EP1558646A2

Single domain antibodies directed against interferon- gamma and uses thereof

Abstract

This record has no abstract on file.

Term

Term ended

Projected expiry passed 7 November 2023, 2.9 years ago.

49 claims: 36 independent, 13 dependent

1
Claims of equivalent WO 2004041863 A2 CLAIMS 1. An anti-IFN-gamma polypeptide comprising at least one anti-IFN-gamma single domain antibody.
3
An anti-IFN-gamma polypeptide according to claims 1 and 2 wherein at least one single domain antibody corresponds to a sequence represented by any of SEQ ID NOs:1 to 35
4
An anti-IFN-gamma polypeptide according to any of claims 1 to 3 further comprising at least one single domain antibody directed against a serum protein.
5
An anti-IFN-gamma polypeptide according to claims 4 wherein a serum protein is any of serum albumin, serum immunoglobulins, thyroxine-binding protein, transferring, or fibrinogen.
6
An anti-IFN-gamma polypeptide according to claims 4 and 5 wherein an anti-serum protein single domain antibody correspond to a sequence represented by any of SEQ ID NOs:36 to 39 and 62 to 74.
7
An anti-IFN-gamma polypeptide according to any of claims 4 to 6 corresponding to a sequence represented by any of SEQ ID NOs:40 to 42.
8
An anti-IFN-gamma polypeptide according to any of claims 1 to 6 further comprising at least one single domain antibody selected from the group consisting of anti-TNF-alpha single domain antibody, anti-TNF-alpha receptor single domain antibody and anti-IFN- gamma receptor single domain antibody.
9
An anti-IFN-gamma polypeptide according to any of claims 1 to 7, wherein the number of single domain antibodies directed against IFN-gamma is at least two.
11
An anti-IFN-gamma polypeptide according any of claims 1 to 10, wherein at least one single domain antibody is a humanized Camelidae VHHs.
12
A composition comprising an anti-IFN-gamma polypeptide according to any of claims 1 to 11 together with at least one single domain antibody from the group consisting of anti- TNF-alpha single domain antibody, anti-TNF-alpha receptor single domain antibody and anti-IFN-gamma receptor single domain antibody, for simultaneous, separate or sequential administration to a subject.
14
An anti-IFN-gamma polypeptide according to any of claims 1 to 11 , and 13, or a composition according to claims 12 and 13, wherein said single domain antibody is an homologous sequence, a functional portion, or a functional portion of an homologous sequence of the full length single domain antibody.
15
An anti-IFN-gamma polypeptide according to any of claims 1 to 11 , 13 and 14, or a composition according to claims 12 to 14, wherein the anti-IFN-gamma polypeptide is an homologous sequence, a functional portion, or a functional portion of an homologous sequence of the full length anti-IFN-gamma polypeptide.
17
A nucleic acid encoding an anti-IFN-gamma polypeptide according to any of claims 1 to 16.
18
A method of identifying an agent that modulates the binding of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16, to IFN-gamma comprising the steps of:(a) contacting an anti-IFN-gamma polypeptide of any of claims 1 to 11, and 13 to 16 with a target that is IFN-gamma, in the presence and absence of a candidate modulator under conditions permitting binding between said polypeptide and target, and (b) measuring the binding between the polypeptide and target of step (a), wherein a decrease in binding in the presence of said candidate modulator, relative to the binding in the absence of said candidate modulator identified said candidate modulator as an agent that modulates the binding of an anti-IFN-gamma polypeptide of any of claims 1 to 11, and 13 to 16 and IFN-gamma.
19
A method of identifying an agent that modulates IFN-gamma-mediated disorders through the binding of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 to IFN-gamma comprising:(a) contacting an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 with a target that is IFN-gamma, in the presence and absence of a candidate modulator under conditions permitting binding between said polypeptide and target, and (b) measuring the binding between the polypeptide and target of step (a), wherein a decrease in binding in the presence of said candidate modulator, relative to the binding in the absence of said candidate modulator identified, said candidate modulator as an agent that modulates IFN-gamma-mediated disorders.
20
A method of identifying an agent that modulates the binding of IFN-gamma to its receptor through the binding of an anti-IFN-gamma polypeptide of any of claims 1 to 11, and 13 to 16 to IFN-gamma comprising:(a) contacting an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 with a target that is IFN-gamma, in the presence and absence of a candidate modulator under conditions permitting binding between said polypeptide and target, and (b) measuring the binding between the polypeptide and target of step (a), wherein a decrease in binding in the presence of said candidate modulator, relative to the binding in the absence of said candidate modulator identified said candidate modulator as an agent that modulates the binding of IFN-gamma to its receptor.
21
A kit for screening for agents that modulate IFN-gamma-mediated disorders comprising an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 and IFN-gamma.
23
An unknown agent that modulates IFN-gamma-mediated disorders, identified according to the methods of claims 19 and 20.
27
An anti-IFN-gamma polypeptide of any of claims 1 to 11, and 13 to 16 or a composition according to any of claims 12 to 16, for treating and/or preventing and/or alleviating disorders requiring the delivery of a IFN-gamma modulating polypeptide that is able pass through the gastric environment without being inactivated.
28
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a IFN-gamma modulating polypeptide that is able pass through the gastric environment without being inactivated.
29
An anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for treating and/or preventing and/or alleviating disorders requiring the delivery of a IFN-gamma modulator to the vaginal and/or rectal tract.
30
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a IFN-gamma modulator to the vaginal and/or rectal tract.
31
An anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for treating and/or preventing and/or alleviating disorders requiring the delivery of a therapeutic compound to the upper respiratory tract and lung.
32
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a therapeutic compound to the upper respiratory tract and lung.
33
An anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for treating and/or preventing and/or alleviating disorders requiring the delivery of a IFN-gamma modulator, wherein said disorder increases the permeability of the intestinal mucosa.
34
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11, and 13 to 16 or a composition according to any of claims 12 to 16, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a IFN-gamma modulator, wherein said disorder increases the permeability of the intestinal mucosa.
35
An anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for treating and/or preventing and/or alleviating disorders requiring delivery of a IFN-gamma modulator that is able pass through the tissues beneath the tongue.
36
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring delivery of a IFN-gamma modulator that is able pass through the tissues beneath the tongue.
37
An anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 or a composition according to any of claims 12 to 16, for treating and/or preventing and/or alleviating disorders requiring delivery of a IFN-gamma modulator that is able pass through the skin.
38
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11, and 13 to 16 or a composition according to any of claims 12 to 16, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring delivery of a IFN-gamma modulator that is able pass through the skin.
41
A method of diagnosing a disorder characterised by the dysfunction of IFN-gamma comprising:(a) contacting a sample with an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16, (b) detecting binding of said polypeptide to said sample, and (c) comparing the binding detected in step (b) with a standard, wherein a difference in binding relative to said sample is diagnostic of a disorder characterised by dysfunction of IFN-gamma.
44
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 for the purification of said IFN-gamma.
45
Use of an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 for inhibiting the interaction between IFN-gamma and one or more IFN-gamma receptors.
46
A method for producing an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 comprising the steps of:(a) obtaining double stranded DNA encoding a Camelidae VHH directed to IFN- gamma, (b) cloning and expressing the DNA selected in step (b).
47
A method of producing an anti-IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16 comprising:(a) culturing host cells comprising nucleic acid capable of encoding an anti-IFN- gamma polypeptide of any of claims 1 to 11 , and 13 to 16, under conditions allowing the expression of the polypeptide, and, (b) recovering the produced polypeptide from the culture.
49
A kit for screening for any of inflammation, rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome or multiple sclerosis comprising an anti- IFN-gamma polypeptide of any of claims 1 to 11 , and 13 to 16.

Independent claims36

341 paragraphs in 7 sections, as filed

Description of equivalent WO 2004041863 A2

SINGLE DOMAIN ANTIBODIES DIRECTED AGAINST INTERFERON-GAMMA

AND USES THEREFOR

0003FIELD OF THE INVENTION The present invention provides polypeptides comprising one or more single domain antibodies directed towards Interferon gamma (IFN-gamma). The present invention further relates to their use in diagnosis and therapy. Such antibodies may have a framework sequence with high homology to the human framework sequences. Compositions comprising antibodies to Interferon gamma (IFN-gamma) alone or in combination with other drugs are described.

BACKGROUND

0005Interferon gamma (IFN-gamma) is believed to play an important role in various disorders, for example in inflammatory disorders such as rheumatoid arthritis, Crohn's disease, inflammatory bowel disease, ulcerative colitis, multiple sclerosis and hyperimmune reactions in the eye. IFN-gamma has also been shown to play a significant role in the pathology of autoimmune diseases. For example, the presence of IFN-gamma has been implicated in rheumatoid arthritis (Brennan et al, Brit. J. Rheum., 31 , 293-8 (1992). Several strategies to antagonize the action of these cytokines have been developed and are currently used to treat various disease states.

0006Interferon gamma (IFN-gamma) in its bioactive form is a dimer and the interaction with the Interferon gamma (IFN-gamma) receptor occurs through interaction of two loops present on the homodimeric IFN-gamma with loop structures on the IFN-gamma receptor (Walter et al, nature, 376, 230-235 (1995)). An Interferon gamma (IFN-gamma) inhibitor which has sufficient specificity and selectivity to IFN-gamma may be an efficient prophylactic or therapeutic pharmaceutical compound for preventing or treating inflammatory disorders. Methods of treating an autoimmune disease by means of an antibody to IFN-gamma have been described. Diseases include multiple sclerosis, rheumatoid arthritis, ankylosing spondylitis, juvenile rheumatoid arthritis, and psoriatic arthritis (US6,333,032 Advanced Biotherapy Concepts, Inc.). Other diseases include Crohn's disease and psoriasis (US6,329,511 Protein Design Labs). Yet other diseases are bowel disease, ulcerative colitis and Crohn's disease (EP0695189 Genentech). Yet none of the presently available drugs are completely effective for the treatment of autoimmune disease, and most are limited by severe toxicity. In addition, it is extremely difficult and a lengthy process to develop a new chemical entitiy (NCE) with sufficient potency and selectivity to such target sequence. Antibody-based therapeutics on the other hand have significant potential as drugs because they have exquisite specificity to their target and a low inherent toxicity. In addition, the development time can be reduced considerably when compared to the development of new chemical entities (NCE's). However, conventional antibodies are difficult to raise against multimeric proteins where the receptor-binding domain of the ligand is a flexible loop as is the case with Interferon gamma (IFN-gamma) . Heavy chain antibodies described in the invention which are derived from Camelidae, are known to be elicited against unexpected epitopes, such as the well-documented cavity-binding VHH's (WO97/49805; Lauwereys et al, EMBO J. 17, 5312, 1998)). Therefore, such heavy chain antibodies are inherently suited to bind to receptor binding domains of such ligands as Interferon gamma (IFN-gamma) . In addition, such antibodies are known to be stable over long periods of time, therefore increasing their shelf-life (Perez et al, Biochemistry, 40, 74, 2001). Furthermore, such heavy chain antibody fragments (coined VHH) can be produced 'en-masse' in fermentors using cheap expression systems compared to mammalian cell culture fermentation, such as yeast or other microorganisms (EP 0 698 097).

0007The use of antibodies derived from sources such as mouse, sheep, goat, rabbit etc., and humanised derivatives thereof as a treatment for conditions which require a modulation of inflammation is problematic for several reasons. Traditional antibodies are not stable at room temperature, and have to be refrigerated for preparation and storage, requiring necessary refrigerated laboratory equipment, storage and transport, which contribute towards time and expense. Refrigeration is sometimes not feasible in developing countries. Furthermore, the manufacture or small-scale production of said antibodies is expensive because the mammalian cellular systems necessary for the expression of intact and active antibodies require high levels of support in terms of time and equipment, and yields are very low. Furthermore the large size of conventional antibodies would restrict tissue penetration, for example, at the site of inflamed tissue. Furthermore, traditional antibodies have a binding activity which depends upon pH, and hence are unsuitable for use in environments outside the usual physiological pH range such as, for example, in treating gastric bleeding, gastric surgery, inflammatory bowel disease, inflammation of the joint lining tissue (as in rheumatoid arthritis), destruction of the conducting fibers of the nervous tissue (as in multiple sclerosis). Furthermore, traditional antibodies are unstable at low or high pH and hence are not suitable for oral administration. However, it has been demonstrated that Camelidae antibodies resist harsh conditions, such as extreme pH, denaturing reagents and high temperatures (Ewert S et al, Biochemistry (2002) 41 (11 ):3628-36), so making them suitable for delivery by oral administration. Furthermore, traditional antibodies have a binding activity which depends upon temperature, and hence are unsuitable for use in assays or kits performed at temperatures outside biologically active-temperature ranges (e.g. 37 ± 20°C).

0008Polypeptide therapeutics and in particular antibody-based therapeutics have significant potential as drugs because they have exquisite specificity to their target and a low inherent toxicity. However, it is known by the skilled addressee that an antibody which has been obtained for a therapeutically useful target requires additional modification in order to prepare it for human therapy, so as to avoid an unwanted immunological reaction in a human individual upon administration thereto. The modification process is commonly termed "humanisation". It is known by the skilled artisan that antibodies raised in species, other than in humans, require humanisation to render the antibody therapeutically useful in humans. ((1 ) CDR grafting : Protein Design Labs: US 6180370, US 5693761 ; Genentech US 6054297; Celltech: 460167, EP 626390, US 5859205; (2) Veneering: Xoma: US 5869619, US 5766886, US 5821123). There is a need for a method for producing antibodies which avoids the requirement for substantial humanisation, or which completely obviates the need for humanisation. There is a need for a new class of antibodies which have defined framework regions or amino acid residues and which can be administered to a human subject without the requirement for substantial humanisation, or the need for humanisation at all.

0009Another important drawback of conventional antibodies is that they are complex, large molecules and therefore relatively unstable, and they are sensitive to breakdown by proteases. This means that conventional antibody drugs cannot be administered orally, sublingually, topically, nasally, vaginally, rectally or by inhalation because they are not resistant to the low pH at these sites, the action of proteases at these sites and in the blood and/or because of their large size. They have to be administered by injection (intravenously, subcutaneously, etc.) to overcome some of these problems. Administration by injection requires specialist training in order to use a hypodermic syringe or needle correctly and safely. It further requires sterile equipment, a liquid formulation of the therapeutic polypeptide, vial packing of said polypeptide in a sterile and stable form and, of the subject, a suitable site for entry of the needle. Furthermore, subjects commonly experience physical and psychological stress prior to and upon receiving an injection. Therefore, there is need for a method for the delivery of therapeutic polypeptides which avoids the need for injection which is not only cost/time saving, but which would also be more convenient and more comfortable for the subject.

0010AIMS OF THE INVENTION It is an aim of the present invention is to provide polypeptides comprising one or more single domain antibodies which bind to Interferon gamma (IFN-gamma), homologues of said polypeptides, functional portions of homologues of said polypeptides. Said polypeptides modify the biological activity of IFN-gamma upon binding. Such polypeptides might bind into the receptor-binding domain of IFN-gamma, or might not bind in the receptor-binding domain.

0011It is a further aim of the present invention to provide single domain antibodies which may be any of the art, or any future single domain antibodies. Examples include, but are not limited to, heavy chain antibodies, antibodies naturally devoid of light chains, single domain antibodies derived from conventional 4-chain antibodies, engineered antibodies and single domain scaffolds other than those derived from antibodies. According to one aspect of the invention, a single domain antibody as used herein is a naturally occurring single domain antibody known as heavy chain antibody devoid of light chains (WO 9404678). For clarity reasons, this variable domain derived from a heavy chain antibody devoid of light chain will be called VHH or nanobody to distinguish it from the conventional VH of four chain immunoglobulins. Such a VHH molecule can be derived from antibodies raised in Camelidae species, for example in camel, dromedary, llama, alpaca and guanaco.

0012It is a further aim of the invention to provide a method of administering anti-IFN-gamma polypeptides intravenously, subcutaneously, orally, sublingually, topically, nasally, vaginally, rectally or by inhalation.

0013It is a further aim of the invention to enhance the binding affinity of monovalent single domain antibodies.

SUMMARY OF THE INVENTION

0015One embodiment of the present invention is an anti-IFN-gamma polypeptide comprising at least one anti-IFN-gamma single domain antibody. Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, wherein at least one anti-IFN-gamma single domain antibody, is a Camelidae VHH antibody.

0016Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above wherein at least one single domain antibody corresponds to a sequence represented by any of SEQ ID NOs: 1 to 35

0017Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above further comprising at least one single domain antibody directed against a serum protein.

0018Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above wherein a serum protein is any of serum albumin, serum immunoglobulins, thyroxine-binding protein, transferring, or fibrinogen.

0019Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above wherein an anti-serum protein single domain antibody correspond to a sequence represented by any of SEQ ID NOs: 36 to 39 and 62 to 74.

0020Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above corresponding to a sequence represented by any of SEQ ID NOs: 40 to 42.

0021Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above further comprising at least one single domain antibody selected from the group consisting of anti-TNF-alpha single domain antibody, anti-TNF-alpha receptor single domain antibody and anti-IFN-gamma receptor single domain antibody.

0022Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, wherein the number of single domain antibodies directed against IFN- gamma is at least two.

0023Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above corresponding to a sequence represented by any of SEQ ID NOs: 59 to 61. Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, wherein at least one single domain antibody is a humanized Camelidae VHHs.

0024Another embodiment of the present invention is a composition comprising an anti-IFN- gamma polypeptide as described above together with at least one single domain antibody from the group consisting of anti-TNF-alpha single domain antibody, anti-TNF-alpha receptor single domain antibody and anti-IFN-gamma receptor single domain antibody, for simultaneous, separate or sequential administration to a subject.

0025Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, or a composition as described above wherein at least one anti-TNF- alpha single domain antibody correspond to a sequence represented by any of SEQ ID NOs: 43 to 58.

0026Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, or a composition as described above, wherein said single domain antibody is an homologous sequence, a functional portion, or a functional portion of an homologous sequence of the full length single domain antibody.

0027Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, or a composition as described above, wherein the anti-IFN-gamma polypeptide is an homologous sequence, a functional portion, or a functional portion of an homologous sequence of the full length anti-IFN-gamma polypeptide.

0028Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, or a composition as described above wherein said single domain antibodies are Camelidae VHHs.

0029Another embodiment of the present invention is a nucleic acid encoding an anti-IFN- gamma polypeptide as described above.

0030Another embodiment of the present invention is a method of identifying an agent that modulates the binding of an anti-IFN-gamma polypeptide as described above, to IFN- gamma comprising the steps of: (a) contacting an anti-IFN-gamma polypeptide as described above with a target that is IFN-gamma, in the presence and absence of a candidate modulator under conditions permitting binding between said polypeptide and target, and

0031(b) measuring the binding between the polypeptide and target of step (a), wherein a decrease in binding in the presence of said candidate modulator, relative to the binding in the absence of said candidate modulator identified said candidate modulator as an agent that modulates the binding of an anti-IFN-gamma polypeptide as described above and IFN-gamma.

0032Another embodiment of the present invention is a method of identifying an agent that modulates IFN-gamma-mediated disorders through the binding of an anti-IFN-gamma polypeptide as described above to IFN-gamma comprising:

0033(a) contacting an anti-IFN-gamma polypeptide as described above with a target that is IFN-gamma, in the presence and absence of a candidate modulator under conditions permitting binding between said polypeptide and target, and

0034(b) measuring the binding between the polypeptide and target of step (a), wherein a decrease in binding in the presence of said candidate modulator, relative to the binding in the absence of said candidate modulator identified, said candidate modulator as an agent that modulates IFN-gamma-mediated disorders.

0035Another embodiment of the present invention is a method of identifying an agent that modulates the binding of IFN-gamma to its receptor through the binding of an anti-IFN- gamma polypeptide as described above to IFN-gamma comprising:

0036(a) contacting an anti-IFN-gamma polypeptide as described above with a target that is IFN-gamma, in the presence and absence of a candidate modulator under conditions permitting binding between said polypeptide and target, and

0037(b) measuring the binding between the polypeptide and target of step (a), wherein a decrease in binding in the presence of said candidate modulator, relative to the binding in the absence of said candidate modulator identified said candidate modulator as an agent that modulates the binding of IFN-gamma to its receptor.

0038Another embodiment of the present invention is a kit for screening for agents that modulate IFN-gamma-mediated disorders comprising an anti-IFN-gamma polypeptide as described above and IFN-gamma. Another embodiment of the present invention is an unknown agent that modulates the binding of an anti-IFN-gamma polypeptide as described above to IFN-gamma, identified according to the method as described above.

0039Another embodiment of the present invention is an unknown agent that modulates IFN- gamma-mediated disorders, identified according to the methods as described above.

0040Another embodiment of the present invention is an unknown agent as described above wherein said disorders are one or more of inflammation, rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis.

0041Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above, or a nucleic acid as described above, or a composition as described above, or an agent as described above for treating and/or preventing and/or alleviating disorders relating to inflammatory processes.

0042Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a nucleic acid as described above, or a composition as described above, or an agent as described above for the preparation of a medicament for treating and/or preventing and/or alleviating disorders relating to inflammatory reactions.

0043Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above or a composition as described above, for treating and/or preventing and/or alleviating disorders requiring the delivery of a IFN-gamma modulating polypeptide that is able pass through the gastric environment without being inactivated.

0044Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a composition as described above, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a IFN-gamma modulating polypeptide that is able pass through the gastric environment without being inactivated.

0045Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above or a composition as described above, for treating and/or preventing and/or alleviating disorders requiring the delivery of a IFN-gamma modulator to the vaginal and/or rectal tract. Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a composition as described above, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a IFN-gamma modulator to the vaginal and/or rectal tract.

0046Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above or a composition as described above, for treating and/or preventing and/or alleviating disorders requiring the delivery of a therapeutic compound to the upper respiratory tract and lung.

0047Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a composition as described above, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a therapeutic compound to the upper respiratory tract and lung.

0048Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above or a composition as described above, for treating and/or preventing and/or alleviating disorders requiring the delivery of a IFN-gamma modulator, wherein said disorder increases the permeability of the intestinal mucosa.

0049Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a composition as described above, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring the delivery of a IFN-gamma modulator, wherein said disorder increases the permeability of the intestinal mucosa.

0050Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above or a composition as described above, for treating and/or preventing and/or alleviating disorders requiring delivery of a IFN-gamma modulator that is able pass through the tissues beneath the tongue.

0051Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a composition as described above, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring delivery of a IFN-gamma modulator that is able pass through the tissues beneath the tongue. Another embodiment of the present invention is an anti-IFN-gamma polypeptide as described above or a composition as described above, for treating and/or preventing and/or alleviating disorders requiring delivery of a IFN-gamma modulator that is able pass through the skin.

0052Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above or a composition as described above, for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders requiring delivery of a IFN-gamma modulator that is able pass through the skin.

0053Another embodiment of the present invention is a method as described above, a kit as described above, a nucleic acid or agent as described above, use of a nucleic acid or agent as described above, a composition as described above, use of a composition as described above, an anti-IFN-gamma polypeptide as described above, use of an anti-IFN- gamma polypeptide as described above wherein said disorders are any of inflammation, rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, multiple sclerosis, Addison's disease, Autoimmune hepatitis, Autoimmune parotitis, Diabetes Type I, Epididymitis, Glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, Hemolytic anemia, Systemic lupus erythematosus, Male infertility, Multiple sclerosis, Myasthenia Gravis, Pemphigus, Psoriasis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Scleroderma, Sjogren's syndrome, Spondyloarthropathies, Thyroiditis, and Vasculitis.

0054Another embodiment of the present invention is a composition comprising a nucleic acid or agent as described above, an anti-IFN-gamma polypeptide as described above, or a composition as described above, and a suitable pharmaceutical vehicle.

0055Another embodiment of the present invention is a method of diagnosing a disorder characterised by the dysfunction of IFN-gamma comprising:

0056(a) contacting a sample with an anti-IFN-gamma polypeptide as described above,

0057(b) detecting binding of said polypeptide to said sample, and

0058(c) comparing the binding detected in step (b) with a standard, wherein a difference in binding relative to said sample is diagnostic of a disorder characterised by dysfunction of IFN-gamma. Another embodiment of the present invention is a kit for screening for a disorder cited above, using a method as described above.

0059Another embodiment of the present invention is a kit for screening for a disorder cited above comprising an isolated anti-IFN-gamma polypeptide as described above.

0060Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above for the purification of said IFN-gamma.

0061Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as described above for inhibiting the interaction between IFN-gamma and one or more IFN-gamma receptors.

0062Another embodiment of the present invention is a method for producing an anti-IFN- gamma polypeptide as described above comprising the steps of:

0063(a) obtaining double stranded DNA encoding a Camelidae VHH directed to IFN-gamma,

0064(b) cloning and expressing the DNA selected in step (b).

0065Another embodiment of the present invention is a method of producing an anti-IFN- gamma polypeptide as described above comprising:

0066(a) culturing host cells comprising nucleic acid capable of encoding an anti-IFN-gamma polypeptide as described above, under conditions allowing the expression of the polypeptide, and,

0067(b) recovering the produced polypeptide from the culture.

0068Another embodiment of the present invention is a method as described above, wherein said host cells are bacterial or yeast.

0069Another embodiment of the present invention is a kit for screening for any of inflammation, rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome or multiple sclerosis comprising an anti-IFN-gamma polypeptide as described above. BRIEF DESCRIPTION OF FIGURES AND TABLES

0070Figure 1 Specificity for human IFN- of the different libraries derived from llama 5 and 6

0071Figure 2 Specificity for human IFN- of the pooled libraries derived from llama 22 and 23

0072Figure 3 Specificity for human IFN- of the pooled libraries derived from llama 6

0073Figure 4 Specificity for mouse IFN- of the pooled libraries derived from llama 29 and 31

0074Figure 5 Binding of biotinylated human and mouse IFN- to neutravidine

0075Figure 6 binding of biotinylated human and mouse IFN- to its receptor

0076Figure 7 Representation of dose-dependent inhibition using a polyclonal anti-human IFN- Y antibody as described in example 10

0077Figure 8 Capacity of clones selected in MP2 (experiment 1) to inhibit IFN- /receptor interaction as described in example 10

0078Figure 9 Capacity of clones selected in MP3 (experiment 2) to inhibit IFN- /receptor interaction as described in example 10

0079Figure 10 Capacity of clones selected in MP4 (experiment 3) to inhibit IFN- /receptor interaction as described in example 10

0080Figure 11 Representation of the dose-dependent inhibition of MP3B4SRA and MP2F6SR as described in example 10

0081Figure 12 Representation of the dose-dependent inhibition of MP3B4SRA and MP2F6SR as described in example 11

0082Figure 13 Representation of the dose-dependent inhibition of monovalent and bivalent MP3B4SRA and MP2F6SR and bispecifc MP3B4SRA/ MP2F6SR as described in example 13 Figure 14 Representation of the dose-dependent inhibition of monovalent and bivalent MP3B4SRA and MP2F6SR and bispecifc MP3B4SRA/ MP2F6SR as described in example 14

0083Figure 15 Representation of dose-dependent inhibition of anti-mouse IFN-gamma VHHs as described in Example 10 and Table 5

0084Table 1 Overview of the libraries, their diversity and % insert derived from different llama's and tissues as described in example 1 and 2

0085Table 2 Overview of screening experiments of different selections for human IFN- specific VHH as described in example 6-1

0086Table 3 Overview of screening experiments of selections for mouse IFN- specific VHH as described in example 6-2

0087Table 4 Overview of amino acid sequence of human IFN- specific VHH's

0088Table 5 Overview of amino acid sequence of mouse IFN- specific VHH's

0089Table 6 Overview of IC50 of different IFN- specific VHH as described in example 10

0090Table 7 Overview of Anti-mouse serum albumin/anti-IFN-gamma

0091Table 8 Amino acid sequence listing of the peptides of aspects of present invention directed against TNF-alpha

0092Table 9 Amino acid sequence listing of the bi-valent and bi-specific peptides of aspects of present invention directed against IFN-gamma

0093Table 10 IC50 data of monovalent anti-IFN-gamma VHH's as described in Example 11.

0094Table 11 IC50 data of bi-valent and bi-specific anti-IFN-gamma VHH's an IgG/Fab derived from neutralizing polyclonal goat anti-human-IFN-gamma serum as described in Example 14. Table 12 Fractional homologies between the amino acid sequences of anti-mouse serum albumin VHHs of the invention.

0095Table 13 Fractional homologies between anti-TNF-alpha VHHs of the invention.

0096Table 14 Percentage homologies between anti-IFN-gamma VHHs of the invention.

DETAILED DESCRIPTION

0098The present invention relates to an anti-interferon gamma (IFN-gamma) polypeptide, comprising at least one single domain antibody directed against IFN-gamma. The invention also relates to nucleic acids capable of encoding said polypeptides.

0099Single domain antibodies are antibodies whose complementary determining regions are part of a single domain polypeptide. Examples include, but are not limited to, heavy chain antibodies, antibodies naturally devoid of light chains, single domain antibodies derived from conventional 4-chain antibodies, engineered antibodies and single domain scaffolds other than those derived from antibodies. Single domain antibodies may be any of the art, or any future single domain antibodies. Single domain antibodies may be derived from any species including, but not limited to mouse, human, camel, llama, goat, rabbit, bovine. According to one aspect of the invention, a single domain antibody as used herein is a naturally occurring single domain antibody known as heavy chain antibody devoid of light chains. Such single domain antibodies are disclosed in WO 94/04678 for example. For clarity reasons, this variable domain derived from a heavy chain antibody naturally devoid of light chain is known herein as a VHH or nanobody to distinguish it from the conventional VH of four chain immunoglobulins. Such a VHH molecule can be derived from antibodies raised in Camelidae species, for example in camel, dromedary, alpaca and guanaco. Other species besides Camelidae may produce heavy chain antibodies naturally devoid of light chain; such VHHs are within the scope of the invention.

0100VHHs, according to the present invention, and as known to the skilled addressee are heavy chain variable domains derived from immunoglobulins naturally devoid of light chains such as those derived from Camelidae as described in WO 94/04678 (and referred to hereinafter as VHH domains or nanobodies). VHH molecules are about 10x smaller than IgG molecules. They are single polypeptides and very stable, resisting extreme pH and temperature conditions. Moreover, they are resistant to the action of proteases which is not the case for conventional antibodies. Furthermore, in vitro expression of VHHs produces high yield, properly folded functional VHHs. In addition, antibodies generated in Camelids will recognize epitopes other than those recognised by antibodies generated in vitro through the use of antibody libraries or via immunisation of mammals other than Camelids (WO 9749805). As such, anti-IFN-gamma VHH's may interact more efficiently with IFN-gamma than conventional antibodies, thereby blocking its interaction with the IFN-gamma receptor more efficiently.

0101According to the invention, IFN-gamma is derived from any species. Examples of species relevant to the invention include as rabbits, goats, mice, rats, cows, calves, camels, llamas, monkeys, donkeys, guinea pigs, chickens, sheep, dogs, cats, horses, and preferably humans.

0102IFN-gamma is also a fragment of IFN-gamma, capable of eliciting an immune response. IFN-gamma is also a fragment of IFN-gamma, capable of binding to a single domain antibody raised against the full length IFN-gamma.

0103A single domain antibody directed against IFN-gamma means single domain antibody that it is capable of binding to IFN-gamma with an affinity of better than 10"6 M.

0104One embodiment of the present invention is an anti-IFN-gamma polypeptide wherein the single domain antibody comprises Camelidae VHH directed against IFN-gamma.

0105Another embodiment of the present invention is an anti-IFN-gamma polypeptide, wherein a single domain antibody corresponds to a sequence represented by any of SEQ ID NOs: 1 to 29 as shown in Table 4. Said sequences are derived from Camelidae heavy chain antibodies (VHHs) which are directed against human IFN-gamma.

0106The present invention further relates to an anti-IFN-gamma polypeptide, wherein a single domain antibody is a VHH directed against IFN-gamma, wherein the VHH belongs to a class having human-like sequences. The class is characterised in that the VHHs carry an amino acid from the group consisting of glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, tryptophan, methionine, serine, threonine, asparagine, or glutamine at position 45, such as, for example, L45 according to the Kabat numbering. As such, peptides belonging to this class show a high amino acid sequence homology to human VH framework regions and said peptides might be administered to a human directly without expectation of an unwanted immune response therefrom, and without the burden of further humanisation.

0107A human-like class of Camelidae single domain antibodies represented by SEQ ID No. 24 and 27 have been described in WO03035694 and contain the hydrophobic FR2 residues typically found in conventional antibodies of human origin or from other species, but compensating this loss in hydrophilicity by the charged arginine residue at position 103 that substitutes the conserved tryptophan residue present in VH from double-chain antibodies. As such, peptides belonging to these two classes show a high amino acid sequence homology to human VH framework regions and said peptides might be administered to a human directly without expectation of an unwanted immune response therefrom, and without the burden of further humanisation.

0108Therefore, one aspect of the present invention allows for the direct administration of an anti-IFN-gamma polypeptide, wherein the single domain antibodies belong to the humanized class of VHH, and comprise a sequence represented by any of SEQ ID NO: 24 or 27, to a patient in need of the same.

0109Any of the VHHs as used by the invention may be of the traditional class or of the classes of human-like Camelidae antibodies. Said antibodies may be directed against whole IFN- gamma or a fragment thereof, or a fragment of a homologous sequence thereof. These polypeptides include the full length Camelidae antibodies, namely Fc and VHH domains, chimeric versions of heavy chain Camelidae antibodies with a human Fc domain or VHH's by themselves or derived fragments.

0110Anti-serum albumin VHH's may interact in a more efficient way with serum albumin than conventional antibodies which is known to be a carrier protein. As a carrier protein some of the epitopes of serum albumin may be inaccessible by bound proteins, peptides and small chemical compounds. Since VHH's are known to bind into 'unusual' or non- conventional epitopes such as cavities (WO 97/49805), the affinity of such VHH's to circulating albumin may be increased.

0111The present invention also relates to the finding that an anti-IFN-gamma polypeptide as disclosed herein further comprising one or more single domain antibodies directed against one or more serum proteins of a subject surprisingly has significantly prolonged half-life in the circulation of said subject compared with the half-life of the anti-IFN-gamma polypeptide when not part of said construct. Examples of such anti-IFN-gamma polypeptides are represented in Table 7 by SEQ ID NOs: 40 to 42. Furthermore, the said anti-IFN-gamma polypeptides were found to exhibit the same favourable properties of VHHs such as high stability remaining intact in mice, extreme pH resistance, high temperature stability and high target affinity.

0112Another embodiment of the present invention is an anti-IFN-gamma polypeptide further comprising one or more single domain antibodies directed against one or more serum proteins, said anti-IFN-gamma polypeptide comprising a sequence corresponding to any represented by SEQ ID NOs: 40 to 42 (Table 7).

0113Another embodiment of the present invention is an anti-IFN-gamma polypeptide, wherein an anti-serum protein single domain antibody corresponds to a sequence represented by any of SEQ ID NOs: 36 to 39 and 62 to 74 as shown in Table 7

0114The serum protein may be any suitable protein found in the serum of subject, or fragment thereof. In one aspect of the invention, the serum protein is serum albumin, serum immunoglobulins, thyroxine-binding protein, transferrin, or fibrinogen. Depending on the intended use such as the required half-life for effective treatment and/or compartimentalisation of the target antigen, the VHH-partner can be directed to one of the above serum proteins.

0115Another aspect of the invention is an anti-IFN-gamma polypeptide as disclosed herein further comprising at least one polypeptide selected from the group consisting of an anti- TNF-alpha polypeptide, an anti-TNF-alpha receptor polypeptide and anti-IFN-gamma receptor polypeptide, such polypeptides joined to each other as described below

0116It is an embodiment of the invention that a single domain antibody directed against TNF- alpha corresponds to a sequence represented by any of SEQ ID NOs: 43 to 58 (Table 8).

0117One aspect of the invention is a method for treating autoimmune disease comprising administering to an individual an effective amount of an anti-IFN-gamma polypeptide further comprising at least one polypeptide selected from the group consisting of anti- TNF-alpha polypeptide, anti-IFN-gamma receptor polypeptide and anti-TNF-alpha receptor polypeptide, such polypeptides joined to each other as described below or given seperately. Another embodiment of the invention is an anti-IFN-gamma polypeptide further comprising an anti-IFN-gamma receptor polypeptide for use in treating autoimmune diseases. The aforementioned bifunctional polypeptide may also be used to treat a subject wherein an antagonistic or blocking of the IFN-gamma receptor is required.

0118One aspect of the invention is a composition comprising an anti-IFN-gamma polypeptide as disclosed herein and at least one polypeptide selected from the group consisting of anti-TNF-alpha polypeptide, anti-TNF-alpha receptor polypeptide and anti-IFN-gamma receptor polypeptide, for simultaneous, separate or sequential administration to a subject.

0119One aspect of the invention is a method for treating autoimmune disease comprising administering to an individual an effective amount of an anti-IFN-gamma polypeptide and a least one polypeptide selected from the group consisting of anti-TNF-alpha polypeptide, anti-IFN-gamma receptor polypeptide and anti-TNF-alpha receptor polypeptide, simultaneously, separately or sequentially.

0120Another aspect of the invention is a kit containing an anti-IFN-gamma polypeptide and at least one polypeptide selected from the group consisting of anti-TNF-alpha polypeptide, anti-IFN-gamma receptor polypeptide and anti-TNF-alpha receptor polypeptide for simultaneous, separate or sequential administration to a subject. It is an aspect of the invention that the kit may be used according to the invention. It is an aspect of the invention that the kit may be used to treat the diseases as cited herein.

0121By simultaneous administration means the polypeptides are administered to a subject at the same time. For example, as a mixture of the polypeptides or a composition comprising said polypeptides. Examples include, but are not limited to a solution administered intraveneously, a tablet, liquid, topical cream, etc., wherein each preparation comprises the polypeptides of interest.

0122By separate administration means the polypeptides are administered to a subject at the same time or substantially the same time. The polypeptides are present in the kit as separate, unmixed preparations. For example, the different polypeptides may be present in the kit as individual tablets. The tablets may be administered to the subject by swallowing both tablets at the same time, or one tablet directly following the other. By sequential administration means the polypeptides are administered to a subject sequentially. The polypeptides are present in the kit as separate, unmixed preparations. There is a time interval between doses. For example, one polypeptide might be administered up to 336, 312, 288, 264, 240, 216, 192, 168, 144, 120, 96, 72, 48, 24, 20, 16, 12, 8, 4, 2, 1 , or 0.5 hours after the other component.

0123In sequential administration, one polypeptide may be administered once, or any number of times and in various doses before and/or after administration of another polypeptide. Sequential administration may be combined with simultaneous or sequential administration.

0124The medical uses of the anti-IFN-gamma polypeptide described below, also apply to the composition comprising an anti-IFN-gamma polypeptide as disclosed herein and at least one polypeptide selected from the group consisting of anti-TNF-alpha polypeptide, anti- TNF-alpha receptor polypeptide and anti-IFN-gamma receptor polypeptide, for simultaneous, separate or sequential administration to a subject as disclosed here above.

0125Another embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein, wherein the number of single domain antibodies directed against IFN- gamma is two or more. Such multivalent anti-IFN-gamma polypeptides as disclosed herein have the advantage of unusually high functional affinity for the target, displaying much higher than expected inhibitory properties compared to their monovalent counterparts.

0126Another embodiment of the present invention is an anti-IFN-gamma polypeptide wherein the number of single domain antibodies directed against IFN-gamma is two or more, said anti-IFN-gamma polypeptide comprises a sequence corresponding to any represented by SEQ ID NOs: 59 to 61 (Table 9).

0127The multivalent anti-IFN-gamma polypeptides have functional affinities that are several orders of magnitude higher than the monovalent parent anti-IFN-gamma polypeptides. The inventors have found that the functional affinities of these multivalent polypeptides are much higher than those reported in the prior art for bivalent and multivalent antibodies. Surprisingly, anti-IFN-gamma polypeptides of the present invention linked to each other directly or via a short linker sequence show much higher functional affinities than those found with multivalent conventional four-chain antibodies. The inventors have found that such large increased functional activities can be detected preferably with antigens composed of multidomain and multimeric proteins, either in straight binding assays or in functional assays, e.g. cytotoxicity assays.

0128A multivalent anti-IFN-gamma polypeptide as used herein refers to a polypeptide comprising two or more anti-IFN-gamma polypeptides which have been covalently linked. The anti-IFN-gamma polypeptides may be identical in sequence or may be different in sequence, but are directed against the same target or antigen. Depending on the number of anti-IFN-gamma polypeptides linked, a multivalent anti-IFN-gamma polypeptide may be bivalent (2 anti-IFN-gamma polypeptides), trivalent (3 anti-IFN-gamma polypeptides), tetravalent (4 anti-IFN-gamma polypeptides) or have a higher valency molecules.

0129According to one aspect of the present invention, the anti-IFN-gamma polypeptides are linked to each other directly, without use of a linker. According to another aspect of the present invention, the anti-IFN-gamma polypeptides are linked to each other via a peptide linker sequence. Such linker sequence may be a naturally occurring sequence or a non- naturally occurring sequence. The linker sequence is expected to be non-immunogenic in the subject to which the anti-IFN-gamma polypeptides is administered. The linker sequence may provide sufficient flexibility to the multivalent anti-IFN-gamma polypeptide, at the same time being resistant to proteolytic degradation. A non-limiting example of a linker sequences is one that can be derived from the hinge region of VHHs described in WO 96/34103.

0130It is an aspect of the invention that the multivalent anti-IFN-gamma polypeptides disclosed above may be used instead of or as well as the single unit anti-IFN-gamma polypeptides in the above mentioned therapies and methods of delivery.

0131The single domain antibodies may be joined to form any of the polypeptides disclosed herein comprising more than one single domain antibody using methods known in the art or any future method. For example, they may be fused by chemical cross-linking by reacting amino acid residues with an organic derivatising agent such as described by Blattler et al, Biochemistry 24,1517-1524; EP294703. Alternatively, the single domain antibody may be fused genetically at the DNA level i.e. a polynucleotide construct formed which encodes the complete polypeptide construct comprising one or more anti-target single domain antibodies. A method for producing bivalent or multivalent VHH polypeptide constructs is disclosed in PCT patent application WO 96/34103. One way of VHH antibodies is via the genetic route by linking a VHH antibody coding sequences either directly or via a peptide linker. For example, the C-terminal end of the VHH antibody may be linked to the N-terminal end of the next single domain antibody. This linking mode can be extended in order to link additional single domain antibodies for the construction and production of tri-, tetra-, etc. functional constructs.

0132According to one aspect of the present invention, the single domain antibodies are linked to each other directly, without use of a linker. Contrary to joining bulky conventional antibodies where a linker sequence is needed to retain binding activity in the two subunits, polypeptides of the invention can be linked directly thereby avoiding potential problems of the linker sequence, such as antigenicity when administered to a human subject, instability of the linker sequence leading to dissociation of the subunits.

0133According to another aspect of the present invention, the single domain antibodies are linked to each other via a peptide linker sequence. Such linker sequence may be a naturally occurring sequence or a non-naturally occurring sequence. The linker sequence is expected to be non-immunogenic in the subject to which the anti-IFN-gamma polypeptide is administered. The linker sequence may provide sufficient flexibility to the anti-IFN-gamma polypeptide, at the same time being resistant to proteolytic degradation. A non-limiting example of a linker sequences is one that can be derived from the hinge region of VHHs described in WO 96/34103.

0134According to another aspect of the invention, multivalent single domain antibodies comprising more than two single domain antibodies can be linked to each other either directly or via a linker sequence. Such constructs are difficult to produce with conventional antibodies and due to steric hindrance of the bulky subunits, functionality will be lost or greatly diminished rather than increased considerably as seen with VHH's of the invention compared to the monovalent construct.

0135The polypeptide constructs disclosed herein may be made by the skilled artisan according to methods known in the art or any future method. For example, VHHs may be obtained using methods known in the art such as by immunising a camel and obtaining hybridomas therefrom, or by cloning a library of single domain antibodies using molecular biology techniques known in the art and subsequent selection by using phage display. According to an aspect of the invention an anti-IFN-gamma polypeptide may be a homologous sequence of a full-length anti-IFN-gamma polypeptide. According to another aspect of the invention, an anti-IFN-gamma polypeptide may be a functional portion of a full-length anti-IFN-gamma polypeptide. According to another aspect of the invention, an anti-IFN-gamma polypeptide may be a homologous sequence of a full length anti-IFN- gamma polypeptide. According to another aspect of the invention, an anti-IFN-gamma polypeptide may be a functional portion of a homologous sequence of a full length anti- IFN-gamma polypeptide. According to an aspect of the invention an anti-IFN-gamma polypeptide may comprise a sequence of an anti-IFN-gamma polypeptide.

0136According to an aspect of the invention a single domain antibody used to form an anti- IFN-gamma polypeptide may be a complete single domain antibody (e.g. a VHH) or a homologous sequence thereof. According to another aspect of the invention, a single domain antibody used to form the anti-IFN-gamma polypeptide may be a functional portion of a complete single domain antibody. According to another aspect of the invention, a single domain antibody used to form the anti-IFN-gamma polypeptide may be a homologous sequence of a complete single domain antibody. According to another aspect of the invention, a single domain antibody used to form the anti-IFN-gamma polypeptide may be a functional portion of a homologous sequence of a complete single domain antibody.

0137As used herein, a homologous sequence of the present invention may comprise additions, deletions or substitutions of one or more amino acids, which do not substantially alter the functional characteristics of the polypeptides of the invention. The number of amino acid deletions or substitutions is preferably up to 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69 or 70 amino acids.

0138A homologous sequence according to the present invention may be a sequence of an anti-IFN-gamma polypeptide modified by the addition, deletion or substitution of amino acids, said modification not substantially altering the functional characteristics compared with the unmodified polypeptide.

0139A homologous sequence of the present invention may be a polypeptide which has been humanised. The humanisation of antibodies of the new class of VHHs would further reduce the possibility of unwanted immunological reaction in a human individual upon administration.

0140A homologous sequence according to the present invention may be a sequence which exists in other Camelidae species such as, for example, camel, llama, dromedary, alpaca, guanaco etc.

0141Where homologous sequence indicates sequence identity, it means a sequence which presents a high sequence identity (more than 70%, 75%, 80%, 85%, 90%, 95% or 98% sequence identity) with the parent sequence and is preferably characterised by similar properties of the parent sequence, namely affinity, said identity calculated using known methods.

0142Alternatively, a homologous sequence may also be any amino acid sequence resulting from allowed substitutions at any number of positions of the parent sequence according to the formula below:

0143Ser substituted by Ser, Thr, Gly, and Asn;

0144Arg substituted by one of Arg, His, Gin, Lys, and Glu;

0145Leu substituted by one of Leu, He, Phe, Tyr, Met, and Val; Pro substituted by one of Pro, Gly, Ala, and Thr;

0146Thr substituted by one of Thr, Pro, Ser, Ala, Gly, His, and Gin;

0147Ala substituted by one of Ala, Gly, Thr, and Pro;

0148Val substituted by one of Val, Met, Tyr, Phe, lie, and Leu;

0149Gly substituted by one of Gly, Ala, Thr, Pro, and Ser; lie substituted by one of lie, Met, Tyr, Phe, Val, and Leu;

0150Phe substituted by one of Phe, Trp, Met, Tyr, lie, Val, and Leu;

0151Tyr substituted by one of Tyr, Trp, Met, Phe, lie, Val, and Leu;

0152His substituted by one of His, Glu, Lys, Gin, Thr, and Arg;

0153Gin substituted by one of Gin, Glu, Lys, Asn, His, Thr, and Arg; Asn substituted by one of Asn, Glu, Asp, Gin, and Ser;

0154Lys substituted by one of Lys, Glu, Gin, His, and Arg;

0155Asp substituted by one of Asp, Glu, and Asn;

0156Glu substituted by one of Glu, Asp, Lys, Asn, Gin, His, and Arg;

0157Met substituted by one of Met, Phe, lie, Val, Leu, and Tyr. A homologous nucleotide sequence according to the present invention may refer to nucleotide sequences of more than 50, 100, 200, 300, 400, 500, 600, 800 or 1000 nucleotides able to hybridize to the reverse-complement of the nucleotide sequence capable of encoding the parent sequence, under stringent hybridisation conditions (such as the ones described by Sambrook et. al., Molecular Cloning, Laboratory Manuel, Cold Spring, Harbor Laboratory press, New York).

0158As used herein, a functional portion refers to a sequence of a single domain antibody that is of sufficient size such that the interaction of interest is maintained with affinity of 1 x 10"6 M or better.

0159Alternatively, a functional portion comprises a partial deletion of the complete amino acid sequence and still maintains the binding site(s) and protein domain(s) necessary for the binding of and interaction with its target.

0160As used herein, a functional portion refers to less than 100% of the complete sequence (e.g., 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 1% etc.), but comprising 5 or more amino acids or 15 or more nucleotides.

0161Targets as mentioned herein such as TNF-alpha, TNF-alpha receptor, IFN-gamma receptor, serum proteins (e.g. serum albumin, serum immunoglobulins, thyroxine-binding protein, transferrin, fibrinogen) and IFN-gamma may be fragments of said targets. Thus a target is also a fragment of said target, capable of eliciting an immune response. A target is also a fragment of said target, capable of binding to a single domain antibody raised against the full length target.

0162A fragment as used herein refers to less than 100% of the sequence (e.g., 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% etc.), but comprising 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more amino acids. A fragment is of sufficient length such that the interaction of interest is maintained with affinity of 1 x 10"6 M or better.

0163A fragment as used herein also refers to optional insertions, deletions and substitutions of one or more amino acids which do not substantially alter the ability of the target to bind to a single domain antibody raised against the wild-type target. The number of amino acid insertions deletions or substitutions is preferably up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69 or 70 amino acids.

0164One embodiment of the present invention relates to a method for preparing modified polypeptides based upon llama antibodies by determining the amino acid residues of the antibody variable domain (VHH) which may be modified without diminishing the native affinity of the domain for antigen and while reducing its immunogenicity with respect to a heterologous species; the use of VHHs having modifications at the identified residues which are useful for administration to heterologous species; and to the VHH so modified.

0165More specifically, the invention relates to the preparation of modified VHHs, which are modified for administration to humans, the resulting VHH themselves, and the use of such "humanized" VHHs in the treatment of diseases in humans. By humanised is meant mutated so that immunogenicity upon administration in human patients is minor or nonexistent. Humanising a polypeptide, according to the present invention, comprises a step of replacing one or more of the Camelidae amino acids by their human counterpart as found in the human consensus sequence, without that polypeptide losing its typical character, i.e. the humanisation does not significantly affect the antigen binding capacity of the resulting polypeptide. Such methods are known by the skilled addressee. Humanization of Camelidae single domain antibodies requires the introduction and mutagenesis of a limited amount of amino acids in a single polypeptide chain. This is in contrast to humanization of scFv, Fab, (Fab)2 and IgG, which requires the introduction of amino acid changes in two chains, the light and the heavy chain and the preservation of the assembly of both chains.

0166Some VHH contain typical Camelidae hallmark residues at position 37, 44, 45 and 47 with hydrophilic characteristics. Replacement of the hydrophilic residues by human hydrophobic residues at positions 44 and 45 (E44G and R45L) did not have an effect on binding and/or inhibition. Further humanization may be required by substitution of residues in FR 1 , such as position 1, 5, 28 and 30; FR3, such as positions 74, 75, 76, 83, 84, 93 and 94; and FR4, such as position 103, 104, 108 and 111 (all numbering according to the Kabat).

0167One embodiment of the present invention is a method for humanizing a VHH comprising the steps of replacing of any of the following residues either alone or in combination: FR1 (position 1 , 5, 28 and 30), the hallmark amino acid at position 44 and 45 in FR2, FR3 residues 74, 75, 76, 83, 84, 93 and 94 , and positions 103, 104, 108 and 111 in FR4 ; (numbering according to the Kabat numbering).

0168One embodiment of the present invention is an anti-IFN gamma polypeptide, or a nucleic acid capable of encoding said polypeptide for use in treating, preventing and/or alleviating the symptoms of disorders relating to inflammatory processes. IFN-gamma is involved in inflammatory processes, and the blocking of IFN-gamma action can have an anti- inflammatory effect, which is highly desirable in certain disease states such as, for example, Crohn's disease. Our Examples demonstrate VHH's according to the invention which bind IFN-gamma and moreover, block its binding to the IFN-gamma receptor.

0169The anti-IFN-gamma polypeptide of the present invention is applicable to autoimmune diseases, such as Addison's disease (adrenal), Autoimmune diseases of the ear (ear), Autoimmune diseases of the eye (eye), Autoimmune hepatitis (liver), Autoimmune parotitis (parotid glands), Crohn's disease (intestine), Diabetes Type I (pancreas), Epididymitis (epididymis), Glomerulonephritis (kidneys), Graves' disease (thyroid), Guillain-Barre syndrome (nerve cells), Hashimoto's disease (thyroid), Hemolytic anemia (red blood cells), Systemic lupus erythematosus (multiple tissues), Male infertility (sperm), Multiple sclerosis (nerve cells), Myasthenia Gravis (neuromuscular junction), Pemphigus (primarily skin), Psoriasis (skin), Rheumatic fever (heart and joints), Rheumatoid arthritis (joint lining), Sarcoidosis (multiple tissues and organs), Scleroderma (skin and connective tissues), Sjogren's syndrome (exocrine glands, and other tissues), Spondyloarthropathies (axial skeleton, and other tissues), Thyroiditis (thyroid), Vasculitis (blood vessels). Within parenthesis is the tissue affected by the disease. This listing of autoimmune diseases is intended to be exemplary rather than inclusive.

0170Autoimmune conditions for which the anti-IFN-gamma polypeptide of the present invention is applicable include, for example, AIDS, atopic allergy, bronchial asthma, eczema, leprosy, schizophrenia, inherited depression, transplantation of tissues and organs, chronic fatigue syndrome, Alzheimer's disease, Parkinson's disease, myocardial infarction, stroke, autism, epilepsy, Arthus's phenomenon, anaphylaxis, and alcohol and drug addiction. In the above-identified autoimmune conditions, the tissue affected is the primary target, in other cases it is the secondary target. These conditions are partly or mostly autoimmune syndromes. Therefore, in treating them, it is possible to use the same methods, or aspects of the same methods that are herein disclosed, sometimes in combination with other methods.

0171Another embodiment of the present invention is a use of an anti-IFN gamma polypeptide, or a nucleic acid capable of encoding said polypeptide for the preparation of a medicament for treating a disorder relating to inflammatory processes.

0172Examples of disorders further include rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis.

0173Polypeptides and nucleic acids according to the present invention may be administered to a subject by conventional routes, such as intravenously. However, a special property of the anti-IFN-gamma polypeptides of the invention is that they are sufficiently small to penetrate barriers such as tissue membranes and/or tumours and act locally thereon, and they are sufficiently stable to withstand extreme environments such as in the stomach. Therefore, another aspect of the present invention relates to the delivery of anti-IFN- gamma polypeptides.

0174A subject according to the invention can be any mammal susceptible to treatment by therapeutic polypeptides.

0175Oral delivery of anti-IFN-gamma polypeptides of the invention results in the provision of such molecules in an active form in the colon at local sites that are affected by the disorder. These sites may be highly inflamed and contain IFN-gamma-producing cells. The anti-IFN-gamma polypeptides of the invention which bind to IFN-gamma can neutralise the IFN-gamma locally, avoiding distribution throughout the whole body and thus limiting negative side-effects. Genetically modified microorganisms such as Micrococcus lactis are able to secrete antibody fragments. Such modified microorganisms can be used as vehicles for local production and delivery of antibody fragments in the intestine. By using a strain which produces a IFN-gamma neutralizing antibody fragment, inflammatory bowel syndrome could be treated.

0176Another aspect of the invention involves delivering anti-INF-gamma polypeptides as described herein by using surface expression on or secretion from non-invasive bacteria, such as Gram-positive host organisms like Lactococcus spec, using a vector such as described in WO 00/23471.

0177One embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein for use in treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able pass through the gastric environment without being inactivated.

0178Examples of disorders are any that cause inflammation, including but not limited to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis. As known by persons skilled in the art, once in possession of said anti- IFN-gamma polypeptide, formulation technology may be applied to release a maximum amount of polypeptide in the right location (in the stomach, in the colon, etc.). This method of delivery is important for treating, prevent and/or alleviate the symptoms of disorder whose targets that are located in the gut system.

0179An aspect of the invention is a method for treating, preventing and/or alleviating the symptoms of a disorder susceptible to modulation by a therapeutic compound that is able pass through the gastric environment without being inactivated, by orally administering to a subject an anti-IFN-gamma polypeptide as disclosed herein.

0180Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as disclosed herein for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able pass through the gastric environment without being inactivated.

0181An aspect of the invention is a method for delivering an IFN-gamma modulator to the gut system without being inactivated, by orally administering to a subject an anti-IFN-gamma polypeptide as disclosed herein .

0182An aspect of the invention is a method for delivering an IFN-gamma modulator to the bloodstream of a subject without being inactivated, by orally administering to a subject an anti-IFN-gamma polypeptide as disclosed herein . Another embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein for use in treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the vaginal and/or rectal tract.

0183Examples of disorders are any that cause inflammation, including but not limited to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis. In a non-limiting example, a formulation according to the invention comprises an anti-IFN-gamma polypeptide as disclosed herein comprising one or more VHHs directed against one or more targets in the form of a gel, cream, suppository, film, or in the form of a sponge or as a vaginal ring that slowly releases the active ingredient over time (such formulations are described in EP 707473, EP 684814, US 5629001).

0184An aspect of the invention is a method for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by a therapeutic compound to the vaginal and/or rectal tract, by vaginally and/or rectally administering to a subject an anti- IFN-gamma polypeptide as disclosed herein.

0185Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as disclosed herein for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the vaginal and/or rectal tract without being inactivated.

0186An aspect of the invention is a method for delivering an IFN-gamma modulator to the vaginal and/or rectal tract without being inactivated, by administering to the vaginal and/or rectal tract of a subject an anti-IFN-gamma polypeptide as disclosed herein .

0187An aspect of the invention is a method for delivering an IFN-gamma modulator to the bloodstream of a subject without being inactivated, by administering to the vaginal and/or rectal tract of a subject an anti-IFN-gamma polypeptide as disclosed herein .

0188Another embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein, for use in treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the nose, upper respiratory tract and/or lung. Examples of disorders are any that cause inflammation, including but not limited to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis. In a non-limiting example, a formulation according to the invention, comprises an anti-IFN-gamma polypeptide as disclosed herein in the form of a nasal spray (e.g. an aerosol) or inhaler. Since the construct is small, it can reach its target much more effectively than therapeutic IgG molecules.

0189An aspect of the invention is a method for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by a IFN-gamma modulator delivered to the upper respiratory tract and lung, by administering to a subject an anti-IFN-gamma polypeptide as disclosed herein, by inhalation through the mouth or nose.

0190Another aspect of the invention is a dispersible VHH composition, in particular dry powder dispersible VHH compositions, such as those described in US 6514496. These dry powder compositions comprise a plurality of discrete dry particles with an average particle size in the range of 0.4-10 mm. Such powders are capable of being readily dispersed in an inhalation device. VHH's are particularly suited for such composition as lyophilized material can be readily dissolved (in the lung subsequent to being inhaled) due to its high solubilisation capacity (Muyldermans, S., Reviews in Molecular Biotechnology, 74, 277- 303, (2001)). Alternatively, such lyophilized VHH formulations can be reconstituted with a diluent to generate a stable reconstituted formulation suitable for subcutaneous administration. For example, anti-lgE antibody formulations (Example 1; US 6267958, EP 841946) have been prepared which are useful for treating allergic asthma.

0191Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as disclosed herein for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the nose, upper respiratory tract and/or lung without being inactivated.

0192An aspect of the invention is a method for delivering an IFN-gamma modulator to the nose, upper respiratory tract and lung, by administering to the nose, upper respiratory tract and/or lung of a subject an anti-IFN-gamma polypeptide as disclosed herein .

0193An aspect of the invention is a method for delivering an IFN-gamma modulator to the nose, upper respiratory tract and/or lung without being inactivated, by administering to the nose, upper respiratory tract and/or lung of a subject an anti-IFN-gamma polypeptide as disclosed herein .

0194An aspect of the invention is a method for delivering an IFN-gamma modulator to the bloodstream of a subject without being inactivated by administering to the nose, upper respiratory tract and/or lung of a subject an anti-IFN-gamma polypeptide as disclosed herein .

0195One embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein as disclosed herein for use in treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the intestinal mucosa, wherein said disorder increases the permeability of the intestinal mucosa. Because of their small size, an anti-IFN-gamma polypeptides as disclosed herein can pass through the intestinal mucosa and reach the bloodstream more efficiently in subjects suffering from disorders which cause an increase in the permeability of the intestinal mucosa, for example Crohn's disease.

0196An aspect of the invention is a method for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the intestinal mucosa, wherein said disorder increases the permeability of the intestinal mucosa, by orally administering to a subject an anti-IFN-gamma polypeptide as disclosed herein.

0197This process can be even further enhanced by an additional aspect of the present invention - the use of active transport carriers. In this aspect of the invention, VHH is fused to a carrier that enhances the transfer through the intestinal wall into the bloodstream. In a non-limiting example, this "carrier" is a second VHH which is fused to the therapeutic VHH. Such fusion constructs are made using methods known in the art. The "carrier" VHH binds specifically to a receptor on the intestinal wall which induces an active transfer through the wall.

0198Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as disclosed herein for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator delivered to the intestinal mucosa, wherein said disorder increases the permeability of the intestinal mucosa. An aspect of the invention is a method for delivering an IFN-gamma modulator to the intestinal mucosa without being inactivated, by administering orally to a subject an anti- IFN-gamma polypeptide as disclosed herein.

0199An aspect of the invention is a method for delivering an IFN-gamma modulator to the bloodstream of a subject without being inactivated, by administering orally to a subject an anti-IFN-gamma polypeptide as disclosed herein.

0200This process can be even further enhanced by an additional aspect of the present invention - the use of active transport carriers. In this aspect of the invention, an anti-IFN- gamma polypeptide as disclosed herein is fused to a carrier that enhances the transfer through the intestinal wall into the bloodstream. In a non-limiting example, this "carrier" is a VHH which is fused to said polypeptide. Such fusion constructs made using methods known in the art. The "carrier" VHH binds specifically to a receptor on the intestinal wall which induces an active transfer through the wall.

0201One embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein for use in treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able pass through the tissues beneath the tongue effectively. Examples of disorders are any that cause inflammation, including but not limited to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis. A formulation of said anti- IFN-gamma polypeptide as disclosed herein, for example, a tablet, spray, drop is placed under the tongue and adsorbed through the mucus membranes into the capillary network under the tongue.

0202An aspect of the invention is a method for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able pass through the tissues beneath the tongue effectively, by sublingually administering to a subject an anti-IFN-gamma polypeptide.

0203Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as disclosed herein for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able to pass through the tissues beneath the tongue. An aspect of the invention is a method for delivering an IFN-gamma modulator to the tissues beneath the tongue without being inactivated, by administering orally to a subject an anti-IFN-gamma polypeptide as disclosed herein .

0204An aspect of the invention is a method for delivering an IFN-gamma modulator to the bloodstream of a subject without being inactivated, by administering orally to a subject an anti-IFN-gamma polypeptide as disclosed herein .

0205One embodiment of the present invention is an anti-IFN-gamma polypeptide as disclosed herein comprising at least one single domain antibody for use in treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able pass through the skin effectively. Examples of disorders are any that cause inflammation, including but not limited to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, complications associated with corneal eye transplant and multiple sclerosis. A formulation of said anti-IFN-gamma polypeptide, for example, a cream, film, spray, drop, patch, is placed on the skin and passes through.

0206An aspect of the invention is a method for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by a therapeutic compound that is able pass through the skin effectively, by topically administering to a subject an anti-IFN- gamma polypeptide as disclosed herein.

0207Another aspect of the invention is the use of an anti-IFN-gamma polypeptide as disclosed herein as a topical ophthalmic composition for the treatment of ocular disorder, such as allergic disorders, which method comprises the topical administration of an ophthalmic composition comprising anti-IFN-gamma polypeptide as disclosed herein, said construct further comprising one or more anti-lgE VHH.

0208Another embodiment of the present invention is a use of an anti-IFN-gamma polypeptide as disclosed herein as disclosed herein for the preparation of a medicament for treating, preventing and/or alleviating the symptoms of disorders susceptible to modulation by an IFN-gamma modulator that is able pass through the skin effectively.

0209An aspect of the invention is a method for delivering an IFN-gamma modulator to the skin without being inactivated, by administering topically to a subject an anti-IFN-gamma polypeptide as disclosed herein . An aspect of the invention is a method for delivering an IFN-gamma modulator to the bloodstream of a subject, by administering topically to a subject an anti-IFN-gamma polypeptide as disclosed herein .

0210In another embodiment of the present invention, an anti-IFN-gamma polypeptide as disclosed herein further comprises a carrier single domain antibody (e.g. VHH) which acts as an active transport carrier for transport said anti-IFN-gamma polypeptide as disclosed herein, the lung lumen to the blood.

0211Examples of disorders are any that cause inflammation, including but not limited to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis.

0212A anti-IFN-gamma polypeptide further comprising a carrier binds specifically to a receptor present on the mucosal surface (bronchial epithelial cells) resulting in the active transport of the polypeptide from the lung lumen to the blood. The carrier single domain antibody may be fused to the anti-IFN-gamma polypeptide. Such fusion constructs made using methods known in the art and are described herein. The "carrier" single domain antibody binds specifically to a receptor on the mucosal surface which induces an active transfer through the surface.

0213Another aspect of the present invention is a method to determine which single domain antibodies (e.g. VHHs) are actively transported into the bloodstream upon nasal administration. Similarly, a naϊve or immune VHH phage library can be administered nasally, and after different time points after administration, blood or organs can be isolated to rescue phages that have been actively transported to the bloodstream. A non-limiting example of a receptor for active transport from the lung lumen to the bloodstream is the Fc receptor N (FcRn). One aspect of the invention includes the VHH molecules identified by the method. Such VHH can then be used as a carrier VHH for the delivery of a therapeutic VHH to the corresponding target in the bloodstream upon nasal administration.

0214In one aspect of the invention, one can use an anti-IFN-gamma polypeptide as disclosed herein an homologous sequence thereof, a functional portion thereof or a functional portion thereof an homologous sequence thereof, in order to screen for agents that modulate the binding of the polypeptide to IFN-gamma. When identified in an assay that measures binding or said polypeptide displacement alone, agents will have to be subjected to functional testing to determine whether they would modulate the action of the antigen in vivo. Examples of screening assays are given below primarily in respect of SEQ ID NO: 3, though any anti-IFN-gamma polypeptide may be appropriate.

0215In an example of a displacement experiment, phage or cells expressing IFN-gamma or a fragment thereof are incubated in binding buffer with, for example, a polypeptide represented by SEQ ID NO: 3 which has been labeled, in the presence or absence of increasing concentrations of a candidate modulator. To validate and calibrate the assay, control competition reactions using increasing concentrations of said polypeptide and which is unlabeled, can be performed. After incubation, cells are washed extensively, and bound, labeled polypeptide is measured as appropriate for the given label (e.g., scintillation counting, fluorescence, etc.). A decrease of at least 10% in the amount of labeled polypeptide bound in the presence of candidate modulator indicates displacement of binding by the candidate modulator. Candidate modulators are considered to bind specifically in this or other assays described herein if they displace 50% of labeled polypeptide (sub-saturating polypeptide dose) at a concentration of 1 μM or less.

0216Alternatively, binding or displacement of binding can be monitored by surface plasmon resonance (SPR). Surface plasmon resonance assays can be used as a quantitative method to measure binding between two molecules by the change in mass near an immobilized sensor caused by the binding or loss of binding of, for example, the polypeptide represented by SEQ ID NO: 3 from the aqueous phase to IFN-gamma, or fragment thereof immobilized in a membrane on the sensor. This change in mass is measured as resonance units versus time after injection or removal of the said polypeptide or candidate modulator and is measured using a Biacore Biosensor (Biacore AB). IFN-gamma, or fragment thereof can be for example immobilized on a sensor chip (for example, research grade CM5 chip; Biacore AB) in a thin film lipid membrane according to methods described by Salamon et al. (Salamon et al., 1996, Biophys J. 71: 283-294; Salamon et al., 2001, Biophys. J. 80: 1557-1567; Salamon et al., 1999, Trends Biochem. Sci. 24: 213-219, each of which is incorporated herein by reference.). Sarrio et. al. demonstrated that SPR can be used to detect ligand binding to the GPCR A(1) adenosine receptor immobilized in a lipid layer on the chip (Sarrio et al., 2000, Mol. Cell. Biol. 20: 5164-5174, incorporated herein by reference). Conditions for the binding of SEQ ID NO:3 to IFN-gamma, or fragment thereof in an SPR assay can be fine-tuned by one of skill in the art using the conditions reported by Sarrio et al. as a starting point.

0217SPR can assay for modulators of binding in at least two ways. First, a polypeptide represented by SEQ ID NO: 3, for example, can be pre-bound to immobilized IFN-gamma, or fragment thereof, followed by injection of candidate modulator at a concentration ranging from 0.1 nM to 1 μM. Displacement of the bound polypeptide can be quantitated, permitting detection of modulator binding. Alternatively, the membrane-bound IFN- gamma, or fragment thereof can be pre-incubated with a candidate modulator and challenged with, for example, a polypeptide represented by SEQ ID NO: 3. A difference in binding affinity between said polypeptide and IFN-gamma, or fragment thereof pre- incubated with the modulator, compared with that between said polypeptide and IFN- gamma, or fragment thereof in absence of the modulator will demonstrate binding or displacement of said polypeptide in the presence of modulator. In either assay, a decrease of 10% or more in the amount of said polypeptide bound in the presence of candidate modulator, relative to the amount of said polypeptide bound in the absence of candidate modulator indicates that the candidate modulator inhibits the interaction of IFN- gamma, or fragment thereof and said polypeptide.

0218Another method of detecting inhibition of binding of, for example, a polypeptide represented by SEQ ID NO: 3, to IFN-gamma, or fragment thereof uses fluorescence resonance energy transfer (FRET). FRET is a quantum mechanical phenomenon that occurs between a fluorescence donor (D) and a fluorescence acceptor (A) in close proximity to each other (usually < 100 A of separation) if the emission spectrum of D overlaps with the excitation spectrum of A. The molecules to be tested, e.g. a polypeptide represented by SEQ ID NO: 3 and a IFN-gamma, or fragment thereof, are labelled with a complementary pair of donor and acceptor fluorophores. While bound closely together by the IFN-gamma: polypeptide interaction, the fluorescence emitted upon excitation of the donor fluorophore will have a different wavelength from that emitted in response to that excitation wavelength when the said polypeptide and IFN-gamma, or fragment thereof are not bound, providing for quantitation of bound versus unbound molecules by measurement of emission intensity at each wavelength. Donor fluorophores with which to label the IFN-gamma, or fragment thereof are well known in the art. Of particular interest are variants of the A. Victoria GFP known as Cyan FP (CFP, Donor (D)) and Yellow FP (YFP, Acceptor (A)). As an example, the YFP variant can be made as a fusion protein with IFN-gamma, or fragment thereof. Vectors for the expression of GFP variants as fusions (Clontech) as well as flurophore-labeled reagents (Molecular Probes) are known in the art. The addition of a candidate modulator to the mixture of fluorescently-labelled polypeptide and YFP-IFN-gamma will result in an inhibition of energy transfer evidenced by, for example, a decrease in YFP fluorescence relative to a sample without the candidate modulator. In an assay using FRET for the detection of IFN-gamma : polypeptide interaction, a 10% or greater decrease in the intensity of fluorescent emission at the acceptor wavelength in samples containing a candidate modulator, relative to samples without the candidate modulator, indicates that the candidate modulator inhibits the IFN-gamma:polypeptide interaction.

0219A sample as used herein may be any biological sample containing IFN-gamma such as clinical (e.g. cell fractions, whole blood, plasma, serum, tissue, cells, etc.), derived from clinical, agricultural, forensic, research, or other possible samples. The clinical samples may be from human or animal origin. The sample analysed can be both solid or liquid in nature. It is evident when solid materials are used, these are first dissolved in a suitable solution.

0220A variation on FRET uses fluorescence quenching to monitor molecular interactions. One molecule in the interacting pair can be labelled with a fluorophore, and the other with a molecule that quenches the fluorescence of the fluorophore when brought into close apposition with it. A change in fluorescence upon excitation is indicative of a change in the association of the molecules tagged with the fluorophore:quencher pair. Generally, an increase in fluorescence of the labelled IFN-gamma, or fragment thereof is indicative that anti-IFN-gamma polypeptide bearing the quencher has been displaced. For quenching assays, a 10% or greater increase in the intensity of fluorescent emission in samples containing a candidate modulator, relative to samples without the candidate modulator, indicates that the candidate modulator inhibits IFN-gamma: anti-IFN-gamma polypeptide interaction.

0221In addition to the surface plasmon resonance and FRET methods, fluorescence polarization measurement is useful to quantitate binding. The fluorescence polarization value for a fluorescently-tagged molecule depends on the rotational correlation time or tumbling rate. Complexes, such as those formed by IFN-gamma, or fragment thereof associating with a fluorescently labelled anti-IFN-gamma polypeptide, have higher polarization values than uncomplexed, labelled polypeptide. The inclusion of a candidate inhibitor of the IFN-gamma:anti-IFN-gamma polypeptide interaction results in a decrease in fluorescence polarization, relative to a mixture without the candidate inhibitor, if the candidate inhibitor disrupts or inhibits the interaction of IFN-gamma, or fragment thereof with said polypeptide. Fluorescence polarization is well suited for the identification of small molecules that disrupt the formation of IFN-gamma:anti-IFN-gamma polypeptide complexes. A decrease of 10% or more in fluorescence polarization in samples containing a candidate modulator, relative to fluorescence polarization in a sample lacking the candidate modulator, indicates that the candidate modulator inhibits the IFN- gamma:anti-IFN-gamma polypeptide interaction.

0222Another alternative for monitoring IFN-gamma : anti-IFN-gamma polypeptide interactions uses a biosensor assay. ICS biosensors have been described in the art (Australian Membrane Biotechnology Research Institute; Cornell B, Braach-Maksvytis V, King L, Osman P, Raguse B, Wieczorek L, and Pace R. "A biosensor that uses ion-channel switches" Nature 1997, 387, 580). In this technology, the association of IFN-gamma, or fragment thereof and a anti-IFN-gamma polypeptide is coupled to the closing of gramacidin-facilitated ion channels in suspended membrane bilayers and thus to a measurable change in the admittance (similar to impedence) of the biosensor. This approach is linear over six orders of magnitude of admittance change and is ideally suited for large scale, high throughput screening of small molecule combinatorial libraries. A 10% or greater change (increase or decrease) in admittance in a sample containing a candidate modulator, relative to the admittance of a sample lacking the candidate modulator, indicates that the candidate modulator inhibits the interaction of IFN-gamma, or fragment thereof and said polypeptide. It is important to note that in assays testing the interaction of IFN-gamma, or fragment thereof with an anti-IFN-gamma polypeptide, it is possible that a modulator of the interaction need not necessarily interact directly with the domain(s) of the proteins that physically interact with said polypeptide. It is also possible that a modulator will interact at a location removed from the site of interaction and cause, for example, a conformational change in the IFN-gamma. Modulators (inhibitors or agonists) that act in this manner are nonetheless of interest as agents to modulate the binding of IFN-gamma to its receptor.

0223Any of the binding assays described can be used to determine the presence of an agent in a sample, e.g., a tissue sample, that binds to IFN-gamma, or fragment thereof, or that affects the binding of, for example, a polypeptide represented by SEQ ID NO: 3 to the IFN-gamma, or fragment thereof. To do so a IFN-gamma, or fragment thereof is reacted with said polypeptide in the presence or absence of the sample, and polypeptide binding is measured as appropriate for the binding assay being used. A decrease of 10% or more in the binding of said polypeptide indicates that the sample contains an agent that modulates the binding of said polypeptide to the IFN-gamma, or fragment thereof. Of course, the above-generalized method might easily be applied to screening for candidate modulators which alter the binding between any anti-IFN-gamma polypeptide of the invention, an homologous sequence thereof, a functional portion thereof or a functional portion of an homologous sequence thereof, and IFN-gamma or a fragment thereof.

0224One embodiment of the present invention is an unknown agent identified by the method disclosed herein.

0225One embodiment of the present invention is an unknown agent identified by the method disclosed herein for use in treating, preventing and/or alleviating the symptoms of disorders relating to inflammatory processes.

0226Another embodiment of the present invention is a use of an unknown agent identified by the method disclosed herein for use in treating, preventing and/or alleviating the symptoms of disorders relating to inflammatory processes.

0227Examples of disorders include rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis

0228A cell that is useful according to the invention is preferably selected from the group consisting of bacterial cells such as, for example, E. coli, yeast cells such as, for example, S. cerevisiae, P. pastoris, insect cells or mammal cells.

0229A cell that is useful according to the invention can be any cell into which a nucleic acid sequence encoding a polypeptide comprising an anti-IFN-gamma of the invention, an homologous sequence thereof, a functional portion thereof or a functional portion of an homologous sequence thereof according to the invention can be introduced such that the polypeptide is expressed at natural levels or above natural levels, as defined herein. Preferably a polypeptide of the invention that is expressed in a cell exhibits normal or near normal pharmacology, as defined herein. Most preferably a polypeptide of the invention that is expressed in a cell comprises the nucleotide sequence capable of encoding any one of the amino acid sequences presented in Table 4 and 5 or capable of encoding an amino acid sequence that is at least 70% identical to the amino acid sequence presented in Table 4 and 5.

0230According to a preferred embodiment of the present invention, a cell is selected from the group consisting of COS7-cells, a CHO cell, a LM (TK-) cell, a NIH-3T3 cell, HEK-293 cell, K-562 cell or a 1321N1 astrocytoma cell but also other transfectable cell lines.

0231In general, "therapeutically effective amount", "therapeutically effective dose" and "effective amount" means the amount needed to achieve the desired result or results (modulating IFN-gamma binding; treating or preventing inflammation). One of ordinary skill in the art will recognize that the potency and, therefore, an "effective amount" can vary for the various compounds that modulate IFN-gamma binding used in the invention. One skilled in the art can readily assess the potency of the compound.

0232As used herein, the term "compound" refers to an anti-IFN-gamma polypeptide or a composition of the present invention, or a nucleic acid capable of encoding said polypeptide (or composition) or an agent identified according to the screening method described herein, or said polypeptides comprising one or more derivatised amino acids.

0233By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with the compound without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

0234The anti-IFN polypeptides of the present invention are useful for treating or preventing conditions in a subject and comprises administering a pharmaceutically effective amount of a compound or composition.

0235The anti-IFN polypeptides of the present invention are useful for treating or preventing conditions relating to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis in a subject and comprises administering a pharmaceutically effective amount of a compound or composition that binds IFN-gamma. The anti-IFN-gamma polypeptides as disclosed here in are useful for treating or preventing conditions in a subject and comprises administering a pharmaceutically effective amount of a compound combination with another, such as, for example, aspirin.

0236The anti-IFN-gamma polypeptides as disclosed here in are useful for treating or preventing conditions relating to rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory, bowel syndrome and multiple sclerosis in a subject and comprises administering a pharmaceutically effective amount of a compound combination with another, such as, for example, aspirin.

0237The present invention is not limited to the administration of formulations comprising a single compound of the invention. It is within the scope of the invention to provide combination treatments wherein a formulation is administered to a patient in need thereof that comprises more than one compound of the invention.

0238Conditions mediated by IFN-gamma include, but are not limited rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome and multiple sclerosis.

0239A compound useful in the present invention can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human patient or a domestic animal in a variety of forms adapted to the chosen route of administration, i.e. but not limited to, orally or parenterally, intranassally by inhalation, intravenous, intramuscular, topical or subcutaneous routes.

0240A compound of the present invention can also be administered using gene therapy methods of delivery. See, e.g., U.S. Patent No. 5,399,346, which is incorporated by reference in its entirety. Using a gene therapy method of delivery, primary cells transfected with the gene for the compound of the present invention can additionally be transfected with tissue specific promoters to target specific organs, tissue, grafts, tumors, or cells.

0241Thus, the present compound may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.

0242The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.

0243The active compound may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

0244The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form must be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

0245Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

0246For topical administration, the present compound may be applied in pure form, i.e., when they are liquids. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.

0247Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, hydroxyalkyls or glycols or water-alcohol/glycol blends, in which the present compound can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers. Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.

0248Examples of useful dermatological compositions which can be used to deliver the compound to the skin are known to the art; for example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508).

0249Useful dosages of the compound can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949.

0250Generally, the concentration of the compound(s) in a liquid composition, such as a lotion, will be from about 0.1-25 wt-%, preferably from about 0.5-10 wt-%. The concentration in a semi-solid or solid composition such as a gel or a powder will be about 0.1-5 wt-%, preferably about 0.5-2.5 wt-%.

0251The amount of the compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician. Also the dosage of the compound varies depending on the target cell, tumor, tissue, graft, or organ.

0252The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye.

0253An administration regimen could include long-term, daily treatment. By "long-term" is meant at least two weeks and preferably, several weeks, months, or years of duration.

0254Necessary modifications in this dosage range may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. See Remington's Pharmaceutical Sciences (Martin, E.W., ed. 4), Mack Publishing Co., Easton, PA. The dosage can also be adjusted by the individual physician in the event of any complication.

0255The invention provides for an agent that is a modulator of IFN-gamma / IFN-gamma- receptor interactions.

0256The candidate agent may be a synthetic agent, or a mixture of agents, or may be a natural product (e.g. a plant extract or culture supernatant). A candidate agent according to the invention includes a small molecule that can be synthesized, a natural extract, peptides, proteins, carbohydrates, lipids etc.

0257Candidate modulator agents from large libraries of synthetic or natural agents can be screened. Numerous means are currently used for random and directed synthesis of saccharide, peptide, and nucleic acid based agents. Synthetic agent libraries are commercially available from a number of companies including Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Brandon Associates (Merrimack, NH), and Microsource (New Milford, CT). A rare chemical library is available from Aldrich (Milwaukee, Wl). Combinatorial libraries are available and can be prepared. Alternatively, libraries of natural agents in the form of bacterial, fungal, plant and animal extracts are available from e.g., Pan Laboratories (Bothell, WA) or MycoSearch (NC), or are readily producible by methods well known in the art. Additionally, natural and synthetically produced libraries and agents are readily modified through conventional chemical, physical, and biochemical means.

0258Useful agents may be found within numerous chemical classes. Useful agents may be organic agents, or small organic agents. Small organic agents have a molecular weight of more than 50 yet less than about 2,500 daltons, preferably less than about 750, more preferably less than about 350 daltons. Exemplary classes include heterocycles, peptides, saccharides, steroids, and the like. The agents may be modified to enhance efficacy, stability, pharmaceutical compatibility, and the like. Structural identification of an agent may be used to identify, generate, or screen additional agents. For example, where peptide agents are identified, they may be modified in a variety of ways to enhance their stability, such as using an unnatural amino acid, such as a D-amino acid, particularly D- alanine, by functionalizing the amino or carboxylic terminus, e.g. for the amino group, acylation or alkylation, and for the carboxyl group, esterification or amidification, or the like.

0259For primary screening, a useful concentration of a candidate agent according to the invention is from about 10 mM to about 100 μM or more (i.e. 1 mM, 10 mM, 100 mM, 1 M etc.). The primary screening concentration will be used as an upper limit, along with nine additional concentrations, wherein the additional concentrations are determined by reducing the primary screening concentration at half-log intervals (e.g. for 9 more concentrations) for secondary screens or for generating concentration curves.

0260A high throughput screening kit according to the invention comprises all the necessary means and media for performing the detection of an agent that modulates IFN- gamma/IFN-gamma receptor interactions by interacting with IFN-gamma, or fragment thereof in the presence of a polypeptide, preferably at a concentration in the range of 1μM to l mM.

0261The kit comprises the following. Recombinant cells of the invention, comprising and expressing the nucleotide sequence encoding IFN-gamma, or fragment thereof, which are grown according to the kit on a solid support, such as a microtiter plate, more preferably a 96 well microtiter plate, according to methods well known to the person skilled in the art especially as described in WO 00/02045. Alternatively IFN-gamma, or fragment thereof is supplied in a purified form to be immobilized on, for example, a 96 well microtiter plate by the person skilled in the art. Alternatively IFN-gamma, or fragment thereof is supplied in the kit pre-immobilized on, for example, a 96 well microtiter plate. The IFN-gamma may be whole IFN-gamma or a fragment thereof.

0262Modulator agents according to the invention, at concentrations from about 1 μM to 1 mM or more, are added to defined wells in the presence of an appropriate concentration of anti-IFN-gamma polypeptide, an homologous sequence thereof, a functional portion thereof or a functional portion of an homologous sequence thereof, said concentration of said polypeptide preferably in the range of 1 μM to 1 mM. Kits may contain one or more anti-IFN-gamma polypeptide (e.g. one or more of a polypeptide represented by any of the SEQ ID NOs: 1 to 29 or other anti-IFN-gamma polypeptides, an homologous sequence thereof, a functional portion thereof or a functional portion of an homologous sequence thereof). Binding assays are performed as according to the methods already disclosed herein and the results are compared to the baseline level of, for example IFN-gamma, or fragment thereof binding to an anti-IFN-gamma polypeptide, an homologous sequence thereof, a functional portion thereof or a functional portion of an homologous sequence thereof , but in the absence of added modulator agent. Wells showing at least 2 fold, preferably 5 fold, more preferably 10 fold and most preferably a 100 fold or more increase or decrease in IFN-gamma-polypeptide binding (for example) as compared to the level of activity in the absence of modulator, are selected for further analysis.

0263The invention provides for kits useful for screening for modulators of IFN-gamma/IFN- gamma receptor binding, as well as kits useful for diagnosis of disorders characterised by dysfunction of IFN-gamma. The invention also provides for kits useful for screening for modulators of disorders as well as kits for their diagnosis, said disorders characterised by one or more process involving IFN-gamma. Kits useful according to the invention can include an isolated IFN-gamma, or fragment thereof. Alternatively, or in addition, a kit can comprise cells transformed to express IFN-gamma, or fragment thereof. In a further embodiment, a kit according to the invention can comprise a polynucleotide encoding IFN- gamma, or fragment thereof. In a still further embodiment, a kit according to the invention may comprise the specific primers useful for amplification of IFN-gamma, or fragment thereof. Kits useful according to the invention can comprise an isolated IFN-gamma polypeptide, a homologue thereof, or a functional portion thereof. A kit according to the invention can comprise cells transformed to express said polypeptide. Kits may contain more than one polypeptide. In a further embodiment, a kit according to the invention can comprise a polynucleotide encoding IFN-gamma, or fragment thereof. In a still further embodiment, a kit according to the invention may comprise the specific primers useful for amplification of a macromolecule such as, for example, IFN-gamma, or a fragment thereof. All kits according to the invention will comprise the stated items or combinations of items and packaging materials therefore. Kits will also include instructions for use.

EXAMPLES

0265The invention is illustrated by the following non-limiting examples.

0266Example 1: Immunization

0267Four llama's (llama 5, 6, 22 and 23) were immunized intramuscularly with human IFN- gamma (PeproTech Inc, USA, Cat Nr: 300-02) using an appropriate animal-friendly adjuvant Stimune (Cedi Diagnostics BV, The Netherlands). Two llama's (llama 29 and 31) were immunized intramuscularly with mouse IFN-gamma (Protein Expression & Purification core facility, VIB-RUG, Belgium) using an appropriate animal-friendly adjuvant Stimune (Cedi Diagnostics BV, The Netherlands). The llama's received 6 injections at weekly intervals, the first two injections containing each 100 μg of IFN-gamma, the last four injections containing each 50 μg of IFN-gamma. Four days after the last immunization a blood sample (PBL1) of 150ml and a lymph node biopsy (LN) was collected from each animal and sera were prepared. Ten days after the last immunization a second blood sample (PBL2) of 150ml was taken from each animal and sera were prepared. Peripheral blood lymphocytes (PBLs), as the genetic source of the llama heavy chain immunoglobulins (HcAbs), were isolated from the blood sample using a Ficoll- Paque gradient (Amersham Biosciences) yielding 5x108 PBLs. The maximal diversity of antibodies is expected to be equal to the number of sampled B-lymphocytes, which is about 10 % of the number of PBLs (5x107). The fraction of heavy-chain antibodies in llama is up to 20 % of the number of B-lymphocytes. Therefore, the maximal diversity of HcAbs in the 150 ml blood sample is calculated as 107 different molecules. Total RNA was isolated from PBLs and lymph nodes according to the method of Chomczynski and Sacchi (1987).

0268Example 2: Repertoire cloning cDNA was prepared on 200 μg total RNA with MMLV Reverse Transcriptase (Gibco BRL) using oligo d(T) oligonucleotides (de Haard et al., 1999). The cDNA was purified with a phenol/chloroform extraction, followed by an ethanol precipitation and subsequently used as template to amplify the VHH repertoire. In a first PCR, the repertoire of both conventional (1.6 kb) and heavy-chain (1.3 kb) antibody gene segments were amplified using a leader specific primer (5'- GGCTGAGCTCGGTGGTCCTGGCT-3') and the oligo d(T) primer (5'-

0269DNA fragments were separated by agarose gel electrophoresis and the 1.3 kb fragment encoding heavy-chain antibody segments was purified from the agarose gel. A second PCR was performed using a mixture of FR1 reverse primers (WO03/054016 sequences ABL037 to ABL043) and the same oligo d(T) forward primer.

0270The PCR products were digested with Sfi\ (introduced in the FR1 primer) and BstEW (naturally occurring in framework 4). Following gel electrophoresis, the DNA fragments of approximately 400 basepairs were purified from gel and ligated into the corresponding restriction sites of phagemid pAX004 to obtain a library of cloned VHHs after electroporation of Escherichia coli TGI . pAX004 allows the production of phage particles, expressing the individual VHHs as a fusion protein with a c-myc tag, a hexahistidine tag and the genelll product. The diversity obtained after electroporation of TG1 cells is presented in Table 1. The percentage insert was determined in PCR using a combination of vector based primers.

0271Example 3: Rescue of the library and phage preparation

0272The library was grown at 37°C in 10 ml 2xTY medium containing 2% glucose, and 100 μg/ml ampicillin, until the OD60onm reached 0.5. M13KO7 phages (1012) were added and the mixture was incubated at 37°C for 2 x 30 minutes, first without shaking, then with shaking at 100 rpm. Cells were centrifuged for 5 minutes at 4,500 rpm at room temperature. The bacterial pellet was resuspended in 50 ml of 2xTY medium containing 100 μg/ml ampicillin and 25 μg/ml kanamycin, and incubated overnight at 37°C with vigorously shaking at 250 rpm. The overnight cultures were centrifuged for 15 minutes at 4,500 rpm at 4°C. Phages were PEG precipitated (20% poly-ethylene-glycol and 1.5 M NaCl) for 30 minutes on ice and centrifuged for 20 minutes at 4,500 rpm. The pellet was resuspended in 1 ml PBS. Phages were again PEG precipitated for 10 minutes on ice and centrifuged for 10 minutes at 14,000 rpm and 4°C. The pellet was dissolved in 1 ml PBS- 0.1 % casein.

0273Example 4: Library evaluation

0274The library was evaluated in a phage ELISA to examine whether the cloned repertoire contained significant IFN- specific VHH's. The repertoire was expressed on phage following infection with M13K07 helper phages as described in example 3. Human IFN- was solid phase coated at a concentration of 1 μg/ml overnight at 4°C in a 96-well microtiterplate. Plates were washed 5 times with PBS/0.05%Tween-20. Plates were blocked using PBS+1% Caseine. A dilution serie of purified phages were added to the wells and incubated for 2 hrs at room temperature. Plates were washed 5 times with PBS/0.05%Tween-20. Bound phages were detected using the anti-M13 gene VIII-HRP conjugated monoclonal antibody (Amersham Biosciences) and ABTS/H2O2 as substrate. Plates were read at 405nm after 30 minutes incubation at room temperature. The results of the phage ELISA are presented in Figure 1 , 2 and 3.

0275To evaluate the mouse IFN- specific libraries, 96-well microtiter plates were coated with neutravidine at a concentration of 2 μg/well overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% Caseine for 2 hrs at room temperature. Biotinylated mouse \F -y (see example 5) at a concentration of 1 μg/ml was captured overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. A dilution serie of purified phages were added to the wells. Plates were washed 5 times with PBS/0.05%Tween-20. Bound phages were detected using the anti-M13 gene VIII-HRP conjugated monoclonal antibody (Amersham Biosciences). Plates were read at 405nm after 30 minutes incubation at room temperature. The results of the phage ELISA are presented in Figure 4.

0276Example 5: Biotinylation of IFN-

0277100 μg human IFN- and 50 μg mouse IFN- was biotinylated using a 10-fold molar excess of biotinamidocaproic acid 3-sulfo N-hydroxysuccinimide ester (Sigma, Cat Nr. B1022). Biotinylation was performed in 50 mM Na2CO3 pH=8 and reaction was stopped after 2 hrs incubation at room temperature using 10 mM Tris-HCI pH=7.5. Free biotine was removed using dialysis. Biotinylation was validated by binding of biotinylated IFN-^ to neutravidine and to IFN-p receptor. 96-well microtiter plates were coated with 2 μg/ml neutravidine overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Plates were blocked for 2 hrs at room temperature with PBS+1% Caseine. A dilution serie of biotinylated human or mouse IFN- was incubated in the wells for 1 hr at room temperature. Plates were washed 5 times with PBS/0.05%Tween-20. Binding was detected using Extravidin-AP and pNPP. Plates were read at 405nm after 30 minutes incubation at room temperature. Results are presented in Figure 5.

027896-well microtiter plates were coated with human IFN- receptor (IFN- R1 (R&D Systems, Cat Nr: 673-IR/CF) or mouse IFN- receptor (IFN- R1/Fc (R&D Systems, Cat Nr:1026-GR) at 1 μg/ml in PBS overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Plates were blocked for 2 hrs at room temperature using PBS+1% Caseine. A dilution serie of biotinylated human or mouse IFN- was incubated for 1 hr at room temperature. Plates were washed 5 times with PBS/0.05%Tween-20. Binding was detected using Extravidin-AP and pNPP. Plates were read at 405nm after 30 minutes incubation at room temperature. Results are presented in Figure 6.

0279Example 6-1 : Selection of human IFN- specific VHH

0280Phages were rescued and prepared as described above in example 3 Two approaches were followed to obtain IFN- specific binders:

0281a. Solid phase coated IFN- Microtiter wells were coated with human IFN- at different concentrations of 10-0.4 μg/well overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% caseine for 2 hrs at room temperature. Phages were incubated for 2 hrs at room temperature. Wells were washed 20 times with PBS+0.05%Tween-20. The two final washes were performed using PBS. Specific phages were eluted using 1 to 2 μg of IFN- R1 (R&D Systems, Cat Nr: 673-IR/CF) for 1 hr. As negative control elutions were performed using 10 μg Ovalbumine (Sigma,

0282A2512) as irrelevant protein. Log phase growing TG1 cells were infected with the eluted phages and plated on selective medium. Enrichment was determined by the number of transfected TG1 colonies after selection using the receptor for elution as compared with negative control using ovalbumine for elution. Bacteria from selections showing enrichment were scraped and used for a second round of selection.

0283The bacteria were superinfected with helperphage to produce recombinant phages as described in example 3. Microtiter wells were coated with IFN- at different concentrations of 2-0.1 μg/well overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% caseine for 2 hrs at room temperature. Phages were incubated for 2 hrs at room temperature. Wells were washed 20 times with PBS+0.05%Tween-20. The two final washes were performed using PBS. Specific phages were eluted using 1 to 2 μg of IFN-y R1 or 10 μg Ovalbumine as irrelevant protein for 1 hr, subsequently overnight at 4°C and subsequently, phages were eluted using 0.1 M glycine pH 2.5 for 15 minutes at room temperature and neutralized with 1 M Tris-HCI pH=7.5. Log phase growing TG1 cells were infected with the eluted and neutralized phages and plated on selective medium. Enrichment was determined by the number of transfected TG1 colonies after selection using the receptor for elution as compared with negative control using ovalbumine for elution.

0284b. Biotinylated IFN-

0285Microtiter wells were coated with neutravidine at a concentration of 2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% caseine for 2 hrs at room temperature. Biotinylated human IFN- at a concentration of 100-10 ng/well was captured overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Phages were incubated for 2 hrs at room temperature. Wells were washed 20 times with PBS+0.05%Tween-20. The two final washes were performed using PBS. Specific phages were eluted using 1 to 2 μg of IFN-κ R1 (R&D Systems, Cat Nr: 673-IR/CF) for 1 hr. As negative control elutions were performed using 10 μg Ovalbumine (Sigma, A2512) as irrelevant protein. Log phase growing TG1 cells were infected with the eluted phages and plated on selective medium. Enrichment was determined by the number of transfected TG1 colonies after selection using the receptor for elution as compared with negative control using ovalbumine for elution. Bacteria from selections showing enrichment were scraped and used for a second round of selection. Bacteria were superinfected with helperphage to produce recombinant phages.

0286Microtiter wells were coated with neutravidine at a concentration of 2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% caseine for 2 hrs at room temperature. Biotinylated human IFN- at a concentration of 20-2.5 ng/100 μl was captured overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Phages were incubated for 2 hrs at room temperature. Wells were washed 20 times with PBS+0.05%Tween-20. The two final washes were performed using PBS. Specific phages were eluted using 1 to 2 μg of IFN- R1 or 10 μg Ovalbumine as irrelevant protein for 1 hr, subsequently overnight at 4°C and subsequently, phages were eluted using 0.1 M glycine pH 2.5 for 15 minutes at room temperature and neutralized with 1M Tris-HCI pH=7.5. Log phase growing

0287TG1 cells were infected with the eluted and neutralized phages and plated on selective medium. Enrichment was determined by the number of transfected TG1 colonies after selection using the receptor for elution as compared with negative control using ovalbumine for elution.

0288Example 6-2: Selection of mouse IFN specific VHH

0289Phages were rescued and prepared as described above in example 3. Microtiter wells were coated with neutravidine at a concentration of 2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% caseine for 2 hrs at room temperature. Biotinylated mouse IFN- at a concentration of 200-30 ng/well was captured overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20.

0290Phages were incubated for 2 hrs at room temperature. Wells were washed 20 times with

0291PBS+0.05%Tween-20. The two final washes were performed using PBS. Specific phages were eluted using 1 μg of IFN- R1/Fc (R&D Systems, Cat Nr:1026-GR) for 1 hr. As negative control elutions were performed using 10 μg Ovalbumine (Sigma, A2512) as irrelevant protein. Log phase growing TG1 cells were infected with the eluted phages and plated on selective medium. Enrichment was determined by the number of transfected

0292TG1 colonies after selection using the receptor for elution as compared with negative control using ovalbumine for elution. Bacteria from selections showing some enrichment were scraped and used for a second round of selection. Bacteria were superinfected with helperphage to produce recombinant phages. Microtiter wells were coated with neutravidine at a concentration of 2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with PBS+1% caseine for 2 hrs at room temperature. Biotinylated mouse IFN- at a concentration of 30- 2.5 ng/well was captured overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Phages were incubated for 2 hrs at room temperature. Wells were washed with PBS+0.05%Tween-20. The two final washes were performed using PBS. Specific phages were eluted using 1 to 2 μg of IFN- R1/Fc or 10 μg Ovalbumine as irrelevant protein for 1 hr, subsequently overnight at 4°C and subsequently, phages were eluted using 0.1 M glycine pH 2.5 for 15 minutes at room temperature and neutralized with 1 M Tris-HCI pH=7.5. Log phase growing TG1 cells were infected with the eluted and neutralized phages and plated on selective medium. Enrichment was determined by the number of transfected TG1 colonies after selection using the receptor for elution as compared with negative control using ovalbumine for elution.

0293Example 7: Specificity of selected VHH's

0294Individual clones were picked, grown in 150 μl 2xTY containing 0.1% glucose and 100 μg/ml ampicillin in a microtiter plate at 37°C until OD60onm= 0.6. 1 mM IPTG and 5 mM MgSO4 was added and the culture was incubated overnight at 37°C. ELISA was performed on the supernatant of the cultures to examine specificity of the selected clones. To examine the clones selected using solid phase coated human IFN- , plates were coated with human IFN- at a concentration of 5-10 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with 1 % caseine for 2 hrs at room temperature. Culture supernatant (1/3 diluted) was applied to the wells. Plates were washed 5 times with PBS/0.05%Tween-20. Detection was performed using anti-c- myc antibody, followed by anti-mouse-HRP and ABTS/H2O2 as substrate. Plates were read at 405nm after 30 minutes incubation at room temperature.

0295To examine the clones selected using biotinylated human or mouse IFN- , wells were coated with neutravidine at a concentration of 2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with 1 % caseine for 2 hrs at room temperature. Biotinylated mouse or human IFN- at a concentration of 1 μg/ml was captured overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Culture supernatant (1/3 diluted) was applied to the wells. Detection was performed using anti-c-myc antibody, followed by anti-mouse-HRP and ABTS/H2O2 as substrate. Plates were read at 405nm after 30 minutes incubation at room temperature. Results on binders against human IFN- are presented in Table 2. Results on binders against mouse IFN- are presented in Table 3.

0296Example 8: Diversity of selected VHH's PCR was performed using M13 reverse and genlll forward primers. The clones were analyzed using Hinfl fingerprinting and representative clones were sequenced. Sequence analysis was performed resulting in the sequences and sequence families presented in Table 4 for human IFN- and in Table 5 for mouse \FH-y.

0297Example 9: Expression and purification of VHH

0298Small scale expressions were started after transformation of DNA into WK6 Escherichia coli cells.

0299Clones were grown in 50 ml 2xTY containing 0.1% glucose and 100 μg/ml ampicillin in a shaking flask at 37°C until OD6oonm= 2. 1 mM IPTG and 5 mM MgSO4 was added and the culture was incubated for 3 more hours at 37°C. Cultures were centrifuged for 10 minutes at 4,500 rpm at 4°C. The pellet was frozen overnight at -20°C. Next, the pellet was thawed at room temperature for 40 minutes, re-suspended in 1 ml PBS/1 mM EDTA/1 M NaCl and shaken on ice for 1 hour. Periplasmic fraction was isolated by centrifugation for 10 minutes at 4°C at 4,500 rpm. The supernatant containing the VHH was loaded on TALON (Clontech) and purified to homogeneity. The yield of VHH was calculated according to the extinction coefficient.

0300Example 10: Functional characterization of selected VHH's: inhibition of binding of IFN- to the IFN- receptor by a VHH in an in-house receptor-binding assay VHH were expressed and purified as described in example 9. Binding was still observed when the periplasmic fractions were tested in an ELISA as described in example 7 (data not shown).

0301Purified VHH was analyzed for the ability to inhibit human or mouse IFN- / IFN- receptor interaction. Mouse or human IFN- receptor was coated at a concentration of 1-2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with 1% caseine overnight at 4°C. VHH was pre-incubated with 20 ng biotinylated human or mouse IFN-K for 30 minutes at room temperature. The mixture was applied to the wells and incubated for 1 hr at room temperature. Detection was performed using Extravidin-AP and pNPP as substrate. Plates were read at 405nm after 30 minutes incubation at room temperature. Abeam AB 7812 polyclonal antibody was used as a positive control showing a dosis- dependent inhibition of human IFN-κ/IFN-κ receptor as presented in Figure 7. 11 VHH molecules from experiment 1 (MP2 selection experiment) showed inhibition of human IFN-κ/ IFN-κ receptor interaction. An irrelant VHH directed against Von Willebrand factor was included as negative control. The clones were selected using either solid phase coated or biotinylated human IFN-K. Figure 8 represents the MP2 selection. 31 clones from experiment 2 (MP3 selection experiment) showed inhibition of human IFN- γl IFN- receptor interaction. The clones were selected using either solid phase coated or biotinylated human IFN-κ and using different elution procedures. Figure 9 represents the MP3 selection.

030220 clones from experiment 3 (MP4 selection experiment) showed inhibition of human IFN- γl IFN-K receptor interaction. The clones were selected using either solid phase coated or biotinylated human IFN-K- Figure 10 represents the MP4 selection. As presented in Table 6, a dose-dependent inhibition assay to determine the IC50 was performed for representative clones of each sequence family. The IC50 was defined as the concentration of VHH that inhibits the binding of IFN-κ to its receptor by 50 %. From that experiment MP2 F6 SR and MP3 B4 SRA were identified as most potent inhibitors showing a good dose-responsiveness. A comparison of both VHH's is given in Figure 11.

03036 clones directed against mouse IFN-κ were analyzed for their capacity to inhibit mouse IFN~κ/ IFN-K receptor interaction. Figure 15 represents the results.

0304Example 11: Functional characterization of selected VHH's: inhibition of binding of human IFN- to the human IFN- receptor by a VHH in an in vitro cell-based inhibition assay

0305Purified VHH were tested in cytotoxicity assays. Endotoxin was depleted from the samples using Tx-114. The samples were incubated for 30 minutes with 0.2 % Tx-114. Subsequently, the mixture was incubated at 37 °C for 30 minutes and centrifuged for 10 minutes at 14,000 rpm. The upper phase was harvested and treated once more. There was no difference in binding in ELISA (example 7) or inhibition capacity (example 10) between Tx-114 treated and untreated VHH (data not shown).

0306On day 1, FS4 cells were seeded at a concentration of 20,000 cells/well in a 96-well microtiter plate and grown in DMEM/10%FCS. On day 2, cells were treated with 50 or 5 lU/ml IFN-K (expressed in CHO) pre-incubated for 1 hr at 37 °C with a dilution serie of VHH. On day 3, cells were infected with EMC virus (103 particles/well). On day 4, 10 μl/well MTT (5 mg/ml) was added to detect viable cells. On day 5, 50 μl/well SDS (100 mg/ml) was added. Read-outs were done at 595-655 nm. Results for MP2F6SR and MP3B4SRA are presented in Figure 12. Results for other isolated anti-human IFN-κ VHH are presented in Table 10.

0307Example 12: Construction of bivalent and bispecific VHH's

0308The DNA coding for MP3B4SRA and MP2F6SR VHH was amplified using a FR1 primer (5'-GAGGTBCARCTGCAGGASTCYGG-3') and a FR4 primer (5'-

0309GTGTGCGGCCGCTGAGGAGACRGTGACCWG - 3') introducing a Psfl and a BstEW restriction site respectively. The PCR products were purified using a PCR purification kit (Qiagen). Half of the PCR product was digested with Ps.1 at 37°C for 1 hr and with BstEW at 60°C for 1 hr, the other half with Λ/o.l for 1 hr at 37°C and with Sf/'l for 1 hr at 50°C. To construct a bivalent MP3B4SRA/MP3B4SRA, a bivalent MP2F6SR/MP2F6SR and a bispecific MP3B4SRA/MP2F6SR, the Ps_1/βs.EII digested products were purified over gel, ligated into pAX11 (Ps.l/Ss_£ll) and transformed to WK6 Escherichia coli to obtain clones with a VHH at the C-terminus of the multicloning site. The clones were examined by PCR using the M13 reverse (5'-GGATAACAATTTCACACAGG-3') and forward (5'- CACGACGTTGTAAAACGAC-3') primers. From clones yielding a PCR fragment of 650 bp, DNA was prepared and digested with Not\ for 1 hr at 37°C and with Sfil for 1 hr at 50°C. Fragments were purified over gel and used as vector to clone the VHH (SfiUNoti) at the N-terminus of the multicloning site. This yielded a bivalent MP3B4SRA/MP3B4SRA and a bispecific MP3B4SRA/MP2F6SR.

0310To clone the MP2F6SR VHH at the N-terminus another strategy was used as described above to get in frame expression of the C- and N-terminal VHH. MP2F6SR does not contain a hinge sequence. The hinge sequence was introduced by cloning the MP2F6SR VHH in pAX001 TNF 3E. pAX001 TNF 3E contains the coding sequence of a VHH in frame with a hinge sequence. This vector was digested with Ps.1/βs.EII to remove the irrelevant VHH, but not the hinge. The vector was gelpurified and used as acceptor vector to clone the DNA coding MP2F6SR. This procedure introduces MP2F6SR in frame with a hinge sequence. Subsequently this clone was digested with Notl for 1 hr at 37°C and with Sf/'l for 1 hr at 50°C. The obtained fragments were cloned at the N-terminus of the multicloning site of the above described vector containing MP2F6SR at the C-terminus. This yielded a bivalent MP2F6SR/MP2F6SR. Constructs were examined by sequence analysis. Sequences are presented in Table 9. Example 13: Functional characterization of bivalent and bispecific VHH's: inhibition of binding of IFN- to the IFN- receptor by a VHH in an in-house receptor binding assay

0311Representative clones were expressed and purified as described in example 9 Purified VHH was analyzed for the ability to inhibit human IFN-κ/ IFN-κ receptor interaction. Human IFN-κ receptor was coated at a concentration of 2 μg/ml overnight at 4°C. Plates were washed 5 times with PBS/0.05%Tween-20. Wells were blocked with 1 % caseine overnight at 4°C. VHH was pre-incubated with 20 ng biotinylated human IFN- for 1 hr at room temperature. Mixture was applied to the wells and incubated for 2 hrs at room temperature. Plates were washed 5 times with PBS/0.05%Tween-20. Detection was performed using Extravidin-AP and pNPP as substrate. Plates were read at 405nm after 30 minutes incubation at room temperature. Results are presented in Figure 13.

0312Example 14: Functional characterization of bivalent and bispecific VHH's: inhibition of binding of IFN- to the IFN- receptor by a VHH in an in vitro cell-based inhibition assay

0313Purified bivalent and bispecific VHH were tested in cytotoxicity assays. Endotoxin was depleted from the samples using Tx-114. The samples were incubated for 30 minutes with 0.2 % Tx-114. Subsequently, the mixture was incubated at 37°C for 30 minutes and centrifuged for 10 minutes at 14,000 rpm. The upper phase was harvested and treated once more. There was no difference in binding in ELISA (example 7) or inhibition capacity (example 13) between Tx-114 treated and untreated VHH (data not shown). On day 1 , FS4 cells were seeded at a concentration of 20,000 cells/well in a 96-well microtiter plate and grown in DMEM/10%FCS. On day 2, cells were treated with 50 or 5 lU/ml IFN-K (expressed in CHO) pre-incubated for 1 hr at 37°C with a dilution serie of VHH. On day 3, cells were infected with EMC virus (103 particles). On day 4, 10 μl/well MTT (5 mg/ml) was added to detect viable cells. On day 5, 50 μl/well SDS (100 mg/ml) was added. Read-outs were done at 595-655 nm. Results are presented in Figure 14 and Table 11.

0314Example 15: Calculation of homologies between anti-target-single domain antibodies of the invention

0315The degree of amino acid sequence homology between anti-target single domain antibodies of the invention was calculated using the Bioedit Sequence Alignment Editor.

0316The calculations indicate the proportion of identical residues between all of the sequences as they are aligned by ClustalW. (Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research, submitted, June 1994). Table 12 indicates the fraction homology between anti-serum albumin VHHs of the invention. Table 13 indicates the fraction homology between anti-TNF-alpha VHHs of the invention. Table 14 indicates the percentage homology between anti-IFN-gamma VHHs of the invention.

0317Example 16: Construction of a bispecific constructs containing a VHH-CDR3 fragment fused to an anti-serum albumin VHH

0318A functional portion, the CDR3 region of MP2F6SR, was amplified by using a sense primer located in the framework 4 region (F6 CRD3

0319Forward:CTGGCCCCAGAAGTCATACC) and an anti-sense primer located in the framework 3 region (F6 CDR3 Reverse primer:TGTGCATGTGCAGCAAACC).

0320In order to fuse the CDR-3 fragment with the anti-serum albumin VHH MSA-21, a second round PCR amplification was performed with following primers:

0321F6 CDR3 Reverse primer Sfi1 :

0322GTCCTCGCAACTGCGGCCCAGCCGGCCTGTGCATGTGCAGCAAACC F6 CDR3 Forward primer Not1 :

GTCCTCGCAACTGCGCGGCCGCCTGGCCCCAGAAGTCATACC

0324The PCR reactions were performed in 50 ml reaction volume using 50pmol of each primer. The reaction conditions for the primary PCR were 11 min at 94 °C, followed by 30/60/120 sec at 94/55/72 °C for 30 cycles, and 5 min at 72°C. All reaction were performed wit 2.5 mM MgCl2 , 200 mM dNTP and 1.25U AmpliTaq God DNA Polymerase (Roche Diagnostics, Brussels, Belgium).

0325After cleavage of the VHH gene of MSA clones with restriction enzymes Pst1/BstEII the digested products were cloned in pAX11 to obtain clones with a VHH at the C-terminus of the multicloning site. The clones were examined by PCR using vector based primers. From clones yielding a 650 bp product, DNA was prepared and used as acceptor vector to clone the CDR3 of MP2F6SR, after cleavage of the PCR product with restriction enzymes Sfi1/Not1 to allow N-terminal expression of CDR3 in fusion with a MSA VHH. These experiments show that the new class of VHH has bona fide binding and functional characteristics, thereby enabling their application for therapeutic purposes.

0326<img file="WO2004041863A2_D0001.tif" />

0327Table 1 Overview of the libraries, their diversity and % insert derived from different llama's and tissues as described in Example 1 and 2

0328<img file="WO2004041863A2_D0002.tif" />

0329Table 2 Overview of screening experiments of different selections for human IFN-κ specific VHH as described in Example 6-1

0330<img file="WO2004041863A2_D0003.tif" />

0331Table 3 Overview of screening experiments of selections for mouse IFN-κ specific VHH as described in Example 6-2. <img file="WO2004041863A2_D0004.tif" /><img file="WO2004041863A2_D0005.tif" /><img file="WO2004041863A2_D0006.tif" />

0332Table 4 Overview of amino acid sequence of human IFN-K specific VHH's as described in Example 8

0333<img file="WO2004041863A2_D0007.tif" /> able 5 Overvew o amno ac sequence o mouse -gamma speciic VHH's as described in Example 8 <img file="WO2004041863A2_D0008.tif" />

0334Table 6 Overview of IC50 of different IFN-κ specifc VHH as described in Example 10

0335<img file="WO2004041863A2_D0009.tif" /><img file="WO2004041863A2_D0010.tif" />

0336Table 7 Overview of Anti-mouse serum albumin/anti-human IFN-gamma binders <img file="WO2004041863A2_D0011.tif" /><img file="WO2004041863A2_D0012.tif" />

0337Table 8: Amino acid sequence listing of the peptides of aspects of present invention directed against TNF-alpha.

0338<img file="WO2004041863A2_D0013.tif" />

0339Table 9 Overview of amino acid sequence of bivalent and bispecific human IFN-κ specific VHH's as described in Example 12

0340<img file="WO2004041863A2_D0014.tif" />

0341<img file="WO2004041863A2_D0015.tif" />

0342Table 10 Overview of C50 of different monovalent human I rN-κ specific VHH as described in example 11 ,

0343<img file="WO2004041863A2_D0016.tif" />

0344Table 11 Overview of IC50 of bivalent/bispecific human IFN-κ specific VHH and IgG/Fab derived from neutralizing polyclonal goat anti-human IFN-κ serum as described in example 14

0345<img file="WO2004041863A2_D0017.tif" /> Table 12: Fractional homologies between the amino acid sequences of anti-mouse serum albumin VHHs of the invention. <img file="WO2004041863A2_D0018.tif" />

0346<img file="WO2004041863A2_D0019.tif" />

0347OZ ooo/εoozaa/iad ε98ϊt0/t00Z OΛV

Contents7

Citations
Reference	Relation	Cited during
None	Non-patent	Examiner
See also references of WO 2004041863A3	Non-patent	Examiner

181 members in 21 offices

This recordMember, by publication datePriority claim11 more offices are in the list below

Priority claims11

Priority claims
Document	Office	Kind	Date
425073P	United States of America	–	2002-11-08
425063P	United States of America	–	2002-11-08
42507302	United States of America	P	2002-11-08
42506302	United States of America	P	2002-11-08
03447005	European Patent Office (EPO)	–	2003-01-10
03447005	European Patent Office (EPO)	A	2003-01-10
PCTEP0306581	World Intellectual Property Organization (WIPO)	–	2003-06-23
0306581	European Patent Office (EPO)	W	2003-06-23
PCTEP0307313	World Intellectual Property Organization (WIPO)	–	2003-07-08
0307313	European Patent Office (EPO)	W	2003-07-08
0300194	Belgium	W	2003-11-07

Members181

Family members, oldest first
Document	Office	Kind
CA2505316A1	Canada	A1	2004-05-21
CA2505325A1	Canada	A1	2004-05-21
CA2505326A1	Canada	A1	2004-05-21
WO2004041862A2	World Intellectual Property Organization (WIPO)	A2	2004-05-21
WO2004041863A2	World Intellectual Property Organization (WIPO)	A2	2004-05-21
WO2004041865A2	World Intellectual Property Organization (WIPO)	A2	2004-05-21
WO2004041867A2	World Intellectual Property Organization (WIPO)	A2	2004-05-21
AU2003283137A1	Australia	A1	2004-06-07
AU2003286002A1	Australia	A1	2004-06-07
AU2003286003A1	Australia	A1	2004-06-07
AU2003286004A1	Australia	A1	2004-06-07
AU2003286004A8	Australia	A8	2004-06-07
WO2004041862A3	World Intellectual Property Organization (WIPO)	A3	2004-06-24
WO2004041863A3	World Intellectual Property Organization (WIPO)	A3	2004-07-15
WO2004041865A3	World Intellectual Property Organization (WIPO)	A3	2004-07-15
AU2004204262A1	Australia	A1	2004-07-29
CA2512545A1	Canada	A1	2004-07-29
WO2004062551A2	World Intellectual Property Organization (WIPO)	A2	2004-07-29
WO2004041867A3	World Intellectual Property Organization (WIPO)	A3	2004-08-12
WO2004062551A3	World Intellectual Property Organization (WIPO)	A3	2004-09-02
WO2005044858A1	World Intellectual Property Organization (WIPO)	A1	2005-05-19
AU2003283136A1	Australia	A1	2005-05-26
NO20052769D0	Norway	D0	2005-06-08
KR20050072814A	Republic of Korea	A	2005-07-12
NO20052769L	Norway	L	2005-07-14
EP1558645A2	European Patent Office (EPO)	A2	2005-08-03
EP1558646A2This record	European Patent Office (EPO)	A2	2005-08-03
EP1558647A2	European Patent Office (EPO)	A2	2005-08-03
EP1558650A2	European Patent Office (EPO)	A2	2005-08-03
NO20053774L	Norway	L	2005-08-31
KR20050092029A	Republic of Korea	A	2005-09-16
BR0316092A	Brazil	A	2005-09-27
EP1587838A2	European Patent Office (EPO)	A2	2005-10-26
MXPA05004955A	Mexico	A	2005-11-17
BRPI0406694A	Brazil	A	2005-12-20
RU2005117634A	Russian Federation	A	2006-01-27
MXPA05006043A	Mexico	A	2006-01-30
RU2005125430A	Russian Federation	A	2006-02-10
CN1735629A	China	A	2006-02-15
CN1735630A	China	A	2006-02-15
US2006034833A1	United States of America	A1	2006-02-16
US2006034845A1	United States of America	A1	2006-02-16
US2006115470A1	United States of America	A1	2006-06-01
HK1082745A1	Hong Kong, China	A1	2006-06-16
HK1082746A1	Hong Kong, China	A1	2006-06-16
US2006149041A1	United States of America	A1	2006-07-06
JP2006517789A	Japan	A	2006-08-03
EP1687338A1	European Patent Office (EPO)	A1	2006-08-09
JP2006519763A	Japan	A	2006-08-31
JP2006520584A	Japan	A	2006-09-14
US2006228355A1	United States of America	A1	2006-10-12
JP2006524036A	Japan	A	2006-10-26
US2007077249A1	United States of America	A1	2007-04-05
US2007178082A1	United States of America	A1	2007-08-02
US2007237769A1	United States of America	A1	2007-10-11
ZA200504996B	South Africa	B	2008-02-27
EP1900753A2	European Patent Office (EPO)	A2	2008-03-19
EP1900753A3	European Patent Office (EPO)	A3	2008-04-09
NZ540194A	New Zealand	A	2008-07-31
NZ540196A	New Zealand	A	2008-09-26
CN100439400C	China	C	2008-12-03
KR20080113286A	Republic of Korea	A	2008-12-29
US2009022721A1	United States of America	A1	2009-01-22
NZ540195A	New Zealand	A	2009-01-31
ZA200503618B	South Africa	B	2009-02-25
CN101412759A	China	A	2009-04-22
NZ563471A	New Zealand	A	2009-04-30
NZ540771A	New Zealand	A	2009-05-31
RU2357974C2	Russian Federation	C2	2009-06-10
US2009238829A1	United States of America	A1	2009-09-24
ZA200803817B	South Africa	B	2009-11-25
US2009324512A1	United States of America	A1	2009-12-31
US2010003248A1	United States of America	A1	2010-01-07
US2010003249A1	United States of America	A1	2010-01-07
US2010003253A1	United States of America	A1	2010-01-07
US2010021459A1	United States of America	A1	2010-01-28
US2010040613A1	United States of America	A1	2010-02-18
AU2003283137B2	Australia	B2	2010-07-01
CA2746964A1	Canada	A1	2010-07-22
WO2010081856A1	World Intellectual Property Organization (WIPO)	A1	2010-07-22
AU2003283137B8	Australia	B8	2010-07-29
NZ576284A	New Zealand	A	2010-07-30
EP1687338B1	European Patent Office (EPO)	B1	2010-10-20
RU2009109061A	Russian Federation	A	2010-10-27
AU2010226938A1	Australia	A1	2010-10-28
AU2004204262B2	Australia	B2	2010-11-04
AT485307T	Austria	T	2010-11-15
ATE485307T1	Austria	T1	2010-11-15
EP2251357A1	European Patent Office (EPO)	A1	2010-11-17
DE60334645D1	Germany	D1	2010-12-02
EP2258392A1	European Patent Office (EPO)	A1	2010-12-08
EP2267027A2	European Patent Office (EPO)	A2	2010-12-29
EP2267032A2	European Patent Office (EPO)	A2	2010-12-29
JP2011004747A	Japan	A	2011-01-13
PT1687338E	Portugal	E	2011-01-20
US2011027281A1	United States of America	A1	2011-02-03
DK1687338T3	Denmark	T3	2011-02-07
JP2011024581A	Japan	A	2011-02-10
EP2284192A2	European Patent Office (EPO)	A2	2011-02-16
ES2352697T3	Spain	T3	2011-02-22

Showing 100 of 181

8 legal events, as the office reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code
2010-11-24	Application deemed to be withdrawnWithdrawn18D	18D
2010-10-22	Information on the status of an ep patent application or granted ep patentGrantedSTATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWNSTAA	STAA
2007-02-14	First examination report despatched17Q	17Q
2006-09-27	First examination report despatched17Q	17Q
2005-08-03	Request for examination filed17P	17P
2005-08-03	Designated contracting statesAK	AK
2005-08-03	Request for extension of the european patentAX	AX
2005-06-17	Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI	PUAI