Transformation du Bacillus thuringiensis.

0001The present invention describes a method which, for the first time, enables direct and targeted genetic manipulation of Bacillus thuringiensis and the closely related B. cereus with the aid of recombinant DNA technology, based on an efficient transformation method for said Bacillus species.

0002Furthermore, the present invention relates to the construction of plasmids and shuttle vectors and the B. thuringiensis and / or B. cereus strains transformed therewith themselves.

0003The present invention further relates to a method for introducing and optionally expressing genes or other useful DNA sequences in Bacillus thuringiensis and / or Bacillus cereus, but in particular a method for introducing and expressing protoxin genes.

0004The present invention also encompasses a method for direct cloning and, if appropriate, for the expression and identification of new genes or other useful DNA sequences in Bacillus thuringiensis and / or Bacillus cereus, which makes it possible for the first time to provide gene banks directly in Bacillus thuringiensis and / or Bacillus cereus establish and express there.

0005Bacillus thuringiensis belongs to the large group of gram-positive, aerobic, endospore-forming bacteria. In contrast to the very closely related Bacillus species, B. cereus and B. anthracis, the majority of the previously known B. thuringiensis species produce a parasporal inclusion body in the course of their sporulation, which is also generally referred to as a crystal body due to its crystalline structure. This crystal body is composed of insecticidally active crystalline protoxin proteins, the so-called ö-endotoxin.

0006These protein crystals are responsible for the insect toxicity of B. thuringiensis. However, the o-endotoxin only develops its insecticidal activity after the crystal body has been taken up orally and dissolved in the alkaline intestinal juice of the target insects and after the actual toxic component has been released from the protoxin by limited proteolysis due to the action of proteases from the insect's digestive tract.

0007The 5-endotoxins of the different B. thuringiensis strains are distinguished by their high specificity towards certain target insects, in particular towards different lepidopteran, coleopteran and dipteran larvae, and by their great effectiveness. Other advantages of using the Ö endotoxins from B. thuringiensis are due to the obvious difficulty for the target insects to develop resistance to the crystalline protein and the harmlessness of the toxins to humans, other mammals, birds, fish or insects, with the exception of the above-mentioned target insects.

0008The insecticidal potential of B. thuringiensis protoxins was recognized very early on. B. thuringiensis preparations have been used as bioinsecticides to control various diseases of crop plants caused by insects since the late 1920s. With the discovery of B. thuringiensis var. Israelensis by¹⁾Goldberg and Margalit (1977) and B. thuringiensis var. Tenebrionis ²⁾Krieg et al (1983) was able to extend the range of applications of B. thuringiensis even to mosquito and beetle larvae.

0009With the introduction of genetic engineering and the resulting new opportunities, the field of B. thuringiensis toxins has experienced a new upswing.

0010The cloning of 5-endotoxin genes in foreign host organisms such as E. coli is already routine. This has led to the fact that the DNA sequences of a whole series of δ-endotoxin genes are now known (e.g.³⁾Schnepf HE and Whiteley HR, 1981; ⁴⁾Klier A et al, 1982; ⁵⁾-Geiser M et al, 1986; ⁶⁾Haider MZ et al, 1987).

0011Most B. thuringiensis species contain several genes that code for an insecticidally active protein. These genes, which are only expressed during the sporulation phase, are localized in the majority of cases on large transferable plasmids (30-150 Md) and can therefore be exchanged very easily between the different B. thuringiensis strains and between B. thuringiensis and B. cereus if they are compatible (⁷⁾Gonzalez JM et al, 1982).

0012The protoxin genes from B. thuringiensis var. Kurstaki belong to a family of related genes, several of which have already been cloned and sequenced. This work was primarily carried out in an E. coli cloning system.

0013The cloning of B. thuringiensis genes has thus far been essentially restricted to a few and exclusively heterologous host systems, of which the E. coli system is the best studied and understood.

0014In the meantime, however, reports of successful cloning and expression of protoxin genes in other host systems have become known, for example in B. subtilis (⁴) Klier A et al, 1982), Pseudomonas fluoreszens (¹) Obukowicz MG et al, 1986) and Saccharomyces cerevisiae (EP 0 238 441). The incorporation and expression of the 3-endotoxin gene in plant host cells has now also been successful (EP 0 292 435).

0015The cloning in E. coli takes advantage of the fact that, in addition to the gram-positive promoters, some protoxin genes also happen to contain an E. coli-like promoter. These promoter-like DNA sequences make it possible that the B. thuringiensis protoxin genes can also be expressed in heterologous host systems, provided that they are able to recognize the control sequences mentioned above.

0016The expressed protoxin proteins can then be isolated and identified using known methods after the host cells have been broken up.

0017In the meantime, however, it has been shown that E. coli-like promoters are not present in protoxin genes in all cases (⁹⁾Donovan et al, 1988), so that so far only very specific protoxin genes that meet the above-mentioned requirements can be expressed and thus identified in heterologous host systems.

0018The cloning of genes outside the natural host organism and the use of these strains in practice as bioinsecticides is therefore associated with a number of serious disadvantages:

0019<ul id="ul0001" list-style="none"><li>a) Expression of B. thuringiensis protoxin genes is only possible in certain cases.</li><li>b) There is generally no or only a small secretion of expressed foreign proteins.</li><li>c) Correct folding of the 5-endotoxins is not always guaranteed in the reducing environment of heterologous host cells, which can result in an undesirable change in the specific activity or the host range of the toxins. <</li><li>> d) If expression takes place at all, the expression rates of the cloned foreign genes among the native expression sequences are mostly only low.<ul id="ul0002" list-style="none"><li>³⁾;¹⁰⁾Schnepf and Whitley (1981; 1985) estimate that the B. thuringiensis toxin cloned in E. coli accounts for only 0.5% to 1% of the total cell protein of E. coli, whereas the crystal protein in B. thuringiensis is between 30% and 40 % of the dry weight of sporulating cultures. These serious differences in expression rates may be due to the lack of sporulation-specific control signals in the heterologous host systems as well as difficulties in recognizing the B. thuringiensis promoters and / or problems in the post-translational modification of the toxin molecule by the foreign host.</li></ul></li><li>e) Many of the host strains generally used for expression are not as toxicologically harmless as B. thuringiensis and B. cereus.</li><li>f) B. thuringiensis and B. cereus form a natural main component of the microbial soil flora, which is not the case for most of the host strains generally used for expression.</li></ul>

0020These problems and difficulties mentioned above could be overcome if the B. thuringiensis genes were cloned directly in the homologous host system, where the natural gram-positive promoters of the protoxin genes can be used for expression.

0021So far, however, there is no method that makes B. thuringiensis, this bacterium, which is so important from a commercial point of view, accessible for direct genetic modification and thus enables, for example, an efficient re-introduction of a cloned protoxin gene into a B. thuringiensis strain.

0022The reason for this is primarily to be seen in the fact that it has so far not been possible to develop an efficient transformation system for B. thuringiensis and the closely related B. cereus, which guarantees sufficiently high transformation rates and thus the use of already established rDNA techniques on B. thuringiensis.

0023The processes used hitherto to produce new B. thuringiensis strains with new insecticidal properties are based primarily on the conjugal transfer of plasmid-encoded protoxin genes.

0024Successful reintroduction of a cloned B. thuringiensis crystal protein gene into B. thuringiensis has only been described in one case (¹¹⁾Klier A et al, 1983), but here too, in the absence of a suitable transformation system for B. thuringien sis, the conjugal transfer between B. subtilis and B. thuringiensis had to be used. E. coli is also used as an intermediate host in the method described by Klier et al.

0025However, the conjugal transfer methods have a number of serious disadvantages which make them seem unsuitable for routine use in the genetic modification of B. thuringiensis and / or B. cereus.<ul id="ul0003" list-style="none"><li>a) The conjugal transfer of plasmid-encoded protoxin genes is only possible between B. thuringiensis strains or between B. cereus and B. thuringiensis strains that are compatible with one another.</li><li>b) With conjugal plasmid transfer between more distant strains, only a low transfer frequency is often achieved.</li><li>c) There is no way to regulate or modify the expression of the protoxin genes.</li><li>d) There is no way to modify the gene itself. e) In the presence of several protoxin genes in a strain, the expression of individual genes can be greatly reduced due to the so-called gene dose effect.</li><li>f) Instabilities may occur due to a possible homologous recombination of related protoxin genes.</li></ul>

0026Alternative transformation methods, which are now routinely used for example in many gram-positive organisms, have proven unsuitable for both B. thuringiensis and B. cereus.

0027The aforementioned methods include, for example, the direct transformation of bacterial protoplasts with the help of polyethylene glycol treatment, which is common in many Streptomyces strains (¹²⁾Bibb JJ et al, 1978) and B. subtilis (¹³⁾Chang S and Cohen SN, 1979), B. megaterium (¹⁴) Brown BJ and Cärlton BC, 1980), Streptococcus lactis (¹⁵⁾Kondo JK and McKay LL, 1984), S. faecalis (¹⁶⁾Wirth R et al), Corynebacterium glutamicum (¹⁷⁾Yoshihama M et al, 1985) and numerous other gram-positive bacteria.

0028To use this method, the bacterial cells must first be protoplastized, ie the cell walls are digested with the help of lytic enzymes.

0029Another prerequisite for the successful application of this direct transformation process is the expression of the newly introduced genetic information and the regeneration of the transformed protoplasts on complex solid media before a successful transformation can be demonstrated, for example with the aid of a selection marker.

0030This transformation method proved to be unsuitable for B. thuringiensis and the closely related B. cereus. Due to the high resistance of the B. thuringiensis cells to lysozyme and the inability to regenerate the protoplasts to intact cells containing cells, the achievable transformation rates remain low and difficult to reproduce (¹⁸⁾Alikhanian SJ et al, 1981; 19) Martin PA et al, 198₁; ²⁰) Fischer HM et al, 1984).

0031With this method it is therefore possible to introduce at most very simple plasmids, which are unsuitable for working with recombinant DNA, into B. thuringiensis or B. cereus cells at a low frequency.

0032Individual reports of satisfactory transformation rates, which could be achieved with the aid of the previously described method, are based on the development of very complex optimization programs, which, however, can only ever be used concretely for a specific B. thuringiensis strain and involve a great deal of time and cost are (²¹⁾Schall D, 1986). These methods are therefore unsuitable for routine use on an industrial scale.

0033As the intensive research work in the field of B. thuringiensis genetics shows, there is great interest in the development of new methods that make B. thuringiensis or the closely related B. cereus accessible for direct genetic modification, and thus for example cloning of protoxin genes enable in the natural host system. However, the existing difficulties and problems have not yet been satisfactorily resolved.

0034At the moment there are no suitable transformation methods available which enable fast, efficient and reproducible transformation of B. thuringiensis and / or B. cereus with a sufficiently high transformation frequency, nor are suitable cloning vectors available which allow the use of the recombinant DNA already established for other bacterial host systems Allow techniques also on B. thuringiensis. This also applies to B. cereus in the same way.

0035Surprisingly, this object has now been achieved in the context of the present invention by using simple, in part known process measures.

0036The present invention thus relates to a novel method which, based on recombinant DNA technology, for the first time enables direct, targeted and reproducible genetic manipulation of B. thuringiensis and B. cereus is made possible by transforming Bacillus thuringiensis and / or Bacillus cereus with high efficiency with the aid of a simple transformation process, using a recombinant DNA which is suitable for the intended genetic manipulation of Bacillus thuringiensis and / or Bacillus cereus.

0037Furthermore, the present invention relates to a method for introducing, cloning and expressing genes or other useful DNA sequences, but in particular protoxin genes, in B. thuringiensis and / or B. cereus, which is characterized in that<ul id="ul0004" list-style="none"><li>a) said genes or DNA isolated;</li><li>b) if appropriate, the isolated genes or DNA are operably linked to expression sequences which are functional in Bacillus thuringiensis and / or B. cereus;</li><li>c) the genetic constructions from section b) are transformed into Bacillus thuringiensis and / or B. cereus cells using suitable vectors; and</li><li>d) if appropriate, a corresponding gene product is expressed and, if desired, isolated.</li></ul>

0038Also included in the present invention is a direct method for cloning, expressing and identifying genes or other useful DNA sequences, but especially protoxin genes, in B. thuringiensis and / or B. cereus, which is characterized in that<ul id="ul0005" list-style="none"><li>a) the total DNA of Bacillus thuringiensis is digested with the aid of suitable restriction enzymes;</li><li>b) isolating such a suitable size from the resulting restriction fragments;</li><li>c) splicing said fragments into a suitable vector;</li><li>d) Bacillus thuringiensis and / or B. cereus cells are transformed with said vector; and</li><li>e) from the transformants, using suitable screening methods, finds new DNA sequences and, if necessary, isolates them.</li></ul>

0039In addition to structural genes, any other useful DNA sequences can of course also be used in the method according to the invention, such as, for example, non-coding DNA sequences which have a regulatory function, such as, for example, anti-sense DNA.

0040The method according to the invention thus opens up a large number of new possibilities which are of exceptional interest both from a scientific and from a commercial point of view.

0041For example, it is now possible for the first time to obtain information about the regulation of B-endotoxin synthesis, particularly with regard to sporulation, at the genetic level.

0042The question of where in the toxin molecule the section (s) responsible for insect toxicity is located and to what extent this is also related to the host specificity should now be clarified to let.

0043Knowledge of the molecular organization of the various toxin molecules and of the toxin genes encoding these molecules from the various B. thuringiensis species is of extraordinary practical interest for a targeted genetic manipulation of these genes, which is now possible for the first time with the aid of the method according to the invention.

0044In addition to a targeted modification of the δ-endotoxin genes themselves, the new method according to the invention also allows the manipulation of the regulatory DNA sequences which control the expression of these genes, as a result of which both the specific properties of the 5-endotoxins such as their host specificity, their resorption behavior, among other things, are specifically changed and also theirs Production rates can be increased, for example by incorporating stronger and more efficient promoter sequences.

0045Through targeted mutation of selected genes or subgenes in vitro, new B. thuringiensis and / or B. cereus variants are obtained.

0046A further possibility for the construction of new B. thuringiensis and / or B. cereus variants consists in splicing together genes or gene segments which come from different B. thuringiensis sources, thereby creating B. thuringiensis and / or B. cereus strains with an expanded range of applications arise. Synthetic or semi-synthetic toxin genes can also be used in this way for the construction of new B. thuringiensis and / or B. cereus varieties.

0047In addition, the method according to the invention enables, for the first time, the creation of gene banks and the rapid screening of modified and new genes in B. thuringiensis and / or B. cereus due to the strong increase in the transformation frequency and the simplification of the method.

0048in particular, the method according to the invention now for the first time enables direct expression of gene banks in B. thuringiensis and / or B. cereus and the identification of new protoxin genes in B. thuringiensis with the aid of known, preferably immunological or biological, methods.

0049The present invention thus relates to a method which is based on a strong increase in the efficiency of the B. thuringiensis / B. cereus transformation for the first time enables a direct genetic modification of the B. thuringiensis and / or B. cereus genome compared to previously known methods.

0050In particular, the present invention relates to a method for transforming B. thuringiensis and / or B. cereus by introducing recombinant DNA, in particular plasmid and / or vector DNA, into B. thuringiensis and / or B. cereus cells with the aid of the Electroporation.

0051A method for transforming B. thuringiensis and / or B. cereus with δ-endotoxin-encoding DNA sequences and DNA sequences which code for a protein which essentially has the insect-toxic properties of said B. thuringiensis toxins is preferred.

0052Another object of the present invention relates to the expression of DNA sequences which encode an δ-endotoxin or a protein which at least essentially has the insect toxic properties of the B. thuringiensis toxin, in transformed B. thuringiensis and / or B. cereus - cells.

0053The present invention also includes a method for producing bifunctional vectors, so-called 'shuttle' vectors, for B. thuringiensis and / or B. cereus, and the use of said 'shuttle' vectors for transforming B. thuringiensis and / or B. cereus cells.

0054Preference is given to the construction of bifunctional vectors which, apart from B. thuringiensis and / or B. cereus, replicate in one or more other, heterologous host systems, but in particular in E. coli cells.

0055In particular, the present invention relates to a method for the production of 'shuttle' vectors for B. thuringiensis and / or B. cereus which contain a DNA sequence which encodes an o-endotoxin polypeptide which occurs naturally in B. thuringiensis or at least one polypeptide which is essentially homologous to it, ie which at least essentially has the insect toxic properties of the B. thuringiensis toxin. The present invention also includes the use of these 'shuttle' vectors for transforming B. thuringiensis and / or B. cereus cells and the expression of the DNA sequences present on said 'shuttle' vectors, in particular those DNA sequences which code for a 5-endotoxin from B. thuringiensis or at least for a protein which essentially has the insect-toxic properties of the B. thuringiensis toxins.

0056The present invention also includes the use of B. thuringiensis and / or B. cereus as general host organisms for the cloning and expression of homologous and in particular also heterologous DNA or a combination of homologous and heterologous DNA.

0057Another object of this invention relates to the previously characterized plasmids and 'shuttle' vectors themselves, their use for transforming B. thuringiensis and / or B. cereus, and the B. thuringiensis and B. cereus cells transformed with them.

0058Particularly preferred in the context of this invention are the bifunctional ('shuttle') vectors pX161 (= pK61) and pX193 (= pK93), which, transformed into B. thuringiensis var. Kurstaki HD1 cryB and B. cereus 569 K, in which as International depository recognized 'German Collection of Microorganisms' (Braunschweig, Germany) in accordance with the provisions of the Budapest Treaty under number DSM 4573 (pX161, transformed into B. thuringiensis var. Kurstaki HD1 cryB) or DSM 4571 (pX193, transformed in B. thuringiensis var. Kurstaki HD1 cryB) and DSM 4573 (pX193, transformed in B. cereus 569 K) have been deposited.

0059In particular, the present invention relates to new B. thuringiensis and B. cereus varieties which are transformed with a DNA sequence which encodes and expresses an δ-endotoxin from B. thuringiensis or at least a protein which essentially has the toxic properties of the B. thuringiensis has toxins.

0060The transformed B. thuringiensis and B. cereus cells as well as the toxins produced by them can be used for the production of insecticidal agents which are a further subject of the present invention.

0061Also included are methods and means for controlling insects using the previously characterized B. thuringiensis and / or B. cereus cells, and cell-free crystal body (ö-endotoxin) preparations which contain the protoxins produced by said transformed Bacillus cells.

0062The following is a brief description of the illustrations.<ul id="ul0006" list-style="none"><li>Figure 1: Transformation of E. coli HB 101 with pBR322 (o) and * B. thuringiensis HD1 cryB with pBCl6 (*) (A number of surviving * HD1 cryB cells).</li><li>Figure 2: Influence of the age of a * B. thuringiensis HD1 cryB culture on the transformation frequency.</li><li>Figure 3: Influence of the pH value of the PBS buffer solution on the transformation frequency.</li><li>Figure 4: Influence of the sucrose concentration of the PBS buffer solution on the transformation frequency.</li><li>Figure 5: Dependency between the number of transformants and the amount of DNA used per transformation.</li><li>Figure 6: Simplified restriction map of the "shuttle" vector ^*pX161. The hatched bar indicates the sequences from the gram-positive pBC16, the rest comes from the gram-negative plasmid pUC8.</li><li>Figure 7: Simplified restriction map of ^*pX193. The hatched bar indicates the protoxin structural gene (arrow, Kurhdl) and the 5 and 3 non-coding sequences. The rest of the non-hatched part comes from the "shuttle" vector * pXI61.</li><li>Figure 8: SDS (sodium dodecyl sulfate) / polyacrylamide gel electrophoresis of extracts from sporulating cultures of ^*B. thuringiensis HD1 cryB, B. cereus 569K and their derivatives.</li></ul>

0063[1: * HD1 cryB (pX193), 2: * HD1 cryB (pXI61), 3: * HD1 cryB, 4: HD1, LBG B-4449, 5: * B. cereus 569K (pX193), 6: 569K]<ul id="ul0007" list-style="none"><li>a) Comassie-stained, M: molecular weight standard, MG: molecular weight (Dalton), arrow: position of the 130,000 Dalton protoxin.</li><li>b) Western blot of the same gel, mixed with polyclonal antibodies against the K-1 crystal protein of B. thuringiensis HD1.</li></ul>

0064Positive bands were found using labeled anti-goat antibodies. Arrow: position of 130,000 Dalton protoxin. Other bands: Protoxin degradation products.

0065Figure 9: Transformation of B. subtilis LBG B-4468 with pBC16 plasmid DNA using the electroporation method optimized for B. thuringiensis. (u: transformants / µg plasmid DNA; •: number of live germs / ml)

0066(* The internal designation pK selected in the priority document for the naming of the plasmids was replaced by the officially recognized designation pXl for the international version. The designation for the asporogenic B. thuringiensis HD1 mutant used in the exemplary embodiments was also changed from cryß to cryB.)

0067An essential aspect of the present invention relates to a novel transformation method for B. thuringiensis and B. cereus, which is based on the introduction of plasmid DNA into B. thuringiensis and / or B. cereus cells using the electroporation technology known per se.

0068After all attempts had failed until the present invention to transfer the transformation methods already established in other bacterial host systems to B. thuringiensis and the closely related B. cereus, it was now possible within the scope of this invention through the use of electroporation technology and accompanying measures surprising success can be achieved.

0069This success must be seen as surprising and unexpected, especially when a Soviet group (²²⁾Shivarova N et al, 1983), electroporation experiments had previously been carried out on B. thuringiensis protoplasts, but the transformation frequencies achieved were so low that this method was subsequently regarded as unusable for a B. thuringiensis transformation and consequently no further ones Noticed more.

0070Based on investigations of the process parameters critical for an electroporation of B. thuringiensis and / or B. cereus cells, it has now surprisingly been possible to develop a transformation process which is ideally adapted to the needs of B. thuringiensis and B. cereus and leads to transformation rates that are in a range between 10⁶ and 10⁸ Cells / µg of plasmid DNA lie, but in particular in a range between 10⁶ and 10⁷ Cells / µg plasmid DNA.

0071Approximately equal transformation rates with values ​​between 10² and a maximum of 10⁶ Transformants / µg plasmid DNA could only be used with the second¹⁾Schall (1986) described PEG (polyethylene glycol) transformation process can be achieved. However, high transformation rates remain limited to those B. thuringiensis strains for which the PEG method was specifically adapted in very time-consuming optimization studies, which makes this method seem unsuitable for practical use.

0072In addition, in many cases, these methods prove to be impossible or difficult to reproduce in practice.

0073In contrast to this, the method according to the invention is a transformation method that can be used in principle for all B. thuringiensis and B. cereus strains, and is less time-consuming, more efficient and therefore more efficient than the traditional PEG transformation methods.

0074For example, whole, intact cells can be used in the method according to the invention, as a result of which the time-consuming protoplasting, which is critical for B. thuringiensis and B. cereus, and the subsequent regeneration on complex nutrient media are eliminated.

0075In addition, when using the PEG method, the implementation of the necessary procedural measures can take up to a week, while with the transformation method according to the invention the transformed cells can be obtained within a few hours (usually overnight).

0076Another advantage of the method according to the invention relates to the number of B. thuringiensis and / or B. cereus cells that can be transformed per unit of time.

0077While in the traditional PEG methods only small aliquots can be plated at the same time in order to avoid an inhibition of regeneration due to the cells growing too densely, when using the electroporation technique large amounts of B. thuringiensis and / or B. cereus cells can be used simultaneously be plated out.

0078This enables the detection of transformants even at very low transformation frequencies, which is not possible or only possible with considerable effort using the methods described above.

0079In addition, quantities of DNA in the nanogram range are sufficient to obtain at least some transformants.

0080This is particularly important when a very efficient transformation system is required, such as when using DNA material from E. coli, which leads to a reduction compared to B. thuringiensis DNA due to a strong restriction system in B. thuringiensis cells the transformation frequencies by a factor of 10³ can lead.

0081The transformation method according to the invention, which is essentially based on the electroporation technology known per se, is characterized by the following specific method measures:<ul id="ul0008" list-style="none"><li>a) preparing a cell suspension with a suitable cell density in a culture medium suitable for the cultivation of B. thuringiensis cells and with sufficient ventilation for the growth of the cells;</li><li>b) separating the cells from the cell suspension and resuspending in an inoculation buffer suitable for the subsequent electroporation;</li><li>c) adding a DNA sample in a concentration suitable for electroporation;</li><li>d) introducing the approach described under b) and c) into an electroporation apparatus;</li><li>e) One or more short-term discharges of a capacitor via the cell suspension for the short-term generation of high electric field strengths over a period of time which is sufficient for a transformation of B. thuringiensis and / or B. cereus cells with recombinant DNA;</li><li>f) optionally post-incubation of the electroporated cells;</li><li>g) plating the electroporated cells on a suitable selection medium; and</li><li>h) reading the transformed cells.</li></ul>

0082In a specific and preferred embodiment of the method according to the invention, the B. thuringiensis cells are first incubated in a suitable nutrient medium with adequate aeration and at a suitable temperature, preferably from 20 C to 35 C, until an optical density (ODsso ) from 0.1 to 1.0 is reached. The age of the Bacillus cultures intended for electroporation has a significant influence on the transformation frequency. An optical density of the Bacillus cultures of 0.1 to 0.3, but in particular of 0.2, is therefore particularly preferred. However, it should be noted that good transformation frequencies can also be achieved with Bacillus cultures from other growth phases, in particular also with overnight cultures (see Figure 2).

0083Fresh cells or spores are generally used as the starting material, but deep-frozen cell material can also be used as well. These are preferably cell suspensions of B. thuringiensis and / or B. cereus cells in suitable liquid media, to which a certain proportion of an 'antifreeze' is advantageously added.

0084Suitable antifreeze agents are primarily mixtures of osmotically active components and DMSO in water or a suitable buffer solution. Other suitable components that are suitable for use in antifreeze solutions include sugars, polyhydric alcohols, such as glycerol, sugar alcohols, amino acids and polymers, such as polyethylene glycol.

0085Assuming B. thuringiensis spores, these are first inoculated in a suitable medium and incubated overnight at a suitable temperature, preferably from 25 ° C. to 280 ° C. and with adequate ventilation. This approach is then diluted and further treated in the manner described above.

0086All media which cause such sporulation can be used to induce sporulation in B. thuringiensis. A GYS medium according to the invention is preferred^23)- Yousten AA and Rogoff MH, (1969).

0087Oxygen is generally introduced into the cultivation medium by moving the cultures, for example on a shaking machine, with speeds of rotation between 50 rpm and 300 rpm being preferred.

0088B. thuringiensis spores and vegetative microorganism cells are cultivated in the context of the present invention by known, generally customary methods, liquid nutrient media preferably being used for reasons of practicality.

0089The composition of the nutrient media can vary slightly depending on the B. thuringiensis or B. cereus strain used. In general, complex media with poorly defined, easily assimilable carbon (C) and nitrogen (N) sources are preferred, as are usually used for the cultivation of aerobic Bacillus species.

0090In addition, vitamins and essential metal ions are required, but these are usually contained in the complex nutrient media used in sufficient concentration as constituents or impurities.

0091Optionally, said components such as essential vitamins and Na⁺, K⁺, Cu²⁺, Approx²⁺, Mg²⁺, Fe³⁺, NH₄^⊕, PO₄^3-, SO₄^2-, CI-, CO₃^2- ions and the trace elements cobalt and manganese, zinc and others are added in the form of their salts.

0092In addition to yeast extracts, yeast hydrolyzates, yeast autolysates and yeast cells, particularly suitable nitrogen sources include soy flour, corn flour, oatmeal, edamin (enzymatically digested lactalbumin), peptone, casein hydrolyzate, corn liquor and meat extracts, without the subject matter of the invention is to be restricted in any way by this exemplary list.

0093The preferred concentration for the N sources mentioned is between 1.0 g / l and 20 g / l.

0094The primary sources of C are glucose, lactose, sucrose, dextrose, maltose, starch, cerelose, cellulose and malt extract. The preferred concentration range is between 1.0 g / l and 20 g / l.

0095In addition to complex nutrient media, half-or. Fully synthetic media are used, which contain the nutrients specified above in a suitable concentration.

0096In addition to the LB medium which is preferably used in the context of the present inventions, all other culture media suitable for the cultivation of B. thuringiensis and / or B. cereus can also be used, such as, for example, Antibiotic Medium 3, SCGY medium and the like. The storage of sporulated B. thuringiensis cultures are preferably carried out on GYS media (inclined agar) at a temperature of 4 C.

0097After the cell culture has reached the desired cell density, the cells are harvested by means of centrifugation and suspended in a suitable buffer solution, which is preferably cooled with ice beforehand.

0098The temperature proved not to be critical in the course of the investigations and is therefore freely selectable in a wide range. A temperature range from 0 ° C. to 35 ° C. is preferred, preferably from 2 ° C. to 15 ° C. and very particularly preferably from 4 ° C. The incubation period of the Bacillus cells before and after electroporation has only a minor influence on the transformation frequency that can be achieved (see Table 1). Only an excessively long incubation leads to a decrease in the frequency of transformation. An incubation time of 0.1 to 30 minutes, in particular 10 minutes, is preferred. The temperature proved not to be critical in the course of the investigations and is therefore freely selectable in a wide range. A temperature range from 0 ° C. to 35 ° C. is preferred, preferably from 2 ° C. to 15 ° C. and very particularly preferably from 4 ° C. This process can be repeated one to several times. Particularly suitable buffer solutions in the context of this invention are osmotically stabilized phosphate buffers which contain sugar, such as glucose or sucrose or sugar alcohols, such as mannitol, as a stabilizing agent and are adjusted to pH values ​​from 5.0 to 8.0. PBS-type phosphate buffers with a pH of 5.0 to 8.0, preferably pH 5.5 to 6.5, which contain sucrose as a stabilizing agent in a concentration of 0.1 M to 1.0 M, but preferably of 0.3 M to 0.5 M, are very particularly preferred (see Figures 3 and 4).

0099Aliquots of the suspended Bacillus cells are then transferred to cuvettes or any other suitable vessels and with a DNA sample for a suitable period, preferably for a period of 0.1 to 30 minutes, but in particular of 5 to 15 minutes, and with a suitable one Temperature, preferably at a temperature of 0 ° C. to 35 ° C., but in particular at a temperature of 2 ° C. to 15 ° C. and very particularly preferably at a temperature of 4 ° C., incubated together. When working at low temperatures, it is advantageous to use pre-cooled cells or any other suitable and pre-cooled vessels.

0100There is a linear relationship between the number of transformed cells and the DNA concentration used in electroporation, with the number of transformed cells increasing with increasing DNA concentration (see Figure 5). The DNA concentration preferred in the context of this invention lies in a range between 1 ng and 20 µg. A DNA concentration of 10 ng to 2 µg is particularly preferred.

0101The entire batch containing B. thuringiensis and / or B. cereus cells and plasmid DNA or another suitable DNA sample is then introduced into an electroporation apparatus and subjected to electroporation, ie briefly exposed to an electrical pulse.

0102Electroporation apparatuses which are suitable for use in the method according to the invention are now already offered by various manufacturers, such as, for example, Bio Rad (Richmond, CA, USA; 'Gene Pulser Apparatus'), Biotechnologies and Experimental Research, Inc. ( San Diego, CA, USA; 'BTX Transfector 100'), Promiga (Madison, Wl, USA; 'X-Cell 2000 Electroporation System'), etc.

0103Of course, any other suitable device can also be used in the method according to the invention.

0104Different pulse shapes can be used, such as rectangular pulses or exponentially decaying pulses.

0105The latter are preferred in the context of this invention. They come about through the discharge of a capacitor and are characterized by an initially very rapid increase in voltage and a subsequent exponential decay phase as a function of resistance and capacitance. The time constant RC gives a measure of the length of the exponential decay time. It corresponds to the time it takes for the voltage to 37% of the output voltage (V_a) to subside.

0106A decisive parameter for influencing the bacteria cell relates to the strength of the electric field with which the cells are exposed and which is calculated from the ratio of the applied voltage and the distance between the electrode plates.

0107Also of great importance in this context is the exponential decay time, which depends both on the configuration of the equipment used (e.g. the capacitance of the capacitor) and on other parameters, such as the composition of the buffer solution or the volumes of the cell suspension intended for electroporation .

0108For example, it has been shown in the course of the investigations that a reduction in the volume of the cell suspension intended for electroporation by half leads to an increase in the transformation frequency by a factor of 10.

0109Extending the exponential decay time by optimizing the buffer solution used also results in a significant increase in the transformation frequency.

0110All measures which lead to an increase in the exponential decay time and consequently to an increase in the transformation frequency are therefore preferred in the context of this invention.

0111The decay time preferred within the scope of the method according to the invention is between approximately 2 ms and approximately 50 ms, but in particular between approximately 8 ms and approximately 20 ms. An exponential decay time of approximately 10 ms to approximately 12 ms is very particularly preferred.

0112In the context of the present invention, the bacterial cells are briefly exposed to very high electric field strengths by briefly discharging a capacitor (s) via the DNA-containing cell suspension, as a result of which the permeability of the B. thuringiensis cells is increased briefly and reversibly. The electroporation parameters are coordinated with one another in the course of the method according to the invention in such a way that an optimal uptake of the DNA present in the electroporation buffer into the Bacillus cells is ensured.

0113The capacitance setting on the capacitor in the context of this invention is advantageously 1 uF to 250 ILF, but in particular 1 uF to 50 uF and very particularly preferably 25 uF. The choice of output voltage is not critical in a wide range and can therefore be freely selected. An output voltage Vo of from 0.2 kV to 50 kV is preferred, but in particular from 0.2 kV to 2.5 kV and very particularly preferably from 1.2 kV to 1.8 kV. The distance between the electrode plates depends, among other things from the dimensioning of the electroporation apparatus. It is advantageously between 0.1 cm and 1.0 cm, preferably between 0.2 cm and 1.0 cm. A plate spacing of 0.4 cm is particularly preferred. The field strength values ​​that act on the cell suspension result from the distance between the electrode plates and the output voltage set on the capacitor. These are advantageously in a range between 100 V / cm and 50,000 Vicm. Field strengths from 100 V / cm to 10,000 V / cm are particularly preferred, but in particular from 3,000 V / cm to 4,500 V / cm.

0114The fine tuning of the freely selectable parameters such as capacity, output voltage, plate spacing, etc. depends to a certain extent on the architecture of the devices used and can therefore vary from case to case within certain limits. The specified limit values ​​can therefore also be exceeded or fallen short of in certain cases if this is necessary to achieve optimal field strength values.

0115The actual electroporation process can be repeated one to several times until an optimal transformation frequency is reached for the respective system.

0116Following electroporation, the treated Bacillus cells can advantageously be re-incubated, preferably for a period of 0.1 to 30 minutes, at a temperature of 0 ° C. to 35 ° C., preferably 2 ° C. to 15 ° C. The electroporated cells are then diluted with a suitable medium and incubated again for a suitable period, preferably from 2 to 3 hours, with adequate ventilation and at a suitable temperature, preferably from 20 ° C. to 35 ° C.

0117The B. thuringiensis cells are then plated out on solid media which contain an additive suitable for the selection of the DNA sequences newly introduced into the bacterial cell. Depending on the type of DNA used, said agents can be, for example, antibiotic compounds, dyes and others. Particularly preferred in the context of this invention for the selection of Bacillus thuringiensis and / or B. cereus cells are antibiotics selected from the group consisting of tetracycline, kanamycin, chloramphenicol and erythromycin.

0118Chromogenic substrates, such as X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactosid), which can be detected by means of a specific color reaction, are also preferred.

0119Other phenotypic markers are known to those skilled in the art and can also be used in the context of this invention.

0120Any nutrient media suitable for the cultivation of B. thuringiensis cells can be used, to which one of the commonly used solidification media, such as agar, agarose, gelatin and others, is added.

0121The process parameters previously described in detail for B. thuringiensis can also be applied in the same way to B. cereus cells.

0122The previously described method according to the invention for transforming B. thuringiensis or B. cereus does not remain restricted to the use of certain plasmids naturally occurring in B. thuringiensis and / or B. cereus, like the methods previously available in the prior art but can be used for all types of DNA.

0123It is now possible for the first time to specifically transform B. thuringiensis and / or B. cereus, whereby plasmid DNA of heterologous origin can also be used in addition to homologous plasmid DNA, which occurs naturally in B. thuringiensis or the closely related B. cereus.

0124This can be both plasmid DNA that occurs naturally in an organism other than B. thuringiensis or the closely related B. cereus, such as plasmids pUB110 and pC194 from Staphylococcus aureus (²⁴⁾Horinouchi S and Weisblum B, 1982; ²⁵⁾Polak J and Novick RP, 1982) and the plasmid pIM13 from B. subtilis (²⁶Mahler J and Halvorson HO, 1980), which are able to replicate in B. thuringiensis and / or B. cereus, as well as hybrid plasmid DNA, which can be derived from homologous plasmid DNA or from heterologous plasmid using recombinant DNA technology DNA or from a combination of homologous and heterologous plasmid DNA is constructed. The latter hybrid plasmid DNA is more suitable for working with recombinant DNA than the natural isolates.

0125The plasmids pBD64 (²⁷⁾Gryczan T et al, 1980), pBD347, pBD348 and pUB1664, but without thereby restricting the subject matter of the present application in any way.

0126The cloning vectors already established for B. subtilis, such as, for example, pBD64, may be of particular importance for carrying out cloning experiments with various B. thuringiensis or B. cereus strains.

0127In addition to plasmid DNA, any other DNA can also be transformed into B. thuringiensis or B. cereus within the scope of the present invention. The transformed DNA can replicate either autonomously or integrated in the chromosome. This can be, for example, a vector DNA that is not derived from a plasmid but from a phage.

0128Another object of the present invention relates to the construction of bifunctional vectors ('shuttle' vectors).

0129Particularly preferred in the context of this invention is the construction and use of bifunctional (hybrid) plasmid vectors, so-called 'shuttle' vectors, which are capable, except in B. thuringiensis or the closely related B. cereus in one or in to replicate several heterologous host organisms and which can be identified in both homologous and heterologous host systems.

0130Within the scope of this invention, heterologous host organisms are to be understood as all those organisms that do not belong to the group B. thuringiensis / B. cereus and who are able to stably maintain a self-replicating DNA.

0131According to the above definition, both prokaryotic and eukaryotic organisms can act as heterologous host organisms. Examples here are representatives from the group of prokaryotic host organisms from the genera Bacillus, such as B. subtilis or B. megaterium, Staphylococcus, such as S. aureus, Streptococcus, such as Streptococcus faecalis, Streptomyces, such as Streptomyces spp., Pseudomonas, such as Pseudomonas spp., Escherichia, such as, for example, E. coli, Agrobacterium, such as, for example, A. tümefaciens or A. rhizogenes, Salomonella, Erwinia, etc. From the group of eukaryotic hosts, yeast and animal and plant cells are primarily to be mentioned. This exemplary list is not exhaustive and is not intended to limit the subject matter of the present invention in any way. Other suitable representatives from the group of prokaryotic and eukaryotic host organisms are known to the person skilled in the art.

0132B. subtilis or B. megaterium, Pseudomonas spp .. and in particular E. coli from the group of prokaryotic hosts and yeasts and animal or plant cells from the group of eukaryotic hosts are particularly preferred in the context of this invention.

0133Bifunctional vectors which are able to replicate both in B. thuringiensis and / or B. cereus cells and in E. coli are very particularly preferred.

0134The present invention also includes the use of said bifunctional vectors for transforming B. thuringiensis and B. cereus.

0135'Shuttle' vectors are constructed with the aid of recombinant DNA technology, with plasmid and / or vector DNA homologous (B. thuringiensis, B. cereus) and heterologous origin being cut first with the aid of suitable restriction enzymes and then those DNA Fragments which contain the functions essential for replication in the respective desired host system are linked again in the presence of suitable enzymes.

0136The aforementioned heterologous host organisms can serve as a source for plasmid and / or vector DNA heterologous origin.

0137The different DNA fragments must be linked in such a way that the functions essential for replication in the different host systems are retained.

0138In addition, of course, plasmid and / or vector DNA of purely heterologous origin can also be used for the construction of 'shuttle' vectors, but at least one of the heterologous fusion partners must contain DNA segments which replicate in the homologous B. thuringiensis / B Enable .cereus host system.

0139As a source of plasmid and / or vector DNA of heterogeneous origin, which is nevertheless able to replicate in the B. thuringiensis / B. cereus host system, a few representatives from the group of gram-positive bacteria are selected here as examples the group consisting of the genera Staphylococcus such as Staphylococcus aureus, Streptococcus such as Streptococcus faecalis, Bacillus such as Bacillus megaterium or B. subtilis, Streptomyces such as Streptomyces spp. etc. In addition to the representatives from the group of gram-positive bacteria listed by way of example, there are a whole series of other organisms which can be used in the process according to the invention and which are known to the person skilled in the art.

0140Another object of the present invention thus relates to a method for producing bifunctional vectors which are suitable for the transformation of B. thuringiensis and / or B. cereus, which is characterized in that plasmid DNA is initially of homologous and heterologous origin<ul id="ul0009" list-style="none"><li>a) broken down into fragments with the aid of suitable restriction enzymes and</li><li>b) then those fragments which contain the functions which are essential for replication and selection in the respective desired host system are reconnected in the presence of suitable enzymes in such a way that the functions which are essential for replication and selection in the various host systems are maintained stay.</li></ul>

0141In this way, bifunctional plasmids are formed which, in addition to the functions necessary for replication in B. thuringiensis or B. cereus, contain further DNA sequences which ensure replication in at least one further heterologous host system.

0142In order to ensure fast and efficient selection of the bifunctional vectors both in homologous and in heterologous host system (s), it is advantageous to provide said vectors with specific selection markers which are present in B. thuringiensis and / or B. cereus as well as in the heterologous host system (s) are usable, ie enable quick and uncomplicated selection. Particularly preferred in the context of this invention is the use of DNA sequences coding for antibiotic resistance, in particular DNA sequences which code for resistance to antibiotics selected from the group consisting of kanamycin, tetracycline, chloramphenicol, erythromycin and others.

0143Also preferred are genes that encode enzymes with a chromogenic substrate, such as X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). The transformed colonies can then be detected very easily using a specific color reaction.

0144Other phenotypic marker genes are known to those skilled in the art and can also be used in the context of this invention.

0145Particularly preferred in the context of this invention is the construction of 'shuttle' vectors which, in addition to DNA sequences which permit replication in B. thuringiensis or B. cereus or in both host systems, also contain those DNA segments which are suitable for replication in further bacterial host systems, such as in B. subtilis, B. megaterium, Pseudomonas spp., E. coli etc. are necessary.

0146Also preferred are 'shuttle' vectors which replicate both in B. thuringiensis or B. cereus or in both, and also in eukaryotic host systems selected from the group consisting of yeast, animal and plant cells and others

0147The construction of 'shuttle' vectors is very particularly preferred which, in addition to DNA sequences which are necessary for the replication of said vectors in B. thuringiensis or B. cereus or in both systems, also contain such DNA sequences which have replication enable said 'shuttle' vectors in E. coli.

0148Examples of such starting plasmids for the construction of shuttle vectors for B. thuringiensisB. cereus / E. coll system, which should not be considered limiting in any way, are the B. cereus plasmid PBC16 and the plasmid pUC8 derived from the E. coli plasmid pBR322 (²⁸) Vieira J and Messing J, 1982).

0149Another object of the present invention relates to bifunctional ('shuttle') vectors which, in addition to the functions essential for replication and selection in homologous and heterologous host systems, also contain one or more genes in expressible form or other useful DNA sequences. This invention also includes methods for producing these vectors, which are characterized in that said genes or other useful DNA sequences are injected into these bifunctional vectors with the aid of suitable enzymes.

0150With the help of the 'shuttle' vectors according to the invention and the previously described transformation method, it is now possible for the first time, outside of B. thuringiensis cells, DNA sequences cloned in a foreign host system with high efficiency in B. thuringiensis and / or B. cereus Transform cells.

0151It is now possible for the first time to insert genes or other useful DNA sequences, in particular also those with a regulatory function, stably in B. thuringiensis or B. cereus cells and, if necessary, to express them there, thereby _B. thuringiensis or B. cereus cells with new and desirable properties emerge.

0152Suitable genes which can be used in the context of the present invention are both homologous and heterologous genes or DNA or synthetic genes or DNA as defined in the context of the present invention, and combinations of said DNAs.

0153The coding DNA sequence can be constructed exclusively from genomic, from cDNA or synthetic DNA. Another possibility is the construction of a hybrid DNA sequence consisting of both cDNA and genomic DNA and synthetic DNA or a combination of these DNAs.

0154In this case, the cDNA can come from the same gene as the genomic DNA, or both the cDNA and the genomic DNA can come from different genes. In any case, however, both the genomic DNA and / or the cDNA, each individually, can be produced from the same or from different genes.

0155If the DNA sequence contains portions of more than one gene, these genes can either belong to one and the same organism, several, organisms belonging to different strains, or varieties of the same species or different species of the same genus, or organisms which have more belong to a genus of the same or a different taxonomic unit.

0156In order to ensure the expression of said structural genes in the bacterial cell, the coding gene sequences must first be operably linked to expression sequences which are functional in B. thuringiensis and / or B. cereus cells.

0157The hybrid gene constructions in the context of the present invention thus contain, in addition to the structural gene (s), expression signals which include promoter and terminator sequences as well as further regulatory sequences of the 3 'and 5' untranslated regions.

0158In the context of this invention, particular preference is given to the natural expression signals from B. thuringiensis and / or B. cereus itself, and to mutants and variants thereof which are essentially homologous to the natural sequence. In the context of this invention, a DNA sequence of a second DNA sequence is essentially homologous if at least 70%, preferably at least 80%, but in particular at least 90% of the active sections of the DNA sequence are homologous. According to the present definition of the term "essentially homologous", two different nucleotides in a DNA sequence of a coding region are regarded as homologous if the exchange of one nucleotide for the other represents a silent mutation.

0159The use of sporulation-dependent promoters from B. thuringiensis, which ensure expression depending on the sporulation, is very particularly preferred.

0160Particularly preferred for the transformation of B. thuringiensis or B. cereus in the context of this invention is the use of DNA sequences which code for an δ-endotoxin.

0161The coding region of the chimeric gene according to the invention preferably contains a nucleotide sequence which encodes a polypeptide which occurs naturally in B. thuringiensis or a polypeptide which is essentially homologous to it, ie which at least essentially has the toxicity properties of a crystalline o-endotoxin protein of B. has thuringiensis. In the context of the present invention, a polypeptide by definition has essentially the toxicity properties of the crystalline B. enduringin protein of B. thuringiensis when it is insecticidal against a similar spectrum of insect larvae as the crystalline protein of a subspecies of B. thuringiensis. Some suitable subspecies are, for example, those selected from the group consisting of kurstaki, berliner, alesti, tolworthi, sotto, dendrolimus, tenebrionis and israelensis. The preferred subspecies for Lepidoptera larvae is kurstaki and especially kurstaki HD1.

0162The coding region can be a region that occurs naturally in B. thuringiensis. Alternatively, the coding region may also contain a sequence which differs from the sequence in B. thuringiensis, but which is equivalent to it due to the degeneracy of the genetic code. The coding region of the chimeric gene can also encode a polypeptide that differs from a naturally occurring crystalline o-endotoxin protein, but still has essentially the insect toxicity properties of the crystalline protein. Such a coding sequence will usually be a variant of a natural coding region. In the context of this invention, a “variant” of a natural DNA sequence is by definition to be understood as a modified form of a natural sequence which, however, still fulfills the same function. The variant can be a mutant or a synthetic DNA sequence and is essentially homologous to the corresponding natural sequence. In the context of this invention, a DNA sequence of a second DNA sequence is essentially homologous if at least 70%, preferably at least 80%, but in particular at least 90% of the active sections of the DNA sequence are homologous. According to the present definition of the term "essentially homologous", two different nucleotides in a DNA sequence of a coding region are regarded as homologous if the exchange of one nucleotide for the other represents a silent mutation.

0163Any chimeric gene encoding an amino acid sequence which has the insecticidal properties of a B. thuringiensis oil endotoxin and which fulfills the disclosed and claimed requirements can thus be used in the context of the present invention. It is particularly preferred to use a nucleotide sequence which is essentially homologous to at least the part or parts of the natural sequence which are responsible for the insecticidal activity and / or the host specificity of B. thuringiensis toxins is (are) responsible.

0164The polypeptide expressed by the chimeric gene generally also has at least some immunological properties in common with a natural crystalline protein because it has at least some of the same antigenic determinants.

0165Accordingly, the polypeptide encoded by said chimeric gene is preferably structurally related to the S-endotoxin of the crystalline protein produced by B. thuringiensis. B. thuringiensis produces a crystalline protein with a subunit that corresponds to a protoxin with a molecular weight (MW) of about 130,000 to 140,000. This subunit can be cleaved by proteases or by alkali into insecticidal fragments with a MW of 70,000 and possibly even less.

0166For the construction of chimeric genes, the coding section of which comprises such fragments of the protoxin or even smaller parts thereof, the fragmentation of the coding region can continue as long as the fragments or parts of these fragments still have the required insecticidal activity. The protoxin, insecticidal fragments of the protoxin and insecticidal parts of these fragments can be linked to other molecules such as polypeptides and proteins.

0167Coding regions suitable for use in the method of the invention can be obtained from genes from B. thuringiensis which encode the crystalline toxin gene (Whiteley et al, PCT application WO86 / 01536 and US Patents 4,448,885 and 4,467 036). A preferred nucleotide sequence encoding a crystalline protein is between nucleotides 156 and 3623 in formula or is a shorter sequence encoding an insecticidal fragment of such a crystalline protein (⁵⁾Geiser et al., 1986 and EP 238,441).<img file="EP0342633A2_D0001.tif" /><img file="EP0342633A2_D0002.tif" /><img file="EP0342633A2_D0003.tif" /><img file="EP0342633A2_D0004.tif" />

0168The coding region defined by nucleotides 156 to 3623 of formula I encodes a polypeptide of formula II.<img file="EP0342633A2_D0005.tif" /><img file="EP0342633A2_D0006.tif" /><img file="EP0342633A2_D0007.tif" /><img file="EP0342633A2_D0008.tif" />

0169In order to transform a chimeric gene into B. thuringiensis or B. cereus cells using the method according to the invention, the gene is preferably first inserted into a vector. Installation in the bifunctional vectors according to the invention is particularly preferred.

0170If the corresponding gene is not available in an amount which is sufficient for the introduction into the Bacillus cells, the vector can first be amplified by replication in a heterologous host cell. Bacterial or yeast cells are most suitable for the amplification of genes. If a sufficient amount of the gene is available, it will be introduced into the Bacillus cells. The introduction of the gene in B. thuringiensis or B. cereus cells can be made with the same vector that was used for replication or with a different vector. The bifunctional vectors according to the invention are particularly suitable.

0171Some examples of bacterial host cells which are suitable for replication of the chimeric gene include bacteria selected from the genera Escherichia such as E. coli, Agrobacterium such as A. tumefaciens or A. rhizogenes, Pseudomonas such as Pseudomonas spp., Bacillus, such as B. megaterium or B. subtilis, etc. The transformation method according to the invention now makes it possible for the first time in the context of this invention, also B. thuringiensis or B. use cereus itself as host cells. Methods of cloning heterologous genes in bacteria are described in US Patents 4,237,224 and 4,468,464.

0172The replication of genes in E. coli encoding the crystalline protein of B. thuringiensis is described by ²⁹⁾Wong et al. (1983).

0173Some examples of yeast host cells which are suitable for replication of the genes according to the invention include those selected from the genus Saccharomyces (European patent application EP 0 238441).

0174Any vector into which the chimeric gene can be incorporated and which replicates in a suitable host cell, such as in bacteria or yeast, can be used for the amplification of the genes according to the invention. The vector can be derived, for example, from a phage or a plasmid. Examples of vectors that can be derived from phages and can be used in the context of this invention are vectors that are derived from M13 and from λ phages. Some suitable vectors derived from M13 phages include M13mp18 and M13mp19. Some suitable vectors derived from x-phages include \ gt11, xgt7 and xCharon4.

0175Of the vectors that are derived from plasmids and are particularly suitable for replication in bacteria, pBR322 (³⁰⁾Bolivar et ai., 1977), pUC18 and pUC19 (³¹⁾Norrander et al., 1983) and Ti plasmids (³²) Bevan et al., 1983) without, however, limiting the subject matter of the invention in any way. The preferred vectors for amplifying genes in bacteria are pBR322, pUC18 and pUC19.

0176For cloning directly in B. thuringiensis and / or B. cereus, direct cloning vectors are primarily to be mentioned, such as pBD347, pBD348, pBD64 and pUB1664, and in particular 'shuttle' vectors, which have already been described in detail before, but without to be limited to that.

0177The bifunctional (shuttle) vectors pX161 (= p_K61) and pX193 (= p_K93), which, transformed into B. thuringiensis var. kurstaki HD1 cryB or B. cereus 569 K, at the 'German Collection of Microorganisms' (Braunschweig, FRG) recognized as an international depositary in accordance with the provisions of the Budapest Treaty under number DSM 4573 (pX161, transformed in B. thuringiensis var. kurstaki HD1 cryB) or DSM 4571 (pX193, transformed in B. thuringiensis var. kurstaki HD1 cryB) and DSM 4573 (pX193, transformed in B. cereus 569 K).

0178In order to construct a chimeric gene suitable for replication in bacteria, a promoter sequence, a 5'-untranslated sequence, a coding sequence and a 3'-untranslated sequence are inserted into a vector or assembled in the correct order in one of the vectors described above . According to the invention, suitable vectors are those which are able to replicate in the host cell.

0179The promoter, the 5'-untranslated region, the coding region and the 3'-untranslated region can, if appropriate, first be combined in one unit outside the vector and then inserted into the vector. Alternatively, parts of the chimeric gene can also be added individually be inserted into the vector.

0180In the case of B. thuringiensis or B. cereus cloning vectors, this process step can be omitted since the entire unit isolated from B. thuringiensis, consisting of a 5'-untranslated region, the coding region and a 3-untranslated region, can be spliced ​​into the vector.

0181In addition, the vector preferably also contains a marker gene which gives the host cell a property by which the cells transformed with the vector can be recognized. Marker genes which code for antibiotic resistance are preferred. Some examples of suitable antibiotics are ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G418 and kanamycin.

0182Also preferred are marker genes that encode enzymes with a chromogenic substrate, such as X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). The transformed colonies can then be detected very easily using a specific color reaction.

0183The insertion or assembly of the gene in the vector is carried out using standard methods, for example the use of recombinant DNA (³³⁾Maniatis et al., 1982) and the application of homologous recombination (³⁴⁾Hinnen et al., 1978).

0184The methods of recombinant DNA technology are based on first cutting the vector and inserting the desired DNA sequence between the cut pieces of the vector; the ends of the desired DNA sequence are then linked to the corresponding ends of the vector.

0185The vector is preferably cut with suitable restriction endonucleases. Suitable restriction endonucleases are, for example, those which form blunt ends, such as Smal, Hpal and EcoRV, and those which form cohesive ends, such as EcoRl, Sacl and BamHl.

0186. The desired DNA sequence normally exists as part of a larger DNA molecule, such as a chromosome, a plasmid, a transposon or a phage. In these cases, the desired DNA sequence is cut out of its original source and modified if necessary so that its ends can be connected to those of the cut vector. For example, when the ends of the desired DNA sequence and cut vector are blunt ends, they can be joined together with blunt end specific ligases such as the T4 DNA ligase.

0187The ends of the desired DNA sequence can also be joined in the form of cohesive ends to the ends of the cut vector, in which case a ligase specific for cohesive ends, which can also be T4 DNA ligase, is used. Another suitable ligase specific for cohesive ends is, for example, the E. coli DNA ligase.

0188Cohesive ends are conveniently formed by cutting the desired DNA sequence and vector with the same restriction endonuclease. In this case, the desired DNA sequence and cut vector have cohesive ends that are complementary to each other.

0189The cohesive ends can also be constructed by attaching complementary homopolymeric tails to the ends of the desired DNA sequence and the cut vector using the terminal deoxynucleotidyl transferase. Alternatively, cohesive ends can also be produced by appending a synthetic oligonucleotide sequence which is recognized by a specific restriction endonuclease and which is known under the name linker and cleaving the sequence with the endonuclease (see for example ³³⁾Maniatis et al., 1982).

0190It is now possible for the first time in the context of this invention to genetically modify, clone and then clone B. thuringiensis genes, but especially δ-endotoxin-coding DNA sequences outside of B. thuringiensis, and then clone them in B. thuringiensis and / or B. attributed to cereus cells, where said S-end toxin genes (in a homologous bacterial host system) can be expressed.

0191This means that the genome of B. thuringiensis can now also be genetically manipulated by firstly obtaining large amounts of plasmid material in a foreign cloning system and then transforming it into B. thuringiensis.

0192Of particular interest is the possibility of modifying the S-endotoxin genes and the control sequences regulating the expression of these genes.

0193In addition to chimeric genes, any other chimeric genetic construction can of course also be introduced into Bacillus thuringiensis and / or Bacillus cereus cells using the method according to the invention.

0194For example, using the method according to the invention, it is conceivable to inject non-coding, 'antisense' DNA into the genome of a Bacillus thuringiensis and / or Bacillus cereus cell, so that in the course of the expression of said 'antisense' DNA an mRNA is transcribed which transcribes the Expression of the corresponding 'sense' DNA inhibits. In this way it is possible to specifically suppress the expression of certain undesired genes in Bacillus thuringiensis and / or Bacillus cereus.

0195In addition to providing improved, well-defined B. thuringiensis strains for the production of improved bioinsecticides, B. thuringiensis as a general host for the cloning and optionally expression of heterologous and / or homologous genes is now also available.

0196In a specific and preferred embodiment of the method according to the invention, it is now possible for the first time to clone new genes, but especially new protoxin genes, directly in the natural host, ie in B. thuringiensis or B. cereus.

0197When searching for new protoxin genes, a B. thuringiensis gene library is first created.

0198In a first process step, the total DNA of a protoxin-producing B. thuringiensis strain is isolated using known process measures and then broken down into individual fragments. The B. thuringiensis DNA can be fragmented either mechanically, for example under the influence of shear forces, or preferably by digestion with suitable restriction enzymes. Depending on the choice of the enzymes, a partial or complete digestion of the DNA sample is obtained. In the context of this invention, particular preference is given to the use of restriction enzymes which contain quaternary recognition sites and / or lead to partial digestion of the B. thuringiensis DNA, such as, for example, the restriction enzyme SaullIA, but without being restricted thereto. Of course, all other suitable restriction enzymes can also be used in the process according to the invention.

0199The restriction fragments obtained in the manner described above are then separated according to their size using methods known per se. Centrifugation methods such as sucrose gradient centrifugation or electrophoretic methods such as agarose gel electrophoresis or a combination of these methods are generally used for the size-dependent separation of DNA fragments.

0200Those fractions which contain fragments of the correct size, ie fragments which, because of their size, are able to encode a protoxin, are pooled and used for the further process steps.

0201First, the fragments previously isolated are spliced ​​into suitable cloning vectors using standard methods and then introduced directly into Bacillus thuringiensis or B. cereus, but preferably into protoxin-free strains of Bacillus thuringiensis, using the transformation method according to the invention.

0202Both gram-positive plasmids, such as, for example, pBC16, pUB110, pC194, and the 'shuttle' vectors described in detail above can be used as vectors. The shuttle vector pX1200, which is described in detail below (see example 9.1.), Is particularly preferred in the context of this invention. Suitable vectors preferably contain DNA sequences which ensure easy identification of the transformed, vector-containing clones from the myriad of untransformed clones. DNA sequences are particularly preferred which encode a specific marker which, when expressed, leads to an easily selectable characteristic, such as, for example, antibiotic resistance. Resistance to ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G418 or kanamycin may be mentioned here by way of example.

0203Also preferred are marker genes, the enzymes with a chromogenic substrate, such as X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). encode. The transformed colonies can then be detected very easily using a specific color reaction.

0204After the electroporation, the treated Bacillus thuringiensis or B. cereus cells are transferred to a selective sporulation medium and there until complete sporulation at a temperature of 10 ° C. to 40 ° C., but preferably at a temperature of 20 ° C. to 35 ° C. and very particularly preferred incubated at a temperature of 29 C to 31 ° C. As a selective substance, the sporulation medium preferably contains one of the above-mentioned antibiotics, depending on the vector used, and a suitable strengthening agent, such as agar, agarose, gelatin, etc.

0205In the course of the sporulation, the sporulating cells are autolysed, which is of great procedural advantage for the subsequent screening, since there is no need for the cells to be broken open artificially. In the case of clones which contain the desired protoxin gene and express it under the control of their natural promoter, the crystal proteins formed are freely accessible in the medium. These church imports that are freely available in the medium can then, for example be fixed with the help of membrane filters or by other suitable measures. Suitable membrane filters are, for example, nylon or nitrocellulose membranes. Membranes of this type are freely available.

0206The crystal proteins fixed in this way can then be detected and identified very easily by means of a suitable screening.

0207In the context of this invention, preference is given to immunological screening using protoxin-specific antibodies. The methods of immune screening are known and, for example, in³⁵⁾Young et al, 1983 described in detail. In the context of the method according to the invention, particular preference is given to the use of monoclonal antibodies which recognize a specific part of the protein molecule very specifically. These antibodies can be used either individually or in the form of a mixture. In addition, of course, polyclonal antisera can also be used for immune screening. Mixtures based on monoclonal and polyclonal antibodies are also conceivable.

0208Methods for the production of monoclonal antibodies against Bacillus thuringiensis protoxin proteins are known and, for example, in ³⁶⁾Huber-Lukac, (1984) and at ³⁷⁾Huber-Lukac et al, (1986). These methods can also be used in the present case.

0209The immunological screening method based on antibodies is part of the present invention.

0210In addition, other suitable screening methods for detecting new DNA sequences in B. thuringiensis and / or B. cereus can of course also be used within the scope of this invention.

0211Bacillus thuringiensis and B. cereus cells, which have been transformed with the aid of the method described above, and the toxins produced by these transformed Bacillus cells are outstandingly suitable for combating insects, but in particular for combating insects from the regulations Lepidoptera, Diptera and Coleoptera.

0212Another object of the present invention thus relates to a method for controlling insects, which is characterized in that insects or their habitat<ul id="ul0010" list-style="none"><li>a) B. thuringiensis or B. cereus cells or treated with a mixture of both, which are transformed with a recombinant DNA molecule which contains a structural gene which codes for an α-endotoxin polypeptide which is naturally present in B. thuringiensis occurs or a polypeptide that is essentially homologous to it; or but</li><li>b) with cell-free crystal body preparations which contain a protoxin which is produced by said transformed Bacillus cells.</li></ul>

0213Also included in the present invention are insecticidal agents which, in addition to the commonly used carriers, distributors or carriers and distributors<ul id="ul0011" list-style="none"><li>a) B. thuringiensis or B. cereus cells or a mixture of said Bacillus cells which are transformed with a recombinant DNA molecule which contains a structural gene which codes for an α-endotoxin polypeptide which is naturally present in B. thuringiensis occurs or a polypeptide that is essentially homologous to them; or but</li><li>b) cell-free crystal body preparations which contain a protoxin which is produced by said transformed Bacillus cells.</li></ul>

0214For use as insecticides, the transformed microorganisms which contain the recombinant B. thuringiensis toxin gene are preferably transformed live or dead B. thuringiensis or B. cereus cells, including mixtures of live and dead B. thuringiensis and B. cereus cells, and the toxin proteins produced by said transformed cells in unchanged form or preferably together with the auxiliaries customary in formulation technology, and formulated in a manner known per se, for example to suspension concentrates, spreadable pastes, directly sprayable or dilutable solutions, wettable powders, soluble powders, dusts, granules, and also encapsulations in, for example, polymeric substances.

0215The methods of application such as spraying, atomizing, dusting, scattering, brushing or pouring are selected in the same way as the type of agent, in accordance with the intended objectives and the prevailing conditions.

0216In addition, it is of course also possible to use insecticidal mixtures consisting of transformed, living or dead B. thuringiensis and / or B. cereus cells and of cell-free crystal body preparations which contain a protoxin which is produced by said transformed Bacillus cells.

0217The formulations, ie the transformed live or dead Bacillus cells or mixtures thereof, as well as the toxin proteins produced by said transformed Bacillus cells and optionally agents or preparations containing solid or liquid auxiliaries are prepared in a known manner, for example by intimately mixing the transformed Cells and / or toxin proteins with solid carriers and optionally surface-active compounds (surfactants).

0218Natural rock flours, such as calcite, talc, kaolin, montmorillonite or attapulgite, are generally used as solid carriers, for example for dusts and dispersible powders. To improve the physical properties, highly disperse silica or highly disperse absorbent polymers can also be added. Porous types such as pumice, broken brick, sepiolite or bentonite come as granular, adsorptive granule carriers, and non-sorptive carrier materials, for example Calcite or sand in question. In addition, a large number of pregranulated materials of an inorganic or organic nature, such as, in particular, dolomite or comminuted plant residues can be used.

0219Nonionic, cationic and / or anionic surfactants with good dispersing and wetting properties are suitable as surface-active compounds. Surfactants are also to be understood as mixtures of surfactants.

0220Suitable anionic surfactants can be both so-called water-soluble soaps and water-soluble synthetic surface-active compounds.

0221The soaps are the alkali, alkaline earth or unsubstituted or substituted ammonium salts of higher fatty acids (C₁₀-C₂₂), such as the Na or K salts of oleic or stearic acid, or of natural fatty acid mixtures which can be obtained, for example, from coconut or tallow oil. Also to be mentioned are the fatty acid methyl taurine salts, such as the sodium salt of cis-2- (methyl-9-octadecenylamino) ethanesulfonic acid (content in formulations preferably about 3%).

0222However, so-called synthetic surfactants are used more frequently, in particular fatty sulfonates, fatty sulfates, sulfonated benzimidazole derivatives or alkylarylsulfonates or fatty alcohols, such as, for example, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (content in formulations preferably about 2%).

0223The fatty sulfonates or sulfates are usually present as alkali, alkaline earth or optionally unsubstituted or substituted ammonium salts and have an alkyl radical with 8 to 22 carbon atoms, alkyl also including the alkyl part of acyl radicals, for example the Na or Ca Salt of lignin sulfonic acid, dodecyl sulfate or a fatty alcohol sulfate mixture made from natural fatty acids. This subheading also includes the salts of sulfuric acid esters and sulphonic acids from fatty alcohol-ethylene oxide adducts. The sulfonated benzimidazole derivatives preferably contain 2 sulfonic acid groups and a fatty acid residue with 8-22 carbon atoms. Alkylarylsulfonates are, for example, the sodium, calcium or triethanolamine salts of dodecylbenzenesulfonic acid, dibutylnaphthalenesulfonic acid or a naphthalenesulfonic acid / formaldehyde condensation product.

0224Corresponding phosphates, such as, for example, salts of the phosphoric acid ester of a p-nonylphenol- (4 to 14) -ethylene oxide adduct, are also suitable.

0225Suitable nonionic surfactants are primarily polyglycol ether derivatives of aliphatic or cycloaliphatic alcohols, saturated or unsaturated fatty acids and alkylphenols, which contain 3 to 30 glycol ether groups and 8 to 20 carbon atoms in the (aliphatic) hydrocarbon radical and 6 to 18 carbon atoms in the alkyl radical of the alkylphenols can.

0226Other suitable non-ionic surfactants are the water-soluble polyethylene oxide adducts containing 20 to 250 ethylene glycol ether groups and 10 to 100 propylene glycol ether groups with polypropylene glycol, ethylene diaminopolypropylene glycol and alkylpolypropylene glycol with 1 to 10 carbon atoms in the alkyl chain. The compounds mentioned usually contain 1 to 5 ethylene glycol units per propylene glycol unit.

0227Examples of nonionic surfactants are nonylphenol polyethoxyethanols, castor oil polyglycol ethers, polypropylene / polyethylene oxide adducts, tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxypolyethoxyethanol. Fatty acid esters of polyoxyethylene sorbitan such as polyoxyethylene sorbitan trioleate are also suitable.

0228The cationic surfactants are primarily quaternary ammonium salts which contain at least one alkyl radical having 8 to 22 carbon atoms as N substituents and have unsubstituted or halogenated lower alkyl, benzyl or lower hydroxyalkyl radicals as further substituents. The salts are preferably in the form of halides, methyl sulfates or ethyl sulfates, for example stearyltrimethylammonium chloride or benzyldi (2-chloroethyl) ethylammonium bromide.

0229The surfactants commonly used in formulation technology are described in the following publications:<ul id="ul0012" list-style="none"><li>³⁸) 1986 International McCutcheon's Emulsifiers &amp; Detergents, The Manufacturing Confectioner</li><li>Publishing Co., Glen Rock, NJ, USA; Helmut Stache "Tensid-Taschenbuch" Carl Hanser-Verlag Munich / Vienna 1981.</li></ul>

0230The agrochemicals generally contain 0.1 to 99%, in particular 0.1 to 95%, of the transformed, living or dead Bacillus cells or mixtures thereof or the toxin proteins produced by said transformed Bacillus cells, 99.9 to 1%, in particular 99.8 to 5%, of a solid or liquid additive and 0 to 25%, in particular 0.1 to 25%, of a surfactant.

0231While concentrated agents are preferred as a commercial product, the end user usually uses diluted formulations.

0232Such agents can also contain other additives such as stabilizers, defoamers, viscosity regulators, binders, adhesives and fertilizers or other active ingredients to achieve special effects.

0233The transformed live or dead Bacillus cells or mixtures thereof, which contain the recombinant B. thuringiensis toxin genes, as well as the toxin proteins themselves produced by said transformed Bacillus cells, are outstandingly suitable for controlling insect pests. Plant-destroying insects of the order Lepidoptera should preferably be mentioned, in particular those of the genera Pieris, Heliothis, Spodoptera and Plutella, such as Pieris brassicae, Heliothis virescens, Heliothis zea, Spodoptera littoralis and Plutella xylostella. Further insect pests which can be controlled with the aid of the insecticidal preparations described above are, for example, beetles of the order Coleoptera, in particular those of the family Chrysomelidae, such as, for example, Diabrotica undecimpunctata, D. longicornis, D. virgitera, D. undecimpunctata howardi, Agelastica alni, Leptinotarsa decemlineata etc. as well as insects of the order Diptera, such as, for example, Anopheles sergentii, Uranatenia unguiculata, Culex univittatus, Aedes aegypti, Culex pipiens, etc.

0234The application rates in which the Bacillus cells or the toxin proteins produced by them are used depend on the respective conditions, such as, for example, the weather conditions, the soil conditions, the plant growth and the time of application.

Formulation examples for material containing B. thuringiensis toxin

0235In the following formulation examples, the term "Bacillus cells" means those B. thuringiensis and / or B. cereus cells which contain a recombinant B. thuringiensis gene according to the invention. (All information is percentages by weight.)

F1. Granules

0236<tables id="tabl0001" num="0001"><img file="EP0342633A2_D0009.tif" /></tables>

0237The Bacillus cells and / or toxin protein produced by them are first suspended in methylene chloride, then the suspension is sprayed onto the support material and the suspension agent is then evaporated in vacuo.

F2. Dusts

0238<tables id="tabl0002" num="0002"><img file="EP0342633A2_D0010.tif" /></tables>

0239Ready-to-use dusts are obtained by intimately mixing the carrier substances with the Bacillus cells and / or the toxin protein produced by them.

F3. Wettable powder

0240<tables id="tabl0003" num="0003"><img file="EP0342633A2_D0011.tif" /></tables>

0241The Bacillus cells and / or the toxin protein produced by them are carefully mixed with the additives and the mixture obtained is then ground well in a suitable mill. Spray powders are obtained which dilute with water to form suspensions of any desired concentration.

F4. Extruder granules

0242<tables id="tabl0004" num="0004"><img file="EP0342633A2_D0012.tif" /></tables>

0243The Bacillus cells and / or toxin protein produced by them are mixed with the excipients, carefully ground and moistened with water. This mixture is extruded and then dried in an air stream.

F5. Coating granules

0244<tables id="tabl0005" num="0005"><img file="EP0342633A2_D0013.tif" /></tables>The homogeneously mixed Bacillus cells and / or toxin protein produced by them are evenly applied in a mixer to the kaolin moistened with polyethylene glycol. In this way, dust-free coating granules are obtained.

0245F6. Suspension concentrate<tables id="tabl0006" num="0006"><img file="EP0342633A2_D0014.tif" /></tables>

0246The homogeneously mixed Bacillus cells and / or toxin protein produced by them are intimately mixed with the additives. This gives a suspension concentrate from which suspensions of any desired concentration can be prepared by dilution with water.

Examples

General recombinant DNA techniques

0247Since many of the recombinant DNA techniques used in this invention are routine for the person skilled in the art, a brief description of the commonly used techniques is given below, so that this general information can be dispensed with in the specific exemplary embodiment. Unless explicitly stated otherwise, all of these methods are in the reference of³³⁾Maniatis et al, 1982.

A. Cutting with restriction endonucleases

0248Typically, about 50 µg / ml to 500 µg / ml DNA is included in the reaction mixture in the buffer solution recommended by the manufacturer, New England Biolabs, Beverly, MA. For each gg DNA, 2 to 5 units of restriction endonucleases are added and the reaction mixture is incubated at the temperature recommended by the manufacturer for one to three hours. The reaction is terminated by heating to 65 C for 10 minutes or by extraction with phenol, followed by precipitation of the DNA with ethanol. This technique is also featured on pages 104-106 of the³³⁾Manlatis et al reference.

B. Treatment of DNA with polymerase to create blunt ends

024950 µg / ml to 500 µg / ml DNA fragments are added to a reaction mixture in the buffer recommended by the manufacturer, New England Biolabs. The reaction mixture contains all four deoxynucleotide triphosphates in concentrations of 0.2 mM. After adding a suitable DNA polymerase, the reaction takes place at 15 ° C. for 30 minutes and is then ended by heating at 65 ° C. for 10 minutes. For fragments made by

0250Cutting with restriction endonucleases that produce 5 'protruding ends, such as EcoRI and BamHl, the large fragment, or Klenow fragment, of the DNA polymerase is used. T4 DNA polymerase is used for fragments obtained from endonucleases that produce 3 'protruding ends, such as Pstl and Sacl. The use of these two enzymes is on pages 113 to 121 of the³³⁾Maniatis et al reference.

C. Agarose gel electrophoresis and purification of the DNA fragments from gel contaminants.

0251Agarose gel electrophoresis is carried out in a horizontal apparatus, as described on pages 150 to 163 of the ³³⁾Maniatis et al reference is described. The buffer used corresponds to the Tris borate or Tris acetate buffer described there. The DNA fragments are stained with 0.5 µg / ml ethidium bromide, which is either present in the gel or in the tank buffer during the electrophoresis or, alternatively, is only added after the electrophoresis. The DNA is made visible by illumination with long-wave ultraviolet light. If the fragments are to be separated from the gel, agarose is used which can be gelled at low temperature and obtained from Sigma Chemical, St. Louis, Missouri. After electrophoresis, the desired fragment is cut out, placed in a plastic tube, heated to 65 ° C. for about 15 minutes, extracted three times with phenol and precipitated twice with ethanol. This procedure is different from that of³³⁾Maniatis et al on page 170 changed slightly.

0252As an alternative, the DNA can also be isolated from the agarose gel using the 'Geneclean Kit' (Bio 101 Inc., La Jolla, CA, US).

D. Removal of 5'-terminal phosphates from DNA fragments

0253During the plasmid cloning steps, treatment of the vector plasmid with phosphatase reduces the recircularization of the vector (discussed on page 13 of ³³⁾Maniatis et al reference). After cutting the DNA with the correct restriction endonuclease, a unit of alkaline phosphatase from the intestine of calves is added, which can be purchased from Boehringer-Mannheim, Mannheim. The DNA is incubated at 37 ° C for one hour and then extracted twice with phenol and precipitated with ethanol.

E. Linking the DNA fragments

0254If fragments with complementary cohesive ends are to be linked to one another, approximately 100 ng of each fragment are incubated in a reaction mixture of 20 μl to 40 μl with approximately 0.2 units of T4 DNA ligase from New England Biolabs in the buffer recommended by the manufacturer. The incubation will₁ performed at 15 ° C for up to 20 hours. If blunt-ended DNA fragments are to be linked, they are incubated as described above, but in this case the amount of T4 DNA ligase is increased to 2 to 4 units.

F. The transformation of DNA into E. coli

0255E. coli strain HB101 is used for most experiments. DNA is made using the calcium chloride method as described by³³⁾Maniatis et al., Pages 250 to 251, was introduced in E. coli.

G. Screening E. coli for plasmids

0256After transformation, the resulting colonies of E. coli are checked for the presence of the desired plasmid by a rapid plasmid isolation procedure. Two common methods are described on pages 366 to 369 of the³³⁾Maniatis et al reference.

H. Large scale isolation of plasmid DNA

0257Methods for isolating plasmids from E. coli on a large scale are described on pages 88 to 94 of the ³³⁾Maniatis et al reference.

0258Media and buffer solutions<tables id="tabl0007" num="0007"><img file="EP0342633A2_D0015.tif" /></tables><tables id="tabl0008" num="0008"><img file="EP0342633A2_D0016.tif" /></tables><tables id="tabl0009" num="0009"><img file="EP0342633A2_D0017.tif" /></tables><tables id="tabl0010" num="0010"><img file="EP0342633A2_D0018.tif" /></tables><tables id="tabl0011" num="0011"><img file="EP0342633A2_D0019.tif" /></tables><tables id="tabl0012" num="0012"><img file="EP0342633A2_D0020.tif" /></tables>

0259The internal designation pK selected in the priority document for the naming of the plasmids has been replaced by the officially recognized designation pXl for the international version.

0260The name for the asporogenic B. thuringiensis HD1 mutant used in the exemplary embodiments was also changed from cryß to cryB.

Example 1: Transformation of B: thuringiensis using electroporation

example 1

.

1:

026110th ml of an LB medium (trypton 10 g / I, yeast extract 5 g / I, NaCl 5 g / I) are mixed with spores from B. thuringiensis var. kurstaki HD1 cryB (³⁹⁾Stahly DP et al, 1978) of a plasmid-free variant of B. thuringiensis var. Kurstaki HD1.

0262This approach is incubated overnight at a temperature of 27 ° C on a rotary shaker at 50 rpm. The B. thuringiensis culture is then diluted 100-fold in 100 ml to 400 ml LB medium and further cultivated at a temperature of 30 C on a rotary shaker at 250 rpm until an optical density (ODsso) of 0.2 is reached.

0263The cells are harvested by centrifugation and placed in 1/40 volume of an ice-cooled PBS buffer (400 mM sucrose, 1 mM MgCl₂, 7 mM phosphate buffer pH 6.0) suspended. The centrifugation and subsequent suspension of the harvested B. thuringiensis cells in PBS buffer is repeated once.

0264The cells pretreated in this way can then either be electroporated directly or, after adding glycerol to the buffer solution [20% (w / v)], stored at -20 ° C. to -70 ° C. and used at a later time.

0265800 µl aliquots of the ice-cooled cells are then transferred to pre-cooled cuvettes, then 0.2 µg pBC16 plasmid DNA (⁴⁰⁾Bernhard K. et al, 1978) (20 µg / ml) was added and the entire batch was incubated at 4 ° C. for 10 minutes.

0266When using frozen cell material, a suitable aliquot of frozen cells is first thawed in ice or at room temperature. The further treatment is carried out analogously to the procedure when using fresh cell material.

0267The cuvette is then placed in an electroporation apparatus and the B. thuringiensis cells present in the suspension are subjected to electroporation by applying voltages between 0.1 kV and 2.5 kV to them by discharging a capacitor once.

0268The capacitor used here has a capacitance of 25 uF, the cuvettes have an electrode spacing of 0.4 cm, which, depending on the setting, leads to an exponentially decreasing field strength with initial peak values ​​of 0.25 kV / cm to 6.25 kV / cm depending on the setting. The exponential decay time is in a range between 10 ms and 12 ms.

0269For example, an electroporation device from Bio Rad can be used for the electroporation experiments described ('Gene Pulser Apparatus', # 165-2075, Bio Rad, 1414 Harbor Way South, Richmond, CA 94804, USA).

0270Of course, any other suitable device can also be used in the method according to the invention.

0271After a further 10 minutes incubation at 4 ° C, the cell suspension is diluted with 1.2 ml LB medium and incubated for 2 hours at a temperature of 30 C on a rotary shaker at 250 rpm.

0272Then suitable dilutions are plated on LB agar (LB medium solidified with agar, 15 g / l), which contains an antibiotic suitable for the selection of the newly obtained plasmid as an additive. In the case of pBC16, this is tetracycline, which is added to the medium in a concentration of 20 mg / l.

0273The transformation frequencies achieved for B. thuringiensis HD1cryB and pBC16 as a function of the applied output voltage for a given plate spacing are shown in Figure 1.

0274The expression of the introduced DNA can be demonstrated on the basis of the tetracycline resistance that occurs. A complete phenotypic expression of the newly introduced tetracycline resistance takes place just 2 hours after the transformation of pBC16 in B. thuringiensis (see Table 2).

Example 1.2:

0275The transformation of B. thuringiensis cells is carried out in an exactly analogous manner to Example 1.1. with the exception that the volume of the cell suspension intended for electroporation in this case is 400 µl.

0276With this method measure, the transformation frequency can be increased by a factor of 10.

Example 2: Transformation of B. thuringiensis HD1cryB with a number of different plasmids

0277Most experiments are carried out with the plasmid pBC16, a naturally occurring plasmid from B. cereus. In addition, other naturally occurring plasmids can also be successfully introduced into B. thuringiensis cells, such as pUB110 (²⁵⁾Polack J. and Novik RP, 1982), pC194 (²⁴⁾Horinouchi S and Weisblum B, 1982) and pIM13 (²⁶⁾Mahler I and Halvorson HO, 1980) (see Table 3).

0278Variants of these plasmids which are more suitable for working with recombinant DNA than the natural isolates can also be transformed into the B. thuringiensis strain HD1cryβ using the method according to the invention, such as, for example, the B. subtilis cloning vector pBD64 (²⁷⁾Gryczan- T et al, 1980) and the plasmids pBD347, pBD348 and pUB1664 (see Table 3; the plasmids pBD347, pBD348 and pUB1164 can be obtained from Dr. W. Schurter, CIBA-GEIGY AG, Basel).

0279The transformation results in Table 3 make it clear that regardless of the plasmid DNA used, when using the transformation method according to the invention, transformation frequencies are achieved which - with one exception - are all in the range between 10⁵ until 10⁷ lie.

Example 3: Construction of a 'shuttle' vector for Bacillus thuringiensis

0280Existing bifunctional vectors for E. coli and B. subtilis such as pHV 33 (⁴¹⁾Primrose SB and Ehrlich SD, Plasmid, 6: 193-201, 1981) are not suitable for B. thuringiensis HD1cryB (see Table 3).

0281For the construction of a potent bifunctional vector, the large EcoRI fragment of pBC16 is first inserted into the EcoRI site of the plasmid pUC8 (using T4DNA ligase (²⁸⁾Vieira J and Messing J, 1982) a spliced ​​one. E. coli cells are then transformed with this construct. A construction identified as correct by means of a restriction analysis is called pXl 62.

0282The EcoRI interface distal to the pUC8 polylinker region is then removed. Partial EcoRI digestion linearizes pXl 62. The cohesive EcoRI ends are filled in with Klenow polymerase and reassembled with T4 DNA ligase. After transformation into E. coli, a construction which is recognized as correct using a restriction analysis is selected and named pXl 61. A map of pXl 61 with the interfaces of restriction enzymes that cut pXl 61 only once is shown in Figure 6.

0283This construction can be transformed directly into B. thuringiensis HD1cryB using the transformation method described in Example 1.

0284Due to strong restriction barriers in B. thuringiensis strains, the transformation rates in this case are lower when using pX161 DNA derived from E. coli than when using plasmid DNA derived from B. thuringiensis HD1cryB (see Table 3). Nevertheless, pX161 proves to be very suitable for carrying out cloning experiments in B. thuringiensis.

Example 4: Introduction of the Kurhdl delta endotoxin gene into strains of B. thuringiensis and B. cereus

0285The DNA sequence used for the introduction and expression in B. thuringiensis or B. cereus in the context of this invention, which codes for a kurhdl delta-endotoxin protein, comes from the plasmid pK36, dated 4. March 1986 was deposited with the German Collection of Microorganisms, FRG, recognized as an international depository, in accordance with the requirements of the Budapest Treaty for the international recognition of the deposit of microorganisms for the purpose of patenting under the deposit number DSM 3668.

0286A detailed description of the methods for identifying and isolating the δ-endotoxin genes and the construction of the plasmid pK36 is contained in the European patent application EP 0238 441 and is part of the present invention in the form of a reference.

0287pK36 plasmid DNA is completely digested with the restriction enzymes Pst1 and BamH1 and the 4.3 Kb fragment, which contains the Kurhd1 delta endotoxin gene (see formula I), is isolated from an agarose gel. This fragment is then spliced ​​into pX161, which was previously digested with Pst1 and BamH1 and treated with alkaline phosphatase from the calf intestine. After the transformation of E. coli HB 101 is isolated using a restriction analysis as a correctly recognized construction, which is given the designation pX193. A restriction map of pX193 is shown in Figure 7. pX193 can be introduced into B. thuringiensis HD1cryB in two different ways.<ul id="ul0013" list-style="none"><li>a) B. thuringiensis cells are transformed directly with a pX193 isolate from E. coli using the transformation method according to the invention described in Example 1.</li><li>b) pX193 is first transformed into B. subtilis cells, as described by Chang and Cohen, 1979. This is isolated from a transformant which contains the complete and intact pXI93 plasmid DNA and then transformed into B. thuringiensis HD1cryB using the electroporation method described in Example 1.</li></ul>

0288The use of both methods leads to transformants which contain the intact pX193 plasmid, which can be shown by means of a restriction analysis.

Example 5: Detection of the expression of the delta endotoxin gene in B. thuringiensis

0289Sporulating cultures of B. thuringiensis HD1 cryB, HD1cryB (pX161) and HD1cryB (pXI93) and HD1 are compared in a phase contrast microscope at 400x magnification. The typical bipyramidal protein crystals can only be detected in the strain containing pX193 and HD1. Extracts from the same cultures are separated electrophoretically on an SDS polyacrylamide gel. Only for the strain containing plasmid pX193 and HD1 could a protein band of 130,000 daltons be detected on the gel, which corresponds to the Kurhdl gene product (Figure 8a).

0290In the 'Western blot' analysis (Figure 8b), this 130,000 dalton protein and its breakdown products react specifically with polyclonal antibodies that previously against crystal protein from B. thuringiensis var. Kurstaki HD1 according to the ⁴²⁾Huber-Lukac H, 1982 described methods are produced. A detailed description of this method can be found in European patent application EP 238,441, which is part of this invention in the form of a reference. On the plasmid pX193 there is a DNA segment comprising 156 bp upstream of the toxin coding region, which contains the above-described sporulation-dependent tandem promoter (²⁹⁾Wong HC et al, 1983). This sequence is sufficient for high expression of the delta endotoxin gene in B. thuringiensis HD1 cryB and B. cereus 569K.

Example 6: Detection of the toxicity of the recombinant B. thuringiensis HD1 cryB (pX193)

0291B. thuringiensis HD1 cryB and HD1 cryB (pX193) are grown at 25 ° C in sporulation medium (GYS medium). After complete sporulation, which is checked in the phase contrast microscope, spores and (if present) protoxin crystals are harvested by centrifugation and spray-dried. The resulting powder is added to the diet of L-1 larvae of Heliothis virescens (tobacco budworm) in various concentrations. The mortality of the larvae is determined after six days.

0292As expected, the protoxingen-free strain HD1 cryB is not toxic to Heliothis virescens, while the strain transformed with plasmid pXl 93 causes a dose-dependent mortality from H. virescens (Table 4). This shows that recombinant strains produced by the electroporation process can actually be used as bioinsecticide.

Example 7: Electroporation of various B. thuringiensis and B. spec. Tribes

0293The transformation protocol for B. thuringiensis HD1 cryB described in Example 1 can also be applied to other strains.

0294All strains of B. thuringiensis var. Kurstaki tested can be transformed very easily and efficiently using this method (Table 5).

0295Excellent transformation frequencies can also be achieved with a laboratory strain from B. cereus. The same applies to other of the tested B. thuringiensis varieties (var. Israelensis, var. Kurstaki). B. subtilis, on the other hand, can only be transformed very poorly by the electroporation process.

0296In contrast, when using the protoplast-dependent PEG method, transformation rates of 4 x 10⁶/ µg of plasmid DNA can be achieved.

0297The low transformation rates of B. subtilis when using the electroporation technique are not related to incorrectly selected parameters, such as an unsuitable voltage or a high mortality rate caused by electrical impulses, as can be seen in Fig. 9.

Example 8: Transformation of B. thuringiensis HD1 cryß with the β-galactosidase gene

8.1. Installation of a BamHI restriction site immediately before the first AUG codon of the B. thuringiensis protoxin gene

0298Before the β-galactosidase gene from the plasmid piWiTh5 (available from Dr. M. Geiser, CIBA-GEIGY AG, Basel, Switzerland) can be linked to the promoter of the Kurhd1 ö endotoxin gene from B. thuringiensis, the one in the environment must first DNA sequence of the protoxin gene located in the AUG start codon.

0299This modification is carried out with the aid of an oligonucleotide-mediated mutagenesis, using the single-stranded phage M13mp8, which contains the 1.8 kB Hincll-Hindlll fragment from the δ-endotoxin gene which comprises the 5 'region of the toxin gene.

0300First 3 μg of the plasmid pK36 (cf. Example 4) are digested with the restriction enzymes Hindlll and Hincll. The resulting 1.8 kb fragment is purified by agarose gel electrophoresis and then isolated from the gel.

0301In parallel, 100 ng M13mp8 RF phage DNA (Biolab, Tozer Road, Beverly MA, 01915, USA or any other manufacturer) are digested with the restriction enzymes Smal and Hindlll, phenolized and precipitated by adding ethanol. The phage DNA treated in this way is then mixed with 200 ng of the previously isolated protoxin fragment and linked to it by adding T4 DNA ligase.

0302After the transfection of E. coli JM103, 6 white plaques are read out and analyzed using a restriction map.

0303An isolate in which the link between the β-galactosidase gene and the promoter of the Kurhd1 ö endotoxin gene from B. thuringiensis has been correctly established is read out and is given the designation M13mp8 / Hinc-Hind.

0304With the help of a DNA synthesizer ('APPLIED BIOSYSTEM DNA SYNTHESIZER') an oligonucleotide is synthesized which has the following sequence:<ul id="ul0014" list-style="none"><li>(5 ') GTTCGGATTGGGATCCATAAG (3')</li><li>This synthetic oligonucleotide is complementary to a region on the M13mp8 / Hinc-Hind DNA that is derived from</li></ul>

0305Position 153 to position 173 of the Kurdh1 δ-endotoxin gene is sufficient (see formula I). However, the oligonucleotide sequence shown above has a 'mismatch' in position 162 and 163 compared to the sequence shown in formula I, which leads to the formation of a BamHI restriction site. The general procedure for mutagenesis is described by JM Zoller and M Smith (⁴³⁾ JM Zoller and M Smith; 19). About 5 µg of single-stranded M13mp18 / Hinc-Hind phage DNA is mixed with 0.3 µg of phosphorylated oligonucleotides in a total volume of 40 µl. This mixture is heated to 65 ° C for 5 minutes, then first cooled to 50 ° C and then gradually cooled down to 4 ° C. Then buffer, nucleotide triphosphates, ATP, T4 DNA ligase and the large fragment of DNA polymerase are added and overnight at 15 ° C as described (⁴³) JM Zoller and M Smith) incubated. After agarose gel electrophoresis, circular double-stranded DNA is purified and introduced into the E. coli strain JM103 by means of transfection. Alternatively, the E. coli strain JM 107 can also be used.

0306The resulting plaques are examined for sequences that start with ³²Hybridize P-labeled oligonucleotide; the phages are examined using DNA restriction endonuclease analysis.

0307A phage that contains a correct construction, in which a BamHI site is located directly in front of the first AUG codon of the protoxin gene, is designated M13mp8 / Hinc-Hind / Bam.

8.2. Linking of the β-galactosidase gene with the ö-endotoxin promoter

03088.2.1: The δ-endotoxin promoter is located on a 162 bp EcoRI / BamHI fragment of the M13mp8 / Hinc-Hind / Bam phage DNA. RF phage DNA is digested with the restriction enzyme BamHl. The resulting overhangs at the 5 'ends are removed by treatment with' Mung Bean 'nuclease (Biolabs) according to the manufacturer's instructions. The DNA is then digested with the restriction endonuclease EcoRI and the 162 bp fragment is isolated from the agarose gel after performing agarose gel electrophoresis.

0309The β-galactosidase gene is isolated from the plasmid piWiTh5. piwiTh5 DNA is first cut at the only Hindlll interface. The 3 recessed ends are filled in using the Klenow fragment of the DNA polymerase (cf.³³⁾ Maniatis et al., 1983, pages 113-114) and the modified DNA is then digested with the restriction enzyme Sall. The DNA fragment which contains the β-galactosidase gene is isolated using agarose gel electrophoresis.

0310The vector pX161 (cf. Example 3) is digested with the restriction enzymes EcoRI and Sall and the two fragments previously isolated are spliced ​​into the vector pX161.

0311After the transformation of this ligation mixture into the E. coli strain HB101 or JM 107, the correctly linked cell clones are analyzed using the restriction analysis and their β-galactosidase activity against the chromogenic substrate X-gal (5-bromo-4-chloro-3-indolyl -ß-D-galactoside) selected. A clone that contains a correct genetic construction is called pX180.

03128.2.2 .: In an alternative embodiment, the 162 bp EcoRI / BamHI fragment which contains the δ-endotoxin promoter is isolated by cutting M13mp8 / Hinc-Hind / Bam with EcoRI and BamHl and subsequent gel electrophoretic separation.

0313The β-galactosidase gene is also isolated from the plasmid piWiTh5 in this case (cf. Example 8.1.). The plasmid DNA is included. digested the restriction enzymes BamHl and BgIII and eluted the large fragment from the agarose gel after gel electrophoresis.

0314The vector pHY300 PLK (# PHY-001; Toyobo Co., Ltd., 2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan), which can be obtained commercially (see Example 9.1), is also included digested the restriction enzymes EcoRI and Bglll. The two fragments previously isolated are then spliced ​​into the vector pHY300 PLK.

0315The entire ligation mixture is then transformed into the E. coli strain JM107 [Bethesda Research Laboratories (BRL), 411 N, Stonestreet Avenue, Rockville, MD 20850, USA]. A clone that has a β-galactosid activity is further analyzed using restriction digests. A clone that contains a correct genetic construction is designated pX1101.

8.3. Transformation of plasmid pX180 or pX1101 in B. subtilis and B. thuringiensis

0316pX180 or PXI101 plasmid DNA is first prepared according to a known test protocol described by Chang and Cohen (¹³⁾ Chang and Cohen, 1979), protoplast-transformed in B. subtilis.

0317A correct clone is read out, the DNA to be transformed is isolated using standard methods and transformed into B. thuringiensis HD1 cryB cells via electroporation (cf. Example 1).

0318The transformed B. thuringiensis cells are plated on GYS agar (sporulation medium) containing X-gal as an additive. Correctly transformed clones turn blue when sporulation begins.

0319A B. thuringiensis HD1 cryB strain, which is transformed with the pX161 vector, however, remains white under the same conditions.

0320The restriction analysis shows that in the case of correctly transformed clones, an intact pX180 or pX1101 plasmid is present in the B. thuringiensis cells.

8.4. β-lactosidase gene under the control of a sporulation dependent promoter

0321B. thuringiensis HD1 cryB cells containing the pX180 or pX1101 plasmid are cultivated on GYS medium as described above. At various times during the growth phase (both during the vegetative growth phase and during the sporulation phase), a ß-galactosidase assay is carried out according to the⁴⁴) JH Miller described experimental protocol ("Experiments in Molecular Genetics", Gold Spring Harbor Laboratory, 1972, Experiments 48 and 49).

0322The only differences from the test protocol mentioned above relate to the use of X-gal as a chromogenic substrate and to the measurement of the colored hydrolysis product which is formed by the cells after about 1 hour.

0323The cells are then removed by centrifugation and the optical density of the supernatant is determined at a wavelength of 650 nm (OD₆₅₀).

0324It can be seen that the increase in optical density depends on the sporulation. In contrast, the non-transformed B. thuringiensis cells cannot hydrolyze the chromogenic substrate X-gal.

Example 9: Creating gene banks in Bacillus thuringiensis

9.1. Construction of pX1200

0325The plasmid pX1200 is a derivative of the plasmid pHY300 PLK, which is manufactured by Toyobo Co., Ltd. (# PHY-001; Toyobo Co., Ltd., 2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan). Plasmid pHY300 PLK, the construction of which is described in European patent application EP 162 725, contains both an ampicillin (amp^R) - as well as a tetracycline (tetr^R) Resistance gene.

0326The plasmid pHY300 PLK is completely digested with Bgll and Pvul. The resulting restriction fragments are then separated using agarose gel electrophoresis. The 4.4 Kb fragment is isolated from the agarose gel, purified and then religated with T4 DNA ligase.

0327The entire ligation mixture is transformed into E.coli HB101. After incubation of the transformed E.coli HB101 cells at 37 ° C on a selective L-agar containing 20 µg / ml tertracycline, the tetracycline-resistant (Tc^r) Transformants selected. From an ampicillin sensitive (Ap^s) Clone (100 µg / ml ampicillin) can then be isolated a plasmid that the Pstl interface in Ap^rGene along with the 0.3 Kb Pvul / Bgll fragment. This plasmid is called pX1200.

9.2. Cloning of protoxin genes from Bacillus thuringiensis var. Kurstaki HD1 in Bacillus thuringiensis HD1 cryß.

0328The total DNA (50 µg) of Bacillus thuringiensis var. Kurstaki HD1 is completely digested by incubation with the restriction enzymes Pst1 and Hpa1. The restriction fragments obtained in this way are transferred to a continuous sucrose gradient [5% (w / v) - 23% (w / v)] and separated there according to their size by means of density gradient centrifugation and collected in fractions of 500 μl each. The centrifugation is carried out in a TST 41 rotor (Kontron swing-out rotor) at max. 2.4 x 10⁵ g over a period of 16 hours and at a temperature of 15 ° C. Then 50 µl aliquots each to determine the fragment size on an agarose gel [0.8% (w / v) agarose in Tris acetate EDTA or Tris borate EDTA; please refer³³⁾Maniatis et al, 1982]. Those fractions which contain fragments between 3 Kb and 6 Kb are pooled and concentrated to a volume of 10 μl by ethanol precipitation.

03295 µg of the 'shuttle' vector pX1200 described in Example 9.1 are completely digested with the restriction enzymes Pst1 and Sma1. The 5'-phosphate groups of the resulting restriction fragments are then removed from the calf intestine by treatment with alkaline phosphatase. 0.2 µg to 0.3 µg of the previously isolated HD1 DNA are then mixed with 0.5 µg pX1200 vector DNA and with the addition of 0.1 U (so-called 'Weiss Units'; one unit of T4 DNA ligase corresponds to an enzyme activity which is sufficient 1 nM [³²P] converted from pyrophosphate at a temperature of 37 ° C. and within a period of 20 minutes into a norite-absorbable material] T4 DNA ligase incubated overnight at 14 ° C. The entire ligation mixture is then transformed directly into Bacillus thuringiensis HD1 cryB cells by electroporation (cf. Example 1). The electroporated B. Thuringiensis cells are then plated on a selective sporulation agar containing 20 µg / ml tetracycline as a selection agent and incubated at a temperature of 25 C until complete sporulation.

9.3. Production of monoclonal antibodies against B. thuringiensis protoxin protein

0330The production of monoclonal antibodies against δ-endotoxin from Bacillus thuringiensis var. Kurstaki HD1 is analogous to the description in ³⁶⁾Huber-Lukac, (1984) and at ³⁷⁾Huber-Lukac et al, (1986).

0331The hybridoma cells used for antibody production are fusion products of Sp2 / 0-Ag myeloma cells (described in ⁴⁵⁾Shulman et al, 1978; can be obtained from the 'American Type Culture Collection' in Rockville, Maryland, USA) and splenic lymphocytes from BALB / c mice previously treated with o-endotoxin and B. thuringiensis kurstaki HD1 were immunized.

0332In this way, monoclonal antibodies can be obtained which are specifically directed against the δ-endotoxin of B. thruingiensis. Monoclonal antibodies are particularly preferred which either bind specifically to an epitope in the N-terminal half of the protoxin protein (for example antibody 54.1 from Huber-Lukac et al, 1986 reference) or an epitope in the part which is constant in lepidopteran-active protoxins of the protein, the C-terminal half (e.g. Antibody 83.16 from Huber-Lukac et al, 1986 reference).

0333However, other monoclonal or polyclonal antibodies can also be used for the subsequent immune screening (see Example 9.4).

9.4. Immunological screening

For the immunological screening those or other suitable

0334te monoclonal antibody used. First, the crystal proteins that are free after the sporulation of the B. thuringiensis cells are bound with the aid of transfer membranes (eg Pall Biodyne Transfer membrane; Pall Ultrafine Filtration Corporation, Glen Cove, NY) by allowing them to stand for a period of about 5 minutes the plates are put on. The filters are then 5 minutes with TBST buffer [0.05% (w / v) Tween 20, 10 mM Tris / HCl (pH 8.0), 150 mM NaCl in H₂0 bidest.] washed and then incubated for 15 to 30 minutes to block non-specific bindings in a mixture of TBST buffer and 1% (w / v) skimmed milk.

0335The filters prepared in this way are then overnight with the protoxin-specific antibodies [antibody mixture of 54.1 and 83.16, (³⁷⁾Huber-Lukacv et al, (1986)]. The unbound antibodies are removed by washing the filter three times with TBST buffer for 5 to 10 minutes each. To detect the antibody-bound protoxin, the filters are incubated with another antibody. An anti-mouse antibody labeled with alkaline phosphatase functions as a secondary antibody, which can be purchased commercially, for example, from Bio-Rad [catalog # 170-6520, goat anti-mouse IgG (H + L) alkaline phosphatase conjugate]. After an incubation period of 30 minutes, the unbound secondary antibodies are removed, as described above, by washing the filters three times (5 to 10 minutes each) with TBST buffer. The filters are then coated with a mixture of substrates consisting of NBT ['p-nitro blue tetrazolium chloride; Nitro blue tetrazolium chloride] and BCIP [5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt]. The enzymatic reaction is carried out according to the manufacturer's instructions [Bio-Rad; 1414 Harbor Way South, Richmond CA, 94804, USA].

0336Positive, ie protoxin-containing clones, can be recognized very easily by their violet color. This comes about through the enzymatic reaction of the alkaline phosphatase with the previously mentioned substrate mixture. From the example 9.2. The transformation described with the ligation approach given there resulted in between 800 and 1000 transformants. Two colonies show clearly positive signals in the enzyme reaction described above.

0337Plasmid DNA is isolated from positive clones, in which an expression of the protoxin gene was detected using the enzyme reaction described. With the help of the restriction analysis and by comparison with known restriction maps, the cloned protoxin genes can be further characterized and finally identified.

0338Both clones contain a recombinant plasmid with an insert of 4.3 Kb. The following restriction digestions with Hindlll, Pvull, EcoRI and Xbal allow identification of the gene on the insert by comparison with the known restriction maps of the endotoxin genes from B. thuringiensis var kurstaki HD1. In both cases, it is the kurhdl gene, also known as the 5.3 Kb protoxin gene and⁵⁾Geiser et al, 1986.

0339This gene, which was cloned directly into B. thuringiensis and identified with the help of an immunological screening, also hybridizes with a BamHI / HindIII fragment of the 5.3 Kb gene in the plasmid pK36 (1847 bp)⁵⁾Geiser et al, 1986). In SDS / PAGE, both clones show a band of 130,000 daltons typical for the protoxin, which is shown in the Western blot (⁴⁶⁾Towbin et al, 1979) react specifically with the previously described (see Example 9.4) monoclonal antibodies.<tables id="tabl0013" num="0013"><img file="EP0342633A2_D0021.tif" /></tables><tables id="tabl0014" num="0014"><img file="EP0342633A2_D0022.tif" /></tables><tables id="tabl0015" num="0015"><img file="EP0342633A2_D0023.tif" /></tables><tables id="tabl0016" num="0016"><img file="EP0342633A2_D0024.tif" /></tables><tables id="tabl0017" num="0017"><img file="EP0342633A2_D0025.tif" /></tables>

Deposit of microorganisms

0340A culture of each of the microorganisms listed below, which are used in the context of the present invention, was obtained from the 'German Collection of Microorganisms' in Braunschweig, Federal Republic of Germany, which is recognized as an international depository, in accordance with the requirements of the Budapest Treaty for the international recognition of the deposit of microorganisms for the purpose of patenting. An explanation of the viability of the deposited samples was made out by the said international depository.<tables id="tabl0018" num="0018"><img file="EP0342633A2_D0026.tif" /></tables>

0341The internal designation pK selected in the priority document for the naming of the plasmids has been replaced by the officially recognized designation pXl for the international version.

0342The name for the asporogenic B. thuringiensis HD1 mutant used in the exemplary embodiments was also changed from cryß to cryB.

bibliography

0343<ul id="ul0015" list-style="none"><li>1. Goldberg L and Margalit J, Mosquito News, 37: 355-358, 1977</li><li>2nd Krieg A et al, Z. Ang. Ent., 96: 500-508, 1983</li><li>3rd Schnepf, HE and Whiteley HR, Proc. Natl. Acad. Sci, USA, 78: 2893-2897, 1981</li><li>4th Klier A et al, The EMBO J, 1: 791-799, 1982</li><li>5. Geiser M et al. Gene, 48, 109-118, 1986</li><li>6. Haider MZ et al., Gene, 52: 285-290, 1987</li><li>7. Gonzalez JM et at .. Proc. Natl. Acad. Sci. USA, 79: 6951-6955, 1982</li><li>8th. Obukowicz MG et al., J. Bacteriol, 168: 982-989, 1986</li><li>9. Donovan LP et al., Mol. Gen. Genet., 214: 365-372, 1988</li><li>10th Schnepf HEand Whitely HR, J. BioLChem., 260: 6273, 1985</li><li>11. Klier A et al, Mol. Gen. Genet. 191: 257-262, 1983</li><li>₁2nd Bibb JJ et al, Nature, 274: 398-400, 1978</li><li>13. Chang S and Cohen SN, Molec. Gene. Genet., 168: 111-115, 1979</li><li>14. Brown BJ and Carlton BC, J. Bacteriol., 142: 508-512, 1980</li><li>15. Kondo JK and McKay LL, Appl. Environ. Microbiol., 48: 252-259, 1984</li><li>16. Wirth R. et al, J. bacteriol., 165: 831-836, 1986</li><li>17th Yoshihama M et al "J. Bacteriol., 162: 591-597, 1985</li><li>18th Alikhanian SJ et al, J. Bacteriol., 146, 7-9, 1981</li><li>19th Martin PA et al., J. Bacteriol., 145: 980-983, 1981</li><li>20th Fischer HM, Arch. Microbiol., 139: 213-217, 1984</li><li>21. Sound D, gene transfer between isolates of Bacillus thuringiensis by protoplast transformation and fusion. Dissertation, University of Tübingen, 1986</li><li>22. Shivarova N, journal General Microbiol., 23: 595-599, 1983</li><li>23. Youston AA and Rogoff MH, J. Bacteriol., 100: 1229-1236, 1969</li><li>24th Horinouchi S, and Weisblum B, J. Bacteriol., 150: 815-825, 1982</li><li>25th Polak J and Novick RP Plasmid, 7: 152-162, 1982</li><li>26. Mahler J and Halvorson HO, J. Gen. Microbiol., 120: 259-263, 1980</li><li>27 Gryczan T et al, J. Bacteriol., 141: 246-253, 1980</li><li>28 Vieira J and Messing J, Gene, 19: 259-268, 1982</li><li>29. Wong et al, J. Biol. Chem., 258: 1960-1967, 1983</li><li>30th Bolivar et al, Gene 2: 95-113, 1977</li><li>31 Norrander et al, Gene, 26: 101-104, 1983</li><li>32. Bevan et al, Nature, 304: 184-187, 1983</li><li>33. Maniatis et al, Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, USA, 1982</li><li>34. Hinnen et al, Proc. Natl. Acad. Sci, USA, 75: 1929-1933, 1978</li><li>35. Young RA et al, Proc. Natl. Acad. Sci., USA, 80: 1194-1198, 1983</li><li>36. Huber-Lucac M, 'On the interaction of the delta endotoxin from Bacillus thuringiensis with monoclonal antibodies and lipids', dissertation No. 7547, ETH Zurich, 1984</li><li>37. Huber-Lucac M et al, Infect. Immunol., 54: 228-232, 1986</li><li>38. McCutcheon's, 1986 International McCutcheon's Emulsifiers &amp; Detergents, The Manufacturing Confections Publishing Co., Glen Rock, NJ, USA</li><li>39. Stahly DP et al, Biochem. Biophys. Res. Comm, 84: 581-588, 1978</li><li>40. Bernhard K et al, J. Bacteriol., 133: 897-903, 1978</li><li>41. Primrose SB, Ehrlich SD, Plasmid 6: 193-201, 1981</li><li>42. Huber-Lukac H, Dissertation, Swiss Federal Institute of Technology, Zurich, Switzerland, No. 7050, 1982</li><li>43. Zoller JM and Smith M, Nucl. Acids Res., 10: 6487, 1982</li><li>44. Miller JH, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972</li><li>45. Shulman et al, Nature, 276: 269, 1978</li><li>46. Towbin H et al, Proc. Natl. Acad. Sci., USA, 76: 4350-4354, 1979</li></ul>

Patent literature

0344<ul id="ul0016" list-style="none"><li>EP 162,725</li><li>EP 238,441</li><li>WO 86/01536</li><li>U.S. Patent 4,448,885</li><li>U.S. Patent 4,447,036</li><li>U.S. 4,237,224</li><li>U.S. Patent 4,468,464</li></ul>