Novel modulators and methods of use

New control materials and methods of use

NOVEL MODULATORS AND METHODS OF USE

Full description

Background of the invention

This application generally relates to new formulations and methods for use in preventing, treating or improving ameliorating hyperproliferative disorders, any expansion, recurrence, relapse or metastasis to sites other than the origin. So. In a broad aspect, the present invention relates to the use of protein tyrosine kinase 7 (PTK7) control materials, including antibodies against PTK7 and fusion constructs, for the treatment, diagnosis or prevention of neoplastic disorders. Particularly favorable applications of the present invention provide the use of these PTK7 control materials for immunotherapeutic treatment of malignant diseases including reduction in tumor initiating cell frequency.

Stem and progenitor cell differentiation and cell proliferation are ongoing natural processes that exert a coordinated influence to support tissue growth during organ formation, cell replacement, and repair of most tissues during the lifespan of all living organisms. Differentiation and division decisions are always controlled by many factors and signals that act in balance to maintain cell fate decisions and tissue structure. The normal structure of the tissue is largely maintained by cells responding to microenvironmental conditions that regulate cell division and tissue maturation. Accordingly, cell division and differentiation normally occur only as necessary to replace damaged or dying cells or for growth. Unfortunately, impediment to cell division and/or differentiation can result from a large number of factors including, for example, low or excessive abundance of various signaling chemicals, the presence of variable microenvironmental conditions, genetic mutations or some combination of that. When normal cellular division and/or differentiation are disturbed or impaired to some degree, it can lead to many diseases or disorders including excessive mitotic disorders such as cancer.

Conventional treatments for cancer include chemotherapy, radiotherapy, surgery, immunotherapy (eg, biological response modifiers, vaccines or targeted therapeutics), or combinations thereof. Sadly, too many cancers do not respond or respond only minimally to these conventional treatments, leaving patients with few options. For example, some patients' cancers exhibit gene mutations that make them unresponsive despite the general effectiveness of selected treatments. In addition, depending on the type of cancer, some available treatments, such as surgery, may not be viable alternatives. The limitations inherent in current standard of care treatments are particularly evident when trying to care for patients who have undergone previous treatments and subsequently relapsed. In these cases, failed therapeutic programs and the resulting deterioration of the patient may contribute to the presence of treatment-resistant tumors that invariably manifest themselves as relatively aggressive disease that ultimately proves incurable. Although there have been significant improvements in the diagnosis and treatment of cancer over the years, overall survival rates for many solid tumors remain largely unchanged due to the failure of existing treatments to prevent relapse, tumor recurrence and spread beyond the origin. Therefore, the challenge remains to find more targeted and effective treatments.

A promising area of ​​research involves using targeted therapies to go after the tumor-generating “seed” cells that appear to underlie many cancers. Up to this point, most solid tissues are now known to contain adult tissue-resident stem cell populations that generate the differentiated cell types that comprise the vast majority of that tissue. Tumors arising in these tissues are composed to a similar degree of heterogeneous groups of cells that also arise from stem cells, but they differ greatly in their division and overall organization. Although it is increasingly observed that the majority of tumor cells have a limited ability to divide, there is a very small group of cancer cells (commonly called cancer stem cells or CSC) that have the exclusive ability to spontaneously renew to an extreme degree, which enables the ability to Rooted in tumor re-initiation. More specifically, cancer stem cell theory posits that there is a distinct subset of cells (i.e., CSC) in each tumor (approximately 0.1-10%) capable of unlimited self-renewal and of generating tumor cells that are severely restricted in their ability to divide as a result of their heterogeneity. into tumor progenitor cells and, subsequently, into terminally differentiated tumor cells.

In recent years it has been more clearly demonstrated that these CSC (also known as tumor perpetuating cells or TPC) may be more resistant to conventional chemotherapeutic agents or radiation and therefore remain present beyond standard clinical care treatments for subsequent growth support. Refractory tumors, secondary tumors and spread away from the source. Furthermore, there is increasing evidence to suggest that pathways regulating organ formation and/or self-renewal of normal tissue-resident stem cells are dysregulated or altered in CSC, leading to a persistent increase in the growth of autologous cancer cells. Regeneration (self-renewing cancer cells) and tumor formation. See in general,

Al-Hajj et al., 2004, PMID: 15378087; and Dalerba et al., 2007, PMID: 17548814;

Incorporated here with full reference. Therefore, the adequacy of conventional treatments, as well as more modern targeted ones, is clearly limited by the presence and/or emergence of resistant cancer cells that are able to make the cancer persistent even in the face of these many treatments.

Huff et al., European Journal of Cancer 42: 1293-1297 (2006) and Zhou et al., Nature Reviews Drug Discovery 8: 806-823 (2009)

Incorporated here with full reference. These observations underscore the consistent inability of conventional bulk-reducing agents to substantially increase survival for patients with solid tumors, and by creating an increasingly complex understanding of how tumors grow, recur and spread away from their origin. Accordingly, modern policies for the treatment of neoplastic disorders have recognized the importance of removing, reducing, suppressing and activating or stimulating the differentiation of tumor perpetuating cells so as to minimize the possibility of tumor recurrence or its spread away from the origin leading to relapse. the patient.

Efforts to develop such policies have included recent work involving non-traditional xenograft (NTX) xenograft (NTX) models, in which primary human solid tumor samples are cultured and passaged exclusively in immunocompetent mice. In many cancers, these techniques confirm the existence of subsets of cells that have the unique ability to generate heterogeneous tumors and support their growth to an unlimited extent. As previously suggested, work in NTX models has confirmed that specific CSC subsets of tumor cells appear to be more resistant to volume reduction programs such as chemotherapy and radiation, potentially explaining the disparity between clinical response rates and overall survival. Additionally, the use of NTX models in CSC research has stimulated a fundamental change in drug discovery and initial clinical evaluation of drug candidates that may yield CSC-targeted therapies that have a significant impact on tumor recurrence and spread away from the source, thereby improving patient survival rates. Although progress has been made, the inherent technical difficulties associated with handling primary tumor tissue and/or xenograft, coupled with the lack of experimental programs to characterize the specificity and differentiation potential of CSC, pose major challenges. Accordingly, there remains a fundamental need to selectively target cancer stem cells and to develop diagnostic, prophylactic or therapeutic compounds or methods that can be used to treat, prevent and/or manage hypermitotic disorders.

General description of the invention

The present invention provides these and other objectives which, with a broad scope, relate to methods, compounds, compositions and manufactured devices that may be used in the treatment of PTK7 associated disorders (such as hypermitotic disorders or proliferative disorders). To this point, the present invention provides novel protein tyrosine kinase 7 (or PTK7) control agents that effectively target tumor cells and/or cancer stem cells and can be used to treat patients with a wide variety of malignant diseases. As explained in more detail here later, there are currently multiple known PTK7 isoforms and one or more of them may preferably include or accompany the declared controls. Additionally, in particular embodiments the disclosed PTK7 control substances may include any compound that recognises, competes with, supports, antagonizes, interacts with, binds or conjugates a PTK7 polypeptide or gene (or part thereof) and adjusts, alters, alters or modifies the effect of the PTK7 protein on one Or more physiological pathways. Therefore, broadly the present invention generally relates to isolated PTK7 control materials and their use. In preferred embodiments the invention relates more specifically to isolated PTK7 control materials comprising antibodies (i.e., antibodies that bind, react with, or conjugate at least one isoform of PTK7). In addition, as explained in greater detail below, these control substances can be used to provide useful drug formulations for the prevention, diagnosis or treatment of neoplastic disorders.

In selected embodiments of the invention, PTK7 control materials may comprise the PTK7 polypeptide or portions thereof, either in isolated form, fused to, or conjugated to other portions (e.g., Fc-PTK7, PEG-PTK7, or PTK7 conjugated to a targeting moiety). In other selected embodiments the PTK7 control substances may include PTK7 antagonists which, for the purposes of the present application, will mean any structure or compound that recognises, competes with, interacts with, binds or conjugates PTK7 and neutralizes, eliminates, reduces, sensitizes, reprograms, inhibits or controls On the growth of neoplastic cells, including tumor-initiating cells. In preferred embodiments the PTK7 control substances of the present invention include PTK7 antibodies, or parts or derivatives thereof that have been shown to, to an unexpected degree, inactivate, neutralize, reduce, reduce, decrease, control, minimize, reprogram, eliminate, or otherwise Others inhibit the ability of tumor-initiating cells to spread, retain, increase in size, divide, or otherwise facilitate the revival, recurrence, renewal, and/or spread away from the origin of the tumor cells. In particularly preferred embodiments the antibodies or immunoactive moieties may be conjugated or combined with one or more anticancer agents (e.g., a cytotoxic agent).

In selected embodiments the appropriate PTK7 control materials may comprise an antibody having a light chain variable region and a heavy chain variable region wherein said light chain variable region comprises an amino acid arrangement having at least 60% homology % with an amino acid arrangement selected from the group consisting of amino acid arrangements as stated in the arrangement definition No. 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58 and 60, wherein said heavy chain variable region comprises an acidic arrangement An amino that has at least 60% homology to an amino acid arrangement selected from the group consisting of amino acid arrangements as stated in the arrangement definition No.: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, and 61.

Certainly, in light of the present clarification, those skilled in the art can easily identify CDRs flanking both the aforementioned heavy and light chain variable regions and use those CDRs to engineer or manufacture CDR-grafted or human-specific, hybrid antibodies without additional experimentation. Thus, in selected embodiments the present invention relates to antibodies against PTK7 comprising a CDR of one or more variable region arrangements previously described in Figure 6(a) and Figure 6(b). In preferred embodiments these antibodies include single-copy antibodies and, in more preferred embodiments also comprising humanized or engrafted antibodies with a CDR, chimeric. As described in more detail below other embodiments also include these antibodies conjugated or conjugated to one or more cytotoxic agents.

Accordingly, in other embodiments the present invention will comprise a PTK7 control material selected from the group consisting of hSC6.23, hSC6.24, hSC6.41 and hSC6.58. Additional embodiments relate to a control substance PTK7 comprising a humanized antibody wherein said humanized antibody comprises a light chain variable region and a heavy chain variable region wherein said light chain variable region comprises an amino acid arrangement having at least 60% homology to An amino acid arrangement selected from the group consisting of amino acid arrangements as stated in the arrangement definition No. 62, 64, 66 and 68 and wherein said heavy chain variable region comprises an amino acid arrangement having at least 60% homology to an amino acid arrangement selected from the group consisting of amino acid arrangements as stated in arrangement definition Nos. 63, 65, 67 and 69. .

As previously shown one aspect of the invention includes an unexpected association of PTK7 polypeptides with cancer stem cells, thus, in certain other embodiments the invention will include a PTK7 control substance that reduces the rate of tumor-initiating cells upon administration to an organism. Preferably the reduction in incidence is determined using limiting dilution analysis in vitro or in vivo. In particularly preferred embodiments such analysis is performed using an in vivo restriction dilution analysis involving transplantation of live human tumor cells into immunocompromised mice. Alternatively, restriction dilution analysis can be performed using in vitro restriction dilution analysis involving limiting dilution sedimentation of live human tumor cells under in vitro colony support conditions. In either case, the analysis, calculation or quantification of the reduction in occurrence rate preferably involves the use of Poisson distribution statistics to provide an accurate calculation. It must be recognized that, although these methods of quantification are preferable, it is also possible to use other, less labor-intensive methods such as flow cytometry or immunohistochemistry to provide the desired values, which are accordingly clearly hoped to be within the scope of the present invention . In these cases, a reduction in the rate of presence can be determined using flow cytometric analysis or immunohistochemical identification of tumor cell surface markers known to be nourishing to tumor-initiating cells.

Accordingly, in another preferred embodiment the present invention includes a method for treating a PTK7 associated disorder comprising administering a therapeutically effective amount of a PTK7 control substance to an organism in need such that the rate of presence of tumor initiating cells is reduced. The associated PTK7 disorder preferably includes a neoplastic disorder. Again, the reduction in the incidence of tumor initiating cells is preferably determined using restriction dilution analysis in vitro or in vivo.

In this aspect, it must be recognized that the present invention is based, at least in part, on the discovery that PTK7 immune genes accompany the tumor cells (i.e., cancer stem cells) involved in the cause of polyplasia. More specifically, the present application unexpectedly demonstrates that the administration of several representative PTK7 control agents can control, reduce, reduce, inhibit or eliminate tumorigenic signaling by tumor initiating cells (i.e., reduce the rate of presence of tumor initiating cells). . These few signals, whether by reducing, neutralizing, reducing, eliminating, reprogramming or suppressing the activity of tumor-initiating cells or by adjusting the shape of the tumor cell (eg, induced differentiation, niche disruption), allow in turn There is a more effective treatment for PTK7-associated disorders by inhibiting tumor formation, tumor retention, increasing the size and/or spreading away from the origin and recurrence.

In addition to the previously mentioned association with carcinoma marrow cells, there is evidence that PTK7 isoforms can be involved in angiogenesis, endothelial cell migration and specific developmental signaling cascades involved with tumorigenesis (i.e., Wnt signaling pathways). Interfering with these cell-cell interactions, using the novel PTK7 control agents described here, may sense or treat a disturbance by more than one mechanism (i.e., reducing tumor-initiating cells and disrupting oncogenic pathway signaling) to provide additional or adjunctive effects. . There are also other preferred embodiments that utilize the PTK7 cell surface endocytosis to deliver an anticancer agent through a control substance. In this aspect, it must be understood that the present invention is not limited to any special mechanism of action, but rather includes the widespread use of control substances declared for the treatment of PTK7-associated disorders (including variant neoplasia).

Thus, further aspects of the present invention demonstrate the ability of the described modifiers to effectively inhibit tumorigenic survival pathways while continually suppressing tumor-inducing cells. These polyreactive PTK7 modulators (eg, PTK7 antagonists) can be shown to be particularly effective when used in combination with standard-of-care anticancer agents or standard debulking agents. Accordingly, preferred embodiments of the present invention comprise the use of the described modifiers as anti-metastasis agents for maintenance therapy after initial treatment. Additionally, one or more anti-PTK7 antibodies (e.g. antibodies that specifically bind to two specific epitopes on PTK7) can be used in combination according to current studies. In addition, as described in more detail below, the PTK7 modulators of the present invention can be used in a conjugated or unconjugated state and, optionally, as a sensitizing agent in combination with various biologically or chemically proven anticancer agents.

Accordingly another preferred embodiment of the present invention includes a method of sensitizing a tumor in an individual for treatment with an anticancer agent including the step of administering the PTK7 modifier to said individual. Other embodiments include a method of reducing metastases after treatment involving the administration of modified PTK7 to an individual in need. In a specific favorable aspect of the invention, the PTK7 modulator specifically causes tumor reduction at the frequency of an inducible cell as determined using a specific dilution analysis in vivo or in vitro.

More generally preferred embodiments of the invention include a method for treating a PTK7 disorder in an individual in need thereof including the step of administering PTK7 to the individual. In certain preferred embodiments the PTK7 modifier is accompanied by (such as coupled with) an anticancer agent. In other embodiments the PTK7 modifier also dissolves after associating or binding with PTK7 on or near the cell surface. In addition, beneficial aspects of the present invention, including any inhibition of a signaling pathway and collateral benefits, can be achieved whether an individual's tumor tissue has high levels of PTK7 or low levels of PTK7 as compared to normal adjacent tissue.

In another aspect also, the present invention includes a method of treating an individual suffering from a neoplastic disorder, including the step of administering a therapeutically effective amount of at least one of the PTK7 modifiers. Preferred embodiments include giving antibody modifiers that solubilize where, in other selected embodiments, the antibody modifiers that solubilize are conjugated or conjugated to a cytotoxic agent.

Other embodiments relate to a method of treating an individual suffering from a PTK7-associated disorder including the step of administering a therapeutically effective amount of at least one PTK7 depletion modifier.

In another embodiment the present invention provides methods for maintenance therapy wherein the indicated modifiers or effectors are given over a period of time after an initial procedure (such as chemotherapy, radiation or surgery) designed to remove at least a portion of the tumor mass. These regimens can be administered over a period of weeks, a period of months or even years where PTK7 modulators can act prophylactically to inhibit metastasis and/or relapse. In still other embodiments the indicated modifiers may be administered in combination with known debulking regimens to prevent or reduce metastases, tumor survival or relapse.

It is further appreciated that the PTK7 modifiers of the present invention can be manufactured and selected to interact a single PTK7 isoform or a few selected isoforms (such as provided by strand variants) with a protein or, conversely, can comprise a pan-PTK7 modifier that interacts with or associates with some Or all PTK7 isoforms (five isoforms have been identified so far). More specifically, as demonstrated here, preferred modulators such as antibodies can be generated and selected to react with control domains found by single strand variants (e.g., at specific exon junctions) or with Ig control domains maintained across many or all PTK7 isoforms. This is unique to the present invention in that certain isoforms can preferentially appear on TIC (tumor initiating cells) and can thus serve as therapeutic targets to provide selective reduction in tumorigenic cell frequency and/or depletion of cancer stem cell populations.

Accordingly, in a selected embodiment the invention includes a control substance that includes all PTK7. In another selected embodiment the invention includes a PTK7 control substance that is specifically immunologically conjugated to one or more sequence variants or similar motifs. It is preferable to select the argument variables from the group that includes similar form a, similar form b, similar form c, and similar form d. In still other embodiments the present invention includes a method for treating an organism in need thereof including administering a therapeutically effective amount of control substances including each PTK7. Other embodiments further include a method of treating an organism in need including administering a therapeutically effective amount of a PTK7 control substance that is immunologically conjugated to one or more similar forms.

Beyond the scope of therapeutic uses described above it should also be recognized that control substances of the present invention can be used to diagnose disorders of PTK7 and, in particular, hypermitotic disorders. In some embodiments the control substance can be given to the object and identified or monitored in the object. Those of skill in the art will recognize that such control materials may be marked or associated with markers or laboratory materials as disclosed below and identified using any one of a number of standard techniques (e.g., MRI, CAT scan, PET scan, etc.).

Thus, in some embodiments the invention includes a method for diagnosing, identifying or monitoring a disorder associated with PTK7 in vivo in an individual in need thereof including the step of administering a PTK7 modifier.

Therefore, in other cases, control materials can be used in diagnostic sessions in the laboratory using procedures recognized by the art. Accordingly, a preferred embodiment includes a method for diagnosing a hypermitotic disorder in an organism in need, including the steps of:

(a) Obtain a tissue sample from the organism in question;

(b) the tissue sample came into contact with at least one PTK7 control; And

(c) Identification or quantification of the control substance PTK7 present in the sample.

These methods can easily be demonstrated in combination with existing demand and can be easily performed using generally available commercial technology such as automatic plate readers, dedicated reporter systems, etc. In selected embodiments the PTK7 control material will associate with tumor perpetuating cells present in the sample. In other preferred embodiments the identification or quantification step includes reducing and determining the incidence of tumor initiating cells. In addition, a constrained dilution analysis can be performed as previously explained above and it is preferable to statistically use a Poisson distribution to provide an accurate calculation of the presence rate reduction.

In a similar aspect the present invention also provides kits useful in the diagnosis and monitoring of PTK7-associated disorders such as cancer. At this point the present invention preferably provides an artificial device useful for diagnosing or treating PTK7-associated disorders including a receptacle containing a PTK7 control substance and instruction material for using said PTK7 control substance to treat or diagnose a PTK7-associated disorder.

Other preferred embodiments of the invention also exploit the properties of the disclosed control materials as a useful tool for identifying, isolating-fractionating or feeding populations or subsets of tumor-initiating cells through methods such as flow cytometric analysis, fluorescence-activated cell sorting (FACS) or laser fractionation.

Accordingly, another preferred embodiment of the present invention relates to a method for identifying, isolating, fractionating or feeding a population of tumor-initiating cells including the step of contacting said tumor-initiating cells with a control substance PTK7.

The above is a summary and therefore necessarily contains simplifications, generalizations, and omissions of details. As a result, those skilled in the art will understand that the summary is illustrative only and is not intended to be in any way specific. There are aspects, features, and advantages of the methods, formulations, tools, and/or other subject matter described here that will become apparent in the teachings described here. The summary is provided to introduce a selection of concepts in a simplified form described further below in the detailed description. This summary is not intended to identify major features or essential features of the selected subject material, nor is it intended to be used as an aid in defining the scope of the selected subject material.

Brief explanation of the drawings

Figures 1(a)-1(c) show, respectively, the nucleic acid arrangement encoding human PTK7 (SEQ ID NO: 1), the amino acid arrangement of a representative human PTK7 variant (SEQ ID NO: 2) and Figure 1(C). Shows the lined up and coded arrangements of four representative isoforms of PTK7 (definition of arrangement numbers: 3-6) Whereas the underlined segment in Figure 1(a) represents the PTK7-1 open reading frame, the underlined segment in Figure 1(b) represents the extracellular control domain of PTK7 as shown here and Figure 1(c) shows. Protein alignment of four known representative isoforms of the human PTK7 protein as recorded in the NCBI Gene database (Protein accessions: isoform a = NP_002812, isoform b = NP_690619; isoform c = NP_690620; isoform d = NP_690621). Figure 1(c) shows the patterned peptides, “GxGxFGxV,” “HRDLxxxN,” and “SDVWSxG” as identification order numbers: 11-13, respectively.

Figure 2 is a schematic representation of PTK7 gene expression levels in untreated (−) and irinotecan (+) mice as measured using a whole transcriptome array from abundant populations of a highly enriched tumor progenitor cell (TProg), a persistence cell. A pre-tumor perpetuating cell (TPC) and a non-tumorigenic cell (NTG) from a subset of a complete colorectal tumor specimen;

Figure 3 shows a schematic representation of the relative gene expression levels for human PTK7 in abundant tumor progenitor cell (TProg) and tumor precursor cell (TPC) populations generated from mice carrying one of three pancreatic or anal colorectal tumor cell lines from a nonclassical xenograft (NTX). ) are different, and are equivalent to abundant non-tumorigenic cell populations (NTG) as measured using quantitative RT-PCR;

Figures 4(a) and 4(b) show schematic representations of relative human PTK7 gene expression levels as measured using RT-PCR in whole anal colon tumor samples from patients with Stage I-IV disease, corresponding to the average expression in normal anal and colon tissue ( Figure 4(a)) or aligned with normal adjacent tissue (Figure 4(b));

Figures 5(a) and 5(b) show schematic representations of relative or absolute gene expression levels, respectively, of human PTK7 genes as measured by RT-PCR in whole tumor samples (gray dot) or NAT aligned (white dots) from patients with... One of eighteen different solid tumor types;

Figures 6(a) and 6(b) provide, in tabular form, contiguous amino acid arrangements of heavy and light chain variable regions from a number of representative human and murine PTK7 modifiers isolated, cloned and engineered as described in the examples herein;

Figures 7(a)-7(e) provide, in schematic and tabular representations, chemical-physiological features of representative PTK7 modulators Where Figure 7(a) shows the binding features of specific modifiers for human and murine PTK7, Figure 7(b) provides affinity data, binding and overlapping activity of selected modulators. Figures 7(c) and 7(d) show comparative binding features for a selected murine modulator and its human counterpart. Figure 7(e) provides binding affinities for selected modifiers for a human PTK7 and its murine counterpart;

Figures 8(a)-8(g) show various PTK7 constructs according to the present invention where Figures 8(a)-8(f) provide amino acid arrangements of six PTK7 modifier variants in the form of Ig-PTK7-ECD constructs wherein the control domain section is varied. The seven Ig control domains for the extracellular portion of PTK7 are schematically shown in Figure 8(g) with ELISA-derived binding regions for various PTK7 modifiers indicated by parentheses;

Figures 9(a)-9(e) show the expression levels of PTK7 protein in different tumor lysates and in NTX samples, while Figures 9(a)-9(d) show the levels of tumor lysates for different disease stages and tumors as compared to comparative examples from adjacent tissue. Figure 9(e) provides histograms showing staining of non-classical human intrusive patches with selected modifiers, where the comparative example staining (gray) is compared to staining on non-tumorogenic (dashed line) and putative cancer stem cell populations. (putative cancer stem cell populations) (line direct);

Figures 10(a)-10(e) schematically illustrate the ability of the selected modifier of the present invention to phosphorylate upon binding to PTK7 on a cell surface where Figure 10(c) shows the fluorescence change associated with the representative modifier (i.e., SC6.10.2 means H10 in Figure 10 (c) Figures 10(a) and 10(b) are comparative examples, and Figure 10(d) shows representative rates from hybridoma supernatants that can be scanned for aliquots compared with pure comparison examples (SC6.2.35, SC6.10.2 and SC6. 25.1 means H2.35, H10.2 and H25.1 respectively) and Figure 10(e) shows the extent of decay at different rates (Each data point represents a specific rate) where the dashed line indicates the basic share of the number of PTK7 rates that were internalized by the cell in response to binding as shown on the y axis;

Figures 11(a)-11(d) schematically illustrate the ability of the described modifiers to specifically induce cytotoxic agent delivery and inducible cell killing. Figure 11(a) shows the use of three representative modifiers (SC6.2.35, SC6.10.2 and SC6). 25.3 means H2.35, H10.2 and H25.3 respectively) as target moieties to direct cytotoxic payloads to cells expressing PTK7 and where Figures 11(b)-11(d) show the ability of four additional representative modifiers to abolish three specific cell lines where In each figure a downward sloping curve indicates killing of a cell by a degraded toxin;

Figure 12 shows the ability of three representative PTK7 modulators to specifically induce the delivery of cytotoxic agents and thus reduce tumor cell viability in different NTX tumor cell lines;

Figures 13(a)-13(c) indicate the ability of the shown modifiers to reduce the frequency of tumor-sustaining cells and inhibit their oncogenic potential as Figures 13(a) and 13(b) show that modulator-mediated delivery (i.e., SC6.H2 tagged with SC6 2.35) Cytotoxic agents affect the viability of two specific NTX mammary tumor cell populations. Figure 13(c) shows the reduced tumorigenesis of treated cell lines when transplanted into an immunodeficient mouse; And

Figure 14 illustrates the ability of representative human-derived PTK7 modulators of the present invention to effectively cause immunologically specific delivery and internalization of cytotoxic agents to PTK7-expressing cells.

Detailed description

1. the introduction

Although the present invention can be embodied in many different ways, what are declared here are special illustrative embodiments of it that represent the basic principles of the invention. It must be emphasized that the present invention is not limited to the particular embodiments described. In addition, any section headings used herein are for organizational purposes only and should not be considered restrictive of the subject matter described.

As noted previously, it has been surprisingly shown that expression of PTK7, including various isoforms, is associated with oncogenic growth and hypermitotic disorders and that these ligands provide useful tumor markers that can be exploited in the treatment of related diseases. More specifically, it has been shown that PTK7 control substances such as those reported here can be used to a useful degree in diagnosing, treating, treating or preventing neoplastic disorders in organisms in need. Accordingly, although there are preferred embodiments of the invention that will be described more extensively below, specifically in the context of cancer stem cells and their interactions with the stated control substances, those skilled in the art will recognize that the scope of the present invention is not limited to those representative embodiments. Rather, the present invention and its complementary claims relate broadly and expressly to PTK7 control substances and their use in the diagnosis, treatment, treatment or prevention of a variety of PTK7-associated or PTK7-mediated disorders, including oncogenic or hypermitotic disorders, regardless of any mechanism of action. A particular or specifically targeted tumor component.

It should be further recognized that, in contrast to various prior art inventions, the present invention relates generally to immunologically specific controls of various isoforms of PTK7 as opposed to general protein tyrosine kinase controls. That is, although classes of protein tyrosine kinase receptors are highly implicated in many types of disorders and are generally targeted for therapeutic intervention, specific PTK7 controls have so far received little attention. In part this may be due to the belief that interference with PTK activity (specifically with small molecules interacting with protected kinase control domains) is more therapeutically effective as the abundance of the kinase can compensate for any specific binding to particular members of this class. In addition, PTK7 is reported to include an inactive kinase control domain (or pseudokinase control domain) which could hamper its use as a therapeutic target.

In contrast, the present invention comprises the use of special immunomodulators that preferentially interact with one or more isoforms of PTK7 to provide therapeutic benefits. As briefly demonstrated above in certain embodiments the modifiers of the present invention may be generated and selected to associate with a single PTK7 isoform while in other embodiments the selected modifiers may interact with more than one or all of the PTK7 isoforms. In latter embodiments the present invention can include modifiers that conjugate or interact with more than one PTK7 isoform thus providing an unexpected synergistic or additive effect that could permit analgesia of more than one PTK7-mediated pathway.

More generally, as demonstrated in the present application, immunologically specific PTK7 modulators can be used in an effective manner to target, abolish or inhibit tumorigenic cells and treat PTK7-associated disorders (e.g., neoplasia). As used herein, PTK7 disorder means any disorder or disease (including proliferative disorders) that is defined, diagnosed or determined by a deviation from the original type of PTK7 expression during the course or causes of the disease or disorder. In this regard, a deviation from the original type could include, for example, increased or decreased levels of PTK7 expression, abnormal expression of PTK over certain identifiable cell populations, or abnormal expression of PTK7 at an inappropriate phase or state of the life cycle. cell.

In addition to the general association described above, the inventors have additionally discovered a hitherto unknown morphological specific association between selected “tumor initiating cells” (TIC) and PTK7. In this aspect, it has been shown that the selected tumor initiating cells exhibit high levels of PTK7 when compared with normal, non-tumorigenic (NTG) tissue cells, which together include many solid tumors. Therefore, PTK7 isoforms include tumor-associated markers (or antigens or immunogens) and have been shown to provide influential factors to identify and suppress a tumor-initiating cell and the associated oncogenesis causes altered levels of proteins on cell surfaces or in the tumor microenvironment. More specifically, the inventors further discover that PTK7 control materials, including immunologically active antigens and antibodies that bind or interact with proteins, significantly reduce the rate of presence of tumor precursor cells and are therefore useful in eliminating, reducing, attenuating, reducing, inducing differentiation, or otherwise Impede or limit the ability of these tumor-initiating cells to remain dormant and/or continue to fuel tumor growth, spread away from the origin, or recurrence of the tumor in a patient. As explained in more detail below, the TIC tumor cell subpopulation consists of both tumor perpetuating cells (TPC) and highly proliferative tumor progenitor cells (TProg).

In light of these discoveries, those skilled in the art will recognize that the present invention provides PTK7 control materials and their use in reducing the rate of presence of tumor initiating cells. As explained more extensively below, the PTK7 control materials of the invention broadly comprise any compound that recognises, interacts with, competes with, antagonizes, interferes with, binds, supports, or accompanies PTK7 or PTK7 or genes thereof, and by means of such interactions, the materials Controlling PTK7 thus reduces or modifies the rate of presence of tumor-initiating cells. Representative controls reported herein include nucleotides, oligonucleotides, polynucleotides, peptides or polypeptides. In particular preferred embodiments the selected controls will include immunologically active anti-PTK7 antibodies or fragments or derivatives thereof. These antibodies may be antagonistic or antagonistic in nature and may optionally be associated with or conjugated to a cytotoxic agent. In other embodiments, the control materials of the present invention will comprise a PTK7 structure including a PTK7 isoform or an active portion thereof. It must be recognized that these structures include fusion proteins and may include active control domains of other polypeptides such as immunoglobulins or biological response control substances. In other respects as well, the PTK7 control material will involve a DNA assembly that produces the desired effects at the genomic level. There are still other controlling materials that are consistent with current teachings, which will be explained in detail below.

Whatever form the control material is ultimately selected, it should preferably be in an isolated and pure state before being introduced into the organism. In this respect the term “isolated PTK7 modulator” will be interpreted broadly and in accordance with standard pharmaceutical practice to mean any preparation or formulation comprising the control substance in a state substantially free of undesirable contaminants (biological or other). As explained in some detail below, these preparations may be pure and formulated upon request using many techniques recognized by the art. Of course, it must be recognized that these “isolated” preparations can be deliberately formulated or combined with inactive or active ingredients on demand to improve the commercial, manufacturing or therapeutic aspects of the final product and provide drug formulations.

II Physiological PTK7

Protein tyrosine kinase (PTK7), also known as colon adenocarcinoma kinase 4 (CCK4), is a tyrosine kinase receptor that is mainly transcribed from normal human melanoma cells (Lee et al., Oncogene 8(12), 1993) and separately from tumor tissue. colon cancer (Mossie et al., Oncogene 11(10), 1995). The PTK7 gene is located at 6p21.1-p12.2. Five homologs for human PTK7 are transcribed from testicular cDNA:

(Jung, Ji et al., Biochim Biophys Acta 1579, 2002)

The relative abundance of isoforms varies between testis and hepatoma or colon carcinoma lines, but the functional significance of these isoforms, if they exist, is unknown. Bioinformatic analyzes suggest that the mouse could express a soluble Ptk7-like form of alternatively spliced ​​mRNAs:

(Forrest, Taylor et al., Genome Biol 7, 2006)

For the purposes of this application the terms PTK7 and CCK4 are to be used interchangeably and include argumentative variants, isoforms, specific analogues and analogues of human PTK7 unless otherwise indicated by contextual restrictions. It is further appreciated that the terms can also refer to any derivative or portion of a native or variant form of PTK7 that includes an epitope to which the PTK7 protein can specifically bind (e.g., an immunologically active fragment or antibody).

The full-length PTK7 protein is a type I transmembrane protein, with an extracellular control domain (ECD) of 674 amino acids, followed by a short TM elongation phase and a cytoplasmic control domain of 345 amino acids. A complete DNA sequence of a representative isoform of human PTK7 (i.e., PTK7-1 transcription variant) has Genbank accession number: NM_002821 and is represented in Figure 1(a) (sequence identification number: 1). Likewise, a representative amino acid arrangement of the full-length PTK7-1 protein is shown in Figure 1(b) (Arrangement Definition No.: 2). It is noted that the PTK7 protein in the arrangement definition No.: 2 differs from the translation product of the underlined DNA arrangement from the arrangement definition No.: 1 (meaning the similar form a shown in the arrangement definition No.: 3) in the presence of a point mutation (L -> P) at Position 93 in Figure 1(b). For isoforms Figure 1(c) shows the alignment of the amino acid arrangements of four representative isoforms of PTK7 as recorded in Genbank (Protein accessions: isoform a = NP_002812, Arrangement Definition No. 3; isoform b = NP_690619, Arrangement Definition No.: 5; i.e. c = NP_690620, i.e. arrangement no.: 6; i.e. d = NP_690621, i.e. arrangement no.: 4). The previously mentioned arrangement is indicated in the isoform a corresponding to the translation product from the open reading frame of PTK7 variant 1 mentioned in Figure 1(a) which represents the longest of the isoforms. The other isoforms encode extracellular control domains that lack different Igcam control domains relative to the isoform a, as shown. All isoforms code for the same control domain within the cell. Conservative subtypes in the catalytic control domain of protein serine/tyrosine kinases are shown below the PTK7 alignments, as explanations for changes in the PTK7 protein due to inhibition of its kinase control domain (eg, changes in control subdomains I and VII).

In any case the full-length mature PTK7 ECD comprises seven immunoglobulin-like control domains while, as shown in Figure 1(c), different splicing variants encoding PTK7 isoforms differ in their ECD construction. All isoforms comprise a cytoplasmic control domain with basic homology to that found in the general class of tyrosine kinases. However, PTK7 lacks identifiable tyrosine kinase activity and, for example, belongs to the subfamily of pseudokinases in which several amino acid changes in control subdomains of a conservative kinase lead to weak ATP binding:

(Kroiher et al. Bioessays 23(1), 2001)

Specifically, basic residues in subdominant domains I and VII of PTK7 are altered such that direct interactions with the phosphates are non-transferable from ATP, as well as the binding of the cofactor Mg2+, which acts as a bridge for the phosphates, to be weak:

(Hanks et al., Methods Enzymol 200, 1991)

It is further estimated that PTK7 polypeptides in accordance with the present invention can be in the form of a mature protein or can be part of a larger protein such as a fusion protein. It is often useful to include an additional amino acid arrangement including a secretory or primary sequence, a post-, pre- or post-pre protein arrangement, or an arrangement that aids in purification such as an affinity tag, for example, but not limited to, several histidine residues, a FLAG tag, an HA tag, or myc tag. Additional arrangements can also be used that can provide stability during modular production. These arrangements can optionally be removed if necessary by entering a breakable arrangement such as an additional arrangement or part thereof. Thus, the PTK7 polypeptide as demonstrated here can comprise fused structures with accessory segments containing other polypeptides. Additional arrangements and signs of affinity are well known in the art and can be generated using standard biochemical techniques.

The biological importance of PTK7 function independent of the inactive kinase control domain can be inferred from the presence of conserved homologues from Hydra across Drosophila to Hen and Adam, each of which can be predicted by rank analysis to lack kinase activity ( Kroiher et al., 2001 ). Based on the high conservation of a particular TM control domain pattern that is accompanied by a tendency for helix-helix association and that the RTK typically becomes dimerized in response to ligand binding, it is proposed that the TM control domain could mediate PTK7 dimerization ( Kroiher et al., 2001 ). A recent study suggests that the PTK7 TM control domain does not induce preferential self-association (Kobus et al., Biochemistry 44(5), 2005), but the study does not rule out heteromeric interactions with TM control domains of other RTKs or members of the signaling complex. Therefore, the PTK7 pseudokinase control domain is not expected to directly transmit signaling but could interact as a scaffold for other molecules in the signaling pathway, or could use other tyrosine kinase(s) (Kroiher et al., 2001).

Human PTK7 is not expressed in adult colon although it is expressed in fetal colon and various colon adenocarcinoma-derived cell lines (Mossie et al. supra, 1995), and additionally in metastatic anal colon carcinoma (Saha et al., Science 294(5545). (2001). Other normal tissues and cells reported to express PTK7 include lung, thyroid, and ovarian (Mossie, Jallal et al. 1995), thymic CD4+ migratory T cells (Haines et al., J Exp Med 206(2) 2009), and normal myeloid progenitor cells. and CD34+CD38- bone marrow cells (Prebet et al., Blood 116(13), 2010). For cancerous tissues, PTK7 has also been shown to be expressed in colon adenocarcinoma cells (Mossie et al. 1995); in AML samples (Muller-Tidow, et al Clin Cancer Res 10(4), 2004); In CD34-pre-TALL cells (Shangguan et al., J Proteome Res 7(5) 2008) and in gastric adenocarcinoma (Gorringe et al., Genes Chromosomes Cancer 42(3), 2005). Importantly, although mainly transcribed from normal temporal cells, loss of PTK7 has been reported in metastatic melanoma (Easty et al., Int J Cancer 71(6), 1997). PTK7 can also be lost in certain breast cancers involving deletions for chromosome 6p21 (Piao et al., Genes Chromosomes Cancer 30(2), 2001), despite the diversity of breast cancer cell lines (Su et al., J Cancer 1 2010). PTK7 is also a lung adenocarcinoma, where stronger expression levels correlate with a more favorable prognosis in those tumors (Endoh et al., J Clin Oncol 22(5), 2004). Fine mapping of amplifications of the 6p12-p21 region in osteosarcoma demonstrates that increases in gene copy number do not necessarily cause overexpression of PTK7, as determined by qRT-PCR (Lu et al., Mol Cancer Res 6(6), 2008). .

The ligand(s) for PTK7 are not known, although PTK7 is associated with diverse biosignaling pathways and developmental processes. The construction of an immunoglobulin-like ECD control domain of protein suggests that it may participate in or sense cell-cell contact and adhesion. The Drosophila homologue of PTK7, OTK, associates with plexin as a potential co-receptor for semaphorin signaling during axon guidance (Winberg et al., Neuron 32(1), 2001). An interaction between PlexinA1 and PTK7 has recently been demonstrated in Xenopus (Wagner et al., Biochem Biophys Res Commun 402(2) 2010) while a chick homologue of PTK7, KLG, has been shown to interact with PlexinA1 and Sema6D in a complex important for chick heart formation (Toyofuku et al. Genes Dev 18(4), 2004. Soluble PTK7 (sPTK7) has been used to elucidate the role of PTK7 in VEGF-stimulated angiogenesis, as well as in vitro tube formation, migration and invasion of human endothelial cells (Shin et al., Biochem Biophys Res Commun 371(4), 2008). Murine PTK7 is also associated with epidermal wound healing processes, which require actin cytoskeletal recognition and cell migration (Caddy et al., Dev Cell 19(1), 2010).

For specific signaling cascades, PTK7 is shown to be a component of several Wnt signaling pathways important for development (Puppo et al., EMBO Rep 12(1), 2010). Mice expressing a severe or no mutation in Ptk7 die perinatally, showing phenotypes consistent with a role for PTK7 in the planar cell polarity (PCP) pathway (Lu et al., Nature 430(6995), 2004). Similarly, chuzhoi mice harbor PTK7 proteins mutations with three amino acid insertions in the ECD demonstrate PCP-deficient phenotypes (Paudyal, Damrau et al. 2010). Murine PTK7 has been shown to genetically interact with other PCP genes, including Vangl2 (Lu et al., 2004), Celsr1 (Paudyal, Damrau et al. 2010), Scrb1 and Grhl3 (Caddy et al., 2010). The matrix metalloproteinase type 1 transmembrane (MT1-MMP) cleaves PTK7 to release soluble PTK7 (i.e., sPTK7), and dysregulation of MT1-MMP activity and sPTK7 production leads to flanking band defects in zebrafish, also consistent with a role for PTK7 in the PCP pathway. (Golubkov et al., J Biol Chem 285(46), 2010). in Wnt is expressed in mouse cells ( Puppo et al., 2010 ). Additionally, a conserved TCF/LEF-binding site in the PTK7 promoter postulates the presence of a Wnt response gene and could explain PTK7 overexpression in certain anal colorectal cancers, as these tumors are often dysregulated for Wnt pathway signaling (Katoh, Int J Mol Med 20(3), 2007).

In cancerous tissues, in addition to potentially modulating the Wnt pathways described above, PTK has been shown to transmit pro-proliferative and anti-cell suicide signals in the colon adenocarcinoma line HCT116, phenotypes that can be reversed by RNAi-mediated reduction of PTK7 (Meng et al., PLoS One 5) 11, 2010). Anti-suicide signaling PTK7 conveys resistance to anthracycline-mediated cell killing in AML lesions, which can be reversed using soluble PTK7-Fc protein ( Prebet et al., 2010 ). Overexpression of PTK7 by certain cancer cells has been used in a strategy to target daunorubicin delivery to T-ALL cells in culture using aptamers that bind PTK7 and subsequently internalize it (Xiao et al., Chemistry 14(6), 2008).

In addition to the aforementioned advantages, the present disclosure demonstrates that PTK7 expression is increased in diverse tumor-inducing cell populations. Combined with the concomitant increase of PTK7 in at least some non-tumorigenic cells in the entire tumor, this raises the possibility that PTK7-mediated ligand-receptor interactions could induce cell signaling cascades associated with tumor proliferation, neovascularization, and/or tumor metastasis. Although not limited to a specific theory, the PTK7 modulators of the present invention (specifically antagonistic or neutralizing embodiments) are believed to function, at least in part, by either reducing or eliminating tumor-inducing cell frequency and thereby interfering with tumor proliferation or survival. In a different manner than conventional standard of care regimens (such as irinotecan), or by sending an immunotherapeutic signal or delivering a payload capable of killing PTK7-expressing cells. For example, a reduction in cancer stem cell activity by PTK7 augmentation could simply involve inducing cell proliferation at the interface of chemotherapy regimens that inhibit proliferating cells, or inducing differentiation of the tumor initiating cell so that its ability to regenerate is lost. Self-renewal (i.e. unlimited proliferation and maintenance of multipotency). Alternatively, in preferred embodiments the use of cytotoxic T cells on PTK7-expressing cells, or delivery of a potent toxin coupled with an antibody against PTK7 that is capable of transfecting TPC can selectively transfect.

III. Tumor perpetuating cells.

In contrast to the prior art, the present invention provides PTK7 control materials that are particularly useful in targeting tumor initiating cells and, in particular, tumor perpetuating cells, thus facilitating the treatment, management or prevention of neoplastic disorders. disorders). More specifically, as previously indicated, it has been surprisingly found that specific tumor cell subpopulations that express PTK7 and potentially modulate the positional coordination of isoform signaling are an important component of cancer stem cell self-renewal and cell survival. Therefore, in preferred embodiments, PTK7 control agents may be used to reduce tumor-generating cell replication according to current teachings and thus facilitate the treatment or management of hyperproliferative diseases.

As used herein, the term tumor initiating cell (TIC) includes both tumor-perpetuating cells (TPC; cancer stem cells, or CSC) and highly mitotic tumor progenitor cells (called TProg), all of which generally comprise a population Subclassification (i.e., 0.1-40%) of a lumpy tumor or mass. For purposes of the present description, the terms tumor-perpetuating cells and cancer stem cells or tumor stem cells are equivalent and are used with the same meaning here. In contrast, TPC differs from TProg in that it fully recapitulates the composition of tumor cells within the tumor that have an undetermined capacity for self-renewal as depicted by serial transplantation (two or more passages through mice) of a small number of isolated cells. As discussed below in more detail, fluorescence-activated cell sorting (FACS) using appropriate cell surface markers is a reliable method for isolating highly enriched cell subpopulations (purity > 99.5%) due at least in part to its ability to differentiate between single cells and cell aggregates. (i.e. doubles, etc.). Using these techniques, it has been shown that when a small number of highly purified TProg cells are transplanted into immunocompromised mice, they can support tumor growth in a primary transplant. However, unlike purified TPC subsets, TProg-generated tumors do not fully elucidate the original tumor in morphological-type cellular heterogeneity and are clearly ineffective when re-initiating sequential tumorigenesis in subsequent transplantations. In contrast, TPC subpopulations de novo remodel the cellular heterogeneity of the original tumors and can efficiently establish tumors when serially isolated and transplanted. Therefore, those skilled in the art recognize that the distinguishing difference between TPC and TProg, although both embody tumor generated in primary cultures, is the unique ability of TPC to sustainably support heterotopic tumor growth upon serial transplantation with low cell numbers. Other common investigations characterizing TPC include examining the structure and examination of cell surface markers, transcriptional pattern, and drug response although the expression of the marker may vary with culture conditions and passage of the cell line in the laboratory.

Accordingly, for purposes of the present invention, tumor-perpetuating cells, such as normal stem cells that support the cellular hierarchy in normal tissue, are preferably defined by their ability to regenerate loosely while maintaining their capacity for polyclonal differentiation. Therefore, tumor-perpetuating cells are capable of generating both tumor progeny (i.e., tumor-initiating cells: TPC and TProg) and non-tumor (NTG) progeny. As used herein, a non-tumor cell (NTG) refers to a tumor cell arising from tumor-generating cells, but which does not have the capacity to self-renew or generate heterogeneous progenies of tumor cells that comprise a tumor. Experimentally, NTG cells are unable to proliferatively form tumors in mice, even when cultured in excess cell numbers.

As indicated, TProg are also classified as tumor-initiating cells (or TIC) due to their limited ability to generate tumors in mice. TProg is a descendant of TPC and is typically capable of performing an unlimited number of non-self-renewing cell divisions. Furthermore, TProg cells may be further subdivided into early tumor progenitor cells (ETP) and late tumor progenitor cells (LTP), each of which may be distinguished by their type of morphology (e.g. cell surface markers) and their different abilities to recapitulate the tumor cell morphology. Despite these technical differences, ETP and LTP differ functionally from TPC in that they generally have a lower ability to serially reconstitute tumors when cultured at low cell numbers and typically do not demonstrate heterogeneity of the original tumor. Despite the above differences, it has also been shown that multiple populations of TProg can, in rare cases, acquire self-renewal capabilities often due to stem cells and become TPC (or CSC) themselves. In any given case, all tumor-generating cell types may be represented in the typical tumor mass of an individual patient and subjected to treatment with control materials as reported herein. This is to say that the stated compositions are generally effective in reducing the recurrence or altering the chemosensitivity of these PTK7-positive tumor-initiating cells regardless of the particular embodiment or mixture represented by the tumor.

In the context of the present invention, TPC is more tumorigenic, relatively more indolent and typically more chemotactic than TProg (both ETP and LTP), NTG cells and non-TPC derived tumor filtering cells (e.g. fibroblasts/intercellular synaptic fibers, endothelial and hematopoietic cells ) containing a tumor mass. Recognizing that conventional treatments and regimens are mostly designed to remove tumor masses and attack rapidly mitotic cells, it is possible that TPC is more resistant to conventional treatments and regimens than the more rapidly mitotic TProg and other cellular aggregates of tumor masses. In addition to the above, TPC often exhibit other distinctive features that make them more chemotactically resistant to conventional therapies, for example increased expression of multidrug resistance vectors, enhanced DNA repair mechanisms and anti-apoptotic proteins. These properties, each of which contribute to drug tolerance by TPC, constitute a major reason for the failure of standard oncology regimens to ensure prolonged benefit for most patients with advanced stage neoplasia, i.e. the failure to adequately target and eliminate these cells that continue to support tumor growth. and recurrence (i.e. TPC or CSC).

Unlike many of the prior art treatments mentioned above, novel compositions of the present invention preferably reduce the frequency of tumor-initiating cells when administered to an organism regardless of the form of the selected control or its specific target (e.g., genetic material, PTK7 antibody, or recombinant docking structure). ). As noted above, the frequency of tumor-initiating cells may decrease as a result of (a) the removal, depletion, sensitization, suppression or inhibition of tumor-initiating cells; (b) control the growth, expansion or reemergence of tumor-generating cells; (c) interrupting the initiation, growth, survival or division of cells that give rise to the tumor; or otherwise (d) impeding the survival, regeneration and/or spread of tumor-generating cells. In some embodiments, a reduction in the frequency of tumor-generating cells occurs as a result of an alteration of one or more physiological pathways. Changing the pathway, whether by reducing or eliminating tumor-generating cells, modifying their probability of occurrence (e.g., enhanced contrast, follicle rupture), or otherwise interfering with their ability to influence the tumor environment or other cells, in turn allows more effective treatment of PTK7-associated disorders by inhibiting tumorigenesis. Tumor retention and/or spread and recurrence.

Among the methods that can be used to evaluate this reduction in the frequency of tumor-generating cells are specific dilution analysis either in vitro or in vivo, preferably followed by statistics using Poisson distribution statistics or evaluation of the frequency of specific pre-defined conditions such as the ability to generate tumors in vivo or Lack of such ability. When the specific dilution analysis mentioned is the preferred method for calculating reduced tumor-generating cell frequency, other less demanding methods may also be used to efficiently determine the desired values, albeit slightly less precise, and are fully consistent with the teachings herein. Therefore, as those skilled in the art realize, low repeatability values ​​can also be determined by well-known flow cytometry or immunohistochemical methods. For all the above methods, see e.g

Dylla et al. 2008, PMCID: PMC2413402 & Hoey et al. 2009, PMID: 19664991;

Each one is integrated here as an entire reference.

For the determination of specific dilution, in vitro counting of tumor-initiating cell replication may be performed by sedimentation of either fragmented or unfractionated human tumor cells (eg from treated and untreated tumors, respectively) under laboratory growth conditions that promote colony formation. In this method, colony-forming cells are counted by simple counting and differentiation of colonies, or by analysis consisting of, for example, sedimentation of human tumor cells into dishes in serial dilutions, and the score for each sample is recorded either as a positive value or as a negative value for colony formation after at least 10 days of operation. The individual. Specific dilution laboratory experiments or analyses, which are generally more accurate in their ability to identify the frequency of the tumor-generating cell, involve culturing human tumor cells, from untreated or treated control conditions, for example in immunocompromised mice in serial dilutions and subsequently recording each mouse's score either As a positive value or as a negative value for tumor formation at least 60 days after transplantation. It is preferable to infer cell frequency values ​​by analyzing a specific dilution in vitro or in vivo by applying Poisson distribution statistics to the known frequency of positive and negative cases, thus providing a repeatability of the cases meeting the definition of a positive case; In this case, colony or tumor formation, respectively.

As for other methods consistent with the present invention that can be used to calculate tumor-generating cell frequency, most common methods include flow cytometry techniques capable of quantification and immunohistochemical staining procedures. Although not as precise as the specific dilution analysis techniques described immediately above, these procedures are much less laboratory intensive and provide reasonable values ​​in a relatively short time frame. Therefore, it is understood that those in the art use the method of flow cytometric cell surface marker profiling using one or more antibodies or reagents that bind cell surface proteins recognized in the art to enrich for tumor-generating cells (ie potentially compatible markers such as (mentioned later in Example 1 below) This measures TIC levels from many samples. In another convenient method, the skilled in the art counts the frequency of TIC at the site of the reaction (eg, in a tissue section) by immunohistochemistry that uses one or more antibodies or reagents that can bind cell surface proteins and are thought to characterize these cells.

Using any of the methods indicated above, it is then possible to estimate the amount of reduction in TIC frequency (or TPC therein) provided by the stated PTK7 control agents (including those combined with cytotoxic agents) according to the guidelines listed here. In some cases, the compounds of the present invention reduce the recurrence of TIC (by several mechanisms described above, including elimination, induced contrast, bursa rupture, suppression, etc.) by 10%, 15%, 20%, 25%, 30% or also 35%. In other embodiments, the TIC frequency reduction may be in the range of 40%, 45%, 50%, 55%, 60% or 65%. In certain embodiments, the disclosed compounds may reduce the frequency of TIC by 70%, 75%, 80%, 85%, 90% or also 95%. It is of course recognized that any reduction in TIC recurrence is likely to lead to a corresponding reduction in tumorigenesis, persistence, recurrence and severity of tumorigenesis.

IV. PTK7 Modulators

In any case, the present invention relates to the use of PTK7 control agents, including PTK7 antagonists, for the diagnosis, treatment, treatment and/or prevention of various disorders including any one of several malignant diseases associated with PTK7. These controls may be used alone or in combination with a wide variety of anticancer compounds, for example chemotherapy agents, immunotherapeutic agents (eg, therapeutic antibodies) or biological response controls. In other selected embodiments, a combination of 2 or more separate PTK7 control substances may be used to provide enhanced effects against tumor development or may be used to fabricate multispecific constructs.

In certain embodiments, the PTK7 control materials of the present invention comprise nucleotides, oligonucleotides, polynucleotides, peptides or polypeptides. It is also more preferable for controls to include soluble PTK7 (sPTK7) or a form, variant, derivative or portion thereof including, for example, PTK7 docking structures (e.g., PTK7-Fc, PTK7 targeting fragment, etc.) or PTK7 conjugates (e.g., PTK7-PEG, PTK7 cytotoxic factor, PTK7-brm, etc.). It is also understood that in other embodiments the PTK7 control materials include antibodies, immunologically active moieties or derivatives thereof. In particularly preferred embodiments, the control materials of the present invention comprise neutralizing antibodies or derivatives or portions thereof. In other embodiments, the PTK7 control materials may comprise neutralizing antibodies or portions thereof. In still other embodiments, the PTK7 control materials may include depletion antibodies or portions thereof. Furthermore, for the aforementioned docking constructs, these antibody modulators may conjugate, bind or otherwise connect to selected cytotoxic agents, polymers, biological response modifiers (BRMs), etc. to provide mechanism-directed immunotherapies Various (and optionally multiple) effects. As mentioned above, these antibodies may be pan-PTK7 antibodies that bind to two or more PTK7 isoforms or immunologically specific antibodies that selectively react with an individual isoform. In still other embodiments, the controlling materials may act at the genetic level and may include compounds such as antisense constructs, siRNA, micro RNA, etc.

It is further recognized that the stated PTK7 control substances may deplete, inactivate, neutralize, eliminate or inhibit the growth, proliferation or survival of tumor cells, particularly TPC, and/or the establishment of the inherent tumor through several mechanisms, including enhancing or antagonizing selective pathways. Or the removal of special cells depending on, for example, the form of the control substance PTK7, i.e. the inherent payload, the inherent dose or the inherent delivery method. Accordingly, when preferred embodiments disclosed herein relate to the depletion, inhibition or suppression of specific tumor cell subpopulations such as tumor-perpetuating cells, it should be emphasized that such embodiments are only illustrative and are in no way specific. Otherwise, as stated later in the appended claims, the present invention relates broadly to PTK7 control substances and their use in the treatment, management or prevention of various PTK7-associated hypermitotic disorders without regard to any particular mechanism or target tumor cell aggregation.

In the same context, embodiments disclosed in the present invention may include one or more PTK7 antagonists conjugated to PTK7. For this purpose, it is understood that the PTK7 antagonists of the present invention may include any conjugative compound, polypeptide, peptide, docking protein, antibody or immunologically active moiety or derivative thereof that recognises, reacts, binds, combines, competes with, conjugates or otherwise inter-reacts. With PTK7 protein or a portion thereof and eliminates, suppresses, inhibits, impedes, restricts or controls the growth of tumor-initiating cells or other tumor-producing cells including tumor cells or NTG cells. In selected embodiments, the PTK7 control substance comprises a PTK7 antagonist.

As used herein, the term antagonist refers to a molecule capable of neutralizing, blocking, inhibiting, nullifying, reducing or interfering with the activities of a particular protein, including binding of receptors to ligands or interfacial interactions of enzymes with subject substances. More generally, antigens include antibodies, antigen-binding moieties or derivatives thereof, proteins, peptides, glycoproteins, glycopeptides, glycolipids, polysaccharides, oligosaccharides, nucleic acids, antisense structures, siRNA, miRNA, organic biomolecules, mimetics peptide, pharmacological agents and their metabolites, transcriptional and translational arrangements, etc. Antibodies may also include small molecule inhibitors, fusion proteins, receptor molecules and derivatives that bind specifically to the protein and thus lock in their binding to their target substrate, antigenic variants of the protein, antisense molecules directed toward the protein, RNA aptamers, and antiribozymes against the protein.

As used herein and applied to two or more molecules or compounds, the term recognizes or associates denotes the interaction, association, special connection, combination, inter-action, connection, connection, unification, fusion, amalgamation or Appended, covalently or non-covalently, where one molecule affects another molecule.

In addition, as shown in the examples here, some human PTK7 controls may, in some cases, cross-react with PTK7 from species other than humans (e.g., murine). In other cases, model controls may be specific for one or more human PTK7 isoforms and do not show cross-reactivity with PTK7 orthologs from other species. Such embodiments, of course, may include, in conjunction with the teachings herein, pan-PTK7 antibodies that attach to 2 or more isoforms of a single species or antibodies that attach only to a single isoform.

In any case, as described in more detail below, those skilled in the art know that the declared control substances may be used in conjugated or unconjugated form. This means that the control substance may be accompanied by or conjugated with (e.g. covalently or non-covalently) pharmacologically active compounds, biological response control agents, anticancer agents, cytotoxic or cytostatic agents, diagnostic moieties or biocompatible control agents. In this regard, it is understood that such conjugated materials may include peptides, polypeptides, proteins, fusion proteins, nucleic acid molecules, small molecules, mimetic agents, synthetic drugs, inorganic molecules, organic molecules and radioisotopes. In addition, as noted herein, the selected conjugate may covalently or noncovalently attach to the PTK7 control substance in various molar ratios depending at least in part on the method used to effect the conjugation.

V. Antibodies

a Overview

As previously indicated specifically preferred embodiments of the present invention comprise PTK7 control materials in the form of antibodies that differentially bind to one or more isoforms of PTK7. The term antibody is used more broadly and specifically includes synthetic antibodies, monoclonal antibodies, oligoclonal or polyclonal antibodies, and multiclonal antibodies. , recombinantly produced antibodies, intrabodies, multispecific antibodies, bispecific antibodies, antibodies monovalent antibodies, multivalent antibodies, human antibodies, humanized antibodies, chimeric antibodies, CDR antibodies, antibodies Become primers, Fab fragments, F(ab') fragments, single-chain FvFcs (scFvFc), single-chain Fvs (scFv), antibodies against the self-type (anti-Id) and any other immunologically active antibody fragments as long as they show the desired biological activity ( Any inherent or PTK7 binding is preferable or immunologically specific). In a comprehensive sense, the antibodies of the present invention include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e. molecules containing an antigen binding site, where such portions may or may not fuse with another control domain of immunoglobulin including but not limited to the Fc region Or part thereof. Furthermore, as defined here in more detail, the term antibody and antibodies specifically include Fc variants as described below, including full-length antibodies and Fc variants comprising Fc regions, or portions thereof, optionally including a single amino acid residue modification At least it fuses with an immunologically active portion of immunoglobulin.

As explained below in more detail, the general terms antibody or immunoglobulin comprise 5 distinct classes of antibodies that can be distinguished biochemically and, based on the amino acid arrangement of the constant control domain of their heavy chains, Its appropriate category can be set easily. For these reasons of reference, the major classes of intact antibodies are termed IgA, IgD, IgE, IgG, and IgM. In humans, the IgG and IgA class may be further divided into defined subclasses (isotypes), i.e., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2 based on structure and specific biochemical properties. It is known that IgG isotypes in humans are named according to their abundance in serum, with IgG1 being the most abundant.

When all five classes of antibodies (i.e., IgA, IgD, IgE, IgG, and IgM) and all their isotypes (i.e., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), as well as their variants, are within the scope of the present invention, embodiments are described Preferred includes the IgG class of immunoglobulin in some detail for illustrative purposes only. It is understood, however, that this explanation is only an illustration of representative constructions and methods for practicing the present invention and does not in any way limit the scope of the invention or its claims.

In this regard, human IgG immunoglobulins comprise 2 identical polypeptide light chains with a molecular weight of 23,000 daltons, and 2 identical heavy chains with a molecular weight of 53,000-70,000 depending on the homologous type. Constant heavy-chain control domains corresponding to different classes of antibodies are shown with the corresponding non-capitalization Greek letters a, d, ε, γ, and μ, respectively. Antibody light chains from any vertebrate species can be assigned to one of two clearly distinguished types, called kappa (κ) and lambda (λ), on the basis of the amino acid arrangements of their constant control domains. Those skilled in the art know the subunit structures and three-dimensional structures of the different classes of immunoglobulins.

The four chains are connected by disulfide bonds in the form of a Y. The light chains include the heavy chains, starting from the mouth of the Y, continuing through the variable region and reaching the double ends of the Y. Each light chain is connected to a heavy chain by a single covalent disulfide bond, while two disulfide bonds in the hinge region connect the chains. Heavy. The respective heavy and light chains also have regularly spaced interchain disulfide bridges that vary in number depending on the IgG isotype.

Each heavy chain contains at one end a variable control domain (VH) followed by a number of constant control domains. Each light chain has a variable control domain (VL) at one end and a fixed control domain at the other end; The fixed control field of the light chain is aligned with the first fixed control field of the heavy chain, and the variable control field of the light chain is aligned with the variable control field of the heavy chain. In this regard, it is recognized that variable control domains of both light (VL) and heavy (VH) chain sections determine antigen perception and specificity. In contrast to this, the constant control domains of light chain (CL) and heavy chain (CH1, CH2 or CH3) impart and regulate important biological properties, such as secretion, transchoroidal movement, circulatory half-life, complement binding, etc. Typically, the number of constant region control domains increases as they become further away from the antigen binding site or amino terminus of the antibody. Therefore, the N or amino terminus of the antibody comprises the variable region and the C or carboxy terminus comprises the constant region. Therefore, the CH3 and CL control domains actually involve the carboxy terminus of the heavy and light chain, respectively.

The term variable actually indicates that certain sections of variable control domains vary strongly in their arrangement among immunoglobulins and these hot spots largely determine the binding and specificity profiles of a particular antibody. The hypervariable sites manifest themselves in 3 segments, known as complementary determining regions (CDRs), in both the light and heavy chain variable control domains, respectively. Frame areas (FRs) are the most protected sections of the variable control areas that constitute CDRs. More specifically, in naturally occurring monomeric IgG antibodies, the 6 CDRs on each arm of the antibody are short, discontinuous arrangements of amino acids specifically positioned to form the antigen-binding site because the antibody assumes its three-dimensional conformation in an aqueous environment.

The frame regions that include the rest of the heavy and light variable control domains show less inter-molecular variation in amino acid arrangement. Beyond this, frame regions largely take the form of a b-page and CDRs serve to form links connecting, and in some cases part of, the construction of a b-page. Therefore, these framework regions form a scaffold that provides positioning of the 6 CDRs in the correct orientation by interchain, non-covalent interchain. The antigen-binding site formed by localized CDRs defines the surface that complements the epitope on the immunologically active antigen. This complementary surface promotes non-covalent binding of the antibody to the immunologically active antigen epitope. It is understood that the placement and composition of CDRs can be easily determined by those skilled in the art using the definitions provided here.

As described in more detail below, all or part of the heavy and light chain variable regions may be created or engineered using standard expression and synthesis techniques to produce effective antibodies. This means that the heavy or light chain variable region of a first antibody (or any section thereof) may be mixed and matched with any selected section of the heavy or light chain variable region of a second antibody. In one embodiment, for example, the complete light chain variable region comprising 3 light-chain CDRs of a first antibody may be coupled to the complete heavy chain variable region comprising 3 heavy-chain CDRs of a second antibody to produce an operational antibody. Furthermore, in other embodiments, individual heavy and light chain CDRs derived from various antibodies may be mixed and coordinated to produce a desired antibody having optimal characteristics. Therefore, a representative antibody may comprise 3 light-chain CDRs from a first antibody, 2 heavy-chain CDRs derived from a second antibody and a third heavy-chain CDR from a third antibody.

More specifically, in the context of the present invention, it will be appreciated that any of the shown heavy and light chain CDRs derived from the murine variable region amino acid arrangements given in Figure 6(a) or Figure 6(b) may be rearranged in this manner to provide optimal antibodies against PTK7 (e.g. hPTK7 antagonist) according to current guidelines. That is, one or more CDRs may be combined derived from the adjacent light chain variable region amino acid arrangements given in Figure 6(a) (Arrangement Definition No.: 20-60, even numbers) or the adjacent heavy chain variable region amino acid arrangements given in Figure 6(b) (Definition No. 21-61, odd numbers) in a PTK7 control material and, in particularly preferred embodiments, incorporated into a CDR patch or human-specific antibody conjugating a PTK7 isoform and one or more immunologically specific conjugates. Examples of light (ID: 62-68, even) and heavy (ID: 63-69, odd) chain amino acid arrangements for these humanized controls are also shown in Figures 6(a). and 6(b). In addition, the new amino acid arrangements depict 21 mice and 4 representative humanized controls according to the present invention. Furthermore, the corresponding DNA rankings for each of the 21 representative mouse controls and 4 humanized controls listed in Figures 6(a) and 6(b) are in the ranking list included with the present application (ranking definition numbers: 120-169).

In any case, the default numbers for the supplementary selection areas may be specified as in

Kabat et al. (1991, NIH Publication 91-3242, National Technical Information Service, Springfield, Va.),

Specifically, residues 24-34 (CDR1), 50-56 (CDR2) and 89-97 (CDR3) in the light chain variable control domain and 31-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3) in String-heavy variable control field. Note that CDRs vary greatly from one antibody to another (and by definition will not show homology to the Kabat consensus arrangements). Maximum alignment of frame residues usually requires the insertion of spacer residues into the numbering system, to be used for the Fv region. In addition, the identification of specific individual residues at any given Kabat locus number may differ from one antibody chain to another due to allelic divergence or species differences. See also

Chothia et al., J. Mol. Biol. 196:901-917 (1987); Chothia et al., Nature 342, pp. 877-883 (1989) and by MacCallum et al., J. Mol. Biol. 262:732-745 (1996)

The definitions include overlapping or subgroups of amino acid residues when compared against each other. Each of the above references is incorporated herein by full reference and amino acid residues comprising CDRs as specified by each of the above references are listed for comparison.

CDR definitions

About 1

Chothia2

MacCallum3

VHCDR1

31-35

26-32

30-35

VH CDR2

50-65

53-55

47-58

VH CDR3

95-102

96-101

93-101

VL CDR1

24-34

26-32

30-36

VL CDR2

50-56

50-52

46-55

VL CDR3

89-97

91-96

89-96

1 The numbering of the relic follows the designation of Kabat and his associates, above

2 The numbering of the relic follows the naming of Chothia and his companions, above

3 The hillbilly numbering follows the naming of MacCallum and his associates, above

As discussed, the skilled art can easily map, identify, derive and/or prepare CDRs as determined by Kabat et al. Chothis et al. or MacCallum et al. for each particular heavy and light chain arrangement given in Figure 6(a) or 6(b). Accordingly, both the CDRs of an organism and the antibodies comprising the CDRs identified by each such nomenclature are clearly within the scope of the present invention. More broadly the term CDR amino acid residue includes a variable region on amino acids in the CDR as determined using any method based on arrangement or structure as stated above.

As used herein the term frameshift (FR) variable region refers to those amino acids in the frame region of the Ig chain. The term frame region, or FR region as used herein, includes amino acid residues that are part of the variable region, but are not part of the CDRs (eg, using Kabat's definition of CDRs). Therefore, the frame of a variable region is a non-contiguous arrangement between about 100-120 amino acids in length but includes only those amino acids outside the CDRs.

For the particular example of a heavy chain variable region and for CDRs as identified by Kabat and co-workers, frame region 1 corresponds to the control domain of the variable region comprising amino acids 1-30; Frame region 2 matches the control domain of the variable region comprising amino acids 36–49; Frame region 3 corresponds to the control domain of the variable region comprising amino acids 66-94, and frame region 4 corresponds to the control domain of the variable region comprising amino acids 103 up to the end of the variable region. The frame regions of the light chain are separated to a similar degree by both light chain variable region CDRs. Similarly, using the definition of CDRs by Chothia et al. or McCallum et al. the boundaries of the frame region are separated by the ends of the respective CDR as described above.

Taking into account the foregoing structural considerations, those skilled in the art will recognize that the antibodies of the present invention may include any one of a number of functional embodiments. In this aspect, antibodies may include any immunologically active antibody (as the term is defined here) that provides the desired physiological response in an organism. Although any of the disclosed antibodies may be used in combination with existing teachings, particular embodiments of the invention will include hybrid, human-specific or human-single-copy antibodies or portions thereof that are immunologically active. Other embodiments also include, for example, homologous or heterologous multi-subunit structures, Fc variants and antibodies conjugated or variable with respect to glycosylation. In addition, it must be recognized that these entities are not entirely exclusive and that individual adapted antibodies may include one or more of the functional aspects declared here. For example, the adapted antibody may include a single-chain dimer with human-acquired variable regions or a fully human, full-length IgG3 antibody with Fc modifications that change the glycosylation pattern to adjust the half-life in serum. There are other exemplary embodiments that are fully apparent to those skilled in the art and can easily be recognized as being within the scope of the invention.

b. Antibody generation.

As is well known, and shown in the examples therein, animals of various families, including rabbits, mice, rodents, etc., can be inoculated and used to provide antibodies in accordance with the teachings herein. Adjuvants known in the art that can be used to augment the immune response, depending on the inoculated type, include, but are not limited to, Freund's adjuvants (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, emulsifiers. Oil, keyhole limpet hemocyanins, dinitrophenol, and potentially beneficial human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. These adjuvants may protect the antigen from rapid dispersal by separating it into a local precipitate, or they may contain host-mimicking substances to secrete chemoattractants for macrophages and other components of the immune system. Preferably, when a polypeptide is administered, the immunization program will include two or more polypeptide administrations, spaced over several weeks.

After immunizing an animal with a PTK7 immunogen (e.g., soluble sPTK7 or sPTK7) comprising selected isoforms and/or peptides, live cells or cell preparations expressing the desired protein, antibodies and/or antibody-producing cells can be obtained from the animal using Techniques realized by art. In some embodiments, a serum containing an anti-PTK7 polyclonal antibody is produced by depleting or killing the animal. The serum may be used for research purposes in the animal-derived form or, alternatively, the antibodies against PTK7 may be partially or completely purified to provide immunoglobulin fragments or replicon antibody preparations.

c. Monoclonal antibodies

Although polyclonal antibodies may be used in combination with particular aspects of the present invention, preferred embodiments include the use of reactive monoclonal antibodies with PTK7. As used herein, the term monoclonal antibody refers to an antibody resulting from a group of antibodies that are substantially identical, that is, the individual antibodies comprising the group are identical except for the presence of possible mutations, e.g., naturally occurring mutations, which may be present in minor quantities. Therefore, the word monocopy denotes a feature of the antibody that is not a mixture of separate antibodies and may be used in combination with any type of antibody. In particular embodiments, such single-copy antibodies include an antibody comprising a polypeptide arrangement that binds or binds to PTK7, wherein the PTK7-binding polypeptide arrangement is produced by a process including selecting a polypeptide arrangement that binds a single target from a plurality of polypeptide arrangements.

In preferred embodiments, antibody-producing cell lines are prepared from cells isolated from the immunized animal. After immunization, the animal is killed and the lymph node cells and pancreatic B cells are rendered viability by techniques well known in the art (as shown in the appended examples). Methods of creating cells include, but are not limited to, receiving a carrier from the host with oncogenes, infecting them with an oncogenic virus and culturing them under conditions that select for immortalized cells, exposing them to carcinogenic or mutagenic compounds, and merging them with immortalized cells. ), such as a myeloma cell, and suppression of the activity of a tumor suppressor gene. When using fusion with myeloma cells, it is preferable that the myeloma cells do not secrete immunoglobulin polypeptides (non-secreting cell line). As noted in the examples below, immortalized cells may be masked with PTK7 (including selected isoforms), or an immunologically active portion of it. In a preferred embodiment, initial blocking is performed using an enzyme-linked immunosorbent assay (ELISA) or a radioimmunoassay.

More generally, separate single-copy antibodies conforming to the present invention may be prepared by a wide variety of techniques known in the art including hybridoma techniques, synthetic techniques, macrophage expression techniques, yeast libraries, mutant animals (e.g., XenoMouse or HuMAb Mouse) or some combination So. For example, single-copy antibodies can be produced with hybridoma techniques as described on a large scale above and as described in more detail in:

Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981)

All of them are integrated here. Using published protocols, mammalian antibodies are preferably generated by multiple subcutaneous or intraperitoneal injections with the specific antigen or adjuvant. As previously explained, this immunization generally produces an immune response that includes the production of active antibodies against an antigen (which may be entirely human if the immunized animal is mutated) from activated spleen cells or activated lymphocytes. Although the resulting antibodies can be collected from animal serum to provide multiple-replicate preparations, it is more generally required to isolate single lymphocytes from the spleen, lymph nodes or peripheral blood to provide replicated single-replicate antibody preparations. More typically, lymphocytes are produced from the spleen and become immortalized to provide hybridomas.

For example, as described above, the selection process may be the selection of a distinct copy from a population of clones, such as a set of hybridoma transcripts, macrophage transcripts, or synthetic DNA transcripts. It must be realized that the binding arrangement of a selected PTK7 can be further modified, for example, to improve its affinity for the target, to impart the human character of an arrangement that binds the target, to improve its production in a cell culture, to reduce its generation of immunity in the body, to generate a multi-specific antibody, etc., and that the antibody The arrangement of a linker to a modified target also includes a single-copy antibody of this invention. In contrast to polyclonal antibody preparations, which typically include separate antibodies directed against different epitopes, each monoclonal antibody is a monoclonal antibody preparation directed against a single determinant on an antigen. In addition to their specificity, single-copy antibody preparations are advantageous in that they are typically not contaminated with other immunoglobulins with which they may cross-react.

d. Chimeric antibodies

In another embodiment, the antibody of the invention includes chimeric antibodies derived from protein fragments covalently attached to at least two different classes or types of antibodies. It must be understood that, as used herein, the term hybrid antibodies relates to structures in which a portion of the heavy and/or light chain is homologous to or similar to corresponding arrangements in antibodies derived from particular species or belonging to a class or subclass of antibody Particular, while the rest of the chain(s) are homologous to or similar to corresponding arrangements in antibodies derived from other species or belonging to a class or subclass of another antibody, as well as parts of those antibodies, as long as they exhibit the desired biological activity:

(U.S. Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)).

In an example embodiment, the hybrid antibody as described herein includes murine VH amino acid and VL amino acid arrangements and human-derived constant regions. In other adapted embodiments the hybrid antibody of the present invention includes an antibody grafted with a CDR or humanized antibody as described herein.

In general, the goal of hybrid antibody manufacturing is to generate hybrids in which the number of amino acids from the particular organism species is at a maximum. An example is an antibody grafted with a CDR, in which the antibody includes one or more CDRs of a particular type or belongs to a class or subclass of a particular antibody, while the remainder of the antibody chain(s) is homologous to or similar to a corresponding arrangement in Antibodies derived from another species or belonging to a class or subclass of another antibody. For use in humans, variable regions or CDRs selected from a rodent antibody are always grafted into a human antibody, replacing variable regions or CDRs normally present in the human antibody. These constructs generally have the advantage of providing fully effective control functions (e.g., CDC, ADCC, etc.) while minimizing unwanted antibody responses in the organism.

e.Humanized antibodies.

A humanized antibody is similar to a CDR antibody. In general, a human-specific antibody results from a single-copy antibody that initially arises in an animal rather than a human. As used herein, human-specific forms of non-human antibodies (eg, murine) are hybrid antibodies containing a lower order derivative of non-human immunoglobulin. In one embodiment, the humanized antibody is a human immunoglobulin (recipient or acceptor antibody) in which the CDR residues of the recipient antibody are replaced by CDR residues of a non-human species (donor antibody) such as a mouse, rodent, rabbit, Or a primate with the specificity, attraction and/or ability required.

The acquisition of the human character of an antibody generally involves analysis of sequence homology and canonical structures for both donor and acceptor antibodies. In selected embodiments, the recipient antibody may include agreed upon arrangements. To generate consensus frames, frames of multiple heavy or light chain amino acid arrangements are aligned to determine a consensus amino acid arrangement. In addition, in many cases, one or more frame residues in the variable control domain of the human immunoglobulin are replaced by a corresponding non-human residue of the donor antibody. These frame substitutions are defined in ways well known in the art, for example, by modeling CDR interactions and frame residues to identify frame residues important for antigen binding and comparing the order to identify typical frame residues at special locations. These substitutions help maintain the proper 3D conformation of the grafted CDR(s) and often improve attraction more than similar constructs without frame substitutions. In addition, human-specific antibodies contain residues that are not present in the recipient antibody or the donor antibody. These modifications can be made for further purification of the performing antibody using well-known techniques.

CDR vaccination and alloantibodies are described, for example, in:

U.S.P.Ns. 6,180,370, 5,693,762, 5,693,761, 5,585,089, and 5,530,101.

In general, a humanized antibody includes at least one, and typically two, variable control domains, in which all or substantially all of the CDRs match those of non-human immunoglobulin, and all or substantially all of the framework regions are those of the globulin sequence Human immunity. The human-specific antibody will also optionally include at least a portion of the immunoglobulin constant (Fc) region, typically that of a human immunoglobulin. For additional details, see, for example:

Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).

See also, for example:

Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1: 105-115 (1998); Harris, Biochem. Soc. Transactions 23:1035-1038 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994); and U.S.P.Ns. 6,982,321 and 7,087,409.

There is another additional method called humanization which is described, for example in US 2005/0008625. For purposes of the present application, the term human-specific antibodies will clearly include CDR-grafted antibodies (i.e., human antibodies including one or more grafted non-human CDRs) with no or very minimal frameshifts.

Additionally, the non-human antibody against PTK7 can also be modified with specific deletion of human T cell epitopes or removal of immunogenicity by methods described in WO 98/52976 and WO 00/34317. Briefly, the heavy and light chain variable regions of an antibody can be analyzed for peptides that bind to MHC class II; These peptides represent possible T cell epitopes (as defined in WO 98/52976 and WO 00/34317). In order to identify possible T cell epitopes, a computer modeling method called the peptide organization method can be used, and additionally a database of human MHC class II binding peptides can be searched for promoters present in the VH and VL arrangements, as described in WO 98/52976 and WO 00. /34317. These promoters bind to any of the 18 major DR MHC class II variants, thus forming possible T cell epitopes. Possible T cell epitopes can be removed by replacing small numbers of amino acid residues in variable regions, or by single amino acid substitutions. As much as possible, protective replacements are made. Often, but not exclusively, a common amino acid can be used for a place in human germ line antibody arrangements. After deamidation changes are identified, nucleic acids encoding VH and VL can be constructed by mutational construction or other synthetic methods (e.g., regenerative formation, conserver substitution, and so on). A mutational variant arrangement can, optionally, be fused with a human constant region.

In selected embodiments, at least 60%, 65%, 70%, 75%, or 80% of the variable region residues of the humanized antibody match those of the original frame region (FR) and CDR arrangements. In other embodiments, at least 85% or 90% of the humanized antibody residues match those of the original frame region (FR) and CDR arrangements. In a further preferred embodiment, more than 95% of the residues of a humanized antibody match those of the original frame region (FR) and CDR arrangements.

Allogenic antibodies can be manufactured using common molecular biotechniques and common biomolecular genetic engineering as described here. These methods involve isolating, processing, and demonstrating nucleic acid sequences encoding all or part of immunoglobulin Fv variable regions of at least one of the heavy or light chain. The sources of such nucleic acid are well known to those skilled in the art and, for example, can be obtained from a hybridoma, a megakaryocyte or a macrophage that produces an antibody or an immunologically active fragment against a pre-selected target, as described above, of germ line immunoglobulin genes. , or from manufactured structures. The synthetic DNA encoding the humanized antibody can then be copied into a suitable expression vector.

Human germ line arrangements, for example, are given in:

Tomlinson, I.A. et al. (1992) J. Mol. Biol. 227:776-798; Cook, G. P. et al. (1995) Immunol. Today 16: 237-242; Chothia, D. et al. (1992) J. Mol. Bio. 227:799-817; and Tomlinson et al. (1995) EMBO J 14:4628-4638.

The VBASE manual provides a comprehensive guide to immunoglobulin heavy region arrangements, see:

(Retter et al., (2005) Nuc Acid Res 33: 671-674).

These arrangements can be used as a source of human arrangement, for example, for frame regions and CDRs. As noted here, agreed upon human frame areas may also be used, for example, as described in USPN 6,300,064.

f Human antibodies

In addition to the aforementioned human antibodies, those skilled in the art will recognize that the antibodies of the present invention include entirely human antibodies. For purposes of the present application, the term human antibody includes an antibody having an amino acid arrangement corresponding to that of an antibody produced by a human and/or prepared using any of the techniques for preparing human antibodies as described herein. This definition of human antibodies specifically excludes a human-acquired antibody that includes non-human antigen binding residues.

Human antibodies can be produced by several techniques known in the art. As indicated above, macrophage expression techniques are used to provide immunologically active binding zones according to current teachings. Therefore, particular embodiments of the invention provide methods for producing antibodies against PTK7 or sections thereof that bind an antigen including the steps of creating an antibody library (preferably human) on a phagosome, blocking the library with selected PTK7 or a section thereof that binds an antibody, isolating the phagosome that binds PTK7, and obtaining On immunologically active parts of macrophages. For example, a method for preparing an antibody library for use in macrophage expression techniques includes the steps of immunizing an animal but not a human including human or non-human immunoglobulin sites with selected PTK7 or a portion thereof that are antigenic to generate an immune response, extract the antibody-producing cells from the immunized animal; Isolate the RNA encoding the heavy and light chains of the antibodies of the invention from extracted cells, reverse transcribe the RNA protein to produce cDNA, amplify the cDNA using primers, and insert the cDNA into a macrophage-expressing vector so that the antibodies appear on Macrophage. More specifically, DNA encoding the VH and VL control domains with a scFv linker is created by PCR and transcribed into a phagemid vector (eg, pCANTAB 6 or pComb 3 HSS). The vector can then be electroporated into E. coli and the E. coli is then infected with the helper phagocytes. The phagophore used in these methods is a typical filamentous phagophore containing fd and M13, and the VH and VL control domains are typically fused to either phagophore gene III or gene VIII.

Synthetic human antibodies against PTK7 of the invention may be isolated by blocking a synthetic conjugate antibody library prepared as described above. In a preferred embodiment, the library is a scFv macrophage expression library, generated using human VL cDNAs and human VH cDNAs from mRNA isolated from B cells. Methods for preparing and blocking such libraries are well known in the art and kits for generating macrophage expression libraries are commercially available, e.g.

(the Pharmacia Recombinant Phage Antibody System, catalog no. 27-9400-01; and the Stratagene SurfZAPTM phage display kit, catalog no. 240612).

There are also other methods and reagents that can be used to generate and block antibody expression libraries, see, for example:

(USPN 5,223,409; PCT Publication Nos. WO 92/18619, WO 91/17271, WO 92/20791, WO 92/15679, WO 93/01288, WO 92/01047, WO 92/09690; Technology 9:1370-1372 (1991); 348:552-554 (1990); EMBO J. 12:725-734 (1993); Nature 352:628 (1991), Proc Natl. USA 89:3576-3580 (1992); Garrad et al., Bio/Technology 9:1373-1377 (1991); Hoogenboom et al., Nuc. Acid Res. 19:4133-4137 (1991); and Barbas et al., Proc. Natl. Acad. Know USA 88:7978-7982 (1991).

Antibodies generated with primary libraries (either natural or synthetic) can have moderate affinity (Ka about 610 to 710 mol−1), but complete affinity can also be simulated in the laboratory by construction and reselection from secondary libraries as described in the art. For example, a mutation can be introduced randomly into the laboratory using an error-prone polymerase, reported in (Leung et al., Technique, 1: 11-15 (1989)) in a method:

Hawkins et al., J. Mol. Biol., 226: 889-896 (1992) or Gram et al., Proc. Natl. Acad. Sci. USA, 89: 3576-3580 (1992).

Additionally, completion of affinity can be performed by randomly mutating one or more CDRs, for example using PCR with primers bearing a random order including the length of the CDR of interest, in single Fv copies selected and screened for the highest affinity copies. WO 9607754 describes a method to induce mutational formation in a complement-specific region of an immunoglobulin light chain to generate a light chain gene library. Another effective method is to create selected VH or VL domains by exposing a phagosome with repertoires of naturally occurring V domain variants from unprotected donors and blocking for higher affinity in several rounds of chain reconsolidation as described in:

Marks et al., Biotechnol., 10: 779-783 (1992).

This technology allows the production of antibodies and antibody fragments with a Kd (koff/kon) dissociation constant of about 10-9 mol or less.

It must also be recognized that there are additional procedures that can be used that use libraries that include eukaryotic cells (eg, yeast) that display binding pairs on their surface. As with the macrophage expression technique, nucleated libraries are blocked against the antigen of interest (i.e., PTK7) and cells expressing candidate binding pairs are isolated and replicated. Steps can be taken to optimize the library content and to ensure complete affinity for active bond pairs. See, for example, USPN 7,700,302 and U.SSN 12/404,059. In one embodiment, the human antibody is selected from a macrophage library, wherein such macrophage library displays human antibodies:

(Vaughan et al. Nature Biotechnology 14:309-314 (1996): Sheets et al. Proc. Natl. Acad. Sci. 95:6157-6162 (1998)); Hoogenboom and Winter, J. Mol. Biol, 227:381 (1991); Marks et al., J. Mol. Biol, 222:581 (1991)).

In other embodiments human ligand pairs may be isolated from conjugate antibody libraries generated in eukaryotic cells such as yeast. See, for example, USPN 7,700,302. These techniques usefully allow the screening of large numbers of control candidates and provide relatively easier processing of candidate arrangements (eg, by complete affinity or synthetic reinforcement).

Human antibodies can also be prepared by introducing human immunoglobulin loci into mutant animals, for example, mice in which the activity of endogenous immunoglobulin genes is partially or completely inactivated. Upon challenge, production of human antibody is observed, which closely resembles that seen in all aspects, including gene rearrangement, gene assembly, and antibody repertoire. This method is described, for example, in:

U.S.P.Ns. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and U.S.P.N 6,075,181 and 6,150,584

Regarding Xenomouse technology with the following scientific publications:

Marks et al., Bio/Technology 10: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14: 845-51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13:65-93 (1995).

Alternatively, a human antibody may be prepared by immortalizing surviving human B lymphocytes that produce an antibody directed against a target antigen (these B lymphocytes may be retrieved from an organism with a neoplastic disorder or who have been immunized in the laboratory). See, for example:

Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al., J. Immunol, 147 (l):86-95 (1991); and U.S.P.N. 5,750,373.

VI. Antibody Characteristics

Regardless of how it was obtained or in what form the foregoing antibody control material takes place (e.g., human-specific, human-specific, etc.), the preferred embodiments of the stated control materials may exhibit several distinctive features. In this respect, cells producing antibodies against PTK7 (eg, hybridomas or yeast colonies) can be selected, replicated, and further screened for the desired characteristics including, for example, spike growth, significant antibody production, and, as explained in more detail below. Distinctive features required for an antibody. Hybridomas can spread in the body in monogenic animals, in animals that lack an immune system, such as immunocompromised mice, or in cell culture in the laboratory. The methods of selecting, replicating and propagating hybridomas and/or colonies, each of which produces a separate antibody type, are well known to those of ordinary skill in the art.

a. Neutralizing antibodies.

In particularly preferred embodiments the control materials of the present invention include neutralizing antibodies or a derivative or part thereof. The term neutralizing antibody or anti-neutralizing antibody refers to an antibody or antigen that binds to or interacts with a PTK7 molecule and prevents the binding or association of the ligand with any of its binding partners, thereby impeding the biological response (eg, phosphorylation or VEGF-induced angiogenesis) that might otherwise result. There is no interaction of molecules. In determining the binding and specificity of an antibody or an immunologically functional derivative or fragment thereof, an antibody or fragment thereof will substantially inhibit the binding of a binding compound to its binding partner or subject substance when an excess of the antibody reduces the amount of binding partner bound to the target molecule by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or more as measured, for example, by phosphorylation or selected controlled substances

(Shin et al, Biochem and Biophys Res Com, Vol. 371:4)

Or in a competitive association test in the laboratory. In the case of antibodies for PTK7, for example, a neutralizing antibody or antibody would preferably reduce the phosphorylation capacity of PTK7 relative to a specific substrate by at least about 20%, 30%, 40%, 50%, 60%, 70%. , 80%, 85%, 90%, 95%, 97%, 99% or more. It must be recognized that this reduced activity can be measured directly using techniques recognized by the art, or it can be measured by the effect of this reduction on secondary activities such as angiogenesis.

b. Internalizing antibodies

Although there is evidence that PTK7 or its isoforms may exist in a soluble form, at least some of the PTK7 likewise remains associated with the cell surface thus allowing the solubilization of expressed controls. Accordingly, the antibodies against PTK7 of the present invention may be internalized, at least to some degree, by cells expressing an ephrin-A recombinant. For example, an antibody against PTK7 that binds to PTK7 on the surface of a tumor initiating cell may be internalized by a tumor initiating cell. In particularly preferred embodiments such antibodies against PTK7 may be conjugated or combined with anticancer agents such as cytotoxic moieties that kill the cell upon apoptosis.

As used herein, an antibody against endogenous PTK7 is one that is captured by a cell upon binding to cell-associated PTK7 of a mammalian organism. An autoantibody includes antibody fragments, a human or human-acquired antibody, and antibody conjugates. Absorption may occur in vitro or in the body. For therapeutic uses, catabolism may occur in the body. The number of autologous antibody molecules may be sufficient or adequate to kill a PTK7-expressing cell, particularly a PTK7-expressing tumor-initiating cell. Depending on the potency of the antibody or antibody conjugate, in some cases, absorption of a single antibody molecule into a cell is sufficient to kill the target cell to which the antibody is bound. For example, certain toxins are so effective at killing that a single molecule of toxin combined with an antibody is sufficient to kill a tumor cell. The solubility of an antibody against PTK7 upon PTK7 binding on a mammalian cell can be determined by several tests including those described in the examples below (e.g., Examples 12 and 13). Methods for determining the internalization of an antibody in a cell are described in the USPN 7,619,068 which are incorporated herein by reference in full.

c. Depleting antibodies

In other preferred embodiments the control materials of the present invention include depleting antibodies or derivatives or parts thereof. The term depleting antibody refers to an antibody or part thereof that binds to or conjugates PTK7 on or near the surface of a cell and induces, promotes, or causes cell death, incapacitation, or elimination (e.g., complement-dependent cytotoxicity or antibody-dependent cytotoxicity). . In some embodiments described more fully below the selected depleting antibody will be conjugated or conjugated to a cytotoxic agent. Preferably the depleting antibody should be able to remove, incapacitate, eradicate or kill at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% of sarcoma cells are in a specific cell population. In some embodiments the cell population may include enriched, fractionated, pure or isolated tumor cells (TPC). In other embodiments the cell assembly includes whole tumor specimens or material extracted from a heterogeneous tumor including a tumor cell. Those skilled in the art will recognize that standard biochemical techniques as described in the examples below (e.g., Examples 13 and 14) may be used to monitor and quantify the depletion of tumorigenic cells or tumor cells as taught herein.

d. Epitope binding

It must additionally be recognized that antibodies reported against PTK7 will associate with, or bind to, separate epitopes or determinants present in the selected target(s). As used herein, the term epitope refers to that portion of a target antigen that has the ability to be specifically recognized and bound by a specific antibody. When the antigen is a polypeptide such as PTK7, epitopes can consist of both contiguous amino acids and non-contiguous amino acids placed next to each other by a three-fold fold of the protein. Epitopes formed by adjacent amino acids are typically retained when the protein is denatured, while epitopes formed by triple folding are typically lost when the protein is denatured. The epitope includes at least 3, and usually more, at least 5 or 8-10 amino acids in a unique spatial conformation. More specifically, a skilled manufacturer will recognize that the term epitope includes any specific protein capable of specifically binding to an immunoglobulin or T cell receptor or interacting in some way with a molecule. Epitopic determinants generally consist of chemically active surface assemblies of molecules such as amino acids, carbohydrates, or sugar side chains and generally have special three-dimensional structural features, as well as special charge characteristics. Additionally, the epitope may be linear or structural. In a linear epitope, all points of interaction between a protein and an intervening molecule (such as an antibody) lie linearly along the initial amino acid order of the protein. In a structural epitope, interaction points are located across amino acid residues on a protein that are linearly separated from each other.

Once a desired epitope on an antigen has been identified, antibodies to that epitope can be generated, for example by immunization with a prptide comprising the epitope using techniques described in the present invention. Alternatively, during the discovery process, the generation and labeling of antibodies may reveal information about the desired epitopes. From this information, antibodies can then be competitively blocked for binding to the same epitope. One way to achieve this is to perform competition studies to find antibodies that bind competitively to each other, that is, the antibodies compete for binding to the antigen. A high-input process for cross-competitive binding antibodies is described in International Application No. 48731/03.

As used herein, the term binding refers to a method of grouping antibodies based on their binding properties to an antigen. The division of binding sites is somewhat arbitrary, depending on how different the observed antibody binding partners test. Therefore, although the technique is a useful tool for classifying antibodies of the present invention, binding sites do not always correspond directly to epitopes and those initial determinations of epitope binding must be further confirmed by another method recognized by the art as described herein.

With this clarification it is possible to determine whether a selected primary antibody (or portion thereof) binds to the same epitope or cross-competes for binding with a second antibody using methods known in the art and given in examples herein. In one embodiment, the primary antibody of the invention is allowed to bind to PTK7 under saturating conditions and the ability of the secondary antibody to bind to PTK7 is then measured. If the test antibody is able to bind to PTK7 at the same time as the primary antibody against PTK7, then the secondary antibody binds with a different epitope than the primary antibody. However, if the secondary antibody is not able to bind to PTK7 at the same time, then the secondary antibody binds to the same epitope, an overlapping epitope, or an epitope very close to the epitope bound to the primary antibody. As known in the art and detailed in the examples below, the required data can be obtained using a direct or indirect solid phase radioimmunoassay (RIA), a direct or indirect solid phase enzyme immunoassay (EIA), a sandwich competition test, the Biacore system (i.e. , surface plasmon resonance - GE Healthcare), ForteBio analysis instrument (i.e., biofilm interferometry instrument - ForteBio Foundation) or flow cytometry method. The term surface plasmon resonance (SPR), as used here, refers to an optical phenomenon that allows the analysis of special interfacial interactions in real time by determining changes in protein concentrations in the structure of a biosensor. In a particularly preferred embodiment, the analysis is performed using a Biacore or ForteBio instrument as shown in the examples below.

The term compete when used in the context of antibodies that compete means competition between test-specific antibodies in which the antibody or immunologically functional moiety under test prevents or inhibits specific binding of a reference antibody to a common antigen. Typically, such testing involves the use of pure antigen bound to a solid surface or cells labeled with either of these, an unlabeled test immunoglobulin and a labeled reference immunoglobulin. Comparative inhibition is measured by determining the toxicity of the marker bound to the solid surface or cells in the presence of the test immunoglobulin. Immunoglobulin for testing is usually present in excess. Antibodies determined by a competition assay (competing antibodies) include antibodies that bind to the same epitope whenever the antibody and the reference antibody bind to a neighboring epitope sufficiently close to the epitope bound by the reference antibody for stereotaxic blockade to occur. The examples here provide additional detail on methods for determining competitive correlation. The competitive antibody, when present in excess, usually inhibits the specific binding of the reference antibody to a common antigen by at least 40, 45, 50, 55, 60, 65, 70 or 75%. In some cases, binding is inhibited by at least 80, 85, 90, 95 or 97% or more.

Besides epitope specificity, expressed antibodies may be characterized using a number of different physical features including for example levels of affinity, melting temperature (Tm), and isoelectric points.

e.Binding affinity.

In this direction, the present invention further includes the use of antibodies having high binding affinity for a selected PTK7, or in the cases of pan antibodies, the use of more than one type of ephrin-A ligand. The antibody of the invention specifically binds its target antigen when the dissociation constant Kd (koff/kon) is ≤ 10-8 mol. The antibody binds antigen specifically with high affinity when Kd ≤ 5 10-9 mol, and with very high affinity when Kd ≤ 5 10-10 mol. In one embodiment of the invention, the antibody has a Kd value ≤ 10-9 mol and an external rate of about 1 10-4/s. In one embodiment of the invention, the external rate is 1 10-5/sec. In other embodiments of the invention, antibodies bind to PTK7 with a Kd value of between 10-8 and 10-10 mol, and in yet another embodiment they bind with a Kd value of ≤ 2 10-10 mol. Selected other embodiments of the present invention also include antibodies having a dissociation constant Kd (koff/kon) of less than 10-2, less than 5 10-2, less than 10-3, less than 5 10-3, less than 10- 4, less than 5 10-4, less than 10-5, less than 5 10-5, less than 10-6, less than 5 10-6, less than 10-7, less than 5 10-7, less than 10-8, less than 5 10-8, less than 10-9, less than 5 10-9, less than 10-10, less than 5 10-10, less than 10-11, less than 5 10-11, Under 10-12, Under 5 10-12, Under 10-13, Under 5 10-13, Under 10-14, Under 5 10-14, or Under 10-15, Less than 5 10-15 mol.

In particular embodiments, the antibody of the invention that specifically binds immunologically to PTK7 has a dissociation rate constant or kon rate (PTK7 (Ab) + antigen (Ag)kon → Ab-Ag) of at least 510 mol-1 s-1, At least 2 510 lg-1 s-1, at least 5 510 lg-1 s-1, at least 610 lg-1 s-1, at least 5 610 lg-1 s-1, at least 710 lg-1 s-1, at least 5 710 lg-1 s-1 or at least 810 lg-1 s-1.

In another embodiment, the antibody of the invention that specifically binds immunologically to PTK7 has a koff ratio (PTK7 (Ab) + antigen (Ag)koff → Ab-Ag) of less than 10-1 s-1, less than 5 10-1 sec-1, less than 10-2 s-1, less than 5 10-2 s-1, less than 10-3 s-1, less than 5 10-3 s-1, less than 10-4 s-1 , less than 5 10-4 s-1, less than 10-5 s-1, less than 5 10-5 s-1, less than 10-6 s-1, less than 5 10-6 s-1, less 10-7 s-1, less than 5 10-7 s-1, less than 10-8 s-1, less than 5 10-8 s-1, less Than 10-9 s-1, less than 5 10-9 s-1 or less than 10-10 s-1.

In selected other embodiments of the present invention, the antibody against PTK7 has an affinity constant or Ka (kon/koff) of at least 210 mol-1, at least 5 210 mol-1, at least 310 mol-1, at least 5 310 lg-1, at least 410 lg-1, at least 5 410 lg-1, at least 510 lg-1, at least 5 510 lg-1, at least 610 lg-1, on At least 5 610 mol-1, at least 710 mol-1, at least 5 710 mol-1, at least 810 mol G-1, at least 5 810 G-1, at least 910 G-1, at least 5 910 G-1, at least 1010 G-1, at least 5 1010 G-1, at least 1110 Lg-1, at least 5 1110 Lg-1, at least 1210 Lg-1, at least 5 1210 Lg-1, at least 1310 Lg-1, at least 5 1310 Lg-1, at least 1410 lg-1, at least 5 1410 lg-1, at least 1510 lg-1 or at least 5 1510 lg-1.

f Isoelectric points

In addition to the aforementioned binding properties, antibodies against PTK7 and parts of it, such as polypeptides, have pI isoelectric points, which are generally defined as the pH at which the polypeptide carries no net charge. It is known in the art that the solubility of a protein is typically lowest when the pH of the solution equals the isoelectric point (pI) of the protein. Therefore, solubility can be improved by adjusting the number and position of ionizable residues in the antibody to adjust the pI. For example, the pI of a polypeptide can be used to make suitable amino acid substitutions (eg by replacing a charged amino acid, such as lysine, with an uncharged residue such as alanine). Without wanting to be bound by any particular theory, amino acid substitutions in an antibody that result in changes in the pI of that antibody may improve the solubility and/or stability of the antibody. Those skilled in the art know the relevance of useful amino acid substitutions for the particular antibody that achieve the desired pI.

The pI of a protein may be determined in a variety of ways including, but not limited to, isoelectric inhibition and various computer calculations, see, e.g.

Bjellqvist et al., 1993, Electrophoresis 14:1023.

In one embodiment, the pI of antibodies against PTK7 of the invention ranges between a value higher than about 6.5, about 7, about 7.5, about 8, about 8.5 or about 9. In another embodiment, the pI of antibodies against PTK7 of the invention ranges between a value higher than 6.5, 7, 7.5, 8, 8.5 or 9. In yet another embodiment, the substitutions resulting from modifications to the pI of the antibodies of the invention do not obviously reduce the binding affinity of these antibodies for PTK7. As explained below in more detail, it is particularly conceivable that substitution “substitutions” of the Fc region that result from altered binding to the FcγR may also result in a change in pI. In a preferred embodiment, substitution “substitutions” of the Fc region are specifically chosen to effect both a desired modification in FcγR binding and any desired change in pI. As used here, the value of pI is defined as the pI of the dominant charge form.

g Thermal stability

It is also recognized that the Tm of the Fab control domain in an antibody may be a good indicator of the thermal stability of the antibody and may provide an additional indication of its half-life. Tm is just the temperature of the 50% expansion of a given domain or arrangement. A lower Tm indicates more accumulation/less stability, while a higher Tm indicates less accumulation/higher stability. For this, it is preferable to use antibodies or parts or derivatives thereof that have a higher Tm. Furthermore, using techniques known in the art the formulation of antibodies against PTK7 or control domains thereof can be modified to increase or improve molecular stability. See, for example, USPN 7,960,142. Therefore, in one embodiment, the control Fab of a selected antibody has a Tm value higher than at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120°C. In another embodiment, the control Fab of a selected antibody has a Tm value higher than at least about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, About 105, about 110, about 115, or about 120 percent. Thermal melting temperatures (Tm) of a protein control domain (eg a Fab control domain) may be measured using any standard method known in the art, eg graphical test calorimetry, see e.g.

Vermeer et al., 2000, Biophys. J. 78:394-404; Vermeer et al., 2000, Biophys. J.79:2150-2154

Included here for reference.

VII PTK7 Modulator Fragments and Derivatives

When the agents of the present invention include docking structures, antibodies, moieties or derivatives, the selected control substances interact, bind, combine, complex, connect, associate, connect, inter-react, or otherwise associate with PTK7 and thus produce the desired antitumor effects. It is understood by those skilled in the art that controls comprising antibodies against PTK7 cross-react with or associate with PTK7 through one or more binding sites appearing on the antibody. More specifically and as used here, the term binding site includes a region of a polypeptide responsible for binding selectively to the target molecule of interest (eg enzyme, antigen, ligand, receptor, substrate or inhibitor). The control domains for binding comprise at least one binding site (e.g. an intact IgG antibody contains two control domains and two binding sites). Representative control domains for binding include a variable control domain for the antibody, a ligand control domain for receptor binding, a receptor control domain for ligand compound binding or an enzymatic control domain. For purposes of the present invention, an exemplary active region in PTK7 (e.g. as part of an Fc-PTK7 docking structure) may include a binding site for the subject substance or enhanced phosphorylation.

a Fragments

Regardless of the form of the control material (e.g., hybrid, humanized, etc.) chosen to practice the invention, it is understood that immunologically active portions thereof may be used in accordance with the teachings herein. In a comprehensive sense, the term antibody fragment includes at least a portion of an intact antibody (eg a naturally occurring immunoglobulin). More specifically, the term fragment refers to a fraction or section of an antibody or antibody chain (or a PTK7 molecule in the case of Fc bindings) containing an amino acid residue lower than the intact or complete antibody or antibody chain. The term antigen-binding fragment refers to a polypeptide portion of an immunoglobulin or antibody that binds antigen or competes with the intact antibody (i.e. with the intact antibody from which it is derived) for antigen binding (i.e. specific binding ). As used herein, the term fragment of an antibody molecule includes antigen-binding portions of an antibody, e.g., antibody light chain (VL), antibody heavy chain (VH), single-chain antibody ( scFv), F(ab')2 fragment, Fab fragment, Fd fragment, Fv fragment, single-chain control domain antibody fragments, dimers, linear antibodies, single-chain antibody molecules and polyspecific antibodies formed from antibody fragments. Similarly, the active portion of PTK7 comprises a portion of the PTK7 molecule that maintains its ability to interface with PTK7-regulated substances or its receptors and modifies them in a similar manner to that of intact PTK7 (e.g., phosphorylation—although this may be somewhat less efficient). ).

Those skilled in the art know that fragments may be obtained through chemical or enzymatic treatment of an intact or complete control (eg, an antibody or an antibody chain) or by synthetic means. In this regard, when identifying the various antibody parts involved in the digestion of an intact antibody, those skilled in the art realize that these parts can be synthesized de novo either chemically or using a synthetic DNA approach. Therefore, the term antibody, as used, clearly includes antibodies, parts or derivatives thereof that are either completely modified or created de novo using a synthetic DNA approach.

More specifically, papain digestion of antibodies produces two identical antigen-binding fragments, called Fab fragments, each of which has an individual antigen-binding site, and a residue Fc fragment, the name of which indicates its ability to readily crystallize. Pepsin processing results in an F(ab')2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen. The Fab fragment also contains a constant control domain for the light chain and a first constant control domain (CH1) for the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the CH1 control domain of the heavy chain including one or more cysteines from the hinge region of the antibody. Fab'-SH is the symbol for Fab' here in which the cysteine ​​residue(s) of the constant control domains bear at least one free thiol group. F(ab')2 antibody fragments are produced natively as pairs of Fab' fragments that have cysteines separated between them. There are also other known chemical associations of body parts. See, for example, Fundamental Immunology, WE Paul, ed., Raven Press, NY (1999), for further description of other antibody parts.

It is further recognized that the Fv fragment is an antibody fragment containing a complete antigen binding and recognition site. This region consists of a dimer with a variable control domain of one heavy chain and one light chain closely coupled, which can be equivalent in nature, eg in scFv. In this configuration, the three CDRs from each variable control domain interact to determine the antigen binding site on the surface of the VH-VL dimer. The six CDRs in total or a subunit thereof impart antigen-binding specificity to the antibody. However, the single variable control domain (or half of the Fv comprising only 3 antigen-specific CDRs) also has the ability to recognize and bind antigen, although usually at a lower level of affinity than the full binding site.

In other embodiments, a portion of the antibody comprising, for example, an Fc region, retains at least one of the biological functions normally associated with the Fc region when present in the intact antibody, e.g., FcRn binding, modulating the half-life of the antibody, ADCC function, and complement binding. In one embodiment, the antibody portion is a monovalent antibody having an in vivo half-life substantially identical to the intact antibody. For example, said antibody portion may include an antigen-binding arm linked to an Fc arrangement capable of adding biostable stability to the portion.

b Derivatives

In another embodiment, it is also understood that the control substances of the invention are monovalent or polyvalent (e.g. divalent, trivalent, etc.). As used here, valency refers to the number of possible target binding sites (i.e., PTK7) associated with the antibody. Each target binding site specifically binds a target molecule, a specific place, or a specific site on the target molecule. When the antibody of the present invention comprises more than one target binding site (polyvalent), each target binding site specifically binds the same or different molecules (e.g. it may bind to different ligands, different antigens, epitopes or sites different on the same antigen). For purposes of the present invention, specific antibodies preferably have at least one binding site specific for human PTK7. In one embodiment, the antibodies of the present invention are monovalent such that each binding site in the molecule specifically binds to an individual PTK7 site or epitope. In other embodiments, the antibodies are multivalent such that they comprise more than one binding site and such that the different binding sites associate more than a single site or epitope with a special attachment. In these cases multiple epitopes may be present on the chosen PTK7 polypeptide or variant, or a single epitope may be present on PTK7 while a second, different epitope may be present on another molecule or surface. See, for example, USPN 2009/0130105.

As indicated above, polyvalent antibodies may bind specifically immunologically to epitopes in the desired target molecule or may bind specifically immunologically to the target molecule as well as a heterogeneous epitope, such as a heteropolypeptide or solid support material. In preferred embodiments of antibodies against PTK7 that bind only two antigens (i.e. bispecific antibodies), the present invention also includes antibodies with additional specificities such as trispecific antibodies. Bispecific antibodies include, without limitation, those having one arm directed against PTK7 and the other arm directed against any other antigen (e.g., cell marker, control material). There are methods known in the art for making bispecific antibodies. Conventional production of full-length bispecific antibodies relies on the co-presentation of two immunoglobulin heavy chain-light chain pairs, where the two chains have different levels of specificity (Millstein et al., 1983, Nature, 305:537-539). USPN mentions 2009/0155255 Other more complex multi-specific conformational structures and methods for their manufacture.

In still other embodiments, variable control domains of the antibody having desired binding specificities (antigen-antibody binding sites) are coupled to fixed immunoglobulin control domain arrangements. The docking is preferably an immunoglobulin heavy chain constant control domain, comprising at least a portion of the hinge, CH2, and/or CH3 regions. In one example, there is a first heavy chain constant region (CH1) containing the site necessary to bind the light chain in at least one of the dockings. DNAs encoding fusions of immunoglobulin heavy chain, if desired, and immunoglobulin light chain, are inserted into separate expression vectors, in which the host gene carrier is co-received into a suitable host organism. This results in tremendous flexibility to adjust the duplex ratio of the 3 polypeptide segments when applying embodiments in which unequal ratios of 3 polypeptide chains used in the structure give optimal yields. However, coding arrangements for two polypeptide chains or all three polypeptide chains can be interpolated into a single display vector when displaying at least two polypeptide chains in equal ratios would give high yields or when the ratios are not very important.

In one embodiment of this approach, the bispecific antibodies consist of a hybrid immunoglobulin heavy chain having a first binding specificity in one arm (e.g. PTK7), and a hybrid immunoglobulin heavy chain-light chain pair (giving a second binding specificity) in the other arm. It has been found that this asymmetric structure facilitates the separation of the desired bispecific compound from the undesired immunoglobulin chain conjugates, as the presence of the immunoglobulin light chain in only one half of the bispecific molecule provides an easy method for separation. This method is known in International Application No. 04690/94. For more details on generating bispecific antibodies, see e.g

Suresh et al., 1986, Methods in Enzymology, 121:210.

According to another method described in International Application No. 27011/96, a pair of antibody molecules can be engineered to maximize the percentage of heterodimers recovered from a synthetic cell culture. The preferred interface includes at least a portion of a CH3 control domain from a constant control domain of the antibody. In this method, one or more small side chains of an amino acid at the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). Compensatory gaps of the same or similar size to the large side chain(s) are created at the interface of the second antibody molecule by replacing the large side chains of an amino acid with small chains (eg alanine or threonine). This produces a mechanism to increase heterodimer yield better than other unwanted end products such as homodimer.

Bispecific antibodies also include cross-linked or heteroconjugated antibodies. For example, one antibody in heteroconjugation could be coupled to avidin, and another to biotin. It has been suggested that these antibodies, for example, direct cells of the immune system towards unwanted cells (US Patent Document No. 4,676,980), and to treat HIV infection (International Application No. 00360/91, International Application No. 200373/92, and Patent Document No. 03089). Heterologous conjugated antibodies may be made using any of the conventional cross-linking methods. Suitable cross-linking agents are known in the art and reported in USPN 4,676,980, with a number of cross-linking techniques.

VIII Control Materials PTK7 Fixed area adjustments

(PTK7 Modulators - Constant Region Modifications)

a. Fc region and Fc receptors.

In addition to various modifications, substitutions, additions or deletions made in the heterologous region or binding region of the control substances described above (e.g. Fc-PTK7 or antibodies against PTK7) described above, those of skill in the art know that selected embodiments of the present invention may also include substitutions or Modifications to the constant region (i.e. Fc region). More specifically, the PTK7 control materials of the invention are conceivable to contain one or more additional amino acid substitutions, mutations and/or modifications, among others, which produce a compound having favorable characteristics including, without limitation: modified pharmacokinetics, increased half-life Serum, increased ligand affinity, decreased immunogenicity, increased production, altered Fc ligand binding, enhanced or reduced ADCC or CDC activity, altered glycosylation and/or disulfide bonds and altered binding specificity. In this regard it can be recognized that these variants of Fc may be usefully used to enhance the potent anti-tumor properties of the described control substances.

The term Fc region used here defines a C-terminal region in an immunoglobulin heavy chain, including natively arranged Fc regions and divergent Fc regions. Although the boundaries of the Fc region in the immunoglobulin heavy chain vary, the Fc region usually specifies the human IgG heavy chain to elongate from an amino acid residue at Cys226, or from Pro230, to its carboxyl terminus. The C-terminal lysine (residue 447 according to the EU numbering system) may be removed in the Fc region, for example during production or purification of the antibody, or by synthetic engineering modification of the nucleic acid encoding the heavy chain of the antibody. Accordingly, an intact antibody composition may include antibody aggregates from which all K447 residues have been removed, antibody aggregates from which all K447 residues have been removed, and antibody aggregates having a mixture of antibodies with or without the K447 residue. The functional Fc region possesses an effector function of the Fc region of the native arrangement. Typical effector functions include C1q binding; CDC; Fc receptor binding; ADCC; phagocytosis Downregulation of cell line receptors (eg B cell receptor; BCR), etc. These effector functions generally require an Fc region that combines with a binding control domain (eg, a variable control domain for an antibody) and can be assessed by various assays, such as those described in the definitions herein.

The Fc receptor or FcR describes a receptor that binds to the Fc region of an antibody. In some embodiments, the FcR is a native human FcR. In some embodiments, the FcR is a receptor that binds an IgG antibody (gamma receptor) and includes receptors of FcγRI, Fc.RII, and FcγRIII subclasses, including allelic variants and differently scheduled forms of such receptors. FcγII receptors include FcγRIIA (activating receptor) and FcγRIIB (inhibitory receptor), and have similar amino acid arrangements that differ fundamentally from their cytoplasmic control domains. The Fcγ activating receptor RIIA contains an immunoreceptor tyrosine-dependent activation motif (ITAM) in its cytoplasmic control domain. The inhibitory receptor FγRIIB contains an immunoreceptor tyrosine-dependent inhibitory motif (ITIM) in its cytoplasmic control domain. See for example

Daeron, Annu. Rev. Immunol. 15:203-234 (1997).

See FcRs in e.g

Ravetch and Kinet, Annu. Rev. Immunol 9:457-92 (1991); Capel et al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab. Clin. Med. 126:330-41 (1995).

The term FcR here also includes more other FcRs, including those that will need to be identified in the future. The term Fc receptor or FcR also includes a nascent receptor, FcRn, which in certain cases is responsible for transferring native IgGs to the fetus

(Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994))

And regulate the balance of immune globulins in the body. There are known methods to measure binding to FcRn, see e.g

Ghetie and Ward., Immunol. Today 18(12):592-598 (1997); Ghetie et al., Nature Biotechnology, 15(7):637-640 (1997); Hinton et al., J. Biol. Chem. 279(8):6213-6216 (2004); WO 2004/92219 (Hinton et al.).

b.Fc functions

As used here, complement and CDC-dependent cytotoxicity refer to the lysis of the target cell in the presence of complement. The complement activation pathway begins with the binding of the first component of the complement system (C1q) to a molecule, such as an antibody, complexed with a homogeneous antigen. To evaluate complement activation, a CDS test is performed as described in

Gazzano-Santoro et al., 1996, J. Immunol. Methods, 202:163.

In addition, antibody-dependent cell-mediated cytotoxicity or ADCC refers to a form of cytotoxicity in which a released Ig binds to Fc receptors (FcRs) present on specific cytotoxic cells (e.g., natural killer (NK) cells, nucleophiles, and macrophages. ) allowing those cytotoxic effector cells to bind specifically to a target cell carrying antigen and thus killing the target cell with cellular cytotoxins. High affinity IgG antibodies specifically target cytotoxic cells and are absolutely required for this killing. Lysis of the target cell is extracellular, requires direct cell-to-cell contact, and does not involve a complementary step.

PTK7 control variants with altered binding affinity to the FcR or altered ADCC activity are those that have enhanced or reduced binding activity to the FcR and/or ADCC activity as compared to a native antibody or a non-control containing a natively arranged Fc region. A control variant that exhibits increased binding to an FcR binds at least one FcR with better affinity to the native antibody, to a non-control antibody, or to a control that includes a natively arranged Fc region. A variant that shows reduced binding to an FcR, binds at least one FcR with worse affinity than the native or non-control antibody or to a control that includes a natively arranged Fc region. Those variants that show low binding to the FcR could show weak or no significant binding to the FcR, e.g., 0-20% binding to the FcR compared to the natively sequenced IgG Fc region, e.g., as specific techniques are well known in the art.

For FcRn, the antibodies of the present invention also include or include Fc variants with modifications in the constant region providing half-lives (e.g., serum half-lives) in mammals, preferably in humans, of greater than 5 days, greater than 10 days, greater than 15 days, preferably more than 20 days, more than 25 days, more than 30 days, more than 35 days, more than 40 days, more than 45 days, more than 2 months, more than 3 months, more than 4 months, or More than 5 months. The increased half-life of the antibodies (or molecules comprising the Fc) of the present invention in mammals, preferably in human, causes higher serum titers of said antibodies or antibody parts in mammalian and, therefore, reduces the frequency of administration of said antibodies or antibody parts. Antibodies with increased in vivo half-lives can be generated by techniques known to those skilled in the art. For example, antibodies with increased half-lives can be generated in the organism by modifying (e.g., substituting, eliminating or adding) specific amino acid residues involved in the interaction between the Fc control domain and the FcRn receptor (see, for example, International Application Nos. 34631/97 , 029207/04; translation 6737056 and translation 0190311/2003. Binding to human FcRn in vivo and the half-life of serum polypeptides can be tested for binding of high affinity to human FcRn, for example, in cell lines of mouse transgenics or human transgenics from the host expressing human FcRn, or in primate organisms given polypeptides having a heterologous Fc region. International Application No. 42072/2000 describes antibody variants that have enhanced or weak binding to FcRns. See also, for example, Shields et al. J. Biol. Chem. 9(2):6591-6604 (2001).

C. Glycosylation modifications

In still other embodiments, the glycosylation modes or compositions of the antibodies of the invention are modified. More specifically, a preferred embodiment of the present invention can comprise one or more glyco geometries, i.e., a variable glycosylation pattern or variable carbohydrate composition that is covalently attached to a molecule including the Fc region. Glyco-engineered motifs can be useful for many purposes, including but not limited to improving or reducing effector function, increasing the affinity of the antibody for the target antigen or facilitating antibody production. In cases where low effector function is desired, it is preferable that the molecule may be engineered to appear in an aglycosylated form. These carbohydrate modifications can be achieved by, for example, changing one or more glycosylation sites in the antibody arrangement. Such that, the substitution of one or more amino acids that eliminates the glycosylation site can be framed by one or more variable regions that thus eliminate glycosylation at that site (see, e.g., USP Nos. 5714350 and 6350861). In contrast, enhanced effector functionality or enhanced binding to an Fc comprising molecule can be hindered by engineering at one or more additional glycosylation sites.

Additionally or alternatively, an Fc variant may be made that has an altered glycosylated structure, such as a hypofucosylated antibody with a reduced amount of fucosyl residues or an antibody with increased diatom GlcNAc structures. These changes and altered glycosylation patterns demonstrate a similarity to increased ADCC capacity of the antibody. Glyco geometries may be generated by any method known to the master of the art, e.g., using geometric or variable display strains by co-expressing with one or more enzyme (e.g. N-acetylglucosaminyltransferase III (GnTI11)), by displaying a molecule including the Fc region in organisms Different organisms, cell lines from different organisms, or carbohydrate modification after expression of the molecule containing the Fc region. See, for example,

RL et al. (2002) J. Biol. Chem. 277:26733-26740; Umana et al. (1999) Nat. Biotech. 17:176-1,

In addition, European Patent No.: 1176195; Publication International Application No. 035835/03 PCT; International Application No. 54342/99,

Umana et al, 1999, Nat. Biotechnol 17:176-180; Davies et al., 20017 Biotechnol Bioeng 74:288-294; Shields et al, 2002, J Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol Chem 278:3466-3473) U.S.P.N. 6,602,684; U.S.S.Ns. 10/277,370; 10/113,929; PCT WO 00/61739A1; PCT WO 01/292246A1; PCT WO 02/311140A1; PCT WO 02/30954A1; PotillegentTM technology (Biowa, Inc.); GlycoMAbTM glycosylation engineering technology (GLYCART biotechnology AG); WO 00061739; EA01229125; U.S.P.N. 2003/0115614; Okazaki et al., 2004, JMB, 336: 1239-49.

IX. Show the control material (Modulator Expression)

a. Overview

DNA encoding required PTK7 control materials can be easily isolated and sequenced using conventional procedures (eg, using oligonucleotide probes that can specifically bind to genes encoding the light and heavy chains of the antibody). Isolated and subcloned hybridoma cells (or macrophage- or yeast-derived colonies) may represent a preferred source for that DNA if the control material is an antibody. Upon request, nucleic acid such as described herein can be further manipulated to create agents including fusion proteins, or hybrid antibodies, that are neither primarily human nor fully human. More specifically, isolated DNA (which can be modified) can be used to replicate constant or variable region rearrangements to manufacture antibodies as described in USPN 7,709,611.

This representative method involves extraction of RNA from selected cells, conversion to cDNA, and amplification by PCR using specific antibody primers. Suitable raw materials are well known in the art and, as mentioned for example in the topic, are readily available from many commercial sources. It is estimated that, to express a synthetic human or non-human antibody isolated by screening a combinatorial library, DNA encoding the antibody is transcribed into a hybrid expression vector and introduced into host cells including mammalian cells, insect cells, plant cells, yeast, or bacteria. In other embodiments, control materials are introduced into and expressed by monkey COS cells, NS0 cells, Chinese hamster ovary (CHO) cells or melanoma cells that do not produce the desired construct. As described in more detail below, transformed cells expressing the desired control substance can be grown in relatively large quantities to provide clinical and commercial supplies of the fusion construct or immunoglobulin.

Whether the nucleic acid encoding a required section of a PTK7 control substance is the product of or derived from a macrophage display technology, yeast libraries, hybridoma-based technology, synthetic or from commercial sources, it is understood that the present invention expressly includes nucleic acid molecules and arrangements encoding PTK7 control materials include fusion proteins, anti-PTK7 antibodies, antigen-binding fragments, or derivatives thereof. The invention further includes nucleic acids or nucleic acid molecules (e.g., polynucleotides) that hybridize under stringent hybridization conditions, or alternatively, under moderate or low-stringency hybridization conditions (e.g., as shown below), to polynucleotides that complete to become nucleic acids having a polynucleotide arrangement carrying the code A controlling substance of the invention or part or variant thereof. The term nucleic acid or isolated nucleic acid molecule, as used herein, includes at least DNA molecules and RNA molecules. The DNA molecule can be single-stranded or double-stranded, but double-stranded DNA is preferred. In addition, the present invention includes any vector medium or construct, such control material bearing a polynucleotide code including, but not limited to, vectors, plasmids, host cells, cosmids or viral constructs.

The term isolated nucleic acid means that the nucleic acid is (1) amplified in the laboratory, eg by polymerase chain reaction (PCR), (2) produced by transcription, (3) selected, eg by cleavage or gel electrophoresis fractionation, or ( 4) Created, for example by chemical synthesis. Isolated DNA is DNA that is available to be manipulated by hybrid DNA techniques.

More specifically, nucleic acids encoding a control substance are also available, including one or both of the antibody sequences of the invention, or a portion, derivative, mutein, or variant thereof, polynucleotides sufficient for use as hybridization probes, PCR primers or sequencing primers for identification, analysis, A modification or amplification of a polynucleotide carrying a polypeptide code, sense amino acids to inhibit expression of the polynucleotide, and complementary arrangements of the above. It can be amino acids of any length. Their length can consist of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 15,000, 3,000, 5,000 or more, may include one or more additional arrangements, e.g., regulatory arrangements, and/or be part of a larger nucleic acid, e.g., vector. These can be single-stranded or double-stranded nucleic acids and may include RNA and/or DNA nucleotides, and synthetic variants thereof (eg, nucleic acids peptide). It is preferable to isolate nucleic acids encoding control materials of the invention, including antibodies, immunologically reactive parts, or derivatives thereof, as described below.

b. Hybridization and Identity

As can be seen, the invention additionally provides nucleic acids that hybridize to other nucleic acids under certain hybridization conditions. You know well in the art the methods of DNA hybridization. See for example,

Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.

For the purposes of the present application, a relatively stringent hybridization condition is used. A prewash solution containing 5x sodium chloride/sodium citrate (SSC), 0.5% SDS, 1 mM EDTA (pH 8), a hybridization stabilizer with a pH of approximately 50% formamide, 6xSSC and Hybridization temperature of 55°C (or other similar hybridization solutions, such as a solution containing about 50% formamide, with a hybridization temperature of 42°C), and washing conditions of 60°C, in 0.5 x SSC, 0.1% SDS. Strict Hybridization Requirement Hybridization occurs in 6xSSC at 45°C, then one or more washes with 0.1xSSC, 0.2% SDS at 68°C. In addition, the skilled art can manipulate the hybridization and/or washing conditions to increase or decrease the stringency of the hybridization such that nucleic acids typically remain with nucleotide arrangements that are at least 65, 70, 75, 80, 85, 90, 98 or 99% identical to each other. Typically and hybrids of some. More generally, for purposes of the present clarification the term substantially identical with respect to a nucleic acid arrangement is interpreted as such that the arrangement of nucleotides includes at least an 85%, 90%, 95%, or 97% match in the arrangement with respect to the reference nucleic acid arrangement.

The basic criteria influencing the choice of hybridization conditions and the guidelines for setting appropriate conditions are mentioned above by, for example,

Sambrook, Fritsch, and Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11; and Current Protocols in Molecular Biology, 1995, Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4),

They can be easily identified by those traditionally skilled in the art based on, for example, the length and/or base structure of a nucleic acid.

It is further estimated that nucleic acids, according to the invention, can exist alone or in combination with other nucleic acids, which can be homotypic or heterotypic. In preferred embodiments, the nucleic acid is functionally linked to expression control arrangements that may be identical or heterogeneous with respect to said nucleic acid. In this context, the term homologous means that a nucleic acid is also functionally related to a naturally occurring expression control arrangement and the term heterologous means that a nucleic acid is not functionally related to a naturally occurring expression control arrangement.

C. Expression

A nucleic acid, such as a nucleic acid expressing RNA and/or a protein or peptide, is functionally related to an arrangement controlling the expression, if they are covalently linked to each other such that the expression or transcription of said nucleic acid is under the control or under the influence of the arrangement controlling said expression. If a nucleic acid is translated into a functional protein, then, with the expression control arrangement linked to the coding arrangement, the expression control arrangement is induced to copy said nucleic acid, without causing a frameshift in the coding arrangement or the coding arrangement becoming unable to be translated into protein or peptide required.

The term expression control arrangement according to the invention includes enhancers, ribosome binding sites, inducers and other control elements that regulate gene transcription or mRNA translation. In certain embodiments of the invention, manifestation control arrangements may be regulated. The specific structure of expression control arrangements can vary as a function of class or cell type, but generally include 5'-non-transcribed and 5'- and 3'-untranslated rearrangements involved in the induction of transcription and translation, respectively, such as the TATA box, the capping arrangement, CAAT ranking, etc. More specifically, an expression-controlling arrangement at the 5'-non-transcribed end includes a region of an enhancer containing an enhancer arrangement to control transcription of a functionally related nucleic acid. Manifestation control arrangements may also include inducer or tonic-precedent arrangements.

According to the invention, the term enhancer or region of the enhancer relates to a nucleic acid arrangement located upstream of the (5') end of the apparent nucleic acid arrangement and controls the manifestation of the arrangement by providing a binding and recognition site for RNA-polymerase. The enhancer region may include additional binding and recognition sites for additional factors involved in the regulation of gene transcription. A promoter can control the transcription of a prokaryotic or eukaryotic gene. In addition, the enhancer material can be inducible and can induce transcription in response to an inducible gene or can be constitutive if transcription is not controlled by an inducing factor. A gene under the control of an inducible enhancer does not appear or only appears to a small extent in the absence of the inducing factor. In the presence of the inducing factor, the gene is turned on or a transcription control substance is increased. This occurs, generally, by the binding of a specific transcription factor.

Preferred enhancers according to the invention include boosters for SP6, T3 and T7 polymerase, a human U6 RNA booster, a CMV booster, and synthetic hybrid boosters thereof (e.g., CMV) wherein a portion or portions are combined to a portion or portions of the gene booster from Other cellular proteins, such as human GAPDH (glyceraldehyde-3-phosphate dehydrogenase), may or may not include one or more additional introns.

According to the invention, the term manifestation is used in its most comprehensive sense and includes the production of RNA or RNA and protein/peptide. Partial expression also includes nucleic acids. In addition, the manifestation can be done transiently or constantly.

In a preferred embodiment, a nucleic acid molecule according to the invention is contained in a vector that, when compatible with an enhancing material, controls the expression of the nucleic acid. The term vector is used in its most general sense and includes any intermediate vector for a nucleic acid that enables the introduction of that nucleic acid, for example, into prokaryotic and/or eukaryotic cells and, where appropriate, its integration into the genome. Vectors of this type are preferably replicated and/or expressed in cells. Vectors can include plasmids, phagemids, bacterial phagocytes or virus genomes. The term plasmid as it is generally used relates to a construct of extrachromosomal genetic material, usually a duplex of circular DNA, that can independently replicate chromosomal DNA.

In practicing the present invention it should be appreciated that many conventional techniques in molecular biology, microbiology, and synthetic DNA technology are optionally used. These traditional techniques relate to vectors, host cells and synthetic methods such as those described in the article. Those techniques are well known and demonstrated in, for example,

Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, Calif.; Sambrook et al., Molecular Cloning-A Laboratory Manual (3rd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 and Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., supra Other useful references, e.g. for cell isolation and culture (e.g., for subsequent humad novi or protein isolation) include Freshney (1994); Payne et al. ( 1992 ) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons , Inc . New York, N.Y.; Gamborg and Phillips (Eds.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Atlas and Parks (Eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, Fla.

The above references describe methods for making nucleic acids (e.g., by in vitro amplification, purification from cells, or chemical synthesis), methods for manipulating nucleic acids (e.g., generating a site-targeted mutation, by enzyme-blocking digestion, ligation, etc.), and various vectors, Cell lines, etc. are useful in manipulating and making nucleic acids. Additionally, any basic polynucleotide (including, for example, labeled or biotinylated polynucleotides) can be ordered customized or standardized from any of the various commercial sources.

Therefore, in one aspect, the present invention provides synthetic host cells that permit the synthetic expression of antibodies of the present invention or portions thereof. Antibodies produced by expression in these synthetic host cells are referred to herein as alloantibodies. The present invention also provides clone cells from these host cells, and antibodies are similarly produced.

The term allogenic host cell (or simply host cell), as used herein, means a cell into which a synthetic expressing vector is introduced. It is understood that a syngeneic host cell and host cell means not only a specific cell but also the descendants of that cell. Because certain modifications may occur in subsequent generations either as a result of environmental influences or mutation, such offspring may, in fact, not be identical, but still within the framework of the term host cell used in the subject. These cells may include a vector according to the invention as described above.

In another aspect, the invention provides a method for making an antibody or a portion thereof as described in the article. According to one embodiment, said method comprises culturing an infectious or transformed cell with a vector such as described in the subject matter, and recovering the antibody or a portion thereof.

As indicated above, the demonstration of an antibody of the invention (or part or variants thereof) preferably includes a demonstration vector(s) comprising a polynucleotide encoding an antibody against the desired PTK7. Methods well known to those skilled in the art can be used to construct expression vectors that include arrangements that encode an antibody and appropriate translation and transcription control signals. These methods include, for example, in vitro synthetic DNA techniques, synthetic techniques, and in vivo gene synthesis. Embodiments of the invention, therefore, provide reproducible vectors comprising a nucleotide arrangement encoding an antibody against PTK7 of the invention (e.g., an aggregate of an antibody, a heavy or light chain of an antibody, a variable chain control domain of a heavy or light chain of an antibody, or a section thereof , or CDR heavy or light chain, Fv individual chain, or parts or variants thereof), connected to a booster in such a way that it can be operated. In preferred embodiments these vectors may include a nucleotide arrangement encoding the heavy chain of the antibody molecule (or portion thereof), a nucleotide arrangement encoding the light chain of the antibody (or portion thereof) or both the heavy and light chains.

Once the nucleotides of the present invention are isolated and modified according to the studies herein, they can be used to produce selected controls including antibodies against PTK7 or parts thereof.

X. Modulator Production and Purification

Using state-of-the-art molecular biological techniques and current protein expression methods, essential quantities of the required control materials may be produced. More specifically, nucleic acid molecules encoding control materials, such as engineered antibodies produced as described above, may be fused to well-known, commercially available protein production systems comprising various host cell types to provide preclinical, clinical or commercial quantities of the desired drug product. It is estimated that in preferred embodiments the molecules modify nucleic acids encoding control substances into vectors or expression vectors that are available for efficient integration into the selected host cell and subsequent high expression levels of the desired control substance PTK7.

It is preferable to use nucleic acid molecules encoding PTK7 control substances and vectors containing these nucleic acid molecules to infect a suitable mammalian, plant, bacterial cell or yeast host cell where the use of rudimentary systems to produce the control substance is recognized. Infection may be by any known method of introducing polynucleotides into a host cell. The introduction of heterologous polynucleotides into mammalian cells is well known in the art and includes dextran-induced infection, calcium phosphate deposition, polybrene-induced infection, progenitor cell fusion, electroporation, encapsulation of polynucleotide(s) into lipid bodies, and direct thin injection of DNA into nuclei. In addition, DNA molecules may enter the cells of a mammalian organism with viral vectors. You know well in art the methods of creating mammalian cells. See, for example, U.S. Patent Nos. 4,399,216, 4,912,040, 4,740,461, and 4,959,455. In addition, methods for creating a plant cell are well known in the art, and include, for example, xenobacterial transformation, biotransformation, direct injection, electroporation, and viral transformation. Methods for transforming bacterial and yeast cells are well known in the art.

In addition, the host cell may co-receive the gene carrier from the host with two expression vectors of the invention, for example, the first vector encoding a heavy chain-derived polypeptide and the second vector encoding a light chain-derived polypeptide. The two transporters may contain identical selectable markers that enable substantially equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used that encodes, and has the ability to express, both heavy and light chain polypeptides. In these cases, it is preferable to place the light chain before the heavy chain to avoid an excess of toxic free heavy chain. The coding arrangements for the heavy and light chains may include cDNA or genomic DNA.

a. Host-expression systems.

There are a variety of host-expression systems, many of which are commercially available, that are compatible with the instructions herein and can be used to demonstrate controlled substances of the invention. These host expression systems represent carrier media from which important coding arrangements can be expressed and subsequently purified, but they also represent cells that, upon being transformed or receiving a gene carrier from the host with appropriate nucleotide coding arrangements, express a molecule of the invention in place. These systems include, without limitation, microorganisms such as bacteria (e.g., E. coli, B. subtilis, streptomyces) transformed with synthetic bacteriophage DNA, vectors expressing plasmid DNA or cosmid DNA containing control material coding arrangements; Yeast (e.g., Saccharomyces, Pichia) transformed with synthetic yeast expression vectors containing control material coding arrangements; Insect cell systems infected with synthetic virus expression vectors (e.g., baculo virus) containing control material coding arrangements; Plant cell systems (e.g., Nicotiana, Arabidopsis, duckweed, maize, wheat, potato, etc.) infected with synthetic virus-expressing vectors (e.g., cauliflower mosaic virus, CaMV; Tobacco mosaic virus, TMV) or mutant with synthetic plasmid expression vectors (e.g., Ti plasmid) containing control material coding arrangements; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) carrying synthetic expression constructs containing inducers derived from the genome of mammalian cells (e.g., a metallothionein inducer) or from mammalian viruses (e.g., an adenovirus late inducer ;pox virus inducer 7.5K).

In bacterial systems, it is useful to select a number of expression vectors depending on the intended use of the molecule to be expressed. For example, when a large quantity of that protein is to be produced, to generate drug formulations for a control substance, vectors that express high levels of completely pure protein fusion products are required vectors. These vectors include, without limitation, the E. coli pUR278 expression vector:

(Ruther et al., EDUCATION 1. 2:1791 (1983)),

in which the coding sequence is ligated individually in the vector in frame with the lac Z coding region so as to produce a fusion protein; pIN vectors:

(Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989));

etc. pGEX vectors can also be used to express foreign polypeptides such as proteins fused to glutathione 5-transferase (GST). In general, these fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to glutathione agarose beads followed by separation in the presence of free glutathione. pGEX vectors are designed to include thrombin protease or factor Xa cleavage sites so that the transcribed target gene product can be released from the GST fragment.

In an insect system, Autographa californica polynuclear virus (AcNPV) can be used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. Coding sequences can be individually transcribed into non-essential regions (e.g., polyhedrin gene) of the virus and placed under the control of the AcNPV promoter (e.g., polyhedrin promoter).

In mammalian host cells, a number of virus-based expression systems can be used to introduce the desired nucleotide sequence. If an adenovirus is used as a manifestation vector, the significant coding sequence can be associated with an adenovirus transcription/translation control complex, e.g., a late promoter and a precursor trimer. This hybrid gene can then be inserted into the adenovirus genome by synthesis in the laboratory or in the body. An insertion into a non-essential region of the viral genome (e.g., the E1 or E3 region) will produce a viable recombinant virus capable of expressing the molecule in infected hosts, for example, see:

(Logan & Shenk, Proc. Natl. Acad. Sci. USA 8 1:355-359 (1984)).

Special initiation signals may also be needed for efficient translation of the encoding arrangements involved. These signals include the ATG starting codon and flanking arrangements. In addition, the start codon must be in phase with the reading frame for the coding order required to confirm translation of the entire insert. These external signals to control translation and initiation codons can be from any variety of sources, both natural and synthetic. The adequacy of presentation can be increased by including appropriate copy-enhancing elements, copy-finishing materials, etc., see, for example:

(Bittner et al., Methods in Enzymol. 153:51-544 (1987)).

Therefore, compatible mammalian cell lines available as demonstration hosts are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC). These include, among others, Chinese hamster ovary (CHO) cells, NS0 cells, SP2 cells, HEK-293T cells, Freestyle 293 cells (Life Technologies), NIH-3T3 cells, HeLa cells, baby hamster kidney (BHK) cells, African green monkey (COS) kidney cells, human hepatocellular carcinoma cells (eg, Hep G2), A549 cells, and a number of other cell lines.

For long-term, high-throughput production of synthetic proteins, constant expression is preferred. Accordingly, cell lines that consistently exhibit the selected control material can be engineered using standard techniques recognized by the art. In addition to using expression vectors containing viral transcription sources, host cells can be transformed with control DNA with appropriate expression controls (e.g., promoter, enhancer, rearrangements, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following introduction of foreign DNA, engineered cells can be allowed to grow for 1 to 2 days in supplemented media, and then transferred to selective media. The selectable marker in the synthetic plasmid provides resistance to selection and allows cells to integrate the plasmid to a stable degree into their chromosomes and grow to form foci that can in turn be replicated and grow to form cell lines. This method can usefully be used to design cell lines that express the molecule. These designed cell lines may be particularly useful for screening and evaluating structures that interact directly or indirectly with the molecule.

There are a number of selection systems well known in the art that can be used that include, but are not limited to, herpes simplex virus thymidine kinase genes:

(Wigler et al., Cell 11:223 (1977)),

hypoxanthineguanine phosphoribosyltransferase:

(Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)),

And adenine phosphoribosyltransferase:

(Lowy et al., Cell 22:8 17 (1980))

They can be used in tk-, hgprt- or aprt- cells, respectively. Also, anti-metabolite resistance can be used as a basis for selection for the following genes: dhfr, which provides resistance to methotrexate:

(Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78:1527 (1981));

gpt, which provides resistance to mycophenolic acid:

(Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981));

neo, which provides resistance to the aminoglycoside G-418:

(Clinical Pharmacy 12:488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); TIB TECH 11(5):155-2 15 (May, 1993));

And hygro, which provides resistance to hygromycin:

(Santerre et al., Gene 30:147 (1984)).

Methods commonly known in the art for synthetic DNA technology can be used routinely to select the desired synthetic clone, and these methods are described, for example, in:

Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981).

It must be recognized that a particularly preferred method for establishing a stable, high-throughput cell line involving a glutamine synthetase gene expression system (GS system) provides an effective way to increase expression under special conditions. The GS system is described in whole or in part in European Patents 0216846, 0256055, 0323997 and 0338841, each of which is incorporated herein by reference.

Additionally, a host cell line can be selected that controls the expression of the involved arrangements, or the gene product can be modified and processed in the particular manner required. Such modifications (e.g., glycosylation) and processing (e.g., separation) of the protein products may be important for the function and/or purification of the protein. There are different host cells that have special features and mechanisms for processing and modifying proteins and gene products after translation. As is known in the art, appropriate cell lines or family systems can be selected to confirm the modification and processing required for the expressed polypeptide. At this point, eukaryotic host cells that have the cellular machinery for optimal processing of the primary transcript, glycosylation, and phosphorylation of the gene product are particularly effective cells for use in the present invention. Accordingly, particularly favored mammalian cell lines include, but are not limited to, CHO, VERY, BHK, HeLa, COS, NS0, MDCK, 293, 3T3, W138 cells, as well as breast cancer cell lines, e.g., BT483, Hs578T, HTB2. , BT2O and T47D, and a normal mammary gland cell line, e.g., CRL7O3O and HsS78Bst. Depending on the control material and production system selected, those skilled in the art can easily select suitable host cells and optimize them for effective expression of the control material.

b.Chemical synthesis

In addition to the host cell systems mentioned above, it must be realized that the control materials of the invention can be chemically formed using techniques known in the art, for example, see:

(Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310:105-111).

For example, a peptide corresponding to the polypeptide portion of the invention may be generated using the peptide generation tool. In addition, upon request, unconventional amino acids or amino acid chemical analogues may be introduced as substitutions or additions in the polypeptide arrangement. Non-traditional amino acids include, but are not limited to, D-isomers of common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e- Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine , b-alanine, fluoro-amino acids, designed amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogues in general. Additionally, an amino acid may be D (right-rotated) or L (left-rotated).

c. Transgenic systems

The PTK7 control materials of the invention can also be mutagenically produced by generating a mammalian or plant organism mutant for immunoglobulin heavy and light chain arrangements (or parts, derivatives, or variants thereof) of interest and producing the desired compounds in a retrievable form. For mutational production in mammals, antibodies against PTK7, for example, can be produced and recovered from the milk of goats, cows, or other mammals. See, for example, U.S. Patent Nos. 5,827,690, 5,756,687, 5,750,172, and 5,721,957. In some applications, mutant animals comprising human immunoglobulin sites are immunized with PTK7 or an immunogenic portion thereof, as described above. Methods for preparing antibodies in plants are described, for example, in US Patent Nos. 6,046,037 and 5,959,177.

According to the teachings herein, mutant animals or plants can be produced by introducing one or more nucleic acid molecules encoding a PTK7 control substance of the invention into the animal or plant by standard mutational techniques. See Hogan and US Patent No. 6,417,429. The mutant cells used to prepare the mutant animal are embryonic stem cells, somatic cells, or a fertilized egg. Nonhuman mutant organisms may be hybrids, heterozygous nonhybrids, and homozygous nonhybrids. See, for example:

Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual 2nd ed., Cold Spring Harbor Press (1999); Jackson et al., Mouse Genetics and Transgenics: A Practical Approach, Oxford University Press (2000); and Pinkert, Transgenic Animal Technology: A Laboratory Handbook, Academic Press (1999).

In some embodiments, in mutant animals but not in humans there is targeted disruption and replacement with a targeting structure encoding, for example, a heavy chain and/or light chain of interest. In one embodiment, the mutant animals comprise and display nucleic acid molecules encoding heavy and light chains that bind specifically to PTK7. Although antibodies against PTK7 can be prepared in any mutant animal, particularly preferred animal embodiments include mice, ferrets, sheep, pigs, goats, cattle or horses. In additional embodiments the mutant animal manifests the desired drug product in blood, milk, urine, saliva, tears, mucus and other bodily fluids from which it can be readily obtained using purification techniques recognized by the art.

Controls, including antibodies, expressed by different cell lines or in mutant animals are likely to have different glycosylation patterns from each other. However, all control materials encoded by nucleic acid molecules provided herein, or comprising amino acid arrangements provided herein, are part of the present invention, regardless of the glycosylation state of the molecule and, more generally, regardless of the presence or absence of modification(s). ) after translation. The invention further includes control materials modified to a varying degree during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting/quenching groups, separation by proptein degradation, contact with an antibody molecule or other cellular binding compound, etc. Any of many chemical modifications may be performed by known techniques, including, without limitation, special chemical separation with cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic formation in the presence of tunicamycin, etc. Numerous post-translational modifications also included in the invention include, for example, N-linked or O-linked carbohydrate chains, processing of N-terminated or C-terminated ends, association of chemical moieties with the primary structure of an amino acid, chemical modifications of N-linked or O-linked carbohydrate chains. -, and adding or deleting a N-terminal methionine residue results in a prokaryotic family cell. Furthermore, as mentioned in the reference and examples below polypeptides can also be modified with an identifiable tag, such as an enzymatic, radioactive, isotope or affinity tag to allow identification and isolation of the control substance.

d.Purification

Once a control substance of the invention has been produced by synthetic demonstration or any one of the other techniques disclosed herein, it may be purified by any method known in the art for purifying immunoglobulins, or more generally by any other standard technique for purifying proteins. In this aspect, the control material can be isolated. As used herein, an isolated PTK7 control material is a material identified, isolated and/or recovered from a component of its natural environment. Contaminated components from their natural environment are substances that interfere with the diagnostic or therapeutic use of the polypeptide and may include enzymes, hormones, and other proteinaceous or non-proteinaceous dissolved substances. Isolated controls include a control substance in situ in synthetic cells because at least one component of the natural environment for the polypeptide will not be present.

When using synthetic techniques, the PTK7 control material (eg, an antibody against PTK7 or a derivative or fragment thereof) can be produced intracellularly, in the periplasmic space, or secreted directly into the medium. When the desired molecule is produced intracellularly, as a first step, particulate debris, either host cells or degraded fractions, can be removed, for example, by centrifugation or ultrafiltration. For example, it describes:

Carter, et al., Bio/Technology 10:163 (1992)

A procedure for isolating antibodies secreted to the periplasmic compartment of E. coli. Briefly, the cell paste was defrosted in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonylfluoride (PMSF) over approximately 30 min. Separated materials can be removed from the cell by centrifugation. When releasing the antibody into the medium, the supernatants from these demonstration systems are generally first concentrated using a commercially available protein concentration filter. For example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the above steps to inhibit protein degradation, and antibiotics may be included to prevent the growth of cross-contaminants.

A control composition (eg, fc-PTK7 or an antibody against PTK7) prepared from cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as a ligand for attraction depends on the species and homology of any immunoglobulin Fc control domain present in the selected structure. Protein A can be used to purify antibodies based on human IgG1, IgG2 or IgG4 heavy chains (Lindmark, et al., J Immunol Meth 62:1 (1983)). Protein G is favorable for both murine isotypes and human IgG3 (Guss, et al., EMBO J 5:1567 (1986)). The interface material to which the affinity ligand is bound is often agarose, but other interface materials are available. Kinetically stable interfacial materials such as controlled porosity glass or poly(styrenedivinyl)benzene allow faster flow rates and shorter processing times than those achievable with agarose. When the antibody contains a CH3 control domain, Bakerbond ABXTM resin (JT Baker; Phillipsburg, NJ) is useful for purification. There are also other techniques for protein purification such as fractionation on an ion replacement column, ethanol precipitation, reversed phase HPLC, chromatography on silica, chromatography on heparin, sepharose chromatography on an anion or cation replacement resin (such as a polyaspartic acid column), confocal chromatography, SDS-PAGE and ammonium sulfate precipitation are also available depending on the antibody to be recovered. In particularly preferred embodiments the control materials of the present invention will be purified, at least in part, using Protein A or Protein G affinity chromatography.

XI Conjugated PTK7 Modulators

Once control materials of the invention are purified in accordance with the instructions herein, they may be connected with, combined with, combined with (e.g., covalently or non-covalently) or otherwise associated with pharmaceutically or diagnostically active biocompatible modified parts or substances. As used herein, the term conjugate is used broadly and is intended to mean any molecule associated with the declared control substances regardless of the method of association. In this aspect, it must be realized that these conjugates may include peptides, polypeptides, proteins, polymers, nucleic acid molecules, small molecules, similar agents, synthetic drugs, inorganic molecules, organic molecules, and radioactive isotopes. In addition, as indicated above, the selected conjugate may be covalently or noncovalently attached to the control substance and exhibit different molar ratios depending, at least in part, on the method used to perform the conjugation.

In preferred embodiments it will be shown that control substances of the invention may be combined with or conjugated with proteins, polypeptides or peptides imparting selected characteristics (e.g., biotoxins, biomarkers, purification markers, etc.). More generally, in selected embodiments the present invention comprises the use of control materials or portions thereof synthetically combined or chemically combined (including both covalent and non-covalent conjugates) with a protein or heteropolypeptide where the polypeptide comprises at least 10, at least 20, at least 30 , at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids. Structure need not be directly connected, but may exist through associative arrangements. For example, antibodies targeting heterologous polypeptides of specific cell types that express PTK7 can be used, either in vitro or in vivo, by combining or conjugating control materials of the present invention with antibodies specific for specific cell surface receptors. In addition, controls fused or combined with heterologous polypeptides may also be used in in vitro immunoassays and may be compatible with a purification method known in the art. See, for example:

International publication No. WO 93/21232; European Patent No. EP 439,095; Naramura et al., 1994, Immunol. Lett. 39:91-99; U.S. Pat. No. 5,474,981; Gillies et al., 1992, PNAS 89:1428-1432; and Fell et al., 1991, J. Immunol. 146:2446-2452.

a.Biocompatible modifiers.

In a preferred embodiment, the control materials of the invention are combined or otherwise coupled with biocompatible modifying materials that can be used to adjust, change, enhance or modify the characteristics of the control material as required. For example, antibodies or fusion constructs with increased half-lives in the body can be generated by binding to relatively large molecular weight polymer molecules such as commercially available polyethylene glycol (PEG) or similar biocompatible polymers. Those skilled in the art will recognize that PEG can be obtained with many different molecular weights and molecular conformations that can be selected to impart special properties to the antibody (eg, to have a specially tailored half-life). PEG may be conjugated to controls, antibody fragments or derivatives with or without a multifunctional linker either through site-specific conjugation of PEG with the N-terminus or C-terminus of said antibodies or antibody fragments or through epsilon-amino groups present on lysine residues. A linear or branched polymer derivation can be used resulting in little loss of bioactivity. The degree of association can be closely monitored by SDS-PAGE and mass spectrometry to confirm optimal association of the PEG molecules with the antibody molecules. Unreacted PEG can be separated from PEG-antibody conjugates by, for example, size-exclusion chromatography or ion substitution. In a similar manner, the stated controls can be combined with albumin in order to prepare an antibody or antibody fragment that is more stable in the body or has a longer half-life in the body. The techniques are well known in art, see, for example:

International Publication Nos. 15199/93, 15200/93, and 77137/01; European patent document No. 0413622.

There are other biocompatible associations that are obvious to those of ordinary skill and can be easily identified according to the teachings here.

b. Diagnostic or detection agents.

In other preferred embodiments, the control materials of the present invention, or portions or derivatives thereof, are combined with a diagnostic or identifiable agent, indication or laboratory substance that is a biomolecule (e.g., a peptide or nucleotide), a small molecule, a radioactive carrier, or a radioactive isotope. . Labeled controls are useful for monitoring the emergence or progression of a hypermitotic disorder or as part of a clinical test procedure to determine the adequacy of a particular treatment that includes labeled controls (i.e., therapeutic agents). These markers or laboratory materials may also be useful in purifying a selected control, separating or isolating tumor-initiating cells, or in preliminary clinical procedures or toxicological studies.

Such diagnosis or identification may be made by coupling the control substance with identifiable substances including, without limitation, various enzymes including, for example, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; Synthetic combinations, such as unspecified streptavidin/biotin and avidin/biotin; Radioactive materials, such as, without limitation, umbelliferone, fluorescein, fluorescein isothiocynate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; Luminous materials, such as, without limitation, luminol; Bioluminescent materials, e.g Without limitation, luciferase, luciferin, and aequorin; Radioactive substances, such as unspecified iodine (131I, 125I, 123I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (115In, 113In, 112In, 111In), and technetium (99Tc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 10 5Rh, 97Ru , 68Ge, 57Co, 65Zn, 85Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, and 117Tin; Positron-emitting metals using various positron emission surface imaging processes, paramagnetic radioactive inactive metal ions, and molecules radioactively labeled or combined with special radioactive isotopes. In these embodiments appropriate identification methods are used that are well known in the art and fully available from commercial sources.

As indicated above, in other embodiments the control materials or portions thereof may be fused with indication arrangements, such as a peptide or radioactive carrier to facilitate purification or diagnostic procedures such as immunohistochemistry or FACs. In preferred embodiments, the indicator amino acid arrangement is a hexa-histidine peptide (order definition number: 7), such as the accessory portion provided in the pQE vector (Qiagen Inc.), among others, many of which are commercially available. As described in:

Gentz ​​et al., 1989, Proc. Natl. Acad. Know USA 86:821-824

For example, hexa-histidine (Definition No. 7) provides convenient purification for protein fusion. Other accessory peptide fragments for purification include, but are not specified, a hemagglutinin (HA) accessory fragment, corresponding to an epitope derived from the influenza hemagglutinin protein (Wilson et al., 1984, Cell 37:767) and a “flag” accessory fragment (USPN 4,703,004).

c. Therapeutic Moieties

As previously indicated, control substances or parts or derivatives thereof may also be combined, attached, fused or otherwise combined with a therapeutic part such as an anti-cancer agent, a cytotoxin or cytotoxic agent, for example, a cell growth arresting or cytostatic agent, a cell-killing agent. Therapeutic or radioactive metal ion, for example, alpha or beta emitting materials. As used herein a cell toxin or cytotoxic agent includes any agent or therapeutic part that is harmful to cells and may inhibit cell growth or survival. Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin, maytansinoids such as DM-1 and DM-4 (Immunogen, Inc.), dione. , mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, epirubicin, cyclophosphamide and similar substances and similar substances. Additional cell toxins include auristatins, including monomethyl auristatin E (MMAE) and monomethyl auristatin F (MMAF) (Seattle Genetics, Inc.), amanitins such as alpha-amanitin, beta-amanitin, gamma-amanitin or epsilon-amanitin (Heidelberg Pharma AG), DNA minor groove binding agents such as duocarmycin derivatives (Syntarga, BV) and modified pyrrolobenzodiazepine dimers (PBDs, Spirogen, Ltd). Additionally, in one embodiment the PTK7 control materials of the present invention may conjugate anti-CD3 ligand molecules to mobilize cytotoxic T-cell target tumor initiating cells (BiTE technology; see, for example, Fuhrmann, S. et. al. Annual Meeting). of AACR Abstract No. 5625 (2010)) incorporated herein by reference.

Additional therapeutic components include appropriate cytotoxic agents including, without limitation, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (eg, mechlorethamine, thioepa chlorambucil, melphalan, carmustine). (BCNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin), antihistamines. Bioactives (eg, dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (eg, vincristine and vinblastine). A more extensive list of therapeutic parts is contained in the PCT publication: International Application No. 075957/03 US Patent No. 0155255/2009 each of which is incorporated herein by reference.

Selected control materials are also combined with therapeutic moieties such as radioactive materials or macrocyclic chelates useful for combining radioactive metal ions (see above for examples of radioactive materials). In particular embodiments, the macrocyclic chelating substance is 1,4,7,10-tetraazacyclododecane-N,N',N'',N''-tetraacetic acid (DOTA) and can bind to an antibody through a linker molecule. These binding molecules are commonly known in the art and are described in:

Denardo et al., 1998, Clin Cancer Res. 4:2483; Peterson et al., 1999, Bioconjug. Chem. 10:553; and Zimmerman et al., 1999, Nucl. Med Biol 26:943.

Representative radioisotopes compatible with this aspect of the invention include, without limitation, iodine (131I, 125I, 123I, 121I), carbon (14C), copper (62Cu, 64Cu, 67Cu), sulfur (35S), tritium (3H), indium (115In, 113In, 112In, 111In), bismuth (212Bi, 213Bi), technetium (99Tc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 10 5Rh, 97Ru ,68Ge,57Co,65Zn,85Sr,32P,153Gd,169Yb,51Cr,54Mn,75Se,113Sn,117Tin,225Ac,76Br,and 211At. There are also other radionuclides available as diagnostic and therapeutic agents, particularly those in the energy range from 60 to 4000 keV. Depending on the condition to be treated and the type of treatment required, those skilled in the art easily select the appropriate radioisotope for use with the declared control materials.

The disclosed PTK7 control substances of the present invention can also be combined with a therapeutic moiety or drug that modulates a specific biological response (e.g., biological response modulating substances or BRMs). That is, therapeutic agents or parts adapted to the present invention should not be considered as beneficial to conventional chemotherapeutic agents. For example, in particularly preferred embodiments the drug moiety may be a protein or polypeptide or a portion thereof having a desired biological activity. These proteins include, for example, toxins such as abrin, ricin A, onconase (or another cytotoxic RNase), pseudomonas exotoxin, cholera toxin, or diphtheria toxin; protein such as tumor lysis factor, a-interferon, b-interferon, nerve growth factor, platelet-derived growth factor, tissue plasminogen activator, or programmed cell death-inducing factor, e.g., TNF-a, TNF-b, AIM I (see International Publication No. 33899/97), AIM II (see International Publication No. 34911/97), Fas ligand (Takahashi et al., 1994, J. Immunol., 6:1567), VEGI (see International Publication No. 23105/99), a clotting factor or an antiangiogenic agent, eg, angiostatin or endostatin; Or, a biological response modulating substance, e.g., a lymphokine (e.g., interleukin-1 (“IL-1”), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), colony-stimulating factor Granulocyte macrophage (“GM-CSF”), granulocyte colony-stimulating factor (“G-CSF”), or growth factor (e.g., growth hormone (“GH”)). As noted above, methods for combining or combining control materials with polypeptide moieties are known in the art, in addition to previously stated subject references see, for example:

USPNs. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851, and 5,112,946; EP 307.434; EP 367.166; PCT Publications WO 96/04388 and WO 91/06570; Ashkenazi et al., 1991, PNAS USA 88:10535; Zheng et al., 1995, J Immunol 154:5590; and Vil et al., 1992, PNAS USA 89:11337

Each is incorporated here for reference. The association of the control substance with a part does not necessarily need to be direct, but may occur through bonding arrangements. These binding molecules are commonly known in the art and are described in:

Denardo et al., 1998, Clin Cancer Res 4:2483; Peterson et al., 1999, Bioconjug Chem 10:553; Zimmerman et al., 1999, Nucl Med Biol 26:943; Garnett, 2002, Adv Drug Deliv Rev 53:171

Each is incorporated here for reference.

More generally, techniques for combining therapeutic moieties or cytotoxic agents with control substances are well known. Parts may combine with control materials in any manner understood in the art, including, without limitation, aldehyde/Schiff bonding, sulphydryl bonding, variable acid bonding, cis-aconityl bonding, hydrazone bonding, enzymatically hydrolyzable bonding, see generally (Garnett, 2002 , Adv Drug Deliv Rev 53:171). See also, for example:

Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., 1982, Immunol. Rev. 62:119.

In preferred embodiments a PTK7 control substance combined with a therapeutic moiety or cytotoxic agent can be phagocytosed by a cell upon binding to an associated cell surface PTK7 molecule thereby delivering the therapeutic net load.

XII. Diagnostics and Screening Methods

a.Diagnostics methods

As indicated, the present invention provides in vitro or in vivo methods for identifying, monitoring or diagnosing hypermitotic disorders and methods for blocking cells from a patient to identify tumor-forming cells including TPCs. These methods include identifying an organism with cancer to treat or monitor the progression of the cancer, including contacting the patient or a sample taken from the patient with a PTK7 control selected as described herein and determining the presence, absence, or level of association of the control with bound or free PTK7 in the sample. When the control material includes an immunologically active antibody or part thereof, the association with a specific PTK7 in the sample is likely to indicate that the sample may contain tumor cells (e.g., cancer stem cells), indicating that the cancerous organism has been treated to a significant extent. With PTK7 control material as described here. The methods may additionally include the step of comparing the level of correlation with a comparator. Conversely, when the selected control is Fc-PTK7 the binding properties of the selected ephrin-A ligand can be utilized and monitored (directly or indirectly, in vitro or in vivo) in contact with the sample to provide the required information. Other diagnostic or therapeutic methods consistent with the teachings here are well known in the art and can be practiced using commercial materials such as dedicated laboratory systems.

In a particularly preferred embodiment the control materials of the present invention are used to determine and quantify PTK7 levels in a patient sample (e.g., plasma or blood) which may, in turn, be used to identify, diagnose or monitor PTK7 associated disorders including hypermitotic disorders.

Adapted representative test methods include radioimmunoassays, enzyme immunoassays, competitive binding tests, radioimmunoassays, immunoblot tests, Western Blot analysis, flow cytometry tests, and ELISA tests. More generally, PTK7 can be identified in a biological specimen or PTK7 enzymatic activity (or its inhibition) measured using any assay known in the art. Adaptive in vivo diagnostic treatments may include well-known imaging and follow-up techniques such as magnetic resonance imaging (MRI), computed tomography (eg, CAT scan), positron tomography (eg, PET scan), radiography, ultrasound, etc. Those skilled in the art can easily understand the appropriate detection tool, monitoring or imaging techniques (including (commercially available) resources) based on the etiology of the disease, elucidation of the causative factors of the disease or the clinical progression of the disorder.

In another embodiment, the invention provides a method for analyzing cancer progression and/or disease progression in vivo. In another embodiment, analyzing cancer progression and/or disease progression in vivo includes determining the extent of tumor progression. In another embodiment, the analysis includes tumor mapping. In another embodiment, tumor progression analysis is performed on a primary tumor. In another embodiment, the analysis is performed additionally depending on the type of cancer known to the person skilled in the art. In another embodiment, additional in vivo analysis of secondary tumors arising from metastatic cells to form metastases from the primary tumor is performed. In another embodiment, he analyzes the size and shape of secondary tumors. In some embodiments, additional ex vivo analysis is performed.

In another embodiment, the invention provides a method for analyzing cancer progression and/or disease progression in vivo including determining tumor spread in a cell. In yet another embodiment, the analysis of tumor spread in a cell includes identifying advanced cell growth at a discontinuous site of the primary tumor. In another embodiment, the intracellular tumor spread analysis site includes a cancer spread method. In some embodiments, the cells may be dispersed throughout a network of blood vessels, lymphatic vessels, into body cavities or combinations thereof. In another embodiment the spread of the tumor in the cell is analyzed in terms of cell migration, spread, extravasation, division or combinations thereof.

In particular examples, the pathogenic cells in an organism or a sample of an organism may be tested or characterized using said control materials prior to treatment or a system to establish a base line. In another example, the sample is derived from a processed object. In some examples, the sample is taken from the organism at at least approximately 1, 2, 4, 6, 7, 8, 10, 12, 14, 15, 16, 18, 20, 30, 60, 90 days, 6 months, 9 months, 12 months, or > 12 months after the start or end of treatment for the object. In specific examples, tumor-initiating cells are identified or characterized after a specified number of doses (eg, after 2, 5, 10, 20, 30 or higher doses of treatment). In other examples, tumor-causing cells are characterized or identified 1 week, 2 weeks, 1 month, 2 months, 1 year, 2 years, 3 years, 4 years or more after one or more treatments.

In another aspect, and as explained in more detail below, the present invention provides kits for identifying, monitoring or diagnosing a hypermitotic disorder, identifying an organism with that disorder for possible treatment or monitoring of the development (or regression) of the disorder in the patient, wherein the kits include a control substance as described. Here, reagent factors are used to determine the effect of the control substance on a sample.

b. Screening

PTK7 controls and the cells, cultures, collections and combinations thereof, including their descendants, may also be used to screen or identify compounds or agents (e.g., drugs) that affect the function or activity of tumor-initiating cells or their progeny by interacting with PTK7 (e.g., a polypeptide or its genetic components ). The invention therefore additionally provides systems and methods for evaluating or identifying a compound or agent that can affect the function or activity of tumor-initiating cells or their progeny in association with PTK7 or its controlled substances. These compounds or agents may be drug candidates that have been blocked to treat a hypermitotic disorder, for example. In one embodiment, a system or method includes PTK7-expressing tumor initiating cells and a compound or agent (e.g., drug), wherein the cells and the compound or agent (e.g., drug) come into contact with each other.

The invention additionally provides methods for blocking and identifying PTK7 control substances or agents and compounds to modify the activity or function of tumor-initiating cells or progenitor cells. In one embodiment, a method includes contacting tumor initiating cells or their progeny with a test agent or compound; To determine whether the test agent or compound modulates the activity or function of the ephrin-A ligand associated with tumor-initiating cells.

An agent or test compound that modulates the activity or function of PTK7 for those tumor-initiating cells (TICs) or their progeny in a population identifies the test agent or compound as an active agent. A controllable activity or function includes changes in cell shape, expression, differentiation or dedifferentiation, completion of growth and function, proliferation, viability, apoptosis, or cell death. Cell death neuronal progenitor cells or their descendants.

If appropriate, when used in reference to cells, a cell culture, a method step, or a process means a direct or indirect interaction between the composition (e.g., PTK7 associated with a cell or cell culture) and another reference species. A particular example of a direct reaction is a physical reaction. A particular example of an indirect reaction is a reaction in which a composition affects an intermediate molecule which in turn affects the reference species (e.g., a cell or cell culture).

In this aspect of the invention, “modulates” means affecting the activity or function of tumor-initiating cells or their progeny in a manner consistent with determining effects on the activity or function of a cell identified as being specific to a particular aspect (e.g., spread away from origin or division) of the cells. The precursor to the tumor or its descendants of the invention. Representative activities and functions include, but are not limited to, morphometry, phylogenetic implications, differentiation, division, vitality, cell respiration, mitochondrial activity, membrane integrity, or manifestation of implications associated with special cases. Accordingly, a compound or agent (e.g., a drug candidate) may be evaluated for its effect on tumor-initiating cells or their progeny, by contacting those cells or progeny cells with the compound or agent and measuring any control of the activity or function of the tumor-initiating cells or their progeny cells as described herein. Or known to the skilled craftsman.

Methods for blocking and identifying agents and compounds include those suitable for high-input blocking, which include cell systems (e.g., microsystems) positioned or positioned, optionally at predetermined locations or locations. Highly input robotic or manual methods can detect chemical reactions and determine the expression levels of many genes in a short period of time. There are techniques that use molecular signals (e.g., radioligands) and automated analyzes that process information at a very rapid rate, see, for example:

(Pinhasov et al., Comb. Chem. High Throughput Screen. 7:133 (2004)).

For example, microsystems technology has been widely used to probe the interactions of thousands of genes at once while providing information about specific genes, see, for example:

(Mocellin and Rossi, Adv. Exp. Med. Biol. 593:19 (2007)).

These screening methods (eg, high-input) can identify active agents and compounds quickly and effectively. For example, cells may be centered or placed (pre-seeded) on a culture dish, tube, flask, roller bottle or dish (e.g., a single flat multi-well plate or plate such as an 8, 16, 32, 64, 96 plate or dish) , 384 and 1536 samples), optionally at specific sites, to potentially identify therapeutic molecules. Libraries that can be blocked include, for example, small molecule libraries, macrophage expression libraries, all-human antibody yeast expression libraries (Adimab, LLC), siRNA libraries, and adenovirus transformation vectors.

XIII. Pharmaceutical preparations and therapeutic uses

(Pharmaceutical Preparations and Therapeutic Uses)

a. Formulations and routes of administration.

Depending on the form of the control substance together with any optional combination, the method of delivery in question, the disease to be treated or monitored and many other variables, the compositions of the present invention can be formulated on demand using techniques recognized by the art. That is, in various embodiments of the present invention compositions comprising PTK7 control materials are formulated with a wide variety of pharmaceutically acceptable carriers, see, for example:

(Gennaro, Remington: The Science and Practice of Pharmacy with Facts and Comparisons: Drugfacts Plus, 20th ed. (2003); Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th ed., Lippencott Williams and Wilkins (2004); Kibbe et al., Handbook of Pharmaceutical Excipients, 3rd ed., Pharmaceutical Press (2000)).

There are many pharmaceutically acceptable carriers, including carrier media, auxiliaries, and diluents that are fully available from many commercial sources. In addition, a variety of pharmaceutically acceptable auxiliaries, such as pH stabilizing agents, frequency adjusting agents, stabilizers, wetting agents, etc., are also available. Representative special carriers include unbound salt solution, constant pH salt solution, dextrose, water, glycerol, ethanol, and combinations thereof.

More particularly it must be recognized that, in some embodiments, the therapeutic compositions of the invention may be administered undiluted or with minimal additional ingredients. In contrast, the control materials PTK7 of the present invention can optionally be formulated to contain suitable pharmaceutically acceptable carriers, including excipients and auxiliaries well known in the art, which are relatively inert materials that facilitate the administration of the control material or assist in the manufacture of the active compounds in preparations in a pharmaceutically optimal form for delivery to Place of influence. For example, the excipient may be given a form, texture, or act as a diluent to improve the pharmacokinetics of the control substance. Suitable excipients include without limitation stabilizing agents, wetting and emulsifying agents, salts for varying osmolarity, encapsulating agents, pH stabilizers, and skin preparation enhancing agents.

Control substances declared for general administration may be formulated for enteral, non-enteral, or superficial administration. In fact, all three types of preparation can be used simultaneously to perform a general administration of the active ingredient. Excipients as well as preparations for the delivery of a drug by a route other than the enteral route and by a route other than the enteral route are listed in:

Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing (2000).

Preparations suitable for non-enteral administration include aqueous solutions of active compounds in water-soluble form, for example, water-soluble salts. Additionally, suspensions of active compounds may be administered as appropriate as oil injection suspensions. Suitable lipophilic solvents or carrier media include fatty oils, e.g., sesame oil, or manufactured fatty acid esters, e.g., ethyl oleate or triglycerides. Aqueous injection suspensions contain substances that increase the viscosity of the suspension and include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers. Lipid bodies can also be used to encapsulate the agent for delivery into the cell.

Preparations suitable for enteral administration include hard or soft gelatin capsules, tablets, tablets, including coated tablets, elixirs, suspensions, syrups or inhalants and controlled-release forms thereof.

In general, the compounds and compositions of the invention, which include PTK7 control substances, can be administered in the body, to an organism in need, in a variety of ways, including, without limitation, oral administration, intravenous administration, into an artery, under the skin, by other than the intestinal route, into the nose, into Intramuscularly, in the heart, in the ventricle, in the trachea, in the genitals, anally, in the peritoneum, in the dermis of the skin, superficially, through the skin, in the sheath, or otherwise by implantation or inhalation. Subject compositions may be formulated as preparations in solid, semi-solid, liquid, or gaseous forms; Includes, without limitation, tablets, capsules, powders, granules, ointments, solutions, suppositories, enemas, injectable forms, inhalation forms, and aerosols. The appropriate preparation and method of administration can be selected according to the intended use and treatment programme.

b.Dosages

In a similar manner, the particular dosing regimen, i.e., dosage, timing and frequency, will depend on the particular organism and the organism's medical history. Experimental considerations, such as pharmacokinetics (e.g., half-life, clearance rate, etc.) will generally contribute to determining dosage. The frequency of administration can be determined and adjusted over the course of treatment, and is based on the reduction in the number of hypermitotic or neoplastic cells, including tumor-initiating cells, the maintenance of the reduction of those neoplastic cells, the reduction in mitotic neoplastic cell division, or the effect of spreading away from the source. Alternatively, sustained-release formulations with prolonged release of a therapeutic formulation for an organism may be appropriate. As indicated above, there are many preparations and tools for achieving long-lasting release known in the art.

From a therapeutic point of view, pharmaceutical formulations are given in an effective amount to treat or prevent the specific use. The therapeutically effective amount typically depends on the weight of the organism being treated, the physical or health condition of the organism, the severity of the condition to be treated, or the age of the organism being treated. In general, the PTK7 control substances of the invention can be administered in an amount in the range of about 10 μg/kg body weight to about 100 mg/kg body weight/dose. In particular embodiments, the PTK7 control substances of the invention may be administered in an amount in the range from about 50 μg/kg to about 5 mg/kg body weight/dose. In other particular embodiments, the PTK7 control substances of the invention may be administered in an amount in the range from 100 μg/kg to about 10 mg/kg per dose. Optionally, the PTK7 control substances of the invention may be administered in an amount in the range from about 100 μg to about 20 mg/kg body weight. Optionally also, the PTK7 control substances of the invention may be administered in an amount in the range from about 0.5 to about 20 mg/kg body weight/dose. In particular embodiments the compounds of the present invention are administered at a dose of at least about 100 μg/kg body weight, at least about 250 μg/kg body weight, at least about 750 μg/kg body weight, at least about 3 mg/kg of Body weight, at least about 5 mg/kg body weight, at least about 10 mg/kg body weight.

There are other dosing regimens that can be predicted by body surface area (BSA) calculations as stated in USPN 7,744,877, incorporated herein by full reference. As is well known in the art, BSA is calculated using the patient's height and weight and provides a measure of an object's size as represented by the surface area of ​​his or her body. In selected embodiments of the invention using BSA, control substances can be administered in doses from 10 to 800 mg/m2. In other preferred embodiments the control substances will be administered at doses of 50 to 500 mg/m2 and also more preferably at doses of 100 mg/m2, 150 mg/m2, 200 mg/m2, 250 mg/m2, 300 mg/m2, 350 mg/m2. m2, 400 mg/m2, or 450 mg/m2. It must of course be recognized that, regardless of how doses are calculated, multiple doses may be given over a selected period of time to provide a substantially higher absolute dose than single administrations.

However, it is preferable to administer PTK7 controls as needed to the organism in need. Determination of the rate of administration may be made by persons skilled in the art, such as the treating physician on the basis of such considerations as the condition treated, age of the organism treated, severity of the condition treated, general health status of the organism treated, etc. In general, an effective dose of control PTK7 is given to an organism one or more times. More specifically, an effective dose of the control substance is given once a month, more than once a month, or less than once a month. In particular embodiments, the effective dose of the control substance PTK7 may be administered multiple times, including for periods of at least 1 month, at least 6 months, or at least 1 year. In yet another embodiment, several days (2, 3, 4, 5, 6 or 7), several weeks (1, 2, 3, 4, 5, 6, 7 or 8) or several months (1, 2, 3, 4, 5, 6, 7 or 8) between administration of the declared control substances.

Dosages and regimens may also be administered empirically for declared therapeutic compositions in organisms to which they have been administered once or more than once. For example, subjects may be administered progressively increasing doses of the resulting therapeutic composition as described herein. To determine the effectiveness of the selected combination, the disease, disorder or special condition can be tracked as previously described. In embodiments where the subject has cancer, these include direct measurements of tumor size by hand sensation or visual observation, indirect measurement of tumor size by X-ray or other imaging techniques; Improvement as determined by direct biopsy of the tumor and microscopic examination of the tumor specimen; A measure of an indirect tumor marker (eg, PSA for prostate cancer) or a specific antigen according to the methods described herein, a reduction in pain or appearance; Improvement in speech, vision, breathing or other impairment associated with the tumor; excessive appetite; Or an increase in quality of life as measured by acceptable tests or Prolong survival. It will be apparent to one skilled in the art that the dosage will vary depending on the organism, the type of neoplasia, the stage of the neoplasia, whether the neoplasia has begun to spread away from the origin to elsewhere in the organism, and past and concomitant treatments used.

(C) Combination therapies

The combination therapies contemplated by the invention are particularly useful in reducing or inhibiting unwanted division of a neoplastic cell (e.g., endothelial cells), reducing the incidence of cancer, reducing or preventing recurrence of cancer, or reducing or preventing metastasis or metastasis of cancer. Away from the origin. In such cases, the compounds of the present invention may function as an allergenic or chemosensitizing agent by removing TPC that increases and perpetuates tumor mass survival (eg, NTG cells) and permits more effective use of standard of care by tumor reducing or anticancer agents. That is, a combination therapy comprising a PTK7 control substance and one or more anticancer agents may be used to reduce established cancer by, for example, reducing the number of cancer cells present and/or reducing tumor load, or improving at least one symptom or side effect of the cancer. Accordingly, combination therapy refers to the administration of a PTK7 control substance and one or more anticancer agents including, but not limited to, cytotoxic agents, cell growth stimulating agents, chemotherapeutic agents, targeting anticancer agents, biological response modulating agents, immunotherapeutic agents. , cancer vaccines, antiangiogenic agents, cytokines, hormone therapies, radiotherapy, and anti-metabolic agents.

According to the methods of the present invention, there is no need for the combined results to add anything to the effects observed when each treatment (e.g., anti-PTK7 antibody and anticancer agent) is performed separately. Although at least additive effects are generally desired, any additive antitumor effect of more than one of the single treatments is beneficial. In addition, the invention does not require that the combined processing exhibit synergistic effects. However, those skilled in the art will realize that with selected special associations involving preferred incarnations, a consolidation may be observed.

To practice combination therapy according to the invention, one or more anticancer agents may be administered to an organism in need in such a way as to produce antitumor activity in the organism. The control substance PTK7 and the anticancer agent are available in significant quantities and for significant periods of time that lead to their combined presence and combined effects in the tumor environment on demand. To achieve this goal, the control substance PTK7 and the anticancer agent may be administered to the organism concomitantly, either in a single formulation, or in 2 or more separate formulations using the same or different routes of administration.

Alternatively, the foregoing substance may precede or follow treatment with the anticancer agent by, for example, intervals ranging from minutes to weeks. In particular embodiments in which the anticancer agent and the antibody are used separately on the organism, the time period between each delivery time is such that the anticancer agent and the control substance have the potential to produce a combined effect on the tumor. In a particular embodiment, both the anticancer agent and the control substance PTK7 are expected to be administered within about 5 minutes to about 2 weeks of each other.

In still other embodiments, several days (2, 3, 4, 5, 6 or 7), several weeks (1, 2, 3, 4, 5, 6, 7 or 8) or several months (1, 2, 3, 4, 5, 6, 7 or 8) between giving the control substance and the anti-cancer agent. The control PTK7 and one or more anticancer agents (combination therapy) may be given once, twice or at least for a period of time until the condition is treated, improved or resolved. Preferably, the union treatment is given several times. Union treatment can be given from 3 times daily to once every 6 months. Administration may be done according to a program such as 3 times daily, twice daily, once daily, once every 2 days, once every 3 days, once weekly, once every 2 weeks, once every month, once every 2 months, once every 3 months, once every 6 months. Months or may be given continuously with a small pump. As previously indicated, the treatment of conjunctivitis is given orally, mucous membrane, genetically, in the nose, by inhalation, intravenously, subcutaneously, intramuscularly, by other than the intestinal route, in the tumor or superficially. Union treatment may be given at a site distant from the location of the tumor. Conjugation treatment will generally be given as long as the tumor is present, provided that conjugation treatment causes the tumor or cancer to stop growing or reduce its weight or size.

In an embodiment the control substance PTK7 is administered in combination with one or more anticancer agents for a short-term course of treatment to an organism in need. The duration of treatment with the antibody may vary depending on the particular anticancer agent used. The invention also foresees discontinuous administration or daily doses divided into several partial administrations. The appropriate treatment frequency for a particular anticancer agent would be estimated by the skilled manufacturer, and the invention foresees the continued determination of optimal treatment programs for each anticancer agent.

The present invention contemplates at least one, and preferably more than one, cycle during which the treatment of union is given. The appropriate length of time for one cycle will be estimated by the skilled craftsman, as well as the total number of cycles, and the time intervals between cycles. The invention foresees the continued determination of optimal treatment programs for each control substance and anticancer agent. In addition, the invention also provides for more than one administration of either an anti-PTK7 antibody or an anticancer agent. The control and the anticancer agent may be given interchangeably, on alternating days or weeks: or the sequence of administration of the antibody treatment may be determined, followed by one or more treatments in combination with treatment with the anticancer agent. However, as those of ordinary skill in the art will realize, appropriate doses of chemotherapeutic agents will generally be within the range of those used exactly in clinical treatments where chemotherapeutic agents are given alone or in combination with other chemotherapeutic agents.

In another preferred embodiment the PTK7 control substances of the present invention are used in maintenance therapy to reduce or eliminate the chance of tumor recurrence following the initial presence of disease. Preferably, the disorder will be treated and the primary tumor mass removed, reduced or otherwise improved such that the patient has no symptoms or feels the disease is regressing. At that time, the organism may be administered pharmacologically effective amounts of the stated responders one or more times even when there is no or minimal indication for the disease using standard diagnostic procedures. In some embodiments the responders are given on a regular program over a period of time. For example, control subjects may be given PTK7 weekly, every 2 weeks, monthly, every 6 weeks, every 2 months, every 3 months, every 6 months or annually. In light of the teachings here, one skilled in the art can easily determine the preferred doses and dosing regimens to minimize the possibility of tumor recurrence. In addition, these treatments can continue for weeks, months, years or even an indefinite period depending on the patient's response and clinical and diagnostic criteria.

In another preferred embodiment the control materials of the present invention may also be used prophylactically to prevent or reduce the possibility of tumor spread beyond a facility following a volume reduction procedure. As used in the present invention, a volume reduction procedure is broadly defined and means any procedure, technique or method that removes, reduces, treats or improves a tumor or tumor division. Representative volume reduction procedures include, but are not limited to, surgery. Radiotherapy (ie, beam radiation), chemotherapy or resection. At appropriate times readily determined by the skilled in the art in light of the present invention, PTK7 control substances may be administered as determined by clinical and diagnostic procedures to reduce the spread of the tumor away from its origin. Control agents may be administered one or more times at therapeutically effective doses as determined by standard techniques. A dosing regimen accompanied by appropriate diagnostic or monitoring techniques that allows for adjustment as necessary is preferred.

(D) Anti-cancer agents

As used herein, an anti-cancer agent means any agent that can be used to treat a disorder of excessive cell division such as cancer, including cytotoxic agents, cell growth arresting agents, anti-angiogenic agents, volume-reducing agents, chemotherapeutic agents, radiotherapy. , radiotherapeutic agents, targeted anticancer agents, biological response modulators, antibodies, and immunotherapeutic agents. It should be recognized that, in selected embodiments as described above, anticancer agents may include conjugates and may be coadministered with control substances prior to administration.

The term cytotoxic agent means a substance that reduces or inhibits the function of cells and/or causes destruction of cells, i.e., the substance is toxic to cells. Typically, a substance is a naturally occurring molecule derived from a living organism. Examples of cytotoxic agents include, but are not limited to, small molecule toxins or enzymatically active toxins from bacteria (e.g., Diphtheria toxin, Pseudomonas endotoxin and exotoxin, Staphylococcal enterotoxin A), fungi (e.g., α-sarcin, restrictocin), plants (e.g. , abrin, ricin, modeccin, viscumin, antiviral protein, saporin, gelonin, momoridin, trichosanthin, barley toxin, Aleurites fordii proteins, dianthin proteins, Phytolacca mericana proteins (PAPI, PAPII, and PAP-S), Momordica charantia inhibitor, curcin, crotin, saponaria officinalis inhibitor, gelonin, mitegellin, restrictocin, phenomycin, neomycin, and trichothecenes) or animal, such as, cytotoxic RNases, such as extracellular pancreatic RNases; DNase I, including parts and/or variants thereof.

Chemotherapeutic agent means a chemical compound that non-specifically reduces or inhibits the growth, division, and/or survival of cancer cells (eg, agents that are toxic to the cell or stop cell growth). These chemical agents are often directed at processes within the cell that are necessary for cell growth or reproduction, and are therefore particularly effective against cancer cells, which generally grow and reproduce rapidly. For example, vincristine depolymerizes microtubules and thus inhibits entry of cells into meiosis. In general, chemotherapeutic agents include any chemical agent that inhibits, or is designed to inhibit, a cancer cell or a cell that has the potential to become cancerous or generate tumorigenic progeny (eg, TIC). These agents, often more effective, are often given in combination, eg in CHOP.

Examples of anticancer agents that may be used in combination with (or in combination with) the control substances of the present invention include, but are not limited to, alkylation agents, alkyl sulfonates, aziridines, ethylenimines and methylamelamines, acetogenins, camptothecin, bryostatin, callystatin, CC-1065, cryptophycins. , dolastatin, duocarmycin, eleutherobin, pancratistatin, sarcodictyin, spongistatin, nitrogen mustard, antibiotics, enediyne antibiotics, dynemicin, bisphosphonates, esperamicin, enediyne antibiotic dye carriers protein, aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN doxorubicin, epirubicin, esor ubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; Anti-substances Metabolites, folic acid analogues, purine analogues, androgens, adrenal antagonists, folic acid enhancing substances such as frolinic acid, aceglatone, aldophosphamide glycoside, aminolevulinic acid, eniluracil, amsacrine, bestrabucil, bisantrene, edatraxate, defofamine, demecolcine, diaziquone, elfornithine, elliptinium acetate , epothilone, etoglucid, gallium nitrate, hydroxyurea, lentinan, lonidainine, maytansinoids, mitoguazone, mitoxantrone, mopidanmol, nitraerine, pentostatin, phenamet, pirarubicin, losoxantrone, podophyllinic acid، 2- ethylhydrazide، procarbazine، معقد PSK polysaccharide (منتجات JHS Natural، Eugene، OR)، razoxane؛ rhizoxin؛ sizofiran؛ spirogermanium؛ tenuazonic acid؛ triaziquone؛ 2,2',2"-trichlorotriethylamine؛ trichothecenes (particularly T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; decarbazine; mannomustine; mitobronitol; metolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids; chloranbucil; GEMZAR gemcitabine; 6-thioguanine; mercaptopurine؛ methotrexate؛ مماثلات platinum؛ vinblastine؛ platinum؛ etoposide (VP-16)؛ ifosfamide؛ mitoxantrone؛ vincristine؛ NAVELBINE vinorelbine؛ novantrone؛ teniposide؛ edatrexate؛ daunomycin؛ aminopterin؛ xeloda؛ ibandronate؛ irinotecan (Camptosar, CPT-11); topoisomerase inhibitors RFS 2000; difluorometlhylornithine (DMFO); retinoids; capecitabine; combretastatin; leucovorin (LV); oxaliplatin; Inhibitors of PKC-alpha, Raf, H-Ras, EGFR and VEGF-A reduce cell division and are pharmaceutically acceptable salts, acids or derivatives of any of the above. This definition also includes anti-hormonal agents that act to regulate or inhibit the effect of the hormone on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, and anti-androgens; In addition to troxacitabine (analogue of 1,3- dioxolane nucleoside cytosine); antisense oligonucleotides; ribozymes such as VEGF expression inhibitor and HER2 expression inhibitor; Vaccines, PROLEUKIN rIL-2; LURTOTECAN topoisomerase 1 inhibitor; ABARELIX rmRH; Vinorelbine Esperamicins and pharmaceutically acceptable salts, acids or derivatives of any of the above. Other embodiments include the use of immunotherapeutic agents, such as antibodies approved for the treatment of cancer including, without limitation, rituximab, trastuzumab, gemtuzumab ozogamcin, alemtuzumab, ibritumomab tiuxetan, tositumomab, bevacizumab, cetuximab, patitumumab, ofatumumab, ipilimumab and brentuximab vedotin. Those skilled in the art will be able to easily identify additional anticancer agents consistent with the teachings herein.

(e) Radiotherapy

The present invention also provides a combination of PTK7 control materials with radiotherapy (i.e., any mechanism to induce DNA damage locally in tumor cells such as gamma rays, X-rays, UV rays, microwaves, electron emissions, etc.). Combination therapy using direct delivery of a radioisotope to tumor cells is also anticipated here, and could be used in combination with an anticancer targeting agent or other targeting methods. Typically, radiotherapy is given in pulses over a period of time of about one to about two weeks. Radiotherapy can be given to organisms with head and neck cancer for about 6 to 7 weeks. Optionally, radiotherapy may be given as a single dose or as multiple successive doses.

(f) Neoplastic conditions

Whether administered alone or in combination with an anticancer agent or radiotherapy, the PTK7 control substances of the present invention are particularly useful for treating neoplastic conditions in general in patients or organisms containing benign or malignant tumors (e.g., kidney, liver, bladder, breast, stomach, ovary, colon and rectum, prostate, pancreas, lung, thyroid, liver; primary gliomas and numerous tumors of the head and neck; Leukemias and lymphoid malignant diseases; Other disorders such as neuron, glial, astrocyte, hypothalamus and many others, in Macrophagic, epithelial, stromal and blastocytic cell; Inflammatory, angiogenic, immunological and disorders caused by pathogens. Particularly preferred targets for treatment with the compositions and therapeutic methods of the present invention are neoplastic conditions involving solid tumors. In other preferred embodiments the control materials of the present invention are used to diagnose, prevent or treat malignant hematological diseases. Preferably the subject or patient being treated is a human although, as used here, the terms explicitly include any species of mammal.

More particularly, the neoplastic conditions treatable according to the present invention are selected from the group including, without limitation, adrenal gland tumors, AIDS-associated cancers; Vesicular soft-fragment sarcoma, astrocytomas, bladder cancer (squamous cell carcinoma and transitional cell carcinoma), bone cancer (jaw tumor, aneurismal bone cysts, osteochondroma, osteosarcoma), brain and spinal cord cancers, brain tumors that have spread far from their origin, Breast cancer, solid body tumors, cervical cancer, chondrosarcoma, enchondroma, antineoplastic renal cell carcinoma, carcinoma Clear cell, colon carcinoma, colorectal carcinoma, benign cutaneous fibrous tissue tumors, desmoid dysplasia small round cell tumors, cerebellar ventriculomas, Ewing's tumors, skeletal mucinous extracellular chondrosarcoma, immature fibrotic bone formation, fibrous dysplasia of bone, Cancers of the gallbladder and bile duct, foodborne illness with pregnancy, germ cell tumors, head and neck cancers, pancreatic islet cell tumors, Kaposi's sarcoma, kidney cancer (primary renal tumor, papillary renal cell carcinoma), blood cancers, lipoma/sebaceous tumors Benign, sebaceous sarcoma/malignant sebaceous tumors, liver cancer (primary hepatoma, hepatocellular carcinoma), lymphomas, lung cancers (small cell carcinoma, adenocarcinoma, squamous cell carcinoma, large cell carcinoma, etc., primary medulloblastoma, melanoma , tumors of the membranes surrounding the brain, multiple endocrine neoplasia, multiple myeloma, myelodysplastic syndrome, primary neuroma, neuroendocrine tumors, ovarian cancer, pancreatic cancers, papillary thyroid cancers, parathyroid tumors, childhood cancers, perithyroid tumors Peripheral nerve, chromaffinoma Adrenal, pituitary adenoma, prostate cancer, posterior uveal melanoma, rare blood disorders, distantly metastatic renal carcinoma, rod-like tumor, rhabdomyosarcoma, sarcoma, skin cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer , serous carcinoma, testicular carcinoma, thymic carcinoma, thymoma, diffuse thyroid carcinoma, and uterine cancers (cervical carcinoma, endometrial carcinoma, non-rhabdomyosarcoma). In particular preferred embodiments, cancer cells are selected from a group of solid tumors including, without limitation, breast cancer, non-small cell lung cancer (NSCLC), small cell lung cancer, pancreatic cancer, colon cancer, prostate cancer, sarcoma, diffuse alkaloid carcinoma, Diffuse thyroid, clear cell carcinoma.

With regard to malignant blood diseases, it must further be recognized that the compounds and methods of the present invention are particularly effective in treating a variety of B-cell lymphomas, including low-grade follicular cell lymphoma (NHL grade/NHL follicular cell lymphoma (FCC), and parietal cell lymphoma). mantle cell lymphoma (MCL), diffuse large cell lymphoma (DLCL), small lymphocytic NHL (SL), intermediate-grade/follicular NHL, diffuse intermediate-grade NHL, primary autoimmune NHL, primary lymphocytic NHL big grade, high-grade small nonseparate cell NHL, bulky disease NHL, Waldenstrom macroglobulinemia, lymphoplasmacytoid lymphoma (LPL), mantle cell lymphoma (MCL), follicular lymphoma lymphoma (FL), diffuse large cell lymphoma (DLCL) Large, small, inseparate Burkitt and non-Burkitt lymphomas, follicular, predominantly large cell; Follicular, small discrete cell predominant; It is follicular, mixed of separate small and large cell. Look,

Gaidono et al., "Lymphomas", IN CANCER: PRINCIPLES & PRACTICE OF ONCOLOGY, Vol. 2: 2131-2145 (DeVita et al., eds., 5.sup.th ed. 1997).

It should be obvious to those skilled in the art that these lymphomas will always have different names due to changing classification systems, and that patients with lymphomas classified under different names may also benefit from the combined therapeutic regimens of the present invention.

In other preferred embodiments PTK7 controls are also used to effectively treat specific myeloid and hematological malignancies including blood cancers such as chronic lymphocytic leukemia (CLL or B-CLL) or acute myeloid leukemia (AML). Leukemia is a prevalent disease of the elderly. Its incidence begins to increase after the age of fifty and reaches its peak in the late sixties. CLL generally involves mitotic lymphoplasmacytic cells from peripheral blood. Clinical findings with CLL include increased lymphocytosis, lymphadenopathy, splenomegaly, anemia and a deficiency of coagulation cells in the blood. AML is also called acute myeloid leukemia, acute primary myeloid leukemia, acute granulocytic leukemia, and non-lymphocytic leukemia. The underlying pathophysiology in AML consists of arrest of maturation of bone marrow cells at early stages of development. If a person skilled in the art is able to easily derive a treatment for a disorder in terms of the present disclosure using clinically acceptable procedures.

The present invention also provides inhibitory or prophylactic treatment for organisms with benign or precancerous tumors. It is not believed that any particular type of tumor or neoplastic disorder should be excluded from treatment with the present invention. However, the type of tumor cells may be important for the use of the present invention in combination with secondary therapeutic agents, namely chemotherapeutic agents and anticancer targeting agents.

Other preferred embodiments of the present invention include using PTK7 control materials to treat subjects suffering from solid tumors. In these organisms, many of these solid tumors involve tissue that displays genetic mutations that make them particularly sensitive to treatment with effector substances. For example, KRAS, APC, CTNNB1 and CDH1 mutations are relatively common in colorectal cancer patients. In addition, patients with tumors with these mutations are typically the most resistant to current therapies; Especially those patients with KRAS mutations. Activating KRAS mutations, which typically result in single amino acid substitutions, have also been implicated in other difficult-to-treat malignancies, including lung adenocarcinoma, mucinous adenocarcinoma, and ductal carcinoma of the pancreas.

Currently, the most reliable predictor of whether colorectal cancer patients will respond to drugs that inhibit EGFR or VEGF, for example, is to test for particular KRAS “activating” mutations. Mutation for KRAS occurs in 35-45% of colorectal cancers, and patients who have tumors showing mutational KRAS do not respond well to these drugs. For example, KRAS mutations predict lack of response to panitumumab and cetuximab therapy in colorectal cancer.

(Lievre et al. Cancer Res 66:39925; Karapetis et al. NEJM 359:1757-1765).

Approximately 85% of patients with colorectal cancer have mutations in the APC gene (Markowitz & Bertagnolli. NEJM 361:2449-60), and more than 800 APC mutations have been characterized in patients with hereditary adenomatous polyps and colorectal cancer. The majority of these mutations result in a truncated APC protein that has little functional ability to cause cleavage of the beta-catenin gene. Mutations in the beta-catenin gene, CTNNB1, can also lead to increased stability of the protein, to produce nuclear criticality and subsequent activation of numerous oncogenic transcriptional programs, which is also a mechanism of tumorigenesis resulting from the failure of a mutant APC to mediate adequate beta-cleavage. catenin, which is required to keep normal cell division programs and normal differentiation in check.

Loss of expression of CDH1 (E-cadherin) is another common event in colorectal cancer, always noticeable in more advanced stages of the disease. E-cadherin is the central organ of adherin connections that connect and organize cells in epithelial layers. Normally, E-cadherin physically sequesters beta-catenin (CTNNB1) at the plasma membrane; Loss of E-cadherin expression in colorectal cancer leads to localization of beta-catenin in the nucleus and to transcriptional activation of the beta catenin/WNT pathway. Aberrant beta-catenin/WNT signaling is a central axis of tumorigenesis and nuclear beta-catenin is involved in cancer stemness formation (Schmalhofer et al., 2009 PMID 19153669). E-cadherin is required for the expression and function of EphA2 and is a known binding partner for PTK7 ligands in epithelial cells.

(Dodge Zantek et al., 1999 PMID 10511313; Orsulic S and Kemler R, 2000 PMID 10769210).

The use of control substances that bind to PTK7 ligands and either favor or antagonize Eph receptor binding can modify, inhibit or reverse processes predisposing to tumor formation. Alternatively, PTK7 controls may bind preferentially to tumor cells with aberrant PTK7 interactions based on the binding preferences of PTK7 controls. Therefore, patients with cancers bearing the above-mentioned genetic features may benefit from treatment with the aforementioned PTK7 controls.

XIV. Articles of Manufacture

Drug packages and combinations are also available that include one or more containers, including one or more of the control substance PTK7. In particular embodiments, a unit dose is available wherein the unit dose contains a predetermined amount of a composition including, for example, a PTK7 antibody, with or without one or more additional agents. For other embodiments, that unit dose is provided in a prefilled syringe for single-use injection. In still other embodiments, the composition in the unit dose may include a salt solution, sucrose, etc.; pH stabilizer, such as phosphate, etc.; And/or formulated within a stable and effective pH range. Alternatively, in particular embodiments, the composition may be available as a lyophilized powder that is reconstituted upon addition of a suitable liquid, e.g., sterile water. In particular preferred embodiments, the composition includes one or more substances that inhibit protein aggregation, including, without limitation, sucrose and arginine. Any marking on, or associated with, the container(s) is used to indicate the composition contained within for the diagnosis or treatment of the selected disease condition.

The present invention also provides combinations for single-dose or multiple-dose administration of units of a PTK7 control substance and, optionally, one or more anticancer agents. The kit includes a container and a label or package leaflet on or attached to the container. Include suitable containers, for example, vials, bottles, syringes, etc. The container may be made of a variety of materials such as glass or plastic. The container contains the active formulation to treat the condition and has a sterile access port (for example, the container may be an intravenous solution bag or a bottle with a stopper that can be punctured with a hypodermic needle). These kits will generally contain in a suitable container a pharmaceutically acceptable preparation of the PTK7 control agent and, optionally, one or more anticancer agents in the same or a different container. Kits may also contain other pharmaceutically acceptable preparations, either for diagnosis or for combination therapy. For example, in addition to the control substance PTK7 of the invention such combinations may contain any one or more of a range of anticancer agents such as chemotherapeutic or radiotherapeutic drugs; antiangiogenic agents; Anti-spreading agents away from the origin; targeted anticancer agents; Cytotoxic agents; and/or other anticancer agents. These kits may also provide suitable reagents for binding the control PTK7 to an anticancer agent or diagnostic agent (see, for example, USPN 7,422,739 merged (its contents herein are for reference in their entirety).

More specifically, kits may have a single container containing the control agent PTK7, with or without additional components, or they may have distinct containers for each agent required. When combination treatments are available for combination, a single solution can be premixed, either in a molecularly stoichiometric combination, or with the components in equal amounts. Alternatively, the control PTK7 and any optional anticancer agent in the kit may preferably be kept in labeled containers prior to administration to the patient. Kits may also include a second/third container to contain a pharmaceutically acceptable sterile pH stabilizer or other diluent such as bacterial growth buffer water for injection (BWFI), pH stabilized salt solution with phosphate (PBS), Ringer's solution and dextrose solution.

When the components of the group are available in one or more liquid solutions, the liquid solution is preferably an aqueous solution, and specifically a sterile aqueous solution. However, the components of the combination may be supplied as dry powder(s). When reagents or components are available as a dry powder, the powder can be reconstituted by adding a suitable solvent. It is expected that the solvent is also available in another container.

As briefly noted above, the kits also contain a means by which the antibody can be administered and any optional components to an animal or patient, for example, one or more needles and syringes, or also an eye dropper, pipette, or other such device, through which an injection can be made. The preparation, or introducing it into the animal, or giving it to the diseased area of ​​the body. Assemblies of the present invention will typically also include a means for containing bottles, etc., and another component with strict commercial scope compliance, e.g., containers, injection or blow molded plastic in which the required bottles and other device are placed and retained. Any label or package leaflet stating that the control substance PTK7 is used to treat cancer, eg CRC.

XV. Research Reagents

Other preferred applications of the invention also take advantage of the properties of the disclosed control materials as a useful tool for identifying, isolating, fractionating or supplying populations or subsets of tumor-initiating cells through methods such as flow cytometry, fluorescence-activated cell classification (FACS), magnetically activated cell classification ( MACS) or fractionation through laser. Those of skill in the art will recognize that control materials can be used in numerous adapted techniques to characterize and manipulate TICs including cancer stem cells (e.g., US Patent Documents Nos. 686359/12, 669136/12, 757649/12, the contents of which are incorporated herein by reference in their entirety).

XVI. Miscellaneous topics

Unless otherwise specified herein, scientific and artistic terms used in the present invention will have the meanings commonly understood by those of ordinary skill in the art. Additionally, unless otherwise required by the context, singular terms will include references to the plural and plural terms will include the singular. More specifically, as used in this specification and subject-matter protective elements, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise. So, for example, a reference to “protein” includes a number of proteins; Reference to "cell" includes cell mixtures, etc. In addition, the scopes available in the specification and the safeguards complementary to the subject matter include both endpoints and all points between endpoints. Therefore, the range of 2 to 3 includes 2, 3, and all points between 2 and 3.

In general, the nomenclature used with, and the techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry and hybridization described here are well known and used in a common way in the art. The methods and techniques of the present invention are generally performed in accordance with conventional methods well known in the art and as described in the various general and more specific references cited and explained throughout the present specification unless otherwise indicated. See, for example,

Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003).

Enzyme reactions and purification techniques are performed according to the manufacturer's specifications, as commonly found in the art or as described herein. The nomenclature used for, and laboratory procedures and techniques for, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and in common use in the art.

All references or documents stated or cited in this standard are, without limitation, incorporated herein by full reference. Additionally, any section headings used herein are for organizational purposes only and should not be considered restrictive of the subject matter described.

Examples

The present invention thus described above, in general, will be more easily understood by reference to the following examples, which are provided by way of illustration and are not intended to identify the present invention. The examples are not intended to indicate that the experiments below are all or only the experiments conducted. Unless otherwise indicated, parts are weight parts, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure.

Example 1

Providing tumor initiating cell populations

To characterize the cellular heterogeneity of solid tumors according to their presence in cancer patients, to elucidate the specificity of stromal tumor cells (stromal tumor cell; i.e., cancer stem cells: CSC) using specific morphological type markers and to identify clinically important therapeutic targets, a non-classical xenograft tumor bank (NTX) was established ) and retaining it using techniques recognized by art. The NTX tumor bank, comprising a large number of discrete tumor cell lines, is propagated in immunocompetent mice through multiple cycles of allogeneic tumor cells originating from multiple cancer patients with a variety of solid tumor malignancies. The continued availability of a large number of discrete early cycle NTX tumor cell lines with well-defined lineages greatly facilitates the identification and isolation of a primordial tumor cell because it allows for reproducible and reproducible differentiation of cells purified from the cell lines. More specifically, an isolated or purified stromal tumor cell is more precisely defined retrospectively according to its ability to generate tumors that are morphologically heterogeneous and morphological in mice that briefly replicate the patient's tumor sample from which the cells originated. Therefore, the ability to use small populations of isolated cells to generate fully differentiated tumors in mice strongly implicates the fact that the isolated cells comprise an inbred tumor cell. In this work, the use of NTX cell lines that underwent minimal cycling greatly simplifies in vivo experimentation and provides easily identifiable results. In addition, early-course NTX tumors also respond to therapeutic agents such as irinotecan (eg, Camptosar), providing clinically important insights into the underlying mechanisms driving cell growth, resistance to current therapies, and tumor recurrence.

Because NTX tumor cell lines are well-established, the tumor cell morphotypes are analyzed using flow cytometry to determine which markers should be used to differentiate, isolate, purify or supply a tumor starting cell and to separate or analyze the permanent tumor cell and TProg in these populations. In this aspect, the inventors used a proprietary protein-based program (i.e., the PhenoPrint system) that provides rapid recognition of cells based on protein expression and the associated identification of highly useful markers. The PhenoPrint system is a proprietary protein program that includes hundreds of discrete ligand molecules, many of them commercially sourced, arranged in plates of 96 eyes with each eye containing a distinct antibody in the radioactive channel for phycoerythrin and several additional antibodies in different radioactive dyes arranged in each eye. across the plate. This allows replenishment of expression levels of the antigen of interest in a subset of selected tumor cells through rapid inclusion of significant cells or removal of non-significant cells through non-phycoerythrin channels. When the PhenoPrint system is used in combination with tissue dissociation, culture and stem cell techniques well known in the art (Al-Hajj et al., 2004, Dalerba et al., 2007 and Dylla et al., 2008, all supra, the entire contents of which are incorporated herein for reference ), it was possible to identify to an impressive degree important markers and then isolate and culture specific human tumor cell subsets with great efficiency.

Accordingly, when different NTX tumor cell lines are established as is commonly done for human tumors in severely immunocompromised mice, the tumors are excised from the mice when reaching 800-200 mm3 and the cells are lysed into single cell suspensions using enzymatic digestion techniques recognized by the art (see (e.g. USPN 2007/0292414 (embedded here).) Data generated from these suspensions using the PhenoPrint system provide both absolute (in the cell) and relative (versus other cells in the group) surface protein on a starch cell basis, leading to more complex recognition and matching of cell groups. More specifically, the use of the PhenoPrint system for rapid identification of proteins or markers that visually distinguish a tumor precursor cell or sarcoma cell from NTG tumor cells and tumor stromal tissue, when isolated from NTX tumor models, is available for relatively rapid differentiation of subpopulations. A tumor cell that expresses different levels of special cell surface proteins. In particular, proteins that have heterogeneous expression across the tumor cell population allow the isolation and culture of distinct, highly pure tumor cell subsets that express either high or low levels of a particular protein or marker in immunocompromised mice, thus determining whether an inbred tumor cell has In one subgroup or the other.

The term provisioning is used to mean the same thing as isolating cells and means that the yield (fraction) of cells of one type is increased more than the fraction of other cell types compared to the starting or primary cell population. Preferably, augmentation refers to a percentage increase of about 10%, about 20%, about 30%, about 40%, about 50% or greater than 50% for one cell type in a cell group compared to the starting cell group.

As used herein, a signifier, in the context of a cell or tissue, means any distinctive feature in the form of a chemical or biological species that is associated with it in an identifiable manner, or is particularly present in or on a particular cell, group of cells or tissue that includes those identified in or on a tissue or tissue. A group of cells affected by a disease or disorder. Depending on their appearance, the indications may be formal, functional or biochemical in nature. In preferred embodiments the cell is a cell surface antigen expressed to a variable or preferable extent by special cell types (e.g., a tumor cell) or by cells under special conditions (e.g. during special points in the cell life cycle or cells in a special niche). . Preferably, such markers are proteins and, more preferably, an antibody epitope, aptamers or other binding molecules as known in the art. However, a marker may consist of any molecule present on the surface or in a cell including, without limitation, proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids and steroids. Examples of morphologically significant features include, but are not limited to, shape, size, and nuclear-to-cytoplasmic ratio. Examples of functionally significant traits or features include, but are not limited to, the ability to bind to subject substances, the ability to incorporate or exclude special pigments, for example but not limited to the exclusion of lipophilic pigments, the ability to migrate under special conditions and the ability to differentiate across special strains. . A marker may also be a protein that appears from a marker gene, for example a marker gene that is expressed by a cell as a result of the DNA sequence encoding the marker gene being inserted into the cell and copied to produce a marker protein that can be used as a marker. Such marker genes that can be used as markers are, for example but not limited to, radioactive proteins enzymes, pigment-generating proteins, resistance genes, etc.

In particular, the term formal type of meaning in the context of a tissue, cell or cell group (e.g. a formal type of an eternally stable tumor cell) means any sign or combination of meanings that can be used to distinguish, identify, separate, isolate or provide a particular cell or cell group (e.g. , by FACS). In particular embodiments, the semantic type is a cell surface formal type that can be identified by specifying or recognizing the manifestation of a cell surface semantic association.

Those skilled in the art will recognize that many implications (or lack thereof) are associated with many cancer stem cell populations and are used to isolate or differentiate tumor cell subsets. In this aspect representative cancer stem cell markers include OCT4, Nanog, STAT3, EPCAM, CD24, CD34, NB84, TrkA, GD2, CD133, CD20, CD56, CD29, B7H3, CD46, transferrin receptor, JAM3, carboxypeptidase M, ADAM9, oncostatin. M, Lgr5, Lgr6, CD324, CD325, nestin, Sox1, Bmi-1, eed, easyh1, easyh2, mf2, yy1, smarcA3, smarckA5, smarcD3, smarcE1, mllt3, FZD1, FZD2, FZD3, FZD4, FZD6, FZD7, FZD8, FZD9, FZD10, WNT2, WNT2B, WNT3, WNT5A, WNT10B, WNT16, AXIN1, BCL9, MYC, (TCF4) SLC7A8, IL1RAP, TEM8, TMPRSS4, MUC16, GPRC5B، SLC6A14، SLC4A11، PPAP2C، CAV1، CAV2، PTPN3، EPHA1، EPHA2، SLC1A1، CX3CL1، ADORA2A، MPZL1، FLJ10052، C4.4A، EDG3، RARRES1، TMEPAI، PTS، CEACAM6، NID2، STEAP، ABCA3، CRIM1، IL1R1، OPN3، DAF، MUC1، MCP، CPD، NMA، ADAM9، GJA1، SLC19A2، ABCA1، PCDH7، ADCY9، SLC39A1، NPC1، ENPP1، N33، GPNMB، LY6E، CELSR1، LRP3، C20orf52، TMEPAI، FLVCR، PCDHA10، GPR54، TGFBR3، SEMA4B، PCDHB2، ABCG2، CD166، AFP، BMP-4، β-catenin، CD2، CD3، CD9، CD14، CD31، CD38، CD44، CD45، CD74، CD90، CXCR4، decorin، EGFR، CD105, CD64, CD16, CD16a, CD16b, GLI1, GLI2, CD49b, and CD49f. See, for example, Schulenburg et al., 2010, PMID: 20185329, US Patent No. 7,632,678 and US Patent Nos. 0292414/2007, 0175870/2008, 0275280/2010, 0162416/2010 and 0020221/2011 combined their content Here for reference. It must be recognized that a number of these connotations are involved in the PhenoPrint system described above.

Likewise includes unrestricted examples of cell surface isoforms associated with cancer stem cells for specific tumor types CD44hiCD24low, ALDH+, CD133+, CD123+, CD34+CD38−, CD44+CD24−, CD46hiCD324+CD66c−, CD133+CD34+CD10−CD19−, CD138. −CD34−CD19+, CD133+RC2+, CD44+α2 β1hiCD133+, CD44+CD24+ESA+, CD271+, ABCB5+ as well as other cancer stem cell surface isotypes known in the art. See, for example, Schulenburg et al., 2010, supra, Visvader et al., 2008, PMID: 18784658 and US Patent No. 2008/0138313, the entire contents of which are incorporated herein by reference. Those skilled in the art will recognize that indicative morphological types such as those represented in the case above can be used in combination with standard flow cytometry analysis and cell sorting techniques in order to characterize, isolate, purify or supply tumor initiating cells and/or infrared tumor cells or cell populations for Additional analysis. A condition of importance to the present invention is that CD46, CD324 and, optionally, CD66c appear either to a very high or to a heterogeneous extent on the surface of many tumors such as human colorectal (CR), breast (BR), non-small cell lung (NSCLC), Small cell pulmonary (SCLC), pancreatic (PA), prostate (PR), melanoma (Mel), ovarian (OV), and head and neck (HN) cancer, regardless of whether the analyzed tumor samples are primary disease tumor samples or NTX patient-derived tumors.

Expression-negative cells (i.e., “-”) are defined here as those cells that exhibit less than, or equal to, 95% of the expression observed with an isotype comparator antibody in a fluorescence channel in the presence of the complete antibody staining cocktail that is labeled for Other important proteins are in additional channels for emitting radiation. Those skilled in the art will recognize that this procedure to identify adverse events is referred to as “fluorescence minus one” staining or FMO. Cells with greater than 95% of the expression observed with a corresponding conjugate antibody using the above FMO dye are designated here as “positive” (i.e., +). As defined here, there are several groups of cells broadly defined as “positive”. First, low-expressing cells (i.e., lo) are generally defined as those cells that have an observed expressivity above the 95th percentile determined using FMO staining with a comparator antibody of similar type and within one standard diffraction band of the 95th percentile of the observed expressivity with a comparator antibody. Similar type using the FMO staining procedure described above. “High” (i.e., hi) expressing cells can be defined as those cells that have an observed expressivity higher than the 95th percentile determined by FMO staining with a comparator antibody of similar type and greater than one standard diffraction above the 95th percentile seen. with an identical type conjugate antibody using the FMO staining procedure described above. In other embodiments, 99% is preferred as the demarcation point between negative and positive FMO staining and in particularly preferred embodiments the percentage may be greater than 99%.

Using techniques such as those described above to rapidly identify and classify colorectal antigens based on severity of expression and heterogeneity across many NTX tumors from colorectal cancer patients, candidates are additionally tested for stromal tumor cell antigens by comparing tumor tissue versus adjacent normal tissue and then selected based on, At least in part, the level of antigen-specific upregulation in malignant cells is up- or downregulated. In addition, the systematic analysis of a variety of cell surface markers for their potential to provide the ability to culture fully heterologous tumors in mice (i.e., tumor generating capacity), and the subsequent combination of these markers fundamentally improves method decay and improves the ability to tailor radiation-activated cell sorting techniques ( FACS) to identify and characterize highly enriched tumor cell subsets that exclusively contain all tumor-generating potential upon transplantation (i.e., tumor-initiating cells). For the sake of repetition, the term tumor-initiating cell (TIC) or tumor-generating cell (TG) includes both stromal cells (stromal tumor cell; i.e., cancer stem cells) and highly mitotic tumor progenitor cells (TProg), together generally encompassing a subset Unique (i.e. 0.1-25%) volumetric tumor or mass; Its distinctive features are specified above. The vast majority of tumor cells characterized in this way lack this necessity for tumor formation, and can therefore be distinguished as non-tumor-generating (NTG) cells. Surprisingly, it has been noted that most of the markers identified using the patented PhenoPrint system do not show the ability to profile tumor-initiating cell populations in colorectal tumors using standard FACS protocols, but marker associations can be used to identify 2 tumor-initiating cell subsets: primordial tumor cell The TProg. Those skilled in the art will recognize that the defining difference between a tumor cell and a TProg, although both are tumor initiators in primary cultures, is the ability of a tumor cell to sustainably support tumor growth upon serial culture at low cell numbers. Additionally, the marker(s) proteins used in combination to supply both an infrared tumor cell and a TProg were not known to associate with cells containing that activity in any tissue or tumor tissue prior to the discovery by the present inventors, although others have identified cell surface markers or enzymatic activity that may be used. to a similar degree to supply tumorigenic cells (Dylla et al 2008, above). As described below, the particular tumor cell subset isolated using cell surface marker conjugates noted above is then analyzed using whole transcriptome next-generation sequencing to identify and characterize genes expressed to varying degrees.

Example 2

Isolation and analysis of RNA samples from supplied tumor-initiating cell populations

The well-established NTX colorectal tumor line SCRX-CR4 is as described in Example 1 and is used to initiate tumors in isoimmune mice. Once the average tumor load reached approximately 300 mm3, mice were randomly divided and treated with 15 mg/kg irinotecan, 25 mg/kg gemcitabine, or comparator medium (PBS) twice weekly for at least 20 days before euthanizing. Tumors are then removed and TPC, TProg and NTG cells are isolated, respectively, from freshly resected colorectal NTX tumors and, to a similar extent, TG and NTG cells are isolated from pancreatic NTX tumors, generally using the techniques described in Example 1. More specifically, cell populations are isolated by FACS and immediately lysed and degraded in Qiagen RLTplus RNA lysis buffer (Qiagen, Inc.). The decomposition materials are then stored at -80°C until use. Upon thawing from freezing, total RNA was extracted using the Qiagen RNeasy Isolation Kit (Qiagen, Inc.) following the vendor's instructions and quantified on a Nanodrop (Thermo Scientific) and a Bioanalyzer 2100 (Agilent Technologies) again using the vendor's documented protocols and instrument settings. The resulting total RNA preparation is suitable for genetic sequencing and analysis.

Total RNA samples from corresponding cell populations isolated as described above from mice treated with carrier medium or therapeutic chemical agent were prepared for whole transcriptome sequencing using Applied Biosystems SOLiD 3.0 (Sequencing by Oligo Ligation/Detection) software (Life Technologies). , starting with 5 nanograms of total RNA in the sample. Data generated by SOLiD mapped 34,609 genes from the human genome and were able to identify PTK7, in many samples.

In general, the SOLiD3 next-generation sequencing software enables simultaneous sequencing of transcriptionally amplified RNA/DNA fragments attached to beads. Ligation with dye-tagged oligonucleotides is then used to generate 50 reads for each fragment present in the sample, with a total of over 50 million reads to generate a much more accurate representation of the level of mRNA transcript expression for proteins in the genome. The SOLiD3 software is able to identify not only expression, but SNPs, known and unknown reciprocal splicing events, and potentially new exon discoveries based solely on read coverage (reads mapped to a distinct degree to genomic locations). Therefore, the use of this next-generation software allows for the identification of differences in transcript level expression as well as differences or preferences for particular strand variants for those expressed mRNA transcripts. Furthermore, analysis with SOLiD3 software using a modified whole transcriptome protocol from Applied Biosystems requires only approximately 5 ng of primer before amplification. This is limited because extracting total RNA from sorted cell populations from a sarcoid tumor cell subset of cells, for example, is much smaller in number than NTG or volumetric tumors and thus yields very small amounts of usable starting material.

Trials of ranking data from SOLiD3 are normalized, transformed, and multiplication ratios calculated as in standard industry practice. As can be seen in Figure 2, PTK gene expression levels (represented as reads per million mapped to exons; RPM-exon) are measured in specific ScRx-CR4 tumor cell subsets. An analysis of the data shows that PTK7 is upregulated at the transcript level 2-4 times more than in the NTG group, and 50-200 times more than in the TProg group, in mice treated with vector medium or irinotecan, respectively.

The observations detailed above show that PTK7 expression is generally elevated in TPC populations and suggest that PTK7 may play an important role in tumorigenesis and tumor retention, thus forming excellent targets for immunotherapeutic approaches.

Example 3

Real-time PCR analysis for PTK7 in supplied tumor-initiating cell populations

To determine the validity of the differential PTK7 expression observed by whole transcriptome sequencing in stromal tumor cell populations versus TProg and NTG cells in colorectal cancer, and TG versus NTG cells in pancreatic cancer, quantitative real-time PCR uses TaqMan to measure gene expression levels in specific cell populations isolated from NTX lines. Many as mentioned above. It must be recognized that real-time PCR allows for a more direct and rapid measurement of gene expression levels for distinct targets using primers and probe sets specific to a particular gene of interest. TaqMan quantitative PCR is performed on an Applied Biosystems 7900HT Machine (Life Technologies), which is used to measure expression of PTK7 and the PTK7 gene in several patient-derived NTX cell line populations and corresponding control populations. In addition, analysis is performed as specified in the instructions provided with TaqMan and using commercially available PTK7 and PTK7 primer/probe kits (Life Technologies).

As shown in Figure 3, quantitative real-time PCR of gene expression was investigated using NTG clusters, TPC isolated from two clear NTX colorectal tumor lines (SCRx-CR4 and CR5 and one pancreatic tumor line (SCRX-PA3). TProg cell clusters were also separated and lysed. For SCRx-CR4, the data in Figure 3 show that expression of the PTK7 gene is more than two-fold greater in colorectal TPC, when compared with NTG cells from the same tumors. PTK7 is also increased by a factor of 2-fold in the TPC of irinotecan-treated mice, and in the TIC cell population of pancreatic tumors (eg, SCRx-PA3). The observation of high PTK7 expression in NTX TPC preparations compared with NTG cell comparators from patient-derived NTX colorectal and pancreatic tumors using the generally accepted method of real-time quantitative PCR confirms the more sensitive SOLiD3 whole-transcriptome sequencing data in the previous example. These results also support the observed association between PTK7 expression levels and cells undergoing tumorigenesis, treatment resistance and tumor recurrence.

Example 4

Expression of PTK7 in unresected colorectal tumor specimens

In light of the fact that expression levels of the PTK7 gene were shown to be elevated in TPC groups of colorectal tumors when compared with TProg and NTG cells from the same tumors, experiments were conducted to determine whether elevated expression of PTK7 could also be detected in colorectal tumor samples. Unresected versus normal adjacent tissue (NAT). Measurements are also made to determine how PTK7 expression in tumors compares with levels in normal tissue (NL) samples.

More specifically, they are designed and manufactured using techniques known in the art. TumorScan qPCR systems (Origene Technologies) have 384 samples containing 110 colorectal tumor samples from a patient at various stages, normal adjacent tissue, and 48 normal tissue. Using the procedures detailed in Example 3 and the same primer/probe combinations as for PTK7, TaqMan quantitative real-time PCR is performed in standard dish eyes.

Figures 4(a) and 4(b) show the results of the visualization data as equivalent graphs against the average visualization in normal colorectal tissue. More specifically, Figure 4(a) summarizes data generated using 168 tissue samples, from 110 colorectal cancer patients at various stages of the disease (I-IV) (35 of which were normal adjacent tissue (NAT) from patients with colon and rectum) and 48 normal tissue from other sites (NL tissue). In the graph, data from each tissue sample/patient is represented by a dot, and the geometric mean value of each group defined on the X-axis is represented by a line. Similarly, Figure 4(b) contains data from 24 matched colorectal patient specimens from tumor (T) or adjacent normal tissue (N) at different stages of the disease (1-4). The data graphed here are based on a given sample with a connection between the respective tumor and adjacent normal tissue from individual patients. PTK7 expression is significantly higher in the majority of matched tumor versus adjacent normal tissue, with expression in stages 3 and 4 reaching statistical significance (n 4, p 0.037).

Figures 4(a) and 4(b) show that, at all four stages represented, the apparent level of the PTK7 gene is high in the majority of colorectal tumors and in matched tumor samples versus adjacent normal tissue. Furthermore, the average expression of the PTK7 gene at any stage of colorectal cancer appears elevated versus more normal tissues that are elevated (Figure 4(a)). These results demonstrate that PTK7 expression is increased in colorectal cancer and when combined with the above observations that PTK7 expression is highest in colorectal tumor cell and pancreatic tumor initiating cell, suggest that therapeutic targeting of CSCs that express PTK7 may provide therapeutic benefit to cancer patients. .

Example 5

Demonstration of PTK7 in representative tumor samples

In order to additionally determine expression of the PTK7 gene in additional colorectal cancer patient tumor samples and tumor samples from patients diagnosed with 1 of 18 different solid tumor types, Taqman qRT-PCR is performed using 384-well TissueScan qPCR systems (Origene Technologies) that are made with an antisense method according to Description in Example 4 but includes solid tumor samples from 18 different tumor types other than just colorectal samples. The results of the measurements are represented in Figures 5(a) and 5(b) and show that expression of the PTK7 gene is significantly high in a number of solid tumor types.

In this aspect, Figures 5(a) and 5(b) show the relative and absolute levels of gene expression, respectively, for human PTK7 in whole tumor samples (gray dots) or matched normal adjacent tissue (NAT; white dots) from patients with 1 Of 18 different solid tumor types. In Figure 5(a), the data are normalized against the average expression of the gene in the NAT from each tumor type analyzed. In Figure 5(b), the absolute expression is determined for PTK7 in various tissues/tumors, and the data are graphed as the number of cycles (Ct) required to reach exponential amplification by quantitative real-time PCR. Unaugmented samples are given a Ct value of 45, which represents the last amplification cycle in the experimental protocol. Each point represents a single tissue sample, and the average value is represented as a black line.

Using the usual clustered OriGene TissueScan Array, it was observed that the majority of patients diagnosed with colorectal cancer and most patients diagnosed with adrenal, endometrial, esophageal, liver, thyroid and bladder cancers had significantly more expression of the PTK7 gene in their tumors versus NAT, suggesting that PTK7 must play a role in tumorigenesis and/or tumor progression in these tumors. There are also subgroups of lung and prostate cancer patients with elevated PTK7 versus NAT. It is also clear from these studies that expression of the PTK7 gene is generally moderate in most NAT samples; The highest manifestation is observed in the adrenal gland, breast, cervix, ovary, pancreas, testicle and bladder. Again, these data suggest that expression of elevated PTK7 is significant, and strongly critical, for tumor formation or tumor spiraling in patients with selected hypermitotic disorders.

Example 6

Construction and demonstration of PTK7 immunogens

In order to generate and characterize specific PTK7 modulators according to the present invention two forms of a PTK7 immunogen are constructed and demonstrated. Initially, a commercial demonstration vector, pCMV6-XL4-PTK7, was purchased from Origene, Inc. The sequence of the full-length ORF (underlined portion in Figure 1(a)) is confirmed, and it is then subcloned by PCR into the EcoRI and NotI sites of the pCDH vector. EF1-MCS-T2A-GFP lentiviral (System Biosciences). The lentiviral vector displays full-length PTK7 protein fused to a T2A ribosomal mutation peptide and a GFP-selectable marker, allowing multicistronic expression in stem cells. This lentiviral vector is used to transduce 293T cells or BALB/c 3T3 cells according to standard protocols. In addition, pCMV6-XL4-PTK7 was used to transiently express PTK7 protein on the surface of 293T cells after 48 hours of transfection with polyethenimine. Plasma membrane preparations are produced from PTK7-overexpressing cells using contrast centrifugation.

In other cases, soluble PTK7 immunogens are prepared and expressed using the pEE12.4 expression vector (Lonza AG) in which a portion of the PTK7 cDNA carries the code for the extracellular control domain (ECD) protein, and its code is carried in the order indicated by underlined amino acids. In Figure 1(b). In the first case, the ECD fragment is sub-transcribed in frame after the IgK major sequence and before the 8xHis epitope tag (sequence definition no.: 8). A PTK7 ECD immunogen tagged with soluble His was produced by transient transfection in CHO-KSV cells, and the secreted protein was purified from the cell supernatant using Ni-NTA resins and standard methods (Qiagen Inc.). In addition to the previously mentioned PTK7-ECD-His construct, in plasma preparations and host cells carrying the gene described above, the Fc-PTK7-ECD construct is also generated and expressed. This process is induced by PCR amplification of the ECD fragment previously mentioned in Figure 1(b) using KOD Hot Start DNA Polymerase High Fidelity (EMD Chemicals). The forward primer used in the PCR reaction has a PTK7 sequence: GCCATTGTCTTCATCAAGCAGCC (Array ID: 9) and also includes a 5' HindIII restriction site and a murine IgG Kappa signal peptide/key arrangement for product secretion into the culture supernatant. The reverse primer used to amplify these constructs has the PTK7 sequence: CTGGATCATCTTGTAGGGGGGAG (definition number: 10) and includes the 5′ DraIII and BglII restriction sites allowing transcription before the human IgG2 Fc protein is specified as a synthetic gene (DNA 2.0 Inc.).

Amplified or subtranscribed products are then transfected into the final expression vector pEE12.4 (Lonza AG) using HindIII and EcoRI restriction sites, and fidelity is confirmed by DNA sequencing. Plasmids were transiently transfected into either CHO-S or 293T cell suspension and purified by either a nickel affinity column for protein tagged with His or Protein A for the Fc fusion product. The products were further purified by size-exclusion chromatography using a Superdex200 column (GE Healthcare) in phosphate-buffered saline (PBS), pH 7.2, with the amount of pure docking protein determined using the Bradford method (Bradford, 1976: PMID 942051).

Example 7

Generation of antibodies against PTK7 using PTK7 immunogens

PTK-7 modifiers are produced in the form of murine antibodies according to the studies herein by inoculation, respectively, with BALB/3T3 or HEK 293 cells by expressing synthetic full-length hPTK7, hPTK7-His, or hPTK7-Fc as previously described in the previous example. In this regard, three strains of female mice (3 each: Balb/c, CD-1, FVB) were immunized with the previously mentioned PTK7 immunogen preparations. All mice were immunized by paw paw with 10 μg of selected PTK7 construct or 1610 cells in each condition as an emulsion with an equal volume of TiterMax or alum stone adjuvant.

Uses either FACS or solid phase ELISA tests to screen mouse sera for mouse IgG antibodies specific for human PTK7. For ELISAs, dishes were coated with PTK7-His at various concentrations ranging from 0.01-1 μg/ml in PBS overnight. After washing with PBS containing 0.02% (v/v) Tween 20, eyes were blocked with 3% (w/v) BSA in PBS or 2% FCS in PBS, 200 μl/eye for 1 h at room temperature. Dilutions of mouse serum were incubated on coated dishes with PTK7-His at 50 μl/eye at room temperature for 1 h. The plates were washed and then incubated with 50 μl/eye labeled goat anti-mouse IgG with HRP diluted 1:10,000 in 3% BSA-PBS or 2% FCS in PBS for 1 hour at room temperature. Wash plates and add 100 μl/eye of TMB buffer solution (Thermo Scientific 34028) for 15 minutes at room temperature. Finally, an equal volume of 2 mol H2SO4 is added to stop the evolution of the subject and it is decomposed by spectrophotometry at OD 450.

Mouse sera are also tested for antibodies against PTK7 by FACS against abundant cells expressing human PTK7 co-transduction with GFP. Briefly, 1510 BALB/3T3 cells per eye were transduced with human GFP and PTK7 and incubated for 30 min with 100 μl mouse serum diluted 100:1 in PBS/2% FCS. Cells were washed with PBS/2% FCS and then incubated with 50 μl per sample of goat anti-mouse IgG labeled with DyeLight 649, specific for the Fc fraction, secondarily diluted 200:1 in PBS/2% FCS. After incubation for 15 min, cells were washed twice with PBS/2% FCS, resuspended in PBS/2% FCS with DAPI, and lysed by FACS.

Serum-positive immunized mice are killed and draining lymph nodes (popliteal and inguinal, if enlarged) are removed and used as a source of antibody-producing cells. In a single cell suspension of B cells (375,610 cells) fuse with non-P3x63Ag8.653-secreting myeloma cells (ATCC #CRL-1580) at a 1:1 ratio by electroporation. Perform cell electroporation using the BTX Hybrimmune System or ECM2001, (both BTX Harvard Apparatus) according to the manufacturers' instructions. After the electroporation procedure the cells were resuspended in hybridoma selection medium supplemented with Azaserine (Sigma #A9666) medium (DMEM (Cellgro cat#15-017-CM) including, 15% Fetal Clone I (Hyclone) serum), 10% BM Condimed ( Roche Applied Sciences), sodium pyruvate 1 mmol, L-glutamine 4 mmol, Penicillin-Streptomycin 100 IU, 2-mercaptoethanol 50 mmol, and hypoxanthine 100 mmol). In first confluency cells were grown at 2410/eye in flat-bottom microtiters, followed by incubation for 2 weeks in selective HAT medium (Sigma, CRL P-7185). In a second confluence, the cells were grown after conjugation in four T225 flasks at 90 ml of selection medium per flask. The flasks are then placed in a humidified incubator at 37°C with 5% CO2 and 95% air for 6-7 days.

After growth, the library containing cells from the second fusion in T225s was sorted using a FACSAria I cell sorter and grown at one cell per eye in Falcon 96-well U-bottom dishes (both BD Biosciences). Any remaining unused hybridoma library cells are frozen for future testing if necessary. The selected hybridomas were then grown in 200 μl of culture medium containing 15% Fetal Clone I serum (Hyclone), 10% BM-Condimed (Roche Applied Sciences), sodium pyruvate 1 mmol, L-glutamine 4 mmol, 100 units. International Penicillin-Streptomycin, 2-mercaptoethanol 50 micromol, and hypoxanthine 100 micromol). After 10-14 days of growth for both clones in 96-well plates, supernatants from each eye were assessed for active antibodies to murine PTK7 using an ELISA or FACS assay.

Briefly, 96-well plates (VWR, 610744) were coated with 1 μg/ml murine PTK7-His in sodium carbonate buffer overnight at 4°C. Wash dishes and freeze with 2% FCS-PBS for one time at 37°C and use immediately or store at 4°C. Incubate undiluted hybridoma supernatants on plates for 1 hour at room temperature. Plates were washed and probed with goat anti-mouse IgG labeled with HRP diluted 1:10,000 in 1% BSA-PBS for 1 hour at room temperature. After incubation with a buffer solution as described above the plates are read at OD 450.

Hybridoma-positive eyes that secrete murine immunoglobulins are also scanned for human PTK7 specificity using a FACS assay similar to that described above. Briefly, 1510 BALB/3T3 cells per eye are transduced with human GFP and PTK7 and incubated for 30 minutes with 25-100 μl hybridoma supernatant. Cells were washed with PBS/2% FCS twice and then incubated with 50 μl per sample of goat anti-mouse IgG labeled with DyeLight 649, specific for the Fc fraction, secondarily diluted 200:1 in PBS/2% FCS. After incubation for 15 min, cells were washed twice with PBS/2% FCS, resuspended in PBS/2% FCS with DAPI (Life Technologies), and lysed by FACS. For the second fusion, the resulting PTK7-specific transcriptional hybridomas were individualized, cryopreserved in CS-10 freezing medium (Biolife Solutions) and stored in liquid nitrogen.

For the first docking, subcloning is performed on antigen-positive eyes selected using a specific dilution culture. Inspect the dishes visually for the presence of single-colony growth and then blot the supernatants from the single-colony samples with antigen-specific ELISAs and FACS profile as described above. The resulting transcriptome assemblies were isolated, cryopreserved in freezing medium (90% FBS, 10% DMSO) and stored in liquid nitrogen.

For the first coalescence, PTK7-secreting hybridomas from positive eyes (4 observations, OD405 at 20 minutes >0.75) are selected for further differentiation.

A second coalescence seeded over 48 plates (4608 eyes) yields approximately 65% ​​replication efficiency with hundreds of views. Selected versions provide several sets of murine antibodies that are immunologically specific for human PTK7, some of which also cross-react with murine PTK7.

Example 8

Arrangement and humanization of control materials PTK7

8(a) Ranking:

Based on the above, a number of specific single-copy antibodies that bind to stable human antibodies and antibodies that reversibly react with murine PTK7 with clearly high affinity are selected for further sequencing and analysis. As shown in tabulated fashion in Figures 6(a) and 6(b), the analysis of the arrangement of light chain heterologous regions (Figure 6(a)) and heavy chain heteroregions (Figure 6(b)) of selected single-copy antibodies arising in Example 7 It confirms that many have new complementary identification areas and also feature new VDJ arrangements. Note the mapping of complementary selection regions mentioned in Figures 6(a) and 6(b) per Chothia et al., above.

More specifically, Figure 6(a) depicts the adjacent amino acid arrangements of the 21 heterologous regions of the new murine light chain antibodies against PTK7 (order identification numbers: 20-60, even numbers) and four heterologous regions of the human acquired light chain (order identification numbers: 20-60, even numbers). Figures: 62-68, even numbers) were derived from representative mouse light chains. By analogy, Figure 6(b) depicts the adjacent amino acid arrangements of 21 novel murine heavy chain heterologous regions (Order ID#: 21-61, single digits) from the same antibody against PTK7 and four human acquired heavy chain heterologous regions (Order ID#: 21-61, single digits). :63-69, single digits) of the same murine antibodies as those providing human-specific light chains. Thus, Figures 6(a) and 6(b) additionally provide footnote arrangements of 21 antibodies against murine PTK7 (named: SC6.2.35, SC6.10.2, SC6.4.1, SC6.50.1, SC6.3, SC6.4). , SC6.6, SC6.7, SC6.13, SC6.14, SC6.15, SC6.19, SC6.20, SC6.21, SC6.23, SC6.24, SC6.26, SC6.29, SC6 .41, SC6.58 and SC6.59) and four human-specific antibodies (named: hSC6.23, hSC6.24, hSC6.41 and hSC6.58). Note that the meanings SC6.4.1 and SC6.4 reflect only an anomalous nomenclature and that the controls actually comprise two separate antibodies having heterologous region arrangements of a heavy chain and a new light chain.

For the present application the sequence identification numbers for each specific antibody are sequential. Thus mAb SC6.2.35 includes order identification number: 20 and 21 for the light and heavy chain heterologous regions, respectively. In this case SC6.10.2 includes arrangement definition No.: 22 and 23, SC6.4.1 includes arrangement definition No.: 24 and 25, and so on. Furthermore, the nucleic acid arrangements corresponding to each amino acid arrangement of the antibody are provided in Figures 6(a) and 6(b) in the present application as an accompanying arrangement list. Existing nucleic acid arrangements have sequence identification numbers that are 100 greater than the corresponding amino acid arrangement (heavy or light chain). Thus, nucleic acid arrangements that encode amino acid arrangements of the heavy and light chain heterologous region of mAb SC6.2.35 (i.e., Configuration Definition Nos. 20 and 21) comprise Configuration Definition Nos. 120 and 121. Other nucleic acid arrangements of the antibody, including those Which encode constructions that also acquired a human character due to the abnormal naming.

As a first step in arranging representative controls, selected hybridoma cells were lysed in Trizol reagent (Life Technologies) for RNA preparation. Given this, between 410 and 510 cells were resuspended in 1 ml Trizol and shaken vigorously after adding 200 µl of chloroform. The samples were then centrifuged at 4°C for 10 minutes and the aqueous phase was transferred to a microfuge tube when an equal volume of isopropanol was added. The tubes were shaken vigorously again and allowed to incubate at room temperature for 10 minutes before being centrifuged at 4°C for 10 minutes. The resulting RNA pellets were washed once with 1 ml of 70% ethanol and dried briefly at room temperature before resuspending in 40 μl of water treated with DEPC. The quality of RNA preparations was determined by fractionating 3 μl in a 1% agarose gel before fractionating at 80°C until use.

The Ig heavy chain heterologous region of each hybridoma is amplified using a 5' primer mixture comprising 32 mouse primer-specific primers, designed to target the entire murine VH repertoire, in combination with a 3'-specific mouse Cγ primer for each mouse Ig isotype. A 400 bp PCR fragment of VH is sequenced from both ends using the same PCR primers. By analogy, 35 uses the mixing of a primer of a specific 5'Vk base arrangement to amplify all of the united mouse Vk families with a single inverse primer specific to the mouse kappa constant region to amplify and rearrange the kappa light chain. VH and VL transcripts were amplified from 100 ng total RNA using reverse transcriptase polymerase chain reaction (RT-PCR).

A total of 8 RT-PCR reactions are performed for each hybridoma: 4 for V kappa light chain and four for V gamma heavy chain (γ1). For amplification, the QIAGEN One Step RT-PCR Kit (Qiagen, Inc.) is used. This kit provides a mixture of Sensiscript and Omniscript Reverse Transcriptases, HotStarTaq DNA Polymerase, dNTP mixture, pH stabilizer and Solution Q, a new additive that enables efficient amplification of “difficult” titration patterns (e.g., rich with GC). The extracted PCR products are directly sequenced using V region-specific primers. The nucleotide arrangements are analyzed using IMGT to identify germ line V, D and J gene members with highest sequence homology. The derived arrangements are compared with known germline DNA arrangements of the Ig-V and J-regions using V-BASE2 (Retter et al., above) by aligning the VH and VL genes with the base data for the murine germline.

Prepare reaction mixtures containing 3 µl RNA, 0.5 of 100 mol primers of either heavy chain or kappa light chain, 5 µl pH 5 RT-PCR buffer, 1 µl dNTPs, 1 µl enzyme mixture containing reverse transcriptase and DNA polymerase, 0.4 μl of ribonuclease inhibitor RNasin (Promega BioSystems.). The reaction mixture contains all the reagents required for both reverse transcription and PCR. The thermal cycler program is a room temperature step of 50°C for 30 minutes, 95°C for 15 minutes followed by 30 cycles of (95°C for 30 seconds, 48°C for 30 seconds, 72°C for 1 minute). The final incubation is then carried out at 72°C for 10 minutes.

To prepare PCR products for direct DNA sequencing, they are purified using the QIAquick PCR Purification Kit according to the manufacturer's protocol. DNA was separated from the spin column using 50 μl sterile water and then directly sequenced from both strands. Again, the resulting DNA arrangements were decomposed using VBASE2 (data not shown) to provide the footnote arrangements given in Figures 6(a) and 6(b). More specifically, as described above, the footnote amino acid arrangements of the 21 heavy- and light-chain heterogeneous regions of a mouse anti-PTK7 antibody are given in Figures 6(a) and 6(b).

8 (b) Acquiring the human trait

Four of the murine antibodies from Example 7 are humanized using complement-specific region (CDR) vaccination. Human heavy and light chain frames are selected on the basis of similarity of arrangement and structure to functional human germ line genes. In this aspect, construct similarity is assessed by comparing a canonical mouse CDR construct with human candidate constructs that have the same canonical constructs as described in Chothia et al. (above).

More specifically, murine antibodies SC6.23, SC6.24, SC6.41 and SC6.58 are humanized using computer-assisted CDR immunoprecipitation (Abysis Database, UCL Business Plc.) and standard molecular engineering techniques to provide hSC6.23 controls. , hSC6.24, hSC6.41 and hSC6.58. Human framework regions are selected for variable regions on the basis of their highest arrangement similarity to the murine framework arrangement and its canonical structure. For analytical purposes, the assignment of amino acids to each of the CDR control domains is according to the numbering of Kabat and colleagues. Many human-specific antibody variants are prepared to generate an optimal human-specific antibody, with human-specific antibodies generally retaining CDRs - binding murine hybridoma antigen associated with human framework regions. The human-specific SC6.23, SC6.24, SC6.41 and SC6.58 mAbs were found to bind to PTK7 antigen with similar affinity to their murine antigens as measured using the Biacore system.

Molecular engineering procedures are performed using techniques recognized by the art. At this point total mRNA was extracted from the hybridomas according to the manufacturer's protocol (Trizol Plus RNA Purification System, Life Technologies). A sequence-specific 5' primer mixture designed to amplify each hybridoma is used in combination with a human Cγ1 3' primer to amplify and copy the heterologous regions of each human-specific antibody. Analogously, a 5' Vk precursor arrangement specifically designed to amplify all Vk heterodimer regions combined with a human kappa constant region-specific inverse primer is used to amplify and copy the kappa light chain. The amplified fragments are transcribed as human gamma1/kappa chains and serve as a tag for each humanized mAb.

From the nucleotide order information, we obtain data regarding the V, D and J gene segments of the heavy and light chains of SC6.23, SC6.24, SC6.41 and SC6.58 mAbs. Based on the sequence data, new primer sets were designed for the precursor sequence of the Ig VH and VK series of antibodies for cloning the synthetic monoclonal antibody. Next, V-(D)-J rearrangements with murine Ig germ line rearrangements are described. The heavy chain genes of SC6.23 were identified as VH36096 (V), DSP2.3 (D) and JH3. The heavy chain genes of SC6.24 were identified as VHJ558 (V), DSP2.7 (D) and JH4. The heavy chain genes of SC6.41 were identified as IGHV14-4 (V), DFL16.1 (D) and JH2. The SC6.58 heavy chain genes were identified as IGHV4-1 (V), DFL16.1 (D) and JH4. All four light chains were of class K. The light chain genes were identified as IGKV14-111 and JK5 for single-copy antibody SC6.23, IGKV3-5 and JK1 for single-copy antibody SC6.24, IGKV2-137 and germ line arrangement. JK4 for single-copy antibody SC6.41 and IGKV17-121 and germ line arrangements of JK4 for SC6.58 kappa light chain. These results are summarized in Table 1 directly below.

Table 1

Release

VH

DH

JH

VL

JL

SC6.23

VH3609

DSP2.3

JH3

IGKV14-111

JK5

SC6.24

VHJ558

DSP2.7

JH4

IGKV3-5

JK1

SC6.41

IGHV14-4

DFL16.1

JH2

IGKV2-137

JK4

SC6.58

IGHV4-1

DFL16.1

JH4

IGKV17-121

JK4

The resulting heavy and light chain arrangements from all four transcripts are aligned with the functional human variable region arrangements and are reviewed for similarity and canonical structure. The results of the heavy and light chain analysis are shown below in Tables 2 and 3, respectively.

Table 2

mAb

VH Adami

DH Adami

JH Adami

Similarity % to human germ line arrangement

Similarity % to mouse order

hSC6.23

VH2-5

IGHD5-5

JH4

91

81

hSC6.24

VH1-3

IGHD4-23

JH6

82

82

hSC6.41

VH1-46

IGHD4-23

JH4

79

88

hSC6.58

VH3-7

IGHD2-8

JH6

86

88

Table 3

mAb

VK is a person

JK is a man

Similarity % to human germ line arrangement

Similarity % to mouse order

hSC6.23

O8

JK5

91

81

hSC6.24

L6

JK1

82

82

hSC6.41

A3/A19

JK1

79

88

hSC6.58

B2

JK4

86

88

Because germ-line selection and CDR vaccination procedures appear to provide Abs that generally retain the specificities of their binding, there is clearly little need to introduce murine residues into most constructs.

As indicated above, Figures 6(a) and 6(b) show the amino acid arrangements of the human heterologous heavy region chains and kappa light chains for all four antibodies (Definition No. 62-69) and list the corresponding DNA arrangements (Definition No. 69). No.: 162-169) in the attached ranking list.

More specifically, the amino acid and nucleic acid arrangements corresponding to the SC6.23 humanized light chain (Definition Nos. 62 and 162) and the humanized heavy chain (Definition Nos. 63 and 163) are shown in Figures 6(a) and 6( b) And in the ranking list. Similarly, the amino acid and nucleic acid arrangements corresponding to the SC6.24 humanized light chain (Definition Nos. 64 and 164) and the humanized heavy chain (Definition Nos. 65 and 165) are shown in the same figure. Another embodiment of the invention is illustrated by the corresponding amino acid and nucleic acid arrangements of the SC6.41 humanized light chain (Definition Nos. 66 and 166) and the humanized heavy chain (Definition Nos. 67 and 167). In yet another embodiment the amino acid arrangements and corresponding nucleic acid arrangements of the SC6.58 humanized light chain (Definition Nos. 68 and 168) and the humanized heavy chain (Definition Nos. 69 and 169) are also shown. As shown in the examples below, each of the aforementioned human acquired antibodies functions as an effective PTK7 control substance according to the teachings here.

In any case, the declared control materials appear and are isolated using techniques recognized by art. At this point, the synthetic human-acquired variable DNA fragments (Integrated DNA Technologies) copy each of the heavy chains into a human IgG1 expression vector. The variable light chain fragments are transcribed into a human C-kappa expression vector. Antibodies appear to co-recept the host gene carrier for heavy and light chains in CHO cells.

More specifically, for antibody production the PCR products of a murine and acquired human variant gene are transcribed into human Ig-expressing vectors. All primers used in Ig gene-specific PCRs contain recognition sites (AgeI and XhoI for IgH, XmaI and DraIII for IgK), allowing direct transcription into expression vectors containing human IgG1 and IGK constant regions, respectively. Briefly, PCR products were purified with a Qiaquick PCR purification kit (Qiagen, Inc.) followed by digestion with AgeI and XhoI (IgH), XmaI and DraIII (IgK), respectively. Digested PCR products were purified before ligation into expression vectors. Ligation reactions were performed in a total volume of 10 μl with 200 units T4-DNA Ligase (New England Biolabs), 7.5 μl of digested and purified gene-specific PCR product, and 25 ng linearized vector DNA. Competent E. coli DH10B bacteria (Life Technologies) were transformed by heat shock at 42°C with 3 μl of ligation product and grown over ampicillin (100 μg/ml) plates. The AgeI-EcoRI portion of the VH region then inserts into the same loci as the expression vector pEE6.4HuIgG1 (Lonza AG) while the XmaI-DraIII VK transcribes the synthetic insert into the XmaI-DraIII loci from the corresponding expression vector pEE12.4Hu-Kappa.

Human-specific antibody-producing cells are generated by receiving HEK 293 cells of the gene carrier from the host with the appropriate plasmids using 293fectin. Here the plasmid DNA was purified with QIAprep Spin columns (Qiagen). Human embryonic kidney (HEK) 293T cells (ATCC No CRL-11268) were grown in 150 mm dishes (Falcon, Becton Dickinson) under standard conditions in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated FCS, 100 μg/ml. streptomycin, 100 units/ml penicillin G (all from Life Technologies).

For temporary reception of the gene carrier from the host, the cells grow until 80% viability. Equal amounts of IgH and IgL vector DNA (12.5 μg of each vector DNA) were added to 1.5 ml of Opti-MEM mixed with 50 μl of HEK 293 host gene carrier reagent in 1.5 ml of Opti-MEM. Incubate the mixture for 30 minutes at room temperature and distribute it evenly on a culture plate. Supernatants were collected 3 days after receiving the gene carrier from the host, replaced with 20 ml of freshly prepared DMEM supplemented with 10% FBS, and collected again on day 6 after receiving the gene carrier from the host. Culture supernatants were cleared of cell debris by centrifugation at 800 specific gravity for 10 minutes and stored at 4°C. Hybridized and allogenic antibodies were purified with Protein G beads (GE Healthcare).

Example 9

Distinctive features of control materials PTK7

-9 (a) The general distinctive features of the control substance

Several methods are used to analyze the immunohistochemical characteristics of selected PTK7 controls (murine and human) generated as mentioned above. Specifically, a number of these antibodies have characterized affinity, kinetics, labeling, and reactivity with observed homologs in the cynomolgus monkey and mouse (eg, by ForteBio). The reactivity of controls is also measured by Western blot using reduced and nonreducing samples to provide some determination of where epitopes are linear or nonlinear. In addition to the binding of mouse and human antigens to the data in Figure 7(a), the results of antibody recognition for selected mouse controls are presented in tabular form in Figure 7(b). Finally, as shown in Figures 7(c) and 7(e), affinities for selected mouse humanized controls were measured using layer biointerferometry analysis on a ForteBio RED (ForteBio, Inc.) with standard antigen concentration series. In general, the selected controls show relatively high affinities in the nanomolecular range.

According to the present invention, the attraction of the control substance is measured in three ways to ensure its occurrence. First, the binding signal is measured for a fixed amount of serial dilutions of antibody that carefully screens the antigen for the antigen in an ELISA to determine the relative activity of the control (data not shown). Second, the affinities and kinetic constants kon and koff for the selected effectors are then measured using biolayer interferometric analysis on a ForteBio RED (ForteBio, Inc.) with standard antigen concentration series. Finally, the affinity of the selected controls is measured by surface plasmon resonance (Biacore System, GE Healthcare). Based on standard antigen concentration series using a 1:1 Langmuir binding model, the Kd for antibody-antigen binding and the kinetic constants kon and koff (e.g., see Figures 7(c) and 7(e)) are determined using techniques common in the art. The selected effectors generally appear , whether murine or human, have relatively high affinities in the nanomolecular range. In the table in Figure 7(b) the superscript B identifies the affinity measurements made on the Biacore while the superscript F identifies the measurements made on the ForteBio.

Preliminary work is also performed to determine the epitope perceived by the PTK7 effector contains contiguous amino acids or is formed by non-contiguous amino acids in close proximity by the secondary structure of the antigen. Western blots are thus performed under reducing conditions (eg, using 0.5 pM DTT) and non-reducing conditions. More specifically, using standard electrophoresis techniques well known in the art, PTK7 antigen is persisted in both cases on gels and stained before exposure to selected controls. As mentioned in Figure 7(b), two PTK7 controls are tested that only clearly react with antigen when the disulphide bonds are intact (NR). Do not test remaining PTK7 controls for Western blot activity.

Noting the labeling of the antibody, the ForteBio Octet Red96 Analyzer (ForteBio, Inc.) is used per the manufacturer's instructions and a sandwich method recognized by the art [Analytical Biochemistry 386:172-180 (2009)] to identify antibodies that bind to identical or different antibodies. Briefly, the antibody (Ab1) is captured on a mouse antibody capture chip before a high concentration of unbound antibody at 15 μg/ml (100 nmol) is used to immobilize the chip and anchor the base line. Synthetic hPTK7-His is then captured monomeric (Figure A) as Provided in Example 6 (at 500 nmol) by the specific antibody (Ab1) and the tip is dipped either into an eye containing the same antibody (Ab1) as a comparator or into an eye containing a different antibody (Ab2) where the two antibodies are at 4 μg/ml ( 25 nm). When additional binding is observed with a new antibody, then Ab1 and Ab2 are determined to be in different cells. When no additional correlation occurs, similar to the comparator Ab1, then Ab2 is determined to be in the same bin. This process can be expanded to screen large libraries of unique antibodies using the entire array of antibodies representing unique bins in a 96-well plate. Table 7(a) shows representative data for three representative controls for human and murine PTK7 antigen. Figure 7(a) shows that when SC6.10.2 does not bind to mouse at all, SC6.2.35 binds at about 10% of human and SC6.25.1 binds to murine PTK7-His with similar affinity (note: antibodies are denoted by H2). 35, H10.2 and H25.1 in Figure 7(a)). It is further determined that each of these tested antibodies resides in a different category. In a similar manner, a classification analysis is performed by labeling the nine additional PTK7 control subjects with the results shown in Figure 7(b). This data identifies at least 7 clear boxes that the control subjects tested realize. ND in tables indicates that the data is not specified.

Finally, the reversibility of the PTK7 homologs of cynomolgus monkey and mouse with ForteBio is evaluated using concentration series containing a synthetically annotated, monomeric antigen. As recorded in Figure 7(b), a number of representative controls react with murine PTK7, while all of the antibodies react inversely with PTK7 of the identical large monkey Cynomolgus.

-9 (b) Distinctive features of a control subject that has acquired a human character

Using the above techniques in this example the humanized constructs hSC6.23, hSC6.24, hSC6.41 and hSC6.58 are analyzed to determine their association features. In addition, the binding of the humanized antibody is compared directly to the original murine antibody for both antibodies to determine any subtle changes in rate constants caused by the humanization process.

More specifically, the phototaxis of murine SC6.23 is measured by Biacore using surface plasmon resonance (SPR) to provide the results reported in Figure 7(c). On the basis of a concentration series of 25, 12.5, and 6.25 nmol (generating the peak-to-trough curves in Figures 7(c) and 7(d)) ​​and using a 1:1 Langmuir binding model, the Kd for antibody-antigen binding was estimated to be 2.3 nmol Grammy. Similar experiments are then conducted with the humanized SC6.23 structure and show equivalent results (Figure 7(d)), indicating that the humanization process does not affect attraction to a bad degree. In this aspect, measurements indicate that the humanized structure has an affinity of 3.9 nanoparticles, which is well within the acceptable limits for therapeutic antibodies. Figure 7(e) shows similar measurements for all of the human-specific constructs in Example 8 and, through the other techniques mentioned in this example, show that the expressed human-identified PTK7 controls have desirable qualities for therapeutic antibodies.

Example 10

Epitope determination of selected PTK7 control substances

To further clean the labeling data and identify epitope regions defined by PTK7 congenic controls as mentioned above, several different PTK7 ECD variants are constructed and annotated. More specifically, PTK7 abolition mutations are performed using primers that amplify various PTK7 Ig control domains and fuse them with a BglII restriction site upstream of the human IgG2 Fc control domain, arranged as a recombinant gene (DNA 2.0). These Fc fusion proteins are then transcribed into the vector to express pEE12.4 (Lonza AG) using HindIII and EcoRI restriction sites. Isolated endotoxin-free DNA Plasmids (Qiagen Inc.) were used to infect adherent 293 cells using 293Fectin (Life Technologies). Supernatants were harvested from 293 transfected cells 72 hours postinfection. Specifically, the following cancellation constructs fused to the Fc region are required.

PTK7 ECD Ig control domains 1-2

(Definition Ranking No.: 70)

Figure 8(a)

PTK7 ECD Ig control domains 3-7

(Definition of Ranking No.: 71)

Figure 8(b)

PTK7 ECD Ig control domains 1-5

(Definition of Ranking No.: 72)

Figure 8(c)

PTK7 ECD Ig control domains 6-7

(Definition of Ranking No.: 73)

Figure 8(d)

PTK7 ECD Ig control domains 2-3

(Definition of arrangement No.: 74)

Figure 8(e)

PTK7 ECD Ig control domains 1-4

(Definition Ranking No.: 75)

Figure 8(f)

PTK7 ECD Ig control domains 1-7

(Definition of Ranking No.: 3)

Figure 1(c)ECD-

Report the amino acid arrangements for the first six constructs in Figures 8(a) and 8(f) (comprising the PTK7 ECD with the Fc region). The arrangement for 7 structures includes an extracellular control domain of similar shape (Arrangement Definition No. 3) as shown in Figure 1(c) fused to the Fc control domain.

Using these constructs several control materials have been tested for their ability to recognize PTK7 proteins with deletions of specific Ig control domains. During ELISA testing using control domain null constructs performed under standard conditions. Thus, Fc fusions to the PTK7 Ig control domain were captured on an ELISA plate coated with a human anti-goat IgG Fc antibody (Jackson Immunoresearch). The ability of each mouse anti-PTK7 antibody to bind multiple Fc fusion proteins was then revealed to be abolished with a mouse anti-goat Fc antibody labeled with HRP.

Using this test, representative controls such as those directed against specific PTK7 Ig control domains are selected. Example ELISA results identify each representative epitope or binding pattern detected and are found directly in Table 4 below.

Table 4

Domains of Ig control

1-2

2-3

1-4

1-5

3-7

6-7

1-7

Areas of control for engagement

SC6.2.35

+

-

+

+

-

-

+

Ig control domains 1-2

SC6.39

+

+

+

+

-

-

+

Domain of Ig control 2

SC6.25.1

-

+

+

+

-

-

+

Ig control domains 2-3

SC6.10.2

-

-

+

+

-

-

+

Ig control domains 1-4

SC6.18

-

-

-

-

+

-

+

Ig control domains 3-7

SC6.11

-

-

-

-

-

-

+

Ig control domains 1-7

Single-copy antibodies against PTK7 clearly recognize several different epitopes based on the different patterns of positive binding in the ELISA (Table 4 and Figure 8(c)). It is noted in Figure 8(c) that the control materials are recorded as 6M, unlike the recording of SC6, SC6.2.35, and SC6.10.2 as H2.35 and H10.2. Not only do antibodies bind to the epitope through Ig control domains 6-7, but two control domains may contribute with the secondary/tertiary structure of the Ig3-7 Fc fusion structure that is linked by SC6.18 and SC6.31 (not tabulated). Furthermore, the antibodies (SC6.2.35, SC6.4.1 and SC6.10.2) recognize the epitope in the first 4 Ig domains and the antibodies do not bind to the epitope during Ig domains 6-7. In the first 4 Ig control domains SC6.2.35 binds to the epitope through control domains 1-2. SC6.4.1 recognizes the epitope through boundaries of Ig control domains 2-3. In contrast, SC6.10.2 shows sensitivity to any deletion within the first 4 Ig control domains, thus all 4 control domains are similarly used as Ig in epitope determination SC6.10.2. By homology some antibodies bind only to the full-length construct, Ig control domains 1-7, suggesting that Ig abrogations may disrupt some binding sites or secondary constructs of these epitopes. Figure 8(g) provides a schematic representation of these binding modes involving additional antibodies and comparative data illustrating the identification of the binding site of the expressed controls when the 7 Ig control domains of the PTK7 ECD are represented by an inhibitory conformation. Brackets are used to indicate the epitope site shown throughout this ECD for the representative antibodies. Against PTK7.

Example 11

Showing PTK7 protein in representative tumor samples

Having documented elevated gene expression and antibody generation against PTK7 in previous examples, evidence of elevated expression of the corresponding PTK7 protein in selected patient tumor groups is believed to exist. In this aspect, reversed-phase cancer protein lysate systems (ProteoScanTM Arrays; OriGene Technologies) are available that include 4 dilutions of 432 tissue lysates from 11 tumor types, or their adjacent normal tissue, along with control samples consisting of HEK cells 293 without or With over showing of TP53 due to external inductor. The expression of PTK7 protein in lysates on this system is detected using a murine PTK7 monoclonal antibody generated as mentioned in Example 7 that detects PTK7 protein by Western blot (eg clone SC6.2.35). Reagents and protocols for colorimetric determination are available from the manufacturer of ProteoScan Arrays. Spots on the manufactured system are converted to a digital image using a flat-bottom scanning instrument using BZScan2 Java Software (INSERM-TAGC) for quantification of spot density.

Figure 9 shows selected results of these tests, which indicate that PTK7 protein expression is upregulated in a subset of tumor samples derived from a patient with pancreatic colorectal cancer, breast cancer, and ovarian cancer. More specifically, Figure 9(a) shows that expression of PTK7 protein appears to be significantly elevated in a subset of colorectal tumor samples; Especially in patients with stage 4 disease when compared with adjacent normal tissue or tumor tissue from samples from early stages of the disease. As shown in Figure 9(b), PTK7 protein is also overexpressed in most pancreatic neuroendocrine tumors, as well as in subgroups of patients with breast cancer (Figure 9(c)) and ovarian cancer (Figure 9(d)). Data is generated as described above and is represented as average pixel/spot intensity (spot intensity). The horizontal black bar in each sample represents the average for the samples in each corresponding taxon.

These data support the observations in the above examples that overexpression of PTK7 accompanies TIC and/or TPC in colorectal cancer, and may be involved in mitosis and/or survival. In light of what the previous examples show: (a) The PTK7 gene often appears to be associated with a TPC cell subset in CRC and a TG cell subset in pancreatic tumors; (b) PTK7 protein shows higher on TIC cell subset; (c) Expression of elevated PTK7 protein in whole tumor samples from late-stage CRC; (d) The general observation is that TIC is more frequent in late-stage tumors. It appears that PTK7 accompanies these cells causing tumor growth, treatment resistance, and tumor recurrence, which supports that PTK7 has an integrative role in supporting TPC and/or TIC in tumors. The above-mentioned.

In light of these results, the expression of PTK7 in cancer stem cell (CSC) and non-tumor (NTG) aggregates of human breast (BR), lung (LU), ovary (OV), colon (CR), and kidney (KDY) tumor markers is evaluated. Using a flow cytometer. As mentioned in Example 1, abundant NTG and CSC populations can be identified, monitored, and enhanced using phenotypic parameters CD46-/lo CD324- and CD46hi CD324+, respectively. Accordingly, human tumor xenografts from immunocompromised mice coimmunoprecipitated, destained, and co-stained with anti-CD46, anti-CD324, and anti-PTK7 antibodies (Miltenyi Biotech) were commercially available prior to evaluating the expression of PTK7 using flow cytometry in the CD46-/lo pool. CD324- NTG and CD46hi CD324+ CSC pool. More specifically, flow cytometric analysis is performed using standard techniques on a BD FACSCantoTM II flow cytometer (BD Biosciences) with isoform and fluorescence minus 1 (FMO) stained comparisons used to confirm dye specificity.

Results for representative mammary, lung, ovarian, anorectal, and renal tumor samples are shown in Figure 9(e) where the like-type comparison is marked by gray shading, the NTG cell population is represented by the dashed line and the abundant CSC population is indicated by the discontinuous line. It is recognized that, while surface PTK7 staining is relatively sparse in the NTG aggregates of each of these tumors, surface PTK7 staining is greatly increased in abundant CSC aggregates. These results are confirmed (data not shown) using a number of modifiers shown in more than 25 unique NTX lines tested (including many solid tumors).

Example

Selected PTK7 controls were lysed by K562 and G401 cells

PTK7 expressions from hybridomas generated by immunized mice as described above tested their ability to autologize in K562 and G401 cells.

Here K562 cells were lysed at starting concentrations of 610/ml (single cell suspension) with Human TruStain (Biolegend, Inc., 422302) for 10 minutes at room temperature. Dilute cells to 50,310 cells per reaction. Samples were double stained for 30 min on ice with antibody supernatant to a final volume of 50 μl, then washed with FACS staining medium (FSM; 2% fetal bovine serum/Hank/HEPES constant pH salt buffer 25 mM [pH 7.4). ]; Mediatech, Inc.) to remove unbound antibody. Following this, a second stain was performed with donkey anti-mouse Alexa647 (Life Technologies) for 30 minutes on ice. The cells were then washed again to remove unbound antibody and the samples were resuspended in denaturation medium (2% fetal bovine serum/Iscove Modified Dulbecco's medium) and incubated in 5% CO2 at 37°C (or 4°C for comparator) for 1 hour to allow denaturation to occur. Stop the reaction by transferring the samples to ice and adding ice-cold FSM. To remove any undissolved antibody remaining on the cell surface, treat samples with low-pH phosphate buffered salt (PBS [pH 2]) for 10 minutes on ice. Following this “acid stripping” procedure, samples were washed extensively with FSM, resuspended in 150 μl of FSM containing 2 μg/ml DAPI (Life Technologies) and lysed on a BD FACS Canto flow cytometer. Any increase in fluorescence beyond that determined from cells incubated on ice in this experiment is due to the ability of the antibody to deubiquitinate, which protects the radioactive molecule from being stripped from the cell surface during treatment with a low-pH phosphate buffer. All incubations are performed in FACS staining medium unless otherwise noted.

When single copies of hybridoma supernatants containing a PTK7 antibody were blotted using the deacidification protocol described above, multiple supernatants showing a positive shift in immunofluorescence were applied against unstained cells and negative IgG comparison antibodies (Figures 10(a) and 10(b)). Antibody solubilization is observed with several antibodies against PTK7, as demonstrated by the ability of these antibodies to protect a secondary antibody Alexa647 from acid dephosphorylation and causing a right-shift of the fluorescence. The SC6.10.2 antibody clone (i.e., H10 in Figure 10(c)) is an example of typical immunoprecipitation by antibodies against PTK7 with this activity. Compared with IgG conjugates, approximately 15 of the supernatants including PTK7 antibody (4 of 27) induced autophagy. Using K562 cells these data demonstrate that a subset of antibodies are able to bind PTK7 ECD binds antigen on cells and is able to effectively transfect.

Further evidence that the described rates can cause ablation in several representative cell lines is shown in Figure 10(d). More specifically, a glioblastoma cell line (Wilm Tumor G401 cells) was found to express high levels of PTK7 (data not shown), which suggests that this cell line may be more sensitive under selected test conditions and thus be able to more effectively determine rates that Be able to induce subjectification. Generally, using these cells and the deacidification procedure described previously, 170 unique hybridoma supernatants from Example 7 are screened for the presence of autoantibodies. The purified antibodies SC6.2.35, SC6.10.2 and SC6.25.3 (referred to as H2.35, H10.2 and H25.3 in Figure 10(d)) identified in the controlled scan above are used as positive comparison examples (Figure 10(d) )). The amplitude of the rates found in six representative supernatants (determined by good design) immediately illustrates the lowest comparative examples. With these more precise tests the data show that several modifiers provided by the above vaccination procedure are able to bind PTK7 and to internalize (as demonstrated by 1A02, 1F02, 2A03 and 2F10) although all copies (2F11 and 2F09) do not have this ability.

In an additional clarification also related to the properties of the modifiers shown, all of the screened antibodies that bound to G401 cells in a particular manner were found to denature to some extent (Figure 10(e)). As represented by the dashed line in Figure 10(e) positive cell staining is adjusted to 4% based on a corresponding murine antibody that shows non-specific staining for 0-3% of cells. The average fluorescence intensity of G401 cells stained with each antibody is measured after the acid denaturation step (i.e., after desorption) at 37°C and 4°C and interpolated to the corresponding receptor counts for each cell using Rainbow 8-peak beads (BD Spherotech #559123) that include a known number of molecules. fluorescence. The numbers of solubilized receptors are calculated by subtracting the numbers of receptors obtained from samples subjected to a desolvation step at 4°C (comparative example) from the numbers of receptors obtained from samples subjected to a solubilization step at 37°C. It is noted that antibodies specific for PTK7 vary in their ability to induce autophagy, giving a tenfold difference in the numbers of autoantigen receptors regardless of the level of cell attachment (top right box of Figure 10(e)).

Example 13

PTK7 modulators facilitate the delivery of cytotoxic agents

Targeting the stability of a cytotoxic drug conjugated to an antibody represents an adjuvant antibody approach that may have significant therapeutic benefit for patients with solid tumors. To determine whether the PTK7 antibodies described above are capable of delivering a cytotoxic agent to living cells, an in vitro cell killing assay is performed in which a streptavidin conjugated to the ribosome-inactivating protein saporin (Advanced Targeting Systems) is bound to a biotinylated PTK7 antibody, and measured The ability of these saporin complexes to lyse and kill cells after 72 h was determined by cell biometry.

Specifically, 1410 G401 Wilm tumor cells were cultured per eye in a 96-well dish. PTK7 modulators in the form of anti-PTK7 antibodies as described above were purified from supernatants, biotinylated and then diluted to 20 μg/ml. An entire aliquot of each antibody was mixed 1:1 with streptavidin-ZAP (Advanced Targeting Systems), held for 5 seconds and then incubated at room temperature for 1 hour. Three additional 10-fold serial dilutions of saporin antibody complexes are then prepared and 50 μl of each mixture is added, respectively, to eyes containing a G401 cell. The cell/saporin antibody mixture was then incubated at 37°C/5% CO for 24 hours. After this incubation, cells were pipetted into round-bottomed 96-well dishes, the supernatant was removed, and 100 μl of freshly prepared culture medium was added to each well. The cells were then incubated for another 72 h and then live cell counts were counted using CellTiter-Glo (Promega Corp.) according to the manufacturer's protocol.

Using the cell killing assay described above, it is shown that representative PTK7 autophagy modulators including antibodies from clones SC6.2.35, SC6.10.2 and SC6.25.3 (referred to as H2.35, H10.2 and H25.3 in Figure 11(a)) cause Saporin toxin decomposes and kills the cell. More specifically, Figure 11(a) clearly demonstrates the ability of these effect modifiers to kill a cell via PTK7-mediated opsonization compared with a comparator antibody of a similar non-specific species (i.e., MOPC). These data demonstrate that the described modifiers are immunologically specific for PTK7 and are capable of efficiently delivering a net cytotoxic payload and killing PTK7-positive cells through cell surface binding.

The previously mentioned killing assay demonstrates the delivery of a net cytotoxic payload by PTK7-specific antibodies using four additional representative modulators (SC6.23, SC6.41, SC6.51 and SC6.58) with SC6.10.2 used as the positive comparator. To this end the following cell types are grown in 96-well tissue culture dishes in corresponding culture media (500 cells per eye) one day before addition of antibodies and toxin: G401 Wilm Tumor cells, HEK293T are engineered using retroviral transduction to express PTK7 molecules on The surface of these cells (referred to here as 293.PTK7 cells) and HEK293T is used as a comparative example.

For this test, pure PTK7 modifiers at different concentrations are added to eyes containing the transplanted cells. After adding the modifiers, a fixed amount of a Fab fragment against a murine IgG covalently linked to saporin (Fab-ZAP, Advanced Targeting Systems, #IT-48) at a concentration of 4 nmol was added to the eyes and the cultures were incubated for 72 hours. Live cell numbers were determined as described above using CellTiter-Glo. Raw scintillation counts are set using cultures containing cells with the saporin-Fab fragment (not modified) as 100% reference values ​​and all other counts are calculated accordingly (referred to as Normalized RLU).

Using this assay, it is shown that all tested PTK7 antibodies (but not control antibodies of the same type) are able to kill target cells (Figures 11(b)-11(d)) where Figures 11(b), 11(c) show and 11(d) effect of the modifier on G401 cells, 293.PTK7 cells and HEK293T cells, respectively. Realizes that the killing and phagocytosis rate depends on the cell type (compare Figures 11(b) - G401 cells and 11(d) - HEK293T cells), expression levels of PTK7 on target cells (compare Figure 11(c) - 293.PTK7 cells and 11(d) )-HEK293T cells) and the intrinsic capacity of different rates of abscission. The test further demonstrates that transfection occurs primarily due to the binding of a PTK7-specific antibody to the cell surface without the need for additional cross-linking. Based on the data used to generate the dose-response curves in Figures 11(b)-11(d) (and similarly derived values ​​for additional rates - not shown) the half-maximal effective concentration (EC50) is determined for each combination of rates tested/target cell. More specifically, Table 5 below immediately lists the EC50 values ​​(in picomolecular grams) for 30 rates as determined for each of the three target cells using the test described immediately above. ND indicates that the value is not specified.

Table 5

PTK7 modulator-induced delivery of a cytotoxic agent

the average

G401 cells

293.PTK7 cells

HEK293T cells

symmetric IgG2b

Without killing

Without killing

Without killing

SC6.2.35

1.1

0.65

0.45

SC6.10.2

4.7

1.1

156

SC6.25.1

233

10.9

97.6

SC6.8

2.8

3.5

ND

SC6.21

~200

30.6

ND

SC6.23

2.6

1.1

SC6.24

6.7

2.3

SC6.30

314

19.7

ND

SC6.41

2.6

2.3

5.7

SC6.51

105

12.6

8100

SC6.53

4.5

1.9

14.2

SC6.55

8.8

4.2

ND

SC6.58

35.1

10.4

86.8

While some changes are observed for killing within single rates, some general trends are evident from the data in Table 5. In this regard, rates are generally more effective in causing cell killing of engineered PTK-overexpressing 293 cells than for G401 cells or wild-type 293 cells. . Importantly, many of the modulators tested are relatively effective in causing killing of unengineered G401 tumor cells that are known to express PTK7 on the cell surface. These reproducible results represent the therapeutic potential of the wide range of PTK7 modulators of apoptosis as represented here.

Example 14

PTK7 modulators facilitate the delivery of cytotoxic agents into tumorigenic cells

To document the results of the previous example and determine whether PTK7 modulators cause toxin internalization and cell killing in primary human tumor cells, NTX-depleted murine progenitor cells (i.e., human tumor cells circulating as sparsely rounded intrusive patches in non-immune-derived mice) are cultured and subsequently exposed to antibodies Against PTK7 and Fab-ZAP.

In particular, NTX tumors derived from patients with lung (lU), ovarian (OV) and melanoma (SK) cancer were dissociated into single cell suspensions and grown on PrimariaTM plates (BD Biosciences) in serum-free media supplemented using techniques described to the common art that support stem cell proliferation. Cancerous. After 3-5 days of culture at 37°C/5% CO2/5% O2, cells were immunoprecipitated with a isotype conjugate antibody (IgG2a) or one of three antibodies against murine PTK7 (SC6.2.35, SC6.10.2, or SC6. 25.1 at 0.1 nmol (SC6.H2, SC6.H10 and SC6.H25 are marked), and Fab-ZAP (at 40 nmol) as generally mentioned in the previous example. The cytotoxicity of the saporin-induced modifier is then assessed by quantifying the number of remaining cells using CellTiter Glo according to the manufacturers' instructions after 5-7 days. The results are equivalent to untreated cells.

As can be seen in Figure 12, exposure to each of the tested equivalents (without the comparable example of a similar type) causes decreased viable cell numbers in all tumor types. In this regard it is recognized that the amount of cell killing clearly depends on the particular tumor cell line as well as on the specific rate. These data indicate that the rates of the present invention may specifically accompany immune cells expressing multiple antigens from several types of tumors, which lyse and thus cause the killing of the underlying cells. In addition, the ability of the demonstrated modifiers to do this for NTX tumor cell lines under conditions that support cancer stem cell proliferation as described above in the art strongly suggests their ability to selectively abolish cancer stem cells.

Example

PTK7 modulators reduce cancer stem cell tumorigenesis

To further confirm the ability of the described modulators to reduce the frequency of CSCs and elucidate their tumorigenic potential, NTX mammary tumor cells were treated with SC6.2.35 and subsequently cultured in immunocompromised mice.

In this regard, two NTX tumors derived from a breast cancer patient (BR13 and BR64) are isolated, the human tumor cells are cultured under conditions known in the art to retain tumorigenic cells, and they are treated with a PTK7 modulator (and a comparator of a similar type) and Fab-ZAP as mentioned in the previous example. Cytotoxicity is then measured in terms of cell viability using Cell Titer Glo according to the manufacturers' instructions 40 days prior to treatment. Again the results are equal for untreated cells.

As can be seen in Figures 13(a) and 13(b), respectively, breast tumor cells derived from BR13 (Figure 13(a)) and from BR64 (Figure 13(b)) are largely abolished through internalization and a special immunological combination caused by the PTK7 modulator of the factor Saporin is cytotoxic. More specifically, treatment with a PTK7 SC6.2.35 (SC6.H2) modifier of 0.2 nmol results in abolition of approximately 70-80% of cells while cells treated with the comparator IgG2a are not significantly affected. The results are consistent with the results shown in Example 13 and further illustrate the broad use of the present invention based on the ability of the described modifiers to eliminate pre-tumor-sustaining cells derived from various tumors.

To confirm that the described modifiers abolish tumor-inducing cells, treated preparations of two breast cancer cell lines were cultured in mice to determine the survival of tumor-inducing cells. More specifically, cells were independently collected from each of three eyes, washed in PBS including 2% BSA, resuspended in 100 μl and then cultured into single immunocompromised mice using generally the procedures previously described in Example 1. Mice were monitored weekly for tumor growth and any tumor growth was measured. Emerging tumors to calculate their sizes. Mice transplanted with only NTX BR13 and BR64 cells treated with IgG comparator showed tumors while those transplanted with cells attached to PTK7 modifiers did not show tumors. These results demonstrate that TIC is abolished by PTK7 modulators capable of toxin delivery (Figure 13(c)).

A review of the data shows that transplanting living cells remaining after treatment of a breast cancer cell line with PTK7 modulator and saporin does not cause tumors to form. In contrast, comparator cells from both breast cancer cell lines (ie, those treated with a comparator antibody of a similar type) are able to re-induce tumor growth upon culture. Specifically, two of three mice transplanted into each of the two comparison cell lines (BR22 and BR64) developed measurable tumors suggesting that the transplanted cells include pre-tumor-sustaining cells. More specifically, the inability of modified-treated cells to form tumors strongly suggests that the transplanted cells did not contain a pre-tumor-sustaining cell. Thus, it is likely that treatment with a PTK7/saporin modulator selectively targets and eliminates pre-neoplastic metastasis cells according to the present invention. In any case, these data show that treatment with the indicated modifiers is effective in reducing the oncogenic potential of tumor cells.

Example 16

Human-acquired PTK7 modulators deliver cytotoxic agents

Preferred embodiments of the present invention often use human-specific PTK7 modulators in a therapeutic setting, testing to show that antibodies against human-specific PTK7 (manufactured as previously mentioned in Example 8) act as agents that are effective in killing a cell by delivering cytotoxic agents to the cell. .

More specifically, three representative human-derived PTK7 modifiers (hSC6.23, hSC6.58 and hSC6.24) are used to induce a net cytotoxic payload and eliminate tumorigenic cells according to the studies here. Generally using the protocol previously described in Example 13 above, HEK293 cells engineered to express PTK7 (i.e., 293.PTK7 cells) are exposed to different concentrations of saporin and selected rates of binding with a human Fab antibody (Fab-ZAP Human, Advanced Targeting Systems). After incubation, the cells were washed and the cytotoxicity of the saporin-mediated modifier was then assessed by quantifying the remaining number of cells using CellTiter Glo according to the manufacturers' instructions after 2-7 days. The results are equivalent for untreated cells and are represented schematically in Figure 14.

Inspection of the previously mentioned curves in Figure 14 shows that all three tested PTK7 modulators are very effective in inducing desulfation of the cytotoxic net payload that reduces cell viability. In this regard, each rate provides a 50% reduction in cell viability at a concentration between 1 and 10 pg and a more than 80% reduction in cell viability at a concentration of 100 pg. Again, according to the present demonstration these data indicate highly effective modulators that can specifically immunologically deliver cytotoxic agents to selected cell populations.

Those skilled in the art will further recognize that the present invention may be embodied in other particular forms without abandoning the essence or central features thereof. Although the foregoing description of the present invention discloses only representative embodiments thereof, it should be recognized that other variations are expected to be within the scope of the present invention. Accordingly, the present invention is not limited to the particular embodiments described in detail herein. Rather, reference must be made to the elements of protection that are complementary to the subject matter as an indication of the scope and content of the invention.

Sequence lists

<110> SteamCentrix, Inc.

<120> New control materials and methods for use

<130> S69697 1030US.PCT

<140>

<141>

<150> PCT/US2011/050451

<151> 2011-09-02

<150> 61/444,614

<151> 2011-02-18

<160> 169

<170> PatentIn version 3.5

<210> 1

<211> 4249

<212> DNA

<213> Homo sapiens

<400> 1

acgcctcggg gtcgggctcc ggctgcggct gctgctgcgg cgcccgcgct ccggtgcgct 120

ccgcctcctg tgcccgccgc ggagcgcagt ctgcgcgccc gccgtgcgcc ctcagctcct 180

tttcctgagc ccgccgcgat gggagctgcg cggggatccc cggccagacc ccgccggttg 240

cctctgctca gcgtcctgct gctgccgctg ctgggcggta cccagacagc cattgtcttc 300

atcaagcagc cgtcctccca ggatgcactg caggggcgcc gggcgctgct tcgctgtgag 360

gttgaggctc cgggcccggt acatgtgtac tggctgctcg atggggcccc tgtccaggac 420

acggagcggc gtttcgccca gggcagcagc ctgagctttg cagctgtgga ccggctgcag 480

gactctggca ccttccagtg tgtggctcgg gatgatgtca ctggagaaga agcccgcagt 540

gccaacgcct ccttcaacat caaatggatt gaggcaggtc ctgtggtcct gaagcatcca 600

gcctcggaag ctgagatcca gccacagacc caggtcacac ttcgttgcca cattgatggg 660

caccctcggc ccacctacca atggttccga gatgggaccc ccctttctga tggtcagagc 720

aaccacacag tcagcagcaa ggagcggaac ctgacgctcc ggccagctgg tcctgagcat 780

agtgggctgt attcctgctg cgcccacagt gcttttggcc aggcttgcag cagccagaac 840

ttcaccttga gcattgctga tgaaagcttt gccagggtgg tgctggcacc ccaggacgtg 900

gtagtagcga ggtatgagga ggccatgttc cattgccagt tctcagccca gccacccccg 960

agcctgcagt ggctctttga ggatgagact cccatcacta accgcagtcg ccccccacac 1020

ctccgcagag ccacagtgtt tgccaacggg tctctgctgc tgacccaggt ccggccacgc 1080

aatgcaggga tctaccgctg cattggccag gggcagaggg gcccacccat catcctggaa 1140

gccacacttc acctagcaga gattgaagac atgccgctat ttgagccacg ggtgtttaca 1200

gctggcagcg aggagcgtgt gacctgcctt ccccccaagg gtctgccaga gcccagcgtg 1260

tggtgggagc acgcgggagt ccggctgccc acccatggca gggtctacca gaagggccac 1320

gagctggtgt tggccaatat tgctgaaagt gatgctggtg tctacacctg ccacgcggcc 1380

aacctggctg gtcagcggag acaggatgtc aacatcactg tggccactgt gccctcctgg 1440

ctgaagaagc cccaagacag ccagctggag gagggcaaac ccggctactt ggattgcctg 1500

acccaggcca caccaaaacc tacagttgtc tggtacagaa accagatgct catctcagag 1560

gactcacggt tcgaggtctt caagaatggg accttgcgca tcaacagcgt ggaggtgtat 1620

gatgggacat ggtaccgttg tatgagcagc accccagccg gcagcatcga ggcgcaagcc 1680

cgtgtccaag tgctggaaaa gctcaagttc acaccaccac cccagccaca gcagtgcatg 1740

gagtttgaca aggaggccac ggtgccctgt tcagccacag gccgagaga gcccactatt

aagtgggaac gggcagatgg gagcagcctc ccagagtggg tgacagacaa cgctgggacc 1860

ctgcattttg cccgggtgac tcgagatgac gctggcaact acacttgcat tgcctccaac 1920

gggccgcagg gccagattcg tgcccatgtc cagctcactg tggcagtttt tatcaccttc 1980

aaagtggaac cagagcgtac gactgtgtac cagggccaca cagccctact gcagtgcgag 2040

gcccaggggg accccaagcc gctgattcag tggaaaggca aggaccgcat cctggacccc 2100

accaagctgg gacccaggat gcacatcttc cagaatggct ccctggtgat ccatgacgtg 2160

gcccctgagg actcaggccg ctacacctgc attgcaggca acagctgcaa catcaagcac 2220

acggaggccc ccctctatgt cgtggacaag cctgtgccgg aggagtcgga gggccctggc 2280

agccctcccc cctacaagat gatccagacc attgggttgt cggtgggtgc cgctgtggcc 2340

tacatcattg ccgtgctggg cctcatgttc tactgcaaga agcgctgcaa agccaagcgg 2400

ctgcagaagc agcccgaggg cgaggagcca gagatggaat gcctcaacgg tgggcctttg 2460

cagaacgggc agccctcagc agagatccaa gaagaagtgg ccttgaccag cttgggctcc 2520

ggccccgcgg ccaccaacaa acgccacagc acaagtgata agatgcactt cccacggtct 2580

agcctgcagc ccatcaccac gctggggaag agtgagtttg gggaggtgtt cctggcaaag 2640

gctcagggct tggaggaggg agtggcagag accctggtac ttgtgaagag cctgcagagc 2700

aaggatgagc agcagcagct ggacttccgg agggagttgg agatgtttgg gaagctgaac 2760

cacgccaacg tggtgcggct cctggggctg tgccgggagg ctgagcccca ctacatggtg 2820

ctggaatatg tggatctggg agacctcaag cagttcctga ggatttccaa gagcaaggat 2880

gaaaaattga agtcacagcc cctcagcacc aagcagaagg tggccctatg cacccaggta 2940

gccctgggca tggagcacct gtccaacaac cgctttgtgc ataaggactt ggctgcgcgt 3000

aactgcctgg tcagtgccca gagacaagtg aaggtgtctg ccctgggcct cagcaaggat 3060

gtgtacaaca gtgagtacta ccacttccgc caggcctggg tgccgctgcg ctggatgtcc 3120

cccgaggcca tcctggaggg tgacttctct accaagtctg atgtctgggc cttcggtgtg 3180

ctgatgtggg aagtgtttac acatggagag atgccccatg gtgggcaggc agatgatgaa 3240

gtactggcag atttgcaggc tgggaaggct agacttctc agcccgaggg ctgcccttcc 3300

aaactctatc ggctgatgca gcgctgctgg gccctcagcc ccaaggaccg gccctccttc 3360

agtgagattg ccagcgccct gggagacagc accgtggaca gcaagccgtg aggagggagc 3420

ccgctcagga tggcctgggc aggggaggac atctctagag ggaagctcac agcatgatgg 3480

gcaagatccc tgtcctcctg ggccctgagg cccctgccct agtgcaacag gcattgctga 3540

ggtctgagca gggcctggcc tttcctcctc ttcctcaccc tcatcctttg ggaggctgac 3600

ttggacccaa actgggcgac tagggctttg agctgggcag ttttccctgc cacctcttcc 3660

tctatcaggg acagtgtggg tgccacaggt aaccccaatt tctggccttc aacttctccc 3720

cttgaccggg tccaactctg ccactcatct gccaactttg cctggggagg gctaggcttg 3780

ggatgagctg ggtttgtggg gagttcctta atattctcaa gttctgggca cacagggtta 3840

atgagtctct tggcccactg gtcccacttg ggggtctaga ccaggattat agaggacaca 3900

gcaagtgagt cctccccact ctgggcttgt gcacactgac ccagacccac gtcttcccca 3960

cccttctctc ctttcctcat cctaagtgcc tggcagatga aggagttttc aggagctttt 4020

gacactatat aaaccgccct ttttgtatgc accacgggcg gcttttatat gtaattgcag 4080

cgtggggtgg gtgggcatgg gaggtagggg tgggccctgg agatgaggag ggtgggccat 4140

ccttacccca cacttttatt gttgtcgttt tttgtttgtt ttgttttttt gtttttgttt 4200

ttgtttttac actcgctgct ctcaataaat aagccttttt tacaacctg 4249

<210> 2

<211> 1070

<212> PRT

<213> Homo sapiens

<400> 2

Met Gly Ala Ala Arg Gly Ser Pro Ala Arg Pro Arg Arg Leu Pro Leu

1 5 10 15

Leu Ser Val Leu Leu Leu Pro Leu Leu Gly Gly Thr Gln Thr Ala Ile

20 25 30

Val Phe Ile Light Gln Pro Ser Ser Gln Asp Ala Leu Gln Gly Arg Arg

35 40 45

Ala Leu Leu Arg Cys Glu Val Glu Ala Pro Gly Pro Val His Val Tyr

50 55 60

Trp Leu Leu Asp Gly Ala Pro Val Gln Asp Thr Glu Arg Arg Phe Ala

65 70 75 80

Gln Gly Ser Ser Leu Ser Phe Ala Ala Val Asp Arg Pro Gln Asp Ser

85 90 95

Gly Thr Phe Gln Cys Val Ala Arg Asp Asp Val Thr Gly Glu Glu Ala

100 105 110

Arg Ser Ala Asn Ala Ser Phe Asn Ile Lys Trp Ile Glu Ala Gly Pro

115 120 125

Val Val Leu Lys His Pro Ala Ser Glu Ala Glu Ile Gln Pro Gln Thr

130 135 140

Gln Val Thr Leu Arg Cys His Ile Asp Gly His Pro Arg Pro Thr Tyr

145 150 155 160

Gln Trp Phe Arg Asp Gly Thr Pro Leu Ser Asp Gly Gln Ser Asn His

165 170 175

Thr Val Ser Ser Lys Glu Arg Asn Leu Thr Leu Arg Pro Ala Gly Pro

180 185 190

Glu His Ser Gly Leu Tyr Ser Cys Cys Ala His Ser Ala Phe Gly Gln

195 200 205

Ala Cys Ser Ser Gln Asn Phe Thr Leu Ser Ile Ala Asp Glu Ser Phe

210 215 220

Ala Arg Val Val Leu Ala Pro Gln Asp Val Val Val Ala Arg Tyr Glu

225 230 235 240

Glu Ala Met Phe His Cys Gln Phe Ser Ala Gln Pro Pro Pro Ser Leu

245 250 255

Gln Trp Leu Phe Glu Asp Glu Thr Pro Ile Thr Asn Arg Ser Arg Pro

260 265 270

Pro His Leu Arg Arg Ala Thr Val Phe Ala Asn Gly Ser Leu Leu Leu

275 280 285

Thr Gln Val Arg Pro Arg Asn Ala Gly Ile Tyr Arg Cys Ile Gly Gln

290 295 300

Gly Gln Arg Gly Pro Pro Ile Ile Leu Glu Ala Thr Leu His Leu Ala

305 310 315 320

Glu Ile Glu Asp Met Pro Leu Phe Glu Pro Arg Val Phe Thr Ala Gly

325 330 335

Ser Glu Glu Arg Val Thr Cys Leu Pro Pro Lys Gly Leu Pro Glu Pro

340 345 350

Ser Val Trp Trp Glu His Ala Gly Val Arg Leu Pro Thr His Gly Arg

355 360 365

Val Tyr Gln Lys Gly His Glu Leu Val Leu Free Mp3 Download

370 375 380

Asp Ala Gly Val Tyr Thr Cys His Ala Ala Asn Leu Ala Gly Gln Arg

385 390 395 400

Arg Gln Asp Val Asn Ile Thr Val Ala Thr Val Pro Ser Trp Leu Lys

405 410 415

Lys Pro Gln Asp Ser Gln Leu Glu Glu Gly Lys Pro Gly Tyr Leu Asp

420 425 430

Cys Leu Thr Gln Ala Thr Pro Lys Pro Thr Val Val Trp Tyr Arg Asn

435 440 445

Gln Met Leu Ile Ser Glu Asp Ser Arg Phe Glu Val Phe Lys Asn Gly

450 455 460

Thr Leu Arg Ile Asn Ser Val Glu Val Tyr Asp Gly Thr Trp Tyr Arg

465 470 475 480

Cys Met Ser Ser Thr Pro Ala Gly Ser Ile Glu Ala Gln Ala Arg Val

485 490 495

Gln Val Leu Glu Lys Leu Lys Phe Thr Pro Pro Pro Gln Pro Gln Gln

500 505 510

Cys Met Glu Phe Asp Lys Glu Ala Thr Val Pro Cys Ser Ala Thr Gly

515 520 525

Arg Glu Lys Pro Thr Ile Lys Trp Glu Arg Ala Asp Gly Ser Ser Leu

530 535 540

Pro Glu Trp Val Thr Asp Asn Ala Gly Thr Leu His Phe Ala Arg Val

545 550 555 560

Thr Arg Asp Asp Ala Gly Asn Tyr Thr Cys Ile Ala Ser Asn Gly Pro

565 570 575

Gln Gly Gln Ile Arg Ala His Val Gln Leu Thr Val Ala Val Phe Ile

580 585 590

Thr Phe Lys Val Glu Pro Glu Arg Thr Thr Val Tyr Gln Gly His Thr

595 600 605

Ala Leu Leu Gln Cys Glu Ala Gln Gly Asp Pro Lys Pro Leu Ile Gln

610 615 620

Trp Lys Gly Lys Asp Arg Ile Leu Asp Pro Thr Lys Leu Gly Pro Arg

625 630 635 640

Met His Ile Phe Gln Asn Gly Ser Leu Val Ile His Asp Val Ala Pro

645 650 655

Glu Asp Ser Gly Arg Tyr Thr Cys Ile Ala Gly Asn Ser Cys Asn Ile

660 665 670

Lys His Thr Glu Ala Pro Leu Tyr Val Val Asp Lys Pro Val Pro Glu

675 680 685

Glu Ser Glu Gly Pro Gly Ser Pro Pro Pro Tyr Lys Met Ile Gln Thr

690 695 700

Ile Gly Leu Ser Val Gly Ala Ala Val Ala Tyr Ile Ile Ala Val Leu

705 710 715 720

Gly Leu Met Phe Tyr Cys Lys Lys Arg Cys Lys Ala Lys Arg Leu Gln

725 730 735

Lys Gln Pro Glu Gly Glu Glu Pro Glu Met Glu Cys Leu Asn Gly Gly

740 745 750

Pro Leu Gln Asn Gly Gln Pro Ser Ala Glu Ile Gln Glu Glu Val Ala

755 760 765

Leu Thr Ser Leu Gly Ser Gly Pro Ala Ala Thr Asn Lys Arg His Ser

770 775 780

Thr Ser Asp Lys Met His Phe Pro Arg Ser Ser Leu Gln Pro Ile Thr

785 790 795 800

Thr Leu Gly Lys Ser Glu Phe Gly Glu Val Phe Leu Ala Lys Ala Gln

805 810 815

Click Download to save Gly Leu Glu Glu Gly Val Ala Glu mp3 youtube com

820 825 830

Gln Ser Lys Asp Glu Gln Gln Gln Leu Asp Phe Arg Arg Glu Leu Glu

835 840 845

Met Phe Gly Lys Leu Asn His Ala Asn Val Val Arg Leu Leu Gly Leu

850 855 860

Cys Arg Glu Ala Glu Pro His Tyr Met Val Leu Glu Tyr Val Asp Leu

865 870 875 880

Gly Asp Leu Lys Gln Phe Leu Arg Ile Ser Lys Ser Lys Asp Glu Lys

885 890 895

Leu Lys Ser Gln Pro Leu Ser Thr Lys Gln Lys Val Ala Leu Cys Thr

900 905 910

Gln Val Ala Leu Gly Met Glu His Leu Ser Asn Asn Arg Phe Val His

915 920 925

Lys Asp Leu Ala Ala Arg Asn Cys Leu Val Ser Ala Gln Arg Gln Val

930 935 940

Lys Val Ser Ala Leu Gly Leu Ser Lys Asp Val Tyr Asn Ser Glu Tyr

945 950 955 960

Tyr His Phe Arg Gln Ala Trp Val Pro Leu Arg Trp Met Ser Pro Glu

965 970 975

Ala Ile Leu Glu Gly Asp Phe Ser Thr Lys Ser Asp Val Trp Ala Phe

980 985 990

Gly Val Leu Met Trp Glu Val Phe Thr His Gly Glu Met Pro His Gly

995 1000 1005

Gly Gln Ala Asp Asp Glu Val Leu Ala Asp Leu Gln Ala Gly Lys

1010 1015 1020

Ala Arg Leu Pro Gln Pro Glu Gly Cys Pro Ser Lys Leu Tyr Arg

1025 1030 1035

Leu Met Gln Arg Cys Trp Ala Leu Ser Pro Lys Asp Arg Pro Ser

1040 1045 1050

Phe Ser Glu Ile Ala Ser Ala Leu Gly Asp Ser Thr Val Asp Ser

1055 1060 1065

Lys Pro

1070

<210> 3

<211> 1070

<212> PRT

<213> Homo sapiens

<400> 3

Met Gly Ala Ala Arg Gly Ser Pro Ala Arg Pro Arg Arg Leu Pro Leu

1 5 10 15

Leu Ser Val Leu Leu Leu Pro Leu Leu Gly Gly Thr Gln Thr Ala Ile

20 25 30

Val Phe Ile Light Gln Pro Ser Ser Gln Asp Ala Leu Gln Gly Arg Arg

35 40 45

Ala Leu Leu Arg Cys Glu Val Glu Ala Pro Gly Pro Val His Val Tyr

50 55 60

Trp Leu Leu Asp Gly Ala Pro Val Gln Asp Thr Glu Arg Arg Phe Ala

65 70 75 80

Gln Gly Ser Ser Leu Ser Phe Ala Ala Val Asp Arg Leu Gln Asp Ser

85 90 95

Gly Thr Phe Gln Cys Val Ala Arg Asp Asp Val Thr Gly Glu Glu Ala

100 105 110

Arg Ser Ala Asn Ala Ser Phe Asn Ile Lys Trp Ile Glu Ala Gly Pro

115 120 125

Val Val Leu Lys His Pro Ala Ser Glu Ala Glu Ile Gln Pro Gln Thr

130 135 140

Gln Val Thr Leu Arg Cys His Ile Asp Gly His Pro Arg Pro Thr Tyr

145 150 155 160

Gln Trp Phe Arg Asp Gly Thr Pro Leu Ser Asp Gly Gln Ser Asn His

165 170 175

Thr Val Ser Ser Lys Glu Arg Asn Leu Thr Leu Arg Pro Ala Gly Pro

180 185 190

Glu His Ser Gly Leu Tyr Ser Cys Cys Ala His Ser Ala Phe Gly Gln

195 200 205

Ala Cys Ser Ser Gln Asn Phe Thr Leu Ser Ile Ala Asp Glu Ser Phe

210 215 220

Ala Arg Val Val Leu Ala Pro Gln Asp Val Val Val Ala Arg Tyr Glu

225 230 235 240

Glu Ala Met Phe His Cys Gln Phe Ser Ala Gln Pro Pro Pro Ser Leu

245 250 255

Gln Trp Leu Phe Glu Asp Glu Thr Pro Ile Thr Asn Arg Ser Arg Pro

260 265 270

Pro His Leu Arg Arg Ala Thr Val Phe Ala Asn Gly Ser Leu Leu Leu

275 280 285

Thr Gln Val Arg Pro Arg Asn Ala Gly Ile Tyr Arg Cys Ile Gly Gln

290 295 300

Gly Gln Arg Gly Pro Pro Ile Ile Leu Glu Ala Thr Leu His Leu Ala

305 310 315 320

Glu Ile Glu Asp Met Pro Leu Phe Glu Pro Arg Val Phe Thr Ala Gly

325 330 335

Ser Glu Glu Arg Val Thr Cys Leu Pro Pro Lys Gly Leu Pro Glu Pro

340 345 350

Ser Val Trp Trp Glu His Ala Gly Val Arg Leu Pro Thr His Gly Arg

355 360 365

Val Tyr Gln Lys Gly His Glu Leu Val Leu Free Mp3 Download

370 375 380

Asp Ala Gly Val Tyr Thr Cys His Ala Ala Asn Leu Ala Gly Gln Arg

385 390 395 400

Arg Gln Asp Val Asn Ile Thr Val Ala Thr Val Pro Ser Trp Leu Lys

405 410 415

Lys Pro Gln Asp Ser Gln Leu Glu Glu Gly Lys Pro Gly Tyr Leu Asp

420 425 430

Cys Leu Thr Gln Ala Thr Pro Lys Pro Thr Val Val Trp Tyr Arg Asn

435 440 445

Gln Met Leu Ile Ser Glu Asp Ser Arg Phe Glu Val Phe Lys Asn Gly

450 455 460

Thr Leu Arg Ile Asn Ser Val Glu Val Tyr Asp Gly Thr Trp Tyr Arg

465 470 475 480

Cys Met Ser Ser Thr Pro Ala Gly Ser Ile Glu Ala Gln Ala Arg Val

485 490 495

Gln Val Leu Glu Lys Leu Lys Phe Thr Pro Pro Pro Gln Pro Gln Gln

500 505 510

Cys Met Glu Phe Asp Lys Glu Ala Thr Val Pro Cys Ser Ala Thr Gly

515 520 525

Arg Glu Lys Pro Thr Ile Lys Trp Glu Arg Ala Asp Gly Ser Ser Leu

530 535 540

Pro Glu Trp Val Thr Asp Asn Ala Gly Thr Leu His Phe Ala Arg Val

545 550 555 560

Thr Arg Asp Asp Ala Gly Asn Tyr Thr Cys Ile Ala Ser Asn Gly Pro

565 570 575

Gln Gly Gln Ile Arg Ala His Val Gln Leu Thr Val Ala Val Phe Ile

580 585 590

Thr Phe Lys Val Glu Pro Glu Arg Thr Thr Val Tyr Gln Gly His Thr

595 600 605

Ala Leu Leu Gln Cys Glu Ala Gln Gly Asp Pro Lys Pro Leu Ile Gln

610 615 620

Trp Lys Gly Lys Asp Arg Ile Leu Asp Pro Thr Lys Leu Gly Pro Arg

625 630 635 640

Met His Ile Phe Gln Asn Gly Ser Leu Val Ile His Asp Val Ala Pro

645 650 655

Glu Asp Ser Gly Arg Tyr Thr Cys Ile Ala Gly Asn Ser Cys Asn Ile

660 665 670

Lys His Thr Glu Ala Pro Leu Tyr Val Val Asp Lys Pro Val Pro Glu

675 680 685

Glu Ser Glu Gly Pro Gly Ser Pro Pro Pro Tyr Lys Met Ile Gln Thr

690 695 700

Ile Gly Leu Ser Val Gly Ala Ala Val Ala Tyr Ile Ile Ala Val Leu

705 710 715 720

Gly Leu Met Phe Tyr Cys Lys Lys Arg Cys Lys Ala Lys Arg Leu Gln

725 730 735

Lys Gln Pro Glu Gly Glu Glu Pro Glu Met Glu Cys Leu Asn Gly Gly

740 745 750

Pro Leu Gln Asn Gly Gln Pro Ser Ala Glu Ile Gln Glu Glu Val Ala

755 760 765

Leu Thr Ser Leu Gly Ser Gly Pro Ala Ala Thr Asn Lys Arg His Ser

770 775 780

Thr Ser Asp Lys Met His Phe Pro Arg Ser Ser Leu Gln Pro Ile Thr

785 790 795 800

Thr Leu Gly Lys Ser Glu Phe Gly Glu Val Phe Leu Ala Lys Ala Gln

805 810 815

Click Download to save Gly Leu Glu Glu Gly Val Ala Glu mp3 youtube com

820 825 830

Gln Ser Lys Asp Glu Gln Gln Gln Leu Asp Phe Arg Arg Glu Leu Glu

835 840 845

Met Phe Gly Lys Leu Asn His Ala Asn Val Val Arg Leu Leu Gly Leu

850 855 860

Cys Arg Glu Ala Glu Pro His Tyr Met Val Leu Glu Tyr Val Asp Leu

865 870 875 880

Gly Asp Leu Lys Gln Phe Leu Arg Ile Ser Lys Ser Lys Asp Glu Lys

885 890 895

Leu Lys Ser Gln Pro Leu Ser Thr Lys Gln Lys Val Ala Leu Cys Thr

900 905 910

Gln Val Ala Leu Gly Met Glu His Leu Ser Asn Asn Arg Phe Val His

915 920 925

Lys Asp Leu Ala Ala Arg Asn Cys Leu Val Ser Ala Gln Arg Gln Val

930 935 940

Lys Val Ser Ala Leu Gly Leu Ser Lys Asp Val Tyr Asn Ser Glu Tyr

945 950 955 960

Tyr His Phe Arg Gln Ala Trp Val Pro Leu Arg Trp Met Ser Pro Glu

965 970 975

Ala Ile Leu Glu Gly Asp Phe Ser Thr Lys Ser Asp Val Trp Ala Phe

980 985 990

Gly Val Leu Met Trp Glu Val Phe Thr His Gly Glu Met Pro His Gly

995 1000 1005

Gly Gln Ala Asp Asp Glu Val Leu Ala Asp Leu Gln Ala Gly Lys

1010 1015 1020

Ala Arg Leu Pro Gln Pro Glu Gly Cys Pro Ser Lys Leu Tyr Arg

1025 1030 1035

Leu Met Gln Arg Cys Trp Ala Leu Ser Pro Lys Asp Arg Pro Ser

1040 1045 1050

Phe Ser Glu Ile Ala Ser Ala Leu Gly Asp Ser Thr Val Asp Ser

1055 1060 1065

Lys Pro

1070

<210> 4

<211> 1014

<212> PRT

<213> Homo sapiens

<400> 4

Met Gly Ala Ala Arg Gly Ser Pro Ala Arg Pro Arg Arg Leu Pro Leu

1 5 10 15

Leu Ser Val Leu Leu Leu Pro Leu Leu Gly Gly Thr Gln Thr Ala Ile

20 25 30

Val Phe Ile Light Gln Pro Ser Ser Gln Asp Ala Leu Gln Gly Arg Arg

35 40 45

Ala Leu Leu Arg Cys Glu Val Glu Ala Pro Gly Pro Val His Val Tyr

50 55 60

Trp Leu Leu Asp Gly Ala Pro Val Gln Asp Thr Glu Arg Arg Phe Ala

65 70 75 80

Gln Gly Ser Ser Leu Ser Phe Ala Ala Val Asp Arg Leu Gln Asp Ser

85 90 95

Gly Thr Phe Gln Cys Val Ala Arg Asp Asp Val Thr Gly Glu Glu Ala

100 105 110

Arg Ser Ala Asn Ala Ser Phe Asn Ile Lys Trp Ile Glu Ala Gly Pro

115 120 125

Val Val Leu Lys His Pro Ala Ser Glu Ala Glu Ile Gln Pro Gln Thr

130 135 140

Gln Val Thr Leu Arg Cys His Ile Asp Gly His Pro Arg Pro Thr Tyr

145 150 155 160

Gln Trp Phe Arg Asp Gly Thr Pro Leu Ser Asp Gly Gln Ser Asn His

165 170 175

Thr Val Ser Ser Lys Glu Arg Asn Leu Thr Leu Arg Pro Ala Gly Pro

180 185 190

Glu His Ser Gly Leu Tyr Ser Cys Cys Ala His Ser Ala Phe Gly Gln

195 200 205

Ala Cys Ser Ser Gln Asn Phe Thr Leu Ser Ile Ala Asp Glu Ser Phe

210 215 220

Ala Arg Val Val Leu Ala Pro Gln Asp Val Val Val Ala Arg Tyr Glu

225 230 235 240

Glu Ala Met Phe His Cys Gln Phe Ser Ala Gln Pro Pro Pro Ser Leu

245 250 255

Gln Trp Leu Phe Glu Asp Glu Thr Pro Ile Thr Asn Arg Ser Arg Pro

260 265 270

Pro His Leu Arg Arg Ala Thr Val Phe Ala Asn Gly Ser Leu Leu Leu

275 280 285

Thr Gln Val Arg Pro Arg Asn Ala Gly Ile Tyr Arg Cys Ile Gly Gln

290 295 300

Gly Gln Arg Gly Pro Pro Ile Ile Leu Glu Ala Thr Leu His Leu Ala

305 310 315 320

Glu Ile Glu Asp Met Pro Leu Phe Glu Pro Arg Val Phe Thr Ala Gly

325 330 335

Ser Glu Glu Arg Val Thr Cys Leu Pro Pro Lys Gly Leu Pro Glu Pro

340 345 350

Ser Val Trp Trp Glu His Ala Gly Val Arg Leu Pro Thr His Gly Arg

355 360 365

Val Tyr Gln Lys Gly His Glu Leu Val Leu Free Mp3 Download

370 375 380

Asp Ala Gly Val Tyr Thr Cys His Ala Ala Asn Leu Ala Gly Gln Arg

385 390 395 400

Arg Gln Asp Val Asn Ile Thr Val Ala Thr Val Pro Ser Trp Leu Lys

405 410 415

Lys Pro Gln Asp Ser Gln Leu Glu Glu Gly Lys Pro Gly Tyr Leu Asp

420 425 430

Cys Leu Thr Gln Ala Thr Pro Lys Pro Thr Val Val Trp Tyr Arg Asn

435 440 445

Gln Met Leu Ile Ser Glu Asp Ser Arg Phe Glu Val Phe Lys Asn Gly

450 455 460

Thr Leu Arg Ile Asn Ser Val Glu Val Tyr Asp Gly Thr Trp Tyr Arg

465 470 475 480

Cys Met Ser Ser Thr Pro Ala Gly Ser Ile Glu Ala Gln Ala Arg Val

485 490 495

Gln Val Leu Glu Lys Leu Lys Phe Thr Pro Pro Pro Gln Pro Gln Gln

500 505 510

Cys Met Glu Phe Asp Lys Glu Ala Thr Val Pro Cys Ser Ala Thr Gly

515 520 525

Arg Glu Lys Pro Thr Ile Lys Trp Glu Arg Ala Asp Gly Ser Ser Leu

530 535 540

Pro Glu Trp Val Thr Asp Asn Ala Gly Thr Leu His Phe Ala Arg Val

545 550 555 560

Thr Arg Asp Asp Ala Gly Asn Tyr Thr Cys Ile Ala Ser Asn Gly Pro

565 570 575

Gln Gly Gln Ile Arg Ala His Val Gln Leu Thr Val Ala Val Phe Ile

580 585 590

Thr Phe Lys Val Glu Pro Glu Arg Thr Thr Val Tyr Gln Gly His Thr

595 600 605

Ala Leu Leu Gln Cys Glu Ala Gln Gly Asp Pro Lys Pro Leu Ile Gln

610 615 620

Trp Lys Asp Lys Pro Val Pro Glu Glu Ser Glu Gly Pro Gly Ser Pro

625 630 635 640

Pro Pro Tyr Lys Met Ile Gln Thr Ile Gly Leu Ser Val Gly Ala Ala

645 650 655

Val Ala Tyr Ile Ile Ala Val Leu Gly Leu Met Phe Tyr Cys Lys Lys

660 665 670

Arg Cys Lys Ala Lys Arg Leu Gln Lys Gln Pro Glu Gly Glu Glu Pro

675 680 685

Glu Met Glu Cys Leu Asn Gly Gly Pro Leu Gln Asn Gly Gln Pro Ser

690 695 700

Ala Glu Ile Gln Glu Glu Val Ala Leu Thr Ser Leu Gly Ser Gly Pro

705 710 715 720

Ala Ala Thr Asn Lys Arg His Ser Thr Ser Asp Lys Met His Phe Pro

725 730 735

Arg Ser Ser Leu Gln Pro Ile Thr Thr Leu Gly Lys Ser Glu Phe Gly

740 745 750

Glu Val Phe Leu Ala Lys Ala Gln Gly Leu Glu Glu Gly Val Ala Glu

755 760 765

Thr Leu Val Leu Val Lys Ser Leu Gln Ser Lys Asp Glu Gln Gln Gln

770 775 780

Leu Asp Phe Arg Arg Glu Leu Glu Met Phe Gly Lys Leu Asn His Ala

785 790 795 800

Asn Val Val Arg Leu Leu Gly Leu Cys Arg Glu Ala Glu Pro His Tyr

805 810 815

Met Val Leu Glu Tyr Val Asp Leu Gly Asp Leu Lys Gln Phe Leu Arg

820 825 830

Ile Ser Lys Ser Lys Asp Glu Lys Leu Lys Ser Gln Pro Leu Ser Thr

835 840 845

Lys Gln Lys Val Ala Leu Cys Thr Gln Val Ala Leu Gly Met Glu His

850 855 860

Leu Ser Asn Asn Arg Phe Val His Lys Asp Leu Ala Ala Arg Asn Cys

865 870 875 880

Leu Val Ser Ala Gln Arg Gln Val Lys Val Ser Ala Leu Gly Leu Ser

885 890 895

Lys Asp Val Tyr Asn Ser Glu Tyr Tyr His Phe Arg Gln Ala Trp Val

900 905 910

Pro Leu Arg Trp Met Ser Pro Glu Ala Ile Leu Glu Gly Asp Phe Ser

915 920 925

Thr Lys Ser Asp Val Trp Ala Phe Gly Val Leu Met Trp Glu Val Phe

930 935 940

Thr His Gly Glu Met Pro His Gly Gly Gln Ala Asp Asp Glu Val Leu

945 950 955 960

Ala Asp Leu Gln Ala Gly Lys Ala Arg Leu Pro Gln Pro Glu Gly Cys

965 970 975

Pro Ser Lys Leu Tyr Arg Leu Met Gln Arg Cys Trp Ala Leu Ser Pro

980 985 990

Lys Asp Arg Pro Ser Phe Ser Glu Ile Ala Ser Ala Leu Gly Asp Ser

995 1000 1005

Thr Val Asp Ser Lys Pro

1010

<210> 5

<211> 1030

<212> PRT

<213> Homo sapiens

<400> 5

Met Gly Ala Ala Arg Gly Ser Pro Ala Arg Pro Arg Arg Leu Pro Leu

1 5 10 15

Leu Ser Val Leu Leu Leu Pro Leu Leu Gly Gly Thr Gln Thr Ala Ile

20 25 30

Val Phe Ile Light Gln Pro Ser Ser Gln Asp Ala Leu Gln Gly Arg Arg

35 40 45

Ala Leu Leu Arg Cys Glu Val Glu Ala Pro Gly Pro Val His Val Tyr

50 55 60

Trp Leu Leu Asp Gly Ala Pro Val Gln Asp Thr Glu Arg Arg Phe Ala

65 70 75 80

Gln Gly Ser Ser Leu Ser Phe Ala Ala Val Asp Arg Leu Gln Asp Ser

85 90 95

Gly Thr Phe Gln Cys Val Ala Arg Asp Asp Val Thr Gly Glu Glu Ala

100 105 110

Arg Ser Ala Asn Ala Ser Phe Asn Ile Lys Trp Ile Glu Ala Gly Pro

115 120 125

Val Val Leu Lys His Pro Ala Ser Glu Ala Glu Ile Gln Pro Gln Thr

130 135 140

Gln Val Thr Leu Arg Cys His Ile Asp Gly His Pro Arg Pro Thr Tyr

145 150 155 160

Gln Trp Phe Arg Asp Gly Thr Pro Leu Ser Asp Gly Gln Ser Asn His

165 170 175

Thr Val Ser Ser Lys Glu Arg Asn Leu Thr Leu Arg Pro Ala Gly Pro

180 185 190

Glu His Ser Gly Leu Tyr Ser Cys Cys Ala His Ser Ala Phe Gly Gln

195 200 205

Ala Cys Ser Ser Gln Asn Phe Thr Leu Ser Ile Ala Asp Glu Ser Phe

210 215 220

Ala Arg Val Val Leu Ala Pro Gln Asp Val Val Val Ala Arg Tyr Glu

225 230 235 240

Glu Ala Met Phe His Cys Gln Phe Ser Ala Gln Pro Pro Pro Ser Leu

245 250 255

Gln Trp Leu Phe Glu Asp Glu Thr Pro Ile Thr Asn Arg Ser Arg Pro

260 265 270

Pro His Leu Arg Arg Ala Thr Val Phe Ala Asn Gly Ser Leu Leu Leu

275 280 285

Thr Gln Val Arg Pro Arg Asn Ala Gly Ile Tyr Arg Cys Ile Gly Gln

290 295 300

Gly Gln Arg Gly Pro Pro Ile Ile Leu Glu Ala Thr Leu His Leu Ala

305 310 315 320

Glu Ile Glu Asp Met Pro Leu Phe Glu Pro Arg Val Phe Thr Ala Gly

325 330 335

Ser Glu Glu Arg Val Thr Cys Leu Pro Pro Lys Gly Leu Pro Glu Pro

340 345 350

Ser Val Trp Trp Glu His Ala Gly Val Arg Leu Pro Thr His Gly Arg

355 360 365

Val Tyr Gln Lys Gly His Glu Leu Val Leu Free Mp3 Download

370 375 380

Asp Ala Gly Val Tyr Thr Cys His Ala Ala Asn Leu Ala Gly Gln Arg

385 390 395 400

Arg Gln Asp Val Asn Ile Thr Val Ala Thr Val Pro Ser Trp Leu Lys

405 410 415

Lys Pro Gln Asp Ser Gln Leu Glu Glu Gly Lys Pro Gly Tyr Leu Asp

420 425 430

Cys Leu Thr Gln Ala Thr Pro Lys Pro Thr Val Val Trp Tyr Arg Asn

435 440 445

Gln Met Leu Ile Ser Glu Asp Ser Arg Phe Glu Val Phe Lys Asn Gly

450 455 460

Thr Leu Arg Ile Asn Ser Val Glu Val Tyr Asp Gly Thr Trp Tyr Arg

465 470 475 480

Cys Met Ser Ser Thr Pro Ala Gly Ser Ile Glu Ala Gln Ala Arg Val

485 490 495

Gln Val Leu Asp Gly Ser Ser Leu Pro Glu Trp Val Thr Asp Asn Ala

500 505 510

Gly Thr Leu His Phe Ala Arg Val Thr Arg Asp Asp Ala Gly Asn Tyr

515 520 525

Thr Cys Ile Ala Ser Asn Gly Pro Gln Gly Gln Ile Arg Ala His Val

530 535 540

Gln Leu Thr Val Ala Val Phe Ile Thr Phe Lys Val Glu Pro Glu Arg

545 550 555 560

Thr Thr Val Tyr Gln Gly His Thr Ala Leu Leu Gln Cys Glu Ala Gln

565 570 575

Gly Asp Pro Lys Pro Leu Ile Gln Trp Lys Gly Lys Asp Arg Ile Leu

580 585 590

Asp Pro Thr Lys Leu Gly Pro Arg Met His Ile Phe Gln Asn Gly Ser

595 600 605

Leu Val Ile His Asp Val Ala Pro Glu Asp Ser Gly Arg Tyr Thr Cys

610 615 620

Ile Ala Gly Asn Ser Cys Asn Ile Lys His Thr Glu Ala Pro Leu Tyr

625 630 635 640

Val Val Asp Lys Pro Val Pro Glu Glu Ser Glu Gly Pro Gly Ser Pro

645 650 655

Pro Pro Tyr Lys Met Ile Gln Thr Ile Gly Leu Ser Val Gly Ala Ala

660 665 670

Val Ala Tyr Ile Ile Ala Val Leu Gly Leu Met Phe Tyr Cys Lys Lys

675 680 685

Arg Cys Lys Ala Lys Arg Leu Gln Lys Gln Pro Glu Gly Glu Glu Pro

690 695 700

Glu Met Glu Cys Leu Asn Gly Gly Pro Leu Gln Asn Gly Gln Pro Ser

705 710 715 720

Ala Glu Ile Gln Glu Glu Val Ala Leu Thr Ser Leu Gly Ser Gly Pro

725 730 735

Ala Ala Thr Asn Lys Arg His Ser Thr Ser Asp Lys Met His Phe Pro

740 745 750

Arg Ser Ser Leu Gln Pro Ile Thr Thr Leu Gly Lys Ser Glu Phe Gly

755 760 765

Glu Val Phe Leu Ala Lys Ala Gln Gly Leu Glu Glu Gly Val Ala Glu

770 775 780

Thr Leu Val Leu Val Lys Ser Leu Gln Ser Lys Asp Glu Gln Gln Gln

785 790 795 800

Leu Asp Phe Arg Arg Glu Leu Glu Met Phe Gly Lys Leu Asn His Ala

805 810 815

Asn Val Val Arg Leu Leu Gly Leu Cys Arg Glu Ala Glu Pro His Tyr

820 825 830

Met Val Leu Glu Tyr Val Asp Leu Gly Asp Leu Lys Gln Phe Leu Arg

835 840 845

Ile Ser Lys Ser Lys Asp Glu Lys Leu Lys Ser Gln Pro Leu Ser Thr

850 855 860

Lys Gln Lys Val Ala Leu Cys Thr Gln Val Ala Leu Gly Met Glu His

865 870 875 880

Leu Ser Asn Asn Arg Phe Val His Lys Asp Leu Ala Ala Arg Asn Cys

885 890 895

Leu Val Ser Ala Gln Arg Gln Val Lys Val Ser Ala Leu Gly Leu Ser

900 905 910

Lys Asp Val Tyr Asn Ser Glu Tyr Tyr His Phe Arg Gln Ala Trp Val

915 920 925

Pro Leu Arg Trp Met Ser Pro Glu Ala Ile Leu Glu Gly Asp Phe Ser

930 935 940

Thr Lys Ser Asp Val Trp Ala Phe Gly Val Leu Met Trp Glu Val Phe

945 950 955 960

Thr His Gly Glu Met Pro His Gly Gly Gln Ala Asp Asp Glu Val Leu

965 970 975

Ala Asp Leu Gln Ala Gly Lys Ala Arg Leu Pro Gln Pro Glu Gly Cys

980 985 990

Pro Ser Lys Leu Tyr Arg Leu Met Gln Arg Cys Trp Ala Leu Ser Pro

995 1000 1005

Lys Asp Arg Pro Ser Phe Ser Glu Ile Ala Ser Ala Leu Gly Asp

1010 1015 1020

Ser Thr Val Asp Ser Lys Pro

1025 1030

<210> 6

<211> 940

<212> PRT

<213> Homo sapiens

<400> 6

Met Gly Ala Ala Arg Gly Ser Pro Ala Arg Pro Arg Arg Leu Pro Leu

1 5 10 15

Leu Ser Val Leu Leu Leu Pro Leu Leu Gly Gly Thr Gln Thr Ala Ile

20 25 30

Val Phe Ile Light Gln Pro Ser Ser Gln Asp Ala Leu Gln Gly Arg Arg

35 40 45

Ala Leu Leu Arg Cys Glu Val Glu Ala Pro Gly Pro Val His Val Tyr

50 55 60

Trp Leu Leu Asp Gly Ala Pro Val Gln Asp Thr Glu Arg Arg Phe Ala

65 70 75 80

Gln Gly Ser Ser Leu Ser Phe Ala Ala Val Asp Arg Leu Gln Asp Ser

85 90 95

Gly Thr Phe Gln Cys Val Ala Arg Asp Asp Val Thr Gly Glu Glu Ala

100 105 110

Arg Ser Ala Asn Ala Ser Phe Asn Ile Lys Trp Ile Glu Ala Gly Pro

115 120 125

Val Val Leu Lys His Pro Ala Ser Glu Ala Glu Ile Gln Pro Gln Thr

130 135 140

Gln Val Thr Leu Arg Cys His Ile Asp Gly His Pro Arg Pro Thr Tyr

145 150 155 160

Gln Trp Phe Arg Asp Gly Thr Pro Leu Ser Asp Gly Gln Ser Asn His

165 170 175

Thr Val Ser Ser Lys Glu Arg Asn Leu Thr Leu Arg Pro Ala Gly Pro

180 185 190

Glu His Ser Gly Leu Tyr Ser Cys Cys Ala His Ser Ala Phe Gly Gln

195 200 205

Ala Cys Ser Ser Gln Asn Phe Thr Leu Ser Ile Ala Asp Glu Ser Phe

210 215 220

Ala Arg Val Val Leu Ala Pro Gln Asp Val Val Val Ala Arg Tyr Glu

225 230 235 240

Glu Ala Met Phe His Cys Gln Phe Ser Ala Gln Pro Pro Pro Ser Leu

245 250 255

Gln Trp Leu Phe Glu Asp Glu Thr Pro Ile Thr Asn Arg Ser Arg Pro

260 265 270

Pro His Leu Arg Arg Ala Thr Val Phe Ala Asn Gly Ser Leu Leu Leu

275 280 285

Thr Gln Val Arg Pro Arg Asn Ala Gly Ile Tyr Arg Cys Ile Gly Gln

290 295 300

Gly Gln Arg Gly Pro Pro Ile Ile Leu Glu Ala Thr Leu His Leu Ala

305 310 315 320

Glu Ile Glu Asp Met Pro Leu Phe Glu Pro Arg Val Phe Thr Ala Gly

325 330 335

Ser Glu Glu Arg Val Thr Cys Leu Pro Pro Lys Gly Leu Pro Glu Pro

340 345 350

Ser Val Trp Trp Glu His Ala Gly Val Arg Leu Pro Thr His Gly Arg

355 360 365

Val Tyr Gln Lys Gly His Glu Leu Val Leu Free Mp3 Download

370 375 380

Asp Ala Gly Val Tyr Thr Cys His Ala Ala Asn Leu Ala Gly Gln Arg

385 390 395 400

Arg Gln Asp Val Asn Ile Thr Val Ala Asn Gly Ser Ser Leu Pro Glu

405 410 415

Trp Val Thr Asp Asn Ala Gly Thr Leu His Phe Ala Arg Val Thr Arg

420 425 430

Asp Asp Ala Gly Asn Tyr Thr Cys Ile Ala Ser Asn Gly Pro Gln Gly

435 440 445

Gln Ile Arg Ala His Val Gln Leu Thr Val Ala Val Phe Ile Thr Phe

450 455 460

Lys Val Glu Pro Glu Arg Thr Thr Val Tyr Gln Gly His Thr Ala Leu

465 470 475 480

Leu Gln Cys Glu Ala Gln Gly Asp Pro Lys Pro Leu Ile Gln Trp Lys

485 490 495

Gly Lys Asp Arg Ile Leu Asp Pro Thr Lys Leu Gly Pro Arg Met His

500 505 510

Ile Phe Gln Asn Gly Ser Leu Val Ile His Asp Val Ala Pro Glu Asp

515 520 525

Ser Gly Arg Tyr Thr Cys Ile Ala Gly Asn Ser Cys Asn Ile Lys His

530 535 540

Thr Glu Ala Pro Leu Tyr Val Val Asp Lys Pro Val Pro Glu Glu Ser

545 550 555 560

Glu Gly Pro Gly Ser Pro Pro Pro Tyr Lys Met Ile Gln Thr Ile Gly

565 570 575

Leu Ser Val Gly Ala Ala Val Ala Tyr Ile Ile Ala Val Leu Gly Leu

580 585 590

Met Phe Tyr Cys Lys Lys Arg Cys Lys Ala Lys Arg Leu Gln Lys Gln

595 600 605

Pro Glu Gly Glu Glu Pro Glu Met Glu Cys Leu Asn Gly Gly Pro Leu

610 615 620

Gln Asn Gly Gln Pro Ser Ala Glu Ile Gln Glu Glu Val Ala Leu Thr

625 630 635 640

Ser Leu Gly Ser Gly Pro Ala Ala Thr Asn Lys Arg His Ser Thr Ser

645 650 655

Asp Lys Met His Phe Pro Arg Ser Ser Leu Gln Pro Ile Thr Thr Leu

660 665 670

Gly Lys Ser Glu Phe Gly Glu Val Phe Leu Ala Lys Ala Gln Gly Leu

675 680 685

Glu Glu Gly Val Ala Glu Thr Leu Val Leu Val Lys Ser Leu Gln Ser

690 695 700

Lys Asp Glu Gln Gln Gln Leu Asp Phe Arg Arg Glu Leu Glu Met Phe

705 710 715 720

Gly Lys Leu Asn His Ala Asn Val Val Arg Leu Leu Gly Leu Cys Arg

725 730 735

Glu Ala Glu Pro His Tyr Met Val Leu Glu Tyr Val Asp Leu Gly Asp

740 745 750

Leu Lys Gln Phe Leu Arg Ile Ser Lys Ser Lys Asp Glu Lys Leu Lys

755 760 765

Ser Gln Pro Leu Ser Thr Lys Gln Lys Val Ala Leu Cys Thr Gln Val

770 775 780

Ala Leu Gly Met Glu His Leu Ser Asn Asn Arg Phe Val His Lys Asp

785 790 795 800

Leu Ala Ala Arg Asn Cys Leu Val Ser Ala Gln Arg Gln Val Lys Val

805 810 815

Ser Ala Leu Gly Leu Ser Lys Asp Val Tyr Asn Ser Glu Tyr Tyr His

820 825 830

Phe Arg Gln Ala Trp Val Pro Leu Arg Trp Met Ser Pro Glu Ala Ile

835 840 845

Leu Glu Gly Asp Phe Ser Thr Lys Ser Asp Val Trp Ala Phe Gly Val

850 855 860

Leu Met Trp Glu Val Phe Thr His Gly Glu Met Pro His Gly Gly Gln

865 870 875 880

Ala Asp Asp Glu Val Leu Ala Asp Leu Gln Ala Gly Lys Ala Arg Leu

885 890 895

Pro Gln Pro Glu Gly Cys Pro Ser Lys Leu Tyr Arg Leu Met Gln Arg

900 905 910

Cys Trp Ala Leu Ser Pro Lys Asp Arg Pro Ser Phe Ser Glu Ile Ala

915 920 925

Ser Ala Leu Gly Asp Ser Thr Val Asp Ser Lys Pro

930 935 940

<210> 7

<211> 6

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

6xHis tag"

<400> 7

His His His His His His

1 5

<210> 8

<211> 8

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

8xHis tag"

<400> 8

His His His His His His His His

1 5

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

primer"

<400> 9

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

primer"

<400> 10

<210> 11

<211> 8

<212> PRT

<213> Unknown

<220>

<221> source

<223> /note="Description of Unknown: motif peptide"

<220>

<221> MOD_RES

<222> (2)..(2)

<223> Any amino acid

<220>

<221> MOD_RES

<222> (4)..(4)

<223> Any amino acid

<220>

<221> MOD_RES

<222> (7)..(7)

<223> Any amino acid

<400> 11

Gly Xa Gly Xa Phe Gly Xa Val

1 5

<210> 12

<211> 8

<212> PRT

<213> Unknown

<220>

<221> source

<223> /note="Description of Unknown: motif peptide"

<220>

<221> MOD_RES

<222> (5)..(7)

<223> Any amino acid

<400> 12

His Arg Asp Leu Xa Xa Xa Asn

1 5

<210> 13

<211> 7

<212> PRT

<213> Unknown

<220>

<221> source

<223> /note="Description of Unknown: motif peptide"

<220>

<221> MOD_RES

<222> (6)..(6)

<223> Any amino acid

<400> 13

Ser Asp Val Trp Ser Xaa Gly

1 5

<210> 14

<400> 14

000

<210> 15

<400> 15

000

<210> 16

<400> 16

000

<210> 17

<400> 17

000

<210> 18

<400> 18

000

<210> 19

<400> 19

000

<210> 20

<211> 112

<212> PRT

<213> Mus sp.

<400> 20

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Ser Phe

20 25 30

Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ser Asn Leu Gly Ser Gly Val Pro Ala. Free Mp3 Download

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Val Glu Glu Asp Asp Ser Ala Met Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Arg Thr Phe Gly Gly Gly Ser Arg Leu Glu Ile Lys Arg

100 105 110

<210> 21

<211> 113

<212> PRT

<213> Mus sp.

<400> 21

Gln Val Gln Met Gln Gln Ser Gly Ala Glu Leu Met Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Thr Gly Tyr Thr Phe Thr Gly Tyr

20 25 30

Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Leu Pro Gly Ser Gly Arg Ser Asn Ser Asn Glu Lys Phe

50 55 60

Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Thr Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Gly Lys Leu Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser

100 105 110

Land

<210> 22

<211> 108

<212> PRT

<213> Mus sp.

<400> 22

Asp Ile Val Met Thr Gln Ser Gln Lys Phe Met Ser Thr Ser Val Gly

1 5 10 15

Asp Arg Val Asn Val Thr Cys Lys Ala Ser Gln Asn Val Gly Thr Asn

20 25 30

Val Val Trp Tyr Gln Gln Lys Thr Gly Gln Ser Pro Lys Ala Leu Ile

35 40 45

His Ser Ala Ser Tyr Arg Tyr Ser Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Leu Ser Asn Val Gln Ser

65 70 75 80

Glu Asp Leu Ala Glu Tyr Phe Cys Gln His Tyr Asn Ser Phe Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210> 23

<211> 115

<212> PRT

<213> Mus sp.

<400> 23

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Val

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Arg Phe Thr Asp Tyr

20 25 30

Pro Ile His Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile

35 40 45

Gly Ile Ile Ser Thr Tyr Tyr Gly Asp Val Thr Asn Asn Pro Lys Phe

50 55 60

Arg Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Thr Thr Ala Tyr

65 70 75 80

Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Asn Asp Leu Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr

100 105 110

Val Ser Ala

115

<210> 24

<211> 94

<212> PRT

<213> Mus sp.

<400> 24

Leu Gly Gly Arg Val Thr Ile Thr Cys Lys Ala Ser Asp His Ile Asn

1 5 10 15

Asn Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Asn Ala Pro Arg Leu

20 25 30

Leu Ile Ser Gly Ala Thr Thr Leu Glu Thr Gly Val Pro Ser Arg Phe

35 40 45

Ser Gly Ser Gly Ser Gly Lys Asp Tyr Thr Leu Ser Ile Thr Ser Leu

50 55 60

Gln Thr Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Tyr Trp Ser Ile

65 70 75 80

Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

85 90

<210> 25

<211> 123

<212> PRT

<213> Mus sp.

<400> 25

Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser

1 5 10 15

Gln Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser

20 25 30

Asp Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu

35 40 45

Trp Met Val Ser Tyr Ser Gly Tyr Thr Asn Tyr Asn Pro Ser Leu Lys

50 55 60

Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe Leu

65 70 75 80

Gln Leu Ile Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala

85 90 95

Arg Gly Asp Ala Tyr Asp Val Arg Arg Ser Thr Tyr Tyr Phe Asp Tyr

100 105 110

Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

115 120

<210> 26

<211> 108

<212> PRT

<213> Mus sp.

<400> 26

Asp Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Thr Pro Gly

1 5 10 15

Asp Ser Val Ser Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Asn Asn

20 25 30

Leu His Trp Tyr Gln Gln Lys Ser His Ala Ser Pro Arg Leu Leu Ile

35 40 45

Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Thr

65 70 75 80

Glu Asp Phe Gly Met Tyr Phe Cys Gln Gln Ser Tyr Ser Trp Pro Arg

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210> 27

<211> 114

<212> PRT

<213> Mus sp.

<400> 27

Gln Leu Glu Glu Ser Gly Ala Glu Leu Met Gln Pro Gly Ala Ser Val

1 5 10 15

Lys Val Ser Cys Lys Ala Thr Leu Glu Glu Gly Tyr Thr Phe Thr Val

20 25 30

Tyr Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu Glu Trp

35 40 45

Ile Gly Glu Ile Leu Pro Gly Ser Gly Ser Thr Asp Tyr Asn Glu Lys

50 55 60

Phe Lys Gly Lys Ala Thr Phe Thr Ala Asp Ser Ser Ser Asn Thr Ala

65 70 75 80

Tyr Met Gln Leu Ser Ser Leu Thr Thr Glu Asp Ser Ala Ile Tyr Tyr

85 90 95

Cys Ala Arg Gly Lys Leu His Trp Gly Gln Gly Thr Leu Val Thr Val

100 105 110

Ser Ala

<210> 28

<211> 114

<212> PRT

<213> Mus sp.

<400> 28

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Val Ser Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Gly

20 25 30

Gly Asn Gln Gln Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Ala Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp His Thr Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Glu Leu Glu Ile

100 105 110

Light Arg

<210> 29

<211> 118

<212> PRT

<213> Mus sp.

<400> 29

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Lys Asp

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Asp Ser Arg Thr Ile Asn Tyr Ala Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Trp Asp Tyr Asp Gly Gly Met Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser

115

<210> 30

<211> 116

<212> PRT

<213> Mus sp.

<400> 30

Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Glu Thr Val Thr Ile Thr Cys Arg Thr Ser Glu Asn Ile Tyr Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Gln Leu Ala Trp Tyr Gln Gln Lys Gln

35 40 45

Gly Lys Ser Pro Gln Leu Leu Val His Asn Ala Asn Thr Leu Ala Glu

50 55 60

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Ser

65 70 75 80

Leu Arg Ile Asn Ser Leu Gln Pro Glu Asp Phe Gly Ser Tyr Tyr Cys

85 90 95

Gln His His Tyr Gly Ile Pro Phe Thr Phe Gly Gly Gly Thr Lys Leu

100 105 110

Glu Val Glu Arg

115

<210> 31

<211> 118

<212> PRT

<213> Mus sp.

<400> 31

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Pro Gly Tyr Gly Asn Leu Phe Ala Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ala

115

<210> 32

<211> 111

<212> PRT

<213> Mus sp.

<400> 32

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Val Phe Cys Arg Ala Ser Gln Thr Val Asp Tyr Asn

20 25 30

Gly Met Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ala Ser Asn Leu Asp Ser Gly Ile Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His

65 70 75 80

Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Cys Ile

85 90 95

Glu Asp Pro Leu Thr Phe Gly Ala Gly Thr Met Leu Glu Val Lys

100 105 110

<210> 33

<211> 122

<212> PRT

<213> Mus sp.

<400> 33

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Val Ile His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Ile Asn Pro Phe Ser Asp Gly Thr Lys Phe Thr Glu Lys

50 55 60

Phe Lys Gly Lys Ala Ser Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala

65 70 75 80

Tyr Met Glu Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr

85 90 95

Cys Ala Arg Arg Gly Pro Tyr Tyr Tyr Gly Thr Ala Met Asp Tyr Trp

100 105 110

Gly Gln Gly Thr Ser Val Thr Val Ser Ser

115 120

<210> 34

<211> 107

<212> PRT

<213> Mus sp.

<400> 34

Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Val Ser Val Gly

1 5 10 15

Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val

35 40 45

Asn Ala Ala Thr Asn Leu Ala Asp Gly Val Ser Ser Arg Phe Arg Gly

50 55 60

Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Ser Leu Gln Ser

65 70 75 80

Glu Asp Phe Gly Ser Tyr Tyr Cys Gln His Phe Trp Ile Thr Pro Phe

85 90 95

Thr Phe Gly Ser Gly Thr Lys Leu Glu Arg Lys

100 105

<210> 35

<211> 122

<212> PRT

<213> Mus sp.

<400> 35

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Gly Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Asp Ser Gly Tyr Thr Ile Thr Ile Tyr

20 25 30

Trp Met Gln Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Ala Ile Tyr Pro Gly Asp Gly Asp Thr Arg Tyr Pro Gln Lys Phe

50 55 60

Lys Gly Lys Ser Thr Leu Ser Ala Asp Lys Ser Ser Asn Thr Ala Ser

65 70 75 80

Met His Leu Ser Ser Leu Ala Ser Asp Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ser Arg Gly Gly Ser Thr Asn Tyr Asp Tyr Asp Gly Phe Ala Tyr Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Ser Ala

115 120

<210> 36

<211> 111

<212> PRT

<213> Mus sp.

<400> 36

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asn Tyr

20 25 30

Gly Ile Ser Phe Met His Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ser Asn Leu Gly Ser Gly Val Pro Ala. Free Mp3 Download

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Leu Glu Glu Ala Asp Thr Ala Met Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 37

<211> 113

<212> PRT

<213> Mus sp.

<400> 37

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Met Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Ala Thr Gly Tyr Thr Phe Ser Asn Tyr

20 25 30

Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Leu Pro Gly Arg Gly Ser Thr Asn Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Lys Gln Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser

100 105 110

To be

<210> 38

<211> 108

<212> PRT

<213> Mus sp.

<400> 38

Ser Ile Val Leu Thr Gln Ser Leu Lys Phe Leu Leu Val Ser Ala Gly

1 5 10 15

Asp Arg Val Thr Met Thr Cys Lys Ala Ser Gln Ser Val Thr Asn Asp

20 25 30

Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile

35 40 45

Tyr Tyr Ala Ser Lys His Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr Ile Ser Thr Val Gln Ala

65 70 75 80

Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln Asp Tyr Ser Ser Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210> 39

<211> 120

<212> PRT

<213> Mus sp.

<400> 39

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Ser Asn Gly Arg Ser Asn Tyr Asn Glu Lys Phe

50 55 60

Lys Ser Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala His Tyr Tyr Asp Gly Ser Tyr Gly Phe Phe Asp Tyr Trp Gly Gln

100 105 110

Gly Thr Thr Leu Thr Val Ser Ser

115 120

<210> 40

<211> 111

<212> PRT

<213> Mus sp.

<400> 40

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Gln Ser Val Ser Thr Ser

20 25 30

Thr Ser Ile Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Lys Tyr Ala Ser Asn Leu Glu Ser Gly Val Pro Ala. Free Mp3 Download

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Ile Thr Leu Asn Ile His

65 70 75 80

Pro Val Glu Glu Glu Asp Thr Ala Thr Tyr Tyr Cys Gln His Ser Trp

85 90 95

Glu Ile Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 41

<211> 118

<212> PRT

<213> Mus sp.

<400> 41

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Lys Val Ser Cys Thr Ala Ser Gly Phe Asp Phe Ser Arg Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Thr Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Pro Gly Tyr Gly Asn Leu Phe Val Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 42

<211> 114

<212> PRT

<213> Mus sp.

<400> 42

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Val Ser Ala Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asn Pro Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Gly Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp His Thr Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

100 105 110

Light Arg

<210> 43

<211> 116

<212> PRT

<213> Mus sp.

<400> 43

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Lys Asp

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Asp Ser Ser Thr Ile Asn Tyr Ala Pro Ala Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Glu Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Trp Ser Thr Gly Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu

100 105 110

Thr Val Ser Ser

115

<210> 44

<211> 107

<212> PRT

<213> Mus sp.

<400> 44

Asp Ile Gln Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Asn Cys Arg Ala Ser Gln Gly Leu Ser Asn Tyr

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile

35 40 45

Tyr Tyr Ala Ser Ile Leu His Ser Gly Val Pro Ser Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Thr Leu Glu Gln

65 70 75 80

Glu Asp Ile Gly Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Trp

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 45

<211> 116

<212> PRT

<213> Mus sp.

<400> 45

Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Pro Phe Ser Thr Ser

20 25 30

Trp Met Asn Trp Val Lys Gln Arg Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Arg Ile Tyr Leu Gly Asp Gly Asp Thr Asn Tyr Asn Gly Lys Phe

50 55 60

Thr Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Val Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Trp Arg Gly Asp Tyr Asp Tyr Trp Gly Gln Gly Thr Thr Leu

100 105 110

Thr Val Ser Ser

115

<210> 46

<211> 113

<212> PRT

<213> Mus sp.

<400> 46

Asp Ile Val Met Ser Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly

1 5 10 15

Glu Lys Val Thr Leu Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser

20 25 30

Ser Thr Gln Asn Asn Tyr Leu Ala Trp Tyr Gln Gln Thr Pro Gly Gln

35 40 45

Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln

85 90 95

Tyr Tyr Ser Tyr Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

100 105 110

Light

<210> 47

<211> 118

<212> PRT

<213> Mus sp.

<400> 47

Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser

1 5 10 15

Gln Thr Leu Ser Leu Thr Cys Ser Val Pro Asp Tyr Ser Ile Thr Ser

20 25 30

Asp Tyr His Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu

35 40 45

Trp Met Gly Tyr Ile Ser Ser Arg Gly Ser Thr Asn Tyr Asn Pro Ser

50 55 60

Leu Lys Asn Arg Ile Ser Ile Thr His Asp Thr Ser Glu Asn Gln Phe

65 70 75 80

Phe Leu Lys Leu Thr Ser Val Thr Thr Glu Asp Ser Ala Thr Tyr Tyr

85 90 95

Cys Ala Gly Leu Ser Gln Leu Ala Leu Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser

115

<210> 48

<211> 107

<212> PRT

<213> Mus sp.

<400> 48

Asp Ile Lys Met Thr Gln Ser Pro Ser Ser Met Tyr Ala Ser Leu Gly

1 5 10 15

Glu Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Ile Tyr Pro Tyr

20 25 30

Leu Asn Trp Phe Gln Gln Lys Pro Gly Lys Ser Pro Lys Thr Leu Ile

35 40 45

Tyr Arg Thr Asn Arg Leu Leu Asp Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Gln Asp Tyr Ser Leu Thr Ile Ser Ser Leu Asp Tyr

65 70 75 80

Glu Asp Met Gly Ile Tyr Tyr Cys Leu Gln Tyr Asp Glu Phe Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100 105

<210> 49

<211> 120

<212> PRT

<213> Mus sp.

<400> 49

Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Lys Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser

20 25 30

Asn Met Gly Val Gly Trp Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu

35 40 45

Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser

50 55 60

Leu Lys Ser Gln Leu Thr Ile Ser Lys Asp Thr Ser Arg Asn Gln Val

65 70 75 80

Phe Leu Lys Ile Thr Ser Val Asp Thr Glu Asp Thr Ala Thr Tyr Tyr

85 90 95

Cys Val Arg Ser Asn Tyr Gly Tyr Ala Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ala

115 120

<210> 50

<211> 111

<212> PRT

<213> Mus sp.

<400> 50

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Ser Tyr

20 25 30

Gly Lys Ser Phe Met His Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn

65 70 75 80

Pro Val Glu Ala Asp Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Asn

85 90 95

Glu Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 51

<211> 119

<212> PRT

<213> Mus sp.

<400> 51

Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg Pro Gly Val

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Ala Val His Trp Val Lys Leu Ser His Ala Lys Ser Leu Glu Trp Ile

35 40 45

Gly Val Ile Ser Thr Tyr Asn Asp Tyr Thr Tyr Asn Asn Gln Asp Phe

50 55 60

Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Gly Asn Ser Tyr Phe Tyr Ala Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser

115

<210> 52

<211> 111

<212> PRT

<213> Mus sp.

<400> 52

Asp Ile Ala Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asn Ser

20 25 30

Gly Ile Cys Phe Val Asn Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr The Best Of Lys Leu Leu Ile Tyr Ala Ser Asn Gln Gly Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Met Glu Lys Asp Asp Thr Ala Met Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 53

<211> 121

<212> PRT

<213> Mus sp.

<400> 53

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Ser Pro Gly Thr

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Phe Tyr

20 25 30

Gly Ile Ser Trp Val Lys Gln Lys Thr Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Tyr Pro Gly Ser Tyr Asn Ala Tyr Tyr Asn Asp Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Ala Asp Arg Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Asp Tyr Gly Asp Pro Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly

100 105 110

Gln Gly Thr Ser Val Thr Val Ser Ser

115 120

<210> 54

<211> 111

<212> PRT

<213> Mus sp.

<400> 54

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Thr Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Gln Ser Val Ser Thr Ser

20 25 30

Thr Phe Asn Tyr Met Asn Trp Tyr Gln Gln Lys Leu Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Lys Tyr Ala Ser Asn Leu Glu Ser Gly Val Pro Ala. Free Mp3 Download

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His

65 70 75 80

Pro Val Glu Glu Glu Asp Ile Ala Thr Tyr Tyr Cys Gln His Ser Trp

85 90 95

Glu Ile Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 55

<211> 118

<212> PRT

<213> Mus sp.

<400> 55

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Gln Lys Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Asp Ser Ser Thr Val Asn Tyr Thr Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Pro Gly Tyr Gly Asn Leu Phe Val Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ala

115

<210> 56

<211> 113

<212> PRT

<213> Mus sp.

<400> 56

Asp Ile Val Leu Thr Gln Ala Thr Pro Ser Val Pro Val Thr Pro Gly

1 5 10 15

Glu Ser Val Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Thr

20 25 30

Lys Gly Asp Thr Tyr Leu Tyr Trp Phe Leu Gln Arg Pro Gly Gln Ser

35 40 45

Pro Gln Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Val Phe Thr Leu Arg Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln His

85 90 95

Leu Glu Tyr Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg

<210> 57

<211> 118

<212> PRT

<213> Mus sp.

<400> 57

Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Ser Val Arg Ser Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Leu Asn Ile Lys Asp Tyr

20 25 30

Tyr Met His Trp Val Asn Leu Arg Pro Glu Gln Gly Leu Glu Trp Ile

35 40 45

Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Glu Phe

50 55 60

Gln Gly Lys Ala Thr Met Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Cys Asn Tyr Gly Ser Ala Tyr Gly Tyr Trp Gly Gln Gly Thr

100 105 110

Thr Leu Thr Val Ser Ser

115

<210> 58

<211> 107

<212> PRT

<213> Mus sp.

<400> 58

Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly

1 5 10 15

Glu Lys Val Thr Ile Arg Cys Ile Thr Asn Thr Asp Ile Asp Asp Asp

20 25 30

Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile

35 40 45

Ser Glu Gly Asn Gly Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser

50 55 60

Ser Gly Tyr Gly Thr Asp Phe Val Phe Thr Ile Glu Asn Met Leu Ser

65 70 75 80

Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asp Asn Leu Pro Leu

85 90 95

Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 59

<211> 120

<212> PRT

<213> Mus sp.

<400> 59

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Asp Leu Asn Pro Asp Ser Ser Ala Ile Asn Tyr Thr Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Thr Leu Ile Thr Thr Leu Val Pro Tyr Thr Met Asp Phe Trp Gly Gln

100 105 110

Gly Thr Ser Val Thr Val Ser Ser

115 120

<210> 60

<211> 113

<212> PRT

<213> Mus sp.

<400> 60

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly

1 5 10 15

Val Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser

20 25 30

Gly Asp Gln Lys Asn Cys Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn

85 90 95

Asp Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu

100 105 110

Light

<210> 61

<211> 120

<212> PRT

<213> Mus sp.

<400> 61

Glu Ile His Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Val Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Arg Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Gly Gly Gly Arg Tyr Thr Tyr Tyr Pro Asp Leu Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Ile Ala Arg Thr Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Thr Ala Arg Ala Ser Asn Tyr Ala Met Asp Tyr Trp Gly Gln

100 105 110

Gly Thr Ser Val Thr Val Ser Ser

115 120

<210> 62

<211> 107

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Ile Tyr Pro Tyr

20 25 30

Leu Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Thr Leu Ile

35 40 45

Tyr Arg Thr Asn Arg Leu Leu Asp Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln Tyr Asp Glu Phe Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 63

<211> 120

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<400> 63

Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln

1 5 10 15

Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser

20 25 30

Asn Met Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu

35 40 45

Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Ser Pro Ser

50 55 60

Leu Lys Ser Arg Leu Thr Ile Thr Lys Asp Thr Ser Lys Asn Gln Val

65 70 75 80

Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr

85 90 95

Cys Val Arg Ser Asn Tyr Gly Tyr Ala Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 64

<211> 111

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<400> 64

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Glu Ser Val Asp Ser Tyr

20 25 30

Gly Lys Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro

35 40 45

Arg Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Ser Asn

85 90 95

Glu Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 65

<211> 119

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<400> 65

Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Ala Val His Trp Val Arg Gln Ala Pro Gly Lys Arg Leu Glu Trp Ile

35 40 45

Gly Val Ile Ser Thr Tyr Asn Asp Tyr Thr Tyr Asn Asn Gln Asp Phe

50 55 60

Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Arg Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Asn Ser Tyr Phe Tyr Ala Leu Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ser Val Thr Val Ser Ser

115

<210> 66

<211> 113

<212> PRT

<213> Artificial Sequence

<220>

<221> source

<223> /note="Description of Artificial Sequence: Synthetic

polypeptide"

<400> 66

Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly

1 5 10 15

Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Thr

20 25 30

Lys Gly Asp Thr Tyr Leu Tyr Trp Phe Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Gln Leu Leu Ile Tyr Arg Met Ser Asn Arg Ala Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln His