The cytoplasmic inhibition of gene expression
15 claims: 15 independent, 0 dependent
- 1A positive single-stranded viral genetic vector capable of replication in the cytoplasm of a plant cell, comprising:a) a first plant viral subgenomic promoter in functional combination with a first nucleic acid sequence which codes for an anti-sense RNA or a co-suppressor RNA specific for a gene of interest in a plant wherein the transcription of the first nucleic acid sequence is regulated by the first plant viral subgenomic promoter;andb) a second plant viral subgenomic promoter operably linked to a second nucleic acid sequence that codes for a plant viral coat protein wherein the transcription of the second nucleic acid is regulated by the second plant viral subgenomic promoter wherein at least one of the subgenomic promoters is from a tobamovirus. Positiver einsträngiger viraler Genvektor, der zur Replikation im Zytoplasma einer Pflanzenzelle fähig ist, umfassend: a) einen ersten subgenomischen Pflanzenviruspromotor in funktioneller Verbindung mit einer ersten Nukleinsäuresequenz, die für eine Antisense-RNA oder eine Kosuppressor-RNA kodiert, welche für ein interessierendes Gen in einer Pflanze spezifisch ist, wobei die Transkription der ersten Nukleinsäuresequenz durch den ersten subgenomischen Pflanzenviruspromotor reguliert ist;undb) einen zweiten subgenomischen Pflanzenviruspromotor, der funktionsfähig mit einer zweiten Nukleinsäuresequenz verbunden ist, die für ein pflanzliches virales Hüllprotein kodiert, wobei die Transkription der zweiten Nukleinsäure durch den zweiten subgenomischen Pflanzenviruspromotor reguliert ist, wobei mindestens einer der subgenomischen Promotoren von einem Tobamovirus kommt. Vecteur génétique viral simple brin positif capable de réplication dans le cytoplasme d'une cellule végétale, comprenant : a) un premier promoteur subgénomique viral végétal en combinaison fonctionnelle avec une première séquence d'acide nucléique qui code un ARN antisens ou un ARN co-suppresseur spécifique d'un gène d'intérêt dans une plante où la transcription de la première séquence d'acide nucléique est régulée par le premier promoteur subgénomique viral végétal ;etb) un second promoteur subgénomique viral végétal lié de manière fonctionnelle à une seconde séquence d'acide nucléique qui code une protéine d'enveloppe virale végétale où la transcription du second acide nucléique est régulée par le second promoteur sub-génomique viral végétal où au moins l'un des promoteurs subgénomiques provient d'un tobamovirus.
- 2The vector according to claim 1, wherein said vector is from a positive strand single-stranded RNA plant virus. Vecteur selon la revendication 1 où ledit vecteur provient d'un virus végétal à ARN simple brin à brin positif. Vektor gemäß Anspruch 1, wobei der Vektor von einem positivsträngigen einsträngigen RNA-Pflanzenvirus kommt.
- 3The vector according to claim 1, wherein said first and second subgenomic promoters are heterologous to each other. Vecteur selon la revendication 1 où lesdits premier et second promoteurs subgénomiques sont hétérologues l'un pour l'autre. Vektor gemäß Anspruch 1, wobei der erste und zweite subgenomische Promotor zueinander heterolog sind.
- 4The vector according to claim 1, wherein said gene of interest is phytoene desaturase. Vecteur selon la revendication 1 où ledit gène d'intérêt est la phytoène désaturase. Vektor gemäß Anspruch 1, wobei das interessierende Gen Phytoendesaturase ist.
- 5The vector according to claim 1, wherein said gene of interest is phytoene synthase. Vecteur selon la revendication 1 où ledit gène d'intérêt est la phytoène synthase. Vektor gemäß Anspruch 1, wobei das interessierende Gen Phytoensynthase ist.
- 6A method of producing a plant cell having reduced expression of a gene of interest, the method comprising the steps of transfecting a plant cell with the vector according to any of claims 1 to 5, wherein the nucleic acid sequence which codes for an anti-sense RNA or a co-suppressor RNA is specific for the gene of interest. Procédé de production d'une cellule végétale ayant une expression réduite d'un gène d'intérêt, le procédé comprenant les étapes de transfection d'une cellule végétale avec le vecteur selon l'une quelconque des revendications 1 à 5, où la séquence d'acide nucléique qui code un ARN antisens ou un ARN co-suppresseur est spécifique du gène d'intérêt. Verfahren zum Herstellen einer Pflanzenzelle mit reduzierter Expression eines interessierenden Gens, wobei das Verfahren die Schritte des Transfizierens einer Pflanzenzelle mit dem Vektor gemäß einem der Ansprüche 1 bis 5 umfasst, wobei die Nukleinsäuresequenz, die für eine Antisense-RNA oder eine Kosuppressor-RNA kodiert, für das interessierende Gen spezifisch ist.
- 7Procédé selon la revendication 6 où ledit vecteur est dérivé d'un virus végétal à ARN simple brin à brin positif. The method according to claim 6, wherein said vector is derived from a positive strand single-stranded RNA plant virus. Verfahren gemäß Anspruch 6, wobei der Vektor aus einem positivsträngigen einsträngigen RNA-Pflanzenvirus abgeleitet ist.
- 8Procédé selon la revendication 7 où lesdits premier et second promoteurs subgénomiques sont hétérologues pour la cellule végétale. The method according to claim 7, wherein said first and second subgenomic promoters are heterologous to the plant cell. Verfahren gemäß Anspruch 7, wobei der erste und zweite subgenomische Promotor heterolog zu der Pflanzenzelle sind.
- 9A method of producing a plant cell having reduced expression of a gene of interest, the method comprising the steps of transfecting a cell with a genetic vector according to claim 4 or 5. Procédé de production d'une cellule végétale ayant une expression réduite d'un gène d'intérêt, le procédé comprenant les étapes de transfection d'une cellule avec un vecteur génétique selon la revendication 4 ou 5. Verfahren zum Herstellen einer Pflanzenzelle mit reduzierter Expression eines interessierenden Gens, wobei das Verfahren die Schritte des Transfizierens einer Zelle mit einem Genvektor gemäß Anspruch 4 oder 5 umfasst.
- 10Procédé selon la revendication 9 où la cellule végétale est une cellule de Nicotiana. The method of claim 9, wherein the plant cell is a Nicotiana cell. Verfahren nach Anspruch 9, wobei die Pflanzenzelle eine Nikotinia-Zelle ist.
- 12Cellule végétale selon la revendication 11 où le vecteur est dérivé d'un virus végétal à ARN simple brin. Pflanzenzelle gemäß Anspruch 11, wobei der Vektor aus einem einsträngigen RNA-Pflanzenvirus abgeleitet ist. The plant cell according to claim 11, wherein the vector is derived from a single-stranded RNA plant virus.
- 14Cellule végétale selon la revendication 13 où ladite cellule végétale est une cellule de Nicotiana. Pflanzenzelle gemäß Anspruch 13, wobei die Pflanzenzelle eine Nikotiana-Zelle ist. The plant cell according to claim 13, wherein said plant cell is a Nicotiana cell.
Independent claims15
85 paragraphs, as filed
<u>FIELD OF THE INVENTION</u>
This invention is in the field of gene regulation through anti-sense RNA endogenously produced inhibitory RNA molecules such as anti-sense RNA and co-suppressor RNA.
<u>BACKGROUND</u>
One of the primary goals of genetic engineering has been to control the expression of selected genes in eukaryotic organisms of interest. While it has been relatively straightforward to insert new genes for expression into eukaryotic cells, the targeting of endogenous genes for reduced expression has been more difficult to achieve. Site-directed inactivation of genes in higher organisms has required extremely complex genetic manipulations and is not applicable to a wide range of organisms. One method reducing the expression of specific genes in eukaryotic organisms has been through the use of anti-sense RNA and through co-suppression.
WO-A-93/03161 describes recombinant plant viral nucleic acids and hosts infected thereby. The recombinant plant viral nucleic acids comprise a native plant viral subgenomic promoter, at least one non-native plant viral subgenomic promoter, a plant viral coat protein coding sequence, and optionally, at least one non-native nucleic acid sequence to be transcribed or expressed in the infected host plant.
Anti-sense RNA has been used to reduce the expression of pre-selected genes in both plants and animals. Descriptions of the use of anti-sense RNA to reduce the expression of selected genes in plants can be found, among other places in U.S. patent 5,107,065, Smith <i>et al</i>. <i>Nature</i> 334: 724-726 (1988), Van der Krol <i>et al., Nature</i> 333: 866-869 (1988), Rothstein <i>et al</i>., <i>Proc</i>. <i>Natl. Aca. Sci. USA</i> 84:8439-8443 (1987), Bird <i>et al</i>., <i>Bio</i>/<i>Technology</i> 9:635-639 (1991), Bartley <i>et al. Biol</i>. <i>Chem.</i> 267:5036-5039 (1992), and Gray <i>et al</i>., <i>Plant Mol. Bio.</i> 19:69-87(1992).
Another method of reducing the expression of specific genes in eukaryotic organisms is through the use of co-suppressor RNA. Co-suppressor RNA, in contrast to anti-sense RNA, is in the same orientation as the RNA transcribed from the target gene, i.e., the "sense" orientation.
It is possible that biochemical pathways in plants transfected with hybrid viruses could be altered by overproducing an enzyme involved in a rate-limiting step, or by inhibiting the synthesis of an enzyme via antisense RNA. Although the expression of numerous genes in transgenic plants have been repressed by antisense RNA, the actual mechanism and location of inhibition is not known. In the nucleus, antisense RNA may directly interfere with transcription or form duplexes with the heterogeneneous nuclear (hnRNA). There is evidence that inhibition of endogenous genes can occur in transgenic plants containing sense RNA A.R. van der Krol <i>et al</i>., <i>Nature</i> 333:866-869 (1988) and C. Napoli <i>et al</i>., <i>Plant Cell</i> 2:279-289 (1990) mechanism of this down regulation or "co-suppression" is thought to be caused by the production of antisense RNA by read through transcription from distal promoters located on the opposite strand of the chromosomal DNA (Greison, <i>et al. Trends in Biotech.</i> 9:122-123 (1991)). Alternatively, in the cytoplasm, antisense RNA may form a double-stranded molecule with the complimentary mRNA and prevent the translation of mRNA into protein.
Tobamoviruses, whose genomes consist of one plus-sense RNA strand of approximately 6.4 kb, replicate solely in the cytoplasm, and can be used as episomal RNA vectors to alter plant biochemical pathways. Hybrid tobacco mosaic (TMV)/ odontoglosum ringspot viruses (ORSV) have been used previously to express heterologous enzymes in transfected plants (Donson, <i>et al</i>. <i>Proc</i>. <i>Natl. Aca. Sci. USA</i> 88:7204 (1991) and Kumagai, <i>et al. Proc. Natl. Aca. Sci USA</i> 90:427-430 (1993), minus-Sense RNA Strand, (Miller, <i>et al.</i>). Infectious RNA transcripts from viral cDNA clones encode proteins involved in RNA replication, movement, and encapsidation (10). Subgenomic RNA for messenger RNA synthesis is controlled by internal promoters located on the minus-sense RNA strand (<i>N.benthamiana</i> plants were inoculated with <i>in vitro</i> transcripts as described previously [W.O. Dawson, <i>et al</i>., <i>Proc.</i><i>Natl</i>. <i>Acad. Sci. U</i>.<i>S</i>.<i>A</i>. 83, 1832 (1986)]). Insertion of foreign genes into a specific location under the control of an additional subgenomic RNA promoter have resulted in systemic and stable expression of neomycin phosphotransferase and α-trichosanthin (Donson, <i>et al. Proc. Natl. Aca. Sci. USA</i> 88:7204 (1991) and Kumagai, <i>et al</i>. <i>Proc. Natl. Aca. Sci USA</i> 90:427-430 (1993)).
One of the many biochemical pathways that could serve as a target for genetic manipulation is the biosynthesis of carotenoids. On the first committed step in carotenoid biosynthesis in higher plants is the condensation of two geranylgeranyl pyrophosphate molecules to phytoene, a colorless C<sub>40</sub> hydrocarbon, by the enzyme phytoene synthase. In the ripening fruit of <i>Lycopersicon esculentum</i>, phytoene synthase is a monomeric, chloroplast localized protein with an approximate relative molecular mass of 42 kDa. This enzyme is initially synthesized as a 47-kDa preprotein and is processed by the removal of a transit peptide during import to the chloroplast (Bartley, <i>et al. J. Biol. Chem</i>. 267:5036-5039 (1992)). Transgenic tomato plants containing anti-sense to phytoene synthase mRNA produce yellow fruit and pale flowers. Although the fruit specific carotenes are reduced by 97%, the levels of carotenoids in the leaves of the transgenic plants are unaffected, (Bird, <i>et al</i>., <i>Bio</i>/<i>Technology</i> 9:635-639 (1991)). It has been proposed that an additional set of biosynthetic genes occurs in plants which regulate the expression of leaf specific carotenoids.
The subsequent step in the biosynthetic pathway is the modification of the colorless phytoene to phytofluene and ζ-carotene by phytoene desaturase. Among higher plants, the isolation of gene encoding this enzyme has been described for tomato, Pecker, <i>et al</i>., <i>Proc. Natl</i>. <i>Acad. Sci</i>. <i>U</i>.<i>S</i>.<i>A</i>., 89, 4962 (1992), and <i>Arabidopsis thaliana</i> (Scolnick and Bartley, <i>Plant Physiol</i> 103:147 (1993)). Phytoene desaturase is inhibited by norflurazon, a bleaching herbicide, in a reversible, non-competitive manner (Sandman, <i>et al</i>., <i>Target Sites of Herbicide Actions</i>, G. Sandman, P. Boger Es. (RC press, Boca Rotan (1989)). Application of this compound causes a dramatic decrease in leaf carotenoids and chlorophylls and a subsequent accumulation of phytoene. The reduction of the photoprotective carotenoids derived from phytoene may cause a rapid destruction of chlorophyll by photooxidation.
The need for new methods of reducing the expression of specific genes in eukaryotes is clearly established. The invention described herein provides new methods for reducing the expression of selected genes, genetic constructions for practicing the methods, and cells transformed by these genetic constructions, and higher organisms comprising the transformed cells.
<u>SUMMARY OF THE INVENTION</u>
One aspect of the invention is to provide novel genetic constructions for the expression of inhibitory RNA in the cytoplasm of plant cells as defined in claim 1. The genetic constructions of the invention are capable of replicating in the cytoplasm of a plant cell and comprise a promoter region in functional combination with an inhibitory RNA encoding polynucleotide, i.e., encoding an anti-sense RNA or a co-suppressor RNA. The genetic constructions of the invention may be designed so as to replicate in the cytoplasm of plant cells. In a plant cell, the genetic construction is preferably derived from a plant RNA virus, being a positive single-stranded RNA virus. Plant RNA virus derived genetic constructions comprise at least one plant virus subgenomic promoter from tobamoviruses, in functional combination with the inhibitory RNA encoding region.
Another aspect of the invention is to provide cells comprising the genetic constructions of the invention and to provide plants comprising a plurality of such cells.
Another aspect of the invention is to provide methods of reducing the expression of a gene of interest in plant cells, i.e., methods of producing plant cells exhibiting reduced levels of expression of a gene of interest. The methods of the invention comprise the step of transforming a cell with a genetic construction of the invention in which the inhibitory RNA encoding region is specific for the gene of interest. Another aspect of the invention is to provide plant cells that produce elevated levels of the carotenoid phytoene. The elevated levels of phytoene are achieved by inhibiting the expression at the enzyme phytoene desaturase using the vectors of the invention.
<u>BRIEF DESCRIPTION OF THE FIGURES</u>
<b>Fig. 1.</b> Phytoene expression vector TTO1/PSY+. This plasmid contains the TMV-U1 126-, 183-, and 30-kDa ORFs, the ToMV coat protein gene (ToMVcp), the SP6 promoter, the tomato phytoene synthase gene, and part of the pBR322 plasmid. The TAA stop codon in the 30-kDa ORF is underlined. The TMV-U1 subgenomic promoter located within the minus strand of the 30-kDa ORF controls the expression of phytoene synthase. The putative transcription start point (tsp) of the subgenomic RNA is indicated with a period (.).
<b>Fig. 2.</b> Nucleotide sequence comparison of <i>N. benthamiana</i> leaf phytoene desaturase (<i>PDS1-Nb</i>) and tomato phytoene desaturase (<i>PDS-Le</i>). The nucleotides are aligned to maximize sequence similarity.
<u>DESCRIPTION OF THE SPECIFIC EMBODIMENTS</u>
<u>Definitions</u>
The term "inhibitory RNA", as used herein, refers to an RNA molecule that interferes with the expression of a target gene. An "inhibitory RNA" is specific for one or more target genes. An inhibitory RNA may be an anti-sense RNA with respect to an RNA molecule transcribed from the target gene. Alternatively, the target gene inhibitory RNA may be a co-suppressor RNA with respect to an RNA molecule transcribed from the target gene.
The term "anti-sense RNA" as used herein, refers to an RNA molecule that is capable of forming a duplex with a second RNA molecule. Thus a given RNA molecule is said to be an anti-sense RNA molecule with respect to a second, complementary or partially complementary RNA molecule, i.e., the target molecule. An anti-sense RNA molecule may be complementary to a translated or an untranslated region of a target RNA molecule. The anti-sense RNA need not be perfectly complementary, to the target RNA. Anti-sense RNA may or may not be the same length of the target molecule; the anti-sense RNA molecule may be either longer or shorter than the target molecule.
The term "co-suppressor RNA" refers to an RNA molecule that effects suppression of expression of a target gene where the RNA is partially homologous to an RNA molecule transcribed from the target gene. A co-suppressor RNA molecule is the RNA molecule that effects co-suppression as described in U.S. patent 5,231,020. Krol <i>et al., Biotechniques</i> 6:958-976 (1988), Mol <i>et al., FEBS Lett.</i> 268:427-430 (1990), and Grierson, <i>et al. Trends in Biotech</i>. 9:122-123 (1991) and similar publications. A "co-suppressor" RNA is in the sense orientation with respect to the target gene, i.e., the opposite orientation of the anti-sense orientation.
The term "inhibitory RNA encoding polynucleotide" as used herein, refers to a polynucleotide, e.g., DNA, RNA, and the like, capable of being transcribed, when in functional combination with a promoter, so as to produce an inhibitory RNA molecule, e.g., an anti-sense RNA or a co-supressor RNA. Anti-sense RNA encoding polynucleotides and co-supressor encoding polynucleotides are both embodiments of the inhibitory RNA encoding polynucleotides. When the inhibitory RNA is an anti-sense RNA, the inhibitory RNA transcribed from the inhibitory RNA encoding polynucleotide region of the genetic constructions of the invention is preferably perfectly complementary to the entire length of the RNA molecule or molecules for which the anti-sense RNA is specific, i.e., the target. The anti-sense RNA encoding polynucleotide in the subject vectors may encode an anti-sense RNA that forms a duplex with a non-translated region of an RNA transcript such as an intron region, or 5' untranslated region, a 3' untranslated region, and the like. Similarly, a co-suppressor encoding polynucleotide in the subject vectors may encode an RNA that is homologous to translated or untranslated portions of a target RNA. An anti-sense RNA encoding polynucleotides may be conveniently produced by using the non-coding strand, or a portion thereof, of a DNA sequence encoding a protein of interest.
The term "reduced expression," as used herein, is a relative term that refers to the level of expression of a given gene in a cell produced or modified by the claimed methods as compared with a comparable unmodified cell, i.e., a cell lacking the subject vector, under a similar set of environmental conditions. Thus, a cell modified by the subject methods, i.e., a cell having "reduced expression" of the gene of interest, may express higher levels of that gene under a first set of environmental conditions, than a comparable unmodified cell under a second set of environmental conditions, if the second set of conditions is highly favorable to gene expression.
<u>The Invention</u>
The invention described herein exploits the discovery that RNA can reduce the expression of a target gene through inhibitory RNA interactions with target mRNA that take place in the cytoplasm of a plant cell, rather than in the nucleus. Prior to the invention, it was not known if inhibitory RNA reduced gene expression by means of an interaction that takes place in the cytoplasm or an interaction that takes place in the nucleus. Thus, prior to the invention, it was necessary to produce inhibitory RNA in the nucleus so as to be certain that inhibition would be achieved. Furthermore, it was not known if adequate concentrations of inhibitory RNA could be provided in the cytoplasm. Cytoplasmic expression of inhibitory RNA (specific for target genes) has numerous advantages over nuclear expression, these advantages include the ability to use high level expression vectors that are not suitable for nuclear expression. The use of such vectors is particularly advantageous in plants, because vectors capable of systemically infecting plants may be used to produce the inhibitory RNA. The invention described herein has many aspects. These aspects include novel genetic constructions for the expression of target gene inhibitory RNA in the cytoplasm of plant cells, cells transfected with these genetic constructions, multicellular organisms comprising the transfected cells, and methods for reducing the expression of selected genes in a cell by transforming a cell with a genetic construction of the invention.
There are numerous ways to produce the genetic constructions of the invention. Techniques for manipulating polynucleotides, e.g., restriction endonuclease digestion and ligation, are well known to the person of ordinary skill in the art. These conventional polynucleotide manipulation techniques may be used to produce and use the genetic construction of the invention. While some optimization of standard techniques may be employed to produce the subject genetic constructions, significant experimentation is not required to produce the genetic constructions or practice the claimed methods.
The genetic constructions of the invention comprise a promoter region in functional combination with an inhibitory RNA encoding polynucleotide. The promoter region is selected so as to be capable of driving the transcription of a polynucleotide sequence in a host cell of interest. Thus for example, in a plant cell, the promoter is selected so as to be able to drive transcription in plant cells. Promoters capable of functioning in a given eukaryotic cell are well known to the person of ordinary skill in the art. Examples of promoters capable of driving transcription in a cell of interest can be found, among other places in, Goeddel <i>et al.</i>, <i>Gene Expression Technology Methods in Enzymology</i> Volume 185, Academic Press, San Diego, (1991), Ausubel <i>et al, Protocols in Molecular Biology</i>, Wiley Interscience (1994), and similar publications. When the cell for transformation is a plant cell, the RNA virus subgenomic promoters are preferably used as promoter regions. RNA virus subgenomic promoter are described, among other places in Dawson and Lehto, <i>Advances in Virus Research,</i> 38:307-342. PCT published application WO93/03161.
The genetic constructions of the invention are capable of replication or maintenance, at least transiently, in the cytoplasm of plant cells of interest i.e., a base vector. Thus, the genetic constructions of the invention necessarily comprise a polynucleotide region derived from a vector capable of being replicated or stably maintained in plant cell of interest. Many vectors capable of replication (or stable maintenance) in different types of plant cells are known. Vectors for use in plants include vectors derived from cauliflower mosaic virus, tobacco mosaic virus, tomato mosaic virus, and the like. Information describing plant cell vectors and their use in plant cells can be found, among other places, in PCT application WO93/03161, and Donson, <i>et al</i>. <i>Proc. Natl</i>. <i>Acad. Sci. USA,</i> 88:7204-7208 (1991).
The promoter driving transcription of the inhibitory RNA encoding region of the subject genetic constructions may be selected so as have a level of transcriptional activity sufficient to achieve the desired degree of expression of the target gene inhibitory RNA of interest. The promoter may be native or heterologous to the cell for genetic modification. The promoter may also be native or heterologous to the base vector, i.e., the portion of the vector other than the promoter and the inhibitory RNA encoding region. The promoter may be inducible or constitutive. Preferably, strong promoters are used to drive transcription of the inhibitory RNA encoding polynucleotide when the target RNA is highly expressed.
The invention also provides methods of reducing the expression of a gene or genes of interest in a plant cell. As a consequence of providing the subject methods of reducing gene expression in plant cell, the subject invention also provides methods of producing a plant cell having reduced expression of a gene of interest and plant cells that have reduced expression of a gene of interest, as produced by the methods of the invention. Reduction of gene expression is achieved by introducing one or more of the vectors of the invention into a eukaryotic cell. The vector used to transform the cell of interest comprises an inhibitory RNA encoding polynucleotide that encodes an inhibitory RNA specific for the gene for which reduced expression is sought. The method of reducing expression of the gene of interest comprises the step of introducing the subject genetic vector into a host cell that is capable of expressing the gene of interest under certain environmental conditions. The vector may be introduced into a cell of interest by any of a variety of well known transformation methods. Such methods include: infection, transfection, electroporation, ballistic projectile transformation, conjugation, and the like. The inventive aspect of the subject methods is not dependent upon the particular means by which the inhibitory RNA encoding vector is introduced into the cell of interest. The particular methods of introducing the vector into a cell of interest is, in part, dependent upon the particular cell for modification and the precise type of vector selected.
For plant cells, the vectors are preferably derived from RNA plant viruses. Preferred RNA plant virus vectors are positive strand single stranded RNA viruses. RNA plant virus vectors may be conveniently manipulated and introduced into cells in a DNA form instead of working directly with RNA vectors. Viral vector derived from tobamoviruses are particularly preferred. Descriptions of suitable plant virus vectors that may be modified so as to contain an inhibitory RNA encoding region in functional combination with a promoter as well as how to make and use such vectors, can be found in, among other places, PCT publication WO 93/03161, Kumagai <i>er al</i>, <i>Proc</i>. <i>Natl</i>. <i>Aca</i>. <i>Sci. USA</i> 90:427-430 (1993).
The invention also provides polynucleotides encoding phytoene synthase and phytoene desaturase, as well as various vector for the expression of target gene inhibitory RNA specific for phytoene synthase genes or phytoene desaturase genes. The first committed step in carotenoid biosynthesis in higher plants is the condensation of two geranylgeranyl pyrophosphate molecules to phytoene, a colorless C<sub>40</sub> hydrocarbon, by the enzyme phytoene synthase. The subsequent step in the biosynthetic pathway is the modification of the colorless phytoene to phytofluene and ζ-carotene by phytoene desaturase.
The invention provides polynucleotides encoding the phytoene desaturase enzyme from <i>Nicotiana</i> species and numerous derivatives thereof. Specifically, the invention provides, in purified form, polynucleotides encoding the phytoene desaturase of <i>Nicotiana benthamiana</i>. Additionally, the invention provides polynucleotides encoding tomato (<i>Lycopersicon esculentum</i>) phytoene synthase and phytoene desaturase. The phytoene synthase and phytoene desaturase encoding polynucleotides described herein may be used to produce inhibitory RNAs specific for phytoene synthase and phytoene desaturase genes from a variety of plant species. The phytoene synthase and phytoene desaturase inhibitory RNA are preferably produced by transcription of phytoene synthase or phytoene desaturase inhibitory RNA encoding polynucleotides in functional combination with a promoter region.
The amino acid sequence of the various phytoene desaturase and the phytoene synthase enzymes described herein and the naturally occurring polynucleotide sequences encoding these enzymes enable a person of ordinary skill in the art of molecular biology to design and construct a variety of related molecules having useful properties similar to these enzymes and the polynucleotides obtained directly from the cloning of the cDNAs encoding these enzymes. In the case of polynucleotides, the degeneracy of the genetic code permits the person of ordinary skill in the art to produce numerous different polynucleotides encoding the same polypeptide, i.e., isocoding polynucleotides. The precise polynucleotide sequence produced may be selected so as to optimize expression in a particular host cell type, taking into account factors affecting expression such as codon frequency, potential mRNA secondary structures, methylation, and the like. The invention also provides a variety of polypeptides having the same enzymatic activity as phytoene desaturase and phytoene synthase, but differing in one or more amino acid residues, so as to produce a phytoene desaturase and phytoene synthase variant polypeptides. Variant polypeptides may be produced and designed in a wide variety of ways. Phytoene desaturase and phytoene synthase variants may be produced and designed by introducing mutations (either random or by design) into a polynucleotide sequence encoding the enzyme, transforming the mutated enzyme encoding polynucleotide (operably linked to a suitable promoter) into a host cell, and subsequently assaying the host cell for the expression of the desired enzymatic activity. The identity of mutations in Srf I encoding polynucleotides introduced randomly, may be determined by sequencing the polynucleotide encoding the enzyme.
The invention also provides for the recombinant DNA expression of phytoene desaturase and phytoene synthase (as well as variants thereof). The recombinant expression of these enzyme may be achieved through standard recombinant DNA expression technology. Suitable recombinant DNA expression technology can be found, among other places, in Goeddel, <i>et al</i>., <i>Gene Expression Technology; Methods in Enzymology Volume</i> 185 Academic Press, San Diego (1991). The enzyme may be expressed in a wide range of host cells, including both eukaryotic and prokaryotic host cells. One advantage of providing the subject enzymes by recombinant DNA methodology is the production of increased amounts of enzyme from reduced amounts of cellular material.
Another advantage of the recombinant production of the enzymes is the ability to produce the enzyme free of certain contaminants. Phytoene synthase and phytoene desaturase (and variants thereof) produced by recombinant DNA techniques may be purified by procedures similar to the procedures described herein for the purification of the non-recombinant enzyme. Guidance in devising and modifying enzyme purification procedures can be found, among other places in Deutscher <i>Guide to Protein Purification Methods in Enzymology - Volume</i> 182) Academic Press, San Diego (1990), Scopes <i>Protein Purification: Principles and Practice</i> 3rd edition Springer-Verlag, NY (1993), and the like.
The invention may be better understood by referring to the following examples. The following examples are offered for the purpose of illustrating the invention and should not be interpreted as a limitation of the invention.
<u>EXAMPLES</u>
<u>Example 1</u>
<u>Isolation of tomato mosaic virus cDNA.</u>
An 861 bp fragment (5524-6384) from the tomato mosaic virus (fruit necrosis strain F; ToMV-F) containing the putative coat protein subgenomic promoter, coat protein gene, and the 3' end was isolated by PCR using ToMV primers 5' CTCGCAAAGTTTCGAACCAAATCCTC 3' (SEQ ID NO: 1) (upstream) and 5'CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG3' (SEQ ID NO:2) (downstream) and subcloned into the <i>Hinc</i>II site of pBluescript KS-. A hybrid virus consisting of TMV-U1 and ToMV-F was constructed by swapping an 874-bp <i>Xho</i>I-<i>Kpn</i>I ToMV fragment into pBGC152 (Kumagai, <i>et al. Proc. Natl. Acad. Sci USA</i>, 90:427-430 (1993)), creating plasmid TTO1. The inserted fragment was verified by dideoxynucleotide sequencing. A unique <i>Avr</i>II site was inserted downstream of the <i>Xho</i>I site in TTO1 by PCR mutagenesis, creating plasmid TTO1A, using the following oligonucleotides:<img file="EP0804600B1_D0001.tif" /><img file="EP0804600B1_D0002.tif" />
<u>Example 2</u>
<u>Isolation of a cDNA encoding tomato phytoene synthase and a partial cDNA encoding tomato phytoene desaturase.</u>
Partial cDNAs were isolated from ripening tomato fruit RNA by polymerase chain reaction (PCR) using the following oligonucleotides: <i>PSY</i>, 5' TATGTATGGTGCAGAAGAACAGAT 3' (SEQ ID NO:4) (upstream), 5' AGTCGACTCTTCCTCTTCTGGCATC 3' (SEQ ID NO:5) (downstream); <i>PDS,</i> 5' TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA 3' (SEQ ID NO:6) (upstream), 5' AACTCGAGCGCTTTGATTTCTCCGAAGCTT 3' (SEQ ID NO: 7) (downstream). Approximately 3 X 10<sup>4</sup> colonies from <i>a Lycopersicon esculentum</i> cDNA library were screened by colony hybridization using a 32 P labelled tomato phytoene synthase PCR product. Hybridization was carried out at 42°C for 48 h in 50% formamide, 5X SSC, 0.02 M phosphate buffer, 5X Denhart's solution, and 0.1 mg/ml sheared calf thymus DNA. Filters were washed at 65°C in 0.1X SSC, 0.1% SDS prior to autoradiography. PCR products and the phyoene synthase cDNA clones were verified by dideoxynucleotide sequencing.
<u>Example 3</u>
<u>DNA sequencing and computer analysis.</u>
A 1.2 Kb PstI, BamHI fragment containing the phytoene synthase cDNA and a .7 Kb the partial phytoene desaturase cDNA was subcloned into pBluescript KS+ (Stratagene, La Jolla, Calif.). The nucleotide sequencing of KS+/PDS #38 and KS+/ 5'3'PSY was carried out by dideoxy termination using single stranded templates. Nucleotide sequence analysis and amino acid sequence comparisons were performed using PCGENE and DNA Inspector IIE programs.
<u>Example 4</u>
<u>Construction of the tomato phytoene synthase expression vector.</u>
A 1253 base pair <i>Xho</i>I fragment containing the tomato phytoene synthase cDNA was subcloned into TTO1. The vector TTO1/PSY+ (Fig.1) contains the phytoene synthase cDNA (positive orientation) under the control of the TMV-U1 coat protein subgenomic promoter; while, the vector TTO1/PSY - contains the phytoene synthase cDNA in the anti-sense orientation.
<u>Example 5</u>
<u>Construction of a viral vector containing a partial tomato phytoene destaturase cDNA.</u>
An <i>Xho</i>I fragment containing the partial tomato phytoene desaturase cDNA was subcloned into TTO1. The vector TTO1A/PDS+ contains the phytoene desaturase cDNA (positive orientation) under the control of the TMV-U1 coat protein subgenomic promoter; while, the vector TTO1/PDS- contains the phytoene desaturase cDNA in the antisense orientation.
A partial cDNA encoding phytoene desaturase was isolated from <i>N</i>. <i>benthamiana</i> leaf RNA by RT-PCR using the following oligonucleotides: <i>PDS</i>, 5' GGCACTCAACTTTATAAACC 3' (SEQ ID NO:8) (upstream), 5' CTTCAGTTTTCTGTCAAACC 3' (SEQ ID NO:9) (downstream) and verified by dideoxynucleotide sequencing.
<u>Example 6</u>
<u>Transfection and analysis of N. benthamiana [TTO1/PSY+, TTO1/PSY-, TTO1/PDS700 +, TTO1/PDS700 -].</u>
Infectious RNAs from TTO1/PSY+ (Fig. 1), TTO1/PSY-, TTO1A/PDS+, TTO1/PDS- were prepared by <i>in vitro</i> transcription using SP6 DNA-dependent RNA polymerase and were used to mechanically inoculate <i>N</i>. <i>benthamiana</i> (Dawson, <i>et al</i>., <i>Adv. Virus Res.</i> 38:307 (1990)). The hybrid viruses spread throughout all the non-inoculated upper leaves as verified by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification. The viral symptoms consisted of distortion of systemic leaves, plant stunting, and mild chlorosis. Plants transfected with TTO1/PSY+ showed at least a two fold increase in phytoene synthase activity over plants transfected with viral vector controls. Leaves from systemically infected TTO1/PSY+ plants developed a bright orange phenotype and accumulated high levels of phytoene (Table 1). The leaves and sepals from TTO1/PDS- plants developed a white bleaching phenotype similar to that seen with the herbicide norflurazon. The structure of the chloroplasts from TTO1/PSY+ and TTO1/PDS- transfected plants, when analyzed by transmission electron microscopy, appeared to be normal. Leaves from systemically infected TTO1A/PDS+ plants developed a bleaching white phenotype approximately one week later than leaves from antisense TTO1/PDS- plants and also accumulated high levels of phytoene.
Agarose gel electrophoresis of PCR cDNA isolated from virion RNA and Northern blot analysis of virion RNA indicate that the vectors are maintained in an extrachromosomal state and have not undergone any detectable intramolecular rearrangements. <tables id="tabl0001" num="0001"><table frame="all"><title>Table I.</title><tgroup cols="4" colsep="1" rowsep="0"><colspec colnum="1" colname="col1" colwidth="39.37mm" /><colspec colnum="2" colname="col2" colwidth="39.37mm" /><colspec colnum="3" colname="col3" colwidth="39.37mm" /><colspec colnum="4" colname="col4" colwidth="39.37mm" /><thead valign="top"><row rowsep="1"><entry namest="col1" nameend="col4" align="center"><b>Quantitation of phytoene leaves of <i>N. benthamiana</i> transfected with viral transcripts.</b></entry></row><row rowsep="1"><entry namest="col1" nameend="col2" align="left">Plant</entry><entry namest="col3" nameend="col3" align="left">Phytoene µg/g FW</entry><entry namest="col4" nameend="col4" align="left">fold increase</entry></row></thead><tbody valign="top"><row><entry namest="col1" nameend="col1" align="left"><i>N. benthamiana</i></entry><entry namest="col2" nameend="col2" align="left">-----</entry><entry namest="col3" nameend="col3" align="char" char=".">4.6</entry><entry namest="col4" nameend="col4" align="left">1</entry></row><row><entry namest="col1" nameend="col1" align="left"><i>N</i>. <i>benthamiana</i> :</entry><entry namest="col2" nameend="col2" align="left">TTO1/PDS-</entry><entry namest="col3" nameend="col3" align="char" char=".">234.8</entry><entry namest="col4" nameend="col4" align="left">51.0</entry></row><row><entry namest="col1" nameend="col1" align="left"><i>N. benthamiana</i> :</entry><entry namest="col2" nameend="col2" align="left">Norflurozon</entry><entry namest="col3" nameend="col3" align="char" char=".">339.8</entry><entry namest="col4" nameend="col4" align="left">73.9</entry></row><row><entry namest="col1" nameend="col1" align="left"><i>N. benthamiana</i> :</entry><entry namest="col2" nameend="col2" align="left">TTO1/PSY+</entry><entry namest="col3" nameend="col3" align="char" char=".">52.4</entry><entry namest="col4" nameend="col4" align="left">11.4</entry></row><row rowsep="1"><entry namest="col1" nameend="col1" align="left"><i>N. benthamiana</i> :</entry><entry namest="col2" nameend="col2" align="left">TTO1/PSY-</entry><entry namest="col3" nameend="col3" align="char" char=".">1.0</entry><entry namest="col4" nameend="col4" align="left">0.2</entry></row></tbody></tgroup></table></tables>
<u>Example 7</u>
<u>Purification and analysis of phytoene from transfected plants</u>
Phytoene was extracted in methanol and identified by its peak retention time and absorption spectra on a 25-cm Spherisorb ODS-1 5-µm column using acetonitrile/ methanol/ 2-propanol (85:10:5) as a developing solvent at a flow rate of 1 ml/ min. The phytoene isolated from systemically infected tissue had an identical retention time to phytoene from norflurozon treated plants. The phytoene peak from <i>N. benthamiana</i> transfected with TTO1/PSY+ had a characteristic optical absorbance maxima at 276, 285, and 298 nm. One week after inoculation, plants transfected with viral encoded phytoene synthase showed a hundred-fold increase in phytoene compared to the levels in noninfected plants as measured by HPLL separation of carotenoids. The carotenoids were extracted in methanol and identified by their peak retention time and absorption spectra on a 25-cm Spherisorb ODS-1 5-µm column using acetonitrile/methanol/2-propanol (85:10:5) as a developing solvent. The expression of sense (TTO1A/PDS+) and antisense (TTO1/PDS-) RNA to a partial phytoene desaturase in transfected plants inhibited the synthesis of colored carotenoids and caused the systemically infected leaves to develop a white phenotype. HPLC analysis of these plants revealed that they also accumulated phytoene high levels. The bleaching of leaves was reproduced in control plants treated with the herbicide norflurozon, a non-competitive inhibitor of phytoene desaturase.
<u>Example 8</u>
<u>Isolation of a partial cDNA encoding <i>N</i>. <i>benthamiana</i> phytoene desaturase.</u>
A partial cDNA clone that encodes for <i>N. benthamiana</i> phytoene desaturase was isolated from young leaf tissue. Nucleotide sequence comparison of 369 bp in the corresponding regions between tomato and <i>N</i>. <i>benthamiana</i> phytoene desaturase indicate that they are 92% similar to each other (Fig. 2). Since the two plant genes have areas of high homology, cytoplasmic inhibition of the endogenous plant gene by viral-derived antisense RNA may occur through the formation of hybrid, double stranded RNA molecules. The down regulation of phytoene desaturase in plants transfected with TTO1A/PDS+ may be caused by direct interference during the translation of mRNA into protein or by duplexes formed between mRNA and viral-derived negative strand RNA, although the precise mechanism of action does not need to be known to carry out the invention.
<u>Example 9</u>
<u>Construction of TTO1 and TTO1A expression vectors</u>
An 861 bp fragment (5524-6384) from the tomato mosaic virus (fruit necrosis strain F; ToMV-F) containing the putative coat protein subgenomic promoter, coat protein gene, and the 3' end was isolated by PCR using ToMV primers 5' CTCGCAAAGTTTCGAACCAAATCCTC 3' (SEQ ID NO:1) (upstream) and 5' CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG 3'(SEQ ID NO:2) (downstream) and subcloned into the <i>Hinc</i>II site of pBluescript KS-. A hybrid virus consisting of TMV-U1 and ToMV-F was constructed by swapping an 874-bp <i>Xho</i>I-<i>Kpn</i>I ToMV fragment into pBGC152 (I. Pecker, <i>et al</i>., <i>Proc</i>. <i>Natl</i>. <i>Acad</i>. <i>Sci</i>. <i>U</i>.<i>S</i>.<i>A</i>., 89, 4962 (1992)), creating plasmid TTO1. The inserted fragment was verified by dideoxynucleotide sequencing. A unique <i>Avr</i>II site was inserted downstream of the <i>Xho</i>I site in TTO1 by PCR mutagenesis, creating plasmid TTO1A, using the following oligonucleotides:<img file="EP0804600B1_D0003.tif" /><img file="EP0804600B1_D0004.tif" />
<u>Example 10</u>
<u>Construction of TTO1/PDS-, TTO1A/PDS+</u>
Using PCR mutagenesis a <i>Xho</i>I fragment, encoding tomato phyotene synthase was amplified from a <i>Lycopersicon esculentum</i> cDNA clone isolated from a ripening fruit cDNA library, and placed under the control of the TMV-U1 coat protein subgenomic promoter by subcloning into TTO1.
<u>Example 11</u>
<u>Inhibition of the expression of a specific endogenous plant gene (phytoene desaturase) using an RNA viral vector: Transfection and analysis of <i>N.</i> benthamiana [TTO1/PDS-, TTO1A/PDS+</u>
Infectious RNAs from TTO1A/PDS+, TTO1/PDS- were prepared by <i>in vitro</i> transcription using SP6 DNA-dependent RNA polymerase and were used to mechanically inoculate <i>N. benthamiana.</i> The hybrid viruses spread throughout all the non-inoculated upper leaves as verified by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification. The viral symptoms consisted of distortion of systemic leaves, plant stunting, and mild chlorosis. The leaves and sepals from TTO1/PDS- plants developed a white bleaching phenotype similar to that seen with the herbicide norflurazon. The structure of the chloroplasts from TTO1/PDS- transfected plants, when analyzed by transmission electron microscopy, appeared to be normal. Leaves from systemically infected TTO1A/PDS+ plants developed a bleaching white phenotype approximately one week later than leaves from antisense TTO1/PDS plants and also accumulated high levels of phytoene.
<u>Example 12</u>
<u>Inhibition of the expression of a specific endogenous plant gene (phytoene synthase) using an RNA viral vector: Transfection and analysis of <i>N. benthamiana</i> [TTO1/PSY-]</u>
Infectious RNAs from TTO1/PSY- were prepared by <i>in vitro</i> transcription using SP6 DNA-dependent RNA polymerase and were used to mechanically inoculate <i>N. benthamiana</i>. The hybrid viruses spread throughout all the non-inoculated upper leaves as verified by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification. The viral symptoms consisted of distortion of systemic leaves, plant stunting, and mild chlorosis. Plants transfected with TTO1/PSY + showed at least a two fold increase in phytoene synthase activity over plants transfected with viral vector controls (data not shown). Leaves from systemically infected TTO1/PSY+ plants developed a bright orange phenotype and accumulated high levels of phytoene (Table 1). The leaves from TTO1/PDS- plants developed a light bleaching phenotype. The structure of the chloroplasts from TTO1/PSY- when analyzed by transmission electron microscopy, appeared to be normal. Leaves from systemically infected TTO1A/PSY- plants did not accumulate phytoene.
<u>Example 13</u>
<u>Isolation of a partial cDNA encoding <i>N.</i> benthamiana phytoene desaturase</u>
A partial cDNA clone that encodes for <i>N</i>. <i>benthamiana</i> phytoene desaturase was isolated from young leaf tissue. Nucleotide sequence comparison of 380 bp in the corresponding regions between tomato and <i>N. benthamiana</i> phytoene desaturase indicate that they are 92% similar to each other (figure 2). Since the two plant genes have areas of high homology, cytoplasmic inhibition of the endogenous plant gene by viral-derived antisense RNA may occur through the formation of hybrid, double stranded RNA molecules. The down regulation of phytoene desaturase in plants transfected with TTO1A/PDS+ may be caused by direct interference during the translation of mRNA into protein or by duplexes formed between mRNA and viral-derived negative strand RNA.
<u>Example 15</u>
<u>Analysis of PDS mRNA in Nicotina Cells Producing Tomato PDS Derived Specific Anti-sense RNA</u>
Reverse Transcriptase PCR experiments measuring the presence or absence of detectable PDS mRNA transcripts in <i>N</i>. <i>benthamiana</i> cells containing TT01/PDS- (producing PDS anti-sense RNA) were performed. RNA was isolated from transfected plants by the method of Gailiano <i>et al.</i> The primers used to detect TT01/<i>L</i>. <i>esculeutum</i> were 5'TAATCGATGATGATTCGGAGGCTAC3' (SEQ ID NO:11) (upstream) 5'GGCACTCAACTTTATAAACC3' (SEQ ID NO:8) (downstream). The primer used to detect <i>N. benthamiana</i> transcripts were 5'GGCACTCAACTTTATAAACC3' (SEQ ID NO:8) (upstream) and 5'CTCCTTTAATTGTACTGCCA3' (SEQ ID NO:12) (downstream). The PCR experiments were unable to detect endogenous PDS mRNA in the vector transfected plants, while the expected 452 bp anti-sense transcript could be detected. The 219 bp PDS mRNA could only be detected in the control, non-infected, <i>N. benthamiana</i> plants.
6 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6
Every citation, both waysCites: the store holds 6 of 7
| Document | Relation | Office |
|---|---|---|
| EP0425004A | Cites | European Patent Office (EPO) |
| WO9012107A | Cites | World Intellectual Property Organization (WIPO) |
| WO9109128A | Cites | World Intellectual Property Organization (WIPO) |
| WO9113078A | Cites | World Intellectual Property Organization (WIPO) |
| WO9113994A | Cites | World Intellectual Property Organization (WIPO) |
| WO9303161A | Cites | World Intellectual Property Organization (WIPO) |
207 members in 18 offices
Priority claims9
| Document | Office | Kind | Date |
|---|---|---|---|
| 260546 | United States of America | – | |
| 26054694 | United States of America | A | |
| 26054694 | United States of America | A | |
| 9506741 | United States of America | W | |
| 9506741 | United States of America | W | |
| 260546 | – | – | – |
| US19940260546 | – | – | – |
| US9506741 | – | – | – |
| WO1995US06741 | – | – | – |
Members207
| Document | Office | Kind | |
|---|---|---|---|
| WO8908145A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU4072589A | Australia | A | |
| WO9000611A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU3975089A | Australia | A | |
| CA2000114A1 | Canada | A1 | |
| EP0363792A1 | European Patent Office (EPO) | A1 | |
| WO9004029A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU4418989A | Australia | A | |
| ZA897501B | South Africa | B | |
| WO9013654A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU5664090A | Australia | A | |
| KR900702037A | Republic of Korea | A | |
| EP0406267A1 | European Patent Office (EPO) | A1 | |
| JPH03502886A | Japan | A | |
| CA2086417A1 | Canada | A1 | |
| CA2166818A1 | Canada | A1 | |
| WO9200373A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU8295491A | Australia | A | |
| CA2114636A1 | Canada | A1 | |
| WO9303161A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU3351193A | Australia | A | |
| KR930701589A | Republic of Korea | A | |
| EP0547065A1 | European Patent Office (EPO) | A1 | |
| AU638411B2 | Australia | B2 | |
| EP0547065A4 | European Patent Office (EPO) | A4 | |
| JPH06500011A | Japan | A | |
| EP0596979A1 | European Patent Office (EPO) | A1 | |
| US5316931A | United States of America | A | |
| KR940005597B1 | Republic of Korea | B1 | |
| EP0596979A4 | European Patent Office (EPO) | A4 | |
| CA2152934A1 | Canada | A1 | |
| WO9416089A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU5987194A | Australia | A | |
| IL108241D0 | Israel | D0 | |
| EP0363792B1 | European Patent Office (EPO) | B1 | |
| IL111608D0 | Israel | D0 | |
| AT117376T | Austria | T | |
| ATE117376T1 | Austria | T1 | |
| ZA939798B | South Africa | B | |
| DE68920685D1 | Germany | D1 | |
| JPH07503361A | Japan | A | |
| ES2069560T3 | Spain | T3 | |
| CA2176236A1 | Canada | A1 | |
| WO9513386A2 | World Intellectual Property Organization (WIPO) | A2 | |
| DE68920685T2 | Germany | T2 | |
| AU1173495A | Australia | A | |
| CA2000114C | Canada | C | |
| WO9513386A3 | World Intellectual Property Organization (WIPO) | A3 | |
| IL113955D0 | Israel | D0 | |
| EP0677113A1 | European Patent Office (EPO) | A1 | |
| CA2193094A1 | Canada | A1 | |
| CA2309028A1 | Canada | A1 | |
| WO9534668A2 | World Intellectual Property Organization (WIPO) | A2 | |
| AU2653495A | Australia | A | |
| IL115578D0 | Israel | D0 | |
| KR960700344A | Republic of Korea | A | |
| WO9534668A3 | World Intellectual Property Organization (WIPO) | A3 | |
| ZA954451B | South Africa | B | |
| ZA948973B | South Africa | B | |
| AU3010695A | Australia | A | |
| CA2202652A1 | Canada | A1 | |
| WO9612028A1 | World Intellectual Property Organization (WIPO) | A1 | |
| ZA958659B | South Africa | B | |
| AU3763795A | Australia | A | |
| JPH08505289A | Japan | A | |
| US5529909A | United States of America | A | |
| EP0731843A1 | European Patent Office (EPO) | A1 | |
| CA2223493A1 | Canada | A1 | |
| WO9640867A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU6157296A | Australia | A | |
| US5589367A | United States of America | A | |
| US5631151A | United States of America | A | |
| MX9606476A | Mexico | A | |
| JPH09505468A | Japan | A | |
| MX9702714A | Mexico | A | |
| EP0787195A1 | European Patent Office (EPO) | A1 | |
| EP0804600A1 | European Patent Office (EPO) | A1 | |
| AU683412B2 | Australia | B2 | |
| KR970707291A | Republic of Korea | A | |
| IS4629A | Iceland | A | |
| JPH10501968A | Japan | A | |
| EP0832191A1 | European Patent Office (EPO) | A1 | |
| CA1339841C | Canada | C | |
| IL122412D0 | Israel | D0 | |
| AU694102B2 | Australia | B2 | |
| AU695044B2 | Australia | B2 | |
| KR0149181B1 | Republic of Korea | B1 | |
| JPH10508468A | Japan | A | |
| US5811653A | United States of America | A | |
| US5814495A | United States of America | A | |
| US5837505A | United States of America | A | |
| CA1340378C | Canada | C | |
| US5866785A | United States of America | A | |
| KR19990022818A | Republic of Korea | A | |
| US5889190A | United States of America | A | |
| US5889191A | United States of America | A | |
| JPH11507217A | Japan | A | |
| CA2086417C | Canada | C | |
| US5922602A | United States of America | A | |
| AU710588B2 | Australia | B2 |
50 legal events, as 6 offices reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | Office | |
|---|---|---|---|
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Announcement of lapse in spainLapsedFD2A | FD2A | ES | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Notification of lapseLapsedST | ST | FR | |
| Patent lapsedLapsedMM4A | MM4A | IE | |
| Gb: european patent ceased through non-payment of renewal feeCeasedGBPC | GBPC | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| No opposition filedOpposition26N | 26N | EP | |
| No opposition filed within time limitOppositionORIGINAL CODE: 0009261PLBE | PLBE | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: NO OPPOSITION FILED WITHIN TIME LIMITSTAA | STAA | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Definitive protectionFG2A | FG2A | ES | |
| Patent ceasedCeasedPL | PL | CH | |
| Fr: translation filedET | ET | EP | |
| Nl: lapsed or annulled due to failure to fulfill the requirements of art. 29p and 29m of the patents actLapsedNLV1 | NLV1 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Corresponds to:REF | REF | EP | |
| European patents granted designating irelandGrantedFG4D | FG4D | IE | |
| Designated contracting statesAK | AK | EP | |
| European patent takes effect as a national patent in ch/liEP | EP | CH | |
| European patent grantedGrantedFG4D | FG4D | GB | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Corresponds to:REF | REF | EP | |
| (expected) grantORIGINAL CODE: 0009210GRAA | GRAA | EP | |
| Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOS IGRAGRAH | GRAH | EP | |
| Despatch of communication of intention to grantORIGINAL CODE: EPIDOS AGRAGRAG | GRAG | EP | |
| Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOS IGRAGRAH | GRAH | EP | |
| Despatch of communication of intention to grantORIGINAL CODE: EPIDOS AGRAGRAG | GRAG | EP | |
| Despatch of communication of intention to grantORIGINAL CODE: EPIDOS AGRAGRAG | GRAG | EP | |
| Party data changed (applicant data changed or rights of an application transferred)RAP1 | RAP1 | EP | |
| First examination report despatched17Q | 17Q | EP | |
| Request for examination filed17P | 17P | EP | |
| Designated contracting statesAK | AK | EP | |
| Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI | PUAI | EP |
Numbers
- Publication
- 0804600
- Publication, DOCDB
- 0804600
- Publication, EPODOC
- EP0804600
- Application
- 95921458
- Application, DOCDB
- 95921458
- Application, EPODOC
- EP19950921458
Titles3
- German
- CYTOPLASMATISCHE INHIBITION DES GENEXPRESSION
- English
- THE CYTOPLASMIC INHIBITION OF GENE EXPRESSION
- French
- INHIBITION CYTOPLASMIQUE DE L'EXPRESSION GENIQUE
Classification
- CPC, 44
- C12N15/1137
- C07K14/005
- C07K14/415
- C07K14/70571
- C12N9/00
- C12N9/0059
- C12N9/0071
- C12N9/0083
- C12N9/1074
- C12N9/14
- C12N9/16
- C12N9/18
- C12N9/20
- C12N9/6459
- C12N9/78
- C12N9/84
- C12N15/8203
- C12N15/8216
- C12N15/8218
- C12N15/8249
- C12N15/825
- C12N15/8289
- C12N15/86
- C12N2710/22043
- C12N2710/22062
- C12N2750/12043
- C12N2770/00022
- C12N2770/00043
- C12N2770/00051
- C12N2770/32643
- C12N2770/32662
- C12N2770/32722
- C12N2770/32743
- C12N2770/32762
- C12N2770/36143
- C12N2770/36162
- C12N2799/021
- C12N2810/609
- C12P41/003
- C12Y114/18001
- C12Y302/01031
- G01N2333/4353
- C12Y304/21069
- C12N9/1085
- IPC, 28
- A01H5 00
- C07K14 08
- C07K14 095
- C07K14 415
- C07K14 705
- C12N1 19
- C12N5 10
- C12N9 00
- C12N9 02
- C12N9 10
- C12N9 14
- C12N9 16
- C12N9 18
- C12N9 20
- C12N9 24
- C12N9 72
- C12N9 78
- C12N9 84
- C12N15 09
- C12N15 113
- C12N15 12
- C12N15 40
- C12N15 53
- C12N15 82
- C12N15 83
- C12N15 86
- C12P21 04
- C12P41 00
Designated states17
- Contracting states, 17
- Austria
- Belgium
- Switzerland
- Germany
- Denmark
- Spain
- France
- United Kingdom
- Greece
- Ireland
- Italy
- Liechtenstein
- Luxembourg
- Monaco
- Netherlands (Kingdom of the)
- Portugal
- Sweden
