EP0809696A1

Novel allele of human histamine h2 receptor and methods of detection of h2 receptor variants

Abstract

This record has no abstract on file.

Term

Term ended

Projected expiry passed 30 January 2016, 10.7 years ago.

  1. Priority
  2. Filed
  3. Published
  4. Projected expiry
  5. Today

16 claims: 7 independent, 9 dependent

  1. 1
    Claims of equivalent WO 9623880 A2 C AIMS 1. A nucleotide sequence coding for a region of a human histamine H2 receptor, comprising one or more of the following base substitutions compared with the published sequence in Gantz et al (1991) Biochem Biophys Res Comm 178, 3, 1386 - 1392, and from which the positional notation is taken:site of change b_a≤e. 398 C 525 T 620 G 649 G 692 G 802 A 2. A nucleotide sequence coding for a region of a human histamine H2 receptor, comprising the sequence (as also listed in SEQ ID NO: 1): CAGCTCGGGTCGCCATCTCTCTGGTCTTAATTTGGGTCATCTCCATTACC CTGTCCTTTCTGTCTATCCACCTGGGGTGGAACAGCAGGAACGAGACCAG CAAGGGCAATCATACCACCTCTAAGTGCAATGTCCAGGTCAATGAAGTGT ACGGGCTGGTGGATGGGCTGGTCACCTTCTACCTCCCGCTACTGATCATG TGCATCACCTACTACCGCATCTTCAGGGTCGCCCGGGATCAGGCCAAGAG GATCGATCACATTAGCTCCTGGAAGGCAGCCACCATCAGGGAGCACAGAG CCACAGTGACACTGGCCGCCGTCATGGGGGCCTTCATCATCTGCTGGTTT CCCTACTTCACCGCGTTTGTGTACCGTGGGCTGAGAGGGGATGATGCCAT CAATGAGATGTTA 3. A nucleotide sequence coding for a region of a human histamine H2 receptor, comprising the sequence (as also listed in SEQ ID NO: 2):
  2. 3
    6. Oligonucleotides, suitable for use as primers for the amplification or sequencing of DNA corresponding to a region of a human histamine H2 receptor, selected from:1) 5' CCAATGGCACAGCCTCTT 3' (also listed in SEQ ID NO: 3) 2) 5' CGTGACTTCTGTCCCACT 3' (also listed in SEQ ID NO: 4) 3) 5* CCAGGCAACAGGAAGAGA 3' (also listed in SEQ ID NO: 5) 4) 5' TCTCTTCCTGTTGCCTGG 3' (also listed in SEQ ID NO: 6) 5) 5' GCAGCAGAAGAGCTGTTG 3' (also listed in SEQ ID NO:
  3. 4
    7) 6) 5' TCCAGGTCAATGAAGTGT 3' (also listed in SEQ ID NO:
  4. 5
    8) 7) 5' ACACTTCATTGACCTGGA 3' (also listed in SEQ ID NO:9) 8) 5' CCAAGAGGATCAATCACA 3' (also listed in SEQ ID NO: 10) 9) 5' TGTGATTGATCCTCTTGG 3' (also listed in SEQ ID NO: 11) 7. The use, as a primer for the amplification or sequencing of DNA corresponding to a region of a human histamine H2 receptor, of an oligonucleotide selected from: 1) 5' CCAATGGCACAGCCTCTT 3' (also listed in SEQ ID NO: 3) 2) 5' CGTGACTTCTGTCCCACT 3' (also listed in SEQ ID NO: 4) 3) 5' CCAGGCAACAGGAAGAGA 3» (also listed in SEQ ID NO: 5) 4) 5' TCTCTTCCTGTTGCCTGG 3' (also listed in SEQ ID NO: 6) 5) 5' GCAGCAGAAGAGCTGTTG 3' (also listed in SEQ ID NO: 7) 6) 5' TCCAGGTCAATGAAGTGT 3' (also listed in SEQ ID NO: 8) 7) 5' ACACTTCATTGACCTGGA 3' (also listed in SEQ ID NO: 9) 8) 5' CCAAGAGGATCAATCACA 3' (also listed in SEQ ID NO: 10) 9) 5' TGTGATTGATCCTCTTGG 3' (also listed in SEQ ID NO: 11) 8. A process for the detection of a nucleotide sequence coding for a region of a human H2 receptor, or of cDNA corresponding to transcription products thereof, in a biological sample thereof, which comprises a) the amplification of the DNA with at least a pair of primers selected from the oligonucleotides of Claim 6 b) the detection of the amplified sequences on an electrophoretic gel.
  5. 8
    11. A method for the detection of one or more inherited or acquired allelic polymorphic variations in a sample of a DNA encoding the human H2 receptor comprising one or more of the six base substitutions hereinbefore defined, which comprises PCR amplification of a DNA sequence.
  6. 13
    16. A nucleotide sequence, or a protein or peptide derived from a cDNA comprising the nucleotide sequence, substantially as hereinbefore described.
  7. 14
    17. An oligonucleotide suitable for use as a primer for the amplification of DNA corresponding to a region of a human H2 receptor substantially as hereinbefore described.