Pharmaceutical composition comprising despro36 exendin-4(1-39)-lys6 -nh2 for use in the treatment of a neurodegenerative disease

The present invention relates to a pharmaceutical composition for use in the prevention and / or treatment of a neurodegenerative disease, a composition comprising desPro³⁶Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant and / or adjuvant.

Alzheimer's disease [0002] Alzheimer's disease (AD) is a neurodegenerative disorder that results in the loss of cortical neurons, especially in the associative new cortex and hippocampus, which in turn leads to slow and progressive loss of cognitive functions, ultimately leading to dementia and death. The main signs of the disease are the aggregation and deposition of misfolded proteins (Bertram et al 2010; Mancuso et al 2010): (1) aggregated beta-amyloid peptide (Αβ) as extracellular senile or neurite plaques, and (2) hyperphosphorylated tau protein as intracellular neurofibrillary 'tangles' (NFT).

[0003] Genetically, AD is divided into two forms: (1) familial AD with an early onset of AD (<60 years) and (2) sporadic AD with late onset (> 60 years). It is known that rare disease-causing mutations in the amyloid protein precursor (APP), presenilin 1 genes (PSEN1) and presenilin 2 (PSEN2) result in familial AD of early onset, APOE (allele 4) is the single most important risk factor for late-onset AD ( Bertram et al 2010).

[0004] Mitochondrial disorders and oxidative stress, manifested by protein oxidation and lipid peroxidation, are characteristics of the AD brain. The imbalance between the production of reactive oxygen species (ROS) and the breakdown of chemically reactive species by antioxidants leads to oxidative stress. Ae has a direct oxidizing action, but it can also interfere with the mitochondrial redox activity, causing free radicals to grow. Neurons are less able to defend against the growth of ROS, because they have low levels of antioxidants compared to other types of mammalian cells, and thus are considered very susceptible to oxidative stress. The addition of Aβ to the culture of primary neurons

2+ causes ATPaz inhibition, changes in cellular potential and Ca influx²⁺ (Varadarajan et al 2000, Higginsa et al 2010).

[0005] Currently, there is no cure for this debilitating disease and there are few therapies approved by the US Food and Drug Administration (FDA) that do not stop the progression of AD and are only partially effective in relieving symptoms (Wollen 2010, Aderinwale et al 2010). Currently, licensed pharmaceutical therapies against AD are acetylcholinesterase inhibitors such as tacrine, Donepizil, rivastigmine, galantamine and NMDA receptor antagonists memantine. The effects of these drugs are very limited, and the main effect is again rather the reduction of symptoms than prevention of the development of the disease.

Other medicines may be given for a different indication than registered ones, such as statins (cholesterol-lowering substances), antihypertensives, anti-inflammatories or others. None of these drugs have been proven to reduce the progression of AD (Kaduszkiewicz et al 2005, Holscher, 2005). Other AD treatment strategies are being investigated. It has been found that the α-neuron growth factor (NGF) can reduce the number of senile plaques and improve cognitive functions (De

Rosa et al 2005). Because insulin resistance is now known to be one of the main problems in AD (Holscher and Li, 2010), instead of insulin alone, other growth factors, such as the glucagon-like incretin hormone peptide-1 (GLP-1), have shown good effects in preclinical studies. GLP-1 incretin analog liraglutide reduces the number of amyloid plaques, decreases betaamyloid levels, prevents cognitive impairment and synaptic dysfunction, reduces inflammatory response, and enhances the growth of synapse neurogenesis in the brain in the AD transgenic mouse model (McClean et al 2011). Amyloid plaques and the associated inflammatory response in the brain are the main characteristics of AD. Similar protective actions have been found with another analog of the GLP-1 receptor agonist on the AD transgenic mouse model (Li et al 2010).

Parkinson's disease [0006] Parkinson's disease (PD) is a chronic neurodegenerative muscle disorder characterized by the joint selective degeneration of nigrostriatal neurons, a significantly reduced ability to synthesize dopamine and, consequently, the lack of dopamine receptors in the striatum. (Gandhi et al 2005). Before the onset of clinical disease, the nigrostriatal neurons die in black matter compacta pars (SNC) silently probably as a result of the presence of simultaneous, apoptotic, excitotoxic free radicals mediated by neuroceptive events. A therapeutic strategy that offers cure or measures to stop PD pathology remains elusive. Established drug therapies are essentially palliative and are not effective in all patients. Because apoptotic cell death is one of the main components in the selective nigrostriatal death of neurons (Schapira 2001), future therapeutic strategies may include the deliberate use of biological molecules with anti-apoptotic properties. Alternatively, a positive therapeutic effect can be produced by molecules with neurotrophic properties or the ability to stimulate neurogenesis of cells with a dopaminergic phenotype. Recently, glucagon-like peptide-1 (GLP-1 receptor), an exendin-4 agonist, has been shown to have neurotrophic (Perry et al 2002) and neuroprotective properties (Perry et al 2002) properties in cultured PC12 cells subjected to stress excitotoxicity. It has recently been shown (Harkavyi et al 2008) that exendin-4 stops progression and even reverses changes in the substantia nigra, once fixed on two models of the PD mouse. In addition, exendin-4 treatment has been shown to protect dopaminergic neurons from degeneration, maintaining dopamine levels and improving motor function on the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) model of Pd (Li et al.

2009).

Huntington's disease [0007] Huntington's disease (HD) is an inherited neurodegenerative disorder characterized by involuntary body movements, as well as psychiatric disorders and cognitive functions. The genetic defect underlying HD involves the extension of the CAG trinucleotide repeats in exon 1 of the HD gene, resulting in the expansion of polyglutamine in the huntingtin protein (HTT). This leads to improper processing and harmful intracellular aggregation. It has recently been proven that exendin-4 treatment inhibits the development of the inclusion of the htt mutants in the pancreas and brain, improves metabolic activities and movement disorders and extends the survival of HD mice (Martin et al 2009).

Stroke [0008] Stroke pathophysiology involves the death of cortical neurons and striatum by apoptosis (Mattson, 2007).

[0009] Exendin-4 has recently been shown to reduce brain damage and a better functional outcome in transiently medium cerebral artery occlusion of the mouse stroke model (Li et al 2009). On the cerebral gerbil ischemic model, it was further demonstrated that stimulation of the GLP-1 receptor, an exendin-4 analogue, reduced the death of ischemic associated neurons by interfering with the activation of microglia prior to transient ischemic injury. (Lee et al 2011). Teramoto et al (2011) showed that exendin-4 is effective in a mouse model of ischemia-reperfusion injury of the brain. Exendin-4 treatment significantly reduces the volume of infarction and improves functional defect.

Peripheral sensory neuropathy [0010] Approximately 60-70% of people with diabetes have some degree of nervous system damage, particularly neuropathy, which causes loss of sensation in the hands and / or feet, slowing gastric peristalsis or carpal tunnel syndrome. There is currently no therapy that would reverse the neurological damage caused by prolonged hyperglycaemia and related metabolic disorders. The expression of GLP-1 has been identified in the neurons of the vagal mucus, suggesting the role of GLP-1 in peripheral neurotransmission (Nakagawa 2004). In the rodent model of pyridoxin-induced peripheral neuropathy in non-diabetic rodents, GLP1 and sc exendin-4, they showed partial protection against several pyridoxine induced functional and morphological deficiencies and facilitated normalization of axonal size (Perry et al 2007).

Cognitive function, mood and memory:

[0011] GLP-1 receptor agonists are able to improve cognition in rodents as measured in the Morris water maze; The GLP-1 knock-out receptor has a learning deficient phenotype that is restored after the transfer of the hippocampal gene to the GLP-1 receptor (During the course of time, et al. 2003). More recently, Isacson et al (2010) demonstrated the effect of chronic exendin-4 treatment of hippocampal cognitive function and mood-related behaviors in adult rodents. In another study, polyneuropathy found in the dorsal root ganglion of the mouse model of diabetes was reversed by exendin-4 (Himeno et al 2011). It was shown that another GLP-1 analogue, liraglutide,

Glucagon-like peptide 1 [0012] A glucagon-like peptide 1, GLP-1 or GLP-1 (7-36) is a 30-amino acid peptide hormone that is encoded in the proglucagon gene. It is mainly produced in endocrine L-cells and secreted into the bloodstream when food containing fat, protein hydrolyzate and / or glucose enters the duodenum. The most widely studied cells activated by GLP-1 are insulin-secreting beta-cells, where its defined action is to increase the secretion of insulin-induced glucose. By activating the GLP-1 receptor (GLP-1 R) in beta cells, adenylate cyclase (AC) is activated and cAMP generated, which in turn leads to activation of cAMP-dependent second messenger pathways, such as protein kinase A (PKA) pathways and Epac. Also the short-term effects of glucose-induced increased insulin secretion, continuous activation of GLP-1R increases insulin synthesis, beta cell proliferation and neogenesis (Doyle et al 2007). In addition, GLP-1 usually regulates glucagon levels, slows gastric emptying, stimulates biosynthesis (Pro-) of insulin, increases insulin sensitivity, and stimulates insulin-independent glycogen biosynthesis (Holst (1999), Curr Med Chem 6: 1005; Nauck et al. (1997) Exp Clin Endocrinol Diabetes 105: 187; Lopez-Delgado et al (1998) Endocrinology 139: 2811).

The specific effects of GLP-1 on insulin and glucagon secretion have induced research activity over the past 20 years ending with the naturally occurring GLP-1 receptor (GLP-1R) agonist, exendin 4, currently used in the treatment of type 2 diabetes mellitus (T2DM ) (Doyle et al 2007).

[0014] In tissues other than the pancreas (brain, kidney, lung, heart and large blood vessels), GLP-1 can activate a specific guanine binding protein (G-protein coupled to the receptor).

[0015] GLP-1 has similar growth factor as well as neuroprotective properties (McClean et al 2010). GLP-1 also decreases the induction of apoptosis of hippocampal neurons and improves spatial and associative learning (During et al. 2003). Perry et al (2002) reported that GLP-1 can completely protect cultured rat hippocampal neurons against glutamate-induced apoptosis. The GLP-1 (Val8) GLP-1 and N-acetyl-GLP-1 analogs have an outstanding effect on the long-term enhancement of synaptic transmission (LTP) in the hippocampus (McClean et al 2010). The GLP-1 analogue liraglutide reduced the number of amyloid plaques, decreased beta-amyloid levels, prevented cognitive impairment and LTP depression, decreased inflammatory response and enhanced synapse neurogenesis in the hippocampus of the AD model in transgenic mice (McClean et al 2011). GLP-1 was shown to be liraglutide and exendin-4 cross the blood-brain barrier (BKM) (Kastin et al 2001; McClean et al 2011). Perry et al (2003) found that GLP-1 and exendin-4 reduced levels of beta-amyloid in the brain and amyloid precursor protein in neurons. Chronic treatment with Exendin-4 or Liraglutide affects cell proliferation and neuroblast differentiation in adult mice in the hippocampus dentate gyrus (Li et al 2010, Hamilton et al 2011).

[0016] Liraglutide (Liraglutide) is a GLP-1 analog having the formula Arg³⁴, Lys²⁶(NY glutamyl (N^and-heksadekanoilo))) GLP-1 (7-37). Liraglutide is usually given parenterally.

[0017] DesPro compound³⁶Exendin-4 (1-39) -Lys6-NH2 (AVE0010, lixisenatide) is an analogue of exendin-4. Lixisenatide (Lixisenatide) is disclosed as SEQ ID NO: 93 in WO 01/04156:

SEQ ID NO: 1: liksisenatide (44 AS)

GGPSSGARPSKKKK Κ-Κ-ΝΗϊ

SEQ ID NO: 2: exendin-4 (39 AS)

H "GEGTFTSDLSKQME EEAVRLFIEWLK-NG-GP" S "SGAPPPS-HH2

SEQ ID NO: 3: GLP-1 (7-36) (30 AS) * y

HAEGTFTSDVSSYLEGQAAK ~ EFIAWLV "KG-R [0018] Exendins are a group of peptides that can lower blood glucose. Exendins have amino acid sequence identity of only about 50% with GLP-1 (7-36). Therefore, exendins are usually not seen as GLP-1 analogues.

[0019] The lixisenatide is characterized by a C-terminal branching of the native exendin-4 sequence. Lixisenatide contains six C-terminal lysine residues absent in exendin4. Until now, lixisenatide has not been considered a suitable drug for the treatment of CNS disorders, especially neurodegenerative diseases, because all C-terminal lysine residues can prevent drug transfusions across the blood-brain barrier. Currently, there is no indication that lixisenatide can be transported across the blood-brain barrier through a specific and / or regulated mechanism.

[0020] In example 1 according to the invention, lixisenatide has been shown to have improved properties compared to the GLP-1 analog of liraglutide and exendin-4, both of which are currently used as treatment for type 2 diabetes:

(a) surprisingly, lixisenatide can cross the blood-brain barrier. The data of the invention indicate that the transport is regulated because the transport rate at higher concentrations is limited to a higher level. In addition, lixisenatide is taken into the brain at a lower parenteral dose compared to liraglutide.

b) lixisenatide activates GLP-1 receptors in the brain and induces cAMP production. Surprisingly, lixisenatide produces higher levels of cAMP than liraglutide, demonstrating a higher efficacy in the activation of the GLP-1 receptor at the same dose.

(c) lixisenatide may induce proliferation of progenitor cells in the dentate gyrus. Compared with exendin-4 or liraglutide, lixisenatide provides enhanced effects when given at the same dose. In neurodegenerative diseases, these activities may be a disease-modifying effect.

(d) lixisenatide had better neuroprotective properties (against cellular stress) in the dentate gyrus compared to liraglutide.

(e) a surprisingly initial treatment with a 10 nM dose of lixisenatide was sufficient to protect SH-SY5Y neuroblastoma cells from the 1200 μΜ methylglyoxal-induced stress. A 200 nM dose of liraglutide was needed to protect cells from the 1200 micrograms of methylglyoxal induced stress, indicating that the lower dose of lixisenatide is effective to induce protection (see also data from Example 2 obtained by initial treatment with two GLP-1 agonites).

[0021] Example 2 shows that post-treatment with lixisenatide was sufficient to protect SH-SY5Y neuroblastoma cells from stress induced by 2 mM methylglyoxal or stress induced by 1 mM H2O2. In contrast, liraglutide does not protect cells from stress caused by MG or H2O2.

[0022] In example 3, lixisenatide has a significant neuroprotective effect on the rotenone treated LUHMES cells for neurodegeneration. Lixisenatide provides advantages over other GLP-1 receptor (GLP-1R) agonists. In LUHMES cells treated with rotenone, lixisenatide is significantly active at 3-fold lower concentrations than liraglutide, resulting in a mitigating and unexpectedly superior activity on the methyl glyoxal model of Example 1. Exenatide does not have significant effects at concentrations of 0.3 and 1 μΜ. In contrast, lixisenatide represents a dose-dependent improvement in viability at these concentrations.

[0023] Example 4 shows that treatment with lixisenatide in vivo leads to a reduction in the burden of amyloid plaques in the brain of transgenic mice of Alzheimer's disease models.

Therefore, in addition to its neuroprotective properties, lixisenatide may reduce pathological changes in the brain, such as amyloid plaques, and therefore represents an attractive prevention and / or treatment of Alzheimer's disease. Activity is observed at the lower dose (10 nmol / kg) than previously described for liraglutide (25 nmolm / kg) McLean et al (2011).

[0024] Thus, lixisenatide is suitable for the treatment and / or prevention of neurodegenerative diseases as described herein, for example in Alzheimer's disease, Parkinson's disease and / or stroke.

[0025] The first aspect of the invention is a pharmaceutical composition for use in the prevention and / or treatment of a neurodegenerative disease, a composition comprising desPro³⁶Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant and / or adjuvant.

[0026] Another aspect of the invention is a pharmaceutical composition for use in the treatment of a neurodegenerative disease, a composition comprising desPro³⁶Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant and / or adjuvant.

[0027] A neurodegenerative disease can be any neurodegenerative disease, especially a neurodegenerative disorder, which is associated with oxidative stress, loss of neurite integrity, apoptosis, neuronal loss and / or an inflammatory response.

[0028] In the invention, the loss of neurite integrity includes the loss of dendritic projections, loss of synaptic plasticity, and / or the loss of new compensatory neurites.

[0029] A neurodegenerative disease may be associated with cognitive impairment.

[0030] In particular, the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease, progressive supranuclear disease (PSP), multiple sclerosis (MSA), dementia with Lewi bodies, dementia with Parkinson's disease, epilepsy, stroke, Huntington's chorea, cerebral hypoxia, multiple sclerosis and peripheral neuropathy. Peripheral neuropathy may be associated with diabetes.

[0031] It is preferred that the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease and stroke.

[0032] It is also preferred that the neurodegenerative disease is selected from the group consisting of progressive supranuclear palsy, multivisual atrophy, dementia with Lewie bodies, Parkinson's disease and dementia from Parkinson's disease. Any of these diseases may be associated with parkinsonism.

[0033] Progressive supranuclear palsy and multivisual atrophy are collectively known as Parkinson's plus syndromes.

In the invention, Parkinsonism is a neurological syndrome that is characterized by a combination of specific symptoms such as tremor, hypokinesia, stiffness, and / or postural instability.

[0035] In one embodiment, the neurodegenerative disease is Alzheimer's disease. Alzheimer's disease may be related to oxidative stress and loss of neurons.

[0036] In another embodiment, the neurodegenerative disease is Parkinson's disease. Parkinson's disease may be associated with oxidative stress, inflammatory response, apoptosis, loss of neurons, especially the loss of dopaminergic neurons, for example loss of neurons in the substantia nigra, resulting in a lack of dopamine.

[0037] Loss of neurons can be caused by apoptosis.

[0038] In another embodiment, the neurodegenerative disease is progressive supranuclear palsy. Progressive supranuclear palsy may be associated with the loss of neurons, especially the loss of dopaminergic neurons.

[0039] In another embodiment, the neurodegenerative disease is a multisystem disorder. Multiple systemic loss may be associated with the loss of neurons, especially the loss of dopaminergic neurons.

[0040] In another embodiment, the neurodegenerative disease is dementia with Lewie bodies. Dementia with Lewie bodies may be associated with the loss of neurons, especially the loss of dopaminergic neurons. Dementia with Lewie bodies may be associated with Parkinson's disease.

[0041] In another embodiment, the neurodegenerative disease is dementia from Parkinson's disease. Dementia from Parkinson's disease may be associated with the loss of neurons, especially the loss of dopaminergic neurons. Especially dementia of Parkinson's disease is associated with Parkinson's disease.

[0042] In yet another embodiment, the neurodegenerative disease is stroke. Stroke may be associated with loss of neurons caused by ischemia, where ischemia may be caused by a blockage (such as thrombosis or arterial embolism) or haemorrhage.

[0043] In yet another embodiment, the neurodegenerative disease is multiple sclerosis, which may be associated with inflammatory processes in the CNS. The data of the invention show that (a) lixisenatide provides neuroprotective and / or neurogenic effects, and (b) lixisenatide is superior to other GLP-1 agonists, such as exendin-4 and liraglutide. Thus, lixisenatide may provide disease-modifying activity in neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and stroke. In particular, the administration of lixisenatide is suitable for early treatment of neurodegenerative diseases, as neuroprotection and neurogeneration can slow down the disease and thus improve the quality of life.

[0044] Thus, in one aspect of the invention, the neurodegenerative disease is in an early stage. For example, Alzheimer's disease may be Alzheimer's disease at an early stage. Early-onset Alzheimer's disease (AD) is also called prodromal Alzheimer's disease or pre-disease Alzheimer's disease. (Dubois et al. 2010). The early stage of Alzheimer's disease can be defined as: patients presenting objective memory complaints related to complementary biomarker data or pathologies of Alzheimer's disease: in cerebrospinal fluid (CSF), low levels of β-amyloid peptide ratio 42 (Ab42) relative to protein are found Tau or amyloid plaques are detected in the brain by a PET amyoid (positron emission tomography) with an agent such as AmyVid ™ from E. Lilly (Avid).

[0045] In another example, Parkinson's disease may be associated with Parkinson's disease at an early stage. In yet another embodiment, the progressing supranuclear palsy can be progressive supranuclear fits at an early stage. In yet another embodiment, the multi-chip loss may be a multi-chip loss at an early stage. In another example, dementia with Lewie bodies may be dementia with early-onset Lewie bodies. In another example, dementia from Parkinson's disease may be associated with dementia from Parkinson's disease at an early stage.

[0046] Furthermore, lixisenatide is suitable for the prevention of neurodegenerative diseases, especially in those patients suspected of suffering from neurodegenerative diseases without a clear diagnosis. In another aspect of the invention, the pharmaceutical composition as described herein is intended for use in the prevention of neurodegenerative diseases. In the context of the invention, desPro³⁶Exendin-4 (1-39) -Lys6-NH2 (lixisenatide) includes its pharmaceutically acceptable salts. The skilled person knows the pharmaceutically acceptable salts of lixisenatide. The preferred pharmaceutically acceptable lixisenatide salt used in the invention is acetate.

[0047] In the invention desPro³⁶Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof may be administered to a patient in need thereof in an amount sufficient to effect a therapeutic effect.

[0048] In the invention desPro³⁶Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof may be formulated with suitable pharmaceutically acceptable carriers, adjuvants and / or excipients.

[0049] The pharmaceutical composition for use in the invention provides disease-modifying effects through its neuroprotective and neuroregenerative effects, as described herein, in a neurodegenerative disease as described herein. In particular, a disease-modifying response can be obtained in the treatment of a neurodegenerative disease as described herein, e.g. in Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple sclerosis, dementia with Lewi bodies, dementia with Parkinson's disease, epilepsy, stroke, Huntington's chorea, cerebral hypoxia. , multiple sclerosis and peripheral neuropathy.

[0050] The pharmaceutical composition for use according to the invention may be administered parenterally, e.g. by injection (such as intramuscular or subcutaneous injection). Suitable injection devices are known, e.g. so-called & quot; pens & quot; comprising a cartridge containing the active ingredient and an injection needle. DesPro³⁶ Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof can be administered in a suitable amount, for example in an amount ranging from 1 to 50 μg per dose, 5 to 40 μg per dose, 10 to 30 μg per dose, 10 to 15 μg per dose or 15 to 20 μg per dose.

[0051] In the invention desPro compound³⁶Exendin-4 (1-39) -Lys6-NH2 and / or a pharmaceutically acceptable salt thereof may be administered in a daily dose in the range of 1 to 50 mg, in the range of 5 to 40 mg, in the range of 10 to 30 mg, in the range of 10 to 20 mg, in the range of 10 to 15 mg or in the range of 15 to 20 mg. The composition may be administered by one injection per day.

[0052] In the invention the composition can be provided as a liquid composition. The skilled person knows liquid lixisenatide compositions suitable for parenteral administration. The liquid composition may have an acidic or physiological pH.

[0053] The acidic pH is preferably in the pH range 1-6, pH 3.5 - 6.8 or pH 3.5 - 5. The physiological pH is preferably in the pH range 2.5 - 8.5, pH 4, 0 - 8.5 or pH 6.0 - 8.5. The pH can be adjusted by a pharmaceutically acceptable dilute acid (typically HCl) or a pharmaceutically acceptable dilute base (typically NaOH).

[0054] The liquid composition may contain a suitable preservative. A suitable preservative may be selected from phenol, m-cresol, benzyl, and p-hydroxybenzoic acid ester. A preferred preservative is m-cresol.

[0055] The liquid composition may contain a tonic substance. A suitable tonicity agent can be selected from glycerol, lactose, sorbitol, mannitol, glucose, NaCl, calcium or magnesium containing compounds, such as CaCl2. The concentration of glycerol, lactose, sorbitol, mannitol and glucose may be in the range of 100 - 250 mM. The NaCl concentration may be up to 150 mm. The preferred tonicity agent is glycerol.

[0056] The liquid composition may comprise methionine from 0.5 μg / ml to 20 μg / ml, preferably from 1 μg / ml to 5 μg / ml. Preferably, the liquid composition comprises L-methionine.

[0057] Also described is a method of preventing and / or treating medical indications as described herein. For example, the method may comprise administering a pharmaceutical composition as described herein. This method can be a method for the prevention and / or treatment of neurodegenerative diseases as described herein.

[0058] In particular, the method as described herein induces a disease modifying response, for example by neuroprotection and / or neurogeneration.

[0059] In the method described herein, disease-modifying therapy is provided for its neuroprotective and neuroregenerative effects, as described herein, by administering a pharmaceutical composition as described herein in a neurodegenerative disease as described herein. In particular, a disease-modifying response can be obtained in the treatment of a neurodegenerative disease as described herein, e.g. in Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple sclerosis, dementia with Lewi bodies, dementia with Parkinson's disease, epilepsy, stroke, Huntington's chorea, cerebral hypoxia. , multiple sclerosis and peripheral neuropathy.

[0060] In the method described herein, a therapeutically effective amount of a pharmaceutical composition is administered as described herein.

[0061] The invention is further illustrated by the following examples and figures.

Legends to figures [0062]

Fig. 1 (A) Total lixisenatide (pmol / L) concentration measured in the brains of wild-type female mice (n = 5, mean age 24 weeks) at 30 min after ip saline carrier injection (0.9% w, v NaCl) or ix of lixisenatide (2.5, 25 or 250 nmol / kg of body weight). Values ​​are the mean ± SEM * = p <0.05, ** = p <0.01. (B) Total lixisenatide (pmol / L) concentration measured in the brains of wild-type female mice (n = 5, average age 24 weeks) for 3 h after ip injection of saline carrier (0.9% w / v NaCl) or ip lixisenatide (2.5, 25 or 250 nmol / kg body weight). Values ​​are the mean ± SEM * p <0.05.

Fig. 2. (A) Total liraglutide concentration (pmol / L) measured in the brains of wild-type female mice (n = 5) during 30 min after ip injection of physiological saline vehicle (0.9% w / v NaCl) or ip liraglutide (2.5, 25 or 250 nmol / kg body weight). Values ​​are the mean ± SEM * = p <0.05, ** = p <0.01. (B) Total liraglutide concentration (pmol / L) measured in the brains of wild-type female mice at 3 h after ip injection of saline carrier (0.9% w / v NaCl) or ip liraglutide (2.5, 25 or 250 nmol) / kg body weight). Values ​​are the mean ± SEM * = p <0.05.

Fig. 3. (A) Injection of 25 nmol / kg b in liraglutide ip. 30 min before analysis showed a significant increase in cAMP in the brain compared to controls (p <0.05, t-test). (B) Injection of 25 nmol / kg b in lixisenatide ip. 30 min before analysis showed a significant increase in cAMP in the brain compared to controls (p <0.01, t-test). (C) When the effects of liraglutide and lixisenatide are directly compared, there is a significant difference between drugs (p <0.05, t-test).

Fig. 4. Injectable effect once a day either with exendin-4, liraglutide or lixisenatide 25 nmol / kg bw. for 3 weeks on cell proliferation in the dentate gyrus (BrdU staining). Values ​​are the mean ± SEM * p <0.05, ** = p <0.01. Lixisenatide has increased cell proliferative activity compared to exendin-4 and liraglutide (p <0.05) and controls (p <0.01).

Fig. 5. Histological analysis of the chronic non-lixisenatide ip. once a day for 3 weeks (25 nmol / kg bw ip.). In BrdU immuno-histological analyzes, more new cells were found in the area of ​​the dentate gyrus brain. There were also many young neurons (double cortin staining). Values ​​are the mean ± SEM * = p <0.05, ** = p <0.01.

Fig. 6. (A) LDH analysis. Pre-treatment of SH-SY5Y cells with lixisenatide followed by methylglyoxylic stress. (*** <0.0001). The 10 nM dose of lixisenatide was sufficient to protect cells from the stress caused by 1200 μΜ methylglyoxal. (B) LDH analysis. Initial treatment of SH-SY5Y cells with liraglutide followed by methylglyoxyl stress. * P <0.05. ** "p <0.001, *** p <0.0001). A 200 nM dose of liraglutide was sufficient to protect cells from the stress caused by 1200 μΜ methylglyoxal. Lower doses of 10 nM or 100 nM did not show any effect.

Fig. 7. Treatment after stress with lixisenatide or liraglutide, followed by treatment with methylglyoxal (MG) and hydrogen peroxide (H₂ABOUT₂). The X axis indicates different analysis conditions, and the Y axis represents the absorbance. * = p <0.05, ** p <0.01. (A) lixisenatide after treatment, (B) liraglutide after treatment.

Fig. 8. Initial treatment with lixisenatide or liraglutide followed by stress on methylglyoxal (MG). The X axis indicates different analysis conditions, and the Y axis represents the absorbance. * = p <0.05, *** p <0.001. The healing effects of (A) lixisenatide, (B) liraglutide and (C) ecsentin-4.

Figure 9. Neuroprotection of LUHMES cells (expressed as the percentage reversal of the decrease in normalized cell viability induced by rotenone exposure) in the presence of different concentrations of lixisenatide. Rot. = rotenone.

NS = unreal; * = p <0.05; *** = p <0.001.

Figure 10. Neuroprotection of LUHMES cells (expressed as the percentage reversal of the decrease in normalized cell viability induced by rotenone exposure) in the presence of different concentrations of exendin-4 / exenatide. Rot. = rotenone. NS = not real. * = p <0.05.

Figure 11. Neuroprotection of LUHMES cells (expressed as the percentage reversal of the decrease in normalized cell viability induced by rotenone exposure) in the presence of different concentrations of liraglutide. Rot. = rotenone. NS = unreal; *** = p <0.001.

Fig. 12. Treatment with lixisenatide reduces the burden of amyloid plaques in the brain of a person with Alzheimer's disease of transgenic mice: Treatment with lixisenatide in APP / PS1 transgenic mice at 7 months of age for 70 days (10 nmol / kg, ip, daily) reduces the burden of amyloid plaques as counted quantitatively by amyloid beta immunohistochemistry and determination of the% amyloid positive β field cross-section of the cerebral cortex. Values ​​are an average of +/- SEM (** = p <0.01).

Fig. 13. Treatment with lixisenatide reduces the burden of amyloid plaques in the brain of a person with Alzheimer's disease of transgenic mice: Treatment with lixisenatide in APP / PS1 transgenic mice at 7 months of age (Alzheimer's disease model) for 70 days (10 nmol / kg, ip, daily) loading of mature amyloid plaques in the brain as quantified by histological staining with Congo red and determination of% positive area for Congo red on cross-sections of the cerebral cortex. Values ​​are an average of +/- SEM (* = p <0.05).

Example 1 [0063] Lixisenatide is a peptide drug that is usually parenterally administered. To induce activity against neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multi-systemic atrophy, dementia with Lewie bodies, dementia from Parkinson's disease or lixisenatide stroke must cross the blood-brain barrier. Lixisenatide, especially if administered parenterally, is suitable for the treatment and / or prevention of neurodegenerative diseases, if lixisenatide provides one or more of the following features:

(a) lixisenatide may cross the blood-brain barrier,

b) lixisenatide activates GLP-1 receptors in the brain and induces physiological actions by activating receptors, (c) lixisenatide provides disease modifying effects on appropriate models, (d) lixisenatide is neuroprotective on appropriate models, and (e) lixisenatide provides benefits over GLP-1 receptor agonists such as liraglutide or exenatide.

Uptake of lixisenatide by the brain [0064] This example describes whether the GLP-1 receptor agonist lixisenatide crossed the blood-brain barrier (BKM). Three doses (2.5 nmol / kg bw, 25 nmol / kg bw and 250 nmol / kg bw, ip.) Were tested, and the levels of 30 min and 3 h after injection in mouse brain tissue were tested. Levels of lixisenatide were fortified 30 minutes after delivery at all doses tested and both low (2.5 nmol / kg body weight) and mean (25 nmol / kg body weight) were detected, but not at a high dose of 250 nmol / kg b in lixisenatide. This difference suggests that lixisenatide transport to the brain is regulated, limiting the influx with high concentrations of the lixisenatide studied here (Fig. 1).

Comparison of lixisenatide uptake with liraglutide uptake in the brain [0065] The above results for liraglutide were compared to those of the GLP-1 agonist liraglutide (Victoza by Novo Nordisk). As discussed above and shown in Figures 1 and 2, levels of lixisenatide showed a significant increase in the brain at the lowest dose of 2.5 nmol / kg body weight ip, whereas liraglutide did not show an increase in this dose (Figure 2), suggesting that lixisenatide is absorbed in the brain at lower concentrations than liraglutide.

[0066] From this finding it should be concluded that lixisenatide requires a lower dose of lixisenatide to cross the blood-brain barrier compared to liraglutide so that it can exert a therapeutic effect in neurodegenerative diseases as described herein at lower doses compared to liraglutide.

Activation of the GLP-1 receptor in the brain / cAMP production [0067] Initial studies have shown that lixisenatide activates the pancreatic GLP-1 receptor, which is associated with an increase in cAMP levels (for review, see, for example, Doyle et al., 2007) ] This example demonstrates for the first time that lixisenatide ip injection increases the amount of cAMP in the brain, indicating that lixisenatide activates GLP-1 receptors in the brain (Figure 3b). A direct comparison of the effects of lixisenatide (25 nmol / kg body weight, ip) and liraglutide (25 nmol / kg body weight, ip, on the results see Figure 3a) on the GLP-1 receptor is shown in Figure 3c. Lixisenatide produces significantly higher levels of cAMP than liraglutide (* = p <0.05), at the same dose, indicating a greater efficacy of lixisenatide.

Neurogenerative effects / actions modifying the lixisenatide disease in the brain [0069] The effects of chronic lixisenatide ip, exendin-4 ip and liraglutide ip for 3 weeks, during which the progenitor core cell proliferation was investigated. Increased cell proliferation in the dentate gyrus (BrdU staining, Figures 4 and 5) was found. Surprisingly, lixisenatide significantly increases cell proliferation (* = p <0.05) compared to exendin-4 or liraglutide, indicating that lixisenatide is more effective in the brain than exendin-4 and liraglutide when injected at the same dose.

[0070] Furthermore, the number of small neurons in the dentate gyrus increased after lixisenatide administration compared to liraglutide (double cortin spots, data not shown), indicating that the progenitor cells differentiate into neurons. This shows that lixisenatide induces a sustained improvement.

[0071] These actions of lixisenatide on stem cells (proliferation and differentiation) are an important aspect of brain repair, so these effects can provide a disease-modifying effect in neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and stroke.

Neuroprotective effects of lixisenatide in the brain [0072] In studies of neural cell culture, lixisenatide was tested to determine if it has neuroprotective effects in cellular stress conditions. The toxic drug methylglyoxal was used to reduce cell viability. The addition of lixisenatide showed neuroprotective effects in a dose-dependent manner (Fig 6a), resulting in 100% protection at all doses with the lowest concentration of methylglyoxal and maintaining protection even at the highest concentration of methylglyoxal tested. The nM dose of lixisenatide was sufficient to protect cells from the stress caused by 1200 μΜ of methylglyoxal.

[0073] In addition, lixisenatide showed better protection compared to liraglutide. Fig. 6b shows that liraglutide is unable to protect the cell at a dose of 10 nM. A 200 nM dose of liraglutide was required to protect the cell against 1200 μΜ methylglyoxal-induced stress, lower doses of 10 or 100 nM had no effect.

Materials and methods

Measurement of cAMP in the brain

Animals [0074] Female wild type mice (C57BL / 6) 5 per group were used. For cAMP measurement, mice were injected ip 25 nmol / kg body weight (bw) with liraglutide, lixisenatide or saline (0.9% wv) as a control in two separate experiments. 30 min after injection, the brains of mice were immediately removed and froze quickly.

Tissue cAMP extraction [0075] Each brain was extracted using 0.1 M HCl. 10 ml 0.1 M HCl per g tissue was added. Samples were sonicated and then centrifuged at 10,000 rpm for 15 g at 4 ° C. The supernatant was poured and used directly for cAMP ELISA (Enzo Life Sciences) measurement. Dilutions were prepared using 0.1 M HCl provided in the kit.

Immunohistochemistry Animals were dosed with BrdU (180 mg / kg body weight ip) 18 hours before their anesthesia with pentobarbitone (0.3 ml, Euthanal Bayer AG, Leverkusen, Germany) and perfused intracardially with PBS followed by 4% paraformaldehyde. The brains were removed and placed in 30% sucrose in PBS overnight. Immunohistochemistry for BrdU or doublekortin (DCX) was performed on 45 μm free floating sections. The activity of endogenous peroxidase was quenched by incubating the sections in 3% hydrogen peroxide. DNA denaturation included incubation in 2 N HCl, followed by 0.1 M borax for 10 minutes. Sections incubated with BrdU primary antibody (1: 200 anti-BrdU monoclonal mouse monoclonal antibody, Sigma) or DCX polyclonal antidoubleortin bottom (1: 200, Santa Cruz, USA, SC-710) overnight at 4 ° C. Secondary antibody was then used: (1: 200, horse anti-mouse, Vector elite ABC kit, mouse, Vector laboratories). Sections were incubated in biotin avidin enzyme reagent and incubated in Vector SG substrate chromogen (see Gengler et al. 2010) for details.

Microscopy [0077] Sections were analyzed using an Olympus CX 40 microscope using stereological techniques. This involves starting a random cut and collecting every 5th slice in the entire granular cell layer (GCL) of the dentate gyrus (DG). The analysis was performed using an x40 lens, and representative images were taken using a 5.1 MPix digital camera. 4-6 brains of mice were analyzed for each group of drugs. Between 8 and 12 slices were taken from each brain. The brain regions were analyzed in the range of -1.3 to -2.5 mm of the dark. All positive cells in the DG were counted using ImageJ software (free NIH http: //rsbweb.nih.govl/ij/). In GCL, positive cells for BrdU or DCX were counted.

SH-SY5Y cell line [0078] SH-SY5Y is a three-fold cloned human neuroblastoma cell line, which was created in 1970 from a bone marrow biopsy with metastasis of a neuroblastoma site in a four-year-old girl. These cells have dopamine hydroxylase beta activity, are acetylcholinergic, glutamatergic and adenosine. SH-SY5Y cells grow as a mixture of floating and adherent cells, as well as in the form of clusters of neuroblastic cell forms with many short, thin cellular processes. Treatment with retinoic acid and cholesterol can force cells to grow dendrites and differentiate.

Pre-treatment of SH-SY5Y cells with lixisenatide or liraglutide followed by stress on methylglyoxal induced SH-SY5Y cells were grown in minimal necessary Dulbecco F12 medium (1: 1) and Glutamax supplemented with 10% heat-inactivated (heated to 56 ° C for 20 minutes). min) fetal bovine serum and penicillin and streptomycin and incubated in 5% CO2 humidity, 37 ° C in an incubator. The cells were trypsinized, 80% confluent and after cell counting, Trypan blue exclusion (Countess, Invitrogen) 2x10⁴ cells were plated on a laminin-coated 96-well plate (Nunc, Inc.) at 95% cell viability.

After 12 hours of cell binding, cells pre-treated with lixisenatide or liraglutide at various doses of 10 nM, 100 nM and 200 nM, followed by the addition of methylglyoxal stressors in medium without serum at 300 μΜ, 600 μΜ (up to 1200 μm (Fig. 6A and 6B) Data were analyzed by PRISM 5.0c (GraphPad Software, Inc.) and significance was defined as values ​​of p <0.05 or less.

Effect of pre-treatment with lixisenatide or liraglutide on SH-SY5Y cells stressed with hydrogen peroxide. Cells were pre-treated with 10 nM and 100 nM liraglutide or lixisenatide followed by the addition of a hydrogen peroxide stressor in serum free medium at 200 μΜ, 400 μΜ and 800 μΜ.

LDH analysis [0081] Cell culture media were analyzed using sensitive lactate dehydrogenase (LDH) analysis (Sigma). LDH analysis provides for measurement of the number of dead cells by means of total cytoplasmic LDH or by integrity of the membrane as a function of the amount of cytoplasmic LDH released into the medium. Measurement of released LDH is based on the reduction of NAD by the action of LDH. The resulting reduced NAD (NADH) is used in the stoichiometric conversion of the tetrazolium dye. The final colored compound is measured by colorimetry.

Summary [0082] The data of the example show that lixisenatide is suitable for the treatment and / or prevention of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple atrophy, dementia with Lewie bodies, dementia from Parkinson's disease or stroke. In addition, lixisenatide has better properties compared to the GLP-1 analogs of liraglutide and exendin-4, both of which are currently used as treatment for type 2 diabetes.

[0083] The example data in particular indicate that (a) surprisingly lixisenatide can cross the blood-brain barrier. The data of the invention indicate that the transport is regulated because the transport rate at higher concentrations is limited to a higher level. In addition, lixisenatide is taken into the brain at a lower parenteral dose compared to liraglutide.

(b) lixisenatide activates GLP-1 receptors in the brain and induces cAMP production. Surprisingly, lixisenatide produces higher levels of cAMP than liraglutide, which is more effective in activating the GLP-1 receptor at the same dose.

(c) lixisenatide may induce proliferation of progenitor cells in the dentate gyrus. In comparison with exendin-4 or liraglutide, lixisenatide gives enhanced effects when given the same dose. In neurodegenerative diseases, these activities may be a disease-modifying effect.

(d) surprisingly lixisenatide had better neuroprotective properties (against cellular stress) in the dentate gyrus compared to liraglutide.

(e) a surprisingly initial treatment with a 10 nM dose of lixisenatide was sufficient to protect SH-SY5Y neuroblastoma cells from the 1200 μΜ methylglyoxal-induced stress. A 200 nM dose of liraglutide was needed to protect cells from the 1200 micrograms of methylglyoxal stress, indicating that the lower dose of lixisenatide is effective to drive protection.

Example 2

Treatment after stress with lixisenatide or liraglutide, after treatment with methylglyoxal (MG) and with hydrogen peroxide (H2O2).

[0084] SHSY-5Y cells were seeded into 96 well plates and after 12 hours of starvation plasma was stressed with 600 μM and 1 mM H₂ABOUT₂ and 1 mM and 2 mM MG for 3 h. Cells were treated with 0, 1, 10, 50 and 100 nM lixisenatide and 0, 10, 50, 100 and 200 nM of liraglutide. After 24 hours, 50 μL of the reagent XTT was added and incubated for 8 hours. The volume of the analysis was 100 μl.

[0085] Fig. 7 shows that after treatment with lixisenatide the number of cells surviving the stress of MG or H 2 O 2 significantly increased in a dose-dependent manner (see in particular data obtained using 600 gM H₂ABOUT₂ and 2 mM Mg Fig. 7A). Liraglutide does not protect cells from stress caused by MG or H2O2 (Fig. 7B).

Pre-treatment with lixisenatide or liraglutide followed by stress on methylglyoxal (MG) [0086] SHSY-5Y cells were seeded into 96 well plates and after 12 hours of starvation plasma was treated with 0, 1, 10, 50 and 100 nM of lixisenatide and 0, 10, 50 , 100 and 200 nM liraglutide and exendin-4 for 4 h, and then stress was treated with 400 gM and 600 g MG for 14 h. 50 g of XTT reagent was added and plates were incubated for 8 h.

[0087] Fig. 8 shows that pre-treatment with lixisenatide before stress with MG or H2O2 significantly increases the number of surviving cells in a dose-dependent manner, starting with the lowest dose of 1 nM with the best results at 50 nM (Figure 8A). Liragutide also protects cells, but only at a higher dose of 100 nM (Figure 8B). Exendin-4 does not protect cells from stress caused by MG or H2O2 (Fig. 8C).

Materials and methods

Analysis of the initial treatment of SH-SY5Y cells using methylglyoxal as a stressor.

[0088]

1. SHSY-5Y cells were maintained on DMEM + F12 Glutamax medium (Cat. No. 313310, Invitrogen Inc.) with 10% FBS (Cat. No. 10437, Invitrogen Inc.) and 1% Penn Strep (Cat No. 15070063, Invitrogen Inc) .).

2. 80-90% of the pooled culture was trypsinized using a 0.22 x trypsin EDTA solution and seeded into 96 well plates (Cat. No. 55301, Orange Scientific) that had been previously coated with Laminin (L2020, Sigma) at a concentration of 1 μg / cm for 2 hours at 37 ° C in a CO 2 incubator and rinsed twice with sterile double distilled water.

3. After 12-15 hours, the medium was changed from containing 10% FBS to serum free medium (SFM) for a further 12 hours.

4. The cells were pretreated for 4 hours, the analysis was done in a volume format of 150 μΐ of various concentrations and fresh SFM was added for 4 h for control, respectively.

5. The wells were rinsed with 1x HBSS and 150 μl of 600 μM methylglyoxal (Cat. No. M0252, Sigma) and SFM respectively were added to the test and control wells for 12 h.

6. The supernatant was collected for LDH analysis and stored at 20 ° C.

7. 75 μΐ of the XTT solution (cat # 11465015001, Roche Inc.) (containing the coupling reagent) was added and the remaining cells were incubated at 37 ° C for 4 hours. The analysis is based on the ability of metabolically active cells to reduce the tetrazolium salts of XTT into colored compounds that can be determined by measuring absorbance. Increased absorbance indicates an increased number of metabolically active cells.

8. Absorbance was obtained by measuring at 492 nm and 690 nm for each well and subtracting A690 from A492.

9. For LDH analysis (Cat. No. G1780, Promega), 50 μΐ of supernatant was added to the 96 well plate together with 50 μl of substrate and incubated in the dark at room temperature for 60 minutes.

10. 10.50 μΐ Stop solution was added and absorbance at 490 nm was measured.

11. Data for XTT and LDH analyzes were analyzed using Prism V.

Summary [0089] Data from Example 2 show that lixisenatide is suitable for the treatment and / or prevention of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple atrophy, dementia with corpuscles

Lewi, dementia from Parkinson's disease or stroke. In addition, lixisenatide has better properties compared to GLF-1 analogs of liraglutide and exenatide.

Pre-treatment with a 10 nM dose of lixisenatide was sufficient to protect the SH-SY5Y neuroblastoma cells from the stress caused by 600 μM methylglyoxal. The 100 nM200 nM dose of liraglutide was sufficient to protect cells from the stress caused by 600 μM methylglyoxal, indicating that a lower dose of lixisenatide is sufficient to induce protection. Lixisenatide is therefore suitable for disease prevention as indicated above. These data are consistent with the data obtained in Example 1 (Figures 6A and B), indicating that lixisenatide had better neuroprotective effects (against cellular stress) in SH-SY5Y neuroblastoma cells, compared to liraglutide.

[0091] Furthermore, the follow-up treatment with lixisenatide was sufficient to protect SH-SY5Y cells from stress induced by 2 mM methylglyoxal or stress induced by 1 mM H2O2. In contrast, liraglutide does not protect cells from stress caused by MG or H2O2.

Example 3

Treatment of glucagon-like peptide 1 agonist (GLP-1R) with lixisenatide protects human neuronal cells from rotenone toxicity.

In this example, neuroprotective effects in cell models have been described using lixisenatide in the treatment of Parkinson's disease, Parkinson's disease, dementia, progressive supranuclear palsy, multiple atrophy and dementia with Lewie bodies. This example shows that lixisenatide may slow down, stop or reverse the progression of Parkinson's disease, dementia in Parkinson's disease, progressive supranuclear palsy, multivisual atrophy and dementia with Lewy bodies, protecting neurons exposed to this disease. These diseases are associated with the loss of neurons using dopamine as a neurotransmitter.

[0093] This example relates to cultures in in vitro assays using a human cell line that is inherently dopaminergic, called Lund Human Mesencephalic (LUHMES cells). These cells are described in Lotharius et al. (2002). Cultures from these cells were exposed in vitro to killing dopaminergic cells with rotenone, which is associated with Parkinson's disease, after accidental or environmental exposure. The association of rotenone with Parkinson's disease is described in Sherer et al., 2003 Tanner et al., 2011. Rotenone can cause parkinsonism by killing dopamine-producing neurons and thereby experimentally reproducing the main features of human Parkinson's disease.

[0094] In the example of a glucagon-like peptide-1 receptor agonist (GLP-1R), lixisenatide has a significant neuroprotective effect in LUHMES cells against rotenone-induced neurodegeneration (Figure 9). Lixisenatide provides advantages over other GLP-1 receptor (GLP-1R) agonists. The neuroprotective effects of lixisenatide in LUHMES-treated rotenone cells are significantly active at 3-fold lower concentrations than liraglutide (Figures 9 and 11), resulting in a mitigating and surprisingly better active effect on the methyl-aluminumoxal model of Example 1.

[0095] Exenatide does not induce increased viability at a concentration of 0.3 μM or 1 μM. In contrast, lixisenatide provides a significant improvement in profitability at these concentrations (Figures 9 and 10).

Materials and methods [0096] To assess the neuroprotection against rotenone, LUHMES cells were cultured at 37 ° C in a humidified atmosphere of 95% air, 5% CO2 in a standard cell culture medium. After 2 days of culture in the plastic bottles, medium containing growth factors was added and the cells were incubated for a further 2 days. The cells were separated and plated on multi-well coated plates with fresh medium for differentiation and added for a further 4 days. On the 6th day of differentiation, the cells were treated with different concentrations of lixisenatide, exenatide (exendin-4) or liraglutide 1 hour before starting treatment with rotenone (0.75 μm). Neuroprotection was measured after 72 hours with a resazurin-based analysis, an indicator of the metabolic activity of cells producing a fluorescent product by cellular oxidation-reduction. The resulting fluorescence is proportional to the number of viable cells in the culture and therefore measures the degree of protection of the LUHMES nerve cells undergoing treatment. Data with n = 12 measurements were compared after normalization of cell viability readings including control without rotenone. A one-way analysis of variance was carried out and then Dunnett's test was used for statistical comparisons between experimental groups. Values ​​of p <0.05 were considered significant and were marked on the charts with the following symbols: * = p <0.05; ** = p <0.01; *** = p <0.001; NS = not real. Neuroprotection was expressed as the percentage reversal of the decrease in rotenone-induced viability. Data with n = 12 measurements were compared after normalization of cell viability readings including control without rotenone. A one-way analysis of variance was carried out and then Dunnett's test was used for statistical comparisons between experimental groups. Values ​​of p <0.05 were considered significant and were marked on the charts with the following symbols: * = p <0.05; ** = p <0.01; *** = p <0.001; NS = not real. Neuroprotection was expressed as the percentage reversal of the decrease in rotenone-induced viability. Data with n = 12 measurements were compared after normalization of cell viability readings including control without rotenone. A one-way analysis of variance was carried out and then Dunnett's test was used for statistical comparisons between experimental groups. Values ​​of p <0.05 were considered significant and were marked on the charts with the following symbols: * = p <0.05; ** = p <0.01; *** = p <0.001; NS = not real. Neuroprotection was expressed as the percentage reversal of the decrease in rotenone-induced viability. 05 were considered significant and were marked on the charts with the following symbols: * = p <0.05; ** = p <0.01; *** = p <0.001; NS = not real. Neuroprotection was expressed as the percentage reversal of the decrease in rotenone-induced viability. 05 were considered significant and were marked on the charts with the following symbols: * = p <0.05; ** = p <0.01; *** = p <0.001; NS = not real. Neuroprotection was expressed as the percentage reversal of the decrease in rotenone-induced viability.

Summary [0097] Data from Example 3 show that lixisenatide is suitable for the treatment and / or prevention of neurodegenerative diseases such as Parkinson's disease, progressive pseudotranal palsy (PSP), multiple system atrophy (MSA), dementia with Lewie bodies, dementia from Parkinson's disease or stroke. In addition, lixisenatide has better properties compared to the GLP-1 analogs of liraglutide and exendin-4.

[0098] In the example, lixisenatide has a significant neuroprotective effect in LUHMES cells against rotenone-induced neurodegeneration (Figure 9). Liksisenated provides benefits over other GLP-1 receptor (GLP-1R) agonists. In LUHMES cells treated with rotenone, lixisenatide is significantly active at 3-fold lower concentrations than liraglutide. No significant effects could be observed at 0.3 μM or 1 μM of exenatide. In contrast, lixisenatide represents a dose-dependent improvement in viability at these concentrations.

Example 4: Action of lixisenatide in APP transgenic mice_his/ PS1 ^₉.

[0099] To further demonstrate the interest of lixisenatide in the treatment of neurodegenerative diseases such as Alzheimer's disease, the example describes the effect of lixisenatide treatment in transgenic mice bearing amyloid plaques in the brain. APP transgenic mice_his/ PS1 ^₉ are a well-characterized model of Alzheimer's disease depicting brain amyloid pathology. Treatment with lixisenatide (10 nmol / kg, ip, daily) was initiated in 7-month APP / PS1 transgenic mice at an age when amyloid plaques were already developed in the brain and were there for 70 days.

Transgenic animals [0100] APP mice_his/ PS1 ^₉ C57BI / 6 background was obtained from the Jackson lab laboratory (<a href="http://research.jax.org/repository/alzheimers.html">http://research.jax.org/repository/alzheimers.html</a>). Heterozygous males were propagated with wild type C57 / BI6 females purchased locally (Harlan, UK). The offspring were pierced and genotyped using PCR with primers specific for the APP sequence (Forward "GAATTCCGACATGACTCAGG, SEQ ID NO: 4", Reverse: "GTTCTGCTGCATCTTGGACA, SEQ ID NO: 5"). Non-transgene expressing mice were used as wild-type controls. Male animals were used in all studies. The animals were housed individually in cages and kept in the 12/12 brightness and dark cycle (light on by 08h00, switched off by 20h00), in a temperature-controlled room (T: 21.5 ° C ± 1). Food and water were available ad libitum. Animals were captured daily for two weeks prior to the start of the study.

Treatment with lixisenatide [0101] Mice were given 7 months when treatment started. At this time, the mice already manifested amyloid cerebral pathology. Mice were submitted once per day for intraperitoneal (ip) lixisenatide (10 nmol / kg body weight) or saline (0.9% w / v) for 70 days. The experiments were licensed by the Ministry of the Interior of the UK according to (scientific procedures) of the Animal Act of 1986.

[0102] The lixisenatide was provided by Sanofi. Lyophilized peptides were reconstituted in Milli-Q water at a concentration of 1 mg / ml. Aliquots were stored in a refrigerator and reconstituted in 0.9% saline for injection.

Histological Production [0103] The animals were perfused transcardially with PBS buffer followed by ice-cold 4% paraformaldehyde in PBS. The brains were removed and fixed in 4% paraformaldehyde for at least 24 hours before being transferred to a 30% sucrose solution overnight. The brains were then snap-frozen using Envirofreez ™ and 40 micron thick coronal sections were cut at a depth of -2 to -3 Bregma using a Leica cryostat. Sections selected according to the stereological principles of the first section taken at random and every six sections later.

[0104] Using standard methods (see McClean et al. 2011 for details), amyloid beta was stained using a polyclonal peptide against amyloid beta (1: 200, Invitrogen, UK, 71-5800), and thick core plates were stained with Congo red. Beta amyloid and Congo red were analyzed by taking 2 images (using a 10x objective) of bark per slice (with 7-10 sections per brain, n = 6 for lixisenatide 10 nmol / kg body weight, n = 12 for saline). All staining was visualized by Axio Scope 1 (Zeiss, Germany) and analyzed using a multi-port plug with image J (NIH, USA).

Results [0105] In transgenic APP mice_his/ PSF_E9 already having cerebral amyloid pathology at the beginning of treatment, treatment with lixisenatide for 70 days led to a reduction in amyloid beta plaque burden as measured by amyloid beta immunoreactivity by 62% (p &lt;0.0039; t-test with repeated measurements) compared to mice treated with saline (Figure 12).

[0106] Similarly, lixisenatide treatment reduced the burden of dense core amyloid beta plaques as quantified by histological staining of red Congp by 52% (p = 0.0419; t-test with repeated measurements), respectively compared to APP / PS1 mice treated with saline (Figure 13).

[0107] Activity at the lower dose (10 nmol / kg) was observed than previously described for liraglutide (25 nmolm / kg, McClean et al 2011).

Summary [0108] These data using two independent techniques show that lixisenatide can reduce the amyloid pathology of the brain in the animal model of Alzheimer's disease. These data show that lixisenatide is suitable for the treatment and / or prevention of neurodegenerative diseases such as Alzheimer's disease by reducing the pathology of amyloid plaques in the brain. Therefore, in addition to its neuroprotective properties, lixisenatide may reduce pathological changes, such as amyloid plaques, and therefore represents an attractive treatment and / or prophylaxis of Alzheimer's disease. In addition, the activity is obtained at a lower dose than those previously described for the liraglutide GLP-1 analogue, as expected from the data of Example 1.

References [0109]

1. Bertram L, Lill CM, and Tanzi RE, 2010. The Genetics of Alzheimer Disease: Back to the Future, Neuron, 68, 270-281.

2. Mancuso M, Orsucci D, LoGerfo A, Calsolaro V, Siciliano G, 2010, Clinical features and pathogenesis of Alzheimer's disease: involvement of mitochondria and mitochondrial

DNA, Adv Exp Med Biol., 685, 34-44.

3. Varadarajan S, Yatin S, Aksenova M, and Butterfield DA, 2000, Review: Alzheimer's Amyloid b-Peptide-Associated Free Radical Oxidative Stress and Neurotoxicity, Journal of Structural Biology, 130, 184-208.

4. Higgins GC, Beart PM, Shin YS, Chene MJ, Cheunge NS and Nagley P, 2010, Oxidative Stress: Emerging Mitochondrial and Cellular Themes and Variations in Neuronal Injury, Journal of Alzheimer's Disease, 20, S453 - S473.

5. Wollen KA, 2010, Alzheimer's disease: the pros and cons of pharmaceutical, nutritional, botanical, and stimulatory therapies, Alfern Med Rev., 15 (3), 223 -44.

6. Aderinwale OG, Ernst HW, Mousa SA, 2010, Current therapies and strategies for the management of Alzheimer's disease, Am J Alzheimers Dis Other Dem., 25 (5), 41424.

7. Kaduszkiewicz, H., Zimmermann T, Beck-Bornholdt HP, van den Bussche H (2005). Cholinesterase inhibitors for patients with Alzheimer's disease: systematic review of randomized clinical trials. BMJ 331: 321 doi: 10.1136 / bmj.331.7512.321

8. Holscher C, 2005, Development of Beta-Amyloid-induced neurodegeneration in Alzheimer's disease and novel neuroprotective strategies, Reviews in Neuroscience, 16, 181-212.

9. De Rosa, Garcia R, Braschi AA, Capsoni C, Maffei S, Berardi L, Cattaneo N, 2005, Intranasal administration of nerve growth factor (NGF) rescues recognition memory deficits in AD11 anti-NGF transgenic mice. Proc Natl Acad Sci., 102, 3811-3816.

10. Holscher C, Li L, 2010, New roles for insulin-like hormones in neuronal signaling and protection: New treatments for novel treatments of Alzheimer's disease? Neurobiology of Aging, 31, 1495-1502.

11. Holscher C, (2010b), The role of GLP-1 in neuronal activity and neurodegeneration, Vitamins and hormones, 84, 331-54.

12. McClean PL, Parthsarathy V, Faivre E, Holscher C (2011): The diabetes drug Liraglutide prevent degenerative processes in a mouse model of Alzheimer's disease. J Neurosci., 31: 6587-6594.

13. Li H, Lee CH, Yoo KY, Choi JH, Park OK, Yan BC. Byun K, Lee B, Hwang JK, Won MH (2010) Chronic treatment of exendin-4 affects cell proliferation and neuroblast differentiation in the adult mouse hippocampal dentate gyrus.Neurosci Lett 19: 12051219.

14. Li Y, Duffy K, Ottinger M, Ray B, Bailey J, Holloway H, Tweedie D, Perry T, Mattson M, Kapogiannis D, Sambamurti K, Lahiri D, Greig N (2010) GLP-1 Receptor

Stimulation Reduces Amyloid-beta Peptide Accumulation and Cytotoxicity in Cellular and Animal Models of Alzheimer's Disease. J Alzheimers Dis 19: 1205-1219.

15. Gandhi S, Wood NW (2005) Molecular pathogenesis of Parkinson's disease. Hum Mol Genet 14: 2749-2755.

16. Schapira AH (2001) Causes of neuronal death in Parkinson's disease. Adv Neurol 86: 155-162.

17. Perry T, Lahiri DK, Chen D, Zhou J, Shaw KTY, Egan JM, Grieg NH (2002) A novel neurotrophic property of glucagon-like peptide 1: a promoter of nerve cell growth factor mediated differentiation on PC12 cells. J Pharmacol exp 300: 958-966.

18. Perry TA, Haughey NJ, Mattson MP, Egan JM, Grieg NN (2002) Protection and reversal of excitotoxic neuronal damage by glucagon-like peptide -1 and exendin-4. J Pharmacol Exp Ther 302: 881-888.

19. Harkavyi A, Abuirmeileh A, Lever R, Kingsbury AE, Biggs CS. Whitton PS. (2008) Glucagon-like peptide I receptor stimulation reverses key deficits in distinct rodent models of Parkinson's disease. J Neuroinflamm 5: 19, 1-9.

20. Li A, Perry TA, Kindy MS, Harvey BK, Tweedie D, Holloway HW, Powers K, Shen H, Egan JM, Sambamurti K, Brossi A, Lahiri DK, Mattson MP, Hoffer BJ, Wang Y, Greig NH ( 2009) GLP-1 receptor stimulation preserves primary cortical and dopaminergic neurons in cellular and rodent models of stroke and Parkinsons. PNAS 106: 4 1285-1290.

21. Martin B, Golden E, Carlson OD, Pistell P, Zhou J, Kim W, Frank BP, Thomas S, Chadwick A, Greig NH, Bates GP, Sathasivam K, Bernier M, Maudsley S, Mattson MP, Eagn JM ( 2009) Exendin-4 improves glycemic control, ameliorates brain and pancreatic pathologies and extends survival in a mouse model of Huntington's Disease. Diabetes 58: 2, 318-328.

22. Mattson MP (2007) Calcium and neurodegeneration. Aging Cell 6: 337-350

23. Lee CH, Yan B, Yo KY, Choi JH, Kwon SH, Her S, Hwang IK, Cho JH, Kim YM, Won MH (2011) Ischemia induced changes in glucagon-like peptide-1 receptor and neuroprotective effect of its agonist exendin-4, in experimental transient cerebral ischemia. J Neurosc Res. 89: 1103-1113.

24. Teramoto S, Miyamoto N, Yatomi K, Tanaka Y, Oishi H, Arai H, Hattori N, Urabe T (2011) Exendin-4, a glucagonlike peptide-1 receptor agonist, provides neuroprotection in mice transient focal cerebral ischemia. J Cerebr Blood Flow Metab 31: 8, 1696-1705.

25. Nakagawa A, Satake H, Nakabayashi H (2004) Receptor gene expression of glucagon-like peptide-1, but not of glucose-dependent insulinotropic polypeptide, in rat nodose ganglion cells. Auton Neurosci 110: 36-43.

26. Perry TA, Holloway H, Weerasuriya A, Mouton PR, Duffy K, Mattison JA, Greig NH (2007) Evidence of GLP-1- mediated neuroprotection in an animal model of pyridoxine induced peripheral neuropathy sensor. Exp Neurol 203: 2, 293-301.

27. During MH, Cao L, Zuzga DS, Francis JS, Fitzsimons HL, Jiao X, Bland RJ, Klugmann M, Banks WA, Drucker DJ, Haile CN (2003) Glucagon-like peptide-1 receptor is involved in learning and neuroprotection . Nat Med 9: 1173-1179.

28. Isacson R, Nielsen E, Dannaeus K, Bertilsson G, Patrine C, Zachrisson O, Wikstrom L (2009) The glucagon like peptide 1 receptor agonist exendin-4 improves reference memory performance and decreases immobility in the forced swim test. Eur J Pharmacol 10: 650, 249-55.

29. Himeno T, Kamiya H, Naruse K, Harada N, Ozaki N, Seino Y, Shibata T, Kondo M, Kato J, Okawa T, Fukami A, Hamada Y, Inagaki N, Drucker DJ, Oiso Y, Nakamura J ( 2011) Beneficial effects of exendin-4 on experimental polyneuropathy in diabetic mice. Diabetes 60: 2397-2406.

30. Porter DW, Kerr BD, Flatt PR, Holscher C, Gault VA (2010) Four weeks of Liraglutide improves memory and learning as well as glycemic control in mice with high fat diet-induced obesity and insulin resistance. Diab Obes Metab 12: 891-899, 2010.

31. Doyle ME, Egan JM., Mechanisms of action of glucagon-like peptide 1 in the pancreas. Pharmacol Ther. 2007 Mar; 113 (3): 546-93. Epub 2006 Dec 28.

32. Holst (1999), Curr. Med. Chem. 6: 1005

33. Nauck et al. (1997) Exp Clin Endocrinol Diabetes 105: 187

34. Lopez-Delgado et al. (1998) Endocrinology 139: 2811.

35. McClean PL, Gault VA, Harriott P, Holscher C, 2010, Glucagon-like peptide-1 analogues enhance synaptic plasticity in the brain: Alzheimer's disease, European Journal of Pharmacology, 630, 158-162.

36. Kastin AJ, Akerstrom V, Pan W, 2001, Interactions of Glucagon-like peptide (GLP-1) with blood brain barriers, Journal of Molecular Neuroscience, 18 (2), 7-14.

37. Perry T and Greig N, 2003, The glucagon-like peptides: a double-edged therapeutic sword? Trends in Pharmacological Sciences, 24, 377-383.

38. Li H, Lee CH, Yoo KY, Choi JH, Park OK, Yan BC. Byun K, Lee B, Hwang JK, Won MH (2010) Chronic treatment of exendin-4 affects cell proliferation and neuroblast differentiation in the adult mouse hippocampal dentate gyrus.Neurosci Lett 19: 12051219.

39. Hamilton A., S. Patterson, D. Porter, VA Gault and C. Holscher (2011): Novel GLP 1 mimetics developed to treat type 2 diabetes promoter progenitor cell proliferation in the brain. J Neurosci Res, 89: 481-489.

40. Gengler S, McClean P, McCurtin R, Gault V, Holscher C (2012) Val (8) GLP-1 rescues synaptic plasticity and reduces dense core plaques in APP / PS1 mice. Neurobiol Aging 33: 265-276.

41. Sherer, TB Kim, J.-H, Betarbet, R. and Greenamyre, JT, Subcutaneous Rotation Exposure Causes, Highly Selective Dopaminergic Degeneration and α-Synuclein Aggregation, 2003, Experimental Neurology, 179: 9-16.

42. Lotharius, J., Barg, S., Wiekop, P., Lundberg, C., Raymon, HK, and Brundin, P., Effect of Mutant α-Synuclein on Dopamine Homeostasis in a New Human Mesencephalic Cell Line, 2002 , Journal of Biological Chemistry, 277: 38884-38894.

43. Lotharius, J., Falsig, J., van Beek, J., Payne, S., Dringen, R., Brundin, P., and Leist, M., Progressive Degeneration of Human Mesencephalic Neuron-Derived Cells Triggered by Dopamine-Dependent Oxidative Stress Is Dependent on the Mixed-Lineage Kinase Pathway, 2005, Journal of Neuroscience, 25: 6329-6342.

44. Tanner, CM, Kamel, F., Ross, GW Hoppin, JA, Goldman, SM, Korell, M., Marras, C., Bhudhikanok, GS, Kasten, M., Chade, AR Comyns, K., Richards , MB, Meng, C., Priestley, B., Fernandez, HH, Cambi, F., Umbach, DM, Blair, A., Sandler, DP, and Langston, JW, Rotenone, Paraquat, and Parkinson's Disease, 2011, Environmental Health Perspectives, 119: 866-872.

45. Kim, S., Moon, M. and Park, S., Exendin-4 protects dopaminergic neurons by inhibition of microglial activation and matrix metalloproteinase-3 expression in an animal model of Parkinson's disease, 2009, J. Endocrinology, 202: 431-439.

46. ​​Dubois B. et al. Revising the definition of Alzheimer's disease: a new lexicon. Lancet Neurol. 2010; 9: 1118-27.

SEQUENCE LIST [0110] &lt;110&gt; Sanofi-Aventis Deutschland GmbH &lt;120&gt; A pharmaceutical composition for use in the treatment of a neurodegenerative disease &lt;130&gt; 51246SP &lt;150&gt; EP 11 179 784.1 &lt;151&gt; 2011-09-01 &lt;160&gt; 5 &lt;170&gt; PatentIn version 3.5 &lt;210&gt; 1 &lt;211&gt; 44 &lt;212&gt; PRT &lt;213&gt; artificial &lt;220&gt;

&lt;223&gt; desPro³⁶-Exendin-4 (1-39) -Lys6-NH2 &amp; lt; 400 &amp; gt; 1

His Gly Glu Gly Thr Phe Thr Cheese Asp Leu Cheese Lys Gin Met Glu Glu 15 10 15

Glu Ala Val Arg Leu Phe Ile Glu Trp Leu Lys Asn Gly Gly Pro Ser 20 25 30

Gly Ala Pro Pro Cheese Ser Lys Lys Lys Lys Lys Lys 35 40 &lt;210&gt; 2 &lt;211&gt; 39 &lt;212&gt; PRT &lt;213&gt; Heloderma suspectum &lt;400&gt; 2

His Gly Glu Gly Thr Phe Thr Cheese Asp Leu Cheese Lys Gin Met Glu Glu 15 10 15

Glu Ala Val Arg Leu Phe Ile Glu Trp Leu Lys Asn Gly Gly Pro Ser 20 25 30

Gly Al Pro Pro Pro Cheese Ser 35 &lt;210&gt; 3 &lt;211&gt; 30 &lt;212&gt; PRT &lt;213&gt; artificial &lt;220&gt;

&lt;223&gt; GLP-1 (7-36) &lt;400&gt; 3

<img file="PL2750698T3_D0001.tif" />

&lt;210&gt; 4 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; artificial &lt;220&gt;

&lt;223&gt; forward primer &lt;400&gt; 4 20 gaattccgac atgactcagg 20 &lt;210&gt; 5 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; artificial &lt;220&gt;

&lt;223&gt; primer reverse &lt;400&gt; 5 gttctgctgc atcttggaca 20

Piotr Godlewski

Patent Attorney