Compositions and methods for the biosynthesis of 1,4-butanediol and its precursors

[0001] This invention relates generally to the design of in silico organisms, more specifically organisms with the ability to biosynthesis 1,4-butanediol.

[0002] The compound, 4-hydroxybutanoic acid (4-hydroxybutanoate, 4-hydroxybutyrate, 4-HB) is a 4-carbon carboxylic acid with industrial potential as a construction unit for various common and specialty chemicals. In particular, 4HB has the potential to serve as a new entry point for the 1,4-butanediol chemical family, which includes solvents, resins, polymer precursors and specialty chemicals. 1,4-butanediol (BDO) is an intermediate polymer and industrial solvent with a global market of approximately £ 3 billion / year. BDO is currently made of petrochemical precursors, mainly acetylene, maleic anhydride and propylene oxide.

[0003] For example, acetylene is reacted with formaldehyde molecules in a Reppe synthesis reaction (Kroschwitz and Grant, Encyclopedia of Chem. Tech., John

Wiley and Sons, Inc., New York (1999)) followed by catalytic hydrogenation to form 1.42 butanediol. It has been estimated that 90% of the acetylene produced in the United States is consumed in the production of butanediol. Alternatively, it can be formed by esterification and catalytic hydrogenation of maleic anhydride, which is obtained from butane. In post-production treatment, butanediol can be further transformed, e.g. by oxidation to γ-butyrolactone, which can then be converted to pyrrolidone and N-methylpyrrolidone, or hydrogenolysis to tetrahydrofuran (Figure 1). These compounds have various applications as polymer intermediates, solvents and additives, and their combined market is almost £ 2 billion / year.

[0004] It is desirable to develop a method for producing these chemicals with alternative agents that not only replace crude oil based raw materials but also use less energy and capital intensive processes. The Department of Energy proposed 1,4-diacids, especially succinic acid, as key, biologically produced intermediates for the production of the butanediol family of products (DOE report, "Top Value-Added Chemicals from Biomass",

2004). Succinic acid is, however, expensive to isolate and purify, and requires high levels

<td>temperatures and</td><td>pressures</td><td>to catalytic</td><td>reduction</td><td>down</td>

<td>butanediol.</td><td></td><td></td><td></td><td></td>

<td>[0005] A</td><td>therefore,</td><td colspan="2">there is a demand</td><td>on</td>

<td>alternative</td><td>means</td><td>to effective</td><td colspan="2">preparation</td>

commercial quantities of 1,4-butanediol and its chemical precursors. The present invention responds to this need and also provides related benefits.

Summary of the Invention [0006] The invention is defined by the subject matter of the claims.

[0007] The description provides a non-naturally occurring microbial biocatalyst comprising a microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthesis pathway containing at least one exogenous nucleic acid coding for 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthase, dehydroxylene dehydrogenase α-ketoglutarate, wherein the exogenous nucleic acid is expressed in amounts sufficient to produce monomeric 4-hydroxybutanoic acid (4-HB). Non-naturally occurring microbial biocatalyst comprising a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthesis pathways, which pathways contain at least one exogenous nucleic acid coding for 4-hydroxybutcinate dehydrogenase, -CoA, CoA-dependent succinic semialdehyde dehydrogenase, CoA-4-hydroxybutyrate transferase, 4-butyrate kinase, phosphotransbutyrylase, α-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or aldehyde / alcohol dehydrogenase, in which the exogenous nucleic acid is expressed in amounts sufficient to produce 1,4-butanediol (BDO). In addition, a method for producing 4-HB is provided. The method involves culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid biosynthesis pathway (4-HB) containing at least one exogenous nucleic acid coding for 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthase, CoA-dependent time, succinyl semialdehyde, succinate-decarboxylate, to produce monomeric 4-hydroxybutanoic acid (4HB). In addition, a method for producing BDO is provided. The method comprises culturing a non-naturally occurring microbial biocatalyst, including a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthesis pathways, which pathways containing at least one exogenous nucleic acid coding for 4-hydroxybutanoate dehydrogenase, a synthetic succinase enzyme CoA, CoA dependent succinic semialdehyde dehydrogenase, Co-4-hydroxybutyrate CoAtransferase, kinase

4-hydroxybutyrate, phosphotranshydroxybutyrylase, α-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or aldehyde / alcohol dehydrogenase for a time sufficient to produce 1,4-butanediol (BDO). 4-HB and / or BDO products can be secreted into the culture medium.

Brief description of the figures [0008]

Fig. 1 is a schematic diagram illustrating the entry point of 4-hydroxybutanoic acid (4-HB) for the manufacture of a product from the chemical family

1,4-butanediol (BDO) and comparison with chemical synthesis pathways from petrochemical raw materials. The arrows represented by a solid black line indicate chemical synthesis pathways; the arrows represented by the blue dotted line indicate the biosynthetic pathway leading to 4-HB and subsequent steps of transformation into the BDO family of chemical compounds.

Fig. 2 is a schematic diagram illustrating biochemical pathways leading to the production of deutrogenase dehydrogenase, glutaminiandecarboxylase dehydrogenase, dehydrogenase, 4-hydroxybutyrate decarboxylase (4-HB) and 1,4-butanediol. The first five stages are endogenous to E. coli, while the others may be expressed heterologously. Enzymes that catalyze biosynthesis are: (1) succinyl-CoA synthetase; (2) CoA-independent succinic semialdehyde; (3) α-ketoglutarate; (4) succinate semialdehyde transaminase; (5) glutamate; (6) CoA-dependent succinic semialdehyde; (7) hydroxybutanoate; (8) α-ketoglutarate; (9) 4-hydroxybutyrylCoA: acetyl-CoA transferase; (10) butyrate kinase; (11) phosphotransbutyrylase; (12) aldehyde dehydrogenase;

(13) alcohol dehydrogenase.

Fig. 3 is a schematic diagram illustrating homoserine biosynthesis in E. coli.

Fig. 4 is a schematic diagram of the predicted homoserine biological pathway from Lhomoserine to 4-HB. Stage 1 is deduced ammonia (EC class 4.3.1) with an estimated ArxnG of 12 kJ / mol. Stage 2 is a deduced oxidoreductase (EC class 1.3.1) with an estimated ArxnG of -59 kJ / mol.

Fig. 5 is a schematic diagram of the endogenous E. coli pathway for converting aspartate via fumarate to succinate. This pathway has similar chemical properties to the predicted homoserine biological pathway.

Fig. 6 is a schematic diagram illustrating similarities between biosynthetic pathways for (A) homoserine and (B) succinyl-CoA leading to BDO.

Fig. 7 is a schematic diagram illustrating the biochemical pathways leading to acetoacetate in E.

coli.

Fig. 8 is a schematic diagram illustrating the biochemical pathway leading from acetoacetate to BDO via amber semialdehyde.

Fig. 9 is a schematic diagram illustrating the reaction scheme of D-lysine-5,6-aminomutase.

Fig. 10 is a schematic diagram illustrating the pathway leading to acetoacetate from acetyl-CoA. The enzymes are: (1) pyruvate formate lyase, (2) pyruvate dehydrogenase, (3) acetylCoA: acetoacetyl-CoA, (4) acetylCoA C-acetyltransferase, (5) phosphotransacetylase and (6) acetate kinase.

Enzyme 7 represents the multistage pathway leading from acetoacetate to BDO in Figure 8.

Fig. 11 shows 4-HB production in minimal glucose medium using E. coli strains carrying plasmids expressing various combinations of the 4-HB pathway genes. (a) 4-HB concentration in culture broth; (b) succinate concentration in the culture broth; (c) optical density of the culture measured at 600 nm. Groups of bars indicate time points: 24 hours, 48 ​​hours and 72 hours (if measured). The codes along the X axis indicate the strain / plasmid combination used. The first indicator refers to the host strain: 1, MG1655 lacI^Q; 2,

MG1655 AgabD Latin^Q; 3, MG1655 AgabD AaldA lacI^Q. The second indicator refers to the combination of plasmids used: 1, pZE13-0004-0035 and pZA33-0036; 2, pZE13-0004-0035 and pZA33-0010n; 3, pZ13-0004-0008 and pZA33-0036; 4, pZ130004-0008 and pZA33-0010n; 5, control vectors: pZE13 and pZA33.

Fig. 12 shows the production of 4-HB from glucose in E. coli strains expressing α-ketoglutarate decarboxylase from Mycobacterium tuberculosis. Strains 1-3 contain pZE13-0032 and pZA33-0036. Strain 4 only expresses empty vectors pZE13 and pZA33. Host strains are as follows: 1 and 4, MG1655 lacI^Q; 2, MG1655 AgabD lacI^Q; 3, MG1655 AgabD AaldA lacI^Q.

Bars refer to concentration at 24 and 48 hours time points.

Fig. 13 shows the production of BDO with 10 mM 4-HB in recombinant E. coli strains. The numbered items correspond to the experience of MG1655 lacI^Q containing pZA33-0024, expressing cat2 from P. gingivalis and the following genes expressed in pZE13: 1, none (control); 2,0002; 3,0003; 4,0003n; 5, 0011;

6.0013; 7, 0023; 8, 0025; 9,0008n; 10, 0035. The gene numbers are specified in Table 6. For each item, the bars refer to aerobic, microaerobic and anaerobic conditions, respectively. Microaerobic conditions were obtained by sealing the culture tubes without removing air from them.

Fig. 14 shows the mass spectrum of 4-HB and BDO generated by MG1655 lacI^Q pZE 13-0004-0035-0002 pZA33-0034-0036 grown in M9 minimal medium supplemented with unlabelled glucose at 4 g / l (a, c, eig) and evenly labeled ¹³C-glucose (b, d, fih).

(a) and (b), a characteristic fragment of derivatized BDO (mass 116) containing 2 carbon atoms; (c) and (d), a characteristic fragment of derivatized BDO (mass 177) containing 1 carbon atom; (e) and (f), a characteristic fragment of 4-HB derivatized (mass

117), containing 2 carbon atoms; (g) and (h), a characteristic fragment of 4-HB derivatized (mass 233) containing 4 carbon atoms.

Fig. 15 shows a process flow diagram for biological processes for the production of γ-butyrolactone.

Panel (a) illustrates batch fermentation with batch separation and panel (b) illustrates batch fermentation with continuous separation.

Detailed description of the invention [0009] The object of the invention is to design and produce cells and organisms having the ability to biosynthetically produce 4-hydroxybutanoic acid (4-HB), γ-butyrolactone and 1,4-butanediol. In one embodiment, the invention utilizes in silico stoichiometric models of Escherichia coli metabolism that identify metabolic designs for biosynthetic production of 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO). The results described herein indicate that metabolic pathways can be designed and recombinantly engineered to obtain biosynthesis of 4-HB and its post-processing products such as 1,4-butanediol in Escherichia coli and other cells or organisms. Biosynthetic 4-HB production, e.g. for in silico projects, can be confirmed by constructing strains with a designed metabolic genotype. Cells or organisms obtained by metabolic engineering can also be subjected to adaptive evolution leading to a further increase in 4-HB biosynthesis, including in conditions close to the theoretical maximum growth.

[0010] As described herein, the characteristics of 4-HB biosynthesis in designed strains make them genetically stable and particularly useful in continuous biological processes. Separate strain design strategies were identified by enriching E.

coli with various non-native or heterologous reaction abilities leading to metabolic pathways

4-HB and 1,4-butanediol either with the participation of CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase and CoA-dependent succinic semialdehyde dehydrogenase, or glutamate transaminase: succinic semialdehyde. Metabolic projects that led to 4-HB biosynthesis in both E. coli and yeast species from each of these metabolic pathways were identified in silico.

γ-butyrolactone, which is an intermediate of 1,4-butanediol, can be formed in culture by spontaneous cyclization at pH &lt;7.5, especially under acidic conditions such as pH below 5.5 e.g. pH &lt;7, pH &lt;6.5, pH &lt;6 and especially at pH &lt;5.5 or lower.

[0011] Strains identified by the platform computing component can be put into actual production by genetic engineering of any of the predicted changes in metabolism that lead to biosynthetic production of 4-HB, 1,4-butanediol or other intermediate products and / or post-production products. In yet a further embodiment, strains exhibiting biosynthetic production of these compounds may then undergo adaptive evolution leading to a further increase in product biosynthesis. Product biosynthesis performance levels after adaptive evolution can also be predicted by the computational system component.

[0012] As described herein, microbial organisms were constructed to express the 4-HB biosynthesis pathway encoding the enzymatic steps from succinate to 4-HB and to 4-HB-CoA.

CoA expression of succinate coA-transferase,

CoA-dependent succinic semialdehyde dehydrogenase,

NAD-dependent 4-hydroxybutyrate dehydrogenase and

CoA-4-hydroxybutyrate transferA in the host microbial organism led to significant 4-HB production compared to host microbial organisms lacking the 4-HB biosynthetic pathway. According to the invention, 4-HB-producing microbial organisms were produced that used α-ketoglutarate as a substrate by introducing nucleic acids encoding α13 ketoglutarate decarboxylase and NAD-dependent 4-hydroxybutyrate dehydrogenase.

[0013] According to the invention, microbial organisms containing the 1.45 butanediol biosynthesis pathway (BDO) were constructed that biosynthesized BDO when grown in the presence of 4-HB. The BDO biosynthesis pathway consisted of a nucleic acid encoding either a multifunctional aldehyde / alcohol dehydrogenase, or nucleic acids encoding an aldehyde dehydrogenase and alcohol dehydrogenase. To support growth on 4-HB substrates, these BDO-producing microbial organisms also expressed 4-hydroxybutyrate CoAtransferase or 4-butyrate kinase in combination with phosphotranshydroxybutyrylase. According to the invention, microbial organisms were produced that synthesized BDO by exogenous expression of nucleic acids encoding the functional biosynthesis pathway

4-HB and the functional biosynthesis pathway BDO. The 4-HB biosynthesis pathway consisted of NAD-dependent 4-hydroxybutyrate dehydrogenase and CoA-4-hydroxybutyrate transferase. The BDO pathway consisted of a multifunctional aldehyde / alcohol dehydrogenase.

[0014] The term "non-naturally occurring" as used herein, when used in reference to a microbial organism or microorganism of the invention, is intended to mean that the microbial organism has at least one genetic change not found in the naturally occurring strain of said species, including strains of wild species mentioned. Genetic changes include e.g. modifications introducing expressed nucleic acids encoding metabolic polypeptides, additions of other nucleic acids, deletions of nucleic acids and / or other functional disruption of the genetic material of the microorganism. Such modifications include, e.g., coding regions and functional fragments thereof, for heterologous, homologous or both heterologous and homologous polypeptides for said species.

Additional modifications include, e.g., non-coding regulatory regions in which the modifications alter the expression of a gene or operon. Exemplary metabolic polypeptides include enzymes within the 4-HB biosynthesis pathway and enzymes within the biosynthesis pathway of the compound family

BDO.

[0015] The term "metabolic modification" refers to a biochemical reaction altered from its natural state. Thus, non-naturally occurring microorganisms having genetic modifications of the nucleic acids encoding metabolic polypeptides or functional fragments thereof. Exemplary metabolic modifications are further described below for both E. coli and yeast microbial organisms.

[0016] The term "isolated" as used herein, when used in reference to a microbial organism, is intended to mean an organism that is substantially free of at least one component with which said microbial organism occurs in nature. The term includes a microbial organism that is deprived of some or all of the components with which it occurs in its natural environment. The term also includes a microbial organism that is deprived of some or all of the components with which the microbial organism occurs in unnatural environments. Thus, the isolated microbial organism is partly or completely separated from other substances with which it occurs in nature or with which it is cultured, stored or maintained in unnatural environments. Specific examples of isolated microbes include partially pure microorganisms, substantially pure microorganisms, and microorganisms cultured in a non-naturally occurring medium.

[0017] As used herein, the terms "microbial", "microbial organism" or "microbial" are intended to mean any organism that exists in the form of a microscopic cell that is part of the domain of archaea, bacteria, or eukaryotes. Thus, it is intended to include prokaryotic or eukaryotic cells or microscopic organisms and includes bacteria, archaea and eubacteria of all species as well as eukaryotic microorganisms such as yeast and fungi. The term also includes cell cultures of all species that can be grown to produce biochemicals.

[0018] The term "4-hydroxybutanoic acid" as used herein is intended to mean 4-hydroxybutyrate of butyric acid with the chemical formula C₄H₈ABOUT₃ and a molecular weight of 104.11 g / mol (126.09 g / mol for its sodium salt). The chemical compound 4-hydroxybutanoic acid is also known in the art as 4-HB, 4-hydroxybutyrate, gammahydroxybutyric acid or GHB. The term as used herein is intended to include all various salt forms of the compound and includes, e.g., 4-hydroxybutanoate and 4-hydroxybutyrate. Specific examples of 4-HB salt forms include 4-HB sodium and 4-HB potassium. Thus, the terms 4-hydroxybutanoic acid, 4-HB, 4-hydroxybutyrate,

4-hydroxybutanoate, gamma-hydroxybutyric acid and GHB, as well as other names recognized in the art, are used here as synonyms.

[0019] The term "monomeric" as used herein, when used in reference to 4-HB, is intended to mean 4-HB in non-polymeric or non-derivatized form. Specific examples of polymeric 4HB include poly (4-hydroxybutanoic acid) and copolymers e.g. 4-HB and 3-HB. A specific example of a 4-HB derivatized form is 4-HB-CoA. Other 4-HB polymer forms and other 4-HB derivatized forms are also known in the art.

[0020] The term "γ-butyrolactone" as used herein is intended to mean a lactone with the chemical formula C₄H₆ABOUT₂ and a molecular weight of 86.089 g / mol. The chemical compound γ-butyrolactone is also known in the art as GBL, butyrolactone, 1,4-lactone, 4-butyrolactone, 4-hydroxybutyric acid lactone and gamma-hydroxybutyric acid lactone. The term, as used herein, is intended to include each of the various salt forms of the compound.

[0021] The term "1,4-butanediol" as used herein is intended to mean the alcohol derivative of butane alkane, carrying two hydroxyl groups, which has the chemical formula C₄H₁₀ABOUT₂ and a molecular weight of 90.12 g / mol.

The chemical compound 1,4-butanediol is also known in the art as BDO and is an intermediate chemical or precursor for the family of compounds referred to herein as the BDO family of compounds, some of which are exemplified in Figure 1.

[0022] The term "tetrahydrofuran" as used herein is intended to mean a heterocyclic organic compound corresponding to a fully hydrogenated analogue of the aromatic compound furan which has the chemical formula C₄H₈O and molecular weight 72.11 g / mol. The chemical compound tetrahydrofuran is also known in the art as THF, tetrahydrofuran, 1,4-epoxybutane, butylene oxide, cyclotetramethylene oxide, oxacyclopentane, diethylene oxide, oxane, furanidine, hydrofuran, tetramethylene oxide. The term, as used herein, is intended to include each of the various salt forms of the compound.

[0023] The term "CoA" or "coenzyme A" as used herein is intended to mean an organic cofactor or a prosthetic group (non-protein portion of the enzyme) whose presence is required for the activity of many enzymes (apoenzyme) to form an active enzyme system. Coenzyme A functions in some condensation enzymes, participates in the transfer of an acetyl group or other acyl group and in the synthesis and oxidation of fatty acids, oxidation of pyruvate and in other acetylation.

[0024] As used herein, the term "substantially anaerobic" when used in reference to breeding or growth conditions, is intended to mean that the amount of oxygen is less than about 10% saturation for dissolved oxygen in liquid media. The term is also intended to include sealed chambers with liquid or solid support maintained with an atmosphere containing less than about 1% oxygen.

[0025] The non-naturally occurring microbial organisms of the invention may contain permanent genetic changes, which refers to microorganisms that can be cultured for over five generations without losing the change. Generally, permanent genetic changes include modifications that persist for more than 10 generations, particularly persistent modifications will persist for more than about 25 generations, and more specifically persistent genetic modifications will persist for more than 50 generations, including indefinitely.

[0026] It will be understood by those skilled in the art that genetic changes, including the metabolic modifications exemplified herein, have been described with respect to E. coli and yeast genes and their respective metabolic reactions. However, due to the complete sequencing of the genome of a wide range of organisms and the high level of skill in the field of genomics, those skilled in the art will easily be able to apply the indications and directions given herein to essentially all other organisms. For example, the exemplary metabolic changes in E. coli exemplified herein can easily be applied to other species by incorporating the same or analogous coding nucleic acid from species other than said species. Such genetic changes include, for example, genetic changes to species homologues, in general and in particular, orthologs, paralogs or nonorthologic gene transfers.

[0027] An ortholog is a gene or genes that are related by descending blood and are responsible for essentially the same or identical functions in different organisms. For example, mouse epoxy hydrolase and human epoxy hydrolase can be considered as an ortholog for the biological function of epoxide hydrolysis. Genes are related by descending kinship, e.g. when their sequences are similar enough to indicate that they are homologous or related by evolving from a common ancestor. Genes can also be considered orthologs if they have a common three-dimensional structure, but not necessarily a similar sequence, sufficient to show that they evolved from a common ancestor to such an extent that the original sequence similarity is not recognizable. Genes that are orthologous can encode proteins with sequence similarity from about 25% to 100% amino acid sequence identity. Genes encoding proteins with amino acid similarity below

25% can also be considered as a result of descending kinship, if their three-dimensional structure also shows similarities. Members of the family of serine protease enzymes, including tissue plasminogen activator and elastase, are considered to have arisen as a result of a descending kinship from a common ancestor.

[0028] Orthologs include genes or their encoded gene products that, through, e.g., evolution, have changed the structure or overall activity. For example, when one species encodes a gene product showing two functions, and when such functions have been separated into different genes in a second species, three genes and their respective products are considered orthologs. In the case of an increased production of biochemical product, those skilled in the art will understand that for the construction of a non-naturally occurring microorganism, an orthologous gene carrying the metabolic activity to be disturbed should be selected. An example of orthologs showing separate activities is when different activities have been split into different gene products between two or more species or within a single species. A specific example is the separation of elastase proteolysis and plasminogen proteolysis, two types of serine protease activity, into different molecules in the form of plasminogen activator and elastase. A second example is the separation of 5 '^ - 3' exonuclease activity of mycoplasma and Drosophila DNA polymerase III. A DNA polymerase from a first species can be considered an exonuclease or polymerase orthologist or both of the second species and vice versa.

In contrast, paralogs are homologs related, e.g., by duplication followed by evolutionary divergence, and have similar or common but not identical functions. Paralogs may originate or originate, e.g., from the same species or from different species. For example, microsomal epoxy hydrolase (epoxy hydrolase I) and soluble epoxy hydrolase (epoxy hydrolase II) can be considered paralogs because they represent two different enzymes that co-evolved from a common ancestor that catalyze different reactions and perform different functions in the same species. Paralogs are proteins from the same species with significant sequence similarity to each other, which suggests that they are homologous or related by being evolved from a common ancestor. Groups of paralogical protein families include homologs

HipA, luciferase, peptidase and other genes.

[0030] Non-organological gene transfer means a situation in which a non-organological gene from one species can replace said gene function in another species. Transfer includes, for example, the ability to perform substantially the same or similar functions in a species of origin compared to said function in another species. Although in general, unorthologous gene transfer will be identifiable as structurally related to a known gene encoding said function, nevertheless structurally but functionally less similar genes and their respective gene products will still fall within the meaning of the term as used herein. Functional similarity requires, e.g., at least some structural similarity in the active site or region of the binding of a non-orthological gene compared to the gene encoding the function to be replaced. Thus, a non-orthological gene includes e.g. a paralog or an unrelated gene.

[0031] Thus, when identifying and constructing the non-naturally occurring microbial organisms of the invention with 4-HB, GBL and / or BDO biosynthesis capability, those skilled in the art will understand that when using the indications and directions provided for specific species, identification metabolic modifications may include the identification and introduction or inactivation of orthologs. To the extent that paralogs and / or unorthologous gene transfers occur in said microorganism encoding an enzyme that catalyzes a similar or substantially similar metabolic reaction, those skilled in the art may also use these evolutionarily related genes.

[0032] Orthologs, paralogs and nonorthologic gene transfers can be determined by methods well known to those skilled in the art. For example, examining the nucleic acid or amino acid sequences of two polypeptides will reveal sequence identity and similarity between the compared sequences. Based on such similarities, one of skill in the art can determine if the similarity is large enough to show that the proteins are related by evolving from a common ancestor. Algorithms well known to those skilled in the art, such as Align, BLAST, Clustal W and others, compare and determine the raw sequence similarity or identity as well as determine the presence or importance of sequence breaks to which weight or point value can be assigned. Such algorithms are also known in the art and are similarly suitable for determining nucleotide sequence similarity or identity. Parameters for sufficient similarity to determine kinship are calculated on the basis of well-known methods for calculating statistical similarity or the chance of finding similar agreement in a random polypeptide and the significance of a specific agreement. Computer comparison of two or more sequences can, if desired, also be visually optimized by those skilled in the art. Related gene or protein products may be expected to have similarities, e.g.

25% to 100% sequence identity. Unrelated proteins may have an identity that is essentially the same as would be expected accidentally if a sufficiently sized database (about 5%) was scanned. Sequences with an identity between 5% and 24% may or may not represent homology sufficient to deduce that the sequences being compared are related.

Additional statistical analysis to determine the significance of such compliance data, taking into account the size of the data set, could be conducted to determine the significance of these sequences.

[0033] Exemplary parameters for determining the relationship of two or more sequences using, e.g., the BLAST algorithm, may be as shown below. Briefly, amino acid sequence alignments can be performed using the BLASTP program, version 2.0.8 (of January 5, 1999) and the following parameters: matrix: 0 BLOSUM62; opening break: 11; pause extension: 1; x_dropoff: 50;

expected value: 10.0; word size: 3; filter: enabled. Nucleic acid sequence alignments can be performed using the BLASTN program, version 2.0.6 (September 16, 1998) and the following parameters:

match: 1; mismatch: -2; opening break: 5; pause extension: 2; x_dropoff: 50; expected value: 10.0; word size: 11; filter: disabled. Those skilled in the art will know what modifications to the above parameters can be made to, e.g. increase or decrease the stringency of the comparison and determine the relationship of two or more sequences.

[0034] Opi provides a non-naturally occurring microbial biocatalyst comprising a microbial organism having a 4-hydroxybutanoic acid biosynthesis pathway (4-HB) containing at least one exogenous nucleic acid coding for 4-hydroxybutanoate dehydrogenase, CoA-independent succinic A-Coaldehyde, succinase, - succinic semialdehyde dehydrogenase dependent, glutamate transaminase: succinate semialdehyde, alpha-ketoglutarate decarboxylase or glutamate decarboxylase, in which the exogenous nucleic acid is expressed in amounts sufficient to produce monomeric 4-hydroxybutanoic acid (4-HB). 4-hydroxybutanoate dehydrogenase is also called 4-hydroxybutyrate dehydrogenase or 4-HB dehydrogenase. Succinyl-CoA synthetase is also called succinyl-CoA synthase or succinyl-CoA ligase.

[0035] Also provided is a non-naturally occurring microbial biocatalyst comprising a microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthesis pathway having at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA-dehydrogenase, Co-succinyl-dehydrogenase, α-ketoglutarate decarboxylase, wherein the exogenous nucleic acid is expressed in amounts sufficient to produce monomeric 4-hydroxybutanoic acid (4-HB).

[0036] The non-naturally occurring microbial biocatalysts of the invention include microbial organisms using combinations of metabolic reactions to biosynthetically produce compounds of the invention. Biosynthesized compounds can be produced intracellularly and / or secreted into the culture medium. Exemplary compounds produced by non-naturally occurring microorganisms include, e.g., 4-hydroxybutanoic acid, 1,4-butanediol and γ-butyrolactone. The associations of these exemplary compounds with chemical synthesis or biosynthesis are exemplified in Figure 1.

[0037] As described herein, the non-naturally occurring microbial organism is constructed to produce 4-HB. This compound is one useful entry point to the 1,4-butanediol family of compounds. Biochemical reactions for the production of 4-HB from succinate, from succinate through succinyl-CoA or from α-ketoglutarate are shown in steps 1-8 of Figure 2.

[0038] The invention has been described herein with a general reference to a metabolic reaction, a reactant or product thereof, or with a specific reference to one or more nucleic acids or genes encoding an enzyme associated with said metabolic reaction, a reactant or product. Unless specifically indicated otherwise, those skilled in the art will understand that reference to reaction also refers to reaction substrates and reaction products. Similarly, unless explicitly stated otherwise herein, a reference to a reaction substrate or product also refers to a reaction and that reference to any of these metabolic elements also makes reference to a gene or genes encoding enzymes that catalyze said reaction, reaction substrate or product. Similarly, due to the well-known fields of biochemistry of metabolism, enzymology and genomics, reference here to a gene or coding nucleic acid also makes reference to the respective encoded enzyme and the reaction it catalyses, as well as to reactants and reaction products.

[0039] Preparation of 4-HB by biosynthesis methods using microbial organisms of the invention is particularly useful because it can give monomeric 4-HB. The non-naturally occurring microbial organisms of the invention and their 4-HB biosynthesis and BDO family of compounds are also particularly useful because the 4-HB product may be devoid of any derivatization such as coenzyme A; avoids thermodynamic changes during biosynthesis; and allows direct biosynthesis of BDO.

[0040] Microbial organisms generally do not have the ability to synthesize 4-HB, and therefore it is known that each of the compounds shown in Figure 1 is from the 1,4-butanediol compound family or is known to those skilled in the art to belong to a family of compounds 1,4-butanediol. In addition, organisms possessing all the required enzymatic metabolic capacity are not known to produce 4-HB from the enzymes described and the biochemical pathways exemplified herein.

Rather, with the possible exception of a few anaerobic microorganisms described below, microorganisms having enzymatic ability use 4-HB as a substrate for the production of e.g. succinate. In contrast, the non-naturally occurring microbial organisms of the invention produce 4-HB as a product. As described above, 4-HB biosynthesis in its monomeric form allows further biosynthesis of the BDO family of compounds and completely avoids chemical synthesis procedures.

[0041] Non-naturally occurring microbial organisms of the invention that they can produce

4-HB is obtained by ensuring that the host microbial organism has functional capabilities for complete biochemical synthesis of at least one 4-HB biosynthetic pathway according to the invention. Providing at least one required 4-HB biosynthetic pathway confers on the host microbial ability to 4HB biosynthesis.

[0042] The five required 4-HB biosynthesis pathways are exemplified herein and shown for illustrative purposes in Figure 2. One required 4-HB biosynthesis pathway involves 4-HB biosynthesis from succinate (succinate pathway). Enzymes involved in this 4-HB pathway include CoA-independent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase. In this pathway, CoA-independent succinic semialdehyde dehydrogenase catalyzes the reverse reaction to the arrow in Figure 2. Another 4-HB biosynthesis pathway required includes succinate-CoA biosynthesis (succinylCoA pathway). Enzymes involved in this 4-HB pathway include succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, and dehydrogenase

4-hydroksybutanianową. Three other required 4-HB biosynthesis pathways include 4-HB biosynthesis from aketoglutarate (α-ketoglutarate pathways). Thus, the third required 4-HB biosynthesis pathway is amber semialdehyde biosynthesis via glutamate transaminase: succinic semialdehyde, glutamate decarboxylase and 4-hydroxybutanoate dehydrogenase.

The fourth required 4-HB biosynthesis pathway that relates to the invention also includes 4-HB biosynthesis from aketoglutarate, but uses α-ketoglutarate decarboxylase to catalyze the synthesis of succinic semialdehyde. 4-hydroxybutanoate dehydrogenase catalyzes the conversion of succinic semialdehyde to 4-HB. The fifth required 4-HB biosynthesis pathway involves biosynthesis from α-ketoglutarate via succinyl-CoA and uses α-ketoglutarate dehydrogenase to produce succinyl-CoA, which enters the succinyl-CoA pathway described above. Each of these 4-HB biosynthesis pathways, their substrates, reaction substrates and products are described further below in the examples.

[0043] Non-naturally occurring microbial organisms as described herein can be produced by introducing expressed nucleic acids encoding one or more enzymes involved in one or more 4-HB biosynthesis pathways. Depending on the microbial host selected for biosynthesis, nucleic acids may be expressed for some or all of the specific 4-HB biosynthesis pathway.

For example, if the selected host lacks both enzymes in the succinate-converting pathway to 4-HB and the pathway is selected for 4-HB biosynthesis, then the expressed nucleic acids for both CoA independent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase are introduced into the host for later exogenous expression.

Alternatively, if the selected host exhibits the presence of endogenous CoA-independent dehydrogenase does not possess succinic semialdehyde biosynthesis but 4-hydroxybutanoate dehydrogenase then the coding nucleic acid is necessary for this enzyme to realize 4-HB biosynthesis.

In a similar way, when you choose

4-HB occurring via the succinate-succinyl-CoA pathway (succinyl-CoA pathway), encoding nucleic acids for a host lacking enzymes such as succinylCoA synthase, CoA-dependent succinic semialdehyde dehydrogenase and / or 4-hydroxybutanoate dehydrogenase should be subjected to exogenous expression recipient host. In the selection of 4-HB biosynthesis through the α-ketoglutarate conversion pathway to the amber semialdehyde (aketoglutarate pathway) exogenous expression can be used for a host lacking one or more enzymes such as glutamate transaminase: succinic semialdehyde, glutamate decarboxylase and / or 4-hydroxybenzohydrogenase or α-ketoglutarate decarboxylase and 4-hydroxybutanoate dehydrogenase.

[0045] Depending on the components of the 4HB biosynthesis pathway of the selected microbial host organism, the non-naturally occurring 4-HB microbial biocatalysts described herein will contain at least one exogenously expressed nucleic acid encoding the 4-HB pathway and up to all coding nucleic acids for one or more pathways 4-HB biosynthesis. For example, 4-HB biosynthesis can be established from all five pathways in a host lacking 4-hydroxybutanoate dehydrogenase, by exogenous expression of a nucleic acid encoding 4-hydroxybutanoate dehydrogenase. In contrast, 4-HB biosynthesis can be established from all five pathways in a host that lacks all eight enzymes, by exogenously expressing all eight of: CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate transaminase: semialdehyde amber, glutamate decarboxylase, α-ketoglutarate decarboxylase, aketoglutarate dehydrogenase and dehydrogenase

4-hydroksybutanianowej.

[0046] Given the indications and directions provided herein, those skilled in the art will understand that the number of coding nucleic acids to be expressed in expression will correspond at least to the parallel deficiencies of the 4-HB pathway of the selected host microbial organism. Thus, the non-naturally occurring microbial organism described herein may have one, two, three, four, five, six, seven or eight nucleic acids encoding the above enzymes constituting one or more 4HB biosynthesis pathways. In some embodiments, non-naturally occurring microbial organisms may also contain other genetic modifications that facilitate or optimize 4-HB biosynthesis or confer other useful functions on the host microbial organism. One such other functionality may include, e.g., an increase in the synthesis of one or more 4-HB pathway precursors such as succinate, succinyl-CoA and / or aketoglutarate.

[0047] In some embodiments, the non-naturally occurring microbial organism of the invention is produced from a host having the enzymatic ability to synthesize 4-HB. In this particular embodiment, it may be useful to increase the synthesis or accumulation of the 4-HB pathway product to e.g. direct the 4HB pathway reactions to 4-HB production. Increased synthesis or accumulation can be obtained e.g. by overexpressing nucleic acids encoding one or more of the above-described 4-HB pathway enzymes. Overexpression of the 4-HB pathway enzyme or enzymes can occur, e.g., by exogenous expression of an endogenous gene or genes, or by exogenous expression of a heterologous gene or genes. Thus, naturally occurring organisms can easily be converted to the non-naturally occurring 4-HB producing microbial organisms of the invention by overexpressing one, two, three, four, five or all six nucleic acids encoding enzymes of the 4-HB biosynthesis pathway. In addition, a non-naturally occurring organism can be produced by mutagenesis of an endogenous gene leading to increased enzyme activity in the 4HB biosynthesis pathway.

[0048] In particularly useful embodiments, exogenous expression of coding nucleic acids is used. Exogenous expression confers the ability to match expression and / or regulatory elements with the host and their use to achieve the desired level of expression, controlled by the user. Nevertheless, endogenous expression can also be used in other embodiments such as by removing the negative regulatory effector or inducing the gene promoter when combined with an inducible promoter or other regulatory element. Thus, an endogenous gene having a naturally occurring inducible promoter can be upregulated to provide a suitable inducing agent, or an endogenous gene regulatory region can be constructed to introduce an inducible regulatory element, thereby allowing regulation of increased endogenous gene expression at a desired time. Similarly, an inducible promoter may be included as a regulatory element for an exogenous gene introduced into a non-naturally occurring microbial organism (see, e.g., Examples II and IV).

[0049] The term "exogenous" as used herein is intended to mean that said molecule or said activity is introduced into the microbial host, which includes, e.g.

the introduction of a coding nucleic acid into host genetic material such as by integration into a host chromosome. Thus, as used for expression of a coding nucleic acid, the term refers to the introduction of the coding nucleic acid in an expressed form into a microbial organism. When used in reference to biosynthetic activity, the term refers to the activity that has been introduced into said host organism. The source may be, e.g., homologous or heterologous coding nucleic acid expressing said activity when introduced into the microbial host. Thus, the term "endogenous" refers to said molecule or activity that occurs in a host. Similarly, the term, when used in reference to the expression of a coding nucleic acid, refers to the expression of the coding nucleic acid contained in a microbial organism. The term "heterologous" refers to a molecule or activity derived from a source other than said species, while "homologous" refers to a molecule or activity derived from a host microbial organism. Accordingly, exogenous expression of the encoding nucleic acid of the invention can use either heterologous or homologous encoding nucleic acid or both.

[0050] Sources of coding nucleic acids for the 4-HB pathway enzyme may include, for example, any species in which the encoded gene product is capable of catalyzing said reaction. Such species include both prokaryotic and eukaryotic organisms, including without limitation bacteria, including archaea and eubacteria, and eukaryotes including yeast, plants, insects, animals and mammals, including humans. Exemplary species for such sources include, e.g., E.

coli, Saccharomyces cerevisiae, Clostridium kluyveri,

Clostridium acetobutylicum, Clostridium beijerinckii,

Clostridium saccharoperbutylacetonicum, Clostridium perfringens, Clostridium difficile, Ralstonia eutropha, Mycobacterium bovis, Mycobacterium tuberculosis and

Porphyromonas gingivalis. For example, 4-HB biosynthetically producing microbial organisms are exemplified herein with reference to E. coli and yeast hosts. However, with the total genome sequence available to over 550 species today (with more than half available in public databases such as

NCBI), including genomes of 395 microorganisms and genomes of various yeasts, fungi, plants and mammals, identification of genes encoding the required 4-HB biosynthetic activity for one or more genes in related or distant species, including e.g.

homologues, orthologs, paralogs and nonorthologic gene transfers for known genes and the exchange of genetic changes between organisms is routine and well known in the art. Accordingly, the metabolic changes enabling biosynthesis of 4-HB and other compounds of the invention, described herein in relation to a specific organism such as E. coli or yeast, can easily be applied to other microorganisms, including both prokaryotic and eukaryotic organisms.

Given the indications and directions provided herein, those skilled in the art will know that the metabolic change exemplified for one organism can be applied to other organisms in the same way.

[0051] In some cases, such as when the 4-HB alternative biosynthesis pathway occurs in an unrelated species, the 4-HB biosynthesis capacity can be conferred on the host species, e.g. by exogenous expression of an unrelated paralog or paralogs that catalyzes a similar, although non-identical, reaction metabolic to replace said reaction. As there are some differences in metabolic networks between different organisms, those skilled in the art will understand that the actual use of genes in different organisms may vary. However, taking into account the indications and directions provided herein, those skilled in the art will also understand that the indications and method of the invention can be applied to all microbial organisms using metabolic changes related to those exemplified herein to construct a microbial organism in a species of interest that will synthesize monomeric

4-HB.

[0052] Host microbial organisms may be selected from (and non-naturally occurring microbial organisms made from) e.g. bacteria, yeast, fungi or any of a variety of other microorganisms suitable for fermentation processes. Exemplary bacteria include species selected from E. coli, Klebsiella oxytoca,

Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Corynebacterium glutamicum,

Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum, Streptomyces coelicolor, Clostridium acetobutylicum, Pseudomonas fluorescens and Pseudomonas putida. Exemplary yeast or fungi include species selected from such as

Saccharomyces cerevisiae, Schizosaccharomyces pombe,

Kluyveromyces lactis, Kluyveromyces marxianus,

Aspergillus terreus, Aspergillus niger and Pichia pastoris.

[0053] Methods for constructing and testing expression levels in a non-naturally occurring 4-HB producing host can be accomplished, e.g., by recombinant and detection methods well known in the art.

Such methods can be found, for example, in:

Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory, New York (2001); Ausubel et al., Current Protocols in Molecular

Biology, John Wiley and Sons, Baltimore, MD (1999). 410 HB and GBL can be separated e.g. by HPLC using a Spherisorb 5 ODS1 column and a mobile phase in the form of 70% mM phosphate buffer (pH = 7) and 30% methanol and detected using a UV detector at wavelength

215 nm (Hennessy et al. 2004, J. Forensic Sci. 46 (6): 115 9). BDO is detected by gas chromatography or

HPLC and refractive index detector using an Aminex HPX-87H column and a mobile phase in the form of 0.5 mM sulfuric acid (Gonzalez-Pajuelo et al., Met. Eng. 7: 329-336 (2005)).

[0054] For example, the expression vector or expression vectors may be constructed to carry one or more nucleic acids encoding the 4-HB biosynthesis pathway and / or one or more nucleic acids encoding the BDO biosynthesis, exemplified herein, operably linked to sequences expression controls that function in the host. Expression vectors suitable for use in microbial host organisms of the invention include, e.g., plasmids, phage vectors, viral vectors, episomes and artificial chromosomes, including vectors and selection sequences or efficient markers for permanent integration into the host chromosome. Selectable marker genes can also be introduced, e.g. they confer resistance to antibiotics or toxins, supplement auxotrophic deficiencies or provide key nutrients not found in the culture media. Expression control sequences may include constitutive and inducible promoters, transcription enhancers, transcription terminators, etc., which are well known in the art. When two or more exogenous coding nucleic acids are to be co-expressed, both nucleic acids can be introduced e.g. into a single expression vector or into separate expression vectors. In the case of a single expression vector, the coding nucleic acids can be operably linked to one common expression control sequence or combined with different expression control sequences, such as one inducible promoter and one constitutive promoter.

Transformation with exogenous nucleic acid sequences involved in the metabolic or synthetic pathway can be confirmed using methods well known in the art.

[0055] Non-naturally occurring microbial organisms of the invention are constructed using methods well known in the art, as exemplified above, to exogenously express at least one nucleic acid encoding the 4-HB pathway enzyme in amounts sufficient to produce monomeric 4-HB. Exemplary levels of 4-HB enzyme expression in each pathway are then described in the examples below. In accordance with the indications and directions provided herein, non-naturally occurring microbial organisms of the invention may achieve 4-HB monomeric biosynthesis resulting in intracellular concentrations of about 0.1-25 mM or greater. Generally, the intracellular concentration of monomeric 4-HB is about 3-20 mM, especially about

5-15 mM and more specifically about 8-12 mM, including about 10 mM or more. Intracellular concentrations between each of these exemplary ranges and higher can also be obtained from the non-naturally occurring microbial organisms of the invention.

[0056] As described below below, one exemplary growth condition for biosynthesis

4-HB includes anaerobic culture or fermentation conditions. In some embodiments, the non-naturally occurring microbial organisms of the invention can be maintained, cultured or fermented with them under anaerobic or substantially anaerobic conditions. In short, the term "anaerobic conditions" refers to an oxygen-free environment. Substantially anaerobic conditions include, e.g. culture, batch fermentation or continuous fermentation in which the dissolved oxygen concentration in the medium remains between 0 and 10% saturation. Substantially anaerobic conditions also include culture or cells at rest, in liquid medium or on solid agar in a sealed chamber maintained in an atmosphere containing less than 1% oxygen. The oxygen percentage can be maintained, e.g., by flushing the culture with N mixture₂/WHAT₂ or other suitable gas or gases without oxygen.

[0057] The description also provides a non-naturally occurring microbial biocatalyst comprising a microbial organism having 4-hydroxybutanoic acid (4-HB) biosynthesis pathways and

1,4-butanediol (BDO), which contain at least a transaminase decarboxylase naturally comprising one exogenous nucleic acid encoding dehydrogenase

4-hydroxybutanoate, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase,

CoA-dependent succinic semialdehyde dehydrogenase,

CoA-4-hydroxybutyrate transferase, glutamate: succinic, glutamate semialdehyde, CoA-independent aldehyde dehydrogenase,

CoA-dependent aldehyde dehydrogenase or alcohol dehydrogenase in which the exogenous nucleic acid is expressed in quantities sufficient to produce

1,4-butanediol (BDO). CoA-4-hydroxybutyrate transferase is also known as transferase

4-hydroksybutyrylo-CoA: acetyl-CoA.

[0058] The description further provides a non-microbial biocatalyst microbial organism having 4-hydroxybutanoic acid (4-HB) biosynthesis pathways and

1,4-butanediol (BDO); wherein these pathways contain at least one exogenous nucleic acid coding for 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semhydehyde dehydrogenase, 4-hydroxybutyrate CoA-transferase, 4-butyrate kinase, alkoxybutylcarboxylase, d-transcarboxylase , alcohol dehydrogenase or aldehyde / alcohol dehydrogenase, wherein the exogenous nucleic acid is expressed in amounts sufficient to produce 1,4-butanediol (BDO).

[0059] Non-naturally occurring biosynthesizing microbial organisms can also be produced

BDO. As with the 4-HB-producing microbial organisms described herein, the BDO-producing microbial organisms of the invention may also produce BDO intracellularly or secrete BDO into the culture medium. By following the indications and guidelines previously given for the construction of microbial organisms that synthesize 4-HB, additional BDO pathways can be introduced into 4-HB producing microbial organisms to produce organisms that also synthesize BDO and another BDO family. The chemical synthesis of BDO and its post-processing products is illustrated in Figure 1. The non-naturally occurring microbial organisms of the invention capable of biosynthesis BDO bypass this chemical synthesis using 4HB as an entry point, as illustrated in Figure 2. As further described below, 4HB producing organisms can also be used e.g. to chemically convert 4-HB into GBL and then to BDO or THF.

According to the invention, producing organisms

4-HB is further modified to possess biosynthetic capabilities to convert 4-HB and / or GBL to BDO.

[0060] Additional BDO pathways for introduction into 4-HB producing organisms include, for example, exogenous expression in a host with some deficiency or overexpression of one or more enzymes exemplified in Figure 2 as steps 9-13. One such pathway includes, e.g., the enzymatic activities necessary to carry out the reactions represented by steps 9, 12 and 13 in Fig. 2. wherein the aldehyde dehydrogenase and alcohol dehydrogenase may be separate enzymes or a multifunctional enzyme having both aldehyde and alcohol dehydrogenase activity. Another such pathway includes, for example, the enzymatic activities necessary to carry out the reactions represented by steps 10, 11, 12 and 13 in Fig. 2, wherein the aldehyde dehydrogenase and alcohol dehydrogenase may also be separate enzymes or a multifunctional enzyme with both aldehyde and alcohol dehydrogenase activity. Accordingly, additional BDO pathways to be introduced into producing organisms

4-HB include, e.g., exogenous expression in a host with some deficiency or overexpression of one or more of: CoA-4-hydroxybutyrate transferase, butyrate kinase, phosphotransbutyrylase, CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or alcohol dehydrogenase. Without endogenous acyl-CoA synthetase capable of modifying 4-HB, non-naturally occurring BDO-producing microbes may also include 4-HB exogenous acyl-CoA synthetase or a combination of multiple enzymes for which the net reaction is 4-HB conversion to 4-HB CoA. As exemplified below in the examples below, butyrate kinase and phosphotransbutyrylase exhibit BDO pathway activity and catalyze the transformations illustrated in Fig. 2 with 4-HB substrate. Thus, these enzymes may also be referred to as 4-hydroxybutyrate kinase and phosphotranshydroxybutyrylase, respectively.

[0061] Exemplary alcohol dehydrogenases and aldehyde dehydrogenases that can be used for these transformations from 4-HB to BDO in vivo are listed in Table 1 below.

Table 1. Alcohol and aldehyde dehydrogenases for converting 4-HB into BDO.

Alcohol dehydrogenases

EC: 1.1.1.78 methylglyoxal reductase (NADH-dependent)

EC: 1.1.1.1 dehydrogenase

EC: 1.1.1.79 alcohol reductase

<td>EC: 1.1.1.2</td><td>dehydrogenase alcohol (NADP +)</td><td>EC: 1.1.1.80</td>

<td>EC: 1.1.1.4</td><td>dehydrogenase (R, R) butanodiolowa</td><td>EC: 1.1.1.81</td>

<td>EC: 1.1.1.5</td><td>dehydrogenase acetoinowa</td><td>EC: 1.1.1.82</td>

<td>EC: 1.1.1.6</td><td>dehydrogenase glycerol</td><td>EC: 1.1.1.83</td>

<td>EC: 1.1.1.7</td><td>dehydrogenase</td><td>EC: 1.1.1.84</td>

propane diolphosphate

<td>EC: 1.1.1.8</td><td>dehydrogenase</td><td>EC</td>

<td></td><td>glycerol-3-</td><td></td>

phosphate (NAD +)

<td>EC: 1.1.1.11</td><td>4-dehydrogenase</td><td>D-EC: 1.1.1.86</td>

<td></td><td>arabinitolowa</td><td></td>

<td>EC: 1.1.1.12</td><td>4-dehydrogenase</td><td>L-EC: 1.1.1.87</td>

<td></td><td>arabinitolowa</td><td></td>

glyoxalate (NADP +) isopropanol dehydrogenase (NADP +) hydroxypyruvate reductase malate dehydrogenase (NADP +) dehydrogenase

D-malate (decarboxylating) dimethyl malate dehydrogenase

3-isopropyl malate ketol acid reductase homoisocitrate dehydrogenase

<td>EC: 1.1.1.13</td><td>2-dehydrogenase</td><td>L-EC: 1.1.1.88</td><td>reductase</td>

<td></td><td>arabinitolowa</td><td></td><td>hydroksymetyloglu-</td>

<td></td><td></td><td></td><td>tarylo-CoA</td>

<td>EC: 1.1.1.14</td><td>2-dehydrogenase</td><td>L</td><td></td>

<td></td><td>iditolowa</td><td></td><td></td>

<td>EC: 1.1.1.15</td><td>2-dehydrogenase</td><td>D-EC: 1.1.1.90</td><td>dehydrogenase</td>

<td></td><td>iditolowa</td><td></td><td>aryl alcohols</td>

<td>EC: 1.1.1.16</td><td>2-dehydrogenase</td><td>EC: 1.1.1.91</td><td>dehydrogenase</td>

<td></td><td>galaktytolowa</td><td></td><td>aryl alcohols</td>

<td></td><td></td><td></td><td>(NADP +)</td>

<td>EC: 1.1.1.17</td><td>5-dehydrogenase</td><td>EC: 1.1.1.92</td><td>reductase</td>

<td></td><td>mannitolo-1-</td><td></td><td>oksaloglikolanowa</td>

<td></td><td>phosphate</td><td></td><td>(Dekarboksylująca)</td>

<td>EC: 1.1.1.18</td><td>2-dehydrogenase</td><td>EC: 1.1.1.94</td><td>dehydrogenase</td>

<td></td><td>inozytolowa</td><td></td><td>glycerolo-3-</td>

<td></td><td></td><td></td><td>phosphate</td>

<td colspan="3"></td><td>[NAD (P) +]</td>

<td>EC: 1.1.1.21</td><td>reductase</td><td></td><td></td>

<td></td><td>aldehyde</td><td></td><td></td>

<td>EC: 1.1.1.23</td><td>dehydrogenase</td><td></td><td></td>

<td></td><td>histidinol</td><td></td><td></td>

<td>EC: 1.1.1.26</td><td>reductase</td><td></td><td></td>

<td></td><td>glyoxylate</td><td></td><td></td>

<td>EC: 1.1.1.27</td><td>dehydrogenase</td><td>EC: 1.1.1.95</td><td>dehydrogenase</td>

<td></td><td>L-lactate</td><td colspan="2">fosfogliceryniano-</td>

<td></td><td></td><td></td><td>wa</td>

<td>EC: 1.1.1.28</td><td>dehydrogenase</td><td>EC: 1.1.1.97</td><td>dehydrogenase</td>

<td></td><td>D-lactate</td><td></td><td>3-hydro alcohol</td>

<td></td><td></td><td></td><td>ksybenzylowego</td>

<td>EC: 1.1.1.29</td><td>dehydrogenase</td><td>EC: 1.1.1.101</td><td>reductase</td>

<td></td><td>phosphoglycerate</td><td></td><td>acyloglicerolo-</td>

<td></td><td></td><td></td><td>phosphate</td>

<td>EC: 1.1.1.30</td><td>dehydrogenase</td><td>EC: 1.1.1.103</td><td>3-dehydrogenase</td>

<td></td><td>3-hydroxy-</td><td></td><td>L-threonine</td>

<td></td><td>butyrate</td><td></td><td></td>

<td>EC: 1.1.1.31</td><td>dehydrogenase</td><td>EC: 1.1.1.104</td><td>4-oxo reductase</td>

<td></td><td>3-hydroxy-</td><td></td><td>proline</td>

<td></td><td>izomaślanowa</td><td></td><td></td>

<td>EC: 1.1.1.35</td><td>dehydrogenase</td><td>EC: 1.1.1.105</td><td>dehydrogenase</td>

<td></td><td>3-hydroksyacylo-</td><td></td><td>retinol</td>

<td></td><td>CoA</td><td></td><td></td>

<td>EC: 1.1.1.36</td><td>reductase</td><td>EC: 1.1.1.110</td><td>dehydrogenase</td>

<td></td><td>acetoacetyl-CoA</td><td></td><td>indolomleczanowa</td>

<td>EC: 1.1.1.37</td><td>dehydrogenase</td><td>EC: 1.1.1.112</td><td>dehydrogenase</td>

<td></td><td>malate</td><td></td><td>indanolowa</td>

<td>EC: 1.1.1.38</td><td>dehydrogenase</td><td>EC: 1.1.1.113</td><td>1-dehydrogenase</td>

<td></td><td>malate</td><td></td><td>L-xylose</td>

decarboxylating oxaloacetate)

<td>EC: 1.1.1.39</td><td>dehydrogenase</td><td>EC: 1.1.1.1.29</td><td>3-dehydrogenase</td>

<td></td><td>malate</td><td></td><td>L-treonianowa</td>

<td></td><td>(Dekarboksylująca)</td><td></td><td></td>

<td>EC: 1.1.1.40</td><td>dehydrogenase</td><td>EC: 1.1.1.137</td><td>2-dehydrogenase</td>

<td></td><td>malate</td><td></td><td>rybitolo-5-</td>

<td></td><td>(dekarboksylująca</td><td></td><td>phosphate</td>

<td></td><td>oxaloacetate)</td><td></td><td></td>

<td></td><td>(NADP +)</td><td></td><td></td>

<td>EC: 1.1.1.41</td><td>dehydrogenase</td><td>EC: 1.1.1.138</td><td>2-dehydrogenase</td>

<td></td><td>isocitrate</td><td></td><td>mannitol</td>

<td></td><td>(NAD +)</td><td></td><td>(NADP +)</td>

<td>EC: 1.1.1.42</td><td>dehydrogenase</td><td>EC: 1.1.1.140</td><td>2-dehydrogenase</td>

<td></td><td>isocitrate</td><td></td><td>sorbitolo-6-</td>

<td></td><td>(NADP +)</td><td></td><td>phosphate</td>

<td>EC: 1.1.1.54</td><td>dehydrogenase</td><td>EC: 1.1.1.142</td><td>dehydrogenase</td>

<td></td><td>alcohol</td><td></td><td>D-pinitolowa</td>

<td></td><td>allyl</td><td></td><td></td>

<td>EC: 1.1.1.55</td><td>reductase</td><td>EC: 1.1.1.143</td><td>dehydrogenase</td>

<td></td><td>laktaldehydowa</td><td></td><td>sekwoitolowa</td>

<td></td><td>(NADPH)</td><td></td><td></td>

<td>EC: 1.1.1.56</td><td>2-dehydrogenase</td><td>EC: 1.1.1.144</td><td>dehydrogenase</td>

<td></td><td>ribitol compounds</td><td></td><td>alcohol</td>

<td></td><td></td><td></td><td>perylilowego</td>

<td>EC: 1.1.1.59</td><td>dehydrogenase</td><td>EC: 1.1.1.156</td><td>2-dehydrogenase</td>

<td></td><td>3-hydroxypropyl</td><td></td><td>glycerol</td>

<td></td><td>pionianowa</td><td>(NADP +)</td>

<td>EC: 1.1.1.60</td><td>2-hydro reductase</td><td>EC: 1.1.1.157 dehydrogenase</td>

<td></td><td>propoxy-3-oxo-</td><td>3-hydroksybutyrylo</td>

<td></td><td>propionate</td><td>CoA</td>

<td>EC: 1.1.1.61</td><td>dehydrogenase</td><td>EC: 1.1.1.163 dehydrogenase</td>

<td></td><td>4-hydroxy-</td><td>cyklopentanolowa</td>

<td></td><td>butyrate</td><td></td>

<td>EC: 1.1.1.66</td><td>dehydrogenase</td><td>EC: 1.1.1.164 dehydrogenase</td>

<td></td><td>omega-hydroxy-</td><td>heksadekanolowa</td>

<td></td><td>decanoate</td><td></td>

<td>EC: 1.1.1.67</td><td>2-dehydrogenase</td><td>EC: 1.1.1.165 dehydrogenase</td>

<td></td><td>mannitol</td><td>2-alkyne-1-lead</td>

<td>EC: 1.1.1.71</td><td>dehydrogenase</td><td>EC: 1.1.1.166 dehydrogenase</td>

<td></td><td>Alcoholic</td><td>hydroksycyklo-</td>

<td></td><td>[NAD (P) +]</td><td>heksanokarboksy-</td>

<td></td><td></td><td>fiefs</td>

<td>EC: 1.1.1.72</td><td>dehydrogenase</td><td>EC: 1.1.1.167 dehydrogenase</td>

<td></td><td>glycerol</td><td>hydroksymaloniano-</td>

<td></td><td>(NADP +)</td><td>wa</td>

<td>EC: 1.1.1.73</td><td>dehydrogenase</td><td>EC: 1.1.1.174 dehydrogenase</td>

<td></td><td>octanolic</td><td>cyclohexane-1,2</td>

<td></td><td></td><td>diol</td>

EC: 1.1.1.75 (R) aminopropanol dehydrogenase dehydrogenase EC: 1.1.1.177 1-dehydrogenase

EC: 1.1.1.76

<td></td><td>(S, S) -butano-</td><td>glycerol-3-</td>

<td></td><td>diol</td><td>phosphate (NADP +)</td>

<td>EC: 1.1.1.77</td><td>reductase laktaldehydowa</td><td></td>

<td>EC: 1.1.1.178</td><td>EC dehydrogenase: 1.2.1.5</td><td>dehydrogenase</td>

<td></td><td>3-hydroxy-2-</td><td>aldehyde</td>

<td></td><td>methylbutyryl-CoA</td><td>[NAD (P) +]</td>

<td>EC: 1.1.1.185</td><td>EC dehydrogenase: 1.2.1.7</td><td>dehydrogenase</td>

<td></td><td>L-glycol</td><td>benzaldehyde [NAD (P) +]</td>

<td>EC: 1.1.1.190</td><td>indole-EC reductase: 1.2.1.8</td><td>dehydrogenase</td>

<td></td><td>3-acetaldehyde</td><td>aldehyde</td>

<td></td><td>(NADH)</td><td>betaine</td>

<td>EC: 1.1.1.191</td><td>indole-EC reductase: 1.2.1.9</td><td>dehydrogenase</td>

<td></td><td>3-acetaldehyde</td><td>glyceroaldehydo-</td>

<td></td><td>(NADPH)</td><td>3-phosphate (NADP +)</td>

<td>EC: 1.1.1.192</td><td>EC dehydrogenase: 1.2.1.10</td><td>dehydrogenase</td>

<td></td><td>long alcohol</td><td>acetaldehyde</td>

<td></td><td>chain</td><td>(Acetylująca)</td>

<td>EC: 1.1.1.194</td><td>dehydrogenase alcohol coniferyl</td><td></td>

<td>EC: 1.1.1.195</td><td>EC dehydrogenase: 1.2.1.11</td><td>dehydrogenase</td>

<td colspan="3">alcohol</td><td>semialdehyde</td>

<td></td><td>cinnamyl</td><td></td><td>asparaginianoweg</td>

<td>EC: 1.1.1.198</td><td>dehydrogenase</td><td>(+) - EC: 1.2.1.12</td><td>dehydrogenase</td>

<td></td><td>borneolowa</td><td></td><td>gliceroaldehydo-</td>

<td></td><td></td><td></td><td>3-phosphate</td>

<td></td><td></td><td></td><td>(Phosphorylates)</td>

<td>EC: 1.1.1.202</td><td>dehydrogenase</td><td>1,3-EC: 1.2.1.13</td><td>dehydrogenase</td>

<td></td><td>propanodiolowa</td><td></td><td>gliceroaldehydo-</td>

<td></td><td></td><td></td><td>3-phosphate</td>

<td></td><td></td><td></td><td>(NADP +)</td>

<td></td><td></td><td></td><td>(Phosphorylates)</td>

<td>EC: 1.1.1.207</td><td>dehydrogenase</td><td> (-)-</td><td></td>

<td></td><td>menthol</td><td></td><td></td>

<td>EC: 1.1.1.208</td><td>dehydrogenase</td><td> (+)-</td><td></td>

<td></td><td>neomentolowa</td><td></td><td></td>

<td>EC: 1.1.1.216</td><td>dehydrogenase</td><td>EC: 1.2.1.15</td><td>dehydrogenase</td>

<td></td><td>farnezolowa</td><td></td><td>semialdehyde</td>

<td></td><td></td><td></td><td>malonate</td>

<td>EC: 1.1.1.217</td><td>dehydrogenase</td><td>EC: 1.2.1.16</td><td>dehydrogenase</td>

<td></td><td>benzyl-2-methyl</td><td></td><td>semialdehyde</td>

<td></td><td>lohydroksymaśla</td><td> -</td><td>succinate</td>

<td></td><td>new</td><td></td><td>[NAD (P) +]</td>

<td>EC: 1.1.1.222</td><td>dehydrogenase</td><td>(R) -ec: 1.2.1.17</td><td>dehydrogenase</td>

<td></td><td>4-hydroxy-</td><td></td><td>glyoxylate</td>

acylating phenyl lactate)

<td>EC: 1.1.1.223</td><td>EC dehydrogenase: 1.2.1.18</td><td>dehydrogenase</td>

<td></td><td>izopiperitenolowa</td><td>semialdehyde malonate (Acetylująca)</td>

<td>EC: 1.1.1.226</td><td>EC dehydrogenase: 1.2.1.19</td><td>dehydrogenase</td>

<td></td><td>4-hydroksycyklo-</td><td>aldehyde</td>

<td></td><td>heksanokarboksylanowa</td><td>aminobutyric acid</td>

<td>EC: 1.1.1.229</td><td>EC reductase: 1.2.1.20</td><td>dehydrogenase</td>

<td></td><td>2-methyl-3-oxo-</td><td>semialdehyde</td>

<td></td><td>succinate diethyl</td><td>glutaranowego</td>

<td>EC: 1.1.1.237</td><td>hydro-EC reductase: 1.2.1.21</td><td>dehydrogenase</td>

<td></td><td>ksyfenylopirogronianowa</td><td>glikoloaldehydowa</td>

<td>EC: 1.1.1.244</td><td>EC dehydrogenase: 1.2.1.22</td><td>dehydrogenase</td>

<td></td><td>The methanol</td><td>laktaldehydowa</td>

<td>EC: 1.1.1.245</td><td>EC dehydrogenase: 1.2.1.23</td><td>dehydrogenase</td>

<td></td><td>cykloheksanolowa</td><td>2-oksoaldehydowa (NAD +)</td>

<td>EC: 1.1.1.250</td><td>D-EC 2-dehydrogenase: 1.2.1.24</td><td>dehydrogenase</td>

<td></td><td>arabinitolowa</td><td>semialdehyde succinate</td>

<td>EC: 1.1.1.251</td><td>EC 5-dehydrogenase: 1.2.1.25</td><td>dehydrogenase</td>

galaktytolo2-oksoizowaleria58

1-phosphate

<td>EC: 1.1.1.255</td><td>dehydrogenase mannitol</td><td>EC: 1.2.1.26</td>

<td>EC: 1.1.1.256</td><td>dehydrogenase fluoren-9-lead</td><td>EC: 1.2.1.27</td>

<td>EC: 1.1.1.257</td><td>dehydrogenase 4- (hydroxymethyl) benzenesulfonate</td><td>EC: 1.2.1.28</td>

<td>EC: 1.1.1.258</td><td>dehydrogenase 6-hydroxyhexanoate</td><td>EC: 1.2.1.29</td>

<td>EC: 1.1.1.259</td><td>dehydrogenase 3-hydroksypimeloilo-CoA</td><td>EC: 1.2.1.30</td>

<td>EC: 1.1.1.261</td><td>dehydrogenase glycerol-1-phosphate [NAD (P) +]</td><td>EC: 1.2.1.31</td>

<td>EC: 1.1.1.265</td><td>reductase</td><td>EC: 1.2.1.32</td>

3-methylbutanal nian (acylating) dehydrogenase

2,5-dioxovalerate methyl malonate semialdehyde dehydrogenase (acylating) benzaldehyde dehydrogenase (NAD +) aryl aldehyde dehydrogenase aryl aldehyde dehydrogenase (NADP +) semialdehyde dehydrogenase

L-aminoadipate aminomuconate semialdehyde dehydrogenase

<td>EC: 1.1.1.283</td><td>reductase</td><td>EC: 1.2.1.36</td><td>dehydrogenase</td>

<td></td><td>metyloglioksalowa</td><td></td><td>retinalowa</td>

<td></td><td>(NADPH-dependent)</td><td></td><td></td>

<td>EC: 1.1.1.286</td><td>dehydrogenase</td><td>EC: 1.2.1.39</td><td>dehydrogenase</td>

<td></td><td>izocytrynian-</td><td></td><td>fenyloacetaldehy</td>

<td></td><td>homoizocytrynian</td><td></td><td>Judicial</td>

<td>EC: 1.1.1.287</td><td>D- dehydrogenase</td><td>EC: 1.2.1.41</td><td>dehydrogenase</td>

<td></td><td>arabinitolowa</td><td></td><td>5-semialdehyde</td>

<td></td><td>(NADP +)</td><td></td><td>glutamate</td>

<td></td><td>dehydrogenase</td><td></td><td></td>

<td></td><td>butanol</td><td></td><td></td>

<td>DEHYDROGENASE</td><td>aldehyde</td><td></td><td></td>

<td>EC: 1.2.1.2</td><td>dehydrogenase</td><td>EC: 1.2.1.42</td><td>dehydrogenase</td>

<td></td><td>formate</td><td></td><td>heksadekanalowa</td>

<td></td><td></td><td></td><td>(Acylation)</td>

<td>EC: 1.2.1.3</td><td>dehydrogenase</td><td>EC: 1.2.1.43</td><td>dehydrogenase</td>

<td></td><td>aldehyde (NAD +)</td><td></td><td>formate</td>

<td></td><td></td><td></td><td>(NADP +)</td>

<td>EC: 1.2.1.4</td><td>dehydrogenase</td><td>EC: 1.2.1.59</td><td>dehydrogenase</td>

<td></td><td>aldehyde (NADP +)</td><td></td><td>gliceroaldehydo-</td>

<td></td><td></td><td></td><td>3-phosphate</td>

<td></td><td></td><td></td><td>(NAD (P) +)</td>

<td></td><td></td><td></td><td>(Phosphorylates)</td>

<td>EC: 1.2.1.45</td><td>dehydrogenase</td><td>EC: 1.2.1.62</td><td>dehydrogenase</td>

4- semialdehyde 4-

<td colspan="3">carboxy-2-</td>

<td>EC: 1.2.1.46</td><td>hydroksymukonianowego dehydrogenase</td><td>EC: 1.2.1.63</td>

<td>EC: 1.2.1.47</td><td>formaldehyde dehydrogenase</td><td>EC: 1.2.1.64</td>

<td>EC: 1.2.1.48</td><td>4-trimetyloamoniakobutyraldehydowa dehydrogenase</td><td>EC: 1.2.1.65</td>

<td></td><td>aldehydes long</td><td></td>

<td>EC: 1.2.1.49</td><td>chain dehydrogenase</td><td>EC: 1.2.1.66</td>

<td>EC: 1.2.1.51</td><td>2-oksoaldehydowa (NADP +) dehydrogenase</td><td>EC: 1.2.1.67</td>

<td>EC: 1.2.1.52</td><td>pyruvate (NADP +) dehydrogenase</td><td>EC: 1.2.1.68</td>

<td>EC: 1.2.1.53</td><td>oxoglutarate (NADP +) dehydrogenase</td><td>EC: 1.2.1.69</td>

4-hydroksyfenyloacetaldehydowa

4-formylbenzenesulfonate dehydrogenase

6-oxohexanoate dehydrogenase

4-hydroxybenzaldehyde dehydrogenase salicylaldehyde dehydrogenase formaldehyde dehydrogenase mycothiol-dependent vanillin dehydrogenase dehydrogenase coniferylaldehyde dehydrogenase fluoroacetaldehyde dehydrogenase

EC: 1.2.1.57 butanal dehydrogenase

EC: 1.2.1.71 succinylglutamate semialdehyde dehydrogenase

EC: 1.2.1.58 Phenylglyoxalate (acylating) dehydrogenase [0062] Pathways other than those exemplified above can also be used to obtain BDO biosynthesis in non-naturally occurring microbial organisms. In one embodiment, biosynthesis can be achieved using L-homoserine in the BDO pathway. This trail has a molar capacity of

0.90 mol / mol glucose, which appears to be limited by the availability of reducing equivalents. The second pathway synthesizes BDO from acetoacetate and is able to give a maximum theoretical yield of

1,091 mol / mol glucose. Each of these pathways can be implemented by introducing two exogenous enzymes and both pathways can further complement BDO production via succinyl-CoA. Pathway enzymes, thermodynamics, theoretical yields and general feasibility are then described below.

[0063] The homoserine pathway can also be constructed to obtain BDO producing microbial organisms. Homoserine is an intermediate in the metabolism of threonine and methionine, created from oxaloacetate via aspartate. The conversion of oxaloacetate to homoserine requires one molecule

NADH, two NADPH molecules and one ATP molecule (Fig. 3). After formation, homoserine enters the biosynthesis pathways for both threonine and methionine. In most organisms, high levels of threonine or methionine inhibit, by feedback, the homoserine biosynthesis pathway (Caspi et al., Nucleic Acids Res.

34: D511-D516 (1990)).

[0064] The conversion of homoserine into 4-hydroxybutyrate (4-HB) can be achieved in two enzymatic steps as shown in Figure 4. The first step in this pathway is deamidation of homoserine by putative ammonia-lyase. The estimated thermodynamic barrier of the reaction is 12 kJ / mol, but it can probably be moved forward using a concentration gradient. In stage 2, the 4-hydroxybut-2-enonate alkene product is reduced to 4-HB by putative reductase at the expense of one NADH molecule.

This thermodynamic reaction step is very favorable for 4-HB synthesis with estimated A_rxnG of -59 kJ / mol. 4-HB can then be converted to BDO as in Figure 2 above.

[0065] Enzymes capable of catalyzing the above transformations are shown in Figure 5. For example, ammonia-lyase in step 1 of the pathway closely resembles the chemical properties of aspartate ammonia-lyase (aspartase). Aspartase is a common enzyme found in microorganisms and has been extensively characterized (Viola, RE, Mol. Biol.

74: 295-341 (2008)). The crystal structure of E. coli aspartase was known (Shi et al., Biochemistry 36: 9136-9144 (1997)), so it is possible to directly construct a mutation at the active site of the enzyme that would change its substrate specificity to include homoserine. Stage 2 oxidoreductase has chemical properties similar to those of several well-characterized enzymes including fumarate reductase in the E. coli TCA cycle.

Because the thermodynamics of this reaction is very beneficial, endogenous reductase with broad substrate specificity will likely be able to reduce

4-hydroxy-but-2-enonian. The yield of this pathway under anaerobic conditions is 0.9 mole BDO per mole glucose though, when compared to the pathway in Fig.

(1.09 mol / mol glucose), both pathways appear to have similar energy and reduction requirements from the metabolic precursor oxaloacetate (Figure 6).

[0066] The succinyl-CoA pathway has been found to have greater efficiency due to the fact that it is more energy efficient. The conversion of one oxaloacetate molecule in BDO through the homoserine pathway will require an expenditure of 2 equivalents of ATP. Due to the fact that the conversion of glucose into oxaloacetate molecules can produce up to 3 molecules

ATP, assuming that PEP carboxyquinase gives reversible reactions, gross conversion of glucose to BDO by homoserine has negative energy efficiency. As expected, if we assume that energy can be generated by breathing, the maximum homoserine pathway efficiency increases to 1.05 mol / mol glucose, which is 96% of the succinyl-CoA pathway efficiency. The succinyl-CoA pathway can discharge some of the carbon stream via pyruvate dehydrogenase and the oxidative branch of the TCA cycle to produce both reducing equivalents and succinyl-CoA without energy expenditure. Thus, the same energy difficulties are not encountered as in the case of the homoserine pathway, because not all of the stream is directed through oxaloacetate to succinyl-CoA to BDO.

Generally, the homoserine pathway represents a moderately high yielding path leading to BDO. One particularly useful feature is that having only two non-native stages requires minimal manipulation

Probably genetic engineering.

in terms of organisms, the thermodynamic pathway favors the synthesis of BDO by methods.

[0067] The acetoacetate pathway should also be constructed to produce microbial BDO-producing. In E. coli, acetoacetate is formed from the degradation of acetone and leucine. Acetoacetate can also be formed from acetyl-CoA by enzymes involved in fatty acid metabolism, including acetyl-CoA acetyltransferase and acetoacetyl-CoA- transferase (Figure 7). Acetate acetate biosynthesis pathways are also particularly useful in microbial organisms that can metabolize monocarbon compounds to form acetyl-CoA.

[0068] The three-step pathway from acetoacetate to succinic semialdehyde (Fig. 8) can be used to synthesize BDO via acetoacetate. Amber semialdehyde, which separates one reduction step from succinyl-CoA or one decarboxylation step from α-ketoglutarate, can be converted to BDO by following the three reduction steps (Figure 2). Briefly, step 1 of the acetoacetate biological pathway involves the conversion of acetoacetate to 3-aminobutanoate by ωaminotransferase. O-aminotransferase o-amino: pyruvate (ω-APT) was overexpressed from

Alcaligenes denitrificans in E. coli and has been shown to have high production activity

In vitro 3-aminobutanoate (Yun et al., Appl. Environ. Microbiol. 70: 2529-2534 (2004)). In this study, ω-APT activity was not measured in the required direction due to the spontaneous degradation of acetoacetate to acetone in the reaction mixture. Thermodynamics, however, indicates that this is feasible.

[0069] According to step 2, the putative aminomutase transfers the amino group from position 3 to position 4 of the main carbon chain. The aminomutase performing this activity on 3-aminobutaniate was not characterized, but the Clostridium stickland enzyme has a very similar mechanism (Fig. 9). The enzyme, D-lysine5,6-aminomutase, is involved in lysine biosynthesis.

[0070] The synthesis pathway to BDO from acetoacetate passes through 4-aminobutanoate, a metabolite in E. coli, which normally arises as a result of glutamate decarboxylation. Once formed, 4-aminobutanoate can be converted to succinic semialdehyde by 4-aminobutanoate transaminase (2.6.1.19), an enzyme that has been biochemically characterized.

The thermodynamics of this enzyme and other stages of the pathway are close to equilibrium, and therefore the action of the enzymes in the direction of interest is probably driven by the concentrations of substrate and product.

[0071] One solution for selecting enzyme candidates for this pathway is the stereoselectivity of the enzymes involved in the first two stages. ω-ABT in

Alcaligenes denitrificans is specific for the L stereoisomer of 3-aminobutanoate, while Diazine 5,6-aminomutase probably requires the stereoisomer D. If enzymes with complementary stereoselectivity could not be found or constructed, a third enzyme with racemase activity could be added to the pathway -3-aminobutanoate in D-3-aminobutanoate. Although amino acid racemases are widespread, it is unknown whether these enzymes can act on ω-amino acids.

[0072] The maximum theoretical molar yield of this pathway under anaerobic conditions is 1.091 mol / mol glucose. In order to generate the stream from acetoacetate to BDO, it was necessary to assume that the acetyl-CoA: acetoacetyl-CoA transferase (enzyme 3 in Figure 10) produces reversible reactions. The function of this enzyme in E. coli is to metabolize short chain fatty acids by first converting them into thioesters.

[0073] Although no effect of acetylCoA: acetoacetyl-CoA transferase in acetate consumption was demonstrated experimentally in E. coli, studies on similar enzymes in other organisms confirm the supposition that this reaction is reversible. Butyryl-CoA transferase enzyme: acetate: CoA in gut microbes Roseburia sp. And F.

prausnitzii works in the direction that uses acetate to produce butyrate (Duncan et al., Appl. Environ.

Microbiol 68: 5186-5190 (2002)). Another very similar enzyme, CoA-acetyl: succinate in Trypanosoma brucei, also works in the acetate-based direction. This reaction has A._rxnG close to equilibrium and therefore high acetate concentrations may probably direct the reaction in the direction of interest. Simulations of the maximum theoretical BDO production of 1.09 mol / mol glucose predict that E.

coli can produce 1.098 moles ATP per mole glucose without fermentation by-products. This ATP yield should be sufficient for cell growth, maintenance and production. The acetoacetate biological pathway is a highly efficient pathway leading to BDO with acetyl-CoA. Like the homoserine pathway, this pathway requires minimal strain modification using genetic engineering methods with only two non-native stages in addition to the BDO pathway.

[0074] Thus, in addition to any of the various modifications exemplified previously to obtain 4-HB biosynthesis in a selected host, BDO-producing microbial organisms may contain any of the previous combinations and permutations of metabolic modifications of the 4-HB pathway, as well as any combination of expression for CoAdependent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or alcohol dehydrogenase for the production of GBL and / or BDO biosynthesis pathways. Thus, the BDO producing organisms described herein may exogenously express e.g. one, two, three, four, five, six, seven, eight, nine or all 10 enzymes suitable for any of the six enzymes of the 4-HB pathway and / or any of the 4 BDO pathway enzymes.

[0075] Design and construction of genetically modified microbial organisms is carried out using methods well known in the art to obtain sufficient expression to produce BDO. In particular, the non-naturally occurring microbial organisms of the invention can achieve BDO biosynthesis leading to intracellular concentrations of about 0.1-25 mM or more. Generally, the intracellular concentration of BDO is about 3-20 mM, especially about 5-15 mM and more specifically about 8-12 mM, including about 10 mM or more.

Intracellular concentrations between each of these exemplary ranges and higher can also be obtained from the non-naturally occurring microbial organisms of the invention. As with 4-HB producing organisms, BDO producing organisms can also be maintained, cultured or fermented under anaerobic conditions.

[0076] The description further provides a production method

4-HB. The method comprises culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthesis pathway containing at least one exogenous nucleic acid encoding dehydrogenase

4-hydroxybutanoate, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate transaminase: succinic semialdehyde, α-ketoglutarate decarboxylase or a decarboxylase by a time-monomeric glutamate hydroxybutane (4-HB). The method may further comprise e.g. chemical transformation

4-HB in GBL and in BDO or THF e.g.

[0077] Furthermore, a production method is provided

4-HB. The method involves culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid biosynthesis pathway (4-HB) containing at least one exogenous nucleic acid coding for 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthase, CoA-dependent succinyl succinate-semaldehyde-succinate, substantially anaerobic for a period of time sufficient to produce monomeric acid

4-hydroxybutane (4-HB). The resulting product, 4-HB, can be secreted into the culture medium.

[0078] In addition, a manufacturing method is provided

BDO. The method comprises culturing a non-naturally occurring microbial biocatalyst, including a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthesis pathways, wherein these pathways contain at least one exogenous nucleic acid encoding 4-hydroxybutcinate dehydrogenase synthetase -CoA, CoA-dependent succinic semialdehyde dehydrogenase, Co-4-hydroxybutyrate CoAtransferase, kinase

4-hydroxybutyrate, phosphotranshydroxybutyrylase, α-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or aldehyde / alcohol dehydrogenase for a time sufficient to produce 1,4-butanediol (BDO). The resulting product, BDO, can be secreted into the culture medium.

[0079] It is understood that in the method of the invention, any of one or more exogenous nucleic acids can be introduced into a microbial organism to produce a non-naturally occurring microbial organism according to the invention. Nucleic acids can be introduced so as to obtain a biosynthetic pathway in the microbial organism, e.g. 4-HB, BDO, THF or GBL. Alternatively, coding nucleic acids can be introduced to obtain an intermediate microbial organism possessing biosynthesis capacity to catalyze certain required reactions to confer biosynthesis capacity for 4-HB, BDO, THF or GBL. For example, a non-naturally occurring microbial organism having a 4-HB biosynthesis pathway may contain at least two exogenous nucleic acids encoding the desired enzymes, such as a combination of 4-hydroxybutanoate dehydrogenase and α73 ketoglutarate decarboxylase; 4-hydroxybutanoate dehydrogenase and CoA-independent succinic semialdehyde dehydrogenase; 4-hydroxybutanoate dehydrogenase and

CoA-dependent succinic semialdehyde dehydrogenase;

CoA-dependent succinic semialdehyde dehydrogenase and succinyl-CoA synthetase; succinyl-CoA synthetase and glutamate decarboxylase, etc. Thus, it is understood that any combination of two or more biosynthetic pathway enzymes can be introduced into the non-naturally occurring microbial organism described herein. Similarly, it is understood that any combination of three or more biosynthesis pathway enzymes can be introduced into the non-naturally occurring microbial organism described herein, e.g., hydroxybutanoate dehydrogenase, α-ketoglutarate decarboxylase, and

CoA-dependent succinic semialdehyde dehydrogenase; CoA-independent succinic semialdehyde dehydrogenase and succinyl-CoA synthetase; 4-hydroxybutanoate dehydrogenase, CoA-dependent succinic semialdehyde dehydrogenase and glutamate: succinic semialdehyde transaminase and etc., if desired, as long as the combination of enzymes of the desired biosynthesis pathway leads to the formation of the desired desired product.

naturally the invention.

[0080] Similarly, e.g., for any one or more exogenous nucleic acids introduced to produce BDO, a non-naturally occurring microbial organism having a BDO biosynthesis pathway may contain at least two exogenous nucleic acids encoding the desired enzymes, such as a combination of dehydrogenase

4-hydroxybutanoate and aketoglutarate decarboxylase; 4-hydroxybutanoate dehydrogenase and 4-hydroxybutyryl-CoA: acetyl-CoA transferase; 4-hydroxybutanoate dehydrogenase and butyrate kinase; 4-hydroxybutanoate dehydrogenase and phosphotransbutyrylase; 4-hydroxybutyrylCoA: acetyl-CoA and aldehyde dehydrogenase transferases;

4-hydroxybutyryl-CoA: acetyl-CoA and alcohol dehydrogenase transferases; 4-hydroxybutyryl-CoA transferase: acetyl-CoA and aldehyde / alcohol dehydrogenase etc. Thus, it is understood that any combination of two or more enzymes of the biosynthesis pathway can be introduced into a non-existent microbial organism according to

Similarly, it is understood that any combination of three or more enzymes of the biosynthesis pathway can be introduced into the non-naturally occurring microbial organism of the invention, e.g. dehydrogenase

4-hydroxybutanoate, α-ketoglutarate decarboxylase and 4-hydroxybutyryl-CoA transferase: acetyl-CoA; 4-hydroxybutanoate dehydrogenase, butyrate kinase and phosphotransbutyrylase; 4-hydroxybutanoate dehydrogenase, 4-hydroxybutyryl-CoA: acetyl-CoA transferase and aldehyde dehydrogenase; transferase

4-hydroxybutyryl-CoA: acetyl CoA, aldehyde dehydrogenase and alcohol dehydrogenase; butyrate kinase, phosphotransbutyrylase and aldehyde / alcohol dehydrogenase, etc. Similarly, any combination of four, five or more enzymes of the biosynthesis pathway as disclosed herein can be introduced into the non-naturally occurring microbial organism of the invention, if desired, as long as the combination of enzymes of the desired biosynthesis pathway leads to the corresponding desired product being produced.

[0081] Any of the non-naturally occurring microbial organisms described previously may be cultured to produce and / or isolate the biosynthetic products described herein. BDO producing organisms can be cultured for biosynthetic BDO production. BDO can be isolated or further processed to chemically synthesize the BDO family of compounds such as post-process compounds as exemplified in Figure 1.

[0082] The culture medium may be, for example, any carbohydrate source that can provide a carbon source for the non-naturally occurring microorganism. Such sources include, for example, sugars such as glucose, xylose, arabinose, galactose, mannose, fructose and starch. Other carbohydrate sources include, for example, renewable feeds and biomass. Exemplary types of biomass that can be used as feedstocks in the method of the invention include cellulose biomass, hemicellulose biomass, and lignin feed feeds or parts of feed feeds. Such biomass feeds contain, e.g., carbohydrate substrates useful as carbon sources such as glucose, xylose, arabinose, galactose, mannose, fructose and starch.

Given the indications and directions provided herein, those skilled in the art will understand that renewable feedstocks and biomass other than those exemplified above can also be used for culturing the microbial organisms of the invention for the production of 4-HB and other compounds of the invention.

[0083] Accordingly, taking into account the indications and directions provided herein, those skilled in the art will understand that a non-naturally occurring microbial organism secreting biosynthesized compounds can be produced when grown on a carbon source such as a carbohydrate. Such compounds include, e.g., 4-HB, BDO and any intermediate metabolites in the 4-HB pathway, BDO pathway and / or the combined 4-HB and BDO pathways. All that is required is to construct one or more of the enzymatic activities depicted in Figure 2 to achieve biosynthesis of the desired compound or intermediate, including, e.g., the introduction of some or all of the 4-HB and / or BDO biosynthesis pathways. Accordingly, the invention provides a non-naturally occurring microbial secreting 4-HB when grown on carbohydrate, secreting BDO when grown on carbohydrate and / or secreting any intermediate metabolites shown in Figure 2 when grown on carbohydrate. The microbial organisms producing BDO according to the invention can start synthesis e.g. from succinate, succinyl-CoA, α-ketoglutarate, succinic semialdehyde, 4-HB, 4-hydroxybutyryl phosphate, 4-hydroxybutyryl-CoA (4-HB-CoA) and / or 4-hydroxybutyraldehyde.

[0084] In some embodiments, the culture conditions include anaerobic or substantially anaerobic growth or maintenance conditions. Exemplary anaerobic conditions have been previously described and are well known in the art. Exemplary anaerobic conditions for fermentation processes are described below in the examples. Any of these conditions can be used with non-naturally occurring microbial organisms as well as other anaerobic conditions well known in the art. Under such anaerobic conditions, 45 HB and BDO producing organisms can synthesize monomeric 4-HB and

BDO, in intracellular concentrations of 5-10 mM or more, as well as in all other concentrations exemplified previously.

[0085] For BDO-producing non-naturally occurring microbial organisms of the invention, a number of post-process compounds can also be produced.

[0086] Fermentation procedures are particularly useful for biosynthetic production of commercial amounts of BDO. Generally, and as with discontinuous breeding procedures, continuous and / or nearly continuous production of BDO will involve culturing the non-naturally occurring BDO producing organism of the invention in sufficient nutrients and medium to maintain and / or nearly maintain growth in the exponential phase. Continuous breeding under such conditions may include, for example 1 day, 2, 3, 4, 5, 6 or 7 days or more. In addition, continuous breeding may include 1 week, 2, 3, 4 or 5 weeks or more and up to several months. Alternatively, the organisms of the invention may be cultured for hours, if appropriate for the particular application.

It should be understood that continuous and / or nearly continuous culture conditions may also include all time intervals in the range between these exemplary periods.

[0087] Fermentation procedures are well known in the art. Briefly, fermentation for biosynthetic production of BDO can be used, e.g., for fed-batch fermentation and periodic separation; fed batch fermentation and continuous separation or continuous fermentation and continuous separation. Examples of well-known batch and continuous fermentation procedures are then exemplified below in the examples.

[0088] In addition to the above fermentation procedures using BDO producing organisms according to the invention for the continuous production of significant amounts of BDO, BDO producing organisms can be suitably used, similarly e.g. simultaneously undergoing chemical synthesis procedures as previously described for the chemical transformation of BDO e.g. into THF, GBL, pyrrolidones and / or other compounds from the BDO family. In addition, BDO producing organism products can be separated from the fermentation culture and subsequently chemically transformed as disclosed herein.

succinate, glutamate decarboxylase transaminase, [0089] Briefly, hydrogenation of GBL in fermentation broth can be carried out as described in: Frost et al., Biotechnology Progress 18: 201-211 (2002). Another procedure for hydrogenation during fermentation includes, e.g., the methods described e.g. in US Pat. Ser. No. 5,478,952. This method is then exemplified in the examples below.

[0090] The description further provides a method for producing γ-butyrolactone (GBL), tetrahydrofuran (THF) or

1,4-butanediol (BDO). The method involves fermentation involving a non-naturally occurring microbial organism having 4-hydroxybutanoic acid (4-HB) and / or 1,4-butanediol (BDO) biosynthesis pathways, these pathways containing at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA - independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent CoA-semialdehyde dehydrogenase, 4-hydroxybutyrate transferase, glutamate: succinic semialdehyde, α-ketoglutarate, 4-hydroxybutanoate kinase decarboxylase, phosphotransbutyrylase,

CoA-independent 1,4-butanediol semialdehyde dehydrogenase, CoA-independent 1,4-butanediol semialdehyde dehydrogenase, CoA-independent 1,4-butanediol alcohol dehydrogenase, or CoA-dependent 1,4-butanediol alcohol dehydrogenase, under substantially anaerobic conditions for a sufficient period of time for the production of 1,4-butanediol (BDO), GBL or THF, the fermentation comprising fed batch fermentation and periodic separation; fed batch fermentation and continuous separation or continuous fermentation and continuous separation.

[0091] In addition to the biosynthesis of BDO and other products as described herein, the non-naturally occurring microbial organisms and methods of the invention can also be used in various combinations with each other and with other microbial organisms and by methods well known in the art to obtain a biosynthesis product by other routes.

[0092] One computational method for identifying and designing metabolic changes favoring product biosynthesis is the OptKnock, Burgard et al., Biotechnol Bioeng, 84: 647-57 (2003) computational framework. OptKnock is a metabolic modeling and simulation program suggesting gene deletion strategies leading to genetically stable microorganisms in which the target product is overproduced. Specifically, the framework checks the complete metabolic and / or biochemical network of the microorganism to suggest genetic manipulations that would force the formation of the desired biochemical as a necessary by-product of cell culture growth. By coupling biochemical production with the growth of cell culture through strategically deployed gene deletions or other disruption of gene function, increasing selection pressures on constructed strains exerted after long periods of time in the bioreactor, they lead to improvements in efficiency as a result of forced, growth-coupled biochemical production. Finally, after the construction of gene deletions, the possibility of the designed strains returning to their wild-type state is negligible, since the genes selected by OptKnock are intended for complete removal from the genome. Thus, this computational methodology can be used to identify alternative pathways leading to 4-HB and / or BDO biosynthesis or in the absence of naturally associated microbial applications with organisms to further optimize biosynthesis

4-HB and / or BDO.

[0093] In brief, OptKnock is the term used herein to refer to the computational method and computational system for modeling cell metabolism.

The OptKnock program applies to the model framework and methods introducing specific limitations to Flux Balance Analysis (FBA) models. These limitations include, e.g., qualitative kinetic information, qualitative regulatory information and / or experimental data from DNA microarrays. OptKnock also calculates solutions for various metabolic problems e.g. by tightening stream boundaries obtained through stream balance models and then checking the boundaries of metabolic network behavior in the presence of gene addition or deletion. The OptKnock computational framework enables the construction of model formulations for efficient query of metabolic network performance limits and provides methods for solving the resulting problems with partially complete linear programming. Metabolic modeling and simulation methods referred to herein as OptKnock are described, e.g., in US Patent Application Ser. Of North America No. 10 / 043,440, filed January 10, 2002 and in International Patent No. PCT / US02 / 00660, filed January 10

2002 r.

[0094] Another calculation method for identifying and designing metabolic changes that favor biosynthetic manufacturing of a product is a metabolic modeling and simulation system called

SimPheny®. This calculation method and system is described, for example, in US patent application Ser. North America

No. 10 / 173,547, filed June 14, 2002 and in International Patent Application No. PCT / US03 / 18838, filed June 13, 2003.

[0095] SimPheny® is a computational system that can be used to create an in silico network model and to simulate mass, energy or charge flux by chemical reactions of a biological system to determine a solution space including any and all possible functionalities of chemical reactions in the system, thereby specifying the range of activities allowed for the biological system. This approach is called constraints-based modeling because the solution space is determined by constraints such as the known stoichiometry of the included reactions as well as the thermodynamics of the reactions and performance restrictions associated with the maximum fluxes through the reactions. The space defined by these restrictions can be "questioned" to determine the phenotypic abilities and behavior of the biological system or its biochemical components. To determine such phenotypic abilities, methods of analysis such as convex analysis, linear programming and calculation of marginal pathways can be used, as described, for example, in:

<td>Schilling and</td><td>in., J. Theor. Biol. 203: 229-248 (2000);</td>

<td>Schilling and</td><td>in., Biotech. Bioeng. 71: 286-306 (2000) and</td>

<td>Schilling and</td><td>in., Biotech. Threshold. 15: 288-295 (1999). How</td>

<td>described in</td><td>examples below, this methodology</td>

computational was used to identify and analyze probable as well as optimal 4-HB biosynthesis pathways in 4-HB-producing microbial organisms.

[0096] As described above, one restriction method (based on constraints) used in the calculation programs suitable for use in the invention is stream balance analysis. Stream balance analysis is based on stream balancing

<td>in conditions</td><td>steady state and can be carried out</td>

<td>as described</td><td>e.g. in: Varma and Palsson, Biotech. Bioeng.</td>

<td> 12:994-998</td><td>(1994). Stream balance approaches</td>

<td>applied</td><td>to the reaction network for simulation or</td>

predicting system properties, e.g., adipocyte metabolism, as described in Fell and Small, J. Biochem. 138: 781-786 (1986), acetate evolution from E. coli under ATP maximization conditions as described in Majewski and

Homes, Biotech. Bioeng. 35: 732-738 (1990) or the secretion of ethanol by yeast as described in:

Vanrolleghem et al., Biotech. Threshold. 12: 434-448 (1996).

In addition, this approach can be used to predict or simulate E. coli growth on a variety of unique carbon sources as well as the metabolism of H. influenzae as described in Edwards and Palsson, Proc. Natl. Acad. Sci. 97: 5528-5533 (2000), Edwards and Palsson, J. Bio. Chem. 274: 17410-17416 (1999) and Edwards et al., Nature Biotech.

19:125-130 (2001).

[0097] Once the solution space has been determined, it can be analyzed to determine possible solutions under various conditions. This computational approach is compatible with biological realities because biological systems are flexible and can achieve the same result in many different ways. Biological systems are designed by evolutionary mechanisms limited by fundamental constraints that all living systems must face. Thus, the restrictive modeling strategy covers these general realities. Then, the ability to continuously impose consecutive constraints on the network model by tightening constraints leads to a reduction in the space of solutions, thereby increasing the accuracy with which physiological performance or phenotype can be predicted.

[0098] Given the indications and guidelines provided herein, those skilled in the art will be able to use various computational frameworks for metabolic modeling and simulation to design and implement biosynthesis of 4-HB, BDO, GBL, THF and other compounds with

<td>BDO family</td><td>host microbial organisms</td>

<td>other than E.</td><td>Cola and yeast. Such modeling methods</td>

<td>metabolic</td><td>and simulation include, e.g., systems</td>

calculations exemplified above as SimPheny® and OptKnock. For illustration of the invention, certain methods are described herein with reference to the framework

<td>computing</td><td>OptKnock for modeling and simulation.</td>

<td>specialists</td><td>in the field will know how</td>

<td>using the</td><td>OptKnock apply identification,</td>

<td>projects</td><td>and implementing metabolic changes to</td>

any of such other metabolic modeling and computational simulation frameworks and methods well known in the art.

[0099] The ability of a cell or organism to biosynthetically produce a biochemical product can be illustrated in the context of the biochemical production limits of a typical metabolic network calculated using an in silico model. These limits are obtained by setting the absorbing rate (s) of the limiting substrate (s) to its experimentally measured value (s) and calculating the maximum and minimum biochemical production rate at each achievable level of growth.

[0100] The production of the desired biochemical substance generally occurs in direct competition with the production of biomass for intracellular resources. Under these circumstances, increased biochemical production volumes will necessarily result in submaximal growth rates. The Nokauty suggested by the above metabolic modeling and simulation programs, such as OptKnock, are designed to limit acceptable solution limits, forcing a change in metabolic behavior from wild-type strains.

Although the actual solution boundaries for a given strain will expand or contract with increasing or decreasing substrate uptake rates, each test point will lie within its calculated solution limit. Graphs such as these allow you to accurately predict how closely designed strains are within their performance limits, which also indicates how much space is available for improvement.

[0101] The OptKnock mathematical framework is presented here, for example, to determine with maximum accuracy the gene deletions leading to product biosynthesis, in particular coupled with the increase in product biosynthesis. The procedure is based on restrictive metabolic modeling narrowing the range of possible phenotypes that the cellular system can demonstrate by further imposing decisive physicochemical constraints: Price et al., Nat Rev Microbiol, 2: 886-97 (2004). As described above, restrictive models and simulations are well known in the art and generally refer to the optimization of a particular cellular target subject to stoichiometry of the network, to suggest probable distribution of streams.

In brief, maximizing the cellular target quantified as the cumulative reaction stream for a steady state metabolic network comprising the set N = {1, ..., N} metabolites and the set M = {1, ..., M} of the reaction metabolic, it is expressed mathematically as follows:

maximize cellular vcel

M submit Σ i = ^{0 Vi e N.} i = 1 ^Vsubstratum ^{= V}uptake of substrate mmol / gDW^.h.

Vi e {limiting substrate (limiting substrates)} ^Vatp - ^V atp_utrzymanie ^mmol /^gD^{W, g}ODZ.

Vj - 0, Vj e {irrelevant reactions} when Sij is the stoichiometric coefficient of the metabolite and in the reaction j, Vj is the reaction stream j,

Substrate pickup MEANS the assumed or measured rate (s) of limiting substrate (limiting substrates) uptake and Vatp_utration MEANS the non-incremental requirement for ATP suppression. The V vector includes both internal and external streams. In this study, it is often assumed that the cellular target is a channel for biosynthetic precursors present in the proportions required for biomass production, Neidhardt, FC et al., Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd edition,

1996, Washington, DC: ASM Press. Volume 2 (xx, 2822,

1xxvi). Data for streams are generally presented as 1 gDW^.h. (gram dry weight times per hour) so that biomass production is expressed as g produced biomass / gDW ^ hour or 1 / hour.

[0103] In modeling gene deletions, elimination of reactions, the use of binary variables for a restrictive approach is used, Burgard et al.,

Bioeng, 74: 364-375 (2001), Burgard et al.,

Prog, 17: 791-797 (2001). These binary variables and therefore the framework first

Biotechnol

Biotechnol

1 if reaction stream 0, if reaction stream ν is active ν is not active

Vj e M assuming the value 1 if the reaction j is active and the value 0 if it is inactive. The following restriction v ·^s · Use^, V e M ensures that the reaction stream vj is set to zero only if the variable yj is zero. Alternatively, when yj is one, vj can take any value between the lower limit v^min and upper v^max . Here, v "" and | | is identified appropriately by minimizing and maximizing each reaction stream subject to the network restrictions described above, Mahadevan et al.,

Metab Eng, 5: 264-76 (2003).

[0104] Optimal gene / reaction knockouts are identified by solving the problem of optimization at two levels, where the set of active reactions (yj = 1) is selected so that the solution for optimal growth for the resulting network leads to the overproduction of the chemical of interest. Mathematically, optimization on two levels is expressed as the following partially total optimization problem on the subject of this problem on two levels:

maximize 'chemical (OptKnock) subject to ν

^smaximize biomass

Σ ^S, = 0 j = 1 substrate ^V uptake. su bstratu^VaTP ^{- V}atp_ maintained

Vi e N.

Vi e {limiting substrate (s)} biomass' biomass - 'target, y, £' y, V e ^M

Σ (1-) = ^K , eM forward yj e {0,1}, V, eM where 'chemical' means the production of the desired target product, e.g. succinate or other biochemical product, and K is the number of allowed knockouts. It should be noted that setting K to zero restores the solution for maximum biomass of the entire network, while setting K for one identifies a single knockout of the gene / reaction (yj = 0) so that the resulting network covers maximum overproduction taking into account its maximum biomass efficiency. The final constraint ensures that the resulting network meets the minimum biomass performance requirement. Burgard et al., Biotechnol Bioeng, 84: 647-57 (2003), provide a more detailed description of the model formulation and solution procedure. Problems involving hundreds of binary variables can be solved in a few minutes to several hours using CPLEX8.0,

GAMS: Solver Manuals. 2003: GAMS Development

Corporation, accessed by GAMS, Brooke et al., GAMS Development Corporation (1998), modeling environment on the IBM RS6000-270 workstation. Framework OptKnock has already been able to identify promising gene deletion strategies for biochemical overproduction, Burgard et al., Biotechnol Bioeng, 84: 647-57 (2003), Pharkya et al., Biotechnol Bioeng, 84: 887-899 (2003) and sets a systematic framework that will naturally include future improvements in metabolic and regulatory modeling frameworks.

[0105] Any solution to the above-described OptKnock problem at two levels will give one set of metabolic reactions to the disorder. Elimination of any reaction within the set or metabolic modification can lead to 4-HB or BDO as a necessary product in the body's growth phase. Because the reactions are known, solving the OptKnock problem at two levels will also provide knowledge of the associated gene or related genes encoding one or more enzymes that catalyze each reaction in the reaction set.

Identifying the set of reactions and their respective genes coding for the enzymes involved in each reaction is generally an automated process by correlating the reaction with a reaction database that has information about the relationships between enzymes and coding genes.

[0106] Once identified, the set of reactions to be disturbed to obtain 4-HB or BDO production is carried out in the target cell or target organism by functional disruption of at least one gene encoding each metabolic reaction in the set. One particularly useful means to obtain functional interference in a set of reactions is the deletion of each coding gene. However, in some cases, it may be beneficial to interfere with other genetic aberrations including, e.g.

mutation, deletion of regulatory regions such as promoters or cis binding sites for regulatory factors, or a shortening of the coding sequence at any of Z many sites. The latter aberrations, leading to less than a total deletion of the gene set, can be useful, e.g. when rapid succinate conjugation assessments are desired or when there is less likelihood of genetic reversions.

[0107] To identify additional productive solutions to the above-described OptKnock problem at two levels that lead to understanding of further reaction syndromes to metabolic disorders or modifications that can lead to biosynthesis, including 4-HB biosynthesis or other biochemical product, implement you can use the optimization method called integer cuts. This method iteratively solves the OptKnock problem exemplified above by introducing an additional constraint, called an integer cut, at each iteration. The limitations of integer cuts effectively prevent the selection procedure from choosing exactly the same set of reactions that was identified in any previous iteration that necessarily couples product biosynthesis with growth. For example, if a previously identified growth-linked metabolic modification determines reactions 1, 2 and 3 to disrupt, then the following limitation prevents the same reactions from being considered in later solutions simultaneously: yi + y2 + y3&gt; 1. The method of integer cuts is well known in field and its description can be found, for example, in the reference: Burgard et al., Biotechnol Prog, 17: 791-797 (2001). As with all methods described here in relation to their use in conjunction with the OptKnock computational framework for metabolic modeling and simulation, the method of integer cuts for reducing redundancy in iterative computational analysis can also be used with other computational frameworks well known in the art including e.g. SimPheny® .

[0108] The limitations in the above form make it impossible to identify larger reaction assemblies including previously identified assemblies. For example, using the above method of integer cutting optimization in the next iteration would prevent the identification of a set of four reactions including designated reactions 1, 2 and 3 for interference, since these reactions were previously identified. In order to ensure identification of all possible reaction groups leading to biosynthetic production of the product, modification of the integer cutting method can be used.

[0109] Briefly, the modified integer cuts procedure begins with a "zero" iteration that calculates the maximum production of the desired biochemical with optimal growth for wild-type networks. This calculation corresponds to the OptKnock solution, where K is equal to 0. Then, individual knockouts are considered and two sets of parameters, objstoreiter and ystoreiter, j are introduced, in order to remember the target function (vs chemical substance) and information on switching the reaction on and off (yj) respectively, at each iteration, iter. Then the following restrictions are added sequentially to the OptKnock formulation for each iteration.

chemical _ chemical&gt; volume ^ 8 + M_Gystoreter, j = 0 j [0110] In the above equation, 8 and M represent small and large numbers, respectively. Generally, 8 can be set to about 0.01 and M can be set to about 1000.

However, smaller and / or larger numbers than these numbers can also be used. M ensures that this restriction can only be binding on previously identified knockout strategies, while ε adding knockouts to ensures that the previously identified strategy must lead to an increase of at least ε in biochemical production with optimal growth. Whenever single-deletion strategies fail to improve the wild-type strain, the approach switches to double deletions.

Triple deletions are then considered when none of the double-deletion strategies improves the wild-type strain, etc. The final result is a ranking list presented as the production of the desired biochemical substance with optimal growth for different deletion strategies differing by at least one knockout. This optimization procedure as well as the identification of a wide range of different reaction syndromes that, when disturbed, lead to biosynthesis, including production-linked biochemical product. Given the indications and guidelines provided herein, those skilled in the art will understand that the examples of metabolic engineering methods and projects exemplified herein are equally suitable for identifying new biosynthetic pathways and / or the necessary coupling of cell growth or microbial growth with any biochemical product.

[0111] The methods exemplified above and then illustrated in the examples below allow the construction of cells and organisms that conduct biosynthetic production; this includes the necessary coupling of the production of the target biochemical product With the growth of the cell or organism constructed to carry Identified Genetic Changes. In this regard, metabolic changes leading to 4-HB and 1,4-butanediol biosynthesis have been identified. Strains of microbes constructed with identified metabolic changes produce 4-HB or BDO at increased levels compared to unmodified microbial organisms. These strains can advantageously be used for commercial production of 4-HB, BDO, THF and GBL, e.g. in a continuous fermentation process without subjecting to negative selection pressures.

[0112] Thus, the calculation methods described herein allow the identification and implementation of metabolic modifications Identified by an in silico method selected from OptKnock or SimPheny. The set of metabolic modifications may include, for example, addition

100 one or more enzymes in the biosynthesis pathway and / or functional disruption of one or more metabolic reactions including, e.g., disruption by gene deletion.

[0113] It is understood that modifications that do not significantly affect the activity of various embodiments of the invention are also included within the definition of the invention given herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.

Example 1

Biosynthesis of 4-hydroxybutanoic acid [0114] This example describes biochemical pathways for the production of 4-HB.

[0115] Previous reports on 4-HB synthesis in microorganisms have focused on this compound as an intermediate in the production of biodegradable plastic polyhydroxyalkanoate (PHA) (US Patent No. 6,117,658). The use of 4-HB / 3-HB copolymers instead of the polymer, poly-3-hydroxybutyrate (PHB), can lead to less brittle plastic (Saito and Doi, Intl.

J. Biol. Macromol. 16: 99-104 (1994)). The production of monomeric 4-HB described here is a fundamentally different process for several reasons: (1) the product undergoes

101 secretion, in contrast to PHA, which is produced intracellularly and remains in the cell; (2) in the case of organisms producing hydroxybutanoate polymers, no free 4-HB is produced, but rather a coenzyme A derivative is used by polyhydroxyalkanoate synthase; (3) in the case of a polymer, the formation of a granular product changes the thermodynamics; and (4) extracellular pH is not a problem for polymer production, but will affect whether 4-HB will be in the free acid or conjugate base, as well as the balance between 4-HB and GBL.

[0116] 4-HB can be produced in two stages of enzymatic reduction from succinate, the central metabolite of the TCA cycle, with succinic semialdehyde as an intermediate (Figure 2). The first of these enzymes, succinic semialdehyde dehydrogenase, is native to many organisms including E. coli in which both NADH- and NADPH-dependent enzymes have been found (Donnelly and Cooper, Eur. J.

Biochem.

113:555-561

1981); Donnelly and Cooper, J. Bacteriol. 145: 1425-1427

1981); Marek and Henson, J.

1988)

There are also

Bacteriol. 170: 991-994 evidence of succinic semialdehyde dehydrogenase activity in S.

cerevisiae (Ramos et al.,

Eur. J. Biochem. 149: 401-404

102 (1985)) and sequence homology identified by the putative gene. Nevertheless, most reports indicate that this enzyme works towards the synthesis of bursinate as shown in Figure 2 (Donnelly and Cooper, supra; Lutke-Eversloh and

Steinbuchel, FEMS Microbiol. Lett. 181: 63-71 (1999)), taking part in the 4-HB and gammaaminobuty degrading pathway. Amber semialdehyde is also made natively by microorganisms such as E.

certain coli organisms via α15 ketoglutarate, an intermediate in the TCA cycle, by the action of two enzymes: glutamate transaminase: succinic semialdehyde and glutamate decarboxylase. An alternative pathway, used by the absolute anaerobic Clostridium kluyveri to degrade succinate, activates succinate to succinyl-CoA, and then converts succinyl-CoA to succinic semialdehyde using an alternative succinic semialdehyde dehydrogenase, which is known to act in this direction (Sohling and

Gottschalk, Eur. J. Biochem. 212: 121-127 (1993)). However, this route is at the expense of ATP energy, which is required to convert succinate to succinyl-CoA.

103 [0117] Second pathway enzyme, dehydrogenase

4-hydroxybutanoate, is not native to E. coli or yeast, but is present in various bacteria such as C. kluyveri and Ralstonia eutropha (Lutke-Eversloh and

Steinbuchel, above; Sohling and Gottschalk, J. Bacteriol. 178: 871-880 (1996); Valentin et al., Eur. J. Biochem. 227: 43-60 (1995); Wolff and Kenealy, Protein

Expr. Purif. 6: 206-212 (1995)). It is known that these enzymes are NADH dependent, although NADPH dependent forms are also present. An additional 4-HB pathway from alpha-ketoglutarate was demonstrated in E. coli; it leads to the accumulation of poly (4-hydroxybutyric acid) (Song et al.,

Wei Sheng Wu Xue.Bao. 45: 382-386 (2005)). The recombinant strain required overexpression of three heterologous genes, PHA synthase (R. eutropha), 4-hydroxybutyrate dehydrogenase (R. eutropha) and 4-hydroxybutyrate CoA-transferase (C. kluyveri), along with two native E. coli genes: glutamate semamindehyde transaminase: and glutamate decarboxylase. Steps 4 and 5 in Fig. 2 can alternatively be carried out using alpha-ketoglutarate decarboxylase such as that identified in Euglena gracilis (Shigeoka et al., Biochem. J. 282 (part 2): 319-323 (1992); Shigeoka and Nakano, Arch.

Biochem. Biophys. 288: 22-28 (1991); Shigeoka and Nakano,

104

Biochem J. 292 (part 2): 463-467 (1993)). However, this enzyme has not previously been used to affect the production of 4-HB or related polymers in any body.

[0118] Reported directivity of succinic semialdehyde dehydrogenase led to the study of thermodynamics of 4-HB metabolism. Specifically, this study examined whether the reactions involved in converting succinate or succinyl-CoA to 4-HB are favorable from a thermodynamic point of view (i.e. AG_r &lt;0) under typical physiological conditions found in E. coli and S. cerevisiae or not. All oxidation / reduction reactions were assumed to use NADH, although results for assuming NADPH use would be similar. For each compound in the succinate and succinyl-CoA pathways shown in Figure 2, standard Gibbs free energies for formation (AGf °) were calculated based on the group participation method (Mavrovouniotis, ML, J. Biol. Chem. 266: 14440-14445 (1991 )). Each standard Gibbs energy for formation was then transformed to produce a criterion for spontaneous change at a particular pressure, temperature, pH and ionic strength (Alberta, RA, Biochem. Biophys. Acta 1207: 1-11 (1994)) (equation 1).

105

<img file="PL2137315T3_D0001.tif" />

[0119] Where AGf ° is the standard Gibbs energy of formation, N_H means the number of hydrogen atoms in the compound, R means the universal gas constant, T is constant and is 298 K, z means the charge of the molecule at pH of interest, I means the ionic strength in M ​​and B means a constant equal to 1.6 l^0,5/moth^0,5.

[0120] Equation 1 reveals that both intracellular pH and ionic strength are important in determining thermodynamic feasibility. Normally, the intracellular pH of the cells is very well regulated, even when there are large changes in the pH of the culture. Information on intracellular pH of both E.

Cola and

S. cerevisiae appeared in the literature. Under typical growth conditions, in neutral buffers, E. coli maintains an intracellular pH of 7.4-7.7, but it may drop to 7.2 at pH 6 of the medium and even 6.9 at an external pH of 5 (Riondet

Biotechnology Tech. 11: 735-738 (1997)).

the growth of E. coli is strongly inhibited at an external pH below 6. The value of yeast pH shows greater variation. In the exponential growth phase, the measured internal pH of S. cerevisiae was in the range 6.7-7.0 at external controlled pH et al.,

However,

106 of 5.0 (Dombek and Ingram, Appl. Environ.

Microbiol. 53: 1286-1291 (1987)). On the other hand, in cells at rest, the internal pH drops to below 6 when the external pH 5 is 6 or less (Imai and Ohno, J. Biotechnol. 38: 165172 (1995)). This analysis assumes an intracellular pH of 7.4 for E. coli and 6.8 for S. cerevisiae. An ionic strength of 0.15 was also assumed (Valenti et al., Supra).

[0121] The transformed Gibbs energies of formation were calculated at the standard state (pH = 7.0, I = 0) and at physiological states of E. coli (pH = 7.4, I =

0.15) and S. cerevisiae (pH = 6.8, I = 0.15). Then the transformed Gibbs reaction energies were calculated (AG_r') taking the difference in AGf' between products and reactants. The transformed reaction Gibbs energies required to convert succinate or succinyl-CoA into 4-HB are given in Table 2. Although positive delta G values ​​have been calculated for some of the steps, the standard errors for these calculations and concentration gradients indicate that each of these steps is feasible. Note that the standard error, U_whopping, for AGf calculated using group theory, it is 4 kcal / mol. Uncertainty at AG_r, U_r,_est

107 can be calculated as the Euclidean norm for uncertainty for

AGf of each relationship (equation).

<img file="PL2137315T3_D0002.tif" />

[0122] Where n is the stoichiometric coefficient and i is the compound. For the reactions tested, this uncertainty is on the order of 8 kcal / mol.

Table 2. Gibbs free energy of the reaction (kcal / mole) at different pH values ​​and ionic strength (IS). The first column is for standard conditions, while the others are for conditions regulated according to equation 1. The temperature is constant and is 298

K. Error bars for these values ​​are on the order of 8 kcal / mol, as calculated by equation 2. Abbreviations: suc, succinate; sucsa, amber semialdehyde; succoa, succinyl-CoA; Pi, inorganic phosphate.

<td>Reaction</td><td>AG_r°'</td><td>AG_r'</td><td>AG_r'</td>

<td></td><td>pH = 7.0</td><td>pH = 7.4</td><td>pH = 6.8</td>

<td></td><td>IS = 0</td><td>IS = 0.15 M</td><td>IS = 0.15</td>

<td></td><td></td><td></td><td>M</td>

<td>succ + NADH + 2H +</td><td> 12,0</td><td> 14,4</td><td> 12,8</td>

<td>sucsa + NAD + H? O</td><td></td><td></td><td></td>

108

<td>succ + CoA + ATP succoa + ADP + Pi</td><td> 0,30</td><td> -0,03</td><td> -0,03</td>

<td>succoa + NADH + H +</td><td> 4,4</td><td> 7,0</td><td> 6,2</td>

<td>sucsa + NAD + CoA</td><td></td><td></td><td></td>

<td>sucsa + NADH + H +</td><td> -5,0</td><td> -3,8</td><td> -4,6</td>

<td>4-HB + ABOVE</td><td></td><td></td><td></td>

[0123] The data in Table 2 reveal that, after considering the potential uncertainty in the calculations of the inventors, the reaction that is likely to encounter the thermodynamic barrier will be the succinic semialdehyde dehydrogenase reaction (step 1 in Fig. 2). It was also examined whether this reaction could be brought closer to thermodynamic feasibility by changing the assumed concentrations of metabolites involved in it. For example, standard Gibbs energies assume concentrations of 1 M for all compounds involved (except water). In an anaerobic environment, NADH will be present in concentrations several times higher than NAD.

Assuming that [NADH] = 5 x [NAD], the inventors calculated the effect on AG_r'using the equation

Π and productJ

AG '_f =. \ G⁰ + RT ln,¹¹^ -1-i (3) l reaction extract

109 [0124] This changes the results by a difference of about kcal / mol in delta G values ​​for succinic semialdehyde dehydrogenase. Equation 3 was also used to calculate other effects on AG_r, such as a high concentration of succinate to drive the reaction.

A thousand-fold difference in succinate and succinic semialdehyde concentrations will add about 5 kcal / mol to delta G. This, assuming uncertainty of 8 kcal / mol, cannot exclude the possibility that under a certain set of physiological conditions succinic semialdehyde dehydrogenase will work towards amber semialdehyde. Thus, the direct route from succinate to 4-HB remains to be considered in subsequent analysis.

[0125] The ability of microorganisms to produce 4-hydroxybutyrate was tested in two microorganisms, Escherichia coli and Saccharomyces cerevisiae, using in silico metabolic models for each organism. Potential pathways leading to 4-HB occurred via the intermediate succinate, succinyl-CoA or alpha-ketoglutarate, as shown in Figure 2.

[0126] The first step in the 4-HB production route from succinate involves the conversion of succinate to succinic semialdehyde via NADH- or NADPH-dependent succinic semialdehyde dehydrogenase. In E. coli,

110 gabD is NADP-dependent succinic semialdehyde dehydrogenase and is part of a cluster of genes involved in the uptake and degradation of 4-aminobutyrate (Niegemann et al., Arch. Microbiol. 160: 454-460 (1993);

Schneider et al., J. Bacteriol. 184: 6976-6986 (2002)).

It is assumed that the orchard encodes the enzyme for the NAD-dependent activity of succinic semialdehyde dehydrogenase (Marek and Henson, supra). S. cerevisiae only contains NADPH-dependent succinic semialdehyde dehydrogenase, presumably attributed to the UGA2 gene, located in the cytosol (Huh et al., Nature 425: 686-691 (2003)).

Calculations of maximum yield assuming the existence of the succinate pathway leading to 4-HB in both E. coli and S. cerevisiae only require the assumption that non-native 4-HB dehydrogenase has been added to their metabolic networks.

[0127] The trail leading from succinyl-CoA to

4-hydroxybutyrate is disclosed in US Pat. Ser. No. 6,117,658 as part of a process for producing polyhydroxyalkanoates comprising monomeric units of 4-hydroxybutyrate. Clostridium kluyveri is one exemplary organism known to possess CoA-dependent succinic semialdehyde dehydrogenase activity (Sohling and Gottschalk, above; Sohling and Gottschalk, above). IN

111 this study assumes that this enzyme from C. kluyveri or another organism is expressed in E. coli or S. cerevisiae together with non-native or heterologous 4-HB dehydrogenase to complete the pathway from succinyl-CoA to 4-HB. It has been shown that in E.

coli, the pathway leading from alpha-ketoglutarate to 4-HB results in the accumulation of poly (4-hydroxybutyric acid) to a level of 30% of the dry matter of the cell (Song et al., above).

As E. coli and S.

cerevisiae endogenously possess glutamate: native semialdehyde or transaminase as well as both amber glutamate decarboxylase (Coleman et al., J. Biol.

Chem. 276: 244-250 (2001)), the pathway leading from AKG to 4HB can be completed in both organisms only assuming that there is non-native 4-HB dehydrogenase.

Example II

Preparation of 4-hydroxybutanoic acid in E. coli [0128] This example describes the biosynthesis efficiency of 4-hydroxybutanoic acid obtained from each biochemical pathway.

[0129] In this section, the maximum theoretical yields of 4-HB from glucose are calculated assuming that each of the three metabolic pathways shown in Figure 2 functions in E. coli. The scale metabolic E. coli model was used as the basis for analysis

112 genome, similar to that described in Reed et al., Genom Biol. 4: R54 (2003). The energy gain, in the sense of the ATP molecules produced, of each pathway with maximum efficiency is calculated assuming anaerobic conditions, unless stated otherwise. It is assumed that 4-hydroxybutyrate leaves E. coli via a proton symport, as is the case with most organic acids. It is also possible that GBL is secreted by simple diffusion and in this case energy conversions would be more favorable than in the case considered here. The influence of cofactor specificity (i.e. dependence on NADH or NADPH) involved in enzyme reaction on maximum efficiency and energy metabolism of each pathway was also investigated.

[0130] The results of the analysis are shown in Tables 3 AC. From an energy and efficiency point of view, the most promising route is from succinate to 4-HB. Specifically, calculations reveal that the maximum theoretical yield of 4-HB from glucose is 1.33 mol / mol (0.77 g / g; 0.89 Cmol / Cmol) assuming the functioning of the pathway from succinate to 4-HB. In addition, anaerobic production of 4-HB via succinate would result in net production of 1.8, 1.5 or 1.1 moles ATP per glucose, depending on the assumed specificity of the cofactors of the enzymes involved in the reaction. These energy efficiency

113 they are comparable to 2.0 ATP per glucose, which can be obtained by phosphorylation at the substrate level in the production of ethanol or lactate, suggesting the potential for anaerobic production of homo-4-HB in E. coli.

[0131] The path through succinyl-CoA to 4-HB is another promising path when considering maximum efficiency and energy metabolism. A yield of 1.33 mol / mol 4-HB can be obtained in E. coli assuming that at least one of the stages of the pathway is dependent on NADH. Nevertheless, since this pathway requires the formation of succinyl-CoA, its energy efficiency is lower than the energy efficiency of the succinate pathway. At high 4-HB yield, oxygen demand is expected if it is assumed that both CoA-dependent succinic semhydehyde dehydrogenase and 4-HB dehydrogenase stages will be NADPH-dependent. In this case, the production of 4-HB in maximum yield would not lead to a net ATP profit and possibly would not meet the energy requirements for maintaining necessary for E. coli survival. Thus, to enable homofermentative 4-HB production, some energy would have to come from oxidative phosphorylation. At a maximum achievable yield of 1.0 mole 4-HB per mole glucose, the alpha-ketoglutarate pathway utilizing

114 glutamate transaminase: succinic semialdehyde and glutamate decarboxylase to form 4-HB is the least preferred of the three potential pathways.

In addition to lower maximum efficiency, this pathway requires 1.5 moles of oxygen per mole of 4-HB-converted glucose. The energy metabolism of this pathway is not affected by the assumed specificity of 4-HB dehydrogenase cofactors.

115

Table 3. Total stoichiometry for converting the substrate to 4-HB assuming production pathways

A) succinate, B) succinyl-CoA or C) alpha-ketoglutarate function in E. coli. Glucose and oxygen are taken while all other molecules are produced.

<td colspan="6">A) The succinate route</td>

<td>Specificity</td><td></td><td>2 stages with</td><td>1st stage from</td><td>2 stages with</td><td></td>

<td>cofactors</td><td></td><td>NADH</td><td>NADH</td><td>NADPH</td><td></td>

<td></td><td></td><td></td><td>1st stage from</td><td></td><td></td>

<td></td><td></td><td></td><td>NADPH</td><td></td><td></td>

<td>Glucose</td><td colspan="2"> -1,000</td><td> -1,000</td><td> -1,000</td><td></td>

<td>Oxygen</td><td colspan="2"> 0,000</td><td> 0,000</td><td> 0,000</td><td></td>

<td>protons</td><td colspan="2"> 1,333</td><td> 1,333</td><td> 1,333</td><td></td>

<td>4-HB</td><td colspan="2"> 1,333</td><td> 1,333</td><td> 1,333</td><td></td>

<td>CO2</td><td colspan="2"> 0,667</td><td> 0,667</td><td> 0,667</td><td></td>

<td>H2O</td><td colspan="2"> 0,667</td><td> 0,667</td><td> 0,667</td><td></td>

<td>ATP</td><td colspan="2"> 1,800</td><td> 1,510</td><td> 1,097</td><td></td>

<td colspan="6">B) Succinyl-CoA route</td>

<td>Specificity</td><td></td><td>2 stages with</td><td>1st stage from</td><td>2 stages with</td><td>2 stages</td>

<td>cofactors</td><td></td><td>NADH</td><td>NADH</td><td>NADPH</td><td>from NADPH</td>

<td></td><td></td><td></td><td>1st stage from</td><td></td><td></td>

<td></td><td></td><td></td><td>NADPH</td><td></td><td></td>

<td colspan="2">Glucose</td><td> -1,000</td><td> -1,000</td><td> -1,000</td><td> -1,000</td>

<td colspan="2">Oxygen</td><td> 0,000</td><td> 0,000</td><td> -0,036</td><td> 0,000</td>

116

<td>protons</td><td> 1,333</td><td> 1,333</td><td> 1,325</td><td> 1,294</td>

<td>4-HB</td><td> 1,333</td><td> 1,333</td><td> 1,325</td><td> 1,294</td>

<td>CO2</td><td> 0,667</td><td> 0,667</td><td> 0,698</td><td> 0,082</td>

<td>h₂about</td><td> 0,667</td><td> 0,667</td><td> 0,698</td><td> 0,470</td>

<td>ATP</td><td> 0,467</td><td> 0,177</td><td> 0,000</td><td> 0,000</td>

<td>C) Alpha pathway</td><td colspan="2">ketoglutaranowy</td><td></td><td></td>

<td>Specificity</td><td>1st stage from</td><td>1st stage from</td><td></td><td></td>

<td>cofactors</td><td>NADH</td><td>NADPH</td><td></td><td></td>

<td>Glucose</td><td> -1,000</td><td> -1,000</td><td></td><td></td>

<td>Oxygen</td><td> -1,500</td><td> -1,500</td><td></td><td></td>

<td>protons</td><td> 1,000</td><td> 1,000</td><td></td><td></td>

<td>4-HB</td><td> 1,000</td><td> 1,000</td><td></td><td></td>

<td>CO2</td><td> 2,000</td><td> 2,000</td><td></td><td></td>

<td>H2O</td><td> 2,000</td><td> 2,000</td><td></td><td></td>

<td>ATP</td><td> 5,500</td><td> 5,500</td><td></td><td></td>

[0132] To confirm the computational forecasts proposed in this report, strains expressing the full pathway leading to 4-HB can be constructed and tested. Confirmation is carried out using both E. coli (examples II and IV) and

S. cerevisiae (example III). In E. coli, the relevant genes are expressed in a synthetic operon behind an inducible promoter on a plasmid giving medium or high copy number; e.g. an induced PBAD promoter

117 by arabinose on a plasmid from the pBAD series (Guzman et al., J. Bacteriol. 177: 4121-4130 (1995)). In S. cerevisiae, genes are incorporated into the chromosome downstream of the PDC1 promoter, replacing the native pyruvate carboxylase gene. It has been reported that this leads to greater expression of foreign genes than from the plasmid (Ishida et al.,

Appl. Environ. Microbiol. 71: 1964-1970

2005) will also ensure expression under anaerobic conditions.

[0133] Cells containing the appropriate constructs are grown in minimal media containing glucose, with the addition of arabinose for E. bacteria.

coli containing genes expressed under the control of the PBAD promoter. Samples are taken from time to time for both gene expression and enzymatic activity analysis. Assays for enzymatic activity are carried out on crude cell extracts using procedures well known in the art. Alternatively, tests based on NAD (P) H oxidation produced in all reaction stages involving dehydrogenase and detectable by spectrophotometry can be used. In addition, antibodies can be used to detect the level of individual enzymes.

Instead of or in addition to measurements of enzymatic activity, RNA can be isolated from parallel samples and by reverse transcription linked to a chain reaction

118 polymerases to measure the transcription level of the gene of interest. Any constructs lacking detectable transcript expression are re-analyzed to ensure that the coding nucleic acids are maintained in the expressed form. Where transcripts are detected, this result indicates either no translation or inactive enzyme production. A variety of methods well known in the art can be used, such as codon optimization, construction of a highly ribosome binding site, use of a different species gene, and prevention of glycosylation (for expression of bacterial enzymes in yeast) by converting Asn residues into Asp. After detecting all required enzymatic activities, the next step is to measure 4-HP production in vivo. Shake flask cultures are grown under anaerobic or microaerobic conditions (in triplicate), depending on the conditions required (see above), and samples are taken from time to time. Organic acids present in culture supernatants are analyzed by HPLC using an Aminex AH87X column. The 4-HB elution time is determined using a standard purchased from a chemical supplier.

119 [0134] For confirmation, the CoA-independent pathway can be implemented and tested. In this case, the overexpressed genes are native succinic semialdehyde dehydrogenase genes from each organism and the 4-hydroxybutanoate dehydrogenase gene

Ralstonia eutropha. After detecting the activity of both enzymes, as discussed above, the strains are tested for the presence of 4-HB production. Confirmation can also be obtained from the implementation of the CoA-dependent route. CoA-dependent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase from Clostridium kluyveri are expressed as described above. In addition, native succinyl-CoA synthetase can also be overexpressed to direct more succinate into the heterologous pathway. Finally, if 4-HB production is unfavorable, various culture conditions, such as a change in oxidation state, that can manipulate the ratio can be checked

NAD (P) H / NAD (P).

Example III

Preparation of 4-hydroxybutanoic acid in yeast [0135] This example describes the yields of 4-hydroxybutanoic acid biosynthesis obtained from each biochemical pathway in S. cerevisiae.

120 [0136] In this section, the maximum theoretical yields of 4-HB from glucose are calculated assuming that each of the three metabolic pathways shown in Figure 2 functions in S. cerevisiae. As a basis for analysis, a metabolic model of S. cerevisiae was used on a genome scale, similar to that described in Forster et al.

Genome Res. 13: 244-253 (2003). The energy gain of each route with maximum efficiency is calculated assuming anaerobic conditions, unless otherwise stated. It is assumed that 4-hydroxybutyrate leaves S. cerevisiae via a proton symport, as is the case with most organic acids. The influence of cofactor specificity (i.e. dependence on NADH or NADPH) involved in enzyme reaction on maximum efficiency and energy metabolism of each pathway was also investigated.

[0137] The results of the analysis are shown in tables 4

AC. As with E. coli, the pathway leading from succinate to 4-HB is most promising provided that the thermodynamic problems mentioned in Example 1 can be overcome. Calculations reveal that the maximum theoretical yield of 4-HB from glucose in S. cerevisiae is 1 , 33 mol / mol (0.77 g / g; 0.89 Cmol / Cmol). In addition, the anaerobic production of 4-HB by succinate would lead to a net production of either 1.4, 1.1, or 0.5 mole ATP per glucose

121 depending on the assumed specificity of the cofactors of the enzymes involved in the reaction.

[0138] The path through succinyl-CoA to 4-HB is the second most preferred pathway. A maximum yield of 1.33 mol 4-HB / mol glucose is achievable in S. cerevisiae regardless of the cofactor specificity. Nevertheless, net energy generation at maximum theoretical efficiency is only possible if it is assumed that both the steps involving CoA-dependent succinic semialdehyde dehydrogenase and 4-HB dehydrogenase will be NADHz dependent. If any of the steps is NADPH-dependent, no net ATP will be obtained from anaerobic 4-HB production and an alternative energy source (e.g., oxidative phosphorylation) would be required to sustain cell growth and maintenance. The 4-HB alpha-ketoglutarate pathway is the least preferred of the three potential pathways in S. cerevisiae, although the maximum yield of 1.1-1.2 moles of 4-HB per mole of glucose is slightly higher than found in E. coli. Nevertheless, this pathway requires 0.8-0.9 moles of oxygen uptake per mole of glucose to become energy neutral.

122

Table 4. Total stoichiometry of converting the 4-HB substrate into S. cerevisiae assuming that the pathways for the production of A) succinate, B) succinyl-CoA or C) alpha-ketoglutarate function in S. cerevisiae.

Glucose and oxygen are taken while all other molecules are produced.

<td colspan="4">A) The succinate route</td>

<td>Specificity</td><td>2 stages with</td><td>1st stage with NADH</td><td>2 stages with</td>

<td>cofactors</td><td>NADH</td><td>1st stage with NADPH</td><td>NADPH</td>

<td>Glucose</td><td> -1,000</td><td> -1,000</td><td> -1,000</td>

<td>Oxygen</td><td> 0,000</td><td> 0,000</td><td> 0,000</td>

<td>protons</td><td> 1,333</td><td> 1,333</td><td> 1,333</td>

<td>4-HB</td><td> 1,333</td><td> 1,333</td><td> 1,333</td>

<td>CO2</td><td> 0,667</td><td> 0,667</td><td> 0,667</td>

<td>H2O</td><td> 0,667</td><td> 0,667</td><td> 0,667</td>

<td>ATP</td><td> 1,444</td><td> 1,067</td><td> 0,533</td>

<td>B) The succinyl-</td><td>CoA</td><td></td><td></td>

<td>Specificity</td><td>2 stages with</td><td>1st stage with NADH</td><td>2 stages with</td>

<td>cofactors</td><td>NADH</td><td>1st stage with NADPH</td><td>NADPH</td>

<td>Glucose</td><td> -1,000</td><td> -1,000</td><td> -1,000</td>

<td>Oxygen</td><td> 0,000</td><td> 0,000</td><td> 0,000</td>

<td>protons</td><td> 1,333</td><td> 1,333</td><td> 1,333</td>

<td>4-HB</td><td> 1,333</td><td> 1,333</td><td> 1,333</td>

<td>CO2</td><td> 0,667</td><td> 0,667</td><td> 0,667</td>

123

<td>H2O</td><td> 0,667</td><td> 0,667</td><td> 0,667</td>

<td>ATP</td><td> 0,533</td><td> 0,000</td><td> 0,000</td>

<td colspan="4">C) Alpha-ketoglutarate pathway</td>

<td>Specificity</td><td>1st stage from</td><td colspan="2">1st stage with NADPH</td>

<td>cofactors</td><td>NADH</td><td></td><td></td>

<td>Glucose</td><td> -1,000</td><td colspan="2"> -1,000</td>

<td>Oxygen</td><td> -0,785</td><td colspan="2"> -0,879</td>

<td>protons</td><td> 1,159</td><td colspan="2"> 1,138</td>

<td>4-HB</td><td> 1,159</td><td colspan="2"> 1,138</td>

<td>CO2</td><td> 1,364</td><td colspan="2"> 1,448</td>

<td>H2O</td><td> 1,364</td><td colspan="2"> 1,448</td>

<td>ATP</td><td> 0,000</td><td colspan="2"> 0,000</td>

Example IV

Biosynthesis of 1,4-butanediol from succinate and α-ketoglutarate [0139] This example illustrates the construction and biosynthetic production of 4-HB and BDO from microbial organisms.

[0140] As previously described in Examples I-III, the thermodynamic properties of the biotransformation steps with

4-HB to BDO shown in Fig. 1 was also calculated based on the standard Gibbs free energy of formation determined by group shares. The results are given in the table

5. Similarly, although for certain stages have been calculated

124 positive delta G values ​​are standard errors for these

<td>calculations and stages is</td><td>concentration gradients feasible.</td><td>show</td><td>that each of these</td>

<td>5 Table</td><td>5. Energy</td><td>free</td><td>Gibbs reaction</td>

<td>(Kcal / mol)</td><td>in standard</td><td>conditions</td><td>(pH values ​​and</td>

ionic strength (IS)). The temperature was constant at 298 K. The error bars for these values ​​are on the order of 8 kcal / mol as calculated by equation 2. Abbreviations:

4-HBald, 4-hydroxybutyraldehyde.

<td>Reaction</td><td>AG_r°'</td>

<td></td><td>pH = 7.0</td>

<td></td><td>IS = 0</td>

<td>4-HB + NADH + H + 4-HBald + NAD</td><td> 2,4</td>

<td>4-HB + acetyl-CoA 4-HB-CoA + acetate</td><td> -5,0</td>

<td>4-HB-CoA + NADH + H + 4-HBald + NAD + CoA</td><td> 9,5</td>

<td>4-HBald + NADH + H + bdo + NAD</td><td> -5,0</td>

[0141] Theoretical yields were calculated assuming that all pathways of Figure 2 were introduced into E.

coli. A genomic scale metabolic model of E. coli was used as the basis for analysis, similar to that described in Reed et al. Genom Biol 4: R54 (2003). Maximum theoretical efficiency assuming neutrality

125 energy and no cell growth or maintenance, was 1.09 mol BDO / mol glucose under microaerobic conditions. Anaerobic simulations were performed that can be used to direct the pathway towards BDO production; either acetate or ethanol is formed as a co-product. Under these conditions, the maximum yield was 1.04 and 1.00 mol / mol, respectively. One alternative is to add a limiting amount of nitrate as an electron acceptor, thus controlling the amount of respiratory response that can occur. Under these conditions, the maximum yield returns to 1.09 mol / mol. Another alternative is to replace the native E. coli phosphoenolpyruvate carboxylase (PEP) with a heterologous or constructed phosphoenolpyruvate carboxyquinase, which is able to work towards PEP carboxylation. This enzyme produces ATP, while PEP carboxylase does not. Under this assumption, the maximum yield returns to 1.09 mol / mol.

[0142] In addition, there are several alternative enzymes that can be used in the pathway described above. The native or endogenous enzyme for converting succinate to succinyl-CoA (step 1 in Figure 2) can be replaced with a CoA-transferase such as that encoded by the cat1 gene from C. kluyveri (Sohling, B. and G.

126

Gottschalk, Eur.J Biochem. 212: 121-127 (1993)), which functions in a similar manner to step 9. However, acetate production by this enzyme may not be optimal, as this compound may be secreted rather than being converted back to acetyl CoA.

Therefore, it may also be beneficial to eliminate acetate formation in step 9. As one alternative to this CoA-transferase, a mechanism in which 4-HB is first phosphorylated by ATP and then converted to a CoA derivative can be used, similar to the kinase pathway acetate / phosphotransacetylase in E. coli to convert acetate to acetyl-CoA. The net cost of this route is one ATP molecule, the same as required for acetyl-CoA regeneration from acetate. Phosphotransbutyrylase (ptb) and butyrate kinase (bk) enzymes are known to carry out these steps with non-hydroxylated butyrate producing molecules in C. acetobutylicum (Cary et al., Appl Environ Microbiol

56: 1576-1583 (1990); Valentine, RC and RS Wolfe, J.

Biol Chem. 235: 1948-1952 (1960)). These enzymes catalyze reversible reactions, which enables 4-HB synthesis.

[0143] Butanediol may also be produced via α-ketoglutarate in addition to or instead of succinate.

127

One pathway to obtain product biosynthesis described previously, and exemplified below below, proceeds with the production of succinic semialdehyde via α-ketoglutarate using endogenous enzymes (Figure 2, steps 4-5). An alternative is the use of α-ketoglutarate decarboxylase, which can do this transformation in one step (Fig. 2, step 8; Tian et al., Proc Natl Acad Sci USA

102:10670-10675 (2005)).

[0144] To construct different strains of BDO-producing microbial organisms, a list of relevant genes was prepared for confirmation. Briefly, one or more genes in the 4-HB and / or BDO biosynthesis pathways were identified for each step of the total BDO production pathway shown in Figure 2 using available literature sources, the NCBI genetic database, and homology search. The genes cloned and evaluated in this study are shown below in Table 6 along with the relevant references and URL publications for the polypeptide sequence. As discussed further below, some genes were synthesized to optimize codons while others were cloned by PCR from the genomic DNA of a native or wild-type organism. For some genes both approaches were used, and in this case the native genes

128 is indicated by the suffix 'n' in the gene identification number when used in the experiment. Note that only the DNA sequences differ; the proteins are identical.

Table 6. Genes expressed in microbial host organisms producing BDO.

<td>No.</td><td>Number</td><td>Name</td><td>Organism</td><td>Name of the enzyme</td><td>Link to</td><td>Odsy-</td>

<td>identical</td><td>reaction</td><td>gene</td><td>source</td><td></td><td>sequence</td><td>link</td>

<td>tyfi-</td><td>tion</td><td></td><td></td><td></td><td>protein</td><td>litera-</td>

<td>kacyj-</td><td>(FIG.</td><td></td><td></td><td></td><td></td><td>ratu-</td>

<td>ny</td><td> 1)</td><td></td><td></td><td></td><td></td><td>trenches</td>

<td>gene</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> 0001</td><td> 9</td><td>cat2</td><td>Clos-</td><td>CoA-</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(29) d}</td>

<td></td><td></td><td></td><td>Tridium</td><td>transferase</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>kluveri</td><td>4-hydroxy-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>DSM 555</td><td>ksymaślanu</td><td>cgi? db = nucco</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>Re &amp; id = 122810</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 0</td><td></td>

<td> 0002</td><td> 12/13</td><td>adhE</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(22) d}</td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>acetonitrile</td><td>aldehyde /</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>butylicum</td><td>Alcoholic</td><td>cgi? db = protest</td><td></td>

<td></td><td></td><td></td><td>ATCC 824</td><td></td><td>in &amp; val =</td><td></td>

129

<td></td><td></td><td></td><td></td><td></td><td> 15004739</td><td></td>

<td> 0003</td><td> 12/13</td><td>adhE2</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(12) d}</td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>acetonitrile</td><td>aldehyde /</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>butylicum</td><td>Alcoholic</td><td>cgi? val = NP 1</td><td></td>

<td></td><td></td><td></td><td>ATCC 824</td><td></td><td> 49325.1</td><td></td>

<td> 0004</td><td> 1</td><td>cat1</td><td>Clos-</td><td>CoA-</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(29) d}</td>

<td></td><td></td><td></td><td>Tridium</td><td>transferase</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>kluveri</td><td>bursztynia-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>DSM 555</td><td>new</td><td>cgi? db = nucco</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>Re &amp; id = 122810</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 0</td><td></td>

<td> 0008</td><td> 6</td><td>sucD</td><td>Clos-</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(29) d}</td>

<td></td><td></td><td></td><td>Tridium</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>kluveri</td><td>semialde-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>DSM 555</td><td>hydu</td><td>cgi? db = nucco</td><td></td>

<td></td><td></td><td></td><td></td><td>succinic</td><td>Re &amp; id = 122810</td><td></td>

<td></td><td></td><td></td><td></td><td>wego (CoA-</td><td> 0</td><td></td>

<td></td><td></td><td></td><td></td><td>subsidiary)</td><td></td><td></td>

<td> 0009</td><td> 7</td><td>4-weeks of gestation</td><td>Ralstonia</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(32) d}</td>

<td></td><td></td><td></td><td>eutropha</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>H16</td><td>4-hydroxy-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td></td><td>butyrate</td><td>cgi? val = YP 7</td><td></td>

<td></td><td></td><td></td><td></td><td>(ABOVE-</td><td> 26053.1</td><td></td>

<td></td><td></td><td></td><td></td><td>subsidiary)</td><td></td><td></td>

130

<td> 0010</td><td> 7</td><td>4-weeks of gestation</td><td>Clos-</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(29) d}</td>

<td></td><td></td><td></td><td>Tridium</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>kluveri</td><td>4-hydroxy-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>DSM 555</td><td>butyrate</td><td>cgi? db = nucco</td><td></td>

<td></td><td></td><td></td><td></td><td>(ABOVE-</td><td>Re &amp; id = 122810</td><td></td>

<td></td><td></td><td></td><td></td><td>subsidiary)</td><td> 0</td><td></td>

<td> 0011</td><td> 12/13</td><td>adhE</td><td>E. coli</td><td>dehydrogenase</td><td><a href="http://www.shigen.n">www.shigen.n</a></td><td></td>

<td></td><td></td><td></td><td></td><td>naza</td><td>ig.ac.jp/eco</td><td></td>

<td></td><td></td><td></td><td></td><td>aldehyde /</td><td>If / pec / genes</td><td></td>

<td></td><td></td><td></td><td></td><td>Alcoholic</td><td>.List.Detail</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>Action.do?fr</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>omListFlag = t</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>Rue &amp; featureT</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>ype = l = &amp; orfld</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 1219</td><td></td>

<td> 0012</td><td> 12/13</td><td>yqhD</td><td>E. coli</td><td>dehydrogenase</td><td><a href="http://www.shigen.n">www.shigen.n</a></td><td></td>

<td></td><td></td><td></td><td></td><td>naza</td><td>ig.ac.jp/eco</td><td></td>

<td></td><td></td><td></td><td></td><td>aldehyde /</td><td>If / pec / genes</td><td></td>

<td></td><td></td><td></td><td></td><td>Alcoholic</td><td>.List.Detail</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>Action.do</td><td></td>

<td> 0013</td><td> 13</td><td>bdhB</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(35) d}</td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>acetobu-</td><td>butanol</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>tylicum</td><td>II</td><td>cgi? val = NP 3</td><td></td>

<td></td><td></td><td></td><td>ATCC 824</td><td></td><td> 49891.1</td><td></td>

131

<td> 0020</td><td> 11</td><td>ptb</td><td>Clostri dium acetobutylicum ATCC 824</td><td>Fosfotransbutyrylaza</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a>.nih.gov / ent rez / viewer.f cgi? db = protest in &amp; id = 158963 27</td><td>(4) d}</td>

<td> 0021</td><td> 10</td><td>buk1</td><td>Clostri -</td><td>kinase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(4) d}</td>

<td></td><td></td><td></td><td>dium</td><td>of buttermilk</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>acetobu-</td><td></td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>tylicum</td><td></td><td>cgi? db = protest</td><td></td>

<td></td><td></td><td></td><td>ATCC 824</td><td></td><td>in &amp; id = 201373</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 34</td><td></td>

<td> 0022</td><td> 10</td><td>buk2</td><td>Clostri -</td><td>kinase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(4) d}</td>

<td></td><td></td><td></td><td>dium</td><td>butyrate</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>acetobu-</td><td>II</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>tylicum</td><td></td><td>cgi? db = protest</td><td></td>

<td></td><td></td><td></td><td>ATCC 824</td><td></td><td>in &amp; id = 201374</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td> 0023</td><td> 13</td><td>Adhem</td><td>Wyizolo-</td><td>dehydrogenase</td><td></td><td>(37) d}</td>

<td></td><td></td><td></td><td>vata z</td><td>naza</td><td></td><td></td>

<td></td><td></td><td></td><td>meta b and b</td><td>Alcoholic</td><td></td><td></td>

<td></td><td></td><td></td><td>lioteki</td><td></td><td></td><td></td>

<td></td><td></td><td></td><td>anaerobo-</td><td></td><td></td><td></td>

<td></td><td></td><td></td><td>Wych</td><td></td><td></td><td></td>

132

<td></td><td></td><td></td><td>consortia microorganisms chamber fermentation sewage</td><td></td><td></td><td></td>

<td> 0024</td><td> 13</td><td>adhE</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.genome.j">www.genome.j</a></td><td></td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>p / dbget-</td><td></td>

<td></td><td></td><td></td><td>Thermo</td><td>Alcoholic</td><td>bin / www bget</td><td></td>

<td></td><td></td><td></td><td>cellum</td><td></td><td>? cth: Cthe 04</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 23</td><td></td>

<td> 0025</td><td> 13</td><td>ald</td><td>Clos-</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(31) d}</td>

<td></td><td></td><td></td><td>tri dium</td><td>name CoA-</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>beijer-</td><td>aldehyde</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>inckii</td><td>(Acylation)</td><td>cgi? db = protest</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>in &amp; id = 490366</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 81</td><td></td>

<td> 0026</td><td> 13</td><td>bdhA</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(35) d}</td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>acetobu-</td><td>butanol</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>tylicum</td><td></td><td>cgi? val = NP 3</td><td></td>

<td></td><td></td><td></td><td>ATCC 824</td><td></td><td> 49892.1</td><td></td>

133

<td> 0027</td><td> 15</td><td>error</td><td>Clostri dium saccharoperbutylacetonicum</td><td>dehydrogenase aldehyde butyric</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a>.nih.gov / ent rez / viewer.f cgi? db = protest in &amp; id = 310753 83</td><td> (18</td><td>d}</td>

<td> 0028</td><td> 13</td><td>BDH</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td> (18</td><td>d}</td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>.nih.gov / ent</td><td></td><td></td>

<td></td><td></td><td></td><td>Saccharomyces</td><td>butanol</td><td>rez / viewer.f</td><td></td><td></td>

<td></td><td></td><td></td><td>roperbu-</td><td></td><td>cgi? db = protest</td><td></td><td></td>

<td></td><td></td><td></td><td>tylace-</td><td></td><td>in &amp; id = 124221</td><td></td><td></td>

<td></td><td></td><td></td><td>tonicum</td><td></td><td> 917</td><td></td><td></td>

<td> 0029</td><td> 12/13</td><td>adhE</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.genome.j">www.genome.j</a></td><td></td><td></td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>p / dbget-</td><td></td><td></td>

<td></td><td></td><td></td><td>tetani</td><td>aldehyde /</td><td>bin / www bget</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>Alcoholic</td><td>? Ctc: CTC0136 6</td><td></td><td></td>

<td> 0030</td><td> 12/13</td><td>adhE</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.genome.j">www.genome.j</a></td><td></td><td></td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>p / dbget-</td><td></td><td></td>

<td></td><td></td><td></td><td>perfrin-</td><td>aldehyde /</td><td>bin / www bget</td><td></td><td></td>

<td></td><td></td><td></td><td>gens</td><td>Alcoholic</td><td>? Cpe: CPE2531</td><td></td><td></td>

<td> 0031</td><td> 12/13</td><td>adhE</td><td>Clostri -</td><td>dehydrogenase</td><td><a href="http://www.genome.j">www.genome.j</a></td><td></td><td></td>

<td></td><td></td><td></td><td>dium</td><td>naza</td><td>p / dbget-</td><td></td><td></td>

<td></td><td></td><td></td><td>difficile</td><td>aldehyde /</td><td>bin / www bget</td><td></td><td></td>

134

<td></td><td></td><td></td><td colspan="2">Alcoholic</td><td>? Cdf: CD2966</td><td></td>

<td> 0032</td><td> 8</td><td>sucA</td><td>Myco-</td><td>Dekarboksy-</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(30) d}</td>

<td></td><td></td><td></td><td>bacterium</td><td>laza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>bovis</td><td>α-ketoglu-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>BCG</td><td>ramming</td><td>cgi? val = YP 9</td><td></td>

<td></td><td></td><td></td><td>Pasteur</td><td></td><td> 77400.1</td><td></td>

<td> 0033</td><td> 9</td><td>cat2</td><td>Clostri -</td><td>CoA-</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td></td>

<td></td><td></td><td></td><td>dium</td><td>transferase</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>· amino -</td><td>4-hydroxy-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>butyricum</td><td>ksymaślanu</td><td>cgi? db = protest</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>in &amp; val = 62493</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 16</td><td></td>

<td> 0034</td><td> 9</td><td>cat2</td><td>Porphy-</td><td>CoA-</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td></td>

<td></td><td></td><td></td><td>romonas</td><td>transferase</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>gingiva-</td><td>4-hydroxy-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>fox W83</td><td>ksymaślanu</td><td>cgi? db = protest</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>in &amp; val = 34541</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 558</td><td></td>

<td> 0035</td><td> 6</td><td>sucD</td><td>Porphy-</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td></td>

<td></td><td></td><td></td><td>romonas</td><td>naza</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>gingiva-</td><td>semialdehy-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td>fox W83</td><td>du</td><td>cgi? val = NP 9</td><td></td>

<td></td><td></td><td></td><td></td><td>succinic</td><td> 04963.1</td><td></td>

<td></td><td></td><td></td><td></td><td>wego (CoA-</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>subsidiary)</td><td></td><td></td>

135

<td> 0036</td><td> 7</td><td>4-weeks of gestation</td><td>Porphyromonas gingivalis W83</td><td>NAD-dependent 4-hydroxybutyrate dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a>.nih.gov / ent rez / viewer.f cgi? val = NP 9 04,964.1</td><td></td>

<td> 0037</td><td> 7</td><td>GBD</td><td>Bacteria</td><td>dehydrogenase</td><td><a href="http://www.ncbi.nlm">www.ncbi.nlm</a></td><td>(16) d}</td>

<td></td><td></td><td></td><td>no-</td><td>name 4-</td><td>.nih.gov / ent</td><td></td>

<td></td><td></td><td></td><td>grown</td><td>hydro-</td><td>rez / viewer.f</td><td></td>

<td></td><td></td><td></td><td></td><td>ksymaślano-</td><td>cgi? db = nucco</td><td></td>

<td></td><td></td><td></td><td></td><td>wa</td><td>Re &amp; id = 591616</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td> 8</td><td></td>

<td> 0038</td><td> 1</td><td>sucCD</td><td>E. coli</td><td>synthetase</td><td><a href="http://www.shigen.n">www.shigen.n</a></td><td></td>

<td></td><td></td><td></td><td></td><td>sukcynylo-</td><td>ig.ac.jp/eco</td><td></td>

<td></td><td></td><td></td><td></td><td>CoA</td><td>If / pec / genes</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>.List.Detail</td><td></td>

<td></td><td></td><td></td><td></td><td></td><td>Action.do</td><td></td>

[0145] Construction of the expression vector for the BDO pathway. Vector skeletons and some strains were obtained from Dr. Rolf Lutz of Expressys (<a href="http://www.expressys.de/">www.expressys.de/</a>). Vectors and strains are based on the pZ Expression System developed by dr Rolf Lutz and prof. Hermann Bujard (Lutz, R. and H. Bujard, Nucleic

Acids Res 25: 1203-1210 (1997)). The resulting vectors were pZE13luc, pZA33luc, pZS * 13luc and pZE22luc i

136 contained the luciferase gene as a filler fragment. In order to replace the filler fragment in the form of the luciferase gene by the lacZ-alpha fragment flanked with appropriate restriction enzyme sites, the filler fragment in the form of the luciferase gene was first removed from each vector by digestion with EcoRI and XbaI enzymes. The lacZ-alpha fragment was amplified by PCR with pUC19 using the following primers:

lacZalpha-RI

5'GACGAATTCGCTAGCAAGAGGAGAAGTCGACATGTCCAATTCACTGGCCGTCG

TTTTAC3 'lacZalpha 3'BB

5'-GACCCTAGGAAGCTTTCTAGAGTCGACCTATGCGGCATCAGAGCAGA-3 '.

[0146] This resulted in a fragment with the 5 'end of the EcoRI site, NheI site, ribosome binding site, site

SalI and start codon. At the 3 'end, the fragment contained a stop codon and XbaI, HindIII and AvrII sites. The PCR product was digested with EcoRI and AvrII enzymes and ligated with EcoRI and XbaI digested base vectors (XbaI and AvrII have compatible ends and produce a site not recognized by non-site enzymes). Because the sites for NheI and XbaI restriction enzymes have compatible ends that can be ligated together (but they give a site not recognized by NheI / XbaI restriction enzymes,

137 which is not digested by any of these enzymes), genes cloned into vectors can be bioblocked (<a href="http://openwetware.org/wiki/Synthetic_Biology:BioBrick">http://openwetware.org/wiki/Synthetic_Biology:BioBrick</a> s). Briefly, this method allows an unlimited number of genes to be combined into a vector using the same 2 restriction sites (unless these sites occur within the genes) because the sites between the genes are destroyed after each addition.

[0147] All vectors have the pZ designation followed by letters and numbers indicating the origin of replication, an antibiotic resistance marker, and a promoter / regulatory unit. The origin of replication is the second letter and is indicated by E for the origin of replication originating from

ColE1, A for p15A and S for pSC101. The first number indicates the antibiotic resistance marker (1 for ampicillin, 2 for kanamycin, 3 for chloramphenicol, 4 for spectinomycin and 5 for tetracycline). The final digit identifies the promoter that regulated the gene of interest (1 for P_LtetO-1, 2 for P_LlacO-1, 3 for ^PAA1lacO-1 ^{and 4 for P.}lac / ara-1^{). MCS and the gene being}of interest immediately follow him. For the discussed work, the inventors used two basic vectors, pZA33 and pZE13, modified

138 for bioblock insertion as discussed above. After cloning the gene (s) of interest in them, the plasmids obtained were identified using the four-digit gene codes given in Table 6;

e.g. pZA33-XXXX-YYYY -....

[0148] Construction of the host strain.

The parent strain in all studies described here is the strain

E.

cola K-12

MG1655.

The marker-free deletion strains in adhE, gabD and 10 aldA were constructed under a contract for the provision of services by third parties using the redET method (Datsenko, KA and BL Wanner, Proc Natl Acad Sci

USA 97: 6640-6645 (2000)). Later strains were constructed by bacteriophage P1-mediated transduction (Miller, J. 1973. Experiments in

Molecular Genetics. Cold Spring Harbor Laboratories, New York). Strain C600Z1 (Latin^q, PN25-tetR, Sp^R, lacY1, leuB6, mcrB +, supE44, thi-1, thr-1, tonA21) were obtained from Expressys and used as a source of the lacIq allele for P1 transduction. P1vir bacteriophage was grown on a strain

E. coli C600Z1 possessing the lacI-associated spectinomycin resistance gene^q. P1 lysate grown on C600Z1 was used for MG1655 infection with selection for spectinomycin resistance. Spectinomycin resistant colonies were then screened

139 for the presence of bound lacIq by determining the ability of transductants to suppress expression of the gene associated with the P promoter_A1lacO-1. The resulting strain was designated MG1655 lacI^q. A similar procedure was used to introduce lacI^Q to deletion strains.

[0149] Preparation of 4-HB from succinate. To construct the 4-HB succinate producing organism, genes encoding the steps leading from succinate to 4-HB and 4-HB-CoA (1, 6, 7 and 9 in Figure 2) were collected in the vectors pZA33 and pZE13, as described below. Various gene combinations were evaluated as well as controls - constructs carrying incomplete pathways (Tables 7 and 8). Plasmids were then transformed into lacI containing host strains^Qwhich allows inducible expression by the addition of β-ti1-thiogalactopyranoside isopropyl (IPTG). Both wild-type organisms and deletion hosts in genes encoding native amber semialdehyde dehydrogenase were tested (step 2 in Figure 1).

[0150] The activity of heterologous enzymes was first tested in in vitro tests using the MG1655lacI strain^Q as the host of plasmid constructs containing pathway genes. Cells were cultured aerobically in LB (Difco) media containing the appropriate antibiotics for each construct and

140 induced by the addition of IPTG at a concentration of 1 mM when the optical density (OD600) reached approximately 0.5. Cells were harvested after 6 hours and enzyme tests were performed as discussed below.

[0151] In vitro enzyme tests. To obtain crude extracts for activity tests, cells were harvested by centrifugation at 4500 rpm (Beckman-Coulter, Allegera X-15R) for 10 minutes. The pellets were resuspended in 0.3 ml reagent

BugBuster (Novagen) with benzonase and lysozyme and lysis was continued for 15 minutes at room temperature with gentle shaking. The cell-free lysate was obtained by centrifugation at 14,000 rpm (Eppendorf centrifuge 5402) for 30 minutes at 4 ° C. The cellular protein in the sample was determined using the method of Bradford et al., Anal. Biochem. 72: 248254 (1976) and specific enzyme assays were performed as described below. Activities are given in units / mg protein, where the activity unit is defined as the amount of enzyme required to convert 1 μmol of substrate in 1 minute at room temperature. In general, the values ​​given are means of at least 3 replicate tests.

[0152] Succinyl-CoA (Cat1) transferase activity was determined by monitoring the formation of acetyl-CoA from

141 succinyl-CoA and acetate, following the previously described procedure of Sohling and Gottschalk, J. Bacteriol.

178: 871-880 (1996). Succinyl-CoA synthetase (SucCD) activity was determined by monitoring succinyl-CoA formation from succinate and CoA in the presence of ATP. In the experiment, the procedure described by Cha and Parks, J. Biol was followed. Chem. 239: 1961-1967 (1964). CoA-dependent succinate semialdehyde dehydrogenase (SucD) activity was determined by monitoring the conversion of NAD to NADH at 340 nm in the presence of succinate semialdehyde and CoA (Sohling and Gottschalk, Eur. J. Biochem. 212: 121-127 (1993)). The enzymatic activity of 4-HB dehydrogenase (4-HBd) was determined by monitoring the oxidation of NADH to NAD at 340 nm in the presence of succinate semialdehyde. The experiment followed the published procedure: Gerhardt et al. Arch. Microbiol. 174: 189-199 (2000). CoA-4-HB transferase (Cat2) activity was determined using a modified procedure: Scherf and Buckel,

Appl. Environ. Microbiol. 57: 2699-2702 (1991).

The formation of 4-HB-CoA or butyryl-CoA from acetyl-CoA and 4HB or butyrate was determined by HPLC.

[0153] Alcohol dehydrogenase (ADH) and aldehyde (ALD) were tested in a reducing direction using a procedure adapted from several literature sources

142 (Durre et al., FEMS Microbiol. Rev. 17: 251-262 (1995);

Palosaari and Rogers, J. Bacteriol. 170: 2971-2976 (1988) and Welch et al., Arch. Biochem. Biophys. 273: 309-318 (1989). NADH oxidation is monitored by reading absorbance at 340 nm every four seconds for a total of 240 seconds at room temperature. Reduction tests are carried out in 100 mM MOPS (adjusted to pH 7.5 using KOH), 0.4 mM NADH and from 1 to 50 μl of cell extract. The reaction was started by adding the following reagents: 100 μl 100 mM acetaldehyde or butyric aldehyde for ADH or 100 μl 1 mM acetyl CoA or butyryl CoA for ALD. The spectrophotometer was quickly zeroed and then the kinetics reading began. The obtained reduction graph as a function of absorbance at 340 nm per minute, together with the molar extinction coefficient NAD (P) H at 340 nm (6000) and the protein concentration in the extract can be used to determine specific activity.

[0154] PTB enzymatic activity is measured in the direction from butyryl-CoA to butyryl phosphate as described in Cary et al. J. Bacteriol. 170: 4613-4618 (1988). It provides inorganic phosphate for transformation and tracks the increase in free CoA concentration using the 5,5'-dithiobis (2-nitrobenzoic acid) or DTNB reagent. DTNB reacts quickly with

143 thiol groups, such as free CoA, releasing yellow-colored 2-nitro-5-mercaptobenzoic acid (TNB), which absorbs light at 412 nm with a molar extinction coefficient of 14140 M cm^-1. The assay buffer contained 150 mM potassium phosphate at pH 7.4, 0.1 mM DTNB and 0.2 mM butyryl-CoA and the reaction was started by adding 2 to 50 μl of cell extract.

BK enzymatic activity is measured in the direction of butyrate to butyryl phosphate at the expense of ATP. The procedure is similar to the acetate kinase test previously described: Rose et al., J. Biol. Chem. 211: 737756 (1954). However, the inventors have found that another acetate kinase enzyme assay protocol provided by Sigma is more useful and sensitive. This test associates the conversion of ATP to ADP by acetate kinase with the associated conversion of ADP and phosphoenol pyruvate (PEP) to ATP and pyruvate by pyruvate kinase followed by the conversion of pyruvate and NADH to lactate and NAD + by lactate dehydrogenase. Replacement with acetate butyrate is the only major modification that allows the test to mimic the BK enzymatic activity. The test mixture contained 80 mM triethanolamine buffer pH 7.6, 200 mM sodium butyrate, 10 mM MgCl₂, 0.1 mM NADH, 6.6 mM ATP, 1.8

144 mM phosphoenolpyruvate. Pyruvate kinase, lactate dehydrogenase and myokinase were added according to the manufacturer's instructions. The reaction was started by adding from 2 to 50 μΐ of cell extract and the course of the reaction was monitored based on a decrease in absorbance at 340 nm indicating NADH oxidation.

[0155] Analysis of CoA derivatives by HPLC. An HPLC-based assay was developed to monitor the enzymatic reactions associated with coenzyme A (CoA) transfer. The developed method allowed characterization of enzymatic activity by quantification

CoA, acetyl-CoA (AcCoA), butyryl-CoA (BuCoA) and 4-hydroxybutyryl-CoA (4-HBCoA) found in in vitro reaction mixtures. Sensitivity down to low mM values ​​was achieved, as well as excellent separation of all CoA derivatives of interest.

[0156] Chemicals and samples were prepared as follows. Briefly, CoA, AcCoA, BuCoA and all other chemicals were obtained from Sigma-Aldrich. Solvents, methanol and acetonitrile, were grade HPLC. Standard curves showed excellent linearity in the 0.01-1 mg / ml concentration range. Enzymatic reaction mixtures contained 100 mM Tris HCl buffer (pH 7), samples were taken at different

145 at time points, the reactions were stopped with formic acid (0.04% final concentration) and directly analyzed by HPLC.

[0157] HPLC analysis was performed using an Agilent 1100 HPLC system equipped with a binary pump, degasser, automatic sampling device with thermostat, column compartment and diode array detector (DAD) for analysis. Reverse phase column, Kromasil 100 5 um C18, 4.6 x 150 mm (Peeke) was used

Scientific). 25 mM potassium phosphate (pH 7) and methanol or acetonitrile were used as aqueous and organic solvents , at a flow rate of 1 ml / minute. Two methods were developed: short, with a faster gradient, for analysis of well-separated CoA, AcCoA and BuCoA, and a longer method for distinguishing between closely eluting AcCoA and 4-HBCoA. A short method utilized an acetonitrile gradient (0 minutes - 5%, 6 minutes - 30%, 6.5 minutes 5%, 10 minutes - 5%) and retention times of

2.7; 4.1 and 5.5 minutes for CoA, AcCoA and

Buco. Methanol with the following linear gradient was used in the long process: 0 minutes - 5%, 20 minutes - 35%, 20.5 minutes - 5%, 25 minutes - 5%. Retention times for CoA,

AcCoA, 4-HBCoA and BuCoA were 5.8, respectively; 8.4;

9.2 and 16.0 minutes. The injection volume was 5 gl,

146 column temperature 30 ° C and UV absorbance monitored at 260 nm.

[0158] The results showed the activity of each of the four pathway steps (Table 6), although activity clearly depends on the source of the gene, the position of the gene in the vector and the context of other genes with which it is expressed.

For example, gene 0035 encodes succinic semialdehyde dehydrogenase, which is more active than that encoded by 0008 and 0036 and 0010n are more active 4-HB dehydrogenase genes than 0009. It also seems that there is better 4-HB dehydrogenase activity when another pre-existing gene exists him in the same operon.

147

Table 7. In vitro enzymatic activities in cell extracts from MG1655 lacI^Qcontaining plasmids expressing genes in the 4-HB-CoA pathway. Activities are given in units / mg protein, where the activity unit is defined as the amount of enzyme required to convert 1 μmol of substrate in 1 minute at room temperature.

<td>Sample No.</td><td>P2E13 (a)</td><td>pZA33 (b)</td><td>FROM 600</td><td>Protein concentration (c)</td><td>catle</td><td>SucD</td><td>4HBd</td><td>cat2</td>

<td> 1</td><td>catl (0004)</td><td></td><td> 2.71</td><td> 6.43</td><td> 1.232</td><td> 0.00</td><td></td><td></td>

<td> 2</td><td>catl (0004) -sucD (0035)</td><td></td><td> 2.03</td><td> 5.00</td><td> 0.761</td><td> 2.57</td><td></td><td></td>

<td> 3</td><td>catl (0004) -sucD | 0008 |</td><td></td><td> 1.04</td><td> 3.01</td><td> 0.783</td><td> 0.01</td><td></td><td></td>

<td> 4</td><td>sucD (0035)</td><td></td><td> 2.31</td><td> 6.94</td><td></td><td> 2.32</td><td></td><td></td>

<td> 5</td><td>sucD (0008)</td><td></td><td> 1.10</td><td> 4.16</td><td></td><td> 0.05</td><td></td><td></td>

<td> 6</td><td></td><td>4hbd (0009)</td><td> 2.81</td><td> 7.94</td><td> 0.003</td><td></td><td> 0.25</td><td></td>

<td> 7</td><td></td><td>4hfcd (0036)</td><td> 2.63</td><td> 7.84</td><td></td><td></td><td> 3.31</td><td></td>

<td> 8</td><td></td><td>4hbd (Olon)</td><td> 2.00</td><td> 5.08</td><td></td><td></td><td> 2,57</td><td></td>

<td> 9</td><td>catl (00041-sucD (00351</td><td>4hbd (0009)</td><td> 2.07</td><td> 5.04</td><td> 0.600</td><td> 1.85</td><td> 0.01</td><td></td>

<td> 10</td><td>catl (0004) -sucD (00351</td><td>4hbd (0036)</td><td> 2.08</td><td> 5.40</td><td> 0.694</td><td> 1.73</td><td> 0.41</td><td></td>

<td> 11</td><td>catl (0004) -sucD (0035)</td><td>4hbd (Olon)</td><td> 2.44</td><td> 4.73</td><td> 0.679</td><td> 2.28</td><td> 0.37</td><td></td>

<td> 12</td><td>catl (0004) -sucD (00081</td><td>4hbd (0009)</td><td> 1.08</td><td> 3.99</td><td> 0.572</td><td> -0.01</td><td> 0.02</td><td></td>

<td> 13</td><td>catl | 0004) -sucD 100081</td><td>4hbd (0036)</td><td> 0.77</td><td> 2.60</td><td> 0.898</td><td> -0.01</td><td> 0.04</td><td></td>

<td> 14</td><td>catl (0004) -sucD (00081</td><td>4hbd (OOlOn)</td><td> 0.63</td><td> 2.47</td><td> 0.776</td><td> 0.00</td><td> 0.00</td><td></td>

<td> 15</td><td></td><td>cat2 (0034)</td><td> 2.56</td><td> 7.86</td><td></td><td></td><td></td><td> 1.283</td>

<td> 16</td><td></td><td>cat2 (D034) -4hbd (0036)</td><td> 3.13</td><td> 8.04</td><td></td><td></td><td> 24.86</td><td> 0.993</td>

<td> 17</td><td></td><td>cat2 (0034) -4hbd (0010n)</td><td> 2.38</td><td> 7.03</td><td></td><td></td><td> 7.45</td><td> 0.675</td>

<td> 18</td><td></td><td>4hbd (0036) -cat2 (0034)</td><td> 2.69</td><td> 8.26</td><td></td><td></td><td> 2.15</td><td> 7.490</td>

<td> 19</td><td></td><td>4hbd (0010n) -tat2 (0034)</td><td> 2.44</td><td> 6.59</td><td></td><td></td><td> 0.59</td><td> 4.101 ,</td>

Genes expressed from Plac on pZE13, a plasmid that produces a large number of copies with colE1 origin and ampicillin resistance. Gene identification numbers are as given in Table 2

Genes expressed from Plac on pZA33, a plasmid giving average number of copies with pACYC replication origin and chloramphenicol resistance, (c) cell protein given as mg of protein per ml of extract.

148 [0159] Recombinant strains containing genes in the 4-HB pathway were then evaluated for their ability to produce 4-HB in vivo from intermediate major metabolic pathways. Cells were grown under anaerobic conditions in LB medium to an OD600 optical density of approximately 0.4, and then induced with 1 mM IPTG. One hour later, sodium succinate was added to 10 mM and samples were taken for analysis after an additional 24 and 48 hours. 4-HB in culture broth was analyzed by GC-MS as described below. The results indicate that the recombinant strain can produce over mM 4-HB after 24 hours, compared to virtually zero for the control strain (Table 8).

149

Table 8. Production of 4-HB from succinate in E. coli strains carrying expression plasmids of various combinations of the 4-HB pathway genes.

<td colspan="4"></td><td colspan="3">24 h</td><td colspan="3">48 hours</td>

<td>Sample No.</td><td>Host strain</td><td>p2El3</td><td>pZA33</td><td>OD 600</td><td>4HB, μΜ</td><td>And * 4HBnon. (and)</td><td>OD 600</td><td>4HB, μΜ</td><td>4HB standards, (a)</td>

<td> 1</td><td>MG1655 Laclq</td><td>catl (0004, -sucD (0035}</td><td>4hbd (0009,</td><td> 0.47</td><td> 487</td><td> 1036</td><td> 1.04</td><td> 1780</td><td> 1711</td>

<td> 2</td><td>MG1655 ladq</td><td>catl (0004, -sucD (0035,</td><td>4hbd (0027)</td><td> 0.41</td><td> 111</td><td> 270</td><td> 0.99</td><td> 214</td><td> 217</td>

<td> 3</td><td>MG1655 ladq</td><td>catl (0004, -sucD (0035}</td><td>4hbd (0036)</td><td> 0.47</td><td> 863</td><td> 1835</td><td> 0.48</td><td> 2152</td><td> 4484</td>

<td> 4</td><td>MG 1655 Laclq</td><td>catl (0004, -sucD (0035,</td><td>4hbd (Olon,</td><td> 0.46</td><td> 956</td><td> 2078</td><td> 0.49</td><td> 2221</td><td> 4533</td>

<td> 5</td><td>MG1655 ladq</td><td>catl (0004, -sucD (0008}</td><td>4hbd (0009,</td><td> 0.38</td><td> 493</td><td> 1296</td><td> 0,37</td><td> 1338</td><td> 3616</td>

<td> €</td><td>MG1655 ladq</td><td>catl (0004, -sucD (0008,</td><td>4hbd (0027,</td><td> 0.32</td><td> 26</td><td> 81</td><td> 0.27</td><td> 87</td><td> 323</td>

<td> 7</td><td>MG165S laclq</td><td>catl (0004, -sucD (0008)</td><td>4hbd (0036)</td><td> 0.24</td><td> 506</td><td> 2108</td><td> 0.31</td><td> 1448</td><td> 4672</td>

<td> 9</td><td>MG 1655 Laclq</td><td>catl (0004, -sucD (0008)</td><td>4hbd (Olon)</td><td> 0.24</td><td> 78</td><td> 324</td><td>0.S6</td><td> 233</td><td> 416</td>

<td> 9</td><td>MG 1655 laclqgabD</td><td>catl (OKM) -sucD (0035)</td><td>4hbd (0009)</td><td> 0.53</td><td> 656</td><td> 1237</td><td> 1.03</td><td> 1643</td><td> 1595</td>

<td> 10</td><td>MG1655 ladq gabD</td><td>catl (0004, -sucD (0035,</td><td>4hbd (0027)</td><td> 0.44</td><td> 92</td><td> 209</td><td> 0.98</td><td> 214</td><td> 218</td>

<td> 11</td><td>MG 1655 laclqgabD</td><td>catl (0004, -sucD (003S)</td><td>4hbd (0036)</td><td> 0.51</td><td> 1072</td><td> 2102</td><td> 0.97</td><td> 2358</td><td> 2431</td>

<td> 12</td><td>MG 1655 ladqgabD</td><td>catl (0004, -sucD (0035,</td><td>4hbd (Olon,</td><td> 0.51</td><td> 981</td><td> 1924</td><td> 0.97</td><td> 2121</td><td> 2186</td>

<td> 13</td><td>MG 1655 ladqgabD</td><td>catl (0004, -sucD (0008,</td><td>4hbd (0009)</td><td> 0.35</td><td> 407</td><td> 1162</td><td> 0.77</td><td> 1178</td><td> 1530</td>

<td> 14</td><td>MG1655 laclq gabD</td><td>catl (0004, -sucD (0008,</td><td>4hbd (0027)</td><td> 0.51</td><td> 19</td><td> 36</td><td> 1.07</td><td> 50</td><td> 47</td>

<td> 15</td><td>MG1655 laclq gabD</td><td>catl (0004, -sucD (0008)</td><td>4hbd (0036)</td><td> 0.35</td><td> 584</td><td> 1669</td><td> 0.78</td><td> 1350</td><td> 1731</td>

<td> 16</td><td>MG1655 laclq gabD</td><td>catl (0004, -sucD (0008,</td><td>4hbd (Olon)</td><td> 0.32</td><td> 74</td><td> 232</td><td> 0.82</td><td> 232</td><td> 283</td>

<td> 17</td><td>MG1655laclq</td><td>only vector</td><td>only vector</td><td> 0.8</td><td> 1</td><td> 2</td><td> 1.44</td><td> 3</td><td> 2</td>

<td> 18 :</td><td>MG1655 laclq gabD</td><td>only vector</td><td>only vector</td><td> 0.89</td><td> 1</td><td> 2</td><td> 1.41</td><td> 7</td><td> 5</td>

(a) normalized concentration of 4-HB, gM / OD600 units

150 [0160] An alternative to using CoA-transferase (cat1) to produce succinyl-CoA from succinate is to use native E. coli sucCD genes encoding succinyl-CoA synthetase. This gene cluster was cloned into pZ13 along with candidate genes for the remaining steps leading to 4-HB to obtain pZE13-0038-0035-0036.

[0161] Preparation of 4-HB from glucose. Although the above experiments show a functional pathway leading to 4-HB from the intermediate major metabolic pathways (succinate), an industrial scale process would require the production of chemicals from cheap carbohydrate feeds such as glucose or sucrose. Thus, the purpose of the next group of experiments was to determine whether endogenous succinate produced by cells during glucose growth could feed the 4-HB pathway. Cells were cultured under anaerobic conditions in M9 minimal medium (6.78 g / l Na₂HPO₄, 3.0 g / l KH₂AFTER₄,

0.5 g / l NaCl, 1.0 g / l NH₄Cl, 1 mM MgSO₄, 0.1 mM CaCl₂) supplemented with 20 g / l glucose, 100 mM 3- (N-morpholino) propanesulfonic acid (MOPS) to improve the buffering efficiency, 10 μg / ml thiamine and appropriate antibiotics. When the OD600 reached approximately 0.2, 0.25 mM IPTG was added and samples were taken for 4-HB analysis every 24 hours after induction. In all cases, the concentration of 4-HB reached a plateau

151 after 24 hours, with a maximum value of about 1 mM in the best strains (Figure 11a), although the succinate concentration continued to increase (Figure 11b). This indicates that succinate delivery to the pathway is probably not limiting and that enzyme activity or NADH availability may be the "bottleneck". 0035 and 0036 are clearly the best candidate genes for CoA-dependent succinic semialdehyde dehydrogenase and 4-HB dehydrogenase, respectively. Elimination of one or both genes coding for known (gabD) or potential (aldA) native succinic semialdehyde dehydrogenase had little effect on behavior. Finally, it should be noted that the cells propagated to a much lower optical density in the 4-HB producing strains than in the controls (Fig. 11c).

[0162] An alternative pathway for the production of 4-HB from glucose occurs via α-ketoglutarate. The inventors investigated the use of αketoglutarate decarboxylase from Mycobacterium tuberculosis, Tian et al., Proc. Natl. Acad. Sci. USA 102: 10670-10675 (2005) to produce succinic semialdehyde directly from α-ketoglutarate (step 8 in Fig. 2). To demonstrate that this gene (0032) was functional in vivo, the inventors expressed it in pZ13 in such

152 the same host as 4-HB dehydrogenase (gene 0036) on pZA33. This strain was able to produce over 1.0 mM 4HB within 24 hours after induction of 1 mM IPTG (Figure 12). Because this strain does not express CoA-dependent succinic semialdehyde dehydrogenase, the possibility of succinic semialdehyde production via succinyl-CoA is eliminated. It is also possible that the native genes responsible for the production of succinic semialdehyde may function in this pathway (steps 4 and 5 in Figure 2); however, the amount of 4-HB produced when plasmid pZE13-0032 was deprived of the host is negligible.

[0163] Preparation of BDO with 4-HB. The production of BDO with 4-HB requires two reduction steps, catalyzed by dehydrogenases. Alcohol dehydrogenase and aldehyde dehydrogenase (ADH and ALD, respectively) are NAD + / H and / or NADP + / H-dependent enzymes that together can reduce the carboxyl group in the molecule to the alcohol group or vice versa, can cause alcohol oxidation to the carboxylic acid. This biotransformation was demonstrated in wild-type Clostridium acetobutylicum (Jewell et al., Current Microbiology, 13: 215-19 (1986)), but neither responsible enzymes nor responsible genes were identified. In addition, it is unknown whether activation of 4-HB-CoA is required first (step 9 on

153 Fig. 2) or whether aldehyde dehydrogenase (step 12) can act directly on 4-HB. The inventors have made a list of the enzymes of candidates from C.

acetobutylicum and related organisms based on known activity for non-hydroxylated 4-HB analogues and pathway intermediates, or by similarity to these characterized genes (Table

6). Because some of these candidate enzymes are multifunctional dehydrogenases, they could potentially catalyze both NAD (P) H-dependent reduction of acid (or CoA derivative) to aldehyde and aldehyde to alcohol. Before working on these genes in E. coli, the inventors first checked the result mentioned above using C. acetobutylicum ATCC 824. Cells were cultured in Schaedler broth (Accumedia, Lansing, MI) supplemented with 10 mM 4-HB, in an anaerobic atmosphere consisting of 10% CO₂, 10%

H₂ and 80% N₂ at 30 ° C. Periodically, culture samples were taken, centrifuged and analyzed for broth for BDO by GC-MS as described below. BDO concentrations of 0.1 mM, 0.9 mM and 1.5 mM were detected after 1 day, 2 days and 7 days of incubation, respectively.

No BDO was detected in culture without 4-HB added. To demonstrate that the BDO produced was from glucose, the inventors cultivated the best BDO-producing strain

154

MG1655 Latin^Q pZE 13-0004-0035-0002 pZA33-0034-0036 in a minimum M9 medium supplemented with 4 g / l evenly marked ¹³C-glucose. Cells were induced at an OD of 0.67 using 1 mM IPTG and the sample was taken after 24 hours. Supernatant analysis from culture was carried out by mass spectrometry.

[0164] Subsequently, the activity expressed in E. coli MG1655 lacI host was tested^Q candidate genes for the 4-HB converting pathway to BDO.

Recombinant strains containing each candidate gene expressed on pZA33 were cultured in the presence of 0.25 mM IPTG for four hours at 37 ° C until complete enzyme expression induction. Four hours after induction, the cells were harvested and examined for the presence of ADH and ALD activity as described above. Because 4-HB-CoA and 4-hydroxybutyraldehyde are not commercially available, tests were performed using non-hydroxylated substrates (Table 9). The activity ratio between 4-carbon and 2-carbon substrates for adhE2 (0002) from C. acetobutylicum and adhE (0011) from E. coli was similar to that previously reported in the literature: Atsumi et al., Biochim. Biophys. Acta.

1207:1-11 (1994).

155

Table 9. In vitro enzymatic activities in cell extracts with MG1655 lacI^Qcontaining pZA33 expressing candidate genes for aldehyde dehydrogenase and alcohol dehydrogenase. Activities are expressed in pmol min^-1 mg of cellular protein^-1. ND, not determined.

<td></td><td colspan="2">dehydrogenase aldehyde</td><td colspan="2">dehydrogenase Alcoholic</td>

<td>Gene Substrate</td><td>ButyryloCoA</td><td>Acetyl</td><td>aldehyde butyric</td><td>acetaldehyde</td>

<td> 0002</td><td> 0,0076</td><td> 0,0046</td><td> 0, 0264</td><td> 0,0247</td>

<td>0003n</td><td> 0,0060</td><td> 0,0072</td><td> 0,0080</td><td> 0,0075</td>

<td> 0011</td><td> 0,0069</td><td> 0,0095</td><td> 0, 0265</td><td> 0,0093</td>

<td> 0013</td><td>ND</td><td>ND</td><td> 0,0130</td><td> 0,0142</td>

<td> 0023</td><td> 0,0089</td><td> 0,0137</td><td> 0,0178</td><td> 0,0235</td>

<td> 0025</td><td> 0</td><td> 0,0001</td><td>ND</td><td>ND</td>

<td> 0026</td><td> 0</td><td> 0,0005</td><td> 0,0024</td><td> 0,0008</td>

[0165] For experiments on BDO production, cat2 from Porphyromonas gingivalis W83 (gene 0034) was introduced into pZA33 to convert 4-HB to 4-HB-CoA, while dehydrogenase genes (candidates) were expressed on pZE13. The host strain was MG1655 lacI^Q. Along with the candidates, alcohol dehydrogenase and dehydrogenase

156 aldehyde, the inventors also tested the ability

CoA-dependent succinic semialdehyde dehydrogenases (sucD) to function at this stage, due to substrate similarity. Cells were grown to an OD of about 0.5 in LB medium supplemented with 10 mM 4HB, induced with 1 mM IPTG, culture broth samples were taken after 24 hours and analyzed for the presence of BDO as described below. The best BDO production took place using acetobutylicum, sucD from C. kluyveri gingivalis (Fig. 13). Interestingly, the absolute amount of BDO produced was greater under aerobic conditions; however, this is essentially due to the lower cell density obtained in anaerobic cultures. After normalizing to cellular OD, BDO production per biomass unit is higher under anaerobic conditions (Table 10).

adhE2 from C.

or sucD from P.

157

Table 10. Absolute and normalized concentrations

BDO from cultures of cells expressing adhE2 from C. acetobutylicum, sucD from C. kluyveri or sucD from P. gingivalis (data from experiments 2, 9 and 10 in Fig. 11) as well as for negative control (experiment 1).

<td>Gene</td><td>Conditions</td><td>BDO (μΜ)</td><td>OD (600 nm)</td><td>BDO / OD</td>

<td>pervious</td><td></td><td></td><td></td><td></td>

<td>expression</td><td></td><td></td><td></td><td></td>

<td>no</td><td>aerobic</td><td> 0</td><td> 13,4</td><td> 0</td>

<td>no</td><td>Mikroaerobowe</td><td> 0,5</td><td> 6,7</td><td> 0,09</td>

<td>no</td><td>anaerobic</td><td> 2,2</td><td> 1,26</td><td> 1,75</td>

<td> 0002</td><td>aerobic</td><td> 138,3</td><td> 9,12</td><td> 15,2</td>

<td> 0002</td><td>Mikroaerobowe</td><td> 48,2</td><td> 5,52</td><td> 8,73</td>

<td> 0002</td><td>anaerobic</td><td> 54,7</td><td> 1,35</td><td> 40,5</td>

<td>0008n</td><td>aerobic</td><td> 255,8</td><td> 5,37</td><td> 47,6</td>

<td>0008n</td><td>Mikroaerobowe</td><td> 127,9</td><td> 3,05</td><td> 41,9</td>

<td>0008n</td><td>anaerobic</td><td> 60,8</td><td> 0,62</td><td> 98,1</td>

<td> 0035</td><td>aerobic</td><td> 21,3</td><td> 14,0</td><td> 1,52</td>

<td> 0035</td><td>Mikroaerobowe</td><td> 13,1</td><td> 4,14</td><td> 3,16</td>

<td> 0035</td><td>anaerobic</td><td> 21,3</td><td> 1,06</td><td> 20,1</td>

0166] As discussed in section 2, it may be beneficial to use such a route for converting 4-HB into 4158

HB-CoA, which does not produce acetate as a by-product. To this end, the inventors investigated the use of phosphotransbutyrylase (ptb) and butyrate kinase (bk) from C. acetobutylicum to perform this transformation through steps 10 and 11 in Figure 2. Native ptb / bk operon from C. acetobutylicum (genes 0020 and 0021 ) was cloned and expressed in pZA33. Extracts were taken from the cells containing the resulting construct and tested for the presence of two enzymatic activities as described herein. The specific BK activity was approximately 65 units / mg, while the specific PTB activity was approximately 5 units / mg. One unit of activity is defined as the transformation of 1 μM substrate in 1 minute at room temperature. Finally, the construct was tested for participation in the conversion of 4-HB to BDO. Host strains were transformed with the constructs described, pZA330020-0021 and pZ13-0002, and compared using cat2 in the production of BDO using the aerobic procedure used above (Figure 13). The BK / PTB strain produced 1 mM BDO, compared to 2 mM when using cat2 (Table 11). Interestingly, the results depended on whether the host strain had a deletion in the native adhE gene.

159

Table 11. Absolute and normalized concentrations

BDO from culture of cells expressing adhE2 from C.

acetobutylicum in pZ13 together with the cat2 gene from P. gingivalis (0034) or PTB / BK genes from C. Acetobutylicum on pZA33.

The host strains were MG1655 lacI^Q or MG1655 AadhE lacI^Q.

<td>genes</td><td>Host strain</td><td>BDO (μΜ)</td><td>FROM (600 nm)</td><td>BDO / OD</td>

<td> 0034</td><td>MG1655 Latin^Q</td><td> 0,827</td><td> 19,9</td><td> 0,042</td>

<td> 0020+0021</td><td>MG1655 Latin^Q</td><td> 0,007</td><td> 9,8</td><td> 0,0007</td>

<td> 0034</td><td>MG1655 AadhE lacI^Q</td><td> 2,084</td><td> 12,5</td><td> 0,166</td>

<td> 0020+0021</td><td>MG1655 AadhE lacI^Q</td><td> 0,975</td><td> 18,8</td><td> 0,052</td>

[0167] Preparation of BDO from glucose. The final step in confirming the pathway is the expression of both 4-HB and BDO segments of the pathway in E. coli and demonstration of BDO production in a minimal glucose medium. The new plasmids were constructed so that all required genes fit on two plasmids. Generally, cat1, adhE and sucD genes were expressed from pZE13 and cat2 and 4-HBd were expressed from pZA33. Various combinations of gene sources and gene order were tested against the background of MG1655 lacI^Q. Cells were cultured under anaerobic conditions in M9 minimal medium (6.78 g / l Na₂HPO₄, 3.0 g / l KH₂AFTER₄, 0.5 g / l NaCl, 1.0

160 g / l NH₄Cl, 1 mM MgSO₄, 0.1 mM CaCl₂) supplemented with 20 g / l glucose, 100 mM 3- (Nmorpholine) propanesulfonic acid (MOPS) to increase buffering efficiency, 10 μg / ml thiamine and appropriate antibiotics. Approximately 15 hours after vaccination, 0.25 mM IPTG was added and supernatant samples from the culture were taken for analysis of BDO, 4-HB and succinate 24 and 48 hours after induction. BDO production appears to have shown a dependence on gene order (Table 12).

The highest BDO production, over 0.5 mM, was obtained when cat2 was expressed first, followed by 4-HBd on pZA33 and cat1 followed by P. gingivalis sucD on pZ13. Addition of adhE2 from C. acetobutylicum at the last position on pZE13 led to slight improvements. 415 HB and succinate were also produced in higher concentrations.

161

Table 12. Production of recombinant strains with minimal pathway gene combinations supplemented in mM.

BDO, 4-HB and succinate in

E. coli expressing

BDO, grown in g / L glucose medium. concentrations

<td rowspan="2">A sample</td><td rowspan="2">pZE13</td><td rowspan="2">PZA33</td><td rowspan="2">Induction OD</td><td colspan="4">24 h</td><td colspan="4">48 hours</td>

<td>00600nm</td><td>SU</td><td>4HB</td><td>BDO</td><td>OD 600nm</td><td>su</td><td>4HB</td><td>BDO</td>

<td> 1</td><td>CATL (0004J-sucD (0035)</td><td>4hM (0036) - &lt;at2 (0034)</td><td> 0.92</td><td> 1.29</td><td> 5.44</td><td> 1.37</td><td> 0.240</td><td> 1.24</td><td> 6.42</td><td> 1.49</td><td> 0.280</td>

<td> 2</td><td>CATL (0004J-SucD (0008NJ</td><td>4hbd (0036) -cat2 (0034)</td><td> 0.36</td><td> 1.11</td><td> 6.90</td><td> 1.24</td><td> 0.011</td><td> 1.06</td><td> 7.63</td><td> 1.33</td><td> 0.011</td>

<td> 3</td><td>adhE (0002) -catl (0004) -sucD (0035)</td><td>4hbd (0036) -cat2 (0034)</td><td> 0.20</td><td> 0.44</td><td> 0.34</td><td> 1.84</td><td> 0,050</td><td> 0.60</td><td> 1.93</td><td> 2.67</td><td> 0.119</td>

<td> 4</td><td>CATL (0004) -sucD (0035) -adhE (0002)</td><td>4hbd (0036) -cat2 (0034)</td><td> 1.31</td><td> 1.90</td><td> 9.02</td><td> 0.73</td><td> 0,073</td><td> 1.95</td><td> 9.73</td><td> 0.82</td><td> 0.077</td>

<td> 5</td><td>adhE (0002) -catl (0004) -sucD (0008N)</td><td>4hbd (0036) -cat2 (0034)</td><td> 0.17</td><td> 0.45</td><td> 1.04</td><td> 1.04</td><td> 0,008</td><td> 0.94</td><td> 7.13</td><td> 1.02</td><td> 0.017</td>

<td> 6</td><td>eatl (OOO4) -sucD (0Oa8N | -adhE ({X) O2)</td><td>4hbd (003b | &lt;at2 «X) 34)</td><td> 1.30</td><td> 1.77</td><td> 10.47</td><td> 0.25</td><td> 0 004</td><td> 1.80</td><td> 11.49</td><td> 0.28</td><td> 0.003</td>

<td> 7</td><td>CATL (0004) -sucD (0035)</td><td>cat2 (0034) -4hbd (0036J</td><td> 1.09</td><td> 1.29</td><td> 5.63</td><td> 2.15</td><td> 0,461</td><td> 1.38</td><td> 6.66</td><td> 2.30</td><td> 0.520</td>

<td> 8</td><td>CATL (0004) -sucD (0008N)</td><td>cat2 (0034) -4hbd (0036)</td><td> 1.81</td><td> 2.01</td><td> 11.28</td><td> 0.02</td><td> 0.000</td><td> 2.24</td><td> 11.13</td><td> 0.02</td><td> 0.000</td>

<td> 9</td><td>adhE (0002) -csl1 (0004&gt; -sucD | 003S)</td><td>cat2 | 0034) -) HL&gt; d "x&gt; 36)</td><td> 0.24</td><td> 1.99</td><td> 2.02</td><td> 2.32</td><td> 0.106</td><td> 0.89</td><td> 4.85</td><td> 2.41</td><td> 0.186</td>

<td> 10</td><td>CATL (0004) -sucD (0035) -adhE (0002)</td><td>cat2 (0034) -4hbd (0036)</td><td> 0.98</td><td> 1.17</td><td> 5.30</td><td> 2.08</td><td> 0,569</td><td> 1.33</td><td> 6.15</td><td> 2.14</td><td> 0.640</td>

<td> 11</td><td>adhE &lt;WW2Fcatl {0004&gt; -sucD (0008N)</td><td>cat2 (0034) -4hbd (0036)</td><td> 0.20</td><td> 0.53</td><td> 1.38</td><td> 2.30</td><td> 0,019</td><td> 0.91</td><td> 8.10</td><td> 1.49</td><td> 0.034</td>

<td> 12</td><td>CATL (0004) -SucD (0008N) -adhE (0002)</td><td>cat2 (0G34) -4hbd (0036]</td><td> 2.14</td><td> 2.73</td><td> 12.07</td><td> 0.16</td><td> 0.000</td><td> 3.10</td><td> 11.79</td><td> 0.17</td><td> 0.002</td>

<td> 13</td><td>only vector</td><td>only vector</td><td> 2.11</td><td> 2.62</td><td> 9.03</td><td> 0.01</td><td> 0.000</td><td> 3.00</td><td> 12.05</td><td> 0.01</td><td> 0.000</td>

[0168] Analysis of BDO, 4-HB and succinate by GC10 MS. BDO, 4-HB and succinate in fermentation samples and from cell cultures were derivatized by silylation and quantified by GC-MS using methods adapted from literature reports ((Simonov et al., J. Anal Chem, 59: 965-971 (2004)) .

The developed method showed good sensitivity up to 1 μΜ, linearity up to at least 25 mM, as well as excellent selectivity and reproducibility.

[0169] Sample preparation was carried out as follows: 100 μΐ filtered (0.2 μm or 0.45 μη syringe filters) samples, e.g. fermentation broth, cell culture or solutions

162 standards, dried in a Speed ​​Vac concentrator

Concentrator (Savant SVC-100H) for approximately 1 hour at ambient temperature, followed by the addition of 20 μl of a 10 mM cyclohexanol solution as an internal standard in dimethylformamide. The mixtures were shaken on a Vortex shaker and sonicated in a water bath (Branson 3510) for 15 minutes to ensure homogeneity. 100 μl of silylation derivatization reagent, N, O-bis (trimethylsilyl) trifluoroacetimide (BSTFA) with 1% trimethylchlorosilane was added and the mixture was incubated at 70 ° C for 30 minutes. Derivatized samples were centrifuged for 5 minutes and clear solutions were directly injected into the GC-MS apparatus. All chemicals and reagents were from Sigma-Aldrich, except BDO, which was purchased from JTBaker.

[0170] GC-MS was performed on an Agilent 6890N gas chromatograph connected to a 5973N Selective Mass Detector (MSD) operating in electron beam ionization (EI) mode which was used for analysis. A DB-5MS capillary column (J&amp;W Scientific, Agilent Technologies) was used, internal diameter 30 mx 0.25 mm, film thickness x 0.25 μm. The gas chromatograph was operated in split-stream injection mode by introducing 1 μl of sample at a ratio

163 20: 1 split. The sample dispenser temperature was 250 ° C. Helium was used as the carrier gas and the flow rate was maintained at 1.0 ml / minute. The temperature gradient program has been optimized to ensure good separation of the analytes of interest and minimal matrix interference. The temperature in the thermostat was initially held at 80 ° C for 1 minute, then quickly raised to 120 ° C at 2 ° C / minute, then quickly raised to 320 ° C at 100 ° C / minute and finally held for 6 minutes at 320 ° C. The connection between MS and the transmission line was maintained at 280 ° C. Data acquisition was performed using MS "lowmass" tuning settings and scanning for a mass range of 30-400 m / z. The total analysis time was 29 minutes including 3 minutes solvent delay. Retention times were 5.2; 10.5;

14.0 and 18.2 minutes for cyclohexanol derivatized with BSTFA, BDO, 4-HB and succinate, respectively. The following specific mass fragments (chromatograms of extracted ions) were selected for quantitative analysis: m / z 157 for the internal standard, cyclohexanol, 116 for BDO and 147 for both 4-HB and succinate. Standard curves were constructed using analyte solutions

164 in a suitable medium for cell culture or fermentation to match the sample matrix as accurately as possible. GC-MS data was processed using Environmental Data Analysis ChemStation (Agilent Technologies).

[0171] The results showed that most of the 4-HB and BDO produced were labeled ¹³C (Fig. 14, on the right). Mass spectra from parallel culture with unlabelled glucose are shown for comparison (Figure 14; left). It should be noted that visible peaks are peaks for fragments of the derivatized molecule containing different numbers of carbon atoms from the metabolite. The derivatization reagent also adds some carbon and silicon atoms, which occur naturally marking degradation, and therefore the results are not strictly quantitative.

[0172] Preparation of BDO with 4-HB using alternative pathways. Various alternative pathways have also been studied for the production of BDO. This includes the use of the native SucCD E. coli enzyme to convert succinate to succinyl-CoA (table 13, lines 2-3), the use of α-ketoglutarate decarboxylase in the α-ketoglutarate pathway (table 13, line 4), and the use of PTB / BK as alternative agents production of CoA-derivative 4HB (Table 13,

165 line 1). Strains containing plasmids expressing the genes indicated in Table 13 were constructed which include these variants. The results indicate that in all cases 4-HB and BDO were produced (Table 13).

Table 13. Production of BDO, 4-HB and succinate in recombinant E. coli strains with genes for various BDO pathway variants, grown under anaerobic conditions in minimal medium supplemented with 20 g / L glucose and collected 24 hours after induction with 0.1 mM IPTG. The concentrations are given in mM.

<td>Genes on pZE13</td><td>Genes on pZA33</td><td>succinate</td><td>4-HB</td><td>BDO</td>

<td> 0002+0004+0035</td><td>0020n-0021n-0036</td><td> 0,336</td><td> 2,91</td><td> 0,230</td>

<td> 0038+0035</td><td> 0034-0036</td><td> 0,814</td><td> 2,81</td><td> 0,126</td>

<td> 0038+0035</td><td> 0036-0034</td><td> 0,741</td><td> 2,57</td><td> 0,114</td>

<td> 0035+0032</td><td> 0034-0036</td><td> 5,01</td><td> 0,538</td><td> 0,154</td>

Example V

Biosynthesis of 4-hydroxybutanoic acid, γ-butyrolactone and 1,4-butanediol [0173] This example describes the biosynthetic production of 4-hydroxybutanoic acid, γ-butyrolactone

166 and 1,4-butanediol using fermentation and other biological processes.

[0174] Methods of integrating the 4-HB fermentation step with the total process of producing purified GBL,

1,4-butanediol (BDO) and tetrahydrofuran (THF) are described below. Because 4-HB and GBL are in equilibrium, the fermentation broth will contain both compounds. At low pH, this balance tilts in favor of GBL. Thus, fermentation can be carried out at a pH of 7.5 or less, generally a pH of 5.5 or less. After biomass removal, the product stream enters a separation step in which GBL is removed and the remaining 4-HB enriched stream is recycled. Finally, GBL is distilled to remove any impurities. The process occurs in one of three ways: 1) fed-batch fermentation and periodic separation; 2) fed-batch fermentation and continuous separation; 3) continuous fermentation and continuous separation. The first two of these types are schematically shown in Figure 15. The integrated fermentation procedures described below also apply to the BDO producing cells of the invention for the biosynthesis of BDO and subsequent BDO family products.

[0175] Fermentation protocol for the production of 4HB / GBL (batch): the producing organism is cultured in

167 10 l bioreactor flushed with mixture N₂/WHAT₂, using 5 l of broth containing 5 g / l of potassium phosphate, 2.5 g / l of ammonium chloride, 0.5 g / l of magnesium sulphate and 30 g / l of corn soak extract and glucose at an initial concentration of 20 g / l.

As cell culture increases and its glucose consumption, an additional 70% glucose is introduced into the bioreactor at a rate approximately offsetting glucose consumption. The bioreactor temperature is maintained at 30 degrees C. Growth continues for approximately 24 hours until a 4-HB concentration is obtained in the 20-200 g / L range, with a cell density in the range between 5 and 10 g / L. PH values ​​are not controlled and typically will decrease to pH 3-6 at the end of the cycle. At the end of the culturing period, the fermenter contents are passed through a cell separation unit (e.g. centrifuge) to remove cells and cell debris and the fermentation broth is transferred to the product separation unit. Separation of 4-HB and / or GBL will be carried out by common separation procedures used in the art to separate organic products from diluted aqueous solutions, such as liquid / liquid extraction using a water-immiscible organic solvent

168 (e.g. toluene) to provide an organic 4HB / GBL solution. The resulting solution is then subjected to conventional distillation methods to remove and recycle the organic solvent to obtain GBL (boiling point 204-205 ° C), which is isolated as a purified liquid.

[0176] Fermentation protocol to produce 4HB / GBL (completely continuous): the producing organism is first cultured in a batch mode using the device and medium as described above, except that the initial glucose concentration is 30-50 g / L . After depletion of glucose, a feed medium of the same composition is supplied continuously at a rate of 0.5 l / hour to 1 l / hour and the liquid is withdrawn at the same rate. The concentration of 4-HB in the bioreactor remains constant at 30-40 g / l and the cell density remains constant in the range of 3-5 g / l. The temperature is maintained at 30 degrees C and the pH is maintained at 4.5 using concentrated NaOH and HCl as required. The bioreactor is operated continuously for one month, with samples taken daily to ensure a constant 4-HB concentration. In continuous mode, the fermenter contents are constantly removed as the new feed medium is supplied. Exit stream containing

169 cells, medium and 4-HB and / or GBL products are then subjected to a continuous product separation procedure, with or without removal of cells and cellular debris, and will be carried out by conventional continuous separation methods used in the art to separate organic products from dilute aqueous solutions, such as continuous liquid / liquid extraction using a water-immiscible organic solvent (e.g. toluene) to form an organic 4-HB / GBL solution. The resulting solution is then subjected to conventional continuous distillation methods to remove and recycle the organic solvent and obtain GBL (boiling point 204-205 ° C), which is isolated as a purified liquid.

[0177] GBL reduction protocol: after isolation and purification of GBL as described above, it will then be subjected to reduction protocols, such as those well known in the art (references cited) to produce 1,4-butanediol or tetrahydrofuran (THF) or their mixture. It is well known that heterogeneous or homogeneous hydrogenation catalysts combined with GBL in a hydrogen atmosphere under pressure give the products in the form of 1,4-butanediol or tetrahydrofuran (THF) or mixtures thereof. It is important to,

170 to note that the 4-HB / GBL product mixture, which is separated from the fermentation broth as described above, can be subjected directly, prior to isolation and purification of GBL, to the same reduction protocols to give products in the form of 1,4-butanediol or tetrahydrofuran or mixtures thereof. The resulting products, 1,4-butanediol and THF are then isolated and purified by methods well known in the art.

Fermentation and hydrogenation protocol for the direct production of BDO or THF (batch):

[0178] Cells were cultured in a 10 L bioreactor flushed with N mixture₂/WHAT₂, using 5 l of broth containing 5 g / l of potassium phosphate, 2.5 g / l of ammonium chloride, 0.5 g / l of magnesium sulphate and 30 g / l of corn soak extract and glucose at an initial concentration of 20 g / l. As cell culture increases and its glucose consumption, an additional 70% glucose is introduced into the bioreactor at a rate approximately offsetting glucose consumption. The bioreactor temperature is maintained at 30 degrees C. Growth continues for approximately 24 hours until a 4-HB concentration is obtained in the 20-200 g / L range, with a cell density in the range between 5 and 10 g / L. PH values ​​are not controlled and typically will decrease to pH 3-6 at the end of the cycle. After

171 at the end of the culture period, the fermenter contents are passed through a cell separation unit (e.g. centrifuge) to remove cells and cell debris and the fermentation broth is transferred to a reducing unit (e.g. hydrogenation vessel) in which the 4-HB / GBL mixture is directly reduced to 1,4-butanediol or THF or a mixture thereof. After completing the reduction procedure, the contents of the reactor are transferred to a product separation unit.

Isolation of 1,4-butanediol carried out by conventional and / or THF procedures will be used in the art to separate organic products from dilute aqueous solutions, such as liquid / liquid extraction using a water-immiscible organic solvent (e.g. toluene) to produce organic 1,4-butanediol solution and / or THF. The resulting solution is then subjected to conventional distillation methods to remove and recycle the organic solvent to obtain 1,4-butanediol and / or THF, which are isolated as purified liquids.

[0179] Fermentation and hydrogenation protocol to directly produce BDO or THF (completely continuous): cells are first grown in batch mode using the equipment and medium as described

172 above, except that the initial glucose concentration is 30-50 g / L. After glucose depletion, a feed medium of the same composition is supplied continuously at a rate between 0.5 L / hour and 1 L / hour and the liquid is withdrawn at the same rate. The concentration of 4-HB in the bioreactor remains constant at 30-40 g / l and the cell density remains constant in the range of 3-5 g / l. The temperature is maintained at 30 degrees C and the pH is maintained at 4.5 using concentrated NaOH and HCl as required. The bioreactor is operated continuously for one month, with samples taken daily to ensure a constant 4-HB concentration. In continuous mode, the fermenter contents are constantly removed as the new feed medium is supplied. The leaving stream containing cells, medium and 4-HB and / or GBL products is then passed through a cell separation unit (e.g. centrifuge) to remove cells and cell debris and the fermentation broth is transferred to a continuous reduction unit (e.g. hydrogenation) in which the 4-HB / GBL mixture is directly reduced to either 1,4-butanediol or a mixture thereof. After completing the reduction procedure, the contents of the reactor are transferred units for continuous separation of products. Isolation of 1,4-butanediol and / or

173

THF will be carried out by conventional continuous separation procedures used in the art to separate organic products from dilute aqueous solutions, such as liquid / liquid extraction using a water-immiscible organic solvent (e.g. toluene) to produce an organic solution of 1,4-butanediol and / or THF. The resulting solution is then subjected to conventional continuous distillation methods to remove and recycle the organic solvent to obtain 1,4-butanediol and / or THF, which is isolated as purified liquids.

[0180] Fermentation protocol for direct BDO production (batch): the producing organism is cultured in a 10 L bioreactor flushed with N mixture₂/WHAT₂, using 5 l of broth containing 5 g / l of potassium phosphate, 2.5 g / l of ammonium chloride, 0.5 g / l of magnesium sulphate and 30 g / l of corn soak extract and glucose at an initial concentration of 20 g / l. As cell culture increases and its glucose consumption, an additional 70% glucose is introduced into the bioreactor at a rate approximately offsetting glucose consumption. The bioreactor temperature is maintained at 30 degrees C.

Growth continues for approximately 24 hours,

174 up to a BDO concentration of 20-200 g / L, with a cell density between 5 and 10 g / L. At the end of the culturing period, the fermenter contents are passed through a cell separation unit (e.g. centrifuge) to remove cells and cell debris and the fermentation broth is transferred to the product separation unit.

Isolation of BDO will be carried out by common separation procedures used in the art to separate organic products from dilute aqueous solutions, such as liquid / liquid extraction using a water-immiscible organic solvent (e.g. toluene) to produce an organic BDO solution. The resulting solution is then subjected to conventional distillation methods to remove and recycle the organic solvent to give BDO (boiling point 228-229 ° C), which is isolated as a purified liquid.

[0181] Fermentation protocol for direct BDO production (completely continuous): the producing organism is first cultured in a batch mode using the equipment and medium as described above, except that the initial glucose concentration is 30-50 g / L. After glucose depletion, the medium

175 feeds with the same composition are supplied continuously at a rate of 0.5 l / hour to 1 l / hour and the liquid is withdrawn at the same rate.

The BDO concentration in the bioreactor remains constant

30-40 g / l, and the cell density remains constant in the range of 3-5 g / l. The temperature is maintained at 30 degrees C and the pH is maintained at 4.5 using concentrated NaOH and HCl as required. The bioreactor is operated continuously for one month, with samples taken daily to ensure a constant BDO concentration. In continuous mode, the fermenter contents are constantly removed as the new feed medium is supplied. The leaving stream containing the cells, substrate and BDO product is then subjected to a continuous product separation procedure, with or without cell removal and will be carried out by conventional continuous separation methods used in the art to separate organic products from dilute aqueous solutions, such as continuous extraction in a system liquid / liquid using a water-immiscible organic solvent (e.g. toluene) to form an organic BDO solution. The resulting solution is then subjected to conventional continuous distillation methods to remove and recycle the solvent

176 organic and obtaining BDO (boiling point 228229 ° C), which is isolated as a purified liquid (mpt 20 ° C).

[0182] Although the invention has been described with reference to the disclosed solutions, those skilled in the art will readily realize that the specific examples and studies set out in detail above merely illustrate the invention. It should be understood that various modifications can be made. Accordingly, the invention is limited only by the following claims.

Genomatica, Inc.

Proxy:

177