PT97111B

The expression of phytase in plants

Abstract

This record has no abstract on file.

PT97111B, drawing sheet 1 — Sheet 1 of 10

Term

Term ended

Expired 22 March 2006, 20.5 years ago.

1 claim: 1 independent, 0 dependent

1
REIVINDICAÇÕES - 19 Processo para a obtenção de plantas ou de orgãos de plantas transgénicas contendo urna quantidade intensificada de urna fitase, caracterizado por se transformar urna planta hospedeira corn urn material construído de expressão contendo urna sequência de ADN que codifica a fitase opera— velrnenete ligada a sequências de regulação capazes de controlar a expressão da fitase na planta hospedeira e se cultivar a planta transf orrnada ern condições tendentes a expressar a sequência de ADN que codifica a fitase. c a r a c ter' i z a d o expressão ser especifica do ..... 29 Processo de acordo corn a reivindicação 1, pelo facto de o material construído de capaz de controlar a expressão da fitase tecido. ... 3 a ... Processo de acordo corn a reivindicação X, caracterizado por se obter a sequência de ADN que codifica a fitase a partir de urna fonte microbiana. - 59 Processo de acordo corn a reivindicação 4, caracterizado por se obter a sequência de ADN que codifica a fitase a partir de urna fonte constituída por urn fungo filamentoso. Processo de acordo coro a reivindicação 5, caracterizado por se obter a sequência de ADN que codifica a fitase a partir de Asρergi11us. - 7ã Processo de acordo com a reivindicação 6, caracterizado por se obter a sequência de ADN gue codifica a fitase a partir de urna espécie de Aspergillus escolhida do grupo gue consiste ern Asper gillus fiou urn, Asper gillus niger, PDF 9Í 1.1 3VJ3[nor i ° Aspergillus nidu 1ans . - 8 a .... Processo para a preparaçao d urn material construído de expressão, caracterizado por se ligar operavelmente urna sequência de ADN que codifica urna fitase com uma sequência de regulação que ê capaz, de controlar a expressão c o n s t i t u t i va d a f i base .. ..... 93 ·.Processo para a obtenção de urn vector de expressão, caracterizado pelo facto de este conter urn material construído de expressão de acordo com a reiv i n d i c a ç a o 8 . ···· 103 Processo para a obtenção duma estirpe ba eter iana, caracterizado pelo facto de esta conter urn vector de acordo corn a reivindicação 9. - i. ::1..3 Processo para a preparação dum material construído de expressão, caracterizado por se ligar operalvelrnente uma sequência de ADN a urna sequência de regulação capaz de controlar a expressão da fitase especifica do teoido. as - 14$ Processo transgénioa ou do um caracterizado polo facto de orgão da planta conter um para a obtenção de orgão de plantei a mencionada plantei rn a t e r i a 1 c o n s t r u i d o uma planta transgénioa, ou o citado de expressão urna fitase que contém uma sequência de ADN que codifica operavelrnente ligada a sequências de regulação capazes de controlar a expressão da fitase na planta hospedeira. - 15$ Processo para a transformação de fitato urn inositol e fosfato inorgânico, caracterizado por se aplicar a urn substrato que oontérn fitato uma fitase obtida pelo processo de acordo corn qualquer das reivindicações 1 a 7. ..... 16$ P r oo e s s ο ρ a r a a 3. i. rn e n t a r es , o a r a o t e r i z a d ο ρ o r , incorporar urna fitase preparada reivindicações 1 a 7. a preparaçao de composições referidas composiçoes, se de acordo corn qualquer das - 17 Processo para a preparaçao de alimentares, de acordo corn a reivindicação o o rn ρ o s i. ç Õ e s 16, ca r acterizado por nas mencionadas composições, se incorporarem plantas transgénicas ou orgaos de plantas transgénicas contendo fitase, obtidos pelo processo de acordo com qualquer das reivindicações 1 a 7. -· 199 Processo para promover o crescimento de animais, caracterizado por se alimentar os citados animais corn uma dieta que compreende um alimento de acordo com a reivindicação 16 numa quantidade eficaz para promover o crescimento dos animais que ingerem o referido alimento. - 199 Processo para promover a redução dos níveis de teores de fitato no estrume produzido por animais, caracterizado pelo facto de se alimentar os animais com uma composição alimentar de acordo com a reivindicação 16, numa quantidade eficaz para transformar o fitato contido nos alimentos em inositol e fosfato inorgânico. 209 Processo para a preparação de fitase, c a r a c t e r i z a d ο ρ o r a) se transformar uma planta hospedeira por um material construído de expressão que contêm urna sequência de ADM que codifica a fitase operavelmente ligada a sequências de regulação capazes de controlar a expressão durna quantidade intensif ica dei de fitase na planta hospedeira e se cultivar a planta transformada em condiçoes tendentes a expressar a sequência de ADN que codifica a fitase nos tecidos da planta;e b) se extrair a fitase do teoido da ρ 1 a n t a t r a n s g é n i c a . (\ requerente reivindica a prioridade dos pedidos de patente norte.....americanos apresentados em 23 Março de 1990 e em 21 de Setembro de 1990, sob os numeros sé r i.e 499 , b 61 e b88,78b , r e s p e c t i v a rn e n t e . Lisboa 22 de Março de 1991. AGENTE OFICIAL DA PKOPBIEDADE INDUSTRIAL de de

408 paragraphs in 9 sections, as filed

DESCRIPTION

GIVES

PATENT OF INVENTION

No. 97111

APPLICANT: GIST-BROCADES NV, Dutch, industrial and canereal, can host Uateringseweg 1, ΡΌ. Booc 1, 2600 MA Delft, The Netherlands and M3GEN International NV, Dutch, industrial and commercial, headquartered in Einsteinweg, 97,2333 CB LEIDEN, The Netherlands.

EPIDEMIC: "PROCESS FOR OBTAINING TRANSGENIC PLANTS

HAVING INTENSIFIED QUANTITIES OF FITASE "

INVENTORS: Jan Pen, Andreas Hoefcenn, Peter Christiaan Sijmons,

Krijn Rietveld, Teunis Comei is Venfoerd and Albert JJ van Ooyen

Claim of right of priority under Article 4 of the Paris Convention of 20 March 1883.

Netherlands, 23 March 1990 and 21 September 1990, serial numbers 498,561 and 586, 765

INPI. MOD. 113 R f 18732

Description: The invention relates to a patent, the invention of GIST-BROCADES NV, a Dutch, industrial and commercial company, established in Wateringseweg 1, PO Box 1, 2600 MA Delft, the Netherlands and MCGEN International NV, (Jan Pen, Andreas Hoekerna, Peter Ghristiaan Sijrnons, Krijr> Rietveld, Teunis Cornelis Verwoerd and Alhert JJ van Ooyen residing in the Netherlands), for "PROCESS FOR THE OBTAINING PLANTS 00 OF TRANSGENIC PLANTS ORGANS CONTAINING QUANTITIES; INTENSIFIED OF FITASE "

DESCRIPTION

Field of Invention

The present invention relates to the production of phytase in transgenic plants and to the use of phytase thus produced in industrial processes.

In the field of phosphorus it is an essential element for the development of all organisms. In animal production, feed must be supplemented with inorganic phosphorus in order to achieve a robust growth behavior of monogastric animals (eg, pigs, poultry and fish).

1. -

In contrast, there is no need to add inorganic phosphate to ruminant feed. The microorganisms present in the rumen produce enzymes which catalyze the conversion of phytate (rhynin-inositol-hexaquis-phosphate) to inositol and inorganic phosphate.

Phytate acid occurs as a source of phosphorus storage in virtually all plant-derived food substances (for a review of the subject, see "Phytic Acid, Chemistry and Applications", Ed-Graf, Pilatus Press, Minneapolis, MN, United States of America. America (1986)) - Phytate constitutes 1 to 3% of all nuts, grains, vegetables, oily seeds, spores and pollen. Complex salts of phytic acid are called phytin. Phytic acid is considered an antinutritional factor because it acts as a chelating agent for mineral substances such as calcium, zinc, magnesium, fer .....

and may also react as proteins, thereby decreasing the bioavailability of proteins and nutritionally important minerals.

The phosphorus of the coughs passes through the gastrointestinal tract of the rnonogastric animals and is excreted as a dejecting agent. Although some phytate hydrolysis may occur in the colon, the inorganic phosphorus thus released has no nutritional value since inorganic phosphorus is absorbed only in the small intestine. As a consequence, a significant amount of nutritionally important phosphorus is not used by the rnonogastric animals, despite their presence in food.

Excretion of phytate phosphorus through the droppings has other consequences. Intensive anirnal production has increased enormously during the last decades. Consequently, the amount of manure produced has increased correspondingly and has caused environmental problems in various parts of the world. This is partly due to the accumulation of

J

SJ & JteraiRíSSWSíS & ga

LSiS

3d £ 5 - $ 3ggn;

phosphate from waste water in surface waters, which has led to eutrophication.

Enzymes produced by microorganisms that catalyze the transformation of phytate into inositol and inorganic phosphorus are generally referred to as phytases. Microorganisms that produce phytases comprise bacteria such as Facites subtilis (VK Paver and VJ Jagannatban (1982), J. Baoteriol, 151, 1102) and Pseudomonas (DJ Cosgrove (1970), Austral J. Biol. 23, 1207); yeast such as Saççhaç; romycescerevisiae (NR Nayini and P. Markakis (1984), Lebensrnittel Wissenschaft und Technol og e 17, 24); and fungi such as Aspergillusterreus (K. Yarnada, Y. Minoda and S. Yamamoto (1986), Agrio Biol. Chern, 32, 1275). Various other Aspergillus species are known to produce phytases, of which the phytase produced by Aspergillus f leuurn has been found to have one of the highest levels of specific activity,

Phytases are also endogenously present in many plant species (see EA Loweus (1990), Plant Biology, Volume 9, Inositol rnetabolism in plants (Ed Ij J. Morre, WF Boss, EA Loweus ) 13), KS Cellatly and DD Eefebvre (1990), Plant Physiology (supplement), 93, abstract 562) mention the isolation and characterization of a phytase cDNA clone obtained from potato tubers DM Gibson et al. and AA Christen et al. (1988), J. Cell Bichern, 12C, abstract L..407 and L402, respectively), mention the synthesis of endogenous phytase during the germination of soybean seeds. are ordinarily produced in quantities insufficient for their application in industrial processes, per se.

The idea of adding microbial phytases to monogastric animal feeds has been previously described (JH Ware, L. Bluff and TR Shieh (1967), U.S. Patent No. 3,297,548; Shieh, RJ Wodzinski and JH, Ware (1971), J. Nutrition 101, 1289). Nowadays, however, the application of this concept has not been commercially possible due to the high cost of producing microbial enzymes (YW Han (1989), Animal Feed Sci. And Technol. 24, 345). For economic reasons, inorganic phosphorus is further added to foods of monogastric animals.

Phytases also have other industrial uses. As examples of such uses, mention is made of the industrial process of producing starch from cereals such as corn and wheat. The residual products, which comprise, for example, maize gluten, obtained from the pro ......

in wet conditions, are sold as feed. During the maceration process, phytase can be supplemented. The conditions (T ~ 50 ° C and pH = 5.5) are ideal for fungi phytases (see, e.g., European Patent Application 0 321 004 to Alko Ltd.). Advantageously, the petfood derived from the waste products of this process contains phosphate rather than phytate.

It has also been envisaged that phytases can be used in soybean processing (see Finase * Enzymes by Alko, a product information brochure published by Alko Ltd., Rajarnaki, Finland). Soybean meal contains high levels of phytate antinutritional factor which makes this product not suitable for application as food for children and in food for fish, calves and other ruminants. The enzymatic degradation of this valuable protein source improves the nutritive and commercial value of this material.

The possibility of using transgenic plants as a valuable protein production system has also been proposed. Current examples are the production of interferon in tobacco (RM Goodman., VG Knauf, GM Houck and L-Cornai (1987), PCT / WO 87/00865), tobacco enkephalins,

Brassica napus and Arabidopsis____tbaliana (J. Vandekerckhove, J.

van Darnrne, M. van Lijsebettens, J. Botterman. M. DeBlock, A. DeCerq. Leernans, 1 * 1. van Hontagu and Ei. Krebbers (1989), Bio / Technol-7, 929), tobacco antibodies (A. Hiatt, R. Cafferkey, Boedish (1990), Nature 342, 76) and human serum albumin in tobacco and potato PC Sijmons, B. 1 * 1.1 * 1. Dekker, B. Schrammer, TC Verwoerd, PJM van den Elzen and A. Hoekerna (1990), Bio / Technol. 8, 217).

In practice, the transformation of a growing number of plant species, especially dicotyledonous species (eg, tobacco, potato, tornate, Petunia, Brassica), has become a routine way for workers skilled in the subject (Klee, R. Horsch and S. Rogers (1987), Annu Rev. Plant Physiol., 38, 467; GS Gasser and RT Fraley (1989), Science, 244, 1293). Strategies for the expression of foreign genes in plants have become well established (Grasser and Fraley, supra). Plant gene regulatory sequences have been identified that are used for the construction of chimeric genes that can be functionally expressed in plants and plant cells.

For the introduction of gene constructs into plants, a number of technologies, such as the transfer of Agrobacterium tuberculosis, are available. A.

Using this strategy, a wide variety of plant tissues were explored, the choice being largely dependent on the plant species and their ability to be brought into contact with tissue culture. Successful examples are the transfer of protoplasts, micropores or pollen and parts of plants such as leaves, stems,

roots, hypocotyls and cótilos. In addition, methods for the direct introduction of DNA into protoplasts and into plant cells or tissues are also used, such as microinjection, electroporation, particle bombardment and direct DNA uptake (1 51 cl S t ·; and Fraley, supra) -

Proteins can be produced in plants using a wide variety of expression systems. For example, the use of a constitutive promoter, such as the CaMV mosaic virus (CaMV) promoter 353 (H. Guilley, PK Dudley, G. Jonard, E. Balazs and K. E. Richards (1982) ), Cell 30, 763) resulted in accumulation of the protein expressed in all organs of the transgenic plant. Alternatively, gene promoters encoding proteins that are expressed in a very specific tissue specific manner and phase of tissue development may be used (TJV Higgins (1984), Annu Rev. Plant

Physiol., 35, 181; 1 * 1.A. Shotwell and BA Larkins (1889), in The Biochemistry of Plants, Vol. 15 (Academic Press, San Diego, ed. PK Sturnpf and E. Conn), 297), i.e., genes are expressed only in the desired tissue and only for the Phase Phase η vo.

It is convenient that the economic procedure for the production of phytase. is a significant benefit to, inter alia, the feed industry. A more economical process for the production of phytase would be the use of recombinant DNA techniques to produce transgenic plants or transgenic plant organs capable of expressing phytase which could in turn be added such as, for example, to animal feed or food products for direct consumption of animals. As a result, the phytase expressed in these transgenic plants or plants of transgenic plants could be extracted and, if so desired, purified for the desired application.

Summary of the Invention

The present invention relates to phytase expression in transgenic plants or transgenic plant organs and methods for the production of such plants. This is achieved by introducing into the plant an expression construct comprising a DNA sequence which codes for a protein having phytase activity.

The DNA expression constructs provided by the present invention for the transformation of plants are under the control of regulatory sequences capable of directing phytase expression. These regulatory sequences may also include sequences capable of directing transcription in plants or constitutively or specifically at the stage of development and / or tissue, depending on the use of the plant or its parts.

The transgenic plants and the transgenic plant organs provided by the present invention may be used in a wide variety of industrial processes. straight line, ρ or ex and rn ρ 1, naa I. i. the phytase may be extracted or, if desired, purified prior to harvesting. The phytase may be removed from the feed.

Ilrevedescription ..... of the Figures

Figure 1 depicts the strategy for cloning phytase cDNA.

Figure 2 depicts the nucleotide sequence of the transcript region of the phytase cDNA fragment and the amino acid sequence derived from the phytase protein; the onset of mature phytase protein is indicated as the "-ι-1" position.

pM0G23A Figure 4 represents double oligonucleotides used in cloning.

Figure 5 depicts the plasmid pM0G29; and the plasminid pUC18 which contains an expression cassette for constitutive expression in plants and a sequence encoding a signal peptide in tobacco.

Figure 6 depicts the effects resulting from the addition of phytase-containing seeds to phytate inorganic phosphorus release.

Figure 7 shows the relationship of the res .....

posed with the phytase dose of Aspergillus in a di ...

invitro management.

Figure 8 depicts the phytase dose-response relationship of Aspergillus and Fitase contained in tobacco seeds in an in vitro digestion model.

Description By reference to the Invention

In accordance with the present invention, they obtain .....

transgenic plants or organelles of transgenic plants in which phytase is produced. This is achieved by introduction into the plant of an expression construct comprising a DNA sequence encoding a protein having phytase activity.

The present invention provides DNA expression constructs for the stable transfer of? plants ran a gene that? encodes a phytase. These

comprise a DNA sequence encoding a phytase that is operably linked to regulatory sequences capable of directing phytase expression. These regulatory sequences may also include sequences capable of directing transcription in plants either constructively or specifically at the stage of development and / or tissue, depending on the use of the plant or its parts.

The expression constructs provided by the present invention may be inserted into a vector, preferably a plasmid, used in the bacterial mediated transformation of the selected host plant. The expression construct is then preferably integrated into the genome of the host plant.

Within the context of the present invention, the term phytase encompasses a family of enzymes that catalyze reactions involving the release of inorganic phosphorus and various myo-inositol phosphates. It is intended to encompass all proteins having phytase activity.

The DNA sequence encoding phytase may be obtained from a variety of sources, such as microbial, plant or animal sources. Preferably, the DNA sequence is obtained from dt? a microbial source such as the filamentous fungus AsRg? aillus. The most preferred DNA sequences are obtained from Aspergillus __ficuum, A.

n iger ', A. awamori and A. nidulans.

The cloning of a gene or a cDNA encoding a phytase protein can be achieved using various methods. One method is to purify the phytase protein, the subsequent determination of the N-terminus and various internal amino acid sequences, and the choice of a genomic or cDNA library of the organism producing the

phytase, using oligonucleotide samples based on the extracts. the surface of the earth.

If at least one partial sequence of the gene is known, this information can be used to clone the corresponding DNA using, for example, the polymerase chain reaction (PCR) ("PCR Technology: Principles and Applications for DNA Amplification" ), Eq. HA ΙΞ hr 1 i. Ch, S too l <t ο η P ress, No va I orq ue).

It is apparent to those skilled in the art that the phytase gene described above can be used in heterologous hybridization experiments directed towards the isolation of phytase-encoding genes from other mammalian genes.

In? According to another aspect, the phytase gene described above can be used as a starting material for the construction of "second generation" phytases are phytases, altered by mutagenesis techniques (for example, site-directed mutagenesis), which have which properties make them different from naturally occurring phytases or recombinant phytases, such as those produced according to the present invention. For example, optimum temperature or optimum pH, specific activity or affinity of the substrate may be varied from time to time as it adapts .....

in the defined process.

cDNA-encoding phytase isolation allows the construction of expression constructs capable of directing phytase production in the host plant chosen by the application of recombinant DNA techniques such as exchange of regulatory elements such as promoters, segregation or combinations thereof.

Phytase can be produced constitutively in transgenic plants during all stages of development. Depending on the use of the plant or the organ thereof, the enzymes may be expressed in a specific manner at the stage of development, for example, during the formation of tubers or during fruit development. Also depending on the use, the enzymes may be expressed specifically in the tissue, for example, in plant organs such as fruits, tubers, leaves or seeds.

Transgenic plants as defined in the context of the present invention include plants (as well as parts and cells of such plants) and their progeny that have been genetically modified using recombinant DNA techniques to elicit or increase the production of a ribbon if in the plant desired organism.

In the context of the present invention, the term "increased amount of phytase" refers specifically to a statistically significant amount of plant tissue which, on average, contains a statistically significantly higher amount of phytase compared to average amount of enzyme phytase found in an equal amount of unmodified plant tissue.

Within the context of the present invention, the plants to be selected, including but not limited to, include edible flowers producing plants such as cauliflower (Brassicaoleracea), artichokes (Cynarascolymus), fruits such as apple (e.g. (such as redcurrants, for example, Rhubarb rubrum), cherries (such as cherry-of-the-birds, for example Pruritis avium) , cucumber (for example, Cu cu missativus), grapes (for example, Vitis Vinevin), lemon (Citrus lirnon), walnuts (walnuts), walnuts (such as walnut

walnut, for example, Juglans regia; peanut, Arachis hypogeae), orange (for example, Citrus ______ max), peach (eg, Pejunus purpurea), pear (eg Pyra ____ communis), plum (e.g. Prunus domestica), strawberry leaves (such as alfalfa), cabbage (for example, Brassica oleracea), endives (for example, C 1. c ho r e rn (for example, Limeuca sativa), spinach (for example, Sfiinaeis, tobacco (for example, Nicotiana .tahacurn), roots , such as arrowroot (eg Macanta arundinacea), beet (eg Beta vulgaris), carrot (eg Pau cus caro ta), manioc (eg Manihot esoulenta), turnip (eg Srassica rapa),

The choice of plant is mainly determined by the intended use of the plant or its parts and by the possibility of transforming that species.

Various techniques are available for the introduction of the expression construct which yield the DNA sequence encoding phytase in the plants to be transformed. Such techniques include, but are not limited to, the transformation of protoplast using the calcium / polyethylene glycol method, electroporation and microinjection or good12

(Potrykus (1998), B 1 O / T and oh η 1, 8, 535).

In addition to these so-called direct DNA transformation methods, transformation systems involving vectors are widely available, such as virus vectors (for example cauliflower mosaic virus (CaMV) and other bacterial vectors (e.g. After selecting and / or choosing, the protoplasts, cells or parts of the plant that have been transformed may be regenerated to obtain complete plants using methods known in the art (RB Horsch, JE Fry, NL Hoffmann, D. Eichholtz, SG Rogers and RT Fraley (1985), Science 227, 1229. The choice of transformation and / or regeneration techniques is not critical to the present invention.

For diotidic plants, a preferred embodiment of the present invention utilizes the principle of the binary vector system (A. Hoekerna, PR Hirsch, PJJ Hooykaas and RA Schilperoort (1983), Nature 383, 179; RA

Schilperoort, A. Hoekerna and PJJ. Hooykaas (1984), European Patent Application No. 0 120 516), in which Agrobacterium strains are used which contain a plasmid coming from the virulence genes and a compatible plasmid containing the construct of the gene to be transferred. This vector can be replicated in both E. coli and E. coli in E. coli E. coli,n derives from the Binl9 binary vector (M. Bevan (1984), Nucl. Acids Res. 12, 871.1), which is altered in details that are not relevant to the present invention. Binary vectors such as are used in these examples have an identical NPTII gene encoding resistance to cannarnycin (Bevan, supra) between the left and right end sequences of the T-DNA and a multiple olonation site for clone in the constructs of the intended genes.

& transformation and regeneration of monocotyledonous crops is not a usual way of proceeding. However, recent scientific developments have shown that, in principle, microbes may be required to undergo transfer and that fertile transgenic plants can be regenerated from transformed cells. The development of reproducible tissue culture systems for these cultures, together with the powerful methods for introducing genetic material into plant cells, facilitated the transformation. At the present time, the methods of choice for the transfer of rhnonoctilioids are the microprojectile bombardment of plant-extracted or suspended cells and the direct uptake of DNA or electroporation of proto-fragments. For example, transgenic rice plants were successfully obtained using the bacterial hph gene, which codes for resistance to bigromycin, as a selection marker. The gene was introduced by electroporation (K. Shirnamoto, R. Terada, T. Izawa and I. Fujimoto (1989), Nature 938, 274). Transgenic maize plants were obtained by introducing the SE gene, reo m and rnormous crosium ω 1 cusbar coding for phosphorus .....

trichinacetyltransferase (an enzyme that inactivates the herbicide phosphinothricin) in embryogenic cells from a corn suspension culture by microparticle bombardment (WJ Gordon-Karnm, Spencer, ML, Mangano, IR Adarns,

Start, JV O'Brien, SA Chambers, WR

Wi.ll.ets, TE). Rice, CJ Mackey, RW

Krueger, A.P. Kausch and PG. Lernaux (1890), The Plant Cell 2, 803). The introduction of genetic material into aleuronic protoplasts from other rhizobacterial cultures, such as wheat and barley, has been reported (B. Lee, K. Murdoch, J. Topping, 1, Krish and 1 GK Jones, 1989 ), Plant Mol. Biol., 13, 21). Reg Cinerary of wheat plants from embryogenic suspension cultures by choosing only the tissues of the aged and nodular compact embryonic stem for the establishment of cultures in suspension internist (V. Vasil, F. Redway and Ϊ.Κ. Vasil 1990), Bio / Technol., 8, 429). The combination with the

R .. J .. Daines, WG Adarns Jr .., N. G.

transfer systems for such crops allows the application of the present invention to the monocotyledonous plants. These methods can also be applied for the transformation and regeneration of dicotyledonous plants.

Expression of the phytase construct involves details such as transcription of the gene by plant polymerases, translation of mRNA, etc., which are known to those skilled in the art of DNA recombination. Only details relevant to the proper understanding of the present invention will be set forth below.

In the present invention, regulatory sequences known or discovered to cause phytase expression may be used. The choice of the regulatory sequences used depends on the crop to be attained and / or on the organ of interest. Such regulatory sequences may be obtained from plants or plant viruses or may be chemically synthesized. Such regulatory sequences are active promoters in the direction of transcription in plants or constitutive or specific of the stage of development and / or tissue, depending on the use of the plant or its parts. Such promoters include, but are not limited to, promoters which exhibit constitutive expression, such as the cauliflower mosaic virus (CaMV) 35S promoter (Guilley et al. (1982), Cell. 30, 763),

Wenzler et al. (1989), Plant Mol. Biol. 12, 41) or those of fruit-specific expression such as the tomato polygalacturonase (PG) promoter (Bird et al. (1998), Plant Mol. Biol.

11, 851).

Other regulatory sequences, such as terminator sequences and polyadenylation signals, include any sequence that functions as such in plants, the choice of which is within the skill of those skilled in the art. An example of such sequences is the 3 'flanking region of the nopaline synthetase (nos) gene of Agrobacterium aeurisms (M. Bevan, supra).

Regulatory sequences may also include boosting sequences such as those found in the CaMV 353 promoter and the mRNA stabilization sequences, such as the leader sequence of the mosaic virus of the .....

fafa (A1Μ V) RNA 4 (F 1. F3 rederode, E.C.K ο ρ er · Z. wart hoffe JF.

Boi (1980), Nucl. Acids Res. 8, 2213) or any other if .....

that work in a similar way.

Phytase should be expressed in an environment that allows stability of the expressed protein. The choice of cell compartments, such as cytosol, endoplasmic reticulum, vacuoles, protein body or periplasmic space may be used in accordance with the present invention to create such a stable environment, depending on the biophysical parameters of phytase. Such inclined parameters are not limited to - optimum pH, protease sensitivity or sensitivity of the preferred compartment.

To achieve expression in the cytoplasm of the cell, the expressed enzyme should not contain a secretory signal peptide in any other desired sequence. of the target horn. For expression in chloroplasts and other metals, aenz i. In addition, joined

transit specific peptide for importation into these oranges. Targeted sequences are known which can be attached to the enzyme of interest in order to achieve this effect (Srneekens et al. (1990), IIBS 15, page 73; van den Broeck et al. (1935), Nature 31.3, 358; Schreider et al (1985) EMBO J. 4, 25). If it is desired to achieve enzyme activity in the vacuoles, a secretory signal peptide must be present, as an indication sequence as the specific target which directs the enzyme to those vacuoles (Taue et al. (1988), Plant Phys. , 506). The same is also true for proteinaceous bodies in seeds. The DNA sequence encoding the enzyme of interest must be modified such that the enzyme can exert its action at the desired location within the cell.

In order to achieve phytase extra-cellular expression, the expression construct according to the present invention uses a secretory signal sequence. Although signal sequences which are homologous (natural) to the host Host species, are preferred, heterologous signal sequences may also be used, i.e., those which are originated by other plant species or are of microbial origin. These signal sequences are known to those skilled in the art.

Suitable signal sequences that can be used within the context of the present invention are described by P. Walter and G. Blobel (1986), Bioohern. Soc. Syrnp. 47, 1.83; G. von Heijne (1986), J. Mol. Biol. 189, 239; and PC. S ij rn ons, Β .. Μ. M .. D ekker, B. S or hr a rnner, T. C. See woer d, PJM van den Elzen and A. Hoekerna (1990), Bio / Technol. 8,

21.7.

All parts of the relevant DNA constructs (promoters, regulatory sequences, secretion sequences, sequencing sequences, sequences that act

1, 2, 3, 4, 5,

(I.e.

like target or terminal sequences) according to the invention?

invention may be modified, if desired, to affect their control characteristics using methods known to those skilled in the art.

Please note that? What plants? Contains st. obtained by the present invention can be used to obtain plants or organs of? plants with even higher levels of? phytase. For example, it may be possible to obtain such plants or plant organs using somoclonal variation techniques or cross-culturing techniques. Such techniques are well known to those skilled in the art.

In? according to an embodiment of the present invention. invention, prepares ..... if a cDNA of? double track it? co

Difficult phytase from rNARN isolated from Aspergillus fuscus. The construction of? DNA is placed under the regulatory control of the gene which? encodes the 12S storage protein of the cruciferin from Brassicanapus. The construct is then subcloned into a binary vector such as plasmid (in strain DHSalpha of E.coli K-12, deposited at the Centraal Bureau voor Schirmercultures, Baarn, The Netherlands, on January 29, 1990, under the accession number CBS 102.90). This vector is introduced in Agrobacterium tumefaciens containing a disarmed Ti plasmid. The bacterial cells which contain this construct are co ..... grown with tobacco tissue or plants of the Brassica species and the transformed plant cells are selected by nutrient media containing antibiotics and induced to regenerate in plants differentiated with these hosts. The resulting plants produce seeds which contain χ and ρ reser rn DNA counseling.

According to yet another embodiment of the present invention, the DNA construct encoding phytase is placed under the control of regulatory sequences

of the cauliflower mosaic virus 35S promoter (CaMV). The construct is then subcloned into a binary vector. This vector is then inbred in Agrobacterium tumefaciens, which contains a disarmed Ti plasmid. The bacterial cells containing this construct are cocultivated with tobacco tissues of plants of the species EGLASS and the cells of the transformed plants are selected by nutrient media which contain antibiotics and are induced to regenerate in differentiated plants in those media. The resulting plants contain and express the construction of DM constituting the same.

Phytase activity can be measured by a number of assays, the choice of which is not critical in the present invention. For example, the phytase enzyme activity of transgenic plant tissue can be assayed by means of an ELISA, Western blotting or enzyme-linked assays using color techniques or assays with natural gels.

The plant or organ of the plant which contains phytase, such. as produced by the present invention, may be used in a variety of industrial processes which require the action of a phytase.

Plants or plant organs containing phytase produced in accordance with the present invention may be used in industrial processes which require the action of a phytase. Examples of such applications are food additives for non-ruminants, soybean processing or the production of inositol or inositol phosphates from phytate. It is used in other industrial processes using phytate-containing substrates, such as the starch industry and fermentation industries, such as the beer industry. The determination of the metal moieties by phytate can cause these compounds to

are not available for the production of microorganisms. Phytate enzymatic hydrolysis avoids these problems.

Phytase produced in plants may also be used in a process for the maceration of maize or grain sorghum. The plant tissue can be budded before it is added to the maceration maize. Phytase released from the plant tissue can act on phytine gue- if found in many maize preparations. Phytin degradation in maize maceration is beneficial to increasing the commercial value of maize maceration liquid, which is used as feed or as a nutrient in microbial fermentations. In addition, phytin degradation can prevent problems related to the accumulation of deposits in filters, piping, reaction vessels, etc. during the concentration, transport and storage of the liquid of? maceration of maize (T Vaara et al. (1989), European Patent Application

321 004). The action of phytase may also accelerate the maceration process and the separation processes involved in the wet processing of maize.

The plants or organs of? plants can be used directly, ie without further processing or prime? iram be processed by conventional processes such as to the consistency desired prior to application.

As a variant, phytase? can be extracted from the plant or plant organs and, if so? intended to be purified prior to use using standard extraction techniques and standard purification techniques.

The production of phytase and? are compatible with the intended application provides convenient results and? reduces production costs compared to that of microbial phytases in order to? allow its application

economic, for example, in feedingstuffs, which eventually gives rise to a competitive price / competitive ratio with inorganic phosphate. As a further benefit, the phosphorus content of excreta is considerably decreased.

It is appreciated that the application of phytases, available at a competitive price with inorganic phosphate, au .....

the degree of freedom of the compound feed industry in order to produce a high quality food. For example, when the food is supplemented with phytase, the addition of inorganic phosphate may be omitted and the contents of the various phytate-containing materials may be increased.

The following examples are provided to provide those skilled in the art with a full description and indications of how to make and use the present invention and are not intended to limit the scope of what the inventors consider to be the scope of their invention.

Efforts have been made to ensure accuracy with regard to the numbers used (eg quantities, temperatures, pH, etc.), but errors and experimental deviations are possible. Unless otherwise indicated, the temperature is expressed in degrees centigrade and the pressure used is atmospheric pressure or near atmospheric pressure.

EXAMPLES

Example 1 - (-) - r gi 11 us fiouu rn

A. ficuum strain NRRL 3135 is grown in medium containing 22.72 grams / liter of corn meal (arnilase treated at pH 7 at 85 ° C for fifteen minutes),

9.36 grams / 1 i. g of zinc, 2.9 gms / 1: 1. KN 0 3, 0.14 2 gr / liter dt; KCl, 0.142 gram / liter of MgSO4 -H2 O, and 56.6 ml. 1. In grams of the F and S O4 - 7 63 0. In the case of six-fold, the culture of mycelium is reduced.

Freeze? dry silica (0.5 gr.) with liquid nitrogen and? Subsequently, the material is homogenized with an Ultra Turrax homogenizer (maximum speed, for one minute) at 0 ° C in 1 ° C. 3 M and? urea Ei M and stays for? overnight at 4 ° C as described by Auvergne and Rougeon (1980), Eur. J. Biochern. .1.0.7, 303. The total cellular RNA was obtained after centrifugation at 16,000 X g, is followed by two successive extractions with phenol: chloroform (50: 48: 2). Does it precipitate? the RNA is ethanol and redissolved in 1 ml of 10 mM Tris-HCl (pH 7.4), 0.5% SDS. For the selection of poly A+, the total sample of? RNA for five minutes at 65 ° C, adjusted to NaCl 0.5 1 * 1 and? will apply? subsequent to an oligo (d T) -cellu column. In? with different concentrations of Tris-10-one, pH 7.0, 1 mM EDTA and 0.1 mM NaCl, the poly A+ RNA by elution with 10 mM Tris pH 7.0 and? with EDTA 1. NMR.

Example 2

Preparation and Cloning of a cDNA

For the synthesis of a first part of the cDNA, 5 micrograms of? poly A+ RNA, isolated according to Example 1, in 16.5 mmol of H 3 O and the following components are added: 2.5 microliters of a buffer containing 50 mM Tris-HCl pH 7.6, 6 mM MgCl2, 2 hydrochlorides of KCl 1 * 1.5 mmol of DDT 0.11 * 1, 0.5 mmololol of oligo (dl) | 2_ | (2.5 mg / ml), 5 microliters of a mixture of 8 mM dNTP, 5 mM BSA (1 mg / ml) and 2.5 mmol Moloney IVV reverse transcriptase (200 IU / microliter). The mixture is incubated for 30 minutes at 37 ° C and the reaction is stopped by addition of 10 microliters of 0.2 molar EDTA and 50

my HgO croliters. Extraction is performed using 1.1.0 microliters of chloroform and, after centrifugation for five minutes, 5 M NH4 Ac and 440 microliters of ethanol are added to the supernatant. absolute (-20 ° C). Precipitation is carried out in an ice / ethanol solution for thirty minutes. After centrifugation (ten minutes at 0 ° C), the cDNA pellet is washed with 70% ice / ethanol. cold. The pellet is dried and dissolved in 20 microliters of EtOAc. Isolation of the phytase encoding oDNA is performed on the polymerase chain reaction (PCR) in two fragments. The two fragments are combined using the BarnHI site within the gene to create a full-length DNA. The strategy for performing the cationation of phytase oDNA is shown in Figure 1.

partial segment of the phytase gene (van Gorcornrn et al., supra) discloses the presence of a BamHI site at approximately 800 base pairs of the initiation coda. The nucleotide sequence around this BarnHI site as well as the nucleotide sequence preceding the initiation cDNA and the nucleotide sequence after the stop codon of the phytase gene are used to design oligonucleotides for PCR.

The polymerase chain reaction is performed according to the supplier of Taq polymerase (Cetus) using 1. 1 microliters of the solution containing the reaction product of the first synthesis and 0.5 micrometre of each of the oligonucleotides . The amplification is performed on a Perkin Elrner / Cetus DNA amplifier. After twenty-five two-minute cycles at 94 ° C, two minutes at 55 ° C and three minutes at 72 ° C, the reaction mixture is deproteinized by subsequent extractions with phenol. and cyro-orphan. C DNA is precipitated, redissolved in a cap containing 10 mM Tris, pH

Ί, and 0.1 mM EDI, é is subsequently digested with appropriate restriction enzymes.

For the amplification of the fragment coding for the N-terminal part of the protein, the following sequences are used: Igonuc 1 and 2:

Oligo 1: '5' GGGTAGAATTCAAAAATGGGCGTCTCTGCTGTTCTA 3 '

The amplified fragment is digested with EcoRI and cloned into the EcoRI site of pT'Z.18R (purchased from the Pharmacia firm). Restriction site mapping and nucleotide sequencing demonstrate the authenticity of The resulting plasmid is designated pGB925.

For the amplification of the second fragment, the following two oligonucleotides are used:

Oligo 3: 5u GAGCACCAAGCTGAAGGATCC 3 '

Oligo 4; The amplified fragment is digested with BamHI and PstI and subsequently sequentially cloned to give pTZ1BR which has been digested with BamHI. and PstI. Restriction site mapping and nucleotide sequencing shows that the correct fragment was isolated. The resulting plasmid is cb amido pGB928.

length is insulated o. This D-plasmid fragment encodes the

In order to isolate a complete cDNA, pGB925 is digested with EcoRI and BarnIII and the fragment encoding the phytase encoding DNA is cloned into plasmid pGB926, which was EcoRI and BarnHI, resulting in the plasmid pGB927. pGB927 contains a full- length phytase cDNA , approximately 1.8 l <bp. THE

region of the oDNA encoding the phytase protein and the amino acid sequence derived from the phytase protein are depicted in Figure 2.

Example ..... 3

With str uction o____Binary Voltage pW0G23

In this example, we describe the binary vector pl * IOG23 (in strain E. coli K-12 DHSalpha, deposited with the Centraal Bureau voor Schirnmel-cultures on 29 January 1990, sot) the number of access 102.90).

binary vector pM0G23 (Figure 2) is a derivative of the vector Bin., 1.19 (M. Be van, sujarei). In order to obtain plasmid DNA, the vector Bi.nl9 is modified in a non-essential manner to the present invention using techniques familiar to those skilled in the art of molecular biology.

First, the positions of the left border (LB) and the right border (RB) are switched off with reference to the neornicin transfection gene II IF (gene NPTII). Secondly, the orientation of the NPTII gene, resulting in transcription in the L..B direction. Finally, the polyvinylalco-substituent is replaced by a polymer with the following recognition sites: restriction enzymes: EcoRI, Knpl, Srnal, EI to E1I, Xbal, Saci, Xbo I and HindIII.

EXAMPLE 4 Cisoryl 9.9. 9..Q.bL ... d.RTM. 9..R.R.Julius f 1.99999.9.99 .C99.9.tF.9..99.9. Asparagine phytase gene is adapted and characterized in an expression construct, as described above, for the constitutive expression downstream of the cauliflower mosaic virus promoter 35. The expression construct also contains the coding information for a sequence of signal peptides of plant origin.

cDNA of the phytase is shown in the expression construct oo ino present in the plasminid pM0G29 (described in a)). Subsequently, the complete construct is intruded in the binary vector pM0G23 and transferred to the strain .LBA4404 of Agrobacterium tumefaciens.

a) C °nstruction of the ExpressionVector pM0G29

The expression construct of ROK1 (Bauloornbe et al. (1996), Nature 321, 446) is cloned as an EcoRI / HindIII fragment in pUCIS. This construct contains the 35S promoter from the earwax virus (CaMV) on an EcoRI / BarnHI fragment and the nopaline synthetase transcription primer (nos) on a fragment of B a rn Η Ϊ. / H ind 111. The promoter fragment consists of the sequence from -800 to 4-1 of the CaMV 35S promoter. Position +1, which is included, is the initiation site of the transcript (Guilley et al., Supra). The sequence upstream of the Ncol site at position -512. is deleted and this site is transformed into an EcoRI site. This is done by cleaving the expression construct present in the IgG18 with NcoI, filling the ends of the single-stranded Klenov polymerase and attaching an EcoRI linker. the resulting plasmid is cleaved with EcoRI, resulting in the deletion of the EcoRI fragment carrying the 35S promoter sequences upstream of the original NcoI site. The fragment 8 to rN1 / H1 nd1I1 that is present in the terninator is replaced by a synthetic DNA fragment (double oligonucleotide A, Figure 4) containing the RNA4 leader sequence of alfalfa virus (AIMV) (Brederode et al., Sugra). This is done by cleavage with BarnHI, followed by cleavage with HindIII and ligation of the synthetic DNA fragment. The BarnHI site and three upstream nucleotides are suppressed by site-directed mutagenesis. In the 1 1 as id id id es es 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11. the gene coding for beta - g.

linked as an NcoI / BamHI fragment, resulting in the plasminid pM0G14.

From the literature it is known that doubling the sequence between -343 and -90 increases the activity of the 35 S promoter (R .. Kay, A. Chan, M .. Dayiy and J. McPherson (1987), Science 239 , 1299). I have stopped to obtain a promoter fragment with a double sequence, called refiner, the following operations, known to those skilled in the art, are carried out. From the plasminid pM0G14, the reinforcing fragment is isolated on an ACCI / EcoRI fragment and the Klenov polyamine kinase is subsequently desensitized. The obtained fragment is introduced into EcoRI cut pM0G14 and the end of such is isolated. so that the border between the EcoRI sites and the desensitized endpoint generates a new EcoRI site. The resulting plasmid (pM0G18) contains the 35S promoter with a double-stranded sequence a, the 4 MV RNA leader sequence and the terminator in an expression construct still present on an EcoRI / HindIII fragment. Finally, the NcoI / BarnHI fragment encoding beta-glucuronidase is replaced by a synthetic DNA fragment B (Figure 4) derived from the PROB 1.2 cDNA (B.J.C. Cornelissen, RAM I looft van Huijsduijnen and JE

Boi (1986), Nature 321, 531). This fragment B encodes to be .....

PR-S signal peptide of PR-protein from Sarnsun NN of tobacco. An Sph I site is created on the signal peptide encoding the DNA sequence by modifying a nucleotide. This modification does not alter the amino acid sequence of the signal peptide. PR-S encoded. The resulting plasmid is called pM0G29 (Figure 5).

b) Cloning ...... of the Fitase Cene of Asperg 11.1.us ficuurn nurn

................. VectorBinary duplex oligonucleotide C (Figure 4) was encoded in the plasmid ρ MO629, digested with SphI and BarnHI, resulting in plasmid pMOG407. O oligonucleo .... 27 -

the double amino acid contains the coding information for the two final amino acids of the PR-S signal peptide, followed by the first six amino acids of mature phytase.

Plasmid pGB927, which contains the full-length phytase cDNA, is digested with XhqI (partially) and PstI .. The XhoI / PstI fragment, which comprises the DNA sequences which encode the mature phytase from the acidic amino acid 6 onwards , is cloned into the plasmid pMOG407 linearized with γίοΙ and PstI, resulting in the plasminid pM0G417. The complete construct, which contains the chimeric phytase gene, is inserted as an EcoRI / HindIII I fragment into the vector binary p 1 * 1 DG23 linearized with EcoRI and HindIII. The resulting binary plasmid pM0G413 is mobilized in an enteric riparian adjustment with E. coli K-12 strain RK2013 (which contains the plasmid pRK2013 (G. Ditta, S. Stanfield, D. Corbin and D. R. Heiinski (1980 ), Proc. Natl. Aoad, Sci IJSA 77,

Example 5

Expression Transien t do ..... Gene of Pita if Chimeric ern

Proto ρ 1 tobacco horns

Tobacco protoplasts are transformed with plasmid DNA which carries the chimeric phytase gene under regulation of the constitutive 35S CaMV promoter. After seventy-two hours, the treated protoplasts are assayed for transient expression of the introduced phytase gene using the phytase activity assay.

The protoplasts are prepared from tobacco plants with one to two months of age (Nicotiana tabacurn SRI). The complete procedure is described by KW Rodenburg, MJA DeGroot, RA Schilperoort and PJJ Hooykaas (1989), Plant

Biol., 13, 711). To undergo transformation, a number of 5 x 10â ¶ protoplasts are electroporated with 40 plasmid DNAs from plasmid pM0G417. After the electroporation, the protoplasts are resuspended in 3 ml of K3G medium. To perform the phytase activity assay, the protoplasts are separated by centrifugation on a continuous day, supernatant; during the night an excess of water. The dialyzed product is lyophilized and; resuspended in 300 micromoliters of 25 mM sodium acetate, pH 5.5. The test proceeds; then as described; in detail in Example 10, with the sole exception of, instead of 250 mM glycine-HCL pH 2.5, use a taro of acetate; 25 mM sodium phosphate buffer pH 5.5.

In these experiments, a phytase unit; (PTIJ) is defined as a phosphoric acid liberated from; a 1.5 mM sodium acetate solution per minute at 37 ° C, pH 5.5.

In untreated protoplasts, it is not; finds activity; detectable. The protoplasts electroporated with the plasminid pM0G417 have an activity of; 0.2b PTU per milliliter of; protein in the supernatant.

Example b

.............................. plants with the strain LBA4404 of; A g ob act, er 1 u rn tumefaciens which; contains the binary vector pM0G413 with the phytase gene; chimeric under the regulation of the CaMV 353 promoter. Transformation is performed; by cocultivation of; discs of; tobacco leaves (Niootiana tabacum 3 RI) according to Horsch et al., supra. The transgenic plants are regenerated from shoots that are grown in the field of selection (100 mg / liter of kanamycin), rooted and transferred to the ground. The plants of; are tested for Î ± 5, Î³3SE3 =

her activity of Ν Ρ Γ11. (life expectancy up to maturity).

kanamycin), allowed to autopolymerize and to assay for the phytase activity of leaves of transgenic plants, a segment of about 5 millimeters in diameter is cut from a fresh leaf of each plant and homogenized 300 microliters of? 25 mM NaOH at pH 5.5. The phytase assays are then performed as described for the transient assays. In the present invention, thirty-two independently transformanted tobacco plants are present in their extracts, or their availability is as high as 2 PTU / ml of the total soluble protein content in the extracts. This corresponds to 1.7% of the soluble protein. total. In the seeds of these transformed tobacco plants, a maximum level of phytase expression equal to 0.4% of the total soluble seed protein was observed.

Two lines of transgenic plants, 413.25 and 413.32, were selected based on their high levels of phytase expression.

Example 7

Cloning of the DNA of ...... Fitase from A s ρ ergi 11 we started a nude street

Specific Expression Constants

An expression construct is constructed so that specific seed expression is obtained using cruciferin sequences from the storage protein gene of Brassica napus 12S (cruA; Ryan et al., Supra). These sequences may be substituted for those of the specific genes of similar seeds to achieve the purpose for which the present invention is intended.

of expression. Finally, the complete construction is introduced in Agrobacterium rumeumensis, which is used for transformation.

In all E. Coli transformants of this Example, E. coli strain K-12 DHSalpha was used.

a) Construction ofExpression Construction

For constructing the expression construct for seed-specific expression, the promoter and terminator sequences of the Cruciferin A (cruA) gene from Brassicanaguscv. Jet Neuf are synthesized using the PCR technology of the genomic DNA solay (I .. J. Mettler (1987), Plant Mol. Biol. Rep. 5, 346) as a template. This gene exhibits seed-specific expression and its coding and flaking sequences were determined (Ryan et al., Supra).

S intetizava rn - sedoiscon J untosofo 1 - nucleotides. One is intended to allow amplification of the 5 'cruA flanking region and part of the signal peptide encoding the sequence as an EcoRI / NcoI fragment:

'GTTtIGGAATTCGGGI 1 CCGG 3' and 5 'AACTG GAGCIGl AGAGCG 3 ".

another set serves for the amplification of the 3 'flanking sequence as a BglII / HindIII:

5 'ClTAAGATCTlACCCAGIGA 3' and 5 'CGGAGAAGCTTGCATCTCGT 3'.

The oligonucleotides are constructed in sequence to contain appropriate restriction sites at their exprehensities to allow direct binding of the

ΪΠΣΞ £ χ ϊ;

expression after digestion of the fragments with the restriction enzymes.

The 5 'fragment of the cruA gene, which includes fifty-four nucleotides of the signal peptide encoding sequence, is cloned out of wood to obtain vector pM0G445 (duplex oligonucleotide E; Figure 4), cloned with the vector pUClG, linearized with SstI and EcoRI and cleaved with EcoRI and Ncol, the vector pl * 10G424 was obtained. Synthetic duplex oligonucleotide D (Figure 4), which encompasses the final coding triplet 5 for the Brassicanapus cruciferin signal sequence, the sequence encoding the mature phytase 1 -6 amino acids and a multiple cloning site is cloned into the vector IOG424 cut with NcoI and NcoI and HindIII. The resulting vector is designated pJ * IOG425. The 3 'cruA PGR fragment is cloned as a Bgl fragment. I1 / Hindi 1I ern pl * IOG425 digested with Bgl. 11 and HindIII,

b) Glpnation of the Phytase Gene ... of the Erillus fichuujm in the Plasmid Binary Plasmid pGB92'7, which contain what is .....

phytase encoding of Aspergillus ficuum, is digested with Xhol (partially) and with PstI. The XhoI / PstI fragment, which comprises DNA sequences encoding phytase from amino acid 6, is cloned into the vector pM0G426, cut with XhoI and PstI. From the resulting vector pM0G428, the whole construct containing the chimeric phytase gene is inserted as an EcoRI / HindIII fragment into the binary vector pMGG23 linearized with EcoRI and HindIII. The resulting binary vector pM (JG429) is mobilized, in a tripartite adjustment with strain RK2013 of E. coli K-12 (containing the same pRK20X3) (Ditta et al., Supra) obtained from the strain LBA4404 (Hoekema et al., 1993, supra), which contains the ρ 1 as the transfer medium

of Ϊ-DNA for the plant.

Example 8

Expression Specifies Stable Seeds

Seeds of Tobacco under the Contract of a Promoter of

Gruoxferin

L. gullacterial strain L.BA4404, having the binary vector pl * IOG429 with the phytase cDNA under the control of the cruciferin promoter, is used for transference experiments. The conversion of the tobacco (Nitrogen to Tobacco Flux) is carried out using the distillation of sheet disks according to the procedure of Horsch et al. frog. Transgenic plants are regenerated from shoots grown in the selection (100 mg / 1 kanamycin). Plants of young age are tested relatively; NPTI1 (kanamycin resistance) activity, grown to maturation & allowed to self-pollinate and seed. The seeds of individual transformants are pooled and part of the seed sample is assayed for the presence of phytase. From clones with the highest levels of expression, compared to untransformed control seeds, the remaining seeds are germinated in kanamycin (200 mg / liter). From the data obtained with the resulting seeds S2, the greyish seeds are selected, respectively, for Ν Ρ 11 (or or or or or or or or Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ) and are used for propagation in the mass of plants capable of producing the maximum amounts of phytase. These can then be used for, for example, digestion experiments. the remaining seeds are germinated in kanamycin (200 mg / liter). From the data obtained with the resulting seeds S2, the greyish seeds are selected, respectively, for Ν Ρ 11 (or or or or or or or or Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ) and are used for propagation in the mass of plants capable of producing the maximum amounts of phytase. These can then be used for, for example, digestion experiments. the remaining seeds are germinated in kanamycin (200 mg / liter). From the data obtained with the resulting seeds S2, the greyish seeds are selected, respectively, for Ν Ρ 11 (or or or or or or or or Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ Ρ) and are used for propagation in the mass of plants capable of producing the maximum amounts of phytase. These can then be used for, for example, digestion experiments.

To determine the phytase activity found in the transgenic seeds, an approximately 50 mg seed sample is obtained and homogenized in an ice-cooled mortar in 1 ml of 25 mM sodium acetate buffer at pH 5.5. After centrifugation, the supernatant is assayed for the transient assays. In fifty-five tobacco plants independently transformed, a maximum phytase expression level of 0.15% of the total soluble protein in the seeds was observed. Phytase activity was not detected in stems, roots and leaves of transgenic plants. No phytase activity was detected in untransformed plants.

Example 9

Rapeseed oilseed rape

In this example, colza transformation is described by plant tissue cocultivation with Agrobacterium turnefac 1 ens containing a binary vector with the chimeric phytase gene. Transgenic plants may be based on resistance to antibiotics. Transgenic plants can be assayed for phytase activity. Those that express larger quantities can be analyzed more carefully and used in later experiments.

The same chimeric phytase construct is engineered into a binary vector (pM0G429) in the strain LBA4404 of eriumtumephase according to a similar manner as described in example 7. This strain can be used for transformin (Brassicanap us v. Westar). For this purpose, shoot segments are pre-conditioned on sterilized surfaces removed from plants at five to six weeks of age, precisely from flowering, for twenty-four bays on MS medium (Ery et al. Plant Cell 1.1, Reports 6, 921) with 1 Âμg / liter of BAP and then cocurised for forty-eight hours with Agrobacterium on fresh plates with the same medium. Transgenic seedlings are regenerated from shoots grown on the selection medium (500 ng / liter of

carbenicillin, 40 mg / liter paromomycin) and are then analyzed as described in Example 8 for tobacco.

Example 10

AssayEducationActivity

An amount of transgenic plant material containing at the site approximately 0.25 Ρ TU (pyij - phytase activity units. A unit of phytase activity is defined as the amount of enzyme which releases inorganic phosphate from sodium phytate 1.5 nM at the rate of 1 microchannel / min at 37 ° C and pH 2.5). Alternatively, this amount of phytase may be extracted from the material of the plant.

The crude plant material was incubated in a total volume of 50 ml. glycine cap / 250 mM HCL, p1

2.5, containing 0.86 grams of sodium phytate. Although Aspergus spreads phytase at an optimum pH of 2.5 as well as 5.5, a lower pH is chosen to exclude phytase activity originated by the plant.

The resulting mixture is incubated for fifteen and sixty minutes at 37 ° C. The reaction is quenched by addition of 5 ml. of material. incubated in 5 ml of 10% TCA (trichloroacetic acid). The enzyme solution is then added with the reaction quenched with 10 ml. of indicator reagent (3.66 grams of FeSO4 / H2 O in 50 ml of arnium molybdate solution (2.5 grams of (NH4) Μογί!24 and Concentrated, diluted to 250 ml. with demineralized water). The intensity of the blue color is measured spectrophotometrically at 700 nm.

content of inorganic phosphate present at

Γ --- 0 is a blank test.

The determinations are indicative of the amount of? phosphate released relative to the phosphate calibration curve in the range of 0-1 mM.

.Example 11

Incubation of ..Material deplanted ..... Nie: çítiana TabacumMqido cornAlimenteis

In a typical experiment, 0.25 grams of solvent-extracted soybean meal is incubated with an amount of milled plant material containing about 0.25 PTU, such as? described above, with the exception of the addition of? phytate? sodium. In this case, the added incubation agent consists of? A mixture of? 410 ml of tarn and 90 ml of demineralized water.

The release of phosphate from phytate in? soybeans extracted with solvent? is represented graphically? in Figure 6. If ground vegetable material is added, no activity is observed ?.

In virtually the same experiment, the same results are obtained using corn gluten as the substrate. The results obtained with the transgenic seeds are orepre? shown in Figure 6.

No activity is observed in the absence of the milled plant material or when the milled plant material added does not have phytase activity.

Example 12

In vitro Assay of Transgenic Vegetai Material Containing

Fiase, in Conditions Imitating Digestive Tube, of ..... Birds of

Capoeira

To determine the effectiveness of phytase produced in: transgenic tobacco plants, determined? the activity? in? phytase coming? from Asper36

gillus in a model that mimics the conditions found in the digestive tract of poultry.

First, a sample of standard poultry feed is incubated in 1 gram / 15 ml water for sixty minutes at 39 ° C to simulate the conditions present in the development of the animals. Subsequently, 5 ml of pepsin solution (Merck, 5.28 grams / liter, pH3.0 - adjusted with HCl) is added, the pH is adjusted to pH 3.0 with HCl and incubation is continued for another ninety minutes at the same temperature to simulate the conditions in the stomach.

During the incubation period,

..... samples are taken in order to determine the amount of phosphate released from the phytate present in the feed.

The action of phytase from fungus is evident in Figure 7. By increasing the phytase dosage from 250 to 1000 OCU / kilogram of feed, an increase in phosphate release from the feed sample is obtained.

When a sample of transgenic tobacco plant material or seed or leaf (lines 413.25 and 413.32, after milling in a mortar) is added instead of fungal phytase, a similarly increased increase of similarly increased phosphate (Figure 8) is observed .

Material from control tobacco plants, which does not contain phytase, was also assayed. No phosphate release was observed in comparison to the blank control.

The comparison of the results obtained with 50 grams of transgenic tobacco seeds / kilogram of feed with those obtained with 500 and 750 OCT / kilogram of

food indicates that 1 gram of tobacco seed is approximately equal to 1.2 μl in this model of in vitro poultry digestion. Comparison with the sample using sheet material indicates that 1 gram (fresh weight) of Tobacco leaves contain approximately 25

PTU.

Example1.3

Testing animals

They perform experiments on grilling chickens to show the efficacy of phytase expressed in plant seeds, as well as the absence of any negative effects of tobacco seeds on zootechnical results.

Phytase-expressing tobacco seeds and tobacco seeds are collected for control. The seeds are milled in 100 gram portions with a sieve (Retch-mill ZM1) having pores of 500 micrometers, taking care to keep the seeds cool.

One-day-old male chicks (Hybro) are housed in bacteria cages for two animals (0.45 ml). The ambient temperature is 32 ° C for the first two days and then decreases by 4 ° C on the first morning. In each of the following weeks, the temperature is decreased from 2 ° C. The chicks are created under one hour of light and three hours of darkness.

The birds are vaccinated against New Castle's disease at one day, using Vaccine Clone 30. During the experiments, the chicks are fed experimental diets of flour at will. Measure the developmental and aldernen / gain ratios during the experimental periods. The apparent availability of total phosphate is measured over a three-day period, during which

the form of dry matter enters and is collected when they contain the excrements.

The apparent availability of phosphorus is defined as the difference between the input amount of phosphorus and the excretion of phosphorus with the excrement.

In the case of contolling diets, phytase is added:

Diets

Ca w

P Total U)

Phytate P (%)

0.30 0.30 0.30

To the diet .1. (basic diet), no phosphate is added to the food. Diets 2 and 3 are supplemented with calcium and phosphorus from a mixture of dicalcium phosphate. anhydride and rhodium o-ammonium phosphate (5: 1 ratio). All experimental diets are obtained by additions to the base diet (see table 1).

The experimental diet 4 contains phytase from microbial origins at a concentration of 400 PTIJ / kg of food, prepared as described by Van Gorcorn et al., (A).

The experimental diet 5 is similar to that of the diet. In addition to the food composition, the seeds of non-trangenic tobacco were added to achieve a final ratio of 3 kg / 90 kg of feed.

The experimental diet 6 is similar to diet 4, but 3 kilograms of high yielding seeds of trangenic tobacco (line 413.25) are added to a mixture of

gilograms of food to give a final concentration of 400 μl / kg of feed.

The experiment is performed with 176 chicks in sixteen battery cages (eleven chicks per battery cage) up to the age of twenty-four days.

The treatments (diets) are repeated twice and are attributed to chance to each animal of the cages.

It measures ..... whether the availability of phosphorus from twenty-one to twenty-four days old.

The results regarding the availability of phosphorus and the development of animals fed with diets 4,5 and 6 demonstrate the positive effect of phytase addition (labella 2). The comparison between the diets 4,5 and 6 also demonstrates that the inclusion of tobacco seeds in the food is compatible with the action of microbial phytase in the gastrointestinal tract of breeding herds, such as chicks, and does not have any negative effects on the zootechnical results ..

While the present invention has been described with reference to specific embodiments thereof, those skilled in the art will appreciate that various changes and modifications are possible without departing from the actual spirit and purpose of the present invention. In addition, a number of modifications may be made to adapt to a situation such as the purpose, spirit and purpose of the present invention, material, process, operation or operations of the process. invention. All such modifications are intended to be included within the scope of the appended claims.

TABLE 1

<td>Base Diet Composition Used</td><td>and rn Ε xperi c ces</td><td>corn chicks</td>

<td>Ingredients</td><td colspan="2">Content (g / kg)</td>

<td>Yellow Corn</td><td>280.0</td><td></td>

<td>Sorghum (small tannin content)</td><td>200.0</td><td></td>

<td>Sunflower Seed Flour</td><td></td><td></td>

<td>(extra 1)</td><td>80.0</td><td></td>

<td>Farinbei de sernente? of soybeans</td><td></td><td></td>

<td>(extractable in addition, 48.8%</td><td></td><td></td>

<td>in? proteins)</td><td>350.0</td><td></td>

<td>Vitamins*</td><td>5.0</td><td></td>

<td>Limestone</td><td>1.0</td><td></td>

<td>Ethionine ethionine</td><td>1.0</td><td></td>

<td>Lysine</td><td>12.9</td><td></td>

<td>Methionine + cisine</td><td>9.1</td><td></td>

<td>Calcium</td><td>6.0</td><td>(6.0-6.6) **</td>

<td>Total match</td><td>4.5</td><td>(4.7-4.7) **</td>

<td>Phosphorus organic phosphorus</td><td>3.0</td><td>(3.1-3.1) **</td>

* Quantity provided per kilogram of diet: 12,000 IU of vitamin A; 2,000 IU of Vitamin Dq; 5 IU of vitamin E; 1.5 mg of vitamin K3; 1 mg of thiamin: 5 mg of riboflavin; 1 mg pyridoxine; 30 mg of nicotinic acid; 7.5 mg of D-pantothenic acid; 0.015 mg of vitamin B12; 0.5 mg folic acid; 350 mg choline chloride; 75 mg of ethoxyquin; 9.5 grams of CaCGq; 2.5 g NaCl; 0.26 g of ESA3; 0.24 g of MnSO4; 45 mg of 61.1 SO4; 80 mg ZnSO4; 105 mg KI (mixture).

() analyzed for experiments 1 and 2, respectively

................. 1st cie

Q 22.2.22.1.2 ......... 22 ...... Ei ..... JI2l.2i ......... 2 ...... 22..5. ...... 2.222 ....... 2.2 ....... E ..... QS2 ......... £ 2.E222.2.2i.

Methodology: 2.2.2.

p.a.

Contents9

67 members in 18 offices

This recordMember, by publication datePriority claim8 more offices are in the list below

Priority claims8

Priority claims
Document	Office	Kind	Date
49856190	United States of America	A	1990-03-23
49856190	United States of America	A	1990-03-23
58676590	United States of America	A	1990-09-21
58676590	United States of America	A	1990-09-21
498561	–	–	–
586765	–	–	–
US19900498561	–	–	–
US19900586765	–	–	–

Members67

Family members, oldest first
Document	Office	Kind
CA2054762A1	Canada	A1	1991-09-24
CA2056396A1	Canada	A1	1991-09-24
EP0449375A2	European Patent Office (EPO)	A2	1991-10-02
EP0449376A2	European Patent Office (EPO)	A2	1991-10-02
WO9114772A1	World Intellectual Property Organization (WIPO)	A1	1991-10-03
WO9114782A1	World Intellectual Property Organization (WIPO)	A1	1991-10-03
EP0449375A3	European Patent Office (EPO)	A3	1991-10-09
AU7765691A	Australia	A	1991-10-21
AU7776691A	Australia	A	1991-10-21
EP0449376A3	European Patent Office (EPO)	A3	1991-11-06
FI915477A7	Finland	A7	1991-11-20
PT97110A	Portugal	A	1991-11-29
PT97111A	Portugal	A	1991-12-31
IL97645D0	Israel	D0	1992-06-21
IL97646D0	Israel	D0	1992-06-21
HU914086D0	Hungary	D0	1992-07-28
HU914087D0	Hungary	D0	1992-07-28
KR920701454A	Republic of Korea	A	1992-08-11
KR920702413A	Republic of Korea	A	1992-09-04
HUT60767A	Hungary	A	1992-10-28
HUT60780A	Hungary	A	1992-10-28
AU632941B2	Australia	B2	1993-01-14
NZ237549A	New Zealand	A	1993-06-25
NZ237550A	New Zealand	A	1993-09-27
JPH06501838A	Japan	A	1994-03-03
JPH06502296A	Japan	A	1994-03-17
AU649447B2	Australia	B2	1994-05-26
US5543576A	United States of America	A	1996-08-06
US5593963A	United States of America	A	1997-01-14
IL97645A	Israel	A	1997-03-18
US5714474A	United States of America	A	1998-02-03
US5770413A	United States of America	A	1998-06-23
HU215164B	Hungary	B	1998-10-28
HU215260B	Hungary	B	1998-11-30
PT97110B	Portugal	B	1998-11-30
RU2128228C1	Russian Federation	C1	1999-03-27
RU2129609C1	Russian Federation	C1	1999-04-27
KR100211308B1	Republic of Korea	B1	1999-08-02
KR100225087B1	Republic of Korea	B1	1999-10-15
US6022846A	United States of America	A	2000-02-08
EP0449376B1	European Patent Office (EPO)	B1	2001-05-16
AT201232T	Austria	T	2001-06-15
ATE201232T1	Austria	T1	2001-06-15
DE69132605D1	Germany	D1	2001-06-21
DK0449376T3	Denmark	T3	2001-08-06
DE69132605T2	Germany	T2	2001-10-25
PT97111BThis record	Portugal	B	2001-10-30
ES2160095T3	Spain	T3	2001-11-01
GR3036358T3	Greece	T3	2001-11-30
IL97646A	Israel	A	2003-05-29
JP3471795B2	Japan	B2	2003-12-02
JP2004041201A	Japan	A	2004-02-12
US2004088750A1	United States of America	A1	2004-05-06
JP3600614B2	Japan	B2	2004-12-15
JP2005006657A	Japan	A	2005-01-13
US2006005286A1	United States of America	A1	2006-01-05
US7033627B2	United States of America	B2	2006-04-25
EP0449375B1	European Patent Office (EPO)	B1	2006-05-31
AT328093T	Austria	T	2006-06-15
ATE328093T1	Austria	T1	2006-06-15
DE69133533D1	Germany	D1	2006-07-06
DE69133533T2	Germany	T2	2006-11-23
ES2267092T3	Spain	T3	2007-03-01
CA2056396C	Canada	C	2007-06-05
JP3938401B2	Japan	B2	2007-06-27
CA2054762C	Canada	C	2008-01-15
FI119939B	Finland	B	2009-05-15

2 legal events, as the office reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code
2002-03-28	Change of proprietorshipPD3A	PD3A
1991-12-31	Laying open of patent applicationBB1A	BB1A

The expression of phytase in plants

Abstract

Term

DESCRIPTION

GIVES

PATENT OF INVENTION

EPIDEMIC: "PROCESS FOR OBTAINING TRANSGENIC PLANTS

HAVING INTENSIFIED QUANTITIES OF FITASE "

DESCRIPTION

J

EXAMPLES

TABLE 1

Priority claims8

Members67

Over the term

Events

Numbers

Titles2

Classification