Intracellular domain of the her-2/neu protein for prevention or treatment of malignancies.
Abstract
Compounds and compositions for eliciting or enhancing immune reactivity to HER-2/neu protein are disclosed. The compounds include polypeptides and nucleic acid molecules encoding such peptides. The compounds may be used for the prevention or treatment of malignancies in which the HER-2/neu oncogene is associated.

Term
Term ended
Expired 30 September 2017, 9 years ago.
- Priority
- Filed
- Granted
- Expired
- Today
10 claims: 7 independent, 3 dependent
- 1REIVINDICACIONES 1. Un polipéptido codificado por una secuencia de ADN seleccionada de:(a) los nucleótidos 2026 hasta 3765 de la SEQ ID NO: 1;y (b) las secuencias de ADN que hibridizan a una secuencia de nucleótido complementaria a los nucleótidos 2026 hasta 3765 de la SEQ ID NO:1 bajo condiciones moderadamente estrictas, en donde la secuencia de ADN codifica un polipéptido que produce una respuesta inmune a la proteína HER-2/neu.
- 2Un polipéptido que tiene la secuencia de aminoácidos SEQ ID NO:2 desde lisina, aminoácido 676, hasta valina, aminoácido 1255, o una variante de la misma que produce cuando menos una respuesta inmune equivalente.
- 3Un polipéptido de acuerdo con la reivindicación 2 que tiene la secuencia de aminoácidos de SEQ ID NO:2 desde el aminoácido 676 hasta el aminoácido 1255.
- 4Una composición que comprende un polipéptido de acuerdo con cualquiera de las reivindicaciones 1, 2 o 3, en combinación con un vehículo o diluyente farmacéuticamente aceptable.
- 5Un polipéptido de acuerdo con cualquiera de las reivindicaciones 1, 2 o 3, o una composición de acuerdo con la -8585 reivindicación 4, para la inmunización de un animal de sangre caliente contra una malignidad a la cual se asocia el oncógeno HER-2/neu.
- 6El uso de un polipéptido de acuerdo con cualquiera de las reivindicaciones 1, 2 o 3, o una composición de acuerdo con la reivindicación 4, para la fabricación de un medicamento para la inmunización de un animal de sangre caliente contra una malignidad a la cual se asocia el oncógeno HER-2/neu.
- 7Una molécula de ácido nucleico que dirige la expresión de un polipéptido de acuerdo con cualquiera de las reivindicaciones 1, 2 o 3 para la inmunización mediante la transfección de células de un animal de sangre caliente con la molécula de ácido nucleico.
- 8Una molécula de ácido nucleico de acuerdo con la reivindicación 7 en donde las células se transfectan ex vivo y posteriormente se administran al animal.
- 9El uso de una molécula de ácido nucleico que dirige la expresión de un polipéptido de acuerdo con cualquiera de las reivindicaciones 1, 2 o 3, para la fabricación de un medicamento para la inmunización de un animal de sangre caliente contra una malignidad a la cual se asocia el oncógeno HER-2/neu.
- 10Un vector viral que dirige la expresión de un polipéptido de acuerdo con cualquiera de las reivindicaciones -8686 1, 2 o 3 para la inmunización infectando las células de un animal de sangre caliente con el vector. 11. Un vector viral de acuerdo con la reivindicación 10 en donde las células se infectan ex vivo y 5 posteriormente se administran al animal. 12 . El uso de un vector viral que dirige la expresión de un polipéptido de acuerdo con cualquiera de las reivindicaciones 1, 2 o 3, para la fabricación de un medicamento para la inmunización de un animal de sangre 10 caliente contra una malignidad a la cual se asocia el oncógeno HER-2/neu. -8787
Independent claims10
643 paragraphs in 11 sections, as filed
(74) Agent: SHARKEY, Richard, G. et ai .; Seed and Berry LLP, 6300 Columbia Center, 701 Fifth Avenuc, Seattle, WA 98KM-7092 (US).
Published
WítA international tearch repon.
Befare the expirarían of the time lintit for amending the claims and to be republithed in the event of the receipt of amendments.
(54) Tille: INTRACELLULAR DOMAIN OF THE HER-2 / NEU PROTEIN FOR PREVENTION OR TREATMENT OF MALIGNANCIES (57) Abstract!
<td>Compounds and compoairitmi for</td><td> 800-</td>
<td rowspan="5">eliciting or enhancing immune reactivity to HER-2 / new protein ate disclosed. The cotnpoundj inúnde polypeptides and nucleic acid motecutes encoding such pepüdes. The compounds may be used for the preventíon or treatment of malignárteles In which the HER-2 / neu oncogene ii uaociated.</td><td> 700-</td>
<td></td>
<td> 600-</td>
<td></td>
<td> 500-</td>
<td><sup>8</sup></td><td> 400-</td>
<td></td><td> 300-</td>
<td></td><td>200- ioo-L</td>
<img file="MX9707501A_D0001.tif" />
Antigen
372
-1 INTRACELLULAR DOMAIN OF HER-2 / NEU PROTEIN FOR THE PREVENTION OR TREATMENT OF MALIGNANCES
Technical field
The present invention generally targets polypeptides, and nucleic acid molecules encoding these polypeptides, to elicit or enhance an immune response to the HER-2 / neu protein, which is included for use in the treatment of malignancies. which is associated with the HER-2 / neu oncogene.
Background of the Invention
Despite numerous investments of financial and human resources, cancer remains a leading cause of death. For example, cancer is the leading cause of death in women between the ages of 35-74. Breast cancer is the most common malignancy in women, and the incidence of developing breast cancer is increasing. One in nine women will be diagnosed with the disease. The standard approaches to curing breast cancer have focused their attention around a combination of surgery, radiation, and chemotherapy. These forms of approximation have resulted in notable successes in certain malignancies. However, these forms of approach have not been successful in all malignancies and breast cancer is more often incurable when trying to treat beyond a certain stage. Alternative approaches to prevention and therapy are needed.
A common feature of malignancies is uncontrolled cell growth. Cancer cells appear to have undergone a process of transformation from normal phenotype to malignant phenotype capable of autonomous growth. Somatic cell gene amplification and overexpression is considered to be a common primary event that results in the transformation of normal cells into malignant cells. The malignant phenotypic characteristics encoded by the oncogenic genes are passed during cell division to the progeny of the transformed cells.
Ongoing research involving oncogens has identified at least forty oncogens operative in malignant cells responsible for, or associated with, transformation. Oncogens have been classified into different groups based on the putative function or location of their gene products (such as the protein expressed by the oncogen).
Oncogens are believed to be essential to certain aspects of normal cellular physiology. In this regard, the HER-2 / neu oncogen is a member of the tyrosine protein kinase family of oncogens and shares a high
-3 degree of homology with the epidermal growth factor receptor. HER-2 / neu presumably plays a role in cell growth and / or differentiation. HER-2 / neu appears to induce malignancies through quantitative mechanisms that result from increased or dysregulated expression of an essentially normal gene product.
HER-2 / neu (pl85) is the protein product of the HER-2 / neu oncogene. The HER-2 / neu gene is amplified and the HER-2 / neu protein is overexpressed in a variety of cancers including breast, ovarian, colon, lung, and prostate cancer. HER-2 / neu is related to malignant transformation. It is found in 50 to 60 percent of ductal carcinoma in si tu and in 2 0. 40 percent of all breast cancers, as well as a substantial fraction of adenocarcinomas that arise in the ovaries, prostate, colon, and lung. HER-2 / neu is closely associated not only with the malignant phenotype, but also with the aggressiveness of the malignancy, being found in a quarter of all invasive breast cancers. HER-2 / neu overexpression is correlated with a poor prognosis in both breast and ovarian cancer. HER-2 / neu is a transmembrane protein with a relative molecular mass of 185 kd that is approximately 1255 amino acids (aa) in length. It has an extracellular binding domain (ECD) of approximately 645 amino acids, with 40 percent
-4homology with the epidermal growth factor receptor (EGFR), a highly hydrophobic transmembrane anchoring domain (TMD), and a carboxyterminal cytoplasmic domain (CD) of approximately 580 amino acids with 80 percent homology to EGFR.
Due to difficulties in current approaches to the therapy of cancers in which the HER-2 / neu oncogen is associated, there is a need in the art for improved compounds and compositions. The present invention meets this need, and also provides other related advantages.
Summary of the invention
Briefly stated, the present invention provides polypeptides, nucleic acid molecules (that direct the expression of those polypeptides) and viral vectors (that direct the expression of those polypeptides) to be used for immunization, or the manufacture of a drug for immunization, of a warm-blooded animal against a malignancy to which the HER-2 / neu oncogen is associated. A polypeptide or nucleic acid molecule, according to this invention, can be present in a composition that includes a pharmaceutically acceptable carrier or diluent. That polypeptide, nucleic acid molecule, viral vector, or pharmaceutical composition can be used for immunization in
-5one-time basis (eg, when a malignancy is suspected) or on a periodic basis (eg, for an individual at high risk of acquiring or reacquiring a malignancy). An immunization medication may be useful in treating an existing tumor or to prevent the occurrence or recurrence of the tumor.
In one embodiment, the present invention provides a polypeptide encoded by a DNA sequence selected from: (a) rtucleotides 2026 to 3765 of SEQ ID NO: 1; and (b) DNA sequences that hybridize to a complementary nucleotide sequence from 2026 to 3765 of SEQ ID NO: 1 under moderately stringent conditions, where the DNA encodes a polypeptide that produces an immune response against the HER-protein. 2 / neu. In a preferred embodiment, a polypeptide has the amino acid sequence of SEQ ID NO: 2 from lysine, amino acid 676, to valine, amino acid 1255, or a variant thereof that produces at least an equivalent immune response. A composition is provided comprising a polypeptide of the present invention in combination with a pharmaceutically acceptable carrier or diluent.
In another embodiment, a polypeptide or composition of the present invention is provided for immunizing a warm-blooded animal against a malignancy to which the HER-2 / neu oncogene is associated. In another modality,
-6this polypeptide or composition is used for the manufacture of a medicament for the immunization of a warm-blooded animal against a malignancy to which the HER-2 / neu oncogen is associated.
In another embodiment, a nucleic acid molecule is provided that drives expression of a polypeptide according to the present invention, for immunization by transfecting the cells of a warm-blooded animal with the nucleic acid molecule. In another embodiment, that nucleic acid molecule is used in the manufacture of a medicament for the immunization of a warm-blooded animal against the malignancy to which the HER-2 / neu oncogen is associated.
In another embodiment, a viral vector that directs the expression of a polypeptide according to the present invention is provided for immunization by infection of the cells of a warm-blooded animal with the vector. In another embodiment, that viral vector is used for the manufacture of a medicament for the immunization of a warm-blooded animal against a malignancy in which the HER2 / neu oncogen is associated.
These and other aspects of the present invention will become apparent upon reference to the following detailed description and accompanying drawings.
Brief Description of Drawings
-7 Figure 1 shows the results of priming the native T lymphocytes with respect to the HER-2 / neu polypeptide by dendritic cells. Dendritic cells derived from bone marrow were generated with GM-CSF, and IL6 from CD34 + stem cells. Dendritic cells driven with the HER-2 / neu polypeptide induce specific proliferation of CD4 + / CD45RA + T autologous lymphocyte proteins after 7 days of culturing T cells with dendritic cells. CD34 + stem cells derived from bone marrow cultured for one week in serum-free medium containing GM-CSF and IL-6 were used as APCs. APCs were plated into 96 round-bottom trays (Corning, Corning, NY, United States of America). at various concentrations and incubated for 16-18 hours with 20-25 gg / milliliter of recombinant HER-2 / neu polypeptide. CD4 + T lymphocytes were isolated from peripheral blood mononuclear cells by positive selection using immunoaffinity columns (CellPro, Inc., Brothwell, WA, United States of North America). APC driven by antigen was irradiated {10 Gy) and CD4 + T lymphocytes were added in 10<sup>5</sup> per well. The proliferative response of T cells was measured by uptake of (<sup>3</sup>H) thymidine (ΐμΟί / ροζο) added on day 7 for 16-18 hours. Proliferation assays were performed in serum-free and cytokine-free medium in 5 well replicates.
-8The symbols represent: - · - DC + HER-2 / neu + CD4 + / CD45RA + T cell polypeptide; —OR— DC + CD4 + / CD45RA + T cells; and - □ - DC + HER-2 / neu polypeptide.
Figure 2 shows the response of CD4 + cells to the HER-2 / neu polypeptide. Using the priming assay described for Figure 1, CD4 + T cells from normal donors were tested to see their responses to the recombinant human HER-2 / neu polypeptide. The symbols represent —— SC + CD4; and ---- ♦ ---- SC + CD4 + HER-2 / neu polypeptide. SC is stem cells.
Figure 3 shows that rats immunized with rat HER-2 / neu polypeptide developed neu-specific antibodies. Rats were immunized with 25gg of recombinant rat HER-2 / neu polypeptide in MPL or Vaccel's adjuvant. Three immunizations were given, each separated 20 days. Twenty days after final immunization rats were assessed for their antibody responses to rat neu. Animals immunized with the HER2 / neu polypeptide and Vaccel's adjuvant showed high specific responses to rat neu dosage, the control was an animal immunized with the human HER-2 / neu polypeptide (foreign protein). In separate experiments, rats immunized with 100 gg and 300 gg of purified whole rat neu did not develop detectable neu-specific antibodies (information not shown). The information represents the mean and standard deviation of 3 animals. The symbols represent: —— HER-2 polypeptide / rat neu / MPL; --- · --- HER-2 polypeptide / rat neu / Vaccel; ---- MPL alone, ---- O --- Vaccel alone; And control.
MPL and Vaccel are adjuvants (Ribi, Bozeman, MT, USA). Neu is the HER-2 / neu protein.
Figure 4 shows that breast cancer patients have a previously existing immunity to the HER-2 / neu polypeptide. PBMC patients were evaluated by incorporating tritiated thymidine into 24-well replicates. Responding wells are rated greater than the mean and 3 standard deviations (372 cpm) from control wells. This HER-2 / neu from a phase II positive breast cancer patient has a significant response to the recombinant human HER-2 / neu polypeptide. The symbols p represent peptides for the HER-2 / neu protein, tt represents tetanus toxoid, and hHNP represents the recombinant human HER-2 / neu polypeptide.
Detailed description of the invention
Before presenting the invention, it may be useful to understand the invention by presenting definitions of some terms to be used hereinafter.
HER-2 / neu polypeptide - as used herein, refers to a portion of the HER-2 / neu protein
-1010 (the protein also known as pl85 or c-erbB2) having the amino acid sequence of SEQ ID NO: 2 from lysine, amino acid 676, to valine, amino acid 1255; and can be naturally derived, synthetically produced, genetically engineered, or a functionally equivalent variant thereof, for example, wherein one or more amino acids are replaced by other amino acids or non-amino acids which does not substantially affect the obtaining or improvement of an immune response with respect to the HER-2 / neu protein (eg, the variant stimulates a response by helper T cells or cytotoxic T cells).
T-cell proliferation - as used herein, includes T-cell multiplication as well as T-cell stimulation leading to multiplication, that is, initiation of events leading to mitosis and mitosis In herself. Methods for detecting proliferation of T cells are discussed below.
As noted above, the present invention is directed toward compounds and compositions to obtain or enhance immunity to the protein product expressed by the HER-2 / neu oncogen, including malignancies in a warm-blooded animal where the HER-2 gene / amplified neu is associated with malignancies. Association of an amplified HER-2 / neu gene with a malignancy does not require
-1111 that the gene protein expression product is present in the tumor, For example, overexpression of the protein expression product may be involved with tumor initiation, but protein expression may have been subsequently lost . One use of the present invention is to obtain or enhance an effective indigenous immune response to convert a HER-2 / neu positive tumor to a HER-2 / neu negative tumor.
More specifically, the description of the present invention, in one aspect, shows that a polypeptide based on a particular portion (HER-2 / neu polypeptide) of the HER-2 / neu gene protein expression product can be recognized by thymus-dependent lymphocytes (hereinafter called T cells), and thus the autochthonous immune T cell response can be used prophylactically or to treat malignancies in which such a protein is overexpressed, or has been overexpressed. The description of the present invention also shows, in another aspect, that the nucleic acid molecules that drive the expression of that peptide can be used alone or in a viral vector for immunization.
In general, CD4 + T cell populations are considered to function as helpers / inducers through the release of lymphokines when stimulated by a specific antigen; however a subset of cells
-1212
CD4 + can act as cytotoxic T lymphocytes (CTL). Similarly, CD8 + T cells are considered to function by directly lysing antigenic targets; however, within a variety of circumstances these may secrete lymphokines to provide support or DTH function. Despite the potential for overlapping function, CD4 and CD8 phenotypic markers are linked to recognition of peptides bound to MHC class II or class I antigens. Antigen recognition in the context of class II or class I mandates that CE4 + or CD8 + T cells respond to different antigens or to the same antigen presented under different circumstances. The binding of immunogenic peptides to MHC class II antigens occurs most commonly for antigens ingested by antigen presenting cells. Therefore, CD4 + T cells generally recognize antigens that have been external to tumor cells. In contrast, under normal circumstances, binding of peptides to MHC class I occurs only for proteins present in the cytosol and synthesized by the target itself, proteins in the external environment are excluded. An exception to this is the binding of exogenous peptides with a precise class I binding motif that are present outside the cell in high concentration. Thus, CD4 + and CD8 + T cells have widely different functions and tend to recognize different antigens as one
-1313 reflection of where antigens normally reside.
As described within the present invention, a polypeptide portion of the protein product expressed by the HER-2 / neu oncogene is recognized by T Cells. The circulating HER-2 / neu polypeptide is degraded into peptide fragments. Peptide fragments from the polypeptide bind to the most complex histocompatibility antigens (MHC). By deploying a peptide binding to an MHC antigen on the cell surface and recognizing by host T cells the combination of the peptide plus the MHC antigen itself, the HER-2 / neu polypeptide (including that expressed in a malignant cell) will be immunogenic to T cells. The exquisite specificity of the T cell receptor enables individual T cells to discriminate between peptides that differ by a single amino acid residue.
During the immune response to a peptide fragment from the polypeptide, T cells that express a T cell receptor with high binding affinity for the peptide-MHC complex will bind to the MHC peptide complex and are therefore activated and induced to proliferate. At the first encounter with a peptide, small numbers of immune T cells will secrete lymphokines, proliferate, and differentiate within the effector and memory of T cells. The primary immune response will occur in vivo but has been difficult to
-1414 detect in vitro. The subsequent encounter with the same antigen through T cell memory will lead to a faster and more intense immune response. The secondary response will occur either in vivo or in vitro. The in vitro response is easily calibrated by measuring the grade. of proliferation, the degree of cytokine production, or the generation of cytolytic activity of the T cell population re-exposed to the antigen. Substantial proliferation of the T cell population in response to a particular antigen is considered to be indicative of previous antigen exposure or priming.
The compounds of this invention generally comprise HER-2 / neu polypeptides or DNA molecules that direct the expression of those peptides, where the DNA molecules can be present in a viral vector. As noted above, the polypeptides of the present invention include variants of the polypeptide of SEQ ID NO: 2 from amino acid 676 to amino acid 1255, which retain the ability to stimulate an immune response. Those variants include various structural forms of the native polypeptide. Due to the presence of ionizable amino and carboxyl groups, for example, a HER-2 / neu polypeptide may be in the form of an acidic or basic salt, or it may be in a neutral form. Individual amino acid residues can also be modified by oxidation or reduction.
-1515
Variants within the scope of this invention also include polypeptides in which the native HER-2 / neu polypeptide of primary amino acid structure is modified by forming covalent or aggregative conjugates with other peptides or polypeptides, or chemical fractions such as glycosyl groups, lipids, phosphate, acetyl groups and the like. Covalent derivatives can be prepared, for example, by linking particular functional groups to amino acid side chains or 'at the N- or C- termini.
The present invention also includes HER-2 / neu polypeptides with or without glycosylation. Polypeptides expressed in yeast or in mammalian expression systems may be similar or slightly different in molecular weight and in the glycosylation pattern than native molecules, depending on the expression system. For example, expression of DNA encoding polypeptides in bacteria such as E. coli typically provides non-glycosylated molecules. The N-glycosylation sites of eukaryotic proteins are characterized by the amino acid triplet Asn-ALZ, where A<sub>x</sub> is any amino acid except Pro, and Z is Ser or Thr. Variants of HER-2 / neu polypeptides that have inactivated N-glycosylation sites can be produced by techniques known to those skilled in the art, such as oligonucleotide synthesis and ligation or site-specific mutagenesis techniques, and are within the scope of scope of
-1616 this invention. Alternatively, the N-linked glycosylation sites can be added to the HER-2 / neu polypeptide.
The polypeptides of this invention also include polypeptide variants of SEQ ID NO: 2 (i.e., variants of a polypeptide having the amino acid sequence of SEQ ID NO: 2 from amino acid 676 to amino acid 1255) which have a sequence amino acid different from this sequence due to one or more deletions, insertions, substitutions or other modifications. In one embodiment, these variants are substantially homologous to the native HER-2 / neu polypeptide and retain the ability to stimulate an immune response. Substantial homology as used herein refers to amino acid sequences that can be encoded by DNA sequences that are capable of hybridizing under moderately stringent conditions, a nucleotide sequence complementary to a naturally occurring DNA sequence that encodes the portion of the polypeptide of SEQ ID NO: 2 specified herein (ie, nucleotides 2026 through 3765 of SEQ ID NO: 1). Suitable moderately stringent conditions include prewash in a solution of 5 x SSC, 0.5 percent SDS, 1.0mM EDTA (pH 8.0); hybridization at 50 ° C-65 ° C, 5 x SSC, overnight; followed by a double wash at 65 ° C for 20 minutes with each of 2x, 0.5x and 0.2x SSC (containing 0.1 percent SDS). Those hybridization DNA sequences
-1717 are also within the scope of this invention. The effect of any of these modifications on the ability of the HER-2 / neu polypeptide to elicit an immune response can be readily determined (eg, by analyzing the ability of the mutated HER2 / neu polypeptide to induce a T cell response using, eg, the methods described here).
Generally, amino acid substitutions can be made in a variety of ways to provide other variant embodiments within the present invention. First, for example, amino acid substitutions can be made conservatively; that is, a substitute amino acid replaces an amino acid that has similar properties, as one skilled in the art of peptide chemistry would expect the hydropathic nature of the secondary structure of the polypeptide to be substantially unchanged. In general, the following groups of amino acids represent conservative changes (1) ala, pro, gly, glu, asp, gln, asn, ser, thr; (2) cys, ser, tyr, thr, · (3) val, ile, leu, met, ala, phe; (4) lys, arg, his, · and (5) phe, tyr, trp, his. An example of a non-conservative change is replacing an amino acid from one group with an amino acid from another group.
Another way to make amino acid substitutions to produce variants of the present invention is
-1818 identify and replace amino acids in T-cell motifs with the potential to bind to MHC class II molecules (for CD4 + T cell response) or MHC class I molecules (for CD8 + T cell response). Peptide segments (from an HER-2 / neu polypeptide) with a motif with theoretical potential to bind to MHC class II molecules can be identified by computer analysis. For example, a protein sequence analysis package, T Sites, can be used that incorporates various computer algorithms designed to distinguish potential sites for T cell recognition (Feller and de la Cruz, Nature 349: 720-721, 1991 ). Two search algorithms are used: (1) the AMPHI algorithm described by Margalit (Feller and de la Cruz, Nature 349: 720-721, 1991; Margalit et al., J, Immunol. 138: 2213-2229, 1987) identifies motifs epitope according to alpha-helical periodicity and amphipathicity; (2) Rothbard and Taylor's algorithm identifies epitope motifs according to the pattern of charge and polarity (Rothbard and Taylor, EMBO 7: 93-100, 1988). Segments with both motifs are most appropriate for binding to MHC class II molecules. CD8 + T cells recognize the binding of the peptide to MHC class I molecules. Falk et al. Have determined that peptides that bind to particular MHC molecules share discernible sequence motifs (Falk et al., Nature 351: 290-1919.
296, 1991). A peptide motif for binding to the HLA-A2.1 groove has been defined by Edman as degradation of peptides separated from HLA-A2.1 molecules from a cultured cell line (Table 2, by Falk et al., Supra. ). The method identified the typical or average of the HLA-A2.1 binding peptide being 9 amino acids long with dominant anchor residues occurring at positions 2 (L) and 9 (V). Strong binding residues that commonly occur at positions 2 (M), 4 (E, K), 6 (V), and 8 (K) have been identified. The identified motif represents the average of
<img file="MX9707501A_D0002.tif" />
many HLA-A2.1 restricted ivo binding peptides
<td></td><td>Amino acid position 123456789</td><td>Assignment point</td>
<td>Anchor residue Dominant joint</td><td>LV</td><td> +3</td>
<td>Strong bond residue</td><td>ME VK K</td><td> + 2</td>
<td>Weak Union Residue</td><td>I AGIIAEL LYPKLYS FFDYTH KPTN Μ MG YSV H</td><td> + 1</td>
The motif of the derived peptide as currently defined is not particularly strict. Some HLA-A2.1 binding peptides do not contain both dominant anchor residues and the amino acids that flank the residues of
-2020 dominant anchors play important roles in allowing or preventing bonding. Not all peptides with the binding motif described now will bind, and some peptides without the motif will bind. However, the current motif is valid enough to allow the identification of some peptides capable of binding. Of note, the current HLA-A2.1 motif places 6 amino acids between the dominant anchor amino acids at residues 2 and 9.
Following the identification of the peptide motifs within an HER-2 / neu polypeptide, amino acid substitutions can be made conservatively or non-conservatively. The latter type of substitutions attempts to produce a polypeptide that is more potent and / or more widely cross-reactive (MHC polymorphism). An example of a more powerful polypeptide is one that binds with greater affinity to the same MHC molecule as the natural polypeptide, without affecting recognition by T cells specific for the natural polypeptide. An example of a polypeptide with broader cross-reactivity is one that more broadly induces cross-reactive immune responses (ie, binds to a greater range of MHC molecules) than the native polypeptide. Similarly, one or more amino acids that reside between peptide motifs and that have a spacer function (eg, do not interact with the MHC molecule or T-cell receptor) can be substituted
-2121 conservatively or non-conservatively. It will be apparent to those skilled in the art that polypeptides containing one or more amino acid substitutions can be tested for their beneficial or adverse immunological interactions by a variety of assays, including those described herein for the ability to stimulate recognition of T cells.
Variants within the scope of this invention may also, or alternatively, contain other modifications, including the deletion or addition of amino acids, that have minimal influence on the immunological properties of the polypeptide. Those skilled in the art will appreciate that non-native truncated or extended forms of a HER-2 / neu polypeptide can be used, provided that the desired immunological properties are at least roughly equivalent to those of the HER-2 / polypeptide. full-length native neu. Cysteine residues can be deleted or replaced with other amino acids to avoid the formation of incorrect intramolecular disulfide bridges during renaturation. Other forms of approach to mutagenesis involve modifications of adjacent dibasic amino acid residues to enhance expression in yeast systems in which KEX2 protease activity is present.
A HER-2 / neu polypeptide can generally be
-2222 obtained using a genomic or cDNA clone that encodes the protein. A genomic sequence encoding the total length of HER-2 / neu is shown in SEQ ID N0: 1, and the deduced amino acid sequence is presented in SEQ ID NO: 2. Those clones can be isolated by filtering an appropriate expression library for clones expressing the HER-2 / neu protein. Library and filter preparation can generally be performed using methods known to those skilled in the art, such as the methods described in Sambrook et al. Molecular Cloning: A Laboratory Manual, Coid Spring Harbor Laboratories. Coid Spring Harbor, NY, 1989, which is incorporated herein by reference. Briefly, a bacteriophage expression library can be plated and transferred to filters. Filters can then be incubated with a detection reagent. In the context of this invention, a detection reagent is any compound capable of binding to the HER2 / neu protein, which can then be detected by any of a variety of means known to those skilled in the art. Typical detection reagents contain a binding agent, such as Protein A, Protein G, IgG, or a lee, coupled to a reporter group. Preferred reporter groups include enzymes, dyes, radionuclides, luminescent groups, fluorescent groups, and biotin. More preferably, the reporter group is horseradish peroxidase
-2323 pungent, which can be detected by incubation with a substrate such as tetramethylbenzidine or 2,2'-azino-di-3-ethylbenzitiazolinsulfonic acid. Plates containing genomic or cDNA sequences expressing the HER2 / neu protein are isolated and purified by techniques known to those skilled in the art. Appropriate methods can be found, for example, in Sambrook et al., Molecular Cloningí A Laboratory Manual, Coid Spring Harbor Laboratories. Coid Spring Harbor, NY, 1989.
Variants of the polypeptide that retain the ability to stimulate an immune response can generally be identified by modifying the sequence in one or more of the aspects described above and testing the resulting polypeptide for its ability to stimulate an immune response, e.g. gr., a T cell response. For example, such assays can generally be performed by contacting T cells with the modified polypeptide and testing the response. Naturally occurring variants of the polypeptide can also be isolated, for example, by filtering a genomic or cDNA library with a DNA sequence encoding the polypeptide or a variant thereof.
The sequence modifications described above can be introduced using standard recombination techniques or by automated synthesis of the modified polypeptide. For example, you can enter
-2424 mutations at particular sites by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites that make it possible to ligate with fragments of the native sequence. Following the link, the resulting reconstructed sequence encodes an analog. Having the desired amino acid insertion, substitution, or deletion.
Alternatively, site-specific mutagenesis procedures can be employed to provide a gene in which particular codons are altered according to the required substitution, deletion, or insertion. Example methods for making the alterations presented above are described in Walder et al., Gene 42: 133, 1986; Bauer et al., Gene 37:73, 1985, Craik, EioTechniques, January 1985, 12-19; Smith et al., Genetic Engineering: Principles and Methods, Plenum Press, 1981; and United States Patents Numbers: 4,518,584 or 4,737,462.
Mutations in nucleotide sequences constructed for expression of HER-2 / neu polypeptides should, of course, preserve the reading frame of the coding sequences and preferably will not create complementary regions that can hybridize to produce secondary mRNA structures. , such as cycles, or hairpins, that would adversely affect the translation
-2525 of the mRNA. Although a mutation site can be pre-determined, the nature of the mutation itself does not need to be pre-determined. For example, in order to select according to the optimal characteristics of mutants at a given site, random mutagenesis can be conducted at the target codon and HER2 / neu polypeptide mutants filtered for the desired activity.
Not all mutations in a nucleotide sequence encoding a HER-2 / neu polypeptide will be expressed in the final product. For example, nucleotide substitutions can be made to enhance expression, rather than to eliminate secondary structure cycling in the transcribed mRNA (see, for example, European Patent Application 75,444A), or to provide codons that are translate faster by the selected host, such as the well-known E-codons. col i preferably for the expression of E. coli.
The polypeptides of the present invention, both naturally occurring and modified, are preferably produced by recombinant DNA methods. Those methods include inserting a DNA sequence that encodes a HER-2 / neu polypeptide into a recombinant expression vector and that expresses the DNA sequence in a microbe, mammalian or insect cell recombinant expression system under conditions that promote The expression. The
-2626 DNA sequences encoding the polypeptides provided by this invention can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene that is capable of being inserted into a vector of recombinant expression and expressed in a recombinant transcription unit.
Recombinant expression vectors contain a DNA sequence encoding an HER-2 / neu polypeptide functionally linked to transcriptional or translational regulatory elements derived from mammalian, microbe, virus, or insect genes. Those regulatory elements include a transcription promoter, an optional operator sequence for transcription control, a suitable ribosomal mRNA that encodes the sequence linking sites, and sequences that control the termination of transcription and translation. Additionally, a replica origin and a selectable marker can be incorporated to facilitate the recognition of the transformers.
DNA regions are operably linked when functionally related to each other. For example, DNA for a signal peptide (secretory forward) is operably linked to DNA for a polypeptide if it is expressed as a precursor that participates in secretion of the polypeptide; a promoter is linked in a way
-2727 operable to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if positioned so as to allow translation. Generally, operably linked means contiguous and, in the case of front secretaries, in reading box. The DNA sequences encoding the HER-2 / neu polypeptides to be expressed in a microorganism will preferably not contain introns that can prematurely terminate DNA transcription in the mRNA.
Expression vectors for use in bacteria can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Those commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, WI, United States of North America). These "structure sections" are combined with an appropriate promoter and the structural sequence to be expressed. E. coli is typically transformed using derivatives of pBR322, a plasmid derived from an E species, coli (Bolívar et al., Gene 2:95, 1977). PBR322 contains genes for ampicillin and tetracycline resistance and thus provides simple means to identify cells
-2828 transformed.
Promoters commonly used for recombinant microbial expression vectors include B-lactamase (penicillinase) and the lactose promoter system (Chang et al., Nature 281: 544, 1979), the tryptophan (trp) promoter system (Goeddel et al. , Nucí, Acids Res 8: 4057, 1980 and European Patent Application 36,766) and the tac promoter (Maniatis, Molecular Cloning: A Laboratory Manual, Coid Spring Harbor Laboratory, p. 412, 1982). A particularly useful bacterial expression system employs the P promoter.<sub>L</sub> of the phage λ the thermolabile repressor cl857ts. Vectors available from the American Type Culture Collection incorporating P promoter derivatives<sub>L</sub> λ includes the plasmid pHUB2, resident in E. coli, strain JMB9 (ATCC 37092) and pPLc28, resident in E, coli RR1 (ATCC 53082).
Suitable promoter sequences in yeast vectors include promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol, Chem. 255: 2073, 1980) or other glycolytic enzymes (Hess et al., J. Adv, Enzyme Reg, 7: 149, 1968; and Holland et al., Biochem. 17: 4900, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase,
-2929 glucokinase. Vectors and promoters suitable for use in yeast expression are further described in R. Hitzeman et al., European Patent Application 73,657.
Preferred yeast vectors can be assembled using DNA sequences from pBR322 for selection and replication in E. coli (Gen Amp<sup>r</sup> and origin of replication) and yeast DNA sequences including the glucose repressing ADH2 promoter and a secretory leader of factor a. The ADH2 promoter has been described by Russell et al. (J. Biol. Chem. 258: 2674, 1982) and Beier et al. (Nature 300: 724, 1982). The factor a leader, which directs secretion of heterologous proteins, can be inserted between the promoter and the structural gene to be expressed (see v. gr., Kurjan et al., Cell 30: 933, 1982; and Bitter et al., Proc. Nati, Acad. Sci. United States of America 81: 5330, 1984). The front sequence can be modified to contain, near its 3 'end, one or more useful restriction sites to facilitate fusion of the front sequence with the foreign genes. The transcription and translation control sequences in expression vectors to be used to transform vertebrate cells must be provided by viral sources. For example, commonly used promoters and enhancers are derived from polyoma, adenovirus 2, simian virus 40 (SV40), and human cytomegalovirus. DNA sequences derived from
-3030 SV40 viral genome, eg, SV40 early and late promoter origin, enhancer, cleavage and polyadenylation sites can be used to provide the other genetic elements required for expression of a heterologous DNA sequence. The early and late promoters are particularly useful because both are readily obtained from the virus as a fragment that also contains the SV40 origin of viral replication (Fiers et al., Nature 273: 113, 1978). Smaller or larger SV40 fragments can also be used, provided that the sequence of the approximately 250 base pairs extending from the HindIII site to the Bgl II site located at the viral origin of replication is included. Furthermore, the viral genomic promoter, signal and / or control sequences can be used provided that those control sequences are compatible with the chosen host cell. Exemplary vectors can be constructed as described in Okayama and Berg, Mol. Cell. Biol. 3: 280, 1983.
A useful system for expression at a stable high level of mammalian receptor cDNAs in murine C127 mammary epithelial cells can be constructed substantially as described by Cosman et al. (Mol. Imuno 1. 23: 935, 1986). A preferred eukaryotic vector for expression of LbeIF4A protein DNA is pDC406 (McMahan et al., EMBO J. 10: 2821, 1991), and includes sequences
-3131 regulators derived from SV40, human immunodeficiency virus (HIV), and Epstein-Barr virus (EBV). Other preferred vectors include pDC409 and pDC410, which are derived from pDC406. PDC410 was derived from pDC406 by replacing the EBV origin of replication with sequences encoding the SV40 large T antigen. PDC409 differs from pDC406 in that a Bgl II restriction site outside the multiple cloning site has been deleted, making the Bgl II site within the multiple cloning site unique.
A useful cell line that allows episomal replication of expression vectors, such as pDC406 and pDC409, which contains the origin of replication for EBV, is CV-1 / EBNA (ATCC CRL 10478). The CV-L / EBNA cell line was derived by transfection of the CV-1 cell line with a gene encoding the Epstein-Barr virus nuclear nuclear antigen (EBNA1) and constitutively expressing EBNA-1 directed from the immediate enhancer / promoter anterior human CMV.
Transformed host cells are cells that have been transformed or transfected with expression vectors constructed using recombinant DNA techniques and which contain sequences encoding an HER-2 / neu polypeptide of the present invention. Transformed host cells can express the desired HER-2 / neu polypeptide, but transformed host cells for cloning or amplification of HER-2 / neu DNA need not express the
-3232 HER-2 / neu polypeptide. The expressed polypeptides are preferably secreted into the culture supernatant, depending on the selected DNA, but can also be deposited on the cell membrane.
Suitable host cells for expression of recombinant proteins include prokaryotes, yeast, or higher eukaryotic cells under the control of suitable promoters. Prokaryotes include gram negative or gram positive organisms, for example E<sub>r</sub> coli or Bacilli. Higher eukaryotic cells include established cell lines of insect or mammalian origin as described below. Cell-free translation systems could also be used to produce HER-2 / neu polypeptides using RNA derived from DNA constructs. Expression and cloning vectors suitable for use with bacterial, fungal, yeast, and mammalian cellular hosts are described, for example, by Pouwels et al., Cloning Vectors: A Laboratory Manual, Elsevier, New York. 1985.
Prokaryotic expression hosts can be used for the expression of HER-2 / neu polypeptides that do not require proteolytic processing and extensive disulfide. Prokaryotic expression vectors generally comprise one or more selectable phenotypic markers, for example proteins that encode a gene conferring resistance to the antibiotic or supplying a requirement
-3333 autotrophic, and a host-recognized origin of replication to ensure amplification within the host. Convenient prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium, and various species within the genera Pseudomonas, Streptomyces, and Staphilococcus, although other hosts may also be employed.
Recombinant HER-2 / neu polypeptides can also be expressed in yeast hosts, preferably from the Saccharomyces species, such as S. cerevisiae. Yeasts from other genera, such as Picbia or Kluyveromyces, can also be used. Yeast vectors will generally contain an origin of replication from the 2μ yeast plasmid or an autonomous replication sequence (ARS), a promoter, DNA encoding the HER-2 / neu polypeptide, sequences for polyadenylation and transcription termination and a selection gene. Preferably, the yeast vectors will include a selectable marker and origin of replication that allows transformation of both yeast and E. coli, for example, the E. coli ampicillin resistance gene and the trpl S. cerevisiae gene, which provides a selection marker for a mimic strain of yeast that lacks the ability to grow in tryptophan, and a promoter derived from a highly expressed yeast gene to induce transcription of
-3434 a downstream structural sequence. The presence of the trpl lesion in the yeast host cell genome then provides an effective environment to detect growth transformation in the absence of tryptophan.
Convenient yeast transformation protocols are known to those of skill in the art. An exemplary technique described by Hind et al. (Proc. Nati. Acad. Sci. USA 75: 1929, 1978), involves selecting Trp transformants<sup>+</sup> in a selective medium consisting of 0.67 percent yeast nitrogen base, 0.5 percent casamino acids, 2 percent glucose, 10 milligrams / milliliter of adenine and 20 milligrams / milliliter of uracil. Vector transformed host strains comprising the ADH2 promoter can be grown for expression in a rich medium consisting of 1 percent yeast extract, 2 percent peptone, and 1 percent glucose supplemented with 80 milligrams / milliliter of adenine and 80 milligrams / milliliter of uracil. Depressure of the ADH2 promoter occurs after termination of glucose in the medium. Raw yeast supernatants are harvested by filtration and kept at 4 ° C before further purification.
Various mammalian or insect cell culture systems (eg, Spodoptera or Trichoplusia) can also be employed to express recombinant polypeptide. The
-3535 Baculovirus systems for the production of heterologous polypeptides in insect cells, are reviewed, for example in Luckow and Summers, Bio / Technology 6:47, 1988. Examples of suitable mammalian host cell lines include monkey kidney cell COS-7 lines, described by Gluzman (Ce22 23: 175, 1981), and other cell lines capable of expressing a suitable vector including, for example, CV1 / EBNA (ATCC CRL 10478), L cells, 0127, 3T3, Chinese Hamster Ovary (CHO) cell lines, COS, NS-1, HeLa, and BHK. Mammalian expression vectors can comprise non-transcribed elements such as an origin of replication, a convenient promoter and enhancer linked to the gene to be expressed, and other 5 'or 3' flanked non-transcribed sequences, and 5 'untranslated sequences. or 3 ', such as required ribosome binding sites, a polyadenylation site, donor and acceptor junction sites, and transcription termination sequences.
Purified HER-2 / neu polypeptides can be prepared by cultivating convenient host / vector systems to express the recombinant translation products of the DNAs of the present invention, which are then purified from the culture medium or cell extracts. For example, supernatants from systems that secrete recombinant polypeptide into a culture medium can first be concentrated using a protein concentration filter
-3636 commercially available, as an Amicon or Millipore Pellicon ultrafiltration unit. After the concentration step, the concentrate can be applied to a convenient purification matrix. For example, a convenient affinity matrix may comprise a protein of counting structure (i.e., a protein for which a HER-2 / neu polypeptide binds in a specific structure-based interaction) or lectin or antibody molecule bound to a convenient support. Alternatively, an anion exchange resin can be employed, for example a matrix or substrate having pendant diethylaminoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose, or other types commonly used in protein purification. Alternatively, a cation exchange step can be employed. Convenient cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred. Gel filtration chromatography also provides a means of purifying a HER-2 / neu.
Affinity chromatography is a preferred method of purifying HER-2 / neu polypeptides. For example, monoclonal antibodies against the HER-2 / neu polypeptide may also be useful in affinity chromatographic purification, using methods that are well known in the art.
-3737
Finally, one or more reverse phase high performance liquid chromatography (RPHPLC) steps employing RP-HPLC hydrophobic medium (eg, silica gel having methyl pendant or other aliphatic groups) can be employed to further purify a polypeptide composition HER-2 / neu. Some or all of the above purification steps, in different combinations, can also be used to provide a homogeneous recombinant polypeptide.
The recombinant HER-2 / neu polypeptide produced in bacterial culture is preferably isolated by the initial extraction of cell agglomeration, followed by one or more steps of concentrations, salting, aqueous ion exchange or size exclusion chromatography. High performance liquid chromatography (HPLC) can be used for the final purification steps. Microbial cells employed in the expression of a recombinant LbeIF4A protein can be disrupted by any convenient method, including freeze-thaw cycle, Bonus, mechanical disruption, or use of cell separation agents.
Fermentation of yeast that expresses the HER-2 / neu polypeptide as a secreted protein greatly simplifies purification. The secreted recombinant protein resulting from large-scale fermentation can be
-3838 purify by methods analogous to those described by Urdal et al. (J. Chromatog. 269: 111, 1984). This reference describes two sequential steps of reverse phase high performance liquid chromatography for the purification of recombinant human GMCSF on a preparative high performance liquid chromatography column.
Recombinant culture synthesized HER-2 / neu polypeptide preparations may contain non-HER-2 / neu cellular components, including proteins, in amounts and of a character that depends on the purification steps taken to recover the HER-2 / neu polypeptide. of the crop. These components will ordinarily be of yeast, prokaryotic, or non-human eukaryotic origin. These preparations are typically free of other proteins that can normally associate with the HER-2 / neu protein as found in nature in its native species.
Automated synthesis provides an alternative method for preparing polypeptides of this invention. For example, any commercially available solid phase technique can be employed as the Merrifield solid phase synthesis method, in which amino acids are sequentially added to an increasing chain of amino acids. (See Merrifield, J<sub>r</sub> Am. Chem. Soc. 85: 2149-2146, 1963.) Equipment for automated synthesis of polypeptides is commercially available from suppliers such as Applied Biosystems, Inc. of
-3939
Foster City, CA, and can generally be operated according to the manufacturer's instructions.
Within one aspect of the present invention, the use of an HER-2 / neu polypeptide (or a DNA molecule that directs the expression of this peptide) can be detected to elicit an immune response to the HER-2 / neu protein ( including that expressed in a malignancy to which the oncogen HER-2 / neu is associated). Representative examples of these malignancies include breast, ovarian, colon, lung, and prostate cancer. An immune response to the HER-2 / neu protein once generated by an HER-2 / neu polypeptide, can be long-lived and can be detected long after immunization, regardless of whether the protein is present or absent in the body at the time of testing. An immune response
<td colspan="3">to the HER-2 / neu protein</td><td>generated</td><td>by</td><td>reaction to</td><td>a</td>
<td>polypeptide</td><td>HER-2 / neu</td><td>I know</td><td>can</td><td>detect</td><td>examining</td><td>the</td>
<td>presence o</td><td>absence, or</td><td colspan="2">increase of</td><td colspan="2">specific activation</td><td>of</td>
CD4 T cells <sup>+</sup> or CD8<sup>+</sup>. More specifically, T cells isolated from an individual immunized by routine techniques (such as by Ficoll / Hypaque density gradient centrifugation of peripheral blood lymphocytes ) are incubated with HER-2 / neu protein. For example, T cells can be incubated in vitro for 2 to 9 days (typically 4 days) at 37 ° C with HER-2 / neu protein (typically 5 gg / milliliter of complete protein or graduated numbers of cells that
-4040 synthesize the HER-2 / neu protein). It may be desirable to incubate another aliquot of a T cell sample in the absence of HER-2 / neu protein to serve as a control.
Specific activation of CD4 T cells<sup>+</sup> or CD8 <sup>+</sup> It can be detected in various ways. Methods for detecting specific T-cell activation include detecting T-cell proliferation, cytokine production (eg, lymphokines), or generation of cytolytic activity (i.e., generation of cytotoxic T cells specific for the HER-2 protein. / neu). For CD4 + T cells, a preferred method of detecting specific T cell activation is detection of T cell proliferation. For CD8 + T cells, a preferred method of detecting specific T cell activation is detection of the generation of cytolytic activity.
Detection of T cell proliferation can be carried out by a variety of known techniques. For example, T cell proliferation can be detected by measuring the speed of DNA synthesis. T cells that have been stimulated to proliferate exhibit an increasing rate of DNA synthesis. A typical way to measure the rate of DNA synthesis is, for example, by pulse-labeled cultures of T cells with tritiated thymidine, a nucleoside precursor that is incorporated into newly synthesized DNA. The amount of tritiated thymidine
Built-in -4141 can be determined using a liquid centylation spectrophotometer. Other ways to detect T-cell proliferation include measuring increases in interleukin-2 (IL-2) production, Ca flux.<sup>2+</sup>, or dye absorption, such as 3- (4,5-dimethylthiazol-2-yl) -2,5diphenyl-tetrazolium. Alternatively, lymphokine synthesis (such as interferon-gamma) can be measured or the relative number of T cells that can respond to the pl85 protein can be quantified<sup>HER</sup>'<sup>2 / neu</sup> intact.
Through the use or expression of a polypeptide
HER-2 / neu, T cells that recognize the HER-2 / neu protein can proliferate in vivo. For example, a drug for immunization with a HER-2 / neu peptide (i.e., as a vaccine) can induce continued expansion in the number of T cells required for therapeutic attack against a tumor to which the HER-2 oncogen is associated. / neu.
Typically, from about 0.01 gg / kilogram to about 100 milligrams / kilogram of body weight will be administered intradermally, subcutaneously, or intravenously.
A preferred dose is from about 1 gg / to about 1 milligram / kilogram, with from about 5 gg / kg to about 200gg / kg particularly preferred. It will be apparent to those skilled in the art that the number and frequency of administration will depend on the patient's response. It may be desirable
-4242 administer HER-2 / neu polypeptide repeatedly. It will be apparent to those skilled in this art that more than one HER-2 / neu polypeptide can be administered, either simultaneously or sequentially. Preferred peptides for use in a drug for immunization are those that include the amino acid sequence SEQ ID NO: 2 starting at approximately the lysine residue at amino acid position 676 and extending to approximately the valine residue at amino acid position 1255. It will be appreciated by those skilled in the art that the present invention contemplates the use of an intact HER-2 / neu polypeptide as well as the division of this polypeptide into a plurality of peptides. Neither the pi85 protein<sup>HER_2 // neu</sup> intact neither a peptide having the amino acid sequence of its entire extracellular domain (i.e., a peptide having an amino acid sequence of SEQ ID NO: 2 from amino acid position 1 to amino acid position 650, more or less approximately one to five positions, and with or without the first 21 amino acid positions) is used only for immunization.
A HER-2 / neu (or nucleic acid) polypeptide is preferably formulated for use in the above methods as a pharmaceutical composition (eg, vaccine). Pharmaceutical compositions generally comprise one or more polypeptides in combination with a vehicle, excipient, or
-4343 pharmaceutically acceptable diluent. These vehicles will be non-toxic to the receptors in the doses and concentrations used. The use of a HER2 / neu polypeptide in conjunction with chemotherapeutic agents is also contemplated.
In addition to the HER-2 / neu polypeptide (which functions as an antigen), it may be desirable to include other components in the vaccine, such as a vehicle for administration of antigen and immunostimulatory substances designed to increase the immunogenicity of the protein. Examples of vehicles for antigen administration include aluminum salts, water-in-oil emulsions, biodegradable oil vehicles, oil-in-water emulsions, biodegradable microcapsules, and liposomes. Examples of immunostimulatory substances (adjuvants) include N-acetylmuramyl-Lalanine-D-isoglutamine (MDP), lipopolysaccharides (LPS), glucan, IL-12, GM-CSF, gamma interferon and IL-15. It will be apparent to technicians with ordinary experience in this technique that a HER-2 / neu polypeptide for a vaccine can be synthetically prepared or naturally derived.
Although any convenient vehicle known to those of ordinary skill in the art can be employed for the pharmaceutical compositions of this invention, the type of vehicle will vary depending on the mode of administration and whether sustained release is desired. For parenteral administration, as a subcutaneous injection,
-4444 the vehicle preferably comprises water, saline, alcohol, a grease, a wax or a regulator. For oral administration, any of the above vehicles or a solid vehicle can be used, such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, and magnesium carbonate. Biodegradable microspheres (eg polylactic galactide) can also be used as carriers for the pharmaceutical composition of this invention. Convenient biodegradable microspheres are described, for example, in US Patent Nos. 4,897,268 and 5,075,109. A HER2 / neu polypeptide can be encapsulated within the biodegradable microsphere or associated with the surface of the microsphere. For example, in a preferred embodiment, a polypeptide having the amino acid sequence of SEQ ID NO: 2 from amino acid 676 to amino acid 1255 is encapsulated within a biodegradable microsphere. In relation to this, it is preferable that the microsphere be greater than about 25 microns.
Pharmaceutical compositions (including vaccines) may also contain diluents as regulators, antioxidants such as ascorbic acid, low molecular weight polypeptides (less than about 10 residues), proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione. and others
-4545 stabilizers and excipients. Neutral buffered saline or saline mixed with non-specific serum albumin are examples of suitable diluents. Preferably the product is formulated as a lyophilisate using suitable excipient solutions (eg, sucrose) as diluents.
As an alternative to the presentation of HER-2 / neu polypeptides, the present invention includes compositions capable of delivering nucleic acid molecules encoding an HER-2 / neu polypeptide. These compositions include recombinant viral vectors (eg, retroviruses (see WO 90/07936, WO 91/02805, WO 93/25234, WO 93/25698, and WO 94/03622), adenoviruses (see Berkner, Biotechniques 5: 616- 627, 1988; Li et al., Hum.Gene Ther. 4: 403-409, 1993; Vincent et al., Nat. Genet. 5: 130-134, 1993; and Kolls et al., Proc. Nati. Acad. Sci. USA 91: 215-219, 1994), smallpox virus (see United States of America Patent Number: 4,769,330; United States of America Patent Number: 5,017,487; and WO 89/01973)), pure DNA ( see WO 90/11092), complexed nucleic acid molecule for a polycationic molecule (see WO 93/03709), and liposome associated nucleic acid (see Wang et al., Proc. Nati. Acad. Sel. USA 84: 7851, 1987). In certain modalities, DNA can be linked to killed or inactivated adenovirus (see Curiel et al., Hum. Gene Ther. 3: 147-154, 1992;
-4646
Cotton et al., Proc. Nati. Acad. Sel. USA 89: 6094, 1992). Other convenient compositions include DNA ligand (see Wu et al., J. Biol. Chem. 264: 16985-16987, 1989) and combinations of lipid DNA (see Felgner et al., Proc. Nati. Acad. Sci. USA 84: 7413. -7417, 1989). Furthermore, the assimilation efficiency of pure DNA in cells can be increased by covering the DNA on biodegradable beads.
In addition to direct in vivo procedures, ex vivo procedures can be used in which cells are removed from an animal, modified, and placed in the same or another animal. It will be apparent that one can use any of the compositions noted above for the introduction of HER-2 / neu nucleic acid molecules into tissue cells in an ex vivo context. Protocols for viral, physical and chemical assimilation methods are well known in the art.
In accordance with the foregoing, the present invention is useful for enhancing or eliciting, in a patient or cell culture, a cellular immune response (eg, generation of antigen-specific cytolytic T cells). As used herein the term "patient" refers to any warm-blooded animal, preferably a human. A patient may be affected by cancer, such as breast cancer, or it may be normal (that is, free from
-4747 detectable disease and infection). A cell culture is any preparation of isolated T cells or component cells (including, but not limited to, macrophages, monocytes, B cells, and dendritic cells). These cells can be isolated by any of a variety of techniques well known to those of ordinary skill in the art (such as Ficoll-hypaque density centrifugation). The cells may (but not necessarily) have been isolated from a patient afflicted with a HER2 / neu-associated malignancy, and may be reintroduced into a patient after treatment.
The present invention also describes that the HER-2 / neu polypeptide, in addition to being immunogenic to T cells, appears to stimulate B cells to produce antibodies capable of recognizing the HER-2 / neu polypeptide. Specific antibodies (i.e., they exhibit a binding affinity of approximately 10<sup>7</sup> liters / mole or better) for the HER-2 / neu protein can be found in a variety of body fluids including sera and ascites. In summary, a body fluid sample is isolated from a warm-blooded animal, such as a human, for which it is desired to determine if antibodies to the HER-2 / neu polypeptide are present. Body fluid is incubated with the HER-2 / neu polypeptide under conditions and for a time sufficient to allow immunocomplexes to form between the polypeptide and the
-4848 specific antibodies for the protein. For example, a body fluid and the HER-2 / neu polypeptide can be incubated at 4 ° C for 24-48 hours. After incubation, the reaction mixture is tested for the presence of immunocomplexes. Detection of one or more immunocomplexes formed between the HER-2 / neu polypeptide and antibodies specific for the HER-2 / neu polypeptide can be carried out by a variety of known techniques, such as radioimmunoassays (RIA) and enzyme immunosorbent assay linked (ELISA).
Convenient immunoassays include the David et al. Double monoclonal antibody sandwich immunoassay technique (US Patent No. 4,376,110); polyclonal-monoclonal antibody sandwich assays (Wide et al., in Kirkham and Hunter, editors, Radioimmunoassay Methods, E. and S. Livingstone, Edinburgh, 1970); the western blot method of Gordon et al. (US Patent Number: 4,452,901); immunoprecipitation of labeled ligand (Brown et al., J. Biol. Chem. 255.-4980-4983, 1980); enzyme-linked immunosorbent assays as described, for example, Raines and Ross (J. Biol. Chem. 257: 5154-5160, 1982); immunocytochemical techniques, including the use of fluorochromes (Brooks et al., Clin. Exp. Immuno1. 39: 477, 1980); and neutralization of
-4949 activity [Bowen-Pope et al., Proc. Nati. Acad. Sci. ULSA 81: 2396-2400 (1984)], all of which are incorporated herein by reference. In addition to the immunoassays described above, several other immunoassays are available, including those described in United States Patent Nos. 3,817,827; 3,850,752; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; and 4,098,876, all of which are incorporated herein by reference.
For detection purposes, the HER-2 / neu polypeptide (antigen) can be labeled or unlabeled. When not labeled, the antigen finds use in agglutination assays. In addition, the unlabeled antigen can be used in combination with labeled molecules that are reactive with immunocomplexes, or in combination with labeled antibodies (second antibodies) that are reactive with the antibody directed against the HER-2 / neu polypeptide, as specific antibodies to immunoglobulin. Alternatively, the antigen can be directly labeled. When labeled, the reporter group may include radioisotopes, fluorophores, enzymes, luminescent or dye particles. These and other labels are well known in the art and are described, for example, in the following US Patent Nos. 3,766,162; 3,791,932; 3,817,837; 3,996,345; and 4,233,402.
-5050
Typically, in an enzyme-linked immunosorbent assay, the antigen is adsorbed on the surface of a microtiter well. Residual protein binding sites on the surface are blocked with an appropriate agent, such as bovine serum albumin (BSA), normal heat-inactivated goat serum (NGS), or BLOTTO (skimmed dry milk buffered solution that also contains a preservative, salts, and an antifoaming agent). The well is then incubated with a sample suspected of containing specific antibody. The sample can be applied as well, or more frequently, can be diluted, usually in a buffered solution containing a small amount (0.1 percent - 5.0 percent by weight) of protein, such as bovine serum albumin, inactivated normal goat serum by heat, or BLOTTO. After incubating for a sufficient amount of time to allow binding to occur, the well is washed to remove unbound protein and then incubated with a specific anti-species immunoglobin antibody labeled with a reporter group. The reporter group can be chosen from a variety of enzymes, including horseradish peroxidase, beta-galactosidase, alkaline phosphatase, and glucose oxidase. Sufficient time is allowed for specific binding to occur, then the well is washed again to remove the unbound conjugate, and the substrate for the enzyme is added. Color is allowed to develop and the optical density of the well content is determined
-5151 visually or instrumentally.
In a preferred embodiment of this aspect of the present invention, a reporter group binds to the HER-2 / neu protein. The step of detecting immunocomplexes involves removing substantially any unbound HER-2 / neu protein and then detecting the presence or absence of the reporter group.
In another preferred embodiment, a reporter group binds to a second antibody capable of binding to antibodies specific for the HER-2 / neu protein. The step of detecting immunocomplexes involves (a) removing substantially any unbound antibody, (b) adding the second antibody, (c) removing substantially any second unbound antibody, and then (d) detecting the presence or absence of the reporter group. When the HER-2 / neu protein specific antibody is derived from a human, the second antibody is an anti-human antibody.
In a third preferred embodiment for detecting immunocomplexes, a reporter group binds to a molecule capable of binding immunocomplexes. The detection step involves (a) adding the molecule, (b) removing substantially any unbound molecules, and then (c) detecting the presence or absence of the reporter group. An example of a molecule capable of binding to immunocomplexes is protein A.
It will be apparent to someone skilled in the art that a variety of methods can be employed to detect the
-5252 immunocomplexes within the present invention. Convenient reporter groups for use in either method include radioisotopes, fluorophores, enzymes, illuminators, and dye particles.
In a related aspect of the present invention, detection of immunocomplexes formed between the HER-2 / neu polypeptide and antibodies in body fluid that are specific for the HER-2 / neu polypeptide can be used to monitor the effectiveness of therapy against cancer, which involves a HER-2 / neu polypeptide, for a malignancy to which the HER-2 / neu oncogen is associated, Body fluid samples taken from an individual before and after initiation of therapy for immunocomplexes can be analyzed using the methodologies described above. Briefly, the number of immunocomplexes detected in both samples is compared. A substantial change in the number of immunocomplexes in the second sample (initiation post-therapy) relative to the first sample (pre-therapy) reflects successful therapy.
The following examples are offered by way of illustration and not by way of limitation.
-5353
EXAMPLES EXAMPLE 1
Expression and purification of HER-2 / n_eu humane? Polypeptide recombinant
The human HER-2 / neu polypeptide was recovered by the polymerase chain reaction method (eg United States Patent Nos. 4,683,195; 4,683,202; 4,800,159) from a plasmid prepared according to * Di Fiore and collaborators (King et al., Science 229: 914-916, 1985; Di Fiore et al., Science 237: 178-182, 1987) using oligonucleotide primers that additionally introduced a BssHII restriction site and an enterokinase protease site at the 5 'end and an EcoRI site at the 3' end. Primer for End 5<sup>1</sup> It was:
'- TCTGGCGCGCTGGATGACGATGACAAGAAACGACGGCAGCAGAAGATC - 3' (SEQ ID
NO: 3) while the primer for the 3 'end was:
'-TGAATTCTCGAGTCATTACACTGGCACGTCCAGACCCAG- 3 <sup>1</sup> (SEQ ID NO: 4).
The resulting 1.8 kb polymerase chain reaction fragment was subcloned into Novagen T vector (Madison, WI, USA) and the sequence of the selected clones was determined on the ABI 373 automated DNA sequencer (Applied Biosystems Inc., Foster City, CA, USA) using overlap sequencing primers. Fragments of the polymerase chain reaction with the sequence that corresponded to the
-5454 published DNA sequence for the human HER-2 / neu cDNA (SSQ ID NO: 1; Coussens et al., Science 230: 1132, 1985; Yamamoto et al., Nature 319: 230, 1986) were then connected in the Correct reading chart via the BssHII site to an E thioredoxin reductase, modified coli. A 6Xhistidine affinity tag employed in the Ni-NTA affinity purification of the expressed fusion protein was incorporated into the thio-redoxin reductase fusion portion. This cDNA for the human HER-2 / neu trxA polypeptide fusion protein was subcloned into a modified pET expression vector for expression in E, coli.
Although thio-redoxin reductase has been reported to stabilize and solubilize other heterologous proteins expressed in E, coli, it does not appear to offer any significant advantage for the expression of the human HER-2 / neu polypeptide in E, coli. Although a significant proportion of the trxA-HER-2 / neu polypeptide fusion protein was soluble, a majority was expressed in inclusion bodies. The fusion protein was also degraded during expression in E, coli. However, the presence of the thioredoxin reductase fusion portion can stabilize the protein during purification. The availability of monoclonal antibodies to thio-redoxin reductase provides a convenient marker to follow during purification.
For purification of HER-2 / neu polypeptide
-5555 human with the thio-redoxin reductase fusion part containing the 6HHis affinity tag, The coli agglomeration was resuspended with protease and lysozyme inhibitors and sonified. Inclusion bodies were isolated by centrifugation, and washed 3 times with deoxycholate, the last wash was overnight to remove LPS. The washed inclusion bodies were solubilized in GuHCl for Ni purification. The Ni column was leached with imidazole in urea and dialyzed against 10mM Tris pH 8. The recovery of the HER-2 / neu polypeptide using this protocol was 80-95 percent of full-length pure protein with protein being the main contaminant degraded. From 500 milliliters of fermentation, 20 milligrams were recovered. It was more than 98 percent HER-2 / neu polypeptide. The techniques used herein are well known in the art and have been described, for example in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd, Ed., Coid Spring Harbor Laboratory Press, 1989, Coid Spring Harbor, New York, USA.
EXAMPLE 2
Dendritic cells can prime human HER-2 / neu A polypeptide. Generation of dendritic cell (PC) cultures to xartir from bone marrow
Dendritic cell cultures were generated from CD34 + hematopoietic stem cells (HPC).
-56 CD34 + cells were purified from bone marrow from normal donors using the Ceprate LC Kit Cell Separation System (CellPro, Bothell, WA, USA). Flow cytometric analysis determined a purity of 80 to 90 percent of the recovered CD34 + cells. CD34 + cells were grown in serum-free medium (X-VIVO 10, Biowhittaker, Inc., Walkersville, MD, USA) supplemented with Lglutamine (584 µg / liter), penicillin (10 Ul / milliliter), streptomycin (100 ^ g / milliliter), 100 ng / milliliter of human rGM-CSF and 50 ng / milliliter of human rIL-6 (Immunex, Seattle, WA, USA). After 0 to 17 days of culture time, the cells were harvested and used for phenotyping and for T cell stimulation assays. GM-CSF alone and in combination with IL-4 or TNFa have been described to induce dendritic cell growth in vitro. In experiments using KLH and OVA as antigens to prime native T cells, GM-CSF plus IL-6 consistently gave comparable total stimulation, but with a lower background and thus a higher stimulation rate compared to GM-CSF plus IL- 4 or TNFa.
B. Test of barley of piulas. T
Bone marrow-derived CD34 + hematopoietic stem cells cultured in serum-free medium containing GM-CSF and IL-6 were used as APCs after a culture period of 0 to 17 days. The priming capacity of dendritic cells was determined by culturing them with natural, autologous T lymphocytes in the presence or absence of the recombinant human HER-2 / neu polypeptide (hHNP) antigen protein (10 µ / milliliter). CD4 + T cells were isolated from mononuclear cells in peripheral blood by positive selection using immunoaffinity columns (CellPro, Inc. <sub>t </sub>Bothell, WA, USA). CD4 + CD45RA + T cells (wild-type) were selected from CD4 + T cells using an anti-CD45RA mAb monoclonal antibody directly conjugated to FITC (Immunotech, Westbrook, ME, USA) by flow cytometric classification. The CD4 + CD45RA + T cells obtained were 99 percent pure. Dendritic cell cultures were plated into round bottom 96-well trays (Corning, Corning, NY, USA) at various concentrations and incubated for 16-18 hours with hHNP 10 pg / milliliter final concentration. Aiitigen-pulsed dendritic cells were irradiated (10 Gy), and autologous CD4 + CD45RA + T lymphocytes (5x10<sup>4</sup>/water well). The proliferative response to T cells was measured by the assimilation of (<sup>3</sup>H) thymidine (1 μΟΐ / ροζο) added on day 6 for 16-18 hours. Proliferation assays were performed in serum-free and cytokine-free medium. The results are shown in Figure 1. Figure 2 shows the results of testing CD4 + T cells from a normal donor to see their responses to the human HER-2 / neu polypeptide. It was obtained
-5858 similar information with T cells from nine out of 10 normal individuals.
EXAMPLE 3 Assay to Detect_UnfQgitQg — Low — Frequency Precursors
Three assays can be used for detection of CD4 + responses: a standard proliferation assay, a low-frequency event search method, and a limiting dilution (LDA) assay. Conventional proliferative assays are capable of easily detecting primed responses. The proliferative response stimulation index provides a rough correlation with the precursor frequency of antigen-reactive T cells. Any specific proliferative response detected from PBL is considered a primed response.
To provide a more quantitative interpretation of CD4 + T cell responses, the assay system developed to detect low frequency responses of the lymphocyte precursor (described below) is used. This trial is simple and cost effective. In circumstances where more precision is needed, the precursor frequency is validated by limiting dilution tests (Bishop and Orosz, Transplantation 47: 671-677, 1989).
Responses greater than those detected in normal individuals are defined as primed response e
-5959 imply existing immunity. Low responses<sub>r </sub>Detectable only by limiting dilution test conditions are considered to be unprimed responses. An absence of response by limiting dilution test or a response less than that defined by the normal population analysis is considered to be tolerance / anergy.
In general, responses of primed CD4 + T cells can be detected in standard proliferative assays, whereas unprimed responses are not detectable in the same assays. Detection of small numbers of unprimed T cells is limited by confusing background thymidine uptake which includes the autologous mixed lymphocyte (AMLR) response to the auto MHC antigen plus responses to processed auto serum proteins and proteins with exogenously added serum .
To obtain and detect unprimed T cells, an assay system for low frequency responses based on Poisson sampling statistics was used (En: Pinnacles, Chiron Corporation, 1: 1-2, 1991). This type of analysis specifically applies to low-frequency events where, if the precursor frequency is less than the number of cells in a replica culture, many replicates are required to detect a statistically significant number of positives. Theoretically, the analysis will correct for autologous responses by presenting a known positive control (such as PHA or toxoid
-6060 tetanus) and known negative control (non-antigen) and evaluating all data points from the lowest to the highest irrespective of the experimental group to which they belong. A cut-off value is calculated based on the cut-off equation - M + (F + SD), where M = arithmetic mean, F = 3.29, a factor from the tables of the standardized normal distribution chosen so that no more than 0.1 per one hundred of the true negatives of a distributed fund will normally be above the cut, and SD = standard deviation. In this search assay, wells above the cut are considered true positives that potentially contain a lymphocyte that is specifically proliferating for the antigen of interest. Although it is possible to make estimates of the frequency of the lymphocyte precursor using this method, accurate determination requires formal limiting dilution assay analysis.
EXAMPLE 4
HER-2 / neu polypeptide-based vaccine grants immunity to HER-2 / neu protein
A. Animals
The rats used in this study were Fischer strain 344 (CDF (F-344) / CrlBR) (Charles River Laboratories, Portage MI). Animals were kept in the animal facilities at the University of Washington under specific pathogen-free conditions and were routinely used
-6161 for experimental studies between 3 and 4 months of age.
B. Immunization
Fischer rats were immunized with recombinant rat HER-2 / neu (rHNP) polypeptide in a variety of adjuvants (MPL, Vaccel; Ribi, Bozeman, MT, USA). Animals received 50 gg of rHNP mixed with adjuvant subcutaneously. Twenty days later the animals were boosted with a second immunization of 50 µl of rHNP administered in the same manner. Twenty days after booster immunization, animals were tested for the presence of antibodies directed against the rat HER2 / neu protein (neu).
C. Lilias celyl ^ res
Two cell lines were used as a source of rat HER-2 / neu protein. SKBR3, a human breast cancer cell line that is a marked HER-2 / neu overexpressor (American Type Culture Collection, Rockville, MD) was maintained in culture in 10 percent fetal bovine serum (FBS) (Gemini Bioproducts, Inc., Calabasas, CA) and RPMI. DHFR-G8, an NIH / 3T3 cell line cotransfected with cneu-p and pSV2-DHFR (American Type Culture Collection, Rockville, MD), was used as a source of non-transforming rat neu protein (Bernards et al., Proc. Nati. Acad. Sci. USA 84: 6854-6858, 1987). This cell line was maintained in 10 percent fetal bovine serum and Eagle medium.
-6262 modified from Dulbecco with 4.5 grams / liter of glucose. DHFR-G8 cells were passed through the same medium supplemented with 0.3 µΜ methotrexate every three passes to maintain the neu transectant.
D. Preparation of Cell Lysates
Lysates of both SKBR3 and DHFR-G8 were prepared and used as a source of neu protein. Briefly, a lysis regulator consisting of a tris base, sodium chloride, and Triton-X (1 percent) pH 7.5 was prepared. Protease inhibitors: aprotinin (Igg / ml), were added. benzamidine (lmM) and PMSF (lmM). 1 milliliter of the lysis regulator was used to suspend 10<sup>7</sup> cells. Cells were spun for 15 seconds every 10 minutes for one hour until ruptured. All procedures were performed on ice in a cold room at 4 ° C. After discontinuation the cells were microfugeed at 4 ° C for 20 minutes. The supernatant was removed from the cell waste and stored in small aliquots at -70 ° C until used. The presence of human and rat neu in lysates was documented by Western blot analysis.
E. Linked_enuhQSQrb ^ ntg__de__enzyme__ test for antibody responses ... of rat neu
4 Immulon 96-well trays (Baxter SP, Redmond, WA: Dynatech Laboratories) were incubated overnight at 4 ° C with a rat neu-specific monoclonal antibody.
-6363 (Oncogene Science), 7.16.4, at a concentration of 10 gg / milliliter diluted in carbonate regulator (equimolar concentrations of Na<sub>2</sub>CO<sub>3</sub> and NaHCO<sub>3</sub> pH 9.6). After incubation, all wells were blocked with Bovine Serum Albumin 1 Percent Phosphate Buffer (Sigma Chemical, St. Louis, MO, USA), 100 g / well for 3 hours at room temperature. The tray was washed with 0.5% Tween and Used phosphate buffer solution from DHFRG8, a murine cell line transfected with rat neu DNA (American Type Culture Collection, Rockville, MD, USA); A rat neu protein source was added to alternate rows. The plate was incubated overnight at 4 ° C. The plate was then washed with 0.5% Tween phosphate buffer and experimental serum was added in the following dilutions: 1:25 to 1: 200. The serum was diluted in phosphate buffer-1 percent bovine serum albumin-1 percent fetal bovine serum 25 gg / milliliter mouse immunoglobin-0.01 percent NaN<sub>3</sub> and then serially in bovine serum albumin phosphate-1 percent buffer. 50 gl of diluted serum was added per well and incubated 1 hour at room temperature. Each experimental serum was added to a well with rat neu and a well without rat neu. Sheep anti-rat immunoglobin F (ab ')<sub>2</sub> Horseradish peroxidase (HRP) was added to the wells at a dilution of 1: 5000 in buffer-1 percent bovine serum albumin
-6464 and incubated for 45 minutes at room temperature (Amersham Co., Arlington Heights, IL, USA). After the final wash, the TMB developer reagent (Kirkegaard and Perry Laboratories, Gaithersburg, MD) was added. The color reaction was read at an optical density of 450nm. The optical density of each serum dilution was calculated as the optical density of the wells covered with rat neu minus the optical density of the wells covered with phosphate buffer-1 percent bovine serum albumin. Sera from animals immunized with nothing more than the adjuvants and one animal immunized with hHNP (foreign protein) were also evaluated in a similar way. The results are shown in Figure 3.
F. T cell proliferation assays
For analysis of specific HER-2 / neu polypeptide responses: Fresh spleen or lymph node cells were harvested by mechanical disruption and passage through wire mesh and washed. 2x10 were plated<sup>5</sup> spleen / well cells and 1 x 10<sup>5</sup> lymph node / well cells in 96-well round-bottom microtiter trays (Corning, Corning, NY) with 6 replicates per experimental group. The medium consisted of ΕΗΆΑ 120 (Biofluids) with L-glutamine, penicillin / streptomycin, 2-mercaptoethanol, and 5 percent fetal bovine serum. Cells were incubated with polypeptides. After 4 days, the wells were pulsed with 1 gCi of [<sup>3</sup>H] thymidine for 6-8 hours
-6565 and were counted. Data were expressed as a stimulation index (SI) which is defined as the mean of the experimental wells divided by the mean of the control wells (non-antigen). For analysis of HER-2 / neu protein specific responses: spleen or lymph node cells were cultured for 3 in vitro stimulations. At the same time of the analysis 1 x 10<sup>5</sup> Cultured lymph node or spleen T cells are plated into 96-well microtiter trays as described above. Cells were incubated with lgg / milliliter of immunoaffinity column purified rat neu (from DHFR-G8 cells as the source of rat neu). After 4 days, the wells were pulsed with 1 μθί of [<sup>3</sup>H] thymidine for 6-8 hours and counted. Data were expressed as a stimulation index which is defined as the mean of the experimental wells divided by the mean of the control wells (non-antigen).
EXAMPLE 5
Primed responses to human HER-2 / neu polypeptide can be detected in patients with breast cancer
Heparinized blood was obtained from a patient with stage II HER-2 / neu overexpressed breast cancer. Peripheral blood mononuclear cells (PBMC) were separated by Ficoll Hipaque density centrifugation. Peripheral blood mononuclear cells were plated at a
-6666 concentration of 2 x 10<sup>5</sup>/ 96-well round-bottom tray well (Corning, Corning, NY<sub>F</sub> USA). 24 wells were made for each experimental group. Antigens consisting of HER-2 / neu derived peptides (15-20 amino acids in length with first amino acid number in the listed sequence) 25 gg / milliliter, HER-2 / human neu polypeptide (hHNP) 1 μg / milliliter, tetanus toxoid 1 gg / milliliter, and p30 a peptide derived from tetanus 25 gg / milligram were added to each 24-well replicate. The assay was performed in medium containing 10 percent human sera. The proliferative response of T cells was measured by the absorption of (<sup>3</sup>H) thymidine (1 μCi / well) added on day 4 for 10 hours. Positive wells, antigen reactive wells, were rated positive if cpm was greater than the mean and 3 standard deviations from wells without antigen. The results are shown in Figure 4. This stage II breast cancer patient has a significant response to recombinant hHNP.
It will be apparent from the foregoing that although specific embodiments of the invention have been described herein for purposes of illustration, various modifications can be made without departing from the spirit and scope of the invention.
-6767
Sequence Listing (1) GENERAL INFORMATION (i) APPLICANT: University of Washington (ii) TITLE OF INVENTION: COMPOUNDS TO BE GRANTED OR
INCREASE IMMUNE REACTIVITY TO HER2 / neu PROTEIN FOR THE PREVENTION OR TREATMENT OF
MALIGNANCES TO WHICH ONCOGEN HER2 / neu (iÜ) IS ASSOCIATED NUMBER OF SEQUENCES: 4 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESS: SEED and BERRY LLP
<td>(B)</td><td>STREET:</td><td>6300 Columbia Center. Avenue</td><td> 701</td>
<td>(C)</td><td>CITY:</td><td>Seattle</td><td></td>
<td>(D)</td><td>STATE:</td><td>Washington</td><td></td>
<td>(AND)</td><td>COUNTRY:</td><td colspan="2">United States of America</td>
<td>(F)</td><td>CODE</td><td>POSTCARD: 98104-7092</td><td></td>
(v) LEGIBLE FORM BY COMPUTER:
(A) MEDIUM TYPE: Flexible disk
-6868 (B) COMPUTER: compatible Compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Release # 1.0. Version # 1.30 (vi) CURRENT REQUEST DATA:
(A) REQUEST NUMBER:
(B) FILING DATE: MAR 28, 1996 (C) CLASSIFICATION:
(viii) INFORMATION ATTORNEY / AGENT NAME: Sharkey, Richard G.
(B) REGISTRATION NUMBER: 32,629 (C) REFERENCE / RECORD NUMBER: 920010.448PC (ix) TELECOMMUNICATION INFORMATION (A) TELEPHONE: (206) 622-4900 (B) TELEFAX: (206) 682-6031 (2) INFORMATION FOR SEQ ID NO: 1 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3768 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear
-6969 (ix) FEATURES:
(A) NAME / KEY: CDS (B) PLACE: 1..3765 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
<td>ATG</td><td>GAG</td><td>CTG</td><td>GCG</td><td>GCC</td><td>TTG</td><td>TGC</td><td>CGC</td><td>TGG</td><td>GGG</td><td>CTC</td><td>CTC</td><td>CTC</td><td>GCC</td><td>CTC</td><td>TTG</td><td> 48</td>
<td>Met</td><td>Glu</td><td>Leu</td><td>To</td><td>To</td><td>Leu</td><td>Cys</td><td>Arg</td><td>Trp</td><td>Gly</td><td>Leu</td><td>Leu</td><td>Leu</td><td>To</td><td>Leu</td><td>Leu</td><td></td>
<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td><td></td>
<td>ccc</td><td>CCC</td><td>GGA</td><td>GCC</td><td>GCG</td><td>AGC</td><td>ACC</td><td>CAA</td><td>GTG</td><td>TGC</td><td>ACC</td><td>GGC</td><td>HERE</td><td>GAC</td><td>ATG</td><td>AAG</td><td> 96</td>
<td>Pro</td><td>Pro</td><td>Gly</td><td>To</td><td>To</td><td>To be</td><td>Thr</td><td>Gln</td><td>Val</td><td>cys</td><td>Thr</td><td>Gly</td><td>Thr</td><td>Asp</td><td>Met</td><td>Lys</td><td></td>
<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td><td></td>
<td>CTG</td><td>CGG</td><td>CTC</td><td>CCT</td><td>GCC</td><td>AGT</td><td>CCC</td><td>GAG</td><td>ACC</td><td>CAC</td><td>CTG</td><td>GAC</td><td>ATG</td><td>CTC</td><td>CGC</td><td>CAC</td><td> 144</td>
<td>Leu</td><td>Arg</td><td>Leu</td><td>Pro</td><td>To</td><td>To be</td><td>Pro</td><td>Glu</td><td>Thr</td><td>His</td><td>Leu</td><td>Asp</td><td>Met</td><td>Leu</td><td>Arg</td><td>His</td><td></td>
<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td><td></td>
<td>CTC</td><td>TAC</td><td>CAG</td><td>GGC</td><td>TGC</td><td>CAG</td><td>GTG</td><td>GTG</td><td>CAG</td><td>GGA</td><td>AAC</td><td>CTG</td><td>GAA</td><td>CTC</td><td>ACC</td><td>TAC</td><td> 192</td>
<td>Leu</td><td>Tyr</td><td>Gln</td><td>Gly</td><td>Cys</td><td>Gln</td><td>Val</td><td>Val</td><td>Gln</td><td>Gly</td><td>Asn</td><td>Leu</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Tyr</td><td></td>
<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td><td></td>
<td>CTG</td><td>CCC</td><td>ACC</td><td>AAT</td><td>GCC</td><td>AGC</td><td>CTG</td><td>CBT</td><td>TTC</td><td>CTG</td><td>CAG</td><td>GAT</td><td>ATC</td><td>CAG</td><td>GAG</td><td>GTG</td><td> 240</td>
<td>Leu</td><td>Pro</td><td>Thr</td><td>Asn</td><td>To</td><td>To be</td><td>Leu</td><td>To be</td><td>Phe</td><td>Leu</td><td>Gln</td><td>Asp</td><td>lie</td><td>Gln</td><td>Glu</td><td>Val</td><td></td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td><td></td>
<td>CAG</td><td>GGC</td><td>TAC</td><td>GTG</td><td>CTC</td><td>ATC</td><td>GCT</td><td>CAC</td><td>AAC</td><td>CAA</td><td>GTG</td><td>AGG</td><td>CAG</td><td>GTC</td><td>CCA</td><td>CTG</td><td> 288</td>
<td>Gln</td><td>Gly</td><td>Tyr</td><td>Val</td><td>Leu</td><td>lie</td><td>To</td><td>His</td><td>Asn</td><td>Gln</td><td>Val</td><td>Arg</td><td>Gln</td><td>Val</td><td>Pro</td><td>Leu</td><td></td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td>
<td>CAG</td><td>AGG</td><td>CTG</td><td>CGG</td><td>ATT</td><td>GTG</td><td>CGA</td><td>GGC</td><td>ACC</td><td>CAG</td><td>CTC</td><td>τπ</td><td>GAG</td><td>GAC</td><td>AAC</td><td>TAT</td><td> 336</td>
<td>Gln</td><td>Arg</td><td>Leu</td><td>Arg</td><td>lie</td><td>Val</td><td>Arg</td><td>Gly</td><td>Thr</td><td>Gln</td><td>Leu</td><td>Phe</td><td>Glu</td><td>Asp</td><td>Asn</td><td>Tyr</td><td></td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td>
<td>GCC</td><td>CTG</td><td>GCC</td><td>GTG</td><td>CTA</td><td>GAC</td><td>AAT</td><td>GGA</td><td>GAC</td><td>CCG</td><td>CTG</td><td>AAC</td><td>AAT</td><td>ACC</td><td>ACC</td><td>CCT</td><td> 384</td>
<td>To</td><td>Leu</td><td>To</td><td>Val</td><td>Leu</td><td>Asp</td><td>Asn</td><td>Gly</td><td>Asp</td><td>Pro</td><td>Leu</td><td>Asn</td><td>Asn</td><td>Thr</td><td>Thr</td><td>Pro</td><td></td>
<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td>
-7070
<td>GTC</td><td>HERE</td><td>GGG</td><td>GCC</td><td>CBT</td><td>CCA</td><td>GGA</td><td>GGC</td><td>CTG</td><td>CGG</td><td>GAG</td><td>CTG</td><td>CAG</td><td></td><td>CGA</td><td>AGC</td><td> 432</td>
<td>Val</td><td>Thr</td><td>Gly</td><td>To</td><td>To be</td><td>Pro</td><td>Gly</td><td>Gly</td><td>Leu</td><td>Arg</td><td>Glu</td><td>Leu</td><td>Gln</td><td>Leu</td><td>Arg</td><td>To be</td><td></td>
<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td></td>
<td>CTC</td><td>HERE</td><td>GAG</td><td>ATC</td><td>TTG</td><td>AAA</td><td>GGA</td><td>GGG</td><td>GTC</td><td>TTG</td><td>ATC</td><td>CAG</td><td>CGG</td><td>AAC</td><td>CCC</td><td>CAG</td><td> 480</td>
<td>Leu</td><td>Thr</td><td>Glu</td><td>lie</td><td>Leu</td><td>Lys</td><td>Gly</td><td>Gly</td><td>Val</td><td>Leu</td><td>lie-</td><td>Gln</td><td>Arg</td><td>Asn</td><td>Pro</td><td>Gln</td><td></td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td>
<td>CTC</td><td>TGC</td><td>TAC</td><td>CAG</td><td>GAC</td><td>ACG</td><td>ATT</td><td>TTG</td><td>TGG</td><td>AAG</td><td>GAC</td><td>ATC</td><td>TTC</td><td>CAC</td><td>AAG</td><td>AAC</td><td> 528</td>
<td>Leu</td><td>Cys</td><td>Tyr</td><td>Gln</td><td>Asp</td><td>Thr</td><td>lie</td><td>Leu</td><td>Trp</td><td>Lys</td><td>Asp</td><td>lie</td><td>Phe</td><td>His</td><td>Lys</td><td>Asn</td><td></td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td>
<td>AAC</td><td>CAG</td><td>CTG</td><td>GCT</td><td>CTC</td><td>HERE</td><td>CTG</td><td>ATA</td><td>GAC</td><td>ACC</td><td>AAC</td><td>CGC</td><td>TCT</td><td>CGG</td><td>GCC</td><td>TGC</td><td> 576</td>
<td>Asn</td><td>Gln</td><td>Leu</td><td>To</td><td>Leu</td><td>Thr</td><td>Leu</td><td>lie</td><td>Asp</td><td>Thr</td><td>Asn</td><td>Arg</td><td>To be</td><td>Arg</td><td>To</td><td>Cys</td><td></td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td>
<td>CAC</td><td>CCC</td><td>TGT</td><td>TCT</td><td>CCG</td><td>ATG</td><td>TGT</td><td>AAG</td><td>GGC</td><td>CBT</td><td>CGC</td><td>TGC</td><td>TGG</td><td>GGA</td><td>GAG</td><td>AGT</td><td> 624</td>
<td>His</td><td>Pro</td><td>Cys</td><td>To be</td><td>Pro</td><td>Met</td><td>Cys</td><td>Lys</td><td>Gly</td><td>To be</td><td>Arg</td><td>Cys</td><td>Trp</td><td>Gly</td><td>Glu</td><td>To be</td><td></td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td>
<td>TCT</td><td>GAG</td><td>GAT</td><td>TGT</td><td>CAG</td><td>AGC</td><td>CTG</td><td>ACG</td><td>CGC</td><td>ACT</td><td>GTC</td><td>TGT</td><td>GCC</td><td>GGT</td><td>GGC</td><td>TGT</td><td> 672</td>
<td>To be</td><td>Glu</td><td>Asp</td><td>Cys</td><td>Gln</td><td>To be</td><td>Leu</td><td>Thr</td><td>Arg</td><td>Thr</td><td>Val</td><td>Cys</td><td>To</td><td>Gly</td><td>Gly</td><td>Cys</td><td></td>
<td></td><td> '210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td></td>
<td>GCC</td><td>CGC</td><td>TGC</td><td>AAG</td><td>GGG</td><td>CCA</td><td>CTG</td><td>CCC</td><td>ACT</td><td>GAC</td><td>TGC</td><td>TGC</td><td>CAT</td><td>GAG</td><td>CAG</td><td>TGT</td><td> 720</td>
<td>To</td><td>Arg</td><td>Cys</td><td>Lys</td><td>Gly</td><td>Pro</td><td>Leu</td><td>Pro</td><td>Thr</td><td>Asp</td><td>Cys</td><td>Cys</td><td>His</td><td>Glu</td><td>Gln</td><td>Cys</td><td></td>
<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td><td></td>
<td>GCT</td><td>GCC</td><td>GGC</td><td>TGC</td><td>ACG</td><td>GGC</td><td>CCC</td><td>AAG</td><td>CAC</td><td>TCT</td><td>GAC</td><td>TGC</td><td>CTG</td><td>GCC</td><td>TGC</td><td>CTC</td><td> 768</td>
<td>To</td><td>To</td><td>Gly</td><td>Cys</td><td>Thr</td><td>Gly</td><td>Pro</td><td>Lys</td><td>His</td><td>To be</td><td>Asp</td><td>Cys</td><td>Leu</td><td>To</td><td>Cys</td><td>Leu</td><td></td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td><td></td>
<td>CAC</td><td>TTC</td><td>AAC</td><td>CAC</td><td>AGT</td><td>GGC</td><td>ATC</td><td>TGT</td><td>GAG</td><td>CTG</td><td>CAC</td><td>TGC</td><td>CCA</td><td>GCC</td><td>CTG</td><td>GTC</td><td> 816</td>
<td>His</td><td>Phe</td><td>Asn</td><td>His</td><td>To be</td><td>Gly</td><td>lie</td><td>Cys</td><td>Glu</td><td>Leu</td><td>His</td><td>Cys</td><td>Pro</td><td>To</td><td>Leu</td><td>Val</td><td></td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td><td></td>
<td>ACC</td><td>TAC</td><td>AAC</td><td>HERE</td><td>GAC</td><td>ACG</td><td>TTT</td><td>GAG</td><td>CBT</td><td>ATG</td><td>CCC</td><td>AAT</td><td>CCC</td><td>GAG</td><td>GGC</td><td>CGG</td><td> 864</td>
<td>Thr</td><td>Tyr</td><td>Asn</td><td>Thr</td><td>Asp</td><td>Thr</td><td>Phe</td><td>Glu</td><td>To be</td><td>Met</td><td>Pro</td><td>Asn</td><td>Pro</td><td>Glu</td><td>Gly</td><td>Arg</td><td></td>
<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td><td></td>
<td>TAT</td><td>HERE</td><td>TTC</td><td>GGC</td><td>GCC</td><td>AGC</td><td>TGT</td><td>GTG</td><td>ACT</td><td>GCC</td><td>TGT</td><td>CCC</td><td>TAC</td><td>AAC</td><td>TAC</td><td>in</td><td> 912</td>
<td>Tyr</td><td>Thr</td><td>Phe</td><td>Gly</td><td>To</td><td>To be</td><td>Cys</td><td>Val</td><td>Thr</td><td>To</td><td>Cys</td><td>Pro</td><td>Tyr</td><td>Asn</td><td rowspan="2">Tyr</td><td>Leu</td><td></td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>
-7171
TCT ACG GAC GTG GGA TCC TGC ACC CTC GTC TGC CCC CTG CAC AAC CAA 960
Ser Thr Asp Val Gly Ser Cys Thr Leu Val Cys Pro Leu His Asn Gln
<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td><td></td>
<td>GAG</td><td>GTG</td><td>HERE</td><td>GCA</td><td>GAG</td><td>GAT</td><td>GGA</td><td>HERE</td><td>CAG</td><td>CGG</td><td>TGT</td><td>GAG</td><td>AAG</td><td>TGC</td><td>AGC</td><td>AAG</td><td> 1008</td>
<td>Glu</td><td>Val</td><td>Thr</td><td>To</td><td>Glu</td><td>Asp</td><td>Gly</td><td>Thr</td><td>Gln</td><td>Arg</td><td>Cys</td><td>Glu</td><td>Lys</td><td>Cys</td><td>To be</td><td>Lys</td><td></td>
<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td><td></td>
<td>CCC</td><td>TGT</td><td>GCC</td><td>CGA</td><td>GTG</td><td>TGC</td><td>TAT</td><td>GGT</td><td>CTG</td><td>GGC</td><td>ATG</td><td>GAG</td><td>CAC</td><td>TTG</td><td>CGA</td><td>GAG</td><td> 1056</td>
<td>Pro</td><td>Cys</td><td>To</td><td>Arg</td><td>Val</td><td>Cys</td><td>Tyr</td><td>Gly</td><td>Leu</td><td>Gly</td><td>Met</td><td>Glu</td><td>HiS</td><td>Leu</td><td>Arg</td><td>Glu</td><td></td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td><td></td>
<td>GTG</td><td>AGG</td><td>GCA</td><td>GTT</td><td>ACC</td><td>AGT</td><td>GCC</td><td>AAT</td><td>ATC</td><td>CAG</td><td>GAG</td><td>TTT</td><td>GCT</td><td>GGC</td><td>TGC</td><td>AAG</td><td> -1104</td>
<td>Val</td><td>Arg</td><td>To</td><td>Val</td><td>Thr</td><td>To be</td><td>To</td><td>Asn</td><td>lie</td><td>Gln</td><td>Glu</td><td>Phe</td><td>To</td><td>Gly</td><td>Cys</td><td>Lys</td><td></td>
<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td><td></td>
<td>AAG</td><td>ATC</td><td>TTT</td><td>GGG</td><td>AGC</td><td>CTG</td><td>GCA</td><td>TTT</td><td>CTG</td><td>CCG</td><td>GAG</td><td>AGC</td><td>TTT</td><td>GAT</td><td>GGG</td><td>GAC</td><td> 1152</td>
<td>Lys</td><td>lie</td><td>Phe</td><td>Gly</td><td>To be</td><td>Leu</td><td>To</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Glu</td><td>To be</td><td>Phe</td><td>Asp</td><td>Gly</td><td>Asp</td><td></td>
<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td><td></td>
<td>CCA</td><td>GCC</td><td>CBT</td><td>AAC</td><td>ACT</td><td>GCC</td><td>CCG</td><td>CTC</td><td>CAG</td><td>CCA</td><td>GAG</td><td>CAG</td><td>CTC</td><td>CAA</td><td>GTG</td><td>TTT</td><td> 1200</td>
<td>Pro</td><td>To</td><td>To be</td><td>Asn</td><td>Thr</td><td>To</td><td>Pro</td><td>Leu</td><td>Gln</td><td>Pro</td><td>Glu</td><td>Gln</td><td>Leu</td><td>Gln</td><td>Val</td><td>Phe</td><td></td>
<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td><td></td>
<td>GAG</td><td>ACT</td><td>CTG</td><td>GAA</td><td>GAG</td><td>ATC</td><td>HERE</td><td>GGT</td><td>TAC</td><td>CTA</td><td>TAC</td><td>ATC</td><td>TCA</td><td>GCA</td><td>TGG</td><td>CCG</td><td> 1248</td>
<td>Glu</td><td>Thr</td><td>Leu</td><td>Glu</td><td>Glu</td><td>lie</td><td>Thr</td><td>Gly</td><td>Tyr</td><td>Leu</td><td>Tyr</td><td>lie</td><td>To be</td><td>To</td><td>Trp</td><td>Pro</td><td></td>
<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td><td></td>
<td>GAC</td><td>AGC</td><td>CTG</td><td>CCT</td><td>GAC</td><td>CTC</td><td>AGC</td><td>GTC</td><td>TTC</td><td>CAG</td><td>AAC</td><td>CTG</td><td>CAA</td><td>Gta</td><td>ATC</td><td>CGG</td><td> 1296</td>
<td>Asp</td><td>To be</td><td>Leu</td><td>Pro</td><td>Asp</td><td>Leu</td><td>To be</td><td>Val</td><td>Phe</td><td>Gln</td><td>Asn</td><td>Leu</td><td>Gln</td><td>Val</td><td>lie</td><td>Arg</td><td></td>
<td></td><td></td><td></td><td> 420</td><td></td><td></td><td></td><td></td><td> 425</td><td></td><td></td><td></td><td></td><td> 430</td><td></td><td></td><td></td>
<td>GGA</td><td>CGA</td><td>ATT</td><td>CTG</td><td>CAC</td><td>AAT</td><td>GGC</td><td>GCC</td><td>TAC</td><td>TCG</td><td>CTG</td><td>ACC</td><td>CTG</td><td>CAA</td><td>GGG</td><td>CTG</td><td> 1344</td>
<td>Gly</td><td>Arg</td><td>lie</td><td>Leu</td><td>His</td><td>Asn</td><td>Gly</td><td>To</td><td>Tyr</td><td>To be</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Gln</td><td>Gly</td><td>Leu</td><td></td>
<td></td><td></td><td> 435</td><td></td><td></td><td></td><td></td><td> 440</td><td></td><td></td><td></td><td></td><td> 445</td><td></td><td></td><td></td><td></td>
<td>GGC</td><td>ATC</td><td>AGC</td><td>TGG</td><td>CTG</td><td>GGG</td><td>CTG</td><td>CGC</td><td>TCA</td><td>CTG</td><td>AGG</td><td>GAA</td><td>CTG</td><td>GGC</td><td>AGT</td><td>GGA</td><td> 1392</td>
<td>Gly</td><td>lie</td><td>To be</td><td>Trp</td><td>Leu</td><td>Gly</td><td>Leu</td><td>Arg</td><td>To be</td><td>Leu</td><td>Arg</td><td>Glu</td><td>Leu</td><td>Gly</td><td>To be</td><td>Gly</td><td></td>
<td></td><td> 450</td><td></td><td></td><td></td><td></td><td> 455</td><td></td><td></td><td></td><td></td><td> 460</td><td></td><td></td><td></td><td></td><td></td>
<td>CTG</td><td>GCC</td><td>CTC</td><td>ATC</td><td>CAC</td><td>CAT</td><td>AAC</td><td>ACC</td><td>CAC</td><td>CTC</td><td>TGC</td><td>TTC</td><td>GTG</td><td>CAC</td><td>ACG</td><td>GTG</td><td> 1440</td>
<td>Leu</td><td>To</td><td>Leu</td><td>lie</td><td>His</td><td>His</td><td>Asn</td><td>Thr</td><td>His</td><td>Leu</td><td>Cys</td><td>Phe</td><td>Val</td><td>His</td><td>Thr</td><td>Val</td><td></td>
<td> 465</td><td></td><td></td><td></td><td></td><td> 470</td><td></td><td></td><td></td><td></td><td> 475</td><td></td><td></td><td></td><td></td><td> 480</td><td></td>
-7272
<td>ccc</td><td>TGG</td><td>GAC</td><td>CAG</td><td>CTC</td><td>TTT</td><td>CGG</td><td>AAC</td><td>CCG</td><td>CAC</td><td>CAA</td><td>GCT</td><td>CTG</td><td>CTC</td><td>CAC</td><td>ACT</td><td> 1488</td>
<td>Pro</td><td>Trp</td><td>Asp</td><td>G1n</td><td>Leu</td><td>Phe</td><td>Arg</td><td>Asn</td><td>Pro</td><td>His</td><td>Gln</td><td>To</td><td>Leu</td><td>Leu</td><td>His</td><td>Thr</td><td></td>
<td></td><td></td><td></td><td></td><td> 485</td><td></td><td></td><td></td><td></td><td> 490</td><td></td><td></td><td></td><td></td><td> 495</td><td></td><td></td>
<td>GCC</td><td>AAC</td><td>CGG</td><td>CCA</td><td>GAG</td><td>GAC</td><td>GAG</td><td>TGT</td><td>GTG</td><td>GGC</td><td>GAG</td><td>GGC</td><td>CTG</td><td>GCC</td><td>TGC</td><td>CAC</td><td> 1536</td>
<td>To</td><td>Asn</td><td>Arg</td><td>Pro</td><td>Glu</td><td>Asp</td><td>Glu</td><td>Cys</td><td>Val</td><td>Gly</td><td>Glu</td><td>Gly</td><td>Leu</td><td>To</td><td>Cys</td><td>His</td><td></td>
<td></td><td></td><td></td><td> 500</td><td></td><td></td><td></td><td></td><td> 505</td><td></td><td> '·</td><td></td><td></td><td> 510</td><td></td><td></td><td></td>
<td>CAG</td><td>CTG</td><td>TGC</td><td>GCC</td><td>CGA</td><td>GGG</td><td>CAC</td><td>TGC</td><td>TGG</td><td>GGT</td><td>CCA</td><td>GGG</td><td>CCC</td><td>ACC</td><td>CAG</td><td>TGT</td><td> 1584</td>
<td>Gln</td><td>Leu</td><td>Cys</td><td>To</td><td>Arg</td><td>Gly</td><td>His</td><td>Cys</td><td>Trp</td><td>Gly</td><td>Pro</td><td>Gly</td><td>Pro</td><td>Thr</td><td>Gln</td><td>Cys</td><td></td>
<td></td><td></td><td> 515</td><td></td><td></td><td></td><td></td><td> 520</td><td></td><td></td><td></td><td></td><td> 525</td><td></td><td></td><td></td><td></td>
<td>GTC</td><td>AAC</td><td>TGC</td><td>AGC</td><td>CAG</td><td>TTC</td><td>in</td><td>CGG</td><td>GGC</td><td>CAG</td><td>GAG</td><td>TGC</td><td>GTG</td><td>GAG</td><td>GAA</td><td>TGC</td><td> 1632</td>
<td>Val</td><td>Asn</td><td>Cys</td><td>To be</td><td>Gln</td><td>Phe</td><td>Leu</td><td>Arg</td><td>Gly</td><td>Gln</td><td>Glu</td><td>Cys</td><td>Val</td><td>Glu</td><td>Glu</td><td>Cys</td><td></td>
<td></td><td> 530</td><td></td><td></td><td></td><td></td><td> 535</td><td></td><td></td><td></td><td></td><td> 540</td><td></td><td></td><td></td><td></td><td></td>
<td>CGA</td><td>Gta</td><td>CTG</td><td>CAG</td><td>GGG</td><td>CTC</td><td>CCC</td><td>AGG</td><td>GAG</td><td>TAT</td><td>GTG</td><td>AAT</td><td>GCC</td><td>AGG</td><td>CAC</td><td>TGT</td><td> 1680</td>
<td>Arg</td><td>Val</td><td>Leu</td><td>Gln</td><td>Gly</td><td>Leu</td><td>Pro</td><td>Arg</td><td>Glu</td><td>Tyr</td><td>Val</td><td>Asn</td><td>To</td><td>Arg</td><td>His</td><td>Cys</td><td></td>
<td> 545</td><td></td><td></td><td></td><td></td><td> 550</td><td></td><td></td><td></td><td></td><td> 555</td><td></td><td></td><td></td><td></td><td> 560</td><td></td>
<td>TTG</td><td>CCG</td><td>TGC</td><td>CAC</td><td>CCT</td><td>GAG</td><td>TGT</td><td>CAG</td><td>CCC</td><td>CAG</td><td>AAT</td><td>GGC</td><td>TCA</td><td>GTG</td><td>ACC</td><td>TGT</td><td> 1728</td>
<td>Leu</td><td>Pro</td><td>Cys</td><td>HIS</td><td>Pro</td><td>Glu</td><td>Cys</td><td>Gln</td><td>Pro</td><td>Gln</td><td>Asn</td><td>Gly</td><td>To be</td><td>Val</td><td>Thr</td><td>Cys</td><td></td>
<td></td><td></td><td></td><td></td><td> 565</td><td></td><td></td><td></td><td></td><td> 570</td><td></td><td></td><td></td><td></td><td> 575</td><td></td><td></td>
<td>TTT</td><td>GGA</td><td>CCG</td><td>GAG</td><td>GCT</td><td>GAC</td><td>CAG</td><td>TGT</td><td>GTG</td><td>GCC</td><td>TGT</td><td>GCC</td><td>CAC</td><td>TAT</td><td>AAG</td><td>GAC</td><td> 1776</td>
<td>Phe</td><td>Gly</td><td>Pro</td><td>Glu</td><td>To</td><td>Asp</td><td>Gln</td><td>Cys</td><td>Val</td><td>To</td><td>Cys</td><td>To</td><td>His</td><td>Tyr</td><td>Lys</td><td>Asp</td><td></td>
<td></td><td></td><td></td><td> 580</td><td></td><td></td><td></td><td></td><td> 585</td><td></td><td></td><td></td><td></td><td> 590</td><td></td><td></td><td></td>
<td>CCT</td><td>CCC</td><td>TTC</td><td>TGC</td><td>GTG</td><td>GCC</td><td>CGC</td><td>TGC</td><td>CCC</td><td>AGC</td><td>GGT</td><td>GTG</td><td>AAA</td><td>CCT</td><td>GAC</td><td>CTC</td><td> 1824</td>
<td>Pro</td><td>Pro</td><td>Phe</td><td>Cys</td><td>Val</td><td>To</td><td>Arg</td><td>Cys</td><td>Pro</td><td>To be</td><td>Gly</td><td>Val</td><td>Lys</td><td>Pro</td><td>Asp</td><td>Leu</td><td></td>
<td></td><td></td><td> 595</td><td></td><td></td><td></td><td></td><td> 600</td><td></td><td></td><td></td><td></td><td> 605</td><td></td><td></td><td></td><td></td>
<td>CBT</td><td>TAC</td><td>ATG</td><td>CCC</td><td>ATC</td><td>TGG</td><td>AAG</td><td>TTT</td><td>CCA</td><td>GAT</td><td>GAG</td><td>GAG</td><td>GGC</td><td>GCA</td><td>TGC</td><td>CAG</td><td> 1872</td>
<td>To be</td><td>Tyr</td><td>Met</td><td>Pro</td><td>lie</td><td>Trp</td><td>Lys</td><td>Phe</td><td>Pro</td><td>Asp</td><td>Glu</td><td>Glu</td><td>Gly</td><td>To</td><td>Cys</td><td>Gln</td><td></td>
<td></td><td> 610</td><td></td><td></td><td></td><td></td><td> 615</td><td></td><td></td><td></td><td></td><td> 620</td><td></td><td></td><td></td><td></td><td></td>
<td>CCT</td><td>TGC</td><td>CCC</td><td>ATC</td><td>AAC</td><td>TGC</td><td>ACC</td><td>CAC</td><td>CBT</td><td>TGT</td><td>GTG</td><td>GAC</td><td>CTG</td><td>GAT</td><td>GAC</td><td>AAG</td><td> 1920</td>
<td>Pro</td><td>Cys</td><td>Pro</td><td>lie</td><td>Asn</td><td>Cys</td><td>Thr</td><td>His</td><td>To be</td><td>Cys</td><td>Val</td><td>Asp</td><td>Leu</td><td>Asp</td><td>Asp</td><td>Lys</td><td></td>
<td> 625</td><td></td><td></td><td></td><td></td><td> 630</td><td></td><td></td><td></td><td></td><td> 635</td><td></td><td></td><td></td><td></td><td> 640</td><td></td>
<td>GGC</td><td>TGC</td><td>CCC</td><td>GCC</td><td>GAG</td><td>CAG</td><td>AGA</td><td>GCC</td><td>AGC</td><td>CCT</td><td>CTG</td><td>ACG</td><td>CBT</td><td>ATC</td><td>ATC</td><td>TCT</td><td> 1968</td>
<td>Gly</td><td>Cys</td><td>Pro</td><td>To</td><td>Glu</td><td>Gln</td><td>Arg</td><td>To</td><td>To be</td><td>Pro</td><td>Leu</td><td>Thr</td><td>To be</td><td>lie</td><td>lie</td><td>To be</td><td></td>
<td></td><td></td><td></td><td></td><td> 645</td><td></td><td></td><td></td><td></td><td> 650</td><td></td><td></td><td></td><td></td><td> 655</td><td></td><td></td>
-7373
<td>GCG</td><td>GTG</td><td>GTT</td><td>GGC</td><td>ΑΤΊ</td><td>'CTG</td><td>i CTG</td><td>i GTC</td><td>GTG</td><td>GTC</td><td>TTG</td><td>GGG</td><td>GTG</td><td>GTC</td><td>πτ</td><td>GGG</td><td> 2016</td>
<td>To</td><td>Val</td><td>Val</td><td>Gly</td><td>lie</td><td>Leu</td><td>Leu</td><td>Val</td><td>Val</td><td>Val</td><td>Leu</td><td>Gly</td><td>Val</td><td>Val</td><td>Phe</td><td>Gly</td><td></td>
<td></td><td></td><td></td><td> 660</td><td></td><td></td><td></td><td></td><td> 665</td><td></td><td></td><td></td><td></td><td> 670</td><td></td><td></td><td></td>
<td>ATC</td><td>CTC</td><td>ATC</td><td>AAG</td><td>CGA</td><td>CGG</td><td>CAG</td><td>CAG</td><td>AAG</td><td>ATC</td><td>CGG</td><td>AAG</td><td>TAC</td><td>ACG</td><td>ATG</td><td>CGG</td><td> 2064</td>
<td>I have</td><td>Leu</td><td>lie</td><td>Lys</td><td>Arg</td><td>Arg</td><td>Gln</td><td>Gln</td><td>Lys</td><td>lie</td><td>Arg</td><td>Lys</td><td>Tyr</td><td>Thr</td><td>Met</td><td>Arg</td><td></td>
<td></td><td></td><td> 675</td><td></td><td></td><td></td><td></td><td> 680</td><td></td><td></td><td></td><td></td><td> 685</td><td></td><td></td><td></td><td></td>
<td>AGA</td><td>CTG</td><td>CTG</td><td>CAG</td><td>GAA</td><td>ACG</td><td>GAG</td><td>CTG</td><td>GTG</td><td>GAG</td><td>CCG.</td><td>CTG</td><td>HERE</td><td>CCT</td><td>AGC</td><td>GGA</td><td> 2112</td>
<td>Arg</td><td>Leu</td><td>Leu</td><td>Gln</td><td>Glu</td><td>Thr</td><td>Glu</td><td>Leu</td><td>Val</td><td>Glu</td><td>Pro</td><td>Leu</td><td>Thr</td><td>Pro</td><td>To be</td><td>Gly</td><td></td>
<td></td><td> 690</td><td></td><td></td><td></td><td></td><td> 695</td><td></td><td></td><td></td><td></td><td> 700</td><td></td><td></td><td></td><td></td><td></td>
<td>GCG</td><td>ATG</td><td>CCC</td><td>AAC</td><td>CAG</td><td>GCG</td><td>CAG</td><td>ATG</td><td>CGG</td><td>ATC</td><td>CTG</td><td>AAA</td><td>GAG</td><td>ACG</td><td>GAG</td><td>CTG</td><td> 2160</td>
<td>To</td><td>Met</td><td>Pro</td><td>Asn</td><td>Gln</td><td>To</td><td>Gln</td><td>Met</td><td>Arg</td><td>lie</td><td>Leu</td><td>Lys</td><td>Glu</td><td>Thr</td><td>Glu</td><td>Leu</td><td></td>
<td> 705</td><td></td><td></td><td></td><td></td><td> 710</td><td></td><td></td><td></td><td></td><td> 715</td><td></td><td></td><td></td><td></td><td> 720</td><td></td>
<td>AGG</td><td>AAG</td><td>GTG</td><td>AAG</td><td>GTG</td><td>in</td><td>GGA</td><td>TCT</td><td>GGC</td><td>GCT</td><td>TTT</td><td>GGC</td><td>HERE</td><td>GTC</td><td>TAC</td><td>AAG</td><td> 2208</td>
<td>Arg</td><td>Lys</td><td>Val</td><td>Lys</td><td>Val</td><td>Leu</td><td>Gly</td><td>To be</td><td>Gly</td><td>To</td><td>Phe</td><td>Gly</td><td>Thr</td><td>Val</td><td>Tyr</td><td>Lys</td><td></td>
<td></td><td></td><td></td><td></td><td> 725</td><td></td><td></td><td></td><td></td><td> 730</td><td></td><td></td><td></td><td></td><td> 735</td><td></td><td></td>
<td>GGC</td><td>ATC</td><td>TGG</td><td>ATC</td><td>CCT</td><td>GAT</td><td>GGG</td><td>GAG</td><td>AAT</td><td>GTG</td><td>AAA</td><td>ATT</td><td>CCA</td><td>GTG</td><td>GCC</td><td>ATC</td><td> 2256</td>
<td>Gly</td><td>lie</td><td>Trp</td><td>lie</td><td>Pro</td><td>Asp</td><td>Gly</td><td>Glu</td><td>Asn</td><td>Val</td><td>Lys</td><td>lie</td><td>Pro</td><td>Val</td><td>To</td><td>lie</td><td></td>
<td></td><td></td><td></td><td> 740</td><td></td><td></td><td></td><td></td><td> 745</td><td></td><td></td><td></td><td></td><td> 750</td><td></td><td></td><td></td>
<td>AAA</td><td>GTG</td><td>TTG</td><td>AGG</td><td>GAA</td><td>AAC</td><td>HERE</td><td>CBT</td><td>CCC</td><td>AAA</td><td>GCC</td><td>AAC</td><td>AAA</td><td>GAA</td><td>ATC</td><td>TTA</td><td> 2304</td>
<td>Lys</td><td>Val</td><td>Leu</td><td>Arg</td><td>Glu</td><td>Asn</td><td>Thr</td><td>To be</td><td>Pro</td><td>Lys</td><td>To</td><td>Asn</td><td>Lys</td><td>Glu</td><td>lie</td><td>Leu</td><td></td>
<td></td><td></td><td> 755</td><td></td><td></td><td></td><td></td><td> 760</td><td></td><td></td><td></td><td></td><td> 765</td><td></td><td></td><td></td><td></td>
<td>GAC</td><td>GAA</td><td>GCA</td><td>TAC</td><td>GTG</td><td>ATG</td><td>GCT</td><td>GGT</td><td>GTG</td><td>GGC</td><td>CBT</td><td>CCA</td><td>TAT</td><td>GTC</td><td>CBT</td><td>CGC</td><td> 2352</td>
<td>Asp</td><td>Glu</td><td>To</td><td>Tyr</td><td>Val</td><td>Met</td><td>To</td><td>Gly</td><td>Val</td><td>Gly</td><td>To be</td><td>Pro</td><td>Tyr</td><td>Val</td><td>To be</td><td>Arg</td><td></td>
770 775 780
<td>in</td><td>CTG</td><td>GGC</td><td>ATC</td><td>TGC</td><td>CTG</td><td>HERE</td><td>CBT</td><td>ACG</td><td>GTG</td><td>CAG</td><td>CTG</td><td>GTG</td><td>HERE</td><td>CAG</td><td>in</td><td> 2400</td>
<td>Leu</td><td>Leu</td><td>Gly</td><td>lie</td><td>Cys</td><td>Leu</td><td>Thr</td><td>To be</td><td>Thr</td><td>Val</td><td>Gln</td><td>Leu</td><td>Val</td><td>Thr</td><td>Gln</td><td>Leu</td><td></td>
<td> 785</td><td></td><td></td><td></td><td></td><td> 790</td><td></td><td></td><td></td><td></td><td> 795</td><td></td><td></td><td></td><td></td><td> 800</td><td></td>
<td>ATG</td><td>CCC</td><td>TAT</td><td>GGC</td><td>TGC</td><td>CTC</td><td>TTA</td><td>GAC</td><td>CAT</td><td>GTC</td><td>CGG</td><td>GAA</td><td>AAC</td><td>CGC</td><td>GGA</td><td>CGC</td><td> 2448</td>
<td>Met</td><td>Pro</td><td>Tyr</td><td>Gly</td><td>Cys</td><td>Leu</td><td>Leu</td><td>Asp</td><td>His</td><td>Val</td><td>Arg</td><td>Glu</td><td>Asn</td><td>Arg</td><td>Gly</td><td>Arg</td><td></td>
<td></td><td></td><td></td><td></td><td> 805</td><td></td><td></td><td></td><td></td><td> 810</td><td></td><td></td><td></td><td></td><td> 815</td><td></td><td></td>
<td>CTG</td><td>GGC</td><td>CBT</td><td>CAG</td><td>GAC</td><td>CTG</td><td>CTG</td><td>AAC</td><td>TGG</td><td>TGT</td><td>ATG</td><td>CAG</td><td>ATT</td><td>GCC</td><td>AAG</td><td>GGG</td><td> 2496</td>
<td>Leu</td><td>Gly</td><td>To be</td><td>Gln</td><td>Asp</td><td>Leu</td><td>Leu</td><td>Asn</td><td>Trp</td><td>Cys</td><td>Met</td><td>Gln</td><td>lie</td><td>To</td><td>Lys</td><td>Gly</td><td></td>
<td></td><td></td><td></td><td> 820</td><td></td><td></td><td></td><td></td><td> 825</td><td></td><td></td><td></td><td></td><td> 830</td><td></td><td></td><td></td>
-7474
<td>ATG</td><td>AGC</td><td>TAC</td><td>CTG i</td><td>GAG '</td><td>GAT </td><td>GTG</td><td>CGG</td><td>CTC</td><td>Gta</td><td>CAC</td><td>AGG</td><td>GAC</td><td>TTG</td><td>GCC</td><td>GCT</td><td> 2544</td>
<td>Met</td><td>To be</td><td>Tyr</td><td>Leu i</td><td>Glu</td><td>Asp</td><td>Val</td><td>Arg</td><td>Leu</td><td>Val</td><td>His</td><td>Arg</td><td>Asp</td><td>Leu</td><td>To</td><td>To</td><td></td>
<td></td><td> 835</td><td></td><td></td><td></td><td></td><td> 840</td><td></td><td></td><td></td><td colspan="2"> 845</td><td></td><td></td><td></td><td></td><td></td>
<td>CGG</td><td>AAC</td><td>GTG</td><td>CTG</td><td>GTC</td><td>AAG</td><td>AGT</td><td>CCC</td><td>AAC</td><td>CAT</td><td>GTC</td><td>AAA</td><td>ATT</td><td>HERE</td><td>GAC</td><td>TTC</td><td> 2592</td>
<td>Arg</td><td>Asn</td><td>Val</td><td>Leu</td><td>Val</td><td>Lys</td><td>To be</td><td>Pro</td><td>Asn</td><td>His</td><td>Val</td><td>Lys</td><td>lie</td><td>Thr</td><td rowspan="2">Asp</td><td>Phe</td><td></td>
<td></td><td> 850</td><td></td><td></td><td></td><td></td><td> 855</td><td></td><td></td><td></td><td></td><td> 860</td><td></td><td></td><td></td><td></td>
<td>GGG</td><td>CTG</td><td>GCT</td><td>CGG</td><td>CTG</td><td>CTG</td><td>GAC</td><td>ATT</td><td>GAC</td><td>GAG</td><td>HERE</td><td>GAG</td><td>TAC</td><td>CAT</td><td>GCA</td><td>GAT</td><td> 2640</td>
<td>Gly</td><td>Leu</td><td>To</td><td>Arg</td><td>Leu</td><td>Leu</td><td>Asp</td><td>lie</td><td>Asp</td><td>Glu</td><td>Thr</td><td>Glu</td><td>Tyr</td><td>His</td><td>To</td><td>Asp</td><td></td>
<td> 865</td><td></td><td></td><td></td><td></td><td> 870</td><td></td><td></td><td></td><td></td><td> 875</td><td></td><td></td><td></td><td></td><td> 880</td><td></td>
<td>GGG</td><td>GGC</td><td>AAG</td><td>GTG</td><td>CCC</td><td>ATC</td><td>AAG</td><td>TGG</td><td>ATG</td><td>GCG</td><td>CTG</td><td>GAG</td><td>CBT</td><td>ATT</td><td>CTC</td><td>CGC</td><td> 2688</td>
<td>Gly</td><td>Gly</td><td>Lys</td><td>Val</td><td>Pro</td><td>lie</td><td>Lys</td><td>Trp</td><td>Met</td><td>To</td><td>Leu</td><td>Glu</td><td>To be</td><td>lie</td><td>Leu</td><td>Arg</td><td></td>
<td></td><td></td><td></td><td></td><td> 885</td><td></td><td></td><td></td><td></td><td> 890</td><td></td><td></td><td></td><td></td><td> 895</td><td></td><td></td>
<td>CGG</td><td>CGG</td><td>TTC</td><td>ACC</td><td>CAC</td><td>CAG</td><td>AGT</td><td>GAT</td><td>GTG</td><td>TGG</td><td>AGT</td><td>TAT</td><td>GGT</td><td>GTG</td><td>ACT</td><td>GTG</td><td> 2736</td>
<td>Arg</td><td>Arg</td><td>Phe</td><td>Thr</td><td>His</td><td>Gln</td><td>To be</td><td>Asp</td><td>Val</td><td>Trp</td><td>To be</td><td>Tyr</td><td>Gly</td><td>val</td><td>Thr</td><td>Val</td><td></td>
<td></td><td></td><td></td><td> 900</td><td></td><td></td><td></td><td></td><td> 905</td><td></td><td></td><td></td><td></td><td> 910</td><td></td><td></td><td></td>
<td>TGG</td><td>GAG</td><td>CTG</td><td>ATG</td><td>ACT</td><td>ΤΓΤ</td><td>GGG</td><td>GCC</td><td>AAA</td><td>CCT</td><td>TAC</td><td>GAT</td><td>GGG</td><td>ATC</td><td>CCA</td><td>GCC</td><td> 2784</td>
<td>Trp</td><td>Glu</td><td>Leu</td><td>Met</td><td>Thr</td><td>Phe</td><td>Gly</td><td>To</td><td>Lys</td><td>Pro</td><td>Tyr</td><td>Asp</td><td>Gly</td><td>lie</td><td>Pro</td><td>To</td><td></td>
<td></td><td></td><td> 915</td><td></td><td></td><td></td><td></td><td> 920</td><td></td><td></td><td></td><td></td><td> 925</td><td></td><td></td><td></td><td></td>
<td>CGG</td><td>GAG</td><td>ATC</td><td>CCT</td><td>GAC</td><td>CTG</td><td>CTG</td><td>GAA</td><td>AAG</td><td>GGG</td><td>GAG</td><td>CGG</td><td>CTG</td><td>CCC</td><td>CAG</td><td>CCC</td><td> 2832</td>
<td>Arg</td><td>Glu</td><td>lie</td><td>Pro</td><td>Asp</td><td>Leu</td><td>Leu</td><td>Glu</td><td>Lys</td><td>Gly</td><td>Glu</td><td>Arg</td><td>Leu</td><td>Pro</td><td>Gln</td><td>Pro</td><td></td>
<td></td><td> 930</td><td></td><td></td><td></td><td></td><td> 935</td><td></td><td></td><td></td><td></td><td> 940</td><td></td><td></td><td></td><td></td><td></td>
<td>CCC</td><td>ATC</td><td>TGC</td><td>ACC</td><td>ATT</td><td>GAT</td><td>GTC</td><td>TAC</td><td>ATG</td><td>ATC</td><td>ATG</td><td>GTC</td><td>AAA</td><td>TGT</td><td>TGG</td><td>ATG</td><td> 2880</td>
<td>Pro</td><td>lie</td><td>Cys</td><td>Thr</td><td>lie</td><td>Asp</td><td>Val</td><td>Tyr</td><td>Met</td><td>I have</td><td>Met</td><td>Val</td><td>Lys</td><td>Cys</td><td>Trp</td><td>Met</td><td></td>
<td> 945</td><td></td><td></td><td></td><td></td><td> 950</td><td></td><td></td><td></td><td></td><td> 955</td><td></td><td></td><td></td><td></td><td> 960</td><td></td>
<td>ΑΠ</td><td>GAC</td><td>TCT</td><td>GAA</td><td>TGT</td><td>CGG</td><td>CCA</td><td>AGA</td><td>TTC</td><td>CGG</td><td>GAG</td><td>TTG</td><td>GTG</td><td>TCT</td><td>GAA</td><td>TTC</td><td> 2928</td>
<td>lie</td><td>Asp</td><td>To be</td><td>Glu</td><td>Cys</td><td>Arg</td><td>Pro</td><td>Arg</td><td>Phe</td><td>Arg</td><td>Glu</td><td>Leu</td><td>Val</td><td>To be</td><td>Glu</td><td>Phe</td><td></td>
<td></td><td></td><td></td><td></td><td> 965</td><td></td><td></td><td></td><td></td><td> 970</td><td></td><td></td><td></td><td></td><td> 975</td><td></td><td></td>
<td>CBT</td><td>CGC</td><td>ATG</td><td>GCC</td><td>AGG</td><td>GAC</td><td>CCC</td><td>CAG</td><td>CGC</td><td>TTT</td><td>GTG</td><td>GTC</td><td>ATC</td><td>CAG</td><td>AAT</td><td>GAG</td><td> 2976</td>
<td>To be</td><td>Arg</td><td>Met</td><td>To</td><td>Arg</td><td>Asp</td><td>Pro</td><td>Gln</td><td>Arg</td><td>Phe</td><td>Val</td><td>Val</td><td>lie</td><td>Gln</td><td>Asn</td><td>Glu</td><td></td>
<td></td><td></td><td></td><td> 980</td><td></td><td></td><td></td><td></td><td> 985</td><td></td><td></td><td></td><td></td><td> 990</td><td></td><td></td><td></td>
<td>GAC</td><td>TTG</td><td>GGC</td><td>CCA</td><td>GCC</td><td>AGT</td><td>CCC</td><td>TTG</td><td>GAC</td><td>AGC</td><td>ACC</td><td>TTC</td><td>TAC</td><td>CGC</td><td>TCA</td><td>CTG</td><td> 3024</td>
<td>Asp</td><td>Leu</td><td>Gly</td><td>Pro</td><td>To</td><td>To be</td><td>Pro</td><td>Leu</td><td>Asp</td><td>To be</td><td>Thr</td><td>Phe</td><td>Tyr</td><td>Arg</td><td>To be</td><td>Leu</td><td></td>
995 1000 1005
-7575
CTG GAG GAC GAT GAC ATG GGG GAC CTG GTG GAT GCT GAG GAG TAT CTG
Leu Glu Asp Asp Asp Met Gly Asp Leu Val Asp Ala Glu Glu Tyr Leu 1010 1015 1020
3072
3120
3168
3216
<td>Gta</td><td>CCC</td><td>CAG</td><td>CAG</td><td>GGC</td><td>TTC</td><td>TTC</td><td>TGT</td><td>CCA</td><td>GAC CCT</td><td>GCC</td><td>CCG</td><td>GGC</td><td>GCT</td><td>GGG</td>
<td>Val</td><td>Pro</td><td>Gln</td><td>Gln</td><td>Gly</td><td>Phe</td><td>Phe</td><td>Cys</td><td>Pro</td><td>Asp Pro</td><td>To</td><td>Pro</td><td>Gly</td><td>To</td><td>Gly</td>
<td colspan="2"> 1025</td><td></td><td></td><td></td><td colspan="2"> 1030</td><td></td><td></td><td colspan="2"> 1035</td><td></td><td></td><td></td><td> 1040</td>
<td>GGC</td><td>ATG</td><td>GTC</td><td>CAC</td><td>CAC</td><td>AGG</td><td>CAC</td><td>CGC</td><td>AGC</td><td>TCA TCT</td><td>ACC</td><td>AGG</td><td>AGT</td><td>GGC</td><td>GGT</td>
<td>Gly</td><td>Met</td><td>Val</td><td>His</td><td>His</td><td>Arg</td><td>His</td><td>Arg</td><td>To be</td><td>Be be</td><td>Thr</td><td>Arg</td><td>To be</td><td>Gly</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td colspan="2"> 1045</td><td></td><td></td><td></td><td> 1050</td><td></td><td></td><td></td><td colspan="2"> 1055</td>
<td>GGG</td><td>GAC</td><td>CTG</td><td>HERE</td><td>CTA</td><td>GGG</td><td>CTG</td><td>GAG</td><td>CCC</td><td>TCT GAA</td><td>GAG</td><td>GAG</td><td>GCC</td><td>CCC</td><td>AGG</td>
<td>Gly</td><td>Asp</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Gly</td><td>Leu</td><td>Glu</td><td>Pro</td><td>Be glu</td><td>Glu</td><td>Glu</td><td>To</td><td>Pro</td><td>Arg</td>
<td></td><td></td><td></td><td colspan="2"> 1060</td><td></td><td></td><td></td><td colspan="2"> 1065</td><td></td><td></td><td colspan="2"> 1070</td><td></td>
<td>TCT</td><td>CCA</td><td>CTG</td><td>GCA</td><td>CCC</td><td>CBT</td><td>GAA</td><td>GGG</td><td>GCT</td><td>GGC</td><td>CBT</td><td>GAT</td><td>Gta</td><td>TTT</td><td>GAT</td><td>GGT</td><td> 3264</td>
<td>To be</td><td>Pro</td><td>Leu</td><td>To</td><td>Pro</td><td>To be</td><td>Glu</td><td>Gly</td><td>To</td><td>Gly</td><td>To be</td><td>Asp</td><td>Val</td><td>Phe</td><td>Asp</td><td>Gly</td><td></td>
<td></td><td></td><td colspan="2"> 1075</td><td></td><td></td><td></td><td colspan="2"> 1080</td><td></td><td></td><td></td><td colspan="2"> 1085</td><td></td><td></td><td></td>
<td>GAC</td><td>CTG</td><td>GGA</td><td>ATG</td><td>GGG</td><td>GCA</td><td>GCC</td><td>AAG</td><td>GGG</td><td>CTG</td><td>CAA</td><td>AGC</td><td>CTC</td><td>CCC</td><td>HERE</td><td>CAT</td><td> 3312</td>
<td>Asp</td><td>Leu</td><td>Gly</td><td>Met</td><td>Gly</td><td>To</td><td>To</td><td>Lys</td><td>Gly</td><td>Leu</td><td>Gln</td><td>To be</td><td>Leu</td><td>Pro</td><td>Thr</td><td>His</td><td></td>
<td></td><td colspan="2"> 1090</td><td></td><td></td><td></td><td colspan="2"> 1095</td><td></td><td></td><td></td><td colspan="2"> 1100</td><td></td><td></td><td></td><td></td>
<td>GAC</td><td>CCC</td><td>AGC</td><td>CCT</td><td>CTA</td><td>CAG</td><td>CGG</td><td>TAC</td><td>AGT</td><td>GAG</td><td>GAC</td><td>CCC</td><td>HERE</td><td>Gta</td><td>CCC</td><td>CTG</td><td> 3360</td>
<td>Asp</td><td>Pro</td><td>To be</td><td>Pro</td><td>Leu</td><td>Gln</td><td>Arg</td><td>Tyr</td><td>To be</td><td>Glu</td><td>Asp</td><td>Pro</td><td>Thr</td><td>Val</td><td>Pro</td><td>Leu</td><td></td>
<td colspan="2"> 1105</td><td></td><td></td><td></td><td colspan="2"> 1110</td><td></td><td></td><td></td><td colspan="2"> 1115</td><td></td><td></td><td></td><td> 1120</td><td></td>
<td>CCC</td><td>TCT</td><td>GAG</td><td>ACT</td><td>GAT</td><td>GGC</td><td>TAC</td><td>GTT</td><td>GCC</td><td>CCC</td><td>CTG</td><td>ACC</td><td>TGC</td><td>AGC</td><td>CCC</td><td>CAG</td><td> 3408</td>
<td>Pro</td><td>To be</td><td>Glu</td><td>Thr</td><td>Asp</td><td>Gly</td><td>Tyr</td><td>Val</td><td>To</td><td>Pro</td><td>Leu</td><td>Thr</td><td>Cys</td><td>To be</td><td>Pro</td><td>Gln</td><td></td>
<td></td><td></td><td></td><td></td><td colspan="2"> 1125</td><td></td><td></td><td></td><td colspan="2"> 1130</td><td></td><td></td><td></td><td colspan="2"> 1135</td><td></td>
<td>CCT</td><td>GAA</td><td>TAT</td><td>GTG</td><td>AAC</td><td>CAG</td><td>CCA</td><td>GAT</td><td>GTT</td><td>CGG</td><td>CCC</td><td>CAG</td><td>CCC</td><td>CCT</td><td>TCG</td><td>CCC</td><td> 3456</td>
<td>Pro</td><td>Glu</td><td>Tyr</td><td>Val</td><td>Asn</td><td>Gln</td><td>Pro</td><td>Asp</td><td>Val</td><td>Arg</td><td>Pro</td><td>Gln</td><td>Pro</td><td>Pro</td><td>To be</td><td>Pro</td><td></td>
<td></td><td></td><td></td><td colspan="2"> 1140</td><td></td><td></td><td></td><td colspan="2"> 1145</td><td></td><td></td><td></td><td colspan="2"> 1150</td><td></td><td></td>
<td>CGA</td><td>GAG</td><td>GGC</td><td>CCT</td><td>CTG</td><td>CCT</td><td>GCT</td><td>GCC</td><td>CGA</td><td>CCT</td><td>GCT</td><td>GGT</td><td>GCC</td><td>ACT</td><td>CTG</td><td>GAA</td><td> 3504</td>
<td>Arg</td><td>Glu</td><td>Gly</td><td>Pro</td><td>Leu</td><td>Pro</td><td>To</td><td>To</td><td>Arg</td><td>Pro</td><td>To</td><td>Gly</td><td>To</td><td>Thr</td><td>Leu</td><td>Glu</td><td></td>
<td></td><td></td><td colspan="2"> 1155</td><td></td><td></td><td></td><td colspan="2"> 1160</td><td></td><td></td><td></td><td colspan="2"> 1165</td><td></td><td></td><td></td>
<td>AGG</td><td>CCC</td><td>AAG</td><td>ACT</td><td>CTC</td><td>CBT</td><td>CCA</td><td>GGG</td><td>AAG</td><td>AAT</td><td>GGG</td><td>GTC</td><td>GTC</td><td>AAA</td><td>GAC</td><td>GTT</td><td> 3552</td>
<td>Arg</td><td>Pro</td><td>Lys</td><td>Thr</td><td>Leu</td><td>To be</td><td>Pro</td><td>Gly</td><td>Lys</td><td>Asn</td><td>Gly</td><td>Val</td><td>Val</td><td>Lys</td><td>Asp</td><td>Val</td><td></td>
1170 1175 1180
-7676
<td>τπ</td><td>GCC</td><td>TTT</td><td>GGG</td><td>GGT</td><td>GCC</td><td>GTG</td><td>GAG</td><td>AAC</td><td>CCC</td><td>GAG TAC</td><td>TTG</td><td>HERE</td><td>CCC CAG</td><td> 3600</td>
<td>Phe</td><td>To</td><td>Phe</td><td>Gly</td><td>Gly</td><td>To</td><td>Val</td><td>Glu</td><td>Asn</td><td>Pro</td><td>Glu Tyr</td><td>Leu</td><td>Thr</td><td>Pro Gln</td><td></td>
<td colspan="2"> 1185</td><td></td><td></td><td></td><td> 119(</td><td> )</td><td></td><td></td><td></td><td> 1195</td><td></td><td></td><td> 1200</td><td></td>
<td>GGA</td><td>GGA</td><td>GCT</td><td>GCC</td><td>CCT</td><td>CAG</td><td>CCC</td><td>CAC</td><td>CCT</td><td>CCT</td><td>CCT GCC</td><td>TTC</td><td>AGC</td><td>CCA GCC</td><td> 3648</td>
<td>Gly</td><td>Gly</td><td>To</td><td>To</td><td>Pro</td><td>Gln</td><td>Pro</td><td>His</td><td>Pro</td><td>Pro</td><td>Pro Wing</td><td>Phe</td><td>To be</td><td>Pro Wing</td><td></td>
<td></td><td></td><td></td><td></td><td colspan="2"> 1205.</td><td></td><td></td><td></td><td colspan="2"> 1210</td><td></td><td></td><td> 1215</td><td></td>
<td>TTC</td><td>GAC</td><td>AAC</td><td>CTC</td><td>TAT</td><td>TAC</td><td>TGG</td><td>GAC</td><td>CAG</td><td>GAC</td><td>CCA CCA</td><td>GAG</td><td>CGG</td><td>GGG GCT</td><td> 3696</td>
<td>Phe</td><td>Asp</td><td>Asn</td><td>Leu</td><td>Tyr</td><td>Tyr</td><td>Trp</td><td>Asp</td><td>Gln</td><td>Asp</td><td>Pro Pro</td><td>Glu</td><td>Arg</td><td>Gly Ala</td><td></td>
<td></td><td></td><td></td><td colspan="2"> 1220</td><td></td><td></td><td></td><td colspan="2"> 1225</td><td></td><td></td><td colspan="2"> 1230</td><td></td>
<td>CCA</td><td>CCC</td><td>AGC</td><td>ACC</td><td>TTC</td><td>AAA</td><td>GGG</td><td>HERE</td><td>CCT</td><td>ACG</td><td>GCA GAG</td><td>AAC</td><td>CCA</td><td>GAG TAC</td><td> 3744</td>
<td>Pro</td><td>Pro</td><td>To be</td><td>Thr</td><td>Phe</td><td>Lys</td><td>Gly</td><td>Thr</td><td>Pro</td><td>Thr</td><td>Glu Wing</td><td>Asn</td><td>Pro</td><td>Glu Tyr</td><td></td>
<td></td><td></td><td> 123!</td><td></td><td></td><td></td><td></td><td colspan="2"> 1240</td><td></td><td></td><td colspan="2"> 1245</td><td></td><td></td>
<td>CTG</td><td>GGT</td><td>CTG</td><td>GAC</td><td>GTG</td><td>CCA</td><td>GTG</td><td>TGA</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3768</td>
<td>Leu</td><td>Gly</td><td>Leu</td><td>Asp</td><td>Val</td><td>Pro</td><td>Val</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 1251</td><td> 1</td><td></td><td></td><td></td><td> 125!</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
(2) INFORMATION FOR SEQ ID NO: 2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1255 amino acids (B) TYPE: amino acid (D) TOPOLOGY: 1 linear (ii) TYPE OF MOLECULA: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
-7777
Met Glu Leu Ala Ala Leu Cys Arg Trp Gly Leu Leu Leu Ala Leu Leu 15 10 15
<td>Pro</td><td>Pro</td><td rowspan="2">Gly</td><td>To</td><td>To</td><td>To be</td><td>Thr</td><td>Gln</td><td>Val Cys</td><td>Thr</td><td>Gly</td><td>Thr</td><td>Asp</td><td>Met</td><td>Lys</td>
<td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td> 30</td><td></td><td></td>
<td>Leu</td><td rowspan="2">Arg</td><td>Leu</td><td>Pro</td><td>To</td><td>To be</td><td>Pro</td><td>Glu</td><td>Thr His</td><td>Leu</td><td>Asp</td><td>Met</td><td>Leu</td><td>Arg</td><td>His</td>
<td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>
<td>Leu</td><td>Tyr</td><td>Gln</td><td rowspan="2">Gly</td><td>Cys</td><td>Gln</td><td>Val</td><td>Val</td><td>Gln Gly</td><td>Asn</td><td>Leu</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Tyr</td>
<td></td><td> 50</td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>
<td>Leu</td><td>Pro</td><td>Thr</td><td>Asn</td><td>To</td><td>To be</td><td>Leu</td><td>To be</td><td>Phe Leu</td><td>Gln</td><td>Asp</td><td>lie</td><td>Gln</td><td>Glu</td><td>Val</td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>
<td>Gln</td><td>Gly</td><td>Tyr</td><td>Val</td><td>Leu</td><td>lie</td><td>To</td><td>Hi S</td><td>Asn Gln</td><td>Val</td><td>Arg</td><td>Gln</td><td>Val</td><td>Pro</td><td>Leu</td>
90 95
<td colspan="2">Gln Arg Leu Arg</td><td rowspan="2">lie</td><td rowspan="2">Val Arg Gly Thr 105</td><td rowspan="2">Gln</td><td rowspan="2">Leu Phe</td><td rowspan="2">Glu</td><td rowspan="2">Asp 110</td><td rowspan="2">Asn</td><td rowspan="2">Tyr</td>
<td></td><td> 100</td>
<td>Ala Leu</td><td>Ala Val</td><td>Leu</td><td>Asp Asn Gly Asp</td><td>Pro</td><td>Leu Asn</td><td>Asn</td><td>Thr</td><td colspan="2">Thr Pro</td>
<td></td><td> 115</td><td></td><td> 120</td><td></td><td></td><td> 125</td><td></td><td></td><td></td>
<td>Val Thr</td><td>Gly Ala</td><td>To be</td><td>Pro Gly Gly Leu</td><td>Arg</td><td>Glu Leu</td><td>Gln</td><td>Leu</td><td colspan="2">Arg Ser</td>
<td> 130</td><td></td><td></td><td> 135</td><td></td><td> 140</td><td></td><td></td><td></td><td></td>
<td>Leu Thr</td><td>Glu lie</td><td>Leu</td><td>Lys Gly Gly Val</td><td>Leu</td><td>lie gln</td><td>Arg</td><td>Asn</td><td colspan="2">Pro Gln</td>
<td> 145</td><td></td><td></td><td> 150</td><td></td><td> 155</td><td></td><td></td><td></td><td> 160</td>
<td>Leu Cys</td><td>Tyr Gln</td><td>Asp</td><td colspan="3">Thr lie Leu Trp Lys Asp lie</td><td>Phe</td><td>His</td><td>Lys</td><td>Asn</td>
<td></td><td></td><td> 165</td><td></td><td> 170</td><td></td><td></td><td></td><td> 175</td><td></td>
<td>Asn Gln</td><td>Leu Ala</td><td>Leu</td><td>Thr Leu lie Asp</td><td>Thr</td><td>Asn Arg</td><td>To be</td><td>Arg</td><td>To</td><td>Cys</td>
<td></td><td> 180</td><td></td><td> 185</td><td></td><td></td><td></td><td> 190</td><td></td><td></td>
<td>His Pro</td><td>Cys Ser</td><td>Pro</td><td>Met Cys Lys Gly</td><td>To be</td><td>Arg Cys</td><td colspan="2">Trp Gly</td><td>Glu</td><td>To be</td>
<td></td><td> 195</td><td></td><td> 200</td><td></td><td></td><td> 205</td><td></td><td></td><td></td>
<td>Be glu</td><td>Asp Cys</td><td>Gln</td><td>Ser Leu Thr Arg</td><td>Thr</td><td colspan="5">Val Cys Ala Gly Gly Cys</td>
<td> 210</td><td></td><td></td><td> 215</td><td></td><td> 220</td><td></td><td></td><td></td><td></td>
<td>Ala Arg</td><td>Cys Lys</td><td>Gly</td><td>Pro Leu Pro Thr</td><td colspan="3">Asp Cys Cys His</td><td colspan="3">Glu Gln Cys</td>
<td> 225</td><td></td><td></td><td> 230</td><td></td><td> 235</td><td></td><td></td><td></td><td> 240</td>
-7878
<td>To</td><td>To</td><td>Gly</td><td>Cys</td><td>Thr</td><td>Gly</td><td>Pro</td><td>Lys</td><td>His</td><td>To be</td><td>Asp</td><td>Cys</td><td>Leu</td><td>To</td><td>Cys</td><td>Leu</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>
<td>H1 s</td><td>Phe</td><td>Asn</td><td>HiS</td><td>To be</td><td>Gly</td><td>lie</td><td>Cys</td><td>Glu</td><td>Leu</td><td>His</td><td>Cys</td><td>Pro</td><td>To</td><td>Leu</td><td>Val</td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>
<td>Thr</td><td rowspan="2">Tyr</td><td>Asn</td><td>Thr</td><td>Asp</td><td>Thr</td><td>Phe</td><td>Glu</td><td>To be</td><td>Met</td><td>Pro</td><td>Asn</td><td>Pro</td><td>Glu</td><td>Gly</td><td>Arg</td>
<td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td> ♦</td><td></td><td> 285</td><td></td><td></td><td></td>
<td>Tyr</td><td>Thr</td><td>Phe</td><td>Gly</td><td>To</td><td>To be</td><td>Cys</td><td>Val</td><td>Thr</td><td>To</td><td>Cys</td><td>Pro</td><td>Tyr</td><td>Asn</td><td>Tyr</td><td>Leu</td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>
<td>To be</td><td>Thr</td><td rowspan="2">Asp</td><td>Val</td><td>Gly</td><td>To be</td><td>Cys</td><td>Thr</td><td>Leu</td><td>Val</td><td>Cys</td><td>Pro</td><td>Leu</td><td>His</td><td>Asn</td><td>Gln</td>
<td> 305</td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>
<td>Glu</td><td>Val</td><td>Thr</td><td>To</td><td>Glu</td><td>Asp</td><td>Gly</td><td>Thr</td><td>Gln</td><td>Arg</td><td>Cys</td><td>Glu</td><td>Lys</td><td>Cys</td><td>To be</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>
<td>Pro</td><td>Cys</td><td>To</td><td>Arg</td><td>Val</td><td>Cys</td><td>Tyr</td><td>Gly</td><td>Leu</td><td>Gly</td><td>Met</td><td>Glu</td><td>His</td><td>Leu</td><td>Arg</td><td>Glu</td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>
<td>Val</td><td>Arg</td><td>To</td><td>Val</td><td>Thr</td><td>To be</td><td>To</td><td>Asn</td><td>lie</td><td>Gln</td><td>Glu</td><td>Phe</td><td>To</td><td>Gly</td><td>Cys</td><td rowspan="2">Lys</td>
<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td>
<td>Lys</td><td>lie</td><td>Phe</td><td>Gly</td><td>To be</td><td>Leu</td><td>To</td><td>Phe</td><td>Leu</td><td>Pro</td><td>Glu</td><td>To be</td><td>Phe</td><td>Asp</td><td>Gly</td><td rowspan="2">Asp</td>
<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td>
<td>Pro</td><td>To</td><td>To be</td><td>Asn</td><td>Thr</td><td>To</td><td>Pro</td><td>Leu</td><td>Gln</td><td>Pro</td><td>Glu</td><td>Gln</td><td>Leu</td><td>Gln</td><td>Val</td><td>Phe</td>
<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>
<td>Glu</td><td>Thr</td><td>Leu</td><td>Glu</td><td>Glu</td><td>lie</td><td>Thr</td><td>Gly</td><td>Tyr</td><td>Leu</td><td>Tyr</td><td>lie</td><td>To be</td><td>To</td><td>Trp</td><td>Pro</td>
<td></td><td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>
<td>Asp</td><td>To be</td><td>Leu</td><td>Pro</td><td>Asp</td><td>Leu</td><td>To be</td><td>Val</td><td>Phe</td><td>Gln</td><td>Asn</td><td>Leu</td><td>Gln</td><td>Val</td><td>lie</td><td rowspan="2">Arg</td>
<td></td><td></td><td></td><td> 420</td><td></td><td></td><td></td><td></td><td> 425</td><td></td><td></td><td></td><td></td><td> 430</td><td></td>
<td>Gly</td><td>Arg</td><td>lie</td><td>Leu</td><td>His</td><td>Asn</td><td>Gly</td><td>.To</td><td>Tyr</td><td>To be</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Gln</td><td>Gly</td><td>Leu</td>
<td></td><td></td><td> 435</td><td></td><td></td><td></td><td></td><td> 440</td><td></td><td></td><td></td><td></td><td> 445</td><td></td><td></td><td></td>
<td>Gly</td><td>lie</td><td>To be</td><td>Trp</td><td>Leu</td><td>Gly</td><td>Leu</td><td>Arg</td><td>To be</td><td>Leu</td><td>Arg</td><td>Glu</td><td>Leu</td><td>Gly</td><td>To be</td><td>Gly</td>
<td></td><td> 450</td><td></td><td></td><td></td><td></td><td> 455</td><td></td><td></td><td></td><td></td><td> 460</td><td></td><td></td><td></td><td></td>
<td>Leu</td><td>To</td><td>Leu</td><td>lie</td><td>His</td><td>His</td><td>Asn</td><td>Thr</td><td>His</td><td>Leu</td><td>Cys</td><td>Phe</td><td>Val</td><td>His</td><td>Thr</td><td>Val</td>
<td> 465</td><td></td><td></td><td></td><td></td><td> 470</td><td></td><td></td><td></td><td></td><td> 475</td><td></td><td></td><td></td><td></td><td> 480</td>
-7979
<td>Pro</td><td>Trp</td><td>Asp</td><td>Gln</td><td>Leu</td><td>Phe</td><td>Arg</td><td>Asn</td><td>Pro</td><td>His 1</td><td>Without</td><td>To</td><td>Leu</td><td>Leu</td><td>His</td><td>Thr</td>
<td></td><td></td><td></td><td></td><td> 485</td><td></td><td></td><td></td><td></td><td> 490</td><td></td><td></td><td></td><td></td><td> 495</td><td></td>
<td>To'</td><td>Asn</td><td>Arg</td><td>Pro</td><td>Glu.</td><td>Asp</td><td>Glu</td><td>Cys</td><td>Val</td><td>Gly 1</td><td>Glu</td><td>Gly</td><td>Leu</td><td>To</td><td>Cys</td><td>His</td>
<td></td><td></td><td></td><td> 500</td><td></td><td></td><td></td><td></td><td> 505</td><td></td><td></td><td></td><td></td><td> 510</td><td></td><td></td>
<td>Gln</td><td>Leu</td><td>Cys</td><td>To</td><td>Arg</td><td>Gly</td><td>His</td><td>Cys</td><td>Trp</td><td>Gly</td><td>Pro</td><td>Gly</td><td>Pro</td><td>Thr</td><td>Gln</td><td>Cys.</td>
<td></td><td></td><td> 515</td><td></td><td></td><td></td><td></td><td> 520</td><td></td><td></td><td></td><td></td><td> 525</td><td></td><td></td><td></td>
<td>Val</td><td>Asn</td><td>Cys</td><td>To be</td><td>Gln</td><td>Phe</td><td>Leu</td><td>Arg</td><td>Gly</td><td>Gln i</td><td>Glu</td><td>Cys</td><td>Val</td><td>Glu</td><td>Glu</td><td>Cys</td>
<td></td><td> 530</td><td></td><td></td><td></td><td></td><td> 535</td><td></td><td></td><td></td><td></td><td> 540</td><td></td><td></td><td></td><td></td>
<td>Arg</td><td>Val</td><td>Leu</td><td>Gln</td><td>Gly</td><td>Leu</td><td>Pro</td><td>Arg</td><td>Glu</td><td>Tyr</td><td>Val</td><td>Asn</td><td>To</td><td>Arg</td><td>His</td><td>Cys</td>
<td> 545</td><td></td><td></td><td></td><td></td><td> 550</td><td></td><td></td><td></td><td></td><td> 555</td><td></td><td></td><td></td><td></td><td> 560</td>
<td>Leu</td><td>Pro</td><td>Cys</td><td>His</td><td>Pro</td><td>Glu</td><td>Cys</td><td>Gln</td><td>Pro</td><td>Gln</td><td>Asn</td><td>Gly</td><td>To be</td><td>Val</td><td>Thr</td><td>Cys</td>
<td></td><td></td><td></td><td></td><td> 565</td><td></td><td></td><td></td><td></td><td> 570</td><td></td><td></td><td></td><td></td><td> 575</td><td></td>
<td>Phe</td><td>Gly</td><td>Pro</td><td>Glu</td><td>To</td><td>Asp</td><td>Gln</td><td>Cys</td><td>Val</td><td>To</td><td>cys</td><td>To</td><td>His</td><td>Tyr</td><td>Lys</td><td>Asp</td>
<td></td><td></td><td></td><td> 580</td><td></td><td></td><td></td><td></td><td> 585</td><td></td><td></td><td></td><td></td><td> 590</td><td></td><td></td>
<td>Pro</td><td>Pro</td><td>Phe</td><td>Cys</td><td>Val</td><td>To</td><td>Arg</td><td>Cys</td><td>Pro</td><td>To be</td><td>Gly</td><td>Val</td><td>Lys</td><td>Pro</td><td>Asp</td><td>Leu</td>
<td></td><td></td><td> 595</td><td></td><td></td><td></td><td></td><td> 600</td><td></td><td></td><td></td><td></td><td> 605</td><td></td><td></td><td></td>
<td>To be</td><td>Tyr</td><td>Met</td><td>Pro</td><td>lie</td><td>Trp</td><td>Lys</td><td>Phe</td><td>Pro</td><td>Asp</td><td>Glu.</td><td>Glu</td><td>Gly</td><td>To</td><td>Cys</td><td>Gln</td>
<td></td><td> 610</td><td></td><td></td><td></td><td></td><td> 615</td><td></td><td></td><td></td><td></td><td> 620</td><td></td><td></td><td></td><td></td>
<td>Pro</td><td>Cys</td><td>Pro</td><td>lie</td><td>Asn</td><td>Cys</td><td>Thr</td><td>His</td><td>To be</td><td>Cys</td><td>Val</td><td>Asp</td><td>Leu</td><td>Asp</td><td>Asp</td><td>Lys</td>
<td> 625</td><td></td><td></td><td></td><td></td><td> 630</td><td></td><td></td><td></td><td></td><td> 635</td><td></td><td></td><td></td><td></td><td> 640</td>
<td>Gly</td><td>Cys</td><td>Pro</td><td>To</td><td>Glu</td><td>Gln</td><td>Arg</td><td>To</td><td>To be</td><td>Pro</td><td>Leu</td><td>Thr</td><td>To be</td><td>lie</td><td>lie</td><td>To be</td>
<td></td><td></td><td></td><td></td><td> 645</td><td></td><td></td><td></td><td></td><td> 650</td><td></td><td></td><td></td><td></td><td> 655</td><td></td>
<td>To</td><td>Val</td><td>Val</td><td>Gly</td><td>lie</td><td>Leu</td><td>Leu</td><td>Val</td><td>Val</td><td>Val</td><td>Leu</td><td>Gly</td><td>Val</td><td>Val</td><td>Phe</td><td>Gly</td>
<td></td><td></td><td></td><td> 660</td><td></td><td></td><td></td><td></td><td> 665</td><td></td><td></td><td></td><td></td><td> 670</td><td></td><td></td>
<td>lie</td><td>Leu</td><td>lie</td><td>Lys</td><td>Arg</td><td>Arg</td><td>Gln</td><td>Gln</td><td>Lys</td><td>lie</td><td>Arg</td><td>Lys</td><td>Tyr</td><td>Thr</td><td>Met</td><td>Arg</td>
<td></td><td></td><td> 675</td><td></td><td></td><td></td><td></td><td> 680</td><td></td><td></td><td></td><td></td><td> 685</td><td></td><td></td><td></td>
<td>Arg</td><td>Leu</td><td>Leu</td><td>Gln</td><td>Glu</td><td>Thr</td><td>Glu</td><td>Leu</td><td>Val</td><td>Glu</td><td>Pro</td><td>Leu</td><td>Thr</td><td>Pro</td><td>To be</td><td>Gly</td>
<td></td><td> 690</td><td></td><td></td><td></td><td></td><td> 695</td><td></td><td></td><td></td><td></td><td> 700</td><td></td><td></td><td></td><td></td>
<td>To</td><td>Met</td><td>Pro</td><td>Asn</td><td>Gln</td><td>To</td><td>Gln</td><td>Met</td><td>Arg</td><td>lie.</td><td>Leu</td><td>Lys</td><td>Glu</td><td>Thr</td><td>Glu</td><td>Leu</td>
<td> 705</td><td></td><td></td><td></td><td></td><td> 710</td><td></td><td></td><td></td><td></td><td> 715</td><td></td><td></td><td></td><td></td><td> 720</td>
-8080
<td>Arg</td><td>Lys</td><td>Val</td><td>Lys</td><td>Val</td><td>Leu</td><td>Gly</td><td>To be</td><td>Gly</td><td>To</td><td>Phe</td><td>Gly</td><td>Thr</td><td>Val</td><td>Tyr</td><td>Lys</td>
<td></td><td></td><td></td><td></td><td> 725</td><td></td><td></td><td></td><td></td><td> 730</td><td></td><td></td><td></td><td></td><td> 735</td><td></td>
<td>Gly</td><td>I have</td><td>Trp</td><td>lie</td><td>Pro</td><td>Asp</td><td>Gly</td><td>Glu</td><td>Asn</td><td>Val</td><td>Lys</td><td>lie</td><td>Pro</td><td>Val</td><td>To</td><td>lie</td>
<td></td><td></td><td></td><td> 740</td><td></td><td></td><td></td><td></td><td> 745</td><td></td><td></td><td></td><td></td><td> 750</td><td></td><td></td>
<td>Lys</td><td>Val</td><td>Leu</td><td>Arg</td><td>Glu</td><td>Asn</td><td>Thr</td><td>To be</td><td>Pro</td><td>Lys</td><td>To</td><td>Asn</td><td>Lys</td><td>Glu</td><td>I have</td><td>Leu</td>
<td></td><td></td><td> 755</td><td></td><td></td><td></td><td></td><td> 760</td><td></td><td></td><td></td><td></td><td> 765</td><td></td><td></td><td></td>
<td>Asp</td><td>Glu</td><td>To</td><td>Tyr</td><td>Val</td><td>Met</td><td>To</td><td>Gly</td><td>Val</td><td>Gly</td><td>To be</td><td>Pro</td><td>Tyr</td><td>Val</td><td>To be</td><td>Arg</td>
<td></td><td> 770</td><td></td><td></td><td></td><td></td><td> 775</td><td></td><td></td><td></td><td></td><td> 780</td><td></td><td></td><td></td><td></td>
<td>Leu</td><td>Leu</td><td>Gly</td><td>lie</td><td>Cys</td><td>Leu</td><td>Thr</td><td>To be</td><td>Thr</td><td>Val</td><td>Gln</td><td>Leu</td><td>Val</td><td>Thr</td><td>Gln</td><td>Leu</td>
<td> 785</td><td></td><td></td><td></td><td></td><td> 790</td><td></td><td></td><td></td><td></td><td> 795</td><td></td><td></td><td></td><td></td><td> '800</td>
<td>Met</td><td>Pro</td><td>Tyr</td><td>Gly</td><td>Cys</td><td>Leu</td><td>Leu</td><td>Asp</td><td>Hi s</td><td>Val</td><td>Arg</td><td>Glu</td><td>Asn</td><td>Arg</td><td>Gly</td><td>Arg</td>
<td></td><td></td><td></td><td></td><td> 805</td><td></td><td></td><td></td><td></td><td> 810</td><td></td><td></td><td></td><td></td><td> 815</td><td></td>
<td>Leu</td><td>Gly</td><td>To be</td><td>Gln</td><td>Asp</td><td>Leu</td><td>Leu</td><td>Asn</td><td>Trp</td><td>Cys</td><td>Met</td><td>Gln</td><td>lie</td><td>To</td><td>Lys</td><td>Gly</td>
<td></td><td></td><td></td><td> 820</td><td></td><td></td><td></td><td></td><td> 825</td><td></td><td></td><td></td><td></td><td> 830</td><td></td><td></td>
<td>Met</td><td>To be</td><td>Tyr</td><td>Leu</td><td>Glu</td><td>Asp</td><td>Val</td><td>Arg</td><td>Leu</td><td>Val</td><td>His</td><td>Arg</td><td>Asp</td><td>Leu</td><td>To</td><td>To</td>
<td></td><td></td><td> 835</td><td></td><td></td><td></td><td></td><td> 840</td><td></td><td></td><td></td><td></td><td> 845</td><td></td><td></td><td></td>
<td>Arg</td><td>Asn</td><td>Val</td><td>Leu</td><td>Val</td><td>Lys</td><td>To be</td><td>Pro</td><td>Asn</td><td>His</td><td>Val</td><td>Lys</td><td>lie</td><td>Thr</td><td>Asp</td><td>Phe</td>
<td></td><td> 850</td><td></td><td></td><td></td><td></td><td> 855</td><td></td><td></td><td></td><td></td><td> 860</td><td></td><td></td><td></td><td></td>
<td>Gly</td><td>Leu</td><td>To</td><td>Arg</td><td>Leu</td><td>Leu</td><td>Asp</td><td>lie</td><td>Asp</td><td>Glu</td><td>Thr</td><td>Glu</td><td>Tyr</td><td>His</td><td>To</td><td>Asp</td>
<td> 865</td><td></td><td></td><td></td><td></td><td> 870</td><td></td><td></td><td></td><td></td><td> 875</td><td></td><td></td><td></td><td></td><td> 880</td>
<td>Gly</td><td>Gly</td><td>Lys</td><td>Val</td><td>Pro</td><td>lie</td><td>Lys</td><td>Trp</td><td>Met</td><td>To</td><td>Leu</td><td>Glu</td><td>To be</td><td>lie</td><td>Leu</td><td>Arg</td>
<td></td><td></td><td></td><td></td><td> 885</td><td></td><td></td><td></td><td></td><td> 890</td><td></td><td></td><td></td><td></td><td> 895</td><td></td>
<td>Arg</td><td>Arg</td><td>Phe</td><td>Thr</td><td>His</td><td>Gln</td><td>To be</td><td>Asp</td><td>Val</td><td>Trp</td><td>To be</td><td>Tyr</td><td>Gly</td><td>Val</td><td>Thr</td><td>Val</td>
<td></td><td></td><td></td><td> 900</td><td></td><td></td><td></td><td></td><td> 905</td><td></td><td></td><td></td><td></td><td> 910</td><td></td><td></td>
<td>Trp</td><td>Glu</td><td>Leu</td><td>Met</td><td>Thr</td><td>Phe</td><td>Gly</td><td>To</td><td>Lys</td><td>Pro</td><td>Tyr</td><td>Asp</td><td>Gly</td><td>I have</td><td>Pro</td><td>To</td>
<td></td><td></td><td> 915</td><td></td><td></td><td></td><td></td><td> 920</td><td></td><td></td><td></td><td></td><td> 925</td><td></td><td></td><td></td>
<td>Arg</td><td>Glu</td><td>I have</td><td>Pro</td><td>Asp</td><td>Leu</td><td>Leu</td><td>Glu</td><td>Lys</td><td>Gly</td><td>Glu</td><td>Arg</td><td>Leu</td><td>Pro</td><td>Gln</td><td>Pro</td>
<td></td><td> 930</td><td></td><td></td><td></td><td></td><td> 935</td><td></td><td></td><td></td><td></td><td> 940</td><td></td><td></td><td></td><td></td>
<td>Pro</td><td>I have</td><td>Cys</td><td>Thr</td><td>lie</td><td>Asp</td><td>Val</td><td>Tyr</td><td>Met</td><td>lie</td><td>Met</td><td>Val</td><td>Lys</td><td>Cys</td><td>Trp</td><td>Met</td>
<td> 945</td><td></td><td></td><td></td><td></td><td> 950</td><td></td><td></td><td></td><td></td><td> 955</td><td></td><td></td><td></td><td></td><td> 960</td>
-8181
<td>lie</td><td>Asp</td><td>To be</td><td>Glu</td><td>Cys</td><td>Arg</td><td>Pro</td><td>Arg Phe</td><td>Arg</td><td>Glu</td><td>Leu</td><td>Val</td><td>To be</td><td>Glu</td><td>Phe</td>
<td></td><td></td><td></td><td></td><td> 965</td><td></td><td></td><td></td><td> 970</td><td></td><td></td><td></td><td></td><td> 975</td><td></td>
<td>To be</td><td>Arg</td><td>Met</td><td>To</td><td>Arg</td><td>Asp</td><td>Pro</td><td>Gln Arg</td><td>Phe</td><td>Val</td><td>val</td><td>lie</td><td>Gln</td><td>Asn</td><td>Glu</td>
<td></td><td></td><td></td><td> 980</td><td></td><td></td><td></td><td> 985</td><td></td><td></td><td></td><td></td><td> 990</td><td></td><td></td>
<td>Asp</td><td>Leu</td><td>Gly</td><td>Pro</td><td>To</td><td>To be</td><td>Pro</td><td>Leu Asp</td><td>To be</td><td>Thr</td><td>Phe</td><td>Tyr</td><td>Arg</td><td>To be</td><td>Leu</td>
<td></td><td></td><td> 995</td><td></td><td></td><td></td><td></td><td> 1000</td><td></td><td></td><td></td><td colspan="2"> 1005</td><td></td><td></td>
<td>Leu</td><td>Glu</td><td>Asp</td><td>Asp</td><td>Asp</td><td>Met</td><td>Gly</td><td>Asp Leu</td><td>Val</td><td>Asp</td><td>To</td><td>Glu</td><td>Glu</td><td>Tyr</td><td>Leu</td>
<td></td><td colspan="2"> 1010</td><td></td><td></td><td></td><td> 101!</td><td> 5</td><td></td><td> *</td><td colspan="2"> 1020</td><td></td><td></td><td></td>
<td>Val</td><td>Pro</td><td>Gln</td><td>Gln</td><td>Gly</td><td>Phe</td><td>Phe</td><td>Cys Pro</td><td>Asp</td><td>Pro</td><td>To</td><td>Pro</td><td>Gly</td><td>To</td><td>Gly</td>
<td> 1021</td><td> 5</td><td></td><td></td><td></td><td> 1031</td><td>OR</td><td></td><td></td><td> 103!</td><td></td><td></td><td></td><td></td><td> 1040</td>
<td>Gly</td><td>Met</td><td>Val</td><td>His</td><td>His</td><td>Arg</td><td>His</td><td>Arg Ser</td><td>To be</td><td>To be</td><td>Thr</td><td>Arg</td><td>To be</td><td>Gly</td><td>Gly</td>
<td></td><td></td><td></td><td></td><td> 104!</td><td> 5</td><td></td><td></td><td> 105'</td><td> 0</td><td></td><td></td><td></td><td> 105!</td><td> 5</td>
<td>Gly</td><td>Asp</td><td>Leu</td><td>Thr</td><td>Leu</td><td>Gly</td><td>Leu</td><td>Glu Pro</td><td>To be</td><td>Glu</td><td>Glu</td><td>Glu</td><td>To</td><td>Pro</td><td rowspan="2">Arg</td>
<td></td><td></td><td></td><td> 1061</td><td> 3</td><td></td><td></td><td colspan="2"> 1065</td><td></td><td></td><td></td><td> 1071</td><td> 3</td>
<td>To be</td><td>Pro</td><td>Leu</td><td>To</td><td>Pro</td><td>To be</td><td>Glu</td><td>Gly Ala</td><td>Gly</td><td>To be</td><td>Asp</td><td>Val</td><td>Phe</td><td rowspan="2">Asp</td><td rowspan="2">Gly</td>
<td></td><td></td><td colspan="2"> 1075</td><td></td><td></td><td></td><td> 1080</td><td></td><td></td><td></td><td colspan="2"> 1085</td>
<td>Asp</td><td>Leu</td><td>Gly</td><td>Met</td><td>Gly</td><td>To</td><td>To</td><td>Lys Gly</td><td>Leu</td><td>Gln</td><td>To be</td><td>Leu</td><td>Pro</td><td>Thr</td><td>His</td>
<td></td><td colspan="2"> 1090</td><td></td><td></td><td></td><td colspan="2"> 1095</td><td></td><td></td><td colspan="2"> 1100</td><td></td><td></td><td></td>
<td>Asp</td><td>Pro</td><td>To be</td><td>Pro</td><td>Leu</td><td>Gln</td><td>Arg</td><td>Tyr ser</td><td>Glu</td><td>Asp</td><td>Pro</td><td>Thr</td><td>Val</td><td>Pro</td><td>Leu</td>
<td colspan="2"> 1105</td><td></td><td></td><td></td><td colspan="2"> 1110</td><td></td><td></td><td colspan="2"> 1115</td><td></td><td></td><td></td><td> 1120</td>
<td>Pro</td><td>To be</td><td>Glu</td><td>Thr</td><td>Asp</td><td>Gly</td><td>Tyr</td><td>Val Ala</td><td>Pro</td><td>Leu</td><td>Thr</td><td rowspan="2">Cys</td><td>To be</td><td>Pro</td><td>Gln</td>
<td></td><td></td><td></td><td></td><td colspan="2"> 1125</td><td></td><td></td><td colspan="2"> 1130</td><td></td><td></td><td colspan="2"> 1135</td>
Pro Glu Tyr Val Asn Gln Pro Asp Val Arg Pro Gln Pro Pro Ser Pro 1140 1145 1150 »Arg Glu Gly Pro Leu Pro Ala Ala Arg Pro Ala Gly Ala Thr Leu Glu 1155 1160 1165
-8282
Arg Pro Lys Thr Leu Ser Pro Gly Lys Asn Gly Val Val Lys Asp Val 1170 11751180
Phe Ala Phe Gly Gly Ala Val Glu Asn Pro Glu Tyr Leu Thr ProGln
1185 1190 11951200
Gly Gly Ala Ala Pro Gln Pro His Pro Pro Pro Ala Phe Ser ProAla
1205 12101215
Phe Asp Asn Leu Tyr Tyr Trp Asp Gln Asp Pro Pro Glu Arg Gly Ala 1220 12251230
Pro Pro Ser Thr Phe Lys Gly Thr Pro Thr Ala Glu Asn Pro Glu Tyr 1235 12401245
Leu Gly Leu Asp Val Pro Val
12501255 (2) INFORMATION FOR SEQ ID NO: 3 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) CHAIN: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
TCTGGCGCGC TGGATGACGA TGACAAGAAA CGACGGCAGC AGAAGATC 48
-8383 (2) INFORMATION FOR SEQ ID NO: 4 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: 1line (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
TGAATTCTCG AGTCATTACA CTGGCACGTC CAGACCCAG 39
-8484
Contents11
6 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6
62 members in 20 offices
Priority claims1
| Document | Office | Kind | Date |
|---|---|---|---|
| 41441795 | United States of America | A |
Members62
| Document | Office | Kind | |
|---|---|---|---|
| NO20061723L | Norway | L | |
| CA2216601A1 | Canada | A1 | |
| WO9630514A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU5522296A | Australia | A | |
| NO974502D0 | Norway | D0 | |
| NO974502L | Norway | L | |
| CZ309697A3 | Czechia | A3 | |
| EP0817846A1 | European Patent Office (EPO) | A1 | |
| US5726023A | United States of America | A | |
| CN1183117A | China | A | |
| MX9707501AThis record | Mexico | A | |
| US5801005A | United States of America | A | |
| KR19980703453A | Republic of Korea | A | |
| HU9801826A2 | Hungary | A2 | |
| HUP9801826A2 | Hungary | A2 | |
| US5846538A | United States of America | A | |
| US5869445A | United States of America | A | |
| US5876712A | United States of America | A | |
| JPH11502710A | Japan | A | |
| AU708237B2 | Australia | B2 | |
| BR9607889A | Brazil | A | |
| US6075122A | United States of America | A | |
| HU9801826A3 | Hungary | A3 | |
| HUP9801826A3 | Hungary | A3 | |
| NZ306616A | New Zealand | A | |
| US2002019331A1 | United States of America | A1 | |
| US2002055614A1 | United States of America | A1 | |
| CA2216601C | Canada | C | |
| US6664370B2 | United States of America | B2 | |
| US2004082758A1 | United States of America | A1 | |
| EP1418235A2 | European Patent Office (EPO) | A2 | |
| CN1150318C | China | C | |
| EP1418235A3 | European Patent Office (EPO) | A3 | |
| RU2236461C2 | Russian Federation | C2 | |
| CN1597953A | China | A | |
| EP0817846B1 | European Patent Office (EPO) | B1 | |
| AT299180T | Austria | T | |
| ATE299180T1 | Austria | T1 | |
| DE69634912D1 | Germany | D1 | |
| US2005191285A1 | United States of America | A1 | |
| US6942862B2 | United States of America | B2 | |
| US6953573B1 | United States of America | B1 | |
| DK0817846T3 | Denmark | T3 | |
| RU2004115492A | Russian Federation | A | |
| PT817846E | Portugal | E | |
| US2006008479A1 | United States of America | A1 | |
| ES2245783T3 | Spain | T3 | |
| DE69634912T2 | Germany | T2 | |
| CZ296617B6 | Czechia | B6 | |
| CZ296618B6 | Czechia | B6 | |
| NO321941B1 | Norway | B1 | |
| KR100554186B1 | Republic of Korea | B1 | |
| CN1951398A | China | A | |
| US7247703B2 | United States of America | B2 | |
| JP2008056679A | Japan | A | |
| US2008076904A1 | United States of America | A1 | |
| US7601697B2 | United States of America | B2 | |
| US2010010075A1 | United States of America | A1 | |
| US7655239B2 | United States of America | B2 | |
| US2010087621A1 | United States of America | A1 | |
| JP4510147B2 | Japan | B2 | |
| US8524491B2 | United States of America | B2 |
Numbers
- Application
- 9707501
Titles2
- English
- INTRACELLULAR DOMAIN OF THE HER-2/NEU PROTEIN FOR PREVENTION OR TREATMENT OF MALIGNANCIES.
- Spanish
- DOMINIO INTRACELULAR DE LA PROTEINA HER-2/NEU PARA LA PREVENCION O TRATAMIENTO DE MALIGNIDADES.
Classification
- CPC, 19
- C07K7/06
- C12N15/11
- A61K38/00
- A61K39/00
- C07K14/4705
- C07K14/71
- G01N2333/71
- G01N2333/82
- Y10S530/806
- Y10S530/828
- A61P35/00
- A61P37/00
- A61P43/00
- A61K39/001106
- A61K40/4205
- A61K40/11
- G01N33/57585
- G01N33/57557
- C12N15/86
- IPC, 30
- A61K38 00
- A61K38 08
- A61K38 10
- C12N15 09
- A61K38 17
- A61K39 00
- A61P43 00
- C07K1 00
- C07K2 00
- C07K4 00
- C07K5 00
- C07K7 00
- C07K7 06
- C07K7 08
- C07K14 00
- C07K14 435
- C07K14 47
- C07K14 705
- C07K14 71
- C07K16 00
- C07K17 00
- C12N1 21
- C12N5 08
- C12N7 00
- C12N9 12
- C12N15 12
- C12N15 54
- C12N15 86
- C12P21 02
- G01N33 574