Genomic sequences of exported mycobacteria polypeptides, vectors containing them and applications to the diagnosis and prevention of tuberculosis

The subject of the invention is new recombinant screening, cloning and / or expression vectors which replicate in mycobacteria. It also relates to a set of sequences coding for exported polypeptides detected by fusions with alkaline phosphatase and the expression of which is regulated (induced or repressed) or constitutive during the ingestion of mycobacteria by macrophages. The invention also relates to a polypeptide, called DP428, of about 12 kD corresponding to an exported protein found in the mycobacteria belonging to the complex of <i>Mycobacterium tuberculosis.</i> The invention also relates to a polynucleotide comprising a sequence coding for this polypeptide. It also relates to the use of the polypeptide or of fragments thereof and of the polynucleotides coding for the latter (or also the polynucleotides complementary to the latter) for the production of means of detection in vitro, or in vivo of the presence of a mycobacterium belonging to the complex of<i>Mycobacterium tuberculosis</i> in a biological sample or for the detection of reactions of the host infected with these bacterial species. The invention finally relates to the use of the polypeptide or fragments thereof as well as polynucleotides encoding the latter as means intended for the preparation of an immunogenic composition, capable of inducing an immune response directed against mycobacteria. belonging to the complex of<i>Mycobacterium tuberculosis,</i> or of a vaccine composition for the prevention and / or treatment of infections caused by mycobacteria belonging to said complex, in particular tuberculosis.

The present invention also aims to use these sequences (polypeptide and polynucleotide) as a target for the search for new inhibitors of the growth and multiplication of mycobacteria and of their maintenance in the host, its inhibitors being able to serve as antibiotics .

The genus Mycobacterium, which includes at least 56 different species, includes major human pathogens such as <i>that Mr. leprae</i> and <i>M. tuberculosis,</i> agents responsible for leprosy and tuberculosis, which remain serious public health problems worldwide.

Tuberculosis continues to be a public health problem worldwide. Today, this disease is the cause of 2 to 3 million deaths worldwide and around 8 million new cases are observed each year (Bouvet, 1994). In developed countries<i>M. tuberculosis</i> is the most common cause of mycobacterial infections. In France there are approximately 10,000 new cases per year and among the reportable diseases it is tuberculosis which includes the largest number of cases. Vaccination with BCG (Bacille de Calmette et Guérin), an avirulent strain derived from<i>Mr. bovis</i> and which is widely used as a vaccine against tuberculosis, is far from being effective in all populations. This effectiveness varies from around 80% in western countries like England, to 0% in India (results of the last Chingleput vaccination trial, published in 1972 in Indian J. Med. Res.). In addition, the appearance of strains of<i>M. tuberculosis</i> resistant to anti-tuberculosis drugs and the increased risk in immunocompromised patients, AIDS patients, of developing tuberculosis, necessitates the development of rapid, specific and reliable methods for the diagnosis of tuberculosis and the development of new vaccines. For example, an epidemiological study carried out in Florida, the results of which were published in 1993 in AIDS therapies, showed that 10% of AIDS patients had tuberculosis when they were diagnosed with AIDS or 18 months before it was diagnosed. . In these patients, tuberculosis appears in 60% of the cases in a disseminated form, therefore not identifiable by conventional diagnostic criteria such as chest radiography or sputum analysis.

Currently, a certainty on the diagnosis brought by the demonstration of cultivable bacilli in a sample coming from the patient is obtained only for less than half of the cases of tuberculosis, even in the cases of pulmonary tuberculosis. The diagnosis of tuberculosis and other related mycobacteria is therefore difficult to achieve, and this for various reasons: mycobacteria are often present in small quantities, their generation time is very long (24h for <i>M</i>. <i>tuberculosis</i>) and their cultivation is difficult (Bates et al., 1986).

Other techniques can be used clinically to identify a mycobacterial infection.<ol id="ol0001" compact="compact"><li>a) Direct identification of microorganisms under the microscope; this technique is rapid, but does not allow the identification of the mycobacterial species observed and lacks sensitivity (Bates, 1979). The cultures, when they are positive, have a specificity approaching 100% and allow the identification of the isolated mycobacterial species; however, as noted above, the growth of mycobacteria<i>in vitro</i> is long (can only be done in 3 to 6 weeks of repeated cultures (Bates, 1979; Bates et al., 1986)) and expensive.</li><li>b) Serological techniques may prove useful under certain conditions, but their use is sometimes limited by their low sensitivity and / or specificity (Daniel et al., 1987).</li><li>c) The presence of mycobacteria in a biological sample can also be determined by molecular hybridization with DNA or RNA using oligonucleotide probes specific for the sequences sought (Kiehn et al., 1987; Roberts et al., 1987; Drake et al., 1987). Several studies have shown the interest of this technique for the diagnosis of mycobacterial infections. The probes used are made up of DNA, ribosomal RNA or mycobacterial DNA fragments from a gene bank. The principle of these techniques is based on the polymorphism of the nucleotide sequences of the fragments used or on the polymorphism of the surrounding regions. In all cases, they require the use of cultures and are not directly applicable to biological samples.</li></ol>

The small quantity of mycobacteria present in a biological sample and consequently the small quantity of target DNA to be detected in this sample may require the use of a specific amplification <i>in vitro</i> target DNA before detection using the nucleotide probe and using amplification techniques <i>in vitro</i> such as PCR (polymerase chain reaction. Specific DNA amplification by the PCR technique can be the first step in a method of detecting the presence of mycobacterial DNA in a biological sample, detecting proper amplified DNA being carried out in a second step using an oligonucleotide probe capable of hybridizing specifically to the amplified DNA.

A test for the detection of mycobacteria belonging to the complex of <i>Mycobacterium tuberculosis,</i> by sandwich hybridization (test using a capture probe and a detection probe) has been described by Chevrier et al. in 1993. The complex of<i>Mycobacterium tuberculosis</i> is a group of mycobacteria that includes <i>M. bovis-BCG, M. bovis, M. tuberculosis, M. africanum</i> and <i>M. microti.</i>

A method of detecting small amounts of mycobacteria, belonging to the tuberculosis complex, by gene amplification and hybridization directly on biological samples has been developed. Said method uses the IS6 insertion sequence<i>110</i> (European patent <patcit id="pcit0001" dnum="EP0490951B1"><text>EP 0 490 951 B1</text></patcit>). Thierry et al. described in 1990 a specific sequence of the complex<i>Mycobacterium tuberculosis</i> and named IS 6110. Some authors have proposed to specifically amplify DNA from <i>Mycobacterium</i> using nucleic acid primers in an amplification method, such as the polymerase chain reaction (PCR). Patel et al. described in 1990 the use of several nucleic primers chosen from a sequence known as a probe in the identification of<i>M. tuberculosis.</i> However, the length of the fragments obtained using these primers was different from the expected theoretical length and several fragments of variable size were obtained. In addition, the authors observed the absence of hybridization of the amplified products with the plasmid used to determine the primers. These results indicate that these primers would not be suitable for detecting the presence of<i>M. tuberculosis</i> in a biological sample and confirm the critical nature of the choice of primers. The same year, JL Guesdon and D. Thierry described a method for detecting<i>M. tuberculosis,</i> of high sensitivity, by amplification of a DNA fragment from <i>M. tuberculosis</i> located within the sequence IS6110 (European patent <patcit id="pcit0002" dnum="EP0461045A"><text>EP 0 461 045</text></patcit>) using primers generating amplified DNA fragments of constant length, even when the choice of primers led to the amplification of long fragments (of the order of 1000 to 1500 bases) where the risk of interruption of polymerization is high due to the effects of the secondary structure of the sequence. Other primers specific to the sequence IS6110 are described in European patent N °<patcit id="pcit0003" dnum="EP0490951A"><text>EP 0 490 951</text></patcit>.

The inventors have shown (unpublished results) that certain clinical isolates of <i>Mycobacterium tuberculosis</i> were free of the IS6110 insertion sequence and therefore could not be detected using the oligonucleotides specific for this sequence, which could thus lead to false negative diagnostic results. These results confirm a similar observation made by Yuen et al. in 1993. The impossibility of detecting these pathogenic strains potentially present in a biological sample taken from a patient is thus likely to lead to difficulties or even misdiagnosis. The availability of several specific sequences of the tuberculosis bacillus, within which primers suitable for amplification will be chosen, is important. The DP428 sequence described here can be used.

<i>M. bovis and M. tuberculosis,</i> the causative agents of tuberculosis, are optional intra-cellular bacteria.

These agents have developed mechanisms to ensure their survival and their replication inside the macrophage, one of the cell types which is supposed to eradicate invasion by microorganisms. These agents are capable of modulating the normal evolution of their phagosome and of preventing them from differentiating into an acid compartment rich in hydrolase (Clemens, 1979; Clemens et al., 1996; Sturgill-Koszycki et al., 1994 and Xu et al., 1994). However, this modulation is only possible if the bacteria is alive within the phagosome, suggesting that compounds actively synthesized and / or secreted inside the cell are part of this mechanism. Exported proteins are probably involved in this mechanism. Despite the major health problems associated with these pathogenic organisms, little is known about their exported and / or secreted proteins. SDS-PAGE analyzes of culture filtrate from<i>M. tuberculosis</i> show at least 30 secreted proteins (Altschul et al., 1990; Nagal et al., 1991 and Young et al., 1992). Some of them have been characterized, their genes cloned and sequenced (Borremans et al., 1989; Wiker et al., 1992 and Yamaguchi et al., 1989). Others, although these are immunodominant antigens of major importance for inducing protective immunity (Anderson et al., 1991 and Orme et al., 1993), are not fully identified. In addition, it is likely that many exported proteins remain attached to the cell membrane and therefore are not present in the culture supernatants. Proteins located on the outer surface of various pathogenic bacteria, such as 103 kDa invasin, have been shown to<i>Yersina Pseudotuberculosis</i> (Isberg et al., 1987) or the 80 kDa internalin of <i>Listeria monocytoqenes</i> (Gaillard et al., 1991 and Dramsi et al., 1997) play an important role in interactions with host cells and therefore, in pathogenicity as well as in the induction of protective responses. Thus, a membrane-bound protein could be important for infection with<i>M. tuberculosis</i> as for the induction of protective response against this infection. These proteins could be of interest for the preparation of vaccines.

Recently, the adaptation to mycobacteria of a genetic methodology for the identification and phenotypic selection of exported proteins has been described (Lim et al., 1995). This method uses the periplasmic alkaline phosphatase (PhoA) of E.<i>coli.</i> A plasmid vector has been constructed allowing the fusion of genes between a gene <i>PhoA</i> truncated and genes coding for exported proteins (Manoil et al., 1990).

By this method, it was possible to identify a gene for <i>M. tuberculosis</i> (<i>erp</i> (Berthet et al., 1995)) showing homologies with an exported protein of 28 kDa from <i>Mr. leprae,</i> which is a frequent target of humoral responses of the lepromatous form of leprosy. A protein with amino acid motifs characteristic of plant desaturase (<i>of</i>) was also characterized by the technique of fusion with PhoA.

However, this genetic method of identifying exported proteins does not allow an easy assessment of the intracellular expression of the corresponding genes. Such an evaluation is of paramount importance both for the selection of good vaccine candidates and for the understanding of the interactions between bacteria and their host cells. Induction of virulence factor expression by contact of pathogenic target cell has been described. This is the case for example for the virulence factors Yops (Petersson et al., 1996) of <i>Yersinia pseudotuberculosis. Shigella</i> by contact with the target cells releases the Ipa proteins into the culture medium, and <i>Salmonella</i> synthesizes new surface structures.

In view of the above, there is today a great need to develop new vaccines against pathogenic mycobacteria as well as new specific, reliable and rapid diagnostic tests. These developments require the development of even more efficient specific tools allowing, on the one hand, to isolate or to obtain sequences of new specific polypeptides, in particular immunogenic, and, on the other hand, to better understand the mechanism interactions between bacteria and their host cells such as, in particular, the induction of virulence factor expression. This is precisely the object of the present invention.

The inventors have defined and produced, for this purpose, new vectors allowing the screening, cloning and / or expression of DNA sequences of mycobacteria in order to identify among these sequences, nucleic acids coding for proteins of interest, preferably exported proteins, which can be localized on the bacterial membrane and / or secreted, and to identify among these sequences those which are induced or repressed during infection (intracellular growth).

<u style="single">Description</u>

The present invention describes the use of the reporter gene <i>phoA</i> in mycobacteria. It makes it possible to identify expression and export systems in a mycobacterial context. Many genes are only expressed in such a context, which shows the advantage of the present invention. During the cloning of DNA segments from strains of the complex<i>M. Tuberculosis</i> in fusion with <i>phoA</i> in another mycobacterium like <i>Mr. smegmatis,</i> the start of the gene, its regulatory regions and its regulator will be cloned, which will make it possible to observe regulation. If this regulation is positive, cloning the regulator will be an advantage to observe expression and export.

In the context of the invention, the term “mycobacterium” means all the mycobacteria belonging to the various species listed by <nplcit id="ncit0001" npl-type="b"><text>Wayne LG and Kubica GP (1980). Family Mycobacteriaceae in Bergey's manual of systematic bacteriology, JP Butler Ed. (Baltimore USA: Williams and Wilkins P. 1436-1457</text></nplcit>).

In some cases the cloned genes are subjected in their host of origin to a down regulation making the observation of the expression and the export difficult in the host of origin. In this case, cloning the gene in the absence of its negative regulator, in a host that does not contain it, will be an advantage.

The invention also relates to new polypeptides and new polynucleotides of mycobacteria which could have been isolated by means of the above vectors and which can be used in the production of compositions for the detection of infection by mycobacteria, or for protection against infection due to mycobacteria or for the detection of inhibitors as described above for DP428.

The subject of the invention is therefore a recombinant vector for screening, cloning and / or expression, characterized in that it replicates in mycobacteria and in that it contains:<ol id="ol0002" compact="compact"><li>1) a functional replicon in mycobacteria;</li><li>2) a selection marker;</li><li>3) a reporter cassette comprising:<ol id="ol0003" compact="compact"><li>a) a multiple cloning site (polylinker),</li><li>b) optionally a transcription terminator active in mycobacteria, upstream of the polylinker,</li><li>c) a coding nucleotide sequence derived from a gene coding for a protein expression, export and / or secretion marker, said nucleotide sequence being devoid of its initiation codon and of its regulatory sequences, and</li><li>d) a coding nucleotide sequence derived from a gene coding for a promoter activity marker contained in the same fragment, said nucleotide sequence being provided with its initiation codon. Optionally, the recombinant vector also contains a functional replicon in E. coli.</li></ol></li></ol>

Preferably, the export and / or secretion marker is placed in the same orientation as the promoter activity marker.

Preferably, the recombinant screening vector according to the invention will further comprise a transcription terminator placed downstream of the promoter activity marker, which is such as to allow obtaining short transcripts which prove to be more stable and which, therefore, allow a higher level of expression of the translation products.

The export and / or secretion marker is a nucleotide sequence whose expression followed by export and / or secretion depends on the regulatory elements which control its expression.

By “sequences or elements for regulating the expression of the production of polypeptides and of its localization” is meant a transcription promoter sequence, a sequence comprising the ribosome binding site (RBS), the sequences responsible for export and / or secretion such as the so-called signal sequence.

A first interesting marker for export and / or expression is a coding sequence derived from the gene <i>phoA.</i> If necessary, it is truncated in such a way that the alkaline phosphatase activity is however capable of being restored when the truncated coding sequence is placed under the control of a promoter and of appropriate regulatory elements.

Other exposure, export and / or secretion markers can be used. Examples of a sequence of the β-agarase gene, of the nuclease of a staphylococcus or of a β-lactamase will be cited as examples.

Among the interesting markers of promoter activity contained in the same fragment, a coding sequence derived from the gene is preferred. <i>luc</i> of firefly luciferase provided with its initiation codon.

Other promoter activity markers contained in the same fragment can be used. A sequence of the GFP (Green Fluorescent Protein) gene will be cited as examples.

The transcription terminator must be functional in mycobacteria. An advantageous terminator in this regard is the terminator of coliphage T4 (tT4). Other terminators suitable for carrying out the invention can be isolated using the technique presented in the examples, for example by means of an “omega” cassette (Prentki et al., 1984).

A particularly preferred vector for carrying out the invention is a plasmid chosen from the following plasmids deposited at the CNCM (National Collection of Cultures of Microorganisms, 25 rue de Docteur Roux, 75724 Paris cedex 15, France):<ol id="ol0004" compact="compact"><li>a) pJVEDa deposited with the CNCM under N ° I-1797, on December 12, 1996,</li><li>b) pJVEDb deposited with the CNCM under N ° I-1906, on July 25, 1997,</li><li>c) pJVEDc deposited with the CNCM under N ° I-1799, on December 12, 1996.</li></ol>

For the selection or identification of nucleic acid sequences of mycobacteria encoding polypeptides capable of being incorporated into immunogenic or antigenic compositions for the detection of an infection, or capable of inducing or repressing a factor virulence of mycobacteria, the vector of the invention will comprise, at one of the multiple cloning sites of the polylinker, a nucleotide sequence of a mycobacterium in which the presence of sequences corresponding to exported and / or secreted polypeptides which can be induced or suppressed during infection, or which is expressed or constitutively produced, their promoter sequences and / is detected or associated regulators capable of allowing or promoting the export and / or the secretion of said polypeptides of interest, or all or part of genes of interest coding for said polypeptides.

Preferably, this sequence is obtained by physical fragmentation or by enzymatic digestion of the genomic DNA or of the DNA complementary to an RNA of a mycobacterium, preferably <i>M. tuberculosis</i> or chosen from <i>M. africanum, M. bovis, M. avium</i> or <i>M. leprae.</i>

The vectors of the invention can indeed also be used to determine the presence of sequences of interest, preferably corresponding to exported and / or secreted proteins, and / or capable of being induced or repressed or produced constitutively during infection, especially during phagocytosis by macrophages, and according to what has been explained above, in mycobacteria such as <i>M. africanum, M. bovis, M. avium</i> or <i>Mr leprae</i> whose DNA or cDNA have been treated by physical fragmentation or with specific enzymes.

According to a first embodiment of the invention, the enzymatic digestion of genomic DNA or of complementary DNA is carried out from <i>M</i>. <i>tuberculosis.</i>

Preferably, this DNA is digested with an enzyme such as sau3A, BclI, BglII.

Other digestion enzymes such as ScaI, ApaI, SacII, KpnI or even nucleases or polymerases, can naturally be used, as long as they allow fragments to be obtained, the ends of which can be inserted into the one of the polylinker cloning sites of the vector of the invention.

If necessary, digestions with different enzymes will be carried out simultaneously.

Preferred recombinant vectors for carrying out the invention are chosen from the following recombinant vectors deposited at the CNCM:<ol id="ol0005" compact="compact"><li>a) p6D7 deposited on January 28, 1997 at the CNCM under N ° I-1814,</li><li>b) p5A3 deposited on January 28, 1997 at the CNCM under N ° I-1815,</li><li>c) p5F6 deposited on January 28, 1997 at the CNCM under N ° I-1816,</li><li>d) p2A29 deposited on January 28, 1997 at the CNCM under N ° I-1817,</li><li>e) pDP428 deposited on January 28, 1997 at the CNCM under N ° I-1818,</li><li>f) p5B5 deposited on January 28, 1997 at the CNCM under N ° I-1819,</li><li>g) p1C7 deposited on January 28, 1997 at the CNCM under N ° I-1820,</li><li>h) p2D7 deposited on January 28, 1997 at the CNCM under N ° I-1821,</li><li>i) p1B7 deposited on January 31, 1997 at the CNCM under N ° I-1843,</li><li>j) pJVED /<i>M</i>. <i>tuberculosis</i> deposited on July 25, 1997 at the CNCM under N ° I-1907,</li><li>k) pM1C25 deposited on August 4, 1998 at the CNCM under N ° I-2062.</li></ol>

Among the most preferred, the recombinant vector pDP428 deposited on January 28, 1997 at the CNCM under No. I-1818 is preferred, and the vector pM1C25 deposited on August 4, 1998 at the CNCM under the No. I-2062.

A subject of the invention is also a method for screening nucleotide sequences derived from mycobacteria to determine the presence of sequences corresponding to exported and / or secreted polypeptides which can be induced or repressed during infection, their promoter sequences and / or associated regulators capable in particular of allowing or promoting the export and / or the secretion of said polypeptides of interest, or all or part of genes of interest coding for said polypeptides, characterized in that it implements a recombinant vector according to the invention.

The invention also relates to a screening method, according to the invention, characterized in that it comprises the following steps:<ol id="ol0006" compact="compact"><li>a) the physical fragmentation of the DNA sequences of mycobacteria or their digestion with at least one specific enzyme and the recovery of the fragments obtained;</li><li>b) the insertion of the fragments obtained in step a) into a cloning site, compatible if necessary with the enzyme of step a), of the polylinker of a vector according to the invention;</li><li>c) if necessary, the amplification of said fragments contained in the vector, for example by replication of the latter after insertion of the vector thus modified in a determined cell, preferably <i>E coli;</i></li><li>d) transformation of the host cells by the vector amplified in step c), or in the absence of amplification, by the vector of step b);</li><li>e) the culture of the transformed host cells in a medium allowing the demonstration of the export and / or secretion marker, and / or of the promoter activity marker contained in the vector;</li><li>f) detection of positive host cells (positive colonies) for the expression of the export and / or secretion marker, and / or the promoter activity marker;</li><li>g) isolating the DNA from the positive colonies and inserting this DNA into a cell identical to that of step c);</li><li>h) selection of the insertions contained in the vector, making it possible to obtain clones positive for the export and / or secretion marker, and / or for the promoter activity marker;</li><li>i) isolation and characterization of the DNA fragments of mycobacteria contained in these inserts.</li></ol>

In one of the preferred embodiments of the screening method according to the invention, the positive host cells, detected in step f), for the export and / or secretion marker are, optionally in a second step, tested for the capacity of the selected nucleotide insert to stimulate the expression of the promoter activity marker when said host cells are phagocytosed by cells of the macrophagic type.

More specifically, we compare the stimulation of the expression of the promoter activity marker in host cells placed in axenic culture (host cells alone in culture) with the stimulation of the expression of the promoter activity marker in host cells cultivated in the presence of macrophages and thus phagocytosed by the latter.

The selection of host cells positive for the promoter activity marker can be carried out from step e) of the screening method described above, or even after any of steps f), g), h) or i), that is to say once the host cells have been positively selected for the export and / or selection marker.

The implementation of this method allows the construction of DNA libraries comprising sequences corresponding to polypeptides capable of being exported and / or secreted, and / or capable of being induced or repressed during infection when they are produced within recombinant mycobacteria. Step i) of the method may include a step of sequencing the selected insertions.

Preferably, in the method according to the invention, the vector used is chosen from the plasmids pJVEDa (CNCM, N ° I-1797), pJVEDb (CNCM, N ° I-1906), pJVEDc (CNCM, N ° I-1799 ) or pJVED / M. <i>tuberculosis</i> (CNCM, No. I-1907), and the digestion of the DNA sequences of mycobacteria is carried out using the enzyme Sau3A.

According to a preferred embodiment of the invention, the screening method is characterized in that the sequences of mycobacteria originate from a pathogenic mycobacterium, for example from <i>M. tuberculosis, M. bovis, M. avium, M. africanum</i> or <i>M</i>. <i>leprae.</i>

The invention also includes a genomic DNA or cDNA library complementary to mycobacterium mRNA, characterized in that it is obtained by a process comprising steps a) and b), or a), b) and c ) of the preceding method according to the invention, preferably a genomic DNA or cDNA library complementary to mRNA of pathogenic mycobacteria, preferably of mycobacteria belonging to the group of the complex <i>Mycobacterium tuberculosis,</i> preferably from <i>Mycobacterium tuberculosis.</i>

In the present invention, the term “nucleic acid sequences” or “amino acid sequences” is intended to denote SEQ ID No. X to SEQ ID No. Y, where X and Y can independently represent a number or an alphanumeric character, respectively the all of the nucleic acid sequences or all of the amino acid sequences represented by FIGS. X to Y, ends included.

For example, the nucleic sequences or the amino acid sequences SEQ ID No. 1 to SEQ ID No. 4N are respectively the nucleic sequences or the amino acid sequences represented by the <figref idref="f0001 f0002 f0003 f0004 f0005 f0006 f0007 f0008 f0009 f0010 f0011 f0012">figures 1 to 4N</figref>, that is to say respectively the nucleic sequences or the amino acid sequences SEQ ID N ° 1, SEQ ID N ° 1A ', SEQ ID N ° 1B', SEQ ID N ° 1C ', SEQ ID N ° 1D, SEQ ID N ° 1F, SEQ ID N ° 2, SEQ ID N ° 3A, SEQ ID N ° 3B, SEQ ID N ° 3C, SEQ ID N ° 4A, SEQ ID N ° 4B, SEQ ID N ° 4C, SEQ ID N ° 4A ', SEQ ID N ° 4B', SEQ ID N ° 4C ', SEQ ID N ° 4F, SEQ ID N ° 4J, SEQ ID N ° 4K, SEQ ID N ° 4L, SEQ ID N ° 4M and SEQ ID No. 4N.

The subject of the invention is also the nucleotide sequences of mycobacteria or comprising nucleotide sequences of mycobacteria selected after carrying out the method according to the invention described above.

Preferably, said mycobacterium is chosen from <i>M. tuberculosis, M. bovis, M. africanum, M. avium, M. leprae, M. paratuberculosis, M. kansassi</i> or <i>Mr. xenopi.</i>

Preferred are the nucleotide sequences of mycobacteria or comprising a nucleotide sequence of mycobacterium, said nucleotide sequence of mycobacterium being chosen from the sequences of mycobacterium DNA fragments of nucleic sequence SEQ ID No. 1 to SEQ ID No. 24C, SEQ ID N ° 27A to SEQ ID N ° 27C, SEQ ID N ° 29 and SEQ ID N ° 31A to SEQ ID N ° 50F, respectively represented by <figref idref="f0001 f0002 f0003 f0004 f0005 f0006 f0007 f0008 f0009 f0010 f0011 f0012 f0013 f0014 f0015 f0016 f0017 f0018 f0019 f0020 f0021 f0022 f0023 f0024 f0025 f0026 f0027 f0028 f0029 f0030 f0031 f0032 f0033 f0034 f0035 f0036 f0037 f0038 f0039 f0040 f0041 f0042 f0043 f0044 f0045 f0046 f0047 f0048 f0049 f0050 f0051 f0052 f0053 f0054 f0055 f0056 f0057 f0058 f0059 f0060 f0061 f0062 f0063 f0064 f0065 f0066 f0067 f0068 f0069 f0070 f0071 f0072 f0073 f0074 f0075 f0076 f0077 f0078 f0079 f0080 f0081 f0082 f0083 f0084 f0085 f0086 f0087 f0088 f0089 f0090 f0091 f0092">figures 1 to 24C</figref> (plates 1 to 150), by <figref idref="f0093 f0094">figures 27A to 27C</figref> (plates 152 to 154), by the <figref idref="f0094">figure 29</figref> (plate 156) and by <figref idref="f0095 f0096 f0097 f0098 f0099 f0100 f0101 f0102 f0103 f0104 f0105 f0106 f0107 f0108 f0109 f0110 f0111 f0112 f0113 f0114 f0115 f0116 f0117 f0118 f0119 f0120 f0121 f0122 f0123 f0124 f0125 f0126 f0127 f0128 f0129 f0130 f0131 f0132 f0133 f0134 f0135 f0136 f0137 f0138 f0139 f0140 f0141 f0142 f0143 f0144 f0145 f0146 f0147 f0148 f0149 f0150 f0151 f0152 f0153 f0154 f0155 f0156 f0157 f0158 f0159 f0160 f0161 f0162 f0163 f0164 f0165 f0166 f0167 f0168 f0169 f0170 f0171 f0172 f0173 f0174 f0175 f0176 f0177 f0178 f0179 f0180">figures 31A to 50F</figref> (plates 158 to 275).

According to a particular embodiment of the invention, preferred sequences are, for example, the DNA fragments of mycobacteria of sequence SEQ ID No 1, SEQ ID No 3A, SEQ ID No 5A, SEQ ID No 6A, SEQ ID N ° 7A, SEQ ID N ° 8A, SEQ ID N ° 9A, SEQ ID N ° 10A, SEQ ID N ° 27A or SEQ ID N ° 29 contained respectively in the vectors pDP428 (CNCM, N ° 1-1818) , p6D7 (CNCM, N ° I-1814), p5F6 (CNCM, N ° I-1816), p2A29 (CNCM, N ° I-1817), p5B5 (CNCM, N ° I-1819), p1C7 (CNCM, N ° I-1820), p2D7 (CNCM, N ° I-1821), p1B7 (CNCM, N ° I-1843), p5A3 (CNCM, N ° I-1815) and pM1C25 (CNCM, N ° I-2062).

The invention also relates to a nucleic acid comprising the entire open reading phase of one of the nucleotide sequences according to the invention, in particular one of the sequences SEQ ID No. 1 to SEQ ID No. 24C, SEQ ID No. 27A to SEQ ID N ° 27C, SEQ ID N ° 29 and SEQ ID N ° 31A to SEQ ID N ° 50F according to the invention. Said nucleic acid can be isolated for example as follows:<ol id="ol0007" compact="compact"><li>a) preparation of a cosmid library from the DNA of <i>M. tuberculosis,</i> for example according to the technique described by Jacobs et al., 1991;</li><li>b) hybridization of all or part of a nucleic acid probe sequence chosen for example from SEQ ID N ° 1 to SEQ ID N ° 24C, SEQ ID N ° 27A to SEQ ID N ° 27C, SEQ ID N ° 29 and SEQ ID No. 31A to SEQ ID No. 50F with the cosmids from the bank previously prepared in step a);</li><li>c) selection of the cosmids hybridizing with the probe nucleic acid of step b);</li><li>d) sequencing the DNA inserts of the clones selected in step c) and identifying the complete open reading frame;</li><li>e) where appropriate, cloning of the inserts sequenced in step d) in an appropriate expression and / or cloning vector.</li></ol>

The nucleic acids comprising the whole of the open reading frame of the sequences SEQ ID N ° 1 to SEQ ID N ° 24C, SEQ ID N ° 27A to SEQ ID N ° 27C, SEQ ID N ° 29 and SEQ ID N ° 31A to SEQ ID No. 50F are among the preferred nucleic acids.

The present invention makes it possible to determine a gene fragment coding for an exported polypeptide. The comparison with the genome sequence published by Cole et al. ((<nplcit id="ncit0002" npl-type="s"><text>Cole et al., 1998, Nature, 393, 537-544</text></nplcit>) makes it possible to determine the entire gene carrying the sequence identified according to the present invention.

By nucleotide sequence comprising the entire open reading frame of a sequence according to the invention, is meant the nucleotide sequence (genomic, cDNA, semi-synthetic or synthetic) comprising one of the sequences according to the invention and extending on the one hand in 5 'of these sequences up to the first codon of initiation of translation (ATG or GTG) or even up to the first stop codon, and on the other hand in 3' of these sequences to the codon next stop, and this in any of the three possible reading phases.

The nucleotide sequences complementary to the above sequences according to the invention also form part of the invention.

By polynucleotide of sequence complementary to a nucleotide sequence according to the invention is meant any DNA or RNA sequence whose nucleotides are complementary to those of said sequence according to the invention and whose orientation is reversed.

The nucleotide fragments of the above sequences according to the invention, in particular useful as probes or primers also form part of the invention.

The invention also relates to the polynucleotides characterized in that they comprise a polynucleotide chosen from:<ol id="ol0008" compact="compact"><li>a) a polynucleotide whose sequence is complementary to the sequence of a polynucleotide according to the invention,</li><li>b) a polynucleotide whose sequence comprises at least 50% identity with a polynucleotide according to the invention,</li><li>c) a polynucleotide hybridizing under conditions of high stringency with a polynucleotide sequence according to the invention,</li><li>d) a fragment of at least 8 consecutive nucleotides of a polynucleotide defined according to the invention.</li></ol>

The high stringency conditions as well as the percentage of identity will be defined below in the present description.

When the coding sequence from the export and / or secretion marker gene is a sequence from the gene <i>phoA,</i> export and / or secretion of the gene product <i>phoA,</i> if necessary truncated, is only obtained when this sequence is inserted in phase with the sequence or element for regulating the expression of the production of polynucleotides and its localization placed upstream, which contains the elements controlling expression, l export and / or secretion from mycobacterial sequence.

The recombinant vectors of the invention can of course comprise multiple cloning sites offset by one or two nucleotides relative to a vector according to the invention, thus making it possible to express the polypeptide corresponding to the DNA fragment of mycobacterium inserted and susceptible to be translated according to one of the three possible reading frames.

For example, the preferred vectors pJVEDb and pJVEDc of the invention are distinguished from the preferred vector pJVEDa by a respective shift of one and two nucleotides at the multiple cloning site.

Thus, the vectors of the invention are capable of expressing each of the polypeptides capable of being encoded by a DNA fragment of mycobacterium inserted. These said polypeptides, characterized in that they are therefore capable of being exported and / or secreted, and / or induced or repressed, or expressed in a constitutive manner during infection, form part of the invention.

The polypeptides of the invention are particularly preferred, the amino acid sequences of which are chosen from the amino acid sequences SEQ ID No. 1 to SEQ ID No. 24C, SEQ ID No. 27A to SEQ ID No. 28 and SEQ ID N ° 30 to SEQ ID N ° 50F and represented respectively by <figref idref="f0001 f0002 f0003 f0004 f0005 f0006 f0007 f0008 f0009 f0010 f0011 f0012 f0013 f0014 f0015 f0016 f0017 f0018 f0019 f0020 f0021 f0022 f0023 f0024 f0025 f0026 f0027 f0028 f0029 f0030 f0031 f0032 f0033 f0034 f0035 f0036 f0037 f0038 f0039 f0040 f0041 f0042 f0043 f0044 f0045 f0046 f0047 f0048 f0049 f0050 f0051 f0052 f0053 f0054 f0055 f0056 f0057 f0058 f0059 f0060 f0061 f0062 f0063 f0064 f0065 f0066 f0067 f0068 f0069 f0070 f0071 f0072 f0073 f0074 f0075 f0076 f0077 f0078 f0079 f0080 f0081 f0082 f0083 f0084 f0085 f0086 f0087 f0088 f0089 f0090 f0091 f0092">figures 1 to 24C</figref> (plates 1 to 150), the <figref idref="f0093 f0094">Figures 27A to 28</figref> (plates 152 to 155) and the <figref idref="f0095 f0096 f0097 f0098 f0099 f0100 f0101 f0102 f0103 f0104 f0105 f0106 f0107 f0108 f0109 f0110 f0111 f0112 f0113 f0114 f0115 f0116 f0117 f0118 f0119 f0120 f0121 f0122 f0123 f0124 f0125 f0126 f0127 f0128 f0129 f0130 f0131 f0132 f0133 f0134 f0135 f0136 f0137 f0138 f0139 f0140 f0141 f0142 f0143 f0144 f0145 f0146 f0147 f0148 f0149 f0150 f0151 f0152 f0153 f0154 f0155 f0156 f0157 f0158 f0159 f0160 f0161 f0162 f0163 f0164 f0165 f0166 f0167 f0168 f0169 f0170 f0171 f0172 f0173 f0174 f0175 f0176 f0177 f0178 f0179 f0180">figures 30 to 50F</figref> (plates 157 to 275).

Also included in the invention are the biologically active fragments or fragments as well as the homologous polypeptides of said polypeptides. Fragment, biologically active fragment and polypeptide homologous polypeptides, being as defined below in the description.

The invention also relates to the polypeptides comprising a polypeptide or a fragment thereof according to the invention.

A subject of the invention is also recombinant mycobacteria containing a recombinant vector according to the invention described above. A preferred mycobacterium is a mycobacterium of the type<i>Mr. smeqmatis.</i>

<i>M. smeqmatis</i> advantageously makes it possible to test the efficiency of mycobacterial sequences, for controlling the expression, export and / or secretion, and / or the activity of promoters of a given sequence, for example of a sequence coding for a marker such as alkaline phosphatase and / or luciferase.

Another preferred mycobacterium is a mycobacterium of the type <i>Mr. bovis,</i> for example the strain BCG currently used for vaccination against tuberculosis.

Another favorite mycobacterium is a strain of <i>M. tuberculosis, M. bovis</i> or <i>M africanum</i> potentially having all the appropriate regulatory systems.

The inventors have thus characterized in particular a polynucleotide constituted by a nucleotide sequence present in all the tested strains of mycobacteria belonging to the complex of <i>Mycobacterium tuberculosis.</i> This polynucleotide, called <i>DP428</i> contains an open reading frame (ORF) encoding a polypeptide of approximately 12 kD. The open reading frame (ORF) coding for the polypeptide DP428 extends from the nucleotide in position nt 941 to the nucleotide in position nt 1351 of the sequence SEQ ID No. 2, the polypeptide DP428 having the amino acid sequence SEQ ID No. 28 next:<img file="EP1950221A2_D0001.tif" />

This molecular weight (MW) corresponds to the theoretical MW of the mature protein obtained after cleavage of the signal sequence, the MW of the DP428 protein or polypeptide being approximately 10 kD after potential anchoring to the peptidoglycan and potential cleavage between S and G of the motif. LPISG.

This polynucleotide includes, on the one hand, an open reading frame corresponding to a structural gene and, on the other hand, the signals for regulating the expression of the coding sequence upstream and downstream of the latter. The DP428 polypeptide is composed of a signal peptide, a hydrophilic central region and a hydrophobic C-terminal region. The latter ends with two arginine residues (R), retention signal, and is preceded by an LPISG motif which recalls the LPXTG motif for anchoring to the peptidoglycan (Schneewind et al., 1995).

By structural gene for the purposes of the present invention is meant a polynucleotide coding for a protein, a polypeptide or a fragment thereof, said polynucleotide comprising only the sequence corresponding to the open reading frame (ORF), which excludes the 5 ′ side sequences of the open reading frame (ORF) which direct the initiation of transcription.

Thus, the invention relates in particular to a polynucleotide whose sequence is chosen from the nucleotide sequences SEQ ID No. 1 to SEQ ID No. 2.

More particularly, the invention relates to a polynucleotide characterized in that it comprises a polynucleotide chosen from:<ol id="ol0009" compact="compact"><li>a) a polynucleotide whose sequence is chosen from the nucleotide sequences SEQ ID No. 1 to SEQ ID No. 2,</li><li>b) a polynucleotide whose nucleic sequence is the sequence between the nucleotide in position nt 964 and the nucleotide in position nt 1234, ends included, of the sequence SEQ ID No. 1,</li><li>c) a polynucleotide whose sequence is complementary to the sequence of a polynucleotide defined in a) or b),</li><li>d) a polynucleotide whose sequence has at least 50% identity with a polynucleotide defined in a), b) or c),</li><li>e) a polynucleotide hybridizing under conditions of high stringency with a polynucleotide sequence defined in a), b), c) or d),</li><li>f) a fragment of at least 8 consecutive nucleotides of a polynucleotide defined in a), b), c), d) or e).</li></ol>

The term “nucleotide sequence, polynucleotide or nucleic acid” according to the present invention is understood to mean both double-stranded DNA, single-stranded DNA and transcripts of said DNAs.

By percentage identity within the meaning of the present invention means a percentage identity between the bases of two polynucleotides, this percentage being purely statistical and the differences between the two polynucleotides being distributed randomly and over their entire length.

Hybridization under conditions of high stringency means that the conditions of temperature and ionic strength are chosen in such a way that they allow hybridization to be maintained between two complementary DNA fragments.

By way of illustration, conditions of high stringency of the hybridization step for the purpose of defining the polynucleotide fragments described above are advantageously as follows.

Hybridization is carried out at a preferred temperature of 65 ° C., in the presence of a buffer marketed under the name of rapid-hyb buffer by Amersham (RPN 1636) and 100 μg / ml of DNA from E. coli.

The washing steps can, for example, be as follows:<ul id="ul0001" list-style="dash" compact="compact"><li>two washes of 10 min, preferably at 65 ° C, in a buffer 2 x SSC and 0.1% SDS;</li><li>two washes of 10 min, preferably at 65 ° C, in a buffer 1 x SSC and 0.1% SDS;</li><li>washing for 10 min, preferably at 65 ° C, in a buffer of 0.1 x SSC and 0.1% SDS.</li></ul>

1 x SSC corresponds to 0.15 M NaCl and 0.05M Na citrate and a solution of 1 x Denhardt corresponds to 0.02% Ficoll, 0.02% polyvinylpyrrolidone and 0.02% bovine serum albumin.

Advantageously, a nucleotide fragment corresponding to the preceding definition will have at least 8 nucleotides, preferably at least 12 nucleotides, and even more preferably at least 20 consecutive nucleotides of the sequence from which it is derived. The high stringency hybridization conditions described above for a polynucleotide with a size of about 200 bases, will be adapted by the skilled person for oligonucleotides of larger or smaller size, according to the teaching of Sambrook et al., 1989.

For the conditions for using restriction enzymes in order to obtain nucleotide fragments of the polynucleotides according to the invention, reference will advantageously be made to the work by Sambrook et al., 1989.

Advantageously, a polynucleotide of the invention will contain at least one sequence comprising the sequence of nucleotides ranging from the nucleotide in position nt 964 to the nucleotide nt 1234 of the polynucleotide of sequence SEQ ID No. 1.

The subject of the present invention is a polynucleotide according to the invention, characterized in that its nucleic sequence hybrid with the DNA of mycobacteria sequence and preferably with the DNA of mycobacteria sequence belonging to the complex of <i>Mycobacterium tuberculosis.</i>

The polynucleotide is coded by a polynucleotide sequence as described above.

The present invention also relates to a polypeptide derived from a mycobacterium, characterized in that it is present only in mycobacteria belonging to the complex of <i>Mycobacterium tuberculosis.</i>

The invention also relates to a polypeptide characterized in that it comprises a polypeptide chosen from:<ol id="ol0010" compact="compact"><li>a) a polypeptide whose amino acid sequence is included in an amino acid sequence chosen from the amino acid sequences SEQ ID No. 1 to SEQ ID No. 24C, SEQ ID No. 27A to SEQ ID No. 28 and SEQ ID N ° 30 to SEQ ID N ° 50F,</li><li>b) a polypeptide homologous to the polypeptide defined in a),</li><li>c) a fragment of at least 5 amino acids of a polypeptide defined in a) or b),</li><li>d) a biologically active fragment of a polypeptide defined in a), b), or c).</li></ol>

The subject of the present invention is also a polypeptide whose amino acid sequence is included in the amino acid sequence SEQ ID No 1 or SEQ ID No 2, or a polypeptide of amino acid sequence SEQ ID No 28.

The term “homologous polypeptide” is intended to denote the polypeptides having, with respect to the natural polypeptide according to the invention such as the DP428 polypeptide, certain modifications such as in particular a deletion, addition or substitution of at least one amino acid, a truncation, an elongation , a chimeric fusion, and / or a mutation. Among the homologous polypeptides, those whose amino acid sequence has at least 30%, preferably 50%, of homology with the amino acid sequences of the polypeptides according to the invention are preferred. In the case of a substitution, one or more consecutive or non-consecutive amino acids are replaced by “equivalent” amino acids. The term “equivalent” amino acid is intended here to denote any amino acid capable of being substituted for one of the amino acids of the basic structure without, however, essentially modifying the immunogenic properties of the corresponding peptides. In other words, the equivalent amino acids will be those which make it possible to obtain a polypeptide of modified sequence which allows induction<i>in vivo</i> antibodies or cells capable of recognizing the polypeptide whose amino acid sequence is included in the amino acid sequence of the polypeptide according to the invention, such as the amino acid sequences SEQ ID No. 1 to SEQ ID No. 2, or an amino acid sequence polypeptide SEQ ID No. 28 (polypeptide DP428) or one of its fragments defined above.

These equivalent aminoacyles can be determined either on the basis of their structural homology with the aminoacyles for which they are substituted, or on the results of the cross immunogenicity tests to which the different peptides are liable to give rise.

By way of example, mention will be made of the possibilities of substitutions which may be carried out without resulting in a profound modification of the immunogenicity of the corresponding modified peptides, the replacements, for example, of leucine by valine or isoleucine, aspartic acid by glutamic acid, glutamine by asparagine, arginine by lysine etc., the reverse substitutions being naturally possible under the same conditions.

The term “biologically active fragment” is intended to denote in particular a fragment of the amino acid sequence of a polypeptide having at least one of the characteristics of the polypeptides according to the invention, in particular in that it is:<ul id="ul0002" list-style="dash" compact="compact"><li>capable of being exported and / or secreted by a mycobacterium, and / or of being induced or repressed during infection by the mycobacterium; and or</li><li>capable of inducing, suppressing or modulating, directly or indirectly, a virulence factor of mycobacterium; and or</li><li>capable of inducing an immunogenicity reaction against mycobacteria; and or</li><li>capable of being recognized by a specific mycobacterium antibody.</li></ul>

The term “polypeptide fragment” is intended to denote a polypeptide comprising at least 5 amino acids, preferably 10 amino acids and 15 amino acids.

A polypeptide of the invention, or a fragment thereof, as defined above, is capable of being recognized specifically by the antibodies present in the serum of patients infected with mycobacteria and preferably bacteria belonging to the complex of <i>Mycobacterium tuberculosis</i> or by cells of the infected host.

Thus forming part of the invention are the fragments of the polypeptide whose amino acid sequence is included in the amino acid sequence of the polypeptide according to the invention, such as the amino acid sequences SEQ ID No. 1 to SEQ ID No. 2, or a polypeptide of amino acid sequence SEQ ID No. 28, which can be obtained by cleavage of said polypeptide by a proteolytic enzyme, such as trypsin or chymotrypsin or collagenase, or by a chemical reagent, such as cyanogen bromide (CNBr) or alternatively by placing a polypeptide according to the invention such as the DP428 polypeptide in a very acidic environment, for example at pH 2.5.

Preferred peptide fragments according to the invention, for use in diagnosis or in vaccination, are the fragments contained in regions of polypeptide according to the invention such as the DP428 polypeptide capable of being naturally exposed to the solvent and thus exhibiting properties significant immunogenicity. Such peptide fragments can be prepared indifferently by chemical synthesis, from hosts transformed by an expression vector according to the invention containing a nucleic acid allowing the expression of said fragments, placed under the control of regulatory elements and / or appropriate expression or by chemical or enzymatic cleavage.

An analysis of the hydrophilicity of the DP428 polypeptide was carried out using the DNA Strider software^™ (marketed by CEA Saclay), based on a calculation of the hydrophilic character of the coding region for DP428 of SEQ ID No. 28. The results of this analysis are presented in <figref idref="f0184">figure 54</figref>, where are detailed, for each of the amino acids (AA) of position defined in SEQ ID No. 28, the hydrophilicity index. The higher the hydrophilicity index, the more likely the amino acid in question is to be exposed to the solvent in the native molecule, and is therefore likely to have a high degree of antigenicity. Thus, a sequence of at least seven amino acids having a high hydrophilicity index (&gt; 0.3) can constitute the basis of the structure of an immunogenic candidate peptide according to the present invention.

The cellular immune responses of the host to a polypeptide according to the invention can be demonstrated according to the techniques described by Colignon et al., 1996.

According to the data from the hydrophilicity map presented to the <figref idref="f0184">Figure 54</figref>, the inventors were able to define regions of the DP428 polypeptide preferably exposed to the solvent, more particularly the region located between amino acids 55 and 72 of the sequence SEQ ID No. 28 and the region located between amino acids 99 and 107 of SEQ ID No. 28.

The peptide regions of the DP428 polypeptide defined above can advantageously be used for the production of the immunogenic compositions or vaccine compositions according to the invention.

The polynucleotides characterized in that they code for a polypeptide according to the invention, also form part of the invention.

The invention also relates to the nucleic acid sequences which can be used as probe or primer, characterized in that said sequences are chosen from the nucleic acid sequences of polynucleotides according to the invention.

The invention further relates to the use of a nucleic acid sequence of polynucleotides according to the invention as probe or primer, for the detection and / or amplification of nucleic acid sequence. Among these nucleic acid sequences according to the invention which can be used as probe or primer, the nucleic acid sequences of the invention are preferred, characterized in that said sequences are sequences, or their complementary sequence, comprised between the nucleotide in position nt 964 and the nucleotide in position nt 1234, ends included, of the sequence SEQ ID No. 1.

Among the polynucleotides according to the invention, which can be used as nucleotide primers, the polynucleotides of sequence SEQ ID No. 25 and SEQ ID No. 26 are particularly preferred.

The polynucleotides according to the invention can thus be used to select nucleotide primers, in particular for the PCR technique (Erlich, 1989; Innis et al., 1990, and, Rolfs et al., 1991).

This technique requires the choice of pairs of oligonucleotides surrounding the fragment which must be amplified. One can, for example, refer to the technique described in the American patent<patcit id="pcit0004" dnum="US4683202A"><text>US No. 4,683,202</text></patcit>. These oligodeoxyribonucleotide or oligoribonucleotide primers advantageously have a length of at least 8 nucleotides, preferably at least 12 nucleotides, and even more preferably at least 20 nucleotides. In particular, primers with a length of between 8 and 30 and preferably 12 and 22 nucleotides are preferred. One of the two primers is complementary to the strand (+) [go primer] of the matrix and the other primer is complementary to the strand (-) [return primer]. It is important that the primers do not have a secondary structure or a sequence complementary to each other. On the other hand, the length and the sequence of each primer must be chosen so that the primers do not hybridize with other nucleic acids originating from prokaryotic or eukaryotic cells, in particular with nucleic acids originating from other pathogenic mycobacteria, neither with human DNA or RNA that could potentially contaminate the biological sample.

The results presented to the <figref idref="f0181">figure 51</figref>, show that the sequence coding for the DP428 polypeptide (SEQ ID No. 28) is not found in the DNAs of M. <i>fortuitum, M. simiae, M. avium, M. chelonae, M. flavescens, M. gordonae, M. marinum</i> and M. <i>kansasii.</i>

The amplified fragments can be identified after agarose or polyacrylamide gel electrophoresis, or after capillary electrophoresis, or even after a chromatographic technique (gel filtration, hydrophobic chromatography or ion exchange chromatography). The specificity of the amplification can be controlled by molecular hybridization using as probes the nucleotide sequences of polynucleotides of the invention, plasmids containing these sequences or their amplification products.

The amplified nucleotide fragments can be used as reagents in hybridization reactions in order to demonstrate the presence, in a biological sample, of a target nucleic acid of sequence complementary to that of said amplified nucleotide fragments.

Among the polynucleotides according to the invention, which can be used as nucleotide probes, very particularly preferred is the polynucleotide fragment comprising the sequence between the nucleotide in position nt 964 and the nucleotide in position nt 1234, ends included, of the sequence of SEQ ID No. 1.

These probes and amplicons may or may not be labeled with radioactive elements or with non-radioactive molecules, such as enzymes or fluorescent elements.

The invention also relates to the nucleotide fragments capable of being obtained by amplification using primers according to the invention.

Other techniques for amplifying the target nucleic acid can advantageously be used as alternatives to PCR.

The SDA (Strand Displacement Amplification) technique or strand displacement amplification technique (Walker et al., 1992) is an isothermal amplification technique, the principle of which is based on the ability of a restriction enzyme to cut one of the two strands of its recognition site which is in a hemiphosphorothioate form and on the property of a DNA polymerase initiate the synthesis of a new strand of DNA from the 3'OH end created by the restriction enzyme and move the previously synthesized strand which is downstream.

The polynucleotides of the invention, in particular the primers according to the invention, can also be used in other methods of amplification of a target nucleic acid, such as:<ul id="ul0003" list-style="dash" compact="compact"><li>the TAS (Transcription-based Amplification System) technique, described by Kwoh et al. in 1989;</li><li>the 3SR (Self-Sustained Sequence Replication) technique, described by Guatelli et al. in 1990 ;</li><li>the NASBA (Nucleic Acid Sequence Based Amplification) technique, described by Kievitis et al. in 1991;</li><li>the TMA (Transcription Mediated Amplification) technique.</li></ul>

The polynucleotides of the invention can also be used in techniques for amplification or modification of the nucleic acid serving as a probe, such as:<ul id="ul0004" list-style="dash" compact="compact"><li>the LCR (Ligase Chain Reaction) technique, described by Landegren et al. in 1988 and perfected by Barany et al. in 1991, which used a thermostable ligase;</li><li>the RCR (Repair Chain Reaction) technique, described by Segev in 1992;</li><li>the CPR (Cycling Probe Reaction) technique, described by Duck et al. in 1990 ;</li><li>the Q-beta-replicase amplification technique, described by Miele et al. in 1983 and improved in particular by Chu et al. in 1986, Lizardi et al. in 1988, then by Burg et al. as well as by Stone et al. in 1996.</li></ul>

In the case where the target polynucleotide to be detected is an RNA, for example an mRNA, it will be advantageous to use, prior to the implementation of an amplification reaction using the primers according to the invention or to the implementation implementation of a detection method using the probes of the invention, an enzyme of reverse transcriptase type in order to obtain a cDNA from the RNA contained in the biological sample. The cDNA obtained will then serve as a target for the primers or probes used in the amplification or detection method according to the invention.

The detection probe will be chosen in such a way that it hybridizes with the amplicon generated. Advantageously, such a detection probe will have a sequence of at least 12 nucleotides, in particular at least 15 nucleotides, and preferably at least 200 nucleotides.

The nucleotide probes according to the invention are capable of detecting mycobacteria and preferably bacteria belonging to the complex of <i>Mycobacterium tuberculosis,</i> more precisely the fact that these mycobacteria have in their genome at least one copy of polynucleotides according to the invention. These probes according to the invention are capable, for example, of hybridizing with the nucleotide sequence of a polypeptide according to the invention, more particularly any oligonucleotide hybridizing with the sequence SEQ ID No. 1 coding for the polypeptide DP428 of<i>M. tuberculosis,</i> and showing no cross-hybridization or amplification reaction (PCR) with, for example, sequences present in mycobacteria not belonging to the <i>Mycobacterium tuberculosis.</i> The nucleotide probes according to the invention specifically hybridize with a DNA or RNA polynucleotide molecule according to the invention, under high stringency hybridization conditions as given in the form of an example above.

The unlabeled sequences can be used directly as probes, however the sequences are generally marked with a radioactive element (³²P, ³⁵S, ³H, ¹²⁵I) or with a non-radioactive molecule (biotin, acetylaminofluorene, digoxigenin, 5-bromo-deoxyuridine, fluorescein) to obtain probes which can be used for many applications.

Examples of non-radioactive labeling of probes are described, for example, in French patent N ° <patcit id="pcit0005" dnum="FR7810975"><text>78 10975</text></patcit> or by Urdea et al. or by Sanchez-Pescador et al. in 1988.

In the latter case, one of the marking methods described in the patents may also be used. <patcit id="pcit0006" dnum="FR2422956"><text>FR 2 422 956</text></patcit> and <patcit id="pcit0007" dnum="FR2518755"><text>FR 2,518,755</text></patcit>. The hybridization technique can be carried out in various ways (Matthews et al., 1988). The most general method consists in immobilizing the nucleic acid extracted from the mycobacteria cells on a support (such as nitrocellulose, nylon, polystyrene) and in incubating, under well defined conditions, the target nucleic acid immobilized with the probe. After hybridization, the excess probe is eliminated and the hybrid molecules formed are detected by the appropriate method (measurement of radioactivity, fluorescence or enzymatic activity linked to the probe).

Advantageously, the nucleotide probes labeled according to the invention can have a structure such that they make it possible to amplify the radioactive or non-radioactive signal. An amplification system corresponding to the definition above will include detection probes in the form of branched DNA (branched DNA) such as those described by Urdea et al. in 1991. According to this technique, several types of probes will be advantageously used, in particular a capture probe, in order to immobilize the target DNA or RNA on a support, and a detection probe. The detection probe binds “branched” DNA with a branched structure. The connected DNA, in turn, is capable of attaching oligonucleotide probes which are themselves coupled to alkaline phosphatase molecules. Then the activity of this enzyme is demonstrated using a chemiluminescent substrate, for example a dioxetane phosphate derivative.

According to another advantageous embodiment of the nucleic acid probes according to the invention, the latter can be immobilized on a support, covalently or non-covalently, and used as capture probes. In this case, a probe, called a "capture probe", is immobilized on a support and serves to capture by specific hybridization the target nucleic acid obtained from the biological sample to be tested. If necessary, the solid support is separated from the sample and the duplex formed between the capture probe and the target nucleic acid is then detected using a second probe, called the "detection probe", marked with an easily detectable element.

The oligonucleotide fragments can be obtained from the sequences according to the invention, by cleavage with restriction enzymes, or by chemical synthesis according to conventional methods, for example according to the method described in European patent N ° <patcit id="pcit0008" dnum="EP0305929A"><text>EP-0305929</text></patcit> (Millipore Corporation) or by other methods.

An appropriate mode of preparation of the nucleic acids of the invention comprising a maximum of 200 nucleotides (or 200 bp in the case of double-stranded nucleic acids) comprises the following steps:<ul id="ul0005" list-style="dash" compact="compact"><li>DNA synthesis using the automated beta-cyanethylphosphoramidite method described in 1986,</li><li>cloning the nucleic acids thus obtained into an appropriate vector and recovering the nucleic acids by hybridization with an appropriate probe.</li></ul>

A mode of preparation, by chemical route, of nucleic acids according to the invention of length greater than 200 nucleotides (or 200 bp in the case of double-stranded nucleic acids) comprises the following steps:<ul id="ul0006" list-style="dash" compact="compact"><li>the assembly of chemically synthesized oligonucleotides, provided at their end with different restriction sites, the sequences of which are compatible with the amino acid chain of the natural polypeptide according to the principle described in 1983,</li><li>the cloning of the nucleic acids thus obtained in an appropriate vector and the recovery of the nucleic acids sought by hybridization with an appropriate probe.</li></ul>

The nucleotide probes used for the recovery of the nucleic acids sought in the above-mentioned methods generally consist of 8 to 200 nucleotides of the polypeptide sequence according to the invention and are capable of hybridizing with the nucleic acid sought in the hybridization conditions defined previously. The synthesis of these probes can be carried out according to the automated method of beta cyanethylphosphoramidites described in 1986.

The oligonucleotide probes according to the invention can be used within a detection device comprising a matrix library of oligonucleotides. An exemplary embodiment of such a matrix library may consist of a matrix of probe oligonucleotides fixed on a support, the sequence of each probe of a given length being located one or more bases offset from the previous probe. , each of the probes of the matrix arrangement thus being complementary to a sequence distinct from the target DNA or RNA to be detected and each probe of known sequence being fixed in a predetermined position of the support. The target sequence to be detected can advantageously be radioactive or non-radioactive. When the labeled target sequence is brought into contact with the matrix device, this forms hybrids with the probes of complementary sequences. A nuclease treatment, followed by washing, makes it possible to eliminate the probe-target sequence hybrids which are not perfectly complementary. Because of the precise knowledge of the sequence of a probe at a determined position of the matrix, it is then possible to deduce the nucleotide sequence from the target DNA or RNA sequence. This technique is particularly effective when arrays of large oligonucleotide probes are used.

An alternative to the use of a labeled target sequence may consist of the use of a support allowing “bioelectronic” detection of the hybridization of the target sequence on the probes of the matrix support, when said support is constituted or comprises a material capable of acting, for example, as an electron donor at the positions of the matrix at which a hybrid has been formed. Such an electron donor material is for example gold. The detection of the nucleotide sequence of the target DNA or RNA is then determined by an electronic device.

An embodiment of a biosensor, as defined above, is described in European patent application N ° <patcit id="pcit0009" dnum="EP0721016A"><text>EP-0721 016</text></patcit> in the name of Affymax technologies NV or in the American patent N ° <patcit id="pcit0010" dnum="US5202231A"><text>US 5,202,231</text></patcit> in the name of Drmanac.

The subject of the invention is also the hybrid polynucleotides resulting:<ul id="ul0007" list-style="dash" compact="compact"><li>either of the formation of a hybrid molecule between an RNA or a DNA (genomic DNA or cDNA) originating from a biological sample with a probe or a primer according to the invention,</li><li>or the formation of a hybrid molecule between an RNA or a DNA (genomic DNA or cDNA) originating from a biological sample with a nucleotide fragment amplified using a pair of primers according to the invention.</li></ul>

By cDNA within the meaning of the present invention means a DNA molecule obtained by causing an enzyme of reverse transcriptase type to act on an RNA molecule, in particular a messenger RNA molecule (mRNA), according to the techniques described in Sambrook et al. in 1989.

The present invention also relates to a family of recombinant plasmids, characterized in that they contain at least one nucleotide sequence of polynucleotide according to the invention. According to an advantageous embodiment of said plasmid, it comprises the nucleotide sequence SEQ ID No. 1 or a fragment thereof.

Another object of the present invention is a vector for the cloning, expression and / or insertion of a sequence, characterized in that it comprises a nucleotide sequence of polynucleotide according to the invention at a site which is not essential for its replication, if necessary under the control of regulatory elements capable of intervening in the expression of the DP428 polypeptide, in a determined host.

Particular vectors are for example plasmids, phages, cosmids, phagemids, YACs.

These vectors are useful for transforming host cells in order to clone or express the nucleotide sequences of the invention.

The invention also includes host cells transformed with a vector according to the invention.

Preferably, the host cells are transformed under conditions allowing the expression of a recombinant polypeptide according to the invention.

A preferred host cell according to the invention is the strain <i>E. coli</i> transformed by the plasmid pDP428 deposited on January 28, 1997 at the CNCM under N ° I-1818 or transformed by the plasmid pM1C25 deposited on August 4, 1998 at the CNCM under N ° I-2062 or a mycobacterium belonging to a strain of <i>M. tuberculosis, M. bovis</i> or <i>M</i>. <i>africanum</i> potentially having all the appropriate regulatory systems.

It is now easy to produce relatively large quantities of proteins or polypeptides by genetic engineering using plasmids, phages and phagemids as expression vectors. All or part of the gene<i>DP428,</i> or any polynucleotide according to the invention, can be inserted into an appropriate expression vector to produce <i>in vitro</i> a polypeptide according to the invention, in particular the DP428 polypeptide. Said polypeptide may be fixed on a microplate to develop a serological test intended to search, for diagnostic purposes, the specific antibodies in patients with tuberculosis.

Thus, the present invention relates to a process for the preparation of a polypeptide, characterized in that it implements a vector according to the invention. More particularly, the invention relates to a process for the preparation of a polypeptide of the invention comprising the following steps:<ul id="ul0008" list-style="dash" compact="compact"><li>if necessary, the prior amplification according to the PCR technique of the quantity of nucleotide sequences coding for said polypeptide using two DNA primers chosen so that one of these primers is identical to 10 to First 25 nucleotides of the nucleotide sequence encoding said polypeptide, while the other primer is complementary to the last 10 to 25 nucleotides (or hybridizes with these last 10 to 25 nucleotides) of said nucleotide sequence, or vice versa so that one of these primers is identical to the last 10 to 25 nucleotides of said sequence, while the other primer is complementary to the first 10 to 25 nucleotides (or hybridizes with the first 10 to 25 nucleotides) of said nucleotide sequence, followed by the introduction of said sequences thus amplified into an appropriate vector,</li><li>culturing, in an appropriate culture medium, a cellular host previously transformed with an appropriate vector containing a nucleic acid according to the invention comprising the nucleotide sequence coding for said polypeptide, and</li><li>separation, from the above culture medium, of said polypeptide produced by said transformed cell host.</li></ul>

The subject of the invention is also a polypeptide capable of being obtained by a method of the invention as described above.

The peptides according to the invention can also be prepared by conventional techniques, in the field of peptide synthesis. This synthesis can be carried out in homogeneous solution or in solid phase.

For example, we will use the synthesis technique in homogeneous solution described by Houbenweyl in 1974.

This synthetic method consists in successively condensing two by two the successive aminoacyles in the required order, or in condensing aminoacyles and fragments previously formed and already containing several aminoacyles in the appropriate order, or several fragments previously thus prepared. , it being understood that care has been taken to protect beforehand all the reactive functions carried by these aminoacyles or fragments, with the exception of the amine functions of one and carboxyl functions of the other or vice versa, which should normally intervene in the formation of peptide bonds, in particular after activation of the carboxyl function, according to the methods well known in the synthesis of peptides. As a variant, coupling reactions may be used which involve conventional coupling reagents, of the carbodiimide type, such as for example 1-ethyl-3- (3-dimethyl-aminopropyl) -carbodiimide.

When the aminoacyl used has an additional acid function (in particular in the case of glutamic acid), these functions will be protected, for example by t-butylester groups.

In the case of progressive synthesis, amino acid by amino acid, the synthesis preferably begins with the condensation of the C-terminal amino acid with the amino acid which corresponds to the neighboring aminoacyl in the desired sequence and so on. , step by step, up to the N-terminal amino acid.

According to another preferred technique of the invention, use is made of that described by Merrifield.

To manufacture a peptide chain according to the Merrifield method, use is made of a very porous polymer resin, on which the first C-terminal amino acid of the chain is fixed. This amino acid is attached to the resin via its carboxylic group and its amine function is protected, for example by the t-butyloxycarbonyl group.

When the first C-terminal amino acid is thus fixed on the resin, the protective group of the amine function is removed by washing the resin with an acid.

In the case where the protecting group for the amine function is the t-butyloxycarbonyl group, it can be removed by treatment of the resin with trifluoroacetic acid.

The second amino acid which provides the second aminoacyl of the desired sequence is then coupled, from the C-terminal aminoacyl residue on the deprotected amine function of the first C-terminal amino acid attached to the chain. Preferably, the carboxyl function of this second amino acid is activated, for example by dicyclohexylcarbodiimide, and the amine function is protected, for example by t-butyloxycarbonyl.

This gives the first part of the peptide chain sought, which comprises two amino acids, and whose terminal amine function is protected. As before, the amine function is deprotected and the third aminoacyl can then be fixed, under conditions analogous to those of the addition of the second C-terminal amino acid.

One fixes thus, one after the other, the amino acids which will constitute the peptide chain on the amine group each time deprotected beforehand from the portion of the peptide chain already formed, and which is attached to the resin.

When the entire desired peptide chain is formed, the protective groups of the various amino acids constituting the peptide chain are removed and the peptide is detached from the resin, for example using hydrofluoric acid.

Preferably, said polypeptides capable of being obtained by a process of the invention as described above will comprise a region exposed to the solvent and will have a length of at least 20 amino acids.

According to another embodiment of the invention, said polypeptides are specific for mycobacteria of the complex <i>Mycobacterium tuberculosis</i> and are therefore not recognized by antibodies specific for other mycobacterial proteins.

The invention further relates to hybrid polypeptides having at least one polypeptide according to the invention and a sequence of a polypeptide capable of inducing an immune response in humans or animals.

Advantageously, the antigenic determinant is such that it is capable of inducing a humoral and / or cellular response.

Such a determinant may comprise a polypeptide according to the invention in glycosylated form used for obtaining immunogenic compositions capable of inducing the synthesis of antibodies directed against multiple epitopes. Said glycosylated polypeptides also form part of the invention.

These hybrid molecules can consist in part of a polypeptide-carrying molecule according to the invention associated with a part, in particular an epitope of diphtheria toxin, tetanus toxin, a surface antigen of the hepatitis B virus (patent <patcit id="pcit0011" dnum="FR7921811"><text>FR 79 21811</text></patcit>), the polio virus VP1 antigen or any other toxin or viral or bacterial antigen.

Advantageously, said antigenic determinant corresponds to an antigenic determinant of immunogenic proteins of 45/47 kD of <i>M. tuberculosis</i> (international request <patcit id="pcit0012" dnum="FR960166W"><text>PCT / FR 96/0166</text></patcit>), or even selected for example from ESAT6 (Harboe et al., 1996; Andersen et al., 1995 and Sorensen et al., 1995) and DES (<patcit id="pcit0013" dnum="FR9700923W"><text>PCT / FR 97/00923, Gicquel et al.</text></patcit>).

A viral antigen, as defined above, will preferably be a surface or envelope protein of a hepatitis virus, for example the hepatitis B surface protein in one of its S forms, S-preS1, S-preS2 or S-preS2-preS1 or a protein from a hepatitis A virus, or from non-A, non-B hepatitis, such as a hepatitis C virus , E or delta.

More particularly, a viral antigen as defined above will be all or part of one of the glycoproteins encoded by the genome of the HIV-1 virus (patents <patcit id="pcit0014" dnum="GB8324800A"><text>GB 8324800</text></patcit>, <patcit id="pcit0015" dnum="EP84401834A"><text>EP 84401834</text></patcit> or <patcit id="pcit0016" dnum="EP85905513A"><text>EP 85905513</text></patcit>) or the HIV-2 virus (<patcit id="pcit0017" dnum="EP87400151A"><text>EP 87400151</text></patcit>), and in particular all or part of a protein selected from gag, pol, nave or env of HIV-1 or HIV-2.

The methods of synthesis of the hybrid molecules include the methods used in genetic engineering to construct hybrid polynucleotides coding for the polypeptide sequences sought. We can, for example, advantageously refer to the technique for obtaining genes coding for fusion proteins described by Minton in 1984.

Said hybrid polynucleotides coding for a hybrid polypeptide as well as the hybrid polypeptides according to the invention characterized in that they are recombinant proteins obtained by the expression of said hybrid polynucleotides, also form part of the invention.

The polypeptides according to the invention can advantageously be used in a method for the detection <i>in vitro</i> antibodies directed against said polypeptides, in particular the DP428 polypeptide, and thus antibodies directed against a bacteria of the Mycobacterium complex <i>tuberculosis,</i> in a biological sample (tissue or biological fluid) capable of containing them, this process comprising bringing this biological sample into contact with a polypeptide according to the invention under conditions allowing an immunological reaction <i>in vitro</i> between said polypeptide and the antibodies possibly present in the biological sample, and the demonstration <i>in vitro</i> antigen-antibody complexes possibly formed.

The polypeptides according to the invention can also and advantageously be used in a method for the detection of an infection by a bacteria of the complex <i>Mycobacterium tuberculosis</i> in a mammal based on detection <i>in vitro</i> of a cellular reaction indicating prior sensitization of the mammal to said polypeptide such as, for example, cell proliferation, the synthesis of proteins such as gamma interferon. This method for the detection of an infection by a bacteria of the complex<i>Mycobacterium tuberculosis</i> in a mammal, is characterized in that it comprises the following stages:<ol id="ol0011" compact="compact"><li>a) preparation of a biological sample containing cells of said mammal more particularly cells of the immune system of said mammal and more particularly still T cells;</li><li>b) incubation of the biological sample from step a) with a polypeptide according to the invention;</li><li>c) detection of a cellular reaction indicating prior sensitization of the mammal to said polypeptide such as, for example, cell proliferation and / or synthesis of proteins such as gamma interferon.</li></ol>

Cell proliferation can be measured, for example by incorporation of ³H-Thymidine.

Also part of the invention are the methods for detecting a delayed hypersensitivity reaction (DTH), characterized in that they use a polypeptide according to the invention.

Preferably, the biological sample consists of a fluid, for example a human or animal serum, blood, biopsies, bronchoalveolar fluid or pleural fluid.

Any conventional procedure can be used to carry out such detection.

For example, a preferred method involves immunoenzymatic processes according to the ELISA technique, by immunofluorescence, or radioimmunological (RIA) or equivalent.

Thus, the invention also relates to the polypeptides according to the invention, labeled with the aid of an adequate marker such as of the enzymatic, fluorescent or radioactive type.

Such methods include, for example, the following steps:<ul id="ul0009" list-style="dash" compact="compact"><li>depositing determined quantities of a polypeptide composition according to the invention in the wells of a microtiter plate,</li><li>introduction into said wells of increasing dilutions of serum, or of other biological sample as defined above, to be analyzed,</li><li>microplate incubation,</li><li>introduction into the wells of the microtiter plate of labeled antibodies directed against human or animal immunoglobulins, the labeling of these antibodies having been carried out using an enzyme selected from those which are capable of hydrolyzing a substrate by modifying the absorption of radiation from the latter, at least at a determined wavelength, for example at 550 nm,</li><li>detection, in comparison with a control witness, of the quantity of hydrolyzed substrate.</li></ul>

The invention also relates to a kit or kit for the in vitro diagnosis of an infection with a mycobacterium belonging to the complex. <i>Mycobacterium tuberculosis,</i> including:<ul id="ul0010" list-style="dash" compact="compact"><li>a polypeptide according to the invention,</li><li>where appropriate, the reagents for constituting the medium suitable for the immunological or specific reaction,</li><li>reagents allowing the detection of antigen-antibody complexes produced by the immunological reaction possibly present in the biological sample, and the demonstration <i>in vitro</i> antigen-antibody complexes possibly formed, these reagents can also carry a marker, or be capable of being recognized in turn by a labeled reagent, more particularly in the case where the polypeptide according to the invention is not labeled,</li><li>where appropriate, a reference biological sample (negative control) devoid of antibodies recognized by a polypeptide according to the invention,</li><li>where appropriate, a reference biological sample (positive control) containing a predetermined quantity of antibodies recognized by a polypeptide according to the invention.</li></ul>

The polypeptides according to the invention make it possible to prepare monoclonal or polyclonal antibodies characterized in that they specifically recognize the polypeptides according to the invention. The monoclonal antibodies can advantageously be prepared from hybridomas according to the technique described by Kohler and Milstein in 1975. The polyclonal antibodies can be prepared, for example by immunization of an animal, in particular a mouse, with a polypeptide according to the invention associated with an adjuvant of the immune response, then purification of the specific antibodies contained in the serum of the animals immunized on an affinity column to which the polypeptide having served as an antigen has previously been fixed. The polyclonal antibodies according to the invention can also be prepared by purification on an affinity column, on which a polypeptide according to the invention has previously been immobilized, antibodies contained in the serum of patients infected with a mycobacterium and preferably a bacterium belonging at the complex <i>Mycobacterium tuberculosis.</i>

The invention also relates to mono or polyclonal antibodies or their fragments, or chimeric antibodies, characterized in that they are capable of specifically recognizing a polypeptide according to the invention.

The antibodies of the invention can also be labeled in the same manner as described above for the nucleic acid probes of the invention, such as labeling of the enzymatic, fluorescent or radioactive type.

The invention further relates to a method for the specific detection of the presence of an antigen of a mycobacterium and preferably a bacteria of the complex <i>Mycobacterium tuberculosis</i> in a biological sample, characterized in that it comprises the following stages:<ol id="ol0012" compact="compact"><li>a) bringing the biological sample (tissue or biological fluid) taken from an individual into contact with a mono or polyclonal antibody according to the invention, under conditions allowing an in vitro immunological reaction between said antibodies and the polypeptides specific for mycobacteria and preferably bacteria from the complex of <i>Mycobacterium tuberculosis</i> possibly present in the biological sample, and</li><li>b) highlighting of the antigen-antibody complex formed.</li></ol>

Also within the scope of the invention, a kit or kit for diagnosis <i>in vitro</i> on a biological sample, the presence of mycobacterial strains of mycobacteria and preferably bacteria belonging to the complex <i>Mycobacterium tuberculosis,</i> preferably <i>M. tuberculosis,</i> characterized in that it comprises:<ul id="ul0011" list-style="dash" compact="compact"><li>a polyclonal or monoclonal antibody according to the invention, optionally labeled;</li><li>where appropriate, a reagent for the constitution of the medium suitable for carrying out the immunological reaction;</li><li>a reagent allowing the detection of antigen-antibody complexes produced by the immunological reaction, this reagent can also carry a marker, or be capable of being recognized in turn by a labeled reagent, more particularly in the case where said monoclonal or polyclonal antibody is not marked;</li><li>if necessary, reagents for carrying out the lysis of the cells of the test sample.</li></ul>

The present invention also relates to a method for the rapid detection and identification of mycobacteria and preferably bacteria of <i>M</i>. <i>tuberculosis</i> in a biological sample, characterized in that it comprises the following stages:<ul id="ul0012" list-style="none" compact="compact"><li>a) isolation of the DNA from the biological sample to be analyzed, or obtaining a cDNA from the RNA of the biological sample;</li><li>b) specific amplification of the DNA of mycobacteria and preferably of bacteria belonging to the complex <i>Mycobacterium tuberculosis</i> using primers according to the invention;</li><li>g) analysis of the amplification products.</li></ul>

Amplification products can be analyzed by different methods.

Two methods of analysis are given as an example below:<ul id="ul0013" list-style="dash" compact="compact"><li>Electrophoretic analysis in agarose gel of amplification products. The presence of a DNA fragment migrating to the expected location suggests that the sample analyzed contained DNA from mycobacteria belonging to the tuberculosis complex, or</li><li>Analysis by the molecular hybridization technique using a nucleic probe according to the invention. This probe will advantageously be marked by a non-radioactive (cold probe) or radioactive element.</li></ul>

For the purposes of the present invention, the term “DNA from the biological sample” or “DNA contained in the biological sample” means either the DNA present in the biological sample considered or the cDNA obtained after the action of an enzyme of reverse transcriptase type on the RNA present in said biological sample.

Another method of the present invention allows the detection of an infection by a mycobacterium and preferably a bacteria of the complex <i>Mycobacterium tuberculosis</i> in a mammal. This process includes the following steps:<ol id="ol0013" compact="compact"><li>a) preparation of a biological sample containing cells of said mammal more particularly cells of the immune system of said mammal and more particularly still T cells;</li><li>b) incubation of the biological sample from step a) with a polypeptide according to the invention;</li><li>c) detection of a cellular reaction indicating prior sensitization of the mammal to said polypeptide, in particular cell proliferation and / or synthesis of proteins such as gamma interferon;</li><li>d) detection of a delayed hypersensitivity reaction or sensitization of the mammal to said polypeptide.</li></ol>

This detection method is an intradermal method, which is described for example by <nplcit id="ncit0003" npl-type="s"><text>MJ Elhay et al. (1988) Infection and Immunity, 66 (7): 3454-3456</text></nplcit>.

Another object of the present invention consists of a method for the detection of mycobacteria and preferably bacteria belonging to the complex <i>Mycobacterium tuberculosis</i> in a biological sample, characterized in that it comprises the following stages:<ol id="ol0014" compact="compact"><li>a) bringing an oligonucleotide probe according to the invention into contact with a biological sample, the DNA contained in the biological sample, or the cDNA obtained by reverse transcription of the RNA of the biological sample, having, the if necessary, previously made available for hybridization, under conditions allowing hybridization of the probe to the DNA or cDNA of the mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis;</i></li><li>b) detection of the hybrid formed between the oligonucleotide probe and the DNA of the biological sample.</li></ol>

The invention also relates to a method for the detection of mycobacteria and preferably bacteria belonging to the complex <i>Mycobacterium tuberculosis</i> in a biological sample, characterized in that it comprises the following stages:<ol id="ol0015" compact="compact"><li>a) bringing an oligonucleotide probe according to the invention immobilized on a support, into contact with a biological sample, the DNA of the biological sample having, if necessary, been made available beforehand for hybridization, under conditions allowing the hybridization of said probe to the DNA of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis;</i></li><li>b) bringing the hybrid formed between said oligonucleotide probe immobilized on a support and the DNA contained in the biological sample, if appropriate after removing the DNA from the biological sample which has not hybridized with the probe, with a labeled oligonucleotide probe according to the invention.</li></ol>

According to an advantageous embodiment of the detection method defined above, it is characterized in that, before step a), the DNA of the biological sample is previously amplified using a pair of primers according to the invention.

Another form of implementation of the detection method according to the invention consists of a method for detecting the presence of mycobacteria and preferably bacteria belonging to the complex of <i>Mycobacterium tuberculosis</i> in a biological sample, characterized in that it comprises the following stages:<ol id="ol0016" compact="compact"><li>a) bringing the biological sample into contact with a pair of primers according to the invention, the DNA contained in the sample having been, if necessary, previously made accessible to hybridization, under conditions allowing hybridization said primers to the DNA of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis;</i></li><li>b) amplification of the DNA of a mycobacterium and preferably of a bacteria of the complex <i>Mycobacterium tuberculosis;</i></li><li>c) demonstration of the amplification of DNA fragments corresponding to the fragment framed by the primers, for example by gel electrophoresis or by means of an oligonucleotide probe according to the invention.</li></ol>

The invention also relates to a method for detecting the presence of mycobacteria and preferably bacteria belonging to the complex of <i>Mycobacterium tuberculosis</i> in a biological sample by strand displacement, characterized in that it comprises the following steps:<ol id="ol0017" compact="compact"><li>a) bringing the biological sample into contact with two pairs of primers according to the invention specifically intended for the SDA type amplification described above, the DNA contained in the sample having been, if necessary, previously made accessible to hybridization, under conditions allowing hybridization of primers to the DNA of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis;</i></li><li>b) amplification of the DNA of the mycobacteria and preferably of the bacteria of the complex <i>Mycobacterium tuberculosis;</i></li><li>c) demonstration of the amplification of DNA fragments corresponding to the fragment framed by the primers, for example by gel electrophoresis or by means of an oligonucleotide probe according to the invention.</li></ol>

The invention also relates to a kit for the implementation of the process described above, intended for the detection of the presence of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis</i> in a biological sample, characterized in that it comprises the following elements:<ol id="ol0018" compact="compact"><li>a) an oligonucleotide probe according to the invention;</li><li>b) the reagents necessary for carrying out a hybridization reaction;</li><li>c) where appropriate, a pair of primers according to the invention as well as the reagents necessary for a DNA amplification reaction (genomic DNA, plasmid DNA or cDNA) of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis.</i></li></ol>

The subject of the invention is also a kit or kit for the detection of the presence of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis</i> in a biological sample, characterized in that it comprises the following elements:<ol id="ol0019" compact="compact"><li>a) an oligonucleotide probe, called a capture probe, according to the invention;</li><li>b) an oligonucleotide probe, called the revelation probe, according to the invention;</li><li>c) where appropriate, a pair of primers according to the invention as well as the reagents necessary for an amplification reaction of the DNA of the mycobacteria and preferably of the bacteria of the complex <i>Mycobacterium tuberculosis.</i></li></ol>

The invention also relates to a kit or kit for the amplification of the DNA of mycobacteria and preferably bacteria of the complex <i>Mycobacterium tuberculosis</i> present in a biological sample, characterized in that it comprises the following elements:<ol id="ol0020" compact="compact"><li>a) a pair of primers according to the invention;</li><li>b) the reagents necessary to carry out a DNA amplification reaction;</li><li>c) optionally a component making it possible to verify the sequence of the amplified fragment, more particularly an oligonucleotide probe according to the invention.</li></ol>

Another object of the present invention relates to an immunogenic composition, characterized in that it comprises a polypeptide according to the invention.

Another immunogenic composition according to the invention is characterized in that it comprises one or more polypeptides according to the invention and / or one or more hybrid polypeptides according to the invention.

According to an advantageous embodiment, the immunogenic composition defined above constitutes a vaccine, when it is presented in association with a pharmaceutically acceptable vehicle and optionally one or more adjuvants of immunity such as alum or a representative of the family of muramyl peptides or the incomplete adjuvant of Freund.

Today, various types of vaccines are available to protect humans against infectious diseases: live attenuated microorganisms (<i>M</i>. <i>bovis -</i> BCG for tuberculosis), inactivated microorganisms (influenza virus), cell-free extracts (<i>Bordetella pertussis</i> for whooping cough), recombinant proteins (hepatitis B virus surface antigen), polysaccharides (pneumococci). Vaccines prepared from synthetic peptides or genetically modified microorganisms expressing heterologous antigens are being tested. Even more recently, recombinant plasmid DNA carrying genes coding for protective antigens have been proposed as an alternative vaccine strategy. This type of vaccination is carried out with a particular plasmid derived from a plasmid of <i>E</i>. <i>coli</i> which does not replicate <i>in vivo</i> and which codes only for the vaccinating protein. The main functional components of this plasmid are: a strong promoter allowing expression in eukaryotic cells (for example that of CMV), a suitable cloning site for inserting the gene of interest, a termination-polyadenylation sequence, an origin of prokaryotic replication to produce the recombinant plasmid<i>in vitro</i> and a selection marker (eg, the ampicillin resistance gene) to facilitate the selection of bacteria which contain the plasmid. Animals have been immunized by simply injecting naked plasmid DNA into the muscle. This technique leads to the expression of the vaccine protein<i>in situ</i> and to an immune response in particular of the cellular type (CTL) and of the humoral type (antibody). This double induction of the immune response is one of the main advantages of the vaccination technique with naked DNA. Huygen et al. (1996) and Tascon et al. (1996) managed to obtain some protection against<i>M. tuberculosis</i> by injecting recombinant plasmids containing genes <i>M. leprae (hsp65, 36kDa pra)</i> as inserts. <i>Mr leprae</i> is the agent responsible for leprosy. The use of a specific insert of<i>M. tuberculosis</i> like for example all or part of the gene <i>DP428,</i> object of the present invention would probably lead to better protection against tuberculosis. All or part of the gene<i>DP428,</i> or any polynucleotide according to the invention, can be easily inserted into the vector plasmids V1J (Montgomery et al., 1993), pcDNA3 (Invitrogen, R &amp; D Systems) or pcDNA1 / Neo (Invitrogen) which have the characteristics necessary for use vaccine.

The invention thus relates to a vaccine, characterized in that it comprises one or more polypeptides according to the invention and / or one or more hybrid polypeptides according to the invention as previously defined in association with a pharmaceutically compatible vehicle and, where appropriate if appropriate, one or more appropriate adjuvants of immunity.

The invention also relates to a vaccine composition intended for the immunization of humans or animals against a bacterial or viral infection, such as tuberculosis or hepatitis, characterized in that it comprises a or several hybrid polypeptides as previously defined in association with a pharmaceutically compatible vehicle and, where appropriate, one or more adjuvants of immunity.

Advantageously, in the case of a hybrid protein between a polypeptide according to the invention and the hepatitis B surface antigen, the vaccine composition will be administered, in humans, in an amount of 0.1 to 1 μg of purified hybrid protein per kilogram of patient weight, preferably 0.2 to 0.5 µg / kg patient weight, for a dose intended for a given administration. In the case of patients with immune system disorders, in particular immunocompromised patients, each dose injected will preferably contain half the weight amount of the hybrid protein contained in a dose intended for a patient not affected by system disorders immune.

Preferably, the vaccine composition will be administered several times, over a period of time, by the intradermal or subcutaneous route. By way of example, three doses as defined above will be administered respectively to the patient at time t0, at time t0 + 1 month and at time t0 + 1 year.

Alternatively, three doses will be administered to the patient respectively at time t0, time t0 + 1 month and time t0 + 6 months.

In mice, in which a weight dose of the vaccine composition comparable to the dose used in humans is administered, the antibody reaction is tested by sampling the serum followed by a study of the formation of a complex between the antibodies present in the serum and the antigen of the vaccine composition, according to the usual techniques.

The invention also relates to an immunogenic composition characterized in that it comprises a polynucleotide or an expression vector according to the invention, in combination with a vehicle allowing its administration to humans or animals.

The subject of the invention is also a vaccine intended for immunization against a bacterial or viral infection, such as tuberculosis or hepatitis, characterized in that it comprises a polynucleotide or an expression vector according to the invention, in combination with a pharmaceutically acceptable vehicle.

Such immunogenic or vaccine compositions are in particular described in international application No. <patcit id="pcit0018" dnum="WO9011092A"><text>WO 90/11092</text></patcit> (Vical Inc.) and also in international application No. <patcit id="pcit0019" dnum="WO9511307A"><text>WO 95/11307</text></patcit> (Pastor Institute).

The polynucleotide constituting the immunogenic composition or the vaccine composition according to the invention can be injected into the host after having been coupled to compounds which promote the penetration of this polynucleotide inside the cell or its transport to the cell nucleus. The resulting conjugates can be encapsulated in polymer microparticles, as described in international application No.<patcit id="pcit0020" dnum="WO9427238A"><text>WO 94/27238</text></patcit> (medisorb Technologies International).

According to another embodiment of the immunogenic and / or vaccine composition according to the invention, the polynucleotide, preferably a DNA, is complexed with DEAE-dextran (Pagano et al., 1967) or with nuclear proteins (Kaneda and al., 1989), with lipids (Felgner et al., 1987) or also encapsulated in liposomes (Fraley et al., 1980).

According to yet another advantageous embodiment of the immunogenic and / or vaccine composition according to the invention, the polynucleotide according to the invention can be introduced in the form of a gel facilitating its transfection into cells. Such a composition in the form of a gel can be a complex of poly-L-lysine and lactose, as described by Midoux in 1993, or else Poloxamer 407.^™, as described by Pastore in 1994. The polynucleotide or the vector according to the invention can also be in suspension in a buffer solution or be associated with liposomes.

Advantageously, such a vaccine will be prepared according to the technique described by Tacson et al. or Huygen et al. in 1996 or according to the technique described by<patcit id="pcit0021" dnum="WO9511307A"><text>Davis et al. in international application No. WO 95/11307</text></patcit> (Whalen et al.).

Such a vaccine will advantageously be prepared in the form of a composition containing a vector according to the invention, placed under the control of regulatory elements allowing its expression in humans or animals.

To make such a vaccine, the polynucleotide according to the invention is first of all subcloned into an appropriate expression vector, more particularly an expression vector containing regulation and expression signals recognized by the enzymes of the cells. eukaryotes and also containing an origin of active replication in prokaryotes, for example in <i>E</i>. <i>coli,</i> which allows its prior amplification. Then the purified recombinant plasmid obtained is injected into the host, for example by the intramuscular route.

It is possible, for example, to use, as a vector for the in vivo expression of the antigen of interest, the plasmid pcDNA3 or the plasmid pcDNA1 / neo, both marketed by Invitrogen (R&amp;D Systems, Abingdon, United Kingdom). One can also use the plasmid V1Jns.tPA, described by Shiver et al. in 1995.

Such a vaccine will advantageously comprise, in addition to the recombinant vector, a saline solution, for example a sodium chloride solution.

A vaccine composition as defined above will, for example, be administered parenterally or intramuscularly.

The present invention also relates to a vaccine characterized in that it contains one or more nucleotide sequences according to the invention and / or one or more polynucleotides as mentioned above in combination with a pharmaceutically compatible vehicle and, where appropriate, a or more appropriate adjuvants of immunity.

Another aspect relates to a method for screening for molecules capable of inhibiting the growth of mycobacteria or the maintenance of mycobacteria in a host, characterized in that said molecules block the synthesis or the function of the polypeptides encoded by a nucleotide sequence according to the invention or by a polynucleotide as described above.

In said screening method, the molecules can be anti-messengers or can induce the synthesis of anti-messengers.

The present invention also relates to molecules capable of inhibiting the growth of mycobacteria or the maintenance of mycobacteria in a host, characterized in that said molecules are synthesized according to the structure of the polypeptides encoded by a nucleotide sequence according to the invention or by a polynucleotide as described above.

Other characteristics and advantages of the invention appear in the following examples and figures:

FIGURES

<ul id="ul0014" list-style="none" compact="compact"><li><u style="single">The series of</u><figref idref="f0001"><u style="single">Figures 1</u></figref> : <ul id="ul0015" list-style="none" compact="compact"><li>The series of <figref idref="f0001">Figures 1</figref> illustrates the series of nucleotide sequences SEQ ID No. 1 corresponding to the insert of the vector pDP428 (deposited at the CNCM under No. I-1818) and the series of amino acid sequences SEQ ID No. 1 of the polypeptides coded by the series of nucleotide sequences SEQ ID No. 1.</li></ul></li><li><figref idref="f0006"><u style="single">Figure 2</u></figref><u style="single">:</u><ul id="ul0016" list-style="none" compact="compact"><li>Illustrates the nucleotide sequence SEQ ID N ° 2 corresponding to the region including the gene coding for the polypeptide DP428 (underlined region). In this figure, both the ATG and GTG codons for translation initiation have been taken into account. The figure shows that the DP428 polypeptide is probably part of an operon comprising at least three genes. The doubly framed region probably includes the promoter regions.</li><li>The region simply framed corresponds to the LPISG motif recalling the LPXTG motif described in Gram-positive bacteria as allowing anchoring to peptidoglycans.</li></ul></li><li><u style="single">The series of</u><figref idref="f0007 f0008"><u style="single">Figures 3</u></figref> : <ul id="ul0017" list-style="none" compact="compact"><li>The series of <figref idref="f0007 f0008">Figures 3</figref> represents the series of nucleotide sequences SEQ ID No. 3 corresponding to the insert of the vector p6D7 (deposited at the CNCM under No. I-1814).</li></ul></li><li><u style="single">The series of</u><figref idref="f0008 f0009 f0010 f0011 f0012"><u style="single">Figures 4</u></figref> : <ul id="ul0018" list-style="none" compact="compact"><li>The series of <figref idref="f0008 f0009 f0010 f0011 f0012">Figures 4</figref> represents the series of nucleotide sequences SEQ ID No. 4 corresponding to the insert of the vector p5A3 (deposited at the CNCM under No. I-1815).</li></ul></li><li><u style="single">The series of</u><figref idref="f0013 f0014 f0015 f0016 f0017 f0018"><u style="single">Figures 5</u></figref><u style="single">:</u><ul id="ul0019" list-style="none" compact="compact"><li>The series of <figref idref="f0013 f0014 f0015 f0016 f0017 f0018">Figures 5</figref> represents the series of nucleotide sequences SEQ ID No. 5 corresponding to the insert of the vector p5F6 (deposited at the CNCM under No. I-1816).</li></ul></li><li><u style="single">The series of</u><figref idref="f0019 f0020"><u style="single">Figures 6</u></figref><u style="single">:</u><ul id="ul0020" list-style="none" compact="compact"><li>The series of <figref idref="f0019 f0020">Figures 6</figref> represents the series of nucleotide sequences SEQ ID No. 6 corresponding to the insert of the vector p2A29 (deposited at the CNCM under No. I-1817).</li></ul></li><li><u style="single">The series of</u><figref idref="f0020 f0021"><u style="single">Figures 7</u></figref><u style="single">:</u><ul id="ul0021" list-style="none" compact="compact"><li>The series of <figref idref="f0020 f0021">Figures 7</figref> represents the series of nucleotide sequences SEQ ID No. 7 corresponding to the insert of the vector p5B5 (deposited at the CNCM under No. I-1819).</li></ul></li><li><u style="single">The series of</u><figref idref="f0022 f0023 f0024 f0025 f0026 f0027 f0028"><u style="single">Figures 8</u></figref><u style="single">:</u><ul id="ul0022" list-style="none" compact="compact"><li>The series of <figref idref="f0022 f0023 f0024 f0025 f0026 f0027 f0028">Figures 8</figref> represents the series of nucleotide sequences SEQ ID No. 8 corresponding to the insert of the vector p1C7 (deposited at the CNCM under No. I-1820).</li></ul></li><li><u style="single">The series of</u><figref idref="f0029 f0030"><u style="single">Figures 9</u></figref><u style="single">:</u><ul id="ul0023" list-style="none" compact="compact"><li>The series of <figref idref="f0029 f0030">Figures 9</figref> represents the series of nucleotide sequences SEQ ID No. 9 corresponding to the insert of the vector p2D7 (deposited at the CNCM under No. I-1821).</li></ul></li><li><u style="single">The series of</u><figref idref="f0030 f0031"><u style="single">Figures 10</u></figref> : <ul id="ul0024" list-style="none" compact="compact"><li>The series of <figref idref="f0030 f0031">Figures 10</figref> represents the series of nucleotide sequences SEQ ID No. 10 corresponding to the insert of the vector p1B7 (deposited at the CNCM under No. I-1843).</li></ul></li><li><u style="single">The series of</u><figref idref="f0032 f0033 f0034 f0035"><u style="single">Figures 11</u></figref><u style="single">:</u><ul id="ul0025" list-style="none" compact="compact"><li>The series of <figref idref="f0032 f0033 f0034 f0035">Figures 11</figref> represents the series of nucleotide sequences SEQ ID No. 11.</li></ul></li><li><u style="single">The series of</u><figref idref="f0036 f0037"><u style="single">Figures 12</u></figref> : <ul id="ul0026" list-style="none" compact="compact"><li>The series of <figref idref="f0036 f0037">Figures 12</figref> represents the series of nucleotide sequences SEQ ID No. 12.</li></ul></li><li><u style="single">The series of</u><figref idref="f0037 f0038 f0039 f0040 f0041 f0042"><u style="single">Figures 13</u></figref> : <ul id="ul0027" list-style="none" compact="compact"><li>The series of <figref idref="f0037 f0038 f0039 f0040 f0041 f0042">Figures 13</figref> represents the series of nucleotide sequences SEQ ID No. 13.</li></ul></li><li><u style="single">The series of</u><figref idref="f0043 f0044 f0045 f0046 f0047 f0048 f0049"><u style="single">Figures 14</u></figref> : <ul id="ul0028" list-style="none" compact="compact"><li>The series of <figref idref="f0043 f0044 f0045 f0046 f0047 f0048 f0049">Figures 14</figref> represents the series of nucleotide sequences SEQ ID No. 14 corresponding to the insert of the vector p5B5 (deposited at the CNCM under No. I-1819).</li></ul></li><li><u style="single">The series of</u><figref idref="f0049 f0050 f0051 f0052 f0053 f0054 f0055 f0056"><u style="single">Figures 15</u></figref><u style="single">:</u><ul id="ul0029" list-style="none" compact="compact"><li>The series of <figref idref="f0049 f0050 f0051 f0052 f0053 f0054 f0055 f0056">Figures 15</figref> represents the series of nucleotide sequences SEQ ID No. 15.</li></ul></li><li><u style="single">The series of</u><figref idref="f0056 f0057"><u style="single">Figures 16</u></figref> : <ul id="ul0030" list-style="none" compact="compact"><li>The series of <figref idref="f0056 f0057">Figures 16</figref> represents the series of nucleotide sequences SEQ ID No. 16.</li></ul></li><li><u style="single">The series of</u><figref idref="f0058 f0059 f0060 f0061"><u style="single">Figures 17</u></figref> : <ul id="ul0031" list-style="none" compact="compact"><li>The series of <figref idref="f0058 f0059 f0060 f0061">Figures 17</figref> represents the series of nucleotide sequences SEQ ID No. 17.</li></ul></li><li><u style="single">The series of</u><figref idref="f0062 f0063 f0064 f0065 f0066"><u style="single">Figures 18</u></figref> : <ul id="ul0032" list-style="none" compact="compact"><li>The series of <figref idref="f0062 f0063 f0064 f0065 f0066">Figures 18</figref> represents the series of nucleotide sequences SEQ ID No. 18.</li></ul></li><li><u style="single">The series of</u><figref idref="f0067 f0068 f0069 f0070 f0071 f0072 f0073"><u style="single">Figures 19</u></figref> : <ul id="ul0033" list-style="none" compact="compact"><li>The series of <figref idref="f0067 f0068 f0069 f0070 f0071 f0072 f0073">Figures 19</figref> represents the series of nucleotide sequences SEQ ID No. 19.</li></ul></li><li><u style="single">The series of</u><figref idref="f0073 f0074 f0075 f0076 f0077"><u style="single">Figures 20</u></figref><u style="single">:</u><ul id="ul0034" list-style="none" compact="compact"><li>The series of <figref idref="f0073 f0074 f0075 f0076 f0077">Figures 20</figref> represents the series of nucleotide sequences SEQ ID No. 20 corresponding to the insert of the vector p2A29 (deposited at the CNCM under No. I-1817).</li></ul></li><li><u style="single">The series of</u><figref idref="f0078 f0079 f0080 f0081 f0082 f0083 f0084 f0085 f0086"><u style="single">Figures 21</u></figref> : <ul id="ul0035" list-style="none" compact="compact"><li>The series of <figref idref="f0078 f0079 f0080 f0081 f0082 f0083 f0084 f0085 f0086">Figures 21</figref> represents the series of nucleotide sequences SEQ ID No. 21.</li></ul></li><li><u style="single">The series of</u><figref idref="f0087 f0088"><u style="single">Figures 22</u></figref><u style="single">:</u><ul id="ul0036" list-style="none" compact="compact"><li>The series of <figref idref="f0087 f0088">Figures 22</figref> represents the series of nucleotide sequences SEQ ID No. 22.</li></ul></li><li><u style="single">The series of</u><figref idref="f0088 f0089 f0090"><u style="single">Figures 23</u></figref><u style="single">:</u><ul id="ul0037" list-style="none" compact="compact"><li>The series of <figref idref="f0088 f0089 f0090">Figures 23</figref> represents the series of nucleotide sequences SEQ ID No. 23.</li></ul></li><li><u style="single">The series of</u><figref idref="f0091 f0092"><u style="single">Figures 24</u></figref> : <ul id="ul0038" list-style="none" compact="compact"><li>The series of <figref idref="f0091 f0092">Figures 24</figref> represents the series of nucleotide sequences SEQ ID No. 24.</li></ul></li><li><figref idref="f0092"><u style="single">Figures 25 and 26</u></figref> : <ul id="ul0039" list-style="none" compact="compact"><li>The <figref idref="f0092">Figures 25 and 26</figref> respectively illustrate the sequences SEQ ID No 25 and SEQ ID No 26 representing a pair of primers used to specifically amplify by PCR the region corresponding to nucleotides 964 to 1234 included in the sequence SEQ ID No 1.</li></ul></li><li><u style="single">The series of</u><figref idref="f0093 f0094"><u style="single">Figures 27</u></figref><u style="single">:</u><ul id="ul0040" list-style="none" compact="compact"><li>The series of <figref idref="f0093 f0094">Figures 27</figref> represents the series of nucleotide sequences SEQ ID No. 27 corresponding to the insert of the vector p5A3.</li></ul></li><li><figref idref="f0094"><u style="single">Figure 28</u></figref><u style="single">:</u><ul id="ul0041" list-style="none" compact="compact"><li>The amino acid sequence as defined in the <figref idref="f0094">figure 28</figref> represents the amino acid sequence SEQ ID No. 28 corresponding to the DP428 polypeptide.</li></ul></li><li><figref idref="f0094"><u style="single">Figure 29</u></figref><u style="single">:</u><ul id="ul0042" list-style="none" compact="compact"><li>The <figref idref="f0094">figure 29</figref> represents the nucleotide sequence SEQ ID N ° 29 of the complete gene coding for the protein M1C25.</li></ul></li><li><figref idref="f0095"><u style="single">Figure 30</u></figref><u style="single">:</u><ul id="ul0043" list-style="none" compact="compact"><li>The <figref idref="f0095">figure 30</figref> represents the amino acid sequence SEQ ID No. 30 of the protein M1C25.</li></ul></li><li><u style="single">The series of</u><figref idref="f0095 f0096"><u style="single">Figures 31</u></figref><u style="single">:</u><ul id="ul0044" list-style="none" compact="compact"><li>The series of <figref idref="f0095 f0096">Figures 31</figref> represents the series of nucleotide sequences SEQ ID No. 31.</li></ul></li><li><u style="single">The series of</u><figref idref="f0097 f0098 f0099 f0100 f0101"><u style="single">Figures 32</u></figref><u style="single">:</u><ul id="ul0045" list-style="none" compact="compact"><li>The series of <figref idref="f0097 f0098 f0099 f0100 f0101">Figures 32</figref> represents the series of nucleotide sequences SEQ ID No. 32.</li></ul></li><li><u style="single">The series of</u><figref idref="f0102 f0103 f0104"><u style="single">Figures 33</u></figref><u style="single">:</u><ul id="ul0046" list-style="none" compact="compact"><li>The series of <figref idref="f0102 f0103 f0104">Figures 33</figref> represents the series of nucleotide sequences SEQ ID No. 33.</li></ul></li><li><u style="single">The series of</u><figref idref="f0104 f0105 f0106 f0112"><u style="single">Figures 34</u></figref> : <ul id="ul0047" list-style="none" compact="compact"><li>The series of <figref idref="f0097 f0098 f0099 f0100 f0101">Figures 32</figref> represents the series of nucleotide sequences SEQ ID No. 34.</li></ul></li><li><u style="single">The series of</u><figref idref="f0106 f0107 f0108"><u style="single">Figures 35</u></figref><u style="single">:</u><ul id="ul0048" list-style="none" compact="compact"><li>The series of <figref idref="f0106 f0107 f0108">Figures 35</figref> represents the series of nucleotide sequences SEQ ID No. 35.</li></ul></li><li><u style="single">The series of</u><figref idref="f0109 f0110 f0111 f0113 f0114 f0115"><u style="single">Figures 36</u></figref><u style="single">:</u><ul id="ul0049" list-style="none" compact="compact"><li>The series of <figref idref="f0109 f0110 f0111 f0113 f0114 f0115">Figures 36</figref> represents the series of nucleotide sequences SEQ ID No. 36.</li></ul></li><li><u style="single">The series of</u><figref idref="f0115 f0116 f0117 f0118 f0119"><u style="single">Figures 37</u></figref><u style="single">:</u><ul id="ul0050" list-style="none" compact="compact"><li>The series of <figref idref="f0115 f0116 f0117 f0118 f0119">Figures 37</figref> represents the series of nucleotide sequences SEQ ID No. 37.</li></ul></li><li><u style="single">The series of</u><figref idref="f0120 f0121 f0122 f0123"><u style="single">Figures 38</u></figref> : <ul id="ul0051" list-style="none" compact="compact"><li>The series of <figref idref="f0120 f0121 f0122 f0123">Figures 38</figref> represents the series of nucleotide sequences SEQ ID No. 38.</li></ul></li><li><u style="single">The series of</u><figref idref="f0124 f0125 f0126 f0127"><u style="single">Figures 39</u></figref><u style="single">:</u><ul id="ul0052" list-style="none" compact="compact"><li>The series of <figref idref="f0124 f0125 f0126 f0127">Figures 39</figref> represents the series of nucleotide sequences SEQ ID No. 39.</li></ul></li><li><u style="single">The series of</u><figref idref="f0127 f0128 f0129"><u style="single">Figures 40</u></figref><u style="single">:</u><ul id="ul0053" list-style="none" compact="compact"><li>The series of <figref idref="f0127 f0128 f0129">Figures 40</figref> represents the series of nucleotide sequences SEQ ID No. 40.</li></ul></li><li><u style="single">The series of</u><figref idref="f0130 f0131 f0132 f0133 f0134 f0135 f0136"><u style="single">Figures 41</u></figref><u style="single">:</u><ul id="ul0054" list-style="none" compact="compact"><li>The series of <figref idref="f0130 f0131 f0132 f0133 f0134 f0135 f0136">Figures 41</figref> represents the series of nucleotide sequences SEQ ID No. 41 corresponding to the insert of the vector p2D7 (deposited at the CNCM under No. I-1821).</li></ul></li><li><u style="single">The series of</u><figref idref="f0136 f0137 f0138 f0139"><u style="single">Figures 42</u></figref><u style="single">:</u><ul id="ul0055" list-style="none" compact="compact"><li>The series of <figref idref="f0136 f0137 f0138 f0139">Figures 42</figref> represents the series of nucleotide sequences SEQ ID No. 42.</li></ul></li><li><u style="single">The series of</u><figref idref="f0140 f0141 f0142"><u style="single">Figures 43</u></figref> : <ul id="ul0056" list-style="none" compact="compact"><li>The series of <figref idref="f0140 f0141 f0142">Figures 43</figref> represents the series of nucleotide sequences SEQ ID No. 43.</li></ul></li><li><u style="single">The series of</u><figref idref="f0143 f0144 f0145 f0146"><u style="single">Figures 44</u></figref><u style="single">:</u><ul id="ul0057" list-style="none" compact="compact"><li>The series of <figref idref="f0143 f0144 f0145 f0146">Figures 44</figref> represents the series of nucleotide sequences SEQ ID No. 44.</li></ul></li><li><u style="single">The series of</u><figref idref="f0147 f0148 f0149 f0150 f0151 f0152 f0153"><u style="single">Figures 45</u></figref><u style="single">:</u><ul id="ul0058" list-style="none" compact="compact"><li>The series of <figref idref="f0147 f0148 f0149 f0150 f0151 f0152 f0153">Figures 45</figref> represents the series of nucleotide sequences SEQ ID No. 45.</li></ul></li><li><u style="single">The series of</u><figref idref="f0154 f0155 f0156 f0157"><u style="single">Figures 46</u></figref><u style="single">:</u><ul id="ul0059" list-style="none" compact="compact"><li>The series of <figref idref="f0154 f0155 f0156 f0157">Figures 46</figref> represents the series of nucleotide sequences SEQ ID No. 46.</li></ul></li><li><u style="single">The series of</u><figref idref="f0158 f0159 f0160 f0161"><u style="single">Figures 47</u></figref><u style="single">:</u><ul id="ul0060" list-style="none" compact="compact"><li>The series of <figref idref="f0158 f0159 f0160 f0161">Figures 47</figref> represents the series of nucleotide sequences SEQ ID No. 47.</li></ul></li><li><u style="single">The series of</u><figref idref="f0162 f0163 f0164 f0165"><u style="single">Figures 48</u></figref> : <ul id="ul0061" list-style="none" compact="compact"><li>The series of <figref idref="f0162 f0163 f0164 f0165">Figures 48</figref> represents the series of nucleotide sequences SEQ ID No. 48.</li></ul></li><li><u style="single">The series of</u><figref idref="f0166 f0167 f0168 f0169 f0170 f0171 f0172 f0173 f0174 f0175"><u style="single">Figures 49</u></figref> : <ul id="ul0062" list-style="none" compact="compact"><li>The series of <figref idref="f0166 f0167 f0168 f0169 f0170 f0171 f0172 f0173 f0174 f0175">Figures 49</figref> represents the series of nucleotide sequences SEQ ID No. 49.</li></ul></li><li><u style="single">The series of</u><figref idref="f0176 f0177 f0178 f0179 f0180"><u style="single">Figures 50</u></figref><u style="single">:</u><ul id="ul0063" list-style="none" compact="compact"><li>The series of <figref idref="f0176 f0177 f0178 f0179 f0180">Figures 50</figref> represents the series of nucleotide sequences SEQ ID No. 50.</li></ul></li><li><figref idref="f0181"><u style="single">Figure 51</u></figref><u style="single">:</u><ol id="ol0021" compact="compact"><li>A. The Pjved construct: Plasmid shuttle (which can multiply in mycobacteria as well as in E.<i>coli</i>) with a kanamycin resistance gene (from Tn903) as a selection marker. The gene<i>phoA</i> truncated (Δ <i>phoA)</i> and the gene <i>luc</i> form a synthetic operon.</li><li>B. Sequence of the junction between <i>phoA</i> and <i>luc.</i></li></ol></li><li><figref idref="f0182"><u style="single">Figure 52</u></figref><u style="single">:</u><ul id="ul0064" list-style="none" compact="compact"><li>Genomic hybridization (Southern blot) of the genomic DNA of different mycobacterial species using an oligonucleotide probe whose sequence is the sequence between the nucleotide in position nt 964 (5 'end of the probe) and the nucleotide in position nt 1234 (3 ′ end of the probe), ends included, of the sequence SEQ ID No. 1.</li></ul></li><li><figref idref="f0183"><u style="single">Figures 53</u></figref><u style="single">and</u><figref idref="f0184"><u style="single">54</u></figref><u style="single">:</u><ul id="ul0065" list-style="none" compact="compact"><li>Luc and PhoA's activities <i>M. smegmatis</i> recombinant containing pJVED with different nucleotide fragments as described in example. The<figref idref="f0182">figures 52</figref> and <figref idref="f0183">53</figref> represent the results obtained for two separate experiments carried out under the same conditions.</li></ul></li><li><figref idref="f0184"><u style="single">Figure 55</u></figref><u style="single">:</u><ul id="ul0066" list-style="none" compact="compact"><li>Representation of the hydrophobicity (Kyte and Doolitle) of the coding sequence of the DP428 polypeptide with its schematic representation. The LPISG motif immediately precedes the hydrophobic C-terminal region. The sequence ends with two arginines.</li></ul></li><li><figref idref="f0185"><u style="single">Figure 56</u></figref> : <ul id="ul0067" list-style="none" compact="compact"><li>Representation of the hydrophoicity (Kyte and Doolitle) of the sequence of the polypeptide M1C25 of amino acid sequence SEQ ID No. 30.</li></ul></li><li><figref idref="f0185"><u style="single">Figure 57</u></figref><u style="single">:</u><ol id="ol0022" compact="compact"><li>A- Acrylide gel (12%) in denaturing condition of a bacterial extract obtained by sonication of bacteria <i>E. coli</i> M15 containing the plasmid pM1C25 without and after 4 hours of induction with IPTG, stained with Comassie blue. Line 1: Molar mass marker (Prestained SDS-PAGE Standards High Range BIO-RAD @). Line 2: Bacterial extract obtained by sonication of bacteria <i>E</i>. <i>coli</i> M15 containing the plasmid pM1C25 without induction by IPTG. Line 3: Bacterial extract obtained by sonication of bacteria <i>E</i>. <i>coli</i> M15 containing the plasmid pM1C25 after 4 hours of induction with IPTG. Line 4: Molar mass marker (Prestained SDS-PAGE Standards Low Range BIO-RAD @).</li><li>B- Western blot of a gel-like gel (12% acrylamide) revealed using the penta-His antibody sold by the company Quiagen. Line 1: Representation of the molar mass marker (Prestained SDS-PAGE Standards High Range BIO-RAD @). Line 2: Bacterial extract obtained by sonication of bacteria <i>E. coli</i> M15 containing the plasmid pM1C25 without induction by IPTG. Line 3: Bacterial extract obtained by sonication of bacteria <i>E. coli</i> M15 containing the plasmid pM1C25 after 4 hours of induction with IPTG. Line 4: Representation of the molar mass marker (Prestained SDS-PAGE Standards Low Range BIO-RAD @).</li></ol></li></ul>

The band present for the most part in the lines corresponding to the bacteria induced by IPTG compared to those not induced by IPTG, comprised between 34,200 and 28,400 daltons, corresponds to the expression of the insert M1C25 cloned into the vector pQE- 60 (Qiagen @).

As regards the legends of the other figures which are numbered by an alphanumeric character, each of these other figures represents the nucleotide sequence and the amino acid sequence of sequence SEQ ID whose numbering is identical to the alphanumeric character of each of said figures.

The alphanumeric numberings of the figures representing the SEQ IDs comprising a number followed by a letter have the following meanings:<ul id="ul0068" list-style="dash" compact="compact"><li>the alphanumeric numberings having the same number relate to the same family of sequences attached to the reference sequence SEQ ID whose numbering presents this same number and the letter A;</li><li>the letters A, B and C for the same family of sequences distinguish the three possible reading phases of the nucleotide sequence SEQ ID reference (A);</li><li>the letters indexed by a premium (') mean that the sequence corresponds to a fragment of the sequence SEQ ID reference (A);</li><li>the letter D signifies that the sequence corresponds to the sequence of the gene predicted by Cole et al., 1998;</li><li>the letter F means that the sequence corresponds to the open reading frame phase (ORF) containing the corresponding sponding sequence “D” according to Cole et al., 1998;</li><li>the letter G signifies that the sequence is a sequence predicted by Cole et al., 1998, and having more than 70% homology with the sequence SEQ ID reference (A);</li><li>the letter H signifies that the sequence corresponds to the open reading phase containing the corresponding “G” sequence according to Cole et al., 1998;</li><li>the letter R signifies that the sequence corresponds to a sequence predicted by Cole et al., 1998, upstream from the corresponding “D” sequence and which may be in phase with the “D” sequence due to possible sequencing errors;</li><li>the letter P signifies that the sequence corresponds to the open reading phase containing the corresponding “R” sequence;</li><li>the letter Q signifies that the sequence corresponds to a sequence containing the corresponding “F” and “P” sequences.</li></ul>

As regards the family of sequences SEQ ID N ° 4, the preceding insert <i>phoA</i> contains two non-contiguous fragments on the genome, SEQ ID 4J and SEQ ID 4A, and therefore derived from multiple cloning allowing the expression and export of <i>phoA.</i> These two non-contiguous fragments, the genes and the open reading phases which contain them according to Cole et al., 1998, are important for the export of an antigen polypeptide:<ul id="ul0069" list-style="dash" compact="compact"><li>the letters J, K and L distinguish the three possible reading phases from the corresponding “J” nucleotide sequence;</li><li>the letter M signifies that the sequence corresponds to the sequence predicted by Cole et al., 1998, and containing the sequence SEQ ID No. 4J;</li><li>the letter N signifies that the sequence corresponds to the open reading phase containing the sequence SEQ ID No. 4M.</li></ul>

As regards the family of sequences SEQ ID No. 45, the letter Z signifies that the sequence corresponds to the sequence of a cloned fragment fused with <i>phoA.</i>

Finally, with regard to the sequence family SEQ ID No. 41, the letter S signifies that the sequence corresponds to a sequence predicted by Cole et al., 1998 and which may be in the same reading phase as the sequence "D" corresponding, the letter T signifying that the corresponding sequence contains the corresponding “F” and “S” sequences.

<u style="single">EXAMPLES</u>

Material and methods

Bacterial cultures, plasmids and culture media

<i>E. coli</i> was grown on Luria-Bertani (LB) liquid or solid medium. <i>M. smegmatis</i> was grown on Middlebrook 7H9 liquid medium (Difco) supplemented with dextrose albumin (ADC), 0.2% glycerol and 0.05% Tween, or on solid medium L. If necessary, the antibiotic kanamycin was added to a concentration of 20 µg / ml- 1. The bacterial clones exhibiting PhoA activity were detected on LB agar containing 5-bromo-4-chloro-3-indolyle phosphate (XP, at 40 µg / ml^-1).

DNA manipulation and sequencing

DNA manipulations and Southern blot analyzes were performed using standard techniques (Sambrook et al., 1989). The double brown DNA sequences were determined with a Taq Dye Deoxy Terminator Cycle sequencing kit (Applied Biosystems), in a 9600 GeneAmp PCR System (Perkin-Elmer), and after migration on a model 373 DNA analysis system ( Applied Biosystems).

Plasmid constructs

The plasmid pJVED_at was constructed from pLA71, a transfer plasmid containing the gene <i>phoA</i> truncated and placed in phase with <i>BlaF.</i> pLA71 was cut with restriction enzymes <i>Kpn</i>I and <i>Not</i>I<i>,</i> thus withdrawing <i>phoA</i> without touching the promoter of <i>BlaF.</i> The gene <i>luc</i> encoding firefly luciferase was amplified from pGEM-<i>luc</i> and a ribosome binding site has been added. <i>phoA</i> was amplified from pJEM11. The amplified fragments were cut with<i>Pst</i>I and ligated together. The oligodeoxynucleotides used are the following:<ul id="ul0070" list-style="none" compact="compact"><li>pPV.luc.Fw: 5'GACTGCTGCAGAAGGAGAAGATCCAAATGG3 '</li><li>luc.Bw: 5'GACTAGCGGCCGCGAATTCGTCGACCTCCGAGG3 '</li><li>pJEM.phoA.Fw: 5'CCGCGGATCCGGATACGTAC3 '</li><li>phoA.Bw: 5'GACTGCTGCAGTTTATTTCAGCCCCAGAGCG3 '.</li></ul>

The fragment thus obtained was amplified using the oligonucleotides complementary to its ends, cut with <i>Kpn</i>I and <i>Not</i>I, and integrated into pLA71 cut with the same enzymes. The resulting construction was electroporated in<i>E</i>. <i>coli</i> DH5α and <i>M. smegmatis</i> mc² 155. A clone <i>M. smegmatis</i> emitting light and exhibiting activity <i>phoA</i> has been selected and called pJVED /<i>blaF.</i> The insert was removed using <i>Bam</i>HI and the construction closed in on itself, thus reconstructing the pJVED_at. In order to obtain the pJVED_{b, c}, the cloning multisite was cut with <i>Sca</i>I and <i>KpnI</i> and closed by removing one (pJVED_b) or two (pJVED_vs) site nucleotides <i>Sna</i>BI<i>.</i> After merging six reading frames were thus obtained. The insert of pJVED /<i>hsp18</i> was obtained by polymerase chain reaction (PCR) of pPM1745 (Servant et al., 1995) using oligonucleotides of the sequence:<ul id="ul0071" list-style="none" compact="compact"><li>18.Fw: 5'GTACCAGTACTGATCACCCGTCTCCCGCAC3 '</li><li>18.Back: AGTCAGGTACCTCGCGGAAGGGGTCAGTGCG3 '.</li></ul>

The product has been cut with <i>Kpn</i>I and <i>ScaI,</i> and ligated to pJVED_at, cut with the same enzymes, leaving pJVED /<i>hsp18.</i>

PJVED /<i>P19kDa</i> and the pJVED /<i>erp</i> were constructed by cutting with <i>Bam</i>HI inserting pExp410 and pExp53 respectively, and inserting them into the site <i>Bam</i>HI of pJVED cloning multisite_at.

Measurement of alkaline phosphatase activity

The presence of activity is detected by the blue color of the colonies growing on a culture medium containing the substrate 5-bromo 4-chloro 3-indolyl phosphate (XP), then the activity can be quantitatively measured more precisely from the as follows:

<i>M. smegmatis</i> were cultured in LB medium supplemented with 0.05% Tween 80 (Aldrich) and kanamycin (20 µg / ml^-1) at 37 ° C for 24 hours. The alkaline phosphatase activity was measured by the method of Brockman and Heppel (Brockman et al., 1968) in a sonicated extract, with p-nitrophenylphosphate as the reaction substrate. The amount of protein was measured by Bio-Rad test. Alkaline phosphatase activity is expressed in arbitrary units (optical density at 420 nm x µg of proteins-¹ x minutes- 1).

Measurement of luciferase activity

<i>M. smegmatis</i> was grown in LB medium supplemented with 0.05% Tween 80 (Aldrich) and kanamycin (20 µg / ml- ¹) at 37 ° C for 24 hours and used in full exponential growth (OD at 600 nm between 0.3 and 0.8). The aliquots of bacterial suspensions were briefly sonicated and the cell extract was used to measure the activity of luciferase. 25 µl of the sonicated extract were mixed with 100 µl of substrate (Promega luciferase test system) automatically in a luminometer and the emitted light expressed in ULR or RLU (Relative Light Units). The bacteria were counted by serial dilutions of the original suspension on LB kanamycin agar medium and the luciferase activity expressed in ULR / μg of bacterial proteins or in ULR / 10³ bacteria.

Construction of genomic banks of

M. tuberculosis

and of

M. bovis-BCG

Banks were obtained using essentially pJVED_ABC previously described.

Preparation of macrophages from the bone marrow and infection with

M

.

smegmatis

recombinants

The macrophages from the bone marrow were prepared as described by Lang et al., 1991. In summary, the cells from the bone marrow were taken from the femur of C57BL / 6 mice aged 6 to 12 weeks (Iffa-Credo, France). The cells in suspension were washed and resuspended in DMEM enriched with 10% fetal calf serum, 10% conditioned L-cell medium and 2 mM glutamine, without antibiotics. 106 cells were seeded on Costar 24-well flat-bottom plates in 1 ml. After four days at 37 ° C in a humid atmosphere with 10% CO2 content, the macrophages were rinsed and reincubated for two to four additional days. The cells of a control well were lysed with 0.1% triton x 100 in water and the nuclei listed. About 5 x 105 adherent cells were counted. For infection,<i>M. smegmatis</i> carrying the various plasmids was cultivated in full exponential phase (DO_600nm between 0.4 and 0.8) and diluted to an OD of 0.1 then 10 times in a medium for macrophage. 1 ml was added to each well and the plates were centrifuged and incubated four hours at 37 ° C. After three washes, the cells were incubated in a medium containing amykacin for two hours. After three new washings, the adherent infected cells were incubated in a macrophage medium overnight. The cells were then lysed in 0.5 ml of lysis buffer (Promega). 100 µl were sonicated and the light emitted was measured over 25 µm. Simultaneously, the bacteria were listed by spreading on L-agar-kanamycin (20 μg / ml^-1). The light emitted is expressed in ULR / 10³ bacteria.

Database analyzes

The nucleotide sequences were compared with EMBL and GenBank using the FASTA algorithm and the protein sequences were analyzed by similarity using the PIR and Swiss Prot databases using the BLAST algorithm.

Example 1

: The pJVED vectors

The pJVED vectors (<figref idref="f0181">Figure 51</figref>) are plasmids carrying a gene <i>phoA</i> truncated from <i>E</i>. <i>coli</i> lacking initiation codon, signal sequence and regulatory sequence. The multiple cloning site (SMC) allows the insertion of fragments of the genes coding for possible exported proteins as well as their regulatory sequences. Therefore, the fusion protein can be produced and exhibit alkaline phosphatase activity if exported. Only in-phase mergers can be productive. Thus, the SMC has been changed so that merges can be obtained in six read phases. Downstream of<i>phoA,</i> the gene <i>luc</i> firefly luciferase has been inserted. The complete gene with the initiation codon but without any promoter having been used should thus be expressed with<i>phoA</i> as in a synthetic operon. A new ribosome binding site has been inserted eight nucleotides upstream of the initiation codon<i>luc.</i> Two transcriptional terminators are present in the pJVED vectors, one upstream of the SMC and a second downstream of <i>luc.</i> These vectors are transfer plasmids <i>E. coli</i>-mycobacterium with a kanamycin resistance gene as a selection marker.

<i>phoA and luc work as in an operon, but export is necessary for phoA activity.</i>

Four plasmids were constructed by inserting DNA fragments of diverse origin into the SMC:<ul id="ul0072" list-style="none" compact="compact"><li>In the first construction named pJVED /<i>blaF</i>, the 1.4 kb fragment comes from the plasmid already described pLA71 (Lim et al., 1995). This fragment from the β-lactamase gene (<i>blaF</i>) of <i>M. fortuitum</i> D216 (Timm et al., 1994) includes the hyperactive mutated promoter, the segment coding for 32 amino acids of the signal sequence and the first 5 amino acids of the mature protein. Thus this construction includes the strongest promoter known in mycobacterium and the elements necessary for the export of the fusion protein.<i>phoA.</i> Therefore, we can expect from this construction a strong light emission and good activity <i>phoA</i> (cf. <figref idref="f0183">figures 53</figref> and <figref idref="f0184">54</figref>).</li><li>In a second construction named pJVED /<i>hsp18</i>, a 1.5 kb fragment was cloned from the plasmid already described pPM1745 (Servant et al., 1995). This fragment includes the nucleotides coding for the first ten amino acids of the 18 kb heat shock protein from<i>Streptomyces albus</i> (heat shock protein 18, HSP 18), the ribosome binding site, the promoter and, upstream, regulatory sites controlling its expression. This protein belongs to the alpha-crystalline family of low molecular weight HSP (Verbon et al., 1992). Its counterpart from<i>Mr. leprae,</i> the 18 kDa antigen is already known to be induced during phagocytosis by a murine macrophage of the cell line J-774 (Dellagostinet al., 1995). Under standard culture conditions, pJVED /<i>hsp18</i>, shows low activity <i>luc</i> and no activity <i>phoA</i> (cf. <figref idref="f0183">figures 53</figref> and <figref idref="f0184">54</figref>).</li><li>In a third construction, named pJVED /<i>P19kDa,</i> the insert from pExp410 (Lim et al., 1995) was cut and cloned in the SMC of pJVED_at. This fragment includes the nucleotides coding for the first 134 amino acids of the protein known to<i>M. tuberculosis</i> 19 kDa and its regulatory sequences. As has been demonstrated, this protein is a glycosylated lipoprotein (Garbe et al., 1993; Herrmann et al., 1996). On the<figref idref="f0183">figures 53</figref> and <figref idref="f0184">54</figref>, we observe, for this construction, a good activity <i>luc</i> corresponding to a strong promoter but the activity <i>phoA</i> is the strongest of the four constructions. The activity<i>phoA</i> high of this fusion protein with a lipoprotein is explained by the fact that it remains attached to the cell wall by its N-terminal end.</li><li>In the fourth and last construction named pJVED /<i>erp</i> the insert comes from pExp53 (Lim et al., 1995) and was cloned into the SMC of pJVED_at. pExp53 is the initial plasmid selected for its activity<i>phoA</i> and containing part of the gene <i>erp</i> of <i>M. tuberculosis</i> which codes for an antigen of 28 kDa. The latter includes the signal sequence, part of the mature protein and, upstream of the initiation codon, the ribosome binding site. The promoter has been mapped. A putative iron box of the type<i>furious</i> is present in this region and frames the promoter's region -35 (Berthet et al., 1995). As expected (<figref idref="f0183">figures 53</figref> and <figref idref="f0184">54</figref>) this construction has good light emission and good activity <i>phoA.</i> The fact that this fusion protein, unlike fusion with the 19 kDa lipoprotein, does not seem to be attached to the cell wall does not exclude that the native protein is associated with it. In addition, the C-terminal end of<i>erp</i> is absent from the fusion protein.</li></ul>

Example 2

: Construction of a genomic DNA library of M. tuberculosis in the pJVED vectors

s

and identification of one of the members of these banks, (DP428), induced during phagocytosis by murine macrophages derived from bone marrow.

The different constructs are tested for their ability to evaluate the intracellular expression of the genes identified by the expression of <i>phoA.</i> With this objective, the activity <i>luc</i> is expressed in URL for 10³ bacteria in axenic culture and / or under intracellular conditions. Induction or repression following phagocytosis by murine macrophages derived from bone marrow can be appropriately assessed by measuring specific activities. The results of two separate experiments are presented in Table 2.

The plasmid pJVED /<i>hsp18</i> was used as a positive control for induction during the intracellular growth phase. Although the induction of the promoter by heating the bacteria to 42 ° C. has not been conclusive, the phagocytosis of the bacteria clearly leads to an increase in the activity of the promoter. In all experiences, the activity<i>luc</i> intracellular activity was strongly induced, increasing the initially weak basal activity by 20 to 100 times (Servant, 1995).

The plasmid pJVED /<i>blaF</i> has been used as a control for nonspecific modulation during phagocytosis. Small variations could be highlighted, probably due to changes in growing conditions. However, these small variations are not comparable to the induction observed with the plasmid pJVED /<i>hsp18.</i>

All members of the DNA bank were tested by measuring the activity of the promoter during intracellular growth. Among them, DP428 is strongly induced during phagocytosis (Tables 1 and 2).<tables id="tabl0001" num="0001"><table frame="all"><title><b>TABLE 1</b></title><tgroup cols="8"><colspec colnum="1" colname="col1" colwidth="25mm" /><colspec colnum="2" colname="col2" colwidth="18mm" colsep="0" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="27mm" /><colspec colnum="5" colname="col5" colwidth="27mm" colsep="0" /><colspec colnum="6" colname="col6" colwidth="25mm" /><colspec colnum="7" colname="col7" colwidth="18mm" colsep="0" /><colspec colnum="8" colname="col8" colwidth="15mm" /><thead><row><entry valign="middle">Construction</entry><entry namest="col2" nameend="col3" align="left" valign="middle">% Recovery</entry><entry valign="middle">URL / 10³ extracellular bacteria</entry><entry namest="col5" nameend="col6" align="left" valign="middle">URL / 10³ intracellular bacteria</entry><entry valign="middle">Induction</entry><entry valign="top" /></row></thead><tbody><row><entry>pJVED /<i>blaF *</i></entry><entry align="char" char=",">0,5</entry>&lt;entry /&gt;<entry align="char" char=",">1460</entry><entry align="char" char=",">1727</entry>&lt;entry /&gt;<entry align="char" char="," charoff="30">1,2</entry><entry align="char" char="," charoff="25" /></row><row><entry>pJVED /<i>hsp18</i></entry><entry align="char" char=",">0,6</entry>&lt;entry /&gt;<entry align="char" char=",">8</entry><entry align="char" char=",">57</entry>&lt;entry /&gt;<entry align="char" char="," charoff="30">7,1</entry>&lt;entry /&gt;</row><row><entry>pJVED /<i>DP428</i></entry><entry align="char" char=",">0,7</entry>&lt;entry /&gt;<entry align="char" char=",">0,06</entry><entry align="char" char=",">18</entry>&lt;entry /&gt;<entry align="char" char="," charoff="30">300</entry>&lt;entry /&gt;</row><row>&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;</row></tbody></tgroup><tgroup cols="8"><colspec colnum="1" colname="col1" colwidth="25mm" /><colspec colnum="2" colname="col2" colwidth="18mm" colsep="0" /><colspec colnum="3" colname="col3" colwidth="15mm" /><colspec colnum="4" colname="col4" colwidth="27mm" /><colspec colnum="5" colname="col5" colwidth="27mm" colsep="0" /><colspec colnum="6" colname="col6" colwidth="25mm" /><colspec colnum="7" colname="col7" colwidth="18mm" colsep="0" /><colspec colnum="8" colname="col8" colwidth="15mm" /><thead><row rowsep="0" valign="middle"><entry morerows="1" rowsep="1">Construction</entry><entry namest="col2" nameend="col3" align="left">% Recovery</entry><entry morerows="1" rowsep="1">URL / 10³ extracellular bacteria</entry><entry namest="col5" nameend="col6" align="left">URL / 10³ intracellular bacteria</entry><entry>Induction</entry>&lt;entry /&gt;</row><row valign="middle"><entry>C57BL / 6</entry><entry>Balb / C</entry><entry>C57BL / 6</entry><entry>Balb / C</entry><entry>C57BL / 6</entry><entry>Balb / C</entry></row></thead><tbody><row><entry>pJVED /<i>blaF</i>*</entry><entry align="char" char=",">7</entry><entry align="char" char="," charoff="13">1,1</entry><entry align="char" char=",">662</entry><entry align="char" char=",">250</entry><entry align="char" char="," charoff="22">911</entry><entry align="char" char="," charoff="30">0,4</entry><entry align="char" char="," charoff="25">1,4</entry></row><row><entry>pJVED /<i>hsp18</i></entry><entry align="char" char=",">6,7</entry><entry align="char" char="," charoff="13">1,7</entry><entry align="char" char=",">164</entry><entry align="char" char=",">261</entry><entry align="char" char="," charoff="22">325</entry><entry align="char" char="," charoff="30">1,6</entry><entry align="char" char="," charoff="25">2</entry></row><row><entry>pJVED /<i>DP428</i></entry><entry align="char" char=",">1,6</entry><entry align="char" char="," charoff="13">2,1</entry><entry align="char" char=",">0,08</entry><entry align="char" char=",">1,25</entry><entry align="char" char="," charoff="22">3,3</entry><entry align="char" char="," charoff="30">15,6</entry><entry align="char" char="," charoff="25">41</entry></row></tbody></tgroup></table></tables><tables id="tabl0002" num="0002"><table frame="all"><title><b>TABLE 2</b></title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="27mm" /><colspec colnum="2" colname="col2" colwidth="28mm" /><colspec colnum="3" colname="col3" colwidth="46mm" /><colspec colnum="4" colname="col4" colwidth="48mm" /><colspec colnum="5" colname="col5" colwidth="18mm" /><thead><row><entry valign="middle">Construction</entry><entry valign="middle">% Recovery</entry><entry valign="middle">URL / 10³ extracellular bacteria</entry><entry valign="middle">URL / 10³ intracellular bacteria</entry><entry valign="middle">Induction</entry></row></thead><tbody><row><entry>pJVED /<i>blaF *</i></entry><entry align="char" char="," charoff="13">22</entry><entry align="char" char=",">1477</entry><entry align="char" char=",">367</entry><entry align="char" char="," charoff="20">0,25</entry></row><row><entry>pJVED /<i>hsp18</i></entry><entry align="char" char="," charoff="13">7</entry><entry align="char" char=",">0,26</entry><entry align="char" char=",">6,8</entry><entry align="char" char="," charoff="20">26</entry></row><row><entry>pJVED /<i>DP428</i></entry><entry align="char" char="," charoff="13">21</entry><entry align="char" char=",">0,14</entry><entry align="char" char=",">4</entry><entry align="char" char="," charoff="20">28</entry></row></tbody></tgroup></table></tables>

The nucleotide fragment coding for the N-terminal region of the polypeptide DP428 of sequence SEQ ID No. 28 is contained in the plasmid deposited at the CNCM under No. I-1818.

The entire sequence coding for the DP428 polypeptide was obtained as detailed below.

A probe was obtained by PCR using the oligonucleotides of sequence SEQ ID No. 25 and SEQ ID No. 26. This probe was labeled by random extension in the presence of ³²P dCTP. Hybridization of genomic DNA from<i>M. tuberculosis</i> strain Mt103 previously digested with the Sca1 endonuclease was carried out using said probe. The hybridization results revealed that a DNA fragment of about 1.7 kb was labeled. Due to the fact that there is a Sca1 site extending from nucleotide nt 984 to nucleotide nt 989 of the sequence SEQ ID No. 1, that is to say on the 5 ′ side of the sequence used as probe, the end of the coding sequence is necessarily present in the fragment detected by hybridization.

The genomic DNA of the Mt 103 strain of <i>M. tuberculosis,</i> after digestion with Sca1, underwent migration on an agarose gel. The fragments of sizes between 1.6 and 1.8 kb were cloned into the vector pSL1180 (Pharmacia) previously cleaved by Sca1 and dephosphorylated. After transformation of<i>E. coli</i> with the resulting recombinant vectors, the colonies obtained were screened using the probe. The screening made it possible to isolate six colonies hybridizing with this probe.

The inserts contained in the plasmids of the previously selected recombinant clones were sequenced, then the sequences aligned so as to determine the entire sequence coding for DP428, more specifically SEQ ID No. 2.

A pair of primers was synthesized in order to amplify, from the genomic DNA of <i>M. tuberculosis,</i> strain Mt 103, the entire sequence coding for the polypeptide DP428. The amplicon obtained was cloned into an expression vector.

Couples of primers suitable for amplification and cloning of the sequence coding for the DP428 polypeptide can be easily carried out by a person skilled in the art, on the basis of the nucleotide sequences SEQ ID No. 1 and SEQ ID No. 2.

A particular pair of primers according to the invention is the following pair of primers, capable of amplifying the DNA coding for the DP428 polypeptide lacking its signal sequence:<ul id="ul0073" list-style="dash" compact="compact"><li>Primer go (SEQ ID N ° 29), comprising the sequence going from the nucleotide in position nt 1021 to the nucleotide nt 1044 of the sequence SEQ ID N ° 2:<ul id="ul0074" list-style="none" compact="compact"><li>5 '-AGTGCAT<b><u style="single">GCTGCTGGCCGAACCATCAGCGAC</u></b>- 3'</li></ul></li><li>Return primer (SEQ ID No. 30), comprising the sequence complementary to the sequence going from the nucleotide at position nt 1345 to the nucleotide at position nt 1325 of the sequence SEQ ID No. 2:<ul id="ul0075" list-style="none" compact="compact"><li>5'-CAGCCAGATCT<b><u style="single">GCGGGCGCCCTGCACCGCCTG</u></b>- 3',</li></ul></li></ul>in which the underlined part represents the sequences hybridizing specifically with the sequence SEQ ID No. 2 and the 5 ′ ends correspond to restriction sites for the cloning of the resulting amplicon in a cloning and / or expression vector.

A particular vector used for the expression of the DP428 polypeptide is the vector pQE70 sold by the company Qiagen.

Example 3

: The complete gene sequence

DP428

and its flanking regions

A probe of the coding region of DP428 was obtained by PCR, and used to hybridize the genomic DNA of different species of mycobacteria. Based on the results of the<figref idref="f0007 f0008">figure 3</figref>, the gene is present only in mycobacteria of the complex of <i>M. tuberculosis.</i>

Analysis of the sequence suggests that DP428 may be part of an operon. The coding sequence and the flanking regions show no homology with known sequences deposited in the databases.

According to the coding sequence, this gene codes for a 10 kDa protein with a signal peptide, a hydrophobic C-terminal end terminated by two arginines and preceded by an LPISG motif similar to the known motif LPXTG. These two arginines could correspond to a retention signal and the DP428 protein could be hooked by this motif to peptidoglycans as has already been described in other Gram bacteria.⁺ (Navarre et al., 1994 and 1996).

The mechanism of survival and intracellular growth of mycobacteria is complex and the intimate relationships between the bacteria and the host cell remain unexplained. Whatever the mechanism, the intracellular growth and survival of mycrobacteria depends on factors produced by the bacteria and capable of modulating the host response. These factors can be molecules exposed to the cell surface such as LAM or proteins associated with the cell surface, or actively secreted molecules.

On the other hand, intracellularly, the bacteria themselves have to deal with a hostile environment. They seem to respond to it by means close to those used under stress conditions, by the induction of heat shock proteins (Dellagostin et al., 1995), but also by induction or repression of different proteins (Lee and al., 1995). Using a methodology derived from PCR, Plum and Clark-curtiss (Plum et al., 1994) have shown that a gene for<i>M. avium</i> included in a 3 kb DNA fragment, is induced after phagocytosis by human macrophages. This gene codes for an exported protein comprising a leader sequence but having no significant homology with the sequences proposed by the databases. Induction during the intracellular growth phase of a low molecular weight heat shock protein from<i>M</i>. <i>leprae</i> has also been highlighted (Dellagostin et al., 1995). In another study, bacterial proteins from<i>M. tuberculosis</i> were metabolically labeled during the intracellular growth phase or under stress conditions and separated by two-dimensional gel electrophoresis: 16 proteins <i>M. tuberculosis</i> were induced and 28 suppressed. The same proteins are involved during stress caused by low pH, thermal shock, H₂O₂, or during phagocytosis by human monocytes of the THP1 line. In any case, the behavior of the induced and repressed proteins was unique in each condition (Lee et al., 1995). Taken together, these results indicate that a subtle molecular dialogue is taking place between bacteria and their cellular hosts. The fate of the intracellular organism probably depends on this dialogue.

In this context, the induction of expression of DP428 could be of major importance, indicating an important role of this protein in survival and intracellular growth.

The method used in these experiments to evaluate the intracellular expression of genes (cf. Jacobs et al., 1993, for the method of determining the expression of firefly luciferase, and Lim et al., 1995, for the method for determining gene expression <i>PhoA)</i> has the advantage of being simple compared to other techniques such as the technique described by Mahan et al. (Mahan et al., 1993) adapted to mycobacteria and proposed by Bange et al. (Bange et al., 1996), or the PCR-based substractive method described by Plum and Clark-curtiss (Plum et al., 1994). There is undoubtedly a variability as shown by the comparison of different experiences. Although inducing induction or repression is sufficient, it is now possible to assess it, thus providing an additional tool for physiological studies of the exported proteins identified by fusion with <i>phoA.</i>

Example 4:

Search for modulation of promoter activity during intramacrophagic phases.

Mouse bone marrow macrophages are prepared as described by Lang and Antoine (Lang et al., 1991). Bacteria<i>M. segmentis</i> recombinants, whose luciferase activity has been determined by 10³ bacteria as above, are incubated at 37 ° C in a humidified atmosphere enriched in CO₂ at 5%, for 4 hours in the presence of these macrophages so that they are phagocytosed. After rinsing to remove the remaining extracellular bacteria, amikacin (100 μg / ml) is added to the culture medium for two hours. After a further rinsing, the medium is replaced by a culture medium (DMEM enriched with 10% calf serum and 2 mM glutamine) without antibiotics. After an overnight incubation as above, the macrophages are lysed cold (4 ° C.) using a lysis buffer (cee lysis buffer, Promega), and the luciferase activity by 10³ bacteria determined. The ratio of activities to cultivation and after one night gives the induction coefficient.

Example 5:

Isolation of a series of sequences by sequencing directly from the colonies.

A series of sequences allowing the expression and the export of <i>phoA</i> were isolated from the DNA of <i>M. Tuberculosis</i> or from <i>Mr. Bovis</i> BCG. Among this group of sequences, two of them were further studied, the whole genes corresponding to the inserts were cloned, sequenced, and antibodies against the product of these genes were used to show by electron microscopy that these genes coded for antigens found on the surface of the tuberculosis bacilli. One of these genes<i>erp</i> coding for a consensus export signal sequence, the other <i>of</i> had no characteristic of a gene encoding an exported protein, according to the sequence. Another DP428 gene was sequenced before the genome sequence of<i>M. Tuberculosis</i> is not available. It contains a sequence resembling the consensus sequence of attachment to peptidoglycan, which suggests that it is also an antigen probably found on the surface of the tuberculosis bacilli. The study of the three genes<i>erp, of,</i> and the one coding for DP428 shows that the system <i>phoA</i> that we have developed in mycobacteria makes it possible to locate genes coding for exported proteins without determinable determinant by studies <i>in silico.</i> This is particularly true for polypeptides that do not have a consensus signal sequence <i>(of)</i> or not similarity with proteins of known function <i>(erp</i> and <i>DP428).</i>

A number of inserts have been identified and sequenced before knowledge of the genome of <i>M. Tuberculosis,</i> others after. These sequences can be considered as primers making it possible to search for genes coding for exported proteins. To date, a series of primers have been sequenced and the corresponding whole genes have either been sequenced or identified from the published genome sequence. To account for the always possible sequencing errors, the regions upstream or downstream of certain primers were considered as being able to be part of sequences coding for exported proteins. In some cases similarities with genes encoding exported proteins or characteristic sequences of export signals or topological characteristics of membrane proteins have been detected.

Primer sequences appear to correspond to genes belonging to gene families having more than 50% similarity. It can thus be indicated that the other genes detected by similarity with a primer code for exported proteins. This is the case for the sequence SEQ ID No. 8G and SEQ ID No. 8H having more than 77% similarity to SEQ ID No. 8A '.

The sequences which can code for exported proteins are the following: SEQ ID N ° 1, 8, 9, 8G, 8H, 13, 3, 10, 19, 20, 6, 16, 22, 23, 24, 39, 44, 46, and 50.

Genes identified from primers from the genome sequence have no characteristic (from the sequence) of exported proteins. These are the following sequences: SEQ ID N ° 4, 27, 11, 12, 14, 7, 15, 17, 18, 21, 31, 32, 33, 34, 35, 36, 37, 38, 40, 41, 42, 43, 45, 47, 48, and 49.

According to the sequence of other organisms like <i>E. coli,</i> we can search in the genome sequence of <i>M. tuberculosis,</i> genes with similarities to proteins known to be exported to other organisms, although they lack an export signal sequence. In this case a merger with<i>phoA</i> is an advantageous protocol for determining whether these sequences of <i>M. tuberculosis</i> encode exported proteins although they lack a consensus signal sequence. It was indeed possible to clone SEQ ID No. 49, a sequence similar to a gene for<i>E. coli</i> of the family <i>htrA.</i> A merger of SEQ ID N ° 49 with <i>phoA</i> leads to the expression and export of <i>phoA.</i> Colonies <i>M. smegmatis</i> hosting a SEQ ID N ° 49 merger <i>phoA</i> on a plasmid pJVED are blue.

SEQ ID N ° 49 is therefore considered as an exported protein.

The method <i>phoA</i> is therefore useful for detecting from the sequence of <i>M</i>. <i>Tuberculosis</i> genes coding for exported proteins without coding for sequences characteristic of the exported proteins.

Even if a sequence has determinants of exported proteins, this does not demonstrate a functional export. The system<i>phoA</i> shows that the suspected gene actually codes for an exported protein.

Thus, it was verified that the sequence SEQ ID No. 50 did indeed have export signals.<tables id="tabl0003" num="0003"><table frame="all"><title><b>TABLE 3</b></title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="30mm" /><colspec colnum="2" colname="col2" colwidth="63mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="63mm" /><thead><row><entry align="center" valign="middle">SEQ ID NO</entry><entry align="center" valign="middle">Reference of the corresponding sequence predicted by Cole et al.</entry><entry align="center" valign="middle" /><entry align="center" valign="middle">Annotation</entry></row></thead><tbody><row valign="middle"><entry>SEQ ID N ° 1</entry><entry>Rv 0203</entry><entry>*</entry><entry>Hydrophobic sequence in N-terminal</entry></row><row valign="middle"><entry>SEQ ID N ° 4 SEQ ID N ° 27</entry><entry>Rv 2050</entry>&lt;entry /&gt;<entry>No prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 8 SEQ ID N ° 9</entry><entry>Rv 2563</entry><entry>*</entry><entry>Membrane protein</entry></row><row valign="middle"><entry>SEQ ID N ° 8G ', H'</entry><entry>Rv 0072</entry><entry>*</entry><entry>Possible ABC transmembrane transport protein</entry></row><row valign="middle"><entry>SEQ ID N ° 11</entry><entry>Rv 0546c</entry><entry>ML</entry><entry>ProteinS-D Lactoyl Glutathione-methyl glyoxal lyase</entry></row><row valign="middle"><entry>SEQ ID N ° 12</entry><entry>no prediction</entry>&lt;entry /&gt;<entry>not found in <i>M.tuberculosis</i> H37rv</entry></row><row rowsep="0" valign="middle"><entry>SEQ ID N ° 13</entry>&lt;entry /&gt;&lt;entry /&gt;<entry morerows="2" rowsep="1">probable cutinase precursor with an N-terminal signal sequence</entry></row><row rowsep="0" valign="middle"><entry>SEQ ID N ° 3</entry><entry>Rv 1984c</entry><entry>*</entry></row><row valign="middle"><entry>SEQ ID N ° 10</entry>&lt;entry /&gt;&lt;entry /&gt;</row><row valign="middle"><entry>SEQ ID N ° 14 SEQ ID N ° 7</entry><entry>no prediction</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 15</entry><entry>with reading offset, could be in phase with Rv 2530c</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 17</entry><entry>Rv 1303</entry><entry>ML</entry><entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 18</entry><entry>Rv 0199</entry><entry>ML</entry><entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 19</entry><entry>Rv 0418</entry><entry>*</entry><entry>prokaryotic membrane lipoprotein binding site, similarity to N-acetyl puromycyne acetyl hydrolase</entry></row><row rowsep="0" valign="middle"><entry>SEQ ID N ° 20</entry><entry morerows="1" rowsep="1">Rv 3576</entry><entry morerows="1" rowsep="1">*</entry><entry morerows="1" rowsep="1">contains a prokaryotic membrane lipoprotein binding site, similarity to a serine / threonine protein kinase</entry></row><row valign="middle"><entry>SEQ ID N ° 6</entry></row><row valign="middle"><entry>SEQ ID N ° 21</entry><entry>Rv 3365c</entry><entry>ML</entry><entry>similarity to a zinc metallo peptidase</entry></row><row valign="middle"><entry>SEQ ID N ° 31</entry><entry>not predicted</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle">&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;</row><row valign="middle"><entry>SEQ ID N ° 32</entry><entry>Rv 0822c</entry><entry>ML</entry><entry>Existence of a consensus region with the Drac family</entry></row><row valign="middle"><entry>SEQ ID N ° 33</entry><entry>Rv 1044</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 34</entry><entry>not predicted</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 35</entry><entry>Rv 2169c</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 36</entry><entry>Rv 3909</entry><entry>ML</entry><entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 37</entry><entry>Rv 2753c</entry>&lt;entry /&gt;<entry>similarity to dihydropricolinate synthases</entry></row><row valign="middle"><entry>SEQ ID N ° 38</entry><entry>Rv 0175</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 39</entry><entry>Rv 3006</entry><entry>* ML</entry><entry>lipoprotein signal sequence prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 40</entry><entry>Rv 0549c</entry>&lt;entry /&gt;<entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 41</entry><entry>Rv 2975c can be in phase with Rv 2974c</entry>&lt;entry /&gt;<entry>similarity to substilis protein</entry></row><row valign="middle"><entry>SEQ ID N ° 42</entry><entry>Rv 2622</entry>&lt;entry /&gt;<entry>similarity to methyl transferase</entry></row><row valign="middle"><entry>SEQ ID N ° 43</entry><entry>Rv 3278c</entry><entry>ML</entry><entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 44</entry><entry>Rv 0309</entry><entry>*</entry><entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 45</entry><entry>Rv 2169c</entry><entry>ML</entry><entry>no prediction</entry></row><row valign="middle"><entry>SEQ ID N ° 46</entry><entry>Rv 1411c</entry><entry>*</entry><entry>probable lipoprotein with an N-terminal signal sequence</entry></row><row valign="middle"><entry>SEQ ID N ° 47</entry><entry>Rv 1714</entry>&lt;entry /&gt;<entry>similarity to a gluconate 3-dehydrogenase</entry></row><row valign="middle"><entry>SEQ ID N ° 48</entry><entry>Rv 0331</entry>&lt;entry /&gt;<entry>similarity to a sulfide dehydrogenase and a sulfide quinone reductase</entry></row><row valign="middle"><entry>SEQ ID N ° 49</entry><entry>Rv 0983</entry><entry>ML</entry><entry>Similarity to a serine protease HtrA</entry></row><row valign="middle"><entry>SEQ ID N ° 5</entry>&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;</row><row valign="middle"><entry>SEQ ID N ° 16</entry><entry>Rv 3810</entry><entry>* ML</entry><entry>Surface protein Berthelet et al. 1995</entry></row><row rowsep="0" valign="middle"><entry>SEQ ID N ° 22</entry>&lt;entry /&gt;<entry morerows="2" rowsep="1">*</entry><entry morerows="2" rowsep="1">Contains a eukaryotic membrane lipoprotein binding site</entry></row><row rowsep="0" valign="middle"><entry>SEQ ID N ° 23</entry><entry>Rv 3763</entry></row><row valign="middle"><entry>SEQ ID N ° 24</entry>&lt;entry /&gt;</row><row valign="middle"><entry>SEQ ID N ° 50</entry><entry>Rv 0125</entry><entry>*</entry><entry>Active site of serine proteases Possible N-terminal signal sequence</entry></row></tbody></tgroup><tgroup cols="4" rowsep="0"><colspec colnum="1" colname="col1" colwidth="30mm" /><colspec colnum="2" colname="col2" colwidth="63mm" /><colspec colnum="3" colname="col3" colwidth="11mm" /><colspec colnum="4" colname="col4" colwidth="63mm" /><tbody><row><entry namest="col1" nameend="col4" align="justify">Legend of table 3: Correspondence of the sequences according to the invention with the sequences predicted by <nplcit id="ncit0004" npl-type="s"><text>Cole et al. 1998, Nature, 393, 537-544</text></nplcit>. *: Prediction that the protein encoded by the sequence will be exported. ML: Prediction of similarity with <i>M. leprae.</i></entry></row></tbody></tgroup></table></tables>

Example 6:

Characteristics and production of the protein M1C25

The N-terminus of the M1C25 protein has been detected by the system <i>PhoA</i> as allowing the export of the fusion protein, necessary for obtaining its phosphatase activity.

The DNA sequence coding for the N-terminus of the protein M1C25 is contained in the sequence SEQ ID No. 20 of the present patent application.

From this primer sequence, the complete gene coding for the protein M1C25 was sought in the genome of <i>M. tuberculosis</i> (Welcome Trust Foundation, Sanger site).

The Sanger center has assigned the names to M1C25:<ul id="ul0076" list-style="none" compact="compact"><li>Rv3576,</li><li>MTCY06G11.23,</li><li>pknM.</li></ul>

Sequence ID SEQ No. 29 of the complete gene M1C25 (714 bases)

: cf. Figure 29

This gene codes for a protein of 237 AA, of 25 kDa of molar mass. This protein is referenced in banks under the names:<ul id="ul0077" list-style="none" compact="compact"><li>PID: e306716,</li><li>SPTREMBL: P96858</li></ul>

Sequence SEQ ID N ° 30 of the protein M1C25 (237 amino acids)

: cf. Figure 30

M1C25 contains a site for attachment to the lipid part of the prokaryotic membrane lipoproteins (PS00013 Prokaryotic membrane lipoprotein lipid attachment site:<ul id="ul0078" list-style="none" compact="compact"><li>CTGGTCGGTG CGTGCATGCT CGCAGCCGGA TGC).</li></ul>

The function of M1C25 is not certain but it most probably has a "serine / threonine-protein kinase" activity. Similarities should be noted with the terminal C-half of K08G_MYCTU Q11053 Rv1266c (MTCY50.16). Similarities are also found with KY28_MYCTU.

5 'from the gene coding for M1C25 is a gene potentially coding for a regulatory protein (PID: e306715, SPTREMBL: P96857, Rv3575c, (MTCY06G11.22c)).

The hydrophobicity profile (Kyte and Doolitle) of M1C25 is shown in <figref idref="f0185">figure 56</figref>.

A signal sequence cleavage site is predicted (SignalP V1.1; World Wide Web Prediction Server, Center for Biological Sequence Analysis) between amino acids 31 and 32: AVA-AD. This cutting site is behind a classic “AXA” motif. This prediction is compatible with the hydrophobicity profile. In this potential signal sequence it should be noted the three-fold repetition of the sequence of the three LAA amino acids. Cloning of the M1C25 gene for the production of the protein which it codes for:<ul id="ul0079" list-style="none" compact="compact"><li>A pair of primers was synthesized in order to amplify, from the genomic DNA of M. tuberculosis, strain H37Rv, the entire sequence coding for the polypeptide M1C25. The amplicon obtained was cloned into an expression vector.</li><li>Couples of primers suitable for amplification and cloning of the sequence coding for M1C25 have been synthesized:</li></ul><ul id="ul0080" list-style="dash" compact="compact"><li>primer go:<ul id="ul0081" list-style="none" compact="compact"><li>5 '-ATAATACCA<u style="single">TGGGCAAGCAGCTAGCCGCGC</u>- 3'</li></ul></li><li>return primer:<ul id="ul0082" list-style="none" compact="compact"><li>5 '-ATTTATAGATCT<u style="single">CTGCTTAGCAACCTTGGCCGCG</u>- 3'</li></ul></li></ul>

The underlined part represents the sequences hybridizing specifically with the M1C25 sequence and the 5 ′ ends correspond to restriction sites for the cloning of the resulting amplicon in a cloning and / or expression vector.

A particular vector used for the expression of the M1C25 polypeptide is the vector pQE60 sold by the company Qiagen, following the protocol and the recommendations proposed by this brand.

The cells used for cloning are bacteria: <i>E. coli</i> XL1-Blue (tetracycline resistant).

The cells used for expression are bacteria: <i>E. coli</i> M15 (kanamycin resistant) containing the plasmid pRep4 (M15 pRep4).

The production of the MC25 protein is illustrated by the <figref idref="f0185">Figures 57 A and B</figref> (Bacterial extracts of the E. coli M15 strain containing the plasmid pM1C25). The bacterial cultures and the extracts are prepared according to Sambrook et al. (1989). The analysis of Bacrarian extracts is carried out according to the instructions of Quiagen (1997).

Bibliographic references

<ul id="ul0083" list-style="none" compact="compact"><li><nplcit id="ncit0005" npl-type="s"><text>AIDS therapies, 1993, in Mycobacterial infections, ISBN 0-9631698-1-5, pp. 1-11</text></nplcit>.</li><li><nplcit id="ncit0006" npl-type="s"><text>Altschul, SF et al., 1990, J. Mol. Biol., 215: 403-410</text></nplcit>.</li><li><nplcit id="ncit0007" npl-type="s"><text>Andersen, P. et al., 1991, Infect. Immun., 59: 1905-1910</text></nplcit>.</li><li><nplcit id="ncit0008" npl-type="s"><text>Andersen, P. et al., 1995, J. Immunol., 154, 3359-3372</text></nplcit>.</li><li><nplcit id="ncit0009" npl-type="s"><text>Bange, FC, AM Brown, and WR Jacobs JR., 1996, Leucine auxotrophy restricts growth of Mycobacterium bovis BCG in macrophages. Infect. Immun., 64: 1794-1799</text></nplcit>.</li><li><nplcit id="ncit0010" npl-type="s"><text>Barany, F., 1911, Proc. Natl. Acad. Sci. USA, 88: 189-193</text></nplcit>.</li><li><nplcit id="ncit0011" npl-type="s"><text>Bates, J. et al., 1986, Am. Rev. Breathe. Dis., 134: 415-417</text></nplcit>.</li><li><nplcit id="ncit0012" npl-type="s"><text>Bates, J. 1979. Chest. 76 (Suppl.): 757-763</text></nplcit>.</li><li><nplcit id="ncit0013" npl-type="s"><text>Bates, J. et al. 1986. Am. Rev. Breathe. Say. 134: 415-417</text></nplcit>.</li><li><nplcit id="ncit0014" npl-type="s"><text>Berthet, FX, J. Rauzier, EM Lim, W. Philipp, B. Gicquel, and D. Portnoï, 1995, Characterization of the M. tuberculosis erp gene encoding a potential cell surface protein with repetitive structures. Microbiology. In press</text></nplcit></li><li><nplcit id="ncit0015" npl-type="s"><text>Borremans, M. et al., 1989, Biochemistry, 7: 3123-3130</text></nplcit>.</li><li><nplcit id="ncit0016" npl-type="s"><text>Bouvet, E. 1994. Rev. Fr. Lab. 273: 53-56</text></nplcit>.</li><li><nplcit id="ncit0017" npl-type="s"><text>Brockman, RW and Heppel LA, 1968, On the localization of alkaline phosphatase and cyclic phosphodiesterase in Escherichia coli, Biochemistry, 7: 2554-2561</text></nplcit>.</li><li><nplcit id="ncit0018" npl-type="s"><text>Burg, JL et al., 1996, Mol. and Cell. Probes, 10: 257-271</text></nplcit>.</li><li><nplcit id="ncit0019" npl-type="s"><text>Chevrier, D. et al., 1993, Mol. and Cell. Probes, 7: 187-197</text></nplcit>.</li><li><nplcit id="ncit0020" npl-type="s"><text>Clemens, DL, 1996, Characterization of the Mycobacterium tuberculosis phagosome, Trends Microbiol., 4: 113-118</text></nplcit>.</li><li><nplcit id="ncit0021" npl-type="s"><text>Chu, BCF et al., 1986, Nucleic Acids Res., 14: 5591-5603</text></nplcit>.</li><li><nplcit id="ncit0022" npl-type="s"><text>Clemens, DL and Horwitz MA, 1995, Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited, J. Exp. Med., 181: 257-270</text></nplcit>.</li><li><nplcit id="ncit0023" npl-type="s"><text>Colignon JE, 1996. Immumologic studies in humans. Measurement of proliferative responses of culturered lymphocytes. Current Protocols in Immunology, NIH, 2, Section II</text></nplcit>.</li><li><nplcit id="ncit0024" npl-type="s"><text>Daniel, TM et al. 1987. Am. Rev. Breathe. Dis., 135: 1137-1151</text></nplcit>).</li><li><nplcit id="ncit0025" npl-type="s"><text>Dellagostin, OA, Esposito G., Eales L.-J., Dale JW and. McFadden JJ, 1995, Activity of mycobacterial promoters during intracellular and extracellular growth. Microbiol., 141: 2123-2130</text></nplcit>.</li><li><nplcit id="ncit0026" npl-type="s"><text>Drake, TA et al. 1987. J. Clin. Mocrobiol. 25: 1442-1445</text></nplcit>.</li><li><nplcit id="ncit0027" npl-type="s"><text>Dramsi et al., 1997, Infection and Immunity, 65, 5: 1615-1625</text></nplcit>.</li><li><nplcit id="ncit0028" npl-type="s"><text>Duck, P. et al., 1990, Biotechniques, 9: 142-147</text></nplcit>.</li><li><nplcit id="ncit0029" npl-type="b"><text>Erlich, HA 1989. In PCR Technology. Principles and Applications for DNA Amplification. New York: Stockton Press</text></nplcit>.</li><li><nplcit id="ncit0030" npl-type="s"><text>Felgner et al., 1987, Proc. Natl. Acad. Sci., 84: 7413</text></nplcit>.</li><li><nplcit id="ncit0031" npl-type="s"><text>Fraley et al., 1980, J. Biol. Chem., 255: 10431</text></nplcit>.</li><li><nplcit id="ncit0032" npl-type="s"><text>Gaillard, JL, Berche P., Frehel C., Gouin E. and Cossart P., 1991, Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from Gram-positive cocci, Cell., 65: 1127-1141</text></nplcit>.</li><li><nplcit id="ncit0033" npl-type="s"><text>Garbe, T., Harris D., Vordermeir M., Lathigra R., Ivanyi J. and Young D., 1993, Expression of the Mycobacterium tuberculosis 19-kilodalton antigen in Mycobacterium smegmatis: immunological analysis and evidence of glycosylation, Infect. Immun., 61: 260-267</text></nplcit>.</li><li><nplcit id="ncit0034" npl-type="s"><text>Guateli, JC et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 1874-1878</text></nplcit>.</li><li><nplcit id="ncit0035" npl-type="s"><text>Harboe et al., 1996, Infect. Immun., 64, 16-22</text></nplcit>.</li><li><nplcit id="ncit0036" npl-type="s"><text>Herrmann, JL, O'Gaora P., Gallagher A., ​​Thole JER and Young DB, 1996, Bacterial glycoproteins: a link between glycosylation and proteolytic cleavage of a 19 kDa antigen from Mycobacterium tuberculosis, EMBO J. 15: 3547-3554</text></nplcit>.</li><li><nplcit id="ncit0037" npl-type="b"><text>Houbenweyl, 1974, in Meuthode der Organischen Chemie, E. Wunsch Ed., Volume 15-I and 15-II, Thieme, Stuttgart</text></nplcit>.</li><li><nplcit id="ncit0038" npl-type="s"><text>Huygen, K. et al., 1996, Nature Medicine, 2 (8): 893-898</text></nplcit>.</li><li><nplcit id="ncit0039" npl-type="b"><text>Innis, MA et al. 1990. in PCR Protocols. A guide to Methods and Apllications. San Diego: Academic Press</text></nplcit>.</li><li><nplcit id="ncit0040" npl-type="s"><text>Isberg, RR, Voorhis DL and Falkow S., 1987, Identification of invasin: a protein that allows enteric bacteria to penetrate cultured mammalian cells, Cell, 50: 769-778</text></nplcit>.</li><li><nplcit id="ncit0041" npl-type="s"><text>Jacobs, WR et al., 1991. Construction of mycobacterial genomic libraries in shuttle cosmids. Genetic Systems for Mycobacteria, Methods in Enzymology, 204: 537-555</text></nplcit>.</li><li><nplcit id="ncit0042" npl-type="s"><text>Jacobs, WR et al., 1993, Science, 260: 819-822</text></nplcit>.</li><li><nplcit id="ncit0043" npl-type="s"><text>Kaneda, et al., 1989, Science, 243: 375</text></nplcit>.</li><li><nplcit id="ncit0044" npl-type="s"><text>Kiehn, TE, et al. 1987. J. Clin. Microbiol. 25: 1551-1552</text></nplcit>.</li><li><nplcit id="ncit0045" npl-type="s"><text>Kievitis, T. et al., 1991, J. Virol. Methods, 35: 273-286</text></nplcit>.</li><li><nplcit id="ncit0046" npl-type="s"><text>Kohler, G. et al., 1975, Nature, 256 (5517): 495-497</text></nplcit>.</li><li><nplcit id="ncit0047" npl-type="s"><text>Kwoh, DY et al., 1989, Proc. Natl. Acad. Sci. USA, 86: 1173-1177</text></nplcit>.</li><li><nplcit id="ncit0048" npl-type="s"><text>Landegren, U. et al., 1988, Science, 241: 1077-1080</text></nplcit>.</li><li><nplcit id="ncit0049" npl-type="s"><text>Lang, T. and Antoine J.-C., 1991, Localization of MHC classII molecules in murine bone marrow-derived macrophages. Immunology, 72: 199-205</text></nplcit>.</li><li><nplcit id="ncit0050" npl-type="s"><text>Lee, BY and Horwitz MA, 1995, Identification of macrophage and stress-induced proteins of Mycobacterium tuberculosis, J. Clin. Invest., 96: 245-249</text></nplcit>.</li><li><nplcit id="ncit0051" npl-type="s"><text>Lim, EM, Rauzier J., Timm J., Torrea G., Murray A., Gicquel B. and Portnoï D., 1995, Identification of Mycobacterium tuberculosis DNA sequences encoding exported proteins, using phoA gene fusions, J. Bacteriol., 177: 59-65</text></nplcit>.</li><li><nplcit id="ncit0052" npl-type="s"><text>Lizardi, PM et al., 1988, Bio / technology, 6: 1197-1202</text></nplcit>.</li><li><nplcit id="ncit0053" npl-type="s"><text>Mahan, MJ et al., 1993. Selection of bacterial virulence genes that are specifically induced in host tissues, Science, 259: 686-688</text></nplcit>.</li><li><nplcit id="ncit0054" npl-type="s"><text>Manoil L., Mekolanos JJ and Beckwith J., J. Bacteriol., 1990, 172, 515-518</text></nplcit>.</li><li><nplcit id="ncit0055" npl-type="s"><text>Matthews, JA et al., 1988, Anal. Biochem., 169: 1-25</text></nplcit>.</li><li><nplcit id="ncit0056" npl-type="s"><text>Merrifield, RD, 1966, J. Am. Chem. Soc., 88 (21): 5051-5052</text></nplcit>.</li><li><nplcit id="ncit0057" npl-type="s"><text>Midoux, 1993, Nucleic Acids Research, 21: 871-878</text></nplcit>/</li><li><nplcit id="ncit0058" npl-type="s"><text>Miele, EA et al., 1983, J. Mol. Biol., 171: 281-295</text></nplcit>.</li><li><nplcit id="ncit0059" npl-type="s"><text>Minton, NP, 1984, Gene, 31, 269-273</text></nplcit>.</li><li><nplcit id="ncit0060" npl-type="s"><text>Montgomery et al., 1993, DNA Cell Biol., 12: 777-783</text></nplcit>.</li><li><nplcit id="ncit0061" npl-type="s"><text>Navarre, WWet al., 1994, Molecular Microbiologie, 14 (1): 115-121</text></nplcit>.</li><li><nplcit id="ncit0062" npl-type="s"><text>Navarre, WWet al., 1996, J. of Bacteriology, 178, 2: 441-446</text></nplcit>.</li><li><nplcit id="ncit0063" npl-type="s"><text>Pagano et al., 1967, J. Virol., 1: 891</text></nplcit>.</li><li><nplcit id="ncit0064" npl-type="s"><text>Pastore, 1994, Circulation, 90: I-517</text></nplcit>.</li><li><nplcit id="ncit0065" npl-type="s"><text>Patel, et al. 1990. J. Clin. Microbiol .:513-518</text></nplcit>.</li><li><nplcit id="ncit0066" npl-type="s"><text>Prentki, B. and Krish HM, 1984, Gene, 29: 303-313</text></nplcit>.</li><li><nplcit id="ncit0067" npl-type="s"><text>Pettersson R., Nordfelth J., Dubinina E., Bergman T., Gustafsson M., Magnusson KE and Wolf-Watz H., 1996, Modulation of virulence factor expression by pathogen target cell contact. Science., 273: 1231-1233</text></nplcit>.</li><li><nplcit id="ncit0068" npl-type="s"><text>Plum, G. and Clark-Curtiss JE, 1994, Induction of Mycobacterium avium gene expression following phagocytosis by human macrophages. Infect. Immun., 62: 476-483</text></nplcit>.</li><li><nplcit id="ncit0069" npl-type="s"><text>Roberts, MC, et al. 1987. J. Clin. Microbiol. 25: 1239-1243</text></nplcit>.</li><li><nplcit id="ncit0070" npl-type="b"><text>Rolfs, A. et al. 1991. In PCR Topics. Usage of Polymerase Chain reaction in Genetic and Infectious Disease. Berlin: Springer-Verlag</text></nplcit>.</li><li><nplcit id="ncit0071" npl-type="b"><text>Sambrook, J. et al. 1989. In Molecular cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press</text></nplcit>.</li><li><nplcit id="ncit0072" npl-type="s"><text>Sanchez-Pescador, R., 1988, J. Clin. Microbiol., 26 (10): 1934-1938</text></nplcit>.</li><li><nplcit id="ncit0073" npl-type="s"><text>Schneewind, O. et al., 1995, Science, 268: 103-106</text></nplcit>.</li><li><nplcit id="ncit0074" npl-type="b"><text>Segev D., 1992, in “Non-radioactive Labeling and Detection of Biomolecules”. Kessler C. Springer Verlag, Berlin, New-York, 197-205</text></nplcit>.</li><li><nplcit id="ncit0075" npl-type="s"><text>Servant, P. and Mazodier P., 1995, Characterization of Streptomyces albus 18-kilodalton heat shock-responsive protein. J. Bacteriol., 177: 2998-3003</text></nplcit>.</li><li><nplcit id="ncit0076" npl-type="b"><text>Shiver, JW, 1995, in Vaccines 1995, eds Chanock, RM Brown, F. Ginsberg, HS &amp; Norrby, E.), pp.95-98, Cold Spring Harbor L aboratory Press, Cold Spring Harbor, New York</text></nplcit>.</li><li><nplcit id="ncit0077" npl-type="s"><text>Sorensen et al., 1995, Infect. Immun., 63, 1710-1717</text></nplcit>.</li><li><nplcit id="ncit0078" npl-type="s"><text>Stone, BB et al., 1996, Mol. and Cell. Probes, 10: 359-370</text></nplcit>.</li><li><nplcit id="ncit0079" npl-type="s"><text>Stover, CK, Bansal GP, Hanson MS, Burlein SR, Palaszynski SR, Young JF, Koenig S., Young DB, Sadziene A. and Barbour AG, 1993, Protective immunity elecited by recombinant Bacille Calmette-Guerin (BCG) expressing outer surface protein A (OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med., 178: 197-209</text></nplcit>.</li><li><nplcit id="ncit0080" npl-type="s"><text>Sturgill-Koszycki, S., Schlesinger PH, Chakroborty P., Haddix PL, Collins HL, Fok AK, Allen RD, Gluck SL, Heuser J. and Russell DG, 1994, Lack of acidification in Mycobacterium phagosomes by exclusion of the vesicular proton -ATPase. Science., 263: 678-681</text></nplcit>.</li><li><nplcit id="ncit0081" npl-type="s"><text>Tascon, RE et al .., 1996, Nature Medicine, 2 (8): 888-892</text></nplcit>.</li><li><nplcit id="ncit0082" npl-type="s"><text>Oligonucleotide assembly technique, 1983, Proc. Natl. Acad. Sci. USA, 80: 7461-7465</text></nplcit>.</li><li><nplcit id="ncit0083" npl-type="s"><text>Beta-cyanethylphosp techniquehoramidites, 1986, Bioorganic Chem., 4: 274-325</text></nplcit>.</li><li><nplcit id="ncit0084" npl-type="s"><text>Thierry, D. et al., 1990, Nucl. Acid Res., 18: 188</text></nplcit>.</li><li><nplcit id="ncit0085" npl-type="s"><text>Timm, J., Perilli MG, Duez C., Trias J., Orefici G., Fattorini L., Amicosante G., Oratore A., Boris B., Frere JM, Pugsley AP and Gicquel B., 1994, Transcription and expression analysis, using lacZ and phoA gene fusions, of Mycobacterium fortuitum B-lactamase genes cloned from a natural isolate and a high-level B-lactamase producer. Mol. Microbiol., 12: 491-504</text></nplcit>.</li><li><nplcit id="ncit0086" npl-type="s"><text>Tuberculosis Prévention Trial, 1980</text></nplcit>, <nplcit id="ncit0087" npl-type="s"><text>Mendis, "Trial of BCG vaccines in South India for Tuberculosis Infection", Indian Journal of Medical research, 1972 (Suppl.): 1-74</text></nplcit>.</li><li><nplcit id="ncit0088" npl-type="s"><text>Urdea, MS et al., 1991, Nucleic Acids Symp. Ser., 24: 197-200</text></nplcit>.</li><li><nplcit id="ncit0089" npl-type="s"><text>Urdea, MS, 1988, Nucleic Acids Research, 11: 4937-4957</text></nplcit>.</li><li><nplcit id="ncit0090" npl-type="s"><text>Verbon, A., Hartskeerl RA, Schuitema A., Kolk AH, Young DB and Lathigra R., 1992, The 14,000-molecular-weight antigen of Mycobacterium tuberculosis is related to the alpha-crystallin family of low-molecular-weight heat shock proteins. J Bacteriol., 174: 1352-1359</text></nplcit>.</li><li><nplcit id="ncit0091" npl-type="s"><text>Walker, GT et al., 1992, Nucleic Acids Res., 20: 1691-1696</text></nplcit>.</li><li><nplcit id="ncit0092" npl-type="s"><text>Walker, GT et al., 1992, Proc. Natl. Acad. Sci. USA, 89: 392-396</text></nplcit>.</li><li><nplcit id="ncit0093" npl-type="s"><text>Wiker, HG et al., 1992, Microbiol. Rev., 56: 648-661</text></nplcit>.</li><li><nplcit id="ncit0094" npl-type="s"><text>Yamaguchi, R. et al., 1989, Infect. Immun., 57: 283-288</text></nplcit>.</li><li><nplcit id="ncit0095" npl-type="s"><text>Xu, S., Cooper A., ​​Sturgill-Koszycki S., van Heyningen T., Chatterjee D., Orme I., Allen P. and Russel DG, 1994, Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages, J Immuno., 153: 2568-2578</text></nplcit>.</li><li><nplcit id="ncit0096" npl-type="s"><text>Young, DB et al., 1992, Mol. Microbiol., 6: 133-145</text></nplcit>.</li><li><nplcit id="ncit0097" npl-type="s"><text>Yuen, LKW et al., 1993, J. Clin. Microbiol., 31: 1615-1618</text></nplcit>.</li></ul>