Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions

Description

The present invention relates to a method of constructing and producing a modified immunoglobulin.

A general area is the construction of proteins with the aim of supplying them with specific binding characteristics. More specifically, the engineered proteins of interest herein are immunoglobulins (antibodies), and more specifically, individual domains or pairs or combinations of individual immunoglobulin domains. The specific binding properties of immunoglobulins are important characteristics, as they control the interaction with other molecules, such as antigens and feedback immunoglobulins, which are useful for diagnostic and therapeutic applications.

The basic structure of the antibody will be explained herein using, by way of example, intact IgG1 immunoglobulin.

Two identical heavy (H) and two identical light (L) chains combine to form a Y-shaped antibody molecule. Each of the heavy chains has four domains. Amino terminal variable domains (VH) are on the arms of Ya. They are monitored with three constant domains: CH1, CH2 and carboxy terminal SNZ, based on the Ya tree. The short span, the crossover, connects the variable and constant regions of the heavy chain. The joint connects CH2 and SNZ (Fc fragment) to the rest of the antibody (Fab fragments). One Fc and two identical Fab fragments can be produced by proteolytic cleavage of the joint in an intact antibody molecule. Light chains are constructed of two domains, variable (VL) and constant (CL), which are separated by a crossover.

Disulfide bonds in the joint region connect two heavy chains. Light chains were coupled to heavy chains by additional disulfide bonds. Asn-fused carbohydrate moieties are attached to different positions in constant domains, depending on the class of immunoglobulin. In IgG1, two disulfide bonds in the joint region, between the Cys235 and Cys238 pairs, connect two heavy chains. The light chains were coupled to the heavy chains using two additional disulfide bonds, between Cys229 in the CH1 domains and Cys214 in the CL domains. The carbohydrate moieties were attached to Asn306 of each CH2, producing a pronounced bulge in the Ya tree.

These characteristics have fundamental functional consequences. The variable regions of both heavy (VH) and light chains (VL) lie on the “arms of Ya, where they are positioned to react with the antigen. This arm of the molecule is the side on which the N-terminus of the amino acid sequence is located. The Ya tree is projected onto one

50752 Β a way to effectively mediate effector functions, such as complement activation and interaction with Fc receptors, or ADCC and ADCP. Its CH2 and SNZ domains are convex to facilitate interaction with effector proteins. The C-terminus of the amino acid sequence is located on the opposite side of the kgaka, which can be called the "foundation" of Ya. The structure of intact IgG1 is illustrated in Figure 1a.

Two types of light chains, denoted by lambda (λ) and kappa (k), have been identified in antibodies. A given immunoglobulin has either k chains or λ chains, never one of each. No functional differences were found between antibodies, which have λ or k light chains.

The structural organization of monomers of the major class of human immunoglobulins is shown in Figure 1b. Classes differ in the composition and sequence of their individual heavy chains. Both IgM and IgE lose the joint region, but each contains an extra heavy chain domain (CH4). The number and locations of disulfide bonds (lines) that bind the chains differ between isotypes. They also differ in the distribution of N-linked carbohydrate groups, which are symbolically represented as circles.

Each domain in the antibody molecule has a similar structure in the form of two beta plates, which are tightly packed towards each other, in a compressed non-parallel beta column. The preserved structure is called the immunoglobulin fold. The constant domain immunoglobulin fold contains a 3-fold plate packed according to the 4-fold plate. The fold was stabilized by hydrogen bonds between the beta waists of each plate, by hydrophobic bonding between the remnants of opposite plates in the interior, and by a disulfide bond between the plates. The 3-stranded plate contains strands C, F, and G, and the 4-stranded plate has strands A, Β, E, and D. The letters A to G denote positions in the beta-sequence sequence, along the amino acid sequence of the immunoglobulin fold.

The variable domain fold has 9 beta strands, which are arranged in two plates of 4 and 5 strands. The 5-fold plate is structurally homologous to the 3-plate plate of constant domains, but contains extra waists C 'and C'. The remaining waists (A, B, C, D, E, F, G) have the same topology and similar structure as their copies in the constant domain of immunoglobulin folds. The disulfide bond joins the waists B and F in opposite plates, as in constant domains. The immunoglobulin fold is illustrated in Figure 2 for the constant and variable immunoglobulin domains.

The variable domains of both light and heavy immunoglobulin chains contain three hypervariable loops or regions, which determine complementarity (CDRi). Three V domain CDRs (CDR1, CDR2, CDR3) accumulate at one end of the beta column. CDRs are loops, which connect the beta strands of BC, C'-C "and FG immunoglobulin fold. Residues in CDRs vary from one immunoglobulin molecule to another, providing antigenic specificity to each antibody.

50752 Β

The VL and VH domains on the arms of the antibody molecules are closely packaged so that 6 CDRs (3 on each domain) jointly participate in the construction of the surface (or cavity) for antigen-specific binding. The natural antigen binding position of the antibody is thus composed of loops, which connect the strands BC, C'-C "and FG of the light chain variable domain and the strands BC, C'-C" and FG of the variable domain of the heavy chain.

Using the 3D structure of the protein as a design aid, the amino acid residues located on the surface of many proteins were randomly distributed, using the structure of the protein nucleus as the basis of the structure. Examples of this strategy are described or set forth in the following references, which are incorporated herein by reference: Nygren PA, Uhlen M., Curr Opin Struct Biol. (1997) 7: 463-9; Binz HK, Amstutz P, Kohl A, Strumpp MT, Briand C, Forrer P, Grutter MG, Pluckthun A. Nat Biotechnol. (2004) 22: 575-82; Vogt M, Skerra A. Chembiochem. (2004) 5: 191-9; US 6,562,617.

The basic principle of this technique is based on the observation that many proteins have a stable nucleus, which is formed by a specific classification of secondary structural elements, such as beta plates or alpha helixes, which are interconnected by structures such as loops, turns or random helices. Typically, these last three element structures are less important for the overall protein structure, and the amino acid residues in these structural elements can be replaced, often without destroying the overall protein fold. An example of this design principle, which exists in nature, are CDRs of antibodies. Artificial examples include: lipocalins, ankyrins and other protein structures.

Loops that are not CDR loops in native immunoglobulin do not possess antigen binding or epitope binding specificity, but contribute to the correct bending of the entire immunoglobulin molecule and / or its effector or other functions, and are therefore termed structural loops for the purposes of the present invention.

In United States Patent 6,294,654, it is shown how altered antibodies can be produced, in which the peptide antigen can be incorporated into the neCDR antibody loop (Ab) in the CH1 region, between the hinge region and the variable region, and the resulting Ab can be taken up in APC, so that the peptide antigen is present on the surface of APC, as part of MHC II, and thereby produce an immune response. These inserted peptides are epitopes, and the overall structure of the carrier molecules is not important. It has been demonstrated that the ras peptide can be placed on the (non-CDR) loop of the Immunoglobulin, and the Immunoglobulin can still be secreted. There is a strict "quality control" in the cells, which prevents the immunoglobulin from being secreted until it is properly folded, and changing the amino acid sequence of the loop could cause the protein to bend into a structure that the cells would detect as incorrect.

50752 Β decomposed. Therefore, in addition to the examples shown, it is considered complicated to further modify the structural loops without altering the nature of the Immunoglobulin.

U.S. Pat. Application 2004/0101905 describes binding molecules, which contain a target binding site and an Fc effector peptide. Fc effector peptide is a peptide that interacts with an effector molecule. The insertion of the effector peptide into the non-CDR loop of the CH1 domain of the immunoglobulin fragment was shown.

Fc effector peptides are structures, which exist in nature in non-CDR loops of antibodies, and, for these reasons, it is expected that the structure of the immunoglobulin is not disturbed if they are grafted to different equivalent locations in the immunoglobulin.

Despite the fact that each protein, grafted onto a non-CDR loop, in accordance with this exposure, has a high chance of being inactivated by a different structural environment, it was selected.

In both previous professional documents, which are mentioned above, it was found that it is complicated to insert peptides into the loop, which would retain its structure and function, since it is crucial not to disrupt the bent immunoglobulin structure, because it is important for function and secretion.

U.S. Patent Applications 2004/0132101 and 2005/0244403 describe mutant immunoglobulins with altered binding affinity for effector ligands, which are natural ligands for antibody loop structures. In these documents, numerous mutations in various regions are described, along the entire immunoglobulin molecule, which affect the effector function of the whole antibody.

WO 01/83525 relates to proteins, which contain Fc domains fused to biologically active peptides, wherein said peptides are fused to Fc domains at their N- or C-terminus.

US 2002/0106370 discloses chimeric polypeptides, comprising a binding moiety, which exhibits specific binding affinity for the surface of target eukaryotic cells and for the effector moiety.

WO 02/32925 discloses proteins, which are capable of antibody-like function. To achieve this, loop structures are also introduced into said proteins, which in structure and position correspond to CDR loops.

WO 2006/036834 discloses molecules and methods by which biologically active peptides are incorporated into the loop region of the Fc domain. A biologically active peptide with the desired biological activity is first selected and then introduced into the Fc domain, either by binding the peptide to a protein or by inserting a single nucleic acid into a nucleic acid encoding the Fc domain.

Other previous expert documents show that, so far, a structure similar to imiinoglobulin has been used to manipulate the existing antigen.

50752 Β binding position, thus introducing new bonding characteristics. So far, however, only CDR regions have been constructed for antigen binding, in other words, in the case of immunoglobulin bending, only the natural antigen binding position has been modified to alter its binding affinity or specificity. There is a large majority of the literature describing different formats of such manipulated immunoglobulins, often expressed as single-stranded Fv fragments (scFv) or Fab fragments, or exposed on the surface of phage particles or solubly expressed in various prokaryotic or eukaryotic expression systems. Among the leading authors in this field are: Greg Winter, Andreas Pluckthun and Hennie Hoogenboom.

It is an object of the present invention to provide immunoglobulins with introduced novel antigen binding sites, and methods for constructing and producing said immunoglobulins.

For these reasons, the present invention relates to the constant domain of an immunoglobulin or to its precursor, as defined in claims 1 to 7, and to nucleic acid molecules encoding said immunoglobulin as defined in claim 7.

A method of constructing an immunoglobulin, comprising at least one modification in the structural region of a loop of said immunoglobulin and determining binding of said immunoglobulin to an antigen epitope, wherein the unmodified immunoglobulin does not bind significantly to said epitope, comprising the steps of:

- providing a nucleic acid encoding imurioglobulin, which contains at least one structural region of the loop,

- modifying at least one nucleotide residue from at least one of said structural regions of the loop,

- translating said modified nucleic acid into an expression system,

- expressing said modified immunoglobulin,

contacting the expressed modified immunoglobulin with the epitope, and

- determining whether said modified immunoglobulin binds to said epitope.

In particular, said construction method comprises an immunoglobulin that specifically binds to an antigen epitope selected from the group consisting of: allergens, tumor-associated antigens, intrinsic antigens, enzymes, bacterial antigens, fungal antigens, protozoan antigens, and viral antigens. Through modification in the structural region of the loop, an epitope-bound immunoglobulin can be constructed. In a preferred embodiment, the immunoglobulin specifically binds to at least two such

50752 Β epitopes, which differ from each other, either from the same antigen or from different antigens.

For example, the method relates to constructing an immunoglobulin that specifically binds to at least one first epitope and comprising at least one modification in at least one structural region of the loop of said immunoglobulin, and to determining the specific binding of said, at least one, region of the loop for, at least one, the other epitope, the epitope, which is selected from the group of antigens, as mentioned above, wherein the unmodified loop structural region (non-CDR region) does not bind specifically to said at least one other epitope, comprising the steps of:

- providing a nucleic acid encoding an immunoglobulin that specifically binds to at least one first epitope, comprising at least one structural region of the loop,

- modifying at least one nucleotide residue of at least one of said loop regions encoding said nucleic acid,

- translating said modified nucleic acid into an expression system,

- expressing said modified immunoglobulin,

- contacting the expressed modified immunoglobulin with said at least one other epitope, and

- determining whether said modified immunoglobulin specifically binds to another epitope.

The method preferably relates to at least one modification in at least one structural region of the loop of said immunoglobulin and to determining the specific binding of said, at least one, loop region to at least one antigen selected from the group consisting of: allergens, tumor-associated antigens, intrinsic antigens, enzymes, bacterial antigens, fungal antigens, viral antigens and protozoal antigens, wherein the immunoglobulin containing the unmodified structural region of the loop does not bind specifically to said antigen.

The term "immunoglobulins, which are modified in accordance with the present invention (as used herein, the terms immunoglobulin and antibody are interchangeable), may exhibit mono- or multi-specific, or multivalent binding characteristics, at least two, preferably at least three specific binding sites for epitopes e.g., antigens, effector molecules / proteins. Immunoglobulins according to the invention are also functional fragments accepted in the art, such as: Fc, Fab, scFv, single chain dimers of the CH / CL domain, Fv or other derivatives or combinations

50752 Β immunoglobulins, heavy and light fan variable region domains (such as Fd, VI, Vk, Vh) and intact antibody constant regions, such as CH1, CH2, SNZ, CH4, Cl and Ck, as well as mini-domains, composed of of two beta strands of the immunoglobulin domain, which are connected by a structural loop.

It is understood that the term "immunoglobulin", "modified immunoglobulin"¹'or "the immunoglobulin according to the invention" also includes an immunoglobulin derivative. A derivative is any combination of one or more immunoglobulins of the invention and or a fusion protein, in which any domain or minidomain of the immunoglobulin of the invention may be linked at any position of one or more other proteins (such as other immunoglobulins, ligands, building proteins, enzymes). toxins and the like). The immunoglobulin derivative of the invention can also be obtained by binding to other substances by various chemical techniques, such as covalent coupling, electrostatic interaction, disulfide binding, and the like.

Other substances bound to immunoglobulins may be: lipids, carbohydrates, nucleic acids, organic and inorganic molecules or any combination thereof (eg, PEG, prodrugs or drugs) The derivative is also an immunoglobulin with the same amino acid sequence, but produced , wholly or partially, from unnatural or chemically modified amino acids.

Molecules constructed in accordance with the present invention will be useful as stand-alone proteins, as well as fusion proteins or derivatives, usually joined in such a way as to be part of a larger structure of antibodies or complete antibody molecules or parts thereof, such as Fab fragments, Fc fragments, Fv fragments and others. It will be possible to use the engineered proteins to produce molecules, which are monospecific, bispecific, trispecific and may even carry more specificity at the same time, and it will be possible to control and, at the same time, pre-select the valence of binding, in accordance with the requirements of planning the use of such molecules.

In accordance with the present invention, antigen or antigen binding regions of all types of allergens, tumor-associated antigens, intrinsic antigens, enzymes, bacterial antigens, fungal antigens, protozoal antigens and viral antigens can be introduced into the loop structure of a given antibody structure.

The term "antigen" in accordance with the present invention would mean molecules or structures that are known to interact with or be able to interact with the region of the CDR loop of an immunoglobulin. The structural regions of the loops from the previous professional documents do not interact with antigens, but contribute to the overall structure and / or binding of effector molecules.

The term "allergens, tumor-associated antigens, intrinsic antigens, enzymes, bacterial antigens, fungal antigens, protozoal antigens and viral antigens", in

50752 Β in accordance with the present invention, would include all allergens and antigens, which antibody structures are able to recognize and fragments of such molecules (especially substructures, which are generally referred to as "epitopes" (eg, B-cell epitopes)), as long as are immunologically relevant, i.e., also recognizable by natural or monoclonal antibodies.

The term "epitope", in accordance with the present invention, would mean a molecular structure, which may completely form a specific binding partner, or be part of a specific binding partner for the binding domain or immunoglobulin of the present invention.

Chemically, the epitope may be composed of a carbohydrate, peptide, fatty acid, inorganic substance, or derivatives thereof, and any combination thereof. If the epitope is a polypeptide, it will generally include at least 3 amino acids, preferably 8 to 50 amino acids, and more preferably between about 10-20 amino acids in the peptide. There is no critical upper limit for the length of a peptide, which can contain almost the full length of a polypeptide sequence. Epitopes can be bifi or linear or conformational epitopes. A linear epitope is composed of a single segment of the primary sequence of a polypeptide chain. Linear epitopes can be tangential or overlapping. Conformational epitopes are composed of linked amino acids, by bending the polypeptide, to form a tertiary structure, and it is not necessary for the amino acids to be close to each other in a linear sequence.

Specifically, epitopes are at least part of the diagnostically relevant molecules, i.e., the absence or presence of epitopes in the sample qualitatively or quantitatively correlates with disease or health status or with the state of the production process or with the state of the environment or diet. Epitopes can also be at least part of the therapeutically relevant molecules, i.e., molecules, that can be targeted by a specific binding domain, which alters the course of the disease.

Preferably, "allergens, tumor-associated antigens, intrinsic antigens, enzymes, bacterial antigens, fungal antigens, protozoal antigens and viral antigens" are those allergens or antigens that have already been shown to be or are capable of being immune or therapeutically relevant, especially those whose clinical efficacy has been examined.

On the other hand, in accordance with another aspect of the present invention, other binding capacities may also be introduced into the structural regions of the loop, e.g., binding capacities for small molecules, such as drugs or enzymes, catalytic positions of enzymes or enzyme substrates, or for analogs of the transition state of the enzyme substrate.

Preferably, the novel antigen binding site in the structural loops is foreign to the unmodified immunoglobulin. Therefore, target-like effector molecules or

50752 Β

Fc receptors are preferably excluded from the binding molecules and the specificity of the immunoglobulin, in accordance with the invention.

Preferably, novel antigen binding positions in the structural loops are introduced by substitution, deletion and / or insertion of immunoglobulins, encoded by the selected nucleic acid.

According to another, preferred embodiment of the present invention, modification of the at least one nucleotide results in substitution, deletion and / or insertion of an immunoglobulin encoded by said nucleic acid.

Modification of at least one loop region may result in substitution, deletion and / or insertion of 1 or more amino acids, preferably point mutations, alterations of entire loops, more preferably alterations of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 30 amino acids.

Random mutation, directed towards the position, is also desirable. By this method, one or more specific amino acid residues of the loop are modified or introduced, using randomly produced inserts, into such structural loops. Alternatively, the use of combinatorial approaches is preferred.

At least one loop region is preferably mutated or modified by random, semi-random methods or, in particular, position-directed random mutagenesis methods. These methods can be used to make amino acid modifications at desired immunoglobulin positions of the present invention. In these cases, the positions were chosen at random, or the amino acid changes were performed using simple rules. For example, all residues can be mutated into alanine, which is referred to as alanine scanning. Such procedures may be associated with more sophisticated engineering approaches, which use selective procedures to protect high levels of sequence diversity. A preferred method according to the invention relates to a randomly modified nucleic acid molecule, comprising at least one repeating nucleotide unit, having the sequence 5'NNS-3 ', 5'-NNN-3' or 5-NNA- 3 '.

A randomly modified nucleic acid molecule may contain the above-mentioned repeating units, which encode all known amino acids, which exist in nature.

As is well known in the art, there are a variety of selective technologies that can be used to identify and isolate proteins with specific binding characteristics and affinities, including, for example, exposure technologies, such as phage exposure, ribosome exposure, cell exposure surfaces and the like, as described below. Methods for producing and screening antibody variants are well known in the art. General procedures of molecular biology

50752 Β antibodies, expression, purification and screening, are described in Antibody Engineering, published by Duebel & Kontermann, Springer-Verlag, Heidelberg, 2001; and Hayhurst & Georgiou, 2001, Curr Opin Chem Biol 5: 683-689; Maynard & Georgiou, 2000, Annu Rev Biomed Eng 2: 339-76.

The "structural loop" or "non-CDR loop", according to the present invention, is to be understood as follows: immunoglobulins are made up of domains with a so-called immunoglobulin fold. In essence, non-parallel beta plates are connected by loops to form a compressed non-parallel beta column. In the variable region, some of the domain loops substantially contribute to antibody specificity, i.e., antigen binding. These loops are called CDR loops. All other loops of the rge antibody domain contribute to the structure of the molecules and / or the function of the effector. These loops are defined herein as structural loops or non-CDR loops.

Nucleic acid molecules, which encode modified immunoglobulins (and throughout the entire description of the patent, hereinafter, always included immunoglobulin fragments) can be cloned into host cells, expressed and tested for their binding specificities. These methods are performed using well-known procedures and a number of methods, which can find application in the present invention, and are described in Molecular Cloning - A Laboratory Manual 3. sup. rd Ed. (Maniatis, Cold Spring Harbor Laboratory Press, New York, 2001) and Current Protocols in Molecular Biology (John Wiley & Sons). Nucleic acids encoding the modified immunoglobulins of the present invention may be incorporated into an expression vector to express said immunoglobulins. Expression vectors typically contain operably linked immunoglobulin, which is operably linked to control or regulatory sequences, selective markers, any fusion partners, and / or additional elements. The modified immunoglobulins of the present invention can be produced by culturing host cells, transformed with a nucleic acid, preferably an expression vector, comprising a nucleic acid encoding the modified immunoglobulins, under appropriate conditions, to induce or induce the expression of the modified immunoglobulins. Methods for introducing exogenous nucleic acid molecules into a host are well known in the art, and will vary depending on the host used. Of course, cellular expression systems or cell-free expression systems can also be used to express the modified immunoglobulins.

In a preferred embodiment of the present invention, the modified immunoglobulins are purified or isolated after expression. Modified immunoglobulins can be isolated or purified in various ways known to those skilled in the art. Standard purification procedures include chromatographic techniques, electrophoretic,

50752 Β immunological, precipitation, dialysis, filtration techniques, concentration techniques and chromatofocusing. Purification can often be made possible by a single fusion partner. For example, antibodies can be purified using glutathione resin, if GST fusion is used, Ni⁺² affinity chromatography, if HisTag was used or if a flag-tag was used, using immobilized anti-flag antibodies. For general recommendations in suitable purification techniques, see Antibody Purification: Principles and Practice, 3.sup.rd Ed., Scopes, Springer-Verlag, NY, 1994. Of course, it is also possible to express modified immunoglobulins, in accordance with the present invention, on the surface of a host cell, in particular on the surface of a bacterial, insect or yeast cell, or on the surface of a phage or virus.

Modified iminoglobulins can be screened using a variety of methods, which include, but are not limited to, technologies that use in vitro assays, in vivo assays, cell-based assays, and selective technologies. High-flow automation and screening technologies can be used in screening procedures. Screening may involve the use of a fusion partner or label, for example, an enzyme, an immunolabel, an isotopic label, or small label molecules, such as a fluorescent or colorimetric dye or a luminogenic molecule.

In a preferred embodiment, the functional and / or biophysical characteristics of the immunoglobulin are screened by an in vitro assay. In a preferred embodiment, the functionality of the antibodies, and, for example, their ability to catalyze the reaction or their binding affinity for their target, is examined,

Tests may include a variety of detection procedures, which include, but are not limited to, chromogenic, fluorescent, luminescent, or isotopic markers.

As is known in the art, a subset of screening tests are those tests by which suitable library members are selected. The methods are referred to herein as "selective methods", and these methods find use in the present invention for screening modified immunoglobulins. When immunoglobulin libraries are screened using a selective procedure, only those library members that are suitable, i.e., that meet some selective criteria, are replicated, isolated, and / or observed. As will be appreciated, since only the largest number of suitable variants are observed, such procedures allow for the screening of libraries, which are larger than those that can be screened by procedures, which individually examine the suitability of library members. Selection is made possible by any method, technique, or fusion partner that associates, covalently or non-covalently, the immunoglobulin phenotype with their genotype, which is the function of the antibody with the nucleic acid that encodes it. For example, the use of exposed phage, as a selective procedure, is made possible by the fusion of library members for gene III. protein. In this way, selection or isolation

50752 Β modified immunoglobulins, which meet some criteria, for example, the binding affinity for the immunoglobulin target, also allows the selection or isolation of nucleic acid, which encodes them. As soon as they are isolated, the gene or genes encoding the modified immunoglobulins can be amplified. This isolation and amplification procedure, referred to as panning, can be repeated, allowing the variants of a suitable antibody in the library to be amplified. Nucleic acid sequencing of the linked nucleic acid finally allows gene identification.

Various selective methods are known in the art, which, in the present invention, can find application in the screening of immunoglobulin libraries. These include, but are not limited to: Phage display of peptides and antibodies: a laboratory manual, Kau et al., 1996, Academic Press, San Diego, Calif., 1996; Lowman et al., 1991, Biochemistry 30: 10832 -10838; Smith, 1985, Science 228: 1315-1317) and its derivatives, such as the production of selective phage infection (Malmborg et al., 1997, J Mol Biol 273: 544-551), the production of selectively infectious phages (Krebber et al., 1997, J Mol Biol 268: 619-630) and the formation of delayed infectivity (Benhar et al., 2000, J Mol Biol 301: 893-904), cell surface exposure (Vitrrup, 2001, Curr Opin Biotechnol, 12: 395-399 ), such as exposure to bacterial cells (Georgiou et al., 1997, Nat Biotechnol 15: 29-34; Georgiou et al., 1993, Trendis Biotechnol 11: 6-10; Lee et al., 2000, Nat Biotechnol 18: 645-648; Jun et al., 1998, Nat Biotechnol 16: 57680), yeasts (Boder & Vittrup, 2000, Methods Enzymol 328: 430-44; Boder & Vitrup, 1997, Nat Biotechnol 15: 553-557), and mammalian cells (Whitehorn et al., 1995, Bio / technology 13: 1215-1219), as well as in vitro exposure technologies (Amstutz et al., 2001, Curr Opin Biotechnol 12: 400-405), such as exposure to poisomes (Mattheakis et al., 1994, Proc Natl Acad Sci USA 91: 9022-9026), ribosome exposure (Hanes et al., 1997, Proc Natl Acad Sci USA) 94: 4937-4942), mRNA exposure (Roberts & Szostak, 1997, Proc Natl Acad Sci USA 94: 12297-12302; Nemoto et al, 1997, FEBS Lett 414: 405-408) and the ribosome inactivation exposure system (Zhou et al., 2002, J Am Chem Soc 124, 538-543).

Other selective methods that may find use in the present invention include methods that do not rely on exposure, such as in vivo methods that include, but are not limited to, periplasmic expression and cytometric screening (Chen et al., 2001 , Nat Biotechnol 19: 537-542), antibody fragment complementarity test (Johnsson & Varshavsky, 1994, Proc Natl Acad Sci USA 91: 10340-10344; Pelletier et al „1998, Proc Natl Acad Sci USA 95: 12141-12146) and two-hybrid yeast screening (Fields & Song, 1989, Nature 340: 245-246), used in selective mode (Visintin et al., 1999, Rgos Natl Acad Sci USA 96: 11723-11728). In an alternative embodiment, the selection is enabled by use

50752 Β a fusion partner, which binds to a specific sequence of an expression vector, linking, thus, covalently or non-covalently, the fusion partner and the associated Fc variant of the library member with the nucleic acid encoding them. For example, PCT WO 00/22906; PCT WO 01/49058; PCT WO 02/04852; PCT WO 02/04853; PCT WO 02/08023; PCT WO 01/28702 and PCT WO 02/07466, describe such a fusion partner and techniques, which may find application in the present invention. In an alternative embodiment, in vivo selection may also occur if the expression of the antibody provides the cell with some advantage over growth, reproduction or survival.

A subset of selective procedures, referred to as “directed evolution” procedures, are those that involve weaving and creating suitable sequences, during selection; sometimes with the inclusion of new mutations. As those skilled in the art can appreciate, directed evolution procedures can facilitate the identification of the most suitable sequence in the library, and can increase the variety of sequences that are screened. Various directed evolution methods are known in the art, which, in the present invention, may find application in the screening of antibody variants , including, but not limited to: DNA mixing (PCT WO 00/42561 AZ; PCT WO 01/70947 AZ), exon mixing (U.S. Pat. No. 6,365,377; Kolkman & Stemmer, 2001, Nat Biotechnol 19: 423-428), family mixing (Crameri et al., 1998, Nature 391: 288-291; U.S. Pat. No. 6,376,246), RACHITT. TM. (Coco et al., 2001, Nat Biotechnol 19: 354359; PCT WO 02/06469), STEP and random priming of in vitro recombination (Zhao et al., 1998, Nat Biotechnol 16: 258-261; Shao et al., 1998 , Nucleic Acids Res 26: 681-683), exonuclease-mediated gene matching (US Pat. No. 6,352,842; US Pat. No. 6,361,974), Gene Site Saturation Mutagenesis. TM. (US Pat. No. 6,358,709), Gene Reassembly.TM. (US Pat. 6,358,709), SCRATCHY (Lutz et al., 2001, Proc Natl Acad Sci USA 98: 11248-11253), DNA fragmentation procedures (Kikuchi et al., Gene 236: 159-167), single DNA mixing (Kikuchi et al., 2000, Gene 243: 133-137) and AMEsystem.TM, directed evolutionary antibody engineering technology (Applied Molecular Evolution). (U.S. Pat. No. 5,824,514; U, S. Pat. No. 5,817,483; U.S. Pat. No. 5,814,476; U.S. Pat. No. 5,763,192; U.S. Pat. No. 5,723,323).

Antibody variants can be screened using one or more cell-based assays or in vivo assays. For such assays, purified or unrefined modified immunoglobulins are usually added exogenously, so that the cells are exposed to individual immunoglobulins or immunoglobulin pools, which belong to the library. These tests are usually, but not always, based on immunoglobulin function; that is, on the ability of antibodies to bind to their target and mediate some biochemical events, for example, effector function, inhibition of binding

50752 Β ligand / receptor, apoptosis, and the like. Such assays often involve monitoring the response of cells to an antibody, such as, for example, cell survival, cell death, changes in cell morphology, or transcriptional activation, such as cellular expression of a natural gene or reporter gene. For example, such assays may measure the ability of antibody variants to elicit ADCC, ADCP, or CDC. In some assays, there may be a need to add additional cells or components, i.e., in addition to target cells, for example, serum complement, or effector cells, such as peripheral blood monocytes (PBMCi), NK cells, macrophages, and the like. Such additional cells may be from any organism, preferably humans, mice, rats, rabbits and monkeys. Immunoglobulins can induce apoptosis of certain cell arrays, which express the target cell, or they can mediate the attack on target cells by immune cells, which have been added to the assay. Methods for monitoring cell death or viability are known in the art, and include: the use of dyes, immunochemical, cytochemical and radioactive reagents. For example, caspase staining assays can measure apoptosis, and the acceptance or release of radioactive substrates or fluorescent dyes, such as alamar blu, can allow cell growth or activation to be monitored. In a preferred embodiment, DELFIA.RTM can be used. EuTDA-based cytotoxicity test (Perkin Elmer, MA). Alternatively, dead or damaged target cells can be monitored by measuring the release of one or more natural intracellular components, for example, lactate dehydrogenase. Transcriptional activation can also serve as a procedure for testing function in cell-based assays. In this case, the response can be monitored by examining natural genes or immunoglobulins, which can be up-regulated, for example, the release of certain interleukins can be measured, or an alternative reading can be reported via a reporter construct. Cell-based assays can also include the measurement of morphological changes in cells in response to the presence of modified immunoglobulins. The cell type, for such tests, can be prokaryotic or eukaryotic, and various cell sequences known in the art can be used. Alternatively, cell-based assays were performed using cells that had been transformed or transfected with nucleic acids encoding variants. That is, antibody variants are not exogenously added to cells. For example, in one embodiment, cell-based screening uses cell surface detection. A fusion accomplice can be used, which allows the detection of modified immunoglobulins on the cell surface (Vitrup, 2001, CurrOpin Biotechnol, 12: 395-399).

In a preferred embodiment, the immunogenicity of the modified immunoglobulins can be determined experimentally, using one or more cell-based assays. In a preferred embodiment, ex vivo T-cell activation assays are used to experimentally quantify immunogenicity. In this process, cells,

50752 Β which represent antigen and natural T cells from a matching donor, are stopped by a peptide or whole antibody of importance, one or more times. Then, T cell activation can be measured, using a number of methods, for example, by monitoring cytokine production or by measuring tritium thymidine uptake. In a most preferred embodiment, the production of gamma interferon is measured, using the Elispot test (Schmittel et al., 2000, J. Immunol. Meth., 24: 17-24).

The biological properties of the modified immunoglobulins of the present invention can be described by experiments on cells, tissue and the whole organism. As is known in the art, drugs are often tested on animals, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and monkeys, to determine drug efficacy in treating a disease or disease model, or to determine pharmacokinetics. , toxicity or other properties of the drug. Animals can be labeled as disease models. Therapeutics are often tested on mice, including, but not limited to, nude mice, SCID mice, xenograft mice, and transgenic mice (including ticks and outbreaks). Such experiments can provide significant data for determining antibody potential, which is used as a therapeutic. Any organism, preferably a mammal, can be used for testing. For example, because of their genetic similarity to humans, suitable therapeutic models may be apes and may therefore be used to test the efficacy, toxicity, pharmacokinetics, or other properties of the modified immunoglobulins of the present invention. Tests on humans are the ultimate requirement for drug approval, so these experiments are, of course, being considered. For these reasons, the modified immunoglobulins of the present invention can be tested in humans to determine their therapeutic efficacy, toxicity, immunogenicity, pharmacokinetics and / or other clinical characteristics.

The modified immunoglobulins of the present invention can find use in a wide range of antibody products. In one embodiment, an antibody variant of the invention is used for therapy or prophylaxis, for preparative or analytical use, in the form of a diagnostic compound, an industrial compound or a research reagent, preferably a therapeutic agent. An antibody variant can be used in a mixture of antibodies, which are monoclonal or polyclonal. In a preferred embodiment, the modified immunoglobulins of the present invention are used to destroy target cells, which carry the target antigen, for example, cancer cells. In an alternative embodiment, the modified immunoglobulins of the present invention are used as blockers, antagonists or agonists of the target antigen, for example, by creating antagonism with a cytokine or cytokine receptor. In an alternative preferred embodiment, the modified immunoglobulins of the present invention are used as blockers, antagonists or agonists of the target antigen and for the destruction of target cells, which carry the target antigen. In an alternative preferred embodiment,

50752 The modified immunoglobulins of the present invention are used as blockers, antagonists or agonists of growth factor or growth factor receptor and for the destruction of target cells, which carry or need a target antigen. In an alternative preferred embodiment, the modified immunoglobulins of the present invention are used as blockers, antagonists or agonists of enzymes and enzyme substrates.

The modified immunoglobulins of the present invention can be used for a variety of therapeutic purposes, l) in a preferred embodiment, an antibody comprising the modified immunoglobulins is administered to a patient for the treatment of a specific disorder. “The patient, for the purposes of the present invention, includes both humans and animals, preferably mammals, and most preferably humans. By "specific disorder" is meant herein a disorder, which can be alleviated by the use of a pharmaceutical composition comprising a modified immunoglobulin of the present invention.

In one embodiment, the modified immunoglobulin, in accordance with the present invention, is the only therapeutically active agent administered to a patient. Alternatively, the modified immuoglobulin according to the invention is administered in combination with one or more other therapeutic agents, which include, but are not limited to, cytotoxic agents, chemotherapeutic agents, cytokines, growth inhibiting agents, anti-hormonal agents, kinase inhibitors, antiangiogenic agents, cardioprotective agents or other therapeutic agents. The modified immunoglobulins may be administered concomitantly with one or more other therapeutic regimens. For example, an antibody variant of the invention may be administered to a patient in conjunction with chemotherapy, radiation therapy, or both chemotherapy and radiation therapy. In one embodiment, the modified immunoglobulins of the invention may be administered in conjunction with one or more antibodies, which may or may not contain an antibody variant of the invention. According to another embodiment of the invention, the modified immunoglobulins of the invention and one or more other anticancer therapies are used to treat ex vivo cancer cells. It is contemplated that such ex vivo treatment may be useful in bone marrow transplants and, in particular, autologous bone marrow transplants. It is to be understood, of course, that the antibodies of the invention may be used in combination with other therapeutic techniques, such as surgery.

Various other therapeutic agents may find use in the administration of the modified immunoglobulins of the present invention. In one embodiment, the modified immunoglobulins are administered with an anti-angiogenic agent, which is a compound that blocks or interferes to some extent with the development of blood vessels. The anti-angiogenic factor may, for example, be a small molecule or protein, for example, an antibody, Fc fusion or cytokine, which binds to a growth factor or receptor

50752 Β growth factors, which are involved in supporting angiogenesis. The preferred anti-angiogenic factor herein is an antibody that binds to vascular endothelial growth factor (VEGF). In an alternative embodiment, the modified immunoglobulin is administered with a therapeutic agent that induces or enhances an adaptive immune response, for example, an antibody that targets CTLA-4. In an alternative embodiment, the modified immunoglobulin is administered with a tyrosine kinase inhibitor, which is a molecule that inhibits, to some extent, tyrosine kinase activity. In an alternative embodiment, the modified immunoglobulins of the invention are administered with a cytokine. By "cytokine", as used herein, is meant a generic name for proteins, which are released in one cell population, and which act on another cell, as intercellular mediators, including chemokines.

Pharmaceutical compositions in which the modified immunoglobulins of the present invention and one or more therapeutically active agents are formulated are contemplated. Formulations of antibody variants of the invention are prepared for storage by mixing said immunoglobulin, which has the desired degree of purity, with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16^th edition, Osol, A. Ed., 1980), in the form of lyophilized formulations or aqueous solutions. Formulations used in vivo are preferably sterile. This is easily achieved by filtration through sterile filtration membranes or other methods. The modified immunoglobulins and other therapeutically active agents disclosed herein may also be formulated as immunoliposomes and / or contained in microcapsules.

The administration of a pharmaceutical composition comprising the modified immunoglobulin of the present invention, preferably in the form of a sterile aqueous solution, may be performed in a variety of ways, including, but not limited to, oral, subcutaneous, intravenous, intranasal, intraotic, transdermal, topical routes (e.g., gels). , ointments, lotions, creams, etc.), or intraperitoneally, intramuscularly, intrapulmonarily (eg, AERx ™ inhalation technology, commercially available through Aradigma, or Inhance ™ pulmonary release system, commercially available through Inhale Therapeutics), vaginal, parenteral, rectal or intraocular.

As used herein, the term "specific binding" refers to a binding reaction, which determines a related ligand of interest, in a heterogeneous population of molecules. Thus, under certain conditions (e.g., immunoassay conditions, in the case of immunoglobulins), the specified antibody binds to its individual "target" and does not bind, in significant amounts, to other molecules present in the sample. Compared with antibody CDRs. modified loop structural regions are protein moieties that bind antigen or molecule, and as such, are not antigens.

50752 Β

The term "expression system" refers to nucleic acid molecules, which contain the desired coding sequence and control sequences in an operative relationship, so that the hosts, which are transformed or transfected with these sequences, are able to produce coded proteins. To act on the transformation, an expression system may be included in the vector; however, the relevant DNA can then also be integrated into the host chromosome.

The expression system may contain a vector. Any expression vector known in the art can, as suitable, be used for this purpose.

The modified immunoglobulin is, preferably, expressed in a host, preferably a bacterial, yeast, plant cell, in an animal cell, or in a plant or animal.

A wide variety of suitable host cells can be used to express the modified immunoglobulin, including, but not limited to, mammalian cells (animal cells), plant cells, bacteria (e.g., Bacillus subtilis, Escherichia coli), insect cells, and yeast. , Pichia pastoris, Saccharomyces cerevisiae). For example, various cell sequences that may find use in the present invention are described in the ATCC cell sequence catalog, available through the American Ture Culture Collection. Further, plants and animals can also be used as hosts for expressing immunoglobulins in accordance with the present invention. Expression as well as transfection vectors or cassettes can be selected according to the host used.

Acellular protein expression systems or cell-free protein expression systems can, of course, be used. Protein expression platforms in vitro transcription / translation, which produce sufficient amounts of protein, provide many benefits of cell-free protein expression, eliminating the need for laborious upstream and downstream steps (e.g., transformation, culturing, or lysing of the host cell) that are commonly associated with expression systems, then cell bases.

An immunoglobulin or pharmaceutical composition thereof, comprising at least one modification in the structural region of the loop of said immunoglobulin and determining the binding of said immunoglobulin to an antigen epitope, wherein the unmodified immunoglobulin does not bind significantly to said epitope, can be produced as follows:

- providing a nucleic acid encoding an immunoglobulin containing at least one loop region,

- by modifying at least one nucleotide residue of at least one of said loop regions,

- by converting said modified nucleic acid into an expression system,

50752 Β

- expressing said modified immunoglobulin,

- contacting the expressed modified immunoglobulin with the epitope,

- determining whether said modified immunoglobulin binds to said epitope, and

- providing binding of the modified immunoglobulin to said epitope and optionally its final incorporation into the pharmaceutical composition.

More specifically, a multispecific immunoglobulin that specifically binds to at least one first molecule, or a pharmaceutical composition thereof, comprising at least one modification in at least one structural region of the loop of said immunoglobulin and that determines the specific binding of said, at least one, region loops with at least one other molecule selected from the group consisting of: allergens, tumor-associated antigens, intrinsic antigens, enzymes, bacterial antigens, fungal antigens, protozoan antigens and viral antigens, wherein the immunogiobulin containing the unmodified structural region of the loop does not bind specifically to said at least one, other molecule , can be produced as follows:

- providing a nucleic acid encoding an immunoglobulin that specifically binds to at least one first molecule, containing at least one structural region of the loop,

- by modifying at least one nucleotide residue of at least one of said loop regions encoding said nucleic acid,

- by converting said, modified nucleic acid into an expression system,

- expressing said modified immunoglobulin,

- contacting the expressed, modified immunoglobulin with said at least one other molecule, and

- determining whether said modified immunoglobulin specifically binds to another molecule, and

- by ensuring that the modified immunoglobulin specifically binds to said, at least one, other molecule and optionally, by its final incorporation into a pharmaceutical composition.

It is desirable to construct more than one specificity in a member of a specific binding pair (Kufer et al. (2004) Trends in Biotechnology vol. 22 pages 238-244).

Numerous ventures have been performed to produce multi-specific, e.g., bispecific, monoclonal antibodies or antibody fragments. One problem in the production of bispecific antibodies, made of two different polypeptide chains (heavy and light chain)

50752 Β there is a need to express four different chains (two heavy and two light chains), in one cell, leading to numerous, different combinations of molecules, which need to be separated from the desired bispecific molecule in the mixture. Due to their similarity, the separation of these molecules is complicated and expensive. Numerous techniques have been used to minimize the occurrence of such unwanted matings (Carter (2001) Joumal of Immunological Methods, vol 248, pp. 7-15).

One solution to the problem is the production of a single polypeptide chain with two specificities, such as two scFvs, linked to each other, or the production of so-called diantibodies. Such molecules have been shown to be far from the fold of a natural molecule, and are generally known to be complicated to produce (LeGall et al. (2004) Protein Engineering, Design & Selection vol. 17, pp. 357-366).

Another problem with the current design of bispecific antibodies is the fact that, even if the parent antibodies are bivalently bound to a single binding partner (e.g., IgG), the resulting bispecific antibody is monovalent to each of the individual binding partners.

Preferred multi-specific molecules of the present invention solve these problems:

It is possible to express a bispecific molecule, as a single polypeptide chain (modified Ig domain with two binding specificities, see section), which is simpler to perform than the expression of two antibody polypeptide chains (Cabilly et al. Proc. Natl. Acad. Sci. USA 81: 3273-3277 (1984)).

It is also possible to produce antibody-like molecules (ie made of 2 polypeptide chains), and due to the fact that the second specificity is located on a non-variable part of the molecule, there is no need for two different heavy chains or different light chains. Therefore, it is not possible to pair the two chains incorrectly.

The antibody of the invention may be composed of a heavy chain and a light chain, which together form a variable region, binding to a specific binding partner, the second specificity may be formed by a modified loop of any of the structural loops or a heavy or light chain. The binding position may also be formed by more than one non-CDR loop, which may be structurally close (either on the heavy chain or on the light chain or on both chains).

The modified antibody or derivative may be a complete antibody or antibody fragment (e.g., Fab, CH1-CH2, CH2-CH3).

It can bind mono- or multi-valently to binding partners or even with different valences to different binding partners, depending on the design.

As there are a large number of different loops, which are available for selecting and designing a specific binding position in non-CDR regions of heavy and light chains,

50752 Β It is possible to design antibody derivatives with even more than two specificities, without the problems mentioned above.

Specific binding domains, within a single polypeptide chain, can be linked to or without a peptide binder.

Some classes of antibodies can be labeled as multi-specific, especially bispecific, by nature: They bind to an antigen (which is usually, for example, either a foreign structure or a structure associated with cancer), with a variable region, and bind to the Fc effector molecule , Fc in part (e.g. Fc receptors on various immune cells or complement protein), thus enabling effects such as: ADCC, ADCP or CDC.

Fc-effector molecules are bound by the Fc portion of immunoglobulin molecules (in IgG1 it is composed of the CH2 and SNZ domains), and a number of methods have been described to optimize effector function by improving the binding of Fc portions of antibody molecules by glycoengineering techniques (US 6,602,684) or protein by engineering directly to Fc (US 2005/0054832) or indirectly by engineering outside Fc (US 2005/02444403). Both Fc region binding to the Fc receptor and / or complement protein binding, such as Cq1, have been altered by such techniques. It is generally sought to improve the binding affinity for such Fc-effector molecules, as it correlates with improved effector functions.

With the present invention, it is possible to design an antibody, which binds to Ffector molecules, outside the natural Fc binding region. Modified loops in non-loop antibody domains that are involved in the natural "binding of an Fcfector molecule" can be selected from the library or designed to bind to one or more Fc-effector molecules. An antibody with such additional binding sites to an Fc-effector molecule would have a stronger propensity for a particular Fc-effector molecule or effector cell, with the Fc-effector molecule exposed, and, for these reasons, may have an even stronger effect than glycoengineering. antibodies or otherwise enhanced Fc regions. However, in certain embodiments of the present invention, the effector characteristics of a given antibody to be modified would not be directly altered, but would remain intact by modification in the structural loop, in accordance with the present invention.

Antibody fragments have certain advantages, compared to whole antibodies. The fragments generally have good bioavailability characteristics and can be more easily produced. However, most of the designed antibody fragments lose effector functions and have a shorter in vivo half-life (Holliger P, et al. Nat Biotechnol. (2005) 23: 1126-36).

None of the CH1, Sk, or CA domains mediate effector functions, which is why Fabs do not exhibit ADCC, ADCP, or CDC. WO

50752 Β

02/44215 describes binding molecules, which consist of an antigen binding position on an antibody and Fc-effector molecules, which bind a peptide. In this way, an antibody fragment can be constructed that exhibits effector functions. The peptide was incorporated into a binding molecule at a position that neither impairs antigen binding nor the ability of the peptide to bind to the Fc-effector molecule.

In accordance with the present invention, however, binding to Fc-effector molecules can be performed with modified immunoglobulin domains, which have been selected for binding to the Fc-effector molecule, from libraries of random loop sequences, within a fixed structure of the immunoglobulin domain. Therefore, it is possible to select specific loop sequences, which would not bind to Fc-effector molecules, outside the structure of the Ig domain. The polypeptides derived from the present invention may, therefore, preferably be composed of more than 100 amino acids.

In order to select the potential effector function of such domains, in accordance with the present invention, from the libraries of mutant CH1, Sk or Ολ domains, those for binding to Fc receptors and / or complement factors, such as C1q, can be selected.

In order to increase the in vivo half-life of a molecule composed of or containing such a domain (e.g. CH1, CH2, SNZ, CH4, Sk or Ολ), which binds to FcRn, the domain can be selected from mutant libraries e.g. CH1-, CH2-, CH3-, CH4-, Sk- or SL-domains, in accordance with the present invention.

Selected FcRn receptors can be provided either on the cell surface, which naturally express the respective receptors, or can be obtained by expressing and purifying the extracellular portion of the corresponding receptor. For the purposes of the present invention, by first screening for FcRn, mutant domains can be selected, which can be further tested in vitro, and even further characterized in FACS experiments, by binding to cells that express the FcRn receptor. They can be further described by classifying the binding affinity for various recombinant FcRn, isoforms and allotypes, e.g., by resonant surface plasmon techniques.

The immunoglobulin of the present invention is of human origin.

Because modified immunoglobulin can be used for various purposes; especially in pharmaceutical compositions, the immunoglobulin is preferably of human origin. Of course, the modified immunoglobulin may also be a chimeric immunoglobulin.

According to another, preferred embodiment of the present invention, the human immunoglobulin is derived from IgG, in particular from IgG1, IgG2, IgG3 or IgG4.

The modified immunoglobulin can be obtained from one of the immunoglobulin classes identified above.

50752 Β

The immunoglobulin preferably contains a heavy and / or light chain of immunoglobulins or a portion thereof.

The modified immunoglobulin may comprise a heavy and / or light chain, at least one variable and / or constant domain.

The immunoglobulin of the present invention comprises at least one constant domain of immunoglobulins or a portion thereof, including a minidomain.

The constant domain is a unit of immunoglobulin folding of the constant part of the immunoglobulin molecule, which is also designated as the domain of the constant region (e.g. CH1, CH2, SNZ, CH4, Sk, Cl).

The preferred immunoglobulin, in accordance with the present invention, is composed of a constant domain, selected from the group consisting of: CH1, CH2, SNZ, CH4, Igk-C, Igl-C, or a portion thereof, including a minidomain, having at least one loop region, characterized in that said at least one loop region comprises at least one amino acid modification , which forms at least one modified loop region, wherein said at least one modified loop region specifically binds to at least one antigen epitope.

The constant domain is selected from the group consisting of CH1, CH2, SNZ or CH4 domains, CL domains, Sk domains, SL, Fab fragments or Fc fragments and combinations thereof.

The modified immunoglobulin, in accordance with the present invention, may contain one or more constant domains (e.g., at least two, three, four, five, six, ten domains). If more than one domain is present in the modified immunoglobulin, these domains may be of the same type or different types (e.g., CH1-CH1-CH2, SNZ-SNZ). Of course, the order of the individual domains can also be of any type (e.g. CH1-CH3-CH2, CH4-CH1-CH3-CH2).

All numerical designations of amino acid sequences of immunoglobulins are in accordance with the IMGT numbering scheme (IMGT, the International ImMunoGeneTics information system@imgt.cines.fr; http://imgt.cines.fr; Lefranc et al., 1999, Nucleic Acids Res. 27: 209-212; Ruiz et al., 2000 Nucleic Acids Res. 28: 219-221; Lefranc et al. 2001, Nucleic Acids Res. 29: 207-209; Lefranc et al., 2003, Nucleic Acids Res. 31 Lefranc et al., 2005, Dev Comp Immunol 29: 185-203).

According to another preferred embodiment of the present invention, the modified loop regions CH1, CH2, SNZ and CH4 comprise amino acids 7 to 21, amino acids 25 to 39, amino acids 41 to 81, amino acids 83 to 85, amino acids 89 to 103 and amino acids 106 to 117.

50752 Β

The Igk-C and Igl-C loop regions of human origin preferably contain amino acids 8 to 18, amino acids 27 to 35, amino acids 42 to 78, amino acids 83 to 85, amino acids 92 to 100, amino acids 108 to 117, and amino acids 123 to 126.

The loop regions of the immunoglobulin variable domain of human origin preferably contain amino acids 8 to 20, amino acids 44 to 50, amino acids 67 to 76 and amino acids 89 to 101.

The amino acid regions of the individual immunoglobulins identified above contain loop regions, which are modified.

The specific binding of the modified immunoglobulin to the molecule was determined by a binding assay selected from the group consisting of: immunoassays, preferably enzyme-linked immunosorbent assays (ELISA), surface plasmon resonance assays, nuclear magnetic resonance imaging spectroscopy and difference spectroscopy NOE transfer spectroscopy (trNOE), competitive assays, tissue binding assays, live cell binding assays, and cell extract assays.

Binding tests can be performed using a variety of methods known in the art, which include, but are not limited to: FRET (Fluorescence Resonance Epegdu Transfer) and BRET-based tests (Bioluminescence Resonance Epegdu Transfer), AlphaScreen.TM. (Amplified Luminescent Proximity Homogeneous Assay), Scintillation Proximity Assay, ELISA (Enzyme-Linked Immunosorbent Assay), SPR (Surface Plasmon Resonance, also known as BIACORE.RTM.), Isothermal titration calorimetry, differential scanning gel chromatography , including gel filtration. These and other procedures may take advantage of some fusion partners or markers.

The modified immunoglobulin is preferably conjugated to a marker selected from the group consisting of: organic molecules, enzyme markers, radioactive markers, colored markers, fluorescent markers, chromogenic markers, luminescent markers, methalidene, haptens, biophenyls, haptens, biophenyls, haptensides, biophenyls, haptensides, biophenyls, haptensites, biophenyls, haptensites, biophenyls gold and their mixtures.

The modified immunoglobulin can be conjugated to other molecules, which allow easy detection of said conjugate, for example, binding assays (e.g. ELISA) and binding studies.

In accordance with a particularly preferred embodiment of the present invention, the immunoglobulin consists of a constant domain, selected from the group consisting of: CH1, CH2, SNZ, CH4, Igk-C, Igl-C, or a portion thereof, including the minidomain, or combinations thereof, with at least one loop region described by

50752 Said at least one loop region comprises at least one amino acid modification that forms at least one modified loop region, said at least one modified loop region specifically binding to at least one antigen epitope.

It is preferred to molecularly combine at least one, modified antibody domain (= that binds to a specific partner via non-variable sequences or a structural loop) with, at least one, other binding molecule, which may be: antibody, antibody fragment, soluble receptor, ligand or other modified antibody domain.

The molecule is selected from the group consisting of: protein molecules, nucleic acids and carbohydrates.

The loop regions of the modified immunoglobulins can specifically bind to any type of binding molecule, especially protein molecules, proteins, peptides, polypeptides, nucleic acids, glycans, carbohydrates, lipids, small organic molecules, inorganic molecules. Of course, the modified immunoglobulins may contain at least two loop regions, each of the loop regions being able to specifically bind to other molecules or epitopes.

In accordance with a preferred embodiment of the present invention, the molecule that binds to the modified structural region of the loop is selected from the group consisting of: tumor-associated antigens, especially EpCAM, tumor-associated glycoprotein-72 (TAG-72), tumor-associated CA 125 antigen, prostate-specific membrane antigen (PSMA), high molecular weight antigen associated with melanoma ), tumor-associated antigen, which expresses Lewis Y-related carbohydrate, carcinoembryonic antigen (CEA), CEACAM5, HMFG PEM, mucin MUC1, MUC18 and tumor-associated cytokeratin antigen, bacterial antigens, viral antigens, allergens, fluorescein lysosome, toll-like receptor 9, erythropoietin, CD2, CD3, CD3E, CD4, CD11, CD11a, CD14, CD18, CD19, CD20, CD22, CD23, CD25, CD28, CD29, CD30, CD33 (p67 protein), CD38, CD40, CD40L, CD52, CD54, CD56, CD80, CD147, GD3, IL-1, IL-1R, IL-2, IL-2R, IL-4, IL-5, IL-6, IL-6R, IL- 8, IL-12, 11-15, IL-18, IL-23, interferon alpha, interferon beta, interferon gamma; TNF-alpha, TNFbeta2, TNF.alpha., TNFalfabeta, TNF-R1, TNF-RII, FasL, CD27L, CD30L, 4-1BBL, TRAIL, RANKL, TWEAK, APRIL, BAFF, LIGHT, VEG1, OX40- L, TRA 1, A1 adenosine receptor, lymphotoxin beta receptor, TACI, BAFF-R, EPO: LFA-3, ICAM-1, ICAM-3, integrin betal, integrin beta2, integrin alpha4 / beta7, integrin alpha2, integrin alpha3, integrin alpha4, integrin alpha5, integrin alpha6, integrin alpha, alphaVbeta3 integrin, FGFR-3, keratinocyte factor growth, VLA-1, VLA-4, L-selectin, anti-1d, E-selectin, HLA, HLA-DR, CTLA-4, T cell receptor, B7-1, B7-2, VNRintegrin, TGFbeta !, TGFbeta2 ,,

50752 Β eotaxin, BLys (B-lymphocyte stimulator), complement C5, IgE, factor VII, CD64, CBL, NCA 90, EGFR (ErbB-1), Her2 / neu (ErbB-2), NegZ (ErbB-3), Her4 (ErbB4), tissue factor, VEGF, VEG-FR, endothelial receptor, VLA-4, carbohydrates, such as blood group antigens and related carbohydrates, Galli-glycosylation, gastrin, gastrin receptors, tumor-associated carbohydrates, hapten NP-drop or kar-car, T cell receptor alpha / beta, E-selectin, digoxin, placental alkaline phosphatase (PLAP) and testicular alkaline phosphatase similar to PLAP, transferrin receptor, heparanase I, human cardiac myosin, glycoprotein IIb / IIa (GPIIb / IIIa), gH envelope glycoprotein of human cytomegalovirus (HCMV, HCMV, HIVM, HCMV, respiratory syncytial virus RSV F, RSVF Fgp, VNRintegrin, Hep B gp120, CMV, gpllbllla, HIV IIIB gp120 V3 loop, respiratory syncytial virus (RSV) Fgp, gD glycoprotein of herpes simplex virus (HSV), HSV gBli gB HCMV envelope glycoprotein, Clostridium perfringens toxin and fragments thereof.

The modified immunoglobulin, in accordance with the present invention, may preferably bind to one of the molecules set out above. These molecules also include allergens.

According to another, preferred embodiment of the present invention, the amino acid residues at positions 15 to 17, 29 to 34, 85.4 to 85.3, 92 to 94, 97 to 98 and / or 10 to 110 SNZ are modified.

Immunoglobulin modification, in accordance with the present invention. deletion, substitution or insertion is preferred.

In accordance with the present invention, at least 1, preferably at least 2, 3, 4, 5, 6, 7, 8, 9, 10 and 15 amino acids are deleted, substituted with other amino acids (also with modified amino acids) or inserted into the region immunoglobulin loops. However, the maximum number of amino acids that are inserted into the region of the immunoglobulin loop may not exceed 30, preferably 25, even more preferably 20 amino acids. Substitution and insertion of amino acids, preferably, take place at random, by methods known in the art and set forth in this patent application.

The immunoglobulin according to the invention is, according to a specific embodiment, characterized in that the SNZ region comprises SEQ ID NO. 16 or SEQ ID NO. 18, when EpCam binds to said immunoglobulin, SEQ ID NO. 20, when, to said immunoglobulin, fluorescein binds, SEQ ID NO. 22, 24, 26, 28, 30 or 32, when lysosome binds to said immunoglobulin, SEQ ID NO. 34, 36, 38 or 40, when TLR9 binds to said immunoglobulin and SEQ ID NO. 42, when lysosome and / or erythropoietin bind to said immunoglobulin.

50752 Β

According to a specific embodiment of the invention, the immunoglobulin is described comprising SEQ ID NO. 44 or SEQ ID NO. 46, when lysosome and gp41 bind to said immunoglobulin.

The modified immunoglobulin is, preferably, conjugated to a label or reporter molecule selected from the group consisting of: organic molecules, enzyme labels, radioactive labels, colored labels, fluorescent labels, chromogenic labels, luminescent metal halidexygenyl labels. metals, colloidal gold and mixtures thereof.

Modified immunoglobulins, which are conjugated to the labels as previously indicated, can be used, for example, in diagnostic procedures.

Another aspect of the present invention relates to the use of an immunoglobulin according to the invention or an immunoglobulin obtainable by a process according to the invention for the manufacture of a vaccine for active immunization. Thus, the immunoglobulin is used as a substance of an antigenic drug, for the formulation of a vaccine, or is used for the search for or acceptance of antigenic structures, for use in the formulation of a vaccine.

Another aspect of the present invention relates to the use of an immunoglobulin according to the present invention, or an immunoglobulin obtainable by a method according to the present invention, for the preparation of a protein library of an immunoglobulin.

The immunoglobulin of the present invention may be used in a method of specific binding and / or detection of molecules, comprising the steps of:

(a) contacting a modified immunoglobulin according to the invention, or a modified immunoglobulin, obtainable by the process according to the invention, with a test sample which is presumed to contain said molecule, and (b) detecting potential formation of a specific immunoglobulin / molecule complex.

The immunoglobulin of the present invention can be used in a method of specifically isolating molecules, comprising the steps of:

(a) contacting a modified immunoglobulin according to the invention, or a modified immunoglobulin obtainable by the process according to the invention, with a sample containing said molecule, (b) separating a specific immunoglobulin / molecule complex, which is formed, and (c) optionally isolating molecules from said complex.

50752 Β

Immunoglobulins, in accordance with the present invention, can be used to specifically isolate molecules from a sample. If multi-specific immunoglobulins are used, more than one molecule may be isolated from the sample. The use of modified immunoglobulins is particularly advantageous in such processes, since it allows, for example, the production of a matrix having a homogeneous surface with a defined amount of binding partners (i.e. modified immunoglobulins), which are immobilized on them, and which are able to bind to molecules, which are released. In contrast, if mono-specific binding partners are used, a homogeneous matrix cannot be produced, since individual binding partners do not bind to the matrix with the same efficiency.

The immunoglobulin of the present invention may be used in a method of targeting a target compound comprising the steps of:

(a) contacting a modified immunoglobulin according to the invention or a modified immunoglobulin obtainable by the process according to the invention, which is capable of specifically binding to said compound, (b) releasing an immunoglobulin / compound complex. according to the target.

Modified immunoglobulins in accordance with the present invention can be used to release at least one compound bound to CDRs and / or modified regions of the target loop. Such immunoglobulins can be used to target therapeutic substances to a desired site of action during the treatment of the disease.

The immunoglobulin according to the invention or the immunoglobulin obtainable by the process according to the invention may be part of a protein library.

Preferred procedures for constructing said library can be found above and in the examples. The library, in accordance with the present invention, can be used to identify immunoglobulins, which bind to a particular molecule.

A protein library comprising an immunoglobulin according to the invention or an immunoglobulin obtainable by the method according to the invention can be used to design immunoglobulin derivatives.

The existing immunoglobulin can be altered to introduce antigen binding sites into any domain or minidomain, using a protein library of a single domain of at least 10, preferably 100, more preferably 1,000, more preferably 10,000, even more preferably 100,000, and most preferably more than 1,000,000 domain variants with at least one modified loop. The library was then tested for specific antigen binding. After a molecular description of the desired characteristics, selected

50752 Β The domain or minidomain is cloned into the original immunoglobulin, by genetic engineering techniques, so that it replaces the wild-type region. Alternatively, only the DNA coding of the loop or the coding of the mutated amino acids can be altered to produce an immunoglobulin with an additional binding site for a specific antigen.

The choice of position for the mutated, antigen-specific structural loop depends on the structure of the original immunoglobulin and the purpose of the additional binding position. If, for example, the original molecule is a complete immunoglobulin, which should have an additional antigen binding position inserted, without disturbing effector function, the loops to be modified would be selected from domains that are distant from CH2 and SNZ, which are natural binding partners. for Fc-effector molecules. If the original immunoglobulin is Fab, it is possible to modify the loops in the constant domains of light chains or heavy chains or in individual variable domains. In order to produce a library, libraries of mutant original molecules can be prepared, which have mutations in one or more structural loops of one or more domains. Selection with complete mutated original molecules may have some advantages, since selection for antigen binding to a modified structural loop will release sterically suitable modifications, if they could be demonstrated by examination of other characteristics of the mutated immunoglobulin.

Requirements for the size (i.e., number of protein variants) of a protein library of a mutated domain or minidomain or domain fusion molecule depend on the task. In general, the library for de novo antigen binding site production needs to be larger than the library used to further modify the already existing, constructed antigen binding site, made of a modified structural loop (e.g. to enhance affinity or change fine specificity for antigen).

The immunoglobulin library and the nucleic acid library comprise a plurality of immunoglobulins, e.g., a constant domain, a minidomain, and / or at least one structural region of a loop, contained in a minidomain or nucleic acid molecule, encoding the same. The library contains members with different modifications, where diversity is defined by modifications in at least one, structural region of the loop. The nucleic acid library preferably includes at least 10 different members (leading to one amino acid substitution), and even more preferably includes at least 100, more preferably 1,000 or 10,000 different members (e.g., designed by random selection strategies or combining techniques). An even more diverse number of individual members is also desirable, such as at least 1,000,000 or at least 10,000,000.

50752 Β

Two different domains or minidomains, selected from at least two libraries, in accordance with the invention, can be used in combination to produce multispecific immunoglobulins. These selected, specific, immunoglobulins can be combined with each other and with other molecules, similar to building blocks, to design the optimal arrangement of domains or minidomains, to obtain the desired characteristics.

Further, one or more modified immunoglobulins, according to the invention, can be introduced at various or all different protein positions, possibly without destroying the protein structure. With this technique of "mixing domains", new libraries have been created, in which the desired characteristics can be re-selected.

The library may contain immunoglobulins, in accordance with the invention, selected from the group consisting of immunoglobulin domains, minidomains or derivatives thereof.

A preferred embodiment of the present invention is an antigen binding molecule (antigen binding molecule) comprising, at least one, an immunoglobulin domain and a structural region of a loop, which is modified in accordance with the present invention to bind to the antigen, wherein said binding molecule does not contains antibody variable domains. It may contain other moieties, which can be used for antibody activity (e.g. such as natural or modified effector regions (sequences); however, it loses the "natural" binding region of the antibody, ie the variable domains in their naturally occurring position. These antigen binding molecules, in accordance with the present invention, have, as described above, advantages for these molecules, even without antibody-specific binding activity: however, with the newly introduced specific binding activity in the structural region of the loop.

Preferably, these antigen binding molecules, in accordance with the present invention, contain CH1, CH2, SNZ, CH4, Igk-C, Igl-C and combinations thereof; said combinations, comprising at least two, preferably at least four, in particular at least six constant domains and, at least one, a structural region of the loop, which is modified in accordance with the present invention. Preferably, these structural loop regions are either linked via a loop structural region, modified in accordance with the present invention, or the structural loops were naturally present between such two constant domains. The embodiment of these antigen binding molecules, in accordance with the present invention, is composed of an Fc region of an antibody with at least one modification in the structural loop, in accordance with the present invention. For antigen binding molecules in accordance with the present invention, it is also preferred that the new antigen binding positions in the structural loops are introduced by random selection techniques, i.e. by modifying one or more amino acid residues of the loop by random techniques or

50752 Β by introducing, randomly produced, inserts into such loop structures. Alternatively, the use of combinatorial approaches is preferred.

The modified immunoglobulin may possess an antigen binding position, which is foreign to the unmodified immunoglobulin and is incorporated into one or more structural loops. The term "foreign" means that the antigen binding site is not naturally formed by a specific immunoglobulin region, and the foreign binding partner, but not the natural binding partner of the immunoglobulin, is bound to the antigen binding site. This means that a binding partner, such as an Fc receptor or an immune system effector, is not considered to bind to an antigen binding site that is foreign to unmodified immunoglobulin.

Preferably, the antigen is selected from the group consisting of: pathogenic antigen, tumor-associated antigen, enzyme, substrate, self-antigen, organic molecule or allergen. More preferred antigens are selected from the group consisting of: viral antigens, bacterial antigens or antigens from eukaryotic or phage pathogens. Preferred viral antigens include: HAV-, HBV-, HCV-, HIV I-, HIV II-, Parvovirus-, Influenza- virus, HSV-, hepatitis viruses, Flaviviruses, VVestnile virus, Ebola virus, smallpox virus, smallpox virus, measles virus, herpes virus , adenovirus, papilloma virus, polio virus, Parvovirus, rhinovirus, Coxsackie virus, Polio virus, Echovirus, Japanese encephalitis virus, dengue virus, borne encephalitis tick virus, yellow fever virus, Coronavirus, respiratory syncytial virus, parainfluenza virus, La Crossence Lassa virus, rabies virus, Rotavirus antigens; preferred bacterial antigens include: Pseudomonas-, Mycobacterium-, Staphylococcus-, Salmonella-, Meningococcus-, Borellia-, Listeria, Neisseria-, Clostridium-, Escherichia-, Legionella-, Bacillus-, Lactobacillus-. Streptococcus-, Enterococcus-, Corynebacterium-. Nocardia-, Rhodococcus-, Moraxella-, Brucella-, Camphylobacter-, Cardiobacterium-, Francisella-, Helicobacter-, Haemophilus-, Klebsiella-, Shigella-, Yersinia-, Vibrio-, Chlamydia-, Leptospira-, Rickettsium- Treponema-, Bartonellaantigene. Preferred eukaryotic antigens of pathogenic eukaryotes include Giardia, Toxoplasma, Cyclospore, Cryptosporidium, Trichinella, Yeast, Candida, Aspergillus, Cryptococcus, Blastomyces, Histoplasma, Coccidoides antigens.

Preferred immunoglobulins in accordance with the present invention comprise at least two antigen binding sites, a first binding site for the first epitope and a second binding site for the second epitope.

According to a preferred embodiment, this immunoglobulin comprises at least two loop regions, a first loop region that binds to the first epitope and a second loop region that binds to the second epitope. At least the first or at least the second region of the loop, or both, may contain a structural loop. Immunoglobulins, according to the present invention, include

50752 Β fragments thereof, known in the art to be functional, which contain essential elements in accordance with the present invention. structural region of the loop, modified in accordance with the present invention.

Preferably, the immunoglobulin according to the present invention is composed of at least two immunoglobulin domains or a portion thereof, including a minidomain, and each domain contains, at least one, antigen binding site.

The immunoglobulin of the invention may comprise, at least one, a constant region domain or a γ portion, including a minidomain. Thus, a variable domain, which is, for example, modified in the C-terminal region, or a variable domain, linked and then a modified CH1 region, for example a modified CH1 minidomain, is one of the preferred embodiments.

The preferred immunoglobulin according to the invention comprises a domain having at least 50% homology to the unmodified domain.

The term "homology" means that the polypeptides have the same or preserved residues at the appropriate position in their primary, secondary or tertiary structure. The term also extends to two or more nucleotide sequences, which encode homologous polypeptides.

"Homologous immunoglobulin domain means an immunoglobulin domain, according to the invention, having at least about 50% amino acid sequence identity, with respect to the full length of the native sequence of the immunoglobulin domain sequence or any other fragment of the full length sequence of the immunoglobulin domain, as set forth herein. Preferably, the homologous immunoglobulin domain will have at least about 50% amino acid sequence identity, preferably at least about 55% amino acid sequence identity, more preferably at least about 60% amino acid sequence identity, more preferably at least about 65% identity

<td>amino acids</td><td>sequence,</td><td>MORE</td><td>more preferably</td><td>least</td><td>eye</td><td> 70%</td><td>identity</td>

<td>amino acids</td><td>sequence,</td><td>more</td><td>more preferably</td><td>least</td><td>eye</td><td> 75%</td><td>identity</td>

<td>amino acids</td><td>sequence,</td><td>more</td><td>more preferably</td><td>least</td><td>eye</td><td> 80%</td><td>identity</td>

<td>amino acids</td><td>sequence,</td><td>more</td><td>more preferably</td><td>least</td><td>eye</td><td> 85%</td><td>identity</td>

<td>amino acids</td><td>sequence,</td><td>more</td><td>more preferably</td><td>least</td><td>eye</td><td> 90%</td><td>identity</td>

<td>amino acids</td><td>sequence,</td><td>more</td><td>more preferably</td><td>least</td><td>eye</td><td> 95%</td><td>identity</td>

<td>amino acids</td><td>sequences are</td><td colspan="5">native immunoglobulin sequence</td><td>domain or</td>

any other specifically defined fragment of the full-length immunoglobulin domain sequence, as defined above.

The "percentage (%) identity of the amino acid sequence" in relation to the immunoglobulin domain sequence identified herein is defined as the percentage of amino acid residues in the candidate sequence that is identical to the amino acid sequence.

50752 Β residues in a specific sequence of the immunoglobulin domain, after sequence sorting and introduction of cavities, if necessary, to achieve the maximum percentage of sequence identity, and not considering any conservative substitutions as part of the sequence identity. Classification for the purpose of determining the percentage of amino acid sequence identity, can be reported in various ways, which are included in the scope of knowledge in this field, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR ) software. Those skilled in the art can determine suitable classification measurement parameters, which include any algorithms needed to achieve maximum classification, over the full length of the sequences being compared.

Values ​​for% amino acid sequence identity can be obtained, as described above, using a VVU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). The largest number of VVU-BLAST-2 research parameters is given in the form of mismatch values. Those that are not given as mismatch values, ie adjustable parameters are given with the following values: overlap spacing = 1, overlap fraction = 0.125, word threshold (T) = 11, and notation matrix = BLOSUM62. When WU-BLAST-2 is used, the value of the% amino acid sequence identity is determined by dividing (a) the number of identical amino acid residues, which agree, between the amino acid sequence of the immunoglobulin domain of interest, having the sequence derived from the native immunoglobulin domain and the amino acid significance, which is compared (ie, the sequence with which the immunoglobulin domain of importance is compared, which may be an unmodified immunoglobulin domain), as determined by WUBLAST-2, with (b) the total number of amino acid residues of the non-randomized portions of the immunogiobulin domain of interest. For example, in the claim "a polypeptide comprising amino acid sequence A having or possessing at least 80% amino acid sequence identity with amino acid sequence B", amino acid sequence A is a comparison of the amino acid sequence of interest and the amino acid sequence of the immunoacid sequence is significance.

The immunoglobulin of the present invention can be used for any of the immunoglobulin uses known in the art, but it also allows applications that depend on the combinations of specificities presented by the present invention. Consequently; immunoglobulins, in accordance with the present invention, are preferably used for therapeutic and prophylactic use (e.g. as active or passive immunotherapy); for preparative and analytical use and for diagnostic use.

The immunoglobulin of the present invention may be used in a binding partner kit, comprising:

50752 Β (a) a modified immunoglobulin, having an antigen binding position, foreign to the immunoglobulin, which is included in one or more structural loops, and (b) a binding molecule, which contains an epitope of said antigen.

Such a binding molecule of this kit, in accordance with the present invention, can be used to identify the binding specificity of a modified immunoglobulin, in accordance with the present invention. Using the binding molecule of this kit in accordance with the present invention, the potency of the modified immunoglobulins in accordance with the present invention can be determined.

Strength, as defined herein, is the binding property of a modified molecule to its antigen. Binding can be determined quantitatively and / or qualitatively by determining specificity and / or affinity and / or attractiveness, as used for quality control purposes.

Further, the binding molecule of the kit according to the invention can be used to select a modified immunoglobulin according to the invention from a library consisting of at least 10, preferably at least 100, more preferably at least 1,000, even more preferably at least 10,000. , and in particular at least 100,000 immunoglobulins with various modifications in the structural loops.

According to the present invention, one of the key features of the present invention is that the construction of immunoglobulin domains occurs in regions, which are not normally involved in antigen binding, in other words, in regions, which are not antibody CDRs. It has been observed that the specific folding of immunoglobulin domains allows the introduction of random mutations into regions, which are structurally analogous to CDRs, but differ in position in the sequence. The regions identified by the present invention are, similar to CDRs, loop regions, which connect the beta strands of the immunoglobulin fold.

More specifically, it is described herein that, by introducing random mutations into the loops linking the beta strands of the AB and EF SNZ domains of the human IgG1, mutated SNZ domains, which specifically bind to the Toll-like 9-peptide receptor (TLR9) or to chicken lysosis, were selected. egg, which is a peptide or protein, when the SNZ domains of human IgG1 are not normally recognized or bound. The mutations we have introduced include mutations, in which selected amino acid residues in the wild-type sequence are replaced by randomly selected residues, and they also involve the insertion of extra amino acid residues into the above-mentioned loops.

By analogy, immunoglobulin domains from any class of immunoglobulins and from immunoglobulins of any type are subject to this type of engineering. Furthermore, not only can the specific loops targeted in the present invention be manipulated, but,

50752 Β In the same way, it can manipulate any loop, which connects beta strands in immunoglobulin domains.

Constructed immunoglobulin domains from any organism and from any class of immunoglobulins can be used, in accordance with the present invention, either as such (as individual domains) or as part of a larger molecule. For example, they may be part of an intact immunoglobulin, which would consequently have its own "normal" antigen binding region, formed by 6 CDRs and a new, engineered, antigen binding region. Similarly, multi-specific, e.g. bispecific, immunoglobulin. The constructed immunoglobulin domains can also be part of any fusion protein. The use of these constructed immunoglobulin domains is in the general field of use of immunoglobulins.

Here, the immunoglobulin domains are the domains of the following immunoglobulins:

for IgG, IgD and IgA: VL, CL, VH, CH1, CH2, SNZ for IgM and IgE: VL, CL, VH, CH1, CH2, SNZ, CH4

1. Individual immunoglobulin domains, randomly selected on one arm, ie in loops, connecting the beta-strands BC, DE or FG ("peak", with the exception of the variable domains, which are covered by numerous patents) or beta-strands AB, CD, (CC) 'and C ”-D, in the case of variable domains) or EF (“ basis ”). Individual loops, or any combination of loops, can be randomly selected. Residues can be modified or deleted or additional residues can be inserted.

2. Individual immunoglobulin domains, randomly selected on both arms, at the apex and at the base.

3. any protein, containing one of the single, random domains, such as:

a) “single-chain SNZ” dimers (scCH3), scCH2, scCH1 / CL, randomly selected on one or both arms

b) single-chain Fv, randomly selected on the “base”, ie on the side opposite to the CDRs

c) Fab fragments, randomly selected on a “basis”, ie at the C-terminal end of the CH1 and CL domains

d) Fc fragments (ie proteins composed of CH2-CH3), randomly selected on one or both arms

e) complete immunoglobulins, randomly selected on the basis of Fc

f) other suitable domains.

The primary advantages of individual domains are: they are very similar to all the arguments used to promote camel VH molecules ("nanobodies", see

50752 Β www.ablynx.com). Randomly selected immunoglobulin domains are very small proteins (molecular weight approx. 12-15 kDa, depending on the number of amino acid residues inserted), and will therefore have the following advantages, compared to conventional antibodies or antibody fragments, such as scFv and Fab: recognition of unusual or hidden epitopes, binding to cavities or active positions of protein targets, ease of production, and many other benefits. In the case of an immunoglobulin domain, which is randomly selected on both arms, a divalent or bispecific molecule can be produced. The main advantages of individual domains as part of fusion proteins are that, on any other protein, additional binding characteristics can be built.

It is believed that any expression system can be used to make the protein. Analogs of individual domains, as described herein, can be found in camel antibodies, which have only VH and not VL. In these proteins, only 3 CDRs (instead of 6 as in “normal antibodies”) are responsible for antigen binding.

The following patent references are incorporated herein by reference in their entirety:

US 6,294,654 Modified immunoglobulin molecule, which includes antigen in non-CDR region of loop

US 5,844,094 Target binding polypeptide

U.S. Pat. No. 5,395,750 Processes for the production of proteins, which bind to predetermined antigens

US 2004/0071690 High potency polyvalent and polyspecific reagents US 2004/0018508 Antibody surrogate and methods for their preparation and use US 2003/0157091 Multi-functional proteins

US 2003/0148372 Methods for screening libraries of excreted phages, with different ligands

US 2002/0103345 Bispecific immunoglobulin-like antigen binding proteins and production methods

US 2004/0097711 Immunoglobulin superfamily proteins

US 2004/0082508 Secretory proteins

US 2004/0063924 Secretory proteins

US 2004/0043424 Immunoglobulin Superfamily Proteins

U.S. Pat. No. 5,892,019 Production of single-genome-encoded immunoglobulin

US 5,844,094 Target binding polypeptide

The present invention is further illustrated by, but not limited to, the following figures and examples.

50752 Β

Figure 1a shows the structure of intact IgG1. Domains are marked with arrows.

Figure 1b illustrates the structural organization of monomers of the major human immunoglobulin isotype. Disulfide bonds are shown as lines, N-linked carbohydrate groups are shown as circles.

Figure 2 shows the immunoglobulin fold for the constant (left) and variable (right) domains of the immunoglobulin. Beta waists are marked with arrows.

Figure 3 shows a molecular model of the SNZ domain constructed in accordance with the present invention, with a randomly selected portion, labeled with a solvent access surface. The surface is rounded.

Figure 4 shows a schematic representation of PCRs, used to produce fragments, which were used to assemble the mutated SNZ domain. PCR primers are indicated by arrows, which refer to their 5'-3 'orientation, and vertical lines indicate the approximate positions of the introduced restriction positions, which were used to match the mutated gene. The following restriction sites are contained on the primers for binding PCR fragments; CH3LNCO: Ncol; CH3LSAC and CH3CSAC: Sacl; CH3CHIN and CH3RHIN: HindIII; CH3RNOT: Notl.

Figure 5 shows some examples of how the current application immunoglobulin domains can be used. Random regions are indicated by a star symbol. The specifics of random regions in a single molecule can be identical or different.

Figure 6 shows a schematic presentation of the design of a constructed, bispecific SNZ domain. The names of the primers are given in squares, and the arrows indicate the direction in which the primers are extended. Squares with oblique lines indicate the corresponding positions of the region, which are randomly selected in this construction, squares with vertical lines indicate the corresponding positions of the region, which were introduced for the production of clone C24, and restriction positions are given, which were used for the cloning process.

Figure 7 shows a schematic representation of the design of a constructed, bispecific SNZ domain. The nucleotide sequence and its translation are shown in the basic design of the constructed, bispecific SNZ domain. Red sequences denote random regions, to produce a bispecific construct, while green squares indicate regions in which the sequence was randomly selected to produce clone C24.

Figure 8 shows a listing of the sequences set forth herein.

DESCRIPTION OF SPECIFIC EXAMPLES.

Example 1: Construction of the SNZ library and exposure of the phage surface

50752 Β

The crystal structure of the Fg fragment of IgG1, published in the Brookhaven database with input 1OQO.pdb, was used, as an aid, in the design of the mutated SNZ domain,

The sequence, which was used as the basis for constructing the SNZ library, is given in SEQ ID No. 1. In this sequence, the first amino acid corresponds to Proline 343 of the A chain of the Brookhaven database with input 1oqo.pdb. The last residue, contained in 1oqo.pdb, is Serine 102 SEQ ID No.1. After a detailed analysis of the structure of 1oqo.pdb and visual inspection of the residues that form the loops that connect the beta waists, it was decided to randomly select residues 17, 18 and 19, which are part of the loop that connects the beta waist AB, as well as 71, 72 , 73, 76 and 77, which are part of the loop, which connects the beta waist EF SEQ ID No. 1. A molecular model of the constructed SNZ domain, with a randomly selected portion, labeled with a solvent access surface, is shown in Figure 3. The constructed gene was produced by a series of PCR reactions, which were followed by linking the resulting PCR products. To facilitate binding, some of the codons of the nucleotide sequence, encoding SEQ ID No. 1, have been modified to produce restriction positions without altering the amino acid sequences (silent mutations). For insertion into the cloning vector pHEN1 (Nucleic Acids Res. 1991 Aug 11; 19 (15): 4133-7. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G.) in a framework with pelB secretion signal, extra nucleotide residues, which encode Met-Ala were attached to the 5 'end of the sequence, to create an Ncol restriction position . For random residues, the codon NNS (IUPAC code, where S means C or G) was chosen, which encodes all 20 amino acids, which exist in nature, and avoids 2 of the 3 stop codons. The constructed sequence is given as the nucleotide sequence in SEQ ID NO. 2, and as the amino acid sequence in SEQ ID NO. 3. The letter X in SEQ ID no. 3 denotes random amino acid residues. The PCR primer sequences, which were used to match the mutated SNZ domain, are given in SEQ ID Nos. 4 to 9. Figure 4 shows a Schematic representation of PCR fragments, produced to assemble the mutated gene, and, for these purposes, the primers used.

Human monoclonal antibody heavy chain cDNA 3D6 (Felgenhauer M, Kohl J, Rucker F. Nucleotides sequences of cD-NAs, encoding the V-regions of H- and L-chams of a human monoclonal antibody specific to HIV-1-gp41. Nucleic Acids Res. 1990 Aug 25; 18 (16): 4927) was used as a mold for PCR reactions. 3 PCR products were digested with SacI and / or HindIII, respectively, and linked together. The binding product is further, digested with Ncol and Noti and linked in the phagemid vector pHEN1 to the exposed surface, which was previously digested with Ncol and Notl. Number of selected

50752 Β Clones were controlled by restriction analysis and DNA sequencing, and were found to contain the insert, as planned, including correctly inserted random sequences. For the next phage preparation steps, standard protocols were followed. Briefly, the binding mixture was transformed into E. coli TG1 cells, by electroporation. Thereafter, phage particles were released from E. coli TG1 cells with helper phage M13-KO7. Phage particles were then precipitated from the culture supernatant with PEG / NaCl in 2 steps, dissolved in water and used for selection by preparation or, alternatively, stored at minus 80 ° C.

Example 2: Construction of SNZ + Z library

This library was constructed and cloned in the same way as the SNZ library. The amino acid sequence is given in SEQ ID NO. 10, the corresponding nucleotide sequence in SEQ ID NO. 11, and the primers used for construction were in SEQ ID NO. 4-7, SEQ ID NO. 9 and SEQ ID no. 12.

Example 3: Construction of SNZ + 5 library

This library was constructed and cloned in the same way as the SNZ library. The amino acid sequence is given in SEQ ID NO. 13, the corresponding nucleotide sequence in SEQ ID №. 14, and the primers used for construction were in SEQ ID №. 4-7, SEQ ID №. 9 and SEQ ID no. 15.

Example 4: Obtaining a SNZ-phage library on a TLR-9 peptide

In accordance with standard protocols, 3 preparation rounds were performed. In short, the following procedure was applied. The 96-well Maxisorp plates (Nunc) were coated with a synthetic peptide, which is part of the Toll-like Receptor 9 (TLR-9) sequence. To each well was added 200 μl of the following solution: 0.1 M Na carbonate buffer, pH 9.6, with the following concentrations of dissolved peptide:

1. preparation cycle: 1 mg / ml TLR-9 peptide

2. circle of obtaining. 500 pg / ml TLR-9 peptide

3. preparation cycle: 100 pg / ml TLR-9 peptide

Incubation was continued for 1 hour at 37 ° C, followed by blocking with 2% milk powder (M-PBS) at 200 [mu] l per well, for 1 hour, at room temperature.

The surface-exposed phage library was then allowed to react with the bound peptide, adding 100 μΙ phage suspension and 100 μΙ 4% milk powder (MPBS), followed by incubation for 45 minutes, with shaking, and for 90 minutes, without shaking, at room temperature.

Unbound phage particles were removed by washing as follows. After the first round of preparation: 10 x 300 μΙ T-PBS, 5x 300 μΙ PBS; after the second round

50752 Β preparations: 15 χ 300 μΙ T-PBS, 10χ 300 μΙ PBS; after the third round of preparation: 20 χ 300 μΙ T-PBS, 20χ 300 μΙ PBS.

Elution of bound phage particles was performed by adding 200 μΙ, per well, 0.1 M glycine, pH 2.2, and incubating, shaking, for 30 minutes at room temperature. Thereafter, the phage suspension was neutralized by the addition of 60 μ M 2 M Trisbase, followed by infection in E. coli TG1 cells, mixing 10 ml of exponentially growing culture with 0.5 ml of eluted phages and incubating for 30 minutes at 37 ° C. Finally, infected bacteria were plated on ΤΥΕ medium with 1% glucose and 100 pg / ml ampicillin, and incubated at 30 ° C overnight.

Table 1: Results of obtaining SNZ - phage library on TLR-9 peptide (Phage titers)

<td>Circle of obtaining</td><td>Concentration gaining</td><td>TLR-9 at</td><td>Input (phage / ml)</td><td>Output (phage / ml)</td>

<td> 1.</td><td colspan="2">1 mg / ml</td><td>6x10¹⁸</td><td>2x10¹°</td>

<td> 2.</td><td colspan="2">0.5 mg / ml</td><td>4x10¹⁶</td><td>2x10¹°</td>

<td> 3.</td><td colspan="2">0.1 mg / ml</td><td>4x10^2ž</td><td>6x10¹⁰</td>

Example 5: Cloning of selected SNZ mutant clones, selected according to TLR-9, for soluble expression

Phage hemid DNA from phage, which was selected through 3 preparation rounds, was isolated using midi-prepa. The DNA, which encodes mutated SNZ regions, was serially amplified by PCR and cloned with Ncol-Not1 into the pNOTBAD / Myc-His vector, which is the E. coli expression vector pBAD / Myc-His (Invitrogen) with the inserted Notl restriction position, to facilitate cloning. The associated constructs were transformed into E cells. coli LMG194 (Invitrogen) by electroporation, and grown at 30 ° C, on ΤΥΕ medium with 1% glucose and ampicillin, overnight. Selected clones were inoculated into 200 μΙ 2xYT medium with ampicillin, grown overnight at 30 ° C, and induced by the addition of L-arabinose to a final concentration of 0.1%. After expression at 16^eC, overnight, cells were harvested by centrifugation and treated with 100 μΙ Na-borate buffer, pH 8.0, at 4 ° C overnight to produce periplasmic extracts. 50 μ! periplasmic extracts were used for the ELISA test (see below).

Example 6 ELISA Assay SNZ mutants, selected according to TLR-9, examined the specific binding of selected clones to the TLR-9 peptide by ELISA assay.

50752 Β

Sheath: Microtiter plate (NUNC, Maxisorp), 100 μl per reaction cup, 20 pg TLR-9 peptide / ml 0.1 M Na carbonate buffer, pH 9.6, 1 h at 37 ° C

Rinsing: Zh 200 μΙ PBS

Blocking: 1% BSA-PBS, 1 h at RT

Rinsing. 3 x200 pl PBS

Binding of periplasmic extract: 50 μΙ periplasmic extract 50 μΙ 2% BSA-PBS, at room temperature, overnight

Rinsing: Zh 200 μΙ PBS

1. antibody: anti-His4 (Qiagen), 1; 1000 in 1% BSA-PBS, 90 min at RT, 100 μΙ per well

Rinsing: Zh 200 μΙ PBS

2. antibody: goat anti mouse * HRP (SIGMA), 1: 1000 in 1% BSA-PBS, 90 min at RT, 100 μ! per pit

Rinsing: Zh 200 μΙ PBS

Detection: 3 mg / ml OPD in bla citrate / phosphate buffer, pH 4.5, 0.4 μΙ 30% H₂Oh₂

Stoppage: 100 ml ZM H₂SO₄ absorbance reading: 492/620 nm

Clones, which gave a high signal in the first, preliminary ELISA assay, were cultured in a 20-ml volume, under the same conditions as described above. Their periplasmic extracts were isolated in 1/20 of the culture volume, as previously described, and examined by ELISA (as previously described) for confirmation.

Table 2: ELISA confirmation results

<td></td><td>with antigen</td><td>without antigen</td>

<td>clone</td><td>A492 / 620 4 readings</td><td>A492 / 620 1 Reading</td>

<td>A67</td><td> 0.0435</td><td> 0.019</td>

<td>clone</td><td>A492 / 620 4 readings</td><td>A492 / 620 1 reading</td>

<td>B54</td><td> 0.0937</td><td> 0.051</td>

<td>C67</td><td> 0.0295</td><td> 0.013</td>

<td colspan="3">Background (antigen alone) (12 parallel readings): 0.0115</td>

50752 Β

Example 7: Obtaining a library of SNZ and SNZ + 5 - phage on chicken egg lysozyme

3 rounds were obtained. Maxisorp 96-well plates (Nunc) were coated with chicken egg lysozyme, by adding 200 μΙ of the following solution, per reaction beaker:

PBS, with the following concentrations of dissolved chicken egg lysozyme:

1. preparation cycle: 2 mg / ml HEL

2. preparation cycle: 1 mg / ml HEL

3. preparation cycle: 1 mg / ml HEL

Incubation was continued for 1 hour at 37 ° C, followed by blocking with 2% milk powder (M-PBS) at 200 μΙ per well, for 1 hour, at room temperature.

The library of surface exposed phages was then allowed to react with bound chicken egg lysozyme, adding 100 μΙ phage suspension and 100 μΙ 4% milk powder (M-PBS), followed by incubation, for 45 minutes, with shaking, and for 90 minutes. , without shaking, at room temperature.

Unbound phage particles were removed by washing as follows:

First round of preparation: 10 x 300 μ-T-PBS, 5x 300 μΙ PBS

Second round of preparation: 15 x 300 μΙ T-PBS, 10x 300 μΙ PBS

Third round: 20 x 300 μΙ T-PBS, 20 x 300 μΙ PBS

Elution of bound phage particles was performed by adding 200 μΙ, per well, 0.1 M glycine, pH 2.2, and incubating, shaking, for 30 minutes at room temperature. Thereafter, the phage suspension was neutralized by adding 60 μΙ 2 M Trisbase, followed by infection in E. coli TG1 cells, mixing 10 ml of exponentially growing culture with 0.5 ml of eluted phages and incubating for 30 minutes at 37 ° C. Finally, infected bacteria were plated on ΤΥΕ medium with 1% glucose and 100 pg / ml ampicillin, and incubated, at 30 ° C, overnight.

Table 3: Results of obtaining the SNZ phage library on chicken egg lysozyme (Phage titers)

<td>Circle of obtaining</td><td>HEL concentration in production</td><td>Input (phage / ml)</td><td>Output (phage / ml)</td>

<td> 1.</td><td>2 mg / ml</td><td></td><td>4.7x10¹°</td>

<td> 2.</td><td>1 mg / ml</td><td>1.2 9x10^ž2</td><td>8.0x10⁹</td>

<td> 3.</td><td>1 mg / ml</td><td>5.71x10²⁰</td><td>4.8x10^w</td>

Table 4: Results of obtaining the SNZ library + 5 phages on chicken egg lysozyme (HEL) (phage titers)

50752 Β

<td>Circle of obtaining</td><td>HEL concentration in production</td><td>Input (phage / ml)</td><td>Output (phage / ml)</td>

<td> 1.</td><td>2 mg / ml</td><td>8.3x10^lb</td><td>29xTo^y</td>

<td> 2.</td><td>1 mg / ml</td><td>2.1x10¹⁹</td><td>2.6x10⁹</td>

<td> 3.</td><td>1 mg / ml</td><td>5.4x10^{, b}</td><td>1.2x10 '°</td>

Example 8: Cloning of Selected Clones of Example 7 for Soluble Expression Cloning of selected clones for soluble expression was performed as described previously for SNZ mutants selected according to TLR-9.

Example 9: Soluble expression of selected clones of Example 7

Soluble expression of selected clones was performed as previously described for SNZ mutants selected according to TLR-9. Periplasmic extracts were examined by a preliminary ELISA assay (for example see Example 10).

Clones, which gave a high signal in the first, preliminary ELISA assay, were cultured in 20-ml volume under the same conditions as described above. Their periplasmic extracts were isolated in 1/20 of the culture volume, as previously described, and examined by ELISA (as described in Example 10) for confirmation.

Example 10: ELISA test of SNZ mutants selected according to chicken egg lysozyme

Sheath: Microtiter plate (NUNC, Maxisorp), 100 μΙ per well, 100 pg chicken egg lysozyme / ml in PBS, 1 h at 37'C

Rinsing: Zh 200 μΙ PBS

Blocking: 1% BSA-PBS, 1 h at RT

Flushing: 3 x 200 μΙ PBS

Binding of periplasmic extract: 50 μΙ periplasmic extract 50 μΙ 2% BSA-PBS, then room temperature, overnight

Rinsing: Zh 200 μΙ PBS

1. antibody: anti-His4 (Qiagen), 1: 1000 in 1% BSA-PBS, 90 min at RT,

100 μ I per pit

Rinsing: Zh 200 μΙ PBS

2. antibody: goat anti mouse * HRP (SIGMA), 1: 1000 in 1% BSA-PBS, 90 min at RT (room temperature), 100 μΙ per well

Rinsing: Zh 200 μΙ PBS

Detection: 3 mg / ml OPD in Na citrate / phosphate buffer, pH 4.5, 0.4 μΙ 30%

H₂Oh₂

Stoppage: 100 ml ZM H₂SO₄

50752 Β

Absorbance reading: 492/620 nm

Table 5: Results of ELISA confirmation S_n3 mutants, selected according to the lysozyme of the hen’s egg

<td></td><td>with antigen</td><td>without antigen</td>

<td>clone</td><td>A492 / 520 4 readings</td><td>A492 / 620 1 reading</td>

<td>B12</td><td> 0.396</td><td> 0.012</td>

<td>D10</td><td> 0.415</td><td> 0.026</td>

<td>D46</td><td> 0.398</td><td> 0.011</td>

<td colspan="3">Background (antigen alone) (12 parallel readings): 0.1763</td>

Table 6: Results of ELISA confirmation with dilutions of SnZ mutant antigens, selected according to chicken egg lysozyme

<td>c (pg / ml) clone</td><td> 200</td><td> 100</td><td> 50</td><td> 25</td><td> 12.5</td><td> 6.25</td><td> 3.125</td><td> 1.55</td><td> 0.78</td><td> 0.39</td>

<td>B12</td><td> 0.707</td><td> 0.532</td><td> 0.432</td><td> 0.297</td><td> 0.192</td><td> 0.150</td><td> 0.148</td><td> 0.049</td><td> 0.034</td><td> 0.015</td>

<td>D46</td><td> 0.713</td><td> 0.561</td><td> 0 342</td><td> 0.220</td><td> 0.133</td><td> 0.088</td><td> 0.047</td><td> 0.032</td><td> 0.021</td><td> 0.010</td>

<td>D10</td><td> 0.715</td><td> 0.685</td><td> 0.571</td><td> 0.368</td><td> 0.231</td><td> 0.175</td><td> 0.171</td><td> 0.068</td><td> 0.047</td><td> 0.026</td>

<td>- (nc)</td><td> 0.449</td><td> 0.360</td><td> 0.165</td><td> 0.072</td><td> 0.038</td><td> 0.023</td><td> 0.017</td><td> 0.013</td><td> 0.009</td><td> 0.007</td>

<td colspan="11">ps: no periplasmic extract added</td>

It has been observed that chicken egg lysozyme reacts with anti-his₄ antibody, which is why a relatively high background was observed.

Table 7: Results of ELISA certification C_H3 + 5 mutants, selected according to hen egg lysozyme

<td></td><td>with antigen</td><td>without antigen</td>

<td>clone</td><td>A492 / 620 4 readings</td><td>A492 / 620 1 reading</td>

<td>A13</td><td> 0.197</td><td> 0.016</td>

<td>A66</td><td> 0.461</td><td> 0.019</td>

<td>B18</td><td>0.533 (5 readings)</td><td>not done</td>

<td>B20</td><td> 0.184</td><td> 0.016</td>

<td>B68</td><td> 0.535</td><td> 0.019</td>

<td>B40</td><td> 0.706</td><td> 0.051</td>

<td>C24</td><td> 0.352</td><td> 0.072</td>

<td>D22</td><td> 0.147</td><td> 0.019</td>

<td>C22</td><td> 0.439</td><td> 0.017</td>

<td>D37</td><td> 0.360</td><td> 0.026</td>

<td>D40</td><td> 0.559</td><td> 0.034</td>

<td>D56</td><td> 0.396</td><td> 0.019</td>

<td colspan="3">Background (antigen alone) (12 parallel readings): 0.1334</td>

<td>Note: lysozyme</td><td>the hen's egg reacts</td><td>with anti-his₄ antibody,</td>

<td colspan="3">which is why a relatively high background is observed.</td>

50752 Β

Example 11: CL library

Visual inspection of the crystal structure of the Fab fragment (the structure of the Fab human monoclonal antibody 3D6 was used: RSCB Protein Data Bank (http://www.rcsb.org/pdb/) with input 1DFB.PDB (He HM, et al. Proc Natl Acad Sci USA. 1992 Aug 1,89 (15): 7154-8) and computer-assisted analysis (e.g., Protein Explorer was used for this purpose (http://molvis.sdsc.edu/protexpl/frntdoor.htm)) secondary and tertiary structure of this protein) allow the identification of residues, ionized in the regions of the loop, which connect the beta-strands of the CL-domain. These residues contain amino acids 8 to 18, amino acids 27 to 35, amino acids 42 to 78, amino acids 83 to 85, amino acids 92 to 100, amino acids 108 to 117 and amino acids 123 to 126 (numbering according to the IMGT number system (Lefranc MP, et al. Nucleic Acids Res. 2005 Jan 1.33 (database edition): D593-7; Lefranc MP, et al. Dev Comp Immunol. 2005; 29 (3): 185-203)).

More specifically, residues 11, 12, 14-18 and 92-95 were randomly selected within the human CL domain (SEQ ID No. 48). Random selection was performed by PCR amplification of coding sequences with PCR primers, in which the positions of the relevant codons were encoded by the nucleotide sequence 5'-NNS-3 ', which potentially encodes all 20 amino acids, avoiding 2 of the 3 stop codons. The insert from the library was amplified by two separate PCR reactions, and the two PCR fragments were linked together via the HpyCH4IV restriction site, which was introduced as a silent mutation, by PCR primer. The primers further provide restriction endonuclease sites of Ncol and Notl, respectively, for cloning into the vector of the detected phage pHEN (Hoogenboom HR, et al. Nucleic Acids Res. 1991 Aug 11; 19 (15): 4133-7). The terminal cysteine ​​of the CL domain is not involved in phage exposure, but may be added later, when a modified CL kion is used, e.g. to construct a Fab fragment.

As a mold for PCR amplification, a plasmid such as pRcCMV3D6LC (Ruker F, et al. Ann NY Acad Sci. 1991 Dec 27; 642: 212-9) was used, which contains, as an insert, a complete light chain of a human monoclonal antibody.

For the CL + 3 (SEQ ID No. 50, 51) and CL + 5 (SEQ ID No. 52, 53) libraries, which contain additional residues inserted between positions 92 and 95 of the CL domain, primers CLRHPY3 and CLRHPY5, respectively, were used. instead of CLRHPY primer.

The nucleotide and amino acid sequence of the final PCR and binding product, which is cloned into the Ncol position of pHEN1, which results in the attachment of the leader of the pelB sequence to the N-terminus of the construct, is shown below (SEQ ID No. 48, 49):

50752 Β + 3 Μ Κ Υ LLPT Α Α Α GLL LLAi

ATGAAATACC TATTGCCTAC GGCAGCCGCT GGATTGTTAT TACTCGCGGf

Ncol + 3 QPA V Α V AAPS VFI FPP

CCAGCCGGCC ATGGCCGTGG CTGCACCATC TGTCTTCATC TTCCCGCCAT + 3S Q ASVVCLLN

101 CTNNSNNSCA GNNSNNSNNS NNSNNSGCCT CTGTTGTGTG CCTGCTGAAT + 3 NFYPR Ε A KVQ W Κ V DNAL

151 AACTTCTATC CCAGAGAGGC CAAAGTACAG TGGAAGGTGG ATAACGCCCT +3 QSG NSQ ESVT EQD SKD

201 CCAATCGGGT AACTCCCAGG AGAGTGTCAC AGAGCAGGAC AGCAAGGACA

HpyCH4IV + 3STY SLSSTLTL YE

251 GCACCTACAG CCTCAGCAGC ACCCTGAC6T TGNNSNNSNN SNNSTACGAG + 3 KHK VYAC Ε VTHQG LSSP

301 AAACACAAAG TCTACGCCTG CGAAGTCACC CATCAGGGCC TGAGCTCGCC

Notl + 3 VTK SFN RGEA AA

351 CGTCACAAAG AGCTTCAACA GGGGAGAGgC GGCCGCk

List of primers for the CL library:

cllnco: 5'-cttaccatgg ccgtggctgc accatctgtc ttcatcttcc cgccatctnn snnscagnns nnsnnsnnsn nsgcctctgt tgtgtgc-Z '(SEQ ID No. 56) cllhpy: 5'-tgacaacgtc agggt aacacaaagt-3 '(SEQ ID No. 58) clrhpy3:

acacaaagtc-3 '

5'-tcagaacgtt gnnsnnsnns nnsnnsnnsn nstacgagaa (SEQ ID No. 59) clrhpy5: 5'-tcagaacgtt gnnsnnsnns nnsnnsnnsn nsnnsnnsta cgagaaacac aaagtc-Z '(SEQ ID No. 5-gccc tcgcnot) No. 61)

50752 Β

A number of selected library clones (mutated CL domains, cloned into the phagemid vector pHEN1) were controlled by restriction analysis and DNA sequencing to see if they contained an insert, as planned, including correctly inserted random sequences. For subsequent phage preparation, standard protocols were followed. Briefly, the binding mixture was transformed into E coli TG1 cells by electroporation. Thereafter, phage particles were released from E. coli TG1 cells with helper phage M13-KO7. Phage particles were then precipitated from the culture supernatant with PEG / NaCl in 2 steps, dissolved in water and used for selection by panning or, alternatively, stored at minus 80^cC.

Example12: CH1 library

Visual inspection of the crystal structure of the Fab fragment (Fab structure of human monoclonal antibody 3D6 used: RSCB Protein Data Bank, input 1DFB.PDB) and computer-aided analysis (Protein Explorer was used for this purpose) of secondary and tertiary structures of this protein, allow identification residues, located in the regions of the loop, which connect the beta multiple structures of the CH1 domain. These residues contain amino acids 7 to 21, amino acids 25 to 39, amino acids 41 to 81, amino acids 83 to 85, amino acids 89 to 103 and amino acids 106 to 117 (numerical designation according to the IMGT number system).

More specifically, residues 12-19 and 93-100 were randomly selected within the human CH1 domain (SEQ ID No. 54, 55). Random selection was performed by PCR amplification of coding sequences with PCR primers, in which the positions of the relevant codons were encoded by the nucleotide sequence 5-NNS-3 ', which potentially encodes all 20 amino acids, avoiding 2 of the 3 stop codons. The insert from the library was amplified by two separate PCR reactions, and the two PCR fragments were linked together via the BstEII restriction site, which naturally exists in the CH1 domain. The primers further provide restriction endonuclease positions of Ncol and Notl, respectively, for cloning into the vector of the detected phage pHEN. The C-terminal cysteine ​​of the CH1 domain is not involved in phage exposure, but may be added later, when a modified CH1 clone is used, e.g. to construct a Fab fragment.

As a mold for PCR amplification, a plasmid, such as pRcCMV3D6HC, was used, which contains, as an insert, the complete heavy chain of the human monoclonal antibody.

50752 Β

The nucleotide and amino acid sequence of the final PCR and binding product, which is cloned into the Ncol position of pHEN1, which results in the attachment of the leader of the pelB sequence to the N-terminus of the construct, is shown below (SEQ ID No. 54, 55):

<td> + 3</td><td>MK. Υ</td><td>LLPT</td><td>Α Α Α</td><td>GLL</td><td>LL Α Α</td>

<td> 1</td><td colspan="2">ATGAAATACC TATTGCCTAC</td><td>GGCAGCCGCT</td><td>GGATTGTTAT</td><td>TACTCGCGGC</td>

<td></td><td colspan="2">Ncol</td><td></td><td></td><td></td>

<td> + 3</td><td>Q Ρ A</td><td>Μ Α Α</td><td>S Τ Κ G</td><td>Ρ SV</td><td>F Ρ L</td>

<td> 51</td><td colspan="2">CCAGCCGGCC ATGGCCGCCT</td><td>CCACCAAGGG</td><td>CCCATCGGTC</td><td>TTCCCCCTGG</td>

<td> + 3</td><td>Α Ρ SS</td><td></td><td></td><td>Α L</td><td>GCL</td>

<td> 101</td><td>SASSSTSSTS</td><td>CNNSNNSNNS</td><td>NNSNNSNNSN</td><td>NSNNSGCCCT</td><td>GGGCTGCCTG</td>

<td> + 3</td><td>V Κ D</td><td>.Ε</td><td>Ρ V Τ</td><td>In sw</td><td>NSGA</td>

<td> 151</td><td>GTCAAGGACT</td><td>ACTTCCCCGA</td><td>ACCGGTGACG</td><td>GTGTCGTGGA</td><td>ACTCAGGCGC</td>

<td> + 3</td><td>L Τ S</td><td>GV Η</td><td>Τ F Ρ Α</td><td>VLQ</td><td>SSG</td>

<td> 201</td><td>CCTGACCAGC</td><td>GGCGTGCACA</td><td>CCTTCCCGGC</td><td>TGTCCTACAG</td><td>TCCTCAGGAC</td>

BstEII

<td> + 3</td><td>LYSL</td><td>SSV</td><td>VTV</td><td>P</td><td></td>

<td> 251</td><td>TCTACTCCCT</td><td>CAGCAGCGTG</td><td>GTGACCGGGC</td><td>CCNNSNNSNN</td><td>SNNSNNSNNS</td>

<td> + 3</td><td>YOU</td><td>ICNV</td><td>N Η K</td><td>PSN</td><td>Κ Κ VD</td>

<td> 301</td><td>NNSACCTACA</td><td>TCTGCAACGT</td><td>GAATCACAAG</td><td>CCCAGCAACA</td><td>CCAAGGTGGA</td>

<td></td><td></td><td></td><td>Notl</td><td></td><td></td>

<td> + 3</td><td>KKV</td><td>Ε Ρ K</td><td>S Α Α A</td><td></td><td></td>

<td> 351</td><td>CAAGAAAGTT</td><td>GAGCCCAAAT</td><td>ct: gcggccgc</td><td>A</td><td></td>

Primer list for CH1 library:

CHILNCO: 5'-acgtccatgg ccgcctccac caagggccca tcggtcttcc ccctggcacc ctcctccnns nnsnnsnnsn nsnnsnnsnn sgccctgggc tgcctggtc-3 '(SEQID No. 62)

CH1LBST: 5'-ggcacggtca ccacgctgct gag-3 '(SEQ ID No. 63)

50752 Β

CHIRBST: 5'-agcgtggtga ccgtgcccnn snnsnnsnns nnsnnsnnsa cctacatctg caacgtgaat s-3 '(SEQ ID No. 64)

CH1RNOT: 5'-catagcggcc gcagatttgg gctcaacttt cttgtc-3 '(SEQ ID No. 65)

A number of selected library clones (mutated CH1 domains, cloned into the phagemid vector pHEN1) were controlled by restriction analysis and DNA sequencing to see if they contained an insert, as planned, including correctly inserted random sequences. For the next phage preparation steps, standard protocols were followed. Briefly, the binding mixture was transformed into E. coli TG1 cells, by electroporation. Thereafter, phage particles were released from E. coli TG1 cells with helper phage M13-KO7. Phage particles were then precipitated from the culture supernatant with PEG / NaCl in 2 steps, dissolved in water and used for panning selection or, alternatively, stored at minus 80 ° C.

Example 13: Obtaining a library of CH1 - phage on chicken egg lysozyme (HEL)

3 preparation rounds were performed with the CH1 - phage library (see Example 12). Maxisorp 96-well plates (Nunc) were coated with chicken egg lysozyme, by adding 200 μΙ, per well, of the following solution: PBS, with the following concentrations of dissolved chicken egg lysozyme:

1. preparation cycle: 2 mg / ml HEL

2. preparation cycle: 1 mg / ml HEL

3. preparation cycle: 1 mg / ml HEL

Incubation lasted 1 hour at 37 ° C, followed by blocking with 2% powdered milk (M-PBS) at 200 μΙ, per well, for 1 hour at room temperature.

The library of surface-exposed phages was then allowed to react with bound hen lysozyme, adding 100 μΙ phage suspension and 100 μΙ 4% milk powder (M-PBS), followed by incubation for 45 minutes, with shaking and for 90 minutes, without shaking, at room temperature.

Unbound phage particles were removed by washing as follows:

First round: 10 x 300 μ 300 T-PBS, 5x 300 μ 300 PBS

Second round: 15 x 300 μΙ T-PBS, 10x 300 μΙ PBS Third round: 20 x 300 μΙ T-PBS, 20 x 300 μΙ PBS

Elution of bound phage particles was performed by adding 200 μΙ, per reaction beaker, 0.1 M glycine, pH 2.2, and incubating, shaking, for 30 minutes at room temperature. Thereafter, the phage suspension was neutralized by the addition of 60 μί 2 M Tris-base, followed by infection in E. coliTGt cells

50752 Β mixing 10 ml of exponentially growing culture with 0.5 ml of eluted phages and incubating for 30 minutes at 37 ° C. Finally, infected bacteria were plated on ΤΥΕ medium with 1% glucose and 100 pg / ml ampicillin, and incubated at 30 ° C overnight.

Cloning of selected clones of CH1 mutants, selected according to lysozyme, for soluble expression

Phage hemid DNA from phage, which was selected through 3 preparation rounds, was isolated using midi-prepa. DNA encoding mutated CH1 domains was serially amplified by PCR and Ncol-Not1 cloned into the pNOTBAD / Myc-His vector, which is the E. coli expression vector pBAD / Myc-His (Invitrogen), with the inserted Notl restriction position, to facilitate cloning. The associated constructs were transformed into E cells. coli LMG194 (Invitrogen) by electroporation, and grown at 30 ° C, on ΤΥΕ medium with 1% glucose and ampicillin, overnight. Selected clones were inoculated into 200 μΙ 2xYT medium with ampicillin, grown overnight, at 30 ° C, and induced by the addition of L-arabinose to a final concentration of 0.1%. After expression at 16 ° C overnight, cells were harvested by centrifugation and treated with 100 μΙ Na-borate buffer, pH 8.0, at 4 ° C overnight to produce periplasmic extracts. 50 μΙ of periplasmic extracts were used for the ELISA test.

Clones, which gave a high signal in the first, preliminary ELISA test, were cultured in a 20-ml volume, under the same conditions as described above. Their periplasmic extracts were isolated in 1/20 volume of the culture, as previously described, and were tested by ELISA test (as described below) for confirmation.

ELISA test of CH1 mutants, selected according to hen egg lysozyme

Sheath: Microtiter plate (NUNC, Maxisorp), 100 μΙ per well, 100 pg chicken egg lysozyme / ml in PBS, 1 h pa 37 ° C

Rinsing: Zh 200 μΙ PBS

Blocking: 1% BSA-PBS, 1 h at RT

Flushing: 3 x 200 μΙ PBS

Binding of periplasmic extract: 50 μΙ periplasmic extract 50 μΙ 2% BSA-PBS, at room temperature, overnight

Rinsing: Zh 200 μΙ PBS

1. antibody: anti-His₄ (Qiagen), 1: 1000 in 1% BSA-PBS, 90 min at RT, 100 μΙ per well

Rinsing: Zh 200 μΙ PBS

2. antibody: goat anti mouse'HRP (SIGMA), 1: 1000 in 1% BSA-PBS, 90 min at RT, 100 μΙ per well

50752 Β

Rinsing: Zh 200 μΙ PBS

Detection: 3 mg / ml OPD in Na citrate / phosphate buffer, pH 4.5, 0.4 μΙ 30% H₂Oh₂

Stoppage: 100 ml ZM H₂SO₄

Absorbance reading: 492/620 nm

Clones were interpreted as positive when their ELISA signal was at least three times greater than the background signal.

Example 14: Obtaining CL-phage libraries on chicken egg lysozyme (HEL)

3 acquisition rounds with the CL - phage library were performed (see example 11). Maxisorp 96-well plates (Nunc) were coated with chicken egg lysozyme, by adding 200 μΙ of the following solution, per reaction beaker: PBS, with the following concentrations of dissolved chicken egg lysozyme:

1. preparation cycle: 2 mg / ml HEL

2. preparation cycle: 1 mg / ml HEL

3. preparation cycle: 1 mg / ml HEL

Incubation was continued for 1 hour at 37 ° C, followed by blocking with 2% milk powder (M-PBS) at 200 μΙ, per well, for 1 hour at room temperature.

The library of surface-exposed phages was then allowed to react with bound hen lysozyme, adding 100 μΙ phage suspension and 100 μΙ 4% milk powder (M-PBS), followed by incubation for 45 minutes, with shaking, for 90 minutes. without shaking, at room temperature.

Unbound phage particles were removed by washing as follows:

First round: 10 x 300 μ 300 T-PBS, 5x 300 μ 300 PBS

Second round of preparation: 15 x 300 μΙ T-PBS, 10x 300 μΙ PBS

Third round: 20 x 300 μΙ T-PBS, 20 x 300 μΙ PBS

Elution of bound phage particles was performed by adding 200 μΙ, per well, 0.1 M glycine, pH 2.2, and incubating, shaking, for 30 minutes at room temperature. Thereafter, the phage suspension was neutralized by adding 60 μΙ 2 M Trisbase, followed by infection in E. coli TG1 cells, mixing 10 ml of exponentially growing culture with 0.5 ml of eluted phages and incubating for 30 minutes at 37 ° C. Finally, infected bacteria were placed on ΤΥΕ medium with 1% glucose and 100 μ9 / ΓηΙ ampicillin, and incubated at 30 ° C overnight.

Cloning of selected clones of CL mutants, selected according to lysozyme, for soluble expression

Phage hemid DNA from phage, which was selected through 3 preparation rounds, was isolated using midi-prepa. DNA encoding mutated CL domains was serially amplified by PCR and Ncol-NotI cloned into the pNOTBAD / Myc-His vector, which is an E. coli expression

50752 Β vector pBAD / Myc-His (Invitrogen), with inserted Notl restriction position, to facilitate cloning. Connected constructs were transformed into E. coli LMG194 cells (Invitrogen) by electroporation, and grown at 30 ° C, on ΤΥΕ medium with 1% glucose and ampicillin, overnight. Selected clones were inoculated into 200 μΙ 2xYT medium with ampicillin, grown overnight at 30 ° C, and induced by the addition of L-arabinose to a final concentration of 0.1%. After expression at 16 ° C overnight, cells were harvested by centrifugation and treated with 100 μΙ Na-borate buffer, pH 8.0, at 4 ° C overnight to produce periplasmic extracts. 50 μΙ of periplasmic extracts were used for the ELISA test.

Clones, which gave a high signal in the first, preliminary ELISA assay, were cultured in a 20-ml volume, under the same conditions as described above. Their periplasmic extracts were isolated in 1/20 of the culture volume, as previously described, and examined by ELISA (as described below) for confirmation.

ELISA test of CL mutants, selected according to hen egg lysozyme

Sheath: Microtiter plate (NUNC, Maxisorp), 100 μΙ term, 100 pg chicken egg lysozyme / ml in PBS, 1 h at 37 ° C

Rinsing: Zh 200 μΙ PBS

Blocking: 1% BSA-PBS and 1 h RT

Flushing: 3 x 200 μΙ PBS

Binding of periplasmic extract: 50 μΙ periplasmic extract 50 μΙ 2% BSA-PBS, at room temperature, overnight

Rinsing: Zh 200 μΙ PBS

1. antibody: anti-His₄ (Qiagen), 1: 1000 in 1% BSA-PBS, 90 min at RT, 100 μΙ per well

Rinsing: Zh 200 μΙ PBS

2. antibody: goat anti mouse * HRP (SIGMA), 1: 1000 in 1% BSA-PBS, 90 min at RT, 100 μΙ per well

Rinsing: Zh 200 μΙ PBS

Detection: 3 mg / ml OPD in Na citrate / phosphate buffer, pH 4.5, 0.4 μΙ 30% H₂Oh₂

Stoppage: 100 ml ZM H₂SO₄

Absorbance reading: 492/620 nm

Clones were interpreted as positive when their ELISA signal was at least three times greater than the background signal.

Example 15: Construction of an immunoglobulin domain, which was randomized on both arms (bispecifically constructed SnZ domain)

50752 Β

This example describes the constructed immunoglobulin domain, with two binding specificities.

The design of this constructed immunoglobulin domain involved the following strategy:

• constructed S_n3 domain, clone C24 (see example 10), obtained from C_HThe 3 + 5 library, which specifically binds to lysozyme, was used as a starting point • in this modified SNZ domain, randomized residues were identified that link the β-strands of the immunoglobulin fold, and which lie on the opposite side of the domain, compared to residues, which are mutated, when clone C24 is produced.

• PCR primers have been designed, which allow randomization of these residues and synthesis of this constructed immunoglobulin domain in a method similar to that previously described for S libraries_n3, S_n3 + 3 and C_H3+5.

PCR products, containing randomized positions, were bound and inserted full-length, amplified by PCR. They were then cloned into pHEN-1 via the NcolNot1 position and transformed into E. coli TG-1 cells to construct a library of about 10⁸ colony. 20 randomly selected colonies were sequenced and random positions were found to be independently mutated. Also, no “wild type” sequence (C24) was observed. The phage library was created according to standard protocols and a titarphage of 6.32 x 10 was achieved.¹° TU / ml.

In order to examine bispecificity, recombinant human erythropoietin (rhEPO) was chosen as the second antigen, while the construct was expected to retain its originally constructed specificity for chicken egg lysozyme. The rhEPO-reactive phage was selected in the preparation round. In order to preserve the population of C24 clones, which after mutagenesis continue to bind chicken lysozyme, the first round of rhEPO selection follows the round of obtaining the phage population on chicken lysozyme (1 mg / ml in PBS). 200 μΙ rhEPO was wrapped in 5 wells of a microtiter plate (Maxisorp, Nunc) in 0.1 M Carbonate Buffer, pH 9.6, in decreasing concentrations in successive preparation rounds (see Table below). After blocking with 2% M-PBS, the phage in the blocking agent was allowed to bind at room temperature for 2 h. After 20 washes with T-PBS and 20 with PBS, it was eluted with 0.1 M glycine, pH 2.2 and neutralized with 2 M Tris. Eluted phage was immediately used to infect exponentially growing TG-1. Infected cells were selected on ampicillin medium. Phage particles were removed from the culture supernatant during superinfection with the M13-KO7 helper phage, concentrated with PEG and used in

50752 Β second round of obtaining. The entry and gain of phage numbers were determined as transforming units of E. co // after each round of production (Table 8).

Table 8

<td>circle of obtaining</td><td>antigen</td><td>entered phage (TU / ml)</td><td>obtained phage (TU / ml)</td>

<td> 1</td><td>rhEPO, 500 pg / ml</td><td>6.32 x10¹°</td><td>1.9 x 10^s</td>

<td> 2</td><td>lysozyme, 1 mg / ml</td><td>6.16 X 10¹⁵</td><td>4.53 x 10¹⁰</td>

<td> 3</td><td>rhEPO, 100 pg / ml</td><td>6? 07 hTb ^</td><td>6.78 x 10^1Q</td>

<td> 4</td><td>rhEPO, 50 pg / ml</td><td>8.42 x 10¹⁵</td><td>3.0 x 10¹¹</td>

<td> 5</td><td>rhEPO, 50 pg / ml</td><td>5.12x10¹⁵</td><td>4.28 x10¹°</td>

The obtained colonies were scraped from the plates, kept in culture in 2xYT with ampicillin and their plasmid DNA was isolated with midi-prep. The inserts were amplified by PCR and then subcloned into the pNOTBAD vector and transformed into E. coli type E104. 4x72 colonies were cultured in 200 μΙ 2xYT with ampicillin and induced with 0.1% L-arabinose the next day. After 24 h expression at 16 ° C, they were lysed with 200 μΙ Na-borate buffer, pH 8.0 for 6 h at 4 ° C and periplasmic extract was used for ELISA.

For ELISA, Maxisorp plates were coated with chicken egg lysosome in PBS (20 pg / ml) or with rhEPO in 0.1 M Na-carbonate buffer, pH 9.6, for 1 h at 37 ° C. After blocking with 1% BSA-PBS, periplasmic extracts in the same blocking agent were allowed to bind overnight. Binding was demonstrated with an anti-His- (4) antibody and a goat mouse IgG antibody conjugated to HRP (for the detection of chicken egg lysozyme) or AP (for the detection of rhEPO). The reaction color from OPD conversion (HRP) was read at 492/620 nm after stopping with 1.25 MH₂SO₄ and pNPP conversion (AP) was read at 405/620 nm. 14 colonies with promising absorbance values ​​were selected for expression on the 20-ml scale. After 24 h induction with arabinose at 16 ° C, cells were harvested and lysed overnight and 1 ml of Naborate buffer at 4 ° C, and the lysate was used for ELISA. The ELISA was performed as before, in 4 parallels, and wells without periplasmic extract and without antigen were used as a negative control. The results (Table 9) were obtained with a clone according to SEQ ID NO. 42.43.

Table 9:

50752 Β

<td>antigen</td><td></td><td>absorbance at binding</td><td>without periplasmic extract</td><td>without antigen</td>

<td>lysozyme</td><td>A 492/620 nm</td><td> 0,299</td><td> 0.110</td><td> 0.018</td>

<td>rhEPO</td><td>A 405/620 nm</td><td> 0.258</td><td> 0.095</td><td> 0.090</td>

Example 16; The constructed SnZ domains provide bispecificity in Fab-like format

In the construction used in this example, and V_L and V_H ianac antibodies are fused into a constructed S_n3 domain.

VH and VL region of human monoclonal antibody 3D6 (He HM, et al. Proc Natl Acad Sci USA, 1992 89: 7154-8; Kohl J, et al. Ann NY Acad Sci. 1991 646: 106-14; Felgenhauer M, et. al. Nucleic Acids Res. 1990 18: 4927), which recognizes the epitope on gp41 HIV-1 was used as a fusion partner to construct the SnZ domain of clone C24 that specifically binds to chicken egg lysozyme.

In order to enhance the formation of VL-CH3 / VH-CH3 dimers via a disulfide bond, Ser-Cys residues are added to the S-kgaj C24 sequence.

The nucleotide and amino acid sequences of the two strands, 3D6VL-C24 and 3D6VH-C24, are given in SEQ ID NO. 47, 46 or SEQ ID no. 45, 44.

The primers are designed to allow amplification of the coding regions, by introducing restriction positions at the same time (silent mutations), which are used to hold the coding regions together. For gene expression, the Pichia pastoris expression system was chosen. The constructs were cloned into suitable Pichia pastoris expression vectors: 3D6VL-C24 was cloned into pPIC9K (final name: pPIC9K3LC) and 3D6VH-C24 was cloned into pPICZalfaA (final name: pPICZ3HC). The pPICZ3HC construct was linearized with Sg / II, transformed into Pichia pastoris GS115, and transformants were isolated on solid medium with zeocin. One of the transformants was then used as a host cell for the Sal I-linearized pPIC9K3LC construct. Then, double transformants on RDB medium were selected.

Clones were inoculated into 30 ml of YPG medium and grown to OD600 = 10, then induced by the addition of 1% methanol in ΒΜΜΥ medium. Induction was continued for 36 hours at 16 ° C. The supernatants were removed by centrifugation and then concentrated about 10 times. The presence of recombinant protein was confirmed by Western blotting with anti-His (4) antibody, and a concentration of approximately 50100 cd / l of the initial culture was determined.

50752 Β

The first functional tests were performed with 10x-concentrated supernatants. First, the wells of Maxisorp plates were coated with 20 μ9 / ηηΙ hen egg lysozymes in PBS or with 20 pg / ml epitope of antibody 3D6 in 0.1 M Carbonate Buffer, pH 9.6, for 1 h, then 37 ° C. The 3D6 epitope was used in the form of a recombinantly produced GST-fusion protein. After blocking with 1% BSAPBS, the concentrated supernatants were allowed to bind overnight in the same blocking agent. Blocking was obtained with anti-His (4) antibody and goat anti-mouse antibody, which is conjugated to HRP and, was visualized as the reaction color resulting from the OPD conversion at 492/620 nm (Table 10).

Table 10

<td>antigen</td><td>ELISA signal (A 492 / 62θ)</td><td>Background (without antigen)</td><td>Background (without supernatant)</td>

<td>lysozyme</td><td> 0.198</td><td> 0.003</td><td> 0.043</td>

<td>epitope 3D6</td><td> 0.061</td><td> 0.001</td><td> 0.007</td>

50752 Β

SEQUENCE LISTING <110> Rocker, Florian <120> SYNTHETIC IMMUNOGLOBULIN DOMAINS WITH BINDING CHARACTERISTICS CONSTRUCTED IN REGIONS OF MOLECULES DIFFERENT FROM REGIONS <787835701 150> US 60/641144 <151> 2005-01-05 <160> 65 <170> Patent inversion 3.3 <210> 1 <211> 108 <212> PRT <213> Homo sapiens <400> 1

<td>Pro</td><td rowspan="2">Arg</td><td>G u</td><td>Pro</td><td>G n</td><td>Val</td><td rowspan="2">Tug</td><td>Thr</td><td>Leu</td><td>Pro</td><td>Pr o</td><td>Ser</td><td rowspan="2">Arg</td><td rowspan="2">Asp</td><td>G u</td><td>Leu</td>

<td> 1</td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td> 15</td><td></td>

<td>Thr</td><td rowspan="2">Lys</td><td>Asn</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Tug</td><td>Pro</td>

<td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td rowspan="2">Asp</td><td>l! e</td><td>Al a</td><td>Val</td><td>G u</td><td rowspan="2">Trp</td><td>Gu</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pr o</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td> 35</td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td rowspan="2">Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pr 0</td><td>Pro</td><td>Val</td><td>Leu</td><td rowspan="2">Asp</td><td>Ser</td><td>Asp</td><td>Qy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td rowspan="2">Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td rowspan="2">Asp</td><td rowspan="2">Lys</td><td>Ser</td><td>Arg</td><td>Trp</td><td>G n</td><td>G n</td><td>Gy</td><td>Asn</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td rowspan="2">Cys</td><td>Ser</td><td>Val</td><td>M5t</td><td>rt s</td><td>G u</td><td>A1 a</td><td>Leu</td><td>HS</td><td>Asn</td><td>n s</td><td rowspan="2">Tug</td><td>Thr</td><td>G n</td>

<td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td> 95</td><td></td>

<td rowspan="2">Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pr O</td><td rowspan="2">Gy</td><td>Lys</td><td>A! a</td><td>Ala</td><td>Al a</td><td></td><td></td><td></td><td></td>

<td></td><td></td><td> 100</td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

50752 Β <2102 <211> 332 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <220 <221> misc_characteristic <222> (57) ... (58) <223> η is a, c, g or t <220 <221> misc_characteristic <222> (60) ... (61) <223> nje a, c, g ilit <220>

<221> misc_characteristic <222> (63) ... (64) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (219) ... (220) <223> n is a, c, g or t <220>

<221> misc characteristic <222> (222) ... (223) <223> n is a, c, g or t <220 <221> misc_characteristic <222> (225) ... (226) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (234) ... (235) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (237) ... (238) <223> n is a, c, g or t <400> 2

50752 Β ccatggcccc ccgagaacca caggt gt aca ccct gccccc at cccgggat gagct cnnsn nsnnscaggt cagcctgacc tgcctggtca aaggct t ct at cccagcgac at cgccgt gg

120 agtgggagag caatgggcag ccggagaaca act acaagac cacgcct ccc gt gct ggact

180 ccgacggctc cttcttcctc t acagcaagc ttaccgtgnn snnsnnsagg tggnnsnnsg

240 ggaacgt ct t ct cat gct cc gt gat gcat g aggctct gca caaccactac acacagaaga

300 gcctctccct gtctccgggt aaagcggccg ca.

332 <210> 3 <211> 110 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <220>

<221> misc_characteristic <222> (19) ... (21) <223> Haa can be any naturally occurring amino acid <220>

<221> misc_characteristic <222> (73) ... (75) <223> Haa can be any naturally occurring amino acid <220>

<221> misc_characteristic <222> (78) ... (79) <223> Haa can be any naturally occurring amino acid

<td>IVfet</td><td>Al a</td><td>Pro</td><td>Arg</td><td>Gu</td><td>Pr o</td><td>G n</td><td>Val</td><td>Tug</td><td>Thr</td><td>Leu</td><td>Pro</td><td>Pro</td><td>Ser</td><td>Arg</td><td rowspan="2">Asp</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>

<td>G u</td><td>Leu</td><td>Haa</td><td>Haa</td><td>Haa</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Tbr</td><td rowspan="2">Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td rowspan="2">Gy</td><td>Phe</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td> 30</td><td></td>

<td>Tug</td><td>Pro</td><td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>G u</td><td rowspan="2">Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>AbP</td><td>Asn</td><td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td rowspan="2">Asp</td><td>Ser</td><td rowspan="2">Asp</td><td rowspan="2">Gy</td><td>Ser</td><td>Phe</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td>

<td>Phe</td><td>Leu</td><td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Haa</td><td>Haa</td><td>Haa</td><td rowspan="2">Arg</td><td rowspan="2">Trp</td><td>Haa</td><td>Haa</td><td>G u</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td> 80</td>

<td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>or</td><td>IVfet</td><td>H s</td><td>G u</td><td>Al a</td><td>Leu</td><td>Hs</td><td>Asn</td><td>H s</td><td rowspan="2">Tug</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td>

<td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>G u</td><td>Lys</td><td>Al a</td><td>Al a</td><td>Al a</td><td></td><td></td>

100 105 110

50752 Β <210> 4 <211> 33 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 4 ct t gccat gg ccccccgaga accacaggt gt ac 33 <210> 5 <211> 30 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 5 agt cgagct c gt cacgggat gggggcaggg 30 <210> 6 <211> 41 <212> DNA <213> Unnatural <220 <223> Unnatural sequence <220>

<221> misc_characteristic <222> (11) ... (12) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (14) ... (15) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (17) ... (18) <223> n is a, c, g or t <400> 6 gt acgagct c nnsnnsnnsc aagt cagcct gacct gcct gg 41 <210 7 <211> 32 < 212> DNA <213> Unnatural

50752 Β <220>

<223> Unnatural sequence <400> 7 tgccaagctt gctgtagagg aagaaggagc cg 32 <210 8 <211> 59 <212> DNA <213> Unnatural <220 <223> Unnatural sequence <220 <221> misc_characteristic <222> (17) .. . (18) <223> n is a, c, g or t <220 <221> misc_characteristic <222> (20) ... (21) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (23) ... (24) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (32) ... (33) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (35) ... (36) <223> n is a, c, g or t <400> 8 t gccaagct t accgt gnnsn nsnnsaggt g gnnsnnsggg aacgt ct t ct cat gct ccg 59 <210 > 9 <211> 33 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 9 agttgcggcc gctttacccg gagacaggga gag 33

50752 Β <210> 10 <211> 113 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <220>

<221> misc_characteristic <222> (19) ... (21) <223> Haa can be any naturally occurring amino acid <220>

<221> misc_characteristic <222> (73) ... (78) <223> Haa can be any naturally occurring amino acid <220>

<221> misc_characteristic <222> (81) ... (82) <223> Haa can be any naturally occurring amino acid

<td colspan="16"> &lt;400&gt; 10</td>

<td>tvtet 1</td><td>Al a</td><td>Pro</td><td>Arg</td><td colspan="3">O u Pr o G n 5</td><td>Val</td><td>Tug</td><td>Thr 10</td><td>Leu</td><td>Pro</td><td>Pro</td><td>Ser</td><td>Arg 15</td><td>Asp</td>

<td>Θ u</td><td>Leu</td><td>Haa</td><td>Haa</td><td>Haa</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Tug</td><td>Pro</td><td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>G u</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G p</td><td>Pro</td><td>G u</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Asn</td><td>Asn</td><td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td colspan="2">Asp G u</td><td>Ser</td><td>Phe</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Phe</td><td>Leu</td><td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>val</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Arg</td><td>Trp</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Haa</td><td>Haa</td><td>Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td></td><td>N s</td><td>G u</td><td>And I</td><td>Leu</td><td>H s</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Asn</td><td>H s</td><td>Tug</td><td>Thr</td><td>G p</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>&lt;3 U</td><td>Lys</td><td>Al a</td><td>Al a</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

Al a <210> 11 <211> 341 <212> DNA <213> Unnatural <220>

50752 Β <223> Unnatural sequence <220>

<221> misc_characteristic <222> (57) ... (58) <223> η is a, c, g or t <220>

<221> misc_characteristic <222> (60) ... (61) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (63) ... (64) <223> nje a, c, g ilit <220>

<221> misc_characteristic <222> (219) ... (220) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (222), .. (223) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (225) ... (226) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (228) ... (229) <223> n is a, c, g or <220>

<221> misc_characteristic <222> (231) ... (232) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (234) ... (235) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (243) ... (244) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (246) ... (247)

50752 Β <400> 11 ccatggcccc ccgagaacca caggtgtaca ccctgccccc at cccgt gac gagct cnnsn nsnnscaagt cagcct gacc tgcctggt ca aaggct t ct at cccagcgac atcgccgt gg

120 agt gggagag caat gggcag ccggagaaca act acaagac cacgcct ccc gt gct ggact

180 ccgacggct c cttcttcctc tacagcaagc ttaccgt gnn snnsnnsnns nnsnnsaggt

240 ggnnsnnsgg gaacgt ct tc tcat gctccg tgat gcatga ggct ct gcac aaccact aca

300 cacagaagag cct ct ccct gt ct ccgggi a aagcggccgc

341 <210> 12 <211> 68 <212> DNA <213> Unnatural <220 <223> Unnatural sequence <220 <221> misc_characteristic <222> (17) ... (18) <223> n is a, c, g or t <220 <221> misc_characteristic <222> (20) ... (21) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (23) ... (24) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (26) ... (27) <223> n is a, c, g or t <220>

<221> misc__characteristic <222> (29) ... (30) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (32) ... (33) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (41) ... (42) <223> n is a, c, g or t <220>

50752 Β <221> misc_characteristic <222> (44) ... (45) <223> η is a, c, g or t <400 12 t gccaagctt t accgt gnnsn nsnnsnnsnn snnsaggt gg nnsnnsggga acgt ct t ct c 60 at gct ccg 68 <210> 13 <211> 115 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <220>

<221> misc characteristic <222> (19) .7 (21) <223> Haa can be any naturally occurring amino acid <220>

<221> misc_characteristic <222> (73) ... (80) <223> Haa can be any naturally occurring amino acid <220>

<221> misc_characteristic <222> (83) ... (84) <223> Haa can be any naturally occurring amino acid <400> 13

<td>JVfet 1</td><td>Al a</td><td>Pro</td><td>Arg</td><td>G u 5</td><td>Pro</td><td>α n</td><td>Val</td><td>Tug</td><td>Thr 10</td><td colspan="2">Leu Pro</td><td>Pro</td><td>Ser</td><td>Arg 15</td><td>Asp</td>

<td>G u</td><td>Leu</td><td>Haa</td><td>Haa</td><td>Haa</td><td>α n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Tug</td><td>Pro</td><td>Ser</td><td>Asp</td><td>And le</td><td>Al a</td><td>Val</td><td>G u</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Asn</td><td>Asn</td><td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>ASp</td><td>Gy</td><td>Ser</td><td>Phe</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Phe</td><td>Leu</td><td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td><td>Haa</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Arg</td><td>Trp</td><td>Haa</td><td>Haa</td><td>Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>Ivtet</td><td>H s</td><td>G u</td><td>Ai a</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Leu</td><td>H s</td><td>Asn</td><td>H s</td><td>Tug</td><td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Gy</td><td>Lys</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

Al a Al a Ai a

115

50752 Β <210> 14 <211> 347 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <220>

<221> misc_characteristic <222> (57) ... (58) <223> η is a, c, g or t <220>

<221> misc characteristic <222> (60) 7 (61) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (63) ... (64) <223> n is a, c, g or t <220>

<221> misc characteristic <222> (219) .. (220) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (222) ... (223) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (225) ... (226) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (228) ... (229) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (231) ... (232) <223> n is a, c, g or t <220>

<221> misc characteristic <222> (234γ. (235) <223> n is a, c, g or <220>

<221> misc characteristic

50752 Β <222> (237) ... (238) <223> η is a, s, g or t <220>

<221> misc_characteristic <222> (240) ... (241) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (249) ... (250) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (252) ... (253) <223> n is a, c, g or t <400> 14 ccat ggcccc ccgagaacca caggt gt aca ccct gccccc at cccgt gac gagct cnnsn nsnnscaagt cagcctgacc tgc ct a tcccagcgac a ( cgccgt gg

120 agt gggagag caatgggcag ccggagaaca act acaagac cacgcct ccc gt gct ggact

1S0 ccgacggct c cttcticctc t acagcaagc ttaccgtgnn snnsnnsnns nnsnnsnnsn

240 nsaggt ggnn snnsgggaac gtct tctcat gct ccgt gat gcat gaggct ct gcacaacc

300 act acacaca gaagagcct c tccctgtctc cgggt aaagc ggccgca

347 <210> 15 <211> 74 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <220 <221> misc_characteristic <222> (17) ... (18) <223> n is a, c, g or t <220 <221> misc_characteristic <222> (20) ... (21) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (23) ... (24) <223> n is a, c, g or t <220>

<221> misc_characteristic

50752 Β <222> (26) ... (27) <223> η is a, s, g or t <220 <221> misc characteristic <222> (29) 7 (30) <223> n is a, c , g or t <220>

<221> misc_characteristic <222> (32) ... (33) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (35) ... (36) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (38) ... (39) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (47) ... (48) <223> n is a, c, g or t <220>

<221> misc_characteristic <222> (50) ... (51) <223> nje a, c, g or t <400> 15 t gccaagct t accgt gnnsn nsnnsnnsnn snnsnnsnns aggt ggnnsn nsgggaacgt 60 ct t ct cat gc t ccg 74 <210> 16 <211> 110 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <400> 16

50752 Β

Pro Arg OuProGnVal Tug Thr Leu Pro Pro Ser Arg Asp Gu Leu 15 10 15

<td colspan="2">G in Trp</td><td colspan="2">Pro (3 n 20</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td colspan="2">Cys Leu 25</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe 30</td><td>Tug</td><td>Pro</td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>Gu</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>Gu</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Pro</td><td>Lys</td><td>Arg</td><td>Trp</td><td>Cys</td><td>Val</td><td>Ser</td><td>Val</td><td>Arg</td><td>Trp</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Pro</td><td>Pro</td><td>Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>val</td><td>Tue.</td><td>H s</td><td>G u</td><td>Al a</td><td>Leu</td><td>HS</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Asn</td><td>H s</td><td>Tug</td><td>Thr</td><td>Gn</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Qy</td><td>Lys</td><td></td><td></td>

100 105 110 <210> 17 <211> 330 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 17 ccccgagaac cacaggt gt a caccct gccc ccatcccgtg acgagct cgg ct ggccgcaa gt cagcct aa cct gcctggt caaaggct tct at cccagcg acat cgccgt ggagtggga

120 agcaat gggc agccggagaa caact acaag accacgcct c ccgt gct gga ctccgacggc

180 t cct t ct t cc t ct acagcaa gct t accgt g cccaagcggt ggt gcgt gag cgt caggt gg

240 cccccgggga acgtcttctc at gct ccgt g at gcat gagg ct ct gcacaa ccact acaca

300 cagaagagcc t ct ccct gt ct ccgggt aaa

330 <210> 18 <211> 110 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <400> 18

50752 Β

<td>Pro</td><td rowspan="2">Arg</td><td>Gu</td><td>Pr 0</td><td>G n</td><td>Val</td><td rowspan="2">Tug</td><td>Thr</td><td>Leu</td><td>ι Pri</td><td>D Pri</td><td>z Se</td><td>r Ar</td><td rowspan="2">g As</td><td rowspan="2">P</td><td>G in Leo</td>

<td> 1</td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td> 15</td>

<td>Ser</td><td>Yes</td><td>Ser</td><td>Gn</td><td>val</td><td>Ser</td><td>Pro</td><td>Thr</td><td>Cys</td><td>. Lei</td><td>in Val</td><td rowspan="2">I Ly</td><td>with G</td><td>in Ph</td><td>e</td><td rowspan="2">Tug Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td> 30</td><td></td>

<td>Ser</td><td rowspan="2">Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>Gu</td><td rowspan="2">Trp</td><td>G u</td><td>Ser</td><td>Asi</td><td>n G;</td><td rowspan="2">/ G</td><td>n Pr</td><td>o G</td><td>u</td><td>Asn Asn</td>

<td></td><td> 35</td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td rowspan="2">Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td rowspan="2">ASp</td><td>Gy</td><td>Ser</td><td>Phe</td><td colspan="2">Phe Leu</td>

<td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>li e</td><td>Pro</td><td>Phe</td><td>Cys</td><td>Arg</td><td>Lfet</td><td>Ser</td><td>Pro</td><td>Ai</td><td>g Trp</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td rowspan="2">Trp</td><td>lle</td><td rowspan="2">Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td rowspan="2">Cys</td><td>Ser</td><td>Val</td><td>Nfet</td><td>n s</td><td>Gu</td><td>And I</td><td colspan="2">Leu H ​​s</td>

<td></td><td></td><td> 85</td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td colspan="2"> 95</td>

<td>Asn</td><td>Hs</td><td rowspan="2">Tug</td><td>Thr</td><td>G P</td><td rowspan="2">Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td rowspan="2">Gy</td><td>Lys</td><td></td><td></td>

<td></td><td></td><td> 100</td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<210> 19 <211> 330 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 19 ccccgagaac cacaggt gt a caccct gccc ccat cccgt g · acgagct ct c ggt gt cgcaa gt cagcccga cct gcctggt caaaggcttc t at cccagcg acat cgcagt ggagt

120 agcaat gggc agccggagaa caact acaag accacgcct c ccgt gct gga ctccgacggc

180 tccttcttcc t ct acagcaa gct t accgt g at cccct t ct gcaggat gag ccccaggt gg

240 t ggat cggga acgt ct t ct c at gctccgtg at gcat gagg ct ct gcacaa ccact acaca

300 cagaagagcc t ct ccct gt ct ccgggt aaa

330 <210> 20 <211> 105 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <400> 20

50752 Β

<td colspan="3">Pro Arg G u 1</td><td>Pro</td><td>G n 5</td><td>Val</td><td>Tug</td><td>Thr</td><td colspan="2">Leu Pro 10</td><td>Pro</td><td>Ser</td><td>Arg</td><td>Asp</td><td>G u 15</td><td>Leu</td>

<td>G u</td><td>Al a</td><td>Leu</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>G u</td><td>Phe</td><td>Tug</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>Gu</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>RG 0</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Arg</td><td>Arg</td><td>Asn</td><td>Arg</td><td>Trp</td><td>Ser</td><td>Trp</td><td>Gy</td><td>Asn</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>or</td><td>IVfet</td><td>HS</td><td>G u</td><td>/ M a</td><td>Leu</td><td>H s</td><td>Asn</td><td>H s</td><td>Tug</td><td>Thr</td><td>G n</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

Lys Ser Leu Ser Leu Ser Pro Gy Lys

100 105 <210> 21 <211> 315 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 21 cct cgagaac cacaggt gt a caccct gccc ccatcccgt g acgagct cga ggcgct gcaa gtcagcctga cct gcct ggt caaaggct tct at cccagcg acat cgccgt ggagtggga

120 agcaat gggc agccggagaa caact acaag accacgcct c ccgt gct gga ct ccgacggc

180 t cct t ct t cc t ct acagcaa gct t accgt g cggcgcaaca ggt ggt cctg ggggaacgt c

240 ct cat gct ccgt gat gca tgaggctctg cacaaccact acacacagaa gagcctct cc

300 ctgtctccgg gt aaa

315 <210> 22 <211> 108 <212> PRT <213> Unnatural <220>

<223> Unnatural sequence <400> 22

50752 Β

<td>Pro</td><td rowspan="2">Arg</td><td>Gu</td><td>Pro</td><td>Gn</td><td>or</td><td rowspan="2">Tug</td><td>Thr</td><td>Leu</td><td>Pr o</td><td>Pro</td><td>Ser</td><td rowspan="2">Arg</td><td rowspan="2">Asp</td><td>Gu</td><td>Leu</td>

<td> 1</td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td> 15</td><td></td>

<td>G n</td><td rowspan="2">Gy</td><td>Ser</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td rowspan="2">Lys</td><td rowspan="2">Gy</td><td>Phe</td><td rowspan="2">Tug</td><td>Pro</td>

<td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td> 30</td><td></td>

<td>Ser</td><td rowspan="2">Asp</td><td>lle</td><td>Ala</td><td>Val</td><td>Gu</td><td rowspan="2">Trp</td><td>Gu</td><td>Ser</td><td>Asn</td><td rowspan="2">Gy</td><td>G n</td><td>Pro</td><td>Gu</td><td>Asn</td><td>Asn</td>

<td></td><td> 35</td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td rowspan="2">Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Yes</td><td>Leu</td><td>Asp</td><td>Ser</td><td rowspan="2">Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td rowspan="2">Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Lys</td><td>Ser</td><td>Arg</td><td>Al a</td><td>Thr</td><td>Arg</td><td>Arg</td><td>Trp</td><td>Val</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Gy</td><td>Asn</td><td>or</td><td>Phe</td><td>Ser</td><td rowspan="2">Cys</td><td>Ser</td><td>Val</td><td>ivtet</td><td>H s</td><td>Gu</td><td>Al a</td><td>Leu</td><td>H s</td><td>Asn</td><td>H s</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td rowspan="2">Tug</td><td>Thr</td><td>G n</td><td>Lys</td><td>Asn</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Gy</td><td rowspan="2">Lys</td><td></td><td></td><td></td><td></td>

<td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td></td><td></td>

<210> 23 <211> 324 <212 »DNA <213> Unnatural <220>

<223 »Unnatural sequence <400> 23 ccccgagaac cacaggtgt a caccct gccc ccatcccgtg acgagctcca ggggagccaa gtcagcctga cctgcctggt caaaggctt ct at cccagcg acat cgccgt ggagtgggag

120 agcaat gggc agccggagaa caact acaag accacgcct c ccgtgctgga ct ccgacggc

180 tccttcttcc t ct acagcaa gct t accgt g aagt cgcgcg ccacccggag gt gggt ggt g

240 gggaacgt ct tttcttgctc cgtgat gcat gaggct ct gc acaaccact a cacacagaag

300 aacctctccc tgtctccggg t aaa

324 <210> 24 <211 »107 <212» PRT <213> Unnatural <220>

<223> Unnatural sequence <400> 24

50752 Β

<td>Pro 1</td><td colspan="2">Ar g G u</td><td>Rto</td><td>G n 5</td><td>Va)</td><td>Typh</td><td>Thr</td><td>Leu</td><td>Pr 0 10</td><td colspan="2">Pro Ser</td><td colspan="2">Arg Asp</td><td>Gu 15</td><td>Leu</td>

<td>Al a</td><td>lle</td><td>G u</td><td>Gn</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Tug</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>G u</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G P</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Arg</td><td>Ser</td><td>Thr</td><td colspan="2">Arg Asp</td><td>ASO</td><td>Arg</td><td>Trp</td><td>Leu</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>kfet</td><td>H s</td><td>G u</td><td>Al a</td><td>Leu</td><td>H s</td><td>Asn</td><td>H s</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Tug</td><td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Qy</td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<210 25 <211> 324 <212> DNA <213> Unnatural <220>

<223> Unnatural sequence <400> 25 ccccgagaac cacaggtgta caccctgccc ccatcccgtg acgagctcgc gatcggccaa60 gtcagcctga cctgcctggt caaaggcttc tatcccagcgcgcgcgcgcggg tccttcttcc tctacagcaa gcttaccgtg cgctcgacga gggacaacag gtggctggtg 240 gggaacgtct tclcatgctc cgtgatgcat gaggctctgc acaaccacta cacacagaag 300 agcctct2210222221111

<223> Unnatural sequence <400> 26

50752 Β

<td colspan="2">Pro Arg 1</td><td>Gu</td><td colspan="3">Pr o G n Val 5</td><td>Tug</td><td>Thr</td><td>Leu</td><td>Pro 10</td><td>Pro</td><td>Ser</td><td>Arg</td><td>Asp</td><td>G u 15</td><td>Leu</td>

<td>Ser</td><td>Gy</td><td>A1 a</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Yes</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Tug</td><td>Pr o</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>lle</td><td>Ai a</td><td>Val</td><td>GU</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Tug</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Tug</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Trp</td><td>Phe</td><td>Arg</td><td>G n</td><td>Gu</td><td>Gy</td><td>Gy</td><td>IVfet</td><td>Arg</td><td>Trp</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Al a</td><td>ОУ</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>tvfet</td><td>H s</td><td>Gu</td><td>Ai a</td><td>Leu</td><td>rts</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Asn</td><td>н s</td><td>Туг</td><td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>G у</td><td>Lys</td><td></td><td></td>

100 105 110 <210> 27 <211 >330 <212> DNK <213> Neprirodna <220 <223> Neprirodna sekvenca <400> 27 ccccgagaac cacaggt gta caccct gccc ccatcccgtg acgagctcag cggggcgcaa gtcagcctga cctgcctggt caaaggct tc tatcccagcg acatcgccgt ggagtgggag

120 agcaat gggc agccggagaa caact acaag accacgcct cccgt gct gga ct ccgacggc

180 t cct t ct t cc t ct acagcaa gcttaccgtg tggttcaggc aggagggcgg cat gaggt gg

240 cgcgggga acgtcttctc at gctccgtg atgcatgagg ctctgcacaa ccact acaca

300 cagaagagcc t ct ccct gt c t ccgggt aaa

330 <210> 28 <211> 110 <212>PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 28

50752 Β

Pr ο Ar g G u Pr ο G л Val Туг Thr

Val Leu G у G n Val Ser Pr o Тћг

Ser Asp 11 e Al a Val G u Trp G и

3540

Туг Lys Thr Thr Pro Pro Val Leu 5055

Туг Gy Lys Leu Thr Val Pro Pro 6570

G у Trp Gу Asn Val Phe Ser Cys

Asn H s Туг Thr G n Lys Ser Leu

100

Leu Pro Pro Ser Arg Asp Gu Leu

<td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Cys</td><td>Leu</td><td>Val</td><td rowspan="2">Lys</td><td rowspan="2">Gy</td><td>Phe</td><td rowspan="2">Туг</td><td>Pro</td>

<td> 25</td><td></td><td></td><td> 30</td><td></td>

<td>Ser</td><td>Asn</td><td rowspan="2">Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>ASn</td><td>Asn</td>

<td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td rowspan="2">Asp</td><td>Ser</td><td rowspan="2">Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td rowspan="2">Arg</td><td>Leu</td><td>Lys</td><td>Gy</td><td>Trp</td><td>Pro</td><td rowspan="2">Arg</td><td>Trp</td>

<td></td><td> 75</td><td></td><td></td><td></td><td> 80</td>

<td>Ser</td><td>Val</td><td></td><td>Hs</td><td>Gu</td><td>Al a</td><td>Leu</td><td>H s</td>

<td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Gy</td><td>Lys</td><td></td><td></td>

<td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<210> 29 <211 >330 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 29 ccccgagaac cacaggtgta caccct gccc ccatcccgtg acgagct cgt ctt ggggcaa gtcagcccga cctgcctggt caaaggct t c t at cccagcg acat cgccgi ggagtgggag

120 agcaat gggc agccggagaa caactacaag accacgcct c ccgt gct gga ct ccgacggc

180 tccttcttcc t ct acggcaa gcttaccgtg cccccgcggt t gaagggct g gccgaggt gg

240 ggct ggggga acgt ct t ct c at gct ccgt g at gcatgagg ct ct gcacaa ccact acaca

300 cagaagagcc t ccgggt aaa

330 <210> 30 <211> 105 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 30

Pro Arg Gu Pro Gn Val Туг Thr Leu Pro Pro Ser 1 5 10

Arg Asp G u Leu

50752 Β

<td>Leu</td><td>AJ a</td><td>Туг</td><td colspan="2">□ n Val 20</td><td>Ser</td><td>Leu</td><td>Thr</td><td colspan="2">Cys Leu 25</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe 30</td><td>Туг</td><td>Pro</td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>G u</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pr 0</td><td>Gu</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>LyS</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Рће</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Туг</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Val</td><td>Al a</td><td>Gy</td><td>Arg</td><td>Тгр</td><td>Thr</td><td>Cys</td><td>Gy</td><td>Asn</td><td>vai</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>Ivtet</td><td>Hs</td><td>Gu</td><td>А1 a</td><td>Leu</td><td>H s</td><td>Asn</td><td>н s</td><td>Туг</td><td>Thr</td><td>G n</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Gy</td><td>Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

100 105 <210> 31 <211> 315 <212>DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 31 ccccgagaac cacaggtgta caccctgccc ccatcccgtg acgagctcct ggcgtaccaa gt cagcct ga cct gcct ggt caaaggct t c t at cccagcg acat cgccgt ggagt gggag agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gcttaccgtg gtggccggca ggtggacgtg cgggaacgtc ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa gagcctctcc ctgtctccgg gtaaa <210> 32 <211> 110 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 32

120

180

240

300

315

<td>Pr o</td><td rowspan="2">Arg</td><td>Gu</td><td>Pro</td><td>Gn</td><td>Val</td><td rowspan="2">Туг</td><td>Thr</td><td>Leu</td><td>Pro</td><td>Pro</td><td>Ser</td><td rowspan="2">Arg</td><td>Asp</td><td>G u</td><td>Leu</td>

<td> 1</td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Cys</td><td>Val</td><td>Pro</td><td>Gn</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td rowspan="2">Lys</td><td rowspan="2">Gy</td><td>Phe</td><td rowspan="2">Туг</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td> 30</td><td></td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>G u</td><td rowspan="2">Trp</td><td>Gu</td><td>Ser</td><td>Asn</td><td rowspan="2">Gy</td><td>G n</td><td>РГ 0</td><td>Θ u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

50752 Β

<td rowspan="2">Туг</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>vai</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>G у</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Туг</td><td>Ser</td><td rowspan="2">Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Val</td><td>Leu</td><td rowspan="2">Lys</td><td>Val</td><td>Val</td><td>G n</td><td>Al a</td><td rowspan="2">Arg</td><td rowspan="2">Arg</td><td>Trp</td>

<td> 65</td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td> 80</td>

<td>G u</td><td>Val</td><td rowspan="2">G у</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td rowspan="2">C^s</td><td>Ser</td><td>Val</td><td></td><td>Hs</td><td>Gu</td><td>Al a</td><td>Leu</td><td>Hs</td>

<td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Asn</td><td>H s</td><td>Туг</td><td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>оу</td><td>Lys</td><td></td><td></td>

100 105 110 <210> 33 <211> 330 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 33 ccccgagaac cacaggt gt a caccctgccc gt cagcct ga cct gcct ggt caaaggct t c agcaat gggc agccggagaa caact acaag tccttcttcc t ct acagcaa gaggt gggga acgt ct t c t c ccatcccgtg t at cccagcg accacgcct e gcttaccgtg gtgctcaagg at gcat gagg

<td>acgagctctg</td><td>cgtcccgcaa</td><td> 60</td>

<td>acat cgccgt</td><td>ggagt gggag</td><td> 120</td>

<td>ccgt gct gga</td><td>ct ccgacggc</td><td> 180</td>

<td>t cgt gcaggc</td><td>gcgcaggtgg</td><td> 240</td>

<td>ct ct gcacaa</td><td>ccact acaca</td><td> 300</td>

330 cagaagagcc tctccctgtc tccgggtaaa <210> 34 <211> 105 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 34

<td colspan="2">Pro Arg 1</td><td>Θ u</td><td>Pro</td><td>G n 5</td><td>Val</td><td>Туг</td><td>Thr</td><td>Leu</td><td colspan="3">Рго Pro Ser 10</td><td>Arg</td><td>flsp</td><td>(3 u 15</td><td>Leu</td>

<td>Gy</td><td>11 e</td><td>Al a</td><td>Gn</td><td>Val</td><td>Ser</td><td>Leu</td><td>Тћг</td><td>cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Туг</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>lle</td><td>AJ a</td><td>Val</td><td>0u</td><td>Trp</td><td>α u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>Gn</td><td>Pro</td><td>Ou</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>Lys</td><td>Тћг</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Туг</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Leu</td><td> 0/</td><td>Arg</td><td>Arg</td><td>Trp</td><td>Thr</td><td>Leu</td><td>G у</td><td>Asn</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>IVfet</td><td>H s</td><td>θυ</td><td>Al a</td><td>Leu</td><td>н s</td><td>Asn</td><td>H s</td><td>Туг</td><td>Thr</td><td>G n</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

50752 Β

Lys Ser Leu Ser Leu Ser Pro Gy Lys

100 105 <210> 35 <211> 315 <212> DNK <213> Neprirodna <220 <223> Neprirodna sekvenca <400 35 ccccgagaac cacaggt gt a caccct gccc ccat cccggg acgagctcgg catcgcgcaa gt cagcct ga cctgcctggt caaaggct t c tatcccagcg acatcgccgt ggagt gggag

120 agcaacgggc agccggagaa caact acaag accacgcct c ccgt gct gga ct ccgacggc

180 ttctcat gct ct gt ctccgg t ct acagcaa ccgt gat gca gt aaa gcttaccgtg t gaggct ct g ttgggccgca cacaaccact ggt ggaccct acacacagaa ggggaacgtc gagcct ct cc

240

300

315 <210> 36 <211> 105 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 36

<td colspan="2">Pro Arg 1</td><td>α u</td><td colspan="2">Pro G n 5</td><td>vai</td><td>Туг</td><td>Thr</td><td colspan="2">Leu Pro 10</td><td colspan="2">Pro Ser</td><td>Arg</td><td>Asp</td><td>G u 15</td><td>Leu</td>

<td>Gy</td><td>II e</td><td>Al a</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Qy</td><td>Phe</td><td>Туг</td><td>Pr o</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>II e</td><td>Ala</td><td>Val</td><td>Gu</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>Gn</td><td>Pro</td><td>Gu</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>G у</td><td>Ser</td><td>Phe</td><td>Рће</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Туг</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Leu</td><td>Gy</td><td>Arg</td><td>Arg</td><td>Trp</td><td>Thr</td><td>Leu</td><td>Gy</td><td>Asn</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>K/fet</td><td>H s</td><td>Gu</td><td>Al a</td><td>Leu</td><td>H S</td><td>Asn</td><td>rt s</td><td>Туг</td><td>Thr</td><td>Gn</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>G у</td><td>Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

50752 Β <210> 37 <211> 315 <212> DNK <213> Neprirodna <220 <223> Neprirodna sekvenca <400 37 ccccgagaac cacaggtgta caccctgccc ccatcccgtg acgagct cgg cat cgcgcaa gtcagcttga cctgcctggt caaaggcttt tat cccagcg acat cgccgt ggagt gggag

120 agcaacgggc agccggagaa caact acaag accacgcct c ccgt gct gga ct ccgacggc

180 tccttcttcc t ct acagcaa gct t accgt g ttgggccgca ggt ggaccct ggggaacgt c

240 ttctcat gct ccgtgatgca tgaggctctg cacaaccact.

acacacagaa gagcct ct cc

300 ct gt ct ccgg gt aaa

315 <210> 38 <211> 105 <212>PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400 38

<td colspan="2">Pro Arg 1</td><td>Gu</td><td colspan="3">Pro G n Val 5</td><td>Туг</td><td>Thr</td><td>Leu</td><td>Pr o 10</td><td>Pro</td><td colspan="2">Ser Arg</td><td>Asp</td><td>G u 15</td><td>Leu</td>

<td>Leu</td><td>Pro</td><td>Cys</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>G у</td><td>Phe</td><td>Туг</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>I le</td><td>Al a</td><td>Val</td><td>G u</td><td>Trp</td><td>Gu</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pr o</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>Gy</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Туг</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Phe</td><td>Cys</td><td>Pro</td><td>Arg</td><td>Trp</td><td>Leu</td><td>Q у</td><td>Gy</td><td>Asn</td><td>Val</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td>Oys</td><td>Ser</td><td>Vai</td><td>tet</td><td>н s</td><td>G u</td><td>A) a</td><td>Leu</td><td>H s</td><td>Asn</td><td>Н s</td><td>Туг</td><td>Тћг</td><td>G n</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>&lt;зу</td><td>Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

100 105 <210> 39 <211> 315 <212> DNK <213> Neprirodna

50752 Β <220>

<223> Neprirodna sekvenca <400> 39 ccccgagaac cacaggtgta caccctgccc gtcagcctga cctgcct ggt caaaggct tc agcaat gggc agccggagaa caactacaag ccat cccgt g t at cccagcg accacgcct c

<td>acgagct ct t</td><td>gccct gccaa</td><td> 60</td>

<td>acat cgccgt</td><td>ggagtgggag</td><td> 120</td>

<td>ccgt gct gga</td><td>ct ccgacggc</td><td> 180</td>

tctttcttcc t ct acagcaa gcttaccgtg ttctgcccca ggtggctggg ggggaacgtc

240 ttctcat gct ccgt gat gca

Igaggctctg cacaaccact acacacagaa gagcctctcc зоо ct gt ct ccgg gt aaa

315 <210> 40 <211> 105 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 40

<td>Pro 1</td><td colspan="2">Ar g Θ u</td><td>Pro</td><td>G n 5</td><td>Val</td><td>Туг</td><td>Thr</td><td>Leu</td><td>Pro 10</td><td colspan="2">Pro Ser</td><td colspan="2">Arg Asp</td><td>Gu 15</td><td>Leu</td>

<td>Thr</td><td>Lys</td><td>Asn</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Туг</td><td>Pr 0</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Ai a</td><td>Val</td><td>G u</td><td>Trp</td><td>Gu</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pr o</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>G у</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Туг</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Vai</td><td>Pro</td><td>Cys</td><td>h/fet</td><td>Arg</td><td>Trp</td><td>Trp</td><td>Gy</td><td>G у</td><td>Asn</td><td>Vai</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>vai</td><td>№t</td><td>H S</td><td>Gu</td><td>А1 a</td><td>Leu</td><td>Hs</td><td>Asn</td><td>H S</td><td>Туг</td><td>Thr</td><td>G n</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Gy</td><td>Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<210> 41 <211> 315 <212> DNK <213> Neprirodna <220 <223> Neprirodna sekvenca

50752 Β <400> 41 ccccgagaac cacaggtgta caccctgccc ccatcccggg atgagctgac caagaaccag gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gcttaccgtg ccctgcatga ggtggtgggg cgggaacgtc ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa gagcctctcc ctgtctccgg gtaaa <210> 42 <211> 115 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 42

120

180

240

300

315

<td>Arg 1</td><td colspan="2">Arg G u</td><td>Pro</td><td colspan="2">G n Val 5</td><td>Туг</td><td>Thr</td><td>Leu</td><td colspan="2">Pro Pro 10</td><td>Ser</td><td>Arg</td><td>Asp</td><td>Gu 15</td><td>Leu</td>

<td>Val</td><td>Leu</td><td>G у</td><td>G n</td><td>Val</td><td>Ser</td><td>Leu</td><td>A) a</td><td>Cys</td><td>Leu</td><td>vai</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Val</td><td>Val</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Arg</td><td>Leu</td><td>II e</td><td>Al a</td><td>Val</td><td>Gu</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>Lvs</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>ASp</td><td>Gy</td><td>Arg</td><td>G n</td><td>Leu</td><td>А1 a</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Asp</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td><td>Туг</td><td>Ser</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Pro</td><td>Pro</td><td>Arg</td><td>Leu</td><td>Lys</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Gy</td><td>Trp</td><td>Pr o</td><td>Arg</td><td>Trp</td><td>Gy</td><td>Tr p</td><td>Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td></td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Phe</td><td>Leu</td><td>Al a</td><td>Leu</td><td>rt S</td><td>Asn</td><td>Hi s</td><td>Туг</td><td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

Pro G у Lys

115 <210> 43 <211 >345 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 43

50752 Β cggcgagaac cacaggt gt a caccct gccc ccatcccgt g acgagct cgt cttggggcaa gtcagcctgg cctgcctcgt gaaaggcttc gt ggt ccggt t gat cgccgt ggagt gggag

120 agcaat gggc agccggagaa caact acaag accacgcctc ccgttctaga ctccgacggc

180 cggcagt tgg cggactcctt cttcctctac agcaagctt a ccgt gccccc gcggt t gaag

240 ggct ggccga ggtggggcrg ggggaacgt c ttctcatgca gt gt gat gt t cct ggcgct g

300 cacaaccact acacacagaa gagcctctcc ctgtctccgggt aaa

345 <210> 44 <211 >238 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 44

<td>Gu</td><td>Val</td><td>G n</td><td>Leu</td><td>Val</td><td>Gu</td><td>Ser</td><td>Gy</td><td>Gy</td><td>Gy</td><td>Leu</td><td>Val</td><td>Gn</td><td>Pr o</td><td>Gy</td><td rowspan="2">Arg</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>

<td>Ser</td><td>Leu</td><td>Arg</td><td>Leu</td><td>Ser</td><td>Cys</td><td>Al a</td><td>Al a</td><td>Ser</td><td>G у</td><td>Phe</td><td>Thr</td><td>Phe</td><td>Asn</td><td rowspan="2">Asp</td><td rowspan="2">Туг</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>

<td>Al a</td><td>№t</td><td>Hs</td><td>Trp</td><td>Val</td><td>Arg</td><td>Gn</td><td>Al a</td><td>Pro</td><td>Gy</td><td rowspan="2">Lys</td><td>Gy</td><td>Leu</td><td>G u</td><td rowspan="2">Trp</td><td>Val</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td>

<td>Ser</td><td>Gy</td><td>II e</td><td>Ser</td><td>Trp</td><td>Asp</td><td>Ser</td><td>Ser</td><td>Ser</td><td>11 e</td><td>Gy</td><td>Туг</td><td>Al a</td><td rowspan="2">Asp</td><td>Ser</td><td>Val</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td>

<td>Lys</td><td>Gy</td><td>Arg</td><td>Phe</td><td>Thr</td><td>l le</td><td>Ser</td><td>Arg</td><td>Asp</td><td>Asn</td><td>Al a</td><td rowspan="2">Lys</td><td>Asn</td><td>Ser</td><td>Leu</td><td>Туг</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td> 80</td>

<td>Leu</td><td>G n</td><td>№t</td><td>Asn</td><td>Ser</td><td>Leu</td><td>Arg</td><td>AJ a</td><td>G u</td><td>Asp</td><td>MJt</td><td>Al a</td><td>Leu</td><td rowspan="2">Туг</td><td>Туг</td><td rowspan="2">Cys</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td> 95</td>

<td>Val</td><td>Lys</td><td>Qy</td><td>Arg</td><td>Asp</td><td>Туг</td><td>туг</td><td>Asp</td><td>Ser</td><td rowspan="2">G у</td><td rowspan="2">Gy</td><td rowspan="2">Туг</td><td>Phe</td><td>Thr</td><td>Val</td><td>Al a</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td> 110</td><td></td><td></td>

<td>Phe</td><td>Asp</td><td>II e</td><td>Trp</td><td rowspan="2">Gy</td><td>G n</td><td>Gy</td><td>Thi</td><td>Nfet</td><td>Val</td><td>Thr</td><td>Val</td><td>Ser</td><td>Ser</td><td>Al a</td><td>Ser</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>Thr</td><td>Lys</td><td>Gy</td><td>Pro</td><td>G n</td><td>Val</td><td>Туг</td><td>Thr</td><td>Leu</td><td>Pro</td><td>Pro</td><td>Ser</td><td rowspan="2">Arg</td><td rowspan="2">Asp</td><td>Gu</td><td>Leu</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td>

<td>Val</td><td>Leu</td><td>Gy</td><td>G n</td><td>Val</td><td>Ser</td><td>Pro</td><td>Thr</td><td rowspan="2">Cys</td><td>Leu</td><td>Val</td><td rowspan="2">Lys</td><td>Gy</td><td>Phe</td><td rowspan="2">Туг</td><td>Pro</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td> 160</td>

<td>Ser</td><td>Asp</td><td>11 e</td><td>Al a</td><td>Val</td><td>Gu</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td rowspan="2">Gy</td><td>G n</td><td>Pro</td><td>G u</td><td>Asn</td><td>Asn</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td> 175</td><td></td>

50752 Β

<td>Туг</td><td>Lys</td><td colspan="2">Thr Thr 180</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp 185</td><td>Ser</td><td colspan="2">Asp G у</td><td>Ser</td><td>Phe 190</td><td>Phe</td><td>Leu</td>

<td>Туг</td><td>Qy</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Pro</td><td>Pro</td><td>Arg</td><td>Leu</td><td>Lys</td><td>Gy</td><td>Trp</td><td>Pro</td><td>Arg</td><td>Trp</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td>G у</td><td>Trp</td><td>Gy</td><td>Asn</td><td>Val</td><td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>M?t</td><td>H s</td><td>G u</td><td>Al a</td><td>Leu</td><td>H s</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td>Asn</td><td>н s</td><td>Туг</td><td>Thr</td><td>G n</td><td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pr 0</td><td>0y</td><td>Lys</td><td></td><td></td>

225 230 235 <210>45 <211> 714 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 45 gaagtgcagc t ggt ggagt c tgggggaggc ttggiacagc ct ggcaggtc cctgagact c tcct gt gcag cctctggatt cacct 11 aat gat t at gcca tgcactgggt ccggcaagct

120 ccagggaagg gcct ggagt g ggtctcaggt at aagt t ggg at agt agt ag t at aggct at

180 gcggactctg t gaagggccg at t caccat c tccagagaca acgccaagaa ctccct gt at

240 ctgcaaatga acagtct gag agct gaggac at ggcct t at at t act gt gt aaaaggcaga

300 gat t actat g at agt ggt gg at 11 cacg gt t gct 111 g at atctgggg ccaagggaca

360 at ggtcaccg t ctcttcagc ctccaccaag ggcccacagg tgt acaccct gcccccat cc

420 cgt gacgagc t cgt ct t ggg gcaagtcagc ccgacct gcc t ggt caaagg ct t ct at ccc

480 agcgacatcg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg

540 cct cccgt gc t ggact ccga cggctccttc cct ct acg gcaagct t ac cgtgcccccg

600 cggt t gaagg gctggccgag gt ggggct gg gggaacgt ct tctcatgctc cgt gatgcat

660 gaggct ct gc acaaccact a cacacagaag agcci ct ccc t gt ct ccggg t aaa

714 <210> 46 <211> 217 <212>PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 46

50752 Β

<td colspan="2">Asp 11 e 1</td><td colspan="2">Gn fc/fet</td><td>Thr 5</td><td colspan="2">Q n Ser</td><td>Pro</td><td>Ser</td><td>Thr 10</td><td>Leu</td><td>Ser</td><td>Al a</td><td>Ser</td><td>vai 15</td><td>Gy</td>

<td>Asp</td><td>Arg</td><td>vai</td><td>Thr</td><td>II e</td><td>Thr</td><td>Cys</td><td>Arg</td><td>Al a</td><td>Ser</td><td>G n</td><td>Ser</td><td>11 e</td><td>Ser</td><td>Arg</td><td>Trp</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Leu</td><td>a</td><td colspan="2">Trp Туг</td><td>Θ п</td><td>G n</td><td>Lys</td><td>Pro</td><td>Gy</td><td>Lys</td><td>Val</td><td>Pro</td><td>Lys</td><td>Leu</td><td>Leu</td><td>lle</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Туг</td><td>Lys</td><td>AJ a</td><td>Ser</td><td>Ser</td><td>Leu</td><td>Gu</td><td>Ser</td><td>Gy</td><td>Val</td><td>Pro</td><td>Ser</td><td>Arg</td><td>Phe</td><td>Ser</td><td>Gy</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Ser</td><td>G у</td><td>Ser</td><td>Gy</td><td>Thr</td><td>Gu</td><td>Phe</td><td>Thr</td><td>Leu</td><td>Thr</td><td>11 e</td><td>Ser</td><td>Ser</td><td>Leu</td><td>G n</td><td>Pro</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td colspan="2">A$p Asp</td><td>Phe</td><td>Al a</td><td>Thr</td><td>Туг</td><td>Туг</td><td>Cys</td><td>G n</td><td>G n</td><td>Туг</td><td>Asn</td><td>Ser</td><td>Туг</td><td>Ser</td><td>Phe</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Gy</td><td>Pro</td><td>Gy</td><td>Thr</td><td>Lys</td><td>Val</td><td>ASp</td><td>11 e</td><td>Lys</td><td>Arg</td><td>Thr</td><td>Val</td><td>Al a</td><td>Gu</td><td>Pro</td><td>G n</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Val</td><td>Туг</td><td>Thr</td><td>Leu</td><td>Pro</td><td>Pro</td><td>Ser</td><td>Arg</td><td>Asp</td><td>G u</td><td>Leu</td><td>Val</td><td>Leu</td><td>Gy</td><td>G n</td><td>Val</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>Ser</td><td>Pr o</td><td>Thr</td><td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td>Gy</td><td>Phe</td><td>Туг</td><td>Pro</td><td>Ser</td><td>Asp</td><td>lle</td><td>Al a</td><td>Val</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td>Gu</td><td>Trp</td><td>G u</td><td>Ser</td><td>Asn</td><td>Gy</td><td>G п</td><td>Pr o</td><td>Θ u</td><td>Asn</td><td>Asn</td><td>Туг</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Ser</td><td>Asp</td><td>ОУ</td><td>Ser</td><td>Phe</td><td>Phe</td><td>Leu</td><td>Туг</td><td>Gy</td><td>Lys</td><td>Leu</td><td>Thr</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td>Val</td><td>Pro</td><td>Pro</td><td>Arg</td><td>Leu</td><td>Lys</td><td>Gy</td><td>Trp</td><td>Pro</td><td>Ar g</td><td>Trp</td><td>Gy</td><td>Trp</td><td>Gy</td><td>Asn</td><td>Val</td>

<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td>Phe</td><td>Ser</td><td>Cys</td><td>Ser</td><td>Val</td><td>IVfet</td><td>H S</td><td>Gu</td><td>Al a</td><td>Leu</td><td>H $</td><td>ASO</td><td>H s</td><td>Туг</td><td>Thr</td><td>G n</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td>Lys</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Pro</td><td>Gy</td><td>Lys</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<210> 47 <211 >651 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 47

50752 Β gacatccaga t gacccagt c tccttccacc ct gt ct gcat ct gt aggaga cagagt cacc at cact t gcc gggccagt ca gagt at t agt aggt ggt t gg cct ggt at ca gcagaaacca

120 gggaaagt cc ct aagctcct gat ct at aag gcat ct agt t t agaaagt gg ggt cccatca

180 aggttcagcg gcagt ggat c t gggacagaa ttcactctca ccatcagcag cctgcagcct

240 caact t at t a ct gccaacag t at aat agt t at t ct 11 cgg ccctgggacc

300 aaagt ggat a t caaacgaac t gt ggct gaa ccacaggtgt acaccctgcc cccat cccgt

360 gacgagctcg t cttggggca agt cagcccg t caaaggct t ct at cccagc

420 gacatcgccg t ggagt ggga gagcaat ggg cagccggaga acaact acaa gaccacgcct

480 cccgtgctgg act ccgacgg ct cct t ct t c ct ct acggca agct t accgt gcccccgcgg

540 ttgaagggct ggccgaggtg gggctggggg aacgtcttct catgct ccgt gat gcat gag

600 gctctgcaca accactacac acagaagagc ct ct ccct gt ctccgggt aa

651 <210> 48 <211> 129 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (35)...(36) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <220>

<221 > misc_karakteristika <222> (38)...(42) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <220>

<221 > misc_karakteristika <222> (95)...(98) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <400 48

<td></td><td rowspan="2">Lys</td><td rowspan="2">Туг</td><td>Leu</td><td>Leu</td><td>Pro</td><td>Thr</td><td>А1 a</td><td>Al a</td><td>Al a</td><td rowspan="2">G У</td><td>Leu</td><td>Leu</td><td>Leu</td><td>Leu</td><td>Al a</td>

<td> 1</td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Al a</td><td>Q n</td><td>Pro</td><td>Al a</td><td>kfet</td><td>А1 a</td><td>Val</td><td>Al a</td><td>Al a</td><td>Pro</td><td>Ser</td><td>Val</td><td>Phe</td><td>11 e</td><td>Phe</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Pro</td><td>Ser</td><td>Хаа</td><td>Хаа</td><td>61 П</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Al a</td><td>Ser</td><td>Val</td><td>Val</td><td rowspan="2">Cys</td><td>Leu</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td>

<td>Leu</td><td>Asn</td><td>Asn</td><td>Phe</td><td rowspan="2">Туг</td><td>Pro</td><td>Arg</td><td>G u</td><td>AI a</td><td rowspan="2">Lys</td><td>Val</td><td>Q n</td><td rowspan="2">Trp</td><td rowspan="2">Lys</td><td>Val</td><td rowspan="2">Asp</td>

<td></td><td> 50</td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td>

50752 Β

<td>Asn 65</td><td colspan="2">Al a Leu</td><td colspan="2">G n Ser</td><td>Gy 70</td><td colspan="2">Asn Ser</td><td>G n</td><td>G u</td><td>Ser 75</td><td>vai</td><td>Thr</td><td>G u</td><td>G n</td><td>Asp 80</td>

<td>Ser</td><td>Lys</td><td>Asp</td><td>Ser</td><td>Thr</td><td>Туг</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Thr</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Хаа</td><td>Хаа</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Хаа</td><td>Хаа</td><td>Туг</td><td>Gu</td><td>Lys</td><td>H s</td><td>Lys</td><td>Val</td><td>Туг</td><td>Al a</td><td></td><td>G u</td><td>Val</td><td>Thr</td><td>Н s</td><td>G n</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Q у</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Рго</td><td>Val</td><td>Thr</td><td>Lys</td><td>Ser</td><td>Phe</td><td>Asn</td><td>Arg</td><td>Gy</td><td>Θ u</td><td>Al a</td><td>Ala</td>

115 120 125

Al а <210 49 <211 >387 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (103)...(104) <223> η je a, c, g ili t <220>

<221 > misc_karakteristika <222> (106)...(107) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (112)...(113) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (115)...(116) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (118)...(119) <223> n је a, c, g ili t <220>

<221 > misc_karakteristika <222> (121)...(122) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (124)...(125) <223> n je a, c, g ili t <220>

<221>misc karakteristika <222* (283)1.(284) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (286)...(287) <223> n je a, c, g ili t <220>

<221>misc karakteristika <222> (289)7..(290) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (292)...(293) <223> n je a, c, g ili t <400> 49 at gaaat acc t at t gcct ac ggcagccgct ggat t gt t at t act cgcggc ccagccggcc at ggccgt gg ctgcaccatc tgtcttcatc cccgccat ct nnsnnsca gnnsnnsnns

120 nnsnnsgcct ctgttgtgtg cct gctgaat aacttctatc ccagagaggc caaagtacag

180 t ggaaggt gg at aacgccct ccaat cgggt aactcccagg agagt gt cac agagcaggac

240 agcaaggaca gcacct acag cctcagcagc accctgacgt tgnnsnnsnn snnst acgag

300 aaacacaaag t ct acgcct g cgaagtcacc cat cagggcc t gagct cgcc cgtcacaaag

360 agct tcaaca ggggagaggc ggccgca

387 <210> 50 <211> 132 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (35)...(36) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <220>

<221 > misc_karakteristika <222> (38)...(42) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi

50752 Β <220 <221 > misc_karakteristika <222> (95).7(101) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <400 50

<td>Ltet 1</td><td>LyS</td><td>Туг</td><td colspan="2">Leu Leu 5</td><td>Pro</td><td>Thr</td><td colspan="5">Ala Ala Ala G у Leu 10</td><td>Leu</td><td>Leu</td><td>Leu 15</td><td>Al a</td>

<td>Al a</td><td>Gn</td><td>Pr o</td><td>AJ a</td><td>Kfei</td><td>Al a</td><td>Val</td><td>Al a</td><td>AJ a</td><td>Pro</td><td>Ser</td><td>Val</td><td>Phe</td><td>11 e</td><td>Рће</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Pro</td><td>Ser</td><td>Хаа</td><td>Хаа</td><td>G n</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Ala</td><td>Ser</td><td>vai</td><td>vai</td><td rowspan="2">cys</td><td>Leu</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td>

<td>Leu</td><td>Asn</td><td>Asn</td><td>Phe</td><td rowspan="2">Туг</td><td>Pro</td><td>Arg</td><td>Gu</td><td>Al a</td><td>Lys</td><td>Val</td><td>Θ n</td><td>Trp</td><td rowspan="2">Lys</td><td>Val</td><td rowspan="2">Asp</td>

<td></td><td> 50</td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td>

<td>Asn</td><td>Al a</td><td>Leu</td><td>G n</td><td>Ser</td><td>G у</td><td>Asn</td><td>Ser</td><td>G n</td><td>Gu</td><td>Ser</td><td>Val</td><td>Thr</td><td>G u</td><td>G n</td><td>Asp</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Ser</td><td rowspan="2">Lys</td><td rowspan="2">Asp</td><td>Ser</td><td>Thr</td><td rowspan="2">Туг</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Thr</td><td>Leu</td><td>Тћг</td><td>Leu</td><td>Хаа</td><td>Хаа</td>

<td></td><td></td><td> 85</td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td rowspan="2">Туг</td><td>G u</td><td rowspan="2">Lys</td><td>Hs</td><td rowspan="2">Lys</td><td>Val</td><td rowspan="2">Туг</td><td>AJ a</td><td>Cys</td><td>G u</td><td>Val</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td> 105</td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Thr</td><td>H s</td><td>G n</td><td rowspan="2">Gy</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Pro</td><td>Val</td><td>Thr</td><td rowspan="2">LyS</td><td>Ser</td><td>Phe</td><td>Asn</td><td rowspan="2">Arg</td><td rowspan="2">G у</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td> 125</td><td></td>

G u Ala Ala Ala

130 <210> 51 <211 >396 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (103)...(104) <223> n je a, c, g ili t <220>

<221>misc karakteristika <222> (10б“..(107) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (112)...(113) <223> η је а, с, g ili t <220 <221 > misc_karakteristika <222> (115)...(116) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (118)...(119) <223>nje a, c, g ili t <220 <221 > misc_karakteristika <222> (121)...(122) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (124)...(125) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (283)...(284) <223> п je a, c, g ili t <220 <221 > misc_karakteristika <222> (286)7.(287) <223> n je a, c, g ili t <220 <221>misc karakteristika <222> (289)7 .(290) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (292)...(293) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (295)...(296) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (298)...(299) <223> n je a, c, g ili t <220 <221>misc karakteristika

50752 Β <222> (301)...(302) <223> η је а, с, g ili t <400> 51 at gaaat acc t at t gcct ac ggcagccgct ggat t gt t at t act cgcggc ccagccggcc atggccgtgg ctgcaccatc tgtct tcatc ttcccgccat ct nnsnnsca gnnsnnsnns

120 nnsrinsgcct ct gttgtgtg cctgct gaat aacttctatc ccagagaggc caaagt acag

180 t ggaaggt gg ataacgccct ccaat cgggt aact cccagg agagt gt cac agagcaggac

240 agcaaggaca gcacct acag cctcagcagc accct gacgt t gnnsnnsnn snnsnnsnns

300 nnst acgaga aacacaaagt ct acgcct gc gaagtcaccc at cagggcct gagct cgccc

360 gt cacaaaga gct t caacag gggagaggcg gccgca

396 <210> 52 <211> 134 <212> PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221> misc_karakteristika <222> (35)...(36) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <220>

<221 > misc_karakteristika <222> (38)...(42) <223> Хаа može biti bilo која amino kiselina koja se javlja u prirodi <220>

<221 > misc_karakteristika <222> (95)...(103) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi

<td> &lt;400:</td><td> &gt;52</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>iVfet</td><td>Lys</td><td>Туг</td><td>Leu</td><td>Leu</td><td>Pro</td><td>Thr</td><td>Al a</td><td>А1 a</td><td>А1 a</td><td rowspan="2">Gy</td><td>Leu</td><td>Leu</td><td>Leu</td><td>Leu</td><td>Al a</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td> 15</td><td></td>

<td>AJ a</td><td>α n</td><td>Pro</td><td>Al a</td><td>№t</td><td>Al a</td><td>Val</td><td>Al a</td><td>Al a</td><td>Pro</td><td>Ser</td><td>Val</td><td>Phe</td><td>11 e</td><td>Phe</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Pro</td><td>Ser</td><td>Хаа</td><td>Хаа</td><td>Gn</td><td>Хаа</td><td>хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Al a</td><td>Ser</td><td>Val</td><td>Val</td><td rowspan="2">Cys</td><td>Leu</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td>

<td>Leu</td><td>Asn</td><td>Asn</td><td>Phe</td><td>Туг</td><td>Pro</td><td>Arg</td><td>Gu</td><td>Ai a</td><td>Lys</td><td>Val</td><td>G n</td><td></td><td>Lys</td><td>Val</td><td>Asp</td>

50752 Β

<td>Asn 65</td><td>Al a</td><td colspan="2">Leu G n</td><td>Ser</td><td>Gy 70</td><td>Asn</td><td>Ser</td><td>G n</td><td>Gu</td><td>Ser 75</td><td>Val</td><td>Thr</td><td>G u</td><td>Gn</td><td>Asp 80</td>

<td>Ser</td><td>Lys</td><td>Asp</td><td>Ser</td><td>Thr</td><td>Туг</td><td>Ser</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Thr</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Хаа</td><td>Хаа</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Туг</td><td>Gu</td><td>Lys</td><td>Hs</td><td>Lys</td><td>Val</td><td>Туг</td><td>Al a</td><td>Cys</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>G u</td><td>Val</td><td>Thr</td><td>H S</td><td>Q п</td><td>Gy</td><td>Leu</td><td>Ser</td><td>Ser</td><td>Pro</td><td>Val</td><td>Thr</td><td>Lys</td><td>Ser</td><td>Phe</td><td>Asn</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>Arg</td><td>Gy</td><td>Gu</td><td>Ai a</td><td>Ai a</td><td>Al a</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

130 <210> 53 <211 >402 <212>DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karaktenstika <222> (103)...(104) <223> η je a, c, g ili t <220>

<221 > misc_karakteristika <222> (106)...(107) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (112)...(113) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (115)...(116) <223> n je a, c, g ili t <220>

<221 > misc karakteristika <222>(11бј?..(119) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (121)...(122) <223> n je a, c, g ilit

S0752 Β <220>

<221 > misc_karakteristika <222> (124)...(125) <223> η je a, c, g ili t <220>

<221 > miscjcarakteristika <222> (283)...(284) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (286)...(287) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (289)...(290) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (292)...(293) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (295)...(296) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (298)...(299) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (301)...(302) <223> п je a, c, g ili t <220>

<221 > misc_karakteristika <222> (304)...(305) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (307)...(308) <223> n je a, c, g ili t <400> 53

50752 Β at gaaat acc t at t gcct ac ggcagccgct t actcgcggc ccagccggcc at ggccgt gg ctgcaccatc tgt ct tcat c cccgccat ct nnsnnsca gnnsnnsnns

120 nnsnnsgcct cctgctgaat aact tct at c ccagagaggc caaagt acag

180 t ggaaggt gg at aacgccct ccaat cgggt aactcccagg agagt gt cac agagcaggac

240 agcaaggaca gcacctacag cctcagcagc accct gacgt t gnnsnnsnn snnsnnsnns зоо nnsnnsnnst acgagaaaca caaagt ct ac gcct gcgaag t cacccat ca gggcctgagc

360 t cgcccgtca caaagagct t caacagggga gaggcggccg ca

402 <210> 54 <211> 127 <212>PRT <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (38)...(45) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <220>

<221 > misc_karakteristika <222> (95)...(101) <223> Хаа može biti bilo koja amino kiselina koja se javlja u prirodi <400> 54

<td>ktet 1</td><td>Lys</td><td>Туг</td><td colspan="4">Leu Leu Pro Thr 5</td><td>Ai a</td><td colspan="3">Ala Ala Gy 10</td><td>Leu</td><td>Leu</td><td>Leu</td><td>Leu 15</td><td>Al a</td>

<td>Ai a</td><td>G n</td><td>Pro</td><td>Al a</td><td>IVfet</td><td>AJ a</td><td>Al a</td><td>Ser</td><td>Thr</td><td rowspan="2">Lys</td><td rowspan="2">G у</td><td>Pro</td><td>Ser</td><td>Val</td><td>Phe</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Leu</td><td>А1 a</td><td>Pro</td><td>Ser</td><td>Ser</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Al a</td><td>Leu</td><td rowspan="2">&lt;3 У</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td>

<td>Cys</td><td>Leu</td><td>Val</td><td>Lys</td><td rowspan="2">Asp</td><td rowspan="2">Туг</td><td>Phe</td><td>Pr o</td><td>G u</td><td>Pro</td><td>Val</td><td>Thr</td><td>Val</td><td>Ser</td><td rowspan="2">Trp</td><td>Asn</td>

<td></td><td> 50</td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td>

<td>Ser</td><td rowspan="2">Gy</td><td>Al a</td><td>Leu</td><td>Thr</td><td>Ser</td><td rowspan="2">ОУ</td><td>Val</td><td>H $</td><td>Thr</td><td>Рће</td><td>Pro</td><td>Al a</td><td>Val</td><td>Leu</td><td>G n</td>

<td> 65</td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Ser</td><td>Ser</td><td>Gy</td><td>Leu</td><td>Туг 85</td><td>Ser</td><td>Leu</td><td colspan="2">Ser Ser</td><td>Val 90</td><td>Val</td><td>Thr</td><td>Val</td><td>Pro</td><td>Хаа 95</td><td>Хаа</td>

<td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Хаа</td><td>Thr</td><td>Туг</td><td>11 e</td><td>Cys</td><td>Asn</td><td>Val</td><td>Asn</td><td>н s</td><td>Lys</td><td>Pro</td><td>Ser</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Asn</td><td>Thr</td><td>Lys</td><td>Val</td><td>Asp</td><td>Lys</td><td>Lys</td><td>Val</td><td>Gu</td><td>Pr o</td><td>Lys</td><td>Ser</td><td>А1 a</td><td>Al a</td><td>Al a</td><td></td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

50752 Β <210> 55 <211> 381 <212> DNK <213> Neprirodna <220 <223> Neprirodna sekvenca <220 <221 > misc_karakteristika <222> (112)...(113) <223> η je a, c, g ili t <220 <221 > misc_karakteristika <222> (115)...(116) <223>njea, c, gilit <220 <221 > misc_karakteristika <222> (118)...(119) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (121)...(122) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (124)...(125) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (127)...(128) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (130)...(131) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (133)...(134) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (283)...(284) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika

50752 Β <222> (286)...(287) <223> η је а, с, g i!i t <220>

<221 > misc_karakteristika <222> (289)...(290) <223>njea, c, gilit <220>

<221 > misc_karakteristika <222> (292)...(293) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (295)...(296) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (298)...(299) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (301). . .(302) <223> n je a, c, g ili t <400> 55

<td>atgaaal acc</td><td>t at t gcct ac</td><td>ggcagccgct</td><td>ggat t gt t at</td><td>t act cgcggc</td><td>ccagccggcc</td><td> 60</td>

<td>atggccgcct</td><td>ccaccaaggg</td><td>cccat cggt c</td><td>11 ccccct gg</td><td>caccctcctc</td><td>cnnsnnsnns</td><td> 120</td>

<td>nnsnnsnnsn</td><td>nsnnsgccct</td><td>gggctgcctg</td><td>gt caaggact</td><td>acttccccga</td><td>accggt gacg</td><td> 180</td>

<td>glgtcgt gga</td><td>act caggcgc</td><td>cct gaccagc</td><td>ggcgtgcaca</td><td>cct t cccggc</td><td>t gt cct acag</td><td> 240</td>

<td>t cct caggac</td><td>t ct act ccct</td><td>cagcagcgt g</td><td>gt gaccgt gc</td><td>ccnnsnnsnn</td><td>snnsnnsnns</td><td> 300</td>

<td>nnsacci aca</td><td>tctgcaacgt</td><td>gaatcacaag</td><td>cccagcaaca</td><td>ccaaggt gga</td><td>caagaaagtt</td><td> 360</td>

<td>gagcccaaat</td><td>ctgcggccgc</td><td>a</td><td></td><td></td><td></td><td> 381</td>

<210> 56 <211> 87 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (49)...(50) <223> п je a, c, g ili t

50752 Β <220>

<221 > misc_karakteristika <222> (52)...(53) <223> η je a, c, g ili t <220>

<221 > misc_karakteristika <222> (58)...(59) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (61)...(62) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (64).7(65) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (67). (68) <223> n je a, c, g ιϋ t <220>

<221 > misc_karakteristika <222> (70)...(71) <223> n je a, c, g ili t <400> 56 cttaccatgg ccgtggctgc accatctgtc ttcatcttcc cgccatctnn snnscagnns nnsnnsnnsn nsgcctctgt tgtgtgc <210> 57 <211> 26 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 57 tgacaacgtc agggt gct gc t gaggc 26 <210> 58 <211> 41 <212> DNK <213> Neprirodna

50752 Β <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (12)...(13) <223> η je a, c, g ili t <220>

<221 > misc_karakteristika <222> (15)...(16) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (18)...(19) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (21)...(22) <223> n je a, c, g ili t <400> 58 tcagaacgtt gnnsnnsnns nnst acgaga aacacaaagt <210> 59 <211 >50 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (12)...(13) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (15)...(16) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (18)...(19) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (21)...(22) <223> n je a, c, g ili t

50752 Β <220>

<221 > misc_karakteristika <222> (24)...(25) <223> η je a, c, g ili t <220>

<221 > misc_karakteristika <222> (27)...(28) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (30)...(31) <223> n je a, c, g ili t <400> 59 t cagaacgt t gnnsnnsnns nnsnnsnnsn nst acgagaa acacaaagt c <210> 60 <211 >56 <212>DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221> misc_karakteristika <222> (12)...(13) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (15)...(16) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (18)...(19) <223> n je a, c, g ili t <220>

<22l>misc karakteristika <222> (21).7(22) <223> n je a, c, g ili t <220>

<221 > misc karakteristika <222> (24).7(25) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (27) 7(28)

50752 Β <223> η је а, с, g ili t <220>

<221 > misc_karakteristika <222> (30)...(31) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (33)...(34) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (36)...(37) <223> n je a, c, g ili t <400> 60 tcagaacgtt t gnnsnnsnns nnsnnsnnsn nsnnsnnsta cgagaaacac aaagt c <210> 61 <211> 31 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 61 cat cgcggcc gcct ct cccc t gt t gaagct c 31 <210> 62 <211 >99 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (58)...(59) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (61)...(62) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (64)...(65) <223> nje a, c, g ilit

100

50752 Β <220>

<221 > misc_karakteristika <222> (67)...(68) <223> η je a, c, g ili t <220>

<221 > misc_karakteristika <222> (70)...(71) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (73)...(74) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (76)...(77) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (79)...(80) <223> n je a, c, g ili t <400> 62 acgtccatgg ccgcctccac caagggccca tcggtcttcc ccctggcacc ctcctccnns 60 nnsnnsnnsn nsnnsnnsnn sgccctgggc tgcctggtc 99 <210> 63 <211> 23 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400> 63 ggcacggt ca ccacgct gct gag 23 <210>64 <211 >61 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <220>

<221 > misc_karakteristika <222> (19)...(20)

101

50752 Β <223> η је а, с, g ili t <220 <221 > misc_karakteristika <222> (22)...(23) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (25)...(26) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (28)...(29) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (31)...(32) <223> n je a, c, g ili t <220>

<221 > misc_karakteristika <222> (34)...(35) <223> n je a, c, g ili t <220 <221 > misc_karakteristika <222> (37)...(38) <223> n je a, c, g ili t <400 64 agcgtggtga ccgtgcccnn snnsnnsnns nnsnnsnnsa cctacatctg caacgtgaat 60 c · 61 <210> 65 <211 >36 <212> DNK <213> Neprirodna <220>

<223> Neprirodna sekvenca <400 65 cat agcggcc gcagatttgg gctcaacttt cttgtc c 36

102

50752 Β

Patentni zahtevi