Method of cdna fragment cleaning with specific nucleotide sequence

The present invention relates to a process for purifying a cDNA fragment, having a specific deoxynucleotide sequence, which encodes human growth hormone. 5

It is known that proteins and peptides are synthesized almost to infinity of varieties in living organisms. Many of these have proved to be of medical, industrial or agricultural use. Some of the proteins are enzymes, used as specific catalysts for complex chemical reactions. Others, act as hormones, which act on the growth or development of an organism, or on the function of specific tissues in medically important ways. Proteins with specific links may be of commercial importance for isolation and purification₂0 traces of substances and to eliminate contamination substances.

Both proteins and peptides are composed of linear amino acid chains, the last term being used to shorten single-stranded sequences, the first refers to multilayer or long-chain substances.

Peptides and proteins are generally high molecular weight substances, each of which has a specific amino acid sequence. Except for smaller peptides, peptide and protein synthesis are often impractical, costly and time consuming, if not impossible. In most cases, in order to make practical use of the desired protein, it must first be isolated from the body that produces it. Frequently, the desired protein is present only in tiny amounts. Often, the source organism cannot be obtained in sufficient quantities to produce an adequate amount of the desired protein. As a result, many of the potential medical, industrial and agricultural applications of specific proteins are known, but remain virtually unresolved because there is no adequate source of desired protein and peptide.

Recently, or rather, recently developed techniques have made possible the use of microorganisms capable of

8.0006

THE PRICE OF LEI '32, 91 rapid and abundant growth, for the synthesis of commercially useful proteins and peptides. These techniques make it possible to genetically equip a suitable microorganism with the ability to synthesize a protein or peptide, normally prepared by another organism. The technique uses a fundamental relationship that exists in all living organisms and between genetic material, usually DNA and proteins synthesized by the body. This relationship is such that the amino acid sequence of the protein is reflected in nucleotide sequence 15 of the DNA. There are one or more groups of specific trinucleotide sequences, linked to each of the two 4 dozen amino acids, which most often occur in proteins. The specific relationship between each given trinucleotide sequence and its corresponding amino acid constitutes the genetic code. The genetic code is believed to be the same or similar for all living organisms. As a consequence, the amino acid sequence of each .protein or peptide is reflected by the corresponding nucleotide sequence, according to the well-known relationship. Moreover, this 'nucleotide sequence can, in principle, be transcribed by any living organism, in Table 1 the genetic code is given' for a number of substances.

Table 1

<td>Substance (a</td><td>Codu.1 genetic</td><td>Substance</td><td>the code genetic</td>

<td>phenylalanine</td><td>TTK</td><td>Hyistidine (His)</td><td>, CAK</td>

<td>Leucine (Leo)</td><td>XTY</td><td>Glutamine (Gin)</td><td>CAJ</td>

<td>Isoleucine (Ile)</td><td>ATM</td><td>Asparagine (Asn)</td><td>AAK</td>

<td>Methionine (Met)</td><td>ATG</td><td>Lysine (Lys)</td><td>AAJ</td>

<td>Valina (Wave)</td><td>GTL</td><td>Aspertic Acid (Asp)</td><td>. GAK</td>

<td>Serine (Serum)</td><td>QRS</td><td>Glutamic acid (Glu)</td><td>PLEDGE</td>

<td>Proline (Pro)</td><td>OCL</td><td>Tank (Cys)</td><td>TGK</td>

<td>Threonine (Thr)</td><td>ACE</td><td>Tryptophan (Try)</td><td>TGG</td>

<td>Alanine (Aln)</td><td>GCL</td><td>Arginine (Arg)</td><td>WGZ</td>

<td>Termination signal</td><td>TAJ</td><td>Termination signal</td><td>TGA</td>

KEY: like »5

Each triplet of letters represents a DNA triiuicleotide, with a 'left' rock and a 3 'end on the right. The corresponding letters represent purine or pyrimidine bases of A = adenine G = fivanine:

C-cytosine;

T = tymin;

X = T or c if Y is A sbu G; Y = A, G, C, or T if X is C; Y = A or G if X is τ:

X = C if Y1 is C or T;

W — c or A if Z is A or C: W = c if Z? is C or T:

Z — A, g. C or T if W is C; Z = A or G if W is A:

QR-TC if S is a. G. C or T: QR-AG if s τ or C:

S = A. G, C or T if QR is TC: S = T or C if QR is AG.

forming the nucleotide sequence: j = A or c: k = t or c:

L-A. T, C or G:

Μ — Λ, c or T:

Trinucleotides of table 1, called codons, are presented as trinucleo, DNA strands, as they exist in the genetic material of the living organism. Expression of these codons in protein synthesis requires intermediate formation of one

Messenger DNA (mRNA). Codons! mRNAs have the same sequences as the DNA codons in Table 1, except that uracil is found instead of thymine. DNA complementary trinucleotide sequences, having opposite polarity chains, are functionally equivalent to the codons in table 1, as known by the specialists. An important and well-known aspect of the genetic code is its degeneration, whereby most of the amino acids used for protein preparation can be used more than one for encoding the nucleotide triplet. Therefore, a number of different nucleotide sequences may constitute the code for a given amino acid sequence. . Such nucleotide sequences are considered functionally equivalent, because they can result in the production of the same amino acid sequence in all organisms, although some chains can transcribe some sequences more efficiently than others would. Occasionally, a methylated variant of purine or pyrimidine may be detected in a given nooleotide sequence. Such trades do not in any way affect the coding relationship. It is worth noting that the method of equipping a microorganism with the ability to synthesize a new protein has three general stages:

(1) isolation and purification of the specific gene or nucleotide sequence containing the genetic information, encoded for the amino acid sequence of the desired protein_; (2) recombining the nucleotide sequence with a suitable transfer vector, typically the DNA of a bacteriophage or a plasmid; (3) transferring the vector to a microorganism and selecting a receptor microorganism strain, which contains the desired genetic information.

A fundamental difficulty encountered in the attempts to commercially exploit the process described, in general, occurs in the first stage - isolation and purification of the desired specific genetic information, DNA exists in all living cells in the form of highly molecular-weight nucleotide chains. big. A cell can contain more than 10 0C0 structural genes, encoding the amino acid sequences of the over 10,000 specific proteins, each gene having a sequence of several hundred nucleotides in length. For the most part, four different nucleotide bases give rise to all Oxistenic sequences. These are adenine (A), guanine (G), cystosine (C) and thymine (T). The long sequences, comprising the Structural genes of the specific proteins, are consequently very similar in the whole chemical composition and physical properties. Separating such a sequence from the plethora of other sequences present in the isolated DNA cannot usually be accomplished by conventional physical and chemical preparation methods.

MRNA functions In the processes of converting the nucleotide information of the DNA into the structure of the amino acid sequence of the protein in the first stage of this process, unpublished transcription, a local segment of the DNA has a nucleotide sequence that specifies a protein to be prepared, it is first copied to RNA. RNA is a polynucleotide similar to DNA, except ribose is substituted with deoxy, ribose, and uracil is used instead of friamine. Nucleotide rays in RNA are able to enter the same way and base pairs, according to relationships that are known to exist between complementary strands of DNA. A and U {Tj are complementary, and G and C are also complementary. The RNA transcribed from a nucleotide DNA sequence will be complementary to the copied sequence. Thus, RNA is defined with messenger RNA, because of its status as an intermediary between the cell's genetic apparatus and its protein synthesis apparatus. Generally, only, the mRNA sequence, present in the cell at a given time, is that which corresponds to the protein actively synthesized at that time. Thus, a differentiated cell whose function is, first, to synthesize a single protein, pa, contains, first of all, the RNA species that correspond to that protein. When possible, isolation and purification of the appropriate nucleotide sequence, which encodes for a protein, may be accomplished by isolating the mRNA code for specialized synthesis of such a protein into differentiated cells.

A major disadvantage of the procedure described above is that it is applicable only in relatively rare cases, where cells can be found to be involved, in the primary synthesis of a single protein. Most proteins of commercial interest are not synthesized on this strand. The desired proteins may be one of a hundred or different proteins, which are produced by cells of a network or organism at a given time. No doubt that technically? RNA isolation is the potential of smallpox, because the establishment of the d &lt;RNA species present in the cell represents, of course, only a fraction of their total sequences that exist in DNA and thus performs an initial purification. In order to have the advantage of such a purification, it is necessary a method by which even in the cases with sequences present in a small frequency, so in a lyrical percentage, they are isolated in a high purity. For the purpose of genetic modification of microorganisms, for Ca such modified organisms can not be used practically, in literature, it is cited: Patent, RSR, no. 78200 ·

Patents, France, no. 2281426; 243 541.

The present invention extends the range of processes aimed at obtaining human protein-producing microorganisms, in that it performs a process of purifying a cDNA fragment, having a specific deoxynucleotide sequence, which encodes human growth hormone, for recombination with a vector of Transfer DNA and transfer to a microorganism, comprising the steps of isolation of human pituitary tissue, isolation of an ARm population from this pituitary tissue, synthesizing a cDNA population from said mRNA and purifying the cDNA, which encodes the human growth hormone from the population _rSaid cDNA, wherein this purified cDNA represents a minority of the cDNA population and at least a portion of these cDNAs have at least two restriction sites, wherein said cDNA population is heterogeneous in terms of length and sequence, and is prepared from the mRNA population, which is heterogeneous in length and sequence, using a reverse transcriptase catalyzed reaction, consisting in the fact that cDNA, which encodes human growth hormone, is purified, using the following steps: a) enzymatic hydrolysis of the cDNA population specifically, at the restriction sites, by incubating a reaction mixture containing said cDNA population and endonuclease specific restriction for these restriction sites, namely by incubating the population mentioned in Haelli at pH = 7.5 and 37 ° C, for one to two hours, to produce cDNA fragments; b) fractionation of these cDNA fragments according to their length, namely, by gel electrophoresis, separating these cDNA fragments into fractions: containing homogeneous cDNA fragments, and c) collecting the fraction containing the cDNA fragment, which encodes the hormone. human growth, the respective fraction containing predominantly this fragment.

An embodiment of the invention is given below.

Purification of the cDNA whose nucleotide sequence comprises, most of the HGH coding region described, together with the synthesis of a plasmid transfer vector containing purified DNA and the construction of a family of microorganisms posing DNA as part of its genetic construction. Five benign human pituitary tumors, suddenly cooled by liquid nitrogen, after surgical removal and weighing 0.4 to 1.5 g each, were softened and homogenized in 4M guan thiocyanate (hen containing IM mercaptoethanol adjusted to pH = 5 , 0 ', at 4 ° C. The homogenized product was deposited over 1.2 ml of 5.7 M CsCl, containing 100 mM EDTA and centrifuged for 18 h at 37000¹ rot / min, at 15 ° C. The RNA migrated to the bottom of the respective tube. Polyadenylated β-cRNA was obtained after double chromatography on cellulose oligo-dT (see Aviv and Leder, Supra.). Polyadenylated cRNA enriched in HGH '_: MRNA by sedimentation in a sucrose gradient 5 ... 20¾ (weight by volume), at 4 ° C, at 25CC0 rpm for 16 h. Region 1 S-14S of the gradient was analyzed and about J0% of the RNA thus isolated encoded for growth hormone, as appreciated, by incorporating an amino acid precursor, radioactive, into the hormone precipitate material of anti-Growth.e., initiating a system of cell-free translation derived from wheat germs- [Roberts Β. E. and Pattersan Β. M., Proc, Nat. Acad. Sci - USA 70,2330 (1973)]. Polyadienylated RNA was used for the synthesis of a beam: double cDNA, as described by Ullrich

A., et al ,, Supra. The synthesis of the latter, the second beam was stopped by extraction of the reaction mixture with a volume of ethanol at -VffC. Digestion of Haelll · endonuclease cDNA was performed in 50 μ 1 of 60 mM iris-HcL, pH = 7.5, 6 mM MgCL ·, 6 mM, beia-mercaptoeianol with two units of Haelll enzyme, at 37X1, .for two hours, after which 0.1 units of hacterian alkaline phosphatase (BAPF type, Warthingtion. Biochepii-cal Corp., Ereehold N, J, units were added. different from the manufacturer) and its digestion: con? kept at a temperature of 60 ° C, for min. After extraction with one volume of phenolchloroform, DNA was precipitated with two volumes of ethanol -70 ° C. dissolved in 20; x J of 10 mM fris-hydrochloric acid, pH: = 8.1 mM EDTA and, were electrophoresed on a 6% polyacrylamide gel (w / v), A distinct band, in a position corresponds to a weight of about 550 nucleotides in length, was observed and isolated for further purification. The fragment of the base pair 550 was digested with 4 units of Pvu II endonucleases in 50 μ 1 of the same buffer solution used for digestion with HaelII endonucleases, at 37 ° C, for two hours. After phenol-chloroform extraction and ethanol precipitation, the digestion products were separated by electrophoresis on a 6¼ poMacrylamide gel (weight / volujne). Two subfragments of about 490 · and about 60 nucleotides in length, were obtained in this way. The two fragments were electrophoretically eluted, combined and incubated in 20 μ 1 of 66 mM iUs-HCL, pH = 7.6, 6 mM MgCh, 15 mM dithiothiol, 1 mM ATP containing 20 μg / ml of T4 DNA ligase at 15 ° C for two hours. The reaction mixture was then diluted to 200 1 with 0.1 M NaCl, extracted with 1 vol of phenololoroform and the DNA precipitated with 2 vol of ethanol. After resuspension in 20 μl of 10 mM fris-HOl, pH = 8.1 mM tris-hydrochloric acid, pH = 8, 1 mM EDTA, the binding products were separated by electrophoresis as 6% (w / v) depoiliacrilamidă. The combined product, about 550 base pairs in length, was higher than the 99% purity, evaluated by subfractionation in four separate endonuclease systems, respectively. The nucleoitidic 550 fragment of HGH cDNA, greater than 99% purity, was used to prepare a plasmid containing most of the HGH coding region. The 5 'phosphatic end groups were recovered in a reaction mixture containing 50 mM hydrochloric acid, pH = 8.5, 10 mM MgCh, 0.1 mM spermidine, 5 mM beverage-mercaptoethanol, 5¼ weight. / volume) glycerin, 333 pmol ATP, 5 units of T4 polynucleotidinase, incubated in a final volume of 40 1 at 37 ° C for two hours. The DNA was separated from the reaction mixture by extraction with phenol followed by ethanol precipitation. Synthetic decanucleotide binding agents, having no specific restriction for Hind III and possessing sequence 5 - CCAAGCTTGG - 3 ', prepared according to Scheller et. al., supra, were then ligated to HGH DNA in a molar ratio of about 50: 1 in 50 1 mM fris-HCl, pH = 7.6, 9 mM MgCl · ·, 15 mM ditlothreitone, 1 mM ATP and 20 μg / ml of T4 DNA ligase. After incubation, at 4 ° C for 18 h, the reaction was stopped by ex 10 fraction with phenol-chloroform. The ligation products were precipitated with ethanol, redissolved in 50 μ 1 100 mM NaCl trispcid hydrochloride, pH = 7.6, 7 mM MgCh and digested with 50 units of Hsu I enidonuclease, at 37 ° C. , clear of 2 h. Hsu I and Hind III have the same specialty of place and can be useful in place of each other. Endonuclease digestion led to cleavage at the Hind III (Hsul) junction of the decamers, giving rise to hGH cDNA with Hind III poetic ends, as well as to cleaved unreacted decanucleotides and inter-decanucleotides. Because the cleaved decamers also contained Hind III terminals and would compete with HGH cDNA for recombination with the similarly cleaved piasmide, the HGH cDNA was isolated by gel electrophoresis, prior to reaction, with the transfer vector. The use of the above decanucleophidic binding agent has the advantage that the HGH cDNA fragment can be re-isolated from the piasmide in a form identical to that of the original fragment. The transfer vector used was the bacterial piasmid pBR-322, a molecule with a molecular weight 2.7χΐ0^ό containing a single Hind III site, prepared according to Bolivai, F. et al., Gene 2, 95 (1977). Escherichia coli infection with pBR-322 confers resistance to antibiotics ampicillin and tetracycline. DNA insertions in place of HindIII resulted in the reduction or elimination of tetracycline resistance. The Hsu I pBR-322 fraction was first treated with alkaline phosphatase, according to the method described in Ullrich et. al., supra. Treatment with alkaline phosphatase removes 5 'phosphates from the generated Hsu I ends of the plasmid and prevents DNA binding of the plasmid itself, ensuring that ring formation and, therefore, transformation is dependent on insertion of a DNA fragment containing 5' phosphorylated terminals. alkaline phosphatase was performed in a reaction mixture at 1.0 enzyme units / mg DNA piasmide in 25 mM hydrochloric trisacid, pH = 8, for 30 min, at 65 ° C, followed by phenol extraction, to remove phosphatase, and ethanol precipitation of DNA. The ligation of HGH cDNA to pBR-322, treated in the above manner, was carried out in 50 μ 1 reactions containing 60 mM hydrochloric trisacid, pH = 8, 10 mM betamercaptoethanol, 8 mM MgCh, between 10 and 500i ng Hsu I. cleaved DNA plasmid 50 ng of Hsu I cleaved dephosphorylated plasmid DNA. Restrictions were started by adding T4 DNA ligase at 5 μg / ml, allowing it to react at η

at 15 ° C for one hour, and then the mixture was diluted to 0.25 ml with 120 ml with 120 mM NaCl, 1 mM EDTA. The diluted reaction mixture was used directly for the transformation of Esche- tichia coli X-1776. Escherichia coli X-1776 is a host bundle specifically developed for DNA recombination work {NIH certified as an EK-2 host, under federal screening guidelines. The bundle can be obtained from Dr. Roy Curtiss III, University of Alabama, Department of Microbiology, Birmingham, Alabama). The bacteria were grown in 150 ml of additional nutrient soup with 100 μg / ml diaminopimelic (DAP) and 40 'g / ml thymine, at a cell density of about 2X10® cells / ml. The cells were collected by centrifugation and washed in 20 60 ml of 10 mM NaCl, re-centrifuged and resuspended in 60 ml of transformation buffer, containing 10 mM trisacid hydrochloric acid, pH-8, 140 mM NaCl, mM CaCk The cell suspension was held on ice for 15 min, the cells were collected by centrifugation and resuspended in 1.5 ml of the same transformation buffer. The cell suspension, 0.5 ml, was added to 0.25 ml of 30 dilute ligation reaction mixture and incubated on ice for 15 min, then transferred. the temperature of 25^of.C, for 4 minutes, then. again on ice, for 30 min. The cell suspension, 0.2 ml, was placed directly on nutrient agar plates, supplemented with 100 μg / ml DAP and 40g / ml thymine and 20ig / ml ampicillin and sectioned for their inability to grow on similar plates , containing 20 pg / ml tetracycline. 7 transformants were obtained. of which 5 contained a base pair insertion 550, which was released from DNA plasmid, either by Hsu I or Hind III endonuclease digestion. One of the bacterial bundles, pHGH-1, possessing HGH DNA as part of its genetic construct, was increased in amount to provide a source of plasmid DNA, from which HGH DNA could be re-isolated by treatment with Hind III or Hsu I. This isolated HGH DNA, having undergone many repetitions, was subjected to sequence analysis following the method described by Maxam and Gilbert, Supta. The results are given in table 2_; nucleotide sequence of HGH-DNA with one side of pHGH-1. The numbers refer to the amino acid sequence of HGH beginning at the amino terminus. Sequence. DNA shows correspondence to the mRNA sequence for HGH except that U replaces T in mRNA.

Table 2 24

Ala Phe Asp Thr Tyr Gin Phe Glu Glu Ala Tyr Ile Pro Lys 5 '... G GCC TTT GAC ACC TAC CAG GAC TT GAA CCC TCT ATC CCA AAC AAG

43

Glu Gin Lys Tyr Ser Phe Leu Gin Asn Pro Gin Thr Ser Leu Cys Phe GAA CAG AAG TAT TCA TTC CTG CAG AAC CCC CAG ACC TCC CTC TCT TTC

6Q

Ser Glu Ser Ile Pro Thr Pro Ser Asn Asg Glu Glu Thr Gin Gin Lys TCT GAG TCT ATT CCG ACA CCC TGC AAC AGG GAG GAA ACA CAA TCA AAA

Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gin Head Trp TGC AAC CTA GAG CTC CTC CGC ATC TGC CTC CTG CTG CTG ATC CAG TCC TGG iop

Leu Glu Pro Val Gin Phe Leu Arg Ser Val Phe Ala Asn Asn Leu Val TGG GAG CCC GTG CAC TTC CTC AGG AGT GTC TTC GCC AAC AAC CTG GTG

Tyr Gly Aln Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Glu TAC CGC CGC GCC TCT GAC AAC CTC TAT GAC CTC CTA AAG GAC CTA GAC

120.

Glu Gly Ile Gin Thr Leu Met Gly Arg Leu CAA ACC CTG ATG CGC ACG CTC CAC

140

Tyr Gly Gin Ile Phe Lys Gin Thr Tyr Ser Lys TTGAAG CAG AQC TAC ACC AAG TTC

Glu Asp Gly Ser Pro Arg GAA GCC ATC GGC ACG CCG CGG

His Âsn His Asp Aln Leu Leu Lys Asn Tyr GAC QCA CTA CTC AAG AAC TAC CGC

Phe Asp Thr Asn Ser ACT GGG CSAG ATA GAC ACA AAC TCA

160

Gly Leu Leu Tyr Gyn Phe CAG AAC CAT CTC CTC TAC TGG TTC

ISO ·

Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gin Cys AGG · AAG GAC ATG GAC AAC CTC GSG ACA TTC CTG CGG ATC TCG CAG TGC

- - '; ; -,. C._19]

Arg Ser Val Glu Gly Ser Cys Gly Phe CGC TCT CTG GAG GGG AGC TGT GGC CCTGTGACGCCTCCCCAGTGCCTCTCCTGGCQ

For a better understanding of the invention, the following are shown.

As a consequence of the known relationship of the pair bases that governs DNA replication and transcription, isolation of the mRNA containing the nucleotide sequence encoded for the amino acid sequence of the specific protein is equivalent to the isolation of the same sequence or genes, from the mRNA itself, if the mRNA is retransmitted. DNA to form complementary DNA, (cDNA), the DNA sequence is precisely reconstituted by it and can, by appropriate techniques, to be inserted into the genetic material of another organism. The two complementary versions of the given sequence are therefore inverconvertible and functionally equivalent to each other.

The nualeotide subunits of the DNA strand are linked or hinged together by phosphodiester linkages between position 5 'of a nucleotide sugar and position 3.' of his next-door neighbor. Reiterating such a link produces a linear polynucleotide, which has polarity in the sense that one end may be destroyed by the other. The 3 'end may have a free 3' - hydroxyl or hydroxy I1 may be substituted with a phosphate or more complex structure. The same thing is true for the 5 'end. In the eukaryotic organisms, respectively those that have a defined nucleus and a nritotic apparatus, the synthesis of functional jnol mRNA, usually, the addition of polyadenyl acid to the 3 'end of the mRNA. The messenger RNA can therefore be separated from other RNA classes isolated from an equariotic organism by chromatography! on the cellulose column, to which the polytimidiilic acid is attached (Aviv H., and Leder P., Proc. Nat.

ECAD. Sci. USU, 69, 1408 ... 1972). Other chromatographic methods that exploit the pairs bases or, more precisely, the affinity of these bases of poly A for the filling chromatographic materials, seem to contain oligo dT, poly U or combinations of poly T and poly U, for example poly U-Sepharose, they are also convenient.

Reverse transcriptase catalyzes, synthesizes complementary DNA into an RNA template chain in the presence of the RNA template, a passing primer may be a complementary oligo or polynucleotide, which has a 3'-hydroxyl and four

TTC TAG CTGlCCGGGGTGGGCATCCCTGTAC —------ 3 '.

deoxynucleosides triphosphates, dATP, dCTP, dCTF and dTTP. The reaction is initiated by the non-covalent binding association of this oligo-deoxynucleotide primer near the 3 'end of the RNA, followed by the step of adding the appropriate deoxynucleotides, determined by the relationship of the base pairs with the nucleotide sequence of the RNA, at the 3' end. the growing chain. The product molecule can be described as a hairpin structure, in which the original RNA is paired by hydrogen bonding with a complementary strand of DNA partially folded over one of its ends. The DNA and RNA chains are not covalently linked to each other. Reverse transcriptase is also capable of catalyzing a similar reaction, using a single strand of hairpin DNA, which has a loop of a single strand of DNA, which binds a set of ends (Efsfriadis A., Kafatos FC et al., Cell 7,279. 1976).

Restriction endonucleases are enzymes capable of hydrolyzing DNA phosphodiester bonds, which create a disruption in the continuity of the DNA chain. If the DNA is in the form of a closed loop, the loop is converted into a linear structure. The main aspect of the restriction enzyme is that its hydrolytic action is exerted only at a point where a nucleotide sequence appears. Such a sequence is defined as the restriction sisitus for endonuclease restriction. The restriction endonucleases were isolated from a variety of sources and characterized by the nucleotide sequence after the sites of its restriction network. When acting on a double-stranded DNA, some restriction endonucleases hydrolyze the phosphodiester bond on both chains, at the same point, producing bulky ends. Other catalysts hydrolyze the bond. The nuclei are separated by a few nucleotides from the other, producing regions with single chains at each end of the cleaved molecule. Such single-stranded ends are self-complementary, so cohesive, and can be used to re-hydrolyze DNA. Because any of the DNAs, susceptible to cleavage by such an enzyme, must contain the same recognition site, the same cohesive ends will be produced, thus heterogeneous sequences of

DNA that was treated with restriction endojiuclease versus other sec, similarly treated gates (Roberts RJ, Crit. Rev. Biochem. 4, 123, 1976),

It has been observed that the reaction sites for a given enzyme are relatively rare and unevenly distributed. Regardless of why a restrictive site exists within a given segment, this is a problem that needs to be determined empirically. Moreover, there is a large and growing number of restriction endonucleases, isolated from a variety of sources with a variety of site specificities, so that there is a reasonable probability that a segment of one thousand noeleotids will contain one or more restriction sites.

In the following, the following data is given to explain the invention.

A novel process for purifying a desired nucleotide sequence of complementary DNA with an individual cDNA species is described in the present invention. The method utilizes the restriction endonuclease cleavage of a cDNA transcribed from a complex mixture of mRNA. The process does not require excessive purification of the RNA, but instead uses RNA transcription in cDNA, fragmentation of the specific sequence of this cDNA with one or two restriction endonucleases and fractionation of restriction cDNA fragments based on their length. The use of restriction endonucleases eliminates size heterogeneity and produces homogeneous DNA fragments of any cDNA species containing at least two restriction sites. From the heterogeneous initial population of transcriptional cDNA, fragments of uniform size from the desired sequence are produced. The fragments may be several hundred nueleotides in length and may, in some cases, include the entire structural gene for the desired protein. The length of the desired fragments depends on the number of nueleotides that separate the restr iction recipes and will usually be different for the different regions of the DNA. Fractionation in length allows the purification of homogeneous populations of fragments having the desired sequence. The fragments will be homogeneous in size and of high purity in terms of the nucleotide sequence. Current separation methods and assays allow isolation of such fragments from mRNA-matching species representing at least 2 "/ o from the mass of the transcribed RNA. The use of previous RNA fractionation methods for the prepurification of its mRNA -16 before transcription will result in the lower real detection limit of less than 2% of the total mRNA being isolated from the body. . The specific sequences purified by the procedure outlined above may be further purified by a second specific cleavage with a restriction endonuclease, capable of cleavage of the desired sequence at an internal site. This cleavage leads to the formation of two subfragments of the desired sequence, separable based on their length. The subfragments are separated by the non-cleaved and specifically cleaved sequences of contamination, which have absolutely the same original size. The method is based on the rarity and mode of placement of the restriction endonuclease recognition sites, which result in an extremely low probability as a contaminant, which has the same original length, is cleaved by the same enzyme, to result in fragments of the same length as those of the desired sequence. After separation of contamination, the sub-fragments of the desired sequence can be re-used using techniques known in this field, to reconstruct the original sequence. A method by which the subfragments can be combined with each other only in the correct order is described. These two chisels can be prevented from joining together in the reverse order of their original sequence.

Different variations of the abovementioned methods, in combination with the appropriate marking techniques, may be used to obtain precise quantitative measurements of the purity of the isolated sequences. Isolated techniques can be applied to produce the nucleotide sequence with a purity greater than 99%.

The cDNA isolated and purified by the methods described can be recombined with a convenient transfer vector and transferred to a host microorganism, by known methods. New plasmids were produced, containing nucleotide sequences that encode most of the HGS portion. The techniques described can be used to isolate and purify human growth hormones from other animal species and to reconstruct new transfer vectors and microorganisms containing these species. The new plasmids contain nucleotide sequences that encode most portions of the human growth hormone.

The present invention uses a polyadenylated starting material of a crude or partially purified mtDNA, which may be heterogeneous in sequence and of molecular size. The selectivity of producing RNA isolation is enriched by any method that results in an enrichment of the desired mRNA in the heterodisperse population of the isolated mRNA. Any such purification method may be used in connection with the method of the present invention, the method provided does not introduce endonucleotide cleavage of the mRNA. An important initial consideration is the selection of a source tissue. Suitable for the desired mRNA. Often, this choice will be dictated by the fact that the protein to be obtained is prepared only by a certain specialized tissue of a differentiated organism. This is the case, for example, with peptide hormones, such as human growth hormone. In these cases, it is found that a variety of cell types or species of microbes may serve as a source for the desired mRNA, in these cases, preliminary experimentation will be required in order to determine the optimal source. Frequently, it is found that the proportion of desired ARMm may be increased by the cell's response to environmental stimuli. For example, hormone treatment can cause the desired mRNA production to increase. Other techniques include raising it at a particular temperature and exposing it to a specific nutrient or other chemical.

Pre-purification in order to. Enrich the desired mRNA sequences, can also be performed using conventional methods for RNA fractionation, after isolation from the cell. Any technique that does not result in RNA degradation can be used. Preparative sedimentation techniques in a gradient of sucrose and gel electrophoresis are, in particular, convenient.

The mRNA must be isolated from the source cells under conditions that exclude mRNA degradation. The action of RNAi enzymes is, in particular, convenient to be avoided, as these enzymes are capable of hydrolytic cleavage of the nucleotide sequence of RNA. The hydrolysis of a sequence link results in the breakage of that sequence and the loss of the RNA fragment containing the original 5 'end of the sequence, a convenient method for inhibiting RNA during cell extraction, is described in the literature (Patent Application, US, A). 805023). The method develops the use of 4 M guajiidine thiocyanate and. 1-M of mercaptoethanol during the cell breaking step. In addition, a low temperature and a pH close to 5.0 are helpful in reducing the amount of RNA degradation isolated by RNAase. Prior to applying the method of the present invention, mRNA should be prepared essentially without any contamination of protein, polysaccharides and lipids. Standard methods are known in this field for such purification. The RNA thus isolated contains the messenger RNA, as well as the non-messenger RNA. A convenient method for separating RNA from eukaryotes is column chromatography of oligo-dT cellulose, or other materials, column with substituted oligonucleotides, such as poly-U-Sepharose, having the advantage of hydrogen bond specificity, conferred by the presence of polyadenyl acid. , at the 3 'end of the eukaryotic mRNA.

The initial step in the process of the present invention is the formation of the commentary DNA with the heterogeneous isolated mRNA sequences. The enzymes chosen for these reactions are reverse transcriptases, although, in principle, any enzyme that is capable of forming a complementary DNA, a faithful copy of the mRNA, can be used. The reaction may take place under conditions known in the art. using mRNA as a template and a pyrene mixture, or as precursors, for the DNA chain, a mixture consisting of four triphosphate deoxynucleosides dATP, dGTP, dCTP and dTTP. It is convenient to provide that one of the deoxynucleotide triphosphates is labeled with a radioisotope, for example,³²P in position «, in order to conduct the course of the operation, in order to achieve the recovery of the product, following the current separation procedures, such as chromatography and electrophoresis and in order to make quantitative determinations regarding the recovered part (Efstratiadis A., Xafatos FC, Maxam A, M., Maniatis, T., Cell 7, 279, 1976).

The transcribed cDNAs produced by the reverse transcriptase reaction are somewhat heterogeneous with respect to the 5 'and 3' end sequences, due to the variation in the starting and ending points of the individual transcripts, relative to the mRNA model. The variability at the 5 'end is due to the fact that the prairie oligodT, used to initiate synthesis, is capable of binding in a variety of locations throughout the polyadenylaphy region of the RNA. Synthesis of the transcribed cDNA starts at an intermediate point in the poly-A and po'li-A region of variable length is transcribed depending on the site that initially binds the oligo-dT primer. It is possible to avoid this indeterminacy by using a primer that contains, in addition to an oigo-dT tract, one or two pucleotides of the RNA sequence itself, which produces a primer that will be preferred and will have a binding site. defined to initiate the transcription reaction.

The non-determination at the 3 'end of the transcribed cDNA is due to a variety of factors that affect the reverse transcriptase reaction and the possibility of partial degradation of the RNA template. Isolation of specific transcripts of full length cDNA is greatly facilitated if the conditions for the reverse transcriptase reaction are chosen in such a way as to not only favor the synthesis lengths but also to repress the synthesis of small cDNA chains. The specific parameters that can be varied to achieve the maximum production of high fidelity long-chain transcribed DNAs are: reaction temperature, salt concentration, enzyme quantity, initiator concentration versus template, and reaction time.

The temperature conditions and the salt concentration are chosen so as to optimize the coupling of the specific bases between the oligo-dT promoter and the polyadenylated portion of the RNA template. under the correctly chosen conditions, the primer will be able to bind to the polyadenylated region of the RNA template, but no specific initiation will occur, due to its binding to other locations of the template, in short, sequences rich in A will be prevented in substantially. The effects of temperature and salt concentration are interdependent. As the temperatures are higher and lower, the salt concentration decreases the stability of the specific interaction of base coupling. The reaction time is kept as short as possible in order to prevent the initiation of non-specifics and to minimize the opportunity for degradation. Reaction times are interrelated with temperature, low temperatures require longer reaction times. At a temperature of 42 ° C, reaction times vary from 1 to 10 minutes and are convenient. The primer will be present in a 5Q ... 500 molar excess over the RNA template, and the enzymes will be present in a molar excess similar to the RNA template. The use of an excess of enzymes and primer allows the initiation and growth of the chain, cDNA, so that long-chain transcribed cDNAs are produced and this production takes place efficiently at short incubation times.

In many cases, it is possible to perform the remainder of the purification process of the present invention, using single-stranded cDNA sequences, transcribed from mRNA. However, as will be shown below, there may be cases where the desired restriction enzyme is one that acts on two-stranded DNA. In these cases, the cDNA prepared as described above can be used as a template for the synthesis of a two-stranded DNA, using a DNA polymerase, such as a reverse transcriptase and a nuclease capable of hydrolyzing a DNA. with a snug side. Methods for preparing two-sided DNA in this manner have been described in the literature (Ulrich A, et al., Science, 196. 1313, 1977).

The heterogeneous DNA, prepared by the transcription of heterogeneous mRNA sequences, is then treated with one or two restriction endonucleases. The choice of endonucleases to be used depends, first of all, on the prior determination of recognition sites for enzymes appears to exist in the cDNA sequence, which is to be isolated. The method depends on the existence of two such sites. If the sites are identical, a single enzyme will be sufficient. The desired sequence will be cli.vated at both sites, eliminating the heterogeneity of dimensions as much as possible and creating a population of defined fragmented molecules that contain the desired sequence and are homogeneous in length. If the restriction recipes are different, two enzymes will be needed in order to produce fragments of the desired length.

The choice of the restriction enzyme or enzymes capable of producing a non-obvious sequence fragment of the desired or better length optimum to encode all or part of the desired proteins, must be empirically performed. If the amino acid sequence of the desired protein is known, it is possible to compare the uniformly-length neoleotide sequence, produced by the cleavage of restriction endonucleases, with an • amino acid sequence for which the bar codes, using the known relationship of the genetic code, common to all. the forms of life, means body .live. A complete amino acid sequence for the desired protein is not required, as identification with reasonable accuracy may. either performed on the basis of a partial sequence. Where the amino acid sequence of the desired protein is not known, the length! uniform, as polynucleotides produced by: cleavage-endonuoleotides of: restriction can be used as evidence capable of identifying the desired protein synthesis in a suitable in vitro system of protein synthesis. In one embodiment, the mRNA may be purified by chromatographic affinity. Other techniques that may be suggested: the specialists in this field will be those. suitable for this purpose. The number of restriction enzymes, suitable for use, depends on. the type of cDNA that is used, if any. with one side or two sides. Preferred enzymes are those capable of acting on: single-stranded DNA, which is the product of the immediate immediate reverse transcription of mRNA. The number of restriction enzymes: known to be able to act on single-stranded DNA is limited. Enzymes: Hae. III, .Hha.I and Hin (f) I are currently known as capable. In addition, enzymes. Mbo II can act on DNA; with one side. Where studies show that restriction enzymes can act on single-stranded DNA; such enzymes can. to be properly included in the enzyme list. preferred. Suitable additional enzymes include those specified for cDNA with. two sides. Also, enzymes are not preferred; because additional reactions are needed in order to produce cDNA. with two sides, increasing the opportunity for the loss of long sequences: and for other losses, due to: incomplete recovery. The use of one, two-sided cDNA has additional technical disadvantages, because the analyzes: the sequence are much more complex - and more so. laborious. For these reasons, cDNA is preferred. with one side, but. the use of a two-sided cDNA is also applicable.

The cDNA prepared for the restriction endonuclease treatment may be radioactive labeled, such that. it can be detected after the following steps: separation; A technique; preferred is the one of: to incorporate a radioactive ion, it, for example, - “Share the position of one of the four tritesylated: deoxinolazides. precursors. The highest activity: it is obtained 'when the concentration of the precursor., Radioactive is relatively high; relative to the concentration of the non-radioactive form. Gu anyway - the total concentration - of any: tri? docinuoleoside phosphate: will be higher - soon. 30 &lt;μΜ, im scopuli .de ia_;, increase to maximum length, length. DNAcrUlui. obtained in reverse transcriptase reaction (Efstra.22 diadis A and others: Gefi 4., 367, 1975); In order to determine the nucleotide sequence of the cDNA, the 5 'ends may be: suitably labeled: with the enzyme-catalyzed reaction. : nucleotide kinase po (Maxam and Gilbert W., Proc. Nat'h Acad. Sci, USA, 7.4, 560¹ since 1977).

The fragments that were produced by the action of the enzyme: restriction- or; combination of two restriction enzymes can be separated from each other and the heterodispersed sequences due to the situs-uritoT; we recognize by an appropriate technique, capable of separating the pofinucleotides on the basis of differences in length. Also, methods include a variety: de.teh neither electrofoietiioe.and de thnia_; sedimentation, using an ultracentrifuge. Eliec.troforezetecu.gel are preferred, because -these, they achieve the one with the best resolution, based on the length of the polytide. In addition, the method easily allows, to. is. recover the separated materials quantitatively. Suitable gel electrophoresis methods have; have been described: in the literature (Dingman G, W .. and Peacnk. AC, Biachemistry, 7, 659, 1958 and Jeffrey A., Vande Sande. II., BJochemistry 1.4, 3, 787 of 1975). Prior to treatment with transcribed cDNA restriction endonucleases, obtained from most sources, it is noted; as elecfcrodisperts in. dimensions, respectively in length. By the action of correctly chosen restriction endonucleases or &lt;the pairs of endonucleases, the chain of the polynucleotide, which contains the desired sequence 'will be cleaved at the respective restriction site, to obtain high-length polynucleotide fragments of uniform length, after gel electrophoresis, they will - be observed to form a distinct band, depending on the presence or absence of restriction sites on other sequences, other discrete bands may be formed, which will be very similar, but of different lengths to that of the sequence¹ desired. Therefore; as a consequence of the restriction endonuclease action, the stain of eleotrophoresis will. revealed the appearance - of one or of many discrete bands, hh. while the remainder of the cDNA will continue to be fietesrodenspensate: it falls -not- the sequence- of the cDNA: British. it comprises most of the polymicleotide species present, staining, electrophoresis will¹ revealed that most cDNA is present in the 'discrete' band. v

Although not desirable¹ as- two different sequences to be elicited by -'- my- restrictive enzymes, in order to obtain-frag; ment of absorption of the same length; a method for determining the purity of the fragments of length 'defined tests; 23 desired. The electrophoresis band sequence analysis can be used to detect impurities representing IO® /, or more of the material in the band. A method for detecting lower levels of impurities has been developed as part of the present invention, discovered according to the general principles applied in the initial method of isolation. The method requires that the fragment of the nooylide sequence desired to contain a recognition site for endonuclease of restriction not used in the initial work. Treatment of the nucleotide material or, more properly, polynucleotide material, eluted from the electrophoresis gel band, with restriction endonucleases, capable of acting internally on the desired sequence, will result in the cleavage of the desired sequence into two subfragments, most likely of unequal length. . These sub-fragments after electrophoresis will form two discrete bands at positions corresponding to the respective lengths, the sum of which is equal to the length of the polynucleotide before cleavage. Contaminants in the original or original band are not susceptible to the restriction enzyme and can be expected to migrate to their original position. Contaminants containing one or more enzyme recognition sites may be expected to result in two or more subfragments. Because the distribution of recognition sites is believed to be essentially random, the probability that the contaminating egg will give a subfragment of the same size as the desired sequence is extremely low. Quantity of material. present in any band of the nucleotide. radioactively labeled can be determined by quantitative measurements of the amount of radioactivity present in each band, or by any other appropriate method. A quantitative measure of the purity of the fragments of the desired sequence can be obtained by comparing the relative quantities of material present in these bands, which represent subfragments of the desired sequence / with the total amount of material.

Following the separation above, the desired sequence may be reconstituted. Enzyme -.DNA ligase that catalyzes the binding of DNA fragments, can be used for this purpose. The bands of the electrophoresis gel that represent the subfragents of the ordered sequence can be eluted separately and combined in the presence of DNA ligase, under the appropriate conditions (Scaramela V. et al., Proc.Nat'l Acad. Sci ,. U, S, A., 67, 1468 din; 1976), Where the '24 sequences to be joined are not with the tooite ends, the ligase contained in Escherichia coli can be used (Modrichi P. and others J. Biol. Chem. 245, 3, 626, 1970).

The efficiency of reconstruction of the original sequence from the subfragments produced by the treatment with restriction endonucleases will be greatly enhanced by using the method to prevent improper sequence reconstruction. This undesirable result is prevented by treatment of the homogeneous length fragment of the desired cDNA sequence with an agent capable of removing the 5 '- phosphatic terminal groups from the cDNA, before the homogeneous cDNA cleavage with a restriction endonuclease. The alkaline phosphatase enzyme is preferred. Phosphatic 5 'end groups are structurally required for the subsequent inhibition of DNA ligase used to reconstitute cleaved subfragments. Therefore, the ends having a 5 'phosphate terminal cannot be covalently bonded. The DNA subfragments can be joined only to the ends containing 5'-phosphate generated by cleaved restriction endonucleases described in detail in the literature (US application, no. 850023).

Most of the cDNAs transcribed under the conditions used are derived from the mRNA region, which contains the 5 'end of the model mRNA, by specific primer. The same template with a fragment obtained by cleavage with endonuclease gives restriction. In this way, the method described tnai .sus can be used to obtain not only fragments of the specific nucleotide sequence related to the desired protein, but also the entire nucleotide sequence encoding the protein of interest.

The purification process is of special significance in the deconvolution of human genes, which, according to the rules, can only be put into recombinant DNA and then into bacteria, after the genes have been carefully purified or, if experiments have been performed in plants. high risk specials (P4) / 12 / (Federal Register, col. 41, no. 131, July 7, 1967, pp, 27,

902., 27, 943), The present method allowed the production of sufficiently pure human genes, comprising most of the HGH structure. Human genetic material, isolated and purified as described above, may be incorporated into recombinant plasmids or other transfer vectors. Chemically synthesized double-stranded oligonucleotide liners, which contain the restriction endonuclease recognition sequence, can be attached to the ends of the isolated cDNA to facilitate further enzymatic removal of the human gene portion of the DNA transfer vector. Scheler RH et al., Science 196, 177, 1977). The ΔDN transfer vector is converted from a continuous loop to a linear form, by treatment with an appropriate restriction endonuclease. The ends formed by this are treated with alkaline phosphatase to remove the reddish 5 'terminal groups so that the DNA transfer vector may not again form a continuous loop in the DNA ligase reaction, without first incorporating a segment of human DNA. , CDNA with the oligonucleotide lynx and the treated DNA transfer vector are mixed together with the DNA ligase enzyme, in order to merge the cDNA with the DNA vector, forming a continuous loop of the recombinant vector, which has cDNA incorporated into it. Where the transfer vector plasmid is used, the closed loop will usually be the only form capable of transforming the bacteria. Transformation, as understood in this field, is the term used to refer to the process by which a microorganism incorporates extracellular DNA into its own genetic constitution. The plasmid DNA in the form of a closed loop can thus be incorporated under appropriate environmental conditions. The embedded closed plasmid loop follows replication in the transformed cell, and the replicated conditions are distributed to produce cells, when cell division occurs. As a result, a new cell line is established, which contains the plasmid and transmits its genetic determination. Plasmid transformation in this way, in which plasmid genes are maintained in the cell line by plasmid replication, occurs at very high frequencies, when DNA plasmid transformation is in the form of a closed loop and does not occur, or rarely occurs. occurs, if it is used linear plasmid DNA. Once a recombinant transfer vector has been created, the transformation of a convenient microorganism is a forward-looking pToces, and the new microorganism containing human genes can be easily isolated, using appropriate selection techniques, which are known in the art.

The invention has the following advantages:

- allows the isolation and purification of nudeotide sequences of HGH, even when they are present with a frequency of only 2¼ of a heterogeneous population in mRNA sequences;

2S - combined with other known procedures for mRNA fractionation, the process can be used to isolate and purify the specific sequences present even at very low frequencies in the total RNA population;

- the process is generally applied to mRNA species extracted from any virtual organisms, thus representing a powerful tool for basic production of proteins that have medical or research interests and in useful quantities;

- realizes a nucleotide sequence that purifies for human HGH with a purity of over 99¼;

- creates a microorganism that produces HGH;

- Human growth hormone has medical utility in the treatment of defective pituitary function, in the case of children suffering from dwarfism.

Animal growth hormones are useful in veterinary medicine and agriculture, especially in animals used as food sources, where large size and rapid maturation are desirable.