Glucopyranosyloxy benzylbenzene derivatives, medicinal compositions containing the same and intermediates for the preparation of the derivatives

Description of the invention

The present invention relates to a glucopyranosyloxybenzylbenzene derivative and a pharmaceutically acceptable salt thereof, a pharmaceutical composition containing such derivative, the use of the derivative for the preparation of a pharmaceutical composition, and a benzylphenol derivative.

Diabetes mellitus is one of the diseases associated with lifestyle, change in eating habits and lack of exercise. Thus, diet and exercise are prescribed for diabetic patients. Moreover, when sufficient control and continuous exercise are difficult, drug therapy is also performed concomitantly. Currently, biguanides, sulfonylureas and agents for reducing insulin resistance are used as anti-diabetes agents. However, biguanides and sulfonylureas have occasional deleterious effects such as lactic acidosis and hypoglycemia, respectively. Adverse effects such as ascites are occasionally observed when agents to reduce insulin resistance are used, and they also contribute to obesity. Thus, in order to overcome these problems, it is desirable to develop anti-diabetes agents with a novel mechanism.

In recent years, the development of new types of anti-diabetes agents has progressed that promote urinary glucose excretion and lower blood glucose levels by preventing excessive glucose reabsorption in the kidney (J. Clin. Invest., Vol. 79, pp. 1510-1515 (1987)). . Moreover, it has been described that SGLT2 (Na⁺/ glucose) is present in the S1 segment of the renal tubule and is involved mainly in glomerular filtered glucose reabsorption (J. Clin. Invest., vol. 93, pp. 397-404 (1994)). Accordingly, inhibiting human SGLT2 activity prevents excess glucose from being reabsorbed in the kidney, in turn promoting excess glucose excretion through the urine, and normalizing blood glucose levels. Thus, it is desirable to rapidly develop anti-diabetes agents that have potent inhibitory activity in human SGLT2 and have a novel mechanism. Moreover, since such agents promote the excretion of excess glucose through the urine and hence the accumulation of glucose in the body decreases, they may also possibly have an obesity preventing effect.

The present inventors have conducted serious research to find compounds having human SGLT2 inhibitory activity. As a result, it has been found that the glucopyranosyloxybenzylbenzene derivatives represented by the following general formula (I) exhibit an excellent inhibitory activity on human SGLT2 as mentioned below, thereby forming the basis of the present invention.

The present invention provides glucopyranosyloxybenzylbenzene derivatives and pharmaceutically acceptable salts thereof which exhibit in vivo human S6LT2 inhibitory activity and exert a hypoglycemic effect by excreting excess glucose in the urine by preventing the reabsorption of such glucose in the kidney, pharmaceutical compositions containing these compounds, their use in the preparation of a pharmaceutical composition and their intermediates.

Thus, the subject of the invention is a glucopyranosyloxybenzylbenzene derivative having the general formula:

<img file="PL205605B1_D0001.tif" />

in which R.¹ is hydrogen or hydroxy (1-6 carbon alkyl) and R³represents an alkyl group of 1-6 carbon atoms, an alkoxy group of 1-6 carbon atoms, an alkylthio group of 1-6 carbon atoms, a hydroxy group (alkyl of 1-6 carbon atoms), a hydroxy group (alkoxy of 1-6 carbon atoms) ), hydroxy (alkylthio with 1-6 carbon atoms), alkyl group with 1-6 carbon atoms substituted with alkoxy group with 1-6 carbon atoms, an alkoxy group of 1-6 carbon atoms substituted with an alkoxy group of 1-6 carbon atoms or an alkylthio group of 1-6 carbon atoms substituted with an alkoxy group of 1-6 carbon atoms, or a pharmaceutically acceptable salt thereof.

Preferably, the glucopyranosyloxybenzylbenzene derivative is a compound of the general formula:

PL 205 605 B1

<img file="PL205605B1_D0002.tif" />

in which R.¹ is hydrogen or hydroxy (1-6 carbon alkyl) and R³is an alkyl group of 1-6 carbon atoms, an alkoxy group of 1-6 carbon atoms or a hydroxy group (alkyl of 1-6 carbon atoms), or a pharmaceutically acceptable salt thereof.

The invention also relates to a pharmaceutical composition which comprises the above-defined glucopyranosyloxybenzylbenzene derivative or a pharmaceutically acceptable salt thereof as an active ingredient, and a pharmaceutically acceptable carrier.

Another object of the invention is the use of a glucopyranosyloxybenzylbenzene derivative or a pharmaceutically acceptable salt thereof for the preparation of a pharmaceutical composition for the prevention or treatment of a hyperglycemic disease, wherein the hyperglycemic disease is diabetes or diabetic complications or obesity.

The next subject of the invention is a benzylphenol derivative of the general formula

<img file="PL205605B1_D0003.tif" />

in which R.¹¹ is hydrogen or a protected hydroxy (1-6 carbon alkyl) group and R¹² is an alkyl group of 1-6 carbon atoms, an alkoxy group of 1-6 carbon atoms, an alkylthio group of 1-6 carbon atoms, a protected hydroxy group (alkyl of 1-6 carbon atoms), a protected hydroxy group (alkoxy of 1-6 carbon atoms) carbon atoms), protected hydroxy (alkylthio with 1-6 carbon atoms), alkyl group with 1-6 carbon atoms substituted with alkoxy group with 1-6 carbon atoms, an alkoxy group of 1-6 carbon atoms substituted with an alkoxy group of 1-6 carbon atoms or an alkylthio group of 1-6 carbon atoms substituted with an alkoxy group of 1-6 carbon atoms; provided that R.¹² does not represent a methyl group, ethyl group, isopropyl group, t-butyl group, or methoxy group when R¹¹ is a hydrogen atom, or a salt thereof.

In the present specification, the term alkyl group with 1-6 carbon atoms means a straight chain or branched alkyl group with 1-6 carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s -butyl group, t-butyl group, pentyl group, isopentyl group, neopentyl group, t-pentyl group, hexyl group or the like; the term alkoxy group with 1-6 carbon atoms means a straight-chain or branched alkoxy group with 1-6 carbon atoms, such as methoxy group, ethoxy group, propoxy group, isopropoxy group, butoxy group, isobutoxy group, s-butoxy group, t- butoxy group, pentyloxy group, isopentyloxy group, neopentyloxy group, t-pentyloxy group, hexyloxy group or the like; and the term alkylthio group with 1-6 carbon atoms means a straight chain or branched alkylthio group with 1-6 carbon atoms such as methylthio, ethylthio, propylthio, isopropylthio, butylthio, isobutylthio, s-butylthio, t -butylthio group, pentylthio group, isopentylthio group, neopentylthio group, t-pentylthio group, hexylthio group or the like. The term hydroxy (alkyl 1-6 carbon atoms) means a straight or branched hydroxyalkyl group with 1-6 carbon atoms such as hydroxymethyl, 2-hydroxyethyl, 1-hydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 1-hydroxypropyl group, group

2-hydroxy-1-methylethyl group, 4-hydroxybutyl group, 3-hydroxybutyl group, 2-hydroxybutyl group, 1-hydroxybutyl group, 5-hydroxypentyl group, 4-hydroxypentyl group,

3-hydroxypentyl group, 2-hydroxypentyl group, 1-hydroxypentyl group, 6-hydroxyhexyl group, 5-hydroxyhexyl group, 4-hydroxyhexyl group, 3-hydroxyhexyl group, 2-hydroxyhexyl group, 1-hydroxyhexyl group or the like; the term hydroxy (alkyl4

(Xyl group with 1-6 carbon atoms) means a straight-chain or branched hydroxyalkoxy group with 1-6 carbon atoms, such as 2-hydroxyethoxy group, 3-hydroxypropoxy group, 2-hydroxypropoxy group, 2-hydroxy-1- methylethoxy group, 4-hydroxybutoxy group, 3-hydroxybutoxy group, 2-hydroxybutoxy group, 5-hydroxypentyloxy group, 4-hydroxypentyloxy group, 3-hydroxypentyloxy group, 2-hydroxypentyloxy group, 6-hydroxyhexyloxy group, 5-hydroxyhexyloxy group, 4-hydroxyhexyloxy group, 3-hydroxyhexyloxy group, 2-hydroxyhexyloxy group or the like; and the term hydroxy (alkylthio with 1-6 carbon atoms) means a straight chain or branched hydroxyalkylthio group with 1-6 carbon atoms such as hydroxymethylthio, 2-hydroxyethylthio, 1-hydroxyethylthio, 3-hydroxypropylthio, 2-hydroxypropylthio, 1-hydroxypropylthio group, 2-hydroxy-1-methylethylthio group, 4-hydroxybutylthio group, 3-hydroxybutylthio group, 2-hydroxybutylthio group, 1-hydroxybutylthio group, 5-hydroxypentylthio group, 4-hydroxypentylthio group, 3-hydroxypentylthio group, 2-hydroxypentylthio group, 1-hydroxypentylthio group, 6-hydroxyhexylthio group, 5-hydroxyhexylthio group, 4-hydroxyhexylthio group, 3-hydroxyhexylthio group, 2-hydroxyhexylthio group, 2-hydroxyhexylthio group the like. The term alkoxy group of 1-6 carbon atoms (alkyl of 1-6 carbon atoms) means the above hydroxy (alkyl of 1-6 carbon atoms) O-alkylated with the above alkyl group of 1-6 carbon atoms; the term alkoxy group of 1-6 carbon atoms (substituted alkoxy of 1-6 carbon atoms) means the above hydroxy (alkyloxy group of 1-6 carbon atoms) O-alkylated with the above alkyl group of 1-6 carbon atoms; and the term alkoxy group of 1-6 carbon atoms (alkylthio of 1-6 carbon atoms) means the above hydroxy group (alkylthio of 1-6 carbon atoms) O-alkylated with the above alkyl group of 1-6 carbon atoms).

The term hydroxyl protecting group means a hydroxyl protecting group that is used in general organic reactions, such as a benzyl group, a methoxymethyl group, an acetyl group or the like.

In the substituent R.¹, hydrogen and hydroxyalkyl groups with 1-3 carbon atoms are preferred. In the substituent R.², lower alkyl, lower alkoxy and hydroxy (lower alkyl) are preferred, and 1-4 carbon atoms alkyl, 1-3 carbon alkoxy, and 1-3 carbon hydroxyalkyl groups are more preferable.

For example, compounds of general formula (I) according to the invention can be prepared by using a benzylphenol derivative of general formula (II) according to the invention according to the following procedure:

<img file="PL205605B1_D0004.tif" />

represents a lower alkyl group, a lower alkoxy group, a lower alkylthio group, a protected hydroxy (lower alkyl) group, a protected hydroxy (lower alkoxy) group, a protected group

Hydroxy (lower alkylthio), lower alkoxy substituted (lower alkyl), lower alkoxy substituted (lower alkoxy) or lower alkoxy substituted (lower alkylthio), X is a leaving group such as trichloroacetoimidoyloxy, acetoxy , bromine or fluorine; and R.¹ and r² have the meanings given above.

Process 1

A glucoside of general formula (IV) can be prepared by subjecting a benzylphenol derivative of general formula (II) or a salt thereof to glucosidation with a glycosyl donor of general formula (III) such as 2,3,4,6-tetra-O-acetyl-1. -O-trichloroacetoimidoyl-αD-glucopyranose, 1,2,3,4,6-penta-O-acetyl-eD-9-glucopyranose, 2,3,4,6-tetra-O-acetyl-αD-glucopyranosyl bromide and 2,3,4,6-tetra-O-acetyl-eD-glucopyranosyl fluoride in the presence of an activating reagent, such as boron trifluoride diethyl ether complex, silver trifluoromethanesulfonate, tin (IV) chloride or trimethylsilyl triflate in an inert solvent. As the solvent, dichloromethane, toluene, acetonitrile, nitromethane, ethyl acetate, diethyl ether, chloroform, mixed solvents thereof, and the like can be proposed. The reaction temperature is usually from -30 ° C to reflux temperature, and the reaction time is usually from 10 minutes to 1 day, varying based on a used starting material, solvent and reaction temperature.

Process 2

Compound (I) of the invention can be prepared by subjecting a glucoside of general formula (IV) to basic hydrolysis to remove hydroxyl protecting groups. Water, methanol, ethanol, tetrahydrofuran, mixed solvent thereof and the like can be proposed as the solvent, and sodium hydroxide, sodium methoxide, sodium ethoxide or the like can be used as basic substances. The operating temperature is usually from 0 ° C to the reflux temperature, and the operating time is usually from 30 minutes to 6 hours depending on the substrate, solvent and operating temperature used. This operation may be conveniently carried out by altering or adding another procedure in the usual manner depending on the hydroxyl protecting group used.

For example, compounds of general formula (II) according to the invention and their salts which are used as starting materials in the above production process can be prepared according to the following procedure:

<img file="PL205605B1_D0005.tif" />

Removing protecting group)

Reduction (followed by reduction and introduction of a protecting group when R.⁴ denotes a lower alkoxycarbonyl group)

Catalytic hydrogenation (Occasional removal or insertion of a protecting group) (followed by reduction and introduction of a protecting group when R⁴ denotes a lower alkoxycarbonyl group)

<img file="PL205605B1_D0006.tif" />

Wherein M is hydrogen or a hydroxyl protecting group; R⁴ is hydrogen, protected hydroxy (lower alkyl) or lower alkoxycarbonyl; one of Y and Z is MgBr, MgCl, Mgl or lithium, while the other is a formyl group; and R.¹¹and r¹² have the meanings given above.

Process A

The compound of general formula (VII) can be prepared by condensing a benzaldehyde derivative of general formula (V) with a Grignard reagent or lithium reagent of general formula (VI), or by condensing a Grignard reagent or lithium reagent represented by the above general formula (V) with a benzaldehyde derivative of general formula (V) formula (VI) in an inert solvent. As a solvent, tetrahydrofuran, diethyl ether, mixed solvent thereof, and the like can be used. The reaction temperature is usually from -78 ° C to reflux temperature, and the reaction time is usually from 10 minutes to 1 day, varying based on a used starting material, solvent and reaction temperature.

Process B

A compound of general formula (VIII) can be prepared by subjecting a compound of general formula (VII) to oxidation using a Dess-Martin reagent in an inert solvent. As a solvent, dichloromethane, chloroform, acetonitrile, mixed solvent thereof, and the like can be used. The reaction temperature is usually from 0 ° C to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying depending on a used starting material, solvent and reaction temperature.

Process C

A compound of general formula (II) can be prepared by removing the protecting group M of a compound of general formula (VIII), (1) condensing the resulting compound with methyl chloroformate in the presence of a base such as triethylamine, diisopropylethylamine or N, N-dimethylaminopyridine in an inert solvent, and (2) subjecting the resulting carbonate derivative to reduction with a reducing agent such as sodium borohydride. As a solvent for the reaction (1), tetrahydrofuran, dichloromethane, acetonitrile, ethyl acetate, diethyl ether, mixed solvent thereof and the like can be used in the reaction. The reaction temperature is usually from 0 ° C to reflux temperature, and the reaction time is usually from 30 minutes to 1 day, varying based on a used starting material, solvent and reaction temperature. As a solvent, a mixed solvent of tetrahydrofuran and water and the like can be used in the reaction (2). The reaction temperature is usually from 0 ° C to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature. In the event that R.⁴ represents a lower alkoxycarbonyl group, the compounds of general formula (II) according to the invention can be converted by reducing the group to a hydroxymethyl group using a reducing agent such as lithium aluminum hydride in an inert solvent and protecting the hydroxyl group in the usual manner. As the reduction solvent, diethyl ether, tetrahydrofuran, mixed solvent thereof and the like can be used. The reaction temperature is usually from 0 ° C to reflux temperature, and the reaction time is usually from 10 minutes to 1 day, varying depending on a used starting material, solvent and reaction temperature. The compound of general formula (II) according to the invention can be converted into a salt thereof, such as a sodium salt or a potassium salt, in the usual manner.

Process D

A compound of general formula (II) of the invention can be prepared by subjecting a compound of general formula (VII) to catalytic hydrogenation using a palladium catalyst such as palladium-carbon powder in the presence or absence of an acid such as hydrochloric acid in an inert solvent, and removing or introducing a protecting group in the usual manner as needed. As a solvent in the catalytic hydrogenation, methanol, ethanol, tetrahydrofuran, ethyl acetate, acetic acid, isopropanol, a mixed solvent thereof and the like can be used. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 30 minutes to 1 day, varying based on a used starting material, solvent and reaction temperature. In the case where it is a lower alkoxycarbonyl group, compounds of general formula (II) of the invention can be converted by reducing the group to a hydroxymethyl group using a reducing agent such as lithium aluminum hydride in an inert solvent and protecting the hydroxyl group in the usual manner. As the reduction solvent, diethyl ether, tetrahydrofuran, mixed solvent thereof and the like can be used. The reaction temperature is usually from 0 ° C to reflux temperature, and the reaction time is usually from 10 minutes to 1 day, varying based on a used starting material, solvent and reaction temperature. The compound of general formula (II) according to the invention can be converted into a salt thereof, such as a sodium salt or a potassium salt, in an ordinary manner.

PL 205 605 B1

The compounds of the invention obtained by the above production process can be isolated and purified by conventional isolation methods such as fractional recrystallization, purification by chromatography, solvent extraction, and solid phase extraction.

The glucopyranosyloxybenzylbenzene derivatives of the general formula (I) according to the invention can be converted into their pharmaceutically acceptable salts in the usual manner. Examples of such salts include inorganic base salts such as a sodium salt or a potassium salt.

The compounds of general formula (I) according to the invention include their hydrates and their solvates with pharmaceutically acceptable solvents such as ethanol.

The compounds of general formula (I) of the invention and their pharmaceutically acceptable salts have excellent human SGLT2 inhibitory activity and are extremely useful as agents for the prevention or treatment of diabetes mellitus, diabetic complications, obesity or the like. For example, in a further test for inhibitory activity against human SGLT2, compounds of the invention exerted potent inhibitory activity against human SGLT2.

When the pharmaceutical compositions of the invention are used in the practice of therapy, different dosage forms are used depending on their uses. As examples of dosage forms, mention may be made of powders, granules, fine granules, dry syrups, tablets, capsules, injections, solutions, ointments, suppositories, poultices and the like that are administered orally or parenterally.

Such pharmaceutical compositions can be prepared by mixing or diluting and dissolving a suitable pharmaceutical additive such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonizing agents, antiseptics, wetting agents, emulsifying agents, dispersing agents, stabilizing agents, adjuvants and adjuvants. dissolving and the like, and composing the mixture according to a conventional method.

When the pharmaceutical compositions according to the invention are used in the practice of therapy, doses of a compound of general formula (I) or a pharmaceutically acceptable salt thereof according to the invention as active ingredient are taken as an active ingredient, respectively, depending on the age, sex, body weight and degree of symptoms and treatment of each patient. which is approximately in the range of 0.1 to 1000 mg / day per adult human for oral administration and approximately in the range of 0.01 to 300 mg / day per adult human for parenteral administration, and the daily dose can be divided into one to three doses per day. several servings a day and serve appropriately.

The best way to carry out the invention

The present invention is further illustrated in more detail by the following Reference Examples, Examples and Test Examples. However, the present invention is not limited thereto.

Reference example 1

4- (3-benzyloxypropyl) bromobenzene

A suspension of sodium hydride (60%, 0.97 g), 3- (4-bromophenyl) -1-propanol (1.0 g) and benzyl bromide (0.69 ml) in benzene (24 ml) was stirred for 7 hours under with a reflux condenser. After cooling to ambient temperature, a saturated aqueous ammonium chloride solution (50 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (100 mL). The organic layer was washed with water (40 ml) and brine (40 ml), and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 20/1) to obtain 4- (3-benzyloxypropyl) bromobenzene (1.4 g).

¹H NMR (CDCl3) δ ppm:

1.85-2.00 (2H, m), 2.60-2.75 (2H, m), 3.47 (2H, t, J = 6.2Hz), 4.50 (2H, s) , 7.00-7.10 (2H, m), 7.20-7.45 (7H, m)

Reference example 2

Methyl 4- (4-ethylbenzyl) -3-hydroxybenzoate

To a solution of 1-bromo-4-ethylbenzene (0.41 ml) in tetrahydrofuran (15 ml) was added 1.45 mol / l n-pentane t-butyllithium solution (2.3 ml) under argon at -78 ° C . After the mixture was stirred at -78 ° C for 10 minutes, a solution of methyl 4-formyl-3-hydroxybenzoate (0.18 g) in tetrahydrofuran (5 ml) was added to the reaction mixture. After the mixture was stirred with ice-cooling for 45 minutes, a saturated aqueous ammonium chloride solution and water were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 3/1) to give a diphenylmethanol compound (0.27 g). The obtained relationship

Diphenylmethanol (0.27 g) was dissolved in methanol (5 mL), and concentrated hydrochloric acid (0.08 mL) and 10% palladium-carbon powder (54 mg) were added to the solution. After the mixture was stirred under a hydrogen atmosphere at room temperature for 18 hours, the catalyst was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate-3/1) to give methyl 4- (4-ethylbenzyl) -3-hydroxybenzoate (0.20 g).

¹H-NMR (CDCl3) δ ppm:

1.22 (3H, t, J = 7.6 Hz), 2.62 (2H, q, J = 7.6 Hz), 3.89 (3H, s), 4.00 (2H, s), 5.01 (1H, s), 7.05-7.25 (5H, m), 7.47 (1H, d, J = 1.6Hz), 7.56 (1H, dd, J = 1, 6, 7.8Hz)

Reference example 3

Methyl 3-hydroxy-4- (4-propoxybenzyl) benzoate

To a solution of 1-allyloxy-4-bromobenzene (3.1 g) in tetrahydrofuran (70 ml) was added 1.45 mol / l of n-pentane solution (11 ml) of t-butyllithium under argon at -78 ° C. After the mixture was stirred at -78 ° C for 5 minutes, a solution of methyl 4-formyl-3-hydroxybenzoate (0.89 g) in tetrahydrofuran (15 ml) was added to the reaction mixture. After the mixture was stirred for 30 minutes under ice-cooling, a saturated aqueous ammonium chloride solution and water were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 3/1) to obtain a diphenylmethanol compound (0.99 g). The obtained diphenylmethanol compound (0.99 g) was dissolved in methanol (10 mL), and 10% palladium-carbon powder (0.50 g) was added to the solution. After the mixture was stirred under a hydrogen atmosphere at room temperature for 24 hours, the catalyst was removed by filtration and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 3/1) to give methyl 3-hydroxy-4- (4-propoxybenzyl) benzoate (0.50 g).

¹H-NMR (CDCl3) δ ppm:

1.02 (3H, t, J = 7.4Hz), 1.70-1.85 (2H, m), 3.80-3.95 (5H, m), 3.97 (2H, s) , 4.99 (1H, s), 6.75-6.90 (2H, m), 7.05-7.20 (3H, m), 7.47 (1H, d, J = 1.5Hz ), 7.56 (1H, dd, J = 1.5, 7.8Hz)

Reference example 4

Methyl 3-hydroxy-4- [4- (2-hydroxyethyl) benzyl] benzoate

To a solution of 2- (bromophenyl) ethyl alcohol (1.7 g) in tetrahydrofuran (100 ml) was added 1.45 mol / l of n-pentane solution (12.6 ml) of t-butyllithium under argon at -78 ° C . After the mixture was stirred at -78 ° C for 10 minutes, a solution of methyl 4-formyl-3-hydroxybenzoate (0.50 g) in tetrahydrofuran (10 ml) was added to the reaction mixture. After the reaction mixture was stirred for 30 minutes under ice-cooling, a saturated aqueous ammonium chloride solution and water were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/3) to give a diphenylmethanol compound (0.28 g). The obtained diphenylmethanol compound (0.28 g) was dissolved in methanol (5 mL), and 10% palladium-carbon powder (0.14 g) was added to the solution. After the mixture was stirred at room temperature for 14 hours under a hydrogen atmosphere, the catalyst was removed by filtration and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/1) to give methyl 3-hydroxy-4- [4- (2-hydroxyethyl) benzyl] benzoate (0.26 g).

¹H-NMR (CDCl3) δ ppm:

1.37 (1H, t, J = 5.9Hz), 2.84 (2H, t, J = 6.5Hz), 3.75-3.95 (5H, m), 4.01 (2H , s), 5.10 (1H, s), 7.05-7.25 (5H, m), 7.47 (1H, d, J = 1.6Hz), 7.56 (1H, dd, J = 1.6, 7.8Hz)

Reference example 5

2- (4-isobutylbenzyl) phenol

The Grignard reagent was prepared from 2-benzyloxy-bromobenzene (0.20 g), magnesium (0.026 g), a catalytic amount of iodine and tetrahydrofuran (1 ml). The obtained Grignard reagent was added to the solution

4-isobutylbenzaldehyde (0.16 g) in tetrahydrofuran (2 ml), and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: tetrahydrofuran) to give a diphenylmethanol compound (0.23 g). The obtained diphenylmethanol compound was dissolved in ethanol (3 mL) and concentrated

Hydrochloric acid (0.1 ml). A catalytic amount of 10% palladium-carbon powder was added to the solution, and the mixture was stirred under a hydrogen atmosphere at room temperature overnight. The catalyst was removed by filtration and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: dichloromethane / hexane = 1/1) to give 2- (4-isobutylbenzyl) phenol (0.10 g).

¹H-NMR (CDCl3) δ ppm:

0.89 (6H, d, J = 6.6Hz), 1.75-1.90 (1H, m), 2.43 (2H, d, J = 7.2Hz), 3.97 (2H , s), 4.66 (1H, s), 6.75-6.85 (1H, m), 6.85-6.95 (1H, m), 7.00-7.20 (6H, m )

Reference example 6

2- (4-isopropoxybenzyl) phenol

The title compound was prepared in a similar manner as described in Reference Example 5 using 4-isopropoxybenzaldehyde in place of 4-isobutylbenzaldehyde.

¹H-NMR (CDCl3) δ ppm:

1.31 (6H, d, J = 6.1Hz), 3.93 (2H, s), 4.50 (1H, septet, J = 6.1Hz), 4.72 (1H, s), 6.75-6.85 (3H, m),

6.85-6.95 (1H, m), 7.05-7.20 (4H, m)

Reference example 7

2- (4-ethoxybenzyl) phenol

The Grignard reagent was prepared from 4-ethoxybromobenzene (1.5 g), magnesium (0.19 g), a catalytic amount of iodine and tetrahydrofuran (2 ml) in the usual manner. To the obtained Grignard reagent solution was added dropwise a solution of 2-benzyloxybenzaldehyde (1.1 g) in tetrahydrofuran (15 mL), and the mixture was stirred at room temperature for 30 minutes. A saturated aqueous ammonium chloride solution (10 ml) and water (20 ml) were added to the reaction mixture, and the mixture was extracted with ethyl acetate (100 ml). The extract was washed with water (20 ml) and brine (20 ml), and dried over anhydrous sodium sulfate. Then the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 5/1) to obtain a diphenylmethanol compound (1.7 g). The obtained diphenylmethanol compound (1.7 g) was dissolved in ethanol (25 ml). Concentrated hydrochloric acid (0.42 mL) and a catalytic amount of 10% palladium-carbon were added to the solution, and the mixture was stirred under a hydrogen atmosphere at room temperature for 18 hours. The catalyst was removed by filtration and the filtrate was concentrated under reduced pressure. Ethyl acetate (100 mL) was added to the residue, and the mixture was washed with a saturated aqueous sodium hydrogen carbonate solution (30 mL) and brine (30 mL). The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 8/1) to give 2- (4-ethoxybenzyl) phenol (0.85 g).

¹H-NMR (CDCl3) δ ppm:

1.39 (3H, t, J = 7.1Hz), 3.93 (2H, s), 4.00 (2H, q, J = 7.1Hz), 4.72 (1H, s), 6, 75-6.85 (3H, m).

6.85-6.95 (1H, m), 7.05-7.20 (4H, m)

Reference example 8

2- [4- (3-benzoyloxypropyl) benzyl] phenol

The Grignard reagent was prepared from 4- (3-benzyloxy-propyl) bromobenzene (3.2 g), magnesium (0.25 g), and a catalytic amount of iodine and tetrahydrofuran (10.5 ml). To the obtained Grignard reagent solution was added a solution of 2- (methoxymethoxy) benzaldehyde (1.1 g) in tetrahydrofuran (24 mL), and the mixture was stirred at 65 ° C for 25 minutes. After cooling to ambient temperature, a saturated aqueous ammonium chloride solution (10 mL) and water (20 mL) were added to the reaction mixture, and the mixture was extracted with ethyl acetate (100 mL). The extract was washed with water (20 ml) and brine (20 ml). The extract was dried over anhydrous sodium sulfate, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: hexane / ethyl acetate = 5/1) to obtain a diphenylmethanol compound (2.5 g). The obtained diphenylmethanol compound (2.5 g) was dissolved in ethanol (42 mL), a catalytic amount of 10% palladium-carbon powder was added to the solution, and the mixture was stirred under a hydrogen atmosphere at room temperature for 7.5 hours. The catalyst was removed by filtration and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 5/2) to obtain a phenylpropanol compound (1.6 g). After dissolving the obtained phenylpropanol compound (1.6 g) in dichloromethane (29 ml), 4- (dimethylamino) pyridine (0.069 g), triethylamine (1.0 ml) and benzoyl chloride (0.79 ml) were added to the solution, and the mixture was stirred at room temperature for 3 hours. Ethyl acetate was added to the reaction mixture

(100 ml) and water (30 ml), and the organic layer was separated. The extract was washed with brine (30 mL) and dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 20/1) to obtain an ester compound (2.2 g). A mixture of the obtained ester compound (2.2 g), p-toluenesulfonic acid monohydrate (0.21 g) and methanol (28 ml) was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 5/1) to obtain 2- [4- (3-benzoyloxy-propyl) benzyl] phenol (1.8 g) .

¹H-NMR (CDCl3) δ ppm:

2.00-2.15 (2H, m), 2.70-2.80 (2H, m), 3.96 (2H, s), 4.33 (2H, t, J = 6.5Hz) , 4.74 (1H, br s), 6.75-6.85 (1H, m), 6.85-6.95 (1H, m), 7.05-7.20 (6H, m), 7 , 35-7.50 (2H, m), 7-50-7.65 (1H, m), 8.00-8.10 (2H, m)

Reference Example 9

2- [4- (2-benzoyloxyethyl) benzyl] phenol

The title compound was prepared in a similar manner to that described in Reference Example 8 using 4- (2-benzyloxyethyl) bromobenzene in place of 4- (3-benzyloxypropyl) bromobenzene.

¹H-NMR (CDCl3) δ ppm:

3.04 (2H, t, J = 7.1Hz), 3.98 (2H, s), 4.51 (2H, t, J = 7.1Hz), 4.66 (1H, s), 6.75-6.85 (1H, m),

6.85-6.95 (1H, m), 7.05-7.25 (6H, m), 7.35-7.50 (2H, m), 7.50-7.60 (1H, m ), 7.95-8.05 (2H, m)

Reference example 10

5-acetoxymethyl-2- (4-ethylbenzyl) phenol

To a suspension of lithium aluminum hydride (95 µg) in diethyl ether (10 ml) was added a solution of methyl 4- (4-ethylbenzyl) -3-hydroxybenzoate (0.27 g) in diethyl ether (5 ml) under ice cooling. The mixture was refluxed for 45 minutes, water (0.1 ml), 15% aqueous sodium hydroxide solution (0.1 ml) and water (0.3 ml) were sequentially added to the reaction mixture under ice-cooling. After the mixture was stirred at room temperature for 5 minutes, the reaction mixture was poured into 0.5 mol / L hydrochloric acid, and the resulting mixture was extracted with ethyl acetate. The extract was dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/1) to give a reduced compound (0.22 g). The obtained reduced compound (0.22 g) was dissolved in tetrahydrofuran (2 ml), vinyl acetate (2 ml) and bis (dibutylchlorotin) oxide (24 mg) were added to the solution, and the mixture was stirred at 30 ° C for 19 hours. The reaction mixture was directly purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 3/1) to give 5-acetoxymethyl-2- (4-ethylbenzyl) phenol (0.21 g).

¹H-NMR (CDCl3) δ ppm:

1.21 (3H, t, J = 7.6 Hz), 2.09 (3H, s), 2.61 (2H, q, J = 7.6 Hz), 3.95 (2H, s), 4.74 (1H, s), 5.03 (2H, s), 6.80 (1H, d, J = 1.3Hz), 6.80-6.90 (1H, m), 7.05 -7.20 (5H, m)

Reference example 11

5-acetoxymethyl-2- (4-propoxybenzyl) phenol

The title compound was prepared in a similar manner as described in Reference Example 10 using methyl 3-hydroxy-4- (4-propoxybenzyl) benzoate in place of methyl 4- (4-ethylbenzyl) -3-hydroxybenzoate.

¹H-NMR (CDCl3) δ ppm:

1.02 (3H, t, J = 7.4Hz), 1.70-1.85 (2H, m), 2.09 (3H, s), 3.88 (2H, t, J = 6, 6 Hz), 3.91 (2H, s), 5.02 (2H, s), 5.28 (1H, s), 6.70-6.90 (4H, m), 7.00-7, 20 (3H, m)

Reference example 12

2- [4- (2-acetoxyethyl) benzyl] -5-acetoxymethylphenol

The title compound was prepared in a similar manner as described in Reference Example 10 using methyl 3-hydroxy-4- [4- (2-hydroxyethyl) benzyl] benzoate in place of methyl 4- (4-ethylbenzyl) -3-hydroxybenzoate.

¹H-NMR (CDCl3) δ ppm:

2.03 (3H, s), 2.09 (3H, s), 2.90 (2H, t, J = 7.1Hz), 3.96 (2H, s), 4.25 (2H, t , J = 7.1Hz), 4.82 (1H, s), 5.03 (2H, s), 6.80 (1H, d, J = 1.5Hz), 6-87 (1H, dd , J = 1.5, 7.7Hz), 7.05-7.20 (5H, m)

Reference Example 13

2- (4-ethylthiobenzyl) phenol

PL 205 605 B1

The Grignard reagent was prepared from 1-bromo-4- (ethylthio) benzene (1.1 g), magnesium (0.12 g), a catalytic amount of iodine and tetrahydrofuran (5 ml). A solution of 2- (methoxymethoxy) benzaldehyde (0.56 g) in tetrahydrofuran (12 mL) was added to the Grignard reagent solution, and the mixture was stirred at 65 ° C for 10 minutes. After cooling to ambient temperature, a saturated aqueous ammonium chloride solution (5 mL) and water (20 mL) were added to the reaction mixture, and the mixture was extracted with ethyl acetate (80 mL). The extract was washed with water (20 ml) and brine (20 ml), dried over anhydrous sodium sulfate, then the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 4/1) to give a diphenylmethanol compound (0.91 g). The obtained diphenylmethanol compound (0-90 g) was dissolved in dichloromethane (15 ml). To the solution was added Dess-Martin reagent (1,1,1-tri (acetyloxy) -1,1-dihydro-1,2-benzodoxol-3 (1H) -one) (1.5 g), and the mixture was stirred at a temperature of 25 ° C for 26 hours. Diethyl ether (75 mL) and a 1 mol / L aqueous sodium hydroxide solution (30 mL) were added to the reaction mixture, the mixture was stirred vigorously, and the organic layer was separated. The organic layer was washed with 1 mol / L aqueous sodium hydroxide (30 mL), water (30 mL, 3 times) and brine (30 mL), dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 15 / 1-9 / 1) to give a ketone compound (0.82 g). A mixture of the obtained ketone compound (0.81 g), p-toluenesulfonic acid monohydrate (0.10 g) and methanol (14 ml) was stirred at 60 ° C for 4 hours. After cooling to ambient temperature, the reaction mixture was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 15/1) to obtain the deprotected compound (0.69 g). The obtained deprotected compound (0.68 g) was dissolved in tetrahydrofuran (11 mL), triethylamine (0.41 mL) and methyl chloroformate (0.22 mL) were added to the solution, and the mixture was stirred at 25 ° C for 1 hour. In addition, triethylamine (0.11 mL) and methyl chloroformate (0.061 mL) were added to the reaction mixture, and the mixture was stirred for 30 minutes. The reaction mixture was filtered and the filtrate was concentrated under reduced pressure. The residue was dissolved in tetrahydrofuran (14 ml) and water (7 ml), sodium borohydride (0.40 g) was added to the solution, and the mixture was stirred at 25 ° C for 7 hours. To the reaction mixture, 1 mol / L hydrochloric acid (15 mL) was added dropwise, and the mixture was extracted with ethyl acetate (75 mL). The extract was washed with water (20 ml), a saturated aqueous sodium hydrogen carbonate solution (20 ml) and brine (20 ml), dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 8/1) to give 2- (4-ethylthiobenzyl) phenol (0.62 g).

¹H-NMR (CDCl3) δ ppm:

1.29 (3H, t, J = 7.3Hz), 2.90 (2H, q, J = 7.3Hz), 3.96 (2H, s), 4.62 (1H, s), 6.75-6.80 (1H, m).

6.85-6.95 (1H, m), 7.05-7.20 (4H, m), 7.20-7.30 (2H, m)

Reference example 14

2- (4-methoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

To a solution of 2- (4-methoxybenzyl) phenol (46 mg) and 2,3,4,6-tetra-O-acetyl-1-O-trichloroacetoimidoyl-αD-glucopyranose (0.13 g) in dichloromethane (2 ml) a complex of boron trifluoride and diethyl ether (0.033 mL) was added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: dichloromethane) to give 2- (4-methoxy-benzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside (0.11 g) .

¹H-NMR (CDCl3) δ ppm:

1.91 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.08 (3H, s), 3.77 (3H, s), 3.80-3 , 95 (3H, m), 4.17 (1H, dd, J = 2.5, 12.2 Hz), 4.29 (1H, dd, J = 5.5, 12.2 Hz), 5, 11 (1H, d, J = 7.5Hz), 5.10-5-25 (1H, m), 5.25-5.40 (2H, m), 6.75-6.85 (2H, m), 6.95-7.10 (5H, m), 7.10-7.25 (1H, m).

Reference example 15

2- (4-methylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 2- (4-methylbenzyl) phenol in place of 2- (4-methoxybenzyl) phenol.

PL 205 605 B1 ¹H-NMR (CDCl3) δ ppm:

1.89 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.07 (3H, s), 2.30 (3H, s), 3.80-3 , 95 (3H, m), 4.17 (1H, dd, J = 2.5, 12.3 Hz), 4.28 (1H, dd, J = 5.5, 12.3 Hz), 5, 11 (1H, d, J = 7.5Hz), 5.10-5.25 (1H, m), 5.25-5.40 (2H, m), 6.90-7.20 (8H, m)

Reference example 16

2- (4-ethylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 2- (4-ethylbenzyl) phenol in place of 2- (4-methoxybenzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

1.20 (3H, t, J = 7.6Hz), 1.87 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.08 (3H, s ), 2.60 (2H, q, J = 7.6 Hz), 3.80-4.00 (3H, m), 4.18 (1H, dd, J = 2.3, 12.2 Hz) , 4.28 (1H, dd, J = 5.4, 12.2 Hz), 5.11 (1H, d, J = 7.5 Hz), 5.10-5.25 (1H, m), 5.25-5.40 (2H, m), 6.90-7.25 (8H, m)

Reference example 17

2- (4-isobutylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 2- (4-isobutylbenzyl) phenol in place of 2- {4-methoxybenzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

0.88 (6H, d, J = 6.6Hz), 1.75-1.90 (1H, m), 1.87 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.08 (3H, s), 2.42 (2H, d, J = 7.2Hz), 3.80-3.95 (3H, m), 4.18 (1H, dd, J = 2.4, 12.3 Hz), 4.29 (1H, dd, J = 5.5, 12.3 Hz), 5.11 (1H, d, J = 7.6 Hz), 5.10-5.25 (1H, m), 5.25-5.40 (2H, m), 6.90-7.25 (8H, m)

Reference example 18

2- (4-ethoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 2- (4-ethoxybenzyl) phenol in place of 2- (4-methoxybenzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

1.39 (3H, t, J = 7.0Hz), 1.91 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.07 (3H, s ), 3.80-3.95 (3H, m), 3.99 (2H, q, J = 7.0Hz), 4.18 (1H, dd, J = 2.5, 12.3Hz) 4.28 (1H, dd, J = 5.6, 12.3Hz), 5.10 (1H, d, J = 7.7Hz), 5.15-5.25 (1H, m), 5.25-5.40 (2H, m), 6.75-6.85 (2H, m), 6.95-7.10 (5H, m), 7.10-7.20 (1H, m )

Reference example 19

2- (4-isopropoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 2- (4-isopropoxybenzyl) phenol in place of 2- (4-methoxybenzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

1.30 (6H, d, J = 6.0Hz), 1.90 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.08 (3H, s ), 3.80-3.90 (3H, m), 4.18 (1H, dd, J = 2.3, 12.3 Hz), 4.28 (1H, dd, J = 5.5, 12 , 3 Hz), 4.48 (1H, septet, J = 6.0Hz), 5.10 (1H, d, J = 7.7Hz), 5.10-5.25 (1H, m), 5.25-5.40 (2H, m), 6.70-6.85 (2H, m), 6.90-7.10 (5H, m), 7.10-7.20 (1M, m )

Reference example 20

5-acetoxymethyl-2- (4-ethylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 5-acetoxy-methyl-2- (4-ethylbenzyl) phenol in place of 2- (4-methoxybenzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

1.20 (3H, t, J = 7.6Hz), 1.88 (3H, s), 2.02 (3H, s), 2.05 (3H, s), 2.07 (3H, s ), 2.09 (3H, s), 2.60 (2H, g, J = 7.6Hz), 3.80-3.95 (3H, m), 4.20 (1H, dd, J = 2.4, 12.3 Hz), 4.27 (1H, dd, J = 5.3, 12.3 Hz), 5.00-5.10 (2H, m), 5.13 (1H, d , J = 7.4Hz), 5.15-5.40 (3H, m), 6.95-7.15 (7H, m)

Reference example 21

Acetoxymethyl-2- (4-propoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Reference Example 14 using 5-acetoxy-methyl-2- (4-propoxybenzyl) phenol in place of 2- (4-methoxy-benzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

1.01 (3H, t, J = 7.4Hz), 1.70-1.85 (2H, m), 1.92 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.07 (3H, s), 2.09 (3H, s), 3.80-3.95 (5H, m), 4.20 (1H, dd, J = 2.4 , 12.3Hz), 4.27 (1H, dd, J = 5.3, 12.3Hz), 5.00-5.10 (2H, m), 5.12 (1H, d, J = 7.4Hz), 5.15-5.40 (3H, m), 6.75-6.85 (2H, m), 6.95-7.10 (5H, m)

Reference example 22

2- [4- (2-acetoxyethyl) benzyl] -5-acetoxymethylphenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside

PL 205 605 B1

The title compound was prepared in a similar manner as described in Reference Example 14 using 2- [4- (2-acetoxyethyl) benzyl] -5-acetoxymethylphenol in place of 2- (4-methoxybenzyl) phenol.

¹H-NMR (CDCl3) δ ppm:

1.89 (3H, S), 2.03 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.07 (3H, s), 2.09 (3H , S), 2.88 (2H, t, J = 7.1Hz), 3.85-3.95 (3H, m), 4.15-4.35 (4H, m), 5.00- 5.10 (2H, m), 5.13 (1H, d, J = 7.5Hz), 5.15-5.40 (3H, m), 6.95-7.15 (7H, m)

Example 1

2- (4-methoxybenzyl) phenyl eD-glucopyranoside

Sodium methoxide (28% methanol solution; 0.12 ml) was added to the solution of 2- (4-methoxybenzyl) -phenyl-2,3,4,6-tetra-O-acetyl-5-D-glucopyranoside (0.11 g ) in methanol (4 ml), and the mixture was stirred at room temperature for 30 minutes. The solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (eluent: dichloromethane / methanol = 10/1) to give 2- (4-methoxy-benzyl) phenyl-eD-glucopyranoside (65 mg).

¹H-NMR (CD3OD) δ ppm:

3.35-3.55 (4H, m), 3.69 (1H, dd, J = 5.1, 12.1Hz), 3.73 (3H, s), 3.80-4.00 ( 2H, m), 4.03 (1H, d,

J = 15.1 Hz), 4.91 (1H, d, J = 7.4 Hz), 6.75-6.85 (2H, m), 6.85-6.95 (1H, m), 6.95-7.10 (1H, m), 7.10-7.20 (4H, m)

Example 2

2- (4-methylbenzyl) phenyl eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 2- (4-methylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) phenyl-2. 3,4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) δ ppm:

2.27 (3H, s), 3.35-3.55 (4H, m), 3.69 (1H, dd, J = 5.2, 12.0 Hz), 3.80-3.90 ( 1H, m), 3.94 (1H, d, J = 15.0 Hz), 4.05 (1H, d, J = 15.0 Hz), 4.85-4.95 (1H, m), 6.85-6.95 (1H, m), 6.95-7.20 (7H, m)

Example 3

2- (4-ethylbenzyl) phenyl eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 2- (4-ethylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) phenyl2,3. 4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) β ppm:

1.15-1.25 (3H, m), 2.50-2.65 (2H, m), 3.35-3.55 (4H, m), 3.65-3.75 (1H, m) ), 3.80-4.00 (2H, m), 4.06 (1H, d, J = 14.9Hz), 4.85-5.00 (1H, m), 6.85-7, 00 (1H, m), 7.00-7.20 (7H, m)

Example 4

2- (4-isobutylbenzyl) phenyl eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 2- (4-isobutylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) -phenyl-2 , 3,4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) δ ppm:

0.80-0.95 (6H, m), 1.70-1.90 (1H, m), 2.41 (2H, d, J = 7.1Hz), 3.30-3.55 ( 4H, m), 3.60-3.75 (1H, m), 3.80-3.95 (1H, m), 3.95 (1H, d, J = 15.0Hz), 4.06 (1H, d, J = 15.0Hz), 4.85-4.95 (1H, m), 6.80-7.20 (8H, m)

Example 5

2- (4-ethoxybenzyl) phenyl eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 2- (4-ethoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) phenyl-2. 3,4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) δ ppm:

1.35 (3H, t, J = 6.8Hz), 3.35-3.55 (4H, m), 3.60-3.75 (1H, m), 3.80-4.10 ( 5H, m), 4.90 (1H, d, J = 7.1Hz), 6.70-6.85 (2H, m), 6.85-6.95 (1H, m), 7.00- 7.20 (5H, m)

Example 6

2- (4-isopropoxybenzyl) phenyl eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 2- (4-isopropoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) -phenyl-2. , 3,4,6-tetra-O-acetyl-eD-glucopyranoside.

PL 205 605 B1 ¹H-NMR (CD3OD) δ ppm:

1.27 (6H, d, J = 6.0Hz), 3.35-3.55 (4H, m), 3.69 (1H, dd, J = 5.4, 12.1Hz), 3 , 88 (1H, dd, J = 2.0, 12.1Hz), 3.91 (1H, d, J = 15.0Hz), 4.02 (1H, d, J = 15.0Hz) , 4.51 (1H, Septet, J = 6.0Hz), 4.91 (1H, d, J = 7.7Hz), 6.70-6.85 (2H, m), 6.85- 6.95 (1H, m), 7.00-7.10 (1H, m), 7.10-7.20 (4H, m)

Example 7

5-hydroxymethyl-2- (4-propoxybenzyl) phenyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 5-acetoxymethyl-2- (4-propoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) δ ppm:

1.02 (3H, t, J = 7.4Hz), 1.70-1.85 (2H, m), 3.30-3.55 (4H, m), 3.65-3.75 ( 1H, m), 3.80-3.95 (4H, m), 4.00 (1H, d, J = 15.0Hz), 4.54 (2H, s), 4.93 (1H, d , J = 7.4Hz), 6.70-6.85 (2H, m), 6.85-6.95 (1H, m), 7.02 (1H, d, J = 7.7Hz) , 7.05-7.20 (3H, m)

Example 8

2- (4-ethylbenzyl) -5-hydroxymethylphenyl-eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 5-acetoxymethyl-2- (4-ethylbenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside in place of 2- (4-methoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) δ ppm:

1.19 (3H, t, J = 7.6 Hz), 2.57 (2H, q, J = 7.6 Hz), 3.30-3.55 (4H, m), 3.65-3 , 75 (1H, m), 3.85-4.00 (2H, m), 4.04 (1H, d, J = 15.0Hz), 4.54 (2H, s), 4.93 ( 1H, d, J = 7.4Hz), 6.85-6.95 (1H, m), 7.02 (1H, d, J = 7.7Hz), 7.06 (2H, d, J = 8.1 Hz), 7.10-7.20 (3H, m)

Example 9

2- [4- (2-hydroxyethyl) benzyl] -5-hydroxymethylphenyl eD-glucopyranoside

The title compound was prepared in a similar manner as described in Example 1 using 2- [4- (2-acetoxyethyl) benzyl] -5-acetoxymethylphenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside instead of 2- ( 4-methoxybenzyl) phenyl-2,3,4,6-tetra-O-acetyl-eD-glucopyranoside.

¹H-NMR (CD3OD) δ ppm:

2.76 (2H, t, J = 7.1Hz), 3.30-3.55 (4H, m), 3.60-3.75 (3H, m), 3.85-4.00 ( 2H, m), 4.05 (1H, d, J = 14.6 Hz), 4.54 (2H, s), 4.92 (1H, d, J = 7.2 Hz), 6.85- 6.95 (1H, m), 7.03 (1H, d, J = 7.9Hz), 7.09 (2H, d, J = 7.8Hz), 7.10-7.20 (3H , m)

Example 10

2- [4- (2-hydroxyethyl) benzyl] phenyl eD-glucopyranoside

To a solution of 2- [4- (2-benzoyloxyethyl) benzyl] phenol (0.49 g) and 1,2,3,4,6-penta-O-acetyl-eD-glucopyranose (1.7 g) in toluene ( 5.2 ml) and dichloromethane (2.2 ml) were added a complex of boron trifluoride and diethyl ether (0.56 ml) and the mixture was stirred at 25 ° C for 8 hours. Ethyl acetate (70 ml) and a saturated aqueous sodium hydrogen carbonate solution (25 ml) were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with brine (25 mL) and dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was dissolved in methanol (5 ml) and tetrahydrofuran (2.5 ml). Sodium methoxide (28% methanol solution, 0.14 mL) was added to the solution, and the resulting mixture was stirred at 25 ° C for 12.5 hours. Ethyl acetate (75 ml) and water (20 ml) were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with brine (20 mL) and dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was dissolved in methanol (7.5 mL), sodium methoxide (28% methanol solution, 0.085 mL) was added to the solution, and the resulting mixture was stirred at 25 ° C for 5 hours. The reaction mixture was purified by column chromatography over silica gel (eluent: dichloromethane / methanol = 4/1). The solvent was removed under reduced pressure, diethyl ether was added to the residue, and the resulting precipitates were collected by filtration. The resulting solid was washed with diethyl ether and dried in vacuo to give 2- [4- (2-hydroxyethyl) benzyl] phenyl eD-glucopyranoside (0.47 g).

¹H-NMR (CD3OD) δ ppm:

2.76 (2H, t, J = 7.1Hz), 3.35-3.55 (4H, m), 3.65-3.75 (3H, m), 3.88 (1H, dd, J = 1.8, 11.8 Hz), 3.95 (1H, d, J = 15.2 Hz), 4.07 (1H, d, J = 15.2 Hz), 4.90 (1H, d, J = 7.4Hz), 6.85-6.95 (1H, m), 7.00-7.20 (7H, m)

Example 11

2- [4- (3-hydroxypropyl) benzyl] phenyl eD-glucopyranoside

PL 205 605 B1

The title compound was prepared in a similar manner as described in Example 10 using 2- [4- (3-benzoyloxypropyl) benzyl] phenol instead of 2- [4- (2-benzoyloxyethyl) benzyl] phenol.

¹H-NMR (CD3OD) δ ppm:

1.70-1.85 (2H, m), 2.55-2.65 (2H, m), 3.30-3.60 (6H, m), 3.69 (1H, dd, J = 5 , 2, 11.9Hz), 3.88 (1H, dd, J = 2.0, 11.9Hz), 3.95 (1H, d, J = 15.1Hz), 4.06 (1H , d, J = 15.1 Hz), 4.90 (1H, d, J = 7.3 Hz),

6.85-6.95 (1H, m), 7.00-7.20 (7H, m)

Example 12

2- (4-ethylthiobenzyl) phenyl-eD-glucopyranoside

For a solution of 2- (4-ethylthiobenzyl) phenol (0.51 g) and 1,2,3,4,6-penta-O-acetyl-eD-glucopyranose (2.4 g) in toluene (6.3 ml) and dichloromethane (2.7 mL), a complex of boron trifluoride and diethyl ether (0.78 mL) was added, and the mixture was stirred at room temperature for 9 hours. Ethyl acetate (70 mL) and a saturated aqueous sodium hydrogen carbonate solution (25 mL) were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with brine (25 ml), dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was dissolved in methanol (10.5 mL), sodium methoxide (28% methanol solution, 0.08 mL) was added to the solution, and the mixture was stirred at 25 ° C for 18 hours. Ethyl acetate (75 mL) and water (20 mL) were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with brine (20 ml), dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by column chromatography over silica gel (eluent: dichloromethane / methanol = 10/1). The solvent was removed under reduced pressure, diethyl ether was added to the residue, and the resulting precipitates were collected by filtration. The obtained colorless solid was washed with diethyl ether and dried under reduced pressure to give 2- (4-ethylthiobenzyl) phenyl-eD-glucopyranoside (0.51 g) ¹H-NMR (CD3OD) δ ppm:

1.24 (3H, t, J = 7.3Hz), 2.88 (2H, q, J = 7.3Hz), 3.35-3.55 (4H, m), 3.69 (1H , dd, J = 5.0, 12.2 Hz), 3.88 (1H, dd, J = 2.0, 12.2 Hz), 3.95 (1H, d, J = 15.1 Hz) , 4.08 (1H, d, J = 15.1Hz), 4.91 (1H, d, J = 7.3Hz), 6.85-7.00 (1H, m), 7.00- 7.10 (1H, m), 7.10-7.30 (6H, m)

Test Example 1

Human SGLT2 activity inhibitory activity test

1) Construction of a plasmid vector expressing human SGLT2

Production of a cDNA library for PCR amplification was performed by reverse transcription of total RNA obtained from human kidney (Ori gene) with oligo dT as primer, using the SUPERSCRIPT Preamplification System (Gibco-BRL: LIFE TECHNOLOGIES). The DNA fragment encoding human SGLT2 was amplified by PCR using Pfu DNA polymerase (Stratagene) in which the human kidney cDNA libraries described above were used as a template and the following oligonucleotides, 0702P and 0712R, shown as Sequence Nos. 1 and 2, respectively, were used as primers. The amplified DNA fragment was ligated into pCR-Blunt (Invitrogen), a cloning vector, according to the standard kit method. Competent cell, Escherichia coli HB101 (Toyobo), was transformed by the usual method and then selection of transformants was performed on LB agar medium containing 50 µg / ml kanamycin. After extraction of plasmid DNA from one of the transformants and purification, amplification of the DNA fragment encoding human SGLT2 was performed by PCR using Pfu DNA polymerase (Stratagene) in which the following oligonucleotides, 0714F and 0715R, shown as Sequence Nos. 3 and 4, respectively, were used as starters. The amplified DNA fragment was digested with the restriction enzymes, Xho I and Hind III, and then purified with the Wizard Purification System (Promega). This purified DNA fragment was inserted at the appropriate restriction enzyme sites into PCDNA3.1 (-) Myc / His-A (Invitrogen), a fusion protein expression vector. Competent cell, Escherichia coli HB101 (Toyobo), was transformed by the usual method and then selection for transformants was performed on LB agar medium containing 100 µg / ml ampicillin. After plasmid DNA was extracted from this transformant and purified, the sequence of the DNA fragment inserted into the multi-cloning sites of the pcDNA3.1 (-) Myc / His-A vector was analyzed. This clone had a single base substitution (ATC encoding isoleucine-433 substituted with GTC) compared to human SGLT2 described by Wells et al. (Am. J. Physiol., Vol. 263, pp. 459-465 (1992)). Subsequently, a clone was obtained in which valine is substituted for isoleucine-433. This plasmid vector expressing human SGLT2 in which the peptide shown as Sequence No. 5 is fused to a carboxy terminus alanine residue was named KL29.

PL 205 605 B1

Sequence No. 1 Sequence No. 2 Sequence No. 3 Sequence No. 4 Sequence No. 5

ATGGAGGAGCACACAGAGGC GGCATAGAAGCCCCAGAGGA AACCTCGAGATGGAGGAGCACACAGAGGC AACAAGCTTGGCATAGAAGCCCCAGAGGA KLGPEQKLISEEDLNSAVDHHHHHH

2) Generation of cells with transient expression of human SGLT2 KL29, plasmid encoding human SGLT2 was transfected into COS-7 cells (RIKEN CELL BANK

RCB0539) by electroporation. The electroporation was carried out GENE PULSER II (Bio-Rad Laboratories) in the following conditions: 0.290 kV, 975 nF, 2 x 10⁶ COS-7 cells and 20 μg KL29 in 500 μΐ OPTIMEM I medium (Gibco-BRL: LIFE TECHNOLOGIES) in a 0.4 cm cuvette. After gene transfer, cells were harvested by centrifugation and resuspended in OPTI-MEM I medium (1 ml / cuvette). To each well of a 96-well plate, 125 µl of this cell suspension was added. After culturing overnight at 37 ° C under 5% CO₂, 125 μl DMEM medium (Gibco-BRL: LIFE TECHNOLOGIES) containing 10% fetal bovine serum (Sanko Jyunyaku), 100 units / ml penicillin G sodium (Gibco-BRL: LIFE TECHNOLOGIES), 100 gg / ml streptomycin sulfate (Gibco-BRL) : LIFE TECHNOLOGIES) have been added to each well. After culturing overnight, these cells were used to measure the uptake inhibitory activity of methyl-αD-glucopyranoside.

3) Measurement of the uptake inhibitory activity of methyl-αD-glucopyranoside

After removing the COS-7 cell medium with transient expression of human SGLT2, 200 g of pre-buffer (pH 7.4 buffer containing 140 mM choline chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 10 mM 2- [4- (2-hydroxyethyl) -1-piperazinyl] ethanesulfonic acid and 5 mM tris (hydroxymethyl) aminomethane) and the cells were incubated at 37 ° C for 10 minutes. The pretreatment buffer was removed and 200 µl of the same buffer was added again, then the cells were incubated at 37 ° C for 10 minutes. 7 g of methyl-aD- (U-14C) glucopyranoside (Amersham Pharmacia Biotech) was added to 525 g of uptake buffer containing the test sample (pH 7.4 buffer containing 140 mM sodium chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 5 mM methyl-αD-glucopyranoside, 10 mM 2- [4- (2-hydroxyethyl) -1-piperazinyl] ethanesulfonic acid, and 5 mM tris (hydroxymethyl) aminomethane), and this mixture was stirred and then a buffer was prepared. for consumption measurement. For controls, a buffer for measuring uptake was prepared without test compound. To evaluate basal uptake in the absence of test sodium compound, a buffer for basal uptake measurement was similarly prepared that contains 140 mM choline chloride in place of sodium chloride. After the pretreatment buffer was removed, 75 µl of the buffer for measurement of uptake was added to each well, the cells were incubated at 37 ° C for 2 hours. After removing the uptake measurement buffer, 200 g of washing buffer (pH 7.4 buffer containing 140 mM choline chloride, mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 10 mM methyl-αD-glucopyranoside, 10 mM acid 2- [4- (2-hydroxyethyl) -1-piperazinyl] ethanesulfonic acid and 5 mM tris (hydroxymethyl) aminomethane) were added to each well and removed immediately. After two additional washes, cells were solubilized by adding 75 µl of 0.2N sodium hydroxide to each well. After the cell lysates were transferred to PicoPlate (Packard) and 150 µl MicroScint-40 (Packard) was added to each well, radioactivity was measured with a TopCount microplate scintillation counter (Packard). The difference in uptake was obtained as a 100% value by subtracting the radioactivity of the basal uptake from the control and then the concentrations at which 50% of uptake is inhibited (IC50 value) was calculated from the concentration-inhibition curve by the least squares method. The results are shown in the following table 1.

[Table 1]

<td>Tested compound</td><td>IC value₅₀ (nM)</td>

<td> 1</td><td> 2</td>

<td>Example 1</td><td> 350</td>

<td>Example 2</td><td> 450</td>

<td>Example 3</td><td> 140</td>

<td>Example 4</td><td> 500</td>

<td>Example 5</td><td> 330</td>

<td>Example 6</td><td> 370</td>

<td>Example 7</td><td> 140</td>

PL 205 605 B1 cont. table 1

<td> 1</td><td> 2</td>

<td>Example 8</td><td> 8,1</td>

<td>Example 9</td><td> 27</td>

<td>Example 10</td><td> 210</td>

<td>Example 11</td><td> 75</td>

<td>Example 12</td><td> 110</td>

Test Example 2

Urinary glucose excretion promoting effect test

As test animals, overnight fasted SD rats (SLC, male, 7 weeks old, 180-240 g) were used. 10 mg of the test compound was suspended or dissolved in 300 µl of ethanol, then dissolved by adding 1.2 ml of polyethylene glycol 400 and 1.5 ml of saline, and then a 3.3 mg / ml solution was prepared. 300 μl of this solution was dissolved in 2.7 ml of a dilution solution (saline: polyethylene glycol 400: ethanol = 5: 4: 1) and a solution of 0.33 mg / ml was prepared. After the rats were weighed, a solution of the test compound was injected intravenously into the tail vein at a dose of 3 ml / kg (1 mg / kg). As a control, only the solution alone (saline: polyethylene glycol 400: ethanol = 5: 4: 1) was injected intravenously into the tail vein at a dose of 3 ml / kg. Immediately after intravenous injection into the tail vein, a glucose solution of 200 g / L was orally administered to rats at a dose of 10 ml / kg (2 g / kg). Intravenous injection into the tail vein was performed with a 26 G injection needle and a 1 ml syringe. Oral administration was carried out with a rat gastric tube and a 2.5 ml syringe. The number of individuals in one group was 2 or 3. Urine was collected in a metabolic cage after the oral administration of glucose was completed. The sampling time for collecting the urine was 24 hours after oral administration of glucose. After the collection of urine was completed, the urine volume was recorded and the concentration of glucose in the urine was measured. Glucose concentration was measured with a laboratory test kit: Glucose B-Test WAKO (Wako Pure Chemical Industries, Ltd.). The amount of glucose excreted in urine in 24 hours per 200 g of body weight was calculated from urine volume, urine glucose concentration and body weight. The results are shown in the following table 2.

<td></td><td>Table 2]</td>

<td>Tested compound</td><td>Glucose excreted in urine (mg)</td>

<td>Example 1</td><td> 27,4</td>

<td>Example 7</td><td> 109,1</td>

<td>Example 8</td><td> 238,9</td>

<td>Example 10</td><td> 69,5</td>

Test Example 3

Acute Toxicity Test

5-week-old male ICR mice (CLEA JAPAN, INC. 29-34 g, 5 animals each group) were fasted for 4 hours, and a 66 mg / ml suspension was made by adding saline: polyethylene glycol 400: ethanol (5 : 4: 1) to 2- [4- (2-hydroxy-ethyl) benzyl] phenyl-eD-glucopyranoside (compound described in Example 10) was administered subcutaneously at a dose of 3 ml / kg (2000 mg / kg). No case of death has been observed until 24 hours after administration.

Utility

The glucopyranosyloxybenzylbenzene derivatives of the general formula (I) according to the invention have an excellent inhibitory activity on human SGLT2. The present invention can provide a means for preventing or treating diabetes, diabetic complications, obesity, or the like. Moreover, since compounds of general formula (II) are important as intermediates in the preparation of compounds of general formula (I), compounds of general formula (I) according to the invention can be easily prepared via such compounds.