Bacterium for use as a probiotic for nutritional and medical applications

The invention relates to bacteria of the species Roseburia hominis and its various nutritional and therapeutic uses.

BACKGROUND OF THE INVENTION [0002] The human intestine, which is believed to be sterile during fetal development, is initially affected by a wide range of maternal and environmental microbes. The subsequent colonization and further consequences in the intestine keep dynamic character in the first years of life, after which the microbiota begins to resemble the adult microbiota and gains relative stability (1). The microbiota of the human intestine includes more than 500 different filotypes, essentially belonging to the two main bacterial groups, Bacteroidetes and Firmicutes (2). Successful symbiotic relationships resulting from the colonization of human intestine by bacteria have resulted in a wide range of metabolic, structural, protective and other beneficial functions.

The increased metabolic activity of the colonized intestine ensures that food components that would otherwise be non-digestible are broken down with the release of by-products, providing the host with an important source of nutrients. Similarly, the importance of intestinal microbiota for immunological immunity is well known, as exemplified by the compromised immune system in germfree animals (GF) (germ-free) whose function is reproduced after introduction of commensal bacteria (3-5).

[0003] In sharp contrast to the production of secretory intestinal immunoglobulin A, which is due to microbial colonization as such (6, 7), there is development and differentiation of T lymphocytes, for which processes seem necessary colonization by specific commensal microorganisms. Species of the genus Clostridium, in particular spore-forming SFB (segmented filamentous bacteria), seem to be the main driving force for the maturation of intestinal Th1, Th17 and Treg (8, 9) lymphocytes. However, recent studies have shown that other intestinal bacteria, including those specific to altered Schaedler flora, may induce de novo dextrogen production of Treg lymphocytes, whereas monocollonation by Bacteroides fragilis may compensate for disturbed Th1 / Th2 balance in germfree mice by supporting Treg cell expansion (5). .

10).

[0004] This invention seeks to identify which other intestinal bacteria may modulate the metabolic activity of the gut and / or be relevant in processes regulating the immune system.

SUMMARY OF THE INVENTION [0005] The invention focuses on the activity of bacteria from the species Roseburia hominis, belonging to Firmicutes. Studies conducted by the applicant have shown that this species of bacteria plays an important role in the regulation of the immune system and metabolic activity in the intestine, as well as that affects the genes of appetite and satiety. The roles of bacterial genes involved in colonization and adaptation to the mouse intestine, as well as host genes reacting to colonization by this bacterium, are described in more detail below.

[0006] Aspects of the invention, together with preferred embodiments, are set out in the accompanying claims. [0007] A first aspect of the invention relates to bacteria of the species

Roseburia hominis for use in the regulation of the patient's immune system.

[0008] Another aspect of the invention relates to Roseburia hominis species for use in the treatment of a disorder selected from inflammatory disorder, immune disorder and intestinal disorders.

[0009] Another aspect of the invention relates to Roseburia hominis species for use in improving bowel health by restoring homeostasis in the immune system.

[0010] Another aspect of the invention relates to bacteria of the species

Roseburia hominis for use in improving intestinal microbiota in a patient.

Another aspect of the invention relates to bacteria of the species Roseburia hominis for use in the regulation of the patient's innate immune system.

[0012] Another aspect of the invention relates to bacteria of the species Roseburia hominis for use in the regulation of the adaptive immune system of a patient.

[0013] Another aspect of the invention relates to Roseburia hominis species for use in supporting lymphocytes

Treg and immune tolerance of the patient.

[0014] Another aspect of the invention relates to bacteria of the species Roseburia hominis for use in medicine.

[0015] Another aspect of the invention relates to a pharmaceutical composition comprising Roseburia hominis species, a pharmaceutically acceptable excipient, carrier or diluent.

[0016] Another aspect of the invention relates to a nutritional supplement comprising Roseburia hominis bacteria and a nutritional excipient, carrier or diluent.

[0017] Another aspect of the invention relates to a probiotic composition comprising bacteria of the species Roseburia hominis.

[0018] Another aspect of the invention relates to a feed, a food product, a nutritional supplement, a food supplement or a food additive containing Roseburia hominis bacteria.

[0019] Another aspect of the invention relates to a method of preparing a pharmaceutical composition of the invention, said method comprising mixing the Roseburia hominis species with a pharmaceutically acceptable adjuvant, carrier or diluent.

[0020] Another aspect of the invention relates to a method of producing a food supplement according to the invention, said method comprising mixing the bacteria of the species Roseburia hominis with a nutritional excipient, carrier or diluent.

[0021] Another aspect of the invention relates to Roseburia hominis species for use in maintaining homeostasis in the patient's immune system.

DETAILED DESCRIPTION OF THE INVENTION [0022] As mentioned above, one aspect of the invention relates to Roseburia hominis bacteria for use in one or more of:

- treatment of disorders of the immune system;

- treatment of intestinal disorders;

- improving intestinal microbiota;

- regulation of the patient's innate immune system;

<td>- regulation</td><td>adaptive</td><td>the</td><td colspan="2">the immune</td>

<td>patient;</td><td></td><td></td><td></td><td></td>

<td>- support</td><td>lymphocyte</td><td>Treg</td><td>and</td><td>tolerance</td>

immune response;

- improving the intestinal health of the patient; and / or

- maintaining homeostasis in the patient's immune system.

Roseburia hominis [0023] Roseburia hominis, the recently described commensal intestinal anaerobe from the phylogenetic cluster XIVa of the Firmicutes type, belongs to the dominant group of bacteria in the human intestine and is also the main producer of butyrate (11). The current applicant has established the complete genome sequence and described the genome of this bacterium. Further research concerned the transcriptomic response for both bacteria and host in germfree mice colonized with one microorganism - R. hominis. The role of bacterial genes involved in colonization and adaptation to the mouse intestine as well as host genes reacting to colonization by this bacterium are described herein.

[0024] To provide the applicant, Roseburia hominis activity is very specific. Studies have shown that the significant genomes of the Roseburia species are very different, which indicates different functionality. Indeed, experiments have shown that Clostridium XIVa cluster bacteria, including the species Roseburia intestinalis, Roseburia hominis and

Eubacterium rectale (all of which produce butyrate), unexpectedly induced very different and different effects in intestinal cells.

[0025] In one preferred embodiment, the bacterial species is a strain deposited, according to the terms of the Budapest Treaty, in the National Collections of Industrial, Food and Marine Bacteria (NCIMB) at NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, UK, AB21 9YA, October 21, 2004 on behalf of the Rowett Research Institute of Nutrition and Health, University of Aberdeen, Greenburn Road, Aberdeen, AB21 9SB, Scotland, UK, NCIMB 14029 access number^T Roseburia hominis A2-183^T (DSM = 16839^T).

[0026] The bacterial species is preferably Roseburia hominis, as described in Duncan, SH, Aminov, RI, Scott, KP, Louis, P., Stanton, TB, &amp; Flint, HJ (2006) Int. J. Syst. Evol. Microbiol. 56: 2437-2441.

[0027] In one preferred embodiment, the bacterial species is in the form of a live bacterial population, a lyophilized bacterial population, a non-viable bacterial preparation, or cell components thereof. Preferably, where the bacterial species is in the form of a non-viable bacterial preparation, it is selected from bacteria killed by high temperature, irradiated bacteria and lysed bacteria.

[0028] In one preferred embodiment, the bacterial species is in the form of live bacteria or cellular components thereof. [0029] In one preferred embodiment, the bacterial species is in an isolated form. The term "isolated" as used herein means isolated from its native environment.

[0030] In one preferred embodiment, the bacterial species is in a biologically pure form. As used herein, the term "biologically pure" refers to a laboratory culture that is substantially free of other species of organisms. Preferably, the bacterial species is in the form of a culture of one species of the organism.

[0031] The invention also encompasses the use of mutants of a bacterial species or strains as described herein. The term "mutant" as used herein includes derived bacterial strains with at least 93% homology, preferably at least 96% homology, more preferably 98% homology with the polynucleotide sequence of the reference strain, but further comprising mutations in other sequences of the bacterial genome. Mutants can be obtained by genetic engineering techniques that alter the genetic material of the strains of the invention or recombine the genetic material of the strains of the invention with other molecules. Typically, for the preparation of such mutant strains, one skilled in the art can use conventional mutagenesis techniques, such as UV irradiation or exposure to mutagenic chemical products.

[0032] As used herein, the term "mutations" includes mutations that are natural or induced, including at least single base changes, including deletions, insertions, transversions, and other modifications known to those skilled in the art, including genetic modifications introduced into the parent nucleotide or parent amino acid sequence from while maintaining at least 50% homology to the parent sequence. Preferably, the sequence containing the mutation or mutations has at least 60%, more preferably at least 75%, even more preferably 85% homology with the parent sequence. The "homology" of the sequences used herein can be determined using standard techniques known to those skilled in the art. For example, homology can be determined using the online homology determination algorithm, the "BLAST" program, widely available at http): // www.

[0033] The invention also encompasses the use of homologues of the bacterial species or strains described herein. The term "homolog" as used herein refers to a bacterial strain with a nucleotide sequence having a degree of sequence identity or sequence homology with the nucleotide sequence of the parent bacterial strain (hereinafter referred to as "homologous sequence (homologous sequences)"). The term "homologous" herein means an entity having a certain homology with the nucleotide sequence of the patient. The term "homology" can be equal to "identity" here.

In this context, it is intended that the homologous sequence comprises a nucleotide sequence which may be at least 50, 60, 70, 75, 80, 85 or 90% identical, preferably at least 95%, 97%, 98 % or 99% identical, with the nucleotide sequence of the parent bacterial strain (sequence from the patient).

[0035] Homology comparisons can be made visually or more typically by means of readily available sequence comparison programs. These commercially available computer programs can calculate% homology between two or more sequences.

[0036] The homology percentage can be calculated from contiguous sequences, i.e. one sequence is aligned with another sequence and each amino acid in one sequence is directly compared to the corresponding amino acid in the other sequence, one residue after the other. This is called "no gap" sequence matching. Typically, such matches without gaps are carried out only on relatively short residue numbers.

[0037] Although it is a very simple and coherent method, it does not take into account that e.g. in another identical sequence pair, one insertion or deletion will cause that further amino acid residues will be forced out of the match, which will potentially lead to a large decrease% homology when performing global sequence alignment.

[0038] Thus, the calculation of the maximum% homology first requires obtaining the optimal sequence alignment, taking into account gap penalties. A suitable computer program for performing such sequence alignment is Vector NTI (Invitrogen Corp.). Examples of software that can perform sequence comparison include, e.g., the BLAST software package (see, Ausubel et al. 1999 Short Protocols in Molecular Biology, 4th edition, Chapter 18), BLAST 2 (see, FEMS Microbiol Lett 1999 174 (2): 247-50; FEMS Microbiol Lett 1999 177 (1): 187-8), FASTA (Altschul et al. 1990 J. Mol. Biol. 403-410) and AlignX. What

<td colspan="2">At least BLAST, BLAST 2</td><td>and</td><td>FASTA</td><td>are</td><td>available to</td><td>searched</td>

<td colspan="4">offline and online (see, Ausubel and</td><td>in</td><td>. 1999, pp.</td><td>7-58 to 7-</td>

<td>60).</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="4">Preferably, the degree of identity,</td><td>in</td><td>regards</td><td>to the sequence</td>

<td>nucleotide</td><td>determines</td><td>himself</td><td>on</td><td>What</td><td>least</td><td>20 continuous</td>

<td>nucleotides,</td><td>favorably</td><td></td><td>on</td><td>What</td><td>least</td><td>30 continuous</td>

<td>nucleotides,</td><td>favorably</td><td></td><td>on</td><td>What</td><td>least</td><td>40 continuous</td>

<td>nucleotides,</td><td>favorably</td><td></td><td>on</td><td>What</td><td>least</td><td>50 continuous</td>

<td>nucleotides,</td><td>favorably</td><td></td><td>on</td><td>What</td><td>least</td><td>60 continuous</td>

<td>nucleotides,</td><td>favorably</td><td></td><td colspan="2">for what</td><td>least</td><td>100 continuous</td>

<td>nucleotides.</td><td>preferably,</td><td colspan="2">degree</td><td colspan="2">identity in</td><td>regards</td>

the nucleotide sequence can be determined on the entire sequence.

[0039] Traditional identification of bacteria based on phenotypic traits is not generally as accurate as identification based on genotypic methods. A comparative genetic technique has become the comparison of the bacterial 16S rRNA gene sequence and allows the identification of new strains by comparing the sequences with known bacterial DNA sequences using the BLAST program (<a href="http://blast.ncbi.nlm.nih.giov/Blast.cgi">http: //blast.ncbi.nlm.nih.giov/Blast.cgi</a>). The sequence of the gene in 16S rRNA bacteria is universal and thus you can measure the relationship with many different bacteria. In general, the comparison of the 16S rRNA sequence allows to distinguish organisms at the level of the genus in all major types of bacteria, and in addition to the classification of strains at many levels, including at the level of the species and subspecies. The sequence of the 16S rRNA gene was determined for many strains. GenBank, the largest database of nucleotide sequences, has over 20 million deposited over 20 million deposited sequences, over 90,000 of which are 16S rRNA gene sequences. This means that there are many previously deposited sequences with which the sequence of an unknown strain can be compared.

[0040] The term "16S rRNA identity" as used herein refers to the percent identity with a known bacterial strain. In one preferred embodiment, the bacterial strain has a 16S rRNA identity of at least 99.5% with the strain deposited under the above accession number.

[0041] The invention also encompasses mutant strains that can be obtained from the aforementioned deposited strain and strains having DNA-DNA homology of at least 70% and / or 16S RNA identity of at least 99.5% with the strain deposited at the above accession number.

[0042] In the context of this invention, the term "DNA-DNA homology" refers to how closely related two or more separate DNA strands are related to each other, based on their nucleotide sequence. Typically, this is measured in the sense of their% identity. In one preferred embodiment, the bacterial strain has a DNA-DNA homology of at least 70% with the strain deposited at the above accession number.

[0043] In one highly preferred embodiment, the bacterial strain has a DNA-DNA homology of at least 70% and a 16S rRNA identity of at least 99.5% with the strain deposited at the above accession number.

Therapeutic applications [0044] Another aspect of the invention relates to a bacterial species

R. hominis for use in medicine.

[0045] More specifically, Roseburia hominis bacteria are for use in the treatment of a disorder selected from inflammatory disorder, immune disorder and intestinal disorders in a patient.

[0046] As used herein, the term "drug" includes drugs for use in both human and animal, in medicine and veterinary medicine. In addition, the term "drug" as used herein means any substance that provides therapeutic and / or beneficial effects. The term "drug" as used herein is not necessarily limited to those substances that require a Marketing Authorization, but may include substances that can be used in cosmetics, nutraceuticals, foods (including food and beverages, e.g.), probiotic cultures, supplements nutritional and natural remedies. In addition, the term "drug" as used herein includes a product designed to be incorporated into animal feed, e.g. livestock feed and / or pet food.

[0047] In one preferred embodiment of the invention, the disorder is selected from an irritable bowel syndrome (IBS), colitis, inflammatory bowel disorder (IBD), including Crohn's disease and ulcerative colitis, intestinal tank inflammation, functional dyspepsia, functional constipation, functional diarrhea (including antibiotic-associated diarrhea, traveler's diarrhea and diarrhea), functional abdominal pain, functional bloating, epigastric pain syndrome, postprandial disorders, gastroesophageal reflux disease ( gastrointestinal reflux disease, GERD), autoimmune diseases such as diabetes, arthritis, multiple sclerosis and psoriasis, allergies, atopic diseases such as atopic dermatitis,necrotizing enterocolitis, other infections and their combinations.

[0048] In one particularly preferred embodiment, the disorder is an inflammatory disorder. Preferably, the expression of proinflammatory genes is inhibited in the host patient. Further details of these tests are presented below.

[0049] More preferably, the inflammatory disorder is colitis, even more preferably, Crohn's disease, ulcerative colitis or inflammation of the intestinal reservoir.

[0050] In one particularly preferred embodiment, the intestinal disorder is IBS. The exact pathophysiology of IBS remains to be determined. Recent studies have described mucositis and changes in intestinal microbiota in patients with IBS and correlation of the disease with intestinal infections.

[0051] In one particularly preferred embodiment, the intestinal disorder is IBD. Preferably, the expression of the barrier genes is increased in the host patient. Further details of these tests are presented below.

[0052] In one particularly preferred embodiment, the intestinal disorder is Crohn's disease.

[0053] In one particularly preferred embodiment, the disorder is a disorder of the immune system. Preferably, the immune disorder is selected from ulcerative colitis, intestinal tank inflammation, other autoimmune conditions including rheumatoid arthritis, psoriasis, multiple sclerosis, allergies including celiac disease, atopic dermatitis and rhinitis.

[0054] In one embodiment, the Roseburia hominis bacteria are for use in the regulation of the immune system of a patient. It is known that the regulation of the immune system by the bacterial species is strongly species-specific (8). In particular, the action of bacteria from clusters XIVa and VI regulating the immune system is very complicated and independent of the production of butyrate (41).

[0055] In one preferred embodiment, the innate immune system of the patient is modulated.

[0056] In another preferred embodiment, the adaptive immune system of the patient is modulated towards regulating the immune system (rather than activating the immune system, thereby reducing inflammation).

[0057] Another aspect of the invention relates to Roseburia hominis bacteria for improving intestinal microbiota in a patient.

[0058] The term "intestinal microbiota" refers to microorganisms that live in the gastrointestinal tract of host animals. These microorganisms perform a wide range of metabolic, structural, protective and other beneficial functions. As used herein, the phrase "improving intestinal microbiota" refers to increasing the number and / or broadening of the type of microorganisms present in the host intestine and / or increasing the activity of said microorganisms in the sense of their metabolic, structural, protective and other beneficial functions.

[0059] Preferably, Roseburia hominis colonizes the colon and / or small intestine, more preferably the colon.

[0060] In a preferred embodiment, Roseburia hominis regulates the expression of at least one gene responsible for mobilization or chemotaxis.

[0061] More preferably, Roseburia hominis activates the expression of at least one gene responsible for mobilization or chemotaxis. Even more preferably, the gene responsible for mobilization or chemotaxis is selected from such as MobA and MobL.

[0062] In another preferred embodiment, Roseburia hominis regulates the expression of at least one gene selected from FlaA1, FlaA2, Fla3 and FlaB.

[0063] In inflammatory bowel disease, specific serum antibodies against FLA-type proteins exist. Thus, in one preferred embodiment, Roseburia hominis is for use in the treatment of inflammatory bowel disease.

[0064] In another preferred embodiment, Roseburia hominis regulates the expression of one or more of acetyl-CoA acetyltransferase, 3-hydroxyacylCoA dehydrogenase, butyryl-CoA dehydrogenase, beta-subunit of electron-transferring flavoprotein, and the electron-transferring alpha-subunit.

[0065] Another aspect of the invention relates to Roseburia hominis bacteria for regulating the innate immune system of a patient.

[0066] As used herein, the term "innate immune system", also known as "non-specific immune system", includes cells and mechanisms that provide the host with an immediate defense, in a non-specific manner, against infection by other organisms. This means that cells in the congenital system recognize and respond to pathogens in a general way, but unlike the adaptive immune system, they do not provide the host with long-term or protective immunity.

[0067] As used herein, the term "regulation of the innate immune system" means to induce the activity of the innate immune system and / or to increase the level of activity relative to the level of basic activity, so as to promote homeostasis in the immune system.

[0068] The loss or dysregulation of innate immune functions due to loss of epithelial barrier, innate immune peptides such as defensins, chemokines and cytokines, or defective TLR signaling has been associated with an increased risk of inflammatory diseases in several body organs, including the intestine. Such diseases include inflammatory bowel disease. Thus, in one highly preferred embodiment, Roseburia hominis is for use in the treatment of inflammatory bowel disease.

[0069] In a preferred embodiment, Roseburia hominis regulates the expression of at least one gene selected from Tlr5, Tlr1, Vnn1, Defb37, Pla2g, Muc16, ltln, Sprr1a, Cldn4, Pmp22, Crb3, Magi3, Marveld3, Mpp7, Defcr20, Pcgf2 , Ltbp4, Igsf8 and Tcfe2a. Many of these genes are intestinal barrier genes and antimicrobial agents, and therefore act by acting by reducing the invasiveness of intestinal pathogens as well as decreasing the number of viable pathogens. [0070] Another aspect of the invention relates to Roseburia hominis species for regulating the adaptive immune system of a patient.

[0071] As used herein, the term "adaptive immune system", otherwise known as "specific immune system", refers to highly specialized cells and systemic processes that eliminate the growth of or prevention of pathogens. Adaptive immune responses provide the vertebrate immune system with the ability to recognize and remember specific pathogens (to create immunity) and to perform stronger attacks each time it encounters a pathogen.

[0072] As used herein, the term "regulating the adaptive immune system" means inducing the activity of the adaptive immune system and / or enhancing homeostasis mechanisms in the immune system by increasing the level of activity relative to the basal activity level. Preferably, the adaptive immune system is modulated to regulate the immune system (rather than activate the immune system, thus reducing inflammation).

[0073] Defects and disorders associated with the adaptive immune system, especially with respect to the lymphocyte function with multiple inflammatory diseases and T-cell responses associated with

T, are associated with autoimmune.

Th1, Th2 and Th17 lymphocytes are associated with atopic, inflammatory and autoimmune diseases. Therapies that support or increase regulatory T cell populations (Treg lymphocytes) are important in controlling diseases caused by excessive Th1, Th2 and Th17 lymphocyte responses.

[0074] In a preferred embodiment, Roseburia hominis activates at least one immune response gene in the colon or small intestine.

[0075] In a preferred embodiment, Roseburia hominis regulates the adaptive immune system by modulating gene expression associated with T-cell regulation, more preferably in the colon. More preferably, Roseburia hominis induces T regulatory lymphocytes (Treg lymphocytes). Increasing Treg counts will overcome the effects of other T-effector cells, such as Th1, Th17 and Th2, which drive inflammation, autoimmunity and allergic / atopic conditions. Thus, this feature of R. hominis can be used to combat many diseases in which the Teff / Treg lymphocyte balance has been disturbed, e.g. Crohn's disease and ulcerative colitis.

[0076] In a particularly preferred embodiment, Roseburia hominis activates the expression of at least one gene selected from genes such as Ly6g6c and Ly6g6e in the ascending colon.

The decrease in the expression of Ly6g6c and Ly6g6e increases the risk of infection, both the intestine and the respiratory tract, and is associated with diseases such as neutropenia. Thus, in a preferred embodiment, Roseburia hominis is used in the treatment of neutropenia.

[0077] Another aspect of the invention relates to Roseburia hominis species for use in maintaining homeostasis in the patient's immune system. The expression "preservation of homeostasis in the immune system" as used herein refers to the self-regulation of the body's immune system to maintain food tolerability or the stability of the immune system in response to changing conditions. The term "food tolerance" refers to normal immune responses to food and commensal bacteria in a healthy intestine. They are lost in celiac disease and inflammatory diseases of the intestine, such as Crohn's disease and ulcerative colitis. Thus, in a particularly preferred embodiment, Roseburia hominis is used in the treatment of celiac disease and inflammatory diseases such as Crohn's disease and ulcerative colitis.

[0078] As used herein, the term "appetite regulating" refers to the ability to modulate the host (i.e., to increase or decrease) the need to eat food. Preferably, Roseburia hominis exerts a stimulatory effect on the appetite of the host by inhibiting the expression of genes associated with appetite suppression. Preferably, Roseburia hominis inhibits the expression of at least one gene selected from the genes Agt, Cartpt, Cck, Cxcl12 and Gcg. More preferably, Roseburia hominis inhibits the expression of the satiety hormone Cck and Gcg genes.

[0079] The bacterial species of the invention can also be used in prophylactic applications. In prophylactic applications, the bacterial species or compositions of the invention are administered to a patient susceptible to, or otherwise at risk for, a particular disease, in an amount that is sufficient to at least partially reduce the risk of reducing the risk of developing the disease. Such an amount is defined as being a "prophylactically effective dose". The exact amounts depend on many factors specific to the patient, such as the patient's health and weight.

[0080] The present invention is further described by the following figures, where:

Figure 1 shows the number and location of R. hominis in the ascending colon. (A) Murine colon colonized by R. hominis showing close association of bacteria with host epithelium; use of A2-183 FISH probe. Original x630 magnification. (B) The PCR method using primers specific for R. hominis showed a strong positive signal in fecal DNA after colonization, while the feces of GF animals gave a negative result for the presence of any bacteria. (C) PCR analysis with real-time product detection showing the level of colonization by R. hominis / mg of feces.

Figure 2 indicates the sequence and annotation of the R. hominis genome. (A) Circular genome map of R. hominis with the location of the PCR experiments indicated in the target areas for primers. Paths on the genome map starting from external path 0: path 0 (blue) PCR experiments with real-time detection of the products indicated by numbered tags; lane 1 - (light blue) CDS Forward sequence; Lane 2 (light blue) CDS Reverse sequence; lane 3 (blue) rRNA; path 4 - (green) tRNA; path 5 (red) STS marker regions being the target of the PCR reaction with real-time detection of products; graph 1 21 graph 1 content in GC animals; graph 2 - statistical error for GC animals.

R. hominis genome.

B)

Functional annotation

Figure 3 identifies transcripts expressed in a differential manner in R. hominis after colonization and adaptation to the mouse intestine. (A) Bacterial RNA isolated from the contents of the mouse cecum, labeled with dCTP-Cy3 or dCTP-Cy5 during cDNA synthesis and hybridized with microarray slides with an incorporated dye (dye swap technique). Data considered significant when microarray analysis revealed a fold change&gt; 2 and P &lt;0.05, 50 expressed in a differential gene (in vivo compared to in vitro conditions). (B) Evaluation of genes involved in conjugation / mobilization for PCR-transfer with real-time detection of products. (C) Evaluation of genes involved in motility and chemotaxis by PCR with real-time detection of products. (D) Western blot analysis of the ascending content of day 14. immunopurified with anti-Fla2 antibody purified using affinity properties (lane 1: ladder, lane 2-6: intestinal contents of animals 1-5, lane 7-8: empty, lane 9- 10: R. hominis biomass (positive control)). Photo of R. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with detection of products in real time. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. immunostained with anti-Fla2 antibody purified using affinity properties (lane 1: ladder, lane 2-6: intestinal contents of animals 1-5, lane 7-8: empty, lane 9-10: R. hominis biomass (positive control)). Photo of R. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with detection of products in real time. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. immunostained with anti-Fla2 antibody purified using affinity properties (lane 1: ladder, lane 2-6: intestinal contents of animals 1-5, lane 7-8: empty, lane 9-10: R. hominis biomass (positive control)). Photo of R. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with detection of products in real time. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. animal gut content 1-5, lane 7-8: empty, lane 9-10: R. hominis biomass (positive control)). Photo of R. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with detection of products in real time. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. animal gut content 1-5, lane 7-8: empty, lane 9-10: R. hominis biomass (positive control)). Photo of R. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with detection of products in real time. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with real-time detection of products. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. hominis showing flagella (black arrows) and (E) evaluation of genes involved in butyrate metabolism using PCR with real-time detection of products. (F) Analysis of R. hominis transcripts by PCR with detection of products in real time during in vitro exposure to human epithelial cells of the intestinal epithelial cells. The results of the PCR reaction with the detection of products in real time are the average repeats, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001.

three with mice 28. Columns

Figure 4 identifies transcripts expressed in a differential manner in the mouse gut after attachment of the only microorganism - R. hominis. (A) Analysis using Affymetrix microarrays of the differential expression of R. hominis colonized mouse genes compared to GF mice. Bar charts show the number of more and less expressed genes after 14 and 28 days. (B) Heat map obtained for the functionally expressed expressed genes in GF mice versus colonized R. hominis on days 14 and represent individual matrices and rows of specific genes of interest. Scoring Z represents the distance measure, in standard deviations, from the average. The relative value for each gene is shown by the intensity of the color, where green indicates greater expression and red represents less expression. (C) Gene evaluation by PCR with real-time detection of the products for which it was shown to be significantly different between mice colonized by R. hominis and GF mice. The results of the PCR reaction with the detection of products in real time are means from three replicates, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001.

Figure 5 shows the expression and location of T cell markers in the colon. Immunofluorescence and analysis of lamina propria cells labeled with anti-Ly6G antibodies

Ly6G (A), anti-CD3 (B) and anti-CD11b (C) in the lamina propria of GF mice and mice treated with R. hominis. * P &lt;0.05.

Figure 6 shows the anti-inflammatory action of R. hominis in an experimental model of colitis. IL-10KO mice received doses three times per week for 14 weeks. (A) In IL-10KO mice treated with untreated mice there was a large increase in the expression of all genes compared to wild-type mice, although the differential gene expression was lower in animals receiving R. hominis. The results of the PCR reaction with the detection of products in real time are means from three replicates, * P &lt;0.05, ** P &lt;0.01, *** P &lt;0.001. (B) Body weights of untreated IL-10KO animals and animals treated with R. hominis IL-10KO at the end of the study. (C) Ascending colon (hematoxylin / eosin staining) of IL-10KO animals and animals treated with R. hominis IL-10KO. Original magnification x100.

Figure 7 shows PCR analysis with the detection of real-time products of IL-10, IL-17 and IFN-γ mRNA levels.

The PCR reaction with real-time detection of the products was performed on ascending colon tissue to measure T-cell markers. The results of PCR with real-time detection of products are means from three replicates, * P &lt;0.05, ** P &lt;0.01.

Figure 8 shows the effect of attachment of the only microorganism - R. hominis in GF mice on body composition. An analysis of dry body weight and lipids in the carcass was carried out. (A) Dry masses of mouse carcasses with R. hominis attached were significantly greater than GF animal weights. (B) Further analysis of lipid analysis in the carcass showed that total obesity on day 14 was also significantly higher in animals treated with R. hominis.

Figure 9 shows a comparison of gene expression data for three strains of bacteria from cluster XIVa (Firmicutes), namely Roseburia hominis, E. rectale and Roseburia intestinalis.

Figure 10 indicates that Roseburia hominis induces A20, a negative regulator of NF-κB signaling with a strong anti-inflammatory effect, while other bacterial strains have no effect. The flagelline part of Roseburia hominis (FLA1 R. hominis) also induces A20 in contrast to the flagellate portion of Eubacterium rectale - a related bacterium. More specifically, Fig. 10 shows the fold of the A20 induction for E. rectale, R. hominis, FLA from E. rectale, FLA1 from R. hominis, EAV9, FLA from SV1400 compared to controls.

Figure 11 shows the distribution of categories within subsystems (Subsystem Category Distribution) for R. hominis A2-183 determined using the RAST platform, showing functional subsystems and the number of genes in each subcategory.

Figure 12 shows the distribution of categories within subsystems for R. inulinivorans DSM 16841 A2-183 determined using the RAST platform, depicting functional subsystems and the number of genes in each sub-category.

Figure 13 shows the distribution of categories within subsystems for R. intestinalis L1-82 determined using the platform

RAST, showing functional subsystems and the number of genes in each subcategory.

Figure 14 shows the distribution of categories within subsystems for R. intestinalis M50 / 1 determined using the RAST platform, depicting functional subsystems and the number of genes in each sub-category.

Figure 15 shows the distribution of categories within the subsystems for Eubacterium rectale, ATCC 33656, determined using the RAST platform, depicting functional subsystems and the number of genes in each sub-category.

R. hominis preferentially colonizes the colon [0081] Healthy adult C3H / HeN germfree mice (GF) were inoculated with R. hominis with three administrations by gavage on consecutive days. Effective colonization was achieved using an inoculum medium containing 3% ascorbic acid and 2% cysteine ​​to protect the bacteria from exposure to oxygen. Analysis of intestinal tissue by fluorescent in situ hybridization (FISH) revealed that R. hominis colonized both the small intestine and the colon, but there were many more in the colon. It was also found that the bacteria were tightly attached to the colon mucosa (Figure 1A). Colonization was then confirmed and quantified by PCR using primers specific for R. hominis with numbers close to 1 x 10¹⁰bacteria / g faeces (Figures 1B and 1C). GF animal excrements were negative for the presence of any bacteria.

that the closest relatives in the sense of the structure of the genome and function among the whole bacterial genomes is Eubacterium rectale (12), which is not unexpected due to the close taxonomic relationship of these organisms (11, 13). Comparative reconstruction of these two genomes with 1095 genes revealed that they differed approximately 25% of the genes. In particular, these differences included genes encoding important functions for interaction with the host. For example, genes from the category "Mobility and chemotaxis" coding for PiIB and PiIC proteins of the type IV fimbriae occurred in E. rectale but were absent in R. hominis, while the rod-shaped FIgC protein of the flagellar core protein, FIiE protein of the complex flagellum-core body, protein FlaB flagellin and FliG protein that activated the flagella were unique to R. hominis.

R. hominis reacts to the gut environment by activating mobilization and chemotaxis genes [0083] To determine the genes expressed in a differential manner by R. hominis in response to the host and diet combination, a microarray was constructed using 6000 PCR fragments from the sequence sequencing library small size. The validation of the PCR method with the detection of products in real time was carried out on 42 expressively expressed genes that cluster in specific regions of the R. hominis genome, as illustrated in Figure 2B. To distinguish the effects of the intestinal environment from the effects of food components, bacterial RNA was isolated from four different experimental conditions: (i) in vivo, from the cecum of mice with one type of microorganism attached; (ii) in vitro, from bacteria growing in culture media; (iii) in vitro, from bacteria growing in the presence of food components; and (iv) from bacteria incubated on the surface of confluent Caco-2 and HT-29 cells.

[0084] Fifty differentially expressed genes were identified (conditions in vivo compared to in vitro conditions) (Figure 3A). The most unexpected finding was the very large in vivo activation of the genes involved in the mobA- and mobL-like conjugation / mobilization for transfer (Figure 3B). The participation of such genes in transcriptional studies was unexpected, as no identifiable genes were assigned to the element "Fagi, profagi, transposons, transposons and plasmids" within the category of subsystems. This difference in detection and gene assignment is probably due to the recognized limitations of category subsystem annotations. The stimulating effect of compounds found in the diet was much less pronounced, which suggests that the intestinal environment, as such,

Other intestinal-induced subsystems included "Membrane transport", in particular magnesium transport and "Mobility and chemotaxis" including many methyl-accepting chemotactic proteins and genes of the flagella (Fig. 3C). R. hominis has many genes of flagellin flaA1, flaA2, flaA3 and flaB and, interestingly, growth in the mouse gut environment promoted the expression of flagellin in this bacterium as evidenced by Western blot analysis of bacteria isolated from colonized mice in vivo, for which analysis was used R. hominis specific anti-flagellin antibodies (Figure 3D). This is consistent with previous reports indicating that only some Firmicutes subgroups produce flagella in vivo (14).

As expected, the expression of genes responsible for catabolic metabolism in R. hominis in the intestinal environment was mostly influenced by compounds found in the diet (Figure 3E). Involved genes included acetylCoA acetyltransferase, 3-hydroxyacyl-CoA dehydrogenase, butyryl-CoA dehydrogenase and phosphoenolpyruvate carboxykinase [ATP]. Although the regulation of these genes depended mainly on the diet, at the later time point of sampling the host effect was also visible. Unexpectedly, the host environment inhibited certain genes involved in the metabolism of host-derived substances such as glucuronide, which is common in the carbohydrate chains of mucosal proteoglycans.

[0086] To further investigate the effect of adaptation to the host on R. hominis transcripts, in vitro stimulation of human intestinal epithelial cells (Caco-2 and HT-29) was performed. It showed that the expression of the mobAlmobL protein 1 gene from the category Conjugation / mobilization for transfer, which was induced by adaptation to the mouse intestine, was also increased in both cell lines (Figure 3F). Consistent with data from in vivo conditions, the MotA flagellin gene was activated in Caco-2 cells. Genes involved in butyrate metabolism showed differences in both cell lines, with inhibition observed in Caco-2 cells and activation in HT-29 cells.

R. hominis affects the T cell pathways, mainly in the colon [0087] Colonization of GF mice by R. hominis was correlated with increased gene expression in the intestine, which was the largest in the colon. (Fig. 4A). The differential expression was most marked on day 28 after colonization, with 159 activated genes and 143 inhibited genes. The number of differentially expressed genes in the small intestine on day 14 was similar to expression in the ascending colon with 79 activated genes and 119 inhibited genes. Differential expression in the small intestine was very low on day 28, according to the reduced level of colonization. The transcriptomic response differed at two time points, as demonstrated by the strong resolution of significant transcripts in heat map analysis (Figure 4B).

[0088] Most of the pathways that were observed on day 14 in the small intestine and ascending colon were grouped in the categories of cell differentiation, cell cycle regulation and tissue remodeling. Importantly, the immune response was one of the major pathways induced on day 28 in the ascending colon. The 36 pathways for which significant effects were observed in this category were mostly involved in the function of T lymphocytes and included the IL-10 signaling pathway, the ICOS pathway in the helper T lymphocyte and the regulation of T lymphocyte function by CTLA-4. The genes involved in these pathways showed both activation and inhibition, and therefore, although these pathways were significantly affected by the presence of R. hominis, precise net functional effects on T-cell differentiation require further investigation. Nevertheless, increased expression of IL-10, CD3s and IL-13 and altered IFN-γ expression confirmed the PCR reaction with real-time detection of products (Figure 7), suggesting that colonization by R. hominis may favor differentiation pathways for Treg and Th2 lymphocytes. A gene ontology analysis (Gene Ontology, GO) was used to obtain information on the functional classification of the genetically regulated genes. GO process "Actin Polymerization" (GO: 0030041) (Arpc3, Capg, Cdc42ep5 and Rhoc) was activated on day 28 in the colon of R. hominis colonized mice (Figure 8). Actinic polymerization in the immune synapse is required for the activation and function of effector T-cells. Gene induction was subsequently confirmed by PCR with real-time detection of the products (Figure 4C). Generally, these data indicate that R.

[0089] Associated with these results was the induction of members of the Ly6 family in the ascending colon. In particular, the glycosylphosphatidylinositol-anchored product of the Ly6g6c gene was activated to a 25-fold, and the related Ly6g6e gene was activated to a two fold on day 28. Most hematopoietic cells express one or more members of the Ly6 family, including neutrophils and plasmacytoid dendritic cells. In addition, a possible role for Ly6 in the activation, differentiation and maturation of T lymphocytes (15) has been proposed.

[0090] Immunocytochemistry confirmed the increased presence of Ly6G cells⁺, CD11b⁺ and CD3⁺ in mice colonized by R. hominis (Figure 5). Consistent with data showing T cell pathways dominated mainly by Treg responses was a statistically significant increase in the number of CD3 T-positive double cells⁺FoxP3⁺ in the colon of inoculated mice

R. hominis. By far colonization by R. hominis, as the only bacterial species, caused a significant increase in the CD3 cell population⁺FoxP3⁺, especially in the colon of these mice.

R. hominis modulates genes for innate immune response in both the small intestine and the colon and alleviates colitis in IL10KO mice [0091] Genes involved in innate immunity and bowel barrier function were significantly induced by the presence of R. hominis in the ascending colon. The GO "innate immune response" (GO: 0045087) process was activated and included related TLR Tlr5, Tlr1 and Vnn1 genes. Activation of Tlr5 was interesting, especially in the face of proper flagella gene induction and the presence of flagellin protein in R. hominis during colonization of the intestine, and it can be assumed that the role of this innate signaling pathway is mediated by other innate and adaptive immune responses. Recently, the link between TLR5 signaling and CD4 T cell responses has been demonstrated⁺ in the case of enucleated pathogens (16). Likewise, the role of TLR2 in facilitating colonization by Bacteroides fragilis, Treg proliferation and homeostasis in the immune system has been demonstrated (17).

[0092] Other genes for innate immune responses to which the R. colinis bacteria were implicated in the colon included Defb37, Pla2g3, Muc16 and ltln antimicrobial peptides and genes responsible for the intestinal barrier function of Sprr1a, Cldn4, Pmp22, Crb3 and Magi3. Innate immune responses genes displaying activation in the small intestine in response to R. hominis included Defcr20, Pcgf2, Ltbp4, Igsf8 and Tcfe2a. Interestingly, Pcgf2 negatively regulates the expression of various cytokines, chemokines and chemokine receptors, and may play an important role in controlling inflammatory responses in intestinal tissues in response to this commensal bacterium. What a commensal bacterium. Interestingly, the inventors have also demonstrated a negative regulation of the NF-kB pathway (GO: 0043124) by R. hominis bacteria, which, like B. thetaiotaomicron (19),

weeks.

Demonstrated that the murine IL-10 (IL-10KO) knockout mouse model was used to test the therapeutic efficacy of R. hominis due to the control of inflammatory pathways as well as the positive effect on the induction of Treg lymphocytes in mice with one type of microorganism attached. Mice were given doses (~ 50 μΐ, 10¹⁰ colony forming units) three times a week, starting from weaning at 20 days of age, through 14 Gene expression of the proinflammatory biomarker panel that in the untreated IL-10KO mice there was a strong increase in the expression of all tested genes compared to expression in wild type mice , with gene induction in the 4- to 49-fold range (Figure 6A). Induction of proinflammatory genes was significantly lower in mice treated with R. hominis than in untreated mice, indicating strong therapeutic benefits of oral administration of R. hominis. The body weights of animals treated with R. hominis were also larger at the end of the study compared to the body weights of the animals as untreated and this effect was statistically significant in males (Fig. 6B). At the end,

Colonization by R. hominis affects the genes of satiety and body composition

GO: 0032099)

GO: 0050433) [0094] Significant metabolic effects of R. hominis were also observed in mice with one type of microorganism attached. All GO processes "negative regulation of the response to food" (GO: 0032096), "negative appetite regulation" and "regulation of catecholamine secretion" were inhibited in the ascending colon by R. hominis colonization. From these data, it can be concluded that R. hominis exerts a stimulating effect on the host's appetite. The genes involved in these processes were Agt, Cartpt, Cck and Cxcl12, with a fold change in the range of 2- to 12-fold. Especially Cck plays a major role in digestion and satiety as a hunger suppressant. Gcg also showed inhibition of the intestine at this site.

[0095] To determine whether these changes in gene expression had a physiological relationship to food intake and body composition, analyzes of the carcass weight and composition were performed. Interestingly, the dry masses of mouse carcasses with attached R. hominis bacteria were significantly greater than the dry weight of GF animal carcasses and the differences were most pronounced on day 14. Further analysis of lipids in the carcass revealed that total obesity was also significantly higher on day 14. animals treated with R. hominis. These statements are consistent with the latest data revealing the role of Firmicutes in collecting energy through fermentation of food, but also confirm the view that intestinal bacteria can properly modulate the axis of the brain-intestine and appetite-regulating hormones.

Discussion [0096] The long-lasting half-evolution of host microbialism was probably driven by the selection of functionally important species of bacteria in the intestine, most of which are not strongly represented in other ecosystems. At present, there is little information about the contribution of specific elements of the microbial environment to the function of the intestine, especially with regard to the development of the mucosal immune system.

[0097] Recent work using a colostral model based on E. coli (HA 107) showed that live bacteria are required in numbers close to 10⁸ colony forming units per gram content to obtain an effect on IgA inducing immunity (20). Recently, the specific functions of SFB and Bacteroides fragilis in the mouse intestine have been investigated to determine their individual contributions to T-lymphocyte biology, and both bacteria have been shown to be potent inducers of Treg and Th17 lymphocytes (5, 8, 9). No reports have previously been made about the impacts of the individual elements of the cluster XIVa Firmicutes, although their presence has been demonstrated in the case of altered Schaedler flora, which also has an effect on the differentiation of T lymphocytes (10).

[0098] The applicant here has demonstrated the first effective connection in the intestine of GF mice with the only type of microorganism - anaerobic bacteria, R. hominis, belonging to the Firmicutes type. The extraordinary sensitivity to bacterial oxygen such as Roseburia requires strict anaerobic breeding techniques, which impedes functional characteristics. The applicant created durable monololonization by R. hominis in germfree mice and obtained a fully described genome sequence to know its metabolic organization, physiology and symbiotic properties. It was found that R. hominis transcriptional responses after colonization can be attributed to both the intestinal environment and the diet. After combining the only type of microorganism, the R. hominis response was dominated by the effects caused by the host. This included the subsystems of gene transfer, membrane transport, Chemotaxis and motility. Strong activation of genes involved in mobilization for transfer is a confirmation of the view that the intestinal environment is highly conductive with respect to horizontal gene transfer between elements of intestinal microbiota. Thus, this environment can accelerate the spread of genes important for the survival, colonization and function of bacteria in the intestinal ecosystem.

[0099] The role of locomotor apparatus in host colonization is well-developed for pathogenic bacteria, but much less is known about the role of flagellar proteins in commensal bacteria. In vivo experiments revealed a stimulating effect of the intestinal host environment on the expression of flagellin genes. Flagellin signals are received by host TLR5 receptors (24) and many flagellin-like flagellin-like structures induce potent pro-inflammatory responses (24). Signaling by TLR5, in response to residual entrapped comensil, may be important for homeostasis because the deletion of TLR5 leads to spontaneous colitis in mice (25). Increased expression of R. rupelis flagellin in vivo is therefore of interest. Another study showed that E. coli flagellin mutants had the advantage of flagellin E. coli have a colonization advantage over wild-type strained strains, perhaps due to the lack of congenital recognition by TLR5 signaling (26, 27). The applicant has shown that for some Firmicutes, activation of flagellin is a natural response to colonization of the intestine. Flagellin R. hominis protein remains expressed in vivo and correlates with prolonged colonization, lack of clear inflammation and T-cell proliferation of the regulatory phenotype. Thus, the structure of the commensal flagellin, via TLR5, may help guide the immune tolerance responses. Additional data, based on TLR5KO and mutants of flagellin R. hominis, will further explain the importance of flagellin commensals in relation to homeostasis in the immune system, but the observed protective effect of R. hominis in IL-10KO mice confirms this hypothesis,

[0100] The decisive role of R. hominis in enhancing the barrier function of the intestine and innate immunity in the colon of mice has been established. Strict connections, joints and adjoining connections are designed to limit the movement of bacteria into the subepithelial layer (28). Both Cohn's disease and ulcerative colitis are characterized by the loss of barrier function and the integrity of tight joints. Interestingly, the dysbiosis of intestinal microbiota in IBD is associated with a decrease in the participation of Firmicutes (1, 29). The observation that R. hominis actively increases the expression of barrier genes suggests that its loss in IBD patients may be important from a functional point of view. Activation of complexed complex complexes is not exclusive to R. hominis; other commensals,

[0101] The effect of R. hominis on the intestinal immune system was intriguing. The strongest effects were demonstrated in the ascending colon and genes such as Ly6g6c were strongly activated as well as pathways involved in the regulation and differentiation of T lymphocytes and actin polymerization in the immune synapse that are involved in T-cell activation and effector functions. Though Treg gene expression in response colonization by R. hominis was not very strong, the major T-cell pathways to which an effect was observed were those associated with IL-10, ICOS and CTLA-4, all of which are involved in supporting the differentiation of Treg lymphocytes. Importantly, the applicant was able to show a significant increase in the number of CD3 cells⁺FoxP3⁺ in the colon of these mice. These test results complement the latest data on other species of the genus Clostridium that control the differentiation of Treg lymphocytes. Apparently R. hominis may support the proliferation of mucocyte T-lymphocytes and has an effect on T-cell differentiation.

[0102] It was interesting to discover the strong immune effects in the colon compared to the small intestine, especially on day 28 after monocollonization by R. hominis. The transcriptome data from day 14 suggest that there may have been some initial priming (sensitization) of immune cells in the small intestine at this time point. Effects on different subsets of T lymphocytes in the ascending colon on day 28 may thus reflect cell transfer from the small intestine and colonization of the mesenteric lymph nodes and colon.

[0103] The intriguing additional biological effect of colonization by R. hominis was the regulation of genes affecting food responses and appetite control. In particular, the gene expression of the satiety hormones Cck and Gcg was significantly reduced. In Cck, food intake is mediated by an erroneous afferent pathway. This is the main nervous pathway through which information about ingested nutrients reach the central nervous system and affect both bowel function and nutritional behavior. Cck acts on the vasculature reducing the expression of appetite stimulant and nutrition molecules and increasing the expression of food-suppressing and appetite-suppressing molecules (in the present study, the expression of both Npy2r and Cartpt was inhibited to a two-fold rate). So far, no connection has been reported between Cck, Gcg and commensal bacteria, however, both fatty acids and proteins are strong inducers of Cck and Gcg (31). R. hominis produces short-chain fatty acids, such as butyrate, with aliphatic tails of less than six carbon atoms; it has been reported that this metabolic activity reduces the stimulatory effect on plasma Cck levels observed with longer chain fatty acids (32). Interestingly, carcase mass analysis revealed that both body weight and body mass as well as lipid content were indeed significantly increased with the participation of R. hominis, in line with the weight gain observed in the convention of germfree mice (33). Is this a direct effect of reducing the amount of satiety hormones observed in this study, it remains to be determined as the involvement of Cck and Gcg has not been reported before. Nevertheless, it is important to admit that the link between microbial colonization and energy gain from the diet has been previously demonstrated, in part due to the release of short-chain fatty acids (34). Assuming that R. hominis is the main producer of butyrate, this mechanism may probably also contribute to the metabolic efficiency observed after treatment with R. hominis.

[0104] In conclusion, the combination in the mouse intestine exclusively with R. hominis induced strong events of bi-directional gene expression, consistent with changes in bacterial membrane transport, chemotaxis and motility of this adapted bacterial intestine and associated activation of the innate and adaptive host immune system. . This metabolically active bacterium also had an important effect on the genes responsible for appetite and satiety, which correlated with increased weight gain in colonized mice.

Compositions [0105] Another aspect of the invention relates to a composition comprising a bacterial species as described above, and a pharmaceutically acceptable excipient, carrier or diluent.

Suitable excipients, diluents, carriers are described below.

[0106] The composition may be any composition, but it is preferably a composition for oral, enteral or rectal administration. For example, the composition may be an edible composition. 'Edible' means a substance that is approved for human or animal consumption.

[0107] Another aspect of the invention relates to a probiotic composition comprising a bacterial species as described above.

[0108] As used herein, the term "probiotic" means preparations from microbial cells or components of microbial cells that have a beneficial effect on the health or well-being of the host. (Salminen S, Ouwehand A. Benno Y. et al. "Probiotics: how should they be defined" Trends Food Sci. Technol 1999: 10 107-10).

[0109] Preferably, the probiotic composition is an orally acceptable composition of metabolically active, i.e. live and / or lyophilized or non-lethal, heat-killed, irradiated or lysed probiotic bacteria. The probiotic composition may contain other

<td>components. The composition</td><td colspan="2">probiotic</td><td colspan="2">according to the invention can be</td>

<td>administered orally, i.e.</td><td>in</td><td>form</td><td>tablets,</td><td>capsules or</td>

<td>powder. In case of</td><td>R.</td><td>hominis</td><td>favorable</td><td>there are products</td>

<td>encapsulated because it is</td><td>this</td><td>organism</td><td>anaerobic.</td><td>You can join</td>

other ingredients (such as vitamin C) as oxygen scavengers. Prebiotic substrates, such as those, enhance colonization and survival in vivo. Alternatively, the probiotic composition of the invention may be administered orally as a food or nutrient, such as a fermented milk-based or whey-based milk processing or as a pharmaceutical product.

[0110] A suitable daily dose of probiotic bacteria is from about 1 x 10³ up to about 1 x 10¹¹ colony forming units (CFU), more preferably from about 1 x 10⁷ up to about 1 x 10¹⁰CFU, more preferably, from about 1 x 10⁶ up to about 1 x 10¹⁰ CFU.

[0111] In a preferred embodiment, the composition comprises a bacterial species and / or cellular constituents thereof, as active ingredients, in an amount of about 1 x 10⁶ up to about 1 x 10¹¹ CFU / g, based on the weight of the composition, preferably from about 1 x 10⁸ up to about 1 x 10¹⁰ CFU / g. The dose may be 1 g, 3 g, 5 g and 10 g.

[0112] Typically, the probiotic is optionally combined with at least one suitable prebiotic compound. A prebiotic is usually a non-digestible carbohydrate such as an oligo- or polysaccharide or sugar alcohol that is not degraded or absorbed in the upper gastrointestinal tract. Known prebiotics include commercially available products such as inulin and transgalactooligosaccharides.

[0113] Preferably, the composition of the invention comprises a prebiotic in an amount of about 1 to about 30% by weight, based on the total weight of the composition, preferably from 5 to 20% by weight. Preferred carbohydrates are selected from: fructooligosaccharides (or FOS), short-chain fructooligosaccharides, inulin, isomaltooligosaccharides, pectins, xylooligosaccharides (or XOS), chitosanoligosaccharides (or COS), beta-glucans, modified gum arabic and resistant starches, polydextrose, D-tagatose, fiber from arabic gum, carob, oats and citrus. Particularly preferred prebiotics are short-chain fructooligosaccharides (for simplicity referred to below as FOSsc.c); listed FOSs-cc are indigestible carbohydrates, generally obtained by converting beet sugar and including a sucrose molecule,

Feeds / products [0114] A further aspect of the invention relates to food products, dietary supplements, nutraceuticals, nutritional preparations, beverages and medicaments comprising a bacterial species as defined above and their uses.

[0115] In a preferred embodiment, the composition further comprises at least one other type of other food grade bacteria, wherein the food grade bacteria is preferably selected from the group consisting of lactic bacteria, bifidobacteria, propionibacteria or mixtures thereof.

[0116] One aspect of the invention relates to a food product comprising a bacterial species as defined above. The term "food product" is intended to include all products suitable for consumption, which may be solid, gelled or liquid. Suitable food products may include, e.g., functional food products, food compositions, pet food, livestock feed, healthy food, animal feed, etc. In a preferred embodiment, the food product is a healthy food.

[0117] As used herein, the term "functional food product" means a food that can provide not only a nourishing effect but is also able to provide the consumer with a further beneficial effect. Accordingly, functional food is a food normally comprising components or ingredients incorporated therein (such as those described herein) imparting a specific functional effect to food - e.g. a curative or physiological benefit - other than purely nutritional.

[0118] Examples of specific food products suitable for the invention include milk-based products, ready-to-eat desserts, powders for reconstitution, e.g. with milk or water, chocolate milk drinks, malt beverages, ready-to-eat meals, dishes or beverages. of the instant type for humans or food compositions representing a complete or partial diet intended for domestic or farm animals.

[0119] In a preferred embodiment, the composition of the invention is a food product intended for humans, domestic animals or farm animals. The composition may be intended for animals selected from the group consisting of dogs, cats, pigs, cattle, horses, goats, sheep or poultry. In a preferred embodiment, the composition is a food product for adults, in particular adults.

[0120] According to the invention, "milk-based product" means any liquid or semi-solid milk-based product or whey with different fat content. The milk-based product may be e.g. cow's milk, goat's milk, sheep's milk, skim milk, full-fat milk, milk reconstituted from milk powder and whey without any treatment or processed product, such as yogurt, curds, milk curd, sour milk , sour full-fat milk, buttermilk and other sour milk products. Another important group includes milk drinks, such as whey beverages, fermented milk, condensed milk, milk for babies or toddlers; flavored milk, ice-cream; food containing milk such as sweets.

[0121] One aspect of the invention relates to animal feed or pet food comprising a bacterial species as defined above.

[0122] The compositions of the present invention may be nutritional supplements also referred to herein as dietary supplements or nutritional supplements or food additives, or may be added thereto. Thus, another aspect of the invention relates to a food supplement or a food additive comprising one or more bacterial strains of the invention.

[0123] The bacterial species and probiotic compositions of the invention can also be used in animal nutrition (e.g., in pig feed), especially in the early post-weaning period and during the growing and fattening period. Probiotics are expected to enhance immune function, reduce infectious diseases and prevent them, preferably change the composition of the microbiome and improve animal growth and performance, e.g. through increased feed efficiency.

Diluents, excipients and carriers [0124] As mentioned above, the invention also relates to compositions, more preferably pharmaceutical compositions or food supplements, comprising a bacterial species as defined above and their use. The bacterial species is generally administered in admixture with a pharmaceutically acceptable or nutritionally acceptable carrier, excipient or diluent, especially for human treatment. The pharmaceutical compositions may be used in humans or animals in human and veterinary medicine. [0125] Examples of such suitable excipients for many of the various forms of pharmaceutical compositions described herein can be found in "Handbook of Pharmaceutical Excipients, 2nd edition, (1994), edited by A Wade and PJ Weller.

[0126] Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art and are described, e.g., in Remington's Pharmaceutical Sciences, Mack Publishing Co. (edited by AR Gennaro, 1985).

[0127] Examples of suitable carriers include lactose, starch, glucose, methylcellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.

[0128] A pharmaceutical carrier, excipient or diluent may be selected depending on the intended mode of administration and typical pharmaceutical practice. The pharmaceutical compositions may contain as carrier, excipient or diluent, or in addition to them, any suitable binder, lubricant, suspending agent, coating agent, dissolving agent (any suitable binders, lubricants, suspending agents, coating agents, solubilizing agents) .

Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free flowing lactose, beta-lactose, sweeteners from corn, natural and synthetic gums such as gum arabic, tragacanth gum or sodium alginate, carboxymethylcellulose and polyethylene glycol.

[0130] Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.

[0131] The pharmaceutical composition may contain preservatives, stabilizers, dyes and even flavorings. Examples of preservatives include sodium benzoate, sorbic acid and p-hydroxybenzoic acid esters. Antioxidants and suspending agents may also be used.

[0132] From a nutritional point of view carriers, diluents and excipients include those suitable for human or animal consumption and which are used as standard in the food industry. Typical carriers acceptable from nutrient point of view, diluents and excipients will be known to the person skilled in the art.

Administration [0133] The compositions of the invention may be adapted for oral, rectal, vaginal, parenteral, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabronchial, subcutaneous, intradermal, intravenous, nasal, buccal or sublingual routes. Preferably, the compositions of the invention are adapted for oral, rectal, vaginal, parenteral, nasal, buccal or sublingual routes.

[0134] For oral administration, particularly compressed tablets, pills, tablets, gelcaps, drops and capsules are used.

[0135] Other forms for administration include solutions or emulsions that may be injected intravenously, intraarterially, intrathecally, subcutaneously, intradermally, intraperitoneally or intramuscularly, and which are prepared from sterile or sterile solutions. The pharmaceutical compositions of the invention may also be in the form of suppositories, globules, suspensions, emulsions, lotions, ointments, creams, gels, sprays, solutions or dusting powders.

[0136] An alternative form of transdermal delivery is administration using a skin patch. For example, the active ingredient can be incorporated into a cream consisting of an emulsion of polyethylene glycols or liquid paraffin in water. The bacterial strain may also be incorporated into an ointment consisting of a white wax or soft white paraffin base together with such stabilizers and preservatives as may be required.

[0137] The compositions may be formulated in a unit dosage form, i.e. in the form of separate unit dose or multiple dose portions or unit dose subunit.

Dosage [0138] A person of ordinary skill in the art can easily determine without undue experiment the appropriate dose of one of the instant compositions to be administered to a patient. Typically, the doctor will determine the actual dosage that will be the most appropriate for the individual patient and will depend on various factors including the activity of the particular bacterial strain used, metabolic stability and duration of action of this strain, age, weight, general health, sex, diet, mode and time the rate of excretion, the combination of drugs, the severity of the particular condition and the person being treated. The doses disclosed herein are exemplary of the average case. Of course, there may be individual instances where higher or lower dosage ranges are preferred and are within the scope of the invention.

[0139] The usual effective daily dose in humans is from about 1 x 10³ up to about 1 x 10¹¹more preferably, from about 1 x 10⁷ up to about 1 x 10¹¹even more preferably, from about 1 x 10⁶ up to about 1 x 10¹⁰ CFU.

Combinations [0140] In a particularly preferred embodiment, the compositions of the invention are administered in combination with one or more other active ingredients. In such cases, the compositions of the invention may be administered sequentially, simultaneously or sequentially with one or more other active ingredients.

[0141] The invention is further described based on the following non-limiting examples.

EXAMPLES

Materials and methods

Bacterial growth conditions [0142] R. hominis A2-183^T (= DSM 16839^T = NCIMB 14029^T) were grown under anaerobic conditions in synthetic YCFA medium or M2GSC complex medium. The culture was inoculated from the frozen stock solution into Hungate tubes and incubated overnight at 37 ° C. Bacteria were then cultured on M2GSC agar plates for 48 hours in an anaerobic MACS-MG-1000 workstation (Don Whitley Scientific) at 80% N₂, 10% CO₂ and 10% H₂ at 37 ° C. The effect of mucin was examined by adding 0.5% (w / v) porcine gastric mucin, type III (Sigma-Aldrich) to YCFA medium.

For germfree mating, R. hominis was cultured in YCFA media overnight at 37 ° C. The culture was centrifuged and the cell pellet resuspended in 1 ml of YCFA medium supplemented with 2% cysteine ​​(w / v, Sigma-Aldrich) and 3% ascorbic acid (w / v, Sigma-Aldrich).

Animal experiments [0143] germfree was performed in the gnotobiotic rodent broth INRA Jouy-en-Josas (ANAXEM platform, Institut Micalis, INRA, Jouy-en-Josas, France). All animal experiments have been approved by the local bioethics commission. Eighteen male C3H / HeN germfree mice were assigned to control (N = 8) and experimental (N = 10) control groups and were individually housed in plastic insulators. Mice were fed without limitation to the sterilized food available on the market (R03-40;

Type mice

R. hominis with karma (R03-40; UAR). On day 0, animals in the experimental group received a probe with 100 μΐ of R. hominis culture, whereas control animals received 100 μl of YCFA medium. On days 14 and 28, four control animals and five animals treated with R. hominis were killed. Experiments involving C57 / BL6 IL-10KO mice were performed at the Rowett Institute of Nutrition and Health (Aberdeen, Scotland, UK) wild (N = 8), IL-10KO (N = 12) and IL-10KO + (N = 11) analyzed 14 weeks from the beginning of the experiment. In summary, R. hominis was administered 3 times a week at 109 CFU / day.

[0144] The small intestine, ascending colon and descending colon were divided into four equal parts and transferred to RNAlater (Ambion), neutral buffered formaline (Sigma-Aldrich) or liquid nitrogen. The whole caecum and the transverse were transferred to the RNAlater. Histopathology was also evaluated in IL-10KO mice.

Tissue culture experiments [0145] All cell culture reagents, unless stated otherwise, were provided by Sigma-Aldrich. 2 x 105 Caco-2 or HT29 cells in 1.5 ml DMEM medium (high glucose, HEPES) supplemented with high-temperature inactivated fetal bovine serum (Gibco), penicillin, streptomycin, amphotericin B and L-glutamine were spread to the upper compartments of the six-well plate Transwell (Corning). The lower compartments contained 3.0 ml of the same medium. The cells were incubated at 37 ° C in a 5% CO atmosphere₂ up to 3 days after confluence, washed with Hanks' solution to remove antibiotics and FCS and transferred to DMEM medium supplemented with L-glutamine, sodium selenate and transferrin for 24 hours without antibiotics. The Transwell inserts were then transferred to the anaerobic box in an anaerobic workstation at 37 ° C. The upper compartment of each cartridge was filled with anaerobic DMEM medium for cells, while the lower compartment was filled with oxygenated DMEM medium.

[0146] The culture of R. hominis A2-183 was harvested in the exponential growth phase by centrifugation at an overload of 3500 xg for 5 minutes. The cell pellet was washed and resuspended in 0.8 ml of anaerobic DMEM medium. One hundred microliters of bacterial suspension (108 CFU / ml) was added to the experimental wells. The same amount of medium without bacterial cells was added to the control wells. Additional control included bacterial cells incubated without Caco-2 or HT29 cells.

[0147] Bacterial and eukaryotic cells were harvested after 2- and 4-hour incubations. Both unadherent and adherent bacteria were aspirated and stored in the RNAlater. The viability of R. hominis cells was examined by plating onto YCFA plates. Caco-2 cells or HT-29 cells were harvested from wells and also stored in the RNAlater.

Construction of the R. hominis library [0148] R. hominis chromosomal DNA for the construction of a small library and pyrosequencing was isolated using the UltraClean kit^TM Microbial DNA Isolation Kit (Mo Bio Laboratories Inc), and high molecular weight DNA for fosmid libraries was isolated using the Wizard kit

Wizard Genomic DNA Purification Kit (Promega). DNA integrity was checked by gel electrophoresis.

[0149] The DNA was cut mechanically using the Nebulizer kit (Invitrogen) and fractionated by gel electrophoresis. The DNA fragments of the desired size were excised from the gel and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). The ends were repaired using the DNA Terminator End Repair Kit (Lucigen). Fragments of 1.53 kb in length were cloned using the CloneSmart® LCAmp kit (Lucigen) and a 4-8 kb library was constructed using the pJAZZ®OC (Lucigen) vector. Fossil libraries were constructed using the CopyControl set^TM Fosmid Library Production Kit (Epicentre Biotechnologies). Colonies were selected using a colony selection robot (BioRobotics BioPick, Genomic Solutions) and archived on 384-well microtiter plates containing 70 μΐ 2x LB medium supplemented with 10% glycerol and the appropriate antibiotic. The cells were grown overnight at 37 ° C with shaking and stored at -80 ° C.

Sequencing, assembly and annotation [0150] Small-library sequencing matrices were prepared by PCR using 1 μΐ of maple biomass and the SL1 and SR2 primers flanking the pSMART-LCAmp cloning site. The PCR products were purified using Multiscreen PCR Cleanup Filter Plates (Milipore). Recombinant DNA from pJAZZ®-OC clones was isolated using the Wizard® SV 96 Plasmid DNA Purification System (Promega). Fosmic DNA was isolated using the FosmidMAX kit^TM DNA Purification Kit (Epicenter).

FosmidMAX^TM DNA Purification Kit (Epicenter). Short terminal fragments of DNA fragments from R. hominis WGS libraries with inserts of various sizes were obtained using DNA sequencers CEQ8000 (Beckman Coulter) and ABI3770 (Applied Biosystems). Genomic DNA from R. hominis was also sequenced using the GS4 (454 Life Sciences) and 454 FLX sequencers (Roche). Sanger and 454 data were submitted using the MIRA program, (<a href="http://chevreux.org/projects">http://chevreux.org/projects</a> mira.html; the automatic and manual annotation of the genome of comparative genomes has used RAST technology with pipelined processing to annotation (<a href="http://rast.nmpdr.org">http://rast.nmpdr.org</a>; (36)). The genome sequence of R. hominis A2-183 with annotations was submitted at GenBank under accession number CP003040.

Up to version

35).

for analysis

Analysis using microarrays

Bacterial microarrays [0151] Bacterial RNA was isolated from the contents of the mouse cecum using the RNeasy minikitch and then processed using MICROBEnrich kits^TM Kit (Ambion), MICROBExpress^TM Bacterial mRNA Enrichment Kit (Ambion) and MessageAmp^TM II-Bacteria RNA Amplification Kit (Applied Biosystems). During synthesis, the RNA cDNA was labeled with dCTP-Cy3 or dCTP-Cy5 (CyScribe First Strand cDNA Labeling Kit; Amersham). Labeled products were purified using the CyScribe GFX Purification Kit (Amersham). PCR products amplified from 6,000 clones in the RA8 library were set up in duplicate on aminosilane-coated microscope slides (Corning) using a MicroGrid II TAS (BioRobotics) device. Duplicated fragments of rpoD and gyrA basal metabolic genes of basic rpoD and gyrA were randomly distributed on the array as controls. Hybridization with microarrays was performed on the GeneTAC Hybridization Station (Genomic Solutions). Dye labeling was exchanged for the second hybridization and the separated purified RNA was also labeled and hybridized twice, to ensure reproducibility and to obtain statistically significant results. In general, four slides were hybridized for each comparison, for a total of 12 hybridization sites per duplicate clone. Fluorescence was measured in two channels using a GeneTAC LS IV device (Genomic Solutions) with GeneTac Integrator software, version 3.0.1. Logarithm was obtained from data from signal intensity for hybridization sites and normalization loess was applied to remove differences in probe labeling and hybridization efficiency. The t-tests for one trial were used to examine the ratio of the troparithmized values ​​of the differential expression. Data was considered significant when the change fold&gt; 2 and P &lt;0.05. for a total of 12 hybridization sites per reproduced clone. Fluorescence was measured in two channels using a GeneTAC LS IV device (Genomic Solutions) with GeneTac Integrator software, version 3.0.1. Logarithm was obtained from data from signal intensity for hybridization sites and normalization loess was applied to remove differences in probe labeling and hybridization efficiency. The t-tests for one trial were used to examine the ratio of the troparithmized values ​​of the differential expression. Data was considered significant when the change fold&gt; 2 and P &lt;0.05. for a total of 12 hybridization sites per reproduced clone. Fluorescence was measured in two channels using a GeneTAC LS IV device (Genomic Solutions) with GeneTac Integrator software, version 3.0.1. Logarithm was obtained from data from signal intensity for hybridization sites and normalization loess was applied to remove differences in probe labeling and hybridization efficiency. The t-tests for one trial were used to examine the ratio of the troparithmized values ​​of the differential expression. Data was considered significant when the change fold&gt; 2 and P &lt;0.05. Logarithm was obtained from data from signal intensity for hybridization sites and normalization loess was applied to remove differences in probe labeling and hybridization efficiency. The t-tests for one trial were used to examine the ratio of the troparithmized values ​​of the differential expression. Data was considered significant when the change fold&gt; 2 and P &lt;0.05. Logarithm was obtained from data from signal intensity for hybridization sites and normalization loess was applied to remove differences in probe labeling and hybridization efficiency. The t-tests for one trial were used to examine the ratio of the troparithmized values ​​of the differential expression. Data was considered significant when the change fold&gt; 2 and P &lt;0.05.

chloroform was purified

Analysis of mouse microarrays [0152] The small intestine and ascending colon tissue were removed from the RNAlater and lysed in the middle of Trizol (Invitrogen). RNA was isolated using standard steps using lysopropanol. Total RNA then using the RNeasy kit (Qiagen), including the step of digesting with DNAse I without RNAse (Qiagen). RNA integrity was determined using an Agilent 2100 Bioanalyzer (Agilent Technologies). Total RNA was processed into biotin-labeled cRNA using the One-Cycle Target Labeling kit

Labeling Kit (Affymetrix). GeneChip Mouse Genome Array (Affymetrix) hybridization with the GeneChip Fluidics Station 450 (Affymetrix) was performed at the Institute of Medical Sciences Microarray Core Facility (University of Aberdeen, UK). Matrices were scanned with an Affymetrix GeneChip Scanner 3000 (Affymetrix). Image quality analysis was performed using the Gene Chip Operating Software (GCOS) (Affymetrix). Further data analysis was performed using the commonly available R software package (<a href="http://www.rproiect.org">http://www.rproiect.org</a>)

Bioconductor (hftp: //www.bioconductor.org). To examine the differential expression, the F-test with moderation from the Bioconductor limma package was used. Data was considered significant when the Benjamini and Hochberg method was found to be P &lt;0.05 for a false statement. Statistical analysis was performed separately for each of the two time points. Data on all the differentially expressed genes (P &lt;0.05) were imported into the MetaCore analysis software (Gene-Go, St Joseph, MI) for route maps. Analysis of enrichment of integrated pathways was performed using known canonical pathways and endogenous metabolic pathways. The ranking of relevant integrated routes was based on p values ​​calculated using a hypergeometric distribution. The p-values ​​represented the probability of randomly matching a given number of genes from the inserted list to a certain number of genes in the map, taking into account the number of genes in the experiment, compared to the number of genes in the map in the full set of all genes on the maps. Functional interpretation of data based on functional ontology of data based on gene ontology (GO) was performed using the DAVID program (<a href="http://david.ab-cc.ncifcrf.gov">http://david.ab-cc.ncifcrf.gov</a>), which is an extended version of the original program available online (37). Indeed, various transcripts (P &lt;0.05) were assigned to GO category "Biological Process" to discover gene expression patterns significantly enriched in terms of specific terms of gene ontology.

Data from microarrays was transferred to the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (accession number GSE25544; <a href="http://www.ncbi.nlm.nih.gov/geo">http://www.ncbi.nlm.nih.gov/geo</a>).

PCR analysis with real-time detection of products [0153] Bacterial PCR primers were designed using the Primer3Plus online tool (38) and purchased from Sigma-Aldrich. PCR analysis with real-time detection of products was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems). PCR was performed as follows: one cycle at 95 ° C for 10 minutes, followed by 40 cycles at 95 ° C for 15 seconds and at 60 ° C for 1 minute, ending with a dissociation step. Cycles for all samples were run in triplicate. GyrA was used as the reference gene for normalization due to its small variability between samples.

[0154] For expression of host genes, 2 μg of total eukaryotic RNA isolated from the small intestine and ascending colon were reverse transcribed into cDNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using random primers. PCR analysis with real-time detection of products was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) with the QuantiFast SYBR Green PCR Kit (Qiagen) and QuantiTect Primer Assays (Qiagen). The conditions of the PCR cycles were: one cycle at 95 ° C for 5 minutes and then 40 cycles at 95 ° C for 10 seconds and at 60 ° C for 30 seconds, ending with a dissociation step. Cycles for all samples were run in triplicate. As the reference gene for normalization, hprt was chosen due to its small variability between samples. All data from RT-PCR were analyzed by Student's t test on a logarithmic scale with base 2, allowing unequal variances, with a significance limit of P &lt;0.05. The differences were converted back to the output units in order to calculate the number of changes.

Western blot [0155] Purified by immunoassay, rabbit polyclonal antibodies against Fla2 Roseburia hominis were prepared as described in: Duck et al. (39). In brief, female New Zealand White rabbits were immunized with a synthetic peptide in complete Freund's adjuvant and boosted several times. In the case of R. hominis fla2, peptide 261-275 (C-AQYNDDAKSVLEILK-COOH) and peptide 58-71 (CGLNKASRNSQDGIS-CONH) were used.₂). After immunization, the antibodies were purified on an affinity chromatography affinity chromatography column, which was prepared by conjugating peptides with 1 ml of beads from activated sepharose.

[0156] For the Western blot method, the contents of the ascending colon were suspended in Laemmli buffer containing 8M urea. The R. hominis biomass (positive control) was diluted in the same buffer. 30 μl of each sample was loaded into NuPAGE® Novex® gel wells 4-12% Bis-Tris Gel (Invitrogen) and subjected to electrophoresis followed by further treatment using a WesternBreeze Chemiluminescent Immunodetection System (Invitrogen). The anti-Fla2 antibody was diluted 1: 1000 in antibody diluent and incubated overnight at 4 ° C and then for 1 hour at room temperature with a phosphatase-conjugated alkaline anti-rabbit antibody. Detection was carried out using the Fuji LAS3000 Imaging System.

Analysis of dry body weight and lipids in the carcass [0157] The heated mouse carcass was weighed, lyophilized to a constant weight and then ground for analysis. The lipid content was determined by extraction (1: 100 w / v) with chloroform / methanol (2: 1 v / v) as previously described (40).

FISH analysis [0158] FISH analysis was performed on intestinal tissue sections using the general bacterial probe Eub338 and the newly designed probe specific for R. hominis A2-183.

[0159] Tissues fixed in neutral buffered formalin were embedded in Technovit 8100 (Heraeus Kulzer). Two-micron sections were excised using rotational microtome (Leica / Reichert Autocut). Three sections from 100 μη, 200 μm and 300 μm into the tissue were placed on each slide, resulting in nine sections per animal.

[0160] The slides were dehydrated by subsequent incubation in 50% (v / v), 80% and 96% ethanol and dried at room temperature. The FISH 16S rRNA probes used were the general bacterial probe Eub338 (GCTGCCTCCCGTAGGAGT; Cy3) and the newly designed probe specific for R. hominis A2-183 (GTACATTACATACTCTGTCAGTG; FITC), which has been extensively studied for specificity for the panel of intestinal bacterial isolates. Ten microliters of probe (30 ng / μΐ) in 100 μΐ of hybridization buffer was added to the dehydrated sample and incubated at a probe-specific temperature. The slides were washed in washing buffer at 50 ° C for 30 minutes, immersed in ice-cold water to remove residual wash buffer and dried under a stream of compressed air. The contrast staining was performed using 4 ', 6-diamidino-2-phenylindole (DAPI;

Bacteria were visualized using a Leica DM RBE fluorescence microscope (Leitz GMBH) and photographed using a Penguin 600CL (Pixera) camera and Viewfinder 3.0 software (Studio Lite). Images under high magnification (x63) were obtained using the Apochromatics system (Leica).

Immunofluorescence [0161] Immunolocalization of T cell markers was tested on consecutive sections obtained by freeze cutting (8 μη). The sections were fixed in pre-cooled methanol for 30 minutes at -20 ° C (Ly6G FITC, CD3 FITC, CD11b FITC, all at 1:50 (BD Biosciences)), or, in the case of the double labeling FoxP3 (1: 500, Abcam) with CD3 FITC (1: 100, BD Biosciences) were fixed in 1% paraformaldehyde (PFA) for 2 minutes at room temperature and then for 3 minutes in 0.01% Triton X in PBS. All sections were blocked with 10% BSA (Sigma) containing 10% of the appropriate sera obtained after pre-immunization in PBS (pH 7.4). The tissues fixed in methanol were incubated with primary antibodies for 1 hour at room temperature. PFA-fixed sections were incubated with antibodies at 4 ° C overnight. FoxP3 was visualized using a 59a Alexa anti-rabbit antibody (1: 1000, Molecular Probes). The sections were counterstained with DAPI and embedded using Vectashield (Vector Laboratories). In order to quantify the positive cells, at least five fields of view were tested from each mouse slice using the imaging software and microscope settings described above.

Histology [0162] Tissue samples were fixed for three hours in Carnoy's fixative (60% (v / v) ethanol, 30% (v / v) chloroform and 10% (v / v) glacial acetic acid ) at room temperature with constant mixing. Samples were transferred to 70% ethanol and transferred to 70% ethanol and stored at room temperature until cross-cut orientation and embedding in a cold-binding resin using Technovit 8100 (Heraeus Kulzer) according to the manufacturer's instructions. The embedded tissue was embedded in Histoblocs blocks using Technovit 3040 (Heraeus Kulzer). Four-micron sections were cut using rotational microtome (Leica Autocut) equipped with a glass knife (TAAB Laboratories Equipment Ltd.). The tissue sections were stained with standard methods using hematoxylin / eosin and examined using a Zeiss Axioskop microscope equipped with x10 and x20 lenses. Pictures were taken using the Qlmaging camera and Image Pro Plus software.

Comparison of the genomes of Roseburia species and strains related to the Roseburia bacterium [0163] The Applicant obtained the entire genomic sequence of R. hominis A2-183, which is represented by a single chromosome of 3592125 bp in length. Automatic and manual annotation of the genome using the RAST platform revealed the presence of four ribosome operons, 66 RNAs and 3273 predicted proteins. Distribution of categories within subsystems for R. hominis A2-183, R. inulinivorans DSM 16841, R. intestinalis L1-82, R. intestinalis M50 / 1 and Eubacterium rectale ATCC 33656 are shown in Figures 11-15, respectively.

[0164] This information illustrates differences in the number of genes (shown in brackets) in each functional subsystem. These genes are very important in mediating the host response to each individual bacterium. Importantly, these genes, important, these genes, both in number and function, are between different strains. The results are summarized below:

R. hominis A2-183

Cell wall and sheath (57)

Membrane transport (24)

Mobility and chemotaxis (49)

Cell regulation and signaling (16)

Sleep and sporulation (12)

Carbohydrates (271)

E. rectale ATCC 33656

Cell wall and sheath (41)

Membrane transport (13)

Mobility and chemotaxis (16)

Cell regulation and signaling (9)

Sleep and sporulation (6)

Carbohydrates (172)

R. intestinalis L1-82

Cell wall and sheath (35)

Membrane transport (36)

Mobility and chemotaxis (15)

Cell regulation and signaling (10)

Sleep and sporulation (17)

R. intestinalis M50 / 1

Cell wall and sheath (28)

Membrane transport (37)

Mobility and chemotaxis (17)

Cell regulation and signaling (10) different

Sleep and sporulation (17) Carbohydrates (201)

R. inulinovorans DSM 16841

Cell wall and sheath (69)

Membrane transport (26)

Mobility and chemotaxis (14)

Cell regulation and signaling (9)

Sleep and sporulation (17)

Carbohydrates (160)

The percentage sequence identity&gt; 3,000 genes found in contig 1 emphasizes the differences between the bacterial R genome.

hominis and the bacterial genome of E. rectale, R. intestinalis and R. inulinivorans [0165] The genomes of the different species Roseburia and related species Eubacterium rectale, closest to R. hominis were compared.

R. hominis reference genome 585394.12 E. rectale genome ATCC336556 515619.3 R. intestinalis L1-82 166486.4

R. intestinalis M50 / 1 166486.5 R. inulinovorans DSM16841 622312.3 [0166] The percent identity of the possible genes in different Roseburia genomes ranges from 0% to about 90% sequence identity. Many genes are hypothetical and are different between strains. Many genes present in the R. hominis genomes do not occur in the genomes of other species

Roseburia.

[0167] Roseburia hominis has 924 genes not found in other genomes of other Roseburia species (0% identity) indicating that almost 25% of the genome of this bacterium is unique to R. hominis. Also a small homology among other genes (&lt;10-70%) indicates that the functions of many other genes are also likely to differ.

[0168] This information is irresistible evidence that these bacteria are very different from the genomic and functional perspective and can not be grouped differently from their phylogenetic relationship, which is generally based on the preserved 16S ribosomal gene, which is the preserved fragment of the prokaryotic DNA found in all bacteria. The sequences of the 16S rRNA gene (a common genetic marker) are used for phylogenetic and taxonomic studies of bacteria.

Functionality with respect to host response and immunity is specific for the bacterial strain [0169] Fig. 9 illustrates the comparison of gene expression data for three strains of bacteria from cluster XIVa (Firmicutes), namely Roseburia hominis, E. rectale and

Roseburia intestinalis.

expressed

The data indicate the numbers of unique genes related strains by phylogenetically bacterial exposure to human epithelial cells. Gene expression was determined using human Affymetrix microarrays containing 56,000 genes. This difference reflects the differences in their respective genomes [these experiments are similar to those using mouse microarrays but using specific human microarrays that are described elsewhere in the description]. The GeneChip® Human Genome U133 Plus 2.0 Array matrix is ​​the first and the most comprehensive matrix of the entire human genome to study expression. Affymetrix GeneChip® Human Genome U133 Plus 2.0 Array (HG-U133 Plus 2.0) contains 1,300,000 unique oligonucleotide elements covering over 47,000 transcripts and variants, which in turn means approximately 39,000 of the best characterized human genes. Cell lines used to assess the signaling response induced by various commensal bacteria, including Caco-2 and HT-29 cell lines living in the human colon and bacteria including R. hominis, E. rectale and R. intestinalis, were compared to Salmonella enteritidis, an intestinal pathogen.

Functional differences in bacteria from cluster XIVa - comparison between R. hominis and E. rectale [0170] Fig. 10 indicates that Roseburia hominis induces A20 negative regulator of NF-κΒ signaling with a strong anti-inflammatory effect, while other bacterial strains have no effect. The flagellate part of Roseburia hominis also induces A20 in contrast to the flagellate portion of Eubacterium rectale, a related bacterium.

[0171] Cell culture reagents, unless specified otherwise, were provided by Sigma-Aldrich. Caco-2 cell lines (ECACC Cat. # 860102002) and HT29 (ATCC) cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, UK), 200 mM L-glutamine and A 1% mixture of antibiotics and antimycotics was plated on a Transwell six-well plate (Corning). The cells were incubated at 37 ° C in a 5% CO atmosphere₂ up to 3 days after confluence, washed with Hanks' solution to remove antibiotics and FCS and transferred to DMEM supplemented with L-glutamine, sodium selenate and transferrin for 24 hours without antibiotics. The Transwell inserts were then transferred to the anaerobic box in an anaerobic workstation at 37 ° C. The upper compartment of each cartridge was filled with anaerobic DMEM medium for cells, while the lower compartment was filled with oxygenated DMEM medium.

[0172] Roseburia hominis A2-183 and E. rectale ATCC336556 in standard YCFA and M2 culture media and Salmonella enteric serovar enteritidis grown in LB broth were harvested in exponential growth phase by centrifugation at 3500 xg for 5 minutes. The cell pellet was washed and resuspended in an anaerobic DMEM medium. One hundred microliters of bacterial suspension was added to the experimental wells (10⁸ CFU / ml). The same amount of medium without bacterial cells was added to the control wells. Additional control included bacterial cells incubated without Caco-2 or HT29 cells.

[0173] Bacterial and eukaryotic cells were harvested after 2 and 4 hours of incubation. Both non-adherent and adherent bacteria were aspirated and stored in the RNAlater. Caco-2 cells or HT-29 cells were collected from wells and also stored in the RNAlater.

Luciferase assay for the determination of A20-luciferase gene expression [0174] Fugene® 6 transfection reagent (Roche, UK) was used to transfect HT29 cells with plasmids carrying the luciferase reporter gene under the control of the A20 promoter pLuc-A20 and pLuc-A20A NFkB (mutated at 3 nucleotides in the region the A2 promoter 0) and the GFP reporter gene under the control of the A20 promoter pCAGGS-GFP1A20 and pLuc-GL2 \ NF-kB. After 48 hours, the cells were stimulated with live bacteria R. hominis, E. rectale and S. enteritidis and recombinant flagellins; S. enteritidis and R. hominis (Fla 1) (100 ng / ml) for 9, 12 and 24 hours. Recombinant flagellin was prepared using full-length sequences cloned into the appropriate vectors and expressed in E. coli JM109, BL21 and Rosetta. Luciferase activity (skylight - f-Luc and renilli - r-Luc) was determined using the Dual-Glo® Luciferase Assay System (Promega, UK) and the Envision 2102 Multilabel Reader. The relative activity of the luciferase reporter gene was obtained by normalization to the activity of the Renilla reporter gene.

[0175] Various modifications and variations to the described aspects of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described methods of carrying out the invention, which are obvious to those skilled in the relevant art, are intended to be within the scope of the following claims.

REFERENCES [0176]

1. Spor, A., Koren, O., &amp; Ley, R. (2011) Unraveling the effects of the environment and host genotype on the gut microbiome. Nat. Rev. Microbiol. 9: 279-290.

2. Eckburg, PB, Bik, EM, Bernstein, CN, Purdom, E.,

Dethlefsen, L., Sargent, M., Gill, SR, Nelson, KE, &amp;

Relman, DA (2005) Diversity of the human intestinal microbial flora. Science 308: 1635-1638.

3. Macpherson, AJ, Hunziker, L., McCoy, K., &amp; Lamarre, A.

(2001) IgA responses in the intestinal mucosa against pathogenic and non-pathogenic microorganisms. Microbes. Infect. 3: 1021-1035.

4. Macpherson, AJ, Martinic, MM, &amp; Harris, N. (2002) The functions of mucosal T cells in containing the indigenous commensal flora of the intestine. Cell Mol. Life Sci. 59:

2088-2096.

5. Mazmanian, SK, Liu, CH, Tzianabos, AO, &amp; Kasper, DL (2005) An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 122: 107-118.

6. Chung, H. &amp; Kasper, DL (2010) Microbiota-stimulated immune mechanisms to maintain gut homeostasis. Curr. Opin.

Immunol. 22: 455-460.

7. Macpherson, AJ (2006) IgA adaptation to the presence of commensal bacteria in the intestine. Curr. Top. Microbiol. Immunol. 308: 117-136.

8. Gaboriau-Routhiau, V., Rakotobe, S., Lecuyer, E., Mulder,

I., Lan, A., Bridonneau, C., Rochet, V., Pisi, A., De, PM, Brandi, G. et al. (2009) The key role of segmented filamentous bacteria in the coordinated maturation of gut helper T cell responses. Immunity. 31: 677-689.

9. Ivanov, II, Atarashi, K., Manel, N., Brodie, EL, Shima, T., Karaoz, U., Wei, D., Goldfarb, KC, Santee, CA, Lynch, SV et al. (2009) Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139: 485-498.

10. Geuking, MB, Cahenzli, J., Lawson, MA, Ng, DC, Slack, E., Hapfelmeier, S., McCoy, KD, &amp; Macpherson, AJ (2011) Intestinal Bacterial Colonization Induces Mutualistic Regulatory T Cell Responses. Impunity.

11. Duncan, SH, Aminov, RI, Scott, KP, Louis, P., Stanton, TB, &amp; Flint, HJ (2006) Proposal of Roseburia faecis sp. Nov., Roseburia hominis sp. Nov. and Roseburia inulinivorans sp. nov., based on isolates from human faeces. Int. J. Syst. Evol. Microbiol. 56: 2437-2441.

12. Mahowald, MA, Rey, FE, Seedorf, H., Turnbaugh, PJ, Fulton, RS, Wollam, A., Shah, N., Wang, C., Magrini, V., Wilson, RK et al. (2009) Characterizing a model of human gut microbiota composed of members of the dominant bacterial phyla. Proc. Natl. Acad. Sci. U.S.A. 106: 5859-5864.

13. Aminov, RI, Walker, AW, Duncan, SH, Harmsen, H.

J., Welling, GW, &amp; Flint, HJ (2006) Molecular diversity, cultivation, and improved detection by fluorescent in situ in the Roseburia spp. Or Eubacterium rectale. Appl. Environ. Microbiol. 72: 6371-6376.

14. Turnbaugh, PJ, Backhed, F., Fulton, L., &amp; Gordon, JI (2008) Diet-induced obesity is connected to the mouse distilled gut microbiome. Cell Host. Microbe 3: 213-223.

15. Mallya, M., Campbell, RD, &amp; Aguado, B. (2006) Characterization of the five novel Ly-6 superfamily members encoded in the MHC, and the definition of the cells expressing their potential ligands. Protein Sci. 15: 2244-2256.

16. Letran, SE, Lee, SJ, Atif, SM, Flores-Langarica, A., Uematsu, S., Akira, S., Cunningham, AF, &amp; McSorley, SJ (2011) TLR5-deficient mice lack basal inflammatory and metabolic defects but exhibit impaired CD4 T cell responses to a flagellated pathogen. J Immunol. 186: 5406-5412.

17. Round, JL, Lee, SM, Li, J., Tran, G., Jabri, B., Chatila, TA, &amp; Mazmanian, SK (2011) The Toll-like receptor 2 pathway establishes colonization by a commensal of the human microbiota. Science 332: 974-977.

18. Hooper, LV, Wong, MH, Thelin, A., Hansson, L., Falk, PG, &amp; Gordon, JI (2001) Molecular analysis of commensal host-microbial relationships in the intestine. Science 291:

881-884.

19. Kelly, D., Campbell, JI, King, TP, Grant, G., Jansson, EA, Coutts, AG, Pettersson, S., &amp; Conway, S. (2004) Commensal anaerobic gut bacteria attenuation by regulating nuclear -cytoplasmic shuttling of PPAR-gamma and

Reia. Nat. Immunol. 5: 104-112.

20. Hapfelmeier, S., Lawson, MA, Slack, E., Kirundi, JK, Stoel, M., Heikenwalder, M., Cahenzli, J., Velykoredko, Y., Balmer, ML, Endt, K. and others . (2010) Reversible microbial colonization of germ-free mice reveals the dynamics of IgA immune responses. Science 328: 1705-1709.

21. Elkins, CA, Moser, SA, &amp; Savage, DC (2001) Genes encoding bile salt hydrolases and conjugated bile salt transporters in Lactobacillus johnsonii 100-100 and other Lactobacillus species. Microbiology 147: 3403-3412.

22. Louis, P., McCrae, SI, Charrier, C., &amp; Flint, HJ (2007). Organization of butyrate synthetic genes in human colonic bacteria: phylogenetic conservation and horizontal gene transfer. FEMS Microbiol. Lett. 269: 240-247.

23. Peterson, G., Kumar, A., Gart, E., &amp; Narayanan, S. (2011) Catecholamines increase conjugative gene transfer between enteric bacteria. Microb. Pathog.

24. Hayashi, F., Smith, KD, Ozinsky, A., Hawn, TR, Yi, EC, Goodlett, DR, Eng, JK, Akira, S., Underhill, DM, &amp; Adera, A. (2001) The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410: 1099-1103.

25. Vijay-Kumar, M., Sanders, CJ, Taylor, RT, Kumar, A., Aitken, JD, Sitaraman, SV, Neish, AS, Uematsu, S., Akira, S., Williams, IR et al. (2007) Deletion of TLR5 results in spontaneous colitis in mice. J Clin. Invest 117:

3909-3921.

26. De, PM, Gaboriau-Routhiau, V., Rainteau, D., Rakotobe, S., Taddei, F., &amp; Cerf-Bensussan, N. (2011) Trade-off between bile resistance and nutritional competence drives Escherichia coli diversification in the mouse gut. PloS Genet. 7: e1002107.

27. Giraud, A., Arous, S., De, PM, Gaboriau-Routhiau, V.,

Bambou, JC, Rakotobe, S., Lindner, AB, Taddei, F., &amp;

Cerf-Bensussan, N. (2008) Dissecting the genetic components of the Escherichia coli to the mouse gut. PLoS Genet. 4: e2.

28. Werth, M., Valentin, K., Aue, A., Schonheit, J., Wuebken, A., Pode-Shakked, N., Vilianovitch, L., Erdmann, B., Dekel, B., Bader , M. et al. (2010) The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development 137: 3835-3845.

29. Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, KS, Manichanh, C., Nielsen, T., Pons, N., Levenez, F., Yamada, T. and others (2010) A human gut microbial gene catalog established by metagenomic sequencing. Nature 464: 59-65.

30. Ukena, SN, Singh, A., Dringenberg, U., Engelhardt, R., Seidler, U., Hansen, W., Bleich, A., Bruder, D., Franzke, A.,

Rogler, G. et al. (2007) Probiotic Escherichia coli Nissle 1917 inhibits leaky gut by enhancing mucosal integrity. PLoS. They.

2: e1308.

31. Geraedts, MC, Troost, FJ, Tinnemans, R., Soderholm, JD, Brummer, RJ &amp; Saris, WH (2010).

Ann. Nutr. Metab. 56: 308-313.

32. McLaughlin, J., Grazia, LM, Jones, MN, D'Amato, M.,

Dockray, GJ, &amp; Thompson, DG (1999) Fatty acid chain length determines cholecystokinin secretion and effect on human gastric motility. Gastroenterology 116: 46-53.

33. Turnbaugh, PJ, Ley, RE, Mahowald, MA, Magrini,

V., Mardis, ER, &amp; Gordon, JI (2006) An obesityassociated gut microbiome with increased capacity for energy harvest. Nature 444: 1027-1031.

34. Tremaroli, V., Kovatcheva-Datchary, P., &amp; Backhed, F. (2010) A role for the gut microbiota in energy harvesting? Gut 59:

1589-1590.

35. Chevreux, B., Wetter, T., &amp; Suhai, S. (1999) Genome sequence assembly using trace signals and additional sequence

<td>information.</td><td>Computer Science and</td><td>Biology:</td><td>Proceedings</td><td>of the</td>

<td colspan="2">German Conference on Bioinformatics</td><td>(GCB) 99:</td><td>45-56.</td><td></td>

<td>36. Aziz, R.</td><td>K., Bartels, D., Best</td><td>, AA,</td><td>DeJongh, M.</td><td>, Disz,</td>

<td>T., Edwards,</td><td>RA, Formsma, K.,</td><td>Gerdes,</td><td>S., Glass,</td><td>EM</td>

Kubal, M. et al. (2008) The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9:75.

37. Dennis, G., Jr., Sherman, BT, Hosack, DA, Yang, J.,

Gao, W., Lane, HC, &amp; Lempicki, RA (2003) DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome

Biol. 4: 3.

38. Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., &amp; Leunissen, JA (2007) Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 35: W71-W74.

39. Duck, LW, Walter, MR, Novak, J., Kelly, D., Tomasi, M., Cong, Y., &amp; Elson, CO (2007) Isolation of flagellated bacteria implicated in Crohn's disease. Inflamm. Bowel. Dis. 13:

1191-1201.

40. Oliver, L., Canul, RR, Pereira-Pacheco, F., Cockburn, J., Soldani, F., McKenzie, NH, Duncan, M., OlveraNovoa, MA, &amp; Grant, G. (2003) Nutritional and physiological responses of young growing rats to diets containing raw cowpea seed meal, protein isolate (globulins), or starch. J Agric. Food Chem. 51: 319-325.

41. Sokol H., et al, PNAS, October 28, 2008, volume 105, no. 43,

16731-16736.

SEQUENCE LISTING &lt;0177] &lt;110&gt; GT Biologies Ltd &lt;120&gt; Bacteria for use as a probiotic for nutritional and therapeutic uses &lt;130&gt; P043712PCT &lt;140&gt; PCT / GB2012 / 052495 &lt;141&gt; 2012-10-08 &lt;150&gt; GB 1117313.5 &lt; 151&gt; 2011-10-07 &lt;160&gt; 4 &lt;170&gt; PatentIn version 3.5 &lt;210&gt; 1 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Roseburia hominis &lt;400&gt; 1

Ala Gin Tyr Asn Asp Asp Ala Lys Ser Val Leu Glu Ile Leu Lys 15 10 15 &lt;210&gt; 2

<td>&lt;211&gt;</td><td>14</td>

<td>&lt;212&gt;</td><td>PRT</td>

<td>&lt;213&gt;</td><td>Roseburia hominis</td>

<td>&lt;400&gt;</td><td>2</td>

Gly Leu Asn Lys Ala Ser Arg Asn Cheese Gin Asp Gly Ile Ser

<td>5 ¹</td><td>5 10</td>

<td>&lt;210&gt;</td><td>3</td>

<td>&lt;211&gt;</td><td>18</td>

<td>&lt;212&gt;</td><td>GOUT</td>

<td>&lt;213&gt;</td><td>Artificial sequence</td>

&lt;220&gt;

<td>&lt;223&gt;</td><td>General bacterial probe Eub338</td>

<td>&lt;400&gt;</td><td>3</td>

gctgcctccc gtaggagt 18 &lt;210&gt; 4

<td>15 &lt;211&gt;</td><td>23</td>

<td>&lt;212&gt;</td><td>GOUT</td>

<td>&lt;213&gt;</td><td>Artificial sequence</td>

&lt;220&gt;

<td>&lt;223&gt;</td><td>A probe specific to Roseburia hominis A2-183</td>

<td>20 &lt;400&gt;</td><td>4</td>

gtacattaca tactctgtca gtg 23