PL188705B1

Synthesis and application retinoidic compositions exhibiting activity of a negative hormone and/or of an antagonists

Abstract

This record has no abstract on file.

PL188705B1, drawing sheet 1 — Sheet 1 of 73

Term

Term ended

Expired 23 August 2016, 10.1 years ago.

6 claims: 5 independent, 1 dependent

1
Patent claims Zastrzeżenia patentowe 1. A retinoid compound of the formula 1 in which X is S;1. Związek retinoidowy o wzorze 1 wzór 1 w którym X oznacza S;Z is -C = C-;Z oznacza -C=C-;Y is a phenyl group;Y oznacza grupę fenylową;B is COOH or COOEt;and R14 is 4-MePh. B oznacza COOH lub COOEt;a R14 oznacza 4-MePh.
2
A retinoid compound of the formula 1a formula 1a wherein X is - [C (R1) 2] n, where R1 is H or methyl, n = 0 or 1;2. Związek retinoidowy o wzorze 1a wzór 1a w którym X oznacza -[C(R1)2]n, gdzie R1 oznacza H lub metyl, n = 0 lub 1;R3 is H or methyl;R3 oznacza H lub metyl;Z is -C = C-, -N = N-, -CH = CH-, -CO-NH-, -CS-NH-, -COO-, - (CRt = CR1) n ', where n' = 3 and R1 is as defined above;Z oznacza -C=C-, -N=N-, -CH=CH-, -CO-NH-, -CS-NH-, -COO-, -(CRt=CR1)n', gdzie n' = 3, a R1 ma wyżej określone znaczenie;Y is phenyl optionally substituted with fluoro or a naphthyl group Y oznacza gn^j^<ę fenylową ewentualnie podstawioną fluorem lub grupę nafiylową B is COOH, COOEt or COO (CH2) 2 SiCHs;and B oznacza COOH, COOEt lub COO(CH2)2 SiCHs;a R14 is phenyl, optionally substituted with one or two Cm alkyl groups, CF3, OH, CH3O or Cl atom, or is pyridyl, thiazolyl, thienyl optionally substituted with one or two methyl groups, or furyl, when in the group Xn is 0, then Z is -C = C =, B is COOH or COOEt, R14 is methylphenyl;R14 oznacza fenyl, ewentualnie podstawiony jedną lub dwiema grupami alkilowymi Cm, grupą CF3, OH, CH3O lub atomem Cl, lub oznacza pirydyl, tiazolil, tienyl ewentualnie podstawione jednym lub dwoma grupami metylowymi, albo furyl, przy czym gdy w grupie Xn stanowi 0, wówczas Z oznacza -C=C=, B oznacza COOH lub COOEt, R14 oznacza metylofenyl;gdy Z oznacza -(CRi=CRi)n, wówczas Y oznacza wiązanie między Z i B;a gdy Y oznacza naftyl, wówczas Z oznacza wiązanie. when Z is - (CRi = CRi) n, then Y is a bond between Z and B;and when Y is naphthyl, then Z is a bond.
3
The use of a retinoid compound of formula 1 as defined in claim 1. 1 for the manufacture of a medicament for treating pathological conditions in mammals susceptible to retinoid antagonist treatment selected from the group consisting of skin irritation, hypertriglyceridemia, bone toxicity, cervical tumors, retinal detachment and psoriasis. 3. Zastosowanie związku retinoidowego o wzorze 1 określonym w zastrz. 1 do wytwarzania leku do leczenia stanów patologicznych u ssaków, podatnych na leczenie retinoidowym antagonistą, wybranych z grupy obejmującej podrażnienie skóry, hipertriglicerydemię, toksyczność kości, guzy szyjki macicy, odklejenie siatkówki i łuszczycę.
4
The use of a retinoid compound of formula 1a as defined in claim 2 for the manufacture of a medicament for treating pathological conditions in mammals susceptible to retinoid antagonist treatment selected from the group consisting of skin irritation, hypertriglyceridemia. bone toxicity, cervical tumors, retinal detachment and psoriasis. 4. Zastosowanie związku retinoidowego o wzorze 1a określonym w zastrz. 2 do wytwarzania leku do leczenia stanów patologicznych u ssaków, podatnych na leczenie retinoidowym antagonistą, wybranych z grupy obejmującej podrażnienie skóry, hipertriglicerydemię. toksyczność kości, guzy szyjki macicy, odklejenie siatkówki i łuszczycę.
5
A retinoid compound according to formula 1 1 for treating pathological conditions in mammals susceptible to retinoid antagonist selected from the group consisting of skin irritation, hypertriglyceridemia, bone toxicity, cervical tumors, retinal detachment and psoriasis. 5. Związek retinoidowy o wzorze 1 określonym w zastrz. 1 do leczenia stanów patologicznych u ssaków, podatnych na leczenie retinoidowym atagonistą wybranych z grupy obej188 705 mującej podrażnienie skóry, hipertriglicerydemię, toksyczność kości, guzy szyjki macicy, odklejenie siatkówki i łuszczycę.

Independent claims5

1,147 paragraphs in 56 sections, as filed

The present invention relates to new retinoid compounds and their use. These new properties exhibit retinoid-like antagonist activity and are useful for treating or preventing retinoid and vitamin A-induced toxicity and vitamin A precursor in mammals and as an additive to mammalian treatment with retinoids to prevent or alleviate unwanted or unwanted side effects.

The invention furthermore relates to the use of i'ethinoid compounds for increasing the biological activity of other retinoids and steroid hormones and inhibiting the essential activity of receptors of b-ligand retinoic acid.

Compounds having rethenoid antagonist-like activity are well known and described in numerous US and other patents and in scientific publications. It is generally known that rectinid like activity is useful in the treatment of mammals, including humans, for the treatment or relief of symptoms associated with numerous diseases and conditions.

Rectinoids (vitamin A and its derivatives) are known for their high activity, including effects on cell proliferation and differentiation, in various biological systems. This activity determines the retinoid toxicity in the treatment of various diseases, including dermatologic disorders and skin cancers. To date, many chemical compounds have been developed that exhibit tinoid-like biological activity and have been described in the extensive patent and chemical literature. The relevant patent literature includes U.S. Patent Nos. 4980369, 5006550, 5015658, 5045551, 5089509, 5134159, 5362546, 5234926, 5248777, 5264578, 5272156, 5278318, 5324744, 5346895, 5346915, 5348979378, 5348979 transferred to the owner of this application) and the patents and publications cited therein, which particularly describe or relate to chromium derivatives, thiochrome and 1,2,3,4-tetrahydroc] hLnoline with retinoid-like biological activity. In addition, several applications from the owner of a minor application have been made regarding further compounds exhibiting retinoidopyridine activity.

U.S. Patent Nos. 4,740,519 (Sbroot et al.), 4,826,969 (Maignan et al., 4326055 (Lykligkr et al., 5,130,335 (Chandraratna et al.) 5,037,825 (Klaus et al.), 5,231,113 (Cbśndraratna et al.) 5324840 (Chśndyayatna), 5344959 (Chandraratna), 5130335 (Chandraratna et al.), Published patent application No. 0 176 034 A (Wuest et al.), 0 350 846 A (Klaus et al.), 0 176 032 A ( F ^ ckel et al.), 0 176 033 A (Frickel et al.), 0 253 302 A (Klaus et al.), 0 303 915 A (Bryce et al.), British Patent Application No. GB 2190378 A (Klaus et al.), German Patent Application No. DE 3715955 A1 (Klaus et al.), DE 3602473 Al (Wuest et al., and articles by J. Amer. Acad Derm. 15: 756 - 764 (1986); Sporn et al.), Chem. Pharm. Bull. 33: 404-407 119851 (Shudo et al.). J. Med Chem. 31: 2182 2192 (1988) (Kagechika et al.), Chemist and Bio of Synthetic Retinyids, CRC Press Inc. 1990 p. 334 335, 354 (Dawson et al.) Describe or refer to compounds that enclose the trondronaphthyl moiety and possess retinoid-like or related biological activity. In U.S. Patent No. 4,391,731 (Boller et al.), There are derivatives of tktisbydrynaphthalene which are useful in liquid crystal compositions.

Kag ^ mi et al. in J. Med. Chem. 32: 834 (1989) describe certain 6- (3-xy-1-propenyl) -1,2,3,4-tetramethyl-1,2,3,4-tetra-tetra-drynaphthylene derivatives and related flavone compounds exhibiting retinoidine anti-resistance. Shudo et al. in Chem. Pharm. Bull. 33: 404 (1985) and Jettena et al. in CancM Rkseśych 47: 3523 (1987) describe further 3-oxo-1-propenyl derivatives (chalcone species) and their retinoid-like or related biological activity.

188 705

Unfortunately, compounds with retinoid-like activity (retinoids) also cause many undesirable side effects at therapeutic doses, including headache, teratogenesis, mucosal skin toxicity, musculoskeletal toxicity, dyslipidemia, skin irritation, headache and hepatotoxicity. These side effects limit the acceptability and usefulness of retinoids for the treatment of diseases.

It is now generally known that mammals (and other organisms) have two major types of retinoid receptors. These two main types or families of receptors are designated RAR and RXR, respectively. There are subtypes in each type: in the RAR family, subtypes are designated RAR-a, RAR-β and RAR-γ, in RXR the subtypes are: RXR-a, ίΤΧΒ-β and RXR-y. Both receptor families are transcription factors that can be distinguished from each other based on their ligand binding specificity. The ΑΙΙ-trans RA ligand (ATRA) binds and activates the class of retinoic acid receptors (RAR), which includes RAR-a, RAR-β and RAR-γ. Another ligand, 9-cis-RA (9C-RA), binds and activates RAR and members of the retinoid X receptor family (RXR).

It has also been established that the distribution of the two major retinoid receptor types, and several subtypes, is not equally mediocre in the various tissues and organs of mammalian organisms. Furthermore, it has been generally accepted that one or more RAR receptor subtypes mediate many undesirable side effects of retinoids. Thus, for compounds that exhibit agonist activity at retinoid receptors, specificity or selectivity for one of the major types or families, and even specificity or selectivity for one or more subtypes in the receptor family is considered a desirable pharmacological trait.

Relatively recently, RAR receptor binding compounds have been developed without triggering responses triggered by agonists of the same receptors. Compounds or agents that bind to RAR receptors without triggering a "retinoid" response are thus able to block (to a greater or lesser extent) the activity of RAR agonists in biological trials and systems. More specifically, published PCT Application No. WO 94/14777 describes certain heterocyclic carboxylic acid derivatives binding to retinoid RAR receptors and intended to be useful in the treatment of certain diseases or conditions, such as acne, psoriasis, rheumatoid arthritis and viral infections, according to the application. Similar data are disclosed in the article by Yoshimury et al., J. Med. Chem. 38: 31633173 (1995). Kaneko et al., Med. Chem. Res. 1: 220-225 (1991); Apfel et al., Proc. Natl. Acad. Sci. USA 89: 7129-7133, Augusty 1992 Cell Biology; Eckhardt et al., Toxicology Letters 70: 299-308 (1994); Keidel et al., Molecular and Cellular Biology 14: 287-298 (1994); and Eyrolles et al., J. Med Chem. 37: 1508-1517 (1994) describe compounds having antagonistic activity against one or more RAR retinoid subtypes.

In addition to the undesirable side effects of retinoid therapy, sometimes there is a serious medical condition caused by an overdose of vitamin A or a vitamin A precursor, resulting either from excessive vitamin supplementation or from the liver of certain fish and animals containing a significant amount of vitamin. Chronic or acute toxicity observed in hypervitaminosis A syndrome includes headache, skin peeling, bone toxicity, dyslipidemia, etc. In recent years it has become apparent that the toxicity symptoms observed for vitamin A analogues, i.e. retinoids, are essentially the same as for hypervitaminosis A syndrome, suggesting a common biological reason, i.e., RAR activation. These toxins are currently cured mainly in a supportive manner and by avoiding the further action of the causative agent, which is the liver, ingestion of vitamins or retinoids. Although some toxins disappear over time, others (e.g. premature closing of the base plate) is permanent.

Generally speaking, specific antidotes are the best treatment for drug poisoning, but only about two dozen chemicals or classes of chemicals out of thousands existing have specific known antidotes. Of course, a specific antidote would be very valuable in the treatment of hypervitaminosis A and retinoid toxicity. Indeed, since increasingly potent retinoids are used clinically, a specific antidote for retinoid poisoning can be a life-saving agent.

188 705

The present invention relates to retinoid compounds which meet specific requirements represented by formula 1

wherein X is S;

With the meaning -C = C-;

Y is a phenyl group;

B is COOH or COOEt; and

R14 is 4-MePh.

The invention also relates to retinoid compounds of formula 1a

wherein X is - [C (Ri) 2] n, where Ri is H or methyl, n = 0 or 1;

R3 is H or methyl;

Z is -C = C, -N = N-, -CH = CH-, -CO-NH-, -CS-NH-, -COO-, - (CRi = CRi )n- where n '= 3 and Ri is as defined above;

Y is a phenyl group optionally substituted with fluoro or a naphthyl group;

B is COOH, COOEt or COO (CH2) 2 SiCH; and

R14 is phenyl, optionally substituted with one or two Cm alkyl groups, CF3, OH, CH3O or Cl atom, or is pyridyl, thiazolyl, thienyl optionally substituted with one or two methyl, or furyl, when in the group X n is 0, then Z is -C = C =, B is COOH or COOEt, R4 is methylphenyl;

when Z is - (CRi = CRi) n, then Y is a bond between Z and B; and when Y is naphthyl, then Z is a bond.

The compounds of the present invention are useful for preventing certain undesirable side effects of retinoids that are administered to treat or prevent certain diseases or conditions. To this end, the compounds of the invention may be administered together with retinoids. The compounds of the present invention are also useful in the treatment of acute or chronic toxicity due to overdose or intoxication with retinoid drugs or vitamin A.

As an antidote to acute or chronic retinoid or vitamin A poisoning, the compounds of the invention may be administered enterally to the mammal, i.e., by intubation into the stomach or in a mixture with food / water, or parenterally, e.g., intraperitoneally, intramuscularly, subcutaneously, topically, etc. The only requirement for the route of administration is that it must allow delivery of the antagonist to the target tissue. The compound of the invention may be formulated alone or in combination with excipients, and need not be in solution in the formulation, e.g. for enteric use.

As an additive to retinoid therapy and to prevent one or more side effects of the retinoid drug administered, the compound of the invention may be similarly administered enterally or parenterally. The compound of the invention - RAR antagonist and RAR agonist need not be administered by the same route. The presence of sufficient quantity is key

188 705 RAR antagonists in tissue all the time during RAR agonist activity. To prevent retinoid toxicity, it is best to administer the RAR antagonist concurrently or prior to administration of the RAR agonist. In many situations, the RAR antagonist will be administered by a different route than the agonist. For example, unwanted skin effects of an enterically administered retinoid may be prevented or mitigated by topical administration of a RAR antagonist.

The present invention will enhance the pharmacological activity of the steroid superfamily receptor agonist administered to a mammal. The method includes co-administering to a mammal with a steroid superfamily receptor agonist a composition comprising a pharmaceutically effective dose of a retinoid negative hormone to enhance the pharmacological activity of the steroid superfamily receptor agonist. Pharmacological activity can be measured in an in vitro trans-activation reporter gene assay, such as measuring anti-AP-1 activity. Pharmacological. the enhanced activity can be antiproliferative activity, such as activity that can be measured in the retinal pigment epithelium. The steroid superfamily receptor agonist can be any of the following: retinoid receptor agonist, vitamin D receptor agonist, glucocorticoid receptor agonist, thyroid hormone receptor agonist, peroxisome proliferator activated receptor or estrogen receptor agonist. The retinoid receptor agonist may be an RAR agonist such as all-trans retinoic acid or 13-cis retinoic acid. The retinoid receptor agonist may also be an RXR agonist. The preferred vitamin D receptor agonist is 1,25-dihydroxyvitamin D3. A preferred glucocorticoid receptor agonist is dexamethasone. The preferred thyroid hormone receptor agonist is 3,3 ', 5-triiodothyronine. The negative retinoid hormone is the RAR-specific negative retinoid hormone, which preferably has a dissociation constant less than or approximately equal to 30 nM. Examples of RAR-specific negative retinoid hormone include AGN 193109, AGN 193385, AGN 93389 and AGN 193871. A composition containing a pharmaceutically effective dose of negative retinoid hormone can be co-administered with a steroid superfamily agonist and combined prior to administration. They can also be administered as separate compositions.

Short description of the drawings

Fig. 1 shows the chemical structure of AGN 193109.

Figures 2A-2F are a series of graphs showing that AGN 193109 inhibited ATRA-dependent RAR transactivation. Figures 2A and 2B represent activity at the RAR-α receptor; Figures 2C and 2D represent activity at the RAR-β receptor; Figures 2E and 2F represent activity at the RAR-γ receptor. In Figures 2A, 2C and 2E, open squares represent retinoic acid treatment and solid circles represent AGN 193109 treatment. In Fig. 2B, 2D and 2F single lines represent luciferase activity measured after treatment 10 8 M ATRA and variable concentrations of AGN 193109.

Figures 3A and 3B are graphs representing luciferase activity detected in CV-1 cells transfected with the ERE-tk-Luc reporter plasmid and ER-RAR-α expression plasmid and ATRA stimulated (Fig. 3A) or AGN 193109 (Fig. 3B) in various concentrations. Data points represent the mean ± standard error of three independent luciferase measurements. Transfection results using different amounts of co-transfected ER-RAR-α (0.05, 0.1 and 0.2 pg / well) are indicated in each figure.

Figures 4A and 4B are graphs representing luciferase activity in CV-1 cells transfected with the ERE-tk-Luc reporter plasmid and ER-RAR-β expression plasmid and ATRA stimulated (Fig. 4A) or AGN 193109 (Fig. 4B) at various concentrations . Data points represent the mean ± standard error of three independent luciferase measurements. Transfection results using different amounts of co-transfected ER-RAR-β (0.05, 0.1 and 0.2 pg / well) are indicated in each figure.

Figures 5A and 5B are graphs representing luciferase activity detected in CV-1 cells transfected with the ERE-tk-Luc reporter plasmid and ER-RAR-γ expression plasmid and ATRA stimulated (Fig. 5A) or AGN 193109 (Fig. 5B) in various concentrations. Data points represent the mean ± standard error of three independent luciferase measurements. Transfection results using different amounts of co-transfected ER-RAR-γ [0/05, 0.1 and 0.2 pg / well) are indicated in each figure.

188 705

Fig. 6 shows dose responses to ATRA and AGN 193109 CV-1 cells co-transfected with a reporter using the ERE-tk-luc plasmid and the ER-RXR-α chimeric receptor expression plasmid alone or plasmid in combination with the RAR-y-VP-16 expression plasmid. ER-RXR-α co-transfected cells were treated with ATRA (square) and AGN 193109 (rhombus). Cells co-transfected with the combination of ER-RXR-a and RAR-y-VP-16 were treated with ATRA (circle) or AGN 193109 (triangle).

Fig. 7 shows a line graph representing luciferase activity measurements recorded in lysates of CV-1 cells transfected with the ERE-tk-Luc reporter and the ER-RAR-γ expression construct and then treated with ATRA at 10 '8 M and test compounds at the concentrations indicated on the horizontal axis. Test compounds are AGN 193109 (square), AGN 193357 (open diamond), AGN 193385 (circle), AGN 193389 (triangle), AGN 193840 (hatched square) and AGN 192870 (full diamond).

Fig. 8 a line graph representing luciferase activity measurements recorded in lysates of CV-1 cells transfected with the ERE-tk-Luc reporter and expression constructs RARY-VP-16 and ER-RKR-a and then treated with test compounds at the concentrations indicated on the horizontal axis. Test compounds are ATRA (open square), AGN 193109 (open circle), AGN 193174 (open triangle), AGN 193199 (hatched square), AGN 193385 (hatched circle), AGN 193389 (inverted triangle), AGN 193840 (oblique filled square) ) and aGn 193871 (half-filled diamond).

Figures 9A, 9B and 9C schematically show the mechanism by which AGN 193109 can modulate the interaction between RAR (shaded square) and negatively co-activating proteins (-), illustrated in the context of a transactivation assay. Fig. 9A shows that negatively co-activating proteins and positively co-activating (+) proteins are in RAR binding balance. In the absence of ligand, transcription occurs at the basic level of the reporter gene. As illustrated in fig. 9B, the addition of an RAR agonist promotes the association of positively co-activating proteins with RAR and causes transcription of the upregulated reporter gene. As illustrated in Figure 9C, the addition of AGN 193109 promotes the association of negatively co-activating protein with RAr and prevents transcription of the reporter gene.

Fig. 10 is a bar graph showing inhibition of TPA-induced Str-AP1-CAT expression as a function of AGN 191183 concentration (10 '° to 10'12 M) with a constant concentration of AGN 193109 108 M. Results from trials conducted with AGN 191183 alone are shown as hatched bars, while striped bars represent results from treatment with a combination of AGN 193109 and AGN 191183.

Fig. 11 schematically illustrates the mechanism by which AGN 193109 can enhance the activity of RAR and other members of the nuclear receptor family; As illustrated in the graph, introduced RARs (open rectangles having AB-C-DEF domains) increased sensitivity to RAR ligands in the anti-AP1 assay, because negatively co-activating protein (ncp), present in a limited amount, is masked on RAR, giving rise to two populations : RAR + ncp and RAR-ncp. RAR-ncp increases sensitivity to ligands. Non-RAR nuclear factors (shaded rectangles having AB-C-DEF domains) increased sensitivity to native ligands because ncp was masked for RAR by AGN 193109 activity. Modular nuclear receptor domains are named according to the standard nomenclature as "AB" (transactivation domain) independent of ligand), "C" (DNA binding domain) and "DEF" (transactivation domain regulated by ligand and dimerization domain).

Fig. 12 is a line graph showing the effect of AGN 193109 on dose response of 1,25-dihydroxyvitamin D3 in CV-1 cells transfected with reporter plasmid fviT'V-DR3-Luc. Transfectants were treated with 1,25-dihydroxyvitamin D3 (full square), 1,25-dihydroxyvitamin D3 and 10 '8 M AGN 193109 (full triangles) and 1,25-dihydroxyvitamin D3 and 10 M AGN 193109 (full circles).

Fig. 13 is a bar graph showing the effect of AGN 193109 (10 nM) co-administration on 1,25-dihydroxyvitamin D3 mediated inhibition of TPA-induced Str-AP1-CAT activity. Solid bars represent inhibition of CAT activity in transfected cells treated with 1,25-dihydroxyvitamin D3 alone. Open bars represent

188 705 inhibition of CAT activity in transfected cells treated with a combination of 1,25-dihydroxyvitamin D 3 and AGN 193109.

Fig. 14 is a line graph showing the effect of AGN 193109 alone and in combination with AGN 191183 on HeLa cells co-transfected with RAR-γ and the corresponding RAR reporter construct MTV-TREp-Luc. The drug treatments illustrated in the graph are: AGN 193109 alone (square), AGN 193109 in combination with AGN 191183 at 10 '10 M (rhombus) and AGN 193109 in combination with AGN 191183 at 109 M.

Fig. 15 is a line graph showing that ECE16-1 cells proliferate in response to EGF (full square) but not in response to the defined medium alone (open circle). Cells treated alone. AGN 193109 are represented by a full triangle. The filled circles represent the results obtained for cells treated with 10 nM AGN 191183 and 0-1000 nM AGN 193109.

Fig. 16 is a bar graph showing the effect of AGN 193109 on the propagation of CaSki cells in the presence or absence of the AGN 191183 retinoid agonist. All sample groups were 20 ng / ml epidermal growth factor (EGF) except for the sample propagated in defined medium (DMI) (open bar ). Striped bars represent samples propagated in the absence of AGN 193109 ligands. Solid bars represent samples propagated in the presence of 1000 nM AGN 193109.

AGN 191183 concentrations used in the procedure are shown on the horizontal axis.

Fig. 17 is a dose response curve showing that AGN 193109 enhanced ATRA antiproliferative activity on retinal pigment epithelium (RPE) cells. Samples treated with ATRA alone are represented by full squares. Samples treated with the combination of ATRA and AGN 193109 (10 '7 M) represent full circles. The ATRA concentration used to treat the different samples is shown on the horizontal axis.

Fig. 18 is a dose response curve showing that 13-cis-RA and ATRA inhibited the growth of RPE cells, and that AGN 193109 enhanced the antiproliferative activity of 13-cisRA. Treatment of different samples shown as dose responses include 13-cisRA (full square) alone, 13-cis-RA in combination with AGN 193109 (10 '7 M) (full circle), 13-cisRA in combination with AGN 193109 (10 '8 M) (full triangle), and ATRA (full diamond). The 13cis-RA and ATRA concentrations used to treat the different samples are shown on the horizontal axis.

Fig. 19 is a dose response creature showing that AGN 193109 enhanced the antiproliferative activity of dexamethasone in primary RPE cell cultures. Treatment of different samples shown as dose responses include ATRA (full square), dexamethasone alone (full circle), dexamethasone in combination with AGN 193109 (10s M) (full triangle), and dexamethasone in combination with AGN 193109 (106 M) (full diamond). Dexamethasone and ATRA concentrations used to treat the samples are shown on the horizontal axis.

Fig. 20 is a dose response curve showing that AGN 193109 potentiated the antiproliferative activity of thyroid hormone (T3) in primary rpE cell cultures.

Treatment of different samples shown as dose responses include ATRA (full square), T3 alone (full circle), T3 in combination with AGN 193109 (10 '8 M) (full triangle), T3 in combination with AGN 193109 (10M) (full diamond). The T3 and ATRA concentrations used to treat the samples are shown on the horizontal axis.

For the purposes of the present invention, an RAR antagonist is defined as a chemical compound that binds one or more RAR subtypes to Kd less than 1 pM (Kd <1 pM) but does not cause significant transcriptional activation of RAR subtype regulated genes in receptor co-transfection assay. Conventionally, antagonists are chemicals that inhibit agonist activity. Thus, receptor antagonist activity is conventionally measured by its ability to inhibit agonist activity.

A RAR agonist is defined as a chemical compound that binds one or more RAR receptor subtypes to a Kd of less than 1 pM (Kd <1 pM) and causes tra? Y> <^; yjn activation of RAR subtype regulated genes in receptor co-transfection assay . The term "RAR agonist" includes chemical compounds that can bind and / or activate other receptors besides RAR, e.g. RXR receptors.

188 705

As used herein, a negative hormone or inverse agonist is a receptor ligand that causes the receptor to be inactive against a ground state in the absence of ligands. Thus, while an antagonist may inhibit agonist activity, the negative hormone is a ligand that can alter receptor conformation in the absence of agonist ligands. The idea of a negative hormone or inverse agonist was investigated by Bond et al. in Nature 374: 272 (1995). More specifically, Bond et al. they proposed that the ligandless [T-adrenoceptor exists in equilibrium between the inactive conformation and the spontaneously active conformation. The agonist is expected to stabilize the receptor in active conformation. Inverse agonists, in turn, are expected to stabilize inactive receptor conformation. Thus, although the antagonist manifests activity by inhibiting the agonist, the negative hormone can additionally manifest activity in the absence of agonist ligands by inhibiting the spontaneous conversion of the ligandless receptor into an active conformation. Only part of the antagonists will act as negative hormones. As described here, AGN 193109 is an antagonist and a negative hormone. To date, no negative hormone activity of other retinoids has been demonstrated.

As used herein, the term "co-administration" of two pharmacologically active compounds refers to the administration of two separate chemical entities, in vitro or in vivo. Co-administration refers to the simultaneous administration of separate agents, to the simultaneous administration of a mixture of agents as well as to the administration of one agent followed by another. In all cases, the co-applied measures are to cooperate.

The compounds of the invention may be administered in the form of a pharmaceutically acceptable salt if the compound has functional groups capable of forming a salt, e.g. an acid group. A pharmaceutically acceptable salt is any salt that retains the activity of the parent compound and does not harm or adversely affect the patient to whom such salt is administered for specific reasons.

Pharmaceutically acceptable salts may be derived from organic or inorganic bases. Salt may contain mono or polyvalent ion. Of particular interest are inorganic ions of sodium, potassium, calcium and magnesium. Organic salts can be prepared with amines, especially with mono-, di- and trialkylamines or ethanolamines. Salts can also be formed with caffeine, tromethamine and similar molecules. When sufficiently basic nitrogen is present to be able to form acid addition salts, they can be prepared with any inorganic or organic acids or an alkylating agent such as methyl iodide. Preferred salts are prepared with inorganic acids such as hydrochloric acid, sulfuric acid or phosphoric acid. Any of many simple organic acids such as mono-, di- or tri-acids can also be used.

Some compounds of the present invention may have trans and cis [E and Z] isomers. In addition, the compounds of the present invention may contain one or more chiral centers, and thus may exist in enantiomeric and diastereomeric forms. The scope of the present invention is intended to include all such isomers as such, as well as mixtures of cis and trans isomers, mixtures of diastereomers and racemic mixtures of enantiomers (optical isomers). In the present application, when the specific configuration (cis, trans or R or S) of the compound (or asymmetric carbon atom) is not referred to, is meant a mixture of such isomers, or one of the isomers.

The most preferred compounds of the present invention are shown in Table 1 with references to formulas 2, 3, 4, 5 and 5 a.

Formula 2

Formula 3 and i88 705

Pattern 4 Pattern 5

Formula 5a

Table 1

<td>Relationship</td><td>Pictured:</td><td>R.4.</td><td>FROM</td><td>r2*</td><td>r8*</td>

<td> 1</td><td> 2</td><td>4-methylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td>1a</td><td> 2</td><td>phenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 2</td><td> 2</td><td>3-methylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 3</td><td> 2</td><td>2-methylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 4</td><td> 2</td><td>3,5-dimethylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 5</td><td> 2</td><td>4-ethylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 6</td><td> 2</td><td>4-t-butylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 7</td><td> 2</td><td>4-chlorophenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 8</td><td> 2</td><td>4-methoxyphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 9</td><td> 2</td><td>4-trifluoromethylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td>i0</td><td> 2</td><td>2-pyridyl</td><td>CC-</td><td>H</td><td>et</td>

<td>ii</td><td> 2</td><td>3-pyridyl</td><td>CC-</td><td>H</td><td>et</td>

<td>i2</td><td> 2</td><td>2-methyl-5-pyridyl</td><td>CC-</td><td>H</td><td>et</td>

<td>i3</td><td> 2</td><td>3-hydroxyphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 14</td><td> 2</td><td>4-hydroxyphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 15</td><td> 2</td><td>5-methyl-2-thiazolyl</td><td>CC-</td><td>H</td><td>et</td>

188 705 c. Table 1

<td>15a</td><td> 2</td><td>2-thiazolyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 16</td><td> 2</td><td>4-methyl-2-thiazolyl</td><td>OC-</td><td>H</td><td>et</td>

<td> 17</td><td> 2</td><td>4,5-dimethyl-2-thiazolyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 18</td><td> 2</td><td>2-methyl-5-pyridyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 19</td><td> 2</td><td>2-pyridyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 20</td><td> 2</td><td>3-methylphenyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 21</td><td> 2</td><td>4-ethylphenyl</td><td>OC-</td><td>H</td><td>H</td>

<td> 22</td><td> 2</td><td>4-methoxyphenyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 23</td><td> 2</td><td>4-trifluoromethylphenyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 24</td><td> 2</td><td>3,5-dimethylphenyl</td><td>CC-</td><td>h</td><td>H</td>

<td> 25</td><td> 2</td><td>4-chlorophenyl</td><td>OC-</td><td>H</td><td>H</td>

<td> 26</td><td> 2</td><td>3-pyridyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 27</td><td> 2</td><td>2-methylphenyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 28</td><td>2 FROM.</td><td>3-hydroxyphenyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 29</td><td> 2</td><td>4-hydroxyphenyl</td><td>OC-</td><td>H</td><td>H</td>

<td> 30</td><td> 2</td><td>5-methyl-2-thiazolyl</td><td>CC-</td><td>H</td><td>H</td>

<td>30a</td><td> 2</td><td>2-thiazolyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 31</td><td> 2</td><td>4-methyl-2-thiazolyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 32</td><td> 2</td><td>4,5-dimethyl-2-thiazolyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 33</td><td> 2</td><td>5-methyl-2-thienyl</td><td>CC-</td><td>H</td><td>et</td>

<td>33a</td><td> 2</td><td>2-thienyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 34</td><td> 2</td><td>5-methyl-2-thienyl</td><td>CC-</td><td>H</td><td>H</td>

<td>34a</td><td> 2</td><td>2-thienyl</td><td>CC-</td><td>H</td><td>H</td>

<td> 35</td><td> 2</td><td>4-methylphenyl</td><td>-CONH-</td><td>H</td><td>et</td>

<td> 36</td><td> 2</td><td>4-methylphenyl</td><td>-CONH-</td><td>H</td><td>H</td>

<td> 37</td><td> 2</td><td>4-methylphenyl</td><td>COO</td><td>H</td><td>et</td>

<td> 38</td><td> 2</td><td>4-methylphenyl</td><td>COO</td><td>H</td><td>(CH2)2si (CH)</td>

<td> 39</td><td> 2</td><td>4-methylphenyl</td><td>COO</td><td>H</td><td>H</td>

<td> 40</td><td> 2</td><td>4-methylphenyl</td><td>-CONH-</td><td>F</td><td>et</td>

<td> 41</td><td> 2</td><td>4-methylphenyl</td><td>-CONH</td><td>F</td><td>H</td>

<td> 42</td><td> 2</td><td>4-methylphenyl</td><td>-CSNH-</td><td>H</td><td>et</td>

<td> 43</td><td> 2</td><td>4-methylphenyl</td><td>-CSNH-</td><td>H</td><td>H</td>

<td> 44</td><td> 2</td><td>4-methylphenyl</td><td>-CH = CH-</td><td>H</td><td>et</td>

<td> 45</td><td> 2</td><td>4-methylphenyl</td><td>-CH = CH-</td><td>H</td><td>H</td>

188 705 cd of table 1

<td>46a</td><td> 2</td><td>4-methylphenyl</td><td>-N = N-</td><td>H</td><td>et</td>

<td>46b</td><td> 2</td><td>4-methylphenyl</td><td>-N = N-</td><td>H</td><td>H</td>

<td> 47</td><td> 3</td><td>4-methylphenyl</td><td>-C = C-</td><td>H</td><td>et</td>

<td> 48</td><td> 3</td><td>4-methylphenyl</td><td>-C = C-</td><td>H</td><td>H</td>

<td> 49</td><td> 4</td><td>4-methylphenyl</td><td>CC-</td><td>H</td><td>et</td>

<td> 50</td><td> 4</td><td>4-methylphenyl</td><td>c ^ c-</td><td>H</td><td>H</td>

<td> 51</td><td> 5</td><td>4-methylphenyl</td><td> -</td><td> -</td><td>et</td>

<td> 52</td><td> 5</td><td>4-methylphenyl</td><td> -</td><td> -</td><td>H</td>

<td> 60</td><td> 2</td><td>4-methylphenyl</td><td>-C = C-</td><td>H</td><td>H</td>

<td>60a</td><td> 2</td><td>phenyl</td><td>-C = C-</td><td>H</td><td>H</td>

<td> 61</td><td> 2</td><td>4-t-butylphenyl</td><td>-C = C-</td><td>H</td><td>H</td>

<td> 62</td><td> 2</td><td>4-methylphenyl</td><td>-cssnh</td><td>F</td><td>et</td>

<td> 63</td><td> 2</td><td>4-methylphenyl</td><td>-CSNH-</td><td>F</td><td>H</td>

<td> 64</td><td>5a</td><td>4-methylphenyl</td><td> -</td><td> -</td><td>et</td>

<td> 65</td><td>5a</td><td>4-methylphenyl</td><td> -</td><td> -</td><td>H</td>

<td> 66</td><td> 2</td><td>2-furyl</td><td>-CsC-</td><td>H</td><td>et</td>

<td> 67</td><td> 2</td><td>2-furyl</td><td>-C = C-</td><td>H</td><td>H</td>

As mentioned above, the compounds of the present invention are antagonists of one or more RAR receptor subtypes. This means that the compounds of the invention bind to one or more RAR receptor subtypes, but do not trigger an agonist-activated response of the same receptors. Some compounds of the present invention are antagonists of all three RAR receptor subtypes (RAR-α, RAR-β and RAR-γ, and are called "general RAR antagonists"). Other compounds are antagonists of only one or two RAR receptor pydtzkas, while some compounds of the invention are partial agonists of one or two RAR receptor subtypes and antagonists of the other subtypes. The compounds of the invention do not bind to RXR receptors and are therefore not RXR agonists or antagonists.

Depending on the place and nature of any side effects that need to be suppressed or mitigated, the compounds of the invention are used, which can be antagonists of only one or two RAR receptor subtypes. Some compounds of the invention may be partial agonists of one or two RAR receptor subtypes and antagonists of the other subtypes. Such bindings are generally useful if the antagonistic effect is against this subtype (or subtypes) of the RAR receptor which is (are) mainly responsible for poisoning with overdose or for undesirable side effects. In this connection, it should be noted that, generally speaking, a compound is considered an antagonist of a given receptor subtype if the compound does not cause significant transcriptional activation of the receptor-regulated reporter gene in the below described co-transfection assays, but nevertheless binds to the receptor with a Kd value less than about 1 μΜ.

The study of equilibrium as an RAR antagonist and the possibility of its use in accordance with the present invention can be carried out in the following tests.

An attempt to transactivate a chimeric receptor that tests agonist-like activity for the RAR-α, RAR-β, RAR-γ, RKR-α receptor subtypes, based on the work of quinnine by Feigner PL and Holm M., Focus volume 11, No. 2 (1989) is described in detail

188 705 in PCT Application No. WO94 / 17796, published August 18, 1994. This publication corresponds to US Patent Application No. 08/016404, filed February 11, 1993, for which US Patent No. 5,455265 was granted. The compound should not cause significant activation of the reporter gene by a given subtype. receptor (RAR-a, RAR-β or RAR-γ) in this assay to qualify as a RaR antagonist useful in the present invention.

A holoreceptor transactivation assay and a ligand binding assay measuring similar to the antagonist / agonist activity of the compounds of the invention, or their ability to bind to several retinoid receptor subtypes, respectively, is described in PCT Application No. WO93 / 11755 (particularly on pp. 30 - 33 and 37 - 41) published on June 24, 1993. The attempt to transactivate the holoreceptor is also described below.

Attempt to transactivate the holoreceptor

CV1 cells (5000 cells / well) were transfected with the MTV-TREp-LUC RAR reporter plasmid (50 ng) along with one of the RAR expression vectors (10 ng) in an automated 96 well system by the method of Heyman et al., Cell 68: 397-406. For RXR-α and rXr ^ transactivation assays, the RXR responsible reporter plasmid CRBPII-tk-LUC (50 ng) was used together with the corresponding RXR expression vectors (10 ng) exactly as described by Heyman et al. above, and Allegretta et al. J. Biol. Chem. 268: 26625-26633. For RXR-O transactivation assays, the RXR responsible reporter plasmid CPRE-tk-LUC (50 mg) was used together with the RXR-p expression vector (10 mg) as described above. These reporters contain DRI elements from human CRBPII and some DRI elements from the promoter, respectively (see Mangelsdorf et al. The Retinoids: Biology, Chemistry and Medicine, pp. 319-349, Raven Press Ltd., New York and Heyman et al., cited above). As internal control in transfection, β-galactosidase expression vector (50 ng) was used to normalize deviations in transfection efficiency. Cells were transfected in three samples for 6 hours, then incubated with retinoids for 36 hours and the extracts tested for luciferase and β-galactosidase activity. Heyman et al., Supra, and Allegrett et al., Described the detailed experimental procedure for holoreceptor transactivation. cited above. The results obtained in this assay and in the transactivation assay of the chimeric receptor are expressed as EC50 numbers. The results of the ligand binding assay are expressed in Kd numbers. See Cheng et al. Biochemical Pharmacology 22: 3099-3108.

The compound should not cause significant activation of the reporter gene by a given receptor subtype (RAR-a, RAR-β or RAR-γ) in an attempt to transactivate a holoreceptor so that it can be qualified as an RAR antagonist useful in the present invention. Finally, the compound should bind to at least one of the RAR receptor subtypes in a ligand binding assay with a Kd of less than about 1 pM (Kd <1 pM) so that it can act as an antagonist of the bound receptor subtype if the same receptor subtype is not significantly activated by relationship.

Table 2 below shows the results of the holoreceptor transactivation assay, the table shows the efficacy (percentage) of the test compound in this assay relative to the total trans retinoic acid for some exemplary compounds of the invention. Table 4 shows the results of the ligand binding assay for certain example compounds of the invention.

table2

Attempt to transactivate the holoreceptor

<td colspan="7">Compound EC50 (nanomoles)</td>

<td></td><td>RARα</td><td>RAR β</td><td>rares</td><td>RXRA</td><td>RXR β</td><td>RXRy</td>

188 705

cd of table 2

0.0 in Table 2 indicates that the compound in this study has 20% less activity (efficacy) than all trans retinoic acid

Table 3

Transactivation assay efficiency (% RA activity)

<td>Compound No.</td><td>RAR</td><td>RARP</td><td>rares</td><td>RXRA</td><td>rxr3</td><td>RXRy</td>

188 705

cd of table 3

Table 4

Ligand binding assay

<td colspan="7">Compound No. Kd (nanomoles)</td>

<td></td><td>RAR</td><td>RARP</td><td>rares</td><td>RXRA</td><td>RXRp</td><td>RXRy</td>

188 705

cd of table 4

0.0 in Table 4 indicates a value greater than 1000 nM.

As can be seen from the results of the tests summarized in Tables 2, 3 and 4, the exemplary compounds of the invention indicated therein are antagonists of the RAR receptor subtypes, but do not show affinity for the RXR receptor subtypes (other compounds of the invention may be antagonists of some, but not all, RAR receptor subtypes and agonists of other RAR subtypes). Due to such properties, the compounds of the invention can be used to block RAR agonist activity in biological assays. In mammals, including humans, the compounds of the invention may be co-administered with RAR agonists and, due to the pharmacological selectivity or local delivery specificity, preferentially prevent undesirable effects of RAR agonists. The compounds of the invention may also be used to treat vitamin A, acute or chronic overdose resulting from excessive intake of vitamin A or the consumption of liver of certain fish or animals that contain large amounts of vitamin A. In addition, the compounds of the invention may also be used to treat acute or chronic toxicity caused by a retinoid drug. It is known that the toxicity observed with hypervitaminosis A syndrome (headache, skin peeling, bone toxicity, dyslipidemia) is similar or identical to that seen with other retinoids, suggesting a common biological reason, i.e. RAR activation. Because the compounds of the present invention block RAR activation, they are useful for treating said toxicity.

The compounds of the invention can definitely prevent skin irritation induced by RAR agonist retinoids when the compound of the invention is topically administered together on the skin. Similarly, the compounds of the invention may be administered topically to the skin to block skin irritation in patients or animals treated with RAR agonist systemically. Compounds of the invention may accelerate recovery from prior retinoid toxicity, may block hypertriglyceridaemia caused by co-administered retinoids, and may block bone toxicity induced by RAR agonist (retinoid).

In general, in the therapeutic uses in the mammals of the present invention, the antagonist compounds can be administered enterally or topically as an antidote to vitamin A, the vitamin A precursor, or an antidote to retinoid toxicity resulting from overdose or too long action, after discontinuation of causative agent (vitamin A precursor) or other retinoid). Alternatively, the antagonist compounds are administered together with the retinoid drugs of the invention in situations where the retinoid has a therapeutic benefit, and where co-administered antagonists alleviate or eliminate one or more undesirable retinoid side effects. With such use, the antagonist may be administered in a site-specific manner, e.g., as a topically applied cream or lotion, while the co-administered retinoid may be administered enterally.

In the therapeutic uses of the present invention, the antagonist compounds are administered as pharmaceutical compositions in dosage forms such as tablets,

188 705 pills, capsules, solutions, suspensions, creams, ointments, gels, lotions, lotions and the like using pharmaceutically acceptable excipients and carriers known in the art. For example, the preparation of topical formulations is well described in Remington's Pharmaceutical Science, ed. 17, Mack Publishing Company, Easton, Pennsylvania. For topical use, antagonistic compounds may also be administered as a powder or aerosol, particularly an aerosol. If the drug is to be administered systemically, it may be prepared as a powder, pill, tablet or the like, or as a syrup or elixir suitable for oral administration. For intravenous or intraperitoneal administration, the antagonist is prepared as an injectable solution or suspension. In some cases it may be useful to formulate antagonists in the form of suppositories or sustained-release preparations for placement under the skin or intravenous injection.

Antagonists will be administered at a therapeutically effective dose. The therapeutic concentration is the concentration at which amelioration of a particular condition (such as toxicity due to the action of retinoid or vitamin A, or a side effect of a retinoid drug) is obtained or inhibition of its development. It should be understood that when antagonists are co-administered to block retinoid-induced toxicity or side effects, antagonists are used prophylactically to prevent the occurrence of a particular condition, such as skin irritation.

The appropriate therapeutic or prophylactic concentration will vary depending on the condition being treated and in some cases depending on the severity of the condition being treated and the patient's susceptibility to treatment. Thus, the concentration may not be useful to the individual patient and may need to be modified depending on the particular chronic or acute retinoid toxicity or related condition being treated. This concentration can be determined by an experimental route. However, it can be anticipated that for topical administration, an effective concentration will be obtained at 0.01 and 1.0 mg antagonist per ml of formulation. For systemic administration, the therapeutically effective dose may range from 0.01 to 5 mg per kg body weight.

The basis for the usefulness of RAR antagonists for preventing or treating RAR agonist-induced toxicity is competitive inhibition of RAR receptor activation by RAR agonists. The main difference between these two uses of RAR antagonists is the presence or absence of previous retinoid toxicity. Most of the examples described below relate to the use of retinoids to prevent retinoid toxicity, but the general methods described herein also apply to the treatment of prior retinoid toxicity.

Description of experiments showing the use of RAR antagonists to prevent or treat retinoid toxicity and / or side effects of retinoid drugs

Example 1: skin irritation induced by a topically administered agonist is treated with a topically applied antagonist

4 - [(E) -2- (5,6,7,8-tetrahydro-5,5,8,8-tetramethylnaphthalen-2-yl) propen-1-yl] benzoic acid, designated AGN 191183, is known as a strong RAR agonist (see, e.g., the descriptive part and Fig. 2b of U.S. Patent No. 5,324,840). (The number "AGN" is the accepted reference number used by the owner of the present invention to identify compounds.)

4 - [(5,6-dihyd! O-5,5-dimethyl-8- (phenyl) -2-naphthalenyl) ethynyl] benzoic acid (AGN 192869, also referred to as compound 60a) is a compound whose preparation is described below. This compound is an RAR antagonist.

Skin irritation induced by a RAR agonist, AGN 191183, administered topically, can be blocked by a RAR antagonist, AGN 192869, also administered topically in hairless mice.

More specifically, skin irritation was measured on a semi-quantitative scale by daily subjective evaluation of peeling and skin abrasion. One number, the assessment of local irritation, sums up the skin irritation induced by the animal during the experiment. The assessment of local irritation is calculated as follows. The assessment of local irritation is the algebraic sum of the composite assessment of peeling and the complex assessment of abrasion. Complex grades range from 0-9 and 0-8 for peeling and abrasion, respectively, and taking into account the maximum severity, time of occurrence and average severity of observed peeling and abrasion.

188 705

The sharpness of peeling is graded on a 4-point scale, and the sharpness of abrasion on a 4-point scale, with a higher rating means greater sharpness. The component of the composite assessment with respect to the maximum severity of the condition being assessed is the highest daily sharpness rating assigned to the animal during observation.

For the component of the composite assessment in relation to the time of onset of the lesion, a rating from 0 to 4 is assigned as follows:

Table 5

Time to peeling or abrasion with a sharpness of 2 or higher

<td>Days</td><td>Evaluation of the time until the change occurs</td>

The component of the composite grade for average sharpness is the sum of the scores of daily peeling or abrasion divided by the number of days of observation. The first day of treatment is not counted because the compound could not work during the first application.

To calculate the composite assessment of peeling and abrasion, the average sharpness ratings are added and until the change occurs and divided by 2. The result is added to the maximum sharpness rating. Complex peeling and abrasion assessments are then added together to give an overall assessment of local irritation. Each animal receives a local irritation score and the values are expressed as mean ± standard deviation of individual scores for the group of animals. The values are rounded to the nearest whole number.

Female hairless mice [CrI: SKH1-hrBR] (8-12 weeks, n = 6) were treated topically for 5 consecutive days with acetone, AGN 191183, AGN 192869 or some combination of AGN 192869 and 191183. The doses of the respective compounds are given in Table 6. dermal skin is applied compounds in a total volume of 4 ml / kg (~ 0.1 ml). Mice were observed daily and evaluated for peeling and abrasion up to and including 3 days after the last treatment, i.e. for 8 days.

Table 6

Plan and results of the experiment, example 1

<td>Group</td><td>AGN 191183 (mg / kg per day)</td><td>AGN 192869 (mg / kg per day)</td><td>Molar ratio 192869: 191183</td><td>Assessment of local irritation</td>

The local irritation ratings of Example 1 are given in Table 6. Neither acetone (carrier) nor AGN 192869 (antagonist) at 1.5 mg / kg daily (Group F) caused visible local irritation. AGN 191183, an rAr agonist, caused moderate local irritation at a dose of 0.025 mg / kg per day. However, AGN-induced i88 705 i9 i9ii83 local irritation was inhibited in a dose-dependent manner by AGN i92869, with almost complete elimination of irritation in the presence of a 50-fold molar excess of AGN i92869. This demonstrates that the local RAR antagonist blocks skin irritation caused by the local RAR agonist. Complete blockade of RAR agonist-induced skin irritation can be achieved at lower antagonist to agonist molar ratios when RAR antagonists are strong, such as 4 - [(5,6-dihydro-5,5-dimethyl8- (4-methylphenyl) -2- naphthalenyl) ethynyl] benzoic acid (AGN i93i09, also referred to herein as compound 60).

Example 2: skin irritation induced by an orally administered agonist is blocked by a topically applied antagonist

In this example, a strong RAR agonist, AGN i9ii83 (4 - [(E) -2 (5,6,7,8-tetrahydro-5,5,8,8-tetraethylnaphthalen-2-yl) propen-i-yl was used ] -benzoic acid) and a strong RAR antagonist, 4- | (5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) ethynyl] benzoic acid (AGN i93i09, compound 60), and the body weights of the experimental animals (mice) were a marker of systemic RAR agonist activity.

Groups of female hairless mice (8-and 2 weeks, n = 6) were treated by gastric intubation with corn oil or AGN i9ii83 (0.26 mg / kg) suspended in corn oil (5 ml / kg). The mice were simultaneously treated topically on the dorsal skin with vehicle (97.6% acetone / 2.4% dimethyl sulfoxide) or AGN i93i09 solutions in vehicle (6 ml / kg). Specific doses for the various treatment groups are given in Table 7. The agents were administered daily for 4 consecutive days. Mice were weighed and evaluated for local irritation daily as described in the example and up to and including the day after the last treatment. The percentage change in body weight was calculated by subtracting the final body weight (day 5) from the initial body weight (day i), dividing by the initial body weight and multiplying by i00%. Assessments of local irritation were established as described in Example 1.

Assessments of local irritation and weight loss for various groups are given in Table 7. The combined topical treatment and oral administration of carriers, i.e. acetone and corn oil, respectively, did not cause local irritation or weight loss. Similarly, combined oral administration of the vehicle and treatment with a local AGN antagonist i93i09 did not cause local irritation or weight loss. Orally administered AGN i9ii83 caused significant weight loss and skin irritation. Skin irritation caused by AGN i9ii83 decreased significantly in combination with the lower dose of AGN i93i09 and completely disappeared at the higher dose of AGN i93i09. AGN i9ii83-induced weight loss also disappeared in a dose-dependent manner with topical AGN i93i09 treatment, but blocking was not complete. Thus, locally administered AGN i93i09 preferentially blocked the cutaneous toxicity of AGN i9ii83. Probably small amounts of AGN i93i09 were absorbed systemically, thus partially blocking the weight loss induced by AGN i9ii83. However, such absorption will probably be even lower in species with less permeable skin such as humans. Alternatively, the inhibition of AGN i93i09 weight loss could be due to the relief of AGN-induced i9ii83 skin irritation.

Table 7

Plan and results of the experiment, example 2

<td>Group</td><td>Local dose AGN 193109 (mg / kg per day)</td><td>Dose of oral AGN 191183 (mg / kg per day)</td><td>% mass decrease (increase)</td><td>Assessment of local irritation</td>

188 705

Thus, Example 2 shows that topically administered RAR antagonists can be used to block preferentially the skin irritation induced by an orally administered RAR agonist.

Example 3: Topically administered antagonist accelerates recovery from retinoid toxicity

In this example, weight loss is induced by topical treatment with the RAR AGN 191183 agonist, and then the test animals are treated topically with the RAR AGN 193109 vehicle or antagonist.

Female hairless mice (8-12 weeks, n = 5) were treated topically with AGN 191183 (0.13 mg / kg per day) in vehicle (97.6% acetone / 2.4% DMSO, 4 ml / kg) daily for 2 days . Groups of the same mice (n = 5) were then treated topically with vehicle or AGN 193109 in vehicle (4 ml / kg) daily for 3 consecutive days starting on day 3. Mice were weighed on days 1-5 and on day 8. Body weights are expressed as mean ± standard deviation. The means are compared statistically using an unpaired bipolar t-test. Differences were considered significant at P <0.05.

Table 8 Results, example 3

<td>Treatment (days 3-5)</td><td colspan="6">Body weight (g)</td>

<td>carrier</td><td> 24,5±1,5</td><td> 23,9±1,2</td><td> 21,4±1,2</td><td> 20,3±1,7</td><td> 21,0±1,4</td><td> 24,7±1,0</td>

The weight changes in Example 3 are given in Table 8. Body weights in both groups of mice decreased in parallel on days 2 and 3 as a result of AGN 191183 treatment on days 1 and 2. Body weights in the two groups were not significantly different on days 1, 2 , or 3. However, AGN 193109 treatment significantly increased body weight compared to vehicle treatment on Days 4 and 5. These data indicate that recovery from AGN 191183 induced weight loss accelerated AGN 193109 treatment. Body weights were not significantly different between the two groups of mice on day 8, indicating full recovery attained in both groups after sufficient time. Thus, RAR antagonists are effective in alleviating RAR agonist-induced toxicity even if the RAR agonist-induced toxicity precedes RAR antagonist treatment, that is, in the RAR agonist poisoning scenario.

Example 4: An orally administered antagonist blocks hypertriglyceridemia induced by an orally co-administered retinoid agonist

5 - [(E) -2- (5,6,7,8-tetrahydro-3,5,5,8,8-pentamethylnaphthalen-2-yl) propen-1-yl] -2-thiophenecarboxylic acid is a known RAR pantagonist / RKR (see U.S. Patent No. 5,324,840 column 32) and is designated AGN 191659. This compound was used orally to induce acute hypenriglyceridemia in rats, and AGN 193109 (compound 60) was co-administered orally to block AGN 191659-induced hypertriglyceridemia.

Male Fischer rats (6-7 weeks, n = 5) were treated by gastric intubation with corn oil (carrier), AGN 191659, AGN 193109 or a combination of AGN 191659 and AGN 193109. AGN 191659 and AGN 193109 were administered as a subtle suspension in corn oil. The experimental design, including doses, is given in Table 9.

Blood was drawn from the inferior vena cava under carbon dioxide anesthesia. The serum was separated from the blood by slow centrifugation. Total serum triglycerides (triglycerides plus glycerin) were measured in a standard endpoint spectrophotometric assay in a commercially available kit and adapted to a 96-well system. Serum triglyceride levels are expressed as mean ± standard deviation.

188 705

The means were compared statistically by one-way analysis of variance followed by Dunnett's test if significant differences were found. The differences were considered significant at P <0.05.

As shown in Table 9, AGN 191659 alone caused a significant increase in serum triglyceride levels relative to vehicle treatment. AGN 193109 alone did not significantly increase serum triglyceride levels. '' It is important that the combination of AGN 193109 and AGN 191659 at 1: 1 and 5: 1 molar ratios reduced serum pyroglycerides to values not significantly different from those of the nervous system.

Table 10

Plan and results of the experiment, example 4

<td>Group</td><td>Treatment (dose)</td><td>Serum triglycerides (mg / dl)</td>

<td>AND</td><td>carrier</td><td> 55,0 ± 3,1</td>

Example 4: shows that the RAR antagonist can be used to block hypoglyceride glycol induced by co-welded retinoids.

Example 5: A parenterally administered antagonist blocks bone toxicity induced by a parenteral co-parent ^^ l ^^^ and ^ idon agonist

Example 5: shows that an RAR antagonist can block bone toxicity induced by an RAR agonist. In this example, AGN 193109 is used to block premature closure of the epiphyseal plaque caused by the co-underlying RAR agonist, AGN 191183, in guinea pigs.

Groups of male Hartley guinea pigs (~ 3 weeks, n = 4) received an intraperitoneal implantation of osmotic pumps containing a carrier (20% drmethylsulphoxide / 80% poly (300-cetylene glycyl), AGN 191183 (0.06 mg / ml), or AGN 191183 (0.06 mg / ml) in combination with AGN 193109 (0.34 mg / ml) Osmotic pumps deliver, according to the manufacturer, ~ 5 μΐ solution per hour continuously for 14 days.

Animals were sacrificed with carbon dioxide 14 days after implantation. The left tibia was removed and placed in 10% buffered formalin. Tibia were decalcified with formic acid / formalin solution for 3-4 days and paraffin sections were made. The sections were stained with bkmatoxylin and enzine by standard methods. The close tibial epiphyseal plate was examined and rated as closed or unclosed. Epiphyseal closure is defined for this purpose as any interruption in the cartilage continuity of the epiphyseal plaque growth, i.e. replacement by bone and / or fibroblast tissue.

None of the four vehicle-treated guinea pigs showed closure of the epiphyseal plate before the end of the experiment. This was expected because the close guinea pig epiphyseal plate usually does not close before reaching the age of at least 10 months. All four AGN 191183 treated guinea pigs showed partial or complete closure of the epiphyseal plate. However, none of the guinea pigs with the aggregation of AGN 191183 and AGN 193109 showed closure of the epiphyseal plate. Thus, AGN 193109 in a 5-fold molar excess completely blocks AGN 191183-induced bone toxicity when these parenteral co-parent compounds.

RAR antagonists

4 - [(5,6-dihydro-5,5-dimethyl-B- (4-methylphenyl) ^ -naphthylenyl) cisyl] benzoic acid (AGN 193109, compound 60) and d-^-dihydro-S ^ - dimethyl ^ -phenoxyl-naphthalene-ethynyl] -benzoate (AGN 192869, compound 60a) are examples of RAR antagonists,

188 705 which were used in the animal tests described above to block RAR receptors according to the present invention.

Exemplary RAR antagonists of Formula 1 can be prepared by the methods of chemical synthesis illustrated herein.

Reaction scheme 1

pTsOH

Δ v

k2What3

MeOH v

Formula 9

Formula 16

Reaction Scheme 1 illustrates the synthesis of compounds of formula Ia, where the Z group is an ethynyl group (-OC-) and X is [C (Ri) 2]n where n is 1. In other words, reaction scheme 1 illustrates the synthesis of ethynyl substituted dihydronaphthalene derivatives of the present

188 705 of the invention. According to this scheme, tetrahydronaphthalene-1-one compound of formula 6 is brominated to give the bromine derivative of formula 7. Compounds of formula 6 already contain the desired substituents R1, R2 and R3 as defined in the compound of formula la. A preferred example of a compound of formula 6 is 3,4-dihydro-4,4-dimethyl-1 (2H) -naitalenone, described in the chemical literature (Arnold et al. J. Am. Chem. Soc. 69: 2322 - 2325 (1947 )). The preferred route for the synthesis of the compound from 3-bromo-3-phenylpropane is also described in the experimental section of the present application.

Compounds of formula 7 are then reacted with (tr ^ im ^ t ^ t ^! 1-))silyl) acetylene to give (trimethylsilyl) -ethynyl-substituted 3,4-dihyd ^^ to: P ^ and ^] ^ 1 ^] ^ - 1 (2H) -one compounds of formula 8. The reaction with (trimethylsilyl) acetylene is carried out usually with heating (about 100 ° C) in the presence of cuprous iodide, a suitable catalyst, typically having the formula Pd (PPh3) 2Cl2, an acid acceptor (such as triethylamine) under an inert gas (argon) atmosphere. Typical reaction time is about 24 hours. The (thnmetic) silyl) ethynyl substituted 3,4-dihydronaphthalen-1 (2H) -one of formula 8 is then reacted with a base (potassium hydroxide or potassium carbonate) in an alcoholic solvent such as methanol to give ethynyl-substituted 3, 4-dihydro-1-naphthalen-1 (2H) ones of formula 9. Compounds of formula 9 are then coupled to an aromatic or heteroaromatous reagent Xj-Y (R2) -AB '(formula 10) in the presence of cuprous iodide, a suitable catalyst, typically Pd (Pph3) 2Cl2, an acid acceptor such as triethylamine, under an atmosphere of gas inert (argon). Alternatively, the zinc salt (or other suitable metal salt) of compounds of Formula 9 can be coupled with reagents of Formula 70 in the presence of Pd (PPh);)) or a similar complex. Typically, the coupling reaction with the reagent Xt-Y (R2) -AB '(formula 10) is carried out at room temperature or slightly elevated. Generally, the coupling between the ethinylaryl derivative or its zinc salt and a substituted halogen or heteroatyl compound such as the reagent of formula 10 is described in US Patent No. 5,284,456. Compounds of formula 11 are precursors of exemplary compounds of the invention, or derivatives thereof protected on group B ', from which the protecting group can be easily removed by well-known reactions. Compounds of formula 11 can also be converted into further precursors of exemplary compounds in such reactions and transformations that are well known. Such reactions are shown in reaction scheme 1 by conversion into "homologues and derivatives". One such conversion used to synthesize several examples of compounds is the saponification of an ester group (when B or B 'is an ester) to give free carboxytic acid or its salts.

The halogen-substituted aryl or heteroaryl compound of formula 10 can generally be obtained by well-known reactions. An example of such a compound is ethyl 4-iodobenzoate, which can be obtained, e.g., by esterification of 4-iodobenzoic acid. Another example is ethyl 6-iodonicotinate, which can be obtained by conducting a halogen exchange reaction of 6-nicotinic acid, followed by esterification. For the derivatization of compounds of formula 11 and / or the synthesis of aryl and heteroaryy compounds of formula 10, which can then be reacted with compounds of formula 9, the following well-known and published general principles and methodology for synthesis can be used7.

Karric acid (o ^ i ^ y ^ yl ^^^ v ^7 typically esterified by heating to boiling the acid in a solution of the appropriate alcohol in the presence of an acid catalyst such as hydrogen chloride or thionyl chloride. Alternatively, the carboxylic acid can be condensed with the appropriate alcohol in the presence of dicyclohexylcarbodiimide and dimethylaminopyridine. The ester is recovered and purified in a conventional manner. Acetals and ketals are easily prepared by the method described by March, Advanced Organic Chemistry, ed. 2, McGraw-Hill Book Company, p. 810). Alcohols, aldehydes and ketones can all be protected by the formation of ethers and esters, acetals or ketals, respectively, by known methods such as those described in McOmie, Plenum Publishing Press, 1973 and Pn otecting Groups, ed. Greene, John Wiley & Sons, 1981.

To increase the n value in compounds of Formula 10 prior to performing the coupling reaction in Scheme 1 (where such compounds corresponding to Formula 30 are not commercially available), aromatic or heteroaromatic carboxylic acids are approved by subsequent treatment under Arndt-Eistert conditions or other approval procedures. Alternatively, non-carboxylic acid derivatives can also be homologated

188 705 appropriate procedures. Approved acids may then be esterified by the general procedures in the previous paragraph.

Compounds of formula 10, (or other intermediates or exemplary compounds) wherein A is an alkenyl group having one or more double bonds, can be prepared, e.g., in synthetic schemes well known to the organist; e.g. in Wittig reaction and similar reactions, or by introducing a double bond by halogen elimination by alpha-halogen-arylalkyl carboxylic acid, an ester or similar carboxaldehyde. Compounds of formula 10 (or other intermediates or exemplary compounds) where group A contains a triple (acetylene) bond, can be prepared by reacting the appropriate aromatic methyl ketone with a strong base, such as lithium diisopropylamide, with diethyl chlorophosphate followed by the addition of lithium diisopropylamide.

Acids and salts of compounds of Formula 11 (or other intermediates or examples) can readily be obtained from the corresponding esters. Basic saponification with an alkali metal base will give acid. For example, an ester of formula 11 (or other intermediates or examples) can be dissolved in a polar solvent such as an alkanol, preferably in an inert atmosphere at room temperature, with about a triple molar excess of base, e.g., lithium hydroxide or potassium hydroxide. The solution is stirred for a long time between 15 and 20 hours, cooled, acidified and the hydrolyzate recovered in a conventional manner.

The amide can be prepared by any suitable amination process from the corresponding esters or carboxylic acids. One way to prepare such compounds is to convert the acid to acid chloride and then treat the compound with ammonium hydroxide or a suitable amine.

Alcohols are made by converting the corresponding acids into acid chloride with thionyl chloride or other means (J. March, Advanced Organic Chemistry, 2nd edition, McGraw-Hill Book Company), then reducing the acid chlorides with sodium borohydride (March, Ibid., P. 1124) , obtaining the appropriate alcohols. Alternatively, esters can be reduced with lithium aluminum hydride at reduced temperature. Alkylation of these alcohols with appropriate alkyl halides under Williamson reaction conditions (March, Ibid. 357) gives the corresponding ethers. These alcohols can be converted to esters by reaction with the appropriate acids in the presence of acid catalysts or dicyclohexylcarbodiimide and dimethylaminopyridine.

Aldehydes can be prepared from the corresponding primary alcohols using weak oxidizing agents such as pyridinium dichromate in methylene chloride (Corey, EJ, Schmidt, G., Tet. Lett. 399, 1979), or dimethyl sulfoxide / oxalyl chloride in methylene chloride (Omura, K. , Swern, D., Tetrahedron 34: 1651 (1978)).

Ketones can be prepared from the appropriate aldehyde by treating the aldehyde with an alkyl Grignard reagent or similar reagent followed by oxidation.

Acetals or ketals can be prepared from the corresponding aldehyde or ketone by the method of March, ibid., P. 810.

Compounds of formula 10 (or other intermediates or examples) where B is H can be prepared from the corresponding halogenated aromatic or heteroaromatic compounds, preferably when halogen is I.

Returning to reaction scheme 1, compounds of formula 11 are reacted with sodium bis (trimethylsilyl) amide and 2- [N, N-bis (trifluoromethylsulfanyl) amino] -5-chloropyridine in an inert ether solvent such as tetrahydrofuran in low temperatures [-78 ° C and 0 ° C]. This is shown in reaction scheme 1, where the usually non-isolated intermediate sodium salt is shown in brackets as formula 12. The reaction gives the trihioromethylsifonyioxy derivatives represented by formula 13. (Tf = SO2 CF3). Compounds of formula 13 are then transformed into exemplary compounds of the invention, shown by formula 14, by reaction with an organometallic derivative derived from an aryl or hetheyl; R 1 H, ^; ^ yl '' ^, so that the formula of the organometallic derivative is R ^ Met (Met is a monovalent metal), preferably RHLi. (R14 is defined as in formula 1.) The reaction with the organometallic derivative, preferably a lithium derivative of formula R ^ Li, is usually carried out in an inert ether solvent (such as tetrahydrofuran) in the presence of zinc chloride (ZnCL) and tetrads (phosphenylphosphine) palladium (O ) (Pd (PPh3) 4). The organolithium reagent R ^ Li, if not commercially available , can be prepared from compound R14H (or its halogen derivative Rpł-X1 where Χ1 is

188 705 halogen) in an ether type solvent according to known practice. The temperature range for the reaction between R 1 Li reagent and compounds of formula 13 is generally speaking in the range of about -78 ° C to 50 ° C. Compounds of formula 14 can be converted into further homologues and derivatives in the reactions discussed above.

The intermediate 7-bromo-tetrahydronaphthalen-1-one compounds of formula 7 shown in reaction scheme 1 can also be converted to a Grignard reagent of formula R ^ MgBr (R14 is defined as in formula 1) to give the tertiary alcohol of formula 15. The tertiary alcohol is dehydrated by treatment with an acid to give 3,4-dihydro-7-bromonaphthalene derivatives of formula 16, which serve as intermediates for the synthesis of additional compounds of the present invention (see reaction schemes 6 and 8).

HX

Formula 17

Reaction scheme 2

Η+/ Δ

NaNfSiMe ^^ THF / -78 ° C

Formula 25

Homologies 1 derivatives

N (Tf)2

OTf

(RA »Formula 24

Y (R)

188 705

Reaction Scheme 2 gives a route for the synthesis of compounds of formula 1 in which X is S and the group Z is ethynyl (-C ^ C-). The substrate for this reaction sequence is bromophenol of formula 17. Thus, a compound of formula 17, preferably parabromophenol, is reacted under basic conditions with 3-bromocarboxylic acid of formula 18. In this reaction scheme, the symbols have the meanings described in formula 1. An example the reagent of formula 18 in which R3 is hydrogen is 3-bromopropionic acid. Reaction with 3-bromocarboxylic acid of formula 18 gives a compound of formula 19, which is cyclized by treatment with an acid to give a 6-bromothiochroman-4-one derivative (X is S) of formula 20. Bromine compounds of formula 20 are then subjected essentially to this the reaction sequence itself under analogous conditions as described in reaction scheme 1 of the conversion of bromine compounds of formula 7 into compounds of the invention. Thus, briefly, bromine compounds of formula 20 are reacted with (trimethylsilyl) acetylene to form 6- (tπ-methylsilyl) ethynyl-basic-thiochroman-4 one or chroman-4-one of formula 21. 6- (tπ-methylsilyl) ) ethynyl-substituted thiochroman-

The 4-one compounds of formula 21 are then reacted with a base (potassium hydroxide or potassium carbonate) to give ethynyl-substituted 6-ethynyl-substituted thiochroman-4-ones of formula 22. Compounds of formula 22 are then coupled with an aromatic or heteroaromatic reagent X] -Y (R ') -AB' (formula 10) under conditions analogous to those described for analogous reactions of reaction scheme 1, to give compounds of formula 23.

Compounds of formula 23 are then further reacted under conditions analogous to similar reactions described in reaction scheme 1 with sodium bis (trimethylsilyl) amide and 2 [N, N-bis (trifluoromethylsulfonyl) amino] -5-chloropyridine to give 4-trifluoromethylsulfonyloxybenzothiopyranated or benzopyranated derivatives formula 24. Compounds of formula 24 are then transformed into compounds of formula 25 by reaction with an organometallic derivative derived from the R14H aryl or heteroaryl compound. as described in connection with reaction scheme 1.

Similarly to the use of the intermediate 7-bromo-tetrahydronaphthalen-1-one O compounds of formula 7 in Reaction Scheme 1, the intermediate fT-bromothiochroman N-one compounds of formula 20 can also be used to prepare further compounds within the scope of this invention as described below, in reaction schemes 6, 7 and 8. Compounds of formula 25 may also be converted into further homologues and derivatives in reactions analogous to those described in connection with reaction scheme 1.

188 705

Reaction scheme 3

Reaction Scheme 3 discloses a route for the synthesis of compounds of formula 1 in which X is [C (Ri) 2] n, n is 0 and the group Z is ethynyl (-CC-). According to this scheme,

The 6-bromo-2,3-dihydro-1H-inden-1-one derivative of formula 25 is subjected to a reaction sequence starting from the reaction with tn-methylsilylacetylene analogous to the reactions drunk above in connection with reaction schemes 1 and 2, to form, by compounds intermediates of formulas 27-30, indene derivatives of formula 31. In a preferred embodiment within Reaction Scheme 3, the substrate is 6-bromo-2,3-dihydrr-3,3-dimethyl - H-inden-1-one available according to with chemical literature (see Smith et al. Org. Prep. Proced. Int. 1978 10, 123-131). Compounds of formula 26, such as 6ibromo-2, -idihydro-3,3-dimethyl-1H-inden-1iOn, can also be used to synthesize further exemplary compounds for use in the present invention as described below.

i88 705

Reaction scheme 4

A1CI3/ R] COCl

2. CrO J >

HOA0 / Ac2O

R ^ MgBr

Etjo

Formula 33

Homologies and derivatives

Reaction Scheme 4 discloses the synthesis route of compounds of formula Ia, in which Z is - (CRi = CRi) n- n 'is 3 and Y is a direct bond between (CRi = CRi) n' B. This synthesis route has been described for examples, where X is [C (Ri) 2] nin is i (dihydronaphthalene derivatives).

According to reaction scheme 4, the derivative i, 2,3,4-tetrahydronaphthalene of formula 32 is reacted with acid chloride (R] COCl) under Friedel Crafts conditions, and the resulting acetylated product is oxidized, e.g. by Jones oxidation reaction, to give mixtures of isomeric 6- and 7-acetyl-and (2H) -naphthalenone derivatives of formula 33. In a particular preferred example of the reaction, the substrate of formula 32 is i, 2,3,4-tetrahydro-i, i-dimethylnaphthalene (known compound), which can be prepared according to the method described in the experimental section of this application. The 7-acetyl-and (2L) -na.italenone derivative of formula 33 is reacted with ethylene glycol in the presence of acid to protect the oxo group of the exocyclic ketone moiety to the ketal derivative of formula 34. The ketal of formula 34 is then reacted with a Grignard reagent of formula RuMgBr (the symbols are defined as in formula 1) to give the tertiary alcohol of formula 35. The dioxolane protecting group is then removed and the tertiary alcohol is dehydrated with acid to give 3,4- dihydro-7-acetylnaphthalene derivative of formula 36. The ketone group of compounds of Formula 36 is reacted by Homer Emmons (or analogous) under strongly basic conditions with a phosphonate reagent of Formula 37 to form, after reduction, aldehyde compounds of Formula 38. Yet another Homer Emmons reaction (or analogous) in strongly basic conditions with a reagent of formula 39 give compounds of formula 40. The latter can be converted into further homologues and derivatives according to the reactions described above. A specific example of a Homer Emmons reagent of formula 37 used to prepare a preferred compound is diethyl cyanomethyl phosphonate; an example of a Homer Emmons reagent of formula 39 is diethyl- (E) -3-ethoxy-1-carbonyl-2-methylallylphosphonate.

1. NaN (SiMe3)2

Reaction scheme 5

THF / -78 ° C

Formula 45

Homologies and derivatives

Formula 46

188 705

Reaction Scheme 5 illustrates the process of synthesis of compounds of formula Ia in which Z is azo (-N = N-). Thus, the nitro group is introduced into the substrate of formula 6 under essentially standard nitration conditions to give a 3,4-dihydro-7-nitro1 (2H) -naitalenone derivative of formula 41, which is reduced to 3,4-dhyhydro-7 -mino1 (2H) -naphthalene derivative of formula 42 and then reacted with a nitroso solution of formula ON-Y (R2) -AB (formula 43) under the conditions usually used (glacial acetic acid) for the production of the products. The nitrite solution of Formula 43 can be obtained by known reactions. A specific example of such a compound used to synthesize a preferred compound is ethyl 4-nitro-benzoxane. The nitrate compound of formula 44 is then reacted with sodium bisOrthylsilylthymidide and 2- [N, N-bis (trifluoromethylsulfonyl) amino] -5-cbloropropyl to give 4-trifluoromethylsulfonylonsyl derivatives represented by formula 45. Compounds of formula 45 are then transformed into the azoresin of formula 45, by reaction with an organometallic derivative derived from R14H aryl or beteroaryl compounds. These last two reactions, specifically the conversion to 4-tyifluoro-sulfonyloxyloxy derivatives and reaction with organometallic. the derivative described above in connection with reaction schemes 1, 2 and 3, and is used in several of the present preferred synthetic processes leading to exemplary RAR antagonists.

Reaction scheme 6

Homologies and derivatives

Reaction Scheme 6 illustrates the processes for the synthesis of compounds of formula Ia in which the group Z is COO- or CONH. These ester and amide derivatives are prepared from 3,4-dibydry-7-bromo derivatives of Formula 16, which can be prepared as described in reaction scheme 1. Thus, compounds of formula 16 are reacted with a strong base, such as tact-butyllithium, in an inert ether solvent such as tetisdrofuran, at low temperature, and added carbon dioxide (CO2) to give the dihydrated acid 5, 6-dibydro-2-naphtha-carboxylic acid of formula 47. Compounds of formula 47 are then reacted with compounds of formula X2-Y (R2) -AB (formula 48) where X2 represents an OH or NR1 group, R1 is preferably hydrogen. One of ordinary skill in the art will recognize that compounds of formula 48 are aryl or heteroaryl hydroxyl or amino derivatives that can be obtained by known methods. The reaction between compounds of formula 47 and 48 can be carried out under various known ester or amide forming conditions, such as coupling both in the presence of the hydrochloride salt

1- (3-dimethylaminopropyl) -3-ethylcarbodiimide and 4-dimethylaminopyridine. Alternatively, compounds of formula 47 can be converted to the corresponding acid chlorides by coupling with compounds of formula 48 in the presence of a base. Amide or ester compounds of formula 49 can be converted into further homologues and derivatives as described above.

Compounds of the present invention of formula 1a in which Z is -OCO-, NHCO, as well as the corresponding thioamide analogues, can be prepared from intermediates derived from the compound of formula 16, where the bromine substituent is replaced with an amino or hydroxyl group and as described in the patent USA No. 5324744.

Reaction scheme 8

Homologies and derivatives

Reaction scheme 8 discloses the preferred processes for the synthesis of compounds of formula 1a, in which Z is - (CR ^ CRO ^, an 'is 1. More specifically, reaction scheme 8 shows a preferred method for preparing compounds that are a derivative of dihydronaphthalene and in which the group Z is vinyl (-CH = CH-) The method described herein can, however, be extended to the analogous benzopyran, bentothiopyran, dihydric, and dihydroxy compounds and compounds in which the vinyl group is substituted. Such modifications are obvious to a specialist. Thus, according to reaction scheme 8 7-bromo-1 (2H) -naphthalenone derivative of formula 7 is reacted with a vinyl derivative of formula -Cl2= CH-Y (R2) -AB (formula 51) in the presence of a suitable catalyst, typically having formula Pd (PPh3), an acid acceptor (such as triethylamine) under an inert gas (argon). The conditions for this reaction are ana32

188 It is logical to couple acetylene derivatives of formula 9 with the reagent of formula 10 (see, e.g., reaction scheme 1), and this type of reaction is generally known as the Heck reaction. The vinyl derivative of formula 51 can be obtained in a known manner, an example of such a reagent used to synthesize a preferred compound for use in the invention is ethyl 4-vinylbenzotsate.

The product of the Heck coupling reaction is the ethenyl derivative of formula 52, which is then transformed into the compounds used in the present invention by the action of sodium bis (trimethylsilyl) amide and 2i [N, N-bis (trifluoromethylsulphinyl) amino] and 5-chloropyridine to give 4- tri-fluoromethylsulfonyloxy derivatives of formula 53, and in a subsequent reaction with an organometallic derivative derived from the RpiH aryl or heteryl compound as described above. The resulting compounds of formula 54 can be converted into further homologues and derivatives.

Compounds of formula 54 can also be obtained by synthetic methods based on Wittig or Lobster Emmons reactions. For example, the intermediate of formula 33 (see reaction scheme 4) can be reacted with triphenylphosphonium bromide (Wittig) or more preferably diethylphosphonate (Harner Emmons) with the structure (EtO) 2PO-CH-Y (R2) -AB as described for analogous reactions of Homer Emmons in U.S. Patent No. 5,324,840. Said Homer Emmons reaction gives intermediate compounds analogous in structure to formulas 52, and can be converted to compounds of formula 54 in the reaction sequence described in reaction scheme 8 by compounds of formula 52.

Examples of synthesis

2-hydroksyi2imetylo-5-fenylopentan

To a mixture of 13.16 g (0.541 mol) magnesium filings in anhydrous Et2O 200 ml, 100.0 g (0.492 mol) 1-brcmo-3-phenyl propane was added as a solution in 100 ml Et20. After adding

5-10 ml solution, stop adding until start of Grignard reagent formation. The remaining bromide was then added over 1 hour. The Grignard reagent was stirred for 20 minutes at 35 ° C and then 31.64 g (0.541 mol) acetone was added over 45 minutes. The reaction mixture was stirred overnight at room temperature, then cooled to 0 ° C and acidified by the careful addition of 20% HCl. The aqueous layer was extracted with Et2O (3 x 200 mL) and the combined organic layers were washed with water and saturated aqueous NaCl solution before drying over MgSO4. Removal of the solvent under reduced pressure and distillation of the residue gave 63.0 g (72%) of the product as a pale yellow oil, boiling point 99-102 ° C / 66.66 Pa. 1HNMR (CDCh): δ 7.26-7.18 (5H, m), 2.63 (2H, t, J = 7.5 Hz), 1.68 (2H, m), 1.52 (2H, m), 1.20 (6H, s).

1,2,3,4-tetrahydrate 1,1,1-dimets-onfftaten

A mixture of P2O5 (55.3 g, 0.390 mol) in 400 mL methanesulfonic acid was heated to 105 ° C under argon to dissolve the solid. The resulting solution was cooled to room temperature and 2-hydroxy-2-methyl15-phenylpentane (63.0 g, 0.354 mol) was added slowly with stirring. After 4 hours, the reaction was stopped by carefully pouring the solution onto 1 L of ice. The resulting mixture was extracted with Et2O (4 x 125 mL) and the combined organic layers were washed with water, saturated aqueous NaHCO3, water and saturated aqueous NaCl before drying over MgSO4. Concentration of the solution under reduced pressure followed by distillation gave 51.0 g (90%) of the product as a clear colorless oil, boiling point 65-67 ° C / 1.1 mmHg. 1H NMR (CDCl): δ 7.32 (1H, d, J = 7.4 Hz), 7.167.05 (3H, m), 2 ^ * ^^ t, J = 5.3 Hz), 1, ^ O (2H, m), 1.66 (2H, m), 1.28 (6H, s).

-, 4-dihydro-4,4-dimethylOi1 (2H) -naphthalenone (compound A)

A solution of 350 ml glacial acetic acid and 170 ml acetic anhydride was cooled to 0 ° C and CrO 2 O 25.0 g (0.25 mol) was carefully added in small portions. The resulting mixture was stirred for 30 minutes before adding 120 ml of benzene. 1,2,3,4-tetrahydro-1,1-dimethyllonaphthalene was added slowly as a solution in 30 ml of benzene. After the addition, the mixture was stirred for 4 hours at 0 ° C. The solution was diluted with H2O (200 mL) and extracted with Et2O (5 x 50 mL). The combined organic layers were washed with water, saturated aqueous Na2CO3 solution and saturated aqueous NaCl solution, before drying over MgSO4. Removal of the solvents under reduced pressure and distillation gave 16.0 g (74%) of the product as a pale yellow oil, boiling point 93-96 ° C / 0.3 mm Hg 1H NMR

188 705 (CDCh): δ 8.02 (1H, dd, J = 1.3, 7.1 Hz), 7.53 (1H, m), 7.42 (1H, d, J = 7.9 H) , 7.29 (1H, m), 2.74 (2H, t, J = 6.8 Hz), 2.02 (2H, t, J = 6.8 Hz), 1.40 (6H, s) .

3.4- dihydro-4.4-dimethyl-7-biOmo-1 (2H) -naphthalenone (compound B)

100 a three-necked flask, equipped with an efficient reflux condenser and drying tube and dropping funnel, was filled with a mixture of 9.5 g AlCl (71.4 mmol) and 3 mL CH2Cl3 AlCl 3 added dropwise with stirring 3,4-dihydro-4,4-dimethyl-1 (2H) -naphthalenone (5.0 g, 28.7 mmol) (note: exothermic reaction). Then 5.5 g (34.5 mmol) bromine was added very slowly and the resulting mixture was stirred for 2 hours at room temperature (note: if it stops stirring, the mixture may warm to 70 ° C before resuming). The reaction was then stopped by the slow addition of ice cold 6M HCl. The mixture was extracted with Et2O and the combined organic layers were washed with water, saturated aqueous NaHCO3, and saturated NaCl, before drying over MgSO4. Removal of the solvent under reduced pressure and distillation of the residue gave 5.8 g (80%) of the product as a pale yellow oil which solidified on standing, boiling point: 140 ° C / 53.33 Pa. 1H NMR (CDCh): δ 8.11 (1H, d, J = 3.0 Hz), 7.61 (3H, dd, J = 3.0, 9.0 Hz), 7.31 (1H, d , J = 9.0 Hz), 2.72 (2H, t, J = 6.0 Hz), 2.01 (2H, t, J = 6.0 Hz), 1.28 (6 H, s) .

1.2.3.4- tetrahydro-1-hydroxy-1- (4-methylphenyl) -4,4-dimethyl-7-bromonaphthalene (compound C) For a mixture of magnesium filings (648.0 mg, 27.0 mmol) in 25 ml THF a solution of 4-bromotoluene (5.40 g, 31.8 mmol) in 10 ml THF was added in two portions. The reaction was started by the addition of 2 ml of solution, then the remaining solution was added slowly from a dropping funnel. The mixture was stirred at room temperature for an hour, then the solution was transferred to a second flask using a tube. 4.0 g (15.9 mmol) was added to the resulting Grignard reagent.

3.4-dihydro-4,4-dimethyl-7-bromo-1 (2H) -naphthalenone (compound B) as a solution in 15 ml THF. The resulting solution was heated to reflux overnight, cooled to room temperature, and quenched by careful addition of ice-cold 10% HCl. Extraction with Et2O was preceded by washing the combined organic layers with H2O and a saturated aqueous NaCl solution, followed by drying over MgSO4. Removal of the solvent under reduced pressure gave an oil which after column chromatography (hexanes / EtOAc, 96: 4) gave the product as a colorless solid. 1 H NMR (CDCl): δ 7.36 (1H, dd, J = 2.1, 7.6 Hz), 7-26 (3H, m), 7.12 (3H, s), 2.34 (3H , s), 2.24-2.04 (2H, m), 1.81 (1H, m), 1.55 (1H, m), 1.35 (3H, s), 1.30 (3H, s).

3,4-dihydro-1- (4-methylphenyl) -4,4-dimethyl-7-bromone.phthalene (compound D)

A flask equipped with a Dean-Stark trap was charged with 3.4 g (9.85 mmol) 1,2,3,4-tetrahydro-1-hydroxy-1 ~ (4-methyl \ phenyl) -4,4-dimethyl-7-bromonaphthalene. (compound C) and 40 ml of benzenes. A catalytic amount of p-toluenesiphonic acid monohydrate was added and the resulting solution was heated to reflux for 2 hours. After cooling to room temperature, Et2O was added and the solution was washed with H2O, saturated aqueous NaHCO3 and saturated aqueous NaCl, then dried over MgSO4. Removal of the solvent under reduced pressure and column chromatography (100% hexane / silica gel) gave the title compound as a colorless solid. 1H NMR (CDCh): δ 7.32 (1H, dd, J = 2.1, 8.2 Hz), 7.21 (5H, m), 7.15 (1H, d, J = 2.1 Hz ), 5.98 (1H, t, J = 4.7 Hz), 2.40 (3H, s), 2.32 (2H, d, J = 4.7 Hz), 1.30 (6H, s).

7-ethynyl ~ 3,4-dihydro-4,4 ~ dimethylnaphthalene ~ 1 (2H) ~ one (compound E)

To the solution (purged for 15 minutes with a stream of argon) 7 g (27.6 mmol)

3.4- dihydl-4,4-dimethyl-7-bromo-1 (2H) -naphthalenone (compound B) in 15 ml of tri-ethyl acetate 0.97 g (1.3 mmol) of bis (taif'enylphosphine) palladium chloride (II) and 0.26 g (1.3 mmol) cuprous iodide. The solution was purged with argon for 5 minutes and then 39 ml (36.6 mmol) (trimethylsilyl) acetylene was added. The reaction mixture was sealed in a pressure tube and placed in a preheated oil bath (100 ° C) for 24 hours. The reaction mixture was then filtered through celite, washed with Et 2 O and the filtrate was concentrated under reduced pressure to give crude 7- (trimethtyosihlABOUT) ethinyl-3,4-dihydro-4,4-dimethylnaphthalene 1 (2H) -one. To a solution of this crude TMS-acetylene compound in 50 mL methanol was added 0.6 g (4.3 mmol) K2 CO3. The mixture was stirred for 8 hours at ambient temperature and then filtered. The filtrate was concentrated under reduced pressure, diluted with 88,705

Et2O, washed with water, 0% HCl and brine, dried over MgSO4 and concentrated under reduced pressure. Purification by column chromatography (silica, 0% EtOAc-hexane) gave the title compound as a white solid. PMR (CDCl ·): δ i, 39 (6H, s), 2.02 (2H, t, J = 7.0 Hz), 2.73 (2H, t, J = 7.0 Hz), 3 , 08 (iH, s), 7.39 (iH, d, J = 8.2 Hz),

7.6i (iH, dd, J = i, 8, 8.2 Hz), 8, i4 (iH, d, J = 9i, 8 Hz).

Ethyl 4-iodobenzoate

To a suspension of 10 g (40.32 mmol) of 4-iodobenzoic acid in 100 ml of absolute ethanol was added 2 ml of thionyl chloride and the mixture was then refluxed for 3 hours. The solvent was removed under reduced pressure and the residue was dissolved in 100 ml ether. The ether solution was washed with saturated NaHCO3 and NaCl solutions and dried (MgSO4). The solvent was then removed under reduced pressure and the residue was distilled through a ball condenser (i00 ° C; 73.33 Pa) to give the title compound as without colored oil, PMR (CDCl3): δ i, 42 (3H, t, J = 7 Hz) , 4.4 (2H, q, J ~ 7 Hz), 7.8 (4H).

6-iodonicotinic acid

Sodium iodide (20.59 g, 37.40 mmol) was cooled to -78 ° C under argon and then hydroiodic acid (97, 3 g, 759.34 mmol) was added. The cooling bath was removed and the suspension was stirred for 5 minutes. To this mixture, 6-chloronicotinic acid (22.09 g, and 40.20 mmol) was added, and the resulting mixture was slowly warmed to ambient temperature with stirring. The mixture was heated to reflux at i25 ° C for 24 hours, cooled to ambient temperature and poured into acetone (500 ml) at 0 ° C. The yellow solid was filtered off and washed with 200 ml of 1N aqueous NaHSO3 solution. Recrystallization from methanol (crystals washed with diethyl ether) gave the title compound as white crystals: melting point i77 -79 ° C (melting point in literature 87-92 ° C. Newkome et al. "Reductive Dehalogenation of Electron-Poor Heterocycles: Nicotinic Acid Derivatives" J. Org. Chem. 5i: 953-954 (i986). 3 H NMR (DMSO-d6): 8 8.8i (iH, dd, J = 0.8, 2.4 Hz), 8.0i (iH, dd, J = 0.8, 8.2 Hz), 7.9i (iH, dd , J = 2.4, 8.2 Hz).

Ethyl 6-iodonicotinate

To a suspension of 6-iodonicotinic acid (23.38 g, 94.20 mmol) in dichloromethane (i00 mL) was added a solution of i- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (i9.86 g, 13.6 mmol) in dichloromethane (250 ml). Ethanol (-2.40 g, 269.27 mmol) was added to this mixture, followed by dimethylaminopyridine (1.5 mg, 9.4 mmol). The mixture was heated at 50 ° C for 24.5 hours, concentrated under reduced pressure and diluted with water (200 mL), then extracted with ethyl ether (550 mL). The combined organic phases were washed with saturated aqueous NaCl solution, dried (MgSO4) and concentrated to a yellow solid. Purification by chromatography (silica, 10% EtOAchexane) gave the title compound as white needles: mp 48-49 ° C; iH NMR (CDCl3): δ 8.94 (iH, d, J = 2, and Hz), 7.9i (iH, dd, J = 2, i, 8.2 Hz), 7.85 (iH, d , J = 8.2 Hz),

4.4i (2H, q, J = 7h Hz), i, 41 (3H, t, J = 74 Hz).

Ethyl 4 - [(5,6,7,8-tetrahydro-5,5-dimethyl-8-oxo-2-naphthalenyl) ethynyl] benzoate (compound F)

To a solution of 4 g (2i, 7 mmol) 7-ethynyl-3,4-dihydro-4,4-dimethylnaphthalen-i (2H) -one (compound E) purged for 5 minutes with a stream of argon, and 6 g (2i, 7 mmol) ethyl 4-iodobenzoate in 100 ml of triethylamine, 5 g (7.2 mmol) of bis (triphenylphosphine) palladium (II) chloride and 3.4 g (7.2 mmol) of cuprous iodide are added. The mixture was purged with argon for 5 minutes and then stirred at ambient temperature for 8 hours. The reaction mixture was filtered through celite and the filtrate, concentrated under reduced pressure. Purification by flash chromatography (silica, 0% EtOAc-hexane) gave the title compound as a white solid. PMR (CDCty): δ i, 4i (3H, t, J = 7.2 Hz), i, 4i (6H, s), 2.04 (2H, t, J = 6.5 Hz), 2.76 (2H, t, J = 6.5 Hz), 4.40 (2H, q, J = 7.2 Hz), 7.44 (iH, d, J =

8.2 Hz), 7.55) (22 ^, d, J = 8.4 Hz), 7.68 OH, dd, J = 1 & 8.2 Hz), 8.00 (2H, d, J = 8.4 Hz), 845 (iH, d, J = i, 8 Hz).

Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (trifluoromethylsulfonyl) oxy-2-naphthalenyl) ethynyl] benzoate (compound G)

188 705

To a cold solution (-78 ° C) 291.6 mg (1.59 mmol) sodium bis (trimethylsilyl) amide in 5.6 ml THF was added a solution of 500.0 mg (1.44 mmol) 4 - [(5.6 , 7,8-tetrahydro-5.5-dimethyl-8-oxo-2-naphthalenyl) ethynyl] benzoate (compound F) in 4.0 mL of THF. The reaction mixture was stirred at -78 ° C for 35 minutes and then a solution of 601.2 mg (1.59 mmol) 5-chloro (2-bis-triflouromethylsulfinyl) imide in 4.0 ml THF was added. After stirring at -78 ° C for an hour, the solution was warmed to 0 ° C and stirred for 2 hours. The reaction was stopped by the addition of a saturated aqueous NH 4 Cl solution.

The mixture was extracted with EtOAc (50 mL) and the combined organic layers were washed with 5X aqueous NaOH, water and brine. The organic phase was dried over Na2SO4 and then concentrated under reduced pressure to a yellow oil. Purification by column chromatography (silica, 7% EtOAc-hexanes) gave the title compound as a colorless solid. 1H NMR (CDCh): δ 8.04 (2H, dd, J = 1.8, 8.4 Hz), 7.60 (2H, dd, J = 1.8, 8.4 Hz), 7.51 (2H, m), 7.32 (1H, d, J = 8.0 Hz), 4.40 (2H, q, J = 7.1 Hz), 6.02 (1H, t, J = 5, 0 Hz), 2.44 (2H, d, J = 5.0 Hz), 1.43 (3H, t, J = 7.1 Hz), 1.33 (6H, s). 4 - [(5,6-dihydro ^ <5.5 ^^ - (^^ IET; yl-8- (4-metyłofen ^^ o) - ^ ^ '^ and ^ ^^ lt ien yyl ^ ^^ ethyl ^^ ^ yl]] ^and^AND^<^^ san ethyl (compound 1)

A 4-toluenolith solution was prepared by adding 189.9 mg (1.74 mL, 296 mmol) of t-butyllithium (1.7 M solution in hexanes) to a cold solution (-78 ° C) 253.6 mg (1.482 mmol) 4 -bromo-toluene in 20 ml THF. After stirring for 30 minutes, a solution of 269.4 mg (1.977 mmol) zinc chloride in 3.0 mL THF was added. The resulting solution was warmed to room temperature, stirred for 30 minutes, and 472.9 mg (0.988 mmol) of 4 [(6-, 6-dilhydro-5,5-dimethyl-8- (tri-uoro-methyl] sulfonyl) oxy was added to the solution through a tube. Ethyl -2-yafalenyl) ethyyl] benzoate (compound G) and 50 mg (0.04 mmol) tetrakis (triphenylphosphine) palladium (0) in 4.0 ml THF. The resulting solution was heated at 50 ° C for 45 minutes, cooled to room temperature and diluted with aqueous NHCl. The mixture was extracted with EtOAc (40 mL) and the combined organic layers were washed with water and brine. The organic phase was dried over Na2SO4 and concentrated under reduced pressure to a yellow oil. Purification by column chromatography (silica, 5% EtOAc-hexanes) gave the title compound as a colorless solid. 1H NMR (d6-acetone): δ 1.35 (6H, s), 1.40 (3H, t, J = 7.1 Hz), 2.36 (2H, d, J = 4.7 Hz), 2.42 (3H, s), 4.38 (2H, q, J = 7.1 Hz), 5.99 (1H, t, J = 4.7 Hz),

7.25 (5H, m), 7.35 (2H, m), 7.52 (2H, d, J = 8.5 Hz), 7.98 (2H, d, J = 8.5 Hz).

Ethyl 4 - [(5,6-dihydro-5.5-dimethyl-8-phenyl-2-yaphthalenyl) ethynyl] benzoate (compound Ia) Using the same general procedure as for the preparation of 4 - [(5.6-dihydro-5.5-dimethyl Ethyl -8 (4-methylphenyl) -2-yaphthalenyl) ethyl] beisoleate (compound 1), 203.8 mg (0.43 mmol) 4 [(5.6-dhydro-5,5-dinletyl-8- (trifklorone-ethylsulfonyl) ) ethyl oxy-2-naphtha: aleyyl) ethylynyl] benzoate (compound G) was converted to the title compound (colorless solid) using 58.2 mg (0.36 ml, 0.59 mmol) phenyllithium (1.8 M solution in cyclohexay / Et2O), 116.1 mg (0.85 mmol) zinc chloride and 13.8 mg (0.01 mmol) tetrakίs (triienylphosimo) of the palace (0). PMR (CDCl3): δ 1.36 (6H, s), 1.40 (3H, t, J = 7.1 Hz), 2.37 (2H, d, J = 4.7 Hz), 4.38 (2H. Q, J = 7.1 Hz), 6.02 (1H, t, J = 4.7 Hz), 7.20 (1H, d, J = 1.5 Hz), 7.27 ( 1H, m), 7.39 (6H, m), 7.52 (2H, d, J = 8.2 Hz), 7.98 (2H, d, J = 8.2 Hz).

Ethyl 4 - [(5.6-dihydro-5.5- <dimethyl-8- (3-methylphenyl] -2-naphthdenyl) ethynyl] benzoate (compound 2)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl8- (4-methyl] phenyl) -2-naphthaleyyl) ethyl] benzoate (compound 1), 250 , 0 mg (0.522 mmol) 4 - [(5,6-dihydro-5,5-dimethyl-8- (trifluor <^] m ^^ t ^ 1<]s^ U'f 'θ] ^ And / ll])(^^]^ί^ S ^^ - ^^r^‘1ίftllt ^^ Ίn ^ l ^] ί ^ tt ^ ly ^ ll]] l ^ t ^ Ethyl isoate (compound G) was converted to the title compound (colorless solid) using 284.8 mg (2.090 mmol) zinc chloride, 24 mg (0.02 mmol) tetrakis (t.RieΓLylphosphino) palladium (0 ') in 2.0 mL THF and 3-methylphenyl lithium (prepared by 201.2 mg (1.88 mL, 3.14 mmol) of t-butyllithium ( 1.7 M solution in pentane) to a cold solution (-78 ° C) 274.0 mg (1.568 mmol) of 3-methylbromobenzene in 2.0 ml of THF). 1H NMR (CDCl): δ 7.99 (2H, d, J = 8.4 Hz), 7.51 (2H, d, J = 8.4 Hz), 7.39-7.14 (7H, m ), 5.99 (1H, t, J = 4.7 Hz), 4.37 (2H, q, J = 7.1 Hz), 2.60 (3H, s), 2.35 (2H, d , J = 4.7 Hz), 1.39 (3H, t, J = 7.1 Hz), 1.34 (6H, s).

Ethyl 4 - [(5,6-dihyώΌ-5.5-dimethyl-8- (2-n-ethylphenic)) -2-yaftaleyyl) ethynyl] benzoate (compound 3)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) ethyl ethynylbenzoate (compound 1), 200.0 mg (0.418 mmol )] 436

188 705

L5,6-dihylkr) 5,5-dimethyl-8- (rifluorrmethylsulffoyl) o] ky-2-naphthdenyl) ethylin] ethylbenzoate (compound G) was converted to the title compound (colorless solid) using 199.4 mg (1.463 mmol) zinc chloride, 24 mg (0.02 mmol) tetrakis (triphenylphosphine) palladium (0) in 4.0 mL THF, and 2-methylphenyl lithium (prepared by the addition of 133.9 mg (1.23 mL, 2.09 mmol ) t-butyllithium (1.7 M solution in pentane) to a cold solution (-78 ° C) 178.7 mg (1.045 mmol)

2-methylbromobenzene in 2.0 ml THF). 1H NMR (CDCty): δ 7.97 (2H, d, J = 8.4 Hz), 7.50 (2H, d, J = 8.4 Hz), 7.49-7.19 (6H, m ), 6.81 (1H, d, J = 1.6 Hz), 5.89 (1H, t, J = 4-5 Hz), 4.36 (2H, q, J = 7.1 Hz), 2.43-2.14 (2H, dq, J = 3.7, 5.4 Hz), 2.15 (3H, s), 1.39-1.34 (9H, m). Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (3,5-dimethylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 4)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl8- (4-methylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 1), 250.0 mg (0.522 mmol) ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (trifluoromethylsulfonyl) oxy-2-naphthylyl) ethynyl] benzoate (compound G) was converted to the title compound (colorless solid) using 249.0 mg (1.827 mmol) zinc chloride, 24 mg (0.02 mmol) tetrOds (triphenylphosphine) palladium (0) in 2.0 ml THF, and 3,5-dimethylphenyl lithium (prepared by adding 167.7 mg (1.54 mL, 2.62 mmol) of t-butyllithium (1.7 M solution in pentane) to a cold solution (-78 ° C) 249.0 mg (1.305 mmol)

3,5-dimethylbromobenzene in 20 ml THF). 1H NMR (CDCl3): δ 7.98 (2H, d, J = 8.4 Hz), 7.52 (2H, d, J = 8.4 Hz), 7.40-7.33 (2H, ml , 7.20 (1H, d, J = 1.6 Hz), 7.00 (1H, s), 6.97 (2H, s), 5.97 (1H, t, J = 4.8 Hz ), 4.37 (2H, q, J = 7.1 Hz), 2.36 (6H, s), 2.34 (2H, d, J = 4.8 Hz),

1.39 (3H, t, J = 7.1 Hz), 1.37 (6H, s).

Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4-ethynylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 5)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-di-methyl8- (4-methylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 1), 250.0 mg (0.522 mmol) ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (trifluoro ^^ et ethyl ^ yiosulfonyl) -oxy-2-naphthalenyl) ethyl] ethyl] benzoate (compound G) was converted to the title compound (colorless solid) using 249.0 mg (1.827 mmol) zinc chloride, 24 mg (0.02 mmol) tetrakis (triphenylphosphine) palladium (0) in 2.0 ml THF, and 4-ethylphenyl lithium (prepared by adding 167.7 mg (1.54 mL, 2.62 mmol) of t-butyllithium (1.7 M solution in pentane) to a cold solution (-78 ° C) 244.0 mg (1.305 mmol) 4-ethylbromobenzene in 2.0 mL THF). 1H NMR (CDCl3): δ 7.99 (2H, d, J = 8.4 Hz), 7.51 (2H, d, J = 8.4 Hz), 7.42 - 7.24 (7H, ml , 5.99 (1H, t, J = 4.7 Hz), 4.37 (2H, q, J = 7.1 Hz). 2.71 (2H, q, J = 7.6 Hz), 2 , 35 (2H, d, J = 4.7 Hz), 1.39 (3H, t, J - 7.1 Hz), 1.34 (6H, s).

Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4- (1,1-dimethylethyl) phenyl) -2-naphthalenyl) ethynyl] benzoate (compound 6)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8 (4-methylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 1), 250.0 mg ( 0.522 mmol) ethyl 4 [(5,6-dihydro-5,5-dimethyl-8- (trifluoromethylsulfonyl) oxy-2-naphthyl) ethynyl] benzoate (compound G) was converted to the title compound (colorless solid) using 142.4 mg (1.045 mmol) of zinc chloride and 4-t-butyl-phenyl lithium (prepared by the addition of 100.6 mg (0.97 mL, 1.57 mmol) t-butyllithium (1.5 M solution in pentane) to a cold solution (-78 ° C) 167.0 mg (0.78 mmol) 4-t-butyl bromobenzene in 1.0 ml tHf) . 1H NMR (CDO3): δ 7.99 (2H, d, J = 8.4 Hz), 7.55 (2H, d, J = 8.4 Hz), 7.28-7.45 (7H, m ) 6.02 (1H, t, J = 4.9 Hz), 4.38 (2H, q, J = 7.2 Hz), 2.36 (2H, d, J = 4.9 Hz), 1 , 59 (3H, s), 1.40 (3H, t, J = 7.2 Hz), 1.39 (9H, s), 1.35 (6H, s).

Ethyl 4 - [(5,6-dihydro-5,5-methylmethyl-8- (4-chlorophenyl)) 2-naphthylyl) ethynyl] benzoate (compound 7)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl8- (4-methylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 1), 250.0 mg (0.522 mmol) ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (trifluoromethylsulfinyl) oxy-2-naphthylyl) ethynyl] benzoate (compound G) was converted to the title compound (colorless solid) using 249.0 mg (1.827 mmol) zinc chloride, 24 mg (0.02 mmol) tetr ^ 1 ^ is (tI ^! tUl - ^ ^ <^ phosphate) palladium (0) in 2.0 ml THF, and 4-chlorophenyl lithium (prepared by the addition of 167.7 mg (1.54 mL,

2.62 mmol) t-butyllithium (1.7 M solution in pentane) to a cold solution (-78 ° C) 252.4 mg (1.305 mmol) 4-chloro-1-bromobenzene in 2.0 mL THF). 1 H NMR (CDCty): δ 7.98 (2H, d, J =

188 705

8.4 Hz), 77> 5 (2H, d, J = 8.4 Hz), 7/1007712 (6H, m), 7.12 (1H, d, J = 1.6 Hz), 6.00 (1H, t, J - 4.8 Hz), 4.37 (2H, q, J = 7.1 Hz), 2.35 (2H, d, J = 4.8 Hz), 1.40 (2H , t, J = 7.1 Hz), 1.34 (6H, s).

4 - [(5,6-dihydro-5,5-dimethyl-78- (4-methoxyphenyl) -2-raίtalenyk>) ethyl ethynylberrate (compound 8)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 1), 250.0 mg (0.522 mmol) 4 [(5,6-dihydro-5,5-dimethyl-8 - ((rifluoromethylsulfonyl) oxy-2-raphthalenyl) ethyl ethynylbenzoate (compound G) was converted to the title compound (a colorless solid) using 249.0 mg (1.827 mmol) zinc chloride, 24 mg (0.02 mmol) tetrαx (triphenylphosphine) palladium (0) in 2.0 ml THF, and 4-methoxyphenyl lithium (prepared by adding 167.7 mg (1.54 mL, 2.62 mmol) tbutyllithium (1.7 M solution in pentane) to a cold solution (-78 ° C) 200.1 mg (1.305 mmol) 4-methoxy-1-bromobenzene in 20 ml THF). 1H NMR (CDCl 3): δ 7.98 (2H, d, J = 8.5 Hz), 7.52 (2H, d, J = 8.6 Hz), 7.40-7.21 (5H, m), 6.95 (2H, d, J = 8.7 Hz), 5.91 (1H, t, J = 4.7 Hz),

4.37 (2H, q, J = 7.1 Hz), 4.34 (3H, s), 2.34 (2H, d, J = 4.7 Hz), 1.39 (3H, t, J = 7.1 Hz), 1.34 (6H, s).

0 - [('5,6-dihydro-5,5-dimetic) -8- (4-trifluoromethyl> ftryio) -2-naphthalenyl) ethynyl] ethyl berzoesar (compound 9)

Using the same. general procedure, as in the preparation of ethyl 4 - [(5.6 ^ dihydro-5,5-dimethyl-8- (O-methylphenyl) -2-naltalenyl) ttinyl] bt-n-potoxane (compound 1), 250.0 mg (0.522 mmol) 4 [( 5,6-dimethyldi-5,5-dimethoxide 8-7-trifluoromethylsullyryl) oxy (2-n-triathenyl) ethynyl] ethyl] ethyl esterate (compound G) was converted to the title compound (colorless solid) using 249.0 mg (1.827 mmol) zinc chloride, 24 mg (0.02 mmol) tetrakis (triphenylphosphine) palladium (0) in 2.0 ml THF, and 0-tπl'luoromethylfelrylolit (prepared by adding 167.7 mg (1.54 mL, 2.62 mmol) of t-butyllithium (1.7 M solution in pentane) to a cold solution (-78 ° C) 296.6 mg (1.305 mmol) 0-trifluoromethylbromobenzene in 2.0 mL THF). 1H NMR (CDCl 3): δ, 98 (2H, d, J = 8-5 Hz), 7.67 (2H, d, J = 8.3 Hz), 7.54 - 7.36 (6H, m ), 7.10 (1H, d, J = 1.6 Hz), 6.06 (1H, t, J = 4.8 Hz),

4.37 (2H, q, J = 7.1 Hz), 2.38 (2H, d, J = 4.8 Hz), 1.39 (3H, t, J = 7.1 Hz), 1, 35 (6H, s).

Ethyl 0 - [(5,6-dihydro-5t5-dimetic - 8- (2-prismic) - 2-raphthaltyl) ethynyl] benzoate (compound 10)

Using the same general procedure as for the preparation of ethyl 0 - [(5,6-dihydro-5,5-d'imethio-8- (O-methylphthyl) -2-nα-phthalenyl) ethynyl] -butyrate (compound 1), 250.0 mg (0.52 mmol) 4 - [(5,6-dihydro-5,5-dimethyl-8-trifluoromethylsulfonyl-oxy (2-naphthalenyl) ethynyl-ethanol) -esulfuric acid (compound G) was transformed into the title compound (colorless solid) using 142.4 mg (1.045 mmol) zinc chloride and 2-lithopyridine (prepared by the addition of 100.6 mg (0.97 mL, 1.57 mmol) t-butyllithium (1.5 M solution in pentane) to a cold solution (-78 ° C) 123.8 mg (0.784 mmol) 2-bromopyridine in 1.0 ml THF). 1H NMR (d6-acetone): δ 8.64 (1H, m), 7.99 (2H, d, J = 8.5 Hz), 7.85 (1 H, ddd, J = 1.8, 7 , 7, 9.5 Hz), 7.58 (2H, d, J = 8.4 Hz), 7.50 (1H, d, J = 7.7 Hz), 7.47 (2H, d, J = 1.1 Hz), 7.35 (2H, m), 6.32 (1H, t, J = 4.8 Hz), 4.34 (2H, q, J = 7.2 Hz),

2.42 (2H, d, J = 7.4 Hz), 1.35 (3H, t, J = 7.0 Hz), 1.35 (6H, s).

07 [Ethyl [(5t6-dihydro5,5-dimethyl-8- (3-pyridyl) -2-naphthyl) ethyl] ethyl] benzoate (compound 11)

Using the same general procedure as for the preparation of ethyl 0 - [(5.6 ^ 1hydro-5,5-dimethyl-8- (4-methyl-toleryl) -2-yl -alenyl) -ethyl] -benzotarate (compound 1), 170.0 mg (0.35 mmol) 4 [(-, 6-dihydro-5,5-dimethyl-8- (trifluoromethylsulfonyl) oxy-2-naphthyltinyl) ethynyl] benzoate (compound G) was converted to the title compound (a colorless solid) using 142.4 mg (1.045 mmol) zinc chloride and 3-lithopyridine (prepared by the addition of 100.2 mg (0.92 ml, 1.56 mmol) t-butyllithium (1.5 M solution in pentane) to a cold solution (-78 ° C) 123.8 mg (0.784 mmol) 3-bromopyridine in 1.0 mL THF). 1H NMH (CDCk): δ 8.63-8.61 (2H, dd, J = 1.7 Hz), 7.99 (2H, d, J = 8.4 Hz), 7.67 (1H, dt , J = 7.9 Hz), 7.52 (2H, d, J = 8.4 Hz), 7.43-7.34 (3H, m), 7.10 (1H, d, J = 1, 6 Hz), 6.07 (1H, t, J = 4.7 Hz), 4.37 (2H, q, J = 7.1 Hz), 2.40 (2H, d, J = 4-7 Hz ), 1.390 (3H, t, J = 7.1 Hz), 1.36 (6H, s).

Ethyl 4 - [(5,6-dhydro-5,5-dimethyl-8- (2-methyl-5-pyridyl) -2-naphthalenyl) ethynyl] benzoate (compound 12)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (O-methylphenyl ^ -naphthalenyl-tinyl] -benzoate) (compound 1), 250.0 mg (0.52 mmol) 4 [(5,6-dihydro-5,5-dίmethyl-8- (trifluoromethylsulforyl) oxy-2-raphthalenyl) ethyl] benzoar

188 705 ethyl (compound G) was converted to the title compound (colorless solid) using 142.4 mg (1.045 mmol) of zinc chloride and 2-methyl-5-lithopyridine (prepared by the addition of 100.5 mg (0.92 ml, 1, 57 mmol) t-butyllithium (1.7 M solution in pentane) to a cold solution (-76 ° C) 134.8 mg (0.784 mmol) 2-mktzl-5-bromo-pyridine in 1.0 ml THF). 1H NMR (CDCL ·): δ 8.50 (1H, d, J = 2.2 Hz), 7.99 (2H, d, J = 8.3 Hz), 7.56 (1H, dd, J = 2.3, 8.0 Hz), 7.53 (2H, d, J = 8.4 Hz), 7.43 (1H, dd, J = 2.3, 8.0 Hz), 7.37 (2H, d, J = 8.0 Hz), 7.21 (1H, d, J = 8.1 Hz), 7.11 (1H, d, J = 1.5 Hz), 6.04 (1H, t, J = 4.7 Hz), 4.38 (2H, q, J = 7.2 Hz), 2.63 (3H, s), 2.38 (2H, d, J = 4.6 Hz) , 1.40 (3H, t, J = 7.1 Hz), 1.35 (6H, s).

4 - [(5,6-dihyclyo-5,5-diai-ethyl-8- (3 - ((2,2-diai-ktyloctyl) -dimethylsiloxyphenyr) -2-naalkylalknzk)) ethznzlo] ethyl broxoxane (compound H)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dibydro-5,5-dimethyl-8- (4-methylphenyl) -2-n-naphthalenzyl) etZnyly] ethyl benrylate (compound G), 150.0 mg (0.314 mmol) 4 [(5,6-dibz'dro-5,5-dimethyl-8- (trifluoromethylsuphonyloxy-22-naphthatenyl) ethynyl) ethyl] benz: ethyl yesan (compound G) was converted to the title compound (colorless solid) using 150 , 0 mg (1.10 mmol) zinc chloride, 24 mg (0.02 mmol) tetrdkιs (trienylphosphine) palladium (0) in 2.0 ml THF, and 3 - ((2,2-dimtyltylethyl) dimethylsilynsz) phenylollt (prepared 'by adding 100.2 mg (0.92 ml, 1.564 mmol) t-butyllithium (1.7 M solution in pentane) to the cold solution (-78 ° C) 226.0 mg (0.787 mmol) 3 - ((2,2-dimethylethyl) dimethylsiloxy) bromobenzken in 2.0 ml THF). 1H NMR (CDCl 3): δ 7.98 (2H, d, J = 8.4 Hz), 7.51 (2H, d, J = 8.4 Hz), 7.407.22 (4H, m), 6 , 95 (1H, d, J = 7.6 Hz), 6.84-6.82 (2H, m), 6.00 (1H, t, J = 4.7 Hz), 4.37 (2H, q, J = 7.1 Hz), 2.35 (2H, d, J = 4.7 Hz), 1.39 (3H, t, J = 7.1 Hz), 1.34 (3H, s) , 0.99 (9H, s), 0.23 (6H, s).

4 - [(5,6-dibz'dyυ-5,5-dimtyl-8- (4 - ((2,2-dialkTyrkyl) -dimelylsiloxyfeIlylυ) -2-yl-alkyl) ethyl-ethyl] benzoate ( relationship I)

Using the same general procedure as for the preparation of ethyl 4 - [(5,6-dibydro-5,5-dimethyl-8- (4-methylphenyl) -2-n-naphthyl) ethylinyl] benzoate (compound 1), 210.0 mg (0.439 mmol) 4 [(5,6-dibydro-5,5-dimethyl-8 - ((rifluoromatylorsphonyloroxy-2-naphtylenyl) ethynyl] benzoate, ethyl (circa G) purging. tthecealed in the title compound solid using 209.0 mg ( 1.53 mmol) zinc chloride, 24 mg (0.02 mmol) trakrakis (1-triphenylphosphine) palladium (0) in 2.0 ml THF, and 4 - ((2,2-dimethlylyl) dimethylsiloxy) phenyllithium (prepared by adding 140.3 mg (1.30 mL, 2.19 mmol) of t-butyllithium (1.7 M solution in pentane) to the cold solution (- 78 ° C) 315.0 mg (1.09 mmol) 4 - ((2,2-dimethylethyl) dlmtylylsons) bromybknrene in 2.0 mL THF). 1H NMR (CDCl 3): δ 7.98 (2H, d, J = 8.4 Hz), 7.51 (2H, d, J = 8.4 Hz), 7.39-7.25 (3H, m), 7.21 (2H, d, J = 8.5 Hz), 5.87 (2H, d, J = 8.5 Hz), 5.96 (1H, t, J = 4.7 Hz) , 4.37 (2H, q, J = 7.1 Hz), 2.33 (2H, d, J = 4.7 Hz), 1.39 (3H, t, J = 7.1 Hz), 1 , 33 (6H, s), 1.01 (9H, s), 0.25 (6H, s).

4 - [(5,6-dlhydro-5,5-dimtyl-8- (3-hydroxyphenyl) -2-naphthylyl) ketinyl] ethyl ethyl (compound 13)

To the solution of 4 - [(5,6-dibydry-5,5-dimethyl-8- (3 - ((2,2-dimktloctyl) -dimethylsiloxyphenyl) 2-n-naphthylenyl) ketinyl] benzoate (cf. H) 60, 0 mg (0.114 mmol) in 1.0 mL THF in room temperature 91.5 mg (0.35 mL, 0.35 mmol) of trabutylaconium fluoride (1 M solution in THF) was added. After stirring overnight, the solution was diluted EtOAc and pyro zto H2O and saturated aqueous NaCl, before drying over MgSO4. Removal of the solvents under reduced pressure and then column chromatography (4: 1, hexanes: EtOAc) gave the title compound as a colorless solid. 1H NMR (CDCl 3): δ 7.98 (2H, d, J = 7.8 Hz), 7.52 (2H, d, J = 8.3 Hz), 7.39 - 7.21 (4H, m), 6.93 (1H, d, J = 7.5 Hz), 6.84 (1H, d, 7.1 Hz), 6.83 (1H, s), 6.01 (1H, t, J = 4.7 Hz), 4.91 (1H, s), 4.39 (2H, q, J = 7.1 Hz), 2.35 (2H, d, J = 4.7 Hz), 1 , 39 (3H, t, J = 7.1 Hz), 1.34 (6H, s).

Ethyl 4 - [(5,6-db healthy-5,5-dimethyl-8- (4-hydrocarbyl) -2-naphthalenyl) ethynyl] benzoate (compound 14)

To a solution of 4 - [(5,6-dibydro-5,5-dimethyl-8- (4 - ((2,2-dimzlylethyl) dlmzzlysilknyl) 2-n-naphthalkyl) ethynyl] ethylenecarboxylate (hand I) 50.0 mg ( 0.095 mmol) in 1.0 mL THF at room temperature 73.2 mg (0.29 mL, 0.29 mmol) of trabutic acid fluoride (1M solution in THF) were added. After stirring overnight, the solution was diluted with EtOAc and washed with H2O and saturated aqueous NaCl solution, then dried over MgSO4. Removal of solvents under reduced pressure and then column chromatography (4: 1, hexanes: EtOAc) gave the title compound as a colorless solid. 1H NMR (CDCh): δ 7.98 (2H, d, J = 8.2 Hz), 8 7.52 (2H, d, J = 8.3 Hz), 7.41 - 7.20 (5H, m), 6.88 (2H, d, J = 8.4 Hz), 5.96 (1H, t, J = 4.5 Hz), 4.37 (2H, q, J = 7.1 Hz) , 2.34 (2H, d, J = 4.5 Hz), 1.39 (3H, t, J = 7.1 Hz), 1.34 (6H, s).

Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (5-methylthiazol-2-yl) -1-naphthalenyl) ethynyl] benzoate (compound 15)

Using the same general procedure as in the preparation of 4 - [(5,6-dihydlΌ-5,5-dimethyl-8- (4-methylthenyl) i2-naphthalenyl) ethynyl] -t-n-potassium ethyl (compound 1), 264.0 mg (0.552 mmol ) 4 [(5,6-dihydro-5,5-dimethyl-8i (trifluoromethylsuphonyl) oxy-2-nenidyl) ethynyl] ethyl benzoate (compound G) was converted to the title compound (colorless solid) using 150.0 mg (1.10 mmol) zinc chloride, 14 mg (0.012 mmol) tetrdds (triphenylphosphine) palladium (0) in 4.0 ml THF, and 5-methylthiazol-2-litholite (prepared by adding 53.2 mg (0.53 mL, 0.83 mmol) of n-butyllithium (1.55 M solution in hexanes) to a cold solution (-78 ° C) 82.0 mg (0 , 83 mmol) 5-methylthiazole in 5.0 mL THF). 1H NMR (CDCl): δ 7.98 (2H, d, J = 7.8 Hz), 7.88 (1H, d, J = 1.5 Hz), 7.55 (2H, d, J = 7 , 8 Hz), 7.54 (1H, s), 7.45 (1H, dd, J = 1.5, 8.0 Hz), 7.35 (1H, d, J = 7.9 Hz), 6 , 48 (1H, t, J = 4.8 Hz), 4.38 (2H, q, J = 7.1 Hz), 2.51 (3H, s), 2.38 (2H, d, J = 4.8 Hz), 1.40 (3H, s), 1.32 (6H. S).

Ethyl 4 - [(5,6idihyxiro-5,5idimetic) -8- (2-thiazolyl) -2-naphthaltyl) thtinyl] benzoate (compound 15a)

A 2-lithothiazole solution was prepared by adding 41.2 mg (0.42 mL, 0.63 mmol) of n-butyllithium (1.5M solution in hexanes) to a cold solution (-78 ° C) 53.4 mg (0.63 mmol) thiazole in 1.0 mL THF. The solution was stirred for 30 minutes and then a solution of 113.9 mg (0.84 mmol) zinc chloride in 1.5 mL THF was added. The resulting solution was warmed to room temperature, stirred for 30 minutes, and then the organozinc compound was added through a tube to a solution of 200.0 mg (0.42 mmol) 4 - [(5,6-dihydro-5,5-dimethyl-8i (triiluo-methyl) and ethyl sulfonyl) ethyl oxy-naphthalenyl) -tinyl] -benzoate (compound G) and 12.4 mg (0.01 mmol) tetrakis (t ^ ^ jfei ^; ^] ^ 1 ^: phosphio) palladium (Ó) in 1 , 5 ml THF. The resulting solution was heated at 50 ° C for. 45 minutes, cooled to room temperature and diluted with saturated aqueous NH4CL. The mixture was extracted with EtOAc (40 mL) and the combined organic layers were washed with water and brine. The organic phase was dried over Na2SO4 and concentrated under reduced pressure to a yellow oil. Purification by column chromatography (silica, 20% EtOAc-hexanes) gave the title compound as a colorless oil. PMR (CDCl 3): δ 1.35 (6H, s), 1.40 (3H, t, J = 7.1 Hz), 2.42 (2H, d, J = 4.8 Hz), 4 , 38 (2H, q, J = 7.1 Hz), 6.57 (1H, t, J = 4.8 Hz), 7.33 (1H, d, J = 3.3 Hz), 7.36 (1H, d, J = 8.0 Hz), 7.46 (1H, dd, J = 1.7, 8.1 Hz), 7.55 (2H, d, J = 8.4 Hz), 7 , 87 (1H, d, J = 1.7 Hz), 7.92 (1H, d, J =

3.3 Hz), 8.00 (2H, d, J = 8.4 Hz).

Ethyl 4 - [(5,6idihydro-5,5idimethyl-18i (4-methylthiazolyl) -2-naphthalenyl) ethynyl] benzoate (compound 16)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6idihydIΌ-5,5idimetic-i8- (4i mtoylphthyl) -2-naphthalenyl) ethynyl] benzotsane (compound 1), 295.0 mg (0.617 mmol) 4 Ethyl [(5,6-dihylbo-5,5-dimethyl-8- (trifluoromtoyl):) ny-o-oxy22-naatenenyl) ethynyl] benzoate (compound G) was converted to the title compound (colorless solid) using 168.0 mg (1.23 mmol) zinc chloride, 16 mg (0.014 mmol) tetrakis (triphenylfbsimo) palladium (0) in 6.0 ml tHf, and 4 ^^ 10110201-2 - ^^ (prepared by adding 59.6 mg (0.60 mL, 0.93 mmol) of n-butyllithium (1.55 M solution in hexanes) to a cold solution (-78 ° C) 92, 0 mg (0.93 mmol) 4-methylthiazole in 6.0 ml THF). 1H NMR (CDCh): δ 8.00 (2H, d, J = 8.4 Hz), 7.80 (1H, d, J = 1.7 Hz), 7.55 (2H, d, J = 8 , 4 Hz), 7.45 (1H, dd, J = 1.7, 8.0 Hz), 7.35 (1H, d, J = 8.0 Hz), 6.87 (1H, s), 6.52 (1H, t, J = 4.7 Hz), 4.37 (2H, q, J = 7.2 Hz), 2.54 (3H, s), 2.39 (2H, d, J = 4.7 Hz), 1.40 (3H, t, J = 7.2 Hz), 1.33 (3H, s).

Ethyl 4 - [(5,6idihydIΌ-5,5-dimtaylOi8i (4.5idimethylthylzol-2-ik)) i2-nitalenyl) thtinyl] benzoate (compound 17)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydtΌ-5,5idimethyl-8 and (4-methyltinyl) -2-naphthalenyl) ethynyl] benzoate (compound 1), 200.0 mg (0.418 mmol ) 4 [(5A-dihydrr-5,5-dimethyl-8-itriifuoramethyl-ullycine) oxy-2-naphthalenyl) ethynyl] -benzoate and ethyl 708 (benzoate) (compound G) was converted to the title compound (colorless solid) using ii0.0 mg (0.84 mmol) zinc chloride, and 2 mg (0.0ii mmol) tetraks (triphenylphosphine) palladium (0) in 20 ml THF, and 4,5-dimethylthiazol-2-yllithium (prepared by adding 40.2 mg (0.39 mL, 0.63 mmol) of n-butyllithium (i, 55 M solution in hexanes) to a cold solution (-78 ° C) 7.0 mg (0.63 mmol) 4.5-dimethylthiazole in 20 mL THF). 1 H NMR (CDCl): δ 8.00 (2H, d, J = 8.4 Hz), 7.82 (iH, d, J = i, 7 Hz), 7.54 (2H, d, J = 8 , 4 Hz), 7.43 (iH, dd, J = i, 7, 8.0 Hz), 7.33 (iH, d, J = 8.0 Hz), 6.45 (iH, t, J = 4.9 Hz), 4.38 (2H, q, J = 7, and Hz), 2.4i (3H. s), 2.40 (3H, s), 2.37 (2H, d, J = 4.9 Hz), i, 40 (3H, t, J = 7, and Hz), i, 32 (6H, s).

4 - [(5-16-dihydro-5,5-dimethyl-8-1,2-methyl-5-pyridyl) -2-naphthalenyl) ethynyl] benzoic acid (compound i8)

Solution 8.7.7 (0, i94 mmol) 4 - [(5,6-dihydro-5,5-dimethyl-8- (2-methyl-5-pyridyl) -2-naphthalenyl) ethynyl] ethynyl] benzoate. Ethyl compound (i2 compound ) and 40.7 mg (0.969 mmol) LiOH-ltyO in 3 mL THF / water (3: i, by volume), stirred overnight at room temperature. The reaction was quenched by the addition of saturated aqueous NIUCl solution and extracted with EtOAc. The combined organic layers were washed with water and brine, dried over Na2SO4 and concentrated under reduced pressure to give the title compound as a colorless solid. 1 H NMR ^ -DMSO): δ 8.4i (iH, d, J = i, 9 Hz), 7.90 (2H, d, J = 8.3 Hz), 7.63 (iH, dd, J = 2.3, 7.9 Hz), 7.55 (2H, d, J = 8.3 Hz), 7.49 (2H, m), 7.33 (iH, d, J = 7.8 Hz) , 6.95 (iH, s), 6, ii (iH, t, J = 4.5 Hz), 2.52 (3H, s), 2.37 (2H, d, J = 4.6 Hz) , and, 3i (6H, s).

4 - [(5,6-dihydro-5,5-dimethyl-8- (2-pyridyl) -2-naphthalenyl) ethynyl] benzoic acid (compound i9)

Solution 80.0 mg (0.96 mmol) of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (2-pyridyl) -2-naphthalene) ethynyl] benzoate (compound i0) and 20.6 mg (0.49i mmol) LiOH-H2O in 3 mL THF / water (3: i, by volume), stirred overnight at room temperature. The reaction was quenched by the addition of a saturated aqueous NH4Cl solution and extracted with EtOAc. The combined organic layers were washed with water and brine, dried over Na2SO4 and concentrated under reduced pressure to give the title compound as a colorless solid. iH NMR (d6-DMSO): δ 8.64 (iH, m), 7.94 (2H, d, J = 8.3 Hz), 7.87 (iH, dt, J = i, 7, 7, 8 Hz), 7.58 (2H, d, J = 9.3 Hz), 7.50 (iH, d, J = 8.2 Hz), 7.47 (2H, s), 7.37 (iH , m), 7.25 (iH, s), 6.30 (iH, t, J = 4.6 Hz), 2.39 (2H, d, J = 4.6 Hz), i, 3i (6H , s).

4 - [(5b-dihydroHA-dimethyl -, 1 - methylphenyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 20)

To a solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (3-methylphenyl) -2-naphthalenyl) ethinyl] benzoate (compound 2) 30.0 mg (0.07i mmol) in 3 mL EtOH and 2 mL THF were added 28.0 mg (0.70 mmol, 0.7 mL) NaOH (i, 0 M aqueous solution). The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 0% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1 H NMR (DMSO): δ 7.90 (2H, d, J =

8.5 Hz), 7.59 (2H, d, J = 8.5 Hz), 7.46 (2H, s), 7.32-7, i3 (4H, m), 7, i0 (iH, s), 6.98 (iH, t, J = 4.5 Hz), 2.34 (3H, s), 2.3i (2H, d, J = 4.5 Hz), and, 30 (6 H , s).

4 - [(5,6-dihydro-5,5-dinhetyl-8-4-ethylphenyl) -2-nattalenene) ethynyl] benzoic acid (compound 21)

To a solution of ethyl 4 - [(5-8-dihydro-5,5-dimethyl-8- (4-ethynylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 5) 47.0 mg (0, i08 mmol) in 3 ml EtOH and 2 mL of THF was added 28.0 mg (0.70 mmol, 0.7 mL) NaOH (i, 0 M aqueous solution). The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 0% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. iH NMR (DMSO): δ 7.90 (2H, d, J = 8.3 Hz), 7.59 (2H, d, J = 8.3 Hz), 7.46 (2H, s), 7, 29 - 7.2i (4H, m), 7.02 (iH, s), 6.0i (iH, t, J = 4.5 Hz), 2.64 (2H, q, J = 7.5 Hz ), 2.33 (2H, d, J = 4.5 Hz), i, 29 (6H, s), i, 22 (3H, t, J = 7.5 Hz).

4 - [(5-8-dihydro-5,5-dimethyl-8- (4-methoxyphenyl) -2-naphthyl! Enyl) ethynyl] benzoic acid (compound 22)

188 705

To a solution of ethyl 4 - ['e5,6-dihydao-5,5-dimethy-8- (4-methoxy ^' enyl) -2-naphthalenyl) ethynyl] benzoate (compound 8) 80.0 mg (0.183 mmol) in 3 mL EtOH and 2 mL THF were added 40.0 mg (1.00 mmol, 1.0 mL) NaOH (1.0 M aqueous solution). The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H NMR (DMSO): δ 7.90 (2H, d, J = 8.3 Hz),

7.60 (2H, d, J = 8.3 Hz), 7.45 (2H, s), 7.24 (2H, d, J = 8.6 Hz), 7.02-6.89 (3H , m), 5.98 (1H, t, J = 4.4 Hz), 3.79 (3H, s), 2.31 (2H, d, J = 4.7 Hz), 1.29 (6 H, s).

4 ~ [(5.6 ~ dihydla1-5.5 ~ dimethyl-8- (4-trifluoaomethylphenyl 5 ~ 2-naphthalenyl) -ennylbenzoic acid (compound 23)

To a solution of ethyl 4 - [(5,6-dihydao ~ 5.5 ~ dimethyl-8- (4-trifluoromethylphenyl) -2-naphlethyl) ethynyl] benzoate (compound 9) 70.0 mg (0.148 mmol) in 3 ml EtOH and 2 mL THF added 60.0 mg (1.50 mmol, 1.50 mL) NaOH (1.0 M aqueous solution). The solution was heated to 50 ° C for 2 hours, cooled to room temperature, and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H NMR (DMSO): δ 7.90 (2H, d, J = 8.3 Hz), 7.80 (2H, d, J = 8.1 Hz), 7.61-7.47 (6H, m ), 6.97 (2H, s), 6.16 (1H, t, J = 4.5 Hz),

2.37 (2H, d, J = 4.6 Hz), 1.30 (6H, s).

4- [e5,6-dihydao-5,5-dimethyl-8- (3,5-dimethylphenyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 24)

To a solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8-e-3,5-d-methylphenyl) -2-naphthalenyl) ethynyl] benzoate (compound 4) 90.0 mg (0.207 mmol) in 3 ml EtOH and 2 ml THF added 48.0 mg (1.20 mmol, 1.20 ml) NaOH (1.0 M aqueous solution). The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H nMr DMSO): 8 7.90 (2H, d, J = 8.2 Hz), 7.59 (2H, d, J = 6.2 Hz), 7.45 (2H, s), 7.00 (1H, s), 6.97 (1H, s), 5.97 (1H, t, J = 4.5 Hz), 2.31 (2H, d, J = 4.5 Hz), 2.30 (6H, s), 1.29 (6H, s).

4 - [(5.6 ~ calcium-5.5-dimethic acid ~ 8 ~ (4-chlorophenyl) -2-naphthalene) To) ethynyl] benzoic acid (compound 25)

To a solution of ethyl 4- [e5,6-dihydro-5.5-dimethyl-8- (4-chlorophenyl) -2-naphadenyl) ethynyl] benzoate (compound 7) 80.0 mg (0.181 mmol) in 3 ml EtOH and 2 ml THF added 48.0 mg (1.20 mmol, 1.20 ml) NaOH (1.0 M aqueous solution). The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H NMR (DMSO): δ 7.90 (2H, d, J = 8.3 Hz), 7.60 (2H, d, J = 8.3 Hz), 7.51-7.48 (4H, m ), 7.34 (2H, d, J = 8.4 Hz), 6.97 (1H, s), 6.07 (1H, t, J = 4.5 Hz), 2.34 (2H, d , J = 4.6 Hz), 129 (6H, s).

4 ~ [(5.6 ~ DIHYD ~ 5.5 ~ dimethyl ~ 8 ~ (3-pilidyl) -2-naphthyl) ethyl> yyl] bemoic acid (compound 26)

To a solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (3-piydyl) -2-naphthalenyl) ethynyl] benzoate (compound 11) 45.0 mg (0.110 mmol) in 3 mL EtOH and 2 ml THF added 48.0 mg (1.20 mmol, 1.20 ml) NaOH (1.0 M aqueous solution). The solution was heated to 50 ° C for. 2 hours, cooled to room temperature, and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H NMR (DMSO): δ 8.60 (1H, d, J = 4.6 Hz), 8.55 (1H, s), 7.90 (2H, d, J = 8.3 Hz), 7- 76 (1H, d, J = 7.5 Hz), 7.60 (2H, d, J = 8.3 Hz), 7.51-7.48 (3H, m), 6.94 (1H, s ), 6.14 (1H, t, J = 4.5 Hz), 2.37 (2H, d, J = 4.5 Hz), 1.31 (6H, s).

4- [(5,6-dihydro-5,5-dimethyl-8- (2-methylphenyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 27)

To a solution of ethyl 4 ~ [(5,6-dihydao-5,5-dimethyl-8- (2-menylenyl-2-nataalenyl) ethynyl] ethyl benzoate (compound 3) 80.0 mg (0.190 mmol) in 3 ml of EtOH and 2 ml of THF 60.0 mg (1.50 mmol, 1.50 ml) NaOH (1.0 M aqueous solution) were added The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 10% HCl After extraction with EtOAc and then after

188 Drying over Na2SO4 and removal of solvents under reduced pressure gave the title compound as a colorless solid. 1 H NMR (DMSO): δ 7.89 (2H, 25 d, J =

8.4 Hz), 7.57 (2H, d, J = 8.4 Hz), 7.46 (2H, s), 7.29-7.14 (4H, m), 6.59 (1H, s), 5.90 (1H, t, J = 4.7 Hz), 2.39 (2H, m), 2.60 (3H. s), 1.39 (3H, s), 1.29 ( 3H, s).

4 - [(5,6-dihydro-5,5-dimethyl-8- (3-hydroxyphenyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 28)

To the solution 4 - [(5,6-dihyd.rr ^ -i ^,; ^^ ii ^ u. ^ T ^ yo ^ ł ^ - ^ (i3 - ((2,2-dimethyl) ^ t ^ y ethyl) ethylsiloxyphenyl) -2-naphthalenyl) ethynyl] benzoate (compound H) 40.0 mg (0.076 mmol) in 3 ml EtOH and 2 ml THF added 40.0 mg (1.00 mmol, 1.00 mL) NaOH (1.0 M aq.) The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H NMR (d6-acetone): δ 7.90 (2H, d, J = 8.3 Hz), 7.49 (2H, d, J = 8.4 Hz), 7.35 (2H, s), 7.15-7.07 (2H, m), 6.77-6.69 (3H, m), 5.92 (1H, t, J = 4.7 Hz), 225 (2H, d, J = 4.7 Hz), 1.23 (6H, s).

4 - [(5,6-dihydro-5,5-dimethyl-8- (4-hydroxyphenyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 29)

To the solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4 - ((2,2-dimethylethyl) dimethylsiloxyphenyl) -2-naphthalenyl) ethynyl] benzoate (compound Γ) 75.0 mg (0.143 mmol) in 3 mL EtOH and 2 mL THF added 60.0 mg (1.50 mmol, 1.50 mL) NaOH (1.0 M aqueous solution) The solution was heated to 50 ° C for 2 hours, cooled to room temperature and acidified with 10% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1H NMR (d6-acetone): δ 8.01 (2H, d, J = 8.3 Hz), 7.59 (2H, d, J = 8.4 Hz), 7.45 (2H, s), 7.20-7.17 (3H, m), 6.92-6.89 (2H, m), 5.97 (1H, t, J = 4.7 Hz), 2.35 (2H, d , J = 4.7 Hz), 1.34 (6H, s).

4 - [(5,6-dihydric-5,5-dimethyl-8- (5-methylthi; azol-2-yl) -2-naphthalenyl) ethynyl] benzoic acid (compound 30)

To a solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (5-mtly) otiaoo2-2l) lo2-2-ntaphthalenes) o) ethyl] benzoate (compound 15) ( 100 mg, 0.23 mmol) and 4 mL EtOH at room temperature added aqueous NaOH (1 mL, 1 M, 1 mmol). The resulting solution was heated to 50 ° C for an hour and concentrated under reduced pressure. The residue was suspended in a solution of CH2Cl2 and ether (5: 1) and acidified to pH 5 with 1M aqueous HCl. The layers were separated and the organic layer was washed with brine, dried (Na2SO4), filtered and the solvents removed under reduced pressure to give the title compound as a white solid. 1H NMR (d6-DMSO): δ 7.96 (1H, d, J = 1.7 Hz), 7.95 (2H, d, J = 8.0 Hz), 7.65 (2H, d, J = 8.0 Hz), 7.64 (1H, s), 7.53 (1H, dd, J = 1.7, 8.0 Hz), 7.46 (1H, d, J = 8.0 Hz ), 6.59 (1H, t, J = 4.5 Hz), 2.50 (3H, s), 239 (2H, d, J = 4.5 Hz), 1.27 (6H, s) .

4 - [(5,6-dihydro-5,5-dimethyl-8- (2-thiazolyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 30a)

Solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (2-thiazolyl) -2-naphthalenyl) ethynyl] benzoate (compound 15a) and 8.5 mg (0.20 mmol) kiOH- H2O in 3 mL THF / water (3: 1, by volume), stirred overnight at room temperature. The reaction was quenched by the addition of saturated aqueous NH4Cl solution and extracted with EtOAc. The combined organic layers were washed with water and brine, dried over Na2SO4 and concentrated under reduced pressure to give the title compound as a colorless solid. PMR (d6-DMSO): δ 1.29 (0H, s), 2.42 (2H, d, J = 4.6 Hz), 6.08 (111, t, J = 4.6 Hz), 7 , 51 (2H, m), 7.62 (2h, d, J = 8.2 Hz), 7.77 (1H, d, J = 3.3 Hz), 7.93 (2H, d, J = 8 , 2 Hz), 7.98 (1H, d, J = 3.3 Hz).

4 - [(5,6-dihydro-5,5-dimethyl-8- (4-methylthiazol-2-yl) -2-naphthalenyl) ethyldic acid) (4-oxo) (oxo (compound 31)

To a solution of ethyl 4 - [(5,6-dihydrogen ^ 5,5-dimethyl-8- (4-methylthiazolyl) ^ 2 ^ - ^ aftalenyl) ethynyl] benzoate (compound 16) (145.0 mg, 0.34 mmol) and 4 ml EtOH at room temperature added aqueous NaOH (1 ml, 1M, 1 mmol). The resulting solution was heated to 50 ° C for.

188 705 hour and concentrated under reduced pressure. The residue was suspended in a solution of CH2O2 and ether (5: 1) and acidified to pH 5 with 1M aqueous HCl. The layers were separated and the organic layer was washed with brine, dried (Na2SO4), filtered and the solvents removed under reduced pressure to give the title compound as a white solid. 1H NMR (d6-DMSO): δ 7.94 (2H, d, J = 8.1 Hz), 7.87 (1H, d, J = 1.6 Hz),

7.63 22H, d, J = 8.3 Hz), 7.50 0H, dd, J = j 1.6, 8.1 Hz), 7.45 11H, d, J = 8.1 Hz), 7.27 0H, s), 6.58 (1H, t, J = 4.8 Hz), 2.43 (3H, s), 2.37 (2H, d, J = 4.8 Hz), 1 , 26 (6H, s).

4 - [(5,6-dihydro-5,5-dimethyl-8- (4.5-dimetic] ttazo] -2-iio) -2-yai-lalenyl) eynyl-yl] benzoic acid (compound 32)

To a solution of ethyl 4 - [(5,6-dihydιΌ-5,) - dimethyl-8- (4,5-dimethylthiazol-2ii] o-2-naphlafflenyl) ethynyl] benzoate (compound 17) (58.0 mg, 0.13 mmol) and 4 ml EtOH at room temperature added aqueous NaOH (1 ml, 1 M, 1 mmol). The resulting solution was heated to 50 ° C for an hour and concentrated under reduced pressure. The residue was suspended in a solution of CH2 Cl2 and ether (5: 1) and acidified to pH 5 with 1M aqueous HCl. The layers were separated and the organic layer was washed with brine, dried (Na2SO4), filtered and the solvents removed under reduced pressure to give the title compound as a white solid. 1H NMR (d6-DMSO): δ 7.94 (2H, d, J = 8.4 Hz), 7.86 (2H, d, J = 1.6 Hz), 7.61 (2H, d, J = 8.3 Hz), 7.50 (1H, dd, J =

1.6, 8.0 Hz), 7.45 (1H, d, J = 8.0 Hz), 6.51 (1H, t, J = 4.9 Hz), 2.37 (3H, s) , 2.36 (2H, d, J =

4.6 Hz), 2.32 (3H, s), R26 (6H, s).

Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (5-methyl-2-thieylS-2-naphthalcyyl) ethyl] beoisoate (compound 33)

Using the same general procedure as in the preparation of ethyl 4 - [(5.6-dihydro-5,5-dimethyl8- (4-methylpheylS-2-naphthalenyl) ethyl] ethyl] benzoate (compound 1), 170.0 mg (0.366 mmol ) 4 - [(5.6-dihy'dro-5,5-dimethoxy] -8- (trifluoromethyl] sulfonyl) oxy-2-naphthalenic]) ethylic]] ethyl beoisoate (compound G) was converted to the title compound (colorless body) solid) using 202.0 mg (1.48 mmol) zinc chloride, 24 mg (0.022 mmol) tetrakisitritcinyk) phosphino) palladium (O) in 20 ml THF, and 5-mathyl-2-lithothiofey (prepared by adding 58.6 mg (0.36 mL, 0.915 mmol) of n-butyllithium (2.5 M solution in hexanes) to a cold solution (-78 ° C) 89.8 mg (0.915 mmol) 2-methylthiophene in 2.0 mL THF). 1H NMR (CDCb): δ 8.00 (2H, d, J = 8.3 Hz), 7.59 (1H, d, J = 1.7 Hz), 7.55 (2H, d, J = 8.2 Hz), 7.43 (1H, dd, J = 1.7, 8.0 Ηε), 7.35 (1H, d, J = 8.0 Hz), 6, J ^ '7 (1H , d, J = 3.5 fk), 6.74 (1H, d, J = 2.8 Hz), 6.15 (1H, t, J = 4.8 Hz), 4.38 (2H, q , J = 7.1 Hz), 2.52 (3H, s), 2.32 (2H, d, J = 4.0 Hz), 1.40 (3H, t, 7.1 Hz), 1, 32 (6H, s).

Ethyl 4 - [(5,6-dihydro-5.5-dimethyl-8- (2-thienyl) -2-naphthalenyl) ethyl] beysoate (compound 33a)

Using the same general procedure as in the preparation of ethyl 4 - [(5,6-dihydr ^ - ^^, 5-dimethyl-8- (4-methylphenyl) -2-naphthaleyyl) ethynyl] benzoate (compound 1), 250.0 mg (0.52 mmol) 4- | KŚ, 6-dihydro-5,5-dimetic] -8- (trifluoro-methyl] ulffoyl] ca.-2-nyatalenyl] ethynyl] -benzoate (compound G) was converted to the title compound ( colorless solid) using 186.8 mg (1.37 mmol) of zinc chloride, 37.1 mg (0.03 mmol) tetrί ^^ 1 ^ ii ^ (t ^ t ^ iie ^ ίyylphosphinyl) palladium (0) and 2-lithothiophene (prepared by the addition of 65.9 mg (0.69 ml, 1.03 mmol ) n-butyllithium (1.5 M solution in hexane) to a cold solution (-78 ° C) 86.5 mg (1.03 mmol) thiophene in 1.0 mL THF). PMR (CDCl3): δ 1.33 (6H, s), 1.36 (3H, t, J = 7.1 Hz), 2.38 (2H, d, J = 4.7 Hz), 4.34 (2H, q, J = 7.2 Hz), 6.25 (1H, t, J = 4.7 Hz), 7.13 (2H, m), 7.47 (4H, m), 7.62 (2H, d, J = 8.5 Hz), 8.00 (2H, d, J = 8.5 Hz).

4 - [(5,6-dihydro-5,5-dimethyl-8- (5-methyl-2-thienyl) -2-naphthalenyl) ebyyyl] benzoic acid (compound 34)

To a solution of ethyl 4 - [(5,6-dihydro-5.5-dimethyl-8- (5-methyl-2-thienyl) -2-naphthalenyl) citinyl] benzoate (compound 33) (35.0 mg, 0.082 mmol) in 2 ml EtOH and 1 ml THF at room temperature were added aqueous NaOH (1 ml, 1 M, 1 mmol). The resulting solution was stirred at room temperature overnight and then acidified with 30% HCl. Extraction with EtOAc followed by drying over Na2SO4 and removal of the solvents under reduced pressure gave the title compound as a colorless solid. 1 H NMR (d6-acetone):

188 705 δ 8.03 (2H, d, J = 8.6 Hz), 7.63 (2H, d, J = 8.6 Hz), 7.54-7.48 (3N, m), 6.89 (1H, m), 6.18 (1H, t, J = 4.7 Hz), 2.49 (3H, s), 2.35 (2H, d, J = 4.7 Hz), 1.32 (6H, s).

4 - [((, 6-dlhydiΌ-5,5-dimethic acid · kr-8- (2-thikinio) -2-naphthyl) ethinyl Zorbenzoic acid (compound 34a)

Using the same general procedure as for the manufacture.

4 - [(5,6-dihydro-5,5-dimethyl-8- (2-thiazzyl) -2-naphthalenyl) ethynyl] benzoic acid (compound 30a), 70.0 mg (0.17 mmol) 4- [ Ethyl (5,6-dibydo-5,5-dichloro-8- (2-oxy) -2-naphthalenyl) ethznaly] benzoate (compound 33 a) was converted to the title compound (colorless solid) using 17.8 mg (0 , 42 mmol) LiOH in H2 O. PMR (d 6-DMSO): δ 1.27 (6H, s), 2.33 (2H, d, J = 4.9 Hz), 6.23 (1H, t , J = 4.9 Hz), 7.14 (2H, m), 7.38 - 7.56 (4H, m),

7.61 (2H, d, J = 8.3 Hz), 7.92 (2H, d, J = 8.3 Hz).

5,6-dlhydro-5,5-dimethyl-8- (4-methylyfnyl) -2-naphthalecarboxylic acid (compound K)

A solution of .3,4-dihy''dro-1- (4-methyl-phenyl) -4,4-dimethyl) -7-bromonaphthalene (compound D) (250.0 mg, 0.764 mmol) in 2.0 mL THF was cooled to -78 ° C and 1.0 ml t-butyllithium (1.68 mmol, 1.7 M solution in pentane) was added slowly. After stirring for one hour at -78 ° C, gaseous CO2 (formed by evaporation of dry ice, and passed through a drying tube) was bubbled through the mixture for 1 hour. The solution was then allowed to warm to room temperature and quenched with 10% HCl. After extraction with EtOAc, the combined organic layers were washed with H 2 O and saturated aqueous NaCl solution, and dried over MgSO 4. After removal of all solids under reduced pressure and washing the solid with hexanes, the title compound was obtained as a colorless solid. 1H NMR (CDCl 3): δ 7.94 (1H, dd, J = 1.8, 8.1 Hz), 7.76 (1H, d, J = 1.8 ΗζΧ 7.4.5 (1H, d, J = 8, 1 Hz ^ 7.24 (4H, ηή, 6.61 (1H, t, J = 4.7 Hz ^ 2, 20 (3H, s)} 2, 2 (5 (2H, d, J = 4.7 Hz), 1.35 (6H, s).

Ethyl 7 - [[((, 6-dihydrido - (, (- dimethyl-8- (4-methylphenyl) -2-naphthalenenyl) carbonyl] amlno] benzoate (compound 35)

Solution 120.0 mg (0.58 mmol) of 5,6-dihydro-5,5-dimethy-8- (7-methyiophene) 2-naphthalecarboxylic acid (compound K), 115.0 mg (0.70 mmol) 7 -amino-ethyl dream, 145.0 mg (0.76 mmol) chlorohydride (- (3-dimethylmlinopropyl) -3-ttoylkydbodimide and 924 mg (0.76 mmol) 4-dimethyldimidopyridine in 6.0 ml DMF was stirred overnight at room temperature. Ethyl acetate was added and the resulting solution was washed with H2O, saturated aqueous NaHCO3, and saturated aqueous NaCl, then dried over MgSO4. After removal of the solvent under reduced pressure, the product was isolated as a colorless solid by column chromatography (10 to 15% EtOAc / hexanes). 1 H NMR (CDCl3): δ 8.02 (2H, d, J = 8.7 Hz), 7.72 (2H; m), 7.65 (2H, d, J = 8.7 Hz), 7.52 (1H, d, J = 1.8 Hz), 7.48 (1H, d, J = 8.0 Hz), 7.25 (4H, m), 6.15 (1H, t, J = 4.9 Hz) , 4.36 (2H, q, J = 7.1 Hz), 2.40 (3H, s), 2.38 (2H, d, J = 4.9 Hz), 1.39 (3H, t, J = 7.1 Hz), 1.37 (6H, s).

7 - [[(5,6-dhydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) kaybonyl] mineo] bknzoic acid (compound 36)

To a solution of 26.5 mg (0.06 mmol) of ethyl 7 - [[(5,6-dihydro-5,5-dimethyl-8- (7-methyllyfnyl) -2-naphthalenzyl) carbonyl] amino] benzoate (compound 35) 270.1 mg NaOH (6.00 mmol, 3.0 mL 2M aqueous solution) was added in 3.0 mL EtOH and 4.0 mL THF. After stirring at room temperature for 72 hours, the reaction was quenched with 10% HCl. Extraction with EtOAc and drying of the organic layers over MgSO4 and removal of the solvent under reduced pressure gave a solid. Crystallization from CH3CN gave the title circular as a colorless solid. 1H NMR (d6-DMSO): δ (1H, s), 7.91 (5H, m), 7.54 (1H, d, J = 8.1 Hz), 7.75 (1H, d, J = 1.7 Hz), 7.23 (4H, s), 6.04 (1H, r, J = 4.4 Hz), 2.35 (5H, s), 1.33 (6H, s).

Ethyl 4- [[(5,6-d ^ ydr ^ -5,5-dlmktzl-8- (4-methylphenyl) -2-naphthyl) carbonyl] oxy] benzoate (compound 37)

Solution 25.0 mg (0.086 mmol) of acid (, 6-d-dihydro-5,5-dimethyl-8- (7-mfifenzly) -2 n-naphthalene carboxylic acid (compound K), 17.5 mg (0.103 mmol) 4- ethyl hydroxybknzoxane,

21.4 mg ^ ¢, 1112 mmolt of hydrochloride (- (3-dimethoxymammopropyio-33-ethylcarbodiimide)

188 705 and 126 mg (0.103 mmol) 0-dimethylaminopyridine in 20 mL DMF was stirred overnight at room temperature. Ethyl acetate was added and the resulting solution was washed with H2O, saturated aqueous NaHCO solution3, and saturated aqueous NaCl solution, before drying over MgSO4. After removal of the solvent under reduced pressure, the product was isolated by column chromatography as a pale yellow solid (10% EtOAc / hexanes). 1H NMR (CDCl 3): δ 8.08 (2H, d, J = 8.1 Hz), 8.05 (1H, dd, J = 1.8, 8.1 Hz), 7.89 (1H, d, J = 1.8 Hz), 7.50 (2H, d, J = 8.1 Hz), 7.22 (5H, m), 6.05 (1H, t, J = 4.7 Hz) , 4.37 (2H. q, J = 7.1 Hz), 2.39 (2H, d, J = 4.7 Hz), 2.38 (3H, s), 1.39 (3H, t, J = 7.1 Hz) , 1.37 (6H, s). 2-trimethylsilyl 4-trimethylsilyl 4-[[(-, 6-dihydro-5,5-dimethyl-8- (4-methyl) oeene) -2-na: yalenyl) carbonyloxy] benzotsane (compound 38)

Solution 93.5 mg (0.320 mmol) of 5.67-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalene carboxylic acid (compound K), 76.0 mg (0.319 mmol) of 2-trimethylsilylethyl 4-hydroxybenzoate mg (0.417 mmol) 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride and 51.0 mg (0.417 mmol) 4-dimethylaminopyridine in 4.0 ml dMf was stirred overnight at room temperature. Ethyl acetate was added and the resulting solution was washed with H2O, saturated aqueous NaHCO solution3 and saturated aqueous NaCl solution before drying over MgSO4. After removal of the solvent under reduced pressure, the product was isolated as a colorless solid by column chromatography (5% EtOAc / hexanes). 1H NMR (CDCl 3): δ 8.08 (2H, d, J = 8.0 Hz), 8.05 (1H, dd, J = 1.8, 8.1 Hz), 7.50 (1H, d, J = 8.1 Hz), 7.26-7.18 (1H, m), 6.05 (1H, t, J = 4.7 Hz), 4.42 12H, t, J = 8, 4 Hz), 2.40 (2H, d, J = 4.7 Hz), 2.39 (3H, s), 1.38 (6H, s), 0.09 (9H, s).

0-1 [(5,6-dihydro-5.5-dimethyl-8- (4-methγk) phthnyl) -2-raftaleryl) k-bacylloxybenzoic acid (compound 39)

110.0 mg (0.213 mmol) of 4 - [[(5,6-dihydro-5,5-dimethyl-8- (0-methylphenyl) -2-lentalenyl) carbonyl] oxy] 2-trimethylsilyl benzoate (compound 38) and 167.3 mg tetrabutyllane innovative (0.640 mmol, 0.64 mL 1M THF) in 2.0 mL THF was stirred at room temperature for 22 hours. Ethyl acetate was added and the resulting solution was washed with H2O and a saturated aqueous NaCl solution, then dried over MgSO4. Removal of the solvents under reduced pressure and washing of the residual solid with EtOAc and CH3CN gave the title compound as a colorless solid. 1H NMR (d-acetone): δ 8.10 (2H, d, J = 8.8 Hz), 8.06 (1H, dd, J = 2.0, 8.1 Hz), 7.82 ( 1H, d, J = 1.8 Hz), 7.64 (1H, d, J = 8.1 Hz), 7.35 (2H, d, J = 8.6 Hz), 7.25 (4H, m), 6.08 (1H, t, J = 4.7 Hz),

2.42 (2H, d, J = 4.7 Hz), 2.35 (3H, s), 1.39 (6H, s).

Ethyl 2-fluoro-4 - [[(5.6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) carbothryloyl] ethyl borate (compound 40)

Solution 115.0 mg (0.41 mmol) -, 6-dihydro-5,5-dimethyl-8- (4-mt-phenyl) -2-naphthalene carboxylic acid (compound K), 89.0 mg (0.49 mmol) 2- ethyl fluoro-0-α-minobenzotsane, 102.0 mg (0.53 mmol) 1- (3-dimethyl-ammopropyl) -3-ethylcarbodiimide hydrochloride and 65.0 mg (0.53 mmol) 4-din'leyylamirlopyridine in 5, 0 ml DMf was stirred at 50 ° C for an hour and then overnight at room temperature. Ethyl acetate was added and the resulting solution was dried over MgSO 4, washed with H 2 O, saturated aqueous NaHCO 3 and saturated aqueous NaCl. After removal of the solvent under reduced pressure and after column chromatography (20% EtOAc / hexanes), the product was isolated as a colorless solid. 1H NMR (CDCl 3): δ 7.96 (1H, s), 7.89 (1H, f J = 8.4 Hz), 7.70 (2H, m), 7.52 (1H, d, J = 1.9 Hz), 7.45 (1H, d, J = 8.1 Hz), 7.23 (5H, m), 6.04 (1H, t, J = 4.8 Hz), 4, 36 (2H, q, J = 7.1 Hz), 2.38 (3H, s), 2.35 (2H, d, J = 4.8 Hz),

1.39 (3H, t, J = 7.1 Hz), 1.36 (6H, s).

2-Fluoro-4- [|) 5,6-dihydro-5.57dmtetic acid -8- (0-methylphenyl-2-naphthalenyl) -carb'boryl] amlno] benzoic acid (compound 41)

To the solution 41.6 mg (0.091 mmol) 2-fluoro-4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenic)) - 2-raftαleryk) carbonyl] amiro] benzoate ethyl (compound 40) in 2.0 mL EtOH and 2.0 mL THF added 40.0 mg NaOH (1.00 mmol, 1.0 mL 1 M aqueous solution). After stirring at room temperature overnight, the reaction was quenched with 10% HCl. Extraction with EtOAc and drying of the organic layers over MgSO4 and removal of the solvent under reduced pressure gave a solid. Crystallization from CH3CN gave the title compound as a pale yellow solid. 1 H NMR (d 6 -acetone): δ 9.84 (iH, s), 7.94-7.83 (3H, m),

7.64 (iH, dd, J = 2.0 Hz), 7.53 (2H, d, J = 8, and Hz), 7.23 (4H, s), 6.04 (iH, t, J = 4.7 Hz), 2.38 (2H, d, J = 4.7 Hz), 2.36 (3H, s), and, 35 (6H, s).

Ethyl 4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) thiocarbonyl] amino] benzoate (compound 42)

Solution ii0.0 mg (0.25 mmol) of ethyl 4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) carbonyl] ^ anino] benzoate (compound 35) and i2i, 0 mg (0.30 mmol) [2,4bis (4-methoxyphenyl) -I, 3-dithia-2,4-diphosphane-2,4-disulfide] (Lawesson's reagent) in 2.0 ml of benzene at reflux overnight. After cooling to room temperature, the mixture was filtered and the filtrate was concentrated under reduced pressure. The title compound was isolated by column chromatography (i0 to 25% EtOAc / hexanes) as a yellow solid. 1 H NMR (CDCl): δ 8.92 (iH, s), 8.06 (2H, t, J = 8.5 Hz), 7.88-7.70 (3H, m), 7.42 (2H , d, J = 8, and Hz), 7, i8 (4H, m), 6.03 (iH, t, J = 4.7 Hz), 4.37 (2H, q, J = 7, and Hz )

2.38 (3H, s), 2.36 (2H, d, J = 4.7 Hz), i, 56 (3H, t, J = 7, and Hz), i, 35 (6H, s).

4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) thiocarbonyl] amino] benzoic acid (compound 43)

To a solution of 84.0 mg (0.84 mmol) of ethyl 4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) 2-raftaleryl) thiocarbonyl] amino] benzoate (compound 42 ) in 2.0 ml EtOH and 20 ml THF 60.0 mg NaOH (i, 50 mmol, i, 5 ml and M aqueous solution) were added. After stirring at room temperature overnight, the reaction was quenched with i0% HCl. Extraction with EtOAc, drying the organic layers over MgSO4 and removal of the solvent under reduced pressure gave a solid. Crystallization from CH3CN gave the title compound as a yellow solid. iH NMR (d6-acetone): δ i0.96 (iH, s), 8.05 (4H, m), 7.72 (iH, dd, J = 2.0, 8.0 Hz), 7.54 (iH, s), 7.46 (iH, d, J = 8, and Hz), 7.20 (4H, m), 6.04 (iH, t, J = 4.7 Hz), 2.38 (2H, d, J = 4.7 Hz), 2.33 (3H, s), and, 35 (6H, s).

2-acetyl-8-bromonaphthalene (compound L)

To a cold (i0 ° C) mixture of 44.0 g (0.2i2 mol) 2-bromonaphthalene and 34.0 g (0.255 mol) aluminum chloride in 400 ml nitrobenzene was added 2i, 0 g (267 mmol) of acetyl chloride. The mechanically stirred reaction mixture was warmed to room temperature and heated to 40 ° C for i8 hours. After cooling to 0 ° C in an ice bath, the reaction was stopped by adding i2 M HCl (70 mL). The layers were separated and the organic phase was washed with water and dilute aqueous Na2CO3 solution. After distillation through a ball condenser, followed by recrystallization from i0% EtOAc-hexane, 23 g of the title compound were obtained as a brown solid. iH NMR (CDCl3): δ 8.44 (iH, br s), 8.04-8, i0 (2H, m), 7.85 (iH, d, J = 8.5 Hz), 7.82 ( iH.d, J = 8.8 Hz), 7.64 (iH, d, J = 8.8 Hz), 2.73 (3H, s).

6-bromo-2-naphthalenecarboxylic acid (compound M)

To a solution of sodium hypochlorite (62 ml, 5.25% in water (by weight), 3.6 g, 48, i8 mmol) and sodium hydroxide (6.4 g, i60.6 mmol) in 50 ml of water was added a solution of 2- acetyl-6-bromonaphthalene (Compound L), 4 g (-06.06 mmol) in 50 mL and, 4-dioxane. The yellow solution was heated to 70 ° C in an oil bath for 2 hours, cooled to ambient temperature and extracted with ethyl ether (2 x 50 mL). The aqueous layers were diluted with NaHSO3 solution (until the indicator KI solution was colorless) and then acidified (pH <2) with N sulfuric acid to form a white precipitate. The mixture was extracted with ethyl ether and the combined organic phase was washed with saturated aqueous NaCl solution, dried (MgSO4) and concentrated to give 3.54 g (88%) of the title compound as a solid. iH NMR (DMSO-d6): 8.63 (iH, br s), 8.32 (iH, d, J = 20 Hz), 8, i0 (iH, d, J = 8.8 Hz), 8, 00-8.05 (2H, m), 7.74 (iH, dd, J = 2.0, 8.8 Hz).

Ethyl 6-bromo-2-naphthalenecarboxylate (Compound N)

To a solution of 6-bromo-2-naphthalene carbonyl (compound M) 3, ig, (-2.43 mmol) in ethanol (30 mL, 23.55 g, 5ii, 0 mmol) was added 8M sulfuric acid (2 mL) . The solution was heated at reflux for 30 minutes, cooled to room temperature and the reaction mixture was partitioned between pentane (i00 ml) and water (i00 ml). The aqueous phase was extracted with pentane (100 mL) and the combined organic layers were washed with saturated aqueous NaCl (100 mL), dried (MgSO 4) and concentrated to give an off-white solid. Purification by flash chromatography (silica, 10% EtOAchexane) gave the title compound as a white solid. 1H NMR (CDCl3): δ 8.58 (1H, br s), 8.10 (1H, dd, J = 1.7, 9 Hz), 8.06 (1H, d, J = 2 Hz), 7 , 83 (1H, d, J = 9 Hz), 7.80 (1H, d, J = 9 Hz), 7.62 (1H, dd, J = 2.9 Hz).

Ethyl (E) -4- (2- (5,6,7,8-te1aahydao-5,5-dimethyl ~ 8 ~ oxo-2-naphthalenyl) ethenyl] benzoate (compound O)

For a solution of 520.0 mg (2.00 mmol) 3.4 ~ dihydra-4,4-dimethyl-7-bromo-1 (2EΓ) ~ naphtha! Eno (compound B) and 510.0 mg (2.30 mmol ) Ethyl 4-vinylbenzoate in 4.0 ml of triethylamine (degassed by blowing with argon for 25 minutes), 124.0 mg (0.40 mmol) of tris (2-methylphenyl) phosphine were added, followed by 44.0 mg (0.20 mmol) of acetate palladium (II). The resulting solution was heated to 95 ° C for 2.5 hours, cooled to room temperature and concentrated under reduced pressure. Purification by column chromatography (10% EtOAc / hexanes) gave the title compound as a colorless solid. 1H NMR (CDCl): δ 8.19 (1H, d, J = 2.0 Hz), 8.03 (2H, d, J = 8.4 Hz), 7.69 (1H, dd, J = 2 , 0, 8.2 Hz), 7.57 (2H, d, J = 8.4 Hz), 7.45 (1H, d, J = 8.2 Hz), 7.20 (2H, s), 4.39 (2H, q, J = 7.1 Hz), 2.76 (2H, t, J = 8.5 Hz), 2.04 (2H, t, J = 6.5 Hz), 1, 41 (3H, t, J = 7.1 Hz, and 6H, s).

Ethyl (E) -4- [2- [5,6-dihydro-5.5- dimethyl-8- etaifluoromethylsulfonyl) oxy-2-naphthalenyl) ethenyl] benzoate (compound P)

To a cold (-78 ° C) solution of 440.0 mg (2.40 mmol) sodium bis (tr ^: met ^ and ^ silyl) amide in 10.0 mL THF was added 700.0 mg (200 mmol) (E) Ethyl 4- (2- (5,6,7,8 ~ tetaahydro-5,5 ~ dimethyl-8 ~ oxo-2-naphthalenyl) ethenyl] benzoate (compound O) as a solution in 25.0 ml THF. After mixing at -78 ° C for 1.5 hours, 960.0 mg (240 mmol) 2 [NEN] was added in one portionLbίs (tritluorometyk ^ sufί-nrylo) amino '] - 5 · -chloropirγdynty. After 30 minutes, the solution was warmed to 0 ° C and stirred for 3 hours. The reaction was quenched by the addition of a saturated aqueous NH4O solution and extracted with EtOAc. The combined extracts were washed with 5% aqueous NaOH, dried (Na2SO4) and the solvents removed under reduced pressure. The title compound was isolated as a colorless solid by column chromatography (7% EtOAc / hexanes). 1H NMR (CDCl 3): δ 8.04 (1H, d, J = 8.4 Hz), 7.57 (2H, d, J = 8.4 Hz), 7.52 (1H, s), 7 , 49 (1H, d, J = 8.0 Hz), 7.33 (1H, d, J = 8.0 Hz), 7.20 (1H, d, J = 16.4 Hz), 7.10 (1H, d, J = 16.4 Hz), 6.00 (1H, t, J = 4.9 Hz), 4.39 (2H, q, J = 7.1 Hz),

2.43 (2H, d, J = 4.9 Hz), 1.41 (3H, t, J = 7.1 Hz), 1.32 (6H, s).

Ethyl (Ej-4- [2- (5,6-dihyyiO-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) ethenyl] benzoate (compound 44)

A 4-lithotoluene solution was prepared at -78 ° C by adding 130.7 mg of t-butyllithium (2.04 mmol; 1.20 mL of 1.7 M solution in pentane) to a solution of 374.5 mg (2.20 mmol) 4-baomotoluene in 2.5 ml THF. After 30 minutes, a solution of 313.4 mg (2.30 mmol) ZnCl2 in 2.0 mL THF was added. The resulting solution was warmed to room temperature, stirred for

1.25 hours and then 285.0 mg (0.590 mmol) ^) - 4- (2- (5,6-dihydla'-5.5-dimethyl-8 - (riffuoromethylsulfonyl) oxy ~ 2 ~ naphthalenyl) etheny-] benesyl ethyl (compound P) and 29.0 mg (0.025 mmol) tetrakis (triphenylphosphine) panad (0) in 2.0 ml THF. The resulting solution was stirred at room temperature for an hour and then at 55 <0> C for 2 hours. After cooling to room temperature, the reaction was quenched by the addition of a saturated aqueous NH4Cl solution. The mixture was extracted with EtOAc and the combined extracts were washed with 5% aqueous NaOH, saturated aqueous NaCl and dried over Na2SO4, then concentrated under reduced pressure. The title compound was isolated by column chromatography (10% EtOAC / hexanes) as a colorless solid. 1H NMR (CDCl 3): δ 7.96 (2H, d, J = 8.1 Hz), 7.47 (2H, d, J = 8.1 Hz), 7.43-7.16 (7H, m), 7.07 (1H, d, J = 16.3 Hz), 6.93 (1H, d, J = 16.3 Hz), 5.97 (1H, t, J =

4.7 Hzz) 4.33 »(2H, q, J = 7.0 Hz), 2.41 ((H, s)) 2.33 ((H, d, J = 4, ^ Hz)) 138 ((H, t, J = 7.0 Hz), 1.33 (6 H, s).

(E) -4- [2- (5,6-dihydn, 5-dimethyl ^ - (4-methylphenyl) -2-naphtaenyl) ethenyl] benzoic acid (compound 45)

188 705

To a solution of 65.0 mg (0.190 mmol) (E) i4- [2i (5,6-dihydro-5,5-dimethyl-8- (4i methylphenyl ^ naphthalenyl ^ tenyl ^ enzoate) (compound 44) in 4.0 ml THF 30.0 mg LiOH (0.909 mmol, 1.0 mL 1.1 M solution) and 1.0 mL MeOH were added The solution was heated to 55 ° C for 3 hours, cooled to room temperature and concentrated under reduced pressure. in H 2 O and extracted with hexanes The aqueous layer was acidified to pH 1 with 10% HCl and extracted with Et2 O. The combined organic layers were washed with saturated aqueous NaCl solution, diluted with EtOAc to give a clear solution and dried over Na2SO4. The solvents were removed under reduced pressure to give the title compound as a colorless solid. 1H NMR (down-DMSO): δ 7.86 (2H, d, J = 8.4 Hz), 7.66 (2H, d, J = 8.4 Hz), 7.58 (1H, dd, J = 1.7, 8.1 Hz), 7.41 (1H, d, J = 8.1 Hz), 7.28 (1H, d, J = 16.5 Hz), 7.23 (4H, s ), 7.08 (1H, d, J = 1.7 Hz), 7.07 (1H, d, J = 16.5 Hz), 5.97 (1H, t, J = 4.6 Hz), 2.35 (3H, s), 2.31 (1H, d, J = 4.6 Hz), 1.29 (6H, s).

Ethyl 4i [2- (1,1-dimethyl-3- (4-methylphenyl) -5-indenyl) ethynyl] benzoate (compound 47)

A solution of 32.0 mg (0.187 mmol) 4ibromotoluene in 1.0 mL THF was cooled to -78 ° C and 2-4.0 mg 1-131 ^ x10111, ^ (0.375 mmol, 0.22 mL) added 1! M solution in pentane). The yellow solution was stirred for 30 minutes, after which 29.8 mg (0.219 mmol) ZnCA was added as a solution in 1.0 mL THF. The resulting solution was warmed to room temperature and after 30 minutes was added to a second flask containing 29.0 mg (0.062 mmol) of 4- [2i (1,1-dimethyl-3 (thiocyoromethylsullynyl)) ca. FF) and 2.9 mg (0.003 mmol) tttrakis (triphenylfbsfmo) palladium (0) in 1.0 ml THF. The resulting solution was heated to 50 ° C for an hour and then stirred at room temperature for 4 hours. The reaction was quenched by the addition of a saturated aqueous NH4Cl solution, followed by extraction with Et2O. The combined organic layers were washed with water, saturated aqueous NaCl solution and dried over MgSO 4, then concentrated under reduced pressure. The title compound was isolated as a colorless oil by column chromatography (10% Et2O / hexanes). 1H NMR (300 MHz, CDCl3): δ 8.03 (2H, d, J = 8.5 Hz), 7.66 (1H, s), 7.58 (2H, d, J = 8.5 Hz) , 7.50 (2H, d, J = 8.0 Hz), 7.46 (1H, d, J = 7.9 Hz), 7.38 (1H, d, J 5 = 7.7 Hz), 7.28 (2H, d, J = 9 Hz), 6.43 (1H, s), 4.40 (2H, q, J = 7.2 Hz), 2.43 (3H, s), 1, 41 (3N, t; + 6H, s).

4i [2- (1,1-dimethyl-3- (4-methylienyl) -5-indenyl) ethynyl]] benzoate (compound 48)

To a solution of 10.0 mg (0.025 mmol) of ethyl 4- [2- (1,1-dimethyl-3- (4-methylphenyl) -5-indenyl-ynyl-ynyl-benzoate (compound 47) in 0.5 ml of THF / H2O (3 : 1 v / v) 5.2 mg (0.12 mmol) LiOH H 2 O. After stirring at room temperature for 46 hours, the solution was extracted with hexanes and the aqueous layer was acidified with saturated aqueous NH 4 Cl solution. Solid NaCl was added and the resulting mixture was extracted with EtOAc. The combined organic layers were dried (Na2SO4) and concentrated under reduced pressure to give the title compound as a colorless solid. 1H NMR (300 MHz, d6-DMSO): δ 7.95 (2H, d, J = 8.3 Hz), 7.65 (2H, d, J = 8.3 Hz), 7.57 (2H, m), 7.49 (3H, m),

7.30 (2H, d, J = 7.9 Hz), 6.61 (1H, s), 2.36 (3H, s), 1.36 (6H, s).

3- (4-bromothiophenoxy) propionic acid

To a solution of 1.44 g (35.7 mmol) NaOH in 20.0 mL degassed H2O (purged with argon) was added 6.79 g (35.7 mmol) 4-bromothiophenol. The resulting mixture was stirred at room temperature for 30 minutes. A second flask was charged with 2.26 g (16.3 mmol) K · CO 3 and 15 ml degassed H2O. To this solution, 5.00 g (327 mmol) of - bromopropionic acid was added (in portions). The resulting potassium carboxylate solution was added to the sodium thiolate solution, and the resulting mixture was stirred at room temperature for 48 hours. The mixture was filtered and the filtrate extracted with benzene and the combined organic layers were discarded. The aqueous layer was acidified with 10% HCl and extracted with EtOAc. The combined organic layers were washed with saturated aqueous NaCl solution, dried over MgSO4 and concentrated under reduced pressure. The resulting solid was recrystallized from Et2O hexanes to afford the title compound as off-white crystals. 1H NMR (CDCl 3): δ 7.43 (2H, d, J = 8.4 Hz), 7.25 (2H, d, J = 8.4 Hz), 3.15 (2H, t, J = 7.3 Hz), 2.68 (2H, t, J = 7.3 Hz).

188 705

2.3- dihydro-8-bromo- (4H) -1-benzothiopyran-4-one

A solution of 3.63 g (13.9 mmol) of 3- (4-bromothiophenoxy) -propionic acid in 60 ml of methanesulfonic acid was heated to 75 ° C for 1.5 hours. After cooling to room temperature, the solution was diluted with H2O and extracted with EtOAc. The combined organic layers were washed with 2N aqueous NaOH, H2O and saturated aqueous NaCl solution, and then dried over MgSO4. Removal of the solvent under reduced pressure gave a yellow solid which was purified by column chromatography (3% EtOAc-hexanes) to give a pale yellow solid. 1H NMR (CDCl 3): δ 8.22 (1H, d, J = 2-1 Hz), 7.48 (1H, dd, J = 2.1, 8.3 Hz), 7.17 (1H, d, J = 8.5 Hz), 3.24 (2H, t, J = 6.4 Hz), 2.98 (2H, t, J = 6.7 Hz),

2.3- dihydro-6- (2-trimethylsilylethynyl) - (4H) -1-benzothiopyran-4-one

Solution of 1.00 g (4.11 mmol) 2,3-dihydro-6-bromo- (4H) -1-benzothiopyran-4-one and 78.3 mg (0.41 mmol) Cul in 15.0 ml THF and 6.0 ml Et2NH was purged with argon for 5 minutes. To this solution, 2.0 mL (1.39 g, 14.2 mmol) (trii ^ ^ ^ t ^] ^ yl) aeethyl was added, followed by 288.5 mg (0.41 mmol) of bis chloride (triferylryl) > sfino) palladium (Π). The resulting dark solution was stirred at room temperature for, 3 days and then filtered through a pad of celite, which was washed with EtOAc. The filtrate was washed with H2O and a saturated aqueous NaCl solution and dried over MgSO4. The title compound was isolated as an orange oil by column chromatography (4% EtOAc - hexanes). 1H NMR (CDCl 3): δ 8.13 (1H, d, J = 1.9 Hz), 7.36 (1H, dd, J = 2.1, 8.2 Hz), 7.14 (1H, d, J = 8.2 Hz), 3.19 (2H, d, J = 6.3 Hz), 2.91 (2H, d, J = 6.3 Hz), 0.21 (9H, s) .

2.3- dihydro-6-ethynyl- (4H) -1-benzothiopyran-4-one

Solution containing 600.0 mg (2.25 mmol) 2,3-dihydro-6- (2-trimethylsilylethinyl) (4H) -1-benzathopyran-4-one and 100.0 mg (0.72 mmol) K2CO3 in 15 ml MeOH was stirred at room temperature for 20 hours. The solution was diluted with H2O and extracted with Et2O. The combined organic layers were washed with H2O and a saturated aqueous NaCl solution, then dried over MgSO4. Removal of the solvents under reduced pressure gave the title compound as an orange solid. 1H NMR (CDCl3): δ 8.17 (1H, d, J = 1.8 Hz), 7.40 (1H, dd, J = 1.8, 8.2 Hz), 7.19 (1H, d , J = 8.2 Hz), 3.22 (2H, t, J = 8.3 Hz), 3.08 (1H, s), 2.94 (2H, t, J = 6.3 Hz).

Ethyl 4- [2- (6- (2,3-dihydro- (4H) -1-benzothiopyran-4-onyl)) ethynyl] benzoate

A solution of 405.0 mg (215 mmol) 2,3-dihydro-6-ethynyl- (4H) -1-benzothiopyran-4-one and 594.0 mg (2.15 mmol) of ethyl 4-iodo benzoate in 15 ml of Ethanol and 3 ml THF was purged with argon for 15 minutes. To this solution, 503.0 mg (0.72 mmol) of bis (triphenylphosphine) palladium (II) chloride and 137.0 mg (0.72 mmol) of CuI were added. The resulting solution was stirred for 20 hours at room temperature and then filtered through a pad of celite, which was washed with EtOAc. Removal of the solvents under reduced pressure gave a brown solid. Column chromatography (3% EtOAc-hexanes) gave the title compound as an orange solid. 1H NMR (d6-acetone): δ 8.15 (1H, d, J = 2.0 Hz), 8.02 (2H, d, J = 8.5 Hz), 7.69 (2H, d, J = 8.5 Hz), 7.61 (1H, dd, J = 2.1, 8.3 Hz),

7.40 (1H, d, J = 8.2 Hz), 4.35 (2H, q, J = 7.1 Hz), 3.40 (2H, t, J = 6.3 Hz), 2, 96 (2H, t, J = 6.3 Hz), 1.37 (3H, t, J = 7.1 Hz).

Ethyl 4- [2- (6- (4- (trifluoromethylsulfonyl) oxy- (2H) -1-benzothiopyraryl)) ethynyl] benzoate

To a solution of 221.9 mg (1.21 mmol) sodium bis (tr ^^ mt ^ t ^ l ^^ yl) -amide amide in 3.0 ml THF cooled to -78 ° C was added 370.0 mg (1, 10 mmol) ethyl 4- [2- (6- (2,3-dihydro- (4H) -1-benzothiopyran-4-oneyl)) ethynyl] benzoate in 4.0 ml THF. After 30 minutes, a solution of 2- [N, N-bis (triΠuoromeiyίosuiforylo) amiro) -5-ehioropyridine in 4.0 ml THF was slowly added. The mixture was slowly warmed to room temperature and quenched by the addition of saturated aqueous NH4Cl solution after 5 hours. The mixture was extracted with EtOAc and the combined organic layers were washed with 5% aqueous NaOH, H2 O and saturated aqueous NaCl solution before drying over MgSO4. Removal of the solvents under reduced pressure followed by column chromatography (4% EtOAc-hexanes) gave the title compound as a pale yellow solid. 1H NMR (d6-acetone): δ 8.12 (2H, d, J = 8.5 Hz), 7.66 (2H, d, J = 8.5 Hz), 7.56 (1H, d, J = 1.7 Hz), 7.49 (1H, dd, J = 1.7, 8.1 Hz), 7.40 (1H, d,

188 705

J = 8.1 Hz), 6.33 (1H, t, J = 5.7 Hz), 4.35 (2H, q, J = 7.1 Hz), 3.82 (2H, d, J = 5.7 Hz), 1.37 (3H, t, J = 7.1 Hz).

Ethyl 4- [2- (6- (4- (4-methyl-phenyl) - (2H) -1-benzothiopyran)) - ethynyl] benzoate (compound 49)

To a solution of 120.8 mg (0.70 mmol) 4-bromotoluene in 20 ml THF at -78 ° C was added 88.4 mg (1.38 mmol, 0.81 ml 1.7 M solution in pentane) t- butyllithium. After 30 minutes, a solution of 131.6 mg (0.97 mmol) ZnCl 2 in 20 mL THF was added and the resulting pale yellow solution was warmed to room temperature. After stirring for 40 minutes, the resulting solution was added to a second flask containing 129.2 mg (0.28 mmol) 4- [2- (6- (4 (trifluoromethylsulfonyl) oxy- (2H) -1-benzothiopyranyl)) ethylynyl] benzoate ethyl, 14.0 mg (0.012 mmol) tetrakis (triphenylphosphine) palladium (0), and 2.0 ml THF. The resulting solution was heated to 50 ° C for 5 hours, cooled to room temperature and quenched with the addition of saturated aqueous NH4CL solution. The mixture was extracted with EtOAc and the combined organic layers were washed with H2O and saturated aqueous NaCl solution, then dried (MgSO4) and concentrated to an orange oil. The title compound was isolated as a colorless solid by column chromatography (3 to 5% EtOAchexanes). 1H NMR (d-acetone): δ 7.98 (2H, d, J = 8.3 Hz), 7.58 (2H, d, J = 8.2 Hz), 7.44-7.38 (2H , m), 7.26-7.15 (5H, m), 6.14 (1H, t, J = 5.8 Hz), 4.34 (2H, q, J = 7.1 Hz), 3 , 53 (2H, d, J =

5.8 Hz), 2.37 (2H, s), 1.35 (3H, t, J = 7.1 Hz).

4- [2- (6- (4- (4-methyl-phenyl) - (2H) -1-beyzothiopyranyl)) - ethynyl] benzoic acid (compound 50)

To a solution of 29.0 mg (0-07 mmol) 4- [2- (6- (4- (4-methylphenyl) - (2H) -1-benzothiopyranyl)) ethynyl] ethyl beyzoate (compound 49) in 2.0 ml tHf and 2.0 ml EtOH added 160.0 mg (4.00 mmol, 2.0 ml 2 M aqueous solution). The resulting solution was stirred at 35 ° C for 2 hours, then cooled to room temperature and stirred for an additional 2 hours. The reaction was quenched with 10% aqueous HCl and extracted with EtOAc. The combined organic layers were washed with H2O and a saturated aqueous NaCl solution and dried over Na2SO4. Removal of the solvents under reduced pressure gave a solid which was washed with CH3CN and dried under high vacuum to give the title compound as a pale yellow solid. 1H NMR (down-DMSO): δ 7.90 (2H, d, J = 8.4 Hz), 7.59 (2H, d, J = 8.4 Hz), 7.40 (4H, m), 7,257.13 (4H, m), 7.02 (1H, d, J = 1.7 Hz), 6.11 (1H, t, J = 5.7 Hz), 3.54 (2H, d, J = 5.7 Hz), 2.34 (3H, s).

3,4-dihydro-4,4-dimethyl-7-acetyl-1 (2H) -naphthalenone (compound R) and 3,4-dihydro-4,4-dimethyl6-acetyl-1 (2HS-naphthalenone (compound S)

To a cold (0 ° C) mixture of aluminum chloride (26.3 g, 199.0 mmol) in dichloromethane (55 mL) was added acetyl chloride (15 g, 192 mmol) and 1,2.3,4-tetrahydro-1.1-dimethylnaphthalene ( 24.4 g, 152 mmol) in dichloromethane (20 mL) over 20 minutes. The reaction mixture was warmed to ambient temperature and stirred for 4 hours. Ice (200 g) was added to the reaction flask and the mixture was diluted with ether (400 mL). The layers were separated and the organic phase was washed with 10% HCl (50 mL), water (50 mL), 10% aqueous sodium bicarbonate solution and saturated aqueous NaCl solution (50 mL) before drying over MgSO 4. The solvent was removed by distillation and the resulting yellow oil was dissolved in benzene (50 ml).

To cold (0 ° C) acetic acid (240 mL) and acetic anhydride (120 mL) was added chromium trioxide (50 g, 503 mmol) in small portions over 20 minutes under argon. The mixture was stirred for 30 minutes at 0 ° C and diluted with benzene (120 ml). Using a dropping funnel, the benzene solution previously prepared was added over 20 minutes. After 8 hours, the reaction was quenched by careful addition of isopropanol (50 mL) at 0 ° C followed by water (100 mL). After 15 minutes, the reaction mixture was diluted with ether (1100 mL) and water (200 mL), then neutralized with solid sodium bicarbonate (200 g). The ether layer was washed with water (100 mL) and saturated aqueous NaCl (2 x 100 mL) and dried over MgSO4. Removal of the solvent under reduced pressure gave a mixture of isomeric diketones, which were separated by chromatography (5% EtOAc / hexanes). (Compound R): 1H NMR (CDCl3): δ 8.55 (1H, d, J = 2.0 Hz), 8.13 (1H, dd, J = 2.0, 8.3 Hz), 7, 53 (1H, d, J = 8.3 Hz), 2.77 (2H, t, J = 6.6 Hz), 2.62 (3H, s), 2.05 (2H, t, J = 6 , 6 Hz), 1.41 (6H, s). (compound S): 1 H NMR

188 705 (CDCl3): δ 8.10 (1H, d, J = 8.1 Hz), 8.02 (1H, d, J = 1.6 Hz), 7.82 (1H, dd, J = 1, 6, 8.1 Hz), 2.77 (2H, t, J = 7.1 Hz), 2.64 (3H, s), 2.05 (2H, t, J = 7.1 Hz), 1 , 44 (6H, s).

3.4- dibzdro-4.4-diethyl-7- (2- (2-ethyl-.1,3-dionsolysinyl)) -1 (2H) -naphthalenone (compound T)

Mixture 3 <4-dibydro-7,7-dimethyl-7-acetyl - ((2H) -naphthalenone (R) (140.0 mg, 0.60 mmol), ethylene glycol (55.0 mg, 0.90 mmol), p-tylenesulfonic acid monohydrate (4 mg) and benzene (25 ml) were heated to reflux using a Dean-Stark apparatus for 12 hours. The reaction was quenched with 10% aqueous sodium bicarbonate solution and extracted with ether (2 x 75 ml) The combined organic layers were washed with water (5 mL) and saturated aqueous NaCl (5 mL) and dried over MgSO4. Removal of the solvent under reduced pressure gave the title compound as an oil. 1H NMR (CDCl3): δ 8.13 (1H, d, J = 20 Hz), 4.64 (1H, dd, J = 2.0, 8.2 Hz), 7.40 (1H, d, J =

8.2 Hz ^ 3.97-4.10 m)) 3.70-3.83 (^ 2 ^, i) 2, ^^ t, J = 6.5 Hz ^ 2, <^^ t, J = 6.5

Hz), 1.64 (3H, s), 1.39 (6H, s).

(, 2,3 <4-tbspb - - - hydroxy - (- (7-methyl-phenyl) -7,7-dimethyl-7- (2- (2-methyl - (<3-dioxinanyl)) naphthalene (compound U)

To a solution (95 <7 mg (1.00 mmol) of p-tolyl magnesium bromide (1.0 ml; 1M solution in ether) in 2 ml THF was added a solution of 3,7-diby-'dro-4,4-dίmetrical'7 - (2- (2-methyl-1,3-dionsylanyl)) -1- (2H) -naphthalknon (Compound T) (35.0 mg, 0.52 mmol) in 5 mL THF. The solution was heated at reflux for 16 hours, cooled to room temperature and diluted with ether (50 mL) The solution was washed with water (5 mL), saturated aqueous NH4Cl (5 mL) and dried over MgSO4. Removal of the solvate under reduced pressure and column chromatography (5% EtOAc / hexanes) gave the title compound as a solid. 1H NMR (CDO3): δ 7.34 (2H, d), 4.21 (iH, s), 4, (3 (2H, d, J = 8.5 Hz), 4.08 (2H. D. J 8. 8.5 Hz). 3.88-3.99 (2H. M). 3.58-3775 (2H. M). 2.34 (3H. S). W ^ O (2H, m) , 1.79-1.90 (1H, m), 1.57 (3H, s), MS-bd (1H, m), 1.38 (3H, s), 1.31 (3H, s). 3,7-dhydro-1- (7-methylphenyl) -4,4-dimethyl-7-acetylnaphthyl (compound V)

A mixture of 1,2.3,4-tktrahyriyυ- (-hy ^^^ - 1- (4-metzZyftnykl) -7,7-dimethyl-7- (2-22-methylZo (, 3-diyksolanyl)) naphthalene (compound U ) 130.0 mg (0.38 mmol), p, ιτΙποικ ^ ιι! Tonic acid monohydrate (4 mg) and benzene (5 ml) were heated to reflux for 16 hours. After cooling to the reaction temperature, the reaction mixture was diluted with ether (100 ml) and washed with 10% aqueous sodium bicarbonate solution, water, and saturated aqueous NaCl solution. The organic layer was dried over MgSO 4 and the solvents removed under reduced pressure to give the title compound as a solid. 1H NMR (CDCl3): δ 7.83 (1H, dd, J = 1.8, 8.0 Hz), 7.66 (1H, d, J = 1.8 Hz), 7.45 (1H, d , J = 8.0 Hz), 7.25 (2H, d, J = 8.5 Hz), 7.22 (2H, d, J = 8.5 Hz), 6.03 (1H, t, J = 6.3 Hz), 2.77 (3H, s), 2.41 (3H, s), 2.37 (2H, d, J = 6.3 Hz), 1.36 (6H, s).

(E) -3 - ((, 6-dibydro-5,5-dimtyl-8- (4-methylphenyl) -2-naphthyl) -2-buteninyl (hand W)

To a suspension of NaH (48.0 mg, 2.00 mmol) in THF (6 mL) was added diethyl cyanogen tetrophosphonate (450.0 mg, 2.50 mmol). After 40 minutes, a solution of 3,7-dibydyo-1- (7-methyiophene) 7.4- dlmcto-7-acetyl-Naphthelioblen (compound V) 95.0 mg (0.33 mmol) in THF (4 mL) was added. Mlxranine was stirred for 16 hours, diluted with ether (100 mL) and washed with water and saturated aqueous NaCl solution before drying over MgSO 4. Removal of the solvents under reduced pressure and column chromatography (3% EtOAc / hexanes) gave the title compound as a solid. 1H NMR (CDCl): δ 4.39 (1H, d, J = 1H), 7.32 (1H, dd, J = 2.0, 8.1 Hz), 7.20-7.25 (4H, brs), 7.15 (1H, d, J = 20 Hz), 6.03 (1H, t, J = 6.0 Hz), 5.44 (1H, s), 2.42 (3H, s) , 2.36 (2H, d, J = 6.0 Hz), 2.35 (3H, s), 1.35 (6H, s).

(H) -J - ^ (^, 6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) -2-butenal (compound X)

For a cold solution (-78 ° C) (E) -3- (5,6-dlbz'dryy-5,5-dimethyl-8- (4-methylphenylZ (r) -2-naphthalenyl-d-butenylmethyl) (compound W) 84 , 0 mg, 0.29 mmol) in dichloromethane (4 mL) 0.50 mL (0.50 mmol) of diisobutylaluminum hydride (1M solution in dichloromethane) was added. After stirring for one hour, the reaction was quenched at -78 ° C with the addition 2-propsnol (1 mL) diluted with ether (100 mL) After warming to room temperature, the solution was washed with water, 10% HCl and saturated aqueous NaCl. The organic layer was dried over MgSO4 and the solvent removed under reduced pressure to give title 52

188 705 lead compound as an oil. 1 H NMR (CDCl3): δ 10.12 (1H, d, J = 7.9 Hz), 7.43 (2H, s), 7.197.28 (5H, m), 6.27 (1H, d, J = 7.9 Hz), 6.03 (1H, t, J = 4.8 Hz), 2.47 (3H, s), 2.42 (3H, s), 2.37 (2H, d, J = 4.8 Hz), 1.37 (6H, s).

(E, E, E) -3-methyl-7- (5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) -2,4 <6 olk: atrienian (relationship 51)

To cold (-78 ° C) solution of diethyl- (E) -3-ethoxycarbonyl-2-methylallylphosphonate [prepared according to J. Org. Chem. 39: 821 (1974)] 264.0 mg, (1.00 mmol) in THF (2 ml) added 26.0 mg (0.41 mmol, 0.65 ml) of n-butyllithium in hexanes (1.6 M solution) and (E) -3- (5t6-dhydro-5,5-dimethyl-8- (4-methyl-ferryl) -2-ral'taltic)) - 2-butenal (compound X) 82.0 mg, 0.26 mmol) in THF (3 mL). After 1 hour, the reaction mixture was diluted with ether (60 mL), washed with water (5 mL), saturated aqueous NaCl (5 mL) and dried over MgSO 4. After removal of the solvents under reduced pressure, the title compound was isolated as an oil by column chromatography (5% EtOAc / hexanes, followed by HPLC using 1% EtOAc / hexanes). 1H NMR (acetone-d6): δ 7.36-7.43 (2H, m),

7.18- 7.27 (4H, m), 7.17 (1H, d, J = 1.7 Hz), 7.08 (1H, dd, J = 11.2, 15.2 Hz), 6.46 (1H, d, J =

11.2 Hz), 6.38 (1H, d, J = 15.2 Hz), 5.98 (1H, t, J = 4.7 Hz), 5.78 (1H, s), 4.10 (2H, q, J = 7.1 Hz), 2.35 (3H, s), 2.33 (3H, s), 2.32 (2H, d, J = 4.7 Hz), 2.12 (3H, s), 1.31 (6H, s), 1.22 (3H, t, J = 7.1 Hz).

(E, E, E) -3-methyl-7- (5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphtha.lenyl) -2,4,6-citatrienic acid (compound 52)

To the solution (E, E, E) -3-methyl-7- (5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalene) -2,0,6-kyatrianate (compound 51) 85.0 mg, 0.20 mmol) in THF (1 mL) and methanol (1 mL) were added 12.0 mg (0.50 mmol) LiOH (0.5 mL, 1M solution). The mixture was stirred for 6 hours, diluted with ether (60 ml), acidified with 10% HCl (1 ml). The solution was washed with water and saturated aqueous NaCl solution, and then dried over MgSO4. Removal of the solvents under reduced pressure gave the title compound as a solid, which was purified by recrystallization from acetone. 1H NMR (acetone-d6): δ (7.35-7.45 (2H, m),

7.19- 7.28 (4H, m), 7.17 (1H, d, J = 1.8 Hz), 7.09 (1H, dd, J = 11.5, 15.1 Hz), 6.48 (1H, d, J =

11.5 Hz), 6.42 (1H, d, J = 15.1 Hz), 5.99 (1H, t, J = 4.7 Hz), 5.82 (1H, s), 2.36 (3H, s), 2.33 (2H, d, J = 4.7 Hz), 2.32 (3H, s), 2.13 (3H, s), 1.32 (6H, s).

3,0-dlhydro-4,4-dimetic) -7-mtro-1 (2H) -raftalenor (compound Y)

To 1.7 ml (3.0 g, 30.6 mmol, 18M) H2 SO4 at -5 ° C (ice-NaCl bath) 783.0 mg (4.49 mmol) 3,4-dihydro- 4T4-dlmetylo-3 (2H) -naftαlenoru. A solution of 426.7 mg (6.58 mmol, 0.43 mL, 16 M) HNO 3, and 1.31 g (0.013 mol, 0.74 mL, 18 M) H2SO4 was slowly added. After 20 minutes, ice was added and the resulting mixture was extracted with EtOAc. The combined extracts were concentrated under reduced pressure to give a residue from which the title compound, a pale yellow solid, was isolated by column chromatography (10% EtOAc / hexanes). 1H NMR (CDCls): δ 8.83 (1H, d, J = 2.6 Hz), 8.31 (1H, dd, J = 2.8,

8.9 EH), 77.2 (1H, d, J = 8.1 ife), 2.88 (2H, t, J = = 6.5 ife), 2.08 (2H, t, J = 6 ^ 5 ife), (, 44 (6H, ss.

3,4-dihydro-4,47-dimethyl-7-amino-1 (2H) -naphthaleneone (compound Z)

A solution of 230.0 mg (1.05 mmol) 3,0-dihydro-4,4-dimethy-7-nitro-1 (2H) -naphtha.lenone (compound Y) in 5.0 mL of EtOAc was stirred at room temperature with with a catalytic amount of 10% Pd-C at 1atm H2 for 24 hours. The catalyst was removed by filtration through a celite pad, the filtrate was concentrated under reduced pressure to give the title compound as a dark green oil. 1 H NMR (CDCl3): δ 7.30 (1H, d, J = 2.7 Hz), 7.22 (1H, d, J = 8.4 Hz), 6.88 (1H, dd, J = 2.7, 8 , 5 Hz), 2.70 (2H, t, J - 6.6 Hz), 1.97 (2H, t, J = 6.6 Hz), 1.34 (6H, s).

Ethyl 4 - [(5,6,7,8-tetrahydro-5,5-dimethyl-8-oxo-2-naphthalenyl) azo] benzoate (compound AA)

To a solution of 198.7 mg (1.05 mmol) 3-O-dihydro-4.0-methyl-7-amino-2 (2H) -naphthalenone (compound Z) in 5.0 mL of glacial acetic acid was added 380.0 mg ( 1.00 mmol) with ethyl 4-nitrosobenzoates. The resulting solution was stirred overnight at room temperature and then concentrated under reduced pressure. The product was isolated from the residual oil as a red solid by column chromatography (15% EtOAc - hexanes). 1H NMR (CDCl 3): δ 8.57 (1H, d, J = 2.0 Hz), 8.19 (2H, d, J = 8.4 Hz), 8.07 (1H, d, J = 8.0 Hz), 7.94 (2H, d, i88 705

J = 8.4 Hz), 7.58 (iH, d, J = 8.6 Hz), 4.4i (2H, q, J = 7, and Hz), 2.79 (2H, t, J = 6.6 Hz), 2.07 (2H, t, J = 7.02 Hz), i, 44 (6H, s), i, 42 (3H, t, J = 7, and Hz).

4 - [(5,6-dihydro-5,5-dimethllcc-8- (trifluoromctyίosulforyl) - oxy-2-naίltacrιylCaz0] ethyl benzoar (compound BB)

To a solution of 90.4 mg sodium bis (trimethylsilyl) amide (0.48 mmol, 0.48 mL and, 0M THF solution) in 2.0 mL THF at -78 ° C, i53.0 mg (0.437 mmol ) Ethyl 4 - [(5,6,7,8-terahydro5,5-dimethyl-8-oxo-2-naphthalenyl) azo] benzoate (compound AA) in 20 ml THF. The dark red solution was stirred at -78 ° C for 30 minutes and then 204.0 mg (0.520 mmol) 2- [N, N-bis (tifluoromethylsulfonyl) amino] -5-chloropyridine as a solution in 2.0 mL THF was added. The reaction mixture was allowed to warm to room temperature and after 3 hours the reaction was stopped by adding H2O. Organic. the layer was concentrated to a red oil under reduced pressure. The product was isolated by column chromatography (25% EtOAc / hexanes) as a red oil. iH NMR (CDCl 3): δ 8.2i (2H, d, J = 8.6 Hz), 7.96 (2H, d, J = 8.6 Hz), 7.94 (2H, m), 7 , 49 (iH, d, J = 8.2 Hz), 6.08 (iH, t, J = 2.5 Hz), 4.42 (2H, q, J = 7, and Hz), 2.49 (2H, d, J = 4.8 Hz), i, 44 (3H, t, J = 7, and Hz), i, 38 (6H, s).

Ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) azo] benzoate (compound 46a)

A 4-lithotoluene solution was prepared by adding 629 mg (0.58 mL, 0.98 mmol) t-butyllithium (i, and M solution in pentane) to a cold solution (-78 ° C) 84.0 mg (0.49i mmol) 4-bromotoluene wi, 0 ml THF. After stirring for 30 minutes, a solution of i0.0 mg (0.785 mmol) zinc chloride in 2.0 mL THF was added. The resulting solution was warmed to room temperature, stirred for 30 minutes, and 94.7 mg (0, and 96 mmol) 4 [(5-16-dihydro-5,5-dimethyl-8- (trifluoromethylsulfonyl) oxy-2-naphthalenyl) was added through a tube to the solution. ) ethyl azo benzoate (compound BB) and 25 mg (0.02 mmol) tetrakis (triphenylphosphine) palladium (O) in 20 ml THF. The resulting solution was heated at 50 ° C for 1.5 hours, cooled to room temperature and diluted with saturated aqueous NH4Cl solution. The mixture was extracted with EtOAc (40 mL) and the combined organic layers were washed with water and brine. The organic phase was dried over Na2SO4, concentrated under reduced pressure and the title compound isolated as a red solid by column chromatography (25% EtOAc-hexanes) and 1 H NMR (CDCl 3): δ 8.2i (2H, d, J = 8.6 Hz ), 7.96 (2H, d, J = 8.6 Hz), 7.94 (2H, m), 7.49 (iH, d, J = 8.2 Hz), 6.08 (iH, t , J = 2.5 Hz), 4.42 (2H, q, J = 7, and Hz), 2.49 (2H, d, J = 4.8 Hz), i, 44 (3H, t, J = 7, i Hz), i, 38 (6 H, s).

4 - [(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-raffialenyl ') azo] benzoic acid (compound 46b)

To a solution of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphtaenyl) azo] benzoate (compound 46a) and 6.5 mg, 0.042 mmol) in THF (2 ml) and ethanol (iml) 80.0 mg (200 mmol) NaOH (2.0 ml, 1M aqueous solution) was added. The mixture was stirred for i2 hours at room temperature, acidified with 0% HCl and extracted with EtOAc. The combined organic layers were washed with water and saturated aqueous NaCl solution, then dried over MgSO4. After removal of solvents under reduced pressure and recrystallization. EtOAC / hexane residues gave the title compound as a red solid. iH NMR (acetond6): δ 8, i9 (2H, d, J = 8.4 Hz), 7.92 (2H, d, J = 8.5 Hz), 7.88 (2H, dd, J = 2 , i, 6, and Hz), 7.66 (iH, s), 7.64 (2H, d, J = 2.3 Hz), 7.28 (4H, d, J = 3.0 Hz), 6.09 (3H, t, J = 25 Hz), 242 (2H, d, J = 4.8 Hz), 2.39 (3H, s), and, 40 (6H, s)

8- (2-trimethylsilyl) ethynyl-2,3-dihydro-3,3-dimethyl-1H-irden-1-one (compound CC)

To a solution of 85-5.0 mg (3.4i mmol) of 6-bromo-2,3-dihydro-3,3-dimethyl-iH-inden-i-one (see Smith et al. Org. Prep. Proced. Int. I978 i0 i23-i3i) in i00 ml degassed Et3N (purged with argon for 20 minutes) 259.6 mg (i, 363 mmol) of copper (I) iodide were added

956.9 mg (i, 363 mmol) of bis (triphenylphosphine) palladium (II) chloride, and 3,4 g (34.08 mmol) (trimethylsilyl) acetylene. The resulting mixture was heated at 70 ° C for 42 hours, cooled to room temperature, filtered through a pad of silica gel and washed with ether. The filtrate was washed with water, and M HCl, water and finally with saturated aqueous NaCl solution, and then dried over MgSO 4. Concentration of the solution under reduced pressure followed by column chromatography (silica gel; 10% Et2O - hexanes) gave the title compound as a brown oil. 1 H NMR (300 MHz, CDCE):

188 705 δ 7.79 (1H, d, J = 1.4 Hz), 7.69 (1H, dd, J = 1.6, 8.3 Hz), 7.42 (1H, d, J = 8, 5 Hz), 2.80 (2H, s), 1.41 (6H, s), 0.26 (9H, s).

6-ttinyl-2,3-dihydro-3,3-dimethyl-1H-inden-1iOn (DD compound)

To a solution of 875.0 mg (3.41 mmol) 6- (2-trimethylsilyl) ttinyl-2,3-dihydridr3.3-dimethic acid> 111-indenone (compound CC) in 28 ml MeOH was added 197.3 mg ( 1.43 mmol) K2CO3 in one serving. After stirring for 6 hours at room temperature, the mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residual oil was placed on a silica gel column and eluted with 5% EtOAc-hexanes to give the title product as a colorless oil. 1H NMR (300 MHz, CDCh): δ 7.82 (1H, s), 7.72 (1H, dd, J = 1.8, 7.8 Hz), 7.47 (1H, d, J = 8 , 4 Hz), 3.11 (1H, s), 2.61 (2H, s), 1.43 (6H, s).

Ethyl 4 [2- (5,6idihydro-5,5idimethyl-7-oxo-2-indenyl) ethynyl] benzoate (Compound EE)

A solution of 280.0 mg (1.520 mmol) 6-ttinyl 02, - dihydro-3,3-dimethyl-1Hiinden-1-one (compound DD) and 419.6 mg (1.520 mmol) of ethyl 4-diisodium benzoate in 5 ml of EhN was purged with argon 40 minutes. To this solution, 271.0 mg (1.033 mmol) triphenylphosphine, 53.5 mg (0.281 mmol) copper (I) iodide and 53.5 mg (0.076 mmol) of bis (triphenylphosphine) palladium (II) chloride were added. The resulting mixture was heated to reflux for 25 hours, cooled to room temperature and diluted with Et2O. After filtration through a celite pad, the filtrate was washed with H2O, 1 M HCl, H2O and a saturated aqueous NaCl solution, then dried over MgSO4 and concentrated under reduced pressure. The title compound was isolated as a pale yellow solid by column chromatography (15% EtOAc-hexanes). 1H NMR (300 MHz, d6acetone): δ 8.05 (2H, d, J = 8.6 Hz), 7.87 (1H. Dd, J = 1.4, 8.1 Hz), 7.75 ( 2H, ml, 7.70 (2H, d, J = 8.5 Hz), 4.36 (2H, q, J = 7.1 Hz), 2.60 (2H, s), 1.45 (6H , s), 1.37 13H, t, J = 7.1 Hz).

4- [2- (1,1 rimimetric> 3- (tnoyltetylosfonyyl) oxy 5-mdenyl) ethynyl] bt-benzoate ethyl (compound FF)

A solution of 88.0 mg (0.48 mmol) sodium bis (trimethylsilyl) amide in 0.5 mL THF was cooled to -78 ° C and 145.0 mg (0.436 mmol) of 4i ['2i (5,6-dihydro- Ethyl 5,5-dimethyl O7-oxo-02-irldethynyl-tinyl enzoate (compound EE) as a solution in 1.0 ml THF. After 30 minutes, 181.7 mg (0.480 mmol) 2- (N, N-bis (trifluoromethanesufbyl) was added ) amino) i5-Chloro-pyridine as a solution in 1.0 ml THF. The reaction mixture was allowed to slowly warm to room temperature and was stopped after 5 hours by the addition of a saturated aqueous NH4Cl solution.

The mixture was extracted with EtOAc and the combined organic layers were washed with 5% aqueous NaOH, H2O and saturated aqueous NaCl, then dried (MgSO4) and concentrated under reduced pressure. The product was isolated as a colorless solid by column chromatography (10% Et2O-hexanes). 1H NMR (300 MHz, d-acetone): δ 8.05 (2H, d, J = 8.3 Hz), 7.69 (2H, d, J = 8.4 Hz), 7.63 (2H, s), 7.55 (1H, s), 4.36 (2H, q, J = 7.1 Hz), 1.44 (6H, s), 1.37 (3H, t, J = 7.1 Hz).

4i [(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) ethynyl] be] benzoic acid (compound 60)

Solution 142.6 mg (0.339 mmol) 43 [(5,6idihydrOi5,5-dimethyl-8- (4-methylphenyl) -2i ethyl naphthalenyl ytynylbenzoate (compound 1) and 35.6 mg (0.848 mmol) LiOH-^ O in 12 ml THF / water (4: 1, v / v), stirred overnight at room temperature The reaction mixture was extracted with hexanes and hexane, the fraction was extracted with 5% aqueous NaOH, the aqueous layers were combined and acidified with 1M HCl, then extracted with EtOAc and Et2O. The combined organic layers were dried over Na2SO4 and concentrated under reduced pressure to give the title compound as a colorless solid. 1H NMR (d6-DMSO): δ 7.91 (2H, d, J = 8.4 Hz), 7.60 (2H, d, J = 8.4 Hz), 7.47 (2H, s), 7.23 (4H, q, J = 8.1 Hz), 7.01 (1H, s), 6.01 (1H, t, J = 4.6 Hz), 2.35 (3H, s), 2.33 (2H, d, J = 4.8 Hz),

1.30 (6H, s).

4 - [(5,6-dihydro-5,5-dimethyl-8-phenyl-2-naphthalenyl) ethynyl] benzoic acid (compound (60a)

Using the same general procedure as in the preparation of 4i [(5,6-dihydro-5,5-dimethyl-8- (2-thiazolUo) ©-naphthakmyl) -ethynyl) -benzoic acid (compound 30a), 27.0 mg (0.07 mmol) ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8 ifenyl and 2-naphthylyl) ittinyl] benzoate (compound Ia) was converted to the title compound (colorless solid) using 5.9 mg (0.14 mmol )

188 705

LiOH in H2O. PMR (d6-DMSO): δ 1.31 (6H, s), 2.35 (2H, d, J = 4.5 Hz), 6.05 (1H, t, J = J = J - 4 , 5 Hz), 7.00 (1H, s), 7.33 (2H, d, J = 6.2 Hz), 7.44 (4H, m), 7.59 (2H, d, J = 8 , 1 Hz), 7.90 (2H, d, J = 8.1 Hz).

4 - [(5,6-dihydro-5,5-dimethyl-8- (4- (1,1-dimethylethyl) phenyl) -2-naphthdenyl) ethynyl] benzoic acid (compound (61)

Solution 80.0 mg (0.173 mmol) of ethyl 4 - [(5,6-dihydro-5,5-dimethyl-8- (4- (1,1-dimethylethyl) phenyl) -2-naphthalenyl) ethynyl] benzoate (compound 6) and 18.1 mg (0.432 mmol) LiOHH2O in 6 ml THF / water (3: 1, by volume) was stirred overnight at room temperature. The reaction mixture was extracted with hexanes and the remaining aqueous layer was acidified with 1 M HCl, and then extracted with EtOAc. The combined organic layers were dried over Na2SO4 and concentrated under reduced pressure to give the title compound as a colorless solid. 1H NMR (d6-DMSO): δ 7.82 (2H, d, J = 8.2 Hz), 7.44 (6H, m), 7.25 (2H, d, J = 8.3 Hz), 7.02 (1H, s), 6.01 [3H, t, J = 4.6 Hz), 2.32 (2H, d, J = 4.7 Hz), 1.32 (9H, s), 1.29 (6H, s).

Ethyl 2-fluoro-4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) thiocarbonyl] aminobenzoate (compound 62)

Solution 54.4 mg (0.119 mmol) of ethyl 2-fluoro-4 - [[(5,6-dihy <± ro-5,5-dimethyl-8- (4-methylphenyl) 2-naphthalenyl) carbonyl] aminobenzoate (compound 40) and 57.7 mg (0.143 mmol) [2,4-bis (4-methoxyphenyl) -1,3-dithia-2,4-diphosphane-2,4-disulfide (Lawesson reagent) in 12.0 ml of benzene boiling overnight. After cooling to room temperature, the mixture was filtered and the filtrate was concentrated under reduced pressure. The title compound was isolated by column chromatography (10 to 25% EtOAc / hexanes) as a yellow solid. 1H NMR (CDCty): δ 9.08 (1H, s), 7.92 (1H, br s), 7.90 (iH. T, J = 8.2 Hz), 7.66 (1H, da , J = 2.0, 6.0 Hz), 7.38 (3H, m), 7.18 (4H, m), 6.01 (1H, t, J = 4.7 Hz), 4, 35 (2H, q, J = 7.1 Hz), 2.36 (3H, s), 2.33 (2H, d, J = 4.7 Hz), 1.38 (3H, t, J = 7 , 1 Hz), 1.33 (6H, s).

2-fluoro-4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) thiocarbonyl] aminobenzoic acid (compound 63)

To a solution of 46.5 mg (0.098 mmol) of ethyl 2-fluoro-4 - [[(5,6-dihydro-5,5-dimethyl-8- (4-methylphenyl) -2-naphthalenyl) thiocarbonyl] amino] benzoate ( compound 62) in 1.0 mL EtOH and 1.0 mL THF added 55 mg NaOH (1.4 mmol) and 1.0 mL H2A. After stirring at room temperature overnight, EtOAc was added and the reaction was stopped by adding 10% HCl. Extracted with EtOAc and washed the combined organic layers H2O, saturated aqueous NaCl solution and dried over MgSO <. Removal of the solvent under reduced pressure gave a solid which after crystallization from CH3CN gave the title compound as a pale yellow solid. 1H NMR (d6-acetone): δ 11.05 (1H, s), 6.02 (1H, m), 7.99 (1H, t, J = 8.3 Hz), 7.75 (1H, m ), 7.69 (1H, dd, J = 2.0, 6.1 Hz), 7.52 (1H, s), 7.46 (1H, d, J = 8.1 Hz), 7.21 (4H, m), 6.04 (1H, t, J = 4.8 Hz), 2.37 (2H, d, J - 4.8 Hz), 2.33 (3H, s), 1.36 (6H, s).

Ethyl 5 ', 6'-dihydro-5', 5'-dimethyl-8 '- (4-methylphenyl) - [2,2'-binaphthalene] -6-carboxylate (compound 64)

A solution of 3,4-dihydro-1- (4-methylphenyl) -4,4-dimethyl-7-bromonaphthalene (compound D) 0.45 g, 1.40 mmol) and THF (2.1 ml) were added to magnesium filings (0.044 g, 1.82 mmol) at room temperature under argon. Two drops of ethylene dibromide were added and the solution, which slowly became cloudy and yellow, was heated to reflux for 1.5 hours. Zinc chloride (0.210 g, 1.54 mmol) was added to the second flask, which was melted under high vacuum, cooled to room temperature, and dissolved in THF (3 mL). Grignard reagent was added to the second flask and after 30 minutes at room temperature, ethyl-bromo-T-naphthalene-4-naphthalene-butoxylate (compound N) was added 0.293 g, (1.0ί5 and THF (2 ml). A solution was prepared in the third flask. Ni (PPh3) 4 and THF as follows: for NiCty solution (PPh3)2 (0.82 g, 1.25 mmol) and PPh3 (0.66 g, 2.5 mmol) in THF (3.5 mL) was added a 1M solution of diisobutylaluminum hydride and hexanes (2.5 mL, 2.5 mmol). The resulting solution was diluted with THF to a total volume of 15 ml and stirred at room temperature for 15 minutes. Three 0.60 ml sample of Ni (PPh3) 4 solution was added every 15 minutes to the second flask. The resulting suspension was stirred at room temperature for 2 hours. The reaction was quenched by the addition of 5 ml 1N aqueous HCl and stirred for one hour before extracting the products

188 705 with ethyl acetate. The organic layers were combined, washed with brine, dried (MgSO4), filtered and the solvent removed under reduced pressure. The residue was crystallized from hexanes to give 130 mg of pure substance. The mother liquor was concentrated under reduced pressure and the residue was purified by silica gel chromatography (95: 5-hexanes: ethyl acetate) to give an additional 170 mg of the title compound (total yield - 300 mg, 64%) as a colorless solid. 1H NMR (CDCl3) δ 8.57 (s, 1H), 8.05 (dd, 1H, J = 1.7, 8.0 Hz), 7.84-7.95 (imposed d, 3H), 7 , 66 (dd, 1 H, J = 1.7, 8.5 Hz), 7.58 (dd, 1H, J = 2.0, 8.0 Hz), 7.48 (d, 1H, J = 8.0 Hz), 7.43 (d, 1H, J = 2.0 Hz), 7.32 (d, 2H, J = 8.0 Hz), 7.21 (d, 2H, J = 8, 0 Hz), 6.04 (t, 1H, J = 4.8 Hz), 4.44 (q, 2H, J = 7.1 Hz), 2.40 (s, 3H), 2.39 (d , 2H, J = 4.8 Hz), 1.45 (t, 3H, J = 7.1 Hz), 1.39 (s, 6H).

- ', 6'-dihydro-5', 5'-dimethyl-8'- ~ 4-methylphenyl) - [2,2'-binaphthalene] -6-kara ^ oxyl <(compound 65)

Solution - ', 6'-dihydro-5', 5'-dimethyl - 8'- ~ 4-mesylphenyio) - [2,2'-bafaftate] -6-kibab) ethyl quinate (compound 64) 0 , 19 g, 0.43 mmol), EtOH (8 mL) and 1N aqueous NaOH (2 mL) was heated to 60 ° C for 3 hours. The solution was cooled to 0 ° C and acidified with 1N aqueous HCl. The product was extracted into ethyl acetate and the organic layers were combined, washed with water, brine, dried (MgSO 4), filtered and the solvent removed under reduced pressure. The residue was recrystallized from THF / ethyl acetate at 0 ° C to give 35 mg of pure substance. The mother liquor was concentrated under reduced pressure and the residue was purified by silica gel chromatography (100% ethyl acetate) to give an additional 125 mg of the title compound (total yield -160 mg, 90%) as a colorless solid. 1H NMR (DMSO-d6) δ 8.57 (s, 1H), 8.11 (d, 1H, J = 8.7 Hz), 7.96-7.82 (superimposed d, 3H), 7.65 (d, 2H, J = 7.6 Hz), 7.50 (d, 1H, J = 7.9 Hz), 7.28 (s, 1H), 7.26 (d, 2H, J = 8, 3 Hz), 7.21 (d, 2H, J = 8.3 Hz), 6.01 (t, 1H, J = 4.5 Hz), 3.34 (br s, 1H), 2.31 ( s, 3H), 2.31 (d, 2H, J = 4.5 Hz), 1.31 (s, 6H)

4 ~ [(5,6-dihydlΌ ~ 5, - dimethye ~ 8 ~ e2 ~ furyio) ~ 2-naphthylene) ~ ethynyl] ethyl benzoate (compound (66)

Using the same general procedure as for the preparation of ethyl 4 ~ [e5,6-dihy'dao-5,5-dimethyl ~ - (4-methylphenyl ^ -naphthalene n-naphthalenecriethyltenzoate) (compound 1), 250.0 mg (0.52 mmol) 4 - [(5,6-dihyγiro-5,5-dimethyl-8- ~ (riffuo-methyl-ulfonyyo-) oxy-22-naphthalenyl) - ethyl tynylbenzoate (compound G) was transformed into the title compound (colorless solid) using 142, 4 mg (1.045 mmol) zinc chloride, 24.1 mg (0.02 mmol) tetrakis (ΐ-triphenylphosphine) dark (0) and 2-nitofuaan (prepared by the addition of 53.4 mg (0.52 mL, 0.78 mmol) of n-butyllithium (1.5 M solution in hexane) to a cold solution (-78 ° C) 53.4 mg (0.784 mmol) of forane in 1.0 ml THF). PMR (CDCl3): δ 1.32 (6H, s), 1.41 (3H, t, J = 7.1 Hz), 2.35 (2H, d, J = 5.0 Hz), 4, 39 (2H, q, J = 7.1 Hz), 6.41 (1H, t, J = 5.0 Hz), 6.50 (2H, s), 7.36 (1H, d, J = 8 , 0 Hz), 7.45 (3H, dd, J =

1.7, 8.0 Hz), 7.49 (1H, s), 7.57 (2H, d, J = 8.2 Hz), 7.63 (1H, d, J = 1.7 Hz) , 8.02 (2H, d, J =

8.2 Hz).

4 - [(5,6-dihydro-5,5-dimethy-8-e2-fuaylo) -2-naphthaenyl) ethynyl | benzoic acid (compound (67)

Using the same general procedure as in the preparation of 4 - [(5,6-dihydro ~ 5,5-dimethyl --- (2-thiazolium) ~ 2-naphthalene) ethynyl] benzoic acid (compound 30a), 4 ~ [(5, > ^ diFιydro ~ -, 5-dimethio --- (2-fuayio) -2-naphthienyl) ethynyl] benzoate (compound (66) was converted to the title compound (colorless solid) using 16.0 mg (0.38 mmol) LiOH in H2O. PMR (d6-DMSO): δ 1.26 (6H, s), 2.33 (2H, d, J = 4.9 Hz), 6.41 (1H, t, J = 4.9 Hz), 6.60 (2H, m), 7.45-7.53 (3H, m), 7.64 (2H, d, J = 8.3 Hz), 7.75 (1H, d. J = 1, 6 Hz), 7.93 (2H, d, J = 8.3 Hz).

A method of enhancing nuclear receptor agonists

Current status and introduction

We have found that a subset of retinoid antagonists that has negative hormone activity can be used to enhance the biological activity of other retinoids and the steroid receptor superfamily hormones. These other retinoids and steroid receptor superfamily hormones can be either endogenous hormones or pharmaceutical agents. In this way, e.g. by using in conjunction with the negative retinoid hormone, certain activities of pharmaceutical retinoid agonists can be made more active in eliciting specific biological effects. Preferably, this combination attempt when it comes to drug delivery can minimize undesirable side effects

188 705 pharmaceutical retinoids, because lower dosages of pharmaceutical retinoids can be used with improved efficacy.

More specifically, we have found that AGN 193109, a synthetic retinoid, having the structure shown in Figure 1, has unique and unexpected pharmacological activity. AGN 193109 has a high affinity for the RAr subclass of nuclear receptors without activating these receptors or stimulating the transcription of retinoid response genes. Instead, AGN 193109 inhibits the activation of RAR by retinoid agonists and thus behaves like a retinoid antagonist.

In addition, we have found that negative retinoid hormones can be used without concomitant administration of retinoid agonists or steroid hormones to control certain disease symptoms. More specifically, the negative retinoid hormone disclosed herein can regulate by lowering high levels of basal transcription of genes that respond to free RARs. If, for example, uncontrolled cell proliferation results from the activity of genes that respond to free RARs, then this gene activity can be reduced by administration of a negative retinoid hormone that inactivates RARs. As a result, cell proliferation dependent on the activity of free RA.R can be inhibited by a negative hormone. Inhibition of free RARs cannot be achieved using conventional antagonists.

Indeed, we have found that AGN 193109 can both inhibit basal RAR activity and sometimes can enhance the activity of other retinoid agonists- and steroid superfamily hormones. In the context of the invention, it is believed that the hormone agonist is enhanced by a negative hormone such as AGN 193109 if, in the presence of the negative hormone, a lower concentration of the agonist produces essentially the same quantitative response as the response that can be obtained with the agonist alone. A quantitative response can e.g. measure in an in vitro reporter gene assay. In this way, the therapeutic retinoid that elicits the desired response, used at a particular dosage or concentration, is enhanced by AGN 193109 if, in combination with aGn 193109, a lower dosage or concentration of therapeutic retinoid can be used to produce essentially the same effect as a higher dose or therapeutic retinoid concentration when this therapeutic retinoid is used alone. The list of agonists that can be amplified by co-administration with AGN 193109 includes RAR agonists, vitamin D receptor agonists, glucocorticoid receptor agonists and thyroid hormone receptor agonists. More specifically, specific agonists that can be potentiated by co-administration are: AtRa, 13-cis retinoic acid, an agonist of the synthetic RAR AGN 191183, 1,25-dihydroxyvitamin D3, dexamethasom and thyroid hormone (3,3 ', 5-triiodothyronine). Also disclosed here is a method that can be used to identify other hormones · 'that can be amplified by co-administering AGN 193109.

In this way, AGN 193109 behaves unexpectedly for a single retinoid antagonist but as a negative hormone that enhances the activity of various members of the nuclear receptor family. We also disclose a likely mechanism that can be counted as both the activity of the negative hormone and the ability of AGN 193109 to enhance the activity of other nuclear receptor ligands. This mechanism includes elements known to participate in rheitnoid-dependent signaling pathways and additionally include a new regulatory negative component.

The average specialist will appreciate that RARs, which are high-affinity targets for AGN 193109 binding, are transcription factors that regulate the expression of various retinoid-responsive genes. Cis-regulatory DNA binding sites for RARs have been identified in the vicinity of genes that are transcriptively regulated in a retinoid-dependent manner. RARs that bind to such DNA sites, known as retinoic acid (RARE) responses, have been well defined. Indeed, RARE bind heterodimers consisting of one rAr and one RXR. The RXR component of the heterodimer is fused. to promote high affinity interaction between the RAR / RXR heterodimer and RARE (Mangelsdorf et al., The Retinoid Receptors in The Retinoids: Biology, Chemistry and Medicine, Second Edition, editors Sporn et al., Raven Press Ltd., New York 1994).

188 705

As detailed below, our solutions that relate to the activity of AGN 193109 negative hormone are consistent with a mechanism involving the interaction of putative Negative Coactivator Protein (NCP) with RAR. According to the proposed mechanism, this interaction is stabilized by AGN 193109.

Our results further indicate that AGN 193109 may modulate the intracellular availability of NCP for interaction with non-RAR nuclear receptors that are occupied by AGN 193109. It follows that AGN 193109 may enhance transcriptional regulatory pathways, including nuclear receptors that share the ability with RAR for binding NCP. In this regard, AGN 193109 has the ability to modulate various nuclear receptor pathways, an activity that is not anticipated for ordinary retinoid antagonists. In this regard, AGN 193109 is useful as a means to enhance the activity of nuclear receptor ligands, including both endogenous hormones and prescribed drugs. This specific embodiment illustrates the more general principle that any negative nuclear receptor hormone will enhance the activity of other nuclear receptors that competitively bind NCP.

Although other materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are now described. General references and methods that can be used to perform various nucleic acid manipulations and procedures described herein can be found in Molecular Cloning: A Laboratory Manual (Sambrook et al., Cold Spring Harbor Lab. Publ. 1989) and Current Protocols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wiley-Interscience 1987). A description of the experiments and results that led to the present invention follows.

Example 6 describes the methods used to show that AGN 193109 bound each of the three RARs with high affinity but failed to activate retinoid-dependent gene expression.

Example 6

AGN 193109 binds RAR with high affinity but does not transactivate retinoid-dependent gene expression

Human RAR-a, RAR-β and RAR-γ receptors were separately expressed as recombinant proteins using a baculovirus expression system, essentially according to Allegretto et al. In J. Biol. Chem. 268: 26625 (1993). Recombinant receptor proteins were used separately to determine the binding affinity of AGN 193109 using a shift assay [3 H] ATRA described by Heyman et al. In Cell 68: 397 (1992). Dissociation constants (Kd) were determined according to the procedure described by Cheng et al. In Biochemical Pharmacology 22: 3099 (1973).

AGN 193109 was also tested for its ability to transactivate RAR in CV-1 cells briefly co-transfected with RAR expression vectors and retinoid-responsive reporter gene constructs. Expression vectors of the pRShRAR-α receptor (Giguere et al., Nature 330: 624 (1987)), pRShRAR-β (Benbrook et al., Nature 333: 669 (1988)) and pRShRAR-γ (Ishikawa et al., Mol. Endocrinol. 4: 837 (1990)), co-transfected separately with the AMTV-TREp-Luc reporter plasmid. The use of this luciferase reporter plasmid has been disclosed by Heyman et al. in Cell 68: 397 (1992). The AMTV-TREpLuc plasmid is essentially identical to the AMTV-TREp-CAT reporter construction described by Umesono et al. in Nature 336: 262 (1988), except that the chloramphenicol acetyltrasferase (CAT) reporter gene has been substituted with a polynucleotide sequence encoding firefly luciferase. Transfection of green monkey CV-1 cells was performed using the calcium phosphate co-precipitation method described in Molecular Cloning: A Laboratory Manual (Sambrook et al., Cold Spring Harbor Lab Publ. 1989). CV-1 cells were plated at a density of 4 x 10 0 / well in 12-well multi-well plates and transiently transfected with a calcium phosphate precipitate containing 0.7 pg reporter plasmid and 0.1 pg receptor plasmid, according to standard laboratory procedures. The cells were washed after 18 hours to remove the precipitate and Dulbecco's modified Eagel medium (DMEM) (Gibco) containing 10% fetal bovine serum extracted with activated charcoal (Gemini Bio-Products) was added again. Cells were treated alone

188 705 carrier (ethanol) or AGN 193109 (W.9 up to 106 M) for 18 hours. Cell lysates were prepared in 0.1 M KPO4 (pH 7.8), 10% TRITON 100-100, 1.0 mM DTT, 2 mM EDTA. Luciferase activity was measured as described in Weta et al., Mol. Cell Biol. 7: 725 (1987), using an NY firefly lucifer (Analytical Lumincscence Laboratory) and a 96 well EG&G Berthold luminometer. The described luciferase values represented the mean ± SEM of triplicate experiments.

The results in Table 11 indicated that AGN 193109 bound each of RAR-α, RAR-β and RAR-y with high affinity, but did not activate retinoid dependent gene expression. More specifically, AGN 193109 bound each of the three receptors, with Kd values in the range of 2-3 nM. Despite this strong binding, AGN 193109 failed in activating gene expression compared to induction stimulated by ATRA. Therefore, AGN 193109, giving half the maximum efficacy (EC 50), was impossible to measure. Although not shown in the table, we found that AGN 193109 did not have measurable affinity for RXR.

Table 11

AGN 193109 binding and RAR transactivation

<td>EC 50 (nM)</td><td>Lack of activity</td><td>Lack of activity</td><td>Lack of activity</td>

Example 7 describes the methods used to show that AGN 193109 is an antagonist of ATRA-dependent gene expression.

Example 7

Inhibition mediated by AGN 193109 RAR transactivation by ATRA

The ability of AGN 193109 to antagonize RAR, mediated by ATRA, was traced in CV-1 co-infected cells co-precipitated by calcium phosphate Sambrook et al. (Molecular Cloning: A Laboratory Manual Cold Spring Harbor Lab Publ. 1989). Eukaryotic expression vectors pRShRAR-α (Giguere et al. Nature 330: 624 (1987)), pRShRAR-β (Benbrook et al. Nature 333: 669 (1988)) and pRSHRAR-γ (Ishikawa et al. Mol. Endocrinol. 4: 837 (1990)) was co-transfected with reporter plasmid: AMTV-Luc described by Hollenberg et al. (Cell 55: 899 (1988)). In particular, the reporter plasmid contained two copies of the palindromic TRE response element. Calcium phosphate transfections were performed exactly as described in Example 6. The cells were treated with the dose of vehicle alone (ethanol), ATRA (109 up to 10'6 M), AGN 193109 (10 '9 up to 10'6 M) or W8 M ATRA in combination with AGN 193109 (10 '9 up to 10'6 M), for 18 hours. Measurements of cell lysate and luciferase activity were also carried out as in Example 6.

The results of these procedures are shown in Figures 2A to 2F, where the luciferase values represent the mean ± SEM of triple determinations. More specifically, the results presented in Figures 2A, 2C and 2E indicate that stimulation of ATRA transfected cells led to an increase in dose-response luciferase. This confirmed that ATRA activated each of the three RARs in the experimental system and provided a basis for comparison for the detection of antagonist activity. Graphic results presented in Fig. 2B, 2D and 2F indicated that the simultaneous treatment of transfected 10 nM ATRA cells and increasing AGN 193109 concentrations led to inhibition of luciferase activity. In particular, equal doses of AGN 193109 and ATRA gave greater than 50% inhibition relative to ATRA alone for all three RAR subtypes. Comparison with the ATRA dose response in the presence of different concentrations of AGN 193109 indicated that ATRA was competitively inhibited by AGN 193109. Specifically, the horizontal axes on all graphs shown in Fig. 2 show the logarithm of the retinoid concentration. These results proved that AGN 193109 was a strong RAR antagonist.

We then conducted experiments to clarify the mechanism underlying AGN 193109 antagonist activity. Fachowey will appreciate that i88 705 nuclear receptor activation is thought to be associated with a change in receptor conformation induced by ligand binding. In fact, the results of protease protection tests have confirmed that agonists and antagonists of nuclear hormones cause receptor proteins to assume different conformations (Keidel et al. Mol. Cell. Biol. i4: 287 (i994); Allan et al. J. Biol. Chem. 267: i95i3 (i992)). We used such a test to determine whether AGN i93i09 and ATRA caused different conformations by RAR-α. AGN i93583, a selective RAR-α antagonist. included as a positive control that is known to confer an antagonist-specific protease sensitivity pattern.

Example 8 describes a method that was used to detect conformation changes in RAR-α resulting from the binding of AGN i93i09. As shown below, the results of this procedure unexpectedly showed that AGN i93i09 led to a trypsin sensitivity pattern that was essentially identical to ATRA-induced RAR agonist, and in contrast to that induced by the model RAR antagonist. These findings suggested that AGN i93i09 had properties different from other retinoid antagonists.

Example 8

Analysis of protease protection

A plasmid assembled in the pGEM3Z vector (Pharmacia) and containing RAR-α cDNA (Giguere et al. Nature 330: 624 (i987)) was used in combination with the in vitro transcription-translation system of reticulocyte lysate conjugated with TNT (Promega) to produce RAR-α labeled with pS] -methionine. Limited proteolytic digestion of labeled RAR-α protein was performed according to the method described by Keidel et al. in Mol. Cell Biol. i4: 287 (i94). Equal amounts of reticulocyte lysate containing labeled labeled [35S] -methionism RAR-α was incubated with either ATRA, AGN i93583 or AGN i93i09 on ice for 45 minutes in a total volume of 9 μΐ. The final retinoid concentration for all samples was 100 nM for ATRA and AGN i93i09 and i000 nM for AGN i93583. The difference between final retinoid concentrations was based on the nearly 100-fold difference in the relative affinity of ATRA and AGN i93i09 (having Kd at RAR-α of 2 and i0 nM respectively) and AGN i93583 (having Kd at RAR-α of> i00 nM ). After ligand binding, 1 μΐ of appropriately concentrated trypsin was added to the mixture, resulting in final concentrations of 25, 50 or 100 μg / ml. Samples were incubated at room temperature for 10 minutes and stopping digestion with trypsin by adding SDS sample buffer. The samples were subjected to polyacrylamide gel electrophoresis and autoradiography according to standard procedures.

Both agonist and antagonist led to different trypsin sensitivity patterns that were different from the result obtained by free receptor digestion. Autoradiographic results indicated that trypsin concentrations of 25, 50 and i00 μg / ml completely digested radiolabeled RAR-α at 10 minutes at room temperature in the absence of added retinoid. Initial binding of ATRA led to the appearance of two major types of protease resistant. Pre-binding of the RN-α AGN i93583 selective antagonist resulted in an increase in the protease resistant type, which had a lower molecular weight than that obtained as a result of the initial ATRA binding. This result showed that the agonist and antagonist lead to conformational changes detectable by the trait of altered trypsin sensitivity. Surprisingly, pre-binding of AGN i93i09 resulted in an increase in the protease protection pattern that was indistinguishable from that generated by the pre-binding ATRA.

The results presented above confirmed that AGN i93i09 bound RAR-α and changed its conformation. Interestingly, the nature of this conformation change more closely resembled that obtained by agonist binding (ATRA) than; change produced by antagonist binding (AGN i93583). Clearly the mechanism of AGN-dependent antagonism i93i09 was one of a kind.

We considered a possible mechanism that could explain the activity of the AGN i93i09 antagonist. In particular, we used the standard gel shift test to examine whether AGN i93i09 interfered with RaR / RXR heterodimer formation, or inhibited the interaction between RAR and its related DNA binding site.

188 705

Example 9 describes a gel shift assay elenti-fyetric mobility, used to show that AGN 193109 neither inhibited RAR / RXR dimerization nor inhibited dimer binding to target DNA.

Example 9

Gel shift analysis

RAR-α produced by in vitro translation, essentially as described in Example 8 except that labeled methionine was omitted 35S. Similarly, RXR-α was produced by in vitro translation using a vector based on pBlukscript (II) (SK) containing RŻR-α cDNA described by Mangelsdorf et al. in Nature 37 (: 224-229 (1990) as template for transcript formation in vivo. Labeled RAR-α and RKR-α alone or in combination or pre-associated with AGN 193109 (10 '6 M) either alone or in combination, placed to interact with the RARE DR-5 double-stranded probe having the sequence 5'-TCAGGTCACCAGGAGGTCAGA-3 '(SEQ ID NO: 1). The binding mixture was subjected to electrophoresis on a non-denaturing pylsrylamide gel and śutyi · adirgrśίii according to standard laboratory procedures. The individual delayed types appearing on the autoradiograph, which were normal for all gel runs, represented a nicocrine factor that binds to the probe present in the reticulycyte lysate. Only the RAR / RXR combination gave rise to delayed types specific for retinid receptors. Neither RAR alone nor RXR alone bound the probe to produce this shifted type. The presence of AGN 193109 did not disturb this interaction.

These results indicated that AGN 193109 did not significantly change the properties of either ROD-α homo- or hctrocroderomerase. Further, AGN 193109 did not inhibit the interaction of receptor dimers with DNA segments containing a related binding site.

Given the unique properties that cbaraktety around AGN 193109, we further investigated whether this antagonist could further inhibit the activity of free RARs. The prescription / repy system used to make this determination advantageously showed a high level of significant activity in the absence of an added retinoid agonist. More specifically, these procedures used the ER-RAR chimeric receptor and the ERE-tk-Luc yeast system. The ERE-tk-Luc plasmid covers the -397 to -87 region of the 5 'flanking region that responds to estrogens, the Xknypus vitkllogknin <A2 gene described by Klkin-Hitpass et al. In Cell 46: (053- (061 (1986), upstream of the HSV thymidine kinase promoter and the tk-Luc plasmid luciferase reporter gene. Chimeric ER-RAR receptors consisted of an estrogen receptor DNA binding domain linked to the "DEF domain "RAR. Those skilled in the art will appreciate the effect of the "DEF" domain on rectinide binding <to provide a retinoid-inducible transactivating effect and to provide a contact site for RXR beta-detection. In this way, luciferase expression in this reporter system was dependent on the activation of the transfected chimeric receptor structure.

Example 10 describes the method used to show that AGN 193109 inhibited the basal gene activity attributable to free RAR. These procedures were carried out in the absence of an added retinoid agonist. The results below provide the first indication that AGN 193109 showed negative hormone activity.

Example 10

Repression of the basic gene activity of a reporter regulated by retinoid in transiently transferred cell lines

CV-1 cells are transfected simultaneously with the ERE-tk-Luc reporter plasmid and either ER-RAR-α, ER-RAR-β or ER-RAR-γ expression plasmids. The ERE-tk-Luc plasmid produced the promotyrokz element, which responded to the estrogen of the Xenopus IśwIs gene A2 and was essentially identical to the reporter plasmid described by Klein Hitpass et al. in Cell 76: 1053 (^ Só), except that the CAT reporter gene has been substituted with a pylinucleotide <luciferic coding> sequence. Polynucleotides encoding ER-RAR-α, ER-RAR-β and ER-RAR-γ chimeric receptors used in co-transfection are described in Graupner et al. Biochem. Biopbzs. Res. Comm. (1991). These polynucleotides were attached to the pECE expression vector described by Ellis et al. in Cell 45: 721 (1986) and expressed under the control of the 8 ^ 40 promoter. Calcium phosphate transfection was performed

188 705 exactly as described in Example 6, using 0.5 pg / well of reporter plasmid and either 0.05 pg, 0.10 pg or 0.2 pg / well of reporter plasmid. The cells were treated with the dose of vehicle alone (ethanol), ATRA (10 '9 up to 10'6 M) or AGN 193109 (10 '9 up to 10M) for 18 hours. Measurements of cell lysate and luciferase activity were performed as described in Example 6.

The results shown in Figures 3A, 4A and 5A confirmed that ATRA strongly induced luciferase expression in all transfectants. The basal luciferase expression level for the three transfected chimeric RAR isoforms ranged from about 7,000 to 40,000 relative light units (rlu) and depended somewhat on the amount of receptor plasmid used for transfection. In this way, the three chimeric receptors can be activated ATRA as expected. More specifically, all three receptors bound ATRA and activated transcription of the reporter gene contained in the ERE-tk-Luc plasmid.

Figures 3B, 4B and 5B show dose response curves of AGN 193109 in the absence of any exogenous retinoid agonist. Interestingly, ER-RAR-α (Fig. 3B) was essentially not affected by AGN 193109, while the ERRAR-β and ER-RAR-γ chimeric receptors (Figs. 4B and 5B, respectively) showed less response to AGN 193109 dose. luciferase reporter activity.

We further traced the repetitive activity of the AGN 193109 hormone by testing its ability to repress gene expression mediated by a chimeric RAR-γ receptor constructed to possess the constitutive domain of transcription activator. More specifically, we used a constitutively active chimeric RAR-γ receptor fused to the domain of the HSV-VP-16 acid activator, called RAR-y-VP-16, in two types of luciferase reporter systems. The first consisted of the ERRaR and ER-RAR-α transfected ERE-tk-Luc reporter. The second used the AMTV-TREp-Luc reporter.

Example 11 describes the method used to show that AGn 193109 could inhibit the activity of the RAR transcription activator domain. The results presented below ensured that AGN 193109 could inhibit RAR-dependent gene expression in the absence of an agonist and confirmed that AGN 193109 showed negative hormone activity.

Example 11

Repression of RAR-VP-16 activity in transiently transfected cells

CV-1 cells were briefly co-transfected according to the calcium phosphate coprecipitation technique described in Example 6, using 0.5 pg / well of the ERE-tk-Luc luciferase reporter plasmid, 0.1 pg / well of the expression plasmid of the ER-RXR-a chimeric reporter. and either 0 pg or 0.1 pg / well of the RAR-y-VP-16 expression plasmid. The ER-RXR chimeric receptor consisted of the hormone binding domain (amino acids 181 to 458) of RXR-a (Mangelsdorf et al. Nature 345: 224-229 (1990), attached to the estrogen receptor DNA binding domain (Graupner et al. Biochem. Biophys. Res. Comm. 179: 1554 (1991)) and expressed from an SV-40 based expression vector pECE described by Ellis et al. in Cell 45: 721 (186). RAR-y-VP-16 is identical to the vP16RAR-y1 expression plasmid described by Nagpal et al. at EMBO J. 12: 2349 (1993), and encodes chimeric proteins having the HSV VP-16 protein activation domain attached to the full-length RAR-γ amino terminus. Eighteen hours after transfection, cells were washed with phosphate-phosphated salt solution (PBS) and treated with DMEM (Gibco-URL) containing 10% FBS (Gemini BioProducts), which was extracted with charcoal to remove retinoids. The cells were treated with a dose of diluted AGN 193109 or ATRA in ethanol vehicle or ethanol alone for 18 hours, then washed with PBS and lysed with 0.1 M KPO4 (pH 7.8), 1.0% TRITON X-100, 1, 0 mM DTT, 2 mM EDTA. Luciferase activity was measured according to the method described by. Weta et al. in Moi. Cell Biol. 7: 725 (1987), using Firefly luciferin (Analytical Luminescence Laboratory) and a 960 well EG&G Berthold luminometer. Luciferase values represented the mean ± SEM of triple determinations.

As shown in Figure 6, CV-1 cells transfected with the reporter construct and the RAR-α chimeric expression plasmid showed weak activation of luciferase activity by ATRA, probably due to the isomerization of ATRA to 9C-RA, natural Uganda RXR (Heyman et al. Cell 68: 397 (1982) Cells transfected with the same mixture

188 705 chimeric expression plasmids but treated with AGN 193109 showed no effect on luciferase activity. Just like the non-binding of AGN 193109 to RXR, the latter result was expected. CV-1 cells similarly transfected with the ERE-tk-Luc reporter but with the substitution of the ER-RAR chimeric expression plasmid by ER-RXR-α showed strong induction of luciferase activity after ATRA treatment.

In contrast, the inclusion of the RAR-γ ^ P-^ expression plasmid with the ER-RXR-a and EREtk-Luc plasmids in the transfection mixture resulted in a significant increase in basal luciferase activity as measured in the absence of any added retinoid. This increase in basal luciferase activity observed for ER-RKR-a / RAR-yVP-16 co-enzymes, compared to results obtained using ER-RKR-a transfected cells alone, indicated that the recombinant ER-RXR-a and RAR-y proteins -kPHó could have heterodimerized. The interaction of the heterodimer with the estrogen-responsive cis-regulatory element led to targeting of the VP-16 activation domain on the promoter region of the ERE-tk-Luc reporter. Treatment of such triple-transfected ATRA cells led to a slight increase in luciferase activity above a high basal level. However, treatment of AGN 193109 triple transfectants resulted in a decrease in dose-dependent luciferase activity. Importantly, Figure 6 shows that AGN 193109 treatment of ER-RXR-a and RAR-y-VP-16 co-transfected cells led to repression of luciferase activity with maximal inhibition occurring at approximately 10 '8 M AGN 193109.

Our observation that AGN 193109 inhibited the constitutive effect of transcriptional activation of RARy-kT-N) in the presence of RXR, explained the model in which binding of AGN 193109 to RAR induced a conformational change in RAR that stabilizes negative conformation, which facilitates binding of the transferred negative co-activator protein. When the AGN 193109 / RAR complex binds via NCP. RAR is unable to increase the transcription of genes that typically correspond to activated RARs. Our model further proposes that the intracellular NCP reservoir exists in a limited concentration in certain contexts and can be exhausted by the feature of AGN 193109 stimulated with RAR complexes.

The results shown in Fig. 6 additionally indicated that even at 10 '5 M AGN 193109, the ER-RXR-a and RARy-kP-Ei proteins could work together to form heterodimers competent to activate the reporerory gene transcription. More specifically, cells transfected with ER-RXR-a and RAR-y ~ VP-16 proteins and treated with (10 'concentration AGN 1931098 - 10 ^ M), sufficient to provide maximum inhibition, gave luciferase readings of approximately 16,000 rl. Conversely, cells transfected only with ER-RXR-a and then treated with AGN 193109 at a concentration as high as 10 '6 M showed a luciferase expression level of only about 8,000 rl. The fact that a higher level of luciferase activity was obtained in cells that showed both ER-R ^ Ra and RAR ~ y ~ CP ~ 16. even in the presence of 1 (f6 M AGN 193109, showed the stability of interaction between two recombinant receptors. AGN 193109 RAR ^ -CP ^ repression activity suggested that modulation of NCP interaction could be codominated using VP-16 activation. In this regard, we have shown that it is possible to modulate the expression of genes that are not normally regulated by retinoids in an AGN 193109 dependent manner.

Candidates for AGN 193109 regulated genes include those that are activated by transcription factor complexes consisting of non-RAR, associating or heterodimerizing RAR agents, where the non-RAR factor does not require RAR agonist to be activated. While stimulation with an RAR agonist may not have a significant effect on the expression of such genes, administration with AGN 193109 may stimulate the formation of inactive transcription complexes including AGN 193109 / RAR / NCP. As a result, the addition of the retinoid negative hormone AGN 193109 may down regulate the transcription of the opposite retinoid insensitive gene.

This similar mechanism may explain the observation that AGN 193109 may inhibit the activity of the t ^^^ glutamine tissue (Tgase) gene in HL-60 cells. The retinoid response element, consisting of three canonical half rctinoid sites separated by 5 and 7 base pairs, was identified in the transcription control region of this gene. While Tgase can be induced with a selective RXR agonist, it does not respond to the selective RAR agonist. The Tgase retinoid response element binds to heterodi64

188 705 mayor RAR / RXR (Davies et al in Press). Interestingly, AGN 193109 is able to repress Tgase activity induced by RXR agonists. This repression in which AGN 193109 can be explained by the ability of this negative hormone to mask NCP on the RAR component of the heterodimer, thereby inhibiting the activity of the accompanying RXR.

We also obtained results that support identical conclusions to those presented in Example 11, by using RAR-y-VP-16 and expression constructs and the AMTY-TREp-Luc reporter plasmid instead of the expression constructs of RAR-y-vP-16 and ER-RXR-a in combination with the ERE-tk-Luc reporter plasmid. In accordance with the results presented above, we have found that RAR-y-VP-16 activity on the AMTV-TREp-Luc reporter inhibited AGN 193109. Thus, AGN 193109 inhibited RAR-γ-VP-16t activity when this chimeric receptor bound directly to the retinoic acid receptor response element instead of indirectly binding to the estrogen response element in the reporter plasmid promoter region. These findings have shown that the test for determining agents having negative hormone activity must be limited by using a particular reporter plasmid. Instead, a critical feature implemented by the experimental system useful for identifying negative rettnoid hormones includes detecting the ability of compounds to repress RAr built to contain the constitutive domain of transcription activation.

In general, negative retinoid hormones can be identified as a subset of retinoid compounds that inhibit the transfected cell's basal expression of a reporter gene that is transcriptively responsible for direct or indirect binding via a retinoid receptor or chimeric receptor, including at least the C-terminal retinoid receptor domains located within the transfected cell. relative to the DNA binding domain of this receptor. This approach has been adapted to a screening method useful for identifying negative retinoid hormones. In various embodiments of the invented screening method, the receptor structure for which a negative hormone is sought is variable. More specifically, the retinoid receptor may be either the RAR or RXR subtype. The receptor can optionally be constructed to contain a constitutive transcriptional activator domain. The retinoid receptor used for screening for negative hormones, optionally contains a domain that binds heterologous DNA as a substitute for the domain that binds enogenous DNA to the native receptor. However, when a second receptor is used in the screening method, and where the second receptor can dimerize with a retinoid receptor for which a negative hormone is sought, then this retinoid receptor may not require a DNA binding domain because it can be attached to the reporter gene transcription control region directly by dimerization with a second receptor that is itself associated with the transcription control region.

In practicing the screening method, the ability of a compound to repress basal reporter expression is typically measured in an in vitro assay. Basal expression represents the level of baseline expression of the reporter in cells transfected under conditions where no exogenous retinoid agonist is added. Optionally, steps can be performed to remove endogenous retinoid ligands from the transfected cell environment by procedures such as charcoal extraction of the serum used in in vitro cell culture.

Examples of reporter genes useful in connection with the scanning method include genes encoding luciferase, beta galactosidase, chloramphenicol acetyltransferase or surface antigens that can be detected by immurochemicals. In practice, the nature of the reporter gene is not expected to be critical to the operability of the method. However, the transcriptional regulatory region 'of the reporter structure must include one or more cis-regulatory elements that are targets of transcription factors for which negative hormones are sought. For example, if negative hormones are required to identify RAR, then the transcriptional regulatory region of the reporter construct may contain a cis-regulatory element that can bind to a RAR-containing protein. In this example, there should be agreement between the RAR DNA binding domain and the cisregulator element of the transcriptional regulatory region of the reporter construction. In this way, if a chimeric RAR, having a constitutive transcription activator domain with a DNA binding domain that can bind cis-regulatory elements of estrogen response, i88 705 is used in the screening method, then the regulatory transcription region of the reporter construct should contain an element of estrogen response .

Examples of cis-regulatory elements that directly bind retinoid receptors (RARE) useful in connection with a reporter assay are described in Mangelsdorf et al. The Retinoid Receptors in The Retinoids: Biology, Chemistry and Medicine. 2nd edition, ed. Spom et al. Raven Press Ltd, New York (i994). Examples of cis-regulatory elements that indirectly bind chimeric receptors include DNA binding sites for each protein, DNA binding for which the protein binding domain of DNA can be incorporated into a chimeric receptor consisting of that domain binding DNA attached to the retinoid receptor. Specific examples of domains that bind heterologous DNA that can be incorporated into chimeric receptors and that will recognize heterologous cisregulator elements include those that recognize estrogen response elements. In this way, the portion of the retinoid chimeric receptor useful in connection with the screening method need not contain retinoid receptor DNA binding but must contain at least the retinoid receptor ligand binding domain.

A further example of indirect retinoid receptor binding involves the use of a protein that can bind the cis-regulatory element and dimerize with the retinoid receptor. In this case, the retinoid receptor associates with the cis-regulatory element only by association with the protein responsible for DNA binding.

An example of such a system would be the use of a linked protein, consisting of a domain, binding heterologous DNA linked to RXR, containing at least the RXR domain, responsible for dimerization with RAR. RARs introduced simultaneously can dimerize with such a fused protein bound to the cis-regulatory element. We anticipate that any protein that binds to the cis-regulatory element that dimerizes with RAR resulting in indirect RAR association with the cis-regulatory element will also be suitable for use in the negative hormone screening method.

In a preferred embodiment of the screening method, retinoid negative hormones are identified as those retinoids that inhibit the basal expression of the RAR transcription factor being built that have increased basal activity. The constructed RAR used in the following example contained the constitutive domain of transcription activation, although not essential for the screening method to be effective. The use of this chimeric receptor advantageously provided an agent that could increase basal expression of the reporter gene in the absence of any retinoid. Although we used short-term transfection in the procedures outlined above, permanently transfected cell lines constitutively expressing the chimeric receptor were also useful in connection with the screening method.

As disclosed in the following example, a chimeric retinoid receptor having a constitutive transcriptional activator domain could dimeize with a second receptor constructed to contain a DNa binding domain specific for the cis-regulatory estrogen response element. In this case, the chimeric retinoid receptor, which has a constitutive transcriptional activator domain, associates with the cis-regulatory region that controls reporter gene expression indirectly by binding to a second receptor that binds to the target DNA sequence. More specifically, the second receptor was constructed to contain a DNA binding domain that it recognized as an estrogen response element. Preferably, the reporter gene, having an estrogen response element upstream of the promoter, did not respond to the retinoid agonist in the absence of a transfected chimeric receptor having a constitutive transcriptional activator domain. Accordingly, all reporter gene activity has been attributed to transfected receptors. The combined use of the domain, the DNA binding element of the estrogen response element and the cis-regulatory element of the estrogen response element, is for illustrative purposes only. It will be understood by those skilled in the art that other combinations of constructed receptors that have specificity for non-RARE cisregulator elements will also be useful in the practice of the invented screening method.

Cells useful in connection with the screening method will be eukaryotic cells that can be transfected. The cells may be animal cells such as human, primate or rodent cells. We have obtained very good results using CV-i cells but we rationally believe that other cultured cell lines66 can be used successfully

188 705 ex. Any number of conventional transfection methods known in the art can be used to introduce expression constructs that encode a chimeric retinoid receptor having a constitutive transcriptional activator domain.

The constitutive domain of transcription activator will consist of many amino acids · · ', which are likely to have a general acid character represented by a negative charge under neutral pH conditions. For example, the constitutive transcriptional activator domain may have an amino acid sequence that is also found in viral transcription factors. An example of a viral transcription factor having a constitutive transcriptional activator domain is herpes virus 16. However, other viral or synthetic transcription activator domains would also be useful in assembling expression constructs encoding a chimeric retinoid receptor having a constitutive transcriptional activator domain.

As described below, we have developed a generalized screening method useful for identifying negative retinoid hormones. This screening method provides a means to distinguish simple antagonists from negative hormones. Table 12 lists several retinoid compounds that have a strong affinity for RAR-γ and yet, with the exception of ATRA, do not transactivate this receptor in a transient transactivation assay. We therefore tested these compounds to determine which were RAR-γ antagonists and which, if any, of these antagonists had negative hormone activity.

Example 12 describes the method used to identify retinoid compounds that were antagonists and a subset of antagonists that had negative hormone activity.

Example 12

Test for negative retinoid hormones.

x 104 X-cell CV-1 transfected transfectionally by the calcium phosphate phosphate described in Mzlceular Cloning: A Loborotory Manual et al. ed. Cold Spring Harbor

Lab Publ. 1989) using 0.5 pg RER-tk-Luc reporter plasmid and 0.1 pg ER-RAR-y chimeric expression plasmid (Graupner et al. Bizehem. Biophys. Res. Comm. 179: 1554 (1991). After 18 hours, cells were washed with PBS and treated with DMEM (Gibco-BRE) containing 10% FBS extracted with activated charcoal (Gemini Bio Products). Cells were treated with 10 '8 M ATRA in ethanol or somone ethanol. In addition, ATRA-treated cells were treated with 10 '9, 10'8, 10'7 or 10 '6 M compounds listed in Table 12. After 18 hours, cells were washed in PBS and lysed in 0.1 M KPO4 (pH 7.8), 1.0% TRITON Χ-100, 1.0 mM DTT, 2 mM EDTA. Luciferase activity was measured as described in Weta et al. in Mol. Cell. Biol. 7: 725 (1987).

Tabelo 12

<td>Relationship</td><td>Kd (nM) @ RARsand</td><td>EC 50 (nM) @ RARsb</td>

<td>AGN 193109 (compound 60)</td><td> 6</td><td>on</td>

<td>AGN 193174 (compound 34a)</td><td> 52</td><td>on</td>

<td>AGN 193385 (compound 23)</td><td> 25</td><td>on</td>

<td>AGN 193389 (compound 25)</td><td> 13</td><td>on</td>

'Relative affinity (Kd) determined by the competition of 3H-ATRA binding to RAR-γ expressed in baculovirus, and using the Cheng-Prussof equation.

b EC 50 measured in CV-1 cells transiently transfected with AMTV-TREp-Luc 1 RS-RAR-γ "na" means no activity

188 705

As indicated by the results shown in part of Figure 7 and table 12 except ATRA, all compounds listed in table 12 were retinoid antagonists at RAR-γ.

The RAR-γ antagonists set out in Table 12 were then screened to determine which, if any, were also retinoid negative hormones. 4 x 104 CV-1 cells were transfected according to the calcium phosphate procedure described in Molecular Cloning: A Laboratory Manual (Sambrook et al. Cold Spring Harbor Lab Publ. 1989), using 0.5 μg reporter plasmid RER-tk-Luc and 0, 1 μg ER-RAR-γ chimeric expression plasmid (Graupner et al. Biochem. Biopbzs. Res. Comm. 149: 15554 (1991). After 18 hours, cells were washed with PBS and treated with DMEM (Gibco-BRL) containing 10% FBS extracted activated charcoal (Gemini Bio-Products). Cells were treated with 10 '9, 10Ί, 10 '7 or 10 '6 M of each compound listed in Table 12. Treatment with ethanol only served as a negative control. After 18 hours, the cells were washed in PBS and lysed in 0.1 M KPO4 (pH 7.8), 1.0% TRITON X-100, 1.0 mM DTT, 2 mM EDTA. Luciferase activity was measured as before in Weta et al. in Mol. Cell. Biol. 7: 725 (1987).

As shown in Figure 8, the retinoid antagonists in Table 12 can be separated into two classes by the trait of their effect on the constitutive activation of transcription cbimerzcznkgy retention of the RAR-γ-VP-16 retinoid receptor. One group that included AGN 193 (44 <AGN 193199 and AGN 193840 did not inhibit RAR-y-VP-16 activity even though they were ATRA antagonists. On the contrary, AGN 193109, AGN 193385, AGN 193389 and AGN 193871 showed repression in dependence from the dose, constitutive activity of RAR-y-VP-16. Thus, while the compounds from both groups were RAR-γ antagonists, only those from the second group showed Ornacrknik negative hormone activity, they favorably distinguished retinoid negative hormones from simple yetinoid antagonists.

The above experimental results showed that AGN 193109 met criteria that define a negative hormone. More specifically, the results presented in Example 11 showed that AGN 193109 was able to exert inhibitory activity at RAR even in the absence of exogenously added rectinoid ligands. As such, this compound had biological activity that did not depend on blocking the interaction between RAR and agonists such as ATRA and AGN 191183. These discoveries led us to the conclusion that AGN 193109 stabilized the interaction between RAR and NCP. As shown in the graph in Figure 9, NCP / RAR / PCP interactions exist in equilibrium. An agonist is used to increase PCP interaction and reduce NCP interaction, while a reverse agonist or negative hormone stabilizes NCP interactions and reduces PCP. As noted previously, our experimental results suggested that the intracellular availability of NCPs for other receptors could be modulated by administration of AGN 193109. More specifically, we found that AGN (93 (09 can stimulate NCP complexes with RARs, thereby reducing the intracellular NCP reservoir available for interaction with transcription factors other than RAR.

We then investigated the effect of AGN 193109 on agonist-mediated inhibition of aP-1 dependent gene expression. In Endocr. Rev. 14: 651 (1993), Pfhal disclosed that retinoid agonists can reduce gene expression. In Endocr. Rev. (1993), Pfhal disclosed that retinoid agonists can reduce gene expression by a mechanism that involved inhibition of AP-1 activity. We assumed that AGN 193109 could also have two effects when used in combination with a rectinide agonist in a model system designed to measure AP-1 activity. First, it is possible that AGN 193109 antagonized the effect of the agonist, thereby attenuating the inhibition of agonist-dependent AP-1 activity. Alternatively, it is possible that AGN 193109 enhanced agonist activity by exaggerating the inhibition of ζ.αι & ζ.η <^ from the agonist of AP-1 activity.

Example 13 describes the methods used to show that AGN 193109 enhanced the activity of the anti-AP-1 yetinoid agonist. As disclosed below, the AGN 193109 retinoid agonist weakly inhibited AP-1 dependent gene expression. The combination of AGN (93 (09 and retinoidywkgy agonist strongly inhibited AP-1 dependent gene expression. AGN 193109 alone did not possess substantially anti-AP-T activity

188 705

Example 13

AGN 193109 enhances the activity of anti-AP-1 retinoid agonist

HeLa cells were transfected with 1 pg of Str-AP1-CAT reporter gene construct and 0.2 pg of pRS-hRARa plasmid, described by Giguere et al. in Nature 33: 624 (1987)), using LIPOFECTAMINE (Life Technologies, Inc.). Str-AP1-CAT was prepared by cloning a DNA fragment corresponding to positions -84 to + 1 of the rat stromiezine-1 promoter (Matrisian et al., Mol CeU.Biol. 6: 1679 (1986)) between HindlU-BamHI pBLCAT sites (Luckow et al., Nucl. Acids Res. 15: 5490 (1987)). This stromelysin-1 promoter sequence contains the AP1 motif as its only enhancer (Nicholson et al., EMBO J. 9: 4443 (1990). Promoter sequences were generated by "annealing" two synthetic oligonucleotides having the sequences:

5'AGAAGCTTATGGAAGCAATTATGATGCAGTTTGCGGGTGACTCTGCAAATACTGCCACT

CTATAAAAGTTGGGCTCAGAAAGGTGGACCTCGAGGATCCAG-3 '(SEQ ID No. 2) and 5'CTGGATCCTCGAGGTCCACCTTTCTGAGCCCAACTTTTATAGAGTGGCAGTATT

TGCAGAGTCACCCGCAAACTGACTCATAATTGCTTCCATAAGCTTCT-3, (SEQ ID No. 3).

Procedures, including transfection, treatment with appropriate compounds, and measurement of CAT activity were performed as described by Nagpal et al. J. Biol. Chem. 270: 923 (1995).

The results of these procedures indicated that AGN 193109 enhanced the anti-AP-1 activity of the retinoid agonist, AGN 191183. More specifically, in a concentration range from 10 '12 up to 10 M, AGN 191183 did not inhibit TPA-induced Str-AP1-CAT expression. AGN 193109 treatment in the concentration range from 10 '10 up to 10'8 M did not substantially inhibit AP-1 mediated reporting activity. However, the results presented in Fig. 10 indicated that stimulation of transfectants with AGN 193109 combination (108 M) and AGN 191183 in the concentration range from 10 '12 up to 10'10 M, significantly inhibited TPA-induced Str-AP1-CAT expression in the amount of 12% -21%. Thus, AGN 193109 enhanced anti-AP-1 activity of AGN 191183 under conditions where this retinoid agonist did not usually inhibit AP-1 activity.

We have demonstrated that AGN 193109 enhanced the agonist-mediated repression of AP-1 activity by a mechanism that probably included AGN 193109-dependent NCP masking on RAR. RARs belong to the superfamily of nuclear receptors, which also include 1,25-dihydroxyvitamin D3, glucocorticoid, thyroid hormone, estrogen and progesterone receptors. It was reasonable to assume that the capacity for NCP binding could be shared by different members of the nuclear receptor superfamily. This led us to suppose that AGN 193109 may have potentiated the anti-AP-1 activity of one or more ligands that interact with the superfamily of nuclear receptors.

The results in the previous example clearly showed; that AGN 193109 enhanced the activity of anti-AP-1 retinoid agonist. More specifically, AGN 193109 lowered the threshold dose at which AGN 191183 anti-AP-1 activity could be detected. Since AGN 193109 alone has essentially no anti-AP-1 activity, its effect on nuclear receptor agonists was synergistic. We also discovered that the AGN 193109 negative hormone enhanced the activity of anti-AP-1 L25-dihydroxyvitamin D3, a natural ligand for the vitamin D3 receptor.

O ') the observed synergism between AGN 193109 and AGN 191183 in the previous example, necessarily necessitated the conclusion that the anti-AP-1 activity of the retinoid agonist and the enhancement of AGN 193109 mediated activity must result from various mechanisms. If the mechanisms of action of the two agents were identical, it explains that the effectiveness of the combination of AGN 193109 and the agonist was additive. Instead, the combination was found to be more effective than any single agent, an effect that might not have been foreseeable before this discovery.

Indeed, AGN 193109-mediated RAR agonist enhancement was performed using approximately KlG fold molar excess of AGN 193109 over the retinoid agonist. Therefore, most RARs should bind to AGN 193109, leaving very few RARs available for agonist binding. Despite this fact, the RAR population, which is not bound by aGn 193109, is available for binding to the tinoid agonist and strongly stimulates the agonist-dependent response that can be measured as inhibition of reporter gene expression. In this way, our data suggested a possible heterogeneity of RAR, which is induced by AGN 193109.

AGN 193109 negative hormone activity, attributed to its ability to stimulate RAR and NCP interactions, provided the basis for understanding the synergies between AGN 193109 and retinoid agonists. Our results were fully consistent with the model in which treatment with AGN 193109 cells stimulated binding of RAR and NCP, thereby reducing the number of free NCP and free RAR inside the cell. This results in the creation of two RAR populations that are functionally different. The first population is represented by RARs associating with NCP. Such AGN 193109 / RAR / NcP complexes cannot be activated with a retinoid agonist. The second population consists of RARs that are not bound by NCP and that remain available for interaction with agonists. This second population is designated "RAR *" to indicate free RARs in an environment substantially free of NCP. RAR * are less likely to associate with NCP via equivalent binding and have greater sensitivity to retinoid agonists, measurable e.g. as antv-AP-1 activity. This is because while the internal NCP reservoir is awaiting by feeding AGN 193109, the PCP reservoir is not depleted. In this regard, free RAR * may bind a retinoid agonist and interact with PCP factors in a substantially NCP-free environment.

The ability of AGN 193109 to increase the sensitivity of other nuclear receptors to their respective agonists can be attributed to the ability of these different nuclear receptors to interact with the same NCPs that interact with AGN 193109 / RAR complexes. This AGN 193109-mediated modulation model for the availability of NCPs for members of the nuclear receptor family is schematically shown in Figure 11.

This model of the mechanism led us to claim that AGN 193109 can modulate the activity of nuclear receptor ligands other than retinoid agonists. As illustrated in the following example, we confirmed that AGN 193109 enhances the activity of 1,25-dihydroxyvitamin D3 in an in vitro transactivation assay.

Example 14 describes the methods used to show that AGN 193109 enhances the activity of 1,25-dihydroxyvitamin D 3 in the transactivation assay.

Example 14

AGN 193109 enhances the activity of 1,25-dihydroxyvitamin D 3

Hela cells were transfected using the cationic liposome mediated transfection procedure described by Felgner et al. in Proc. Natl. Acad. Sci. USA 84: 7413 (1987). 5 x 104 cells were plated on 12-well multi-plate plates and cultured in DMEME supplemented with 10% FBS. Cells were transfected simultaneously in serum-free medium using 2 pg / well of LIPOFECTAMINE reagent (Life Technologies, Inc.) with 0.7 pg MTV-VDRE-Luc reporter plasmid containing two copies of the response element

1.25- dihydroxyvitamin D 3 5'-GTACAAGGTTCACGAGGTTCACGTCTA-3 '(SEQ ID NO: 4) from the mouse osteopontin gene (Ferrara et al. J. Biol. Chem. 269: 2971 (1994)) connected to the reporter plasmid aMtY-Luc (Heyman et al. in Cell 68: 397 (1992)) and 0.3 pg of pGEMSZ plasmid (Pharmacia, Inc.) as a DNA carrier, to a final DNA concentration of up to 1.0 pg per well. After six hours of transfection, the cells were treated with culture medium containing FBS extracted with charcoal at a final concentration of 10%. Eighteen hours after transfection, cells were treated with vehicle alone (ethanol) or AGN 193109 in ethanol at a final concentration or 10 '8 or 10 '7 M. Six hours later, 1.25 dihydroxyvitamin D3 in ethanol was added to a final concentration of W -107 M. Cells were lysed and harvested eighteen hours after treatment with 1,2-7-dihydroxyvamine D 3. Luciferase activity was measured as described above. This experimental system allowed for a convenient method of monitoring and quantitative analysis of 1,25-dihydroxyvitamin D 3 dependent gene expression.

The results shown in Figure 12 indicated that, compared to the results obtained using 1,25-dihydroxyviamine D3 alone, AGN 193109 administered concurrently with

1.25- dihydroxyvitamin, D3 shifted the dose response curve to the left. This confirmed that AGN 193109 enhances the efficacy of 1,257 dihydIΌksivitammy D3 in the transakty70 test

188 705 in vitro. More specifically, Figure 12 graphically illustrates that AGN 193109 concentrations as low as 10-100 nM caused nearly 10-fold greater activity of 1,25-dihydroxyvitamin D3. While the concentration of 10 '8 M 1,25-dihydroxyvitamin D3 was required to produce a luciferase expression of about 2,000 rl, only one tenth of 1,25-dihydroxyvitamin D3 was needed to produce the same luciferase efflux when the vitamin was administered from AGN 193109 at a concentration of 10 '8-l 09 M. Although not shown in the graph in Figure 12, substantially identical results were obtained using AGN 193109 concentrations of 10 'M and 10'8 M. In this way, co-administration of AGN 193109 substantially reduced the amount of 1,25-dihydroxyvitamin D3 required to produce a similar effect in the absence of a negative hormone.

Interestingly, when the above procedure was repeated with co-transfection of the vitamin D receptor plasmid expression (VDR), there was a simultaneous decrease in the ability of AGN 193109 to enhance the activity of 1,25-dihydroxyvitamin D3. We have translated this result as indicating that overexpression of VDR may affect the ability of AGN 193109 to increase the activity of 1,25-dihydroxyvitamin D3. In this way, the intracellular concentration of the ligand receptor, which can be differentiated in a tissue-specific manner, may affect the ability of AGN 193109 to enhance the activity of the ligand that binds the receptor. This was again in line with the model in which NCPs could be used to regulate vitamin D3 responses and uphold the model outlined above.

As illustrated in the following example, we also confirmed that AGN 193109 enhanced anti-AP-1 activity by 1,25-dihydroxyvitamin D3. Our model for AGN 193109 activity activity explains this observation by calling that NCPs associate with RAR in the presence of this drug. Endogenous vitamin D receptors present in HeLa cells probably caused greater sensitivity to 1,25-dihydroxyvitamin D3 ligand, due to the exaggerated ability of this ligand to inhibit expression from the StrAP1-CAT reporter.

Example 15 describes the methods used to show that AGN 193109 enhances anti-AP-1 activity of 1.25-20 dihydroxyvitamin D3.

Example 15

AGN 193109 enhances anti-AP-1 1,25-dihydroxyvitamin D3 activity

HeLa cells were transfected with 1 pg Str-AP1-CAT using LIPOFECTAMINE according to the method described by Nagpal et al. in J. Biol. Chem. 270: 923 (195). Transfected cells were treated with AGN 193109 alone (109-10'7 M), 1,25-dihydroxyvitamin D3 alone (10 '12-l0 '7 M) or 1,25-dihydroxyvitamin D3 alone (10 -10 '7 M) in the presence of 10 '8 M AGN 193109.

The results of these procedures indicated that AGN 193109 enhanced the ability of 1,25-dihydroxyvitamin D3 to inhibit TPA-induced AP-1 activity. Used alone at a concentration of 10 '9 up to 10'7 M, AGN 193109 showed no detectable antiAP-1 activity. The results presented in Figure 13 indicated that 1,25-dihydroxyvitamin D3 inhibits TPA stimulated activity only in the 10 'concentration range8 and 10 '7. Analysis of repression of CAT activity stimulated by TPA mediated by 1,25-dihydroxyvitamin D3 in the presence of ΙΟ '8 M AGN 193109 indicated that anti-Ap-1 activity is detectable at 10 '10 and 10 '9 M 1,25-dihydroxyvitamin D3 and increases activity at 10 'doses8 and 10 '7 M compared to treatment with 1,25-dihydroxyvitamin D3 alone. This modulation depends on AGN 193109 anti-AP-1 activity mediated by 1,25-dihydroxyvitamin D3, was consistent with our model in which NCP masking against RAR made NCP unavailable for interaction with other members of the nuclear receptor family. Accordingly, receptors have become more sensitive to 1,25-dihydroxyvitamin D3 treatment.

The mechanisms underlying RAR-mediated transactivation and anti-AP-1 activity are likely to be different. This conclusion was based on our observation that high doses of AGN 193109 completely inhibited transactivation without substantially inhibiting anti-AP-1 activity. We therefore wanted to gain additional evidence to confirm our RAR * creation model mediated by AGN 193109 treatment. To achieve this, we examined whether AGN 193109 could enhance the activity of the RAR-specific AGN 191183 agonist in an in vitro transactivation assay.

188 705

Example 16 describes the methods used to show that AGN 193109 enhances the activity of the RAR-specific agonist, aGn 191183. The results of this procedure indicated that under special circumstances, AGN 193109 enhances the potency of the RAR-specific retinoid and provided strong evidence that AGN 193109 stimulates the formation of RAR.

Example 16

Enhancing retinoid efficacy by co-administering AGN 193109

HeLa cells are traffected using the trusfection procedure mediated by a cationic liposome, described by Felgner et al. in Proc. Natl. Acad. Sci. USA 84: 7413 (1987). 5 x 104 cells were plated in 12 well multi-well plates and cultured in supplemented DMEM. 10% FBS. Transfected cells simultaneously in serum-free medium using LIPOFECTAMINE reagent (2 pg / well, Life Technologies, Inc.) with 0.7 pg MTY-TREp-Luc reporer plasmid containing two copies of the TREpal 5'- response element TCAGGTCATGACCTGA-3 '(SEQ ID NO: 5) introduced into the AMTV-Luc reporter plasmid (Heyman et al in Cell 68: 397 (1992)) and 0.1 pg RAR-γ pRShRAR-y expression plasmid (Ishikawa et al. in Cell 4: 837 (1990)). After six hours of transfection, the cells were treated with culture medium containing FBS extracted with charcoal at a final concentration of 10%. Eighteen hours after transfection, cells were treated with vehicle alone (ethanol) or AGN 193109 in ethanol at a final concentration of 10-10-8 M. Six hours later, AGN 191183 in ethanol was added to a final concentration of either 10 '10 or 10 '^ M. Cells were harvested after eighteen hours of AGN 191183 treatment and lucifer / Δ 'activity was measured as described above.

Preliminary experiments have shown that 109 M AGN 193109 was relatively inefficient in inhibiting the response against 10 '9 M AGN 191183 in HeLa cells. It contrasted with the 10 'ability9 M AGN 193109 for 10 'braking9 M ATRA in C V-1 cells (Figure 2).

The results presented in Fig. 14 supported the supposition that AGN 193109 stimulated RAR * formation. According to our characterization of AGN 193109 antagonist and negative hormone activity, AGN 193109 treatment resulted in a biphasic dose response curve. Lower doses of AGN 193109 (10-11 and 10 '10 M) resulted in stimulation of luciferase activity over stimulation of AGN 191183 alone. This effect suggests that RAR * is formed by AGN 193109. Peculiarly, this was also seen with treatment with AGN 193109 alone, suggesting that RAR * may respond to an endogenous ligand. AGN 191183 is a synthetic retinoid agonist and, like ATRA, activates transcription through RAR. Substitution of AGN 191183 ATRA in Example 7 gives qualitatively similar results (i.e. AGN 193109 would antagonize the effect of 10 nM AGN 191183). Example 16 illustrates that while AGN 193109 may act as an RAr agonist antagonist, dosing conditions under which co-administration of AGN 193109 enhances RAR agonist-mediated activation can be easily determined. It should be noted that the doses of the compounds used in Example 16 are significantly lower than the doses used in the procedure described in Example 7. We proposed that AGN 193109 treatment could lead to RAR, RAR versus RAr * heterogeneity. Visible heterogeneity (i.e., ability to enhance) is manifested in various windows when it comes to transactivation against AP-1 repression. The reason why the curves are biphasic is because with increasing amounts of AGN 193109, there is a proportionally less RAR available for agonist binding. This is not the case with AP-1 repression and it remains to be presumed that this difference must reflect two different mechanisms of AP-1 transactivation and repression by the same types of receptors.

Clinical results confirmed that some retinoids are useful for inhibiting the growth of precancerous and cancerous cervical conditions. Examples of studies supporting this conclusion were published by Graham et al. in West. J.Med. 145: 192 (1986), Lippman et al. in J. Natl. Cancer Inst. 84: 241 (1992) and Weiner et al. at Invest. New Drugs 4: 241 (1986)).

Similar conclusions support the results of in vitro studies that used culture cells to quantify the antiproliferative effects of various retinoids ^. More specifically, Agarwal et al. in Caneer Res. 5513982 ((911 used ECE16-1 cell lines for the modehi of early cervical dysplasia) and showed that retinoic acid can inhibit epidermal growth factor-dependent (EGF) cell proliferation.

188 705

Example i7 describes the methods used to show that AGN 193109 can antagonize the activity of the AGN 191183 retinoid agonist, which inhibited the proliferation of the ECE16-1 cell line.

Example i7

AGN i93i09 antagonizes the antiproliferative effect of retinoids in ECE16-1 cells

ECE16-1 cells were seeded at a density of ix i04 cells per cm2 in complete medium, containing DMEM: Fi2 (3: 1), non-basic amino acids, 5% FBS, 5 μg / ml trasferin, 2 nM 3.3 ', 5'-triiodothyronine (thyroid hormone or "T3"), 0, 1 nM cholera toxin, 2 mM L-glutamine, 1.8 x 10 '1 adenine and i0 ng / ml EGF. Cells were allowed to attach to the plates overnight and then shifted to specific medium containing DMEM: Fi2 (3: 1), 2 mM L-glutamine, non-basic amino acids, 0, and% bovine serum albumin, 1.8 x i0 "* M adenine, 5 μg / ml transferrin, 2 nM T3, 50 μg / ml ascorbic acid, 100 μg / ml streptomycin, 100 units / ml penicillin and 50 μg / ml gentamycin. The specified medium (DM) was supplemented with 10 ng / ml EGF. EGF-treated cells received i0 nM AGN 191183 retinoid agonist in combination with either 0, 0.1, 1.0, 10, 100 or i000 nM AGN 193109 or i000 nM aGn i93i09 alone. After three days of treatment, cells were harvested as described in Hambree et al. in Cancer Res. 54: 3160 (1994) and the number of cells was determined using a COULTER counter.

The results presented in Fig. I5 showed that ECEi6-i cells proliferated in response to EGF but not in the specific medium alone. This was confirmed by the findings published by Andreatt-van Leyen et al. in J. Cell Physio. 160: 265 (1994), and by Hembree et al. in Cancer Res. 54: 3160 (i994). The addition of i0 nMAGN 191183 and 0 nM AGN 193109 completely inhibited EGF-mediated proliferation. So, AGN 191183 is a potent antiproliferative retinoid. Increasing the AGN 193109 concentration from 0 nM to i0 nM antagonized the increase in AGN 191183-mediated inhibition by about 50%. A tenfold excess molarity of AGN 193109 completely reversed the antiproliferative effect of AGN 191183. Treatment of i000 nM cells with AGN 193109 alone had no effect on EGF-mediated proliferation increase. These results demonstrated that AGN 193109 antagonized the antiproliferative effect of retinoid but essentially not its own antiproliferative activity for use in the treatment of cells representing cervical epithelium which is sensitive to growth inhibition caused by retinoids such as AGN i9ii83. In particular, there was no evidence that AGN 193109 enhanced the antiproliferative activity of the AGN 19ii83 agonist using the ECEi6-i model system.

Unlike the model system represented by the ECE16-1 cell line, there are other examples where cell proliferation associated with cervical dysplasia cannot be inhibited by a retinoid agonist. For example, Agarwal et al. in Cancer Res. 54: 2108 (1994) described the use of CaSki cells as a model for cervical tumors that do not respond to retinoid therapy. As disclosed below, retmoid treatment did not significantly affect CaSki cell growth rate rather than inhibit cell proliferation. The following example directed the effect of the negative hormone AGN 193109 on the rate of proliferation of this cell line. The results have unexpectedly demonstrated that AGN 193109 may inhibit the proliferation of cervical tumor cells that do not respond to the antiproliferative effects of retinoid agonists.

Example 18 describes the methods used to show that AGN 193109 inhibited the growth of a cervical tumor cell line that does not respond to the antiproliferative effects of other retinoids, such as AGN 191183. Indeed, AGN 193109 showed antiproliferative activity in the absence of added retinoid.

Example 18

AGN 193109 inhibits the cell proliferation rate of CaSki cervical cancer

We tested the effect of EGF on CaSki cell proliferation, either alone or in combination with the AGN 191183 retinoid agonist and / or AGN 193109 negative hormone, at a concentration of 10 '6 M. Cell proliferation assays were performed as described above for studies involving ECE16-1 cells. EGF was added to cultures treated with retino188 705 idem to a final concentration of 20 ng / ml. Cells were treated with AGN 191183 (W.10 up to 10'6 M) in the presence or absence of 10 '6 M AGN 193109, for three days. The media were replaced fresh and each of the two retinoid compounds, respectively, each day. Count cell count using a COULTER counter as described above.

The results shown in Figure 16 indicated that CoSki cells were essentially resistant to the effects of the retinoid agonist, and that AGN 193109 had anti-blocking activity when added to the retinoid added. The presence of EGF in culture media stimulated CaSki cell growth. This conclusion was based on a comparison of a striped bar representing no AGN 191183 and an open bar representing growth in specific medium alone ("DM"). AGN 191183 treatment did not give anti-cleavage activity to the CaSki tumor cell line. We ruled out any unintentional increase in the rate of cellular proliferation associated with the tail retinoid, because the increase of ten thousand times the retinoid agonist concentration was associated with only approximately a 20% increase in the proliferation rate. In this way, the 191183 aGn agonist had essentially no effect on the rate of CaSki cell proliferation.

The results of Fig. 16 also indicated that AGN 193109 inhibited the proliferation of the CaSki cervical epithelial cell line. This conclusion was based on a comparison of measurements shown as the black "0" pillar of AGN 191183 and the ribbed "0" pillar of AGN 191183. In this way, AGN 193109 was able to stimulate a biological response at the amount of added retinoid agonist, in the stew to treat cervical tumor cells whose growth was not inhibited by the agonist β-agonist, such as AGN 191183.

Our finding that the AGN 193109 negative hormone could inhibit cellular proliferation was in line with the model in which free RAR mediated the expression of genes required for proliferation. While a RAR agonist such as AGN 191183 had essentially no effect, or perhaps stimulated nothingonic cellular proliferation. AGN 193109 had antiproliferative effects. Negative hormone AGN 193109 tightly bound RARs, thereby stimulating NCP associations and causing the RAR to become inactive conformation. According to our model, this inhibited gene activity that was positively regulated by free RARs. This ability of AGN 193109 to reduce the activity of free RARs was probably due to its ability to stimulate the association of rAr and NCP.

Those skilled in the art will appreciate that some retinoid agonists are useful for controlling the adverse effects of cell growth that results from retinal detachment. After retinal detachment, the retinal pigmented epithelium (RPE) is differentiated, proliferates and migrates to the space of the ganglia. This process may negatively affect the success of the surgical procedure aimed at re-sticking the retina. Compochiaro et al. at Invest. Ophtal & Vis.Sci. 32:65 (1991) showed that RAR agonists such as ATRA demonstrated the effect of ontyproliferaeyjpy on the growth of primary RPE human cultures. Retinoid agonists have also been shown to reduce the extent of retinal detachment following retinal sticking surgery (Fekrot et al. Ophtalmolzgy 102: 412 (1994)). As disclosed in the following example, we analyzed the ability of AGN 193109 negative hormone to suppress growth in primary human RPE cultures.

Example 19 describes the methods used to show that AGN 193109 enhances the antiproliferative effect of the rctinzid antagonist in primary cultures of human retinal pigment epithelium.

Example 19

AGN 193109 enhances the anti-proliferative activity of ATRA, in contrast, cultures of human retinal pigment epithelium (RPE) were established according to the method described by Campochiaro et al. Ipvest. Opthal & Vis.Sci 32:65 (1991). 5 x 104 cells were plated in 16 mm wells of multi-well plates (24 wells of DMEM IgU (co) containing 5% FBS). The cells were artificially treated with ethanol, ATRA (10- ™ to 10)6 M) in ethanol, AGN 193109 (10-10 to 10 6 M) in ethanol or ATRA (10-10 to 10'6 M) and 10-5 M AGN 193109. Cells were fed with fresh medium containing appropriate concentrations of these compounds every two days for a total period of

188 705 five days of treatment. Cells were removed from the plates by gentle trypsin digestion, and the number of cells was calculated using an electronic cell counter.

The results presented in Fig. 17 indicated that AGN 193109 dramatically enhanced ATRA antiproliferative activity on RPE cells. Treatment of primary RPE ATRA cells led to a decrease in dose-dependent RPE cell proliferation with a nearly 40% reduction at 106 M of ATRA alone compared to the control culture. AGN 193109 treatment did not significantly change the rate of RPE cell growth at any concentration tested in this procedure. Unexpectedly, ATRA connection (10 'ñ up to 10 'M) and 10' M AGN 193109 had stronger antiproliferative activity than ATRA alone. In this way, the simultaneous treatment of AGN 193109 enhanced the antiproliferative effect of ATRA. More specifically, the results shown in the figure indicated that the 10 'antiproliferative effect8 M ATRA was only possible using 10 'l (i M ATRA in combination with 10 '7 AGN 193109. In this way, the negative hormone AGN 193109 favorably increased ATRA antiproliferative activity by nearly 100-fold.

In an independent experiment, comparison of the antiproliferative effect of ATRA (10 '11 to ΙΟ-6 M) with the influence of ATRA and 10 '6 M AGN 193109, again showed a visible increase in the sensitivity of primary RPE cells to ATRA in the presence of AGN 193109. In this system, AGN 193109 neither acted as a retinoid antagonist nor showed antiproliferative effect when used alone. However, co-administration of AGN 193109 enhanced the antiproliferative activity of the retinoid agonist.

AGN 193109 was tested for its ability to enhance the antiproliferative effect of 13-cis retinoic acid (13-cis RA) in primary RPE cultures, using the conditions and techniques for measuring RPE cell proliferation described above. In particular, 13-cis RA is clinically relevant. More specifically, 13-cis RA is useful in the treatment of several disease states, including acne (Peck et al. N. Engl. J. Med. 300: 329 (1977); Jones et al. Br. J. Dermatol. 108: 333 (1980)), and skin and cervical squamous cell carcinoma in combined treatment with interferon 2a (Lippman et al. J. Natl.Cancer Inst. 84: 241 (1992); Moore et al. Seminars in Hematology 31:31 (1994)).

The results presented in Fig. 18 indicated that both 13-cis RA (10 '12 up to 10'6 M) and ATRA (10 '12 up to 10'6 M) effectively inhibited the growth of RPE cells. In particular, the 13-cis isomer was nearly two orders of magnitude less effective compared to ATRA. Similar to results obtained using the co-administration of AGN 193109 and ATRA (above), the co-administration of AGN 193109 (or 10 '8 or 10 '6 M) with 13-cis RA (10 '12to 10 '° M) dramatically increased the strength of 13-cis RA in mediating the repression of RPE cell proliferation. In contrast to treatment with 13-cis RA alone, co-administration of AGN 193109 enhanced the strength of 13-cis RA. In this way, AGN 193109 enhanced the antiproliferative activity of 13-cis RA.

We then tested the ability of AGN 193109 to enhance the activity of other nuclear receptor hormones in primary RPE cell cultures. Dexamethasone, a synthetic glucocorticosteroid receptor agonist, is one of the class members that has been used clinically for their strong anti-inflammatory and immunosuppressive properties. Thyroid hormone (T3; 3,3 ', 5'-triiodothyronine) is an agonist of the natural thyroid hormone receptor, used mainly for hormone substitution therapy in the treatment of thyroid hypothyroidism. The methods used in these experiments were identical to those described above for the procedure, including ATRA and 13-cis RA.

The results of these procedures indicated that co-administration of AGN 193109 and nuclear receptor agonists enhanced the antiproliferative activity of nuclear receptor agonists. More specifically, the results presented in Fig. 19 showed that treatment with RPE cells with a single agent or dexamethasone (10 ^1 to ΙΟ '6 M) or ATRA (10 '12 to ΙΟ '6 M) essentially could not inhibit RPE cell proliferation. However, treatment of RPE cells with dexamethasone (1011 up to 10 6 M) and or 108 M or 10 6 M AGN 193109 inhibited RPE cell proliferation to a size that was approximately the same as inhibition caused by ATRA treatment. Similarly, the results presented in Fig. 20 indicated that AGN 193109 enhanced the antiproliferative activity of thyroid hormone. Similar to results obtained with dexamethasone, RPE cell proliferation was resistant to single agent treatment with thyroid hormone (10-11 to 10 '6 M). However, the simultaneous treatment of RPE cells with thyroid hormone (10-11, 10'6 M) and AGN 193109 (either 10 ^ M or 10-6 M) inhibited RPE cell proliferation in a thyroid hormone dependent manner. We concluded that AGN 193109 made primary RPE cultures sensitive to the antiproliferative effects of these nuclear receptor agonists. The mechanism by which AGN 193109 mediated this impact probably included modulations of NCP / RAR interactions.

We also examined the effect of AGN 193109 on the expression of marker genes in other experimental systems that were sensitive to retinoid agonists. Both MRP8 and stromelysin genes are known to be inhibited by retinoid agonists in various biological systems. For example, Wilkinson et al. in Cell Sci. 91: 221 (1988) and Madsen et al. in J. Invest. Dermatol.99: 299 (1992) revealed that MRP8 gene expression was elevated in psoriasis. Conversely, MRP8 gene expression was inhibited by the retinoid agonist AGN 190168 in human skin with psoriasis (Nagpal et al. Submitted 1995), in human keratinocyte mass cultures (Chandraratna et al. J. Invest. Dermatol. 102: 625 (1994)) and in human keratinocyte neonatal foreskin cultures (Thacher et al. J. Invest. Dermatol. 104: 594 (1995)). Nagpal et al. In J.Biol.Chem.270: 923 (1995) disclosed that stromelysin mRNA levels were inhibited by retinoid agonists such as AGN 190168 in cultured human foreskin neonatal keratinocytes. We analyzed the regulated expression of these genes after treatment of neonatal foreskin in cultured human keratinocytes with AGN 191183 or AGN 193109 retinoid agonist.

Example 20 describes the methods used to show that AGN 193109 inhibited MRP-8 expression in cultured keratinocytes.

Example 20

AGN 193109 inhibits MRP-8 expression in keratinocytes

Primary foreskin keratinocytes were isolated according to the procedure described by Nagpal et al. in J. Biol. Chem. 270: 923 (1995) and grown in keratinocyte culture medium (KGM), which was purchased from Clonetic. After 3 days of treatment with AGN 191183 (WT 'M) or AGN 193109 (106 M), all of the cellular RNA was isolated from the treated and control kerate cytes according to standard methods. mRNA was reverse transcribed into cDNA, which then served as a template in the PCR amplification protocol using primers specific for either the glyceroaldehyde phosphate dehydrogenase host gene (GAPDH) or MRP-8.

GAPDH primers had sequences

5'-CCACCCATGGCAAATTCCATGGCA-3 '(SEQ ID NO: 6) and

5'-TCTAGACGGCAGGTCAGGTCCACC-3 '(SEQID No.: 7).

The MRP-8 primers had the sequences' -ACGCGTCCGGAAGACCTGGT-3 (SEQ ID No. 8) and '-ATTCTGiC-AGGTACATGTCCA-3' (SEQ D> No. 9).

An equal portion of the MRP-8 amplification reaction (10 µl) was removed after each PCR amplification cycle, starting with 12 cycles and ending with 21 cycles. Similarly, an equal portion of the GAPDH amplification reaction was removed after each PCR cycle, starting at 15 cycles and ending at 24 cycles. Samples were electrophoresed on 2% agarose gels and the amplification products detected by etidium bromide staining were separated. The intensity of staining of the amplification products served as a quantitative measurement of the amount of starting mRNA specific for a given primer set.

The results of this procedure indicated that both AGN 191183 and AGN 193109 independently inhibited MRP-8 expression in keratinocytes. The staining intensity of GAPDH amplification products was essentially equal in the gel paths representing the starting material isolated from the control, AGN 191183 and AGN 193109 treated keratinocytes. Weak bands representing the GAPDH amplification product were initially detectable in runs corresponding to samples removed after 18 PCR amplification cycles. Equivalent color intensities among different gel-runs indicated that equivalent masses of starting material were used for all samples. Therefore, differences in the intensity of the color of the webs representing the MRP-8 amplification products pointed to

188 705 differences in MRP-8 mRNA expression among different starting samples. As expected, the amplified MRP-8 signal was inhibited in cultures treated with AGN 191183 (10'7 M) relative to the untreated control. Treatment of cultured keratinocytes AGN 193109 (10 '6 M) also inhibited MRP8 expression as judged by the lower color intensity of the amplification product.

As illustrated in the following example, AGN 193109 also inhibited the expression of a second marker gene in keratinocytes. Nagpal et al. in J. Biol. Chem. 270: 923 (1995) disclosed that expression of stromelysin mRNA was reduced by a KAR-specific agonist in cultured human neonatal foreskin keratinocytes. Nicholson et al. (EMBO J. 9: 4443 (1990)) disclosed that the AP-1 promoter element played a role in the negative regulation of the retinoid-dependent stromelysin-1 gene. In this way, it was necessary to determine whether AGN 193109 could change the expression of this gene.

Example 21 describes the methods used to show that AGN 193109 inhibited the expression of the stromelysin-1 gene in the absence of an exogenously added retinoid agonist.

Example 21

AGN 193109 inhibits the expression of them stromelysin-1 in cultured keratinocytes

Primary foreskin keratinocytes were either artificially treated or treated for 24 hours with the RAR agonist AGN 191183 (10'7 M) or AGN 193109 (106 M). Total RNA obtained from artificially treated and retinoid treated keratinocytes was reverse transcribed and the resulting cDNA amplified by PCR using oligo primers β-actin or stlelimelizyyy-1, exactly as described in Nagpal et al. in J. Biol. Chem. 270: 923 (1995)). A sample (10 µl) from the PCR amplification reaction was removed after every three cycles, starting with 18 cycles of PCR amplification. The sample was subjected to 2% agarose gel electrophoresis and detected after staining with etidium bromide.

The results of these procedures indicated that AGN 193109 inhibited the expression of the stromelysin-1 gene in the absence of an exogenously added retinoid agonist. More specifically, ribbons stained with etidium bromide, representing β-actin amplification products, were easily detectable on agarose gels after 18 PCR cycles. While the intensity of all the entire web increased with additional cycles of amplification reactions, the stained webs were slightly less intense in samples representing AGN 191183 treated cells. This indicated that a slightly lower amount of RNA had to be present in the starting samples corresponding to AGN 191183 treated cells. Results also indicated that stromel.isin-1 mRNA was detectable in artificially treated keratinocytes starting from 33 cycles of PCR amplification. As expected, stromelysin-1 mRNA expression was inhibited by AGN 191183 (10'6 M) treatment as judged by the weaker intensity of the ribbons compared to samples derived from artificially treated samples. After normalization to the intensity of β-actin amplification products, according to results obtained in MRP-8 expression measurements, treatment of AGN 193109 (10'6 M) keratinocytes resulted in a decrease in stromelysin-1 mRNA level. In fact, the reduction stimulated by AGN 193109 treatment was indistinguishable from the reduction caused by treatment of keratinocytes with the RaR AGN 191183 agonist.

As disclosed herein, AGN 193109 may have each of three possible effects due to modulation of the activity of the co-administered steroid superfamily agonist. First, AGN 193109 may not be affected. Secondly, AGN 193109 may antagonize the effect of the agonist, thereby reducing the agonist's activity. Finally, AGN 193109 may enhance agonist activity, thereby leading to stimulation of the measured effect produced by the agonist.

193109, comprising Compounds having activity that can be modulated by retinoid receptor agonists that binds to other members of the steroid receptor superfamily. The latter category of agonists includes vitamin D receptor agonists, glucocorticoid receptor agonists and thyroid hormone receptor agonists. Receptors activated by the peroxisome proliferator, estrogen receptor and orphan receptors, which have currently unknown ligands, can also be strengthened with AGN 193109. In the case where the steroid superfamily agonist is an RAR agonist, AGN 193109 may either antagonize or enhance the activity of this agonist. In the case where the agonist used in combination with AGN 193109 is a compound that can bind to a non-RAR nuclear receptor, co-administration of AGN 193109 will either have no effect or sensitize the system on the agonist such that the agonist activity is enhanced.

The generalized example procedures for determining which of the three possible AGN 193109 activities will occur in each system are as follows. This description illustrates each of the possible outputs for the administration of AGN 193109 simultaneously with a steroid receptor superfamily agonist. Biological systems useful for assessing the ability of AGN 193109 to modulate nuclear receptor agonist activity include, but are not limited to: established cell culture tissue lines, virus transformed cell lines, primary ex-vivo cell cultures and in vivo studies using live organisms. Measurements of the biological impact of AGN 193109 in such systems could include determining each of the different biological endpoints. These endpoints include: cell proliferation analysis, programmed cell death (apoptosis) analysis, analysis of the stage of cell differentiation by determining gene expression, analyzing the ability of cells to form tumors in nude mice, and analyzing gene expression after brief or permanent introduction of reporter gene construction.

For illustrative purposes, types of mRCA designated as "X" mRNA are expressed from the "X" gene in primary cultured "Y" cells isolated from the "Z" organ. Under standard culture conditions, where several "Y" genetic markers are preserved, including "X" gene expression, the addition of a retinoid agonist leads to a reduction in "X" mRNA abundance. Analysis of gene X expression can be estimated by isolating cellular mRNA and measuring the amount of X mRNA level by polymerase chain reaction, ribonuclease protection or RNA blotting procedures such as Nothern analyzes. After isolation from the Z organ, primary Y cells are cultured in appropriate culture medium. Primary cultures are then coated on tissue culture plates to expand the cell population. This step facilitates the separation of cells into four sample groups so that different doses of retinoid agonist and AGN 193109 can be obtained. The first group will be the vehicle-only control. The second group will receive the RAR agonist retinoic acid, supply them with ethanol in sufficient quantities to provide final concentrations in the range of 101 - 10'6 M. The lowest dose may need empirical determination depending on system sensitivity. Such terms fall within the scope of routine experimentation for the average specialist. The third group will receive both the nuclear receptor agonist at the same doses as used to treat the cells in the group w, and the constant dose of AGN 193109. The dose of AGN 193109 used for group 3 cells will also need to be determined empirically, but it should have a similar affinity constant (Kd) of AGN 193109 for RAR subtypes (i.e. at least 10 '8 M). The fourth group will receive AgN 193109, in doses minimally covering the dose used for simultaneous administration of the agonist in group 3. An alternative to this dosing regimen would replace AGN 193109 with the retinoid agonist described in the previous example, as detailed for group 2, and a fixed dose of retinoid agonist in place of AGN 193109 as detailed in groups 3 and 4. After an appropriate incubation period, cells should be harvested in a manner appropriate to determine the biological endpoint as measured as an indicator of agonist activity.

For example, analyzing the effect of AGN 193109 on retinoic acid-dependent gene expression regulation would involve comparing the amount of X-type mRNA in the pool of mRNA harvested from cells treated according to each of the four protocols described above. RNA derived from control cells will serve to determine the mRNA X expression baseline and will represent conditions corresponding to the lack of expression. Comparison of this level with mRNA measured from the pool, derived from cells treated with retinoic acid, will determine the effect of this agonist on gene expression. The quantitative levels of specific mRNA repression resulting from retinoic acid treatment can be compared with the amounts of mRNA from cells treated in parallel with either AGN 193109 or AGN 193109 alone in combination with retinoic acid. Although this generalized example illustrates an analysis of the effect of co-administered aGn 193109 on the expression of a gene inhibited by a retinoid agonist, the example could possibly describe the analysis

188 705 effect of AGN 193109 co-administered on a gene that was induced by retinoid agonists. A critical feature in determining whether AGN 193109 will behave like an agonist, like a negative hormone, or whether it will not affect individual systems, will include quantitative comparison of the magnitude of the effect in the presence or absence of AGN 193109.

An example in which AGN 193109 enhanced the activity of a co-administered agonist would be the case in which co-administration of AGN 193109 with retinoic acid resulted in the expression level of mRNA X, which was further repressed relative to the level measured in cells treated with retinoic acid alone. More specifically, comparing the dose response curve of the biological effect (i.e. repressing the amount of X mRNA) drawn on the Y axis, versus the agonist dose (logarithmic scale) on the X axis, will allow comparison of the repression mediated by the agonist of the amount of X mRNA in the presence and absence of simultaneous AGN 193109 administration. The ability of AGN 193109 to sensitize a biological response to an agonist, thereby enhancing agonist activity, will be indicated by shifting to the left the dose response curve. More specifically, in the presence of AGN and 93109, you will need less agonist to obtain the same biological effect achievable using the agonist alone.

An example of antagonism of a co-administered agnist mediated by AGN 193109 would be the case in which co-administration of AGN 193109 with retinoic acid results in a level of expression of mRNA X with less repression compared to that measured in cells treated with retinoic acid alone. Comparison of mRNA X dose repression curves versus log agonist dose in the presence or absence of AGN 193109 will show a shift to the right of the dose response curve. More specifically, in the presence of AGN 193109, more agonist will be needed to achieve the same biological effect achievable with single agent treatment with the agonist alone.

The above examples, in which AGN 193109 mediates either antagonism or enhancement, describe the experimental outputs of co-administration of AGN 193109 with a retinoid agonist. However, if the agonist co-administered with AGN 193109 is an agonist that allows binding and activation of a non-RAR steroid receptor superfamily member, then instead of antagonizing the agonist, it is possible that AGN 193109 will not affect agonist activity. If co-administration of AGN 193109 with such an agonist results in a level of mRNA expression equal to that measured in cells treated with the agonist alone, then the ability of AGN 193109 to affect NCP availability by stimulating RAR: NCP association will be weak in this system. This would be an example in which AGN 193109 had no effect on a concomitant agonist.

An example of antagonism

The method disclosed in the generalized example above, determining the effect of AGN 193109 co-administered with a retinoid agonist, is illustrated by the procedure described in Example 7. CV-i cells co-transfected with one of three retinoid acid receptors and the MTV-TREp-Luc inducible agonist construction of the reporter retinoid, dose given or ethanol (control, group 1), AGN 193109 with a final concentration of 10 '9-10'fM (group 2), AGN 193109 with a final concentration of 10 ^ -10 ^ M co-administered with retinoic acid at 104 M (group 3) or retinoic acid (10 '8 M, group 4). Comparison of luciferase activity from group 1 with activity in group 4 allowed to determine the level of expression of the retinoid agonist luciferase reporter gene in the absence of added AGN 193109. Comparison of expression of the luciferase reporter gene in group 3 cells with measurement in group 4 cells showed that AGN 193109 behaved like a retention agonist antagonist in this system.

An example of antagonism

The method disclosed in the generalized example for determining the effect of AGN 193109 administered concurrently with a retinoid agonist was similar to that used for the determination in Example 17, where AGN 193109 functioned as an antagonist of repression mediated by retinoid agonist, EGF-stimulated cell proliferation in transformed cervical epithelial cells

188 705 uterus, ECE-16-1. In this procedure, the ECE-16-1 cell treatment included an EGF-treated control (group 1) EGF-treated and AGN 193109 treated sample at a final concentration of 10 'δ M (group 2), treated sample. combination of EGF and AGN 193109 193109 with a final concentration of 10 '6 M administered concurrently with a single dose of 10 µM AGN 191183 retinoid agonist (group 3) and a sample treated with a combination of EGF and AGN 191183 at 10-8 M (group 4). After three days of treatment, the cell proliferation rate was determined. Determination that the cells were stimulated to proliferate by eGf was possible because an additional control taactate was included in which the cells were exposed to a specific medium that did not contain EGF. Comparison of the number of cells in the group with the number of cells in group 4 allowed for settling. that agonist RAR AGN 191183 inhibited EGF-stimulated proliferation of ECE-16-1 cells. Comparison of group 3 with group 4 indicated that AGN 193109 antagonized the activity of the RAR intaginocyte in this system.

Example of strengthening

The method disclosed in the generalized example, determining the effect of AGN 193109 co-administered with an agonist was also used in Example 14 to determine that

AGN 193109 w / macna nuclear receptor agonist activity in HeLa cells transfected with reporter gene inducible with 1,25-dihydroxyvitamin D3. Treatment of these cells included vehicle alone (control, group 1), 1.25-dihydroxyvitamin D3 with a final concentration of 10-10-10-7 M (group 2), 1.25-dihydaoxy ~ vitamin D3 with a final concentration of 10- 10-10-7 M administered concurrently with AGN 193109 with a final concentration of either 10-8 or 10-7 M (group 3), and AGN 193109 as a single agent treatment with a final concentration of either 10-8 or 10-M (group 4) ). Comparison of luciferase activity measured in group 1 (control) cells with activity in group 2 cells determined that stimulated 1,25-di ^ yd: ^^ l ^! ^; Ywit ^ mi ^ ą D 3 luciferase activity was dependent on dose. Comparison of the activity of the luciferase measured in group 4 cells (single agent AGN 193109 treatment) with measurement from group 3 cells (simultaneous administration of AGN 193109), similarly allowed to determine the dose-dependent lueyfeaa / y stimulated activity with 1,25-dihydroxyvitamin D3 in the presence of a given concentration AGN 193109. In this case, the zero value represented luciferase activity in cells treated with AGN 193109 alone (group 4). This dosing regimen allowed the comparison of three dose response curves 1,2 - dihydroxyvitamin D3. Comparison of the dose response curve of 1.25 ~ dihydroxyvitamma D3 in the absence of AGN 193109 with the curve representing the co-administration of AGN 193109 (either 10- or 10-7 M) showed increased activity of the vagrant, as evidenced by a shift of the left half of the maximum response.

Example of strengthening

The method disclosed in the generalized example, determining the effect of AGN 193109 co-administered with the ^ Ιμϊ agonist, was further used in Example 19 to determine that AGN 193109 enhances the anti-proliferative activity of RAR agonists in primary cultures of human cabbage retinal pigment cells. Cell treatment included: ethanol carrier alone (group 1), retinoic acid final concentration from 10 '10 up to 10-6 M (group 2), retinoic acid with a final concentration of 10 ^ to 10 '6 M given jointly with (6 M AGN 193109 (group 3) and AGN 19/3109 alone with a final concentration of 1040 up to 106 M (group 4). Comparison of test results obtained using group 1 and 2 cells allowed to determine the inhibition of dose dependent proliferation of these cells by retinoic acid. Similarly, comparison of results obtained using group 3 cells with group. 1 allowed to determine the inhibition of the proliferation of these cells in a dose-dependent manner by retinoic acid in the presence of co-administered AGN 193109. Group 4 showed the inability of AGN 193109 to significantly change the rate of proliferation of these cells when treated with a single agent. Comparison of response curves to the dose of retinoic acid-mediated cell proliferation repression generated in Groups 2 and 3 provided the basis for the conclusion that AGN 193109 sensitized primary RPE cells to the antiproliferative effect of the RAR agonist, thereby altering RAR agonist activity.

188 705

As noted above, Agarwal et al. in Cancer Res. 54: 2108 (1984), showed that the growth of CaSki cells, unlike ECV-16-1 cells immortalized in HPV, was not inhibited by treatment with retinoid agonists. As disclosed herein, we have surprisingly discovered that CaSki cell growth was inhibited by AGN 193109 in the absence of a retinoid agonist. The following example illustrates how AGN 193109 can be used to inhibit the growth of tumors with CaSki cells in vivo.

Example 22

Inhibition of tumor growth with CaSki cells in nude mice after administration of AGN 193109

1x10 CaSki cells were injected into each group of nude mice. Tumor formation is assessed using techniques known to those skilled in the art. The control group received a placebo. The test group was given AGN 193109. Animals treated with placebo received intragastrically through a tube of corn oil. Test animals received 20 pmol / kg AGN 193109 in corn oil per day throughout the treatment period. Tumor volume is measured in cubic centimeters using scaled tentacles. Tumor volume is marked on the graph as a function of time. Mice receiving AGN 193109 showed tumors with a much lower growth rate compared to tumors in control mice, as assessed by tumor size and number over the study period. This result shows in vivo that AGN 193109 inhibits the growth of advanced cervical cancer that is refractory to therapy including administration of a retinoid agonist.

As noted above, CaSki cells are a model of cervical tumors that do not respond to retinoid agonist therapy. However, we disclosed here that CaSki cell growth was inhibited by AGN 193109 in the absence of retinoid agonist treatment. The ability of AGN 193109 to inhibit CaSki cell proliferation suggested that AGN 193109 could be used for the therapeutic treatment of cervical cancers that are insensitive to retinoid agonist therapy. The following example illustrates a method that can be used to assess the therapeutic capabilities of AGN 193109 in the treatment of cervical cancer

Example 23

Assessment of the therapeutic capacity of AGN 193109 in patients with cervical cancer

First, a patient with advanced cervical cancer is identified. Cervical biopsies are obtained according to methods known to those skilled in the art. Tumor transplanted cells were spread in tissue culture according to standard techniques to provide a sufficient number of cells to divide into three groups of samples. For this purpose, the culture conditions described in Agarwal et al. In Cancer Res. 54: 2108 (1994). The first group is kept as a control and receives the vehicle alone (ethanol). The second group is treated with RAR agonist at a concentration of 10 '10 up to 106 M. The third group is treated with AGN 193109 in doses in the range of 10 '3° to 106 M. Cells are fed daily with fresh medium and provide the retinoids described above for each sample group respectively. Cells are counted after three days using an electric cell counter. Comparison of the number of cells in control cultures with the number of cells in cultures treated with retinoic acid indicates that the RAR agonist does not significantly inhibit the growth rate of cultured cervical cancer cells. In contrast, AGN 193109-treated cells show a decrease in the number of cells in a dose-related manner, compared to control cell counts. This result, in which AGN 193109 treatment inhibits the proliferation of cultured cervical cancer cells, indicates that AGN 193109 will be a useful therapeutic agent for treating patients who have metastatic disease.

Cervical cancer patients who have undergone surgery to remove the original tumor and who have had itL metastatic disease was taken for randomized clinical trials to show the therapeutic benefits of AGN 193109 in this indication. Patients are divided into two groups. The first group is the control group, while the second group is treated with AGN 193109. AGN 193109 is combined with a pharmaceutically acceptable carrier to produce a composition suitable for systemic administration, all in accordance with techniques known to a person skilled in the art. The control group is given a placebo formulation and the experimental group is given a formulation containing the negative hormone AGN 193109. Patients are given maximum tolerated doses and this is done daily for a period of three

188 705 months to one year. The test result is quantified by the measure of disease survival over time. Individuals receiving AGN 193109 show a significant increase in disease survival, including a disproportionate number of patients showing full remission of their metastatic disease. This result indicates that AGN 193109 has therapeutic use for in vivo treatment of years that do not respond to the optol-proliferative effect of retinoid agonists such as retlnzwy acid .

As disclosed above, AGN 193109 enhanced the ontyproliferative activity of RAR agonists in five-cell cultures of human retinal pigment epithelial cells. Therefore, it is expected that co-administration of in vivo AGN 193109 with an RAR agonist will increase the therapeutic index of the agonist because less tailed RAR will be needed to achieve the same therapeutic effect. Dzdatkzwz, AGN 193109 sensitizes primarily cultures of human retinal pigmented epithelial cells to the effect of anti-polymorphic disease of the tail of gluczkrrcycloid and thyroid hormone receptors. The following pVr rabbit model will be used in two separate studies to show the increased therapeutic index obtained by co-administration of AGN 193109 with RAR agonist (13-cis retinoic acid) or thyroid hormone receptor, respectively. In particular, the model of rabbit bunny volleyball published by Sen et al. in Areh.Opthalmol. 106: 1291 (1988), was used to show that retinoid agonists that homogeneize proliferation in primary RPE cells in vitro also inhibit the in vivo retinal detachment frequency (Arab et al. Invest. Optholmo. 34: 522 (1993)). In this way, due to their use as therapeutic agents in preventing retinal detachment, a correlation has already been established between the in vitro and in vivo activity of retinzi id agonists. The following examples illustrate. jlk AGN 193109 can be used for therapeutic applications aimed at preventing retinal detachment.

Example 24

The use of AGN 193109 to increase the therapeutic capacity of steroid padrefamily receptor agonists in the treatment of proliferative vitreczretipzpatli (PVR)

In the first study, human RPE cells were injected into the vitreous cavity of the rabbit eyes according to the method described by Sena et al. in Akch.Opthalmzl. 106: 1291 (1988). After intravitreal injection, the rabbits were divided into five groups. The first group (control) will receive the vehicle with the help of vitreous humor. The second group receives retinoic acid as a single agent treatment (100 pg) by intravitreal injection. The third group receives AGN 193109 as single agent treatment (100 pg) by intravitreal injection. The fourth group receives via intravitreal injection, a RAR agonist (retinoic acid) at a dose of one tenth of the amount given to group 2 (10 pg). The fifth group receives the joint AGN 193109 (100 pg) and retinoic acid (10 pg) by intravitreal injection. Animals receive a single intravitreal injection of the appropriate treatment one day after intravitreal injection of human RPE cells. The rabbits are examined by indirect ophthalmoscopy on days 7, 14 and 28 and are classified for the frequency and severity of traction (t ^^ and ^ thionol) for retinal detachment. Rabbits from the group injected with 100 pg retinoic acid show a lower frequency and severity of retinal detachment compared to control rabbits or rabbits receiving either AGN 193109 or som retie acid (10 pg). The rabbits in the group given the combination of AGN 193109 and retipzwegz acid (10 pg) show significantly lower incidence and severity of retinal cluster compared to either the control, AGN 193109 or retinoic acid (10 pg). This result shows that AGN 193109 improves the RAR tailing therapies index of rctinic acid in the in vivo PVR model.

In the second study, rabbits were first injected with human RPE cells into the vitreous cavity of the eye, and then divided into four groups. The first group (control) receives vehicle, by injection into the vitreous humor. The second group receives thyroid hormone as a single agent treatment (100 pg) by intravitreal injection. The third group is administered AGN 193109 as a single treatment (100 pg) by intravitreal injection. The fourth group is given a combination of AGN 193109 (100 pg) and thyroid hormone (100 pg). Rabbits are examined by indirect ophthalmoscopy on days 7, 14 and 28 and classified for the frequency and severity of traction retinal adhesion. Po82

188 The 705 equation of frequency and severity of retinal detachment in four groups shows that treatment with a single agent or AGN 193109 or thyroid hormone does not inhibit retinal detachment compared to control rabbits. In contrast, the group of rabbits that were given a combination of AGN 193109 and thyroid hormone had significantly less retinal detachment and severity. This result shows that AGN 193109 improves the therapeutic index of thyroid hormone in the in vivo PVR model.

The following example illustrates how AGN 193109 can be used to enhance the therapeutic index of an RAR agonist used to treat patients after retinal sticking surgery.

Example 25

Increasing the therapeutic index of 13-cis retinoic acid RAR agonist

First, the adult volunteer population having retinal detachment resulting from PVR is identified. People have undergone gluing using standard techniques in the field. Patients were then divided into five groups. The control group consists of patients who have undergone retinal adhesive surgery and do not receive any retinoid compound. The second group receives 40 mg of 13-cis retinoic acid orally twice a day for four weeks after surgery. The third group receives 40 mg of AGN 193109 orally twice daily for four weeks after surgery. The fifth group receives 40 mg of AGN 193109 orally in combination with 4 mg of 13-cis retinoic acid orally, twice daily for four weeks after surgery. The protocol for treatment and evaluation of drug efficacy is carried out essentially as described in Fekrat et al. in Opthalmology 102: 412 (1995).

The frequency and severity of retinal detachment after surgery in all five groups are monitored over a nine month period using ophthalmological examination techniques known to those of skill in the art. Patients receiving oral 40 mg 13-cis retinoic acid show a much smaller range of retinal detachment compared to control patients, patients receiving 4 mg 13-cis retinoic acid orally twice daily or patients receiving 40 mg AGN 193109 orally twice daily . A study of a group of patients receiving a combination of 40 mg AGN 193109 orally and 4 mg 13-cis retinoic acid orally twice daily for four weeks after surgery shows that the therapeutic result in this group of patients is equal to or better than patients receiving 40 mg orally Retino 13-cis twice a day for four weeks after surgery. This result shows that the AGN 193109 negative hormone improves the therapeutic index of an RAR agonist by the property of reducing the frequency and severity of retinal detachment in PVR patients.

General test for the identification of negative nuclear receptor hormones

We have shown above that AGN 193109 can act as a negative hormone, enabling repression of the basic transcription activity of RAR nuclear receptors. Next, we described the assay using CV-1 cells co-transfected with the ERE-tk-Luc luciferase report plasmid and ER-RXR-a and RAR-G-YP-16 receptor expression plasmids to distinguish RAR ligands that are simple antagonists from those possessing activity negative hormone.

We concluded that negative RARs mediate the repression of RAR mediated transcriptional activity by stimulating the increased interaction between RAR and NCP. Further, we have shown that AGN 193109 can enhance the effect of other nuclear receptor agonists in a manner consistent with the mutual distribution of NCPs between members of the nuclear receptor steroid superfamily. As such, ligands can be labeled and screened to identify compounds having negative hormone activity at these non-RAR nuclear receptors.

Our method of screening the negative RAR hormone, based on the use of CV-1 cells co-transfected with the ERE-tk-Luc luciferase reporter plasmid and ER-RXR-a and RAR-G-YP-16 receptor expression plasmids, can generally be adapted so that the RAR particle -γ plasmid RAR-y-VP-16 is converted to the peroxisome proliferator activated receptor (PPAR), vitamin D receptor (VDR), thyroid hormone receptor (T3R) or any other nuclear receptor of the steroid superfamily, enabling heterodimerization with RXR. CV-1 cells co-transfected with such plasmids will express a high basal level of luciferase activity. Ligands that enable binding to the receptor ligand binding domain substituted with the RAR-γ particle can easily be screened for negative hormone activity by measuring their ability to repress luciferase activity.

For nuclear receptors, a steroid superfamily that does not heterodimerize with RXR (e.g. glucocorticosteroid and estrogen receptors), the same results can be obtained using GR-VP-16 receptors and a luciferase reporter plasmid consisting of the appropriate glucocorticosteroid response element or estrogen combined with heterologous element of the promoter and luciferase or other reporter gene. An essential feature of the negative negative hormone general screening test is the inclusion of at least the domain that binds the ligand of the particular nuclear receptor for which the inverse agonist is to be screened, and the method of localizing the domain that binds the nuclear receptor ligand to the reporter gene promoter. This can be accomplished using the receptor's natural DNA binding site, or optionally by assembling a chimeric receptor having a heterologous DNA binding domain and the corresponding use of a reporter gene that is under the control of a DNA regulatory element recognized by the heterologous DNA binding domain. In a preferred embodiment, the plasmid expressing the nuclear receptor for which the inverse agonist is screened will express that nuclear receptor as a fused protein containing a constitutive activation domain, such as the activation domain of HSV VP-16, to ensure high primary activity. This high basal activity will effectively increase the sensitivity of the test, thereby allowing the analysis of nuclear receptor ligands that inhibit basal transcription activity in the absence of an added receptor agonist, nuclear.

The following example illustrates a method that can be used to screen compounds having negative hormone activity at the thyroid hormone receptor.

Example 26

How to identify negative hormones' thyroid hormone receptor

CV-1 cells are transfected simultaneously with the ERRXR-α and T3R-YP-15 luciferase reporter plasmid. T3R-VP-16 is identical to the RAR-y-VP-16 plasmid, except that the RAR-γ RAR-y-VP-16 particle has been substituted with thyroid hormone receptor cDNA. As such, T3R-VP-16 expresses a fused protein containing the HSV-VP-16 activation domain in frame at the N-terminus of thyroid hormone receptor. Standard methods of transfection and cell culture are used for this purpose. After transfection, the cells are washed and fed with culture medium containing 10% fetal calf serum, which has been extracted with activated charcoal. Cells are treated with vehicle alone (ethanol), thyroid hormone (W ^ to 10)40 M) or TR-1 compound (10'9 to 10'6 M). TR-1 is a synthetic thyroid hormone receptor ligand that has a strong affinity for thyroid hormone receptor in competitive binding studies, but which does not activate the transfectionary thyroid hormone receptor in a transient transactivation assay using a short-lived co-transfection reporter gene, thyroid hormone responsive gene and hormone receptor expression plasmid thyroid. Further, TR-1 is capable of antagonizing transactivation. thyroid hormone mediated and as such is a thyroid receptor antagonist.

Analysis of luciferase activity from a ERE-tk-Luc, ER-RXRa and T3R-VP-16 transfected CV-1 cell shows a high level of basal luciferase reporter activity in vehicle-treated cells. Thyroid hormone treated cells show a slight increase in luciferase activity in a dose-dependent manner. TR-1 treated cells show a decrease in dose-dependent luciferase activity. This means that TR-1 has thyroid receptor inverse agonist activity, probably due to the increased interaction of NCP with the thyroid hormone receptor.

The proliferation factor of human primary retinal pigment epithelial cells inhibits RAR agonist treatment. The therapeutic value of this observation has been demonstrated for use in postoperative retinoid therapy after retinal adhesive surgery. We have shown above that the RAR AGN 193109 negative hormone can sensitize primary RPE cells to the antiproliferative effects of ATRA and 13-cis retinoic acid in co-administration procedures. Furthermore, it also turned out that AGN 193109 sensitizes ko84

188 705 RPE cells on the antiproliferative effect of other nuclear receptor agonists. More specifically, AGN 193109 sensitized RPE cells to the anti-operative effects of glucocorticoid agonists, dexamethasone and thyroid hormone agonist 3,3'.5 ^^^^! J <o ^ otyrorir ^, T3. These data were consistent with our working model in which AGn 193109 modulated the availability of NCP, shared among members of the nuclear receptor family. Treatment of RPE cells with an inverse TR-1 thyroid hormone receptor agonist will similarly alter the availability of split NCPs, so that co-administration with a non-thyroid agonist such as the RAR agonist 13-cis retinoic acid will lead to increased antiproliferative effects on RPE culture compared to acid 13 retinoate as a single agent treatment.

The following example illustrates a method that can be used to sensitize primary RPE cells to RAR agonist antiproliferative activity. In particular, this example further illustrates how RAR agonist activity can be enhanced by co-administration with a negative hormone.

Example 27

Sensitization of primary retinal pigment epithelial cells to the antiproliferative effect of RAR agonists by co-administration of an inverse TR-1 thyroid hormone agonist

Human primary RPE cells are obtained and cultured according to standard methods. Cell culture is divided into four groups and treated as follows. The first group receives the vehicle alone (ethanol). Group 2 is treated with 13-cis retinoic acid in a concentration range of 10 '11 up to 10'i) * * * * 6 M. Group 3 is treated with an inverse thyroid hormone TR-1 agonist at concentrations ranging from 10 'n up to 104 M. Group 4 is treated simultaneously with 13-cis retinoic acid in concentrations in the range of 10 'n up to 104 M TR-1. The cells are again fed with fresh culture medium and treated again with the appropriate compound every two days for a total treatment period of five days. The proliferation rate throughout the experiment is quantified by measuring the number of cells in culture using an electric cell counter.

TR-1 treated cells (group 3) show cell proliferation rates, essentially the same as control cells (group 1), and this inverse agonist is not affected by the measured growth rate of culture. Cells treated with 13-cis retinoic acid (group 2) show a reduced number of cells depending on the dose. The comparison of the reduction of cell proliferation depending on the dose of group 4 cells (simultaneous administration of 13-cis retinoic acid and TR-1) with that obtained in group 3 shows that the possibility of simultaneous administration of inverse TR-1 thyroid hormone receptor agonist sensitization of RPE cultures to antiproliferative the effect of 13-cis retinoic acid as measured by shifting the dose response curve of this RAR agonist to the left in Group 4 compared to Group 2 cells.

LIST OF SEQUENCES

1) GENERAL INFORMATION:

i) NOTIFIER: ALLERGAN ii) TITLE IN THE INVENTION: ZvwJik relmr) ddwv and their application iii) NUMBER OF SEQUENCES: 9 iv) CORRESPONDENCE ADDRESS:

A) ADRESSEE: Knobe, Martens, Olson & Bear

B) STREET: 620 Newport Center Drive 16th Floor

C) CITY: Newport Beach

D) STATUS: CA

E) COUNTRY: USA

F) CODE: 92660

188 705

v) COMPACT READABLE FORM:

A) MEDIA TYPE: Floppy disk

B) COMPUTER: Compatible with IBM PC

C) OS: DOS

D) SOFTWARE: FastSEQ Version 1.5 vi) CURRENT APPLICATION DATA:

A) APPLICATION NUMBER:

B) SUBMISSION DATE:

C) CLASSIFICATION:

vii) PREVIOUS NOTIFICATION DATA:

A) APPLICATION NUMBER: 08/522 448

B) DATE OF SUBMISSION: SEPTEMBER 01, 1995

A) APPLICATION NUMBER: 08/522 779

B) DATE OF SUBMISSION: SEPTEMBER 01, 1995

A) APPLICATION NUMBER: 08/542 648

B) DATE: 13 OCTOBER 1995

A) APPLICATION NUMBER: 08/613 863

B) SUBMISSION DATE: MARCH 11, 1995 viii) INFORMATION FOR THE ATTORNEY / INTERMEDIARY

A) NAME: Altman, Daniel E

B) REGISTRATION NUMBER: 34 115

C) CERTIFICATE / PERMISSION NUMBER: ALERGN.058A ix) TELECOMMUNICATION INFORMATION:

A) PHONE: 714-460-0407

B) PHONE: 4 (4-460-9502

C) TELEX:

2) INFORMATION ABOUT SEQ ID NO: 1:

i) SEQUENCE FEATURES:

A) LENGTH: 21 pairs of rules

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) TYPE OF PARTICIPATION: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) OPIZ: SEQ O No. 1:

TCAGGTCACC AGGAGGTCAG 21

2) NFF (^ IMA ^ C ^ O SEQ ID yy: 2:

i) FEATURES βΕΚν / ΕΝΟΙ:

A) LENGTH: 101 base pairs

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear

188 705 ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTI-SENSUAL: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 2:

AGAAGCTTAT GGAAGCAATT ATGAGTCAGT TTGCGGGTGA CTCTGAAAAT ACTGCCACTC 60 TATAAAAGTT GGGCTCAGAA AGGTGGACCT CGAGGATCCA C 101

2) INFORMATION ABOUT SEQ ID No.; 3:

i) SEQUENCE FEATURES:

A) LENGTH: 101 base pairs

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 3:

CTGGATCCTC GAGGTCCACC TTTCTGAGCC CAACTTTTAT AGAGTGGCAG TATTTGCAGA 60 GTCACCCGCA AACTGACTCA TAATTGCTTC CATAAGCTTC 100

2) INFORMATION ABOUT SEQ ID NO: 4:

i) SEQUENCE FEATURES:

A) LENGTH: 28 pairs of rules

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 4:

GTACAAGGTT CACGAGGTTC ACGTCTTA 28

2) INFORMATION ABOUT SEQ ID NO: 5:

i) SEQUENCE FEATURES:

A) LENGTH: 16 base pairs

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none

188 705 iv) ANTI-SENSUAL: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 5:

TCAGGTCATG ACCTGA 16

2) INFORMATION ABOUT SEQ ID NO: 6:

i) SEQUENCE FEATURES:

A) LENGTH: 24 pairs of rules

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 6:

CCACCCATGG CAAATTCCAT GGCA 24

2) INFORMATION ABOUT SEQ ID NO: Ί:

i) SEQUENCE FEATURES:

A) LENGTH: 24 pairs of rules

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 7:

TCTAGACGGC AGGTCAGGTC CACC 24

2) INFORMATION ABOUT SEQ ID NO: 8:

i) SEQUENCE FEATURES:

A) LENGTH: 20 base pairs

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 8:

ACGCGTCCGG AAGACCTGGT 20

188 705

2) INFORMATION ABOUT SEQ ID NO: 9:

i) SEQUENCE FEATURES:

A) LENGTH: 20 base pairs

B) TYPE: nucleic acid

C) NUMBER OF CHAINS: single

D) TOPOLOGY: linear ii) PARTICLE TYPE: cDNA iii) HYPOTHETICAL: none iv) ANTISENSIVE: none

v) FRAGMENT TYPE:

xi) DESCRIPTION OF THE SEQUENCE: SEQ ID No: 9:

ATTCTGCAGG TACATGTCCA 20

188 705

990000 180000 970000 960000 96Ó0009400009SOOOO990000990000 9000009000080000roooo60000300004000030000

30000 \ 90000 sts

-8 -3 -6

LOGARISMIC DOSE (M)

LOGARISMIC DOSE (M)

188 705 <

NJ ω

£ o

fc jooooo-i J80000770000teooooϊίΟΟΰΰJ400007300007900007700007000009000080000700006000080000- f

40000·' 30000\ 90000 70000

FIG. 4 A <

ω fc>

About fc

FIg -0- Ο.ΰί / ίβ —®— 0.70 / tg —o ™ 0.9O / t $

-9 -8 -7 -o

LOGARISMIC DOSE (M)

4B LOGARISM DOSE (M)

188 705 / 50,000 / 30,000 / 70,000 / 60,000 / 50,000 / 40,000 / 30,000 / 30,000 // OOOÓ / 00,000 30,000 30,000 70,000 60,000 50,000 50,000 40,000

30000 \ 30000 /0000

, 0-3-3 -7 -6

JFJ-G. FG. LOGARISMIC dose (M)

Fig 5B. Logarithmic YfkNTiA (M)

188 705 —0— ALFA, ANSWER TO THE ATRAŁ A-RXff DOSE ALFA, ANSWER TO THE AGN DOSE 193109 —o— £ / ł-AXH alfa + ΜΚ 6 AMMA-VXJ £, ANSWER TO THE ATRA DOSE

--- ALFA + ΑΜ 6 AMMŹ-W/6,

ANSWER TO DA WKĘACN193109

-r-7

O -9 -8

LOGARISM DOSE (M) jFfG-. FG

LUCIFERASE ACTIVITY

LOGARISMIC DOSE (M)

188 705 in

U □

* TZ3

ABOUT

Μΰοο

- * s -r LOGARITHIC DOSE (M) ~ -o - a £ ti ffjjog J93ir4 ~ ® ~ AGN i93J $ 9 - *> - A6Nft338 £ ~ * ~ a & tjt9389 --- o-fiCA / 793830 88NJ9387J _rfiSL 8,

NO UGANDA

Θ jGst

ADDING AN AGONIST

ADDING AGN 193109

188 705

Αβ

INHIBITION (%)

JO.

\ lo & μ]

ΜΗ J9H8S (PCP)

HCP

WP / GP @>

HCP

D £ f

Ά &

Χιϊϋ.

rę.ęby.

+ AGH 193109

188 705

LUCIFERASE ACTIVITY

188 705

700·

80&0-9!

M £ 3 a

z £ L ·

4020-72 -7 and -70 -9 -8 -7

FITG. 13 1.25 DIHYDROXIVITAMINE D3 \ L0 & M]

LUCIFERASE ACTIVITY

LOGARISMIC DOSE (M)

188 705

ASM J9HS3

188 705

JO 90 90 90 90 90 [Μ]

RETINOID CONCENTRATION

13.

188 705

DENSAMETAZONE OR ATRA CONCENTRATION

&&. 20.

T3 OR ATRA CONCENTRATION

100

188 705

luciferase

UP Department of Publications. Circulation of 50 copies Price PLN 6.00.

Contents56

104 members in 20 offices

This recordMember, by publication datePriority claim10 more offices are in the list below

Priority claims5

Priority claims
Document	Office	Kind	Date
52277895	United States of America	A	1995-09-01
52277995	United States of America	A	1995-09-01
54264895	United States of America	A	1995-10-13
61386396	United States of America	A	1996-03-11
9613779	United States of America	W	1996-08-23

Members104

Family members, oldest first
Document	Office	Kind
CA2230672A1	Canada	A1	1997-03-13
WO9709297A2	World Intellectual Property Organization (WIPO)	A2	1997-03-13
AU7235496A	Australia	A	1997-03-27
WO9709297A3	World Intellectual Property Organization (WIPO)	A3	1997-08-28
NO980880D0	Norway	D0	1998-02-27
NO980880L	Norway	L	1998-04-27
PL325249A1	Poland	A1	1998-07-06
US5776699A	United States of America	A	1998-07-07
EP0853610A2	European Patent Office (EPO)	A2	1998-07-22
IL123490D0	Israel	D0	1998-09-24
CZ62198A3	Czechia	A3	1998-11-11
CA2294601A1	Canada	A1	1998-12-30
WO9858922A1	World Intellectual Property Organization (WIPO)	A1	1998-12-30
AU8261998A	Australia	A	1999-01-04
US5877207A	United States of America	A	1999-03-02
CN1209802A	China	A	1999-03-03
KR19990044302A	Republic of Korea	A	1999-06-25
BR9610412A	Brazil	A	1999-07-06
CA2316351A1	Canada	A1	1999-07-08
WO9933821A1	World Intellectual Property Organization (WIPO)	A1	1999-07-08
AU1940699A	Australia	A	1999-07-19
EP0931786A2	European Patent Office (EPO)	A2	1999-07-28
EP0931786A3	European Patent Office (EPO)	A3	1999-09-01
US5952345A	United States of America	A	1999-09-14
US5958954A	United States of America	A	1999-09-28
HU9902337A2	Hungary	A2	1999-10-28
HUP9902337A2	Hungary	A2	1999-10-28
AU713586B2	Australia	B2	1999-12-02
US6008204A	United States of America	A	1999-12-28
HK1018771A1	Hong Kong, China	A1	2000-01-07
NZ319762A	New Zealand	A	2000-01-28
HU9902337A3	Hungary	A3	2000-02-28
HUP9902337A3	Hungary	A3	2000-02-28
EP0991636A1	European Patent Office (EPO)	A1	2000-04-12
US6090810A	United States of America	A	2000-07-18
BR9810340A	Brazil	A	2000-09-19
CN1268130A	China	A	2000-09-27
EP1042313A1	European Patent Office (EPO)	A1	2000-10-11
AU729140B2	Australia	B2	2001-01-25
KR20010020505A	Republic of Korea	A	2001-03-15
US6218128B1	United States of America	B1	2001-04-17
HK1030167A1	Hong Kong, China	A1	2001-04-27
US6228848B1	United States of America	B1	2001-05-08
NZ500397A	New Zealand	A	2001-06-29
JP2001527071A	Japan	A	2001-12-25
IL140567D0	Israel	D0	2002-02-10
JP2002504887A	Japan	A	2002-02-12
JP2002507204A	Japan	A	2002-03-05
AU744757B2	Australia	B2	2002-03-07
CN1360890A	China	A	2002-07-31
HU0202511D0	Hungary	D0	2002-09-28
US6469028B1	United States of America	B1	2002-10-22
US2002156054A1	United States of America	A1	2002-10-24
US6521624B1	United States of America	B1	2003-02-18
EP0853610B1	European Patent Office (EPO)	B1	2003-03-05
AT233726T	Austria	T	2003-03-15
ATE233726T1	Austria	T1	2003-03-15
DE69626528D1	Germany	D1	2003-04-10
RU2203884C2	Russian Federation	C2	2003-05-10
IL153296D0	Israel	D0	2003-07-06
IL153305D0	Israel	D0	2003-07-06
IL153306D0	Israel	D0	2003-07-06
IL153307D0	Israel	D0	2003-07-06
IL140567A	Israel	A	2003-07-31
EP0931786B1	European Patent Office (EPO)	B1	2003-08-06
AT246669T	Austria	T	2003-08-15
ATE246669T1	Austria	T1	2003-08-15
DE69629399D1	Germany	D1	2003-09-11
CN1121379C	China	C	2003-09-17
US2003219832A1	United States of America	A1	2003-11-27
ES2195014T3	Spain	T3	2003-12-01
DE69626528T2	Germany	T2	2003-12-24
KR20040004463A	Republic of Korea	A	2004-01-13
KR20040004464A	Republic of Korea	A	2004-01-13
CN1142928C	China	C	2004-03-24
EP1042313B1	European Patent Office (EPO)	B1	2004-04-28
ES2205380T3	Spain	T3	2004-05-01
AT265447T	Austria	T	2004-05-15
ATE265447T1	Austria	T1	2004-05-15
DE69629399T2	Germany	T2	2004-05-27
DE69823553D1	Germany	D1	2004-06-03
KR100447045B1	Republic of Korea	B1	2004-09-07
KR100447047B1	Republic of Korea	B1	2004-09-07
NO317562B1	Norway	B1	2004-11-15
KR100447046B1	Republic of Korea	B1	2004-11-17
EP0991636B1	European Patent Office (EPO)	B1	2005-03-02
AT289998T	Austria	T	2005-03-15
ATE289998T1	Austria	T1	2005-03-15
PL188705B1This record	Poland	B1	2005-03-31
DE69829183D1	Germany	D1	2005-04-07
PL188785B1	Poland	B1	2005-04-29
DE69823553T2	Germany	T2	2005-05-25
EP1535919A2	European Patent Office (EPO)	A2	2005-06-01
KR100512058B1	Republic of Korea	B1	2005-09-02
US6942980B1	United States of America	B1	2005-09-13
EP1535919A3	European Patent Office (EPO)	A3	2005-10-26
DE69829183T2	Germany	T2	2006-04-06
CA2230672C	Canada	C	2006-10-31
JP4118511B2	Japan	B2	2008-07-16
JP2008280346A	Japan	A	2008-11-20

Showing 100 of 104

2 legal events, as the office reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code
2010-10-29	Decisions on the lapse of the protection rightsLapsedLAPS	LAPS
2007-04-30	Rectifications of patent specificationRECP	RECP

Abstract

Term

HX

Y (R)

5'AGAAGCTTATGGAAGCAATTATGATGCAGTTTGCGGGTGACTCTGCAAATACTGCCACT

LIST OF SEQUENCES

1) GENERAL INFORMATION:

D) STATUS: CA

E) COUNTRY: USA

F) CODE: 92660

C) OS: DOS

A) APPLICATION NUMBER:

B) SUBMISSION DATE:

C) CLASSIFICATION:

A) APPLICATION NUMBER: 08/522 448

B) DATE OF SUBMISSION: SEPTEMBER 01, 1995

A) APPLICATION NUMBER: 08/522 779

B) DATE OF SUBMISSION: SEPTEMBER 01, 1995

A) APPLICATION NUMBER: 08/542 648

B) DATE: 13 OCTOBER 1995

A) APPLICATION NUMBER: 08/613 863

B) REGISTRATION NUMBER: 34 115

A) PHONE: 714-460-0407

B) PHONE: 4 (4-460-9502

C) TELEX:

2) INFORMATION ABOUT SEQ ID NO: 1:

TCAGGTCACC AGGAGGTCAG 21

2) INFORMATION ABOUT SEQ ID NO: 4:

GTACAAGGTT CACGAGGTTC ACGTCTTA 28

2) INFORMATION ABOUT SEQ ID NO: 5:

TCAGGTCATG ACCTGA 16

2) INFORMATION ABOUT SEQ ID NO: 6:

CCACCCATGG CAAATTCCAT GGCA 24

TCTAGACGGC AGGTCAGGTC CACC 24

2) INFORMATION ABOUT SEQ ID NO: 8:

ACGCGTCCGG AAGACCTGGT 20

2) INFORMATION ABOUT SEQ ID NO: 9:

ATTCTGCAGG TACATGTCCA 20

LOGARISMIC DOSE (M)

LOGARISMIC DOSE (M)

LOGARISMIC DOSE (M)

4B LOGARISM DOSE (M)

O -9 -8

LUCIFERASE ACTIVITY

LOGARISMIC DOSE (M)

ABOUT

NO UGANDA

ADDING AN AGONIST

ADDING AGN 193109

HCP

HCP

LUCIFERASE ACTIVITY

LUCIFERASE ACTIVITY

LOGARISMIC DOSE (M)

ASM J9HS3

RETINOID CONCENTRATION

DENSAMETAZONE OR ATRA CONCENTRATION

T3 OR ATRA CONCENTRATION

Priority claims5

Members104

Over the term

Events

Numbers

Titles2

Classification