Compounds and methods for kinase modulation, and indications therefor

Description

FIELD

The present disclosure relates to protein kinases and compounds that selectively modulate kinases, and their uses. In particular embodiments, indications of diseases are contemplated that are treatable by the modulation of kinase activity by the compounds of the present disclosure.

BACKGROUND

[0002] Receptor protein tyrosine kinases (RPTKs) regulate key signal transduction cascades that control cell growth and proliferation. Stem Cell Factor Receptor (SCF) c-kit is a type III transmembrane RPTK that contains five extracellular immunoglobulin (IG) domains, a single transmembrane domain, and a cleaved cytoplasmic kinase domain separated by an insert segment of a kinase. C-kit plays an important role in the development of melanocytes, mast cells, germ cells and hematopoiesis.

[0003] Stem cell growth factor (SCF) is a protein encoded by the S1 locus and is also called kit ligand (KL) and Mast Cell Growth Factor (MGF) based on biological properties used to identify it (reviewed in Tsujimura, Pathol Int 1996, 46: 933-938; Loveland, et al., J. Endocrinol 1997,153: 337-344; Vliagoftis, et al., Clin Immunol 1997, 100: 435-440; Broudy, Blood 1997, 90: 1345-1364; Pignon, Hermatol Cell Ther 1997, 39: 114-116; and Lyman, et al., Blood 1998, 91: 1101-1134.). Here, the inventors use the abbreviation SCF to refer to a ligand for C-kit RTK (Receptor Tyrosine Kinase).

[0004] Stem cell growth factor is synthesized as a transmembrane protein with a molecular weight of 220 or 248 daltons depending on alternative splicing of the mRNA encoding exon 6. A larger protein can be proteolytically cleaved to produce a soluble, glycosylated protein that undergoes non-covalent dimerization. Both soluble and membrane bound forms of SCF can bind to and activate C-kit. For example, in the skin, SCF is predominantly expressed by fibroblasts, keratinocytes, and endothelial cells that modulate the activity of melanocytes and mast cells expressing C-kit. In bone, marrow stromal cells express SCF and regulate hematopoiesis of C-kit expressing stem cells. In the gastrointestinal tract, intestinal epithelial cells express SCF and influence Cajal's interstitial cells and endothelial lymphocytes. In the nucleus, Sertoli cells and granulosa cells express SCF which regulates spermatogenesis by interacting with C-kit on germ cells.

[0005] Abnormal expression and / or activation of C-kit and / or mutant form (s) of C-kit has been associated with a variety of pathological conditions (Roskoski, 2005, Biochemical and Biophysical Research Comm. 338: 1307-1315). For example, evidence of C-kit involvement in neoplastic pathology includes its association with leukemias and mast cell tumors, small cell lung cancer, testicular cancer, and some cancers of the gastrointestinal tract and central nervous system. In addition, C-kit has been associated with a role in the carcinogenesis of sarcomas of neuroectodermal female origin.

PZ / 5321 / AG

And Schwann cell tumor formation associated with neurofibromatosis. Mast cells have been found to be involved in modifying the tumor microenvironment and enhancing tumor growth (Yang et al., J Clin Invest. 2003, 112: 1851-1861; Viskochil, J Clin Invest. 2003, 112: 17911793). Accordingly, there is a need in the art for compounds and compounds for use in their methods for modulating receptor protein kinases. The present disclosure meets these and other needs.

SUMMARY OF THE INVENTION

[0006] In one aspect, a compound of formula (I ') is described herein:

<img file="PL2935248T3_D0001.tif" />

or a pharmaceutically acceptable salt, solvate, tautomer, isomer or deuterated analog thereof, wherein: (i) R¹ and r² together they form an optionally substituted 5- or 6-membered fused ring having from 0 to 3 heteroatoms as ring members selected from N, O or S in which one or two ring carbon atoms are optionally replaced by a -C group (= O) -; or (ii) R¹ R represents H, halogen, C 1-4 alkyl, C 1-4 haloalkyl C 1-4 haloalkoxy, cyclopropyl or only a pair of electrons and R² is -NH-L²-R⁶where R.⁶ is H, optionally substituted aryl, optionally substituted aryl-C_1-4alkyl, optionally substituted heteroaryl, optionally substituted heteroaryl-C_1-4alkyl, optionally substituted heterocycloalkyl, optionally substituted C._1-6alkyl, optionally substituted cycloalkyl, optionally substituted cycloalkyl-C₁₄alkyl, optionally substituted heterocyclyl, or optionally substituted heterocyclyl-C_1-4alkyl; i, in which L.² is selected from a bond, -C (O) -, -C (O) N (R^f) -, -SO2N (R^f) -, -SO2-, -C (O) O-, C (= NR^f) N (R^f) - where each R.^f is independently H or C 1-4 alkyl;

G is optionally substituted C._1-6alkyl, optionally substituted aryl, or optionally substituted 5- or 6-membered heteroaryl having one or more nitrogen atoms as ring members, wherein the aryl or heteroaryl is optionally fused to an optionally substituted 5- to 8-membered ring having 0 to 2 heteroatoms as ring members selected from O, N or S;

L.¹ is selected from -CH (OH) -, -C (O) NR⁵-, -NR⁵C (O) -, -CH2N (R⁵) -, -SO2N (R⁵) -, -N (R⁵) C (O) N (R⁵) -, N (R⁵) SO2-, -N (R⁵) CH2-, -OC_1-4alkylene-, -C_1-4alkylene-O-, -C (O) -, -NR⁵C (O) -, -SO₂-, -SON (R⁵) -, N (R⁵) SO2N (R⁵) - or -S (O) -, where each R.⁵ is independently H or C 1-4 alkyl;

Y¹ is N or C;

Y² is N or optionally substituted = C-; and

Y³ is N or CH; with the restriction that Y¹, Y² and Y³ do not simultaneously represent the N atom.

[0007] In accordance with another aspect, the present disclosure provides a composition. The composition comprises a compound of formula (IVa-2) as described herein, or a compound as mentioned in any one of the claims

PZ / 5321 / AG

And a pharmaceutically acceptable salt, solvate, tautomer or isomers thereof and a pharmaceutically acceptable excipient or carrier thereof. The disclosure also provides a composition which comprises a compound as recited in the claims and described herein, a pharmaceutically acceptable excipient or carrier, and another therapeutic agent.

[0008] According to another aspect, described herein is a method for preparing a compound of formula (IV), (V '), and any of its subsets.

[0009] In another aspect, the disclosure provides a compound for use in a method of modulating a protein kinase. A compound for use in a method comprises administering to a patient in need of a compound of formula (IVa-2) as described herein, or a compound as recited in any one of the claims and described herein, or a pharmaceutically acceptable salt, solvate, tautomer or isomers or composition thereof. pharmaceutical as described herein. In some embodiments, the protein kinase is a C-kit protein kinase or a C-kit protein kinase mutant.

[0010] In yet another aspect, the disclosure provides a compound for use in a method of treating a patient suffering from, or at risk of, a protein kinase mediated disease or condition. A compound for use in a method comprises administering to a patient an effective amount of a compound of formula (IVa-2) or a compound as recited in any one of the claims and described herein, or a pharmaceutically acceptable salt, solvate, tautomer, or isomer thereof, or a composition comprising a compound of formula described herein. formula (IVa-2) or a compound as recited in or described herein, or a pharmaceutically acceptable salt, solvate, tautomer, or isomer thereof.

DETAILED DESCRIPTION

I. Definitions

[0011] As used herein, the following definitions apply unless expressly indicated otherwise:

[0012] It should be noted here that as used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural references thereof, unless the context clearly dictates otherwise.

[0013] The term "halogen" or "halo" refers to all halogens, ie chlorine (Cl), fluorine (F), bromine (Br) or iodine (I).

[0014] The term "hydroxy" or "hydroxy" refers to the group -OH.

[0015] The term "thiol" refers to the group -SH.

[0016] The term "heteroatom" is intended to include an oxygen atom (O), a nitrogen atom (N) and a sulfur atom (S).

[0017] The term "alkyl" by itself or as part of another substituent, means, unless otherwise stated, a straight chain or branched hydrocarbon having the number of carbon atoms indicated (i.e., C 1-6 carbon atoms). Representative alkyl groups include straight and branched chain alkyl groups having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 carbon atoms. Further, representative alkyl groups include straight chain and branched alkyl groups having 1, 2, 3, 4, 5, 6, 7, or 8 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, but-2-enyl (e.g. -CH2CH = CHCH3), cis2-butene-1- yl, n-pentyl, n-hexyl, n-heptyl, n-octyl etc. For each of the definitions set forth herein

PZ / 5321 / AG

(E.g., alkyl, alkoxy, alkylamino, alkylthio, alkylene, haloalkyl arylalkyl, cycloalkylalkyl, heterocycloalkylalkyl, heteroarylalkyl) when the alkyl portion does not contain a prefix indicating the number of carbon atoms, the alkyl group or portion thereof will have 12 atoms or less backbone carbon or 8 or less backbone carbon atoms or 6 or less backbone carbon atoms. For example, C1-6 alkyl refers to a straight or branched hydrocarbon having 1,2, 3, 4, 5, or 6 carbon atoms and includes, but is not limited to, C_1-2 alkyl, C._1-4alkyl, C._2-6alkyl, C._2-4alkyl, C.₁6alkyl, C2-8alkyl, C1-6 alkyl, C2- yalkyl, and C3-6alkyl. The term "fluoro-substituted alkyl" denotes an alkyl group substituted with one or more fluoro atoms such as perfluoroalkyl, preferably the lower alkyl is substituted with 1,2, 3, 4 or 5 fluoro atoms, also 1,2 or 3 fluoro atoms . While it is understood that the substituents attached at any available atom are attached to form a stable compound, when the optionally substituted alkyl is the R group of a group such as -OR (e.g. alkoxy), -SR (e.g. thioalkyl), -NH (e.g. alkylamino), -C (O) NHR etc., the substitution of the R alkyl group is such that the substitution of the alkyl carbon atom attached to any O, S or N atom of the group (except where N is an atom in a heteroaryl ring) excludes substituents which could cause any O, S, or N atom of the substituent (except where N is an atom in a heteroaryl ring) to be bonded to an alkyl carbon atom bonded to any O, S or N atom of the group. The term "deuterated C."_1-6"alkyl" is intended to include partially deuterated or perdeuterated C groups_1-6 alkyl. Non-limiting examples include -CD3, CD3CH2-, CD3CD2-, -CD (CD3) 2, -CD (CH3) 2 etc.

[0018] The term "alkylene" by itself or as part of another substituent means a linear or branched saturated alkane-derived divalent hydrocarbon group having the number of carbon atoms as indicated in the prefix. For example, (ie, C1-6 is one to six carbon atoms; C1-6 alkylene is intended to include methylene, ethylene, propylene, 2-methylpropylene, pentylene, hexylene, etc.). C1₄ alkylene includes methylene -CH₂-, ethylene -CH₂CH₂-, propylene -CH₂CH₂CH₂- and isopropylene CH (CH₃) CH₂-, -CH₂CH (CH₃) -, -CH₂- (CH₂)₂CH₂-, -CH₂-CH (CH₃) CH₂-, -CH₂-C (CH₃)₂-, -CH₂CH2CH (CH3) -. Typically, the alkyl (or alkylene) will have from 1 to 24 carbon atoms, with those groups having 10 or less, 8 or less or 6 or less carbon atoms being preferred in the present disclosure. Where there is no carbon prefix on the alkylene portion, the alkylene group or portion thereof will have 12 or fewer backbone carbon atoms or 8 or fewer backbone carbon atoms, 6 or fewer backbone carbon atoms, or 4 or fewer backbone carbon in the main chain.

[0019] The term "alkenyl" refers to a linear monovalent hydrocarbon radical or branched monovalent hydrocarbon radical having the number of carbon atoms indicated in the prefix and containing at least one double bond. For example, (C.₂C6) alkenyl is intended to include ethenyl, propenyl, -CH = C (H) (CH3), - CH = C (CH3) 2, -C (CH3) = C (H) 2, C (CH₃) = C (H) (CH₃), -C (CH₂CH₃) = CH₂, butadienyl e.g. 2- (butadienyl), pentadienyl e.g. 2,4-pentadienyl and 3- (1,4-pentadienyl) and hexadienyl and the like, among others and their larger homologues and stereoisomers. Similarly, the term "alkynyl" refers to a linear monovalent hydrocarbon radical or branched monovalent hydrocarbon radical containing at least one

PZ / 5321 / AG

A triple bond and having the number of carbon atoms indicated in the prefix. Examples include, but are not limited to, ethynyl e.g. -CC (H), 1-propynyl e.g. -C = C (CH₃), -C = C (CH₂CH₃), -C (H₂) CC (H), C (H)₂C = C (CH3) and -C (H) 2C = C (CH2CH3), among others, and their larger homologues and isomers. When no prefix indicating the number of carbon atoms is included in the alkenyl or alkynyl portion, the alkenyl or alkynyl group or portion thereof will have 12 or fewer backbone carbon atoms or 8 or fewer backbone carbon atoms or 6 or fewer backbone carbon atoms or 4 or fewer carbon atoms in the main chain.

[0020] The term "alkenylene" refers to a linear divalent hydrocarbon group or branched divalent hydrocarbon group having the number of carbon atoms indicated in the prefix and containing at least one double bond. For example, i.e., C._2-6 is two to six carbon atoms; C2-6 alkenylene is intended to include, but is not limited to, -CH = CH-, -CH2-CH = CH-, -CH2-CH = C (CH3) -, -CH = CH-CH = CH- etc.). Similarly, the term "alkynylene" refers to a linear divalent hydrocarbon group or branched divalent hydrocarbon group containing at least one triple bond and having the number of carbon atoms indicated in the prefix. For example, (i.e., C._2-6 is two to six carbon atoms; C._2-6alkynylene is intended to include, but is not limited to, -C = C-, -C = CCH2-, -CH2-C = CCH2-, -C = CCH (CH3) - etc. When a prefix indicating the number of carbon atoms is not included in the alkenylene or alkynylene portion , the alkenylene group or a portion thereof will have 12 or less backbone carbon atoms or 8 or less backbone carbon atoms or 6 or fewer backbone carbon atoms or 4 or fewer backbone carbon atoms.

[0021] The term "cycloalkyl" or "carbocycle" by itself or as part of another substituent refers to saturated or unsaturated, non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems having the number of carbon atoms indicated in the prefix or, if not specified, containing 3-10, also 3-8, more preferably 3-6, ring members per ring such as cyclopropyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, adamantyl and the like, wherein one or two ring carbon atoms may optionally be replaced by a carbonyl. Cycloalkyl refers to hydrocarbon rings having the indicated number of ring atoms (e.g., C._3-8cycloalkyl is three to eight carbon ring atoms). The term "cycloalkyl" or "carbocycle" refers to a mono- bicyclic or polycyclic group such as, for example, bicyclo [2.2.1] heptane, bicyclo [2.2.2] octane etc. When used in combination with cycloalkyl substituents, the term "polycyclic" "Refers herein to fused and non-fused alkylcyclic structures. "Cycloalkyl" or "carbocycle" can form a bridged ring or a spiro ring. A cycloalkyl group can have one or more double or triple bonds.

[0022] The term "cycloalkylene" by itself or as part of another substituent refers to a divalent cycloalkyl wherein cycloalkyl as defined above has 3-10, also 3-8, more preferably 3-6, ring members per ring. An exemplary cycloalkylene includes, for example, 1,2-, 1,3-, or 1,4-cis or transcyclohexylene, 2-methyl-1,4-cyclohexylene, 2,2-dimethyl-1,4-cyclohexylene and the like.

[0023] The term "cycloalkylalkyl" refers to a - (alkylene) cycloalkyl group in which an alkylene as defined herein has the indicated number of carbon atoms or, if not specified, has six or fewer, preferably four or fewer carbon atoms in the main chain; and cycloalkyl is defined herein

PZ / 5321 / AG

The meaning and number of carbon atoms indicated, or if not specified, comprises 3-10, also 3-8, more preferably 3-6, ring members per ring. C 3-8 cycloalkyl-C 1-2 alkyl is understood to have 3 to carbon ring atoms and 1 to 2 carbon atoms in the alkylene chain. An exemplary cycloalkylalkyl includes, e.g., cyclopropylmethylene, cyclobutylethylene, cyclobutylmethylene and the like.

[0024] The term "cycloalkylalkenyl" refers to a - (alkenylene) cycloalkyl group in which alkenylene as defined herein has the number of carbon atoms indicated or, if not specified, has six or fewer, preferably four or fewer carbon atoms in the main chain; and cycloalkyl is as defined herein and the number of carbon atoms indicated or, if not specified, contains 3-10, also 3-8, more preferably 3-6, ring members per ring. It is understood that C._3-8cycloalkyl-C_2-4alkenyl contains 3 to 8 ring carbon atoms and 2 to 4 carbon atoms in the alkenylene chain. An exemplary cycloalkylalkenyl includes, e.g., 2-cyclopropylvinyl, 2-cyclopentylvinyl, etc.

[0025] The term "cycloalkylalkynyl" refers to a - (alkynylene) cycloalkyl group in which an alkynylene as defined herein has the number of carbon atoms indicated or, if not specified, has six or fewer, preferably four or fewer carbon atoms in the main chain; and cycloalkyl is as defined herein having the number of carbon atoms indicated or, if not specified, 3-10, also 3-8, more preferably 3-6, ring members per ring. It is understood that C._3-8cycloalkyl-C_2-4alkynyl has 3 to 8 ring carbon atoms and 2 to 4 carbon atoms in the alkynylene chain. An exemplary cycloalkylalkynyl includes, e.g., 2-cyclopropylethynyl, 2-cyclobutylethynyl, 2-cyclopentylethynyl and the like.

[0026] The term "cycloalkenyl" by itself or as part of another substituent refers to a non-aromatic monocyclic, bicyclic or tricyclic carbon ring system having the number of carbon atoms indicated in the prefix or, if not specified, 3-10, also 3-8, more preferably 3- 6, ring members to a ring that contains at least one carbon-carbon double bond. An exemplary cycloalkenyl includes, e.g. 1-cyclohexenyl, 4-cyclohexenyl, 1-cyclopentenyl, 2-cyclopentenyl etc.

[0027] The term "cycloalkenylene" by itself or as part of another substituent refers to a divalent cycloalkenyl wherein cycloalkenyl as defined herein contains 3-10, also 3-8, more preferably 3-6, ring members per ring. An exemplary cycloalkenylene includes, e.g., cyclohexene-1,4-diyl, 2-methylcyclohexene-1,4-diyl, 3-methylcyclohexene-1,4-diyl, 3,3-dimethylcyclohexene-1,4-diyl, cyclohexene-1,2- diyl, cyclohexene-1,3-diyl etc.

[0028] The term "haloalkyl" is intended to include alkyl substituted with one to seven halogen atoms. Haloalkyl includes monohaloalkyl and polyhaloalkyl. For example, the term "C1-6 haloalkyl" is intended to include trifluoromethyl, difluoromethyl, fluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl and the like.

[0029] The term "haloalkoxy" refers to the group -O-haloalkyl in which haloalkyl is as defined herein, eg, trifluoromethoxy, 2.2.2-trifluoroethoxy, difluoromethoxy and the like.

[0030] The term "alkoxy" refers to the group -O-alkyl, wherein alkyl is as defined herein. The term "cycloalkoxy" refers to the group -O-cycloalkyl wherein cycloalkyl is as defined herein. The term "fluoro-substituted alkoxy" denotes alkoxy where alkyl is substituted with one or more fluoro atoms, preferably alkoxy is substituted with 1, 2, 3, 4 or 5 fluoro, also 1, 2 or 3 fluoro. While it is understood that the substituents

PZ / 5321 / AG

The alkoxy groups are attached at any available atom to form a stable compound, the substitution of the alkoxy group is such that the O, S or N atoms (except where N is a heteroaryl ring atom) are not bonded with an alkyl carbon bonded to the O atom of the alkoxy group. Then, when an alkoxy is described as a substituent of another group, the oxygen of the alkoxy group is not bonded to the carbon atom which is bonded to the O, S or N atom of the other group (except where N is a heteroaryl ring atom) or with the carbon of the alkene or alkyne of the second group.

[0031] The term "amino" or "amine" denotes the group -NH2.

[0032] The term "alkylamino" refers to the group -NH-alkyl wherein alkyl is as defined herein. Exemplary alkylamino groups include CH3NH-, ethylamino and the like.

[0033] The term "dialkylamino" refers to the group -N (alkyl) (alkyl), wherein each alkyl is independently as defined herein. Exemplary dialkylamino groups include dimethylamino, diethylamino, ethylmethylamino and the like.

[0034] The term "cycloalkylamino" denotes the group -NR^ddR^eein which R.^dd and r^ee combine with a nitrogen atom to form a 5-7 membered heterocycloalkyl ring, wherein the heterocycloalkyl may contain an additional ring heteroatom such as an O, N, or S atom and may also be further substituted with alkyl. Alternatively, the term "cycloalkylamino" refers to a -NH-cycloalkyl group wherein cycloalkyl is as defined herein.

[0035] The term "alkylthio" refers to -S-alkyl wherein alkyl is as defined herein. Exemplary alkylthio groups include CH₃S-, ethylthio, etc.

[0036] The term "aryl" by itself or as part of another substituent refers to a monocyclic, bicyclic or polycyclic polyunsaturated aromatic hydrocarbon radical containing 6 to 14 carbon ring atoms, which may be a single ring or multiple rings (up to three rings) which are fused together or linked covalently. Non-limiting examples of unsubstituted aryl groups include phenyl, 1-naphthyl, 2-naphthyl, and 4-biphenyl. Exemplary aryl groups such as phenyl or naphthyl may optionally be fused to a cycloalkyl having preferably 5-7, more preferably 5-6, ring members.

[0037] The term "arylene" by itself or as part of another substituent refers to a divalent aryl wherein aryl is as defined herein. An exemplary arylene includes, e.g., phenylene, biphenylene, etc.

[0038] The term "aralkyl" refers to - (alkylene) aryl wherein the alkylene group is as defined herein having the indicated number of carbon atoms or, if not specified, has six or fewer backbone carbon atoms or four or fewer carbon atoms in the main chain. main chain; and aryl is as defined herein. Examples of aralkyl include benzyl, phenethyl, 1-methylbenzyl etc.

[0039] The term "aralkoxy" refers to -O- (alkylene) aryl wherein the alkylene group is as defined herein having the indicated number of carbon atoms or, if not specified, has six or fewer backbone carbon atoms or four or fewer backbone atoms. backbone carbon; and aryl is as defined herein. Examples of aralkoxy include benzyloxy, phenethyloxy and the like.

[0040] The term "aryloxy" refers to -O-aryl, wherein the aryl group is as defined herein. An exemplary aryloxy group includes, for example, phenoxy.

PZ / 5321 / AG

EP 2 935 248 B1

[0041] The term "arylthio" refers to -S-aryl wherein the aryl group is as defined herein.

An exemplary arylthio group includes, e.g., phenylthio.

[0042] The term "heteroaryl" by itself or as part of another substituent refers to a monocyclic aromatic ring radical of 5 or 6 ring atoms or a bicyclic aromatic radical of 8 to 10 atoms containing one or more, preferably 1-4, more preferably 1-4. 3, even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S and N. Heteroaryl is also intended to include oxidized S or N atoms such as sulfinyl, sulfonyl and the N-oxide of a tertiary ring nitrogen. The carbon or nitrogen atom is the point of attachment of the heteroaryl ring structure so as to obtain a stable compound. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrazinyl, indolizinyl, benzo [b] thienyl, quinazolinyl, purinyl, indolyl, quinolinyl, pyrimidinyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, thienyl, isoxazolyl, oxidetazoliazolyl, isoxidetiadiazolyl triazolyl, furanyl, benzofuryl, indolyl, triazinyl, quinoxalinyl, cinnolinyl, phthalazinyl, benzotriazinyl, benzimidazolyl, benzopyrazolyl, benzotriazolyl, benzisoxazolyl, isobenzofuryl, isoindolyl, indolizinyl, benzotriazinyl, thienopyridinyl, thienopyrimidinyl, pyrazolopyrimidinyl, imidazopyridines, benzothiaxolyl, benzothienyl, quinolyl, isoquinolyl, indazolyl, pteridinyl and thiadiazolyl. The term "nitrogen-containing heteroaryl" refers to a heteroaryl in which any of the heteroatoms is N. It is understood that the term "heterocyclic aromatic ring" as used herein denotes a heteroaryl ring.

[0043] The term "heteroarylene" by itself or as part of another substituent refers to a divalent heteroaryl wherein heteroaryl is as defined herein. Exemplary heteroarylene includes, e.g., pyridine-2,5-diyl, pyrimidine-2,5-diyl, pyridazine-3,5-diyl, pyrazine-2,5-diyl, and the like.

[0044] The term "heteroarylalkyl" refers to - (alkylene) heteroaryl, wherein the alkylene group is as defined herein and has the indicated number of carbon atoms or, if not specified, contains six or fewer backbone carbon atoms or four or fewer carbon atoms in the main chain. main chain; and heteroaryl is as defined herein. Non-limiting examples of heteroarylalkyl include 2-pyridylmethyl, 4-pyridylmethyl, 2-thiazolylethyl and the like.

[0045] The term "heterocyclyl", "heterocycle" or "heterocyclic" refers to a saturated or unsaturated non-aromatic mono- or bicyclic radical containing at least one heteroatom independently selected from oxygen (O), nitrogen (N) or sulfur (S). Each heterocycle may be attached at any available ring carbon or heteroatom. Each heterocycle can have one or more rings. When multiple rings are present, they may be fused together or linked covalently. Each heterocycle typically contains 1, 2, 3, 4 or 5, independently selected heteroatoms. Preferably, these groups contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms, 0, 1, 2, 3, 4 or 5 nitrogen atoms, 0, 1 or 2 sulfur atoms and 0 , 1 or 2 oxygen atoms. More preferably, these groups contain 1, 2 or 3 nitrogen atoms, 0-1 sulfur atoms and 0-1 oxygen atoms. Non-limiting examples of heterocyclyl groups include morpholin-3-one, piperazin-2-one, piperazine-1-oxide, pyridin-2-one, piperidine, morpholine, piperazinyl, isoxazoline, pyrazoline, imidazoline, pyrazol-5-one, pyrrolidine-2, 5-dione, imidazolidine-2,4-dione, pyrrolidine, tetrahydroquinolinyl, decahydroquinolinyl, tetrahydrobenzoxazepinyl, dihydrodibenzoxepine etc.

[0046] The term "heterocyclylene" by itself or as part of another substituent refers to a divalent heterocyclyl wherein heterocyclyl is as defined herein. An exemplary heterocyclylene includes, e.g., piperazine-1,4-diyl, piperidine-1,4-diyl, 1,2,3,6-tetrahydropyridine-1,4-diyl, 3PZ / 5321 / AG

Azabicyclo [3.2.1] octane-3,8-diyl, 3,8-diazabicyclo [3.2.1] octane-3,8-diyl, 8-azabicyclo [3.2.1] octane-3.8-diyl , 2-azabicyclo [2.2.2] octane-2,5-diyl, 2,5-diazabicyclo [2.2.2] octane-2,5-diyl, 2,3,6,7-tetrahydro-1Hazepine-1,4 -diyl, 2,3,6,7-tetrahydro-1H-azepine-1,5-diyl, 2,5-dihydro-1H-pyrrole-1,3-diyl etc.

[0047] The term "heterocyclylalkyl" refers to - (alkylene) heterocyclyl, wherein the alkylene group is as defined herein and has the indicated number of carbon atoms or, if not specified, contains six or fewer carbon backbone or four or fewer carbon atoms in the main chain. main chain; and heterocyclyl is as defined herein. An exemplary heterocyclylalkyl includes, e.g., pyrrolidin-1-ylmethyl, 2-piperidinylmethyl, etc.

[0048] The term "heterocycloalkyl" refers to a saturated or unsaturated non-aromatic cycloalkyl group that contains from one to five heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atoms are optionally quaternized. and the remaining ring atoms are C, wherein one or two C atoms may optionally be replaced by a carbonyl. Heterocycloalkyl may be a monocyclic, bicyclic or polycyclic ring system containing from 3 to 12, preferably from 4 to 10 ring atoms, more preferably from 5 to 8 ring atoms in which one to five ring atoms are heteroatoms selected from -N =, -N-, -O-, -S-, -S (O) - or -S (O) 2- followed by, in which one or two atoms in the ring are optionally replaced by a -C (O) - group . The heterocycloalkyl can also be an alkyl heterocyclic ring fused to a cycloalkyl, aryl or heteroaryl ring. Non-limiting examples of heterocycloalkyl groups include pyrrolidinyl, piperidinyl, imidazolidinyl, pyrazolidinyl, butyrolactam group, valerolactam group, imidazolidinone group, hydantoin, dioxolane group, phthalimide group, piperidine, 1,4-dioxo, morpholinylmorpholinyl, thiomorpholinyl thiomorpholinyl -S, S-oxide, piperazinyl, pyranyl, pyridine group, 3-pyrrolinyl, thiopyranyl, pyrone, tetrahydrofuranyl, tetrahydrothiophenyl, quinuclidinyl etc. The heterocycloalkyl group can be attached to the remainder of the molecule through a ring carbon or heteroatom. The term "heterocycloalkylene" as used herein by itself or as part of another substituent refers to a divalent heterocycloalkyl wherein heterocycloalkyl is as defined herein. Non-limiting examples of heterocycloalkylene include piperidine-1,4-diyl, 1,2,3,6-tetrahydropyridine-1,4-diyl, 1,2,3,6-tetrahydropyridine-1,5-diyl, 2,3,6,7- tetrahydro-1H-azepine-1,4-diyl, 2,3,6,7-tetrahydro-1H-azepine-1,5-diyl, 2,5-dihydro-1H-pyrrole-1,3-diyl etc.

[0049] The term "heterocycloalkylalkyl" refers to - (alkylene) heterocycloalkyl, wherein the alkylene group is as defined herein and has the number of carbon atoms indicated or, if not specified, contains six or fewer carbon backbone or four or fewer carbon atoms in the main chain. main chain; and heterocycloalkyl is as defined herein. Non-limiting examples of heterocycloalkylalkyl include 2-pyridylmethyl, 2-thiazolylethyl and the like.

Substituents for alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heterocycloalkylalkyl, heterocyclyl, alkylene, alkenylene or alkynylene include, but are not limited to, R ', halogen, -OH, -NH₂, -NO₂, -CN, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR ', -SR', -OC (O) R ', -OC (S) R', C (O) R ', -C (S) R', -C (O) OR ', -C (S) OR ', -S (O) R', -S (O)₂R ', -C (O) NHR', -C (S) NHR ', -C (O) NR'R ", -C (S) NR'R", -S (O)₂NHR ', -S (O)₂NR'R ", -C (NH) NHR ', -C (NH) NR'R", -NHC (O) R', -NHC (S) R ', -NR "C (O) R',

PZ / 5321 / AG

EP 2 935 248 B1

NR'C (S) R ", -NHS (O)₂R ', -NR'S (O)₂R ", -NHC (O) NHR ', -NHC (S) NHR', -NR'C (O) NH₂, -NR'C (S) NH₂, NR'C (O) NHR ", -NR'C (S) NHR", -NHC (O) NR'R ", -NHC (S) NR'R", -NR'C (O) NR "R '", -NR"' C (S) NR'R ", NHS (O)₂NHR ', -NR'S (O)₂NH₂, -NR'S (O)₂NHR ", -NHS (O)₂NR'R ", -NR'S (O)₂NR "R" ", -NHR 'and -NR'R" from zero to (2m' + 1), where m 'is the total number of carbon atoms in such group. Each of R ', R ", and R" "independently refers to a group such as hydrogen, C1-4alkyl, heterocycloalkyl, aryl, heteroaryl, arylalkyl, heteroarylalkyl, aryl substituted with 1-3 halo, C1-4 alkoxy, haloalkyl, haloalkoxy or C 1-6 alkoxy groups or unsubstituted aryl C 1-6 alkyl groups. When R 'and R "are attached to the same nitrogen atom, they can be linked to the nitrogen atom to form a 3-, 4-, 5-, 6- or 7-membered ring. For example, -NR'R "is intended to include 1-pyrrolidinyl and 4-morpholinyl. R ', R "and R" "may then be substituted by R^a1, halogen, -OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2 , NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -OR^a1, -SR^a1, -OC (O) R^a1, -OC (S) R^a1, C (O) R^a1, -C (S) R^a1, -C (O) OR^a1, -C (S) OR^a1, -S (O) R^a1, -S (O) 2R^a1, -C (O) NHR^a1, -C (S) NHR^a1, C (O) NO^a1R^a2, -C (S) NO^a1R^a2, -S (O) 2NHR^a1, -S (O) 2NR^a1R^a2, -C (NH) NHR^a1, -C (NH) NR^a1R^a2, NHC (O) R^a1, -NHC (S) R^a1, -NR^a2C (O) R^a1, -NR^a1C (S) R^a2, -NHS (O) 2R^a1, -NR^a1S (O) 2R^a2, NHC (O) NHR^a1, -NHC (S) NHR^a1, -NR^a1C (O) NH2, -NR^a1C (S) NH2, -NR^a1C (O) NHR^a2, -NR^a1C (S) NHR^a2, NHC (O) NR^a1R^a2, -NHC (S) NR^a1R^a2, -NR^a1C (O) NO^a2R^a3, -NR^a3C (S) NO^a1R^a2, -NHS (O) 2NHR^a1, NO^a1S (O) 2NH₂, -NR^a1S (O) 2NHR^a2, -NHS (O) 2NR^a1R^a2, -NR^a1S (O) 2NR^a2R^a3, -NHR^a1 and -NR^a1R^a2 a number ranging from zero to (2n '+ 1), where n' is the total number of carbon atoms in that group. Each of R^a1, R^a2 and r^a3 independently refers to a group such as hydrogen, C 1-8 alkyl, heterocycloalkyl, aryl, heteroaryl, arylalkyl, heteroarylalkyl, aryl substituted with 1-3 halo, C 1-8 alkoxy, haloalkyl, haloalkoxy or C groups_1-8thioalkoxy or unsubstituted arylC1-4 alkyl groups. R^a1, R^a2 and r^a3 can be then, substituted with R.^b1, halogen, -OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2 , -NHC (O) NH2, -NHC (S) NH2, NHS (O) 2NH2, -C (NH) NH2, -OR^b1, -SR^b1, -OC (O) R^b1, -OC (S) R^b1, -C (O) R^b1, -C (S) R^b1, -C (O) OR^b1, C (S) OR^b1, -S (O) R^b1, -S (O) 2R^b1, -C (O) NHR^b1, -C (S) NHR^b1, -C (O) NO^b1R^b2, -C (S) NO^b1R^b2, S (O) 2NHR^b1, -S (O) 2NR^b1R^b2, -C (NH) NHR^b1, -C (NH) NR^b1R^b2, -NHC (O) R^b1, -NHC (S) R^b1, NO^b2C (O) R^b1, -NR^b1C (S) R^b2, -NHS (O) 2R^b1, -NR^b1S (O) 2R^b2, -NHC (O) NHR^b1, -NHC (S) NHR^b1, NO^b1C (O) NH2, -NR^b1C (S) NH2, -NR^b1C (O) NHR^b2, -NR^b1C (S) NHR^b2, -NHC (O) NR^b1R^b2, NHC (S) NR^b1R^b2, -NR^b1C (O) NO^b2R^b3, -NR^b3C (S) NO^b1R^b2, -NHS (O) 2NHR^b1, -NR^b1S (O) 2NH₂, NO^b1S (O) 2NHR^b2, -NHS (O) 2NR^b1R^b2, -NR^b1S (O) 2NR^b2R^b3, -NHR^b1 and -NR^b1R^b2 a number ranging from zero to (2p '+ 1), where p' is the total number of carbon atoms in that group. R^b1, R^b2 and r^b3 each independently refers to a group such as hydrogen, C1-8alkyl, heterocycloalkyl, aryl, heteroaryl, arylalkyl, heteroarylalkyl, aryl substituted with 1-3 halogen atoms, C_1-8 alkoxy, haloalkyl, haloalkoxy, or C_1-8thioalkoxy or unsubstituted aryl-C_1-4alkyl.

PZ / 5321 / AG

EP 2 935 248 B1

[0051] The substituents for the aryl and heteroaryl groups are diverse and are generally selected from: R ', halogen, -OH, -NH₂, -NO₂, -CN, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR ', -SR', -OC (O) R ', -OC (S) R', C (O) R ', -C (S) R', -C (O) OR ', -C (S) OR ', -S (O) R', -S (O)₂R ', -C (O) NHR', -C (S) NHR ', -C (O) NR'R ", C (S) NR'R", -S (O)₂NHR ', -S (O)₂NR'R ", -C (NH) NHR ', -C (NH) NR'R", -NHC (O) R', -NHC (S) R ', -NR "C (O) R', - NR'C (S) R ", -NHS (O)₂R ', -NR'S (O)₂R ", -NHC (O) NHR ', -NHC (S) NHR', -NR'C (O) NH₂, -NR'C (S) NH₂, NR'C (O) NHR ", -NR'C (S) NHR", -NHC (O) NR'R ", -NHC (S) NR'R", -NR'C (O) NR "R '", -NR"' C (S) NR'R ", NHS (O)₂NHR ', -NR'S (O)₂NH₂, -NR'S (O)₂NHR ", -NHS (O)₂NR'R ", -NR'S (O)₂NR "R" ", -NHR ', -NR'R", N3, perfluoro (C1-C4) alkoxy and perfluoro (C1-C4) alkyl, ranging from zero to the total number of free valences in the aromatic ring system; and wherein R ', R "and R" "are independently selected from hydrogen, haloalkyl, haloalkoxy, C 1-6 alkyl, C 3-6 cycloalkyl, cycloalkylalkyl, C 1-6_2-8alkenyl, C._2-8alkynyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, aryl-C_1-4alkyl and aryloxy C1-4alkyl. Other suitable substituents include any of the above aryl group substituents attached to a ring atom through an alkylene group having 1 to 4 carbon atoms. R ', R "and R" "may then be substituted for E by R^a1, halogen, -OH, -NH2, NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2, NHS (O) 2NH2, -C (NH) NH2, -OR^a1, -SR^a1, -OC (O) R^a1, -OC (S) R^a1, -C (O) R^a1, -C (S) R^a1, -C (O) OR^a1, C (S) OR^a1, -S (O) R^a1, -S (O) 2R^a1, -C (O) NHR^a1, -C (S) NHR^a1, -C (O) NO^a1R^a2, -C (S) NO^a1R^a2, S (O) 2NHR^a1, -S (O) 2NR^a1R^a2, -C (NH) NHR^a1, -C (NH) NR^a1R^a2, -NHC (O) R^a1, -NHC (S) R^a1, NO^a2C (O) R^a1, -NR^a1C (S) R^a2, -NHS (O) 2R^a1, -NR^a1S (O) 2R^a2, -NHC (O) NHR^a1, -NHC (S) NHR^a1, NO^a1C (O) NH2, -NR^a1C (S) NH2, -NR^a1C (O) NHR^a2, -NR^a1C (S) NHR^a2, -NHC (O) NR^a1R^a2, NHC (S) NR^a1R^a2, -NR^a1C (O) NO^a2R^a3, -NR^a3C (S) NO^a1R^a2, -NHS (O) 2NHR^a1, -NR^a1S (O) 2NH₂, NO^a1S (O) 2NHR^a2, -NHS (O) 2NR^a1R^a2, -NR^a1S (O) 2NR^a2R^a3, -NHR^a1, -NR^a1R^a2, -N3, perfluoro (Cr C₄) alkoxy and perfluoro (C.₁-C₄) alkyl, a number ranging from zero to the total number of free valences in the aromatic ring system; and in which R.^a1, R^a2 and r^a3 are independently selected from the group consisting of hydrogen, haloalkyl, haloalkoxy, C 1-8 alkyl, C 3-8 cycloalkyl, cycloalkylalkyl, C 1-8_2-8 alkenyl, C._2-8 alkynyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, aryl-C₁₄ alkyl or aryloxy-C_1-4 alkyl. Other suitable substituents include each of the above aryl substituents attached to a ring atom via an alkylene group having 1 to 4 carbon atoms.

[0052] When two substituents are present on adjacent atoms of a substituted aryl or substituted heteroaryl ring, such substituents may optionally be replaced by a substituent of the formula -TC (O) - (CH2) qU-, wherein T and U are independently -NH- , -O-, -CH2, or a single bond and q is an integer from 0 to 2. Alternatively, when two substituents are present on adjacent atoms of a substituted aryl or substituted heteroaryl ring, such substituents may optionally be replaced with a substituent of formula -A- (CH2)_r-B- where A and B are independently -CH2-, -O-, -NH-, -S-, -S (O) -, -S (O) 2-,

PZ / 5321 / AG

EP 2 935 248 B1

S (O) 2NR'- or a single bond and r is an integer from 1 to 3. One of the single bonds of the new ring so formed may optionally be replaced by a double bond. Alternatively, when two substituents are present on adjacent atoms of a substituted aryl or substituted heteroaryl ring, such substituents may optionally be replaced by a substituent of formula - (CH2)_s-X- (CH2) t- where s and s are independently integers from 0 to 3 and X is -O-, -NR'-, -S-, -S (O) -, -S (O) 2- or -S (O) 2NR'-. R 'substituent in -NR'- and -S (O) groups₂NR'- is selected from hydrogen or unsubstituted C 1-6 alkyl.

[0053] The term "protecting group" refers to a group of atoms which, when attached to a reactive group on a molecule, mask, reduce, or prevent their reactivity. Examples of protecting groups can be found in TW Greene and PG Wuts, PROTECTIVE GROUPS IN ORGANIC CHEMISTRY, (Wiley, 4th edition 2006), Beaucage and lyer, Tetrahedron 48: 2223-2311 (1992) and Harrizon and Harrizon et al., COMPENDIUM OF SYNTHETIC ORGANIC METHODS, Volumes 1-8 (John Wiley and Sons. 1971-1996). Representative amino protecting groups include formyl, acetyl, trifluoroacetyl, benzyl, benzyloxycarbonyl (CBZ), tert-butoxycarbonyl (Boc), trimethylsilyl (TMS), 2-trimethylsilylethanesulfonyl (SES), trityl and substitutedoxycarbonylmethyl (FM) NVOC), triisopropylsilyl (TIPS), phenylsulfonyl etc. (see also, Boile, AL (publisher), carbamates, amides, N-sulfonyl derivatives, groups of formula -C (O) OR where R is, e.g. methyl, ethyl, t-butyl, benzyl, phenylethyl, CH2 = CHCH2 etc., groups of formula -C (O) R 'where R' is, e.g. methyl, phenyl, trifluoromethyl etc., groups of the formula SO2R "where R" is, e.g. tolyl, phenyl, trifluoromethyl, 2.2.5, 7,8-pentamethylchroman-6-yl, 2,3,6-trimethyl-4-methoxyphenyl etc. and silanyl-containing groups such as 2-trimethylsililetoxymethyl, tbutyldimethylsilyl, triisopropylsilyl and the like, CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY, John Wiley and Sons, New York, Vol. 1, 2000).

[0054] The terms "optional" or "optionally" as used herein mean that the later described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances in which it does not. For example, the phrase "an aromatic group is optionally substituted with one or two alkyl substituents" means that the alkyl may or may not be present, and the description includes situations where an aromatic group is substituted with an alkyl group and situations where an aromatic group is not substituted. by an alkyl group.

[0055] The term "composition" as used herein refers to a formulation suitable for administration for therapeutic purposes to the intended animal patient, which formulation comprises at least one pharmaceutically active compound and at least one pharmaceutically acceptable carrier or excipient.

[0056] The term "pharmaceutically acceptable" indicates that the indicated material does not have properties that would cause a prudent physician to avoid administering the material to a patient, given the disease or conditions to be treated and the appropriate mode of administration. For example, it is commonly required that such material be essentially sterile, e.g., for injectables.

[0057] The term "pharmaceutically acceptable salt" refers to a salt that is acceptable for administration to a patient, such as a mammal (eg, salts exhibiting mammal-acceptable safety).

PZ / 5321 / AG

For a given dosing regimen). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids depending on the particular substituents found on the compounds described herein. When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Salts derived from pharmaceutically acceptable inorganic bases include aluminum, ammonium, calcium, copper, iron (III), iron (II), lithium, magnesium, manganese (III), manganese (II), potassium, sodium, zinc, etc. Salts derived from pharmaceutically acceptable organic bases include salts of primary, secondary, tertiary, and quaternary amines including substituted amines, cyclic amines, naturally occurring amines and the like such as arginine, betaine, caffeine, choline, N-N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucosamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine, tripropylamine, tromethamine, N, N'-dibenzylethylenediamine, chloroprocaine, choline, methylglumanolamine, etc. When compounds of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Salts derived from pharmaceutically acceptable acids include salts of an acid such as acetic acid, trifluoroacetic acid, propionic acid, ascorbic acid, benzenesulfonic acid, benzoic acid, camphosulfonic acid, citric, ethanesulfonic, fumaric, glycolic, gluconic, glucuronic, glutamic, hippuric, hydrobromic, isethhonic, lactic, lactobionic, maleic, malic, almond, methanesulfonic, mucic, naphthalenesulfonic, nicotinic, nitric, 4,4'-methylenebis (3-hydroxy-2-naphthalenecarboxylic acid) (pamic acid), pantothenic, phosphoric, succinic, sulfuric, hydroiodic, carbonic, tartaric, p-toluenesulfonic, pyruvic, aspartic, benzoic, anthranilic, mesylic, salicylic acid, p-hydroxybenzoic, phenylacetic, pamic, ethanesulfonic, benzenesulfonic, 2-hydroxyethanesulfonic, sulfanilic, stearic, cyclohexylaminosulfonic, alginic, hydroxybutyric, galactaric and galacturonic acid etc.

Also included are amino acid salts such as arginate and the like, and salts of organic acids such as glucuronic or galactoric acids and the like (see, e.g., Berge, SM et al., "Pharmaceutical Salts", J. Pharmaceutical Science, 1977, 66: 1 -19). Certain specific compounds of the present disclosure contain both basic and acid functional groups that allow the compounds to be converted to base or acid addition salts.

[0059] The neutral forms of the compounds can be recovered by contacting the salt with a base or acid and isolating the parent compound in an usual manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to the parent form of the compound for the purposes of this disclosure.

[0060] In the present context, the term "therapeutically effective" or "effective amount" indicates that the compound or the amount of the compound, when administered, is sufficient or effective to avoid reducing

PZ / 5321 / AG

Or alleviating one or more symptoms of the disease, disorder, or medical condition being treated and / or prolonging survival of the patient being treated. The therapeutically effective amount will vary with the compound, disease, disorder or condition and the severity and age, weight etc. of the mammal to be treated. In general, satisfactory patient results are indicated to be obtained with a daily dose of from about 0.1 to about 10 g / kg patient body weight. In some embodiments, the daily dose ranges from about 0.10 to 10.0 mg / kg body weight, about 1.0 to 3.0 mg / kg body weight, about 3 to 10 mg / kg body weight. , about 3 to 150 mg / kg body weight, about 3 to 100 mg / kg body weight, about 10 to 100 mg / kg body weight, about 10 to 150 mg / kg body weight, or about 150 to 1000 mg / kg body weight. The dose may conveniently be administered, e.g., in divided doses up to four times a day or in sustained release form.

[0061] Reference to specific amino acid residues in a human C-kit polypeptide is given by numbering corresponding to the Kit sequence in GenBank NP_000213 (SEQ ID NO: 1). Reference to specific nucleotide positions in the nucleotide sequence encoding all or part of the C-kit is by numbering corresponding to the sequence given in GenBank NM_000222 (SEQ ID NO: 2).

[0062] The terms "kit", "C-kit" and "C-kit" mean an enzymatically active kinase that has a portion with greater than 90% amino acid sequence identity to the amino acid residues comprising the full-length C-kit (eg human) ATP binding site. C-kit, e.g. the sequence NP_000213, SEQ ID NO: 1), for maximum alignment of the sequence with a segment of equal length; or which contains a portion with greater than 90% amino acid sequence identity to at least 200 contiguous amino acids of native C-kit and retains kinase activity. Preferably the sequence identity is at least 95, 97, 98, 99 or even 100%. Preferably, the determined level of sequence identity comprises a sequence length of at least 100-500, at least 200-400, or at least 300 contiguous amino acid residues. Unless otherwise indicated, the term includes reference to wild-type C-kit, allelic variants, and mutant forms (e.g., having activating mutations).

[0063] In the present context, the terms "synergistically effective" or "synergistic effect" indicate that two or more compounds that are therapeutically effective, when used in combination, provide improved therapeutic effects greater than the additive effect that would be expected based on effect of each compound used independently.

[0064] By "testing" is meant creating experimental conditions and collecting data related to the specific outcome of exposure to specific experimental conditions. For example, enzymes can be tested for their ability to act on a detectable substrate. A compound can be tested based on its ability to bind to a particular target molecule or molecules.

[0065] As used herein, the terms "ligand" and "modulator" are used equivalently to refer to a compound that alters (ie, increases or decreases) the activity of a target biological molecule, eg, an enzyme such as a kinase. Generally, the ligand or modulator will be a small molecule, where the term "small molecule" refers to a compound with a molecular weight of 1,500 Daltons or less, or preferably 1,000 Daltons or less, 800 Daltons or less, or 600 Daltons or less. Thus, an "improved ligand" is one that has better pharmacological and / or pharmacokinetic properties than the reference compound, where "better" can be determined by one skilled in the art for a particular biological system or therapeutic application.

PZ / 5321 / AG

EP 2 935 248 B1

[0066] The term "associates", due to the interaction between the target and the potentially associating compound, indicates that the potential associating compound associates with the target to a statistically significant degree compared to association with proteins in general (ie, non-specific binding). Thus, the term "associating compound" refers to a compound that has a statistically significant association with the target molecule. Preferably, the binding compound interacts with the defined target with a dissociation constant (K_D) of 1 mM or less, 1 µM or less, 100 nM or less, 10 nM or less, or 1 nM or less.

[0067] In the context of target binders, the terms "higher affinity" and "selective" indicate that the compound binds tighter than the reference compound or than the same compound under reference conditions, ie, with a lower dissociation constant. In some embodiments, higher affinity means an affinity of at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, 1,000, or 10,000 times greater.

[0068] As used herein in connection with the compounds of the disclosure, the term "synthesizing" and the like means chemical synthesis from one or more precursor materials. Further, by "testing" is meant the creation of experimental conditions and the collection of data relating to the specific outcome of the experimental conditions. For example, enzymes can be tested for their ability to act on a detectable substrate. A compound or ligand can be tested based on its ability to bind to a particular target molecule or molecules.

[0069] The term "lone pair" or "lone pair" as used herein refers to an electron pair in the outermost shell of an atom, in particular a nitrogen atom, which is not used in the bond.

[0070] As used herein, the term "modulating" or "modulating" refers to the effect of altering a biological activity, especially a biological activity associated with a particular biological molecule such as a protein kinase. For example, an agonist or antagonist of a particular biological molecule modulates the activity of that biological molecule, e.g. an enzyme, either by increasing (e.g. agonist, activator) or by reducing (e.g. antagonist, inhibitor) of the activity of a biological molecule such as an enzyme. Such activity is typically indicated in terms of inhibitory concentration (IC50) or excitatory concentration (EC₅₀) a compound for an inhibitor or activator, respectively, relative to e.g. an enzyme.

[0071] The term "prodrugs" means any compound that releases an active parent drug of formula I in vivo when such prodrug is administered to a mammalian patient. Prodrugs of a compound of formula I are prepared by modifying functional groups present in the compound of formula I such that the modifications can be cut off in vivo to release the parent compound. Prodrugs can be prepared by modifying functional groups present on the compounds such that the modifications are cleaved either by routine manipulation or in vivo to the parent compounds. Prodrugs include compounds of Formula I wherein the hydroxyl, amino, carboxyl, or sulfhydryl group in the compound of Formula I is bonded to any group that can be cleaved in vivo to restore free hydroxyl, amino, or sulfhydryl groups, respectively. Examples of prodrugs include, but are not limited to esters (e.g. acetate, formate and benzoate derivatives), amides, guanidines, carbamates (e.g. N, N-dimethylaminocarbonyl) of hydroxyl functional groups in compounds of formula I etc. Preparation, selection and use of prodrugs are discussed in T. Higuchi and V. Stella, "Pro-drugs as Novel Delivery Systems," Vol. 14, ACS Symposium Series; Design of Prodrugs, edited by H. Bundgaard, Elsevier, 1985; and in Bioreversible Carriers in Drug Design, edited by Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

PZ / 5321 / AG

EP 2 935 248 B1

[0072] The term "tautomer" denotes compounds that are produced by the phenomenon by which the proton of one atom in a molecule is transferred to another atom. See, Jerry March, Advanced Organic Chemistry: Reactions, Mechanisms and Structures, Fourth Edition, John Wiley &amp; Sons, pp. 69-74 (1992). Tautomers also refer to one of two or more structural isomers that exist in equilibrium and are readily converted from one isomeric form to the other. Examples include keto-enol tautomers such as acetone / propen-2-ol, imine-enamine tautomers and the like, ring-chain tautomers such as glucose / 2,3,4,5,6-pentahydroxy-hexanal and the like, tautomeric forms of the groups heteroaryls containing an -N = C (H) -NH- moiety in the ring, such as pyrazole, imidazole, benzimidazole, triazole and tetrazole. Where a compound contains, e.g., a keto or oxime group or an aromatic group, tautomeric isomerism ("tautomerism") may occur. The compounds described herein may possess one or more tautomers and thus include various isomers. One of ordinary skill in the art will recognize that other tautomeric ring moieties are possible. All such isomeric forms of these compounds are expressly included in this disclosure.

[0073] The term "isomers" includes compounds which have identical molecular formulas but differ in the properties or bonding order of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers". The terms "stereoisomer" and "stereoisomers" refer to compounds that exist in different stereoisomeric forms if they have one or more asymmetric centers or double bonds with asymmetric substitution, and can therefore be produced as specific stereoisomers or as mixtures. Stereoisomers include enantiomers and diastereoisomers. Stereoisomers that are not mirror images of one another are termed "diastereoisomers" and which are non-superimposable mirror images of one another are termed "enantiomers". When a compound has an asymmetric center, e.g., which is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and it is described according to the R and S order rules of Cahn and Prelog or by the way in which the molecule rotates the plane of polarized light and is indicated as right-handed or left-handed (i.e., as (+ ) or (-), respectively). A chiral compound can exist as either a specific enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is termed a "racemic mixture". Unless otherwise indicated, the description is intended to include the specific stereoisomers as well as mixtures thereof. Methods for determining stereochemistry and separating stereoisomers are well known in the art (see for discussion in Chapter 4 of ADVANCED ORGANIC CHEMISTRY, 6th edition, J. March, John Wiley and Sons, New York, 2007) differing in the chirality of one or more stereochemical centers.

[0074] Certain compounds of the present disclosure can exist in unsolvated forms as well as solvated forms, including hydrated forms. The term "hydrate" refers to the complex formed by the combination of water molecules with solute molecules or ions. The term "solvate" refers to a complex formed by the combination of solvent molecules with solute molecules or ions. The solvent can be an organic compound, an inorganic compound, or a mixture of both. The solvate is intended to include a hydrate. Some examples of solvents include, but are not limited to, methanol, N, N-dimethylformamide, tetrahydrofuran, dimethyl sulfoxide, and water. In general, the solvated forms are equivalent to the unsolvated forms and are within the scope of this disclosure. Certain compounds of the present invention

PZ / 5321 / AG

The disclosures may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated in this disclosure and are intended to be included within the scope of this disclosure.

[0075] In the context of the use, testing or screening of compounds that are or may be modulating, the term "contacting" means that the compound (s) are made (are) in sufficient proximity to the particular molecule, complex, cell, tissue, organism, or other specified material, that potential binding interactions and / or a chemical reaction between the compound and other specified material may have occurred.

[0076] The term "patient" as used herein refers to a living organism that is treated with compounds as described herein, including, but not limited to, any mammal such as humans, other primates, sports animals, commercial interest such as cattle, livestock such as horses, or domestic animals such as dogs and cats.

[0077] The term "administration" refers to oral administration, suppository administration, topical contact, intravenous, intraperitoneal, intramuscular, intranasal, or subcutaneous administration, or implantation of a slow-release device, eg, an osmotic mini-pump, to a patient. Administration is by any route, including parenteral and mucosal (e.g., buccal, sublingual, palatal, gingival, intranasal, vaginal, rectal, or transdermal) routes. Parenteral administration includes, e.g., intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration. Other types of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.

[0078] The term "solid form" refers to a solid preparation (ie, preparation that is neither a gas nor a liquid) of a pharmaceutically active compound that is suitable for administration to an intended animal patient for therapeutic purposes. The solid form includes any complex, such as a salt, co-crystal, or amorphous complex, as well as any polymorph of the compound. The solid form may be substantially crystalline, semi-crystalline, or substantially amorphous. The solid form can be administered directly or used in the preparation of a suitable composition having improved pharmaceutical properties. For example, the solid form can be used in a formulation comprising at least one pharmaceutically acceptable carrier or excipient.

[0079] As used herein, the terms "prevent," "preventing," "preventing," and their grammatical variations, refer to a method of partially or completely delaying or preventing the onset or relapse of a disease. the disorder or condition and / or one or more of its accompanying symptoms, or not allowing the patient to contract or re-contract the disorder or condition, or to reduce the patient's risk of contracting or re-contracting the disorder or condition or one or more of its associated symptoms.

[0080] "Pain" or "painful state" can mean acute and / or chronic pain, including, without limitation, arachnoiditis; arthritis (e.g., osteoarthritis, rheumatoid arthritis, ankylosing spondylitis, gout); back pain (e.g. sciatica, disc herniation, spondylolisthesis, radiculopathy); burn pain; cancer pain; painful menstruation; headaches (e.g. migraine, cluster headaches, tension headaches); headache and facial pain (eg. cranial neuralgia, trigeminal neuralgia); hyperalgesia; hyperpathy; inflammatory pain (e.g. pain associated with irritable bowel syndrome, inflammatory bowel disease, ulcerative colitis, Leśniowski's disease PZ / 5321 / AG

EP 2 935 248 B1

Crohn's, cystitis, pain due to bacterial, fungal or viral infection); keloid or scar tissue formation; labor pain or pain in labor; muscle pain (e.g., as a result of polymyositis, dermatomyositis, inclusion myositis, repetitive activity disorders (e.g., scribe's cramp, carpal tunnel syndrome, tendinitis, tenosynovitis)); myofascial pain syndromes (e.g. fibromyalgia); neuropathic pain (e.g. diabetic neuropathy, causalgia, neuropathy due to adjacent anatomical structure, abdominal plexus abortion, occipital neuralgia, gout, reflex sympathetic dystrophy syndrome, phantom limb or amputation pain, post-herpetic neuralgia, central pain syndrome or nerve pain as a result of trauma (e.g. nerve damage), disease (e.g. diabetes mellitus, multiple sclerosis, Guillain-Barré syndrome, myasthenia gravis, neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis or cancer treatment); pain associated with dermatological disorders (e.g. herpes zoster, herpes, skin tumors, cysts, neurofibromatosis); sports injuries (e.g. cuts, injuries of joints with torn ligaments without dislocation, stress injuries, bruises, dislocations, fractures, spinal cord, head); spinal stenosis; postoperative pain; tactile hyperesthesia; disorders of the temporomandibular joint; vascular disease or injury (e.g., vasculitis, coronary artery disease, reperfusion injury (e.g., after ischemia, stroke, or myocardial infarction)); other specific pain in an organ or tissue (e.g. eye pain, corneal pain, bone pain, heart pain, visceral pain (e.g., kidney, gallbladder, gastrointestinal), joint pain, toothache, pelvic sensitivity, pelvic pain, renal colic, urinary incontinence); other pain related to the disease (e.g. sickle cell disease, AIDS, herpes zoster, psoriasis, endometriosis, asthma, chronic obstructive pulmonary disease (COPD), silicosis, pulmonary sarcoidosis, esophagitis, heartburn, gastroesophageal reflux, gastric ulcer, duodenal ulcer, functional dyspepsia, , cerebral malaria, bacterial meningitis); or pain from graft versus host rejection or graft rejection.

[0081] The term "unit dosage form" refers to a composition intended for a single administration to treat a patient suffering from a disease or medical condition. Each dosage unit form typically contains each of the active ingredients of the present disclosure plus pharmaceutically acceptable excipients. Examples of unit dosage forms are individual tablets, individual capsules, bulk powders, liquid solutions, ointments, creams, eye drops, suppositories, emulsions or suspensions. Treatment of a disease or condition may require periodic administration of unit dosage forms, for example, one unit dosage form two or more times a day, one with each meal, one every four hours or other apart, or only one per day. The phrase "oral dosage unit form" indicates a dosage unit form designed for oral ingestion.

[0082] As used herein, the term "C-kit mediated disease or condition" or "kit mediated disease or condition" or "KIT-mediated disease or condition" refers to a disease or condition in which the biological the functions of the C-kit and / or the C-kit mutant are involved in the development and / or course of a disease or condition, and / or in which modulation of the C-kit and / or the C-kit mutant alters development, course and / or symptoms. For example, mutations in the C-kit gene such as mutations W42, Wv, and W41 reported by Herbst et al. (J. Biol. Chem., 1992, 267: 13210-13216) confer heavy, intermediate and mild phenotypic traits, respectively. These mutations reduce the natural activity of the receptor tyrosine kinase to varying degrees

PZ / 5321 / AG

EP 2 935 248 B1 and are models for the modulation effect of C-kit activity. A C-kit mediated disease or condition includes a disease or condition in which inhibition of C-kit and / or a C-kit mutant provides a therapeutic benefit, e.g. wherein treatment with C-kit inhibitors, including the compounds described herein, provides therapeutic benefit. a patient suffering from or at risk of a disease or condition. The terms mutant C-kit, kit or KIT as used herein include kit having one or more mutations selected from D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A , N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822K, N822K, N822K Y823D, Y823C and T670I. In some instances, the KIT mutations include D816F, D816H, D816N, D816Y, D816V, T670I, and V654A. In other instances, the KIT mutations include D816V and or V560G.

[0083] The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes for one or more of the atoms that make up such compounds. For example, the compounds can be radiolabeled with radioactive isotopes, such as, e.g., tritium (³H), iodine-125 (¹²⁵I), carbon-14 (¹⁴C), carbon-11 (¹¹C) or fluorine-18 (¹⁸F). All isotopic variants of the compounds of the present disclosure, whether radioactive or not, are intended to be included within the scope of this disclosure.

[0084] The term "deuterated", as used herein alone or as part of a group, means deuterium substituted atoms. When a particular item is indicated as holding deuterium (denoted as "D" or "deuterium"), it is understood that the deuterium abundance at that item is well above the natural deuterium abundance which is 0.015% (i.e., at least 50.1% introduction of deuterium).

[0085] The term "deuterated analog", as used herein alone or as part of a group, means deuterium substituted atoms in place of hydrogen. A deuterated analog of the disclosure may be a fully or partially deuterium substituted derivative. Preferably, the deuterium substituted compound of the disclosure is a fully or partially deuterium substituted alkyl, aryl, or heteroaryl group. In one embodiment, a deuterium substituted compound of the disclosure is a fully or partially deuterium substituted alkyl group, e.g., -CD₃, CD₂CD₃, -CD₂CD₂CD₃ (n-propyl-D7), -CD (CD₃)₂ (isopropyl-D7), -CD₂CD₂CD₂CD₃ (n-butyl-D9), -CD₂-CD (CD₃)₂ (iso-butyl-D9) and the like. In another embodiment, a deuterium substituted compound of this disclosure is a fully or partially deuterium substituted aryl, such as phenyl, e.g.₆D₅ or fully or partially deuterium substituted heteroaryl, e.g. pyrazoly-d₂, thiazoly-d₂, pyridyl-d₃ e.t.c.

[0086] As used herein in connection with an amino acid or nucleic acid sequence, the term "isolate" indicates that the sequence is separate from at least a portion of the amino acid and / or nucleic acid sequence with which it would normally be associated.

[0087] Regarding amino acid or nucleic sequences, the term "purified" indicates that a given molecule has a significantly greater proportion of biological molecules in the composition than that observed in an earlier composition, eg, cell culture. The greater proportion can be 2 times, 5 times, 10 times or more than 10 times, based on the proportion found in the previous composition.

[0088] The disclosure also includes isotopically-labeled compounds of the present disclosure that are identical to those cited herein but differ in that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number typically

PZ / 5321 / AG

Occurring in nature. Examples of isotopes that may be incorporated into the compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as, inter alia,²H (deuterium, D,) ³H (tritium), 11C, ¹³C, ¹⁴C, ¹⁵N, ¹⁸F, ³¹P, ³²P, ³⁵S, ³⁶Cl and ¹²⁵I. Unless otherwise stated, when a position is indicated specifically as "H" or "hydrogen", it is understood that the position has a hydrogen atom with its naturally occurring isotopic composition or with isotopes thereof such as deuterium (D) or tritium (³H). Certain isotopically-labeled compounds of the present disclosure (e.g., labeled with³H i ¹⁴C) are useful in compound and / or substrate tissue distribution assays. Tritium (i.e.,³H) and carbon-14 (i.e., ¹⁴C) and fluorine-18 (¹⁸F) Isotopes are useful for their easy preparation and detectability. Then, substitution with heavier isotopes such as deuterium (i.e.,²H) It may provide some therapeutic benefit derived from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and therefore may be beneficial in some circumstances. Isotopically labeled compounds of the present disclosure can generally be prepared by the following procedures analogous to those disclosed in the Schemes and Examples herein below by substituting an isotopically labeled reagent for a non-isotopically labeled reagent.

II. General part

[0089] The present disclosure relates to compounds of formula (IVa-2), compounds as recited in the claims, and compounds described herein that modulate protein kinases, e.g., without limitation, the compounds are wild-type KIT modulators and / or mutant forms of KIT protein kinases. and the use of such compounds in the treatment of diseases or conditions.

III. Relationships

[0090] In one aspect, compounds of formula (I ') are described herein:

<img file="PL2935248T3_D0002.tif" />

or pharmaceutically acceptable salts, hydrates, solvates, tautomers and isomers thereof; wherein the variables and substituents are as defined in the Summary of the Invention.

[0091] In certain embodiments of compounds of Formula (I '), the compounds have molecular weights below 600. In some preferred embodiments, the compounds have molecular weights below 500. In other preferred embodiments, the compounds have molecular weights below 450. compounds have molecular weights below 400. In yet other preferred embodiments, the compounds have molecular weights below 350. In still other preferred embodiments, the compounds have molecular weights below 300.

[0092] In some embodiments of compounds of formula (I '), G is an optionally substituted aryl or an optionally substituted 5- or 6-membered heteroaryl having one to three nitrogen atoms as ring members, wherein the aryl or heteroaryl is optionally fused to an optionally substituted 5 to 8 membered ring having 0 to 2 heteroatoms as ring members selected from O, N or S. R¹ and r² together they form an optionally substituted aryl or an optionally substituted 5- or 6-membered fused heteroaryl ring having from 0 to 3 heteroatoms as ring members, selected

PZ / 5321 / AG

EP 2 935 248 B1 from N, O or S wherein one or two ring carbon atoms are optionally replaced by -C (= O) -.

[0093] In certain embodiments of compounds of formula (I '), the disclosure provides compounds of formula (I):

<img file="PL2935248T3_D0003.tif" />

or pharmaceutically acceptable salts, hydrates, solvates, tautomers and isomers thereof; wherein:

(i) R.¹ and r² together they form an optionally substituted 5- or 6-membered fused ring having from 0 to 3 heteroatoms as ring members selected from N, O or S in which one or two ring carbon atoms are optionally replaced by C (= ABOUT)-; or (ii) R¹ is H, halogen, C 1-4 alkyl, C 1-4 haloalkyl C 1-4 haloalkoxy, cyclopropyl or only an electron pair and R² is -NH-L²-R⁶where R.⁶ is H, optionally substituted aryl, optionally substituted aryl-C1-4alkyl, optionally substituted heteroaryl, optionally substituted heteroaryl-C1-4alkyl, optionally substituted heterocycloalkyl, optionally substituted C1-6alkyl, optionally substituted cycloalkyl, optionally substituted cycloalkyl-C14alkyl, optionally substituted heterocyclyl or optionally substituted heterocyclyl C1-4alkyl; i, in which L.² is selected from a bond, -C (O) -, -C (O) N (R^f) -, -SO2N (R^f) -, -SO2-, -C (O) O-, C (= NR^f) N (R^f) - where each R.^f, is independently H or C 1-4 alkyl;

R³ and r⁴ independently from each other are selected from H, halogen, C 1-4 alkyl, C 14 haloalkyl C 1-4 haloalkoxy, cyclopropyl, phenyl, CN, CN-CH 2 -, C 1-4 alkoxy, R^g or just a pair of electrons; or R³ and r⁴ taken together with the atoms to which they are attached form an optionally substituted 5 to 8-membered ring having 0 to 2 heteroatoms as ring members selected from O, N or S; in which R.^g means -OH, -NH2, -NO2, C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC (O) NH2 , -NHC (S) NH2, -NHS (O) 2NH2, C (NH) NH2, -OR^h, -SR^h, -OC (O) R^h, -OC (S) R^h, -C (O) R^h, -C (S) R^h, -C (O) OR^h, -C (S) OR^h, -S (O) R^h, S (O) 2R^h, -C (O) NHR^h, -C (S) NHR^h, -C (O) NO^hR^h, -C (S) NO^hR^h, -S (O) 2N HR^h, -S (O) 2NR^hR^h, C (NH) NHR^h, -C (NH) NR^hR^h, -NHC (O) R^h, -NHC (S) R^h, -NR^hC (O) R^h, -NR^hC (S) R^h, -NHS (O) 2R^h, NO^hS (O) 2R^h, -NHC (O) NHR^h, -NHC (S) NHR^h, -NR^hC (O) NH2, -NR^hC (S) NH2, -NR^hC (O) N HR^h, NO^hC (S) NHR^h, -NHC (O) NR^hR^h, -NHC (S) NR^hR^h, -NR^hC (O) NO^hR^h, -NR^hC (S) NO^hR^h, -NHS (O) 2N HR^h, NO^hS (O) 2NH₂, -NR^hS (O) 2NHR^h, -NHS (O) 2NR^hR^h, -NR^hS (O) 2NR^hR^h, -NHR^h or -NR^hR^hwhere each R.^h is independently H or C1-2alkyl; In some cases, R.³ and r⁴ they are not both hydrogen;

PZ / 5321 / AG

EP 2 935 248 B1

L.¹ is selected from -C (O) NR⁵-, -CH2N (R⁵) -, -SO2N (R⁵) -, -N (R⁵) C (O) N (R⁵) -, -N (R⁵) SO2-, N (R⁵) CH2-, -OC4alkylene-, -C_1-4alkylene-O-, -C (O) -, -NR⁵C (O) -, -SO₂-, -SON (R⁵) - or -S (O) -, where each R.⁵ is independently H or C 1-4 alkyl;

Y¹ is N or C;

Y² is N or optionally substituted = C-;

Y³ is N or CH; with the restriction that Y¹, Y² and Y³ they are not both N atom;

WITH¹ is N or CH;

WITH³ is N, C or CH;

WITH² and Z⁴ each independently represent N or C, with the proviso that Z¹, WITH², WITH³ and Z⁴ they are not both N atom; and

----- denotes a single or double bond. In some embodiments of compounds of Formula (I), Z² and Z³are C. In some cases, a group

R³ R *

<img file="PL2935248T3_D0004.tif" />

N - l ¹H in compounds of formula (I) may exist in tautomeric form:

R) R A. /

H-Z 'J, N' / where the wavy line indicates the point of attachment to the rest of the molecule.

[0094] In some embodiments of the compounds of formula (I), Z¹ is N, Z², WITH³ and Z⁴ are C. In other embodiments of the compounds of formula (I), Z¹ is N, Z² is C, Z³ and Z⁴ are N. In still other embodiments of the compounds of formula (I), Z¹ is N, Z² is C, Z³ means CH and Z⁴ is N. In still other embodiments of the compounds of formula (I), Z¹ is N, Z² is C, Z³ is N and Z⁴ is C. In other embodiments of the compounds of Formula (I), Z¹ is N, Z² is N, Z³ is N and Z⁴ is C. In other embodiments of the compounds of Formula (I), Z¹ is N, Z² is N, Z³ means CH and Z⁴ is N. In other embodiments of the compounds of Formula (I), Z¹ is N, Z² is N, Z³ and Z⁴are C. In other embodiments of the compounds of formula (I), Z¹ means CH, Z², WITH³ and Z⁴ are C. In other embodiments of the compounds of formula (I), Z¹ means CH, Z² is C, Z³ is N and Z⁴ is C. In other embodiments of the compounds of Formula (I), Z¹ means CH, Z² is C, Z³ is C and Z⁴ is N. In other embodiments of the compounds of Formula (I), Z¹means CH, Z² is C, Z³ and Z⁴ are N. In other embodiments of the compounds of formula (I), Z¹ means CH, Z² is N, Z³ is C and Z⁴ is C. In other embodiments of the compounds of Formula (I), Z¹ means CH, Z² is N, Z³ is N and Z⁴ is C. In other embodiments of the compounds of Formula (I), Z¹ means CH, Z² is N, Z³ means CH and Z⁴is N. In other embodiments of the compounds of Formula (I), Z¹ means CH, Z², WITH³ and Z⁴ represent N. All other variables and Y¹, Y², Y³, R¹, R², L.¹, R³ and r⁴ they do matter

PZ / 5321 / AG

Are defined in any of the sub-formulas for formula (I) or in any of the embodiments of compounds of formula (I) as described herein.

[0095] In certain embodiments of compounds of formula (I ') or (I), compounds of formula (II) are described herein:

<img file="PL2935248T3_D0005.tif" />

Y variables¹, Y², Y³, R¹, R², WITH¹, L.¹, R³ and r⁴ are as defined in any of the embodiments of the compounds of formulas (I '), (I) or (IV) or in any of the sub-formulas (I'), (I), (II) or (IV). In one case, Z¹ is N. Otherwise, Z¹ means CH. In some cases, a group

R? R *

JŁ

Ν '/' H in compounds of formula (II) exist in tautomeric form:

R = r &lt;• T ^Hz\.-Yj N &lt;

where the wavy line indicates the point of attachment to the rest of the molecule.

[0096] In some embodiments of the compounds of formulas (I '), (I) or (II), L.¹ is selected from -C (O) NR⁵-, CH2N (R⁵) -, -SO2N (R⁵) -, -N (R⁵) C (O) N (R⁵) -, -N (R⁵) SO2-, -N (R⁵) CH2-, -OC_1-4alkylene-, -C_1-4alkylene-O-, C (O) -, -SO2-, -SON (R⁵) - or -S (O) -. In other implementations, L.¹ is selected from -C (O) N (R⁵) -, SO2N (R⁵) -, -C (O) -, -SO2-, -CH₂O-, -CH₂N (r⁵) - or -SON (R⁵) -. In other implementations, L.¹ is C (O) N (R.⁵) -. In still other realizations, L.¹ is -C (O) NH- or -SO2NH-. In one implementation, L.¹is -C (O) NH-. In some cases, R.⁵ is H. In other cases, R.⁵ is C 1-6 alkyl. In still other cases, R.⁵ is H, C 1-4 alkyl or C 1-4 haloalkyl. In one case, R.⁵ is H, -CH3, -CHF₂, -CH2F or -CF3. All other variables and Y substituents¹, Y², Y³, R¹, R², WITH¹, WITH², WITH³, WITH⁴, R³ and r⁴ are as defined in any one of the sub-formulas (I '), (I) or (II) or in any of the embodiments of the compounds of formulas (I'), (I) or (II) as described herein.

[0097] In some embodiments of the compounds of formulas (I '), (I) or (II), L.¹ means -NHSO2-, -SO2NH-, NHC (O) NH-, -NHC (O) -, -CH2O-, -OCH2-, -C (O) NH-, -SO2-, -C (O) O- , -C (O) -, -C (= NH) NH- or NHC (= NH) -. In some implementations, L.¹ represents -NHSO2-, -SO₂NH-, -NHC (O) NH-, -NHC (O) -, - C (O) NH, -SO₂-, -C (O) O-, -OC (O) -, -C (O) - or -C (= NH) NH-. In some cases, L.¹ is -NHSO2-, SO2NH-, -NHC (O) NH- or -NHC (O) -. In other cases, L.¹ is -C (O) NH-, -SO2-, -SO₂NH-, C (O) O- or -C (O) -. In other cases, L.¹ is -NHSO₂- or -SO₂NH-. In still other cases, L.¹ is -C (O) NH-, -NHSO2-, -SO2NH- or -C (= NH) NH-. In still other cases

PZ / 5321 / AG

EP 2 935 248 B1

L.¹ is -NHSO2-, -SO2NH- or -SO₂-. In other cases, L.¹ is -NH-C (O) -. All other variables and Y substituents¹, Y², Y³, R¹, R², WITH¹, WITH², WITH³, WITH⁴, R³ and r⁴ are as defined in any of the embodiments as described herein.

[0098] In certain embodiments of compounds of formulas (I '), (I) (II), compounds of formula (III) are described herein:

<img file="PL2935248T3_D0006.tif" />

Y variables¹, Y², Y³, R¹, R², R³, R⁴ and L.¹ are as defined in any one of the embodiments of the compounds of formulas (I '), (I), (II) or (IV) as described herein, or in any of the sub-formulas (I'), (I), (II) or (IV). In some cases, compounds of formula (III), L.¹ is -C (O) NR⁵-, in which the carbonyl group in L.¹ is covalently bonded to the pyrazole ring and the nitrogen atom in L.¹ is covalently linked to the 6-membered aromatic ring in formula (III).

[0099] In some embodiments of the compounds of formulas (I '), (I), (II) or (III), R¹ and r² taken together with the atoms to which they are attached form an optionally substituted 5- or 6-membered fused heterocyclic aromatic ring having 1 to 3 heteroatoms as ring members selected from O, N or S; or an optionally substituted fused benzene ring. In some cases, the substituents for the fused aromatic ring are R groups⁷ defined in any one of the embodiments of the compounds of formula (I '), (I), (II), (III), (IV) as described herein, or in any one of the sub-formulas (I'), (I), ( II), (III) or (IV).

[0100] In certain embodiments of compounds of formula (I '), compounds of formula (I'a) are described herein:

R⁵

<img file="PL2935248T3_D0007.tif" />

G is as defined in any one of the embodiments of the compounds of formula (I '). R⁵is H, C 1-4 alkyl or C_3-4 haloalkyl. Ring A is a 5- or 6-membered fused heterocyclic aromatic ring having 1 to 3 heteroatoms as ring members selected from O, N or S; or fused benzene ring;

each R⁷ is independently selected from C 1-6 alkyl, C 1-6 alkoxy, C 2-6 alkenyl, C 2-6 alkynyl, X 1 -aryl, aryl-C 1-4 alkyl¹-, heteroaryl-Χ¹-, heteroaryl-C1-4 alkyl-Χ¹-, C3-6cycloalkyl-X¹-, C36cycloalkyl-C1-4alkyl-X¹-, C3-6cycloalkenyl-X¹-, CH2 = CH-X1, C3-6cycloalkyl-C2_-4alkenyl-X¹, C36cycloalkyl-C2-4alkynyl-X¹, heterocyclyl-Χ¹-, heterocyclyl-C3-4alkyl-X¹- or R.⁸, with R.⁸ selected from halogen, CN, -OH, -NH2, -NO2, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, S (O) ) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -OR^and, -SR^and, -OC (O) R^and, -OC (S) R^and, C (O) R^and, -C (S) R^and, -C (O) OR^and, -C (S) OR^and, -S (O) R^and, -S (O) 2R^and, -C (O) NHR^and, -C (S) NHR^and, -C (O) NO^andR^and, C (S) NO^andR^and, -S (O) 2NHR^and, -S (O) 2NR^andR^and, -C (NH) NHR^and, -C (NH) NR^andR^and, -NHC (O) R^and, -NHC (S) R^and, NO^andC (O) R^and, -NR^andC (S) R^and, -NHS (O) 2R^and, -NR^andS (O) 2R^and, -NHC (O) NHR^and, -NHC (S) NHR^and, -NR^andC (O) NH₂,

PZ / 5321 / AG

EP 2 935 248 B1

NO^andC (S) NH2, -NR^andC (O) NHR^and, -NR^andC (S) NHR^and, -NHC (O) NR^andR^and, -NHC (S) NR^andR^and, -NR^andC (O) NO^andR^and, NO^andC (S) NO^andR^and, -NHS (O) 2NHR^and, -NR^andS (O) 2NH2, -NR^andS (O) 2NHR^and, -NHS (O) 2NR^andR^and, NO^andS (O) 2NR^andR^and, -NHR^and or -NR^andR^andwhere each R.^and is independently selected from C18alkyl, aryl, aryl-C1-2alkyl, C3-6cycloalkyl, C3-6cycloalkyl-C1-4alkyl, heteroaryl, heteroaryl-C1-4alkyl, heterocycloalkyl, or heterocycloalkyl-C1-4alkyl, wherein each R^and then optionally substituted with 1 to 3 R &lt;2&gt; groups^b independently selected from C 1-6 alkyl, C 1-8 alkoxy, halo, C 1-6 haloalkyl, or C 1-6 haloalkoxy; in which X¹ represents a bond or -C (O) - i, wherein R⁷ is optionally substituted with 1 to 5 R members⁹ selected from halogen, -CH = CH2, CN, -OH, -NH₂, -NO₂, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR^c, -SR^c, -OC (O) R^c, -OC (S) R^c, P (= O) HR^c, -P (= O) R^cR^c, -PH (= O) OR^c, -P (= O) (OR^c) 2, -OP (= O) (OR^c) 2, -C (O) R^c, -C (S) R^c, -C (O) OR^c, C (S) OR^c, -S (O) R^c, -S (O) 2R^c, -C (O) NHR^c, -C (S) NHR^c, -C (O) NO^cR^c, -C (S) NO^cR^c, -S (O) 2NHR^c, S (O) 2NR^cR^c, -C (NH) NHR^c, -C (NH) NR^cR^c, -NHC (O) R^c, -NHC (S) R^c, -NR^cC (O) R^c, -NR^cC (S) R^c, NHS (O) 2R^c, -NR^cS (O) 2R^c, -NHC (O) NHR^c, -NHC (S) NHR^c, -NR^cC (O) NH2, -NR^cC (S) NH2, NR^cC (O) NHR^c, -NR^cC (S) NHR^c, -NHC (O) NR^cR^c, -NHC (S) NR^cR^c, -NR^cC (O) NO^cR^c, -NR^cC (S) NO^cR^c, NHS (O) 2NHR^c, -NR^cS (O) 2NH2, -NR^cS (O) 2NHR^c, -NHS (O) 2NR^cR^c, -NR^cS (O) 2NR^cR^c, -NHR^c, R^c or NO^cR^cwhere each R.^c is independently selected from C1-6alkyl, aryl, aryl C1-4alkyl, C3-8cycloalkyl, C3-8cycloalkyl-C1-4alkyl, heteroaryl, heteroaryl-C1-4alkyl, heterocycloalkyl, or heterocycloalkyl-C1-4alkyl, each of which R^c then optionally substituted with 1 to 3 R &lt;2&gt; groups^d independently selected from CN, -OH, -N (R^e) (R^e), -NO2, -C (O) OH, P (= O) HR^e, -P (= O) R^eR^e, -PH (= O) OR^e, -P (= O) (OR^e) 2, -OP (= O) (OR^e) 2, - C (O) NH2, -S (O) 2NH2, NHC (O) NH2, -C (NH) NH2, -OC (O) R^e, -OC (S) R^e, -C (O) R^e, -C (S) R^e, -C (O) OR^e, -S (O) 2R^e, -C (O) NHR^e, C1-galkyl, C1-galkoxy, halogen, C1-hhaloalkyl or C1-hhaloalkoxy, each of which R^e is independently C1-4alkyl; or two adjacent R.⁷ substituents together with the atoms to which they are attached form a 4-, 5- or 6-membered carbocyclic ring or a heterocyclic ring having 1 to 2 heteroatoms as ring members selected from O, N or S; Y² stands for CR¹⁰where R.¹⁰ is H, C 1-4 alkyl, C 1-6 alkoxy, C 2-6 alkenyl, C 2-6 alkynyl, aryl C 1-4 alkyl-, heteroaryl-C 1-4 alkyl-, C 3-8 cycloalkyl-C 1-4 alkyl-, C 3-8 cycloalkenyl-C 1-4 alkyl-, CH 2 = CH-X²-, C3-gcycloalkyl-C2_-4alkenyl-X²-, C3-8cycloalkyl-C2-4alkynylX²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹ or from 1 to 5 R^c or from 1 to 5 R^d or from 1 to 5 R^e; in which X² is C1-4alkylene, -O-, -S-, or -NH-; Y¹ is N or C; and the index m is 0, 1, or 2. In some embodiments, R.¹⁰ is H. In some embodiments, R.¹⁰ is H, halogen, C_1-4alkyl, C._1-2alkoxy, CN, NH₂, C_1-2alkylNH, (C._1-2alkyl)₂N. In some implementations, R.¹⁰ is C1-4 alkyl, halogen, -NH2, -CN, -OCH3, CF3, CN, -OCF3, PZ / 5321 / AG

EP 2 935 248 B1

CHF₂, -CH2F, -OCH2F, or -OCHF2. In other implementations, R.¹⁰ is C 1-6 alkyl. In other implementations, R.⁷ is C1-4 alkyl, halogen, -CN, -OCH3, CF3, CN, -OCF3, -CHF2, -CH2F, OCH2F or -OCHF2. In other implementations, R.⁷ is C 1-6 alkyl. In some embodiments, index m is 0, 1.2, or 3. In one embodiment, Y¹ is N or C. In another embodiment, Y³ means CH.

[0101] In some embodiments, the variables and substituents G, Y¹, Y², Y³, A, R⁷ and the index m are as defined in any of the sub-formulas (I '), (I'a) or (IV) or in any embodiment of the compounds of formula (IV). In any embodiment of the compounds of formula (I'a), the hydrogen atoms in G are optionally replaced by 1 to 12, or 1 to 8, or 1 to 6, or 1 to 3, or 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 deuterium atoms with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% injection deuterium for each deuterium. In some embodiments, each hydrogen in G is optionally replaced with a deuterium atom with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5%, or 99. 9% deuterium injection for each deuterium.

[0102] In some embodiments of compounds of formulas (I ') or (I'a), G is an optionally substituted C_1-6 alkyl. In other embodiments, G is an optionally substituted aryl or an optionally substituted 5- or 6-membered heteroaryl having one or more nitrogen atoms as ring members, wherein the aryl or heteroaryl is optionally fused to an optionally substituted 5 to 8 membered ring having from 0 Up to 2 heteroatoms as ring members selected from O, N or S. In some cases, the alkyl or aromatic portion of G is optionally substituted with 1 to 3 R.⁷; or from 1 to 3 R⁸; or from 1 to 3 R⁹; or from 1 to 3 R^and; or from 1 to 3 R^c; or from 1 to 3 R^d; or from 1 to 3 R^g substituents. In other cases, the alkyl or aromatic portion of G is optionally substituted with 1 to 3 R.²¹ selected from halogen, C1-4 alkyl, C1-4 haloalkyl C1-4 haloalkoxy, cyclopropyl, phenyl, CN, CN-CH2-, C1-4alkoxy, -OH, -NH2, -NO2, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -ORi, -SRi, -OC (O) R^and, -OC (S) Ri, C (O) Ri, -C (S) R^and, -C (O) OR^and, -C (S) OR^and, -S (O) R^and, -S (O) 2R¹, -C (O) NHR^and, -C (S) NHR^and, -C (O) NRiR^and, -C (S) NRiR^and, -S (O) 2NHRi, -S (O) 2NRiR^and, -C (NH) NHRi, -C (NH) NRiRi, -NHC (O) R¹, -NHC (S) R¹, -NR¹C (O) R¹, -NRiC (S) Ri, -NHS (O) 2R1, -NRiS (O)₂Ri, -NHC (O) NHR¹, -NHC (S) NHR¹, -NR1C (O) NH2, -NR1C (S) NH2, -NRiC (O) NHR^and, -NRiC (S) NHR^and, -NHC (O) NRiR^and, -NHC (S) NRiR^and, -NRiC (O) NRiR^and, -NRiC (S) NRiR^and, -NHS (O) 2NHR^and, NRiS (O) 2NH2, -NRiS (O) 2NHR^and, -NHS (O) 2NRiR^and, -NRiS (O) 2NRiR^and, -NHR^and or -NRiR^andwherein Ri is C1-2alkyl or optionally substituted phenyl.

[0103] In some embodiments of compounds of formula (I ') or (I'a), G is phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 1H-1,2,4-triazol-5-yl, 1H-1,2,4-triazol-3-yl, 1H-1,2,5-triazol- 3-yl, 1H-5-pyrazolyl, 1H-4-pyrazolyl, 1H-3-pyrazolyl, 3-pyridazinyl, 4-pyridazinyl, 1H-indazol-3-yl, 1H-indazol-4-yl, 1H-indazol- 5-yl, 1H-indazol-6-yl, 1H-indazol-7-yl,

PZ / 5321 / AG

EP 2 935 248 B1

Η ΎΔ

NH-n |_last "HH, each of which is optionally substituted with 1 to 3 R &lt;2&gt;²² independently selected from halogen, C1-4 alkyl, C1-4 haloalkyl C1-4 haloalkoxy, cyclopropyl, phenyl, CN, CN-CH2-, C1-4 alkoxy or Rg; or from 1 to 3 Rg substituents wherein hydrogen atoms in the R group²² are optionally replaced with from 1 to 8 deuterium atoms. In some embodiments, G is 2-pyridyl, 3-pyridyl, or 4-pyridyl, each of which is optionally substituted with 1 to 3 R²² independently selected from halogen, C 1-4 alkyl, C 14 haloalkyl C 1-4 haloalkoxy, cyclopropyl, phenyl, CN, CN-CH 2 -, C 1-4 alkoxy or R^g; or from 1 to 3 R^g. In other cases, G is 1H-5-pyrazolyl, 1H-4-pyrazolyl, or 1H-3-pyrazolyl, each of which is optionally substituted with 1 to 3 R²² independently selected from halogen, C1-4alkyl, C_1-4haloalkyl C_1-4haloalkoxy, cyclopropyl, phenyl, CN, CN-CH₂-, C_1-4alkoxy or R.^g; or from 1 to 3 R^g. In still other cases, G is 1H-5-pyrazolyl, which is optionally substituted with 1 to 3 R &lt;1&gt;²²independently selected from halogen, C1-4 alkyl, C1-4 haloalkyl, C14 haloalkoxy, cyclopropyl, phenyl, CN, CN-CH2-, C1-4alkoxy or R^g; or from 1 to 3 R^g. In some cases, R.²² is -CD3, -C6D5, partially deuterated C1-6 alkyl or perdeuterated C1-6alkyl.

[0104] In certain embodiments of compounds of formulas (I '), (I'a), (I), (II), or (III), compounds of formula (IV) are described herein:

<img file="PL2935248T3_D0008.tif" />

ring A is a 5- or 6-membered fused heterocyclic aromatic ring having 1 to 3 heteroatoms as ring members selected from O, N or S; or fused benzene ring;

each R⁷ is independently selected from C 1-6 alkyl, C 1-6 alkoxy, C 2-6 alkenyl, C 2-6 alkynyl, X¹-aryl, aryl-C1-4alkyl-X¹-, heteroaryl-X¹-, heteroaryl-C1-4 alkyl-X¹-, C3-6cycloalkyl-X¹-, C36cycloalkyl-C1-4alkyl-X¹-, C3-6cycloalkenyl-X¹-, CH2 = CH-X1, C3-6cycloalkyl-C2-4alkenyl-X¹, C36cycloalkyl-C2-4alkynyl-X¹, heterocyclyl-X1-, heterocyclyl-C1_-4alkyl-X¹- or R.⁸, with R.⁸ selected from halogen, CN, -OH, -NH2, -NO2, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, S (O) ) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -OR^and, -SR^and, -OC (O) R^and, -OC (S) R^and, C (O) R^and, -C (S) R^and, -C (O) OR^and, -C (S) OR^and, -S (O) R^and, -S (O) 2R^and, -C (O) NHR^and, -C (S) NHR^and, -C (O) NO^andR^and, C (S) NO^andR^and, -S (O) 2NHR^and, -S (O) 2NR^andR^and, -C (NH) NHR^and, -C (NH) NR^andR^and, -NH C (O) R^and, -NHC (S) R^and, NO^andC (O) R^and, -NR^andC (S) R^and, -NHS (O)₂R^and, -NR^andS (O) 2R^and, -NHC (O) NHR^and, -NHC (S) N HR^and, -NR^andC (O) NH2,

PZ / 5321 / AG

EP 2 935 248 B1

NO^andC (S) NH2, -NR^andC (O) NHR^and, -NR^andC (S) NHR^and, -NHC (O) NR^andR^and, -NHC (S) NR^andR^and, -NR^andC (O) NO^andR^and, NO^andC (S) NO^andR^and, -NHS (O) 2NHR^and, -NR^andS (O) 2NH2, -NR^andS (O) 2NHR^and, -NHS (O) 2NR^andR^and, NO^andS (O) 2NR^andR^and, -NHR^and or -NR^andR^andwhere each R.^and is independently selected from C6alkyl, aryl, aryl-C1-2alkyl, C3-6cycloalkyl, C3-6cycloalkyl-C1-4alkyl, heteroaryl, heteroaryl-C1-4alkyl, heterocycloalkyl, or heterocycloalkyl-C1-4alkyl, each R^and then optionally substituted with 1 to 3 R &lt;2&gt; groups^b independently selected from C 1-6 alkyl, C 1-8 alkoxy, halo, C 1-6 haloalkyl, or C 1-6 haloalkoxy; in which X¹ represents a bond or -C (O) - i, wherein R⁷ is optionally substituted with from 1 to 5 R.sup.⁹ selected from halogen, -CH = CH2, CN, -OH, -NH₂, -NO₂, -C (O) OH, -C (S) OH, -C (O) NH₂, C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR^c, -SR^c, -OC (O) R^c, OC (S) R^c, -P (= O) HR^c, -P (= O) R^cR^c, -PH (= O) OR^c, -P (= O) (OR^c) 2, -OP (= O) (OR^c) 2, -C (O) R^c, -C (S) R^c, C (O) OR^c, -C (S) OR^c, -S (O) R^c, -S (O) 2R^c, -C (O) NHR^c, -C (S) NHR^c, -C (O) NO^cR^c, -C (S) NO^cR^c, S (O) 2NHR^c, -S (O) 2NR^cR^c, -C (NH) NHR^c, -C (NH) NR^cR^c, -NHC (O) R^c, -NHC (S) R^c, -NR^cC (O) R^c, NO^cC (S) R^c, -NHS (O) 2R^c, -NR^cS (O) 2R^c, -NHC (O) NHR^c, -NHC (S) NHR^c, -NR^cC (O) NH 2, -NR^cC (S) NH2, NR^cC (O) NHR^c, -NR^cC (S) NHR^c, -NHC (O) NR^cR^c, -NHC (S) NR^cR^c, -NR^cC (O) NO^cR^c, -NR^cC (S) NO^cR^c, NHS (O) 2NHR^c, -NR^cS (O) 2NH2, -NR^cS (O) 2NHR^c, -NHS (O) 2NR^cR^c, -NR^cS (O) 2NR^cR^c, -NHR^c, R^c or NO^cR^cwhere each R.^c is independently selected from C1-6alkyl, aryl, aryl C1-4alkyl, C3-6cycloalkyl, C3-6cycloalkyl-C1-4alkyl, heteroaryl, heteroaryl-C1-4alkyl, heterocycloalkyl, or heterocycloalkyl-C1-4alkyl, each of which R^c then optionally substituted with 1 to 3 R &lt;2&gt; groups^d independently selected from CN, -OH, -N (R^e) (R^e), -NO2, -C (O) OH, C (O) NH2, -S (O)₂NH₂, -NHC (O) NH₂, -C (NH) NH₂, -P (= O) HR^e, -P (= O) R^eR^e, -PH (= O) OR^e, -P (= O) (OR^e) 2, -OP (= O) (OR^e) 2, -OC (O) R^e, -OC (S) R^e, -C (O) R^e, -C (S) R^e, -C (O) OR^e, -S (O) 2R^e, -C (O) NHR^e, C1-6alkyl, C1-6alkoxy, halogen, C1-hhaloalkyl or C1-haloalkoxy, each of which R^e is independently C1-4alkyl; or two adjacent R.⁷ together with the atoms to which they are attached form a 4-, 5- or 6-membered carbocyclic ring or a heterocyclic ring having 1 to 2 heteroatoms as ring members selected from O, N or S;

Y² stands for CR¹⁰where R.¹⁰ represents H, C 1-4 alkyl, C 1-6 alkoxy, C 2-6 alkenyl, C 2-6 alkynyl, aryl-C 1-4 alkyl-, heteroaryl-C 1-4 alkyl-, C 3-6 cycloalkyl-C 1-4 alkyl-, C 3-6 cycloalkenyl-C 1-4 alkyl -, CH2 = CH-X²-, C3-gcycloalkyl-C2_-4alkenyl-X²-, C3-8cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹ or from 1 to 5 R^c or from 1 to 5 R^d or from 1 to 5 R^e; in which X² is C1-4 alkylene, -O-, -S-, or -NH-; Y¹ is N or C; and the index m is 0, 1, or 2. In some embodiments, R.¹⁰ is H. In other embodiments, R.¹⁰ is H, halogen, C 14 alkyl, C 1-4 alkoxy, CN, NH 2, C 1-2 alkylNH, (C 1-4 alkyl) N. In other embodiments, R¹⁰ is C1-4 alkyl, halogen, -CN, -NH2, -OCH₃, CF₃, CN, -OCF3, -CHF₂, -CH₂F, -OCH2F, or -OCHF2. IN

PZ / 5321 / AG

In other embodiments, R.¹⁰ is C 1-6 alkyl. In other implementations, R.⁷ is C1-4 alkyl, halogen,

-CN, -OCH₃, CF₃, CN, -OCF₃, -CHF₂, -CH2F, -OCH2F, or -OCHF2. In other implementations, R.⁷ means

C1-4alkyl. In one implementation, Y¹ is C. In one embodiment, Y³ means CH.

[0105] In some embodiments of compounds of formula (IV) or (I'a), index m is 1 or 2 and all other substituents of formula (IV) are as defined in any of the embodiments described herein. In one case, index m is 1. Otherwise, index m is 2. In yet another case, index m is 0. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and r⁷ in formula (IV) are as defined in any of the embodiments described herein.

[0106] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is independently selected from C 1-6 alkyl, deuterated C 1-6 alkyl, C 1-6 alkoxy, C 2-6 alkenyl, C 2-6 alkynyl, -X¹-aryl, aryl-C-] 4alkyl-X¹-, heteroaryl-X¹-, heteroaryl-C1-4 alkyl-X¹-, C3-gcycloalkyl-X¹-, C3-gcycloalkenyl-X¹-, C 3-8 cycloalkyl-C 1-4 alkyl-X¹-, heterocyclyl-X¹-, heterocyclyl-C1-4alkyl-X¹-, CH2 = CH-X¹, C3-8cycloalkylC2-4alkenyl-X¹, C3-gcycloalkyl-C2-4alkynyl-X¹, halogen, CN, -OH, -NH2, -NO2, -C (O) OH, C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, - NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, OR^and, -SR^and, -OC (O) R^and, -OC (S) R^and, -C (O) R^and, -C (S) R^and, -C (O) OR^and, -C (S) OR^and, -S (O) R^and, -S (O) 2R^and, C (O) NHR^and, -C (S) NHR^and, -C (O) NO^andR^and, -C (S) NO^andR^and, -S (O) 2NHR^and, -S (O) 2NR^andR^and, -C (NH) NHR^and, C (NH) NO^andR^and, -NH C (O) R^and, -NHC (S) R^and, -NR^andC (O) R^and, -NR^andC (S) R^and, -NHS (O) 2R^and, -NR^andS (O) 2R^and, NHC (O) NHR^and, -NHC (S) NHR^and, -NR^andC (O) NH2, -NR^andC (S) NH2, -NR^andC (O) NHR^and, -NR^andC (S) NHR^and, NHC (O) NR^andR^and, -NHC (S) NR^andR^and, -NR^andC (O) NO^andR^and, -NR^andC (S) NO^andR^and, -NHS (O) 2NHR^and, -NR^andS (O) 2NH₂, NO^andS (O) 2NHR^and, -NHS (O) 2NR^andR^and, -NR^andS (O) 2NR^andR^and, -NHR^and or -NR^andR^andwhere each R.^and is independently C1-galkyl, aryl, aryl-C_1-2alkyl, C._3rdcycloalkyl, C._3rdcycloalkyl-C_1-4alkyl, heteroaryl, heteroaryl C1-4alkyl, heterocycloalkyl or heterocycloalkyl C1-4alkyl, each R^and then optionally substituted with from 1 to 3 R b independently selected from 0 ° C. galkyl, -OCH3, -OCH2CH3, -O-CH (CH3) 2, -Cl, -F, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, or -OCH2F; in which X¹ is a bond or -C (O) - i, wherein an aliphatic or aromatic part of R⁷is optionally substituted with from 1 to 5 R.sup.⁹ selected from halogen, CN, -OH, -NH2, -NO₂, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR^c, -SR^c, -P (= O) HR^c, -P (= O) R^cR^c, -PH (= O) OR^c, P (= O) (OR^c) 2, -OP (= O) (OR^c) 2, -OC (O) R^c, -OC (S) R^c, -C (O) R^c, -C (S) R^c, -C (O) OR^c, -C (S) OR^c, -S (O) R^c, S (O) 2R^c, -C (O) NHR^c, -C (S) NHR^c, -C (O) NO^cR^c, -C (S) NO^cR^c, -S (O) 2NHR^c, -S (O) 2NR^cR^c, -C (NH) NHR^c, -C (NH) NR^cR^c, -NHC (O) R^c, -NHC (S) R^c, -NR^cC (O) R^c, -NR^cC (S) R^c, -NHS (O) 2R^c, -NR^cS (O) 2R^c, NHC (O) NHR^c, -NHC (S) NHR^c, -NR^cC (O) NH2, -NR^cC (S) NH2, -NR^cC (O) NHR^c, -NR^cC (S) NHR^c, NHC (O) NR^cR^c, -NHC (S) NR^c R^c, -NR^cC (O) NO^cR^c, -NR^cC (S) NO^cR^c, -NHS (O) 2NHR^c, -NR^cS (O) 2NH2, NR^cS (O) 2NHR^c, -NHS (O) 2NR^cR^c, -NR^cS (O) 2NR^cR^c, -NHR^c, R^c or -NR^cR^cwhere each R.^cis independently C._1stalkyl, aryl, aryl-C_1-2alkyl, C._3rdcycloalkyl, C._3rdcycloalkyl-C_1-4alkyl, heteroaryl,

PZ / 5321 / AG

Heteroaryl-C1-4alkyl, heterocycloalkyl or heterocycloalkyl-C1-4alkyl, wherein each R^c then optionally substituted with 1 to 3 R &lt;2&gt; groups^d independently selected from CN, -OH, -N (R^e) (R^e), -NO2, -C (O) OH, -C (O) NH2, -S (O) 2NH2, -NHC (O) NH2, -C (NH) NH2, -P (= O) HR^e, P (= O) R^eR^e, -PH (= O) OR^e, -P (= O) (OR^e) 2, -OP (= O) (OR^e) 2, -OC (O) R^e, -OC (S) R^e, -C (O) R^e, -C (S) R^e, C (O) OR^e, -S (O) 2R^e, -C (O) NHR^e, C1-6alkyl, C1-6alkoxy, halogen, C1-6haloalkyl or C1-6 haloalkoxy, wherein R^e is C1-4 alkyl; or two adjacent R.⁷ together with the atom to which they are attached form a 4-, 5- or 6-membered carbocyclic ring or a heterocyclic ring having 1 to 2 heteroatoms as ring members selected from O, N or S; and the index m is 0, 1, or 2. In some cases, X¹ means bond. In other cases, X¹ means -C (O) -. In some cases, R.⁹ means CN, -CH3, OCH3, -OCH₂CH₃, -O-CH (CH₃)₂, -Cl, -F, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF2 or -OCH2F, P (= O) CH₃, -P (= O) (CH₃)₂, -PH (= O) O (C._1-4alkyl), -P (= O) (OC_1-4alkyl)₂, -OP (= O) (OC_1-4alkyl)₂, C_1-6alkyl, phenyl, perdeuterated phenyl, benzyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-thiazolyl, 4-thiazolyl, 4-thiazolyl, 4-thiazolyl -pyrazolyl, 4-pyrazolyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 2-oxazolyl, 5-oxazolyl, 4oxazolyl, 2-thiophenyl, 3-thiophenyl, 1-piperidinyl, 4-piperidinyl or 4-morpholinyl, 4 -morpholinylcarbonyl, cyclopropylcarbonyl, 1-piperazinyl, 4-methyl-1-piperazinyl, 1-pyrrolidinyl, 1-piperazinylcarbonyl, 1-piperidinylcarbonyl, 1-pyrrolidinylcarbonyl, dimethylamino, 2- (4-morpholinyl) ethoxy, 3-methoxypropoxy, dimethylcarbamoyl, acetamido, propanoyl, methylsulfonylcarbonyl, methylsulfonylcarbonyl, 1, thiomorpholylamino , propanoylamino, 1-cyclopentenyl, 1-cyclohexenyl, 1,2,3,6-tetrahydropyridin-4-yl, 1,2,3,6-tetrahydropyridin-5-yl, 2,5-dihydro-1H-pyrrol-3-yl , 2,5-dihydropyrrol-1-yl, each of which is optionally substituted with 1 to 3 R &lt;2&gt; groups^j groups independently selected from OH, NH2, CN, -CH3, -OCH3, -OCH2CH3, -O-CH (CH3) 2, -Cl, -F, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, C1-6alkyl, 4-morpholinyl, 4-morpholinylcarbonyl, cyclopropyl, cyclopropylmethyl, cyclopropylcarbonyl, 1-piperazinyl, 4-methyl-1-piperazinyl, 1-pyrrolidinyl, 1-piperazinylcarbonyl, 1-piperidinylcarbonyl, 2-piperidinylcarbonyl, 2-piperidinylcarbonyl - (4-morpholinyl) ethoxy, 3-methoxypropoxy, acetamido, propanoyl, methylsophonylamino, methylsulfonyl, propanoylamino, dimethylcarbamoyl or ethoxycarbonylamino. In other cases, R.^and is C1-4 alkyl, phenyl, perdeuterated phenyl, benzyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-thiazolyl, 5-thiazolyl thiazolyl, 3-pyrazolyl, 4-pyrazolyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 2-oxazolyl, 5-oxazolyl, 4-oxazolyl, 2-thiophenyl, 3-thiophenyl, 1-piperidinyl, 4-piperidinyl or 4- morpholinyl, 4-morpholinylcarbonyl, cyclopropylcarbonyl, 1-piperazinyl, 4-methyl-1-piperazinyl, 1-pyrrolidinyl, 1-piperazinylcarbonyl, 1-piperidinylcarbonyl, 1-pyrrolidinylcarbonyl, dimethylamino, 2- (4-morpholinyl) ethoxy, 3-methoxypropoxy, dimethylcarbamoyl, acetamido, propanoyl, methylsulfonylaminyl, 1-methylsulfonylcarbonyl , propanoylamino, 1-cyclopentenyl, 1-cyclohexenyl, 1,2,3,6-tetrahydropyridin-4-yl, 1,2,3,6-tetrahydropyridin-5-yl, 2,5-dihydro-1H-pyrrol-3-yl , 2,5-dihydropyrrol-1-yl, each of which is optionally substituted with 1 to 3 R &lt;2&gt; groups^j. In other cases, R.^and, R^c or R⁹ are each independently C1-6alkyl or C_1-4alkoxy, each of which is optionally

PZ / 5321 / AG

Substituted by a group selected from C 1-4 alkyl, methoxy, phenyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-thiazolyl, 4-thiazolyl, 5- thiazolyl, 3-pyrazolyl, 4-pyrazolyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 2-oxazolyl, 5-oxazolyl, 4-oxazolyl, 2-thiophenyl, 3-thiophenyl, 1-piperidinyl, 4-piperidinyl or 4- morpholinyl. In still other cases, R.^d are selected from C_1stalkyl, -CN, -OCH₃, -OCH₂CH₃, -O-CH (CH₃)₂, -Cl, -F, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF2, OCH2F, -NH-Ci-6alkyl, -N (C1_-galkyl) (C1_-galkyl). All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) are as defined in any of the embodiments described herein.

[0107] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from halogen, -CN, vinyl-Χ¹, C1-galkyl-X¹, C1-galkoxy-X¹, C2-galkynyl-X¹, C 3-8 cycloalkyl-Χ¹, C 3-8 cycloalkenyl-Χ¹-, C3-g cycloalkyl-C1-4alkyl-X¹, C3-8 cycloalkyl-C2-4alkynyl-X¹, aryl-X¹, aryl-C14lkyl-X¹, heteroaryl-X¹, heteroaryl-C1-4 alkyl-X¹, heterocyclyl-X¹, heterocyclyl-C1-4alkyl, -C (O) -R^and, C (O) NHR^and, -C (O) NO^andR^and, -NHC (O) R^and, -NHC (O) OR^and, -NHC (O) NHR^and, -NHC (O) NR^andR^and, -NR^andR^and, -NHR^and, C (O) OR^and, -OC (O) R^and, -SO2R^and, -NHSO2R^and, -NHSO2NHR^and, -NHSO2NR^andR^and, -SO2NHR^and or -SO2NR^andR^andwherein at each occurrence R.⁷ is optionally substituted with 1 to 4 R &lt;2&gt; groups⁹. In some cases, each R.⁹ is independently selected from halogen, -CN, C1-galkyl, C1-galkoxy, C1-ghaloalkyl, C1-ghaloalkoxy, C3-gcycloalkyl, C3-g cycloalkyl-C_1-4alkyl, aryl, aryl-C_1-4alkyl, heteroaryl, heteroaryl-C_1-4alkyl, heterocyclyl, or heterocyclylC 1-4 alkyl, or R⁸. In one case, R.⁷ is H. In other cases, two adjacent R⁹ together in an aromatic ring they form a 5 or g-membered ring having 0 to 2 heteroatoms selected from O, N, or S. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) are as defined in any of the embodiments described herein.

[0108] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from halogen, CN, vinyl, C1-galkyl, C1-galkoxy, C2-g alkynyl, C3-g cycloalkyl, C3-g cycloalkenyl, C3-g cycloalkyl-C1-4alkyl, C3-g cycloalkyl-C2- 4alkynyl, aryl, aryl-C1-4alkyl, heteroaryl, heteroaryl-C1-4alkyl, heterocycloalkyl, heterocycloalkyl-C1-4alkyl, -C (O) -R^and, -C (O) NHR^and, -C (O) NO^andR^and, -NHC (O) R^and, NHC (O) OR^and, -NHC (O) NHR^and, -NHC (O) NR^andR^and, -NR^andR^and, -NHR^and, -C (O) OR^and, -OC (O) R^and, -SO2R^and, NHSO₂R^and, -NHSO2NHR^and, -NHSO2NR^andR^and, -SO2NHR^and or -SO2NR^andR^andeach of which is independently optionally substituted with 1 to 4 R &lt;3&gt; groups⁹; or optionally independently substituted with from 1 to 4 R.sup.^c; or optionally independently substituted with from 1 to 4 R.sup.^d; or optionally substituted with 1 to 4 R.sup.¹⁵ selected from halogen, -CN, C1-galkyl, C1-galkoxy, C1-haloalkyl, C1-hhaloalkoxy, C3₆cycloalkyl, C._3rdcycloalkyl-C_1-4alkyl, heterocycloalkyl-C_1-4alkyl, -C (O) -R^c, -C (O) NHR^c, -C (O) NO^cR^c, NHC (O) R^c, -P (= O) HR^c, -P (= O) R^cR^c, -PH (= O) OR^c, -P (= O) (OR^c) 2, -OP (= O) (OR^c) 2, -NHC (O) OR^c, NHC (O) NHR^c, -NR^cR^c, -NHR^c, -C (O) OR^c, -OC (O) R^c, -OC (O) NHR^c, -SO2R^c, -NHSO2R^c, -SO₂NHR^c or -SO2NR^cR^c; or optionally independently substituted with from 1 to 4 R.sup.^1g chosen

PZ / 5321 / AG

EP 2 935 248 B1 from C_1-6alkyl, -OH, -CN, -NO₂, -NH₂, -NHCH3, -N (CH₃)₂, -OCH3, -OCH2CH3, -OCH (CH₃)₂, -Cl, -F, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF2, -OCH2F, 4-morpholinyl, cyclopropyl, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-pyrrolidinylcarbonyl, 1-piperidinylcarbonyl, acetyl, methoxycarbonyl, acetamido, dimethylcarbamoyl, methylcarbamoyl or methylsulfonylamoyl, In some cases, R.^c is C3-6cycloalkyl, C3-6cycloalkyl-C1-4alkyl, heterocycloalkyl or heterocycloalkyl-C1-4alkyl. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0109] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from aryl, heteroaryl, C2-6 alkynyl, C3-6 cycloalkenyl, heterocycloalkyl, -C (O) -R^and, -C (O) NHR^and, -C (O) NO^andR^and, C (O) OR^and, -SO2NHR^and or -SO2NR^andR^andeach of which is optionally substituted with (i) 1 to 4 R &lt;2&gt; groups⁹; or (ii) from 1 to 4 R.sup.^c; or (iii) from 1 to 4 R^d; or (iv) from 1 to 4 R¹⁵ selected from halogen, -CN, C 1-4 alkyl, C 1-4 alkoxy, C 16 haloalkyl C 1-6 haloalkoxy, C 3-6 cycloalkyl, C 3-6 cycloalkyl-C 1-4 alkyl, heterocycloalkyl-C 14 alkyl, -C (O) -R^c, -C (O) NHR^c, -C (O) NO^cR^c, -NHC (O) R^c, -NHC (O) OR^c, -NHC (O) NHR^c, -NR^cR^c, -NHR^c, C (O) OR^c, -P (= O) HR^c, -P (= O) R^cR^c, -PH (= O) OR^c, -P (= O) (OR^c) 2, -OP (= O) (OR^c) 2, -OC (O) R^c, OC (O) NHR^c, -SO2R^c, -NHSO2R^c, -SO2NHR^c or -SO2NR^cR^c; or (v) from 1 to 4 R¹⁶; or (vi) from 1 to 4 R¹⁷ independently selected from C1-4alkyl, -OH, -CN, -NO2, NH2, -NHCH₃, -N (CH₃)₂, -OCH₃, -OCH₂CH₃, -O-CH (CH₃)₂, -Cl, -F, -CH₂F, -CHF₂, CF₃, -OCF₃, OCHF₂, -OCH₂F, 4-morpholinyl, thiomorpholino, 1-piperidinyl, cyclopropyl, 1-cyanocyclopropyl, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-piperazinyl, 1-piperazinylcarbonyl, 1-pyrrolidinylcarbonyl, 1-piperidinyl, methylcarbonyl, acetarbidylcarbonyl, acetarbidylcarbonyl, acetarbidylcarbonyl, methylsulfonyl, methylsulfonylamino, -C1-2alkyl-R^k, -C (O) -R^k, -C (O) NHR^k, C (O) NO^kR^k, -NHC (O) R^k, -P (= O) HR^k, -P (= O) R^kR^k, -PH (= O) OR^k, -P (= O) (OR^k) 2, -OP (= O) (OR^k) 2, C (O) OR^k, -OC (O) R^k, -SO2R^k, -NHSO2R^k, -SO2NHR^k, -SO2NR^kR^kwhere each R.^k is independently C1-6alkyl, C3-6cycloalkyl, phenyl, or heterocycloalkyl, wherein R^k then optionally substituted with 1 to 3 R &lt;2&gt; groups^d, R^e or R^j; or (vii) from 1 to 4 R¹⁸selected from F, Cl, I, -CH3, -OCH₃, Oh₂CH₃, -O-CH (CH₃)₂, -OH, -CN, -NO₂, -NH₂, NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, cyclopropyl, cyclopropylmethyl, 1-cyanocyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -PH (= O) -C_1-6alkyl, -P (= O) (C._1-6alkyl)₂, PH (= O) O (C._1-6alkyl), -P (= O) (OC₁.₆alkyl)₂, -OP (= O) (OC_1-6alkyl)₂, -NHSO₂-C_1-6alkyl, -SO₂NH-C_1-6alkyl, NHC (O) -C_1-6alkyl, -C (O) NH-C_1-6alkyl, -NHC (O) NH-C_1-6alkyl, NHC (O) OC_1-6alkyl, -C (O) -C_1-6alkyl, C (O) OC_1-6alkyl, -OC (O) -C_1-6alkyl, -NHSO2CH3, NH₂C (O) -, CH3NHC (O) -, NH₂SO₂-, CH3SO2-, (CH₃)₂NC (O) -, CH₃C (O) NH-, CH3SO2NH-, benzyl, benzyl-C (O), (C_1-4alkyl) OC (O) -, cyclopropylC (O) -, cyclopropylethyl-C (O) -, cyclobutyl-C (O) -, cyclobutylmethyl-C (O) -, Ph-NH-C (O) -, 4- morpholinyl, 4-morpholinylmethyl, 4-morpholinylethyl, thiomorpholino, 4-thiomorpholinyl-C (O) -, 4-morpholinyl-C (O) -, 1-piperidinyl, 1-piperidinyl-C (O) -, p-CH₃-Ph-SO₂NH-, Ph-SO₂NH-, propyl-SO₂NH-, cyclopropyl

PZ / 5321 / AG

EP 2 935 248 B1

SO2NH-, cyclobutyl-SO2NH-, butyl-SO2NH-, ethoxycarbonyl-NH-, methoxycarbonyl-NH-, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-piperazinyl, 1-piperazinylcarbonyl, 4-methyl-1-piperazinylcarbonyl, 4-methyl-1-piperazinylcarbonyl -piperidinylcarbonyl, acetyl, methoxycarbonyl, acetamido, dimethylcarbamoyl, methylcarbamoyl, ethoxycarbonylamino, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, 1-morpholinylethyl, 2-methoxypropoxy 4-morpholinylmethylcarbonyl or 4-morpholinylethylcarbonyl with each occurrence R¹⁸ then optionally substituted with 1 to 3 substituents independently selected from -CN, F, Cl, I, -OCH3, C1-4alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl , -OH, -NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and index m of the formulas (I'a) or (IV) are as defined in any one of the embodiments of the formulas (I'a) or (IV) as described herein.

[0110] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is selected from aryl, heteroaryl, C2-8 alkynyl, C3-8 cycloalkenyl, or heterocycloalkyl, each of which is optionally substituted with (i) 1 to 4 R⁹; or (ii) from 1 to 4 R.sup.^c; or (iii) from 1 to 4 R^d; or (iv) from 1 to 4 R¹⁵; or (v) from 1 to 4 R¹⁶; or (vi) from 1 to 4 R¹⁷ independently selected from Y-galki ^ -OH, -CN, -NO2, -NH2, NHCH3, -N (CH3) 2, -OCH3, -OCH2CH3, -O-CH (CH3) 2, -Cl, -F , -CH2F, -CHF2, CF3, -OCF3, -OCHF2, OCH2F, 4-morpholinyl, 1-piperidinyl, cyclopropyl, 1-cyanocyclopropyl, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-piperazinyl, 1-piperazinylcarbonyl, 1-piperazinyl-pyrrolidinyl, 1-piperazinyl-pyrrolidinyl, 1-piperazinyl-pyrrolidinyl , 1-piperidinylcarbonyl, acetyl, methoxycarbonyl, acetamido, dimethylcarbamoyl, methylcarbamoyl, methylsulfonyl, methylsulfonylamino, -C1-2alkyl-R^k, -C (O) -R^k, -P (= O) HR^k, -P (= O) R^kR^k, -PH (= O) OR^k, -P (= O) (OR^k) 2, OP (= O) (OR^k)₂, -C (O) NHR^k, -C (O) NO^kR^k, -NHC (O) R^k, -C (O) OR^k, -OC (O) R^k, -SO2R^k, -NHSO2R^k, SO₂NHR^k, -SO2NR^kR^kwhere each R.^k independently is C1-6alkyl, C_3-6cycloalkyl, phenyl, or heterocycloalkyl, wherein R^k then optionally substituted with 1 to 3 R &lt;2&gt; groups^d, R^e or R^j; or (vii) from 1 to 4 R¹⁸ selected from F, Cl, I, -CH3, -OCH3, OCH₂CH₃, -O-CH (CH₃)₂, -OH, -CN, -NO₂, -NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, OCHF₂, -OCH₂F, cyclopropyl, 1-cyanocyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -NHSO₂CH₃, NH₂C (O) -, CH₃NHC (O) -, NH₂SO₂-, CH₃SO₂-, -PH (= O) -C₁.₆alkyl, -P (= O) (C.₁.₆alkyl)₂, -PH (= O) (OC₁. ₆alkyl), - P (= O) (OC_1-6alkyl)₂, -OP (= O) (OC_1-6alkyl)₂, (CH₃)₂NC (O) -, CH3C (O) NH-, CH3SO2NH-, benzyl, benzyl-C (O), (C_1-4alkyl) OC (O) -, cyclopropyl-C (O) -, cyclopropylethyl-C (O) -, cyclobutyl-C (O) -, cyclobutylmethyl-C (O) -, Ph-NH-C (O) -, 4-morpholinyl, 4-morpholinylmethyl, 4-morpholinylethyl, 4-morpholinyl-C (O) -, 1-piperidinyl, 1-piperidinyl-C (O) -, p-CH₃-Ph-SO₂NH-, Ph-SO₂NH-, propyl-SO₂NH-, cyclopropyl-SO₂NH-, cyclobutyl-SO₂NH-, butyl-SO₂NH-, ethoxycarbonyl-NH-, methoxycarbonylNH-, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-piperazinyl, 1-piperazinylcarbonyl, 4-methyl-1-piperazinylcarbonyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 3-azetidinyl -oxetanyl, 1-pyrrolidinylcarbonyl, 1-piperidinylcarbonyl, acetyl, methoxycarbonyl, acetamido, dimethylcarbamoyl,

PZ / 5321 / AG

Methylcarbamoyl, ethoxycarbonylamino, 1-morpholinylethyl, 3-methoxypropoxy, 2- (4-morpholinyl) ethoxy, 4-morpholinylmethylcarbonyl or 4-morpholinylethylcarbonyl, where in each case R¹⁸ then optionally substituted with 1 to 3 substituents independently selected from -CN, F, Cl, I, -OCH3, C1-galkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl , -OH, -NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and index m of the formulas (I'a) or (IV) are as defined in any one of the embodiments of the formulas (I'a) or (IV) as described herein.

[0111] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from halogen, -CN, C 1-6 alkyl, O-galkoxy, 2-pyridyl, 3-pyridyl, 4-pyridyl, perdeuterated pyridyl, phenyl, perdeuterated phenyl, 1-pyrazolyl, 3-1H-pyrazolyl, 4 -1H-pyrazolyl, vinyl, ethynyl, propynyl, 3-fluoropropynyl, cyclopropylethynyl, cyclobutylethynyl, cyclopentylethynyl, cyclohexylethynyl, 1-cyclopentenhenylethynyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, cyclopropyl, cyclobutyl, cyclopropylmethyl, cyclopropylmethyl, cyclopropylmethyl , cyclohexylmethyl, 1-piperazinyl, 1-piperidinyl, morpholinyl, 1,2,5,6-tetrahydropyridin-4-yl, 1,2,5,6-tetrahydropyridin-3-yl, 2,3-dihydro-1,4-benzodioxin- 5-yl, 1,3-benzodioxol-4-yl, 1,3-benzodioxol-5-yl, indanyl, 1,2-benzoxazolyl, 1,3-benzoxazolyl, 1-cyclohexenyl, 1-cyclopentenyl, 1-cyclooctenyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 2-pyrazinyl, 3-pyridazinyl, 4-pyridazinyl, 5,6-dihydro-2H-pyran-4-yl, 5,6-dihydro-2H-pyran-3-yl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-imidazolyl, 4-imidazolyl, 1-pyrazolyl, 2-pyrazolyl, 3-pyrazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 3-isothiazolyl, 4-isothiazolyl, 5-isothiazolyl, 1, 2,3-triazol-1-yl, 1,2,3-triazol-2-yl, 1,2,3-triazol-3-yl, 1,2,3-triazol-4-yl, 1,2, 3-triazol-5-yl, 1,2,4-triazol-1-yl, 1,2,4-triazol-2-yl, 1,2,4-triazol-3-yl, 1,2,4- triazol-4-yl, 1,2,4-triazol-5-yl, 1-oxa-2,3-diazol-4-yl, 1-oxa-2,3-diazol-5-yl, 1-oxa- 2,4-diazol-3-yl, 1-oxa-2,4-diazol-5-yl, 1-oxa-2,5-diazol-3-yl, 1-oxa-2,5-diazol-4-yl, 1-thia-2,3-diazol-4-yl, 1-thia-2,3-diazol-5-yl, 1-thia-2,4- diazol-3-yl, 1-thia-2,4-diazol-5-yl, 1-thia-2,5-diazol-3-yl, 1-thia-2,5-diazol-4-yl, 1- tetrazolyl, 3-tetrazolyl, 1H-5-tetrazolyl, 3H-5-tetrazolyl, 2-furanyl, 3-furanyl, 2-thiophenyl or 3-thiophenyl, each optionally substituted with (i) 1 to 4 R⁹; or (ii) from 1 to 4 R.sup.^c; or (iii) from 1 to 4 R^d; or (iv) from 1 to 4 R¹⁵ selected from halogen, -CN, C1-4alkyl, 06alkoxy, C1-6 haloalkyl, C1-6 haloalkoxy, C3-6cycloalkyl, C3-6cycloalkyl-C1-4alkyl, heterocycloalkyl-C1-4alkyl, -C (O) -R^c, -C (O) NHR^c, -C (O) NO^cR^c, -NHC (O) R^c, -NHC (O) OR^c, NHC (O) NHR^c, -NR^cR^c, -NHR^c, -C (O) OR^c, -OC (O) R^c, -OC (O) NHR^c, -SO2R^c, -NHSO2R^c, -SO2NHR^c or SO2NR^cR^c; or (v) from 1 to 4 R¹⁶; or (vi) from 1 to 4 R¹⁷ independently selected from C1-6alkyl, -OH, -CN, -NO2, -NH2, -NHCH3, -N (CH3) 2, -OCH3, OCH2CH3, -O-CH (CH3) 2, -Cl, -F , -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, 4-morpholinyl, thiomorpholine, 1-piperidinyl, cyclopropyl, 1-cyanocyclopropyl, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-piperazinyl, 1-piperazinyl pyrrolidinylcarbonyl, 1-piperidinylcarbonyl, acetyl, methoxycarbonyl, acetamido, dimethylcarbamoyl, methylcarbamoyl, methylsulfonyl, methylsulfonylamino, -C1-2alkyl-R^k, -C (O) -R^k, -C (O) NHR^k, -C (O) NO^kR^k, -NHC (O) R^k, -C (O) OR^k, -PH (= O) R^k, -P (= O) R^kR^k, PH (= O) OR^k, -P (= O) (OR^k) 2, -OP (= O) (OR^k) 2, -OC (O) R^k, -SO2R^k, -NHSO2R^k, -SO2NHR^k, -SO₂NO^kR^k, in

PZ / 5321 / AG

EP 2 935 248 B1 each of which R^k is independently C1-6alkyl, C3-6cycloalkyl, phenyl, or heterocycloalkyl, wherein R^kthen optionally substituted with 1 to 3 R.sup.^d, R^e or R^j; or (vii) from 1 to 4 R¹⁸ selected from F, Cl, I, -CH3, -OCH3, OCH2CH3, -O-CH (CH3) 2, -OH, CN, -NO2, -NH2, -NHCH3, -N (CH3) 2, -CH2F , -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, cyclopropyl, 1-cyanocyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, -NHSO2CH3, NH2C (O) -, CH3NHC (O) -, NH2SO2-, CH3SO2-, (CH3) 2NC (O) -, CH3C (O) NH-, CH3SO2NH-, benzyl, benzyl-C (O), (C14alkyl) OC (O) -, cyclopropyl-C (O) -, cyclopropylethyl-C (O) -, cyclobutyl -C (O) -, cyclobutylmethyl-C (O) -, Ph-NH-C (O) -, thiomorpholino, 4-thiomorpholinyl-C (O) -, -PH (= O) -C1-6alkyl, -P (= O) (C1-6alkyl) 2, -PH (= O) (OC1galkyl), -P (= O) (OC1-6alkyl) 2, -OP ( = O) (OC1-6alkyl) 2,4-morpholinyl, 4-morpholinylmethyl, 4-morpholinylethyl, 4-morpholinyl-C (O) -, 1-piperidinyl, 1-piperidinyl-C (O) -, p-CH3-Ph- SO2NH-, Ph-SO2NH-, propylSO2NH-, cyclopropyl-SO2NH-, cyclobutyl-SO2NH-, butyl-SO2NH-, ethoxycarbonyl-NH-, methoxycarbonyl-NH-, cyclopropoxy, cyclopropylmethyl, 1-pyrrolidinyl, 1-piperazinyl, 1-piperazine 4-methyl-1-piperazinylcarbonyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2oxetanyl, 3-oxetanyl, 1-pyrrolidinylcarbonyl, 1-piperidinylcarbonyl, acetyl, methoxycarbonyl, acetamido, dimethylcarbamoyl, methylcarbamoyl, ethoxycarbonylamino, 1-morpholinylpropoxy, 3-morpholinylpropoxy, 3-morpholinylpropoxy, 3- -morpholinylmethylcarbonyl or 4-morpholinylethylcarbonyl, with each occurrence R¹⁸ then optionally substituted with 1 to 3 substituents independently selected from -CN, F, Cl, I, -OCH3, C_1-6alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, -N (CH₃)₂, CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. In some embodiments, the hydrogen atoms in R⁷ are optionally replaced by 1 to 12 or 1 to 8 or 1 to 6 or 1 to 3 or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 deuterium atoms with at least 52, 5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium. In some embodiments, each hydrogen in R⁷ is optionally replaced with a deuterium atom with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and index m of the formulas (I'a) or (IV) are as defined in any one of the embodiments of the formulas (I'a) or (IV) as described herein. [0112] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from halogen, -CN, C_1-6alkyl, C._1-6alkoxy, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-methoxy-4-pyridyl, phenyl, 1-pyrazolyl, 3-1H-pyrazolyl, 4-1H-pyrazolyl, 1-methyl-4-pyrazolyl, 1,3- dimethyl-5-pyrazolyl, vinyl, ethynyl, propynyl, 3-fluoropropynyl, cyclopropylethynyl, cyclobutylethynyl, cyclopentylethynyl, cyclohexylethynyl, 1-cyclopentenhenylethynyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, cyclopropyl, cyclopomethyl, cyclopropyl, cyclopropyl, cyclopropyl, cyclopropyl, cyclopropyl, cyclopropyl, cyclobutyl cyclopentylmethyl, cyclohexylmethyl, 2-cyclopropylethyl, 2-cyclobutylethyl, 1-methyl-1-cyclopropyl, 1-cyclopropylethyl, 1-methyl-1-cyclobutyl, 1-cyclobutylethyl, methoxymethoxy, 4-morpholinylmethoxy, 1-piperidinylmethoxy, 4,4-difluoropiperidinyl, 4-ethoxycarbonyl-1- piperazinyl, 1-piperidinyl, 4-morpholinyl, 1,2,3,6-tetrahydropyridin-4-yl, 1,2,3,6-tetrahydropyridin-5-yl, 1-cyclopropylcarbonyl-2,3,6-trihydropyridin- 4-yl, 2,2,6,6-tetramethyl-1,5-dihydropyridin-4-yl, 2,2,6,6-tetramethyl-1,5-dihydropyridin-3-yl, 1-cyclopropylcarbonyl-2,3,6

PZ / 5321 / AG

Trihydropyridin-5-yl, 1-methylsulfonyl-2,3,6-trihydropyridin-4-yl, 1-methylsulfonyl-2,3,6-trihydropyridin-5-yl, 1- (4-morpholinylcarbonyl) -2 , 3,6-trihydropyridin-4-yl, 1- (4-morpholinylcarbonyl) -2,3,6-trihydropyridin-5-yl, 1-t-butoxycarbonyl-2,3,6-trihydropyridin-4-yl, 1-t -butoxycarbonyl-2,3,6-trihydropyridin-5-yl, 2,3-dihydro-1,4-benzodioxin-5-yl, 1,3-benzodioxol-4-yl, 1,3-benzodioxol-5-yl, indanyl , 1,2-benzoxazolyl, 1,3-benzoxazolyl, 1-cyclohexenyl, 1-cyclopentenyl, 1-cyclooctenyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 2-cyclopropyl-5-pyrimidinyl, 2-cyclopropyl-pyrimidin-5-yl, 2-pyrazinyl, 3-pyridazinyl, 4-pyridazinyl, 5,6-dihydro-2H-pyran- 4-yl, 5,6-dihydro-2H-pyran-3-yl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-imidazolyl, 4-imidazolyl, 1-pyrazolyl, 2-pyrazolyl, 3-pyrazolyl, 2- oxazolyl, 4-oxazolyl, 5oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 3-isothiazolyl, 4-isothiazolyl, 5-isothiazolyl, 1,2,3-triazol-1-yl, 1,2,3- triazol-2-yl, 1,2,3-triazol-3-yl, 1,2,3-triazol-4-yl, 1,2,3-triazol-5-yl, 1,2,4-triazol-1-yl, 1, 2,4-triazol-2- yl, 1,2,4-triazol-3-yl, 1,2,4-triazol-4-yl, 1,2,4-triazol-5-yl, 1-oxa- 2,3-diazol-4-yl, 1-oxa-2,3-diazol-5-yl, 1-oxa-2,4-diazol-3-yl, 1-oxa-2,4-diazol-5-yl, 1-oxa-2,5-diazol-3-yl, 1-oxa-2,5-diazol-4-yl, 1-thia-2,3-diazol-4-yl, 1-thia-2,3-diazol- 5-yl, 1-thia-2,4-diazol-3-yl, 1-thia-2,4-diazol-5-yl, 1-thia-2,5-diazol-3-yl, 1-thia- 2,5-diazol-4-yl, 1-tetrazolyl, 3-tetrazolyl, 1H-5-tetrazolyl, 3H-5-tetrazolyl, 2-furanyl, 3-furanyl, 2-thiophenyl, 3-thiophenyl, 3-chloro-5-thiophenyl or 1-cyclopropylcarbonylpiperidin-4-yl each of which is optionally substituted with 1 to 4 R¹⁶ or R substituents¹⁷; or from 1 to 4 R¹⁸, with the proviso that, in each occurrence, R.¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ selected from CN, F, Cl, I, -OCH3, C1-4alkyl, cyclopropyl, -OH, -NH2, NHCH3, -N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O), CH3NHC (O) -, CH3C (O) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2-, (CH3) 2S (O) 2NH- or CH3SO2-. In some cases, R.^k is C1-6 alkyl, C3-6cycloalkyl, C3-6cycloalkyl-C1_-2-alkyl, 4-morpholinyl, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxatanyl, 3-oxatanyl, 2-oxo-1-pyrrolidinyl, 1-piperidinyl, 2- piperidinyl, 3-piperidinyl, 4-piperidinyl, piperazinyl, phenyl or benzyl, each of which is optionally substituted with 1 to 3 substituents selected from -CH₃, -OCH₃, F, Cl, CN, CF₃, CHF₂, CH₂F, -OCF₃, -N (CH₃)₂, -NHCH₃. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0113] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from 3-fluoropropynyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-methoxy-4-pyridyl, phenyl, 1-pyrazolyl, 3-1H-pyrazolyl, 4-1H-pyrazolyl, 1-methyl-4-pyrazolyl , 1,3-dimethyl-5-pyrazolyl, 4-morpholinyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2,5-dimethyl-4-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-methyl -5-thiazolyl, 1-isopropylpyrazol-4-yl, 1-cyclohexenyl, 1-cyclopentenyl, 1-cyclooctenyl, 1,2,3,6-tetrahydropyridin-4-yl, 1,2,3,6-tetrahydropyridin-5-yl, cyclopropyl , 2,5-dihydro-1H-pyrrol-3-yl, 2,5-dihydro-1H-pyrrole-2-yl or 2,5-dihydropyrrol-1-yl, each of which is optionally substituted with 1 to 4 R¹⁶ or R¹⁷; or from 1 to 4 R¹⁸, with the proviso that, in each occurrence, R.¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ selected from CN, F, Cl, I, OCH3, C1-6alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, NH2, -NHCH3, -N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, CH3NHC (O) -, CH3C (O ) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2 -, (CH3) 2S (O) 2NH- or CH3SO2-. In some cases, R.^k is C1-6alkyl, C_3-6cycloalkyl, C._3-6cycloalkyl-C_1-2alkyl, 4

PZ / 5321 / AG

Morpholinyl, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 2-oxo-1-pyrrolidinyl, 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl, piperazinyl, phenyl or benzyl, each is optionally substituted with 1 to 3 substituents selected from -CH3, -OCH3, F, Cl, CN, CF3, CHF2, CH2F, OCF3, -N (CH3) 2, -NHCH3. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0114] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is H, CN, vinyl, ygalkyl, deuterated? -galkyl, perdeuterated? -galkyl, halogen, C1-6alkoxy, 2-cyclopropylethynyl, pyridyl, phenyl, benzyl, pyrazolyl, oxazolyl, thiozolyl, pyrimidinyl, pyrazinyl, pyridazinyl, cyclopropylropyl, cyclopropylropyl, , cyclopropylcarbonyl, cyclobutyl, cyclobutylmethyl, cyclopentyl, cyclopentylmethyl, cyclohexyl, cyclohexylmethyl, benzoyl, phenylcarbamoyl, piperidinyl, piperazinyl, morpholinyl, cyclopentenyl, cyclohexenyl, 1,2,3, g-tetrahydrop, 2,3-dihydro-1,4-benzodioxin-5-yl, 1,3-benzodioxol-4-yl, 1,3-benzodioxol-5-yl, indanyl, 1,2-benzoxazolyl, 1,3-benzoxazolyl, of which each is optionally substituted with from 1 to 4 groups independently selected from halo, -CH₃, CD₃, -OCH₃, CN, CF₃, CF3O-, -CF₂H, CHF2O-, -N (CH₃)₂, -NHCH3, CH3CONH-, NH2C (O) -, CH3NHC (O) -, (CH3) 2NC (O) -, cyclopropyl, 1-cyanocyclopropyl, CH3SO2NH-, cyclopropylSO2NH-, butyl-SO₂NH-, p-CH₃C._gH.₄SO₂NH-, NH₂SO₂-, CH3NHSO2-, (CH₃)₂NSO₂-, 4-morpholinyl, piperidinyl, 4-methyl-1-piperazinyl, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, 4-morpholinylcarbonyl, piperidinylcarbonyl, piperazinylcarbonyl, tbutyloxycarbonyl, or tbutyloxycarbonyl. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0115] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from Cl, Br, phenyl, 4-fluorophenyl, 2-fluorophenyl, 3-fluorophenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 1-cyclopropylcarbonyl 1,2,3, g-tetrahydropyridin-4-yl , 1-morpholinocarbonyl, 1,2,3, g-tetrahydropyridin-4-yl, 1,2,3, gtetrahydropyridin-5-yl, 1,3-dimethylpyrazol-4-yl or 1- (4-piperidinyl) pyrazol- 4-yl, 3,4-dimethyl-1H-pyrazol-5-yl, 1- (cyclopropylcarbonyl) -2,5-dihydropyrrol-3-yl, 3-fluoropropynyl, 3,5-dimethylisoxazol-4-yl, 5-thiazolyl, each of which is optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁴ independently selected from F, Cl, -CH₃, - Et, propyl, isopropyl, 2-methylpropyl, CD₃, -OCH₃, CN, CH₂F, -CF₂H, CF₃, CF₃O-, CHF₂O-, CH₂FO-, NH₂, -N (CH₃)₂, -NHCH₃, CH₃CONH-, NH₂C (O) -, CH₃NHC (O) -, (CH₃)₂NC (O) -, -PH (= O) (C._1-4alkyl), -P (= O) (C_1-4alkyl)₂, -PH = O) CH₃, -P (= O) (CH₃)₂, Cyclopropyl, 1cyjanocyklopropyl, 4-morpholinyl, 4-morpholinyl-methyl, 4-thiomorpholinyl, 4-morpholinylcarbonyl, 4tiomorfolinylokarbonyl 4-morfolinylometylokarbonyl, 4-tiomorfolinylometylokarbonyl, cyclopropylcarbonyl, cyklobuylokarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, 4-piperidinyl, 4piperydynylokarbonyl, 1-piperidinylcarbonyl, 1 -piperazinylcarbonyl, t-butoxycarbonyl, 2- (4-morpholinyl) ethyl, 2- (4-morpholinyl) ethoxy, 1,2-dihydroxyethylcarbonyl, 3-methoxypropoxy, 1-pyrrolidinyl, PhSO₂NH-, C_1-4alkyl-SO₂NH-, cyclopropyl-SO₂NH-, p-CH₃C._gH.₄SO₂NH-, NH₂SO₂-, C_1-4alkylNHSO2-, (C._1-4alkyl)₂NSO₂-, C₁.₄alkyl-NHC (O) -, C._1-4alkyl-C (O) -, C._1-4alkyl-SO₂-, 4-morpholinyl-C₁₄alkoxy or 1-pyrrolidinylcarbonyl, each of which is optionally substituted with from 1 to 2 C_1-4alkyl. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

PZ / 5321 / AG

EP 2 935 248 B1

[0116] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is aryl optionally substituted with: (i) 1 to 3 R.sup.⁹; or two adjacent R.⁹ on R⁷and together with the atoms to which they are attached form a 5- or 6-membered ring having 0 to 2 additional heteroatoms selected from O, N, or S, and optionally substituted with 1 to 3 R^d; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶ or R¹⁷; or (vi) from 1 to 3 R¹⁸in which each of R.⁷, R⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, -NHCH3, -N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, CH3NHC (O) -, CH3C (O ) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2 -, (CH3) 2S (O) 2NH or CH3SO2. In some cases, R.⁷ is phenyl or perdeuterated phenyl (C6D5), each of which is optionally substituted with 1 to 3 R¹⁶ or R¹⁷; or from 1 to 3 R¹⁸, each with R.¹⁶, R¹⁷ and r¹⁸ is then, optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. In other cases, R.⁷ is phenyl optionally substituted with from 1 to 3 substituents independently selected from F, Cl, CH3, -OCH₃, CF₃, CF₃O-, -CFH₂, CF₂H, CHF₂O-, CH₂FO-, -NHCH₃, -N (CH₃)₂, -CN, 4-morpholinyl, 4-morpholinylmethyl, 1-piperidinyl, 4-methyl-1-piperazinyl, 1-pyrrolidinyl, 1-pyrrolidinylcarbonyl, 4-morpholinylcarbonyl, 1-piperidinylcarbonyl, 4-methyl-1-piperazinylcarbonyl, 1-methyl-1-piperazinylcarbonyl, 1-pyrrolidinyl cyclopropyl, cyclopropylcarbonyl, 4morpholinylethyl, CH3SO2, CH3SO2NH-, CH3C (O) -, 4-morpholinylmethylcarbonyl, 1,2-dihydroxypropanoyl, (CH₃)₂NC (O) - or methoxycarbonylamino, each of which is optionally substituted with 1-2 groups independently selected from C_1-6alkyl, C._1-4alkoxy, 4-morpholinyl, or 4-morpholinylmethyl. In other cases, R.⁷ is 1-naphthyl or 2-naphthyl, each of which is optionally substituted with 1 to 3 R¹⁶ or R¹⁷; or from 1 to 3 R¹⁸, each with R.¹⁶, R¹⁷ and r¹⁸ is then, optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. In some embodiments, the hydrogen atoms in R.⁷ are optionally replaced by 1 to 12 or 1 to 8 or 1 to 6 or 1 to 3 or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 deuterium atoms with at least 52, 5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium. In some embodiments, each hydrogen in R⁷ is optionally replaced with a deuterium atom with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0117] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ Means 1H-4-benzotriazolyl, 1H-5-benzotriazolyl, 1H-4-benzimidazolyl, 1H-5-benzimidazolyl, 1H-4-indazolyl, 1H-5-indazolyl, 1H-6-indazolyl, 1H7-indazolyl, 1H-4-indolyl , 1H-5-indolyl, 1H-6-indolyl, 1H-7-indolyl, 2-oxo-6-indolinyl, 2-oxo-4-indolinyl, 2-oxo-5-indolinyl, 2-oxo-7-indolinyl, 1 , 2-benzoxazol-4-yl, 1,2-benzoxazol-5-yl, 1,2-benzoxazol-6-yl, 1,2-benzoxazol-7-yl, 1,3-benzoxazol-4-yl, 1,3 -benzoxazol-5-yl, 1,3-benzoxazol-6-yl, 1,3-benzoxazol-7-yl, 1,2-benzothiazol-4-yl, 1,2-benzothiazol-5-yl, 1,2-benzothiazol-6-yl, 1,2-benzothiazol-7-yl, 5-quinolinyl, 6-quinolinyl, 7-quinolinyl, 8-quinolinyl, 5-isoquinolinyl, 6- isoquinolinyl, 7-isoquinolinyl, 8-isoquinolinyl, 5PZ / 5321 / AG

Cinnolinyl, 6-cinnolinyl, 7-cinnolinyl, 8-cinnolinyl, 5-quinazolinyl, 6-quinazolinyl, 7-quinazolinyl, 8-quinazolinyl, 5-quinoxalinyl, 6-quinoxalinyl, 7-quinoxalinyl, 8-quinoxalinyl -indanyl, 5-indanyl, 5-tetralinyl, 6-tetralinyl, 1,3-dihydroisobenzofuran-4-yl, 1,3-dihydroisobenzofuran-5-yl, 2,3-dihydrobenzofuran-4-yl, 2,3-dihydrobenzofuran-5-yl , 2,3-dihydrobenzofuran-6-yl, 2,3-dihydrobenzofuran-7-yl, 1,3-dihydroisobenzothiophen-4-yl, 1,3-dihydroisobenzothiophen-5-yl, 2,3-dihydrobenzothiophen-4-yl, 2,3-dihydrobenzothiophen-5-yl, 2,3-dihydrobenzothiophen-6-yl, 2,3-dihydrobenzothiophen-7-yl, 4-indolinyl, 5-indolinyl, 6-indolinyl, 7-indolinyl, 5-isochromanyl, 6-isochromanyl, 7-isochromanyl, 8-isochromanyl, 5-chromanyl, 6-chromanyl, 7-chromanyl, 8-chromanyl, 2,3-dihydro-1,3-benzothiazo-4-yl, 2,3-dihydro-1,3-benzothiazo-5-yl, 2,3-dihydro-1,3-benzothiazo-6-yl, 2,3-dihydro-1,3-benzothiazo-7-yl, 2, 3-dihydro-1,2-benzothiazo-4-yl, 2,3-dihydro-1,2-benzothiazo-5-yl, 2,3-dihydro-1,2-benzothiazo-6-yl, 2,3-dihydro-1,2-benzothiazo-7-yl, 2,3-dihydro-1,3-benzoxazol-4-yl, 2,3- dihydro-1,3-benzoxazol-5-yl, 2,3-dihydro-1,3-benzoxazol-6-yl, 2,3-dihydro-1,3-benzoxazol-7-yl, 2,3-dihydro-1, 2-benzoxazol-4-yl, 2,3-dihydro-1,2-benzoxazol-5-yl, 2,3-dihydro-1,2-benzoxazol-6-yl, 2,3-dihydro-1,2-benzoxazol- 7-yl, 4-benzofuranyl, 5-benzofuranyl, 6-benzofuranyl, 7-benzofuranyl, 4-benzo [b] thiophenyl, 5-benzo [b] thiophenyl, 6-benzo [b] thiophenyl, 7-benzo [b] thiophenyl, 4-benzo [c] thiophenyl, 5-benzo [c] thiophenyl, 2,3-dihydro-1,4-benzodioxin-5-yl, 1,3-benzodioxol-4-yl, 1,3-benzodioxol-5-yl, indanyl, 1,2-benzoxazole- 4-yl, 1,2-benzoxazol-5-yl, 1,2-benzoxazol-6-yl, 1,2-benzoxazol-7-yl, 1,3-benzoxazol-4-yl, 1,3-benzoxazol-5- il, 1,3-benzoxazol-6-yl or 1,3-benzoxazol-7-yl, each of which is optionally substituted with: (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, PH (= O) CH₃, -P (= O) (CH₃)₂, -PH (= O) OCH₃, -P (= O) (OCH₃)₂, -OP (= O) (OCH₃)₂, -N (CH₃)₂, -ch₂f, CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0118] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is heteroaryl optionally substituted with: (i) 1 to 3 R &lt;3&gt; groups⁹; or two adjacent R.⁹ on R⁷together with the atoms to which they are attached form a 5- or 6-membered ring having 0 to 2 additional heteroatoms selected from O, N or S, and optionally substituted with 1 to 3 R^d; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH₃, C_1-6alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, -N (CH₃)₂, -PH (= O) CH₃, -P (= O) (CH₃)₂, PH (= O) OCH₃, -P (= O) (OCH₃)₂, -OP (= O) (OCH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F,

PZ / 5321 / AG

EP 2 935 248 B1

CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH3) 2S (O) 2NH- or CH3SO2. In some cases, R.⁷ is an optionally substituted 5- or 6-membered heteroaryl. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0119] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is 5-pyrimidinyl, 2-pyrimidinyl, 4-pyrimidinyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrazinyl, 2-pyridazinyl, 3-pyridazinyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-imidazolyl, 4 -imidazolyl, 1-pyrazolyl, 2-pyrazolyl, 3-pyrazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl , 3-isothiazolyl, 4-isothiazolyl, 5-isothiazolyl, 1,2,3-triazol-1-yl, 1,2,3-triazol-2-yl, 1,2,3-triazol-3-yl, 1 , 2,3-triazol-4-yl, 1,2,3-triazol-5-yl, 1,2,4-triazol-1-yl, 1,2,4-triazol-2-yl, 1,2,4-triazol-3-yl, 1,2,4-triazol-4-yl, 1,2, 4-triazol-5-yl, 1-oxa-2,3-diazol-4-yl, 1oxa-2,3-diazol-5-yl, 1-oxa-2,4-diazol-3-yl, 1- oxa-2,4-diazol-5-yl, 1-oxa-2,5-diazol-3-yl, 1-oxa-2,5-diazol-4-yl, 1-thia-2,3-diazol-4- yl, 1-thia-2,3-diazol-5-yl, 1-thia-2,4-diazol-3-yl, 1-thia-2,4-diazol-5-yl, 1-thia-2, 5-diazol-3-yl, 1-thia-2,5-diazol-4-yl, 1-tetrazolyl, 3-tetrazolyl, 1H-5-tetrazolyl, 3H-5-tetrazolyl, 2-furanyl, 3-furanyl, 2-thiophenyl or 3-thiophenyl, each of which is optionally substituted with: (i) 1 to 3 R.sup.⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, γ6alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, NHCH3, - N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -PH (= O) CH₃, -P (= O) (CH₃)₂, -PH (= O) OCH₃, -P (= O) (OCH₃)₂, OP (= O) (OCH₃)₂, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0120] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ selected from 1-benzotriazolyl, 1-benzimidazolyl, 1H-2-benzimidazolyl, 1-indazolyl, 1H-3-indazolyl, 1-indolyl, 1H-2-indolyl, 1H3-indolyl, 1,2-benzoxazol-3-yl , 1,3-benzoxazol-2-yl, 1,2-benzothiazol-3-yl, 1,3-benzothiazol-2-yl, 2-quinolinyl, 3-quinolinyl, 4-quinolinyl, 1-isoquinolinyl, 3-isoquinolinyl , 4-isoquinolinyl, 3-cinnolinyl, 4-cinnolinyl, 2-quinazolinyl, 4-quinazolinyl, 2-quinoxalinyl, 2-benzofuranyl, 3-benzofuranyl, 2-benzo [b] thiophenyl, 3-benzo [b] thiophenyl or 1-benzo [c] thiophenyl, each of which is optionally substituted with: (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. All other Y variables¹, Y¹, Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0121] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ are chosen from:

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0009.tif" />

<img file="PL2935248T3_D0010.tif" />

N or

<img file="PL2935248T3_D0011.tif" />

each of which is optionally substituted with (i) 1 to 3 R &lt;3&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, N (CH₃)₂, -CH₂F, -PH (= O) CH₃, -P (= O) (CH₃)₂, -PH (= O) (OC_1-6alkyl), -P (= O) (OC_1-6alkyl)₂, -OP (= O) (

OC_1-6alkyl)₂, -CHF₂, CF₃, -OCF3, -OCHF2, -OCH2F, CH₃C (O) -, CH₃C (O) O-, CH3OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂, where the wavy lines indicate the point of attachment to the rest of the molecule. Mark

<img file="PL2935248T3_D0012.tif" />

means that R.⁷ can be attached to the remainder of the molecule at any of the available positions of the R substituent⁷ shown above. For example,

<img file="PL2935248T3_D0013.tif" />

it is intended to include 1-indolizinyl, 2-indolizinyl, 3-indolizinyl, 4-indolizinyl, 5-indolizinyl, 6indolizinyl, 7-indolizinyl and 8-indolizinyl (i.e., the substituents may be on 1, 2, 3, 5, 6, 7 or 8 positions of the indolizine ring).

[0122] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ are chosen from:

<img file="PL2935248T3_D0014.tif" />

or each of which is optionally substituted with (i) 1 to 3 R.sup.⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸substituents, each of R⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then is possibly

PZ / 5321 / AG

Substituted with 1 to 3 R¹⁹ independently selected from -CN, F, Cl, I, OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, NH₂, -NHCH3, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF2, -OCH2F, CH₃C (O) -, CH₃C (O) O-, PH (= O) CH₃, -P (= O) (CH₃)₂, -PH (= O) (OC_1-6alkyl), -P (= O) (OC_1-6alkyl)₂, -OP (= O) (OC_1-6alkyl)₂,

CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH3SO2, where the wavy line indicates the point of attachment to the rest of the molecule. The designation means that R⁷ can be attached to the remainder of the molecule at any of the available positions of the R substituent⁷ shown above. For example,⁷ h,, ¢ .- /, .. N

XX ... .I. x

5'Ν '' T is intended to include 1H-pyrrolo [3,2-b] pyridin-1-yl, 1H-pyrrolo [3,2-b] pyridin-2-yl, 1H-pyrrolo [3,2-b] ] pyridin-3-yl, 1H-pyrrolo [3,2-b] pyridin-5-yl, 1H-pyrrolo [3,2-b] pyridin-6-yl and 1H-pyrrolo [3,2-b] pyridin-7 -yl (i.e., the substituents may be at the 1,2,3, 5, 6 or 7 positions of the pyrrolo [3,2-b] pyridine ring). All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0123] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ are chosen from:

<img file="PL2935248T3_D0015.tif" />

Each of which is optionally substituted with (i) 1 to 3 R &lt;1&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R^{15; or (}v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸substituents, each of R⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, OCH₃, C_1-6alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, PH (= O) CH₃, -P (= O) (CH₃)₂, -PH (= O) (OC_1-6alkyl), -P (= O) (OC_1-6alkyl)₂, -OP (= O) (OC_1-6alkyl)₂, -OH, NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂, where the wavy line indicates the point of attachment to the rest of the molecule. Mark

PZ / 5321 / AG

EP 2 935 248 B1 means that R⁷ can be attached to the remainder of the molecule at any of the available positions of the R substituent⁷ shown above. For example,

<img file="PL2935248T3_D0016.tif" />

it is intended to include 5H-pyrrolo [3,2-c] pyridazin-3-yl, 5H-pyrrolo [3,2-c] pyridazin-4-yl, 5H-pyrrolo [3,2c] pyridazin-5-yl, 5H -pyrrolo [3,2-c] pyridazin-6-yl, 5H-pyrrolo [3,2-c] pyridazin-7-yl (i.e., the substituents may be at the 3, 4, 5, 6 or 7 position of the 5H ring -pyrrolo [3,2-c] pyridazine). All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0124] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ are chosen from:

<img file="PL2935248T3_D0017.tif" />

each of which is optionally substituted with (i) 1 to 3 R &lt;3&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, - NHCH3, -N (CH3) 2, CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF2, -OCH2F, CH₃C (O) -, CH₃C (O) O -, - PH (= O) CH₃, -P (= O) (CH₃)₂, PH (= O) (OC_1-6alkyl), -P (= O) (OC_1-6alkyl)₂, -OP (= O) (OC_1-6alkyl)₂, CH₃OC (O) -, CH3NHC (O) -,

CH₃C (O) NH-, (CH₃)₂NC (O) -, CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂, where the wavy line indicates the point of attachment to the rest of the molecule. The designation means that R⁷ can be attached to the remainder of the molecule at any of the available positions of the R substituent⁷ shown above. For example,

<img file="PL2935248T3_D0018.tif" />

PZ / 5321 / AG

Is intended to include 5H-pyrrolo [3,2-c] pyrimidin-2-yl, 5H-pyrrolo [3,2-c] pyrimidin-4-yl, 5H-pyrrolo [3.2c] pyrimidine- 5-yl, 5H-pyrrolo [3,2-c] pyrimidin-6-yl and 5H-pyrrolo [3,2-c] pyrimidin-7-yl (i.e., substituents can be on 2, 4, 5, 6 or the 7 position of a 5H-pyrrolo [3,2-c] pyrimidine ring). All other Y variables¹, Y², Y³,

R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0125] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ are chosen from:

<img file="PL2935248T3_D0019.tif" />

or each of which is optionally substituted with (i) 1 to 3 R.sup.⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF2, -OCH2F, CH₃C (O) -, -PH (= O) CH₃, -P (= O) (CH₃)₂, PH (= O) (OC_1-6alkyl), -P (= O) (OC_1-6alkyl)₂, -OP (= O) (OC_1-6alkyl)₂, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O), CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂, where the wavy line indicates the point of attachment to the rest of the molecule. The designation means that R⁷ can be attached to the remainder of the molecule at any of the available positions of the R substituent⁷ shown above. For example,

<img file="PL2935248T3_D0020.tif" />

it is intended to include 5H-pyrrolo [2,3-b] pyrazin-2-yl, 5H-pyrrolo [2,3-b] pyrazin-3-yl, 5H-pyrrolo [2,3-b] pyrazin-5-yl, 5H -pyrrolo [2,3-b] pyrazin-6-yl, 5H-pyrrolo [2,3-b] pyrazin-7-yl, (i.e. the substituents may be at the 2, 3, 5, 6 or 7 position of the ring 5H-pyrrolo [2,3-b] pyrazine). All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein. [0126] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is cycloalkyl or cycloalkenyl, each of which is optionally substituted with: (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with from 1

PZ / 5321 / AG

Up to 3 R¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0127] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ means cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 1-cyclopentenyl, 3-cyclopentenyl, 4-cyclopentenyl, 1-cyclohexenyl, 3-cyclohexenyl, 4-cyclohexenyl, 1-cyclohexenyl, 1-octenyl, 1-octenyl, 1-octenyl , 4-cyclohexadien-3-yl or cyclooctatetraene, each of which is optionally substituted with: (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. In some cases, R.⁷ is cyclopentenyl, cyclohexenyl or cyclopropyl, each of which is optionally substituted with (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸then optionally substituted with 1 to 3 R.sup.¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and index m and m of formula (IV) are as defined in any of the embodiments as described herein.

[0128] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is heterocycloalkyl, optionally substituted with: (i) 1 to 3 R &lt;3&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0129] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is 1-aziridinyl, 2-aziridinyl, 1-1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 2,3-dihydro-1H-pyrrol-1-yl, 2,3 -dihydro-1H-pyrrole-2-yl, 2,3-dihydro-1H-pyrrol-3-yl, 2,3-dihydro-1H-pyrrole-4-yl, 2,3-dihydro-1H-pyrrol-5-yl , 2,5-dihydro-1H-pyrrol-1-yl, 2,5-dihydro-1H-pyrrole-2-yl, 2,5-dihydro-1H-pyrrol-3-yl, 2,3-dihydro-1Himidazole -1-yl, 2,3-dihydro-1H-imidazol-2-yl, 2,3-dihydro-1H-imidazol-4-yl, 2,3-dihydrothiazol-2-yl, 2,3-dihydrothiazol-4-yl , 2,3-dihydrothiazol-5-yl, 2,3-dihydrofuran-2-yl, 2,3-dihydrofuran-3-yl, 2,3-dihydrofuran-4-yl, 2,3-dihydrofuran-5-yl, 2,5-dihydrofuran-2-yl, 2,5-dihydrofuran-3-yl, 2,3-dihydropyran-2-yl, 2,3-dihydropyran-3-yl, 2,3-dihydropyran-4-yl, 2, 3-dihydropyran-5-yl, 2,3-dihydropyran-6-yl, 3,6-dihydro-2H-pyran-2-yl, 3,6-dihydro-2H-pyran-3-yl, 3,6-dihydro 2H-pyran-4-yl, 3,6-dihydro-2H-pyran-5-yl, 3,6-dihydro-2H-pyran-6-yl, 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl, 1-piperazinyl, 2-piperazinyl, 2-morpholinyl, 3-morpholinyl, 4-morpholinyl, 1,2,3,6-tetrahydropyridin-1-yl, 1,2,3,6-tetrahydropyridin-1-yl, 1,2,3,6-tetrahydropyridin-2-yl, 1,2,3,6-tetrahydropyridin-3-yl, 1,2,3,6-tetrahydropyridin-4-yl, 1,2,3,6-tetrahydropyridin-5-yl or 1,2,3,6-tetrahydropyridin- 6-yl each of which is optionally substituted with: (i) 1 to 3 R &lt;1&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵,

PZ / 5321 / AG

EP 2 935 248 B1

R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. In some cases, R.⁷ is 1-aziridinyl, 2-aziridinyl, 2,3-dihydro-1H-pyrrol-5-yl, 2,5-dihydro-1H-pyrrol-3-yl, 2,3-dihydro-1H-imidazol-4-yl , 2,3-dihydrofuran-4-yl, 2,3-dihydrofuran-5-yl, 2,3-dihydrofuran-4-yl, 2,3-dihydrofuran-5-yl, 2,5-dihydrofuran-3-yl, 2 , 3-dihydropyran-5-yl, 2,3-dihydropyran-6-yl, 3,6-dihydro-2H-pyran-4-yl, 3,6-dihydro-2H-pyran-5-yl, 1,2,3 , 6-tetrahydropyridin-4-yl or 1,2,3,6-tetrahydropyridin-5-yl, each of which is optionally substituted with (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. In other cases, R.⁷ means 1,2,3,6-tetrahydropyridin-4-yl or 1,2,3,6-tetrahydropyridin-5-yl, 2,5-dihydro-1H-pyrrol-1-yl, 2,5-dihydro-1H-pyrrolo -2-yl or 2,5-dihydro-1H-pyrrol-3-yl, each of which is optionally substituted with (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0130] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is C2-4 alkenyl or C2-4alkynyl, each of which is optionally substituted with from: each of which is optionally substituted with (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0131] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is vinyl, ethynyl, 1-propynyl, 3-fluoropropynyl, or cyclopropylethynyl, each of which is optionally substituted with: (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ the substituent then optionally substituted with 1 to 3 R &lt;1&gt; substituents¹⁹. In some cases, R.⁷is ethynyl, 1-propynyl, 3-fluoropropynyl or cyclopropylethynyl, each of which is optionally substituted with: (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

PZ / 5321 / AG

EP 2 935 248 B1

[0132] In some embodiments of the compounds of formula (IV) or (I'a), R⁷ is halogen, C1-4alkyl, CN, -C1-2alkyl-R^k, -C (O) -R^k, -C (O) NHR^k, -C (O) NO^kR^k, -NHC (O) R^k, -C (O) OR^k, -OC (O) R^k, -SO2R^k, NHSO2R^k, -SO2NHR^k, -SO2NR^kR^kwhere each R.^k is independently C1-6alkyl, C3-8cycloalkyl, phenyl, or heterocycloalkyl, wherein R^k then optionally substituted with 1 to 3 R &lt;2&gt; groups^d. In some cases, R.^k is C1-6alkyl, C3-gcycloalkyl, phenyl, 4-morpholinyl, 1-piperidinyl, 3-piperidinyl, 4-piperidinyl, 1-piperazinyl or 2-piperazinyl, wherein R^k then optionally substituted with 1 to 3 R &lt;2&gt; groups^d. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0133] In some embodiments of compounds of formula (IV) or (I'a), two adjacent R⁷ together with the atoms to which they are attached form a 5- or 6-membered ring having 0 to 2 heteroatoms selected from N, O or S, the ring being optionally substituted with (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. In some embodiments, the 5- or 6-membered ring is selected from cyclopentane, cyclohexane, pyrrolidine, pyrrole, pyrazole, imidazole, oxazole, isoxazole, thiazole, isothiazole, tetrahydrofuran, tetrahydropyran, 1,4-dioxane, pyridine ring systems, pyrazine, piperidine, piperazine, pyrimidine or pyridazine, each of which is optionally substituted with 1 to 3 R¹⁶; or from 1 to 3 R¹⁷; or from 1 to 3 R¹⁸, with R.¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ and the index m of the formulas (I'a) or (IV) have the meanings defined in any of the embodiments as described herein.

[0134] In some embodiments of compounds of formula (IV) or (I'a), Ring A is an optionally substituted 5-membered fused heterocyclic aromatic ring having 1 to 3 heteroatoms as ring members selected from O, N or S; or an optionally substituted fused benzene ring; or when ring A is substituted with two or more substituents, two such substituents, together with the atoms to which they are attached, optionally form a 5- or 6-membered ring. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ the formulas (I'a) or (IV) are as defined in any of the embodiments as described herein.

[0135] In any embodiment of the compounds of formulas (I'a) or (IV), the hydrogen atoms in R⁷ are optionally replaced by 1 to 12 or 1 to 8 or 1 to 6 or 1 to 3 or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 deuterium atoms with at least 52, 5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium. In some embodiments, each hydrogen in R⁷ is optionally replaced with a deuterium atom with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium.

[0136] In certain embodiments of compounds of formulas (I'a) or (IV), Ring A is a 5-membered fused heterocyclic aromatic ring having 1 to 3 heteroatoms as ring members selected from O, N or S ; or condensed

PZ / 5321 / AG

A benzene ring. All other Y variables¹, Y², Y³, R³, R⁴, R⁵ of formula (IV) are as defined in any of the embodiments as described herein. In some cases, ring A is a fused ring such as a pyrrole, pyrazole, 1,2,3-triazole, 1,2,4-triazole, imidazole, thiophene, or benzene.

[0137] In some embodiments of compounds of formula (IV), the group:

<img file="PL2935248T3_D0021.tif" />

or are selected each of which is optionally substituted with 1 to 2 R &lt;2&gt; groups⁷ and a wavy line indicates the point of attachment to the rest of the molecule. In some implementations, the group

<img file="PL2935248T3_D0022.tif" />

is substituted with 1 to 2 R.sup.⁷. In one implementation, a group

<img file="PL2935248T3_D0023.tif" />

means a group

<img file="PL2935248T3_D0024.tif" />

(pyrrolo [2,3-b] pyridine) optionally substituted with 1 to 2 R⁷. In other implementations, the group

<img file="PL2935248T3_D0025.tif" />

means a group

<img file="PL2935248T3_D0026.tif" />

(pyrazolo [1,5-a] pyrimidine) optionally substituted with 1 to 2 R⁷. In other implementations, the group

<img file="PL2935248T3_D0027.tif" />

means a group

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0028.tif" />

(thieno [2,3-b] pyridine) optionally substituted with 1 to 2 R⁷. In still other realizations, the group

<img file="PL2935248T3_D0029.tif" />

means a group

<img file="PL2935248T3_D0030.tif" />

(pyrazolo [3,4-b] pyridine group) optionally substituted with R⁷. In still other realizations, the group

<img file="PL2935248T3_D0031.tif" />

means a group

<img file="PL2935248T3_D0032.tif" />

(quinoline) optionally substituted with 1 to 2 R⁷. All other variables of R.³, R⁷ and r⁵ of formula (IV) are as defined in any of the embodiments as described herein. In some embodiments, the hydrogen atoms in the group

<img file="PL2935248T3_D0033.tif" />

are optionally replaced by 1 to 6 deuterium atoms with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium. In some embodiments, each hydrogen in the group

<img file="PL2935248T3_D0034.tif" />

is optionally replaced with a deuterium atom with at least 52.5%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 99.5% or 99.9% deuterium feed for each deuterium.

[0138] In some embodiments of the compounds of formula (IV), the group:

<img file="PL2935248T3_D0035.tif" />

are chosen from

<img file="PL2935248T3_D0036.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0037.tif" />

or each of which is optionally substituted with 1 to 2 R.sup.⁷ and a wavy line indicates the point of attachment to the rest of the molecule.

[0139] In certain embodiments of compounds of formulas (I '), (I'a), (I), (II) or (III), compounds of formula (V) are described herein:

<img file="PL2935248T3_D0038.tif" />

In some implementations, R.⁵ R is H, halogen, C 1-4 alkU, C 1-4 haloalkyl, C 14 haloalkoxy, cyclopropyl or only an electron pair; L.² is a bond, -CH2-, -C (O) - or SO2; R⁶ is alkyl, aryl or heteroaryl, each of which is optionally substituted with 1 to 3 R &lt;3&gt; groups⁹ independently selected from C1-6alkyl, C1-6 alkoxy, C2-6alkenyl, C26alkynyl, -X¹-aryl, aryl-C1-4alkyl-X¹-, heteroaryl-X¹-, heteroaryl-C1-4 alkyl-X¹-, C3-6cycloalkyl-X¹-, C3-6cycloalkyl-C1-4alkyl-X¹-, C3-6cycloalkcyl-X¹-, CH2 = CH-X¹-, C3-6cycloalkyl-C2_-4alkenyl-X¹-, C3-6cycloalkyl-C2-4alkynyl-X¹-, heterocyclyl-X¹-, heterocyclyl-C1-4alkyl-X¹- or R.⁸; or two adjacent R.⁹ together with the atoms to which they are attached form a 5- or 6-membered fused ring having 0 to 2 heteroatoms as ring members selected from O, N or S. In some cases, R¹ is H or just a pair of electrons. In one case, R.¹ is H. Otherwise, Y¹ is N and R¹it only means a pair of electrons. Other Y variables¹, Y², Y³, R³, R⁴, L.¹ and L.² in formula (V) are as defined in any of the embodiments as described herein. In some embodiments of the compounds of Formula (V), L.¹ is -C (O) NR⁵-, in which the carbonyl group in L.¹ is covalently bonded to the pyrazole ring and the nitrogen atom in L.¹ is covalently linked to the 6-membered aromatic ring in formula (V).

[0140] In certain embodiments of compounds of formulas (I '), (I'a), (I), (II), (III), or (V), compounds of formula (V') are described herein:

<img file="PL2935248T3_D0039.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

In some implementations, R.⁵ R is H, halogen, C 1-4 alkyl, C 1-4 haloalkyl, C 14 haloalkoxy, cyclopropyl or only an electron pair; L.² is a bond, -CH2-, -C (O) - or SO2; R⁶ is alkyl, aryl or heteroaryl, each of which is optionally substituted with 1 to 3 R &lt;3&gt; groups⁹ independently selected from C 1-6 alkyl, C 1-6 alkoxy, C 2-6 alkenyl, C 26 alkynyl, -X1-aryl, aryl-C 1-4 alkyl-X¹-, heteroaryl-X1-, heteroaryl-C1-4 alkyl-X1-, C3-6cycloalkyl-X¹-, C36cycloalkyl-C1-4alkyl-X¹-, C3-6cycloalkenyl-X¹-, CH2 = CH-X1-, C3-6cycloalkyl-C2-4alkenyl-X¹-, C36cycloalkyl-C2-4alkynyl-X¹-, heterocyclyl-X1-, heterocyclyl-C1_-4alkyl-X¹- or R.⁸; or two adjacent R.⁹ together with the atoms to which they are attached form a 5- or 6-membered fused ring having 0 to 2 heteroatoms as ring members selected from O, N or S. In some cases, R¹ is H or just a pair of electrons. In one case, R.⁵ is H. Otherwise, Y¹ is N and R⁵ it only means a pair of electrons. Other Y variables¹, Y², Y³, R³, R⁴ and L.² of formula (V ') are as defined in any of the embodiments as described herein.

[0141] In some embodiments of the compounds of formula (V) or (V '), R⁶ is aryl or heteroaryl, each of which is optionally substituted with (i) 1 to 3 R &lt;3&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, - NHCH3, N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, CH3NHC (O) -, CH3C (O) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2 -, (CH3) 2S (O) 2NH- or CH3SO2. In some cases, R.⁶ is phenyl, 1-naphthyl or 2-naphthyl, each of which is optionally substituted with (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸then optionally substituted with 1 to 3 R.sup.¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, - NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, Oh₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH3) 2NS (O) 2 -, (CH3) 2S (O) 2NH- or CH3SO2. In some cases, R.⁶ is heteroaryl having 1 to 3 heteroatoms as ring members selected from O, N, or S. In other cases, R⁶ is heteroaryl having 1 to 2 heteroatoms as ring members selected from the group atom N. Other variables Y¹, Y², Y³, R¹, R³, R⁴, R⁵ and L.² of formula (V) are as defined in any of the embodiments as described herein.

[0142] In some embodiments of the compounds of formula (V) or (V '), R⁶ is phenyl which is optionally substituted with (i) 1 to 3 R &lt;3&gt; groups⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to

PZ / 5321 / AG

Of R substituents^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸; or (viii) from 1 to 3 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. Other Y variables¹, Y², Y³, R¹, R³, R⁴, R⁵ and L.² of formula (V) are as defined in any of the embodiments as described herein.

[0143] In some embodiments of the compounds of formula (V) or (V '), R⁶ is 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 2-pyrazinyl, 3-pyridazinyl or 4-pyridazinyl, each of which is optionally substituted with from (i) from 1 up to 3 R substituents⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸; or (viii) from 1 to 3 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, OCH3, C1_-3alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH3SO2. Other Y variables¹, Y², Y³, R¹, R³, R⁴, R⁵ and L.² of formula (V) or (V ') are as defined in any of the embodiments as described herein.

[0144] In certain embodiments of compounds of formulas (I), (II), (III), (IV), (V) or (V '), and any sub-formulas thereof, R³ and r⁴ independently from each other are selected from H, halogen, C1-4 alkyl, C1-4 haloalkyl C1-4 haloalkoxy, cyclopropyl, phenyl , CN, CN-CH2-, C14alkoxy, Rg or only an electron pair; or R³ and r⁴ taken together with the atoms to which they are attached form an optionally substituted 5 to 8-membered ring having 0 to 2 heteroatoms as ring members selected from O, N or S; with R.^g means OH, -NH2, -NO₂, -C (O) OH, -C (S) OH, -CO) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, NHS (O)₂NH₂, -C (NH) NH₂, -OR^h, -SR^h, -OC (O) R^h, -OC (S) R^h, -C (O) R^h, -C (S) R^h, -C (O) OR^h, -C (S) OR^h, S (O) R^h, -S (O) 2R^h, -C (O) NH R^h, -C (S) NHR^h, -C (O) NO^hR^h, -C (S) NO^hR^h, -S (O) 2NHR^h, -S (O) 2NR^hR^h, C (NH) NHR^h, -C (NH) NR^bR^b, -N HC (O) R^h, -NHC (S) R^h, -NR^hC (O) R^h, -NR^hC (S) R^h, -NHS (O) 2R^h, NO^hS (O) 2R^h, -NHC (O) NHR^h, -NHC (S) NHR^h, -NR^hC (O) NH2, -NR^hC (S) NH2, -NR^hC (O) NHR^h, NO^hC (S) NHR^h, -NHC (O) NR^hR^h, -NHC (S) NR^h R^h, -NR^hC (O) NO^hR^h, -NR^hC (S) NO^hR^h, -NHS (O) 2NHR^h, NO^hS (O)₂NH₂, -NR^hS (O) 2NHR^h, -NHS (O) 2NR ^hR^h, -NR^hS (O)₂NO^hR^h, -NHR^h or -NR^hR^hwhere each R.^h is independently H or C1-2alkyl. In some implementations, R.³ and r⁴ they are not both hydrogen. In some cases, R.³ and r⁴ independently from each other are selected from H, C1-3alkyl, halogen, CN, cyclopropyl, CN-CH2-, phenyl, cyclopropylmethyl, C1

PZ / 532i / AG

C 1-6 haloalkoxy, C 1-6 haloalkoxy, C 1-6 haloalkoxy, or Rg. In some implementations, R.³ and r⁴ are independently of each other halogen, C1-6alkyl, C1-6alkoxy, cyclopropyl, -CN, C1-4 haloalkyl, or C1-4 haloalkoxy. In other implementations, R.³ and r⁴ are independently selected from Br, Cl, methyl, ethyl, cyclopropyl, -CN, CF3, CHF2, CH2F, -OCH3, -OCF3, -OCHF2 or -OCH2F, CNCH2-, NH2C (O) -, CH3NHCO- or CH3C (O) NH-. In other cases, R.³ and r⁴ are independently selected from H, -CH3, -CD3, -CgD₅, -CF₃, -CHF₂, -CH₂F, -OCF₃, -OCHF2, -OCH2F halogen, CN, cyclopropyl, CN-CH2-, phenyl, cyclopropylmethyl or -OCH3. In still other cases, R.³ and r⁴ independently of each other are H, F, Cl, Br, NH2C (O) -, CH3, CD3, Et, cyclopropyl, CN, CH2CH2- or CH3C (O) NH-. In other cases, R.³ and r⁴ are each independently selected from H, -OH, -NH2, -NO₂, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, S (O)₂NH₂ -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OC (O) R^h, -C (O) R^h, -C (O) OR^h, S (O) R^h, -S (O) 2R^h, -C (O) NHR^h, -C (O) NO^hR^h, -C (S) NO^hR^h, -S (O) 2NH^h, -S (O) 2NR^hR^h, -C (NH) NHR^h, C (NH) NO^hR^h, -NH (O) R^h, -NHC (S) R^h, -NR^hC (O) R^h, -NHC (O) NHR^h, -NHC (S) NHR^h, -NR^hC (O) NH2, NR^hC (O) NHR^h, -NHC (O) NR^hR^h, -NR^hC (O) NO^hR^h, -NHS (O) 2NHR^h, -NR^hS (O) 2NH₂, -NR^hS (O) 2NHR^h, NHS (O) 2NR^hR^h, -NR^hS (O) 2NR^hR^h, -NHR^h or -NR^hR^hwhere R.^h is H or C1-6alkyl. In some implementations, R.³ and r⁴ are H. In other embodiments, R.³ is H and R⁴represents a substituent other than hydrogen as described herein. In still other realizations, R.⁴ is H and R³ represents a substituent other than hydrogen as described herein. In other implementations, both R.³ and r⁴ represent a non-hydrogen substituent as described herein. The other variables and substituents are as defined in any of the embodiments as described herein.

[0145] In certain embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III), (IV), (V) or (V'), or any sub-formulas thereof, Y^and is C, Y² stands for CRⁱ⁰ and Y³ are CH. In other implementations, Y^and is C and Y² and Y³ are N. In still other embodiments, Y^and is C, Y² is N and Y³ means CH. In still other realizations, Y^and is C, Y²stands for CRⁱ⁰ and Y³ is N. In other embodiments, Y^and is N, Y² is N and Y³is N. In other embodiments, Y^and is N, Y² stands for CRⁱ⁰ and Y³. In other implementations, Y^and is N, Y² stands for CRⁱ⁰ and Y³ is N. In other embodiments, Y^andis N, Y² stands for CRⁱ⁰ and Y³ means CH. In other implementations, Y^and is N, Y²is N and Y³ means CH. In some cases, R.ⁱ⁰ is H, CN, C 1-4 alkyl, halogen, C 1-4 haloalkyl, C 1-4 haloalkoxy, C 1-4 alkoxy. In one implementation, R.ⁱ⁰ is H. All other R variables^and, R², WITH^and, WITH², WITH³, WITH⁴, R³, R⁴, R⁵, L.^and or L.² are as defined in any of the embodiments as described herein.

[0146] In certain embodiments of the compounds of formula (I '), (I'a), (I), (II), (III), (IV), (V) or (V'), or any sub-formulas thereof, Y^and is C, Y³ means CH and Y² is H, C1-6alkyl, C1-6alkoxy, vinyl, ethynyl, phenyl-C1-4alkyl, heteroaryl-C1-4alkyl-, C3-8cycloalkyl-C1-4alkyl, C3-8cycloalkenyl-C1-4alkyl-, CH2 = CH-X²-, C3-gcycloalkyl-C2_-4alkenyl-X²-, C3_-gcycloalkyl-C2_-4alkynylPZ / 5321 / AG

EP 2 935 248 B1

X²-, heterocyclyl-C 1-4 alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹ or from 1 to 5 R^c or from 1 to 5 R^d or from 1 to 5 R^e. All other variables of R.¹, R², WITH¹, WITH², WITH³, WITH⁴, R³, R⁴, R⁵, L.¹ or L.² are as defined in any of the embodiments as described herein.

[0147] In certain embodiments of compounds of formulas (IV), (V), (V ') or any sub-formulas thereof, or in any embodiments of compounds of formulas (IV), (V), (V') as described herein, or any compounds as described in the examples, group

<img file="PL2935248T3_D0040.tif" />

can be in the tautomeric form:

<img file="PL2935248T3_D0041.tif" />

where the wavy line indicates the point of attachment to the rest of the molecule.

Sub-formulas (I '), (I'a), (I), (II), (III), (IV), (V) or (V')

[0148] In one embodiment of the disclosure, compounds of formulas (I '), (I), (II) or (III) have the sub-formulas (IIIa), (IIIb), (IIIc), (IIId) or (IIIe ):

<img file="PL2935248T3_D0042.tif" />

(Illd) or branches)

R variables and substituents³, R⁴, R⁷, L.¹, Y² and Y³ in the sub-formulas (IIIa), (IIIb), (IIIc), (IIId) or (IIIe) have the meanings defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II) or (III) and in any of the embodiments as disclosed herein. In some implementations, R.⁷ is as defined in any one of the embodiments of the compounds of formula (IV) as described herein. In some implementations, L.¹ has the meaning as defined in the embodiments of the compounds of formulas (I '), (I'a), (I) or (II) as disclosed herein. In some implementations, R.⁵ is H. In some cases, L¹ means NHSO2-, -SO2NH-, -NHC (O) NH-, -NHC (O) -, -CH₂O-, -OCH₂-, -C (O) NH-, -SO₂-, -C (O) O-, -C (O) -, C (= NH) NH- or -NHC (= NH) -. In some cases, L.¹ is -SO2NH-, -CH2O-, -OCH2- or C (O) NH-. In other cases, L.¹ is -C (O) NH-. In one embodiment, the disclosure provides compounds of Formula (IIIa). In another embodiment, the disclosure provides compounds of formula (IIIb). In another implementation,

PZ / 5321 / AG

The disclosure provides compounds of formula (IIIc). In another embodiment, the disclosure provides compounds of formula (IIId). In another embodiment, the disclosure provides compounds of formula (IIIe). In certain embodiments of compounds of formulas (IIIa), (IIIb), (IIIc), (IIId), or (IIIe), Y² and Y³ are CH. In other embodiments of the compounds of formulas (IIIa), (IIIb), (IIIc), (IIId) or (IIIe), Y² is N and Y³ means CH. In other embodiments of the compounds of formulas (IIIa), (IIIb), (IIIc), (IIId) or (IIIe), Y² stands for CR¹⁰where R.¹⁰ represents a substituent other than hydrogen as described herein for compounds of formulas (I '), (I'a), (I), (II), (III), (IV) (V) or (V') and Y³ means CH.

[0149] In a second group of embodiments of the disclosure, the compounds of formulas (I '), (I), (II), (III) or (IIIa) have the sub-formulas (IIIa-1), (IIIa-2), (IIIa -3), (IIIa-4), (IIIa-5), (IIIa-6), (IIIa-7) or (IIIa-8):

<img file="PL2935248T3_D0043.tif" />

(Hla-5) (HIa-6) (IHa-7) or (IUa-8)

The variables of R³, R⁴, L.¹, R¹⁰ and r⁷ are as defined in any one of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IIIa). In some implementations, R.⁷ is as defined in any one of the embodiments of the compounds of formula (IV) described herein. In some implementations, R.¹⁰ selected from C1-6alkyl, C1-6alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C14alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl- , CH2 = CH-X²-, C3-6cycloalkyl-C24alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S or -NH-. In other implementations, R.¹⁰ is CN, C 1-4 alkyl, halogen, C 1-4 haloalkyl, 4- haloalkoxy or C 1-4 alkoxy. In some embodiments of compounds of formulas (IIIa-1) through (IIIa-8), L.¹is -C (O) NH-, -SO2NH-, -NHSO₂-, -CH₂O- or -OCH₂-. In some embodiments of compounds of formulas (IIIa-1) through (IIIa-8), L.¹ is -C (O) NH-. In one embodiment, the disclosure provides a compound of formula (IIIa-1). In another embodiment, the disclosure provides a compound of formula (IIIa-2). In another embodiment, the disclosure provides a compound of formula (IIIa-3). In another embodiment, the disclosure provides a compound of formula (IIIa-4). In another embodiment, the disclosure provides a compound of formula (IIIa-5). In another embodiment, the disclosure provides a compound of formula (IIIa-6). In another embodiment, the disclosure provides a compound of formula (IIIa-7). In another embodiment, the disclosure provides a compound of formula (IIIa-8).

[0150] In a third group of embodiments of the disclosure, compounds of formulas (I '), (I), (II), (III), or (IIIb) have sub-formulas (IIIb-1), (IIIb-2), ( IIIb-3), (IIIb-4) or (IIIb-5):

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0044.tif" />

(IIIb-5)

The variables of R³, R⁴, R¹⁰, L.¹ and r⁷ are as defined in any one of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IIIb). In some implementations, R.⁷ is as defined in any one of the embodiments of the compounds of formula (IV) described herein. In some implementations, R.¹⁰ selected from C1-4alkyl, C1-4 alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C14alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl- , CH2 = CH-X²-, C3-6cycloalkyl-C24alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S or -NH-. In other implementations, R.¹⁰ is CN, C 1-4 alkyl, halogen, C 1-4 haloalkyl, C 1₄haloalkoxy or C_1-4alkoxy. In some embodiments of compounds of formulas (IIIb-1) through (IIIb-5), L.¹ is -C (O) NH-, -SO₂NH-, -NHSO₂-, -CH₂O- or -OCH₂-. In some embodiments of compounds of formulas (IIIb-1) through (IIIb-5), L.¹ is -C (O) NH-. In one embodiment, the disclosure provides a compound of formula (IIIb-1). In another embodiment, the disclosure provides a compound of formula (IIIb-2). In another embodiment, the disclosure provides a compound of formula (IIIb-3). In another embodiment, the disclosure provides a compound of formula (IIIb-4). In another embodiment, the disclosure provides a compound of formula (IIIb-5).

[0151] In a 4th group of embodiments of the disclosure, the compounds of formulas (I '), (I), (II), (III) or (IIIc) have sub-formulas (IIIc-1), (IIIc-2), (IIIc-3), (IIIc-4) or (IIIc-5):

<img file="PL2935248T3_D0045.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

The variables of R³, R⁴, R¹⁰ , L.¹ and r⁷ are as defined in any one of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IIIc). In some implementations, R.⁷ is as defined in any one of the embodiments of the compounds of formula (IV) described herein. In some implementations, R.¹⁰ selected from A-8alkyl, C 1-6 alkoxy, C 2 -6 alkenyl, C 2 -8 alkynyl, aryl C 1-4 alkyl-, heteroaryl-C 14 alkyl-, C 3-8 cycloalkyl-C 1-4 alkyl-, C 3-8 cycloalkenyl-C 1-4 alkyl -, CH2 = CH-X²-, C3-gcycloalkyl-C24alkenyl-X²-, C3-gcycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S or -NH-. In other implementations, R.¹⁰ is CN, C 1-4 alkyl, halogen, C 1-4 haloalkyl C 1-4 ₄haloalkoxy or C_1-4alkoxy. In some embodiments of compounds of formulas (IIIc-1) through (IIIc-5), L.¹ is -C (O) NH-, -SO₂NH-, -NHSO₂-, -CH₂O- or -OCH₂-. In some embodiments of compounds of formulas (IIIc-1) through (IIIc-5), L.¹ is -C (O) NH-. In one embodiment, the disclosure provides a compound of formula (IIIc-1). In another embodiment, the disclosure provides a compound of formula (IIIc-2). In another embodiment, the disclosure provides a compound of formula (IIIc-3). In another embodiment, the disclosure provides a compound of formula (IIIc-4). In another embodiment, the disclosure provides a compound of formula (IIIc-5).

[0152] In a 5th group of embodiments of the disclosure, compounds of formulas (I '), (I), (II), (III) or (IIId) have sub-formulas (IIId-1), (IIId-2), (IIId-3), (IIId-4) or (IIId-5):

<img file="PL2935248T3_D0046.tif" />

(IIId-4) (IIId-5)

The variables of R³, R⁴, R¹⁰ and L.¹ are as defined in any one of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IIId). In some implementations, R.¹⁰ is selected from N -6alkyl, C 1-6 _galkoxy, C._2ndalkenyl, C._2ndalkynyl, aryl-C_1-4alkyl-, heteroaryl-C_1-4alkyl-, C._3rdcycloalkyl-C_1-4alkyl-, C._3gcycloalkenyl-C_1-4alkyl-, CH₂= CH-X²-, C3-8cycloalkyl-C2-4alkenyl-X²-, C3-8cycloalkyl-C_2-4alkynylX²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S-, or -NH-. In other implementations, R.¹⁰is CN, C1-4alkyl, halogen, C_1-4haloalkyl C_1-4haloalkoxy or C_1-4alkoxy. In some embodiments of compounds of formulas (IIId-1) through (IIId-5), L.¹ means -C (O) NH -, - SO₂NH-, -NHSO₂-, -CH₂O- or -OCH₂-. In some embodiments of compounds of formulas (IIId-1) through (IIId-5), L.¹ means C (O) NH-. In one embodiment, the disclosure provides a compound of formula (IIId-1). In another implementation,

PZ / 5321 / AG

The disclosure provides a compound of formula (IIId-2). In another embodiment, the disclosure provides a compound of formula (IIId-3). In another embodiment, the disclosure provides a compound of formula (IIId-4). In another embodiment, the disclosure provides a compound of formula (IIId-5).

[0153] In the 6th group of embodiments of the disclosure, compounds of formulas (I '), (I), (II), (III) or (IIIe) have sub-formulas (IIIe-1), (IIIe-2), (IIIe-3), (IIIe-4) or (IIIe-5):

<img file="PL2935248T3_D0047.tif" />

The variables of R³, R⁴, R¹⁰, R⁷ and L.¹ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IIIe). In some implementations, R.⁷ is as defined in any one of the embodiments of the compounds of formula (IV) described herein. In some implementations, R.¹⁰ selected from C1-4alkyl, C1-4 alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C14alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl- , CH2 = CH-X²-, C3-6cycloalkyl-C24alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S or -NH-. In other implementations, R.¹⁰ is CN, C 1-4 alkyl, halogen, C 1-4 haloalkyl, C 14 haloalkoxy or C_1-4alkoxy. In some embodiments of compounds of formulas (IIIe-1) through (IIIe-5), L.¹is -C (O) NH-, -SO₂NH-, -NHSO₂-, -CH₂O- or -OCH₂-. In some embodiments of compounds of formulas (IIIe-1) is (IIIe-5), L.¹ is -C (O) NH-. In one embodiment, the disclosure provides a compound of formula (IIIe-1). In another embodiment, the disclosure provides a compound of formula (IIIe-2). In another embodiment, the disclosure provides a compound of formula (IIIe-3). In another embodiment, the disclosure provides a compound of formula (IIIe-4). In another embodiment, the disclosure provides a compound of formula (IIIe-5).

[0154] In the 7th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IIIa), (IV) have the sub-formula (IVa ):

<img file="PL2935248T3_D0048.tif" />

The variables of R³, R⁴, R⁵, R⁷, m, Y² and Y³ are as defined in any of the embodiments of the formulas (I '), (I'a), (I), (II), (III), (IIIa) or (IV) or in any of the embodiments as disclosed herein . IN

PZ / 5321 / AG

In one embodiment, R⁵ is H or C 1-4 alkyl. In another embodiment, R.⁵ is H. In some embodiments, Y² is N or CR¹⁰ and Y³ is N or CH, wherein R¹⁰ is H, C1-6alkyl, C1-6alkoxy, C2-8alkenyl, C2-8alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-8cycloalkylC 1-4alkyl-, C3-8cycloalkenyl-C1-4alkyl-, CH2 = CH-X²-, C3-gcycloalkyl-C2-4alkenyl-X²-, C3-8cycloalkylC2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with from; (i) from 1 to 5 R.sup.⁹; or (ii) from 1 to 5 R^c; or (iii) from 1 to 5 R.sup.^d; or (iv) from 1 to 5 R¹⁵; or (v) from 1 to 5 R^1g; or (vi) from 1 to 5 R¹⁷; or (vii) from 1 to 5 R¹⁸; or (viii) from 1 to 5 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R^1g, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl,

1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, -N (CH₃)₂, CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -,

CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂where X² is C1.

4alkylene, -O-, -S-, or -NH-. In some embodiments of compounds of formula (IVa), Y² and Y³ are CH. In other implementations, Y² is N and Y³ means CH. In other implementations, Y² stands for CR¹⁰where R.¹⁰ represents a non-hydrogen substituent as described herein and Y³ means CH. In some embodiments of compounds of Formula (IVa), index m is 0. In other embodiments of compounds of Formula (IVa), index m is 1. In other embodiments of compounds of Formula (IVa), index m is 2.

[0155] In the 8th embodiment of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IIIa), (IV) or (IVa) have sub-formula (IVa-1), (IVa-2), (IVa-3), (IVa-4), (IVa-5), (IVa-g), (IVa-7), (IVa-8), (IVa-9), (IVa-10):

<img file="PL2935248T3_D0049.tif" />

or

PZ / 5321 / AG

EP 2 935 248 B1

The variables of R³, R⁴, R⁵, R⁷ and r¹⁰ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III), (IIIa) or (IV) and in any of the embodiments as disclosed herein. In one implementation, R.⁵ is H or C 1-4 alkyl. In another embodiment, R.⁵ is H. In yet another embodiment, R⁵ is C 1-6 alkyl. In some implementations, R.¹⁰ is selected from C1-4alkyl, C1₆alkoxy, C._2-6alkenyl, C._2-6alkynyl, aryl-C_1-4alkyl-, heteroaryl-C_1-4alkyl-, C._3-6cycloalkyl-C_1-4alkyl-, C.₃6cycloalkenyl-C1-4alkyl-, CH2 = CH-X²-, C3-6cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynylX²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S-, or -NH-. In other implementations, R.¹⁰ is CN, C._1-4alkyl, halogen, C._1-4haloalkyl C_1-4haloalkoxy or C_1-4alkoxy. In other implementations, R.¹⁰ means CN, CH₃, Et, Cl, Br, F, CF₃, CF2H-, CFH2-, CH3O-, CF3O-, CF2HO or CFH₂ABOUT-.

[0156] In the 9th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IIIa), (IV), (IVa), (IVa-1), (IVa-2), (IVa-3), (IVa-4), (IVa-5), (IVa-6), (IVa-7), (IVa-8), (IVa -9) or (IVa-10) have sub-patterns (IVa-1a), (IVa-2a), (IVa-3a), (IVa-4a), (IVa-5a), (IVa-6a), (IVa -7a), (IVa-8a), (IVa-9a) or (IVa

10a):

<img file="PL2935248T3_D0050.tif" />

or

The variables of R³, R⁴, R⁷ and r¹⁰ have the meanings defined in any of the embodiments of the compounds of the formulas (I '), (I'a), (I), (II), (III), (IIIa), (IV), (IVa), (IVa-1) , (IVa-2), (IVa-3), (IVa-4), (IVa-5), (IVa-6), (IVa-7), (IVa-8), (IVa-9) or ( IVa-10) or in any of the embodiments as disclosed herein.

[0157] In a 10th embodiment of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IIIa), (IV), (IVa), (IVa-1), (IVa-2), (IVa-3), (IVa-4), (IVa-5), (IVa-6), (IVa-7), (IVa-8), (IVa -9), (IVa-10), (IVa-1a), (IVa2a), (IVa-5a), or (IVa-8a) have sub-patterns (IVa-1b), (IVa-2b), (IVa-5b ) or (IVa-6b):

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0051.tif" />

(IVa-6b)

The variables of R³, R⁴ and r⁷ have the meanings defined in any of the embodiments of the compounds of the formulas (I '), (I'a), (I), (II), (III), (IIIa), (IV), (IVa), (IVa-1) , (IVa-2), (IVa-3), (IVa-4), (IVa-5), (IVa-6), (IVa-7), (IVa-8), (IVa9) or (IVa- 10) or in any of the embodiments as disclosed herein. In one embodiment, the compounds have the sub formula (IVa-2b).

[0158] In an 11th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III) or (IV) have sub-formulas (IVb):

<img file="PL2935248T3_D0052.tif" />

The variables of R³, R⁴, R⁵, R⁷, m, Y² and Y³ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IV) and in any of the embodiments as disclosed herein. In one implementation, R.⁵ is H or C1-4alkyl. In another embodiment, R.⁵ is H. In some embodiments of compounds of Formula (IVb), Y² stands for CR¹⁰ and Y³ is CH, where R.¹⁰ is H, C1-6alkyl, C1-6alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl-, CH2 = CH-X²-, C3-6cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with from; (i) from 1 to 5 R.sup.⁹; or (ii) from 1 to 5 R^c; or (iii) from 1 to 5 R.sup.^d; or (iv) from 1 to 5 R¹⁵; or (v) from 1 to 5 R¹⁶; or (vi) from 1 to 5 R¹⁷; or (vii) from 1 to 5 R¹⁸; or (viii) from 1 to 5 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, - NHCH₃, -N (CH₃)₂, CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂where X² is C14alkylene, -O-, -S- or -NH-. In other embodiments of compounds of Formula (IVb), Y² and Y³ are CH. In other implementations, Y² is N and Y³ means CH. In other implementations, Y² stands for CR¹⁰, in

PZ / 5321 / AG

EP 2 935 248 B1 wherein R.¹⁰ represents a non-hydrogen substituent as disclosed herein and Y³ means CH. In some embodiments of compounds of Formula (IVb), the index m is 0. In other embodiments of compounds of Formula (IVb), the index m is 1. In other embodiments of compounds of Formula (IVb), the index m is 2.

[0159] In a 12th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III) (IV), or (IVb) have sub-formulas (IVb- 1), (IVb-2), (IVb-3), (IVb-4), (IVb-5), (IVb-6), (IV-7) or (IVb-8):

<img file="PL2935248T3_D0053.tif" />

or

The variables of R³, R⁴, R⁵, R⁷, and R¹⁰ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III), (IV) or (IVb) or in any of the embodiments as disclosed herein . In some embodiments, m is 0. In formulas (IVb-7) or (IVb-8), each R.⁷ is a group independently selected. In one embodiment, the compounds of formulas (IVb-1), (IVb-2), (IVb-3), (IVb-4), (IVb-5), (IVb-6), (IVb7) or (IVb-8) ), R.⁵ is H or C1-4alkyl. In another embodiment, the compounds of formulas (IVb-1), (IVb-2), (IVb-3), (IVb-4), (IVb-5), (IVb-6), (IVb-7), or (IVb -8), R.⁵ is H. In yet another embodiment, R⁵is C1-4alkyl. In certain embodiments of the compounds of formulas (IVb-1), (IVb-2), (IVb-3), (IVb-4), (IVb-5), (IVb-6), (IVb-7) or (IVb -8), R.¹⁰ selected from C1-4alkyl, C1-4alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl- , CH2 = CH-X²-, C3-6cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2_-4alkynyl-X²-, heterocyclyl-0-4alkyl or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X²is C1-4 alkylene, -O-, -S-, or -NH-. In other embodiments of the compounds of formulas (IVb-1), (IVb-2), (IVb3), (IVb-4), (IVb-5), (IVb-6), (IVb-7), or (IVb-8) ), R.¹⁰ is CN, C 1-4 alkyl, halo, C 1-4 haloalkyl, C 1-4 haloalkoxy or C 1-4 alkoxy. In other embodiments of the compounds of formulas (IVb1), (IVb-2), (IVb-3), (IVb-4), (IVb-5), (IVb-6), (IVb-7), or (IVb-8) ), R.¹⁰ is CN, CH3, Et, Cl, Br, F, CF₃, CF₂H-, CFH₂-, CH₃O-, CF₃O-, CF₂HO- or CFH₂ABOUT-.

PZ / 5321 / AG

EP 2 935 248 B1

[0160] In a 13th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III) or (IV) have sub-formulas (IVc):

<img file="PL2935248T3_D0054.tif" />

The variables of R³, R⁴, R⁵, R⁷, m, Y² and Y³ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IV) or in any of the embodiments as disclosed herein. In one implementation, R.⁵ is H or C 1-4 alkyl. In another embodiment of the compounds of formula (IVc), R.⁵ is H. In some embodiments of compounds of Formula (IVc), Y² is N or CR¹⁰ and Y³ is N or CH, wherein R¹⁰ represents H, C1-4 alkyl, C1-4 alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl -, CH2 = CH-X²-, C36cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with from; (i) from 1 to 5 R.sup.⁹; or (ii) from 1 to 5 R^c; or (iii) from 1 to 5 R.sup.^d; or (iv) from 1 to 5 R¹⁵; or (v) from 1 to 5 R¹⁶; or (vi) from 1 to 5 R¹⁷; or (vii) from 1 to 5 R¹⁸; or (viii) from 1 to 5 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH or CH3SO2 where X² is C1-4 alkylene, -O-, -S-, or -NH-. In other embodiments of compounds of Formula (IVc), Y² and Y³ are CH. In other implementations, Y² is N and Y³ means CH. In other implementations, Y² stands for CR¹⁰where R.¹⁰ represents a non-hydrogen substituent as disclosed herein and Y³ means CH. In some embodiments of compounds of Formula (IVc), the index m is 0. In other embodiments of compounds of Formula (IVc), the index m is 1. In other embodiments of compounds of Formula (IVc), the index m is 2.

In a 14th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IV), or (IVc) have sub-formulas (IVc -1), (IVc-2), (IVc-3), (IVc-4) or (IVc-5):

<img file="PL2935248T3_D0055.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0056.tif" />

or

The variables of R³, R⁴, R⁵, R⁷, and R¹⁰ in formulas (IVc-1), (IVc-2), (IVc-3), (IVc-4) or (IVc-5) have the meanings defined in any of the embodiments of the compounds of formulas (I '), (I'a ), (I), (II), (III), (IV) or (IVc) or in any of the embodiments as disclosed herein. In one embodiment, m is 0. In another embodiment, m is 1. In yet another embodiment, m is 2 and each R.⁷ is a group independently selected. In one embodiment of the compounds of formulas (IVc-1), (IVc-2), (IVc-3), (IVc-4) or (IVc-5), R⁵ is H or γ4alkyl. In another embodiment of the compounds of formulas (IVc-1), (IVc-2), (IVc-3), (IVc-4), or (IVc-5), R⁵ is H. In yet another embodiment, R⁵ is C1-4alkyl. In some embodiments of the compounds of formulas (IVc-1), (IVc-2), (IVc-3), (IVc-4), or (IVc-5), R¹⁰ selected from C1-4alkyl, C1-4 alkoxy, C26alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C36cycloalkenyl-C1-4alkyl-, CH2 = CH-X²-, C3-6cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynylX²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² is C1-4 alkylene, -O-, -S-, or -NH-. In other embodiments of the compounds of formulas (IVc-1), (IVc-2), (IVc-3), (IVc-4), or (IVc-5), R¹⁰ is CN, C 1-4 alkU, halogen, γ4 haloalkyl C_1-4haloalkoxy or C_1-4alkoxy. In other embodiments of the compounds of formulas (IVc1), (IVc-2), (IVc-3), (IVc-4), or (IVc-5), R¹⁰ means CN, CH₃, Et, Cl, Br, F, CF₃, CF2H-, CFH2-, CH3O-, CF₃O-, CF₂HO- or CFH₂ABOUT-.

[0162] In a 15th group embodiment of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), or (IV) have sub-formulas (IVd):

<img file="PL2935248T3_D0057.tif" />

The variables of R³, R⁴, R⁵, R⁷, p, Y² and Y³ in formula (IVd) are the meanings as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IV) or in any of the embodiments as described herein revealed. In one implementation, R.⁵ is H or C 1-4 alkU. In another embodiment of the compounds of formula (IVd), R.⁵ is H. In some embodiments of compounds of Formula (IVd), Y² is N or CR¹⁰ and Y³ is N or CH, wherein R¹⁰ is H, C 1-4 alkyl, C 1-6 alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C14alkyl-, CH2 = CH-X²-, C3-6cycloalkyl-C_2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclylC1-4alkyl- or R⁸each of which is optionally substituted with from; (i) from 1 to 5 R.sup.⁹; or (ii) from 1 to 5 R^c; or (iii) from 1 to 5 R.sup.^d; or (iv) from 1 to 5 R¹⁵; or (v) from 1 to 5 R¹⁶; or (vi) from 1 to 5 R¹⁷; or (vii) 1 to 5

PZ / 5321 / AG

Of R substituents¹⁸; or (viii) from 1 to 5 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, -NHCH3, -N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, CH3NHC (O) -, CH3C ( O) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2-, (CH3) 2S (O) 2NH- or CH3SO2 where X² is C1-4alkylene, -O-, -S-, or -NH-. In other embodiments of compounds of Formula (IVd), Y² and Y³ are CH. In other implementations, Y² is N and Y³ means CH. In other implementations, Y² stands for CR¹⁰where R.¹⁰ represents a non-hydrogen substituent as disclosed herein and Y³ means CH. The index p is 0, 1, 2, or 3. In some embodiments of compounds of Formula (IVd), the index p is 0. In other embodiments of compounds of Formula (IVd), the index p is 1. In other embodiments of compounds of Formula (IVd) , the index p is 2. In other embodiments of compounds of Formula (IVd), the index p is 3.

[0163] In a 16th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IV), or (IVd) have sub-formulas (IVd -1), (IVd-2), (IVd-3), (IVd-4) or (IVd-5):

<img file="PL2935248T3_D0058.tif" />

(IVd-4) or (IVd-5)

The variables of R³, R⁴, R⁵, R⁷, and R¹⁰ in formulas (IVd-1), (IVd-2), (IVd-3), (IVd-4) or (IVd-5) have the meanings defined in any of the embodiments of the compounds of formulas (I '), (I'a ), (I), (II), (III), (IV) or (IVd) or in any of the embodiments as disclosed herein. In one embodiment, p is 0. In another embodiment, p is 1. In yet another embodiment, p is 2 and each R.⁷ is a group independently selected. In one embodiment of the compounds of formulas (IVd-1), (IVd-2), (IVd-3), (IVd-4) or (IVd-5), R⁵ is H or C14alkyl. In another embodiment of the compounds of formulas (IVd-1), (IVd-2), (IVd-3), (IVd-4), or (IVd-5), R⁵ is H. In yet another embodiment, R⁵ is C1-4alkyl. In some embodiments of the compounds of formulas (IVd-1), (IVd-2), (IVd-3), (IVd-4), or (IVd-5), R¹⁰ selected from C1-4alkyl, C1-4 alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C14alkyl-, CH2 = CH-X²-, C3-6cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclylC1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹; in which X² means C._1-4alkylene, -O-, -S-, or -NH-. In other embodiments of the compounds of formulas (IVd-1), (IVd-2), (IVd-3), (IVd-4), or (IVd-5), R¹⁰ means CN, C1-4 alkyl, halogen, C1-4 haloalkyl C1PZ / 5321 / AG

EP 2 935 248 B1

4 haloalkoxy or C 1-4 alkoxy. In other embodiments of the compounds of formulas (IVd-1), (IVd-2), (IVd-3), (IVd-4), or (IVd-5), R¹⁰ means CN, CH3, Et, Cl, Br, F, CF3, CF2H-, CFH2-, CH3O-, CF3O-, CF2HO- or

CFH₂ABOUT-.

[0164] In a 17th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), or (IV) have sub-formulas (IVe):

<img file="PL2935248T3_D0059.tif" />

The variables of R³, R⁴, R⁵, R⁷, m, Y² and Y³ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III) or (IV) or in any of the embodiments as disclosed herein. In one implementation, R.⁵ is H or C1-4alkyl. In another embodiment of the compounds of formula (IVe), R.⁵ is H. In some embodiments of compounds of formula (IVe), Y² is N or CR¹⁰ and Y³ is N or CH, wherein R¹⁰ represents H, C1-4alkyl, C1-4 alkoxy, C2-6alkenyl, C2-6alkynyl, aMo-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1-4alkyl -, CH2 = CH-X²-, C36cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with from; (i) from 1 to 5 R.sup.⁹; or (ii) from 1 to 5 R^c; or (iii) from 1 to 5 R.sup.^d; or (iv) from 1 to 5 R¹⁵; or (v) from 1 to 5 R¹⁶; or (vi) from 1 to 5 R¹⁷; or (vii) from 1 to 5 R¹⁸; or (viii) from 1 to 5 R¹⁹, each of which R.⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷ or R¹⁸ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH₃, C_1-6alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O), CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂, (CH3) 2S (O) 2NH- or CH3SO2, wherein X² is C1-4 alkylene, -O-, -S-, or -NH-. In other embodiments of the compounds of formula (IVe), Y² and Y³ are CH. In other implementations, Y² is N and Y³ means CH. In other implementations, Y² stands for CR¹⁰where R.¹⁰ represents a non-hydrogen substituent as disclosed herein and Y³ means CH.

[0165] In an 18th group of embodiments of the disclosure, the compounds of formulas (I '), (I'a), (I), (II), (III), (IV), or (IVe) have sub-formulas (IVe -1), (IVe-2), (IVe-3), (IVe-4) or (IVe-5):

<img file="PL2935248T3_D0060.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0061.tif" />

<img file="PL2935248T3_D0062.tif" />

fIVe-4) |_atb (IVe-5)

The variables of R³, R⁴, R⁵, R⁷, and R¹⁰ in formulas (IVe-1), (IVe-2), (IVe-3), (IVe-4) or (IVe-5) have the meanings defined in any of the embodiments of compounds of formulas (I '), (I'a ), (I), (II), (III), (IV) or (IVe) or in any of the embodiments as disclosed herein. In one embodiment of the compounds of formulas (IVe-1), (IVe-2), (IVe-3), (IVe-4) or (IVe-5), R⁵ is H or C 1-4 alkyl. In another embodiment of the compounds of formulas (IVe1), (IVe-2), (IVe-3), (IVe-4) or (IVe-5), R⁵ is H. In yet another embodiment, R⁵ is C14alkyl. In some embodiments of the compounds of formulas (IVe-1), (IVe-2), (IVe-3), (IVe-4), or (IVe-5), R¹⁰selected from C1-6 alkyl, C1-4 alkoxy, C2-6alkenyl, C2-6alkynyl, aryl-C1-4alkyl-, heteroaryl-C1-4alkyl-, C3-6cycloalkyl-C1-4alkyl-, C3-6cycloalkenyl-C1- 4alkyl-, CH2 = CH-X²-, C36cycloalkyl-C2-4alkenyl-X²-, C3-6cycloalkyl-C2-4alkynyl-X²-, heterocyclyl-C1-4alkyl- or R⁸each of which is optionally substituted with 1 to 5 R.sup.⁹ groups; in which X² is C14alkylene, -O-, -S- or -NH-. In other embodiments of the compounds of formulas (IVe-1), (IVe-2), (IVe-3), (IVe-4), or (IVe-5), R¹⁰ is CN, C 1-4 alkyl, halogen, C 1-4 haloalkyl, C 1-4 haloalkoxy or C 14 alkoxy. In other embodiments of the compounds of formulas (IVe-1), (IVe-2), (IVe-3), (IVe-4), or (IVe-5), R¹⁰means CN, CH₃, Et, Cl, Br, F, CF₃, CF2H-, CFH2-, CH3O-, CF3O-, CF2HO- or CFH2O-.

[0166] In a 19th group of embodiments of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V) or (V') have the sub-formula (Va):

<img file="PL2935248T3_D0063.tif" />

each of Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ is independently selected from CH, CR⁹ or N with each occurrence at least two of Y⁴, Y⁵, Y⁶, Y⁷and Y⁸ are independently selected from CH or CR⁹where R.⁹ is as defined in any one of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V) or (V') as described herein. In some implementations, R.⁹ represents R^c or R^d or R^e. In some implementations, L.² is a bond, CH2-, -C (O) - or -SO2-. In one case, L.² means bond. Otherwise, L.² is CH2-, -C (O) - or -SO2-. In some embodiments of compounds of Formula (Va), Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ are independently CH or CR⁹. In other implementations, Y⁴ is N and Y⁵, Y⁶, Y⁷ and Y⁸ are independently CH or CR⁹. In other implementations, Y⁴ is N, Y⁵ is N and Y⁶, Y⁷and Y⁸ are independently CH or CR⁹. In other implementations, Y⁴ is N, Y⁶ is N and Y⁵, Y⁷ and Y⁸ are independently CH or CR⁹. Y⁴ is N, Y⁷ is an atom

PZ / 5321 / AG

EP 2 935 248 B1

N and Y⁵, Y⁶ and Y⁸ are independently CH or CR⁹. Y⁴ is N, Y⁸ is N and Y⁵, Y⁶ and Y⁷ are independently CH or CR⁹. Y⁵ is N and Y⁴, Y⁶, Y⁷ and Y⁸ are independently CH or CR⁹. Y⁶ is N and Y⁴, Y⁵, Y⁷ and Y⁸ are independently CH or CR⁹. In some embodiments of compounds of Formula (Va), an aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ is optionally substituted with: (i) 1 to 3 R.sup.⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸; (viii) 1 to 3 R¹⁹; or (ix) from 1 to 3 R.sup.²⁰ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, -NHCH3, -N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, -PH (= O) CH3 , -P (= O) (CH3) 2, -PH (= O) (OC1.6alkyl), -P (= O) (OC1.6alkyl) 2, OP (= O) (OC1.6alkyl) 2, CH3NHC (O) -, CH3C (O) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2-, (CH3) 2S (O) 2NH-, EtNHSO2-, PhNHSO2-, CH3SO2NH-, EtSO2NH-, PhSO2NH-, CH3SO2, EtSO2, PhSO2-, 4-morpholinyl, EtOC (O) NH-, CH3OC (O) NH-, EtNHC (O) NH-, CH3NHC (O) NH-, EtOC (O) O- or CH3OC (O) O-, each of R⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷, R¹⁸, R¹⁹ or R²⁰ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C1-4alkyl, cyclopropyl, -OH, -NH2, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH or CH₃SO₂. In one implementation, R.⁵ is H. In some embodiments, Y¹ is N and R¹it only means a pair of electrons. In some implementations, Y¹ is C and R¹ is H, halogen, C_1-4 alkyl, C._1-4 haloalkoxy or cyclopropyl. In one implementation, Y¹ is C and R¹ is H. The variables R¹, R³, R⁴, R⁵, Y¹, Y², Y³ and L.² and are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III), (IIIa) or (IV) and in any of the embodiments as disclosed herein .

[0167] In a 20th embodiment of the disclosure, compounds of formulas (I '), (I), (II), (III), (V), (V'), or (Va) have sub-formulas (Va- 1), (Va-2) or (Va-3):

<img file="PL2935248T3_D0064.tif" />

or in)

PZ / 5321 / AG

EP 2 935 248 B1

Variables, R.³, R⁴, R⁵, R¹⁰, R¹, L.², Y⁴, Y⁵, Y⁶, Y⁷ or Y⁸ in formulas (Va-1) (Va-2) or (Va-3) are the meanings defined in any of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), ( V ') or (Va). In some cases, compounds of formulas (Va-1), (Va-2) or (Va-3), R.⁵ is H. In other cases, compounds of formulas (Va-1), (Va-2) or (Va-3), R¹ is H. In other cases, compounds of formulas (Va-1), (Va-2) or (Va-3), L² means bond. In still other cases, the compounds of formulas (Va-1), (Va-2) or (Va-3), R.¹⁰ is H. In one embodiment of the compounds of formulas (Va-1), (Va-2) or (Va-3), R¹, R⁵ and r¹⁰ are H and L² means bond.

[0168] In a 21st group embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va), (Va-1) , (Va-2) or (Va-3) have the sub-formulas (Va-1a), (Va-1a-1), (Va-2a), (Va-2a-1) or (Va-3a):

<img file="PL2935248T3_D0065.tif" />

<img file="PL2935248T3_D0066.tif" />

(Va-3a)

Variables, R.³, R⁴, R¹⁰, R¹, L.², Y⁴, Y⁵, Y⁶, Y⁷ or Y⁸ in formulas (Va-1a), (Va-1a-1), (Va-2a), (Va-2a-1) or (Va-3a) have the meanings defined in any of the embodiments of compounds of formulas (I '), (I), (II), (III), (V), (V '), (Va), (Va-1), (Va-2) or (Va-3).

[0169] In a 22nd embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va), (Va-1) , (Va-2), (Va-3), (Va-1a), (Va-1a-1), (Va-2a), (Va-2a-1) or (Va-3a) have sub-formulas ( Va-1b), (Va-1b-1), (Va-2b), (Va-2b-1) or (Va-3b):

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0067.tif" />

or

Variables, R.³, R⁴, R¹, Y⁴, Y⁵, Y⁶, Y⁷ or Y⁸ in formulas (Va-1b), (Va-1b-1), (Va-2b), (Va-2b-1) or (Va-3b) have the meanings defined in any of the embodiments of compounds of formulas (I '), (I), (II), (III), (V), (V '), (Va), (Va-1), (Va-2), (Va-3, (Va-1a), (Va -1a-1), (Va-2a) or (Va-2a-1).

[0170] In a 23rd embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), or (Va) have the sub-formula (Va- 4):

<img file="PL2935248T3_D0068.tif" />

The variables of R³, R⁴, L.¹, Y², Y³, R¹, L.² and r⁹ in formula (Va-4) are as defined in any of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), (V') or (Va). The index n is 0, 1, 2, or 3. In some embodiments of compounds of Formula (Va-4), L.¹ is -C (O) N (R.⁵) - where R.⁵ is H or C1-4alkyl. In some embodiments of compounds of formula (Va-4), L.² means bond. In some embodiments of compounds of formula (Va-4), Y³ is N and Y² stands for CR¹⁰. In other embodiments of compounds of formula (Va-4), Y³ is N and Y² means CH. In other embodiments of compounds of formula (Va-4), Y³ and Y² are CH. In other embodiments of compounds of formula (Va-4), Y³ means CH and Y² is N. In some embodiments of compounds of formula (Va-4), R⁹ represents R^c; or R^d; or R^e; or R¹⁵; or R¹⁶; or R¹⁷; or R¹⁹; or R²⁰.

[0171] In a 24th embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va) or (Va-4) have the subordinate formula (Va-4a):

<img file="PL2935248T3_D0069.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

The variables of R³, R⁴, R⁵, Y², Y³, R¹, L.² and r⁹ are as defined in any one of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va) or (Va-4a). The index n is 0, 1, 2, or 3. In some embodiments of compounds of Formula (Va-4a), R⁵ is H. In other embodiments of compounds of formula (Va-4a), R⁵ is C 1-6 alkyl. In some embodiments of compounds of formula (Va-4a), L.²is a bond, -CH2-, -C (O) - or -SO2. In some embodiments of compounds of formula (Va-4a), L.²means bond. In some embodiments of compounds of formula (Va-4a), Y³ is N and Y² stands for CR¹⁰. In other embodiments of compounds of formula (Va-4a), Y³ is N and Y² means CH. In other embodiments of compounds of formula (Va-4a), Y³ and Y² are CH. In other embodiments of compounds of formula (Va-4a), Y³ means CH and Y² is N. In some embodiments of compounds of formula (Va4a), R⁹ represents R^c; or Rd; or R^e; or R¹⁵; or R¹⁶; or R¹⁷; or R¹⁹; or R²⁰.

[0172] In a 25th embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va), (Va-4) or (Va-4a) have the subordinate formula (Va-4a-1):

<img file="PL2935248T3_D0070.tif" />

The variables of R³, R⁴, R⁵, Y², Y³, R¹, L.², R⁹ and the index n are as defined in any of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va), (Va-4) or ( Va-4a). In some embodiments of compounds of formula (Va-4a-1), L.² represents a bond, -CH₂-, -C (O) - or -SO₂.

[0173] In a 26th group of embodiments of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va), (Va-4) , (Va-4a) or (Va-4a-1) have the subordinate formula (Va-4a-1a):

<img file="PL2935248T3_D0071.tif" />

The variables of R³, R⁴, R⁵, Y², Y³, R¹, R⁹ and the index n are as defined in any of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va), (Va-4), ( Va-4a) or (Va-4a-1). In some embodiments of the compounds of formula (Va-4a-1), Y³ is N and Y² stands for CR¹⁰. In other embodiments of the compounds of formula (Va-4a-1), Y³ is N and Y² means CH. In other embodiments of the compounds of formula (Va-4a-1), Y³ and Y² are CH. In other embodiments of the compounds of formula (Va-4a-1), Y³means CH and Y² is N.

[0174] In the 27th group of embodiments of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), or (Va) have sub-formulas (Va- 5a), (Va-5b) or (Va-5c):

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0072.tif" />

The variables of R³, R⁴, L.¹, Y², Y³, R¹, L.² and r⁹ are as defined in any of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), (V') or (Va). The index n is 0, 1, 2, or 3. In some embodiments of compounds of formulas (Va-5a), (Va-5b), or (Va-5c), L¹ is -C (O) N (R.⁵) - where R.⁵is H or C 1-4 alkyl. In some embodiments of compounds of Formula (Vb), L.² means bond. In some embodiments of compounds of formulas (Va-5a), (Va-5b), or (Va-5c), Y³ is N and Y² stands for CR¹⁰. In other embodiments of compounds of formulas (Va-5a), (Va-5b), or (Va-5c), Y³ is N and Y²means CH. In other embodiments of compounds of formulas (Va-5a), (Va-5b), or (Va-5c), Y³ and Y² are CH. In other embodiments of the compounds of Formula (Va-5a), (Va-5b), or (Va-5c), Y³ means CH and Y² is N. In some embodiments of compounds of formulas (Va-5a), (Va-5b) or (Va-5c), R⁹ represents R^c; or Rd; or R^e; or R¹⁵; or R¹⁶; or R¹⁷; or R¹⁹; or R²⁰.

[0175] In a 28th embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), or (Va) have the sub-formula (Va- 6):

<img file="PL2935248T3_D0073.tif" />

Variables, R.³, R⁴, R⁵, R¹⁰, L.², Y⁴, Y⁵, Y⁶, Y⁷ or Y⁸ in formula (Va-6) are as defined in any one of the embodiments of the compounds of formulas (I '), (I), (II), (III), (V), (V') or (Va). In some cases of compounds of formula (Va-6), R.⁵ is H. In other cases of compounds of formula (Va-6), R¹ is H. In other cases, compounds of formulas (Va-6), L² means bond. In still other instances of compounds of formulas (Va-6), R.¹⁰ is H. In other cases, compounds of formulas (Va-6), Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ are CH, each of which is optionally substituted with such as (i) a group R⁹; or (ii) R^c; or (iii) R^d; or (iv) R¹⁵; or (v) R¹⁶; or (vi) R¹⁷; or (vii) R¹⁸; (viii) R¹⁹; or (ix) R²⁰ selected from -CN, F, Cl, I, -OCH3, C 1-6 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, -NHCH3, -N (CH3) 2, -CH2F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH-, EtNHSO₂-, PhNHSO₂-, CH3SO2NH-, EtSO₂NH-, PhSO₂NH-, CH₃SO₂, EtSO₂, PhSO₂-, 4-morpholinyl, EtOC (O) NH-, CH₃OC (O) NH-, EtNHC (O) NH-, CH₃NHC (O) NH-, EtOC (O) O- or CH3OC (O) O-, each of R⁹, R^c, R^and, R¹⁵, R¹⁶, R¹⁷, R¹⁸, R¹⁹ or R²⁰ then optionally substituted with from 1 to 3

PZ / 5321 / AG

Of R substituents¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C 1-8 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, - NHCH3, -N (CH3) 2, CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, CH3NHC (O) -, CH3C (O) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2 -, (CH3) 2S (O) 2NH- or CH3SO2. In some embodiments of compounds of formulas (Va-1), (Va-2) or (Va-3), R.¹, R⁵ and r¹⁰ are H; L.² represents a bond; and Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ are CH, each of which is optionally substituted with such as (i) a group R⁹; or (ii) R^c; or (iii) Rd; or (iv) R¹⁵; or (v) R¹⁶; or (vi) R¹⁷; or (vii) R¹⁸; (viii) R¹⁹; or (ix) R²⁰ selected from -CN, F, Cl, I, -OCH3, C1_6alk.yl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH-, EtNHSO₂-, PhNHSO₂-, CH₃SO₂NH-, EtSO₂NH-, PhSO₂NH-, CH₃SO₂, EtSO₂, PhSO₂-, 4-morpholinyl, EtOC (O) NH-, CH3OC (O) NH-, EtNHC (O) NH-, CH3NHC (O) NH-, EtOC (O) O- or CH3OC (O) O-, where each of R.⁹, R^c, R^and, R¹⁵, R¹⁶, R¹⁷, R¹⁸, R¹⁹ or R²⁰ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from CN, F, Cl, I, -OCH₃, C_1-6alkyl, cyclopropyl, -OH, - NH₂, -NHCH3, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, -OCF3, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH3SO2.

[0176] In a 29th embodiment of the disclosure, the compounds of formulas (I '), (I), (II), (III), (V), (V'), (Va) or (Va-6) have sub-formulas (Va-6a), (Va-6b), (Va-6c) or (Va-6d):

<img file="PL2935248T3_D0074.tif" />

or

Variables, R.³, R⁴ and r⁹ in formulas (Va-6a), (Va-6b), (Va-6c) or (Va-6d) have the meanings defined in any one of the embodiments of the formulas (I '), (I), (II), (III ), (V), (V '), (Va) or (Va-6). The index p is 0, 1.2, or 3. In some embodiments of compounds of formulas (Va-6a), (Va-6b), (Va-6c), or (Va-6d), R⁹ represents R²⁰.

PZ / 5321 / AG

EP 2 935 248 B1

[0177] In certain embodiments of any compounds of formulas (Va), (Va-1), (Va-2), (Va-3), (Va-1a), (Va-2a), (Va-3a), (Va-1a-1), (Va-2a-1), (Va-1b), (Va-2b), (Va-3b), (Va-1b-1), (Va-2b-1), (Va-6), (Va-6a), (Va-6b), (Va-6c) or (Va-6d), aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ is optionally substituted with (i) 1 to 3 R.sup.⁹; or (ii) from 1 to 3 R^{c; or} (iii) from 1 to 3 R.sup.^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸; (viii) 1 to 3 R¹⁹; or (ix) from 1 to 3 R.sup.²⁰ independently selected from -CN, F, Cl, I, -OCH3, C1-4 alkyl, cyclopropyl, 1-azetidinyl, 2-azetidinyl, 3-azetidinyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH2, - NHCH3, N (CH3) 2, -CH2F, -CHF2, CF3, -OCF3, -OCHF2, -OCH2F, CH3C (O) -, CH3C (O) O-, CH3OC (O) -, CH3NHC (O) -, CH3C (O) NH-, (CH3) 2NC (O) -, (CH3) 2NS (O) 2-, (CH3) 2S (O) 2NH-, EtNHSO2-, PhNHSO2-, CH3SO2NH-, EtSO2NH-, PhSO2NH- , CH3SO2, EtSO2, PhSO2-, 4-morpholinyl, EtOC (O) NH-, CH3OC (O) NH-, EtNHC (O) NH-, CH3NHC (O) NH-, EtOC (O) O- or CH3OC (O )ABOUT-, with each substituent R⁹, R^c, R^d, R¹⁵, R¹⁶, R¹⁷, R¹⁸, R¹⁹ or R²⁰ then optionally substituted with 1 to 3 R &lt;2&gt; groups¹⁹ independently selected from -CN, F, Cl, I, -OCH3, C16alkyl, cyclopropyl, 2-oxetanyl, 3-oxetanyl, -OH, -NH₂, -NHCH₃, -N (CH₃)₂, -CH₂F, -CHF₂, CF₃, OCF₃, -OCHF₂, -OCH₂F, CH₃C (O) -, CH₃C (O) O-, CH₃OC (O) -, CH₃NHC (O) -, CH₃C (O) NH-, (CH₃)₂NC (O) -, (CH₃)₂NS (O)₂-, (CH₃)₂S (O)₂NH- or CH₃SO₂. In some cases, an aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ is an optionally substituted benzene ring. In other instances, an aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ represents an optionally substituted pyridine ring where Y⁴ is N; or Y⁵ is N or Y⁶ is N. In other cases, an aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ represents an optionally substituted pyrimidine ring where Y⁴ and Y⁶ are N; or Y⁴ and Y⁸ are N; or Y⁵ and Y⁷ are N. In other cases, an aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ represents an optionally substituted pyrazine ring in which Y⁴ and Y⁷ are N. In other cases, an aromatic ring containing Y⁴, Y⁵, Y⁶, Y⁷ and Y⁸ represents an optionally substituted pyridazine ring where Y⁴ and Y⁵ are N; or Y⁵ and Y⁶ are N. In some embodiments, optional substituents for the benzene, pyridine, pyrimidine, pyrazine, or pyridazine rings are (i) 1 to 3 R⁹; or (ii) from 1 to 3 R^c; or (iii) from 1 to 3 R^d; or (iv) from 1 to 3 R¹⁵; or (v) from 1 to 3 R¹⁶; or (vi) from 1 to 3 R¹⁷; or (vii) from 1 to 3 R¹⁸; (viii) 1 to 3 R¹⁹; or (ix) from 1 to 3 R.sup.²⁰.

[0178] In certain embodiments of any compound of formulas (IIIa), (IIIb), (IIIc), (IIId), (IIId), (IIIe), (IIIa1), (IIIa-2), (IIIa-3), (IIIa-4), (IIIa-5), (IIIa-6), (IIIa-7), (IIIa-8), (IIIb-1), (IIIb-2), (IIIb-3), (IIIb -4), (IIIb-5), (IIIc-1), (IIIc-2), (IIIc-3), (IIIc-4), (IIIc-5), (IIId-1), (IIId-2 ), (IIId-3), (IIId-4), (IIId-5), (IIIe-1), (IIIe-2), (IIIe-3), (IIIe-4), (IIIe-5), (IVa), (IVa-1), (IVa-2), (IVa-3), (IVa-4), (IVa-5), (IVa-6), (IVa-7), (IVa-8 ), (IVa-9), (IVa-10), (IVa1a), (IVa-2a), (IVa-3a), (IVa-4a), (IVa-5a), (IVa-6a), (IVa-7a), (IVa-8a), (IVa-9a), (IVa -10a), (IVa-1b), (IVa2b), (IVa-5b), (IVa-6b), (IVb), (IVb-1), (IVb-2), (IVb-3), (IVb -4), (IVb-5), (IVb-6), (IVb-7), (IVb-8), (IVc), (IVc1), (IVc-2), (IVc-3), (IVc -4), (IVc-5), (IVd), (IVd-1), (IVd-2), (IVd-3), (IVd-4), (IVd-5), (IVe), (IVe -1), (IVe-2), (IVe-3), (IVe-4), (IVe-5), (V), (V '), (Va), (Va-1), (Va- 2), (Va-3), (Va-1a), (Va-2a), (Va-3a), (Va-1a-1), (Va

PZ / 5321 / AG

EP 2 935 248 B1

2a-1), (Va-1b), (Va-2b), (Va-3b), (Va-1b-1), (Va-2b-1), (Va-6), (Va-6a) , (Va-6b), (Va-6c) or (Va-6d), R³ and r⁴ are independently selected from H, C 1-4 alkyl, halogen, CN, cyclopropyl, CN-CH 2 -, phenyl, cyclopropylmethyl, C 1-4 alkoxy, C 1-4 haloalkyl, C 1-4 haloalkoxy or R 8. In other cases, R.³ and r⁴ independently of each other are selected from H, CH3, -CD3, -C6D5, -CF3, -CHF2, -CH2F, -OCF3, -OCHF2, -OCH2F halogen, CN, cyclopropyl, CN-CH2-, phenyl, cyclopropylmethyl or -OCH3. In still other cases, R.³ and r⁴ each independently represent H, F, Cl, Br, NH2C (O) -, CH₃, CD₃, Et, cyclopropyl, CN, CH₂CH₂- or CH₃C (O) NH-. In other cases, R.³ and r⁴ are D. In other cases, R.³ and r⁴are C1-6alkyl. In other cases, R.³ and r⁴ are C1-4alkoxy.

[0179] In some embodiments, the disclosure provides any of the compounds shown in Table 1, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof. In some embodiments, the disclosure provides the above-selected compounds and pharmaceutically acceptable salts thereof. In some embodiments, the disclosure provides any of the compounds P-2001 to P-2273 and P-2274 to P2307 as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof. In some embodiments, the disclosure provides any of the compounds described by formulas (I '), (I'a), (I), (II), (III), (IV), or any sub-formulas thereof, such as those described herein, any of the following compounds: the compounds described in the examples, and any of the compounds described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers or isomers thereof.

[0180] In some embodiments, the disclosure provides a compound selected from:

4-bromo-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide, (P-2005), 3,4-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2007), 4-methyl-3-phenyl-N- (2-phenyl- 1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide, (P-2008), 3-cyclopropyl-N- (2-phenyl-1H-pyrrolo [2,3- b] pyridin-5-yl) -1H-pyrazole-5-carboxamide, (P-2009), 5-fluoro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-indazole-3-carboxamide (P-2010), N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P-2019), 4-chloro-N - [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P2023), N- [2- (4- fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2024), 3-ethyl-N- [2- (4 -fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-5-carboxamide (P2028), N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-3-carboxamide (P-2029), 5-methyl-N - [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3 -carboxamide (P-2031), 3,4-dimethyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2 , 3-b] pyridin-5-yl] 1H-pyrazole-5-carboxamide (P-2034), 4-chloro-3-methyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin5 -yl] -1H-pyrazole-5-carboxamide (P-2036),

N- [2- (1,3-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2038),

PZ / 5321 / AG

EP 2 935 248 B1

4-chloro-N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydra-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl- 1H-pyrazole-3-carboxamide (P-2039), N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl1H-pyrazole-3-carboxamide (P-2042), N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydra-2H-pyridin-4-yl] -1H -pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2043), N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-indazole-3-carboxamide (P-2046), N- [2- (4-fluorophenyl ) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5,6,7-tetrahydro-1H-indazole-3-carboxamide (P2047), 3,4-dimethyl-N- [2 - [1- (4-piperidyl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2048), N- (2-chloro -1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2049), N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1,4,5,6-tetrahydrocyclopenta [c] pyrazole-3-carboxamide (P-2056), 4 -chloro-3-methyl-N- [2- (1-methylsulfonyl-3,6-dihydra-2H-pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H- pyrazole-5-carboxamide (P-2057), 3-methyl-N- (2-morpholine-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2058 ), 4,5-dimethyl-N- [2- (4-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide (P2059), 4-chloro-N- [2- [1- (cyclopropanecarbonyl) -2,5-dihydropyrrol-3-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl1H-pyrazole- 5-carboxamide (P-2060), N- [2- (1-acetyl-3,6-dihydra-2H-pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-chloro-3-methyl-1H-pyrazole-5-carboxamide (P-2061), 4-chloro-3-methyl-N- [2- [1- (morpholine-4-carbonyl) -2,5-dihydropyrrole- 3-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2062),

N- [2- (3-fluoraprap-1-ynyl) -1H-pyralo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2063), N - [2- [3- (dimethylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2064), N - [2- (3,5-dimethylisoxazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2065 ), 3,4-dimethyl-N- [2- [3- (2-morpholinoethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P -2066), 3,4-dimethyl-N- [2- [4- (methylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2067), N- [2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P-2068), 4 , 5-dimethyl-N- [2- [2- (4-methylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide (P-2069), 4,5-dimethyl-N- [2- (3-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide (P2070) , 3,4-dimethyl-N- [2- [1- (2-morpholinoacetyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl ] -1H-pyrazole-5-carboxamide (P-2073),

PZ / 5321 / AG

EP 2 935 248 B1

N- [2- [1- (2,3-dihydraxprapanoyl) -3,6-dihydra-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3, 4-dimethyl-1H-pyrazole-5-carboxamide (P-2074), N- [2- (2-chloro-4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3.4 -dimethyl-1H-pyrazole-5-carboxamide (P-2075), N- [2- (2-fluoro-4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3, 4-dimethyl-1H-pyrazole-5-carboxamide (P-2076), N- [2- (2-chloro-5-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3 , 4-dimethyl-1H-pyrazole-5-carboxamide (P-2077), N- [2- (3-fluora-5-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2078) ,

3,4-dimethyl-N- [2- (3-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2079), N - [2- (4-aminocyclohexen-1-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2080),

N- [2- (4-cyano-3-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2081) ,

N- [2- (3-fluoro-2-morpholine-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2082),

N- [2- (1-isobutylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2083),

N- [2- (1,5-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2084),

N- [2- [4- (dimethylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2085),

3,4-dimethyl-N- [2- [3- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2086),

N- [2- [3- (dimethylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2087), 3, 4-dimethyl-N- [2- (3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2088), 3,4-dimethyl -N- [2- (6-morpholine-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2089), N- [2- ( 6-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2090),

3,4-dimethyl-N- [2- (2-methylthiazol-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2091), N - [2- (4-cyanophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2092), N- [2 - (2-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2093), N- [2- (3 -fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2094), N- [2- (3-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2095), N- [ 2- (2-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2096), 3,4-dimethyl- N- [2- (o-tolyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2097), N- [2- (3-methoxyphenyl) ) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2098),

PZ / 5321 / AG

EP 2 935 248 B1

N- [2- (4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2099),

N- [2- (3-acetamidophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2100), 3,4-dimethyl -N- [2- [4- (pyrrolidine-1-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2101), N- [ 2- [4- (3-methoxypropoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-H-pyrazole-5-carboxamide (P-2102), 3,4 -dimethyl-N- [2- [4- (4-methylpiperazin-1-yl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2104) , 3,4-dimethyl-N- [2- [4- (thiomorpholine-4-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2105 ), 3,4-dimethyl-N- [2- [3- (morpholine-4-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P -2106), 3,4-dimethyl-N- [2- [3- (pyrrolidine-1-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2107), N- [2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5- carboxamide (P-2108)

N- [2- (2-methoxy-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2109), 3 , 4-dimethyl-N- [2- (2-morpholine-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2110), N- [2- [4- (methanesulfonamido) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2111), 3,4- dimethyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2112), N- [2- [2-chloro-5- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2113 ), 3,4-dimethyl-N- (2-pyrrolidin-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2115) or 3 -methyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridm-5-yl) -1H-pyrazole-5-carboxamide (P-2116), N- [2- [ 4- (methanesulfonamido) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2117), N- [2- [3- [4- (cyclopropanecarbonyl) piperazin-1-yl] phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5- carboxamide (P-2118), N- [2- (4-cyano-3-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H -pyrazole-5-carboxamide (P-2120), 3,4-dimethyl-N- [2- [3- (methylsulfamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole -5-carboxamide (P-2121), N- [2- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5- carboxamide (P-2122) 3,4-dimethyl-N- [2- (6-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2123), 3 , 4-dimethyl-N- [2- (4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2124), 3,4- dimethyl-N- [2- (4-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2125),

PZ / 5321 / AG

EP 2 935 248 B1

3,4-dimethyl-N- [2- [3- (prapylsulfonylamino) phenyl] -1H-pyralo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2126), N- [2- (3-cyanophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2128), N- [2- (2-fluoro-3-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2129), 3,4- dimethyl-N- [2- (m-tolyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2130), IV- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-propyl-1H-pyrazole-5-carboxamide (P-2132), N- [2- (6-acetamido-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2133), N- [2- [ 3- (butylcarbamoylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2134), N- [2- (2- methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2135), 3,4-dimethyl-N- [2- (2-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2136),

N- [2- (4-acetamidophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2137), 3,4-dimethyl -N- [2- [4- (morpholine-4-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2138),

N- [2- (2,4-dimethylthiazol-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2139) , N- [2- [1- (difluoromethyl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2140),

N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2143),

N- [2- (3-fluoro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2146), N - [2- (3-chloro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2147),

N- [2- [4- (cyclopropylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2148), 3, 4-dimethyl-N- [2- [4 - [(3-methyloxetan-3-yl) methoxy] phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide ( P-2149),

N- [2- (2-ethoxypyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2153) ,

N- [2- (2-isopropylpyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2154), N - [2- (2-cyclopropylpyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2155),

N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3- (trifluoromethyl) -1H-pyrazole-5-carboxamide (P2156), N- [2- [2- (cyclopropylamino) pyrimidin-5-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2157),

PZ / 5321 / AG

EP 2 935 248 B1

3,4-dimethyl-N- [2- (2-morpholinopyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2158) ,

3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2159),

3,4-dimethyl-N- [2- [2- (4-methylpiperazin-1-yl) pyrimidin-5-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole - carboxamide (P-2160),

N- [2- (4-cyano-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2161) ,

N- [2- (2-isopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2163), 3 , 4-dimethyl-N- [2- (2,3,4,5,6-pentadeuterophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2164 ),

3,4-dimethyl-N- [2- (1,3,5-trimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide ( P-2165),

N- [2- (3,5-dimethyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide ( P-2167),

3,4-dimethyl-N- [2- [3-methyl-1- (oxetan-3-yl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H -pyrazole-5-carboxamide (P-2168)

N- [2- (6-methoxy-2-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2169),

N- [2- (2-methoxy-6-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2170),

N- [2- (3-chloro-2-methoxy-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2171), 3- (difluoromethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2172), 4- chloro-3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2173), N- [ 2- [4-fluoro-3- (2H-tetrazol-5-yl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide ( P-2174),

N-cyclopropyl-4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] pyridine-2-carboxamide (P- 2175), 3,4-dimethyl-N- [2- [2- (trifluoromethyl) -3-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P -2176),

N- [2- (2-ethyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2177),

N- [2- (6-ethyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2178), N - [2- (2,3-dihydro- [1,4] dioxino- [2,3-b] pyridin-8-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3 , 4-dimethyl-1H-pyrazole-5-carboxamide (P-2179),

3,4-dimethyl-N- [2- [2- (trifluoromethyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2180),

N- [2- (2,4-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2181),

PZ / 5321 / AG

EP 2 935 248 B1

3,4-dimethyl-N- [2- [2- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2182),

N- [2- (5-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2183), 3 , 4-dimethyl-N- [2- (5-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2184),

N- [2- (4-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2185), 3 , 4-dimethyl-N- [2- [2- (4-methylsulfonylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2186), N- [2- [2- [4- (cyclopropanecarbonyl) piperazin-1-yl] -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3 , 4-dimethyl-1H-pyrazole-5-carboxamide (P-2187), N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole- 5-carboxamide (P-2188) N- [2- [2- [4- (2-cyanoacetyl) piperazin-1-yl] -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl -1H-pyrazole-5-carboxamide (P-2189), 4,5-dimethyl-N- (3- (6- (piperazin-1-yl) pyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2190), 4,5-dimethyl-N- (3- (6- (piperazin-1-yl) pyridin-2-yl) -1H-pyrrolo [ 2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2191), 4,5-dimethyl-N- (3- (6-morpholinopyridin-2-yl) -1H-pyrrolo [2 , 3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2192), 4,5-dimethyl-N- (3- (2-morpholinopyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2193) , N- (2- (1- (1-acetylazetidin-3-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4 , 5-dimethyl1H-pyrazole-3-carboxamide (P-2194), N- (2- (1- (azetidin-3-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2 , 3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2195), 4,5-dimethyl-N- (2- (5-methyl-1- (oxetan-3-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl ) -1H-pyrazole-3-carboxamide (P-216), N- (2- (1- (azetidin-3-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3- b] pyridin-5-yl) -4,5-dimethyl-1H pyrazole-3-carboxamide (P-2197), 4,5-dimethyl-N- (2- (5-methyl-1- (piperidin-4-yl) ) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2198), N- (2- (1- (1-acetylpiperidin-4-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4, 5-dimethyl1H-pyrazole-3-carboxamide (P-2199), N- (2- (1- (1- (cyclopropanecarbonyl) piperidin-4-yl) -5-methyl-1H-pyrazol-4-yl) -1H -pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2200), 4,5-dimethyl-N- (2- (3-methyl-1 - (piperidin-4-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2201), N- (2- (1- (1-acetylpiperidin-4-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4, 5-dimethyl1H-pyrazole-3-carboxamide (P-2202),

PZ / 5321 / AG

EP 2 935 248 B1

N- (2- (1- (1- (cyclopropanecarbonyl) piperidin-4-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4 , 5-dimethyl-1H-pyrazole-3-carboxamide (P-2203),

N- (2- (2- (cyclopropylamino) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2204 ),

N- (2- (3-chloro-2- (cyclopropanecarboxamido) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl1H-pyrazole-3-carboxamide (P-2205)

N- (2- (2- (cyclopropanecarboxamido) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2206 ),

N- (2- (2- (1- (cyclopropanecarbonyl) piperidin-4-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H- pyrazole-3-carboxamide (P-2207), 4,5-dimethyl-N- (2- (2- (pyrrolidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridine -5-yl) -1H-pyrazole-3-carboxamide (P-2208), 4,5-dimethyl-N- (2- (2- (piperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2 , 3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2209),

4,5-dimethyl-N- (2- (2- (4-methylpiperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole -3 carboxamide (P-2210)

4,5-dimethyl-N- (2- (2- (piperidin-4-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2211)

N- (2- (2- (4-hydroxypiperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3 - carboxamide (P-2212),

N- (2- (2- (3-Hydraxypiperidin-1-yl) pyridin-4-yl) -1H-pyralo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3 - carboxamide (P-2213),

N- (2- (2- (4-acetylpiperazin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3 - carboxamide (P-2214),

4,5-dimethyl-N- (2- (2- (4- (3-methylbut-2-enoyl) piperazin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin -5-yl) -1H-pyrazole-3-carboxamide (P-2215),

4,5-dimethyl-N- (2- (2- (morpholine-4-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2216)

4,5-dimethyl-N- (2- (2- (4-methylpiperazine-1-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3 - carboxamide (P-2217),

4,5-dimethyl-N- (2- (2- (pyrrolidine-1-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2218)

4,5-dimethyl-N- (2- (2- (thiomorpholine-4-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2219), 4- (5- (4,5-Dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-methoxyethyl) picolinamide (P-2220)

4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2- (dimethylamino) ethyl) picolinamide (P -2221), 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-methoxyethyl) picolinamide (P -2222),

4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N-methoxypicolinamide (P2223),

PZ / 5321 / AG

EP 2 935 248 B1

4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N, N-dimethylpicolinamide (P-2224), 4 - (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-morpholinoethyl) picolinamide (P-2225), 4 - (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2- (4-methylpiperazin-1-yl) ethyl ) picolinamide (P-2226), N- (2-cyanoethyl) -4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl ) picolinamide (P-2227), 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N-isobutylpicolinamide (P-2228), 4- ( 5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N-isopropylpicolinamide (P-2229), 4- (5- ( 4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N, N-diethyl-picolinamide (P-2230), 4-methyl-N- ( 2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -5- (trifluoromethyl) -1H-pyrazole-3-carboxamide (P2231), 4-chloro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -5- (trifluoromethyl) -1H-pyrazole-3-carboxamide (P2232), 5-chloro-N - (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -4- (trifluoromethyl) -1H-pyrazole-3-carboxamide (P2233), 5- (difluoromethyl) -4-methyl- N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P2234), 4- (difluoromethyl) -5-methyl-N- (2- phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P2235), 5-chloro-4- (difluoromethyl) -N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P2236), 4-chloro-5 - (difluoromethyl) -N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P2237), N- (2- (2-methoxypyridin- 3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2238), N- (2- (2-ethoxypyridin -3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2239), N- (2- (2- (difluoromethoxy) pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2240 ), 4,5-dimethyl-N- (2- (2- (trifluoromethyl) pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P -2241), N- (2- (2,6-dimethoxypyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide ( P-2242), N- (2- (5-cyclopropylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P -2243), N- (2- (5,6-dimethylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P- 2244),

PZ / 5321 / AG

EP 2 935 248 B1

N- (2- (2-fluoropyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2245), 4 , 5-dimethyl-N- (2- (2-methylpyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P2246), N- (2- (2-ethoxypyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2247), N- ( 2- (2-isopropoxypyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2248), N- (2- (3-chloro-2-methoxypyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P- 2249),

N- (2- (3-chloropyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2250), 4 , 5-dimethyl-N- (2- (3-methylpyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P2251), 4, 5-dimethyl-N- (2- (2- (pyrrolidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P -2252),

N- (2- (5-fluoropyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2253), 4 , 5-dimethyl-N- (2- (5- (trifluoromethyl) pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2254) , N- (2- (6-cyclopropylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2255),

N- (2- (5-ethylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2256), N - (2- (2- (difluoromethyl) phenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2257), N - (2- (4-chloro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2258),

N- (2- (4-fluoro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2259), N - (2- (2,4-difluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2260), N- (2 - (3-cyano-2,4-difluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2261), N - (2- (4-fluoro-2,3-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2262 ), N- (2- (2- (difluoromethoxy) phenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2263), N- (2- (2- (difluoromethoxy) -3-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2264) ,

N- (2- (3,6-dihydro-2H-pyrazole-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3- carboxamide (P-2265)

PZ / 5321 / AG

EP 2 935 248 B1

4,5-dimethyl-N- (2- (2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5 -yl) -1H-pyrazole-3-carboxamide (P-2266), N- (2- (2,2-difluorobenzo [d] [1,3] dioxol-4-yl) -1H-pyrrolo [2,3-b ] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2267), N- [2- [2- (difluoromethoxy) -4-fluorophenyl] -1H-pyrrolo [2,3- b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2268)

N- [2- (6-fluoro-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2269)

N- [2- (5-cyano-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2270)

N- [2- (3,6-dihydro-2H-pyrazole-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5- carboxamide (P-2271) 3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] pyridine-4-carboxamide ( P-2272)

N- [2- (2,3-Dihydrobenzofuran-7-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2273) 3,4-dimethyl-N- [2- (3-piperazin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2274) 4- fluoro-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P2275)

N- [2- [3- (Isobutylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2276)

N- [2- (4-chloro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2277)

N- [2- (3-chloro-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2278)

N- [2- (4-fluoro-2,3-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2279)

N- [2- (2,6-difluoro-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2280)

N- [2- (2,2-difluoro-1,3-benzodioxol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole- 5 carboxamide (P-2281)

N- [2- (5,6-dimethyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2282)

N- [2- (6-fluoro-2-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2283)

N- [2- (4-methoxy-2,3-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2284) 3- [4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -3-methylpyrazol-1-yl] tert-Butyl azetidine-1-carboxylate (P-2285) N- [2- [1- (azetidin-3-yl) -3-methylpyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin- 5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2286)

PZ / 5321 / AG

EP 2 935 248 B1

3- (difluoromethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-5-carboxamide (P-2287) acid 4 - [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -2-fluorobenzoic acid (P-2292) 2- [ 3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] phenyl] acetic acid (P-2293) acid 1 - [4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] phenyl] cyclopropanecarboxylic acid (P-2294) 2- [4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] phenyl] acetic acid (P-2295 ) 4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -2-methylbenzoic acid (P-2296) 3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -2-methylbenzoic acid (P-2297)

3,4-dimethyl-N- (2-methyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2302) N, 3,4-trimethyl- N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2304) N- [2- (2,3-dihydro-1, 4-benzodioxin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2305) 4- [4- [5 Tert-Butyl - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] pyrazol-1-yl] piperidine-1-carboxylate (P -2306) or

N- [2- (Cyclohexen-1-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2307) or pharmaceutically acceptable thereof salts, hydrates, solvates, tautomers or isomers. In some embodiments, a pyrazole ring group:

<img file="PL2935248T3_D0075.tif" />

in any of the compounds P-2001 to P-2273 and P-2274 to P-2307 may be in tautomeric form:

IHN J,; N / 'where the wavy line indicates the point of attachment to the rest of the molecule.

[0181] In some embodiments, the disclosure provides a compound of formula (IVa-2) or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof.

[0182] In some embodiments, the disclosure provides any of the compounds selected from P-2005, P-2007, P-2008, P-2009, P-2010, P-2019, P-2023, P-2024, P- 2028, P-2029, P-2031, P-2034, P2036, P-2038, P-2039, P-2042, P-2043, P-2046, P-2047, P-2048, P-2049, P- 2056, P-2057, P-2058, P2059, P-2060, P-2061, P-2062, P-2063, P-2064, P-2065, P-2066, P-2067, P-2068, P- 2069, P-2070, P2073, P-2074, P-2075, P-2076, P-2077, P-2078, P-2079, P-2080, P-2081, P-2082, P-2083, P- 2084, P2085, P-2086, P-2087, P-2088, P-2089, P-2090, P-2091, P-2092, P-2093, P-2094, P-2095, P-2096, P2097, P-2098, P-2099, P-2100, P-2101, P-2102, P-2104, P-2105, P-2106, P-2107, P-2108, P-2109, P2110, P-2111, P-2112, P-2113, P-2115, P-2116, P-2117, P-2118, P-2120, P-2121, P-2122, P-2123, PPZ / 5321 / AG

EP 2 935 248 B1

2124, P-2125, P-2126, P-2128, P-2129, P-2130, P-2132, P-2133, P-2134, P-2135, P-2136, P-2137, P2138, P- 2139, P-2140, P-2143, P-2146, P-2147, P-2148, P-2149, P-2153, P-2154, P-2155, P-2156, P2157, P-2158, P- 2159, P-2160, P-2161, P-2163, P-2164, P-2165, P-2167, P-2168, P-2169, P-2170, P2171, P-2172, P-2173, P- 2174, P-2175, P-2176, P-2177, P-2178, P-2179, P-2180, P-2181, P-2182, P2183, P-2184, P-2185, P-2186, P- 2187, P-2188, P-2189, P-2190, P-2191, P-2192, P-2193, P-2194, P2195, P-2196, P-2197, P-2198, P-2199, P-2200, P-2201, P-2202, P-2203, P-2204, P-2205, P-2206, P2207, P-2208, P-2209, P-2210, P-2211, P-2212, P-2213, P-2214, P-2215, P-2216, P-2217, P-2218, P2219, P-2220, P-2221, P-2222, P-2223, P-2224, P-2225, P-2226, P-2227, P-2228, P-2229, P-2230, P2231, P-2232, P-2233, P-2234, P-2235, P-2236, P-2237, P-2238, P-2239, P-2240, P-2241, P-2242, P2243, P-2244, P-2245, P-2246, P-2247, P-2248, P-2249, P-2250, P-2251, P-2252, P-2253, P-2254, P2255, P-2256, P-2257, P-2258, P-2259, P-2260, P-2261, P-2262, P-2263, P-2264, P-2265, P-2266, P2267, P-2268, P-2269, P-2270, P-2271, P-2272, P-2273, P-2274, P-2275, P-2276, P-2277, P-2278, P2279, P-2280, P-2281, P-2282, P-2283, P-2284, P-2285, P-2286, P-2287, P-2292, P-2293, P-2294, P2295, P-2296, P-2297, P-2302, P-2304, P-2305, P-2306 or P-2307 or its pharmaceutically acceptable salts , hydrates, solvates, tautomers or isomers.

Manufacturing method

[0183] According to another aspect, described herein is a method of preparing a compound of formula (IV) or any of the sub-formulas as described herein. The method comprises contacting a compound of formula (VI) or any sub-formula thereof:

with the agent of the formula:

<img file="PL2935248T3_D0076.tif" />

under conditions sufficient to produce a compound of formula (VIII):

<img file="PL2935248T3_D0077.tif" />

and reacting the compound of formula VIII with an agent of formula: G²- (R⁷)_m under conditions sufficient to produce a compound of formula (IV) wherein J.¹ is -NR⁵, -NH2, P¹NH-, P¹NO⁵-, -COOH or C (O) Q¹; G.¹ is -NH2, -COOH, or -C (O) Q²; and J² is halogen, tosylate, mesylate or triflate. P.¹ represents an amino protecting group. Q¹ and Q² are each independently -OH, halogen, C1-4 alkoxy or phenoxy. G.² is NH2, -B (OR⁵⁰) 2 or Sn (Bu) 3, where R.⁵⁰ is -OH, alkyl, or two -OR⁵⁰ together with the boron to which they are attached form an optionally substituted 5 or 6 membered ring. In one case,

PZ / 5321 / AG

EP 2 935 248 B1

BORON⁵⁰) 2 is 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl. The variables of R³, R⁴, R⁵, Y¹, Y², Y³ and A are as defined in any of the embodiments, and sub patterns and patterns as disclosed herein. In some embodiments, A is a fused pyrrole ring that together with the aromatic ring to which it is fused forms a pyrrolo [2,3-b] pyridine group. In other embodiments, A is a fused thiophene ring that together with the aromatic ring to which it is fused forms a thieno [3,2-b] pyridine group. In still other embodiments, A is a fused pyrazole ring that together with the aromatic ring to which it is fused forms a pyrazolo [3,4-b] pyridine group. In other embodiments, A is a fused benzene ring that together with the aromatic ring to which it is fused to form a quinoline group. In one implementation, J.² is the group I, Cl or Br and J.¹ is NH2 or NHP¹. In another implementation, G.² is 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl. In yet another embodiment, G.¹ means -COOH. In another implementation, G.¹ is -NH2. In some cases, the reaction between a compound of formula (VI) and an agent of formula (VII) may be carried out in the presence of a coupling agent. Exemplary coupling agents include, but are not limited to, benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (PyBOP), 1-methyl-3- (3-dimethylaminopropyl) carbodiimide (EDC), and O-benzotriazole-N, N, N 'hexafluorophosphate, NetramethylUuronium, NetramethylUuronium hexafluorophosphate. In some implementations, R.⁵⁰ is H. In some embodiments, G²- (R⁷) m is reacted with a compound of formula (VIII) in the presence of a palladium complex. In some cases, the palladium complexes include, but are not limited to, Pd (PPh₃)₄, palladium acetate, bis (diphenylphosphino) ferrocene] dichloropalladium, tris (dibenzylideneacetone) dipalladium (0), bis (triphenylphosphine) palladium (II) dichloride, etc. In some embodiments, compounds of Formula VI have sub-formula (VI-1), ( VI-2), (VI-3), (VI-4) or (VI-5):

<img file="PL2935248T3_D0078.tif" />

(VI-1) (yi-2) (VI-3) (Vl-4) (Vl-5) in which P² is H or an amino protecting group; J.¹ and J² are as defined in any of the embodiments and formulas disclosed herein; and Y² and Y³ are as defined in any of the embodiments and formulas disclosed herein. In some implementations, P.¹ and P²each independently are selected from 9-fluorenylmethoxycarbonyl, t-butoxycarbonyl, trimethylsilyl, t-butyldiphenylsilyl, phenylsulfonyl, 4-methylphenylsulfonyl or 2,6-dichlorophenylcarbonyl.

[0184] In some embodiments, the method of preparing a compound of Formula (IV) comprises contacting a compound of Formula VI with the agent G²- (R⁷)_m under conditions sufficient to produce a compound of formula (IX):

<img file="PL2935248T3_D0079.tif" />

and then reacting the compound of formula (IX) with an agent of formula:

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0080.tif" />

under conditions sufficient to make a compound of Formula IV. In some cases, the reaction between a compound of formula (IX) and an agent

<img file="PL2935248T3_D0081.tif" />

can be carried out in the presence of a coupling agent. Exemplary coupling agents include, but are not limited to, benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (PyBOP), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC), and O-benzotriazole-N, N, N ', N', N'tetronium hexafluorophosphate. In some cases, agent G.²- (R⁷)_m reacting with a compound of formula (VI) under basic conditions, e.g. in the presence of triethylamine or at a temperature above 100 ° C.

[0185] In some embodiments, the disclosure provides a method of preparing a compound of formulas (IVa), (IVb), (IVc), (IVd), or (IVe). The method includes (i) contacting any compound of formulas (VI-1), (VI2), (VI-2), (VI-3), (VI-4) or (VI-5) with an agent of formula:

<img file="PL2935248T3_D0082.tif" />

under conditions sufficient to produce a compound of the formulas (VI-1a), (VI-2a), (VI-3a), (VI-4a) or (VI-5a):

<img file="PL2935248T3_D0083.tif" />

(ii) reacting any compound of formulas (VI-1a), (VI-2a), (VI-3a), (VI-4a) or (VI-5a): with an agent of formula: G²- (R⁷)_m under conditions sufficient to produce a compound of the formulas (VI-1b), (IVb), (IVc), (IVd) or (VI-5b), respectively:

PZ / 5321 / AG

EP 2 935 248 B1 _WITH(R⁷) m

N

N

R³ R⁴

R³ R⁴

<img file="PL2935248T3_D0084.tif" />

(VI-lb) (VI-5b)

For compounds of formulas (VI-1b) protecting P² in compounds to form a compound that adequately protects P.² is performed or (VI-5b), the method further comprises the step of removing the group of formulas (VI-1b) or (VI-5b) under conditions sufficient to those of formulas (IVa) or (IVe). In one embodiment, removal of the group under basic conditions, e.g., in the presence of KOH. In some cases, the method also comprises preparing compounds of formulas (IVa), (IVb), (IVc), (IVd) or (IVe) by carrying out steps (i) and (ii) above in reverse order, e.g. first reacting any compound of formulas (VI-1), (VI-2), (VI-2), (VI-3), (VI-4), or (VI-5) with G²- (R⁷)_m and then by reacting with a compound of formula:

<img file="PL2935248T3_D0085.tif" />

The variables of R³, R⁴, R⁵, Y², Y³, m, r⁷ and P² in the sub-formulas (VI-1a), (VI-2a), (VI-3a), (VI-4a), (VI-5a), (VI-1b) and (VI-5b) have the meanings defined in any of embodiments, and sub patterns and patterns as disclosed herein. In one case, m is 1.

[0186] In one embodiment, G² is -B (OH) 2. In another implementation, G.² is 2-hydroxy-1,3,2 benzodioxaborol or 2-hydroxy-4,4,5,5-tetramethyl-1,3,2-benzodioxaborolan-2-yl. In another implementation, G.² means -Sn (Bu)₃.

[0187] According to another aspect, a method of preparing a compound of formula (V ') is described herein:

<img file="PL2935248T3_D0086.tif" />

The method comprises contacting a compound of formula (X):

<img file="PL2935248T3_D0087.tif" />

with a compound of formula: (XI): NH2-L²- R⁶ under conditions sufficient to make a compound of formula (V ') wherein J.² is halogen, tosylate, mesylate or triflate and the variables R³, R⁴, R⁵, Y¹, Y², Y³ and r¹ are as defined in any of the embodiments of the compounds of formulas (I '), (I'a), (I), (II), (III), (IV), (V) or (V') as described herein . In some embodiments, the reaction is carried out above 100 ° C under acidic conditions. In one embodiment, the reaction

PZ / 5321 / AG

The process can be carried out in the presence of an aqueous solution of hydrochloric acid. In some cases, J.² is Cl or Br. In some implementations, Y¹ is N and R¹ it only means a pair of electrons. In some cases, L.² means bond. In other cases, R.⁶ is aryl or heteroaryl, each of which is optionally substituted with 1 to 3 R &lt;2&gt; groups⁹; or from 1 to 3 R^c; or from 1 to 3 R^d; or from 1 to 3 R^e; or from 1 to 3 R¹⁵; or from 1 to 3 R¹⁶; or from 1 to 3 R¹⁷; or from 1 to 3 R¹⁹; or from 1 to 3 R²⁰.

[0188] In other embodiments, a synthetic intermediate of formula (XII) is described herein:

<img file="PL2935248T3_D0088.tif" />

in which J.¹ is -NR⁵, -NH2, P¹NH-, (P ^ N- or P1NR⁵in which P¹ is an amino protecting group; J.³ is -B (OR⁵⁰) 2, in which R.⁵⁰ is -OH, alkyl, or two -OR⁵⁰ together with the boron to which they are attached form an optionally substituted 5 or 6 membered ring. In some cases, the 5 or 6 membered ring is formed by two -OR groups⁵⁰ is optionally substituted with from 1 to 3 independently selected C groups_1-6alkyl. In one case, -B (OR⁵⁰) 2 is 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl, 5,5-dimethyl1,3,2-dioxaborate-2-yl or 4,4,6-trimethyl-1 , 3,2-dioxaborian-2-yl. Otherwise, -B (OR⁵⁰) 2 is 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl. Otherwise, R.⁵⁰ is H. The variables R⁵, Y¹, Y², Y³ and A are as defined in any of the embodiments, and sub patterns and patterns as disclosed herein. The intermediate is useful for the preparation of compounds of formula (I'a) or (IV) or any sub-formulas thereof. In some embodiments, A is a fused pyrrole ring that together with the aromatic ring to which it is fused forms a pyrrolo [2,3-b] pyridine. In other embodiments, A is a fused thiophene ring that together with the aromatic ring to which it is fused to form a thieno [3,2-b] pyridine group. In still other embodiments, A is a fused pyrazole ring that together with the aromatic ring to which it is fused forms a pyrazolo [3,4-b] pyridine group. In other embodiments, A is a fused benzene ring that together with the aromatic ring to which it is fused to form a quinoline group. In some embodiments, compounds of formula (XII) have the sub-formula (XII-1), (XII-2), (XII-3), (XII-4), or (XII5):

<img file="PL2935248T3_D0089.tif" />

in which P² is H or an amino acid protecting group. In one implementation, P²is H. In some embodiments, compounds of formula (XII) have a sub-formula selected from (XII-6), (XII-7), (XII-8), (XII-9), (XII-10) , (XII-11), (XII-12), (XII-13), (XII-14), (XII-15), (XII-16) or (XII-17):

PZ / 5321 / AG

EP 2 935 248 B1

<img file="PL2935248T3_D0090.tif" />

or in which P² is H or an amino acid protecting group. In one implementation, P²is H.

[0189] In some embodiments of the compounds of formula (XII) or any sub-formulas (XII1) through (XII-17), Y² stands for CR¹⁰ and Y³ means CH. In some cases, R.¹⁰ is H. In some embodiments, Y² is N and Y³ means CH. In other implementations, Y² stands for CR¹⁰ and Y³is N. In some embodiments, Y² and Y³ are CH. In certain embodiments of compounds of formula (XII) or any one of sub-formulas (XII-1) through (XII-17) as described herein, J¹is NH2. In certain embodiments of compounds of formula (XII) or any one of sub-formulas (XII-1) through (XII-17) as described herein, J³ is -B (OR⁵⁰) 2, in which R.⁵⁰ is -OH, alkyl or two -OR⁵⁰ substituents together with the boron to which they are attached form an optionally substituted 5 or 6 membered ring. In certain embodiments of compounds of formula (XII) or any sub-formula thereof (XII-1) through (XII-17) as described herein, J³ is 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl. In certain embodiments of compounds of formula (XII) or any sub-formula thereof (XII-1) through (XII-17) as described herein, P² is H. In one embodiment, J¹ is NH2, J.³ is -B (OR⁵⁰)₂where R.⁵⁰ is -OH, alkyl or two -OR⁵⁰ substituents together with the boron to which they are attached form an optionally substituted 5 or 6 membered ring. In one instance of compounds of formula (XII) or any of the sub-formulas (XII-1) through (XII-17) as described herein, J¹ is NH2 and J.³ is 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl.

Organic synthesis techniques

[0190] A wide variety of organic synthetic techniques are known in the art to facilitate the design of potential modulators. Many of these organic synthetic methods are described in detail in standard literature references used by those skilled in the art. One example of such a reference is March, 1994, Advanced Organic Chemistry; Reactions, Mechanisms and Structure, New York, McGraw Hill. Thus, techniques useful for synthesizing

PZ / 5321 / AG

Any potential modulator of kinase function is readily available to those skilled in the art of organic chemical synthesis.

Alternative compound forms or derivatives

[0191] The compounds contemplated herein are described with reference to general formulas and specific compounds. Moreover, the compounds of the disclosure can exist in a wide variety of forms or derivatives, all within the scope of this disclosure. Alternative forms or derivatives include, e.g. (a) prodrugs and active metabolites (b) tautomers, isomers (including stereoisomers and regioisomers) and racemic mixtures (c) pharmaceutically acceptable salts and (d) solid forms, including various crystalline, polymorphic or amorphous solids, including hydrates and solvates and other forms.

(a) Prodrugs and metabolites

[0192] In addition to the formulas and compounds described herein, the disclosure also includes prodrugs (generally pharmaceutically acceptable prodrugs), active metabolic derivatives (active metabolites), and pharmaceutically acceptable salts thereof.

[0193] Prodrugs are compounds or pharmaceutically acceptable salts which, when metabolized under physiological conditions or converted by solvolysis, yield the desired active compound. Prodrugs include, without limitation, esters, amides, carbamates, carbonates, ureides, solvates or hydrates of the active compound. Typically, the prodrug is inactive or less active than the active compound, but may provide one or more advantages such as favorable handling, administration, and / or metabolic properties. For example, some prodrugs are active compound esters; and during metabolism, the ester group is cleaved off to give the active drug. Esters include, for example, esters of an acid carboxyl group, or the S-acyl or O-acyl derivatives of a thiol, alcohol or phenol. In this context, a common example is a carboxylic acid alkyl ester. Prodrugs can also include variants in which the -NH group of the compound has been acylated, such as the 1-position of the 1H-pyrrolo [2,3-b] pyridine ring or the sulfonamide nitrogen of the compounds as described herein, where cleavage of the acyl group provides a free - NH active drug. Certain prodrugs are activated enzymatically to produce the active compound, or the compound may then undergo a chemical reaction to produce the active compound. Prodrugs can be converted from a prodrug form to an active form in a single step, or one or more intermediates can be formed which may have some activity or may be inactive.

[0194] As described in the Practice of Medicinal Chemistry, Ch. 31-32 (Ed. Wermuth, Academic Press, San Diego, CA, 2001), prodrugs can be conceptually divided into two non-exclusive categories, bioprecursor prodrugs and carrier prodrugs. Generally, bioprecursor prodrugs include compounds that are inactive or have little activity as compared to the corresponding active compound, drug, that contain one or more protecting groups and are converted to the active form by metabolism or solvolysis. Both the active drug form and any metabolic products released should exhibit acceptably low toxicity. Typically, the formation of an active drug compound involves a metabolic process or reaction that is one of the following types:

[0195] Oxidation Reactions: The oxidation reaction is exemplified without being limited by reactions such as the oxidation of alcohol, carbonyl and acid functional groups, hydroxylation

PZ / 5321 / AG

EP 2 935 248 B1 of aliphatic carbon atoms, hydroxylation of alicyclic carbon atoms, oxidation of aromatic carbon atoms, oxidation of carbon-carbon double bonds, oxidation of nitrogen atom-containing functional groups, oxidation of silicon, phosphorus, arsenic and sulfur, oxidizing N-dealkylation, oxidizing O- and Sdealkylation, oxidative deamination as well as other oxidation reactions.

[0196] Reduction Reactions: Reduction reactions are exemplary, without being limited by reactions such as reduction of carbonyl functional groups, reduction of alcohol functional groups and carbon-carbon double bonds, reduction of nitrogen-containing functional groups, and other reduction reactions.

[0197] Reactions without changing the oxidation state: Reactions without changing the oxidation state are exemplified, without limitation, by reactions such as ester and ether hydrolysis, hydrolytic cleavage of carbon-nitrogen single bonds, hydrolytic cleavage of a non-aromatic heterocycle, hydration and dehydration at multiple bonds, new atomic bonds resulting from dehydration reactions , hydrolytic dehalogenation, removal of hydrogen halide molecules and other such reactions.

[0198] Carrier prodrugs are drug compounds that contain a transport group that, eg, improves uptake and / or localized delivery to a site (s) of action. It is desirable for such a carrier prodrug that the bond between the drug group and the transport group is a covalent bond, the prodrug is inactive or less active than the drug compound, the prodrug and any releasing transport group are acceptably non-toxic. For prodrugs in which the transport group is expected to increase uptake, typically the release of the transport group should be rapid. In other cases, it is desirable to use a group that provides slow release, e.g., of certain polymers or other groups such as cyclodextrins. (See, e.g., Cheng et al., US Published Patent No. 20040077595, Application No. 10 / 656,838). Such carrier prodrugs are often beneficial for orally administered drugs. In some instances, a transport group provides targeted drug delivery, e.g., the drug can be conjugated to the antibody or antibody fragment. Carrier prodrugs can be, e.g. stability, water solubility, inhibition of undesirable organoleptic or physicochemical properties). For example, lipophilicity can be increased by esterifying hydroxyl groups with lipophilic carboxylic acids or carboxylic acid groups with alcohols, e.g. aliphatic alcohols. Wermuth, above.

[0199] Metabolites, e.g. active metabolites, overlap with prodrugs as described above, e.g. bioprecursor prodrugs. Thus, such metabolites are pharmacologically active compounds or compounds that are further metabolized to pharmacologically active compounds which are derivatives obtained from metabolic processes in the patient's body. Among them, active metabolites are such pharmacologically active derivative compounds. As for prodrugs, the prodrug compound is generally inactive or less active than the product of metabolism. As for active metabolites, the parent compound may either be an active compound or it may be an inactive prodrug. For example, in some compounds, one or more alkoxy groups can be metabolized to hydroxyl groups while maintaining pharmacological activity and / or carboxyl groups can be esterified, e.g., glucuronidation. In some cases, it may occur

PZ / 5321 / AG

There is more than one metabolite where the intermediate metabolite (s) is (are) further metabolized (metabolized) to obtain an active metabolite. For example, in some cases, a derivative of metabolic glucuronidation may be inactive or of low activity, and may be further metabolized to produce an active metabolite.

[0200] The metabolites of a compound can be identified using routine techniques known in the art, and their activities determined using assays such as those described herein. See, e.g., Bertolini et al., 1997, J. Med. Chem., 40: 2011-2016; Shan et al., 1997, J Pharm Sci 86 (7): 756-757; Bagshawe, 1995, Drug Dev. Res., 34: 220230; Wermuth, above.

(b) Tautomers, stereoisomers and regioisomers

[0201] It is understood that certain compounds may exhibit tautomerism. In such cases, the formulas shown herein clearly illustrate only one of the possible tautomeric forms. It is therefore understood that the formulas provided herein are intended to mean any tautomeric form of the compounds depicted and are not intended to be limited only to the specific tautomeric forms represented by the drawings of the formulas.

[0202] Similarly, certain compounds of the present disclosure can exist as stereoisomers, ie, have the same atomic linkage between the covalently bonded atoms but differ in the spatial orientation of the atoms. For example, the compounds can be optical stereoisomers that contain one or more chiral centers and can therefore exist in two or more stereoisomeric forms (e.g., enantiomers or diastereoisomers). Thus, such compounds may exist as single stereoisomers (ie, substantially free of other stereoisomers), racemates and / or mixtures of enantiomers and / or diastereoisomers. As another example, stereoisomers include geometric isomers such as the cis- or trans-orientations of the substituents on adjacent carbon atoms to form double bonds. All such individual stereoisomers, racemates, and mixtures thereof are intended to be within the scope of this disclosure. Unless otherwise indicated, all such stereoisomeric forms are embraced by the formulas given herein.

[0203] In some embodiments, the chiral compound of the present disclosure is in a form that comprises at least 80% of a single isomer (60% enantiomeric excess ("ee") or diastereomeric excess ("de")) or at least 85% (70%). % ee or de), 90% (80% ee or de), 95% (90% ee or de), 97.5% (95% ee or de), or 99% (98% ee or de). As will be generally understood by one skilled in the art, an optically pure compound having one chiral center is a compound that consists essentially of one of the two possible enantiomers (i.e., is enantiomerically pure) and an optically pure compound having more than one chiral center is a compound that is both diastereomerically pure and enantiomerically pure. In some embodiments, the compound is in optically pure form, wherein such optically pure form is produced and / or isolated by methods known in the art (e.g., using recrystallization techniques, chiral synthesis techniques (including synthesis from optically pure starting materials), and chromatographic separation. using a chiral column.

(c) Pharmaceutically acceptable salts

[0204] Unless otherwise indicated, the description of a compound herein includes the pharmaceutically acceptable salts of the compound. Thus, compounds described herein and cited in any of the claims may be in

PZ / 5321 / AG

They may be formulated as pharmaceutically acceptable salt forms or may be formulated as pharmaceutically acceptable salts. Contemplated pharmaceutically acceptable salt forms include, without limitation, mono, bis, tris, tetrakis, etc. Pharmaceutically acceptable salts are non-toxic in the amounts and concentrations at which they are administered. The preparation of such salts may facilitate pharmacological use by altering the physical properties of the compound without preventing them from exerting their physiological effects. Useful changes in physical properties include lowering the melting point to facilitate mucosal administration and increasing solubility to facilitate administration of higher drug concentrations. A compound of the disclosure may have sufficiently acidic, sufficiently basic, or both functional groups and accordingly may react with any of a number of inorganic or organic bases and inorganic and organic acids to form a pharmaceutically acceptable salt.

[0205] Pharmaceutically acceptable salts include acid addition salts such as those including chloride, bromide, iodide, hydrochloride, acetate, phenylacetate, acrylate, ascorbate, aspartate, benzoate, 2-phenoxybenzoate, 2-acetoxybenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methylbenzoate, bicarbonate, butyne-1,4-date, hexine-1,6-date, caproate, caprylate, chlorobenzoate, cinnamate, citrate, decanoate, formate, fumarate, glycolate, gluconate, glucarate, glucuronate, glucose-6-phosphate, glutamate, heptanoate, hexanoate, isethionate, isobutyrate, gamma-hydroxybutyrate, phenylbutyrate, lactate, malate, maleate, hydroxymaleate, methyl maleate, malonate, mandelate, nicotinate, nitrate, octoate, isoate pamoate, phosphate, monohydrogen phosphate, dihydrogen phosphate, orthophosphate, metaphosphate, pyrophosphate, 2-phosphoglycerate, 3-phosphoglycerate, phthalate, propionate, phenylpropionate, propiolate, pyruvate, quinate, salicylate, 4-aminosalicylate, sebacate, stearate, suberan, succinate, sulfate, metabisulfate, bisulfate, sulfite, bisulfate (IV), sulfamate, sulfonate, benzenesulfonate (i.e. besylate), ethanesulfonate (i.e. esylate), ethane 1,2 -disulfonate, 2-hydroxyethanesulfonate (i.e. isethionate), methanesulfonate (i.e., mesylate), naphthalene-1-sulfonate, naphthalene-2-sulfonate (i.e. napylate), propanesulfonate, p-toluenesulfonate (i.e. tosylate), xylene sulfonates, cyclohexyl sulfamate, tartrate and trifluoroacetate. These pharmaceutically acceptable acid addition salts can be prepared using the appropriate corresponding acid.

[0206] When acid functional groups such as carboxylic acid groups or phenolic groups are present in the molecule, pharmaceutically acceptable salts also include base addition salts such as those containing bases such as benzathine, chloroprocaine, choline, ethanolamine, diethanolamine, triethanolamine, t-butylamine, dicyclohexylamine, ethylenediamine, N, N'dibenzylethylenediamine, meglumine, hydroxyethylpyrrolidine, piperidine, morpholine, piperazine, procaine, aluminum, calcium, copper, iron, lithium, magnesium, manganese, potassium, sodium, zinc, ammonia, and mono-, di- or trialkylamines (e.g. diethylamine) or salts derived from amino acids such as L-histidine, L-glycine, L-lysine and L- arginine. For example, see Remington's Pharmaceutical Sciences, 29th Edition, Mack Publishing Co., Easton, PA, Vol. 2, p. 1457, 1995. These pharmaceutically acceptable base addition salts can be prepared using an appropriate corresponding base.

[0207] Pharmaceutically acceptable salts can be prepared using standard techniques. For example, the free base form of a compound can be dissolved in a suitable solvent such as water or a hydroalcoholic solution containing the appropriate acid, and then isolated by evaporating the solution. In another example, the salt can be prepared by reacting

PZ / 5321 / AG

The free base and acid in an organic solvent. When the specific compound is an acid, the desired pharmaceutically acceptable salt may be prepared by any suitable method, e.g., by treating the free acid with an appropriate inorganic or organic base.

(d) Other forms of relationship

[0208] For agents that are solids, one skilled in the art will understand that these compounds and salts may exist in various crystalline or polymorphic forms or may be formulated as co-crystals or may be amorphous or may exist in any desired form. their combinations (e.g. partially crystalline, partially amorphous, or mixtures of polymorphs), all of these forms are intended to be included within the scope of this disclosure and specific formulas. While salts are formed by adding acid / base i.e. the free base or free acid of the compound of interest undergoes an acid / base reaction with the corresponding added base or added acid, respectively, resulting in ionic charge interactions, co-crystals are new chemicals that are formed between neutral compounds, resulting in to a compound and additional molecular substances in the same crystal structure.

[0209] In some cases, the compounds of the disclosure are complexed using an acid or a base, including base addition salts such as ammonia, diethylamine, ethanolamine, ethylenediamine, diethanolamine, t-butylamine, piperazine, meglumine; acid addition salts such as acetate, acetylsalicylate, benzenesulfonate, camsylate, citrate, formate, fumarate, glutarate, hydrochloride, maleate, mesylate, nitrate, oxalate, phosphate, succinate, sulfate, tartrate, thiocyanate and tosylate; and amino acids such as alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine. By combining a compound of this disclosure with an acid or base, an amorphous complex is preferably formed rather than a crystalline material such as a conventional salt or co-crystal. In some cases, the amorphous form of the complex is improved by additional processing such as by spray drying, mechanochemical methods such as roller compaction, or microwave irradiation of the parent compound mixed with an acid or base. Such methods may also include the addition of ionic and / or nonionic polymeric systems, including, but not limited to, cellulose hydroxypropylmethylacetate succinate (HPMCAS) and methacrylic acid copolymer (e.g. Eudragit® L100-55), which then stabilize the amorphous properties of the complex. Such amorphous complexes offer several advantages. For example, lowering the melting point with respect to the free base facilitates additional processing, such as hot melt extrusion, to further improve the biopharmaceutical properties of the compound. Also, the amorphous complex crumbles more easily, which provides improved packing for the purpose of incorporating the solid into a capsule or tablet.

[0210] In addition, formulas are intended to include hydrated or solvated as well as non-hydrated or unsolvated forms of the identified structures. For example, the indicated compounds include both hydrated and non-hydrated forms. Other examples of solvates include structures in combination with a suitable solvent such as isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, or ethanolamine.

IV. Preparations and administration

PZ / 5321 / AG

EP 2 935 248 B1

[0211] In another aspect, the present disclosure provides pharmaceutical compositions comprising / including a pharmaceutically acceptable carrier, excipient, and / or diluent, and a compound of the disclosure described herein, or a pharmaceutically acceptable salt or solvate thereof. In an exemplary embodiment, the present disclosure provides a pharmaceutical formulation containing / including a compound as described herein. In some embodiments, the disclosure provides a pharmaceutical composition comprising / including a compound of formula (IVa-2) and a pharmaceutically acceptable carrier, excipient, and / or diluents.

[0212] The compounds for use in the methods and the compounds will typically be used in the treatment of human patients. Nevertheless, they can also be used to treat similar or identical indications in other animal patients. The compounds described herein can be administered by a variety of routes, including injection (i.e., parenteral, including intravenous, intraperitoneal, subcutaneous, and intramuscular), oral, transdermal, mucosal, rectal, or inhalation. Such dosage forms should allow the compound to reach target cells. Other factors are well known in the art and include considerations such as toxicity and dosage forms that delay the effects of a compound or composition. For information on techniques and formulations in general, see Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott, Williams and Wilkins, Philadelphia, PA, 2005.

[0213] In some embodiments, the compositions will contain pharmaceutically acceptable carriers or excipients, such as fillers, binders, disintegrants, lubricants, lubricants, complexing agents, solubilizers, and surfactants, which can be selected to facilitate administration. relationship in a particular way. Examples of carriers include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose or sucrose, types of starch, cellulose derivatives, gelatin, lipids, liposomes, nanoparticles, etc. The carriers also include physiologically compatible liquids such as solvents or for suspensions, including, e.g. Sterile Water for Injections (Water for Injections) solutions Water for injection (WFI), saline solution, dextrose solution, Hank's solution, Ringer's solution, vegetable oils, mineral oils, animal oils, polyethylene glycols, liquid paraffin, etc. colloidal silicon dioxide, silica gel, talc, magnesium silicate, calcium silicate, sodium aluminum silicate, magnesium silicate, powdered cellulose, macrocrystalline cellulose, carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose, sodium benzoate, calcium carbonate, magnesium stearate, aluminum stearate, calcium, magnesium stearate, zinc stearate, sodium stearyl fumarate, Syloid, Stear-O-Wet C, magnesium oxide, starch, sodium starch glycolate, glyceryl monostearate, glyceryl dibehenate, glyceryl palmitostearate, hydrogenated vegetable oil, hydrogenated cottonseed oil, castor oil, mineral oil, polyethylene glycol (e.g. PEG 4000-8000), polyoxyethylene glycol, poloxamers, crosparmonium, crosphorous sodium salt casein, methacrylic acid and divinylbenzene copolymer, docusate sodium, cyclodextrin (e.g. 2-hydroxypropyl-delta, cyclodextrin), polysorbates (e.g. polysorbate 80), cetrimide, TPGS (d-alpha-tocopheryl polyethylene glycol 1000 succinate), magnesium lauryl sulfate, sodium lauryl sulfate, polyethylene glycol ethers, polyethylene glycol di fatty acid ester or polyethylene glycol ester of polyoxyethylene (e.g. oxyalkenesorbitol) polyoxyethylene sorbitol , polyoxyethylene sorbitan fatty acid esters, sorbitol fatty acid ester, e.g. fatty acid ester of sorbitol from a fatty acid such as oleic, stearic or palmitic acid, mannitol, xylitol, sorbitol,

PZ / 5321 / AG

EP 2 935 248 B1 maltose, lactose, lactose monohydrate or spray dried lactose, sucrose, fructose, calcium phosphate, dibasic calcium phosphate, tribasic calcium phosphate, calcium sulfate, dextrans, dextran, dextrin, dextrose, cellulose acetate, polysimeticone, symtodicon , chitosan, gelatin, HPMC (hydroxypropylmethyl cellulose), HPC (hydroxypropyl cellulose), hydroxyethyl cellulose etc.

[0214] The pharmaceutical preparation may be in unit dosage forms containing a predetermined amount of active ingredient per unit dose. Such a unit may contain, for example, from 0.5 mg to 1 g, preferably from 1 mg to 700 mg, more preferably from 5 mg to 100 mg of a compound of this disclosure (as a free base, solvate (including hydrate) or salt, in any given manner. form) depending on the condition to be treated, the route of administration and the age, weight and condition of the patient. Preferred unit dose formulations are those containing a daily dose, a weekly dose, a monthly dose, or a sub-dose thereof, of the active ingredient. Moreover, such a pharmaceutical preparation can be prepared by any means well known in the pharmaceutical art.

[0215] The pharmaceutical formulation may be adapted for administration by any suitable route, e.g., the oral route (including capsules, tablets, liquid-filled capsules, disintegrating tablets, immediate, delayed and controlled release tablets, oral films, solutions, syrups, buccal and buccal). sublingual), rectal, intranasal, inhalation, topical (including transdermal), vaginal or parenteral (including subcutaneous, intramuscular, intravenous or intradermal). Such preparations may be prepared by any method known in the art of pharmacy, for example, by combining the active ingredient with the carrier (s), excipient (s) or diluent. Generally, the carrier, excipient, or diluent used in the pharmaceutical formulation is "non-toxic", meaning it is / are found to be safe / safe to use in the amount provided in the pharmaceutical composition, and "inert", meaning it does not react. they react substantially with the therapeutic activity of the active ingredient or do not have an undesirable effect thereon.

[0216] In some embodiments, oral administration may be used. A pharmaceutical preparation for oral use can be formulated into conventional oral dosage forms such as discrete capsule units, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops. The compounds described herein can be combined with solid excipients, optionally grinding the resulting mixture and processing the granule mixture, after adding suitable adjuvants if desired, to obtain, e.g., tablets, coated tablets, hard capsules, soft capsules, solutions (e.g. water, alcohol or oil solutions) etc. Suitable excipients are, in particular, fillers such as sugars, including lactose, glucose, sucrose, mannitol, or sorbitol; cellulose preparations, e.g. corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose (CMC) and / or poly (vinylpyrrolidone) (PVP: povidone); oily excipients, including vegetable and animal oils such as sunflower oil, olive oil or cod liver oil. Oral dosage formulations can also contain disintegrants, such as cross-linked poly (vinylpyrrolidone), agar, or alginic acid or a salt thereof such as sodium alginate; a lubricant such as talc or magnesium stearate; a plasticizer such as glycerol or sorbitol; a sweetening agent such as sucrose, fructose, lactose or aspartame; a natural or artificial flavor such as peppermint, oil of wintergreen or cherry flavor; or dyes or

PZ / 5321 / AG

EP 2 935 248 B1

100 pigments that can be used to identify or characterize various dosages or combinations, such as a unit dose. Dragee cores with suitable shells are also provided. For this purpose, concentrated sugar solutions may be used, which may optionally contain, for example, gum arabic, talc, polyvinylpyrrolidone, Carbopol gel, polyethylene glycol and / or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Oral fluids such as solutions, syrups, and elixirs can be prepared in unit dosage form so that a given amount contains a predetermined amount of the compound.

[0217] A pharmaceutical preparation that can be used orally includes push-fit capsules made of gelatin ("gelcaps") as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.

[0218] In some embodiments, injection (parenteral administration) may be used, e.g., intramuscularly, intravenously, intraperitoneally, and / or subcutaneously. The injectable compounds described herein may be formulated in sterile liquid solutions, preferably physiologically compatible buffers or solutions such as saline solution, Hank's solution, or Ringer's solution. Dispersions can also be prepared in non-aqueous solutions such as glycerol, propylene glycol, ethanol, liquid polyethylene glycols, triacetin, and vegetable oils. The solutions may also contain a preservative such as methylparaben, propylparaben, chlorobutanol, phenol, sorbic acid, thiomersal, and the like. In addition, the compounds may be formulated in solid form, including, e.g., lyophilized form, and redissolved or suspended prior to use. The formulations may be presented in unit-dose or multi-dose containers, e.g., sealed ampoules and vials, and may be stored in a freeze-dried (freeze-dried) condition requiring only the addition of a sterile liquid carrier, e.g., water for injection, immediately prior to use.

[0219] In some embodiments, mucosal, topical, or transdermal administration may be used. In such formulations of the compounds described herein, penetrants suitable for the penetration barrier are used. Such penetrants are generally known in the art and include, for example, for mucosal administration, a bile acid salt and fusidic acid derivatives. In addition, detergents can be used to facilitate permeation. Mucosal administration can be e.g. by nasal spray or suppositories (rectal or vaginal (pessaries)). Topical compositions of the compounds described herein may be formulated as oils, creams, lotions, ointments and the like by selecting the appropriate carriers known in the art. Suitable carriers include vegetable or mineral oils, white petroleum jelly (white soft paraffin), branched chain fats or oils, animal fats and high molecular weight alcohol (above C₁₂). In some embodiments, the carriers are selected so that the active ingredient is soluble. Emulsifiers, stabilizers, humectants and antioxidants as well as colorants or flavors, if desired, can also be included. Topical creams are preferably formulated with a mixture of mineral oil, self-emulsifying beeswax and water to which is added a mixture of the active ingredient dissolved in a small amount of solvent (e.g. oil). In addition, administration by transdermal means may include a transdermal patch or dressing such as

PZ / 5321 / AG

EP 2 935 248 B1

101 a bandage impregnated with the active ingredient and optionally one or more carriers or diluents known in the art. For administration in the form of a transdermal delivery system, the dosage administration in the dosage regimen will be continuous rather than intermittent.

[0220] In some embodiments, compounds are administered as inhalants. The compounds described herein may be formulated as a dry powder or as a suitable solution, suspension or aerosol. Powders and solutions can be formulated with suitable additives known in the art. For example, powders may include a suitable powder base such as lactose or starch, and the solutions may contain propylene glycol, sterile water, ethanol, sodium chloride, and other additives such as acidic, basic, and buffer salts. Such solutions or suspensions may be administered by inhalation via a spray, pump, atomiser or nebulizer etc. The compounds described herein may also be used in combination with other inhalable therapeutic agents, e.g. corticosteroids such as fluticasone propionate, beclomethasone dipropionate, triamcinolone acetonide, budesonide, and mometasone furainate; beta agonists such as albuterol, salmeterol and formoterol; anticholinergic agents such as ipratropium or tiotropium bromide; vasodilators such as treprostinal and iloprost; enzymes such as DNAse; therapeutic proteins; immunoglobulin antibodies; an oligonucleotide such as single or double stranded DNA or RNA, siRNA; antibiotics such as tobramycin; muscarinic receptor antagonists; leukotriene antagonists; cytokine antagonists; protease inhibitors; sodium cromolyn; nedocryl sodium and sodium chromoglycate.

[0221] The amounts of the various compounds to be administered can be determined by standard procedures taking into account factors such as compound activity (in vitro, e.g., compound IC50 vs target, or in vivo activity in animal efficacy models), pharmacokinetic results in animal models (e.g. half-life or bioavailability), the age, size and weight of the subject, and the disorder in the subject. The importance of these and other factors is well known to those of ordinary skill in the art. Generally, the dose will be in the range of about 0.01 to 50 mg / kg, also about 0.1 to 20 mg / kg of the patient to be treated. Multiple doses can be used.

[0222] The compounds described herein can also be used in combination with other therapies to treat the same disease. Such use in combination includes administering the compounds and one or more other therapeutic agents at different times or concurrently administering the compound and one or more other therapies. In some embodiments, dosages can be modified for one or more compounds of this disclosure or other therapeutic agents used in combination, e.g. reduce the dosage amount with respect to the compound or therapy administered alone, by methods well known to those of ordinary skill in the art.

[0223] It is understood that the use in combination includes use with other therapies, drugs, medical treatments, etc., where the other treatment or procedure may be applied at different times (e.g., within a short period of time, such as within a few hours (e.g. , 2, 3, 4-24 hours) or at a longer time (e.g. 1-2 days, 2-4 days, 4-7 days, 1-4 weeks)) than the compound described herein or at the same time as the compound described herein relationship. Use in combination also includes use with a therapy or therapeutic procedure that is used once or on rare occasions such as surgery, with a compound described herein administered short or longer before or after another therapy or procedure. In some embodiments, the present disclosure provides the provision of a compound described herein and one or more other pharmacological therapeutic agents delivered by a variety of modes of administration.

PZ / 5321 / AG

EP 2 935 248 B1

102 or the same mode of administration. Use in combination for any route of administration includes providing a compound as described herein and one or more other pharmacological therapeutic agents delivered by the same route of administration together in any formulation, including formulations in which the two compounds are chemically linked such that when administered, they retain their therapeutic activity. . In one aspect, another drug therapy can be co-administered with a compound described herein. Use in combination by co-administration includes the administration of a combination formulation or formulation of a chemically combined compound, or the administration of two or more compounds in separate formulations closely spaced from each other (e.g., within an hour, 2 hours, 3 hours, up to 24 hours) when administered as such. by itself or by a different route. Co-administration of separate formulations includes simultaneous administration by delivery through one device, e.g., the same inhalation device, the same syringe, etc., or administration from separate devices within a short period of time from each other. Combination preparations of a compound described herein and one or more additional pharmacological therapeutic agents delivered by the same route include the preparation of the materials together so that they can be administered in a single device, including separate compounds combined in a single formulation, or compounds that have been engineered to be chemically linked. but still retaining their biological activity. Such chemically linked compounds may have a bond that is substantially conserved in vivo, or the bond may break in vivo, separating the two active elements.

V. Disease indications and C-kit kinase modulations

Examples of C-kit or mutant C-kit diseases

[0224] The compounds of formula (IVa-2) as described herein are useful for the treatment of C-kit mediated disorders e.g. diseases associated with unregulated kinase signal transduction including, but not limited to, cell proliferative disorders, fibrotic disorders, and metabolic. As described in more detail below and in Lipson et al. US No. 20040002534 (US patent application no. No. 10/600, 868, filed June 23, 2003), cell proliferative disorders treatable using the present disclosure include cancers and mast cell proliferative disorders.

[0225] The presence of C-kit or the C-kit mutant has also been associated with many different types of cancer, diseases and conditions, as described below. Moreover, the relationship between abnormalities in C-kit and disease is not limited to cancer. As such, C-kit has been associated with malignancies, including mast cell tumors, small cell lung cancer, testicular cancer, and gastrointestinal stromal tumors. gastrointestinal stromal tumor (GIST), metastatic GIST, glioblastoma, astrocytoma, neuroblastoma, female genital tract carcinomas, neuroectodermal sarcomas, colorectal cancer, non-invasive carcinoma, Schwann cell tumor formation associated with neurofibromatosis, acute granulocytic leukemia (ang. acute myelocytic leukemia (AML), acute lymphocytic leukemia, chronic myeloid leukemia, mastocytosis, melanoma and mast cell tumors in dogs, and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection , hypereosinophilia, urticaria pigmentosa (urticaria) urticaria pigmentosa (UP), telangiectasia macularis eruptiva perstans (TMEP), slow systemic, systemic smoldering, aggressive systemic mastocytosis, mast cell leukemia and mast cell sarcoma. Occurrence

PZ / 5321 / AG

EP 2 935 248 B1

103 mutant forms of C-kit have been associated with diseases or conditions, e.g., gastrointestinal stromal tumors (GIST), mast cell leukemia, germ cell tumor, T cell lymphoma, mastocytosis, acute lymphocytic leukemia, and seminoma.

Examples of C-kit malignant diseases

[0226] Abnormal expression and / or activation of C-kit and / or a mutant form of C-kit has been associated with a variety of tumors (Roskoski, 2005, Biochemical and Biophysical Research Comm. 338: 13071315). Evidence for C-kit's involvement in neoplastic pathology includes its association with leukemias and mast cell tumors, small cell lung cancer, testicular cancer, and some cancers of the gastrointestinal tract and central nervous system. In addition, C-kit has been associated with a role in carcinogenesis of the female genital tract (Inoue et al., 1994, Cancer Res. 54 (11): 3049-3053), sarcomas of neuroectodermal origin (Ricotti et al., 1998, Blood 91: 2397- 2405) and tumor formation from Schwann cells associated with neurofibromatosis (Ryan et al., 1994, J. Neuro. Res. 37: 415432). Mast cells have been found to be involved in modifying the tumor microenvironment and enhancing tumor growth (Yang et al., 2003, J Clin Invest. 112: 1851-1861; Viskochil, 2003, J Clin Invest. 112: 1791-1793). Thus, C-kit is a useful target in the treatment of neurofibromatosis as well as malignant tumors.

[0227] Small cell lung cancer: The C-kit kinase receptor has been found to be abnormally expressed in many cases of small cell lung cancer (SCLC) cells (Hibi et al., 1991, Oncogene 6: 2291-2296). Thus, by way of example, inhibition of C-kit kinase may be beneficial in the treatment of SCLC, e.g., to extend the long-term survival of SCLC patients.

[0228] Leukemias: SCF binding to C-kit protects hematopoietic stem cells and progenitor cells from apoptosis (Lee et al., 1997, J. Immunol. 159: 3211-3219), thereby contributing to colony formation and hematopoiesis. C-kit expression is frequently observed in acute granulocytic leukemia (AML) and in some cases acute lymphocytic leukemia (ALL) (for reviews, see Sperling et al., 1997, Haemat 82: 617-621; Escribano et al., 1998, Leuk. Lymph. 30: 459-466). Although C-kit is expressed in most AML cells, its expression does not appear to be a prognostic factor for disease progression (Sperling, et al., 1997, Haemat 82: 617-621). Nevertheless, SCF protected AML cells against apoptosis induced by chemotherapeutic agents (Hassan et al., 1996, Acta. Hem. 95: 257-262). Inhibition of C-kit by the present disclosure will increase the efficacy of these agents and may induce apoptosis of AML cells.

[0229] The clonal growth of cells from patients with myelodysplastic syndrome (Sawada et al., 1996, Blood 88: 319-327) or chronic myeloid leukemia (CML) (Sawai et al., 1996, Exp. Hem. 2: 116) has been found to be -122) is significantly increased by SCF in combination with other cytokines. Chronic myeloid leukemia is characterized by the expansion of myeloid cells containing the Philadelphia chromosome (Verfaillie et al., Leuk. 1998, 12: 136-138), which appears to result essentially from inhibition of apoptotic death (Jones, Curr. Opin. Onc. 1997, 9: 3-7). It was reported that the Philadelphia chromosome product, p210^BCR-ABL, it mediates the inhibition of apoptosis (Bedi et al., Blood 1995, 86: 1148-1158). Since both Mr.^ABLas well as C-kit inhibits apoptosis and it has been suggested that p62^dock is a substrate (Carpino et al., Cell 1997, 88: 197-204), clonal expansion mediated by these kinases can occur via a common signaling pathway. Nevertheless, it has also been reported that C-kit interacts directly with p^210BCR-ABL (Hallek and

PZ / 5321 / AG

EP 2 935 248 B1

104 in., Brit. J Haem. 1996, 94: 5-16), suggesting that C-kit has a more causal role in CML pathology. Thus, inhibition of C-kit will be useful in the treatment of the above disorders.

[0230] Gastrointestinal cancers: The normal colon mucosa does not express C-kit (Bellone et al., 1997, J. Cell Physiol. 172: 1-11). Nevertheless, C-kit is frequently expressed in colon cancer (Bellone et al., 1997, J. Cell Physiol. 172: 1-11) and SCF and C-kit autocrine loops have been observed in several colon cancer cell lines (Toyota et al., et al., 1993, Turn Biol 14: 295-302; Lahm et al., 1995, Cell Growth &amp; Differ 6: 1111-1118; Bellone et al., 1997, J. Cell Physiol. 172: 1-11). Moreover, disruption of the autocrine loop by the use of neutralizing antibodies (Lahm et al., 1995, Cell Growth &amp; Differ. 6: 1111-1118) and downregulation of C-kit and / or SCF significantly inhibits cell proliferation (Lahm et al., 1995, Cell Growth &amp; Differ 6: 1111-1118; Bellone et al., 1997, J. Cell Physiol. 172: 1-11).

[0231] SCF / C-kit autocrine loops have been observed in gastric cancer cell lines (Turner et al., 1992, Blood 80: 374-381; Hassan et al., 1998, Digest. Dis. Science 43: 8-14) and constitutive activation of C-kit also appears to be important for gastrointestinal stromal tumors (GIST). Gastrointestinal stromal tumors are the most common mesenchymal tumor of the digestive system. Over 90% of GIST expresses C-kit which is consistent with the putative origin of these tumor cells from Cajal interstitial cells of Cajal (ICC) (Hirota et al., 1998, Science 279: 577-580). Cajal interstitial cells are believed to regulate gastrointestinal contraction, and patients who lacked C-kit ICC showed a myopathic form of chronic idiopathic pseudo-ileus (Isozaki et al., 1997, Amer. J. of Gast. 9 332-334). C-kit expressed in GIST from several different patients has been observed to have mutations in the intracellular perimembrane domain leading to constitutive activation of C-kit (Hirota et al., 1998, Science 279: 577-580). Thus, inhibition of C-kit kinase would be an effective agent for treating these cancers.

[0232] Overexpression or constitutive activation of Kit mutations has been associated with and associated with gastrointestinal stromal tumors (GISTs) and most GISTs contain oncogenic mutations of the KIT receptor or receptor tyrosine kinase PDGFRA (Miettinen et al., 2006, Arch Pathol Lab Med, 130: 14661478; Fletcher et al., 2007, Current Opinion in Genetics &amp; Development, 17: 3-7; and Frost et al. 2002, Molecular Cancer Therapeutics, 1: 1115-1124). Frost, et al., 2002 showed that the D816V KIT mutation is resistant to imatinib, such that additional types of C-kit inhibitors are useful. Many GISTs have activating mutations in the perimembrane regions of KIT (Lux et al., 2000, American Journal Pathology, 156: 795). The constitutive activation of Kit receptor tyrosine kinase is a central pathogenic event in most GISTs and generally results from oncogenic point mutations (Heinrich et al. 2002, Human Pathology, 33: 484-495). Inhibition of wild-type KIT and / or certain mutant KIT isoforms with a small molecule tyrosine kinase inhibitor has become the standard of care for the treatment of a patient with metastatic GIST (Schittenhelm et al. 2006, Cancer Res. 66: 473-481). Thus, inhibition of C-kit kinase and / or C-kit kinase mutant will be an effective agent for treating GIST.

[0233] Testicular carcinomas: male germ cell tumors have been histologically classified into seminomas, which retain germ cell properties, and non-seminomas, which may exhibit embryonic differentiation properties. Both seminomas and non-seminomas are believed to derive from a pre-invasive stage designated as carcinoma in situ (CIS) (Murty et al., 1998, Sem. Oncol. 25: 133-144). Both C-kit and SCF have been reported to be essential for normal gonadal development during embryogenesis (Loveland et al., 1997, J. Endocrinol 153: 337-344).

PZ / 5321 / AG

EP 2 935 248 B1

105

Loss of either the receptor or the ligand resulted in animals lacking germ cells. In the case of postnatal nuclei, C-kit was found to be expressed in Leydig cells and spermatogonia, while SCF was expressed in Sertoli cells (Loveland et al., 1997, J. Endocrinol 153: 337-344). Testicular tumors develop from Leydig cells at high frequency in transgenic mice expressing the oncogenes E6 and E7 of human papillomavirus 16 (HPV16) (Kondoh et al., 1991, J. Virol. 65: 3335-3339; Kondoh et al., 1994, J. Urol. 152: 2151-2154). These tumors express both C-kit and SCF, and the autocrine loop may contribute to tumor development (Kondoh et al., 1995, Oncogene 10: 341-347) associated with the loss of the cell of functional p53 and the product of the retinal glioma gene by association with E6 and E7 (Dyson et al., 1989, Science 243: 934-937; Werness et al., 1990, Science 248: 76-79; Scheffner et al., 1990, Cell 63: 1129-1136). Mutant SCFs with defective signaling (Kondoh et al., 1995, Oncogene 10: 341-347) or mutant C-kit kinases with defective signaling (Li et al., 1996, Canc. Res. 56: 4343-4346) inhibited the formation of testicular tumors in mice expressing HPV16 E6 and E7. Activation of C-kit kinase is critical to tumor development in these animals and thus modulation of the C-kit kinase pathway by the present disclosure will prevent or treat such disorders.

[0234] Expression of C-kit in germ cell tumors indicates that the receptor is expressed by most non-invasive and seminomas, but C-kit is only expressed in a minority of non-seminomas (Strohmeyer et al., 1991, Canc. Res. 51: 1811) -1816; Rajpert-de Meyts et al., 1994, Int. J. Androl. 17: 85-92; Izquierdo et al., 1995, J. Pathol. 177: 253-258; Strohmeyer et al., 1995, J Urol 153: 511-515; Bokenmeyer et al., 1996, J. Cancer Res. Clin. Oncol. 122: 301-306; Sandlow et al., 1996, J. Androl. 17: 403-408). Thus, inhibition of C-kit kinase provides an agent for treating these disorders.

CNS cancers: SCF and C-kit are expressed in the CNS of developing rodents and the pattern of expression indicates their role in the growth, migration and differentiation of neuroectodermal cells. Both the receptor and the ligand have been reported to be expressed in the adult brain (Hamel et al., 1997, J. Neuro-Onc. 35: 327333). C-kit expression has also been observed in normal human brain tissue (Tada et al. 1994, J. Neuro 80: 1063-1073). Immature glioma and astrocytoma, which define the majority of intracranial tumors, result from neoplastic transformation of astrocytes (Levin et al., 1997, Principles &amp; Practice of Oncology: 2022-2082). Expression of c-kit is observed in glioblastoma cell lines and tissues (Berdel et al., 1992, Canc. Res. 52: 3498-3502; Tada et al. 1994, J. Neuro 80: 10631073; Stanulla et al., 1995 , Act Neuropath 89: 158-165).

Cohen et al., 1994, Blood 84: 3465-3472 reported that all 14 neuroblastoma cell lines tested contained C-kit / SCF autocrine loops and both receptor and ligand expression was observed in 45% of the tumor samples tested. In two cell lines, anti-C-kit antibodies inhibited cell proliferation, suggesting that the SCF / C-kit autocrine loop contributed to growth (will be Cohen et al., 1994, Blood 84: 3465-3472). Thus, C-kit kinase inhibitors can be used to treat these cancers.

Examples of mast cell diseases requiring C-kit

[0237] Excessive activation of C-kit is also associated with diseases resulting from excess mast cells. Mastocytosis is a term used to describe a heterogeneous group of disorders characterized by excessive proliferation of mast cells (Metcalfe, 1991, J. Invest. Derm 93: 2S-4S; Golkar et al.,

PZ / 5321 / AG

EP 2 935 248 B1

106

1997, Lancet 349: 1379-1385). Increased expression of C-kit on mast cells of aggressive mastocytosis patients has been reported (Nagata et al., 1998, Leukemia 12: 175-181).

[0238] Furthermore, mast cells and eosinophils represent key cells involved in allergy, inflammation and asthma (Thomas et al., 1996, Gen. Pharmacol 27: 593-597; Metcalfe et al., 1997, Physiol Rev 77: 1033-1079; Naclerio et al., 1997, JAMA 278: 1842-1848; Costa et al., 1997, JAMA 278: 1815-1822). SCF, and thus C-kit, directly and indirectly regulates the activation of both mast cells and eosinophils, thereby influencing, through a number of mechanisms, the primary cells involved in allergy and asthma. Due to this reciprocal regulation of mast cell and eosinophil functions and the role that SCF may play in this regulation, inhibition of C-kit can be used to treat allergic chronic rhinitis, inflammation and asthma.

[0239] Mastocytosis: stimulation of c-kit by SCF (also known as mast cell growth factor) has been reported to be essential for the growth and development of mast cells (Hamel et al., 1997, J. Neuro-Onc. 35: 327-333. ; Kitamura et al., 1995, Int. Arch. Aller. Immunol. 107: 54-56). Mice with Ckit mutations that weaken their signaling activity showed significantly fewer mast cells in their skin (Tsujimura, 1996, Pathol Int 46: 933-938). Excessive activation of C-kit may be related to diseases resulting from excess mast cells.

[0240] In most patients, mastocytosis is confined to the skin, but in 15-20% of patients it may involve other organs (Valent, 1996, Wein / Klin Wochenschr 108: 385-397; Golkar et al., 1997, Lancet 349: 1379-). 1385). Even among patients with systemic mastocytosis, the disease can range from having a relatively mild prognosis to aggressive mastocytosis and mast cell leukemia. (Valent, 1996, Wein / Klin Wochenschr 108: 385-397; Golkar et al., 1997, Lancet 349: 1379-1385). C-kit kinase has been observed on malignant mast cells from canine mast cell tumors (London et al., 1996, J. Compar. Pathol. 115: 399-414) as well as on mast cells from patients with aggressive systemic mastocytosis ( Baghestanian et al., 1996, Leuk.:116-122; Castells et al., 1996, J. Aller. Clin. Immunol. 98: 831-840).

[0241] It has been shown that SCF is expressed on stromal cells as a membrane bound protein and its expression can be triggered by fibrogenic growth factors such as PDGF. It has also been shown to be expressed on keratinocytes as a membrane-bound protein in normal skin. Nevertheless, an increased amount of soluble SCF has been observed in the skin of patients with mastocytosis (Longley et al., 1993, New Engl. J. Med. 328: 1302-1307).

[0242] Mast cell chymase has been reported to cleave membrane-bound SCF into a soluble and biologically active form. This mast cell-mediated process can generate a feedback loop to enhance mast cell proliferation and function (Longley et al., 1997, Proc. Natl. Acad. Sci. 94: 9017-9021) and may be important in etiology mastocytosis. Transgenic mice overexpressing a form of SCF that could not be proteolytically released from keratinocytes do not develop mastocytosis, while similar animals expressing normal SCF in keratinocytes showed a phenotype resembling human cutaneous mastocytosis (Kunisada et al., 1998, J. Exp. Med. 187: 1565-1573). The formation of large amounts of soluble SCF can contribute to mastocytosis pathology in some patients and the present disclosure can treat or prevent such disorders by modulating the interaction between SCF and C-kit kinase. Several different C-kit mutations have been found in human and rodent mast cell tumor cell lines which resulted in constitutive kinase activity (Furitsu et al., 1993, J. Clin. Invest. 92: 1736-1744;

PZ / 5321 / AG

EP 2 935 248 B1

107

Tsujimura et al., 1994, Blood 9: 2619-2626; Tsujimura et al., 1995, Int. Arch. Aller. Immunol 106: 377-385; Tsujimura, 1996, Pathol Int 46: 933-938). In addition, activating mutations of the C-kit gene were observed in peripheral blood mononuclear cells isolated from patients with mastocytosis and associated hematological disorders (Nagata et al., 1998, Mastocytosis Leuk 12: 175-181) and in mast cells from a patient with pigmentary urticaria and aggressive mastocytosis (Longley et al., 1996, Nat. Gen. 12: 312-314). Thus, inhibition of C-kit kinase will prove to be an excellent therapeutic role in the treatment of these disorders.

[0243] In some patients, activating C-kit mutations may be responsible for the pathogenesis of the disease, and these patients may be treated or prevented by modulating the interaction of SCF with C-kit kinase. Activation of C-kit by SCF has been shown to prevent mast cell apoptosis, which may be critical in maintaining skin mast cell homeostasis (Iemura et al., 1994, Amer. J. Pathol 144: 321-328; Yee et al., 1994). , J. Exp. Med. 179: 1777-1787; Mekori et al., 1994, J. Immunol 153: 2194-2203; Mekori et al., 1995, Int. Arch. Allergy Immunol. 107: 137-138). Inhibition of mast cell apoptosis can lead to mast cell accumulation associated with mastocytosis. Thus, the observation of C-kit activation as a result of receptor overexpression, excessive formation of soluble SCF, or mutations in the C-kit gene that constitutively activate its kinase provides the rationale that inhibiting C-kit kinase activity will reduce the number of mast cells and benefit patients. with mastocytosis.

[0244] In cells with activating C-kit mutations, C-kit inhibitors have been found to inhibit or even kill cells (Ma et al., 2000, J Invest Dermatol. 114: 392-394), especially for mutations in a regulatory region (Ma et al., 2002, Blood 99: 1741-1744). Ma et al., 2002, also showed that, with regard to mutations in the catalytic region, inhibitors of STI571 (Gleevec) and SU9529 did not inhibit cells, so additional types of C-kit inhibitors are useful. Thus, C-kit inhibitors can be used against both wild-type C-kit and C-kit having mutations, e.g. activating mutations in the regulatory region and / or the catalytic region.

[0245] Mastocytosis has been shown to be characterized by a pathological increase in the number of tissue mast cells associated with mutations in KIT (Metcalfe, 2008, Blood, 112: 946-956; and Ma et al., 2002). The D816 C-kit mutation has been detected in patients with mastocytosis (Taylor et al., 2001, Blood, 98: 11951199; and Longley et al. 1999, Proc. Natl. Acad. Sci. 96: 1609-14). Inhibition of the oncogenic KIT KITD protein⁸¹The 6V small molecule tyrosine kinase inhibitor is able to treat patients with systemic mastocytosis (Shah et al., 2006, Blood, 108: 286-291). Thus, C-kit inhibitors can be used to treat patients with mastocytosis.

[0246] Asthma and Allergy: Mast cells and eosinophils represent key cells in parasitic infection, allergy, inflammation and asthma (Thomas et al., 1996, Gen. Pharmacol 27: 593-597; Metcalfe et al., 1997, Physiol Rev 77 : 1033-1079; Holgate, 1997, CIBA Found. Symp .; Naclerio, et al., 1997, JAMA 278: 1842-1848; Costa et al., 1997, JAMA 778: 1815-1822). SCF has been shown to be essential for the development, survival and growth of mast cells (Kitamura et al., 1995, Int. Arch. Aller. Immunol. 107: 54-56; Metcalfe et al., 1997, Physiol Rev 77: 1033-1079). In addition, SCF collaborates with the eosinophil specific regulator, IL-5, in enhancing the development of eosinophil progenitor cells (Metcalf et al., 1998, Proc. Natl. Acad. Sci., USA 95: 6408-6412). SCF has also been reported to induce mast cells to secrete factors (Okayama et al., 1997, Int. Arch. Aller. Immunol. 114: 75-77; Okayama et al., 1998, Eur. J. Immunol. 28: 708-). 715) that support the survival of eosinophils (Kay et al., 1997, Int. Arch. Aller.

PZ / 5321 / AG

EP 2 935 248 B1

108

Immunol. 113: 196-199), which may contribute to chronic eosinophilic inflammation (Okayama et al., 1997, Int. Arch. Aller. Immunol. 114: 75-77; Okayama et al., 1998, Eur. J.

Immunol. 28: 708-715). In this sense, SCF directly and indirectly regulates the activation of both mast cells and eosinophils.

[0247] SCF induces the release of mediators from mast cells as well as priming these cells for IgE-induced degranulation (Columbo et al., 1992, J. Immunol 149: 599-602) and sensitizing their reactivity to the major basic protein of eosinophil granules (Furuta et al., 1998, Blood 92: 1055-1061). Among the factors released by activated mast cells are IL-5, GMCSF and TNF-α, which influence the secretion of eosinophilic protein (Okayama et al., 1997, Int. Arch. Aller. Immunol. 114: 75-77; Okayama et al., 1998, Eur. J. Immunol. 28: 708-715). In addition to inducing the release of histamine from mast cells (Luckacs et al., 1996, J. Immunol. 156: 3945-3951; Hogaboam et al., 1998, J. Immunol. 160: 6166-6171), SCF promotes the mast cell production of the factor chemotactic agent for eosinophils, eotaxin (Hogaboam et al., 1998, J. Immunol. 160: 6166-6171) and infiltration by eosinophils (Luckacs et al., 1996, J. Immunol. 156: 3945-3951).

SCF also directly influences the adhesion of both mast cells (Dastych et al., 1994, J. Immunol. 152: 213-219; Kinashi et al., 1994, Blood 83: 1033-1038) and eosinophils (Yuan et al., 1997, J. Exp. Med. 186: 313-323), which in turn regulates tissue infiltration. Thus, SCF can affect primary cells involved in allergy and asthma through multiple mechanisms. Currently, corticosteroids are the most effective treatment for allergy-related chronic rhinitis and inflammation (Naclerio et al., 1997, JAMA 278: 1842-1848; Meltzer, 1997, Aller. 52: 33-40). These agents act by multiple mechanisms including reduction of circulating and infiltrating mast cells and eosinophils, and decreased eosinophil survival associated with inhibition of cytokine production (Meltzer, 1997, Aller. 52: 33-40). Steroids have also been reported to inhibit SCF expression by fibroblasts and solid connective tissue cells, leading to decreased mast cell survival (Finotto et al., 1997, J. Clin. Invest. 99 17211728). Due to the mutual regulation of mast cell and eosinophil function and the role that SCF may play in this regulation, inhibition of C-kit kinase will provide a means for treating allergic chronic rhinitis, inflammation and asthma.

Arthritis (e.g., rheumatoid arthritis): Due to the association of mast cells with the arthritis process (Lee et al., 2002, Science 297: 1689-1692), C-kit provides a useful target to prevent, delay and / or treating arthritis such as rheumatoid arthritis.

[0250] Multiple sclerosis: Mast cells have been shown to play a broad role in autoimmune disease as demonstrated in the mouse model of multiple sclerosis (MS), experimental allergic encephalomyelitis (EAE). It has been shown that mast cells are required for full disease manifestation. Secor et al., 2000, J Exp Med 191: 813-821. Thus, C-kit also provides a useful target for the prevention, delay and / or treatment of multiple sclerosis.

Kinase activity tests

[0251] A variety of kinase activity assays can be used to test active modulators and / or to determine the specificity of the modulator for a particular kinase or groups or kinases. In addition to the test mentioned in the examples below, a person of average skill in the field will know

PZ / 5321 / AG

EP 2 935 248 B1

109 other tests that can be used and may modify the test for a specific application. For example, numerous articles on kinases describe assays that can be used.

[0252] In certain embodiments, compounds of formula (IVa-2) as disclosed herein are active in an assay that measures the activity of C-kit and / or a C-kit protein kinase mutant. In some embodiments, the compound of formula (IVa-2) has an IC50 of less than 10,000 nM, 1,000 nM, less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM. as determined by the generally accepted C-kit kinase and / or C-kit mutant activity assay. In some embodiments, a compound as described herein has an IC50 of less than 10,000 nM, 1,000 nM, less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM, is determined in a generally accepted C-kit mutant activity assay (such as D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822K, N822H, Y823D, Y823C and T670I). In some embodiments, an assay for measuring C-kit kinase activity and / or a C-kit kinase mutant (such as D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A) , N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822K, N822H, Y823D, Y823C and T670I) includes the test (e.g. biochemical or cell-based assays) as described in Example 17 or an assay well known in the art similar to those described in Example 17.

[0253] In some embodiments, compounds of formula (IVa-2), as described herein, or a compound as described herein, are active in an assay that measures C-kit protein kinase activity and / or a C-kit mutant assay. (such as the D816V and / or V560G). In some embodiments, a compound as described herein has an IC50 of less than 10,000 nM, 1,000 nM, less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM, as determined by a generally accepted C-kit kinase activity assay (including a C-kit mutant kinase activity assay). In some embodiments, a compound as described herein has an IC50 of less than 100 nM, less than 10 nM, or less than 1 nM in an assay for mutant C-kit D816V and / or V560G.

C-kit kinase modulation

[0254] In another aspect, the disclosure provides a compound for use in a method of modulating or inhibiting C-kit and / or a C-kit kinase mutant. The compound for use in the method comprises administering to the patient an effective amount of a compound of formula (IVa-2) or a compound shown in Table 1, Table 2 or Table 3, or a compound P-2001 to P-2273 and P-2274 to P-2307 or a compound as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof, or a composition comprising a compound of any of the formulas described herein, thereby modulating or inhibiting C-kit and / or a C-kit kinase mutant. In some embodiments, C-kit is a wild-type kit kinase. In other embodiments, the C-kit kinase is a kit kinase mutant with a mutation selected from D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A, N822H, Del 550 -558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822K, N822H, Y823C23D and T670I. In one embodiment, the C-kit mutant has an activating mutation D816V and / or V560G. In some implementations,

PZ / 5321 / AG

EP 2 935 248 B1

110 a compound for use in the method comprises contacting a cell in vivo or in vitro with a compound of formula (IVa-2) as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof, or a composition containing a compound of formula (IVa-2). 2) as described here. In other embodiments, the compound for use in the method comprises contacting a C-kit kinase mutant in vivo or in vitro with a compound of formula (IVa-2), as described herein, or a pharmaceutically acceptable salt, hydrate, solvate, tautomer, or isomer thereof, or a composition comprising a compound of formula (IVa-2) as described herein.

VI. Compounds for use in methods of treating conditions mediated by C-kit kinase

[0255] In another aspect, the present disclosure provides a compound for use in a method of treating a patient suffering from diseases or conditions mediated by the C-kit protein kinase and or at risk of a C-kit protein kinase mutant. The compounds for use in the method include administering to the patient an effective amount of a compound of formula (IVa-2) or a compound disclosed in the examples, a compound shown in Table 1, Table 2 or Table 3, or a compound P-2001 to P-2273 and P-2274 to P-2307 or a compound as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers or isomers thereof, or a composition comprising a compound of formula (IVa-2) as described herein. In some embodiments, a C-kit kinase mutant has a mutation selected from D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822K, N822H, Y823C, or combinations thereof . In one embodiment, the C-kit mutant has an activating mutation D816. In one embodiment, the C-kit mutant has an activating mutation D816V. In another embodiment, the C-kit mutant has the V560G mutation. In yet another embodiment, the C-kit mutant has the D816V and V560G activating mutations. In some embodiments, a compound for use in a method comprises administering to a patient an effective amount of any one or more compounds as described herein in combination with one or more other treatments for a disease or condition.

[0256] In some embodiments, the disclosure provides a compound for use in a method of suppressing unwanted proliferation of tumor cells expressing a C-kit D816 protein kinase mutant (such as D816F, D816H, D816N, D816Y, or D816V) and / or V560G. A compound for use in the method comprises contacting tumor cells expressing the C-kit D816 protein kinase mutant (such as D816F, D816H, D816N, D816Y, or D816V) and / or V560G with an effective amount of a compound of formula (IVa2) or pharmaceutically acceptable salts, hydrates thereof , solvates, tautomers, or isomers, or a composition containing a compound as described herein. In some instances, the tumor cells express mutant C-kit D816V and / or V560G kinase.

[0257] In some embodiments, the disclosure provides a compound for use in a method of treating a patient with a C-kit D816 protein kinase mutation (such as D816F, D816H, D816N, D816Y, or D816V) and / or V560G. A compound for use in a method comprises administering to a patient in need an effective amount of a compound of formula (IVa-2) or a pharmaceutically acceptable salt, hydrate, solvate, tautomer, or isomer thereof, or a composition containing the compound as described herein. In some embodiments, the patient has the D816V mutation. In other embodiments, the patient has the V560G mutation. In some embodiments, the patient has the D816V and V560G mutations. In some cases, the patient suffers from gastrointestinal stromal tumors (GIST) and / or mastocytosis.

PZ / 5321 / AG

EP 2 935 248 B1

111

[0258] In some embodiments, diseases or conditions treatable with the compounds of the present disclosure include, but are not limited to, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease, seizures, and epilepsy; neoplastic diseases including, but not limited to, melanoma, glioblastoma, multiforme glioblastoma, filamentous astrocytoma, sarcoma, cancer (e.g. digestive tract, liver, bile ducts, bile duct (cancer of the bile ducts), large intestine, lung, gallbladder, breast, pancreas, thyroid, kidney, ovary, adrenal cortex, prostate), lymphoma (e.g. Histiocyte lymphoma) neurofibromatosis, gastrointestinal stromal tumors, acute myeloid leukemia, myelodysplastic syndrome, leukemia, tumor angiogenesis, neuroendocrine tumors such as medullary thyroid carcinoma, carcinoid tumor, small cell lung carcinoma, and chromophyllosarcoma; pain of neuropathic or inflammatory origin, including, but not limited to, acute pain, chronic pain, cancer pain, and migraine; cardiovascular diseases including, but not limited to, circulatory failure, ischemic stroke, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis and post-reperfusion injury; inflammation and / or proliferation including, but not limited to, psoriasis, eczema, arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, including, but not limited to, transplant organ rejection, graft versus host disease, and HIV-associated Kaposi's sarcoma; kidney, bladder, or prostate diseases including, but not limited to, diabetic nephropathy, renal cystic disease, nephrosclerosis, glomerulonephritis, prostate hyperplasia, polycystic liver disease, tuberous sclerosis, von Hippel-Lindau disease, medullary renal cystic disease, nephronophthosis, and cystic fibrosis ; metabolic disorders, including, but not limited to, obesity; infection, including but not limited to Helicobacter pylori infection, hepatitis and influenza viruses, fever, HIV and sepsis; pulmonary diseases including, but not limited to, chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); genetic developmental diseases including, but not limited to, Noonan syndrome, Costello syndrome, (facial and skeletal syndrome), LEOPARD syndrome, cardiofaciocutaneous syndrome (CFC) and neural crest abnormality syndrome causing diseases of the cardiovascular system, skeleton, gut, skin, hair and endocrine diseases; and diseases associated with muscle regeneration or degeneration including, but not limited to, sarcopenia, muscular dystrophies (including, but not limited to, Duchenne, Becker, Emery-Dreifuss, girdle-limb, facial-scapular muscular dystrophies) -brachial, myotonic, oropharyngeal, distal and congenital), motor neuron diseases (including, but not limited to, amyotrophic lateral sclerosis, progressive spinal muscular atrophy (childhood), spinal muscular atrophy (intermediate), spinal muscular atrophy (juvenile form), adult bulbospinal muscular atrophy and spinal muscular atrophy), inflammatory myopathies (including but not limited to dermatomyositis, polymyositis, and inclusion myositis), neuromuscular junction disorders (including but not limited to , myasthenia gravis, Lambert-Eaton syndrome and congenital myasthenic syndrome), endocrine myopathies (including, but not limited to, hyperthyroid myopathy and hypothyroid myopathy) peripheral nerve diseases (including, but not limited to, Charcot-Marie-Tooth disease, Dejerine-Sottas disease and Friedreich ataxia), other myopathies (including but not limited to , congenital myotonia, congenital paramotonia, central core disease, nemaline myopathy, myotubular myopathy and paralysis) and metabolic

PZ / 5321 / AG

EP 2 935 248 B1

112 Muscle diseases (including, but not limited to, phosphorylase deficiency, acid maltase deficiency, phosphoofructokinase deficiency, glycogen-splitting enzyme (debrancher) deficiency, mitochondrial myopathy, carnitine deficiency, carnitine-palmatyl-mutagenase deficiency, phosphoglycerinase deficiency, phosphoglycerinase deficiency, and myoadenylate deaminase deficiency). In one embodiment, the disease or condition is selected from the group consisting of melanoma, glioblastoma, multiforme glioblastoma, fibrillar astrocytoma, sarcoma, liver cancer, biliary cancer, biliary cancer (cholangiocarcinoma), colorectal cancer, lung cancer, follicular cancer. biliary, breast cancer, pancreatic cancer, thyroid cancer, kidney cancer, ovarian cancer, adrenal cortex cancer, prostate cancer, histiocytic lymphoma, neurofibromatosis, gastrointestinal stromal tumors, acute myeloid leukemia, myelodysplastic syndrome, leukemia, tumor angiogenesis, medullary thyroid cancer, carcinoid tumor, small cell lung cancer, Kaposi's sarcoma, phaeochromocytoma, acute pain, chronic pain, and renal cystic disease. In a preferred embodiment, the disease or condition is selected from the group consisting of melanoma, glioblastoma, multiforme glioblastoma, filamentous astrocytoma, colorectal cancer, thyroid cancer, lung cancer, ovarian cancer, prostate cancer, liver cancer, gallbladder cancer, tumors gastrointestinal stromal cancer bile duct cancer cholangiocarcinoma acute pain chronic pain and cystic kidney disease.

[0259] In other embodiments, diseases or conditions treatable with the compounds of the present disclosure include, but are not limited to, ischemic stroke, cerebrovascular ischemia, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, dementia. , atherosclerotic chorea, Huntington's disease, neoplastic disease, complications of neoplastic disease, hypoxia induced by chemotherapy, gastrointestinal stromal tumors, prostate tumors, mast cell tumors, mast cell tumors in dogs, acute myeloid leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, multiple myeloma, melanoma, mastocytosis, glioma, glioblastoma neuroma, sarcomas, sarcomas of neuroectodermal origin, smooth muscle myoma, lung cancer, breast cancer, pancreatic cancer, colon cancer, hepatocellular carcinoma, kidney cancer, cancer of the female genital tract, squamous cell carcinoma, non-infiltrating cancer, lymphoma, histiocyte lymphoma, non-Hodgkin's lymphoma, MEN2 syndromes, neurofibromatosis, Schwann cell carcinoma, myelodysplastic syndrome, leukemia, liver angiogenesis, cancer, cancer, cancer , skin cancer, brain cancer, central nervous system cancer, pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, colon cancer, bladder cancer, prostate cancer, gastrointestinal cancer, endometrial cancer, fallopian tube cancer, testicular cancer, ovarian cancer, neuropathic pain, inflammatory pain, acute pain, chronic pain, migraine, cardiovascular disease, circulatory failure, cardiac hypertrophy, thrombosis, thrombotic microangiopathy syndromes, atherosclerosis, post-reperfusion injury, ischemia, cerebrovascular ischemia, hepatic ischemia, inflammation, renal cystic disease, age-related macular degeneration, rheumatoid arthritis, allergic rhinitis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, Sjogren's syndrome, Wegener's granuloma, psoriasis, scleroderma, chronic Graves' disease, Based on , myasthenia gravis, multiple sclerosis, osteoarthritis, endometriosis, skin scarring, scarring

PZ / 5321 / AG

EP 2 935 248 B1

113 tissue, vascular restenosis, fibrotic disorders, hypereosinophilia, CNS inflammation, pancreatitis, nephritis, atopic dermatitis, hepatitis, immunodeficiency disease, severe combined immunodeficiency, organ transplant rejection, graft versus host disease, kidney disease, prostate disease, diabetic nephropathy, kidney sclerosis, glomerulonephritis, interstitial nephritis, lupus nephritis, prostatic hyperplasia, chronic kidney damage, tubular necrosis, diabetic renal complication, diabetic renal hyperplasia, type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, fatty liver, insulin resistance, hyperglycaemia, lipolysis, obesity, infection, Helicobacter pylori infection, influenza virus infection , fever, sepsis, pulmonary disease, chronic obstructive pulmonary disease, acute respiratory distress syndrome, asthma, allergy, bronchitis, emphysema, pulmonary fibrosis, genetic developmental diseases, Noonan syndrome, Crouzon syndrome, acrocephalosndactyly type I, Pfeiffer syndrome, Jackson-Weiss syndrome, Costello syndrome, facial-dermal skeletal syndrome, LEOPARD syndrome, cardio-facial-cutaneous syndrome, neural crest abnormality causing diseases of the cardiovascular system, skeleton, intestines, skin, hair or endocrine diseases, disorders of bone structure or mineralization, osteoporosis, increased risk of fracture, hypercalcemia, bone metastases, Graves' disease, Hirschsprung's disease, lymphoedema, selective T-cell defect, X-linked agammaglobulinemia, diabetic retinopathy, alopecia, impotence and tuberous sclerosis

[0260] In some embodiments, the disease is selected from the group consisting of mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GIST), metastatic GIST, glioblastoma, astrocytoma, neuroblastoma, female genital carcinomas, sarcomas of neuroectodermal origin, colorectal cancer, non-infiltrating cancer, Schwann cell tumor formation associated with neurofibromatosis, acute granulocytic leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, mastocytosis, pigment urticaria (UP), telangiectasia macularis eruptiva perstans (TMEP), systemic, slow systemic mastocytosis, systemic smoldering, aggressive systemic, mast cell leukemia, mast cell sarcoma, melanoma and mast cell tumors in dogs and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel disease syndrome, transplant rejection and hypereosinophilia. In some embodiments, the disease is a C-kit mediated or mediated by a C-kit mutant such as D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C80Y9G, D820Y9G, D820Y9G , N822K, N822H, Y823D, Y823C or T670I. In one embodiment, the disease is a disease mediated by a D816 mutant (such as D816F, D816H, D816N, D816Y, or D816V). In another embodiment, the disease is a D816V mutant mediated disease. In yet another embodiment, the disease is a V560G mutant mediated disease. In another embodiment, the disease is a D816V and V560G mutant mediated disease. In one embodiment, the disease is cancer, preferably selected from the group consisting of melanoma, glioblastoma, multiforme glioblastoma, filamentous astrocytoma, colorectal cancer, thyroid cancer, lung cancer, ovarian cancer, prostate cancer, liver cancer, gallbladder cancer, and neoplasms. gastrointestinal stromal cancer, bile duct cancer and bile duct cancer (cholangiocarcinoma). In one embodiment, the cancer is melanoma, colorectal cancer, thyroid cancer, or lung cancer.

PZ / 5321 / AG

EP 2 935 248 B1

114

[0261] In some embodiments, the disclosure provides a compound for use in a method of treating a disease or condition selected from urticaria pigmentosa (UP), telangiectasia macularis eruptiva perstans (TMEP), systemic mastocytosis, indolent systemic, systemic smoldering, systemic aggressive. , mast cell leukemia, mast cell sarcoma, GIST and metastatic GIST. A compound for use in a method comprises administering to a patient in need thereof an effective amount of any one or more compounds as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers or compositions thereof as described herein.

[0262] In some embodiments, the disclosure provides compounds for use in methods of treating any disease or condition mediated by the C-kit protein kinase, including any disease or condition mediated by a C-kit kinase mutant in an animal patient in need thereof. the method comprising administering to the patient an effective amount of any one or more compounds as described herein. In some embodiments, a compound for use in a method comprises administering to a patient an effective amount of any one or more compounds as described herein in combination with one or more other treatments for the disease or condition.

[0263] In certain embodiments, the disclosure provides compounds for use in methods of treating any disease or condition mediated by a mutant C-kit protein kinase D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557. -561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822K, N822H, Y823D, Y823C or T670I in an animal patient in need of it, the method comprising administering to the patient an effective amount of any one or more compounds as described herein. In some embodiments, a compound for use in a method comprises administering to a patient an effective amount of any one or more compounds as described herein in combination with one or more other treatments for the disease or condition. In some embodiments, a C-kit protein kinase mutant is a C-kit D816 kinase mutant (such as D816F, D816H, D816N, D816Y, or D816V). In one embodiment, the C-kit protein kinase mutant is a C-kit D816V mutant. In another embodiment, the C-kit protein kinase mutant is a C-kit V560G mutant. In another embodiment, the C-kit protein kinase mutant is a C-kit D816V / V560G mutant.

[0264] In some embodiments, the compound of formula (IVa-2) or the pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof or the composition comprising the compound as described herein is a C-kit inhibitor and / or a C-kinase mutant. kit and has an IC50 value of less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined by the generally accepted C-kit kinase activity assay. In some embodiments, a compound as described herein will have an IC value₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM or less than 1 nM for C-kit, C-kit D816V mutant, C-kit V560G mutant or D816V / V560G mutant . In some embodiments, a compound as described herein will selectively inhibit one or more mutant C-kit kinases with respect to one or more other mutant C-kit kinases.

[0265] In some embodiments, the disclosure provides a compound for use in a method for inhibiting a C-kit protein kinase mutant such as a D816V, V560G, or D816V / V560G protein kinase mutant. The compound for use in the method comprises contacting a compound of formula (IVa-2) or a composition containing a compound as described herein, or a pharmaceutically acceptable salt thereof.

PZ / 5321 / AG

EP 2 935 248 B1

115 hydrates, solvates, tautomers, or isomers with a cell or mutant protein kinase C-kit either in vitro or in vivo.

[0266] In some embodiments, the disclosure provides the use of a compound of formula (IVa-2) or a composition comprising a compound as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof in the manufacture of a medicament for treating a disease or condition. as described here. In other embodiments, the disclosure provides a compound of formula (IVa-2) or a composition comprising a compound as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers, or isomers thereof, for use in treating a disease or condition as described herein.

Combination therapy

[0267] Protein kinase modulators can be usefully combined with another pharmacologically active compound or two or more other pharmacologically active compounds, especially in the treatment of cancer. In one embodiment, the composition comprises any one or more compounds as described herein together with one or more compounds that are therapeutically effective for the same disease indication, wherein the compounds have a synergistic effect on the disease indication. In one embodiment, the composition comprises any one or more compounds as described herein that are effective in treating cancer and one or more other compounds are effective in treating the same cancer, further wherein the compounds are synergistically effective in treating cancer.

[0268] In some embodiments, the disclosure provides compounds for use in methods of treating a C-kit and / or C-kit protein kinase mutant mediated disease or condition in an animal patient in need thereof, the method comprising administering to the patient in an effective amount. any one or more compounds as described herein, or one or more compounds of formula (IVa-2) or pharmaceutically acceptable salts, solvates, tautomers or isomers, or a composition containing a compound as described herein, in combination with one or more other therapeutic agents as described herein. In some embodiments, the disclosure provides compounds for use in methods of treating a C-kit and / or C-kit protein kinase mutant mediated disease or condition in an animal patient in need thereof, the method comprising administering to the patient an effective amount of any one or more compounds as described herein, or one or more compounds of formula (IVa-2) or pharmaceutically acceptable salts, solvates thereof, tautomers or isomers, or a composition containing a compound as described herein, in combination with one or more other treatments for a disease or condition.

[0269] In some embodiments, the disclosure provides a composition, e.g., a pharmaceutical composition comprising a compound of formula (IVa-2) or a compound disclosed in the examples, a compound shown in Table 1, Table 2, or Table 3, or the compound P-2001 and P-2004 to P-2307, or a compound as described herein, or pharmaceutically acceptable salts, hydrates, solvates, tautomers or isomers thereof, and one or more other therapeutic agents. In some embodiments, the one or more other therapeutic agents are selected from an alkylating agent including, but not limited to, adozelesin, altretamine, bendamustine, bizelesin, busulfan, carboplatin, carboquone, carmofur, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine. , estramustine, etoglucide, fotemustine, hepsulfam, ifosfamide, improsulfan, irofulwen, lomustine, mannosulfan, mechlorethamine, melphalan, mitobronitol, nedaplatin, nimustin, oxaliplatin, piposulfan, prednimustin, procarbazine, ranimustin, satraplatin, semustine, streptozocin, temozolomide, thiotepa, treosulfan, triazinone,

PZ / 5321 / AG

EP 2 935 248 B1

116 triethylene melamine, triplatin tetranitrate, trophosphamide and uramustine; an antibiotic, including, but not limited to, aclarubicin, amrubicin, bleomycin, dactinomycin, daunorubicin, doxorubicin, elzamitrucin, epirubicin, idarubicin, menogaril, mitomycin, neocarcinostatin, penticubicin, penticubicin, and penticubicin; an antimetabolite, including, but not limited to, aminopterin, azacitidine, azathioprine, capecitrabine, cladribine, clofarabine, cytarabine, decitrabine, floxuridine, fludarabine, 5-fluorouracil, gemcitrabine, hydroxyurea, mercaptoprexabine, nelotrerexabine, nelotrexrexine, nelotrexrexabine, , trimethoprim, trimetrexate and vidarabine; immunotherapeutic agent, antibody therapy including, but not limited to, alemtuzumab, bevacizumab, cetuximab, galiximab, gemtuzumab, panitumumab, pertuzumab, rituximab, brentuximab, tositumomab, trastuzumab, 90 Y ibritumomab, Tilimum tibymab, anti-tibymab, Tilimum and 4 antibodies; a hormone or hormone antagonist, including, but not limited to, anastrozole, androgens, buserelin, diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelin, idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen, and toremifene; a taxane including, but not limited to, DJ-927, docetaxel, TPI 287, larotaxel, ortataxel, paclitaxel, DHA-paclitaxel, and tesetaxel; a retinoid, including, but not limited to, alitretinoin, bexarotene, fenretinide, isotretinoin, and tretinoin; an alkaloid including, but not limited to, demecolcin, homoharringtonine, vinblastine, vincristine, vindesine, vinflunine, and vinorelbine; an anti-angiogenic agent, including, but not limited to, AE-941 (GW786034, Neovastat), ABT-510, 2-methoxyestradiol, lenalidomide, and thalidomide; a topoisomerase inhibitor, including, but not limited to, amsacrine, belotecan, edotecarin, etoposide, etoposide phosphate, exatecane, irinotecan (also active metabolite SN-38 (7-ethyl-10-hydroxycamptothecin)), licantone, mitoxantrone, pixantrone, rubitecan, rubitecan teniposide, topotecan and 9-aminocamptothecin; a kinase inhibitor, including, but not limited to, axitinib (AG 013736), dasatinib (BMS 354825), erlotinib, gefitinib, flavopyridol, imatinib mesylate, lapatinib, motesanib diphosphate (AMG), nilotinib (AMN107), selafinib 706 (AMNiblib7), selafeniblib7 sunitinib, AEE-788, BMS-599626, UCN-01 (7-hydroxystaurosporine), vemurafenib, dabrafenib, PLX3397, selumetinib, and vatalanib; a targeted signal transduction inhibitor including, inter alia, bortezomib, geldanamycin and rapamycin; a biological response modifier including, but not limited to, imiquimod, interferon α, and interleukin 2; and other chemotherapeutic agents, including, but not limited to 3-AP (3-amino-2-carboxaldehyde-thiosemicarbazone), altrasentan, aminoglutethimide, anagrelide, asparaginase, briostatin 1, cilengitide, elesclomol, eribulin mesylate (E7389), ixabepilone, testonindolaconidamine, mesabepilone, lemonindolacetam thiazofurin, mTOR inhibitors (e.g. sirolimus, temsirolimus, everolimus, deforolimus), PI3K inhibitors (e.g. BEZ235, GDC-0941, XL¹47, XL765), Cdk4 inhibitors (e.g. PD-332991), Akt inhibitors, Hsp90 inhibitors (e.g. geldanamycin, radicycol, tanespimycin), farnesyl transferase inhibitors (e.g. tipifarnib) and aromatase inhibitors (anastrozole letrozole exemestane). In one embodiment, the compounds for use in a method of treating cancer comprise administering to the patient an effective amount of a composition comprising any one or more compounds of formula (IVa-2) or a compound as described herein in combination with a chemotherapeutic agent selected from capecytrabin, 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide, vinblastine, bevacizumab, cetuximab, interferon α, interleukin 2 or erlotinib. In another embodiment, the chemotherapeutic agent is a Mek inhibitor. Exemplary Mek inhibitors include, but are not limited to, AS703026, AZD6244 (selumetinib), AZD8330, BIX 02188, CI1040 (PD184352), GSK1120212 (JTP-74057), PD0325901, PD318088, PD98059, RDEA119 (BAY 869766 and U012-73366), TAK etoH. In another embodiment, the chemotherapeutic agent is a tyrosine kinase inhibitor. Exemplary tyrosine kinase inhibitors include, but are not limited to, AEE788, AG-1478

PZ / 5321 / AG

EP 2 935 248 B1

117 (tyrphostin AG-1478), AG-490, apatinib (YN968D1), AV-412, AV-951 (tivozanib), axitinib, AZD8931, BIBF1120 (Vargatef), BIBW2992 (afatinib), BMS794833, BMS-599626 -540215), brivanib alanate (BMS-582664), cediranib (AZD2171), chrysophanic acid (chrysophanol), crenolanib (CP-868569), CUDC-101, CYC116, ditinib dimylactic acid (TKI258 dimylic acid), E7080, Tarceva, CP-358774, OSI-774, NSC-718781), Peptinib (GSK1363089, XL880), gefitinib (ZD-1839 or Iressa), imatinib (Gleevec), imatinib mesylate, Ki8751, KRN 633, lapatinib (Tycerb), linifanib (ABT-869), masitinib (Masivet, AB1010), MGCD-265, motesanib (AMG-706-265) ), MP-470, mubritinib (TAK 165), neratinib (HKI-272), NVP-BHG712, OSI-420 (Desmethyl Erlotinib, CP473420), OSI-930, pazopanib hydrochloride, PD-153035 HCl, PD173074, pelitinib (EKB -569), PF299804, ponatinib (AP24534), PP121, RAF265 (CHIR-265), Raf265 derivative, regorafenib (BAY 734506), sorafenib tosylate (Nexavar), sunitinib malate (Sutent), telatinib (BAY 57-9352), TSU-68 (SU6668), vandetanib (Zactima), vatalanib dihydrochloride (PTK787), WZ3146, WZ4002, WZ8040, free base cabozantinib), XL647, EGFR siRNA, FLT4 siRNA, KDR siRNA, antidiabetic agents such as metformin, PPAR agonists (rosiglitazone, pioglitazone, bezafibrate, ciprofibrate, clofibrate, gemfibrozil, fenofibrate, indeglitazar, sittagliptyna, and sitagliptyna dutogliptin, gemigliptin, alogliptin). In another embodiment, the agent is an EGFR inhibitor. Exemplary EGFR inhibitors include, but are not limited to, AEE-788, AP-26113, BIBW-2992 (Tovok), CI1033, GW-572016, Iressa, LY2874455, RO-5323441, Tarceva (erlotinib, OSI-774), CUDC-101, and WZ4002. In one embodiment, a compound for use in a method of treating cancer comprises administering to the patient an effective amount of a composition containing any one or more compounds as described herein in combination with a chemotherapeutic agent selected from capecitrabine, 5-fluorouracil, carboplatin, dacarbazine, gefitinib. , oxaliplatin, paclitaxel, SN-38, temozolomide, vinblastine, bevacizumab, cetuximab, interferon α, interleukin 2, or erlotinib. In some embodiments, a kit protein kinase modulator, especially a compound of formula (IVa-2), or pharmaceutically acceptable salts, solvates, tautomer, or isomers thereof, may be administered simultaneously, sequentially, or separately in combination with one or more agents as described above.

[0270] In some embodiments, the disclosure provides compounds for use in methods of treating a disease or condition mediated by C-kit and / or a mutant C-kit kinase, including any mutations thereof, by administering to a patient an effective amount of a composition such as described herein, which includes any one or more compounds as described herein in combination with one or more other therapeutic agents as described herein. In other embodiments, the disclosure provides compounds for use in methods of treating a disease or condition mediated by C-kit and / or a mutant C-kit kinase, including any mutations thereof, by administering to a patient an effective amount of a composition as described herein. which comprises any one or more compounds as described herein in combination with one or more other suitable therapies for treating a disease or condition.

[0271] In some embodiments, there are provided compositions comprising a therapeutically effective amount of any one or more compounds as described herein, and at least one pharmaceutically acceptable carrier, excipient, and / or diluent, including combinations of any two or more compounds. as described here. The composition may then, include a wide variety of pharmacologically active compounds, which may include many compounds as described herein. In some embodiments, a composition may contain any one or more compounds as described herein, along with one or more compounds that are therapeutically effective for the same disease indication. IN

PZ / 5321 / AG

EP 2 935 248 B1

118 in one aspect, the composition comprises any one or more compounds as described herein together with one or more compounds that are therapeutically effective for the same disease indication, wherein the compounds have a synergistic effect on the disease indication. In one embodiment, the composition comprises any one or more compounds as described herein that are effective in treating cancer and one or more other compounds are effective in treating the same cancer, further wherein the compounds are synergistically effective in treating cancer. The compounds can be administered simultaneously or sequentially. [0272] In one embodiment, the disclosure provides compounds for use in methods of treating a disease or condition mediated by a C-kit kinase mutant such as a mutant D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558 kinase mutant. , Del 557-561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E , T801I, C809G, D820Y, N822K, N822H, Y823D, Y823C or T670I, by administering to a patient an effective amount of a composition containing any one or more compounds as described herein in combination with one or more other suitable therapies as described herein for treating a disease. In one embodiment, the disclosure provides compounds for use in methods of treating cancer mediated by a C-kit kinase mutant such as mutant D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557-558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C80Y9G, D820Y9G, D820Y9G , N822K, N822H, Y823D, Y823C or T670I, by administering to a patient an effective amount of a composition containing any one or more compounds as described herein. In one embodiment, the disclosure provides compounds for use in methods of treating cancer mediated by a mutant Ckit kinase such as mutant D816F, D816H, D816N, D816Y, D816V, K642E, Y823D, Del 550-558, Del 557-561, N822K, V654A, N822H, Del 550-558 + V654A, Del 557-561 + V654A, Ins503AY, V560G, 558NP, Del 557558, Del W559-560, F522C, Del 579, R634W, K642E, T801I, C809G, D820Y, N822H22 , Y823D, Y823C or T670I, by administering to a patient an effective amount of a composition containing any one or more compounds as described herein in combination with one or more appropriate anti-cancer therapies such as one or more drugs or chemotherapeutic agents as described herein. In one embodiment, the C-kit kinase mutant is a D816V kinase mutant. In another case, the C-kit kinase mutant is a V560G kinase mutant. In yet another embodiment, the C-kit kinase mutant has both the D816V and V560G mutations.

[0273] In some embodiments, the disclosure provides a compound for use in a method of treating cancer as described herein in a patient in need thereof by administering to the patient an effective amount of a compound or composition containing any one or more compounds as described herein. in combination with one or more other therapies or therapeutic treatments effective in the treatment of cancer. Other treatments or treatments include appropriate anti-cancer therapy (e.g. drug therapy, vaccinotherapy, gene therapy, photodynamic therapy) or therapeutic procedure (e.g., surgery, radiation therapy, hyperthermia therapy, bone marrow or stem cell transplant). In one embodiment, the one or more suitable cancer therapies or treatment treatments are selected from treatment with a chemotherapeutic agent (e.g., a chemotherapeutic drug), radiation therapy (e.g. X-rays, γ-rays or beams of electrons, protons, neutrons or α particles), hyperthermia therapy (e.g. microwave, ultrasound, radiofrequency ablation), vaccinotherapy (e.g. vaccine with the hepatocellular carcinoma AFP gene, AFP adenoviral vector vaccine, AG-858, allogeneic vaccine with breast cancer cells

PZ / 5321 / AG

EP 2 935 248 B1

119 GM-CSF secreting vaccines, dendritic cell peptide vaccines), gene therapy (e.g. Ad5CMV-p53 vector, adenovirus MDA7 encoding, adenovirus 5-tumor necrosis factor alpha), photodynamic therapy (e.g. aminolevulinic acid, lutetium motexafin), oncolytic viral therapy or bacterial, surgery, or bone marrow and stem cell transplantation. In some embodiments, the disclosure provides a compound for use in a method of treating cancer in a patient in need thereof by administering to the patient an effective amount of a compound as described herein and administering radiation therapy as described herein, either separately or simultaneously. In one embodiment, the disclosure provides a compound for use in a method of treating cancer in a patient in need thereof by administering to the patient an effective amount of a compound as described herein, followed by applying radiation therapy (e.g. or α particles). In another embodiment, the disclosure provides a compound for use in a method of treating cancer in a patient in need thereof by administering radiation therapy (e.g. X-rays, γ rays, or beams of electrons, protons, neutrons or α particles) in a patient, and then, by administering to the patient an effective amount of a compound as described herein. In yet another embodiment, the disclosure provides a compound for use in a method of treating cancer in a patient in need thereof by co-administering the compound as described herein and administering radiation therapy to the patient (e.g. X-rays, γ rays, or beams of electrons, protons, neutrons or α particles).

[0274] In another aspect, the disclosure provides kits or containers containing a compound of formula (IVa-2) or a pharmaceutically acceptable salt thereof, a compound as described herein, or a composition thereof as described herein. In some embodiments, the compound or composition is packaged, e.g., in a vial, bottle, flask, which may then be packaged, e.g., in a box, envelope, or bag; the compound or composition is approved by the U.S. A Food and Drug or a similar regulatory agency for administration to a mammal, e.g., a human; the compound or composition is approved for administration to a mammal, e.g., a human, for a protein kinase mediated disease or condition; a kit or container of the disclosure may contain written instructions for use and / or other indication that the compound or composition is suitable or approved for administration to a mammal, e.g. to a human for a disease or condition mediated by the C-kit protein kinase; and the compound or composition may be packaged in unit dose or unit dosage form, e.g., unit dose pills, capsules, etc.

VII. Examples

[0275] The following examples are presented herein to illustrate and not to limit the disclosure claimed.

[0276] The compounds within the scope of the present disclosure can be synthesized as described below using a variety of reactions known to those skilled in the art. One skilled in the art will also recognize that alternative methods can be used to synthesize the target compounds of the present disclosure and that the approaches described throughout this document are not exhaustive but provide widely used and practical routes for synthesizing compounds of interest. In some examples, the mass spectrometric result indicated for a compound may have more than one value due to the isotopic distribution of the atoms in the molecule, such as for a compound containing a bromo or chloro substituent.

PZ / 5321 / AG

EP 2 935 248 B1

120

[0277] Certain molecules claimed in this patent may exist in different enantiomeric and diastereomeric forms, or one or more hydrogen atoms in the molecules may be replaced with one or more deuterium atoms comprising perdeuterated analogs, and all such variants of these compounds are claimed herein. Further, it should be noted that the term "deuterated analog" refers to compounds in which at least one hydrogen atom has been replaced with a deuterium atom.

[0278] One skilled in the art will also recognize that acids and bases are frequently used in standard work-up procedures in organic chemistry. During the experimental procedures described in this patent, salts of the parent compounds are sometimes formed when they possess the necessary intrinsic acidity or basicity.

Example 1: Preparation of N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2024)

[0279]

Scheme 1

<img file="PL2935248T3_D0091.tif" />

Step 1 - Synthesis of 3 - ((4-fluorophenyl) ethynyl) -5-nitropyridin-2-amine (3): For a suspension of 3-bromo-5-nitropyridin-2-amine (1) (62.63 g, 287 mmol) in tetrahydrofuran (400 ml) and triethylamine (120 ml, 861 mmol) added 1-ethynyl-4-fluorobenzene 2 (38.0 g, 316 mmol), copper (I) iodide (378 mg, 1.98 mmol) and bis (triphenylphosphine) palladium (II) dichloride (1.39 g, 1.98 mmol). The reaction mixture was purged with nitrogen for 5 minutes at room temperature and heated overnight in a sealed vessel at 50 ° C. The reaction mixture was cooled and filtered. The resulting solid was washed with 3: 1 heptanes: ethyl acetate (1.6 L), water (500 mL), heptanes (1 L) and dried at 50 ° C in a vacuum oven to give crude 3 - ((4-fluorophenyl) ) ethynyl) -5-nitropyridin-2-amine 3 (59.27 g) as a golden solid. Data from spectrum¹H NMR was consistent with the structure of the compound and the solid was used in the next step without further purification.

Step 2 - Synthesis of 3 - ((4-fluorophenyl) ethynyl) pyridine-2,5-diamine (4): For 3 - ((4-fluorophenyl) ethynyl) -5-nitropyridin-2-amine 3 (59.27 g) Tin (II) chloride (208 g, 0.952 mol) was added in tetrahydrofuran (800 ml) and ethyl acetate (800 ml) over 90 minutes while heating the reaction mixture to 60 ° C. After the addition was complete, the reaction mixture was stirred at 60 ° C for 2 hours. The reaction mixture was cooled and filtered through celite (550 g). Celite was washed with ethyl acetate (3 L) then tetrahydrofuran (5 L) to give compound 4 (55.22 g). 1H NMR data was consistent with the structure of the compound and the compound was used in the next step without further purification.

PZ / 5321 / AG

EP 2 935 248 B1

121

Step 3 - Synthesis of 2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine (5): To N-methyl-2-pyrrolidone (360 ml) at 80 ° C was added Potassium tert-butoxide (55 g) then crude 3 - ((4-fluorophenyl) ethynyl) pyridine-2,5-diamine 4 (55.22 g) in N-methyl-2-pyrrolidone (750 ml) over 7 minutes. After 2 hours, the reaction mixture was cooled to room temperature (~ 22 ° C) and water (5.5 L) was added. The aqueous layer was extracted with dichloromethane (~ 8 L). The organic layers were combined and dried with sodium sulfate, filtered and concentrated under reduced pressure. The crude material was purified by column chromatography on silica gel (1.5 kg), eluting with 0-5% methanol / dichloromethane to give 2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridine-5amine 5 (4.5 g). Data¹HNMR and MS spectroscopy were consistent with the desired product.

Step 4 - Synthesis of N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2024 ): A mixture of 3,4-dimethyl-1H-pyrazole-5-carboxylic acid 6 (0.11 g, 0.78 mmol) and benzotriazol-1-yloxytripyrrolidine phosphonium hexafluorophosphate (0.5 g, 0.96 mmol) in dimethylacetamide ( 4 ml) was stirred for 30 minutes. 2- (4-Fluorophenyl) 1H-pyrrolo [2,3-b] pyridin-5-amine 5 (0.12 g, 0.53 mmol) was added to the mixture followed by N, N-diisopropylethylamine (0.1 ml . The reaction mixture was stirred at room temperature overnight. Acetonitrile and water were added to the reaction mixture, and the precipitate was collected, washed with ethyl acetate and methanol. The precipitate was dried in vacuo to give compound (P-2024) (85 mg, 46%). MS ESI [M + H +] + = 350.1. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0284] Exemplary compounds N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P-2019); N3- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzene-1,3-dicarboxamide (P-2020); 3- (cyanomethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzamide (P-2021); 2-chloro-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -6-methylbenzamide (P-2022); 4-chloro-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P-2023); 3-cyano-N [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzamide (P-2025); 3-acetamido-N- [2- (4-fluorophenyl) 1H-pyrrolo [2,3-b] pyridin-5-yl] benzamide (P-2026); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -2H-indazole-4-carboxamide (P-2027); 3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-5-carboxamide (P-2028); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-3-carboxamide (P-2029); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-1,2,4-triazole-5-carboxamide (P-2035); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl-2H-triazole-4-carboxamide (P-2037); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-indazole-3-carboxamide (P-2046); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5,6,7-tetrahydro-1H-indazole-3-carboxamide (P-2047); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1,4,5,6-tetrahydrocyclopenta [c] pyrazole-3-carboxamide (P-2056); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1,5-dimethylpyrazole-3-carboxamide (P-2119); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-1,2,4-triazole-5-carboxamide (P-2131); N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-propyl-1H-pyrazole-5-carboxamide (P-2132); 3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H-pyrazole-5-carboxamide (P-2159); 3- (difluoromethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2172); and 4-chloro-3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2173) was prepared according to the protocols the syntheses shown in Scheme 1 and Example 1. Data from the spectrum¹H NMR and the observed molecular weights (Table 1) were consistent with the structures of the compounds.

PZ / 5321 / AG

EP 2 935 248 B1

122

Example 2: Preparation of 3,4-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2007).

Scheme 2

BocHN. _ "Br -...."_v BocHN .. | | - |

Br · ....... __, SO_WITHCI '&gt; - ·. '· Μ^;- · Ν ·

AND.¹ Λ ' ⁺ ------ n^;n 'nn SO2 ^N N '' - SOiPh ^SO/^h &amp; 9 10 11 12'

Λ -OH ·.

HO_about . ⁹ at 0 '

BocHN ·. HO ·· · ''^BocHN_with. ·_Λ , H.₂N, _e N _s ....... ____

N ^—LIn⁷ K · '' _N N Η θ 10.0:, /

15 16 P-2007

Step 1 - Synthesis of 5-bromo-1- (phenylsulfonyl) -1H-pyrrolo [2,3-b] pyridine (10): 5-bromo-1H-pyrrolo [2,3-b] pyridine 8 solution (196 g , 994 mmol) in anhydrous tetrahydrofuran (2 L) cooled to 0 ° C and treated with sodium hydride (60% in mineral oil, 49.3 g 1233 mmol) over 30 minutes. After two hours, benzenesulfonyl chloride 9 (153 mL, 1193 mmol) was added dropwise and the reaction mixture was stirred at room temperature overnight. The reaction was stopped with brine (1 L). The layers were separated and the aqueous phase was extracted with ethyl acetate (2 x 500 ml). The organic layers were combined, dried with sodium sulfate, filtered, and concentrated under reduced pressure. The product was triturated with methyl tert-butyl ether to give 10 as a tan solid (319 g, 95%). Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 2 - Synthesis of tert-butyl (1- (phenylsulfonyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate (11): 5-bromo-1- (phenylsulfonyl) -1H suspension -pyrrolo [2,3-b] pyridine (10) (200 g, 594 mmol), tert-butyl carbamate (118 g, 1009 mmol), cesium carbonate (368 g, 1128 mmol), Xantphos (32 g, 65 mmol) ) and palladium (II) acetate (10.7 g, 47.5 mmol) in 1,4-dioxane (3 L) were degassed with nitrogen for 10 minutes then refluxed overnight. LC / MS and TLC analyzes indicated completion of the reaction. The reaction mixture was diluted with ethyl acetate / tetrahydrofuran (1: 1, 1 L) and filtered through celite. The filtrate was extracted with water (1 L). The layers were separated and the aqueous phase was extracted with ethyl acetate (2 x 500 ml). The combined organic layers were dried with sodium sulfate, filtered and concentrated under reduced pressure. The product was triturated with methyl tert-butyl ether to provide compound 11 as a tan solid (125 g, 57%). Data from spectrum ¹H NMR was consistent with the structure of the compound.

Step 3 - Synthesis of tert-butyl (2-iodo-1- (phenylsulfonyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate (12): To N- [1- (benzenesulfonyl) ) tert-butyl pyrrolo [2,3-b] pyridin-5-yl] carbamate (0.5 g, 1.34 mmol) in anhydrous tetrahydrofuran (10 ml) at -78 ° C tert-butyl lithium (1, 7 ml, 1.7 M). The resulting mixture was allowed to warm to -20 ° C, then cooled to -78 ° C. Then iodine (0.4 g, 1.58 mmol) in anhydrous tetrahydrofuran (2 mL) was added and the reaction mixture was allowed to warm to room temperature overnight. Quench the reaction with an aqueous ammonium chloride solution and extract with ethyl acetate. The organic layer was collected, washed with aqueous sodium thiosulfate (10%), brine, and dried over sodium sulfate. After removing the drying agent and solvent, the residue was purified by column chromatography to obtain compound (12) as an off-white solid (0.38 g, 56%). MS (ESI) [M + H +]⁺ = 500.15. 1H NMR data was consistent with the structure of the compound.

PZ / 5321 / AG

EP 2 935 248 B1

123

Step 4 - Synthesis of tert-butyl (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate (13): For the solution of (2-iodo-1- (phenyl) sulfonyl) Tert-Butyl (12) -1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate (45 g, 73 mmol) in tetrahydrofuran (600 ml) was added tetrabutylammonium fluoride trihydrate (126 g, 400 mmol). The solution was stirred at room temperature overnight. The reaction mixture was poured into water (500 ml) and extracted with ethyl acetate (2 x 200 ml). The combined organic layers were dried with sodium sulfate, filtered and concentrated under reduced pressure. The crude material was triturated with dichloromethane to afford compound (13) as an off-white solid (15 g, 59%). Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 5 - Synthesis of tert-butyl (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate (15): Suspension of (2-iodo-1H-pyrrolo [2,3- b] pyridin-5-yl) carbamate of tert-butyl 13 (8.3 g, 23 mmol), phenylboronic acid 14 (3.0 g, 25 mmol), potassium carbonate (9.6 g, 69 mmol) in mixture 1 , 4-Dioxane / water (10: 1, 165 mL) was degassed with nitrogen for 10 minutes followed by the addition of tetrakis (triphenylphosphine) palladium (0) (1.6 g, 1.4 mmol, 0.06 eq.). The reaction mixture was refluxed overnight. LC / MS analysis indicated completion of the reaction. The reaction mixture was diluted with tetrahydrofuran (50 ml) and filtered through celite. The filtrate was extracted with brine (100 ml). The layers were separated and the aqueous phase was extracted with ethyl acetate (2 x 100 ml). The organic layers were combined, dried with sodium sulfate, filtered, and concentrated under reduced pressure. The product was triturated with dichloromethane to give compound (15) as a tan solid (5.3 g, 74%). Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 6 - Synthesis of 2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-amine (16): For the suspension of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) ) tert-butyl carbamate (5.3 g, 17 mmol) in dichloromethane (60 ml) was added trifluoroacetic acid (12 ml). The solution was stirred at room temperature for two hours at which time LC / MS indicated the reaction was complete. The reaction mixture was concentrated under reduced pressure. The crude material was suspended in 10% aqueous sodium carbonate solution (100 ml) and stirred at room temperature for 1 hour. The solid was filtered off, washed with water (50 ml), methyl tert-butyl ether (50 ml) and dichloromethane (50 ml) and dried under high vacuum at 50 ° C. Compound 16 was obtained as a brown solid (3.2 g, 89%). 1H NMR data was consistent with the structure of the compound.

Step 7 - Synthesis of 3,4-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2007): Compound Solution 6 (0.09 g, 0.67 mmol) and benzotriazol-1-yloxytripyrrolidine phosphonium hexafluorophosphate (0.35 g, 0.67 mmol) in dimethylacetamide (4 mL) was stirred at room temperature for 30 minutes. To this mixture was added 2-phenyl-1H-pyrrolo [2,3-b] pyridine-5amine (16) (0.08 g, 0.38 mmol) followed by diisopropylethylamine (0.1 ml). The reaction mixture was stirred at room temperature overnight. The reaction mixture was added dropwise to water and the suspension was stirred for 1 hour. The solid was filtered off and purified by preparative HPLC to give compound (P-2007) as a white solid (46 mg, 36%). MS ESI [M + H +] + = 332.2. 1H NMR spectra were consistent with the structure of the compound.

[0293] Exemplary compounds such as 4-bromo-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2005); 4-methyl-3-phenyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2008); 3-cyclopropyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2009); 5-fluoro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-indazole-3-carboxamide

PZ / 5321 / AG

EP 2 935 248 B1

124 (P-2010); N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyrimidine-4-carboxamide (P-2011); 3-fluoro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyridine-2-carboxamide (P-2012); 3,5-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) isoxazole-4-carboxamide (P-2013); N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyridazine-3-carboxamide (P-2014); N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -2H-triazole-4-carboxamide (P-2015); 3-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyridine-2-carboxamide (P2016); and 4,5-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) isoxazole-3-carboxamide (P-2017) was prepared according to the synthesis protocols outlined in Scheme 2 and Example 2. Data from 1 H NMR spectra and observed molecular weights (Table 1) were consistent with the structures of the compounds.

Reference Example 3: Preparation of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanol (P-2001) and (2-phenyl-1H-pyrrolo [2, 3-b] pyridin-5-yl) - (3-pyridyl) methanone (P-2002) [0294]

Scheme 3 o, U.

Tl ii ^:and N κ

P-2002

<img file="PL2935248T3_D0092.tif" />

Step 1 - Preparation of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanol (P-2001): For 5-bromo-2-phenyl- 1H-pyrrolo [2,3-b] pyridine (18) (56 mg, 0.21 mmol) in tetrahydrofuran (6 mL) at -78 ° C under nitrogen, n-butyl lithium in tetrahydrofuran (0.21 ml, 2.5M). After 1 hour, 3-pyridinecarboxaldehyde (19) (0.02 mL, 0.19 mmol) in tetrahydrofuran (5 mL) was added to the reaction mixture. The reaction mixture was allowed to warm to room temperature (~ 22 ° C) and poured into water followed by extraction with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel, eluting with 20% to 100% ethyl acetate in hexane to afford compound (P-2001) (40 mg, 64.7%). MS (EI) [M + H +] + = 301.85. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 2 - Preparation of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone (P2002): Compound (P-2001) was oxidized using acid 2 - iodobenzoic acid (IBX) in a mixture of tetrahydrofuran and dichloromethane. The reaction mixture was stirred at room temperature for 48 hours and quenched with water. After aqueous workup, the product was purified by silica gel chromatography eluting with a mixture of dichloromethane and a gradient of methanol (220%) to afford compound (P-2002) (17mg, 68%). MS ESI [M + H +]⁺ = 299.85. 1H NMR data was consistent with the structure of the compound.

Reference Example 4: Preparation of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone (P-2006) and (2-phenyl-1H-pyrrolo [2, 3-b] pyridin-5-yl) - (3-pyridyl) methanone (P-2018)

[0297]

<img file="PL2935248T3_D0093.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

125

Step 1 - Preparation of (2-Phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone P-2006:

To a mixture of 2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-amine 16 (50 mg, 0.24 mmol) and ethyl 3-isocyanopropanoate 22 (50 mg, 0.35 mmol) in dimethylformamide (3 ml) N, N-diisopropylethylamine (0.1 ml) was added. The reaction mixture was stirred at room temperature for 3 hours. The precipitated solid was filtered and washed with a mixture of ethyl acetate and hexanes to afford compound (P-2006) (22 mg, 26%). MS ESI [M + H +] + = 352.85. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 2 - Preparation of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone (P2018): To 2-phenyl-1H-pyrrolo [2, 3-b] pyridin-5-amine 16 (15 mg, 0.07 mmol) in pyridine (3 mL) was added 1 H-pyrazole-4-sulfonyl chloride 24 (30 mg, 0.18 mmol). The reaction mixture was stirred at room temperature for 2 hours and concentrated. The residue was purified by column chromatography eluting with a mixture of dichloromethane and methanol with a gradient (0-15%) to afford compound (P-2018) (9 mg, 37%). MS ESI [M + H +]⁺ = 340.1. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0300] An exemplary 2-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] pyrazole-3-sulfonamide compound (P-2030) was prepared according to the synthesis protocols outlined in Scheme 4 and Example 4. Data from 1 H NMR spectra and observed molecular weights (Table 1) were consistent with the structure of the compound.

Reference Example 5: Preparation of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone (P-2071) Scheme 5

EtO₂C ..

Br

EtO₂C.

HO₂C.

HN

N 'NH_WITH

N NH₂

HŃ

N

H ... - 'NN -' H

P-Z071

Step 1 - Synthesis of ethyl 6-amino-5- (phenylethynyl) nicotinate (28): To a solution of ethyl 6-amino-5-bromonicotinate 26 (5.04 g, 20.6 mmol) in tetrahydrofuran (30 ml) was added triethylamine (8.6 mL, 61.7 mmol, 3.0 eq.), Copper (I) iodide (23.4 mg, 0.28 mmol), bis (triphenylphosphine) palladium (II) dichloride (190 mg, 0.28 mmol) and phenylacetylene 27 (4.1 mL, 37.6 mmol). The reaction mixture was purged with nitrogen then heated to reflux in a sealed tube. When LCMS analysis indicated completion of the reaction, the reaction mixture was cooled, poured into water, and extracted with ethyl acetate. The organic layers were combined, dried with sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was triturated with 3: 1 heptanes: ethyl acetate to yield compound (28) (3.05 g). The filtrate was allowed to stand overnight at room temperature to yield additional compound (28) (1.67 g) as a beige solid after washing with

PZ / 5321 / AG

EP 2 935 248 B1

126 heptanes. Overall yield: 4.72 g (86% yield). 1H NMR data was consistent with the structure of the compound.

Step 2 - Synthesis of 2-phenyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid (29): To compound (28) (40 mg, 0.15 mmol) in N-methylpyrrolidine ( 1.6 ml) was added potassium tert-butoxide (35 mg, 0.32 mmol, 3.2 eq.). The reaction mixture was heated at 80 ° C overnight, cooled to room temperature, hydrochloric acid (IN, 3 ml) was added and poured into water (250 ml). The resulting solution was adjusted to pH with a 1N aqueous hydrochloric acid solution to precipitate. The precipitate was filtered off, washed with water and diethyl ether to afford compound (29) as an orange-brown solid (30 mg, 71% yield). Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 3 - Synthesis of (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone (P-2071): To 2-phenyl-1H-pyrrolo acid [2,3-b] pyridine-5-carboxylic acid 29 (50mg, 0.21mmol) in tetrahydrofuran (3ml) was added benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (0.12g, 0.23mmol) and N, N-diisopropylethylamine (0.2 mL, 1.16 mmol). The suspension was stirred at room temperature for 30 minutes and 3,4-dimethyl-1H-pyrazol-5-amine (30) (28 mg, 0.25 mmol) in N, N-dimethylformamide (1 ml) was added. The reaction mixture was stirred at room temperature overnight and quenched with water. The precipitate was collected, washed with ethyl acetate and purified by silica gel column chromatography to afford compound (P-2071) as a white solid (18 mg, 25%). MS ESI [M + H +] + = 331.85. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0305] Exemplary compounds N- (3-carbamoylphenyl) -2-phenyl-1H-pyrrolo [2,3-b] pyridine-5-carboxamide (P2003); and 2-phenyl-N- (1H-pyrazol-3-yl) -1H-pyrrolo [2,3-b] pyridine-5-carboxamide (P-2004) was prepared according to the synthesis protocols outlined in Scheme 5 and Example 5. Data from the 1H NMR spectrum and the observed molecular weights (Table 1) were consistent with the structures of the compounds.

Reference Example 6: Preparation of N- [2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidin-6-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2072) and N- ( 3- (4-fluorophenyl) -1H-pyrazolo [3,4-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2041) [0306]

Scheme 6 ^F."\ _ - X. I - N --35 rt OV

H * TO 'P-2072

Step 1 - Synthesis of 6-bromo-2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidine (34): To 3- (4-fluorophenyl) -1H-pyrazol-5-amine 32 (75 g, 423 mmol) and bromomalonaldehyde 33 (63.9 g, 423 mmol) w

Br

On no₂

ABOUT _,ⁿnh;

NH₂ ~ 32

Ν '

N · '· u

H.

N '

H.

NH₂

OH

N] | '

Ν 'V'

H. ⁱⁿ

H, N_X . 'Ί About nN.h

P-2041

PZ / 5321 / AG

EP 2 935 248 B1

127 ethanol (652 mL) p-toluenesulfonic acid monohydrate (8.05 g, 42.3 mmol) was added. The reaction mixture was refluxed overnight. After cooling, the reaction mixture was concentrated in vacuo to yield a crude residue. The residue was dissolved in dichloromethane and purified by column chromatography on silica gel eluting with 0-100% ethyl acetate / heptane to afford compound 34 (3.6 g, 12.32 mmol, 2.9% yield) as a light yellow solid. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 2 - Synthesis of 2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidin-6-amine (35): For a mixture of 6-bromo-2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidines (34) (4 g, 13.69 mmol), sodium tert-butoxide (1.842 g, 19.17 mmol) and benzophenone imine (2.76 mL, 16.43 mmol) in degassed toluene (45.6 mL) 2,2'bis (diphenylphosphino) -1,1'-binaphthyl (0.294 g, 1.027 mmol) and tris (dibenzylideneacetone) dipalladium (0) (0.313 g, 0.342 mmol) were added. The reaction mixture was heated at 100 ° C overnight and concentrated in vacuo to give a crude residue which was dissolved in tetrahydrofuran (150 mL) and 2 N aqueous hydrochloric acid (150 mL) and stirred at room temperature overnight. The reaction mixture was diluted with ethyl acetate and the aqueous layer was separated, basified with saturated aqueous potassium carbonate and extracted with ethyl acetate. The organic layer was concentrated under reduced pressure to yield a crude residue. The residue was dissolved in dichloromethane and purified by column chromatography on silica gel eluting with 0-10% methanol / dichloromethane and triturated with methyl tert-butyl ether / heptane to afford compound (35) (0.05 g, 0.219 mmol, 1 6% yield) as a brown solid. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 3 - Synthesis of N- [2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidin-6-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2072): For 3,4-dimethyl-1H-pyrazole-5-carboxylic acid 6 (35 mg, 0.25 mmol) in dimethylacetamide (4 ml) was added benzotriazol-1-yloxytripyrrolidine phosphonium hexafluorophosphate (0.12 g, 0.23 mmol) followed by N , N-diisopropylethylamine (0.2 mL, 1.16 mmol). The suspension was stirred at room temperature for 30 minutes. To this suspension was added 2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidin-6-amine (35) (22 mg, 0.1 mmol, brown solid). The reaction mixture was stirred at room temperature overnight and poured into water. The precipitate was collected and purified by column chromatography to afford compound (P-2072) as a light yellow solid (5 mg, 15%). MS ESI [M + H +] + = 351.95. 1H NMR data was consistent with the structure of the compound.

Step 4 - Synthesis of 3- (4-fluorophenyl) -5-nitro-1H-pyrazolo [3,4-b] pyridine (38): Yellow suspension of 3 (4-fluorophenyl) -1H-pyrazol-5-amine 32 (10 g, 56.4 mmol) and the in-house prepared sodium nitromalonaldehyde monohydrate 37 (9.31 g, 59.3 mmol) in acetic acid (202 mL) was heated at 50 ° C overnight. The reaction mixture was diluted with water (10 volumes) and the resulting solid was filtered and washed with additional water to yield compound 38 which was used directly in the next step. 1H NMR data was consistent with the structure of the compound.

Step 5 - Synthesis of 3- (4-fluorophenyl) -1H-pyrazolo [3,4-b] pyridin-5-amine 39: Into the reaction vessel containing the 3- (4-fluorophenyl) -5-nitro-1H solution -pyrazolo [3,4-b] pyridine 38 (14.57 g, 56.4 mmol) in a mixture of ethanol (500 mL) and tetrahydrofuran (500 mL) was added hydrogen at 40 psi. The reaction was stopped after the hydrogen consumption was complete. The reaction mixture was filtered through the bed

PZ / 5321 / AG

EP 2 935 248 B1

128 celite and the residue was washed with additional tetrahydrofuran. The filtrate was concentrated under reduced pressure to give compound 39 (11.4 g, 50.0 mmol, 89% yield over 2 steps) as a solid. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 6 - Synthesis of N- (3- (4-fluorophenyl) -1H-pyrazolo [3,4-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2041 ): To a solution of 3- (4-fluorophenyl) -1H-pyrazolo [3,4-b] pyridin-5-amine 39 (0.150 g, 0.657 mmol) in N, N-dimethylformamide (3.87 mL) was added a mixture of triethylamine (0.102 ml, 0.723 mmol), 3,4-dimethyl-1H-pyrazole-5-carboxylic acid (0.101 g, 0.723 mmol) and O- (7-azabenzotriazol-1-yl) -N, N, N ', N' hexafluorophosphate -tetramethyluronium (0.250 g, 0.657 mmol) and stirred at room temperature overnight. The reaction mixture was then poured into water and extracted with acetate. The organic layer was separated and concentrated under reduced pressure and the resulting residue was dissolved in a minimum amount of dichloromethane and purified by chromatography eluting with 0-10% methanol / dichloromethane and triturated with methyl tert-butyl ether / heptane to afford compound (P-2041) (0.100 g, 0.285 mmol, 43.4% yield) as a light yellow solid. MS ESI [M + H +] + = 351.3. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0313] Exemplary compounds 3,4-dimethyl-N- (3-methyl-1H-pyrazolo [3,4-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2040) and 4,5- dimethyl-N- (2-methylpyrazolo [1,5-a] pyrimidin-6-yl) -1H-pyrazole-3-carboxamide (P-2114) was prepared according to the synthesis protocols outlined in Scheme 6 and Example 6. Data from 1H NMR spectrum and the observed molecular weights (Table 1) were consistent with the structures of the compounds.

Example 7: Preparation of N- [2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl1H-pyrazole-5-carboxamide (P- 2063) [0314]

Scheme 7

BocHN. OH BocHN.F

Γ 11 11 n''N ----- ίΓ '

SO_?PhSOjPh

4344

BocHN.

Ν '

SOiPh '· —Br N

SO₂

OH

N

Ν '

H.

H.

N ..

HP * 2063

Step 1 - Synthesis of tert-butyl N- [1- (benzenesulfonyl) -2-bromo-pyrrolo [2,3-b] pyridin-5-yl] carbamate 41: To N- [1- (benzenesulfonyl) pyrrole Tert-Butyl 11 [2,3-b] pyridin-5-yl] carbamate (0.5g, 1.34mmol) in anhydrous tetrahydrofuran (10ml) at -78 ° C was added tert-butyllithium (1.6 ml, 1.7M). The resulting mixture was allowed to warm to -20 ° C and then cooled to -78 ° C. 1,2-Dibromo-1,1,2,2-tetrachloroethane (0.22 g, 0.676 mmol) in anhydrous tetrahydrofuran (3 mL) was added slowly to the mixture and the reaction mixture was allowed to warm to room temperature overnight. Quench the reaction with an aqueous ammonium chloride solution and extract with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. The drying agent and solvent were removed and the residue was purified by column chromatography to yield compound 41 as a viscous oil that solidified to

PZ / 5321 / AG

EP 2 935 248 B1

129 a light yellow solid (0.24 g, 39%). MS (ESI) [M + H +] + = 453.8. 1H NMR data was consistent with the structure of the compound.

Step 2 - Synthesis of tert-butyl N- [1- (benzenesulfonyl) -2- (3-hydroxyprop-1-ynyl) pyrrolo [2,3-b] pyridin-5-yl] carbamate: 43: To a mixture of N- [ Tert-Butyl 1- (benzenesulfonyl) -2-bromopyrrolo [2,3-b] pyridin-5-yl] carbamate 41 (250 mg, 0.55 mmol), copper (I) iodide (20 mg, 0.11 mmol) acetate palladium (II) (20 mg, 0.09 mmol) and triphenylphosphine (40 mg, 0.15 mmol) in diethylamine (5 ml) were added propargyl alcohol 42 (0.25 ml, 4.23 mmol). The reaction mixture was stirred at room temperature for 4.5 hours and filtered through celite and concentrated. The residue was mixed with water and extracted with ethyl acetate. The organic layer was collected, washed with water and brine, then dried over sodium sulfate. The solvent was removed and the residue was purified by silica gel chromatography eluting with a mixture of ethyl acetate and hexanes with a gradient (10-100%) to afford compound 43 (100mg, 34%). MS ESI [M + H +]⁺ = 427.9. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0317] Step 3 - Synthesis of tert-butyl N- [1- (benzenesulfonyl) -2- (3-fluoroprop-1-ynyl) pyrrolo [2,3-b] pyridin-5-yl] carbamate: 44: To N- [1 - tert-butyl - (benzenesulfonyl) -2- (3-hydroxyprop-1-ynyl) pyrrolo [2,3b] pyridin-5-yl] carbamate (100mg, 0.23mmol) in dichloromethane (10ml) at a temperature -10 ° C bis (2-methoxyethyl) aminosulfur trifluoride (0.08 ml, 0.43 mmol) was added. The reaction mixture was stirred at a temperature between -10 ° C and 0 ° C for 10 minutes and allowed to warm to room temperature. The reaction was quenched with water. The organic layer was collected, washed with water and brine, and dried over sodium sulfate. The solvent was removed and the residue was purified by chromatography, eluting with a mixture of ethyl acetate and hexanes (20-100%) to yield compound 44. MS ESI [M + H +]⁺ = 430.1. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 4 - Synthesis of 2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin-5-amine (45): To N- [1 (benzenesulfonyl) -2- ( Potassium hydroxide in methanol (4 mL, 1 M) was added to 3-fluoroprop-1-ynyl) pyrrolo [2,3-b] pyridin-5-yl] carbamate 44 (50 mg, 0.12 mmol). The reaction mixture was stirred at room temperature for 30 minutes. Hydrochloric acid in dioxane (6 mL, 4 M) was added to the reaction mixture, and the reaction mixture was stirred at room temperature for three hours. The reaction mixture was concentrated twice from toluene and dried under reduced pressure to obtain compound (45) as a hydrochloric acid salt (30 mg). MS ESI [M + H +]⁺ = 190.1. The compound was used in the subsequent reaction without further purification.

Step 5 - Synthesis of N- [2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2063): To 3,4-Dimethyl-1H-pyrazole-5-carboxylic acid 6 (50mg, 0.36mmol) in dimethylacetamide (3ml) was added benzotriazol-1-yloxytripyrrolidine phosphonium hexafluorophosphate (200mg, 0.38mmol) ). The reaction mixture was stirred at room temperature for 30 minutes and 2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridine-5amine hydrochloride (12 mg, 0.05 mmol) and N, were added. N-diisopropylethylamine (1 mL), followed by stirring at room temperature for three hours. The reaction mixture was then purified by chromatography eluting with a mixture of ethyl acetate and hexanes with a gradient to afford compound (P-2063) (2.2 mg, 13%). MS ESI [M + H +]⁺ = 312.1. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0320] Exemplary compound N- [2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide (P-2068 ) were prepared according to the synthesis protocols outlined in

PZ / 5321 / AG

EP 2 935 248 B1

130

Scheme 7 and Example 7. 1H NMR data and observed molecular weights (Table 1) were consistent with the structure of the compound.

Reference Example 8: Preparation of N- [2- [3- (benzenesulfonamido) anilino] pyrimidin-5-yl] -3,4 dimethyl-1H-pyrazole-5-carboxamide (P-2053) [0321]

Scheme 8

<img file="PL2935248T3_D0094.tif" />

Step 1 - Synthesis of N- (2-chloropyrimidin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide (48): 3,4-Dimethyl-1H acid was added to a 20 ml scintillation vial. -pyrazole-5-carboxylic-6 (0.6 g, 4.28 mmol) and benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (2.4 g, 4.61 mmol) in dimethylacetamide (4 mL) to form a reaction mixture. The reaction mixture was stirred at room temperature for 30 minutes to give solution A. To a second 20 mL scintillation vial was added 2-chloropyrimidin-5-amine 47 (0.75 g, 5.79 mmol) and N, N-diisopropylethylamine (0.1 mL) to form a mixture. The mixture was heated at 60 ° C to give solution B. The activated acid (solution A) was then added to the amine (solution B). The reaction mixture was stirred at 60 ° C overnight and cooled to room temperature. Water was added to the reaction mixture to yield a precipitate that was collected to afford compound 48 (323 mg, 30%). MS ESI [M + H +] + = 251.8.

Step 2 - Preparation of N- [2- [3- (benzenesulfonamido) anilino] pyrimidin-5-yl] -3,4-dimethyl1H-pyrazole-5-carboxamide (P-2053): N - (2-chloropyrimidin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide 48 (50 mg, 0.2 mmol), isopropanol (3 ml), N- (3-aminophenyl) benzenesulfonamide 49 (113 , 64 mg, 0.46 mmol) and aqueous hydrochloric acid (0.1 mL, 37%). The reaction mixture was heated in a microwave reactor at 160 ° C for 120 minutes. The reaction mixture is purified by silica gel chromatography eluting with a gradient of dichloromethane and methanol (015%). The desired fractions were combined to give compound (P-2053): (41 mg, 45%). MS ESI [M + H +]⁺ = 464,3.

[0324] Exemplary compounds N- (2-anilinopyrimidin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2044); N- (6-anilino-3-pyridyl) -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2045); N- [2- [3 (ethylsulfamoyl) anilino] pyrimidin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2050); 3,4-dimethylN- [2- (3-morpholinoanilino) pyrimidin-5-yl] -1H-pyrazole-5-carboxamide (P-2051); 3,4-dimethyl-N- [2- [3- (propylsulfonylamino) anilino] pyrimidin-5-yl] -1H-pyrazole-5-carboxamide (P-2052); 3,4-dimethyl-N- [2 [3- (methylcarbamoyl) anilino] pyrimidin-5-yl] -1H-pyrazole-5-carboxamide (P-2054); and ethyl N- [3 - [[5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] pyrimidin-2-yl] amino] phenyl] carbamate (P-2055) was prepared according to the synthesis protocols outlined in Scheme 8 and in Example 8. Data from the spectrum¹H NMR and the observed molecular weights (Table 1) were consistent with the structures of the compounds.

PZ / 5321 / AG

EP 2 935 248 B1

131

Example 9: Preparation of N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -4.5- dimethyl-1H-pyrazole-3-carboxamide (P-2043)

[0325]

Scheme 9

<img file="PL2935248T3_D0095.tif" />

Step 1 - Synthesis of N- [2-chloropyrimidin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide 52: To 4- (4,4,5,5-tetramethyl-1, Tert-Butyl 3,2-dioxaborolan-2-yl) -3,6-dihydro-2H-pyridine-1-carboxylate 51 (3 g, 9.7 mmol) in dichloromethane (5 ml) was added hydrochloric acid in 1.4 -dioxane (4 N, 5 ml). The reaction mixture was stirred at room temperature overnight, then, concentrated twice from toluene. The residue was washed with ethyl acetate and dried under reduced pressure to provide compound 52 as a hydrochloride salt (2.3 g, 96%). Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 2 - Synthesis of cyclopropyl- [4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -3,6-dihydro-2H-pyridin-1-yl] methanone 54 : For 4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1,2,3,6-tetrahydropyridine hydrochloride 52 (0.7 g, 2.85 mmol) in acetonitrile (15 mL) cyclopropanecarbonyl chloride 53 (0.3 g, 2.87 mmol) was added followed by N, N-diisopropylethylamine (0.8 mL). The reaction mixture was stirred at room temperature for 3 hours, then, passed through a silica gel column (eluting with a mixture of ethyl acetate and hexanes) to give the crude product in slightly colored fractions. The fractions were combined and concentrated. The residue was triturated with a mixture of ethyl acetate and hexanes. The mother liquor was collected and concentrated to afford Compound 54 as an orange gel. Compound 54 was used in subsequent reactions without further purification.

Step 3 - Synthesis of tert N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] carbamate -butyl 55: Tert-butyl N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate 13 (400 mg, 1.11 mmol), cyclopropyl- [4- (4 , 4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -3,6-dihydro-2H-pyridin-1-yl] methanone 54 (340 mg, 1.23 mmol), dichloro ( 1,1-bis (diphenylphosphino) ferrocene) palladium (II) acetone adduct (68.41 mg, 0.09 mmol) in acetonitrile (6 ml) and potassium carbonate (IN, 3.3 ml). The mixture was irradiated with microwaves at 100 ° C for 30 minutes. The reaction was quenched with water, neutralized with aqueous hydrochloric acid (5 N), extracted with ethyl acetate, washed with brine, and dried over sodium sulfate. After removal of the solvent and filtration of the salt, the residue was purified by silica gel chromatography, eluting with a mixture of ethyl acetate and hexane to afford compound 55 (102 mg, 24%). Data from spectrum¹H NMR was consistent with the structure of the compound.

PZ / 5321 / AG

EP 2 935 248 B1

132

Step 4 - Synthesis of [4- (5-amino-1H-pyrrolo [2,3-b] pyridin-2-yl) -3,6-dihydro-2H-pyridin-1-yl] cyclopropylmethanone 56: To Tert-butyl N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] carbamate 55 (102 mg, 0.27 mmol) in dichloromethane, hydrochloric acid in 1,4-dioxane (4 M, 0.7 ml) was added. The reaction mixture was stirred at room temperature overnight. After removal of the solvent, the residue was dried in vacuo to give compound 56 as a yellow solid (85 mg, 100%). MS ESI [M + H +] + = 282. This compound was used as is without purification.

Step 5 - Synthesis of N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -4 , 5-Dimethyl-1H-pyrazole-3-carboxamide (P-2043): To 4,5-dimethyl-1H-pyrazole-3-carboxylic acid 6 (0.02 g, 0.17 mmol) in acetonitrile (3 mL) was added benzotriazol-1-yl oxytripyrrolidine phosphonium hexafluorophosphate (0.1 g, 0.19 mmol). The reaction mixture was stirred at room temperature for one hour, then [4- (5-amino-1H-pyrrolo [2,3-b] pyridin-2-yl) -3,6-dihydro-2H-pyridin-1 hydrochloride was added. -yl] cyclopropylmethanone 56 (0.05 g, 0.16 mmol) and triethylamine (0.03 ml, 0.19 mmol) and stirred at room temperature overnight. The reaction was quenched with water, extracted with ethyl acetate, washed with brine, and dried over sodium sulfate. After removal of the solvent, the residue was triturated with ethyl acetate. The solid was collected, washed with methanol and water to give compound 57 as a white solid (5 mg, 7%). MS ESI [M + H]⁺ = 404.9. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0331] Exemplary compounds 5-methyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin- 5-yl] -1H-pyrazole-3-carboxamide (P-2031); N- [1- (benzenesulfonyl) -2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] pyrrolo [2,3-b] pyridin-5-yl] -3 , 4-dimethyl-1H-pyrazole-5-carboxamide (P-2033); 3,4-dimethyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl ] -1H-pyrazole-5-carboxamide (P-2034); 4-chloro-3-methyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5 -yl] -1H-pyrazole-5-carboxamide (P2036); 4-chloro-N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl- 1H-pyrazole-3-carboxamide (P-2039); and N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl-1H-pyrazole -3-carboxamide (P-2042) was prepared according to the synthesis protocols outlined in Scheme 9 and Example 9. 1H NMR data and observed molecular weights (Table 1) were consistent with the structures of the compounds.

Example 10: Preparation of 3,4-dimethyl-N- [2- [1- (2-morpholinoacetyl) -3,6-dihydro-2H-pyridin-4-yl] 1H-pyrrolo [2,3-b] pyridin- 5-yl] -1H-pyrazole-5-carboxamide (P-2073) [0332]

Scheme 10

<img file="PL2935248T3_D0096.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

133

Step 1 - Synthesis of 2-iodo-1H-pyrrolo [2,3-b] pyridin-5-amine hydrochloride 58: To tert-butyl 2-iodopyrrolo [2,3-b] pyridin-5-yl] carbamate 13 (0.25 g, 0.7 mmol) in dichloromethane (5 ml) was added hydrochloric acid in 1,4-dioxane (3 ml, 4 M). The suspension was stirred at room temperature for three hours. The reaction mixture was concentrated and dried under reduced pressure to give compound 58 as a hydrochloric acid salt (0.26 g). MS ESI [M + H +] + = 260.0. Compound 58 was used in subsequent reactions without purification.

Step 2 - Synthesis of N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide 59: A solution of 3,4- dimethyl-1H-pyrazole-5-carboxylic acid 6 (0.81 g, 5.79 mmol) and benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (3.01 g, 5.79 mmol) in dimethylacetamide (20 mL) were stirred at room temperature for for one hour. 2-Iodo-1H-pyrrolo [2,3-b] pyridin-5-amine 58 (0.5 g, 1.93 mmol) was added to the reaction mixture followed by N, N-diisopropylethylamine (0.67 mL, 3.86 mmol). The reaction mixture was stirred at room temperature for 3 hours, then added dropwise to ice water (200 ml). The resulting suspension was stirred overnight. The solid was collected by filtration, washed with water, and triturated with methanol to give compound 59 (1.4 g, 96%). MS ESI [M + H +]⁺ = 382.05. The compound was used in the subsequent reaction without purification.

Step 3 - Preparation of 3,4-dimethyl-N- [2- (1,2,3,6-tetrahydropyridin-4-yl) -1H-pyrrolo [2,3b] pyridin-5-yl] -1H -pyrazole-5-carboxamide 60: To N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide 59 (0.15 g, 0.39 mmol) in 1 , 4-dioxane (3 ml) was added 4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1,2,3,6-tetrahydropyridine hydrochloride 52 (0.19 g, 0.79 mmol), dichloro (1,1-bis (diphenylphosphino) ferrocene) palladium (II) adduct with acetone (0.02 g, 0.03 mmol) and aqueous potassium carbonate (1.2 ml , 1M). The reaction mixture was heated in a microwave reactor at 130 ° C for 20 minutes. The reaction mixture was poured into ice water and the precipitate was collected by filtration then triturated with ethyl acetate to give compound 60 (73 mg, 55%). The compound was used in the subsequent reaction without further purification.

Step 4 - Preparation of 3,4-dimethyl-N- [2- [1- (2-morpholinoacetyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2073): To a solution of 2-morpholinoacetic acid hydrochloride 61 (0.02 g, 0.11 mmol) in dimethylacetamide (2 ml) was added benzotriazol-1 hexafluorophosphate -iloxytripyrrolidine phosphonium (55.69 mg, 0.11 mmol). The mixture was stirred at room temperature for 40 minutes, then 3,4-dimethyl-N- [2- (1,2,3,6-tetrahydropyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5 was added. -yl] -1H-pyrazole-5-carboxamide 60 (0.02 g, 0.07 mmol) and N, N-diisopropylethylamine (0.02 ml, 0.14 mmol). The reaction mixture was stirred at room temperature for two hours. After completion of the reaction as judged by LCMS analysis, the reaction mixture was filtered and purified by preparative HPLC to give compounds (P-2073) (5 mg, 15%). MS (ESI) [M + H]⁺ = 464.6. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0337] Exemplary compound N- [2- [1- (2,3-dihydroxypropanoyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2074) was prepared according to the synthesis protocols outlined in Scheme 10 and Example 10. The 1H NMR spectrum data and observed molecular weights (Table 1) were consistent with the structure of the compound.

PZ / 5321 / AG

EP 2 935 248 B1

134

Reference Example 11: Preparation of 3-Methyl-N- (2-morpholine-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2058)

[0338]

Scheme 11. \ HN Ó \

P-2058

Step 1 - Synthesis of N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3-methyl-1H-pyrazole-5-carboxamide 64: A mixture of 3-methyl-1H- acid pyrazole-5-carboxylic acid 63 (0.15 g, 1.19 mmol) and benzotriazol-1-yloxytripyrrolidine phosphonium hexafluorophosphate (0.66 g, 1.27 mmol) in dimethylacetamide (2 mL) were stirred at room temperature for 30 minutes. To this reaction mixture was added 2-iodo-1H-pyrrolo [2,3-b] pyridin-5-amine hydrochloride 58 (0.15 g, 0.51 mmol) followed by N, N-diisopropylethylamine. The reaction mixture was stirred at room temperature for three hours then, purified by column chromatography on silica gel eluting with a gradient of dichloromethane in methanol (5-20%) to afford compound 64 (0.1 g, 64%). MS ESI [M + H +] - = 368.0. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 2 - Synthesis of 3-methyl-N- (2-morpholine-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2058): A mixture of N- ( 2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3-methyl-1H-pyrazole-5-carboxamide 64 (0.05 g, 0.14 mmol) and morpholine 65 (4 mL) was heated in a microwave reactor at 160 ° C for 60 minutes. The reaction mixture was purified by preparative HPLC to yield compound (P-2058) (18 mg, 40%). MS ESI [M + H +]⁺ = 327.3. 1H NMR data was consistent with the structure of the compound.

[0341] An exemplary compound 3,4-dimethyl-N- (2-pyrrolidin-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2115) was prepared according to the synthesis protocols outlined in Scheme 11 and Example 11. 1H NMR data and observed molecular weights (Table 1) were consistent with the structure of the compound.

Example 12: Preparation of N- [2- (1,3-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide ( P-2038)

[0342]

Scheme 12

<img file="PL2935248T3_D0097.tif" />

PZ / 5321 / AG

EP 2 935 248 B1

135

Step 1 - Synthesis of 1- (benzenesulfonyl) -2-iodo-pyrrolo [2,3-b] pyridin-5-amine 67: To the solution of N- [1- (benzenesulfonyl) -2-iodo-pyrrolo [2 Tert-Butyl, 3-b] pyridin-5-yl] carbamate 12 (0.5 g, 1 mmol) in acetonitrile (5 ml) was added hydrochloric acid in dioxane (10 ml, 4 M). The reaction mixture was stirred at room temperature for four hours. The reaction mixture was concentrated and dried under reduced pressure to give Compound 67 as a hydrochloric acid salt (0.6 g). The compound was used in the subsequent reaction without purification.

Step 2 - Synthesis of N- [1- (benzenesulfonyl) -2-iodo-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide 68: To the acid 3,4-dimethyl-1H-pyrazole-5-carboxylic acid 6 (0.2 g, 1.43 mmol) in acetonitrile (20 mL) was added o-benzotriazole-N, N, N ', N'-tetramethyluronium hexafluorophosphate (0 55 g, 1.45 mmol) followed by N, N-diisopropylethylamine (0.5 mL, 2.89 mmol). The suspension was stirred at room temperature for 2 hours to form a clear solution. 1- (Benzenesulfonyl) -2-iodopyrrolo [2,3-b] pyridin-5-amine hydrochloride 67 (0.4 g, 0.92 mmol) in tetrahydrofuran (1 mL) was added to the clear solution. The reaction mixture was stirred at 40 ° C overnight. The reaction mixture was concentrated and the residue was partitioned with ethyl acetate, washed with brine and dried with sodium sulfate. The solvent was removed and the residue was purified by flash chromatography on silica gel to give the product 68 as a light yellow solid (0.1 g, 21%). MS (ESI) [M + H +] + = 522.0. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 3 - Synthesis of N- [1- (benzenesulfonyl) -2- (1,3-dimethylpyrazol-4-yl) pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H- pyrazole-3-carboxamide 70: Do N- [1- (benzenesulfonyl) -2-iodopyrrolo [2,3b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide 68 (52 mg, 0.1 mmol) in acetonitrile (3 ml) was added 1,3-dimethyl-4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) pyrazole 69 (26 mg, 0.12 mmol), [1 , 1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (14 mg, 0.02 mmol) and aqueous potassium carbonate (1 mL, 1 M). The reaction mixture was irradiated with microwave at 100 ° C for 15 minutes. The reaction mixture was partitioned with ethyl acetate, washed with brine, and dried over sodium sulfate. The drying agent and solvent were removed and the residue was purified by column chromatography to give the product 70 as an off-white solid (0.02 g, 36%). MS (ESI) [M + H +]⁺ = 490.0. 1H NMR data was consistent with the structure of the compound.

Step 4 - Synthesis of N- [2- (1,3-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl1H-pyrazole-3 -carboxamide (P-2038): For N- [1- (benzenesulfonyl) -2- (1,3-dimethylpyrazol-4-yl) pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl- 1H-pyrazole-3-carboxamide 70 (0.02 g, 0.04 mmol) in acetonitrile (2 mL) was added tetrabutylammonium fluoride (0.23 mL, 0.76 mmol). The reaction mixture was stirred at 80 ° C for six hours, then partitioned with ethyl acetate, washed with brine, and dried over sodium sulfate. The drying agent and solvent were removed and the residue was purified by column chromatography on silica gel followed by preparative HPLC to give compound (P-2038) (5 mg, 35%). MS (ESI) [M + H +]⁺ = 349.9. 1H NMR data was consistent with the structure of the compound.

[0347] Exemplary compound N- [1- (benzenesulfonyl) -2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] pyrrolo [2,3-b] pyridin-5 -yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2033) was prepared according to the synthesis protocols outlined in Scheme 12 and Example 12. Data from the 1H NMR spectrum and observed molecular weights (Table 1) were consistent with structure of the relationship.

PZ / 5321 / AG

EP 2 935 248 B1

136

Example 13: Preparation of 3,4-dimethyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2112) [0348 ]

Scheme 13

<img file="PL2935248T3_D0098.tif" />

Step 1 - Synthesis of tert-butyl N- [1- (benzenesulfonyl) -2-bromo-pyrrolo [2,3-b] pyridin-5-yl] -N-tert-butoxycarbonylcarbamate 72: N - [1 (benzenesulfonyl) -2-bromopyrrolo [2,3-b] pyridin-5-yl] tert-butyl carbamate 41 (1.2 g, 2.65 mmol), tetrahydrofuran (10 ml), di-tert dicarbonate -butyl (1.32 g, 6.07 mmol), 4-dimethylaminopyridine (0.01 g, 0.08 mmol) and N, N-diisopropylethylamine (1.5 ml). The reaction mixture was stirred at room temperature overnight. The mixture was concentrated and the residue was partitioned between water and ethyl acetate. The organic layer was collected, washed with brine, and dried over anhydrous sodium sulfate. The solvent was removed and the residue was dried in vacuo to give a compound

72. MS ESI [M + H +] + = 554.2. The compound was used in the subsequent reaction without further purification.

Step 2 - Synthesis of tert-butyl N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate 74: N- [1- ( benzenesulfonyl) -2-bromo-pyrrolo [2,3-b] pyridin-5-yl] -N-tert-butoxycarbonylcarbamate tert-butyl 72 (0.4 g, 0.72 mmol), 1H-pyrazole 73 (0.5 g , 7.34 mmol), tris (dibenzylideneacetone) dipalladium (0) (0.05 g, 0.05 mmol), and racemic 2,2'-bis (diphenylphosphino) -1.1'binaphthyl (0.050 g, 0.08 mmol) and toluene (5 ml). The mixture was stirred at room temperature for 5 minutes then potassium tert-butoxide (0.7 g, 6.24 mmol) was added followed by an additional 2 mL of toluene. The mixture was irradiated with microwaves at 145 ° C for 15 minutes. The mixture was poured into brine and extracted with ethyl acetate. The organic layers were collected and dried over anhydrous sodium sulfate. The solvent was removed and the residue was purified by column chromatography on silica eluting with a mixture of methanol and dichloromethane with a gradient (0-20%) to afford compound 74 (0.12 g, 55%). MS ESI [M + H +]⁺ = 300.1. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 3 - Synthesis of 2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-amine hydrochloride 75: Do N (2-pyrazol-1-yl-1H-pyrrolo [2, Tert-Butyl 3-b] pyridin-5-yl) carbamate 74 (0.12 g, 0 mol) in methylene chloride (4 ml) was added hydrochloric acid in 1,4-dioxane (5 ml, 4N). The reaction mixture was stirred for 30 minutes and concentrated. The residue was dried in vacuo to give compound 75 (0.13 g, 96%). MS ESI [M + H +]⁺ = 199.85. The compound was used in the subsequent reaction without purification.

Step 4 - Synthesis of 3,4-dimethyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2112 ): 3,4-Dimethyl-1H-pyrazole-5-acid was added to a 20 ml scintillation vial.

PZ / 5321 / AG

EP 2 935 248 B1

137 carboxylic 6 (0.1 g, 0.71 mmol), benzotriazol-1-yl oxytripyrrolidine phosphonium hexafluorophosphate (0.36 g, 0.7 mmol), and dimethylacetamide (2 ml). The reaction mixture was stirred at room temperature for one hour. 2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridine-5amine 75 hydrochloride (0.13 g, 0.39 mmol) in dimethylacetamide (1 mL) was added to the mixture followed by NN-diisopropylethylamine ( 1.5 ml, 8.67 mmol). The reaction mixture was stirred at room temperature for two hours and concentrated. The residue was purified by column chromatography on silica gel, eluting with a mixture of methanol and dichloromethane with a gradient to give the product which was then titrated using a mixture of ethyl acetate and hexanes to afford compound 76 (5mg, 4%). MS ESI [M + H +] + = 322.3. Data from spectrum¹H NMR was consistent with the structure of the compound.

[0353] Exemplary compound 3-methyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide (P-2116) was prepared according to the protocols the syntheses shown in Scheme 13 and Example 13. Data from the 1H NMR spectrum and observed molecular weights (Table 1) were consistent with the structure of the compound.

Example 14: Preparation of N- [2- [2-chloro-5- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] 3,4-dimethyl-1H-pyrazole-5- carboxamide (P-2113)

[0354]

Scheme 14

<img file="PL2935248T3_D0099.tif" />

[0355] To a solution of N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide 59 (0.05 g, 0 , 13 mmol), [2-chloro-5- (trifluoromethoxy) phenyl] boronic acid 77 (37.84 mg, 0.16 mmol) and dichloro (1,1-bis (diphenylphosphino) ferrocene) palladium (II) as adduct with acetone (7.05 mg, 0.01 mmol) in 1,4-dioxane (3 ml) was added an aqueous solution of potassium carbonate (0.4 ml, 1 M). The reaction mixture was irradiated with microwaves at 120 ° C for 20 minutes. The reaction was quenched with water, neutralized with 1 M aqueous hydrochloric acid, and extracted with ethyl acetate. The organic layer was washed with brine, dried with sodium sulfate, filtered, and concentrated to dryness. The residue was adsorbed onto a silica gel pad and purified using medium pressure column chromatography (0-10% methanol / dichloromethane). The desired fractions were concentrated to dryness then triturated with ethyl acetate to afford compound (P-2113) as an off-white solid (30 mg, 51%). MS ESI [M + H +]⁺ = 450.2. 1H NMR data was consistent with the structure of the compound.

[0356] Exemplary compounds 4,5-dimethyl-N- [2- (4-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide (P-2059); N- [2- [3- (dimethylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2064); N- [2- (3,5-dimethylisoxazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2065) ; 3,4-dimethyl-N- [2- [3- (2-morpholinoethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2066) ; 3,4-dimethyl-N- [2- [4- (methylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2067); 4,5-dimethyl-N- [2- [2- (4-methylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1HPZ / 5321 / AG

EP 2 935 248 B1

138 pyrazole-3-carboxamide (P-2069); 4,5-dimethyl-N- [2- (3-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H-pyrazole-3-carboxamide (P-2070); N- [2- (2-chloro-4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4 dimethyl-1H-pyrazole-5-carboxamide (P-2075); N- [2- (2-fluoro-4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridines

5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide; (P-2076); N- [2- (2-chloro-5-methoxyphenyl) -1H-pyrrolo [2,3

b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2077); N- [2- (3-fluoro-5-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2078); 3,4-dimethyl-N- [2- (3-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2079); N- [2- (4 aminocyclohexen-1-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2080); N- [2- (4-cyano-3-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2081); N- [2- (3-fluoro-2-morpholine-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl1H-pyrazole-5-carboxamide (P- 2082); N- [2- (1-isobutylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2083); N- [2- (1,5-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2084) ; N- [2- [4- (dimethylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2085); 3,4-dimethyl-N- [2- [3- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2086); N- [2- [3- (dimethylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2087); 3,4-dimethyl-N- [2- (3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2088); 3,4-dimethyl-N- [2- (6-morpholine-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2089); N- [2- (6-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2090); 3,4-dimethyl-N- [2- (2-methylthiazol-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2091); N- [2- (4-cyanophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2092); N- [2- (2-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2093); N- [2- (3-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2094); N- [2- (3-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2095); N- [2- (2-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2096); 3,4-dimethyl-N- [2- (o-tolyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide; (P-2097); N- [2- (3-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2098); N- [2- (4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2099); N- [2- (3-acetamidophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2100); 3,4-dimethyl-N- [2- [4- (pyrrolidine-1-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2101 ); N- [2- [4- (3-methoxypropoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2102); 3,4-dimethyl-N- [2- [4- (4-methylpiperazin-1-yl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P -2104); 3,4-dimethyl-N- [2- [4- (thiomorpholine-4-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2105); 3,4-dimethyl-N- [2- [3- (morpholine-4-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2106 ); 3,4-dimethyl-N- [2- [3- (pyrrolidine-1-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2107 ); N- [2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2108); N- [2- (2-methoxy-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2109); 3,4-dimethylN- [2- (2-morpholine-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2110); N- [2- [4 (methanesulfonamido) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P2111); N- [2- [3- [4- (cyclopropanecarbonyl) piperazin-1-yl] phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3.4

PZ / 5321 / AG

EP 2 935 248 B1

139 dimethyl-1H-pyrazole-5-carboxamide (P-2118); N- [2- (4-cyano-3-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2120); 3,4-dimethyl-N- [2- [3- (methylsulfamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2121); N- [2- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide; (P-2122); 3,4-dimethyl-N- [2- (6-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2123); 3,4-dimethyl-N- [2- (4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (2124); 3,4-dimethyl-N- [2- (4-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2125); 3,4-dimethyl-N- [2- [3- (prapylsulfonylamino) phenyl] -1H-pyralo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2126); N- [2- (3-cyanophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2128); N- [2- (2-fluoro-3-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2129); 3,4-dimethyl-N- [2- (m-tolyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2130); N- [2- (6-acetamido-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2133); N- [2- [3- (butylcarbamoylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] 3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2134); N- [2- (2-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] 3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2135); 3,4-dimethyl-N- [2- (2-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2136); N- [2- (4-acetamidophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2137); 3,4-dimethyl-N- [2- [4- (morpholine-4-carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2138 ); N- [2- (2,4-dimethylthiazol-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2139) ; N [2- [1- (difluoromethyl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P- 2140); 3,4-dimethyl-N- [2- [2- (trifluoromethyl) -3-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2176) ; N- [2- (2-ethyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2177); N- [2- (6-ethyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2178); N- [2- (2,3-Dihydro- [1,4] dioxino [2,3-b] pyridin-8-yl) -1H-pyrrolo [2,3b] pyridin-5-yl] -3.4 -dimethyl-1H-pyrazole-5-carboxamide (P-2179); 3,4-dimethyl-N- [2- [2 (trifluoromethyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2180); N- [2- (2,4-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2181); 3,4-dimethyl-N- [2- [2- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P2182); N- [2- (5-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (p-2183); 3,4-dimethyl-N- [2- (5-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2184); N- [2- (4-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2185); and compounds P-2144, P-2146, P-2147, P-2148, P-2149, P2153, P-2154, p-2155, P-2156, P-2157, P-2158, P-2160, P- 2161, P-2163, P-2164, P-2166, P-2167, P2168, P-2169, P-2170, P-2171 and P-2174 were prepared according to the synthesis protocols outlined in Scheme 14 and Example 14. Data from the spectrum ¹H NMR and the observed molecular weights (Table 1) were consistent with the structures of the compounds. In addition, the compounds P-2238, P-2239, P-2240, P-2241, P-2242, P2243, P-2244, P-2245, P-2246, P-2247, P-2248, P-2249, P -2250, P-2251, P-2252, P-2253, P-2254, P2255, P-2256, P-2257, P-2258, P-2259, P-2260, P-2261, P-2262, P -2263, P-2264, P-2265, P-2266 and P2267 can be prepared according to the synthetic methods outlined in Example 14 and Scheme 14.

Example 15: Preparation of N- [2- (4-dimethylphosphorylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2127)

PZ / 5321 / AG

EP 2 935 248 B1

140

Scheme 15

<img file="PL2935248T3_D0100.tif" />

Step 1 - Methylphosphonoylmethane Synthesis (80): In a round bottom flask, methylmagnesium chloride in tetrahydrofuran (20 mL, 3 M) was cooled using an ice-water bath. Then 1-ethoxyphosphonoyloxyethane 79 (2.58 ml, 20 mmol) in tetrahydrofuran (5 ml) was added dropwise. The reaction mixture was stirred from 0 ° C to room temperature for 5 hours. A saturated sodium bicarbonate solution (20 mL) was added slowly to the reaction mixture, followed by methanol (20 mL). A precipitate formed and the reaction mixture was stirred at room temperature overnight. The salt formed was filtered off, and the filtrate was concentrated under reduced pressure. The reaction mixture was dried in vacuo to give a clear semisolid / oil (80).¹The H NMR [D2O] spectrum was consistent with the desired product.

Step 2 - Synthesis of 1-bromo-4-dimethylphosphorylbenzene (82): In a pressure vessel, 1,4-dibromobenzene 81 (4 g, 16.96 mmol), methylphosphonoylmethane (80) (5.5 g, 70.67 mmol) ), tetrakis (triphenylphosphine) palladium (0) (0.98 g, 0.85 mmol) and triethylamine (9.45 ml, 67.82 mmol) were dissolved in acetonitrile (40 ml). The reaction mixture was stirred at 90 ° C overnight. The reaction mixture was cooled to room temperature and concentrated. The residue was loaded onto silica gel and purified by silica gel chromatography to give crude compound 82 as a yellowish solid (2.1 g). The solid was used in the subsequent reaction without further purification. MS (ESI) [M + H +] + = 232.7 / 234.7.¹H NMR was consistent with the structure of the compound. Step 3 - Synthesis of 2- (4-dimethylphosphorylphenyl) -4,4,5,5-tetramethyl-1,3,2-dioxaborolane 83: To a solution of 1-bromo-4-dimethylphosphorylbenzene 82 (2.1 g, 9.01 mmol) in 1,4-dioxane (50 ml) in a pressure vessel was added 4,4,5,5-tetramethyl-2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolane- 2-yl) 1,3,2-dioxaborolane (4.58 g, 18.02 mmol), potassium acetate (2.99 ml, 47.76 mmol) and 1,1'bis (diphenylphosphino) ferrocene palladium (II) dichloride as a complex with dichloromethane (0.99 mL, 1.17 mmol). The mixture was stirred at 90 ° C for four hours. The reaction mixture was cooled and filtered through celite. The filtrate was concentrated to dryness. The third material was loaded onto silica gel and purified by silica gel chromatography to give compound 83 (350 mg). MS (ESI) [M + H +]⁺ = 280.80. Compound 83 was used in the subsequent reaction without further purification.

Step 4: Synthesis of N- [2- (4-dimethylphosphorylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2127 ): For the suspension of 2- (4-dimethylphosphorylphenyl) -4,4,5,5

PZ / 5321 / AG

EP 2 935 248 B1

141 tetramethyl-1,3,2-dioxaborolane 83 (60 mg, 0.21 mmol) in 1,4-dioxane (3 ml) was added N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) ) -3,4-dimethyl-1H-pyrazole-5-carboxamide 59 (163.3 mg, 0.43 mmol), 1,1'-bis (diphenylphosphino) ferrocene palladium (II) dichloride complex with dichloromethane (0, 01 g, 0.01 mmol) and aqueous potassium carbonate solution (0.64 ml, 1 M). The reaction mixture was irradiated with microwaves at 110 ° C for 20 minutes. The reaction mixture was filtered and the precipitate was collected and triturated with a mixture of methanol and acetonitrile to afford the product (P-2127) as an off-white solid (33 mg, 37.8%). MS (ESI) [M + H +] + = 408.30. Spectrum data¹H NMR and mass spectroscopy were consistent with the structure of the compound.

Reference Example 16: Preparation of N - [(4-chloro-5-methyl-1H-pyrazol-3-yl) methyl] -2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine ( P-2141) and preparation of 2- (4-fluorophenyl) -N - [(5-methyl-1H-pyrazol-3-yl) methyl] -1H-pyrrolo [2,3-b] pyridin-5-amine (P-2142 Scheme 16

<img file="PL2935248T3_D0101.tif" />

Step 1

- Preparation of N - [(4-chloro-5-methyl-1H-pyrazol-3-yl) methyl] -2- (4-fluorophenyl) -1H pyrrolo [2,3-b] pyridin-5-amine (P- 2141): To 4-chloro-5-methyl-1H-pyrazole-3-carbaldehyde 85 (0.16 g, 1.1 mmol) in tetrahydrofuran (5 ml) was added 2- (4-fluorophenyl) -1H-pyrrolo [ 2,3-b] pyridin-5-amine 5 (0.4 g, crude) and sodium borohydride (84 mg, 1.34 mmol). The reaction mixture was stirred at room temperature for three days. Quench the reaction with water, extract with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. The drying agent and solvent were removed and the residue was purified by silica gel column chromatography followed by preparative HPLC to give the product as a yellow solid (P-2141) (48 mg,

12%). MS (ESI) [M + H +]⁺ = 355.95. 1H NMR spectral and mass spectral data were consistent with the structure of the compound.

Step 2 - Preparation of 2- (4-fluorophenyl) -N - [(5-methyl-1H-pyrazol-3-yl) methyl] -1H-pyrrolo [2,3b] pyridin-5-amine (P- 2142): To a mixture of 2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine 5 (46 mg, 0.2 mmol) and 5-methyl-1H-pyrazole-3-carbaldehyde 87 (58 mg, 0.53 mmol) in acetonitrile (3 mL) was added trifluoroacetic acid (0.1 mL, 1.3 mmol) followed by triethylsilane (0.1 mL, 0.63 mmol). The reaction mixture was stirred at room temperature overnight. The reaction mixture was concentrated. The residue was dissolved in a mixture of water and saturated sodium bicarbonate solution, followed by extraction with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by column chromatography to yield compound (P-2142) as a tan solid (28 mg, 43%). MS (ESI) [M + H +]⁺ = 453.75. 1H NMR spectral and mass spectral data were consistent with the structure of the compound.

Reference Example 17: Preparation of 3,4-dimethyl-N- (2-phenylthiazolo [5,4-b] pyridin-6-yl) -1H-pyrazole-5-carboxamide (P-2144)

PZ / 5321 / AG

EP 2 935 248 B1

142

Scheme 17

<img file="PL2935248T3_D0102.tif" />

Step 1 - Synthesis of 6-nitro-2-phenyl-thiazolo [5,4-b] pyridine (103): In a pressure vessel, 2-chloro-3,5-dinitropyridine 101 (2.5 g, 12.04 mmol ) and benzenecarbothioamide 102 (6.6 g, 48.18 mmol) were dissolved in sulfolane (20 ml, 209.87 mmol). The mixture was heated to 100 ° C and stirred overnight. The reaction mixture was cooled to room temperature, quenched with brine, extracted with ethyl acetate and washed with brine. The organic layer was dried with sodium sulfate. After removal of the solvent, the residue was triturated with methanol, filtered and the filter cake was washed with hexane. The solid was triturated again with methanol to give the product as a tan solid 103 (0.46 g, 14.7%).

Step 2 - Synthesis of 2-phenylthiazolo [5,4-b] pyridin-6-amine 104: Into a round bottom flask containing 6-nitro-2-phenyl-thiazolo [5,4-b] pyridine 103 (30 mg, 0.116 mmol) in an aqueous solution of hydrochloric acid (12N, 1 ml) and methanol (1 ml) was added iron (30 mg). The reaction mixture was stirred at 80 ° C for 2 hours, cooled to room temperature, filtered through celite and washed with methanol and dichloromethane. The filtrate was concentrated to half its volume, diluted with water, neutralized with sodium bicarbonate and extracted with ethyl acetate. The organic layer was washed with brine and dried with sodium sulfate. After removal of the solvent, the residue was dried in vacuo to give 2-phenylthiazolo [5,4-b] pyridin-6-amine 104 as a yellowish solid (93 mg, 98%).

Step 3 - Synthesis of 3,4-dimethyl-N- (2-phenylthiazolo [5,4-b] pyridin-6-yl) -1H-pyrazole-5-carboxamide 105: 3,4-Dimethyl acid was added to the scintillation vial -1H-pyrazole-5-carboxylic 6 (0.03 g, 0.21 mmol) and (O- (7-azabenzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluorophosphate) (0, 1 g, 0.26 mmol) in dimethylacetamide (3 ml). The reaction mixture was stirred at room temperature for one hour. To this mixture then, 2-phenylthiazolo [5,4-b] pyridin-6amine 104 (30 mg, 0.13 mmol) and triethylamine (0.04 ml, 0.26 mmol) were added. The reaction mixture was stirred at room temperature overnight. The reaction was quenched with water, extracted with ethyl acetate, and washed with brine. The organic layer was dried with sodium sulfate. After removal of the solvent, the residue was purified by reverse phase column chromatography to yield compound (P-2144) as a fluffy white solid (6.3 mg, 13.7%). MS (ESI) [M + H +] + = 349.85. Data¹H NMR and mass spectroscopy were consistent with the desired product.

Reference Example 18: Preparation of N- [2- (2-fluorophenyl) -3H-imidazo [4,5-b] pyridin-6-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2152)

PZ / 5321 / AG

EP 2 935 248 B1

143

Scheme 18

<img file="PL2935248T3_D0103.tif" />

Step 1 - Synthesis of 2- (2-fluorophenyl) -6-nitro-3H-imidazo [4,5-b] pyridine (108): Into the pressure vessel containing 5-nitropyridine-2,3-diamine 106 (125 mg, 0.8 mmol) and 2-fluorobenzoic acid 107 (112.17 mg, 0.8 mmol) was added Eaton's reagent (2 mL, 12.73 mmol). The reaction mixture was stirred at 150 ° C. The mixture was cooled to room temperature and quenched with water. The precipitate was collected and dried in vacuo to yield compound 108. The compound was used in the subsequent reaction without purification.

Step 2 - Synthesis of 2- (2-fluorophenyl) -3H-imidazo [4,5-b] pyridin-6-amine (109): For a pressure vessel with 2- (2-fluorophenyl) -6-nitro 3H-imidazo [4,5-b] pyridine 108 (100 mg, 0.38 mmol), aqueous hydrochloric acid (12N, 3 ml) and methanol (3 ml) were added iron (22 mg). The reaction mixture was stirred at 80 ° C for two hours, cooled to room temperature, filtered through celite and washed with methanol and dichloromethane. The filtrate was concentrated to half its volume, diluted with water, neutralized with sodium bicarbonate and extracted with ethyl acetate. The organic layer was washed with brine and dried with sodium sulfate. After removal of the solvent, the residue was dried in vacuo to yield compound 109 as a yellow solid (60 mg, 68.4%). The compound was used in the subsequent reaction without purification.

Step 3 - Synthesis of N- [2- (2-fluorophenyl) -3H-imidazo [4,5-b] pyridin-6-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2152 ): 3,4-Dimethyl-1H-pyrazole-5-carboxylic acid 6 (44 mg, 0.32 mmol) and (O- (7-azabenzotriazol-1-yl) -N, N, N 'hexafluorophosphate) were added to the scintillation vial. N'tetramethyluronium) (0.15 g, 0.39 mmol) in dimethylacetamide (3 mL). The reaction mixture was stirred at room temperature for one hour, then 2- (2-fluorophenyl) -3H-imidazo [4,5b] pyridin-6-amine 109 (45 mg, 0.2 mmol) and N, N-diisopropylethylamine ( 0.07 ml, 0.39 mmol). The mixture was stirred at room temperature overnight, quenched with water, extracted with ethyl acetate and washed with brine. The organic layer was collected and dried with sodium sulfate. After removal of the solvent, the residue was purified by column chromatography followed by trituration with methanol to give compound (P-2152) as an off-white solid (22 mg, 30%). MS (ESI) [M + H +] + = 351.1. Data¹H NMR and mass spectroscopy were consistent with the desired product. [0373] Exemplary compounds 3,4-dimethyl-N- (2-phenyl-3H-imidazo [4,5-b] pyridin-6-yl) -1H-pyrazole-5-carboxamide (P-2145), 4-chloro 3-methyl-N- (2-phenyl-3H-imidazo [4,5-b] pyridin-6-yl) -1H-pyrazole-5-carboxamide (P-2150) and 3-methyl-N- (2-phenyl- 3H-imidazo [4,5-b] pyridin-6-yl) -1H-pyrazole-5-carboxamide (P-2151) was prepared according to the synthesis protocols outlined in Scheme 18 and

PZ / 5321 / AG

EP 2 935 248 B1

144

Example 18. Data from spectrum ¹H NMR and the observed molecular weights (Table 1) were consistent with the structures of the compounds.

Example 19: Preparation of 4- [3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrazolo [3,4b] pyridin-3-yl] phenyl] piperazine-1 tert-butyl-carboxylate (P-2162) and 3,4-dimethyl-N- [3- (3-piperazin-1-ylphenyl) -1H-pyrazolo [3,4-b] pyridin-5-yl] -1H-pyrazole -5-carboxamide (P-2165) [0374]

Scheme 19

<img file="PL2935248T3_D0104.tif" />

Synthesis

[0375] Step 1

Tert-butyl 4- [3- (5-nitro-1H-pyrazolo [3,4-b] pyridin-3-yl) phenyl] piperazine-1-carboxylate (113): To 3-bromo-5-nitro-1H-pyrazole [3,4-b] pyridine 111 (0.1 g, 0.41 mmol) in acetonitrile (3 mL) was added 4- [3- (4,4,5,5-tetramethyl-1,3,2-dioxaborolane) Tert-Butyl -2-yl) phenyl] piperazine-1-carboxylate 112 (0.2 g, 0.52 mmol), [1,1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (12 mg, 0.016 mmol) and aqueous potassium carbonate solution (1 mL, 1 M). The reaction mixture was irradiated with microwaves at 120 ° C for 20 minutes and at 150 ° C for 170 minutes. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine and dried over sodium sulfate. After removing the drying agent and solvent, the residue was purified by silica gel column chromatography to give compound 113 as a tan solid (58 mg, 23%). MS (ESI) [MH -] - = 423.20.

Step 2 - Synthesis of tert-butyl 4- [3- (5-amino-1H-pyrazolo [3,4-b] pyridin-3-yl) phenyl] piperazine-1-carboxylate (114): To 4- [3 - tert-butyl - (5-nitro-1H-pyrazolo [3,4-b] pyridin-3-yl) phenyl] piperazine-1-carboxylate (58 mg, 0.14 mmol) in a mixture of methanol (2 ml) and methylene chloride (2 mL) Palladium on carbon (5 mg, 10%, wet) was added. The reaction mixture was stirred under a hydrogen balloon at room temperature overnight. After removing the catalyst and solvent, the residue was dried in vacuo to give compound 114 as a tan solid (46 mg, 85%). MS (ESI) [M-H +] - = 395.25. The compound was used in the subsequent reaction without purification.

Step 3 - Synthesis 4- [3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrazolo [3,4b] pyridin-3-yl] phenyl] tert-Butyl piperazine-1-carboxylate (P-2162): To 4,5-dimethyl-1H-pyrazole-3-carboxylic acid 6 (30 mg, 0.21 mmol) in N, N-dimethylamide (4 ml) was added benzotriazole hexafluorophosphate -1-yloxytripyrrolidine phosphonium (0.115 g, 0.22 mmol) followed by N, N

PZ / 5321 / AG

EP 2 935 248 B1

145 diisopropylethylamine (0.1 mL, 0.58 mmol). The suspension was stirred at room temperature for 60 minutes. To this suspension was added tert-butyl 4- [3- (5-amino-1H-pyrazolo [3,4-b] pyridin-3-yl) phenyl] piperazine-1-carboxylate (46 mg, 0.12 mmol) in N , N-dimethylamide (1 mL). The reaction mixture was stirred at room temperature for two days, then, the reaction mixture was quenched with water and the mixture was extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by column chromatography and preparative HPLC to provide compound 115 as a white solid (12 mg, 10%). MS (ESI) [M + H +] + = 517.4. Data from spectrum¹H NMR was consistent with the structure of the compound.

Step 4 - Preparation of 3,4-dimethyl-N- [3- (3-piperazin-1-ylphenyl) -1H-pyrazolo [3,4-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2165): Do 4- [3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrazolo [3,4-b] pyridin-3-yl] phenyl] tert-Butyl piperazine-1-carboxylate 115 (8 mg, 0.02 mmol) in tetrahydrofuran (1 mL) was added hydrochloric acid in dioxane (0.4 mL, 4 M). The reaction mixture was stirred at room temperature overnight. The reaction was quenched with water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by preparative HPLC to yield compound 116 as a white solid (2 mg, 28%). MS (ESI) [M + H +]⁺ = 417.15. Data¹H NMR and MS were consistent with the desired product.

[0379] Exemplary compounds 4,5-dimethyl-N- (3- (6- (piperazin-1-yl) pyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H- pyrazole-3-carboxamide (P-2190); 4,5-dimethyl-N- (3- (6- (piperazin-1-yl) pyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2191); 4,5-dimethyl-N- (3- (6-morpholinopyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2192); and 4,5-dimethyl-N- (3- (2-morpholinopyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2193) can be be prepared according to the synthesis protocols outlined in Scheme 19 and Example 19.

Example 20: Preparation of 3,4-dimethyl-N- [2- [3-methyl-1- (oxetan-3-yl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide (P-2168)

[0380]

Scheme 20

<img file="PL2935248T3_D0105.tif" />

Step 1 - Synthesis of 3-methyl-1- (oxetan-3-yl) -4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) pyrazole (119): In a round bottom flask was placed 3-methyl-4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrazole 117 (0.7 g, 3.36 mmol) in dimethylformamide (10 ml) and cooled in an ice-water bath. Then sodium hydride (60% in mineral oil, 0.34 g, 8.41 mmol) was added and the mixture was stirred for 60 minutes. To this mixture was added 3-iodooxetane 118 (0.3 mL, 3.49 mmol) dropwise under nitrogen atmosphere. The reaction mixture was allowed to warm to room temperature and stirred overnight. The reaction was quenched with methanol and concentrated to dryness.

PZ / 5321 / AG

EP 2 935 248 B1

146

The obtained liquid crude product solidified to compound 119 with a toffee consistency. The material was used in the subsequent reaction without purification. MS ESI [M + H +] + = 264.8.

Step 2 - Synthesis of 3,4-dimethyl-N- [2- [3-methyl-1- (oxetan-3-yl) pyrazol-4-yl] -1H-pyrrolo [2,3b] pyridin-5 -yl] -1H-pyrazole-5-carboxamide (2168): N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole was placed in a microwave vessel -5-carboxamide 59 (0.05 g, 0.13 mmol) and 3-methyl-1- (oxetane-3-yl) -4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolane- 2-yl) pyrazole 119 (0.18 g, crude), [1,1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (0.01 g, 0.02 mmol) and 1,4-dioxane (3 ml). To this mixture, potassium carbonate (1 M aqueous solution, 0.8 mL) was added and the reaction mixture was irradiated at 110 ° C for 20 minutes. After filtration, the mixture was purified by preparative HPLC, eluting with acetonitrile: water and 0.1% formic acid with a gradient to yield compound (P-2168) as a major product. MS (ESI) [M + H +]⁺ = 392.2. Data¹H NMR and mass spectroscopy were consistent with the desired product.

[0383] Exemplary compounds N- (2- (1- (1-acetylazetidin-3-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2194); N- (2- (1- (azetidin-3-yl) -3-methyl1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl- 1H-pyrazole-3-carboxamide (P-2195); 4,5-dimethyl-N- (2- (5-methyl-1 - (oxetan-3-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) - 1H-pyrazole-3-carboxamide (P-2196); N- (2- (1- (azetidin-3-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl- 1H-pyrazole-3-carboxamide (P-2197); 4,5-dimethyl-N- (2- (5-methyl-1- (piperidin-4-yl) 1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (p-2198); N- (2- (1- (1 acetylpiperidin-4-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4.5 -Dimethyl-1H-pyrazole-3-carboxamide (P-2199); N- (2- (1- (1- (cyclopropanecarbonyl) piperidin-4-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4 , 5-dimethyl-1H-pyrazole-3-carboxamide (P-2200); 4,5-dimethyl-N- (2- (3-methyl-1- (piperidin-4-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) - 1H-pyrazole-3-carboxamide (P-2201); N- (2- (1- (1-acetylpiperidin-4-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4.5- dimethyl-1H-pyrazole-3-carboxamide (P-2202); and N- (2- (1- (1 (cyclopropanecarbonyl) piperidin-4-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2203) can be prepared according to the synthesis protocols outlined in Scheme 20 and Example 20.

Example 21: Preparation of N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2024) [0384 ]

Scheme 21

PZ / 5321 / AG

EP 2 935 248 B1

147

<img file="PL2935248T3_D0106.tif" />

Step 1 - Preparation of tert-butyl 5- [bis (tert-butoxycarbonyl) amino] pyrrolo [2,3-b] pyridine-1 carboxylate 122: Place 1H-pyrrolo [2,3-b] pyridine in a round bottom flask -5-amine 121 (1 g, 7.51 mmol), di-tert-butyl dicarbonate (6.5 g, 29.78 mmol), 4-dimethylaminopyridine (0.03 g, 0.23 mmol), and N, N-diisopropylethylamine (5 mL, 28.71 mmol) in tetrahydrofuran (20 mL). The reaction mixture was stirred at room temperature overnight and then concentrated. The residue was mixed with water and brine and extracted with ethyl acetate. The organic layers were dried over anhydrous sodium sulfate and concentrated to dryness. The resulting solid was purified by silica gel chromatography to yield compound 122 (0.73 g, 22%) MS ESI [M + H +] + = 434.3. Data¹H NMR and mass spectroscopy were consistent with the desired product.

Step 2 - Preparation of [5- (tert-butoxycarbonylamino) -1H-pyrrolo [2,3-b] pyridin-2-yl] boronic acid 124: To an ice-cooled solution of 5- [bis (tert-butoxycarbonyl) amino] pyrrole Tert-Butyl [2,3b] pyridine-1-carboxylate 122 (0.38 g, 0.88 mmol) and triisopropyl borate 123 (2 mL, 8.67 mmol) in tetrahydrofuran (5 mL) under nitrogen atmosphere was added 2 M lithium diisopropylamide solution (3.6 ml). The reaction mixture was stirred at 0 ° C for one hour after which time the reaction mixture was allowed to stir at room temperature for an additional hour. The reaction was quenched with 2 N HCl, placed on silica and concentrated to dryness. The crude product was purified by silica gel chromatography, eluting with a gradient of methanol: methylene chloride (0-30%) to afford compound 124 (0.1 g, 41%). Analytical data was consistent with the desired product.

[0387] Step 3 - Preparation of tert-butyl N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] carbamate (126): [5- (tert. -butoxycarbonylamino) -1H-pyrrolo [2,3-b] pyridin-2-yl] boronic 124 (0.1 g, 0.36 mmol), 1-fluoro-4-iodobenzene (0.09 g, 0.4 mmol) , [1,1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (50mg, 0.06mmol) and 1,4-dioxane (4ml). Potassium carbonate (1 M aqueous solution, 1 mL) was then added and the reaction mixture was irradiated at 80 ° C for 10 minutes. The mixture was loaded onto silica and purified by silica gel chromatography eluting with a gradient of ethyl acetate: hexanes (20,100%) to afford compound 126 (0.02 g, 17%). MS ESI [M + H +]⁺ = 327.8. Analytical data was consistent with the desired product.

PZ / 5321 / AG

EP 2 935 248 B1

148

Step 4 - Preparation of 2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine 5: Do N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3- b] tert-butyl pyridin-5-yl] carbamate 125 (0.02 g, 0.06 mmol) in methylene chloride (2 ml) was added hydrochloric acid in 1,4-dioxane (4 ml, 4N) and an aqueous acid solution Hydrochloric acid (50 μl, 12 N). The reaction mixture was stirred at room temperature for two hours and concentrated. The residue was dried in vacuo to give crude compound 5 which was used without purification. MS ESI [M + H +] + = 227.7. Analytical data was consistent with the desired product.

Step 5 - Preparation of N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P2034): To a solution of 3,4-dimethyl-1H-pyrazole-5-carboxylic acid 6 (0.03 g, 0.21 mmol) in dimethylacetamide (2 ml) was added benzotriazol-1-yl oxytripyrrolidine phosphonium hexafluorophosphate (0.11 g, 0.21 mmol) and the mixture was stirred at room temperature for 30 minutes. Then 2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine hydrochloride (16mg, 0.06mmol) was added followed by N, N-diisopropylethylamine (0.5ml, 2.89 mmol). The reaction mixture was stirred at room temperature for 1 hour and purified by preparative HPLC to give compound (P-2034) (5 mg, 21%). MS ESI [M + H +]⁺ = 350.15. Data¹H NMR and mass spectroscopy were consistent with the desired product.

Step 6 - Preparation of isopropyl 5 - [(4,5-dimethyl-1H-pyrazole-3-carbonyl) amino] -2- (4-fluorophenyl) pyrrolo [2,3-b] pyridine-1-carboxylate (128) Isopropyl chloroformate 127 (0.5 ml) was added dropwise to 4,5-dimethyl-1H-pyrazole-3-carboxylic acid 6 (69.3 mg, 0.49 mmol) in N-methylmorpholine (2 ml) at -20 ° C. , 1.0 M in toluene, 0.5 mmol). The mixture was stirred at -20 ° C for 10 minutes. To this mixture then, 2- (4-fluorophenyl) 1H-pyrrolo [2,3-b] pyridin-5-amine (105 mg, 0.46 mmol), N-methylmorpholine (2 ml) was added. The reaction mixture was stirred at -20 ° C for 20 minutes and allowed to warm to room temperature. The mixture was then stirred at room temperature overnight. The solvent was removed and the residue was partitioned between ethyl acetate and saturated sodium bicarbonate solution. The organic layers were collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by column chromatography to yield compound 128 (32 mg, 15.9%). MS ESI [M + H +]⁺ = 435.90. Data¹H NMR and MS were consistent with the desired product.

Step 7 - Preparation of N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2034 ): To isopropyl 128 5 - [(4,5-dimethyl-1H-pyrazole-3-carbonyl) amino] -2- (4-fluorophenyl) pyrrolo [2,3-b] pyridine-1-carboxylate (20 mg, 0.046 mmol ) in methanol (2 ml), potassium hydroxide (8 mg, 0.14 mmol) was added. The reaction mixture was stirred at room temperature overnight, concentrated, taken up in water and brine and extracted with ethyl acetate. The organic layers were dried over anhydrous sodium sulfate. After removal of the drying agent and solvent, the residue was purified by silica gel chromatography to give compound (P-2034) (12 mg, 74%). MS ESI [M + H +]⁺ = 350,1.

Example 22: Preparation of N- [2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P- 2108)

[0392]

Scheme 22

PZ / 5321 / AG

EP 2 935 248 B1

149

<img file="PL2935248T3_D0107.tif" />

Step 1 - Synthesis of tert-butyl 5- [bis (tert-butoxycarbonyl) amino] -2-iodo-pyrrolo [2,3-b] pyridine-1-carboxylate (127): To a round bottom flask was added 1H-pyrrolo [2 , 3-b] pyridin-5-amine 126 (1 g, 7.51 mmol), di-tert-butyl dicarbonate (6.5 g, 29.78 mmol), 4-dimethylaminopyridine (0.03 g, 0.10 mmol) 23 mmol) and N, N-diisopropylethylamine (5 mL, 28.71 mmol) in tetrahydrofuran (20 mL). The reaction mixture was stirred at room temperature overnight and concentrated. The residue was partitioned between ethyl acetate and water. The organic layers were collected, washed with brine, and dried with sodium sulfate. After removal of the drying agent and solvent, the residue was purified by column chromatography on silica eluting with a gradient of ethyl acetate: hexanes to afford compound 127 (0.73 g, 22%). MS (ESI) [M + H +] + = 434.3. Data¹H NMR and mass spectroscopy were consistent with the desired product.

Step 2 - Synthesis of 5- [bis (tert-butoxycarbonyl) amino] -2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) pyrrolo [2,3-b] tert-Butyl pyridine-1-carboxylate (131a): To ice-cooled tert-butyl 5- [bis (tert-butoxycarbonyl) amino] -2-iodo-pyrrolo [2,3-b] pyridine-1-carboxylate 127 (0 , 1 g, 0.23 mmol) and isopropoxy- (4,4,5,5-tetramethyl-1,3-dioxolan-2-yl) borane (0.091 g, 0.49 mmol) in tetrahydrofuran (3 mL) was added lithium diisopropylamide (2 M, 0.23 mL, 0.46 mmol). The mixture was stirred at 0 ° C for one hour. The reaction was quenched with an aqueous hydrochloric acid solution. The reaction mixture was poured into water and extracted with dichloromethane. The organic layer was washed with brine and dried over sodium sulfate. After removing the solvent, the residue was purified by silica gel column chromatography to give compound 131a. MS (ESI) [M + H +]⁺ = 559.80. Analytical data was consistent with the desired product.

Step 3 - Synthesis of 2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-amine (132): To tert 5- [bis (tert-butoxycarbonyl) amino] -2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) pyrrolo [2,3-b] pyridine-1-carboxylate -butyl 131a (1 eq.) in tetrahydrofuran (THF) was added hydrochloric acid (1 to 10 eq.). The reaction mixture was stirred at

PZ / 5321 / AG

EP 2 935 248 B1

150 room temperature overnight. The solvent was removed and the residue was partitioned between ethyl acetate and saturated sodium bicarbonate solution. The organic layer was washed with brine and dried over sodium sulfate. After removal of the solvent, the residue was dried in vacuo to yield compound 132.

Step 4 - Synthesis of tert-butyl 5- [bis (tert-butoxycarbonyl) amino] -2-iodo-pyrrolo [2,3-b] pyridine-1-carboxylate (129): A round bottom flask was charged with N- (2- iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamate tert-butyl 128 (0.8 g, 2.23 mmol), di-tert-butyl dicarbonate (1 g, 4.58 mmol), 4-dimethylaminopyridine (0.01 g, 0.08 mmol) and N, N-diisopropylethylamine (1 mL, 5.74 mmol) in tetrahydrofuran (20 mL). The reaction mixture was stirred at room temperature overnight. The mixture was concentrated and the residue was partitioned between ethyl acetate and water. The organic layers were collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was dried in vacuo to yield compound 129, which was used in the subsequent reaction without purification. MS (ESI) [M + H +] + = 560.25.

Step 5 - Synthesis of N- [2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] tert-butyl carbamate (131b): To tert-butyl 5- [bis (tert-butoxycarbonyl) amino] -2-iodopyrrolo [2,3-b] pyridine-1-carboxylate 129 (0.1 g, 0.23 mmol) ) in tetrahydrofuran (3 ml), butyl lithium (1.6 M, 0.6 ml, 0.9 mmol) was added. The mixture was stirred at room temperature for 20 minutes. To this mixture was added slowly isopropoxy- (4,4,5,5-tetramethyl-1,3-dioxolan-2-yl) borane 130 (0.1 g, 0.53 mmol) in tetrahydrofuran (2 mL). The resulting mixture was stirred at room temperature for three hours and then overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate. After removing the solvent, the residue was purified by silica gel column chromatography to give compound 131 as an off-white solid (16 mg, 16%). MS (ESI) [M + H +]⁺ = 359,9.

Step 6 - Synthesis of 2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-amine (132): To tert-butyl 131 N- [2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] carbamate ( 14 mg, 0.04 mmol) in tetrahydrofuran (1 ml) was added hydrochloric acid in dioxane (0.5 ml, 4 M). The reaction mixture was stirred at room temperature overnight. The solvent was removed and the residue was partitioned between an appropriate solvent (ethyl acetate or dichloromethane), water and saturated sodium bicarbonate solution. The organic layer was collected and dried over sodium sulfate. After removal of the solvent, the residue was dried in vacuo to give crude compound 132 as a brown solid (8 mg, 67%) which was used in the subsequent reaction without purification. MS (ESI) [M + H +]⁺ = 259,8.

[0399] Step 7 - Synthesis of 4,5-dimethyl-N- [2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide (133): To 3,4-dimethyl-1H-pyrazole-5-carboxylic acid 6 (1 eq.) In the appropriate amount of a solvent such as dimethylacetamide, tetrahydrofuran, acetonitrile or N, N-dimethylformamide is added benzotriazol-1-yloxytripyrrolidinophosphonium or o (1 eq. -N, N, N ', N'-tetramethyl uronium hexafluorophosphate (1 eq.) And N-hydroxybenzotriazole (1 eq.) Followed by N, N-diisopropylethylamine (1 eq.) Or triethylamine (1 eq.). The mixture is stirred at room temperature for 30 minutes to several hours. To this mixture is added 2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-amine 132 (1 eq.) And N, N

PZ / 5321 / AG

EP 2 935 248 B1

151 diisopropylethylamine (1 eq.) or triethylamine (1 eq.). The reaction mixture is stirred at room temperature for one hour to 2-3 days. Heating can be used if needed. The reaction mixture is partitioned between an organic solvent (including, but not limited to, hexanes, benzene, ethyl acetate, and dichloromethane) and water. The organic layer is collected and dried over sodium sulfate. After removal of the drying agent and solvent, the residue is purified by chromatography to produce compound 133.

[0400] Step 8 - Synthesis of N- [2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2108): To a mixture of 4,5-dimethyl-N- [2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl ] -1H-pyrazole-3-carboxamide 133 (1 eq.), 4-bromo-2-cyclopropylpyridine 134 (1 eq.), [1,1'bis (diphenylphosphino) ferrocene] dichloropalladium (II) or tetrakis (triphenylphosphine) palladium ( 0) (0.1 eq) in a suitable amount of a solvent (e.g. acetonitrile or tetrahydrofuran or dioxane) is added a suitable amount of aq. Potassium carbonate (1M). The reaction mixture is irradiated with microwaves at a temperature ranging from 90 ° C to 180 ° C for about 10 minutes to 2-3 hours. The reaction mixture is partitioned between water and an organic solvent (including, but not limited to, hexanes, ethyl acetate, and dichloromethane). The organic layer is collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue is purified by chromatography to yield compound 135.

Step 9 - Synthesis of tert- 5- [tert-butoxycarbonyl- (1-tert-butoxy carbonyl-4,5-dimethylpyrazole-3-carbonyl) amino] -2-iodopyrrolo [2,3-b] pyridine-1-carboxylate butyl (136): N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide 59 (0, 5 g, 1.31 mmol), di-tert-butyl dicarbonate (1.15 g, 5.25 mmol) and 4-dimethylaminopyridine (0.02 g, 0.13 mmol) in tetrahydrofuran (18 mL). Then N, N-diisopropylethylamine (0.8 mL, 4.59 mmol) was added and the mixture was stirred at room temperature overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by silica gel column chromatography (0-10% methanol / dichloromethane, 12G) to afford compound 136 as a white brittle foam (700 mg, 78.3%). MS (ESI) [M + H +] + = 682.4. Data¹H NMR and mass spectroscopy were consistent with the structure of the desired product.

Step 10 - Synthesis of 5- [tert-butoxycarbonyl- (1-tert-butoxycarbonyl-4,5-dimethylpyrazole-3-carbonyl) amino] -2- (4,4,5,5-tetramethyl-1,3,2 tert-butyl-dioxaborolan-2-yl) pyrrolo [2,3-b] pyridine-1-carboxylate (137): To tert-butyl 5- [tert-butoxycarbonyl- (1-tert-butoxycarbonyl-4,5-dimethylpyrazole-3-carbonyl) amino] -2-iodo-pyrrolo [2,3-b] pyridine-1-carboxylate 136 (50 mg , 0.073 mmol) and isopropoxy- (4,4,5,5-tetramethyl-1,3-dioxolan-2-yl) borane 130 (0.03 g, 0.15 mmol) in tetrahydrofuran (3 mL) at - At 20 ° C, lithium diisopropylamide (2 M, 0.15 ml, 0.3 mmol) in tetrahydrofuran (1 ml) was added. The mixture was allowed to warm to room temperature slowly and was stirred at room temperature overnight. The reaction was quenched with an aqueous hydrochloric acid solution. The mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine and dried over sodium sulfate. After removing the solvent, the residue was purified by silica gel column chromatography to yield compound 137. MS (ESI) [M + H +]⁺ = 682,5.

PZ / 5321 / AG

EP 2 935 248 B1

152

Step 11 - Synthesis of tert 3 - [[2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] carbamoyl] -4,5-dimethylpyrazole-1-carboxylate -butyl (138): To the mixture 5- [tert-butoxycarbonyl- (1-tert-butoxycarbonyl-4,5-dimethylpyrazole-3-carbonyl) amino] -2- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) tert-Butyl pyrrolo [2,3-b] pyridine-1-carboxylate 137 (1 eq.), 4-bromo-2-cyclopropylpyridine 134 (1 eq.), [1,1'bis (diphenylphosphino) ferrocene] dichloropalladium (II) or tetrakis (triphenylphosphine) palladium (0) (0.1 eq.) in a suitable amount of a solvent (e.g. acetonitrile or tetrahydrofuran or dioxane) is added the appropriate amount of aqueous potassium carbonate (1M). The reaction mixture is irradiated with microwaves at a temperature in the range of 90 to 180 ° C for 10 minutes to 2-3 hours. The reaction mixture is partitioned between water and an appropriate solvent (ethyl acetate or dichloromethane). The organic layer is collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue is purified by chromatography to yield compound 138.

Step 12 - Synthesis of N- [2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2108): To tert 3 - [[2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3b] pyridin-5-yl] carbamoyl] -4,5-dimethylpyrazole-1-carboxylate -butyl 138 (1 eq.) in an appropriate amount of tetrahydrofuran, hydrochloric acid (1 to 10 eq.) is added. The reaction mixture was stirred at room temperature overnight. The solvent is removed and the residue is partitioned between an appropriate solvent (ethyl acetate or dichloromethane), water and saturated sodium bicarbonate solution. The organic layer is collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue is purified by chromatography to yield compound 135.

[0405] Exemplary compounds N- (2- (2- (cyclopropylamino) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3- carboxamide (P-2204); N- (2- (3-chloro-2- (cyclopropanecarboxamido) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2205); N- (2- (2 (cyclopropanecarboxamido) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide (P-2206) ; N- (2- (2- (1- (cyclopropanecarbonyl) piperidin-4-yl) pyridin-4-yl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H- pyrazole-3-carboxamide (P-2207); 4,5-dimethyl-N- (2- (2- (pyrrolidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2208); 4,5-dimethyl-N- (2 (2- (piperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3- carboxamide (P-2209);

4,5-dimethyl-N- (2- (2- (4-methylpiperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole -3 carboxamide (P-2210); 4,5-dimethyl-N- (2- (2- (piperidin-4-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2211); N- (2- (2- (4-hydroxypiperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3 -carboxamide (P-2212); and N- (2- (2- (3-hydroxypiperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole- The 3-carboxamide (P-2213) can be prepared according to the synthesis protocols set forth in Example 22 and Scheme 22.

Example 23: Preparation of 4,5-dimethyl-N- [2- [2- (4-methylsulfonylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H- pyrazole-3-carboxamide (P-2189) [0406]

Scheme 23

PZ / 5321 / AG

EP 2 935 248 B1

153

<img file="PL2935248T3_D0108.tif" />

Step 1 - Synthesis of 3-oxo-3- [4- [4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -2-pyridyl] piperazin-1-yl ] propanenitrile (141): To 2-cyanoacetic acid 140 (0.1 g, 1.18 mmol) in tetrahydrofuran (3 mL) was added O-benzotriazole-N, N, N ', N'-tetramethyluronium hexafluorophosphate (0.48 ml, 1.32 mmol) and N, N-diisopropylethylamine (0.4 ml, 2.31 mmol). The reaction mixture was stirred at room temperature for 30 minutes. 1- [4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -2-pyridyl] piperazine 139 (0.2 g, 0.69 mmol) in tetrahydrofuran ( 1 ml). The reaction mixture was stirred at room temperature overnight and concentrated. The residue was partitioned between ethyl acetate and water. The organic layers were collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was dried in vacuo to yield crude compound 141 (0.35 g), which was used in the subsequent reaction without purification.

Step 2 - Synthesis of 4,5-dimethyl-N- [2- [2- (4-methylsulfonylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide (P-2189): Do N- (2-iodo-1H-pyrrolo [2,3b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide 59 (0.1 g, 0.26 mmol) in acetonitrile (3 ml) added 3-oxo-3- [4- [4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) -2-pyridyl] piperazin-1-yl] propanenitrile 141 (0.2 g, crude), [1,1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (15 mg, 0.019 mmol) and aqueous potassium carbonate (1 mL, 1 M). The reaction mixture was irradiated with microwaves at 130 ° C for 30 minutes. The residue was partitioned between ethyl acetate and water. The organic layers were collected, washed with brine, and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by preparative HPLC to give compound (P-2189) as a yellow solid (35 mg, 25%). MS (ESI) [M + H +] - + = 484.30. Data¹H NMR and mass spectroscopy were consistent with the desired product.

[0409] Exemplary Compounds 3,4-dimethyl-N- [2- [2- (4-methylsulfonylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H -pyrazole-5-carboxamide (P-2186) and N- [2- [2- [4- (cyclopropanecarbonyl) piperazin-1-yl] -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5 -yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide (P-2187) was prepared according to the synthesis protocols set forth in Example 23 and Scheme 23. The 1H NMR and mass spectral data were consistent with the structures of the compounds. Compounds N- (2- (2- (4-acetylpiperazin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole- 3-carboxamide (P-2214) and 4,5-dimethyl-N- (2- (2- (4- (3-methylbut-2-enoyl) piperazin1-yl) pyridin-4-yl) -1H-pyrrolo [ 2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2215) can also be prepared using the synthetic methods outlined in Example 23 and Scheme 23.

Example 24: Preparation of N-cyclopropyl-4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] pyridine-2- carboxamide (P-2175) [0410]

Scheme 24

PZ / 5321 / AG

EP 2 935 248 B1

154

<img file="PL2935248T3_D0109.tif" />

Step 1 - Preparation of [2- (cyclopropylcarbamoyl) -4-pyridyl] boronic acid (141): To a round bottom flask was added 4-boronopyridine-2-carboxylic acid 139 (120 mg, 0.72 mmol), hydrochloride 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide (0.28 g, 1.44 mmol) and 1-hydroxybenzotriazole (0.19 g, 1.44 mmol) in dimethylacetamide (3 mL). The mixture was stirred at room temperature for 40 minutes then cyclopropanamine (0.06 mL, 1.44 mmol) was added followed by N, N-diisopropylethylamine (0.25 mL, 1.44 mmol). The reaction mixture was stirred at room temperature for three hours, poured into water and extracted with ethyl acetate. The organic layer was washed with brine and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was dried in vacuo to yield compound 141 (60 mg, 40.5%). The compound was used in the subsequent reaction without purification.

Step 2 - Preparation of N-cyclopropyl-4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] 1H-pyrrolo [2,3-b] pyridin-2-yl] pyridine-2-carboxamide (P-2175): N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5 was placed in a microwave vessel. -carboxamide 59 (60 mg, 0.16 mmol), [2- (cyclopropylcarbamoyl) -4-pyridyl] boronic acid 141 (0.06 g, 0.31 mmol) [1.1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (0.01 g, 0.01 mmol) and 1,4-dioxane (3 mL). An aqueous solution of potassium carbonate (0.47 mL, 1 M) was then added to the mixture and the reaction mixture was irradiated with microwave radiation at 130 ° C for 30 minutes. Additional equivalents of [2 (cyclopropylcarbamoyl) -4-pyridyl] boronic acid, [1,1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) and aqueous potassium carbonate (0.47 ml, 1M) were added and the reaction mixture was irradiated with microwave radiation at 135 ° C for another 30 minutes. The reaction mixture was neutralized with 1 N aqueous hydrochloric acid solution, poured into water, and extracted with ethyl acetate. The organic layer was washed with brine and dried over sodium sulfate. After removing the drying agent and solvent, the residue was purified by silica gel column chromatography and triturated with methanol to give compound (P-2175) as a white solid (5.5 mg, 8.4%). MS (ESI) [M + H +] + = 415.85. Data¹H NMR and mass spectroscopy were consistent with the structure of the compound.

[0413] Exemplary compounds 4,5-dimethyl-N- (2- (2- (morpholine-4-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3b] pyridin-5-yl) -1H- pyrazole-3-carboxamide (P-2216); 4,5-dimethyl-N- (2- (2- (4-methylpiperazine-1-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3 -carboxamide (P-2217); 4,5-dimethyl-N- (2- (2- (pyrrolidine-1-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P -2218); 4,5-dimethyl-N- (2- (2- (thiomorpholine-4-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2219); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-methoxyethyl) picolinamide (P-2220) ; 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2- (dimethylamino) ethyl) picolinamide (P- 2221); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-methoxyethyl) picolinamide (P2222); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N-methoxypicolinamide (P-2223); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2

PZ / 5321 / AG

EP 2 935 248 B1

155 yl) -N, N-dimethylpicolinamide (P-2224); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-morpholinoethyl) picolinamide (P-2225); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2- (4-methylpiperazin-1-yl) ethyl) picolinamide (P-2226); N- (2-cyanoethyl) -4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) picolinamide (P-2227); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) N-isobutylpicolinamide (P-2228); 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N-isopropylpicolinamide (P-2229); and 4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) -N, N-diethylpicolinamide (P-2230) can be prepared according to the synthesis protocols set forth in Example 24 and Scheme 24.

Example 25: Preparation of 5-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -4- (trifluoromethyl) 1H-pyrazole-3-carboxamide (P-2190) [ 0414]

Scheme 25

<img file="PL2935248T3_D0110.tif" />

Step 1 - Preparation of 5-methyl-4- (trifluoromethyl) -1H-pyrazole-3-carboxylic acid (145): To a mixture of bis (trifluoromethylsulfonyl) zinc (0.15 g, 0.45 mmol) and acid 5 -methyl-1H-pyrazole-3-carboxylic acid 143 (0.05 g, 0.4 mmol) in dichloromethane (2 ml) was added water (0.5 ml) followed by tert-butyl hydroperoxide (0.3 ml, 70% solution in water, 2 mmol). The reaction mixture was allowed to warm to room temperature and stirred for two hours then overnight. The reaction mixture was stirred at 50 ° C for three days. The reaction mixture was partitioned between dichloromethane and water. The organic layer was collected and dried over sodium sulfate. After removal of the drying agent and solvent, the residue was purified by preparative HPLC to yield compound 145 as a white solid (5 mg, 6.5%). MS (ESI) [M + H +] + = 194.70. Data¹H NMR and mass spectroscopy were consistent with the structure of the compound.

Step 2 - Preparation of 5-methyl-4- (trifluoromethyl) -1H-pyrazole-3-carboxylic acid (P2190): To 5-methyl-4- (trifluoromethyl) -1H-pyrazole-3-carboxylic acid (1 eq.) 145 in the appropriate amount of a solvent such as dimethylacetamide, tetrahydrofuran, acetonitrile or N, N-dimethylformamide, benzotriazol-1-yloxytripyrrolidinium hexafluorophosphate is added eq.) or o-benzotriazole-N, N, N ', N'-tetramethyluronium hexafluorophosphate (1 eq.) and N-hydroxybenzotriazole (1 eq.), followed by N, N-diisopropylethylamine (1 eq.) or triethylamine (1 eq.). The mixture is stirred at room temperature for 30 minutes to several hours. To this mixture is added 2- (4-phenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine hydrochloride 16 (1 eq.) And N, N-diisopropylethylamine (1 eq.) Or triethylamine (1 eq.) . The reaction mixture is stirred at room temperature for one hour to 2-3 days. Heating may be used if required. The reaction mixture is partitioned between an organic solvent (ethyl acetate, dichloromethane, etc.) and water. The organic layer is collected and dried over

PZ / 5321 / AG

EP 2 935 248 B1

156 sodium sulfate. After removing the drying agent and the solvent, the residue is purified by chromatography and / and preparative HPLC to yield the compound P-2190.

[0417] Exemplary compounds 4-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -5- (trifluoromethyl) -1H-pyrazole-3-carboxamide (P-2231); 4-chloro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -5- (trifluoromethyl) 1H-pyrazole-3-carboxamide (P-2232); 5-chloro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -4 (trifluoromethyl) -1H-pyrazole-3-carboxamide (P-2233); 5- (difluoromethyl) -4-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2234); 4- (difluoromethyl) -5-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2235); 5-chloro-4- (difluoromethyl) -N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2236); and 4-chloro-5- (difluoromethyl) N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide (P-2237) can be prepared according to the protocols the syntheses set out in Example 25 and Scheme 25.

[0418] The compounds listed in Table 1 below, e.g., compounds P-2001 to P-2189 were prepared according to the protocols provided in Examples 1 to 25 and Schemes 1 to 25. Data ¹H NMR and mass spectroscopy were consistent with the structures of the compounds.

Table 1

<td>No</td><td>Relationship</td><td>Name</td><td>MS (ESI) observed [M + H +] + or [M-H +] -</td>

<td>P-2001 (reference example)</td><td>H N.</td><td>(2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanol</td><td> 301,8</td>

<td>P-2002 (reference example)</td><td>About CYC</td><td>(2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - (3-pyridyl) methanone</td><td> 299,8</td>

<td>P-2003 (reference example)</td><td></td><td>N- (3-carbamoylphenyl) -2-phenyl-1H-pyrrolo [2,3-b] pyridine-5-carboxamide</td><td> 355,1*</td>

<td>P-2004 (reference example)</td><td></td><td>2-phenyl-N- (1H-pyrazol-3-yl) -1H-pyrrolo [2,3-b] pyridine-5-carboxamide</td><td> 304,1</td>

<td>P-2005</td><td>H.</td><td>4-bromo-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) 1H-pyrazole-5-carboxamide</td><td> 384,0</td>

<td>P-2006 (reference example)</td><td>H .. Η</td><td>Ethyl 3 - [(2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamoylamino] propanoate</td><td> 352,8</td>

<td>P-2007</td><td></td><td>3,4-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 332,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

157

<td>P-2008</td><td></td><td>4-methyl-3-phenyl-N- (2-phenyl-1H-pyrrolo [2,3- b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 394,2</td>

<td>P-2009</td><td>&lt;1 nh H.</td><td>3-cyclopropyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin- 5-yl) -1H-pyrazole-5-carboxamide</td><td> 344,1</td>

<td>P-2010</td><td>WH η</td><td>5-fluoro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) 1H-indazole-3-carboxamide</td><td> 372,1</td>

<td>P-2011 (reference example)</td><td>Η</td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyrimidine-4-carboxamide</td><td> 316,1</td>

<td>P-2012 (reference example)</td><td>^Η</td><td>3-fluoro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyridine-2-carboxamide</td><td> 333,1</td>

<td>P-2013 (reference example)</td><td>Yow</td><td>3,5-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) isoxazole-4-carboxamide</td><td> 333,1</td>

<td>P-2014 (reference example)</td><td>about</td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyridazine-3-carboxamide</td><td> 316,1</td>

<td>P-2015 (reference example)</td><td>H. H.</td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -2H-triazole-4-carboxamide</td><td> 305,1</td>

<td>P-2016 (reference example)</td><td></td><td>3-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) pyridine-2-carboxamide</td><td> 329,1</td>

<td>P-2017 (reference example)</td><td>H.</td><td>4,5-dimethyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) isoxazole-3-carboxamide</td><td> 333,3</td>

<td>P-2018 (reference example)</td><td>ABOUT ^H.0 ^ 00 ^ H. ^H.</td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-4-sulfonamide</td><td> 340,1</td>

<td>P-2019</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3-methyl-1H-pyrazole-5-carboxamide</td><td> 335,8</td>

<td>P-2020 (reference example)</td><td></td><td>N3- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzene-1,3-dicarboxamide</td><td> 375,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

158

<td>P-2021 (reference example)</td><td>T. 7- ^ XO &amp;</td><td>3- (cyanomethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzamide</td><td> 371,1</td>

<td>P-2022 (reference example)</td><td>□ O^-</td><td>2-chloro-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -6-methylbenzamide</td><td> 380,1</td>

<td>P-2023</td><td></td><td>4-chloro-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide</td><td> 369,75</td>

<td>P-2024</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 350,1</td>

<td>P-2025 (reference example)</td><td></td><td>3-cyano-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzamide</td><td> 357,1</td>

<td>P-2026 (reference example)</td><td></td><td>3-acetamido-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] benzamide</td><td> 389,0</td>

<td>P-2027 (reference example)</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 2H-indazole-4-carboxamide</td><td> 370,1</td>

<td>P-2028</td><td>$ 9xij-o-</td><td>3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-5-carboxamide</td><td> 364,25</td>

<td>P-2029</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 4-methyl-1H-pyrazole-3-carboxamide</td><td> 336,2</td>

<td>P-2030 (reference example)</td><td></td><td>2-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] pyrazole-3-sulfonamide</td><td> 386,05</td>

<td>P-2031</td><td></td><td>5-methyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H- pyrazole-3-carboxamide</td><td> 435,9</td>

<td>P-2032 (reference example)</td><td>fi Yo 2 ;. r</td><td>3,4-dimethyl-N- (1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 256,1</td>

<td>P-2033 (reference example)</td><td>l &lt;i ^H.hjTOOTZWL &lt;Λ 0 ° ⁱⁿ</td><td>N- [1 - (benzenesulfonyl) -2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] pyrrolo [2,3-b] pyridin-5-yl] -3.4 -dimethyl-1H-pyrazole-5-carboxamide</td><td> 589,95</td>

PZ / 5321 / AG

ΕΡ2 935 248 Β1

159

<td>Ρ-2034</td><td>Η</td><td>3,4-dimethyl-N- [2- [1- (morpholine-4-carbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] - 1H-pyrazole-5-carboxamide</td><td> 449,95</td>

<td>Ρ-2035 (reference example)</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H-1,2,4-triazole-5-carboxamide</td><td> 322,95</td>

<td>Ρ-2036</td><td>Τη</td><td>4-chloro-3-methyl-N- [2- [1- (morpholine-4-carbonyl) - 3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 470</td>

<td>Ρ-2037 (reference example)</td><td>η Η</td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 5-methyl-2H-triazole-4-carboxamide</td><td> 337,2</td>

<td>Ρ-2038</td><td>Κγγ</td><td>N- [2- (1,3-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 349,9</td>

<td>Ρ-2039</td><td>\ CI hoji. Η [&gt;</td><td>4-chloro-N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl-1H -pyrazole-3-carboxamide</td><td> 424,9</td>

<td>Ρ-2040 (reference example)</td><td></td><td>3,4-dimethyl-N- (3-methyl-1H-pyrazolo [3,4-b] pyridin- 5-yl) -1H-pyrazole-5-carboxamide</td><td> 271,2</td>

<td>Ρ-2041 (reference example)</td><td>F. ν JJ &lt;ζτ Υ Η</td><td>N- [3- (4-fluorophenyl) -1H-pyrazolo [3,4-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 351,3</td>

<td>Ρ-2042</td><td>hq a ΥτγγοΥ H [&gt;</td><td>N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -5-methyl-1H-pyrazole-3- carboxamide</td><td> 390,9</td>

<td>Ρ-2043</td><td>B TocycT H [&gt;</td><td>N- [2- [1- (cyclopropanecarbonyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -4,5-dimethyl-1H-pyrazole- 3-carboxamide</td><td> 404,9</td>

<td>Ρ-2044 (reference example)</td><td>Τ1Χ0 H.</td><td>N- (2-anilinopyrimidin-5-yl) -3,4-dimethyl-1 Hpyrazole-5-carboxamide</td><td> 309,1</td>

<td>Ρ-2045 (reference example)</td><td>nML ίί Yw H.</td><td>N- (6-anilino-3-pyridyl) -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 308,5</td>

<td>Ρ-2046</td><td>ΥΥΧΗΥ ^υ Tr N H.</td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 1H-indazole-3-carboxamide</td><td> 372,35</td>

PZ / 5321 / AG

EP 2 935 248 B1

160

<td>P-2047</td><td>H.</td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 4,5,6,7-tetrahydro-1H-indazole-3-carboxamide</td><td> 376,45</td>

<td>P-2048</td><td>HSochY</td><td>3,4-dimethyl-N- [2- [1- (4-piperidyl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 405,2</td>

<td>P-2049</td><td>hs Ie¹™ H</td><td>N- (2-chloro-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 289,95</td>

<td>P-2050 (reference example)</td><td>this ^H.h 0 9 h</td><td>N- [2- [3- (ethylsulfamoyl) anilino] pyrimidin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 415,9</td>

<td>P-2051 (reference example)</td><td>and H.</td><td>3,4-dimethyl-N- [2- (3-morpholinoanilino) pyrimidin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 394,5</td>

<td>P-2052 (reference example)</td><td>oh, Χ ' XX Η ^Ηχ ° Χί ΧΧχΟ Η</td><td>3,4-dimethyl-N- [2- [3- (propylsulfonylamino) anilino] pyrimidin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 430,4</td>

<td>P-2053 (reference example)</td><td>D, jQ χ- /^ΗΗ</td><td>N- [2- [3- (benzenesulfonamido) anilino] pyrimidin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 464,3</td>

<td>P-2054 (reference example)</td><td>Η</td><td>3,4-dimethyl-N- [2- [3- (methylcarbamoyl) anilino] pyrimidin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 365,9</td>

<td>P-2055 (reference example)</td><td>Η</td><td>Ethyl N- [3 - [[5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] pyrimidin-2-yl] amino] phenyl] carbamate</td><td> 396,4</td>

<td>P-2056</td><td>Η &lt;Χ Η Η</td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 1,4,5,6-tetrahydrocyclopenta [c] pyrazole-3-carboxamide</td><td> 361,9</td>

<td>P-2057</td><td></td><td>4-chloro-3-methyl-N- [2- (1-methylsulfonyl-3,6-dihydro-2H-pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole- 5-carboxamide</td><td> 434,9</td>

<td>P-2058</td><td></td><td>3-methyl-N- (2-morpholine-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 327,3</td>

<td>P-2059</td><td></td><td>4,5-dimethyl-N- [2- (4-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide</td><td> 417,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

161

<td>P-2060</td><td></td><td>4-chloro-N- [2- [1- (cyclopropanecarbonyl) -2,5-dihydropyrrol-3-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5- carboxamide</td><td> 412,0</td>

<td>P-2061</td><td></td><td>N- [2- (1-acetyl-3,6-dihydro-2H-pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-chloro-3-methyl-1H-pyrazole- 5-carboxamide</td><td> 398,9</td>

<td>P-2062</td><td></td><td>4-chloro-3-methyl-N- [2- [1- (morpholine-4-carbonyl) 2,5-dihydropyrrol-3-yl] -1H-pyralo [2,3-b] pyridin-5-yl] -1H -pyrazole-5-carboxamide</td><td> 456,0</td>

<td>P-2063</td><td>Η</td><td>N- [2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin- 5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 312,25</td>

<td>P-2064</td><td></td><td>N- [2- [3- (dimethylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 374,95</td>

<td>P-2065</td><td></td><td>N- [2- (3,5-dimethylisoxazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 351,5</td>

<td>P-2066</td><td></td><td>3,4-dimethyl-N- [2- [3- (2-morpholinoethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 461,1</td>

<td>P-2067</td><td>π π</td><td>3,4-dimethyl-N- [2- [4- (methylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 388,9</td>

<td>P-2068</td><td>Η</td><td>N- [2- (3-fluoroprop-1-ynyl) -1H-pyrrolo [2,3-b] pyridin- 5-yl] -3-methyl-1H-pyrazole-5-carboxamide</td><td> 298</td>

<td>P-2069</td><td>hQL Η Λ⁷η</td><td>4,5-dimethyl-N- [2- [2- (4-methylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide</td><td> 431,3</td>

<td>P-2070</td><td>'γΤγΥγ Ν' Ν</td><td>4,5-dimethyl-N- [2- (3-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-3-carboxamide</td><td> 417,25</td>

<td>P-2071 (reference example)</td><td></td><td>N- (4,5-dimethyl-1H-pyrazol-3-yl) -2-phenyl-1H-pyrrolo [2,3-b] pyridine-5-carboxamide</td><td> 331,9</td>

<td>P-2072 (reference example)</td><td></td><td>N- [2- (4-fluorophenyl) pyrazolo [1,5-a] pyrimidin-6-yl] - 4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 352,0</td>

PZ / 5321 / AG

EP 2 935 248 B1

162

<td>P-2073</td><td></td><td>3,4-dimethyl-N- [2- [1- (2-morpholinoacetyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H- pyrazole-5-carboxamide</td><td> 464,6</td>

<td>P-2074</td><td>ΤχιχΧ ^H. HO OH</td><td>N- [2- [1- (2,3-dihydroxypropanoyl) -3,6-dihydro-2H-pyridin-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl- 1H-pyrazole-5-carboxamide</td><td> 425,2</td>

<td>P-2075</td><td></td><td>N- [2- (2-chloro-4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 396,2</td>

<td>P-2076</td><td></td><td>N- [2- (2-fluoro-4-methoxyphenyl) -1H-pyrrolo [2,3b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 380,3</td>

<td>P-2077</td><td></td><td>N- [2- (2-chloro-5-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 395,9</td>

<td>P-2078</td><td>Cli Λ X fiy ™ H Jł-.</td><td>N- [2- (3-fluoro-5-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 435,3</td>

<td>P-2079</td><td>^M. 0</td><td>3,4-dimethyl-N- [2- (3-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 401,4</td>

<td>P-2080</td><td></td><td>N- [2- (4-aminocyclohexen-1-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 351,3</td>

<td>P-2081</td><td>ιγτΓ ^h _r H.</td><td>N- [2- (4-cyano-3-morpholinophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 442,2</td>

<td>P-2082</td><td>helium ^H. \ H.</td><td>N- [2- (3-fluoro-2-morpholine-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 435,9</td>

<td>P-2083</td><td></td><td>N- [2- (1-isobutylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 378,4</td>

<td>P-2084</td><td>ΎοχΤ H.</td><td>N- [2- (1,5-dimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 350,3</td>

<td>P-2085</td><td></td><td>N- [2- [4- (dimethylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 403,3</td>

PZ / 5321 / AG

EP 2 935 248 B1

163

<td>P-2086</td><td>\ _Z Β HO ΑΓΗ</td><td>3,4-dimethyl-N- [2- [3- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 416,2</td>

<td>P-2087</td><td>Wiu ^ yO ΥΊ Ani</td><td>N- [2- [3- (dimethylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 403,3</td>

<td>P-2088</td><td>Ηθ Άη</td><td>3,4-dimethyl-N- [2- (3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 333,3</td>

<td>P-2089</td><td>V /</td><td>3,4-dimethyl-N- [2- (6-morpholine-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 418,3</td>

<td>P-2090</td><td>akY</td><td>N- [2- (6-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 363,3</td>

<td>P-2091</td><td>W Η ho Arii</td><td>3,4-dimethyl-N- [2- (2-methylthiazol-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 353,1</td>

<td>P-2092</td><td>\ _ / η Λ / ΥΐΑ ΥΛ</td><td>N- [2- (4-cyanophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 357,3</td>

<td>P-2093</td><td>F. YY id ho Αγη</td><td>N- [2- (2-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 350,1</td>

<td>P-2094</td><td>HJKKr ^ ΥΛ ηκτ</td><td>N- [2- (3-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 350,4</td>

<td>P-2095</td><td>Cl</td><td>N- [2- (3-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 366,3</td>

<td>P-2096</td><td>Cl HO A / h</td><td>N- [2- (2-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 366,0</td>

<td>P-2097</td><td>YY ^H.ho Αγη</td><td>3,4-dimethyl-N- [2- (o-tolyl) -1H-pyrrolo [2,3-b] pyridin- 5-yl] -1H-pyrazole-5-carboxamide</td><td> 346,2</td>

<td>P-2098</td><td>YY η Η Ο Αγη</td><td>N- [2- (3-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 362,4</td>

<td>P-2099</td><td>ΥΛ ΥΛΗ</td><td>N- [2- (4-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 362,4</td>

PZ / 5321 / AG

EP 2 935 248 B1

164

<td>P-2100</td><td>Yo Η ° ^H.</td><td>N- [2- (3-acetamidophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 389,4</td>

<td>P-2101</td><td>X /</td><td>3,4-dimethyl-N- [2- [4- (pyrrolidine-1- carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 429,4</td>

<td>P-2102</td><td>ϊ OH</td><td>N- [2- [4- (3-methoxypropoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 420,4</td>

<td>P-2104</td><td>In wYab HO </td><td>3,4-dimethyl-N- [2- [4- (4-methylpiperazin-1-yl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 430,6</td>

<td>P-2105</td><td>H o ^H.</td><td>3,4-dimethyl-N- [2- [4- (thiomorpholine-4- carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 461,2</td>

<td>P-2106</td><td>ΐ&gt; ΫίΧΉ</td><td>3,4-dimethyl-N- [2- [3- (morpholine-4-carbonyl) phenyl] 1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 445,3</td>

<td>P-2107</td><td>° ^ Γ3 X / H HO</td><td>3,4-dimethyl-N- [2- [3- (pyrrolidine-1- carbonyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 429,4</td>

<td>P-2108</td><td></td><td>N- [2- (2-cyclopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 373,2</td>

<td>P-2109</td><td>\ __ / Η Λ¹ΥΛ</td><td>N- [2- (2-methoxy-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 363,3</td>

<td>P-2110</td><td>η α ^Η</td><td>3,4-dimethyl-N- [2- (2-morpholine-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 418,3</td>

<td>P-2111</td><td>^ ΪΟ \ _ / Η ~ &lt;ϋκ-CtfH Y &amp;</td><td>N- [2- [4- (methanesulfonamido) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 425,2</td>

<td>P-2112</td><td>νΠΓ Η ^ Υχιγδ Η</td><td>3,4-dimethyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 322,3</td>

<td>P-2113</td><td>V '</td><td>N- [2- [2-chloro-5- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 450,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

165

<td>P-2114 (reference example)</td><td></td><td>4,5-dimethyl-N- (2-methylpyrazolo [1,5-a] pyrimidin-6-yl) -1H-pyrazole-3-carboxamide</td><td> 271,0</td>

<td>P-2115</td><td>M nV^fOH</td><td>3,4-dimethyl-N- (2-pyrrolidin-1-yl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 325,2</td>

<td>P-2116</td><td>Ύοχ</td><td>3-methyl-N- (2-pyrazol-1-yl-1H-pyrrolo [2,3-b] pyridin- 5-yl) -1H-pyrazole-5-carboxamide</td><td> 308,1</td>

<td>P-2117</td><td>\ _ / H</td><td>N- [2- [4- (methanesulfonamido) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 425,2</td>

<td>P-2118</td><td></td><td>N- [2- [3- [4- (cyclopropanecarbonyl) piperazin-1-yl] phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 484,4</td>

<td>P-2119 (reference example)</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 1,5-dimethylpyrazole-3-carboxamide</td><td> 350,4</td>

<td>P-2120</td><td>hCtt ^H. r H.</td><td>N- [2- (4-Cyano-3-pyrrolidin-1-ylphenyl) -1H- pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 426,0</td>

<td>P-2121</td><td></td><td>3,4-dimethyl-N- [2- [3- (methylsulfamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 425,2</td>

<td>P-2122</td><td></td><td>N- [2- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 366,1</td>

<td>P-2123</td><td>Ύχι ^ ο-</td><td>3,4-dimethyl-N- [2- (6-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 347,2</td>

<td>P-2124</td><td>ΧΓ ^hAbove</td><td>3,4-dimethyl-N- [2- (4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 333,2</td>

<td>P-2125</td><td>mess</td><td>3,4-dimethyl-N- [2- (4-pyrrolidin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 401,2</td>

<td>P-2126</td><td>HJ X. TT N</td><td>3,4-dimethyl-N- [2- [3- (propylsulfonylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 453,3</td>

PZ / 5321 / AG

EP 2 935 248 B1

166

<td>P-2127 (reference example)</td><td></td><td>N- [2- (4-dimethylphosphorylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 408,3</td>

<td>P-2128</td><td></td><td>N- [2- (3-cyanophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 357,2</td>

<td>P-2129</td><td>H.</td><td>N- [2- (2-fluoro-3-methoxyphenyl) -1H-pyralo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 380,4</td>

<td>P-2130</td><td>H.</td><td>3,4-dimethyl-N- [2- (m-tolyl) -1H-pyrrolo [2,3-b] pyridin- 5-yl] -1H-pyrazole-5-carboxamide</td><td> 346,2</td>

<td>P-2131 (reference example)</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3-methyl-1H-1,2,4-triazole-5-carboxamide</td><td> 335</td>

<td>P-2132</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3-propyl-1H-pyrazole-5-carboxamide</td><td> 364,15</td>

<td>P-2133</td><td>ΚΧχκΧ ·</td><td>N- [2- (6-acetamido-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 390,2</td>

<td>P-2134</td><td></td><td>N- [2- [3- (butylcarbamoylamino) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 446,3</td>

<td>P-2135</td><td>ΉγΤ</td><td>N- [2- (2-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 362,2</td>

<td>P-2136</td><td></td><td>3,4-dimethyl-N- [2- (2-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 347,15</td>

<td>P-2137</td><td>γο W Η Γδ</td><td>N- [2- (4-acetamidophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 389,4</td>

<td>P-2138</td><td>IN ^ΗQ η &amp; »</td><td>3,4-dimethyl-N- [2- [4- (morpholine-4-carbonyl) phenyl] 1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 445,3</td>

<td>P-2139</td><td></td><td>N- [2- (2,4-dimethylthiazol-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 367,2</td>

<td>P-2140</td><td>\ / Η^fΗ 0 ^Η</td><td>N- [2- [1- (difluoromethyl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-</td><td> 372</td>

PZ / 5321 / AG

EP 2 935 248 B1

167

<td></td><td></td><td>carboxamide</td><td></td>

<td>P-2141 (reference example)</td><td>™ H</td><td>N - [(4-chloro-3-methyl-1H-pyrazol-5-yl) methyl] -2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-amine</td><td> 356</td>

<td>P-2142 (reference example)</td><td>oh _Λ H.</td><td>2- (4-fluorophenyl) -N - [(3-methyl-1H-pyrazol-5-yl) methyl] -1H-pyrrolo [2,3-b] pyridin-5-amine</td><td> 322</td>

<td>P-2143</td><td></td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H-pyrazole-5-carboxamide</td><td> 322,1</td>

<td>P-2144 (reference example)</td><td></td><td>3,4-dimethyl-N- (2-phenylthiazolo [5,4-b] pyridin-6-yl) 1H-pyrazole-5-carboxamide</td><td> 349,9</td>

<td>P-2145 (reference example)</td><td></td><td>3,4-dimethyl-N- (2-phenyl-3H-imidazo [4,5-b] pyridin- 6-yl) -1H-pyrazole-5-carboxamide</td><td> 333,1</td>

<td>P-2146</td><td></td><td>N- [2- (3-fluoro-2-methylphenyl) -1H-pyrrolo [2,3b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 364,2</td>

<td>P-2147</td><td></td><td>N- [2- (3-chloro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 380,2</td>

<td>P-2148</td><td>Άο-οχ HH</td><td>N- [2- [4- (cyclopropylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 415,3</td>

<td>P-2149</td><td>Άυ</td><td>3,4-dimethyl-N- [2- [4 - [(3-methyloxetan-3-yl) methoxy] phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H-pyrazole-5-carboxamide</td><td> 432,3</td>

<td>P-2150 (reference example)</td><td></td><td>4-chloro-3-methyl-N- (2-phenyl-3H-imidazo [4,5b] pyridin-6-yl) -1H-pyrazole-5-carboxamide</td><td> 353,0</td>

<td>P-2151 (reference example)</td><td></td><td>3-methyl-N- (2-phenyl-3H-imidazo [4,5-b] pyridin-6-yl) -1H-pyrazole-5-carboxamide</td><td> 319,1</td>

<td>P-2152 (reference example)</td><td>ΑχχΑ</td><td>N- [2- (2-fluorophenyl) -3H-imidazo [4,5-b] pyridin-6-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 351,1</td>

<td>P-2153</td><td>Τχχ Η</td><td>N- [2- (2-ethoxypyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 378,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

168

<td>P-2154</td><td>ΑζΐΜΧ</td><td>N- [2- (2-isopropylpyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 376,2</td>

<td>P-2155</td><td>ιΓΪ [ ^H.H.</td><td>N- [2- (2-cyclopropylpyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 374,1</td>

<td>P-2156</td><td>rc! ^H.™ H</td><td>N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] - 3- (trifluoromethyl) -1H-pyrazole-5-carboxamide</td><td> 390,0</td>

<td>P-2157</td><td>^M. about H.</td><td>N- [2- [2- (cyclopropylamino) pyrimidin-5-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 389,3</td>

<td>P-2158</td><td>H.</td><td>3,4-dimethyl-N- [2- (2-morpholinopyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 419,3</td>

<td>P-2159</td><td>* cTl ^hTsOty-cy * H</td><td>3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3- b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 350,2</td>

<td>P-2160</td><td>Ay⁰ SA Aj ⁿ at</td><td>3,4-dimethyl-N- [2- [2- (4-methylpiperazin-1-yl) pyrimidin-5-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] 1H-pyrazole-5- carboxamide</td><td> 432,3</td>

<td>P-2161</td><td>Aoo-b—</td><td>N- [2- (4-cyano-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 371,0</td>

<td>P-2162 (reference example)</td><td>by YCn H.</td><td>4- [3- [5 - [(3,4-dimethyl-1H-pyrazole-5- tert-butyl carbonyl) amino] -1H-pyrazolo [3,4-b] pyridin-3-yl] phenyl] piperazine-1-carboxylate</td><td> 517,4</td>

<td>P-2163</td><td>ΆςκΑ</td><td>N- [2- (2-isopropyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 374,9</td>

<td>P-2164</td><td>θ 'H RJ⁵HDD</td><td>3,4-dimethyl-N- [2- (2,3,4,5,6-pentadeuteriophenyl) 1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 336,9</td>

<td>P-2165</td><td></td><td>3,4-dimethyl-N- [2- (1,3,5-trimethylpyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 364,2</td>

<td>P-2166 (reference example)</td><td>Η You κΊί ^η*8^0^?</td><td>3,4-dimethyl-N- [3- (3-piperazin-1-ylphenyl) -1H-pyrazolo [3,4-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 417,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

169

<td>P-2167</td><td>&amp; UV ™ H /</td><td>N- [2- (3,5-dimethyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 350,2</td>

<td>P-2168</td><td>►OL ^H. \ Yo-oh</td><td>3,4-dimethyl-N- [2- [3-methyl-1- (oxetan-3-yl) pyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5 -carboxamide</td><td> 392,2</td>

<td>P-2169</td><td></td><td>N- [2- (6-methoxy-2-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 377,1</td>

<td>P-2170</td><td></td><td>N- [2- (2-methoxy-6-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 375,3</td>

<td>P-2171</td><td></td><td>N- [2- (3-chloro-2-methoxy-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 396,9</td>

<td>P-2172</td><td>Λίι ^M.</td><td>3- (difluoramethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 372,1</td>

<td>P-2173</td><td>£ 1 ΥΥΥΊΟΧΧ H.</td><td>4-chloro-3-ethyl-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 383,8</td>

<td>P-2174</td><td>hTTl ^hh y_u H.</td><td>N- [2- [4-fluoro-3- (2H-tetrazol-5-yl) phenyl] -1H- pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 417,8</td>

<td>P-2175</td><td>r? T [ ^H.CD V</td><td>N-cyclopropyl-4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] pyridine-2-carboxamide</td><td> 415,9</td>

<td>P-2176</td><td>'νΧ® ^F.\ K^H. ΧαγΧμ UrU H.</td><td>3,4-dimethyl-N- [2- [2- (trifluoromethyl) -3-pyridyl] 1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 401,2</td>

<td>P-2177</td><td>ŁG H.</td><td>N- [2- (2-ethyl-4-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 361,2</td>

<td>P-2178</td><td>Ά » ^HhX »&lt;h</td><td>N- [2- (6-ethyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 361,2</td>

<td>P-2179</td><td>o hy τπτν-ίΓΝ ^H. θ LUU y # H</td><td>N- [2- (2,3-dihydro- [1,4] dioxynp [2,3-b] pyridin-8-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3.4 -dimethyl-1H-pyrazole-5-carboxamide</td><td> 391,3</td>

PZ / 5321 / AG

EP 2 935 248 B1

170

<td>P-2180</td><td>kL ^hf ^^f</td><td>3,4-dimethyl-N- [2- [2- (trifluoromethyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 400,3</td>

<td>P-2181</td><td>X #</td><td>N- [2- (2,4-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 360,3</td>

<td>P-2182</td><td></td><td>3,4-dimethyl-N- [2- [2- (trifluoromethoxy) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 416,2</td>

<td>P-2183</td><td>Hi^-™ H Q_</td><td>N- [2- (5-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 363,3</td>

<td>P-2184</td><td></td><td>3,4-dimethyl-N- [2- (5-methyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 347,1</td>

<td>P-2185</td><td></td><td>N- [2- (4-methoxy-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 363,3</td>

<td>P-2186</td><td>H.</td><td>3,4-dimethyl-N- [2- [2- (4-methylsulfonylpiperazin-1-yl) -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 494,9</td>

<td>P-2187</td><td>AĄ</td><td>N- [2- [2- [4- (cyclopropanecarbonyl) piperazin-1-yl] -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5 -carboxamide</td><td> 485,0</td>

<td>P-2188</td><td></td><td>N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 381,9</td>

<td>P-2189</td><td>CN</td><td>N- [2- [2- [4- (2-cyanoacetyl) piperazin-1-yl] -4-pyridyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole -5-carboxamide</td><td> 484,3</td>

<td colspan="4">* MS (ESI) [M-H +]^- watched.</td>

[0419] Exemplary compounds of the present disclosure as set forth in Table 2, e.g., compounds P2190 through P-2273 were prepared according to the protocols provided in Examples 1 to 25 and Schemes 1 to 25. Data ¹H NMR and mass spectroscopy were consistent with the structures of the compounds.

Table 2

<td>No</td><td>Relationship</td><td>Name</td><td>MS (ESI) [M + H +] + observed</td>

PZ / 5321 / AG

EP 2 935 248 B1

171

<td>P-2190</td><td>^H.p X — N^H. H.</td><td>4,5-dimethyl-N- (3- (6- (piperazin-1-yl) pyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2191</td><td>HN y ⁰</td><td>4,5-dimethyl-N- (3- (6- (piperazin-1-yl) pyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2192</td><td>about ^x N IN⁰</td><td>4,5-dimethyl-N- (3- (6-morpholinopyridin-2-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2193</td><td>⁰ Ύ</td><td>4,5-dimethyl-N- (3- (2-morpholinopyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2194</td><td>^η0τ^νυΑ3 U θ Αν^Η κ</td><td>N- (2- (1- (1-acetylazetidin-3-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl- 1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2195</td><td>ο L^Η Uh</td><td>N- (2- (1- (azetidin-3-yl) -3-methyl-1H-pyrazol-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2196</td><td>Ζ-Ζ W ΤΖ 5 = 0 Υί ζ</td><td>4,5-dimethyl-N- (2- (5-methyl-1- (oxetan-3-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) - 1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2197</td><td>θ Η</td><td>N- (2- (1- (azetidin-3-yl) -5-methyl-1H-pyrazol-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2198</td><td>α η * ΗΝ 1 Ν \ LJ⁰</td><td>4,5-dimethyl-N- (2- (5-methyl-1- (piperidin-4-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) - 1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2199</td><td>W Η ν HN AR \ LJ θ ί_ΝΑ_Ν^ Ν Η</td><td>N- (2- (1- (1-acetylpiperidin-4-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl- 1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2200</td><td> 0 ^Ν Η</td><td>N- (2- (1- (1- (cyclopropanecarbonyl) piperidin-4-yl) -5-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4.5 -dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

PZ / 5321 / AG

EP 2 935 248 B1

172

<td>P-2201</td><td>H 7?</td><td>4,5-dimethyl-N- (2- (3-methyl-1- (piperidin-4-yl) -1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) - 1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2202</td><td>hnX H \ o Η Γ 1 k-IL Ac</td><td>N- (2- (1- (1-acetylpiperidin-4-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl- 1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2203</td><td> ° ^and &lt;γ 0</td><td>N- (2- (1- (1- (cyclopropanecarbonyl) piperidin-4-yl) -3-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4.5 -dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2204</td><td>o ybC^NH.</td><td>N- (2- (2- (cyclopropylamino) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2205</td><td>H.</td><td>N- (2- (3-chloro-2- (cyclopropanecarboxamido) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2206</td><td>HNb ^H. HNj / = &lt;o π I IH "^N</td><td>N- (2- (2- (cyclopropanecarboxamido) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2207</td><td>K b^NηνΧ [1 / AlTV \ n H.</td><td>N- (2- (2- (1- (cyclopropanecarbonyl) piperidin-4-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) 4,5-dimethyl-1H-pyrazole -3-carboxamide</td><td></td>

<td>P-2208</td><td>Ν _Λη I IH _ñ^NH.</td><td>4,5-dimethyl-N- (2- (2- (pyrrolidin-1-yl) pyridin-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2209</td><td>^hnJ^N about OIMY</td><td>4,5-dimethyl-N- (2- (2- (piperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2210</td><td>/ about ηνΧΗ, ^ / 0 OK H</td><td>4,5-dimethyl-N- (2- (2- (4-methylpiperidin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2211</td><td>λ^νηTmT ⁰ b N H.</td><td>4,5-dimethyl-N- (2- (2- (piperidin-4-yl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2212</td><td>OH X γ d? H.</td><td>N- (2- (2- (4-hydroxypiperidin-1-yl) pyridin-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3- carboxamide</td><td></td>

PZ / 5321 / AG

EP 2 935 248 B1

173

<td>P-2213</td><td>\ z f&gt; OH^ν5ϊΜ^νH.</td><td>N- (2- (2- (3-hydroxypiperidin-1-yl) pyridin-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3- carboxamide</td><td></td>

<td>P-2214</td><td>Ac hnW H _</td><td>N- (2- (2- (4-acetylpiperazin-1-yl) pyridin-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3- carboxamide</td><td></td>

<td>P-2215</td><td>° Ύ " / —N About ΥνΎ ^N H.</td><td>4,5-dimethyl-N- (2- (2- (4- (3-methylbut-2enoyl) piperazin-1-yl) pyridin-4-yl) -1H-pyrrolo [2,3b] pyridin-5-yl ) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2216</td><td>ΥγΥ H.</td><td>4,5-dimethyl-N- (2- (2- (morpholino-4- carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2217</td><td>V / o niui H FN NMe / = &lt; Al Σ&gt; Α, n H.</td><td>4,5-dimethyl-N- (2- (2- (4-methylpiperazine-1-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2218</td><td>η ΪΙΗ, NH</td><td>4,5-dimethyl-N- (2- (2- (pyrrolidine-1- carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2219</td><td>V / 0^HNXn._ 2Y³about ΤΧΥΤν ^{0 k}NN H.</td><td>4,5-dimethyl-N- (2- (2- (thiomorpholine-4-carbonyl) pyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2220</td><td>Vz 0. HnT ij&gt;^NH. A 1 ΓΗ N OMe⁰ Sl ^ -NH</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-methoxyethyl) picolinamide</td><td></td>

<td>P-2221</td><td>Yz o^hnXy ^ Jy ^{0 1}H.</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2 (dimethylamino) ethyl) picolinamide</td><td></td>

<td>P-2222</td><td>3 ZZ ZT ^MA^ ζχ ° from fz</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-methoxyethyl) picolinamide</td><td></td>

<td>P-2223</td><td>HN ^ ^H. V^NHΝ'Ύυ ^ τ ^ Υθo T TMTn H.</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N-methoxypicolinamide</td><td></td>

<td>P-2224</td><td>Υ^βϊχΎ H.</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N, N-dimethyl picolinamide</td><td></td>

<td>P-2225</td><td>V / θ hn ^ IH&gt; -NH⁰ Q π ^ 0</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2-morpholinoethyl) picolinamide</td><td></td>

PZ / 5321 / AG

EP 2 935 248 B1

174

<td>P-2226</td><td>L / o uroi H VNH^{0 k}NN (&gt; HA_NMe</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) - 1H-pyrrolo [2,3-b] pyridin-2-yl) -N- (2- (4- methylpiperazin-1-yl) ethyl) picolinamide</td><td></td>

<td>P-2227</td><td>\ / ABOUT hm 'Ί H XNH^HNnK, Nx,,^N η ίΐΜΤ^Ν CN ° | Xn A H.</td><td>N- (2-cyanoethyl) -4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) -1H-pyrrolo [2,3-b] pyridin-2-yl) picolinamide</td><td></td>

<td>P-2228</td><td>\ zo hQ Η _TⁿŁ / ni TH,^NXH.</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -Nisobutylpicolinamide</td><td></td>

<td>P-2229</td><td>H.</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -Nisopropylpicolinamide</td><td></td>

<td>P-2230</td><td>^{0 k}N ^ NH</td><td>4- (5- (4,5-dimethyl-1H-pyrazole-3-carboxamido) 1H-pyrrolo [2,3-b] pyridin-2-yl) -N, N-diethyl-picolinamide</td><td></td>

<td>P-2231</td><td>^{Fs &lt;}Y ^Μθ^HN N ₌^N Ίί ΊΑ Ί \ o _N x&gt;; H.</td><td>4-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - 5- (trifluoromethyl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2232</td><td>1 MT O = (2 ΞΙ IN IZ L 0</td><td>4-chloro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - 5- (trifluoromethyl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2233</td><td>^C.V · » 0 ^N H.</td><td>5-chloro-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) - 4- (trifluoromethyl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2234</td><td>^F.2^HC «Α. about H.</td><td>5- (difluoromethyl) -4-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2235</td><td>^Me\,^CHF2 □</td><td>4- (difluoromethyl) -5-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2236</td><td>^H.O &lt;N^NWw no. ^ H.</td><td>5-chloro-4- (difluoromethyl) -N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2237</td><td> 0 \^^zxAbout 12 Q&gt; =^ABOUTTo me LOAM*</td><td>4-chloro-5- (difluoromethyl) -N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2238</td><td>HN H, ^M.*° - ^N'Ίι t my o _N VV H.</td><td>N- (2- (2-methoxypyridin-3-yl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 363,3</td>

PZ / 5321 / AG

EP 2 935 248 B1

175

<td>P-2239</td><td>□ ΧΑΧΑ</td><td>N- (2- (2-ethoxypyridin-3-yl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 377,1</td>

<td>P-2240</td><td>Ał __ £ Ϊ 11 about^zxabout zz Y ° zz</td><td>N- (2- (2- (difluoromethoxy) pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 399,1</td>

<td>P-2241</td><td>from &lt;r ° γ zz = ABOUT IZ. AND 1 w / Y ° xz</td><td>4,5-dimethyl-N- (2- (2- (trifluoromethyl) pyridin-3-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2242</td><td>^H.Y u ^M.Y^ν^ &lt;ΆΑ Aft 1 AV Aowie about -_nand_n^with IN</td><td>N- (2- (2,6-dimethoxypyridin-3-yl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 393,4</td>

<td>P-2243</td><td>^ηνΧα- / λ Y^N τ γγγχχ⁰Π</td><td>N- (2- (5-cyclopropylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 373,2</td>

<td>P-2244</td><td>^N π γ χνχχ_ ° Χ ^ Εί ^ Ν Π</td><td>N- (2- (5,6-dimethylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2245</td><td>Ya ⁰H.</td><td>N- (2- (2-fluoropyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin- 5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 393,4</td>

<td>P-2246</td><td>XZ λ \ ° / zz = oz</td><td>4,5-dimethyl-N- (2- (2-methylpyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td> 347,1</td>

<td>P-2247</td><td></td><td>N- (2- (2-ethoxypyridin-4-yl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 377,1</td>

<td>P-2248</td><td>ΎΥ About YTAz^N H.</td><td>N- (2- (2-isopropoxypyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 391,3</td>

<td>P-2249</td><td>£ XJ ϋ About zz Yo z X</td><td>N- (2- (3-chloro-2-methoxypyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2250</td><td>.with. Ό o^zxby xz Y ° z ' X</td><td>N- (2- (3-chlorapyridin-4-yl) -1H-pyralo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

PZ / 5321 / AG

EP 2 935 248 B1

176

<td>P-2251</td><td>'γ 5 THESE o \ = 7</td><td>4,5-dimethyl-N- (2- (3-methylpyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td> 347,1</td>

<td>P-2252</td><td>hnW h 0^N and THAT</td><td>4,5-dimethyl-N- (2- (2- (pyrrolidin-1-yl) pyridin-4-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td> 402,1</td>

<td>P-2253</td><td>M ^ z L h O MA Mo Υί of 'X</td><td>N- (2- (5-fluoropyridin-3-yl) -1H-pyralo [2,3-b] pyridin- 5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 351,3</td>

<td>P-2254</td><td>hTY m /^cf’ ^N t ΥΤΎγΤ</td><td>4,5-dimethyl-N- (2- (5- (trifluoromethyl) pyridin-3-yl) 1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td> 401,2</td>

<td>P-2255</td><td>° 'Λ' -ν</td><td>N- (2- (6-cyclopropylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 373,2</td>

<td>P-2256</td><td>ηνυΓ h / * Ύ ΏΜ Π</td><td>N- (2- (5-ethylpyridin-3-yl) -1H-pyrrolo [2,3-b] pyridin- 5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 361,2</td>

<td>P-2257</td><td>XZ CT ^{o =}\ ZI^withABOUT ΤΖ ^ Χ -π Ia CT</td><td>N- (2- (2- (difluoromethyl) phenyl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2258</td><td>X of TT ° X ^xZI T. ^XZXi ^ 0 ^ about</td><td>N- (2- (4-chloro-2-methylphenyl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2259</td><td>X of. ° = ( ZI^WITHX^MACr</td><td>N- (2- (4-fluoro-2-methylphenyl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 364,2</td>

<td>P-2260</td><td>s YYm&gt;^f</td><td>N- (2- (2,4-difluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 368,1</td>

<td>P-2261</td><td>X of CT □ χ ZI xz ^&gt; ęr T z</td><td>N- (2- (3-cyano-2,4-difluorophenyl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2262</td><td> H.</td><td>N- (2- (4-fluoro-2,3-dimethylphenyl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2263</td><td>xf Π o- ° &lt;^ zx O xz M ° Jrl with</td><td>N- (2- (2- (difluoromethoxy) phenyl) -1H-pyrrolo [2,3b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td> 398,2</td>

PZ / 5321 / AG

EP 2 935 248 B1

177

<td>P-2264</td><td>hnY h V /^νΎ γγ ^ χ ί ⁰ /</td><td>N- (2- (2- (difluoromethoxy) -3-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2265</td><td>ιΤΐΧ&gt;</td><td>N- (2- (3,6-dihydro-2H-pyran-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2266</td><td>Ύα 0^N H p</td><td>4,5-dimethyl-N- (2- (2,2,6,6-tetramethyl-1,2,3,6- tetrahydropyridin-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-pyrazole-3-carboxamide</td><td> 393,3</td>

<td>P-2267</td><td>IZ z</td><td>N- (2- (2,2-difluorobenzo [d] [1,3] dioxol-4-yl) -1H- pyrrolo [2,3-b] pyridin-5-yl) -4,5-dimethyl-1H-pyrazole-3-carboxamide</td><td></td>

<td>P-2268</td><td>about ^H. ° part H.</td><td>N- [2- [2- (difluoromethoxy) -4-fluorophenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 416,2</td>

<td>P-2269</td><td></td><td>N- [2- (6-fluoro-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 351,3</td>

<td>P-2270</td><td>^H. Ai</td><td>N- [2- (5-cyano-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin- 5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 358,2</td>

<td>P-2271</td><td></td><td>N- [2- (3,6-dihydro-2H-pyran-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 338,4</td>

<td>P-2272</td><td>^H.AA / W illhH o</td><td>3- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] 1H-pyrrolo [2,3-b] pyridin-2-yl] pyridine-4-carboxamide</td><td> 376,2</td>

<td>P-2273</td><td></td><td>N- [2- (2,3-dihydrobenzofuran-7-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 374,1</td>

[0420] Exemplary compounds of the present disclosure as set forth in Table 3, e.g., compounds P2274 through P-2307 were prepared according to the protocols provided in Examples 1 to 25 and Schemes 1 to 25. Data ¹H NMR and mass spectroscopy were consistent with the structures of the compounds.

Table 3

<td>No</td><td>Relationship</td><td>Name</td><td>MS (ESI) [M + H +] + observed</td>

PZ / 5321 / AG

EP 2 935 248 B1

178

<td>P-2274</td><td>H. ΤΥΐΧ? H.</td><td>3,4-dimethyl-N- [2- (3-piperazin-1-ylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -1H-pyrazole-5-carboxamide</td><td> 416,0</td>

<td>P-2275</td><td>yOKT H</td><td>4-fluoro-N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3-methyl-1H-pyrazole-5-carboxamide</td><td> 355,0</td>

<td>P-2276</td><td>OH</td><td>N- [2- [3- (isobutylcarbamoyl) phenyl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 431,0</td>

<td>P-2277</td><td>KŁ ^h™ H /</td><td>N- [2- (4-chloro-2-methylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 380,1</td>

<td>P-2278</td><td>Ύζγρ H ci</td><td>N- [2- (3-chlorine-4-pyridyl) -1H-pyralo [2,3-b] pyridin- 5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 367,2</td>

<td>P-2279</td><td></td><td>N- [2- (4-fluoro-2,3-dimethylphenyl) -1H-pyralo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 378,3</td>

<td>P-2280</td><td></td><td>N- [2- (2,6-difluoro-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 369,0</td>

<td>P-2281</td><td>^ 5 100 ^ 0 H.</td><td>N- [2- (2,2-difluoro-1,3-benzodioxol-4-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 412,0</td>

<td>P-2282</td><td>ΥχιγΥ</td><td>N- [2- (5,6-dimethyl-3-pyridyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 361,2</td>

<td>P-2283</td><td>H.</td><td>N- [2- (6-fluoro-2-methyl-3-pyridyl) -1H-pyralo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 365,1</td>

<td>P-2284</td><td></td><td>N- [2- (4-methoxy-2,3-dimethylphenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 390,4</td>

<td>P-2285</td><td>19wK * H LA o Ύτ</td><td>3- [4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -3-methylpyrazol-1- tert-butyl yl] azetidine-1-carboxylate</td><td> 491,4</td>

<td>P-2286</td><td></td><td>N- [2- [1 - (azetidin-3-yl) -3-methylpyrazol-4-yl] -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5- carboxamide</td><td> 391,0</td>

PZ / 5321 / AG

EP 2 935 248 B1

179

<td>P-2287</td><td>About h hJ ΤΧΧΧΑ H.</td><td>3- (difluoramethyl) -N- [2- (4-fluorophenyl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -4-methyl-1H-pyrazole-5-carboxamide</td><td> 386,1</td>

<td>P-2288 (reference example)</td><td></td><td>N- (2-iodo-1H-pyrrolo [2,3-b] pyridin-5-yl) -2Hindazole-4-carboxamide</td><td> 403,9</td>

<td>P-2289 (reference example)</td><td>Αχ</td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -2Hindazole-4-carboxamide</td><td> 353,9</td>

<td>P-2290 (reference example)</td><td></td><td>Methyl 3 - [(2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) carbamoyl] benzoate</td><td> 372,1</td>

<td>P-2291 (reference example)</td><td>“Ie</td><td>3 - [(2-phenyl-1H-pyrrolo [2,3-b] pyridin-5- acid yl) carbamoyl] benzoic</td><td> 357,8</td>

<td>P-2292</td><td>LjG^η A a jJT H OOH</td><td>4- [5 - [(3,4-dimethyl-1H-pyrazole-5- acid carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -2-fluorobenzoic</td><td> 394,3</td>

<td>P-2293</td><td>YtA-. H. OH</td><td>2- [3- [5 - [(3,4-dimethyl-1H-pyrazole-5- acid) carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] phenyl] acetic acid</td><td> 390,4</td>

<td>P-2294</td><td>nL *⁰^H. * A a WATT H&gt; = 0 HO</td><td>1- [4- [5 - [(3,4-dimethyl-1H-pyrazole-5- acid) carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] phenyl] cyclopropanecarboxylic acid</td><td> 416,2</td>

<td>P-2295</td><td> 0 ^H. h and o</td><td>2- [4- [5 - [(3,4-dimethyl-1H-pyrazole-5- acid) carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] phenyl] acetic acid</td><td> 390,4</td>

<td>P-2296</td><td>^H. «Τ ho</td><td>4- [5 - [(3,4-dimethyl-1H-pyrazole-5- acid carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -2-methylbenzoic</td><td> 390,4</td>

<td>P-2297</td><td>^H. HWW ° XQA H</td><td>3- [5 - [(3,4-dimethyl-1H-pyrazole-5- acid carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] -2-methylbenzoic</td><td> 390,4</td>

<td>P-2298 (reference example)</td><td></td><td>1-methyl-N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) indazole-4-carboxamide</td><td> 367,8</td>

PZ / 5321 / AG

EP 2 935 248 B1

180

<td>P-2299 (reference example)</td><td>jCl E H.</td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1Hindole-4-carboxamide</td><td> 352,8</td>

<td>P-2300 (reference example)</td><td></td><td>N- (2-phenyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -1H-benzimidazole-4-carboxamide</td><td> 353,8</td>

<td>P-2301 (reference example)</td><td></td><td>N- (2-methyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -2Hindazole-4-carboxamide</td><td> 291,8</td>

<td>P-2302</td><td>at SL JQ " H.</td><td>3,4-dimethyl-N- (2-methyl-1H-pyrrolo [2,3-b] pyridin- 5-yl) -1H-pyrazole-5-carboxamide</td><td> 270,0</td>

<td>P-2303 (reference example)</td><td>^{HO h}™ H</td><td>4 - [(2-phenyl-1H-pyrrolo [2,3-b] pyridin-5- acid yl) carbamoyl] benzoic</td><td> 358,2</td>

<td>P-2304</td><td>Χζίγο</td><td>N, 3,4-trimethyl-N- (2-phenyl-1H-pyrrolo [2,3- b] pyridin-5-yl) -1H-pyrazole-5-carboxamide</td><td> 346,2</td>

<td>P-2305</td><td>Yeah</td><td>N- [2- (2,3-dihydro-1,4-benzodioxin-5-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 389,8</td>

<td>P-2306</td><td> H.</td><td>4- [4- [5 - [(3,4-dimethyl-1H-pyrazole-5-carbonyl) amino] -1H-pyrrolo [2,3-b] pyridin-2-yl] pyrazol-1-yl] piperidine-1-carboxylate tert- butyl</td><td> 506,2</td>

<td>P-2307</td><td></td><td>N- [2- (cyclohexen-1-yl) -1H-pyrrolo [2,3-b] pyridin-5-yl] -3,4-dimethyl-1H-pyrazole-5-carboxamide</td><td> 336,0</td>

Example 26. Properties of compounds

[0421] While the inhibitory activity of the compounds against any C-kit kinase and its mutants is important in their activity in treating disease, the compounds described herein exhibit advantageous properties which also provide advantages as a pharmaceutical.

[0422] The compounds described herein are useful for the treatment of disorders associated with C-kit and its mutants, eg, diseases associated with unregulated signal transduction by kinase, including, but not limited to, cell proliferative disorders, fibrotic disorders, and metabolic disorders. As described in more detail below and in: Lipson et al., U.S. Pat. US 2004/0002534 (US patent application no. No. 10 / 600,868, filed June 23, 2003), cell proliferative disorders that can be treated with the present disclosure include cancers and mast cell proliferative disorders.

PZ / 5321 / AG

EP 2 935 248 B1

181

[0423] The presence of C-kit or C-kit mutant (s) has also been associated with many different types of cancer. Moreover, the relationship between abnormalities in C-kit and disease is not limited to cancer. As such, C-kit has been associated with malignancies including mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GIST), glioblastoma, astrocytoma, neuroblastoma, female genital carcinomas, neuroectodermal sarcomas, colorectal cancer, non-infiltrating cancer, Schwann cell tumor formation associated with neurofibromatosis, acute granulocytic leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, mastocytosis, melanoma and mast cell tumors in dogs, and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection, and hypereosinophilia.

Sample C-kit biochemical test

[0424] Assays for the biochemical activity of C-kit kinase in a cell are known in the art, e.g. US Nos. 7,498,342 and 7,846,941. C-kit (or its kinase domain) is an active kinase in AlphaScreen. IC50 values ​​are determined with respect to inhibition of C-kit kinase activity, where inhibition of peptide substrate phosphorylation is measured as a function of compound concentration. Compounds to be tested were dissolved in DMSO to a concentration of 20 mM. These were diluted with 30 µl to 120 µl DMSO (4 mM) and 1 µl was added to the assay plate. These were then serially diluted 1: 3 (50 µl to 100 µl DMSO) to a total of 8 points. The plates were prepared such that each kinase reaction mixture was 20 μl in 1x kinase buffer (50 mM HEPES, pH 7.2, 5 mM MgCl₂, 5 mM MnCl₂, 0.01% NP-40, 0.2% BSA), 5% DMSO and 10 μM ATP. The substrate was 100 nM biotin- (E4Y) 3 (Open Source Biotech, Inc.). C-kit kinase was 0.1 ng per sample. After incubation of the kinase reaction mixture for 1 hour at room temperature, 5 μl of donor beads (streptavidin coated beads (Perkin Elmer Life Science) final concentration 1 μg / ml) in stop buffer (50 mM EDTA in 1x kinase buffer) were added, the sample was mixed and incubated for 20 minutes at room temperature before adding 5 µl of acceptor beads (PY20 coated beads (Perkin Elmer Life Science), final concentration 1 µg / ml) in stop buffer. Samples were incubated for 60 minutes at room temperature and the signal per well was read on an AlphaQuest reader. The phosphorylated substrate results in binding of the PY20 antibody and binding of donor and acceptor beads such that the signal correlates with kinase activity. The signal vs compound concentration relationship was used to determine the IC50.

[0425] Compounds were also tested using a similar assay with a 10-fold higher ATP concentration. For these samples, compounds to be tested were dissolved in DMSO to a concentration of 20 mM. These were diluted with 30 µl to 120 µl DMSO (4 mM) and 1 µl was added to the assay plate. These were then serially diluted 1: 3 (50 µl to 100 µl DMSO) to a total of 8 points. The plates were prepared such that each kinase reaction mixture was 20 μl in 1x kinase buffer (25 mM HEPES, pH 7.5, 2 mM MnCl₂, 2 mM MnCl₂, 0.01% Tween-20, 1 mM DTT and 0.001% BSA), 5% DMSO and 100 µM ATP. The substrate was 30 nM biotin- (E4Y) 10 (Upstate Biotech, Cat # 12-440). C-kit kinase was at a concentration of 1 ng per sample. After incubation of the kinase reaction mixture for 1 hour at room temperature, 5 μl of donor beads (streptavidin coated beads (Perkin Elmer Life Science) final concentration 10 μg / ml) in stop buffer (25 mM HEPES pH 7.5, 100 mM EDTA, 0 , 3% BSA), the sample was mixed and incubated for 20 minutes at room temperature before adding 5 μl of acceptor beads (PY20 coated beads (Perkin Elmer Life Science)

PZ / 5321 / AG

EP 2 935 248 B1

182 final concentration 10 µg / ml) in stop buffer. Samples were incubated for 60 minutes at room temperature and the signal per well was read on an AlphaQuest or Envision reader (Perkin

Elmer Life Science). The phosphorylated substrate results in binding of the PY20 antibody and binding of donor and acceptor beads such that the signal correlates with kinase activity. In order to determine

The IC50 uses the signal vs compound concentration relationship.

The C-kit enzyme used in the above assay was either obtained from Cell Signaling Technology (Cat # 7754) or prepared as follows: A kit encoding plasmid (DNA and encoded protein sequences are shown below) was constructed using conventional polymerase chain reaction methods. (polymerase chain reaction (PCR). Complementary DNA cloned from different human tissues was purchased from Invitrogen and used as a substrate in PCR reactions. Specific synthetic oligonucleotide primers were custom designed to start the PCR product and also to provide a suitable restriction enzyme cleavage site for ligation with plasmids. The entire enzyme coding sequence was generated by a gene synthesis procedure using custom made synthetic oligonucleotides covering the entire coding sequence (Invitrogen, see below).

[0427] The plasmid used for ligation with the kinase-encoding insert was a pET derivative (Novagen) for expression in E. coli. The kit kinase was constructed to contain a histidine tag for purification using metal affinity chromatography. The kinase-encoding plasmid was constructed as a bicistronic mRNA for co-expression of a second protein that modifies the kinase protein when expressed in a host cell. Protein-tyrosine phosphatase 1B (PTP) was co-expressed for the dephosphorylation of phosphotyrosines.

[0428] For protein expression, E. coli BL21 (DE3) RIL strain was transformed with a plasmid containing the Kit gene and transformants were selected for growth on LB agar plates containing the appropriate antibiotics. Single colonies were grown overnight at 37 ° C in 200 ml of TB (Terrific broth) medium. 16x1L of fresh TB medium in 2.8L flasks were inoculated with 10ml of a culture that had previously been grown overnight and grown with constant shaking at 37 ° C. After the cultures reached an absorbance of 1.0 at 600 nm, IPTG was added and the cultures were allowed to grow for a further 12 to 18 hours at temperatures ranging from 12-30 ° C. Cells were harvested by centrifugation and pellets were frozen at -80 ° C until ready to be lysed.

[0429] For protein purification, frozen E. coli cell pellets were resuspended in lysis buffer and lysed using standard mechanical methods. The protein was purified using poly-histidine tags using the IMAC method of affinity purification for immobilized metal. The kit kinase was purified using a 3-step purification process using; IMAC, size exclusion and ion exchange chromatography. The polyhistidine tag was removed using thrombin (Calbiochem).

[0430] Compounds were tested using an assay similar to that described above using in a final reaction volume of 25 µl: C-Kit (h) (5-10 mU) in 8 mM MOPS pH 7.0, 0.2 mM EDTA, 10 mM MnCl₂, 0.1 mg / ml poly (Glu, Tyr) 4: 1, 10 mM magnesium acetate and y-³³P-ATP (approximately 500 cpm / pmol), with the compound at appropriate concentrations. Incubated for 40 minutes at room temperature and quenched by adding 5 μl of 3% phosphoric acid. 10 μl of each sample was spotted onto the Filtermat A i filter

PZ / 5321 / AG

EP 2 935 248 B1

183 washed 3x with 75 mM phosphoric acid, once with methanol, dried and measured on a scintillation counter (performed at Upstate USA, Charlottesville, VA).

An exemplary biochemical test of the C-kit mutant

[0431] The C-kit D816V mutant (or its kinase domain) is an active kinase in AlphaScreen. IC50 values ​​are determined with respect to inhibition of the kinase activity of the C-kit D816V mutant, where inhibition of phosphorylation of a peptide substrate is measured as a function of compound concentration. Compounds to be tested were dissolved in DMSO to a concentration of 20 mM. These were diluted with 30 µl to 120 µl DMSO (4 mM) and 1 µl was added to the assay plate. These were then serially diluted 1: 3 (50 µl to 100 µl DMSO) to a total of 8 points. The plates were prepared such that each kinase reaction mixture was 20 μl in 1x kinase buffer (25 mM HEPES, pH 7.2, 8 mM MnCl₂, 2 mM MnCl₂, 50 mM NaCl, 0.01% Brij, 1 mM DTT, 0.01% BSA), 5% DMSO and 10 µM ATP. The substrate was 30 nM biotin- (E4Y) 10 (EMD Millipore, cat no. 12-440). C-kit D816V mutant kinase was at a concentration of 0.75 ng per sample. After incubation of the kinase reaction mixture for 30 minutes at room temperature, 5 μl of donor beads (streptavidin coated beads (Perkin Elmer Life Science), final concentration 7.5 μg / ml) in stop buffer (25 mM Hepes pH 7.5, 100 mM EDTA) were added. , 0.01% BSA), the sample was mixed and incubated for 20 minutes at room temperature before adding 5 µl of acceptor beads (PY20 coated beads (Perkin Elmer Life Science), final concentration 7.5 µg / ml) in stop buffer. Samples were incubated for 60 minutes at room temperature and the signal per well was read on an EnVision reader. The phosphorylated substrate results in binding of the PY20 antibody and binding of donor and acceptor beads such that the signal correlates with kinase activity. The signal vs compound concentration relationship was used to determine the IC50.

Protein expression and purification

[0432] Recombinant mutant C-kit D816V (residues 551-934, kinase insertional domain residues 694-753 deleted) with a 6x-histidine N-terminal tag was expressed in E. coli Arctic Express (DE3) RIL (Stratagene). Cells were grown in Terrific broth (TB) to an OD600 of 0.6 at 37 ° C, which temperature was reduced to 10 ° C, the protein was induced with 1.0 mM IPTG for 18 hours and harvested by 8000 xg overload centrifugation for Twenty minutes. Cells were resuspended in 0.1M KPO₄ pH 8.0, 250 mM NaCl, 10% glycerol, 0.75% NP-40, 25 mM imidazole, 5 mM BME with 0.2 mg / ml lysozyme, 2.0 mM PMSF, 25 μg / ml DNAse I, incubated on ice for 30 minutes and lysed using a cell disintegrator (MicroFluidics). The lysate was clarified by centrifugation at 20,000 xg for 2 hours. Protein was captured using Talon resin (Clontech). Contaminating proteins were eluted with 25 mM Tris-HCl pH 8.3, 250 mM NaCl, 15% glycerol, 1% Triton®-100 and the protein was eluted with 100 mM EDTA. The protein was then purified using a 26/600 Superdex 200 gel filtration column (GE) in 50 mM Tris-HCl, pH 8.0, 250 mM NaCl, 15% glycerol, 5 mM BME. The protein was aliquoted and snap-frozen in liquid nitrogen.

Exemplary cellular assays for C-kit kinase mutant activity

[0433] Inhibitors of the C-kit D816V mutant were evaluated using the constructed cell line BaF3-FL KIT D816V or BaF3-FL KIT V560G / D816V. The BaF3-FL KIT D816V cell lines were generated by introducing full-length KIT mutant (D816V) constructs that make cell growth dependent on

PZ / 5321 / AG

EP 2 935 248 B1

184 introduced kinase. C-kit D816V kinase mutant inhibitors reduce or eliminate C-kit D816V mutant-mediated activation, resulting in reduced cellular proliferation of BaF3-FL cells with the Kit D816V mutant. This inhibition is measured by the effect of compound concentration on cell growth to assess IC50 values. BaF3-FL KIT D816V cells were seeded at a density of 1 x 104 cells per well of a 96-well cell culture plate in 50 μl of RPMI 1X cell culture medium (Invitrogen # 11875-093) supplemented with 10% FBS (Invitrogen # 10438), 1% endogenous amino acids (Invitrogen # 11140), 1% penicillin / streptomycin mixture (Invitrogen # 15140), 1% L-glutamine (Invitrogen # 25030-081). Compounds were dissolved in DMSO at a concentration of 5 mM and serially diluted 1: 3 to a total of eight points and added to the cells to a final maximum concentration of 10 μL in 100 μL of cell culture medium (0.2% DMSO final concentration). Cells were also treated with dasatinib as a positive control. Cells were incubated at 37 ° C, 5% CO 2 for three days. ATPlite buffer (Perkin Elmer # 6016739) and substrate were brought to room temperature and the enzyme / substrate recombinant firefly luciferase / D-luciferin mixture was reconstituted. The cell plates were brought to room temperature for 30 minutes, then the cells were lysed by adding 25 µl of ATPlite reagent per well. The plate was mixed for 5 minutes on a plate shaker to lyse the cells. Plates were read on a Tecan Safire using a Luminescence protocol modified to read 0.1 sec per well. The luminescence reading evaluates the ATP content which is directly correlated with the number of cells so that in order to determine the IC value₅₀ the reading is used as a function of compound concentration.

[0434] Plasmids P75635 and P75565 were constructed for expression in mammalian cells. In both plasmids, the full-length oncogenic gene homologous to the human Hardy-Zuckerman 4 feline sarcoma virus v-kit (NCBI Access NM_000222, KIT, residues M1-V976) was subcloned into the vector pCI-Neo (Promega E1841). Plasmid P75635 contains a mutation (replacement) of 816 aspartic acid to valine. Plasmid P75565 contains a double mutation of valine residues 560 to glycine and aspartic acid 816 to valine. The mammalian pCI-neo expression vector carries the immediate-early gene transcription enhancer / human cytomegalovirus (CMV) promoter region to increase constitutive expression of KIT, and contains the selectable neomycin phosphotransferase gene.

[0435] It is understood that the results of these tests may vary as test conditions vary. The inhibition levels determined under the conditions described herein represent the relative activity of the compounds tested under the specific conditions used. Cellular tests are likely to show variability due to the complexity of the system and their sensitivity to any changes in test conditions. As such, some level of inhibition in cellular assays indicates compounds with some inhibitory activity for these cells, while the lack of inhibition below the threshold of the highest concentration tested does not necessarily indicate that the compound has no cell inhibitory activity, just that under the conditions tested, no inhibitory activity is observed. braking. In some cases, compounds were not tested in all tests or the test results were not valid.

[0436] The table below lists data showing the biochemical inhibitory activity of the C-kit and C-kit D816V exemplary compounds as described herein. In the table below, the activities in the kit and kit mutant assays are given as follows: +++ = 0.0001 &lt;IC50 &lt;1 µΜ; ++ = 1 μΜ &lt;IC50 &lt;10 μΜ; + = 10 μΜ &lt;IC50 &lt;200 μΜ.

PZ / 5321 / AG

EP 2 935 248 B1

185

<td>Relationship number</td><td>Biochemical activity (IC50 μΜ)</td><td>Biochemical activity (IC50 μΜ)</td>

<td></td><td>Putty</td><td>Kit D816V</td>

<td>P-2003</td><td></td><td> +</td>

<td>P-2005</td><td> ++</td><td> +++</td>

<td>P-2007</td><td> +++</td><td> +++</td>

<td>P-2009</td><td></td><td> +</td>

<td>P-2010</td><td> +</td><td> +</td>

<td>P-2011</td><td></td><td> +</td>

<td>P-2012</td><td> +++</td><td> ++</td>

<td>P-2013</td><td> +++</td><td> +</td>

<td>P-2015</td><td> ++</td><td> ++</td>

<td>P-2016</td><td> ++</td><td> ++</td>

<td>P-2017</td><td></td><td> +</td>

<td>P-2018</td><td> +</td><td> +</td>

<td>P-2019</td><td> +</td><td> +++</td>

<td>P-2020</td><td> ++</td><td></td>

<td>P-2021</td><td></td><td> +</td>

<td>P-2023</td><td> ++</td><td> +++</td>

<td>P-2024</td><td> +</td><td> +++</td>

<td>P-2025</td><td></td><td> +</td>

<td>P-2026</td><td> +++</td><td> +</td>

<td>P-2027</td><td> +++</td><td> ++</td>

<td>P-2029</td><td> +++</td><td> +++</td>

<td>P-2030</td><td> ++</td><td> +</td>

<td>P-2031</td><td> +++</td><td> +++</td>

<td>P-2032</td><td> +</td><td> ++</td>

<td>P-2033</td><td> +</td><td> +++</td>

<td>P-2034</td><td> +++</td><td> +++</td>

<td>P-2036</td><td> +++</td><td> +++</td>

<td>P-2037</td><td> ++</td><td> +++</td>

<td>P-2038</td><td> +++</td><td> +++</td>

<td>P-2039</td><td> +++</td><td> +++</td>

<td>P-2040</td><td> +</td><td> +++</td>

<td>P-2041</td><td></td><td> +++</td>

<td>P-2042</td><td> +++</td><td> +++</td>

<td>P-2043</td><td> +++</td><td> +++</td>

<td>P-2044</td><td> +</td><td> +++</td>

<td>P-2045</td><td> +</td><td> +++</td>

<td>P-2046</td><td> +</td><td> +++</td>

<td>P-2047</td><td> +</td><td> +++</td>

PZ / 5321 / AG

EP 2 935 248 B1

186

<td>P-2048</td><td> +++</td><td> +++</td>

<td>P-2049</td><td> +</td><td> +++</td>

<td>P-2050</td><td> +</td><td> ++</td>

<td>P-2051</td><td> +++</td><td> +++</td>

<td>P-2052</td><td> ++</td><td> +++</td>

<td>P-2053</td><td> ++</td><td> +++</td>

<td>P-2054</td><td> ++</td><td> +++</td>

<td>P-2055</td><td> ++</td><td> +++</td>

<td>P-2056</td><td></td><td> +++</td>

<td>P-2057</td><td> +++</td><td> +++</td>

<td>P-2058</td><td> +</td><td> +++</td>

<td>P-2059</td><td> +++</td><td> +++</td>

<td>P-2060</td><td> +++</td><td> +++</td>

<td>P-2061</td><td> +++</td><td> +++</td>

<td>P-2062</td><td> +++</td><td> +++</td>

<td>P-2063</td><td></td><td> +++</td>

<td>P-2064</td><td> +++</td><td> +++</td>

<td>P-2065</td><td> ++</td><td> +++</td>

<td>P-2066</td><td></td><td> +++</td>

<td>P-2067</td><td> ++</td><td> +++</td>

<td>P-2068</td><td></td><td> ++</td>

<td>P-2069</td><td> ++</td><td> +++</td>

<td>P-2070</td><td> ++</td><td> +++</td>

<td>P-2071</td><td></td><td> +</td>

<td>P-2072</td><td></td><td> ++</td>

<td>P-2073</td><td> ++</td><td> +++</td>

<td>P-2074</td><td> +++</td><td> +++</td>

<td>P-2075</td><td></td><td> +++</td>

<td>P-2076</td><td></td><td> +++</td>

<td>P-2077</td><td></td><td> ++</td>

<td>P-2078</td><td></td><td> +++</td>

<td>P-2079</td><td> ++</td><td> +++</td>

<td>P-2080</td><td> ++</td><td> +++</td>

<td>P-2081</td><td> ++</td><td> +++</td>

<td>P-2112</td><td> ++</td><td> +++</td>

<td>P-2113</td><td></td><td> ++</td>

<td>P-2114</td><td></td><td> ++</td>

<td>P-2115</td><td></td><td> ++</td>

<td>P-2116</td><td> +</td><td> ++</td>

<td>P-2118</td><td> +</td><td> +++</td>

PZ / 5321 / AG

EP 2 935 248 B1

187

<td>P-2120</td><td></td><td> +++</td>

<td>P-2121</td><td></td><td> +++</td>

<td>P-2122</td><td></td><td> +++</td>

<td>P-2123</td><td></td><td> +++</td>

<td>P-2144</td><td> ++</td><td> ++</td>

<td>P-2145</td><td></td><td> +++</td>

<td>P-2146</td><td></td><td> +++</td>

<td>P-2148</td><td> +++</td><td> +++</td>

<td>P-2149</td><td></td><td> +++</td>

<td>P-2150</td><td></td><td> +++</td>

<td>P-2151</td><td></td><td> ++</td>

<td>P-2152</td><td></td><td> +++</td>

<td>P-2153</td><td></td><td> +++</td>

<td>P-2154</td><td></td><td> +++</td>

<td>P-2155</td><td></td><td> +++</td>

<td>P-2157</td><td></td><td> +++</td>

<td>P-2158</td><td></td><td> +++</td>

<td>P-2159</td><td></td><td> +++</td>

<td>P-2160</td><td> ++</td><td> +++</td>

<td>P-2161</td><td></td><td> +++</td>

<td>P-2162</td><td> +++</td><td> ++</td>

<td>P-2163</td><td> +++</td><td> +++</td>

<td>P-2164</td><td> ++</td><td> +++</td>

<td>P-2165</td><td> +++</td><td> ++</td>

<td>P-2166</td><td> +++</td><td> +++</td>

<td>P-2167</td><td> +++</td><td> +++</td>

<td>P-2168</td><td> +++</td><td> +++</td>

<td>P-2169</td><td></td><td> +++</td>

<td>P-2172</td><td></td><td> ++</td>

<td>P-2174</td><td> ++</td><td> +++</td>

<td>P-2175</td><td></td><td> +++</td>

<td>P-2176</td><td> +</td><td> +++</td>

<td>P-2177</td><td> +++</td><td> +++</td>

<td>P-2178</td><td> +</td><td> +++</td>

<td>P-2179</td><td> ++</td><td> +++</td>

<td>P-2180</td><td> ++</td><td> +++</td>

<td>P-2181</td><td> +</td><td> +++</td>

<td>P-2182</td><td> ++</td><td> +++</td>

<td>P-2183</td><td> +</td><td> +++</td>

<td>P-2184</td><td> ++</td><td> +++</td>

PZ / 5321 / AG

EP 2 935 248 B1

188

<td>P-2185</td><td></td><td> +++</td>

<td>P-2186</td><td> ++</td><td> +++</td>

<td>P-2187</td><td> ++</td><td> +++</td>

<td>P-2188</td><td></td><td> ++</td>

<td>P-2189</td><td> +++</td><td> +++</td>

<td>P-2268</td><td> ++</td><td> +++</td>

<td>P-2269</td><td></td><td> +++</td>

<td>P-2270</td><td> +</td><td> +++</td>

<td>P-2271</td><td> +++</td><td> +++</td>

<td>P-2272</td><td> +</td><td> +++</td>

<td>P-2273</td><td> +</td><td> +++</td>

<td>P-2274</td><td> +++</td><td> +++</td>

<td>P-2275</td><td></td><td> +++</td>

<td>P-2276</td><td></td><td> +++</td>

<td>P-2277</td><td> +</td><td> +++</td>

<td>P-2278</td><td> +</td><td> +++</td>

<td>P-2279</td><td> +</td><td></td>

<td>P-2280</td><td> +</td><td> +++</td>

<td>P-2281</td><td> +</td><td> +++</td>

<td>P-2282</td><td> ++</td><td> +++</td>

<td>P-2283</td><td></td><td> +++</td>

<td>P-2284</td><td> ++</td><td> +++</td>

<td>P-2285</td><td> +++</td><td> +++</td>

<td>P-2286</td><td> +++</td><td> +++</td>

<td>P-2287</td><td></td><td> +++</td>

<td>P-2288</td><td></td><td> ++</td>

<td>P-2289</td><td> +++</td><td> ++</td>

<td>P-2290</td><td> +</td><td> +</td>

<td>P-2291</td><td> +</td><td> +</td>

<td>P-2292</td><td> +++</td><td> +++</td>

<td>P-2293</td><td> +++</td><td> +++</td>

<td>P-2294</td><td> +++</td><td> +++</td>

<td>P-2295</td><td> +++</td><td> +++</td>

<td>P-2296</td><td> +++</td><td> +++</td>

<td>P-2297</td><td> +++</td><td> +++</td>

<td>P-2301</td><td> +</td><td></td>

[0437] Compounds P-2001 to P-2102, P-2104 to P-2116 and P-2118 to P-2189, e.g. compounds P-2001, P-2002, P2004, P-2005, P-2006, P -2007, P-2008, P-2012, P-2013, P-2014, P-2015, P-2016, P-2019, P-2020, P2022, P-2023, P-2024, P-2026, P -2027, P-2028, P-2029, P-2030, P-2031, P-2032, P-2033, P-2034, PPZ / 5321 / AG

EP 2 935 248 B1

189

2035, P-2036, P-2037, P-2038, P-2039, P-2040, P-2041, P-2042, P-2043, P-2044, P-2045, P-2046, P2047, P- 2048, P-2049, P-2050, P-2051, P-2052, P-2053, P-2054, P-2055, P-2056, P-2057, P-2058, P2059, P-2060, P- 2061, P-2062, P-2063, P-2064, P-2065, P-2066, P-2067, P-2068, P-2069, P-2070, P2072, P-2073, P-2074, P- 2075, P-2076, P-2077, P-2078, P-2079, P-2080, P-2081, P-2082, P-2083, P2084, P-2085, P-2086, P-2087, P- 2088, P-2089, P-2090, P-2091, P-2092, P-2093, P-2094, P-2095, P2096, P-2097, P-2098, P-2099, P-2100, P-2101, P-2102, P-2104, P-2105, P-2106, P-2107, P-2108, P2109, P-2110, P-2111, P-2112, P-2113, P-2114, P-2115, P-2116, P-2117, P-2118, P-2119, P-2120, P2121, P-2122, P-2123, P-2124, P-2125, P-2126, P-2127, P-2128, P-2129, P-2130, P-2131, P-2132, P2133, P-2134, P-2135, P-2136, P-2137, P-2138, P-2139, P-2140, P-2141, P-2142, P-2144, P-2145, P2146, P-2147, P-2148, P-2149, P-2150, P-2151, P-2152, P-2153, P-2154, P-2155, P-2156, P-2157, P2158, P-2159, P-2160, P-2161, P-2162, P-2163, P-2164, P-2165, P-2166, P-2167, P-2168, P-2169, P2170, P-2171, P-2172, P-2173, P-2174, P-2175, P-2176, P-2177, P-2178, P-2179, P-2180, P-2181, P2182, P-2183, P-2184, P-2185, P-2186, P-2187, P-2188 and P-2189 had IC value₅₀ less than 10 µΜ in at least one of the C-kit cell assays described above in Example 26.

[0438] Compounds P-2190 to P-2267, e.g. compounds P-2190, P-2191, P-2192, P-2193, P-2194, P-2195, P2196, P-2197, P-2198, P-2199, P-2200, P-2201, P-2202 , P-2203, P-2204, P-2205, P-2206, P-2207, P2208, P-2209, P-2210, P-2211, P-2212, P-2213, P-2214, P-2215 , P-2216, P-2217, P-2218, P-2219, P2220, P-2221, P-2222, P-2223, P-2224, P-2225, P-2226, P-2227, P-2228 , P-2229, P-2230, P-2231, P2232, P-2233, P-2234, P-2235, P-2236, P-2237, P-2238, P-2239, P-2240, P-2241 , P-2242, P-2243, P2244, P-2245, P-2246, P-2247, P-2248, P-2249, P-2250, P-2251, P-2252, P-2253, P-2254, P-2255, P2256, P-2257, P-2258, P-2259, P-2260, P-2261, P-2262, P-2263, P-2264, P-2265, P-2266 and P-2267 show an IC50 value of less than 10 µΜ in at least one of the C-kit cell assays described in Example 26 above.

[0439] Compounds P-2268 to P-2307, e.g. compounds P-2268, P-2269, P-2270, P-2271, P-2272, P-2273, P2274, P-2275, P-2276, P -2277, P-2278, P-2279, P-2280, P-2281, P-2282, P-2283, P-2284, P-2285, P2286, P-2287, P-2288, P-2289, P -2290, P-2291, P-2292, P-2293, P-2294, P-2295, P-2296, P-2297, P2298, P-2299, P-2300, P-2301, P-2302, P -2303, P-2304, P-2305, P-2306 and P-2307 had an IC value₅₀ less than 10 µΜ in at least one of the C-kit cell assays described above in Example 26.

[0440] The pharmacokinetic properties of compounds as described herein (including any solid forms or formulations thereof), e.g., P-2001, P-2002, P-2004 through P-2273, and P-2274 through P-2307 have been estimated in male Sprague Dawley rats or male beagle dogs. Rats were administered a daily dose of compound either by intravenous (IV) injections via surgically implanted jugular catheters or via an intragastric tube (orally, PO). Each compound is prepared as a 20 mg / mL stock solution in dimethylsulfoxide, which is then diluted to provide a dosing stock solution at the desired concentration for Formulations IV or PO. For IV dosing, the dosing stock solution is diluted in a 1: 1: 8 mixture of Solutol®: ethanol: water. For dosing PO, the dosing stock solution is diluted in 1% methylcellulose. In cassette format (or each compound, its solid form, or its formulation is manipulated individually), each compound is diluted to 0.5 mg / ml for IV dosing and 0.4 mg / ml each for PO dosing and dosed as appropriate. 1 mg / kg (2 ml / kg) or 2 mg / kg (5 ml / kg). For animals dosed intravenously, tail vein blood samples are collected daily with the anticoagulant lithium heparin in

PZ / 5321 / AG

EP 2 935 248 B1

190 time points of 5, 15, 30, and 60 minutes and 4, 8, and 24 hours post-dose. For animals dosed orally, blood samples are collected daily from the tail vein anticoagulated with lithium heparin at the 30 minutes, 1, 2, 4, 8 and 24 hours post-dose time points. Dogs are dosed daily in oral capsules in an appropriate formulation at 50 mg / ml. Jugular vein blood samples are collected daily with the anticoagulant lithium heparin at the 30 minutes, 1, 2, 4, 8 and 24 hours post-dosing time points. All samples are processed to plasma and frozen for later analysis of each compound by LC / MS / MS. Plasma concentrations are plotted as a function of time to evaluate AUC (ng * hr / ml). The compounds of the present disclosure advantageously exhibit improved pharmacokinetic properties relative to the previously described compounds, i.e. have significantly greater values ​​for one or more of AUC, C max and half life with respect to the compounds previously described.

[0441] One skilled in the art will readily appreciate that the present disclosure is well suited to obtain the stated results and advantages, as well as those inherent to him. The methods, variations, and compositions described herein as presently representative of the preferred embodiments are exemplary and are not intended to limit the scope of the disclosure. It will be appreciated by those skilled in the art for variations therein and for other uses that fall within the scope of the disclosure and fall within the scope of the claims.

[0442] While this disclosure is disclosed in terms of specific embodiments, it will be appreciated that other embodiments and variations of this disclosure may be made by other skilled artisans without departing from the scope of the disclosure.

[0443] Moreover, where features or aspects of the disclosure are described in terms of Markush groups or other alternative moieties, those skilled in the art will appreciate that the disclosure is also thereby described in terms of any particular member or subgroup of members of a Markush group or other group.

[0444] Also, unless otherwise indicated, where different numerical values ​​are given for the embodiments, additional embodiments are described by taking any two different values ​​as the endpoints of the range. Such ranges also fall within the scope of the disclosure described herein.

PZ / 5321 / AG

ΕΡ2 935 248 Β1

191

SEQUENCE LIST [0445]

SEQ ID NO: 1 Sequence NP_000213

Met Arg Gly Ala Arg Gly Ala

Arg Val Gln Thr Gly Cheese Ser

Pro Ser Ile His Pro Gly Lys

Pro

Main

Cys Ala

Leu

Cys Gly Ser

Arg Leu Ser

Tire Ile

Thr

How much

Val

How much

Asn

Thr

Arg Leu Leu Cys Thr Asp Glu Thr Asn Glu Asn Lys Asn Thr Gly Lys Tyr Thr Val Phe Val Arg Asp Pro Lys Glu Asp Asn Asp Thr Asn Tyr Ser Leu Lys Gly Ile Pro Asp Pro Lys Ala Arg Leu Cys Leu His Cys Lys Phe Ile Leu Lys Val Ser Lys Ala Ser Tyr Leu Ile Lys Asp Val Ser Ser Thr Lys Leu Gln Glu Lys Arg Gln Ala Thr Leu Thr Met Cys Tyr Ala Asn Asn Val Val Asp Lys Gly Phe Val Asn Asp Gly Glu Asn Pro Glu His Gln Gln Trp Asp Tyr Pro Lys Ser Glu Leu Thr Arg Leu Lys Gly Ser Asp Val Asn Ala Ala Ile Leu Thr Tyr Asp Arg Phe Pro Glu Pro Thr Ile Ser Ala Ser Val Leu Pro Phe Gly Lys Leu Val Val Gly Thr Val Glu Cys Lys Asn Phe Ala Phe Lys Gly Thr Pro Leu Lou Ile Gly Met Ile Leu Thr Tyr Lys Val val Glu Glu Background Asn Pro Tyr Asp His Lys Trp Leu Gly Ala Gly Ala Phe

Trp Asp Phe LeuCys

Gln Pro Cheese ValSer

Asp Leu IleVal cheese

Gly Phe Val LysTrp

Asn Glu Trp IleThr

Thr Asn Lys HisGly

Lys Leu Phe LeuVal

Val Arg Cys Pro Leu

Gln Gly Lys Pro Leu

Ile Met Ile Lys Ser

Val Asp Gln Glu Gly

Pro Ala Phe Lys Ala

Arg Glu Gly Glu Glu

Val Tyr Ser Thr Trp

Asn Ser Trp His His

Cheese Ala Arg val

Phe Gly Cheese Ala Asn

Asn Ile Phe Pro Met

Asp Leu Ile Val Glu

Tyr Met Asn Arg Thr

Glu Cheese Asn Ile Arg

Glu Gly Gly Thr Tyr

Ile Ala Phe Asn Val Tyr

Leu Val Asn Gly Met Leu

Asp Trp Tyr Phe Cys Pro

Vai Asp Val Gln Thr Leu

Gln Cheese Cheese Ile Asp Ser

Ala Tyr Asn Asp Val Gly

Asn Asn Lys Glu Gln ile

Phe Val ile Val Ala Gly

Tyr Leu Gln Lys Pro Met

Gly Asn Asn Tyr val Tyr

Glu Phe Pro Arg Asn Arg

Gly Lys Va.l Val Glu Ala

Val Leu Leu Leu Leu Leu Pro Gly Glu Pro Ser Pro Arg Val Gly Asp Glu Ile Thr Phe Glu Ile Leu Asp Glu Lys Ala Glu Ala Thr Leu Ser Asn Ser Ile Tyr Asp Arg Ser Leu Tyr Gly Thr Asp Pro Glu Val Thr Pro Lys Asp Leu Arg Phe Val Lys Arg Ala Tyr His Lys Ser Val Leu Ser Glu Val Pro Val Val Ser Val Phe Thr Val Thr Cys Thr Lys Arg Glu Asn Ser Gln Gly Asp Phe Asn Tyr Glu Asn Asp Ser Gly Val Phe Val Thr Thr Thr Leu Glu Ile Asn Thr Thr Val Phe Tyr Glu Ala Phe Pro Lys Phe Thr Asp Lys Trp Glu Tyr Val Ser Glu Leu His Thr Phe Leu Val Ser Asn Val Asn Thr Lys Pro Glu Gln Cys Val Ala Ala Gly Gly Thr Glu Gln Arg Cys Asn Ser Ser Gly Pro Pro Ser Ala Phe Lys His Asn Lys Thr Ser Ala Tyr Phe His Pro His Thr Leu Phe Met Met Cys Ile ile Val Tyr Glu Val Gln Trp Lys Ile Asp Pro Thr Gln Leu Leu Ser Phe Gly Lys Thr Thr Ala Tyr Gly Leu Ile

PZ / 5321 / AG

ΕΡ2 935 248 Β1

192

Lys Ser Asp Ala A.la Met Thr Val Ala Val Lys Met Leu Lys Pro Ser Ala His

Leu Thr Glu Arg Glu Ala Leu Met Ser Glu Leu Lys Val Leu Ser Tyr Leu Gly

Asn His Met Asn Ile Val Asn Leu Leu Gly Ala Cys Thr Ile Gly Gly Pro Thr

Leu Val Ile Thr Glu Tyr Cys Cys Tyr Gly Asp Leu Leu Asn Phe Leu Arg Arg

Lys Arg Asp Ser Phe Ile Cys Ser Lys Gin Glu Asp His Ala Glu Ala Ala Leu

Tyr Lys Asn Leu Leu His Ser Lys Glu Ser Ser Cys Ser Asp Ser Thr Asn Glu

Tyr Met Asp Met Lys Pro Gly Val Ser Tyr Val Val Pro Thr Lys Ala Asp Lys

Arg Arg Cheese Val Arg Ile Gly Cheese Tyr Ile Glu Arg Asp Val Thr Pro Ala Ile

Met Glu Asp Asp Glu Leu Ala Leu Asp Leu Glu Asp Leu Leu Ser Phe Ser Tyr

Gin Val Ala Lys Gly Met Ala Phe Leu A.la Ser Lys Asn Cys Ile His Arg Asp

Leu Ala Ala Arg A.sn Ile Leu Leu Thr His Gly Arg Ile Thr Lys Ile Cys Asp

Phe Gly Leu Ala Arg A.sp Ile Lys Asn Asp Ser Asn Tyr Val Val Lys Gly Asn

Ala Arg Leu Pro Val Lys Trp Met Ala Pro Glu Ser Ile Phe Asn Cys Val Tyr

Thr Phe Glu Ser Asp Val Trp Cheese Tyr Gly Ile Phe Leu Trp Glu Leu Phe Cheese

Leu Gly Ser Ser Pro Tyr Pro Gly Met Pro Val Asp Ser Lys Phe Tyr Lys Met

Ile Lys Glu Gly Phe Arg Met Leu Ser Pro Glu His Ala Pro Ala Glu Met Tyr

Asp Ile Met Lys Thr Cys Trp Asp Ala Asp Pro Leu Lys Arg Pro Thr PheLys

Gin Ile Val Gin Leu Ile Glu Lys Gin Ile Ser Glu Ser Thr Asn His IleTyr

Ser .Asn Leu Ala Asn Cys Ser Pro Asn Arg Gin Lys Pro Val Val Asp HisSer

Val Arg Ile Asn Ser Val Gly Ser Thr Ala Ser Ser Ser Gin Pro Leu LeuVal

His Asp AspVal

SEQ ID NO: 2 Sequence NM_000222 gatcccatcg cagctaccgc gatgagaggc gctcgcggcg cctgggattt tctctgcgtt ctgctcctac tgcttcgcgt ccagacaggc tcttctcaac catctgtgag tccaggggaa

121 ccgtctccac catccatcca tccaggaaaa tcagacttaa tagtccgcgt gggcgacgag

181 attaggctgt tatgcactga tccgggcttt gtcaaatgga cttttgagat cctggatgaa

241 acgaatgaga ataagcagaa tgaatggatc acggaaaagg cagaagccac caacaccggc

301 aaatacacgt gcaccaacaa acacggctta agcaattcca tttatgtgtt tgttagagat

361 cctgccaagc ttttccttgt tgaccgctcc ttgtatggga aagaagacaa cgacacgctg

421 gtccgctgtc ctctcacaga cccagaagtg accaattatt ccctcaaggg gtgccagggg

481 aagcctcttc ccaaggactt gaggtttatt cctgacccca aggcgggcat catgatcaaa

541 agtgtgaaac gcgcctacca tcggctctgt ctgcattgtt ctgtggacca ggagggcaag

601 tcagtgctgt cggaaaaatt catcctgaaa gtgaggccag ccttcaaagc tgtgcctgtt

661 gtgtctgtgt ccaaagcaag ctatcttctt agggaagggg aagaattcac agtgacgtgc

721 acaataaaag atgtgtctag ttctgtgtac tcaacgtgga aaagagaaaa cagtcagact

781 aaactacagg agaaatataa tagctggcat cacggtgact tcaattatga acgtcaggca

PZ / 5321 / AG

ΕΡ2 935 248 Β1

193

841

901

961

1021

1081

1141

1201

1261

1321

1381

1441

1501

1561

1621

1681

1741

1801

1861

1921

1981

2041

2101

2161

2221

2281

2341

2401

2461

2521

2581

2641

2701

2761

2821

2881

2941

3001 acgttgacta aatacttttg aa LCL La Lec attgttgaat accttcactg gtaagtgaac gtgtccaatt gaaatccega ccagagccca gtactgccag gtteagagtt tacaacgatg gag caaauec ggcatgaegt gaagtacagt acacaacttc accctgggtg teagatgegg cgggaagccc gtgaatccac tgctatggtg caggaagatc tgeagegata accaaggccg cccgccacca taccaggtgg gcagccagaa gccagagaca aagtggatgg tcctatggga ccggtcgatt ca cgcacctg agaccaacat catatttact tctgtgcgga gacgatgtct gcttccacga teagtteage gatcagcaaa ccaLgaLaaa atgaagcatt ataaatggga ttcatctaac ctgacgtcaa cttacgacag caatagattg tggatgtgca etatagatte tgggcaagac and Lccccacac gcattattgt ggaaggttgt cttatgatca ctggagcttt ccatgactgt tcatgtctga ttggagcctg atcttttgaa atgcagaagc gtactaatga acaaaaggag tggaggatga caaagggcat atatcctcct tcaagaatga cacctgaaag tttttctttg ctaagttcta ctgaaatgta tcaagcaaat ccaacttagc tcaattctgt gageagaate tggttatttt gagagttaat tgtcacaaca cac LacagLa ccccaaacct agattatccc gagattaaaa tgctgccata gctcgtgaat gtatttttgt gacactaaac tagtgeattc ttctgcctat ccLgLLcacL gatgattetg tgaggagata caaatgggag cgggaaggtt cgctgtaaag actcaaagtc caccattgga ttttttgaga tgcactttat gtacatggac atctgtgaga egagttggee ggctttcctc tactcatggt ttctaattat cattttcaac ggagctgttc caagatgatc tgacataatg tgtteageta aaacLgcagc cggcagcacc agtgtttggg cttttctttc gattctggag accttggaag LL Lg Laaacg gaacaccagc aagtctgaga ggcaccgaag gcatttaatg ggcatgctcc ccaggaactg tcatctgggc aagcacaatg tttaactttg eeLLLgcLga acctacaaat aatggaaaca tttcccagaa gttgaggcaa atgctcaagc ctgagttacc gggcccaccc agaaaacgtg aagaatcttc atgaaacctg ataggeteat etagaettag gcctccaaga cggatcacaa gtggttaaag tgtgtataca tctttaggaa aaggaaggct aagacttgct attgagaagc cccaaccgac gcttcctcct tcacccctcc aacttgcatc tgttcatgtg tagtagataa and Lgg ag aaaa agtggatcta atgaaagtaa gaggcactta tttatgtgaa aatgtgtggc ageagagatg caccgtttgg gcacggttga catttaaagg L Lgg LL Leg L atttacagaa attatgttta acaggctgag ctgcttatgg cgagtgccca ttggtaatca tggtcattac atteatttat tgcattcaaa cagtttctta acatagaaag aagacttgct attgtattca agatttgtga gaaacgctcg cgtttgaaag gcagccccta tccggatgct gggatgeaga agattteaga agaagcccgt cccagcctct aggaatgatc caactccagg ttatgccaat aggatteatt Lg LagaLLLg tatgaacaga tatcagatac cacattccta tacaaaacca ageaggatte ctctgcttct aaagctagtg atgtaaggct taacaacaaa aa Leg LageL acccatgtat catagaccca ttttgggaaa cttaattaag tttgacagaa catgaatatt agaatattgt ttgttcaaag ggagtcttcc tgttgtccca agatgtgact gagcttttct cagagacttg ttttggtcta actacctgtg tgacgtctgg tcctggaatg cagccctgaa tcccctaaaa gagcaccaat ggtagaccaL gcttgtgcac tcttcttttg atagtgggca

PZ / 5321 / AG

ΕΡ2 935 248 Β1

194 ccccactgca caccatccta atgaacagaa cctttccaag ggtagtaatc agctgaaaac atgaacacct aaaaaatgat tatactaccg gcctccctag ggggaaaaca tagaagtaga aacaatataa tctgtagatt gatgctgttt gccatcttag aggcatgtcc agacaaatat aagtaacttg tagcttacca tttgcagttc ccttagacct gtagcctgga aactcccctt ttgtcttgaa tacatttaga ctcgcacctt ttgccatact aagtggttgt ttgccatact aagtggttgt aatgtctttt aactttatgt ttattcctgt atcctgtctt ttgcaaaggt aacattctga gcttctccaa acagttggcc ctaagtcctt gggcttaaga ccccaagtgt acctggtttt ccagcacttg ccataaggtt ttaagagcca ccacaaagca ctgtggaaca gacaaagtta tttggattct tggacaccgg ttggaggggt gctttcatta gaagcttcca acctgcactt tccataatgc tattattctt cctcactgcc agattcaggt gaactgtggc tccaaagtta ttgtctgaaa tagttataga ttgtctgaaa tagttataga gaatattccc gtaaatacat atgttgtcca tctgagcaca tccaactgta tttggaaaaa ttctgcccaa ttcagaacca tatgtggaaa aatctagtat gaacaaaaga taaatagagt tatatacgca tcgtttctgt tataagtttg cagtttgaac agcctatcag ctgattcact tatgtagcag gccagtatct atttttgccc ttagtactgc tagtggtgca aaggcactct tactgtctca gtagtttacc caatataaaa atgttgcctt cgttatctgg acagattttg aattcctttg tgtctaggta aattcctttg tgtctaggta aagcccatga aagcggcgta attgttgaca ctttagtggc tatattccca gagagggagg aaatatggtt tccatagtag acagaacatc ttcatgctgg tgctcttctg ttgctattag tctataaatt atacaaccct aaggaaacag aaaatctcct cttcagaatg gcatggctcc gaaataaagt atatatgtgt tgagtccaag tcttgtttct gaggaagtgg gttatttaga ctgaaacatt tctttaaaaa ggcaaatgtg tatggtttcc aagtaaccat gggttgtgtt tgtttctatt cttcaggggc tgtttctatt cttcaggggc gtccttgaaa agtttaaagg gttctgaaga cgatgatttt atagcaacgt tatggactgg gatagtttac tatgatgata attagaacaa gaatgagaca tggaccactg agcattgaat gtccgtgttc ggcattatgt ttaataccat cttttagctg gcattgtact cacaggagtg ataggtttag atgtacgttt agggtccttt tttcacatag aaggcatcag ctcatcttac taaattttac caaaacaaaa tacatggcag cccttctaca ttgcactgga gtcacccaag gacttcaatg acttcattga gacttcaatg acttcattga atatttttta atgttggtgt ATCC tgtcatcagc agcttctacc gggccagagt ctgaataaat caagattaga aggacagagt taggccatga catgagcttt tggagagaag atacatttga ccactgtgta tttttaagga atgaacttat caatggattt ggaaaacact cctccttcgc gtatgtgtgt agtacctgaa ctgtctagag tccctatgta tgtacctgtt cctttagact caaaacaaaa agtttgtgtg tttactagttagtagttagtagttagtagttgatgttagtagttgtagttagtagttgatgtttagtagttgatgttagtagttgtagttagtagttgatgtaga

SEQUENCE LIST

[0446] &lt;110&gt; Plexxikon, Inc.

&lt;120&gt; RELATIONS AND METHODS OF MODULATION OF KINASES AND INDICATIONS FOR THEM

PZ / 5321 / AG

ΕΡ2 935 248 Β1

195 &lt;130&gt; ΡΝ815805ΕΡ &lt;140&gt; ΕΡ13824239.1 &lt;141&gt; 2013-12-20 &lt;150&gt; 61 / 784.928 &lt;151&gt; 2013-03-14 &lt;150&gt; 61 / 745.409 &lt;151&gt; 2012-12-21 &lt;160&gt; 2 &lt;170&gt; Patentln version 3.5 &lt;210&gt; 1 &lt;211&gt; 976 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 1

Met Arg Gly Ala Arg Gly Ala Trp Asp Phe Leu Cys Val Leu Leu Leu 15 1015

Leu Leu Arg Val Gin Thr Gly Ser Ser Gin Pro Ser Val Ser Pro Gly 20 2530

Glu Pro Ser Pro Pro Ser Ile His Pro Gly Lys Ser Asp Leu Ile Val 35 4045

Arg Val Gly Asp Glu Ile Arg Leu Leu Cys Thr Asp Pro Gly Phe Val 50 5560

Lys Trp Thr Phe Glu Ile Leu Asp Glu Thr Asn Glu Asn Lys GinAsn

70 7580

Glu Trp Ile Thr Glu Lys Ala Glu Ala Thr Asn Thr Gly Lys TyrThr

9095

Cys Thr Asn Lys His Gly Leu Ser Asn Ser Ile Tyr Val Phe Val Arg 100 105 110

Asp Pro Ala Lys Leu Phe Leu Val Asp Arg Ser Leu Tyr Gly Lys Glu 115 120 125

Asp Asn Asp Thr Leu Val Arg Cys Pro Leu Thr Asp Pro Glu Val Thr

130 135140

PZ / 5321 / AG

ΕΡ2 935 248 Β1

196

Asn Tyr Ser Leu Lys Gly Cys Gin Gly 145 150

Arg Phe Ile Pro Asp Pro Lys Ala Gly 165

Arg Ala Tyr His Arg Leu Cys Leu His

180 185

Lys Cheese Val Leu Cheese Glu Lys Phe Ile 195 200

Lys Ala Val Pro Val Val Ser Val Ser

210 215

Glu Gly Glu Glu Phe Thr Val Thr Cys 225 230

Val Tyr Ser Thr Trp Lys Arg Glu 245

Glu Lys Tyr Asn Ser Trp His His Gly

260 265

Ala Thr Leu Thr Ile Ser Ser Ala Arg 275 280

Met Cys Tyr Ala Asn Asn Thr Phe Gly

290 295

Leu Glu Val Val Asp Lys Gly Phe Ile 305 310

Thr Thr Val Phe Val Asn Asp Gly Glu 325

Tyr Glu Ala Phe Pro Lys Pro Glu His

340 345

Arg Thr Phe Thr Asp Lys Trp Glu Asp 355 360

Cheese Asn Ile Arg Tyr Val Cheese Glu Leu

370 375

Thr Glu Gly Gly Thr Tyr Thr Phe Leu 385 390

Pro Leu Pro Lys Asp Leu

155 160

Met Ile Lys Cheese Val Lys 175

Val Asp Gin Glu Gly cheese 190

Lys Val Arg Pro Ala Phe

205

Ala Ser Tyr Leu Leu Arg 220

Ile Lys Asp Val Ser Ser

235 240

Cheese Gin Thr Lys Leu Gin 255

Phe Asn Tyr Glu Arg Gin 270

Asn Asp Ser Gly Val Phe 285

Ala Asn Val Thr Thr Thr

300

Ile Phe Pro Met Ile Asn

315 320

Val Asp Leu Ile Val Glu 335

Gin Trp Ile Tyr Met Asn 350

Pro Lys Cheese Glu Asn Glu 365

Leu Thr Arg Leu Lys Gly 380

Cheese Asn Cheese Asp Val Asn

395 400

PZ / 5321 / AG

ΕΡ2 935 248 Β1

197

Ala Ala Ile Ala Phe Asn Val Tyr Val 405

Thr Tyr Asp Arg Leu Val Asn Gly Met

420 425

Phe Pro Glu Pro Thr Ile Asp Trp Tyr 435 440

Arg Cys Ser Ala Ser Val Leu Pro Val

450 455

Gly Pro Pro Phe Gly Lys Leu Val Cheese 465 470

Ser Ala Phe Lys His Asn Gly Thr Val 485

Val Gly Lys Thr Ser Ala Tyr Phe Asn

500 505

Lys Glu Gin Ile His Pro His Thr Leu 515 520

Phe Val Ile Val Ala Gly Met Met Cys 530 535

Tyr Lys Tyr Leu Gin Lys Pro Met Tyr 545 550

Glu Glu Ile Asn Gly Asn Asn Tyr Val 565

Pro Tyr Asp His Lys Trp Glu Phe Pro

580 585

Lys Thr Leu Gly Ala Gly Ala Phe Gly 595 600

Tyr Gly Leu Ile Lys Ser Asp Ala Ala 610 615

Leu Lys Pro Ser Ala His Leu Thr Glu 625 630

Thr Lys Pro Glu Ile Leu 415

Gin Cys Val Ala Ala Gly 430

Cys Pro Gly Thr Glu Gin 445

Val Gin Thr Leu Asn Ser 460

Gin Cheese Cheese Ile Asp Ser

475 480

Cys Lys Ala Tyr Asn Asp 495

Ala Phe Lys Gly Asn Asn 510

Thr Pro Leu Leu Ile Gly 525

Ile Val Met Ile Leu Thr

540

Val Gin Trp Lys Val Val

555 560

Ile Asp Pro Thr Gin Leu 575

Asn Arg Leu Ser Phe Gly 590

Val Val Glu Ala Thr Ala

605

Thr Val Ala Val Lys Met 620

Leu Lys Val Leu Ser Tyr Leu Gly Asn His Met Asn Ile Val Asn Leu

Glu Ala Leu Met Cheese Glu

635 640

PZ / 5321 / AG

ΕΡ2 935 248 Β1

198

645

655

Leu Val Ile Thr Glu Tyr

670

Leu Gly Ala Cys Thr Ile Gly Gly Pro

660 665

Cys Cys Tyr Gly Asp Leu Leu Asn Phe 675 680

Phe Ile Cys Ser Lys Gin Glu Asp His

690 695

Asn Leu Leu His Ser Lys Glu Ser Ser 705 710

Tyr Met Asp Met Lys Pro Gly Val Ser 725

Asp Lys Arg Arg Ser Val Arg Ile Gly

740 745

Thr Pro Ala Ile Met Glu Asp Asp Glu 755 760

Leu Leu Cheese Phe Cheese Tyr Gin Val Ala

770 775

Ser Lys Asn Cys Ile His Arg Asp Leu 785 790

Thr His Gly Arg Ile Thr Lys Ile Cys 805

Ile Lys Asn Asp Ser Asn Tyr Val Val

820 825

Val Lys Trp Met Ala Pro Glu Ser Ile 835 840

Glu Cheese Asp Val Trp Cheese Tyr Gly Ile

850 855

Leu Gly Ser Ser Pro Tyr Pro Gly Met 865 870

Lys Met Ile Lys Glu Gly Phe Arg Met 885

Arg Arg Lys Arg Asp Ser 685

Glu Ala Ala Leu Tyr Lys 700

Ser Asp Ser Thr Asn Glu

715 720

Val Val Pro Thr Lys Ala 735

Tyr Ile Glu Arg Asp Val 750

Ala Leu Asp Leu Glu Asp 765

Gly Met Ala Phe Leu Ala 780

Ala Arg Asn Ile Leu Leu

795 800

Phe Gly Leu Ala Arg Asp 815

Gly Asn Ala Arg Leu Pro 830

Asn Cys Val Tyr Thr Phe 845

Leu Trp Glu Leu Phe Ser 860

Val Asp Ser Lys Phe Tyr

875 880

Pro Glu His Ala Pro cheese

895

PZ / 5321 / AG

ΕΡ2 935 248 Β1

199

Ala Glu Met Tyr Asp Ile Met Lys Thr Cys Trp Asp Ala Asp Pro Leu 900 905910

Lys Arg Pro Thr Phe Lys Gin Ile Val Gin Leu Ile Glu Lys Gin Ile 915 920925

Ser Glu Ser Thr Asn His Ile Tyr Ser Asn Leu Ala Asn Cys Ser Pro 930 935940

Asn Arg Gin Lys Pro Val Val Asp His Ser Val Arg Ile Asn SerVal

945 950 955960

Gly Ser Thr Ala Ser Ser Ser Gin Pro Leu Leu Val His Asp AspVal

965 970975 &lt;21 0&gt; 2 &lt;211&gt; 5084 &lt;212&gt; DNA &lt;213&gt; Homo sapiens &lt;400&gt; 2

<td>gatcccatcg</td><td>cagctaccgc</td><td>gatgagaggc</td><td colspan="2">gctcgcggcg cctgggattt</td><td>tctctgcgtt</td><td> 60</td>

<td>ctgctcctac</td><td>tgcttcgcgt</td><td>ccagacaggc</td><td>tcttctcaac</td><td>catctgtgag</td><td>tccaggggaa</td><td> 120</td>

<td>ccgtctccac</td><td>catccatcca</td><td>tccaggaaaa</td><td>tcagacttaa</td><td>tagtccgcgt</td><td>gggcgacgag</td><td> 180</td>

<td>attaggctgt</td><td>tatgcactga</td><td>tccgggcttt</td><td>gtcaaatgga</td><td>cttttgagat</td><td>cctggatgaa</td><td> 240</td>

<td>acgaatgaga</td><td>ataagcagaa</td><td>tgaatggatc</td><td>acggaaaagg</td><td>cagaagccac</td><td>caacaccggc</td><td> 300</td>

<td>aaatacacgt</td><td>gcaccaacaa</td><td>acacggctta</td><td>agcaattcca</td><td>tttatgtgtt</td><td>tgttagagat</td><td> 360</td>

<td>cctgccaagc</td><td>ttttccttgt</td><td>tgaccgctcc</td><td>ttgtatggga</td><td>aagaagacaa</td><td>cgacacgctg</td><td> 420</td>

<td>gtccgctgtc</td><td>ctctcacaga</td><td>cccagaagtg</td><td>accaattatt</td><td>ccctcaaggg</td><td>gtgccagggg</td><td> 480</td>

<td>aagcctcttc</td><td>ccaaggactt</td><td>gaggtttatt</td><td>cctgacccca</td><td>aggcgggcat</td><td>catgatcaaa</td><td> 540</td>

<td>agtgtgaaac</td><td>gcgcctacca</td><td>tcggctctgt</td><td>ctgcattgtt</td><td>ctgtggacca</td><td>ggagggcaag</td><td> 600</td>

<td>tcagtgctgt</td><td>cggaaaaatt</td><td>catcctgaaa</td><td>gtgaggccag</td><td>ccttcaaagc</td><td>tgtgcctgtt</td><td> 660</td>

<td>gtgtctgtgt</td><td>ccaaagcaag</td><td>ctatcttctt</td><td>agggaagggg</td><td>aagaattcac</td><td>agtgacgtgc</td><td> 720</td>

<td>acaataaaag</td><td>atgtgtctag</td><td>ttctgtgtac</td><td>tcaacgtgga</td><td>aaagagaaaa</td><td>cagtcagact</td><td> 780</td>

<td>aaactacagg</td><td>agaaatataa</td><td>tagctggcat</td><td>cacggtgact</td><td>tcaattatga</td><td>acgtcaggca</td><td> 840</td>

<td>acgttgacta</td><td>tcagttcagc</td><td>gagagttaat</td><td>gattctggag</td><td>tgttcatgtg</td><td>ttatgccaat</td><td> 900</td>

<td>aatacttttg</td><td>gatcagcaaa</td><td>tgtcacaaca</td><td>accttggaag</td><td>tagtagataa</td><td>aggattcatt</td><td> 960</td>

<td>aatatcttcc</td><td>ccatgataaa</td><td>cactacagta</td><td>tttgtaaacg</td><td>atggagaaaa</td><td>tgtagatttg</td><td> 1020</td>

<td>attgttgaat</td><td>atgaagcatt</td><td>ccccaaacct</td><td>gaacaccagc</td><td>agtggatcta</td><td>tatgaacaga</td><td> 1080</td>

<td>accttcactg</td><td>ataaatggga</td><td>agattatccc</td><td>aagtctgaga</td><td>atgaaagtaa</td><td>tatcagatac</td><td> 1140</td>

PZ / 5321 / AG

ΕΡ2 935 248 Β1

200

<td>gtaagtgaac</td><td>ttcatctaac gagattaaaa ggcaccgaag</td><td>gaggcactta</td><td>cacattccta</td><td> 1200</td>

<td>gtgtccaatt</td><td>ctgacgtcaa tgctgccata gcatttaatg</td><td>tttatgtgaa</td><td>tacaaaacca</td><td> 1260</td>

<td>gaaatcctga</td><td>cttacgacag gctcgtgaat ggcatgctcc</td><td>aatgtgtggc</td><td>agcaggattc</td><td> 1320</td>

<td>ccagagccca</td><td>caatagattg gtatttttgt ccaggaactg</td><td>agcagagatg</td><td>ctctgcttct</td><td> 1380</td>

<td>gtactgccag</td><td>tggatgtgca gacactaaac tcatctgggc</td><td>caccgtttgg</td><td>aaagctagtg</td><td> 1440</td>

<td>gttcagagtt</td><td>ctatagattc tagtgcattc aagcacaatg</td><td>gcacggttga</td><td>atgtaaggct</td><td> 1500</td>

<td>tacaacgatg</td><td>tgggcaagac ttctgcctat tttaactttg</td><td>catttaaagg</td><td>taacaacaaa</td><td> 1560</td>

<td>gagcaaatcc</td><td>atccccacac cctgttcact cctttgctga</td><td>ttggtttcgt</td><td>aatcgtagct</td><td> 1620</td>

<td>ggcatgatgt</td><td>gcattattgt gatgattctg acctacaaat</td><td>atttacagaa</td><td>acccatgtat</td><td> 1680</td>

<td>gaagtacagt</td><td>ggaaggttgt tgaggagata aatggaaaca</td><td>attatgttta</td><td>catagaccca</td><td> 1740</td>

<td>acacaacttc</td><td>cttatgatca caaatgggag tttcccagaa</td><td>acaggctgag</td><td>ttttgggaaa</td><td> 1800</td>

<td>accctgggtg</td><td>ctggagcttt cgggaaggtt gttgaggcaa</td><td>ctgcttatgg</td><td>cttaattaag</td><td> 1860</td>

<td>tcagatgcgg</td><td>ccatgactgt cgctgtaaag atgctcaagc</td><td>cgagtgccca</td><td>tttgacagaa</td><td> 1920</td>

<td>cgggaagccc</td><td>tcatgtctga actcaaagtc ctgagttacc</td><td>ttggtaatca</td><td>catgaatatt</td><td> 1980</td>

<td>gtgaatctac</td><td>ttggagcctg caccattgga gggcccaccc</td><td>tggtcattac</td><td>agaatattgt</td><td> 2040</td>

<td>tgctatggtg</td><td>atcttttgaa ttttttgaga agaaaacgtg</td><td>attcatttat</td><td>ttgttcaaag</td><td> 2100</td>

<td>caggaagatc</td><td>atgcagaagc tgcactttat aagaatcttc</td><td>tgcattcaaa</td><td>ggagtcttcc</td><td> 2160</td>

<td>tgcagcgata</td><td>gtactaatga gtacatggac atgaaacctg</td><td>gagtttctta</td><td>tgttgtccca</td><td> 2220</td>

<td>accaaggccg</td><td>acaaaaggag atctgtgaga ataggctcat</td><td>acatagaaag</td><td>agatgtgact</td><td> 2280</td>

<td>cccgccatca</td><td>tggaggatga cgagttggcc ctagacttag</td><td>aagacttgct</td><td>gagcttttct</td><td> 2340</td>

<td>taccaggtgg</td><td>caaagggcat ggctttcctc gcctccaaga</td><td>attgtattca</td><td>cagagacttg</td><td> 2400</td>

<td>gcagccagaa</td><td>atatcctcct tactcatggt cggatcacaa</td><td>agatttgtga</td><td>ttttggtcta</td><td> 2460</td>

<td>gccagagaca</td><td>tcaagaatga ttctaattat gtggttaaag</td><td>gaaacgctcg</td><td>actacctgtg</td><td> 2520</td>

<td>aagtggatgg</td><td>cacctgaaag cattttcaac tgtgtataca</td><td>cgtttgaaag</td><td>tgacgtctgg</td><td> 2580</td>

<td>tcctatggga</td><td>tttttctttg ggagctgttc tctttaggaa</td><td>gcagccccta</td><td>tcctggaatg</td><td> 2640</td>

<td>ccggtcgatt</td><td>ctaagttcta caagatgatc aaggaaggct</td><td>tccggatgct</td><td>cagccctgaa</td><td> 2700</td>

<td>cacgcacctg</td><td>ctgaaatgta tgacataatg aagacttgct</td><td>gggatgcaga</td><td>tcccctaaaa</td><td> 2760</td>

<td>agaccaacat</td><td>tcaagcaaat tgttcagcta attgagaagc</td><td>agatttcaga</td><td>gagcaccaat</td><td> 2820</td>

<td>catatttact</td><td>ccaacttagc aaactgcagc cccaaccgac</td><td>agaagcccgt</td><td>ggtagaccat</td><td> 2880</td>

<td>tctgtgcgga</td><td>tcaattctgt cggcagcacc gcttcctcct</td><td>cccagcctct</td><td>gcttgtgcac</td><td> 2940</td>

<td>gacgatgtct</td><td>gagcagaatc agtgtttggg tcacccctcc</td><td>aggaatgatc</td><td>tcttcttttg</td><td> 3000</td>

PZ / 5321 / AG

ΕΡ2 935 248 Β1

201

<td>gcttccatga</td><td>tggttatttt</td><td>cttttctttc</td><td>aacttgcatc</td><td>caactccagg</td><td>atagtgggca</td><td> 3060</td>

<td>ccccactgca</td><td>atcctgtctt</td><td>tctgagcaca</td><td>ctttagtggc</td><td>cgatgatttt</td><td>tgtcatcagc</td><td> 3120</td>

<td>caccatccta</td><td>ttgcaaaggt</td><td>tccaactgta</td><td>tatattccca</td><td>atagcaacgt</td><td>agcttctacc</td><td> 3180</td>

<td>atgaacagaa</td><td>aacattctga</td><td>tttggaaaaa</td><td>gagagggagg</td><td>tatggactgg</td><td>gggccagagt</td><td> 3240</td>

<td>cctttccaag</td><td>gcttctccaa</td><td>ttctgcccaa</td><td>aaatatggtt</td><td>gatagtttac</td><td>ctgaataaat</td><td> 3300</td>

<td>ggtagtaatc</td><td>acagttggcc</td><td>ttcagaacca</td><td>tccatagtag</td><td>tatgatgata</td><td>caagattaga</td><td> 3360</td>

<td>agctgaaaac</td><td>ctaagtcctt</td><td>tatgtggaaa</td><td>acagaacatc</td><td>attagaacaa</td><td>aggacagagt</td><td> 3420</td>

<td>atgaacacct</td><td>gggcttaaga</td><td>aatctagtat</td><td>ttcatgctgg</td><td>gaatgagaca</td><td>taggccatga</td><td> 3480</td>

<td>aaaaaatgat</td><td>ccccaagtgt</td><td>gaacaaaaga</td><td>tgctcttctg</td><td>tggaccactg</td><td>catgagcttt</td><td> 3540</td>

<td>tatactaccg</td><td>acctggtttt</td><td>taaatagagt</td><td>ttgctattag</td><td>agcattgaat</td><td>tggagagaag</td><td> 3600</td>

<td>gcctccctag</td><td>ccagcacttg</td><td>tatatacgca</td><td>tctataaatt</td><td>gtccgtgttc</td><td>atacatttga</td><td> 3660</td>

<td>ggggaaaaca</td><td>ccataaggtt</td><td>tcgtttctgt</td><td>atacaaccct</td><td>ggcattatgt</td><td>ccactgtgta</td><td> 3720</td>

<td>tagagtaga</td><td>ttaagagcca</td><td>tataagtttg</td><td>aaggaaacag</td><td>ttaataccat</td><td>tttttaagga</td><td> 3780</td>

<td>aacaatataa</td><td>ccacaaagca</td><td>cagtttgaac</td><td>aaaatctcct</td><td>cttttagctg</td><td>atgaacttat</td><td> 3840</td>

<td>tctgtagatt</td><td>ctgtggaaca</td><td>agcctatcag</td><td>cttcagaatg</td><td>gcattgtact</td><td>caatggattt</td><td> 3900</td>

<td>gatgctgttt</td><td>gacaaagtta</td><td>ctgattcact</td><td>gcatggctcc</td><td>cacaggagtg</td><td>ggaaaacact</td><td> 3960</td>

<td>gccatcttag</td><td>tttggattct</td><td>tatgtagcag</td><td>gaaataaagt</td><td>ataggtttag</td><td>cctccttcgc</td><td> 4020</td>

<td>aggcatgtcc</td><td>tggacaccgg</td><td>gccagtatct</td><td>atatatgtgt</td><td>atgtacgttt</td><td>gtatgtgtgt</td><td> 4080</td>

<td>agacaaatat</td><td>ttggaggggt</td><td>atttttgccc</td><td>tgagtccaag</td><td>agggtccttt</td><td>agtacctgaa</td><td> 4140</td>

<td>aagtaacttg</td><td>gctttcatta</td><td>ttagtactgc</td><td>tcttgtttct</td><td>tttcacatag</td><td>ctgtctagag</td><td> 4200</td>

<td>tagcttacca</td><td>gaagcttcca</td><td>tagtggtgca</td><td>gaggaagtgg</td><td>aaggcatcag</td><td>tccctatgta</td><td> 4260</td>

<td>tttgcagttc</td><td>acctgcactt</td><td>aaggcactct</td><td>gttatttaga</td><td>ctcatcttac</td><td>tgtacctgtt</td><td> 4320</td>

<td>ccttagacct</td><td>tccataatgc</td><td>tactgtctca</td><td>ctgaaacatt</td><td>taaattttac</td><td>cctttagact</td><td> 4380</td>

<td>gtagcctgga</td><td>tattattctt</td><td>gtagtttacc</td><td>tctttaaaaa</td><td>caaaacaaaa</td><td>caaaacaaaa</td><td> 4440</td>

<td>aactcccctt</td><td>cctcactgcc</td><td>caatataaaa</td><td>ggcaaatgtg</td><td>tacatggcag</td><td>agtttgtgtg</td><td> 4500</td>

<td>ttgtcttgaa</td><td>agattcaggt</td><td>atgttgcctt</td><td>tatggtttcc</td><td>cccttctaca</td><td>tttcttagac</td><td> 4560</td>

<td>tacatttaga</td><td>gaactgtggc</td><td>cgttatctgg</td><td>aagtaaccat</td><td>ttgcactgga</td><td>gttctatgct</td><td> 4620</td>

<td>ctcgcacctt</td><td>tccaaagtta</td><td>acagattttg</td><td>gggttgtgtt</td><td>gtcacccaag</td><td>agattgttgt</td><td> 4680</td>

<td>ttgccatact</td><td>ttgtctgaaa</td><td>aattcctttg</td><td>tgtttctatt</td><td>gacttcaatg</td><td>atagtaagaa</td><td> 4740</td>

<td>aagtggttgt</td><td>tagttataga</td><td>tgtctaggta</td><td>cttcaggggc</td><td>acttcattga</td><td>gagttttgtc</td><td> 4800</td>

<td>ttgccatact</td><td>ttgtctgaaa</td><td>aattcctttg</td><td>tgtttctatt</td><td>gacttcaatg</td><td>atagtaagaa</td><td> 4860</td>

<td>aagtggttgt</td><td>tagttataga</td><td>tgtctaggta</td><td>cttcaggggc</td><td>acttcattga</td><td>gagttttgtc</td><td> 4920</td>

PZ / 5321 / AG

ΕΡ2 935 248 Β1

202

<td>aatgtctttt gaatattccc</td><td>aagcccatga</td><td>gtccttgaaa</td><td>atatttttta</td><td>tatatacagt</td><td> 4980</td>

<td>aactttatgt gtaaatacat</td><td>aagcggcgta</td><td>agtttaaagg</td><td>atgttggtgt</td><td>tccacgtgtt</td><td> 5040</td>

<td>ttattcctgt atgttgtcca</td><td>attgttgaca</td><td>gttctgaaga</td><td>attc</td><td></td><td> 5084</td>

PZ / 5321 / AG

EP 2 935 248 B1

203