Glucopyranosyloxypyrazole derivatives, medicinal compositions containing the same and intermediates in the production thereof

Description of the invention

The invention relates to glucopyranosyloxypyrazole derivatives or pharmaceutically acceptable salts thereof which are useful as medicaments, a pharmaceutical composition containing them and intermediates.

Diabetes mellitus is a lifestyle-related disease, and its background is changes in eating habits and a lack of exercise. Thus, diet and exercise are introduced as therapy in diabetic patients. Moreover, when their sufficient control and continuous administration are difficult, drug administration is introduced. Currently, biguanides, sulfonylureas and insulin sensitivity enhancers are used as antidiabetic agents. However, biguanides and sulfonylureas sometimes have side effects such as lactic acidosis and hypoglycemia, respectively. Side effects such as edema have sometimes been observed with the use of insulin sensitivity enhancers, and this also applies to progressive obesity. Thus, in order to overcome these problems, anti-diabetic agents with a new mechanism of action have been developed.

Recently, the development of a new type of antidiabetic agent has been observed which stimulated urinary glucose excretion and lowered blood glucose levels, protecting the kidneys from excess glucose reabsorption (J. Klin. Invest., Vo. 79, pp. 1510-1515 (1987)). Moreover, SGLT2 (sodium / glucose pump 2) has been found to occur in the S1 segment of the proximal renal tubule and is mainly involved in glomerular filtered glucose reabsorption (J. Clin. Invest., Vol. 93, pp. 397-404 (1994)) . Accordingly, inhibition of human SGLT2 activity prevents reabsorption of excess glucose in the kidney and consequently stimulates urinary excretion of excess glucose and normalizes glucose levels in the kidneys. Thus, it is desirable to rapidly develop anti-diabetic agents that have potent inhibitory activity on human SFLT2 and inhibit the novel mechanism of action. At the same time, since such agents stimulate the excretion of excess glucose in the urine and consequently increase the accumulation of glucose in the body, they are expected to prevent and alleviate the effects of obesity.

As compounds having a pyrazole moiety, WAY-123783 is described to reduce the amount of glucose excreted in normal mice. However, such effects have not been described for humans (J. Med. Chem., Vol. 39, pp. 3920-3928 (1996)).

In forming the basis of the present invention, the inventors carefully studied compounds having potent human SGLT2 inhibitory activity.

The invention relates to glucopyranosyloxypyrazole derivatives of the general formula

<img file="PL203124B1_D0001.tif" />

wherein

R¹ represents a hydrogen atom or a C1-C6 alkyl group, one of Q¹ and T.¹ denotes a group of formula:

<img file="PL203124B1_D0002.tif" />

OH while the other is a C1-C6 alkyl group or a halo (C1-C6 alkyl) group, R² is hydrogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, halo (C1-C6 alkyl) or halogen, or a pharmaceutically acceptable salt thereof.

In a glucopyranosyloxypyrazole derivative of the general formula

<img file="PL203124B1_D0003.tif" />

PL 203 124 B1

R¹¹ is a hydrogen atom or a straight or branched alkyl group with 1 to 3 carbon atoms, one of Q¹¹ and T.¹¹ represents a group of formula

<img file="PL203124B1_D0004.tif" />

while the other is a straight or branched alkyl group of 1 to 3 carbon atoms and R²¹ is a straight chain or branched alkyl group with 1 to 4 carbon atoms, a straight chain or branched alkoxy group with 1 to 3 carbon atoms or a straight chain or branched alkylthio group with 1 to 3 carbon atoms, or a pharmaceutically acceptable salt thereof.

In the glucopyranosyloxypyrazole derivative of the general formula and T.¹² represents a group of formula

<img file="PL203124B1_D0005.tif" />

isopropoxy or methylthio, or a pharmaceutically acceptable salt thereof.

Another object of the invention is a pharmaceutical composition containing, as an active ingredient, the glucopyranosyloxypyrazole derivatives as defined above or pharmaceutically acceptable salts thereof.

The pharmaceutical composition of the invention is useful as an inhibitor of human SGLT2, as an agent for the prevention or treatment of diabetes, and as an agent for the prevention or treatment of obesity. The invention further relates to a glucopyranosyloxypyrazole derivative of the general formula

<img file="PL203124B1_D0006.tif" />

wherein

2 2 of¹ represents a hydrogen atom or a C1-C6 alkyl group, one of Q² and T.² represents a 2,3,4,6-tetrao-acetyl-D-glucopyranosyloxy group, while the other is a C1-C6 alkyl group, or a halo (C1-C6 alkyl) group, and R² represents a hydrogen atom, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C1-C6 alkylthio group, a halo (C1-C6 alkyl) group or a halogen atom, or a salt thereof and a C1-C6 alkylthio group, a halo (C1-C6 group) alkyl) or a halogen atom, or a salt thereof and a glucopyranosyloxypyrazole derivative of the general formula

<img file="PL203124B1_D0007.tif" />

PL 203 124 B1 ₂ wherein R is a C1-C6 alkyl group, a C1-C6 alkoxy group, a C1-C6 alkylthio group, a halo (C1-C6 alkyl) group, or a fluorine atom, and R³ is a C1-C6 alkyl group, or a salt thereof.

In the compounds of general formula (I), the term "C1-C6 alkyl group" denotes a straight chain or branched alkyl group with 1 to 6 carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert. -butyl, pentyl, isopentyl, neopentyl, tert-pentyl, hexyl or the like, the term "C1-C6 alkoxy" means a straight or branched alkoxy group with 1 to 6 carbon atoms, such as a methoxy group, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy, isopentyloxy, neopentyloxy, tertpentyloxy, hexyloxy or the like, and the term "C1-C6 alkylthio" means a straight-chain or branched alkylthio group carbon such as methylthio, ethylthio, propylthio, isopropylthio, butylthio, isobutylthio, sec-butylthio, tert-butylthio, pentylthio, isopentylthio, neopentylthio, tert-pentylthio, hexylthio or the like. The term "halogen" denotes fluorine, chlorine, bromine or iodine atoms, the term "halo (C1-C6 alkyl)" denotes a C1-C6 alkyl group substituted with different or the same 1 to 3 halogen atoms with the meanings given above.

As a substituent of R.¹, hydrogen or a straight or branched alkyl group of 1 to 3 carbon atoms are preferred, but hydrogen, ethyl, propyl or isopropyl are more preferred. As a substituent of R.², a straight chain or branched alkyl group with 1 to 4 carbon atoms, a straight chain or branched alkoxy group with 1 to 3 carbon atoms or a straight chain or branched alkylthio group with 1 to 3 carbon atoms are more preferred, but ethyl, ethoxy, isopropoxy or methylthio. As substituents for Q¹ and T.¹preferably one of them is a straight or branched alkyl group with 1 to 3 carbon atoms, more preferably one of them is a methyl group.

For example, compounds of the invention represented by general formula (I) can be prepared by the following method:

<img file="PL203124B1_D0008.tif" />

where X and Y are a leaving group such as halogen, mesyloxy or tosyloxy groups, R³ is a lower alkyl group or a halo (lower alkyl) group, R⁴ is a methyl or ethyl group, R⁵ is a lower alkyl group, one of Q² and T.² is a 2,3,4,6-tetraO-acetyl-pD-glucopyranosyloxy group and the other is a lower alkyl group or a halo (lower alkyl) group and R¹, R², Q¹ and T.¹ have the meanings given above.

Method 1

The compound of general formula (IV) can be prepared by condensation of a benzyl derivative of general formula (II) with a ketoacetate of general formula (III) in the presence of a base such as sodium hydride or potassium tert-butoxide in an inert solvent. As the inert solvent used in the reaction, 1,2-dimethoxyethane, tetrahydrofuran, N, N-dimethylformamide, a mixture thereof or other solvents can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature.

PL 203 124 B1

Way 2

A pyrazolone derivative of general formula (V) can be prepared by condensing a compound of general formula (IV) with hydrazine or hydrazine monohydrate in an inert solvent. As the inert solvent used in the reaction, toluene, tetrahydrofuran, chloroform or a mixture of these solvents and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature. The obtained pyrazolone derivative of general formula (V) can also be used in method 3 after converting into its salt in a known manner.

Process 3 (1) For pyrazolone derivatives of general formula (V) wherein R³ represents a lower alkyl group, the corresponding compound of general formula (VII) can be prepared by subjecting the corresponding pyrazolone derivative of general formula (V) to glycosidation with acetobromo-αD-glucose in the presence of a base such as silver carbonate in an inert solvent, and subjecting the resulting compound to N-alkylation using an alkylating agent of general formula (VI) in the presence of a base such as potassium carbonate in an inert solvent as required. As the solvent for the glycosidation reaction, tetrahydrofuran and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature. As the solvent used in the N-alkylation reaction, acetonitrile, N, N-dimethylformamide, tetrahydrofuran, a mixed solvent thereof and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature.

(2) In the case of pyrazolone derivatives of general formula (V) in which R³ represents halo (lower alkyl), the corresponding compound of general formula (VII) can be prepared by subjecting the corresponding pyrazolone derivative of general formula (V) to glucosidation with acetobromo-αD-glucose in the presence of a base such as potassium carbonate in an inert solvent, and subjecting the resulting compound to N-alkylation with an alkylating agent of general formula (VI) in the presence of a base such as potassium carbonate in an inert solvent as required. As the solvent for the glycosidation reaction, acetonitrile, tetrahydrofuran and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature. As the solvent used in the N-alkylation reaction, acetonitrile, N, N-dimethylformamide, tetrahydrofuran and mixtures of these solvents and the like can be illustrated. The reaction temperature is usually from room temperature to reflux temperature, and the reaction time is usually from 1 hour to 1 day, varying based on a used starting material, solvent and reaction temperature.

The obtained compounds of general formula (VII) can also be used in process 4 after converting into their salt in the usual manner.

Way 4

A compound of formula (I) according to the invention can be prepared by subjecting a compound of general formula (V) to alkaline hydrolysis. As the solvent used in this reaction, methanol, ethanol, tetrahydrofuran, water, mixtures of these solvents and the like can be illustrated, and as the base used, sodium hydride, sodium ethoxide and the like can be illustrated. The reaction temperature is usually from 0 ° C to room temperature, and the reaction time is usually from 30 minutes to 6 hours, varying based on a used starting material, solvent and reaction temperature.

Compounds of general formula (I) wherein R¹ represents a lower alkyl group can be produced by the following method:

<img file="PL203124B1_D0009.tif" />

PL 203 124 B1 where Q¹, R², R⁵, T¹ and X are as defined above.

Way 5

A compound of general formula (Ib) of the invention can be prepared by subjecting a compound of general formula (Ia) of the invention to N-alkylation with an N-alkylating agent of general formula (VI) in the presence of a base such as potassium carbonate or cesium carbonate. and sometimes a catalytic amount of sodium iodide in an inert solvent. As the inert solvent used in the reaction, N, N-dimethylformamide, dimethoxyethane, dimethyl sulfoxide, tetrahydrofuran, ethanol, mixtures of these solvents and the like can be illustrated. The reaction temperature is usually from room to reflux temperature, and the reaction time is usually from 10 minutes to 1 day, varying based on a used starting material, solvent and reaction temperature.

Useful compounds of general formula (VII) and their salts which are used in the above-mentioned preparation method are compounds which are intermediates of compounds of general formula (I) according to the invention. In compounds of general formula (VII) as well as in compounds of general formula (I) according to the invention, preferably each of Q² and T.² represents a straight or branched alkyl group with 1 to 3 carbon atoms, and more preferably, each is a methyl group.

In the compound of formula (V), the following three tautomers are used as starting materials, depending on the change in the reaction conditions:

<img file="PL203124B1_D0010.tif" />

in which R.² and r³ have the meanings given above. The compounds of general formula (V) and their salts which are useful in the above-mentioned preparation method are intermediates of compounds of general formula (I) according to the invention. In compounds of general formula (V) as well as in compounds of general formula (I) according to the invention, preferably the substituent R³ is a straight chain or branched alkyl group with 1 to 3 carbon atoms, more preferably R³ represents a methyl group.

The compounds of general formula (I) according to the invention, obtained by the above-mentioned methods, can be isolated and purified by conventional purifying means, such as fractional recrystallization, chromatographic purification and solvent extraction.

The glucopyranosyloxypyrazole derivatives of general formula (I) according to the invention can be converted into their pharmaceutically acceptable salts in the usual manner. Examples of such salts are addition salts with mineral acids such as hydrochloric, hydrobromic, hydroiodic, sulfuric, nitric, phosphoric and the like, addition salts with organic acids such as formic acid, acetic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, propionic acid, lemon, amber, tartaric, fumaric, butyric, oxalic, malonic, maleic, lactic, apple, carbonic, glutamine, aspartic and the like, and salts with inorganic bases, such as sodium salt, potassium salt and the like.

The compounds of general formula (I) according to the invention include their solvates with pharmaceutically acceptable solvents such as ethanol and water.

The compounds of general formula (I) of the present invention show excellent inhibitory activity on human SGLT2 and are extremely useful as agents for the prevention or treatment of diabetes mellitus, diabetic complications, obesity and the like. For example, in the following tests for inhibitory activity

The activity of human SGLT2 according to the invention showed a strong inhibitory activity on human SGLT2. On the other hand, since the compound WAY-123783 has extremely weak inhibitory activity against human SGLT2, it is not expected to have a sufficient effect as an inhibitor of human SGLT2.

When the pharmaceutical composition according to the invention is used in practice, various forms of administration are used depending on their use. As examples of the administration forms, there may be mentioned powder, granules, microgranules, dry syrups, tablets, capsules, injectables, solutions, ointments, suppositories, compresses and the like which can be administered orally or parenterally.

These pharmaceutical compositions can be prepared by mixing with / or diluting and dissolving suitable additional pharmaceutical substances such as excipients, disintegrants, binders, lubricants, buffers, isotonic agents, antiseptics, wetting agents, emulsifying agents, dispersing agents, stabilizing agents, dissolving agents. and the like, producing mixtures according to a conventional method.

When the pharmaceutical compositions according to the invention are used in practice, the doses of a compound of general formula (I) or a pharmaceutically acceptable salt thereof as active ingredient are suitably selected according to the age, sex, body weight and severity of the symptoms and treatment of each patient, which are ranging from about 0.1 to 1,000 mg per day per adult for oral administration and in the range from about 0.1 to 300 mg per day per adult for parenteral administration. and the daily dose may be divided into several doses per day and administered appropriately.

Examples

The following reference examples, examples and tests illustrate the present invention without limiting it.

Example 1

1.2- dihydro-4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one

Triethylamine (0.28 mL) and methanesulfonyl chloride (0.16 mL) were added to a solution of 4-isopropoxybenzyl alcohol (0.34 g) in tetrahydrofuran (6 mL), and the mixture was stirred at room temperature for 30 minutes. The resulting insoluble product was removed by filtration. The obtained solution of 4-isopropoxybenzyl mesylate in tetrahydrofuran was added to a suspension of sodium hydride (60%, 81 mg) and methyl acetoacetate (0.20 mL) in 1,2-dimethoxyethane (10 mL), and the mixture was stirred at 80 ° C overnight. The reaction mixture was poured into a saturated sodium bicarbonate solution, and the resulting mixture was extracted with diethyl ether. The organic layer was washed with brine, and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure and the residue was dissolved in toluene (5 mL). Anhydrous hydrazine (0.19 mL) was added to the solution, and the mixture was stirred at 80 ° C overnight. The solvent was removed under reduced pressure and the residue was purified by column chromatography on silica gel (eluent: dichloromethane / methanol - 10/1) to give 1,2-dihydro-4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3H- pyrazol-3-one (95 mg).

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.22 (6H, d, J = 6.0Hz), 1.99 (3H, s), 3.45 (2H, s), 4.40-4.60 (1H, m), 6.65 -6.80 (2H, m), 6.957.10 (2H, m).

Example 2

1.2- dihydro-5-methyl-4 - [(4-propylphenyl) methyl] -3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-propylbenzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

0.75-0.95 (3H, m), 1.45-1.65 (2H, m), 1.99 (3H, s), 2.40-2.55 (2H, m), 3. 32 (2H, s), 6.95-7.10 (4H, m).

Example 3

1.2- dihydro-4 - [(4-isobutylphenyl) methyl] -5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-isobutylbenzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

0.83 (6H, d, J = 6.6Hz), 1.70-1.85 (1H, m), 1.99 (3H, s), 2.30-2.45 (2H, m) , 3.50 (2H, s), 6.907.10 (4H, m).

PL 203 124 B1

Example 4

1.2- dihydro-5-methyl-4 - [(4-propoxyphenyl) methyl] -3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-isopropoxybenzyl alcohol in place of 4-propoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

0.95 (3H, t, J = 7.4Hz), 1.60-1.75 (2H, m), 1.98 (3H, s), 3.46 (2H, s), 3.75 -3.90 (2H, m), 6.706.85 (2H, m), 6.95-7.10 (2H, m).

Example 5

4 - [(4-ethoxyphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-ethoxybenzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.20-1.35 (3H, m), 1.98 (3H, s), 3.46 (2H, s), 3.85-4.05 (2H, m), 6.70-6, 85 (2H, m), 6.95-7.10 (2H, m).

Example 6

1.2- dihydro-5-methyl-4 - [(4-trifluoromethylphenyl) methyl] -3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-trifluoromethylbenzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

2.02 (3H, s), 3.64 (2H, s), 7.30-7.45 (2H, m), 7.55-7.70 (2H, m).

Example 7

4 - [(4-tert-butylphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-tert-butylbenzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.24 (9H, s), 2.01 (3H, s), 3.49 (2H, s), 7.00-7.15 (2H, m), 7.15-7.30 (2H, m).

Example 8

4- [(4-butoxyphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4-butoxybenzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

0.91 (3H, t, J = 7.4Hz), 1.30-1.50 (2H, m), 1.55-1.75 (2H, m), 1.98 (3H, s) , 3.46 (2H, s), 3.803.95 (2H, m), 6.70-6.85 (2H, m), 6.95-7.10 (2H, m).

Example 9

1.2- dihydro-5-methyl-4 - [(4-methylthiophenyl) methyl] -3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4- (methylthio) benzyl alcohol in place of 4-isopropoxybenzyl alcohol.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.99 (3H, s), 2.42 (3H, s), 3.50 (2H, s), 7.05-7.20 (4H, m).

Example 10

5-ethyl-1,2-dihydro-4 - [(4-methylthiophenyl) methyl] -3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 1 by using 4- (methylthio) benzyl alcohol in place of 4-isopropoxybenzyl alcohol and using methyl 3-oxopentanoate in place of methyl acetoacetate.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.02 (3H, t, J = 7.6 Hz), 2.39 (2H, q, J = 7.6 Hz), 2.42 (3H, s), 3.51 (2H, s), 7.05-7.20 (4H, m).

Example 11

1.2- dihydro-4 - [(4-isopropylphenyl) methyl] -5-methyl-3H-pyrazol-3-one

Methyl acetoacetate (0.11 mL), 4-isopropylbenzyl chloride (0.17 g) and a catalytic amount of sodium iodide were added to a suspension of sodium hydride (60%, 40 mg) in 1,2-dimethoxyethane (1 mL), and the mixture was stirred in 80 ° C overnight. The reaction mixture was poured into a saturated sodium bicarbonate solution, and the mixture was extracted with diethyl ether. The organic layer was washed with brine, and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure and the residue was dissolved in toluene (1 mL). Anhydrous hydrazine (0.094 mL) was added to the solution, and the mixture was stirred at 80 ° C overnight. The solvent was removed under reduced pressure and the residue was purified by gel column chromatography

Silica (eluent: dichloromethane / methanol = 10/1) to give 1,2-dihydro-4 - [(4-isopropylphenyl) methyl] -5-methyl-3H-pyrazol-3-one (0.12 g).

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.16 (6H, d, J = 6.9Hz), 2.01 (3H, s), 2.70-2.90 (1H, m), 3.49 (2H, s), 6.95 -7.20 (4H, m).

Example 12

4 - [(4-ethylphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 11 using 4-ethylbenzyl chloride in place of 4-isopropylbenzyl chloride.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.13 (3H, t, J = 7.6Hz), 2.00 (3H, s), 2.45-2.60 (2H, m), 3.49 (2H, s), 7.00 -7.15 (4H, m).

Example 13

1.2- dihydro-5-methyl-4 - [(4-methylphenyl) methyl] -3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 11 by using 4-methylbenzyl bromide in place of 4-isopropylbenzyl chloride.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.98 (3H, s), 2.23 (3H, s), 3.48 (2H, s), 6.95-7.10 (4H, m).

Reference example 1

4-benzyl-1,2-dihydro-5-trifluoromethyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 11 using ethyl trifluoroacetoacetate in place of methyl acetoacetate and using benzyl bromide in place of 4-isopropylbenzyl chloride.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

3.73 (2H, s), 7.05-7.35 (5H, m), 12.50-13.10 (1H, br s).

Example 14

1.2- dihydro-4 - [(4-methoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 11 using 4-methoxybenzyl bromide in place of 4-isopropylbenzyl chloride.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

1.99 (3H, s), 3.47 (2H, s), 3.69 (3H, s), 6.75-6.85 (2H, m), 7.00-7.10 (2H, m) , 8.70-11.70 (2H, br).

Reference example 2

4-benzyl-1,2-dihydro-5-methyl-3H-pyrazol-3-one

The title compound was prepared in a similar manner to that described in Example 11 using benzyl bromide in place of 4-isopropylbenzyl chloride.

¹H-NMR (500 MHz, DMSO-d6) δ ppm:

2.00 (3H, s), 3.54 (2H, s), 7.05-7.30 (5H, s).

Example 15

4- [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

For a suspension of 1,2-dihydro-4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one (46 mg), acetobromo-aD-glucose (99 mg) and 4A molecular sieves in tetrahydrofuran (3 mL) Silver carbonate (66 mg) was added and the mixture was stirred in the shade at 65 ° C overnight. The reaction mixture was purified by column chromatography on aminopropyl silica gel (eluent: tetrahydrofuran). Further purification by preparative thin layer chromatography on silica gel (developing solvent: ethyl acetate / hexane = 2/1) gave 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4, 6-tetra-O-acetyl-3-D-glucopyraznosyloxy) -1H-pyrazole (42 mg).

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.25-1.35 (6H, m), 1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2 . 10 (3H, s), 3.45-3.65 (2H, m), 3.80-3.90 (1H, m), 4.13 (1H, d, J = 2.3, 12, 4 Hz), 4.31 (1H, dd, J = 4.0, 12.4 Hz), 4.40-4.55 (1H, m), 5.15-5.35 (3H, m), 5.50-5.60 (1H, m), 6.70-6.80 (2H, m), 6.95-7.05 (2H, m).

Example 16

5-methyl-4 - [(4-propylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 1,2-dihydro-5-methyl-4 - [(4-propylphenyl) methyl] -3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

PL 203 124 B1 ¹H-NMR (500 MHz, CDCl3) δ ppm:

0.91 (3H, t, J = 7.3Hz), 1.50-1.65 (2H, m), 1.86 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.05 (3H, s),

2.10 (3H, s), 2.45-2.55 (2H, m), 3.55 (1H, d, J = 15.8 Hz), 3.63 (1H, d, J = 15, 8 Hz), 3.80-3.90 (1H, m),

4.13 (1H, dd, J = 2.3, 12.4 Hz), 4.30 (1H, dd, J = 3.9, 12.4 Hz), 5.15-5.35 (3H, m), 5.50-5.60 (1H, m), 7.00-7.20 (4H, m).

Example 17

4- [(4-isobutylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy-1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 1,2-dihydro-4 - [(4-isobutylphenyl) methyl] -5-methyl-3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

0.87 (6H, d, J = 6.6Hz), 1.70-1.85 (1H, m), 1.87 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s),

2.10 (3H, s), 2.40 (2H, d, J = 7.2Hz), 3.56 (1H, d, J = 15.8Hz), 3.63 (1H, d, J = 15.8 Hz), 3.80-3.90 (1H, m), 4.14 (1H, dd, J = 2.3, 12.4 Hz), 4.31 (1H, dd, J = 4.0, 12.4 Hz), 5.15-5.35 (3H, m), 5.50-5.60 (1H, m), 6.95-7.10 (4H, m).

Example 18

5-methyl-4 - [(4-propoxyphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 15 using 1,2-dihydro-5-methyl-4 - [(4-propoxyphenyl) methyl] -3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.01 (3H, t, J = 7.4Hz), 1.70-1.85 (2H, m), 1.89 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s),

2.10 (3H, s), 3.53 (1H, d, J = 15.7Hz), 3.59 (1H, d, J = 15.7Hz), 3.80-3.95 (3H , m), 4.14 (1H, dd, J = 2.3, 12.4Hz), 4.31 (1H, dd, J = 4.0, 12.4Hz), 5.15-5, 35 (3H, m), 5.50-5.60 (1H, m), 6.70-6.80 (2H, m), 6.95-7.10 (2H, m).

Example 19

4- [(4-ethoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 4 - [(4-ethoxyphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one instead of 1,2-dihydro-4- [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.38 (3H, t, J = 7.0Hz), 1.89 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s ), 2.10 (3H, s), 3.53 (1H, d, J = 15.8 Hz), 3.59 (1H, d, J = 15.8 Hz), 3.80-3.90 (1H, m), 3.98 (2H, q, J = 7.0Hz), 4.13 (1H, dd, J = 2.3, 12.4Hz), 4.31 (1H, dd, J = 4.0, 12.4), 5.15-5.30 (3H, m), 5.50-5.60 (1H, m), 6.70-6.80 (2H, m), 6.95-7.10 (2H, m).

Example 20

5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -4 - [(4-trifluoromethylphenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 15 using 1,2-dihydro-5-methyl-4 - [(4-trifluoromethylphenyl) methyl] -3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.85 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.14 (3H, s), 3.65 (1H , d, J = 15.9 Hz), 3.71 (1H, d, J = 15.9 Hz), 3.80-3.90 (1H, m), 4.14 (1H, dd, J = 2.4, 12.4Hz), 4.31 (1H, dd, J = 4.0, 12.4Hz), 5.15-5.40 (3H, m), 5.55-5.65 (1H, m), 7.20-7.30 (2H, m), 7.45-7.55 (2H, m).

Example 21

4 - [(4-tert-butylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 4 - [(4-tert-butylphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one instead of 1,2-dihydro -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-2-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.27 (9H, s), 1.84 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.14 (3H , s), 3.56 (1H, d, J = 15.8 Hz), 3.64 (1H, d, J = 15.8 Hz), 3.80-3.90 (1H, m), 4 , 13 (1H, dd, J = 2.3, 12.4Hz), 4.31 (1H, dd, J = 4.0, 12.4Hz), 5.15-5.30 (3H, m ), 5.50-5.60 (1H, m), 7.00-7.10 (2H, m), 7.20-7.30 (2H, m).

PL 203 124 B1

Example 22

4- [(4-butoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 4 - [(4-butoxyphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

0.96 (3H, t, J = 7.4Hz), 1.40-1.55 (2H, m), 1.65-1.80 (2H, m), 1.88 (3H, s) , 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.10 (3H, s), 3.52 (1H, d, J = 15.8 Hz), 3.59 (1H, d, J = 15.8 Hz), 3.80-3.90 (1H, m), 3.91 (2H, t, J = 6.5 Hz), 4. 13 (1H, dd, J = 2.3, 12.4 Hz), 4.31 (1H, dd, J = 4.0, 12.4 Hz), 5.155.30 (3H, m), 5.50 -5.60 (1H, m), 6.70-6.80 (2H, m), 6.95-7.10 (2H, m).

Example 23

5-methyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 15 using 1,2-dihydro-5-methyl-4 - [(4-methylthiophenyl) methyl] -3H-pyrazol-3-one instead of 1,2-dihydro-4 - [( 4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.07 (3H, s), 2.12 (3H, s), 2.44 (3H , s), 3.50-3.65 (2H, m), 3.80-3.90 (1H, m), 4.13 (1H, dd, J = 2.4, 12.4Hz), 4.31 (1H, dd, J = 4.1, 12.4 Hz), 5.15-5.30 (3H, m), 5.55-5.65 (1H, m), 7.00- 7.10 (2H, m), 7.10-7.20 (2H, m), 8.65-8.85 (1H, br s).

Example 24

5-ethyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 5-ethyl-1,2-dihydro-4 - [(4-methylthiophenyl) methyl] -3H-pyrazol-3-one instead of 1,2-dihydro-4- [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.13 (3H, t, J = 7.6 Hz), 1.88 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s ), 2.44 (3H, s), 2.452.55 (2H, m), 3.50-3.70 (2H, m), 3.80-3.90 (1H, m), 4.05- 4.20 (1H, m), 4.31 (1H, dd, J = 4.0, 12.4Hz), 5.15-5.35 (3H, m), 5.55-5.65 ( 1H, m), 7.00-7.10 (2H, m), 7.10-7.20 (2H, m), 8.80-9.20 (1H, br s).

Example 25

4 - [(4-isopropylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 1,2-dihydro-4 - [(4-isopropylphenyl) methyl] -5-methyl-3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.20 (6H, d, J = 6.9Hz), 1.85 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s ), 2.13 (3H, s), 2.752.90 (1H, m), 3.56 (1H, d, J = 15.8 Hz), 3.63 (1H, d, J = 15.8 Hz ), 3.80-3.90 (1H, m), 4.05-4.20 (1H, m), 4.31 (1H, dd, J = 4.0, 12.4Hz), 5, 15-5.35 (3H, m), 5.50-5.60 (1H, m), 7.00-7.15 (4H, m), 8.709.30 (1H, br s).

Example 26

4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

To a solution of 1,2-dihydro-4 - [(4-methylthiophenyl) methyl] -5-trifluoromethyl-3H-pyrazol-3-one (2.0 g) in acetonitrile (100 mL) was added acetobromo-? 3.1 g) and potassium carbonate (1.1 g) and the mixture was stirred at room temperature overnight. Water was then added to the reaction mixture, and the resulting mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous bicarbonate solution and brine, and dried over anhydrous magnesium sulfate. The solvent was removed under reduced pressure and the residue was purified by column chromatography on silica gel (eluent: hexane / ethyl acetate = 1/1) to give 4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6- tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole (2.0 g).

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.91 (3H, s), 2.03 (3H, s), 2.04 (3H, s), 2.09 (3H, s), 2.45 (3H, s), 3.73 (2H , s), 3.75-3.90 (1H, m), 4.15-4.35 (2H, m), 5.15-5.65 (4H, m), 7.00-7.20 (4H, m).

Example 27

4-benzyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 26 using 4-benzyl-1,2-dihydro-5-trifluoromethyl-3H-pyrazol-3-one instead of 1,2-dihydro-4 - [(4-methylthiophenyl) methyl ] -5-trifluoromethyl-3H-pyrazol-3-one.

PL 203 124 B1 ¹H-NMR (500 MHz, CDCl3) δ ppm:

1.89 (3H, s), 2.02 (3H, s), 2.04 (3H, s), 2.08 (3H, s), 3.70-3.90 (3H, m), 4 , 15-4.30 (2H, m), 5.10-5.50 (4H, m), 7.10-7.30 (5H, m).

Example 28

4 - [(4-methoxyphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 26 using 1,2-dihydro-4 - [(4-methoxyphenyl) methyl] -5-trifluoromethyl-3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-methylthiophenyl) methyl] -5-trifluoromethyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.93 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.09 (3H, s), 3.65-3.75 (2H, m), 3 . 77 (3H, s), 3.75-3.90 (1H, m), 4.15-4.35 (2H, m), 5.10-5.45 (4H, m), 6.75 -6.85 (2H, m), 7.00-7.15 (2H, m).

Example 29

4 - [(4-methoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 15 using 1,2-dihydro-4 - [(4-methoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one instead of 1,2-dihydro-4-. [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.89 (3H, s), 2.02 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.10 (3H, s), 3.45-3.65 (2H, m), 3.76 (3H, s), 3.80-3.90 (1H, m), 4.11 (1H, dd, J = 2.2, 12.4Hz), 4, 30 (1H, dd, J = 4.0, 12.4Hz), 5.15-5.35 (3H, m), 5.50-5.60 (1H, m), 6.70-6, 85 (2H, m), 7.00-7.10 (2H, m).

Example 30

4-benzyl-5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole

The title compound was prepared in a similar manner to Example 15 using 4-benzyl-1,2-dihydro-4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one instead of 1,2- dihydro-4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3H-pyrazol-3-one.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.86 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.11 (3H, s), 3.59 (1H , d, J = 15.8 Hz), 3.66 (1H, d, J = 15.8 Hz), 3.80-3.90 (1H, m), 4.11 (1H, dd, J = 2.3, 12.4Hz), 4.30 (1H, dd, J = 4.09, 12.4Hz), 5.15-5.30 (3H, m), 5.50-5.65 (1H, m), 7.05-7.30 (5H, m), 8.75-9.55 (1H, br s).

Example 31

4 - [(4-methoxyphenyl) methyl] -1,5-dimethyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -pyrazole

Suspension of 4 - [(4-methoxyphenyl) methyl-5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole (18 mg), potassium carbonate (14 mg ) and iodomethane (4.7 mg) in acetonitrile (2 mL) was stirred at 75 ° C overnight. The reaction mixture was filtered through celite^® and the solvent was removed under reduced pressure. The residue was purified by preparative thin layer chromatography (developing solvent: benzene / acetone = 2/1) to give 4 - [(4-methoxyphenyl) methyl] -1,5-dimethyl-3- (2,3,4,6-tetra- O-acetyl-eD-glucopyranosyloxy) -pyrazole (4 mg).

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.90 (3H, s), 2.01 (3H, s), 2.03 (3H, s), 2.06 (3H, s), 2.07 (3H, s), 3.45-3.60 (2H, m), 3.60 (3H, s), 3.76 (3H, s), 3.80-3.90 (1H, m), 4.13 (1H, dd, J = 2.4 , 12.4Hz), 4.29 (1H, dd, J = 4.1, 12.4Hz), 5.15-5.30 (3H, m), 5.50-5.60 (1H, m), 6.70-6.80 (2H, m), 7.00-7.10 (2H, m).

Example 32

1-methyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-tri-fluoromethylpyrazole

Suspension of 4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-tri-fluoromethyl-1H-pyrazole (30 mg), potassium carbonate (8.0 mg) and iodomethane (8.2 mg) in tetrahydrofuran (1 mL) was stirred at 75 ° C overnight. The reaction mixture was filtered through celite^®and the solvent was removed from the filtrate under reduced pressure. The residue was purified by preparative thin layer chromatography (developing solvent: dichloromethane // ethyl acetate = 5/1) to give 1-methyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra- O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethylpyrazole (13 mg).

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.89 (3H, s), 2.02 (3H, s), 2.04 (3H, s), 2.07 (3H, s), 2.44 (3H, s), 3.65-3 , 95 (6H, m), 4.14 (1H, dd, J = 2.3, 12.4 Hz), 4.29 (1H, dd, J = 4.3, 12.4 Hz), 5, 15-5.35 (3H, m), 5.50-5.65 (1H, m), 7.007.20 (4H, m).

PL 203 124 B1

Example 33

1-ethyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethylpyrazgl

The title compound was prepared in a similar manner to that described in Example 32 using iodoethane in place of iodomethane.

¹H-NMR (500 MHz, CDCl3) δ ppm:

1.40 (3H, t, J = 7.2Hz), 1.90 (3H, s), 2.02 (3H, s), 2.04 (3H, s), 2.06 (3H, s ), 2.44 (3H, s), 3.72 (2H, s), 3.80-3.90 (1H, m), 4.05-4.20 (3H, m), 4.27 ( 1H, dd, J = 4.5, 12.4Hz), 5.10-5.35 (3H, m), 5.555.65 (1H, m), 7.00-7.10 (2H, m) , 7.10-7.20 (2H, m).

Example 34

4 - [(4-methylthiophenyl) methyl] -1-propyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethylpyrazole

The title compound was prepared in a similar manner to that described in Example 32 using iodopropane in place of iodomethane.

¹H-NMR (500 MHz, CDCl3) δ ppm:

0.92 (3H, t, J = 7.4Hz), 1.75-1.90 (2H, m), 1.89 (3H, s), 2.02 (3H, s), 2.04 (3H, s), 2.06 (3H, s), 2.44 (3H, s), 3.72 (2H, s), 3.80-3.90 (1H, m), 3.90- 4.05 (2H, m), 4.12 (1H, dd, J = 2.3, 12.4Hz), 4.27 (1H, dd, J = 4.5, 12.4Hz), 5 , 10-5.35 (3H, m), 5.55-5.65 (1H, m), 7.00-7.10 (2H, m), 7.10-7.20 (2H, m) .

Example 35

3 - (- eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole

To a solution of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole (61 mg) in ethanol (3 mL) was added a solution of 1N aqueous sodium hydride (0.53 mL) and the mixture was stirred at room temperature for 2 hours. The solvent was removed under reduced pressure and the residue was purified by solid phase extraction on ODS column (washing solvent: distilled water, eluent: methanol) to give 3- (e-D-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5 -methyl-1H-pyrazole (39 mg).

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.26 (6H, d, J = 5.9Hz), 2.05 (3H, s), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m) , 3.75-3.90 (1H, m), 4.45-4.60 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m), 7.00-7.15 (2H, m).

Example 36

3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-propylphenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 35 using 5-methyl-4 - [(4-propylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H -pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.91 (3H, t, J = 7.5Hz), 1.50-1.65 (2H, m), 2.05 (3H, s), 2.45-2.60 (2H, m) , 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.83 (1H, d, J = 11.9Hz), 5.00-5.10 (1H, m), 7.00-7.15 (4H, m).

Example 37

3- (eD-glucopyranosyloxy) -4 - [(4-isobutylphenyl) methyl] -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-isobutylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) - 1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.87 (6H, d, J = 6.6Hz), 1.70-1.90 (1H, m), 2.04 (3H, s), 2.41 (2H, d, J = 7, 1 Hz), 3.25-3.45 (4H, m), 3.55-3.90 (4H, m), 5.00-5.10 (1H, m), 6.95-7.15 (4H, m).

Example 38

3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-propoxyphenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 35 using 5-methyl-4 - [(4-propoxyphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H -pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.02 (3H, t, J = 7.4Hz), 1.65-1.80 (2H, m), 2.05 (3H, s), 3.25-3.45 (4H, m) , 3.60-3.75 (3H, m), 3.80-3.90 (3H, m), 5.00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.05-7.15 (2H, m).

PL 203 124 B1

Example 39

4- [(4-ethoxyphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-ethoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) - 1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.34 (3H, t, J = 7.0Hz), 2.05 (3H, s), 3.25-3.45 (4H, m), 3.60-3.75 (3H, m) , 3.80-3.90 (1H, m),

3.97 (2H, q, J = 7.0Hz), 5.00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.05-7.15 ( 2H, m).

Example 40

3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-trifluoromethylphenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to that described in Example 35 using 5-methyl-3- (2,3,4,6-tetra-O-acetyl-β-D-glucopyranyloxy) -4 - [(4-trifluoromethylphenyl) methyl ] -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-β-D-glucopyranyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.08 (3H, s), 3.20-3.40 (4H, m), 3.67 (1H, dd, J = 5.0, 11.9Hz), 3.75-3.90 ( 3H, m), 5.00-5.10 (1H, m), 7.30-7.45 (2H, m), 7.45-7.60 (2H, m).

Example 41 1-I1-tert-butylphenyl ^ ^ ^ ethyl ^ ^ ^ eD-flucopyranosyloxy-S-methylol ^ -pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-tert-butylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-β-D-glucopyranyloxy) -1H-pyrazole.

^lH-NMR (500 MHz, CD3OD) δ ppm:

1.28 (9H, s), 2.06 (3H, s), 3.25-3.45 (4H, m), 3.60-3.90 (4H, m), 5.00-5, 10 (lH, m), 7.05-7.15 (2H, m), 7.20-7.30 (2H, m).

Example 42 m-Butoxyphenylmethylmethyl-D-glucopyranosyloxy-smethyl-1Hipiiazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-butoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl- (eD-glucopyranosyloxy) - 1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

^lH-NMR (500 MHz, CD3OD) δ ppm:

0.97 (3H, t, J = 7.4Hz), 1.40-1, 55 (2H, m), 1.65-1, 80 (2H, m), 2.05 (3H, s) , 3.30-3.45 (4H, m), 3.60-3.75 (3H, m), 3.83 (1H, d, J = 1.2Hz), 3.9L (2H, t , J = 6.4Hz), 5.00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.05-7.15 (2H, m).

Example 43

3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-methylthiophenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 5-methyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H -pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

^lH-NMR (500 MHz, CD3OD) δ ppm:

2.06 (3H, s), 2.42 (3H, s), 3.20-3.45 (4H, m), 3.55-3.75 (3H, m), 3.80-3. 90 (lH, m), 5.00-5.10 (lH, m), 7.05-7.20 (4H, m).

Example 44

5-ethyl-3- (eD-glucopyranosyloxy) -4 - [(4-methylthiophenyl) methyl] -1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 5-ethyl-4 - [(methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H- pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

^lH-NMR (500 MHz, CD3OD) δ ppm:

1.06 (3H, t, J = 7.6 Hz), 2.42 (3H, s), 2.47 (2H, q, J = 7.6 Hz), 3.25-3.45 (4H , m), 3.60-3.80 (3H, m), 3.80-3.90 (lH, m), 5.00-5.10 (lH, m), 7.10-7.20 (4H, m).

PL 203 124 B1

Example 45

3- (eD-glucopyranosyloxy) -4 - [(4-isopropylphenyl) methyl] -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-isopropylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) - 1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.20 (6H, d, J = 6.9Hz), 2.05 (3H, s), 2.75-2.90 (1H, m), 3.25-3.45 (4H, m) , 3.55-3.90 (4H, m), 5.00-5.10 (1H, m), 7.00-7.15 (4H, m).

Example 46

3- (eD-glucopyranosyloxy) -4 - [(4-methylthiophenyl) methyl] -5-trifluoromethyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H -pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.42 (3H, s), 3.25-3.50 (4H, m), 3.69 (1H, dd, J = 4.9, 12.0 Hz), 3.75-3.90 ( 3H, m), 4.90-5.10 (1H, m), 7.10-7.20 (4H, m).

Example 47

4-benzyl-3- (eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4-benzyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole instead of 4- [ (4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

3.25-3.45 (4H, m), 3.67 (1H, dd, J = 5.3, 12.0 Hz), 3.80-3.95 (3H, m), 4.97 ( 1H, d, J = 7.4Hz), 7.05-7.25 (5H, m).

Example 48

3- (eD-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -5-trifluoromethyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-methoxyphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl- 1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

3.25-3.45 (4H, m), 3.67 (1H, d, J = 5.4, 12.1Hz), 3.73 (3H, s), 3.75-3.90 ( 3H, m), 4.90-5.00 (1H, m), 6.70-6.85 (2H, m), 7.05-7.15 (2H, m).

Example 49

3- (eD-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-methoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1 H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.04 (3H, s), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.73 (3H, s), 3.80-3.90 ( 1H, m), 5.00-5.10 (1H, m), 6.75-6.85 (2H, m), 7.05-7.15 (2H, m).

Example 50

4-benzyl-3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

The title compound was prepared in a similar manner to Example 35 using 4-benzyl-5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.05 (3H, s), 3.25-3.45 (4H, m), 3.60-3.90 (4H, m), 5.00-5.10 (1H, m), 7.05- 7.25 (5H, m).

Example 51

3- (eD-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -1,5-dimethylpyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-methoxyphenyl) methyl] -1,5-dimethyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

PL 203 124 B1 ¹H-NMR (500 MHz, CD3OD) δ ppm:

2.06 (3H, s), 3.25-3.45 (4H, m), 3.55-3.70 (6H, m), 3.73 (3H, s), 3.75-3. 90 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m), 7.05-7.15 (2H, m).

Example 52

3- (eD-glucopyranosyloxy) -1-methyl-4 - [(4-methylthiophenyl) methyl] -5-trifluoromethylpyrazole

The title compound was prepared in a similar manner to Example 35 using 1-methyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-eD-glucopyranosyloxy) -5-trifluoromethylpyrazole , instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.42 (3H, s), 3.30-3.50 (4H, m), 3.69 (1H, dd, J = 4.7, 12.0 Hz), 3.75-3.90 ( 6H, m), 5.25-5.35 (IH, m), 7.05-7.20 (4H, m).

Example 53

1-ethyl-3- (eD-glucopyranosyloxy) -4 - [(4-methylthiophenyl) methyl] -5-trifluoromethylpyrazole

The title compound was prepared in a similar manner to that described in Example 35 using 1-ethyl-4 - [(4-methylthiophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl- (eD-glucopyranosyloxy) - 5-trifluoromethylpyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl- (eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.38 (3H, t, J = 7.1Hz), 2.42 (3H, s), 3.30-3.50 (4H, m), 3.60-3.75 (1H, m) , 3.75-3.90 (1H, m), 4.14 (2H, q, J = 7.1Hz), 5.25-5.35 (1H, m), 7.05-7.20 (4H, m).

Example 54

3- (eD-glucopyranosyloxy) -4 - [(4-methylthiophenyl) methyl] -1-propyl-5-trifluoromethylpyrazole

The title compound was prepared in a similar manner to Example 35 using 4 - [(4-methylthiophenyl) methyl] -1-propyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) - 5-trifluoromethylpyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.90 (3H, t, J = 7.4Hz), 1.75-1.90 (2H, m), 2.42 (3H, s), 3.30-3.50 (4H, m) , 3.69 (1H, dd, J = 4.9, 12.0 Hz), 3.75-3.90 (3H, m), 4.00-4.10 (2H, m), 5.25 -5.35 (1H, m), 7.05-7.20 (4H, m).

Example 55

3- (eD-glucopyranosyloxy) -5-methyl-4 - [(4-methylphenyl) methyl] -1H-pyrazole

5-methyl-4 - [(4-methylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole was prepared in a similar manner to that described in Example Using 1,2-dihydro-5-methyl-4 - [(4-methylphenyl) methyl] -3H-pyrazol-3-one, instead of 1,2-dihydro-4 - [(4-isopropoxyphenyl) methyl] -5 -methyl-3H-pyrazol-3-one. Then, the title compound was prepared in a similar manner to that described in Example 35 using 5-methyl-4 - [(4-methylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.04 (3H, s), 2.26 (3H, s), 3.25-3.45 (4H, m), 3.55-3.90 (4H, m), 5.00-5. 10 (1H, m), 6.95-7.15 (4H, m).

Example 56

4- [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1H-pyrazole

4 - [(4-ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole was prepared in a similar manner to that described in Example Using 4 - [(4-ethylphenyl) methyl] -1,2-dihydro-5-methyl-3H-pyrazol-3-one, instead of 1,2-dihydro-4 - [(4-isopropoxyphenyl) methyl] -5 -methyl-3H-pyrazol-3-one. Then, the title compound was prepared in a similar manner to that described in Example 35 using 4 - [(4-ethylphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.18 (3H, t, J = 7.6 Hz), 2.04 (3H, s), 2.57 (2H, q, J = 7.6 Hz), 3.25-3.45 (4H , m), 3.55-3.90 (4H, m), 5.00-5.10 (1H, m), 6.95-7.20 (4H, m).

Example 57

3- (eD-glucopyranosyloxy) -4 - [(4-methylphenyl) methyl] -5-trifluoromethyl-1H-pyrazole

PL 203 124 B1

4 - [(4-methylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl- (3-D-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole was prepared in a similar manner to that described in Example 26 using 1,2-dihydro-4 - [(4-methylphenyl) methyl] -5-trifluoromethyl-3H-pyrazol-3-one, instead of 1,2-dihydro-4 - [(4-methylthiophenyl) methyl] - 5-trifluoromethyl-3H-pyrazol-3-one. Then, the title compound was prepared in a similar manner to Example 35 using 4 - [(4-methylphenylmethyl] -3- (2,3,4,6-tetra-O-acetyl-pD-glucopyranosyloxy) -5-trifluoromethyl- 1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

2.25 (3H, s), 3.20-3.45 (4H, m), 3.55-3.70 (1H, m), 3.70-3.90 (3H, m), 4. 80-4.95 (1H, m), 6.907.15 (4H, m).

Example 58

4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole

4 - [(4-ethylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl1H-pyrazole was prepared in a similar manner to Example 26 using 4- [(4-ethylphenyl) methyl] -1,2-dihydro-5-trifluoromethyl-3H-pyrazol-3-one, instead of 1,2-dihydro-4 - [(4-methylthiophenyl) methyl] -5-trifluoromethyl-3H -pyrazol-3-one. Then, the title compound was prepared in a similar manner to that described in Example 35 using 4 - [(4-ethylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.18 (3H, t, J = 7.6Hz), 2.50-2.60 (2H, m), 3.15-3.40 (4H, m), 3.55-3.65 ( 1H, m), 3.70-3.90 (3H, m), 4.80-4.95 (1H, m), 6.95-7.15 (4H, m).

Example 59

3- (eD-glucopyranosyloxy) -4 - [(4-isopropylphenyl) methyl] -5-trifluoromethyl-1H-pyrazole

4- [(4-isopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole was prepared in a similar manner to Example 26 using 1,2-dihydro-4 - [(4-isopropylphenyl) methyl] -5-trifluoromethyl-3H-pyrazol-3-one, instead of 1,2-dihydro-4 - [(4-methylthiophenyl) methyl] -5-trifluoromethyl -3H-pyrazol-3-one. Then, the title compound was prepared in a similar manner to that described in Example 35 using 4 - [(4-isopropylphenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.20 (6H, d, J = 6.9Hz), 2.75-2.85 (1H, m), 3.15-3.40 (4H, m), 3.55-3.65 ( 1H, m), 3.70-3.90 (3H, m), 4.80-4.95 (1H, m), 7.00-7.15 (4H, m).

Example 60

4 - [(4-chlorophenyl) methyl] -3- (eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole

4 - [(4-chlorophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl-1H-pyrazole was prepared in a similar manner to that described in Example 26 using 4 - [(4-chlorophenyl) methyl] -1,2-dihydro-5-trifluoromethyl-3H-pyrazol-3-one, instead of 1,2-dihydro-4 - [(4-methylthiophenyl) methyl] -5-trifluoromethyl -3H-pyrazol-3-one. Then, the title compound was prepared in a similar manner to that described in Example 35 using 4 - [(4-chlorophenyl) methyl] -3- (2,3,4,6-tetra-O-acetyl-eD-glucopyranosyloxy) -5-trifluoromethyl -1H-pyrazole, instead of 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-3- (2,3,4,6-tetra-O-acetyl-3-D-glucopyranosyloxy) -1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

3.20-3.40 (4H, m), 3.55-3.70 (1H, m), 3.75-3.90 (3H, m), 4.80-4.95 (1H, m ), 7.10-7.25 (4H, m).

Example 61

3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1-propylpyrazole

For a suspension of 3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole (50 mg) and cesium carbonate (0.20 g) in N, N-dimethylformamide (1 mL ) iodopropane (0.036 mL) was added at 50 ° C and the mixture was stirred overnight. Water was added to the reaction mixture and the resulting mixture was purified by solid phase extraction on an ODS column (washing solvent: distilled water, eluent: methanol). The obtained semi-purified material was purified by column chromatography on silica gel (eluent: dichloromethane / methanol = 8/1) to give 3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1- propylpyrazole (28 mg).

PL 203 124 B1 ¹H-NMR (500 MHz, CD3OD) δ ppm:

0.87 (3H, t, J = 7.4Hz), 1.26 (6H, d, J = 6.0Hz), 1.65-1.80 (2H, m), 2.07 (3H , s), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.75-3.95 (3H, m), 4.40-4.60 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m), 7.00-7.10 (2H, m).

Example 62

1-ethyl-3- (eD-glucopyranosyloxy) -4 - [(4-isopropylphenyl) methyl] -5-methylpyrazole

The title compound was prepared in a similar manner to the one described in Example 61 using iodoethane in place of iodopropane.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.26 (6H, d, J = 6.0Hz), 1.29 (3H, t, J = 7.2Hz), 2.08 (3H, s), 3.25-3.45 (4H , m), 3.55-3.75 (3H, m), 3.75-3.90 (1H, m), 3.96 (2H, q, J = 7.2Hz), 4.40- 4.60 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m), 7.00-7.10 (2H, m).

Example 63

1-ethyl-3- (eD-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -5-methylpyrazole

The title compound was prepared in a similar manner to Example 61 using 3- (β-D-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -5-methyl-1H-pyrazole instead of 3- (eD-glucopyranosyloxy) - 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole and using iodoethane in place of iodopropane.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.29 (3H, t, J = 7.1Hz), 2.07 (3H, s), 3.20-3.45 (4H, m), 3.55-3.75 (6H, m) , 3.82 (1H, dd, J = 2.0, 12.0 Hz), 3.90-4.05 (2H, m), 5.00-5.10 (1H, m), 6.70 -6.85 (2H, m), 7.05-7.15 (2H, m).

Example 64

3- (eD-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -5-methyl-1-propylpyrazole

The title compound was prepared in a similar manner to Example 61 using 3- (β-D-glucopyranosyloxy) -4 - [(4-methoxyphenyl) methyl] -5-methyl-1H-pyrazole instead of 3- (eD-glucopyranosyloxy) - 4 - [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.87 (3H, t, J = 7.5Hz), 1.65-1.80 (2H, m), 2.07 (3H, s), 3.35-3.45 (4H, m) , 3.60-3.75 (3H, m), 3.73 (3H, s), 3.75-3.85 (1H, m), 3.85-3.95 (2H, m), 5 . 00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.00-7.15 (2H, m).

Example 65

1-ethyl-4 - [(4-ethoxyphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methylpyrazole

The title compound was prepared in a similar manner to Example 61 using 4 - [(4-ethoxyphenyl) methyl] -5-methyl-3- (eD-glucopyranosyloxy) -1H-pyrazole instead of 3- (eD-glucopyranosyloxy) -4- [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole and using iodoethane in place of iodopropane.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.28 (3H, t, J = 7.4Hz), 1.34 (3H, t, J = 7.2Hz), 2.07 (3H, s), 3.25-3.45 (4H , m), 3.55-3.75 (3H, m), 3.75-3.85 (1H, m), 3.90-4.00 (4H, m), 5.00-5.10 (1H, m), 6.70-6.85 (2H, m), 7.00-7.15 (2H, m).

Example 66

4- [(4-ethoxyphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1-propylpyrazole

The title compound was prepared in a similar manner to Example 61 using 4 - [(4-ethoxyphenyl) methyl] -5-methyl-3- (eD-glucopyranosyloxy) -1H-pyrazole instead of 3- (eD-glucopyranosyloxy) -4- [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.87 (3H, t, J = 7.6Hz), 1.34 (3H, t, J = 7.1Hz), 1.65-1.80 (2H, m), 2.07 (3H , s), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.81 (1H, dd, J = 2.1, 12.1Hz), 3.85-4.05 (4H, m), 5.00-5.10 (1H, m), 6.706.85 (2H, m), 7.00-7.15 (2H, m).

Example 67

1-ethyl-4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methylpyrazole

The title compound was prepared in a similar manner to Example 61 using 4 - [(4-ethylphenyl) methyl] -5-methyl-3- (eD-glucopyranosyloxy) -1H-pyrazole instead of 3- (eD-glucopyranosyloxy) -4- [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole and using iodoethane instead of iodopropane.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.17 (3H, t, J = 7.6Hz), 1.28 (3H, t, J = 7.2Hz), 2.06 (3H, s), 2.56 (2H, q, J = 7.6 Hz), 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.75-3.85 (1H, m), 3.90- 4.00 (2H, m), 5.00-5.10 (1H, m), 7.00-7.15 (4H, m).

Example 68

4 - [(4-ethylphenyl) methyl] -3- (eD-glucopyranosyloxy) -5-methyl-1-propylpyrazole

PL 203 124 B1

The title compound was prepared in a similar manner to Example 61 using 4 - [(4-ethylphenyl) methyl] -5-methyl-3- (eD-glucopyranosyloxy) -1H-pyrazole instead of 3- (eD-glucopyranosyloxy) -4- [(4-isopropoxyphenyl) methyl] -5-methyl-1H-pyrazole.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.87 (3H, t, J = 7.4Hz), 1.17 (3H, t, J = 7.6Hz), 1.65-1.80 (2H, m), 2.06 (3H , s), 2.56 (2H, q, J = 7.6 Hz), 3.25-3.45 (4H, m), 3.60-3.95 (6H, m), 5.00- 5.10 (1H, m), 7.00-7.15 (4H, m).

Example 69

1-butyl-3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -5-methylpyrazole

The title compound was prepared in a similar manner to that described in Example 61 using bromobutane in place of iodopropane.

¹H-NMR (500 MHz, CD3OD) δ ppm:

0.92 (3H, t, J = 7.4Hz), 1.20-1.40 (8H, m), 1.60-1.75 (2H, m), 2.07 (3H, s) , 3.25-3.45 (4H, m), 3.55-3.75 (3H, m), 3.81 (1H, dd, J = 2.1, 12.0Hz), 3.91 (2H, t, J = 7.2Hz), 4.45-4.55 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m ), 7.00-7.10 (2H, m).

Example 70

3- (eD-glucopyranosyloxy) -4 - [(4-isopropoxyphenyl) methyl] -1-isopropyl-5-methylpyrazole

The title compound was prepared in a similar manner to the one described in Example 61 by using 2-bromopropane in place of iodopropane.

¹H-NMR (500 MHz, CD3OD) δ ppm:

1.26 (6H, d, J = 6.0Hz), 1.30-1.40 (6H, m), 2.08 (3H, s), 3.15-3.45 (4H, m) , 3.55-3.75 (3H, m), 3.78 (1H, dd, J = 2.3, 12.0Hz), 4.35-4.45 (1H, m), 4.45 -4.55 (1H, m), 5.00-5.10 (1H, m), 6.70-6.80 (2H, m), 7.00-7.10 (2H, m).

Test Example 1

Study of the inhibitory effect on human SGLT2 activity

1) Construction of a plasmid vector expressing human SGLT2

The production of the cDNA library for amplification was carried out by reverse transcription of total RNA derived from human kidney (Ori gene) oligo dT as a primer, using the SUPER SCRIPT preamplification system (Gibco-BRL: LIFE TECHNOLOGIES). The DNA fragment encoding human SGLT2 was amplified by a PCR reaction in which the human kidney cDNA library described above was used as a template, and the following 0702F and 0712R oligonucleotides, shown as sequences 1 and 2, respectively, were used as a primer. The amplified DNA fragment was ligated into pCR (Invitrogen), a cloning vector, according to a standard method for this kit. Escherichia coli HB101 was transformed by the usual method, and then selection of transformants was performed on LB agar medium containing 50 µl / mL kanamycin. After extraction of the plasmid DNA and purification from one of the transformants, the amplication of the DNA fragment encoding human SGLT2 was performed by PCR reaction in which the following oligonucleotides were used as primers as sequences 3 and 4, respectively. A fragment of the amplified DNA was digested with the restriction enzymes Xho I and Hind III, and then the Wizard purification kit (Promega) was purified. This purified DNA fragment was inserted into the corresponding restriction sites pcDNA3.1 (-) Myc / His-B (Invitrogen), vector for expression of functional proteins. Escherichia coli HB101 was transformed by the usual method, and then selection of the transformant was performed on LB agar medium containing 50 µg / mL ampicillin. After plasmid DNA was extracted and purified from this transformant, the primary sequence of the DNA fragment inserted into the cloning sites of the vector, pcDNA3.1 (-) Myc / His, was analyzed. compared to the human SGLT2 described by Wells et al. (Am. J. Physiol., Vol. 263, pp. 459-465 (1992)), this clone had a single base substitution (ATC that encodes Isoleucine-433 was replaced with GTC). Subsequently, a clone was obtained in which isoleucine-433 was replaced with valine. This plasmid vector expressing human SGLT2 in which the peptide is shown as sequence 5 was fused to the carboxy terminus of an alanine residue was designated KL29.

Sequence # 1 ATGGAGGAGCACACAGAGGC

Sequence # 2 of GGCATAGAAGCCCCAGAGGA

Sequence # 3 AACCTCGAGATGGAGGAGCACACAGAGGC

Sequence No. 4 AACAAGCTTGGCATAGAAGCCCCAGAGGA

Sequence # 5 KLGPEQKLISEEDLNSAVDHHHHHH

2) Generation of cells expressing transient human SGLT2

KL29, a plasmid expressing human SGLT2, was transfected in COS-7 cells (RIKEN CELL BANK RCB539) by electroporation. Electroporation was performed using a GENE PUL20 device

PL 203 124 B1

SER II (Bio-Rad Laboratories) under the conditions: 0.290 kV, 975 pF, 2 x 10⁶ COS-7 cells and 20 μg KL29 in 500 µl OPTI-MEM I (Gibco-BRL: LIFE TECHNOLOGIES) in a 0.4 ml cuvette-type container. After gene transfer, cells were harvested by centrifugation and resuspended in OPTI-MEM I medium (1 mL / cuvette). 125 µl of this cell suspension was added to each 96-well plate. After overnight cultivation at 37 ° C under 5% CO2, 125 µl of DMEM medium containing 10% fetal bovine serum (Sanko Jyunyaku), 100 units / ml penicillin G sodium (Gibco-BRL: LIFE TECHNOLOGIES) was added to each well. ), 100 pg / mL streptomycin sulfate (Gibco-BRL: LIFE TECHNOLOGIES). Cells were grown until the next day and then used to measure the inhibitory activity against methyl-αD-glucopyranoside uptake.

3) Measurement of the inhibitory activity against the uptake of methyl-αD-glucopyranoside

Test compounds were dissolved in dimethyl sulfoxide and diluted with uptake buffer (pH

7.4 buffer containing 140 mM sodium chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 5 mM methyl-αD-glucopyranoside, 10 mM 2- [4- (2-hydroxyethyl) -1-piperazinyl acid] ethanesulfonic acid and 5 mM tris (hydroxymethyl) aminoethane), each diluent was used as the sample for the inhibitory activity inhibitory activity assay. After removal of COS-7 cells expressing transient human SGLT2 from the medium, 200 µl of pretreatment buffer (7.4 pH buffer containing 140 mM choline chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride were added to each well, 10 mM 2- [4- (2-hydroxyethyl) -1-piperazinyl] ethanesulfonic acid and 5 mM tris (hydroxymethyl) aminomethane), and the cells were incubated at 37 ° C for 10 minutes. After the pretreatment buffer was removed, 200 µl of the same buffer was added again and the cells were incubated at 37 ° C for 10 minutes. The buffer for measurement was prepared by adding 7 µl of methyl-αD- (U-14C) glucopyranoside (Amersham Pharmacia Biotech) to 525 µL of the prepared test sample. For controls, a buffer without test compound was prepared. To evaluate the basal uptake in the absence of test compound and sodium, a basal uptake buffer containing 140 mM choline chloride in place of sodium chloride was similarly prepared. After the pretreatment buffer was removed, 75 µl of each of the assay buffers was added to each well, and the cells were incubated at 37 ° C for 2 hours. After removing the measurement buffer, 200 µl of wash buffer (pH 7.4 buffer containing 140 mM choline chloride, 2 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 10 mM methyl-α-glucopyranoside, 10 mM methyl-α-glucopyranoside was added to each well, 10 mM 2- [4- (2-hydroxyethyl) -1-piperazinyl [ethanesulfonic acid and 5 mM trie (hydroxymethyl) aminomethane), and the buffer was immediately removed. After two additional washes, cells were solubilized by adding 75 µL of 0.2 N sodium hydride to each well. The cell lysates were transferred to a PicoPlate (Packard), then 150 µL of MicroScint-40 (Packard) was added to each well and the radioactivity was measured using a TopCount microplate scintillation counter (Packard). The difference in uptake was obtained as 100% of the value by dividing the basal uptake radioactivity by the radioactive control study, and then from the concentration-inhibition curves by the least square method, the concentrations at which 50% of the uptake was inhibited were calculated.

Table 1

<td>Test compound</td><td>IC50 value (nM)</td>

<td> 1</td><td> 2</td>

<td>Example 35</td><td> 181</td>

<td>Example 36</td><td> 441</td>

<td>Example 37</td><td> 346</td>

<td>Example 38</td><td> 702</td>

<td>Example 39</td><td> 185</td>

<td>Example 43</td><td> 84</td>

<td>Example 44</td><td> 509</td>

<td>Example 45</td><td> 441</td>

PL 203 124 B1 cont. array l

<td> 1</td><td> 2</td>

<td>Example 46</td><td> 679</td>

<td>Example 48</td><td> 415</td>

<td>Example 49</td><td> 383</td>

<td>Example 52</td><td> 835</td>

<td>Example 55</td><td> 280</td>

<td>Example 56</td><td> 190</td>

<td>Example 58</td><td> 634</td>

<td>WAY-123783</td><td> &gt;100000</td>

TEST EXAMPLE 2

Testing of the action of promoting glucose excretion in urine

Method A)

Fasted SD rats (5 week old male SLC, 120-150 g) were used as test animals. The test compound (25.40 mg) was suspended in 762 µL of ethanol and dissolved by adding 3.048 mL of polyethylene glycol 400 and 3.8L mL of saline, then 3.3 mg / mL solution was prepared. A portion of this solution was diluted with a solvent (saline: polyethylene glycol 400: ethanol = 5: 4: 1), and then a solution with a concentration of 3.3.1 or 0.33 (mg / mL) was prepared. Each of the solutions was subcutaneously administered to rats at a dose of 3 mL / kg (10.3 and 1 mg / kg). In the control study, only the solvent (saline: polyethylene glycol 400: ethanol = 5: 4: 1) was administered subcutaneously at a dose of 3 mL / kg. Immediately after subcutaneous administration, 200 g / L of a glucose solution was orally administered at a dose of 10 mL / kg (2 g / kg). A 26G needle and a 1 mL syringe were used for subcutaneous administration. For oral administration to rats, a gastric tube and a 2.5 mL syringe were used. The number of animals in the group was 3. After the administration was completed, collection was performed in a metabolic cage. The urine sampling time was 4 hours post-glucose administration. After collection was completed, the urine volume was recorded and the urine glucose concentration was measured. Glucose concentration was measured using a laboratory test kit: Glucose B-Test WAKO (Wako Pure Chemical Industries, Ltd.). From the urine volume and the urinary glucose concentration, the amount of glucose excreted in urine over 4 hours per animal was calculated.

Method B)

Fasted SD rats (5 week old male SLC, 120-150 g) were used as test animals. The test compound (25.40 mg) was suspended in 762 µL of ethanol and dissolved by adding 3.048 mL of polyethylene glycol 400 and 3.81 mL of saline, then 3.3 mg / mL solution was prepared. A portion of this solution was diluted with a solvent (saline: polyethylene glycol 400: ethanol = 5: 4: 1), and then a solution with a concentration of 3.3.1 or 0.33 (mg / mL) was prepared. Each of the solutions was subcutaneously administered to rats at a dose of 3 mL / kg (10.3 and 1 mg / kg). In the control study, only the solvent (saline: polyethylene glycol 400: ethanol = 5: 4: 1) was administered subcutaneously at a dose of 3 mL / kg. Immediately after subcutaneous administration, 200 g / L of a glucose solution was orally administered at a dose of 10 mL / kg (2 g / kg). A 26G needle and a 1 mL syringe were used for subcutaneous administration. For oral administration to rats, a gastric tube and a 2.5 mL syringe were used. The number of animals in the group was 3. After the administration was completed, collection was performed in a metabolic cage. The urine sampling time was 4 hours post-glucose administration. After collection was completed, the urine volume was recorded and the urine glucose concentration was measured. Glucose concentration was measured using a laboratory test kit: Glucose B-Test WAKO (Wako Pure Chemical Industries, Ltd.). From the urine volume and the urinary glucose concentration, the amount of glucose excreted in urine over 4 hours per animal was calculated.

PL 203 124 B1

Table 2

<td>Test compound</td><td>Way</td><td>Dose (mg / kg)</td><td>Glucose excreted in urine (mg)</td>

<td rowspan="3">Example 35</td><td rowspan="3">B</td><td> 0,1</td><td> 16</td>

<td> 1</td><td> 74</td>

<td> 10</td><td> 188</td>

<td rowspan="6">Example 45</td><td rowspan="3">AND</td><td> 1</td><td> 22,1</td>

<td> 3</td><td> 83,2</td>

<td> 10</td><td> 153,3</td>

<td rowspan="3">B</td><td> 0,1</td><td> 2</td>

<td> 1</td><td> 45</td>

<td> 10</td><td> 132</td>

Test Example 3

Acute toxicity test

Method A)

A 0.5% solution of sodium carboxymethylcellulose was added to the test compound, and a 100 mg / mL suspension was prepared. As test animals, male mice of 6-7 weeks, fasted for 4 hours (Clea Japan, 28-33 g, 5 animals each group) were used. The test suspension described above was orally administered to the test animals at a dose of 10 mL / 1 g (1000 mg / kg), and then observations were made for 24 hours.

Method B)

A solvent (saline: polyethylene glycol 400: ethanol = 5: 4: 1) was added to the test compound to obtain a 200 mg / mL suspension. As test animals, 5-week-old male ICR mice fasted for 4 hours (Clea Japan, 26-33 g, 5 animals each group) were used. The test suspension described above was administered subcutaneously to the test animals described above at a dose of 3 mL / kg (600 mg / kg), and then observation was carried out 24 hours after administration.

The results are shown in Table 3.

Table 3

<td>Test compound</td><td>Way</td><td>Number of deaths</td>

<td>Example 35</td><td>B</td><td> 0/5</td>

<td>Example 45</td><td>AND</td><td> 0/5</td>

Industrial suitability

The glucopyranosyloxybenzylbenzene derivatives of the general formula (I) according to the invention and their pharmaceutically acceptable salts have human SGLT2 inhibitory activity and have an excellent hypoglycemic effect by excreting excess glucose in the urine, thereby inhibiting renal glucose reabsorption. Thus, agents for the prevention or treatment of diabetes mellitus, diabetic complications, obesity and the like are provided comprising a glucopyranosyloxybenzylbenzene derivative of general formula (I) according to the invention or a pharmaceutically acceptable salt thereof.

Furthermore, the compounds of the above general formulas (V) and (VII) and their salts are important intermediates in the preparation of the compounds of general formula (I) and their pharmaceutically acceptable salts. Thus, by using these compounds, compounds of general formula (I) and pharmaceutically acceptable salts thereof can be readily prepared.