Polypeptides

(57) Naturally, derivatives of naturally occurring alkyl G-CSF having at least one vhinol have been discovered. The physical properties of the naturally occurring C-CSi are attained by about 3.5% in the solution. concentration, 5 µm / ml, in which of Cys¹· 'N.iti. in her. sequence-is replaced by Ser¹⁷ and Aftp³⁷native sequence jo replaced by resviluero ser ”. Nucleotide sequences encoding a portion of the rn-bn of the entire amino acid sequence of a minor moiety can be absorbed into autonucleotides of a replicating plasroid, or viral vectors used for transformation, or transfection of a suitable prokaryotic eukaryotic host. cells, such as bacteria, yeasts, or animal tissue cultures.

<img file="CS9101250A3_D0001.tif" />

.'i \ j * ». · * ·

<img file="CS9101250A3_D0002.tif" />

; -K&gt;?

<img file="CS9101250A3_D0003.tif" />

Technical Field

ŠPOLYPEPTIDY

<img file="CS9101250A3_D0004.tif" />

<img file="CS9101250A3_D0005.tif" />

it relates to derivatives; G-CSF (factor_:They are characterized by good stability of the processes for their preparation. The following are inventive stimulant granulocytes of the solution, and further include a description. the composition of pharmaceutical preparations containing these derivatives.

BACKGROUND OF THE INVENTION

A group of stimulating factors are proteinaceous hormones that stimulate proliferation. and the function of specific types of blood cells such as grariulocytes. Granulocytes absorb and destroy harmful microorganisms and cell debris, and thus represent a vital factor in response to infection. In this regard, granulocytes may form certain, pseudo-clumps and may be released from the vascular system of endothelial cells. Neutrophil granulocytes can then come into direct contact with and destroy microorganisms using specific enzyme systems, such as those they generate. superoxide anions. Because. granulocytes. having only a short circulating life (approximately 6-12 hours) and being destroyed in the course of their function, it is essential for bone marrow stem cells to generate as many granulocytes as red blood cells every day. The rate of granulocyte production further increases enormously if infection occurs. Conversely, if bone marrow is damaged, granulocyte counts decline rapidly, eg as a result of chemotherapy in the case of cancer, radiation, AIDS, or haematological disorders; the result of this rapid change is the susceptibility of patients to insurmountable infection. True sepsis is a general cause of death in cancer patients whose marrow is damaged by radiation, chemotherapy or a disorder, neoplasticity.

The existence of G-CSF has been described in Wallet K. et al.

vj ^ t ^ fi £ Eaa £ «F. * 4 '. = £ 9 £ # w' yXJi &lt;&lt;« /. and\"·..

ft. *. · __ r._{P r} -, -, -, -, -, -,. 'g &amp; z ^ V.' · i ·; ·_: '♦ ξ ^ Ρί-Ό ^ · ·: · “^ / 4'-Λ. · ,,; - ¾ / - · - ýýýýW -'. . M (Proc) Natl. Acad. Sci. USA vol. 82, pp. 1526-1530, further described. .. · ·. . ' No. 169,556; and PCT Patent 17- / - 7 '*.

A / Publication No. WO 87/01132. G-CSF has been shown to stimulate granulocyte production in vivo, with minimal side effects. It appears that human G-CSF can find post-therapeutic use in the management of neutropaenia associated with chemotherapy, radiation therapy, radiation diseases, or bone marrow transplantation. In addition, it can be used to stimulate bone marrow suppression associated with AIDS, to treat myelodisplastic syndromes, characterized by abnormalities in granulocyte function, and to assist in the treatment of serious infections.

In addition, certain of the foregoing G-CSF analogs have been described in PCT Patent Publication No. WO 87/01132, European Patent Publication No. 243,153, European Patent Publication No. 256,843, European Patent Publication No. 272,703 and the journal Biochemical and Biophysical Research Communicatidh (1989), vol. 159, no. 1, pp. 103-111, and tor al. Modification of G-CSF

Kuga t

[Ser] G-CSF was affected by the substitution of cysteine ​​and serine residues at position 17, but these. the changes had no anticipated effect (Protein. Engineering, Vol. 3, No.4, p. 360 (1990))

G-CSF and its analogs are unstable in solution, tend to precipitate out of solution on standing, resulting in their short-term stability and storage problems at high concentrations. In addition, G-CSF and certain analogs tend to covalent aggregation upon storage.

SUMMARY OF THE INVENTION

The present invention is based on the discovery of modifications to which G-CSF may be subjected, or a derivative having part or all of the amino acid sequence, and at least one of the biological properties of naturally occurring G-CSF,

<img file="CS9101250A3_D0006.tif" />

For example, naturally occurring human G-CSF can be improved by modifying the stability of the solution.

In the present invention, a naturally occurring derivative is disclosed. G-CSF ,. which has at least one of.

biological properties of naturally occurring G-CSF with at least 35¾ stability, at a concentration of 5mg / ml. Said derivative comprises at least a change in when. Cys native sequence -^J is replaced by 'Serum ^'⁷ The native sequence is replaced by the Ser residue. Derivatives of the invention prefer at least one of the following modifications selected from;

(a) Glu¹¹ the native sequence is replaced by Arg¹¹ residues 1-5_h ~). Leu¹⁵ The sequence "sequence" is "na-hr-azene-residu-Glti" native sequence is replaced by the residue Arg

<td>C)</td><td>_T i □ Lys</td>

<td>(d)</td><td>Gly²⁶</td>

<td>E)</td><td>Gly²⁸</td>

<td>F)</td><td>Ala³⁰</td>

<td>G)</td><td>- 34 Lys</td>

<td>.h).</td><td>_T 40</td>

<td>and)</td><td>For⁴⁴</td>

<td>(j)</td><td>Leu⁴⁹</td>

<td>to)</td><td>Gly⁵¹</td>

<td> 1)</td><td>Gly⁵⁵</td>

<td>(m)</td><td>58 Trp</td>

<td>(n)</td><td>For⁶⁰ :</td>

<td> ?)</td><td>For⁶⁵ :</td>

<td>P)</td><td>Pto¹¹¹</td>

<td>q)</td><td>Thr¹¹⁵</td>

<td> *)..</td><td>Thr¹¹⁶</td>

<td>with)</td><td>Tyr¹⁶⁵</td>

the native sequence is replaced by the Ala native residue, sequence is replaced by Ala residue native sequence is replaced by residue Lys or Arg native sequence is replaced by residueArg native sequence is replaced by residue Arg native sequence is replaced by residue Ala native sequence is replaced by residue Lys native sequence is replaced by residue Ala native sequence is replaced by residue Ala native sequence is replaced by residual Lys native sequence is replaced by residual Ser native sequence is replaced by residual Ser native sequence is replaced by residual Glu ^ native sequence is replaced by residue Ser native sequence is replaced by residue Ser native sequence is replaced by residue Arg

115

116 165

- 4 -ΐΚΪ'ώΐί '«iífcť-lř-' '-'. · · **« £ ». ·. 'áfeT-:' '-. w - · - -.

ff. /. Presence, at least one of the others. modifications, selected¹ of examples a), b), d), e), f), n) and o) is partially preferred.

Much more desirable are other modifications comprising at least one of the following changes:

(i) Gin^-14·, Ρ1ο⁸θ '⁸⁵ the native sequences are replaced by Arg, ser⁶⁰'⁶⁵ ii) Ala ^ 1, Thr^115, the native sequences are replaced

Glu¹¹¹, Ser¹¹⁵'¹¹⁶ iii) Gin¹¹, Trp⁵⁸, Tyr¹⁶⁵ the native sequences are replaced. 11,165 _ 58

Arg ', Lys c 9 9 ft o λ iv) Leu, Gly', Ala native sequences are replaced

26,28 _T 30

Glu, Ala, Lys

v) Asp2 \ Pro⁴\ Leu ^, Gly^51,55, Trp⁵⁸ native sequence

and.

. . _: in _T 49.58 44.51.55 are replaced by Lys. , Ala.

The above-defined modifications can, if desired, be introduced into any polypeptide chain that. it has at least one of the biological properties of the naturally occurring G-CSF so as to improve the stability of the molecule in solution. The modifications of the invention may be applied to such polypeptides that differ in amino acid composition from that described herein for naturally occurring G-CSF, either in the composition or in the location of one or more residues (e.g. occurrence of substitutions, terminal or internal additions and deletions):

Examples of such polypeptides are those. that were. summary; separating, such. . manifest - in the resistance to hydrolysis (and: hence the effect is longer than naturally occurring); furthermore, those have been altered to remove potential O-glycosylation (which may result in activity for yeast-producing substances) or that one or more cysteine ​​residues have been removed; O

replaced by, for example, alanine or serine residues, and are more readily recoverable in active form from microbial systems. Also included are polypeptides having one or more tyrosine residues replaced by phenylalanine and may be more or less bound to human G-CSF cell receptors.

The proposed modifications aa) -s), and preferably i) -v) may thus be

For example, G-CS-F = has = G- ^: . The native sequence has been replaced by Ser or allelic variants and analogues thereof which have demonstrated at least one of the biological properties of naturally occurring G-CSF, as well as those described in the literature above.

The polypeptides of the present invention were found to be tested.^: have greater stability in solution while maintaining or better biological activity compared to unmodified polypeptides, ^r The stated quantity, the stability of the solution, is different from the solubility. Solution stability is defined as the decreasing ability of a substance to precipitate from solution due to the physiological conditions of pH, temperature and ionic strength.

The stability of the solution is measured herein by assay. the percentage of G-CSF derivative remaining in solution (borate buffer) after 14 days at 37 ° C at an initial concentration of Img / ml, 5mg / ml, 10mg / ml. Determination of this quantity

- 6 v Λ? ' ; * ·? Ν ··.; Λύ »ΛΛτ) 5ζ-Λ^,&lt;^ ανί.ι · η-ϊ^,“^{Γ /} - yA.iEij.&gt; * 3. * 5 * '*&gt; »ί' ^ · '&lt;γ ^. *' i *&gt; in / &lt;&gt; '/····..··. - - /

-7. ^, 7.4- .v.,. · .-. .f ·· described in detail in Example 4. Polypeptides tv

The solution will have a stability of the solution at a concentration of 5 ° C (52 ° C). ⁽ .· .

at least 35%, or 50%, or rather 75%, at the end? or 10mg / ml of at least 75%, especially 85%. .

The expression of naturally occurring G-CSF as used herein is attributed to those G-C3 factors in which it has been. discovered,. They are found in nature and comprise two polypeptides having the amino acid sequence shown in SEQ ID NO: 37. The two polypeptides differ only in that one polypeptide contains an inserted Val-Ser-Glu tripeptide between positions 35 and 36, while the other polypeptide does not contain the tripeptide. The numbering system used is derived from a naturally occurring polypeptide without insertion. "⁷the sequence of Val-Ser-Glu, and the term native, herein, is; refers to a polypeptide without the Val-Ser-Glu sequence. Significantly, the present invention is applicable to all naturally occurring forms of G-CSF and analogs thereof, as described above, and hence the resulting revision of the polypeptide position numbers must necessarily depend on the form of the naturally occurring polypeptide selected for modification. .

The present invention further provides a DNA sequence encoding all or part of the amino acid sequence of a derivative of a naturally occurring, previously defined G-CSF. For example, such sequences may include 1) incorporated codons that are preferred for expression by a selected non-mammalian host; 2) restriction endonuclease cleavage sites; 3) additional initial, terminal, or intermediate DNA sequences that facilitate the construction of readily expressable vectors. The DNA sequences disclosed herein include those that are useful for guaranteed expression in prokaryotic or eukaryotic cells, wherein the derivatives disclosed herein may be in either:

- 7 Λ'-. '. ¹'-.'. Glycosylated or non-glycosylated form, depending on the type of host cell selected.

Where the derivative is obtained in a non-glycosylated form, e.g., subsequent expression in prokaryotic. cells, the derivative may, if desired, be glycosylated chemically, e.g., using mammalian or other eukaryotic hydrocarbons.

The present invention provides a description of a recombinant vector comprising a DNA sequence herein. byra ~ jxz “d” previously defined. For example, the recombinant vector may be a biologically functional plasmid or a viral DNA vector.

• &lt;?

The present invention further provides guidance for the preparation of a recombinant vector as defined hereinbefore which is prokaryotic.

transformed, contains the inserted DNA sequence inside.

The present invention further provides. The description and eukaryotic cells stably or transfected with a recombinant vector previously described.

The present invention further provides instructions for the preparation of a prokaryotic or eukaryotic host cell comprising a recombinant vector as defined herein so as to obtain a stably transformed or transfected prokaryotic or eukaryotic host cell.

The present invention further provides guidance on the preparation of a naturally occurring G-CSF derivative, which includes a description of the preparation (cultivation) of prokaryotic or eukaryotic cells by which the aforementioned derivative would be obtained. The instructions also contain a description of the isolation of said DNA expression derivative, the characteristics of which are disclosed in the invention, in a recombinant vector as defined above.

<img file="CS9101250A3_D0007.tif" />

<img file="CS9101250A3_D0008.tif" />

ť; Use in the processes described herein, host procaryotic cells are preferred, such as

Τν'Κί · »'·' V '

SLnapf. But may also be Saccharomyces cerevisiae cells or mammalian cells (e.g., hamster ovary cells). , '_: "./. ' ._____ - jr.

The present invention further provides a pharmaceutical composition comprising as an active ingredient at least one derivative of naturally occurring G-CSF in association with a pharmaceutically acceptable carrier or filler.

The present invention further provides a method for treating hematopoiesis in a mammal which comprises effective doses of the disclosed derivative.

The present invention further provides a method of describing / administering an effective amount of a derivative that can be avoided.¹proliferation of leukemia cells.

Brief Description of the Figures i '7

Giant. 1 shows the nucleotide sequence of the 167 bp fragment, reference is made to Example 1

Giant. 2 shows the amino acid sequence and the corresponding nucleotide sequence of native human (hu) G-CSF1 and restriction sites

Giant. 3 shows the amino acid sequence and the corresponding 17 27 nucleotide sequence of [Ser '] native human

G-CSF and restriction sites Ϊ

Giant. 4 depicts the nucleotide sequence of the T4 transcriptional terminus that comprises a) terminal (terminal) SalI restriction sites and a. HindIII and b) terminal. Sáli a Styl restriction sites: 17¾?

&gt;.? ~ · · »S- - ·· 'ί!

W = - ^. .-Giant. 5 depicts the restriction napu of pTB357 (also referred to herein as gico-β-77 β-pLB004). / ........... "'

Giant. 6 shows the nucleotide sequence of the EcoRI-SalI fragment referred to in Example fi (b) but without the interferon gene sequence

Giant. 7 shows a restriction map of pLB015 (also referred to herein as pCI 0080)

.............. 06r ... δ. Shows .restriction-map pI-CI - 10-79 ------------- '· - ----------- -.....Giant. 9 shows a restriction map of pICI 54 (also referred to herein .....).

-: —-— 3-like pCG54 - “—'—--^: '

Giant. 10 shows the restriction map of pCG61 ......

Giant. 11 shows a restriction map of Fodder 1107, where the shaded area represents the gene sequence encoding __ [Ser^17,2Z.] _ Human-G = CS-F-;⁼⁼01&gt; ϊ7^_Uvádí2 shows the restriction map of pCG300 (also referred to here as 1295)^?

Detailed description

Preferably, those derivatives of the invention that have been modified in one of the aforementioned (i), (ii), (iii), (iv) or (v) are preferred, and modifications such as (i), (ii) or (iv), in particular (ii) or (iv).

Especially preferred are those derivatives which have good solution stability and include:

[Arg¹¹, Ser^17/27'^6Q'⁶⁵] G ~ CSF [Glu^1?; Ser¹/'²⁷, Ala²⁶'²⁸, Lys³⁰] G-CSF t

r.

<img file="CS9101250A3_D0009.tif" />

• 'Tttw-iu ·· lc / - ·· .-: ·. ** '&gt; -Έι --- v' V [Arg¹¹, Glu¹⁵, Ser¹⁷'²⁷'⁶⁰'⁶⁵, Ala^{26, 28}, Lys³⁰] GCr [Arg¹¹'²³, Ser¹⁷'²⁷'⁶⁰'⁶⁵] G-CSF 1Arg ^^ SeriLZZ ^ SjG.CS ^ [Arg¹¹'⁴⁰, Ser¹⁷'²⁷'⁶⁰'⁶⁵G-CSF '[Ala¹, Thr³, Tyr⁴, Arg^5,11, Ser¹⁷'²⁷'⁶⁰'⁶⁵G-CSF [Arg¹¹, Glu¹⁵'¹¹¹, Ser¹⁷' ²¹' ^{60/ 65,115}' ¹¹⁶, Ala²⁶'²⁸Lys] G-CSF [Arg¹¹'¹⁶⁵, Glu¹⁵, Ser¹⁷'²⁷'⁶⁰'⁶⁵, Ala²⁶'²⁸,

Lys³⁰'⁵⁸G-CSF [Arg¹¹, Glu¹⁵, Ser¹⁷' ²¹ &gt; ⁶⁰' ⁶⁵, _Ala26,28,44,51,55,

Lys³⁰'⁴⁹'⁵⁸] G-CSF. [Arg¹¹'¹⁶⁵, Glu¹⁵'¹¹¹, Ser¹⁷'²⁷'⁶⁰'⁶⁵'¹¹⁵'¹¹⁶, .

.Ala²⁶'²⁸t⁴⁴'⁵¹'⁵⁵, Lys³⁰'⁴⁹'⁵⁸] G-CSF [Glu¹⁵, Ser¹⁷'²/ Ala²⁶'²⁸, Arg³⁰} native human G-GSF

Particularly preferred derivatives of the invention, characterized by exceptional solution stability and at the same time good specific activity, include;

(i) [Arg, Ser '17, 27, 60, 65

JG-CSF ii) [Glu¹⁵, Šer¹⁷'²⁷, Ala²⁶'²⁸, Lys³⁰] G-CSF

Ser¹⁷' ²⁷'⁶⁰' $5,.-^26,.28.- :£,_γ33° ]_G__CSF----- IV) [Arg¹¹'⁴⁰, Ser¹⁷'²⁷'⁶⁰'⁶⁵] G-CSF _rs 11,23 _ 17,27, 60, 65,- _PCT,

[Arg], Ser JG-CSF vi .._ [Ar 5^11/165z-Glu¹⁵, Ser^{17 / 276O}'_⁶⁵, .- Ala²⁶' ²⁸·, Lys³⁰' ⁵⁸human G-CSF

Vii) [Arg¹¹, Glu¹⁵'¹¹¹, _SerH, 27,60,65,115,116, _Ala26, ₂₅, Lys³⁰] human G-CSF viii) [Glu¹⁵, Ser¹⁷'²⁷, Ala²⁶'²⁸, Arg³⁰] human G-CSF ix) [Ala^{* 1 *}, Thr³,. Tyr \ Arg⁵'¹¹, Ser¹⁷'²⁷' ⁶⁰' ⁶⁵] G-CSF, the most preferred of which are (i), (ii) ,. (iii), (vi), (vii), (viii).

These human G-CSF derivatives listed below not only exhibit exceptional solution stability but also have better specific activity compared to naturally occurring human G-CSF.

The methionine presequence may or may not be present in the polypeptides.

It has been found to be advantageous to use a pAT153-derived vector comprising:

i) a promoter and an operator thereto, e.g. the trp promoter or T7A3 promoter. T7A3 is the A3 promoter of bacteriophage T7

(See Dun JJ and Studier FW: J. Mol. Biol. 166, 477-535 (1983). Full nucleotide DNA sequence).

<img file="CS9101250A3_D0010.tif" />

ii) bacteriophage T7 and the location of the genetic portions of T7 is described in the above reference.

a ribosome binding site sequence, e.g., a binding site of the ribosome binding site iii) a cloning site for the gene to be expressed; iv) a T4 transcriptional terminal sequence (see SEQ ID NO: 51 and FIG. 4).

v) cer sequence (Summers D. et al. MGG, 201, pp. 334-338;

1985} (vi) the tetracycline repressor gene (tetracycline repression gene) Tet R vii) the gene responsible for resistance to tetracycline Tet A »

viii) multiple restriction enzyme recognition sequences

SEQ ID No. 50 provides a sequence that includes an EcoRI restriction endonuclease cleavage site (nucleotides 1-6), an A3 promoter sequence (nucleotides 7-52), a leader sequence for a trp ribosome binding site (nucleotides 53-78), and a translational initiation sequence. codon (nucleotides 79-81).

It may be advantageous to cultivate host cells capable of expressing a given derivative in a growth medium with enrichment of the culture medium. an additive containing yeast extract; It is preferred that the addition of the yeast extract substances occurs after the start of the cultivation, but before the start of production monitoring. The dosing must be adjusted to prevent it from occurring during cultivation.

yeast extract in medium. Furthermore, it is particularly advantageous; Use of a production vector with the T7A3 promoter.

At the same time advantageous. culturing a host transformed with a recombinant vector carrying the genetic material for a given derivative may be in the presence of leucine and / or threonine in an amount sufficient to improve the accumulation of the derivative. It is particularly advantageous to influence the fermentation by the presence of leucine, who used the production promoter containing the promoter.

In addition to the discovery of modifications to G-CSF or a derivative thereof that includes some or all of the amino acid sequence and at least one of the properties of naturally occurring G-CSF. The present invention is further based on the discovery of modified techniques for the purification of such G-CS factors and derivatives thereof.

For example, it does not exist. no disclosure in PCT Patent Publication No. WO 87/01132, describing a method for removing a detergent, especially N-lauroylsarcosine, occurring in the form of a salt (Sarkosyl), from the G? CSF analogs prepared in this publication. Accordingly, it was necessary to determine such a way that the stability of the G-CSF derivatives of the invention in solution could be determined at high concentrations and that the desired formulation studies (designs) could be performed.

E.g. it is stated in the invention that the removal of detergent can be influenced by phosphate buffer (pH 7.2-7.5). The phosphate buffer may be prepared from isotonic salts and may have the composition described in Example 1. Less useful are other in this regard. buffers, - Whereas; This means that there is less detergent removal, in particular

.. ,....

**; / -'íít í · '-' -i. ·;? *

J ^ s ^ í íCCC^S .S³'' ίΛ.Λ ** ''.

:. 'ί?' · -8 .-. 'i / b in C #. ,! ». β -.-¹·* ' ¹ : wi&gt; ..; , ·.

• ýa ^ V “·.? ·

Ir '' 4, v&gt;&gt;, · * · Α · 1 * £, · * - '. . 7

<img file="CS9101250A3_D0011.tif" />

L.

bNrlauroylsarcosine, or the amount of precipitated increases -.... _t\ ... protein from the solution. Further, the diafiltration effect is advantageously utilized in this step, since it has been found that efficacy increases without causing increased protein precipitation.

—Dia f ± 11 raci ™ s^and_For example, it is preferable to dialysis by routine di f ΰζηϊ '*. It has further been discovered that the concentration of detergent, especially N-lauroylsarcosine in the form of a salt, can be reduced to below 1¾ the concentration if it decomposes during chromatography. Since the possibility of removing the detergent can be increased by reducing its initial concentration, the detergent is already used at the minimum initial concentration, e.g. the same for N-lauroylsarcosine; concentration which decomposes during chromatography.

Particular detergent concentrations are from about 0.8% to about 0.2%, preferably from about 0.5% to about 0.2%, preferably at about 0.3%.

In addition to the above, it has been found that the removal of a detergent such as N-lauroylsarcosine. in the form of a salt such as sarcosyl, activates traces of proteolytic activity that can. complicate product formation · There was; It has been found that this proteolytic activity can be significantly reduced or eliminated if, after removal of the detergent by diafiltration, the pH is lowered below pH 7.0 by diafiltration or better by dialysis. Another part of the invention states that the reduction or elimination of proteolytic activity can be achieved at a pH that is less than pH 7.0, but is high enough to exclude some possible hydrolysis of the polypeptide. A suitable pH is in the range of 6.0 to 4 &amp; gt; 5, preferably a pH. from 5.8 to 5.0, in particular pH 5.4. It is also an advantage that contaminants produced by E.coli and / or due to the presence of degraded or improperly synthesized protein may be under the action of a lower · · &lt;··· -^Α· -^;7í. ' The pH was excreted by precipitation. It is preferred that for purification, chromium-based chromium-based size separation (gel chromatography) is used, since otherwise the risk of proteolytic degradation increases, while the previous action (lowering the pH) reduces the possibility of such degradation without using chromatography is difficult to rule out.

Furthermore, the stability of G-CSF and its derivatives is mentioned. v. _r.oz.toku allows, simplify..process.-xtraction ...

In the present invention, a method for extracting -—^:—Active — if — previously — defined — derivatives — consisting of:

1) suspending said inclusion particles in a detergent, in particular N-lauroylsarcosine, in the form of a salt.

2) oxidation

3) removing the detergent as previously described

4) maintaining the solution obtained by subsequent removal of the detergent at an elevated temperature of, for example, 30-45 ° C, more preferably 34-42 ° C, thereby precipitating contaminating bacterial proteins, oligomeric products, or degradation products. Said solution is maintained at this temperature for 6-24 hours, preferably 8-18, or 10-14, especially 12 hours.

For example, the extraction process may start with glabrous host cells followed by centrifugation to obtain inclusion particles, e.g., in the form of pellets. The inclusion particle may then be suspended in a detergent such as N-lauroylsarcosine in the form of a salt (Sarkosyl), at a concentration of 1-3%, especially about 2% of the N-lauroylsarcosine in the form of a salt. This is followed by oxidation of the suspension in the detergent, e.g. in the presence of copper sulfate, which may be followed by further centrifugation.

If possible, the inclusion particle may be included

<img file="CS9101250A3_D0012.tif" />

&lt;.

and s

*».· .· ··

<img file="CS9101250A3_D0013.tif" />

£ &amp;

<img file="CS9101250A3_D0014.tif" />

<img file="CS9101250A3_D0015.tif" />

λ. washing, with urea preferably being&gt; i.

^: deoxycholate.

Extraction allows simplification of the whole product. In addition, the high yield of the product after the process (referred to in point 4) (effect of elevated temperature) is one of the consequences of the increased stability of the derivatives in the process. solution. Of course, the greater the stability of the derivative in solution, the better the protein is ready for re-extraction. It is preferable to use extraction for derivatives in which the stability in solution is at least 85¾ at a concentration of 10mg / ml. E.g. when the known -117 [Met, Ser] G-CSF analog was extracted according to the above procedure, it appeared after rpHPLC that only 40 µl of the desired product remained in solution after heat treatment of the eluate containing only 1mg / ml protein. At a protein concentration of 3mg / ml, only 19¾ of the analog remained in solution.

All nucleotide sequences in the invention are by convention indicated from the 5'-3 'end.

All derivatives are derived from human G-CSF, which can be expressed as hu G-CSF.

Generally, in all of the examples described, Met preference was present since all derivatives were prepared using E.coli cells.

The following materials are referred to in the Examples and Examples, - their description is as follows.

The term N-lauroylsarcosine always refers to this salt, which is present in the form of a salt. In the Examples it is. this is the sodium salt of N-lauroylsarcosine.

ř '

PUFFERS FOR RESTRICTIVE ENZYMES

Stability: stable at -20 ° C

components final concentration [mmol / 1] ———'— -——: -: - dilution - -1: -10-- --- A · 'BL Μ H

Tris acetate 33

Tris-HCl- 10 10 10 50

<td>Mg-acetate</td><td> 10</td><td></td><td></td><td></td>

<td>MgCl₂</td><td> 5</td><td> 10</td><td> 10</td><td> 10</td>

<td>K-acetate</td><td> 66</td><td></td><td></td><td></td>

<td>NaCl</td><td> 100</td><td> -</td><td> 50</td><td> 100</td>

<td>Dithioerythritol_:(DTE)</td><td></td><td> 1</td><td> 1</td><td> 1</td>

<td>Dithiothreitol. (DTT).</td><td> 0,5</td><td> - ·</td><td> “ </td><td> ... -</td>

<td>Mercaptoethanol</td><td> 1</td><td> —</td><td> —</td><td> —</td>

<td>pH at 37 ° C</td><td> 7, 9 8,0</td><td> 7,5</td><td> 7,5</td><td> 7,5</td>

The above buffers are available from Boehringer Mannheim

Procedure for site-directed mutagenesis - see reference to Example 2

Buffer 1 100mM Tris-HCl pH 8.0 100mM NaCl '

20mM MgCl₂

<img file="CS9101250A3_D0016.tif" />

and, _Ť pH-10mMTris-HCl pH 8.0 20mM NaCl 1mM EDTA

Buffer 3 12 mM Tris-HCl pH 7.7

30mM NaCl 10mM MgCl₂

8mM 2-mercaptoethanol

Buffer 4 60 mM Tris-HCl pH 8.0

90mM NaCl

6mM MgCl? 10mM DTT

Nucleotide Mixture 1: 250μΜ dATP, dGTP, dCTP = S (phosphothiohate derivative dCTP), dTTP and 1mM ATP

Nucleotide Mixture 2: 250μΜ dATP, dGTP, dCTP, dTTP and 350μΜ ATP

M9 minimal medium ammonium chloride lg Disodium phosphate 6g Potassium dihydrogen phosphate 3g j Sodium chloride 0.5g Distilled water 1 1

- 19 —

<td colspan="3">Other ingredients / 75ml</td>

<td>300μ1</td><td>50¾ glucose</td><td></td>

<td>75μ1</td><td>1Μ MgSO₄</td><td></td>

<td>75μί</td><td>0.1M CaCl₂</td><td></td>

<td>75μ1</td><td>4mg / ml thiamine</td><td></td>

<td>75μ1</td><td>20¾ amino acids</td><td>casein</td>

Trace Element Stock (TES) ^ TES ^ Follow us

A1C1₃.6H₂0 CoCl₂-6H₂About KCr_y)._?..- 1.2H₇.0 CuCl2.2H-0 hr₃bo₃Kl

MnSO ^ .HO ..

NiSO,₄ 6H₂O .. ...

On₂Mo0₄[0100] 2H₂0

ZnS0₄.7H₂0

<td>0.1 mg Γ¹</td><td colspan="2">100 μg 1 ¹</td>

<td>0,04 mg l '¹</td><td>40 µg</td><td>l '¹</td>

<td>0-1 mg 1^_1</td><td>--1-0 — ug-</td><td>-J-¹</td>

<td>0.01 mg 1 ¹0,005 mg l '¹</td><td>10 µg l "¹5 ug Γ¹</td>

<td>0.1 mg. 1¹</td><td>100 µg, 1¹</td>

<td>0,1 mg 1 ¹</td><td>100 µg l¹</td>

<td>0, 0045. ng. l^-1</td><td>4.5 ng. l¹</td>

<td>0.02 mg l '¹</td><td>20 µg l¹</td>

<td> 0.02 mg 1 ¹</td><td>20 µg¹</td>

and is added to the growth medium at a concentration of 0.5 ml / L

Gene Purification (TM)

The set includes:

1) 6M sodium iodide

2) concentrated sodium chloride solution, Tris and EDTA to prepare a sodium chloride / ethanol / water wash solution

<img file="CS9101250A3_D0017.tif" />

, .. «» 41 í 'j · ·, *¹, '. ·, ·. J '' ·. '*; .

'Z / •' incl. '' in ·&gt;. '*? *. '' \ '

-20 3) 1.5 ml milk glass ampoule containing 1.25 ml silica matrix suspension in water

This DNA purification technique is based on the method described by Voge-te-teihen and Gil-lešpi, published in Proceedings of the National Academy of Sciences, USA (1979). , roč. 76, p. 615.

However, any other method described in Molecular Cloning - and Laboratory Manual Second Edition, Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory, 1989) may be used.

Random Label Kit - Pharmacia Product No. 27-9250

The procedure is described in Molecular Cloning and Laboratory Manual Second Edition, Sambrook, Fritsch and Maniatis, pages 10.13-10.17 (Published by Cold Spring Harbor Laboratory, 1989).

Sequence (TM)

Chemically modified T7 DNA polymerase The modification is based on the procedure described by Tábor a

Richardson, published in Proceedings of the National Academy of Sciences, USA, (1987), Vol. 84, pp. 4767-4771

- 21 Τ4 DNA ligase

Described in Molecular Cloning - a Laboratory Manual Second Edition, Sambrook,. Fritsch. and Maniatis 5.60-5.64 (published by Cold Spring Harbor Laboratory 1989) and in an article by Weiss B. et al.

J. Biol. Chem., Vol. 243, p. 4543 (1968)

...... The following examples. they are given only in the form^-Images. ' -

Example 1

Preparation [Ser^17,27] of human G-CSF

The steps of a) and b), referred to in Example 1, were repeated with the following modifications:

The oligonucleotides of SEQ ID Nos. 24, 25, 26 and 27 (which are further defined) replace SEQ ID Nos 1, 2, 3, and 4 (which are further defined below).

c) Cloning of the [Ser^17,27] human G-CSF into an expression vector

The gene described above (see Fig. 3 and SEQ ID No. 49) was cloned into the plasmid vector pICI0020. This vector is derived from plasmid pAT153, in which the 651 bp EcoRI-AccI region is replaced by a 167 bp EcoRI-ClaI fragment (SEQ ID No. 47) consisting of:

1) a synthetic E.coli trp promoter and a leader sequence for the trp binding site on the ribosome

<img file="CS9101250A3_D0018.tif" />

<img file="CS9101250A3_D0019.tif" />

.,·&gt; ..

ΐ ^ Χ ·. '. · · * ·

-; Λ1 α '&lt;- - 2) xtranslationto initiation codon sv.- ^; · · : · · .······.

3) multiple restriction enzyme recognition sequences deviated from M13mpl8, containing the mixes for KpnI, BamH-I, SalI, PstI, SphI and HindIII.

4) synthetic transcription termination sequences

The DNA sequence of this region is shown in Figure 1.

The expression vector pICI0020 was for subsequent replenishment.

Λ digested with KpnI (BCL) in 10 mM Tris-HCl (pH 7.5), 10 mM magnesium chloride. The DNA was precipitated with ethanol at -20 ° C from a solution containing 0.3M sodium acetate and the 3'-cohesive ends were removed after treatment with T4 DNA polymerase for 10 minutes at 37 ° C in the following reaction mixture:

DNA (µg) in water (16μ1) 10X T4 polymerase buffer (2μ1)

0.3M Tris-acetate pH 7.9 0.1M magnesium acetate

0.66M potassium acetate 5mM dithiothreitol 1mg / ml bovine serum albumin (BSA PENTAX fraction V) 2mM dNTP mix (ΐμΐ)

T4 DNA polymerase (Ιμΐ; 2, Units / μΐ BCL) a

Water (80μ1) was added and the mixture was extracted with 100μ1 of phenol / chloroform and then with chloroform (100μ1). The DNA was precipitated with ethanol (250μ1) at -20 ° C after addition of sodium acetate (10μ1) and further digested with SalI (BCL) in 150mM NaCl, 10mM Tris-HCl (pH7.5). The Kpn-blunt vector was purified on a 0.7¾ agarose gel and isolated by% method.

Purification of the gene (trademark) according to the procedure recommended by the manufacturer (BiolOl, USA). 5

The synthetic gene was isolated from pSTP1 vectors as described below. Vectors were digested with Seal and SalI (both * derived from BCL) in 100mM NaCl, 10mM MgCl₂ and 10 mM Tris-HCl - (pH -7.5). The 530-bp fragment was purified from 0.2 to 7% agarose. .

gel and isolated by the trademark purification method according to the &amp; quot; manufacturer-recommended procedure &amp; quot; (Biol01j; -S).

Prior to ligase treatment, a mixture of the Scal-SalI gene fragment (50ng) and the pICI0020 vector fragment (100ng) was in a 2.0.times.multiple solution containing 50mM_T.r.is-HC.L_ (p.H_7_, 10mM);

MgCl₂1mM ATP, 1mM DTT, 5µ w / v PEG 800CtT ^ T4^—DNA ^ Tigase ('2^— 1 unit; (BRL) incubated at 16 ° C for 20 hours. The resulting mixture was?

used to transform the respective cells. E. coli HB101.

The transformed cells were selected by growth on. L-agar containing ampicillin and further tested for the presence of gene 32 by hybridization of labeled colonies. P (SEQ ID No. 24). DNA plasmid was prepared from 6 positively hybridizing · γ colonies, purified by chloride gradient centrifugation | and the sequence was determined by dideoxy sequencing. The i-plasmid containing this gene was designated pICI 1080.

and,

d) Subcloning the expression set of genes,

27 Mar: containing the [Ser '] G-CSF gene, to M13mpl8.

The following subcloning was done to be

-24 provided starting material for the preparation of the G-CSF 'derivatives detailed in Examples 3-8.

The plasmid DNA, derived from pICI1080 (purified by cesium chloride density gradient centrifugation), was digested with Lres &amp; apos; EcoRI &amp; apos; ... manufacturer's instructions. A small EcoRI-SalI fragment containing the trp promoter and the [Ser '] G-CSF gene was isolated from 0.7% agarose gel using the gene purification method (trademark). This fragment was inserted into the M13mp18 vector (DNA supplied by Amersham International) after its previous digestion with EcoRI-SalI (supplied by BCL). The fragments were ligated in 5x BRL buffer using the previously described BRL T4 DNA ligase. The mixture was used to. Transfect the respective E.coli TG1 cells (these cells were selected based on the calcium chloride method described above).

Mandel and Higem (Molecular Cloning-A Laboratory Manual - Maniatis et al., Cold Spring Harbor). Transfected cells were suspended in top layer of TY agar (trypton-yeast agar) containing 2% X-Gal in DMF α.

• · v

200μ1 of the E.coli TG1 cells harvested in logarithmic phase: growth, and the transfected cells were seeded on TY agar plates (containing 8g tryptone, 5g yeast extract, 5g NaCl, 3.75g bactoagar in 500ml sterile H 2 O, plates with TY agar - 8g of Bactotrypton, 5g of yeast extract, 5g of NaCl, 7.5g of bactoagar in 500ml of sterile H₂O). Four white plaques were collected and mixed with 4x 2ml of a 1% suspension of E. coli TG1 cells in TY culture medium (8g tryptone, 5g yeast extract, 5g NaCl in 500ml sterile H).₂O) and allowed to grow for 6 hours. at 37 ° C. The 2 ml portions were then divided into two 0.5 ml and 1.5 ml volumes. The bacterial cells were then centrifuged in Eppendorf microcvens and the supernatants were transferred to sterile microtubes after centrifugation. 0, aliquots. 5ml were frozen on

- 25 ° C-20 ° C and left as phage stock, V5ml aliquots were^_used to prepare single stranded DNA according to the method described in Amersham International M13 sequencing handbook (see below). These DNA samples were further sequenced using the oligonucleotides of SEQ ID NO: 22, SEQ ID NO: 23, and the M13 universal sequencing primer. Reaction. were made according to the manufacturer's instructions with the Sequenase trademark kit. All four clones contained the correct DNA sequence for [Ser¹⁷'²⁷] G-CSF.

Large-scale preparation of single-stranded DNA To prepare single-stranded DNA

-2O0-5G0pg^_DNA7ml was used as described by Amersham International Oligonucleotide Diredted Mutagenesis. Detailed workflow is described below:

PROCEDURE FOR PREPARING ONE-FIBER., DNA: A. Preparation of 1ml phage material (stocks)

1. Pick up a single colony of TG1 E. coli, grown on minimal glucose medium and grow overnight in 10 ml 2x TY medium at 37 ° C, with shaking. Add 10μ1 to 20ml of fresh medium and shake for 3 hours: at 37 ° C.

2. Inoculate 1ml 2x TY media in 10ml sterile culture tubes with ΙΟΟμΙ cultures prepared according to point 1, 3 hours old.

3. Inoculate 1 ml of recombinant plaque culture.

4. Incubate with constant shaking at 37 ° C.

^F ΐ. · - -¹· '' - / ΐ »ΑϊζΑ ^: · Τ, / /? &lt;'' / '

Λ L? i * -S '· * »' -? -, * 'Ή'.

- 26 5. Centrifuge for 5 minutes. at room temperature. Pour the supernatant into a clean tube and leave overnight at room temperature.

-1 ° C. Prepare a overnight culture of TG1E, coli for the next step.

B. Growth of XOOml phage culture.

1. Inoculate 100ml 2x TY media with 1ml TG1 culture and shake until the turbidity absorbance of the culture medium reaches 0.3 at 500nm.

2. Add 1 ml of phage supernatant prepared according to Instructions A (see A5) to 100 ml culture

3. Incubate for 5 hours with shaking at 37 ° C.

4. Centrifuge at 5000g at 4 ° C for 30 min.

5. Transfer the supernatant to a clean tube. Leave the cells for RF DNA preparation.

6. Add 0.2% volume of 20% w / v PEG 6000 in 2.5M NaCl to the supernatant, mix well and allow to stand at 4 ° C for 1 hour.

7. Centrifuge at 5000g at 4 ° C for 20min. Decant the supernatant.

8. Centrifuge at 5000g for 5min. and remove any remaining PEG / dextran.

9. Resuspend the viral pellets in 500μ1 of redistilled water and transfer to a microcentrifuge tube (1.5ml).

10. Centrifuge for 5 minutes, separate the supernatant from the remaining cells and transfer to a clean tube.

11. Add 200μ1 of 20% PEG 12.5M NaCl to the supernatant, mix well and allow to stand at room temperature for 15 minutes.

12. Centrifuge for 5 minutes. and decant the supernatant.

13. Centrifuge for 2 minutes. and carefully remove any residue

PEG / NaCl. '

200 [mu] l of phenol-saturated-10 mM Tris-HCl pK-1, Stir briefly, stand the tube for 15 min. at laboratory

14. Resuspend the viral pellets in 500μ1 redistilled &lt;15. Add 1 mM EDTA

16. Leave the temperature.

17. Centrifuge for 3 minutes.

18. Transfer the supernatant to a clean tube.

_______19. Repeat steps 15-18. _________ _ _

20 May Add 500μ1 of chloroform and extract twice with aqueous ^:—- phase. ---—.-: -: ----: _

21. Add 50μ1 of 3M sodium acetate and pure ethanol line. Stir.

22nd Put in dry ice and ethanol bath for 20min.

23. 15min. centrifuge._

2 ~ 4 ~ y⁼Wash each wash - l^:ml of water-temperature

25. Dry the pellets under vacuum and dissolve in 50μ1 distilled water.

In this way, 100-200μ9 single stranded DNA can be prepared.

e) Fermentation of pICI 1080 was transformed into E. coli strain cells

MSD 522. Recombinant cells were purified and stored in glycerol at -80 ° C.

A portion of the culture was harvested and inoculated on L-ampicillin agar smear to separate single colonies when grown overnight at 37 ° C. The grown colony, appearing separately on agar broth, was collected and resuspended in 10 ml of L-ampicillin soil and ΙΟΟμΙ were immediately inoculated into 10 250 ml Errenmayer flasks containing 75 ml of L-ampicillin culture medium. After 16 hours growth at. At 37 ° C on a reciprocating shaker, the contents of the flasks combined were used as an inoculum for a fermenter containing 201 µl of culture medium.

The composition of the culture medium LCM50 dissolved in distilled water g / i

<td>kh₂after₄</td><td> 3,0</td>

<td>On₂HPO₄</td><td> 6, 0</td>

<td>NaCl</td><td> 0,5</td>

<td>casein hydrolyzate (Oxoid L41)</td><td> 2, 0</td>

<td>(nh₄)₂^with°₄</td><td> 10,0</td>

<td>yeast extract (Difco)</td><td> 10, 0</td>

<td>glycerol</td><td> 35,0</td>

<td>L-leucine</td><td> 2,5</td>

<td>L-threonine</td><td> 0,9</td>

<td>MgSO4 .7H₂O</td><td> 0,5 ·</td>

<td>CaCl₂.2H₂O</td><td> 0, 03</td>

<td>thiamine</td><td> 0,008</td>

<td>FeSO4 / citric acid</td><td> 0,94/0,02</td>

<td>trace element solution (TES)</td><td>0,5ml *</td>

Fermentations were carried out at 37 ° C and pH 6.7. The pH was controlled and automatically controlled by the addition of 6M sodium hydroxide. The oxygen partial pressure (dOT) was set at 50% air. saturation and was initially controlled by automatically increasing the speed of the fermenter stirrer. Flow

- 29 29

The air was initially 201 / min, which corresponds to a flow rate of 1 volume of air per volume of media per minute (WM), and was increased to a flow rate of 501 / min (2.5 WM) as the stirrer speed was approaching 80-90¾ of its maximum. Whereas the oxygen transfer rate (OTR) in fermenters was not able to satisfy the oxygen consumption (OUR) of the bacteria at cell density in the medium higher than that

The absorbance is equal to 50- at a wavelength of ~ 5-5Onm^{_ _}for-----.....

described. conditions, was. partial pressure. of oxygen. (dOT) at^: fewer cells to a value corresponding to 50¾ air saturation. This was achieved by culturing cells whose density corresponded to value

Absorbance 50 at a wavelength of 550nm in medium, with a limited amount of carbon monoxide, with subsequent addition of a trace amount of carbon source together with ammonium sulfate and yeast extract in an amount limiting the rate of growth of the bacteria.

Fermentations lasted 16 hours, during which time samples were taken for measurement - turbidity absorbance at wavelength. 550 nm, cell dry matter and the amount of G-CSF in the cells.

. The amount of formation of G-CSF was monitored by SDS-PAGE of whole cell lysates by electrophoresis after staining with Coomassie blue gels.

At a time when the turbidity absorbance at a wavelength of 550nm reached 25. a solution was added to the fermenter

1 casein hydrolyzate (100g / L Oxoid 4141) at 1.5g / L per hour. * When the absorbance at 550 nm reached * approximately. .50, the carbon source was depleted resulting in a rapid increase in the oxygen partial pressure (dOT) from 50¾ air saturation. At this point they were into the media saw ·. I · · i i i

Ť.

-^tr

/.-·

'with.

. added, glycerol (470g / l), yeast extract (113g).

^r &lt;1 ^-+ '' ',. -. ·&gt;. 4 (an-X ammonium sulfur (118g / l) at a rate that caused both and a return to the retention of dOT at 50¾ relative saturation, with stirring reaching approximately 80¾ maximum After 13-14 hours, the additions were repeated. Only glycerol (715 g / l) and ammonium sulfate 143g / l were added to the medium. The rate of addition of casein hydrolyzate was maintained. at 1.5g / l / h. After approximately 16 hours, when the presence of a large number of inclusion particles was detected microscopically in most cells, the cells were centrifuged in a Sorval RC3B centrifuge (7000g, 30min., 4 ° C) and frozen at -80 ° C.

f) Purification

Frozen cells (500g) were resuspended at 50mM

Tris-HCl buffer, 25 mM EDTA, pH 8.0 (51 liters) at 4 ° C at 50 ° C.

Silverson model AXR. Lysis of the cells in suspension was performed in a Manton-Gaulin homogenizer at 6000psi by three times pushing the suspension. A centrifugation of 30 minutes followed. at 5000g on a Šorvall RC3C centrifuge with a H6000A rotor. The supernatant was decanted after centrifugation and the pellet was frozen before further purification to -20 ° C.

60-100g of the pellets were resuspended in a solution of 1¾ w / v deoxycholic acid (sodium salt) in 5mM EDTA, with 5mM dithiothreitol, 50mM Tris-HCl, pH 9.0 (1200ml) containing 1mg / ml sodium azide, in a homogenizer The suspension was stirred for 30 minutes at room temperature and centrifuged at 6500g for 30 minutes in a Sorvall RC 5C centrifuge with a GSA rotor. The supernatant was again j&gt; 1 &amp;

·· SSøW · * · '?? * - · ** · * · · &lt;- ·. X,.,

?. · .V $ Í * V £ íJ. \

?&lt;

· .... . with

- ·. ··. The pellets were removed and the pellets were treated in the same way. twice &lt;.2 $

With the stated method. Next, the pellets were resuspended twice; in water and centrifuged at 15000g 20min. The resulting precipitates containing the inclusion particles were further solubilized at 2¾. (w) in N-lauroylsarcosine sodium in 50 mM Tris-HCl buffer pH 8.0 (150 ml). with 1mg / ml azide. sodium. Sodium sulphate was added to a final concentration of 20μΜ and the mixture

......- was · then-- centrifuged- at — 30000g -30min; —to — centrifuge-i-more - —§

Sorvall RC5C; SS34 rotor. The supernatant containing the desired diluent was added to the fryer at 5 ° C.

aliquots.

The solubilized derivative (20ml) was thawed and -filtered-filtered through -filter-s-pore-o-size-5-µm.₇—And — by — out — to — remove all solid particles. The filtrate was applied to a 5x90cm column (Ultrogel AcA54) equilibrated

0.3¾ w / v N-lauroylsarcosine (sodium salt) in Tris-HCl buffer at a concentration of 50 mM and pH 8.0 containing. 1mg / ml sodium azide. The whole procedure was. operating at 4 ° C. This was followed by elution with the same buffer at a flow rate of 2.5 ml / min. The eluate. was collected in 10ml_;fractions. Fractions containing the derivative were pooled (approximately 100ml) and stored at 4 ° C. Fractions with the desired derivative, eluting from several columns, were pooled and dialyzed against ΙΟπΜ phosphate buffer with 150 mM sodium chloride pH7,4 (3-51) containing 1mg / ml sodium azide in an Amicon CH2A-1S diafiltration device equipped with a S1Y10 membrane (s 10kD). The retentate was centrifuged at 30000g for 30min in centrifuge no. Sorvall RC5C with an SS34 rotor and the supernatant after centrifugation was 24h. In dialyzed against water containing 1mg / ml sodium azide.

. Another 72 hour dialysis followed with a 6-fold change in water. The resulting retentate was centrifuged for 30 minutes

<img file="CS9101250A3_D0020.tif" />

By centrifugation at 30,000g and frozen at -20 ° C, ending with 1mg / ral protein, or subjected to freeze-sublimation. '

<img file="CS9101250A3_D0021.tif" />

aci

The N-lauroyl sarcosine concentration decreased below dia. dialysis against water concentration of this. the substance has fallen below the limit determined by the rpHPLC method (0.0001¾).

Example 2

Preparation [Ser^17,27human G-CSF

The procedure described in Example 1 was repeated with the following exceptions:

Double helix I was phosphorylated with T4 polynucleotide kinase and digested with Mstil (10un.) In 1x H buffer (BCL, 30μ1) for 2h. at 37 ° C.

After ethanol precipitation,. the 143 bp 'EcoRI-MstII fragment was further purified in 10' polyacrylamide. gel containing 7M urea and eluted by electroelution from the gel matrix. The DNA strands were joined as described in reference to Example 1.

The synthetic EcoRI-MstII fragment described above was cloned into the plasmid vector pAG88, which is described in reference to Example 1. For the preparation of the vector pAG88, it was most necessary to digest it (10 µg) with Mstil (20 one, BCL) in 1x H buffer (ΐΟΟμΙ) for 2 hours at 37 ° C. DNA was ethanol precipitated from 0.3 M sodium acetate at -20 ° C and further digested with EcoRI (20 units) in 1x H buffer (BCCCL, 100μ1) for 2 hours. at 37 ° C. After the following ethanol precipitation, the large EcoRI-MstII fragment was:

- 33? first purified on a 1¾ agarose gel and then using i *

7- - methods of purification^- gene 7 (trademark) as described in d. manufacturer (Bio 101, USA). Colonies were screened for the content of the synthetic fragment by radiolabeling:

the sequence prepared from the oligoriucleotide (SEQ ID NO. 24) and the desired sequence was. The plasmid containing the gene for [Ser_G-CSF__byl. marked. as; .pI.C.11.1.0.7 ...__ G.en_b.y_l.clone_in_ _____ - ______ 1 into the expression vector pICI0020, fermentation and purification &lt;

7 —-- white cine — was — for the woman and - - after the —p-step described —v --- 5

Example 1. '

Example 3

Preparation [Arg^{* 11 * * * * *} Ser¹⁷'²⁷'^60,65] of human G-CSF

The procedure described in reference to Example 2 was repeated with mutation^- template M13mpl8 containing. gen pro

27 Mar: [Ser.] G-CSF described in Examples 1 or 2. The mutant oilgonucleotides used were designated as SEQ ID No. 28 and SEQ ID No. 29 (as described below).

The ACG triplet of SEQ ID NO: 28 serves to convert GIn at position to Arg, the first and last AGA triplets in SEQ ID NO: 29 encode Pro conversion at positions 65 and 60 to Ser. Mutagenesis was performed as described in reference to Example 2 using SEQ ID NO: 29 as a mutagenic primer. Separate plaque was obtained that contained Pro 60 Ser and Pro 65 Ser changes. Single stranded DNA was prepared from this material according to the procedure described in reference to Example 2. This DNA was used as a template for single mutagenesis,

34 V using SEQ ID NO: 28 as a mutation primer. This procedure resulted in a plaque yield of &amp; gt; 100. The DNA was screened for DNA (1) by sequencing so that. as previously described. All changes were fully incorporated. The double-helix RE DNA was prepared from one of the large scale (single step) DNA preparation steps (step d of Example 1) to step B5. RE DNA was extracted from bacterial pellets by alkaline lysis according to Birnboim and Doly (Nucleic Acids Research (1979) 7, 1513-1523) and purified by density gradient centrifugation, cesium chloride as described in Sambrook's Molecular Cloning-a Laboratory Manual,

Fritsch and Maniatise (Cold Spring Barbor Publication). Purified RF DNA was digested with EcoRI and SalI in buffer H, as previously described, and a small fragment containing the trp promoter, ribosome binding site, translation initiation codon, and [Arg gene].¹¹, Ser¹?' ⁶g-CSF was isolated from 0.7% agarose gel using the Gene Purification (TM) method.

The fragment was ligated with T4 DNA ligase (BRL) in the appropriate buffer on pICI0020. vector, cleavable by restriction enzymes

EcoRI-SalI, using 2; 1 molar. an excess of the insert, relative to the vector; essentially as previously described. The ligation mixture was used to transform E.coli strain HB1O1 cells. Transformed cells were selected by growth to

L-agar plates containing 50µg / ml ampicillin. The colonies were then screened with insert DNA by the restriction analysis method prepared by the method of Birnboim and Doly as described in the Molecular Cloning and Laboratoy Manual of Sambrook. Fritsche. And Maniatise (Cold Spring Harbor Publication). The colony-derived DNA plasmid containing the expected 619bp EcoRI-SalI insert was used to transform the strain MSD522 E.coli and the vector pICI1239.

for the presence of plasmid DNA, rl. "; Vx _in· * * -Jj, c^-'' * ,.X »• t '·, .'- - · · i ···. ·; '· *, ^; 4S: r ·' - 'f · ^' ί *. '&lt;. * Λ' rC ... τ '»» x · · .. &lt;j. :

—

<img file="CS9101250A3_D0022.tif" />

. Fermentations and purifications were carried out as described in Example 1 above.

- ,. ·. r

Example 4

Preparation [Ser^{17,27,115,116}, Glu¹¹¹] of human G-CSF

Method; described in Example 3 was repeated using the mutagenic template M13mpl8 containing the [Ser ') G-CSF gene described in Example 1 or 2. The mutagenic oligonucleotide used is designated SEQ ID 30 (further defined below).^{* 17}

The GCT triplet introduces a Thr change at position 116 to Ser, an AGA triplet introduces a Thr change at position 115 to Ser, and a TTC triplet changes Ala at position 111 to Glu. The mutagenesis procedure is essentially described in Example 3, expression genes. was converted to. The expression plasmid that yielded pICI. 1243. Fermentation and purification were performed as described in Example 1.

Example 5

Preparation of [Arg @ +, Ser @ +⁷' ²⁷, Lys., - Arg¹^] human G-CSF

The procedure described in Example 3 was repeated using the mutagenic template M13mpl8 containing the gene for

27 Mar: [Ser. /. ] G-CSF described. in Examples 1 or 2. The oligonucleotides used for mutagenesis were designated as SEQ ID NO: 28, SEQ ID NO: 31 and SEQ ID NO: 32.

<img file="CS9101250A3_D0023.tif" />

“-V '. The '' if • 2 'Triplet' in SEQ ID NO: 31 introduces a change in Trp vj 'f.^T’^with Position 58 of Lys and a second GCG triplet of SEQ ID NO: 32 provides a change in Tyr at position 165 to Arg. The prim double priming mutation experiment was first performed using two

.... mu.tagenni.ch_pr.iměrú. SEQ ID NO.31 and SEQ ID NO.32, ..... as described in reference to Example 2. This procedure provides plaques, both containing a change in SEQ ID NO.32 ( TYR J.

165 after Arg), but do not contain a change in SEQ ID No. 31.

Single-stranded DNA was prepared from one of the plaques as described in Example 1. This DNA was used as a template, in another double priming mutagenesis of the use of SEQ.

SEQ ID NO: 28 and SEQ ID NO: 31 as mutagenic primers. This procedure yielded 2 plaques, one of which fully incorporated the incorporated changes. The expression set of genes was converted to an expression plasmid that yielded pICI 1246. Fermentations and purifications were performed as described in Example 1.

.Example 6

Preparation [Glu ^^, Ser ^ '²Ala, Ala²Lys (R) human G-CSF.

a) The procedure described in Example 3 was repeated using the mutagenic template M13mpl8 containing the gene for

27 Mar: [Ser '] G-CSF described in Examples 1 or 2. The oligonucleotides used for mutagenesis were designated as SEQ ID NO: 33 and SEQ ID NO: 34.

The TTC triplet of SEQ ID NO: 33 provides a Leu change at position 15 on Glu. In SEQ ID No. 34, the first TTT triplet introduces an Ala change at position 30 after Lys, and AGC triplets provide Gly changes at positions 28 and 26 to Ala. The mutagenesis process was carried out essentially as described in reference to

<img file="CS9101250A3_D0024.tif" />

.in·. .

Example-2. (as a double priraing procedure) and expressive y '.' The set of "genes" was transformed into an expression plasmid that gave pICI 1266. The fermentation was performed as described in Example 1.

b) Purification

The frozen cells were lysed. and crude fractions -: - pe 1 et- by lys - with eprocessed - in the same — way “j'euve * derT7v“

Example-1. The inclusion particles present in the pellets and containing the desired protein were solubilized in a buffer prepared from sodium deoxycholic acid as described in Example 1, and then used to isolate the protein.^: usTeůuJTc í^—modTf iko i todal

Crude pellet fractions (60-100g) were thawed and resuspended in 25mM EDTA, 50mM Tris-HCl, pH 8.0 (1200ml) in a Polytron homogenizer with a PTA 20 probe at a speed set to 5. The suspension was stirred for 30min. at room temperature and centrifuged at 6500xg for 30 minutes in a Sorvall RC5C centrifuge using a GSA rotor. After pelleting the supernatant, the pellets were processed twice more in the same manner as above. Further, the pellets were resuspended twice in water (1 liter) and centrifuged as described in Example 1. The following purification was also performed in the same manner as in Example 1.

W v ^;;

ČSŠt $. &gt;). ·&gt; '/. '? AND; ·.

<img file="CS9101250A3_D0025.tif" />

)

'.fy'. *. · * t ^ '+'&gt; j **&gt; * ·; ? · *

<img file="CS9101250A3_D0026.tif" />

'' In '·· *'

- 38_t&gt; - * 'jťTÍÍ ^' '&lt;Í &lt;! ··&gt;; ·&gt; ^ ΐ;,;^:. -^:4

\.

.; IT'S!

Example 7

Preparation [Ser^17,27, Lys^49,58, Ala^44,51,55] of human G-CSF

The procedure described in Example 3 was "repeated". using the mutagenic template -M13mpl8, which contained the 1727 [Ser ') G-CSF gene described in Examples 1 or 2.

The oligonucleotides used for mutagenesis are referred to as

SEQ ID No.35 and SEQ ID No.36 (as discussed later).

In SEQ ID No. 35, the AGC triplet introduces a Gly change at position 51 after Ala and at position 44 Pro for Ala, and the TTT triplet provides a Leu change at position 49 after Lys. In the sequence SEQ ID

The TTT triplet provides a change in Trp y position 58 for Lys and the second AGC triplet introduces at position 55 Ala instead of Gly.

Mutagenesis was performed as a double priming experiment described in reference to Example 2. This procedure resulted in 16 plaques. Eight plaques were screened by sequencing

The DNAs described in Example 3. All plaques contained changes in SEQ ID NO.36 (Gly 55 Ala, Trp 58 Lys), but none contained the altered SEQ ID NO 35, as above. Single stranded DNA was prepared from one of the plaques as described in Example 1 (d) and was used as a template for mutagenesis in single priming mutagenesis using SEQ ID 35 as primer. 50 plaques were obtained, 3 of which were tested by DNA sequencing, 2 containing all changes. The expression set of genes was converted to an expression plasmid that gave pICI 1297. Fermentations and purifications were performed according to Example 1.

<img file="CS9101250A3_D0027.tif" />

<img file="CS9101250A3_D0028.tif" />

• · ? *'?'· ·,' ^τ “Example 8 '' ............... '' '' '' Preparation [Arg¹¹, Glu¹⁵, Ser¹⁷'²⁷'^{60 * * * *}'⁶⁵, Ala²⁶'²⁸, Lys³⁰]

I $

, -A fo) -'ί

j. * fel

- —KB

M 'of human G-CSF

The procedure of Example 3 was repeated with template 1r 1797 9 6 9S

M13mpl8, containing the gene for [Gln¹ "Ser", "Ala", qa

Lys of human GtCSF ,. ... which ... is ... po.ps.án __ in _Example_ad. . The oligonucleotide used for mutagenesis is shown in SEQ ID NO: 28, which provides for a change in the Gin at position 14 after the Arg. The modified gene was isolated and ligated to the pICI0020 vector (Ex. .l). This vector was further used to transform the E.coli strain MSD522 as shown in Example 3 and designated as PICI1347. The plasmid DNA (5 µg) was incubated at 37 ° C for 2 hours in ΙΟΟμΙ BCL buffer with high concentration, salt. (50 mM Tris-HCl pH7.5, 10 mM MgCl 2, 100 mM Na 2, 1 mM dithioerythritol) containing BamHI (40 U) and SalI (50 U). The DNA was precipitated by the addition of 3M sodium acetate (10μ1) and pure ethanol (250μ1), cooled to -20 ° C for 2 hours, collected by centrifugation (10min, 10,000 rpm), dried under vacuum and dissolved in 10μ1 water. To the sample were added 2μ1 buffer of 240 mM Tris-acetate pH7.8,

6mM EDTA, 20¾ sucrose, 0.2¾ xylene cyanol and .0.2¾ bromophenol blue and the mixture was applied to a 0.7¾ agarose preparative gel (in Tris-acetate pH7.8 and 1mM EDTA) containing ethidium bromide (0.5pg / ml) ) and subjected to electrophoresis at 100 volts for 1 hour. The large BamHI-SalI fragment of the vector was isolated from a 0.7¾ agarose gel by the gene purification method (trademark). Similarly, plasmid pICI1239, from Example 3, was isolated and further digested with i

<img file="CS9101250A3_D0029.tif" />

- 40 enzymes BámHI. and Sáli. A small BamHI-SalI fragment containing_t .codones for. Ser at positions 60 and 65 was isolated and ligated into the large BamHI-SalI vector fragment described above.

The mixture was used to transform cells of strain MSD522 E.coli a. The coating agent was designated as "pI.CI 1.34.8. Fermenta.ce", and_:, pur if.ika.ee, proceeded as described in Example 6.

Example 9

The procedure of Examples 1 and 2 was repeated using TG1 E. coli strain cells in fermentation (see Example 1e) instead^:strains of MSD 522 E. coli.

Example 10

Alternative extraction procedure, human [Met ¹, Arg¹¹/ _Seri7,27,60,65_]G._CSF

Frozen cells (640g) were resuspended at 4 ° C in 50mM Tris-HCl, 5mM EDTA, 5mM dithiothreitol, 2M urea, pH 8.0 (5L) containing 1mg / ml sodium azide in a Polytron-s homogenizer. · PTA20 probe at 7/8 rpm. Cells in suspension were lysed by triple punching in Manton-Gaulin Lab · 60 60/60 homogenizer at 6000psi and washed with 1 liter buffer. Cooling was performed in a Conair cooler at -20 ° C. The lysed cells were further centrifuged at 5000xg for 30 min. in centrifuge zn.Sorvall RC3C with rotor H6000A.

. After decanting the supernatant. the pellets (about 450g) were resuspended in the same buffer (10 liters) described above.

<img file="CS9101250A3_D0030.tif" />

<img file="CS9101250A3_D0031.tif" />

- 41. After stirring for 30 minutes at room temperature, the suspension was centrifuged for 30 minutes. at 5000 rpm on a Sorvall RC3C centrifuge with a H6000A rotor. The supernetant was again decanted and the pellets were treated twice in the same manner as described above. Next, the pellets were suspended twice in water (10 liters) and centrifuged for 30 minutes. at 5000 rpm. The thus treated pellets containing washed inclusion particles were resuspended in Tris-HCl buffer pH 8.0 (1L) with 2% w / v sodium salt of N-lauroylsarcosine containing 1mg / ml sodium azide in a Polytron homogenizer at a speed set to A solution of 20mM sodium sulfate in water (1.5ml) was added and the mixture was stirred at room temperature overnight. This was followed by centrifugation at ==== l'.0.0.0.0.o.fc / mi-n7 = 3 0mi-n = na = from: s -t-ed-iv-ce = S o tv-ad.4 = RG SG = s = GSA^::

<img file="CS9101250A3_D0032.tif" />

rotor.

The supernatant containing the desired derivative was filtered through a 5μπι filter to remove any impurities and solid particles, and further diluted 6 times with 50 mM Tris-HCl; buffer pH8.0 containing 1mg / ml sodium azide (at 4 ° C). Diafiltration was also performed on an Amicon DC20 ultrafiltration apparatus equipped with a 10kD 10 S10Y10 filter at maximum pressure against a solution containing 10 mM sodium phosphate, 150 mM sodium chloride pH 7.4 (90 liters) with 1 mg / ml sodium azide. At the end of the diafiltration a precipitate formed.

«

Retentate. (total protein content of 2.1mg / ml, product content of 1.7mg / ml) was collected in polypropylene screw cap closures of 41 and incubated overnight at 37 ° C. The resulting precipitate was removed by centrifugation at 5000 rpm for 45 min on a Sorvall centrifuge

- 42 Oct

<img file="CS9101250A3_D0033.tif" />

* '-i7¾ ..' 7-¾¾3νϊ, /;: '=:' i-ν 'zJ.,' -. ./íj. V -. ---- ..-. .

'.' ; '_' 2. J &lt;.fc- £ V 4. ·. /, ».. ·· ...

•^:The XXRC3CXa C supernatant was stored at 4 ° C.

By SDS-PAGE and rpHPLC, it was shown that during the final procedure involving exposure to higher temperature,^:contaminating E. coli proteins, oligomeric products and degradation products were selectively precipitated, with some of the 'desired product' of which 85% remained in solution. The highly enriched, purified product solution after heat treatment was fully biologically active and stable at 20mg / ml at 37 ° C for more than two weeks without any indication of the possibility of proteolytic degradation. During this time, less than 20% of the product precipitated. This gave an excellent intermediate for further chromatographic purification.

Example 11.

Characterization of G-CSF and its derivatives - 1 17

A solution of [Met, Ser] G-CSF and its derivatives in water (Examples 1-9) (conc. Protein Img / ml) was concentrated to 11mg / ml protein using an Amicon YM10 membrane at 4 ° C. In order to prevent any possible precipitation during concentration, the pH of the starting solution was adjusted from the value. pH 5.5 to 8.5 by addition of ammonium hydroxide to a final concentration of 0.25 mM. After concentration, the pH was lowered to about 8.0.

The protein concentration in the concentrated protein solution (derivatives) was adjusted to 10mg / ml protein by adding 20x concentrated phosphate buffer.

- 43 'τ-k-ý' »/ *.,. Concentrated solution of the derivative in 10 mM sodium phosphate, 15 mM sodium chloride, pH 7.4 (PBS) provided a common stock solution for which the homogeneity, identity, biological activity and stability of the protein in solution was determined.

A stock solution of human G-CSF in PBS (basic phosphate buffer) at a concentration of 1mg / ml, described in reference to Example 1, was also prepared.

PAGE-SDS (SDS polyacrylamide gel electrophoresis) under reducing and non-reducing conditions, and rpHPLC (reverse phase HPLC), it was shown that each protein is at least 95% single protein (component). Repeated analysis of zam-in.ok-ys.e.-1·l.no = composition = po = k-yse-l = hysteresis-6N-HCl · pfr 110 ° C gave data on the amount of amino acids in each derivative, as well as the exact protein concentration in the stock solution. This protein concentration, using bioanalytical titration results obtained over at least six days, was used to determine the specific activity of the derivative. N-terminal sequence analysis and electron mass spectrometric analysis of selected derivatives yielded the expected sequences and their molecular weights.

Example 12

Preparation (Arg¹¹, Ser¹⁷'²⁷'⁶⁰'⁶⁵] of human G-CSF using a production vector including the trp promoter.

a) Plasmid pICX1239 (shown in Example 3) was digested with EcoRI and SalI in H buffer as previously described. Small fragment

'' · £ '· &lt;·. '•' • r ··; » &gt; - * ··. '' AjfJr-jtfc '· · J * · ύ' ij · * '.? ·'¹ /- .)-:· '·'&lt;·-·- *-

Λ4ΙΡ. ·. ·· '-.

- 44 EcoRI-Sáli

... .

containing the trp promoter, ribosome binding site and gene pro [Árg¹¹, Ser^17,27'⁶⁰'⁶⁵Human G-CSF] was isolated from a 0.7 / agarose gel by Gene Purification (TM). The vector fragment was prepared from plasmid pICI 0080 (see Example 6), digested with EcoRI and X-buffer, and the large EcoRI-XhoI fragment was isolated from a 0.7 ° agarose gel by the gene purification method. (trade mark). The small EcoRI-SalI fragment was ligated into the EcoRI-XhoI vector fragment using a 2: 1 molar excess insert over the vector as previously described, and the ligation mixture was then used to transform E.coli MSD 522 cells. cells were selected by growth on L-agar plates containing tetracycline (15 µg / ml). Three colonies were picked and grown in minimal medium M9 (75ml) containing the appropriate ingredients and tetracycline (15µg / ml) for 20 hours at 37 ° C on a shaker. Protein accumulation was monitored by evaluating the results after SDS-PAGE when the gel was stained with Coomassie blue. Whole cell lysates were used for SDS-PAGE. All three clones contained .17, 27, 60, 65 expressed [Arg¹¹, Seř^AND'\'^/O^'^OJ] 'human G-CSF,

The DNA of one of the colonies was designated pICI1327, and the promoter and gene were verified by standard dideoxy sequencing as previously described.

Plasmid sequence method

b) Fermentation

Plasmid piCI 1237 was transformed into E. coli MSD 522 cells and the resulting recombinant cells were purified and maintained in glycerol at -80 ° C.

A portion of the culture was removed from the stock mixture and spread onto tetracycline-containing agar plates to cross over.⁴

<img file="CS9101250A3_D0034.tif" />

L ?? S_P^Řand·. ? 7 ??. X.^ri. | Growth..oneQtl.yy.ch_colony. After growth, a separately grown colony was taken, resuspended in 10 ml of tetracycline culture medium and ΙΟΟμΙΟΟ was immediately used to inoculate 3 Erlenmayer flasks (250 ml) containing 75 ml of tetracycline culture medium. After

The 16-hour growth on a shaker at 37 ° C was used to inoculate the fermentor,

containing 201 [deg.] C.^-media

Composition of culture medium

9/1

KH₂AFTER₄ 3,0 ^On2^HPO4 6,0

NaCl 0.5 casein hydrolyzate (Oxoid L41) 2.0 '(nh₄)₂Sat₄. 10.0 yeast extract (Difco) 10.0 glycerol 35.0

L-leucine 0.625

MgSO₄.7H₂O 0,5

CaCl₂.2H₂0.03 thiamine 0.008

FeSO4 / citric acid 0.04 / 0.02 trace element solution (TES) 0.5ml 1^_1 tetracycline. ..... iQmg l ”¹ dissolved in distilled water

• “. '•“ Z- · #' · *&gt; * Λ »Τ

-·.

.;'in. * '· ££' »·. · '··· ...

- 46 ..,; r n &lt;· ',_in,.; , '. . 'and

The fermentations were carried out at a temperature of 37 ° C and a pH of 6.7, which were? ; / '.' * - 'i^τ1,11 ·. ' - '.Ή. ': Ϊ^J . 1 \ '' was it auomatics: regulated-additions? solutions of 6M sodium hydroxide. The oxygen partial pressure (dOT) was set at 50% air: saturation and was initially automatically re-adjusted by adjusting the stirrer speed. The air flow rate was initially 201 / min, which corresponds to a flow rate of 1 volume of air based on the volume of medium per minute (WH) '; and was increased to 501 / min (2.5 WM) when the stirrer speed reached 80-90% of its maximum. Since the oxygen transfer rate (OTR) in the fermenters was unable to satisfy the oxygen uptake of the bacteria, at a cell density in the medium higher than jet, which corresponds to an absorbance of 50 at a wavelength of 550nm under the conditions described,

Λ oxygen transfer rate (dOT) in the fermenter at higher cell densities, maintained at 50% air saturation. This . the effect was achieved by culturing cells whose density in the medium was 50 turbidity absorbance, measured at 550nm, in a limited carbon source medium, followed by the addition of a trace amount of carbon source along with ammonium sulphate and yeast extract velocity limiting bacterial growth.

Fermentations were performed for 18 hours, samples were taken during cultivation, turbidity absorbance at 550nm, cell dry weight and amount were measured [Arg¹¹, Ser^17,27,60,65] ”Of human G-CSF within cells. Quantity [Arg¹¹, Ser^17,27/Human G-CSF was monitored after staining of Coomassie Blue gels after SDS-FAGE (SDS-polyacrylamide gel electrophoresis), which was performed with whole cell lysates of bacterial samples.

<img file="CS9101250A3_D0035.tif" />

<img file="CS9101250A3_D0036.tif" />

<img file="CS9101250A3_D0037.tif" />

_____ at the instant when the turbidity of the wavelength at wavelength

550nm reached 35 (8.5h) was⁷ a solution of the casein hydrolyzate (100g / L Oxoid L41) is added to the fermenter in an amount. 0.75g / l per hour.

During cultivation, when the turbidity absorbance at a wavelength of 550nm reached approximately 50, the carbon source was depleted resulting in a rapid increase in the oxygen partial pressure. (dOT) of 50% air saturation. At this point, glycerol (470g / l), yeast extract (118g / l) and ammonium sulphate (118g / l) were added to the medium to cause the dOT to return to 50% air saturation while stirring, reaching approximately '

17-0 = 80% -max-i-ma-R-ych-losi-addition-hydrol-yzate = casine - still maintained at 0.75g / l / h. After about 18 hours, when the presence of a large number of inclusion bodies was microscopically identified. particles in most; cells, the bacterial cells were centrifuged on a Sorval RC3B centrifuge at 7000xg, 30min and 4 ° C and frozen at -80 ° C.

c) Purification

Purification was performed as described in the Example

Example 13

<img file="CS9101250A3_D0038.tif" />

] of human G-CSF using a production vector including the T7A3 mBO * 'promoter ·

<img file="CS9101250A3_D0039.tif" />

· '' 4. -4 - / -: · ί, ',, * * γ ζ ^ ΑιΒ- · ,.' '^ - #' W

-.48.

a): fFragment ^ E1&gt; /1 / Sal1 containing T7A3. promoter, and the leader⁷·¹ the ribosome binding site and the '[Ser'] gene of human G-CSF was cloned into plasmid M13 mpl8 as described in. The sequence of the EcoRI-SalI fragment is shown in SEQ ID NO: 50 and shown in FIG. 3, '

SEQ ID NO 50 contains an EcoRI restriction site (nucleotides

1-6), a sequence for the A3 promoter of bacteriophage T7 (nucleotides .7-52), a leader sequence for the trp binding site on the ribosome (nucleotides 53-78), and a translation initiation codon (nucleotides 17 27).

79-81). Giant. 3 depicts the nucleotide sequence of [Ser '] human G-CSF that ends at the SalI restriction site. It will be appreciated that the 3 'terminal ATG codon of SEQ ID No. 50 &amp; lt; 1 &amp; gt; immediately follows the ACT codon that encodes the threonine &amp; lt; 3. It follows that the 5 'nucleotide sequence of AATTCAGT is not present in the EcoRI-SalI fragment. The EcoRI-SalI fragment can also be prepared by splicing from plasmid pICI 1295 (see reference to Example 7). Point mutagenesis was performed on single stranded DNA as described in reference to Example 2, using the oligonucleotides SEQ. ID No. 28 to change the codon for Gin at position 11 to. codon for Arg. Double stranded RF DNA was prepared from plaque that contained a Gln change¹¹ Arg¹¹as described in the Example

3, with the exception of step B3, incubation was performed for 3 hours instead

For 5 hours, the DNA was digested with EcoRI (as previously described) and SnaBI (as described in reference to Example 5). The resulting 144 bp EcoRI-SnaBI fragment containing the T7A3 promoter, a leader sequence for the trp ribosome binding site, and an Arg gene fragment¹¹ the codon was isolated and ligated with the EcoRI-SnaBI vector cleaved from pICI 1327 (which contained the codons for Ser⁶⁰ and Ser⁶⁵ and is described in the Example

12. The ligation mixture was used to transform E.coli cells of strain MSD522, the transformed cells were selected by growing i,

IN·:

·. íX^F- ·. ' . 4 v.-Λ · »¹ λΆ

?...

<img file="CS9101250A3_D0040.tif" />

<img file="CS9101250A3_D0041.tif" />

ί- ·. .in. · ',, · ·

<img file="CS9101250A3_D0042.tif" />

, /»· '

<img file="CS9101250A3_D0043.tif" />

dishes containing tetracycline (15 g / ml). Colony-derived DNA plasmid containing the putative T7A3 promoter and gene sequence [Arg], Ser¹⁷'²⁷'⁶⁰'⁶⁵] human. G-CSF, were identified by DNA sequencing of the isolated plasmid and designated as 1386 fodder.

The fermentation was carried out on the basis of two alternative processes (b) and (c), see below.¹¹- “prT” 37⁰C and after 16 hours of fermentation as mentioned, 35g / l of microbial biomass and the amount of [ArgU, Ser @ 2 +] produced were recovered.⁷'^27,human G-CSF was determined to be 7g / L culture medium. Process c) was carried out at a temperature of -30 ° C and a fermentation in accordance with the use of a culture temperature, proceeding more slowly. In this culture labeled c), after 35 hours, 55g / l of microbial biomass was obtained and yield [Arg¹¹, Ser¹⁷'²⁷'⁶⁰'⁶⁵] of human G-CSF was 15g / L culture broth.

(b) strain E.coli CGSC 6300 (genotype F, λ, lac₊), obtained from E. coli Genetic Stock Center ,. was transformed with plasmid pICI 1386. The resulting strain CGSC 6300 (pICX 1386) was purified and stored in glycerol at -80 ° C. A portion of the culture was removed from the stock and plated onto L-tetracycline-containing agar plates so that single colonies could be isolated after growth (about 16 hours at 37 ° C overnight).

The separately grown colony was harvested and resuspended in 10 ml of L-tetracycline-containing culture medium and immediately thereafter, ΙΟΟμΙ of this solution was used to inoculate each of the twenty Erlenmeyer flasks (250 ml) containing 75 ml of growth medium ss-5. ': ”

'' Z ^ Ý - /, - '?

· ^ Ύ.'Ι A &lt;· ·

- 50 tfkfc.

-7-77, .7.-. ' .L-tetracycline.

Mon ./. 167 hour growth at

37 ° C to^ř7shaker; - the contents of all flasks were combined and used to inoculate &lt;-&gt; i *^: '. A fermenter containing 20 liters of modified culture medium LCM50. is shown in Table 1.

Culture Media Composition LCM50 iTABLE 1: Culture Media Composition

Modified culture medium LCM50 (A) substances are dissolved in distilled water g / l

<td>kh₂after₄</td><td> 3,0</td>

<td>On₂HPO₄</td><td> 6,0’</td>

<td>NaCl</td><td> 0,5</td>

<td>casin hydrolyzate (Oxoid Lal)</td><td> 2,0.</td>

<td>(nh₄)₂^withO₄ ··.·/..-</td><td> 10,0</td>

<td>yeast extract (Difco)</td><td> 20,0</td>

<td>glycerol</td><td> 35, 0</td>

<td>MgSO₄.7H₂O</td><td> 0,5</td>

<td>CaCl₂-2H₂O</td><td> 0,03</td>

<td>thiamine</td><td> 0, 008-</td>

<td>FeS0₄/kys.citrónová</td><td> 0,04/0, 02</td>

<td>Trace Element Solution (TES)</td><td>(0.5ml / l)</td>

<td>Tetracycline</td><td>(10mg / 1)</td>

<img file="CS9101250A3_D0044.tif" />

τ? α ·.

• i, * A 'fc. * '-.' 'i- £ Γ..3Λ' .. · '. Fermentation. - at a temperature of -37¾ and - at pH 6, 7, .............

^ lů ^ B ^ which^:. was automatically controlled by the addition of 6M sodium hydroxide solution. The oxygen partial pressure (dOT) was stabilized.

to 50% air saturation and was initially regulated automatically by adjusting the stirrer speed. The air flow rate was initially 201 / min, which corresponds to a flow rate of 1 volume of air per minute (WM) and was manually increased to 451 / min when the stirrer speed reached its maximum (1000 rpm). Fermentation was carried out for 16 ____ hours and during this time samples were taken for measuring the turbidity absorbance of the culture (Οϋ ^^ θ). biomass concentration, total microbial protein concentration, and amount of accumulated [Arg¹¹, Ser¹⁷'²⁷'^60/65] human. G-CSF in ____________ ~ -yt₌₌₌₌₌^₌^^ ak₁-t_e.rTÍ.áíní.eh ^^ = cells ^ = Quantity == ak-umu^;-l^:and^:ee^£=[^ofA-rg ^ Ser¹⁷'^27/The human G-CSF was monitored after staining of Coomassie blue gels after SDS-PAGE electrophoresis, which was performed with whole lysates of bacteria * samples. how was it? described',,. The total microbial protein content * was determined by the Lowry method, and the yeast extract solution (225g / l) was added to the fermenter 4.5 hours after the start of inoculation at a rate of 1.7g / l / h.

When he was in; Growth medium depleted carbon source (glycerol), dOT rapidly decreased from 50% air saturation. At this stage nutrients containing glycerol (714 g / l) and ammonium sulfate (143 g / l) were added. Since the oxygen consumption rate (OUR) has reached the maximum oxygen consumption rate in the fermenter (OTR), just before the source has been depleted^ŤCarbon, nutrients were added to the fementor in an amount that affected bacterial growth to an extent that the oxygen consumption rate (OUR) was approximately 80-90% of the maximum oxygen consumption rate in the fermenter (OTR). The nutrient addition rate was manually adjusted to the original a

<img file="CS9101250A3_D0045.tif" />

and;

íí '/

. '/ • j

- &lt;V ·&gt; -. '··; 52

7-h · ^? Cl · '• ·'ί'. -r -. ». ^ -V&gt; t

<img file="CS9101250A3_D0046.tif" />

(The number was maintained dOT at a maximum of 50¾ aeration under the conditions described above.). ^; .

C) The fermentation process described in (B) was repeated, but at a temperature of 30 ° C for a period of 35 hours. Except for the melting temperature, 30 ° C, the medium and fermentation conditions were the same as in (b). ...

d) Purification was performed as described in Example 1 (f). - '

-S, j

Example 14

Preparation [Glu¹⁵, Ser¹⁷'²⁷, Ala²⁶'²⁸, Arg³⁰] hu G-CSF '· · ϊ?! &lt;

The mutagenic template, M13mpl8, containing the gene for [Glu, Ser, Ala ', Lys] hu G-CSF, was prepared as described in (d) of Example 1, where plasmid pICI1266 was replaced with pICI1080. The procedure described in Example 3 was repeated using the above-mentioned mutagenic oligonucleotide template designated SEQ ID NO: 37. This changed the codon for Lys at position 30 to the codon for Arg. Double helical RF DNA was prepared from one phage containing the desired changes. The EcoRI-SalI gene expression set was isolated and cloned into pICI 0080 as described in Example 12 to obtain pICI 1343.

Further procedure to obtain the title compound was carried out as described in Example 6.

Vii '· V ν. -i · .. * - ·.^ry '· ·. - Ρ¹ &gt; - .·'

<img file="CS9101250A3_D0047.tif" />

2 “ø -, í b?

, Α Example. 15______ ________ ________J____________________i

Preparation [Arg¹¹'²³, Ser^{17,27/ 60, 65}] of human G-CSF '1

Γί

S * i

<td>Mutagenic template, M13mpl8,</td><td>containing</td><td>gene</td><td>for</td><td></td>

<td>[Arg¹¹, Ser¹⁷'²⁷'⁶⁰'⁶³hu hu G-CSF was</td><td>prepared</td><td>how</td><td>was</td><td>WITH;</td>

<td>described in (d) of Example 1, p</td><td>plasmid</td><td>pICI</td><td> 1239</td><td></td>

<td colspan="3">replaced by pICI 1080, The procedure described in Example 3</td><td>was</td><td> £</td>

- repeated use of the above template with mutagenic no

-----------------------— — - -...........................—·’ ...............'—............................-- -----------^:-^;-7 an oligonucleotide named SEQ ID NO. This procedure caused ii¹ the codon change for Lys at position 23, after the codon for Arg.

Double helix RF DNA was prepared from one phage, $

I * ^ / · containing the desired change and the expression set of genes was irsirsirs;;; l;_rp-cl-1-4 -, - r-my .............. - was obtained pICI 1388. ·. . £

Another procedure used to obtain the title compound i;

and its purification was carried out as described in &lt;

Example. 1. *. .¹ AND

Example 16 j

Preparation [Arg^11,34, Ser^17,27/60'⁶⁵] human G-CSF is &lt;

The procedure described in Example 15 was repeated with the oligonucleotide designated SEQ ID NO: 38 replaced by SEQ_r, |

ID No. 39 (this serves to change the codon for Lys, at position 34, za per codon for Arg), resulting in pICI 1389. _Ř r

Next. The procedure for obtaining the title compound and its purification was carried out as described in 4. ·⁷"·. ·" 'Íržr · .- "- ;?' ; '

II¹. ί · ϊ · Λ. ' »''¹ . ¹ ^ μΓ.ϊ ··· ^ =. λ ./,· * ŤV, '/?_ir ,?&gt;. '· *&gt;' '♦ * 3 ·.: ?. -7 · &lt;'.' . ^ ϊΐίτ'- ', *. *&gt; ♦ · / KKJp · - · &lt;. · Ζ · ί &lt;\

Examples. 1.

Example 17 · ·

Preparation [Arg^11,40, Ser^{17,27, 6θ}'⁶⁵] of human G-CSF

The procedure described in Example 15 was repeated ^: with the oligonucleotide of SEQ ID NO: 38, replaced by the oliginucleotide of SEQ ID NO: 40 (this serves to replace the codon for Lys at position 40 with the codon for Arg) to give pICI 1390.

Another procedure used to obtain the title compound¹and purification thereof was performed as described in Example 1.

Example 18

Preparation [Ala¹, Thr³, Tyr⁴, Arg⁵'^1X, Ser¹⁷'²⁷' ⁶⁰' ⁶⁵ j. . human G-CSF

The procedure described in Example 15 was repeated with the oligonucleotide of SEQ ID NO: 38, replaced by the oligonucleotide of SEQ ID NO: 41 (this serves to change the codons for Thr, Leu, Gly and Pro at positions 1,3,4 and 5 after the codons for Ala, Thr, Tyr and Arg to give pICI 1391.

The polypeptide of this example demonstrates that a modification of the present invention can be applied to polypeptides known to have G-CSF activity to increase the stability of the polypeptide solution. The known polypeptide is

<img file="CS9101250A3_D0048.tif" />

cc

<img file="CS9101250A3_D0049.tif" />

• ύ '.

What. Ltd.

Another procedure to obtain the title compound and purify it was carried out as described in Example 1.

Example 19

Preparation [Arg¹¹, Ser^17,27] of human G-CSF

Posztup., - - - - - - - - - - Repeated by - with the oligonucleotide SEQ ID NO: 30, replaced SEQ ID NO: 28 (this serves to change the codon for Gln at position 11 to the codon for Arg). Set of genes; was transferred to the expression plasmid pICI: 0080₇instead of pICI ... 0020 as it was. described in Example 14, to form. pICI 1405.

Another procedure to obtain the title compound and purify it was carried out as described in Example 1.

ι I.

Example 20

Preparation- [Ser

17,27,60,65] human G-CSF

<img file="CS9101250A3_D0050.tif" />

oligonucleotide of SEQ ID NO: 28 replaced by oligonucleotide of SEQ ID NO: 29 (this serves to change the codon for Pro at positions 60 and 65.).

'.íV? * · *. «Ii,« ýr'.FSM.7i

<img file="CS9101250A3_D0051.tif" />

&lt;

-,.·,. . . \ .^-¾ _r(xza codons for Ser), resulting in pICI 1400.

; '3' '·' ·; -. ·, '. '' · - - - - - ''. -&gt;. ~ '' '. - Further procedure to obtain the title substance. Example and its purification was carried out as described

Example 21

Preparation [Arg¹¹, Ser^17,27'⁶⁰] of human G-CSF

The procedure described in Example 6 was repeated with the oligonucleotides of SEQ ID NO: 33 and SEQ ID NO: 34 replaced by the oligonucleotides SEQ ID NO: 28 and SEQ ID NO: 42. These serve to change the codon for Gin at position 11 and for Pro at position 60 after Arg respectively. Ser. The expression set of genes was transferred to the expression plasmid pICI 0080 instead of pICI 0020, generating pICI 1401.

Another procedure to obtain the title compound and purify it was carried out as described in Example 1.

Example 22

Preparation [Arg¹¹, Ser¹⁷'²⁷'⁶⁵] of human G-CSF

The procedure described in Example 3 was repeated with the oligonucleotide designated as SEQ ID NO: 29, replaced by SEQ ID NO: 43 (this serves to change the codon for Pro at position 65 to the proSer codon) to give pICI 1418.

<img file="CS9101250A3_D0052.tif" />

In the next example and in the Example, the procedure for obtaining the title compound of its purification was performed as described

i.,. / ·· .; '' f. ·· · '

Example 23

Preparation [Ser.^{17, 27, 60}] human G-CSF _

The procedure described in Example 19 was repeated with the oligonucleotide designated SEQ ID NO: 28. replaced by the oligonucleotide of SEQ ID NO 42 (this serves to change the codon for

--For — in — position — 6_Q.-,₌na — kO.don = pr.o = S: er- g = za — v-z-kk-u = pT-CI- = ^ 1-4'f&gt;^:2=^=

Another procedure to obtain the title compound and purify it was carried out as described in Example 1.

Example 24

Preparation [Ser^17,27,65] of human G-CSF

The procedure of Example 4 was repeated with the oligonucleotide designated SEQ ID NO: 30, replaced by the oligonucleotide SEQ ID NO: 43 (this serves to change the codon for Pro at position 65, to the codon for Ser) to give pICI 1420.

Another procedure to obtain the title compound and purify it was carried out as described in Example 1.

. · ..? ·. : - ·. i'.i ', - ·· Ϊ' ·· »»

<img file="CS9101250A3_D0053.tif" />

si 3 'Iv: * A · W' · 'Íí¹ · Ί

4? * &lt;/ - * \% · J?

Λ &lt;

- / X ^ &lt;^ '

- 58 '\ χ .v- ·· ^?andí 'w •&gt;' lU &lt;ί · '«

- «%, ··. · - XOX '-:

* 2 ί ”'V * ·· F i:; * ·'“ '.iF'¹ '* Λ $ ίτ &gt;&gt; 2ϊ $$ *: Τ · ·

- . · · . ;

Example 25, 26.28 _T 30 Ala, Lys of human G-CSF

Plasmid 1348, described in Example 8, was digested with XbaI in buffer M and then SalI in buffer H, and then a large vector fragment of XbaI-SalI was isolated from a 0.7% agarose gel as previously described. The plasmid pICI 1243 described in Example 4 was digested with XbaI and SalI as described above, and a small XbaI-SalI fragment was isolated from 0.7% agarose.^?gel and further ligated with the XbaI-SalI vector fragment mentioned above. The ligation mixture was used to transform E. coli MSD 522 cells and transformed cells were selected by growth on L-agar plates containing ampicillin (50 µg / ml). Three colonies were tested for protein expression as described in Example 12, but with the difference that tetracycline was replaced with ampicillin (50 µg / ml). The plasmid DNA from the colony expressing the desired protein was designated as pICI 1421.

Further procedure to obtain the title compound was performed as described in Example 3 and its purification was performed as described in Example 6.

Example 26

Preparation [Arg^11/165, Glu¹⁵, Ser^{17, 27}'⁶⁰' ⁶⁵, Glu²⁶'²⁸,

Lys^30,58] of human G-CSF

/ * S ^:^ «^ ΓΛ ··? ΗΐύΕ '· .IK

*. *. ··. * / 'Λ.

'λ ·' - Λ Λ ·. · *

I ii ·. ··? - · *** '·&gt; ·'. , I * · ύ '^' ύ ^., · '* ·;

'Viíí?⁴'* / ... *. M^Jrow, -,¹ .. J *, &amp;. ' _F ~ ‘ '·

Mutagenic Membrane, M13mp18, containing a ger 'for [Arg¹¹, Glu¹⁵, Ser^{17/ 27,60/ 65}, Ala^{26, 28}, Lys³⁰1 H G-CSF, was prepared as described in (d) of Example 1 with plasmid pICI 1348 (described in Example 8), replaced with pICI 1080. The procedure described in Example 3 was repeated using the above template with mutagenic oligonucleotides labeled as SEQ ID No. 28 and SEQ ID No. 29, replaced by oligonucleotides. SEQ ID No.44 and SEQ ID No 32 (these serve to change the codons for Trp at position 53, after the codon for Lys, and the codon for Tyr at position 165, after the codon for 'Arg), to give pICI 1422.

= ± ===== al-a-axis-up-using-x-jumper-1-y-F = 4-mentioned = 13e = 3-phase:

As an example, it was carried out as described in Example 3 and its purification was carried out as described in Example 6.

Example 27

Preparation [Arg¹¹, Glu¹⁵Ser Lys^30,49'⁵⁸] of human G-CSF

17.27, 60.65 t

_Ala26,28, 44,51,55,

The mutagenic template was prepared as described in Example 26. The procedure described in Example 4 was repeated using the above template with the mutagenic oligonucleotide designated as SEQ ID No. 30, replaced by SEQ ID No. 45 (this serves to change the codons for the Pro position. 44, Leu at position 49 and Gly at positions 51 and 55, after Ala, Lys, Ala and Ala), to give pICT 1423.

Another procedure to obtain the title compound $ 1 $

$ £

$ $

and

In t '/ A

5¾ $

ti three · £

I b

I $

!£

I $

<img file="CS9101250A3_D0054.tif" />

- 60 example, ^Fwas performed as described in Example 3 and its purification was performed as described in Example 6.

Example 28

Preparation [Arg¹¹'¹⁶⁵^26,28,44,55, _Lys_Glú15, III_{f Ser}17.27.60, 115.15, 30.49.58j _human g-CSF

The mutagenic template was prepared as described in (d) of Example 1 with lung 1080 replaced by pICI 1423 described in Example 27. The preparation method of Example 3 was repeated using the above template and the oligonucleotide designated SEQ ID NO: 28 and SEQ. ID NO.29, replaced by SEQ ID NO 32 and SEQ ID NO 30, to prepare pICI 1424.

Further procedure to obtain the title compound was carried out as described in Example 3 and the purification was carried out as described in Example 6.

Reference to Example 1

Preparation of human G-CSF

a) Preparation of a synthetic gene for human G-CSF

The DNA sequence (Figure 2) encoding the amino acid sequence of the polypeptide of Figure 2 (human G-CSF) was designed according to the following requirements:

j) and i

!

Ϊ i:

i íí ΐ

?.

Á: ίί

Z · '-'5' jefi '.____'.

; .

'W.; f' ''^!. ·· *. «And« (·? - ^. \. · I

FJ tí f / ř &amp;

* R * -r₄ ^ ”Λ ·»? »/ '/') Ϊ (~ _ J®dppfibers_/._which permits_ligation

·. .. ·.&gt; ··· .:, '.. -. ·. suitable plasmid sites^Ř ;; Ť ·? *, '¹' ^,:

2) Many sites in the restriction endonuclease gene, pro; facilitating subsequent genetic manipulation.

3) Translation of the stop codon.

4) Codons at the 5 'end of the coding region, selected to have a lot of A / T. Other codons, selected by their ability

......... expression preference in Έ. "...........

The gene was composed of 18 nucleotides designated as SEQ ID No. 1 - SEQ ID No. 18 as previously described.

....... —-Prpr-ava-oligonucleotides ............- ~ .................

The oligonucleotide sequence described previously was prepared using an Applied Biosystems 380A DNA synthesizer from a nucleoside-2-cyanoethyl-N, N-diisopropylphosphoramide with a 5'-dimethoxytrityl protected base, with the protected nucleosides bound to a porous glass control carrier of 0. 2 micromoles, according to the methodology reported by Applied Biosystem Inc.

Alternatively, the oligonucleotide sequences can be prepared by the method described by Atkinson and Smith in the Iigonucleotide Synthesis, and Practical Approach (T. T.

Gait, Editor, IRL Press, Oxford, Washington, DC, pages 35-81).

Oligonucleotide sequence preparation was subsequently streamlined using Applied Biosystem 380A DNA

... . a synthesizer; : - .....

Each oligonucleotide, after cleavage from the solid support and &lt;-; ·

<img file="CS9101250A3_D0055.tif" />

&amp;

<img file="CS9101250A3_D0056.tif" />

vV

<img file="CS9101250A3_D0057.tif" />

,\IN;

if

CZK

<img file="CS9101250A3_D0058.tif" />

iiž ,. i; -, -.

OF-, _AND.

i '··' · - ... /. ·· ..7^:·· - ···. .. /·'.--· c. ···· .. ·: / .. &lt;''.-G ..:. \? - ...

η _;ί · .IV. · ..

i: * - r * íí '·

·: 1 'T&gt; - 62 water ..' *. • f

3M

<img file="CS9101250A3_D0059.tif" />

sodium acetate solution (pH 5.6; 40 µl) and ethanol (1 ml) and the mixture was stored. at, -70⁰for 20 hours. The resulting precipitate was centrifuged (13,000 rpm, 10min.) And the pellets washed with ethanol: water (7: 3) (200μ1) and then dried rapidly in vacuum and dissolved in 'water' (15μ1) and in ΙΟμΙ formamide-dye mixture. (10mM NaOH, 0.5mMEDTA, 0.01¾ bromophenol blue, 0.01¾ xylene cyanol, 80¾ formamide).

The oligonucleotides were purified on a 10¾ polyacrylamide gel in 50 mM Tris-borate (pH 8.3) containing 8.3 M urea.

Oligonucleotides of the desired length were identified by UV in radiation (Narang et al., 1979 in Methods in Enzymology, Vol.

68,. 90-98). The most desirable band was excised from the gel, electroeluted in 5 mM Tris-borate (pH 8.3) at 300 mV for 3-4 hours. The aqueous solutions were concentrated to 200µl with n-butanol (stir, vortex and remove the upper organic layer). The promoted nucleotides were precipitated at. -70 ° C for 20 hours in 3M sodium acetate solution, by addition; ethanol (2.5 volumes).

Gene assembly

Oligonucleotides SEQ ID No. 2-SEQ ID No. 17 (400 µM each) [as previously defined] were phosphorylated with T4 polynucleotide kinase (3.6 units), for 2 hours, at 37 ° C in a 25μ1 solution containing ATP (800 pM containing 25 pM γ³²Ρ ATP), · 100 μΜ spermidine, 20 mM MgCl 2, 50 mM Tris-HCl (pH 9.0) and 0.1 mM EDTA. The solutions were heated

<img file="CS9101250A3_D0060.tif" />

· · · ·

·;· ^ί '~ ί-

<img file="CS9101250A3_D0061.tif" />

The mixture was stirred at 100 ° C for 5 minutes to complete the reaction, as the steam was mixed as it is. shown in Table I, to form double helices (duplexes) from A to I. Oligonucleotides SEQ ID NO

SEQ ID No. 18 (400 mM in 25μ1) were used non-phosphorylated. Next, a 0.3M acetate solution was added. sodium * (pH 5.6, 200μ1) and ethanol (850μ1) and the duplexes were precipitated at -20 ° C for 20 hours. The resulting precipitates were collected by centrifugation and washed with ethanol-water (7: 3) and then dissolved in water (50µl). in bath with boiling water. The bath was then slowly cooled. 40 ° C (about 4 hours). Solutions containing 3 pairs of double helices. have been joined as shown in Table 1,

The formulations were lyophilized.^-and dissolved in

30μ1 solution containing T4 DNA ligase (1 unit, BRL), 50mM Tris (pH 7.6), 10mM MgCl₂, 5¾ (w / v) .PEG 8000, 1mM ATP, 1mM DT.T. (BRL, Focus, Vol. 8 no 1 Wintér, 1986) and the DNA was ligated at 30 ° C for 5 min. And further 20 hours at 16 ° C. Then 3M sodium acetate solution (20μ1) and water (150μ1) were added and the product was precipitated by the addition of ethanol (750μ1) and cooled to -20 ° C for 20 hours. The precipitate was collected by centrifugation, washed with ethanol (lml), then dissolved in water (15μ1) and formamide / dye mixtures and purified on a 10¾ polyacrylamide gel in 50 mM Trisborate (pH 8.3), 1 mM EDTA and 8.3M urea. Strips corresponding to strands of approximate length (173-186 bases) were identified by autoradiographic method and collectively isolated by electroelution from individual strips of gel as previously described for individual oligonucleotide sequences. DNA strands were joined by first heating the aqueous solution (50μ1) to 10 ° C for 2min. followed by cooling to 40 ° C for 4 hours.

<img file="CS9101250A3_D0062.tif" />

P '

• · '. ••' In ·. ·

-v * d 'VJ. ^ ·, ·.

&gt;&gt; W- · ^ · &lt;'. ♦ ..y ».lM. · 'JMgS' · r '' Ύχρ'-χ-λλ ·· ''₄???¹Groups i; II and ΙΙΪ were linked together as described above, the gene sequence is shown in FIG. After precipitation, the gene was phosphorylated with T4 polynucleotide kinase as previously described for individual oligonucleotides. and then dissolved in water (20μ1).

<td></td><td>TABLE 1</td><td></td><td></td><td></td>

<td>DUPLEX</td><td>OLIGONUKLEOTID</td><td></td><td>NUMBER OF BASES</td><td>in the Chain</td>

<td></td><td></td><td></td><td>VRCHNÍM</td><td>LOWER</td>

<td>AND</td><td>SEQ ID NO: 1 + SEQ ID NO</td><td> . 2</td><td> 62</td><td> 64</td>

<td>(B)</td><td>SEQ ID NO. 3 + SEQ ID NO</td><td> .4</td><td> 60</td><td> 60</td>

<td>C</td><td>SEQ ID NO. 5 + SEQ ID NO</td><td> . 6</td><td> 48</td><td> 51</td>

<td>D</td><td>SEQ ID NO. 7 + SEQ ID NO</td><td> . 8</td><td> 63</td><td> . 60</td>

<td>E</td><td>SEQ ID NO. 9 + SEQ ID NO</td><td> . 10</td><td>⁶³</td><td> 63</td>

<td>F</td><td>SEQ ID NO. 11 + SEQ ID NO</td><td>No 12</td><td> 60</td><td> 63</td>

<td>G</td><td>SEQ ID NO. 13 + SEQ ID NO</td><td>No 14</td><td> 63</td><td>⁶⁰</td>

<td>H '</td><td>SEQ ID NO. 15 + SEQ ID NO</td><td>No 16</td><td> 60</td><td> 60</td>

<td>AND</td><td>SEQ ID NO. 17 + SEQ ID NO</td><td>No 18</td><td> 55</td><td> 53</td>

<td>AND</td><td>A + B + C</td><td></td><td> 170</td><td> 175</td>

<td>II</td><td>D + E + F</td><td></td><td> 186</td><td> 186</td>

<td>III</td><td>G + Η + I</td><td></td><td> 178 </td><td> 173</td>

b) Cloning of the foreign gene for human G-CSF] i

<td>Synthetic. gene</td><td>described above was</td><td>cloned</td><td>to</td>

<td>plasmid vector Research (1983) Vol.</td><td>pSTP1 (Windass et al., 10, p. 6639).</td><td>Nucleic</td><td>Acid</td>

<img file="CS9101250A3_D0063.tif" />

<img file="CS9101250A3_D0064.tif" />

►'Ú ·, '' ** '_? R, preparation, vector-was-lpg-pSTPl dissolved in water'j (37, 5μ1)^: a. 10 x B restriction buffer (4.5μ1) (BCL). Furthermore, it was restriction endonuclease SalI (3μ1) added (BCL, 8 |^J , Λ units / μΐ) and incubated for 1 hour at 37 ° C. §, γ predominated in the mixture linearized plasmid over ξ supercoiled and split circular form of the plasmid. DNA | were precipitated with ethanol at 4 ° C for 3 minutes, washed with the mixture ethanol and water (7: 3) and then dissolved in water (39,5μ1),. 10X H buffer (4, 5μ1) (BCLj). added restriction --- 7- EcoRI endonuclease (2μ1) (BCL, 90 units / μΐ), incubation ·) was carried out for 1 hour at 37 ° C, where a large EcoRI-SalI fragment predominated. The DNA was precipitated at -20 ° C for 20 hours, washed with ethanol: water (7: 3) and then dissolved in water __%. - (: 2ΌμΓ) ---- - · ------- ~

The large EcoRI-SalI fragment was purified to 1% preparative. agarose gel and then electroeluted and;

precipitated as previously described, and finally dissolved in. | water / 20μ1) ,. For ligation of the synthetic gene, it was as follows. / mixed incubated for 4 hours at 16 ° C: DNA vector (2μ1 of EcoRI-SalI fragment), synthetic gene (5μ1 of the aqueous solution previously described), 5X ligase buffer (6μ1-250πι pH Tris pH7,6, |

50mM MgClg 25% W / V PEG 800 (0.5mM DTT exBRL), water (15μ1) and J

T4 DNA ligase (2μ1, 1 U / μΙ). Mixture of DNA (or Ιμΐ modified $ v?

ligation mixture or 2μ1 ligation mixture 5X diluted with water) was used directly to transform the E. coli HB101 strain. Mixture?

eDNA (1 or 2μ1) was added to competent cells of strain /

E. coli HB101 (20 µl, BRL) in ice and the mixture was incubated in an ice bath for 45 min. and then subjected to heat shock at 42 ° C for 45 sec. After an additional 2 min in ice, 100μ1 of SOC buffer (Bactotrypton 2%, yeast extract 0.5%, NaCl 10mM, KCl 2.5mM, MgCl) was / added₂ 10mM, MgSO 4 10mM,

<img file="CS9101250A3_D0065.tif" />

&gt; · Ν *, ίν · · ·

<img file="CS9101250A3_D0066.tif" />

T ^^^^ - globose; 20mMl · "..._ν ... and the mixture was. incubated at. 37 ° C for 1 hour. plated on "L-agar" dishes. 50μ1 / ω1 ampicillin. Transformed cells were transfected into; presence. cloning a synthetic gene using the standard hybridization method described in Molecular Cloning: A Laboratory Manual, Maniatis et al. (Cold Spring Harborj and U.S. Patent Application Ser. 8502605. ' A total of 100 colonies were transferred to filters (Schleicher and Schuell), cultured at 37 ° C for 20 hours, lysed and heated. Hybridization was carried out at 65 ° C for 20 hours, when the filter was in contact with a radioactive assay prepared by labeling the oligonucleotide sequence of SEQ ID No. 1 with a random / label set (Pharmacia). Five colonies, labeled 1-5, which * gave a positive hybridization signal, were cultured in L medium (100ml) at 37 ° C for 20 hours, and then * the DNA plasmid was prepared by cesium chloride density gradient centrifugation as described in Molecular Cloning: A Laboratory Manual Maniatas et al. (Cold Spring Harbor). * jAi

DNA was sequenced by standard method. Sangera et al. described in Why. Nat., Acad. Sci. USA, 74, 5463-5467 (1977), based on chain termination using dideoxy nucleotide derivatives, using the Sequenase (Trade Mark) set (United States Biochemical Corporation). Oligonucleotides from SEQ ID 19 to SEQ ID No. 23 (defined previously, see Table 2) were used as sequencing primer.

Plasmid DNA from clone 5 contains the DNA sequences shown in Figure 2. The plasmid (pAG88) was used to transform competent cells of the following E.coli strain, using a standard procedure:

HB101 '

CGSC 6300 (hereinafter also referred to as MSD 522)

<img file="CS9101250A3_D0067.tif" />

Ϊ

<img file="CS9101250A3_D0068.tif" />

Ί;

μ i

?

AND

Tf

<img file="CS9101250A3_D0069.tif" />

<img file="CS9101250A3_D0070.tif" />

OF

<img file="CS9101250A3_D0071.tif" />

CODE

SEQ ID NO: 19 SEQ ID NO: 20 SEQ_ID: 21 SEQ ID NO: 22 .S.EQ_ID_, _2J_ table-2 τ J .....

LIGHTS OF PRIORITY

214-234 top strand 333-353 top strand 375-395 bottom strand 207-227 bottom strand

69- 93 bottom thread

Strains Ε. coli. HB101 and MSD522. (CGSC. 6300) are freely available. For example, they can be obtained from E. coli Genetic Stock = ββϊΓΐτ * τ⁼^ -3-1% = υη'1 ^ · δ · ίδ^:ί ^ 7 = ϋδΑ^:ΐ = ^ &amp; ^^Σ= Ε ^ · © 14 = ΒΒ-1: 0ί. === πιύ · ζβ = δγ4: = subsequently obtained, for example, from BRL supported by GIBCOO Limited Unit 4, Cowley Dear Trading Estate, Longbridge Wax, Uxbridge, UB8 2ZG, Middlesex, England or GIBCO Laboratories, Life. Technologies. Inc., 3175 Staley Road, Grand Island, NJ 14072, USA. The genotype of strain HB101 is described in the aforementioned Molecular Cloning-A Laboratory Manual as Sup E44 hsd S20 (r_n m_n } rec A 13 ara-14 F leu 6 thi-1 proA2 lac Y1 gal K2 rps L20 xyl 5 mtl 1. The genotype of MSD 522 (CGSC 6300) is shown in Example 13.

c) Cloning of the human G-CSF gene into an expression vector

The gene described above was cloned into plasmid pICI 0020 as described in Example 1 (c) to obtain the expression plasmid pICI 1056.

<img file="CS9101250A3_D0072.tif" />

- 68 Q &lt;, ··

• V ^ / · '·

<img file="CS9101250A3_D0073.tif" />

: d)&gt; iFermentation '

Plasmid pICI 1056 was transformed and fermented as described in Example 1 (e) to obtain human G-CSF. '.....' '

e) Purification

Purification was performed as described in the second purification procedure, allowing to obtain larger amounts of Hu-G-CSF as described on pages 48 and 49 of PCT Patent, Publication No. WO 87/01132, which ends with dialysis against; phosphate buffer 7

Reference to Example 2

I. t

Preparation of genes for human G-CSF derivatives using point mutations.

The phosphothionate method of Eckstein et al. Was used:

Taylor, J.W. et al., Nucleic Acids Research (1985) Vol., p. 8749-8764

Taylor, JW et al., Nucleic Acids Research (1985) Vol., Pp. 8765-8785

Nakamaye, K. et al., Nucleic Acids Research (1986) Vol., Pp. 9679-9698

Sayers, JR et al., Nucleic Acids Research (1988) Vol., Pp. 791-802

<img file="CS9101250A3_D0074.tif" />

^ gišIŠsfiÍsííí? * W^;'7

...... /. ι'ίΛύ **, jjuJ '·. . , '-'9§®'^L £ / · - • C'7 if ....-7 .. '£ ^F

Si * '*' 4 '

e. n ' ¹ r ': · •. ^ The procedure was_If'executed - using - the set provided; &lt;Amersham International. The method is set forth below and includes changes to the original method with respect to the use of more than one mutagenic. oligonucleotide and an incubation temperature for oligonucleotides longer than 30 bases. '

1. Linking the mutant oligonucleotide to the single stranded DNA template: .....

Single stranded DNA template (lpg / μΐ) 5,0μ1 Phosphorylated mutant oligonucleotide (1,6pmol / lgl) 2,5µ1 Buffer 1 3,5μ1 Water · 6, Ομί

When two mutagenic oligonucleotides were used at the same time, 2.5μ1 (1.6ριηο1 / μ1) of each phosphorylated oligonucleotide was added to 5μ1 single stranded DNA template (1pg / gl) in 3.5μ1 buffer 1 and 3.5μ1 water. When. 3 mutagenic oligonucleotides were used, 2.5μ1 (1.6ρπιο1 / μ1) of each phosphorylated oligonucleotide was added to 5μ1 single stranded DNA (1μς / μ1 in buffer 1 and Ιμΐ water). In the case of oligonucleotides shorter than 30 bases, the above components were placed in a sealed tube and heated in a water bath at 70 ° C for 3 minutes. Oligonucleotides longer than 30 bases were immersed in a boiling water bath for 3 minutes. The tubes were then transferred to a 37 ° C water bath for 30 minutes.

KW *. ..

.. .

· Ί &amp; ·· ~ 7 * ·· *;&gt; ··? -i * '· - --i. ·?

&gt; ·^{? 1} ':

. , , .· ,₄ , · ·. ‘._rf -_r ,, r · '' •• iítfti &amp; øèšcv? .....

'.. λ · · * · ”ŮZ? // - ťí-l ·'? '' V- ·.; - · 'No ..

: Λ. ·. . /.,, .. -, &lt;. -.,. ·. : · ·: .U / 7

70 ·· - j-í-r. i * '' .A -J in · *, · ..... - ..._to '' '' '' '·. * Synthesis * and51igators (mutated DNA strands:

DNA strands were pooled in the following MgCl reaction mixture₂ (solution) 5μ1.

Nucleotide 1 ™ 19μ1 (containing dCTP and S) water - 6μ1

Klenow fragment (6 units) - 1.5μ1

T4 DNA ligase (5 units) 2μ1

The above ingredients were left overnight in a 16 ° C water bath.

3. Remove unmutated single stranded DNA using centrifugal filter units

To the reaction mixture mentioned in point 2 was added:

voďá. '' '170μ1 ··. ·'

5M NaCl 30μ1

250μ1 samples were added to the upper half of the filter unit and centrifuged at 1500 rpm for 10min. at room temperature in a SORVALL RT6000B centrifuge using a SORVALL H1000B swing out rotor. The samples pass through two nitrocellulose membranes on which the single stranded DNA is captured and the double stranded DNA is captured in a collection tube after passing through the membrane.

To remove the remaining RF DNA, ΙΟΟμΙ 500mM NaCl was added to the sample and left for 10min.

β? · • ^ ^ íf '

- i

The following ingredients were added to the filtrate: ...........; .........

i 3M sodium acetate (pH 6.0) 28μ1 iced ethanol (-20 ° C) 700μ1

The mixture was left for 20rain. in a dry ice / ethanol bath and then centrifuged in Eppendorf microtubes (15min). The precipitate was resuspended in 10μϊ buffer 2.

i í £ j

b.

$

J

S! 'S | $

<img file="CS9101250A3_D0075.tif" />

4. Cleavage of uninsulated fibers by Nci I.

65μ1 &lt;was added to the reaction mixture mentioned in point 3

Buffer — 3-a^—S = 1 = No = I = (4^:Ni = = Mixture = = was given₌n2! ^ - 9µm_:JK_₌A water bath at 37 ° C

5. Cleavage of unmutated fibers by exonuclease III.

500mM NaCl 12μ1 Buffer 4. 10μ1 exonuclease III (50 units) 2μ1

The mixture was transferred to a 37 ° C water bath and incubated for 30 min., 50 units of exonuclease III decomposed approximately 3000 bases in 30 min. The mixture was then transferred to a 70 ° C water bath for 15 min. to inactivate the enzyme.

6. DNA repolymerization and ligation with gapped

<img file="CS9101250A3_D0076.tif" />

$ í&gt;

if;

l · '·· ^IN.

íj.

and.

J * ř!

IN

<img file="CS9101250A3_D0077.tif" />

<img file="CS9101250A3_D0078.tif" />

<img file="CS9101250A3_D0079.tif" />

<img file="CS9101250A3_D0080.tif" />

To the reaction mixture mentioned in point 5 was added:

Nucleotide Mixture 2 13μ1 MgCl₂(foztok). 'Μ4 T4 DNA liogase- (2.5 units) Ιμϊ r

V r;

ϊ · /

I k

The mixture was transferred to a 16 ° C water bath for 3 hours

7. Transformation of competent E.coli host cells with TG1 DNA

300 µl of freshly prepared cell suspensions of competent: ψ E.coli TG1 cells (prepared by the following Mandel and Hig method) were transformed with 20 µl of the reaction mixture described in step 6 (twice).

Transformed cells in the 'late logarithmic phase' were&gt; Ϊ;

AND?

transferred to TY Top agar and incubated overnight at

Deň: 32 ° C. . , 'ί

The E.coli TG1 strain is freely available eg from the Genetic Stock Center, Yale University, USA and Amersham International plc, Amersham Crying, Little Chalfont, Amersham, Buckinghamshire H07 9NA, England, is a supplier of their in vitro mutagenic system, oligonucleotide set (Code product is RPN 1523).

<img file="CS9101250A3_D0081.tif" />

'ύ' · 'V - r

<img file="CS9101250A3_D0082.tif" />

/ 1¾¾ Reference to Example 3___; 7 (B'Bio-determination of G-CSF

The cell line dependency factor, Paterson-G-CSF (FDCP-G), obtained from the Paterson Institute in Manchester, England, was cloned by limiting dilution in the presence of

-q_-csf .G-CSF sensitive kangaroo, 'ožňá'cěriý' 'as^_Leaf Ε7ζ ~ was used to determine the activity of human recombinant G-CSF. 2.5 x icf³FDCP-Gclone E7 cells, in ΙμΙ RPMI 1640 + 10% FCS, were added to an equal volume of RPMI 1640 + 10% FCS containing G-CSF. Each G-CSF sample was measured twice in more than 10 dilutions. The final volume of RPMI 1640 (see Moore, GE, such as 1775L (; i; 9; 6.?:)., - ^ JAMA_/___ 179797) 7 = 51797), + + 10% ~ FCS ~ (7-rod-te-1-ec-cis) in each well of a microtiter plate (96 wells), was

200μ1. The microtiter plate was incubated at 37 ° C in 5%

WHAT₂ in a humidified incubator, 4 days. 1.0 µCi of thawed thimidine was added to each well and incubated for 6 hours.

Cells were harvested on a glass fiber filter and the level of radioactivity was determined in a scintillator. The level of incorporated tritiated thymidine was found to be proportional to the amount of G-CSF present. The FDCP-G clone E7 assay was calibrated using recombinant human G-CSF, obtained from Amersham International, with a declared specific activity of 10 units / mg protein.

The activity of G-CSF samples was determined by comparison with known standard activity.

Units of G-CSF activity · per ml were calculated according to the following formula:

<img file="CS9101250A3_D0083.tif" />

7 &lt;&gt; ». - &lt;-τΓ'- * '

·. &lt;'W' iii · v ·· ^ evří · γφ &lt;&amp;&amp; · 6 «.»

WITH-"

<td>Xrrt · Š. '«·. ^ Thrives ^ standard¹G-CSF ¥ • «&lt;£ &lt;7 • ί ' &gt; * giving 50% of the highest incrum-</td><td>Sample dilution giving 50% of the highest</td><td> *</td><td>Units / ml activity .. G-CSF.</td>

<td>1 H-thymidine</td><td>growth of inkorpo-</td><td></td><td>standard</td>

<td></td><td>2 of purified H-thymidine</td><td></td><td></td>

Reference to Example 4

Stability of solutions of G-CSF and its derivatives

Appropriate dilutions of the G-CSF stock solution and derivatives in alkaline phosphate buffer (PBS) at 4 ° C described in Example 9 were tested for solution stability. Solutions containing 1mg protein / ml, 5mg protein / ml and sometimes 10mg protein / ral PBS were incubated at 37 ° C for 14 days. The solutions were visually inspected at regular time / intervals for clot formation. After 14 days, each solution was centrifuged at 14,000 rpm for 20 minutes, the supernatant was removed by decantation and the precipitate was redissolved in PBS containing 1% w / v N-lauroyl-sarcosine. The total protein content of each supernatant and redissolved precipitate was determined by measuring the absorbance of the solutions at 280 nm. and the monomer content of each sample was determined by reverse phase chromatography on HPLC. The results were expressed as a percentage of the corresponding data obtained for the solutions at the start of incubation and the 1 mg / ml pro-solution incubated at 4 ° C for 14 days. Differences between total protein and assayed monomer were observed only in some re-dissolved precipitates. The percentages of residual proteins in the superhatant, for each initial concentration, are shown in the Table.

ÍĚ:.:

-3¾¾¾¾ * '

..par ·. · '···' r

- 75 The following results were obtained:

<td></td><td>G-CSF derivatives</td><td colspan="2">Spec.akt. (U / mgx10⁹)</td><td colspan="2">Stability r &lt; (Mg / ml. 1 5</td><td>* and .0</td><td></td>

<td></td><td>[Met^-1hu G-CSF</td><td></td><td> 0,4</td><td> 23</td><td>nd</td><td>nd</td><td></td>

<td></td><td>[Met ¹, Ser¹⁷hu G-CSF</td><td></td><td> 1,0</td><td> 80</td><td> 20</td><td>nd</td><td> · R: -</td>

<td> _</td><td>[Met^-1, Ser^17,27hu G-CSF</td><td></td><td> 1,5</td><td> 80</td><td> 40</td><td>nd</td><td>'Λ</td>

<td></td><td>[Met '¹, Arg¹¹, Ser¹⁷'²⁷'⁶⁰'⁶⁵hu G-CSF</td><td></td><td> 1,2</td><td> 98</td><td> 94</td><td> 92</td><td>-Y · Uý</td>

<td></td><td rowspan="2">[Met ¹, Ser¹ ^ VgIu^{11 1}7S^_'er¹¹⁵'hu G-CSF'</td><td rowspan="2"></td><td></td><td></td><td> ·</td><td></td><td> 5&gt;%</td>

<td></td><td> 2,7</td><td> 100</td><td> 72</td><td> 50</td><td> ;&gt;1</td>

<td></td><td colspan="2">[Meť¹, Ser¹⁷·²⁷, Arg¹¹·¹⁶⁵, Lys⁵⁸hu.G-CSF</td><td> 1,2</td><td> 92</td><td> 77</td><td> 47</td><td>and: Λ</td>

<td></td><td>[Met^-1, Glu¹⁵'Ser^17,27, Ala²⁶'²⁸Lys^J hu G-CSF</td><td>t</td><td> 1,0</td><td> 100</td><td> 100</td><td> 94</td><td>and- and , 9 1 t</td>

<td></td><td>[Met ”¹, Ser^17,27, Lys^49,58, Ala^44,51,55hu G-CSF</td><td></td><td> 1,0</td><td> 84</td><td> 69</td><td> 44</td><td></td>

<td></td><td>[Met ”¹, Arg¹¹, Glu¹⁵, Ser^17,27,80Ala^28,28, Lys³⁰hu G-CSF</td><td>&lt;65 OF</td><td> 2,6</td><td> 100</td><td> 103</td><td> 93</td><td></td>

<td></td><td>[Met ”¹, Glu¹⁵, Ser¹⁷'²⁷, Ala^26,28he Arg-hu G-CSF</td><td>F</td><td> 0,85</td><td> 100</td><td> 100 .</td><td>1G0</td><td> ·.</td>

<td></td><td>[Met^-1, Arg^11,23, Ser^{17, 27, 80, 85}hu G-CSF ''</td><td> ] /</td><td> 2,5</td><td> 100</td><td> 98</td><td> 88</td><td></td>

<img file="CS9101250A3_D0084.tif" />

From the sequel:

, G-CSF derivatives

Spec. act. Year stability (U / mgx10⁹) ·. (mg / ml)

10

1,4 105

1,3 108

1,5 106

0.500 [Met \ Arg¹¹'³⁴, Ser¹⁷' ^{27/ 60/65}] hu G-CSF [Met¹, Arg¹¹'⁴⁰, Ser¹⁷'²⁷'⁶⁰'⁵⁵] .

hu G-CSF [Met^-1, Ala¹, Thr³, Tyr⁴, Arg⁵'¹¹,

Ser¹⁷'²⁷'⁶⁰'⁶⁵] hu G-CSF [Met¹, Arg¹¹, Glu¹⁵'¹¹¹, Ser¹⁷'²⁷'⁶⁰'^{65 115}'¹¹⁶, Ala²⁶'²⁸, Lys^3O] hu G-CSF [Met ']¹, Arg¹¹'¹⁶⁵, Glu¹⁵, Ser¹⁷'²⁷'⁶⁰'⁶⁵, Ala²⁶'²⁸, Lys³⁰'⁵⁸] hu G-CSF¹, Arg¹¹, Glu¹⁵, Ser¹⁷'²⁷'⁶⁰'⁶⁵,. Ala²⁶'²⁸44, 51, 55, &amp; lt; 30,49.58} hu G-CSF [Met^-1, Arg¹¹'¹⁶⁵, Glu^{15 / U1},

Ser¹⁷'²⁷'⁶⁰'⁶⁵'¹¹⁵'¹¹⁶Ala26, 28.44, 51.55,_Lys30, 49, 58, and G-CSF

0,65 100

100

100

100

100

0,20 100 100

100

100.

0.05 100 100 100 percent determined in PBS solution after 14 days at 37 ° C (determined by UV, possibly by HPLC) nd = not determined [Met, Ser] hu G-CSF can be obtained as described in References to Example 5 .

&gt; 1 ti '

<img file="CS9101250A3_D0085.tif" />

*. * ?? Product specific activity; in each of the supernatant of the phyphyphyl incubation is the same as the activity in the initial solution by incubation, and no differences in PAGE-SD: reducing and non-reducing conditions were observed.

The above results show that modifi; c of the present invention improve solution stability without loss of G-CSF activity, [Met^-1, Ser¹⁷G-CSF at a concentration of 5mg / ml begins to “precipitate” within 3 hours.

Reference to Example. 5^=::^ Preparation ~ [~ SeT¹⁷The procedure described in Example 2 for the preparation of [Met^-1, Ser^17,27] hu G-CSF was repeated with the following exceptions:

1) Double helical DNA for phosphorylation was prepared from the oligonucleotide sequences of SEQ ID Nos. 24, 25, 3 and 4, wherein SEQ ID Nos. 3 and 4 may be replaced by the sequences of SEQ ID Nos. 26 and 27 used in Examples 1 and 2.

2) The double-stranded DNA described in (1) was phosphorylated with T4 polynucleotide kinase but was digested with SnaBI. (10 units) in 1 x M buffer (BCL, 30μ1) at 37 ° C for 2 hours.

3) Ethanol purification was followed, with the 72 bp EcoRI-SnaBI fragment purified instead of the 143 bp EcoRI-MstII fragment. .

in,.--.'

-**-;

iTtf x - '. Vv - ·' - ;. ·····&gt; -, ·

- 78 ;_r/ L. f ΐϊ._ΓΑ, ·

V., «F -^to_r f, -.-.

^ό ^ τ ^⁴- / · '*' -y /

<img file="CS9101250A3_D0086.tif" />

, 4). A synthetic EcoRI-SnaBI fragment was cloned into the plasmid vector pAG88 as described in reference to

Example 1 and to prepare the vector, pAG88 was digested with SnaBI (20 units, BCL) in 1 x M buffer (BCL, ΙΟΟμΙ) at 37 ° C for 2 hours instead of Mstil in 1 x H buffer.

5) Ethanol precipitation followed by a large EcoRI-SnaBI fragment purified on a 1% agarose gel instead of a large EcoRX-MstII fragment.

Ϊ7

6) The plasmid containing the [Ser] hu G-CSF gene was designated pICI 1105.

Reference to Example 6

Construction of pICI 0080

a) Construction of pTB357 (also referred to as pLB 004)

Plasmid pTB357 utilizes a repressed factor determining resistance to tetracycline. This factor is found on plasmid RP4, which occurs in nature. This repression system stops expression of the tetA gene in the absence of tetracycline, unlike most drug resistance mechanisms that have constitutive expression. . ..

The tet locus was first mapped to RP4 by Barth and Grinter (J. Mol.Biol. 113, 455-474, 1977). It was found to consist of adjacent genes: tetA, structural resistance gene and tetR, repressor gene and this region was

<img file="CS9101250A3_D0087.tif" />

1 - /. / .., .......................................... sequenced (Klock et al., J. Bacilliol., 161, 32: 1985). These genes are located on the neighboring fragrir · BglII-Smal and Smal-Snmal. RP4 has a single site for BglII, has five sites for cleavage of SmaI (Lanka, Lurz and Furste, Plas: 10, 303-307, 1983).

?·

i) Cloning of the tetA + tetR gene

Plasmid RP4 is well described (Datta et al., J. Bacteriol., 108, 1244, 1971) and is freely available. Further, plasmid RP4 is stored in the National Collection of Type

Gu-lt-ur-es-, 6-1-Colindale-Avenue., _ London, NW9 5HT under numbers.

50078 and 50437. E. coli strains containing^-puppies²they were grown on selective culture media and plasmid DNA was isolated on a larger scale according to the method of Holmes and Quigley (Holmes and Quigley, Anal. Biochem. 114, 193-197, 1981). It was deproteinized with 2.5 M ammonium acetate and reprecipitated with isopropanol. This plasmid; ·· .., · '· -. ·' '.' . *.

The DNA was treated with BglII restriction endonuclease following the manufacturer's recommendations. Further, it was partially cleaved to Xmal using a diluted enzyme and a short incubation time. XmaI is the SmaI isoschizomer that produces 4-nucleotide cohesive termini at the cleavage site.

! t, ·

The vector plasmid pUC8 (Yanisch-Perron, Vieira and Messing, Gene, 33, 103-119, 1985) was prepared in a similar manner, the final form was obtained by digestion with BamHI and XmaI. RP4 fragments were cloned into this vector by ligation with T4 ligase at. 12 ° C for 16 hours. The recombinant vector was used to transform competent calcium chloride-treated E. coli C600 cells (Maniatis et al., Cold Spring with .alpha. @. @ .Alpha. @ .Alpha.). . '»Í &lt;V -Λ · Υ · 7 y λ

Q 'f? ''. '. fr-yy. ·; &lt;... '

ΛΚ ·. '

ΤΓΛ »- # ·. &lt;'T^r^. (Harbor Laboratory, 1982). The cell cultures were then plated -W 'on medium selective for tetracycline resistance.

^AND The E.coli C600 is freely available from many of the following: including several collections of microorganisms such as r.

...... 'Genetic Stock' Ceňtré, Yálé UnioveršityPUSA under number no.

3004. The genotype of E.coli C600 is K12 thr-1 leuB6 thi-1h, 11 lacYl tonA21 A^_cyne44. Several colonies with this resistance have been tested for the putative phenotype (ampicillin and tetracycline resistance, but not kanamycin resistance, which is inherent to RP4 alone). Colonies with correct resistance were subjected to; isolated plasmid DNA 'cloning analysis (Holmes and Quigley). These preparations were digested with EcoRI and HindIII and analyzed by goal electrophoresis. The size of the cloned inserts was determined to be 2.45 kb, indicating a BglII-Xmal-Xmal fragment from RP4. The clone carrying this fragment containing the tetA and tetR genes was designated pTB344.

ii) Removal of the tet gene from pAT153

It was necessary to remove the tet gene from the vector plasmid pAT153, before inserting the tetA + tetR gene set from RP4 into the predominant gene duplication that could be a source of genetic instability. Thus, the tet gene cannot be effectively suppressed by not related etR. Removal was performed by isolating the pAT153 plasmid DNA and digesting it with EcoRI and Aval. A synthetic oligonucleotide of SEQ ID NO: 59 was cloned between these sites:

<img file="CS9101250A3_D0088.tif" />

SSesw &amp; er · '··'¹· -., 4 / Λ

-ί - '..' ··· .- Τ * '- .. -.

/ Λί'τ · - -. .

&amp;

$ &lt;

ΙιΛ

- »1 -50 - AATTCGCATGCGGATCCATCGATC _.3ί

3 'GCGTACGCCTAGGTAGCTAGAGCC 5'

These cohesive ends are complementary to the EcoRI and Aval cohesive ends and further comprise SphI, BamHI and ClaI sites.

After transformation and selection, colonies were tested for loss of tetracycline resistance-determining factor. Plasmid · _.

DNA from one clone was sequenced to confirm that it contained the predicted correct sequence. This plasmid was designated pCH19.

iii) Introduction of tetA + tetR genes

The TetA and TetR genes were isolated from pTB344 on the EcoRI-PstI fragment. The pUC8 vector was digested with SspI because it carries the same selection factor (ampicillin resistance) as pCH19. Plasmid DNA of pH19 was digested with EcoRI and PstI and then ligated with the 2 &amp; gt; 45 kb fragment carrying the tet genes. The resulting recombinant plasmid was then used to transform E.coli C600 cells, and the culture of the transformed cells was then selected for tetracycline resistance. The insertion of tet genes was determined to replace most of the bia genes in pCH19, which could cause the loss of its ampicillin resistance factor. This loss of ampicillin resistance from transformed cells was confirmed. Several clones were then used to isolate plasmid DNA that was subjected to restriction analysis. This confirmed that^_the constructed plasmid had the desired structure. The plasmid was designated pTB351.

Ss ^ Sá ^ TO? ”· *

<img file="CS9101250A3_D0089.tif" />

<img file="CS9101250A3_D0090.tif" />

<img file="CS9101250A3_D0091.tif" />

<img file="CS9101250A3_D0092.tif" />

iv) Insertion of the cer sequence

The naturally occurring 'plasmid ColEI' is stable in E. coli / while its derivatives pBR322 and pAl3:

they are not stable in E. coli. Summers and Sherratt (Cell,,

1097-1103, 1934) found that this is due to ί

the derivatives do not contain a short (283 bp) sequence called cer,;

which is present in the parent plasmid. This sequence contains a specific site responsible for the decomposition of plasmid multimers, which prevents the accumulation of these multimers resulting from homologous recombination. These multimers have;

a deleterious effect on the division process that normally ensures stable properties of daughter plasmids during bacterial division.

Cer sequence (Summers, D. et al., MGG, 201, 334-338,

(1985) was isolated from plasmid pKS492 (enabled by D. Sherratt) as a 289 bp fragment by digestion with BamHI and Taql.

Plasmid pTB351 was. isolated as DNA from dams of the E.coli strain to prevent blocking of its Cla1 site by the dam + methylation system. This DNA was digested with BamHI and ClaI (both;

It was introduced into a synthetic oligonucleotide for this cloning). The cer fragment was ligated with the digested vector and then used to transform E.coli C600 cells. Selection was performed for tetracycline resistance. Transformed?

the cells were subjected to cloning analysis by Aval restriction endonuclease and gel electrophoresis. The presence of an additional 1 zon DNA indicates increment of the cer fragment. Further restriction analyzes were performed to confirm the correct structure of the resulting plasmids. One of these plasmids was designated J pTB357 (Figure 5) and was also designated pLBOO4. J

<img file="CS9101250A3_D0093.tif" />

(B) Plasmid pCH101

Plasmid pCH101 corresponds to plasmid pICI 0020 (see Example 1d 1c), except that the EcoRI-SalI fragment (see Figure 1) is replaced by a fragment consisting of SEQ ID NO: 53 (see also Figure 6) and the gene the sequence of interferon α as described by Edg MD et al., Nucleic Acids Research 1983, Vol.

11, 6419-6435. In this regard, the 3'-terminal codon of ATG of SEQ ID NO: 53 is immediately followed by a TGT codon that encodes a cysteine ​​(amino acid 1) in the interferon sequence as described in the previously mentioned reference Edge, MD et al .: Nucleic Acids

The sequence of GAT-CCA-TG --- and the 'complementary 3' GTAC nucleotide sequences are then deleted from the nucleotide sequence. according to the previously mentioned reference.

, ;·

c) Insertion of the expression gene set into pTB357

An expression set of genes consisting of the trp promoter, the ribosome binding site, and the. interferon was isolated from plasmid pCH101 (see previous point b) 'on the restriction fragment EcoRI-SphI. It was then ligated into a production vector (pTB357) (see previous point a) also digested with EcoRI and SphI. This DNA was used to competent E. coli C600 cells and after transformation-resistant transformation cells were isolated.

Š r?

Ϊ.

tetracycline. Several of them were subjected to analysis of the cloned DNA to determine if an SstI restriction site had been added to the expression pool.

and;'

<img file="CS9101250A3_D0094.tif" />

*4,

<img file="CS9101250A3_D0095.tif" />

<img file="CS9101250A3_D0096.tif" />

/Ί / - gene. Clones that showed por * * / z in this respect? · '* /. . ' As a result of the aspect, they were subjected to a restriction analyzer to determine whether the predicted composition of the construct.

“Of the gene. is right. “The following were: / clones - tested - on -sch / i

Producing an interferon protein after po; The electrophoresis on a Cooma: ie blue stained polyacrylamide-SDS gel. One of the clones was designated pLB005.

d) Insertion of the T4 transcription terminator into pTB244

The T4 transcription terminator sequence, in the form of a SalI to HindIII (67 bp) fragment (see SEQ ID No. 51 and Figure 4a), was inserted into the multiclonal site of the intermediate vector pTB244 between SalI and HindIII sites. A cloning analysis was used to confirm the composition of this constructed gene (pTB244.T4 ter.). The SstI-SphI fragment containing the majority of the multicloning site and the T4 terminator Ty were isolated from this vector. then they were. embedded in pLBOOS ,. cleaved, also SstI and SphI, replacing the interferon α1 gene, but leaving a set of genes comprising the trp promoter. This constructed gene was subjected to cloning analysis and the plasmid was designated pLB013.

e) Substitution of the multicloning site

The presence of a multiclonal site is not ideal in plasmid pBL013 for several reasons: SalI, BamHI and SmaI sites are not the only plasmid, but occur. there were a few: This fragment was therefore cleaved with Ssl and XbaI (both sites are in a single copy on the vector) and replaced with ν '»' - 'ί

•.//^· _Λ--’·-. ,...·.

'- * .

·»&lt;.

- 85 -; - “\ Z r; ': -3^andThe synthetic oligohucolotide is SEQ ID NO: 54.

š &amp;

AND

AND ^;5 'AGCTCCATATGGTAČCAGATCTCTCGAGAGTACTT

GGTATACCATGGTCTAGAGAGCTCTCATGAAGATC5 '

Clones were analyzed for the presence of new restriction sites and then subjected to sequencing. One such plasmid was designated pLB014. The new inserted cloning sites are: NdeI, KpnI, BglII., Whol. and Seal, then Xbal and Sali, who follow them .__

f) Other, modifications ..

It has been found that the adjacent SsI and NdeI sites in pLB014 cannot, due to their proximity, be cleaved by both respective restriction endonucleases, either simultaneously or sequentially. Therefore, additional sequences were inserted between them. This was done by digesting pLB014 with SstI and KpnI and then inserting the synthetic oligonucleotide of SEQ ID No. 55.

5 'AGCTCAGCTGCAGCATATGGTAC

GTCGACGTCGTATAC 5 '

Clones were tested for the presence of new PvuII or PstI sites and were subjected to sequencing. One of these • MSSKSand charge &lt;4.

./&lt;·&lt;

37 = 37;

. * · K

86 plasmids were designated as pLBOIS (= pICI 0080) (see Ob7). This plasmid is efficiently compared to plasmid pLB014 by SstI and NdeI. This provided a site for insertion of ru sequences, for binding sites. ribosomes, correctly positioned with respect to the position of the trp promoter downstream, and further ensures that the ATG initiation codon of the gene is expressed.

<img file="CS9101250A3_D0097.tif" />

Reference to Example 7

Construction of PICI 1295 (also referred to as pCG300)

a) pCG54 production from pICI1079 pIcI1079 is ampicillin resistant, the derived plasmid pAT153 contains the following elements between the EcoRI and StylI restriction sites:

(i) CI857 from phage λ (ii) λΡ ^ promoter (iii) synthetic ribosome binding site (iv) synthetic interferon gene sequence and₂ (v) a synthetic transcriptional terminator sequence derived from phage T4 between SalI and StylI restriction sites. The DNA sequence for this transcription terminator is shown in Figure 4a. SEQ ID

No. 56.

pICI1079 is shown in Figure 8.

pICI1079 is based on the Budapest Treaty at the National College of Industrial and Marina Bacteria Limited (NCIMB), 23, St.Machar Drive, Aberdeen, AB2 1RZ, Scotland,

<img file="CS9101250A3_D0098.tif" />

- 8 /, -ν 'r' -έί - ^^ υκ. {NGIMB-No. -40370 ·, · save-date 19.2.1991} ._._. PCG5..i ---------------------? &amp;

designed to be an appropriate expression age.

containing the same promoter, ribosome binding sequence, and transcriptional terminator sequence as previously reported, i.e., λρ, RBS7 and β4, lacking a gene sequence encoding specificity / protein production. The plasmid constructed in this way could ensure that the basic expression vector containing the necessary /

transcription and translational elements for the production of the desired protein. which could be introduced into this / vector by the following cloning procedures. "

The vector construction was initiated by cleavage of pICI1079.

restriction endonucleases at EcoRI sites. and Sall., When /

------ --- ^χ ^ ΐΌ⁼^^ί1 ^ ρβηί / 5 ^ γ1 === ηνοΤη ^ η == φι? 3χτηοηί = ν6ΕΐοΓη7 = ^ = οΡ53ΐια ^ ίτ: 4 --------- PICI1079 plasmid genes with plasmid replication genes and genes with antibiotic resistance and, in addition, the T4 sequence for the transcription terminator. The fragment was isolated on an agarose gel, purified. using a method of purifying the final DNA purification gene; t

P * *

A second small, approximately 1.2 kb DNA fragment was introduced into this vector fragment. This second fragment can be obtained, for example, by DNA synthesis or by point synthesis

Or by PCR mutagenesis of the small restriction fragment EcoRI-SalI obtained from pICI1079 described above. This second fragment, ·, contains the same promoter and ribosomal binding site sequence as the original plasmid pICI1079, and additionally has EcoRI and SalI sites available at the 5 'and 3' ends, respectively, thereby providing kompatibilní compatible ends for ligation of the pICI1079 fragment. . As a result, the ligation reaction, in the presence of Gibco-BRL T4 DNA ligase and appropriate buffer, resulted in the constructed plasmid pCG54.

<img file="CS9101250A3_D0099.tif" />

Clones containing this engineered plasmid were isolated by transformation of a portion of the ligation reaction mixture: competent E. coli cells, strain HB101. _

The constructed plasmid pCG54 was 3.682 kb and contained the necessary features as shown in the map in Figure 9.

b) Production of pCG61 from pCG54 (also referred to as pICI54)

Synthetic oligonucleotide sequences were designed to include both natural sequences for the T7A3 promoter and sequences that could provide efficient translation of the initiator region, allowing flawless cloning of any polypeptide gene adjacent to them. RBS1, the rib sequence binding domain, was selected as a suitable sequence for the region mentioned in the second place. Therefore, two complementary oligonucleotides, designated SEQ ID NO: 57 and SEQ ID NO: 2, were synthesized. 58, to create a double stranded DNA linker incorporating the sequences for the T7A3 promoter and for RBS1.

Oligonucleotides were prepared as 84-mers, by a standard method using an ABI gene synthesizer.

(They were designed in a double stranded form to have synthetic fragments having restriction sites for EcoRI 'and KpnI endonucleases at the 5' and 3 'ends. acrylamide gel containing 10% acrylamide and 7M urea.

•, fi

<img file="CS9101250A3_D0100.tif" />

.eu, ce _;; ou

- 89 y, ·. ....

During purification, the oligomers were first subjected to chromatography not only to determine if they were correct, but also to determine whether they were purified.

contains predominantly the desired oligomers with the desired c.

...... .sizes that ... which. .when they arise. by-products. .p.ři. ... ...... j synthesis. %

....... ......................................... .......'^J·................................. ......... ~ . ..... £..

• Λ *

Acrylamide gels were prepared by the standard method with ammonium persulfate and N, N, Ν ', N'-tetramethylenediamine, used as a catalyst for gel polymerization.

”, T

The size of the nucleotides required requires visualization after electrophoresis. Therefore, radiolabeling of samples with P was also necessary. This allows 1 to estimate the quality of the sample after autoropiography electrophoresis.

Oligonucleotide samples were available in crude form and not phosphorylated. You. were then used for radiolabeling, so that the samples were labeled at the 5 'end by phosphorylation (using the T4 polynucleotide kinase enzyme;

Oligomers were obtained after synthesis in a non-phosphorylated form and after purification each oligomer was individually subjected to a phosphorylation reaction involving ATP to phosphorylate the 5 'end of each molecule in the presence of T4 polynucleotide kinase (see *

Molecular Cloning: A Laboratory Manual, 3rd Edition,

Sambrook, Fristch and Maniatis, p.5,68-5,71). After phosphorylation, two complementary oligonucleotides were joined together to form double-stranded DNA containing T7A3 ',

<img file="CS9101250A3_D0101.tif" />

<img file="CS9101250A3_D0102.tif" />

&lt;&lt;? »* I» · - ·. » ·

<img file="CS9101250A3_D0103.tif" />

promoter or RBS1 sequence?

The vector molecule pCG54 was digested with restriction. by endonucleases with EcoRI and KpnI, Tim. _.ru.

2.3 kb in size, 1.1 kb in size, containing λρ_τthe promoter and the RBS1 sequence. This cloning step oyl ......... ·. . . .. ·. Scheduled to remove λρρ-RBS1 sequences with the synthetic EcoRI-KpnI fragment containing the T7A3-RBS1 sequence. The 2.3 kb vector fragment obtained by digestion of pCG54 was purified by conventional gel electrophoresis and gel purification methods to remove DNA from agarose fragments.

A 84 bp EcoRI-KpnI synthetic fragment was ligated into the vector molecule prepared above and the ligated DNA was used to transform E.coli HB101 cells. The selection marker for recombinant clones was ampicillin resistance. After the transformation, a number of colonies were selected! containing a recombinant plasmid, for further testing.

As such, the 84-mer synthetic fragment inserted into the vector during cloning was unsuitable for simple restriction analysis assays for recombinant plasmid DNA samples. Small size inserts are not visible on the agarose gel after electrophoresis.

The fragment itself does not contain any restriction site for endonucleases that would. could be a suitable diagnostic proof of his presence. Testing of recombinant clones was therefore performed by the colony hybridization method (see Grunstein and Hognes, Proc. Natl. Acad. Sci., 72, 3961, 1975). Nitrocellulose filters containing immobilized plasmid DNA from recombinant clones were hybridized against the set,

<img file="CS9101250A3_D0104.tif" />

- 91 7 / prepared 'random'? by radiolabeling the 'spc' of the synthetic oligonucleotides of SEQ ID NO: 57 and SEQ ID NO: 5?

were labeled with α-dCTP and incubation with Klem and polymerase at 37 ° C for 2 hours. Recombine Ko? that showed a positive hybridization reaction, was you? y for the preparation of plasmid DNA

..every of. . cases. in a relatively large amount, centrifugation in the density gradient Csď is swept to make it. secured

-——^:- Required purity a (v-iz-^ Mo lecul and r-Cl on ing-AL ab orato ryu)

Manual, 2nd Edition, Sambrook, Fritsch and Maniais, Cold Spring Harbor Laboratory, 1989, p 1.42-1.52. The preparation of DNA by this method ensures a high quality of material suitable for further cloning and sequence analysis.

All plasmid DNA isolated from recombinant clones was placed in the second selection step of sequence analysis to confirm that the oligonucleotide sequence of the cloned junction of the T7A3-RBS1 fragment alone was absolutely correct. The sequencing procedure used Sequenase and for example pBR322 UP (pBR322 universal primer) was selected as sequencing primer. Sequencing was performed by the Sanger method, utilizing chain termination using dideoxy nucleotide derivatives.

<img file="CS9101250A3_D0105.tif" />

;* ¹ ft '·&gt;

Clones containing the correct sequences were designated as a new expression engineered plasmid pCG61 that contains the T7A3 promoter, the RBS1 sequence, and the T4 terminator sequence (see Figure 10). &gt;

<img file="CS9101250A3_D0106.tif" />

Λ ', · - -ýý · * »* -' ··.

&lt;c)_«Production_;pCG300 = (also referred to as pICI1295) ···. -w .μ ...,. I. , n 4 of pCGc

<img file="CS9101250A3_D0107.tif" />

Sequencing and synthetic procedures used in con; : i 1-) 27 · .. ·.

The OC-SF / α-analogs of G-CSF are described in Ex. ·, 1_; -,_r (see Figure 3). This G-CSF analog sequence was isolated from a constructed plasmid in which the gene was incorporated into plasmid pSTP1 to give pICI1107 (see Example 2). pICI1107 was digested with Seal and then the large fragment was isolated by subsequent agarose gel electrophoresis and gene purification method. This fragment was then digested with SalI restriction endonuclease to obtain the [Ser '] hu G-CSF gene at i Ί. 4 of a Scal-SalI fragment suitable for cloning into pCG61 (see Figure 10).

After subsequent restriction with SalI, the desired fragment was re-isolated using an agarose gel purification technique.

The vector molecule pCG61 was digested with the restriction enzyme Kpnl. Cleavage with this enzyme gives a 3 'overhang, which was then flushed using the T4 polymerase enzyme (see Molecular Cloning-A Laboratory Manual, 2nd Edition, Sambrook, Fritsch and Maniatis, p. 5.44-5.47). The DNA was precipitated with ethanol, the precipitate was dissolved in sterile distilled water, and the dissolved DNA was digested with Sal. The KpnI (new blunt-end) -SalI fragment was precipitated with ethanol and then purified by gel electrophoresis and other purification techniques.

27

The Scal-SalI [Ser '] hu-G-CSF fragment was then ligated to the blunt end of the KpnI-SalI vector. The ligated DNA was

<img file="CS9101250A3_D0108.tif" />

-,.···. .

transformed into E. coli, strain HB101. £ · :.

· '-' i · '·?' even recombinant clones were performed with respect to resis: L to ampicillin.

Search for potential recombinant clones was performed by hybridization. The radiolabeled test was - ----------- prepared by random 'labeling' of the Erdri-Sari fragment '(containing^_

27 Mar: . . gene sequence [Ser. -] hu G-CSF_?prepared from plasmid piCI1107. This was used for hybridization against colonies containing DNA that had been immobilized on. the surface of the nitrocellulose filter. Subsequently, plasmid DNA was prepared from 24 clones that hybridized in this assay.

DNA-bvl-a-prxayeri, ary, chdd.Unini-pr.e.p_mefadou ^ (2, see Birnboim and Doly, Nucleic Acid Researc, 7, 1513, 1979) . These recombinant DNAs were subjected to a second stage restriction analysis. Linearization of DNA with BamHI, which has a single restriction site on the gene expression set, is indicative of the presence of [Ser '] hu G-CSF sequence.

Sequence analysis was performed to confirm the presence of the [Ser '] hu G-CSF gene and to verify that the base sequence was cloned and everywhere in [Ser. '·] Hu

The G-CSF gene was correct. For this purpose, a larger amount of plasmid DNA sample was prepared from 16 recombinant clones, using a CsCl density gradient centrifugation technique. The sequencing procedures were performed with respect to the sequencing procedure and the universal primer pBR322 (EcoRI) was selected as the sequencing primer. Two of the recombinant clones contained the SD-sequence at the Seal end-fragment of the [Ser-] hu G-CSF and everywhere in the G-CSF peptide sequence alone.

OF

C;

•AND

A r

?

ř ·. X '

...:. * ►— &lt;: ί3 .. · * ν »- * ·. · »

Η '·· -. ». 7: ·. -? '

<td></td><td></td><td> . ; · R ·</td><td></td><td></td><td>^Ř“ ‘ ‘</td>

<td> - ^:-' ’ '</td><td></td><td> 7 -7 94 -</td><td></td><td></td><td></td>

<td></td><td>and</td><td>... -</td><td></td><td></td><td></td>

<td> - .</td><td></td><td></td><td></td><td></td><td></td>

<td>&lt;: £ · * Λ '-? ··' - -: V · - '</td><td></td><td></td><td></td><td></td><td></td>

<td>'7ř'; . '</td><td></td><td></td><td></td><td></td><td></td>

<td>ίύ »</td><td></td><td></td><td></td><td></td><td></td>

<td>ÍVV-</td><td></td><td></td><td></td><td></td><td></td>

<td>-. Sequence ID no.</td><td> 1</td><td> 1</td><td></td><td></td><td></td>

<td>-. -. ., - in - · - /</td><td> -</td><td></td><td></td><td></td><td></td>

<td>7 ^ 7.77. Length of the sequence</td><td> ♦</td><td> 62 bases</td><td></td><td></td><td> *. ·</td>

<td> / type 'sequence':</td><td></td><td>nucleotide '</td><td> 1. .· » · ' *’</td><td> ' </td><td> .’^L'</td>

<td>. spiral.:</td><td></td><td>simple</td><td></td><td></td><td></td>

<td>- 7- '- topology ·:' ·^;</td><td></td><td>linear</td><td> • ......- - · — - -—-</td><td>..... -r- ·</td><td> - ·* ·</td>

<td colspan="3">AATTCAGT ACT CCA CTG GGT CGA-AGC TC</td><td>T CTG 'CCG CAG</td><td> TCT</td><td> 44</td>

<td>TTC CTG CTG AAG</td><td>TGT</td><td>CTC</td><td></td><td></td><td> 62</td>

<td>Sequence ID 5.</td><td> 2 .</td><td></td><td></td><td></td><td></td>

<td>Length of the sequence</td><td>ζ</td><td>64 bases</td><td></td><td></td><td></td>

<td>sequence type:</td><td></td><td>nucleotide</td><td></td><td></td><td></td>

<td>spiral:</td><td></td><td>simple</td><td></td><td></td><td></td>

<td>topology :</td><td></td><td>linear</td><td></td><td></td><td></td>

<td>CTG TTC GAG ACA</td><td>CTT</td><td>CAG CAG GAA AGA CTG</td><td>CGG CAG AGA</td><td>GCT</td><td> .. 42.-</td>

<td>TGC TGG ACC CAG</td><td> TGG</td><td>AGT ACTG</td><td>l</td><td></td><td> 64:</td>

<td>Sequence ID · No.</td><td> 3 . ·'·'</td><td></td><td></td><td></td><td></td>

<td>Length of the sequence</td><td> «</td><td>60 bases</td><td> -</td><td></td><td></td>

<td>sequence type:</td><td></td><td>nucleotide</td><td></td><td></td><td></td>

<td>spiral:</td><td></td><td>simple</td><td></td><td></td><td></td>

<td colspan="2">topology: linear</td><td></td><td></td><td></td><td></td>

<td>* GAA CAG GTA CGT</td><td>AAA</td><td>ATT CAA.GGC GAT GGT</td><td>GCG GCT CTG</td><td>CAG</td><td> 42</td>

<td>GAA AAG CTG TGC</td><td>GCA</td><td>ACC</td><td></td><td></td><td> 60</td>

Sequence ID No,_; 4

Length of the base sequence

ΛΑ¹??»'; ·· &amp;

I &amp;

#:· &amp;

'sequence type spiral: topology:

nucleotide 3 simple linear '

Vfi

TTT OTA.GGT TGC GC CAG CTT TTC CTG CAG AGC CGC ACC

GCC * TTG '?? ACG TAC ·.

Sequence ID .Length, sequence

4S base type-sequence: spiral: tonology:

single nucleotide ί npd τ&gt; η η ”

TAC AAA CTG TGC CAC CCT. C-AG GAA CTG GTG CTG CTC GGT CAC 42 =_{T &amp;?}=_G-_?:G= Sequence ID 6

Sequence length: 51 bases sequence type: nucleotide · spiral: simple topology: · · linear

CGC- GAT CCC CAG

GTG GCA CAG

AC-^AND

GTG et al

P 3 r * '• JsiaJ ·

CAC TAG CTC AGG

SEQ ID NO: 7

Sequence length type sequence .: spiral: top.ologi'e-:

the nucleotide is simple linear, τλ ^ -ΤΛ -.

Ř ^ * á - · ř ř ir ir ir ir ir ir ir; · Ir. '.

- . /*

- 96:.-;

GGG ATC GCG TGG GCT CCA CTG

Sequence - ID No. 8 bases a single linear nucleotide

Sequence length ': sequence type: spiral: topology:

CTG GCT CAA GCC GCC TGC CAG

SEQ ID NO: 5

Sequence Length ': Sequence Type: Spiral: Tonology:

base nucleotide is simple linear

AGC CAG CTG CTC GGT CTG. CTG 42 CAG GCT CTA GAA GGC ATC TCT 63

SEQ ID NO: 10 bases nucleotide single linear

Sequence length:

'sequence type: spiral: topology:

TTC AGG AGA GAT GTC

CAG GAA CAG ACC

...·

Sequence ID No. 11 _:Sequence length: sequence type: spiral: topology:

6O bases simple single nucleotide

CCT GAA TTG

CCC ACG CTG GAC AGA fAft pr.f 'L · rv v λ \ J

GCC GAG TTC GCT ACT ACC

Sequence ID No. 12

Sequence length: 63 bases Sequence type: nucleotide = β-β and β: one = one^:ďu^:with^:há^: topology: linear

<td>TTG</td><td>CCA</td><td>MELT</td><td>GGT</td><td>AGT</td><td>AC-C</td><td>GAA GTC. GGG 'AAG GTC CAG</td><td> 42</td>

<td>TGT</td><td>GTC</td><td>GAG</td><td>GGT</td><td>GGG</td><td>CCC</td><td>CAA '</td><td>S3</td>

<td>Sequence ID No. 13</td><td></td><td></td>

<td>Sequence length:</td><td>63 bases</td><td></td>

<td>sequence type:</td><td>nucleotide</td><td></td>

<td>spiral:</td><td>simple</td><td></td>

<td>topology :</td><td>linear</td><td></td>

<td>ATA TGG CAA CAG ATG</td><td>GAG GAA CTG</td><td> 42</td>

<td>CAG CCG ACT</td><td>C-CG ATG</td><td> 63</td>

<td>SEQ ID NO: 14</td><td></td><td></td>

ř *.

<img file="CS9101250A3_D0109.tif" />

h Sequence length:

·, RtV-T ”;

<img file="CS9101250A3_D0110.tif" />

- t; * »ysf:« * £.? £ *! · '·³'.Xf' X;

The sequence of the spiral;

SC bases,. 3 * nucleotides single

1 «* * ,,,. '· I-neami ... ·,

TGC 'TG &amp; OAT · CGCvACC ACC' OAG 'TTC CTO ~ CA?

Π pn f. F π&gt; '41. 1'4 1 yy r * fi in -JAj

CTG CAG TGC

CGΛ &lt;1 ι .ιυ

CA?

π τη

OJ Λ L?

SEQ ID NO: 15

Sequence length Sequence type: Spiral: Topology:

base nucleotide simple linear

<td>CCA</td><td>GCA</td><td>m mn i XV</td><td>GCC</td><td>TCT</td><td>5ΠΓΠ π 5 Λ π, ο.-ι CnfTA cxi llv νΛα V'J'J 4ΌΛ,</td><td>mm Lr \ J in G - i in -x</td><td> 42</td>

<td>CTG</td><td>m »m i</td><td>, -i / ♦ rl sťv V</td><td>.n XL · V ·</td><td>CA?</td><td>Cl?</td><td></td><td> 60</td>

SEQ ID NO 16

<td>Length of the sequence</td><td> •</td><td>6C basí</td><td></td>

<td>sequence type:</td><td></td><td>nucleotide</td><td></td>

<td>spiral;</td><td></td><td>simple</td><td></td>

<td>4 topology :</td><td></td><td>linear</td><td></td>

<td>Uul OlU AA'J r.lu</td><td>GGA</td><td>GGC AAC CAG - AAC ACC GCC TGC GCG CCG</td><td> 42</td>

<td>CTG GAA AGC ADA</td><td>'jvL ·</td><td>GAA</td><td> 60</td>

SEQ ID NO 17

Sequence length: 55 bases Sequence type: nucleotide Spiral: single 'flame.' '-'. ·. ·.

-: 99 .. topology:

linear ____ in \&gt; CAG _AGC_? TC_CTC_GAG G? G _ ?? C_TAC CGC GTT CTG CGT _CAC_'CTG_ ·. J; cc CAG CCG TTAC

42'

CAV τ - in:, · * »o! ICA 7 wi * K- *

Length _sec_e _: · sequence type;

7so irála -: —-, / .... 7 ..: ......:

A simple nucleotide is simple topology: linear

DQfiACG1 CTG C-GC-CAG GIG ACG-CAG-AAC GCG-GTA-AGA CAC 44 • i *. , '' ι * 4 4 kJTL ·

Sequence ID S. 19

Sequence length: sequence type:

spiral:

Topology:

T AC AACTGGC AGGCT GC I¹ The GA basinucleotide is simple linear

SEQ ID NO: 20

Sequence length: Sequence type Spiral: · GAC GTTGCCGACTTCGCTACT 'topology bases nucleotide single linear

<img file="CS9101250A3_D0111.tif" />

! r ·

<img file="CS9101250A3_D0112.tif" />

<img file="CS9101250A3_D0113.tif" />

Sequence ID NO * 21

Sequence length ':' 'type ·· sequence ··:' 'spiral: -topology

21. simple

- linear

TGCCGGAGCCAtACCCAGTTC

SEQ ID NO 22

Sequence length Sequence type: Spiral: Topology:

base nucleotide simple linear

GCCTGCCAGTTGTAAAGCTTG

SEQ ID NO: 23

Length of the sequence⁷: sequence type: spiral: topology:

base nucleotide simple linear

GCACCÁTCGCCTTGAATTTTACGTAG

Sequence ID No. 2.4

Sequence length: sequence type spiral: topology:

'62 base nucleotide simple linear

<img file="CS9101250A3_D0114.tif" />

<img file="CS9101250A3_D0115.tif" />

. ··· -. 7 á.-y;! '. ·': '·' ':' · '' 'Phi /.- r' · .— · · &lt;. ·&gt;.: V.v ';; ·;

'&lt;' .. * AATTCAGT.ACT CCA CTG GGT. 44 V // 7-JTTC CTG CTG_AAG TCT CTC-_ _ __ 62

<td></td><td></td>

<td>SEQ ID NO: 25</td><td></td>

<td>Sequence length:</td><td>64 bases</td>

<td>sequence type:</td><td>nucleotide</td>

<td>spiral^- ' - -— ”</td><td>^ simple '”</td>

<td>topology :</td><td>. linear.</td>

<img file="CS9101250A3_D0116.tif" />

-I i '·'

-.her

CTG TTC GAG AGA CTT CAG CAG GAA AGA CTG CAG AGA GCT 42 TGS TGG ACC CAG TGG AGT ACGT,. 64 »

Vf. · • Λ '' Sequence ID No. 2? 6

Sequence length Sequence type: Spiral: Topology:

base nucleotide, is simple _;linear · ' ^J·..·

GAA CAG GTA CCT AAA ATT CAA GGC

GAA AAG CTG TGC GCA ACC

<td>SEQ ID NO.</td><td> 27</td><td></td><td></td>

<td>Lenght</td><td></td><td>60 bas</td><td></td>

<td>sequence type:</td><td></td><td>nucleotide</td><td></td>

<td>spiral:.</td><td></td><td>simple</td><td></td>

<td>topology- :</td><td></td><td>-1 »* ** . 1 * 1 VI Λ * 1 ** V, ....... - ... M. * iiliC Ct-L 11-U * ·· “* ·“ - ....</td><td></td>

<td>TTT GTAGGT TGC</td><td>GCA</td><td>( CAG CTT TTC CTC AGC CGC ACC GCT</td><td> 42</td>

<td>GCC TTG AAT TTT</td><td>ACG</td><td>TRAY</td><td> 60</td>

'X

Ϊ ?.

Ris-aSsM4. * ~ "

<img file="CS9101250A3_D0117.tif" />

ί '^ Ζϊ ^ Λ-ϊίιΐϋ.' ^ ·, ~,

7 $ «^. '^ I'_ · .., · ID Sequence' 'Ϊ * ϊ &amp; ί.' . λ * &amp;&amp;&amp; '^j í * VíT / ·. ^ Z ·. · Á \ 74 74 74 ·. v &amp;? x5ii ^

3 h

Length of sequence, · '·' * '. ^ H ,, v * ... .; .

Type / sequence:

spiral: topology:

CTT CAG CAG GAA AGA Basis', _. , nucleo.tid simple. linear_.

»/&gt; / '» Ππ, -ν · λ «/ ♦ and • i'v¹./ '_r'_w- ?, Cx X

- 102 -7

<img file="CS9101250A3_D0118.tif" />

if*

A '_r ^

SEQ ID NO: 2

Sequence length Sequence type: Spiral: Topology:

base nucleotide simple linear

Pf! ΓΓίΓΓ · 7 η ((fi A θ '¹ A A. ​​',', z''n, Tl f, A Λ &lt;A in C * Λ,

Ju ± i · τ ajn A'J-jx tr'vA -. 'J-'. '' Ji 'Ac Ajb O'j.' 2

SEQ ID NO: 30

Distance.s equivalence: sequence type ϊ spiral: topology:

CTG TTO CCA TAT C-CT AGA AGC GAA GTC TTC simple linear nucleotide

Sequence ID · No. · 31

Sequence length typ. sequence: spiral: topology:

base nucleotide single linear ypho &amp; yo '.. ·

103 GCT CAG TGG AGC TTT

CGG GAT-CCC CAG

<img file="CS9101250A3_D0119.tif" />

r

Sequence ID No. 32

Sequence length Sequence type: Spiral:

-topology · -: - - ACG CAG AAC GCC bases nucleotide single

- - - - Linear-GCG AGA GAC CTC GAG

Sequence 13 '# 33

^ .ej.l &lt;a ~ s7el &lt;v is ~ n.e:. ~ sequence type: spiral: topology

G TTC GAG AGA. CTT TTC

SEQ ID NO 34

Sequence length Sequence type: Spiral: Topology:

C CTG CAG. TTT CGC AGC

SEQ ID No 35 '

Sequence length: sequence type:

—2: gcKaší-_;στα nucleotide simple linear

CAG GAA AGA CTG C ​​is a simple linear nucleotide

GCT AGC TTG AAT TTT AC base nucleotide

<img file="CS9101250A3_D0120.tif" />

kl Cý

- 104 ÚV · 4 · '· t «._r '^J-ⁱⁿ·-Χ} - '' · '- ·': ·. · Simple linear spiral:

.topology :

CAG AGA GTC AGC GAG CTC TTC CTC CTCAGC GTG G.

Λ '' '' Sequence 'ID' No '3'6

Sequence length: sequence type: spiral: topology:

GC? CAG TGG AGC TT CGG GA? AGC AG AG

- 29 bases simple linear

SEQ ID NO 37

Sequence length: 30 bases sequence type: nucleotide spiral: simple topology: linear

CAG CTT TTC CTG CAG ACG

SEQ ID NO: 38

Sequence length: 29 bases sequence type: nucleotide single linear spiral: topology:

CC GCT GCC TTG AAT

SEQ ID NO: 39

105 -

<img file="CS9101250A3_D0121.tif" />

ν ';

'T)&gt;

• three VkS? ! ' '' * Vf0-: T ··. ·,

... Length of sequence:

ptýjž; sequence:

i. · '· spiral': 'topology:

base nucleotide simple linear

GGT TGC.GCA CAG ACG TTG

JS '·

SEQ ID NO: 40

Sequence length: - 29-base fyp sequence: nucleotide spiral: simple topology: linear

G GTG GCA CAG ACG GTA GGT TGG GGA CAG 0 .2.9.

SEQ ID NO 41

Sequence length: Sequence type: Spiral: Topology:

extinguishes the nucleotide. j simple linear

CG CGG CAG AGA GCT JGC ACG GTA GGT TGG AGC CAT TGTCGATACC 45

SEQ ID NO 42

Length Sequence: sequence type: spiral: topology. :

GCA AGA GCT CAG The AGA AGC CCA CGG is based on a simple linear nucleotide

<img file="CS9101250A3_D0122.tif" />

&lt;VW''V5?&gt; £ i *:&gt; · -; · ·: - '· λ ··^; ·:

ί, -A * - ^r'~, i * / ·'⁷”

The nucleotide of the invention is SEQ ID NO: 43

Sequence length.

sequence type: spiral: topology; :., _ '. ·

P A p'fi Π, Τ f »/ *&gt; hm φ.A m ♦ aa ρ · .π, Τ ~ ns * · n rr. -&gt; p · * »ρ &lt;pr» rp 'Λ

LA LzLL υαυ ^ Λσ lib iAA AUL \ jL --- · kjL x ^withuLH λΙιΑ jg and L

SEQ ID NO: 44

Sequence length: sequence type: spiral: topology:

base nucleotide simple linear

GCT CAG AGA AGC TTT

2?

Sequence ID No. 4b .Length..Sequence ':' sequence type: spiral: topology:

base · simple nucleotide linear

CGG GAT AGC CAG AGA GTG AGC GAG ITC CAC CAG TTC CTC AGC pr.

4.2

SEQ ID NO: 46

Sequence Length: Sequence Type: Topology:

174/177. amino acid amino acid linear

- 107

<img file="CS9101250A3_D0123.tif" />

· &lt;Τ 'wrl.

<td>IW- ^ yThr</td><td>? ro</td><td>-Leu</td><td>Gly</td><td>'Pro</td><td>Ala</td><td>Ser</td><td>α η v *</td><td>Leu</td><td>For</td><td>Glr.</td>

<td>•• ^ ** 4.:$*í.v.·; .. 'í * $' - 'in Ser</td><td></td><td>Leu</td><td>Leu</td><td>___ Lys</td><td>Cys</td><td>Leu</td><td>Glu</td><td>Gin</td><td> __:_l_o. Wall</td><td>* · No Arg</td>

<td></td><td></td><td></td><td> 15</td><td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td>

<td>τ »* o JJ? O</td><td> 7 1</td><td>Gin</td><td>.Gly</td><td>Asp</td><td>'51y</td><td>Ala</td><td>Ala</td><td>. Leu</td><td>Gin</td><td>Glu</td>

<td rowspan="2">........ Lys-</td><td></td><td> 2 5</td><td rowspan="2">'Ser G</td><td></td><td rowspan="2">'Cýs^-</td><td></td><td> 30</td><td rowspan="2"></td><td rowspan="2">'Lyš^_</td><td></td>

<td>• PíX</td><td>/? and 1</td><td>w_T</td><td>Aia</td><td>Tňr</td><td>Leu</td>

<td></td><td> 35</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> - 40-</td><td></td>

<td>I Cys</td><td>at·; with</td><td>For</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Wall</td><td>Leu</td><td>Leu</td><td>Gly</td><td>His</td>

<td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td>

<td>Ser</td><td>Leu</td><td>Giy.</td><td>ΐ lo</td><td>For</td><td>Trp</td><td>Ala ·</td><td>For</td><td>Leu</td><td>Ser</td><td>Ser</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> .....</td><td></td><td></td><td></td>

<td></td><td></td><td>-JJ-</td><td></td><td></td><td></td><td></td><td>-3t-</td><td></td><td></td><td></td>

<td>Cys</td><td>ΟύίΛ X _V</td><td>Ser</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Gin</td><td>Leu</td><td>Ala</td><td>Gly</td><td>Cys</td>

<td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td>

<td>Leu</td><td>S 07</td><td>Gin</td><td>Leu</td><td>HÍ £</td><td>Ser</td><td>Gly</td><td>. Leu</td><td>Phe</td><td>Leu.</td><td>Tyr</td>

<td> 75</td><td></td><td></td><td></td><td></td><td>SO.</td><td></td><td></td><td></td><td></td><td> . 55 .......</td>

<td>Gin</td><td>ni v</td><td>Leu</td><td>Leu</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Glu</td><td>Gly</td><td>Tle</td><td>Ser</td>

<td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>For</td><td>Glu-</td><td>Leu</td><td>Gly</td><td>For</td><td>Thr</td><td>Leu</td><td>Asp</td><td>Thr</td><td>Leu</td><td>Gin</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td>

<td>Leu</td><td>Asp</td><td>Wall</td><td>Ala</td><td>Asp</td><td>Phe</td><td>Ala</td><td>Thr</td><td>Thr</td><td>Ile-</td><td>Tm</td>

<td> -</td><td></td><td>¹¹⁰</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td>

<td>Gin</td><td>Gin</td><td>Met</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Gly</td><td>Met</td><td>Ala</td><td>For;</td><td>Ala</td>

<td> -</td><td>1 nf!</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> Leu</td><td>Gin</td><td>Ero</td><td>Thr</td><td>Gin</td><td>Gly</td><td>Ala</td><td>Met</td><td> For</td><td>Ala.</td><td>Phe</td>

135 140

130 '·⁸· Α {.-- '·' '. • v&gt; 'fc jh7&gt; -' '' ';^;· -· - -~·^^ν· '' Fe · \ * r »^ ¹ /·-.

r · ', {*&gt;^r .4:? Rf '' i. A $ ti * ^ * jU, '. * &amp; / *' 4 · £ 4 - - '._t &gt; /

- «ť * jiřiA *. ^. - «,» * 5 ·. 'ι.ς »' x. · /: j. * w - '». .

• λ. tr-t · ^ · .-, «, -... tj-s

- -108 Leu

<td>/ • Ser</td><td>Ala</td><td>Phe</td><td>Gin</td><td>Arg</td><td>Arg</td><td>.Ala</td><td>Gly</td><td>Gly</td>

<td>• «r ·</td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>

<td> Wall.'</td><td>Ala</td><td>Ser.</td><td>His </td><td>t .. · · · · Leu</td><td>Gin</td><td>Ser.</td><td>Phe</td><td>Leu</td>

<td></td><td></td><td> '155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td>

<td>·. Ser.</td><td>- Tyr,</td><td>, Arg.</td><td>In al</td><td>..Leu</td><td>-Arg ··</td><td>His</td><td>'Leu-</td><td>- Ala-</td>

7a '

165

170 Γ0 / where m is zero or one /

Sequence ID No. 47

<td>Sequence length:</td><td> 168 + 166</td><td>basí</td><td></td><td></td>

<td>sequence type:</td><td>nucleotide</td><td></td><td></td><td></td>

<td>spiral:</td><td>double</td><td></td><td></td><td></td>

<td>topology :</td><td>linear</td><td></td><td></td><td></td>

<td>AATTCTGGCA AATATTCTGA</td><td>AATGAGCTGT ';</td><td>/ TGAGAATTAA ·</td><td>'.TfiATGGAACT </td><td> 50</td>

<td>GACCGT TTATAAGACT</td><td>TTACTCG.ACA</td><td>ACTG.TTAATT '</td><td>AGTAGCTTGA. ·.</td><td> 46.</td>

<td>AGTTAACTAG 'TACGCAAGTT</td><td>CÁCGTAAAAA</td><td>GGGTATCGAC</td><td></td><td> 90</td>

<td>TCAATTGATC ATGCGTTCAA</td><td>GTGCATTÍTT</td><td>CCCATAGCTG</td><td></td><td> 86 '</td>

<td>AATGGTACCC GGGGATACTC</td><td>TAGAGTCGAC</td><td>CTGCAGGCAT</td><td>GCAAGCTTAG</td><td> 140</td>

<td>TTACCATGGG CCCCTAGGAG</td><td>ATCTCAGCTG</td><td>GACGTCCGTA</td><td>CGTTCGAATC</td><td> 136</td>

<td>CCCGCCTAAT GAGCGGGCTT</td><td>TTTTTTAT</td><td></td><td></td><td> 16.8</td>

<td>GGGCGGATTA CTCGGCCGAA</td><td>AAAAAATAGC</td><td></td><td></td><td> 166</td>

0 '' · '* &lt;V •' eSřSf ^ fVí * · ',.

λ

SEQ ID NO: 48 &lt;

Sequence length Sequence type: Spiral: Topology:

534'bas, '' '.... ^ '' í '·. The nucleotide with the corresponding protein is simple linear

AATTCAGT ACT.CCA GGT CCA GCA AGO TCT CTG CCG CAG TCT 44 ------. . .. -Thr-Pro-Leu-GTy -Pro-ATa ^ S-er-Ser-Leu-pro-GT-n-Ser ------------- 1 - 5 10

<td colspan="3" rowspan="2">TTC CTG CTG Phe Leu</td><td rowspan="2">AAG Lys</td><td rowspan="2">TGT Cys</td><td colspan="2" rowspan="2">CTC GAA Leu Glu</td><td colspan="4">GAG GTA CGT AAA</td><td colspan="2">ATT CAA</td><td rowspan="2">GGC Gly</td><td rowspan="2"> 86</td>

<td>Gin</td><td colspan="2">Val Arg</td><td>Lys</td><td>Ile</td><td>Gin</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td> 15“</td><td></td><td></td><td></td><td></td><td> 20-</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>GAT</td><td>C-GT</td><td>GCG</td><td>GCT</td><td>CTG</td><td>CAG</td><td>GAA</td><td>AAG</td><td>CTC-</td><td>TGC</td><td>C-CA</td><td>ACC</td><td>TRAY'</td><td>AAA</td><td>i 28</td>

<td>Asp</td><td>Gly</td><td>Ala</td><td>Ala</td><td>Leu</td><td>Gin</td><td>Glu</td><td>Lys</td><td>Leu</td><td>Cys</td><td>Ala</td><td>Thr</td><td>Tyr</td><td>Lys</td><td></td>

<td> ♦ ·.</td><td></td><td></td><td> . ³⁰</td><td></td><td></td><td></td><td></td><td> /35</td><td></td><td></td><td></td><td></td><td> 40 .</td><td></td>

<td>_Ř CTG</td><td>TGC</td><td>CAC</td><td>CCT</td><td>GAG</td><td>GAA.</td><td>CTG</td><td>GTG</td><td>CTG</td><td>CTC '</td><td>GGT</td><td>CAC</td><td>TCT</td><td>CTC-</td><td> 170</td>

<td>Leu</td><td>Cys</td><td>His</td><td>For</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Wall</td><td>Leu</td><td>Leu</td><td>Gly</td><td>His</td><td>Ser</td><td>Leu</td><td></td>

<td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td></td>

<td>GGG</td><td>ATC</td><td>CCG</td><td>TGG</td><td>GCT</td><td>CCA</td><td>CTG</td><td>AGO</td><td>TCT</td><td>TGC</td><td>CCG</td><td>TCC</td><td>CAA</td><td>C-CT</td><td> 212</td>

<td>Gly</td><td>Tle</td><td>For</td><td>Trp</td><td>Ala</td><td>For</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Cys</td><td>For</td><td>Ser</td><td>Gin</td><td>Ala</td><td></td>

<td> ' ' 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td> .. =-.</td><td></td><td></td><td> 65</td><td></td><td> ---</td><td></td><td></td>

<td></td><td colspan="2">&lt;ϊ #? * γλ '* f •' k * '*' ·· '' »</td><td> /-&lt;-/·:,^·_Λ.</td><td>; j- «- </td><td></td><td></td><td> ; , -</td><td></td><td></td><td> in·'·· </td><td> ' </td><td> . * 9</td><td>· &lt;A _AND ' :</td><td>'IN - w -</td><td> - G ·</td><td> with</td>

<td></td><td>^ τ *⁵*^, ·';</td><td></td><td>^;</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>?? Ií</td>

<td>&lt;^ S '^' =</td><td> ·, * * .</td><td></td><td>In ':'.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>and</td>

<td>m / m;</td><td>'· TO</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>her Ϊ</td>

<td>'i. ',:. · S - ^ _^w &gt;£**£ *' '</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>? ΐ</td>

<td></td><td> ; _TTA; </td><td>: CAA</td><td>CTG</td><td>GCA</td><td>GGC</td><td>TGC</td><td>TTG</td><td>5 c '</td><td>CAG</td><td>rT · 'í í J</td><td>fl 4 s * L λ L ·</td><td>TCC</td><td>GGT</td><td>CTG ·</td><td> 254</td><td></td>

<td></td><td>jrttr- fL - '. ::and. ·. 1, “-Ϊ</td><td></td><td>S »ir · · · *</td><td> .._;\ a \</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> &lt;</td>

<td>· V, \ * _Λ v ffl. '' J? R 3 ''</td><td>.yčLěu Λ ·</td><td>iGln</td><td>Leu</td><td colspan="2">Ala- · Gly</td><td>Cys</td><td>Leu</td><td>Ser</td><td>Gin</td><td>Leu</td><td>His</td><td>Ser</td><td>Gly.</td><td>Leu</td><td></td><td></td>

<td>UC i Υ “·^{0 1,1}</td><td> *</td><td rowspan="2"> 70</td><td></td><td></td><td></td><td></td><td rowspan="2"> 75</td><td></td><td></td><td></td><td></td><td rowspan="2">-so-</td><td>v, R ·</td><td> » . . ...</td><td></td><td rowspan="2">and Ř</td>

<td>LJ. ,,: 4, - ... · F</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> - - „</td>

<td></td><td>TTC</td><td>CTG</td><td>TRAY.</td><td>CAG</td><td>GGT</td><td>CTG</td><td>CTG</td><td>read • r • uAtf</td><td>GCT</td><td>Γΐφ A v- A Λ</td><td>GAA</td><td>&lt;* ir * yy</td><td>ATC</td><td>k V A.</td><td> 296 ·</td><td></td>

<td></td><td>Phe</td><td>Leu</td><td>Tyr</td><td>Gin</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Glu</td><td>Gly</td><td>Ile</td><td>Ser</td><td></td><td>and</td>

<td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td>Sat</td><td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td>and</td>

<td></td><td>CCT</td><td>GAA</td><td>TTG</td><td>GGG</td><td>CCC</td><td>ACC</td><td>CTG</td><td>GAC</td><td>ACA</td><td>CTG</td><td>r ři</td><td>CTG</td><td>GAC</td><td>GTT</td><td> 338</td><td></td>

<td></td><td>For</td><td>Glu</td><td>Leu</td><td>Gly</td><td>For</td><td>Thr</td><td>Leu</td><td>Asp</td><td>Thr</td><td>Leu</td><td>Gin</td><td>Leu</td><td>Asp</td><td>Wall</td><td></td><td>Τί</td>

<td></td><td></td><td></td><td></td><td>ICC ·</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td> ;</td>

<td></td><td>GCC</td><td>GAC</td><td>ΦΤ 0</td><td>GCT</td><td>ACT</td><td>ACC</td><td>AT A</td><td>TGG</td><td>CAA</td><td>CAG</td><td>λ mr * Λ X - J-</td><td>4Q-</td><td>GAA</td><td>CTG</td><td> 380</td><td> ?</td>

<td></td><td>. Ala</td><td>Asp</td><td>Phe</td><td>Ala</td><td>Thr</td><td>Thr</td><td>Ile</td><td>Trp</td><td>Gin</td><td>Gin</td><td>Het</td><td>Glu</td><td>Glu</td><td>Leu</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>GGT</td><td>ATG</td><td>GCT</td><td>CCG</td><td>GCA '</td><td>CTG</td><td>CAG</td><td>CCG</td><td>ACT</td><td>CAG</td><td>GGT</td><td>GCG</td><td>ήίΓΠ</td><td>CCA</td><td> 422</td><td>ir % &amp;</td>

<td></td><td>Gly</td><td>Fly</td><td>Ala</td><td>For</td><td>Ala</td><td>Leu</td><td>Gin</td><td>For</td><td>Thr</td><td>Gin.</td><td>Gly</td><td>Ala</td><td>ΓίΓ - Α »: ϊΐθ u</td><td>For</td><td></td><td>with Λ!</td>

<td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> '*?' • ¹ &gt;’· $</td>

<td></td><td>GCA</td><td>TTC</td><td>GCC</td><td>TCT</td><td>GCT</td><td>TTC</td><td>CAG</td><td>CGG</td><td>CGC</td><td>GCA</td><td></td><td>GGT</td><td>GTT</td><td>CTG</td><td> 464</td><td></td>

<td></td><td>Ala</td><td>Phe</td><td>Ala-</td><td>Ser</td><td>Ala</td><td>Phe</td><td>Gin</td><td>Arg</td><td>Arg</td><td>Ala</td><td>Oly</td><td>Gly</td><td>Wall</td><td>Leu</td><td></td><td>and ! r</td>

<td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td> £</td>

<td> '·</td><td>GTT</td><td>GCC</td><td>TCC</td><td>CAT</td><td>CTT</td><td>CAG</td><td>AGC</td><td>TTC</td><td>CTC</td><td>V. “I V Λ -j</td><td>GTG</td><td>TCT</td><td>TRAY'</td><td>CGC</td><td> 506</td><td>and</td>

<td></td><td>Wall</td><td>Ala</td><td>Ser</td><td>His</td><td>Leu</td><td>Gin</td><td>Ser</td><td>Phe</td><td>Leu</td><td>Glu</td><td>Wall</td><td>Ser</td><td>Tyr</td><td>Arg</td><td></td><td></td>

155 160 165

111

534

<img file="CS9101250A3_D0124.tif" />

ί '·.

&lt;·..

GTT CTG CGT.CAC Val Leu Arg_Kis Leu

170

GCC. CAG CCG TAA G Ala_Gln _Pro __-.

174 SEQ ID NO: 49

L'ka 's e'k in ric typ. sequence: spiral: topology:

'534'basí .......... ......

nucleotide with the corresponding protein single linear

AATXCAOT_AG.T_C.C.A_C.TC-_G-G.T_C-CA-G-CA-AGC-TCT-CTG-GGG-G-AG-T-GT-4-4Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gin Ser 1 10

<td>ttc</td><td>£ 2G.</td><td>CTG</td><td>..AAG.</td><td>TCT</td><td>CTC</td><td>GAA</td><td>CAG</td><td>GTA</td><td>CC-T '</td><td>AAA</td><td>ATT</td><td>CAA</td><td>GGC </td><td> 86</td>

<td>Phe</td><td>Leu</td><td>Leu</td><td>Lys</td><td>. Ser</td><td>Leu</td><td>Glu</td><td>Gin</td><td>Wall</td><td>'Arg</td><td>Lys</td><td>lie</td><td>Gin</td><td>Gly</td><td></td>

<td></td><td></td><td> 15</td><td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td>

<td>AGC</td><td>n.qm</td><td>GGG</td><td>GCT</td><td>CTG</td><td>CAG</td><td>GAA</td><td>AAG</td><td>CTG</td><td>TGC</td><td>GCA</td><td>ACC</td><td>TRAY</td><td>AAA</td><td> 128</td>

<td>Ser</td><td>Gly</td><td>Ala</td><td>Ala</td><td>Leu</td><td>Gin</td><td>Glu</td><td>Lys</td><td>Leu</td><td>Cys</td><td>Ala</td><td>Thr</td><td>Tyr</td><td>Lys</td><td></td>

<td></td><td></td><td></td><td>³⁰</td><td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td>

<td>CTG</td><td>mpn xkJO</td><td>CAC</td><td>GCT.</td><td>GAG</td><td>GAA</td><td>CTG</td><td>GTG</td><td>CTG</td><td>CTC</td><td>GGT</td><td>CAC</td><td>TCT</td><td>CTG</td><td> 170</td>

<td>Leu</td><td>Cys</td><td>His</td><td>For'</td><td>Glu</td><td>Glu</td><td>Leu</td><td>Wall</td><td>Leu</td><td>Leu-</td><td>'Gly</td><td>His</td><td>Ser</td><td>Leu</td><td></td>

IN*".

y / 'Λ iú · í *', '·' i '' • r. ** _; ’?

Vvi ·? ·

- 112'

AND

I &amp;

<td>ii-jU - v · fr ».</td><td>-CGG'ATC</td><td>CCG</td><td>φΓ'Π, -JV</td><td>-GCT</td><td>CCA</td><td>CTG</td><td>AGC</td><td>TCT</td><td>TGC</td><td>CCG</td><td>TCC</td><td>CAA</td><td>GCT</td><td> 212</td>

<td>; 7Xft. ' ^, .. ,; ^ r- ' * ϊίζ '</td><td>óř / ^ lfelle ^</td><td colspan="3">.- 'For TroAla.</td><td>For</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Cys'</td><td>'Pro</td><td>Ser</td><td>Gin</td><td>Ala</td><td></td>

<td>ft ** r. * íff *</td><td></td><td>. ' AT:</td><td></td><td></td><td> ...</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Λ · * »¹ » “.' &gt; . ,'? ’-&gt;·% .</td><td> '55. '</td><td></td><td></td><td></td><td> 60</td><td> ......</td><td></td><td></td><td></td><td> ,65</td><td></td><td> ...</td><td></td><td></td>

<td>-wr- -J</td><td>. '. .TTA- .CAA</td><td>n-TC • J »iw</td><td>GCA-</td><td>GGC</td><td>-TGC.</td><td>TTG '</td><td>^TAGC</td><td>'CAG</td><td>GTC '</td><td>GAC '</td><td>TCC '</td><td>GGT</td><td>CTG '</td><td> 254</td>

<td></td><td>Leu Gin</td><td>Leu</td><td>Ala</td><td>Gly</td><td>Cys</td><td>Leu</td><td>Ser</td><td>Gin</td><td>Leu</td><td>His</td><td>Ser</td><td>Gly</td><td>Leu</td><td></td>

<td></td><td> -· '^! 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80.</td><td></td><td></td><td></td>

<td></td><td>TTC CTG</td><td>TRAY</td><td>CAG</td><td>GGT</td><td>CTG</td><td>CTG</td><td>CAG</td><td>GCT</td><td>. CTA</td><td>GAA</td><td>GGC</td><td>ATC</td><td>TCT</td><td> 296</td>

<td></td><td>Phe Leu</td><td>Type</td><td>Gin</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Gin</td><td>Ala</td><td>Leu</td><td>Glu</td><td>oiy</td><td>Tle</td><td>Ser</td><td></td>

<td></td><td></td><td> 35'</td><td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td>

<td></td><td>CCT GAA</td><td>TTG</td><td>r * rt n σν / τίζ</td><td>CCC</td><td>ACC</td><td>CTG</td><td>GAC</td><td>ACA</td><td>CTG</td><td>CAG</td><td>CTG XU</td><td>GAC</td><td>GTT</td><td> 338</td>

<td></td><td>Pro Glu</td><td>Leu</td><td>kllv</td><td>For</td><td>Thr</td><td>Leu</td><td>Asp</td><td>Thr</td><td>Leu</td><td>Gin</td><td>Leu</td><td>As o</td><td>Wall</td><td></td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td>

<td></td><td>GCC GAC-</td><td>TTC</td><td>GCT</td><td>ACT</td><td>ACC</td><td>ATA</td><td>TGG</td><td>CAA</td><td>CAG</td><td>ATG</td><td>GAG·</td><td>GAA</td><td>CTG</td><td> . 380</td>

<td></td><td>Ala Asp</td><td>Pne</td><td>.Ala</td><td>Thr</td><td>Thr</td><td>Tle</td><td>Trp</td><td>Gin</td><td>Gin'</td><td>Have</td><td>Glu</td><td>Glu</td><td>Leu</td><td></td>

<td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>GGT ATG</td><td>GCT</td><td>ς / k / lr</td><td>GCA</td><td>CTG</td><td>CAG</td><td>CCG</td><td>ACT</td><td>CAG</td><td>GGT</td><td>GCG</td><td>► &lt;rn π a1'j</td><td>CCA</td><td> 422</td>

<td></td><td>Oly Met</td><td>Ala</td><td>For</td><td>Ala</td><td>Leu</td><td>Gin</td><td>For</td><td>Thr</td><td>Gin</td><td>Gly</td><td>Ala</td><td>Met</td><td>For</td><td></td>

<td></td><td> 125·</td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td>

<td></td><td>GCA TTC</td><td>GCC _</td><td>TCT</td><td>GCT</td><td>TTC</td><td>CAG</td><td>CGG</td><td>CC-C</td><td>GCA</td><td>GGC</td><td>GGT</td><td>GTT</td><td>CTG</td><td>4č4</td>

<td></td><td>Ala Pně '</td><td>Ala</td><td>Ser</td><td>Ala</td><td>Phe</td><td>Gin</td><td>Arg</td><td>Arg</td><td>Ala</td><td>Gly</td><td>Gly</td><td>Wall</td><td>Leu</td><td></td>

<td></td><td> 14.0</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td>

^ | íúI s / l ι, ΐΊ_:ώ1

Γ |, |

<img file="CS9101250A3_D0125.tif" />

i?; J

4V, tv t * is driven

£ a

I li '• ^{andd $ tt)

A f

113 .GTT .GCC TCC CATCTT CAG; GAG GTG 'TCT TAC CGC ^ grvVai-ATa; fSer'Hr' leu -Gln'-Ser'P '' - 'Leu' 'GTu'Val * Ser Jyr Arg 155 160 165

506

GTT CTG CTG CAC CTG GCC CAG CCG TAA G 534

Val Leu Arg His

170 ...... .......174 ' ..... ............

Sequence ID No. 50 lialka-S.ek.v-ence -: ........... I ^ 81 ~ bash ----—

<td>sequence type:</td><td>nucleotide</td><td></td>

<td>spiral:</td><td>simple</td><td></td>

<td>topology :</td><td>linear.</td><td></td>

<td>GAATTCAACA-AAACGGTTGA</td><td>CAACATGAAG TAAACACGGT.ACGATGTACC</td><td> 50</td>

<td>ACAAGTTCAC? G.TAAAAAGGG</td><td>TATCGACAATG '... '·</td><td> 81</td>

<td>Sequence ID</td><td>No. 51.</td><td></td><td></td><td></td><td></td>

<td colspan="2">Sequence length:</td><td colspan="2">67+ 67 bases</td><td> ’ -./ .,—</td><td></td>

<td colspan="2">sequence type: </td><td>nucleotide</td><td></td><td></td><td></td>

<td>spiral:</td><td></td><td>double</td><td></td><td></td><td></td>

<td>topology :</td><td></td><td>linear</td><td></td><td></td><td></td>

<td>TCGACATTAT</td><td>ATTACTAATT</td><td>AATTGGGGAC</td><td>CCTAGAGGTC</td><td>CCCTTTTTTA</td><td> .' ⁵⁰</td>

<td>GTAATA '.</td><td>TAATGATTAA</td><td>TTAACCCCTG</td><td>GGATCTCCAG</td><td>GGGAAAAAA?</td><td>. of* what</td>

<td>TTTTAAAÁAG</td><td>CATGCGA</td><td></td><td></td><td></td><td> 67</td>

<td>AAAATTTTTC</td><td colspan="2">GTACGCTTCGA</td><td></td><td></td><td> 67</td>

SXifix-J-t;

- 114.114.

· - i

-w -'4. '&lt;·. ·' ' ^J~ Sequence. ID No. 52 '-' 'V · &lt;ý ./·· -!

£; ' - . ··

-A * *&gt; Sequence length:

/ p '' 'type / sequence':

·· spiral ·: · • - - - topology; + 72 base nucleotide double linear ........

<img file="CS9101250A3_D0126.tif" />

TCGACATTAT ATTACTAATT

GTAATA TAATGATTAA

AATTGGGGAC CCTAGAGGTC

TTAACCCCTG GGATCTCCAG

CCCTTTTTTA pyn »/ a * n ^!^ ΙΤ7λΛλΛ.ΛΛ i

TTTTAAAAG CATGCGGATC CC 72

AAAATTTT0..GTACSGCTAG GGGAAC 72

<td colspan="3">SEQ ID NO 53</td>

<td>Sequence length:</td><td>118 bases</td><td> ' · ·</td>

<td>sequence type:</td><td>nucleotide</td><td></td>

<td>spiral:</td><td>simple</td><td></td>

<td>topology :</td><td>linear. </td><td></td>

<td>AATTCTGGCA AATATTCTGA</td><td>AATGAGCTGT TGACAATTAA TCATCGAACT.</td><td> 50</td>

<td>AGTTAACTAG TACGCAGAGC</td><td>TCAATCTAGA GGGTATTAAT AAŤGTTCCCA</td><td>wo</td>

<td>TTGC-AGGATG ATTAAATG </td><td>and</td><td> 118</td>

SEQ ID NO 54

Sequence length: sequence type: spiral: topology:

+ 35 bases double nucleotide. .,. linear.

AGCTCCATAT GGTACCAGAT CTCTCGAGAG TACTT

<img file="CS9101250A3_D0127.tif" />

- 115 --

<img file="CS9101250A3_D0128.tif" />

GGTATA CCATGGTCTA GAGA.GCTCTC ATGAAGATC '' ϊΛa '' Λ ''.

- ~ 7-7&gt; '' Sequence. ID 55

Sequence Length 'Sequence Type: Spiral:

_topology_:.......

23+ 15 bases nucleotide double linear

AGCTCAGCTG CAGCATATGG TAC

GTCGAG GTCGTATAC '; Sgk in —DD — No — 5 ±

Sequence length Sequence type: Spiral: Topology:

+ 72 bases double linear nucleotide

<td>TCGACATTAT</td><td>ATTACTAATT</td><td>AATTGGGGAC</td><td>CCTAGAGGTC</td><td>CCCTTTTTTA</td><td> 50</td>

<td>GTAATA</td><td>TAATGATTAA</td><td>TTAACCCCTG</td><td>GGATCTCCAG</td><td>GGGAAAAAAT</td><td> 46</td>

<td>TTTTAAAAAG</td><td>CATC-CGGATC</td><td>CC</td><td></td><td></td><td> 72</td>

<td>AAAATTTTTC</td><td>GTACGCCTAG</td><td>GGGAAC</td><td></td><td></td><td> 72</td>

Sequence ID No. 57

Sequence Length ·: '· Sequence Type:

simple basinucleotide

W '; /^;^; f ··. '·'

- ^ Λ'Α '· / ·' -f- -. '-Λ · "*? 'Γ^P 'ť * \ -, *&gt; ../. · V ** · Ϊ \;? * - / / / Ύ * Ϊ' '' '^ 1.^Λ·’¹·.

- * ·. ·&gt; ΤΓΐ'Ύ '*? '-Λ * Λ -:' # '? *. χ. . ",} '\ ^ Ώ&gt;_τ '·'. %, £. .--, ·&gt; ·. · '«-! * - · 7. ·' .-. 'Λ ·' · '» · ί · X · · X^τ &gt;*^&gt; · '- ***&lt;?*···&gt;

Α «ϊ Jv. '/ Χύ-Χ ·' ''

^ .4.7-7, * ·· »,» ΐ4'Γ. '* .....- ktopologie' ::

'·:?. ··:'·' ·' * · ', '·/ . ..

linear ^ r * WW &amp; CA; AAA; CGG · TTG. ACA 'ACA, TGAAGAGT^,?AAA &lt;CAC; GGTíACG. TAT CGA CAA-TGC / TAC TA-A-AAA-GGG^:

J · · jwJ- &lt;

, 42 /X-.A

SEQ ID NO 58

Sequence length: sequence type: spiral: topology:

base nucleotide simple linear

CAT TGT CGA TAC

CCG TGT TTA CTT

CCT

CAT

TTT ·. TRAY

GTT GTC

GTG AAC.TTG

AAC CGT TTT

TGG TAC

GTT G iTC GTA i

<td>SEQ ID NO 59</td><td></td><td></td>

<td>Sequence length:</td><td>, 24 + 24 </td><td></td>

<td>sequence type:</td><td>nucleotide</td><td></td>

<td>spiral:</td><td>double</td><td></td>

<td>topology :</td><td>linear</td><td></td>

<td>AATTCGCATG CGC-ATCCATC</td><td>GATC</td><td> 24</td>

<td>GCGTAC GCCTAGGTAG</td><td>CTAGAGCC</td><td> ,···..·.· 24</td>

117 -

<img file="CS9101250A3_D0129.tif" />

isayí »»¹?.

* # Λ * -,

The claims