Artificial plant minichromosomes

[0001] The invention relates to the field of plant biotechnology, and more particularly relates to artificial minichromosomes and methods for the preparation of such minichromosomes in plant lines.

BACKGROUND OF THE INVENTION [0002] Recent advances in chromosomal engineering have made it possible to change the genome of a plant, thereby altering its phenotype. When a transgene integrates into a plant genome, this usually occurs randomly and in an unpredictable number of copies. Accordingly, research efforts have been directed to better control of transgene integration.

[0003] Given this need, the researchers considered whether the answer lies in the use of artificial minichromosomes. They are human-made linear or circular DNA molecules constructed of cis-acting DNA sequence elements that provide replication and partitioning of constructed minichromosomes.

[0004] It is believed that the production of artificial chromosomes will reduce or eliminate certain issues related to random genomic integration into a native plant chromosome, e.g. non-target gene transfer, due to the association of a transgene with the genome of a host plant. Artificial chromosomes can also provide a method of delivering 10-100 times more genes than standard transformation vectors, and provide large chromosomal segments for complementation and / or cloning based on genetic mapping.

[0005] Three elements have been identified for the purposes of replication, stabilization and maintenance / inheritance of an artificial chromosome: (i) autonomous replication sequences that act as an origin of replication; (ii) telomeres whose function is to stabilize and maintain the ends of linear chromosomes; and (iii) centromeres, which are the site of kinetochore assembly, for the proper segregation of chromosomes in mitosis and meiosis. Isolated centromers from single-celled organisms, such as yeast, do not work in higher eukaryotes.

[0006] US Patent 5,270,201, issued to Richards et al. December 14, 1993, describes plant-based artificial chromosomes based on telomeres and, optionally, a centromere. [0007] US Patent 7,119,250, issued to Luo et al. October 10, 2006, describes compositions of plant centromeres.

[0008] US Patent 7,132,240, issued to Richards et al. November 7, 2006, describes a method for isolating methylated centromeric DNA, potentially from any centromere in the body.

[0009] U.S. Patent 7,193,128, issued to Copenhaver et al. March 20, 2007, describes how to generate or increase income from collections using the nucleic acid sequence of plant centromere.

[0010] The PCT application with publication number WO2007 / 030510, which was published on March 15, 2007, describes methods for producing plants transformed with autonomous minichromosomes.

SUMMARY OF THE INVENTION [0011] The invention relates to a plant artificial minichromosome comprising a functional centromere comprising: (a) at least two CentC tandem repeat arrays in an inverted orientation, wherein the first matrix comprises at least fifty CentC copies and the second matrix comprises at least fifty CentC copies; ; and (b) at least one copy of an element capable of retrotransposition, wherein the retrotransposable element is located between the first and second matrix.

[0012] In a second aspect, the artificial plant minichromosome according to the invention comprises a retrotranspositionable member selected from the group consisting of CentA, CRM1 and CRM2.

[0013] In a third aspect, the artificial plant minichromosome according to the invention also comprises at least one functional telomere.

[0014] In a fourth aspect, the functional centromere contained in an artificial plant minichromosome specifically binds centromeric C protein (CENPC).

[0015] In the fifth aspect, the maize plant may comprise any of the artificial minichromosomes of the invention.

[0016] In a sixth aspect, the invention relates to an isolated polynucleotide comprising: (a) at least two CentC tandem repeat arrays in an inverted orientation, wherein the first matrix contains at least ten CentC copies and the second matrix contains at least ten CentC copies; and (b) at least one copy of an element capable of retrotransposition, wherein the retrotransposable element is located between the first and second matrix.

[0017] In a seventh aspect, the isolated polynucleotide of the invention comprises a retrotranspositable member selected from the group consisting of CentA, CRM1 and CRM2. [0018] In an eighth aspect, the invention relates to a recombinant construct comprising any of the isolated polynucleotides of the invention as well as transgenic corn plants containing such recombinant constructs.

BRIEF DESCRIPTION OF THE DRAWINGS [0019] The invention can be understood more fully on the basis of a detailed description and accompanying drawings and sequence lists that form part of the disclosure.

[0020] Figure 1. Fluorescence in situ hybridization (FISH) on a mitotic chromosomal spread preparation from maize embryogenic calli, from Hi-II transformation of CMC3 pool 1 event # 14. Calli were from immature embryos transformed with the linearized BAC pool 1, modified with Tn5-3. Both prometafas (left) and metaphase (right) testes show 20 native chromosomes plus 1 minichromosome (arrows and inserts). both

- 3 minichromosomes are positive for CentC (green - color, white - grayscale) of the centromere-specific repeat and unique marker - probe 23715 (red - color, white scale of gray) specific to the construct for transformation, with both CentC and 23715 essentially colocalized in the minichromosome (inserts).

[0021] Figure 2. FISH on a dissected mitotic chromosomal preparation of maize embryogenic calli from Hi-II transformation of CMC3 pool 1 event # 14. Calli were derived from immature embryos transformed with the linearized BAC clone pool 1 modified with Tn5-3. Panel A presents a metaphase nucleus showing 20 native chromosomes plus 2 minichromosomes (window). Both minichromosomes are positive for CentC (green - color, white - gray scale) of the centromere-specific repeat and unique marker - probe 23715 (red - color, white scale of gray) specific to the construct for transformation. BD panels are a larger magnification of the window, showing minichromosomes (arrowheads) from: B - only DAPI; C - DAPI + probe 23715 (red - color, white - gray scale); and D - DAPI + CentC probe (green - color;

[0022] Figure 3. Immunofluorescence on a mitotic chromosomal spread from maize embryogenic calli from Hi-II transformation of CMC3 pool 1 event # 14. Calli were derived from immature embryos transformed with the linearized BAC clone pool 1 modified with Tn5-3. Panel A presents a metaphase nucleus showing 20 native chromosomes plus 1 minichromosome (arrow). All centromeres of native chromosomes and minichromosomes are positive for centromeric C protein, CENPC (red - color, white - gray scale), centromer / kinetochore specific protein. BC panels show a higher magnification of the minichromosome from: B - only DAPI; and C - DAPI + CENPC (red - color, white - gray scale). The morphology and immunolocalization of CENPC indicates that the minichromosome consists of two sister chromatids,

[0023] Figure 4. Panel A - Immunofluorescence on a mitotic chromosomal spread from maize embryogenic calli from Hi-II transformation CMC3 pool 1 event # 14. Calli were derived from immature embryos transformed with the linearized BAC clone pool 1 modified with Tn5-3. Separation of sister chromatids of native chromosomes and the minichromosome (window) was observed during anaphase. All centromeres of native chromosomes and minichromosomes are positive for centromeric C protein, CENPC (red - color, white - gray scale), centromer / kinetochore specific protein. Panel B is an image with a high magnification of the window in A showing the separation of the sister chromatids of the minichromosome (double arrow) indicating that minichromosome, like normal chromosomes, can segregate during mitosis.

[0024] Figure 5. FISH on a spread mitotic chromosomal preparation of maize embryogenic calli from Hi-II transformation of CMC3 pool 3 event # 12. Calli were derived from immature embryos transformed with the linearized BAC clone pool 3 modified with Tn5-3. Presented are tetra-aneuploid (39 chromosomes, devoid of one copy of ch 6) metaphase nucleus, showing native chromosomes plus 1 minichromosome (arrow). Minichromosome is positive for CentC (green - color, white - gray scale) of the repeat of the centromere specific and unique marker - probe 23715 (red - color, white - gray scale) specific for the construct to be transformed. BD panels are a larger magnification of the area surrounded by a frame, showing minichromosom (arrowheads) and a native chromosome with: A only DAPI; B - DAPI + CentC probe (green - color, white - gray scale); and D DAPI + probe 23715 (red - color, white - gray scale). The bipolar localization of CentC repeats, as revealed by FISH minichromosome staining, indicates that the minichromosome consists of two sister chromatids, similar to those observed in native chromosomes.

[0025] Figure 6. FISH on a dissected mitotic chromosomal preparation of maize embryogenic calli from Hi-II transformation of CMC3 pool 3 event # 12. Calli were derived from immature embryos transformed with the linearized BAC clone pool 3 modified with Tn5-3. Panel A - tetra-aneuploid (39 chromosomes, without one copy of ch 6) metaphase nucleus, showing native chromosomes plus 2 minichromosomes (arrow). Minichromosomes are positive for CentC (green - color, white - gray scale) of the repeat of the centromere specific and unique marker - probe 23715 (red - color, white - gray scale) specific for the construct for transformation. Panel B is a high magnification image of 2 minichromosomes, showing variations in the abundance of CentC repeats and the unique marker 23715.

[0026] Figure 7. FISH on a spread mitotic chromosomal preparation from maize embryogenic calli from Hi-II transformation of CMC3 pool 3 event # 12. Calli were derived from immature embryos transformed with the linearized BAC clone pool 3 modified with Tn5-3. Panel A - tetra-aneuploid (39 chromosomes, devoid of one copy of ch 6) nucleus, showing the separation of sister chromatids of native chromosomes and two minichromosomes (window) in early anaphase. The sister chromatids of both minichromosomes are positive for CentC (green color, white - gray scale) of the repeat of the centromere specific and unique marker - probe 23715 (red - color, white - gray scale) specific for the construct to be transformed. BC panels are images with high magnification of 2 minichromosomes (double arrows) showing: B - DAPI + CentC probe (green - color, white - gray scale); and C - DAPI + probe 23715 (red - color, white - gray scale). Separation of sister chromatids of minichromosome in anaphase suggests the presence of functional centromers, allowing segregation during mitosis.

[0027] Figure 8. Immunofluorescence on a mitotic chromosomal spread from maize embryogenic calli from Hi-II transformation of CMC3 pool 3 event # 12. Calli were derived from immature embryos transformed with the linearized BAC clone pool 3 modified with Tn5-3. Panel A presents tetra-aneuploid (39 chromosomes, without one copy of ch 6) metaphase nucleus, showing 39 native chromosomes plus 2 minichromosomes (arrows).

All centromeres of native chromosomes and minichromosomes are positive for C centromeric protein, CENPC (red - color, white - gray scale), centromer / kinetochore specific protein. BC panels are images with high magnification of minichromosomes. The CENPC immunolocalisation pattern, two outbreaks on minichromosome, indicates that the minichromosome consists of two sister chromatids, each of which has a functional centromere that is capable of forming a kinetochore complex.

[0028] Figure 9. FISH on a mitotic chromosomal spread preparation from plant root tips regenerated from the Hi-II maize transform event. Plants came from immature embryos transformed with linearized bacm.pk128.j21 modified with Tn5-3. Panel A presents an aneuploid metaphase nucleus showing 19 native chromosomes plus 1 minichromosome (arrow). Minichromosome is positive for CentC (green - color, white - gray scale) of the repeat of the centromere specific and unique marker - probe 23715 (red - color, white scale of gray) specific for the construct for transformation. BD panels are larger minichromosome enlargements from: B - only DAPI; C - DAPI + CentC probe (green - color, white - gray scale); and D - DAPI + probe 23715 (red - color;

[0029] Figure 10. Immunofluorescence on a mitotic chromosomal spread preparation from plant root tips regenerated from the Hi-II maize transform event. Plants came from immature embryos transformed with linearized bacm.pk128.j21 modified with Tn5-3. Panel A presents an aneuploid metaphase nucleus showing 19 native chromosomes plus 1 minichromosome (arrow). All centromeres of native chromosomes and minichromosomes are positive for centromeric C protein, CENPC (red - color, white - gray scale), centromer / kinetochore specific protein. BC panels are larger minichromosome enlargements from: B - only DAPI; and C - DAPI + CENPC. The CENPC immunolocalisation pattern, two outbreaks on the minichromosome, indicates that the minichromosome consists of two sister chromatids,

[0030] Figure 11. A fine structure of maize centromers as disclosed by FISH on stretched chromatin fibers. Four centromeric repeats, CentC (green - color, white - gray scale) and sum of CentA, CRM1 and CRM2 (red - color, gray - gray scale) were used in multi-colored FISH on stretched fibers

- 6 DNA of oat-maize addition lines containing separate maize chromosomes. This revealed the hybridization lengths of mega bases that are unique to each chromosome.

[0031] Figure 12. A corn centromere model. The centromeric organization was shown using the centromere maize repeating nomenclature. Uninterrupted CentC matrices can be composed of several hundred to thousands of repetition elements. Other, corn-specific centromere, retrotranspositable elements such as CentA, CRM1 and / or CRM2 can be integrated into the CentC matrix, with each other and / or against each other in centromeric regions. In addition to centromere-specific retrotransposons, other retrotransposons may be integrated into the matrix, to elements such as CentA, CentC, CRM1 and CRM2 and / or to each other to form inserts that disrupt the CentC tandem repeat matrix. This figure shows one model of the organization of CentC corn elements (arrowheads) forming two matrices of tandem head to tail tones. The CentC matrices can be found in an inverted orientation to form a large centromeric DNA segment. FISH on stretched chromatin fibers, along with FISH on meiotic anaphase chromosomes and hybridization analysis of cloned sections of centromeric DNA indicated that the regions with high density of all four centromeric repeats (CentC, CRM1, CentA and CRM2) are involved in the formation of kinetochore.

[0032] Figure 13. Modification and conversion of a BAC clone to a linear artificial minichromosome in vitro. BAC clone DNA is modified using a custom-made Tn5-3 transposon containing an ampicillin resistance gene (AP)^r), origin of replication (ori), selection (MO-PAT) and visual (DS-RED2) markers, under the control of the ubiquitin promoter (UBI1ZM PRO), telomeric (TEL) sequences in reversed orientation, separated by the kanamycin resistance gene (KAN)^r) and homing sites for restriction enzymes I-Ppo I, I-Ceu I and PI-Sce I. ME means mosaic-like ends of the transposon. Digesting the BAC construct with a self-guiding restriction enzyme I-Ceu I transforms the circular BAC into a linear DNA molecule, surrounded on the sides by telomeric sequences.

[0033] Figure 14. Metaphase nucleus of callus from CMC3 pool 1 event # 14 was tested for centromer and telomeres elements. FISH analysis was performed using fluorescently labeled probes, CentC-specific repeats (green - color, white - gray scale) and telomere-specific repeat telo-31 (red - color, white - gray scale). The location of these probes, noted for the native chromosome, CentC is marked with asterisks (*), and telo-31 is marked by double arrows. The BE panels show a greater magnification of the minichromosome. Panel B - DAPI + Cent C + telo31 (green / red - color, white - gray scale); C - only DAPI; D - DAPI + CentC probe (green - color, white - gray scale); and E - DAPI + probe 23715 (red - 7 color, white - gray scale). The telo-31 hybridization pattern suggests

[0034] Figure 15. Metaphase nucleus of CUS3 Callus of the lower order 1.3 event # 27 was tested for centromere and telomeres elements. FISH analysis was performed using fluorescently labeled probes, CentC-specific repeats (green - color, white - gray scale) and telomere-specific repeat telo-31 (red - color, white - gray scale). The location of these probes was noted for the native chromosome, CentC is marked with asterisks (*), and telo-31 is marked by double arrows. The BE panels show a greater magnification of the minichromosome. Panel B - DAPI + Cent C + telo-31 (green / red - color, white - gray scale); C - only DAPI; D DAPI + CentC probe (green - color, white - gray scale); and E - DAPI + probe 23715 (red - color, white - gray scale).

DETAILED DESCRIPTION OF THE INVENTION As used in the specification and the appended claims, singular forms such as "a" "an" and "the" [in English] include their corresponding plural referents, unless from the context of clearly shows otherwise. Thus, for example, reference to "plants" includes many such plants, reference to "cells" includes one or more cells and their counterparts known to those skilled in the art and the like.

[0036] In the context of the disclosure, a number of terms and abbreviations are used. The following definitions are provided.

[0037] "Open reading frame" is shortened to the ORF.

[0038] "American Type Culture Collection" is truncated to ATCC.

[0039] The term "artificial plant minichromosome" as used herein refers to any artificially-formed chromosome containing centromere and telomeres that have properties comparable to those of the native chromosome, such as replication and segregation during mitosis and meiosis, and thus autonomous and transferable in cell division. The artificial concepts of minichromosome, minichromosome and artificial chromosome are used interchangeably here.

[0040] The term "functional centromere" refers to the spindle attachment region of a eukaryotic chromosome that functions in a manner comparable to centromeres in the native chromosome. It is the most condensed and narrowed region of the chromosome to which the spindle fiber is attached during mitosis. During mitosis in a typical plant or animal cell, each chromosome divides longitudinally into two sister chromosomes that eventually separate and move to the opposite poles of the mitotic spindle. At the beginning of mitosis, when the sister chromosomes separate, but still form a pair, each chromosome joins the spindle at a specific point along its length. This point is referred to as centromer or

- 8 connection region of the spindle. Centromeres are formed of highly repetitive DNA, i.e., DNA sequences that are present in the genome in multiple copies.

[0041] The term "matrix" refers to the ordered arrangement of elements.

[0042] The term "tandem repeat" refers to multiple copies of the same base sequence in the same orientation. Thus, these are copies of the nucleotide sequences that are repeated multiple times, tandem, for example along the chromosome. Any tandem repeat matrix may include multiple copies of a single element, or it may have at least one other interleaving element within a matrix, or within a matrix element.

[0043] The term "inverted orientation" refers to two or more copies of the same sequence present in an inverted form.

The terms & quot; retrotransposable element & quot; and & quot; retrotransposon & quot; are used interchangeably herein and refer to a genetic element that is transposed to a new location in DNA by first making a copy of itself and then copying that RNA with reverse transcriptase. and then inserting DNA copies into the target DNA. Retrotransposons are genetic elements that can be amplified in the genome and are common components of the DNA of many eukaryotic organisms. They are a sub-class of the transposon. They are especially common in plants, where they are often the main component of nuclear DNA.

[0045] The term "functional telomere" refers to structures found at the ends of chromosomes in eukaryotic cells. Telomeres work by protecting the ends of the chromosome from recombination, fusion with other chromosomes or degradation by nucleases. They allow cells to distinguish between random DNA breaks and the ends of the chromosome. They also play a significant role in determining the number of times a normal cell can divide. A telomer is a region of highly repetitive DNA at the end of a linear chromosome that functions as a transferable buffer. Whenever linear eukaryotic chromosomes are replicated during the late S phase, the DNA polymerase complex is unable to replicate up to the end of the chromosome; if it were not for telomeres, it would quickly lead to the loss of the necessary genetic information,

[0046] As used herein, "nucleic acid" means a polynucleotide and includes a single or double strand polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides. Thus, the terms "polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably to denote a RNA polymer or DNA that is single- or double-stranded, optionally containing synthetic, non-naturally occurring or changed nucleotide bases. Nucleotides (usually found in the form of 5'-monophosphate) are determined by their single-letter designation as follows: "A" for adenosine or deoxyadenosine (for RNA or DNA, respectively), "C" for cytosine or deoxycytosine, "G" for guanosine or deoxyguanosine,

- 9 deoxythymidine, "R" for purines (A or G), "Y" for pyrimidines (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine and "N" for any nucleotide.

[0047] The terms "subfragment, which is functionally equivalent" and "functionally equivalent subfragment" are used interchangeably herein. These concepts relate to the portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a particular phenotype is preserved, regardless of whether the fragment or subfragment encodes an active enzyme. For example, a fragment or subfragment can be used in the design of chimeric genes to produce the desired phenotype in a transformed plant. Chimeric genes can be designed for use in silencing by combining a nucleic acid fragment or a subfragment thereof, regardless of whether it encodes an active enzyme, in sense or antisense orientation to the plant promoter sequence.

[0048] The term "conservative domain" or "motif" means a set of amino acids retained at specific positions along the superimposed sequences of evolutionarily related proteins. While the amino acids in other positions may differ between homologous proteins, the amino acids that are highly conserved at certain positions indicate the amino acids that are essential in the structure, stabilization or activity of the protein. Because they are identified by their high degree of conservatism in the overlapped sequences of the protein homologs family, they can be used as identifiers or "signatures" to determine whether a protein with a newly determined sequence belongs to a previously identified family of proteins.

[0049] The terms "homology", "homologous", "largely similar", "largely identical" and "largely equivalent" are used interchangeably herein. They relate to a nucleic acid fragment wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a particular phenotype. These concepts also apply to the modification of a nucleic acid fragment of the invention, such as a deletion or insertion of one or more nucleotides that do not significantly alter the functional properties of the resulting nucleic acid fragment relative to the original, unmodified fragment. These concepts also apply to amino acid sequences, polypeptides or peptide fragments, with or without modification, deletion, insertion, or substitution, which do not significantly change functional properties relative to the initial, unmodified sequence. It is the same understandable as the one skilled in the art will recognize that the invention encompasses more than specific, exemplary sequences.

[0050] Furthermore, the skilled person will recognize that largely similar nucleic acid sequences falling within the scope of the invention are also defined by their ability to hybridize (under moderately stringent conditions, e.g. 0.5X SSC, 0.1% SDS, 60 ° C) with the illustrated sequences, or to any part of the nucleotide sequences disclosed herein and which are functionally equivalent to any of the nucleic acid sequences disclosed herein. The stringency of conditions can be tailored to screening for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as

- 10 genes that duplicate functional enzymes from closely related organisms. Washing after hybridization determines the rigor of conditions.

[0051] The term "selectively hybridizes" includes a reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specific target nucleic acid sequence, to a detectably higher degree (e.g., at least 2-fold more than the background) than its hybridization to other nucleic acids. than the target nucleic acid sequences and with the significant exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 80% sequence identity or 90% sequence identity up to and including 100% sequence identity (i.e., full complementarity) to each other.

[0052] The term "stringent conditions" or "stringent hybridization conditions" includes a reference to the conditions under which the probe will selectively hybridize to its target sequence. Stringent conditions depend on the sequence and will be different in different circumstances. By controlling the stringency of hybridization and / or wash conditions, target sequences that are 100% complementary to the probe can be identified (homologous testing). Alternatively, the stringency of conditions can be adjusted allowing some mismatches in sequences to detect lower degrees of similarity (heterologous testing). In general, the probe is shorter than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.

[0053] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH

7.0 to 8.3 and the temperature is at least about 30 ° C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 ° C for long probes (e.g., longer than 50 nucleotides). Strict conditions can also be achieved by adding destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37 ° C and washing at 1X to 2X SSC (20X SSC = 3.0 M NaCl / 0, 3 M trisodium citrate) at 50 to 55 ° C. Exemplary moderately stringent conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37 ° C and washing at 0.5X to 1X SSC at 55 to 60 ° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 ° C and washing in 0.1X SSC at 60 to 65 ° C.

[0054] Specificity is typically a function of washing after hybridization, where the critical factors are the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, tm can be estimated from the equation of Meinkoth et al. ((1984) Anal Biochem 138: 267-284): Tm = 81.5 ° C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% form) - 500 / L; where M is the molarity of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is the temperature (at defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a fully paired probe. Tm is reduced by about 1 ° C for each 1% of the mismatches; thus, Tm, hybridization and / or washing conditions

11 may be tailored for the purpose of hybridizing to sequences of the desired identity.

For example, if a sequence with> 90% identity is sought, t_m can be lowered by 10 ° C. In general, stringent conditions are selected as about 5 ° C lower than the thermal melting point (T m) for a particular sequence and its complementation at a defined ionic strength and pH. However, highly stringent conditions can utilize hybridization and / or wash at 1, 2, 3 or 4 ° C lower than the thermal melting point (T m); moderately stringent conditions can use hybridization and / or wash at 6, 7, 8, 9 or 10 ° C lower than the thermal melting point (Tm); low stringency conditions may use hybridization and / or wash at 11, 12, 13, 14, 15 or 20 ° C lower than the thermal melting point (Tm). Using the equation, the hybridization and wash compositions, and the desired T m, those skilled in the art will understand that variations in the stringency of hybridization and / or wash solutions are inherently described. If the desired degree of non-coupling leads to a T m lower than 45 ° C (aqueous solution) or 32 ° C (formamide solution), it is preferable to increase the SSC concentration so that a higher temperature can be used. A comprehensive guide to nucleic acid hybridization can be found at Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Elsevier, New York, Part 2, Chapter 2, "Overview of Principles of Hybridization and Strategy of nucleic acid probe assays" (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995). The hybridization and / or wash conditions can be used for at least 10, 30, 60, 90, 120 or 240 minutes.

[0055] The term "sequence identity" or "identity" in the context of nucleic acid or polypeptide sequences refers to bases of nucleic acid or amino acid residues in two sequences that are the same after application, for maximum correspondence in a specific comparison window. The term "sequence identity percentage" refers to a value determined by comparing two optimally superimposed sequences in a comparison window, wherein a portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which contains no addition or deletions) for the optimal application of two sequences. The percentage is calculated by specifying the number of positions in which an identical nucleic acid base or amino acid residue is in both sequences, to obtain the number of paired positions, dividing the number of paired positions by the total number of positions in the comparison window and multiplying the results by 100 to obtain the percentage of sequence identity. Useful examples of percent sequence identity include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer from 50 % to 100%. These identities can be determined using any of the programs described in the description. [0056] Sequence alignment and calculation of percent identity or similarity can be determined using a number of comparison methods designed to detect homologous sequences, including, but not limited to, the MegAlign ™ program from the LASERGENE bioinformatic calculation package ( DNASTAR Inc., Madison, WI).

It will be understood that when using sequence analysis software for analysis, the results of the analysis will be based on the "default values" of the respective program, unless otherwise specified. As used herein, "default values" will mean any set of values ​​or parameters that are originally loaded with the software when it is run for the first time. The term "Clustal V fitting method" corresponds to the Clustal V fitment method (described by Higgins & Sharp (1989) CABIOS 5: 151-153; Higgins et al. (1992) Comput Appl Biosci 8: 189-191) and found in the MegAlign program The LASERGENE bioinformatic calculation package (DNASTAR Inc., Madison, WI). For multiple matches, the default values ​​correspond to GAP PENALTY = 10 and GAP LENGHT PENALTY = 10. The default parameters for matches in pairs and the calculation of the percentage of protein sequence identity using the Clustal method are KTUPLE = 1, GAP PENALTY = 3, WINDOW = 5 and DIAGONALS SAVED = 5. For nucleic acids, these parameters are KTUPLE = 2, GAP PENALTY = 5, WINDOW = 4 and DIAGONALS SAVED = 4. After sequence alignment using the Clustal V program, it is possible to obtain a "percent identity" by viewing the "sequence distances" table in the same program. The term "Clustal V fitting method" corresponds to the Clustal V fitment method (described by Higgins & Sharp (1989) CABIOS 5: 151-153; Higgins et al. (1992) Comput Appl Biosci 8: 189-191) and found in the MegAlign program V6.1 package for bioinformatic computing LASERGENE (DNASTAR Inc., Madison, WI). The default parameters for multiple matches are GAP PENALTY = 10, GAP LENGHT PENALTY = 0.2, Delay Divergen Seqs (%) = 30, DNA Transition Weight = 0.5, Protein Weight Matrix = Gonnet Series, DNA Weight Matrix = IUB. After applying the sequence using the Clustal W program, it is possible to obtain a "percent identity" by viewing the "sequence distances" table in the same program. The term "BLASTN fitting method" is an algorithm provided by the National Center for Biotechnology Information (NCBI) for comparing nucleotide sequences using default parameters.

[0057] It is clearly understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides from different species, wherein such polypeptides share the same or similar function or activity. Useful examples of identity percentages include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any of the percentages from 50% to 100%. In fact, any integer amino acid identity from 50% to 100% may be useful in describing the invention, such as 51%, 52%, 53%, 54%, 55%,

56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%,

72% 73% 74% 75% 76% 77% 78% 79% 80% 81% 82% 83% 84% 85% 86% 87% 88% , 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0058] The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including the preceding (5 'non-coding sequences) and subsequent (3' non-coding sequences) regulatory sequences to the coding sequence. The "native gene" refers to a gene, as found in nature, with its own regulatory sequences. A "chimeric gene" refers to any gene that is not native

- a gene that contains regulatory and coding sequences that are not found together in nature. Accordingly, the chimeric gene may contain regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. The "foreign" gene refers to a gene not normally found in the host organism, but one that is introduced into the host organism by gene transfer. Foreign genes may contain native genes introduced into the body different from native or chimeric genes. "Transgen" means a gene that has been introduced into the genome via a transformation procedure.

[0059] The term "genome" in reference to plant cells includes not only the chromosomal DNA found within the nucleus but the organelle DNA found within the subcellular components (e.g., mitochondria or plastids) of the cell.

[0060] "Codon-optimized gene" or "preferential codon gene" means a gene with a codon usage frequency designed to mimic the frequency of preferential codon usage in a host cell.

[0061] "Allele" means one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present in a given chromosome locus are the same, then the plant is homozygous for a given locus. When all the alleles present in a given chromosome locus are different, the plant is heterozygous for the given locus.

[0062] The term "coding sequence" refers to a polynucleotide sequence that encodes a particular amino acid sequence. "Regulatory sequences" refer to nucleotide sequences located upstream (5 'non-coding sequences), within or below (3' non-coding sequences) coding sequences that affect transcription, RNA processing or stabilization, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and hairpin loop structures.

[0063] The term "promoter" refers to a DNA sequence capable of controlling the expression of a coding or functional RNA sequence. The promoter sequence consists of proximal and more distal elements lying above, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence that can promote promoter activity and can be an innate promoter element or a heterologous element introduced to increase the level or tissue specificity of the promoter. Promoters can be obtained entirely from the native gene, or can consist of various elements derived from various promoters found in nature, or even contain synthetic DNA segments. It is understandable to experts in a given field, that various promoters may drive gene expression in various tissues or cell types, or at different stages of development, or in response to various environmental conditions. It is further recognized that since in most cases the exact limits of the regulatory sequences have not been fully defined, the DNA fragments of some variations may have identical promoter activity. Promoters that cause the gene to be expressed in most cell types for the most part

- 14 times are commonly referred to as "constitutive promoters". New promoters of various types useful in plant cells are still being discovered; numerous examples can be found in the compilation by Okamuro & Goldberg (1989) Biochemistry of Plants 15: 1-82. [0064] The term "translation leader sequence" refers to a polynucleotide sequence that is located between the gene promoter sequence and the coding sequence. The translation leader sequence is present in the fully processed mRNA above the translation start sequence. The translation leader sequence may affect the processing of the primary mRNA transcript, stabilization or translation efficiency of the mRNA. Examples of translation leader sequences are described (Turner & Foster (1995) Mol Biotechnol 3: 225-236).

[0065] The terms "3 'non-coding sequences", "transcription terminator" or "termination sequences" refer to DNA sequences located downstream of the coding sequence and include polyadenylation recognition sequences and other regulatory coding sequences capable of affecting mRNA processing or gene expression. The polyadenylation signal is typically characterized by affecting the addition of polyadenylic acid sequences to the 3 'end of the mRNA precursor. The use of various 3 'non-coding sequences is illustrated by Ingelbrecht et al. (1989) Plant Cell 1: 671-680.

[0066] The term "RNA transcript" refers to a product derived from RNA polymerase-catalyzed transcription of DNA sequences. When the RNA transcript is a fully complementary copy of the DNA sequence, it is referred to as the primary transcript. An RNA transcript is referred to as mature RNA when it is a RNA sequence derived from post-transcriptional processing of the primary transcript. "Messenger RNA" or "mRNA" refers to RNA that is free of introns and can be translated into protein by the cell. "CDNA" refers to DNA that is complementary to and synthesized from, an mRNA template using the reverse transcriptase enzyme. cDNA can be single-stranded or converted to a double-stranded form using the Klenow fragment of DNA polymerase I. "Sensible" RNA refers to the RNA transcript, which includes mRNA and can be translated into a protein within a cell or in vitro. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of the target primary transcript or mRNA and which blocks the expression of the target gene (US Patent 5,107,065). The complementarity of the antisense RNA can refer to any part of a particular gene transcript, i.e. the 5 'non-coding sequence, the 3' non-coding sequence, the introns or the coding sequence. "Functional RNA" refers to antisense RNA, ribozyme RNA or other RNA that can not be translated, but nevertheless affects cellular processes. The terms "complementary" and "inverted complementary" are used interchangeably in the description with respect to the mRNA transcripts and they are intended to define antisense messenger RNA.

[0067] The term "operably linked" refers to the combination of a nucleic acid sequence on a single nucleic acid fragment, in such a way that the function of one is regulated by the other. For example, the promoter is operably linked to the coding sequence when it is able to regulate the expression of this coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). The coding sequences may be operably linked to the regulatory sequences in orientation

- 15 sense or antisense. In a further example, the complementary RNA regions of the invention may be operably linked, either directly or indirectly, 5 'to the target mRNA, or 3' to the target mRNA, or within the target mRNA, or the first complementary region is 5 'and complementary to it 3 to the target mRNA.

[0068] Standard recombinant DNA and molecular cloning techniques used in the specification are well known in the art and are described in greater detail in Sambrook et al. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). Methods of transformation are well known to those skilled in the art and infra is described.

[0069] "PCR" or "polymerase chain reaction" is a technique for the synthesis of specific DNA segments and consists of a series of repetitive denaturation, hybridization and extension cycles. Typically, double stranded DNA is thermally denatured, two primers complementary to the 3 'borders of the target segment undergo low temperature hybridization and subsequent extension at intermediate temperatures. One set of these three consecutive steps is referred to as a "cycle".

[0070] The term "recombinant" refers to an artificial combination of two otherwise separated segments of a sequence, e.g. by chemical synthesis or by manipulation of isolated nucleic acid sections by genetic engineering techniques.

The terms & quot; plasmid & quot ;, & quot; vector & quot; and & quot; cassette & quot; refer to extrachromosomal elements, often bearing genes that are not part of the central cell metabolism, and usually occur in the form of circular DNA fragments. Such elements may be autonomously replicating sequences, sequences integrating into the genome, phage or nucleotide sequences, linear or circular, single or double stranded DNA or RNA, derived from any source in which the number of nucleotide sequences has been linked or recombined to a unique structure that is capable of introducing a promoter fragment and a DNA sequence for a selected gene product, together with a suitable 3 'untranslated sequence into the cell. "Transformation cartridge" refers to a specific vector, containing a foreign gene and having elements in addition to a foreign gene that facilitate the transformation of a particular host cell. An "expression cassette" refers to a particular vector containing a foreign gene and having elements in addition to a foreign gene that allow expression of that gene in a foreign host.

[0072] The terms "recombinant construct", "expression construct", "chimeric construct", "construct" and "recombinant DNA construct" are used interchangeably herein. The recombinant construct contains an artificial combination of nucleic acid fragments, e.g. regulatory and coding sequences that are not found together in nature. For example, a chimeric construct may contain regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. Such a construct may be used alone or it may be used in conjunction with a vector. If a vector is used, then the choice of the vector is dependent on the method,

- which will be used to transform host cells, as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled person has a complete understanding of what genetic elements must be present in the vector in order to achieve successful transformation, selection and propagation of host cells containing any of the isolated nucleic acid fragments of the invention. The skilled person will also recognize that various independent transformation events may result in different levels and patterns of expression (Jones et al. (1985) EMBO J 4: 2411-2418; De Almeida et al. (1989) Mol Gen Genet 218: 78-86) a therefore, multiple events must be screened to obtain lines presenting the desired level and pattern of expression. Such screening tests can be performed, e.g. using Southern analysis for DNA,

[0073] The term "expression" as used herein refers to the functional production of a final product (e.g., mRNA or protein, both in precursor and mature form). [0074] The term "inserted" means the provision of a nucleic acid (e.g., a construct for expression) or a protein in a cell. The included includes a reference to incorporation of a nucleic acid into a eukaryotic or prokaryotic cell in which a nucleic acid can be incorporated into a cell genome and includes a reference to a transient delivery of a nucleic acid or protein to a cell. Introduced includes reference to methods of stable or transient transformation, as well as sexual intercourse. Thus, "inserted" in the context of the insertion of a nucleic acid fragment (e.g., a recombinant DNA construct / construct for expression) into a cell, means "transfection" or "transformation" or "transduction" and includes a reference to incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell in which a nucleic acid fragment can be incorporated into the cell genome (e.g., a chromosome, plasmid, plastid or mitochondrial DNA), conversion into an autonomous replicon or transient expression (e.g., transfected mRNA). [0075] The term "mature" protein refers to a post-translational processed polypeptide (i.e., one from which any pre- or propeptides present in the original translation product have been removed). The "precursor" protein refers to the primary translation product of mRNA (i.e. with pre- and propeptides still present). Pre- and propeptides may be, inter alia, intracellular localization signals.

[0076] The term "stable transformation" refers to the transfer of a nucleic acid fragment to the genome of a host organism, including both the nuclear and organellic genome, leading to genetically stable inheritance. In contrast, "transient transformation" refers to the transfer of a nucleic acid fragment to the nucleus, or containing host organelle DNA, leading to gene expression without integration or stable inheritance. Host organisms containing transformed nucleic acid fragments are referred to as "transgenic" organisms.

[0077] The term "transgenic" refers to a plant or cell that contains within its genome a heterologous polynucleotide. Preferably, the heterologous polynucleotide is stably integrated within the genome, such that the polynucleotide is passed on to the next one.

- 17 generations. The heterologous polynucleotide may be integrated into the genome alone, or as part of a construct for expression. Transgenic is used herein to encompass any cell, cell line, callus, tissue, plant part or plant whose genotype has been altered by the presence of a heterologous nucleic acid, including those transgenic initially altered in this way, as well as those formed by sexual interbreeding or asexual propagation from the initial transgenic organisms. The term "transgenic" as used herein does not include genomic changes (chromosomal or extrachromosomal) by conventional plant breeding methods or naturally occurring events such as random crossing, non-recombinant viral infection, non-recombinant bacterial transformation,

[0078] The term "plant" refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny thereof. Plant cells include, but are not limited to, seed cells, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, legumes, gametophytes, sporophytes, pollen and microspores. Parts of the plant include diverse and undifferentiated tissues including, e.g. the following: roots, stems, legs, leaves, pollen, seeds, tumor tissue and various forms of cells and cultures (e.g., single cells, protoplasts, embryos and callus tissue). The plant tissue may be in a plant or organ of a plant, tissue or cell culture. The term "plant organ" refers to a plant tissue or group of tissues that constitute a morphologically and functionally separate part of a plant. The term "genome" refers to the following: (1) the entire complementary sequence of genetic material (genes and non-coding sequences) that is present in every cell of the body, or virus or organelles; and / or (2) a complete set of chromosomes, inherited as a unit (haploid) from one parent. "Offspring" includes any subsequent generation of the plant.

[0079] The invention relates to a plant artificial minichromosome comprising a functional centromere comprising: (a) at least two CentC tandem repeat arrays in an inverted orientation, wherein the first array comprises at least fifty CentC copies and the second matrix comprises at least fifty CentC copies; and (b) at least one copy of an element capable of retrotransposition, wherein the retrotransposable element is located between the first and second matrix. Preferably, the retrotransposable element is selected from the group consisting of CentA, CRM1 and CRM2.

[0080] The artificial chromosome comprises a functional centromere having a CentC tandem repeat matrix. Each CentC repeat matrix may include at least 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 150, 160, 180, 200, 220, 240, 250, 260, 280, 300, 320, 340,

360, 380, 400, 450 or 500 CentC copies. In addition, each CentC tandem repeat matrix may be disrupted by another sequence element, including, but not limited to, a retrotransposon that is introduced between CentC copies, or within a CentC element, or within a retrotransposon or any other sequence element in the array. Retrotransposons include, e.g. CentA, CRM1, CRM2.

[0081] In most eukaryotes, the centromere, which is the site of kinetochore formation and attachment of the spindle in chromosomes, is embedded in heterochromatin. S. cerevisiae chromosomes are devoid of satellite sequences and have small, precisely located centromeres that define spindle attachment with a length of ~ 125 bp DNA (Blackburn & Szostak (1984) Ann Rev Biochem 53: 163-194).

[0082] However, centromeres from other fungal lines contain repetitive matrices more similar to those found in animals and plants (Fishel et al. (1988) Mol Cell Biol 8: 754763). In higher eukaryotes, cytological and biochemical studies showed a physical association between tandem repeating satellite DNA, centromere regions, and specific proteins associated with the centromere (Henikoff et al. (2001) Science 293: 1098-1102; Yu & Dawe (2000) J Cell Biol 151 : 131-142).

[0083] Despite the lack of universal sequence motifs, the majority of centromeric satellite repeats have an unusually similar unit length between organisms, for example, the basic satellite unit has 171 bps in primate, 186 bp in Sparus aurata and 155 bp in the insect Chironomus pallidivittatus (Henikoff et al. (2001) Science 293: 10981102).

[0084] Plant centromeres have a similar unit of repeat length, for example, repetition of 156 bp in maize (Ananiev et al (1998) Proc Natl Acad Sci USA 95: 1307313078), 168 bp repetition in rice (Dong et al (1998) Proc Natl Acad Sci USA 95: 81358140) and 180 bp repeat in Arabidopsis (Copenhaver (2003) Chromosome Res 11: 255262). In Arabidopsis, the centromeres typically contain 2.8-4 Mb strands of tandem repeating 178 bp satellite sequences (Hall et al. (2004) Curr Opin Plant Biol 7: 108114). In maize, a fully functional centromere of the supernumerary B chromosome contains about 500 kb of tandem repeats, with partial deletions reducing the transmission (Alfenito & Birchler (1993) Genetics 135: 589-597). Preparations of spreading chromosomes of maize, the supernumerary B chromosome was hybridized with probes from various repetitive elements, including CentC, CRM and CentA, which localized to the centromeric regions on the chromosomes. These repetitive elements, usually found near the chromosome A centromeres, hybridized to many sites separate from the centromere on the B chromosome (Lamb et al. (2005) Chromosoma 113: 337-349).

[0085] At least two examples departed from the general principle of centromere formation on the basis of centromeric satellite DNA. The first, apparently normal functioning of foreign centromeres in somatic hybrids or introgression lines of the oat corn (Ananiev et al. (1998) Proc Natl Acad Sci USA 95: 13073-13078) indicates the maintenance of the centromere function and the corresponding protein complexes. All centromeric proteins to support the function of a foreign centromere containing unrelated centromeric satellite DNA are visibly provided by the host (Jin et al. (2004) Plant Cell 16: 571-81). The other, neocentromeres are a new class of centromeres, not based on repetitive DNA, recently described in humans, and Drosophila (Williams (1998) Nat Genet 18: 30-37; Choo (1997) Am J Hum Genet 61: 1225-1233).

- 19 neocentromeres are created in overt euchromatic DNA regions, devoid of repeats typically associated with centromere function. Chromosomes with neocentromers are characterized by different mitotic or meiotic stabilization.

[0086] The nature and functioning of the centromere are not yet fully understood and require additional analysis. So far, most artificial chromosomes have functional centromeres based on native centromeric satellite DNA. It is possible that the repetitions found in the so-called knob regions, such as 180 bp and 350 bp (TRI), can be used as a neocentromer component. It has been shown that some regions of the "knob" can acquire the function of a centromere in meiotic maize chromosomes, these neocentromeers consisted exclusively of 180 bp and 350 bp of tandem repeats. The study of neocentromeres in humans and in lower organisms revealed previously unpredicted phenomena depicting the dynamic nature of centromeric DNA (Choo et al. (1997) Am J Hum Genet. 61: 122533). At the core of this phenomenon, it seems that there is no requirement for a specific DNA sequence to act as a centromere; rather, a series of sequences that can respond to the corresponding epigenetic influence seems to provide this function.

[0087] The extensive characterization of the centromere sequence comes from studies on yeast, for example S. cerevisiae and S. pombe, and defined the functional elements and organization of yeast centromers. For example, the structure and function of centromeres of three major regions, CDEI, CDEII and CDEIII, having a total of 125 bp, or 0.006 - 0.06% of each chromosome are described in S. cerevisiae (Carbon et al. (1990) New Biologist 2: 1019; Bloom (1993) Cell 73: 621-624).

[0088] S. pombe centromers have between 40-100 kbp and consist of repetitive elements that comprise 1-3% of each chromosome (Baum et al. (1994) Mol Cell Biol 5: 747-761). Subsequent studies have demonstrated that less than 1/3 of the native centromere

S. pombe is sufficient to provide the centromere function (Baum et al. (1994) Mol Cell Biol 5: 747-761). In S. pombe, it was shown that the region of the inverted repetition was necessary for the centromere to function, but neither the central core nor one arm of the inverted repeat alone gave function. The deletion of parts of the repeating sequences that surrounded the central core had no effect on the mitotic segregation function, nor meiotic segregation of the minichromosome to the haploid progeny, but drastically disturbed the centromere-regulated maintenance of sister pairs of sister I chromatid residues in meiosis. There is significant variation between each of the three different chromosomes. in S. pombe, and a centromere of any particular chromosome may contain significant variability between different strains of S. pombe. However, the basic structural DNA motif, namely inverted repeats, are a common parameter of the centromere of S. pombe (Clarke et al. (1993) Cold Spring Harb Symp Quant Biol 58: 687-695). [0089] Centromeres from higher eukaryotes are less characterized. DNA fragments that hybridize to centromeric regions in higher eukaryotes have been identified, but generally little is known about the structure, organization and / or functionality of these sequences. However, rice is an exception due to its different size of centromeres. Although some rice chromosomes have a centromere similar in size to those in other species (> 1 Mpz), centromeres of several chromosomes are surprisingly small and can [0089] Centromeres from higher eukaryotes are less characterized. DNA fragments that hybridize to centromeric regions in higher eukaryotes have been identified, but generally little is known about the structure, organization and / or functionality of these sequences. However, rice is an exception due to its different size of centromeres. Although some rice chromosomes have a centromere similar in size to those in other species (> 1 Mpz), centromeres of several chromosomes are surprisingly small and can [0089] Centromeres from higher eukaryotes are less characterized. DNA fragments that hybridize to centromeric regions in higher eukaryotes have been identified, but generally little is known about the structure, organization and / or functionality of these sequences. However, rice is an exception due to its different size of centromeres. Although some rice chromosomes have a centromere similar in size to those in other species (> 1 Mpz), centromeres of several chromosomes are surprisingly small and can

- be fully covered with BAC contigs constructed using standard techniques. Complete sequencing of rice centromas 4 and 8 revealed the presence of inverted blocks of centromeric tandem repeats within the chromosomal segment considered centromere, similar to the reverse repeat structure seen in yeast (Zhang et al (2004) Nucl Acids Res 32: 2023-2030; Wu et al (2004) Plant Cell 16: 967-976).

[0090] In many cases, centromeric repeat probes correlate with the centromere location both cytologically and genetically, many of which are presented as tandem repeating satellite elements, and are disseminated in repeated sequences in matrices in the range of 300 to 5000. kpz in length (Willard (1990) Trends Genet 6: 410-416). In situ hybridization showed the presence of an alphoid satellite 171 bp repeater in each human centromere (Tyler-Smith et al. (1993) Curr Biol 390-397). It has not been established yet whether these replicates are functional centromeres, it seems that another genomic DNA is necessary to transmit DNA heredity. Transfection of cell lines with alphoid satellites has created new chromosomes, however these new chromosomes also contain host DNA, which might contribute to centromere activity (Haaf et al. (1992) Cell 70: 681-696; Willard (1997) Nat Genet 15: 345-354). In addition, new chromosomes may show alphoid DNA extending over their entire length, but have only one centromeric constriction, indicating that the alphoid DNA block may not be sufficient to give the centromere function.

[0091] The genetic characterization of centromeres from plants has used segregational analysis of chromosomal fragments, including the analysis of trisomic strains harboring a genetically stigmatized telocentric fragment (e.g., Koornneef (1983) Genetica 62: 33-40). Repetitive elements of plant centromere that are genetically (Richards et al. (1991)) or physically (Alfenito et al. (1993) Genetics 135: 589-597; Maluszynska et al. (1991) Plant J 1: 159-166) related with the centromezer, however, the significance of these sequences with respect to the centromere function has not been fully characterized.

[0092] Pap tests on Arabidopsis thaliana showed a correlation of the centromere structure with the repeat sequences. Staining with a non-specific, fluorescent DNA-binding agent, such as 4 ', 6-diamidino-2-phenylindole (DAPI), allows the visualization of centromeric chromatin domains in metaphase chromosomes. Fluorescence in situ hybridization (FISH) probe up to 180 bp of the pALI repeat sequence co-localized with the DAPI signature near the centromeres of all five Arabidopsis chromosomes (Maluszynska et al (1991) Plant J 1: 159-166; Martinez-Zapater et al. (1986) ) Mol Gen Genet 204: 417-423). A functional role for pALI was proposed, however more recent studies did not detect this sequence near centromas of species closely related to Arabidopsis (Maluszynska et al. (1993) Ann Botany 71: 479-484). It is believed, that one of the species tested, A. pumila, is an amphipidloid originating from the intersection of A. thaliana with another closely related organism (Maluszynska et al (1991) Plant J 1: 159-166; Price et al. (1995) in Arabidopsis, Somerville & Meyerowitz (eds) Cold Spring Harbor Press, NY). Another repetitive sequence, pAt12, genetically maps

- 21 within 5cM of the centromere of chromosome 1 and the central region of chromosome 5 (Richards et al. (1991) Nucl Acids Res 19: 3351-3357), but its role in the functioning of the centromere remains undetermined.

[0093] The plant centromeric regions are composed predominantly of centromere-specific repeats, centromeric retrotransposons and several other repetitive elements that are largely dispersed in the plant genome. For example, centromeric repeats such as CentO and CRR are known from rice. Four centromeric repetitive elements are described in corn: CentA, CentC, CRM1 and CRM2 (SEQ ID NOS: 1-4). In maize, the first discovered element - a centromere specific tandem repeat was CentC (Ananiev et al. (1998) Proc Natl Acad Sci USA 95: 13073-13078). CentC creates numerous tandem matrices of varying length, with some tandem matrices containing up to a thousand copies of the CentC repeat. The CentC tandem repeat interacts with the CENH3 protein in the centromeric nucleosome.

[0094] Maize, a centromere-specific element, CentA, appears to be a retrotransposon, based on its structure and properties (Ananiev et al (1998) Proc Natl Acad SciUSA95: 13073-13078; GenBank AF078917). Another highly conserved centromere-specific retrotransposon from maize, CRM2, was found in 2003 (Nagaki et al. (2003) Genetics 163: 759-770; GenBank AY129008). A fourth centromere-specific retrotransposon, CRM1 (SEQ ID NO: 3), was identified by comparative analysis of published DNA sequences from two corn centromeric BAC clones (Nagaki et al. (2003) Genetics 163: 759-770) and maize specific genomic DNA sequences. (Ananiev (2005) not published). A certain homology can be detected between elements of centromeric repeats from closely related species, such as sorghum and sugar cane (Miller et al. (1998) Genetics 150: 1615-1623; Nagaki et al. (1998) Chromosome Res 6: 295-302; Zwick et al. (2000) Am J Bot 87: 17571764) ; and corn and rice (Ananiev et al. (1998) Proc Natl Acad Sci USA 95: 13073-13078); Cheng et al. (2002) Plant Cell 14: 1691-1704).

[0095] In addition, plant centromeres include multiple retrotransposons (CRs), many of the CR components in cereals fall within the highly conserved phylogenetic clade of Ty3 / gypsy elements (Miller et al (1998) Theor Appl Genet 96: 832-839; Presting et al. (1998) Plant J 16: 721-728; Langdon et al. (2000) Genetics 156: 313-325). DNA homology is sufficient for CR probes from sorghum or Brachypodium sylvaticum to identify centromeres in most or all chromosomes in agronomically significant cereals, such as rice, maize, wheat, sorghum, barley and rye (Aragon-Alcaide et al. (1996) Chromosoma 105 : 261-268; Jiang et al. (1996) Proc Natl Acad Sci USA 93: 1421014213; Miller et al. (1998) Theor Appl Genet 96: 832-839).

[0096] Retrotransposons, also known as Class I transposable elements, consist of two subgenuses, long terminal repeats (LTR) and retrotransposons other than LTR. The sub-types of long end reps have a direct LTR, in the range from ~ 100 bp to over 5 kb from size. LTR retrotransposons are additionally classified into the groups ty1-copia-like (Pseudoviridae) and ty3-gypsy-like (Metaviridae)

- 22 based on both their degree of sequence similarity and the order of coded gene products. Groups of Ty1-copia and Ty3-gypsy retrotransposons are commonly found in large numbers of copies (up to several million copies per haploid nucleus) in plants with large genomes. Ty1-copia retrotransposons are numerous in species, from single-cell algae to mosses, gymnosperms and angiosperms. Ty3-gypsy retrotransposons are also widespread, including both gymnosperms and angiosperms. LTR retrotranssposons account for about 8% of the human genome. Retrotransposons different from LTR consist of two subgenuses, long dispersed nuclear elements (LINE) and short dispersed nuclear elements (SINE). They can also be found in a large number of copies (up to 250,000) in plant species. Plant transposons, including retrotransposons, are discussed by Feschotte et al. (2002) Nat Rev Genet 3: 329-341. Plant retrotransposons are discussed by Kumar & Bennetzen (1999) Ann Rev Genet 33: 479-532.

[0097] Centromeric retrotransposons are identified based on the unified classification of reverse-transcribed elements used in phylogenetic and taxonomic studies. Complete retroelements and retroviruses contain two or more open reading frames (ORFs) that encode single proteins or polyproteins. The order of genes in the elements differs, but are classified based on the overlap of amino acids and key conserved residues or domains within the reverse transcriptase genes (RT), RNase H (RH), integrase (INT) and aspartic protease (PR) and in the conserved domain of cysteine -Histidine (CH) similar to a zinc finger. Retroelements also contain sequences of long terminal repeats (LTR) that surround the inner retroelement region. Each retrotransposon family has different, not cross-hybridizing LTRy, and components within the family may vary (0-50%) in their LTR sequences. In the transposition process, two LTRs are usually identical at the time of insertion, but over time substitutions may result in sequence divergence. Many retroelements are known, including centromer-specific retrotransposons (see, for example, SanMiguel et al (1998) Nat Genet 20: 43-45; Turcotte et al. (2001) Plant J 25: 169179; Feng et al. (2002 ) Nature 420: 316; Nagaki et al (2004) Nat Genet 36: 138; Nagaki et al (2003) Genetics 163: 750-770: Wu et al (2004) Plant Cell 16: 967-976; Hansen & amp; HaslopHarrison (2004) Adv Bot Res 41: 165-193). but over time, substitutions can cause sequence divergence. Many retroelements are known, including centromer-specific retrotransposons (see, for example, SanMiguel et al (1998) Nat Genet 20: 43-45; Turcotte et al. (2001) Plant J 25: 169179; Feng et al. (2002 ) Nature 420: 316; Nagaki et al (2004) Nat Genet 36: 138; Nagaki et al (2003) Genetics 163: 750-770: Wu et al (2004) Plant Cell 16: 967-976; Hansen & amp; HaslopHarrison (2004) Adv Bot Res 41: 165-193). but over time, substitutions can cause sequence divergence. Many retroelements are known, including centromer-specific retrotransposons (see, for example, SanMiguel et al (1998) Nat Genet 20: 43-45; Turcotte et al. (2001) Plant J 25: 169179; Feng et al. (2002 ) Nature 420: 316; Nagaki et al (2004) Nat Genet 36: 138; Nagaki et al (2003) Genetics 163: 750-770: Wu et al (2004) Plant Cell 16: 967-976; Hansen & amp; HaslopHarrison (2004) Adv Bot Res 41: 165-193). (2004) Plant Cell 16: 967-976; Hansen & HaslopHarrison (2004) Adv Bot Res 41: 165-193). (2004) Plant Cell 16: 967-976; Hansen & HaslopHarrison (2004) Adv Bot Res 41: 165-193).

[0098] There is a significant variation between the centromere of the various maize chromosomes, with respect to their relative size and the composition of the repeats. In corn, CentC clusters can be as small as about 100 kbp, or larger than about 2,000 kb in different chromosomes, but it is commonly about 200 kb to about 300 kb. Given the lower size range, it is possible that the entire central part of the corn centromere region could be found within a single BAC clone. The observed structural polymorphism suggests that the corn centromere consists of unnecessary functional blocks, each of which may be capable of supporting the centromere function. Significant (at least 10-fold) variations in centromer size are observed, defined by the length and / or number of centromeric copies of CentC tandem repeats between different maize chromosomes. There are also significant variations

- 23 in centromer size between homologous chromosomes from various associated closely related species .

[0099] Telomeres are nucleoprotein attachments at the ends of linear eukaryotic chromosomes essential for the maintenance of the ends of chromosomes. Synthesis of telomeric DNA is carried out by telomerase, a ribonucleoprotein with reverse transcriptase activity (McKnight et al. (2002) Plant Mol Biol 48: 331-337). Telomerase adds telomeric DNA at the 3 'ends of the chromosomes by copying the short template sequence within its RNA subunit. Telomeres of most organisms consist of highly conservative short asymmetric repeat sequences.

[0100] Many telomeric repeating sequences are known, including CCCCAA (C4A2, Tetrahymena & Paramecium); C4A4 (Oxytricha & Euplotes); C3TA (Trypanosoma, Leishmania & Physarum); C1-3A (Saccharomyces); C1-8T (Dictyostelium); and C3TA3 (Arabidopsis, human, mouse, Caenrhabditis). The number of repeats observed in native chromosomes varies greatly between organisms, e.g. some ciliates have about 50 repeats, less than 350 repetitions were observed in Arabidopsis, and repetitions of around 300-500 bp in total were observed in Saccharomyces.

[0101] The telomere length in plants, typically in the range of about 2-75 kbp, is controlled by genetic and developmental factors. Telomeric regions were isolated from Arabidopsis, and they show heterogeneous tandem repeats in size (Richards & Ausubel (1988) Cell 53: 127-136). There were 25-fold differences in telomere length between inbred maize lines, ranging from less than 2 kb for WF9 to about 40 kb for cM37 (Burr et al (1992) Plant Cell 4: 953-960). Closer to the centromere, a canonical telomere repeat was often found, mixed with other repetitive elements of the plant's genome. In contrast, Drosophila uses transposons at the ends of its chromosomes. Transposons, HeT-A and TART elements are found in a large number of copies at the end of each chromosome. Gradual shortening of telomeres can be reversed by transposition of the new transposon repeats at the ends. Telescopic-like model for transposition in Drosophila, similar to telomere, refers to the mechanism using an RNA transposition intermediate that is converted to terminal DNA by reverse transcriptase.

[0102] DNA replication is the process by which cells produce a complete copy of their genetic information prior to cell division. In E. coli, mammalian viruses and S. cerevisiae, the initiation of DNA replication is controlled by trans-acting initiator proteins that interact with the cis-acting DNA replicator sequences. For S. cerevisiae, replicators cover 100-200 bp and include major origins of replication, where DNA synthesis begins. These replicators contain a conserved, 11 bp autonomous replication sequence (ARS) that binds the replication origin (ORC) complex to initiate the formation of pre-replication complexes in the nucleus (Gilbert (2001) Science 294: 96-100).

[0103] In higher eukaryotes, DNA replication can be initiated simultaneously in hundreds or thousands of chromosomal sites. Defined initiation sequences are not required, there are many potential origins of replication, consisting of

- 24 of the wide zones distributed near the initiation sites, some of which can be used more often.

[0104] However, several specific eukaryotic origins of replication are known, such as the 18S-26S rDNA origin of replication which is located in the non-transcribed area (Ivessa & Zakian (2002) Gens Dev 16: 2459-2464). This region is capable of promoting the amplification of transgenic constructs (Hemann et al. (1994) DNA Cell Biol 13: 437-445). Another specific initiation site is found in the region below the dihydrofolate reductase (DHFR) gene in Chinese hamster ovary (CHO) cells (Altman & Fanning (2001) Mol Cell Biol 21: 1098-1110). Preferential origins of replication were also found in the Drosophila chromosome segment containing chorion genes (Levine & Spradling (1985) Chromosoma 92: 136142).

[0105] The replication machinery of plant and animal cells is in all likelihood capable of replicating any type of introgressive DNA, including integrated constructs, episomes, whole chromosomes or fragments thereof (Gilbert (2001) Science 294: 96-100).

[0106] Artificial minichromosomes are linear or circular DNA molecules, constructed from cis-acting elements of DNA sequences responsible for the proper replication and partitioning of chromosomes to posterior cells. The cis-acting elements include: origins of replication (ori), sites for the initiation of DNA replication, also known as sequences for autonomous replication (ARS); centromeres, sites for kinetochore assembly for proper segregation of replicated chromosomes in mitosis and meiosis; and telomeres, specialized DNA repeat structures that stabilize the ends of linear chromosomes and facilitate complete replication of the ends of the chromosome.

[0107] Several strategies are available for the production of eukaryotic minichromosomes, including but not limited to self-assembling in vivo of the minichromosome from constituent elements, endogenous cellular chromosomal storage machinery in a eukaryotic cell, assembly of eukaryotic minichromosome from components in a prokaryotic cell, and in vitro assembly of a eukaryotic minichromosome from elements of ingredients.

[0108] Artificial minichromosomes were first constructed in Saccharomyces cerevisiae (Murray et al. (1986) Mol Cell Biol 6: 3166-3172; Blackburn & Szostak (1984) Ann Rev Biochem 53: 163-194). A circular plasmid containing yeast 125 bp centromere, an origin of replication, a selection marker and a palindromic system of two telomeric DNA sequences was assembled by conventional recombinant DNA techniques and introduced into yeast by transforming the spheroplast, where it was broken down into a simple linear molecule. Linear constructs, 50 kb in length, containing the centromere, the origin of replication and the two telomeres replicated and segregated during mitosis with ~ 99% accuracy and were preserved in dividing cultures for at least 20 generations. The generation of YACs indicated the potential of artificial chromosomes folding in other eukaryotes, such as plants and animals. Experiments on YACs indicated that

- three cis-acting DNA sequences to build an artificial chromosome are necessary: ​​telomeres; place (s) of initiation of replication; and centromer.

[0109] Animal artificial chromosomes were generated using two different approaches: de novo chromosomes were generated from cloned DNA sections; or by fragmenting and rearranging the natural chromosome (Brown et al. (2000) Trends Biotechnol 18: 402-403; Cooke (2001) Cloning Stem Cells 3: 243-249; Lipps et al. (20030 Gene 304: 23-33). The de novo approach, known as syntax or bottom-up approach, generates artificial chromosomes by combining indispensable cloned components.Cotransfection of a mixture of human alphoid DNA, telomers, human genomic DNA and a selection marker into HT1080 cells has led to the formation of minichromosomes (Harrington et al. (1997) Nat Genet 15: 345-355).

[0110] Characterization of the minichromosomes revealed that all of them had complex cytogenetic structures and were stably maintained in the absence of any selection. It was concluded that the minichromosomes and their centromere (s) were de novo formed from the input DNA by means of complex rearrangements. Subsequently, other groups also used HT1080 cells to introduce linear or circular DNA constructs containing human alphoid DNA and telomers cloned in YACs, PACs or BACs (Compton et al. (1999) Nucleic Acids Res 27 : 1762-1765, Grimes et al. (2001) EMBO Rep 2: 910-914). Minichromosomes with different frequencies were observed and showed different mitotic stability. All minichromosomes produced were significantly larger than the original constructs, with variations from 5 to 10 Mpz. As a result,

[0111] Fragmentation and rearrangement of natural chromosomes, retaining the centromere and telomer regions is another strategy for the production of the minichromosome. Small chromosome fragments can be isolated by means of gel electrophoresis in the pulsed field, modified with the desired genes and re-introduced into the host cell. The fragmented minichromosomes were observed in cancer cells and other cell types after irradiation, however, the fragments were too large for isolation and there was no way to control the composition of the genes.

[0112] One approach to controlling chromosome size reduction was based on telomere chromosome fragmentation (TACF) or regulated telomere shortening (TDT) (Heller et al. (1996) Proc Natl Acad Sci USA 93: 7125-7130; Shen et al. (1997) Hum Mol Genet 6: 1375-1382). It requires successive fragmentation of specific chromosomes of the human host into smaller minichromosomes, using a targeting vector containing the final telomere segment, a selection marker and sometimes a region homologous to the target chromosome. The resulting "engineered minichromosomes" remain autonomous and are subject to normal segregation. Minichromosomes as small as 0.5 Mpz were generated as containing the alphoid DNA as a functional centromere sequence in human cells,

[0113] Recently, human artificial chromosomes have been used to produce transchromosomal cloned calves producing human immunoglobulin. The human minichromosome vector (HAC) constructed by Cre / loxP-regulated chromosomal translocations and telomere-directed chromosome shortening in homologous recombinant DT40 chicken cells was introduced into bovine primary fetal fibroblasts by microcellular transfer (MMCT) chromosomes. Isolated nuclei from fetal fibroblasts with HAC were transferred to testicular mature oocytes to produce cloned calves (Kuroiwa et al. (2002) Nat Biotechnol 20: 889-894). An in vivo approach to the generation of artificial chromosomes was developed, based on the induction of internal mechanisms of amplification of mammalian cells on a large scale. The targeted integration of centromeric satellite DNA and the non-transcriptionable rDNA region on a particular chromosome led to the amplification of centromeric regions on a large scale. These amplified chromosomes become unstable and undergo significant rearrangements producing stable minichromosomes preferentially composed of satellite DNA (Kereso et al. (1996) Chromosome Res 4: 226-239; Hadlaczky (2001) Curr Opin Mol Ther 3: 125-132). [0114] An artificial chromosome containing numerous sequence-specific recombination acceptor sites (ACE platform) was developed. The sequences of interest are provided in a targeting vector, and a lambda integrase enzyme is used to catalyze recombination between the ACE platform and the targeting vector.

[0115] Similar processes have been observed in plants. Spontaneous fragmentation of native chromosomes in plants has been observed. Minichromosomes were discovered in Arabidopsis (Murata et al. (2006) Chromosoma, published on the Internet on April 11, 2006) and maize (Brock & Pryor (1996) Chromosome 104: 575-584, Kato et al. (2005) Cytogenet Genome Res 109: 156-165). In some cases, the minichromosomes were induced by ionizing radiation (Riera-Lizaraz et al. (2000) Genetics 156: 327339).

[0116] A physical map of the rice centromere 5 was constructed, and it can be used to produce an artificial rice chromosome (Nonomura & Kurata (2001) Chromosoma 110: 284-291). A similar approach to the construction of artificial beet chromosome was proposed, Beta procumbens (Gindullis et al. (2001) Genome 44: 846-855). Concatamination, ligations and rearrangements of the transgenic construct can be found in plant transformation events. In general, plant transformation with standard constructs can form complex rearrangements, concatamerization and amplification of the construct (Svitashev & Somers (2001) Genome 44: 691-897, Svitashev et al. (2002) Plant J 32: 443-445). Cotransformation of plants with plasmids can generate transgenic loci containing combinations of different transgenes (Wu et al. (2002) Transgenic Res 11: 533-541).

[0117] Kinetochores combine centromeric DNA into the spindle apparatus fibers. Human autoantibodies that bind specifically to centromere sites have facilitated the cloning of proteins associated with the centromere (CENPs, Rattner (1991) Bioassays 13: 51-56). At least one of these proteins belongs to the kinesin superfamily, microtubule motor proteins (Yen (1991) EMBO J 10: 1245-1254). Yeast centromere binding proteins have been identified by genetic and biochemical studies (Bloom (1993) Cell 73: 621-624, Lechner et al (1991) Cell 64: 717-725). CENH3 is a highly conservative protein that replaces histone H3 in centromere that is thought to recruit other proteins required for the chromosome movement. CENH3 is present throughout the cell cycle and co-locates with kinetochore centromeric protein C (CENPC) in meiotic cells.

[0118] Antibodies specific for centromere-associated proteins can be used to confirm assembly of the centromere in the DNA construct and / or the minichromosome. Immunolocation of CENP, such as CENH3 and / or CENPC, to the centromere of the minichromosome indicates the formation of a functional centromere composed of centromeric DNA elements and related binding proteins. Antisera were prepared against centromeric histone H3 maize (CENH3, 17kD) and tested on native maize chromosomes (Zhong et al. (2002) Plant Cell 14: 2825-2836). Chromatin immunoprecipitation showed that CentC and CRM2 interact specifically with CENH3. About 38 and 33% of CentC and CRM2 precipitated in the chromatin immunoprecipitation assay, confirming that a large amount of CENH3 was co-localizing with CentC. Dawe et al. they isolated a CENPC homologue from maize. ((1999) Plant Cell 11: 1227-1238) and it has been shown to be a component of the kinetochore in corn. A 20 amino acid conservative peptide from the terminal amino domain was used for the production of CENPC specific maize specific sera, which was directly labeled and used to show that CENPC specifically locates to the centromere of native and artificial minichromosomes in maize (see, e.g., Figures 3 , 4, 8 and 10).

[0119] Centomer centromere repeat elements CentA, CentC, CRM1 and CRM2 include sequences that are largely identical to the corn sequences for CentA, CentC, CRM1 and CRM2 of SEQ ID NO: 1-4. To a large degree, identical sequences include sequences that have high homology to one another, as illustrated by having a significant percentage of sequence identity, and / or by selective hybridization under stringent conditions to CentA, CentC, CRM1 or CRM2 (SEQIDNOs: 1-4) or sequences complementary to them. Sequences that selectively hybridize to stringent hybridization conditions include sequences that hybridize to the target sequence at least 2-fold greater than the background and with significant exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have at least about 80, 85, 90, 95, 96, 97, 98, 99 or 100% sequence identity to the target sequence. Any suitable hybridization conditions and buffers known in the art may be used, examples of which are described herein. Sequence identity can be used to compare the primary structure of two polynucleotide or polypeptide sequences. Sequence identity measures residues in two sequences that are the same when applied to maximum agreement. Sequence compounds Sequence identity can be used to compare the primary structure of two polynucleotide or polypeptide sequences. Sequence identity measures residues in two sequences that are the same when applied to maximum agreement. Sequence compounds Sequence identity can be used to compare the primary structure of two polynucleotide or polypeptide sequences. Sequence identity measures residues in two sequences that are the same when applied to maximum agreement. Sequence compounds

- 28 can be analyzed using algorithms implemented using a computer. Sequence compounds between two or more polynucleotides or two or more polypeptides can be determined by determining the best sequence application and scoring matches and gaps in the aligner, which gives the percentage of sequence identity and percentage sequence similarity. Polynucleotide compounds can also be described based on a comparison of polypeptides that each encodes. Many programs and algorithms for comparing and analyzing sequences are known. Unless otherwise stated, the sequence identity / similarity values ​​provided herein refer to the value obtained using GAP Version 10 (GCG, Accelrys, San Diego, CA) using the following parameters: % identity and% similarity for the nucleotide sequence using a GAP Weight equal to 50 and a Weight Weight equal to 3 and a matrix for scoring nwsgapdna.cmp; % identity and% similarity for the amino acid sequence using a GAP Weight equal to 8 and a Weight Weight equal to 2 and a BLOSUM62 scoring point (Henikoff & Henikoff (1992) Proc Natl Acad Sci USA 89: 10915-10919). GAP uses the Needleman & Wunsch algorithm (1970) J Mol Biol 48: 443-453 to find a match between two complete sequences that maximizes the number of matches and minimizes the number of gaps. To a large extent, identical includes sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity, with it is expected that the sequences retain a native function, based on the overall percentage of sequence identity,

[0120] Variant polynucleotides include polynucleotides having at least one deletion, addition and / or substitution at at least one of the 5 'ends, 3' ends and / or internal sites, including introns or exons, as compared to the native polynucleotide. . Variant polynucleotides include naturally occurring variants as well as synthetically produced polynucleotides, for example, those generated using site-directed mutagenesis. Conservative variants include sequences that retain their function, encode the same polypeptide, or encode a polypeptide variant with a high degree of similar identity, function and / or activity as the native polynucleotide. Variants can be identified by known techniques, e.g., polymerase chain reaction (PCR) techniques and / or hybridization techniques. On the whole, variants of a particular polynucleotide will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide. Variants of polynucleotides may also be assessed by comparing the percentage of sequence identity between the encoded polypeptides, using standard programs and alignment parameters. When assessed by comparison, the percentage of sequence identity is divided using standard programs and alignment parameters. When assessed by comparison, the percentage of sequence identity is divided using standard programs and alignment parameters. When assessed by comparison, the percentage of sequence identity is divided

By the two polypeptides encoded by each of them, the percentage of sequence identity between the two encoded polypeptides is typically at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0121] Variant proteins include proteins having at least one deletion, addition and / or substitution at at least one of the N-termini of the C-termini and / or at the inner site as compared to the native polypeptide. Variant proteins have the desired biological activity of the protein. Variants include naturally occurring polypeptides as well as those generated by human manipulation. Biologically active protein variants typically have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, 99% or more of sequence identity to the amino acid sequence of the native protein as determined by sequence matching programs. The biologically active protein variant can differ from this protein by as little as 1-15 amino acid residues. Conservative substitutions generally involve the conversion of one amino acid to another having similar properties. For example, the Dayhoff et al. (1978) The Atlas of Protein Sequence and Structure (Natl Biomed Res Found, Washington, DC) provides guidance on amino acid substitutions that are not expected to affect the biological activity of the protein.

[0122] Variant polynucleotides and proteins include sequences derived from mutagenesis and / or recombination procedures, such as mutagenesis and / or DNA shuffling. Methods for mutagenesis and nucleotide sequence changes are known (see, e.g., Kunkel (1985) Proc Natl Acad Sci USA 82: 488-492; Kunkel et al. (1987) Methods Enzymol 154: 367-382; US Patent 4,873,192; Walker & Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publ. Co., NY) and references cited therein). For example, one or more different coding sequences for recombinases may be manipulated to generate and select a new recombinase protein having desirable properties. Typically, recombinant polynucleotide libraries are generated from a population of related sequences and may be subject to homologous recombination in vitro or in vivo (see e.g. Stemmer (1994) Proc Natl Acad Sci U S A 91: 10747-10751; Stemmer (1994) Nature 370: 389-391; Crameri et al. (1997) Nat Biotechnol 15: 436-438; Moore et al. (1997) J Mol Biol 272: 336-347; Zhang et al. (1997) Proc Natl Acad Sci USA 94: 4504-4509; Crameri et al. (1998) Nature 391: 288-291; and U.S. Patents 5,605,793 and 5,837,458). In general, modifications to the polynucleotide encoding the polypeptide should not alter the reading frame, or produce and / or alter the secondary structure of the DNA or mRNA. See EP Patent Application No. 75.444. 793 and 5,837,458). In general, modifications to the polynucleotide encoding the polypeptide should not alter the reading frame, or produce and / or alter the secondary structure of the DNA or mRNA. See EP Patent Application No. 75.444. 793 and 5,837,458). In general, modifications to the polynucleotide encoding the polypeptide should not alter the reading frame, or produce and / or alter the secondary structure of the DNA or mRNA. See EP Patent Application No. 75.444.

[0123] Overlapping oligonucleotides, called overgos, are primer pairs that stretch about 40 bp in length and are typically formed of two 24-bp oligonucleotides that have an overlapping 8-bp region at the 3 'ends. This feature allows the pair of overgo primers to pair with one another and synthesize their threads complementary to the labeled nucleotides by filling in the Klenow method (McPherson (1999) Genome Analysis: A Laboratory Manual, Vol. 4, pp. 207-213,

- 30 ed. Birren et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). A variety of labeled nucleotides may be used, including but not limited to radioactive labeled nucleotides or fluorescently labeled nucleotides. This is useful for generating probes for a variety of hybridization methods, including but not limited to colony hybridization, dot blotting, Southern blotting and in situ hybridization such as FISH. The main advantage of overgo probes over conventional probes for library hybridization is that sequences for designing "overgos" can be selected, and therefore repeating sequences present in a conventional DNA fragment probe can be avoided; as a result, the cross-hybridization problem can be minimized, which is often associated with the screening of large genomic DNA libraries. Because of this advantage, overgo hybridization in conjunction with the strategy of probe pool formation (Cai et al. (1998) Genomics 54: 387-397; Chang et al. (2001) Genetics 159: 1231-1242; Tao et al. (2001 Genetics 158: 1711-1724; Romanov et al. (2003) Cytogenet Genome Res 101: 277-281) emerged as a method for high-throughput screening of the BAC screening library for the identification of clones and physical gene mapping.

[0124] In some instances, genes or encoded polypeptides are provided that can enhance or stimulate cell growth, from or within the DNA construct (s). Genes that enhance or stimulate cell growth include genes involved in transcriptional regulation, homeotic gene regulation, stem cell maintenance and proliferation, cell division, and / or cell differentiation, such as WUS homologs (Mayer et al. (1998) Cell 95: 805 -815; WO01 / 0023575; US2004 / 0166563); aintegumenta (ANT) (Klucher et al. (1996) Plant Cell 8: 137-153; Elliott et al. (1996) Plant Cell 8: 155-168; GenBank Accession Nose U40256, U41339, Z47554); clavata (e.g., CLV1, CVL2, CLV3) (WO03 / 093450; Clark et al. (1997) Cell 89: 575-585; Jeong et al. (1999) Plant Cell 11: 1925-1934; Fletcher et al. (1999) Science 283: 1911-1914); Clavata genes and embryo-surrounding region (e.g., CLE) (Sharma et al. (2003) Plant Mol Biol 51: 415-425; Hobe et al. (2003) Dev Gens Evol 213: 371-381; Cock & McCormick (2001) Plant Physiol 126: 939-942; Casamitjana-Martinez et al. (2003) Curr Biol 13: 1435-1441); baby boom (e.g., BNM3, BBM, ODP1, ODP2) (WO00 / 75530; Boutileir et al. (2002) Plant Cell 14: 1737-1749); Zwille (Lynn et al. (1999) Dev 126: 469-481); deciduous cotyledon (e.g. Lec1, Lec2) (Lotan et al (1998) Cell 93: 1195-1205; WO00 / 28058; Stone et al. (2001) Proc Natl Acad Sci USA 98: 11806-11811; US ​​Patent 6,492,577) ; Shoot Meristemless (STM) (Long et al (1996) Nature 379: 66-69); ultrapetala (ULT) (Fletcher (2001) Dev 128: 1323-1333); Mitogen-activated kinase protein (MAPK) (Jonak et al. (2002) Curr Opin Plant Biol 5: 415); phosphatase protein kinase (KAPP) associated with protein kinase (Williams et al. (1997) Proc Natl Acad Sci USA 94: 10467-10472; Trotochaud et al. (1999) Plant Cell 11: 393-406); GTPase ROP (Wu et al (2001) Plant Cell 13: 2841-2856, Trotochaud et al (1999) Plant Cell 11: 393-406); fasciata (e.g., FAS1, FAS2) (Kaya et al. (2001) Cell 104: 131-142); cell cycle genes (US Patent 6,518,487; WO99 / ​​61619; WO02 / 074909), Shepherd (SHD) (Ishiguro et al. (2002) EMBO J. 21: 898-908); Poltergeist (Yu et al. (2000) Dev 127: 1661-1670; Yu et al. (2003) Curr Biol 13: 179-188); Pickle (PKL) (Ogas et al. (1999) Proc Natl Acad Sci USA 96: 13839-13844); cell cycle genes (US Patent 6,518,487; WO99 / ​​61619; WO02 / 074909), Shepherd (SHD) (Ishiguro et al. (2002) EMBO J. 21: 898-908); Poltergeist (Yu et al. (2000) Dev 127: 1661-1670; Yu et al. (2003) Curr Biol 13: 179-188); Pickle (PKL) (Ogas et al. (1999) Proc Natl Acad Sci USA 96: 13839-13844); cell cycle genes (US Patent 6,518,487; WO99 / ​​61619; WO02 / 074909), Shepherd (SHD) (Ishiguro et al. (2002) EMBO J. 21: 898-908); Poltergeist (Yu et al. (2000) Dev 127: 1661-1670; Yu et al. (2003) Curr Biol 13: 179-188); Pickle (PKL) (Ogas et al. (1999) Proc Natl Acad Sci USA 96: 13839-13844);

31 knox genes (e.g., KN1, KNAT1) (Jackson et al (1994) Dev 120: 405-413, Lincoln et al (1994) Plant Cell 6: 1859-1876; Venglat et al. (2002) Proc Natl Acad Sci USA 99: 4730-4735); endotherm independent of fertilization (FIE) (Ohad et al. (1999) Plant Cell 11: 407-415) and the like. Combinations of polynucleotides include multiple copies of any of the polynucleotides of interest, and the combinations may have any combination of linked polynucleotides that increase and decrease expression. The combinations may or may not be combined into one construct for transforming the host cell, and therefore may be delivered sequentially or simultaneously. The host cell may be a wild-type or mutant cell in a normal or aneuploid state.

[0125] Targeted recombinase systems can be used with any minichromosome system. Both integrases and recombinases capable of catalyzing both forward and reverse reactions are useful for introducing modifications after the DNA construct (s) or minichromosome are introduced into the plant cell. Various intramolecular modifications, such as deletion or inversion of defined sequences, can be performed. In addition, intracellular insertions and exchanges, including translocations with endogenous chromosomes containing compatible target recombination sites, may be made. Recombinase systems can also be used to determine the target site (docking sites) within the minichromosome for the subsequent targeted integration of polynucleotide (s) of interest,

[0126] Elements from recombination systems, such as recombinases and recombination sites, for example in a DNA construct, target site and / or transfer cassette, may be used. The target site contains a polynucleotide integrated into the genome, a polynucleotide comprising a promoter operably linked to at least one recombination site. The transfer cassette contains at least a first recombination site operably linked to the polynucleotide of interest and / or a polynucleotide encoding the selection marker, wherein the first recombination site is recombined with the recombination site at the target site. The target semen or plant stably incorporated into its genome a DNA construct that was generated and / or manipulated by the use of a recombination system. Recombinant recombination methods can be used, leading to a variety of integration, alteration and / or excision events to generate the discussed DNA construct to generate the target semen. See, e.g., WO99 / ​​25821, WO99 / ​​25854, WO99 / ​​25840, WO99 / ​​25855, WO99 / ​​25853, WO99 / ​​23202, WO99 / ​​55851, WO01 / 07572, WO02 / 08409 and WO03 / 08045.

[0127] A recombinase is a polypeptide that catalyzes targeted recombination between its compatible recombination sites and includes naturally occurring sequences, variants and / or recombinase fragments that retain activity. A recombination site is a nucleotide sequence that is specifically recognized by the recombinase enzyme and includes naturally occurring sequences, variants and / or fragments of a recombinase that

- 32 remain active. For a review of targeted recombinases, see Sauer (1994) Curr Op Biotech 5: 521-527; Sadowski (1993) FASEB 7: 760-767; Groth & Calos (2004) J Mol Biol 335: 667-678; and Smith & Thorpe (2002) Mol Microbiol 44: 299-307. Any recombinant system or combination of systems may be used, including, but not limited to, recombinase and recombination sites from the family of integrase and / or resolvases, their biologically active variants and fragments, and / or any other naturally occurring or recombinantly produced enzymes or theirs. variants that catalyze conservative targeted recombination between specific recombination sites and naturally occurring or modified recombination sites or variants thereof,

[0128] The recombination sites used may be corresponding sites or dissimilar sites. Corresponding recombination sites, or a set of corresponding recombination sites, are sites having an identical nucleotide sequence. A set of corresponding recombination sites, in the presence of a suitable recombinase, will efficiently recombine with each other. Unneutable recombination sites have a separate sequence containing at least one nucleotide difference in comparison to each other. Recombination sites within a set of dissimilar recombination sites can either be recombined or not recombined with respect to each other. Each recombination site within a set of dissimilar sites is biologically active and can recombine with an identical site. Recombinant sites are capable of recombining with each other in the presence of an appropriate recombinase. Recombinant sites include those sites where the relative efficacy of recombinant cleavage between the recombined sites is above the detectable limit under standard conditions, in the cut assay, as compared to wild-type controls, typically, more than 2%, 5%, 10%, 20% , 50%, 100% or more. The non-recombined sites will not recombine with each other in the presence of a suitable recombinase, or the recombination between sites is not detectable. Non-recombined recombination sites include those that recombine with each other at a frequency lower than the detectable limit under standard conditions in the cleavage assay, compared to wild-type controls, typically, less than 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075, 0.005%, 0.001%. Any suitable non-recombination recombination sites may be used, including an FRT site or active variant thereof, a lox site or active variant thereof, a att site or an active variant thereof, any combination thereof, or any other combination of non-recombined recombination sites. Immediately recombined recombination sites in a set of recombined recombination sites are arranged in the same orientation, recombination between these sites results in excision of the DNA sequence between them. Reversed recombination sites in a set of recombined recombination sites are arranged in opposite orientation,

[0129] The recombinase family has more than one hundred members and includes, for example, FLP, Cre, Dre, Int and R. For other members of the integraz family, see, for example, Esposito et al. (1997) Nucleic Acids Res. 25: 3605-3614; Nunes-Duby et al. (1998) Nucleic Acids Res 26: 391-406; Abremski et al. (1992) Protein Eng 5: 87-91; Groth & Calos (2004) J Mol Biol 335: 667-678; and Smith & Thorpe (2002) Mol Microbiol 44: 299-307. Other recombinant systems include, for example, streptomycete phiC31 bacteriophage (Kuhstoss et al. (1991) J Mol Biol 20: 897-908); bacteriophage λ (Landy (1989) Ann Rev Biochem 58: 913949 and Landy (1993) Curr Op Genet Dev 3: 699-707); SSV1 - a targeted recombination system from Sulfolobus shibatae (Maskhelishvili et al. (1993) Mol Gen Genet 237: 334342); and a retroviral integrase integration system (Tanaka et al. (1998) Gene 17: 67-76). In some examples, the recombinase is such that it does not require cofactors or a substrate in the form of a superspace. Such recombinases include Cre, FLP, phiC31 Int, mutant λ Int, R, SSV1, Dre or their active variants or fragments. The FLP recombinase catalyzes a targeted reaction between two FRT sites, and is involved in amplifying the copy number of the two-micron S. cerevisiae plasmid during DNA replication. The FLP protein was cloned and expressed. See, for example, Cox (1993) Proc Natl Acad Sci USA 80: 4223-4227. The FLP recombinase used may be of the Saccharomyces genus. In some examples, a polynucleotide synthesized using the codon-preferred coding for recombinase is used. The FLP enzyme encoded by a nucleotide sequence containing codons preferred by maize (FLPm) is known which catalyzes targeted recombination events (US Patent 5,929,301). Additional functional variants and FLP fragments are known. See, for example, Buchholz et al. (1998) Nat Biotechnol 16: 617-618, Hartung et al. (1998) J Biol Chem 273: 22884-22891, Saxena et al. (1997) Biochim Biophys Acta 1340: 187-204, Hartley et al. (1980) Nature 286: 860-864, Shaikh & Sadowski (2000) J Mol Biol 302: 27-48, Voziyanov et al. (2002) Nucleic Acids Res 30: 1656-1663 and Voziyanov et al. (2003) J Mol Biol 326: 65-76. Cre recombinase, bacteriophage P1 catalyzes targeted recombination between two lox sites. See, for example, Guo et al. (1997) Nature 389: 40-46; Abremski et al. (1984) J Biol Chem 259: 1509-1514; Chen et al. (1996) Somat Cell Mol Genet 22: 477-488; Shaikh et al. (1977) J Biol Chem 272: 5695-5702; and Buchholz et al. (1998) Nat Biotechnol 16: 617-618. Cre polynucleotide sequences may also be synthesized using codons preferred by the plant, for example, moCre is known (see, e.g., WO 99/25840) and other variants, see for example Vergunst et al. (2000) Science 290: 979-982, Santoro & Schulz (2002) Proc Natl Acad Sci USA 99: 4185-4190, Shaikh & Sadowski (2000) J Mol Biol 302: 27-48, Rufer & Sauer (2002) Nucleic Acids Res 30: 2764-2771, Wierzbicki et al. (1987) Mol Biol 195: 785-794, Petyuk et al. (2004) J Biol Chem 279: 37040-37048, Hartung & Kisters-Wolke (1998) J Biol Chem 273: 22884-22891, Koresawa et al. (2000) J Biochem (Tokyo) 127: 367-372, American patent 6.890.726 and Buchholz & Stewart (2001) Nat Biotechnol 19: 1047-1052. The Cre homolog was identified in phage-related phages P1, the recombinase isolated from D6 phage is known as Dre, which is a tyrosine recombinase closely related to Cre, but which recognizes a distinct 32 bp rox site (Sauer & McDermott (2004) Nucleic Acids Res 32: 1 -10). She is known

- 34 PhiC31 integrase and variants (Kushtoss et al. (1991) J Mol Biol 222: 897-908, WO03 / 066867, WO05 / 017170, US2005 / 0003540 and Sclimenti et al. (2001) Nucleic Acids Res 29: 5044-5051 The integrase λ and cofactors are known (Hoess et al. (1980) Proc Natl Acad Sci USA 77: 2482-2486, Blattner et al. (1997) Science 277: 1453-1474) and variants thereof, including variants independent from the cofactor Int (Miller et al. (1980) Cell 20: 721-729, Lange-Gustafson and Nash (1984) J Biol Chem 259: 12724-12732, Christ et al. (1998) J Mol Biol 288: 825-836 and Lorbach et al. (2000) J Mol Biol 296: 1175-1181), variants of the att recognition site (Dorgai et al. (1995) J Mol Biol 252: 178-188, Yagu et al. (1995) J Mol Biol 252: 163 -167 and Dorgai et al. (1998) J Mol Biol 277: 1059-1070), as well as codons optimized for maize, Int variants and sequences of cofactors (WO03 / 08045).Other integrases and variants are known, such as HK022 integrase (Kolot et al. (1999) Mol Biol Rep 26: 207-213) and variants such as variant recognition sites att (Dorgai et al. (1995) J Mol Biol 252: 178 -188, Yagu et al. (1995) J Mol Biol 252: 163-167 and Dorgai et al. (1998) J Mol Biol 277: 1059-1070).

[0130] Wild type recombination sites, mutants or any combination of wild type and / or mutant sites may be used. Such recombination sites include, for example, the lox sites, FRT and wild type att and mutated lox, FRT and att sites. Analysis of the recombinant activity of mutant lox sites is shown in Lee et al. (1998) Gene 216: 55-65. Other recombination sites and variants are known, see, for example, Hoess et al. (1982) Proc Natl Acad Sci USA 79: 3398-3402; Hoess et al. (1986) Nucleic Acids Res 14: 2287-2300; Thomson et al. (2003) Genesis 36: 162-167; Schlake & Bode (1994) Biochemistry 33: 12746-12751; Siebler & Bode (1997) Biochemistry 36: 1740-1747; Huang et al. (1991) Nucleic Acids Res. 19: 443-448; Sadowski (1995) in Progress in Nucleic Acid Research and Molecular Biology Vol. 51, pp. 53-91; Cox (1989) in Mobile DNA, Berg & Howe (eds) American Society of Microbiology, Washington DC, pp. 116-670; Dixon et al. (1995) Mol Microbiol 18: 449-458; Umlauf & Cox (1988) EMBO J 7: 1845-1852; Buchholz et al. (1996) Nucleic Acids Res 24: 3118-3119; Kilby et al. (1993) Trends Genet 9: 413-421; Rossant & Geagy (1995) Nat Med 1: 592-594; Bayley et al. (1992) Plant Mol Biol 18: 353361; Odell et al. (1990) Mol Gen Genet 223: 369-378; Dale & Ow (1991) Proc Natl Acad Sci USA 88: 10558-10562; Qui et al. (1994) Proc Natl Acad Sci USA 91: 1706-1710; Stuurman et al. (1996) Plant Mol Biol 32: 901-913; Dale et al. (1990) Gene 91: 79-85; Albert et al. (1995) Plant J 7: 649-659, US Patent 6,465,254, WO01 / 2354 WO99 / ​​55851 and WO01 / 11058. In some instances, sets of dissimilar and corresponding recombination sites can be used, for example, places from different recombination systems. Accordingly, any suitable recombination site or set of recombination sites can be used, including FRT site, biologically active FRT site variant, lox site, biologically active lox site variant, att site, biologically active variant att site, any combination thereof, or any other combination recombination sites. Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those Accordingly, any suitable recombination site or set of recombination sites can be used, including FRT site, biologically active FRT site variant, lox site, biologically active lox site variant, att site, biologically active variant att site, any combination thereof, or any other combination recombination sites. Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those Accordingly, any suitable recombination site or set of recombination sites can be used, including FRT site, biologically active FRT site variant, lox site, biologically active lox site variant, att site, biologically active variant att site, any combination thereof, or any other combination recombination sites. Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those any suitable recombination site or set of recombination sites can be used, including an FRT site, a biologically active FRT site variant, a lox site, a biologically active lox site variant, a att site, a biologically active variant of the att site, any combination thereof, or any other combination of recombination sites . Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those any suitable recombination site or set of recombination sites can be used, including an FRT site, a biologically active FRT site variant, a lox site, a biologically active lox site variant, a att site, a biologically active variant of the att site, any combination thereof, or any other combination of recombination sites . Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those biologically active variant of the lox site, att site, biologically active variant of the att site, any combination thereof, or any other combination of recombination sites. Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those biologically active variant of the lox site, att site, biologically active variant of the att site, any combination thereof, or any other combination of recombination sites. Examples of FRT sites include, for example, minimal, wild type, FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those FRT site (FRT1) and various mutant FRT sites, including, but not limited to FRT5, FRT6 and FRT7 (see US Patent 6,187,994). Additional variants of FRT sites are known (see e.g. WO01 / 23545 and US Publication 2007/0015195, incorporated herein by reference). Other recombination sites that can be used include att sites, such as those

- 35 disclosed in Landy (1989) Ann Rev Biochem 58: 913-949, Landy (1993) Curr Op Genet Dev 3: 699-707, US Patent 5,888,732, WO01 / 07572 and Thygarajan et al. (2001) Mol Cell Biol 21: 3926-3934. The targeted recombinase (s) used depends on the recombination sites at the target site and the transfer cassette. If FRT sites are used, a FLP recombinase is provided, when Iox sites are used, a Cre recombinase is provided, where λ att sites are used, when Int is used, when phiC31 att sites are used, phiC31 Int is provided. Where the recombination sites contain sites from different systems, e.g. FRT and lox site, both recombinase activities may be delivered, either as a separate whole, or as a chimeric recombinase, for example FLP / Cre (see, e.g., WO 99/25840).

[0131] The marker provides identification and / or selection of cells, plants and / or marker expressing agents. Markers include, e.g., a marker suitable for screening, visual and / or selection. A selection marker means any marker that, when expressed to a sufficient level, confers resistance to the selection agent. For example, visual markers can be used to identify transformed cells containing the inserted DNA construct (s). In one example, a visual marker is a fluorescent protein. Such fluorescent proteins include yellow fluorescent protein (YFP), green fluorescent protein (GFP), blue-green fluorescent protein (CFP) and red fluorescent protein (RFP). In still other examples, the visual marker is encoded by a polynucleotide having codons preferred by corn. In additional examples, the visual marker includes GFPm, AmCyan, ZsYellow or DsRed. See Wenck et al. (2003) Plant Cell Rep. 22: 244-251.

[0132] Selection markers and their corresponding selection agents include, but are not limited to, herbicide resistance and herbicide genes; resistance genes for antibiotics and antibiotics; and other resistance genes for chemicals along with their corresponding chemical agents. Bacterial drug resistance genes include, but are not limited to, neomycin II phosphotransferase (nptII) which confers resistance to kanamycin, paromomycin, neomycin and G418 and hygromycin phosphory transfer (hph) which confers resistance to hygromycin B. See also, Bowen (1993) Markers for Plant Gene Transfer, Transgenic Plants, Vol. 1, Engineering and Utilization; Everett et al. (1987) Bio / Technology 5: 1201-1204; Bidney et al. (1992) Plant Mol Biol 18: 301-313; and WO97 / 05829.

[0133] Several herbicide resistance can also be given, including amino acid synthesis inhibitors, photosynthetic inhibitors, lipid inhibitors, growth regulators, cell membrane dysfunctioners, pigment inhibitors, seedling growth inhibitors, including but not limited to imidazolinones, sulfonylureas , triazolopyrimidines, glyphosate, setoxydim, fenoxaprop, glufosinate, phosphinothricin, triazines, bromoxynil and the like. See, e.g., Holt (1993) Ann Rev Plant Physiol Plant Mol Biol 44: 203-229; and Miki et al. (2004) J Biotechnol 107: 193-232. Selectable markers include sequences that confer herbicide resistance, including but not limited to a bar gene, which encodes phosphinothricin acetyl transferase (PAT) that confers resistance to glufosinate (Thompson et al. (1987) EMBO J 6: 2519-2523);

- 36 (EPSPS) which confers resistance to glyphosate (Barry et al. (1992) in Biosynthesis and Molecular Regulation of Amino Acids in Plants, BK Singh et al (Eds) pp. 139-145; Kishore et al. (1992) Weed Tech 6: 626-634; Castle (2004) Science 304: 1151-1154; Zhou et al. (1995) Plant Cell Rep 15: 159-163; WO97 / 04103; WO02 / 36782; and WO03 / 092360). Other selection markers include dihydrofolate reductase (DHFR) that confers resistance to methotrexate (see, e.g., Dhir et al (1994) Improvements of Cereal Quality by Genetic Engineering, RJ Henry (ed), Plenum Press, New York, and Hauptmann et al. (1988) Plant Physiol 86: 602-606). mutated acetohydroxy acid synthase (AHAS or ALS) sequences lead to resistance to imidazolinones and / or sulfonylureas, such as imazethapyr and / or chlorosulfuron (see, e.g., Zu et al. (2000) Nat Biotechnol 18: 555-558; US patents 6,444,875 and 6,660,910; Sathasivan et al. (1991) Plant Physiol 97: 1044-1050; Ott et al. (1996) J Mol Biol 263: 359-368; and Fang et al. (1992) Plant Mol Biol 18: 1185-1187).

[0134] In addition, the chemical resistance genes further include tryptophan decarboxylase that confers resistance to 4-methyltryptophan (4-mT) (Goodijn et al. (1993) Plant Mol Biol 22: 907-912); and bromoxynil nitrilase that confers bromoxynil resistance. The selection marker may contain cyanamide hydratase (Cah), see, for example, Greiner et al. (1991) Proc Natl Acad Sci USA 88: 4260-4264; and Weeks et al. (2000) Crop Sci 40: 17491754. The cyanamide hydratase enzyme converts cyanamide to urea, thereby giving resistance to cyanamide. Any form or derivative of cyanamide can be used as a selective agent, including, but not limited to, calcium cyanamide (Perlka® (SKW, Trotberg Germany) and acid cyanamide (Dormex® (SKW)). Also see U.S. Patents 6,096,947 and 6,268,547. Variants of the cyanamide hydratase polynucleotides and / or polypeptides retain cyanamide hydratase activity. The biologically active variant of cyanamide hydratase will retain the ability to convert cyanamide to urea. Methods for determining such activity include determining the resistance of plants expressing cyanamide cyanamide hydrate to cyanamide. Additional assays include the colorimetric assay of cyanamide hydratase (see, e.g., Weeks et al (2000) Crop Sci 40: 1749-1754, and U.S. Patent 6,268,547).

[0135] The invention also relates to an isolated polynucleotide comprising: (a) at least two CentC tandem repeat matrices in an inverted orientation, the first matrix comprising at least ten CentC copies and the second matrix comprising at least ten CentC copies; and (b) at least one copy of an element capable of retrotransposition, wherein the retrotransposable element is located between the first and second matrix. Suitable retrotranspositable elements are discussed above. [0136] Isolated polynucleotides comprise at least two CentC tandem repeat arrays. Each CentC repeat matrix may include at least 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 150, 160, 180, 180, 180, 240, 250, 220, 240, 250, 260, 280, or 300 copies of CentC. Additionally, each CentC tandem repeat matrix may be disrupted by another sequence element, including, but not limited to, a retrotransposon that is introduced between CentC copies, or within a CentC element, or within a retrotransposon or any other sequence element in the array. Retrotransposons include, e.g. CentA, CRM1 and CRM2.

[0137] A polynucleotide includes any nucleic acid molecule and contains naturally occurring, synthetic and / or modified ribonucleotides, deoxyribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Polynucleotides include all sequence forms, including but not limited to single-stranded, double-stranded, linear, circular, branched, hairpins, hairpin loops, and the like.

[0138] Also, within the scope of the invention is a recombinant construct containing any of the isolated polynucleotides of the invention.

[0139] The recombinant DNA construct comprises a polynucleotide, when present in the plant genome, is heterologous or foreign to that chromosomal location in the plant genome. When preparing a DNA construct, various fragments can be manipulated to provide sequences in the correct orientation and / or in the correct reading frame. You can use adapters or connectors to connect fragments. Other manipulations may be used to provide convenient restriction sites, remove unnecessary DNA or remove restriction sites. For example, in vitro mutagenesis, primer repair, restriction cleavage, hybridization, resubstitutions, transitions, transversions or recombination systems can be used. The polynucleotides of interest refer to any nucleic acid molecules contained in the DNA construct for any target, including but not limited to non-translated regions, regulatory regions, transcription initiation regions, translation initiation regions, introns, exons, RNA-encoding polynucleotides, selectable markers, suitable for screening markers, phenotypic markers, polynucleotides encoding recombinase, recombination sites, target sites, transfer cassettes, restriction sites, recognition sites, isolators, enhancers, spacer / filler sequences, origins of replication, telomeric sequences, operators, and the like, be provided in the DNA construct. The construct may comprise 5 'and 3' regulatory sequences operably linked to the sequences of interest. The DNA construct (s) may (may) be transcribed, 5 'to 3', at least one of the following, transcriptional and translational initiator region, polynucleotide and transcriptional and translational terminating region, functional in plants. Alternatively, the DNA construct may be deprived of at least one 5 'and / or 3' regulatory element. For example, the DNA construct may be designed such that when introduced into a cell and in the presence of an appropriate recombinase, the recombination event at the target site operably binds the 5 'and / or 3' regulatory regions to the relevant DNA construct sequences. polynucleotide and transcriptional and translational termination region, functional in plants. Alternatively, the DNA construct may be deprived of at least one 5 'and / or 3' regulatory element. For example, the DNA construct may be designed such that when introduced into a cell and in the presence of an appropriate recombinase, the recombination event at the target site operably binds the 5 'and / or 3' regulatory regions to the relevant DNA construct sequences. polynucleotide and transcriptional and translational termination region, functional in plants. Alternatively, the DNA construct may be deprived of at least one 5 'and / or 3' regulatory element. For example, the DNA construct may be designed such that when introduced into a cell and in the presence of an appropriate recombinase, the recombination event at the target site operably binds the 5 'and / or 3' regulatory regions to the relevant DNA construct sequences.

[0140] The controller elements may be used in a number of ways, depending on the polynucleotide element, the recombination site, the transfer cassette and / or the used target site. In some instances, the disrupting sequences may be present between the functionally connected elements and not interfere with functional bonding. For example, a functional linkage between a promoter and a polynucleotide of interest allows the promoter to initiate and mediate the transcription of a polynucleotide of interest. In some examples, a place

The translation start 38 is operably linked to the recombination site. In some instances, the recombination site is within the intron.

[0141] The cassette may additionally contain at least one additional sequence for introduction into the plant. Alternatively, additional sequences may be provided separately. The DNA constructs can be provided with a number of restriction sites or recombination sites to manipulate various components and elements. The DNA constructs may additionally contain genes for selectable markers.

[0142] The transcription initiation region may be native, analogous, foreign or heterologous to the host plant or to the polynucleotide of interest and may be a natural sequence, a modified sequence or a synthetic sequence. A number of promoters may be used to express the coding sequence. [0143] Many promoters useful in plants are discussed in Potenza et al. (2004) In Vitro Cell Dev Biol Plant 40: 1-22. In some examples, the promoter expressing the selectable marker is active in the semen. Promoters active in the semen include constitutive promoters, for example, the Rsyn7 promoter core and other constitutive promoters disclosed in WO99 / ​​43838 and US Patent 6,072,050; core of the CaMV 35S promoter (Odell et al. (1985) Nature 313: 810-812); MVV promoter (weevil mosaic virus) (Dey & Maiti (1999) Plant Mol Biol 40: 771-782); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christensen et al. (1989) Plant Mol Biol, 12: 619-632 and Christensen et al. (1992) Plant Mol Biol 18: 675-689); pEMU (Last et al (1991) Theor Appl Genet 81: 581-588); MAS (Velten et al. (1984) EMBO J 3: 2723-2730); the ALS promoter (US Patent 5,659,026) and the like. Other constitutive promoters include those disclosed in, e.g., US Patents 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611. (1991) Theor Appl Genet 81: 581-588); MAS (Velten et al. (1984) EMBO J 3: 2723-2730); the ALS promoter (US Patent 5,659,026) and the like. Other constitutive promoters include those disclosed in, e.g., US Patents 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611. (1991) Theor Appl Genet 81: 581-588); MAS (Velten et al. (1984) EMBO J 3: 2723-2730); the ALS promoter (US Patent 5,659,026) and the like. Other constitutive promoters include those disclosed in, e.g., US Patents 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

[0144] The promoter may be a promoter preferred in a given tissue, for targeted up-regulation of expression within a particular plant tissue. In some examples, the promoter preferred in the semen is used to express the selection marker. Promoters preferred in semen include both defined in the semen promoters, active during the development of the seed, as well as seed germination promoters active during germination of the seed. See Thompson et al. (1989) BioEssays 10: 108. Promoters preferred in semen include, but are not limited to, Cim1 (cytokinin induced information); cZ19B1 (19 kDa zein); milps (myoinositol-1-phosphate synthase) (see WO00 / 11177 and US Patent 6,225,529), bean-β-phasease, tightens, β-conglycinin, soy lectin, cruciferin, 15 kDa zein, 22 kDa zein, 27 kDa zein, waxy,

[0145] A chemically-controlled promoter can be used to modulate expression in the seed by using an exogenous chemical regulator. The promoter may be a chemically inducible promoter, where the application of a chemical agent induces gene expression or a chemical repressible promoter where the deposition of the chemical removes the gene expression. Chemically-inducible promoters include, but are not limited to, the corn-2-2-2 promoter, activated by substances protecting against the benzenesulfonamide herbicide; corn promoter GST, activated by

39 hydrophobic electrophilic compounds (e.g., some herbicides to prevent germination); and the PR-1 promoter from tobacco, activated by salicylic acid. Other chemically regulated promoters of interest include steroid-sensitive promoters (see, for example, a glucocorticoid-inducible promoter in Schena et al. (1991) Proc Natl Acad Sci USA 88: 10421-10425 and McNellis et al (1998) Plant J 14: 247-257) and tetracycline inducible promoters that are repressed after tetracycline activation (see, e.g., Gatz et al. (1991) Mol Gen Genet 227: 229-237 and U.S. Patents 5,814,618 and 5,789,156).

[0146] The DNA construct may contain expression units. Expression units may include elements that include, but are not limited to, introns, enhancers, leader sequences, shielding sequences, spacers, RNA-coding regions, marker genes, recombination sites, termination regions, recombinase coding sequences, enhancers, linkers, recognition sites, etc. In addition, the DNA constructs may comprise transfer cassettes, target sites, or any parts or combinations thereof. The DNA construct can be modified in a number of ways, including targeted recombination / integration or transposon-based transpositions to ensure a number of variations in the DNA construct. Polynucleotide sequences can be modified for expression in a plant. See, e.g., Campbell & Gowri (1990) Plant Physiol 92: 1-11. Methods for synthesizing gene-preferred genes include, e.g., US Patents 5,380,831, 5,436,391 and Murray et al. (1989) Nucleic Acids Res 17: 477-498.

[0147] Additional sequence modifications are known to enhance gene expression in the cellular host. These include the elimination of sequences coding for alleged polyadenylation signals, exon-intron splice site signals, similar to repeat transposons, and other such well characterized sequences that may be detrimental to gene expression. The GC content in the sequence may be adjusted to medium levels for a given host, as calculated by reference to endogenous genes expressed in the host. The sequence may also be modified to avoid secondary mRNA structures. The cassettes may additionally contain 5 'leader sequences in the DNA cassette that may act to enhance translation. Translational leader sequences include, e.g. picornavirus leader sequences, such as the leader from EMCV (Elroy-Stein et al. (1989) Proc Natl Acad Sci USA 86: 6126-6130); potyvirus leader sequences, such as the leader from TEV (Gallie et al. (1995) Gene 165: 233-238), leader of MDMV (Kong et al. (1988) Arch Virol 143: 1791-1799) and human heavy chain binding protein immunoglobulins (BiP) (Macejak et al. (1991) Nature 353: 9094); the untranslated leader of the RNA coat protein of the alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325: 622-625); leader of tobacco mosaic virus (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and a leader from the maize chlorotic maize virus (MCMV) (Lommel et al. (1991) Virology 81: 382-385). See also, Della-Cioppa et al. (1987) Plant Physiol 84: 965-968. Other methods or sequences known to enhance translation, such as introns and the like, may also be used.

[0148] Sequences of interest include, e.g., zinc fingers, kinases, heat shock proteins, transcription factors, DNA repair, agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility,

- oil, protein, starch, digestibility, grain size, maturity, composition of nutrients, levels or metabolism, and the like. Insect resistance genes may encode resistance to pests such as rootworm, caterpillar of the farm, prostrate nevus, and the like. Such genes include, e.g., toxic protein genes

B. thuringiensis (U.S. Patents 5,366,892, 5,747,450, 5,736,514, 5,723,756, 5,593,881, Geiser et al. (1986) Gene 48: 109) and the like. Disease resistance traits include detoxifying genes such as anti-fumonisin (US Patent 5,792,931); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266: 789; Martin et al. (1993) Science 262: 1432; Mindrinos et al. (1994) Cell 78: 1089); and the like. Hericidal resistance characteristics include genes encoding herbicide resistance, including sulfonylurea herbicides (e.g., S4 and / or Hra mutations in ALS), herbicides that act to inhibit the functioning of glutamine synthase, such as phosphinothricin or basta (e.g., the bar gene), EPSPS (US Patents 6,867,293, 5,188,642, and 5,627,061), GOX (Zhou et al (1995) Plant Cell Rep 15: 159-163) and GAT (US Patent 6, 395.485). Antibiotic resistance genes can also be used, such as the nptII gene, which encodes resistance to antibiotics, kanamycin and geneticin. Sterile genes may also be used, e.g. as an alternative to removing pollen-producing flowers, including preferred genes in male tissues and genes with male sterility phenotypes, such as QM (e.g., US Patent 5, 83,210), kinases and those coding for toxic compounds for male development. or a female gametophyte.

[0149] It may be desirable to reduce, suppress and / or suppress the activity of specific genes. Many gene techniques are known, including, but not limited to, antisense technology (see, e.g., Sheehy et al. (1988) Proc Natl Acad Sci USA 85: 8805-8809, and US Patents 5,107,065; 5,453, 566; and 5,759,829); co-suppression (e.g. Taylor (1997) Plant Cell 9: 1245; Jorgensen (1990) Trends Biotech 8: 340-344; Flavell (1994) Proc Natl Acad Sci USA 91: 3490-3496; Finnegan et al. (1994) Bio / Technology 12: 883-888 and Neuhuber et al. (1994) Mol Gen Genet 244: 230-241); RNA interference (Napoli et al. (1990) Plant Cell 2: 279-289; US patent 5,034,323; Sharp (1999) Genes Dev 13: 139-141; Zamore et al. (2000) Cell 101: 25-33; Javier ( 2003) Nature 425: 257-263, and Montgomery et al. (1998) Proc Natl Acad Sci USA 95: 15502-15507), virus-induced gene silencing (Burton et al. (2000) Plant Cell 12: 691-705; and Baulcombe (1999) Curr Op Plant Bio 2: 109113); ribozymes with a defined target RNA (Haseloff et al. (1988) Nature 334: 585591); hairpin structures (Smith et al (2000) Nature 407: 319-320; WO99 / ​​53050; WO02 / 00904; and WO98 / 53083); ribozymes (Steinecke et al. (1992) EMBO J 11: 1525; U.S. Patent 4,987,071; and Perriman et al. (1993) Antisense Res Dev 3: 253); target oligonucleotide-regulated modifications (e.g. WO03 / 076574: and WO99 / ​​25853); target zinc finger molecules (e.g. WO01 / 52620; WO03 / 048345; and WO00 / 42219); and other methods or combinations of the above methods. hairpin structures (Smith et al (2000) Nature 407: 319-320; WO99 / ​​53050; WO02 / 00904; and WO98 / 53083); ribozymes (Steinecke et al. (1992) EMBO J 11: 1525; U.S. Patent 4,987,071; and Perriman et al. (1993) Antisense Res Dev 3: 253); target oligonucleotide-regulated modifications (e.g. WO03 / 076574: and WO99 / ​​25853); target zinc finger molecules (e.g. WO01 / 52620; WO03 / 048345; and WO00 / 42219); and other methods or combinations of the above methods. hairpin structures (Smith et al (2000) Nature 407: 319-320; WO99 / ​​53050; WO02 / 00904; and WO98 / 53083); ribozymes (Steinecke et al. (1992) EMBO J 11: 1525; U.S. Patent 4,987,071; and Perriman et al. (1993) Antisense Res Dev 3: 253); target oligonucleotide-regulated modifications (e.g. WO03 / 076574: and WO99 / ​​25853); target zinc finger molecules (e.g. WO01 / 52620; WO03 / 048345; and WO00 / 42219); and other methods or combinations of the above methods.

[0150] The termination region may be native to the transcription initiation region, may be native with a functionally linked DNA sequence of interest, or may be derived from another source. Suitable terminating regions are available on Ti plasmids of A. tumefaciens, such as the octopin synthase and nopaline synthase regions.

- 41 See also Guerineau et al. (1991) Mol Gen Genet 262: 141-144; Proudfoot (1991) Cell 64: 671-674; Sanfacon et al. (1991) Genes Dev 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 157-158; Ballas et al. (1989) Nucleic Acids Res 17: 7891-7903; and Joshi et al. (1987) Nucleic Acids Res 15: 9627-9639.

[0151] The mixture may further comprise a polynucleotide encoding a polypeptide that stimulates cell growth. Examples of polypeptides that stimulate cell growth include, but are not limited to, wuschel, baby boom, RepA or Lec1.

[0152] Any method can be used to introduce a sequence into a plant, as long as the polynucleotide or polypeptide gains access to the interior of at least one cell. Methods for introducing sequences into plants are known and include, but are not limited to, stable transformation, transient transformation, virus-based methods, and sexual interbreeding. Stable incorporation indicates that the introduced polynucleotide has been integrated into the genome and is capable of being inherited by progeny. Transient transformation indicates that the introduced sequence does not integrate into the genome in such a way as to be inherited by the progeny from the host. The plants and seeds used may have a DNA construct stably incorporated into their genomes. Any protocol for introducing a DNA construct may be used, any component of targeted recombination systems, a polypeptide or any other polynucleotide of interest. The delivery includes any method that contacts any polypeptide and / or polynucleotide with any of the other components discussed. Any method may be used to contact the target, transfer cassette, and appropriate recombinase, including, for example, stable transformation, transient delivery, and sexual interbreeding (see, e.g., WO99 / ​​25884). In some instances, the recombinase may be provided in the form of a polypeptide or mRNA. A number of protocols can be used to contact various components. For example, a cell may be provided with at least one of these components through a number of methods including transient and stable transformation methods; co-introducing a recombinase of DNA, mRNA or protein directly into the cell; the use of an organism (e.g., a strain or line) that expresses recombinase; or culturing / multiplying the cell or organism carrying the target site, crossing with the organism expressing the active recombinase protein and selecting the events in the progeny. A simple integration pattern is created when the transfer cassette integrates mostly at the destination. Any promoter may be used, including constitutive, inducible, developmentally regulated, temporal and / or spatial, etc., which is capable of regulating expression in the body. crossing with the organism expressing the active recombinase protein and selecting events in the offspring. A simple integration pattern is created when the transfer cassette integrates mostly at the destination. Any promoter may be used, including constitutive, inducible, developmentally regulated, temporal and / or spatial, etc., which is capable of regulating expression in the body. crossing with the organism expressing the active recombinase protein and selecting events in the offspring. A simple integration pattern is created when the transfer cassette integrates mostly at the destination. Any promoter may be used, including constitutive, inducible, developmentally regulated, temporal and / or spatial, etc., which is capable of regulating expression in the body.

[0153] The transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants may vary depending on the type of plant or plant cell targeted for transformation. Suitable methods for introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechniques 4: 320-334, US patent 6,300,543, and US applications 11 / 427,947 and 11 / 427,371, all of which are incorporated herein by reference), electroporation (Riggs et al. (1986) Proc Natl Acad Sci USA 83: 5602-5606, Agrobacterium mediated transformation (US Patents 5,563,055; and 5,981,840), direct

- gene transfer (Paszkowski et al. (1984) EMBO J 3: 2717-2722) and acceleration of ballistic missiles (US Patents 4,945,050, 5,879,918, 5,886,244, and 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue and Organ Culture: Fundamental Methods, edited by Gamborg & Phillips (Springer-Verlag, Berlin), McCabe et al. (1988) Biotechnology 6: 923-926); and transformation Lec1 (WO00 / 28058). Also, see Weissinger et al. (1988) Ann Rev Genet 22: 421-477; Sanford et al. (1987) Particulate Science and Technology 5: 27-37 (onion); Christou et al. (1988) Plant Physiol 87: 671-674 (soybean); Finer & McMullen (1991) In Vitro Cell Dev Biol 27P: 175-182 (soybean); Singh et al. (1998) Theor Appl Genet 96: 319-324 (soybean); Datta et al. (1990) Biotechnology 8: 736-740 (rice); Klein et al. (1988) Proc Natl Acad Sci USA 85: 4305-4309 (maize); Klein et al. (1988) Biotechnology 6: 559-563 (maize); U.S. Patents 5,240,855; 5,322,783; and 5,324,646; Klein et al. (1988) Plant Physiol 91: 440-444 (maize); Fromm et al. (1990) Biotechnology 8: 833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature 311: 763-764; U.S. Patent 5,736,369 (cereals); Bytebier et al. (1987) Proc Natl Acad Sci U.S.A. 84: 5345-5349 (liliaceous); De Wet et al. (1985) in Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Rep 9: 415-418; and Kaeppler et al. (1992) Theor Appl Genet 84: 560-566 (transformation by whiskers [thin fibers or single crystals of silicon carbide]); D'Halluin et al. (1992) Plant Cell 4: 1495-1505 (electroporation); Li et al. (1993) Plant Cell Rep 12: 250-255; Christou & Ford (1995) Ann Bot 75: 407-413 (rice); Osjoda et al. (1996) Nat Biotechnol 14: 745-750 (maize via A. tumefaciens); their. 8, pp. 189-253 in Advances in Cellular and Molecular Biology of Plants, Vol. 5, Ed. Vasil, Kluwer Acad Publ (Dordrecht, The Netherlands) 1999.

[0154] Various compounds may be used in combination with any direct delivery methods for introducing into any plant cell any polynucleotide, polypeptide or combination thereof, optionally containing other components. For example, the method of microproches for a gene shot can be prepared by linking a DNA construct to microprojects, in the presence of a cationic lipid solution, a liposome solution, a cationic polymer, a DNA binding protein, a cationic protein, a cationic peptide, a cationic polyamino acid or a combination thereof. In some instances, the method of microprojectiles for a gene gun is prepared by linking a DNA construct to microprojects in the presence of Tfx-10, Tfx-20, Tfx-50, Lipofectin, Lipofectamine, Cellfectin, Effectene, Cytofectin GSV, Perfect Lipids, DOTAP, DMRIE-C , FuGENE-6, Superfect, Polyfect, polyethylenimines, chitosan, protamine Cl, DNA binding proteins, histone H1, CENH3 histone, poly-L lysine, DMSA and the like. [0155] The polynucleotide may be introduced into plants by contacting the plants with a virus or viral nucleic acids. In general, such methods require the incorporation of a desired polynucleotide within a viral DNA or RNA molecule. The sequence may initially be synthesized in a viral polyprotein and may be further processed in vivo or in vitro to produce the desired protein. Useful promoters include promoters used for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing are known [0155] The polynucleotide may be introduced into plants by contacting the plants with a virus or viral nucleic acids. In general, such methods require the incorporation of a desired polynucleotide within a viral DNA or RNA molecule. The sequence may initially be synthesized in a viral polyprotein and may be further processed in vivo or in vitro to produce the desired protein. Useful promoters include promoters used for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing are known [0155] The polynucleotide may be introduced into plants by contacting the plants with a virus or viral nucleic acids. In general, such methods require the incorporation of a desired polynucleotide within a viral DNA or RNA molecule. The sequence may initially be synthesized in a viral polyprotein and may be further processed in vivo or in vitro to produce the desired protein. Useful promoters include promoters used for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing are known The sequence may initially be synthesized in a viral polyprotein and may be further processed in vivo or in vitro to produce the desired protein. Useful promoters include promoters used for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing are known The sequence may initially be synthesized in a viral polyprotein and may be further processed in vivo or in vitro to produce the desired protein. Useful promoters include promoters used for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing are known

- encoded protein using viral DNA or RNA molecules, see e.g., US Patents 5,889,191; 5,889,190; 5,866,785; 5,589,367; 5,316,931; and Porta et al. (1996) Mol Biotech 5: 209-221.

[0156] Various components, including those from a targeted recombination system, can be delivered to the plant using a variety of transient methods. Such methods for transient transformation include, inter alia, the introduction of the recombinase or its active fragment or variant directly, the introduction of the mRNA recombinase, or using a method not based on integration, or the introduction of low levels of DNA into the plant. Such methods include, for example, microinjection, particle bombardment, viral vector systems and / or polynucleotide precipitation, wherein transcription occurs from particle-bound DNA without significant release from the particle or integration into the genome, such methods generally using polyethyliminine coated particles (see e.g. Crossway et al. (1986) Mol Gen Genet 202: 179-185; Nomura et al. (1986) Plant Sci 44: 53-58; Hepler et al. (1994) Proc Natl Acad Sci USA 91: 2176-2180; and Hush et al. (1994) J Cell Sci 107: 775-784).

[0157] Transformed cells can be regenerated into plants using standard protocols and media, see, e.g., McCormick et al. (1986) Plant Cell Rep. 5: 8184. These plants can then be grown and pollinated with their own pollen, backcross, and / or uncreated, and identified progeny having a desirable trait. You can grow two or more generations to ensure that the trait is stably maintained and inherited, and then collect the seeds. In this way, a transformed / transgenic seed is provided having the DNA construct discussed, stably incorporated into its genome. The plant and / or seed having a stably incorporated DNA construct may additionally be characterized for expression, potential for targeted integration, agronomy and copy number (see, e.g., U.S. Patent 6,187,994). [0158] Fragments and variants of recombination sites, recombinases, selectable markers and nucleotide sequences of interest may be used and, unless otherwise indicated, indicate that the variant or fragment retains at least some of the activity / function of the original composition. In cases where the polynucleotide encodes a protein, the polynucleotide fragment can encode protein fragments that retain the biological activity of the full-length protein. The polynucleotide fragments are in the range of at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides or more, up to the full-length polynucleotide. The polynucleotide fragment that codes for the biologically active portion of the protein typically encodes at least 15, 25, 30, 50, 100, 150, 200, 250, 300, 325, 350, 375, 400, 420 or 450 adjacent amino acids or any integer number within this range, including the total number of amino acids present in the full-length protein. The biologically active fragment of the polypeptide can be obtained by isolating a portion of one of the polynucleotides encoding a portion of the polypeptide of interest, expressing a fragment of the protein and evaluating the activity.

[0159] Alternatively, the biologically active fragment of the polypeptide can be produced by selective chemical or proteolytic cleavage of the full-length polypeptide and measurement

- 44 activities. For example, polynucleotides that encode recombinase polypeptide fragments may contain a nucleotide sequence of at least 16, 20, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700. , 800, 900, 1,000, 1,100, 1,200, 1,300, or 1,400 nucleotides, or any integer number within this range, including the total number of nucleotides of the full-length polynucleotide. In addition, fragments of recombination sites retain the biological activity of the recombination site, passing the recombination event in the presence of the appropriate recombinase. Fragments of the recombination site may be in the range of at least about 5, 10, 15, 20, 25, 30, 35, 40 nucleotides up to the full-length recombination site. For example, full-length FRT, lox,

[0160] The assays for measuring the biological activity of recombination and recombinase sites are known (see, e.g., Senecoll et al. (1988) J Mol Biol 201: 406-421; Voziyanov et al. (2002) Nucleic Acids Res 30: 7; 6,187,994; WO01 / 00158; Albert et al. (1995) Plant J 7: 649-659; Hartang et al. (1998) J Biol Chem 273: 22884-22891, Saxena et al. (1997) Biochim Biophy Acta 1340: 187 -204; and Hartley et al. (1980) Nature 280-860-864). Recombinase activity assays generally measure overall enzyme activity on DNA substrates containing recombination sites. For example, when determining FLP activity, inversion of DNA sequences in a circular plasmid containing two inverted FRT sites can be detected as a change in the position of restriction enzyme sites (see, e.g., Vetter et al. (1983) Proc Natl Acad Sci USA 80: 7284). Alternatively, the excision of DNA from a linear molecule or the frequency of intracellular recombination induced by an enzyme may be determined (see, e.g., Babineau et al (1985) J Biol Chem 260: 12313; Meyer-Leon et al. (1987) Nucleic Acids Res 15: 6469; and Gronostajski et al. (1985) J Biol Chem 260: 12328). Recombinase activity can also be measured by cleaving the sequence encapsulated by recombinant FRT sites to activate the marker gene to be determined.

EXAMPLES [0161] The invention is further defined in the following Examples, wherein parts and percentages are by weight and degrees are Celsius unless otherwise stated. It is to be understood that these Examples, while indicating the preferred embodiments of the invention, are given for purposes of illustration only.

[0162] The meaning of the abbreviations is as follows: "sec" means the second (s), "min" means the minute (s), "h" means the hour (s), "d" means the day (s), " gl "means microlitric (y)," ml "means milliliter (s)," l "means liter (y)," μΜ "means micromolar," mM "means millimolar," M "means molar," mmol "means millimol ( e), "gmol" means micromol (e), "g" means gram (y), "gg" means microgram (s), "ng" means nanogram (s), "U" means unit (s), " pz "means base pair (s) and" kpz "means kilopar (s) bases.

EXAMPLE 1. Identification and isolation of centromeres from maize [0163] To assess the size, composition and structural organization of individual centromeres, labeled probes specific for CentC, CentA, CRM1 and / or CRM2, were used individually and / or in a blend for fluorescence hybridization in situ (FISH) on pachiomenic mexicum chromosomes, metaphase, anaphase I and stretched DNA molecules (FISH on chromatin fibers). These four probes were also used for screening genomic BAC corn libraries.

A. In situ Hybridization [0164] Multicolor FISH on metaphase maize chromosomes revealed that these four centromeric repeats are centromere specific and colocalized in centromeric regions on all chromosomes in somatic cells. FISH analysis showed that retrotransposons of CRM1, CRM2 and CentA occupy approximately the same region in corn centromere. There are significant variations in the composition of repeats and the relative size of the repeats between the centromere of various maize chromosomes. [0165] FISH results showed that the CentA probe had the weakest hybridization signal; the CRM1 probe presented a gradient-like hybridization pattern with the strongest signal around the original metaphase constriction of the chromosome, with a signal gradually disappearing at the periphery of the centromeric regions, and the CRM2 probe showed the clearest and confusing hybridization signal. The strength of the FISH signal for CentC repeats was highly dependent on the CentC copy number, which is variable between centromeres of different maize chromosomes. In some centromere CentC creates strong aggregations, showing a slight overlap with other centromeric repeats, in other chromosomes the CentC repeat distribution shows a stronger overlap with all other repeats. FISH of meiotic anaphase I chromosomes in microsporocytes with all four centromeric repeats revealed that the centromeric region at this stage is highly stretched and only a small section of the entire centromeric region is actually attached to the kinetochore. All four replicates co-localized in the microtubule integration section, suggesting that the native functional centromeric region contains all four centromeric repeats. FISH on stretched chromatin fibers of stretched DNA molecules was used to further characterize the distribution and the centromere repeat system with higher resolution.

[0166] Crossing oats with maize generated F1 embryos that retained one or more maize chromosomes (see, e.g., Riera-Lizaraz et al (1996) Theor Appl Genet 93: 123-135; Ananiev et al. (1997) Proc Natl Acad Sci USA 94: 3524-3529). These lines provide a way to study individual corn chromosomes without the background complexity of the other nine maize chromosomes. A series of oat-corn addition lines are available from Ron Phillips at the University of Minnesota (St. Paul, MN, USA), including Seneca 60, A188 and B73 oat-corn addition lines as used herein.

[0167] DNA from oat-maize chromosomal addition lines was used to analyze centromeric regions from individual maize chromosomes. Multicolour

FISH on stretched chromatin fibers on oat-maize chromosomal addition lines revealed hybridization sequences of mega base length, centromeric repeats unique for each chromosome (Figure 11). In chromosomes 1, 7 and 8, all four replicates were dispersed along the entire centromeric region. In other chromosomes, CentC was present as relatively short strings (approximately 300 kb) surrounded by "loose" matrices of the other three centromeric repeats. The overall length of the centromeric regions differed significantly between the various maize chromosomes as observed by FISH. CentC revealed a significant polymorphism between centromeres of individual chromosomes with the abundance of this repeat, with a difference as large as 10-fold, observed within any given genotype. Chromosome 7 had the largest blocks of CentC tandem repeats in metaphase and pachytene chromosomes. Similarly, the oat corn addition line, with the maize chromosome 7, had the longest strands of DNA fibers that hybridized to the CentC probe. Conversely, the centromere of chromosome 4 maize had the smallest block of CentC repeats in the metaphase chromosomes and the shortest CentC strands in the oats-maize line with chromosome 4, especially in the B73 chromosome line 4. With FISH type analysis on stretched chromatin fibers, centromeric CentA retrotransposons , CRM1 and CRM2 showed a dot-like pattern with large gaps between positive hybridization signals. When the probes for these three retrotransposons were mixed together and used as one mixed probe, they revealed more adjacently labeled DNA fibers, separated by CentC repeat blocks. The sides of adjacent labeled centromeric retrotransposons exhibited a dot-like pattern along DNA molecules, indicating that centromeric retrotransposons were dispersed with other types of DNA sequences, including specific elements different from centromeres. Centromeric retrotransposons can form loose matrices up to 1 Mpz in centromere chromosomes with small CentC repeat blocks, such as chromosome 4. The corn hybrid Zapalote chico had a supernumerary chromosome B. FISH meiotic chromosomes Zapalote chico indicates that the functional centromere of the maize chromosome B contains all four repeats centromere, similar to those observed in all chromosomes A. However,

[0168] The results of FISH on mitotic and meiotic chromosomes and FISH on chromatin fibers suggest that the functional native centromeric segment responsible for kinetochore formation on the maize chromosome generally contains CentC tandem repeat matrices mixed with three other centromeric repeats, CRM1, CRM2 and CentA ( Figure 12).

B. BAC Libraries [0169] BACs allow cloning of large genomic DNA fragments up to about 300 kb in size that can be maintained in a bacterial host,

- typically E. coli. A wide range of BAC libraries were generated from plant and animal species and made available to the public, see, for example, the Clemson University Genome Institute (CUGI; see the website at genome.clemson.edu) and Children's Hospital, Oakland Research Institiute (CHORI; see website at the address chori.org). BAC maize genomic libraries represent more than 13X coverage, using a number of enzymes to construct for a library from two distinct maize genotypes, B73 and Mo17, representing the dent and Lancaster heterosis, respectively, that were screened for maize centromeric sequences.

i. Mo17 maize genomic BAC library from maize [0170] PlndigoBac536 (Shizuya, unpublished) and pBeloBAC11 (Kim et al (1996) Genomics 34: 213-218) BAC cloning vectors were developed on the basis of pBAC108L (Shizuya et al. (1992) Proc Natl Acad Sci USA 89: 8794-8797). PBAC108L is a plasmid based on the mini-F factor. Factor F encodes genes that regulate their own replication and number of copies in the cell. The pBeloBAC11 vector was generated by introducing the lacZ gene to facilitate the identification of recombinant clones through the "blue" or "colorless" (white) phenotypes. pBeloBAC11 has three unique cloning sites: BamHI, SphI and HindIII, which are surrounded by the T7 and SP6 promoters. It is possible to use restriction sites for the rarely cutting enzymes NotI, EagI, XmaI, SmaI, Bg / I and SfiI for cutting the insert from pBeloBAC11. In the pIndigoBac536 vector,^R), such that the Eco RI site at the cloning site can be used to construct the library. The vectors pBeloBAC11 and pIndigoBac536 have two selection markers, LacZ and CM^R for the selection of transformants.

[0171] A proprietary maize genomic BAC library from the Mo17 inbred public inbred line was constructed in pBeloBAC11 or plndigoBac536 essentially as described in Kim et al. ((1996) Genomics 34: 213-218) under a contract with Shizuya's laboratory at the California Institute of Technology. Briefly, Mo17 genomic DNA was partially digested with HindIII or EcoRI restriction enzymes. The DNA fragments were size fractionated on an agarose gel and cloned into pBeloBAC11 at HindIII sites or to pIndigoBac536 at EcoRI sites. The average size of the insert was about 150 kb. The entire Mo17 genomic BAC library consists of 433 384-well plates or 166272 full BAC clones. The first half of the library containing 214 tiles contains BAC clones with HindIII inserts, while the other half contains about 219 plates, contains BAC clones with EcoRI inserts. BAC clones are maintained in E. coli DH10B (BRL Life Technologies).

ii. B73 Maize BAC genomic libraries [0172] Two public B73 BAC genomic libraries from maize were obtained. The ZMMBBb library is available from the Clemson University Genome Institute (CUGI, University of Georgia, Athens, GA, USA). The BAC ZMMBBb library was created in CUGI by cloning partially digested B73 genomic maize genomic DNA into the pIndigoBac536 vector containing the chloramphenicol resistance gene (CM^R). The ZMMBBb BAC library contains 247680 full BAC clones with an average insert size of

- about 137 kbp, representing 14X of genomic coverage. The second BAC library B73, CHORI-201 (ZMMBBc) created by the Pieter de Jong laboratory at the Children's Hospital of the Oakland Research Institute (CHORI), is available from the BACPAC Resource Center at CHORI. To construct this library, genomic DNA was isolated from the B73 maize plant. The first segment of the library was constructed using DNA partially digested with the combination of EcoRI and EcoRI methylase, the second segment was constructed using partially digested MboI DNA. The size-matched DNA was cloned into the pTARBAC2.1 vector (segment 1, plates 1-288) between the EcoRI sites and into the pTARBAC1.3 vector (segment 2, plates 289-576) between the BamHI sites. The ligation products were transformed into E. coli DH10B electrocompetent cells (BRL Life Technologies). BAC clones for each library segment in each vector were arrayed in 288,384 well microtiter plates. Segment 1 contains 106637 individual BAC clones, with an average insert size of 163 kb, representing 6.9X genomic coverage. Segment 2 contains 105579 individual BAC clones, with an average insert size of 167 kb, representing 7.0X genomic coverage. The full ZMMBBc library contains 212216 individual BAC clones with an average insert size of 165 kb, representing 13.9X genomic coverage. with an average insert size of 167 kb, representing 7.0X genomic coverage. The full ZMMBBc library contains 212216 individual BAC clones with an average insert size of 165 kb, representing 13.9X genomic coverage. with an average insert size of 167 kb, representing 7.0X genomic coverage. The full ZMMBBc library contains 212216 individual BAC clones with an average insert size of 165 kb, representing 13.9X genomic coverage.

C. Screening of BAC libraries [0173] Corn B73 and Mo17 BAC libraries were screened with four separate probes for CentA, CentC, CRM1 and CRM2 centromeric sequences. The probes were designed as OVERGO oligonucleotides with a length of 40 bp and unique for each centromeric element. Using suitable labels, these probes can be used for colony and point hybridization, and FISH and FISH on stretched chromatin fibers.

i. Overgo Probes [0174] Overgo probes are typically designed as two short oligonucleotides that have an 8 bp complementary overlap region. Short oligonucleotides are typically in the range of 23-28 bp, with 24 bp most commonly used. After hybridization, the oligonucleotides form dimers with 16 bp single-stranded DNA on both sides. The partially double-stranded probe is labeled by filling the recessed 3 'ends with the Klenow enzyme polymerase activity in the presence of labeled nucleotides. The final overgo probe contains a marked, double-strand 40 bp probe. TABLE 1 lists the primers and probes used to generate, screen and characterize BAC clones, DNA constructs, and maize minichromosome events.

- 49 TABLE 1

<td>SEQ ID</td><td>Biocode</td><td>The name of the oligonucleotide</td><td>Sequence</td>

<td>5</td><td></td><td>Telomer-PCR-F</td><td>AGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGG</td>

<td>6</td><td></td><td>Telomer-PCR-R</td><td>CCCTAAACCCTAAACCCTAAACCCTAAACC</td>

<td>7</td><td>65644</td><td>CentC-OVG-1-40f</td><td>GGTTCCGGTGGCAAAAACTCGTGC</td>

<td>8</td><td>65645</td><td>CentC-OVG-1-40r</td><td>TGTCGGTGCATACAAAGCACGAGT</td>

<td>9</td><td>65646</td><td>CentC-OVG-51-90f</td><td>GAATGGGTGACGTGCGACAACGAA</td>

<td>10</td><td>65647</td><td>CentC-OVG-51-90r</td><td>GGTGGTTTCTCGCAATTTCGTTGT</td>

<td>11</td><td>65648</td><td>CentC-OVG-101-140f</td><td>GTTTTGGACCTAAAGTAGTGGATT</td>

<td>12</td><td>104790</td><td>CentC-OVG-101-140r</td><td>CACAACGAACATGCCCAATCCACT</td>

<td>13</td><td>69509</td><td>CRM1-LTR-OVG1f</td><td>CTTGGTCTTGGACAGTACCTCACT</td>

<td>14</td><td>69510</td><td>CRM1-LTR-OVG2f</td><td>CCCTTGCGATCCGACTACGACGAG</td>

<td>15</td><td>69511</td><td>CRM1-LTR-OVG3f</td><td>TCACGAAGATCGTTTCCTGTGCGC</td>

<td>16</td><td>69512</td><td>CRM1-LTR-OVG4f</td><td>CAGCGCAGATTAGCGCGTGTTCGA</td>

<td>17</td><td>69513</td><td>CRM1-LTR-OVG5f</td><td>CCAACCCTAGGTCGTCCATTATGG</td>

<td>18</td><td>69514</td><td>CRM1-LTR-OVG6f</td><td>TTCAATTCTCTTGCACGGGCCCGA</td>

<td>19</td><td>69515</td><td>CRM1-LTR-OVG1r</td><td>TCAGGTCTACTTCATCAGTGAGGT</td>

<td>20</td><td>69516</td><td>CRM1-LTR-OVG2r</td><td>TGGCGCCTCGGGCTTGCTCGTCGT</td>

<td>21</td><td>69517</td><td>CRM1-LTR-OVG3r</td><td>TGTTCGTTCTTCGATTGCGCACAG</td>

<td>22</td><td>69518</td><td>CRM1-LTR-OVG4r</td><td>TTAGCCTTAGCTACTCTCGAACAC</td>

<td>23</td><td>69519</td><td>CRM1-LTR-OVG5r</td><td>CCAGCCCAATTGCGGCCCATAATG</td>

<td>24</td><td>69520</td><td>CRM1-LTR-OVG6r</td><td>CACCTGGGCCAGTGACTCGGGCCC</td>

<td>25</td><td>69521</td><td>CRM2-LTR-OVG1f</td><td>TGATGAAGACATCCACACTACTGA</td>

<td>26</td><td>69522</td><td>CRM2-LTR-OVG2f</td><td>TTGAACATGCTGGATTCGGACTGC</td>

<td>27</td><td>69523</td><td>CRM2-LTR-OVG3f</td><td>CTGCCCATGGTGCTGCGTCACCCT</td>

<td>28</td><td>69524</td><td>CRM2-LTR-OVG4f</td><td>GCGCGTGCTAGTTCAGCCGCCCGT</td>

<td>29</td><td>69525</td><td>CRM2-LTR-OVG5f</td><td>GTATCGGTTGCTAAGGCGCAGCGT</td>

<td>thirty</td><td>69526</td><td>CRM2-LTR-OVG1r</td><td>TATTGGTATAGATGCATCAGTAGT</td>

<td>31</td><td>69527</td><td>CRM2-LTR-OVG2r</td><td>AAGTTGGTGTTCTTCTGCAGTCCG</td>

<td>32</td><td>69528</td><td>CRM2-LTR-OVG3r</td><td>CCCATTGGGCCAAAATAGGGTGACG</td>

<td>33</td><td>69529</td><td>CRM2-LTR-OVG4r</td><td>TTCCGAAGACAAGAAGACGGGCGG</td>

<td>34</td><td>69530</td><td>CRM2-LTR-OVG5r</td><td>CTACAGCCTTCCAAAGACGCTGCG</td>

<td>35</td><td>69531</td><td>CentA-LTR-OVG1f</td><td>TGATGAGAACATAACCCGCACAGA</td>

<td>36</td><td>69532</td><td>CentA-LTR-OVG2f</td><td>AGGATGATGAGGACATCACTGCCA</td>

<td>37</td><td>69533</td><td>CentA-LTR-OVG3f</td><td>AACCATCTAGAATTTGAGAAGGCA</td>

<td>38</td><td>69534</td><td>CentA-LTR-OVG4f</td><td>GTCCAGAAACTGCCGAGTGAACTC</td>

<td>39</td><td>65535</td><td>CentA-LTR-OVG5f</td><td>GAGAGAGTTTCGTTCTCCATTAGA</td>

<td>40</td><td>69536</td><td>CentA-LTR-OVG6f</td><td>GTTCTTGCTTGTTCTCGATTGCTT</td>

<td>41</td><td>69537</td><td>CentA-LTR-OVG7f</td><td>TTGGTTGTGGTAGTCGGGCAGCCA</td>

<td>42</td><td>69538</td><td>CentA-LTR-OVG1r</td><td>CATTAACATGGTCATATCTGTGCG</td>

<td>43</td><td>69539</td><td>CentA-LTR-OVG2r</td><td>TGGTGTGGTGTATTGATGGCAGTG</td>

<td>44</td><td>69540</td><td>CentA-LTR-OVG3r</td><td>CTTTTATTGCCTTGTTGCCTTCT</td>

<td>45</td><td>69541</td><td>CentA-LTR-OVG4r</td><td>GACTTGGGTAGAGCAGGAGTTCAC</td>

<td>46</td><td>69542</td><td>CentA-LTR-OVG5r</td><td>AGGAATAGAAAGGAGTTCTAATGG</td>

<td>47</td><td>69543</td><td>CentA-LTR-OVG6r</td><td>ACAGCCTTGAACCTGCAAGCAATC</td>

<td>48</td><td>69544</td><td>CentA-LTR-OVG7r</td><td>TGTTGGAGAACGACGTTGGCTGCC</td>

<td>49</td><td>69555</td><td>Cent4-250-OVG1f</td><td>TAAGTGCAAACCATTGTTAAATTT</td>

<td>50</td><td>69556</td><td>Cent4-250-OVG2f</td><td>CACAAACCCTTAACTCGAAACTAT</td>

<td>51</td><td>69557</td><td>Cent4-250-OVG3f</td><td>ATCGAAAGATAACTCATATGGCTT</td>

<td>52</td><td>69558</td><td>Cent4-250-OVG4f</td><td>TCCACTAAAGAACCAAGATTGTGA</td>

<td>53</td><td>69559</td><td>Cent4-250-OVG1r</td><td>AATTGTACTATCTCTAAAATTTAA</td>

<td>54</td><td>69560</td><td>Cent4-250-OVG2r</td><td>TTTAGGGTTTGGGGTTATAGTTTC</td>

<td>55</td><td>69561</td><td>Cent4-250-OVG3r</td><td>GACCATAATGGTCAAAAAGCCATA</td>

<td>56</td><td>69562</td><td>Cent4-250-OVG4r</td><td>ATATGTTGGACACAAATCACAATC</td>

<td>57</td><td>69634</td><td>18-26SrDNANTS-OvG1f</td><td>CCGGAAATAAGCAAAGTCCAAGCG</td>

<td>58</td><td>69635</td><td>18-26SrDNANTS-OvG2f</td><td>TATGTCTTGGGTGAAGGGCATGGC</td>

<td>59</td><td>69636</td><td>18-26SrDNANTS-OvG3f</td><td>CGCAAGGCGACGGGCGGCATGGCT</td>

<td>60</td><td>69637</td><td>18-26SrDNANTS-OvG4f</td><td>CGAGGGGTTCCCCATGGCGCACGG</td>

<td>61</td><td>69638</td><td>18-26SrDNANTS-OvG1r</td><td>TCGGTGTCTTTCCACACGCTTGGA</td>

<td>62</td><td>69639</td><td>18-26SrDNANTS-OvG2r</td><td>GTTTTCCCTCCGTTCCGCCATGCC</td>

<td>63</td><td>69640</td><td>18-26SrDNANTS-OvG3r</td><td>AGACGCAAGGCCGAACAGCCATGC</td>

<td>64</td><td>69641</td><td>18-26SrDNANTS-OvG4r</td><td>GGCCTCAGTTTTCGGCCCGTGCGC</td>

<td>65</td><td>74794</td><td>subtelo-TR430-OvG2f</td><td>GACACATGTTTTTGTCGTCGAACA</td>

<td>66</td><td>74795</td><td>subtelo-TR430-OvG2r</td><td>GGAGGCACGAAATCGCTGTTCGAC</td>

<td>67</td><td>74796</td><td>subtelo-TR430-OvG3f</td><td>CGACCGCCACCCATGATTTGACCA</td>

<td>68</td><td>74797</td><td>subtelo-TR430-OvG3r</td><td>ACCTTACCAGTCTCTATGGTCAAA</td>

<td>69</td><td>74799</td><td>subtelo-TR430-OvG4f</td><td>TCCCGTGAGCTATAGCACACGTTT</td>

<td>70</td><td>74800</td><td>subtelo-TR430-OvG4r</td><td>GGTCGCTCGGCCATGAAAACGTGT</td>

<td>71</td><td>74801</td><td>subtelo-TR430-OvG5f</td><td>CCGTGTTCCTCCACACGTGTTTTT</td>

<td>72</td><td>74802</td><td>subtelo-TR430-OvG5r</td><td>AAGGTGCTCCGGGGACAAAAACAC</td>

<td>73</td><td>74803</td><td>subtelo-TR430-OvG6f</td><td>TTGGCCTCCCGCGAGCTATATCAC</td>

<td>74</td><td>74804</td><td>subtelo-TR43 0-OvG6r</td><td>TTGGCCACGGAAATGTGTGATATA</td>

<td>75</td><td>74805</td><td>subtelo-TR430-OvG7f</td><td>TTATGTATCCGACCTGCCACCTTC</td>

<td>76</td><td>74806</td><td>subtelo-TR430-OvG7r</td><td>CTCCCCGGTCTAAAACGAAGGTGG</td>

<td>77</td><td>74807</td><td>subtelo-TR430-OvG8f</td><td>GCCACCCGTGAGCTATAGCACACG</td>

<td>78</td><td>74808</td><td>subtelo-TR43 0-OvG8r</td><td>TAGGTTTCCATAAAATCGTGTGCT</td>

<td>79</td><td>65650</td><td>180knobOvG21-60f</td><td>TGTCGAAAATAGCCATGAACGACC</td>

<td>80</td><td>65651</td><td>180knobOvG21-60r</td><td>CGGTATTATTGGAAATGGTCGTTC</td>

<td>81</td><td>65652</td><td>180knobOvG71-110f</td><td>CCTACGGATTTTTGACCAAGAAAT</td>

<td>82</td><td>65653</td><td>180knobOvG71-110r</td><td>ATTTCTAGTGGAGACCATTTCTTG</td>

<td>83</td><td>65654</td><td>180knobOvG141-180f</td><td>ATGTGGGGTGAGGTGTATGAGCCT</td>

<td>84</td><td>65655</td><td>180knobOvG141-180r</td><td>ATGAGCCTCTGGTCGATGATCAAT</td>

<td>85</td><td>65656</td><td>5SrDNAOvG1-40f</td><td>GGATGCGATCATACCAGCACTAAA</td>

<td>86</td><td>65657</td><td>5SrDNAOvG1-40r</td><td>TGATGGGATCCGGTGCTTTAGTGC</td>

<td>87</td><td>65658</td><td>5SrDNAOvG61-100f</td><td>CTTGGGCGAGAGTAGTACTAGGAT</td>

<td>88</td><td>65659</td><td>5SrDNAOvG61-100r</td><td>TCCCAGGAGGTCACCCATCCTAGT</td>

<td>89</td><td>65660</td><td>5SrDNAOvG161-200f</td><td>ACCATAGTAAAAATGGGTGACCGT</td>

<td>90</td><td>65661</td><td>5SrDNAOvG161-200r</td><td>TAATTTAACACGAGAACGGTCAC</td>

<td>91</td><td>65662</td><td>5SrDNAOvG261-230f</td><td>CCGTGGGCGAGCCGAGCACGGAGG</td>

<td>92</td><td>65663</td><td>5SrDNAOvG261-230r</td><td>TCCTCTTATGCCCACACCTCCGTG</td>

<td>93</td><td>65664</td><td>350knobOvG31-70f</td><td>CTCAAATGACGTTTCTATGATATT</td>

<td>94</td><td>65665</td><td>350knobOvG31-70r</td><td>TGAATACAATGCCCTCAATATCAT</td>

<td>95</td><td>65666</td><td>350knobOvG121-160f</td><td>CTAGGTTTCCTATAATCCCCTCTA</td>

<td>96</td><td>65667</td><td>350knobOvG121-160r</td><td>CTAGGTATGCCTTGAATAGAGGG</td>

<td>97</td><td>65668</td><td>350knobOvG161-200f</td><td>ATGTTGTTTATGTCCACTCAAGTA</td>

<td>98</td><td>65669</td><td>350knobOvG161-200r</td><td>ATGGTGTACGGTGTTTTACTTGAG</td>

<td>99</td><td>65670</td><td>350knobOvG261-300f</td><td>GTGAGATCTGTCCAAACATAGGTT</td>

<td>100</td><td>65671</td><td>350knobOvG261-300r</td><td>GGTGCCTTACAACCGTAACCTATG</td>

<td>101</td><td></td><td>b010.m7 fis31</td><td>GCAAACTTTATGTGATCCCTTCCTCGCTGAACGAG ATGAG</td>

<td>102</td><td></td><td>b108.h15 fis47</td><td>GGGACGGCAAGTCACGGTAAGACCAGTCCAACCG AATGAT</td>

<td>103</td><td></td><td>Cen3n.pk0001.g11</td><td>CCAAACTTGCTGAGATTACTGGGCAATCTGTTCGC TCGCA</td>

<td>104</td><td>103022</td><td>23715-3101-3200f</td><td>CCAGGTAGTTTGAAACAGTATTCT</td>

<td>105</td><td>103023</td><td>23715-3501-3600f</td><td>ATAAAGGAAAAGGGCAAACCAAAC</td>

<td>106</td><td>103024</td><td>23715-1401-1500f</td><td>GATGCCCACATTATAGTGATTAGC</td>

<td>107</td><td>103025</td><td>23715-2901-3000f</td><td>CCACATATAGCTGCTGCATATGCC</td>

<td>108</td><td>103026</td><td>23715-3701-3800f</td><td>CGGATCTAACACAAACATGAACAG</td>

<td>109</td><td>103027</td><td>23715-1-100f</td><td>CGATGAATTTTCTCGGGTGTTCTC</td>

<td>110</td><td>103028</td><td>23715-101-200f</td><td>CCTGCAGCCCTAATAATTCAGAAG</td>

<td>111</td><td>103029</td><td>23715-301-400f</td><td>CACAGTCGATGAATCCAGAAAAGC</td>

<td>112</td><td>103030</td><td>23715-901-1000f</td><td>GCGTGCAATCCATCTTGTTCAATC</td>

<td>113</td><td>103031</td><td>23715-3201-3300f</td><td>CAACCACACCACATCATCACAACC</td>

<td>114</td><td>103032</td><td>23715-3601-3700f</td><td>ACTGGCAAGTTAGCAATCAGAACG</td>

<td>115</td><td>103033</td><td>23715-4901-5000f</td><td>CATGAACGTGTCTTCAACTAGAGG</td>

<td>116</td><td>103034</td><td>23715-4201-4300f</td><td>GACGGCGTTTAACAGGCTGGCATT</td>

<td>117</td><td>103035</td><td>23715-201-300f</td><td>CCAAGCTCTTCAGCAATATCACGG</td>

<td>118</td><td>103036</td><td>23715-601-700f</td><td>ATACTTTCTCGGCAGGAGCAAGGT</td>

<td>119</td><td>103037</td><td>23715-1001-1100f</td><td>ATCCTTGGCGGCAAGAAAGCCATC</td>

<td>120</td><td>103038</td><td>23715-1101-1200f</td><td>GCAAGCTACCTGCTTTCTCTTTGC</td>

<td>121</td><td>103039</td><td>23715-1601-1700f</td><td>GCTTCTTGGCCATGTAGATGGACT</td>

<td>122</td><td>103040</td><td>23715-1801-1900f</td><td>TTCACGCCGATGAACTTCACCTTG</td>

<td>123</td><td>103041</td><td>23715-5001-5087f</td><td>AAGCTTGCCAACGACTACGCACTA</td>

<td>124</td><td>103042</td><td>23715-401-500f</td><td>CCCTGATGCTCTTCGTCCAGATCA</td>

<td>125</td><td>103043</td><td>23715-801-900f</td><td>AGAGCAGCCGATTGTCTGTTGTGC</td>

<td>126</td><td>103044</td><td>23715-1301-1400f</td><td>CAGGATCCCGTAACTATAACGGTC</td>

<td>127</td><td>103045</td><td>23715-2801-2900f</td><td>CGACCTGCAGAAGTAACACCAAAC</td>

<td>128</td><td>103046</td><td>23715-3401-3500f</td><td>ATCTAGAACGACCGCCCAACCAGA</td>

<td>129</td><td>103047</td><td>23715-3801-3900f</td><td>ATTTGGGGGAGATCTGGTTGTGTG</td>

<td>130</td><td>103048</td><td>23715-3901-4000f</td><td>GAGGGGGTGTCTATTTATTACGGC</td>

<td>131</td><td>103049</td><td>23715-4801-4900f</td><td>CATGCAAGCTGATCTGAGCTTGGC</td>

<td>132</td><td>103050</td><td>23715-2101-2200f</td><td>TCCATGCGCACCTTGAAGCGCATG</td>

<td>133</td><td>103051</td><td>23715-501-600f</td><td>TTCCATCCGAGTACGTGCTCGCTC</td>

<td>134</td><td>103052</td><td>23715-1201-1300f</td><td>ATCCACTAGTAACGGCCGCCAGTG</td>

<td>135</td><td>103053</td><td>23715-4001-4100f</td><td>GCCACGCAATTTCTGGATGCCGAC</td>

<td>136</td><td>103054</td><td>23715-701-800f</td><td>CGATAGCCGCGCTGCCTCGTCTTG</td>

<td>137</td><td>103055</td><td>23715-1901-2000f</td><td>CACTTGAAGCCCTCGGGGAAGGAC</td>

<td>138</td><td>103056</td><td>23715-1701-1800f</td><td>TCCTTCAGCTTCAGGGCCTTGTGG</td>

<td>139</td><td>103057</td><td>23715-2001-2100f</td><td>CACCTTGGAGCCGTACTGGAACTG</td>

<td>140</td><td>103058</td><td>23715-2601-2700f</td><td>TGCGGCTCGGTGCGGAAGTTCACG</td>

<td>141</td><td>103059</td><td>23715-4101-4200f</td><td>ACGCGACGCTGCTGGTTCGCTGGT</td>

<td>142</td><td>103060</td><td>23715-3101-3200r</td><td>CGTTCTAGATCGGAGTAGAATACT</td>

<td>143</td><td>103061</td><td>23715-3501-3600r</td><td>TGTTTCGTTGCATAGGGTTTGGTT</td>

<td>144</td><td>33332</td><td>23715-1401-1500r</td><td>GCACACATAGTGACATGCTAATCA</td>

<td>145</td><td>103062</td><td>23715-2901-3000r</td><td>GATATACTTGGATGATGGCATATG</td>

<td>146</td><td>103063</td><td>23715-3701-3800r</td><td>CCCGGTAGTTCTACTTCTGTTCAT</td>

<td>147</td><td>103064</td><td>23715-1-100r</td><td>ATTCGAGCCAATATGCGAGAACAC</td>

<td>148</td><td>103065</td><td>23715-101-200r</td><td>GCCTTCTTGACGAGTTCTTCTGAA</td>

<td>149</td><td>103066</td><td>23715-301-400r</td><td>ATGGTGGAAAATGGCCGCTTTTCT</td>

<td>150</td><td>103067</td><td>23715-901-1000r</td><td>GAGGATCGTTTCGCATGATTGAAC</td>

<td>151</td><td>103068</td><td>23715-3201-3300r</td><td>TGCTTTTTGTTCGCTTGGTTGTGA</td>

<td>152</td><td>103069</td><td>23715-3601-3700r</td><td>ACCTGTACGTCAGACACGTTCTGA</td>

<td>153</td><td>103070</td><td>23715-4901-5000r</td><td>AATTAAGTCAGGCGCGCCTCTAGT</td>

<td>154</td><td>103071</td><td>23715-4201-4300r</td><td>CTTGTTTCGAGTAGATAATGCCAG</td>

<td>155</td><td>103072</td><td>23715-201-300r</td><td>ACATAGCGTTGGCTACCCGTGATA</td>

<td>156</td><td>103073</td><td>23715-601-700r</td><td>GATCTCCTGTCATCTCACCTTGCT</td>

<td>157</td><td>103074</td><td>23715-1001-1100r</td><td>CCTGCAAAGTAAACTGGATGGCTT</td>

<td>158</td><td>103075</td><td>23715-1101-1200r</td><td>AAGGGAAAACGCAAGCGCAAAGAG</td>

<td>159</td><td>103076</td><td>23715-1601-1700r</td><td>TACCTGGTGGAGTTCAAGTCCATC</td>

<td>160</td><td>103077</td><td>23715-1801-1900r</td><td>ACGGCTGCTTCATCTACAAGGTGA</td>

<td>161</td><td>103078</td><td>23715-5001-5087r</td><td>TGAAGCTCTTGTTGGCTAGTGCGT</td>

<td>162</td><td>103079</td><td>23715-401-500r</td><td>GTCTTGTCGATCAGGATGATCTGG</td>

<td>163</td><td>103080</td><td>23715-801-900r</td><td>ATTCGGCTATGACTGGGCACAACA</td>

<td>164</td><td>103081</td><td>23715-1301-1400r</td><td>CGCTTCGCTACCTTAGGACCGTTA</td>

<td>165</td><td>103082</td><td>23715-2801-2900r</td><td>CGATGCTCACCCTGTTGTTTGGTG</td>

<td>166</td><td>88245</td><td>23715-3401-3500r</td><td>GGTTGTGATGATGTGGTCTGGTTG</td>

<td>167</td><td>103083</td><td>23715-3801-3900r</td><td>GTTCGGAGCGCACACACACACAAC</td>

<td>168</td><td>103084</td><td>23715-3901-4000r</td><td>TTTCCCTTCCTCGCCCGCCGTAAT</td>

<td>169</td><td>103085</td><td>23715-4801-4900r</td><td>TAAAACGACGGCCAGTGCCAAGCT</td>

<td>170</td><td>103086</td><td>23715-2101-2200r</td><td>ACGTCATCACCGAGTTCATGCGCT</td>

<td>171</td><td>103087</td><td>23715-501-600r</td><td>AGCGAAACATCGCATCGAGCGAGC</td>

<td>172</td><td>103088</td><td>23715-1201-1300r</td><td>AAGCCGAATTCCAGCACACTGGCG</td>

<td>173</td><td>103089</td><td>23715-4001-4100r</td><td>TTGGACTTGCTCCGCTGTCGGCAT</td>

<td>174</td><td>103090</td><td>23715-701-800r</td><td>TGCCCTGAATGAACTGCAAGACGA</td>

<td>175</td><td>103091</td><td>23715-1901-2000r</td><td>CCGACTACAAGAAGCTGTCCTTCC</td>

<td>176</td><td>103092</td><td>23715-1701-1800r</td><td>TGCTGAAGGGCGAGACCCACAAGG</td>

<td>177</td><td>103093</td><td>23715-2001-2100r</td><td>GGACATCCTGTCCCCCCAGTTCCA</td>

<td>178</td><td>103094</td><td>23715-2601-2700r</td><td>ACATCGAGACCTCCACCGTGAACT</td>

<td>179</td><td>103095</td><td>23715-4101-4200r</td><td>AGTCTAACGGACACCAACCAGCGA</td>

<td>180</td><td></td><td>PCRbacmpk108h15f</td><td>GATCGTCGAATGGGAATCCATGGG</td>

<td>181</td><td></td><td>PCRbacmpk108h15r</td><td>CCCTGAGTGAACCATTTAGGAAGATCAG</td>

<td>182</td><td></td><td>PCRbacmpk108h15-2.fis47f</td><td>TGCAACATCCAAAGACCCAACATG</td>

<td>183</td><td></td><td>PCRbacmpk108h15-2.fis47r</td><td>TTCCAACATGGTTGGTGGTCAG</td>

<td>184</td><td></td><td>PCRbacmpk010m07fis3 1f</td><td>TGTCATGACATCTTGTTGCTACCCTG</td>

<td>185</td><td></td><td>PCRbacmpk010m07fis3 1r</td><td>AAACCCGGAGTTTCTATGCAGG</td>

<td>192</td><td>75319</td><td>Telo-31over primer 1</td><td>AGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGG</td>

<td>193</td><td>39612</td><td>Telo-31overgo primer 2</td><td>CCCTAAACCCTAAACCCTAAACCCTAAACCC</td>

- 59 ii. BAC screening screening results [0175] Colony hybridization screening identified a pool of about 8,000 BAC clones that hybridized to at least one of four centromere-specific probes. 8,000 BAC clones were divided into 4 groups based on their hybridization profile (Table 2).

TABLE 2

<td>Group</td><td>altogether</td>

<td>All BACs containing CentA</td><td>842</td>

<td>All BACs containing CentC</td><td>2479</td>

<td>All BACs containing CRM2</td><td>2968</td>

<td>All BACs containing CRM1</td><td>6012</td>

[0176] Based on the composition of the centromeric repeat, BAC clones were further subdivided into 15 sets based on probe compositions that hybridized to each particular BAC clone (Table 3).

TABLE 3

<td>Group</td><td>#BAC</td>

<td>BAC containing CentA &amp; CentC &amp; CRM1 &amp; CRM2</td><td>247</td>

<td></td><td></td>

<td>BACs containing CentA &amp; CentC &amp; CRM2; no CRM1</td><td>6</td>

<td>BACs containing CentA &amp; CentC &amp; CRM1; no CRM2</td><td>45</td>

<td>BACs containing CentA &amp; CRM1 &amp; CRM2; no CentC</td><td>116</td>

<td>BACs containing CentC &amp; CRM1 &amp; CRM2; no CentA</td><td>730</td>

<td>BACs containing CentA &amp; CentC; no CRM1 no CRM2</td><td>4</td>

<td>BACs containing CentA &amp; CRM1; CentC missing, CRM2 missing</td><td>131</td>

<td>BACs containing CentA &amp; CRM2; CentC missing, CRM1 missing</td><td>27</td>

<td>BACs containing CentC &amp; CRM2; CentA is missing CRM1</td><td>97</td>

<td>BACs containing CentC &amp; CRM1; CentA is missing CRM2</td><td>829</td>

<td>BACs containing CRM1 &amp; CRM2; no CentA no CentC</td><td>749</td>

<td></td><td></td>

<td>BAC containing CentC; none CentA no CRM1 no CRM2</td><td>521</td>

<td>BACs containing CRM2; no CentA no CentC no CRM1</td><td>966</td>

<td>BACs containing CRM1; no CentA no CentC no CRM2</td><td>3165</td>

<td>BACs containing CentA; no CentC missing CRM1 no CRM2</td><td>266</td>

[0177] The BAC clones were further divided by the summation of BAC clones that hybridized to each particular probe (Table 4).

TABLE 4

<td>All BACs containing CentA</td><td>842</td>

<td>All BACs containing CentA &amp; CentC</td><td>302</td>

<td>All BACs containing CentA, CentC, &amp; CRM1</td><td>292</td>

<td>All BACs containing CentA, CentC, &amp; CRM2</td><td>253</td>

<td>All BACs containing CentA &amp; CRM1</td><td>539</td>

<td>All BACs containing CentA, CRM1, &amp; CRM2</td><td>363</td>

<td>All BACs containing CentA &amp; CRM2</td><td>396</td>

<td>All BACs containing CentA, CentC, CRM1, &amp; CRM2</td><td>247</td>

<td>All BACs containing CentC</td><td>2479</td>

<td>All BACs containing CentC &amp; CRM1</td><td>1851</td>

<td>All BACs containing CentC &amp; CRM2</td><td>1080</td>

<td>All BACs containing CentC, CRM1, &amp; CRM2</td><td>977</td>

<td>All BACs containing CRM1</td><td>6012</td>

<td>All BACs containing CRM1 &amp; CRM2</td><td>1842</td>

<td>All BACs containing CRM2</td><td>2968</td>

[0178] One group of 247 BAC clones contains all four centromeric repeats. They include 0.15% of the maize genome or they may be present on the DNA segment on average around 300 kb per centromer. This group of BAC clones was identified as a core set, for use first in experiments for the construction of maize minichromosome. DNA was purified from all 247 BACs in the core set, digested with XmnI or RsaI, transferred to a membrane and hybridized with each of the four centromeric repeats. Southern hybridization confirmed that the clones in this core set contained all four centromeric repeats. BACs showed general differences in the composition of restriction fragments and hybridization patterns, and were further subdivided into 87 groups based on the similarity of restriction fragments.

DNA and / or BAC pool of core set constructs for the transformation and assembly of the minichromosome.

<td>TAB]</td><td colspan="5">ELA 5</td>

<td>No.</td><td>Name</td><td>Insert (kb)</td><td>No.</td><td>Name</td><td>Insert (kb)</td>

<td>1</td><td>bacm.pk101.n23</td><td>50</td><td>45</td><td>bacm2.pk002.g7</td><td>125</td>

<td>2</td><td>bacm2.pk064.e15</td><td>50</td><td>46</td><td>bacm.pk135.l7</td><td>125</td>

<td>3</td><td>bacm.pk036.e13</td><td>60</td><td>47</td><td>bacm.pk090.o5</td><td>125</td>

<td>4</td><td>bacm2.pk179.e1</td><td>70</td><td>48</td><td>bacm2.pk100.j24</td><td>130</td>

<td>5</td><td>bacm.pk030.a6</td><td>70</td><td>49</td><td>bacm2.pk013.c9</td><td>130</td>

<td>6</td><td>bacm2.pk179.b18</td><td>75</td><td>50</td><td>bacm.pk166.n7</td><td>130</td>

<td>7</td><td>bacm.pk133.b11</td><td>75</td><td>51</td><td>bacm.pk043.o23</td><td>130</td>

<td>8</td><td>bacm2.pk066.m12</td><td>80</td><td>52</td><td>bacm.pk001.n1</td><td>130</td>

<td>9</td><td>bacm.pk119.a23</td><td>80</td><td>53</td><td>bacm.pk106.j20</td><td>135</td>

<td>10</td><td>bacm.pk098.h2</td><td>85</td><td>54</td><td>bacm.pk015.d19</td><td>135</td>

<td>11</td><td>bacm2.pk174.e4</td><td>90</td><td>55</td><td>bacm.pk007.a2</td><td>140</td>

<td>12</td><td>bacm2.pk116.g16</td><td>90</td><td>56</td><td>bacm.pk148.e2</td><td>140</td>

<td>13</td><td>bacm2.pk023.e24</td><td>90</td><td>57</td><td>bacm.pk141.j4</td><td>140</td>

<td>14</td><td>bacm.pk178.c10</td><td>90</td><td>58</td><td>bacm.pk138.e14</td><td>140</td>

<td>15</td><td>bacm.pk135.l6</td><td>90</td><td>59</td><td>bacm.pk135.j2</td><td>140</td>

<td>16</td><td>bacm.pk098.f3</td><td>90</td><td>60</td><td>bacm.pk134.f15</td><td>140</td>

<td>17</td><td>bacm.pk075.16</td><td>90</td><td>61</td><td>bacm.pk085.k5</td><td>140</td>

<td>18</td><td>bacm.pk066.j 14</td><td>95</td><td>62</td><td>bacm.pk077.b21</td><td>140</td>

<td>19</td><td>bacm2.pk099.m24</td><td>100</td><td>63</td><td>bacm.pk124.j24</td><td>145</td>

<td>20</td><td>bacm2.pk093.h11</td><td>100</td><td>64</td><td>bacm.pk023.i5</td><td>145</td>

<td>21</td><td>bacm2.pk083.a2</td><td>100</td><td>65</td><td>bacm.pk039.m16</td><td>150</td>

<td>22</td><td>bacm.pk179.d4</td><td>100</td><td>66</td><td>bacm2.pk169.a21</td><td>150</td>

<td>23</td><td>bacm.pk076.m3</td><td>100</td><td>67</td><td>bacm2.pk130.e20</td><td>150</td>

<td>24</td><td>bacm.pk070.h17</td><td>100</td><td>68</td><td>bacm.pk156.i17</td><td>150</td>

<td>25</td><td>bacm.pk064.n1</td><td>100</td><td>69</td><td>bacm.pk143.m18</td><td>150</td>

<td>26</td><td>bacm.pk011.l8</td><td>100</td><td>70</td><td>bacm.pk112.p1</td><td>150</td>

<td>27</td><td>bacm.pk068.p16</td><td>105</td><td>71</td><td>bacm.pk102.i4</td><td>150</td>

<td>28</td><td>bacm.pk012.n20</td><td>105</td><td>72</td><td>bacm.pk087.m4</td><td>150</td>

<td>29</td><td>bacm.pk077.k5</td><td>110</td><td>73</td><td>bacm.pk079.m11</td><td>150</td>

<td>thirty</td><td>bacm2.pk053.g23</td><td>110</td><td>74</td><td>bacm.pk041.e16</td><td>150</td>

<td>31</td><td>bacm2.pk034.j8</td><td>110</td><td>75</td><td>bacm.pk129.a4</td><td>150</td>

<td>32</td><td>bacm.pk164.b11</td><td>110</td><td>76</td><td>bacm.pk164.e18</td><td>155</td>

<td>33</td><td>bacm.pk062.c14</td><td>110</td><td>77</td><td>bacm.pk161.h1</td><td>155</td>

<td>34</td><td>bacm.pk013.m8</td><td>110</td><td>78</td><td>bacm.pk089.18</td><td>155</td>

<td>35</td><td>bacm.pk056.j 19</td><td>110</td><td>79</td><td>bacm.pk076.o15</td><td>160</td>

<td>36</td><td>bacm.pk051.g11</td><td>115</td><td>80</td><td>bacm.pk039.a3</td><td>160</td>

<td>37</td><td>bacm2.pk179.o14</td><td>120</td><td>81</td><td>bacm.pk019.h24</td><td>160</td>

<td>38</td><td>bacm2.pk096.d23</td><td>120</td><td>82</td><td>bacm2.pk158.f12</td><td>160</td>

<td>39</td><td>bacm2.pk070.g7</td><td>120</td><td>83</td><td>bacm2.pk075.n6</td><td>170</td>

<td>40</td><td>bacm2.pk034.g20</td><td>120</td><td>84</td><td>bacm2.pk137.f2</td><td>175</td>

<td>41</td><td>bacm2.pk012.g19</td><td>120</td><td>85</td><td>bacm.pk093.d8</td><td>175</td>

<td>42</td><td>bacm2.pk115.o22</td><td>125</td><td>86</td><td>bacm.pk133.b10</td><td>180</td>

<td>43</td><td>bacm2.pk094.f14</td><td>125</td><td>87</td><td>bacm.pk178.o20</td><td>180</td>

<td>44</td><td>bacm2.pk003.g6</td><td>125</td><td></td><td></td><td></td>

D. Identification of CentC Reverse Centers Repeat [0179] The BACs from the Mo17 and B73 corn lines were screened for reverse CentC tandem matrices. BLAST searches for the Mo17 BAC end sequence database revealed 591 BAC ends containing CentC repeats. Of these, only 45 BAC clones contained CentC repeats at both ends and 44 BACs had CentC repeats in the same orientation, with just one BAC having CentC repeats in the reverse orientation (bacm.pk128.j21). A second BAC clone, bacm.pk008.d20 having CentC repeats in inverted orientation, was found in a Southern hybridization assay. Southern analysis of this clone showed a hybridization pattern very similar to the pattern observed for bacm.pk128.j21. A BLAST search of the public B73 BAC end sequence database revealed 136 BAC ends containing CentC repeats. Of these, only 5 BAC clones contained CentC repeats at both ends and 4 BACs had CentC repeats in the same orientation, with only one BAC having CentC repeats in the reverse orientation (ZMMBBb0243L15). The bacm.pk128.j21 and bacm.pk008.d20 DNAs were digested with the restriction enzyme XmnI, which cleaves the CentC repeats into short monomeric or dimer fragments. 10 kb of the XmnI fragment were isolated, which cleaves the CentC repeats into short monomeric or dimeric fragments. 10 kb of the XmnI fragment were isolated, which cleaves the CentC repeats into short monomeric or dimeric fragments. 10 kb of the XmnI fragment were isolated,

- 63 were subcloned and sequenced. Sequence analysis showed that the CRM1 element (SEQ ID NO: 191) is located between the two inverted CentC repeats.

E. Isolation of centromeric BAC clones from maize chromosome [0180] Maize chromosome 4 contains the shortest CentC repeat matrix. These matrices are present in a single DNA sequence of about 300 kbp, as assessed by FISH on stretched chromatin fibers. This segment may contain core functional centromeric DNA sequences and could potentially be represented by 2-4 overlapping BAC clones. The centromere BAC clones specific for chromosome 4 can be identified by finding unique DNA sequences located in the centromeric region of chromosome 4.

[0181] The Mo17 corn moons genomic BAC library containing 10965 BAC end sequences was analyzed to identify unique BAC end sequences represented only once in the library. Eighty-one unique BAC end sequences were identified, and selected for additional characterization. A pair of PCR primers were designed for each of the 81 unique BAC end sequences for mapping the oat-maize chromosomal panel and each unique sequence was assigned to an individual maize chromosome.

[0182] The final BAC sequence bacm.pk108.h15 (170 kb) from Mo17 was mapped to chromosome 4. This BAC was sequenced and 6 unique sequences were found, as well as all four centromere repeats CentA, CentC, CRM1 and CRM2. Using PCR, this BAC was assigned to a contig containing several BACs that also hybridized to CentC. Sequencing confirmed that two more BAC clones from this contig, bacm.pk010.m7 (170 kbp) and bacm.pk184.c21 (150 kbp) partially overlap with bacm.pk108.h15 and share several unique markers. Three unique DNA sequences were identified within these three BAC clones, and their location on chromosome 4 was confirmed by PCR on the oat-maize addition line DNA. Respective overgo probes have been developed (SEQ ID NO:

[0183] Seven BAC clones were selected from the B73 BAC library, based on this hybridization to all three chromosome-specific 4 probes. The DNA from these BAC clones was digested with XmnI, transferred to a membrane and hybridized with all four centromeric repeat probes. Four of the selected B73 BAC clones contain centromeric repetitive CentC, CRM1 and CRM2 elements: bacb, 0424.d20 (150 kb); bacb.0155.h15 (175 kbp); bacc.0048.g5 (170 kbp); and bacc.0237.m8 (125 kb). The next three B73 BAC clones contain only centromeric repetitive CRM1 and CRM2 elements: bacc.0143.i9 (205 kb); bacc.0237.j16 (175 kb); and bacc.0270.c1 (180 kpz). Sequencing of the BAC clone bacb.0155.h15 confirmed that it contains significant regions of homology to chromosome-specific 4 BAC Mo17 bacm.pk010.m7 clones and bacm.pk108.h15.

[0184] Two groups of BAC clones representing the centromeric region of chromosome 4 from inbred mo17 and B73 lines were used to produce DNA constructs for minichromosome assembly.

- 64 F. Isolation and purification of chromosomal centromeric DNA fragments [0185] In principle, all corn genomic DNA is strongly methylated, and this methylation pattern may play a role in the assembly, function and / or maintenance of corn centromeres. Insulated genomic corn genomes that retain methylation and / or other native genomic features, such as size, organization of elements, and other native nucleotide modifications can be used to generate DNA constructs for assembly of maize minichromosome.

i. Selection of restriction enzymes [0186] Sequence analysis of corn centromeric repeats has identified a large number of restriction enzymes (recognizing and cleaving the 6 base sequence) lacking a cleavage site within any of Centomer CentA, CentC, CRM1 or CRM2 repeats (Table 6). These restriction enzymes should cut most of the genomic DNA into small DNA fragments, most of which will be around 1-20 kb in size, while centromeric DNA is expected to be significantly longer. The cornomer centromeric chromomeric regions may be isolated by partially or completely digesting high molecular weight (HMW) genomic corn DNA at at least one of these restriction enzymes. Fraction of HMW-stained genomic DNA,among people embedded in agarose blocks.

ii. Preparation and characterization of HMW maize genomic DNA [0187] HMW maize genomic DNA from Mo17 was prepared essentially as described in Liu &amp; Whittier ((1994) Nucleic Acids Res 22: 2168-2169), from DNA embedded in agarose blocks, by digestion with various restriction enzymes from TABLE 6 and fractionation using PFGE. Five restriction enzymes were selected, BspTI, AatII, Cfr9I, MbiI, MluI, for initial analyzes. Of these, BspTI was chosen for all additional preparations. Hybridization with a centromere labeled CentC probe revealed that the BspTI restriction enzyme produced a genomic set of centromeric DNA fragments ranging from about 50 kb to about 600 kb, which were well separated from the rest of the genomic DNA. Hybridization to the same DNA fragments of three other centromeric probes (CentA, CRM1, andCRM2) confirmed that that these long DNA fragments containing all four centromeric repeats had essentially no BspTI restriction site. Hybridizing bands may represent individual centromeric DNA fragments that can be isolated and used to generate DNA constructs for minichromosome assembly.

- 65 TABLE 6

<td>Enzyme</td><td>Place Rec</td><td>Enzyme</td><td>Place Rec</td>

<td>Aatl</td><td>AGGCCT</td><td>AgoPIII</td><td>CCGCGG</td>

<td>AatII</td><td>GACGTC</td><td>Pac25I</td><td>cccggg</td>

<td>AccBSI</td><td>CCGCTC</td><td>Pae 14kI</td><td>CCGCGG</td>

<td>AflII</td><td>CTTAAG</td><td>Pae 5 kI</td><td>CCGCGG</td>

<td>AhyI</td><td>cccggg</td><td>Pae AI</td><td>CCGCGG</td>

<td>Asp MI</td><td>AGGCCT</td><td>PaeBI</td><td>cccggg</td>

<td>BbI24I</td><td>ACGCGT</td><td>PaeQI</td><td>CCGCGG</td>

<td>BfrI</td><td>CTTAAG</td><td>Pcei</td><td>AGGCCT</td>

<td>BpuB5I</td><td>CGTACG</td><td>Pfi23II</td><td>CGTACG</td>

<td>BsiWI</td><td>CGTACG</td><td>Pme55I</td><td>AGGCCT</td>

<td>BspTI</td><td>CTTAAG</td><td>PPUA</td><td>CGTACG</td>

<td>BsrBI</td><td>GAGCGG</td><td>Psp AI</td><td>cccggg</td>

<td>Bst31NI</td><td>CCGCTC</td><td>Psp ALI</td><td>cccggg</td>

<td>Bst98I</td><td>CTTAAG</td><td>PspLI</td><td>CGTACG</td>

<td>BstD102I</td><td>CCGCTC</td><td>.SacII</td><td>CCGCGG</td>

<td>BstPZ740</td><td>CTTAAG</td><td>Sarl</td><td>AGGCCT</td>

<td>BvuBI</td><td>CGTACG</td><td>SchZI</td><td>CCGCGG</td>

<td>Cfr42I</td><td>CCGCGG</td><td>SenPT14bi</td><td>CCGCGG</td>

<td>Cfr9I</td><td>cccggg</td><td>SexBI</td><td>CCGCGG</td>

<td>CfJ4I</td><td>cccggg</td><td>SexCI</td><td>CCGCGG</td>

<td>CSCI</td><td>CCGCGG</td><td>Sfr303I</td><td>CCGCGG</td>

<td>Eae46I</td><td>CCGCGG</td><td>SgrBI</td><td>CCGCGG</td>

<td>Eae AI</td><td>cccggg</td><td>Smal</td><td>cccggg</td>

<td>Ec / RI</td><td>cccggg</td><td>Sleeps</td><td>CGTACG</td>

<td>Eco147I</td><td>AGGCCT</td><td>Spui</td><td>CCGCGG</td>

<td>Eco29kI</td><td>CCGCGG</td><td>Sru30DI</td><td>AGGCCT</td>

<td>Esp4I</td><td>CTTAAG</td><td>SseBI</td><td>AGGCCT</td>

<td>Ga / I</td><td>CCGCGG</td><td>Ssp5230I</td><td>GACGTC</td>

<td>Gce GLI</td><td>CCGCGG</td><td>SstII</td><td>CCGCGG</td>

<td>GceI</td><td>CCGCGG</td><td>Stei</td><td>AGGCCT</td>

<td>GdiI</td><td>AGGCCT</td><td>StuI</td><td>AGGCCT</td>

<td>Kpn378I</td><td>CCGCGG</td><td>glide</td><td>CGTACG</td>

<td>KspI</td><td>CCGCGG</td><td>Vha464I</td><td>CTTAAG</td>

<td>MaeK81I</td><td>CGTACG</td><td>XcyI</td><td>cccggg</td>

<td>MbiI</td><td>CCGCTC</td><td>XmaCI</td><td>cccggg</td>

<td>MluI</td><td>ACGCGT</td><td>Xmal</td><td>cccggg</td>

<td>MspCI</td><td>CTTAAG</td><td>Raia</td><td>GACGTC</td>

<td>Ago AIII</td><td>CCGCGG</td><td></td><td></td>

EXAMPLE 2. Identification and isolation of telomer sequences [0188] Any functional telomeric, native, cloned, or synthetic telomeric repeat region may be used to create DNA constructs. Several telomere repetitions are known, including those from Tetrahymena, Paramecium,

- 66 Oxytricha, Euplotes, Dictyostelium, Saccharomyces, Caenorhabditis, Trypanosoma,

Leishmania, Physarum, Arabidopsis, human and mouse.

Telomeric Repetition An example of an organism

CCCCAA (C4A2) CCCCAAAA (C4A4) CCCTA (C3TA)

1-3

C1-8T

CCCTAAA (C3TA3)

Tetrahymena, Paramecium

Oxytrich, Euplotes

Trypanosoma, Leishmania, Physarum

Saccharomyces

Dictyostelium

Arabidopsis, human, mouse, Caenrhabditis

A. Synthetic telomeric sequences [0189] The highly conserved, repetitive nature of telomeric sequences allows for the chemical synthesis and / or PCR amplification of long telomeric regions suitable for the construction of the vector. Long telomere repeat sequences can be generated, e.g. (CCCTAAA) n to surround the ends of the minichromosome.

[0190] Long sequences of tandem telomeric repeats can be produced in several rounds of PCR amplification using a pair of primers SEQ ID NO: 5 &amp; 6 by the reciprocal pairing of two complementary telomere oligonucleotides and their products. A PCR reaction using low primer concentrations (&lt;0.1 μΜ) can produce DNA sections of about 100-10000 bp. Optionally, synthetic telomere repeats can be produced by ligating phosphorylated oligonucleotides. Telomeric DNA segments were cloned and used for the production of DNA constructs.

B. Identification and isolation of subtelomeric sequences

i. Telomere BAC containing clones. repeats [0191] BAC clones containing telomer repeating subtelomeric regions can be used to stabilize the chromosomal ends of the minichromosome construct. A number of sequences have previously been identified as subtelomeric repeats (Burr et al (1992) J Plant Cell 4: 953-60). The Genbank database database was searched using keywords for telomere and subtelomeric sequences. Selected sequences were applied and a common repetitive element identified (Telo266, SEQ ID NO: 189). Using SEQ ID NO: 189, several oligonucleotides were designed and used as probes for screening the Mo17 BAC library. A number of BACs were recovered, one was selected (bacm.pk107.g1), labeled and hybridized to pachytene chromosomes. The BAC clone sequences were found in clusters on 6 out of 20 subtelomers in maize chromosomes. Insert BAC bacm.pk107.g1 was subcloned and sequenced. Sequence analysis revealed a common repetitive element (TR430, SEQ ID NO: 190) that was used to design overgo probes (Table 1). The subtelomeric location of these repeats was confirmed by FISH for

- 67 pachytenic chromosomes of maize Mo17 and B73. Using the same probe, Mo17 corn genomic BAC libraries were screened by colony hybridization.

[0192] About 71 BAC clones containing corn blocks of subtelomeric repeats were confirmed to have a subtelomeric repeat of TR430 (Table 7).

TABLE 7

<td>bacm.pk155.e24</td><td>bacm.pk166.a12</td><td>bacm.pk173.m16</td><td>bacm.pk203.j 15</td>

<td>bacm.pk203.j 15</td><td>bacam2.pk092.a9</td><td>bacm2.pk114.i4</td><td>bacm2.pk169.b21</td>

<td>bacm2.pk177.j 18</td><td>bacm2.pk190.m10</td><td>bacm2.pk220.h7</td><td>bacm.pk001.k4</td>

<td>bacm.pk009.c19</td><td>bacm.pk024.j 15</td><td>bacm.pk024.k8</td><td>bacm.pk036.g23</td>

<td>bacm.pk038.g6</td><td>bacm.pk061.i6</td><td>bacm.pk062.g4</td><td>bacm.pk064.f6</td>

<td>bacm.pk070.j 17</td><td>bacm.pk071.c12</td><td>bacm.pk073.m7</td><td>bacm.pk082.m9</td>

<td>bacm.pk101.h5</td><td>bacm.pk107.g1</td><td>bacm.pk110.h10</td><td>bacm.pk112.b18</td>

<td>bacm.pk123.e21</td><td>bacm.pk125.n6</td><td>bacm.pk132.h6</td><td>bacm.pk141.p12</td>

<td>bacm.pk142.b15</td><td>bacm.pk146.l14</td><td>bacm.pk148.j 17</td><td>bacm.pk154.a21</td>

<td>bacm.pk155.p12</td><td>bacm.pk157.d2</td><td>bacm.pk164.n4</td><td>bacm.pk165.n1</td>

<td>bacm.pk169.n16</td><td>bacm.pk171.d3</td><td>bacm.pk172.m20</td><td>bacm.pk172.n19</td>

<td>bacm.pk172.n16</td><td>bacm.pk173.e9</td><td>bacm.pk173.i12</td><td>bacm.pk174.g4</td>

<td>bacm.pk176.q2</td><td>bacm.pk184.e5</td><td>bacm.pk185.o19</td><td>bacm.pk189.a10</td>

<td>bacm.pk197.m23</td><td>bacm.pk198.f9</td><td>bacm.pk198.k3</td><td>bacm.pk200.c20</td>

<td>bacm.pk208.j 1</td><td>bacm.pk213.f2</td><td>bacm.pk214.i17</td><td>bacm.pk214.k16</td>

<td>bacm.pk214.l11</td><td>bacm.pk214.m20</td><td>bacm2.pk007.d1</td><td>bacm2.pk034.k22</td>

<td>bacm2.pk043.g14</td><td>bacm2.pk043.j 16</td><td>bacm2.pk073.o7</td><td>bacm2.pk102.o18</td>

<td>bacm2.pk108.a3</td><td>bacm2.pk117.h13</td><td>bacm2.pk160.l2</td><td>bacm.pk203.j 15</td>

<td>bacm.pk155.e24</td><td>bacm.pk166.a12</td><td>baacm.pk173.m16</td><td>bacm2.pk169.b21</td>

<td>bacm2.pk022.m14</td><td>bacam2.pk092.a9</td><td>bacm2.pk114.i4</td><td>bacm.pk001.k4</td>

<td>bacm2.pk177.j 18</td><td>bacm2.pk190.m10</td><td>bacm2.pk220.h7</td><td>bacm.pk036.q23</td>

<td>bacm.pk009.c19</td><td>bacm.pk024.j 15</td><td>bacm.pk024.k8</td><td></td>

[0193] The restriction "fingerprint" of DpnI and dot hybridization with TR430 probes, probe (CCCTAAA) and probes up to 180 bp of repeating the knob region showed at least 3 types of subtelomeric BAC clones. The first type has long strings associated with TR430 repeats longer than 10-20 kb. The other BAC clone has been linked

- 68 with TR430 repeats that have a restriction place within the unit, with a unit size of 800 bp or 900 bp. Some BAC clones contain both of these two repeats. The third type of BAC clones has a unit of 500 bp associated with the TR430 bp. Some of these BAC clones are also associated with telomeres (CCCTAAA) n replicates. 180 bp repeats from the "knob" region are also present in 37 subtelomeric BAC clones, suggesting that repeats of 180 bp from the "knob" region may be part of some subtelomeric regions. Representative BAC clones from each genus were taken for additional analysis, modification experiments and transgenic experiments: bacm.pk038.g6; bacm2.pk063.g24; bacm.pk071.c12; bacm.pk112.b18; bacm.pk142.b15; bacm.pk173.e9.

ii. Isolation of native chromosomal telomeric DNA fragments [0194] Chromosomal telomeric fragments that retain at least one native genomic trait, such as the methylation pattern, were purified from genomic DNA of maize by fractionation for the size of genomic DNA of maize digested with restriction enzymes that have a short recognition site, on the order of 4 bp or less. The native corn telomeric sequence contains hundreds or thousands of tandem repeats of CCCTAAA on each telomer, this short telomeric tandem repeat has no recognition site for any known restriction enzyme. Any restriction enzymes that recognize and cleave a short sequence that recognize the 2-4 bp sequence can be used, as long as they do not have any specificity for canonical telomeric tandem repeats (CCCTAAA) n. Restriction enzymes that recognize and cut the short sequence digest most of the genomic DNA into small fragments that can be separated from the larger telomeric DNA. By using a combination of two or more restriction enzymes that recognize and cut the short sequence, other non-telomeric DNA fragments can be eliminated, not fragmented by the first enzyme. There are no known restriction enzymes having a recognition site within the canonical tandem telomeric repeat. recognizing and cutting the short sequence, other non-telomeric DNA fragments can be eliminated, not fragmented by the first enzyme. There are no known restriction enzymes having a recognition site within the canonical tandem telomeric repeat. recognizing and cutting the short sequence, other non-telomeric DNA fragments can be eliminated, not fragmented by the first enzyme. There are no known restriction enzymes having a recognition site within the canonical tandem telomeric repeat.

[0195] Mo17 corn genomic corn was digested with the Sau3A restriction enzyme, most of the genomic corn was reduced to very small fragments well below 1 kb, whereas most telomeric DNA fragments were longer than about 15 kb as determined by dot blotting. The overall length of Sau3A telomere DNA segments per haploid genome is approximately 400 kbp, or 0.02% of the total haploid genome of maize. About 1 mg of total genomic corn genome gives about 200 ng of telomeric DNA fragments in the non-digested fraction of the relic. The genomic telomere DNA fraction can be purified from the gel and used to generate DNA constructs for the assembly of the minichromosome.

EXAMPLE 3. Origin of replication [0196] The DNA constructs are modified by means of DNA fragments carrying origins of replication to allow proper replication of the construct and / or the minichromosome in the transgenic nuclei of plant cells. Any origin of replication that functions in a plant cell can be used. The available origins of replication are known and include plant origins of replication and viral origins of replication. Optionally, if the construct is maintained in a non-plant host cell, at least one suitable origin of replication may be included in the construct, e.g. bacterial and / or yeast origin (s) of replication.

A. Non-transcribed 18-26S rDNA region [0197] A well established eukaryotic origin of replication is the non-transcribed 18-26S rDNA region (Ivessa &amp; Zakian (2002) Gen Dev 16: 2459-2464), which is probably functional in plants (Hemandez et al. (1993) EMBO J 12: 1475-85). The 18-26S NTS rDNA DNA sequences can be isolated from a number of different plant species such as Zea mays, Triticum aestivum, Avena sativa, Hordeum vulgare, Arabidopsis thaliana and / or Glycine max. These sequences are cloned into constructs as single or multiple scattered copies. Eukaryotic chromosomes typically have multiple origins of replication, whereby the inclusion of multiple origins of replication in DNA constructs may be useful. Unless otherwise stated,

B. Initiator protein (Rep) from wheat dwarf virus (WDV) [0198] The initiator protein (Rep) from wheat dwarf virus (WDV) and its related origin of replication can be used to generate DNA constructs for minichromosome assembly. The initiator protein (Rep) from wheat dwarf virus (WDV) and its related origin of replication can be used to support the replication of minichromosome constructs in maize cells. The origin of WDV replication can be delivered on a DNA construct (in a cis system), while the genes needed for the Rep protein initiator and RepA stimulating cell cycle can be delivered by cotransformation on independent plasmid constructs (in the trans system) (Sanz-Burgos &amp; Gutierrez) (1998) Virology 243: 119129.).

EXAMPLE 4. Polynucleotides and polypeptides that stimulate growth [0199] Polynucleotides and / or polypeptides that enhance cell growth by promoting cell division, entering S phase, stimulating cell division and / or growing in culture, or improving transformation can be provided before during or after the introduction of DNA constructs containing corn centromeric sequences and / or a subtelomer fragment. Any such composition may be used,

Or a combination thereof, including polynucleotides, polypeptides, and / or other agents, using any suitable method of delivery.

A. Replication of the related protein A.

[0200] A protein A virus depletion of wheat dwarf virus (WDV) may be provided to enhance cell growth and / or recover transgenic events. Both RepA, which has replication activity and modified RepA, which does not support viral replication, can be used. For example, a plasmid carrying the nos :: RepA promoter may be co-delivered to plant cells with a DNA construct. It is expected that transient expression of RepA during the first three days will be sufficient to stimulate cell division and enhance event recovery (see, e.g., WO00 / 50614).

B. Cyclins [0201] Cyclin proteins involved in cell cycle modulation can enhance cell growth and recover transgenic events. For example, cyclin D from corn can stimulate cell division and the growth of callus in culture and improve the transformation of maize. Ectopic expression of E2F induced cell proliferation in Arabidopsis, this effect was amplified by co-expression of DPa (de Veylder et al. (2002) EMBO J 21: 1360-1368). Many cell cycle homologs, including cyclin D, cyclin E, wee1, Rb, Rbr3, E2F / DP and the like, were isolated from plants (US Patent 6,518,487; WO99 / ​​61619; WO00 / 37645; WO02 / 074909; Xie et al. ( 1996) EMBO J 15: 4900-4908) and can be introduced into vectors for delivery to plant cells.

C. Wuschel [0202] Genes that trigger specific developmental pathways are also useful in enhancing cell growth. For example, members of the WOX family, such as Wuschel (WUS), seem to stimulate cell division in both WUS expressing cells and neighboring cells. A construct containing a polynucleotide encoding a WUS polypeptide can be used to stimulate cell division by co-transformation with a DNA construct. Several WUS homologs are known in plants such as Arabidopsis and maize (e.g., Mayer et al. (1998) Cell 95: 805-815; WO01 / 0023575; and US2004 / 0166563) and can be used to enhance the growth of transformed cells. For example, a construct containing the maize WUS gene was constructed:

PHP21139 ubi pro :: ubi 5 'UTR :: ubi intron :: WUS :: pinii

D. Embryo Development Protein 2 [0203] Other genes of interest include those family-related AP2 / ERF transcription factors that are preferentially expressed in developing embryos and seeds, including Embryo Development Protein 2 (ZmODP2)

- which is expressed early in maize embryogenesis. In ectopic expression, ODP2 may stimulate cell growth in a number of tissues, including non-embryonic tissues, which may facilitate the recovery of transgenic events. This family of genes includes the baby boom (BBM, BNM3, ODP2), which has been shown to induce ectopic somatic embryos in plants (Boutilier et al. (2002) Plant Cell 14: 1737-1749). BBM / ODP2 homologs are known, including homologs from maize (WO00 / 75530) and can be provided to plant cells to enhance cell growth. For example, a construct containing the maize ODP2 gene was constructed: PHP21875 ubi pro :: ubi 5 'UTR :: ubi intron :: ODP2 :: pinII

E. Knotted-1 [0204] The homeobox genes, including members of the knox gene family, such as KN1, KNAT1 and STM, function to initiate and / or maintain meristems in plants (Jackson et al. (1994) Dev 120: 405-413 ; Lincoln et al. (1994) Plant Cell 6: 1859-1876; Venglat et al. (2002) Proc Natl Acad Sci USA 99: 4730-4735). Many knox family members are known in plants, including homologs from corn (Vollbrecht &amp; Hake (1991) Nature 350: 241-243; Kerstetter et al. (1994) Plant Cell 6: 1877-1887; Serikawa et al. (1996) ) Plant Mol Biol 32: 673-683) and can be used to construct vectors for delivery to plant cells.

F. Lec1 [0205] Leafy cotyledon genes, such as Lec1 and Lec2, are involved in the regulation of embryogenesis and transcriptional activity in plants (Meinke et al. (1994) Plant Cell 6: 1049-1064; Lotan et al. (1998) Cell 93: 1195-1205; WO00 / 28058; Stone et al. (2001) Proc Natl Acad Sci U.S.A.98: 11806-11811; U.S. Patent 6,492,577). A number of homologues are known that can be used to construct vectors for delivery to plant cells.

G. Combination of Growth-stimulating Polynucleotides [0199] Polynucleotides and / or polypeptides that enhance cell growth by promoting cell division, entering S-phase, stimulating cell division and / or growing in culture or improving transformation can be provided before, during, or after the introduction of DNA constructs comprising centromeric corn sequences and / or a subtelomer fragment. For example, polynucleotides coding for ODP2 corn (PHP21875) and WUS corn (PH121139) may be used in transformative experiments with a DNA construct comprising the maize centromeric region and / or the subtelomeric region. In general, ODP2 and / or WUS in cotransformation by bombardment with immature maize germ particles, as described in Example 6D, showed a significant increase in the frequency of transgenic events,^R and expression of a fluorescent marker protein (DsRed). On average, 1008 events / 4800 primary embryos (21%) were observed after delivery in transformation

- 72 mixture. Without PHP21139 or PHP21875, 8 events / 706 primary embryos were observed (~ 1%). Additional analyzes of transgenic events indicated that the ODP2 and / or WUS constructs introduced by bombardment did not integrate into the genome or assembled minichromosomes.

EXAMPLE 5. Vector Construction [0207] Vectors, either circular or linear, for delivery to plant cells using any standard transformation protocol are constructed using standard molecular biology protocols, see e.g. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Volumes. 1-3. Vectors for the transformation of plant cells are constructed by combining isolated chromosomal elements, optionally with other polynucleotides of interest, using standard techniques. Vectors include those designed to be maintained in a convenient host system, such as E. coli, Agrobacterium or yeast, as well as in plant cells. Typically, the construct further comprises a selective and / or screenable marker, which functions in plant cells, helping in the maintenance, identification and / or selection of plant cells containing the minichromosome construct. In addition, the construct typically contains several unique restriction sites, where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. helping in the maintenance, identification and / or selection of plant cells containing the minichromosome construct. In addition, the construct typically contains several unique restriction sites, where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. helping in the maintenance, identification and / or selection of plant cells containing the minichromosome construct. In addition, the construct typically contains several unique restriction sites, where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. identification and / or selection of plant cells containing the minichromosome construct. In addition, the construct typically contains several unique restriction sites, where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. identification and / or selection of plant cells containing the minichromosome construct. In addition, the construct typically contains several unique restriction sites, where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. where additional polynucleotides of interest can be cloned. The construct may also contain site-directed recombination sites, useful for recombinant cloning, and / or for later targeting and / or modification of the minichromosome. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs. DNA constructs derived from maize BAC clones containing centromeric sequences for the direct delivery or transformation of plants mediated by Agrobacterium are described below. Various components may be provided either on the BAC clone construct and / or on the trans constructs on separate DNA constructs.

A. Markers [0208] A variety of markers can be used to identify transformed cells containing the inserted DNA construct. Visual markers include fluorescent proteins such as AmCyan, ZsYellow or DsRed (ClonTech Laboratories, Inc., Mountain View, CA, USA). Selectable markers include PAT, BAR, GAT and the like.

[0209] An expression cassette, PHP 23715, was constructed for delivery to plant cells, containing a red fluorescent protein (DsRed2) and a PAT selection marker containing the following functionally linked components:

ubi pro :: ubi 5'UTR :: ubi intron :: DsRed2 :: moPAT :: pinll [0210] A DNA construct was constructed, PHP 23714, for delivery to plant cells, containing a blue-green fluorescent protein (AmCyan) containing the following functionally linked components :

ubi pro :: ubi 5'UTR :: ubi intron :: AmCyan1 :: moPAT :: pinll

Agrobacterium vectors [0211] Agrobacterium binary plasmids are made using the hybrid system described by Komari et al. (1996) Plant J 10: 165-174). The pSB11 derivatives are constructed as intermediate T-DNA constructs containing the desired configuration between the T-DNA sequence limits. Plasmid pSB11 was obtained from Japan Tobacco Inc. (Tokyo, Japan). The construction of pSB11 from pSB21 and the construction of pSB21 from start vectors are described in Komari et al. (1996) Plant J 10: 165-174). A description of the integration of the T-DNA plasmid into the pBB1 super binary plasmid by homologous recombination can be found in EP672752 A1. Plasmid pSB1 was also obtained from Japan Tobacco Inc. These plasmids are used for Agrobacterium-mediated transformation after the cointegrating factor in LBA4404. Electrocompetent Agrobacterium cells of LBA4404 strain harboring pSB1 are produced using the protocol as described in Lin (1995) in Methods in Molecular Biology, eds. Nickoloff, JA (Humana Press, Totowa, NJ). Cells and DNA are prepared for electroporation by mixing 1 μl plasmid DNA (100 ng) with 20 μl of competent cells in a Life Technologies cuvette (now Whatman Biometra) with an electrode gap of the order of 0.15 cm (Whatman Biometra # 11608031). Electroporation is performed in the Cell-Porator electroporation device using the impulse control unit (Whatman Biometra # 11604-014) at 330 μF settings with the Voltage Booster (Whatman Biometra # 11612-017) setting at 4 kW. The system delivers about 1.8 kV to cells Agrobacterium.

C. In vitro assembly of linear DNA constructs by ligation [0212] Vectors of the linear DNA construct of the minichromosome are produced by preparing a component of DNA fragments, such as centromeric corn sequences, selection markers (DsRed2 and AmCyan), eukaryotic origin (s) of replication ( ori), telomeric sequences (TEL) and a gene conferring resistance to Bialaphos (PAT) under the control of the ubiquitin promoter (ubi). In one example, linear minichromosome vectors were made from the centromeric BAC clone bacm.pk128.j21 that contains inverted repeats of the CentC tandem arrays surrounding the centromeric repeat CRM1 element. The DNA fragments were generated from bacm.pk128.j21 by digestion with NotI and agarose gel purification. The purified fragment containing the centromeric region was combined with specific fragments after restriction digestion containing selectable marker (s) and origins of replication: ubi pro :: ubi 5 'UTR :: ubi intron :: DsRed :: moPAT-18S-26S rDNA NTS (Notl / Spel) and the cassette of the second selection marker: ubi pro :: ubi 5 'UTR :: ubi intron :: AmCyan :: moPAT (Notl / Smal) and telomeric sequences (Spel / Xhol or Smal / Kpnl) from their constructs. The DNA fragments were prepared so that each fragment contained unique recognition sites for in vitro assembly of a unique linear structure during ligation. The composed linearized vector contains: ubi intron :: AmCyan :: moPAT (Notl / Smal) and telomeric sequences (Spel / Xhol or Smal / Kpnl) from their constructs. The DNA fragments were prepared so that each fragment contained unique recognition sites for in vitro assembly of a unique linear structure during ligation. The composed linearized vector contains: ubi intron :: AmCyan :: moPAT (Notl / Smal) and telomeric sequences (Spel / Xhol or Smal / Kpnl) from their constructs. The DNA fragments were prepared so that each fragment contained unique recognition sites for in vitro assembly of a unique linear structure during ligation. The composed linearized vector contains:

TEL- (Spel) -ubi pro :: ubi 5 'UTR: ubi intron :: AmCyan :: moPAT- (Notl) -bacm.pk128.j21 (Notl) -ori-ubi pro :: ubi 5' UTR :: ubi intron :: DsRed :: moPAT- (Smal) -TEL

D. D. DNA constructs - Circular Modified BAC clone vectors [0213] Any centromeric and / or subtelomeric BAC clone or chromosomal fragment of a clone can be modified by means of additional plant transformation components.

[0214] The EPICENTRE EZ :: TN ™ pNOD ™ 2 MCS transposon system construct system (EpiCentre Madison, WI, USA) is used to modify polynucleotides of interest to existing BAC clones. PMOD-2 is a plasmid-based plasmid with colE1 replication origin and multiple cloning sites (MCS) between hyperactive 19 bp mosaic ends (ME) recognized by EZ-Tn5 transposase. The transposon Tn5-2 randomly integrates into each target DNA, as a result of which each transposition reaction generates a small library of constructs representing different integration sites. DNA preparations of individual modified clones or a group of clones for the transformation of plant cells may be used.

i. Centromeric BAC [0215] Two representatives of CentC BAC alone, bacm.pk018.I13 and bacm2.pk174.o21, were selected on the basis of their restriction enzyme digestion and Southern hybridization patterns. These BAC clones were modified using the EPICENTRE EZ :: TN ™ pMOD ™ -2 MCS engineering system to generate circular DNA constructs for plant transformation and minichromosome assembly.

[0216] MCS was used to introduce a DNA fragment containing selectable markers: ubi pro :: ubi 5 'UTR :: ubi intron :: DsRed :: moPAT with or without 18-26S corn rDNA NTS ori to produce the first version of the transposon construct per order, Tn5-1s. After cloning of the DNA sequences of interest, the transposon was generated by digestion with restriction enzyme PshAl. After integration, the BAC constructs are transformed into E. coli, positive clones selected by colony hybridization with transposon probes, and the DNA is isolated from selected positive clones.

ii. Subtelomeric BAC [0217] Six representative BAC clones were selected from the subtelomeric BAC pool: bacm.pk038.g06, bacm2.pk063.g24, bacm.pk071.c12, bacmpk112.b18, bacm.pk142.b15 and bacm.pk173.e09. New custom-made Tn5-2 transposon constructs containing 18-26S rDNA NTS ori-ubi pro :: ubi 5 'UTR :: ubi intron :: DsRed :: moPAT, Kan gene^r and sites for three different homing restriction enzymes: I-PpoI, I-CeuI and PI-SceI, were created and used to modify the subtelomeric BAC clones. After modification, the BAC constructs are transformed into E. coli, subjected to selection on kanamycin and chloramphenicol, and the DNA is isolated from selected positive clones.

- E. E. DNA constructs - Linearized modified BAC clones [0218] Additional custom-made Tn5-3 transposon constructs were created. These Tn5-3 vectors contain 18-26S rDNA NTS ori-ubi pro :: ubi 5 'UTR :: ubi intron :: DsRed :: moPAT. The constructs also contain the Kan gene^r surrounded by two DNA segments in an inverted orientation, each consisting of two recognition sites for homing restriction enzymes I-CeuI and PI-SceI and telomeric sequences containing telomeric repeat matrices. After cloning of the DNA sequences of interest, the transposon was generated by digestion with restriction enzyme PshAl. After integration, the BAC constructs are transformed into E. coli, subjected to selection on kanamycin and chloramphenicol, and the DNA is isolated from selected positive clones. The recombinant modified BAC DNA is digested in vitro with a self-guiding restriction enzyme (I-CeuI or PI-SceI) converting the circular DNA into a linear DNA construct surrounded by telomeric sequences in the correct orientation and removing the can contains fragment^r (Figure 13).

[0219] Three types of centromeric BAC clones were modified using this Tn5-3 vector:

1. Centromeric BAC clone with inverted blocks of centromeric CentC repeats surrounding the centromeric CRM1 element bacm.pk128.j21, without the CentA or CRM2 sequence;

2. Centromeric BAC clones belonging to the core set of centromeric BAC clones containing all four centromere-specific repeats CentA, CentC, CRM1 and CRM2 (Table 8); and

3. Centromeric BAC clones from maize chromosome (Table 9).

[0220] DNA samples from each BAC clone are fractionated in an agarose gel, and a band containing the linear modified BAC construct is excised. DNA is electroeluted from agarose and is used to transform (via a gene shotgun) Hi-II immature embryos of 8-11 DAP (days after pollination). Optionally, these constructs can be used for microinjecting DNA or converting into Agrobacterium mediated transformation vectors.

TABLE 8

<td>Pool 1</td><td>Pool 2</td><td>Pula 3</td><td>Pool 4</td>

<td>bacm.pk007.a2</td><td>bacm.pk011.l8</td><td>bacm.pk001.n1</td><td>bacm.pk109.h24</td>

<td>bacm.pk036.e13</td><td>bacm.pk012.n20</td><td>bacm.pk023.i5</td><td>bacm.pk039.a3</td>

<td>bacm.pk066.j 14</td><td>bacm.pk013.m8</td><td>bacm.pk043.o23</td><td>bacm.pk039.m16</td>

<td>bacm.pk075.16</td><td>bacm.pk062.c14</td><td>bacm.pk051.g11</td><td>bacm.pk041.e16</td>

<td>bacm.pk076.m3</td><td>bacm.pk064.n1</td><td>bacm.pk056.j 19</td><td>bacm.pk077.b21</td>

<td>bacm.pk119.a23</td><td>bacm.pk068.p16</td><td>bacm.pk076.o15</td><td>bacm.pk079.m11</td>

<td>bacm.pk133.b10a</td><td>bacm.pk070.h17</td><td>bacm.pk087.m4</td><td>bacm.pk085.k5</td>

<td>bacm.pk133.b10b</td><td>bacm.pk090.o5</td><td>bacm.pk089.18</td><td>bacm.pk098.h2</td>

<td>bacm.pk133.b11</td><td>bacm.pk098.fi</td><td>bacm.pk093.d8</td><td>bacm.pk102.i4</td>

<td>bacm.pk135.i6</td><td>bacm.pk135.17</td><td>bacm.pk106.j20</td><td>bacm.pk112.p1</td>

<td>bacm.pk178.c10</td><td>bacm2.pk002.g7</td><td>bacm.pk129.a4</td><td>bacm.pk124.j24</td>

<td>bacm2.pk023.e24</td><td>bacm2.pk003.g6</td><td>bacm.pk134.f15</td><td>bacm.pk143.m18</td>

<td>bacm2.pk064.e15</td><td>bacm2.pk012.g19</td><td>bacm.pk135.j2</td><td>bacm.pk148.e2</td>

<td>bacm2.pk066.m12</td><td>bacm2.pk013.c9</td><td>bacm.pk138.e14</td><td>bacm.pk156.i17</td>

<td>bacm2.pk083.a2</td><td>bacm2.pk034.g20</td><td>bacm.pk141.j4</td><td>bacm.pk164.b11</td>

<td>bacm2.pk093.h11</td><td>bacm2.pk053.g23</td><td>bacm.pk161.h1</td><td>bacm.pk166.n7</td>

<td>bacm2.pk099.m24</td><td>bacm2.pk070.g7</td><td>bacm.pk164.e18</td><td>bacm.pk178.o20</td>

<td>bacm2.pk116.g16</td><td>bacm2.pk094.f14</td><td>bacm.pk179.d4</td><td>bacm2.pk034.j8</td>

<td>bacm2.pk174.e4</td><td>bacm2.pk096.d23</td><td>bacm2.pk130.e20</td><td>bacm2.pk075.n6</td>

<td>bacm2.pk179.b18</td><td>bacm2.pk100.j24</td><td>bacm2.pk137.fi</td><td>bacm2.pk115.o22</td>

<td>bacm2.pk179.e1</td><td>bacm2.pk179.014</td><td>bacm2.pk158.f12</td><td>bacm2.pk169.a21</td>

TABLE 9

<td>4-B73 chromosome specific B73 pot</td><td>4-Chromosome-specific pot Mo17</td>

<td>baccpk0143i9</td><td>bacm.pk010m7</td>

<td>bacbpk0155h15</td><td>bacm.pk108h15</td>

<td>bacbpk0424d20</td><td>bacm.pk184c21</td>

F. DNA Constructs - Modified Multiple Combinations of BAC Vectors [0221] Centromeric BAC clones belonging to the core set of centromeric BAC clones containing all four centromere-specific repeats CentA, CentC, CRM1 and CRM2 (Table 8) were also modified with the tn5-2 vector . Tn5-2 constructs containing ori-ubi pro :: ubi 5 'UTR :: ubi intron :: DsRed2 :: moPAT, Kan gene^r and sites for the three homing restriction enzymes: I-Ppol, I-Ceul and PI-Scel. Modified BACs were cleaved with restriction enzymes I-Ceul and PI-Scel, separated by means of gel electrophoresis in the pulsatile field (PFGE) under standard conditions: 1% agarose, 1X TAE, initial pulse 5 sec, final pulse 10 sec,

- 77 total analysis time 12 hours w12 ° C. Large fragments were purified and ligated to form multimeric DNA constructs up to 1 Mpz in length.

EXAMPLE 6: Transformation of plants [0222] Any suitable method for transforming plants may be used. Similarly, any plant cell and / or tissue that can be transformed, cultured and / or regenerated into a plant can be used. These plant cells and tissues as well as nutrient media and culture conditions, appropriate transformation methods and medium and regeneration conditions are well known.

A. Cell Types [0223] Several types of maize cells were evaluated for their potential as targets for minichromosome generation and construct delivery, including Black Mexican Sweet suspension cells (BMS), meristem cells, zygote, cotyledon cells in immature embryo, cells in cultured somatic embryos, central cells and early endosperm cells. There are methods for producing haploid embryos by crossing a given genotype with a RWS line or other induction line. Haploid immature embryos could be a good target for delivery of the minichromosome, either to cotyledon cells 10-12 days after pollination (DAP) or to exposed apical meristems at the cilpyclo (7-8 DAP) stage. Important comparisons of the behaviors of the introduced minichromosomes could be made to diploid or haploid environments, moreover, if after introducing the minichromosome a chemically induced chromosome duplication (e.g., colchicine or nitrous oxide) occurs, these doubled-haploid embryos can be quickly regenerated to form an inbred line containing minichromosome. All mentioned diploid and haploid cell types can be converted to suspension cultures and / or protoplasts, or fixed suspension cultures such as BMS are suitable and can be used for transformation. Suspension cells and / or protoplasts can provide easy accessibility and optical clarity for monitoring upon delivery of the DNA construct. Any suitable method can be used to deliver a plant protoplast culture construct, including standard direct methods of electroporation and PEG mediated delivery, see e.g. Ch. 8, pp. 189-253 in Advances in Cellular and Molecular Biology of Plants, Vol. 5, Ed. Vasil, Kluwer Acad Publ (Dordrecht, The Netherlands) 1999.

B. Microinjection into corn [0224] Any suitable method for microinjection into plant cells, tissues and / or embryos can be used. In addition, any composition or combination / mixture of compositions may be injected, including polynucleotides, polypeptides, co-factors, chemical agents, adjuvants, and the like. Direct delivery to a zygote provides the opportunity to produce a transgenic plant without intermediate steps in tissue culture and regeneration. For example, microinjection into corn may be substantially made as described in US Patent No. 6,300,543. Briefly, immature seeds

- 78 maize are cut to obtain nucleolar plaques containing an embryo sac that is the target for delivery by microinjection of the transformation composition. After microinjection, the embryo sacs are cultured in appropriate media for the propagation and regeneration of plants.

C. Agrobacterium mediated transformation [0225] Agrobacterium mediated transformation of maize is essentially performed as described in Zhao (WO98 / 32326). Briefly, immature embryos are isolated from the germs of the corn and the embryos are contacted with an Agrobacterium suspension containing T-DNA, wherein the bacteria are capable of transferring the DNA construct to at least one cell of at least one immature embryo. Optionally, the target tissue may be co-transformed with multiple Agrobacterium lines containing T-DNA with various DNA constructs and / or polynucleotides of interest.

Stage 1: Infection stage. Immature embryos are dipped in an Agrobacterium suspension to initiate inoculation.

Stage 2: Co-cultivation stage. The embryos are subject to co-cultivation with Agrobacterium for some time.

Stage 3: Resting phase. Optionally, after co-cultivation, a resting phase can be performed. Immature embryos are grown on solid medium with an antibiotic, but without a selective agent, to eliminate Agrobacterium and to provide a resting phase to the infected cells.

Stage 4: Selection stage. The inoculated embryos are cultured on a medium containing the selective agent and the growing transformed callus is recovered. Immature embryos are grown on a solid medium with a selective agent, which leads to the selective growth of transformed cells.

Stage 5: The regeneration stage. Calli grown on selective medium are grown on solid medium for plant regeneration.

D. Maize bombardment with particles [0226] Immature corn seeds are bombarded with a circular or linear DNA construct containing an isolated corn centromeric sequence and optionally a subtelomeric region (s), replication origin (s), recombination docking sites , a polypeptide (s) and / or markers, e.g. a selectable marker gene such as PAT (Wohlleben et al. (1988) Gene 70: 25-37) which confers resistance to a Bialaphos herbicide, or another suitable selection marker or suitable for screening marker (s) such as RFP and / or CFP. The construct may also contain other marker genes, or be co-transformed with additional polynucleotide constructs containing markers. The transformation is essentially as follows.

[0227] Immature maize corn on 8-11 DAP is surface sterilized in a 30% bleach solution, plus 0.5% Micro detergent for 20 minutes and rinsed twice with sterile water. Immature embryos are cut out, placed on the side of the axis

- embryo downwards (cotyledon side up), 50 embryos per plate, on 560L medium for 1-3 days at 26 ° C in the dark. Before the transformation, the immature embryos are transferred to 560Y medium for 4 hours and then placed within the 2.5-cm target zone, in preparation for the bombardment.

[0228] DNA is precipitated at 0.6 mm (mean diameter) golden granules using a water soluble cationic Tfx ™ 50 lipid (Cat # E1811, Promega, Madison, WI, USA) as follows: prepare the DNA solution on ice using using 1 gg of corn centromeric DNA construct (10 g); optionally other co-banding constructs, such as 50 ng (0.5 g) of PHP21875 (BBM) and 50 ng (0.5 g) of PHP21139 (WUS); mix the DNA solution. Add 20 g of prepared gold particles (15 mg / ml) in water to the premixed DNA; 10 gl Tfx-50 in water; mix thoroughly. This can be stored on ice during the preparation of macrocarriers, typically about 10 min. Spin the gold particles in the microcentrifuge at 10,000 rpm for 1 minute, remove the supernatant. Thoroughly wash the granules with 100 ml 100% EtOH without resuspending the granules, remove the irritating EtOH thoroughly. Add 20 g 100% EtOH and carefully suspend the particles again by short sonication, glue on the center of each macrocarrier and dry about 2 minutes before bombardment.

[0229] The target maize germ target plates are bombarded twice per plate using about 0.5 gg of DNA per shot using a Bio-Rad PDS1000 / He device (Bio-Rad Laboratories, Hercules, CA) with 450 PSI burst pressure, negative pressure 27 -28 inches Hg and a particle flight distance of 8.5 cm.

[0230] After bombardment, the embryos are transferred to solid medium 560P, kept in the dark at 26 ° C for 4-6 days, then transferred to 560R selection medium containing 3 mg / L Bialaphos and passaged every 2 weeks. After about 10 weeks of selection, selection-resistant callus clones are transferred to 288J medium to initiate plant regeneration. After maturation of somatic embryos (2-4 weeks), well-developed somatic embryos are transferred to 272V germination medium and transferred to an illuminated breeding room. Approximately 7-10 days later, the developing plants are transferred to 272V hormone-free medium, in test tubes, for 7-10 days until the plants stabilize well. Plants are then moved into inserts in flat containers (equivalent to pot 2,

D. Soy particle bombardment [0231] A polynucleotide, a mixture of polynucleotides, and optionally, a polypeptide (s), can be introduced into embryonic soy suspension cultures by particle bombardment using essentially the methods described in Parrott et al. (1989) Plant Cell Rep 7: 615617. This method, with modifications, is described below.

[0232] The seed is removed from the immature pods and cotyledons shorter than 4 mm in length are selected. The seeds are sterilized for 15 minutes at 0.5% v / v. bleach solution and then rinsed with sterile distilled water. Immature cotyledons are cut, first by cutting off a part of the seed that contains the germ axis.

- 80 Kotyledons are then removed from the seed coat by gently pushing the distal end of the seed with the blunt end of the scalpel blade. The cotyledons are then placed on Petri dishes (flat side up) with the SB1 initiating medium. Petri dishes are incubated with light (16 hrs day, 75-80 μΕ) at 26 ° C. After 4 weeks of incubation, the cotyledons are transferred to fresh SB1 medium. After an additional two weeks, spherical somatic embryos that present proliferation areas are excised and transferred to FN Lite liquid media (Samoylov et al. (1998) In Vitro Cell Dev Biol Plant 34: 8-13). About 10 to 12 small clusters of somatic embryos are placed in 250 ml flasks containing 35 ml of SB172 medium. Embryonic soybean cultures are maintained in 35 ml of liquid media on a 150 rpm rotary shaker, at 26 ° C with fluorescent lighting (20 μΕ) with a schedule of 16: 8 hours day / night. The cultures are passaged every two weeks by inoculating about 35 mg of tissue into 35 ml of liquid medium.

[0233] Embryonic soybean cultures are then transformed using particle bombardment (Klein et al (1987) Nature 327: 70; US Patent 4,945,050). BioRad Biolistica PDS1000 / HE can be used for these transformations. A selectable marker gene may be used to facilitate soy transformation, e.g. an expression cassette containing the 35S promoter from cauliflower mosaic virus (Odell et al. (1985) Nature 313: 810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz et al. (1983) Gene 25: 179-188) and 3 'region of the nopaline synthase gene from the T-DNA of Agrobacterium tumefaciens plasmid Ti.

[0234] Up to 50 μl of 60 mg / ml 1 μl of the gold particle suspension are added (in succession): 5 μl DNA (1 μg / μl), 20 μl spermidine (0.1 M) and 50 μl CaC1₂ (2.5 M). The particle preparation is shaken for three minutes, microcentrifuged for 10 seconds and the supernatant removed. The DNA-coated particles are washed once in 400 μl 70% ethanol and then resuspended in 40 μl of anhydrous ethanol. The DNA / particle suspension is sonicated three times, each time in a second. Five μl of gold-plated gold particles are then loaded onto each of the macrocarrier discs.

[0235] Approximately 300-400 mg of a biweekly suspension culture are placed in an empty 60 x 15 mm Petri dish and the liquid is removed from the tissue with a pipette. The bursting pressure of the membrane is set to 1100 psi and sets a negative pressure in the chamber, on the order of 28 inches of mercury. The tissue is placed approximately 8 cm from the stopping screen and is bombarded three times. After the bombardment, the tissue is divided into half and placed in two separate flasks with 35 ml FN Lite medium per flask.

[0236] Five to seven days after bombardment, liquid medium was replaced with fresh medium. Eleven days after bombardment, the medium was replaced with fresh, containing 50 mg / ml hygromycin. This selection medium was refreshed weekly. Seven to eight weeks after the bombardment, the growth of green transformed tissue from untransformed, necrotic embryonic centers was observed. The isolated green tissue was removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryonic suspension cultures. Each new line was treated as an independent transformation event. These suspensions are

- 81 then divided into smaller cultures and maintained as clusters of immature embryos, or the tissue is regenerated into whole plants by maturing and germination of individual embryos.

[0237] For the purpose of regeneration, the events are removed from the liquid culture and the maturation process begins on a solid medium. Embryogenic clusters are removed from liquid SB196, transferred to sterile filter paper and placed on SB166 agar solid medium for 1-2 weeks. Clots of tissue are smashed or gently crushed with a spatula spoon. About 10-20 clots of tissue with a diameter of about 4-5 mm is carried out as a derivative culture for 3 weeks on SB103 or SB148 medium to generate embryos. Embryos are grown for 4-6 weeks at 26 ° C under fluorescent lights with cold white light and Agro bulbs (40 watts) with photoperiod 16: 8 hours, with a light intensity of 90120 μE / m2s. After 4-6 weeks of maturation, individual embryos are dried by placing in sterile Petri dishes (60 x 25 mm) sealed with fiber tape, or placed in a plastic box (without fiber tape) for 4-7 days. The dried seeds were planted in solid SB71-4 medium either in a ventilated round culture vessel (RCV) or in 100 x 25 mm petri dishes and sprouted at 26 ° C under cold white fluorescent lights and Agro bulbs (40 watts) with photoperiod 16: 8 hours, with a light intensity of 90-120 μE / m2s, to obtain plants. The plants were planted on collection trays and placed in an incubator under conditions of 16 hours. photoperiod, temperatures 26 ° C / 24 ° C day / night for about 2 weeks before transfer to soil, for seed production. The dried seeds were planted in solid SB71-4 medium either in a ventilated round culture vessel (RCV) or in 100 x 25 mm petri dishes and sprouted at 26 ° C under cold white fluorescent lights and Agro bulbs (40 watts) with photoperiod 16: 8 hours, with a light intensity of 90-120 μE / m2s, to obtain plants. The plants were planted on collection trays and placed in an incubator under conditions of 16 hours. photoperiod, temperatures 26 ° C / 24 ° C day / night for about 2 weeks before transfer to soil, for seed production. The dried seeds were planted in solid SB71-4 medium either in a ventilated round culture vessel (RCV) or in 100 x 25 mm petri dishes and sprouted at 26 ° C under cold white fluorescent lights and Agro bulbs (40 watts) with photoperiod 16: 8 hours, with a light intensity of 90-120 μE / m2s, to obtain plants. The plants were planted on collection trays and placed in an incubator under conditions of 16 hours. photoperiod, temperatures 26 ° C / 24 ° C day / night for about 2 weeks before transfer to soil, for seed production.

F. Media for Plant Cell Cultures [0238] The 560L medium contains 4.0 g / L of N6 basal salts (Sigma C-1416), 1.0 mL / L of Eriksson vitamins mixture (1000X Sigma 1511), 0.5 mg / L thiamine HCl, 20 g / L sucrose, 1.0 mg / L 2.4-D and 2.88 g / L L-proline (adjusted to a volume of DI H 2 O after adjusting to pH 5.8 with KOH); 2.0 g / l Gelrite® (added after bringing to volume with DI H 2 O); and 8.5 mg / L silver nitrate (added after sterilizing the medium and cooling to room temperature).

[0239] The 560P medium contains 4.0 g / L of N6 basal salts (Sigma C-1416), 1.0 mL / L of Eriksson vitamins (1000X Sigma 1511), 0.5 mg / L of thiamine HCl, 30 g / L sucrose, 2.0 mg / L 2,4-D and 0.69 g / L L-proline (adjusted to volume with DI H 2 O after adjusting pH 5.8 with KOH); 3.0 g / L Gelrite® (added after bringing to volume with DI H2O); and 0.85 mg / L silver nitrate (added after sterilizing the medium and cooling to room temperature).

[0240] The 560Y medium contains 4.0 g / L of N6 basic salt (Sigma C-1416), 1.0 mL / L of Eriksson vitamins (1000X Sigma 1511), 0.5 mg / L of thiamine HCl, 120 g / L sucrose, 1.0 mg / L 2,4-D and 2.88 g / L L-proline (adjusted to volume with DI H 2 O after adjusting pH 5.8 with KOH); 2.0 g / l Gelrite® (added after bringing to volume with DI H 2 O); and 8.5 mg / L silver nitrate (added after sterilizing the medium and cooling to room temperature).

[0241] The 560R medium contains 4.0 g / L of N6 basic salt (Sigma C-1416), 1.0 mL / L of Eriksson vitamins (1000X Sigma 1511), 0.5 mg / L of thiamine HCl, 30 g l sucrose, 2.0 mg / L 2,4-D (adjusted to volume with DI H 2 O after adjusting pH 5.8 with KOH); 3.0 g / l Gelrite (added after bringing to volume with DI H 2 O); and 0.85 mg / L silver nitrate and 3.0 mg / L bialaphos (added after sterilizing the medium and cooling to room temperature).

[0242] The 288J medium contains: 4.3 g / l MS salt (Gibco 11117-074), 5.0 ml / l MS vitamins from the stock solution (0.100 g / l of nicotinic acid, 0.02 g / l thiamine HCl, 0.10 g / l pyridoxine HCl and 0.40 g / l glycine were brought to a volume of DI H2O) (Murashige &amp; Skoog (1962) Physiol Plant, 15: 473), 100 mg / L myoinositol, 0.5 mg / L Zeatin , 60 g / L sucrose and 1.0 mL / L of 0.1 mM abscisic acid (adjusted to a volume of DI H 2 O after adjusting to pH 5.6); 3.0 g / l Gelrite (added after bringing to volume with DI H 2 O); and 1.0 mg / L indole acetic acid and 3.0 mg / L bialaphos (added after sterilizing the medium and cooling to 60 ° C).

[0243] The 272V medium contains: 4.3 g / l of MS salt (Gibco 11117-074), 5.0 ml / l of MS vitamins from the stock solution (0.100 g / l of nicotinic acid, 0.02 g / l of thiamine HCl, 0.10 g / l pyridoxine HCl and 0.40 g / l glycine were brought to a volume of DI H 2 O) 0.1 g / l myoinositol, 40.0 g / l sucrose (adjusted to volume with DI H 2 O after adjusting to pH 5.6) ; and 8.0 g / L bactoagar (added after bringing to volume with DI H 2 O); sterilized and cooled to 60 ° C.

[0244] SB1 medium contains MS salts (Gibco / BRL - Cat # 11117-066, 1 pk / L), B5 basic vitamin solution 1 ml / l, 20 mg / l 2,4-D, 31.5 g / l sucrose, 8 g / l TC Agar, pH 5.8 [0245] A stock solution of 1000X B5 vitamins contains 10 g myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCl, 1 g thiamine, DI H 2 O to 100 ml, separated into portions and stored at -20 ° C.

G. DNA Isolation from callus and leaf tissues [0246] The putative transformation events can be screened for the presence of the transgene. Genomic DNA can be extracted from calli, leaf or other tissue using plant nucleus separation, lysis and HMW purification or alternatively using the CTAB modification method (cetyltriethylammonium bromide, Sigma H5882) described by Stacey &amp; Isaac (1994 in Methods in Molecular Biology Vol. 28 , pp. 9-15, Ed. PG Isaac, Humana Press, Totowa, NJ). About 100-200 mg of frozen tissue is triturated in liquid nitrogen and homogenized in 1 ml of CTAB extraction buffer (2% CTAB, 0.02 M EDTA, 0.1 M Tris HCl pH 8, 1.4 M NaCl, 25 mM DTT) for 30 min at 65 ° C. The homogenised samples were allowed to cool at room temperature for 15 min before performing single protein extraction of about 1 ml 24: 1 v / v. chloroform: octanol. Samples were centrifuged for 7 min at 13,000 rpm, and the top layer of the supernatant was collected using pipette tips with a wide mouth. The DNA was precipitated from the supernatant by incubation in 95% ethanol on ice for 1 h. The DNA strands were wound onto a glass hook, washed in 75% ethanol containing 0.2 M sodium acetate for 10 min, air dried for 5 min and resuspended in TE buffer. Five μl RNAse A was added to the samples and incubated at 37 ° C for 1 hour. In order to The DNA was precipitated from the supernatant by incubation in 95% ethanol on ice for 1 h. The DNA strands were wound onto a glass hook, washed in 75% ethanol containing 0.2 M sodium acetate for 10 min, air dried for 5 min and resuspended in TE buffer. Five μl RNAse A was added to the samples and incubated at 37 ° C for 1 hour. In order to The DNA was precipitated from the supernatant by incubation in 95% ethanol on ice for 1 h. The DNA strands were wound onto a glass hook, washed in 75% ethanol containing 0.2 M sodium acetate for 10 min, air dried for 5 min and resuspended in TE buffer. Five μl RNAse A was added to the samples and incubated at 37 ° C for 1 hour. In order to

- quantification of genomic DNA was performed by gel electrophoresis using a 0.8% agarose gel in 1x TBE buffer. One microlitre of each sample was fractionated along 200, 400, 600 and 800 ng μl-1 of unlabeled DNA markers.

EXAMPLE 7. Transformation Results [0247] Immature Hi-II maize germs, in 8-11 DAP, were transformed by particle bombardment, essentially as described in Example 6D. Together with the modified BAC DNA constructs, the embryos were co-transformed with the ODP2, WUS and / or ODP2 + WUS vectors. Two weeks after the bombardment, the transformed cells proliferated to form embryogenic callus with numerous somatic embryos. Some of these somatic embryos expressed the DsRed2 fluorescent marker gene that demonstrated stable inheritance. Individual somatic embryos were excised and propagated as independent transgenic events on Bialaphos selection media. Clonally propagated callus culture was created from each event.

[0248] Primary screening of each transforming event by FISH was performed. Individual somatic embryos were used to make chromosomal spreads for FISH as described in Example 8. Each event was characterized using separate FISH probes for the mo-PAT / DsRed2 marker (PHP23715) and tandem centromeric CentC repeats to detect inheritance, respectively, transgenic marker and centromeric DNA sequence.

[0249] After primary screening, selected transformation events of interest were transferred to regeneration media to form plants that were eventually transferred to the soil to recover the plants. After the growth period, the selected plants were screened a second time using FISH analysis on crushed root tips to confirm inheritance again.

A. Cotransformation Experiments Collected in BAC Pools [0250] Embryos were co-transformed with pools of DNA constructs. These pools can contain combinations of DNA constructs derived from BAC clones containing maize centromeric repeats, DNA constructs derived from BAC clones containing telomeric and / or subtelomeric DNA segments, the plasmid PHP23715 visual marker and plasmids with polynucleotides encoding the stimulating protein growth: embryo development protein -2, ODP-2 (PHP21875) and Wushel (PHP21139). DNA constructs derived from centromeric BAC clones include BAC clones having only CentC, exclusively CRM2, only CentC and CRM2 and core BACs having all four centromere repeats CentA, CentC, CRM1 and CRM2.

[0251] FISH analysis of 80 transformed calluses collected in BAC pools containing centromeric DNA revealed cytogenetically detectable events of new CentC clusters in addition to normal centromeric sites. In some cases, maize centromeric elements used for transformation

- 84 were inserted into the native chromosomes, which resulted in the creation of dicentric structures. These insertions of centromeric DNA sequences differed in size (number of repeats), number of insertions per chromosome (up to 3 detectable in a single chromosome) and number of chromosomes with insertions (up to 4 chromosomes with at least one insertion) and all insertions co-located with the plasmid probe RFP marker. This indicates that exogenous DNA fragments can be combined into large blocks and integrated into the chromosome of the corn.

B. Transformation with DNA constructs of the linear prototype minichromosome, assembled by in vitro ligation of a centromeric BAC clone, telomere sequence and marker sequence.

[0252] BAC clone Mo17, bacm.pk128.j21 was identified with the reverse orientation of CentC tandem repeats as described in Example 1D. Telomeric sequences were generated by PCR amplification of telomere oligonucleotides and cloned in a plasmid vector. A linear DNA construct was generated from this BAC clone by in vitro assembly with selectable markers (moPAT, AmCyan1, DsRed2), an origin of replication (ori) of 18-26S NTS rRNA and telomeric sequences (TEL). Each piece of DNA had recognition sites that made it possible to assemble a unique structure after ligation. The complex linearized construct contains: TEL- (Spel) -ubi pro :: ubi 5 'UTR :: ubi intron :: AmCyan :: moPAT- (Notl) -bacm.pk. 128J21- (Notl) -ori-ubi pro :: ubi 5 'UTR :: ubi intron :: DsRed :: moPAT- (Smal) -TEL [0253] The entire ligation mixture containing the composite construct, as well as ligation by-products, were delivered to immature Hi-II embryos by transformation using a gene gun. Over two hundred events were promoted as individual callus clones, based on selection with fluorescent and selection marker (PAT). Three groups of clones were recovered: those that showed only red (72), only blue (83) or both (137) fluorescent markers. Events expressing both markers were selected for additional FISH analysis. only blue (83) or both (137) fluorescent markers. Events expressing both markers were selected for additional FISH analysis. only blue (83) or both (137) fluorescent markers. Events expressing both markers were selected for additional FISH analysis.

[0254] In addition to the simple integration event, a number of multiple integration events were observed, either on the same chromosome or in different chromosomes. In two events, chromosome rearrangements were observed. Additional centromere replication insertion sites CentC co-localized with a marker - probe PHP23715 suggesting the possible creation of a dicentric chromosome. Analysis of dividing cells in anaphase showed chromosomal bridges, consistent with the presence of dicentric chromosomes with two functional centromere, due to the integration of the exogenous centromeric CentC DNA sequences. The centromeric function is indicated by the formation of dicentric chromosomes, the appearance of chromosomal bridges in anaphases and the induction of chromosomal cracking. These results indicate

[0255] One event showed chromosome 6 after rearrangement, having two insertion sites of the centromeric DNA construct near the core organization region (NOR),

- as well as one additional minichromosome-like structure with one large centromeric region and one additional small insertion site of the centromeric DNA construct. Cytology of this event may be an indication of chromosomal cracking due to the formation of a dicentric chromosome.

C. Transformation with linearized modified pooled BAC clones. [0256] Several BAC clones were modified with the custom-made Tn5-3 transposon using the transposase system (EPICENTRE EZ :: TN ™ pMOD ™ -2 MCS transposon vector construction system (EpiCentre, Madison) , WI, USA)) essentially as described in Example 5E. They were linearized and used for transformation via the gene gun of immature HiII corn embryos:

1. Seven different variants of the modified bacm.pk128.j21 clone with inverted bits of CentC centromeric repeats representing the various transposase-generated insertions into the same BAC clone were pooled;

2. 84 modified centromeric core sets of BAC clones were combined to generate 4 pools with 21 individual variants each (Table 8). Each of the four pools was used individually to be transformed by means of a gene gun;

3. Modified centromeric BAC clones from chromosome 4 were divided into 2 pools containing three BAC clones of B73 and three BAC clones of Mo17 (Table 9); and

4. Pool 1 of Table 8 was divided into 4 lower order pools with 5 or 6 modified centromeric sets of core BAC clones (Table 10). Each of the lower-order pools were used individually for transformation by means of a gene gun.

TABLE 10

<td>Lower-order pool 1.1</td><td>Poorer pool 1.2</td><td>Lower-order pool 1.3</td><td>Poorer row 1.4</td>

<td>bacm.pk007.a2</td><td>bacm.pk133.b10</td><td>bacm.pk119.a23</td><td>bacm.pk075.l6</td>

<td>bacm.pk036.e13</td><td>bacm.pk077.k5</td><td>bacm2.pk174.e4</td><td>bacm.pk0066.j 14</td>

<td>bacm.pk178.c10</td><td>bacm2.pk179.b18</td><td>bacm2.pk116.g16</td><td>bacm2.pk099.m24</td>

<td>bacm2.pk179.e1</td><td>bacm.pk0133.b11</td><td>bacm2.pk023.e24</td><td>bacm2.pk093.h11</td>

<td>bacm2.pk064.e15</td><td>bacm2.pk066.m12</td><td>bacm.pk135.16</td><td>bacm2.pk083.a2</td>

<td></td><td></td><td></td><td>bacm.pk076.m3</td>

For each of the above examples, immature Hi-II embryos were co-transformed with ODP2, WUS and / or ODP2 + WUS expression vectors and modified BAC pools.

[0257] Several different classes of integration events were found when linearized modified constructs from BAC clones were used for transformation. For example, when using BAC constructs containing inverted blocks of centromeric CentC repeats (bacm.pk128.j21) or modified pools or lower-order pools of a set of core BAC clones for transformation:

1. Single integrations into the euchromatic regions of the host chromosome;

2. Numerous integration into the euchromatic regions of the host chromosome;

3. Single integration into the centromeric region of the host chromosome;

4. Numerous integration into the centromeric regions of host chromosomes;

5. Integrations that resulted in chromosome breakage, such as new unusual variants of maize chromosomes with reduced chromosomal arms or the duplication of certain chromosomal regions, e.g. chromosome 6 with two NORs, or the formation of a dicentric chromosome;

6. Local amplification of marker and centromeric constructs after integration;

7. Amplification of marker and centromeric constructs into extra chromosomal segments of chromatin in some cells;

8. The creation of new minichromosomes having a functional centromere similar to native chromosomes, for example, autonomous segregation in mitosis.

[0258] These observations indicate that the modified centromere BAC clone bacm.pk128.j21 and the modified core set of pooled BAC clones are capable of inducing a series of cytogenetic effects, such as dicentric chromosome formation, chromosomal cracking, local transgenic amplification and formation of elements extrachromosomal, i.e., minichromosomes. [0259] Successful minichromosome events resulting from the modification of a single BAC or pool of BAC-specific engineer construct Tn5-3 and their subsequent linearization to a linear transformation construct are described below:

1) pool 1 of a core set specific for a BAC centromere (Table 8) or pools of a lower order pool 1 (Table 10);

2) pool 3 of the core set specific for the BAC centromere (Table 8);

3) a single BAC clone, bacm.pk128.j21, with reversed CentC repeats; and

4) three centromere specific clones BAC B73 chromosome 4 (Table 9).

[0260] The first maize minichromosome event (CMC3 pool 1 event # 14) was found between events generated by transformation via a gene shotgun modified with linearized Tn5-3 core set BAC pool 1 (Table 8). On selection media, the actively growing embryogenic callus expressed the visual marker dsRed2. FISH analysis during the metaphase stage showed 0, 1, 2, or 3 additional minichromosomes having different forms and sizes (Figures 1-4). In this event, 60 out of 80 analyzed nuclei had 1, 2 or 3

- 87 minichromosomes with a normal complement of 20 native chromosomes. These artificial chromosomes varied in size, from about 20% to about 50% of the average native corn chromosome, as measured in metaphase. Initial prometaphase measurements show relatively small unmodified minichromosomes, whereas native chromosomes are about 4-5 times longer, with the result that the minichromosomes measured at this stage account for about 5% to about 15% of the average native prometaphase corn chromosome. As determined by FISH, minichromosomes are usually composed of centromeric repeats and Tn5-3 components. Several examples of the formation of a chromosome ring with a more complex organization have also been observed. These newly formed minichromosomes are apparently capable of replication and segregation during mitosis (Figure 4), however, segregation is not perfect and sometimes the nondysjunction was observed, which led to the formation of cells with a change in the number of minichromosomes. Callus CMC3 pool 1 event # 14 was maintained in the active growth phase, with selection for at least 10 months, sampling at various time points and analyzed by FISH, to demonstrate stable maintenance of the minichromosome for many rounds of mitotic cell division. This event, CMC3 pool 1 event # 14, was also analyzed by FISH for the presence of telomeres using overgo telo-31 probes (SEQ ID NOS: 192 &amp; 193) using callus metaphase nuclei. Two to four positive telo-31 fusions were observed on each minichromosome, with the two observed foci representing 4 separate foci, which can not be distinguished at this resolution. The intensity of the telo-31 signal was generally weaker on the minichromosome compared to the signal observed for the native chromosomes in each sample. Plants were regenerated from this event, and their tops were analyzed by FISH to determine whether minichromosome (s) are inherited, through subsequent mitotic divisions in the greenhouse environment. Five of the 19 plants regenerated from this transformation event showed the presence of the minichromosome (s). Four plants had a high incidence of nuclei with a single minichromosome plus a normal complement of 20 native chromosomes. The fifth plant had the majority of nuclei with 1, 2 or 3 minichromosomes plus a normal complement of 20 native chromosomes.

Next, the modified BAC core pool set 1 was further divided into four lower order pools having 5-6 modified sets of core BAC clones (Table 10). FISH analyzes showed the presence of minichromosome (s) in the callus of the germ, generated by lower order pools of 1.1 and 1.3. Two minichromosome events were generated from a lower order pool of 1.1: the first event had a normal complement of 20 chromosomes, plus 1 minichromosome that did not hybridize to the marker PHP23715 or CentC at a detectable level; the second event showed 24-28 chromosomes, 3 copies of chromosome 6 and 1 minichromosome. Based on FISH observations, this minichromosome was positive for CentC, but was not consistently positive for the PHP23715 probe. This event could have been created by integrating and cracking native

- 88 chromosome and / or conditions generated by or resulting from aneuploidy. Pools of lower order 1.3 gave 5 events. Three of the five events appeared to be a de novo minichromosome and had a normal complement of 20 chromosomes, plus 1 minichromosome, and the minichromosomes were positive for the marker PHP23715 and CentC in the FISH analysis of primary callus events in metaphase. One of these events, the CMC3 sub-level 1.3 event # 27, was further analyzed by FISH for the presence of telomeres using overgo telo-31 probes (SEQ ID NOS: 192 &amp; 193) using callus metaphase nuclei. This event had a very small minichromosome with two strong CentC foci and two telo-31 foci on each minichromosome. The two observed telo-31 foci can represent 4 separate foci, which can not be distinguished at this resolution. This event had smaller minichromosome than was observed in earlier events. When measured in metaphase, the minichromosome was about 0.5 to 1 micron in length, i.e. from about one-third to about half the size of minichromosomes in other independent events. The FISH signal for telo-31 was generally weaker on the minichromosome than on the native chromosomes. Callus CMC3 of the lower order 1.3 pool # 27 was maintained in the active growth phase, with selection for at least 10 months, sampling at various time points and analyzed by FISH, to demonstrate stable maintenance of the minichromosome for many rounds of mitotic cell division. Two other pools of lower-order events of 1.3 had 19 normal chromosomes, plus one minichromosome, probably as a result of chromosome integration and cracking. Using FISH analysis it was found that one of the two minichromosomes was positive for CentC only and the other was positive for both the PHP23715 and CentC marker. Using FISH on metaphase callus nuclei, all lower order event pools look essentially similar to comparable samples from other generated minichromosome events, as shown in Figures 1, 2, 5, 6 and 9.

[0262] A further minichromosome event was observed (Figures 5-8) from a gene shot transformation event on immature Hi-II embryos with a linearized modified core set of BAC 3 pools (Table 8). The resulting embryogenic callus - the event was positive on Bialaphos selection media and the marker - the fluorescent dsRed protein - was expressed. Analysis FISH analysis showed that this event was a tetra-aneuploid, with only 39 chromosomes observed, because one chromosome 6 was absent. Each nucleus had 0, 1, or 2 minichromosomes in this event. As described at the first minichromosome event from pool 1, the minichromosomes in this event usually contain centromeric repeats and Tn5-3 components. In anaphase, the sister chromatids of the minichromosome (s) were able to segregate (Figure 7) indicating the presence of functional centromers. The above indicates that the minichromosomes replicate autonomously and show stability through subsequent mitotic divisions.

[0263] A further minichromosome event was observed (Figures 9-10) with a transforming event using a gene gun on immature Hi-II embryos with a linearized, Tn5-3-modified BAC clone, bacm.pk128.j21. Again,

- 89 embryogenic callus of this third event was positive on Bialaphos selection media and expressed dsRed fluorescent protein. The plant was regenerated from this event, and the tops of the roots were screened using FISH. Each nucleus had 0 or 1 minichromosome. In these nuclei with minichromosome, only 19 of the 20 native chromosomes were observed. FISH analysis on metaphase preparations showed that the single minichromosome consisted mainly of centromeric repeats and Tn5-3 components.

[0264] Another minichromosome event, bCMC4 event # 73, was observed with a gene-transformational transformation event on immature Hi-II embryos with linearized, Tn5-3-modified three B73 chromosomes 4 specific for the centromere of BAC clones (Table 9). The resulting embryogenic callus event was positive on Bialaphos selection media and expressed the dsRed fluorescent protein marker. FISH analysis showed that this event was aneuploid with only 19 chromosomes and 1 or 2 minichromosomes. Similar to the minichromosomes described above, the minichromosomes in this event consisted mostly of centromeric repeats and Tn5-3 components.

[0265] Observations on all minichromosome events indicate that the newly formed minichromosomes predominantly originated from concatenation and / or amplification of primary linear DNA constructs delivered to plant cells to form de novo minichromosomes.

[0266] Three minichromosome events were further analyzed using immunofluorescence with a fluorescently labeled antibody directed against a centromere / kinetochore specific protein, centromeric C protein (CENPC). Immunostaining of stretched nuclear preparations revealed that CENPC specifically binds to the centromeric region of the native chromosomes. In addition, CENPC localized to different positions on all minichromosomes in all three investigated minichromosome events (Figures 3, 4, 8 and 10). FISH coupling with immunolocalization showed that the location of CentC repeat and probe - dsRed2 marker overlapped with CENPC on minichromosomes. As observed for native chromosomes, in metaphase minichromosomes have two separate CENPC foci (Figures 3, 8 and 10), in anaphase, the sister chromatids of the minichromosomes separate and each of the sister chromatids has a single CENPC focus (Figure 4). The above results indicate that minichromosomes can recruit essential proteins, such as CENPC, to form kinetochores, and consequently function autonomously with native chromosomes during replication and segregation to posterior cells during mitosis and meiosis.

[0267] Several thousand Bialaphos-resistant, DsRed-positive transgenic maize events were generated, and at least a few hundred were cytologically characterized. Events show a high frequency of integration into host chromosomes, with about 60% of events showing FISH-detectable integration. Both visual and selection markers are present in almost 39% of events, but are not detectable by FISH analysis. To date, most combinations of recombinant constructs have generated minichromosomes containing both markers and CentC repeatable detectable

- 90 using FISH only in about 1% of events (4 events, Figures 1-10). An exception are lower-order pools of 1.3, which generated minichromosomes containing both markers and CentC repeats in approximately 12% of the analyzed events (4 out of 34).

D. Size measurements of the artificial minichromosome [0268] Three of the events with autonomous maize minichromosomes were further characterized by measuring the size of the assembled minichromosome and chromosome 6, which is easily identifiable using the FISH 18-26S rDNA probe. All measurements were performed on metaphase nuclei, which gave the most consistent measurements. Other stages are less defined and highly variable with regard to the size of chromosomes, for example, pre-measurements in prometaphase show minichromosomes relatively unchanged in size relative to metaphase measurements, whereas native chromosomes are about 4-5 times longer, as a result of which the minichromosomes measured in this stage constitute about 5% to about 15% of the length of the average native prometaphores corn chromosome. As a result, the minichromosomes measured during the metaphase probably appear to be larger relative to native chromosomes than when measured at other stages. The chromosomes were measured using a Leica DMRXA fluorescence microscope, the photos were taken with a CCD Photometrics CoolSnap, and the measurements were performed using Metamorph® image analysis software (Molecular Devices, Sunnyvale, CA, USA). All measurements were given in microns.

Native chromosome 6 (n = 29):

Average = 4.62 (I) and 2.38 (in)

Range = 3.16 - 5.78 (I) and 2.06 - 2.70 (in)

Minichromosome (n = 337):

Average = 1.29 (I) and 1.67 (in)

Range = 0.75 - 3.07 (I) and 1.12 - 3.17 (in)

Maize minichromosomes have an average of about 28% of the length of the chromosome 6, but may be in the range of about 13-97% of the total length of chromosome 6 in metaphase. [0269] The size of the observed minichromosomes of maize can also be estimated in Mpz. For example, the maize genome contains about 2500 Mb of total DNA, with chromosomes in the size range of about 150-350 Mpz, the chromosome 6 is about 200 Mpz (Seneca 60).

EXAMPLE 8: Methods [0270] DNA isolation from immature flasks or green leaves of maize plants was performed essentially as described in Ananiev et al. (1997) Proc Natl Acad Sci USA 94: 3524-3529. BAC clone DNA was isolated using the Nucleobond plasmid set (BD Biosciences Clontech, California) according to the manufacturer's instructions. High molecular weight DNA preparations in agarose blocks were made essentially as described in Liu &amp; Whittier Nucleic Acids Res (1994) 22: 2168-2169.

DNA restriction digestions, gel electrophoresis, Southern blotting and membrane hybridization were performed using standard techniques as described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Volumes 1-3.

A. Overgo probe labeling for colony hybridization and Southern hybridization [0271] Grouped in an overgos pool for each probe (5 pmol of each oligo) were combined with 2 μl of 10 x Klenow buffer, 1 μl of Klenow enzyme (5 U / g), 1 μl 1 mM dGTP, 1 μl 1mM dTTP, [a-³²P] dCTP and [a-³²P] dATP - 5 μl each and sterile water to a final volume of 20 μl. The reaction was incubated at 14 ° C for 2 hours. The percentage of incorporation was deducted, and it was considered acceptable at the level of 50% or more.

B. Membrane Preparation and Hybridization [0272] Membranes were prepared using 432 384-well plates equally divided between the Mo17 EcoRI and HindIII BAC libraries. A 4 x 4 mesh spread pattern was used that allowed 96 plates to be loaded with 384 wells per Millipore Imobilon N + nylon membrane (Bedford, MA). The 96 plates forming the grid included 90 plates with BAC clones and 6 plates with clones of plasmids, used as markers on the grid. After distribution on the grid, the membranes were carefully placed with the bacterial side up on Luria-Bertani agar plates with 17 Lig / ml chloramphenicol, the plates were covered, inverted and grown at 37 ° C overnight. After colony growth, the membranes were removed from the plates and denatured in 1.5 M NaCl and 0.5 M NaOH for 5 min in each, followed by neutralization at 1, 5 M NaCl, 1 M TrisHCl, twice for 5 min in each. The membranes were dried and treated with Proteinase K (100 mls at 1 mg / ml, Sigma, St. Louis, MO) for 50 min at 37 ° C.

[0273] Each membrane was soaked in a solution of 6 x SSC, 0.5% SDS in plastic boxes. The filters were prehybridized at 56 ° C, 6 x SSC, 0.5% SDS with continuous mixing for at least 20 minutes. The overgo probe pools were denatured at 100 ° C for 5 min and added to the hybridization solution used for prehybridization. Hybridization was carried out for 12-16 hours. at 56 ° C. Membranes were washed progressively, after 1 hour. each time at 56 ° C in 2 x SSC and 0.1% SDS (wash 1), 1.5 x SSC and 0.1% SDS (wash 2) and 0.1 x SSC and 0.1% SDS (washing 3). Membranes were protected by foil wrapping and exposed to x-ray film for 3 hours to overnight. After hybridization, the filters were rinsed clean in 100 ml of 0.1 x SSC and 0.1% SDS at 90 ° C for 10 min and stored at -20 ° C. Membranes were used repeatedly.

C. Cytologic Methods [0274] Any suitable cytological methods and compositions, including many standard cytological methods, formulations and the like, are known in the art and can be used to test plant tissues.

- 92 i. Preparation of testicles from maize callus tissue [0275]

1. Calli used to make nuclear preparations were first treated with nitrous oxide, at 150 psi for 3 hours, and then immediately fixed. Nitric oxide stops the nuclei in metaphase, which allows obtaining improved stretched chromosome preparations for FISH analysis.

2. Fix a callus of callus tissue in 50% acetic acid for at least 1 hour. The tissue can be stored indefinitely in 50% acetic acid at -20 ° C.

3. Separate somatic embryos from callus and place in 50 μl drops of PIM buffer (50 mM CaCl 2, 10 mM sodium acetate, pH 5.8) in a small Petri dish.

4. Cut the somatic embryos into smaller pieces of 0.5 mm.

5. Wash the tissue in PIM buffer 3-5 times within 1 hour to remove the fixative. Slowly pipet several times to clean and replace with fresh PIM buffer.

6. Carefully remove the PIM buffer. Add 50 μl digestive enzyme solution (2% w / v cellulase (Cat # CEL, Worthington Biochemical Corp. (Lakewood, NJ, USA)), 0.2% w / v pectinase (Cat # PASE, Worthington Biochemical Corp. (Lakewood, NJ, USA)), 0.5% w / v, bovine serum albumin)

7. Digest the tissue at room temperature, in the dark, in a moist chamber for 1-2 hours. As the tissue softens, gently pipet and / or crush the probe, to crush larger pieces and release the cells.

8. Thoroughly remove the pickling enzyme solution and replace about 50 μl of PIM buffer.

9. Transfer the free cells / testicles to the centrifuge tube. Add more PIM buffer to the remaining digested tissue and gently pipet to release cells, transfer these cells to a centrifuge tube, repeat as needed.

10. Centrifuge the microcentrifuge cells at 500 rpm for 3 minutes, remove the supernatant. Add fresh PIM buffer and gently re-suspend the cells. Repeat this washing step for another 3 times.

11. Remove the PIM buffer and replace with 50% acetic acid. Gently suspend the cells again, centrifuge at 500 rpm for 10 min, remove the supernatant and add 50% acetic acid. Repeat.

12. Keep isolated nuclei in 50% acetic acid at -20 ° C. The final volume of 50% acetic acid should be 2X the volume of the nuclear sediment.

13. Transfer 5 μl of re-suspended nuclei to the basic slide, add 18 mm² coverslip.

14. Heat the preparation on a heating plate at 70 ° C for 15 seconds.

15. Remove the preparation from the heat source and gently press on the cover slip to crush the tube.

16. Allow the product to cool briefly, then immerse the preparation in liquid nitrogen for 10-15 seconds.

17. Remove the liquid nitrogen preparation and warm the coverslip with breath.

- 93 18. Quickly remove the cover slip with the edge of the razor blade.

19. Place the preparation in 2 shifts of 100% EtOH after 2 minutes each time.

20. Allow the preparations to dry in the air. Store preparations at -20 ° C until needed.

ii. FISH with subsequent nuclear immunolocalization

a. Preparation of Overgo probe for FISH [0276] Overgo probes are described in Table 1.

1. Add 10 μl of 100 μΜ of an overgo mix containing equal concentrations of each overgo to 5 μl of deionized water.

2. Heat at 95 ° C for 1 min, then transfer to ice.

3. Add to the above mixture:

- 2 μl of 10X DNA polymerase buffer (100mM Tris-HCl, pH 7.5, 100 mM MgCl₂.

7.5 mM DTT)

- 0.5 μl of fluorophore dUTP

a) dUTP-Cy3 (Amersham)

b) dUTP-FITC (Roche)

c) dUTP-Texas Red (Molecular Probes)

- 2 g dNTPs (200 μM A-, G-, CTP; 40 μM TTP)

- 0.5 gl Klenowa

4. Incubate at 37 ° C for 20 min.

5. Clean the probe using the Quiagen Nucleotide Extraction kit. Elute in 50 ml 50% formamide in the elution buffer from the kit.

b. Fluorescent in situ hybridization (FISH) [0277] FISH on maize nucleus on preparations was essentially as follows:

1. Fix the formulation 10 min in 1% v / v. paraformaldehyde in phosphate buffer (PBS) pH 7.2

2. Wash off 2X 5 min in PBS

4. Wash off 2 minutes in distilled / deionized water

5. Dry the preparation in the air

6. Hybridize 2 min at 80 ° C in a titrated fluorescent probe in 50% formamide at a final concentration of 50 mM MgCl2

7. Hybridize 30 min - overnight in a humid chamber at 37 ° C

8. Wash off 5 min in 2X SSC

9. Wash off for 5 min at 0.2X SSC

10. Dry the preparation in the air

11. Add Vectashield® from DAPI (Cat # H-1200, Vector Laboratories, Burlingame, CA, USA) and coverslip (5 ml coverslipping / 22 mm cover slip)

12. Look under the microscope using appropriate filter kits and / or immersion oil as needed.

- 94 c. Immunolocation [0278] After analyzing and characterizing the FISH probe, the same samples can be processed and used for immunolocalization using a probe - directly labeled antibody. Immunolocation of the fluorescent-labeled polyclonal rabbit anti-CENPC antibody was essentially performed as follows:

1. Remove the cover slip

2. Wash off 5 min at 70% v / v. EtOH to remove coverslips and immersion oil

3. Wash 3X 5 min in PBS

4. Block 1 hour at 37 ° C in a humid chamber at 5% v / v. normal rabbit serum (Jackson Immunoresearch, West Grove, PA, USA) in PBS-BT (PBS with 3% w / v BSA, 0.02% w / v sodium azide, 0.5% v / v Triton X100)

5. Wash in PBS

6. Incubate overnight at 37 ° C in a humid chamber, with 1% antibody in 5% v / v. normal rabbit serum in PBS-BT. Rabbit anti-CENPC-Cy3 (or FITC) was used at a dilution of 1: 200, a final concentration of 2.5 μg / ml of the labeled antibody.

7. 3X wash in PBS within 1 hour

8. Dry the preparation in the air

9. Add Vectashield® from DAPI (Cat # H-1200, Vector Laboratories, Burlingame, CA, USA) and coverslip (5 ml coverslipping / 22 mm cover slip)

10. Seal the coverslip with nail polish

11. Look under the microscope using appropriate filters and / or and / or immersion oil as needed.

d. CENPC antibody production and labeling [0279] The CENPC mammal homologue maize was isolated by Dawe et al. (1999 Plant Cell 11: 1227-1238) and presented as a component of the kinetochore in corn. A 20-aminoacid conservative peptide from the terminal amino domain was synthesized and used in the production of a polyclonal antibody in rabbits (Openbiosystems, Huntsville, AL, USA). The resulting antibodies were directly labeled with flurophores while the Fluorolink-AbCy3 labeling kit (GE Healthcare, UK) or the Fluorescein Protein labeling kit (Roche Diagnostics Corp., Indianapolis, IN, USA) were used.

iii. FISH on stretched chromatin fibers [0280] Stretched DNA fibers on cytological preparations were prepared as described by Jackson et al. (1998) Genome 41: 566-572. FISH stretched chromatin probes were labeled with biotin-11-dUTP (Roche, Germany) or DIG-dUTP (Roche, Germany) using the Nick Translation Marking Kit (Roche, Germany) according to the manufacturer's instructions. After precipitation, the probes were re-dissolved in TE buffer and stored at -20 ° C. For FISH on stretched fibers

The chromatographic probes were hybridized to DNA fibers in a 50% (v / v) mixture of formamide, 10% (v / v) SDS and 2 x SSC in a final volume of 10 g. The formulations were covered with coverslips, sealed with a rubber adhesive and incubated at 80 ° C for 2 min to denature both the probe and the target DNA, followed by incubation at 37 ° C. Post-hybridization washing and signal detection were performed as described in Zhong et al. (1996) Plant Mol Biol Rep 14: 232-242. The biotin-labeled probes were detected with fluorescein-avidin DN (Vector Laboratories, Burlingame, CA, USA), biotinylated anti-avidin D (Vector Laboratories, Burlingame, CA, USA) and again with fluorescein-avidin DN (Vector Laboratories, Burlingame, CA, USA) . The DIG-labeled probes were detected by mouse anti-DIG monoclonal antibodies (Jackson ImmunoResearch, West Grove, PA, USA) and Cy3-conjugated anti-mouse antibodies (Jackson ImmunoResearch, West Grove, PA, USA). The preparations were then embedded in the Vectashield coverslips for mounting (Vector Laboratories, Burlingame, CA, USA). The preparations were analyzed using a Leica DMRXA fluorescence microscope, the photos were taken with the CCD Photometrics CoolSnap. Photographs were taken using Metamorph® image analysis software (Molecular Devices, Sunnyvale, CA, USA). FISH on stretched chromatin fibers was performed on 3 to 5 preparations from each line. The preparations were analyzed using a Leica DMRXA fluorescence microscope, the photos were taken with the CCD Photometrics CoolSnap. Photographs were taken using Metamorph® image analysis software (Molecular Devices, Sunnyvale, CA, USA). FISH on stretched chromatin fibers was performed on 3 to 5 preparations from each line. The preparations were analyzed using a Leica DMRXA fluorescence microscope, the photos were taken with the CCD Photometrics CoolSnap. Photographs were taken using Metamorph® image analysis software (Molecular Devices, Sunnyvale, CA, USA). FISH on stretched chromatin fibers was performed on 3 to 5 preparations from each line.

- 96 SEQUENCE LIST [0281] &lt;110&gt; PIONEER HI-BRED INTERNATIONAL, INC.

&lt;120&gt; Artificial Plant Minichromosomes &lt;130&gt; 2083-PCT &lt;150&gt; 60 / 801.004 &lt;151&gt; 2006-05-17 &lt;160&gt; 193 &lt;170&gt; FastSEQ for Windows Version 4.0 &lt;210&gt; 1 &lt;211&gt; 4635 &lt;212&gt; DNA &lt;213&gt; Zea mays &lt;220&gt;

&lt;221&gt; source &lt;222&gt; (1) ... (4635) &lt;223&gt; CentA &lt;400&gt; 1

- 97 tgatgagaac gaggaacaaa aagcacatca gactctatta gcgacctcct tatcaggtga ccttgtgatt ggcaacaagg gtttaagagg aaaggtctct gtccagaaac caccaaatta tgttggaaag cgaggcgtcc ctatttaagc tttgctactt cccaactcta gcttgcaggt actatcgcta ccaccccaaa ttggttgtgg ctcatcgaaa ggttgctcgg caaagatata tagttttcga ttcttaccgc tgctgcaatt taatcagcaa gaattttggt ttttatagtt ggctcgcgtc tcaacttgtt ataacccgca gaagttgatt tcaaatttaa caagaagggg tcaccattta actcgttcct actttattaa caataaaagc gcatatcttt ttgtctactt tgccgagtga aatggagcat ctctcttcgt agaaactgcc aactagcagc ccttgtaaac tcagatccgt tcaaggctgt aggcgcagca tcgtagttat tagtcgggca gatcgggcac tgagagatct tttagagcag cttgttgaat tagagtttcg caaccaaaaa aacaaaaaaa agataaaatt tcagaaatca tctattacgg gtggctaacg cagatatgac ggggaccaag agatatactt aggatgatga ataatggacc tattgttgaa tctaaggtgt tgctccactt cagctcctaa tctagtggat actcctgctc aactttccac ctactttcatgagagagttt caccaaagaa gcatgtgtcg gagtgtctgc tcttggcacg cccttgtggt caggagacgg gccaacgtcg ccttctaccc caatcttcct aaattcacct tccggtagct agttcgcgcc gaagagaaag gacacgtgca tgtaagtgca gattgttgtt tttggactag tggtactagc catgttaatg taatgatatt gggtgaggag ggacatcact agtaaacgag gctaatcatt ttgggaggtg gaggggattt ggttgtttaa caagaatcaa tacccaagtc tcccaaggtt gtgcatcaat cgttctccat cttgggtttt gctagaccac tttttatctt gcaagggcag tgttgtagtc tgtacctgtc ttctccaaca gttgggttta tgttttgttt aaaaacagtt gcatttgggt accttgtttc caaaaggcga aaacaaaaga acaaaacaaa ctgagctttt gaccagcaca tattccttgg gctcctgcta tccaacattt catacactag gccatcaata tccgtgcacg ccttaaatga aaccatctag cgaaactaca tgcaaataag cgagagatca aatttcgtaa gtttagtgca aatcaatgac tagaactcct tgtttgatgt ccggatactt gttcttgctt caacaacagg ggatagcaca gctcaaggcg agtttccacc tcaagtggta acctacagtc tgagcctttg cgagttgctg aatcaccagt gtgcacaaaagagagaaaaa aggcagtttg ggtgatacta acaccttgtg aactattgtt caaagacatt ccaacaaagc agtcgaggac caccacacca taaattttat ggtactaata aatttgagaa acaagtgcaa cacttgttgg gacactaagt ctgcagcatg aataactact agaaaccaaa ttctattcct aagtttagcc gaaacagaac gttctcgatt agccgatgta acgtcgacct ccacaccatc tccatcatct tcaaatttca cacttttgcc ctttactact gtctaaagtt ttagacctct aaagccgcac aaccagttct tgtgccttct tttgtgtaac gaacgtttat taaacagcca

120

180

240

300

360

420

480

540

600

660

720

780

840

900

960

1020

1080

1140

1200

1260

1320

1380

1440

1500

1560

1620

1680

1740

1800

1860

1920

- 98 cctataaatc cacaaaattt tctacaacac caccaggttg tgctagcagc cactgttgtt 1980 gttgttcgtg ctgtttgcca gcgcctcctg ctttgcgtgg tgagaacttg taagaacttg 2040 tttaaccagt ttgagagtga gagattacaa caatgattcc tagtagttta tagaatcaaa 2100 gatatttttt attgtttctt gtctttacta aacatggcag gtgatatgga catttttgac 2160 ccaaccgaac gttatattgg aggcatcatt caacacttgc ctttatatgc cggtaaattc 2220 gatcctcatg catacattga ttgggagcta aagctagata aggaatttga taagcatgat 2280 ctatctcaaa aacaaaagat ttatattgcc tctaatttgt taactgagca cgcattgatg 2340 gaatggaaat acatttgtag gcacaacaaa gttccacaat cttgggaaga cttcaaactt 2400 cattttagag atgcattcat tcctgcatac tatgctgatc atttgctttc taaattagac 2460 accttaaagc agggtgctag gactgtgaaa gattattatt atgattttaa aatttttacc 2520 atgtttgctc gtttagatga atgcatggaa gatgtcatga ctaggttcat gaaaggactc 2580 aattctgaaa ttcagactat agtcatgcat gaagcataca aacacatttc tcacttgttt 2640ttgcttgcat gtaaagctga aaatgagatt ctattataca attatacaag cactgaacat 2700 gtgagccata attcctcttt tgcatcttct ctacatgctg atcaagaaca caaaataatg 2760 aaaccagctg ttgtttttcc atcatcacaa gaagaattga ttgctgacac ttgtgatagt 2820 gaagatttgt gggataatga ttcacatgta ctaagacaac aactagtaaa tgaacatgtt 2880 acatctatta ttgaaccaaa cattttggct aaaaaggaac atgtaatttg tattgcaaac 2940 gaaactgaag aaataaattt gctctcttct ttaaatactt ggggctatat tgaatttgat 3000 gatctttttg agctcggtaa tttggaaaat attttatttg ctagattcaa ctataccatg 3060 tccttctcat gatatatttt atattgctgg caagtacaac aacataggac aatttcttgt 3120 gcatagaatt tctatttcat ctagatatgt tgtttcttca ctttgtgcaa ataagatatt 3180 ggtatgttct caagaagaaa agaatctctt gtttccatgt actttagttg aagtttcagg 3240 tttatatttg aaagacatta ataaaagctt agtcatcaac atcaatcatg atgcaaaacc 3300 gaggacggtt tgctatcaag aaggggagaa tgatgagaac ataacccgca cagatatgac 3360catgttaatg gctcctgcta caaagacatt aaggaacaaa gaagttgatt ggggaccaag 3420 taatgatatt ttcaacattt ccaacaaagc aagcacatca tcaaatttaa agatatactt 3480 gggtgaggag catacactag agtcgaggac gactctatta caagaagggg aggacgatga 3540 ggacatcact gccatcaata caccacacca gcgacctcct tcaccattta ataatggacc 3600 agtaaacgag tccgtgcacg taaatttaat tatcaggtga actcgttcct tgttgttgaa 3660 gctaatcatt ccttaaatga ggtactaata ccttgtgatt actttattat tctaaggtgt 3720 ttgggaggtg aaccatctag aatttgagaa ggcaacaagg caataaaagt tgctccactt 3780 gaggggattt cgaaactaca acaagtgcaa gtttaagagg gcatatcttt cagctcctaa 3840 ggttgtttaa tgcaaataag cacttgttgg aaaggtctct ttgtctactt tctagtggat 3900 caagaatcaa cgagagatca gacactaagt gtccagaaac tgccgagtga actcctgctc 3960 tacccaagtc aatttcgtaa ctgcagcatg caccaaatta aatggagcat aactttccac 4020 tcccaaggtt gtttagtgca aataactact tgttggaaag ctctcttcgt ctactttcat 4080gtgcatcaat aatcaatgac agaaaccaaa cgaggcgtcc agaaactgcc gagagagttt 4140 cgttctccat tagaactcct ttctattcct ctatttaagc aactagcagc caccaaagaa 4200 cttgggtttt tgtttgatgt aagtttagcc tttgctactt ccttgtaaac tcatgtgtcg 4260 gctagaccac ccggatactt gaaacaaaac cccaactcta tcagatccgt gagtgtctgc 4320 tttttatctt gttcttgctt gttctcgatt gcttgcaggt tcaaggctgt tcttggcacg 4380 gcaagagcag caacaacagg agccggtgta actatcgcta aggcgcagca cccttgtggt 4440 tgttgtagtc ggatagcaca acgtcgacct ccaccccaaa tcgtagttat caggagacgg 4500 tgtacctgtc gctcaaggca ccacaccatc ttggttgtgg tagtcgggca gccaacgtcg 4560 ttctccaaca agttttccac ctccatcatc tctcatcgaa agatcgggca cccttctacc 4620 cgttgcgttt atcaa 4635 &lt;210&gt; 2 &lt;211&gt; 156 &lt;212&gt; DNA &lt;213&gt; Zea mays &lt;221&gt; source &lt;220&gt;

- 99 &lt;222&gt; (1) ... (156) &lt;223&gt; CentC &lt;400&gt; 2 ggttccggtg gcaaaaactc gtgctttgta tgcaccccga cacccgtttt cggaatgggt 60 gacgtgcgac aacgaaattg cgcgaaacca ccccaaacat gagttttgga cctaaagtag 120 tggattgggc atgttcgttg cgaaaaacga agaaat 156 &lt;210&gt; 3 &lt;211&gt; 6915 &lt; 212&gt; DNA &lt;213&gt; Zea mays &lt;220&gt;

&lt;221&gt; source &lt;222&gt; (1) ... (6915) &lt;223&gt; CRM1 &lt;400&gt; 3

- 100 cttggtcttg tttcggcgag cgagcaagcc ctgatgcgag agaataagat cagcgcagat ataaaggagg ccctaggtcg tctttaacaa gaaggggtgg tgatgtccgc cttctcccgc caggtaggtc cagcacgagg accaaaccat gattttttgt gttcaacatg caataggtgc aatgcgtggc aattcttgtc gtccatcagt aaagagatct gaataccatg cagttttatg tactatccct gccaaggaga tagctttctg gccaaaagaa gaccgcctcc gcttgttagc taatacaatg tgtccaaacc catcagcaat tgaattctac aagcctcatg gcaaagtgcg cgcttaattt gcccaatacc agaggggagc tccaggcaaa aatcacgaac ccgtcgtcgg cctgcggagt ccatgttacc aatgctcctc aacctatgaa tcaatccaaa tccattcatc agaaaataac gacagtacct tagagataat cgaggcgcca atcggcctga gcgagcaatc tagcgcgtgt cgcagctcct tccattatgg catgatgtag cgcctgggct atcatcctcc atacggtttc gagggtataa catcaattta atcaccaggt attagtagca tgcagaagca cctaggaatg atgattgtaa taaaacagcc ttgagggtga ccaaaaatgg taaacgaata acaaggtata ccccttctta agaagggaca acaagtagtg gtgggcagccatgcgcttcc gcgaaacagg gccgaaagca aaagatttta aacattgtcc ccatttagca atcagaatgg cactaaagcg ttcactaaaa actagcatcg ttgggttaac cggcacatct aaatctgcgg tgtaggccac aaccacataa aaacaagcga tatagacttg ggcccgtaga tggcataacc accgagtttc ggcaccacta cactgatgaa tccgatttgg atgcaatcgc tcacgaagat taatctatta tcgagagtag gaataaatag gccgcaattg ttcaattctc ggagaaggtg ccttcttgaa aaatctgcaa gcattatcat gaacggcgca tcaaaagtaa gcaatgttct tctacatgtg taaccataaa gcaaattcaa ctaagcatgg caagtagtgc cttagaaact atttctctaa aagtgagcca gttctaggca ggcaaaggca cagcgtgcaa aacacctcat tgtaacaaca aacccatcct tctttaaaat aaatctaact ttcccgttct tgacgacggt attatgaact taaagctcct taagcaactg cattcaagct ttatctttca ttctttgtaa tagaaaccgg tcccgaatgg ccaagaaacg gcagcacgca ctgtaaataa acttcgttca aaccattcat attctaatct agctcatcta gtagacctga cggaagatga tgaaccaact cgtttcctgt ctcgagggtg ctaaggctaa agagggggcg ggctggtcgtttgcacgggc ctgctggtgt ctgaagtcgt cattaaaact taatcttggt aagtaggaaa catgttttct gtttcgtttg gggcgttcgc caatctggaa catgaggcaa tagataaagt taaacaacaa tagcatcgcg agaacaattc ttttagagaa agcccaaaac tatacaaacc caaggcgctc gtgtcttgta aaagacgaac gtatgtgaaa cagcatcgtc gtgacagcat tgtgtttaat tcagatttgt cacgatgcca tatcataagt gttttccttc cgaaaacttt aagtgctgaa gctcatgtag caagtccaag cagcaatctt agacacgttg aagcgtcaaa ggatatcatc ttaaacgcat ataaaccaaa gatggtaacc gcatatcatc tgaagctgag cccttgcgat ccctgtggtt gcgcaatcga gagttctgaa cgtaaaacaa cagcccctag ctattcttcc ccgagtcact agatgtgctc cctcgacggc agtggaaaca tagtatctta acgatccttt tcctttacta ttcatgtatg agcattaagt agggcacatc gcaatcctcc tctatttact tttagttccc atcagagact agcaacaatg tctatcaaca aaagtccata atggttgttc cacatcagcg gacgccaaaa cgagctagct tttgccccat aacatattga ggtatagcga aatgtaagga ttgggtacga aagatagtgc agaatatttc ttgtaacaaaattaaaatca cgctacctcc aggcgctgca aaagctccga gctgctatcc cgtgcaaaat aacagcacgc gaaataaaca aaaggtgctg tttcgtttta gctacgcaaa aaggcgtgga gtgcccgatc ccgactacga accgaccttg agaacgaaca tacacgaaga aactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt aactcctcat ccaaactccg aaaggaccag ctcaaatgca ccagcaacct gtaatcattt gaaatcaaat tttgtagaag caacgtcgca acctcagttt aatttattcc attgtttttg ctagcatcat accacaaaaa gagatatcaa aaccgtgact cgcatccgag tgccccatga ggaacacaca ggttttccat tccttcacag cgagacaaag aaggactcaa atatgtttta tgccatgtat agactagcac acagcaccca ggcaattgca tgcgaatcac atggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcaactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt aactcctcat ccaaactccg aaaggaccag ctcaaatgca ccagcaacct gtaatcattt gaaatcaaat tttgtagaag caacgtcgca acctcagttt aatttattcc attgtttttg ctagcatcat accacaaaaa gagatatcaa aaccgtgact cgcatccgag tgccccatga ggaacacaca ggttttccat tccttcacag cgagacaaag aaggactcaa atatgtttta tgccatgtat agactagcac acagcaccca ggcaattgca tgcgaatcac atggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcaactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt aactcctcat ccaaactccg aaaggaccag ctcaaatgca ccagcaacct gtaatcattt gaaatcaaat tttgtagaag caacgtcgca acctcagttt aatttattcc attgtttttg ctagcatcat accacaaaaa gagatatcaa aaccgtgact cgcatccgag tgccccatga ggaacacaca ggttttccat tccttcacag cgagacaaag aaggactcaa atatgtttta tgccatgtat agactagcac acagcaccca ggcaattgca tgcgaatcac atggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcatggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcatggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatc

120

180

240

300

360

420

480

540

600

660

720

780

840

900

960

1020

1080

1140

1200

1260

1320

1380

1440

1500

1560

1620

1680

1740

1800

1860

1920

1980

2040

2100

2160

2220

2280

2340

2400

2460

2520

2580

2640

2700

2760

2820

2880

2940

- 101 cttggtcttg tttcggcgag cgagcaagcc ctgatgcgag agaataagat cagcgcagat ataaaggagg ccctaggtcg tctttaacaa gaaggggtgg tgatgtccgc cttctcccgc caggtaggtc cagcacgagg accaaaccat gattttttgt gttcaacatg caataggtgc aatgcgtggc aattcttgtc gtccatcagt aaagagatct gaataccatg cagttttatg tactatccct gccaaggaga tagctttctg gccaaaagaa gaccgcctcc gcttgttagc taatacaatg tgtccaaacc catcagcaat tgaattctac aagcctcatg gcaaagtgcg cgcttaattt gcccaatacc agaggggagc tccaggcaaa aatcacgaac ccgtcgtcgg cctgcggagt ccatgttacc aatgctcctc aacctatgaa tcaatccaaa tccattcatc agaaaataac gacagtacct tagagataat cgaggcgcca atcggcctga gcgagcaatc tagcgcgtgt cgcagctcct tccattatgg catgatgtag cgcctgggct atcatcctcc atacggtttc gagggtataa catcaattta atcaccaggt attagtagca tgcagaagca cctaggaatg atgattgtaa taaaacagcc ttgagggtga ccaaaaatgg taaacgaata acaaggtata ccccttctta agaagggaca acaagtagtg gtgggcagccatgcgcttcc gcgaaacagg gccgaaagca aaagatttta aacattgtcc ccatttagca atcagaatgg cactaaagcg ttcactaaaa actagcatcg ttgggttaac cggcacatct aaatctgcgg tgtaggccac aaccacataa aaacaagcga tatagacttg ggcccgtaga tggcataacc accgagtttc ggcaccacta cactgatgaa tccgatttgg atgcaatcgc tcacgaagat taatctatta tcgagagtag gaataaatag gccgcaattg ttcaattctc ggagaaggtg ccttcttgaa aaatctgcaa gcattatcat gaacggcgca tcaaaagtaa gcaatgttct tctacatgtg taaccataaa gcaaattcaa ctaagcatgg caagtagtgc cttagaaact atttctctaa aagtgagcca gttctaggca ggcaaaggca cagcgtgcaa aacacctcat tgtaacaaca aacccatcct tctttaaaat aaatctaact ttcccgttct tgacgacggt attatgaact taaagctcct taagcaactg cattcaagct ttatctttca ttctttgtaa tagaaaccgg tcccgaatgg ccaagaaacg gcagcacgca ctgtaaataa acttcgttca aaccattcat attctaatct agctcatcta gtagacctga cggaagatga tgaaccaact cgtttcctgt ctcgagggtg ctaaggctaa agagggggcg ggctggtcgtttgcacgggc ctgctggtgt ctgaagtcgt cattaaaact taatcttggt aagtaggaaa catgttttct gtttcgtttg gggcgttcgc caatctggaa catgaggcaa tagataaagt taaacaacaa tagcatcgcg agaacaattc ttttagagaa agcccaaaac tatacaaacc caaggcgctc gtgtcttgta aaagacgaac gtatgtgaaa cagcatcgtc gtgacagcat tgtgtttaat tcagatttgt cacgatgcca tatcataagt gttttccttc cgaaaacttt aagtgctgaa gctcatgtag caagtccaag cagcaatctt agacacgttg aagcgtcaaa ggatatcatc ttaaacgcat ataaaccaaa gatggtaacc gcatatcatc tgaagctgag cccttgcgat ccctgtggtt gcgcaatcga gagttctgaa cgtaaaacaa cagcccctag ctattcttcc ccgagtcact agatgtgctc cctcgacggc agtggaaaca tagtatctta acgatccttt tcctttacta ttcatgtatg agcattaagt agggcacatc gcaatcctcc tctatttact tttagttccc atcagagact agcaacaatg tctatcaaca aaagtccata atggttgttc cacatcagcg gacgccaaaa cgagctagct tttgccccat aacatattga ggtatagcga aatgtaagga ttgggtacga aagatagtgc agaatatttc ttgtaacaaaattaaaatca cgctacctcc aggcgctgca aaagctccga gctgctatcc cgtgcaaaat aacagcacgc gaaataaaca aaaggtgctg tttcgtttta gctacgcaaa aaggcgtgga gtgcccgatc ccgactacga accgaccttg agaacgaaca tacacgaaga aactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt aactcctcat ccaaactccg aaaggaccag ctcaaatgca ccagcaacct gtaatcattt gaaatcaaat tttgtagaag caacgtcgca acctcagttt aatttattcc attgtttttg ctagcatcat accacaaaaa gagatatcaa aaccgtgact cgcatccgag tgccccatga ggaacacaca ggttttccat tccttcacag cgagacaaag aaggactcaa atatgtttta tgccatgtat agactagcac acagcaccca ggcaattgca tgcgaatcac atggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcaactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt aactcctcat ccaaactccg aaaggaccag ctcaaatgca ccagcaacct gtaatcattt gaaatcaaat tttgtagaag caacgtcgca acctcagttt aatttattcc attgtttttg ctagcatcat accacaaaaa gagatatcaa aaccgtgact cgcatccgag tgccccatga ggaacacaca ggttttccat tccttcacag cgagacaaag aaggactcaa atatgtttta tgccatgtat agactagcac acagcaccca ggcaattgca tgcgaatcac atggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcaactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt aactcctcat ccaaactccg aaaggaccag ctcaaatgca ccagcaacct gtaatcattt gaaatcaaat tttgtagaag caacgtcgca acctcagttt aatttattcc attgtttttg ctagcatcat accacaaaaa gagatatcaa aaccgtgact cgcatccgag tgccccatga ggaacacaca ggttttccat tccttcacag cgagacaaag aaggactcaa atatgtttta tgccatgtat agactagcac acagcaccca ggcaattgca tgcgaatcac atggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcatggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatcatggagctaa atttgtgtga acctcaatgc gtgcactttt aaatgttcta acaacaaaca ggagcattag aaagccgttt tcaaccttag ataggatatc

120

180

240

300

360

420

480

540

600

660

720

780

840

900

960

1020

1080

1140

1200

1260

1320

1380

1440

1500

1560

1620

1680

1740

1800

1860

1920

1980

2040

2100

2160

2220

2280

2340

2400

2460

2520

2580

2640

2700

2760

2820

2880

2940

- 102 gataacgaac ctttctttgg ccttatcaag ggtacggagc cacggagggg aaaggttaac ttcgcgagca cacgtgtagc atgtcgattt ggtcaggggt ttgaacgacc agcatgcttc aggggacacg gatacggatg ccaaattgtt ccttggtatg gaacacgctg cctcattttc ctgaagagta tcatgtgccc aagcggcgcc taggcgtagg aagagttagt attcaaacaa tgttcaaacc gaagcatacc aacgctgcat tggcagtttt cacgccacca tagcaggaat cagcaggatc cattaggggg cagtgtcacc tggtgtcgag tcgtcgaagt catcaacttg tagttagcgc caaggcgctc tgaactgcaa agaaacctgc ttagcacgat ctggccacag tgtactagtg tgtatgattt gtttcaccta cgtgcgagaa cgaaccccaa tgtaaaaatt tacctcaaat gttttttgtt gactcggttt atcaaggaaa ggagaaaaac gcggcgctag gcacacaaat gataagatct ataaactcac tttcggcgag cgagcaagcc ctgatgcgag agaataagat tgtgatgtta aacgagtaaa cagcgtctgc gcggttcgga aggaagaccc aacagcaggg tacaagtgca aagtaaaaca gacttgttgt cattggatgt atgatgtaaa cataggaata taccgaacgt tggatgtgtg gcagctgcca gaatagagtgcacaacaaga tgcatggtta ctcaccattg aaaccctctg tttggcaggg aggtgcaggg atatgtcttt tgtggttata accacgaaaa cttttgcaac tttgttaagc taattgggtc aattaaagca atcatggcat atatttacca atgacgaacc gccgtattcc tgtggtgcga gatcgttgaa gccccttact aaacaccaaa acactagtgc ccaacaggtg tcgtcgtaga caaacaataa gtgcaaagga atgccaaaaa ttttgatatt aaacagatat ctttgacgga acagaccgta tcagattttt tatgttttca tctgtttttt gttttttttt acagccgttg aaggaaacaa ggtttgaatg tcaacaatgc aacctgaatt cgatcaacct tagagataat cgaggcgcca atcggcctga gcgagcaatc ttaatagcac acgggaaccg acctggcgct agagaagtgc ggtggtaagt ggtatatcca taacagggca ggagagtgca gcagttttag ataattattt ctatcagtat acatcgcaat gttaccttta cgagtgggca ctatcgatga tgtcgctgat ctctcatacc gtggcaatca tcacgtataa caacgatggc ggcgccactg ctggaaggag gatcgtcgtc tcaaaataat cgcgccatag tcctggtaat aaatcacgag caagtaatga aaatcagtaa gaaaatttct ttaaaagatg acacgacgtg tgctccatctgtcgccgttt tcaagccgtt tcctgcaact aggagaaaaa tgttatcaag gaaccggtga aatatgtgga tgcaaagttg tggatggatg ggcactagta tttctcagca cagatgtggt tttttttctt ggtgagtttg tggacacccg aacgaccgga tttttacgta ctgttttttt actcggtttg tgttgactcg gtggaagaac agattattga tttatgtggt agaaatctga tccgatttgg atgcaatcgc tcacgaagat taatctatta gacaatctac agcaagggct ggatctcctt cggggatgag ccgtaggata aagacggtgc tatgagcttc acttgatttc cagccctagt tctggccttt catattgcca caacataatc ttttaccacc aggataattt tgatgcgaat ttttttcggc tatcagcgtc tagcatgact gcaaggtacg actgaatatc gcttggccgg ttgagctgtg cctgcacttc ccttataatc cagcgtcatc attcctcaac cataatagga cactgttaat attcactaat gttctacctc gaattttaaa cacgaccacg ttgtggtcaa gagcaaggtc catgcatcgt gggcatccac ccaacgacaa ttcttatccg aagattggat gttgtgggta aattatagtg gaaatagcag caaatcacag caagaagcaa ctacagaaaa tattttcctg gccgggctca agcgaaaagt atgaaacaac accgaaggagttctgttttt ttttttctgt gtttgtggtg acaatgcaac aagaaagtgc tttgtggact taccaattga cggaagatga tgaaccaact cgtttcctgt ctcgagggtg gcacatacgc aagagactca cgtctcatct atcgatctga aacatcagca atcatcaagc atggagatca agatttaata aagatcatct aaacatgaaa aggtcgaccc agaataagaa atcattaagc ctctaccaac cgaccgttcg ctgggcaacc gatgggatca agtttcctca cttgtttggg ccgtgtacgt ccctgtgcgc tgttggaccc acgttcagct aagtatatcc tgactcaacc agattgtgaa aggaacaaat gggaagtttt ggcagccttc taattcccaa tttaatctta gcgatctcca tgcatcaagg aagttggttg cctaatgtca catgtcgtgt aaacaggggt ttcttaccaa gagcgattgc ggctgcactc caaaacacga aatggcagta gtgattttgt caagatagga tcaggaagtt aatttttttg gaatggtgtc tatgcccggt cgtatccttt aaaaacaagg tttcgtaacc ttttttttga tgatcaaacg cagcaacaaa gaggctcaaa gtaggaaaaa tgaagctgag cccttgcgat ccctgtggtt gcgcaatcga gagttctgaa catgacccat cgaatgtaac 3000 3060 3120 ggatttgtac tgctcaatgc 3180tactcctgca 3240 ggaacaagca 3300 tcaaaatcag 3360 ggtgcggctg 3420 ttcaaaattt 3480 gaataatgat 3540 aataacaaag 3600 cccagcgaaa 3660 cattgaatgt 3720 gctgtacttg 3780 tgcacgacgc 3840 tgtgtgctga 3900 acgtggactt 3960 gaatcactgg 4020 cagtcccgaa 4080 cctgtggaag 4140 gatgtagtgc 4200 cggcctgcaa 4260 ttgcaagcat 4320 tgaatttccc 4380 aaaccacaac 4440 ccttgttgaa 4500 ctgtggcgca 4560 tgtttatact 4620 acttggctat 4680 tcaagatatg 4740 gaaaataagt 4800 tcgtcctgct 4860 cgtgccagga 4920 aaacgctcgg 4980 gcagcaagtc 5040 gctcctgcca 5100 gtactgctca 5160 gccacagtgg 5220 ttggagaaac 5280 aagtcaagga 5340 aactatattg 5400 acgtaaatat 5460 ttttcttttt 5520 gctacacgaa 5580 ctctgaaaag 5640 acaattttgt 5700 aactagctcc 5760 ttaaggaagg 5820 ctccttcgtt 5880 aaacgatgtt 5940 gaaggagaaa 6000 cgtaaccgaa 6060 agagatggtg 6120 tgacgcgaaa 6180 agggtgctgg 6240 aaaacgctcg 6300 gtgcccgatc 6360 ccgactacga6420 accgaccttg 6480 agaacgaaca 6540 tacacgaaga 6600

- 103 cagcgcagat ataaaggagg ccctaggtcg tctttaacaa gaaggggtgg tgatgtccgc tagcgcgtgt cgcagctcct tccattatgg catgatgtag cgcctgggct ATCA tcgagagtag gaataaatag gccgcaattg ttcaattctc ggagaaggtg ctaaggctaa agagggggcg ggctggtcgt ttgcacgggc ctgctggtgt cgtaaaacaa cagcccctag ctattcttcc ccgagtcact agatgtgctc aactcaggaa gggcggccaa gggccttcgt ggcccaggtg gtgttggtgt

6660

6720

6780

6840

6900

6915 &lt;210&gt; 4 &lt;211&gt; 7572 &lt;212&gt; DNA &lt;213&gt; Zea mays &lt;220&gt;

&lt;221&gt; source &lt;222&gt; (1) ... (7572) &lt;223&gt; CRM2 &lt;400&gt; 4

- 104 tgatgaagac atccacacta ctgatgcatc tataccaata caagtaccaa tttctggtcc 60 cattactcgc gctcgtgctc gtcaactcaa ccatcaggtg attacactct tgagttcatg 120 tccatcatat ttagaccatg gagacccgtg cactcttgtt ttgcttagga atcagggaga 180 agaccgaaag ggaaaaggat ttgaacatgc tggattcgga ctgcagaaga acaccaactt 240 gtgacggtca ccacggtcag atgcgggctc ggattggaat gttcaagcac aacatggaaa 300 gcttatcaag tctactttca tatggatccg gaattatagt catatctgtt ctgaggccgc 360 cgtaatcatt gttttcttac cgagacattt cctgcctttt ctgcccatgg tgctgcgtca 420 ccctattttg gcccaatggg tcgtgtatca agttaggtcc attagggacg catcctaggg 480 ttgcagcacg accccaatac ccttgtggtc gtcctcccat gtttataaac cccctagccg 540 ccaccaagaa cagcgggttt tgtttagatc aagtttagct ctcgctactt gcttgcaagc 600 gcgcgtgcta gttcagccgc ccgtcttctt gtcttcggaa ccccaccata ttggagtttg 660 atctttaaac ctacatttag atctggtaat tcagtacttg ttctacttgt tcttgctagt 720 tcttcgattgcttgcaggac gagtgcccta gtggccaggg tgtcacgctc cacaagatcg 780 tgacagccat aggaggtggt gtatcggttg ctaaggcgca gcgtctttgg aaggctgtag 840 tcgggccgtg aacgtcgtct cctcccccaa tcgagttatt ccacaccctc tcatcgaaag 900 atcgggcaat cacccaacgg gtgcacatca gttggtaatc agagcaaggt ttatcggtga 960 gagatttact tttcttcgct gttttcttat ctcctatagt ccagaaaaag ccaaaaaaat 1020 agtagattag ttttaccgca atcctataaa ccattgagca tttactagta ctacttagtt 1080 agggcttgtt gagtttttgg ttgcatcggt tgtgtcgagt tgctggtctt agtttattcc 1140 tttagagttt tgagttctac cacgttttgg tcaccacgag atccaccatc accaaaaaca 1200 tctctggttc gtttttgcca ccacggatac atatcatatc cgatttggaa gtttaaatac 1260 aatctggaaa gcttatctta tcttctttcc aacggatctg accttatctc aaaattcgtt 1320 ctgagcgctc cgcaatcatc gtagagattt ctggactttc tatattaaca agatttgtta 1380 aatctgattt aaaggggttg ttagcaatat ctttattgtt tgggttgtca tagtgaaaaa 1440 aagggtttag gcccctgcaaaaaaaaacag aagaagaaga aaaaaaaaga atagaaaaga 1500 aaaaaaagga aaagaagaag aagggggctg aatctctaaa tctgttgttt ctctttgtgc 1560 tgtgctagtt gttctttttc agtgactacc tttgtgccta ggctcacgtc tctagcctgg 1620 tttagcctag gaccagcaca gtaccaccgt tgaacgatta ttcagcttgc ttttgtaact 1680 aacgtggtac tagtgtattc cttgcttcag cccacctaca actctacata tttcgactac 1740 agtttgacag gtcgtgttgc tgcggcaccg atacacttat tccacggttg cagacttgtt 1800 ggttgctgac ccctcctgtt gtgcaaggta agaattggta agagcttgtg tggcaggttg 1860 agagtgagcg ccttgcagta gctacatcct aatagttgta gagtttttat tccttcacat 1920 ttttttttct tgttgcctct gttcgtctaa ccatggcagg attggaggtt gatgatgctt 1980 ctcgtaatat gccacactct cctcgcacca agggtatcat acaacacttt gtaaggctgg 2040 tgaaaacgca cacggaaggt cttgataatg acatgcaggt gacgaatgaa aagatggggc 2100 aattggaggc cacacagatc gacacaaaca ccaaacttgc aaatgtggaa atgacagttg 2160 ctcatattga caagagccttgtcgcactct tgaggcgatt tgatgagatg catgctaata 2220 ccaatggtgg gcgtgatgag ggcgccgaag gtaactggga tgactatgtt gctgatactg 2280 aacaagatga ccaagaagca cctaatcgcc ggcgactacg tactaaccgt agaggtatgg 2340 gtggttttca ccgacgtgag gtacatggta atgatgatgc ttttagtaag gttaaattta 2400 aaatacctcc ttttgatggt aaatatgacc ctgatgctta cattacttgg gagattgcgg 2460 ttgatcaaaa gtttgcatgc catgaatttc ctgagaatgc gcgggttaga gctgctacta 2520 gtgagtttac tgaatttgct tctgtttggt ggatagaaca tggtaagaag aatcctaata 2580 acatgccaca aacttgggat gcgttgaaac gggtcatgcg ggctagattt gttccttctt 2640gagattgcgg 2460 ttgatcaaaa gtttgcatgc catgaatttc ctgagaatgc gcgggttaga gctgctacta 2520 tggtaagaag aatcctaatagagattgcgg 2460 ttgatcaaaa gtttgcatgc catgaatttc ctgagaatgc gcgggttaga gctgctacta 2520 tggtaagaag aatcctaata

- 105 attatgcacg tgatatgtta aacaagttgc aacaattgag acagggtact aaaagtgtag 2700 aagaatatta tcaggaatta caaatgggta tgctgcgttg taacatagag gagggtgagg 2760 aatctgctat ggctagattt ttgggcgggt taaataggga aattcaggac atccttgctt 2820 ataaagatta tgctaatgta acccgattgt ttcatcttgc ttgcaaagct gaaagggaag 2880 tgcagggacg acgtgctagt gcaaggtcta atgtttctgc aggaaaatct acaccatggc 2940 aacagcgcac gactacgtcc atgaccggcc gtacactagc accaactccc tcgccaagtc 3000 gaccagcacc cccgccttcc tccagcgaca aaccacgtgc atcttccaca aattcagcaa 3060 ccaaatctgc ccagaaacca gcaggtagtg cctcttcagt agcctccacg ggtagaacaa 3120 gagatgttct gtgttatcga tgcaagggct atggacacgt gcagcgtgat tgtcctaatc 3180 agcgtgtttt ggtggtaaaa gacgatggtg ggtattcctc tgctagtgat ttggatgaag 3240 ctacacttgc tttgcttgcg gctgatgatg caggcactaa ggaaccaccc gaagaacaga 3300 ttggtgcaga tgatgcagag cattatgaga gcctcattgt acagcgtgtg cttagtgcac 3360aaatggagaa ggcagagcag aatcagcgac atacgttgtt tcaaacaaag tgtgtcatta 3420 aggagcgttc atgtcgtttg atcattgatg gaggtagctg caacaacttg gctagcagcg 3480 acatggtgga gaagcttgca cttacgacca aaccgcaccc gcatccatat cacattcaat 3540 ggctcaacaa tagtggtaag gtcaaggtaa ccaagctggt acgaattaat tttgctattg 3600 gttcatatcg tgatgttgtt gactgtgatg ttgtgcctat ggatgcttgt aatattctgc 3660 taggtagacc atggcaattt gattcagatt gtatgcatca tggtagatca aatcaatatt 3720 ctctcataca ccatgataag aaaattattt tgcttcccat gtcccctgag gctattgtgc 3780 gtgatgatgt tgctaaagct accaaagcta aaactgagaa caacaagaat attaaagttg 3840 ttggtaataa caaagatggg ataaaattga aaggacattg cttgcttgca acaaaaactg 3900 atgttaatga attatttgct tccactactg ttgcctacgc cttggtatgc aaggatgctt 3960 tgatttcaat tcaagatatg cagcattctt tgcctcctgt tattactaac attttgcagg 4020 agtattctga tgtatttcca agtgagatac cagaggggct gccacctata cgagggattg 4080agcaccaaat tgatcttatt cctggtgcat ctttgccgaa tcgtgcgcca tataggacaa 4140 atccagagga aacaaaagaa attcagcgac aagtgcaaga actactcgac aaaggttacg 4200 tgcgtgagtc tcttagtccg tgtgctgttc cggttatttt agtgcctaaa aaagatggaa 4260 catggcgtat gtgtgttgat tgtagggcta ttaataatat cacgatacgt tatcgacacc 4320 ctattccacg tttagatgat atgcttgatg aattgagtgg tgccattgtc ttttctaaag 4380 ttgatttgcg tagtgggtac caccagattc gtatgaaatt gggagatgaa tggaaaactg 4440 ctttcaaaac taagttcgga ttgtatgagt ggttagtcat gccttttggg ttaactaatg 4500 cacctagcac tttcatgaga ttaatgaacg aggttttgcg tgccttcatt ggaaaatttg 4560 tggtagtata ctttgatgac atattaatct acagcaaatc tatggatgaa catgttgatc 4620 acatgcgtgc tgtttttaat gctttacgag atgcacgttt atttggtaac cttgagaagt 4680 gcacattttg caccgatcga gtttcgtttc ttggttatgt tgtgactcca cagggaattg 4740 aggttgatca agccaaggta gaagcgatac atggatggcc tatgccaaag actatcacac 4800aggtgcggag tttcctagga cttgctggct tctatcgccg ttttgtgaag gactttagca 4860 ccattgctgc acctttgaat gagcttacga agaagggagt gcattttagt tggggcaaag 4920 tacaagagca cgctttcaac gtgctgaaag ataagttgac acatgcacct ctcctccaac 4980 ttcctgattt taataagact tttgagcttg aatgtgatgc tagtggaatt ggattgggtg 5040 gtgttttgtt acaagaaggc aaacctgttg catattttag tgaaaaattg agtgggtctg 5100 ttctaaatta ttctacttat gataaggaat tatatgctct tgtgcgaaca ttagaaacat 5160 ggcagcatta tttgtggccc aaagagtttg ttattcattc tgatcatgaa tctttgaaac 5220 atattcgtag tcaaggaaaa ctgaaccgta gacatgctaa gtgggttgaa tttatcgaat 5280 cgtttcctta tgttattaag cacaagaaag gaaaagagaa tatcattgct gacgctttgt 5340 ctaggagata tactttgctg aatcaacttg actacaaaat ctttggatta gagacgatta 5400 aagaccaata tgttcatgat gctgatttta aagatgtgtt gctgcattgt aaagatggga 5460 aaggatggaa caaatatatc gttagtgatg ggtttgtgtt tagagctaac aagctatgca 5520ttccagctag ctccgttcgt ttgttgttgt tacaggaagc acatggaggt ggcttaatgg 5580 gacattttgg agcaaagaaa acggaggaca tacttgctgg tcatttcttt tggcccaaga 5640 tgagaagaga tgtggtgaga ttggttgctc gttgcacgac atgccaaaag gcgaagtcac 5700 ggttaaatcc acacggtttg tatttgcctc tacccgttcc tagtgctcct tgggaagata 5760 tttctatgga ttttgtgctg ggattgccta ggactaggaa gggacgtgat agtgtgtttg 5820 tggttgttga tagattttct aagatggcac atttcatacc atgtcataaa actgacgatg 5880 ctactcatat tgctgatttg ttctttcgtg aaattgttcg cttgcatggt gtgcccaaca 5940 caatcgtttc tgatcgtgat gctaaatttc ttagtcattt ttggaggact ttgtgggcaa 6000 aattggggac taagctttta ttttctacta catgtcatcc tcaaactgat ggtcaaactg 6060 aagttgtgaa tagaactttg tctactatgt taagggcagt tctaaagaag aatattaaga 6120 tgtgggagga ctgtttgcct catattgaat ttgcttataa tcgatcattg cattctacta 6180 caaagatgtg cccatttcag attgtatatg gtttgttacc tcgtgctcct attgatttaa 6240tgcctttgcc atcttctgaa aaactaaatt ttgatgctac taggcgtgct gaattgatgt 6300

- 106 taaaactgca cgaaactact aaagaaaaca tagagcgtat gaatgctaga tataagtttg 6360 ctagtgataa aggtagaaag gaaataaatt ttgaacctgg agatttagtt tggttgcatt 6420 tgagaaagga aaggtttcct gaattacgaa aatctaaatt gttgcctcga gccgatggac 6480 cgtttaaagt gctagagaaa attaacgaca atgcatatag gctagatctg cctgcagact 6540 ttggggttag ccccacattt aacattgcag atttaaagcc ctacttggga gaggaagttg 6600 agcttgagtc gaggacgact caaatgcaag aaggggagaa tgatgaagac atccacacta 6660 ctgatgcatc tataccaata caagtaccaa tttctggtcc cattactcgc gctcgtgctc 6720 gtcaactcaa ccatcaggtg attacactct tgagttcatg tccatcatat ttagagccat 6780 ggagacccgt gcactcttgt tttgcttagg aatcagggag aagaccgaaa gggaaaagga 6840 tttgaacatg ctggattcgg actgcagaag aacaccaact tgtgacggtc accacggtca 6900 gatgcgggct cggattggaa tgttcaagca caacatggaa agcttatcaa gtctactttc 6960 atatggatcc ggaattatag tcatatctgt tctgaggccg ccgtaatcat tgttttctta 7020ccgagacatt tcctgccttt tctgcccatg gtgctgcgtc accctatttt ggcccaatgg 7080 gtcgtgtatc aagttaggtc cattagggac gcatcctagg gttgcagcac gaccccaata 7140 cccttgtggt cgtcctccca tgtttataaa ccccctagcc gccaccaaga acagcgggtt 7200 ttgtttagat caagtttagc tctcgctact tgcttgtaag cgcgcgtgct agttcagccg 7260 cccgtcttct tgtcttcgga accccaccat attggagttt gattttgaaa cctacattta 7320 gatctggtaa ttcagtactt gttctacttg ttcttgctag ttcttcgatt gcttgcagga 7380 cgagtgccct agtggccagg gtgtcacgct ccacaagatc gtgacagcca taggaggtgg 7440 tgtatcggtt gctaaggcgc agcgtctttg gaaggctgta gtcgggccgt gaacgtcgtc 7500 tcctccccca atcgagttat tccacaccct ctcatcgaaa gatcgggcaa tcacccaacg 7560 ggtgcacatc ag 7572 &lt;210&gt; 5 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo telomere 1 1 &lt;400&gt; 5 agggtttagg gtttagggtt tagggtttag gg 32 &lt;210&gt; 6 &lt;211&gt; 30 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo telomere 2 extractor &lt;400&gt; 6

- 107 ccctaaaccc taaaccctaa accctaaacc 30 &lt;210&gt; 7 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentC-OVG-1-40-F Biocode 65644 &lt;400&gt; 7 ggttccggtg gcaaaaactc gtgc 24 &lt;210&gt; 8 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CentC-OVG-1-40-R primer Biocode 65645 &lt;400&gt; 8 tgtcggtgca trafficking gagt 24 &lt;210&gt; 9 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentC-OVG-51-90-F Biocode 65646

- 108 &lt;400&gt; 9 gaatgggtga cgtgcgacaa cgaa 24 &lt;210&gt; 10 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentC-OVG-51-90-R Biocode 65647 &lt;400&gt; 10 ggtggtttct cgcaatttcg ttgt 24 &lt;210&gt; 11 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentC-OVG-101-140-F Biocode 65648 &lt;400&gt; 11 gttttggacc taaagtagtg gatt 24 &lt;210&gt; 12 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentC-OVG-101-140-R Biocode 104790

- 109 &lt;400&gt; 12 cacaacgaac atgcccaatc cact 24 &lt;210&gt; 13 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Priemr CRM1-LTR-OVG1-F Biocode 69509 &lt;400&gt; 13 cttggtcttg gacagtacct cact 24 &lt;210&gt; 14 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG2-F primer Biocode 69510 &lt;400&gt; 14 cccttgcgat ccgactacga cgag 24 &lt;210&gt; 15 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG3-F Biocode 69511 primer

- 110 &lt;400&gt; 15 tcacgaagat cgtttcctgt gcgc 24 &lt;210&gt; 16 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG4-F primer Biocode 69512 &lt;400&gt; 16 cagcgcagat tagcgcgtgt tcga 24 &lt;210&gt; 17 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Starter CRM1-LTR-OVG5-F Biocode 69513 &lt;400&gt; 17 ccaaccctag gtcgtccatt atgg 24 &lt;210&gt; 18 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

- 111 &lt;223&gt; Primer CRM1-LTR-OVG6-F Biocode 69514 &lt;400&gt; 18 ttcaattctc ttgcacgggc ccga 24 &lt;210&gt; 19 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG1-R primer Biocode 69515 &lt;400&gt; 19 tcaggtctac ttcatcagtg aggt 24 &lt;210&gt; 20 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG2-R primer Biocode 69516 &lt;400&gt; 20 tggcgcctcg ggcttgctcg tcgt 24 &lt;210&gt; 21 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG3-R primer Biocode 69517

- 112 &lt;400&gt; 21 tgttcgttct tcgattgcgc acag 24 &lt;210&gt; 22 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG4-R primer Biocode 69518 &lt;400&gt; 22 ttagccttag ctactctcga acac 24 &lt;210&gt; 23 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG5-R primer Biocode 69519 &lt;400&gt; 23 ccagcccaat tgcggcccat aatg 24 &lt;210&gt; 24 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM1-LTR-OVG6-R primer Biocode 69520

- 113 &lt;400&gt; 24 cacctgggcc agtgactcgg gccc 24 &lt;210&gt; 25 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG1-F primer Biocode 69521 &lt;400&gt; 25 tgatgaagac atccacacta ctga 24 &lt;210&gt; 26 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG2-F primer Biocode 69522 &lt;400&gt; 26 ttgaacatgc tggattcgga ctgc 24 &lt;210&gt; 27 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG3-F Biocode 69523 primer

- 114 &lt;400&gt; 27 ctgcccatgg tgctgcgtca ccct 24 &lt;210&gt; 28 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG4-F primer Biocode 69524 &lt;400&gt; 28 gcgcgtgcta gttcagccgc ccgt 24 &lt;210&gt; 29 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG5-F primer Biocode 69525 &lt;400&gt; 29 gtatcggttg ctaaggcgca gcgt 24 &lt;210&gt; 30 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

- 115 &lt;223&gt; CRM2-LTR-OVG1-R primer Biocode 69526 &lt;400&gt; 30 tattggtata gatgcatcag tagt 24 &lt;210&gt; 31 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG2-R primer Biocode 69527 &lt;400&gt; 31 aagttggtgt tcttctgcag tccg 24 &lt;210&gt; 32 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG3-R primer Biocode 69528 &lt;400&gt; 32 cccattgggc caaaataggg tgacg 25 &lt;210&gt; 33 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 116 &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG4-R primer Biocode 69529 &lt;400&gt; 33 tccgaagac aagaagacgg gcgg 24 &lt;210&gt; 34 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; CRM2-LTR-OVG5-R primer Biocode 69530 &lt;400&gt; 34 ctacagcctt ccaaagacgc tgcg 24 &lt;210&gt; 35 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG1-F Biocode 69531 &lt;400&gt; 35 tgatgagaac ataacccgca caga 24 &lt;210&gt; 36 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 117 &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG2-F Biocode 69532 &lt;400&gt; 36 aggatgatga ggacatcact gcca 24 &lt;210&gt; 37 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG3-F Biocode 69533 &lt;400&gt; 37 aaccatctag aatttgagaa ggca 24 &lt;210&gt; 38 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG4-F Biocode 69534 &lt;400&gt; 38 gtccagaa ac tgccgagtga actc 24 &lt;210&gt; 39 &lt;211&gt; 24 &lt;212&gt; DNA

- 118 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG5-F Biocode 65535 &lt;400&gt; 39 gagagagttt cgttctccat tag 24 &lt;210&gt; 40 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG6-F Biocode 69536 &lt;400&gt; 40 gttcttgctt gttctcgatt gctt 24 &lt;210&gt; 41 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG7-F Biocode 69537 &lt;400&gt; 41 ttggttgtgg tagtcgggca gcca 24 &lt;210&gt; 42 &lt;211&gt; 24

- &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG1-R Biocode 69538 &lt;400&gt; 42 cattaacatg gtcatatctg tgcg 24 &lt;210&gt; 43 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG2-R Biocode 69539 &lt;400&gt; 43 tggtgtggtg tattgatggc agtg 24 &lt;210&gt; 44 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG3-R Biocode 69540 &lt;400&gt; 44 cttttattgc cttgttgcct tct 23 &lt;210&gt; 45

- 120 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG4-R Biocode 69541 &lt;400&gt; 45 gacttgggta gagcaggagt tcac 24 &lt;210&gt; 46 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG5-R Biocode 69542 &lt;400&gt; 46 aggaatagaa aggagttcta atgg 24 &lt;210&gt; 47 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG6-R Biocode 69543 &lt;400&gt; 47 acagccttga acctgcaagc aatc 24

- 121 &lt;210&gt; 48 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer CentA-LTR-OVG7-R Biocode 69544 &lt;400&gt; 48 tgttggagaa cgacgttggc tgcc 24 &lt;210&gt; 49 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG1-F Biocode 69555 &lt;400&gt; 49 taagtgcaaa ccattgttaa attt 24 &lt;210&gt; 50 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG2-F Biocode 69556 &lt;400&gt; 50 cacaaaccct taactcgaaa ctat 24

- 122 &lt;210&gt; 51 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG3-F Biocode 69557 &lt;400&gt; 51 atcgaaagat aactcatatg gctt 24 &lt;210&gt; 52 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG4-F Biocode 69558 &lt;400&gt; 52 tccactaaag aaccaagatt gtga 24 &lt;210&gt; 53 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG1-R Biocode 69559 &lt;400&gt; 53

- 123 aattgtacta tctctaaaat ttaa 24 &lt;210&gt; 54 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG2-R Biocode 69560 &lt;400&gt; 54 tttagggttt ggggttatag tttc 24 &lt;210&gt; 55 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG3-R Biocode 69561 &lt;400&gt; 55 gaccataatg gtcaaaaagc cata 24 &lt;210&gt; 56 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer Cent4-250-OVG4-R Biocode 69562

- 124 &lt;400&gt; 56 atatgttgga cacaaatcac aatc 24 &lt;210&gt; 57 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG1-F Biocode 69634 &lt;400&gt; 57 ccggaaataa gcaaagtcca agcg 24 &lt;210&gt; 58 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG2-F Biocode 69635 &lt;400&gt; 58 tatgtcttgg gtgaagggca tggc 24 &lt;210&gt; 59 &lt;211&gt; 24 &lt;212&gt; DNA &lt;

213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG3-F Biocode 69636

- 125 &lt;400&gt; 59 cgcaaggcga cgggcggcat ggct 24 &lt;210&gt; 60 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG4-F Biocode 69637 &lt;400&gt; 60 cgaggggttc cccatggcgc acgg 24 &lt;210&gt; 61 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG1-R Biocode 69638 &lt;400&gt; 61 tcggtgtctt tccacacgct tgga 24 &lt;210&gt; 62 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

- 126 &lt;223&gt; Primer 18-26SrDNANTS-OVG2-R Biocode 69639 &lt;400&gt; 62 gttttccctc cgttccgcca tccc 24 &lt;210&gt; 63 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG3-R Biocode 69640 &lt;400&gt; 63 agacgcaagg ccgaacagcc atgc 24 &lt;210&gt; 64 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 18-26SrDNANTS-OVG4-R Biocode 69641 &lt;400&gt; 64 ggcctcagtt ttcggcccgt gcgc 24 &lt;210&gt; 65 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 127 &lt;220&gt;

&lt;223&gt; Primer Subtelomere-266 Biocode 74794 &lt;400&gt; 65 gacacatgtt tttgtcgtcg aaca 24 &lt;210&gt; 66 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode primer 74795 &lt;400&gt; 66 ggaggcacga aatcgctgtt cgac 24 &lt;210&gt; 67 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 primer Biocode 74796 &lt;400&gt; 67 cgaccgccac ccatgatttg acca 24 &lt;210&gt; 68 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 128 &lt;220&gt;

&lt;223&gt; Primer Subtelomere-266 Biocode 74797 &lt;400&gt; 68 accttaccag tctctatggt caaa 24 &lt;210&gt; 69 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74799 &lt;400&gt; 69 tcccgtgagc tatagcacac gttt 24 &lt;210&gt; 70 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74800 primer &lt;400&gt; 70 acacgttttc atggccgagc gacc 24 &lt;210&gt; 71 &lt;211&gt; 24 &lt;212&gt; DNA

- 129 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74801 primer &lt;400&gt; 71 ccgtgttcct ccacacgtgt tttt 24 &lt;210&gt; 72 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer Subtelomere-266 Biocode 74802 &lt;400&gt; 72 aaggtgctcc ggggacaaaa acac 24 &lt;210&gt; 73 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74803 &lt;400&gt; 73 tgcgcccc gcgagctata tcac 24 &lt;210&gt; 74 &lt;211&gt; 24 &lt;212&gt; DNA

- 130 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74803 &lt;400&gt; 74 ttggccacgg aaatgtgtga dad 24 &lt;210&gt; 75 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74805 &lt;400&gt; 75 ttatgtatcc gacctgccac cttc 24 &lt;210&gt; 76 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 primer BIocode 74806 &lt;400&gt; 76 ctccccggtc taaaacgaag gtgg 24 &lt;210&gt; 77 &lt;211&gt; 24

- 131 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74807 &lt;400&gt; 77 gccacccgtg agonist cacg 24 &lt;210&gt; 78 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Subtelomere-266 Biocode 74808 &lt;400&gt; 78 taggtttcca taaaatcgtg tgct 24 &lt;210&gt; 79 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 180-knob-OVG-21-60-F Biocode 65650 &lt;400&gt; 79 tgtcgaaaat agccatgaac gacc 24 &lt;210&gt; 80

- 132 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 180-knob-OVG-21-60-R primer Biocode 65651 &lt;400&gt; 80 cggtattatt ggaaatggtc gttc 24 &lt;210&gt; 81 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 180-knob-OVG-71-110-F Biocode 65652 &lt;400&gt; 81 cctacggatt tttgaccaag aaat 24 &lt;210&gt; 82 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 180-knob-OVG-71-110-R Biocode 65653 &lt;400&gt; 82 atttctagtg gagaccattt cttg 24

- 133 &lt;210&gt; 83 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 180-knob-OVG-141-180-F primer Biocode 65654 &lt;400&gt; 83gpggggggg aggtgtatga gcct 24 &lt;210&gt; 84 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 180-knob-OVG-141-180-R primer Biocode 65655 &lt;400&gt; 84 atgagcctct ggtcgatgat caat 24 &lt;210&gt; 85 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-1-40-F primer Biocode 65656 &lt;400&gt; 85 ggatgcgatc ataccagcac taaa 24

- 134 &lt;210&gt; 86 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-1-40-R primer Biocode 65657 &lt;400&gt; 86 tgatgggatc cggtgcttta gtgc 24 &lt;210&gt; 87 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-61-100-F Primer Biocode 65658 &lt;400&gt; 87 cttgggcgag agtagtacta ggat 24 &lt;210&gt; 88 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 5S-rDNA-OVG-61-100-R Biocode 65659 &lt;400&gt; 88

- 135 tcccaggagg tcacccatcc tagt 24 &lt;210&gt; 89 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-161-200-F Primer Biocode 65660 &lt;400&gt; 89 accatagtaa aaatgggtga ccgt 24 &lt;210&gt; 90 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-161-200-R primer Biocode 65661 &lt;400&gt; 90 taatttaaca cgagaacggt cac 23 &lt;210&gt; 91 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-261-230-F Biocode 65662 primer

- 136 &lt;400&gt; 91 ccgtgggcga gccgagcacg gagg 24 &lt;210&gt; 92 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; 5S-rDNA-OVG-261-230-R primer Biocode 65663 &lt;400&gt; 92 tcctcttatg cccacacctc cgtg 24 &lt;210&gt; 93 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-31-70-F Biocode 65664 &lt;400&gt; 93 ctcaaatgac gtttctatga tatt 24 &lt;210&gt; 94 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-31-70-R Biocode 65665

- 137 &lt;400&gt; 94 tgaatacaat gccctcaata tcat 24 &lt;210&gt; 95 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-121-160-F Biocode 65666 &lt;400&gt; 95 ctaggtttcc tataatccccccc tcc 24 &lt;210&gt; 96 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-121-160-R Biocode 65667 &lt;400&gt; 96 ctaggtatgc cttgaataga ggg 23 &lt;210&gt; 97 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-161-200-F Biocode 65668

- 138 &lt;400&gt; 97 atgttgttta tgtccactca agta 24 &lt;210&gt; 98 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-161-200-R Biocode 65669 &lt;400&gt; 98 atggtgtacg gtgttttact tgag 24 &lt;210&gt; 99 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-261-300-F Biocode 65670 &lt;400&gt; 99 gtgagatctg tccaaacata ggtt 24 &lt;210&gt; 100 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 350-knob-OVG-261-300-R Biocode 65671

- 139 &lt;400&gt; 100 ggtgccttac aaccgtaacc tatg 24 &lt;210&gt; 101 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer to b010.m7 fis31 &lt;400&gt; 101 gcaaacttta tgtgatccct tcctcgctga acgagatgag &lt;210&gt; 102 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Primer to b108.h15 fis47 &lt;400&gt; 102 gggacggcaa gtcacggtaa gaccagtcca accgaatgat &lt;210&gt; 103 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

- 140 &lt;223&gt; Primer for Cen3n.pk0001.g11 &lt;400&gt; 103 ccaaacttgc tgagattact gggcaatctg ttcgctcgca 40 &lt;210&gt; 104 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3101-3200f Biocode 103022 &lt;400&gt; 104 ccaggtagtt tgaaacagta ttct 24 &lt;210&gt; 105 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3501-3600f Biocode 103023 &lt;400&gt; 105 ataaaggaaa agggcaaacc aaac 24 &lt;210&gt; 106 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 141 &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1401-1500f Biocode 103024 &lt;400&gt; 106 gatgcccaca ttatagtgat tagc 24 &lt;210&gt; 107 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-2901-3000f Biocode 103025 &lt;400&gt; 107 ccacatatag ctgctgcata tgcc 24 &lt;210&gt; 108 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3701-3800f Biocode 103026 &lt;400&gt; 108 cggatctaac acaaacatga acag 24 &lt;210&gt; 109 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 142 &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1-100f Biocode 103027 &lt;400&gt; 109 cgatgaattt tctcgggtgt tctc 24 &lt;210&gt; 110 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-101-200f Biocode 103028 &lt;400&gt; 110 cctgcagccc taataattca gaag 24 &lt;210&gt; 111 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-301-400f Biocode 103029 &lt;400&gt; 111 cacagtcgat gaatccagaa aagc 24 &lt;210&gt; 112 &lt;211&gt; 24 &lt;212&gt; DNA

- 143 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-901-1000f Biocode 103030 &lt;400&gt; 112 gcgtgcaatc catcttgttc aatc 24 &lt;210&gt; 113 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3201-3300f Biocode 103031 &lt;400&gt; 113 caaccacacc acatcatcac aacc 24 &lt;210&gt; 114 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-3601-3700f Probe Overgoer Biocode 103032 &lt;400&gt; 114 actggcaagt tagcaatcag aacg 24 &lt;210&gt; 115 &lt;211&gt; 24

- 144 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4901-5000f Biocode 103033 &lt;400&gt; 115 catgaacgtg tcttcaacta gagg 24 &lt;210&gt; 116 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4201-4300f Biocode 103034 &lt;400&gt; 116 gacggcgttt aacaggctgg catt 24 &lt;210&gt; 117 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-201-300f Biocode 103035 &lt;400&gt; 117 ccaagctctt cagcaatatc acgg 24 &lt;210&gt; 118

- 145 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-601-700f Biocode 103036 &lt;400&gt; 118 atactttctc ggcaggagca aggt 24 &lt;210&gt; 119 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1001-1100f Biocode 103037 &lt;400&gt; 119 atccttggcg gcaagaaagc catc 24 &lt;210&gt; 120 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo Probe Probe 23715-1101-1200f Biocode 103038 &lt;400&gt; 120 gcaagctacc tgctttctct ttgc 24

- 146 &lt;210&gt; 121 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1601-1700f Biocode 103039 &lt;400&gt; 121 gcttcttggc catgtagatg gact 24 &lt;210&gt; 122 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1801-1900f Biocode 103040 &lt;400&gt; 122 ttcacgccga tgaacttcac cttg 24 &lt;210&gt; 123 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;400&gt; 123 aagcttgcca acgactacgc acta 24 &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-5001-5087f Biocode 103041

- 147 &lt;210&gt; 124 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-401-500f Biocode 103042 &lt;400&gt; 124 ccctgatgct cttcgtccag atca 24 &lt;210&gt; 125 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe starter 23715-801-900f Biocode 103043 &lt;400&gt; 125 agagcagccg attgtctgtt gtgc 24 &lt;210&gt; 126 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-1301-1400f Biocode 103044 &lt;400&gt; 126

- 148 caggatcccg taactataac ggtc 24 &lt;210&gt; 127 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-2801-2900f Biocode 103045 &lt;400&gt; 127 cgacctgcag aagtaacacc aaac 24 &lt;210&gt; 128 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3401-3500f Biocode 103046 &lt;400&gt; 128 atctagaacg accgcccaac caga 24 &lt;210&gt; 129 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-3801-3900f Biocode 103047

- 149 &lt;400&gt; 129 atttggggga gatctggttg tgtg 24 &lt;210&gt; 130 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3901-4000f Biocode 103048 &lt;400&gt; 130 gagggggtgt ctatttatta cggc 24 &lt;210&gt; 131 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4801-4900f Biocode 103049 &lt;400&gt; 131 catgcaagct gatctgagct tggc 24 &lt;210&gt; 132 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-2101-2200f Biocode 103050 &lt;400&gt; 132

- 150 tccatgcgca ccttgaagcg catg 24 &lt;210&gt; 133 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-501-600f Biocode 103051 &lt;400&gt; 133 ttccatccga gtacgtgctc gctc 24 &lt;210&gt; 134 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1201-1300f Biocode 103052 &lt;400&gt; 134 atccactagt aacggccgcc agtg 24 &lt;210&gt; 135 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-4001-4100f Biocode 103053

- 151 &lt;400&gt; 135 gccacgcaat ttctggatgc cgac 24 &lt;210&gt; 136 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-701-800f Biocode 103054 &lt;400&gt; 136 cgatagccgc gctgcctcgt cttg 24 &lt;210&gt; 137 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1901-2000f Biocode 103055 &lt;400&gt; 137 cacttgaagc cctcggggaa ggac 24 &lt;210&gt; 138 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-1701-1800f Biocode 103056 probe

- 152 &lt;400&gt; 138 tccttcagct tcagggcctt gtgg 24 &lt;210&gt; 139 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-2001-2100f Biocode 103057 &lt;400&gt; 139 caccttggag ccgtactgga actg 24 &lt;210&gt; 140 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-2601-2700f Biocode 103058 &lt;220&gt;

&lt;400&gt; 140 tgcggctcgg tgcggaagtt cacg 24 &lt;210&gt; 141 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- &lt;223&gt; Overgo probe 23715-4101-4200f Biocode 103059 &lt;400&gt; 141 acgcgacgct gctggttcgc tggt 24 &lt;210&gt; 142 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-3101-3200r Biocode 103060 &lt;400&gt; 142 cgttctagat cggagtagaa tact 24 &lt;210&gt; 143 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3501-3600r Biocode 103061 &lt;400&gt; 143 tgtttcgttg catagggttt ggtt 24 &lt;210&gt; 144 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 154 &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1401-1500r Biocode 33332 &lt;400&gt; 144 gcacacatag tgacatgcta atca 24 &lt;210&gt; 145 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-2901-3000r Biocode 103062 &lt;400&gt; 145 gatatacttg gatgatggca tatg 24 &lt;210&gt; 146 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe starter 23715-3701-3800r Biocode 103063 &lt;400&gt; 146 cccggtagtt ctacttctgt tcat 24 &lt;210&gt; 147 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 155 &lt;220&gt;

&lt;223&gt; Overgo 23715-1-100r Probe Overlord Biocode 103064 &lt;400&gt; 147 attacgagcca atatgcgaga acac 24 &lt;210&gt; 148 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo Probe Probe 23715-101-200 Biocode 103065 &lt;400&gt; 148 gccttcttga cgagttcttc tgaa 24 &lt;210&gt; 149 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-301-400r Probe Overlord Biocode 103066 &lt;400&gt; 149 atggtggaaa atggccgctt ttct 24 &lt;210&gt; 150 &lt;211&gt; 24 &lt;212&gt; DNA

- 156 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-901-1000r Biocode 103067 &lt;400&gt; 150 gaggatcgtt tcgcatgatt gaac 24 &lt;210&gt; 151 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-3201-3300 Probe Overbore Biocode 103068 &lt;400&gt; 151 tgctttttgt tcgcttggtt gtga 24 &lt;210&gt; 152 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-3601-3700r Probe Overlord Biocode 103069 &lt;400&gt; 152 acctgtacgt cagacacgtt ctga 24 &lt;210&gt; 153 &lt;211&gt; 24 &lt;212&gt; DNA

- 157 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4901-5000r Biocode 103070 &lt;400&gt; 153 aattaagtca ggcgcgcctc tagt 24 &lt;210&gt; 154 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4201-4300r Biocode 103071 &lt;400&gt; 154 cttgtttcga gtagataatg ccag 24 &lt;210&gt; 155 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo Probe Probe 23715-201-300r Biocode 103072 &lt;400&gt; 155 acatagcgtt ggctacccgt gata 24 &lt;210&gt; 156 &lt;211&gt; 24

- 158 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-601-700 Probe Probe Biocode 103073 &lt;400&gt; 156 gatctcctgt catctcacct tgct 24 &lt;210&gt; 157 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe starter 23715-1001-11OOr Biocode 103074 &lt;400&gt; 157 cctgcaaagt aaactggatg gctt 24 &lt;210&gt; 158 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1101-1200r Biocode 103075 &lt;400&gt; 158 aagggaaaac gcaagcgcaa agag 24 &lt;210&gt; 159

- 159 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1601-1700r Biocode 103076 &lt;400&gt; 159 tacctggtgg agttcaagtc catc 24 &lt;210&gt; 160 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1801-1900 Biocode 103077 &lt;400&gt; 160 acggctgctt catctacaag gtga 24 &lt;210&gt; 161 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;400&gt; 161 tgaagctctt gttggctagt gcgt 24 &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-5001-5087r Biocode 103078

- 160 &lt;210&gt; 162 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-401-500 Probe Probe Biocode 103079 &lt;400&gt; 162 gtcttgtcga tcaggatgat ctgg 24 &lt;210&gt; 163 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-801-900r Biocode 103080 &lt;400&gt; 163 attcggctat gactgggcac aaca 24 &lt;210&gt; 164 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;400&gt; 164 cgcttcgcta ccttaggacc gtta 24 &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-1301-1400 Biocode 103081

- 161 &lt;210&gt; 165 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-2801-2900r Biocode 103082 &lt;400&gt; 165 cgatgctcac cctgttgtttggtg 24 &lt;210&gt; 166 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-3401-3500r Biocode 88245 &lt;400&gt; 166 ggttgtgatg atgtggtctg gttg 24 &lt;210&gt; 167 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;400&gt; 167 &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-3801-3900r Biocode 103083

- 162 gttcggagcg cacacacaca caac 24 &lt;210&gt; 168 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-3901-4000r Probe Overlord Biocode 103084 &lt;400&gt; 168 tttcccttcc tcgccccccg taat 24 &lt;210&gt; 169 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4801-4900r Biocode 103085 &lt;400&gt; 169 taaaacgacg gccagtgcca agct 24 &lt;210&gt; 170 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-2101-2200 Biocode 103086 probe

- 163 &lt;400&gt; 170 acgtcatcac cgagttcatg cgct 24 &lt;210&gt; 171 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-501-600r Biocode 103087 &lt;400&gt; 171 agcgaaacat cgcatcgagc gagc 24 &lt;210&gt; 172 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1201-1300 Biocode 103088 &lt;400&gt; 172 aagccgaatt ccagcacact ggcg 24 &lt;210&gt; 173 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo Probe 23715-4001-4100r Biocode 103089

- 164 &lt;400&gt; 173 ttggacttgc tccgctgtcg gcat 24 &lt;210&gt; 174 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-701-800r Biocode 103090 &lt;400&gt; 174 tgccctgaat gaactgcaag acga 24 &lt;210&gt; 175 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-1901-2000r Biocode 103091 &lt;400&gt; 175 ccgactacaa gaagctgtcc ttcc 24 &lt;210&gt; 176 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

- 165 &lt;223&gt; Overgo probe 23715-1701-1800r Biocode 103092 &lt;400&gt; 176 tgctgaaggg cgagacccac aagg 24 &lt;210&gt; 177 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo 23715-2001-2100r Probe Probe Biocode 103093 &lt;400&gt; 177 ggacatcctg tccccccagt tcca 24 &lt;210&gt; 178 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Overgo probe 23715-2601-2700r Biocode 103094 &lt;400&gt; 178 acatcgagac ctccaccgtg aact 24 &lt;210&gt; 179 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 166 &lt;220&gt;

&lt;223&gt; Overgo probe 23715-4101-4200r Biocode 103095 &lt;400&gt; 179 agtctaacgg acaccaacca gcga 24 &lt;210&gt; 180 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; PCR primer for a single sequence bacm.pk108.h15.f &lt;400&gt; 180 gatcgtcgaa tgggaatcca tggg 24 &lt;210&gt; 181 &lt;211&gt; 28 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; PCR primer for single sequence bacm.pk108.h15.r &lt;400&gt; 181 ccctgagtga accatttagg aagatcag 28 &lt;210&gt; 182 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 167 &lt;220&gt;

&lt;223&gt; PCR primer for single sequence bacm.pk108.h15-2 FIS47.f &lt;400&gt; 182 tgcaacatcc aaagacccaa catg 24 &lt;210&gt; 183 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; PCR primer for single sequence bacm.pk108.h15-2 FIS47.r &lt;400&gt; 183 ttccaacatg gttggtggc ag 22 &lt;210&gt; 184 &lt;211&gt; 26 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; PCR primer for a single sequence bacm.pk010.m07.fis31.f &lt;400&gt; 184 tgtcatgaca tcttgttgct accctg 26 &lt;210&gt; 185 &lt;211&gt; 22 &lt;212&gt; DNA

- 168 &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; PCR primer for a single sequence bacm.pk010.m07.fis31.r &lt;400&gt; 185 aaacccggag tttctatgca gg 22 &lt;210&gt; 186 &lt;211&gt; 591 &lt;212&gt; DNA &lt;213&gt; Zea mays &lt;220&gt;

&lt;221&gt; misc feature &lt;222&gt; (1) ... (591) &lt;223&gt; n = a, t, c, or g &lt;221&gt; source &lt;222&gt; (1) ... (591) &lt;223&gt; single the sequence bacm.pk108.h15 &lt;400&gt;186 ttgctcgtaa cagatggttc angnnngatt gatcgtcgaa tgggaatcca tgggcaccca 60 cttgaaattc aggttttctt tttgctacac ctagttatat tttctgtttc atacgggtct 120 tttttcccaa gttgattttt tgtgattgtt tttgaggcac cttttaaaag aataaaatac 180 acaaacattc ttcaaattgt ctgggaatgt catctaggtt cccaaacgat tagtttggat 240 tcaaaacatc cctgatcttc ctaaatggtt cactcagggt tcgatccttc aaaatcagct 300 agtccacgac catcctactt ggcagcccct acatctcttt ctcccccctc tcgttcacac 360 cttgttaatg tccatcagca tagagtcttg ttagtgtcca cgtcgccagc caaaggattt 420 accatggggt ttgcaccttg agtgaaccac ataacaagtt gagggacatg aaattgcaaa 480 ttaatagctc agggatctcg ataacatgct tggacaagtt ttagcnactg ctgatgcatc 540 ttagtcctat taaaagnntn nnnnacagtg cnacgncccc tattttacac g 591 &lt;210&gt; 187 &lt;211&gt; 2000 &lt;212&gt; DNA

- 169 &lt;213&gt; Zea mays &lt;220&gt;

&lt;221&gt; source &lt;222&gt; (1) ... (2000) &lt;223&gt; single sequence bacm.pk108.h15-2.fis47 &lt;400&gt;187 tgagaggctg atatgtcttc ttttttttct tattttttct aaaatcctga ttcctttcaa 60 tgtcagtttt gaattccaaa ttcaaattta atttgattct caagcttcaa ttttaatgca 120 acatccaaag acccaacatg aaatgcataa ttccatttta tttatcttat tttatctatt 180 aaacaaagag tttcttaata tgaaacttat atacacaaaa gacactattc taagaaaaca 240 attcctcata tatcatctta aatcttttgc tgaatattct ttaaacatta attctaaata 300 gttttatttg tacaagaatt tgtgattatt tcctacgaag agatggttcc taggcactat 360 aatgaatagt tttgctaatt aaacaattga aaatgtttct atgttctctg ttttaacctt 420 agtttagagt ttttaacttc aagtttgaac taccaaagtt tgaacctctt tttttatttt 480 ctttatactt ttaaaataca tttaaactca aatcttttgg agaaccttta taaatcccaa 540 aatagggttt tgaggtgtta taaacgagga gtctgtgcat gggacggcaa gtcacggtaa 600 gaccagtcca accgaatgat ggggcagctc ggtgtcgtct caattaatgc atctcttaag 660 ttgctgacca ccaaccatgt tggaacctga tcagttggta cccattgtct gtttacatgt 720 ggtagcttctaattggttcg cgtgatcttg aattttaaaa aattgaaata acatttttat 780 aaaattagaa tctagcttgt ggtaacattg ctcactccat tgttgaatat atcaaaatgg 840 agaaagcacg acgttaaaat gcttgcaaca tttatgtagg agtgttattt tatgtttttg 900 cgaggagtat aatcgtagtg tcactgttga caatctttgg cgacttttag ctaaaggaga 960 ggagagacaa tttcttgcta atgataggaa ttatagattg catatattga aagtgataga 1020 gctagagtgc ccgatctttc ggtgagtgga gataattccg atttggtgga agtagaccct 1080 cacgatccga ctacgacgag cgaacccgaa gcgccaatgc aatcgctgaa ccaactccca 1140 atggttaccg accttgctta tgcgagatcg gcctgatcac gaagatcgtt tcctgtgcgc 1200 aatcgaagaa cgaacaagaa aaagatgcga gcaatcttaa tatcactcga ggtggagttc 1260 tgaatcacag aggacaacac gtatttgtgt gtgttctggg gtagctaaag ctagatgtaa 1320 aacaaaactc aagttctaaa tgaaacagga ctctgactaa atagaggaga ggcgtgaaca 1380 gtaggtcgac gctacagtac cacgtttact gttcacgact tacctaggcg ccccatccgg 1440 gccttcctat tggaccatcttctaatcttc tgggccttcg ttctttaaca acatgatgta 1500 gttcaattct cttgcacgag cctgagtcac tggcccaagt ggaagggtgg cgcctggact 1560 agggaagatg gtgcctgggc tggagaaggt gctgctggtg tagatgtact catgttggtg 1620 ttgatgtcct cctcatcctc cccttcttga actgaagtcg tcctcgacgg caactcctca 1680 tcttctcccg catacggttt caaatctgca acattaaaat tagtggaaac accaaacttc 1740 gcaggtaggt caaggatata agcattagca ttaatcttgg ttagtatctt aaaaggacca 1800 gcaacacgag gcatcaattt agaacggcgc aaagtaggaa aacgatcctt tctcaaatgc 1860 aacccaacca tatcaccagg ttcaaaagta actaggtttc tgggctttac taccaataat 1920 ctgatattta gcattagcag caacaatgtt ttgttgagtt tgttctggag gttatcattt 1980 gttcacatgt gcacatcatc 2000 &lt;210&gt; 188 &lt;211&gt; 1541 &lt;212&gt; DNA &lt;213&gt; Zea mays &lt;220&gt;

- 170 &lt;221&gt; source &lt;222&gt; (1) ... (1591) &lt;223&gt; single sequence bacm.pk010.m07-fis31 &lt;400&gt;188 atcgataccc ttaattggga gataactgtt atattaatag tgaaaaatcc atcctattat 60 aatttttgtt atatctttta catggccatc agtaatcaca gttaagagtt ggacaaaggc 120 actatggagc gtggcccttc taattgtgtt gctgaagttc ttattaaggt ttgccaattt 180 tttggtaggt gttccaaagc acagaaggct cttgagctaa gccaactttt aggagtcaac 240 atttcttcaa cacaggtact tctgaagtag tcatgagtca ttgcttatct gaagtaagga 300 gagaaagtta ttgcttttct tttctgatgc gtgaggttgt gcatgtacat tctatagagt 360 gtgcctttca agtactacat caataatttc ttatttcttc atagacctgt agcacctgaa 420 tgaaacctat ttttgaactc tgcatttttt gaagatgaca ttatgtatca atttagttct 480 gtattggttg ttgccaaaaa atttgtaaga tattgagata gataatatat gtgatatttt 540 tttatgtagt taggcaccta tcttggatac atggttgtca gcaagtgcag ccaatgaaag aggtctaaat agaaagaggc ccttccccgt cacccctttc gctccatccc gcgtcgtggt gcaaacttta gttcacacgt aatgacttgc catcttactt tgatcaagcg &lt;210&gt;189 tgttttgcaa actagtgtat cattatctag tgacatcttg gaatgtatga tttgaaaatg ttgtgataac gtggggagag ttcgtcttcc ctccttccgc cgcccgcgct cggccggtaa tgtgatccct gcacctgcat cacgcttcgt caaattcgtt taaagatacc taacattttg atataggatg tgtaggtgta ttgctaccct ccaatgcaaa cttgaccaga aaaacaagaa gcgcgagaga ggtcctcgtt cctccgccgc gcctcccctg gagttccttg tcctcgctga agaaactccg cttacttcaa cgattcttgc gtcgacctcc atgaatattt gaaacacaaa catgggtatt gacaggtaac agctaaagta ttttatcaac aaatagaaaa ggtggttggt ttatcccctc gcctggcttt gcgatcggcg ctttcctcta acgagatgag ggttttggct attcgttcaa tgggttcctc cgctttttga ttgtatatta ttgtaacaca caccatcgac gtcgatgatc atgattatca tagtgtgttt ctaaaaatcc aaaacacaat aagtgctttc taataaatac gtggggaaac tgggggtgga gcccttgcac ctcccttccc gcgaccgcgg cgcgttgctc aagaaaagtt tccgttggaa attaattact tgattatatc acattcgttg tgtatataat aaaaaatagt ggaccgtcgg tcctccgccg gagaggccaccccaacgaaa ctgccgttac gctgactttc aattttgata tgctatgctt tttttttgta

600

660

720

780

840

900

960

1020

1080

1140

1200

1260

1320

1380

1440

1500

1541 &lt;211&gt; 355 &lt;212&gt; DNA &lt;213&gt; qSequity Artificial &lt;220&gt;

&lt;223&gt; telo-266 consensus 355 bp repeat &lt;400&gt; 189 attttagtgt tgacatagta aaggctattt cccgtccgcc agctatagca cgttttggtc cgaaaccatg gaattttagt ttggcctccc acccatgatt camgttttca cccagagcac gtaaaatgaa gtccaaacca gtvacacatg tggccacwga tggtcgagcg cttaaagttg atttgagtct tagtacacat ttttcatcgt gactgctaag actattttta ttcttggcct cccaaccata tttggtcccc caaacaacga gctrtttatg agtacgtgtt cccacgagct tcaactttgc ggaggccggt tttcatgcct gcctcccgta ccaccacccg gtagg

120

180

240

300

355

- 171 &lt;210&gt; 190 &lt;211&gt; 430 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; TR430 subtelomeryczne repeat &lt;400&gt; 190 gacatggtag aggctatttt cgaccgccac tatagcacac ttttgtcccc ccgtggccaa gccgttatgg gaccctaaat aattttagtg ggcctcccgt ccatgatttg gttttcatgg ggagcacctt acaaccaatt caattttttt tccaaaccaa gacacatgtt accatagaga ccgagcgacc aaagcggttc ttatgtatcc gccacccgtg agtacacgtt tttgtcgtcg ctggtaaggt atttttatgt ttggcctccc gacctgccac agctatagca ttagtccccg aacagcgatt tgttttggcc ccgtgttcct gcgagctata cttcgtttta cacgatttta gaggcccgta tcgtgcctcc tcccgtgagc ccacacgtgt tcacacattt gaccggggag tggaaaccta

120

180

240

300

360

420

430 &lt;210&gt; 191 &lt;211&gt; 10368 &lt;212&gt; DNA &lt;213&gt; Zea mays &lt;400&gt; 191

<img file="PL2018435T3_D0001.tif" />

- 172 acgtgcgaca acgaaattgc gcgaaaccac cccaaacatg agttttggac ctaaagtagt 120 ggattgggca tgtttgttgc tgatgtagct gaggtgcccg atctttcggc gagtagagat 180 aattccgatt tggcggaaga tgacccttgc gatccgacta cgacgagcaa gcccgaggcg 240 ccaatgcaat cgctgaacca actccctgtg gttaccgacc ttgctgatgc gagatcggcc 300 tgatcacgaa gatcgtttcc tgtgcgcaat cgaagaacga acaagaacaa gatgcgagca 360 atctaatcta ttactcgagg gtggagttct gaatacacga ggacagcgca gatttgcgcg 420 tgttcggaag tagctaaggc taacgtaaaa caaaactccc caaaaataaa ggaggcgcag 480 ctcctgtata aatagagagg gggcgcagcc cctaggggcg gccaacccta ggtcgtccat 540 tatgggccgc aattgggctg gtcgtctatc cttccgggcc ttcgttcttt aacaacatga 600 tgtagttcaa ttctcttgca cgggcccgag tcactggccc aggtggaagg ggtggcgcct 660 gggctggaga aggtgctgct ggtgtagatg tgctcgtgtt ggtgttgatg tcctcatcat 720 cctccccttc ttgaactgaa gtcgtcctcg acggcaactc ctcatcttct cccgcatacg 780 gtttcaaatctgcaacatta aaactagtgg aaacaccaaa ctccgcaggc aggtcaagga 840 tataagcatt atcattaatc ttggttagta ccttaaaagg accagcagca cgaggcatca 900 atttagaacg gcgcaaagta ggaaaacgat cctttctcaa atgcaaccaa accatatcac 960 caggttcaaa agtaactagt ttccggcctt tactaccagt aatctgatat ttagcattag 1020 cagcagcaat gttttgttga gtttgttcat ggagattaat catttgttca acatgtgcaa 1080 gagcatctat gtgtggggcg tccgtagcat caagcgaaaa caaagcaata ggcgccctag 1140 gaatgtaacc ataaacaatt tgaaaagggc acatctttgt agaagaatgt gttgcatgat 1200 tataagcaaa ctcaacatga ggtaagcaat cctcccaacg tttcaaattt ttgtctaaaa 1260 cagccctaag catggtagac aaagttcgat taactacctc agtttgacca tcagtctgag 1320 ggtgacaagt ggtgctaaac agcaatttag ttcctaattt attccacaga gatctccaaa 1380 aatgactcag aaacttggca tcacgatccg agactattgt attgggaata ccgtgcaaac 1440 gaataatctc tctaaaaaac aattcagcaa cattgctagc atcatcagtc ttatgacaag 1500 gtatgaaatg agccattttggagaatcgat caacaaccac aaaaatgcta tccctcccct 1560 tcttagttct aggcaatccc aaaacaaaat ccatcgaaat atcaatccaa gggaaagtag 1620 gaacaggcaa aggcatatac aaaccatggt tgttcaaccg tgacttagct ttctgacaag 1680 tagtgcagcg tgcaacaagg cgctcaacat cagcgcgcat ccgaggccaa aagaagtggg 1740 cagccaacac ctcatgtgtc ttgtagacgc caaagtgccc catgagaccg cctccatgtg 1800 cttcctgtaa caacaaaaga cgaaccgagc tagctggaac acacagcttg ttagcgcgaa 1860 acaggaaccc atcctgtatg tgaaatttgc cccatggttt cccattaata caatggccga 1920 aagcatcttt aaaatcagca tcgtcaacat attgatcttt tacagtgtgc aaaccaaaga 1980 ttttaaaatc taactgtgac agcatggtat agcgacgaga caaagcatca gcaataacat 2040 tgtccttccc gttcttgtgt ttaataatgt aaggaaaaga ctcaatgaat tctacccatt 2100 tagcatgacg acggttcaga tttgtttggg tacgaatatg ttttaaagcc tcatgatcag 2160 aatgaattat gaactcacga tgccaaagat agtgctgcca tgtatgtaaa gtgcgcacta 2220 acgcgtaaag ctccttatcataagtagaat atttcagact agcaccgctt aatttttcac 2280 taaaataagc aactggtttt ccttcttgta ataaaacagc acctagccca ataccgctag 2340 catcgcattc aagctcaaat actttattaa aatcaggcaa ttgcaatagg ggagcttggg 2400 ttaacttatc tttcaaagtg ctgaacgctt cctcctgcga atcactccaa gcaaatggca 2460 catctttctt tgtaagctca tgtagaggcg ctgcaatgga gctaaaatca cgaacaaatc 2520 tgcggtagaa accggcaagt ccaagaaagc tccgaatttg tgtgaccgtc gtcggtgtag 2580 gccactcccg aatggcagca atcttgctgc tatccacctc aatgccctgt ggagtaacaa 2640 cataaccaag aaacgagaca cgtcgtgtgc aaaagatgca tttttccatg ttagcgaata 2700 actgggcggc acgcaatgca tcaaaaacag cacttaaatg ttccaaatgc tctttcttag 2760 atttgctgta aataaggata tcatcgaaat aaacaaccac aaacaatcct atgaagggcc 2820 tcagaacttc attcatcact cgcataaaag tgctgggagc attagtcaat ccaaacggca 2880 taaccaacca ttcatataaa ccaaatttcg ttttgaaggc tgttttccat tcatcaccta 2940 gtttcattct aatctggtggtaaccactac gcaaatcaat cttagtgaaa ataatggcac 3000 cactaagctc atctagcata tcatcaaggc gtggtatagg atagcgataa cgaatagtga 3060 tattattaat agcacgacag tctacacaca tacgccatga cccatccttc ttgggaacaa 3120 gtaacacagg aacagagcaa gggctaagag actcacgaat gtatcctttg tcaagcaacg 3180 cctttacctg gcgctgaatc tccttcgtct catccggatt tgtacggtat ggtgcgcggt 3240 ttggaagctg tgcaccggga atgaggtcga tctggtgctc aatgccacga agcggtggga 3300 gacccggtgg taagtctttg ggaaagacat cagcgtactc ctgcaaaagg ttagcaacca 3360 tagggggaat agccaaagat ggtgcatcat caagtgaaat gaggacacta gagcatacaa 3420 gtgcatagca tggcaaatga gcaccgtgta gatcatcaaa atcagcacgt gtagcaagta 3480 aaacaggagc cttcaactta atttcagaag gaacagagtg cgatggatca agttgtttag 3540 cagttatagc agctcgggca agatcatctt taacaatttg ttcaggtgtc attggatgta 3600 taattatttt ctgaccctta aaaatgaaag aataatgatt cgaacgacca tgatgcaagc 3660 tatcagtatc atattgccaaggtcgaccaa gtaacaaaga gcatgcttcc atgggaataa 3720

- 173 catcacaatc aacaaaatca gaataagcac ccatggagaa aggaactcgc acggaacgcg 3780 tgatttttat tttaccacca tcattaagcc attgaatgtg atatgggttc ggatgcttac 3840 gagtgggtaa cgacaacttt tcgaccagca tggtactcgc caaattgttg caactgccgc 3900 tgtcgataat gatgcgaatt gaccgctcct gcacaacacc ctttgtatgg aacagagtgt 3960 gtcgctgatt cttctcgggc aaagcgacct gtgtactgag aacacgctgc acaacaagac 4020 tttcatacct atcagcgtcg cccgggttga catgtacctc cgccttagct gcatggtcag 4080 tggcaagtag tgcatgttca atttcttcag aatcactagc ggaagagtac tcaccatcgt 4140 cacgaatgag taaagtgcgc ttgtttggac agtcccgaat cacatggcca aatcctctac 4200 agcgatgaca ctgaatatcc cgtgtacgac ctgtgggtgg ggcagtgctg gctggtttgg 4260 tcgtcttctc gcgtggagta gtggtggacg tggatggcgc agggggaact ggtgctgagg 4320 tggatgtcga gcttcgtcct gcaaaagggt tagaatattg cttcgagcgg cgtccctgca 4380 cttcacgttc agctttgcaa gcatattcaa ataaagtagt catatcataa tattccttat 4440aatcaagtat atcttggatt tcgcggttta aaccaccacg aaaacgtgcc atagcagcgt 4500 cgttgtcctc caatatccca caacgaatca tacctttttg taactcctgg aaatagtcct 4560 caacagattg agaaccttgc tgaaaacgct gcattttatt aagcaaatca cgagcataat 4620 acgaaggcac aaatcgatgt cgcatcgcag ctttcaactg atcccaagtg gttggaatgg 4680 tagtgggatg ttttatttta aactcacgcc accaaattaa agcaaaatca gtaaattcac 4740 taatagcagc tttaacctga gaatgtgcag caatatcatg gcatgaaaat ttttgttcaa 4800 cctctaactc ccaatcaaga tatgcagcag gatcatattt gccattaaaa ggtggaattt 4860 taaatttaat cttagaaaat aagtcattag ggggattacg aaccacacgg cgtgcacgac 4920 cacggcgatc tccatcgtcc cactcagtgt caccgccgta gtcctgctcc atctttgtgg 4980 tcaacgcatc aaggcgtgct aggatggtgt cgagtgtggt gcgagtcgcc gtttgagcaa 5040 ggtcaagctg gttgaaacgc tcggtcgtcg aagtgaccgt tgaatcaagc cgttcatgca 5100 tcgtcctaat gtcatcagca agtccatcaa cttgtccctt tacttccagc aactgggcat 5160ccaccgtgtc atgtgctcct gccatagtta gcgcaaacac caaaacacca aaaaaaacga 5220 caaaaacagg ggtgtactgc tcacaaggcg ctcacactag tgctgttatc aaattcttat 5280 ccgttcttac caagccacag tggtgaactg caaccaacag gtggaaccgg tgaaagattg 5340 gatgagcgat tgcctggaga aacagaaacc tactcgttgt agaaatatgt ggagttctgg 5400 gtaggctgca ctcaagtcaa ggattagcac gaccaaacaa taatgcaaag ttgaattata 5460 gtgcaaaaca cgaaactata ttgctggcca caagtgcaaa ggacggatgg aactagcaga 5520 atggcagtac cgtaaatatt gtactagcga ggccactagt aggaatcaca agtgattttg 5580 tttttctttt ttgtatgatt tttttggtat ttttctcagc acaagaagca acaaaatagg 5640 agctacacga agtttcacct aaaacagagt tcaaatgtgg tctacagaaa atcagaaagt 5700 tctctaaaaa gcgtgcgaga actttgaagg attttttctt tattttcctg aatttttttt 5760 gacaattttg tcgaacccaa acagaccgaa ggtcagtttg gccggcctca gaatggtgtc 5820 aactagctcc tgtaaaaatt tcagattttt cggacacccg agcgaaaagt tatgcccggt 5880ttaaggaagg tacctcaaat tatgttttca aacgaccgga atgaaacaac cgtatccttt 5940 ctccttcgtt gttttttgtt tctgtttttt tttttacgta accgaaggag aaaaacaagg 6000 aaacgatgtt gactcggttt gttttttttt ctgttttttt ttctgttttt tttcgtaacc 6060 gaaggagaaa atcaaggaaa acagccgttg actcggtttg ttttttctgt ttttttttga 6120 cgtaaccgaa ggagaaaaac aaggaaacaa tgttgactcg gtttgtggtg tgatcaaacg 6180 agagatggtg gcggcgctag ggtttgaatg gtggaagaac acaatgcaac cagcaacaaa 6240 tgacgcgaaa gcacacaaat tcaacaatgc agattattga aagaaagtgc gaggctcaaa 6300 agggtgctgg gataagatct aacctgaatt tttatgtggt tttgtggact gtaggaaaaa 6360 aaaacgctcg ataaactcac cgatcaacct agaaatctga taccaattga tgaagctgag 6420 gtgcccgatc tttcggcgag tagagataat tccgatttgg cggaagatga cccttgcgat 6480 ccgactacga cgagcaagcc cgaggcgcca atgcaatcgc tgaaccaact ccctgtggtt 6540 accgaccttg ctgatgcgag atcggcctga tcacgaagat cgtttcctgt gcgcaatcga 6600agaacgaaca agaataagat gcgagcaatc taatctatta ctcgagggtg gagttctgaa 6660 tacacgaaga cagcgcagat tagcgcgtgt tcgagagtag ctaaggctaa cgtaaaacaa 6720 aactcaggaa ataaaggagg cgcagctcct gaataaatag agagggggcg cagcccctag 6780 gggcggccaa ccctaggtcg tccattatgg gccgcaattg ggctggtcgt ctattcttcc 6840 gggccttcgt tctttaacaa catgatgtag ttcaattctc ttgcacgggc ccgagtcact 6900 ggcccaggtg gaaggggtgg cgcctgggct ggagaaggtg ctgctggtgt agatgtgctc 6960 gtgttggtgt tgatgtccgc atcaacatcg caatcaacat aatcagaata agaacccagc 7020 gaaaagggga cacgtaccga acgtgttacc tttattttac caccatcatt aagccattga 7080 atgtgatacg gatgtggatg tgtgcgagtg ggcaaggata atttctctac caacgctgta 7140 cttgccaaat tgttgcagct gccactatcg atgatgatgc gaatcgaccg ttcgtgcacg 7200 acgcccttgg tatggaatag agtgtgtcgc tgattttttt cggcctgggc aacctgtgtg 7260 ctgagaacac gctgcacaac aagactctca tacctatcag cgtcgatggg atcaacgtgg 7320acttcctcat tttctgcatg gttagtggca atcatagcat gactagtttc ctcagaatca 7380

- 174 ctggctgaag agtactcacc attgtcacgt ataagcaagg tacgcttgtt tgggcagtcc 7440 cgaatcatgt gcccaaaccc tctgcaacga tggcactgaa tatcccgtgt acgtcctgtg 7500 gaagaagcgg cgcctttggc agggggcgcc actggcttgg ccggccctgt gcgcgatgta 7560 gtgctaggcg taggaggtgc agggctggaa ggagttgagc tgtgtgttgg accccggcct 7620 gcaaaagagt tagtatatgt ctttgatcgt cgtccctgca cttcacgttc agctttgcaa 7680 gcatattcaa acaatgtggt tatatcaaaa taatccttat aatcaagtat atcctgaatt 7740 tccctgttca aaccaccacg aaaacgcgcc atagcagcgt catctgactc aaccaaacca 7800 caacgaagca tacccttttg caactcctgg taatattcct caacagattg tgaaccttgt 7860 tgaaaacgct gcattttgtt aagcaaatca cgagcataat aggaaggaac aaatctgtgg 7920 cgcatggcag tttttaattg ggtccaagta atgacactgt taatgggaag tttttgttta 7980 tactcacgcc accaaattaa agcaaaatca gtaaattcac taatggcagc cttcacttgg 8040 ctattagcag gaatatcatg gcatgaaaat ttctgttcta cctctaattc ccaatcaaga 8100tatgcagcag gatcatattt accattaaaa gatggaattt taaatttaat cttagaaaat 8160 aagtcattag ggggatgacg aaccacacga cgtgcacgac cacggcgatc tccatcgtcc 8220 tgctcagtgt caccgccgta ttcctgctcc atctttgtgg tcaatgcatc aaggcgtgcc 8280 aggatggtgt cgagtgtggt gcgagtcgcc gtttgagcaa ggtcaagttg gttgaaacgc 8340 tcggtcgtcg aagtgatcgt tgaatcaagc cgttcatgca tcgtcctaat gtcagcagca 8400 agtccatcaa cttggcccct tacttcctgc aactgggcat ccaccatgtc gtgtgctcct 8460 gccatagtta gcgcaaacac caaaaggaga aaaaccaacg acaaaaacag gggtgtactg 8520 ctcacaaggc gctcacacta gtgctgttat caagttctta tccgttctta ccaagccaca 8580 gtggtgaact gcaaccaaca ggtggaaccg gtgaaagatt ggatgagcga ttgcttggag 8640 aaacagaaac ctgctcgtcg tagaaatatg tggagttgtg ggtaggctgc actcaagtca 8700 aggattagca cgatcaaaca ataatgcaaa gttgaattat agtgcaaaac acgaaactat 8760 attgctggcc acaggtgcaa aggatggatg gatggaaata gcagaatggc agtaacgtaa 8820atattgtact agtgatgcca aaaaggcact agtacaaatc acaggtgatt ttgtttttct 8880 tttttgtatg atttttttga tatttttctc agcacaagaa gcaacaagat aggagctaca 8940 cgaagtttca cctaaaacag atatcagatg tggtctacag aaaatcagga agttctctga 9000 aaagcgtgcg agaactttga cggatttttt tctttatttt cctgaatttt tttgacaatt 9060 ttgtcgaacc ccaaacagac cgtaggtgag tttggccggg ctcagaatgg tgtcaactag 9120 ctcctgtaaa aatttcagat tttttggaca cccgagcgaa aagttatgcc cggtttaagg 9180 aaggtaccct caagttatgt tttcaaacga ccgggatgaa acaaccgtat cctttctcct 9240 tcgttgtttt tttttgtttc tgtttttttt ttgacgtaac cgaaggagaa aaacaaggaa 9300 acgatgttgc ctcggttttt ttttttctgt tttttttcgt aaccgaagga gaaaaacaag 9360 gaaacggccg ttgactcggt ttgttttttc tgtttttttt tacgtaaccg aaggagaaaa 9420 acaaggaaac aatgttgact cggtttgtgg cgtgatcaaa ggggagatgg tggcggcgct 9480 aggatatgaa tggtggaaga acacaatgca accagcaaca aggaaacgcg aaagcacaca 9540aattcaacaa tgcagattat tgaaagaaag tgcgaggctc aaaagggtgc tgggataaga 9600 actaacctga atttttatgt ggttttgtgg actgtaggaa aaaaaacgct cgataaactc 9660 accgatcaac ctggaaatct gataccaatt gatgtagctg aggtgcccga tctttcggcg 9720 agtagagata attccgattt ggcggaagat gacccttgcg atccgactac gacgagcaag 9780 cccgaggtgc caatgcaatc gctgaaccaa ctccctgtgg ttaccgacct tgctgatgcg 9840 agatcggcct gatcacgaag atcgtttcct gtgcgcaatc gaagaacgaa caagaacaag 9900 atgcgagcaa tctaatctat tactcgaggg tggagttctg aatacacgag gacagcgcag 9960 atttgcgcgt gttcggaagt agctaaggct aacgtaaaac aaaactccca aaaataaagg 10020 aggcgcagct cctgtataaa tagagagggg gcgcagcccc taggggcggc caaccctagg 10080 tcgtccatta tgggccgcaa ttgggctggt cgtctatcct tccgggcctt cgttctttaa 10140 caacatgatg tagttcaatt ctcttgcacg ggcccgagtc actggcccag gtggaagggg 10200 tggcgcctgg gctggagaag gtgctgctgg tgtagatgtg ctcgtgttgg tgttgatgtc 10260ctcatcacat gtttggggtg gtttcgcgca atttcgttgt cgcacgtcac acattccgaa 10320 aacggttgtc ggggtgcata caaagcacga gtttttgaca ccggaacc 10368 &lt;210&gt; 192 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence

- 175 &lt;220&gt;

&lt;223&gt; 1 Telo-31overgo Biocode 75319 &lt;400&gt; 192 agggtttagg gtttagggtt tagggtttag gg 32 &lt;210&gt; 193 &lt;211&gt; 31 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&lt;223&gt; Primer 2 Telo-31over Biocode 39612 &lt;400&gt; 193 ccctaaaccc taaaccctaa accctaaacc c 31

She prepared and verified

Iwona Płodzich-Hennig

Patent Attorney

- 176 -