System for the expression of orthogonal translation components in eubacterial host cells

[0001] The invention relates to the field of protein chemistry, e.g., biochemistry of translation. The invention relates to compositions and methods for producing in vivo polypeptides containing one or more unnatural amino acids.

[0002] The study of protein structure and function has historically been based on the chemical properties available using R groups of naturally occurring amino acids. Unfortunately, every known organism, from bacteria to human, encodes twenty of the same typical amino acids (with rare exceptions to selenocysteine ​​(see, e.g., Bock et al., (1991), Molecular Microbiology 5: 515-20) and pyrolysine (see, e.g. , Srinivasan, et al. (2002), Science 296: 1459-62). This limited selection of R groups narrowed the study of protein structure and function to restricted studies by the chemical properties of naturally occurring amino acids. [0003] A general methodology for in vivo site specific incorporation of chemically different unnatural amino acids with new physicochemical and biological properties into proteins in both prokaryotic organisms has been developed. and eukaryotic (Wang et al., Science 292, 498-500 (2001); Chin, et al., Science 301, 964-967 (2003); Wang and Schultz, Angew Chem Int. Ed. 44, 34-66 (2005)). This method is based on a unique pair of tRNA codons and the corresponding aminoacyl-tRNA synthetase (aaRS or simply RS) for any unnatural amino acid that works efficiently in protein translation but does not cross-react with any of the endogenous tRNA, RS, amino acids or codons in host organism (i.e. they must be orthogonal). The use of such orthogonal tRNA-RS pairs has genetically encoded a large number of structurally different amino acids, including those with unique chemical reactivity (Wang et al., Proc. Natl. Sci. Acad. USA. 100, 56-61 (2003)) and photochemical (China et al., Proc. Natl. Acad. Sci. USA 99, 1102011024 (2002); Wu et al., J. Am Chem Soc, 126, 14306-14307 (2004)) as well as glycosylated (Zhang et al., Science 303, 371-373 (2004)) fluorescent (Wang and Schultz, Angew. Chem. Int. Ed. 44:34) -66 (2005)), metal-binding (Wang and Schultz, Angew. Chem. Int. Ed. 44: 34-66 (2005)) and amino acids with reducing oxidation activity (Alfonta et al., J. Am. Chem. Soc. 125: 14662-14663 (2003)). One particular MjtRNA-Tyr (CUA) -MjTyrRS pair mutant was particularly useful for encoding new amino acids in E. coli (Wang and Schultz, Chem. Biol. 8: 883-890 (2001)).

[0004] WO 2005/007870 describes compositions of orthogonal leucyl-tRNA and synthetase aminoacylotRNA pairs and their uses.

[0005] WO 2004/094593 describes compositions of orthogonal-tRNA pairs and orthogonal aminoacyl-tRNA synthetase and their use for incorporating unnatural amino acids into proteins of interest.

[0006] US 2005/272121 describes site-specific incorporation of unnatural heavy atom containing amino acids into a protein for structure determination.

[0007] Wang and Schultz, 2001, Chemistry & Biology, vol. 8, pp. 883-890, describe a general approach to orthogonal tRNA production.

[0008] However, despite the success of this method in incorporating a variety of different unnatural amino acids in vivo, the performance of the expression system has not been optimized for the production of mutated proteins containing unnatural amino acids, and the suppressive efficiency of overcoming the selector codon by the orthogonal system may be poor. There is a need in the art to develop reagents to improve the suppressive efficiency of orthogonal translation systems. The invention described herein meets these and other needs, as will be apparent from the following disclosure.

[0009] The invention provides a composition comprising a nucleic acid construct, wherein the construct comprises: promoter and terminator of the nucleotide sequence of the proline tRNA gene from Escherichia coli and the first expressed nucleotide sequence encoding the orthogonal tRNA (O-tRNA) of Archaea, in which the Archaea O-tRNA contains a C1-G72 pair, and in which both promoter and terminator sequences are operably linked with the first expressed nucleotide sequence, and the first expressed nucleotide sequence is heterologous to the promoter and terminator nucleotide sequences, and wherein the promoter nucleotide sequence has the nucleotide sequence of SEQ ID NO: 32 or 34 and the terminator nucleotide sequence has the nucleotide sequence selected from SEQ ID NOS: 33, 35 and 36.

[0010] In some instances of the composition of the invention, the nucleic acid construct further comprises a modified E coli glns promoter nucleotide sequence with the nucleotide sequence of SEQ ID NO: 13 and a second expressed nucleotide sequence in which the modified E coli glnS promoter nucleotide sequence is functionally linked to a second expressed nucleotide sequence, which second expressed nucleotide sequence encodes an orthogonal aminoacylotRNA synthetase (O-RS), wherein O-RS preferably aminoacylates said O-tRNA with an unnatural amino acid.

[0011] In some cases, in the composition of the invention said O-tRNA is encoded by the nucleotide sequence of SEQ ID NO: 1 (MjtRNA-Tyr (CUA)); or wherein the first expressed nucleotide sequence is a polycistronic operon containing a plurality of O-tRNAs, each of which has the nucleotide sequence of SEQ ID NO: 1 (MjtRNA-Tyr (CUA)).

[0012] In some cases, said first expressed nucleotide sequence comprises a plurality of said polycistronic operons.

[0013] In some cases, said O-RS is Methanococcus jannaschii aminoacyl-tRNA synthetase; or (ii) said O-RS is Methanococcus jannaschii tyrosyl-tRNA synthetase; or (iii) said O-RS has an aspartic acid substitution with arginine at amino acid position 286 or at position analogous to position 286, relative to the wild type amino acid sequence, Methanococcus jannaschii tyrosyl tRNA synthetase provided in SEQ ID NO: 2 (wild type Mj-tRNA-Tyr RS).

[0014] In another aspect, the invention provides a host cell comprising the composition of the invention.

[0015] In some cases, the host cell is an eubacterial host cell or said host cell is an E. coli cell.

[0016] In another aspect, the invention provides a translation system for expressing a polypeptide comprising at least one unnatural amino acid at a particular position, a system comprising:

(a) an unnatural amino acid;

(b) a nucleic acid construct, a construct comprising:

(i) the promoter and terminator nucleotide sequences from the Escherichia coli proline tRNA gene and the expressed nucleotide sequence, expressed nucleotide sequence encoding Archaea orthogonal tRNA (O-tRNA), wherein Archaea O-tRNA contains a C1-G72 pair and in which the promoter sequences and the terminator are both operably linked to the nucleotide sequence expressed, and in which the expressed nucleotide sequence is heterologous to the promoter and terminator nucleotide sequences in which the promoter nucleotide sequence has the nucleotide sequence of SEQ ID NO: 32 or 34 and the terminator nucleotide sequence has the nucleotide sequence selected from SEQ ID NOS: 33, 35 and 36, and (ii) the nucleotide sequence encoding the orthogonal aminoacyl-tRNA synthetase (O-RS), wherein O-RS preferably aminoacylates said O-tRNA with an unnatural amino acid, and, (c) a polynucleotide encoding the polypeptide of interest of interest, a polynucleotide comprising at least one selector codon that is recognized by an O-tRNA in which the position of the selector codon in the polynucleotide controls the specific position of the unnatural amino acid in the polypeptide, of interest during expression of the polynucleotide to produce the polypeptide.

[0017] In some cases, the nucleic acid construct further comprises at least one of:

(i) a nucleotide sequence with a modified E coli glnS promoter having the nucleotide sequence of SEQ ID NO: 13, wherein the modified E coli glnS nucleotide sequence is operably linked to the O-RS coding nucleotide sequence; and

(Ii) a polycistronic operon comprising a plurality of O-tRNA gene nucleotide sequences in which at least one O-tRNA gene is separated from at least one adjacent O-tRNA gene by a heterologous polynucleotide linker from a polynucleotide linker from the operon tRNA.

[0018] In some cases, the E. coli proline tRNA promoter and terminator sequences are provided in SEQ ID NOS: 32 (promoter) and 33 (terminator), respectively; or in which the polycistronic operon contains multiple identical heterologous polynucleotide linkers;

or wherein the polycistronic operon contains multiple heterologous polynucleotide linkers, wherein at least two of the heterologous polynucleotide linkers are different;

or wherein the heterologous polynucleotide linker comprises a 5 'terminal thymidine nucleotide or a 3' terminal adenosine nucleotide, or both a 5 'terminal thymidine nucleotide and a 3' terminal adenosine nucleotide;

or wherein the heterologous polynucleotide linker is a polynucleotide linker located between the endogenous Escherichia coli tRNA genes selected from: valU and valX, ileT and alaT; serV and argV; valV and valW; glyT and thrT; metT and leuW; glnW and metU; hisR and leuT; glnU and glnW; leuP and leuV; glnV and glnX; alaW and alaX; ileU and alaU; ileV and alaV; metU and glnV; gllyW and cysT; argX and hisR; and argY and argZ;

or wherein the heterologous polynucleotide linker comprises the nucleotide sequence of SEQ ID NO: 14 (valU / valX linker) or 15 (ileT / alaT linker).

[0019] In some cases, the nucleotide sequence encoding ca O-tRNA is a polycistronic operon containing multiple nucleotide sequences encoding O-tRNA;

or wherein the O-tRNA encoding nucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 1 (MjtRNA-Tyr (CUA));

or wherein the O-tRNA encoding nucleotide sequence is a polycistronic operon containing multiple nucleotide sequences of SEQ ID NO: 1 (MjtRNA-Tyr (CUA)); or wherein O-RS is a Methanococcus jannaschii aminoacyl-tRNA synthetase;

or wherein O-RS is Methanococcus jannaschii tyrosyl tRNA synthetase;

or in which O-RS has an aspartic acid substitution with arginine at amino acid position 286 or at a position analogous to position 286, relative to the wild type amino acid sequence, Methanococcus jannaschii tyrosyl tRNA synthetase provided in SEQ ID NO: 2 (wild type Mj- tRNA Tyr RS).

[0020] In some cases, the translation system includes a host cell comprising (a), (b) and (c).

[0021] In some cases, the host cell is an eubacterial host cell.

[0022] In a further aspect, the invention provides a method of producing, in a host cell, a polypeptide of interest comprising an unnatural amino acid at a particular position, a method comprising:

(a) providing:

(i) an unnatural amino acid;

(ii) a nucleic acid construct comprising:

Promoter and terminator nucleotide sequences from the Escherichia coli proline tRNA gene and the expressed nucleotide sequence, expressed nucleotide sequence encoding Archaea orthogonal tRNA (O-tRNA), in which Archaea O-tRNA contains a C1-G72 pair, and in which the promoter and terminator sequences are both functionally linked to the expressed nucleotide sequence, and wherein the expressed nucleotide sequence is heterologous to the nucleotide sequence of the promoter and terminator, wherein the promoter nucleotide sequence has the nucleotide sequence of SEQ ID NO: 32 or 34, and the terminator nucleotide sequence has the nucleotide sequence selected from SEQ ID NOS: 33, 35 and 36 ; and a nucleotide sequence encoding orthogonal aminoacyl-tRNA synthetase (O-RS), wherein O-RS preferably aminoacylates O-tRNA with an unnatural amino acid; and, (iii) a polynucleotide encoding a polypeptide of interest, a polynucleotide comprising at least one selector codon that is recognized by an O-tRNA, and in which the position of the selector codon correlates with the specific position of the unnatural amino acid in the polypeptide of interest and;

(iv) a host cell comprising (i), (ii) and (iii); and (b) culturing the host cell; and (c) incorporating an unnatural amino acid at a certain position in the polypeptide during translation of said polypeptide in a host cell, thereby forming a polypeptide of interest comprising the unnatural amino acid at a specific position.

[0023] In some cases, providing a nucleic acid construct comprises providing a polycistronic operon containing multiple nucleotide sequences encoding one or more O-tRNA species; or wherein providing the nucleic acid construct comprises providing a nucleotide sequence encoding an O-tRNA comprising the nucleotide sequence of SEQ ID NO: 1 (MjtRNA-Tyr (CUA)), or providing a nucleic acid construct comprising providing a polycistronic operon comprising multiple nucleotide sequences of SEQ ID NO: I (MjtRNATyr (CUA)); or wherein said delivery of the nucleic acid construct comprises the delivery of Methanococcus jannaschii aminoacyl-tRNA synthetase; or wherein said providing the nucleic acid construct comprises providing Methanococcus jannaschii tyrosyl-tRNA synthetase; or wherein said delivery

- the nucleic acid construct comprises providing a nucleotide sequence encoding O-RS with an substitution of aspartic acid with arginine, at amino acid position 286 or at a position analogous to position 286, relative to the wild type amino acid sequence, Methanococcus jannaschii tyrosyl tRNA provided in SEQ ID NO: 2 (wild type MjtRNATyrRS); or wherein said providing the nucleic acid construct comprises providing at least one of:

(I) promoter and terminator sequences comprising promoter and terminator sequences from E coli proK provided in SEQ ID NOS: 32 (promoter) and 33 (terminator), respectively;

(II) the nucleotide sequence of the promoter with the modified E. coli glnS promoter having the nucleotide sequence of SEQ ID NO: 13, wherein the modified E. nucleotide sequence coli glnS, is operably linked to the nucleotide sequence encoding O-RS; and (III) a polycistronic operon comprising multiple nucleotide sequences of the OtRNA gene, wherein at least one O-tRNA gene is separated from at least one adjacent O-tRNA gene by a heterologous polynucleotide linker from a polynucleotide linker from the tRNA operon.

[0024] In some cases, delivery of a polycistronic operon (III) involves providing multiple identical heterologous polynucleotide linkers; or wherein said providing polycistronic (III) operon comprises providing multiple heterologous polynucleotide linkers, wherein at least two of the heterologous polynucleotide linkers are different; or providing a polycistronic operon (III) includes providing a heterologous polynucleotide linker comprising a 5 'terminal thymidine nucleotide, a 3' terminal adenosine nucleotide, or both a 5 'terminal thymidine nucleotide and a 3' terminal adenosine nucleotide; or providing a polycistronic (III) operon includes providing a heterologous polynucleotide linker from a polynucleotide linker located between the endogenous Escherichia coli tRNA genes selected from: valU and valX; ileT and alaT; serV and argV; valV and valW; glyT and thrT; metT and leuW; glnW and metU; hisR and leuT; glnU and glnW; leuP and leuV; glnV and glnX; alaW and alaX; ileU and alaU, how many V and alaV; metU and glnV; gllyW and cysT; argX and hisR and argY and argZ; or providing a polycistronic operon (iii) includes providing a heterologous polynucleotide linker with the nucleotide sequence of SEQ ID NO: 14 (link valU / valX) or 15 (link ileT / alaT).

[0025] In some cases, the delivery of the host cell includes the delivery of an eubacterial host cell or Escherichia coli host cell.

[0026] In a further aspect, the invention provides a method of producing in a host cell a polypeptide of interest comprising an unnatural amino acid at a certain position, a method comprising:

(a) providing:

(i) an unnatural amino acid;

(Ii) a nucleic acid construct comprising a nucleotide sequence encoding an orthogonal tRNA (O-tRNA) of Archaea, wherein the Archaea O-tRNA comprises a C1-G72 pair;

(iii) a nucleic acid construct comprising a nucleotide sequence encoding an orthogonal aminoacyl-tRNA synthetase (O-RS), wherein O-RS preferably aminoacylates O-tRNA with an unnatural amino acid;

(iv) a polynucleotide encoding a polypeptide of interest, a polynucleotide comprising at least one selector codon that is recognized by an O-tRNA, and wherein the position of the selector codon correlates with a particular position of an unnatural amino acid in the polypeptide of interest; and (v) a host cell comprising (i), (ii), (iii) and (iv);

wherein the nucleic acid construct (ii) contains promoter and terminator nucleotide sequences from the Escherichia coli proline tRNA gene, wherein the promoter and terminator sequences are both operably linked to the OtRNA coding nucleotide sequence, and wherein said O-tRNA coding nucleotide sequence is heterologous to the sequence a promoter and terminator in which the promoter nucleotide sequence has the nucleotide sequence of SEQ ID NO: 32 or 34 and the terminator nucleotide sequence has a nucleotide sequence selected from SEQ ID NOS: 33, 35 and 36;

(b) culturing the host cell; and (c) incorporation of an unnatural amino acid at a specific position in the polypeptide during translation of the polypeptide in a host cell, thereby forming a polypeptide of interest containing the unnatural amino acid at a specific position.

[0027] In some cases, providing a nucleic acid construct comprises providing a polycistronic operon containing multiple nucleotide sequences encoding one or more O-tRNA species; or wherein providing the nucleic acid construct comprises providing a nucleotide sequence encoding an O-tRNA comprising the nucleotide sequence SEQ ID NO: 1 (MjtRNA-Tyr (CUA)), or wherein providing the nucleic acid construct comprises providing a polycistronic operon comprising multiple nucleotide sequences SEQ ID NO : 1 (MjtRNATyr (CUA)); or wherein the delivery of the nucleic acid construct comprises the delivery of Methanococcus jannaschii aminoacyl-tRNA synthetase; or wherein providing the nucleic acid construct comprises providing Methanococcus jannaschii tyrosylRNA synthetase;

or providing the nucleic acid construct comprises providing a nucleotide sequence encoding O-RS having an aspartic acid substitution with arginine, at amino acid position 286 or at position analogous to position 286, relative to the amino acid sequence of the wild type tyrosyl tRNA synthetase, Methanococcus jannaschii provided in SEQ ID NO: 2 (wild type Mj-tRNATyrRS); or wherein the delivery of the nucleic acid (I) construct comprises promoter and terminator sequences comprising the E. coli proK promoter and terminator sequences provided in SEQ ID NOS: 32

- 8 (promoter) and 33 (terminator), respectively; or wherein providing the host cell comprises providing the eubacterial host cell; or wherein providing the host cell comprises providing the Escherichia coli host cell.

[0028] In another aspect, the invention provides a method of producing a translation system for expressing a polypeptide of interest comprising at least one unnatural amino acid at a particular position, the method comprising providing:

(a) an unnatural amino acid;

(b) a nucleic acid construct, a construct comprising:

(i) the promoter and terminator nucleotide sequences from the Escherichia coli proline tRNA gene and the expressed nucleotide sequence, expressed nucleotide sequence encoding Archaea orthogonal tRNA (O-tRNA) in which Archaea (O-tRNA) contains a C1-G72 pair; and wherein the promoter and terminator sequences are both operably linked to the expressed nucleotide sequence, and wherein said expressed nucleotide sequence is heterologous to the promoter and terminator nucleotide sequences, wherein the promoter nucleotide sequence has the nucleotide sequence of SEQ ID NO: 32 or 34, and wherein the terminator nucleotide sequence comprises the nucleotide sequence selected from SEQ ID NOS: 33, 35 and 36; and (ii) a nucleotide sequence encoding orthogonal aminoacyl-tRNA synthetase (O-RS), wherein O-RS preferably aminoacylates O-tRNA with an unnatural amino acid; and (c) a polynucleotide encoding a polypeptide of interest comprising at least one selector codon that is recognized by an O-tRNA, where the position of the selector codon in the polynucleotide controls the specific position of the unnatural amino acid in the polypeptide of interest during expression of the polynucleotide to form polypeptide.

[0029] In some cases (a), (b) and (c) are provided in a host cell.

[0030] In other embodiments of the method, the nucleic acid (III) construct uses multiple identical heterologous polynucleotide linkers. Optionally, at least two of the heterologous polynucleotide linkers are different.

[0031] Optionally, the polycistronic (III) operon in these methods uses a heterologous polynucleotide linker comprising a 5 'terminal thymidine nucleotide linker, a 3' terminal adenosine nucleotide, or both a 5 'terminal thymidine nucleotide and a 3' terminal adenosine nucleotide. The heterologous polynucleotide linker used herein may be from a naturally occurring polynucleotide linker located between endogenous Escherichia coli tRNA genes selected from: val U and valX; ileT and alaT; serV and argV; valV and valW; glyT and thrT; metT and leuW; glnW and metU; hisR and leuT; glnU and glnW; leuP and leuV; glnV and glnX; alaW and alaX; ileU and alaU; ileV and alaV; metU and glnV; gllyW and cysT; argX and hisR; and argY and argZ. For example, the heterologous polynucleotide linker may be derived from the nucleotide sequence of SEQ ID NO: 14 (ValUlvalX linker) or 15 (linker

- 9 ileTlalaT). Optionally, these methods are carried out in a eubacterial host cell such as Escherichia coli.

[0032] In other aspects, the invention also provides translation systems for expressing a polypeptide of interest that has at least one unnatural amino acid at a particular position. Basically, these systems include:

(a) an unnatural amino acid;

(b) a nucleic acid construct, a construct comprising a nucleotide sequence encoding orthogonal tRNA (O-tRNA) and a nucleotide sequence encoding orthogonal aminoacyl-tRNA synthetase (O-RS), wherein O-RS preferably aminoacylates O-tRNA with an unnatural amino acid; and (c) a polynucleotide encoding a polypeptide of interest, a polynucleotide comprising at least one selector codon that is recognized by an O-tRNA, where the position of the selector codon in the polynucleotide controls the specific position of the unnatural amino acid in the polypeptide of interest during expression of the polynucleotide production of the polypeptide.

[0033] Optionally, these system components are integrated in the host cell.

DEFINITIONS [0034] Before describing the invention in detail, it should be understood that the invention is not limited to specific biological systems, which of course may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting. As used herein and in the appended claims, singular forms also include the plural, unless the context clearly indicates otherwise. In this way, for example, reference to "a cell" includes a combination of two or more cells; reference to "polynucleotide" includes, in practical terms, multiple copies of that polynucleotide.

[0035] Unless defined herein and below in the description below, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. In the description and claims of the invention, the following terminology will be used according to the definitions given below.

[0036] Orthogonal: As used herein, the term "orthogonal" refers to a molecule (e.g., orthogonal tRNA (O-tRNA) and / or orthogonal aminoacyl-tRNA synthetase (O-RS)) that functions with endogenous cell components with reduced efficiency compared to a suitable molecule that is endogenous to the cell or translation system, or that does not function with endogenous cell components. In the context of tRNA and aminoacyl-tRNA synthetases, orthogonal refers to the inability or reduced performance, e.g., less than 20% yield, less than 10% yield, less than 5% yield, less than 1% yield, orthogonal tRNA to function with endogenous synthetase tRNA compared to endogenous tRNA to function with endogenous tRNA synthetase, or orthogonal aminoacyl-tRNA synthetase to function with

- endogenous tRNA compared to endogenous tRNA synthetase to function with endogenous tRNA. The orthogonal molecule lacks the functionality of a normal endogenous complementary molecule in a cell. For example, orthogonal tRNA in a cell is aminoacylated with any endogenous RS cell with reduced or even zero yield if compared with aminoacylation of endogenous tRNA with endogenous RS. In another example, orthogonal RS aminoacylates any endogenous tRNA of the cell of interest with reduced or even zero yield as compared to aminoacylation of endogenous tRNA using endogenous RS. The second orthogonal molecule can be introduced into a cell that functions with the first orthogonal molecule. For example, an orthogonal tRNA / RS pair includes introduced complementary components that function together in a cell with efficiency (e.g., 45% yield, 50% yield, 60% yield, 70% yield, 75% yield, 80% yield, 90 yield %, 95% yield or 99% yield or more) compared to the control yield, e.g., the corresponding endogenous tRNA / RS pair or active orthogonal pair (e.g., tyrosyl orthogonal tRNA / RS pair).

[0037] Orthogonal tyrosyl-tRNA: As used herein, the term orthogonal tyrosyl-tRNA (tyrosyl-O-tRNA) means tRNA, which is orthogonal to the translation system of interest, where the tRNA is: (1) identical or essentially similar to naturally occurring tyrosyl-tRNA, (2) derived from naturally occurring tyrosyl-tRNA by natural or artificial mutagenesis, (3) obtained by any process that takes into account wild-type sequence or mutational tyrosyl-sequence tRNA from (1) or (2), (4) homologous to wild-type or mutant tyrosyl RNA; (5) homologous to any example of tRNA that is assigned as a substrate to tyrosyl-tRNA synthetase, e.g., synthetases from SEQ ID NOS: 2, 4, 6, 8 or 10, (6) a conservative variant of any example of tRNA which is designated as a substrate for tyrosyl-tRNA synthetase in, e.g., O-tRNA of SEQ ID NO: 1. Tyrosyl-tRNA may exist charged with an amino acid or in an uncharged state. It is also to be understood that "tyrosyl-O-tRNA" is optionally charged (aminoacylated) using a related synthetase with an amino acid other than tyrosine or leucine, respectively, e.g., an unnatural amino acid. Indeed, it will be appreciated that the tyrosyl-O-tRNA of the invention is preferably used to insert essentially any amino acid, natural or artificial, into a growing polypeptide during translation in response to a selector codon.

[0038] Orthogonal tyrosyl amino acid synthetase: As used herein, the term orthogonal tyrosyl amino acid synthetase (tyrosyl-O-RS) means an enzyme that preferably aminoacylates tyrosyl-O-tRNA with an amino acid in the translational system of interest. The amino acid that tyrosyl-O-RS loads into tyrosyl-OtRNA can be any amino acid, be it natural, unnatural or artificial, and is not limited here. The synthetase is optionally the same or homologous to the naturally occurring amino acid tyrosyl synthetase, or the same or homologous to the synthetase designated as O-RS in, e.g., SEQ ID NOS: 4, 6, 8 or 10. For example, O-RS may be a conservative tyrosyl-O-RS variant with, e.g., SEQ ID NOS: 4, 6, 8 or 10, and / or may

- 11 be at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more identical in sequence with O-RS with e.g. SEQ ID NOS: 4, 6 , 8 or 10.

[0039] Related: The term "related" refers to components that function together, e.g., orthogonal tRNA and orthogonal aminoacyl-tRNA synthetase. Ingredients can also be referred to as complementary.

[0040] Preferably, aminoacylates: As used herein for orthogonal translation systems, O-RS "preferably aminoacylates" related O-tRNAs if O-RS charges the OtRNA with the amino acid more efficiently than it loads any endogenous tRNA in the expression system. That is, if O-tRNA and any endogenous tRNA are present in the translation system in approximately equal molar proportions, O-RS loads O-tRNA more often than it loads endogenous tRNA. Preferably, the relative ratio of O-tRNA loaded by O-RS to endogenous O-RS loaded tRNA is high, preferably leading to exclusive or almost exclusive loading of O-tRNA by O-RS if OtRNA and endogenous tRNA are present in equal molar concentrations in translation system. The relative ratio between O-tRNA and endogenous tRNA that is loaded by O-RS if O-tRNA and OR-S present in equimolar concentrations is greater than 1: 1, more preferably at least about 2: 1, more preferably from 5: 1, even more preferably 10: 1, even more preferably 20: 1, even more preferably 50: 1, even more preferably 75: 1, even more preferably 95: 1, 98: 1, 99: 1, 100: 1 , 500: 1, 1000: 1, 5000: 1 or higher.

[0041] O-RS "preferably aminoacylates O-tRNA with an unnatural amino acid" if (a) ORS preferably aminoacylates O-tRNA compared to endogenous tRNA, and (b) where aminoacylation is specific for the unnatural amino acid as compared with aminoacylation O-tRNA via O-RS with any natural amino acid. That is, if unnatural and natural amino acids are present in equimolar quantities in a translation system containing O-RS and O-tRNA, then O-RS loads O-tRNA with an unnatural amino acid more often than with a natural amino acid. Preferably, the relative ratio of OtRNA loaded with unnatural amino acid to O-tRNA loaded with natural amino acid is high. More preferably, O-RS charges the O-tRNA with an unnatural amino acid exclusively, or almost exclusively. The relative ratio of O-tRNA loading with an unnatural amino acid and O-tRNA loading with a natural amino acid, if both natural and unnatural amino acids are present in the translation system at equimolar concentrations, is greater than 1: 1, preferably at least about 2: 1, more preferably 5: 1, even more preferably 10: 1 even more preferably 20: 1, even more preferably 50: 1, even more preferably 75: 1, even more preferably 95: 1, 98: 1, 99: 1, 100: 1 . 500: 1, 1000: 1, 5000: 1 or higher.

[0042] Selector codon: The term "selector codon" refers to codons recognized by the O-tRNA in the translation process and not recognized by the endogenous tRNA. The O-tRNA anti-codon loop recognizes the selector codon on the mRNA and inserts its amino acid, e.g., an unnatural amino acid, at this point in the polypeptide. Selector codons can include, e.g., nonsense codons, such as stop codons, e.g., amber codons,

- 12 ocher and opal; four or more base codons; rare codons; codons obtained from natural or unnatural base pairs and / or the like.

[0043] Suppressor tRNA: A suppressor tRNA is a tRNA that alters the reading of messenger RNA (mRNA) in a given translation system, e.g., by providing a mechanism for incorporating an amino acid into a polypeptide chain in response to a selector codon. For example, the suppressor tRNA can be read by, e.g., a stop codon, (e.g., an amber, ocher or opal codon), a four-base codon, a rare codon, etc.

[0044] Suppressive activity: As used herein, the term "suppressive activity" generally refers to the ability of tRNA (e.g., suppressor tRNA) to allow translational reading of a codon (e.g., a selector codon that is an amber codon or a four or more base codon ), which would otherwise cause translation termination or incorrect translation (e.g., reading frame shift). The suppressor activity of the suppressor tRNA can be expressed as a percentage of the observed translational read activity compared to the second suppressor tRNA, or compared to a control system, e.g., a control system lacking O-RS.

[0045] The invention provides various methods by which the suppressive activity can be quantified. The percentage suppression of a specific O-tRNA and O-RS relative to the selector codon (e.g., an amber codon) of interest relates to the percentage activity of a given expressed test marker (e.g., LacZ) that includes the selector codon in the nucleic acid encoding the expressed marker test, in the translation system of interest, wherein the translation system of interest includes O-RS and O-tRNA, compared to the positive control construct, where the positive control is lacking O-tRNA, O-RS and selector codon. Thus, for example, if for an active positive control marker construct that lacks a selector codon, X activity was observed in a given translation system, in units corresponding to the marker test under consideration, then the percentage suppression of the test construct containing the selector codon is the percentage of X which test marker exhibits in substantially the same environmental conditions as the positive control marker was expressed except that the test marker construct is expressed in a translation system that also includes O-tRNA and O-RS. Typically, the translation system expressing the test marker also includes an amino acid that is recognized by O-RS and O-tRNA. Alternatively, the measurement of percentage suppression can be improved by comparing the test marker with a "background" or "negative" control marker construct that includes the same selector codon as the test marker, but in a system that does not include O-tRNA, O-RS and / or the corresponding amino acid recognized by O-tRNA and / or O-RS. This negative control is useful in normalizing percent suppression measurements to include background signal effects from the marker in the translation system of interest.

[0046] Suppressive performance can be determined by any of numerous tests known in the art. For example, a β-galactosidase reporter assay can be used, e.g.

The derivative of the lacZ plasmid (where the construct has a selector codon in the lacZ nucleic acid sequence) is introduced into cells from a suitable organism (e.g., an organism in which orthogonal components can be used) together with the plasmid containing the O-tRNA according to the invention. Related synthetase may also be introduced (as a polypeptide or polynucleotide that encodes the related synthetase during expression). Cells are cultured in the medium to the desired density, e.g., up to an OD600 of about

0.5, and β-galactosidase assays are performed, e.g., using the BetaFluor ™ βgalactosidase assay kit (Novagen). Percent suppression can be calculated as the percentage of activity for the sample relative to a comparable control, e.g., the value observed from the lazZ derivatized construct, where the construct has the appropriate sense codon in the desired position rather than the selector codon.

[0047] Translation system: The term "translation system" refers to components that incorporate an amino acid into a growing polypeptide chain (protein). Components of the translation system may include, e.g., ribosomes, tRNA, synthetases, mRNA and the like. The O-tRNA and / or O-RS of the invention can be added to or be part of a translation system in vitro or in vivo, e.g., in a non-eukaryotic cell, e.g., eubacteria (such as E. coli), or in a eukaryotic cell, e.g., yeast cell, mammalian cell, plant cell, algae cell, fungal cell, insect cell and / or the like.

[0048] Unnatural amino acid: As used herein, the term "unnatural amino acid" refers to any amino acid, modified amino acid and / or amino acid analog that is not one of the 20 common naturally occurring amino acids or selenocysteine, or pyrolysin. For example, the unnatural amino acids p-benzoyl-L-phenylalanine (Bpa), para-acetyl-L-phenylalanine (pAcPhe), para-azido-L-phenylalanine (pAzPhe) and para-iodo-L-phenylalanine (pIPhe) find use in the invention .

[0049] In response to: As used herein, the term "in response to" refers to a process in which the O-tRNA of the invention recognizes a selector codon and mediates the incorporation of an unnatural amino acid that is associated with tRNA into the growing polypeptide chain.

[0050] Polypeptide: A polypeptide is any oligomer of amino acids (natural or unnatural, or combinations thereof) of any length, typically but not exclusively connected by covalent peptide bonds. The polypeptide may be from any source, e.g., a naturally occurring polypeptide, a polypeptide produced by recombinant genetic molecular techniques, a polypeptide from a cell or translation system, or a polypeptide produced by cell-free synthetic methods. The polypeptide is characterized by its amino acid sequence, e.g., the primary structure of its constituent amino acids. As used herein, the amino acid sequence of a polypeptide is not limited to a full-length sequence, but can be a partial or full sequence. In addition, it is not intended that the polypeptide be restricted due to having no or no biological activity. As used herein, the term "protein" is synonymous with a polypeptide. The term "peptide" refers to a small polypeptide, for example, without limitation, from 2-25 amino acids in length.

[0051] Conservative variant: As used herein, the term "conservative variant", in the context of a translational component, refers to a translational component, e.g., a conservative O-tRNA variant or a conservative O-RS variant that functionally functions similarly to a base component, to which the conservative variant is similar, e.g., OtRNA or O-RS, having variations in sequence compared to the reference O-tRNA or O-RS. For example, an O-RS or conservative O-RS variant will aminoacylate a related O-tRNA with an unnatural amino acid, e.g., an amino acid containing an N-acetylgalactosamine residue. In this example, O-RS and the conservative O-RS variant do not have the same amino acid sequences. The conservative variant may have, e.g., one variation, two variations, three variations, four variations, five or more varieties in sequence, as long as the conservative variant is still complementary to the corresponding OtRNA or O-RS.

[0052] In some embodiments, the conservative O-RS variant comprises one or more conservative amino acid substitutions compared to the O-RS from which it is derived. In some embodiments, the conservative O-RS variant comprises one or more conservative amino acid substitutions compared to the O-RS from which it is derived, and further retains the biological activity of O-RS; for example, a conservative O-RS variant that retains at least 10% of the biological activity of the parent O-RS molecule from which it originates, or, alternatively, at least 20%, at least 30%, or at least 40%. In some preferred embodiments, the conservative O-RS variant retains at least 50% of the biological activity of the parent O-RS molecule from which it is derived. Conservative amino acid substitutions of the conservative O-RS variant may occur in any O-RS domain including the amino acid binding pocket.

[0053] Polynucleotide or nucleic acid: The terms "nucleic acid", "nucleic acid sequence", "nucleotide sequence", "oligonucleotide", "polynucleotide" or "nucleic acid molecule" or similar terms used herein refer to base oligomers typically linked by a sugar phosphate backbone, such as oligonucleotides or polynucleotides and fragments or parts thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double stranded and represent sense or antisense strands. The terms nucleic acid, polynucleotide and nucleotide also specifically include nucleic acids consisting of bases other than the five biological bases (i.e., adenine, guanine, thymine, cytosine and uracil), and also include nucleic acids with unnatural skeletal structure such as molecules PNA.

[0054] Nucleic acid molecules (e.g., DNA or RNA) are said to have "5 'ends" and "3' ends" because mononucleotides are reacted to obtain oligonucleotides or polynucleotides in such a way that 'the phosphate of one pentose ring of the mononucleotide is attached at the 3' position to the oxygen of its neighbor in one direction by means of a phosphodiester linkage. In this way, the polynucleotide typically has one "5 'end" containing 5' phosphate and one "3 'end" containing 3' oxygen. About the sequence

Even though it is internal in a larger nucleic acid, it can also be said to have a 5 'and 3' directionality. In any DNA molecule, linear or circular, discrete components are referred to as "upstream" or 5 'relative to "downstream" or 3' components. This terminology reflects the fact that transcription progresses 5 'to 3' along the DNA strand.

[0055] Gene: As used herein, the term "gene" most generally refers to a combination of polynucleotide components that, when operably linked by native means or by recombination, provide a certain product or function. The term "gene" is intended to be broadly interpreted herein, including mRNA, cDNA, cRNA and genomic DNA forms of the gene. In some cases, the gene is inherited. In some aspects, the genes contain coding sequences (e.g., "open reading frame" or "coding region") necessary for producing a polypeptide, while in other aspects, the genes do not encode the polypeptide. Examples of genes that do not encode polypeptides include ribosomal RNA (rRNA) and transfer RNA (tRNA) genes.

[0056] The term "gene" may optionally include non-coding regulatory sequences that are found at the genetic locus. For example, in addition to the nucleic acid coding region, the term "gene" also includes transcribed full-length mRNA nucleotide sequences adjacent to the 5 'and 3' ends of the coding region. These non-coding regions are of different sizes, and typically extend at both 5 'and 3' ends of the coding region. Sequences that are 5 'and 3' relative to the coding region and are contained in mRNA are referred to as 5 'and 3' non-translated sequences (5 'UT and 3' UT). Both 5 'and 3' UT can be used for regulation, including translation initiation, transcription cleavage and polyadenylation. The term "gene" includes mRNA, cDNA and genomic forms of the gene.

[0057] In some aspects, the genomic form or genomic clone of the gene comprises transcribed mRNA sequences as well as other non-transcribed sequences that are outside the transcript. Regulatory regions that lie outside the mRNA transcription unit are sometimes called "5 'or 3' flanking sequences." The functional genomic form of the gene typically contains the regulatory components necessary to regulate transcription. For example, the term "promoter" is usually used to describe a DNA region, typically, but not exclusively, 5 'from the transcription start site, sufficient to ensure precise transcription start. In some embodiments, the promoter is constitutively active, while in alternative embodiments, the promoter is conditionally active (e.g., when transcription is started only under certain physiological conditions). In prokaryotes, promoter activity can be modulated by the adjacent "operator" sequence. In some embodiments, the 3 'flanking region contains additional sequences that regulate transcription termination, sometimes referred to as "terminator" sequences. Generally, the term "regulatory component" refers to any genetic component that controls certain aspects of the expression of a nucleic acid sequence.

[0058] Expressible nucleotide sequence: As used herein, the term "expressed nucleotide sequence" refers to any nucleotide sequence that may

Be transcribed (e.g., transcribed by a DNA-dependent RNA polymerase) to form a transcript. The transcript sequence is not restricted and may be coding for a protein (e.g., may encode aminoacyl-tRNA synthetase) or may be coding for non-protein (e.g., may encode a tRNA molecule).

[0059] Functionally linked: As used herein, the terms "in functional combination", "in functional order", "functionally linked", "functionally attached" and similar phrases, when used in reference to nucleic acids, refer to the coupling of remaining nucleic acid sequences in mutual functional relationship. For example, an operably linked promoter sequence, open reading frame, and terminator sequence lead to precise RNA molecule production. In some aspects, operably linked nucleic acid components lead to transcription of the open reading frame and eventually to polypeptide formation (i.e., expression of the open reading frame).

[0060] Operon: As used herein, the term "operon" refers to a genetic unit (e.g., a chromosomal region) that controls gene expression in prokaryotes. An operon typically contains one or more genes encoding one or more polypeptides or RNAs and an adjacent regulatory region (or regions) that controls gene transcription. The regulatory region typically contains a promoter and operator. The coding region of the prokaryotic gene is historically called the "cistron". Operons that contain many cistrons are referred to as "polycistronic". Genes in the polycistronic operon are typically associated with functioning and are typically co-transcribed as a single entity and expressed in a coordinated manner.

[0061] Construct: As used herein, the term "construct" is used to refer to any polynucleotide or other molecule that can carry a stretch (s) of nucleic acid into a cell. The term "vector" or "carrier" is sometimes used interchangeably with "vector". The vector optionally contains portions that mediate the propagation and manipulation of the vector (e.g., sequences necessary for replication, genes transmitting drug or antibiotic resistance, multiple cloning sites, components of a functionally linked promoter / enhancer that allow expression of the cloned gene, etc.). Vectors are often derived from plasmids, bacteriophages, or plant or animal viruses. "Cloning vector" or "shuttle vector" or "subcloning vector" contain functionally linked portions facilitating the subcloning steps (e.g., a multiple cloning site containing multiple endonuclease restriction sites).

[0062] Expression vector: The term "expression vector" as used herein refers to a recombinant vector containing functionally linked polynucleotide sequences that facilitate the expression of a coding sequence in a given host organism (e.g., a bacterial expression vector). Polynucleotide sequences that facilitate expression in prokaryotes usually include, e.g., a promoter, transcription termination sequences, i.e., terminator sequences, operator (optionally) and ribosome binding site, often together with other sequences.

[0063] Encode: As used herein, the term "encode" refers to any process in which information contained in a polymeric macromolecule or sequence sequence is used to direct the formation of a second molecule or sequence sequence that is different from the first molecule or sequence sequence. As used herein, the term is widely used, and can have many uses. In some aspects, the term "encode" describes a process of semi-conservative DNA replication in which one strand of a double-stranded DNA molecule was used as a template for encoding a freshly synthesized complementary sister strand, by DNA-dependent DNA polymerase.

[0064] In another aspect, the term "encode" refers to any method in which information contained in one molecule is used to direct the formation of a second molecule that differs in chemical nature from the first molecule. For example, the DNA molecule may encode an RNA molecule (e.g., by a transcription process introducing a DNA-dependent RNA polymerase enzyme). Also, the RNA molecule can encode the polypeptide, as in the translation process. When used to describe the translation process, the term "encode" also extends to the triplet codon that encodes the amino acid. In some aspects, the RNA molecule can encode a DNA molecule, e.g., in a reverse transcription process introducing RNA-dependent DNA polymerase. In another aspect, the DNA molecule may encode a polypeptide in which it is understood that "encode" as used in this case includes both transcription and translation processes.

[0065] Heterological: As used herein, the term "heterologous" or "exogenous" when used for polynucleotides or polypeptides refers to molecules that have been rearranged or artificially delivered to a biological system and are not in a native configuration (e.g., with reference to sequence , genomic location or alignment) or are not native to that particular biological system. The terms indicate that the correct material came from a source other than a natural source, or refers to molecules that have an unnatural configuration, genetic location or arrangement of parts. The terms "exogenous" and "heterologous" are sometimes used interchangeably with "recombinant".

[0066] Recombinant: The term "recombinant", referring to a nucleic acid or polypeptide, indicates that the material (e.g., recombinant nucleic acid, gene, polynucleotide, polypeptide, etc.) has been altered as a result of human intervention. Generally, the arrangement of a portion of the recombinant molecule is not a native configuration, or the primary sequence of the recombinant polynucleotide or the polypeptide has been somehow manipulated. The change to obtain recombinant material can be made in the material in its natural environment or state or after removal from it. For example, a naturally-occurring nucleic acid becomes a recombinant nucleic acid if it is altered, or if it is transcribed from DNA that has been altered, as a result of human intervention in the cell of origin. The open reading gene gene sequence is recombined if the nucleotide sequence has been removed from its natural context and cloned into any type of artificial acid vector

- 18 nucleic acid. The term recombined may also refer to an organism that stores recombinant material. Protocols and reagents for producing recombinant molecules, especially recombinant nucleic acids, are widely known and routine in the art (see, e.g., Maniatis et al., Ed.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York , [1982]; Sambrook et al. (Ed.), Molecular Cloning: A Laboratory Manual, Second Edition, Vol. 1-3, Cold Spring Harbor Laboratory Press, New York, [1989]; and Ausubel et al., (ed.), Current Protocols in Molecular Biology, Volume 1-4, John Wiley & Sons, Inc., New York [1994]).

[0067] Native or endogenous: In contrast to a heterologous or exogenous molecule, the "native" or "endogenous" molecule is native to the biological system, species or chromosome under study. A "native" or "endogenous" gene is a gene that does not contain nucleic acid components encoded by sources other than the chromosome on which it normally occurs in nature. The endogenous gene, transcript or polypeptide is encoded by its natural chromosomal locus, and is not unnaturally delivered to the cell.

[0068] Host cell: The term "host cell" typically refers to a cell that contains a heterologous nucleic acid, such as a vector, and supports the replication and / or expression of the nucleic acid. Host cells can be prokaryotic cells such as E. coli or eukaryotic cells such as yeast, insect, amphibian or mammalian cells. Preferably, the host cells are plant cells. In the context of the invention, one particularly preferred host cell is a soybean host cell.

[0069] Eukaryote: As used herein, the term "eukaryote" refers to organisms belonging to the Kingdom of Eucarya. Eukaryotes generally differ from prokaryotic organisms in their typically multicellular organization (but not exclusively multicellular, for example, yeast), the presence of membrane-surrounded nucleus and other membrane-surrounded organelles, linear genetic material (i.e. linear chromosomes), the lack of operons, the presence of introns, the closing message and poly-A mRNA, and other biochemical features such as the distinguishing structure of the ribosome. Eukaryotic organisms include, for example, animals (e.g., mammals, insects, reptiles, birds, etc.), ciliates, plants (e.g., monocots, dicotyledons, algae, etc.), fungi, yeast, flagellates, microsporidia, protozoa, etc.

[0070] Prokaryote: As used herein, the term "prokaryote" refers to organisms belonging to the Kingdom of Monera (also called Procarya). Prokaryotic organisms generally differ from eukaryotes in their unicellular organization, asexual reproduction by budding or fission, the absence of a membrane-surrounded nucleus or other membrane-surrounded organelles, a circular chromosome, the presence of operons, a lack of introns, a closing message and poly-A mRNA, and other features biochemicals, such as the distinguishing structure of the ribosome. Prokarya include the subdomains of Eubacteria and Archaea (sometimes referred to as "Archeabacteria"). Cyanobacteria (cyanobacteria) and mycoplasma sometimes receive separate classifications under the Monera Kingdom.

[0071] Bacteria: As used herein, the terms "bacterium" and "eubacteria" refer to prokaryotic organisms that differ from Archaea. Similarly, Archaea relates to prokaryotic organisms that differ from eubacteria. Eubacteria and Archaea can be distinguished by many morphological and biochemical criteria. For example, differences in the ribosomal RNA sequence, RNA polymerase structure, presence or absence of introns, antibiotic sensitivity, presence or absence of cell wall peptidoglycans and other cell wall components, branched structures compared to unbranched membrane lipids, and in the presence / absence of histones and proteins histone-like ones are used to assign the body to Eubacteria or Archaea.

[0072] Examples of Eubacteria include Escherichia coli, Thermus thermophilus and Bacillus stearothermophilus. An example of an Archaea includes Methanococcus jannaschii (Mj), Methanosarcina mazei (Mm), Methanobacterium thermoautotrophicum (Mt), Methanococcus maripaludis, Methanopyrus kandleri, Halobacterium such as Haloferax volcanii and Halobacterium species NRC-1, Archusoglobus fulus, .

Pyrococcus horikoshii (Ph), Pyrobaculum aerophilum, Pyrococcus abyssi, Sulfolobus solfataricus (Ss), Sulfolobus tokodaii, Aeuropyrum pernix (Ap), Thermoplasma acidophilum and Thermoplasma volcanium.

[0073] Derived from: As used herein, the term "derived from" refers to an ingredient that is isolated from or obtained using a particular molecule or organism, or information from a particular molecule or organism. For example, a polypeptide that is derived from a second polypeptide may comprise an amino acid sequence that is identical or substantially similar to the amino acid sequence of the second polypeptide. In the case of polypeptides, derived species can be obtained by, for example, naturally occurring mutagenesis, unnatural site-directed mutagenesis or unnatural random mutagenesis. The mutagenesis used to prepare derivative polypeptides may be deliberately targeted or deliberately random, or a mixture thereof. Mutagenesis of the polypeptide to form another first-derived polypeptide may be a random event (e.g., caused by polymerase inaccuracy) and identification of the derivative polypeptide may be accomplished using appropriate screening methods, e.g., as discussed herein. Mutagenesis of a polypeptide typically requires manipulation of a polynucleotide that encodes the polypeptide.

[0074] Similarly, the term "derived from" may refer to polynucleotides. A polypeptide that is derived from a source polynucleotide may contain a nucleotide sequence that is identical or substantially similar to the source of the nucleotide sequence. In the case of polynucleotides, derivatives of species can be obtained by, for example, naturally occurring mutagenesis, unnatural site-directed mutagenesis or unnatural random mutagenesis. The mutagenesis used for the preparation of polynucleotides may be either intentionally targeted or intentionally random, or a mixture thereof. In some aspects, a derivative polynucleotide is generated by placing the source polynucleotide in a heterologous context, i.e. in a context that is different from the native or endogenous context. For example, the gene promoter can be obtained from the endogenous gene promoter

- removing the domain of this endogenous promoter and placing it in operative association with various nucleotide sequences to which it is not normally associated.

[0075] Positive selection or screening marker: As used herein, the term "positive selection or screening marker" refers to a marker that, when present, e.g., expressed, activated or similar, leads to the identification of the cell that contains the trait, e.g., cells with a positive selection marker from those with no trait.

[0076] Negative selection or screening marker: As used herein, the term "negative selection or screening marker" refers to a marker that, when present, e.g., expressed, activated or similar, allows the identification of a cell that does not contain the selected property or characteristic (e.g., compared to a cell that has properties or traits).

[0077] Selection or screening agent: As used herein, the term "selection or screening agent" refers to an agent that, when present, allows selection / screening of certain components from a population. For example, the selection or screening agent may be, but not limited to, e.g., nutrient, antibiotic, light wavelength, antibody, expressed polynucleotide, or the like. Selection agents may vary, e.g., concentration, intensity, etc.

[0078] Reporter: As used herein, the term "reporter" or equivalent terms generally refer to any component that can be easily detected in a test system in which reporter detection correlates with the presence or absence of another molecule or property, or can be used to identify, select and / or search targets in the system of interest. The selection of the most suitable reporter to use for a given application depends on the intended purpose and other variables known in the art. In some aspects, the reporter is a reporter gene.

[0079] A variety of reporter molecules and genes are known in the art. Each reporter has a specific test to detect this reporter. Some tests detecting reporters may be enzymatic tests, while other tests may be immunological tests (e.g., ELISA or immunohistochemical analysis), or colorimetric, for example. In addition, the reporter may include a protein, e.g., an enzyme that confers sensitivity or resistance to an antibiotic (e.g., β-lactamase, chloramphenicol acetyl transferase (CAT), etc.), a fluorescent marker (e.g., green fluorescent protein such as GFP, YFP , EGFP, RFP, etc.), a luminescent marker (e.g., skylight luciferase protein), an affinity-based search marker, an enzymatic activity such as lacZ (β-galactosidase) or other selective positive or negative marker genes, such as ADH (alcohol dehydrogenase), his3, ura3, leu2, lys2, or the like.

BRIEF DESCRIPTION OF THE FIGURES [0080] FIG. 1 provides the structure and corresponding names of four unnatural amino acids, which are p-benzoyl-L-phenylalanine (Bpa), para-acetyl-L-phenylalanine (pAcPhe), para-azido-L-phenylalanine (pAzPhe) and para-iodo-L -phenylalanine (pIPhe).

[0081] FIG. 2 is a histogram showing the efficiency of plasmid suppression (relative to wild-type β-galactosidase) with the proK promoter and terminator for the V // tI <\ A-Tvr (CUA) gene, D286R mutation in the BpaRS gene, a mutated form of the glnS promoter for the gene

BpaRS and / or multiple copies of the tRNA gene. S error shakes indicate standard deviation in =

3.

[0082] FIG. 3 provides a chemiluminescence image from Northern blot analysis of the amber suppressor MjtRNA-Tyr (CUA) expressed from said suppression plasmids.

[0083] FIG. 4 provides a chemiluminescence image after Western blot analysis of BpaRS expressed under the control of the wild type glnS promoter and the mutated form of the glnS promoter. Blot used anti-His (C-term) antibody-HRP conjugate (Invitrogen).

[0084] FIG. 5 shows the plasmid map of pSup-BpaRS-6TRN. Other synthetase genes were subcloned from their respective plasmids pBK into the Ndel / Pstl sites of this plasmid.

[0085] FIG. 6 shows the efficiency of suppression of the new system for the incorporation of Bpa, pAcPhe, pAzPhe and pIPhe. Error bars indicate standard deviation in = 3.

[0086] FIG. 7 provides an image of chemiluminescence after Western blotting of a Bpa-containing myoglobin mutant at the Ser-4 site expressed in the absence or presence of Bpa. Blot used anti-His (C-term) antibody-HRP conjugate (Invitrogen).

[0087] FIG. 8 provides various polynucleotide and polypeptide sequences that find use in the invention.

DETAILED DESCRIPTION OF THE INVENTION [0088] The invention provides compositions, host cells, translation systems and methods as defined in the claims.

[0089] The invention provides new features of expression vectors that result in a significant improvement in efficiency in the incorporation of unnatural amino acids into proteins in eubacteria (e.g., E. coli), and lead to high-throughput expression of mutated proteins containing unnatural amino acids at specific locations designated genetically by selector codons . The improvement in the incorporation of unnatural amino acids into the protein of interest is likely due to (at least partially) improved expression of the orthogonal aminoacyl-tRNA synthetase and suppressor tRNA, although an understanding of the mechanism of improved performance is not required to implement or use the invention.

[0090] These features of the new expression vectors of the invention are broadly compatible with the various skeletons of the E. coli expression vector and E. coli strains, and are also readily adapted to the expression of other proteins or tRNAs of interest in addition to expression of orthogonal aminoacyl-tRNA synthetase or orthogonal suppressive tRNA.

[0091] In some aspects, the features of the new expression vector provided by the invention are used independently in separate plasmids. In other aspects, one new feature or combination of features is used in many plasmids. In yet other embodiments, many of these features are used in combination on the same plasmid. The invention provides a number of improvements in bacterial expression vector systems that can be used to improve the expression of mutated proteins containing one or more unnatural amino acids, and in some cases, can be used more widely to increase the expression of any particular polypeptide or tRNA of interest.

[0092] The invention provides, for example, the following improvements in bacterial expression vector systems:

[0093] (A) Expression vectors are described herein in which the orthogonal aminoacyl-tRNA synthetase gene and the orthogonal suppressor tRNA gene are carried on the same plasmid. This simplifies the expression of these orthogonal components, in which previously, the two components were each carried on separate plasmids;

[0094] (B) The invention provides improved promoter and terminator sequences as defined in the claims.

[0095] (C) Also described herein are improved recombinant polycistronic operons for expressing tRNA genes in which any two tRNA genes in the operon are separated by a sequence of a heterologous linker derived from a linker of the naturally occurring tRNA of the polycistronic operon, for example, a linker that occurs naturally between E. coli valU and valX genes, or alternately, e.g., between the ileT and alaT genes.

[0096] (D) Also described herein is a new promoter sequence derived from the E. coli glnS promoter for improved expression of an open reading frame, e.g., an open reading frame encoding orthogonal aminoacyl-tRNA synthetase

VECTOR SYSTEMS FOR CO-EXPRESSION OF O-tRNA and O-RS GENES [0097] Described herein are expression vectors in which the orthogonal aminoacyl-tRNA synthetase gene and the orthogonal suppressor tRNA gene are carried on the same plasmid. This feature is an improvement in the field where previously co-transformation of the host cell from two separate expression vectors that independently carried the O-tRNA and O-RS genes were needed.

[0098] As described in the Examples, a number of related expression vectors were constructed that are suitable for co-expressing O-tRNA and O-RS species. These plasmids include:

pYR-BpaRS1 pYR-BpaRS5 pYR-BpaRS5 (D286R) pYR-BpaRS-TRN

- 23 pYR-BpaRS-TRN (D286R) pYR-BpaRS-3TRN (D286R) pYR-BpaRS-6TRN (D286R) pSup-BpaRS-6TRN (D286R) pSup-pAcPheRS-6TRN pSup-pAzPSRS-6TRP 0099] Each of these plasmids is described herein. However, it is not intended that the invention be limited to these plasmids, since one of ordinary skill in the art will recognize that constructions of variants of these plasmids are within the scope of the disclosure.

[0100] For example, it is not intended that any plasmid of the invention be limited to the expression of any particular species of O-tRNA or O-RS to produce a protein containing any particular unnatural amino acid. The examples provided herein describe the effective use of MjtRNA-Tyr (CUA) (SEQ ID NO: 1) and four different O-RS species that have tRNA loading specificity for p-benzoyl-L-phenylalanine (Bpa), para-acetyl-L-phenylalanine ( pAcPhe), para-azido-L-phenylalanine (pAzPhe) and p-iodo-L-phenylalanine (pIPhe) (see FIG. 1 and FIG. 8, SEQ ID NOS: 4, 6, 8 and 10).

[0101] These above working examples serve to illustrate the broader application of the invention for use with other O-tRNA and O-RS species. Indeed, the invention finds use in the expression of any O-tRNA or any O-RS of interest, and in particular orthogonal translation components that work optimally in eubacterial cells. In some aspects, the invention finds particular use with O-RS species that are derived from naturally occurring Archaea (e.g., Methanococcus jannaschii) aminoacyl-tRNA synthetase or O-tRNA species derived from Archaea tRNA. The wide range of O-tRNA and ORS species that find use in the invention is known in the art and are described in many sources. See, for example, International Publication Numbers WO 2002/086075, entitled "METHODS AND COMPOSITION FOR THE PRODUCTION OF ORTHOGONAL tRNA-AMINOACYLO-tRNA SYNTHETASE PAIRS;" WO 2002/085923, entitled "IN VIVO INCORPORATION OF UNNATURAL AMINO ACID;" WO 2004/094593, entitled "EXPANDING THE EUKARYOTIC GENETIC CODE;" WO 2005/019415, filed July 7, 2004; WO 2005/007870, filed July 7, 2004; WO 2005 / 00762A., Filed July 7, 2004 and WO 2006/110182, filed October 27, 2005, entitled "ORTHOGONAL TRANSLATION COMPONENTS FOR THE IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS." For further discussion of orthogonal translation systems that contain unnatural amino acids, and methods for their production and use, see also, Wang and Schultz "Expanding the Genetic Code," Angewandte Chemie Int. Ed., 44 (1): 34.66 (2005), Xie and Schultz, "An Expanding Genetic Code," Methods 36 (3): 227-238 (2005); Xie and Schultz, "Adding Amino Acids to the

- 24 Genetic Repertoire, "Curr. Opinion in Chemical Biology 9 (6): 548-554; and Wang et al.," Expanding the Genetic Code, "Annu. Rev. Biophys. Biomol. Struct., Pub January, 2006.

[0102] The prior art (e.g., field cited herein) also provides guidance on the construction and use of many variants (e.g., conservative variants) and fragments of known O-RS and O-tRNA species. These variants and fragments also find use with the expression vectors of the invention. The field also provides guidance on the identification and construction of new O-RS and O-tRNA species, which are also applicable to the invention.

PLASMID CONSTRUCTIONS AND EUBACTERIAL HOST CELLS [0103] As described and used in Example 6, the plasmids provided herein are based on the pACYC184 vector backbone. However, it is not intended that the plasmids of the invention be limited to the use of this particular vector backbone. One skilled in the art will recognize that any of a variety of plasmids (including other plasmids available on the market or on the market) can be used to construct the plasmids of the invention. For example, plasmids pACYC177 and pRARE2 vector (Novagen; see in Novations, No. 12, June 2001), can also be used in conjunction with the invention. In some aspects, any plasmid bearing a compatible origin of replication (e.g., p15A origin of replication) and at least one selection marker can be used in conjunction with the invention. Derivatives of plasmid pSC101 can also be used in the invention.

[0104] Also as described in Example 6, the plasmids provided by the invention were used to transform One Shot^® TOP-10 electrocompetent E. coli (Invitrogen ™). However, it is not intended that the eubacterial strain used as host cells for the production of proteins containing one or more unnatural amino acids is restricted to the use of that particular host cell. One skilled in the art will recognize that any of a variety of host cells (including other commercially available plasmids as well as user-generated strains) can easily be used to produce proteins containing unnatural amino acids. For example, other host cells, such as E. coli DH10B ™ strain (Invitrogen ™), Electrocomp ™ GeneHogs^®(Invitrogen ™), BL21 One Sbot^® (Invitrogen ™) and BL21 (DE3) One Shot^® (Invitrogen ™). Indeed, any E. coli strains without any endogenous tRAN suppressor gene are a suitable host cell. Other species of eubacteria besides E. coli also find use in the invention. For example, it is believed that Bacillus subtilis strains can also be used as host cells for the vectors of the invention.

IMPROVED PROMOTER AND TERMINATOR SEQUENCES FOR O-tRNA EXPRESSION [0105] To improve suppressive efficiency in the orthogonal translation system, a new amber suppressor tRNA operon with the naturally occurring E. coli tRNA promoter and terminator was constructed. Examination of E. coli tRNA genes showed that E. coli proline tRNA had the same C1-G72 pair as Archaea tRNA; this couple

- 25 bases are the main determinant of identity for the selective recognition of MjtRNATyr (CUA) by MjTyrRS in E. coli (Wang and Schultz, Chem Biol, 8: 883-890 (2001)).

[0106] In connection with this observation, the synthetic amber suppressor tRNA gene was constructed such that the heterologous O-tRNA gene replaces the gene of the same length (77 nucleotides) of E. coli proK in the monocistronic proK operon. The improved expression vector (pYR-BpaRS5) was produced by substitution of the original suppressor tRNA operon in pYR-BpaRS 1 with the MjtRNA-Tyr gene (CUA) under the control of promoter proK (SEQ ID NO: 32) and terminator proK (SEQ ID NO: 33). This expression construct showed a 2-fold increase in O-tRNA expression (see FIG. 3) and resulted in a significant improvement in suppressive efficiency (see FIG. 2), both relative to the activity of the pYRBpaRS1 vector.

[0107] Thus, the invention provides improved expression vectors for tRNA expression of interest, where expression of polycistronic tRNA is driven by promoter and terminator nucleotide sequences derived from the E. coli prolino tRNA proK gene.

[0108] As described in Example 1, the specific tRNA used to demonstrate this improved vector expression was orthogonal tRNA (O-tRNA), more specifically, MjtRNA-Tyr (CUA). However, it is not intended that the improved tRNA expression efficiency be limited to MjtRNA-Tyr (CUA) nor limited to O-tRNA. Indeed, this feature of the invention can be used to improve expression of the tRNA of interest.

[0109] In E. coli, three tRNA species are loaded with proline during translation. In addition to the proK tRNA gene, E. coli also uses two additional prolyl-tRNA genes. They are proL and proM. Due to the similar structure to the proK locus, it is believed that the proL promoter sequence (SEQ ID NO: 34) and the proL and proM terminator sequences ((SEQ ID NOS: 35 and 36, respectively) also find use in constructing improved expression vectors according to invention. It is also a feature of the invention that combinations of promoters and terminators from different genes of E. coli prolyl-tRNA can also be used to achieve better expression. For example, the proK promoter sequence (SEQ ID NO: 32) can be used in conjunction with the proL terminator sequence (SEQ ID NO: 35).

STRUCTURES OF THE IMPROVED POLICISTRON OPERON [0110] The invention provides improved recombinant polycistronic operons for expression of tRNA genes. Such polycistronic operons contain multiple copies (e.g., three copies) of tRNA genes of interest in which the tRNA sequences are separated by the sequence of a heterologous linker derived from the linker of the naturally occurring polycistronic operon tRNA, e.g., the linker that occurs naturally between E. genes colU valU and valX (SEQ ID NO: 14), or alternatively, e.g., between E. coli ileT and alaT tRNA genes (SEQ ID NO: 15).

[0111] Thus, the invention provides improved expression vectors for the expression of polycistronic tRNA operons, wherein the operon contains at least one heterologous tRNA linker that separates at least two sequences of expressed tRNA. In some embodiments, as described in Example 3, multiple tRNA linkers are used to separate three or more sequences of expressed tRNA in an operon. In this case, the tRNA linker used between each expressed tRNA pair may be different (as in Example 3), or may be the same linker between each tRNA gene.

[0112] It is not intended that the invention be limited to the use of the E. coli valU and valX gene linker (SEQ ID NO: 14), or the E. coli ileT gene linker and alaT tRNA (SEQ ID NO:

15). Indeed, additional naturally occurring tRNA linkers also find use in the invention. For example, each of the following linkers located between the native E. coli tRNA genes listed below finds use in the invention, wherein the linker that is used in the recombinant system is heterologous to any sequence of expressed tRNA is in the recombinant operon. These useful tRNA linkers include:

<td>Connector native E. coli tRNA</td><td>Sequence</td><td>SEQ ID WELL:</td>

<td>valU and valX</td><td>ACTACTTTATGTAGTCTCCGCCGTGTAGCAAGAAATTGAGAA GT</td><td> 14</td>

<td>ileT and alaT</td><td>AATTTGCACGGCAAATTTGAAGAGGTTTTAACTACATGTTAT</td><td> 15</td>

<td>serV and argV</td><td>TTT</td><td> 16</td>

<td>valV and valW</td><td>TCCT</td><td> 17</td>

<td>glyT and thrT</td><td>AGATGT.</td><td> 18</td>

<td>metT and leuW</td><td>TCTTTTTTT</td><td> 19</td>

<td>glnW and METU</td><td>TCGAAGAAACAATCT</td><td> 20</td>

<td>hisR and leuT</td><td>TTATTAGAAGTTGTGACAAT</td><td> 21</td>

<td>glnW and glnW</td><td>TCTTCTTCGAGTAAGCGGTTCACCGCCCGGTTAT</td><td> 22</td>

<td>leuP and leuV</td><td>AACGAGGCGATATCAAAAAAAGTAAGATGACTGT</td><td> 23</td>

<td>glnV and glnX</td><td>ATTTATTCAAGACGCTTACCTTGTAAGTGCACCCAGT</td><td> 24</td>

<td>alaW and alaX</td><td>AATTTTGCACCCAGCAAACTTGGTACGTAAACGCATCGT</td><td> 25</td>

<td>ileU and alaU</td><td>AATTTGCACGGCAAATTTGAAGAGGTTTTAACTACATGTTAT</td><td> 26</td>

<td>ileV and alaV</td><td>AATTTGCACGGCAAATTTGAAGAGGTTTTAACTACATGTTAT</td><td> 27</td>

<td>METU and GLNV</td><td><a href="http://patentimages.storage.googleapis.com/EP1991680B1/imgb0001.png">AATTCTGAATGTATCGAATATGTTCGGCAAATTCAAAACCAATTT</a>GT</td><td> 28</td>

<td>glyW and cysT</td><td><a href="http://patentimages.storage.googleapis.com/EP1991680B1/imgb0002.png">GTTTAAAAGACATCGGCGTCAAGCGGATGTCTGGCTGAAAGGCCT</a>GAAGAATTT</td><td> 29</td>

<td>argX and hisR</td><td><a href="http://patentimages.storage.googleapis.com/EP1991680B1/imgb0003.png">TTTAGTCCCGGCGCTTGAGCTGCGGTGGTAGTAATACCGCGTAAC</a>AAGATTTGTAGT</td><td> 30</td>

<td>argY and argZ</td><td><a href="http://patentimages.storage.googleapis.com/EP1991680B1/imgb0004.png">TCTCTTACTTGATATGGCTTTAGTAGCGGTATCAATATCAGCAGT</a>AAAATAAATTTCCCGAT</td><td> 31</td>

[0113] In some embodiments, preferred tRNA linkers that find use in the invention comprise one or both of the T (-1) and A (77) nucleotides. These two nucleotide positions in tRNA linkers have proved to be optimal for efficient 5 'and 3' processing of tRNA precursors when in their native (i.e. endogenous) context. See, for example, Li and Deutscher, "Maturation pathways for E. coli tRNA precursors: A random multienzyme process in vivo, "Cell 86: 503-512 (1996); and Zahler et al.," Recognition of the 5 'leader of pre-tRNA substrates by the active site of ribonuclease P, "RNA 9 : 734-745 (2003) In other embodiments, tRNA linkers useful in the present invention include restriction sites (naturally occurring or modified).

[0114] In some embodiments, the invention provides constructs that contain many of the same polycistronic operon, optionally in tandem. Thus, if one polycistronic operon contains three copies of the expressed nucleotide sequence (such as the tRNA gene), then two of the operons lead to a total of six expressed tRNA gene sequences. This type of gene cluster configuration is demonstrated in Example 3 and FIG. 5.

[0115] The improved recombinant polycistronic operon described in Example 3 expresses the orthogonal MjtRNA-Tyr (CUA) tRNA. However, it is not intended that the invention be limited to the expression of MjtRNA-Tyr (CUA). Nor is the invention limited to the expression of orthogonal tRNA species. Indeed, the improved polycistronic operons of the invention can be used to express any desired tRNA species.

IMPROVED E. coli glnS PROMOTER FOR POLYPEPTIDE EXPRESSION [0116] The disclosure provides a new promoter sequence derived from the E. coli glnS promoter to increase expression of the open reading frame. As described in Example 2, the glnS promoter mutant (SEQ ID NO: 12) described in Plumbridge and Soll (Biochim 69: 539-541 (1987)) was subcloned into the expression vector of the invention. Sequencing of the glnS promoter subcloned region showed accidental insertion of the deletion into the promoter sequence (in addition to the substitution described in Plumbridge and Soll). This further modified variant of the new glnS promoter was named glnS-TNR (provided in SEQ ID NO: 13). Unexpectedly, this mutation improves the translational efficiency of the w system

Compared to wild-type glnS promoter activity as determined by Western blotting (see Fig. 4).

[0117] As described in Examples 2 and 5, the glnS-TNR promoter was used to express orthogonal BpaRS, pAcPheRS, pAzPheRS and pIPheRS synthetases. However, it is not intended that the invention be limited to the expression of any particular orthogonal aminoacyl-tRNA synthetase, or limited to any aminoacyl-tRNA synthetase in general. This improved promoter finds wide application in the expression of bacterial open reading frames of any desired polypeptide.

ORTHOGONAL tRNA / AMINOACLO-tRNA SYNTHETASE TECHNOLOGY [0118] Understanding of the new compositions and methods of the invention is facilitated by understanding the pairs of orthogonal tRNA and orthogonal aminoacyl-tRNA synthase activities. In order to add additional unnatural amino acids in the genetic code, new orthogonal pairs containing aminoacyl-tRNA synthetase and the corresponding tRNA are needed so that they can work efficiently in the host's translation mechanism, but which are "orthogonal" to the translation system in question, meaning that it works independently from synthetases and tRNA endogenous to the translation system. Desirable traits of an orthological pair include tRNA that only decodes or recognizes a particular codon, e.g., a selector codon that is not decoded by any endogenous tRNA and aminoacyl-tRNA synthetase that preferably aminoacylates (or "charges") its related tRNA with only one specific unnatural amino acid. O-tRNA is also not typically aminoacylated by endogenous synthetases. For example, in E. coli, the orthogonal pair will contain an aminoacyl-tRNA synthetase that does not cross-react with any of the endogenous tRNA, e.g., which is in E. coli, and orthogonal tRNA that is not aminoacylated by any of the endogenous synthetases, e.g., which is 21 in E. coli. So far, many structurally diverse unnatural amino acids have been incorporated into proteins using orthogonal translation technology as is known in the art.

[0119] The ability to incorporate a site-specific unnatural amino acid into a polypeptide may facilitate protein testing by enabling highly selective post-translational modification of these proteins as well as enabling the construction of proteins with new properties. For example, the expression of proteins containing one or more unnatural amino acids may facilitate the study of proteins by specific labeling, change the catalytic function of enzymes, improve biological activity or reduce cross-reactivity with the substrate, cross-link the protein with other proteins, small molecules or biomolecules, reduce or eliminate protein breakdown, improve in vivo half-life of proteins (e.g., by pegylation or other modifications of introduced reactive sites), etc.

[0120] Orthogonal translation systems that are suitable for the production of proteins that include one or more unnatural amino acids are known in the art, as are general methods for producing orthogonal translation systems. On

- For an example, see International Publication Numbers WO 2002/086075, entitled "METHODS AND COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA-AMINOACYL-tRNA SYNTHETASE PAIRS;". WO 2002/085923, entitled "IN VIVO INCORPORATION OF UNNATURAL AMINO; WO 2004/094593, entitled "EXPANDING THE EUKARYOTIC GENETIC CODE;" WO 2005/019415, filed July 7, 2004; WO 2045/007870, filed July 7, 2004; WO 2005/007624, filed July 7, 2004 and WO 2006/110182, filed October 27, 2005, entitled "ORTHOGONAL TRANSLATION COMPONENTS FOR THE IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS." For an overview of orthogonal translation systems that incorporate unnatural amino acids, and methods for their production and use, see also, Wang and Schultz, "Expanding the Genetic Code," Angewandte Chemie Int. Ed., 44 (1): 34-66 (2005), Xie and Schultz, "An Expanding Genetic Code," Methods 36 (3): 227-238 (2005); Xie and Schultz, "Adding Amino Acids to the Genetic Repertoire," Curr. Opinion in Chemical Biology 9 (6): 548-554; Wang et al., "Expanding the Genetic Code," Annu. Rev. Biophys. Biomol. Struct., 35: 225-249 (2006); and Xie and Schultz, "A chemical toolkit for proteins - an expanded genetic code," Nat. Rev. Moth. Cell Biol., 7 (10): 775-782 (2006; pub August 23, 2006).

[0121] Such translation systems generally contain cells (which may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast), which include orthogonal tRNA (O-tRNA), orthogonal aminoacyl-tRNA synthase (ORS), and an unnatural amino acid, where O-RS aminoacylates O-tRNA with an unnatural amino acid. The orthogonal pair of the invention may include O-tRNA, e.g., suppressor tRNA, frame shift tRNA, etc., and related O-RS.

[0122] Generally, if an orthogonal pair recognizes a selector codon and loads an amino acid in response to a selector codon, then the orthogonal pair is said to "suppress" the selector codon. This means that a selector codon that is not recognized by the endogenous apparatus of the translation system (e.g., cells) is not normally loaded, which blocks the production of a polypeptide that would otherwise be translated from the nucleic acid. In the pair's orthogonal system, O-RS aminoacylates O-tRNA with a specific unnatural amino acid. The charged O-tRNA recognizes the selector codon and suppresses the translational block caused by the selector codon. The cell uses an O-tRNA / O-RS pair to incorporate an unnatural amino acid into the growing polypeptide chain, e.g., by a nucleic acid that contains a polynucleotide encoding the polypeptide of interest, where the polynucleotide contains a selector codon that is recognized by O-tRNA. In some preferred aspects, the cell may contain an additional O-tRNA / O-RS pair in which the additional O-tRNA is loaded by additional O-RS with another unnatural amino acid. For example, one of the O-tRNAs can recognize a four-base codon and the other recognizes a stop codon. Alternatively, many different stop codons or many different four-base codons can specifically recognize different selector codons.

[0123] In some embodiments, the systems include cells, such as an E. coli cell or yeast cell, which contains orthogonal tRNA (O-tRNA), orthogonal aminoacyl-tRNA synthetase (O-RS), an unnatural amino acid, and a nucleic acid that contains a polynucleotide encoding a polypeptide of interest, wherein the polynucleotide contains a selector codon that is recognized by O-tRNA. The translation system can also be a cell-free system, e.g., many of the various commercially available "in vitro" transcription / translation systems combined with an O-tRNA / ORS pair and an unnatural amino acid as described herein.

[0124] As already mentioned, in some embodiments, there are many OtRNA / O-RS pairs in a cell or other translation system that allows the incorporation of more than one unnatural amino acid in a polypeptide. For example, the cell may further comprise another additional O-tRNA / O-RS pair and a second unnatural amino acid, wherein the additional O-tRNA recognizes the second selector codon and the additional O-RS preferably aminoacylates O-tRNA with a second unnatural amino acid. For example, a cell that contains an O-tRNA / O-RS pair (where the O-tRNA recognizes, e.g., an amber selector codon) may further comprise a second orthogonal pair, where the second O-tRNA recognizes a different selector codon, e.g., opal codon, four base codon, or the like. Preferably, different orthogonal pairs are from different sources, which may facilitate recognition of different selector codons.

[0125] O-tRNA and / or O-RS may be naturally occurring or may be, e.g., obtained by mutations of naturally occurring tRNA and / or RS, e.g., by producing tRNA libraries and / or RS libraries from any from different organisms and / or using one of the many mutation strategies available. For example, one strategy for producing an orthogonal tRNA / aminoacyl-tRNA pair involves importing a heterologous (into the host cell) tRNA / synthetase pair from, e.g., a source other than the host cell or multiple sources, into the host cell. The properties of the heterologous synthetase candidate include, e.g., that it does not load any host cell tRNA, and the properties of the heterologous tRNA candidate include, e.g., that it is not aminoacylated by any host cell synthetase. In addition, the heterologous tRNA is orthogonal to all host cell synthetases.

[0126] The second strategy for generating an orthogonal pair requires the generation of mutational libraries that are screened and / or selects O-tRNA or O-RS. These strategies can also be combined.

Orthogonal tRNA (O-tRNA) [0127] Orthogonal tRNA (O-tRNA), preferably mediates the incorporation of an unnatural amino acid into a protein that is encoded by a polynucleotide that contains a selector codon that is recognized by O-tRNA, for example, in in vivo or in vitro, with high suppressive efficiency. Suppressive performance can be determined using one of many tests known in the art. For example, a test can be used

31 β-galactosidase reporter, e.g., a lacZ derivative of a plasmid (in which the construct has a selector codon in the lacZ nucleic acid sequence) is introduced into cells from a suitable organism (e.g., an organism in which orthogonal components can be used) together with a plasmid containing O-tRNA according to the invention. Related synthetase may also be introduced (as a polypeptide or polynucleotide that codes for the related synthetase during expression). Cells are cultured in media to the desired density, e.g., to OD₆₀₀ about 0.5 and β-galactosidase tests are performed, e.g., using the BetaFluor ™ β-galactosidase Test Kit (Novagen). The percentage of suppression can be calculated as the percentage of activity for the sample relative to a comparable control, e.g., the value observed from the lacZ derivative construct, where the construct has the appropriate sense codon in the desired position rather than the selector codon.

[0128] O-tRNA can also be obtained from conservative variants of known O-tRNA. For example, conservative variants of O-tRNA are those molecules that function similarly to specific O-tRNAs, e.g., as in the sequence listing here, and which maintain the L-shaped tRNA structure due to their own complementarity, but which do not have such the sequence itself, e.g., here in the sequence listing, figures or examples (and preferably, are other than wild-type tRNA molecules).

[0129] The composition comprising O-tRNA may further comprise orthogonal aminoacyl-tRNA synthetase (O-RS), wherein O-RS preferably aminoacylates O-tRNA with an unnatural amino acid. In some embodiments, the O-tRNA containing composition may further comprise a translation system (e.g., in vitro or in vivo). A nucleic acid that contains a polynucleotide that encodes a polypeptide of interest, wherein the polynucleotide contains a selector codon that is recognized by an O-tRNA, or a combination of one or more of these may be present in the cell.

[0130] Methods for producing orthogonal tRNA (O-tRNA) are known. In some embodiments, the O-tRNA can be produced by generating a library of mutants. A library of mutated tRNAs can be produced using various mutagenesis methods known in the art. For example, mutated tRNAs can be generated by site-specific mutations, random point mutations, homologous recombinations, DNA shuffling or other recursive methods of mutagenesis, chimeric construction, or any combination thereof.

[0131] Additional mutations can be introduced in a specific position (s), e.g., in a non-conservative position, or in a conservative position, in a random position (random positions) or a combination of both in the desired loop or tRNA region, e.g., anti-codon loop, the acceptor arm, D loop or arm, variable arm, TPC arm or loop, other areas of the tRNA molecule, or a combination thereof. Typically, mutations in tRNA include mutation of the anti-codon loop of each component of the library of mutated tRNAs so as to enable selector codon recognition. The method may further comprise adding additional sequences to the O-tRNA. Typically, O-tRNA has improved orthogonality for the desired organism compared to the material

As a starting point, e.g., multiple tRNA sequences, while maintaining their affinity for the desired RS.

[0132] The methods optionally include analyzing similarity (and / or inferred homology) of the tRNA sequence and / or aminoacyl-tRNA synthetases to determine potential candidates for O-tRNA, O-RS and / or pairs thereof that appear orthogonal to a particular body. Computer programs known in the art and described herein, e.g., BLAST and pileup programs can be used for analysis. In one example, to select potential translational orthogonal components for use in E. coli, a synthetase and / or tRNA is selected that does not exhibit close sequence similarity to eubacterial organisms.

[0133] Typically, O-tRNA is obtained by subjecting, e.g., negative selection, a population of cells from a first species in which the cells contain a component from numerous potential O-tRNAs. Negative selection eliminates cells that contain a component from the potential O-tRNA library that is aminoacylated by aminoacylotRNA synthetase (RS), which is endogenous to the cell. This provides a pool of tRNAs that are orthogonal to the first species cell.

[0134] In some embodiments, in negative selection, the selector codon (s) is inserted into a polynucleotide that encodes a negative selection marker, e.g., an enzyme that confers resistance to an antibiotic, e.g., β-lactamase, an enzyme that confers detectable product, e.g., β-galactosidase, chloramphenicol acetyltransferase (CAT), e.g., toxic product, such as barnase, in an insignificant position (e.g., still producing functional barnase), etc. Optionally, screening / selection is performed by culturing the cell population in the presence of a selective agent (e.g., an antibiotic such as ampicillin. In one embodiment, the concentration of the selective agent varies.

[0135] For example, to measure suppressor tRNA activity, a selection system is used that is based on in vivo suppression of a selector codon, e.g., nonsense mutations (e.g., stop) or reading frame shifts introduced into a polynucleotide that encodes a selection marker negative, e.g., the gene for β-lactamase (bla). For example, polynucleotide variants, e.g., blah variants, with a selector codon in a certain position (e.g., A184) are constructed. Cells, e.g., bacteria, are transformed with these polynucleotides. For orthogonal tRNA that cannot be efficiently charged by endogenous E. coli synthetases, antibiotic resistance, e.g., ampicillin resistance, should be about or less than that of a transformed bacterium without plasmid. If the tRNA is not orthogonal, or if the heterologous synthase capable of charging tRNA is co-expressed in the system, a higher level of antibiotic resistance, e.g., ampicillin, is observed. Cells are selected, e.g., bacteria that are not able to grow on LB agar plates with antibiotic concentrations approximately equal to cells transformed without plasmids.

[0136] In the case of a toxic product (e.g., ribonuclease or barnase), if a component of multiple potential tRNAs is aminoacylated by an endogenous host, e.g., Escherichia coli synthetase (i.e. not orthogonal to the host, e.g., Escherichia coli synthetase ), the selector codon is suppressed, and the produced toxic polynucleotide product leads to cell death. Cells storing orthogonal tRNAs or non-functional tRNAs survive.

[0137] In one embodiment, a pool of tRNAs that are orthogonal to the desired organism is then subjected to positive selection in which the selector codon is placed in a positive selection marker, e.g., encoded by a drug resistance gene such as the β- gene lactamase. Positive selection is performed on a cell containing a polynucleotide encoding or containing a tRNA pool component that are orthogonal to the cell, a polynucleotide encoding a positive selection marker, and a polynucleotide encoding RS related. In some embodiments, the second cell population comprises cells that have not been eliminated by negative selection. Polynucleotides are expressed in a cell and the cell is cultured in the presence of a selective agent, e.g., ampicillin. tRNAs are then selected for their ability to be aminoacylated by co-expressed related synthetase and to insert an amino acid in response to this selector codon. Typically, these cells show an improvement in suppressive efficiency compared to cells storing non-functional tRNA or tRNA that cannot be efficiently recognized by the synthetase of interest. A cell storing non-functional tRNA or tRNA that is not efficiently recognized by the synthetase of interest is sensitive to the antibiotic. Thus, tRNAs that: (i) are not substrates for an endogenous host, e.g., Escherichia coli, synthetases; (ii) may be aminoacylated by a synthetase of interest; and (iii) are functional in translation, survive both selections.

[0138] Accordingly, the same marker may be either a positive or negative marker, depending on the context in which it is screened. This means that the marker is a positive marker if it is searched for, but a negative marker if it is searched against.

[0139] Strictness of selection, e.g., positive selection, negative selection, or both positive and negative selection, in the methods described above, optionally involves differentiating the selection stringency. For example, because barnase is a highly toxic protein, the stringency of negative selection can be controlled by inserting different amounts of selector codons into the barnase gene and / or using an inducible promoter. In another example, the concentration of selection or screening agent varies (e.g., ampicillin concentration). In some aspects of the invention, stringency is varied because the desired activity may be low during the initial cycles. Thus, less stringent selection criteria are used in the initial cycles, and more stringent criteria are used in later cycles. In some embodiments, negative selection, positive selection or

- 34 both negative and positive selections can be repeated many times. Many different negative selection markers, positive selection markers, or both positive and negative selection markers can be used. In some embodiments, the positive and negative selection marker can be the same.

[0140] Other types of selection / screening may be used in the invention to produce orthogonal translational components, e.g., O-tRNA, O-RS, and an O-tRNA / O-RS pair that charges an unnatural amino acid in response to a selector codon. For example, a negative selection marker, a positive selection marker, or both positive and negative selection markers may include a marker that fluoresces or catalyzes a luminescent reaction in the presence of a suitable reagent. In another embodiment, the marker product is detected by sorting fluorescence activated cells (FACS) or by luminescence. Optionally, the marker includes an affinity based screened marker. See also, Francisco, JA, et al. (1993) Production and fluorescence-activated cell sorting of Escherichia coli expressing a functional antibody fragment on the external surface. Proc Natl Acad Sci USA. 90: 10444-8.

[0141] Additional methods for producing recombinant orthogonal tRNA can be found, e.g., in International Patent Application WO 2002/086075, entitled "METHODS AND COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA AMINOACYL-tRNA SYNTHETASE PAIRS;" WO 2004/094593 EXP, titled EUKARYOTIC GENETIC CODE ", and WO 2005/019415, filed July 7, 2004. See also Forster et al. (2003) Programming peptidomimetic synthetases by translating genetic codes designed de novo PNAS 100 (11): 6353-6357; i, Feng i collaborators, (2003), Expanding tRNA recognition of a tRNA synthetase by a single amino acid change, PNAS 100 (10): 5676-5681.

Orthogonal aminoacyl-tRNA synthetase (O-RS) [0142] O-RS useful in the invention preferably aminoacylates O-tRNA with an unnatural amino acid, in vitro or in vivo. O-RS may be delivered to a translational system, e.g., a cell, through a polypeptide that includes O-RS and / or through a polynucleotide that encodes O-RS or a fragment thereof. For example, O-RS contains an amino acid sequence as is known in the art, or a conservative variant thereof. In another example, O-RS, or a portion thereof, is encoded by a polynucleotide sequence that encodes an amino acid containing the sequence, in the sequence listing or examples herein, or a complementary polynucleotide sequence thereof. See, e.g., FIG. 8 for sequences of useful O-RS molecules.

[0143] Methods for identifying orthogonal aminoacyl-tRNA synthetase (O-RS), e.g., O-RS for use with O-tRNA, are known. For example, the method includes subjecting selection, e.g., positive selection, to a population of cells from a first species, wherein the cells individually comprise: 1) a component of multiple aminoacyl-tRNA synthetases (RS), (e.g., multiple RS may include mutated RS, RS obtained from a species other than the first species or both mutated RS and RS obtained from a species other than the first species); 2) orthogonal

TRNA (O-tRNA) (e.g., from one or more species); and 3) a polynucleotide that encodes a selection (e.g., positive) marker and comprises at least one selector codon. Cells are selected or screened for those that show an increase in suppressive efficiency compared to cells lacking or with a reduced amount of the multiple RS component. Suppressive performance can be measured using methods known in the art and as described herein. Cells with increased suppressive efficiency contain an active RS that aminoacylates O-tRNA. The level of aminoacylation (in vitro or in vivo) by the active RS of the first tRNA set from the first species is compared with the level of aminoacylation (in vitro or in vivo) by the active RS of the second tRNA set from the second species. The level of aminoacylation can be determined using a detectable substance (e.g., labeled unnatural amino acid). Active RS, which more efficiently aminoacylates the second tRNA set compared to the first tRNA set, is typically selected, thus providing efficient (optimized) orthogonal aminoacyl-tRNA synthetase for use with O-tRNA., Identified by this method, O-RS is also a feature invention.

[0144] Any number of tests can be used to determine aminoacylation. These tests can be carried out in vitro or in vivo. For example, in vitro aminoacylation assays are described, e.g., in Hoben and Soil (1985) Methods Enzymol. 113: 55-59. Aminoacylation can be determined using a reporter together with orthogonal translation components and by detecting the reporter in a cell expressing a polynucleotide containing at least one selector codon that encodes a protein. See also WO 2002/085923, entitled "IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS"; and WO 2004/094593, entitled "EXPANDING THE EUKARYOTIC GENETIC CODE."

[0145] The identified O-RS can be further manipulated to change the specificity of the synthetase substrate such that only the desired unnatural amino acid, but not any of the common 20 amino acids is loaded into the O-tRNA. Methods for generating an orthogonal aminoacyl-tRNA synthetase with substrate specificity for an unnatural amino acid include mutating the synthetase, e.g., at an active site in the synthetase, at the mechanism editing site in the synthetase, at different sites, by combining different synthetase domains, or the like, and using a selection process . A strategy is used which is based on a combination of positive selection followed by negative selection. In positive selection, selector codon suppression introduced at the negligible position (s) of the positive marker allows cells to survive under the pressure of positive selection. In the presence of both natural and unnatural amino acids, those that survive in this way encode active synthetases by loading orthogonal suppressor tRNA with a natural or unnatural amino acid. In negative selection, selector codon suppression introduced at the negligible position (s) of the negative marker removes synthetases with the specificity of natural amino acids. Those that survive in negative and positive selection encode synthetases that aminoacylate (charge) orthogonal suppressor tRNA with only unnatural amino acids. These synthetases can then be subjected to further mutagenesis, e.g., DNA shuffling or other recursive mutagenesis methods.

[0146] A library of O-RS mutants can be generated using various mutagenesis methods known in the art. For example, RS mutants can be generated by site-specific mutations, random point mutations, homologous recombinations, DNA shuffling or other recursive methods of mutagenesis, chimeric construction, or any combination thereof. For example, the RS mutant library can be created from two or more others, e.g., smaller, less diverse "sub-libraries". Chimeric RS libraries are also included in the invention. It should be noted that libraries of tRNA synthetases from various organisms (e.g., microorganisms such as eubacteria or archaebacteria), such as libraries that contain natural diversity (see e.g., US Patent No. 6,238,884, Short et al; US Patent No. 5,756,316, Schallenberger et al; US Patent No. 5,783,431, Petersen et al; US Patent No. 5,824,485, Thompson et al; US Patent No. 5,958,672, Short et al.), Are possibly constructed and searched for orthogonal pairs.

[0147] After subjecting the synthetases to a positive and negative selection / screening strategy, these synthetases can then be subjected to further mutagenesis. For example, a nucleic acid that encodes O-RS can be isolated; a set of polynucleotides that encode mutated ORS (e.g., using random mutagenesis, site-specific mutagenesis, recombination or any combination thereof) can be generated from nucleic acid; and these individual steps or combinations of these steps can be repeated until a mutated O-RS is obtained that preferably aminoacylates the O-tRNA with an unnatural amino acid. In some aspects of the invention, the steps are performed multiple times, e.g., at least twice.

[0148] Additional levels of selection / screening stringency can also be used in the methods of the invention for the production of O-tRNA, O-RS or pairs thereof. The stringency of selection or screening can be varied at one or both stages of the O-RS formation method. This may include, e.g., varying the amount of selection / screening agent that is used, etc. Additional positive and / or negative selection cycles may also be performed. Selecting or screening may also include one or more changes in amino acid permeability, a change in translational efficiency, a change in translational accuracy, etc. Typically, one or more changes are based on a mutation in one or more genes in the body in which the pair Orthogonal tRNA-tRNA synthetase is used to produce protein.

[0149] Additional general information regarding the production of O-RS, and a change in the specificity of the synthetase substrate can be found in International Patent Application WO 2002/086075, entitled "METHODS AND COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA AMINOACYL-tRNA SYNTHETASE PAIRS" and WO 2004/094593 , entitled "EXPANDING THE EUKARYOTIC GENETIC CODE." See also, Wang and Schultz, "Expanding the Genetic Code," Angewandte Chemie Int. Ed., 44 (1): 34-66 (2005).

SOURCE AND ECONOMY ORGANISMS [0150] Translational orthogonal components (O-tRNA and O-RS) used in the invention may be from any organism (or combination of organisms) for use in the host's translation system from any other species, subject to that the O-tRNA / O-RS components and the host system work in an orthogonal manner. It is not required that the orthogonal pair O-tRNA and O-RS originate from the same organism. In some aspects, the orthogonal components are derived from Archaea (i.e., archaebacteria) genes for use in an eubacterial host system.

[0151] For example, orthogonal O-tRNA may be derived from the Archaea organism, e.g., archaebacteria such as Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Halobacterium such as Haloferax volcanii and Halobacterium species NRC-1, Archaeoglobus fulgidus, Pyrococcus, Pyrococcus, Pyrococcus, Pyrococcus pernix, Methanococcus maripaludis, Methanopyrus kandleri, Methanosarcina mazei (Mm), Pyrobaculum aerophilum, Pyrococcus abyssi, Sulfolobus solfataricus (Ss), Sulfolobus tokodaii, Thermoplasma acidophilum, Thermoplasma volcanium, or the like, or an eubacteria, such as Escherichia coli, Thermus thermophilus, Bacillus stearothermphilus, or the like, while orthogonal O-RS may come from an organism or combination of organisms, e.g., archaebacteria, such as Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Halobactetium such as Haloferax volcanii and Halobacterium NRC-1 species, Archaeoglobus fulgidus, Pyrococcus furiosus, Pyrococcus horikoshii, Aeuropyrum pernix, Methanococcus maripaludis, Methanopyrus kandleri, Methanosarcina mazei, Pyrobaculum aerophilum, Pyrococcus abyssi, Sulfolobus solfataricus, Sulfolobus tokodaii, Thermoplasma acidophilum, Thermoplasmus e. or similar. In one embodiment, eukaryotic sources, e.g., plants, algae, protists, fungi, yeast, animals (e.g., mammals, insects, arthropods, etc.) or the like can also be used as O-tRNA and O-RS sources.

[0152] The individual components of the O-tRNA / O-RS pair may be from the same organism or different organisms. In one embodiment, the O-tRNA / O-RS pair is from the same organism. Alternatively, the O-tRNA and O-RS from the O-tRNA / O-RS pair are from different organisms.

[0153] O-tRNA, O-RS or O-tRNA / O-RS pair can be selected or screened in vivo or in vitro and / or used in a cell, e.g., an eubacterial cell, to form a polypeptide with an unnatural amino acid. The eubacterial cell used is not limited, for example, Escherichia coli, Thermus thermophilus, Bacillus stearothermophilus, or the like. Eubacterial cell compositions containing translational components of the invention are also a feature of the invention.

[0154] See also, International Patent Application WO 2004/094593, entitled "EXPANDING THE EUKARYOTIC GENETIC CODE," filed April 16,

- 38 2004, for screening O-tRNA and / or O-RS in one species for use in another species.

[0155] In some aspects, the O-tRNA, O-RS or O-tRNA / O-RS pair can be selected or screened in vivo or in vitro and / or used in a cell, e.g., a eukaryotic cell, to produce a polypeptide with an unnatural amino acid. The eukaryotic cell used is not restricted; for example, any suitable yeast cell such as Saccharomyces cerevisiae (S. cerevisiae) or the like can be used. Eukaryotic cell compositions containing translational components of the invention are also a feature of the invention.

[0156] Although orthogonal translation systems (e.g., containing O-RS, O-tRNA and unnatural amino acid) can use cultured host cells to produce proteins having unnatural amino acids, it is not intended that the orthogonal translation system of the invention would require intact, viable host cells. For example, an orthogonal translation system may use a cell-free system in the presence of a cell extract. Indeed, the use of cell-free in vitro transcription / translation systems for protein production is a well-known method. Adaptation of these systems in vitro to produce proteins having unnatural amino acids using the components of the orthogonal translation system described herein is also within the scope of the invention.

SELECTOR CODONS [0157] Selector codons in orthogonal translation systems expand the codon structure of the protein biosynthetic mechanism of the protein. For example, the selector codon includes, e.g., a unique three-base codon, a nonsense codon, such as a stop codon, e.g., an amber codon (UAG), an opal codon (UGA), an unnatural codon, at least a four-base codon, a rare codon , or similar. A number of selector codons can be inserted into the desired gene, e.g., one or more, two or more, more than three, etc. By using different selector codons, multiple orthogonal tRNA / synthetase pairs can be used that allow simultaneous site-specific integration of multiple unnatural amino acids, e.g., comprising at least one unnatural amino acid, using these different selector codons.

[0158] In one embodiment, the methods include the use of a selector codon, which is a stop codon to incorporate an unnatural amino acid in vivo into a cell in a polypeptide. For example, an O-tRNA is formed that recognizes a stop codon and is aminoacylated by an O-RS with an unnatural amino acid. This O-tRNA is not recognized by naturally occurring host aminoacyl-tRNA synthetases. Conventional site-directed mutagenesis can be used to introduce a stop codon at a site of interest in a polynucleotide encoding a polypeptide of interest. See, e.g., Sayers, et al., (1988), 5 ', 3' Exonuclease in phosphorothioate-based oligonucleotidedirected mutagenesis. Nucleic Acids Res, 791-802. If O-RS, O-tRNA and nucleic acid,

Which encodes the polypeptide of interest are linked, e.g., in vivo, an unnatural amino acid is included in response to a stop codon to give a polypeptide having an unnatural amino acid at a particular site. In one embodiment of the invention, the stop codon used as the selector codon is an amber codon, UAG, and / or an opal codon, UGA. In one example, the genetic code, in which both UAG and UGA are used as a selector codon, can encode 22 amino acids while maintaining the ocher nonsense codon, UAA, which is the most common termination signal.

[0159] Incorporation of unnatural amino acids in vivo can be done without significantly interfering with the host cell. For example, in non-eukaryotic cells such as Escherichia coli, because the suppressive efficiency for the UAG codon depends on the competition between the O-tRNA, e.g., amber suppressor tRNA, and release factor 1 (RF1) (which binds to the UAG codon and initiates release (ribosome growing peptide), suppressive efficiency can be modulated by, e.g., either increasing the level of O-tRNA expression, e.g., suppressor tRNA, or using an RF1 deficient strain. In eukaryotic cells, because the suppressive efficiency for the UAG codon depends on the competition between O-tRNA, e.g., amber suppressor tRNA, and eukaryotic release factor (e.g. eRF) (which binds to the stop codon and initiates the release of the growing peptide from the ribosome), suppressive efficiency can be modulated by, e.g., increasing the level of O-tRNA expression, e.g., suppressor tRNA. In addition, additional compounds, e.g., reducing agents such as dithiothreitol (DTT) may also be present.

[0160] Unnatural amino acids can also be encoded with rare codons. For example, if the concentration of arginine in the in vitro protein synthesis reaction is reduced, the rare arginine codon, AGG, has been shown to be effective in incorporating Ala via synthetic alanine acylated tRNA. See, e.g., Ma et al., Biochemistry, 32: 7939 (1993). In this case, synthetic tRNA competes with naturally occurring tRNA^Arg, which exists as a small species in Escherichia coli. In addition, some organisms do not use all triplet codons. The unassigned AGA codon in Micrococcus luteus was used to insert in vitro amino acids into the transcriptional / translational extract. See, e.g., Smith and Oliver, Nucl. Acid. Res., 25: 4685 (1997). The components of the invention can be prepared for the use of these rare codons in vivo.

[0161] Selector codons may also include extended codons, e.g., four or more base codons, such as four, five, six or more base codons. Examples of four-base codons include, e.g., AGGA, CUAG, UAGA, CCCU, and the like. Examples of five-base codons include, e.g., AGGAC, CCCCU, CCCUC, CUAGA, CUACU, UAGGC, and the like. The methods of the invention include the use of extended codons based on suppression associated with reading frame shift. Four or more base codons can introduce, e.g., one or more unnatural amino acids, into the same protein. In other embodiments, loops

Anti-codon may decode, e.g., a at least four base codon, at least five base codon, at least six base codon or more. Because there are 256 possible four-base codons, multiple unnatural amino acids can be encoded in the same cell using a four or more base codon. See also, Anderson et al., (2002) Exploring the Limits of Codon and Anticodon Size, Chemistry and Biology, 9: 237-244; i, Magliery, (2001) Expanding the Genetic Code: Selection of Efficient Suppressors of Four-base Codons and Identification of "Shifty" Four-base Codons with a Library Approach in Escherichia coli, J. Mol. Biol. 307: 755-769.

[0162] For example, four-base codons have been used to incorporate unnatural amino acids into proteins using in vitro biosynthetic methods. See, e.g., Ma et al., (1993) Biochemistry, 32: 7939; Hohsaka et al. (1999) J. Am. Chem. Soc., 121: 34. CGGG and AGGU were used to simultaneously incorporate 2-naphthylalanine and NBD derivative lysine into streptavidin in vitro with two chemically acylated suppressor tRNAs with a reading frame shift. See, e.g., Hohsaka et al., (1999) J. Am. Chem. Soc., 121: 12194. In an in vivo study, Moore and colleagues investigated the ability of tRNA derivatives^Leu with NCUA anti-codons for suppression of UAGN codons (N can be U, A, G or C), and found that the UAGA quadruplet can be decoded by tRNA^Leu with UCUA anti-codon with efficiency from 13 to 26% with little decoding in frame 0 or -1. See Moore et al., (2000) J. Mol. Biol., 298: 195. In one embodiment, extended codons based on rare codons or nonsense codons can be used in the invention, which can reduce sense-altering recognition of termination signals and frame shift suppression, at other undesirable sites. The four base codons were used as selector codons in various orthogonal systems. See, e.g., WO 2005/019415; WO 2005/007870 and WO 2005/07624. See also Wang and Schultz "Expanding the Genetic Code," Angewandte Chemie Int. Ed., 44 (1): 34-66 (2005). While the following examples use an amber selector codon, four or more base codons can also be used, here by modifying the examples to include four-base O-tRNA and synthetases modified to include mutations similar to those previously described for the various unnatural amino acids DSB.

[0163] For a given system, the selector codon may also include one of the natural three-base codons in which the endogenous system does not (or rarely uses) the natural base codon. For example, this includes a system that is devoid of tRNA that recognizes a natural three-base codon and / or a system in which the three-base codon is a rare codon.

[0164] The selector codons optionally include unnatural base pairs. These unnatural base pairs further extend the existing genetic alphabet. One additional base pair increases the number of triplet codons from 64 to 125. Properties of third base pairs include stable and selective base pairing, efficient enzymatic incorporation into DNA with high accuracy by polymerase, and efficient continuous primer expansion after synthesis of the resulting

- 41 unnatural base pairs. Descriptions of unnatural base pairs that can be adapted to methods and compositions include, e.g., Hirao, et al., (2002) An unnatural base pair for incorporating amino acid analogues into protein, Nature Biotechnology, 20: 177-182.

See also Wu, Y., et al. (2002) J. Am. Chem. Soc. 124: 14626-14630. Other relevant publications are listed below.

[0165] For in vivo use, the unnatural nucleoside is membrane permeable and is phosphorylated to form the corresponding triphosphate. In addition, increased genetic information is persistent and is not destroyed by cellular enzymes. Previous efforts by Benner and others have used the property of hydrogen bonding, which differs from those in canonical Watson-Crick pairs, of which the most notable example is the iso-C: iso-G pair. See, e.g., Switzer et al. (1989) J. Am. Chem. Soc., 111: 8322; and Piccirilli et al. (1990) Nature, 343: 33; Kool, (2000) Curr. Opin. Chem. Biol., 4: 602. These bases generally pair to some extent with natural bases and cannot be enzymatically replicated. Kool and colleagues have shown that hydrophobic packing interactions between bases can replace hydrogen bonding to lead to base pairing. See Kool, (2000) Curr. Opin. Chem. Biol., 4: 602; and Guckian and Kool, (1998) Angew. Chem. Int. Ed. Engl., 36, 2825. In order to develop an unnatural base pair meeting all of the above requirements, Schultz, Romesberg and colleagues systematically synthesized and investigated a number of unnatural hydrophobic bases. The twin pair of PICS: PICS has been found to be more stable than natural base pairs and can be efficiently incorporated into DNA via a Klenow fragment from Escherichia coli DNA polymerase I (KF). See, e.g., McMinn et al., (1999) J. Am. Chem. Soc., 121: 11586; and Ogawa et co-workers, (2000) J. Am. Chem. Soc., 122: 3274. The 3MN: 3MN twin pair can be synthesized by KF with sufficient yield and selectivity for biological function. See, e.g., Ogawa et al., (2000) J. Am. Chem. Soc., 122: 8803. However, both bases act as a chain-terminating agent for further replication. Mutant DNA polymerase has recently been developed that can be used to replicate the PICS twin pair. In addition, you can replicate the twin pair of 7AI. See, e.g., Tae et al., (2001) J. Am. Chem. Soc., 123: 7439. A new metal base pair, Dipic: Py, was also developed that forms a stable pair after Cu (II) binding. See Meggers et al. (2000) J. Am. Chem. Soc., 122: 10714. Because the extended codons and unnatural codons are intrinsically orthogonal to natural codons, the methods of the invention can use this property to generate orthogonal tRNAs for them.

[0166] A translational bypass system can also be used to incorporate an unnatural amino acid into the desired polypeptide. In the translational bypass system, the large sequence is inserted into the gene but is not translated into protein. The sequence contains a structure that serves as a signal to induce the ribosome to skip the sequence and resume downstream translation of the insertion.

Unnatural amino acids

[0167] As used herein, the term unnatural amino acid refers to any amino acid, modified amino acid or amino acid analogue other than selenocysteine ​​and / or pyrolysine and the following twenty genetically encoded alpha amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine , glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine. The general structure of the alpha-amino acid is illustrated by Formula 1:

<img file="PL1991680T3_D0001.tif" />

[0168] An unnatural amino acid is typically any structure of Formula I wherein the R group is any substituent other than that used in the twenty natal amino acids. See, e.g., Biochemistry L. Stryer, 3rd ed. 1988, Freeman and Company, New York, for structures of twenty natural amino acids. It should be noted that the unnatural amino acids of the invention may be naturally occurring compounds other than the twenty alpha-amino acids above.

[0169] Because the unnatural amino acids of the invention are usually different from the natural side chain amino acids, the unnatural amino acids form amide bonds with other amino acids, e.g., natural or unnatural, in the same way as they form in naturally occurring proteins. However, unnatural amino acids have side chain groups that distinguish them from natural amino acids.

[0170] FIG. 1 provides unnatural amino acid structures that are used in embodiments of the invention. These unnatural amino acids can be incorporated into proteins using the appropriate O-RS and O-tRNA pairs. For example, p-benzoyl-L-phenylalanine (Bpa) can be incorporated by means of an orthogonal translation pair containing the O-tRNA of SEQ ID NO: 1 and the related O-RS of SEQ ID NO: 4. para-Acetyl-L-phenylalanine (pAcPhe) can be incorporated by means of an orthogonal translation pair containing O-tRNA from SEQ ID NO: 1 and related O-RS from SEQ ID NO: 6. p-Azido-L-phenylalanine (pAzPhe) can be enabled by means of an orthogonal translation pair containing O-tRNA from SEQ ID NO: 1 and a related O-RS from SEQ ID NO: 8. p-Iodo-L-phenylalanine (pIPhe) can be enabled by an orthogonal translation pair containing O -tRNA with SEQ ID NO: 1 and related O-RS with SEQ ID NO: 10.

[0171] However, the unnatural amino acids used herein only serve to illustrate the broader application of the invention, and the invention is not limited to the use of these amino acids shown in FIG. 1.

[0172] A variety of different unnatural amino acids can be simultaneously incorporated into the polypeptide of interest, e.g., by using the appropriate second O-43 RS / O-tRNA pair in combination with the first orthogonal pair, and where the first and second orthogonal pairs use different selector codons .

[0173] In other unnatural amino acids, for example, R in Formula I optionally contains alkyl-, aryl-, acyl-, hydrazine, cyano, halo-, hydrazide, alkenyl, ether, borate, boronate, phospho, phosphono, phosphine, enone, imine, ester, hydroxylamine, amine, and the like, or any combination thereof. Other unnatural amino acids of interest include, but are not limited to, photoactive cross-linking amino acids, spin-labeled amino acids, fluorescent amino acids, metal binding amino acids, metal containing amino acids, radioactive amino acids, new amino acids, amino acids that covalently or non-covalently interact with other molecules, photoclatted ( photocaged) and / or photoisomerized amino acids, biotin or biotin-containing amino acids, ketone-containing amino acids, glycosylated amino acids, saccharide group attached to the amino acid side chain, amino acids containing polyethylene glycol or polyether, heavy atom substituted amino acids, photochemically cleavable amino acids or chemically cleavable amino acids with an elongated side chain compared to natural amino acids (e.g., long chain polyethers or hydrocarbons, e.g., greater than about 5, greater than about 10 carbons, etc.), amino acids containing carbon-related sugar, amino acids containing amino thio acid and amino acids containing one or more toxic moieties.

[0174] In another aspect, the invention provides unnatural amino acids with the general formula represented by Formula IV below:

<img file="PL1991680T3_D0002.tif" />

[0175] An unnatural amino acid having this structure is typically any structure in which R1 is a substituent used in one of the twenty natural amino acids (e.g., tyrosine or phenylalanine), and R2 is a substituent. Thus, this type of unnatural amino acid can be seen as a derivative of a natural amino acid.

[0176] The unnatural amino acids may also optionally contain modified skeletal structures, e.g., as illustrated in structures of Formula II and III:

<img file="PL1991680T3_D0003.tif" />

- 44 <a name="caption2"></a><a href="http://patentimages.storage.googleapis.com/EP1991680B1/imgb0008.png">III</a>

<img file="PL1991680T3_D0004.tif" />

wherein Z typically includes OH, NH2, SH, NH-R ', or S-R', X and Y, which may be the same or different, typically contain S or O, and R and R ', which are optionally such same or different, they are usually selected from the same list of ingredients for the R group described above for the unnatural amino acids of Formula I as well as hydrogen. For example, the unnatural amino acids of the invention optionally include amino or carboxy substitutions as illustrated by Formulas II and III. Unnatural amino acids of this type include, but are not limited to, α-hydroxy acids, α-thiacids, α-aminothiocarboxylates, e.g., with side chains corresponding to common twenty amino acids or unnatural side chains. In addition, substitutions at α-carbon optionally include L, D or α-α-disubstituted amino acids such as D-glutamate, D-alanine, D-methyl-O-tyrosine, aminobutyric acid, etc. Other structural alternatives include cyclic amino acids such as proline analogs as well as 3, 4, 6, 7, 8 and 9 membered ring proline analogues, β and γ amino acids such as substituted β-alanine and γ-butyric acid.

[0177] In some aspects, the invention uses unnatural amino acids in the L configuration. However, it is not intended that the invention be limited to the use of unnatural amino acids in the L configuration. It is believed that the D-enantiomers of these unnatural amino acids also find use in the invention.

[0178] Tyrosine analogs include para-substituted tyrosines, ortho-substituted tyrosines and meta-substituted tyrosines in which the substituted tyrosine contains an alkynyl group, acetyl group, benzoyl group, amino group, hydrazine, hydroxyamine, thiol group, carboxyl group, isopropyl group, a methyl group, a straight or branched C6-C20 hydrocarbon, a saturated or unsaturated hydrocarbon, an methyl group, a polyether group, a nitro group, or the like. In addition, multi-substituted aryl rings are also contemplated. The glutamine analogs of the invention include, but are not limited to, α-hydroxy derivatives, γ-substituted derivatives, cyclic derivatives, and amido substituted glutamine derivatives. Examples of phenylalanine analogs include, but are not limited to, para-substituted phenylalanines, ortho-substituted phenylalanines and metasubstituted phenylalanines, wherein the substituent includes an alkynyl group, hydroxyl group, methoxy group, methyl group, allyl group, aldehyde group, nitro group, thiol group or ketone group , or similar. Specific examples of unnatural amino acids include, but are not limited to, p-ethylthiocarbonyl-L-phenylalanine, p- (3-oxobutanoyl) -L-phenylalanine, 1,5-dansyl-alanine, amino acid 7-amino coumarin, amino acid 7-hydroxy coumarin, nitrobenzyl serine, O- (2-nitrobenzyl) -L-tyrosine; p-carboxymethyl-L-phenylalanine, p-cyano-L-phenylalanine, m-cyano-L-phenylalanine, biphenylalanine, 3-amino-L-tyrosine, bipyridylalanine, p- (2-amino-1-hydroxyethyl) -L-phenylalanine , p-isopropylthiocarbonyl-L-phenylalanine, 3-nitro-L-tyrosine and p-nitro-L-phenylalanine. Also, p-propargyloxyphenylalanine, 3,4-dihydroxy-L-phenylalanine (DHP), 3,4,6-trihydroxy-L-phenylalanine, 3,4,5-trihydroxy-L-phenylalanine, 4-nitrophenylalanine, p-acetyl -L-phenylalanine, O-methyl-L-tyrosine, L-3- (2-naphthyl) alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, 3-nitrosine tyrosine, 3-thiolothyrosine, tri-O-acetyl-GlcNAceserine, L-Dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphotyrosine, p-iodophenylalanine, pbromophenylalanine, p-amino-L-phenylalanine, isopropyl L-phenylalanine, and the like. Structures of various unnatural amino acids that can be incorporated by means of orthogonal translation systems are known. See references cited here.

Chemical Synthesis of Unnatural Amino Acids [0179] Many of these unnatural amino acids provided above are commercially available, e.g., from Sigma (USA) or Aldrich (Milwaukee, WI, USA). Those that are not commercially available are optionally synthesized as shown in various publications or using standard methods known to those of skill in the art. For information on organic synthesis methods, see, e.g., Organic Chemistry Fessendon and Fessendon, (1982, Second Edition, Willard Grant Press, Boston Mass.); Advanced Organic Chemistry March (Third Edition, 1985, Wiley and Sons, New York); and Advanced Organic Chemistry, Carey and Sundberg (Third Edition, Parts A and B, 1990, Plenum Press, New York). Additional publications describing the synthesis of unnatural amino acids include, e.g., WO 2002/085923 entitled "In vivo incorporation of Unnatural Amino Acids;" Matsoukas and colleagues, (1995) J. Med. Chem., 38, 4660-4669; King and Kidd (1949) A New Synthesis of Glutamine and of γ-Dipeptides of Glutamic Acid from Phthylated Intermediates. J. Chem. Soc., 3315-3319; Friedman and Chatterrji (1959) Synthesis of Derivatives of Glutamine as Model Substrates for Anti-Tumor Agents. J. Am. Chem. Soc. 81, 3750-3752, Craig et al. (1988) Absolute Configuration of the Enantiomers of 7-Chloro4 [[4- (diethylamino) -1-methylbutyl] amino] quinoline (Chloroquine). J. Org. Chem. 53, 11671170; Azoulay et al. (1991) Glutamine analogues as Potential Antimalarials ,. Eur. J. Med. Chem. 26, 201-5; Koskinen and Rapoport (1989) Synthesis of 4-Substituted Prolines as Conformationally Constrained Amino Acid Analogues. J. Org. Chem. 54, 18591866; Christie and Rapoport (1985) Synthesis of Optically Pure Pipecolates from L-Asparagine. Application to the Total Syntheses of (+) - Apovincamine through Amino Acid Decarbonylation and Iminium Ion Cyclization. J. Org. Chem. 1989: 1859-1866; Barton et al. (1987) Synthesis of Novel a-Amino-Acids and Derivatives Using Radical Chemistry: Synthesis of L- and Da-Amino-Adipic Acids, La-aminopimelic Acid and Appropriate Unsaturated Derivatives. Tetrahedron Lett. 43: 4297-4308; i, Subasinghe i collaborators, (1992) Quisqualic acid analogues: synthesis, of betaheterocyclic 2aminopropanoic acid derivatives and their activity at a novel quisqualate-sensitized site. J. Med. Chem. 35: 4602-7. See also, International Patent Specification WO 2004/058946, entitled "PROTEIN ARRAYS," filed December 22, 2003.

Cellular uptake of unnatural amino acids [0180] Uptake of unnatural amino acid by a cell is an issue that is typically considered when designing and selecting unnatural amino acids, e.g., for incorporation into protein. For example, the high charge density of α-amino acids suggest that these compounds are unlikely to be cell-permeable. Natural amino acids are taken into the cell through a set of protein-based transport systems, often showing varying degrees of amino acid specificity. A quick search can be performed that assesses which unnatural amino acids, if any, are taken up by the cell. See, e.g., toxicity tests in, e.g., International Patent Specification, WO 2004/058946, entitled "PROTEIN ARRAYS," filed December 22, 2003; and Liu and Schultz (1999) Progress toward the evolution of an organism with an expanded genetic code. PNAS 96: 4780-4785. Although uptake can easily be analyzed by various assays, an alternative to the design of unnatural amino acids that are susceptible to cellular uptake pathways is to provide biosynthetic pathways to create amino acids in vivo.

Biosynthesis of Unnatural Amino Acids [0181] Many biosynthetic pathways already exist in cells for the production of amino acids and other compounds. While the biosynthetic method of a particular unnatural amino acid may not exist in nature, e.g., in a cell, the invention provides such methods. For example, biosynthetic pathways for unnatural amino acids are optionally generated in the host cell by adding new enzymes or modifying existing host cell pathways. Additional new enzymes are optionally naturally occurring or artificially developed enzymes. For example, the biosynthesis of p-aminophenylalanine (as shown in the example in WO 2002/085923, supra) involves the addition of a combination of known enzymes from other organisms. Genes for these enzymes can be introduced into a cell by transforming the cell with a plasmid containing the genes. Genes, when expressed in a cell, provide an enzyme pathway to synthesize the desired compound. Examples of the types of enzymes that are optionally added are provided in the examples below. Additional enzyme sequences are found, e.g., in GenBank. Artificially developed enzymes are also optionally added to the cell in the same way. In this way, the cellular mechanism and cell resources are manipulated to produce unnatural amino acids.

[0182] Indeed, any of a variety of methods can be used to produce new enzymes for use in biosynthetic pathways, or to develop existing routes, to produce unnatural amino acids, in vitro or in vivo. Many of the available methods for developing enzymes and other components of the biosynthetic pathway can be used in the invention to create unnatural amino acids (or, indeed, to develop synthetases for new substrate specificities or other activities of interest). For example, DNA shuffling is optionally used to develop new enzymes and / or pathways of such enzymes for the production of unnatural amino acids (or the production of new synthetases), in vitro or in vivo. See, e.g., Stemmer

- 47 (1994), Rapid evolution of a protein in vitro by DNA shuffling, Nature 370 (4): 389-391; i, Stemmer, (1994), DNA shuffling by random fragmentation and reassembly: In vitro recombination for molecular evolution, Proc. Natl. Acad. Sci. USA., 91: 10747-10751. A similar approach shuffles families of related (e.g., homologous) genes to quickly develop enzymes with desired properties. An example of such methods of "gene shuffling" is found in Crameri et al. (1998) "DNA shuffling of a family of genes from diverse species accelerates directed evolution" Nature, 391 (6664): 288291. New enzymes (whether they are components of the biosynthetic pathway or synthetases) can also be generated using a recombinant DNA procedure known as "incremental truncation for the formation of hybrid enzymes ( "incremental truncation for the creation of hybrid enzymes") ("ITCHY"), e.g., as described in Ostermeier et al. (1999) "A combinatorial approach to hybrid enzymes independent of DNA homology" Nature Biotech 17: 1205. This approach can also be used to create enzyme libraries or other pathway variants that can serve as substrates for one or more recombination methods in vitro or in vivo. See also Ostermeier et al., (1999) "Combinatorial Protein Engineering by Incremental Truncation," Proc. Natl. Acad. Sci. USA, 96: 3562-67, and Ostermeier et al. (1999), "Incremental Truncation as a Strategy in the Engineering of Novel Biocatalysts," Biological and Medicinal Chemistry, 7: 2139-44. Another approach uses exponential syndrome mutagenesis to create enzyme libraries or other path variants that are, e.g., selected for their ability to catalyze a biosynthetic reaction suitable to produce an unnatural amino acid (or a new synthetase). In this approach, small groups of residues in the sequence of interest are in parallel randomized to identify, at each changed position, the amino acids that lead to functional proteins. Examples of such procedures that can be adapted to the invention to create new enzymes to produce unnatural amino acids (or new synthetases) are found in Delegrave and Youvan (1993) Biotechnology Research 11: 1548-1552. In yet another approach, random or semi-random mutagenesis using doped or degenerate oligonucleotides can be used to design enzymatic and / or pathway components, e.g., by using general mutagenesis methods, e.g., from Arkin and Youvan (1992) "Optimizing nucleotide mixtures to encode specific subsets of amino acids for semirandom mutagenesis "Biotechnology 10: 297-300; or Reidhaar-Olson et al., (1991) "Random mutagenesis of protein sequences using oligonucleotide cassettes" Methods Enzymol. 208: 564-86. Yet another approach, often referred to as "non-stochastic" mutagenesis, which utilizes polynucleotide reassembly and local saturation mutagenesis, can be used to produce enzymes and / or pathway components that can then be screened for the ability to perform one or more synthetase functions or biosynthetic pathway (e.g., for the production of unnatural amino acids in vivo). See, e.g., Short in WO 2000/046344, entitled "NON-STOCHASTIC GENERATION OF GENETIC VACCINES AND ENZYMES".

[0183] An alternative to such mutation methods involves recombination of whole genomes of organisms and selection of offspring due to specific pathway functions (often referred to as "whole genomic shuffling"). This approach can be used in the invention, e.g., by genomic recombination and selection of the organism (e.g., E. coli or other cell) due to the ability to form an unnatural amino acid (or its intermediate). For example, the methods recommended in the following publications can be used in pathway design to develop existing and / or new pathways in cells to create unnatural amino acids in vivo. Patnaik et al. (2002) "Genome shuffling of lactobacillus for improved acid tolerance" Nature Biotechnology, 20 (7): 707-712; and Zhang et al. (2002) "Genome shuffling leads to rapid phenotypic improvement in bacteria" Nature, February 7, 415 (6872): 644-646.

[0184] Other techniques for organism and metabolic pathway design, for example, for the production of desired compounds are also available and can be used to produce unnatural amino acids. Examples of publications recommending useful approaches to pathway design include: Nakamura and White (2003) "Metabolic engineering for the microbial production of 1,3 propanediol" Curr. Opin. Biotechnol. 14 (5): 454-9; Berry i collaborators, (2002) "Application of Metabolic Engineering to improve both the production and use of Biotech Indigo" J. Industrial Microbiology and Biotechnology 28: 127-133; Banta et al. (2002) "Optimizing an artificial metabolic pathway: Engineering the cofactor specificity of Corynebacterium 2,5-diketo-Dgluconic acid reductase for use in vitamin C biosynthesis" Biochemistry, 41 (20), 6226-36; Selivonova et al. (2001) "Rapid Evolution of Novel Traits in Microorganisms" Applied and Environmental Microbiology, 67: 3645, and many others.

[0185] Regardless of the method used, typically, the unnatural amino acid produced by the designed biosynthetic pathway of the invention is produced at a concentration sufficient for efficient protein biosynthesis, e.g., a natural cell quantity, but not to such a degree that significantly affects the concentration of other cellular amino acids or depleted cellular resources. Typical concentrations generated in vivo in this way are from about 10 mM to about 0.05 mM. After designing the cell to produce the enzymes desired for a particular pathway, an unnatural amino acid is generated, optionally in vivo selections are used to further optimize the production of unnatural amino acid for both ribosomal protein synthesis and cell growth.

Orthogonal Components Used in the Invention [0186] Incorporation of an unnatural amino acid into a protein is accomplished by orthogonal pairs that incorporate an unnatural amino acid in response to the genetic signal of a selector codon in E. coli, where the orthogonal components do not cross-react with endogenous E components. coli host cell translational apparatus, but recognize the desired unnatural amino acid and incorporate it into proteins in response to a selector codon (e.g., amber nonsense codon, TAG). Orthogonal components useful in the invention include orthogonal aminoacyl-tRNA synthetases derived from

- 49 Methanococcus jannaschii tyrosyl tRNA-synthetases and the mutated amber tyrosyl tRNACUA suppressor that function as an orthogonal pair in an eubacterial host cell such as E. coli. In this system, mutated aminoacyl-tRNA synthetases aminoacylate the tRNA suppressor with its corresponding unnatural amino acid, rather than any of the twenty typical amino acids.

[0187] Methods for producing orthogonal components find use in the invention, wherein these methods lead to the incorporation of unnatural amino acids, for example, but not limited to, the unnatural amino acids shown in FIG. 1 to a growing polypeptide chain in response to a selector codon, e.g., an amber stop codon, a nonsense codon, a four or more base codon, etc., e.g., in vivo. For example, orthogonal-tRNA (O-tRNA), orthogonal aminoacyl-tRNA synthetase (O-RS) and pairs thereof find use in the invention.

[0188] In some embodiments, these pairs can be used to incorporate an unnatural amino acid into growing polypeptide chains, and then the polypeptide is translational modified. For further information on unnatural amino acids that can be post-translational modified, see, for example, the orthogonal systems of unnatural amino acids described in China et al., Science (2003) 301: 964-967; Zhang et al., Proc. Natl. Acad. Sci. USA 2004, 101: 8882-8887; Anderson et al., Proc. Natl. Acad. Sci. USA 2004, 101: 7566-7571; Wang et al. (2001) Science 292: 498-500; Chin et al. (2002) Journal of the American Chemical Society 124: 9026-9027; Chin and Schultz, (2002) ChemBioChem 11: 1135-1137; Chin, et al., (2002) PNAS USA 99: 11020-11024; Wang and Schultz, (2002) Chem. Comm, 1-10; Wang and Schultz "Expanding the Genetic Code," Angewandte Chemie Int. Ed., 44 (1): 34-66 (2005); Xie and Schultz, "An Expanding Genetic Code," Methods 36: 227-238 (2005); and Deiters et al., Bioorganic &amp; Medicinal Chemistry Letters 15: 1521-1524 (2005).

[0189] See also orthogonal systems of unnatural amino acids described in International Publications WO 2002/086075, entitled "METHODS AND COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA AMINOACYLtRNA SYNTHETASE PAIRS;" WO 2002/085923, entitled "IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS;" WO 2004/094593, entitled "" EXPANDING THE EUKARYOTIC GENETIC CODE; "WO 2005/019415, filed July 7, 2004; WO2005 / 007870, filed July 7, 2004; WO 2005/007624, filed July 7, 2004; WO 2006/034332, filed September 20, 2005; and Schultz et al., WO 2006/110182 entitled "ORTHOGONAL TRANSLATION COMPONENTS FOR THE IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS" filed October 27, 2005.

[0190] In some embodiments, O-RS finds use in the invention preferably by aminoacylating O-tRNA on each endogenous tRNA with a specific unnatural amino acid in which O-RS has an O-tRNA direction and in which ratio

O-tRNA charged with an unnatural amino acid to endogenous charged tRNA

With the same unnatural amino acid is greater than 1: 1, and more preferably wherein the O-RS charges the O-tRNA exclusively or almost exclusively.

[0191] The invention also uses orthogonal tRNA (O-tRNA) in which the O-tRNA recognizes a selector codon. Typically, the O-tRNA includes at least about, e.g., 45%, 50%, 60%, 75%, 80% or 90% or greater suppressive efficiency in the presence of a related synthetase in response to a selector codon compared to an OtRNA suppressive efficiency including or encoded by a polynucleotide sequence as set forth in the sequence lists (e.g., SEQ ID NO: In one embodiment, the suppressive efficiency of O-RS and O-tRNA together, e.g., is 5 times, 10 times, 15 times, 20 times, 25 times or more than the suppressive efficiency of O-tRNA lacking DSB. In some aspects, the suppressive efficiency of OR and O-tRNA together is at least 45% of the suppressive efficiency of an orthogonal tyrosyl-tRNA synthetase pair derived from Methanococcus jannaschii.

[0192] The invention uses cells (e.g., E. coli) containing a translation system and nucleotide sequences that program the production of a protein in which the translation system includes orthogonal-tRNA (O-tRNA), orthogonal aminoacyl-tRNA synthetase (O-RS ), and an unnatural amino acid. Typically, O-RS preferably aminoacylates O-tRNA on any endogenous tRNA with an unnatural amino acid in which O-RS has an OtRNA direction, and in which the ratio of O-tRNA charged with an unnatural amino acid to an endogenous tRNA charged with the same unnatural amino acid is greater than 1: 1, and more preferably wherein O-RS charges the O-tRNA exclusively or almost exclusively. The O-tRNA recognizes the first selector codon, and O-RS preferably aminoacylates the O-tRNA with an unnatural amino acid.

[0193] Various polynucleotides also find use in the invention. These polynucleotides include an unnatural (e.g., human-made, and non-naturally occurring, e.g., recombinant) polynucleotide comprising the O-Rs-encoding nucleotide sequence. The polynucleotide of use in the invention may also include a nucleic acid that hybridizes to the polynucleotide described above, under very stringent conditions, over substantially the entire length of the nucleic acid. Vectors containing polynucleotides also find use in the invention. For example, the vector may contain a plasmid, cosmid, phage, virus, expression vector and / or the like. Methods for making the O-tRNA / O-RS pair components are known and find use in the present invention. See this disclosure and references cited herein.

NUCLEIC ACID AND POLYPEPTIDE SEQUENCE, AND OPTIONS [0194] As described herein, a polynucleotide encoding sequences, e.g., O-tRNA and O-RS, find use in the invention as well as the corresponding amino acid sequences encoded by polynucleotides. The disclosure provides and references examples of polynucleotide and polypeptide sequences that find use in the invention. However, it should be noted that the use of the invention is not limited to these sequences here

- 51 disclosed. One of skill in the art will appreciate that the invention also provides many related sequences with the functions described herein, e.g., polynucleotides and polypeptides encoding conserved O-RS variants disclosed herein.

[0195] A polynucleotide useful in the invention also includes an unnatural polynucleotide that is, e.g., at least 75%, at least 80%, at least 90%, at least 95%, at least 98% or more identical to naturally occurring tRNA (but other than naturally occurring tRNA). A polynucleotide useful in the invention also includes an unnatural polynucleotide that is, e.g., at least 75%, at least 80%, at least 90%, at least 95%, at least 98% or more identical (but not 100% identical ) with naturally occurring tRNA.

[0196] In some embodiments, the vector finding use in the invention (e.g., plasmid, cosmid, phage, virus, etc.) includes a polynucleotide that finds use in the invention. In some embodiments, the vector is an expression vector. In other embodiments, the expression vector comprises a promoter operably linked to one or more polynucleotides of the invention. In other embodiments, the cell comprises a vector that includes a polynucleotide useful in the invention.

[0197] One skilled in the art will recognize that many variants of the disclosed sequences also find use with the invention. For example, conservative variants of the disclosed sequences that provide functionally identical sequences find use in the invention. Variant polynucleotide nucleic acid sequences in which the variants hybridize to at least one disclosed sequence find use in the present invention.

Conservative changes [0198] Due to the degeneracy of the genetic code, "silent substitutions" (ie, substitutions in a nucleic acid sequence that do not lead to a change in the encoded polypeptide) are an implied feature of any nucleic acid sequence that encodes the amino acid sequence. Similarly, "conservative amino acid substitutions" in which one or a limited number of amino acids in an amino acid sequence are substituted by different amino acids with very similar properties are also easily identified as being very similar to the disclosed construct. Such conservative variants of each disclosed sequence are a feature of the invention.

[0199] "Conservative changes" of a particular nucleic acid sequence refer to those nucleic acids that encode identical or substantially identical amino acid sequences, or in which the nucleic acid does not encode the amino acid sequence, to a substantially identical sequence. The skilled person will recognize that single substitutions, deletions or additions that change, add or remove a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 4%, 2% or 1%) in the coded sequence are "conservatively modified changes ", in which the changes lead to amino acid deletion, amino acid addition or amino acid substitution with

- 52 chemically similar amino acid. Thus, "conservative changes" of said polypeptide sequence of the invention include substitutions of a small percentage, typically less than 5%, more typically less than 2% or 1%, of amino acids from the polypeptide sequence, with an amino acid from the same conservative substitution group. Finally, sequence additions that do not change the encoded activity of the nucleic acid molecule, such as the addition of a non-functional sequence, are conservative changes in the basic nucleic acid.

[0200] Conservative substitution tables showing functionally similar amino acids are well known in the art in which one amino acid residue is substituted by another amino acid residue with similar chemical properties (e.g., aromatic side chains or positively charged side chains), and therefore does not change substantially functional properties of the polypeptide molecule. The following are examples of groups that contain natural amino acids with similar chemical properties in which substitutions within the group are "conservative substitutions."

TABLE 1

Conservative Amino Acid Substitutions

<td>nonpolar and / or aliphatic chains side glycine</td><td>polar chains side deprived cargo serine</td><td>aromatic chains side</td><td>Positively charged chains side</td><td>Negatively charged chains side</td>

<td>alanine</td><td>threonine</td><td>phenylalanine</td><td>lysine</td><td></td>

<td>valine</td><td>Cysteine</td><td>tyrosine</td><td>arginine</td><td>aspartate</td>

<td>leucine</td><td>methionine</td><td>tryptophan</td><td>histidine</td><td>glutamate</td>

<td>isoleucine</td><td>asparagine</td><td></td><td></td><td></td>

<td>proline</td><td>glutamine</td><td></td><td></td><td></td>

Nucleic Acid Hybridization [0201] Comparative hybridization can be used to identify nucleic acids that find use in the invention, including conservative nucleic acid variants provided herein, and this method of comparative hybridization is

By the preferred method of distinguishing between nucleic acids which find use in the invention. Target nucleic acids that hybridize to the nucleic acids provided herein or listed here under high, ultra-high and ultra-ultra high stringency conditions are also applicable in the invention. Examples of such nucleic acids include those with one or more silent or conservative nucleic acid substitutions compared to the given nucleic acid sequence.

[0202] Test nucleic acid is considered to specifically hybridize to probe nucleic acid if it hybridizes at least 50% to both the probe and the perfectly matched complementary target, i.e., with a signal to noise ratio at least half as high as hybridization probe to target in conditions where a perfectly matched probe is associated with a perfectly matched complementary target with a signal-to-noise ratio, which is at least about 5x-10x higher than observed for hybridization to any of the unmatched target nucleic acids.

[0203] Nucleic acids "hybridize" when they bind, typically in solution. Nucleic acids hybridize due to a variety of well-characterized physicochemical forces such as hydrogen bonding, solvent exclusion, base stacking and the like. A comprehensive guide to nucleic acid hybridization is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes Part I Chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," (Elsevier , New York), as well as in Current Protocols in Molecular Biology, Ausubel et al., Ed., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley &amp; Sons, Inc., (supplemented to 2004) ("Ausubel"); Hames and Higgins (1995) Gene Probes 1 IRL Press at Oxford University Press, Oxford, England, (Hames and Higgins 1) and Hames and Higgins (1995) Gene Probes 2 IRL Press at Oxford University Press, Oxford, England (Hames and Higgins 2) provide details on the synthesis, labeling, detection and quantification of DNA and RNA, including oligonucleotides.

[0204] An example of stringent hybridization conditions for hybridization of complementary nucleic acids that have more than 100 complementary residues on a filter in a Southern blot or northern blot is 50% formalin with 1 mg heparin at 42 ° C, with overnight hybridization. An example of stringent wash conditions is 0.2x SSC wash at 65 ° C for 15 minutes (see Sambrook, supra, for SSC buffer description). Often, high stringency flushing is preceded by low stringency flushing to remove background probe signal. An example of low stringent rinsing is 2x SSC at 40 ° C for 15 minutes. Generally, a signal to noise ratio of 5x (or higher) than that observed for an unrelated probe in a particular hybridization assay indicates the detection of specific hybridization.

[0205] "Rigorous hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and nothern hybridizations are sequence dependent and are different for different environmental parameters. Comprehensive guide to

54 nucleic acid hybridizations are found in Tijssen (1993), supra, and in Hames and Higgins, 1 and 2. Stringent hybridization and washing conditions can easily be determined empirically for each test nucleic acid. For example, when determining stringent hybridization and rinsing conditions, hybridization and rinsing conditions are gradually increased (e.g., by raising temperature, decreasing salt concentration, increasing detergent concentration and / or increasing the concentration of organic solvents such as formalin, in hybridization or rinsing), until the selected set of criteria is met. For example, under highly stringent hybridization and washing conditions, hybridization and washing conditions are gradually increased until the probe binds to a perfectly matched complementary target with a signal to noise ratio that is at least 5x higher than observed for probe hybridization to mismatched target.

[0206] "Very stringent" conditions are selected to be equal to the melting point (Tm) for a specific probe. Tm is the temperature (at a certain ionic strength and pH) at which 50% of the test sequences hybridize to a perfectly matched probe. For the purposes of the invention, generally, "highly stringent" hybridization and washing conditions are selected to be about 5 ° C below Tm for a specific sequence at a specified ionic strength and pH.

[0207] "Ultra-high stringency" hybridization and wash conditions are those in which stringency of hybridization and wash conditions are increased until the signal-to-noise ratio for probe binding to a perfectly matched target nucleic acid is at least 10x higher than observed for hybridization to any among unmatched target nucleic acids. It is believed that the target nucleic acid that hybridizes to the probe under such conditions, with a signal to noise ratio of at least ½ of that for a perfectly matched complementary target nucleic acid, binds to the probe under ultra high stringency conditions.

[0208] Similarly, even higher levels of stringency can be determined by gradually increasing the hybridization and / or washing conditions of the respective hybridization assay. For example, those in which the stringency of hybridization and washing conditions increases until the signal-to-noise ratio for probe binding to a perfectly matched target nucleic acid is at least 10x, 20X, 50X, 100X or 500X higher than that observed for hybridization to any of the unmatched target nucleic acids. It is believed that the target nucleic acid that hybridizes to the probe under such conditions, with a signal to noise ratio of at least ½ of that for a perfectly matched complementary target nucleic acid, binds to the probe under ultra high stringency conditions.

[0209] Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they encode are substantially identical. This happens, for example, if a copy of the nucleic acid is created using the maximum codon degeneracy allowed by the genetic code.

Unique Subsequences [0210] In some aspects, the invention uses a nucleic acid that contains a unique nucleic acid subsection selected from the O-tRNA and O-RSS sequences disclosed or listed herein. The unique sub-sequence is unique compared to the nucleic acid corresponding to any known OtRNA or O-RS nucleic acid sequence. Alignment can be performed using, e.g., a BLAST set to default parameters. Any arbitrary sub-sequence is useful, e.g., as a probe to identify nucleic acids of the invention.

[0211] Similarly, the invention uses a polypeptide that contains a unique sub-sequence in a polypeptide selected from the O-RS sequences disclosed or mentioned herein. Here, the unique sub-sequence is unique compared to a polypeptide corresponding to any of the known polypeptide sequences.

[0212] The invention also provides target nucleic acids that hybridize under stringent conditions to a unique coding oligonucleotide that encodes a unique sub-sequence in a polypeptide selected from the O-RS sequence in which the unique sub-sequence is unique compared to a polypeptide corresponding to any of the control polypeptides ( e.g., parent sequences from which the synthetases of the invention have been obtained, e.g., by mutation). Unique sequences are determined as indicated above. Comparison, identity and sequence homology, [0213] The terms "identical" or "percent identity" in the context of two or more nucleic or polypeptide acid sequences refer to two or more sequences or sub-sequences that are the same or have a specific percentage of amino acid residues or nucleotides that are the same if compared and aligned for maximum compatibility, as measured using one of the sequence comparison algorithms described below (or other algorithms available to those skilled in the art) or by visual inspection.

[0214] The phrase "substantially identical" in the context of two nucleic acids or polypeptides (e.g., DNA encoding O-tRNA or O-RS, or an amino acid sequence from ORS) refers to two or more sequences or sequences that have at least about 60 %, about 80%, about 90-95%, about 98%, about 99% or more nucleotide or amino acid residue identity, if compared and aligned for maximum compatibility, as measured using a sequence comparison algorithm or by visual inspection. Such "substantially identical" sequences are typically considered "homologous" without reference to actual origin. Preferably, "substantial identity" exists within a sequence region that is at least 50 residues in length, more preferably within a region of at least about 100 residues, and most preferably the sequences are substantially identical within at least 150 residues, or within full length two sequences to compare.

[0215] Proteins and / or protein sequences are "homologous" if they are derived, naturally or artificially, from a common ancestral protein or protein sequence. Similarly, nucleic acids

56 and / or nucleic acid sequences are homologous when derived, naturally or artificially, from a common rhodium nucleic acid or nucleic acid sequence. For example, any naturally occurring nucleic acid may be modified in any available mutagenesis manner to include one or more selector codon. As a result of expression, this mutated nucleic acid encodes a polypeptide containing one or more unnatural amino acids. The mutation process can, of course, additionally change one or more standard codons, thus also changing one or more standard amino acids in the resulting mutational protein. Homology is generally inferred from sequence similarity between two or more nucleic acids or proteins (or their sequences). The exact percentage of sequence similarity that is useful in determining homology varies depending on the particular nucleic acid and protein, but only 25% sequence similarity is routinely used to determine homology. Higher levels of sequence similarity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more can also be used to establish homology. Methods for determining the percentage of sequence similarity (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available.

[0216] For sequence comparison and homology determination, typically one sequence is the reference sequence with which the test sequences are compared. If a sequence comparison algorithm is used, test and reference sequences are entered into the computer, the sub-sequence coordinates are marked if necessary, and the sequence algorithm program parameters are determined. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence (s) relative to the reference sequence based on the determined program parameters.

[0217] Optimal sequence alignment for comparison can be performed, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981), according to the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), using the similarity search method according to Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85: 2444 (1988), by computer implementation of these algorithms (GAP, BESTFTT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual examination (see General Current Protocols in general) in Molecular Biology, Ausubel et al., ed., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley &amp; Sons, Inc., supplemented until 2004).

[0218] One example of an algorithm that is suitable for determining the percentage sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215: 403-410 (1990). BLAST analysis software is publicly available on the National Center for Biotechnology Information website. This algorithm first involves identifying a pair of high index sequences ( HSP) by identifying short words of length W in the search sequence that match the indicator or meet a certain indicator

- 57 threshold T with a positive value after matching with a word of the same length in the sequence from the database. T is defined as the threshold value of the neighbor word (Altschul et al., Supra). These initial results (hits) for the neighbor word are embryos for initiating searches to find HSPs containing them. Word results (hits) are then expanded in both directions along each sequence as far as the cumulative match score can increase. Cumulative results are calculated using the parameters M for nucleotide sequences (reward score for a pair of matching residues; always&gt; 0) and N (penalty score for unmatched residues; always &lt;0). For amino acid sequences, the resulting matrix is ​​used to calculate the cumulative result. The extension of the results (hits) of words in each direction stops when: the cumulative match result drops by the value of X compared to its maximum value obtained; the cumulative result tends to zero or a lower value due to the accumulation of one or more negative residue alignments; or if the end of one of the sequences is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of matching. The BLASTN program (for the nucleotide sequence) uses as defaults a word length (W) of 11, an expectation (E) of 10, a cut-off of 100, M = 5, N = -4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses the default word length (W) 3, expectation (E) 10, and the resulting matrix BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).

[0219] In addition to calculating percent sequence identity, the BLAST algorithm also performs statistical analysis of similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which indicates with what probability a match between two nucleotides or amino acid sequences will occur by chance. For example, a nucleic acid sequence is considered similar to another sequence if the probability of the smallest sum in comparison of test nucleic acid to reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001 .

Mutagenesis and Other Molecular Biology Techniques [0220] The polynucleotide and polypeptides of the invention and used in the invention can be manipulated using molecular biology techniques. General texts that describe molecular biology techniques include Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, CA (Berger); Sambrook et al., Molecular Cloning - A Laboratory Manual (Ed. 3cie), Volume 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2001 ("Sambrook") and Current Protocols in Molecular Biology, FM Ausubel et al., Ed., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley &amp; Sons, Inc., (supplemented to 2004) ("Ausubel"). These texts describe mutagenesis, the use of vectors, promoters and many other important issues related to, e.g.,

Producing genes that include selector codons for producing proteins that include unnatural amino acids, orthogonal tRNAs, orthogonal synthetases, and pairs thereof.

[0221] Various types of mutagenesis can be used in conjunction with the invention, for example, to mutate tRNA molecules, to produce tRNA libraries, to produce synthetase libraries, to introduce selector codons that encode unnatural amino acids in a protein or polypeptide of interest. These include, but are not limited to, site-directed random point mutagenesis, homologous recombination, DNA shuffling or other recursive mutagenesis methods, chimeric construction, mutagenesis using uracil-containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified mutagenesis DNA double-sided DNA with breaks or the like, or any combination thereof. Additional suitable methods include repairing spot mismatch, repair defective strand mutagenesis, restriction-selection and restriction-purification, deletion mutagenesis, complete gene synthesis mutagenesis, repair of both strand damage, and the like. Mutaganesis, e.g., including chimeric constructs, is also included in the invention. In one embodiment, mutagenesis may be performed using known information from a naturally occurring molecule or a changed or mutated naturally occurring molecule, e.g., sequence, sequence comparison, physical properties, crystal structure or the like.

[0222] Host cells are genetically modified (e.g., transformed, transduced or transfected) with polynucleotides of the invention or constructs that include the polynucleotide, e.g., a vector, which may be, for example, a cloning vector or expression vector. For example, the coding areas for orthogonal tRNA, orthogonal tRNA synthetase, and derivatization proteins are operably linked to gene expression control components that are functional in the desired host cell. Typical vectors contain transcription and translation terminators, transcription and translation initiation sequences, and promoters useful for regulating the expression of a particular target nucleic acid. The vectors optionally contain genetic expression cassettes containing at least one independent terminator sequence, sequences enabling cassettes to replicate in eukaryotes or prokaryotes or both (e.g., shuttle vectors) and selection markers for both prokaryotic and eukaryotic systems. The vectors are suitable for replication and / or integration in prokaryotes, eukaryotes or preferably both. See Giliman and Smith, Gene 8:81 (1979); Roberts et al., Nature, 328: 731 (1987); Schneider B., et al., Protein Expr. Purif. 6435: 10 (1995); Ausubel, Sambrook, Berger (all supra / all supra). The vector may be, for example, in the form of a plasmid, bacterium, virus, naked polynucleotide or conjugated polynucleotide. Vectors are introduced into cells and / or microorganisms by standard methods, including electroporation (From et al., Proc. Natl. Acad. Sci. USA 82, 5824 (1985), infection by viral vectors, high velocity ballistic penetration with small particles with nucleic acid within the matrix of small

- 59 pearls or particles, or on the surface (Klein et al., Nature 327, 70-73 (1987)), and / or the like.

[0223] A highly efficient and universal single plasmid system was developed for site-specific incorporation of unnatural amino acids into proteins in response to the amber stop codon (UAG) in E. coli. In the new system, the M. jannaschii tRNAtyr suppressor (CUA) and tyrosyl-tRNA synthetase pair is encoded in one plasmid that is compatible with most E. coli expression vectors. The monocistronic tRNA operon under the control of the proK promoter and terminator was constructed for optimal secondary structure and tRNA processing. The introduction of the mutated form of the glnS promoter for synthetase resulted in a significant increase in both the efficiency and accuracy of suppression. Increased suppression efficiency was also obtained by multiple copies of the tRNA gene as well as by a specific mutation (D286R) on synthetase (Kobayashi et al., "Structural basis for orthogonal tRNA specificities of tyrosyltRNA synthetases for genetic code expansion," Nat. Struct. Biol. (6): 425-432 [2003]). The generality of the optimized system has also been demonstrated by the highly efficient and accurate incorporation of several different unnatural amino acids whose unique use in the study of protein function and structure has been previously proven.

[0224] A catalog of Bacteria and Bacteriophages useful for cloning is provided, e.g., by ATCC, e.g., The ATCC Catalog of Bacteria and Bacteriophage (1996) Ghema et al. (Ed.) Published by ATCC. Additional basic procedures for sequencing, cloning and other aspects of molecular biology and related theoretical considerations are also found in Sambrook (supra), Ausubel (supra), and in Watson et al. (1992) Recombinant DNA Second Edition Scientific American Books, NY. In addition, essentially any nucleic acid (and virtually any labeled nucleic acid, standard or non-standard) can be ordered freely or as standard from any of a variety of commercial sources, such as the Midland Certified Reagent Company (Midland, TX), The Great American Gene Company (Ramona, CA), ExpressGen Inc. (Chicago, IL), Operon Technologies Inc. (Alameda, CA) and many others.

[0225] The designed host cells can be cultured in conventional media appropriately modified for such activities as, for example, screening steps, activating promoters or selecting transformants. Alternatively, these cells can be cultured in transgenic organisms. Other useful references, e.g., for cell culture or isolation (e.g., for subsequent nucleic acid isolation) include Freshney (1994) Culture of Animal Cells, and Manual of Basic Technique, Third Edition, Wiley-Liss, New York and cited therein links; Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley &amp; Sons, Inc. New York, NY; Gamborg and Phillips (ed.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Atlas i Parks (ed.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, FL. Proteins and polypeptides of interest

[0226] Methods for producing a protein having an unnatural amino acid at a particular position is also a feature of the invention. For example, the method may comprise culturing the cell in appropriate medium (for example, in E cell. coli), wherein the cell comprises a nucleic acid that contains at least one selector codon and encodes a protein; and provides an unnatural amino acid, wherein the cell further comprises: orthogonal tRNA (O-tRNA), which functions in the cell and recognizes the selector codon; and orthogonal aminoacyl-tRNA synthetase (O-RS), which preferably aminoacylates O-tRNA with an unnatural amino acid. The protein thus produced in E. coli contains an unnatural amino acid at the position corresponding to the selector codon. This protein can optionally then be reacted under conditions in which the unnatural amino acid is covalently modified, thereby forming a translational protein.

[0227] In some embodiments, the O-RS includes a setting for aminoacylation of a related O-tRNA on any endogenous tRNA in the expression system. The relative ratio between O-tRNA and endogenous tRNA that is charged by O-RS when O-tRNA and O-RS are present in equimolar concentrations, is greater than 1: 1, preferably at least about 2: 1, more preferably from 5: 1, even more preferably 10: 1, even more preferably 20: 1, even more preferably 50: 1, even more preferably 75: 1, even more preferably 95: 1, 98: 1, 99: 1, 100: 1 , 500: 1, 1000: 1, 5000: 1 or higher.

[0228] A protein containing an unnatural amino acid at a certain position that is post-translational modified is also a feature of the invention. The protein is produced in a cell, e.g., an E. coli cell. O-tRNA / O-RS pairs are also found in the cell and utilize the host cell's translation apparatus, which causes the in vivo incorporation of unnatural amino acids into the fusion protein in response to a selector codon. The ability of the OtRNA / O-RS system to function in a host cell to incorporate a large selection of a variety of unnatural amino acids that can be translated is known. See, e.g., China et al., Science (2003) 301: 964-967; Zhang et al., Proc. Natl. Acad. Sci. USA 2004, 101: 8882-8887; Anderson et al., Proc. Natl. Acad. Sci. USA 2004, 101: 7566-7571; Wang et al. (2001) Science 292: 498-500; Chin et al. (2002) Journal of American Chemical Society 124: 9026-9027; Chin and Schultz, (2002) ChemBioChem 11: 11351137; Chin, et al., (2002) PNAS USA 99: 11020-11024; Wang and Schultz, (2002) Chem. Comm, 1-10; Wang and Schultz "" Expanding the Genetic Code, "Angewandte Chemie Int. Ed., 44. (1): 34-66 (2005); Xie and Schultz, "An Expanding Genetic Code," Methods 36: 227238 (2005); and Deiters et al., Bioorganic &amp; Medicinal Chemistry Letters 15: 15211524 (2005).

[0229] See also orthogonal systems of unnatural amino acids described in

International Publications WO 2002/086075, entitled "METHODS AND

COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA AMINOACYLtRNA SYNTHETASE PAIRS; "WO 2002/085923, entitled" IN VIVO

INCORPORATION OF UNNATURAL AMINO ACIDS; "WO 2004/094593, entitled

- 61 "EXPANDING THE EUKARYOTIC GENETIC CODE;" WO 2005/019415, filed July 7, 2004; WO2005 / 007870, filed July 7, 2004; WO 2005/007624, filed July 7, 2004; WO 2006/034332, filed September 20, 2005; and WO 2006/110182 entitled "ORTHOGONAL TRANSLATION COMPONENTS FOR THE IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS," submitted on October 27, 2005 by Schultz et al.

[0230] Incorporation of an unnatural amino acid can be accomplished, e.g., to adjust changes in protein structure and / or function, e.g., to change size, acidity, nucleophilicity, hydrogen bonding, hydrophobicity, availability of protease targets, targeting (e.g. , for a protein matrix), incorporation of markers or reactive groups, etc. Proteins that comprise an unnatural amino acid may have improved or even completely new catalytic or physical properties. For example, the following properties are optionally modified by the inclusion of an unnatural amino acid in the protein: toxicity, biodistribution, structural properties, spectroscopic properties, chemical and / or photochemical properties, catalytic ability, half-life (e.g., serum half-life), responsiveness. with other molecules, e.g. , covalently or non-covalently, and the like. Compositions comprising proteins that include at least one unnatural amino acid are useful for, e.g., new therapeutic agents, diagnostic agents, catalytic enzymes, industrial enzymes, binding proteins (e.g., antibodies) and, e.g., studying the structure and function of proteins. See e.g., Dougherty, (2000) Unnatural Amino Acids as Probes of Protein Structure and Function, Current Opinion in Chemical Biology, 4: 645-652. Proteins that contain an unnatural amino acid that can be selectively post-translatively modified (e.g., by [3 + 2] cycloaddition or Staudinger modification) can be designed to contain any desired functionality that can be coupled to the reaction partner. The nature of the reaction partner is not limited in any way except that it contains the appropriate reactive residue, which leads to covalent attachment of the unnatural amino acid residue in the polypeptide.

[0231] In some aspects, the composition comprises a protein with at least one, e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more unnatural amino acids. Unnatural amino acids can be the same or different, e.g., there can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more different places in a protein that contain 1, 2, 3, 4 , 5, 6, 7, 8, 9, or 10 or more different unnatural amino acids. In another aspect, the composition includes a protein with at least one, but less than all, a specific amino acid present in the protein is an unnatural amino acid. For a given protein with more than one unnatural amino acid, the unnatural amino acids may be identical or different (e.g., a protein may contain two or more different types of unnatural amino acids, or may contain two of the same unnatural amino acid). For a given protein with more than two unnatural amino acids, the unnatural amino acids may be the same,

62 different or be a combination of multiple unnatural amino acids of the same type with at least one different unnatural amino acid.

[0232] In general, any protein (or portion thereof) that contains an unnatural amino acid (and any suitable encoding nucleic acid, e.g., which contains one or more selector codons) can be produced using these compositions and methods. No attempt is made to identify hundreds of thousands of known proteins, each of which can be modified to contain one or more unnatural amino acids, e.g., by matching any available mutation methods to contain one or more selector codons in the appropriate translation system. Typical sequence repositories for known proteins include GenBank EMBL, DDBJ and NCBI. Other repositories can be easily identified by searching the internet.

[0233] Typically, the proteins are, e.g., at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99% or more identical to any available protein (e.g., therapeutic protein, diagnostic protein, industrial enzyme or part thereof, and the like) and contain one or more unnatural amino acids. Examples of therapeutic, diagnostic and other proteins that can be modified to contain one or more unnatural amino acids can be found in, but not limited to, in International Publications WO 2004/094593, filed April 16, 2004, entitled "Expanding the Eukaryotic Genetic Code;" and, WO 2002/085923, entitled "IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS." Examples of therapeutic, diagnostic and other proteins that can be modified so to contain one or more unnatural amino acids include, but are not limited to, e.g., alpha-1 antitrypsin, angiostatin, antihemolytic factor, antibodies (further details about the antibodies are below), apolipoprotein, apoprotein, atrial natriuretic factor, atrial natriuretic polypeptide. atrial peptides, CXC chemokines (e.g., T39765, NAP-2, ENA-78, Gro-a, Gro-b, Gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG ), calcitonin, CC chemokines (e.g., monocyte chemoattractant protein-1, monocyte chemoattractant protein-2, monocyte chemoattractant protein-3, monocytic inflammatory protein-1 alpha, monocytic inflammatory protein-1 beta, RANTES, I309, R83915, R91733, HCC1, T58847 D31065, T64262), CD40 ligand, C-kit Ligand, collagen, colony stimulating factor (CSF), complementary factor 5a, complementary inhibitor, complementary receptor 1, cytokines (e.g., epithelial neutrophilic activation peptide-78, GROa / MGSA, GROe, GROy, MIP1α, MIP-Ιδ, MCP-1), epidermal growth factor (EGF), Erythropoietin ("EPO"), exfoliating toxins A and B, factor IX, factor VII, factor VIII, factor X, fibroblast growth factor (FGF), fibrinogen, fibronectin, G-CSF, GM-CSF, glucocerebrosidase, gonadotropin, growth factors, Hedgehog proteins (e.g., Sonic, Indian, Desert), hemoglobin, hepatocyte growth factor (HGF), hirudin, human serum albumin, insulin, insulin-like growth factor (IGF), interferons (e.g., IFN-α, IFN-β, IFN-γ), interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL12, etc.), keratinocyte growth factor (KGF), lactoferrin, leukemia inhibitory factor, luciferase, neurturin, neutrophil inhibitory factor (NIF), oncostatin M, protein

63 osteogenic, parathyroid hormone, PD-ECSF, PDGF, peptide hormones (e.g., human growth hormone), pleiotropin, protein A, protein G, pyrogenic exotoxins A, B and C, relaxin, renin, SCF, soluble complement I receptor , soluble I-CAM 1, soluble interleukin receptors (IL-1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15), soluble TNF receptor, somatomedin, somatostatin, somatotropin, streptokinase, superantigens, i.e., staphylococcal enterotoxins (SEA, SEB, SEC1, SEC2, SEC3, SED, SEE), superoxide dismutase (SOD), toxic shock syndrome toxin (TSST-1), thymosin alpha 1, tissue plasminogen activator, tumor necrosis factor (TNF beta), tumor necrosis factor receptor (TNFR), tumor necrosis factor-alpha (TNF alpha), vascular endothelial growth factor (VEGEF), urokinase and many others.

[0234] One class of proteins that can be created using compositions and methods for incorporating in natural vivo amino acids into proteins described herein includes transcriptional modulators or a portion thereof. Examples of transcription modulators include genes and proteins of transcription modulators that modulate cell growth, differentiation, regulation, or the like. Transcription modulators are found in prokaryotes, viruses and eukaryotes, including fungi, plants, yeast, insects and animals, including mammals, providing a wide range of therapeutic goals. It should be appreciated that expression and transcriptional activators regulate transcription through a variety of mechanisms, e.g., binding to receptors, stimulating the signal transduction cascade, regulating expression of transcription factors, binding to promoters and enhancers, and binding to proteins that bind to promoters and enhancers, by unwinding DNA, pre-mRNA splicing, RNA polyadenylation, and RNA degradation.

[0235] One class of proteins of the invention (e.g., proteins with one or more unnatural amino acids) include biologically active proteins such as cytokines, anti-inflammatory molecules, growth factors, their receptors, and oncogen products, e.g., interleukins (e.g. , IL-1, IL-2, IL-8, etc.), interferons, FGF, IGF-I, IGF-II, FGF, PDGF, TNF, TGF-α, TGF-β, EGF, KGF, SCF / c -Kit, CD40L / CD40, VLA-4 / VCAM-1, ICAM-1 / LFA-1 and hyalurin / CD44; signal transduction molecules and corresponding oncogen products, e.g., Mos, Ras, Raf and Met; and transcription activators and suppressors, e.g., p53, Tat, Fos, Myc, Jun, Myb, Rel and steroid hormone receptors such as those for estrogen, progesterone, testosterone, aldosterone, LDL receptor ligand and corticosterone.

[0236] Enzymes (e.g., industrial enzymes) or parts thereof with at least one unnatural amino acid are also provided by the invention. Examples of enzymes include, but are not limited to, e.g., amidases, amino acid racemases, acylases, dehydrogenases, dioxygenases, diaryl propane peroxidases, epimerases, epoxy hydrolases, esterases, isomerases, kinases, glucose isomerases, glycosidases, glycosidase, monoperoxyl, e.g. , p450s), lipases, lignin peroxidase, nitrile hydrates, nitrilases, proteases, phosphatases, subtilisins, transaminase and nucleases.

[0237] Many of these proteins are commercially available (See, e.g., Sigma BioSciences catalog), and the respective protein and gene sequences and, typically many variants thereof are well known

- 64 (see e.g., Genbank). Each of these can be modified by inserting one or more unnatural amino acids of the invention, e.g., to alter a protein relative to one or more of the therapeutic, diagnostic or enzymatic properties of interest. Examples of therapeutically relevant properties include serum half-life, storage stability, stability, immunogenicity, therapeutic effect, detectability (e.g., by inclusion of reporter groups (e.g., markers or marker binding sites) in unnatural amino acids), reduction of LD50 or other side effects, the ability to enter the body through the digestive tract (e.g., oral availability) or the like. Examples of diagnostic properties include shelf life, storage, diagnostic performance, detectability or the like. Examples of suitable enzymatic properties include storage stability, stability, enzymatic activity, production capacity and the like.

[0238] Many other proteins may also be modified to contain one or more unnatural amino acids using the compositions and methods of the invention. For example, the invention may comprise the substitution of one or more natural amino acids in one or more vaccine proteins with an unnatural amino acid, e.g., in proteins from infectious fungi, e.g., the species Aspergillus, Candida; bacteria, especially E. coli, which serves as a model for pathogenic bacteria as well as medically important bacteria such as Staphylococci (e.g., aureus) or Streptococci (e.g., pneumoniae); protozoa such as sporozoa (e.g., Plasmodia), root stems (e.g., Entamoeba) and flagellates (Trypanosoma, Leishmania, Trichomonas, Giardia, etc.); viruses such as RNA (+) viruses (examples include poxviruses, e.g., vaccinia; Picornaviruses, e.g., polio; Togaviruses, e.g., rubella; Flaviviruses, e.g., HCV; and Coronaviruses), RNA (-) viruses (e.g., Rabdoviruses, e.g., VSV; Paramyxoviruses, e.g., RSV; Ortomixoviruses, e.g., influenza; Buniaviruses; and Arenaviruses), dsDNA viruses (Reoviruses, for example), viruses RNA to DNA, i.e., Retroviruses, e.g., HIV and HTLV, and certain DNA to RNA viruses such as Hepatitis B (hepatitis B).

[0239] Agricultural proteins, such as insect-resistant proteins (e.g., Cry proteins), starch and fat producing enzymes, plant and insect toxins, toxin-resistant proteins, mycotoxin detoxification proteins, plant growth enzymes (e.g. , ribulose-1,5-bisphosphate carboxylase / oxygenase, "RUBISCO"), lipoxygenase (LOX) and phosphoenolpyruvate carboxylase (PEP) are also suitable targets for the modification of unnatural amino acids.

[0240] In some embodiments, the protein of interest (or portion thereof) is encoded by a nucleic acid. Typically, the nucleic acid comprises at least one selector codon, at least two selector codons, at least three selector codons, at least four selector codons, at least five selector codons, at least six selector codons, at least seven selector codons, at least eight selector codons, at least nine selector codons, ten or more selector codons.

[0241] Genes encoding for proteins or polypeptides of interest may be mutagenized using methods well known to those skilled in the art and described herein in "Mutagenesis and other molecular biology techniques" to contain, e.g., one or more selector codons to incorporate an unnatural amino acid. For example, the nucleic acid for the protein of interest is mutagenized to contain one or more selector codons, ensuring the insertion of one or more unnatural amino acids. The invention includes any such variant, e.g., mutant, versions of any protein, e.g., comprising at least one unnatural amino acid. Similarly, the invention also includes corresponding nucleic acids, i.e. any nucleic acid with one or more selector codons that encode one or more unnatural amino acids.

[0242] Host cells and organisms that are adapted to incorporate in vivo an unnatural amino acid using tRNA / RS orthogonal pairs can be used to form a protein that includes the translational modified unnatural amino acid. Host cells are genetically designed (e.g., transformed, transduced or transfected) with one or more vectors that express orthogonal tRNA, orthogonal tRNA synthetase, or a vector that encodes a protein for derivatization. Each of these components may be on the same vector or may be on a separate vector, or the two components may be on one vector and the third component on the other vector. The vector may be, for example, in the form of a plasmid, bacterium, virus, naked polynucleotide or conjugated polynucleotide.

Defining Polypeptides by Immunoreactivity [0243] Because the polypeptides of the invention provide many new polypeptide sequences (e.g., polypeptides containing unnatural amino acids in the case of proteins synthesized herein in translation systems, or, for example in the case of new synthetases, new standard amino acid sequences) , polypeptides also provide new structural features that can be recognized, e.g., in immunoassays. The production of antisera that specifically bind the polypeptides of the invention as well as the polypeptides that are bound by such antisera are a feature of the invention. The term "antibody" as used herein includes, but is not limited to, a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof that specifically bind and recognize an analyte (antigen). Examples include polyclonal, monoclonal, chimeric, and single chain antibodies, and the like. Immunoglobulin fragments, including Fab fragments and fragments generated by the expression library, including phage display, are also encompassed by the term "antibody" as used herein. See, e.g., Paul, Fundamental Immunology, Ed. 4th, 1999, Raven Press, New York, due to the structure and terminology of antibodies.

[0244] To prepare an antiserum for use in an immunoassay, one or more immunogenic polypeptides are prepared and purified as described herein. For example, a recombinant protein can be produced in

- 66 recombinant cell. Inbred strain mice (used in this test because they are more reproducible because of the actual genetic identity of the mice) are immunized with an immunogenic protein (s) in combination with a standard adjuvant, such as Freund's adjuvant and a standard mouse immunization protocol (see. e.g., Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, due to standard antibody production descriptions, formats and conditions of immunoassay that can be used to determine specific immunoreactivity. Additional details about proteins, antibodies, antisera, etc. can be found in International Publications No. WO 2004/094593, entitled "EXPANDING THE EUKARYOTIC GENETIC CODE;" WO 2002/085923, entitled "IN VIVO INCORPORATION OF UNNATURAL AMINO ACIDS;" WO 2004/035605, entitled "GLYCOPROTEIN SYNTHESIS;" and WO 2004/058946, entitled "PROTEIN ARRAYS."

EXAMPLES [0245] The following examples are given to illustrate, but not limit, the claimed invention.

EXAMPLE 1

Construction of a Single-Plasmid System for Expressing Polypeptides Containing Unnatural Amino Acids [0246] The example describes the construction of a plasmid encoding both members of the orthogonal aminoacyl-tRNA pair and aminoacyl-tRNA synthetase for incorporation of p-benzoyl-L-phenylalanine.

[0247] A plasmid (called pYR-BpaRS1) was constructed containing nucleotide sequences encoding both components of an orthogonal translation pair that function in an E. coli host cell. Namely, these two components are the orthogonal MjtRNA-Tyr (CUA) tRNA and the MjTyrRS synthetase (BpaRS) mutant that specifically aminoacylate the orthogonal tRNA with the photo-crosslinking amino acid, p-benzoyl-L-phenylalanine (Bpa, see FIG. 1). See, China et al., Proc. Natl. Acad. Sci. USA 99: 11020-11024 (2002).

[0248] To determine the suppressive efficiency of the pYR-BpaRS1 plasmid system, β-galactosidase activity was measured in E. coli TOP410 cells (Invitrogen ™) co-transformed with the report plasmid pYR-BpaRS1 and lacZ, which codes for βgalactosidase with the amber site lacZ. Unfortunately, when cells were cultured in the presence of 1 mM Bpa, very low levels of β-galactosidase activity were observed (FIG. 2). Attempts to increase suppressive efficiency by modifying the flanking tRNA gene sequences have failed.

[0249] To improve suppressive efficiency, a new amber suppressor tRNA operon was constructed with the naturally occurring E. coli tRNA promoter and terminator.

Review of E. coli tRNA genes showed that E. coli prolyl tRNAs have the same C1-G72 pair as Archaea tRNA; this base pair is the main determinant of the identity of the selective recognition of MjtRNA-Tyr (CUA) by MjTyrRS in E. coli (Wang and Schultz, Chem. Biol.

- 67 8: 883-890 (2001)). In connection with this observation, the synthetic amber suppressor tRNA gene was constructed so that the MjtRNA-Tyr (CUA) gene replaces the same length (77-nucleotides) of the E. coli proK gene in the monocistronic proK operon. Because the proK gene encodes tRNA, which recognizes the most commonly used proline codon (CCG) in E. coli (Nakamura et al., Nucleic Acids Res. 28: 292 (2000)), we expected the MjtRNA-Tyr (CUA) gene to be efficiently transcribed under the control of the proK promoter. The FIS binding site, naturally located upstream of the proK promoter, was also included in the construction of the synthetic gene construct to increase tRNA transcription (Muskhelishvili et al., EMBO J. 16: 3655-3665 (1997)). The final expression vector pYR-BpaRS5 was generated by replacing the primary suppressor tRNA operon in pYR-BpaRS1 with the MjtRNA-Tyr (CUA) gene under the control of the proK promoter and terminator. This plasmid, when introduced into E. coli, led to a 2-fold increase (relative to the primary tRNA gene, under the control of the 1pp promoter and rrnC terminator) of MjtRNA-Tyr (CUA) expression, as found by northern analysis (see FIG. 3). This increase in expression corresponds to 8% suppressive efficiency (relative to expression of wild-type β-galactosidase) as determined using the βgalactosidase activity assay (FIG. 2).

EXAMPLE 2

Preparation of Improved Synthetase Genes and Promoters [0250] This Example describes the construction of improved systems for the expression of components of the orthogonal translation system, where the effects of mutations in the synthetase gene and synthetase promoter are determined.

[0251] Kobayashi et al. Previously reported that a single substitution of the amino acid Asp286 by Arg (D286R) in MjTyrRS significantly increased the total aminoacylation rate (67-fold higher kcat / Km) MjtRNA-Tyr (CUA) in vitro, mainly due to increased recognition (Km 57-fold lower) of anti-codon (CUA) in amber suppressor tRNA by related synthetase (Kobayashi et al., Nat. Struct. Biol. 10: 425-432 (2003)). Using this information, the same D286R mutation was introduced into the BpaRS gene in pYR-BpaRS5 by site-directed mutagenesis. Indeed, the D286R mutant in BpaRS led to a 4.5-fold increase in β-galactosidase activity (see FIG. 2).

[0252] It has previously been shown that a glnS promoter mutant ((SEQ ID NO: 12) which has a TATC sequence at the GATC site in the -10 region leads to increased gene expression (Plumbridge and Soll, Biochimie 69: 539-541 (1987) Knowing this, the wild-type glnS promoter in pYR-BpaRS5 was replaced with the mutated form of the glnS promoter described in Plumbridge and Soll in an attempt to improve system performance. However, after inserting this promoter sequence into pYR-BpaRS5, the sequencing showed that in addition to the intended mutation, additional unintended deletion mutations were also identified. Of the deletion mutants tested for β-galactosidase activity, one particular pYR-BpaRS-TRN mutant that has a single nucleotide deletion (residue A in

- position 68 -15), in addition to the intended substitution of one nucleotide (G on T at position -11) in the glnS promoter, showed a 5-fold increase in β-galactosidase activity compared to pYR-BpaRS5 (see FIG. 2). The complete nucleotide sequence of the promoter domain of this new glnS mutant, named glnS-TRN, identified after our sequencing is shown in SEQ IN NO: 13.

<td>Description</td><td>Sequence</td><td>SEQ ID NO:</td>

<td>glnS mutant promoter Described in Plumbridge and Soll</td><td>CGATTATCAATTTTAAAAAACTAACAGTTGTCAGCCT GTCCCGCTTATAATATCATACGCC</td><td> 12</td>

<td>glnS promoter TRN</td><td>CGATTATCAATITTAAAAAAGTAACAGITGTCAGCGT GTCCCGCmMTATCATACGCC</td><td> 13</td>

[0253] BpaRS expression, under the control of the mutated form of the glnS promoter, improved 2-fold as determined by Western blot analysis (see FIG. 4). A further 1.5-fold increase in β-galactosidase activity was observed as a result of the combination of D286R BpaRS substitution and the new glnS promoter mutant, which corresponds to a total suppressive efficiency of 57% for pYR-BpaRS-TRN (D286R).

EXAMPLE 3

Production of Improved tRNA Expression Systems [0254] The example describes the construction of improved expression systems of components of the orthogonal translation system, where the effects of placing multiple copies of MjtRNA-Tyr (CUA) in the polycistronic operon were determined.

[0255] The effect of multiple copies of amber suppressor tRNA on suppressive performance was observed. A polycistronic MjtRNA-Tyr (CUA) operon was constructed containing three copies of the amber suppressor tRNA gene under the control of a single promoter and proK terminator.

[0256] Three O-tRNA tandem sequences in the polycistronic operon were separated from each other by tRNA linker sequences derived from naturally occurring E. coli tRNA linker sequences. These specific linker sequences were chosen because they contain T (-1) and A (77) nucleotides. These two nucleotide positions in the tRNA linker have been described as optimal for efficient processing of tRNA precursors at the 5 'and 3' positions when in their native (i.e. endogenous) context.

[0257] The first and second MjtRNA-Tyr (CUA) genes in the recombinant polycistronic operon are separated by a tRNA linker derived from a linker that naturally occurs between the valU and valX E. coli tRNA genes (SEQ ID NO: 14). The second and third MjtRNA-Tyr (CUA) genes in the recombinant polycistronic operon are

- 69 separated by a tRNA linker derived from a linker that naturally occurs between the E. coli ileT tRNA and alaT genes (SEQ ID NO: 15). The use of these linkers has the additional practical advantage that these polynucleotides have convenient restriction sites.

[0258] Two identical copies of the synthetic tRNA polycistronic operon containing three copies of the tRNA suppressor gene were ligated to generate gene clusters with six copies of the MjtRNA-Tyr (CUA) gene. Then, the combined gene clusters with three and six copies of tRNA were cloned into pYR-BpaRS-TRN (D286R) to form pYRBpaRS-3TRN (D286R) and pYR-BpaRS-6TRN (D286R), respectively. After expression in E. coli, these plasmids showed a 30% and 50% increase in MjtRNA-Tyr (CUA) expression, as determined by northern analysis (see FIG. 3), respectively. This increase in message expression led to a 30-40% increase in β-galactosidase activity (see FIG. 2).

[0259] Because the rare E. coli tRNA codons encoded in these plasmids may be unnecessary when expressing most proteins, these E. coli tRNA genes were removed from plasmid pYR-BpaRS-6TRN (D286R) to form pSup-BpaRS-6TRN (D268R) (shown in Fig. 5). As expected, the suppressive efficiency of this plasmid determined in the in vivo β-galactosidase activity assay remained the same as in the parent plasmid (see FIG. 6).

EXAMPLE 4

Expression of Model Protein Containing Unnatural Amino Acid Using Enhanced Expression Systems [0260] The example describes the expression of a sperm myotine sperm myotropin model protein containing an unnatural amino acid using the improved expression systems of the invention.

[0261] To further investigate the improvement of the efficiency and accuracy of incorporation of an unnatural amino acid into proteins using the systems of the invention, the sperm myocotin myoglobin mutant Ser 4-BPA (described in China et al. Proc. Natl. Acad. Sci. USA 99: 11020-11024 (2002)), expressed in E. coli. TOP10 E. coli (Invitrogen ™) cells co-transformed with pBAD / Myc-His / MB (S4TAG) and pSup-BpaRS6TRN (D286R) were cultured in Luria-Bertani medium at 37 ° C in the presence of 1 mM Bpa. According to the above in vivo β-galactosidase assay data, a full-length myoglobin mutant was generated in total yield after purification of 40 mg / L, while the previous system provided 2 mg / L of the mutated protein (Chin et al., Proc. Natl. Acad. Sci. USA 99: 11020-11024 (2002)). No mutated protein was observed on the SDS-PAGE gel in the absence of the amino acid (FIG. 6). MALDI-TOF mass spectrometry of a Bpa-containing myoglobin mutant at Ser-4 site showed an average mass of 18521, with good agreement with the predicted calculated mass of 18520. No evidence of inclusion of any natural position 4 amino acid was detected in the mass spectrum.

EXAMPLE 5

The Widespread Use of the Improved Expression Systems of the Invention

[0262] The example describes the expression of β-galactosidase containing four different unnatural amino acids, where the expression systems use different mutant synthetases having loading specificities for different unnatural amino acids.

[0263] To test the generality of these expression systems of the invention, three additional orthogonal aminoacyl-tRNA synthetases were tested in the system. TeO-RS specifically aminoacylate (i.e. load) the MjtRNA-Tyr O-tRNA (CUA), alternatively with pacetyl-L-phenylalanine (pAcPhe), p-azido-L-phenylalanine (pAzPhe) and p-iodo-L-phenylalanine (pIPhe) (FIG. 1). These unnatural amino acids are useful for chemical labeling experiments (Wang et al., Proc. Natl. Acad. Sci. USA 100: 56-61 (2003)), photo-crosslinking (China et al., J. Am. Chem. Soc, 124: 9026-9027 (2002)), and X-ray crystallographic phasing (Xie et al., Nat Biotechnol, 22 : 1297-1301 (2004)). Expression vectors of the invention encoding these mutated MjTyrRS genes were constructed by sub-cloning the corresponding O-RS into the Ndel / Pstl sites of pSug-BpaRS-6TRN (D286R) to generate the vectors pSuppAcPheRS-6TRN, pSup-pAzPheRS-6TRN and pSup-pSRS-6TRN and pSup 6TRN. As with Bpa, when E. coli cells that store these plasmids are cultured in the presence of these amino acids (1 mM), the level of β-galactosidase activity is similar to wild-type β-galactosidase (FIG. 7), indicating β formation -galactosidase containing the corresponding unnatural amino acid.

EXAMPLE 6

Constructions of pYR-BpaRS1 lazimids [0264] pYR-BpaRS1, a p15A replicon containing a chloramphenicol resistance marker, MjtRNA-Tyr (CUA) under the control of the Ipp promoter and the rrnC and BpaRS terminator under the control of the glnS promoter, produced by insertion of the BpaRS and Mjt genes CUA) to the Sacl and Spel sites of the plasmid pRARE2 (Novagen).

GEN MtRNA-TYR (CUA) WITH PROMOTOR AND PROK TERMINATOR [0265] The MjtRNA-Tyr (CUA) monocistronic operon containing the promoter and proK terminator was constructed by PCR using four synthetic oligonucleotides in overlapping PCR strategy to construct the entire tRNA operon in one PCRR :

<td>Starter</td><td>Sequence</td><td>SEQ ID WELL:</td>

<td>pro P1</td><td>GTGCACGGCTAACTAAGCGGGCTGCTGACTTTCTCGCCGATCAAA AGGC</td><td> 37</td>

<td>pro T1</td><td>CTTTCTCGCCGATCAAAAGGCATTTTGCTATTAAGGGATTGACGA GGGCGTATCTGCGCAGTAAGATGCGCCCCGCATTCCGGCGGTAGT TCAGCAGGGC</td><td> 38</td>

<td>pro T2</td><td>CTTTCTCGCCGATCAAAAGGCATTTTGCTATTAAGGGATTGACGA GGGCGTATCTGCGCAGTAAGATGCGCCCCGCATTCCGGCGGTAGT TCAGCAGGGC</td><td> 39</td>

<td>pro P2</td><td>GCATAAGCTTATGCAAAAAAGCCTGCTCGTTGAGCAGGCTTTTC G</td><td> 40</td>

[0266] The PCR amplicon was then amplified by PCR using two primers:

<td>Starter</td><td>Sequence</td><td>SEQ ID WELL:</td>

<td>PROKA-F</td><td>AGTCTGATCAGTCACGGCTAACTAAGCGG</td><td> 41</td>

<td>PROKA-R</td><td>GCATCTCGAGATGCAAAAAAGCCTGCTCGTTG</td><td> 42</td>

[0267] The resulting amplicon was inserted between the Bcll and Xhol sites (underlined) in pYRBpaRS1 to form the pYR-BpaRS5 plasmid.

GlnS PROMOTOR MUTANT [0268] The glnS promoter mutant was constructed by PCR using four synthetic oligonucleotides:

<td>Starter</td><td>Sequence</td><td>SEQ ID WELL:</td>

<td>glnS P1</td><td>CCGAGCTCCCGGGTCATC</td><td> 43</td>

<td>GLS T1</td><td>CCGAGCTCCCGGGTCATCAATCATCCCCATAATCCTTGTTAGATTATCAAT TTTAAAAAACTAACAGTTGTCAGCCTGTC</td><td> 44</td>

<td>GLS T2</td><td>TATAACICGGGACA &lt;5GZTGACJJJCTGTTAG</td><td> 45</td>

<td>glnS P2</td><td>GTCCATATGGGATTCCTC</td><td> 46</td>

[0269] The product was inserted between the Xmal and Ndel sites of PYR-BpaRS5. A number of clones were screened using an in vivo LacZ activity assay and a mutant (called pYR-BpaRS-TRN) was identified and sequenced, with a specific deletion of a single base with improved activity.

TRANNA TANDEM GENE CASSETTE [0270] Two tRNA linker sequences that naturally occur between the valU and valX genes (SEQ ID NO: 14), and between the ileT and alaT genes (SEQ ID NO: 15) in the E. coli genome

72 were used as spacers between the MjtRNA-Tyr (CUA) genes. These linker sequences contain BsmAl I and Earl restriction sites to which MjtRNATyr (CUA) genes have been ligated. These flanking sequences also contain T (-1) and A (77) residues that are optimal for efficiently processing tRNA precursors at the 5 'and 3' positions. The tRNA gene cassette was amplified by PCR using three sets of primers:

<td></td><td>Set 1</td><td></td>

<td>Starter</td><td>Sequence</td><td>SEQ ID NO:</td>

<td>Connector P1</td><td>GTGCACGGCTAACTAAGCGGCCTGCTGACTTTCTCGCCGATCAAAA GGC</td><td> 47</td>

<td>Connector P2</td><td>tacacggcggagactacataaagtagttggtccggcgggccggatt TG</td><td> 48</td>

<td></td><td>Set 2</td><td></td>

<td>Starter</td><td>Sequence</td><td>SEQ ID WELL:</td>

<td>Connector P3</td><td>GTAGTCTCCGCCGTGTAGCAAGAAATTGAGAAGTCCGGCGGTAGTT CAGCAG</td><td> 49</td>

<td>Connector P4</td><td>AAACCTCTTCAAATTTGCCGTGCAAATTTGGTCCGGCGGGCCGGAT TTG</td><td> 50</td>

<td></td><td>Set 3</td><td></td>

<td>Starter</td><td>Sequence</td><td>SEQ ID WELL:</td>

<td>Connector P5</td><td>GCAAATTTGAAGAGGTTTTAACTACATGTTATCCGGCGGTAGTTCA GCAG</td><td> 51</td>

<td>PROKA-R</td><td>GCATCTCGAGATGCAAAAAAGCCTGCTCGTTG</td><td> 52</td>

[0271] The product from each set was digested with BsmAl (Set 1), Earl (Set 2) or each (Set 3). Ligation of these three restriction fragments formed the tRNA polycistronic operon containing three copies of the tRNA gene joined by two different naturally occurring linker sequences. The resulting gene clusters were amplified by PCR using two sets of primers:

<td></td><td>Set 4</td><td></td>

<td>Starter</td><td>Sequence</td><td>SEQ ID NO:</td>

<td>Tandem P1</td><td>ATCAGTGCACGGCTAACTAAGCGG</td><td> 53</td>

<td>Tandem P2</td><td>GCTGGCATGCATGCAAAAAAGCCTGCTCGTTGAGC</td><td> 54</td>

<td></td><td>Set 5</td><td></td>

<td>Starter</td><td>Sekwecja</td><td>SEQ ID WELL:</td>

<td>Tandem P3</td><td>ATCAGCATGCGGCTAACTAAGCGGCCTGCTG</td><td> 55</td>

<td>Tandem P4</td><td>GCTGCTCGAGATGCAAAAAAGCCTGC</td><td> 56</td>

[0272] The PCR products from sets 4 and 5 were digested with Sphl and ligated together to generate a one-way tRNA gene system that consists of two identical tRNA polycistronic operons, each of which encodes three tRNA genes under the control of a single promoter and proK terminator . Each tRNA gene cluster containing one or two identical copies of the tRNA polycistronic operon was cloned into the ApaLI and XhoI sites of pYR-BpaRS-TRN to give pYR-BpaRS-3TRN and pYR-BpaRS6TRN, respectively.

PLSAMIDES pSup [0273] Each of the twelve E. coli tRNA genes that were initially encoded in the pRARE2 plasmid, were removed from pYR-BpaRS-6TRN (D286R) by digestion with Spel and Drdl, followed by Mung bean nuclease treatment. Religion of linearized vectors generated pSup-BpaRS-6TRN (D286R). The genes of the MjTyrRS mutant p-acetyl-L-phenylalanine, p-azido-L-phenylalanine and p-iodo-L-phenylalanine were subcloned from their respective plasmids pBK to the Ndel and Pstl sites of pSup-BpaRS-6TRN (D286R) generating pSup-pAc 6TRN, pSuppAzPheRS-6TRN and pSup-pIodoPheRS-6TRN, respectively.

LacZ REPORTER PLASMID AND IN vivo β-GALACTTOIDASE ACTIVITY TEST [0274] Phenylalanine codon (TTC) at residue 13 (underlined) from the leader sequence (MDPLVTAASVLEFGLFET; SEQ ID NO: 57) located above the lacZ pBAD / Myc-His gene Invitrogen ™) was mutated to the amber codon (TAG) by site-directed mutagenesis to generate the LacZ reporter plasmid pBAD / Myc-His / LacZ (TAG). This plasmid was co-transformed with each suppressor plasmid into E. coli TOP10 cells (Invitrogen ™). Cells were incubated at 37 ° C overnight in Luria-Bertani (LB) medium containing 0.02% arabinose and 1 mM unnatural amino acid.

- LacZ (β-galactosidase) activity was measured according to the method described by Miller (Miller, JH Experiments in Molecular Genetics (Cold Spring Harbor Laboratory, New York,

1972)).

EXAMPLE 7

General Methodologies [0275] E. coli XL1-Blue cells (Stratagene) were used for cloning and maintenance of plasmids. PfuUltra ™ High-Fidelity DNA Polymerase (Stratagene^®) was used for polymerase chain reaction (PCR). QuikChange site directed mutagenesis kit^®II (Stratagene^®) was used for site directed mutagenesis. The sequences of all constructed plasmids were verified by sequencing.

PROTEIN EXPRESSION [0276] The mutated sperm myocyte sperm myoglobin gene, labeled at the C-terminus with hexahistidine, with an amber codon at position four (Ser-4) inserted with pBAD-JYAMB-4TAG between the Ncol and Kpnl sites of pBAD / Myc-His (Invitrogen ™) generating pBAD / Myc-His / MB (S4TAG). The plasmid was co-transformed from pSup-BpaRS-6TRN (D286R) to TOP10 E. coli (Invitrogen ™). Cells were incubated at 37 ° C in LB containing 100 mg / ml carbenicillin, 50 mg / ml chloramphenicol and 1 mM Bpa. Cells were induced at OD600 = 0.6 by the addition of 0.2% arabinose and incubated for 12 hours. Cells were harvested by centrifugation and lysed using BugBuster reagent^® (Novagen^®). The protein obtained from the inclusion bodies was purified using TALON metal affinity resin^®(Clontech^®) under denaturing conditions according to the manufacturer's protocol. The purified protein was concentrated by ultrafiltration and analyzed by MALDI-TOF mass spectrometry. Protein concentration was measured by the Bradford method.

NORTHERN ANALYSIS [0277] E. coli TOP10 cells (Invitrogen ™), transformed with each suppressive plasmid, were incubated in LB at 37 ° C. Cells were collected at OD600 = 0.8. Total tRNA was isolated by phenol extraction and isopropanol fractionation as previously described (Deutscher and Hilderman "Isolation and partial characterization of Escherichia coli mutants with low levels of transfer ribonucleic acid nucleotidyltransferase," J. Bacteriol., 118: 621-627 (1974)). RNA samples were separated on a 15% denaturing polyacrylamide gel and transferred to a GeneScreen Plus membrane^® (PerkinElmer^®). The membrane was hybridized overnight at 55 ° C with:

5'-biotin-CCCTGCTGAACTACCGCC-3 '(SEQ ID NO: 58).

Hybridized biotinylated probe was detected using the NorthLSouth Detection Kit (Pierce) chemiluminescent hybridization and detection kit according to the manufacturer's protocol.

WESTERN BPA EXPRESSION ANALYSIS

[0278] The C-terminus labeled at the C-terminal hexahistidine was constructed by PCR and inserted between the Ndel and Pstl sites of pYR-BpaRS5 and pYR-BpaRS-TRN generating pYRBpaRS5 (C-His), and pYR-BpaRS-TRN (C-His ), respectively. Top 10 E. coli cells, transformed with each plasmid, were incubated in LB at 37 ° C. Cells were harvested at OD600 = 1 and lysed with Bugbuster reagent. Total protein was separated on a 10% polyacrylamide gel and transferred to a PVDF membrane (Invitrogen). The membrane was hybridized with Anti-His (C-term) -HRP antibody conjugate (Invitrogen) and detected by chemiluminescence.

Piotr Godlewski Patent Attorney