Homologous 28-kilodalton immunodominant protein genes of ehrlichia canis and uses thereof.
Abstract
The present invention is directed to the cloning, sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-1, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis. Further disclosed is a multigene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins react with convalescent phase antiserum from an E.canis-infected dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effective for disease prevention and serodiagnosis.

Term
Term ended
Expired 12 September 2021, 5 years ago.
- Priority
- Filed
- Expired
- Today
20 claims: 5 independent, 15 dependent
- 1REIVINDICACIONES Habiéndose descrito la invención como antecede, se reclama como propiedad lo contenido en las siguientes reivindicaciones:1. Una secuencia aislada de ADN que codifica para una proteína de 30 kilodaltones de Ehrlichia canis, caracterizada la proteína porque es inmunorreactiva con el suero anti-Ehrlichia canis.
- 2La secuencia de ADN de conformidad con la reivindicación 1, caracterizada porque la proteína comprende una secuencia de aminoácidos seleccionada del grupo que consiste de las SEQ ID Nos. 2, 4, 6, 40, 42, 44 y 46 .
- 3La secuencia de ADN de conformidad con la reivindicación 2, caracterizada porque la proteína tiene una secuencia de señal N-terminal.
- 4La secuencia de ADN de conformidad con la reivindicación 3, caracterizada porque la proteína es posttraduccionalmente modificada a una proteína de 28 kilodaltones.
- 5La secuencia de ADN de conformidad con la reivindicación 1, caracterizada porque el ADN comprende una secuencia seleccionada del grupo que consiste de las SEQ ID Nos. 1, 3, 5, 39, 41, 43 y 45.
- 6La secuencia de ADN de conformidad con la reivindicación 1, caracterizada porque el ADN está contenido en un locus simple de Ehrlichia canis.
- 7La secuencia de ADN de conformidad con la reivindicación 6, caracterizada porque el locus es un locus de genes múltiples de 10,677 pares de bases de longitud.
- 8La secuencia de ADN de conformidad con la reivindicación 7, caracterizada porque el locus contiene los genes que codifican para las proteínas homólogas de 28 kilodaltones de Ehrlichia canis.
- 9La secuencia de ADN de conformidad con la reivindicación 8, caracterizada porque las proteínas homólogas de 28 kilodaltones de Ehrlichia canis son seleccionadas del grupo que consiste de p28-l, p28-2, p283, p28-4, p28-5, p28-6, p28-7, p28-8 y p28-9.
- 10Un vector, caracterizado porque comprende la secuencia de ADN de conformidad con la reivindicación 1.
- 11El vector de conformidad con la reivindicación 10, caracterizado porque el vector es un vector de expresión capaz de expresar un péptido o polipéptido codificado por una secuencia seleccionada del grupo que consiste de las SEQ ID Nos. 1, 3, 5, 39, 41, 43 y 45, cuando el vector de expresión es introducido en una célula.
- 12Una proteína recombinante, caracterizada porque comprende una secuencia de aminoácidos seleccionada del grupo que consiste de las SEQ ID Nos. 2, 4, 6, 40, 42, 44 y 46.
- 13La proteína recombinante de conformidad con la reivindicación 12, caracterizada porque la secuencia de aminoácidos es codificada por un segmento de ácido nucleico que comprende una secuencia seleccionada del grupo que consiste de las SEQ ID Nos. 1, 3, 5, 39, 41, 43 y 45.
- 14Una célula huésped, caracterizada porque comprende un segmento de ácido nucleico seleccionado del grupo que consiste de las SEQ ID Nos. 1, 3, 5, 39, 41, 43 y 45 .
- 15Un método para producir la proteína recombinante de conformidad con la reivindicación 12, caracterizado el método porque comprende los pasos de:la obtención de un vector que comprende una región de expresión que incluye una secuencia que codifica para la secuencia de aminoácidos seleccionada del grupo que consiste de las SEQ ID Nos. 2, 4, 6, 40, 42, 44 y 46, operativamente enlazada a un promotor;la transfección del vector dentro de una célula;y el cultivo de la célula bajo condiciones efectivas para la expresión de la región de expresión.
- 16Un anticuerpo, caracterizado porque es inmunorreactivo con un polipéptido que comprende una secuencia de aminoácidos seleccionada del grupo que consiste de las SEQ ID Nos. 2, 4, 6, 40, 42, 44 y 46.
- 17Un método para inhibir la infección por Ehrlichia canis en un sujeto, caracterizado porque comprende los pasos de:identificar un sujeto antes de la exposición o sospechoso de estar expuesto a o infectado con Ehrlichia cani s;y administrar una composición que comprende un antígeno de 29 kDa de Ehrlichia canis, en una cantidad efectiva para inhibir la infección por Ehrlichia canis.
- 18El método de conformidad con la reivindicación 17, caracterizado porque el antígeno de 28 kDa es una proteína recombinante que comprende una secuencia de aminoácidos seleccionada del grupo que consiste de las SEQ ID Nos. 2, 4, 6, 40, 42, 44 y 46.
- 19El método de conformidad con la reivindicación 18, caracterizado porque la proteína recombinante es codificada por un gen que comprende una secuencia seleccionada del grupo que consiste de las SEQ ID NOS. 1, 3, 5, 39, 41, 43 y 45.
- 20El método de conformidad con la reivindicación 17, caracterizado porque la composición que comprende un antígeno de 2Θ kDa es dispersada en un portador farmacéuticamente aceptable.
Independent claims20
1,010 paragraphs in 17 sections, as filed
(54) Title: 28 KILODALTON IMMUNODOMINANT PROTEIN GENES OF EHRLICHIA CANIS AND USES.
(54) Title: HOMOLOGOUS 28-KILODALTON IMMUNODOMINANT PROTEIN GENES OF EHRLICHIA CANIS AND USES THEREOF.
(57) Summary
The present invention is aimed at the cloning, sequencing and expression of the genes of the homologous immunoreactive 28 kDa protein, p28-1, -2, -3, -5, -6, -7, -9, from a Ehrlichia canis polymorphic multiple gene family. A multiple gene locus encoding the nine genes of the homologous 28 kDa protein from Ehrlichia canis is further described. Recombinant 28 kDa proteins from Ehrlichia canis react with convalescent phase antiserum from a dog infected with E. canis, and may be useful in vaccine development and serodiagnosis, which are particularly effective for disease prevention and disease. serodiagnosis.
(57) Abstract
The present invention is directed to the cloning, sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-1, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis. Further disclosed is a multigene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins react with convalescent phase antiserum from an E.canis-infected dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effective for disease prevention and serodiagnosis.
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organized Intemauonal Burean (43) International Publieation Date
March 2002 (03/21/2002)
<img file="MXPA03002145A_D0001.tif" />
PCT
IVIIIIIIIIIUIIIIIIIIIIIIIIIIIIUIIIIIII1 (10) International Publieation Number
WO 02/22782 A2 (51) International Patent Classlflcation<sup>7</sup>: C12N (21) International Application Number: PCT / US01 / 28759 (22) International Flllng Date:
September 2001 (12.09.2001) (81) Deslgnated States (nationalj: AE, AG, AL, AM, AT. Al !. AZ, BA, BB, BG, BR. BY, BZ, CA, CH. CN. CO, CR, CU, CZ, DE. DK, DM, DZ. RE. ES, FI, GB. GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT. RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, UZ, VN, YU, ΖΛ, ZW.
<td>(25) Filing Language:</td><td>English</td>
<td>(26) Publieation Language:</td><td>English</td>
(30) Priority Data:
09 / 660.587 12 September 2000 (12.09.2000) US (84) Designated States (regional): ARIPO patent (GH, GM. KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), Eurasian patent (AM, AZ, BY, KG, KZ, MD. RU. TJ. TM), European patent (AT. BE, CH, CY, DE. DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OAPI patent (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
(71) Applicant: RESEARCH DEVELOPMENT FOUNDA-
TION [US / US]; 402 North Division Street, Carson City, NV 89703 (US).
(72) Inventor: WALKER, David, H .; 22 North Dansby, Galveslon, TX 77551 (US). YU, Xue-Jie; 6424 Central City Boulevard, # 828, Galveslon, TX 77551 (US). McBRIDE, Jere, W .; 9457 lamaica Beach, Galvcston, TX 77554 (US).
Published:
- without International search report and to be republished upon receipt of that report
For two-letter codes and other abbreviations, refer to the Guidance Notes on Codes and Abbreviations appearing to the begin ~ ning offeach regular issue of the PCT Gazette.
(74)
Agent: WE1LER, James, F .; 1 Riverway, Suite 1560, Ilouston, TX 77056 (US).
Γ4
0 © ------------------------------------------------ --------------------------- t '' (54) Tltle: HÜMOLOGOUS 28-KILODALTONIMMUNODOMINANT PROTEIN GENES OF EHRLICH1A CANIS AND USES Γ4 THEREOF
F4.
(57) Abstract: The present invention is directed to the cloning. sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-l, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis- Furthcr disclosed is a multiQ gene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins rcact with convalescent phase antiserum from an E. canis-infcctcd dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effcctive for disease prevention and serodiagnosis.
EHRLICHIA CANIS 28 KILODALTON HOMOLOGATED IMMUNODOMINANT PROTEIN GENES AND USES OF THE SAME
BACKGROUND OF THE INVENTION
Field of Invention
The present invention relates generally to the field of molecular biology. More specifically, the present invention relates to the molecular cloning and characterization of the genes for the homologous 28 kDA protein in Ehrlichia cania, a multiple gene locus that codes for homologous 28 kDa proteins from Ehrlichia cania and uses of the themselves.
Description of Related Technique
Canine ehrlichiosis, also known as canine tropical pancytopenia, is a rickettsial disease carried by dog ticks, first described in Africa in 1935, and the United States in 1963 (Donatien and Lestoquard, 1935; Ewing, 1963). The disease became better recognized after an epizootic outbreak in United States military dogs during the Vietnam War (Walker et al., 1970).
REF. 145862
The etiologic agent of canine ehrlichiosis is Ehrlichia canis, a small, gram-negative, obligate intracellular bacterium which shows tropism for mononuclear phagocytes (Nyindo et al., 1971) and is transmitted by the brown dog tick, Rhipiephalus sanguneas (Groves et al., 1975). The progression of canine ehrlichiosis occurs in three phases, acute, subclinical, and chronic. The acute phase is characterized by fever, anorexia, depression, lymphadenopathy, and mild thrombocytopenia (Troy and Forrester, 1990). Dogs typically recover from the acute phase, but become persistently infected carriers of the organism without clinical signs of disease for months or even years (Aarhus et al., 1998). A chronic phase develops in some cases, which is characterized by thrombocytopenia, hyperglobulinemia, anorexia, emaciation, and hemorrhage, particularly epistaxis, followed by death (Troy and Forrester, 1990).
Regulation of surface antigenicity may be an important mechanism for the establishment of such persistent infections in the host. Although the pathogenesis of the disease is poorly understood, multiple gene families described in members of the related genera Ehrlichia, Anaplasma, and Cowdria may be involved in varying the expression of the major surface antigen, thereby evading immune survival. Anaplasma margínale, an organism closely related to E. canis, shows variation in genes for major surface protein 3 (msp-3) resulting in antigenic polymorphism between strains (Alleman et al., 1997).
Particular taxonomic analysis based on the 16S rRNA gene has determined that E. canis and E. chaffeensis, the etiologic agent of human monocytic ehrlichiosis (HME), are closely related (Anderson et al., 1991; Anderson et al. , 1992; Dawson et al., 1991; Chen et al., 1994). Considerable cross-reactivity of 64, 47, 40, 30, 29, and 23 kDa antigens has been reported between E. canis and E. chaffeensis (Chen et al., 1994; Chen et al., 1997; Rikihisa et al., 1994; Rikihisa et al., 1992). Analysis of immunoreactive antigens with convalescent phase sera in humans and canines, by immunoblotting (immunoblot) has resulted in the identification of numerous immunodominant proteins from E. canis, including a 30 kDa protein (Chen et al., 1997) . Furthermore, a 30 kDa protein from E. canis has been described as a major immunodominant antigen recognized early in the immune response, which is antigenically distinct from the 30 kDa protein of E.
chaffeensis (Rikihisa et al., 1992; Rikihisa et al., 1994). Other immunodominant proteins of E. canis with molecular masses in the range of 20 to 30 kDa have also been identified (Brouqui et al., 1992; Nyindo et al., 1991; Chen et al., 1994; Chen et al., 1997 ).
Homologous 28-32 kDa immunodominant proteins, encoded by multiple gene families, have been reported in related organisms including, E. chaffeensis and Cowdria ruminantium (Sulsona et al., 1999; Ohashi et al., 1998a; Reddy et al. , 1998). Recently, the characterization of a 21-member multi-gene family encoding 23 to 28 kDa proteins has been described in E. chaffeensis (Yu et al., 2000). The 28 kDa outer membrane proteins of E. chaffeensis are exposed on the surface, and contain three major hypervariable regions (Ohashi et al., 1998a). Recombinant P28 from E. chaffeensis appeared to provide protection against homologous challenge infection in mice, and antisera raised against the recombinant protein cross-reacted with a 30 kDa protein from E. canis (Ohashi et al., 1998a). The diversity in the p28 gene among isolates of E. chaffeensis has been reported (Yu et al., 1999a), and studies using monoclonal antibodies have additionally demonstrated diversity in expressed P28 proteins (Yu et al., 1993). In contrast, the complete conservation of p28 genes in geographically different isolates of E, canis has been reported, and suggests that E. cania may be conserved in North America (McBride et al., 1999, 2000).
The prior art is deficient in the lack of cloning and characterization of new genes for the homologous 28 kDa immunoreactive protein from Ehrlichia cania, and a single multiple gene locus containing the genes for the homologous 28 kDa protein. Furthermore, the prior art is deficient in the lack of recombinant proteins of such Ehrlichia cania immunoreactive genes. The present invention fulfills this need and desire long recognized in the art.
BRIEF DESCRIPTION OF THE INVENTION
Certain embodiments of the present invention describe the molecular cloning, sequencing, characterization, and expression of the genes for the mature 28 kDa immunoreactive homologous protein from Ehrlichia cania (designated p28-1, -2, -3, -5., -6, -7, -9), and the identification of a single locus (10,677 base pairs (bp)) containing nine genes of the 28 kDa protein from Ehrlichia cania (p28-l to p28-9). Eight of the p28 genes were located on one DNA strand, and one p28 gene was found on the complementary strand. The nucleic acid homology between the nine members of p28 ranged from 37 to 75%, and the nucleic acid homology was in the range of 28 to 72%.
In one embodiment of the present invention, DNA sequences encoding a 30 kDa immunoreactive protein from Ehrlichia canis were provided. Preferably, the protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 40, 42, 44, 46 and the gene has a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 39, 41, 43, 45, and is a member of a family of multiple polymorphic genes. In general, the protein has an N-terminal signal sequence that can be cleaved after post-translational processing, resulting in the production of a mature 28 kDa protein. In addition, the genes encoding the 28 kDa proteins are preferably contained in a single multigene locus, which is 10,677 base pairs in size, and encodes homologous 28 kDa proteins from Ehrlichia canis.
In another embodiment of the present invention, an expression vector is provided comprising a gene encoding a 28 kDa immunoreactive protein of
Ehrlichia canis, and capable of expressing the gene when the vector is introduced into a cell.
In yet another embodiment of the present invention, a recombinant protein is provided comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 40, 42, 44 and 46. Preferably, the sequence of amino acids is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 39, 41, 43 and 45. Preferably, the recombinant protein comprises four variable regions that can be surface exposed, hydrophilic and antigenic. The recombinant protein can be useful as an antigen.
In yet another embodiment of the present invention, a method for producing the recombinant protein is provided, comprising the steps of obtaining a vector that includes an expression region possessing a sequence encoding the amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 40, 42, 44 and 46 operatively linked to a promoter; transfection of the vector into a cell; and culturing the cell under conditions effective for expression of the expression region.
The invention can also be described in certain embodiments as a method of inhibiting infection by
Ehrlichia canis in a subject, comprising the steps of: identifying a subject prior to exposure or suspected of being exposed to or infected with Ehrlichia canis, and administering a composition comprising a 28 kDa Ehrlichia canis antigen in an amount effective to inhibit an Ehrlichia canis infection. Inhibition can occur through any means such as, for example, stimulation of the subject's humoral or cellular immune responses, or by other means such as inhibition of normal function of the 28 kDa antigen, or even by competing with the antigen for interaction with some agent in the subject's body.
Other aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention, given for purposes of description.
BRIEF DESCRIPTION OF THE DRAWINGS
Thus, the matter in which the aforementioned characteristics, the advantages and the objectives of the invention are achieved and can be understood in detail, as well as others that will become clear, can be taken by reference more particular descriptions of the invention briefly summarized above, for certain embodiments thereof that are illustrated in the accompanying drawings. These drawings form a part of the specification. It should be noted, however, that the accompanying drawings illustrate the preferred embodiments of the invention, and therefore should not be construed as limiting its scope.
Figure 1 shows the nucleic acid sequence (SEQ ID NO: 1) and the deduced amino acid sequence (SEQ ID NO: 2) of the p28-7 gene including the adjacent 5 'and 3' noncoding sequences. The ATG start codon and the TAA stop are shown in bold, and the 23 amino acid leader signal sequence is underlined.
Figure 2 shows SDS-PAGE of the recombinant 50 kDa, p28-7-thioredoxin fusion protein expressed (Lane 1, arrow) and the 16 kDa thioredoxin control (Lane 2, arrow), and the corresponding immunotransference. of the recombinant p287-thioredoxin fusion protein recognized by the canine antiserum of Ehrlichia canis in the convalescent phase (Lane 3). The thioredoxin control was not detected by the Ehrlichia canis antiserum (not shown).
Figure 3 shows the alignment of the aforementioned sequences of protein p28-7 (ECa28-l, SEQ ID NO: 2), protein p28-5 (ECa28SA2, partial sequence, SEQ ID NO: 17), protein p28 -4 (ECa28SAl, SEQ ID NO: 8), P28 from E. Chaffeensis (SEQ ID NO: 9), OMP-1 family from E. chaffeensis (SEQ ID NOs: 10-14) and MAP-1 protein from C ruminantium (SEQ ID NO: 15). The amino acid sequence of p28-7 is presented as the consensus sequence. Amino acids not shown are identical to p28-7 and are represented by a broken line. Divergent amino acids are shown with the corresponding single letter abbreviation. The gaps introduced for the maximum alignment of the amino acid sequences are denoted with a hatch. The variable regions are underlined and denoted (VR1, VR2, VR3 and VR4). Arrows indicate the signal peptidase cleavage site, predicted for the signal peptide.
Figure 4 shows the phylogenetic relationship of E. cania p28-7 (ECa28-l), p28-5 (ECa28SA2, partial sequence), p28-4 (ECa28SAl), members of the omp-1 multi-gene family of E. chaffeensis, and the map-1 protein from C. ruminantium from the reduced amino acid sequences, using the unbalanced tree construction. The length of each pair of branches represents the distance between the amino acid sequence of the pairs. The scale measures the distance between the sequences.
Figure 5 shows Southern blot analysis of E. cania genomic DNA, fully digested with six individual restriction enzymes, and hybridized with a DIG-labeled probe from p2 8-7 (Lanes 27); DIG-labeled molecular weight markers (Lanes 1 and 8).
Figure 6 shows the comparison of the characteristics of the predicted protein of E. canis p28-7 (ECa28-l, Jake strain) and E. chaffeensis P28 (Arkansas strain). Surface probability predicts surface residues by using a hexapeptide window. A surface residue is any residue with more than 2.0 nm<sup>2</sup> surface area accessible to water.
A hexapeptide with a value greater than 1 was considered as the surface region. The antigenic index predicts potential antigenic determinants. Regions with a value above zero are potential antigenic determinants. The T cell portion localizes the potential antigenic determinants of T cells, using a 5 amino acid portion with the 1-glycine or polar residue, 2-hydrophobic residue, 3-hydrophobic residue, 4-hydrophobic residue, or proline, and 5-polar residue or glycine. The scale indicates the amino acid positions.
Figure 7 shows the nucleic acid sequences and deduced amino acid sequences of the p28-5 genes of the 28 kDa protein from E. canis (nucleotides 1-849; SEQ ID NO: 3; amino acid sequence: SEQ ID NO : 4) and p28-6 (nucleotides 1195-2031: SEQ ID NO: 5; amino acid sequence SEQ ID NO: 6) including the noncoding intergenic sequences (NC2, nucleotides 850-1194; SEQ ID NO: 31). The ATG start codon and stop codons are shown in bold.
Figure 8 shows a schematic of the E. canis 28 kDa protein gene locus (5,592-Kb, containing five genes) indicating genomic orientation and intergenic non-coding regions (28NC1-4). 28 kDa protein shown at Locus 1 and 2 (shaded) have been described (McBride et al., 1999; Reddy et al., 1998; Ohashi et al., 1998). The complete sequence of p28-5 and a new 28 kDa protein gene designated p28-6 was sequenced. The intergenic noncoding regions (28NC2-3) between p28-5, p28-6 and p28-7 were completed by joining loci 1 and 2 not previously linked.
Figure 9 shows the phylogenetic relationship of the p28-4 gene of the 28 kDa protein of E. canis (ECa28SAl), p28-5 (ECa28SA2), p28-6 (ECa28SA3), p28-7 (ECa28-l) and p28- 8 (ECa28-2) based on amino acid sequences using the unbalanced tree construction. The length of each pair of branches represents the distance between the pairs of amino acids. The scale measures the distance between sequences.
Figure 10 shows the sequence alignment of non-coding, intergenic, non-coding nucleic acids (SEQ ID NOs: 30-33). Nucleic acids not shown, denoted as a dotted line (.), Are identical to noncoding region 1 (28NC1). Divergence is shown with the corresponding single letter abbreviation. The gaps introduced for maximum amino acid sequence alignment are denoted with a dash (-). The putative transcriptional promoter regions (-10 and -35) and the ribosome binding site (RES) are boxed.
Figure 11 shows the schematic representation of the nine gene E. cania p28 locus (10,677 base pairs), indicating genomic orientation and intergenic noncoding regions. The p28 genes (p28-l, 2, 3, 9) (not shaded) were identified in Example 8. The shaded p28 genes have been previously identified and designated as follows: p28-4, p30a (Ohashi et al., 1998b) and ORF1 (Reddy et al., 1998); p28-5 and p28-6 (McBride, et al., 2000); p28-7, p28 (McBride et al., 1999) and p30 (Ohashi et al., 1998b); and p28-8, p30-1 (Ohashi et al., 1998b).
Figure 12 shows the phylogenetic relationship of E. cania P28-1 to P28-9 based on amino acid sequences. The length of each pair of branches represents the distance between the pairs of amino acids. The scale measures the percentage of divergence between the sequences.
Figure 13 shows the nucleic acid sequence (SEQ ID NO: 39) and the deduced amino acid sequence (SEQ ID NO: 40) of the E. cania p28-l gene.
Figure 14 shows the nucleic acid sequence (SEQ ID NO: 41) and the deduced amino acid sequence (SEQ ID NO: 42) of the E. canis p28-2 gene.
Figure 15 shows the nucleic acid sequence (SEQ ID NO: 43) and the deduced amino acid sequence (SEQ ID NO: 44) of the E. canis p28-3 gene.
Figure 16 shows the nucleic acid sequence (SEQ ID NO: 45) and the deduced amino acid sequence (SEQ ID NO: 46) of the E. cania p28-9 gene.
DETAILED DESCRIPTION OF THE INVENTION
The present invention describes the cloning, sequencing and expression of homologous genes encoding a 30 kilodalton (kDa) protein from Ehrlichia canis. A comparative molecular analysis of the homologous genes between seven isolates of E. canis and the omp-1 family of multiple genes of E. chaffeensis was also performed. Several new genes for the 28 kDa protein are identified as follows:
P28-7 (ECa28-l) has an 834 base pair open reading frame that encodes a 278 amino acid protein (SEQ ID NO: 2) with a predicted molecular mass of 30.5 kDa. An N-terminal signal sequence was identified suggesting that the protein is post-translationally modified to a mature 27.7 kDa protein.
P28-6 (ECa28SA3) has an 840 base pair open reading frame that codes for a 280 amino acid protein (SEQ ID NO: 6).
Using PCR to amplify the genes for the 28 kDa protein from E. canis, a previously unsequenced region of p28-5 (Eca28SA2) was completed. Sequence analysis of p28-5 revealed an 849 bp open reading frame encoding a 283 amino acid protein (SEQ ID NO: 4).
PCR amplification using the specific primers for the intergenic non-coding regions of the 2 8 kDa protein gene, led to the sequencing of the regions that link two previously separated loci, thereby identifying a single locus (5,592 kb ) containing five genes for the 28 kDA protein (p28-4, -5, -6, -7 and -8). The five 28 kDa proteins were predicted to possess signal peptides, resulting in mature proteins, and had amino acid homology in the range of 51 to 72%. Analysis of the intergenic regions revealed hypothetical promoter regions for each gene, suggesting that these genes may be independently and differentially expressed. The intergenic noncoding regions (28NC1-4) ranged in size from 299 to 355 base pairs, and were 48 to 71% homologous.
In addition, previously known DNA regions upstream (5 ') and downstream (3') of the aforementioned five-gene locus of the tandemly arranged p28 genes were sequenced, and p28-1, -2, - were identified. 3 and -9. Consequently, a nine-gene p28 locus of E. canis spanning 10,677 base pairs was identified in the present invention.
The present invention is directed, among other things, to the genes of the homologous 28 kDa protein in Ehrlichia canis, p28-l, -2, -3, -6, -7 and p28-9, and a complete sequence of p28 -5 previously partially sequenced. Also described is a multiple gene locus that encodes nine homologous 28 kDa outer membrane proteins from Ehrlichia canis. Eight of the p28 genes were located on one DNA strand, and one p2 8 gene was found on the complementary strand. The nucleic acid homology between the nine members of the p28 gene was 37 to 75%, and the amino acid homology was in the range of 28 to 72%.
In accordance with the present invention, conventional molecular biology, microbiology, and recombinant DNA techniques can be employed within the skill of the art. Such techniques are fully explained in the literature. See, for example, Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, Volumes I and II (DN Glover ed. 1985); Oligonucleotide Synthesis (MJ Gait ed. 1984); Nucleic Acid Hybridization [BD Hames & SJ Higgins eds. (1985)]; Transcription and Translation [BD Hames & SJ Higgins eds. (1984)]; Animal Cell Culture [RI Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984).
The invention includes substantially pure DNA encoding a 28 kDa immunoreactive protein from Ehrlichia canis. The protein encoded by the DNA of this invention can share at least 80% sequence identity (preferably 85%, more preferably 90% and most preferably 95%) with the amino acids listed in SEQ ID NOS: 2, 4, 6, 40, 42, 44 or 46. More preferably, the DNA includes the nucleotide coding sequence of SEQ ID NOs. 1, 3, 5, 39, 41, 43, 45 or a degenerate variant of such a sequence.
It is well known in the art that the amino acid sequence of a protein is determined by the nucleotide sequence of the DNA that codes for the protein. Due to the degeneracy of the genetic code (for example, for most amino acids, more than one nucleotide triplet (codon) codes for a single amino acid), different nucleotide sequences can code for a particular amino acid, or for a polypeptide. Thus, the polynucleotide sequences of the present invention also encompass those degenerate sequences that encode the polypeptides of the present invention, or a fragment or variant thereof.
This invention also includes a substantially pure DNA containing a sequence of at least 15 consecutive nucleotides (preferably 20, more preferably 30, even more preferably 50, and most preferably all) from the region derived from the nucleotides listed in SEQ ID NOs. : 1, 3, 5, 39, 41, 43 or 45.
By substantially pure DNA is meant DNA that is not part of a medium in which DNA appears naturally, by virtue of the separation (partial or total purification) of some or all of the molecules of that medium, or by virtue of the alteration of the sequences flanking the claimed DNA. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (eg, a cDNA or genomic or cDNA fragment produced by polymerase chain reaction (PCR) or restriction endonuclease digestion) independent of other sequences. This also includes a recombinant DNA that is part of a hybrid gene encoding an additional polypeptide sequence, for example a fusion protein. Also included in the present invention is a recombinant DNA that includes a portion of the nucleotides listed in SEQ ID NOs. 1, 3, 5, 39, 41, 43 or 45, encoding a 28 kDa immunoreactive protein from Ehrlichia canis.
The DNA must have at least about 70% sequence identity to the coding sequence of the nucleotides listed in SEQ ID NOs. 1, 3, 5, 39, 41, 43 or 45, preferably at least 75% (for example at least 80%); and most preferably at least 90% identity. The identity between two sequences is a direct function of the number of positions that agree or are identical. When a subunit position in both of the two sequences is occupied by the same monomeric subunit, for example, if a given position is occupied by an adenine in each of two DNA molecules, then they are identical in that position. For example, if 7 positions in a sequence of 10 nucleotides in length are identical to the corresponding positions in a second sequence of 10 nucleotides, then the two sequences have 70% sequence identity. The length of the comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides. Sequence identity is typically measured using sequence analysis software (eg, the Sequence Analysis Software Package from Genetics Computer Group, University of Wisconsin Center for Biotechnology, 1710 University Avenue, Madison, WI 53705).
The present invention also comprises a vector comprising a DNA sequence encoding a gene encoding a 28 kDa immunoreactive protein from Ehrlichia cania, and said vector is capable of replication in a host comprising, in operable linkage: a) an origin of replication; b) a promoter, and c) a DNA sequence encoding said protein. Preferably, the vector of the present invention contains a portion of the DNA sequence shown in SEQ ID NOS. 1, 3, 5, 39, 41, 43 or 45.
A vector can be defined as a replicable nucleic acid construct, eg, a plasmid or viral nucleic acid. Vectors can be used to amplify and / or express nucleic acid encoding a 28 kDa immunoreactive protein from Ehrlichia canis. An expression vector is a replicable construct in which a nucleic acid sequence encoding a polypeptide is operably linked to suitable control sequences capable of effecting expression of the polypeptide in a cell. The need for such control sequences will vary depending on the cell selected and the transformation method chosen. In general, control sequences include a transcriptional promoter and / or enhancer, suitable mRNA ribosome binding sites, and sequences that control termination of transcription and translation. Methods that are well known to those skilled in the art can be used to construct expression vectors containing appropriate transcriptional and translational control signals. See, for example, the techniques described in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual (2nd Ed.), Coid Spring Harbor Press, NY A gene and its transcriptional control sequences are defined as being operably linked if the transcriptional control sequences effectively control the transcription of the gene. Vectors of the invention include, but are not limited to, plasmid vectors and viral vectors. The preferred viral vectors of the invention are those derived from retroviruses, adenoviruses, adeno-associated viruses, SV40 viruses, or herpes viruses.
In general, expression vectors containing the promoter sequences that facilitate efficient transcription of the inserted DNA fragment are used in connection with the host. As used herein, the term "host" is understood to include not only prokaryotes but also eukaryotes such as yeast, plant and animal cells. A recombinant DNA molecule or a gene encoding a 28 kDa immunoreactive protein from Ehrlichia cania of the present invention can be used to transform a host using any of the techniques commonly known to those of ordinary skill in the art. Especially preferred is the use of a vector containing the coding sequences for a gene coding for a 28 kDa immunoreactive protein from Ehrlichia canis, of the present invention, for prokaryotic transformation purposes.
Prokaryotic hosts can include E. coli, S. typhimurium, Serratia marcescens, and Bacillus subtilis. Eukaryotic hosts include yeasts such as Pichia pastoria, mammalian cells, and insect cells. Transformed hosts can be fermented and cultured according to means known in the art, to achieve optimal cell development.
As used herein, the term " recombinant or genetically engineered cell" is intended to refer to a cell into which a recombinant gene, such as a gene encoding an Ehrlichia canis antigen, has been introduced. Therefore, genetically engineered cells are distinguishable from naturally-occurring cells, which do not contain a recombinantly introduced gene. Genetically engineered cells are thus cells that have a gene or genes introduced through human hands. The recombinantly introduced genes will either be in the form of a cDNA gene, a copy of a genomic gene, or will include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene. Furthermore, the recombinant gene may be integrated into the host genome, or it may be contained in a vector, or in a bacterial genome transfected within the host cell.
The present invention is also written for the substantially pure 28-30 kDa immunoreactive proteins of E. canis, comprising amino acid sequences listed in, for example, SEQ ID NOs. 2, 4, 6, 40, 42, 44, 6 46.
By a substantially pure protein is meant a protein that has been separated from at least some of those components that naturally accompany it. Typically, the protein is substantially pure when it is at least 60% by free weight of the proteins and other naturally occurring molecules with which it is naturally associated in vivo. Preferably, the purity of the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99% by weight. A substantially pure 28 kDa immunoreactive protein from Ehrlichia canis can be obtained, for example, by extraction from a natural source; by expressing a recombinant nucleic acid encoding a 28 kDa immunoreactive protein from Ehrlichia cania; or by chemical synthesis of the protein. Purity can be measured by any appropriate method, for example, column chromatography, such as immunoaffinity chromatography using an antibody specific to a 28 kDa immunoreactive protein from Ehrlichia canis, polyacrylamide gel electrophoresis, or HPLC (liquid chromatography) analysis. high resolution). A protein is substantially free of associated natural components, when it is separated from at least some of those contaminants that accompany it in its natural state. Thus, a protein that is chemically synthesized or produced in a cellular system other than the cell from which it naturally originates, will by definition be, by definition, substantially free of its naturally associated components. Accordingly, substantially pure proteins include eukaryotic proteins synthesized in E. coli, other prokaryotes, or any other organism in which they do not occur naturally.
In addition to substantially full-length proteins, the invention also includes fragments (e.g., antigenic fragments) of the 28 kDa immunoreactive protein from Ehrlichia canis (SEQ ID NOs. 2, 4, 6, 40, 42, 44 6 46 ). As used herein, "fragment" as applied to a polypeptide, will ordinarily be at least 10 residues, more typically at least 20 residues, and preferably at least 30 (eg, 50) residues in length, but less than sequence intact, complete. Fragments of the 28 kDa immunoreactive protein from Ehrlichia canis can be generated by methods known to those skilled in the art, for example by enzymatic reaction of the naturally occurring or recombinant 28 kDa immunoreactive protein, from Ehrlichia canis, by techniques of Recombinant DNA using an expression vector encoding a defined fragment of the 28 kDa immunoreactive protein from Ehrlichia canis, or by chemical synthesis. The ability of a candidate fragment to display a characteristic of the Ehrlichia canis 28 kDa immunoreactive protein (for example, that it binds to an antibody specific for the Ehrlichia canis 28 kDa immunoreactive protein) can be evaluated by the methods described in the present.
The purified 28 kDa immunoreactive protein from Ehrlichia canis or antigenic fragments of the 28 kDa immunoreactive protein from Ehrlichia canis can be used to generate new antibodies or to test existing antibodies (for example, as positive controls in an assay diagnostic) using standard protocols known to those skilled in the art.
As is well known in the art, a given polypeptide can vary in its immunogenicity. Therefore, it is frequently necessary to apply the immunogen (eg, a polypeptide of the present invention) with a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and human serum albumin. Means for conjugating a polypeptide to a carrier protein are well known in the art, and include glutaraldehyde, mmaleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide, and bis-biazotized benzidine. It is also understood that the peptide can be conjugated to a protein by genetic engineering techniques that are well known in the art.
As is also well known in the art, immunogenicity to a particular immunogen can be increased through the use of non-specific stimulators of the immune response, known as adjuvants. Exemplary and preferred adjuvants include complete BCG, Detox, (RIBI, Immunochem. Research Inc.) ISCOMS, and aluminum hydroxide adjuvant (Superphos, Biosector).
Included in this invention are polyclonal antisera generated by use of the 2 8 kDa immunoreactive protein from Ehrlichia canis, or a fragment of the 2 8 kDa immunoreactive protein from Ehrlichia canis as the immunogen, for example, in rabbits. Standard protocols for the production of monoclonal and polyclonal antibodies, known to those skilled in the art, are employed. Monoclonal antibodies generated by this procedure can be screened for the ability to identify recombinant Ehrlichia canis cDNA clones, and to distinguish them from known cDNA clones.
The invention encompasses not only an intact monoclonal antibody, but also an immunologically active antibody fragment, for example, a Fab or (Fab) fragment.<sub>2</sub>; a single-chain, engineered Fv molecule, or a chimeric molecule, for example, an antibody that contains the binding specificity of an antibody, for example, of murine origin, and the remaining portions of another antibody, for example, of human origin.
In one embodiment, the antibody, or fragment thereof, may be linked to a toxin or a detectable marker, for example, a radioactive marker, non-radioactive isotopic marker, fluorescent marker, chemiluminescent marker, paramagnetic marker, enzymatic marker, or colorimetric marker. Those of ordinary skill in the art will know of these and other suitable markers that can be employed in accordance with the present invention. The binding of these markers to antibodies or fragments thereof can be accomplished using standard techniques commonly known to those of ordinary skill in the art.
It is also contemplated that pharmaceutical compositions can be prepared using the novel proteins of the present invention. In such a case, the pharmaceutical composition comprises the new active composition (s) of the present invention, and a pharmaceutically acceptable carrier. A person of ordinary skill in this art would easily be able to determine, without undue experimentation, the appropriate dosages and routes of administration of the active component of the present invention.
The phrase "pharmaceutically acceptable" refers to entities and molecular compositions that do not produce a similar allergic or adverse reaction when administered to a subject. The preparation of an aqueous composition containing a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; Solid forms suitable for solution in, or suspension in liquid prior to injection can also be prepared. The preparation can also be emulsified.
A protein can be formulated into a composition in a neutral or saline form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic acids, oxalic, tartaric, mandelic, and the like. The salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and organic bases such as isopropylamine, trimethylamine, histidine, procaine and the like.
After formulation, the solutions will be administered in a manner compatible with the dosage formulation and in such an amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions.
For parenteral administration in an aqueous solution, for example, the solution must be adequately buffered if necessary and the liquid diluent first made isotonic with sufficient saline or glucose.
These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this context, the sterile aqueous media that can be employed will be known to those skilled in the art, in light of the present disclosure. For example, a dose could be dissolved in 1 ml of isotonic sodium chloride solution and added to either 1000 ml of hypodermoclysis fluid, or injected into the proposed infusion site (see for example, Remington's Pharmaceutical Sciences 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration, in any case, will determine the appropriate dose for the individual subject.
In one embodiment of the present invention, DNA sequences encoding a 30 kDa immunoreactive protein from Ehrlichia canis are provided. Preferably, the protein has an amino acid sequence selected from the group consisting of SEQ ID NOs. 2, 4, 6, 40, 42, 44, 46, and the gene has a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 1, 3, 5, 39, 41, 43, 45 and is a member of a polymorphic multiple gene family. Most preferably, the protein has an N-terminal signal sequence that is cleaved after post-translational processing, resulting in the production of a mature 28 kDa protein. Even more preferably, the DNAs encoding the 28 kDa proteins are contained in a single multiple gene locus, which is 10,677 bp in size and encodes nine homologous 28 kDa proteins from Ehrlichia canis.
In another embodiment of the present invention, an expression vector is provided which comprises a gene encoding a 2-8 kDa immunoreactive protein from Ehrlichia canis, and capable of expressing the gene when the vector is introduced into a cell.
In yet another embodiment of the present invention, a recombinant protein is provided comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 2, 4, 6, 40, 42, 44, 46. Preferably, the amino acid sequence is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 1, 3, 5, 39, 41, 43, 45. Most preferably, the recombinant protein comprises four variable regions that are surface exposed, hydrophilic and antigenic. Most preferably, the recombinant protein is an antigen.
In yet another embodiment of the present invention, a method for producing the recombinant protein is provided, comprising the steps of obtaining a vector that includes an expression region comprising a sequence encoding the amino acid sequence selected from the group consisting of SEQ ID NOs. 2, 4, 6, 40, 42, 44, 46, operably linked to a promoter; transfection of the vector into a cell; and culturing the cell under conditions effective for the expression of the expression region.
The invention may also be described in certain embodiments as a method for inhibiting Ehrlichia canis infection in a subject, comprising the steps of: identifying a subject suspected of being exposed to or infected with Ehrlichia canis; and administering a composition comprising an Ehrlichia canis 2-8 kDa antigen, in an amount effective to inhibit an Ehrlichia canis infection. Inhibition can occur through any means such as, for example, stimulation of the subject's humoral or cellular immune responses, or by other means such as normal inhibition of the 28 kDa antigen, or even by competing with the antigen for interaction with some agent in the subject's body.
The following examples are given for purposes of illustration of the various embodiments of the invention, and are not intended to limit the present invention in any way.
EXAMPLE 1
Sequencing of the Unknown 5 'and 3' Regions of the ECa28 ~ l Gene (p28-7)
Ehrlichia and Purification.
Ehrlichia canis (Florida strain and isolates Demon, DJ, Jake, and Fuzzy) were provided by Dr. Edward Breitschwerdt (College of Veterinary Medicine, University of North Carolina, Raleigh, NC). E. canis (Louisiana strain) was provided by Dr. Richard E. Corstvet (School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA) and E. canis (Oklahoma strain) was provided by Dr. Jacqueline Dawson (Centers for Disease Control and Prevention, Atlanta, Georgia). Ehrlichia propagation was performed in DH82 cells with DMEM supplemented with 10% fetal bovine serum and 2 mM Lglutamine at 37 ° C. Intracellular development in DH82 cells was monitored for the presence of E. canis morulae, using general cytological staining methods. Cells were harvested when 100% of the cells were infected with ehrlichias, and were then concentrated in a centrifuge at 17,000 xg for 20 minutes. Cell buttons were disintegrated with a Braun-Sonic 2000 sonicator twice at 40 W for 30 seconds on ice. The Ehrlichias were purified as previously described (Weiss et al., 1975). The lysate was loaded on discontinuous gradients of 42% -36% -30% renografin, and centrifuged at 80,000 xg for 1 hour. The heavy and light bands containing ehrlichias were collected and washed with sucrose-phosphatoglutamate buffer (SPG, sucrose 218 mM, KH<sub>2</sub>P0<sub>4</sub> 3.8 mM, K<sub>2</sub>HPO<sub>4</sub> 7.2 mM, 4.9 mM glutamate, pH 7.0) and concentrated by centrifugation.
Nucleic Acid Preparation.
Ehrlichia cania genomic DNA was prepared by resuspending purified ehrlichias with renografin in 60 μΐ of 10 mM Tris-HCl buffer (pH 7.5) with 1% sodium dodecyl sulfate (SDS, w / v) and 100 ng / ml of proteinase K as previously described (McBride et al., 1996). This mixture was incubated for 1 hour at 56 ° C, and the nucleic acids were extracted twice with a mixture of phenol / chloroform / isoamyl alcohol (24: 24: 1). The DNA was concentrated by precipitation with absolute ethanol, washed once with 70% ethanol, dried, and resuspended in 10 mM Tris (pH 7.5). Plasmid DNA was purified using the Isolation Kit for
High Purity Plasmids (Boehringer Mannheim, Indianapolis, IN), and PCR products were purified using a QIAquick PCR Purification Kit (Qiagen, Santa Clarita, CA).
Cloning of the ECa28-I Gene (p28-7).
The full-length sequence of the p28-7 gene was determined using a Universal GenomeWalker Kit (CLONTECR, Palo Alto, CA) according to the protocol supplied by the manufacturer. Genomic DNA from E. canis (Jake isolate) was completely digested with five restriction enzymes (Dral, EcoRV, PvuII, Seal, Stul) that produce the blunt end DNA. An adapter (API), supplied in the kit, was ligated to each end of the E. canis DNA. Genomic libraries were used as templates to find the unknown DNA sequence of the p28-7 gene by PCR, using a primer complementary to a known portion of the p28-7 sequence, and a primer specific for the API adapter. The specific primers for p28-7, used for genomic walking, were designed from known DNA sequences, derived from the PCR amplification of p28-7 with primers 793 (SEQ ID NO: 16) and 1330 (SEQ ID NO : 17). Primers 394 (5'GCATTTCCACAGGATCATAGGTAA-3 '; nucleotides 687-710, SEQ ID
NO: 21) and 394C (5'-TTACCTATGATCCTGT GGAAATGC-3 '; nucleotides 710-687, SEQ ID NO: 22) were used in conjunction with the supplied API primer, to amplify the unknown 5' and 3 'regions of the gene p28-7 by PCR. A PCR product corresponding to the 5 'region of the p28-7 gene amplified with primers 394C and API (2000 bp) was unidirectionally sequenced with primer 793C (5'-GAGTA ACCAACAGCTCCTGC-3', SEQ ID NO: 23). A PCR product corresponding to the 3 'region of the p28-7 gene amplified with primers 394 and API (580 bp) was bi-directionally sequenced with the same primers. The non-coding regions on the 5 'and 3' regions adjacent to the open reading frame were sequenced, and the primers EC28OM-F (5'-TCTACTTTGCACTTCC ACTATTGT-3 ', SEQ ID NO: 24) and EC28OM-R (5'ATTCTTTTGCCACTATT TTCTTT-3 ', SEQ ID NO: 25) complementary to these regions, were designed in order to amplify the complete p28-7 gene.
DNA sequencing.
DNA was sequenced with an ABI Prism 377 DNA Sequencer (Perkin Elmer Applied Biosystems, Foster City, CA). The complete p28-7 genes of seven isolates of E. cania (four from North Carolina and each from Oklahoma, Florida and Louisiana) were amplified by PCR with primers EC28OM-F (SEQ ID NO: 24) and EC28OM-4 (SEQ ID NO: 25) with a cycle profile 95 ° C for 5 minutes, and 30 cycles of 95 ° C for 30 seconds, 62 ° C for 1 minute, and 72 ° C for 2 minutes, and an extension of 72 ° C for 10 minutes. The resulting PCR products were bidirectionally sequenced with the same primers.
EXAMPLE 2
PCR Amplification, Cloning, Sequencing and Expression of the E. canis ECa28-l (p28-7) Gene
Expression Vectors.
The complete E. cania p28-7 gene was amplified by PCR with primers EC28OM-F and EC28OM-R and cloned into the cloning vector pCR2.1-TOPO TA to obtain the desired group of cleavage sites with enzymes of restriction (Invitrogen, Carlsbad, CA). The insert was excised from pCR2.1-TOPO WITH BstXl and ligated into the eukaryotic expression vector pcDNA 3.1 (Invitrogen, Carlsbad, CA) designated pcDNA3.1 / EC28 for subsequent studies. The plasmid pcDNA3.1 / EC28 was amplified, and the gene was excised with a double digest with KpnlXbal and directionally ligated into the prokaryotic expression vector pThioHis (Invitrogen, Carlsbad, CA). The clone (designated pThioHis / EC28) produced a recombinant thioredoxin fusion protein, in Escherichia cali BL21. The recombinant fusion protein was crude purified in the insoluble phase by centrifugation. The control thioredoxin fusion protein was purified from the soluble cell Uses, under native conditions using the nickel-NTA spinning columns (Qiagen, Santa Clarita, CA).
Western blot analysis.
Recombinant E. canis p28-7 fusion protein was subjected to SDSpolyacrylamide gel electrophoresis (SDS-PAGE) on 4 to 15% TrisHC1 gradient gels (Bio-Rad, Hercules, CA) and transferred to pure nitrocellulose (Schleicher & Schuell, Keene, NH) using a semi-dry transfer cell (Bio-Rad, Hercules, CA). The membrane was incubated with convalescent phase antisera from a dog infected with E. canis, diluted 1: 5000 for 1 hour, washed, and then incubated with an anti-canine alkaline phosphatase (H&L) conjugated, affinity-purified secondary IgG antibody, at 1: 1000 for 1 hour (Kirkegaard Se Perry Laboratories, Gaithersburg , MD). Bound antibody was visualized with 5-bromo-4-chloro-3-indolyl phosphate / nitroblue tetrazolium (BCIP / NBT) substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD).
Southern Blot Analysis.
To determine whether multiple genes homologous to the p28-7 gene were present in the E. canis genome, a genomic Southern blot analysis was performed using a standard procedure (Sambrook et al. 1989). The genomic DNA of E. canis completely digested with each of the restriction enzymes Bañil, EcoRV, Haell, Kpnl and Spel, which do not cut within the p28-7 gene, and Asel which digests p28 7 at nucleotides 34, 43, and 656. The probe was produced by PCR amplification with primers EC28OM-F and EC28OM-R and digoxigenin-labeled deoxynucleotide triphosphates (dNTPs) (Boehringer Mannheim, Indianapolis, IN) and digested with Asel. The digested probe (566 bp) was separated by agarose gel electrophoresis, gel purified and then used for hybridization. The DNA of E. canis, genomic, fully digested, was electrophoresed and transferred to a nylon membrane (Boehringer Mannheim, Indianapolis, IN) and hybridized at 40 ° C for 16 hours with the DIG-labeled probe of the p28-7 gene in the DIG buffer Easy Hyb according to the manufacturer's protocol (Boehringer Mannheim, Indianapolis, IN). The bound probe was detected with an anti-DIG antibody, conjugated to alkaline phosphatase, and a luminescent substrate (Boehringer Mannheim, Indianapolis, IN) and exposed to BioMax scientific imaging film (Eastman Kodak, Rochester, NY).
Sequential Analysis and comparison.
The DNA sequences of p-28 from E. chaffeensis and map-1 from C. ruminantium were obtained from the National Center for Biotechnology Information (NCBI). Nucleotide and deduced amino acid sequences, and protein analysis and phylogenetic analysis were performed with LASERGENE software (DNASTAR, Inc., Madison, WI). The post-translational processing analysis was performed by the method of McGeoch and von Heijne for the recognition of the signal sequence using the SPORT program (McGeoch, 1985; von Heijne, 1986).
Sequential analysis of p28-7 from seven different strains of E. canis was performed with primers designed to amplify the entire gene. Analysis revealed that the sequence of this gene was conserved among isolates from North Carolina (four), Louisiana, Florida, and Oklahoma.
Results
Alignment of the nucleic acid sequences of p28 from E. chaffeensis and map-1 from Cowdria ruminantium using the Jotun-Hein algorithm, produced a consensus sequence with regions of high homology (> 90%). These homologous regions (nucleotides 313-332 and 823-843 of map-1 from C. ruminntium; 307-326 and 814-834 from p28 of E. chaffeensis) were targeted as annealing sites for PCR amplification. PCR amplification of the p28-7 gene of E. canis was achieved with primers 793 (5-GCAGGAGCTGTTGGTTACTC-3 ') (SEQ ID NO: 16) and 1330 (5'-CCTTCCTCCAAGTTCTATGCC-3') (SEQ ID NO: 17), resulting in a PCR product of 518 bp. The E. canis DNA was purified with primers 793 and 1330 with a thermal cycle profile of 95 ° C for 2 minutes, and 30 cycles of 95 ° C for 30 seconds, 62 ° C for 1 minute, 72 ° C for 2 minutes, followed by an extension of 72 ° C for 10 minutes and hold at 4 ° C. The nucleic acid sequence of the E. canis PCR product was obtained by sequencing the product directly with primers 793 and 1330..
Sequence analysis revealed an open reading frame that codes for a 170 amino acid protein, and the alignment of the 518 bp sequence obtained from the PCR amplification of E. canis with the DNA sequence of the p28 gene of E. chaffeensis, revealed a similarity greater than 70%, indicating that the genes were homologous.
The adapter PCR with primers 394 and 793C was performed to determine the 5 'and 3' segments of the complete gene sequence. Primer 394 produced four PCR products (3-kb, 2-kb, 1-kb, and 0.8-kb), and the 0.8-bp product was bi-directionally sequenced using primers 394 and API. The deduced sequence overlapped with the 3 'end of the 518-bp product, spanning the 12-bp open reading frame toward a stop codon. An additional 625-bp noncoding sequence at the 3 'end of the p28-7 gene was also sequenced.
Primer 394C was used to amplify the 5 'end of the p28 ~ 7 gene with the supplied API primer. Amplification with these primers resulted in three PCR products (3.3, 3-kb and 2-kb). The 2 kb fragment was unidirectionally sequenced with the 793C primer. The sequence provided the putative start codon for the p28-7 gene, and completed the 834 bp open reading frame encoding a 278 amino acid protein. An additional 144 bp stretch of readable sequence was generated in the 5 'noncoding region of the p28-7 gene. The primers EC28OM-F and EC28OM-R were designated from the complementary, noncoding regions adjacent to the p28-7 gene.
The PCR product amplified with these primers was directly sequenced with the same primers. The complete DNA sequence for the E. canis p28-7 gene (SEQ ID NO: 1) is shown in Figure 1. The PCR fragment of p28-7, amplified with these primers, contained the complete open reading frame and an additional 17 amino acids from the 5 'noncoding primer region. The gene was directly subcloned into the expression vector pThioHis, and E. coli (BL21) was transformed with this construct. The expressed p28-7-thioredoxin fusion protein was insoluble. The expressed protein had an additional 114 amino acids associated with thioredoxin, 5 amino acids for the enterokinase recognition site, and 32 amino acids from the multiple cloning site and the 5 'noncoding primer region, at the N terminus. convalescent phase from a dog infected with E. canis, recognized the recombinant fusion protein, but did not react with the thioredoxin control (Figure 2).
EXAMPLE 3
Sequence Homology of the E. canis p28-7 Gene
The nucleic acid sequence of E. canis p28-7 (834 bp) and the E. chaffeensis omp-1 family of genes that include the signal sequences (p28-7, omp-lA, B, C, D , E and F) were aligned using the Clustal method to examine the homology between these genes (alignment not shown). Nucleic acid homology was equally conserved (68.9%) between E. canis p28-7, p28, and E. chaffeensis omp-lF. Other putative outer membrane protein genes in the E. chaffeensis omp-1 family, omp-lD (68.2%), omp-lE (66.7%), omp-lC (64.1%), map-1 de Cowdria ruminantium (61.8%), the E. canis 28 kDa protein 1 gene (60%) and the 28 kDa (partial) protein 2 gene (59.5%) were also homologous to p28-7. omp-ΙΒ from E. chaffeensis had the lowest nucleic acid homology (45.1%) with p28-7 from E. canis.
Alignment of the predicted amino acid sequences of E. canis P28-7 (SEQ ID NO: 2) and E. chaffeensis P28, revealed amino acid substitutions resulting in four variable regions (VR) Substitutions or deletions in the amino acid sequence and the locations of the variable regions of E. canis P28-7 and the E. chaffeensis OMP-1 family were identified (Figure 3). Comparison of amino acids including the signal peptide revealed that P28-7 from E. canis shared the highest homology with OMP-1F (68%) of the OMP-1 family of E. chaffeensis, followed by P28 of E. chaffeensis (65.5%), OMP-1E (65.1%), 0MP-1D (62.9%). ), OMP-1C (62.9%), MAP-1 from Cowdría ruminantium (59.4%), protein 1 of 28 kDa from E. canis (55.6%) and protein 2 of 28 kDa (partial) (53.6%), and OMP -1B (43.2%). Phylogenetic relationships based on amino acid sequences show that P28-7 from E. canis and MAP-1 from C. ruminantium, the OMP-1 proteins from E. chaffeensis and E. canis 28 kDa proteins 1 and 2 (partial) are related (Figure 4).
EXAMPLE 4
Predicted Surface Probability and Immunoreactivity of E. canis P28-7
Analysis of E. canis P28-7 using the hydropathy and hydrophilicity profiles predicted the superficially exposed regions on P28-7 (Figure 6). Eight major surface exposed regions consisting of 3 to 9 amino acids were identified on P28-7 from E. canis and were similar to the profile of the surface exposed regions on P28 from E. chaffeensis (Figure 6). Five of the largest, superficially exposed regions on P28-7 of E. canis were located in the N-terminal region of the protein. Hydrophilic regions exposed on the surface were found in the four variable regions of P28-7 of E. canis. Ten portions of T cells were predicted in P28-7, using the Rothbard-Taylor algorithm (Rothbard and Taylor 1988), and the high antigenicity of P28-7 from E. canis was predicted by the Jameson-Wolf antigenicity algorithm ( Figure 6) (Jameson and Wolf, 1988). Similarities in antigenicity and T cell portions were observed between P28-7 from E. canis and P28 from E. Chaffeensis.
EXAMPLE 5
Detection of Homologous Genomic Copies of the E. canis p28-7 Gene
Genomic Southern blot analysis of fully digested E. canis DNA, independently with the restriction enzymes Bañil, EcoRV, Raell, Kpnl, Spel, which do not have restriction endonuclease sites in the p28-7 gene and Asel, which has internal restriction endonuclease sites at nucleotides 34, 43 and 656, revealed the presence of at least three copies of the homologous p28-7 gene (Figure 5). Although P287 of E. cania has internal Ase I restriction sites, the DIG-labeled probe used in the hybridization experiment was targeted to a region of the gene within a single DNA fragment generated by Aael digestion of the gene. Digestion with Asel produced 3 bands (approximately 566 bp, 850 bp, and 3-kb) that hybridized with the p28-7 DNA probe, indicating the presence of multiple genes homologous to p28-7 in the genome. Digestion with EcoRV and Spel produced two bands that hybridized to the p28-7 gene probe.
EXAMPLE 6
PCR Amplification of E. cania Genes, Eca28SA2 (p28-5), Eca28SA3 (p28-6) and Identification of Multiple Gene Locus
In order to specifically amplify the possible unknown genes downstream (3 ') of Eca28SA2 (p28-5), the primer 46f specific for p28-5 (5' ~ ATATACTTCCTACCTAATGTCTCA-3 'SEQ ID No. 18), and the primer 1330 (SEQ ID No. 17) targeting a conserved region on the 3 'end of the p28 ~ 7 gene, were used for amplification. The amplified product was gel purified and cloned into a TA cloning vector (Invitrogen, Santa Clarita, CA). The clone was sequenced bidirectionally with the primers: reverse M13 from the vector, 46f Eca28SA2 (5 'AGTGCAGAGTCTTCGGTTTC-3', SEQ ID No. 19), EcaS.3 (5'GTTACTTGCGGAGGACAT-3 ', SEQ ID No. 20). DNA was amplified with a thermal cycle profile of 95 ° C for 2 minutes, and 30 cycles of 95 ° C for 30 seconds, 48 ° C for 1 minute, 72 ° C for 1 minute, followed by extension at 72 ° C. for 10 minutes and retention of 4 ° C.
A 2-kb PCR product was amplified with these primers that contained 2 open reading frames. The first open reading frame contained the known region of the p28-5 gene, and a previously unsequenced 3 'portion of the gene. Downstream (3 ') of p28-5 a non-identical, but homologous 28 kDa protein gene was found and designated ECA28SA3 (p28-6).
The specific primers designated ECaSA3-2 (5'CTAGGATTAGGTTATAGTATAAGTT-3 'SEQ ID No. 26) corresponding to the regions within p28-6 and the 793C primer (SEQ ID No. 23) that anneals to a region with p28-7 , were used to amplify the intergenic region between the p28-6 and p28-7 gene. The DNA was amplified with a thermal cycle profile of 95 ° C for 2 minutes, and 30 cycles of 95 ° C for 30 seconds, 50 ° C for 1 minute, 72 ° C for 1 minute, followed by a 72 ° extension. C for 10 minutes and hold at 4 ° C.
An 800 bp PCR product was amplified, which contained the 3 'end of p28-6, the intergenic region between p2B-6 and p28-7 (28NC3) and the 5' end of p28-7, joining the loci previously separated (figure 8). The 849 bp open reading frame of p28-5 codes for a 283 amino acid protein, and p28-6 has an 840 bp open reading frame that codes for a 280 amino acid protein. The intergenic noncoding region between p28-6 and p28-7 was 345-bp in length (Figures 7 and 8).
EXAMPLE 7
Nucleic Acid and Amino Acid Homology of E. canis p28-4, p28-5, p28-6, p28-7 and p28-8 proteins
The nucleic acid and amino acid sequences of the five genes of the 28 kDa protein from E. canis were aligned using the Clustal method to examine the homology between these genes. Nucleic acid homology was in the range of 58 to 75%, and similar amino acid homology in the range of 67 to 72% was observed among members of genes of the 28 kDa protein from E. canis (Figure 9). .
Transcriptional Promoting Regions.
The intergenic regions between the genes of the 28 kDa protein were analyzed for the promoter sequences, by comparing with the promoter regions of Escherichia coli consensus and a promoter of E. chaffeensis (Yu et al., 1997; McClure, 1985) . The putative promoter sequences including RES, the -10 and -35 regions were identified in 4 intergenic sequences corresponding to the genes ρ28 ~ 5, p28-6, p28-7 and p28-8 (Eca28-2) (figure 10). The upstream (5 ') noncoding region of p28-4 (Eca28SAl) is not known and was not analyzed.
N-terminal Signal Sequence.
Amino acid sequence analysis revealed that complete E. canis p28-7 has a deduced molecular mass of 30.5 kDa and complete p28-6 has a deduced molecular mass of 30.7 kDA. Both proteins have a predicted 23 amino acid N-terminal signal peptide (MNCKKILITTALMSLMYYAPSIS, SEQ ID No. 27), which is similar to that predicted for P28 from E. chaffeensis (MNYKKILITSALISLISSLPGVSFS, SEQ ID No. 28), and the OMP-1 protein family (Yu et al., 1991a; Ohashi et al, 1998b).
A preferred cleavage site for signal peptidases (SIS; Ser-X-Ser) (Oliver, 1985) is found at amino acids 21, 22 and 23 of p28-7. The additional putative cleavage site at amino acid position 25 (MNCKKILITTALISLMYSIPSISSFS, SEQ ID No. 29) identical to the predicted cleavage site of E. chaffeensis P28 (SFS) was also present, and could result in a p28-7 protein mature, with a predicted molecular mass of 27.7 kDa. The signal cleavage site of the previously reported partial sequence of p-28-5 is predicted at amino acid 30. However, signal sequence analysis predicted that p28-4 had a non-cleavable signal sequence.
Summary
Proteins of similar molecular mass have been identified and cloned from multiple rickettsial agents, including E. canis, E. chaffeensis, and C. ruminantium (Reddy et al. 1998; Jongejan et al; 1993; Ohashi et al; 1989). A single locus in Ehrlichia chaffeensis with 6 homologous p28 genes, and 2 loci in E. canis, each containing some homologous 28 kDa protein genes, have been previously described.
The present invention demonstrated the cloning, expression, and characterization of genes encoding mature 28 kDa proteins from E. canis that are homologous to the E. chaffeensis omp-1 multiple gene family and the C map-1 gene. , ruminantium. Two new genes for the 28 kDa protein, p28-7 and p28-6, were identified. Another 28 kDa protein gene from E. canis p28-5, partially sequenced previously (Reddy et al., 1998), was fully sequenced in the present invention. The identification and characterization of a single locus in E. canis containing five genes of the 28 kDa protein of E. canis (p28-4, p28-5, p28-6, p28-7 and p28-8) is also described. .
The 28 kDa proteins from E. canis are homologous to the OMP-1 family of E. chaffeensis and to the MAP-1 protein C. ruminantium. The more homologous E. canis 28 kDa proteins (p28-6, p28-7, and p28-8), are sequentially arranged at the locus. The homology of these proteins was in the range of 67.5% to 72.3%. The divergence between these 28 kDa proteins ranged from 27.3% to 38.6%. The 28 kDa proteins p28-4 and p28-5 from E. canis were the least homologous, with homology in the range from 50-9% to 59.4%, and divergence from 53.3 to 69.9%. The differences between the genes lie mainly in the four hypervariable regions, and suggest that these regions are exposed on the surface, and subjected to selective pressure by the immune system. Conservation of p28-7 among E. canis isolates has been reported (McBride et al., 1999), suggesting that E. canis may be clonal in North America. Conversely, significant p28 diversity has been reported among E. chaffeensis isolates (Yu et al., 1999a).
All 28 kDa proteins from E. canis appear to be post-translationally processed from a 30 kDa protein to a 28 kD protein. Recently, a signal sequence on E. chaffeensis Ρ2Θ was identified (Yu et al., 1999a), and terminal amino acid sequencing has verified that the protein is post-translationally processed resulting in cleavage of the signal sequence to produce a mature protein (Ohashi et al., 1998). The leader sequences of OMP-1F and OMP-1E have also been proposed as guide signal peptides (Ohashi et al., 1998). The signal sequences identified on OMP-1F, OMP-1E and P28 from E. chaffeensis are homologous to the leader sequence of the 28 kDa protein from E. canis. The promoter sequences for the P28 genes have not been determined experimentally, but the putative promoter regions were identified by comparison with the consensus sequences of the RBS-10 and -35 promoter regions of E. coli and other ehrlichias (Yu et al., 1997;
McClure, 1985). Such promoter sequences could allow each gene to be potentially transcribed and translated, suggesting that these genes may be differentially expressed in the host. The persistence of infection in dogs may be related to the differential expression of the p28 genes, resulting in antigenic changes in vivo, thus allowing the organism to evade the immune response.
The genes for the 28 kda protein from E. canis were found to show nucleic acid and amino acid sequence homology with the E. chaffeensis omp-1 gene family and the C. ruminantium map-1 gene. Previous studies have identified a 30 kDa protein from E. canis that reacts with convalescent phase antisera against E. chaffeensis, but was believed to be antigenically distinct (Rikihisa et al., 1994). The findings based on the comparison of amino acid substitutions in four variable regions of the 28 kDa proteins of E. canis, support this possibility. Together, these findings also suggest that the amino acids responsible for the antigenic differences between P28 of E. canis and E. chaffeensis are located in these variable regions, and are easily accessible to the immune system.
Immunoreactive peptides were reported to be localized in the variable regions of the 28 kDa proteins of C. ruminantium, E. chaffeensis γ E. canis (Reddy et al., 1998). Analysis of Ρ2Θ from E. canis and E. chaffeensis revealed that all variable regions have predicted surface exposed amino acids. A study in dogs demonstrated the lack of cross protection between E. canis and E. chaffeensis (Dawson and Ewing, 1992). This observation may be related to antigenic differences in the variable regions of P28, as well as in other immunologically important antigens of these ehrlichia species. Yet another study found that convalescent human antisera from patients infected with E. chaffeensis recognized the 29/28 kDa protein (s) of E. chaffeensis, and also reacted with the homologous proteins of E. canis (Chen et al. al., 1997). The homologous and cross-reactive epitopes on the E. canis 28 kDa protein and E. chaffeensis P28 appear to be recognized by the immune system.
The 28 kDa proteins from E. canis can be important immunoprotective antigens. Several reports have shown that the 30 kDa antigen from E. canis shows strong immunoreactivity (Rikihisa et al., 1994; Rikihisa et al., 1992). Antibodies in convalescent phase antisera from humans and dogs have reacted consistently with proteins in this size range from E. chaffeensis and E. canis, suggesting that these may be important immunoprotective antigens (Rikishisa et al., 1994; Chen et al., 1994; Chen et al., 1997). Furthermore, antibodies to the 30, 24 and 21 kDa proteins developed early in the immune response to E. canis (Rikihisa et al., 1994; Rikihisa et al., 1992), suggest that these proteins may be especially important in the immune responses in the acute stage of the disease. Recently, a family of homologous genes coding for outer membrane proteins has been identified, with molecular masses of 28 kDa in E. chaffeensis, and mice immunized with recombinant E. chaffeensis p28 appeared to have developed immunity against it. homologous challenge (Ohashi et al., 1998). P28 from E. chaffeensis is present on the outer membrane, and immunoelectron microscopy has located P28 on the surface of the body, thus suggesting that it may serve as an adhesin (Ohashi et al., 1998). The 28 kDa proteins from E. canis identified in this study likely have the same site and possibly serve a similar function.
Comparison of p28-7 from different strains of E. canis revealed that the gene is apparently completely conserved. Studies involving E.
chaffeensis have shown immunological and molecular evidence of diversity. Patients infected with E. chaffeensis have variable immunoreactivity to 29/28-kDa proteins, suggesting that there is antigenic diversity (Chen et al., 1997). Recently, molecular evidence has been generated to support antigenic diversity in the E. chaffeensis p28 gene (Yu et al., 1999a). A comparison of five isolates of E. chaffeensis revealed that two isolates (Sapulpa and St. Vincent) were 100% identical, but three others (Arkansas, Jax, 91HE17) were divergent by as much as 13.4% at the amino acid level. Conservation of E. canis p28-7 suggests that E. canis strains found in the United States may be genetically identical, and thus the E. canis 28 kDa protein is an attractive vaccine candidate for ehrlichiosis canina in the United States. Further analysis of the E. canis outside the United States, you can provide information regarding the origin and evolution of E. canis. The conservation of the 28 kDa protein makes it an important potential candidate for the reliable serodiagnosis of canine ehrlichiosis.
The role of the multiple homologous genes is not known at this point; however, the persistence of E. canis infections in dogs could appear to be related to antigenic variation due to variable expression of homologous 28 kDa protein genes, thus making it possible for E. canis evade immune survival. The variation of the msp-3 genes in A. margínale is partially responsible for the variation in the MSP-3 protein, resulting in persistent infections (Alleman et al., 1997). Studies to examine the expression of the 28 kDa protein gene by E. canis in acutely and chronically infected dogs could provide a look back at the role of the 28 kDa protein gene family in the persistence of infection. .
EXAMPLE 8
Identification of the Genes p28-l, p28-2, p28-3 and p28-9 of E. canis
The unknown DNA regions upstream (5 ') and downstream (3') of the five gene loci of the p28 genes arranged in tandem, described above, were sequenced by gene-specific primer design for p28 ~ l ( ECa28-75C) and p285 (ECa28-5-818f) to extend the p28 gene locus bidirectionally. Multiple gene walks were performed to obtain the unknown sequence as follows:
1.9 kp downstream (3 ') from 5 gene loci was amplified and sequenced using primers p28-5818f (S'-TTA AAC ATA TGC CAC TTC GGA CTA-3', SEQ ID No. 34), producing an amplicon of 900 bp, and 1191 (5'-TAT GAT CGT GTA AAA TTG CTG TGA GTA T-3 ', SEQ ID No. 35), producing a 1 kb amplicon. The 3.67 kbp of DNA (5 ') of the five gene loci were amplified and sequenced with the primers ECa28-75C (5'-TAC TGG CAC GTG CTG GAC TA-3', SEQ ID No. 36), producing a 1.6 kbp amplicon; ECa5'-1600 (5'-CAC CAA TAA ATG CAG AGA CTT C-3 ', SEQ ID No. 37), producing a 1.6 kbp amplicon; and 312 5 (5'-AAT CCA TCA TTT CTC ATT ACA GTG TG-3 ', SEQ ID No. 38), producing an 800 bp amplicon. The locus of nine genes arranged in tandem, consisting of the four new p28 genes, and the five p28 genes described above, were designated p28-l through p28-9 (Figure 11).
The nucleic acid and amino acid sequences of the E. canis p28 genes were aligned using the Clustal method to examine the homology between these genes. The homology of these proteins ranged from 67.5% to 75%, and the divergence between these P28 proteins was from 26.9% to 38%. The proteins P281, P28-2, and P28-9 of E. canis were the least homologous with the other genes of p28<sub>t</sub> in the range from 37% to 49% and divergence from 53 to 77%. The nucleic acid homology of the nine p28 genes ranged from 28 to 72%.
Phylogenetic relationships based on the amino acid sequences of P28 from E. cania are shown in Figure 12.
Mycleotide sequence and accession numbers.
The GenBank accession numbers for the nucleic acid and amino acid sequences for the full nine E. canis (strain Jake) p28 gene loci is AF082744. This accession number was originally assigned to p28-7, but has been updated with the sequence of all nine loci of the p28 gene, which includes p28-7. The GenBank accession numbers for the nucleic acid and amino acid sequences of p28-7 in other isolates of E. canis described in this study are: Louisiana AF082745; Oklahoma, AF082746; Demon, AF082747; DJ, AF082748; Fuzzy, AF082749; Florida AF082750.
Multiple bands in the 28 kilodalton range have been observed by immunoblotting (immunoblotting) of convalescent sera from dogs infected with E. canis (Rikishisa et al., 1994), and the expression of multiple p28 proteins could be an explanation for this. observation. Southern blot studies suggest that other p28 genes, in addition to the five members of this locus, are present in the genome (McBride et al., 1999; Ohashi et al. , 1998b).
In this study, a single gene locus was identified that contains nine E. canis p28 genes arranged in tandem, which code for homologous, but not identical, p28 genes. The nine gene loci included four new p28 genes (Figures 13-16) and five p28 genes arranged in tandem that were previously reported. Eight of the p28 genes were located on one DNA strand, and one p28 gene was found on the complementary strand. The nucleic acid homology between the nine members of p28 genes ranged from 37 to 75% and the amino acid homology ranged from 28 to 72%.
The P28s of E. canis were found to be closely related to the 28 kilodalton proteins of other species such as E. chaffeensis, as they are themselves (McBride et al., 2000). Differences between proteins are found primarily in several major hypervariable regions and suggest that these regions are exposed on the surface and subjected to selective pressure by the immune system (McBride et al., 2000).
The conservation of an E. canis p28 gene (p28-7) among seven geographically different isolates has been reported (McBride et al., 1999), suggesting that E. canis may be highly conserved in North America.
Similarly, the 120 kDa glycoprotein from E. canis is also conserved among isolates in the United States (Yu et al., 1997). In contrast, the genes for the 120 kDa and 28 kDa proteins of E. chaffeensis are divergent between isolates (Yu et al., 1999a; Chen et al., 1997). The gene diversity of the 28 kDa protein from E. chaffeensis appeared to result from point mutations in the hypervariable regions, perhaps due to selective immune pressure (Yu et al., 1999a). These data suggest that E. canis may have been introduced to North America relatively recently, and this may explain the conservation that was observed among isolates. Conservation of the p28 genes in E. canis isolates may provide an opportunity to develop a vaccine, and serodiagnosis antigens that are particularly effective for disease prevention and serodiagnosis. A mixture of the p28s can provide the most reliable serodiagnostic test, but serodiagnosis with a single P28 has been reported as useful for immunodiagnosis (Ohashi et al., 1998b); McBride et al., 1999).
The following references are cited herein.
Alleman AR, et al., (1997) Infect Immun 65: 156-163.
Anderson BE, et al. , (1991) J Clin Microbiol 29: 283864
2842 .
Anderson BE, et al., (1992) Int J Syst Bacterial 42: 299-302. '
Brouqui P., et al., (1992) J Clin Microbiol 30: 1062-1066.
Chen S, M. et al., (1997) Clin Diag Lab Immunol 4: 731-735.
Chen SM, et al., (1994) Am J Trop Med Hyg 50: 52-58.
Dawson JE et al., (1992) Am J Vet Res 53: 1322-1327.
Dawson JE, et al., (1991) J Infect Dis 163: 564-567.
Donatien, et al., (1935) Bull Soc Pathol Exot 28: 418-9.
Ewing, (1963) J Am Vet Med Assoc 143: 503-6.
Groves MG, et al., (1975) Am J Vet Res 36: 937-940.
Harrus S., et al., (1998) J. Clin Microbiol 36: 73-76.
Jameson BA, et al., (1988) CABIOS 4: 181-186.
Jongejan F., et al., (1993) Rev Elev Med Vet Pays Trop 46: 145-152.
McBride JW, et al., (1996) J Vet Diag Invest 8: 441-447.
McBride, et al., (1999) Clin Diagn Lab Immunol. 6: 392-399.
McBride, et al., (2000) Gene; In press
McClure, (1985) Ann Rev Biochem 54: 171-204.
McGeoch DJ (1985) Virus Res 3: 271-286.
Nyindo M., et al., (1991) Am J Vet Res 52: 1225-1230.
Nyindo, et al., (1971) Am J Vet Res 32: 1651-58.
Ohashi, et al., (1998a) Infect immune 66: 132-9.
Ohashi, et al., (1998b) J Clin Microbiol 36: 2671-80
Reddy, et al., (1998) Biochem Biophys Res Commk 247: 63665.
Rikihisa, et al., (1994) J Clin Microbiol 32: 2107-12.
Rothbard JB, et al., (1988) The EMBO J7: 93-100.
Sambrook J., et al., (1989) In Molecular Cloning: A Laboratory Manual. Coid Spring Harbor: Coid Spring Harbor Press.
Sulsona et al., (1999) Biochem. Biophys. Res. Commun. 257: 300-305.
Troy GC, et al., (1990) Canine ehrlichiosis. In Infectious diseases of the dog and cat. Green C. E (ed). Philadelphia: WB Sauders Co.
Von Heijne, (1986) Nod Acids Res. 14: 4683-90
Walker, et al. (1970) J Am Vet Med Assoc 157: 43-55.
Weiss E., et al., (1975) Appl Micriobiol 30: 456-463.
Yu et al., (1993) J. Clin. Microbiol. 31: 3284-3288.
Yu, et al., (1997) Gene 184: 149-154.
Yu, et al., (1999a) J. Clin. Microbiol. 37: 1137-1143.
Yu et al., (2000) Gene 248: 59-68.
Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention belongs. These patents and publications are incorporated herein by reference, to the same extent as if each individual publication were individually indicated as incorporated by reference.
One of ordinary skill in the art will readily appreciate that the present invention is well adapted to carry out the objectives and to obtain the aforementioned ends and advantages, as well as those inherent therein. The present examples, along with the specific methods, procedures, treatments, molecules, and compounds described herein, are presently representative of the preferred embodiments, are exemplary, and are not intended to be limitations on the scope of the invention. Changes in the present and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention as defined by the scope of the claims.
It is noted that in relation to this date, the best method known to the applicant for putting the aforementioned invention into practice is the one that is clear from the present description of the invention.
SEQUENCE LISTING <110> Walker, David H.
McBride, Jere W.
Yu, Xue-Jie <12 0> Genes of the 28 kilodalton Immunodominant Homologous Protein from Ehrlichia canis and uses thereof <13 0> D6152CIP2 / PCT.
<141> 2001-09-12 <150> 09/660,587 <151> 2000-09-12 <160>46 <210>1 <211>1607 <212> <sup>DNA</sup> <213> Ehrlichia canis <220>
<223> Nucleic acid sequence of p28-7 from E, canis <400> 1 attttattta ttaccaatct tatataatat attaaatttc tcttacaaaa 50 atctctaatg ttttatacct aatatatata ttctggcttg tatctacttt 100 gcacttccac tattgttaat ttattttcac tattttaggt gtaatatgaa 150 attcttataa ttgcaaaaaa aatatcatta caactgcatt atgtactcta 200 ttccaagcat atctttttct gatactatac aagatggtaa catgggtggt 250 ttagtggaaa aacttctata gtatgtacca agtgtctcac attttggtag 300 cttctcagct aaagaagaaa gcaaatcaac tgttggagtt tttggattaa 350 aacatgattg ggatggaagt ccaatactta agaataaaca cgctgacttt 400 actgttccaa actattcgtt cagatacgag aacaatccat ttctagggtt 450 tgcaggagct atcggttact caatgggtgg tagg cccaagaata gaattcgaaa 500 tatcttatga agcattcgac gtaaaaagtc ctaatatcaa ttatcaaaat 550 gacgcgcacagcatccattagtactgact gagcatgattgcactcatgactatgattgattgattgattgactatgattgattgattgattgattgaatgattgattgattgattgaatt
1/38
<td colspan="6">Gly Asn Met Gly Gly Asn</td><td rowspan="2">Phe</td><td colspan="3" rowspan="2">Tyr lie Ser 40</td><td rowspan="2">Gly</td><td rowspan="2">Lys</td><td rowspan="2">Tyr</td><td rowspan="2">Val</td><td rowspan="2">Pro Four. Five</td>
<td colspan="3"></td><td colspan="3"> 35</td>
<td>To be</td><td>Val</td><td>To be</td><td>His</td><td>Phe fifty</td><td>Gly</td><td>To be</td><td>Phe</td><td>To be</td><td>To 55</td><td>Lys</td><td>Glu</td><td>Glu</td><td>To be</td><td>Lys 60</td>
<td>To be</td><td>Thr</td><td>Val</td><td>Gly</td><td>Val 65</td><td>Phe</td><td>Gly</td><td>Leu</td><td>Lys</td><td>His 70</td><td>Asp</td><td>trp</td><td>Asp</td><td>Gly</td><td>To be 75</td>
<td>Pro</td><td>lie</td><td>Leu</td><td>Lys</td><td>Asn 80</td><td>Lys</td><td>His</td><td>To</td><td>Asp</td><td>Phe 85</td><td>Thr</td><td>Val</td><td>Pro</td><td>Asn</td><td>Tyr 90</td>
<td>To be</td><td>Phe</td><td>Arg</td><td>Tyr</td><td>Glu 95</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Phe</td><td>Leu 100</td><td>Gly</td><td>Phe</td><td>To</td><td>Gly</td><td>To 105</td>
<td>lie</td><td>Gly</td><td>Tyr</td><td>To be</td><td>Met 110</td><td colspan="2">Gly Gly</td><td>Pro</td><td>Arg</td><td>lie 115</td><td>Glu</td><td>Phe</td><td>Glu</td><td>lie</td><td>To be 120</td>
<td>iy<sub>r</sub></td><td>Glu</td><td>To</td><td>Phe</td><td>Asp 125</td><td>Val</td><td>Lys</td><td>To be</td><td>Pro</td><td>Asn 130</td><td>lie</td><td>Asn</td><td>Tyr</td><td>Gln</td><td>Asn 135</td>
<td>Asp</td><td>To</td><td>His</td><td>Arg</td><td>Tyr 140</td><td>Cys</td><td>To</td><td>Leu</td><td>To be</td><td>His 145</td><td>HIS</td><td>Thr</td><td>To be</td><td>To</td><td>To 150</td>
<td>Met</td><td>Glu</td><td>To</td><td>Asp</td><td>Lys 155</td><td>Phe</td><td>Val</td><td>Phe</td><td>Leu</td><td>Lys 160</td><td>Asn</td><td>Glu</td><td>Gly</td><td>Leu</td><td>lie 165</td>
<td>Asp</td><td>lie</td><td>To be</td><td>Leu</td><td>To 170</td><td>lie</td><td>Asn</td><td>To</td><td>Cys</td><td>Tyr 175</td><td>Asp</td><td>lie</td><td>lie</td><td>Asn</td><td>Asp 180</td>
<td>Lys</td><td>Val</td><td>Pro</td><td>Val</td><td>To be 185</td><td>Pro</td><td>Tyr</td><td>lie</td><td>Cys</td><td>To 190</td><td>Gly</td><td>lie</td><td>Gly</td><td>Thr</td><td>Asp 195</td>
<td>Leu</td><td>lie</td><td>To be</td><td>Met</td><td>Phe 200</td><td>Glu</td><td>To</td><td>Thr</td><td>To be</td><td>Pro 205</td><td>Lys</td><td>lie</td><td>To be</td><td>Tyr</td><td>Gln 210</td>
<td>Gly</td><td>Lys</td><td>Leu</td><td>Gly</td><td>lie 215</td><td>To be</td><td>Tyr</td><td>To be</td><td>lie</td><td>Asn 220</td><td>Pro</td><td>Glu</td><td>Thr</td><td>To be</td><td>Val 225</td>
<td>Phe</td><td>lie</td><td>Gly</td><td>Gly</td><td>His 230</td><td>Phe</td><td>His</td><td>Arg</td><td>lie</td><td>lie 235</td><td>Gly</td><td>Asn</td><td>Glu</td><td>Phe</td><td>Arg 240</td>
<td>Asp</td><td>lie</td><td>Pro</td><td>To</td><td>lie 245</td><td>Val</td><td>Pro</td><td>To be</td><td>Asn</td><td>To be 250</td><td>Thr</td><td>Thr</td><td>lie</td><td>To be</td><td>Gly 255</td>
<td>Pro Glu</td><td>Gln Leu</td><td>Phe Gly</td><td>To Gly</td><td>Thr 260 Arg 275</td><td>Val Phe</td><td>Thr Asn</td><td>Leu Phe</td><td>Asn</td><td>Val 265</td><td>Cys</td><td>His</td><td>Phe</td><td>Gly</td><td>Leu 270</td>
3/38 <210>
<211>
<212>
<213>
849
DNA
Ehrlichia canis <220>
<221> Itiat-peptidc <223> nucleic acid sequence of p28-5 <400> 3 atgaattgta aaaaagtttt cacaataagt gcattgatat catccatata 50 cttcctacct aatgtctcat actctaaccc agtatatggt aacagtatgt 100 atggtaattt ttacatatca ggaaagtaca tgccaagtgt tcctcatttt 150 cagctgaaga ggaatttttt agagaaaaaa aagacaactg tagtatatgg 200 cttaaaagaa aactgggcag gagatgcaat atctagtcaa agtccagatg 250 ataattttac cattcgaaat tactcattca agtatgcaag caacaagttt 300 ttagggtttg cagtagctat tggttactcg ataggcagtc caagaataga 350 agttgagatg tcttatgaag catttgatgt gaaaaatcca ggtgataatt 400 acaaaaacgg tgcttacagg tattgtgctt tatctcatca agatgatgcg 450 gatgatgaca tgactagtgc aactgacaaa tttgtatatt taattaatga 500 aggattactt aacatatcat ttatgacaaa catatgttat gaaacagcaa 550 gcaaaaatat acctctctct ccttacatat gtgcaggtat tggtactgat 600 ttaattcaca tgtttgaaac tacacatcct aaaatttctt atcaaggaaa 650 gctagggttg gcctacttcg taagtgcaga gtcttcggtt tcttttggta 700 taaaattata tatattttca aataataagt ttaaaaatgt tccagccatg 750 gtacctatta actcagacga gatagtagga ccacagtttg caacagtaac 800 attaaatgta tgctactttg gattagaact tggatgtagg ttcaacttc 849 <210> 4 <211> 283 <212> PRT <213> Ehrlichia canis <220>
<223> amino acid sequence of protein p28-5
4/38 <400> 4
<td>Met</td><td>Asn</td><td>Cys</td><td>Lys</td><td>Lys</td><td>Val</td><td>Phe</td><td>Thr</td><td>lie</td><td>To be</td><td>To</td><td>Leu</td><td>lie</td><td>To be</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>lie</td><td>Tyr</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Asn</td><td>Val</td><td>To be</td><td>Tyr</td><td>To be</td><td>Asn</td><td>Pro</td><td>Val</td><td colspan="2">Tyr gly</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Asn</td><td>To be</td><td>Met</td><td>Tyr</td><td>Gly</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td><td>Gly</td><td>Lys</td><td>Tyr</td><td>Met</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>To be</td><td>Val</td><td>Pro</td><td>His</td><td>Phe</td><td>Gly</td><td>lie</td><td>Phe</td><td>To be</td><td>To</td><td>Glu</td><td>Glu</td><td>Glu</td><td colspan="2">Lys Lys</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Lys</td><td>Thr</td><td>Thr</td><td>Val</td><td>Val</td><td>Tyr</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Glu</td><td>Asn</td><td>Trp</td><td>To</td><td colspan="2">Gly Asp</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>To</td><td>lie</td><td>To be</td><td>To be</td><td>Gln</td><td>To be</td><td>Pro</td><td>Asp</td><td>Asp</td><td>Asn</td><td>Phe</td><td>Thr</td><td>lie</td><td>Arg</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>Tyr</td><td>To be</td><td>Phe</td><td>Lys</td><td>Tyr</td><td>To</td><td>To be</td><td>Asn</td><td>Lys</td><td>Phe</td><td>Leu</td><td>Gly</td><td>Phe</td><td>To</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
<td>To</td><td>lie</td><td>Gly</td><td>Tyr</td><td>To be</td><td>lie</td><td>Gly</td><td>To be</td><td>Pro</td><td>Arg</td><td>lie</td><td>Glu</td><td>Val</td><td>Glu</td><td>Met</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>To be</td><td>Tyr</td><td>Glu</td><td>To</td><td>Phe</td><td>Asp</td><td>Val</td><td>Lys</td><td>Asn</td><td>Pro</td><td>Gly</td><td>Asp</td><td>Asn</td><td>Tyr</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>Asn</td><td>Gly</td><td>To</td><td>Tyr</td><td>Arg</td><td>Tyr</td><td>Cys</td><td>To</td><td>Leu</td><td>To be</td><td>His</td><td>Gln</td><td>Asp</td><td>Asp</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>Asp</td><td>Asp</td><td>Asp</td><td>Met</td><td>Thr</td><td>To be</td><td>To</td><td>Thr</td><td>Asp</td><td>Lys</td><td>Phe</td><td>Val</td><td>Tyr</td><td>Leu</td><td>lie</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Asn</td><td>Glu</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Asn</td><td>lie</td><td>To be</td><td>Phe</td><td>Met</td><td>Thr</td><td>Asn</td><td>lie</td><td>Cys</td><td>Tyr</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Glu</td><td>Thr</td><td>To</td><td>To be</td><td>Lys</td><td>Asn</td><td>lie</td><td>Pro</td><td>Leu</td><td>To be</td><td>Pro</td><td>Tyr</td><td>lie</td><td>Cys</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Gly</td><td>I have</td><td>Gly</td><td>Thr</td><td>Asp</td><td>Leu</td><td>lie</td><td>His</td><td>Met</td><td>Phe</td><td>Glu</td><td>Thr</td><td>Thr</td><td>His</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Lys</td><td>lie</td><td>To be</td><td>Tyr</td><td>Gln</td><td>Gly</td><td>Lys</td><td>Leu</td><td>Gly</td><td>Leu</td><td>To</td><td>Tyr</td><td>Phe</td><td>Val</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>To</td><td>Glu</td><td>To be</td><td>To be</td><td>Val</td><td>To be</td><td>Phe</td><td>Gly</td><td>lie</td><td>Tyr</td><td>Phe</td><td>His</td><td>Lys</td><td>lie</td><td>lie</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Asn</td><td>Asn</td><td>Lys</td><td>Phe</td><td>Lys</td><td>Asn</td><td>Val</td><td>Pro</td><td>To</td><td>Met</td><td>Val</td><td>Pro</td><td>lie</td><td>Asn</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
5/38
Asp Glu lie Val Gly Pro Gln Phe Ala Thr Val
260 265
Cys Tyr Phe Gly Leu Glu Leu Gly Cys Arg Phe
275 280
<td colspan="2">Thr Leu Asn Val</td>
<td></td><td> 270</td>
<td>Asn</td><td>Phe</td>
<td> <210></td><td> 5</td>
<td> <211></td><td> 840</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>Ehrlichia canis</td>
<220>
<221> mat_peptidc <223> nucleic acid sequence of p28-6
<td> <400></td><td> 5</td>
<td>atgaattgca</td><td>aaaaaattct tataacaact gcattaatgt cattaatgta 50</td>
<td>ctatgctcca</td><td>agcatatctt tttctgatac tatacaagac gataacactg 100</td>
<td>gtagcttcta</td><td>catcagtgga aaatatgtac caagtgtttc acattttggt 150</td>
<td>gttttctcag</td><td>ctaaagaaga aagaaactca actgttggag tttttggatt 200</td>
<td>aaaacatgat</td><td>tggaatggag gtacaatatc taactcttct ccagaaaata 250</td>
<td>tattcacagt</td><td>tcaaaattat tcgtttaaat acgaaaacaa cccattctta 300</td>
<td>gggtttgcag</td><td>gagctattgg ttattcaatg ggtggcccaa gaatagaact 350</td>
<td>tgaagttctg</td><td>tacgagacat tcgatgtgaa aaatcagaac aataattata 400</td>
<td>agaacggcgc</td><td>acacagatac tgtgctttat ctcatcatag ttcagcaaca 450</td>
<td>agcatgtcct</td><td>ccgcaagtaa caaatttgtt ttcttaaaaa atgaagggtt 500</td>
<td>aattgactta</td><td>tcatttatga taaatgcatg ctatgacata ataattgaag 550</td>
<td>gaatgccttt</td><td>ttcaccttat atttgtgcag gtgttggtac tgatgttgtt 600</td>
<td>tccatgtttg</td><td>aagctataaa tcctaaaatt tcttaccaag gaaaactagg 650</td>
<td>attaggttat</td><td>agtataagtt cagaagcctc tgtttttatc ggtggacact 700</td>
<td>ttcacagagt</td><td>cataggtaat gaatttagag acatccctgc tatggttcct 750</td>
<td>agtggatcaa gtgtcacttt</td><td>atcttccaga aaaccaattt gcaatagtaa cactaaatgt 800 ggcatagaac ttggaggaag atttaacttc 840</td>
6/38 <210> 6 <211> 280 <212> PRT <213> Ehrlichia canis
<td colspan="6"> <220></td>
<td></td><td> <223></td><td>sequence</td><td>of</td><td>amino acid B of the</td><td>i protein p28-6</td>
<td></td><td> <400></td><td> 6</td><td></td><td></td><td></td>
<td>Met</td><td>Asn Cys</td><td>Lys Lys lie 5</td><td>Leu</td><td>lie Thr Thr Wing 10</td><td>Leu Met Ser Leu fifteen</td>
<td>Met</td><td>Tyr Tyr</td><td>Wing Pro Ser twenty</td><td>lie</td><td>Ser Phe Ser Asp 25</td><td>Thr lie Gln Asp 30</td>
<td>Asp</td><td>Asn Thr</td><td>Gly Ser Phe 35</td><td>Tyr</td><td>lie Ser Gly Lys 40</td><td>Tyr Val Pro Ser Four. Five</td>
<td>Val</td><td>Be his</td><td>Phe Gly Val fifty</td><td>Phe</td><td>Ser Ala Lys Glu 55</td><td>Glu Arg Asn Ser 60</td>
<td>Thr</td><td>Val Gly</td><td>Val Phe Gly 65</td><td>Leu</td><td>Lys His Asp Trp 70</td><td>Asn Gly Gly Thr 75</td>
<td>lie</td><td>Be asn</td><td>Be Be Pro 80</td><td>Glu</td><td>Asn lie Phe Thr 85</td><td>Val Gln Asn Tyr 90</td>
<td>To be</td><td>Phe Lys</td><td>Tyr Glu Asn 95</td><td>Asn</td><td>Pro Phe Leu Gly 100</td><td>Phe Ala Gly Ala 105</td>
<td>lie</td><td>Gly Tyr</td><td colspan="2">Be Met Gly Gly 110</td><td>Pro Arg lie Glu 115</td><td>Leu Glu Val Leu 120</td>
<td>Tyr</td><td>Glu Thr</td><td>Phe Asp Val 125</td><td>Lys</td><td>Asn Gln Asn Asn 130</td><td>Asn Tyr Lys Asn 135</td>
<td>Gly</td><td>His wing</td><td>Arg Tyr Cys 140</td><td>To</td><td>Leu Ser His His 145</td><td>Ser Ser Ala Thr 150</td>
<td>To be</td><td>Met Ser</td><td>Be wing be 155</td><td>Asn</td><td>Lys Phe Val Phe 160</td><td>Leu Lys Asn Glu 165</td>
<td>Gly</td><td>Leu lie</td><td>Asp Leu Ser 170</td><td>Phe</td><td>Met lie Asn Ala 175</td><td>Cys Tyr Asp lie 180</td>
<td>lie</td><td>lie Glu</td><td>Gly Met Pro 185</td><td>Phe</td><td>Ser Pro Tyr lie 19C</td><td>Cys Ala Gly Val 195</td>
7/38
<td rowspan="2">Gly</td><td rowspan="2">Thr Asp Val</td><td colspan="3">Val Ser Met Phe Glu Ala lie Asn Pro Lys lie</td>
<td> 200</td><td> 205</td><td> 210</td>
<td>To be</td><td>Tyr Gln Gly</td><td>Lys Leu Gly Leu</td><td>Gly Tyr</td><td>Ser lie Ser Ser Glu</td>
<td></td><td></td><td> 215</td><td> 220</td><td> 225</td>
<td>To</td><td>Ser Val Phe</td><td>lie Gly Gly His</td><td>Phe His</td><td>Arg Val lie Gly Asn</td>
<td></td><td></td><td> 230</td><td> 235</td><td> 240</td>
<td>Glu</td><td>Phe Arg Asp</td><td>lie Pro Wing Met</td><td>Val Pro</td><td>Ser Gly Ser Asn Leu</td>
<td></td><td></td><td> 245</td><td> 250</td><td> 255</td>
<td>Pro</td><td>Glu Asn Gln</td><td>Phe Ala lie Val</td><td>Thr Leu</td><td>Asn Val Cys His Phe</td>
<td></td><td></td><td> 260</td><td> 265</td><td> 270</td>
<td>Gly</td><td>lie Glu Leu</td><td>Gly Gly Arg Phe</td><td>Asn Phe</td><td></td>
<td></td><td></td><td> 275</td><td> 280</td><td></td>
<210> 7 <211> 133 <212> PRT <213> Ehrlichia canis <220>
<223> partial amino acid sequence of protein p28 ~ 5 <400> 7
<td>Met</td><td>Asn</td><td>Cys</td><td>Lys</td><td>Lys</td><td>Val</td><td>Phe</td><td>Thr</td><td>lie</td><td>To be</td><td>To</td><td>Leu</td><td>lie</td><td>To be</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>lie</td><td>Tyr</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Asn</td><td>Val</td><td>To be</td><td>Tyr</td><td>To be</td><td>Asn</td><td>Pro</td><td>Val</td><td>Tyr</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Asn</td><td>To be</td><td>Met</td><td>Tyr</td><td>Gly</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td><td>Gly</td><td>Lys</td><td>Tyr</td><td>Met</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>To be</td><td>Val</td><td>Pro</td><td>His</td><td>Phe</td><td>Gly</td><td>lie</td><td>Phe</td><td>To be</td><td>To</td><td>Glu</td><td>Glu</td><td>Glu</td><td>Lys</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Lys</td><td>Thr</td><td>Thr</td><td>Val</td><td>Val</td><td>Tyr</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Glu</td><td>Asn</td><td>Trp</td><td>To</td><td colspan="2">Gly Asp</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>To</td><td>lie</td><td>To be</td><td>To be</td><td>Gln</td><td>To be</td><td>Pro</td><td>Asp</td><td>Asp</td><td>Asn</td><td>Phe</td><td>Thr</td><td>lie</td><td colspan="2">Arg Asn</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
8/38
<td rowspan="2">Tyr Ser</td><td rowspan="2">Phe Lys</td><td colspan="3">Tyr Ala Ser Asn Lys Phe Leu Gly Phe Ala Val</td>
<td> 95</td><td> 100</td><td> 105</td>
<td>Wing lie</td><td>Gly Tyr</td><td>To be</td><td>lie Gly Ser Pro Ara lie Glu</td><td>Val Glu Met</td>
<td></td><td></td><td> 110</td><td> 115</td><td> 120</td>
<td>Ser Tyr</td><td>Glu Wing</td><td>Phe</td><td>Asp Val Lys Asn Gln Gly Asn</td><td>Asn</td>
<td></td><td></td><td> 125</td><td> 130</td><td></td>
<td> <210> <211> <212> <213></td><td>8 287 PRT Ehrlichia canis</td>
<td> <220> <223> <400></td><td>amino acid sequence of ρ2β-4 protein 8</td>
<td>Met Lys Tyr Lys</td><td>Lys Thr Phe Thr Val Thr Ala Leu Val Leu Leu 5 10 15</td>
<td>Thr Ser Phe Thr</td><td>His Phe lie Pro Phe Tyr Ser Pro Ala Arg Ala 20 25 30</td>
<td>Ser Thr lie His</td><td>Asn Phe Tyr lie Ser Gly Lys Tyr Met Pro Thr 35 40 45</td>
<td>Ala Ser His Phe</td><td>Gly lie Phe Ser Ala Lys Glu Glu Gln Ser Phe 50 55 60</td>
<td>Thr Lys Val Leu</td><td>Val Gly Leu Asp Gln Arg Leu Ser His Asn lie 65 70 75</td>
<td>lie Asn Asn Asn</td><td>Asp Thr Ala Lys Ser Leu Lys Val Gln Asn Tyr 80 85 90</td>
<td>Ser Phe Lys Tyr</td><td>Lys Asn Asn Pro Phe Leu Gly Phe Ala Gly Ala 95 100 105</td>
<td>lie Gly Tyr Ser</td><td>lie Gly Asn Ser Arg lie Glu Leu Glu Val Ser 110 115 120</td>
<td>His Glu lie Phe</td><td>Asp Thr Lys Asn Pro Gly Asn Asn Tyr Leu Asn 125 130 135</td>
9/38
<td>Asp</td><td>To be</td><td>His</td><td>Lys</td><td>Tyr</td><td>Cys</td><td>To</td><td>Leu</td><td>To be</td><td>His</td><td>Gly</td><td>To be</td><td>His</td><td>lie</td><td>Cys</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>To be</td><td>Asp</td><td>Gly</td><td>Asn</td><td>To be</td><td colspan="2">Gly Asp</td><td>Trp</td><td>Tyr</td><td>Thr</td><td>To</td><td>Lys</td><td>Thr</td><td>Asp</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Phe</td><td>Val</td><td>Leu</td><td>Leu</td><td>Lys</td><td>Asn</td><td>Glu</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Asp</td><td>Val</td><td>To be</td><td>Phe</td><td>Met</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Leu</td><td>Asn</td><td>To</td><td>Cys</td><td>Tyr</td><td>Asp</td><td>lie</td><td>Thr</td><td>Thr</td><td>Glu</td><td>Lys</td><td>Met</td><td>Pro</td><td>Phe</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Pro</td><td>Tyr</td><td>lie</td><td>Cys</td><td>To</td><td>Gly</td><td>lie</td><td>Gly</td><td>Thr</td><td>Asp</td><td>Leu</td><td>lie</td><td>To be</td><td>Met</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Glu</td><td>Thr</td><td>Thr</td><td>Gln</td><td>Asn</td><td>Lys</td><td>lie</td><td>To be</td><td>Tyr</td><td>Gln</td><td>Gly</td><td>Lys</td><td>Leu</td><td>Gly</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>Asn</td><td>Tyr</td><td>Thr</td><td>lie</td><td>Asn</td><td>To be</td><td>Arg</td><td>Val</td><td>To be</td><td>Val</td><td>Phe</td><td>To</td><td>Gly</td><td>Gly</td><td>His</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Phe</td><td>HIS</td><td>Lys</td><td>Val</td><td>lie</td><td>Gly</td><td>Asn</td><td>Glu</td><td>Phe</td><td>Lys</td><td>Gly</td><td>lie</td><td>Pro</td><td>Thr</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td>Leu</td><td>Pro</td><td>Asp</td><td>Gly</td><td>To be</td><td>Asn</td><td>lie</td><td>Lys</td><td>Val</td><td>Gln</td><td>Gln</td><td>To be</td><td>To</td><td>Thr</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td>
<td>Thr</td><td>Leu</td><td>Asp</td><td>Val</td><td>Cys</td><td>His</td><td>Phe</td><td>Gly</td><td>Leu</td><td>Glu</td><td>lie</td><td>Gly</td><td>To be</td><td>Arg</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td>
Phe Phe <210> 9 <211> 281 <212> PRT <213> Ehrlichia chaffeensis <220>
<223> amino acid sequence of E. chaffeensis Ρ2Θ <400> 9
Met Asn Tyr Lys Lys val Phe lie Thr Ser Ala Leu lie Ser Leu
10 15
10/38
<td>lie</td><td>To be</td><td>To be</td><td>Leu</td><td>Pro</td><td>Gly</td><td>Val</td><td>To be</td><td>Phe</td><td colspan="2">Be Asp</td><td>Pro</td><td>To</td><td>Gly</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Gly</td><td>lie</td><td>Asn</td><td>Giy</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td><td colspan="2">Gly Lys</td><td>Tyr</td><td>Met</td><td>Pro</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>To</td><td>To be</td><td>His</td><td>Phe</td><td>Gly</td><td>Val</td><td>Phe</td><td>To be</td><td>To</td><td>Lys</td><td>Glu</td><td>Glu</td><td>Arg</td><td>Asn</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Thr</td><td>Val</td><td>Gly</td><td>Val</td><td>Phe</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Gln</td><td>Asn</td><td>Trp</td><td>Asp</td><td>Gly</td><td>To be</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>lie</td><td>To be</td><td>Asn</td><td>To be</td><td>To be</td><td>Pro</td><td>Asn</td><td>Asp</td><td>Val</td><td>Phe</td><td>Thr</td><td>Val</td><td>To be</td><td>Asn</td><td>Tyr</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>To be</td><td>Phe</td><td>Lys</td><td>Tyr</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Phe</td><td>Leu</td><td>Gly</td><td>Phe</td><td>To</td><td>Gly</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
<td>lie</td><td>Gly</td><td>Tyr</td><td>To be</td><td>Met</td><td>Asp</td><td>Gly</td><td>Pro</td><td>Arg</td><td>I have</td><td>Glu</td><td>Leu</td><td>Glu</td><td>Val</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>Tyr</td><td>Glu</td><td>Thr</td><td>Phe</td><td>Asp</td><td>Val</td><td>Lys</td><td>Asn</td><td>Gln</td><td>Gly</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>Glu</td><td>To</td><td>Hís</td><td>Arg</td><td>Tyr</td><td>Cys</td><td>To</td><td>Leu</td><td>To be</td><td>His</td><td>Asn</td><td>To be</td><td>To</td><td>To</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>Met</td><td>To be</td><td>To be</td><td>To</td><td>To be</td><td>Asn</td><td>Asn</td><td>Phe</td><td>Val</td><td>Phe</td><td>Leu</td><td>Lys</td><td>Asn</td><td>Glu</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Leu</td><td>Leu</td><td>Asp</td><td>lie</td><td>To be</td><td>Phe</td><td>Met</td><td>Leu</td><td>Asn</td><td>To</td><td>Cys</td><td>Tyr</td><td>Asp</td><td>Val</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Gly</td><td>Glu</td><td>Gly</td><td>lie</td><td>Pro</td><td>Phe</td><td>To be</td><td>Pro</td><td>Tyr</td><td>lie</td><td>Cys</td><td>To</td><td>Gly</td><td>lie</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Thr</td><td>Asp</td><td>Leu</td><td>Val</td><td>To be</td><td>Met</td><td>Phe</td><td>Glu</td><td>To</td><td>Thr</td><td>Asn</td><td>Pro</td><td>Lys</td><td>lie</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Tyr</td><td>Gln</td><td>Gly</td><td>Lys</td><td>Leu</td><td>Gly</td><td>Leu</td><td>To be</td><td>Tyr</td><td>To be</td><td>lie</td><td>To be</td><td>Pro</td><td>Glu</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>To be</td><td>Val</td><td>Phe</td><td>lie</td><td colspan="2">Gly Gly</td><td>His</td><td>Phe</td><td>His</td><td>Lys</td><td>Val</td><td>lie</td><td>Gly</td><td>Asn</td><td>Glu</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Phe</td><td>Arg</td><td>Asp</td><td>lie</td><td>Pro</td><td>Thr</td><td>lie</td><td>lie</td><td>Pro</td><td>Thr</td><td>Gly</td><td>To be</td><td>Thr</td><td>Leu</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td>Gly</td><td>Lys</td><td>Gly</td><td>Asn</td><td colspan="2">Tyr Pro</td><td>To</td><td>lie</td><td>Val</td><td>lie</td><td>Leu</td><td>Asp</td><td>Val</td><td>Cys</td><td>His</td>
<td></td><td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td>
11/38
Phe Gly lie Glu Leu Gly Gly Arg Phe Ala Phe
275 2Θ0
<td> <210></td><td> 10 '</td>
<td> <211></td><td> 283</td>
<td> <212></td><td>PRT</td>
<td> <213></td><td>Ehrlichia chaffeensis</td>
<220>
<223> amino acid sequence of OMP-1B from E. chaffeensis <400 10
<td>Met</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Lys</td><td>lie</td><td>Phe</td><td>Val</td><td>To be</td><td>To be</td><td>To</td><td>Leu</td><td>lie</td><td>To be</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>Met</td><td>To be</td><td>lie</td><td>Leu</td><td>Pro</td><td>Tyr</td><td>Gln</td><td>To be</td><td>Phe</td><td>To</td><td>Asp</td><td>Pro</td><td>Val</td><td>Thr</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Asn</td><td>Asp</td><td>Thr</td><td>Gly</td><td>lie</td><td>Asn</td><td>Asp</td><td>To be</td><td>Arg</td><td>Glu</td><td>Gly</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>Val</td><td>Lys</td><td>Tyr</td><td>Asn</td><td>Pro</td><td>To be</td><td>lie</td><td>To be</td><td>His</td><td>Phe</td><td>Arg</td><td>Lys</td><td>Phe</td><td>To be</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Glu</td><td>Glu</td><td>To</td><td>Pro</td><td>lie</td><td>Asn</td><td>Gly</td><td>Asn</td><td>Thr</td><td>To be</td><td>lie</td><td>Thr</td><td>Lys</td><td>Lys</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>Phe</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Lys</td><td>Asp</td><td>Gly</td><td>Asp</td><td>lie</td><td>To</td><td>Gln</td><td>To be</td><td>To</td><td>Asn</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>Asn</td><td>Arg</td><td>Thr</td><td>Asp</td><td>Pro</td><td>To</td><td>Leu</td><td>Glu</td><td>Phe</td><td>Gln</td><td>Asn</td><td>Asn</td><td>Leu</td><td>lie</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
<td>Gly</td><td>Phe</td><td>To be</td><td>Gly</td><td>To be</td><td>lie</td><td>Gly</td><td>Tyr</td><td>To</td><td>Met</td><td>Asp</td><td>Gly</td><td>Pro</td><td>Arg</td><td>I have</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>Glu</td><td>Leu</td><td>Glu</td><td>To</td><td>To</td><td>Tyr</td><td>Gln</td><td>Lys</td><td>Phe</td><td>Asp</td><td>To</td><td>Lys</td><td>Asn</td><td>Pro</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>Asn</td><td>Asn</td><td>Asp</td><td>Thr</td><td>Asn</td><td>To be</td><td colspan="2">Gly Asp</td><td>Tyr</td><td>Tyr</td><td>Lys</td><td>Tyr</td><td>Phe</td><td>Gly</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>To be</td><td>Arg</td><td>Glu</td><td>Asp</td><td>To</td><td>I have</td><td colspan="2">Asp Wing</td><td>Lys</td><td>Lys</td><td>Tyr</td><td>Val</td><td>Val</td><td>Leu</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
12/38
<td colspan="3" rowspan="2">Asn Glu Gly</td><td colspan="2" rowspan="2">He Thr 170</td><td colspan="10">Phe Met Ser Leu Met Val Asn Thr Cys Tyr</td>
<td colspan="5"> 175</td><td colspan="5"> 180</td>
<td>Asp</td><td>lie</td><td>Thr</td><td>To</td><td>Glu</td><td colspan="2">Gly Val</td><td>Pro</td><td>Phe</td><td>lie</td><td>Pro</td><td>Tyr</td><td>To</td><td>Cys</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Gly</td><td>Val</td><td>Gly</td><td>To</td><td>Asp</td><td>Leu</td><td>lie</td><td>Asn</td><td>Val</td><td>Phe</td><td>Lys</td><td>Asp</td><td>Phe</td><td>Asn</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Lys</td><td>Phe</td><td>To be</td><td>Tyr</td><td>Gln</td><td>Gly</td><td>Lys</td><td>lie</td><td>Gly</td><td>lie</td><td>To be</td><td>Tyr</td><td>Pro</td><td>lie</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>Pro</td><td>Glu</td><td>Val</td><td>To be</td><td>To</td><td>Phe</td><td>lie</td><td>Gly</td><td>Gly</td><td>Tyr</td><td>Tyr</td><td>His</td><td>Gly</td><td>Val</td><td>lie</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Gly</td><td>Asn</td><td>Asn</td><td>Phe</td><td>Asn</td><td>Lys</td><td>lie</td><td>Pro</td><td>Val</td><td>lie</td><td>Thr</td><td>Pro</td><td>Val</td><td>Val</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td>Glu</td><td>Gly</td><td>To</td><td>Pro</td><td>Gln</td><td>Thr</td><td>Thr</td><td>To be</td><td>To</td><td>Leu</td><td>Val</td><td>Thr</td><td>lie</td><td>Asp</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td>
<td>Gly</td><td>Tyr</td><td>Phe</td><td colspan="2">Gly Gly</td><td>Glu</td><td>Val</td><td>Gly</td><td>Val</td><td>Arg</td><td>Phe</td><td>Thr</td><td>Phe</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> <210></td><td></td><td> 11</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> <211></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> <212></td><td></td><td>PRT</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> <213></td><td></td><td colspan="6">Ehrlichia chaffeensis</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> <220></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> <223></td><td> £</td><td colspan="2">sequence</td><td>of</td><td colspan="3">amino acids <</td><td colspan="2">the OMP-1C</td><td>of 1</td><td colspan="2">E. chaffeensis</td>
<td></td><td colspan="2"> <400></td><td></td><td> 11</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Met</td><td>Asn</td><td>Cys</td><td>Lys</td><td>Lys</td><td>Phe</td><td>Phe</td><td>lie</td><td>Thr</td><td>Thr</td><td>To</td><td>Leu</td><td>To</td><td>Leu</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>Met</td><td>To be</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Gly</td><td>lie</td><td>Leu</td><td>Leu</td><td>To be</td><td>Glu</td><td>Pro</td><td>Val</td><td>Gln</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Asp</td><td>To be</td><td>Val</td><td>To be</td><td>Gly</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td><td>Gly</td><td>Lys</td><td>Tyr</td><td>Met</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>To be</td><td>To</td><td>To be</td><td>Hls</td><td>Phe</td><td>Gly</td><td>Val</td><td>Phe</td><td>To be</td><td>To</td><td>Lys</td><td>Glu</td><td>Glu</td><td>Lys</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
13/38
<td rowspan="2">Pro</td><td colspan="2" rowspan="2">Thr Val</td><td colspan="2" rowspan="2">Wing Leu 65</td><td rowspan="2">Tyr</td><td colspan="2" rowspan="2">Gly Leu</td><td rowspan="2">Lys</td><td colspan="6">Gln Asp Trp Asn Gly Val</td>
<td> 70</td><td colspan="5"> 75</td>
<td>To be</td><td>To</td><td>To be</td><td>To be</td><td>His 80</td><td>To</td><td>Asp</td><td>To</td><td>Asp</td><td>Phe 85</td><td>Asn</td><td>Asn</td><td>Lys</td><td>Gly</td><td>Tyr 90</td>
<td>To be</td><td>Phe</td><td>Lys</td><td>Tyr</td><td>Glu 95</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Phe</td><td>Leu 100</td><td>Gly</td><td>Phe</td><td>To</td><td>Gly</td><td>To 105</td>
<td>lie</td><td colspan="2">Gly Tyr</td><td>To be</td><td>Met 110</td><td colspan="2">Gly Gly</td><td>Pro</td><td>Arg</td><td>lie 115</td><td>Glu</td><td>Phe</td><td>Glu</td><td>Val</td><td>To be 120</td>
<td>Tyr</td><td>Glu</td><td>Thr</td><td>Phe</td><td>Asp 125</td><td>Val</td><td>Lys</td><td>Asn</td><td>Gln</td><td>Gly 13 0</td><td>Gly</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Asn 135</td>
<td>Asp</td><td>To</td><td>His</td><td>Arg</td><td>Tyr 140</td><td>Cys</td><td>To</td><td>Leu</td><td>Asp</td><td>Arg 145</td><td>Lys</td><td>To</td><td>To be</td><td>To be</td><td>Thr 150</td>
<td>Asn</td><td>To</td><td>Thr</td><td>To</td><td>To be 155</td><td>His</td><td>Tyr</td><td>Val</td><td>Leu</td><td>Leu 160</td><td>Lys</td><td>Asn</td><td>Glu</td><td>Gly</td><td>Leu 165</td>
<td>Leu</td><td>Asp</td><td>lie</td><td>To be</td><td>Leu 170</td><td>Met</td><td>Leu</td><td>Asn</td><td>To</td><td>Cys 175</td><td>Tyr</td><td>Asp</td><td>Val</td><td>Val</td><td>To be 180</td>
<td>Glu</td><td>Gly</td><td>lie</td><td>Pro</td><td>Phe 185</td><td>To be</td><td>Pro</td><td>i and r</td><td>lie</td><td>Cys 190</td><td>To</td><td>Gly</td><td>Val</td><td>Gly</td><td>Thr 195</td>
<td>Asp</td><td>Leu</td><td>lie</td><td>To be</td><td>Met 200</td><td>Phe</td><td>Glu</td><td>To</td><td>lie</td><td>Asn 205</td><td>Pro</td><td>Lys</td><td>lie</td><td>To be</td><td>Tyr 210</td>
<td>Gln</td><td>Gly</td><td>Lys</td><td>Leu</td><td>Gly 215</td><td>Leu</td><td>To be</td><td>Tyr</td><td>To be</td><td>lie 220</td><td>Asn</td><td>Pro</td><td>Glu</td><td>To</td><td>To be 225</td>
<td>Val</td><td>Phe</td><td>Val</td><td>Gly</td><td>Gly 230</td><td>His</td><td>Phe</td><td>His</td><td>Lys</td><td>Val 235</td><td>To</td><td>Gly</td><td>Asn</td><td>Glu</td><td>Phe 240</td>
<td>Arg</td><td>Asp</td><td>lie</td><td>To be</td><td>Thr 245</td><td>Leu</td><td>Lys</td><td>To</td><td>Phe</td><td>To 250</td><td>Thr</td><td>Pro</td><td>To be</td><td>To be</td><td>To 255</td>
<td>To Gly</td><td>Thr Val</td><td>Pro Glu</td><td>Asp Leu</td><td>Leu 260 Gly 275</td><td>To Gly</td><td>Thr Arg</td><td>Val Phe</td><td>Thr Asn</td><td>Leu 265 Phe 280</td><td>To be</td><td>Val</td><td>Cys</td><td>His</td><td>Phe 270</td>
<td> <210></td><td> 12</td>
<td> <211></td><td> 286</td>
<td> <212></td><td>PRT</td>
14/38 <213> Ehrlichia chaffeensis <220>
<td></td><td colspan="2"> <223></td><td colspan="3">sequence</td><td>of</td><td colspan="5">OMP-1D amino acids</td><td>of 1</td><td colspan="2">E. chaffeensis</td>
<td>Met</td><td colspan="2"><400> Asn Cys</td><td>Glu</td><td>12 Lys</td><td>Phe</td><td>Phe</td><td>lie</td><td>Thr</td><td>Thr</td><td>To</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>Met</td><td>To be</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Gly</td><td>lie</td><td>To be</td><td>Leu</td><td>To be</td><td>Asp</td><td>Pro</td><td>Val</td><td>Gln</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Asp</td><td>Asn</td><td>lie</td><td>To be</td><td>Gly</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td><td>Gly</td><td>Lys</td><td>Tyr</td><td>Met</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>To be</td><td>To</td><td>To be</td><td>His</td><td>Phe</td><td>Gly</td><td>Val</td><td>Phe</td><td>To be</td><td>To</td><td>Lys</td><td>Glu</td><td>Glu</td><td>Arg</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Thr</td><td>Thr</td><td>Val</td><td>Gly</td><td>Val</td><td>Phe</td><td>Gly</td><td>lie</td><td>Glu</td><td>Gln</td><td>Asp</td><td>Trp</td><td>Asp</td><td>Arg</td><td>Cys</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>Val</td><td>lie</td><td>To be</td><td>Arg</td><td>Thr</td><td>Thr</td><td>Leu</td><td>To be</td><td>Asp</td><td>lie</td><td>Phe</td><td>Thr</td><td>Val</td><td>Pro</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>Tyr</td><td>To be</td><td>Phe</td><td>Lys</td><td>Tyr</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Leu</td><td>Phe</td><td>To be</td><td>Gly</td><td>Phe</td><td>To</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
<td>To</td><td>lie</td><td>Gly</td><td>Tyr</td><td>To be</td><td>Met</td><td>Asp</td><td>Gly</td><td>Pro</td><td>Arg</td><td>lie</td><td>Glu</td><td>Leu</td><td>Glu</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>To be</td><td>Tyr</td><td>Glu</td><td>To</td><td>Phe</td><td>Asp</td><td>Val</td><td>Lys</td><td>Asn</td><td>Gln</td><td>Gly</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>Asn</td><td>Glu</td><td>To</td><td>His</td><td>Arg</td><td>Tyr</td><td>Tyr</td><td>To</td><td>Leu</td><td>To be</td><td>His</td><td>Leu</td><td>Leu</td><td>Gly</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>Glu</td><td>Thr</td><td>Gln</td><td>lie</td><td>Asp</td><td>Gly</td><td>To</td><td>Gly</td><td>To be</td><td>To</td><td>To be</td><td>Val</td><td>Phe</td><td>Leu</td><td>lie</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Asn</td><td>Glu</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Asp</td><td>Lys</td><td>To be</td><td>Phe</td><td>Met</td><td>Leu</td><td>Asn</td><td>To</td><td>Cys</td><td>Tyr</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Asp</td><td>Val</td><td>lie</td><td>To be</td><td>Glu</td><td>Gly</td><td>lie</td><td>Pro</td><td>Phe</td><td>To be</td><td>Pro</td><td>Tyr</td><td>lie</td><td>Cys</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Gly</td><td>lie</td><td>Gly</td><td>lie</td><td>Asp</td><td>Leu</td><td>Val</td><td>To be</td><td>Met</td><td>Phe</td><td>Glu</td><td>To</td><td>lie</td><td>Asn</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
15/38
<td rowspan="2">Lys</td><td colspan="3" rowspan="2">lie Ser Tyr</td><td colspan="11">Gln Gly Lys Leu Gly Leu Ser Tyr Pro lie Ser</td>
<td> 215</td><td colspan="9"> 220</td><td> 225</td>
<td>Pro</td><td>Glu</td><td>To</td><td>To be</td><td>Val 230</td><td>Phe</td><td>lie</td><td>Gly</td><td>Gly</td><td>His 235</td><td>Phe</td><td>His</td><td>Lys</td><td>Val</td><td>lie 240</td>
<td>Gly</td><td>Asn</td><td>Glu</td><td>Phe</td><td>Arg 245</td><td>Asp</td><td>lie</td><td>Pro</td><td>Thr</td><td>Met 250</td><td>lie</td><td>Pro</td><td>To be</td><td>Glu</td><td>To be 255</td>
<td>To</td><td>Leu</td><td>To</td><td>Gly</td><td>Lys 260</td><td>Gly</td><td>Asn</td><td>Tyr</td><td>Pro</td><td>To 265</td><td>lie</td><td>Val</td><td>Thr</td><td>Leu</td><td>Asp 270</td>
<td>Val Leu</td><td colspan="2">Plie tyr <210> <211> <212> <213> <220></td><td>Phe</td><td colspan="6">Gly lie Glu Leu Gly Gly 275 280 13 278 PRT Ehrlichia chaffeensis</td><td>Arg</td><td>Phe</td><td>Asn</td><td>Phe</td><td>Gln 285</td>
<td></td><td colspan="2"> <223> <400></td><td colspan="3">sequence 13</td><td>of</td><td colspan="3">amino acids .</td><td colspan="2">by OMP-1E</td><td>! of</td><td colspan="2">E. chaffeensis</td>
<td>Met</td><td>Asn</td><td>Cys</td><td>Lys</td><td>Lys 5</td><td>Phe</td><td>Phe</td><td>lie</td><td>Thr</td><td>Thr 10</td><td>To</td><td>Leu</td><td>Val</td><td>To be</td><td>Leu fifteen</td>
<td>Met</td><td>To be</td><td>Phe</td><td>Leu</td><td>Pro twenty</td><td>Gly</td><td>I have</td><td>To be</td><td>Phe</td><td>To be 25</td><td>Asp</td><td>Pro</td><td>Val</td><td>Gln</td><td>Gly 30</td>
<td>Asp</td><td>Asn</td><td>lie</td><td>To be</td><td>Gly 35</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>val</td><td>To be 40</td><td>Gly</td><td>Lys</td><td>Tyr</td><td>Met</td><td>Pro Four. Five</td>
<td>To be</td><td>To</td><td>To be</td><td>His</td><td>Phe fifty</td><td>Gly</td><td>Met</td><td>Phe</td><td>To be</td><td>To 55</td><td>Lys</td><td>Glu</td><td>Glu</td><td>Lys</td><td>Asn 60</td>
<td>Pro</td><td>Thr</td><td>Val</td><td>To</td><td>Leu 65</td><td>Tyr</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Gln 70</td><td>Asp</td><td>Trp</td><td>Glu</td><td>Gly</td><td>lie 75</td>
<td>To be</td><td>To be</td><td>To be</td><td>To be</td><td>His 80</td><td>Asn</td><td>Asp</td><td>Asn</td><td>His</td><td>Phe 85</td><td>Asn</td><td>Asn</td><td>Lys</td><td>Gly</td><td>Tyr 90</td>
<td>To be</td><td>Phe</td><td>Lys</td><td>Tyr</td><td>Glu 95</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Phe</td><td>Leu 100</td><td>Gly</td><td>Phe</td><td>To</td><td>Gly</td><td>To 105</td>
16/38
<td>lie</td><td colspan="3">Gly Tyr Ser</td><td>Met 110</td><td colspan="6">Gly Gly Pro Arg Val Glu 115</td><td colspan="2">Phe Glu</td><td>Val</td><td>To be 120</td>
<td>Tyr</td><td>Glu</td><td>Thr</td><td>Phe</td><td>Asp 125</td><td>Val</td><td>Lys</td><td>Asn</td><td>Gln</td><td>Gly 130</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Asn 135</td>
<td>Asp</td><td>To</td><td>His</td><td>Arg</td><td>Tyr 140</td><td>cys</td><td>To</td><td>Leu</td><td>Gly</td><td>Gln 145</td><td>Gln</td><td>Asp</td><td>Asn</td><td>To be</td><td>Gly 150</td>
<td>lie</td><td>Pro</td><td>Lys</td><td>Thr</td><td>To be 155</td><td>Lys</td><td>T * yr</td><td>val</td><td>Leu</td><td>Leu 160</td><td>Lys</td><td>To be</td><td>Glu</td><td>Gly</td><td>Leu 165</td>
<td>Leu</td><td>Asp</td><td>lie</td><td>To be</td><td>Phe 170</td><td>Met</td><td>Leu</td><td>Asn</td><td>To</td><td>Cys 175</td><td>Tyr</td><td>Asp</td><td>lie</td><td>lie</td><td>Asn 180</td>
<td>Glu</td><td>To be</td><td>lie</td><td>Pro</td><td>Leu 185</td><td>To be</td><td>Pro</td><td>Tyr</td><td>lie</td><td>Cys 190</td><td>To</td><td>Gly</td><td>Val</td><td>Gly</td><td>Thr 195</td>
<td>Asp</td><td>Leu</td><td>lie</td><td>To be</td><td>Met 200</td><td>Phe</td><td>Glu</td><td>To</td><td>Thr</td><td>Asn 205</td><td>Pro</td><td>Lys</td><td>lie</td><td>To be</td><td>Tyr 210</td>
<td>Gln</td><td>Gly</td><td>Lys</td><td>Leu</td><td>Gly 215</td><td>Leu</td><td>To be</td><td>Tyr</td><td>To be</td><td>lie 220</td><td>Asn</td><td>Pro</td><td>Glu</td><td>To</td><td>To be 225</td>
<td>Val</td><td>Phe</td><td>lie</td><td>Gly</td><td>Gly 230</td><td>His</td><td>Phe</td><td>His</td><td>Lys</td><td>Val 235</td><td>lie</td><td>Gly</td><td>Asn</td><td>Glu</td><td>Phe 240</td>
<td>Arg</td><td>Asp</td><td>lie</td><td>Pro</td><td>Thr 245</td><td>Leu</td><td>Lys</td><td>To</td><td>Phe</td><td>Val 250</td><td>Thr</td><td>To be</td><td>To be</td><td>To</td><td>Thr 255</td>
<td>Pro Glu</td><td>Asp Leu</td><td>Leu Gly</td><td>To Gly</td><td>lie 260 Arg 275</td><td>Val Phe</td><td>Thr Asn</td><td>Leu Phe</td><td>To be</td><td>Val 265</td><td>Cys</td><td>His</td><td>Phe</td><td>Gly</td><td>lie 270</td>
<td> <210></td><td> 14</td><td></td>
<td> <211></td><td> 280</td><td></td>
<td> <212></td><td>PRT</td><td></td>
<td> <213*</td><td>Ehrlichia</td><td>chaffeensis</td>
<td> <220></td><td></td><td></td>
<td> <223></td><td>sequence</td><td>amino acids of OMP-1F from E. chaffeensis</td>
17/38 <400> 14
<td colspan="7">Met Asn Cys Lys Lys Phe Phe</td><td colspan="2" rowspan="2">lie Thr</td><td rowspan="2">Thr 10</td><td colspan="3" rowspan="2">Thr Leu Val</td><td rowspan="2">To be</td><td rowspan="2">Leu fifteen</td>
<td colspan="4"></td><td colspan="3"> 5</td>
<td>Met</td><td>To be</td><td>Phe</td><td>Leu</td><td>Pro twenty</td><td>Gly</td><td>lie</td><td>To be</td><td>Phe</td><td>To be 25</td><td>Asp</td><td>To</td><td>Val</td><td>Gln</td><td>Asn 30</td>
<td>Asp</td><td>Asn</td><td>Val</td><td>Gly</td><td>Gly 35</td><td>Asn</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be 40</td><td>Gly</td><td>Lys</td><td>Tyr</td><td>Val</td><td>Pro Four. Five</td>
<td>To be</td><td>Val</td><td>To be</td><td>His</td><td>Phe fifty</td><td>Gly</td><td>Val</td><td>Phe</td><td>To be</td><td>To 55</td><td>Lys</td><td>Gln</td><td>Glu</td><td>Arg</td><td>Asn 60</td>
<td>Thr</td><td>Thr</td><td>Thr</td><td>Gly</td><td>Val 65</td><td>Phe</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Gln 70</td><td>Asp</td><td>Trp</td><td>Asp</td><td>Gly</td><td>To be 75</td>
<td>Thr</td><td>lie</td><td>To be</td><td>Lys</td><td>Asn 80</td><td>To be</td><td>Pro</td><td>Glu</td><td>Asn</td><td>Thr 85</td><td>Phe</td><td>Asn</td><td>Val</td><td>Pro</td><td>Asn 90</td>
<td>Tyr</td><td>To be</td><td>Phe</td><td>Lys</td><td>Tyr 95</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Phe 100</td><td>Leu</td><td>Gly</td><td>Phe</td><td>To</td><td>Gly 105</td>
<td>To</td><td>Val</td><td>Gly</td><td>Tyr</td><td>Leu 110</td><td>Met</td><td>Asn</td><td>Gly</td><td>Pro</td><td>Arg 115</td><td>lie</td><td>Glu</td><td>Leu</td><td>Glu</td><td>Met 120</td>
<td>To be</td><td>Tyr</td><td>Glu</td><td>Thr</td><td>Phe 125</td><td>Asp</td><td>Val</td><td>Lys</td><td>Asn</td><td>Gln 130</td><td>Gly</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys 135</td>
<td>Asn</td><td>Asp</td><td>To</td><td>His</td><td>Lys 140</td><td>Tyr</td><td>Tyr</td><td>To</td><td>Leu</td><td>Thr 145</td><td>His</td><td>Asn</td><td>To be</td><td>Gly</td><td>Gly 150</td>
<td>Lys</td><td>Leu</td><td>To be</td><td>Asn</td><td>To 155</td><td colspan="2">Gly Asp</td><td>Lys</td><td>Phe</td><td>Val 160</td><td>Phe</td><td>Leu</td><td>Lys</td><td>Asn</td><td>Glu 165</td>
<td>Gly</td><td>Leu</td><td>Leu</td><td>ASp</td><td>lie 170</td><td>To be</td><td>Leu</td><td>Met</td><td>Leu</td><td>Asn 175</td><td>To</td><td>Cys</td><td>Tyr</td><td>Asp</td><td>Val 180</td>
<td>lie</td><td>To be</td><td>Glu</td><td>Gly</td><td>lie 185</td><td>Pro</td><td>Phe</td><td>To be</td><td>Pro</td><td>Tyr 190</td><td>lie</td><td>Cys</td><td>To</td><td>Gly</td><td>Val 195</td>
<td>Gly</td><td>Thr</td><td>Asp</td><td>Leu</td><td>lie 200</td><td>To be</td><td>Met</td><td>Phe</td><td>Glu</td><td>To 205</td><td>lie</td><td>Asn</td><td>Pro</td><td>Lys</td><td>I have 210</td>
<td>To be</td><td>Tyr</td><td>Gln</td><td>Gly</td><td>Lys 215</td><td>Leu</td><td>Gly</td><td>Leu</td><td>To be</td><td>Tyr 220</td><td>To be</td><td>lie</td><td>To be</td><td>Pro</td><td>Glu 225</td>
<td>To</td><td>To be</td><td>Val</td><td>Phe</td><td>Val 230</td><td colspan="2">Gly Gly</td><td>His</td><td>Phe</td><td>His 235</td><td>Lys</td><td>Val</td><td>I have</td><td>Gly</td><td>Asn 240</td>
<td>Glu</td><td>Phe</td><td>Arg</td><td>Asp</td><td>lie</td><td>Pro</td><td>To</td><td>Met</td><td>lie</td><td>Pro</td><td>To be</td><td>Thr</td><td>To be</td><td>Thr</td><td>Leu</td>
245 250 255
18/38
Thr Gly Asn
Gly Val Glu
His Phe Thr lie Val Thr Leu Ser Val Cys His Phe
260 265270
Leu Gly Gly Arg Phe Asn Phe
275280 <210> 15 <211> 284 <212> PRT <213> Cowdria ruminantium <220>
<td></td><td colspan="2"> <223></td><td colspan="3">sequence</td><td>of</td><td colspan="5">MAP-1 amino acids</td><td>of C</td><td colspan="2">. ruminantium</td>
<td>Met</td><td colspan="2"><400> Asn Cys</td><td>• Lys</td><td>15 Lys</td><td>lie</td><td>Phe</td><td>lie</td><td>Thr</td><td>To be</td><td>Thr</td><td>Leu</td><td>lie</td><td>To be</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>Val</td><td>To be</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Gly</td><td>Val</td><td>To be</td><td>Phe</td><td>To be</td><td>Asp</td><td>Val</td><td>lie</td><td>Gln</td><td>G1U</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Glu</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Val</td><td>Gly</td><td>To be</td><td>Val</td><td>Tyr</td><td>lie</td><td>To be</td><td>To</td><td>Lys</td><td>Tyr</td><td>Met</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>Pro</td><td>Thr</td><td>To</td><td>To be</td><td>His</td><td>Phe</td><td>Gly</td><td>Lys</td><td>Met</td><td>To be</td><td>lie</td><td>Lys</td><td>Glu</td><td>Asp</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Arg</td><td>Asp</td><td>Thr</td><td>Lys</td><td>To</td><td>Val</td><td>Phe</td><td>Gly</td><td>Leu</td><td>Lys</td><td>Lys</td><td>Asp</td><td>Trp</td><td>Asp</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>Val</td><td>Lys</td><td>Thr</td><td>Pro</td><td>To be</td><td>Gly</td><td>Asn</td><td>Thr</td><td>Asn</td><td>To be</td><td>lie</td><td>Phe</td><td>Thr</td><td>Glu</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>Asp</td><td>Tyr</td><td>To be</td><td>Phe</td><td>Lys</td><td>Tyr</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Pro</td><td>Phe</td><td>Leu</td><td>Gly</td><td>Phe</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
<td>Gly</td><td>To</td><td>Val</td><td>Gly</td><td>Tyr</td><td>To be</td><td>Met</td><td>Asn</td><td>Gly</td><td>Pro</td><td>Arg</td><td>lie</td><td>Glu</td><td>Phe</td><td>Glu</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>Val</td><td>To be</td><td>Tyr</td><td>Glu</td><td>Thr</td><td>Phe</td><td>Asp</td><td>Val</td><td>Arg</td><td>Asn</td><td>Pro</td><td>Gly</td><td>Gly</td><td>Asn</td><td>Tyr</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>Lys</td><td>Asn</td><td>Asp</td><td>To</td><td>His</td><td>Met</td><td>Tyr</td><td>Cys</td><td>To</td><td>Leu</td><td>Asp</td><td>Thr</td><td>To</td><td>To be</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
19/38
<td>To be</td><td>Thr</td><td>To</td><td>Gly</td><td>To</td><td>Thr</td><td>Thr</td><td>To be</td><td>Val</td><td>Met</td><td>Val</td><td>Lys</td><td>Asn</td><td>Glu</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Leu</td><td>Thr</td><td>Asp</td><td>lie</td><td>To be</td><td>Leu</td><td>Met</td><td>Leu</td><td>Asn</td><td>To</td><td>Cys</td><td>Tyr</td><td>Asp</td><td>lie</td><td>Met</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Leu</td><td>Asp</td><td>Gly</td><td>Met</td><td>Pro</td><td>Val</td><td>To be</td><td>Pro</td><td>Tyr</td><td>Val</td><td>Cys</td><td>To</td><td>Gly</td><td>lie</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Thr</td><td>Asp</td><td>Leu</td><td>Val</td><td>To be</td><td>Val</td><td>lie</td><td>Asn</td><td>To</td><td>Thr</td><td>Asn</td><td>Pro</td><td>Lys</td><td>Leu</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Tyr</td><td>Gln</td><td>Gly</td><td>Lys</td><td>Leu</td><td>Gly</td><td>lie</td><td>To be</td><td>Tyr</td><td>To be</td><td>lie</td><td>Asn</td><td>Pro</td><td>Glu</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>To be</td><td>lie</td><td>Phe</td><td>lie</td><td colspan="2">Gly Gly</td><td>His</td><td>Phe</td><td>HIS</td><td>Arg</td><td>Val</td><td>lie</td><td>Gly</td><td>Asn</td><td>Glu</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Phe</td><td>Lys</td><td>Asp</td><td>lie</td><td>To</td><td>Thr</td><td>To be</td><td>Lys</td><td>Val</td><td>Phe</td><td>Thr</td><td>To be</td><td>To be</td><td>Gly</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td>To</td><td>To be</td><td>To be</td><td>To</td><td>Val</td><td>To be</td><td>Pro</td><td>Gly</td><td>Phe</td><td>To</td><td>To be</td><td>To</td><td>lie</td><td>Leu</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td>
<td>Val</td><td>Cys</td><td>His</td><td>Phe</td><td>Gly</td><td>lie</td><td>Glu</td><td>I have</td><td colspan="2">Gly Gly</td><td>Arg</td><td>Phe</td><td>Val</td><td>Phe</td><td></td>
<td></td><td></td><td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td></td>
<210> 16 <211> 20 <212> <sup>DNA</sup> <213> artificial sequence <220>
<221> linked primer <222> nucleotides 313-332 from ΜΑΡ-1, from C. ruminantium also nucleotides 307-326 from P28 from E. chaffeensis <223> forward primer 793 for PCR <400> 16 gcaggagctg ttggttactc 20
20/38
<td> <210></td><td> 17</td>
<td> <211></td><td> 21</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<td> <220></td><td></td>
<td> <221></td><td>primer_linked</td>
<td> <222></td><td>nucleotides 823-843 of MAP-1, from C. ruminantium also nucleotides 814-834 of P28 from E. chaffeensis</td>
<td> <223></td><td>reverse primer 1330 for PCR</td>
<td> <400></td><td> 17</td>
<td>ccttcctcca</td><td>agttctatgc c 21</td>
<td> <210></td><td> 18</td>
<td> <211></td><td> 24</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<td> <220></td><td></td>
<td> <221></td><td>primer_linked</td>
<td> <223></td><td>primer 46f, specific for the p28-5 gene</td>
<td> <400></td><td> 18</td>
<td>atatacttcc</td><td>tacctaatgt ctca 24</td>
<td> <210></td><td> 19</td>
<td> <211></td><td> 20</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<td> <220></td><td></td>
<td> <221></td><td>priming bound</td>
<td> <223></td><td>primer used for sequencing the 28 kDa protein genes in E. canis</td>
21/38
<td> <400</td><td> 19</td>
agtgcagagt cttcggtttc
<td> <210></td><td> 20</td>
<td> <211></td><td> 18</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<220>
<td> <221></td><td>priming bound</td>
<td> <223></td><td>primer used for sequencing of the 26 kDa protein genes in E. canis</td>
<td> <400></td><td> 20</td>
gttacttgcg gaggacat
<td> <210></td><td> 21</td>
<td> <211></td><td> 24</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<220>
<td> <221></td><td>primer_linked</td>
<td> <222></td><td>nucleotides 687-710 of E. canis p28-7</td>
<td> <223></td><td>primer 394 for PCR</td>
<td> <400></td><td> 21</td>
<td>gcatttccac</td><td>aggatcatag gtaa 24</td>
<td> <210></td><td> 22</td>
<td> <211></td><td> 24</td>
22/38 <212> DNA <213> artificial sequence <220>
<221> linked primer <222> nucleotides 710-687 from E. canis p28-7 <223> 394C primer for PCR <400> 22 ttacctatga tcctgtggaa atgc24 <210> 23 <211> 20 <212> <sub>DNA</sub> <213> artificial sequence <220>
<221> primer_linked <223> 793C primer which anneals to a region with p28-7 of E, canis, used to amplify the intergenic region between the p28-6 gene and p28-7 <400> 23 gagtaaccaa cagctcctgc20 <210> 24 <211> 24 <212> <sub>AD</sub>N <213> artificial sequence <220>
<221> bonded primer <222>
<223> primer EC28OM-F complementary to noncoding regions adjacent to the reading frame
23/38 open of ρ28-7 acttccacta ttgt 24
24
DNA artificial sequence primer_linked primer EC28OM-R complementary to non-coding regions adjacent to the open reading frame of p28-7 cactattttt cttt 24
25
DNA artificial sequence primer linked primer ECaSa3-2 corresponding to regions within p28-6 used to amplify the intergenic region NC3 between the p28 ~ 6 gene and p28-7 gttatagtat aagtt
24/38
<td> <210></td><td> 27</td>
<td> <211></td><td> 23</td>
<td> <212></td><td>PRT</td>
<td> <213></td><td>Ehrlichia canis</td>
<220>
<td> <221></td><td>PEPTIDO</td>
<td> <223></td><td>a predicted N-terminal signal peptide from p28-7 and p28-6</td>
<td> <400></td><td> 27</td>
<td>Met Asn Cys</td><td>Lys Lys lie Leu lie Thr Thr Ala Leu Met Ser Leu 5 10 15</td>
<td>Met tyr tyr</td><td>Wing Pro Ser lie Ser twenty</td>
<td> <210></td><td> 28</td>
<td> <211></td><td> 25</td>
<td> <212></td><td>PRT</td>
<td> <213></td><td>Ehrlichia chaffeensis</td>
<220>
<td> <223></td><td>amino acid sequence of the N-terminal signal peptide of P28 from E. chaffeensis</td>
<td><400> Met Asn Tyr</td><td>28 Lys Lys lie Leu lie Thr Ser Ala Leu lie Ser Leu 5 10 15</td>
<td>lie Be Be</td><td>Leu Pro Gly Val Ser Phe Ser 20 25</td>
<td> <210></td><td> 29</td>
<td> <211></td><td> 26</td>
25/38 <212>
<213>
<220>
<223>
PRT Ehrlichia canis amino acid sequence of the putative cleavage site of ρ2θ-7
<td>Met</td><td><400> Asn Cys</td><td>29 Lys Lys lie Leu lie</td><td>Thr</td><td>Thr</td><td>Wing Leu</td><td>lie Ser Leu</td>
<td></td><td></td><td> 5</td><td></td><td> 10</td><td></td><td> 15</td>
<td>Met</td><td>Tyr Ser</td><td>lie Pro Ser Lie Ser</td><td>To be</td><td>Phe</td><td>To be</td><td></td>
<td></td><td></td><td> 20</td><td></td><td> 25</td><td></td><td></td>
<td></td><td> <210></td><td> 30</td><td></td><td></td><td></td><td></td>
<td></td><td> <211></td><td> 299</td><td></td><td></td><td></td><td></td>
<td></td><td> <212></td><td>DNA</td><td></td><td></td><td></td><td></td>
<td></td><td> <213></td><td>Ehrlichia canis</td><td></td><td></td><td></td><td></td>
<220>
<223>
nucleic acid sequence of noncoding region 1 (28NC1), intergenic
<td> <400></td><td> 30</td>
<td>taatacttct</td><td>attgtacatg ttaaaaatag tactagtttg cttctgtggt 50</td>
<td>ttataaacgc</td><td>aagagagaaa tagttagtaa taaattagaa agttaaatat 100</td>
<td>tagaaaagtc</td><td>atatgttttt cattgtcatt gatactcaac taaaagtagt 150</td>
<td>ataaatgtta</td><td>cttattaata attttacgta gtatattaaa tttcccttac 200</td>
<td>aaaagccact</td><td>agtattttat actaaaagct atactttggc ttgtatttaa 250</td>
<td>tttgtatttt</td><td>tactactgtt aatttacttt cactgtttct ggtgtaaat 299</td>
<210> 31 <211> 345 <212> DNA <213> Ehrlichia canis
26/38 <220> .
<223> nucleic acid sequence of noncoding region 2 (28NC2), intergenic <400> 31 taatttcgtg gtacacatat cacgaagcta aaattgtttt tttatctctg 50 ctgtatacaa gagaaaaaat agtagtgaaa attacctaac aatatgacag 100 tacaagttta ccaagcttat tctcacaaaa cttcttgtgt cttttatctc 150 tttacaatga aatgtacact tagcttcact actgtagagt gtgtttatca 200 atgctttgtt tattaatact ctacataata tgttaaattt ttcttacaaa 250 actcactagt aatttatact agaatatata ttctgacttg tatttgcttt 300 atacttccac tattgttaat ttattttcac tattttaggt gtaat345
<td> <210> <211> <212> <213></td><td colspan="5">32 3. 4. 5 DNA Ehrlichia canis</td>
<td> <220></td><td></td><td></td><td></td><td></td><td></td>
<td> <223></td><td colspan="2">Non-coding acid sequence,</td><td>nucleic of intergenetics</td><td>region 3</td><td>(28NC3)</td>
<td><400> tgattttatt</td><td>32 gttgccacat</td><td>attaaaaatg</td><td>atctaaactt</td><td>gtttttatta</td><td> 50</td>
<td>ttgctacata</td><td>caaaaaaaag</td><td>aaaaatagtg</td><td>gcaaaagaat</td><td>gtagcaataa</td><td> 100</td>
<td>gagggggggg</td><td>ggggactaaa</td><td>tttaccttct</td><td>attcttctaa</td><td>tattctttac</td><td> 150</td>
<td>tatattcaaa</td><td>tagcacaact</td><td>caatgcttcc</td><td>aggaaaatat</td><td>gtttctaata</td><td> 200</td>
<td>ttttatttat</td><td>taccaatcct</td><td>tatataatat</td><td>attaaatttc</td><td>tcttacaaaa</td><td> 250</td>
<td>atctctaatg</td><td>ttttatactt</td><td>aatatatata</td><td>ttctggcttg</td><td>tatttacttt</td><td> 300</td>
<td>gcacttccac</td><td>tattgttaat</td><td>ttattttcac</td><td>tattttaggt</td><td>gtaat</td><td> 345</td>
<210> 33 <211> 355 <212> dna
27/38 <213>
<220>
<223>
Ehrlichia cania noncoding nucleic acid sequence, intergenic region 4 (28NC4)
<td> <400></td><td> 33</td>
<td>taattttatt</td><td>gttgccacat attaaaaatg atctaaactt gtttttawta 50</td>
<td>ttgctacata</td><td>casaaaaaga aaaatagtgg caaaagaatg tagcaataag 100</td>
<td>aggggggggg</td><td>gggaccaaat ttatcttcta tgcttcccaa gttttttcyc 150</td>
<td>gctatttatg</td><td>acttaaacaa cagaaggtaa tatcctcacg gaaaacttat 200</td>
<td>cttcaaatat</td><td>tttatttatt accaatctta tataatatat taaatttctc 250</td>
<td>ttacaaaaat</td><td>cactagtatt ttataccaaa atatatattc tgacttgctt 300</td>
<td>ttcttctgca ataaw</td><td>cttctactat ttttaattta tttgtcacta ttaggttata 350 355</td>
<210 * 34 <211> 24 <212> DNA <213> artificial sequence <220>
<223> primer p28-5-818f <400> 34 ttaaacatat gccacttcgg acta, 24 <210>
<2U>
<212>
<213>
DNA artificial sequence <220>
<223>
primer 1191
28/38 <400> 35 tatgatcgtg taaaattgct gtgagtat
<td> <210></td><td> 36</td>
<td> <211></td><td> 20</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<td> <220></td><td></td>
<td> <223></td><td>ECa28-75C primer</td>
<td><400> tactggcacg</td><td>36 tgctggacta 20</td>
<td> <210</td><td> 37</td>
<td> <211></td><td> 22</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<td> <220></td><td></td>
<td> <223></td><td>ECa5'-1600 primer</td>
<td> <400></td><td> ’ 37</td>
<td>caccaataaa</td><td>tgcagagact te 22</td>
<td> <210></td><td> 38</td>
<td> <211></td><td> 26</td>
<td> <212></td><td>DNA</td>
<td> <213></td><td>artificial sequence</td>
<220>
<223>
primer 3125
29/38 <400> 38 aatccatcat ttctcattac agtgtg 26 <210>
<211>
<212>
<213>
<220>
<223>
<400>
879
DNA
Ehrlichia canis nucleic acid sequence of p28-I of E. Cania atgaataata aactcaaatt tactataata aacacagtat tagtatgctt50 attgtcatta cctaatatat cttcctcaaa ggccataaac aataacgcta100 aaaagtacta cggattatat atcagtggac aatataaacc cagtgtttct150 gttttcagta atttttcagt taaagaaacc aatgtcataa ctaaaaacct200 tatagcttta aaaaaagatg ttgactctat tgaaaccaag actgatgcca250 gtgtaggtat tagtaaccca tcaaatttta ctatccccta tacagctgta300 attctgtcaa tttcaagata tttcaatgga actattggtt acacctttgc350 tgaaggtaca agagttgaaa tagaaggttc ttatgaggaa tttgatgtta400 aaaaccctgg aggctataca ctaagtgatg cctatcgcta ttttgcatta450 gcacgtgaaa tgaaaggtaa tagttttaca cctaaagaaa aagtttctaa500 tagtattttt cacactgtaa tgagaaatga tggattatct ataatatctg550 ttatagtaaa tgtttgctac gatttctctt tgaacaattt gtcaatatcg600 ccttacatat gtggaggagc aggggtagat gctatagaat tcttcgatgt650 attacacatt aagtttgcat atcaaagcaa gctaggtatt gcttattctc700 taccatctaa cattagtctc tttgctagtt tatattacca taaagtaatg750 ggcaatcaat ttaaaaattt aaatgtccaa catgttgctg aacttgcaag800 tatacctaaa attacatccg cagttgctac acttaatatt ggttattttg850 gaggtgaaat tggtgcaaga ttgacattt879 <210>
<211>
<212>
<213>
293
PRT
Ehrlichia canis
30/38
<td></td><td> <220> <223> <400></td><td>sequence 40</td><td>aminoacidon</td><td>p28-l protein from E. canis</td>
<td>Met</td><td>Asn Asn</td><td>Lys Leu Lys 5</td><td>Phe Thr lie lie Asn 10</td><td>Thr Val Leu Val fifteen</td>
<td>Cys</td><td>Leu Leu</td><td>Be Leu Pro twenty</td><td>Asn lie Ser Ser Ser 25</td><td>Lys Ala lie Asn 30</td>
<td>Asn</td><td>Asn Wing</td><td>Lys Lys Tyr 35</td><td>Tyr Gly Leu Tyr lie 40</td><td>Ser Gly Gln Tyr Four. Five</td>
<td>Lys</td><td>Pro Ser</td><td>Val Ser Val fifty</td><td>Phe Ser Asn Phe Ser 55</td><td>Val Lys Glu Thr 60</td>
<td>Asn</td><td>Val lie</td><td>Thr Lys Asn 65</td><td>Leu lie Ala Leu Lys 70</td><td>Lys Asp Val Asp 75</td>
<td>To be</td><td>lie Glu</td><td>Thr Lys Thr 80</td><td>Asp Ala Ser Val Gly 85</td><td>lie Be Asn Pro 90</td>
<td>To be</td><td>Asn Phe</td><td>Thr lie Pro 95</td><td>Tyr Thr Ala Val Phe 100</td><td>Gln Asp Asn Ser 105</td>
<td>Val</td><td>Asn Phe</td><td>Asn Gly Thr 110</td><td>lie Gly Tyr Thr Phe 115</td><td>Glu Gly Thr Wing 120</td>
<td>Arg</td><td>Val Glu</td><td>lie Glu Gly 125</td><td>Ser Tyr Glu Glu Phe 130</td><td>Asp Val Lys Asn 135</td>
<td>Pro</td><td>Gly Gly</td><td>Tyr Thr Leu 140</td><td>Ser Asp Ala Tyr Arg 145</td><td>Tyr Phe Ala Leu 150</td>
<td>To</td><td>Arg Glu</td><td>Met Lys Gly 155</td><td>Asn Ser Phe Thr Pro 160</td><td>Lys Glu Lys Val 165</td>
<td>To be</td><td>Asn Ser</td><td>lie Phe His 170</td><td>Thr Val Met Arg Asn 175</td><td>Asp Gly Leu Ser 180</td>
<td>lie</td><td>lie be</td><td>Val lie Val 185</td><td>Asn Val Cys Tyr Asp 190</td><td>Phe Ser Leu Asn 195</td>
<td>Asn</td><td>Leu Ser</td><td>lie Be Pro 200</td><td>Tyr lie Cys Gly Gly 205</td><td>Gly Val Asp Wing 210</td>
<td>To</td><td>lie Glu</td><td>Phe Phe Asp 215</td><td>Val Leu His He Lys 220</td><td>Phe Ala Tyr Gln 225</td>
<td>To be</td><td>Lys Leu</td><td>Gly lie Wing 230</td><td>Tyr Ser Leu Pro Ser 235</td><td>Asn lie Ser Leu 240</td>
31/38
<td rowspan="2">Phe</td><td rowspan="2">Wing Being</td><td rowspan="2">Leu</td><td colspan="3">Tyr Tyr His Lys Val Met Gly Asn Gln Phe Lys</td>
<td> 245</td><td> 250</td><td> 255</td>
<td>Asn</td><td>Leu Asn</td><td>Val</td><td>Gln His</td><td>Val Ala Glu Leu Ala Ser He</td><td>Pro Lys</td>
<td></td><td></td><td></td><td> 260</td><td> 265</td><td> 270</td>
<td>I have</td><td>Thr Ser</td><td>To</td><td>Val Ala</td><td>Thr Leu Asn He Gly Tyr Phe</td><td>Gly Gly</td>
<td></td><td></td><td></td><td> 275</td><td> 280</td><td> 285</td>
<td>Glu</td><td>He gly</td><td>To</td><td>Arg Leu</td><td>Thr Phe</td><td></td>
<td></td><td></td><td></td><td> 290</td><td> 293</td><td></td>
<210> 41 <211> 840 <212> DNA <213? Ehrlichia canis <220?
<223? nucleic acid sequence of p28-2 from E. canis <400? 41 atgaattata agaaaattct agtaagaagc gcgttaatct cattaatgtc 50 aatcttacca tatcagtctt ttgcagatcc tgtaggttca agaactaatg 100 ataacaaaga aggcttctac attagtgcaa agtacaatcc aagtatatca 150 cactttagaa aattctctgc tgaagaaact cctattaatg gaacaaattc 200 tctcactaaa aaagttttcg gactaaagaa agatggtgat ataacaaaaa 250 tacaagagta aagacgattt ttgattttca gctccaggca aaataactta 300 atatcaggat tttcaggaag tattggttac tctatggacg gaccaagaat 350 agaacttgaa gctgcatatc aacaatttaa tccaaaaaac accgataaca 400 atgatactga taatggtgaa tactataaac attttgcatt atctcgtaaa 450 aagatcagea gatgcaatgg atatgtagta cttaaaaatg acggcataac 500 ttttatgtca ttgatggtta atacttgcta tgacattaca gctgaaggag 550 accatatgca tatctttcgt tgtgcaggta taggagcaga tcttatcact 600 atttttaaag acctcaatct aaaatttgct taccaaggaa aaataggtat 650 tagttaccct atcacaccag aagtctctgc atttattggt ggatactacc 700 tggtaataaa atggcgttat tttgagaaga tacctgtaat aactcctgta 750 atgctcctca gtattaaatg aaccacatct gcttcagtaa ctcttgacgt 800 tggatacttt ggcggagaaa ttggaatgag gttcaccttc 840
32/38 <210> 42 <211> 280 <212> PRT <213> Bhrlichia canis <220>
<td></td><td colspan="2"> <223></td><td colspan="3">sequence</td><td colspan="5">amino acids of the</td><td colspan="2">protein</td><td>p28</td><td>-2 from E. canis</td>
<td>Met</td><td colspan="2"><400> Asn Tyr</td><td>Lys</td><td>42 Lys</td><td>lie</td><td>Leu</td><td>Val</td><td>Arg</td><td>To be</td><td>To</td><td>Leu</td><td>lie</td><td>To be</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>Met</td><td>To be</td><td>lie</td><td>Leu</td><td>Pro</td><td>Tyr</td><td>Gln</td><td>To be</td><td>Phe</td><td>To</td><td>Asp</td><td>Pro</td><td>Val</td><td>Gly</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>Arg</td><td>Thr</td><td>Asn</td><td>Asp</td><td>Asn</td><td>Lys</td><td>Glu</td><td>Gly</td><td>Phe</td><td>Tyr</td><td>lie</td><td>To be</td><td>To</td><td>Lys</td><td>Tyr</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>Asn</td><td>Pro</td><td>To be</td><td>lie</td><td>To be</td><td>His</td><td>Phe</td><td>Arg</td><td>Lys</td><td>Phe</td><td>To be</td><td>To</td><td>Glu</td><td>Glu</td><td>Thr '</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>Pro</td><td>lie</td><td>Asn</td><td>Gly</td><td>Thr</td><td>Asn</td><td>To be</td><td>Leu</td><td>Thr</td><td>Lys</td><td>Lys</td><td>Val</td><td>Phe</td><td>Gly</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>Lys</td><td>Lys</td><td>Asp</td><td>Gly</td><td>Asp</td><td>I have</td><td>Thr</td><td>Lys</td><td>Lys</td><td>Asp</td><td>Asp</td><td>Phe</td><td>Thr</td><td>Arg</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>To</td><td>Pro</td><td>Gly</td><td>lie</td><td>Asp</td><td>Phe</td><td>Gln</td><td>Asn</td><td>Asn</td><td>Leu</td><td>lie</td><td>To be</td><td>Gly</td><td>Phe</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
<td>Gly</td><td>To be</td><td>lie</td><td>Gly</td><td>Tyr</td><td>To be</td><td>Met</td><td>Asp</td><td>Gly</td><td>Pro</td><td>Arg</td><td>lie</td><td>Glu</td><td>Leu</td><td>Glu</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>To</td><td>To</td><td>Tyr</td><td>Gln</td><td>Gln</td><td>Phe</td><td>Asn</td><td>Pro</td><td>Lys</td><td>Asn</td><td>Thr</td><td>Asp</td><td>Asn</td><td>Asn</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>Thr</td><td>Asp</td><td>Asn</td><td>Gly</td><td>Glu</td><td>Tyr</td><td>Tyr</td><td>Lys</td><td>His</td><td>Phe</td><td>To</td><td>Leu</td><td>To be</td><td>Arg</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>Asp</td><td>To</td><td>Met</td><td>Glu</td><td>Asp</td><td>Gln</td><td>Gln</td><td>Tyr</td><td>Val</td><td>Val</td><td>Leu</td><td>Lys</td><td>Asn</td><td>Asp</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>lie</td><td>Thr</td><td>Phe</td><td>Met</td><td>To be</td><td>Leu</td><td>Met</td><td>Val</td><td>Asn</td><td>Thr</td><td>Cys</td><td>Tyr</td><td>Asp</td><td>lie</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>To</td><td>Glu</td><td>Gly</td><td>Val</td><td>To be</td><td>Phe</td><td>Val</td><td>Pro</td><td>Tyr</td><td>To</td><td>Cys</td><td>To</td><td>Gly</td><td>lie</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
. 33/38
<td>Asp Wing</td><td>Leu lie</td><td>Thr 200</td><td>lie Phe Lys</td><td>Asp</td><td>Leu Asn 205</td><td>Leu Lys</td><td>Phe</td><td>To 210</td>
<td>Tyr Gln</td><td>Gly Lys</td><td>lie</td><td>Gly lie Ser</td><td>Tyr</td><td>Pro lie</td><td>Thr Pro</td><td>Glu</td><td>Val</td>
<td></td><td></td><td> 215</td><td></td><td></td><td> 220</td><td></td><td></td><td> 225</td>
<td>It will be the</td><td>Phe lie</td><td>Gly</td><td>Gly Tyr Tyr</td><td>His</td><td>Gly Val</td><td>lie Gly</td><td>Asn</td><td>Lys</td>
<td></td><td></td><td> 230</td><td></td><td></td><td> 235</td><td></td><td></td><td> 240</td>
<td>Phe Glu</td><td>Lys lie</td><td>Pro</td><td>Val lie Thr</td><td>Pro</td><td>Val Val</td><td>Leu Asn</td><td>Asp</td><td>To</td>
<td></td><td></td><td> 245</td><td></td><td></td><td> 250</td><td></td><td></td><td> 255</td>
<td>Pro Gln</td><td>Thr Thr</td><td>To be</td><td>Ala Ser Val</td><td>Thr</td><td>Leu Asp</td><td>Val Gly</td><td>Tyr</td><td>Phe</td>
<td></td><td></td><td> 260</td><td></td><td></td><td> 265</td><td></td><td></td><td> 270</td>
<td>Gly Gly</td><td>Glu lie</td><td>Gly</td><td>Met Arg Phe</td><td>Thr</td><td>Phe</td><td></td><td></td><td></td>
<td></td><td></td><td> 275</td><td></td><td></td><td> 280</td><td></td><td></td><td></td>
<td> <210> <211> <212> <213></td><td>43 828 DNA Ehrlichia canis</td>
<td> <220> <223></td><td>nucleic acid sequence of E. cania p28-3</td>
<td><400> atgaactgta</td><td>43 aaaaaattct tataacaact acattggtat cactaacaat 50</td>
<td>tcttttacct</td><td>ggcatatctt tctccaaacc aatacatgaa aacaatacta 100</td>
<td>caggaaactt</td><td>ttacattatt ggaaaatatg taccaagtat ttcacatttt 150</td>
<td>gggaactttt</td><td>cagctaaaga agaaaaaaac acaacaactg gaatttttgg 200</td>
<td>nttaaaagaa</td><td>tcatggactg gtggtatcat ccttgataaa gaacatgcag 250</td>
<td>cttttaatat</td><td>cccaaattat tcatttaaat atgaaaataa tccattttta 300</td>
<td>ggatttgcag</td><td>gggtaattgg ctattcaata ggtagtccaa gaatagaatt 350</td>
<td>tgaagtatca</td><td>tacgagacat tcgatgtaca aaatccagga gataagttta 400</td>
<td>acaatgatgc</td><td>acataagtat tgtgetttat ccaatgattc cagtaaaaca 450</td>
<td>atgaaaagtg</td><td>gtaaattcgt ttttctcaaa aatgaaggat taagtgacat 500</td>
<td>atcactcatg</td><td>ttaaatgtat gttatgatat aataaacaaa agaatgcctt 550</td>
<td>tttcacctta</td><td>catatgtgca ggcattggta ctgacttaat attcatgttt 600</td>
<td>gacgctataa</td><td>accataaagc tgcttatcaa ggaaaattag gttttaatta 650</td>
34/38
<td>tccaataagc</td><td>ccagaagcta</td><td>acatttctat gggtgtgcac</td><td>tttcacaaag 700</td>
<td>taacaaacaa</td><td>cgagtttaga</td><td>gttcctgttc tattaactgc</td><td>tggaggactc 750</td>
<td>gctccagata</td><td>atctatttgc</td><td>aatagtaaag ttgagtatat</td><td>gtcattttgg 800</td>
<td>gttagaattt</td><td>gggtacaggg</td><td>tcagtttt</td><td> 828</td>
<210 44 <211> 276 <212> PRT <213> Ehrlichia canis <220>
<223> amino acid sequence of E. canis p28-3 protein <400 44.
Met Asn Cys Lys Lys lie Leu lie Thr Thr Thr Leu Val Ser Leu 5 1015
Thr lie Leu Leu Pro Gly lie Ser Phe Ser Lys Pro lie His Glu
2530
Asn Asn Thr Thr Gly Asn Phe Tyr lie lie Gly Lys Tyr Val Pro 35 4045
Ser lie Ser His Phe Gly Asn Phe Ser Ala Lys Glu Glu Lys Asn
5560
Thr Thr Thr Gly lie Phe Gly Leu Lys Glu Ser Trp Thr Gly Gly
7075 lie lie Leu Asp Lys Glu His Ala Ala Phe Asn lie Pro Asn Tyr 80 '8590
Ser Phe Lys Tyr Glu Asn Asn Pro Phe Leu Gly Phe Ala Gly Val 95 100 105 lie Gly Tyr Ser lie Gly Ser Pro Arg lie Glu Phe Glu Val Ser
110 115120
Tyr Glu Thr Phe Asp Val Gln Asn Pro Gly Asp Lys Phe Asn Asn
125 130135
Asp Ala His Lys Tyr Cys Ala Leu Ser Asn Asp Ser Ser Lys Thr
140 145150
35/38
<td>Met</td><td>Lys</td><td>To be</td><td>Gly</td><td>Lys</td><td>Phe</td><td>Val</td><td>Phe</td><td>Leu</td><td colspan="2">Lys Asn</td><td>Glu</td><td>Gly</td><td>Leu</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Asp</td><td>lie</td><td>To be</td><td>Leu</td><td>Met</td><td>Leu</td><td>Asn</td><td>Val</td><td>Cys</td><td colspan="2">Tyr asp</td><td>I have</td><td>I have</td><td>Asn</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Arg</td><td>Met</td><td>Pro</td><td>Phe</td><td>To be</td><td>Pro</td><td>Tyr</td><td>I have</td><td>Cys</td><td>To</td><td>Gly</td><td>I have</td><td>Gly</td><td>Thr</td><td>Asp</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Leu</td><td>lie</td><td>Phe</td><td>Met</td><td>Phe</td><td>Asp</td><td>To</td><td>I have</td><td>Asn</td><td>His</td><td>Lys</td><td>To</td><td>To</td><td>Tyr</td><td>Gln</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Gly</td><td>Lys</td><td>Leu</td><td>Gly</td><td>Phe</td><td>Asn</td><td>Tyr</td><td>Pro</td><td>lie</td><td>To be</td><td>Pro</td><td>Glu</td><td>To</td><td>Asn</td><td>lie</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>To be</td><td>Met</td><td>Gly</td><td>Val</td><td>His</td><td>Phe</td><td>His</td><td>Lys</td><td>Val</td><td>Thr</td><td>Asn</td><td>Asn</td><td>Glu</td><td>Phe</td><td>Arg</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Val</td><td>Pro</td><td>Val</td><td>Leu</td><td>Leu</td><td>Thr</td><td>To</td><td>Gly</td><td>Gly</td><td>Leu</td><td>To</td><td>Pro</td><td>Asp</td><td>Asn</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td>Phe</td><td>To</td><td>lie</td><td>Val</td><td>Lys</td><td>Leu</td><td>To be</td><td>I have</td><td>Cys</td><td>His</td><td>Phe</td><td>Gly</td><td>Leu</td><td>Glu</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td>
<td>Gly</td><td>Tyr</td><td>Arg</td><td>Val</td><td>To be</td><td>Phe</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
275
<td> <210> <211> <212> <213></td><td>Four. Five 813 DNA Ehrlichia canis</td>
<td> <220> <223></td><td>nucleic acid sequence of E. canis p28-9</td>
<td><400> atgaattaca</td><td>Four. Five aaagatttgt tgtaggtgtt acgctgagta catttgtttt 50</td>
<td>tttcttatct</td><td>gatggtgctt tttctgatgc aaatttttct gaagggagga 100</td>
<td>gaggacttta</td><td>tataggtagt cagtataaag ttggtattcc caattttagt 150</td>
<td>aatttttcag</td><td>ctgaagaaac aattcctggt attacaaaaa agatttttgc 200</td>
<td>gttaggtctt</td><td>gataagtctg agataaatac tcacagcaat tttacacgat 250</td>
<td>catatgaccc</td><td>tacttatgca agcagttttg cagggtttag tggtatcatt 300</td>
<td>ggatattatg</td><td>ttaatgactt tagggtagaa tttgaaggtt cttatgagaa 350</td>
36/38
<td>ttttgaacct</td><td>gaaagacaat ggtaccctga</td><td>gaatagccaa</td><td>agctacaaat</td><td> 400</td>
<td>tttttgcttt</td><td>gtctcgaaat gctacaaata</td><td>gtgataataa</td><td>gtttatagta</td><td> 450</td>
<td>ctagagaata</td><td>acggcgttgt tgacaagtct</td><td>cttaatgtaa</td><td>atgtttgtta</td><td> 500</td>
<td>tgatattgct</td><td>agtggtagta ttcctttagc</td><td>accttatatg</td><td>tgtgctggtg</td><td> 550</td>
<td>ttggtgcaga</td><td>ttatataaag tttttaggta</td><td>tatcattgcc</td><td>taagttttct</td><td> 600</td>
<td>tatcaagtta</td><td>agtttggtgt caactaccct</td><td>ctaaatgtta</td><td>atactatgtt</td><td> 650</td>
<td>gtttggtggg</td><td>ggttattacc ataaggttgt</td><td>aggtgatagg</td><td>catgagagag</td><td> 700</td>
<td>tagaaatagc</td><td>ttaccatcct actgcattat</td><td>ctgacgttcc</td><td>tagaactact</td><td> 750</td>
<td>tcagcttctg tagatttgcg</td><td>ctactttaaa tactgattat cta</td><td>tttggttggg</td><td>agattggatt</td><td> 800 813</td>
<210> 46 <211> 271 <212> PRT <213> Ehrlichia canis <220>
<223> amino acid sequence of the protein p28-9 from E. canis <400> 46
<td>Met</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Arg</td><td>Phe</td><td>Val</td><td>Val</td><td>Gly</td><td>Val</td><td>Thr</td><td>Leu</td><td>To be</td><td>Thr</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td>
<td>Val</td><td>Phe</td><td>Phe</td><td>Leu</td><td>To be</td><td>Asp</td><td>Gly</td><td>To</td><td>Phe</td><td>To be</td><td>Asp</td><td>To</td><td>Asn</td><td>Phe</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td>
<td>G1U</td><td>Gly</td><td>Arg</td><td>Arg</td><td>Gly</td><td>Leu</td><td>Tyr</td><td>lie</td><td>Gly</td><td>To be</td><td>Gln</td><td>Tyr</td><td>Lys</td><td>Val</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td>
<td>lie</td><td>Pro</td><td>Asn</td><td>Phe</td><td>To be</td><td>Asn</td><td>Phe</td><td>To be</td><td>To</td><td>Glu</td><td>Glu</td><td>Thr</td><td>lie</td><td>Pro</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td>
<td>lie</td><td>Thr</td><td>Lys</td><td>Lys</td><td>lie</td><td>Phe</td><td>To</td><td>Leu</td><td>Gly</td><td>Leu</td><td>Asp</td><td>Lys</td><td>To be</td><td>Glu</td><td>lie</td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td>
<td>Asn</td><td>Thr</td><td>His</td><td>To be</td><td>Asn</td><td>Phe</td><td>Thr</td><td>Arg</td><td>To be</td><td colspan="2">Tyr'Asp</td><td>Pro</td><td>Thr</td><td>Tyr</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td>
<td>To be</td><td>To be</td><td>Phe</td><td>To</td><td>Gly</td><td>Phe</td><td>To be</td><td>Gly</td><td>lie</td><td colspan="2">lie Gly</td><td>Tyr</td><td>Tyr</td><td>Val</td><td>Asn</td>
<td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td>
37/38
<td>Asp</td><td>Phe</td><td>Arg</td><td>Val</td><td>Glu</td><td>Phe</td><td>Glu</td><td>Gly</td><td>To be</td><td>Tyr</td><td>Glu</td><td>Asn</td><td>Phe</td><td>Glu</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td>
<td>G1U</td><td>Arg</td><td>Gln</td><td>Trp</td><td>Tyr</td><td>Pro</td><td>Glu</td><td>Asn</td><td>To be</td><td>Gln</td><td>To be</td><td>Tyr</td><td>Lys</td><td>Phe</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td>
<td>To</td><td>Leu</td><td>To be</td><td>Arg</td><td>Asn</td><td>To</td><td>Thr</td><td>Asn</td><td>To be</td><td>Asp</td><td>Asn</td><td>Lys</td><td>Phe</td><td>lie</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td> 145</td><td></td><td></td><td></td><td></td><td> 150</td>
<td>Leu</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Gly</td><td>Val</td><td>Val</td><td>Asp</td><td>Lys</td><td>To be</td><td>Leu</td><td>Asn</td><td>Val</td><td>Asn</td><td>Val</td>
<td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td><td></td><td></td><td></td><td> 165</td>
<td>Cys</td><td>Tyr</td><td>Asp</td><td>lie</td><td>To</td><td>To be</td><td>Gly</td><td>To be</td><td>lie</td><td>Pro</td><td>Leu</td><td>To</td><td>Pro</td><td>Tyr</td><td>Met</td>
<td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td><td></td><td></td><td> 180</td>
<td>Cys</td><td>To</td><td>Gly</td><td>Val</td><td colspan="2">Gly Wing</td><td>Asp</td><td>Tyr</td><td>lie</td><td>Lys</td><td>Phe</td><td>Leu</td><td>Gly</td><td>lie</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td><td></td><td> 195</td>
<td>Leu</td><td>Pro</td><td>Lys</td><td>Phe</td><td>To be</td><td>Tyr</td><td>Gln</td><td>Val</td><td>Lys</td><td>Phe</td><td>Gly</td><td>Val</td><td>Asn</td><td>Tyr</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td> 210</td>
<td>Leu</td><td>Asn</td><td>Val</td><td>Asn</td><td>Thr</td><td>Met</td><td>Leu</td><td>Phe</td><td>Gly</td><td colspan="2">Gly Gly</td><td>Tyr</td><td>Tyr</td><td>His</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td> 225</td>
<td>Val</td><td>Val</td><td>Gly</td><td>Asp</td><td>Arg</td><td>His</td><td>Glu</td><td>Arg</td><td>Val</td><td>Glu</td><td>lie</td><td>To</td><td>Tyr</td><td>His</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td>Thr</td><td>To</td><td>Leu</td><td>To be</td><td>Asp</td><td>Val</td><td>Pro</td><td>Arg</td><td>Thr</td><td>Thr</td><td>To be</td><td>To</td><td>To be</td><td>To</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td>Leu</td><td>Asn</td><td>Thr</td><td>Asp</td><td>Tyr</td><td>Phe</td><td>Gly</td><td>Trp</td><td>Glu</td><td>lie</td><td>Gly</td><td>Phe</td><td>Arg</td><td>Phe</td><td>To</td>
<td></td><td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td>
Leu
271
38/38
Contents17
18 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18
49 members in 15 offices
Priority claims2
| Document | Office | Kind | Date |
|---|---|---|---|
| 66058700 | United States of America | A | |
| 0128759 | United States of America | W |
Members49
| Document | Office | Kind | |
|---|---|---|---|
| CA2352466A1 | Canada | A1 | |
| WO0032745A2 | World Intellectual Property Organization (WIPO) | A2 | |
| AU1923400A | Australia | A | |
| KR20010093122A | Republic of Korea | A | |
| BR9916141A | Brazil | A | |
| CA2421952A1 | Canada | A1 | |
| WO0222782A2 | World Intellectual Property Organization (WIPO) | A2 | |
| AU9092601A | Australia | A | |
| IL143415A0 | Israel | A0 | |
| IL143415D0 | Israel | D0 | |
| US6392023B1 | United States of America | B1 | |
| WO0222782A3 | World Intellectual Property Organization (WIPO) | A3 | |
| US6403780B1 | United States of America | B1 | |
| US2002115840A1 | United States of America | A1 | |
| US6458942B1 | United States of America | B1 | |
| US2003073095A1 | United States of America | A1 | |
| US2003096250A1 | United States of America | A1 | |
| KR20030042461A | Republic of Korea | A | |
| EP1317474A2 | European Patent Office (EPO) | A2 | |
| AU762315B2 | Australia | B2 | |
| JP2003527073A | Japan | A | |
| US2003185849A1 | United States of America | A1 | |
| IL154870A0 | Israel | A0 | |
| IL154870D0 | Israel | D0 | |
| NZ511922A | New Zealand | A | |
| US6660269B2 | United States of America | B2 | |
| CN1473166A | China | A | |
| JP2004508823A | Japan | A | |
| MXPA03002145AThis record | Mexico | A | |
| ZA200103970B | South Africa | B | |
| WO0032745A3 | World Intellectual Property Organization (WIPO) | A3 | |
| BR0113818A | Brazil | A | |
| TWI221481B | Taiwan Province of China | B | |
| CN1535314A | China | A | |
| US2004198951A1 | United States of America | A1 | |
| RU2237716C2 | Russian Federation | C2 | |
| EP1470223A2 | European Patent Office (EPO) | A2 | |
| NZ524678A | New Zealand | A | |
| US2004247616A1 | United States of America | A1 | |
| ZA200301886B | South Africa | B | |
| EP1470223A4 | European Patent Office (EPO) | A4 | |
| EP1317474A4 | European Patent Office (EPO) | A4 | |
| RU2288952C2 | Russian Federation | C2 | |
| AU2001290926B2 | Australia | B2 | |
| KR100713571B1 | Republic of Korea | B1 | |
| US7309583B2 | United States of America | B2 | |
| US7344719B2 | United States of America | B2 | |
| KR100837581B1 | Republic of Korea | B1 | |
| CN101307312A | China | A |
1 legal event, as the office reported them to INPADOC
Events
| Event | Code | |
|---|---|---|
| Abandonment or withdrawalAbandonedFA | FA |
Numbers
- Application
- 3002145
Titles2
- English
- HOMOLOGOUS 28-KILODALTON IMMUNODOMINANT PROTEIN GENES OF EHRLICHIA CANIS AND USES THEREOF.
- Spanish
- GENES DE LA PROTEINA HOMOLOGA INMUNODOMINANTE DE 28 KILODALTONES DE EHRLICHIA CANIS Y USOS.
Classification
- CPC, 8
- C07K14/29
- C12N15/117
- A61K39/00
- A61K2039/52
- A61P31/00
- A61P31/04
- A61P33/02
- Y02A50/30
- IPC, 13
- C12N15 09
- A61K38 00
- A61K39 00
- A61P31 00
- C07K14 195
- C07K14 29
- C07K16 12
- C12N1 15
- C12N1 19
- C12N1 21
- C12N5 10
- C12N15 117
- C12P21 02