Hybrid winter oilseed rape and methods for producing same

Description of the invention

The subject of the invention is a winter oilseed rape plant, winter oilseed rape seed, a method of producing hybrid seeds, a method of identifying a transgenic plant or its cells or tissues, a kit for identifying a transgenic plant, its cells or tissues, a kit for identifying an elite event MS-BN1 or RF- BN1 in biological samples, a method of confirming seed purity, a method of screening seeds for the presence of MS-BN1 and RF-BN1.

Winter oilseed rape (WOSR) plants, specifically pairs of winter oilseed rape plants, are particularly useful for producing hybrid seed. One such plant is sterile for male gametes due to the presence of a male gamete sterility gene in its genome, while the other carries a fertility restoring gene capable of preventing the male sterility gene from acting. Such a pair of WOSR plants combines the ability to form hybrid seeds with general agronomic properties, genetic stability and the ability to adapt to a variety of genetic backgrounds.

All the documents cited here are also references to the literature.

The expression of a transgenic plant phenotype is determined both by the structure of the gene itself and its location in the plant genome. At the same time, the presence of the transgene in different places of the genome will influence the phenotype of the plant in different ways. Successful agronomic or industrial introduction of a commercially interesting plant strain by genetic manipulation can be a lengthy procedure, depending on various factors. In fact, the transformation and regeneration of genetically transformed plants are only the first steps in a series of selections involving comprehensive genetic characterization, breeding and evaluation in field tests.

Oilseed rape (OSR) (Brassica napus, AACC, 2n = 38) is a natural hybrid obtained from an interspecific cross between vegetable cabbage (Brassica oleracea, CC, 2n = 18) and field cabbage (Brassica campestris, AA, 2n = 20). Winter oilseed rape is sown during the last ten days of August and the first ten days of September and harvested from July onwards, requires the right temperature to be applied for a certain time for vernalization. The fast-growing spring varieties sown in late March and early April are harvested from mid-August to September. The types of RIA currently cultivated are both low and high erucic acid varieties. The doubly poor (00) varieties contain very little (typically less than 1%) erucic acids (hardly digestible for humans) and very little glucosinates (which make the animal feed additive indigestible). Current applications of "00" varieties include cooking oil for humans and high protein food for animals. Industrial uses include use as a starting product for pharmaceuticals and hydraulic oils. High erucic acid oilseed rape (HEAR) varieties are grown specifically for their high erucic acid content - typically 50-60% oil. A typical end use for HEAR is the production of erucamide, "a lubricant used in the production of polyethylene. A small amount is used for the production of behenyl alcohol which, when added to the crude mineral wax, increases its flowability.

Oilseed rape plants are bisexual and typically 60-70% self-pollinated. The production of hybrids and the introduction of genetic variation as a basis for selection has traditionally depended on the exploitation of a naturally occurring phenomenon such as self-incompatibility and cytoplasmic male sterility. Artificial pollination control methods such as manual castration or the use of gametocides are not widely used in OSR breeding due to their limited practicality and high cost, respectively.

Methods for obtaining transgenic plants have been developed to produce male or female sterile plants providing interesting alternatives to the traditional methods. EP 0,344,029 describes a system for obtaining nuclear sterility for male gametes in which plants are transformed with a male gamete sterility gene which contains, for example, DNA encoding the barnase gene under the control of the tapetum-specific promoter PTA29 which when incorporated into the plant provides the assurance of a selective destroying tapetum cells. Transformation of tobacco and oilseed rape plants with such a gene produces plants in which pollen production is completely prevented (Mariani et al., 1990, Nature 347: 737-741). To restore fertility in the offspring of a male sterile plant, a system has been developed in which the plant sterile for male gametes is crossed with a transgenic plant carrying a fertility restoring gene which, when expressed, is capable of inhibiting or counteracting the activity of the sterility gene.

PL 205 071 B1 against male gametes (US 5,689,041; US ​​5,792,929). Such a fertility restorer gene is placed under the control of an expression promoter at least in cells in which the male sterility gene is expressed. Mariani et al. (1992, Nature 357: 384-387) have shown that sterility encoded by pTA29: barnase can be abolished in oilseed rape by the chimeric pTA29: barstar construct.

Cytochemical and histochemical studies of the anther development of Brassica napus plants harboring the pTA29: barnase chimeric construct, alone or with pTA29: barstar, are described by De Block and De Brouwer (1993, Planta 189: 218-225).

Successful transformation of Brassica species has been obtained using a number of methods including infection with Agrobacterium (as for example described in EP 0,116,718 and EP 0,270,882), micro-bullet bombardment (as described in, for example, Chen et al., 1994, Theor. Appl. Genet. 88: 187-192). ) and direct introduction of DNA (as for example described by De Block et al., 1989, Plany Physiol. 914: 694-701; Poulsen, 1996, Plant Breeding 115: 209-225). However, these documents do not suggest or teach what is included in the present invention.

The present invention relates to a winter oilseed rape plant comprising the elite event RF-BN1, which is characterized in that genomic DNA can be used to amplify a DNA fragment between 195 and 235 base pairs in length by a polymerase chain reaction with two primers of the nucleotide sequence from SEQ. 23 and SEQ ID NO: 41 respectively, wherein the plant can be obtained from seed deposited in accordance with ATCC under Accession No. PTA-730. In a preferred plant, genomic DNA can be used to amplify a DNA fragment of about 215 base pairs in the polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 41 respectively. Preferably, the plant further comprises an elite event MS-BN1, characterized in that genomic DNA can be used to amplify a DNA fragment of between 260 and 300 bp in length in a polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19 respectively.

In a preferred plant, genomic DNA can be used to amplify a DNA fragment of approximately 280 base pairs in length by a polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19, respectively. Preferably, the plant may be obtained by crossing the plant with a winter oilseed rape plant obtained from seed deposited with the ATCC under accession number PTA-730. The preferred plant is a hybrid plant.

The invention also relates to a winter oilseed rape plant, comprising an elite MS-BN1 event, characterized in that genomic DNA can be used to amplify a DNA fragment of between 260 and 300 base pairs in length by a polymerase chain reaction with two primers of the nucleotide sequence from SEQ. 12 and SEQ ID NO: 19 respectively, wherein the plant can be obtained from seed deposited in accordance with ATCC under Accession No. PTA-730. In a preferred plant, genomic DNA can be used to amplify a DNA fragment of about 280 base pairs in length by the polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19, respectively.

Furthermore, the invention relates to the seed of winter oilseed rape, which includes the elite event RF-BN1, characterized in that genomic DNA can be used to amplify a DNA fragment of between 195 and 235 base pairs in length by a polymerase chain reaction with two primers of the nucleotide sequence from SEQ. 23 and SEQ ID NO: 41 respectively, wherein the seed can be obtained from seed deposited with the ATCC under accession number PTA-730. Preferably the seed further comprises an elite MS-BN1 event, characterized in that genomic DNA can be used to amplify a DNA fragment of between 260 and 300 bp in length in a polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 12 and SEQ ID NO: 12 ID NO: 19 respectively.

The seed is preferably a hybrid seed.

The invention also relates to the seed of winter oilseed rape comprising the elite event MS-BN1, characterized in that genomic DNA can be used to amplify a DNA fragment of between 260 and 300 base pairs in length by a polymerase chain reaction with two primers having the nucleotide sequence of SEQ NO. ID: 12 and SEQ ID NO: 19 respectively, wherein the seed may be obtained from seed deposited in accordance with the ATCC under accession number PTA-730. The seed is preferably a hybrid seed.

PL 205 071 B1

Furthermore, the invention relates to a method for producing hybrid seed which comprises steps

a) identifying the transgenic male sterile winter oilseed rape plant, including the elite MS-BN1 event, characterized in that genomic DNA can be used to amplify a DNA fragment of between 260 and 300 base pairs in length in a polymerase chain reaction with two primers with the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19 suitably, wherein the transgenic male sterile winter oilseed rape plant can be obtained from seed deposited under the ATCC accession number PTA-730,

(b) crossing the transgenic male sterile winter oilseed rape plant identified in step (a) with a fertility restoring winter oilseed rape plant containing a fertility restoring gene stably integrated into the genome comprising:

DNA encoding a ribonuclease inhibitor under the control of a promoter responsible for the expression of said DNA in at least cells in which the male sterility gene from the elite MS-BN1 event is expressed; and

c) collecting hybrid seeds from sterile male gametes of winter oilseed rape.

In a preferred method, the fertility restoring plant comprises an elite RF-BN1 event, which is characterized in that genomic DNA can be used to amplify a DNA fragment of approximately 215 base pairs in length using a polymerase chain reaction and two primers with a nucleotide sequence. of SEQ ID NO: 23 and SEQ ID NO: 41 respectively, wherein a fertility restorer plant of a winter oilseed rape can be obtained from seed deposited in accordance with the ATCC accession number PTA-730.

Also within the scope of the invention is a method for identifying a transgenic plant or cells or tissues thereof involving the elite event MS-BN1, which includes determining whether genomic DNA can be used to amplify a DNA fragment of between 260 and 300 base pairs in length by a polymerase chain reaction with two primers with the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19, respectively.

A preferred method comprises determining whether the genomic DNA of the transgenic plant or cells or tissues thereof can be used to amplify a 280 bp long DNA fragment by a polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19, respectively.

The invention further relates to a kit for identifying a transgenic plant, cells or tissues thereof comprising an elite event MS-BN1, which comprises PCR primers, one of which recognizes a foreign DNA of the MS-BN1 sequence within the sequence of SEQ ID NO: 1, and the other recognizes 5. 'flanking DNA of the MS-BN1 sequence within the sequence of SEQ ID NO: 13 or 3' flanking DNA of the MSBN1 sequence within the sequence of SEQ ID NO: 18, for use in a PCR identification protocol.

In a preferred kit, a primer that recognizes foreign DNA from MS-BN1 recognizes foreign DNA from MS-BN1 within the sequence shown in SEQ ID NO: 13 or SEQ ID NO: 18.

In another preferred set, the PCR primers include the nucleotide sequence of SEQ ID NO: 12 and SEQ ID NO: 19, respectively.

Furthermore, the invention relates to a method for identifying a transgenic plant, cells or tissues thereof involving the elite RF-BN1 event, which comprises determining whether genomic DNA can be used to amplify a DNA fragment of between 195 and 235 base pairs in length by a polymerase chain reaction with two primers of a nucleotide sequence. with SEQ ID NO: 23 and SEQ ID NO: 41, respectively.

A preferred method comprises determining whether the genomic DNA of a transgenic plant or cells or tissues thereof can be used to amplify a DNA fragment of about 215 base pairs in a polymerase chain reaction with two primers having the nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 41. respectively.

Also within the scope of the invention is a kit for identifying a transgenic plant, cells or tissues thereof including the elite RF-BN1 event, which includes PCR primers, one of which recognizes a foreign DNA of the RF-BN1 sequence within the sequence of SEQ ID NO: 2, and the other recognizes The 5 'flanking DNA of the RF-BN1 sequence within the sequence of SEQ ID NO: 24 or the 3' flanking DNA of the RF-BN1 sequence within the sequence of SEQ ID NO: 30, for use in a PCR identification protocol.

In a preferred kit, a primer recognizing the foreign DNA of the RF-BN1 sequence recognizes the foreign DNA of the RF-BN1 sequence within the sequence shown in SEQ ID NO: 24 or SEQ ID NO: 30.

PL 205 071 B1

In a preferred kit, the PCR primers include the nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 41, respectively.

The invention also relates to a kit for the identification of an elite MS-BN1 event in biological samples, which comprises at least one PCR primer or probe recognizing the 5 'flanking DNA of the MS-BN1 sequence within the sequence shown in SEQ ID NO: 13 or the 3' flanking DNA of the MS sequence. -BN1 within the sequence of SEQ ID NO: 18. In a preferred set, a PCR primer or probe recognizes the 5 'flanking sequence of MS-BN1 comprising the sequence SEQ ID NO: 19.

The kit preferably further comprises at least a second PCR primer or a probe which recognizes the sequence of foreign MS-BN1 DNA within the sequence shown in SEQ ID NO: 1, more preferably a second PCR primer or probe recognizes the foreign DNA of MS-BN1 within the sequence shown in SEQ ID NO: 1 ID: 13 or SEQ ID NO: 18, also preferably the second PCR primer or probe comprises the sequence SEQ ID NO: 12.

The invention also relates to a method for confirming seed purity which comprises detecting an MS-BN1 specific DNA sequence in seed samples using a specific primer or probe specifically recognizing the 5 'flanking MS-BN1 sequence within the sequence shown in SEQ ID NO: 13 or 3'. flanking the MS-BN1 sequence within the sequence shown in SEQ ID NO: 18.

The invention further relates to a method of screening seeds for the presence of MS-BN1 which comprises detecting an MS-BN1 specific DNA sequence in a sample from a seed lot using a specific primer or probe specifically recognizing the 5 'flanking sequence of MS-BN1 within the sequence shown in SEQ. 13 or 3 'flanking MS-BN1 sequence within the sequence shown in SEQ ID NO: 18.

Kit for identification of the RF-BN1 elite event in biological samples, which contains at least one PCR primer or probe that recognizes the 5 'flanking sequence RF-BN1 within the sequence of SEQ ID NO: 24 or the 3' flanking sequence RF-BN1 within the sequence with SEQ ID NO: 30 also falls within the scope of the invention.

In a preferred kit, a PCR primer or probe recognizes a 5 'flanking sequence RF-BN1 comprising the sequence shown in SEQ ID NO: 41.

Preferably the kit further comprises at least a second PCR primer or probe recognizing the foreign DNA of the sequence RF-BN1 within the sequence shown in SEQ ID NO: 2, more preferably a second PCR primer or probe which recognizes the sequence of foreign DNA RF-BN1 within the sequence shown in SEQ ID NO: 2 Either in SEQ ID NO: 30, also more preferably a second PCR primer or probe comprises the sequence shown in SEQ ID NO: 23.

Also within the scope of the invention is a method for confirming seed purity which comprises detecting an RF-BN1 specific DNA sequence in seed samples using a specific primer or probe specifically recognizing the 5 'flanking region of RF-BN1 within the sequence shown in SEQ ID NO: 24 or 3 'flanking region for RF-BN1 within the sequence shown in SEQ ID NO: 30.

The invention also relates to a method of screening seeds for the presence of RF-BN1 which comprises detecting an RF-BN1 specific DNA sequence in a sample from a seed batch using a specific primer or probe specifically recognizing the 5 'flanking region for RF-BN1 within the sequence. shown in SEQ ID NO: 24 or the 3 'flanking region for RF-BN1 within the sequence shown in SEQ ID NO: 30.

The solutions according to the invention make it possible to obtain a transgenic winter oilseed rape (WOSR) plant or its seeds, cells or tissues containing an expression cassette embedded in the genome containing the gene sterile for male gametes and the second transgenic WOSR plant, or its seeds, cells or tissue containing the integrated into the genome an expression cassette carrying the fertility restoring gene and hybrid seeds obtained by crossing the first and second plants, which contains a male sterility gene and / or a fertility restoring gene integrated into the genome.

The solutions according to the invention also enable the production of a kit for identifying the elite event MS-BN1 and / or RF-BN1 in biological samples, which kit comprises at least one specific primer or probe having a sequence corresponding to (or complementary to) a sequence having between 80% and 100% sequence identity to a specific region of MS-BN1 and / or at least one specific primer or probe having a sequence corresponding to (or complementary to) ) sequences with 80% to 100% sequence identity to spec6

PL 205 071 B1 phonic region of RF-BN1. Preferably, the probe sequence corresponds to a specific region comprising part of the 5 'or 3' flanking region of MS-BN1 and / or RF-BN1. A more preferred specific probe has (or is complementary to) a sequence with 80% to 100% identity to the plant DNA sequence of SEQ ID NO. 36 or SEQ ID NO. 38 for MS-BN1 or with the plant DNA sequence within SEQ ID NO. 39 or SEQ ID NO. 40 for RF-BN1.

Preferably, the kit comprises, in addition to a primer specifically recognizing the 5 'or 3' flanking region of MS-BN1 and / or RF-BN1, and a second primer specifically recognizing a sequence within the foreign DNA of MS-BN1 and / or RF-BN1 for use in the PCR identification protocol. . Such a kit may contain two (or more) specific primers, one of which recognizes a sequence in the 3 'flanking region of MS-BN1 and / or RF-BN1, most preferably a sequence from the plant DNA region of SEQ ID NO. 36 or SEQ ID NO. 38 for MS-BN1 or the plant DNA sequence of SEQ ID NO. 39 or SEQ ID NO. 40 for RF-BN1 and another which recognizes the sequence within the foreign DNA MS-BN1 and / or RF-BN1, respectively. It is particularly preferred that the primer recognizes a plant DNA sequence within the 5 'flanking region of MS-BN1 which comprises the nucleotide sequence of SEQ ID NO. 19. In particular, a primer which recognizes a plant DNA sequence within the 5 'flanking region of MS-BN1 comprises the nucleotide sequence of SEQ ID NO. 19 and the foreign DNA recognition primer MS-BN1 recognizes the nucleotide sequence of SEQ ID NO. 12, which is described here. It is particularly preferred that the primer recognizes a plant DNA sequence within the 5 'flanking region of RF-BN1 which comprises the nucleotide sequence of SEQ ID NO. 21. Particularly, the primer recognizes the sequence of plant DNA within the 5 'flanking region of MS-BN1 containing the nucleotide sequence of SEQ ID NO. 41 and a primer recognizing the foreign DNA RF-BN1 comprising the nucleotide sequence SEQ ID NO. 23.

The methods and kits described herein may be used for a variety of purposes, such as, but not limited to: identifying MS-BN1 and / or RF-BN1 in plants, plant material, or in products such as, but not limited to, food or food products (fresh or treated) containing or derived from plant material. Additionally or alternatively, such methods and kits can be used to identify material from a transgenic plant for the purpose of segregating transgenic and non-transgenic material. Additionally or alternatively, such methods and kits can be used to determine the quality (i.e., percent purity of the material) of the plant material containing MS-BN1 and / or RF-BN1.

Brief description of the drawings

The following detailed description is provided by way of example only, and is not intended to limit the invention to the specific embodiment described, and will be more readily understood in conjunction with the accompanying Figures incorporated herein by reference in which:

Fig. 1 Map of plasmid pVE113.

Fig. 2 Restriction map obtained after digestion of MS-BN1 genomic DNA.

Gel-separated sequences were analyzed by Southern blot: lane 1, EcoRI digested MS-BN1 DNA, lane 2, EcoRV digested MS-BN1 DNA, lane 3 Hpal digested MS-BN1 DNA, lane 4 MS-BN1 digested DNA AfIIII, lane 5 NdeI digested MS-BN1 DNA, lane 6 BamHI digested non-transgenic WOSR DNA, lane 7 BamHI digested non-transgenic WOSR DNA + control plasmid DNA of BamHI digested pTHW107.

Fig. 3 The restriction map obtained after digestion of the genomic DNA of RF-BN1.

Gel-separated sequences were analyzed by Southern blot: lane 1, BamHI digested RF-BN1 DNA, lane 2, EcoRI digested RF-BN1 DNA, lane 3 EcoRV digested RF-BN1 DNA, lane 4 HindIII digested RF-BN1 DNA, lane 5 not BamHI digested WOSR transgenic DNA, lane 6 BamHI digested non-transgenic WOSR DNA + control plasmid DNA of BamHI digested pTHW118.

Fig. 4 PCR analysis of the different paths using the MS-BN1 PCR identification protocol.

Gel-separated sequences: lane 1, DNA sample from OSR plant containing MS-BN1 transgene, lane 2, DNA sample from OSR plant containing another transgene, lane 3, DNA from wild-type OSR, lane 4, negative control (water), lane 5, molecular weight marker (100 bp ladder).

Fig. 5 PCR analysis of the different paths using the RF-BN1 PCR identification protocol.

Gel-separated sequences: lane 1, DNA sample from OSR plant containing RF-BN1 transgene, lane 2, DNA sample from OSR plant containing another transgene, lane 3, DNA from wild-type OSR, lane 4, negative control (water), lane 5, molecular weight marker (100 bp ladder).

PL 205 071 B1

The term "gene, as used herein, denotes any DNA sequence comprising several operably linked DNA fragments, such as a promoter and a 5 'untranslated region (5'UTR), which together form a promoter region and a coding region (which may or may not encode a protein) and 3 'untranslated region (3' UTR) containing a polyadenylation site. Typically in plant cells 5'UTR, the coding region and 3'UTR are transcribed into RNA, which in the case of a gene encoding protein is translated into protein. The gene may contain additional DNA fragments, such as, for example, introns. A genetic locus as used herein is a site of a given gene in the genome of a plant.

The term "chimeric when referring to a gene or DNA sequence is used to indicate that a gene or DNA sequence contains at least two DNA fragments (such as a promoter, 5'UTR, coding region, 3'UTR, intron) that are naturally related to each other and come, for example, from different sources. "Alien refers to a gene or DNA sequence in relation to an animal species and is used to indicate that the gene or DNA sequence does not occur naturally in that plant species or is not found in nature at that genetic locus in that species. plants. The term "foreign DNA will be used herein to denote a DNA sequence that is integrated into the plant genome as a result of transformation. Transforming DNA as used herein refers to a recombinant DNA molecule used for transformation. A transforming DNA typically comprises at least one "gene of interest (e.g., a chimeric gene) that is capable of establishing one or more specific properties of a transformed plant. The term "recombinant DNA molecule is used by way of example, and thus may include an isolated nucleic acid molecule, which may be DNA and which may be obtained by recombinant or other methods.

The term "transgene" as used herein denotes a gene of interest inserted into the genome of a plant. "A transgenic plant is a plant that contains at least one transgene in the genome of all its cells.

The foreign DNA present in the plants of the present invention will preferably contain two genes of interest, more specifically both the male sterility gene and the herbicide resistance gene, or the fertility restoring gene and the herbicide resistance gene.

"Male sterile (male sterile) gene as used herein defines a gene which, when expressed in a plant, renders it incapable of producing fertile, viable pollen. An example of a male sterile gene is a gene containing a DNA sequence encoding barnase under the control of a promoter causing expression in tapetum cells. More specifically, according to the present invention, the male sterility gene is "TA29-barnase" as described.

"A fertility restoring gene as used herein defines a gene that, when expressed in a plant having a male sterile gene, is capable of preventing expression of a male sterile gene-mediated phenotype, restoring fertility in the plant. More specifically, the fertility restoring gene is "TA2 9-barstar" as described.

Integration of a recombinant DNA molecule into the plant genome is typically achieved by transforming a cell or tissue (or by other genetic manipulation). The specific place of incorporation of the fragment depends on the case or is predetermined (if the process of integration to a specific place is used - the addressed integration).

Foreign DNA can be characterized by the location and configuration at the site of incorporation of a recombinant DNA molecule in the plant genome. The site in the plant genome where the recombinant DNA is integrated is also referred to as the "integration site or" target site. Integration of a transgene into the plant genome may be associated with a deletion of the plant DNA, referred to herein as "deletion of the target site." "Flanking region or" sequence, flanking region (s) as used herein refers to sequences of at least 20 base pairs, preferably at least 50 base pairs, and up to 5,000 base pairs long. " base pairs of the genome of a plant that is located either immediately in front of, while being sequentially linked, or immediately downstream of being linked in a string to foreign DNA. Transformation procedures leading to random integration of foreign DNA will result in transformants with different surrounding regions that are characteristic and unique to each transformant. When a transgene is introduced into a plant by traditional crossbreeding, its site of integration into the plant genome or the surrounding areas generally will not be altered. "Area of ​​incorporation as used herein defines an area corresponding to a region and a length of at least 40 base pairs, preferably at least 100 base pairs, and up to more than 10,000. base pairs, flanked by the surrounding regions of the transgene from the genome of the (non-transformed) plant and including the site of integration (and presumably a deletion at the target site). Given the smaller differences due to mutations in species, the insertion site will retain at least 85%, preferably 90%, more preferably 95%

And most preferably 100% sequence identity with a sequence including regions flanking foreign DNA in a given plant of that species.

Expression of a gene of interest refers to the fact that the gene establishes one or more phenotypic traits in a plant (e.g., herbicide tolerance) that are conceived to be established by the introduction of a recombinant DNA molecule - DNA transformation - used during transformation (on the basis of structure and function some or all of the gene (s) of interest).

“An event is defined as a genetic (artificial) locus which, through genetic manipulation, carries foreign DNA containing at least one copy of the gene (s) of interest. A typical allelic event state is the presence or absence of foreign DNA. As used herein, MS and RF events will define events carrying the "TA29-barnase and" TA29-barstar transgenes, respectively. An event is phenotypically characterized by expression of one or more transgenes. At the genetic level, an event is part of a plant's genetic makeup. At the molecular level, the event is characterized by a restriction map (e.g., as determined by Southern blot) and / or by preceding and / or subsequent sequences flanking the transgene and / or by the molecular configuration of the transgene. Typically, the transformation of a plant with transforming DNA involves at least one gene of interest, leading to multiple events, each of which is unique.

"Elite event as used herein is an event from a group of events obtained by transformation with transforming DNA alone or by backcrossing with plants obtained by such transformation, based on the expression and stability of the transgene and the compliance with the optimal agronomic characteristics of the plant containing it.

Thus, the criteria for selecting an elite event are one or more, preferably two or more, most preferably all of the following:

(a) the presence of the transgene does not disturb other desirable properties of the plant, such as agronomic or commercial merit;

b) the event is characterized by a well-defined molecular configuration that is stably inherited and for which appropriate diagnostic tools can be developed to check its identity;

c) the gene (s) of interest in the transgene reveal (s) appropriate and locally and temporally stable phenotype expression both in heterozygotes (or hemizygotes) and homozygotes for the event at a commercially acceptable level under the environmental conditions to which the event bearing plants are likely to be exposed during cultivation.

It is preferred that the foreign DNA is bound to a site in the plant genome that allows it to be introduced into a commercially desirable genetic background.

The status of an event as an elite event is confirmed by introducing an elite event into various relevant genetic backgrounds and observing the implementation of one, two or all of the above criteria, e.g. a), b) and c).

In addition, for the transgenes encoding the male sterility and fertility restoration described herein, a selection of elite events based on the agreement of these events will also be determined. More specifically, progeny obtained by crossing a plant bearing the male sterility event and a plant bearing the fertility restorer when both events occur will have the following characteristics:

a) adequate expression of the fertility reproductive phenotype, i.e. male fertility, i

b) expression of the phenotype at a commercially acceptable level within the environmental conditions to which plants bearing the two events are likely to be exposed during cultivation.

Thus, "an elite event identifies a genetic locus containing a transgene meeting the criteria described above. A plant, plant material, or progeny, such as seeds, may contain one or more elite events in its genome.

“Diagnostic tools designed to identify an elite event or plant or plant material containing an elite event are based on specific properties of the elite event in the genome, such as a specific restriction map of the genome region containing the foreign DNA and / or the sequence of the area (s) surrounding the transgene. "Restriction map" as used herein defines a set of Southern blot patterns obtained after cutting the genomic DNA of a plant with a defined restriction enzyme, or set of restriction enzymes, and hybridization to a probe of transgene-like sequence under conventional stringency hybridization conditions. As used herein, typical stringency hybridization conditions refer to the conditions for the hybridization described herein or to the conventional hybridization conditions described by Sambrook et al. (1989) (Molecular Cloning: A LaboPL 205 071 B1 ratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press NY), which, for example, may include the following steps: 1) immobilization of genomic plant DNA fragments on the filter, 2) pre-hybridization of the filter for 1 to 2 hours at 42 ° C in 50% formamide, 5 x SSPE, 2x Denhardf's reagent and 0.1% SDS, or for 1 to 2 hours at 68 ° C in 6 x SSC, 2x Denhardf's reagent and 0.1% SDS, 3) addition of the hybridization probe that is labeled, 4) incubation for 16 to 24 hours, 5) washing the filter for 20 min. in temp. room in 1 x SSC, 0.1% SDS, 6) washing the filter three times, 20 min each time at 68 ° C in 0.2 x SSC, 0.1% SDS and 7) exposing the filter for 24 to 48 hours against X-ray film at -70 ° C with an intensifying screen.

Depending on the (internal) restriction sites present in the genome prior to incorporation of the foreign DNA, incorporation of the foreign DNA will alter the specific restriction map of that genome. Thus, a particular transformant or its progeny may be identified by one or more specific restriction patterns. The conditions for determining an event restriction map are given in the "Restriction Map Identification Protocol." Alternatively, once the nucleotide sequence of one or both of the regions surrounding the transgene has been determined, PCR-probes that specifically recognize the sequence (s) due to the "PCR identification protocol" can be developed. Plants or plant material containing an elite event can be identified by testing according to the PCR identification protocol with these specific primers.

A biological sample, as used herein, means that it is a sample of a plant, plant material, or products containing plant material. The term "plant as used herein includes winter oilseed rape plant - WOSR (Brassica napus), plant tissues at any stage of maturity, as well as any cells, tissues or organs derived from or derived from any plant including, without limitation, seeds, leaves, stalks. , flowers, roots, single cells, gametes, cell cultures, tissue cultures or protoplasts. Plant material as used herein refers to material which is obtained or derived from a plant. Products containing plant material relate to food, food or other products that are made with plant material, or that may be contaminated with plant material. In the context of the present invention, it is understood that such biological samples are preferably tested for the presence of MS-BN1 and / or RF-BN1 specific nucleic acids suggesting the presence of nucleic acids in the samples. Consequently, the methods defined herein for identifying an elite event MS-BN1 and / or RF-BN1 in biological samples preferably relate to the identification of nucleic acids containing an elite event in biological samples.

"A kit as used herein relates to a kit of reagents for carrying out the method of the invention, more particularly the identification of elite event MS-BN1 and / or RF-BN1 in biological samples. More particularly, a preferred embodiment of the kit of the invention comprises at least one or two specific primers as described above. Optionally, the kit may further contain any other reagent described in the PCR identification protocol. Alternatively, according to another embodiment of this invention, the kit may include a specific probe as described above that hybridizes specifically to a nucleic acid of biological samples to identify the presence of MS-BN1 and / or RF-BN1 therein. Conditionally, the kit may further include any other reagent (such as, but not limited to, hybridization buffer, label) for identification in biological samples using a specific probe, MS-BN1 and / or RF-BN1.

The kit of the invention may be used, and its components may be specifically tailored for quality control (e.g. seed batch purity), elite event detection in plant material, or material containing or derived from plant material, such as but not limited to food and products. food.

The present invention relates to the development of a set of elite events in WOSR, MS-BN1 and RF-BN1 for plants containing these events, progeny obtained by crossing these plants and plant cells or plant material derived from these events. Plants containing MS-BN1 elite events were obtained by transforming with pTHW108 as described in Example 1. Plants containing the elite event RF-BN1 were obtained by transforming with THW118 also as described in Example 1.

The recombinant DNA molecules used to generate the MS-BN1 elite event contain the DNA sequence encoding the barnase molecule under the control of a promoter selectively acting in tapetum cells (referred to as "TA29-barnase). The TA29 promoter gives a tapetum-specific expression pattern in OSR (De Block and Debrouwer, Planta 189: 218-225, 1993). Expression of the TA29barnase gene in WOSR plants causes the destruction of the tapetum and, consequently, male sterility (Ma10

Riani et al., 1990, supra). The recombinant DNA molecule used to generate the RF-BN1 elite event contains a DNA sequence encoding a barstar molecule which is under the control of a tapetum specific promoter (termed "PTA29-barstar). Expression of the TA29-barstar gene in WOSR plants will be in the presence of the "TA29-barnase gene" prevented barnase activity in the plant's tapetum cells, preventing the destruction of the tapetum and thus restoring fertility in these plants (Mariani et al., 1992, supra).

The recombinant DNA to generate the elite event MS-BN1 and RF-BN1 additionally contains a DNA sequence encoding the enzyme phosphinothricin acetyltransferase and the 35S promoter from cauliflower mosaic virus characterized in that the sequence encoding the phosphinothricin acetyltransferase is under the control of the 35S promoter (termed "35S-bar). The 35S promoter has a "constitutive expression pattern" in OSR, meaning that it is significantly expressed in most cell types throughout most of the plant's life cycle. Expression of the 35S-bar gene in OSR plants determines resistance to the herbicidal compounds of phosphinothricin or bialaphos or glufosinate, or more generally glutamine synthetase inhibitors, or salts or optical isomers thereof.

WOSR plants or plant material containing MS-BN1 can be identified according to the restriction map identification protocol described in Example 5 for MS-BN1. Briefly, WOSR genomic DNA is digested with a combination (preferably two to five) of the following restriction enzymes: EcoRI, EcoRV, NdeI, Hpal, AfIIII, transferred to nylon membranes and hybridized with a 3942 bp Hindlll fragment from plasmid pTHW107 (or containing it go T-DNA). Then, for each restriction enzyme used, it was determined whether the following fragments could be identified:

- EcoRI: between 2140 and 2450 base pairs in length, preferably 2266 base pairs and one fragment larger than 14K. base pairs;

- EcoRV: one fragment with a size between 1159 and 1700 bp, preferably around 1.4k. base pairs and one fragment greater than 14K base pairs;

- Hpal: one fragment with a size between 1986 and 2140 bp, preferably about 1990 bp, and one fragment with a size between 2140 and 2450 bp, preferably about 2229 bp;

- AfIIII: one fragment between 514 and 805 bp, preferably about 522 bp, one fragment between 2140 and 2450 bp, preferably about 2250 bp and one fragment between 2450 and 2838 bp, preferably about 2477 bp;

- NdeI: two fragments between 5077 and 14057 base pairs in length, preferably one around 6500 base pairs and one around 10,000 in length. base pairs;

The lengths of the DNA fragments are determined by comparison with a set of DNA fragments of known length, especially PstI fragments for bacteriophage lambda DNA. In the case of fragments longer than 14 thousand. base pairs are estimated to be between 14,000 base pairs and 40K base pairs when DNA extraction was performed according to the method of Dellaport et al. (1983, Plant Molecular Biology Reporter, 1, vol. 3 p. 1921).

If the plant material after digestion with at least two, preferably at least three, especially at least four, more particularly at least all of these enzymes yields DNA fragments of the same length as those described above, the WOSR plant is defined as harboring the MS-BN1 elite event.

Plants or plant material containing MS-BN1 may also be identified according to the PCR identification protocol for MS-BN1 provided herein in Example 5. Briefly, WOSR genomic DNA is amplified by PCR with a primer that specifically recognizes the sequence flanking MS-BN1, preferably a 5 'or 3' recognition sequence flanking MS-BN1 as described herein, particularly the primer sequence SEQ ID NO: 19 and the primer recognizing sequences in the transgene, especially the primer with the sequence SEQ ID NO: 12. Endogenous WOSR primers were used as controls. If the plant material yields a fragment of between 260 and 300 bp, preferably about 280 bp, then the plant is determined to harbor the elite event MS-BN1.

Plants harboring MS-BN1 are phenotypically characterized by the fact that in the absence of a reproductive gene in their genome, they are male sterile. Male sterility is defined as the inability to produce fertile, viable pollen.

Plants harboring MS-BN1 can, for example, be obtained from seed containing MS-BN1 deposited with the ATCC under accession number PTA-730. Such plants can then be propagated to introduce the elite event of the invention into other plant cultivars of the same species.

PL 205 071 B1

WOSR plants or plant material containing RF-BN1 can be identified from a restriction map according to the identification protocol described for RF-BN1 in Example 5. Briefly, WOSR genomic DNA is digested with selected (preferably two to four) the following restriction enzymes: BamHI, EcoRI , EcoRV and HindIII and is then transferred to nitrocellulose filters and hybridized with the 2182 bp HpaI fragment of plasmid pTHW118 (or T-DNA containing it). Then, for each restriction enzyme used, it is determined whether the following DNA fragments can be identified:

- BamHI: one fragment between 805 and 1099 bp, preferably around 814 bp, one fragment between 1700 and 1968 bp, preferably around 1849 bp, one fragment between 2450 and 2838 bp , preferably about 2607 base pairs and one fragment having a size between 5077 and 14057 base pairs, preferably about 6500 base pairs;

- EcoRI: one fragment between 805 and 1159 bp, preferably around 1094 bp, one fragment between 1986 and 2450 bp, preferably around 2149 bp, and two fragments between 5077 and 14057 bp , preferably one about 7,000 base pairs and one about 10,000 base pairs;

- EcoRV: two fragments between 5077 and 14057 base pairs, preferably one about 5.4K. base pairs and about 8K base pairs;

- HindIII: one fragment between 1700 and 1986 bp, preferably about 1969 bp and two fragments between 2450 and 2838 bp, preferably one between about 2565 bp and one about 2635 bp;

The lengths of the DNA fragments are determined by comparison with a set of DNA fragments of known length, particularly fragments obtained by digesting lambda bacteriophage DNA with PstI.

If the plant material after digestion with at least two, preferably at least three, especially at least four, more particularly at least all of these enzymes yields DNA fragments of the same length as those described above, the WOSR plant is determined to be carrying the RF-BN1 elite event.

Plants or plant material containing RF-BN1 can also be identified according to the PCR identification protocol for RF-BN1 which is described in Example 5. Briefly, WOSR genomic DNA is amplified by PCR with a primer that specifically recognizes the surrounding sequence. RF-BN1, preferably a 5 'or 3' recognition sequence flanking RF-BN1 as described herein, particularly a primer having the sequence SEQ ID NO. 41 and a primer that recognizes the sequences in the transgene, especially the primer with the sequence SEQ ID NO. 23. Endogenous primers for WOSR were used as controls. If the plant material yields a fragment of between 195 and 230 bp, preferably about 215 bp, then the plant is determined to harbor the elite event RF-BN1.

Plants harboring RF-BN1 are characterized by the fact that the barstar gene is expressed in tapetum cells. The production of barstar in plant tapetum cells was found to be neither beneficial nor detrimental to pollen production (Mariani et al., 1992, supra). Thus, in the absence of the male sterility gene in the plant genome, the TA29-barstar gene will not produce an observable phenotype. In the presence of the male sterility gene in the plant genome, the TA29-barstar gene will restore fertility, ie the fertile phenotype. A plant with a restored fertile phenotype is defined as a plant that, regardless of the presence of the male sterility gene in its genome, is capable of producing fertile, viable pollen.

Plants harboring RF-BN1 can, for example, be obtained from seeds deposited with the ATCC under accession number PTA-730. Such plants may furthermore be propagated and / or used in a conventional breeding scheme to introduce the elite event of the invention into other cultivars of the same plant species.

Plants harboring MS-BN1 and / or RF-BN1 are also glufosinate tolerant, such as in the context of the present invention include Liberty ™ herbicide tolerant plants. Liberty ™ tolerance is defined by the criterion that spraying plants at the three to four leaf stage (3V to 4V) at least 200 g of active ingredient per hectare (gai / ha), preferably 400 gai / ha and presumably up to 1600 gai / ha does not kill plants. Plants harboring MS-BN1 and / or RF-BN1 can further be characterized by the presence of phosphinothricin acetyltransferase in their cells as determined by the PAT assay (DeBlock et al., 1987, supra).

The WOSR plants of the present invention can be grown in conventional manner. The presence of the 35S-bar gene ensures that they are tolerant to glufosinate. Hence the weeds in the field,

Where WOSR is grown can be controlled by the use of herbicides containing glufosinate as an active ingredient (such as Liberty ™).

Plants harboring MS-BN1 and / or RF-BN1 are also characterized by having agronomic characteristics that are compatible with commercially available WOSR varieties in the USA. Relevant agronomic traits are plant height, strength, shoot stiffness, propensity to lay, winter hardiness, breaking resistance, drought tolerance, disease resistance (black leg, leaf blotch, Sclerotinia), grain production and yield.

It has been observed that the presence of foreign DNA at the insertion sites in the WOSR Brassica napus plant genome described herein, more specifically at the insertion sites in the Brassica napus WOSR genome, establishes a particularly favorable phenotype and molecular characterization of plants exhibiting these events. More specifically, the presence of foreign DNA in these particular regions of the plant genome results in stable expression of the transgene phenotype without significantly compromising the agronomic properties of the plants, making them particularly useful for the production of WOSR hybrids. Thus, the insertion regions corresponding to SEQ ID NO. 22 and SEQ ID NO. 34, more particularly the insertion site MS-BN1 and RF-BN1, are as shown particularly useful for inserting the gene (s) of interest. More specifically, the insertion regions of MS-BN1 (SEQ ID NO. 22) and RF-BN1 (SEQ ID NO. 34) or the insertion sites of MS-BN1 and RF-BN1, respectively, are particularly useful for the introduction of plasmids containing the male sterility gene and a fertility restoring gene, ensuring optimal expression of each of these genes, or both, in the plant without disturbing its agronomic properties.

More specifically, the recombinant DNA molecule can be inserted into the insertion region by means of methods designed for targeted insertion. Such methods are well known to those skilled in the art and include, for example, homologous recombination using a recombinase such as, but not limited to, the Saccharomyces cerevisiae FLP recombinase (US patent 5,527,695), the Escherichia coli P1 CRE recombinase (PCT publication WO 9109957), a recombinase from pSRI from Saccharomyces rouxii (Araki et al., 1985, J. Mol. Biol. 182: 191-203) or a lambda phage recombination system as described in US Patent 4,673,640.

As used herein, "sequence identity with respect to nucleotide sequences (DNA or RNA) defines the number of sites with identical nucleotides divided by the number of nucleotides in the shorter of the two sequences. The alignment of the two nucleotide sequences was performed by the Wilbur and Lipmann algorithm (Wilbur and Lipmann, 1983) using a window of 20 nucleotides, words 4 nucleotides long with a gap penalty of four. Computer analysis and interpretation of sequence data include the sequence alignment described above, e.g., performed by Intelligentic ™ Sweet (Intelligentics Inc., CA). Sequences are given as "substantially similar when the identity of such sequences is about 75%, preferably at least about 80%, more preferably at least about 85%, even more preferably about 90%, especially about 90%, and most preferably about 100%, and most preferably when identical. It is understood that when RNA sequences are determined to be substantially similar or have a defined level of identity to DNA sequences then thymine (T) in the DNA is the equivalent of uracil (U) in the RNA sequence. As used herein, "comprising is construed to denote the presence of a particular feature, value, step, or components relating to, but not excluding the presence or addition of, one or more features, values, steps or components, or groups thereof. For example a nucleic acid or protein comprising nucleotide or amino acid sequences may contain more nucleotides or amino acids than that which is currently quoted, i.e., present in a larger nucleic acid or protein molecule. A chimeric gene containing a DNA sequence that is functionally or structurally defined may contain additional DNA sequences, etc.

The following examples describe the production and properties of winter oilseed rape (WOSR) plants carrying the elite MS-BN1 and RF-BN1 events.

Unless otherwise stated, all recombinant DNA techniques are performed according to the standard protocols described in Sambrook et al. (1989) Molecular cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, NY and volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Common materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by RDD Croy published by BIOS Scientific Publications Ltd. (UK) and Blackwell Scientific Publications UK.

In the description, examples and references refer to the following sequences:

SEQ ID NO: 1: plasmid pTHW107

SEQ ID NO: 2: plasmid pTHW118

PL 205 071 B1

SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEC NO

SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO SEQ NO

3: starter 248

4: starter 249

5: starter 247

6: starter 250

7: starter 251

8: starter 254

9: starter 258

10: SP6 starter

11: T7 starter

12: starter 201 (BNA01)

13: sequence including the 5 'area surrounding MS-BN1 14: primer 611 15: primer 259 16: primer 260 17: primer 24

18: sequence including the 3 'region surrounding MS-BN1 19: primer 51 (BNA02)

20: starter 48

21: sequence containing deletion target MS-BN1 22: insertion region MS-BN1 23: primer 193 (BNA03)

24: sequence including approximately 5 'surrounding area RF-BN1 25: primer 286 26: primer 314

27: starter 315 28: starter 316

ID 29:

primer 288 sequence containing the entire 3 'area surrounding RF-BN1 primer 269 primer 283 primer 284 integration area RF-BN1 primer 57 sequence containing the entire 5' area surrounding MS-BN1 in WOSR primer 68 sequence containing the entire 3 'area surrounding the MS -BN1 in WOSR sequence containing the entire 5 'region surrounding RF-BN1 in WOSR sequence containing the entire 3' region surrounding RF-BN1 in WOSR primer 268 (BNA04) primer BNA05 primer BNA06

Examples

Example 1. Transformation of Brassica napus with male sterility and fertility restorer gene.

a) Construction of chimeric DNA containing the barnase gene under the control of a tapetum specific promoter (pTHW107).

The pTHW107 plasmid (SEQ ID NO. 1) was essentially derived from the intermediate pGSV1 vector. PGSV1 itself is derived from pGSC1700 (Cornelissen and Vandewielle, 1989), but contains an artificial T region containing a left and right border sequence from the TL-DNA of pTiB6S3 and a multiple cloning site allowing the insertion of chimeric genes between border T-DNA repeats. The vector pGSV1 is provided with the barstar gene in the main frame of the plasmid, with regulatory signals for expression in E.coli.

A full description of the DNA contained between border repeats of pTHW107 is given in Table 1:

PL 205 071 B1

TABLE 1: T-DNA of the pTHW107 plasmid

<td>Nucleotide position</td><td>Orientation</td><td>Description and literature</td>

<td> 1-25</td><td></td><td>TL-DNA right border repeat from pTiB6S3 (Gielen et al. (1984) The EMBO Journal 3: 835-846).</td>

<td> 26-97</td><td></td><td>Sequences derived from synthetic polylinker.</td>

<td> 309-98</td><td>counterclockwise</td><td>3 'untranslated region from gene 7 (3'g7) TL-DNA from pTiB6S3 (Velten and Schell (1985) Nucleic Acids Research 13: 6981-6998; Dhaese et al. (1983) The EMBO Journal 3: 835-846).</td>

<td> 310-330</td><td></td><td>Sequences derived from synthetic polylinker.</td>

<td> 882-331</td><td>counterclockwise</td><td>Coding sequence for the bar gene from Streptomyces hygroscopicus (Thompson et al. (1987) The EMBO Journal 6: 2519-2523). The two N-terminal codons of the wild-type bar coding region were substituted with ATG and GAC codons, respectively.</td>

<td> 2608-883</td><td>counterclockwise</td><td>Promoter from the gene for atS1A small subunit of ribulose-1,5-bisphosphate carboxylase from Arabidopsis thaliana (PssuAra) (Krebbers et al. (1988) Plant Molecular Biology 11: 745-759).</td>

<td> 2609-2658</td><td></td><td>Sequences derived from synthetic polylinker.</td>

<td> 2919-2659</td><td>counterclockwise</td><td>A 260 bp Taql fragment from the 3 'untranslated end of the nopaline synthetase gene (3' nos) from the T-DNA of pTiT37 containing a plant polyadenylation signal (Depicker et al. (1982) Journal of Molecular and Applied Genetics 1: 561-573 ).</td>

<td> 2920-3031</td><td></td><td>3 'untranslated region downstream of the B. amyloliquefaciens barnase coding sequence.</td>

<td> 3367-3032</td><td>counterclockwise</td><td>The coding region of the barnase gene from Bacillus amyloliquefaciens (Hartley (1988) Journal of Molecular Biology 202: 913-915).</td>

<td> 4877-3368</td><td>counterclockwise</td><td>The promoter region of the TA29 gene, specific for Nicotiana tabacum anthers. The promoter contains 1.5 thousand. base pairs of sequences upstream of the ATG translation initiation codon (Seurinck et al. (1990) Nucleic Acids Research 18: 3403).</td>

<td> 4878-4921</td><td></td><td>Sequences derived from synthetic polylinker.</td>

<td> 4922-4946</td><td></td><td>TL-DNA left border repeat from pTiB6S3 (Gielen et al. (1984) The EMBO Journal 3: 835-846).</td>

b) Construction of chimeric DNA containing the barstar gene under the control of the constitutive promoter (pTHW118).

The pTHW118 plasmid (SEQ ID NO. 2) was essentially derived from the intermediate vector pGSV1 (described above). A full description of the DNA contained between border repeats of pTHW118 is given in Table 2:

TABLE 2: T-DNA of pTHW118 plasmid

<td>Position nucleotides</td><td>Orientation</td><td>Description and literature</td>

<td> 1</td><td> 2</td><td> 3</td>

<td> 1-25</td><td></td><td>TL-DNA right border repeat from pTiB6S3 (Gielen et al. (1984) The EMBO Journal 3: 835-846).</td>

<td> 26-53</td><td></td><td>Sequences derived from synthetic polylinker.</td>

PL 205 071 B1 cont. table 2

<td> 1</td><td> 2</td><td> 3</td>

<td> 54-90</td><td></td><td>The residue of the TL-DNA sequence in the right border repeat.</td>

<td> 91-97</td><td></td><td>Sequences derived from synthetic polylinker.</td>

<td> 309-98</td><td>counterclockwise</td><td>3 'untranslated region from gene 7 (3'g7) TL-DNA from pTiB6S3 (Velten and Schell (1985) Nucleic Acids Research 13: 6981-6998; Dhaese et al. (1983) The EMBO Journal 3: 835-846) .</td>

<td> 310-330</td><td></td><td>Sequences derived from synthetic polylinker.</td>

<td> 883-331</td><td>counterclockwise</td><td>Bialaphos resistance coding sequence (bar gene) from Streptomyces hygroscopicus (Thompson et al. (1987) The EMBO Journal 6: 2519-2523). The two N-terminal codons of the wild-type bar coding region were substituted with ATG and GAC codons, respectively.</td>

<td> 2608-883</td><td>counterclockwise</td><td>Promoter from the gene for atS1A small subunit of ribulose 1,5-bisphosphate carboxylase from Arabidopsis thaliana (PssuAra) (Krebbers et al. (1988) Plant Molecular Biology 11: 745-759).</td>

<td> 2609-2658</td><td></td><td>Sequences derived from synthetic polylinker</td>

<td> 2919-2659</td><td>counterclockwise</td><td>A 260 bp Taql fragment from the 3 'untranslated end of the nopaline synthetase gene (3' nos) from the T-DNA of pTiT37 containing a plant polyadenylation signal (Depicker et al. (1982) Journal of Molecular and Applied Genetics 1: 561-573 ).</td>

<td> 2920-2940</td><td></td><td>Sequences derived from synthetic polylinker</td>

<td> 2941-2980</td><td></td><td>3 'untranslated region downstream of the barstar coding sequence from Bacillus amyloliquefaciens.</td>

<td> 3253-2981</td><td>counterclockwise</td><td>The coding region of the barstar gene from Bacillus amyloliquefaciens (Hartley (1988) Journal of Molecular Biology 202: 913-915).</td>

<td> 4762-3254</td><td>counterclockwise</td><td>The promoter region of the TA29 gene, specific for Nicotiana tabacum anthers. The promoter contains 1.5 thousand. base pairs of sequences upstream of the ATG translation initiation codon (Seurinck et al. (1990) Nucleic Acids Research 18: 3403).</td>

<td> 4763-4807</td><td></td><td>Sequences derived from synthetic polylinker</td>

<td> 4808-4832</td><td></td><td>TL-DNA left border repeat from pTiB6S3 (Gielen et al. (1984) The EMBO Journal 3: 835-846).</td>

c) Transformation of Brassica napus.

The vector system described by Deblaere et al. (1985, 1987) was used to transform Brassica napus. The vector system comprises an Agrobacterium strain and two plasmids 1) a non-oncogenic Ti plasmid (pGV4000) and 2) an intermediate cloning vector based on the pGSV1 plasmid. The non-oncogenic Ti plasmid from which the T region has been removed carries the vir gene required for transfer of the artificial T-DNA cloned on the second plasmid into the plant genome. Agrobacterium strains obtained from a tri-parent cross between these components can be used for plant transformation.

Selection was carried out on phosphinothricin (PPT) at all steps, except for graft regeneration, which was done without PPT to accelerate growth. As a result, a set of primary transformants (T0 generation plants) was obtained.

Example 2. Obtaining Events.

2.1 Characterization of transgenic events

2.1.1 Southern blot analysis of MS events

Presence of the transgene and the number of gene insertions were checked by standard Southern blot analysis. Total genomic DNA was isolated from 1g of sprout tissue according to Dellaport (1983, Plant Molecular Biology Reporter, 1 vol. 3, pp. 19-21 or Doyle et al. 1987, Photochem. Bull. 19:11) and digested with the restriction enzyme SacI. SacI has a unique restriction site in the T-DNA fragment at skill16

PL 205 071 Blown between barnase and bar constructs. Southern analyzes were performed with the following two probes:

barnase probe: 478 bp PstI-EcoRI fragment from plasmid pVE113 barnase: 546 bp NcoRI-BgIII fragment from plasmid pDE110.

The plasmid pVE113 and pDW110 are described in Figure 1 and in WO 92/09696, respectively. Hybridization of MS events with the barnase probe resulted in 12K base pairs, while hybridization with the bar probe resulted in a 14K fragment. base pairs.

The relative intensity of the band gave an indication of whether the plants were homozygous or hemizygous at the transgenic locus. Two events with simple inserts were found. This was confirmed by the fact that the segregation pattern of a transgene can be explained by Mendelian inheritance of a single locus.

2.1.2. Southern blot analysis of RF events.

The presence of the transgene and the number of gene insertions were characterized by standard Southern blot analysis. Total genomic DNA was isolated from 1 g of sprout tissue (according to Doyle et al. 1987, Photochem. Bull. 19:11) and digested with the restriction enzyme SacI. SacI has a unique restriction site in the T-DNA fragment located between the barnase and the bar constructs. Southern analyzes were performed with the following two probes:

barnase probe: 436 bp HindIII-Pstl fragment from plasmid pVE113 barnase probe: 546 bp NcoI-BglI fragment from plasmid pDW110.

Hybridization of the RF events with the barnase gave a labeled band for the 3k base pair band, while hybridization with the barnase gave a 14k fragment. base pairs.

The relative intensity of the band gave an indication of whether the plants were homozygous or hemizygous at the transgenic locus. Two events with simple inserts were found. This was confirmed by the fact that the segregation pattern of a transgene can be explained by Mendelian inheritance of a single locus.

2.1.3. General plant phenotype and agronomic properties.

T1 plants with both MS and RF events were assessed for a number of phenotypic traits including plant height, stem strength / stiffness, tendency to lay, resistance to breaking, drought tolerance, disease resistance (black leg, leaf spot, sclerotine) and production seeds and fertility.

The strains were assessed to be similar (or improved) in agronomic properties as compared to untransformed varieties as well as to a number of oilseed rape cultivars. In some cases, plants segregate to give somatic variants due to one or more of the aforementioned traits. If the result was not the introduction of commercially interesting phenotypic traits, the plants were rejected.

2.2 Receipt of lines bearing MS or RF features.

Various T0 hemizygous plants ("Ms / -" or "Rf / -") derived from tissue culture were planted in greenhouse soil. The presence of the transgene and the copy number were checked by Southern blot analysis (described above). The plants were allowed to bloom and the sterility or fertility of the flowers was assessed as appropriate. T0 plants were crossed with wild-type (- / -) plants to produce T1 seeds (MsT1 and RfT1). T1 seeds were planted and grown in a greenhouse. Plants were assessed for their tolerance to ammonium glufosinate. Ms-T1 plants were also assessed for sterility / fertility segregation (unsprayed plants), while Rf-T1 plants were checked for flower fertility.

Ms-T1 plants containing the transgene were crossed with a test plant homozygous for the fertility restorer (Rf / Rf) gene to produce MsRf-Fl seeds. These seeds (Ms / -, Rf / - and - / -, Rf / -) were planted in a greenhouse and sprayed with Liberty ™. The remaining F1 progeny were assessed for fertility / sterility segregation by testing whether the male sterility trait could be adequately reproduced in Brassica napus (fertility close to 100%).

The best events were selected for further testing. MsT1 plants were crossed with a homozygous fertility restorer and the seeds were sown in the field. Plants were assessed for tolerance to Liberty ™ herbicide (800 grams active ingredient per hectare (gai / ha), farmer recommended dose is 400 gai / ha), segregation of fertility / sterility and overall phenotype characterization. Lines were selected in which fertility was 100% restored and which showed no negative changes in phenotype or agronomic properties (listed under (d)) compared to isogenic wild-type controls.

PL 205 071 B1

Rf-T1 plants containing the transgene were crossed with test plants containing the male sterility (Ms / -) gene to generate F1 seeds. These seeds were sown in a greenhouse, sprayed with Liberty ™, and fertility restoration was assessed (nearly 100%).

At the same time, the Rf-T1 plants are self-hybridized to produce S1. S1 plants were grown in a greenhouse, sprayed with Liberty ™ and self-crossbred to obtain S2, and from S2 homozygous units were selected.

2.3. combination of MS and RF events

To test for fertility restoration, selected Ms-T1 plants were crossed in the greenhouse with the selected Rf-S2 events. The seeds were pickled in a greenhouse, the plants sprayed with Liberty ™ and the fertility and flowers were checked.

2.4. testing MS and RF events in different genetic backgrounds and locations

Selected events were introduced into two significant different genetic backgrounds to confirm that MS and RF events functioned well and had no negative effect on yield or quality in any background tested.

At the same time, selected MS and RF events are tested in four to five different environments ensuring that there are no negative interactions between the environment and MS or RF events.

In the next step, the production of hybrid seed was more extensively tested in the field using selected MS and RF events.

A selected MS event in its original background and in two different and heterozygous backgrounds was crossed with two selected RF events in their original background and two different heterozygous backgrounds. Hybrid F1 was evaluated for resistance to Liberty ™, for fertility, as well as for overall agronomic properties (yield and quality).

2.5. selection of elite events

The above-described selection procedure to generate the transgenic MS line resulted in a series of elite events that reveal optimal transgene expression, i.e. ammonium glufosinate resistance, a male sterility phenotype and a fertility full restoration susceptibility with a homozygous fertility restoration line, more specifically the selected RF elite event.

Example 3: Introduction of candidates for an elite event to the WOSR.

The series of elite MS and RF events that were obtained in B. napus as described above were introduced by successive crosses with Drakkar plants into WOSR winter oilseed rape cultivars.

Plants were checked and it was found that:

a) the presence of the foreign DNA does not impair other desirable plant characteristics such as agronomic or commercial properties;

b) the event was characterized by a well-defined molecular configuration that is stably inherited;

c) the gene (s) of interest in the foreign DNA showed the correct, appropriate and spatially and temporally stable expression phenotype, both in the heterozygote (or hemizygote) and homozygote in terms of the event, at a commercially acceptable level, within the environmental conditions to which the plants carrying the event are likely to be exposed during normal cultivation.

In addition, the plants were assessed for their agronomic characteristics and behavior compared to wild-type WOSR species.

Intensive field studies have shown that certain candidate elite events of spring oilseed rape when introduced into WOSR winter oilseed rape produce plants displaying appropriate gene expression in foreign DNA, combined with optimal agronomic properties. These events were selected as elite MS and RF events in WOSR and named MS-BN1 and RF-BN1, respectively.

Example 4. Characterization of the elite Ms-BN-1 and RF-BN1 events.

When MS-BN1 and RF-BN1 were identified as elite events where expression of the respective transgenes as well as overall agronomic properties were optimal, the transgene loci were studied in detail at the molecular level. This includes detailed Southern blotting (using multiple restriction enzymes) and sequencing of the regions surrounding the transgene.

PL 205 071 B1

4.1 Southern blot analysis with multiple restriction enzymes.

Leaf tissue was harvested from transgenic and control plants. Total genomic DNA was isolated from leaf tissue according to Dellaporta et al. (1983, Plant Molecular Biology Report, 1, vol. 3 pp. 19-21). The DNA concentration of each preparation was determined by measuring the optical density with a spectrophotometer at 260 nm.

gg of genomic DNA was digested with restriction enzyme in a final reaction volume of 40 µl, using the reaction conditions recommended by the manufacturer. The digestion time and / or the amount of restriction enzyme were determined to ensure complete digestion of the genomic DNA samples without non-specific degradation. After digestion, 4 g of loading dye was added to the digested DNA samples and loaded onto a 1% agarose gel.

The following control DNA was also applied to the gel:

- negative control from a genomic DNA preparation from a non-transgenic Brassica plant. This negative control is used to confirm no hybridization background.

- Positive control DNA: from a heterozygote embedded with a single copy of the transgene into the Brassica napus genome, 10 gq of genomic DNA contains the same number of molecule equivalents as ± 19 picograms of the 1501 bp PvuI-HindIII fragment of pTHW118 DNA (size of the Brassica napus diploid genome: 0.8x10⁹ base pairs). An amount corresponding to one plasmid copy per genome is added to 1 gq of the digested non-transgenic Brassica napus DNA. The reconstructed sample is used to show that hybridizations are performed under conditions that allow the probe to hybridize to target sequences.

Lambda phage DNA (strain Clind 1 ts 857 Sam 7, Life Technologies) digested with PstI was used as a size standard.

After electrophoresing the DNA samples (digested Brassica genomic DNA, control and size standards DNA), they were transferred to a nylon membrane by capillary blotting for 12 to 16 hours.

DNA templates used to prepare the probe for MS-BN1 events were prepared by HindIII restriction digestions of PTW107. This releases a 3942 bp DNA fragment containing the appropriate part of the transforming DNA (part of PSSUARA, 3'nos, barnase, PTA29).

The DNA templates used to prepare the probe for the RF-BN1 events were prepared by Hpal restriction digestions of PTW118. This releases a 2182 bp DNA fragment containing the appropriate part of the transforming DNA (part of PSSUARA, 3'nos, barstar, PTA29).

After purification, the DNA fragments were labeled according to standard procedures and used for hybridization to the filter.

Hybridization was performed under conditions of standard stringency. The labeled probes were denatured by heating for 5 to 10 minutes in a 95 ° C to 100 ° C water bath and cooling on ice for 5 to 10 minutes and adding to the hybridization solution (6XSSC (20X SSC to 3.0 M NaCl, 0 , 3 M sodium citrate, pH 7.0), 5X Denhardt's solution (100X Denhardt's solution = 2% Ficoll, 2% polyvinyl pyrolidone, 2% bovine serum albumin), 0.5% SDS and 20 gq / ml denatured carrier DNA (single-stranded DNA from fish sperm, average length 120-3000 nucleotides). Hybridization was performed overnight at 65 ° C. Filters were washed three times for 20 to 40 minutes at 65 ° C with washing solution (2X SSC, 0.1% SDS).

Autoradiographs were scanned electronically.

4.1.1. MS-BN1.

The restriction patterns obtained after digestion of MS-BN1 genomic DNA with various restriction enzymes are shown in Figure 2 and summarized in Table 3.

TABLE 3: Restriction Map of MS-BN1

<td rowspan="2">Track No.</td><td rowspan="2">DNA imprinted</td><td colspan="2">Migration of hybridizing DNA fragments between bands of the size marker</td><td rowspan="2">Hybrid Estimated Length absorbing DNA fragments</td>

<td>Bigger than</td><td>Smaller than</td>

<td> 1</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td>

<td rowspan="2"> 1</td><td rowspan="2">MS-BN1-EcoRI</td><td> 2140</td><td rowspan="2"> 2450</td><td>2666 base pairs (*)</td>

<td> 14057</td><td>&gt; 14,000 base pairs</td>

<td rowspan="2"> 2</td><td rowspan="2">MS-BN1-EcoRV</td><td> 1159</td><td> 1700</td><td>1.4 thousand base pairs (*)</td>

<td> 14057</td><td> -</td><td>&gt; 14 thousand base pairs</td>

PL 205 071 B1 cont. table 3

<td> 1</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td>

<td> 4</td><td>MS-BN1-Hpal</td><td> 1986 2140</td><td> 2140 2450</td><td>1990 base pairs 2229 base pairs</td>

<td></td><td></td><td> 2450</td><td> 2838</td><td>2477 base pairs (*)</td>

<td> 5</td><td>MS-BN1-Afllll</td><td> 2140</td><td> 2450</td><td>2250 base pairs</td>

<td></td><td></td><td> 514</td><td> 805</td><td>552 base pairs (*)</td>

<td rowspan="2"> 6</td><td rowspan="2">MS-BN1-Ndel</td><td> 5077</td><td> 14057</td><td>10 thousand base pairs</td>

<td> 5077</td><td> 14057</td><td>6510 thousand base pairs</td>

<td> 7</td><td>non-transgenic WOSR</td><td> -</td><td> -</td><td> -</td>

<td rowspan="2"> 8</td><td>Control plasmid DNA</td><td> 1700</td><td> 1986</td><td>1966 base pairs (*)</td>

<td>ne - BamHI</td><td> 2450</td><td> 2838</td><td>2607 base pairs (*)</td>

(*) the lengths of these fragments are those determined from the restriction map of the pTHW107 plasmid.

4.1.2. RF-BN1

The restriction patterns obtained after digestion of the genomic DNA of RF-BN1 with various restriction enzymes are shown in Fig. 3 and summarized in Table 4.

Table 4: Restriction Map of RF-BN1

<td rowspan="2">Track number</td><td rowspan="2">DNA imprinted</td><td colspan="2">Migration of hybridizing DNA fragments between bands of the size marker</td><td rowspan="2">Estimated length of the hybridizing DNA fragments</td>

<td>Bigger than</td><td>Smaller than</td>

<td></td><td></td><td> 805</td><td> 1099</td><td>814 base pairs</td>

<td rowspan="2"> 1</td><td rowspan="2">MS-BN1-BamHI</td><td> 1700</td><td> 1986</td><td>1849 base pairs (*)</td>

<td> 2450</td><td> 2838</td><td>2607 base pairs (*)</td>

<td></td><td></td><td> 5077</td><td> 14057</td><td>6580 thousand base pairs</td>

<td></td><td></td><td> 805</td><td> 1159</td><td>1094 base pairs</td>

<td rowspan="2"> 2</td><td rowspan="2">MS-BN1-EcoRI</td><td> 1986</td><td> 2450</td><td>2149 base pairs</td>

<td> 5077</td><td> 14057</td><td>7,000 base pairs</td>

<td></td><td></td><td> 5077</td><td> 14057</td><td>10 thousand base pairs</td>

<td rowspan="2"> 3</td><td rowspan="2">MS-BN1-EcoRV</td><td> 5077</td><td> 14057</td><td>5.4k base pairs</td>

<td> 5077</td><td> 14057</td><td>8 thousand base pairs</td>

<td></td><td></td><td> 1700</td><td> 2140</td><td>1969 base pairs</td>

<td> 4</td><td>MS-BN1-HindIII</td><td> 2450</td><td> 2838</td><td>2565 base pairs</td>

<td></td><td></td><td> 2450</td><td> 2838</td><td>2635 base pairs</td>

<td> 5</td><td>Non-transgenic WOSR</td><td> -</td><td> -</td><td> -</td>

<td> 6</td><td>Control plasmid DNA - BamHI</td><td> 1700 2450 5077</td><td> 1986 2838 14057</td><td>1849 base pairs (*) 2607 base pairs (*) 8100 bp</td>

(*) the lengths of these fragments are those determined from the restriction map of plasmid pTHW118 for BamH1.

4.2. Identification of surrounding / flanking areas.

The areas surrounding the elite MS-BN1 and RF-BN1 events were first identified for the OSR spring oilseed rape where the events occurred and then checked for the WOSR winter oilseed rape.

4.2.1. Identification of the regions surrounding MS-BN1

4.2.1.1. Right (5 ') surrounding area

The MS-BN1 right border sequence was used, the polymerase chain reaction linking reaction (Mueller et al. 1989, Science 780-786; Maxine et al., 1994, PCR Methods and Applications, 71-75) with the capture of elongated molecules (Tormanen et al., 1993, NAR

20:5487-5488).

PL 205 071 B1

The oligonucleotides used to prepare the linker were:

MDB248: (SEQ ID NO. 3)

5'CAT GCC CTG ACC CAG GCT AAG TAT TTT AAC TTT AAC CAC TTT GCT CCG ACA GTC CCA TTG

MDB249: (SEQ ID NO. 4)

5'CAA TGG GAC TGT CGG AGG ACT GAG GGC CAA AGC TTG GCT CTT AGC CTG GGT CAG GGC ATG

The preparation of the linker was preceded by the synthesis of the first strand from the genomic MS-BN1 DNA digested with NcoI, using biotinylated gene-specific primers:

<td></td><td>Sequence (5 '^ 3')</td><td>Place in pTHW107</td>

<td>biotinylated starter MDB247</td><td>CCG TCA CCG AGA TCT GAT CTC ACG CG (SEQ ID NO. 5)</td><td> 322 347</td>

The linker is then attached to the first DNA strand, which is then attached to the magnetic beads from which the non-biotinylated strands are eluted. DNA was used for larger scale PCR amplification using the following primers:

<td></td><td>Sequence (5 ^ 3 ')</td><td>Place in pTHW107</td>

<td>liaison starter MDB250</td><td>GCACTGAGGGCCAAAGCTTGGCTC (SEQ ID NO. 6)</td><td> -</td>

<td>T-DNA primer MDB251</td><td>GGATCCCCCGATGAGCTAAGCTAGC (SEQ ID NO. 7)</td><td> 293 317</td>

PCR yields a fragment of approximately 1150 bp. The right stopper fragment was purified from the agarose gel and subsequent PCR was performed on 100-fold diluted DNA with the following primers:

<td></td><td>Sequence (5 ^ 3 ')</td><td>Place in pTHW107</td>

<td>connector starter MDB254</td><td>CTTAGCCTGGGTCAGGGCATG (SEQ ID NO. 8)</td><td> -</td>

<td>T-DNA primer MDB258</td><td>CTACGGCAATGTACCAGCTG (SEQ ID NO. 9)</td><td> 224 243</td>

The obtained fragment, approximately 1000 bp in length, was eluted from the agarose gel, purified and ligated to the pGem®-T vector. Recombinant plasmid DNA was searched using a standard PCR reaction with the following primers:

<td></td><td>Sequence (5 '^ 3')</td><td>Place in pTHW107</td>

<td>SP6 starter</td><td>TAATACGACTCACTATAGGGCGA (SEQ ID NO. 10</td><td>(SP6 promoter in the pGem®-T vector)</td>

<td>starter T7</td><td>TTTAGGTGACACTATAGAATAC (SEQ ID NO.11)</td><td>(T7 promoter in the pGem®-T vector)</td>

<td>T-DNA primer MDB201</td><td>gCTTGGACTATAATACCTGAC (SEQ ID NO.12)</td><td> 143 163</td>

The following fragments were obtained:

SP6-T7: 1224 bp

SP6-MDB201: 1068 bp

T7-MDB201: 1044 bp.

The right border fragment was purified and its nucleotide sequence (SEQ ID NO. 13) was determined to give a 963 bp fragment of which 1-867 corresponds to plant DNA and bp 868 to 953 corresponds to the T-DNA of pTW107.

4.2.1.2. Left (3 ') area surrounding MS-BN1

The nucleotide sequence of the left border region surrounding the transgene in the MS-BN1 event was determined by the (TAIL-) PCR method as described by Liu et al. (1995, The Plant JourPL 205 071 B1 nal 8 (3): 457-463). The method uses three specific nested primers in sequential reactions along with a shorter arbitrarily degenerate (AD) primer such that the relative efficiency of specific and non-specific amplification can be thermally controlled. Specific primers were selected to bind to the border sequences of the transgene based on their conditions of attachment. A small amount (5 μί) of crude secondary and tertiary PCR products were analyzed on a 1% agarose gel. The tertiary reaction product used for preparative amplification was purified and its nucleotide sequence determined using an automated nucleotide sequence determination device and the DyeDeoxy Terminator cycle kit.

The following primers were used:

<td></td><td>Sequence (5 '^ - 3')</td><td>Place in pTHW107</td>

<td>MDB611 degenerate starter</td><td>NgTCgASWgTNTWCAA (SEQ ID NO.14)</td><td> -</td>

<td>Primary TAIL MDB259 starter</td><td>gTgCAGGGAAgCggTTAACTgg (SEQ ID NO. 15)</td><td> 7164 4186</td>

<td>Secondary TAIL MDB260 starter</td><td>CCTTTggAgTAAATggTgTTgg (SEQ ID NO.16)</td><td> 4346 4366</td>

<td>TAIL HCA24 Tertiary Starter</td><td>gCTTGGACTATAATACCTGAC (SEQ ID NO. 17)</td><td> 4738 4757</td>

where N = A &lt;C &lt;T or g; S = C or g; W = A or T

The fragment amplified with HCA24-MDB611 was 540 bp, of which the nucleotide sequence was determined at 537 bp (3 'neighborhood of SEQ ID NO. 18). The sequence between bases 1 and 180 is pTHW107 DNA, while the sequence between 181 and 537 corresponds to plant DNA.

4.2.1.3. Identification of the targeted deletion.

Using primers corresponding to the sequences surrounding the transgene regions and as a template of Brassica napus var. Wild-type Drakkar has identified a transgene integration site.

The following primers were used:

<td></td><td>Sequence (5 '^ - 3')</td><td>A place in the 5 'neighborhood (SEK ID NO. 13)</td><td>A place in 3 'surroundings (SEK ID NO. 18)</td>

<td>VDS51</td><td>TgACACTTTgAgCCACTCg (SEQ ID NO. 19)</td><td> 733 751</td><td> -</td>

<td>HCA48</td><td>GgAgggTgTTTTTggTTATC (SEQ ID NO. 20)</td><td> -</td><td> 189 208</td>

This resulted in a 178 bp fragment (SEQ ID NO. 21) where bases 132 to 150 correspond to the target deletion site.

4.2.1.4. Identification of the MS-BN1 insertion site.

Based on the identification of the flanking regions and the deletion target site, the MS-BN1 insertion region (SEQ ID NO. 22) can be determined:

1-822 5 'surrounding base region 46-867 of SEQ ID NO. 13

823-841 deletion site for base 132-150 of SEQ ID NO. 21

842-1198 3 'surrounding base region 181 to 537 of SEQ ID NO. 18

4.2.2. Identification of the area surrounding the RF-BN1 region.

Border regions surrounding RF-BN1 were defined by Vectorette-PCR (Use of Vectorette and Subvectorette PCR to isolate transgene flanking DNA, Maxine J. Allen, Andrew Collick and Alec J. Jeffreys PCR Methods and Applications - 1994 (4) pages 71-75) using HindIII digested genomic DNA of RF-BN1 as template. The "vectorette linker was made with the above-described primers MDB248 (SEQ ID NO. 3) and MDB249 (SEQ ID NO. 4).

PL 205 071 B1

4.2.2.1. Right (5 ') area surrounding BN-RF1. The following primers were used:

<td></td><td>Sequence (5 '^ 3')</td><td>Item in pTHW118</td>

<td>Vectorette MDB250 starter</td><td>GCACTGAGGGCCAAAGCTTGGCTC (SEQ ID NO. 6)</td><td> -</td>

<td>Vectorette MDB254 starter</td><td>CTTAGCCTGGGTCAGGGCATG (SEQ ID NO. 8)</td><td> -</td>

<td>MDB251 T-DNA primer</td><td>GGATCCCCCGATGAGCTAAGCTAGC (SEQ ID NO. 7)</td><td> 293 317</td>

<td>T-DNA primer MDB193</td><td>CTACGGCAATGTACCAGC (SEQ ID NO 23)</td><td> 226 243</td>

<td>T-DNA primer MDB258</td><td>CTACGGCAATGTACCAGCTG (SEQ ID NO. 9)</td><td> 224 243</td>

<td>MDB201 T-DNA primer</td><td>GCTTGGACTATAATACCTGAC (SEQ ID NO.12)</td><td> 143 163</td>

A fragment of 1077 bp (SEQ ID NO. 24) was obtained in which bases 1-881 correspond to the plant DNA and base pairs 882-1077 correspond to the T-DNA of pTW118.

4.2.2.2. Left area surrounding BN-RF1

To identify the 3 'surrounding elite event region BN-RF1, TAIL PCR was performed as described above using the arbitrarily degenerate primer and primers located in the T-DNA adjacent to the left border region.

The starters used were:

Arbitrarily degenerate starter:

MDB286 NTg.CgA.SWg.ANA.WgA.A where: N = A, C, T or g; S = C or g; W = A or T

T-DNA primers:

MDB314 gTAggAggTTgggAAgACC

MDB315 gggCTTTCTACTAgAAAgCTCTCgg

MDB316 CCgATAgggAAgTgATgTAggAgg (SEQ ID NO.25) (SEQ ID NO.26) (SEQ ID NO.27) (SEQ ID NO.28)

The resulting fragment was approximately 2000 bp. This fragment was cloned into the pGem®-T vector and used as a template for a PCR reaction carried out with the following primers:

Plant DNA primer:

MDB288 T-DNA primer ATgCAgCAAgAAgCTTggAgg (SEQ ID NO.29)

MDB314 gTAggAggTTgggAAgACC (SEQ ID NO. 26)

A 1500 bp fragment (SEQ ID NO. 30) was obtained, in which base pairs 1-166 correspond to the T-DNA from plasmid pTW118 and 167-1441 corresponds to plant DNA.

4.2.2.3. Molecular analysis of the targeted deletion.

The targeted deletion was cloned by TAIL-PCR (described above) using wild-type genomic DNA and plant-specific primers binding upstream of the T-DNA insert inserted in orientation into the insert:

Arbitrary degenerate starter:

MDB286 NTgCgASWgANAWgAA where: N = A, C, T or g; S = C or g; W = A or T

Plant DNA primers

MDB269 ggTTTTCggAggTCCgAgACg

MDB283 CTTggACCCCTAggTAAATgC

MDB284 gTACAAAACTTggACCCCTAgg (SEQ ID No. 25) (SEQ ID No. 31) (SEQ ID No. 32) (SEQ ID No. 33)

A fragment with a length of 1068 bp (SEQ ID NO. 34) was obtained in which:

53-83:

84-133:

134-1055:

5 'flanking region deletion target 3' flanking region

PL 205 071 B1

After incorporation of T-DNA, a 51 bp deletion of the target site was made. Sequence comparison of the wild-type locus with the Rf3 locus revealed the presence of filler DNA at the junction with the right border sequence. The TCTCG stuffer sequence in the right border is flanked at the 5 'end by the TCA sequence and at the 3' end by the CGA. These triangles were also found at the appropriate breakpoints of the targeted deletion and T-DNA. Examination of the most distant plant sequences revealed the possible origin of the filler DNA. The TCA.TCTCG.CGA sequence is also found in plant DNA at the 3 'end of the targeted deletion site. This is a core sequence of 13 nucleotide identical repeats located 210 base pairs downstream of the targeted deletion site.

The region of an RF-BN1 insertion may be defined as including the left region surrounding the site of the addressed deletion and the right region surrounding the following:

1-881: 5 'surrounding area (1-881 of SEQ ID NO. 24)

882-932: deletion target site (84-133 of SEQ ID NO. 34)

933-2207: 3 'surrounding region (167-1441 of SEQ ID NO. 30)

4.3. Genetic analysis of the locus

The genetic stability of the insertions for two events was checked by molecular and phenotypic analyzes of the progeny of plants over several generations.

Southern blot results of the T0, T1, and T2 generation were compared for both MS-BN1 and RF-BN1 events. It was found that the obtained formulas are identical for each of the events in different generations. This confirmed that the molecular configuration of the transgenes was stable in both MS-BN1 and RF-BN1 containing plants.

The events MS-BN1 and RF-BN1 revealed Mendelian segregation for the respective transgenes as single genetic loci in at least three consecutive generations showing that the inserts are stable.

Based on the above results, MS-BN1 and MS-RF1 were identified as elite events.

4.4. Identification of the flanking sequences of MS-BN1 and RF-BN1 in WOSR winter oilseed rape.

Sequences surrounding the MS-BN1 and RF-BN1 elite events in WOSR were determined with primers that were generated from the sequences surrounding these events in spring oilseed rape. The right (5 ') flanking sequence of MS-BN1 WOSR was determined with a T-DNA primer (SEQ ID NO. 12) and a primer positioned at the MS-BN1 right border plant DNA.

VDS57: 5'-gCATgATCTgCTCgggATggC-3 '(SEQ ID NO. 35)

The resulting fragment was 909 bp (SEQ ID NO. 36) with a sequence substantially similar to that of SEQ ID NO. 13 (starting at nucleotide 98).

The left (3 ') MS-BN1 WOSR flanking sequence was determined with a T-DNA primer (SEQ ID NO. 17) and a primer positioned on the left flanking MS-BN1 plant DNA sequence:

HCA68: 5'-CCATATAcgCCAgAgAggAC-3 '(SEQ ID NO 37)

The resulting fragment was 522 bp (SEQ ID NO. 38) with a sequence substantially similar to that of SEQ ID NO. 18.

The right (5 ') flanking sequence of RF-BN1 was determined with a T-DNA primer (SEQ ID NO. 12) and a primer located at the RF-BN1 right border plant DNA (SEQ ID NO. 31). The resulting fragment was 694 bp (SEQ ID NO. 39) with a sequence substantially similar to that of SEQ ID NO. 24 (from nucleotide 293 to 980).

The left border sequence for RF-BN WOSR was determined with a T-DNA primer (SEQ ID NO. 26) and a primer located at the left border RF-BN1 plant DNA (SEQ ID NO. 29). A fragment with a length of 1450 bp was obtained, of which the nucleotide sequence of 1279 bp was determined (SEQ ID NO. 40). This sequence appeared to be substantially similar to the sequence of SEQ ID NO. 30 (from nucleotide 141 to 1421).

Consequently, it was confirmed that the left and right border sequences in the MS-BN1 and RF-BN1 elite events are substantially similar in spring oilseed rape (SOSR) and winter oilseed rape (WOSR).

PL 205 071 B1

Example 5

Development of diagnostic tools for identity checks

The following protocols were developed to identify the WOSR plant material containing the elite MS-BN1 event.

5.1 MS-BN1 and RF-BN1 elite event identification protocol based on the restriction map.

WOSR plants containing the MS-BN1 elite event can be identified by Southern blot using substantially the same procedures as described in Example 4.1. The WOSR genomic DNA is thus 1) digested with at least two, preferably at least three, particularly at least four, particularly preferably with all of the following restriction enzymes: EcoRI, EcoRV, NdeI, Hpal, AfIIII, 2) transferred to nylon filters and 3) hybridized with a 3942 bp fragment obtained after HindIII digestion of the plasmid pTHW107. If, for at least two of the restriction enzymes used, the identified DNA fragments are of the same length as listed in Table 3 of Example 4.1.1., The WOSR plant is determined to be harboring the elite event MS-BN1.

WOSR plants containing the RF-BN1 elite event can be identified by Southern blot using essentially the same procedure as described in Example 4.1. Thus, the WOSR genomic DNA is 1) digested with at least two, preferably at least three, more preferably all of the following restriction enzymes: BamHI, EcoRI, EcoRV, HindIII 2) transferred to nylon filters and 3) hybridized with the 2182 bp fragment of plasmid pTHW118 obtained after digestion of Hpal. If, for at least two of the restriction enzymes used, the identified DNA fragments have the same length as those listed in Table 4 of Example 4.1.2., Then the WOSR plant is determined to carry the elite event RF-BN1.

5.2 MS-BN1 and RF-BN1 Elite Event Identification Protocol by Polymerase Chain Reaction.

Before the actual test, a test study with appropriate control reactions should be performed. The current protocol may require optimization of components that may differ between laboratories (template DNA preparations, Taq polymerase, primer quality, d-NTPes, thermocycler, etc.).

Endogenous sequence amplification plays a key role in this protocol. One can perform PCR under conditions in which equal molar amounts of both endogenous and transgenic sequences of a known template, which are the DNA of the transgenic genome, are amplified. Whenever the target, endogenous fragment is not amplified, or whenever the target sequences are not amplified so as to produce the same glow intensity of the fragments after staining with ethidium bromide, as judged by agarose gel electrophoresis, optimization of the PCR conditions may be required.

5.2.1. DNA matrix

The template DNA is prepared with either a leaf or a single seed according to Edwards et al. (Nucleic Acid Research, 19, pp. 1349, 1991). When the used DNA has been prepared by other means, a test reaction using different amounts of template should be performed. Typically 50 ng of genomic DNA template gives the best results.

5.2.2. Established positive and negative control experiments

The following positive and negative controls should be included in the PCR reaction:

- control experiment with a stock mixture (negative control for DNA). This is a PCR reaction in which no DNA is added to the reaction. When the expected absence of PCR products is observed, it means that the PCR mix was not contaminated with target DNA.

- DNA positive control (a genomic DNA sample known to contain the transgene sequence). A positive amplification reaction result with the positive control indicates that the PCR was performed under conditions appropriate to the amplification of the target sequence.

- wild DNA control. Such PCR is performed with template DNA obtained from genomic DNA from non-transgenic plants. If the expected results are obtained, i.e., there is no PCR amplification for the transgene and the endogenous product is amplified by PCR, this indicates that there is no measurable transgene contamination in the genomic DNA sample.

PL 205 071 B1

5.2.3. Starters

The following primers were used that specifically recognize the transgene and the sequences flanking MS-BN1:

<td>BNA01:</td><td>5'-gCTTggACTATAATACCTgAC-3 '</td><td>(SEQ ID 12)</td>

<td>(MDB201)</td><td>(target: transgene)</td><td></td>

<td>BNA02:</td><td>5'-TgACACTTTgAgCCACTCg-3 '</td><td>(SEQ ID 19)</td>

<td>(VDS51)</td><td>(target: plant DNA)</td><td></td>

<td colspan="3">The following primers were used to identify plant material containing RF-BN1, which specified</td>

<td colspan="2">digitally recognize the transgene and the surrounding RF-BN1 sequence:</td><td></td>

<td>BNA03:</td><td>5'-TCATCTACggCAATgTACCAg-3 '</td><td>(SEQ ID 23)</td>

<td>(MDB193)</td><td>(target: transgene)</td><td></td>

<td>BNA04:</td><td>5'-TggACCCCTAggTAAATgCC-3 '</td><td>(SEQ ID 41)</td>

<td>(MDB268)</td><td>(target: plant DNA)</td><td></td>

Primers targeting the internal sequence are always included in the PCR mix. These primers serve as internal controls in unknown samples and in DNA positive control. The positive result obtained with the endogenous primer pairs shows that the DNA sample is of adequate quality in the genomic DNA preparation to obtain the PCR product. The endogenous starters used are:

BNA05: 5'-AACgAgTgTCAgCTAgACCAgC-3 '(SEQ ID 42)

BNA06: 5'-CgCAgTTCTgTgAACATCgACC-3 '(SEQ ID 43)

5.2.4. Amplified fragments.

The expected PCR-amplified fragments are:

For primer pair BNA05-BNA06: For primer pair BNA01-BNA02: For primer pair BNA03-BNA04:

394 base pairs (endogenous control)

280 base pairs (elite event MS-BN1) 215 base pairs (elite event RF-BN1)

5.2.5. PCR conditions.

The 50 μl PCR reaction mix contains:

il template DNA and l 10x concentrated amplification buffer (supplied with Taq Polymerase) μί 10 mM dNTPs μ BNA01 (MS-BN1) or BNA03 (RF-BN1) (10 ρη ^ ί / μ!) μ BNA02 (RF-BN1 ) or BNA04 (RF-BN1) (10 pmoίi / μί)

0.5 μ BNA05 (10 pmoίi / μί)

0.5 μ BNA06 (10 pmoίi / μί)

0.2 µl Taq DNA polymerase (5 units / µl) water to 50 µl.

For optimal results, the temperature cycle profiles will be as follows:

min at 95 ° C then: 1 min at 95 ° C min at 57 ° C min at 72 ° C for 5 cycles then 30 sec. at 92 ° C sec. at 57 ° C 1 min at 72 ° C for 22 to 25 cycles then 5 minutes at 72 ° C.

5.2.6. Analyzes in agarose gel.

10 to 20 µl of the sample obtained by PCR should be loaded on a 1.5% agarose gel (Tris-borate buffer) with an appropriately sized molecular marker (e.g. 100 bp Ladder, PHARMACIA).

PL 205 071 B1

5.2.7. Evaluation of the results.

Data obtained for one sample of the transgenic plant, one PCR reaction performed with one mixture for PCR should not be accepted unless 1) the positive control reveals the expected PCR products (transgenic and endogenous fragment), 2) the negative DNA control is negative for PCR amplification ( no fragments) and 3) the control with wild type DNA gives the expected result (amplification of endogenous fragments).

Lanes revealing observable amounts of transgenic and endogenous PCR products of the expected size show that the respective plant from which the genomic DNA template was prepared inherited the elite event MS-BN1 and / or RF-BN1. Lanes that did not reveal observable amounts of transgenic and endogenous PCR products show that the respective plant from which genomic DNA was prepared does not contain an elite event. Lanes showing no observable amounts of endogenous and transgenic products demonstrate that the quality and / or quantity of genomic DNA does not permit the generation of a PCR product. Such plants cannot be evaluated. The preparation of genomic DNA should be repeated and a new PCR run performed, with appropriate controls.

5.2.8. Use of a PCR discriminant protocol for the identification of MS-BN1 and RF-BN1.

WOSR leaves derived from either plants containing MS-BN1, RF-BN1 or other transgenic event were tested according to the protocol described above. Samples taken from the wild-type WOSR were used as negative controls.

The results of the PCR analysis are shown in Figures 4 and 5.

Fig. 4 illustrates the result obtained according to the protocol for elite event PCR identification for MS-BN1 performed on two WOSR samples (lanes 1 and 2). Lane 1 is recognized as containing an elite event by detecting a 280 bp band, while sample 2 does not contain MS-BN1.

Fig. 5 illustrates the result obtained according to the elite event PCR identification protocol for RF-BN1 performed on two WOSR samples (lane 1 and 2).

Lane 1 is recognized as containing an elite event based on the detection of a 215 bp band, while sample 2 does not contain RF-BN1.

Example 6: Production of hybrid seeds in WOSR with MS-BN1 and RF-BN1.

WOSR plants containing MS-BN1 that were male sterile were crossed with WOSR plants homozygous for RF-BN1. Hybrid seed harvested from MS-BN1 was deposited with ATCC under ATCC accession number PTA-730.

Hybrid seeds were sown in the field. The plants were found to be 100% fertile and display optimal agronomic properties. The hybrid plants contained both MS-BN1 and RF-BN1 or the event RF-BN1 itself.

Example 7: Introduction of MS-BN1 and RF-BN1 to preferred WOSR breeding varieties.

The elite events MS-BN1 and RF-BN1 were introduced into a number of cultivars important WOSR cultivars by repetitive backcrosses of plants containing event MS-BN1 or RF-BN1, respectively.

It was observed that the introduction of elite events into these crop varieties did not significantly affect any of the desired phenotypic or agronomic characteristics of these crop varieties depending on transgene expression as determined by glufosinate tolerance at commercially acceptable levels. This confirms the event status of MS-BN1 and RF-BN1 as elite events.

As used in the claims, except where otherwise expressly stated, the term "plant is intended to include plant tissues at various stages of maturity as well as any cells, tissues or organs derived from or derived from any such plant, including without limitation any seed. , leaves, stems, flowers, roots, single cells, gametes, cell cultures, tissue cultures or protoplasts.

Seeds containing Elite Event MS-BN1 and Elite Event RF-BN1 or Elite Event RF-BN1 itself have been deposited with the American Tissue Culture Collection under Accession Number: PTA-730.

PL 205 071 B1

Sequence List &lt;110&gt; AVENTIS CROPSCIENCB NV

&lt;120&gt; Hybrid _OBl"Y oilseed rape and _{Jeso woBoby} ^_twaraanla &lt;130 »EE-BN1 &lt;140» &lt;141 »&lt;160» 43 '&lt;170 »Patentin Ver. 2.0 &lt;210 »1.

&lt;211 »4946 &lt;212» DNA &lt;213 »Artificial sequence &lt;220» &lt;223 »Description of the artificial sequence: Γ-DNA from the pTHW107 plasmid &lt;220 »&lt;221» complex trait &lt;222 »(964) .. (4906) &lt;223» Hind III fragment &lt;400 »1 aatfcacaacg gtatatatcc tgecagtact cggccgtcga tgtagtact cggccgtcga actcggc-cgt cgagtacagatta aattaaggatagattagataggatagattagaaggatagattagaaggatagattagaaaggatagattagaaaggatagatta 120 atatttattg ataaaataac aagteaggta ttatagtcca agcaaaaaca taaatttatt 180gatgcaagtt taaattcaga aatatttcaa taaetgatta tatcagctgg tacattgccg 240 tagatgaaag actgagtgcg atattatgtcggatgatagatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgata gtgacgggca ggaccggacg 360 gggcggtacc ggcaggctga agtecagctg ccagaaaccc acgfecatgcc agttcccgtg 420 cttgaagceg gccgcccgca gcatgccgcg gggggcatat ccgagcgcct cgtgcatgcg 480 cacgctcggg tpgttgggca gcccgatgac agcgaccacg ctcttgaagc cctgtgcctc 540 cagggacttc agcaggtggg tgtagagcgt ggagcccagt cccgtccgct ggtggcgggg 600 ggagacgtac acggtcgact cggccgtcca gtcgtaggcg ttgcgtgcct tccaggggcc 660 cgcgtaggcg atgccggcga cctcgccgtc caectcggcg aegagccagg gatagcgctc 720 ccgcagacgg acgaggtcgt ccgtccactc ctgcggttcc tgcggctcgg tacggaagtt 780 gaccgtgctt gtetcgatgt agtggttgac gatggtgcag accgccggca tgtccgcctc 840 ggtggcacgg cggatgtcgg ccgggcgtcg ttctgggtcc attgttcttc tttactcttt 900 gtgtgactga ggtttggtct agtgctttgg tcatctatat ataatgataa caacaatgag 960 aacaagcttt ggagfcgatcg gagggtctag gatacatgag attcaagtgg actaggatct 1020

GB 205 071 B1 acaccgttgg attttgagtg tggatatgtg aaggcctaag gaga'ggtgtt gagaccctta ggaagataat tccatgaatc ttatcgttat gtgcttgctc attttacttg cctggtggac ttacttacta tagagctttc ataccttttt tatgattcat gaataaaaat gggaaatttt ggtgaaactg tggaatatat atttttttca ttataaatat agaaaaatat ataacattca acagaactat gtttaatgtg taaagattag tacaacaagt cataagccca acaaagttag aatattacaa atcataagcc caacaaagtt gctaaacaaa gtccaaaaaa aacttctcaa ctatacacaa aacaagtcag ataaatctct cacttcccta tcggattgaa tgttttactt tatgtttgtg aaaactaata gggttaacaa gattttccga gagctttcta gtagaaagcc caccaattag gtttcttatt atgtgccaaa gaaaacgtat gaatgttatt agtaaatggt gatattcaac tttaaaaatt cgatcagtgt atatatataa tgctttacaa cacttggatt atatttgttt tggccatgca ccaactcatt atatgtgttc gtgtatattt gtataagaat atatatatat atatattata tatcatgcac tagtgcattt tttctaacaa ccatatatgt taatgaaaaa tataatctat tgctgaaatt attctttcaa attttagcta aaagtcttgt cacggaaaaa aaacacataa taaatttgaa ggtacccggg gatcttcccg atctagtaac tagtttgcgc gctatatttt gttttctatc atcataaaaa cccatctcat aaataaogtc acgtaattca acagaaatta tatgataatc aagaaacttt attgccaaat gtttgaacga gaaattgacc gatcagagtt tgaagaaaaa aaacggcctc cgcaggaagc cgtttttttc ggtccgttgt tttgtaaatc agccagtcgc agcctgatgt atagttaata tccgcttcac tgccttccct gtttgagaag atgtctccgc ggttcccttt tgatgccacc cagccgaggg caggtagctt atgatatgtc tgaagataat gtaccatggt agctaatttc tttaagtaaa ttacacttgc accacaaggg catatataga taacttttgt tggagcattt cgaggaaaat ttaaggtttc atgtattaat ttgttgcaaa aattttgtct caccctgatt tcagttatgg atgtttattc tagtccagcc acccacctta ctgatttaat ttacattgct aaatgtgcat aggatgtata tattagtaca taaaaaatca tcaattgtcc cttcttgttt ggcactatat tgaggttaat tttacttggt aacggccaca 1080 tcggcttgaa ccgctggaat aatgccacgt 1140 ctatgagtga aattgtgtga tggtggagtg 1200 ttggcccttt ccttatgggg aatttatatt 1260 tttaccttgg atttagttaa tatataatgg 1320 tgaatttgta ctgctaaatg cataagatta 1380 tttaaaagca aaatttgcct tttactagaa 1440 aataaaaatg aaaataagaa ctttcaaaaa 1500 tcgcacatca agtcatctgt tacaatatgt 1560 cacgtctaaa taaactaaag agtccacgaa 1620 attgatcaaa aaaaaaaaac gcccaacaaa 1680 gtctccatct tcctttatga acattgaaaa 1740 ttctgggcct gtcttcccaa cctcctacat 1800 gtaccttttc cgttgcaatg atattgatag 1860 tcgaagtcat ggaatatgga tttggtccaa 1920 catcaccaga aatttactag taaaataaat 1980 ttcaatataa ttatagagga tatttcaaat 2040 caggtaagac attaaaaaaa tcctacgtca 2100 ggaattgtac aaaaatttgg gatctactat 2160 tttttttgga ggctggaatt tttaatctac 2220 gtttagtgta atactttgat tttgtcaaat 2280 ttctttgacc atatacacac acacatatat 2340 ttttaattga aaaaataata tatatatata 2400 tgcgattgat ctgcaaaaat actgctagag 2460 atctcagatg ttaagatttt cttaaagtaa 2520 aataactaaa gaataataca caatctcgac 2580 tttcgaccgc ggtacccgga attcgagctc 2640 atagatgaca ccgcgcgcga taatttatcc 2700 gcgtattaaa tgtataattg cgggactcta 2760 atgcattaca tgttaattat tacatgctta 2820 atcgcaagac cggcaacagg attcaatctt 2880 tctgcttcgg atcctctaga gccggaaagt 2940 tttattacac actttatgta aagctgaaaa 3000 gttatctgat ttttgtaaag gtctgataat 3060 ttgagtaaag aatccggtct gaatttctga 3120 gccatgttcg tccgcttttg cccgggagtt 3180 cgatgctttt ccccggagcg acgtctgcaa 3240 cttgtgcttc tgattttgta atgtaattat 3300 ccgcaacccc gtcaaacgtg ttgataaccg 3360 aactttgatt tgagtgatga tgttgtactg 3420 gcacaagaca tacacaacaa cttgcaaaac 3480 ggggagtagc aggctaatct gagggtaaca 3540 catggactta gtgtgaggaa aaagtaccaa 3600 aaattacatt atgaagctgt gctagagaag 3660 tgcaagtctg cttttagctt gattcaaaaa 3720 acttcgagcc tatgtcgctt taattcgagt tgtttgaatc atctttcata aagtgacaag 3780 3840 3900 tcaatctgtt aatgcaaatt atccagttat

GB 205 071 B1 acttagctag atatccaatt ttgaataaaa atagctcttg attagtaaac cggatagtga 3960 caaagtcaca tatcćatcaa acttctggtg ctcgtggcta agttctgatc gacatggggt 4020 taaaatttaa attgggacac ataaatagcc tattfegtgca aatctcccca tcgaaaatga 4080 cagattgtta catggaaaao aaaaagtcct ctgatagaag tcgćaaagta tcacaatttt 4140 ctatcgagag atagattgaa agaagtgcag ggaagcggtt aactggaaca taacacaatg 4200 tctaaattaa ttgcattcgc taaccasaaa gtgtattact ctctccggtc cacaataagt 4260 tattttttgg cccttttttt atggtccaaa ataagtgagt tttttagatt tcaaaaatga 4320 tttaattatt tttttactac agtgcccttg gagtaaatgg tgttggagta tgtgttagaa 4380 atgtttatgt gaagaaatag taaaggttaa tatgatcaat ttcattgcta tttaatgtta 4440 aaafegtgaat ttcttaatct gtgtgaaaac aaccaaaaaa tcacttattg tggaccggag 4500 aaagtatata aatatatatt tggaagcgac taaaaataaa cttfctctcat attatacgaa 4560 cctaaaaaca gcatatggta gtttctaggg aatctaaatc actaaaatta ataaaagaag 4620 caacaagtat caatacatat gatttacacc gtcaaacacg aaattcgtaa atatttaata 4680 taataaagaa ttaatccaaa tagcctccca ccctataact taaactaaaa ataaccagcg 4740 aatgtatatt atatgcataa tttatatatt aaatgtgtat aatcatgtat aatcaatgta 4800 taatctatgt atatggttag aaaaagtaaa caattaatat agccggctat ttgtgtaaaaa 4860 atcccggatgatgacatgcccggatgatgaca 4860 atcccggatgata gacaatgcccggatgata ⁴⁹⁴⁶ &lt;210&gt; 2 &lt;211&gt; 4832 &lt;212&gt; DBA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Description of the artificial sequence; T-DNA of the plasmid pTHW11S &lt;220&gt;

&lt;221&gt; complex feature &lt;222&gt; (1883) .- (4065) &lt;223&gt; restriction fragment Upal &lt;4 00&gt; 2 aattacaacg gtatatatcc tgccagtact cggccgtcga actcggccgt cgagtacatg 60 gtcgataaga aaaggcaatt tgtagatgtt aatteccatc ttgaaagaaa tatagtttaa 120 atatttattg ataaaataac aagtcaggta ttatagtcca agcaaaaaca taaatttatt 180 gatgcaagtt taaattcaga aatatttcaa taactgatta tatcagctgg tacattgccg 240 tagatgaaag actgagtgcg atattatgtg taatacataa attgatgata tagctagctt 300 agctcatcgg gggatcctag acgcgtgaga tcagatctcg gtgacgggca ggaccgggca ggaccg 360 gggcggtacc ggcaggctga agtccagctg ccagaaaccc acgtcatgcc agtteccgtg 420 cttgaagccg gccgcccgca gcatgccgcg gggggcatat ccgagcgcct cgtgcatgcg 480 cacgctcggg tcgttgggca gcecgatgac agcgaccacg ctcttgaagc cctgtgcctc 540 cagggacttc ageaggtggg tgtagagegt ggagcccagt cccgtccgct ggtggcgggg 600 ggagacgtac acggtcgaet cggccgtcca gtcgtaggcg ttgcgtgcct tccaggggcc 660 cgcgtaggcg atgccggcga cctcgccgtc cacctcggcg acgagccagg gatagcgctc 720 ccgcagacgg acgaggtcgt ccgtccactc ctgcggttcc tgeggctcgg tacggaagtt 780 gaccgtgctt gtctcgatgt agtggctgac gatggtgcag accgccggca tgtccgcetc 840

GB 205 071 B1 ggtggcacgg cggatgtcgg ccgggcgtcg ttctgggtcc attgttcttc tttactcttt 900 gtgtgactga ggtttggtct agtgctttgg tcatctatat ataatgataa caacaatgag 960 aacaagcttt ggagtgatcg gagggtctag gatacatgag attcaagtgg actaggatct 1020 acaccgttgg attttgagtg tggatatgtg aaggcctaag gagaggtgtt gagaccctta ggaagataat tccatgaatc ttatcgttat gtgcttgctc attttacttg cctggtggac ttacttacta tagagctttc ataccttttt tatgattcat gaataaaaat gggaaatttt ggtgaaactg tggaatatat atttttttca ttataaatat agaaaaatat ataacattca acagaactat gtttaatgtg taaagattag tacaacaagt cataagccca acaaagttag aatattacaa atcataagcc caacaaagtt gctaaacaaa gtccaaaaaa aacttctcaa ctatacacaa aacaagtcag ataaatctct cacttcccta tcggattgaa tgttttactt tatgtttgtg aaaactaata gggttaacaa gattttccga gagctttcta gtagaaagcc caccaattag gtttcttatt atgtgccaaa gaaaacgtat gaatgttatt agtaaatggt gatattcaac tttaaaaatt cgateagtgt atatatataa tgctttacaa cacttggatt atatttgttt tggccatgca ccaactcatt atatgtgttc gtgtatattt gtataagaat atatatatat atatattata tateatgcac tagtgcattt tttctaacaa ccatatatgt taatgaaaaa tataatctat tgctgaaatt attctttcaa attttagcta aaagtcttgt cacggaaaaa aaacacataa taaatttgaa ggtacccggg gatcttcccg atctagtaac tagtttgcgc gctatatttt gttttctatc atcataaaaa cccatctcat aaataacgtc acgtaattca acagaaatta tatgataatc aagaaacttt attgccaaat gtttgaacga gggtttgtgt ttccatattg ttcatctccc tgtcgcagcc ttccgctttc gcttcacgga cagtcagctg cttgctttgt tcaaactgcc atccggtcag acaatcccat aaagcgtcca gctccttttt caatgtctgg tggaggtcgc ctgctttttt catcggtagc taatttcttt tgtactgtta cacttgcacc acaagggcat gcaaaactaa cttttgttgg agcatttcga ggtaacatta aggtttcatg tattaatttg gtaccaaaat fcttgtctcac cctgatttca agagaagatg tttattctag tccagccacc tcaaaaactg atttaattta cattgctaaa ttcgagtagg atgtatatat tagtacataa tgaggttaat tttacttggt aacggccaca 1000 tcggcttgaa ccgctggaat aatgccacgt 1140 ctatgagtga aattgtgtga tggtggagtg 1200 ttggcccttt ccttatgggg aatttatatt 1260 tttaccttgg atttagttaa tatataatgg 1320 tgaatttgta ctgctaaatg cataagatta 1380 tttaaaagca aaatttgcct tttactagaa 1440 aataaaaatg aaaataagaa ctttcaaaaa 1500 tcgcacatca agtcatctgt tacaatatgt 1560 cacgtctaaa taaactaaag agtccacgaa 1620 attgatcaaa aaaaaaaaac gcccaacaaa 1680 gtctccatct tcctttatga acattgaaaa 1740 ttctgggcct gtcttcccaa cctcctacat 1800 gtaccttttc cgttgcaatg atattgatag 1860 tcgaagtcat ggaatatgga tttggtccaa 1920 catcaccaga aatttactag taaaataaat 1980 ttcaatataa ttatagagga tatttcaaat 2040 caggtaagac attaaaaaaa tcctacgtca 2100 ggaattgtac aaaaatttgg gatctactat 2160 tttttttgga ggctggaatt tttaatctac 2220 gtttagtgta atactttgat tttgtcaaat 2280 ttctttgacc atatacacac acacatatat 2340 ttttaattga aaaaataata tatatatat 2400 tgcgattgat ctgcaaaaat actgetagag 2460 atctcagatg ttaagatttt cttaaagtaa 2520 aataactaaa gaataataca caatctcgac 2580 tttcgaccgc ggtacccgga attcgagctc 2640 atagatgaca ccgcgcgcga taatfctatcc 2700 gcgtattaaa tgtataattg cgggactcta 2760 atgcattaca tgttaattat tacatgctta 2820 atcgcaagac cggcaacagg attoaatctt 2880 tctgcttcgg atcctctaga ccaagcttgc 2940 attgatcgta tjtaagaaagt atgatggtga 3000 aaacctgaag cacactctcg gcgccatttt 3060 tccattccaa aacgagcggg tactccaccc 3120 ggttttcacc gtagtattcc ggaagggcaa 3180 tgatacttct gatttgttcc ccgttaatga 3240 aagtaaaaac tttgatttga gtgatgatgt 3300 atatagagca caagacatac acaacaactt 3360 ggaaaatggg gagtagcagg ctaatctgag 3420 ttgcaaacat ggacttagtg tgaggaaaaa 3480 gttatggaaa ttacattatg aagctgtgct 3540 caccttatgc aagtctgctt ttagcttgat tgtgcatact tcgagcctat gtcgctttaa 3600 3660 3720 aaaatcatgt ttgaatcatc tttcataaag

GB 205 071 B1 tgacaagtca attgtccctt cttgtttggc cagttatact tagctagata tccaattttg atagtgacaa agtcacatat ccatcaaact atggggttaa aatttaaatt gggacacata aaaatgacag attgttacat ggaaaacaaa caattttcta tcgagagata gattgaaaga cacaatgtct aaattaattg cattcgctaa aataagttat tttttggccc tttttttatg aaaatgattt aattattttt ttactacagt gttagaaatg tttatgtgaa gaaatagtaa aatgttaaaa tgtgaatttc ttaatctgtg ccggagaaag tatataaata tatatttgga tacgaaccta aaaacagcat atggtagttt aagaagcaac aagtatcaat acatatgatt ttaatataat aaagaattaa tccaaatagc ccagcgaatg tatattatat gcataattta aatgtataat ctatgtatat ggttagaaaa gtaaaaatcc ctaatataat cgcgacggat tggagccatt tacaattgaa tatatcctgc &lt;210&gt; 3 &lt;211&gt; 602 &lt;220&gt; artificial DNA sequence

&lt;223&gt; artificial sequence description: primer 248 &lt;400&gt; 3 catgccctga cccaggctaa gtattttaac &lt;21O&gt; 4 &lt;211&gt; 60 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 249 &lt;400&gt; 4 caatgggact gtcggaggac tgagggccaa &lt;210&gt; 5 &lt;211&gt; 26 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

actatattca atctgttaat gcaaattatc 3780 aataaaaata gctcttgatt agtaaaccgg 3840 tctggtgctc gtggctaagt tctgatcgac 3900 aatagcctat ttgtgcaaat ctccccatcg 3960 aagtcctctg atagaagtcg caaagtatca 4020 agtgcaggga agcggttaac tggaacataa 4080 ccaaaaagtg tattactctc tccggtccac 4140 gtccaaaata agtgagtttt ttagatttca 4200 gcccttggag taaatggtgt tggagtatgt 4260 aggttaatat gatcaatttc attgctattt 4320 tgaaaacacc aaaaaatcac ttattgtgga 4380 agcgactaaa aataaacttt tctcatatta 4440 ctagggaatc taaatcacta aaattaataa 4500 tacaccgtca aacacgaaat tcgtaaatat 4560 ctcccaccct atkacttaaa ctaaaaataa 4620 tatattaaat gtgtataatc atgtataatc 4680 agtaaacaat taatatagcc ggctatttgt 4740 ccccgggaat tccggggaag cttagatcca 4800 ca 4832 tttaaccact ttgctccgac agtcccattg 60 agcttggctc ttagcctggg tcagggcatg 60

PL 205 071 B1 &lt;223&gt; artificial sequence description: primer 247 &lt;4 00&gt; 5 ccgtcaccga gatctgatct cacgcg &lt;210&gt; 6 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 250 &lt;400&gt; 6 gcactgaggg ccaaagcttg gctc &lt;210&gt; 7 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 251 &lt;400&gt; 7 ggatcccccg atgagctaag ctagc &lt;210&gt; 8 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 254 &lt;400&gt; 8 cttagcctgg gtcagggcat g &lt;210&gt; 9 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: starter 258 &lt;400&gt; 9 ctacggcaat gtaccagctg

PL 205 071 B1 &lt;210&gt; 10 &lt;211&gt; 23 &lt;212&gt; DNA '&lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: SP6 primer &lt;400&gt; 10 taatacgact cactataggg ega &lt;210&gt; 11 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt; _ &lt;223&gt; artificial sequence description: T7 primer &lt;400&gt; 11 tttaggtgac actatagaat ac &lt;210&gt; 12 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;22 3&gt; artificial sequence description: primer 201 &lt;400&gt; 12 gcttggacta taatacctga c &lt;210&gt; 13 &lt;211&gt; 953 '&lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; Artificial sequence description: sequence spanning the 5 'flanking region of MS-BN1 &lt;220&gt;

&lt;221&gt; complex trait &lt;222&gt; (1). - (24) &lt;223&gt; pGEM-T vector

PL 205 071 B1 &lt;400&gt; 13.

cccngccgcc atggccgcgg gattęttagc ctgggtcagg gcatgcatgg tgtgatccaa 60 agactttctc ggcccaaata ctaatcatca caagtcatgc atgatctgct cgggatggcc 120 aagaaaaatc gaacccatga caatattcac agttgtaagt tttttaccag tagacaaata 180 ccacttggtt taacatattg taaacttaat atatagaaga tgttectatt cagaaaataa 240 tatatgtata tatataaaat tttattggcg actcgaggat gcacagaaat ataaaatgtt 300 ggtcgcttag accatctcca atgtatttct ctatttttac ctctaaaata aaggagctct 360 ataatagagg tgggttttgc tccaatgtat ttctttaaaa tagagatctc tacatataga 420 gcaaaatata gaggaatgtt atttcttcct ctataaatag aggagaaaat agcaatctct 480 attttagagg caaaaataga gatbsgttgg agtgattttg cctctaaatg ctattataga 540 ggtagaaata gaggtgggtt ggagatgctc ttactatttt catagtaggt gaaaacttga 600 aactagaaag ctttggagtg tacgagtgga aaacctctct ttgtagaaac atacacatgc 660 catttagtta actagttgac atagattttt gagtcagata actttaagaa tatatatgtt 720 tggatgagag tttgacactt tgagccactc gaaggacaaa ttttaaaaac ttgtgggatg 780 ctgtggccat aaacctfegag gacvstttga tcatattcta ttaactacag tacgaatatg 840 attcgacctt tgcaattttc tcttcag / gta ctcggccgtc gaactcggcc gtcgagtaca 900 tggtcgataa gaaaaggcaa tttgtagatg ttaattccca tcttgaaaga aat 953 &lt;210&gt; 14 &lt;211&gt; 16 &lt;212&gt; DNA &lt;213&gt;20&gt; artificial sequence &lt;213&gt;

&lt;22 3&gt; artificial sequence description: primer 611 &lt;400&gt; 14 ngtcgaswgt ntwcaa 16 &lt;210&gt; 15 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 259 &lt;400&gt; 15 gtgcagggaa gcggttaact gg 22 &lt;210&gt; 16 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 260

&lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 48 &lt;400&gt; 20 ggagggtgtt tttggttatc 20 &lt;210&gt; 21 &lt;211&gt; 178 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; θΡ «manmade sequence: sequence containing the target MS-BN1 deletion &lt;400&gt; 21 gacactttga gccactcgaa ggacaaattt taaaaacttg tgggatgctg tggccataaa 60 ccttgaggac gctttgatca tattctatta actacagta tttacttacagcta cgttacagtacattacttacagtca

&lt;211&gt; 1198 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: insertion site of MS-BN1 &lt;400&gt; 22 catggtgtga tccaaagact ttctcggccc aaatactaat catcacaagt catgcatgat 60 ctgctcggga tggccaagaa aaatcgaacc catgacaata ttcacagttg taagtttttt 120 accagtagac aaataccact tggtttaaca tattgtaaac ttaatatata gaagatgttc 180 ctattcagaa aataatatat gtatatatat aaaattttat tggcgactcg aggatgcaca 240 gaaatataaa atgttggtcg cttagaccat ctccaatgta tttctctatt tttacctcta 300 aaataaagga gctctataat agaggtgggt tttgctccaa tgtatttctt taaaatagag 360 atctctacat atagagcaaa atatagagga atgttatttc ttcctctata aatagaggag 420 aaaatagcaa tctctatttt agaggcaaaa atagagatbs gttggagtga ttttgcctct 480 aaatgctatt atagaggtag aaatagaggt gggttggaga tgctcttact attttcatag 540 taggtgaaaa cttgaaacta gaaagctttg gagtgtacga gtggaaaacc tctctttgta 600 gaaacataca catgccattt agttaactag ttgacataga tttttgagtc agataacttt 660 aagaatatat atgtttggat gagagtttga cactttgagc cactcgaagg acaaatttta 720 aaaacttgtg ggatgctgtg gccataaacc ttgaggacvs tttgatcata ttctattaac 780 tacagtacga atatgattcg acctttgcaa ttttctcttc aggttttcta attcatatgg 840 atttgttatg ataaccaaaa acaccctcct ttttattata aaggtaggga tagctaatct 900 gttattcggt tttgattaga gatattaatc ccgttttatc aagtacagtt tgatgtattt 960

GB 205 071 B1 ttttgttcgt tttcattaca atccaagaca agttaggttt attacatttt accaaaaaaa 1020 aaggtttggt ttattgtgaa cattgctgcg gtttatttaa atttgattct attcaaaggt 1080 caatccgtat ttaacaagta aactagtctt tatataatct taaatctaac gatctttgat 1140 ttttaaattg catttancta tgtcctctct ggcgtatatg gtctctttga aaacactc 1198 &lt;210&gt; 23 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt; 220&gt;

&lt;223&gt; artificial sequence: primer 193 &lt;400&gt; 23 tcatctacgg caatgtacca gc 22 &lt;210&gt; 24 &lt;211&gt; 1077 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; Artificial sequence description: sequence spanning the 5 'flanking region of RF-BN1 &lt;220&gt;

&lt;221&gt; Composite feature &lt;222&gt; (1) .. (45) &lt;223&gt; pGEM®-T vector &lt;22Q&gt;

&lt;221&gt; Feature complex &lt;222&gt; (1061) .. (1077) &lt;22 3&gt; pGEM®-T vector &lt;400&gt; 24 gagctctccc atatggtcga cctgcaggcg gccgcactag tgattcttag cctgggtcag 60 ggcatggcat gtctgatggt acatgctaaa tgctatattt cctgtttaaa gtgttaaaat 120 cattttctga tggaactaaa tccagtttta agagtaactg acaagtacaa ttaagcacaa 180 caatataata gtagtaattg gcatctttga ttgttaaata tcaaaacagt aaagttacaa 240 aaaaaaatac caaaccaata atgaagactt ggcggagaca gtgccgtgcg aaggttttcg 300 gaggtccgag acgagttcaa aaatatattattacata tatatattttacata tataacattc aaaagtttga attattacat aaacgttttc taaattttct tcaccaaaat 420 tttataaact aaatttttaa atcatgaaca aaaagtatga atttgtaata taaatacaaa 480 gatacaaatt tttgattgaa atattggtag ctgtcaaaaa agtaaatctt agaatttaaa 540 ttaactatag taaactatat attgaaaata ttataaattt ttatcaaatt ctcataaata 600 tataaaataa atctaactca tagcatataa aaagaagact aatgtggatc aaaatattta 660 cagtttttta gaagtagaat ctttatagtt ttatttaaaa tatagcaaaa atgatcacaa 720

GB 205 071 B1 acctagttay ttaaggagaa gtccaattca aaatcaaata aaaataaaat ctatctaaaa 780 aaatatgtta actaccatgc aaaagtattt tttttgtaat tagaaaccct gaaatttgta 840 caaaacttgg acccctaggt aaatgccttt ttcatctcgc gataagaaaa ggcaatttgt 900 agatgttaat tcccatcttg aaagaaatat agtttaaata tttattgata aaataacaag 960 tcaggtatta tagtccaagc aaaaacataa atttattgat gcaagtttaa attcagaaat 1020 atttcaataa ctgattatat cagctggtac atcgccgtag aatcccgcgc catggcg '1077 &lt;210&gt; 25 &lt;211&gt; 16 &lt;212&gt; DNA &lt;2 and 3&gt; artificial sequence &lt;220&gt;

&lt;223&gt; ^{artificial description}J sequence: primer 286 &lt;400&gt; 25 ntgcgaswga nawgaa 16 &lt;210&gt; 26 &lt;211&gt; 19 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 314 &lt;400&gt; 26 gtaggaggtt gggaagacc 19 &lt;210&gt; 27 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 315 &lt;400&gt; 27 gggctttcta ctagaaagct ctcgg 25 &lt;210&gt; 28 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 316

PL 205 071 B1 &lt;400&gt; 28 ccgataggga agtgatgtag gagg 24 &lt;210&gt; 29 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 288 &lt;400&gt; 29 atgcagcaag aagcttggag g 21 &lt;210&gt; 30 * &lt;211 »..... 1501 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;?23&gt; . .

Artificial sequence description: sequence spanning the 3 'flanking region of RF-BN1 &lt;220&gt;

&lt;221&gt; compound feature &lt;222&gt; (!) .. (16) &lt;223&gt; pGEM®-T vector &lt;220&gt;

&lt;221&gt; 2łożona feature &lt;222&gt; (1458) .. (1501) &lt;223&gt; pGEM®-T vector &lt;400&gt; 30 ccatggccgc gggattgtag gaggttggga agacaggccc agaaagagąt ttatctgact 60 cgttttgtgt atagttttca atgttcataa aggaagatgg agacttgaga agtttttttt 120 ggactttgtt tagctttgtt gggcgttttt tttttttgat caataacttt gttgggctta 180 tggtcgataa gcgtgcgcat gtctgatggt acatgctaaa tgctatattt ctgtttaaag 240 tgttaaaatc attttctgat ggaactaaat ccagttttaa gagtaactga caagtacaat 300 taagcacaac aataaaatag tagtaattgg catctacataaat ca aagttacaaa aaaaaatacc aaaccaataa tgaagacttg gcggagacag tgccgtgcga 420 aggttttcgg aggtccgaga cgagttcaaa aatacatttt acataatata tttttcatat 480 atatatatat atataacatt caaaagtttg aattattaca taaacgtttt ctaaattttc 540 ttcaccaaaa ttttataaac taaaattttt maatcatgaa caaaaagtat gaatttgtaa 600 tataaatacm aagatacaaa tttttgattg aaatattggt agctgtcaaa aaagtaaatc 660 ttagaattta aattaactat agtaaactat atatggaaaa tattataaat ttttatcaaa 720 ttctcataaa tatataaaat aaatctaact catagcatat aaaaagaaga ctaatgtgga 780 tcaaratatt tacagttttt tagaagtaga atctctatag ttttatttaa aatatagcaa 840

GB 205 071 B1 aaatgatcac aaacctagtt actttaacca gaagtccaat tcaaaatcaa ataaaaataa 900 aaatctatct aaaaaaatat gttaactacc atgcaaaagt attttttttt gtaattagaa 960 accctgaaat ttgtacaaaa cttggacccc taggtaaatt ccctagaaag tatcctatta 1020 gcgtcgacaa actgttgctc atatttttct ctccttactt tatatcatac actaatatan 1080 gnagatgatc taattaatta ttcatttcca tgctagctaa ttcaagaaaa agaaaaaaaa 1140 ctattatcta aacttatatt cgagcaacac ctcggagata acaggatata tgtcattaat 1200 gaatgcttga actcatctcg cgaactcatc tcgcatcgct tatagccaca aagatccaac 1260 ccctctcttc aatcatatat cagtagtaca atacaaatag atattgtgag cacatatgcc 1320 gtctagtact gatgtgtaca tgtagaggag ccgcaaatgt ttagtcactc caacaaatga 1380 gcatgaccac gcatcttctg atgatgtaca gccgtccctt ttgctctctc aaatatcctc 1440 caagcttctt gctgcataaa tcactagtgc ggccgcctgc aggtcgacca tatgggagag 1500 c ¹⁵⁰¹ &lt;210&gt; 31 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; ° pi^s artificial sequence: primer 269 &lt;400&gt; 31 ggttttcgga ggtccgagac g ²¹ &lt;210&gt; 32 &lt;211&gt; 21 &lt;212&gt; ^nMa &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; ^{artificial description}J sequence: primer 283 &lt;400&gt; 32 cttggacccc taggtaaatg c &lt;210&gt; 33 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; ° P^{is artificial}J sequence: starter 284 &lt;400&gt; 33 gtacaaaact tggaccccta gg ²² &lt;210&gt; 34 &lt;211&gt; 1068

&lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: sequence comprising the target site deletion of RF-BN1 &lt;400&gt; 34 cgcgttggga gctctcccat atggtcgacc tgcaggcggc cgcactagtg attcttggac 60 ccctaggtaa atgccttttt caaaagcctc taagcacggt tctgggcggg gagtcagcga 120 gaaaaaaaga tatttcccta gaaagtatcc tattagcgtc gacaaactgt tgctcatatt 180 tttctctcct tactttatat catacactaa tataaaaaga tgatctaatt aattattcat 240 ttccatgcta gctaattcaa gaaaaagaaa aaaactatta tctaaactta tattcgagca 300 acacctcgga gataacagga tatatgttat taatgaatgc ttgaactcat ctcgcgaact 360 catctcgcat cgcttatagc cacaaagatc caacccctct cttcaatcat atatcagtag 420 tacaatacaa atagatattg tgagcacata tgccgtctag tactgatgtg tatatgtaga 480 gganngcaaa tgtttagtca ctccaacaaa tgagcatgac nacgcatctt ctgatgatgt 540 acagccgtcc cttttgctct ctcaaatatc ctccaagctt cttgctgcat ggaatcttct 600 tcttggtgtc tttcatgata acaaaatcta acgagagaga aacccttagt caagaaaaaa 660 caaataaaac tctaacgaga gtgtgtgaga aagtagagag tatgtgtgag tgacggagag 720 aaagtgagac cataaagatg ttgtgcaaag agagcaagac ttaacctata tatactcaca 780 tacacgtaca catcataccc attanagata ataaaaagga aaaaggaaca actaacaagg 840 gaactgtatc ccatacttta tctcatcata catgatgcat aatatattct ttcgtatatc 900 aagaaaaatg agcctgatat ttttttattt cgaaactaaa agagtgtcta tttctctctc 960 ttagagatag tgccatgtca aatttctaag aagtagcaag atttacaaag gaatctaaag 1020 caaccccacg cgcattgtgt tcatttctct cgaccatccc gcggccat 1068 &lt;210&gt; 35 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 57 &lt;400&gt; 35 gcatgatctg ctcgggatgg c ²¹ &lt;210&gt; 36 &lt;211&gt; 909 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; ° pi^s artificial sequence: sequence spanning the 5 'flanking region of MS-BN1 in the WOSR

GB 205 071 B1 &lt;400&gt; 36 tgcatgatct gctcgggatg gccaagaaaa atcgaaccca tgacaatatt cacagttgta 60 agttttttac cagtagacaa ataccacttg gtttaacata ttgtaaactt aatatataga 120 agatgttcct attcagaaaa taatatatgt atatatataa aattttattg gcgactcgag 180 gatgeacaga aatataaaat gttggtcgct tagaccatct ccaatgtatt tctctatttt 240 tacctctaaa ataaaggaac tctataatag aggtgggttt tactccaatg tatttcttta 300 aaatagagat ctctacatat agagcaaaat atagaggaat gttatttctt cctctataaa 360 tagaggagaa aatagcaatc tctattttag aggcaaaaat agagatgggt tggagtgatt 420 ttgcctctaa atgctattat agaggtagaa atagaggtgg gttggagatg ctcttactat 480 tttcatagta ggtgaaaact tgaaactaga aagctttgga gtgtacgagt ggaaaacctc 540 tctttgtaga aacatacaca tgccatttag ttaactagtt gacatagatt tttgagtcag 600 ataactttaa gaatatatat gtttggatga gagtttgaca ctttgagcca ctcgaaggac 660 aaattttaaa aacttgtggg atgctgtggc ccataaacct tgaggacgct ttgatcatat 720 tctattaact acagtacgaa tatgattcga cctttgcaat tttctcttca gtactcggcc 780 gtcgaactcg gccgtcgagt acatggtcga taagaaaagg caatttgtag atgttaattc 840 ccatcttgaa agaaatatag tttaaatatt tattggataa aataacaagt caggtattat 900 agtccaagc 909 &lt;210&gt; 37 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;22 3&gt; artificial sequence description: primer 68 &lt;400&gt; 37 ccatatacgc cagagaggac 20 &lt;210&gt; 38 '&lt;211&gt; 522 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: sequence comprising the 3 'flanking region of MS-BN1 in WOSR &lt;400&gt; 38 gcgaatgtat attatatgca taatttatat attaaatgtg tataatcatg tataatcaat 60 gtataatcta tgtatatggt tagaaaaagt aaacaattaa tatagccggc tatttgtgta 120 aaaatcccta atataatcga cggatccccg ggaattccgg gggaagctta gatccatgga 180 tttgttatga taaccaaaaa caccctcctt tttattataa aggtagggat agctaatctg 240 ttattcggtt ttgattagag atattaatcc cgttttatca agtacagttt gatgtatttt 300 tttgttcgtt ttcattacaa tccaagacaa gttaggttta ttacatttta ccaaaaaaaa 360 aggtttggtt tattgtgaac attgctgcgg ttttatttaa atttgattct attcaaaggt 420 caatccgtat ttaacaagta aactagtctt tatataatct taaatctaac gatacttgga 480

PL 205 071 B1 tttttaaatt gcatttagct atgtcctctc tggcgtatat gg 522 &lt;210&gt; 39 &lt;211&gt; 694 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220 &lt;223&gt; artificial sequence description: sequence comprising the 5 'flanking region of RF-BN1 in WOSR &lt;400&gt; 39 ggttttcgga ggtccgagac gagttcaaaa atacatttta cataatatat ttttcatata 60 tatatatat tataacattc aaaagtttga attattacat aaacgttttc taaattttct 120 tcaccaaaat tttataaact aaaattttta aatcatgaac aaaaagtatg aatttgtaat 180 ataaatacaa agatacaaat ttttgattga aatattggta gctgtcaaaa aagtaaatct 240 tagaatttaa attaactata gtaaactata tattgaaaat attataaatt tttatcaaat 300 tctcataaat atataaaata aatctaactc atagcatata aaaagaagac taatgtggat 360 caaaatattt acagtttttt agaagtagaa tctttatagt tttatttaaa atatagcaaa 420 aatgatcaca aacctagtta ctttaaccag aagtccaatt caaaatcaaa taaaaataaa 480 aatctatcta aaaaaatatg ttaactacca tgcaaaagta tttttttttg taattagaaa 540 ccctgaaatt tgtacaaaac ttggacccct aggtaaatgc ctttttcatc tcgcgataag 600 aaaaggcaat ttgtagatgt taattcccat cttgaaagaa atatagttta aatatttatt 660 gataaaataa caagtcaggt attatagtcc aagc 694 &lt;210&gt; 40 &lt;211&gt; 1279 &lt;212&gt; ^{nM &amp;} &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; ° P^is artificial sequence: sequence comprising the 3 'flanking region of RF-BN1 in WOSR &lt;400 40 gggggttttt ttttttgatc aataactttg ttgggcttat ggtcgataag cgtgcgcatg 60 tctgatggta catgctaaat gctatatttc tgtttaaagt gttaaaatca ttttctgatg 120 gaactaaatc cagttttaag agtaactgac aagtacaatt aagcacaaca ataaaatagt 180 agtąattggc atctttgatt gttaaatatc aaacaataaa gttcaaaaaa aaataccaac 240 ccaataatga agacttggcg gagacagtgc cgtgcgaagg ttttcggagg tccgagacga 300 gttcaaaaat acattttaca taatatattt ttcatatata tatatatata taacattcaa 360 aagtttgaat tattacataa acgttttcta aattttcttc accaaaattt tataaactaa 420 aatttttaaa tcatgaacaa aaagtatgaa tttgtaatat aaatacaaag atacaaattt 480 ttgattgaaa tattggtagc tgtcaaaaaa gtaaatctta gaatttaaat taactatagt 540 aaactatata ttgaaaatat tataaatttt tatcaaattc tcataaatat ataaaataaa 600 tctaactcat agcatataaa aagaagacta atgtggatca aaatatttac agttttttag 660

GB 205 071 B1 aagtagaatc tttatagttt tatttaaaat atagcaaaaa tgatcacaaa cctagttact 720 ttaaccagaa gtccaattca aaatcaaata aaaataaaaa tctatctaaa aaaatatgtt 780 aactaccatg caaaagtatt tttttttgta attagaaacc ctgaaatttg tacaaaactt 840 ggacccctag gtaaattccc tagaaagtat cctattagcg tcgacaaact gttgctcata 900 tttttctctc cttactttat atcatacact aatataaaaa gatgatctaa ttaattattc 960 atttccatgc tagctaattc aagaaaaaga aaaaaaactt attatctaaa cttatattcg 1020 agcaacacct cggagataac aggatatatg tcattaatga atgcttgaac tcatctcgcg 1080 aactcatctc gcatcgctta tagccacaaa gatccaaccc ctctcttcaa tcatatatca 1140 gtagtacaat acaaatagat attgtgagca catatgccgt ctagtactga tgtgtatatg 1200 tagaggagcc gcaaatgttt agtcactcca acaaatgagc atgaccacgc atcttctgat 1260 gatgtacagc cgtcccttt 1279 &lt;210&gt; 41 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer 268 (BNA04) &lt;400&gt; 41 tggaccccta ggtaaatgcc 20 &lt;210&gt; 42 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;22 3&gt; artificial sequence description: primer BNA05 &lt;400 42 aacgagtgtc agctagacca gc 22 &lt;210 43 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; artificial sequence &lt;220&gt;

&lt;223&gt; artificial sequence description: primer BNA06 &lt;400 43 cgcagttctg tgaacatcga cc 22