Albumin variants.

ALBUMINA VARIANTS

Reference to a Sequence Listing

This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

Field of the Invention

The present invention relates to albumin variants or their fusion fragments or polypeptides comprising albumin variant or its fragments that have a change in half-life compared to albumin, its fragment or fusion polypeptide comprising albumin or its fragment.

DESCRIPTION OF THE RELATED TECHNIQUE

Albumin is a protein found naturally in the blood plasma of mammals where it is the most abundant protein. It has important roles to maintain the desired osmotic pressure in the blood and also the transport of various substances in the bloodstream.

Albumin has been characterized by many species including humans, pigs, mice, rats, rabbits and goats, and they share a high degree of sequence and structural homology.

Albumin is bound in vivo to its receptor, the Neonatal Fe (FcRn) 2 0 Brambell receptor and this interaction is known to be important for the plasma half-life of albumin. FcRn is a membrane-bound protein, expressed in many cells and tissue types. FcRn has been found to recover albumin from intracellular degradation (Roopenian DC and Akilesh, S. (2007), Nat. Rev. Immunol 7, 715-725). FcRn is a bifunctional molecule that helps maintain a high level of serum IgGs and 2-5 albumin in mammals such as humans.

While the FcRn-immunoglobulin (IgG) interaction has been characterized in the prior art, the FcRn-albumin interaction is less well characterized. The largest FcRn link site is located within Dlll (381-585). Andersen et al (2010). Clinical Biochemistry 43, 367-372. The data indicate that IgG and albumin are linked non-cooperatively at different sites in FcRn (Andersen et al. (2006), Eur. J. Immunol 36, 3044-3051; Chaudhury et al. (2006), Biochemistry 45, 49834990).

It is known that mouse FcRn binds to mouse and human IgG, while human FcRn seems to be more discriminant (Ober et al. (2001) Int. Immunol 13, 1551 1559). Andersen et al. (2010). Journal of Biological Chemistry 285 (7): 4826-36, describes the affinity of human and mouse FcRn for each mouse and human albumin (all possible combinations). No albumin binding of any species was observed at physiological pH with any receptor. At acidic pH, a 100-fold difference in binding affinity was observed. In all cases, the binding of albumin and IgG of any species to both receptors was additive.

Human serum albumin (HAS = Human Serum Albumin) has been well characterized as a 585 amino acid polypeptide and the sequence of which can be found in Peters, T., Jr. (1996) All about Albumin: Biochemistry, Genetics and Medical, Applications pp10, Academic Press, Inc., Orlando (ISBN 0-12-552110-3). It has a characteristic link to its FcRn receptor, where it binds at pH 6.0 but not at pH 7.4.

The plasma half-life of HSA has been found to be approximately 19 days. A natural variant that has a lower plasma half-life has been identified (Peach, RJ and Brennan, SO, (1991) Biochim Biophys Acta. 1097: 49-54) that has the D494N substitution. This substitution generates a Nglycosylation site in this variant, which is not present in wild-type albumin. It is not known whether glycosylation in the amino acid change is responsible for the change in plasma half-life.

Albumin has a prolonged plasma half-life and due to this property it has been suggested for drug delivery use. Albumin has been conjugated into pharmaceutically beneficial compounds (WO 2000 / 69902A), and it was found that the conjugate - maintains the prolonged plasma half-life of albumin. The plasma half-life resulting from the conjugate in general was considered longer than the plasma half-life of the beneficial therapeutic compound alone.

In addition, albumin has been fused to the therapeutically beneficial peptides (WO 2001/79271 A and WO 2003/59934 A) with the typical result that the fusion has beneficial therapeutic peptide activity and a plasma half-life considerably longer than life plasma mean of beneficial therapeutic peptides alone.

Otagiri et al (2009), Biol. Pharm, Bull. 32 (4), 527-534, describes that 77 albumin variants are known, of these 25 are in domain III. A natural variant that lacks the last 175 amino acids at the carboxy ends has been shown to have reduced half-life (Andersen et al (2010), Clinical Biochemistry 43, 367-372). Iwao et al. (2007) studied the half-life of naturally occurring human albumin variants using a mouse model, and found that K541E and K560E have reduced half-life, E501K and E570K have increased half-life and K573E has almost no effect on half-life ( Iwao, et. Al. (2007) BBA Proteins and Proteomics 1774, 1582-1590).

Galliano et al (1993) Biochim. Biophys Minute 1225, 27-32 describes a natural variant E505K. Minchiotti et al. (1990) describes a natural variant K536E. Minchiotti et al (1987) Biochim. Biophys Minute 916, 411-418 describes a natural variant

Κ574Ν. Takahashi et al (1987) Proc. Nati Acad. Sci. USA 84, 4413-4417, describes a natural variant D550G. Carlson et al (1992). Proc. Nat. Acad. Sci. USA 89, 8225-8229, describes a natural variant D550A.

Albumin has the ability to bind a number of ligands and these are associated (associated) with albumin. This property has been used to extend the plasma half-life of drugs that have the ability to covalently bond with albumin. This can also be achieved by linking a beneficial pharmaceutical compound that has few or no albumin binding properties, to a portion that has albumin binding properties. See the review article and the reference there, Kratz (2008). Journal of Controlled Release 132, 171-183.

Albumin is used in preparations of beneficial pharmaceutical compounds, where this preparation may be for example, but is not limited to a nanoparticle or microbial particle of albumin. In these examples, the delivery of a compound or mixture of beneficial pharmaceutical compounds can benefit from alterations in the affinity of the albumin to its receptor where the beneficial compound has been shown to be associated with albumin for the delivery medium.

It is not clear what determines the plasma half-life of the partners formed (for example but not limited to Levemir®, Kurtzhals P et al. Biochem. J. 1995; 312: 725-731) conjugates or fusion polypeptides, but it appears to be a result of the combination of albumin and the selected beneficial pharmaceutical compound / polypeptide. It will be convenient to be able to control the plasma half-life of certain albumin conjugates, associates or albumin fusion proteins, so that a longer or shorter plasma half-life than that provided by the components of the association can be achieved , conjugation or fusion, in order to be able to design a particular drug according to the particular data of the indication that b

It is intended to be treated.

It is known that albumin accumulates and catabolizes in tumors, it has also been shown to accumulate in inflamed joints of patients with rheumatoid arthritis. See review article and reference there, Kratz (2008) Journal of Controlled 5 Release 132, 171-183. It is anticipated that HSA variants with increased affinity for FcRn will be advantageous for the delivery of pharmaceutically beneficial compounds.

It may even be convenient to have albumin variants that have little or no binding to FcRn in order to provide shorter half-lives or 10 controlled serum pharmacokinetics as described in Kenanova et al (2009) J. Nucí. Med., 50 (Supplement 2): 1582).

SUMMARY OF THE INVENTION

The present invention provides variants of a precursor albumin with improved properties compared to its precursor. In particular, the invention provides variants of a precursor albumin that have altered plasma half-life compared to its precursor.

The present invention relates to isolated variants of albumin or its fragments, or fusion polypeptides comprising albumin variant or fragments thereof, of a precursor albumin, which comprises an alteration in one or more (several) positions corresponding to positions 417 , 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573 , 574, 575, 577, 578, 579, 580, 581, 582 and 584 of the mature polypeptide of SEQ ID NO: 2, wherein the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501K, K541E, D550G, A, K573E or K574N.

5 The alteration in one or more positions can be independently selected from substitutions, insertions and deletions, where substitution is preferred.

The present invention also relates to isolated polynucleotides encoding variants; nucleic acid constructs, vectors and host cells comprising the polynucleotides; and methods to produce the variants.

The present invention also relates to conjugates or associates comprising the albumin variant or its fragment according to the invention and a beneficial therapeutic portion or a fusion polypeptide comprising an albumin variant or its fragment of the invention and a partner polypeptide. of fusion.

The invention further relates to compositions comprising the albumin variant, its fragment, fusion polypeptide comprising the albumin variant or its fragment or conjugates comprising the albumin variant or its fragment, according to the invention or associates comprising the albumin variant or its fragment, according to the invention. Preferred compositions are pharmaceutical compositions.

The invention further relates to a pharmaceutical composition comprising an albumin variant, its fragment, fusion polypeptide comprising albumin variant or its fragment or conjugates comprising the albumin variant or its fragment, or associates comprising the albumin variant. or its fragment, where the albumin variant, its fragment, fusion polypeptide comprising the albumin variant or its fragment or conjugates comprising the albumin variant or fragment or associates of the albumin variant or its fragment, have altered plasma half-life compared to the corresponding plasma half-life of the HSA or its fragment, fusion polypeptide comprising HSA or its fragment or conjugates or associates of HSA or its fragment, comprising HSA or its fragment.

BRIEF DESCRIPTION OF THE FIGURES

The

Figure shows a restriction map of the expression plasmid pDB4082.

The

Figure shows a restriction map of the expression plasmid pDB2305.

The

Figure shows a restriction map of the expression plasmid pDB4005

The

Figure shows sensog branches

10 μΜ albumin SPR injected on shFcRn HSA (JTA) = free of fatty acid obtained from HSA Sigma-Aldrich (A3782), HSA (Novozymes) = Commercial Recombinant Human Serum Albumin (RECOMBUMIN).

Figure 5 shows shFcRn-GST ELISA binding to human serum albumin (HSA) variants (100-0.045 pg / ml). WT Link, D494N, D494Q and

D494A pH 6.0 and pH 7.4. Link of WT, D494N, D494N / T496A and T496A at pH 6.0 and pH 7.4. Link of WT, E495Q and E495A at pH 6.0 and pH 7.4.

Figure 6 shows representative 0.2 pM binding sensograms of HSA variants with shFcRn (-4600 RU) .WT, D494N, D494Q, D494A, D494N / T496A and immobilized T496A.

Figure 7 shows representative 1 pM binding sensograms of HSA variants to shFcRn (-1400 RU) .WT, D494N, D494Q, D494A, D494N / T496A and T496A immobilized.

Figure 8 shows relative linkage of HSA variants compared to WT, based on two independent SPR experiments as shown (A) Figure 6 and (B) Figure 7.

Figure 9 shows ELISA: (A) shFcRn binding to human, donkey, bovine, sheep, goat and rabbit albumin at pH 6.0. (B) shFcRn binding to guinea pig, hamster, rat and chicken albumin at pH 6.0. (C) shFcRn binding to human, donkey, bovine, sheep, goat and rabbit albumin at pH 7.4. (D) shFcRn binding to guinea pig, hamster, rat and chicken albumin at pH 7.4. (E) relative binding of different albumins. The relative binding of human albumin to shFcRn is defined as 1.0. ELISA values ​​represent the average of duplicates.

Figure 10 shows SPR: ShFcRn-GST binding to albumin of various species at pH 6.0 and pH 7.4. Representative sensograms showing a binding of 5.0 μΜ of albumin of different species: (A) human, (B) donkey, (C) bovine, (D) goat, (E) sheep, (F) rabbit, (G) dog, ( H) guinea pig, (I) hamster, (J) rat, (K) mouse and (L) chicken. The albumin variants were injected onto shFcRn labeled with immobilized GST (-2100 RU). Injections were performed at 25 ° C at a rate of 40 μΙ / min.

Figure 11 shows SPR sensograms of selected HSA mutants compared to wild-type or wild-type HSA. 20 μΜ of (A) WT and P499A (B) WT and K500A, (C) WT and K536A, (D) WT and P537A and (E) WT and K538A and (F) WT and K537A were injected onto shFcRn immobilized at pH 6.0 (-1500 RU).

Figure 12 shows SPR sensograms of HSA mutants compared to WT HSA. 10 μΜ of (A) WT and K573A (B) WT and K573C, (C) WT and K573F, (D) WT and K573G and (E) WT and K573L and (F) WT and K573M, (G) WT and K573Q , (H) WT and K573R and (I) WT and K573T and (J) WT and K573V injected on shFcRn immobilized at pH 5.5 and pH 7.4. Injections were performed at 25 ° C at a flow rate of 80 μΙ / min.

Figure 13 shows SPR sensograms of HSA mutants compared to wild type HSA. 10 μΜ of (A) WT and K573D (B) WT and K573E, (C) WT and K573H, (D) WT and K573I and (E) WT and K573N and (F) WT and K573P, (G) WT and K573S , (H)

WT and K573 * and (I) WT and K573W and (J) WT and K573Y injected on shFcRn immobilized at pH 5.5 and pH 7.4. Injections were made at 25 ° C at a flow rate of 80 pl / min.

Figure 14 shows SPR sensograms of HSA mutants compared to wild type HSA. 20 μΜ of (A) WTy

E492G + K538H + K541N + E542D (B) WT and E492T + N503K + K541A, (C) WT and E492P + N503K + K541G + E542P, (D) WT and E492H + E501P + N503H + E505D + T506S + T510 + K541 (E) WTy

A490D + E492T + V493L + E501P + N503D + A504E + E505K + T506F + K541D and (F) WT and E492G + V493P + K538H + K541N + E542D injected on shFcRn immobilized at pH 6.0. Injections were performed at 25 degrees C at a flow rate of 80 μΙ / min.

Figure 15 shows SPR sensograms of HSA mutants compared to wild-type or wild-type HSA. Twenty μΜ of (A) WT, (B) H440Q, (C) H464Q and (D) H535Q injected on shFcRn immobilized at pH 6.0. Injections were performed at 25 ° C at a flow rate of 80 μΙ / min.

Figure 16 shows SPR sensograms of mutant K500E of HSA compared to wild-type HSA. Ten μΜ of mutant K500E HSA injected on shFcRn immobilized at pH 5.75. Injections were made at 25 ° C at a flow rate of 30pl / min.

Figure 17 shows a restriction map of the expression plasmid pDB3017

Figure 18 shows a restriction map of the PDB3021 expression plasmid

Figure 19 shows a restriction map of the expression plasmid pDB3056

Figure 20 shows a restriction map of the expression plasmid pDB3165

Figure 21 shows a restriction map of the expression plasmid PDB4172

Figure 22 shows a restriction map of the expression plasmid PDB4267

Figure 23 shows a restriction map of the expression plasmid pDB4285

Figure 24 shows a WT HSA GP-HPLC chromatogram and mutant conjugates K573P HRP for shFcRn analysis. 25 // L injections were made on a TSK G3000SWXL column (Tosoh Bioscience) as described in materials and methods.

Figure 25 shows SDS PAGE separation followed by both visual (A) and ultraviolet (B) detection of Fluorescein-conjugated albumin. HSA :: F5M (Lane 1), K573P :: F5M (Lane 2) and standard rHA (Lane 3).

Figure 26 shows shFcRn binding properties of HSA variants. 10μΜ of WT rHA and E492T (A), WT rHA and D494N / E495Q / T496A (B), WT rHA and N503D (C), WT rHA and N503K (D), WT rHA and E492T / N503D (E), WT rHA and E495Q / T496A (F), WT rHA and K538H (G), WT rHA and E492D (H) injected on shFcRn immobilized at pH 5.5

Figure 27 shows shFcRn binding properties of HSA variants. 10 μΜ of WT rHA and K541 A (1) and WT rHA and K541N (J) were injected onto shFcRn immobilized at pH 5.5.

Figure 28 shows competitive binding of K573A and K573P measured by injecting shFcRn (100 nM) alone or pre-incubated with different amounts of HSA K573A and K573P on immobilized HSA (~ 2500 RU) at pH 6.0

Figure 29 shows competitive binding of HSA-FLAG variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSAFLAG variants on immobilized HSA (~ 2500 RU) at pH 6.0.

Figure 30 shows competitive binding of HSA-IL1Ra variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSA5 IL1Ra variants on immobilized HSA (~ 2500 RU) at pH 6.0

Figure 31 shows competitive binding of scFv-fused HSA variants measured by injecting shFcRn (100 nM) alone or together with different amounts of (A) scFv-HSA-FLAG variants or (B) HSA-scFv-FLAG variants on immobilized HSA ( -2500 RU) at pH 6.0.

io Figure 32 shows HSA binding, single, double and triple mutant variants to shFcRn. Samples of 10 μΜ of each HSA variant were injected onto immobilized shFcRn at pH 5.5 or pH 7.4.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to isolated variants of albumin or its fragments, or fusion polypeptides comprising albumin variant or fragments thereof, of a precursor albumin, which comprise an alteration in one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 of the mature polypeptide of SEQ ID NO:

2, where the variant is not the variant consisting of SEQ ID NO: 2 with the substitution

D494N, E501K, K541E, D550G.A, K573E or K574N.

The alteration in one or more positions can be independently selected from substitutions, insertions and deletions, where substitution is preferred.

Definitions

Variant: The term variant means a polypeptide derived from a precursor albumin by one or more alterations, that is, a substitution, insertion and / or deletion, in one or more (several) positions. A substitution means a replacement of an amino acid that occupies a position with a different amino acid; a deletion means elimination of an amino acid that occupies a position; and an insertion means adding one or more, preferably 1-3 amino acids, immediately adjacent to an amino acid that occupies a position.

Mutant: The term mutant means a polynucleotide that encodes a variant.

Wild-type albumin: The term wild-type albumin (WT = Wild-Type) means albumin that has the same amino acid sequence as that found naturally in an animal or in a human being.

Precursor or Precursor Albumin: The term precursor or precursor albumin means an albumin to which an alteration is made by the hand of humans to produce the albumin variants of the present invention. The precursor can be a polypeptide of natural origin (natural or wild type) or its allele, or even a variant thereof.

FcRn and shFcRn: The term FcRn means the human neonatal Fe (FcRn) receptor. shFcRn is a recombinant soluble form of FcRn.

smFcRn: The term smFcRn is a soluble recombinant form of the mouse neonatal Fe Receptor.

Isolated variant: The term isolated variant means a variant that is modified by the hand of humans and completely or partially separates from at least one component with which it occurs naturally. In one aspect, the variant is at least 1% pure, for example at least 5% pure, at least 10% pure, at least 20% pure, at least 40% pure, at least 60% pure, at least 80% pure. , and at least 90% pure, as determined by SDS-PAGE or GP-HPLC.

Substantially pure variant: The term substantially pure variant means a preparation that contains at most 10%, when more 8%, when more 6%, when more 5%, when more 4%, when more 3%, when more 2%, when plus 1%, and at most 0.5% weight percent of another polypeptide material with which it is associated natively or recombinantly. Preferably, the variant is at least 92% pure, for example, at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99% pure , at least 99.5% pure, and 100% pure by weight of the total polypeptide material present in the preparation. Variants of the present invention are preferably in substantially pure form. This can be achieved, for example, by preparing the variant by well-known recombinant methods and by purification methods.

Mature Polypeptide: The term mature polypeptide means a polypeptide in its final form after translation and any post-translational modifications, such as N-terminal processing, truncated C-terminal, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 1 to 585 of SEQ ID NO: 2, with the inclusion of any post-translation modifications.

Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide encoding a mature albumin polypeptide. In one aspect, the mature polypeptide coding sequence is nucleotides 1 to 1758 of SEQ ID NO: 1.

Sequence Identity: The relationship between two amino acid sequences or between two nucleotide sequences is described by the sequence identity parameter.

For the purposes of the present invention, the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al, 2000, Trends Genet. 16: 276-277), preferably version 3.0.0 or later. The optional parameters used are opening penalty for each gap (gap open penalty) of 10, extension penalty for each hole (gap extension penalty) of 0.5, and the replacement matrix EBLOSUM62 (EMBOSS version of BLOSUM62). The longest identity output labeled Needle (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

(Identical waste x 100) / (Alignment Length - Total Number of Alignment Gaps).

For the purposes of the present invention, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. The optional parameters used are penalty in the opening for each hole of 10, penalty in the extension of hole of 0.5, and the EDNAFULL replacement matrix (EMBOSS version of NCBI NUC4.4). The longest identity output labeled Needle (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

(Identical Deoxyribonucleotides x 100) / (Alignment Length - Total Number of Alignment Spaces)

Fragment: The term fragment means a polypeptide that has one or more (several) amino acids removed from the amino and / or carboxyl end of an albumin and / or an internal albumin region that has retained the ability to bind FcRn. Fragments may consist of an uninterrupted sequence derived from HSA or may comprise two or more sequences derived from HSA. The fragments according to the invention are larger than about 20 amino acid residues, preferably more than 30 amino acid residues, more than 40 amino acid residues are more preferred, more than 50 amino acid residues are more preferred, more than 75 residues are more preferred amino acids, more is preferred more than 100 amino acid residues, more is preferred more than 200 amino acid residues, more is preferred more than 300 amino acid residues, Even more than 400 amino acid residues is more preferred and more than 500 amino acid residues are more preferred.

Allelic variant: The expression allelic variant means any of two or more alternate forms of a gene that occupies the same chromosomal site. Allelic variation arises naturally through mutation, and can result in polymorphism within populations. Gene mutations can be silent (without change in the encoded polypeptide) or they can encode polypeptides that have altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of your translated polypeptide product. The boundaries of the coding sequence in general are determined by an open reading frame, which usually begins with the start codon ATG or alternately with start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG and TGA. The coding sequence can be a DNA, cDNA (cDNA), synthetic or recombinant polynucleotide.

cDNA: The term cDNA means a DNA molecule that can be prepared by reverse transcription from a combined, mature mRNA molecule that is obtained from a eukaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. Initial primary RNA transcription is an mRNA precursor that is processed through a series of stages, including combination, before appearing as mature combined mRNA.

Nucleic Acid Construction: The term "nucleic acid construct" means a nucleic acid molecule, either single stranded or double stranded, that is isolated from a naturally occurring gene or modified to contain nucleic acid segments in a way that otherwise does not exist in nature or that is synthetic. The term "nucleic acid construct" is synonymous with the expression expression cassette when the nucleic acid construct contains the control sequences required for the expression of a coding sequence of the present invention.

Control sequences: The term "control sequences" means all components necessary for the expression of a polynucleotide encoding a variant of the present invention. Each control sequence can be native or foreign to the polynucleotide encoding the variant or native or foreign to each other. These control sequences include, but are not limited to a leader sequence, a polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence and transcription terminator. At a minimum, control sequences include a promoter and transcription and translation stop signals. Control sequences may be provided with linkers for the purpose of introducing specific restriction sites that facilitate ligation of control sequences within the coding region of the polynucleotide encoding a variant.

Operationally linked: The term "operably linked" means a configuration in which a control sequence is placed in an appropriate position with respect to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

Expression: The term expression includes any stage involved in the production of the variant including, but not limited to transcription, posttranscription modification, translation, post-translation modification, and secretion.

Expression vector: The term "expression vector" means a linear or circular DNA molecule (DNA) that comprises a polynucleotide that encodes a variant and is operably linked with additional nucleotides that allow its expression.

Host cell: The term "host cell" means any type of cell that is susceptible to transformation, transfection, transduction, and the like, with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a precursor cell that is not identical to the precursor cell, due to mutations that occur during replication.

Plasma half-life: Plasma half-life is ideally determined 20 in vivo in suitable individuals. However, since it is time consuming and expensive, and there are unavoidable ethical considerations connected when conducting experiments on animals or humans, it is convenient to use an in vitro assay to determine if plasma half-life is prolonged or reduced. It is known that albumin binding to its FcRn receptor is important for plasma half-life and the correlation between 25-receptor binding and plasma half-life is that a higher affinity of albumin or its receptor leads to a longer plasma half-life. . Thus, for the present invention, a higher affinity of albumin to FcRn is considered indicative of an increased plasma half-life and a lower affinity of albumin to its receptor is considered indicative of a reduced plasma half-life.

In this application and claims albumin binding to its FcRn receptor is described using the term affinity and the strongest or weakest expressions. Thus, it will be understood that a molecule that has a higher affinity to FcRn than HSA, is considered to bind stronger to FcRn than HSA and a molecule that has a lower affinity to FcRn than HSA is considered to bind weaker to FcRn than HSA

The terms longer half-life in plasma or shorter half-life in plasma and similar expressions are understood in relation to the corresponding precursor albumin molecule. Thus, a longer plasma half-life with respect to an albumin variant of the invention means that the variant has a longer plasma half-life than the corresponding albumin with the same sequences except for the positional alterations. corresponding to 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541,542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 in SEQ ID NO: two.

Conventions for Designation of Variants

For purposes of the present invention, the mature polypeptide described in SEQ ID NO: 2 is used to determine the corresponding amino acid residue in another albumin. The amino acid sequence of another albumin is aligned with the mature polypeptide described in SEQ ID NO: 2, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide described in SEQ ID NO: 2 , is determined using the Needleman-Wunsch algorithm (Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 3.0 .0 or later.

Identification of the corresponding amino acid residue in another albumin can be confirmed by an alignment of multiple polypeptide sequences using ClustalW (Larkin et al., 2007, Bioinformatics 23: 2947-2948).

When the other polypeptide (or protein) has diverged from the mature polypeptide of SEQ ID NO: 2, such that comparison based on traditional sequence fails to detect its relationship (Lindahl & Elofsson, 2000, J. Mol. Biol. 295: 613-615 ), other sequence comparison algorithms in pairs can be used. Greater sensitivity in sequence-based search can be achieved using search programs that use probabilistic representations of polypeptide families (profiles) for database search. For example, the PSI-BLAST program generates profiles through an iterative database search process and is able to detect remote counterparts (Atschul et al., 1997, Nucleics Acid Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or super family for the polypeptide has one or more representations in the protein structure databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources (PSI-BLAST, secondary structure prediction, structural alignment profiles, and solvation potentials) are feeds to a neural network that predicts folding structural for a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol 313: 903-919, can be used to align a sequence of unknown structure within the super family models present in the SCOP database. These alignments in turn can be used to generate homology models for the polypeptide, and these models can be estimated accurately using a variety of tools developed for that purpose.

For proteins of known structure, several tools and resources are available to recover and generate structural alignments. For example, super protein SCOP families have been structurally aligned, and those alignments are accessible and can be downloaded. Two or more protein structures can be aligned using a variety of algorithms such as the 10 distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747), and implementations of these algorithms can additionally be used to query structure databases with a structure of interest to discover possible structural counterparts (eg, Holm and Park, 2000, Bioinformatics 16: 566-567).

In describing the albumin variants of the present invention, the nomenclature described below is adapted for ease of reference. Accepted single letter or three letter IUPAC amino acid abbreviation is used.

Substitutions For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, for example, the substitution of threonine with alanine at position 226 is designated as Thr226Ala or T226A. Multiple mutations are separated by addition marks (+), for example Gly205Arg + Ser411Phe or G205R + S411F, which represent substitutions at positions 205 and 411 of glycine (G) with arginine (R) and serine (S) with phenylalanine (F ), respectively. The Figures also use (7), for example, 25 E492T / N503D this will be seen as interchangeable with (+).

Deletions For an amino acid deletion, the following nomenclature is used: Original amino acid, position *. Accordingly, the glycine deletion at position 195 is designated as Gly195 * or G195. Multiple deletions are separated by addition marks (+), for example, Gly195 + Ser411 or G195 + S411

Insertions For amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly, the insertion of lysine after glycine at position 195 is designated Gly195GlyLys or G195GK. A multi-amino acid insert is designated [Original amino acid, position, original amino acid, inserted amino acid # 1, inserted amino acid # 2; etc.]. For example, the insertion of lysine and alanine then glycine at position 195 is indicated as Gly195GlyLysAla or G195GKA.

In these cases, the inserted amino acid residue or numbers are numbered by the addition of lowercase letters to the position number of the amino acid residue preceding the inserted amino acid residue. In the previous example, the sequence would be like this:

<td>Precursor:</td><td>Variant:</td>

<td> 195</td><td>195 195a 195b</td>

<td>G</td><td>GKA</td>

Multiple alterations Variants comprising multiple alterations are separated by addition marks (+), for example, Arg170Tyr + Gly195Glu or R170Y + G195E representing a substitution of tyrosine and glutamic acid with arginine and glycine at positions 170 and 195, respectively.

Different substitutions When different substitutions can be introduced in one position, the different substitutions are separated by a comma, for example, Arg170Tyr, Glu represents a substitution of arginine with tyrosine or glutamic acid at position 170. Thus, Tyr167Gly, Ala + Arg170Gly, Ala designates the following variants:

Tyr167Gly + Arg170Gly, Tyr167Gly + Arg170Ala, Tyr167Ala + Arg170Gly, and Tyr167Ala + Arg170Ala.

Precursor albumin

The albumins are proteins and constitute the most abundant protein in the plasma of mammals and albumins of a large number of mammals have been characterized by biochemical methods and / or sequence information. Several albumin, for example, human serum albumin (HSA), have also been characterized in crystallographic form and the structure determined.

HSA is a preferred albumin according to the invention and is a protein that consists of 585 amino acid residues and has a molecular weight of 67 kDa. In its natural form it is not glycosylated. The amino acid sequence of HSA are shown in SEQ ID NO: 2. The skilled person will appreciate that there may be natural alleles that have essentially the same properties as HSA but have one or more amino acid changes compared to SEQ ID NO: 2, and the inventors also contemplate the use of these natural alleles as albumin. precursor according to the invention.

Albumin generally has a prolonged plasma half-life of approximately 20 days or more, for example, HSA has a plasma half-life of 19 days. It is known that the prolonged plasma half-life of HSA is mediated by interaction with its FcRn receptor, however, an understanding or knowledge of the exact mechanism after the prolonged half-life of HSA is not essential for the present invention.

According to the invention, the term albumin means a protein that has the same three-dimensional structure or very similar as HSA, and has a long plasma half-life. As examples of albumin proteins according to the invention, there can be mentioned human serum albumin, primate serum albumin, (such as chimpanzee serum albumin, gorilla serum albumin), rodent serum albumin (such as albumin of hamster serum, guinea pig serum albumin, mouse serum albumin and rat serum albumin), bovine serum albumin, equine serum albumin, donkey serum albumin, rabbit serum albumin, goat serum albumin, sheep serum albumin, dog serum albumin, chicken serum albumin and pig serum albumin. HSA as described in SEQ ID NO: 2 or any of its alleles of natural origin, is the preferred albumin according to the invention.

The precursor albumin, a fragment thereof, or an albumin part of a fusion polypeptide comprising albumin or a fragment thereof according to the invention generally has a sequence identity to the HSA sequence shown in SEQ ID NO : two at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91%, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, more preferred at least 96%, more at least 97% is preferred, more at least 98% is preferred and at least 99% is more preferred.

The precursor preferably comprises or consists of the amino acid sequence of SEQ ID NO: 2. In another aspect, the precursor comprises or consists of the mature polypeptide of ID NO: 2.

In another embodiment, the precursor is an allelic variant of the mature polypeptide of SEQ ID NO: 2.

In a second aspect, the precursor is encoded by a polynucleotide that hybridizes under conditions of very low severity, conditions of low severity, conditions of medium severity, conditions of high medium severity, conditions of high severity, or conditions of very high severity, with (i) in the mature polypeptide coding sequence SEQ ID NO: 1, (ii) the mature polypeptide coding sequence of SEQ ID NO: 1, or (iii) the complementary length strand of (i) or (ii) (J. Sambrook, EF Fritsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2^toedition, Coid Spring Harbor, New York).

The polynucleotide of SEQ ID NO: 1 or a sub-sequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or its fragment, can be used to design nucleic acid probes to identify and clone DNA encoding a strand precursor of different genera or species, according to methods well known in the art. In particular, these probes can be used for hybridization with the genomic or cDNA (cDNA) of the genus or species of interest, following Southern standard transfer procedures in order to identify and isolate the corresponding gene therein. These probes may be considerably shorter than the entire sequence, but they must be at least 14, for example, at least 25, at least 35 or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, for example, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. Probes are typically labeled to detect the corresponding gene (for example, with³²Ρ, ³Η, ³⁵S, biotin, or avidin). These probes are encompassed by the present invention.

A library of genomic DNA or cDNA prepared from these other organisms can be screened by DNA that hybridizes with the probes described above and encodes a precursor. Genomic DNA or other of these other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. Library DNA or separated DNA can be transferred to and immobilized in nitrocellulose or other convenient carrier material. To identify a clone or DNA that is homologous with SEQ ID NO: 1 or its sub-sequence, the carrier material is used in a Southem transfer.

For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleotide probe corresponding to the polynucleotide shown in SEQ ID NO: 1, its complementary strand or its sub-sequence thereof, under conditions of low to very high severity. Molecules in which the hybridizing probe can be detected using, for example, X-ray film or any other means of detection known in the art.

In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1. In another aspect, the nucleic acid probe is nucleotides 1 to 1785 of SEQ ID NO: 1. In another aspect, The nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2 or its fragment. In another aspect, the nucleic acid probe is SEQ ID NO: 1.

For long probes of at least 100 nucleotides in length, conditions of very low to very high severity are defined as prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA , and either 25% formamide for very low and low severities, 35% formamide for medium and medium high severities, or formamide at

50% for high and very high severities, following standard Southern transfer procedures for 12 to 24 hours optimally. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45 ° C (very low severity), 50 ° C (low severity), 55 ° C (medium severity), 60'C ( medium high severity), 65 ° C (high severity) or 70 ° C (very high severity).

For short probes that are approximately 15 nucleotides at approximately 70 nucleotides in length, severity conditions are defined as prehybridization and hybridization at approximately 5 ° C to approximately 10 ° C below T_m calculated using the calculation according to Bolton and McCarthy (1962, Proc. Nati. Acad. Sel. USA 48: 1390) in 0.9 M NaCI, 0.09 M Tris-HCI pH 7.6, 6 mM EDTA, 0.5% NP-40, solution 1X Denhardt, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP and 0.2 mg of yeast RNA by me following standard Southern blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5 ° C to 10 ° C below T_mcalculated

In a third aspect, the precursor is encoded by a polynucleotide with a sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 of at least 60%, for example of at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which encodes a polypeptide that is capable of functioning as an albumin. In one embodiment, the precursor is encoded by a polynucleotide that comprises or consists of SEQ ID NO: 1.

Variant Preparation

In a further aspect the invention relates to a method for preparing an albumin variant, its fragment or fusion polypeptide comprising albumin variant or its fragment comprising the steps of:

to. Identify one or more amino acid residue positions that are important for the binding of albumin to FcRn, in an albumin or its fragment or the albumin part of a fusion polypeptide comprising albumin or its fragment;

b. Provide a nucleic acid encoding the albumin, its fragment or the albumin part of a fusion polypeptide comprising albumin or its fragment;

c. Modifying the nucleic acid provided in b., Such that one or more amino acid residues (several) located at the positions identified in a., Are removed or replaced or inserted with a different amino acid;

d. Express the modified nucleic acid in a convenient host cell; Y

and. Recover the variant albumin, its fragment or the fusion polypeptide comprising the variant albumin or its fragment.

The identification of one or more amino acid residue positions is important for the binding of albumin to FcRn, in albumin, its fragment or the albumin part of a fusion polypeptide can be performed in several ways including but not limited to random mutagenesis followed by analysis. of the mutants generated and comparison with the non-mutated precursor molecule, and identification based on

0 Structural considerations, optionally followed by generation of variants that have the alterations identified and comparison with the non-mutated precursor molecule.

A preferred method for identifying one or more amino acid residue positions to be changed in order to prepare a variant HSA having an altered FcRn bond compared to natural HSA, comprises the following steps:

i) Identify a non-human albumin that has a different binding property to FcRn;

I) Identify the amino acid residues of human serum albumin that interact with FcRn;

iii) Compare the primary and / or tertiary structure of the identified non-human albumin and human serum albumin with respect to the amino acid residues identified in stage ii) and identify the amino acid residues that differ between non-human albumin and albumin. human serum as responsible for the difference in bond observed; and iv) Optionally prepare HSA variants at the positions identified in step iii) and confirm that the prepared variants have altered FcRn binding compared to HSA.

Step i) above can be performed using the SPR test described below. However, the person with skill will appreciate that other methods can be employed to identify non-human albumins that have different FcRn binding properties than HSA, and that the method is not dependent on how the non-human albumin that has binding properties has been identified. different from FcRn.

In a preferred embodiment, the identified non-human albumin has a stronger bond to FcRn than HSA. Examples of non-human albumin that have stronger binding to FcRn than HSA, include donkey serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, guinea pig serum albumin, albumin mouse serum and rat serum albumin. The step i) can be achieved by considering the structure of FcRn as HSA and the binding complex of these two. In the absence of an available structure of the binding complex, it is possible to use a model in which the HSA structure is coupled in the structure of the FcRn structure and thus identify amino acid residues of HSA that interact with FcRn.

In another preferred embodiment, the identified non-human albumin has a weaker binding to FcRn than HSA. Examples of non-human albumin that have weaker binding to FcRn than HSA include bovine serum albumin, goat serum albumin, sheep serum albumin and chicken serum albumin. Step ii) can be achieved by considering the structure of FcRn, HSA and the link complex of these two, in the absence of an available structure of the link complex it is possible to use a model where the HSA structure is coupled in the structure of the FcRn structure and in this way identify HSA residues that interact with FcRn.

In this invention and claims, HSA amino acid residues that interact with FcRn are considered to be any HSA amino acid residues located less than 10A from an amino acid in the FcRn or any amino acid residue that is involved in a hydrogen bond, a salt bridge, or a polar or non-polar interaction with an amino acid residue that is located less than 10A of an amino acid in FcRn. Preferably, the amino acid in HSA residues is located less than 10A of the amino acids in FcRn, more preferable less than 6A of amino acids in FcRn and more preferred less than 3A of amino acids in FcRn.

Steps ii) and iv) can be performed using techniques well known to the person with skill.

The present invention also relates to methods for obtaining an albumin variant or its fragments, or fusion polypeptides comprising the albumin variant or its fragments, or associated albumin variant or its fragments comprising: (a) introducing into a precursor albumin or its fragments, or fusion polypeptides comprising the precursor albumin or its fragments, an alteration in one or more (several) positions corresponding to positions 417, 440,

464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541,542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 of the mature polypeptide of SEQ ID NO: 2; and (b) recovering the variant albumin or its fusion fragments or polypeptides comprising the variant albumin or its fragments.

Variants can be prepared for those with skill in the art using any method of mutagenesis known in the art, such as site-directed mutagenesis, synthetic gene construction, semisynthetic gene construction, random mutagenesis, transposition, etc.

Site-directed mutagenesis is a technique where one or more (several) mutations are created at one or more sites defined in a polynucleotide encoding the precursor.

Site-directed mutagenesis can be achieved in vitro by PCR, which involves the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis that involves disruption by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the precursor and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. . Usually, the restriction enzyme that digests in the plasmid and the oligonucleotide is the same, allowing plasmid ligation and insertion with each other. See for example, Schererand Davis, 1979, Proc. Nati Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 73494966.

Site-directed mutagenesis can also be achieved in vivo by methods known in the art. See for example, Publication of US Patent Application Number 2004/0171154; Storici et al., 2001, Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal

Genet Newslett 43: 15-16.

Any site directed mutagenesis method can be employed in the present invention. There are many commercial equipment available that can be used to prepare variants.

Synthetic gene construction involves in vitro synthesis of a polynucleotide molecule designed to encode a polypeptide of interest. Gene synthesis can be performed using a number of techniques such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technology where oligonucleotides are synthesized and assembled on programmable photo microfluidic chips.

Single or multiple amino acid substitutions, deletions and / or insertions can be made and tested using known methods of mutagenesis, recombination and / or transposition, followed by a relevant screening procedure, such as those described by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Nati Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that may be employed include error-prone PCR, phage expression (eg, Lowman et al., 1991, Biochemistry 30: 10832-10837; US Patent Number 5,223,409; WO 92/06204) and region-directed mutagenesis ( Derbyshire etal., 1986, Gene 46: 145; Nereta /., 1988, DNA 7: 127).

Mutagenesis / transposition methods can be combined with high-performance automated screening methods to detect activity of cloned mutagenized polypeptides that are expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and sequenced quickly using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.

Semi-synthetic gene construction is achieved by combining aspects of synthetic gene construction and / or site-directed mutagenesis and / or random mutagenesis and / or transposition. Semi-synthetic construction is typified by a process that uses 5 polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes can thus be synthesized de novo, while other regions can be amplified using site-specific mutagenic primers, while still other regions can undergo error-prone PCR or non-error-prone PCR. Subsequences of polynucleotides may be transposition.

Variants

The present invention also provides variants of albumin or its fragments, or fusion polypeptides, which comprise the albumin variant or its fragments, of a precursor albumin comprising an alternation in one or more 15 (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 in SEQ ID NO: 2, where each alteration is independently a substitution, insertion or deletion provided that the variant is not SEQ ID NO: 2 which has the substitution D494N, E501K, K541E, D550G, A, 20 K573E or K574N.

The albumin variant, or its fragment, or albumin part of a fusion polypeptide comprising albumin variant or its fragment according to the invention, generally has a sequence identity the HSA sequence shown in SEQ ID NO: two at least 60%, preferably at least 70%, preferably at least 25% 80%, preferably at least 85%, preferably at least 90%, more at least 95% is preferred, more preferred at least 96%, more at least 97% is more preferred, at least 98% is more preferred and at least 99% is still more preferred.

In one aspect, the number of alterations in the variants of the present invention is 1-20, for example, 1-10 and 1-5, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 alterations.

The albumin variant, its fusion fragment or polypeptide comprising the albumin variant or its fragment has an altered plasma half-life compared to the corresponding precursor albumin, its fragment, or fusion polypeptide comprising the albumin variant or its fragment.

In a particular preferred embodiment, the precursor albumin is HSA and the albumin variant, a fragment thereof or fusion polypeptide comprising the albumin variant or its fragment, has altered plasma half-life compared to HSA, the corresponding fragment. or fusion polypeptide comprising HSA or its fragment.

The correlation between albumin bond with its receptor and plasma half-life has been achieved by the present inventors based on the naturally occurring allele of HSA D494N. The inventors have analyzed this allele and found that it has lower affinity to its FcRn receptor.

In addition, it has been described that a transgenic mouse having natural mouse FcRn replaced with human FcRn has a higher serum albumin level than the normal mouse; see (J Exp Med. (2003) 197 (3): 315-22). The inventors have discovered that human FcRn has higher affinity for mouse serum albumin than mouse FcRn has for mouse serum albumin and therefore the increase observed in serum albumin in the transgenic mouse corresponds to higher affinity between albumin for serum and its receptor, confirming the correlation between albumin binding to FcRn and plasma half-life. In addition, albumin variants that have little or no FcRn binding have been shown to have reduced FcRn in a mouse model, Kenanova et al (2009) J. Nucí. Med .; 50 (Supplement 2): 1582).

One way to determine if the affinity of an albumin variant to FcRn is greater than or less than the precursor albumin is to use the Surface Plasmon Resonance assay (SPR = Surface Plasmon Resonance) as described below. The person with skill will understand that other methods may be useful in determining whether the affinity of an albumin variant FcRn is greater than or less than the affinity of the albumin precursor to FcRn, for example, determination and comparison of the KD binding constants. Thus, according to the invention, albumin variants that have a KD that is less than the KD for natural HSA, are considered to have a higher plasma half-life than HSA and albumin variants that have a KD that is greater than KD for natural HSA, is considered to have a shorter plasma half-life than HSA.

Variants of albumin or its fusion fragments or polypeptides comprising albumin or its fragments, comprise one or more alterations such as substitutions, deletions or insertions in one or more (several) positions corresponding to the HSA positions selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584. The substitution may be any substitution where the amino acid in the natural albumin sequence is substituted with a different amino acid selected from the remaining 19 naturally occurring amino acids.

In one aspect, a variant comprises an alteration in one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494,

495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 in SEQ ID NO: 2. In another aspect, a variant comprises an alteration in two positions corresponding to any of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510,

535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and

584 in SEQ ID NO: 2. In another aspect, a variant comprises an alteration in three positions corresponding to any positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504 , 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550,

573, 574, 575, 577, 578, 579, 580, 581,582 and 584 in SEQ ID NO: 2. In another aspect, a variant comprises an alteration in each position corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535,

536, 537, 538, 540, 541, 542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 in

SEQ ID NO: 2.

In another aspect, the variant comprises the Q417A.H substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the H440Q substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the H464Q substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A490D substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the E492G, Τ, Ρ, Η substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the V493P.L substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the D494N, Q, A, E, P substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the E495Q.A substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the T496A substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the P499A substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K500E , G, D, A, S, C, P, H, F, N, W, T, M, Y, V, Q, L, l, R of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E501A, P, Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the N503K, D, H substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A504E substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant it comprises the E505K, D substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the T506F, S substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the H510Q substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the H535Q substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K536A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the P537A substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the K538A, H substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the T540S substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the K541 A, D, G, N, E substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the E542P.D substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the D550N substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K573Y, W, P, H, F, V, I, T, N, S, G , M, C, A, E, Q, R, L, D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the K574N substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, The variant comprises the Q580K substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the L575F substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A577T.E substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A578R.S substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the S579C.T substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the Q580K substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A581D substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A582T substitution. of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the G584A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 417. In another aspect, the amino acid in a position corresponding to position 417 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly , His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ala or His. In another aspect, the variant comprises the replacement Q417A, H of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 440. In another aspect, the amino acid in a position corresponding to position 440 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly , His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the H440Q substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 464. In another aspect, the amino acid is substituted in a position corresponding to position 464 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the H464Q substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 490 In another aspect, the amino acid in a position corresponding to position 490 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the A490G substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 492. In another aspect, the amino acid is replaced in a position corresponding to position 492 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly. In another aspect, the variant comprises the E492G substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 493. In another aspect, the amino acid is substituted in a position corresponding to position 493 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Pro. In another aspect, the variant comprises the V493P substitution of the mature polypeptide of SEQ ID NO: 2 .

In another aspect, the variant comprises an alteration in a position corresponding to position 494. In another aspect, the amino acid is substituted in a position corresponding to position 494 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn, Gln or Ala. In another aspect, the variant comprises the D494N, Q, A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 495. In another aspect, the amino acid is substituted in a position corresponding to position 495 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gln or Ala. In another aspect, the variant comprises the E495Q or A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 496. In another aspect, the amino acid is substituted in a position corresponding to position 496 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the T496A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 499. In another aspect, the amino acid is substituted in a position corresponding to position 499 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the P499A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 500. In another aspect, the amino acid is substituted in a position corresponding to position 500 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution K500E, G, D, A, S, C, P, H, F, N, W, T, M, Y, V, Q, L, I, R of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 501. In another aspect, the amino acid is substituted in a position corresponding to position 501 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala or Gln to reduce affinity and Pro to increase affinity. In another aspect, the variant comprises the substitution E501 A, Q, P of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 503. In another aspect, the amino acid is substituted in a position corresponding to position 503 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Lys or His. In another aspect, the variant comprises the N503D, K, H substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 504. In another aspect, the amino acid is replaced in a position corresponding to position 504 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the A504 substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 505. In another aspect, the amino acid is substituted in a position corresponding to position 505 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the E505D substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 506. In another aspect, the amino acid is substituted in a position corresponding to position 506 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the T506S, F substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 510. In another aspect, the amino acid is substituted in a position corresponding to position 510 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gln. In another aspect, the variant comprises the H510Q substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 535. In another aspect, the amino acid is substituted in a position corresponding to position 535 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gln. In another aspect, the variant comprises the H535Q substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 536. In another aspect, the amino acid is substituted in a position corresponding to position 536 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the K536A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 537. In another aspect, the amino acid is substituted in a position corresponding to position 537 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the P537A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 538. In another aspect, the amino acid is substituted in a position corresponding to position 538 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the K538H substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 540. In another aspect, the amino acid is substituted in a position corresponding to position 540 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the T540S substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 541. In another aspect, the amino acid is substituted in a position corresponding to position 541 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gl, Asp or Ala. In another aspect, the variant comprises the substitution K541 G, DA, N of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 542. In another aspect, the amino acid is substituted in a position corresponding to position 542 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Pro. In another aspect, the variant comprises the E542D, P substitution of the mature SEQ polypeptide ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 550. In another aspect, the amino acid is substituted in a position corresponding to position 550 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn to reduce affinity, preferably with Glu to increase affinity.

In another aspect, the variant comprises an alteration in a position corresponding to position 573. In another aspect, the amino acid is substituted in a position corresponding to position 573 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Tyr, Trp, Pro, His. Phe, Val, Lie, Thr, Asn, Ser, Gly, Met, Cys, Ala, Glu, Gln, Arg, Leu, Asp. In another aspect, the variant comprises the substitution

K573Y, W, P, H, F, V, I, T, N, S, G, M, C, A, E, Q, R, L, D of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 574. In another aspect, the amino acid is substituted in a position corresponding to position 574 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn. In another aspect, the variant comprises the K574N substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 575. In another aspect, the amino acid is substituted in a position corresponding to position 575 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Phe. In another aspect, the variant comprises the L575F substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 577. In another aspect, the amino acid is substituted in a position corresponding to position 577 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Thr or Glu. In another aspect, the variant comprises the A577TE substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 578. In another aspect, the amino acid is substituted in a position corresponding to position 578 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Ser. In another aspect, the variant comprises the A578R, S substitution of the mature SEQ polypeptide ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 579. In another aspect, the amino acid is substituted in a position corresponding to position 579 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys or Thr. In another aspect, the variant comprises the substitution S579C, T of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 580. In another aspect, the amino acid is substituted in a position corresponding to position 580 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Lys. In another aspect, the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 581. In another aspect, the amino acid is substituted in a position corresponding to position 581 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp. In another aspect, the variant comprises the A581D substitution of the mature polypeptide of SEQ ID

NO: 2.

In another aspect, the variant comprises an alteration in a position corresponding to position 582. In another aspect, the amino acid is substituted in a position corresponding to position 582 with Ala, Arg, Asn, Asp, Cys, Gln, Glu , Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Thr. In another aspect, the variant comprises the A582T substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in a position that io corresponds to position 584. In another aspect, the amino acid is substituted in a position corresponding to position 584 with Ala, Arg, Asn, Asp, Cys, Gln, Glu , Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the G584A substitution of the mature polypeptide of SEQ ID NO: 2.

In another aspect, the variant comprises an alteration in positions corresponding to positions 494 and 496 in SEQ ID NO. 2, such as those described above.

In another aspect, the variant comprises alterations in positions corresponding to positions 492 and 493 in SEQ ID NO. 2, such as those described above.

In another aspect, the variant comprises alterations in positions corresponding to positions 494 and 417 in SEQ ID NO. 2, such as those described above.

In another aspect, the variant comprises alterations in positions that correspond to positions 492 and 503 in SEQ ID NO. 2, such as those described above.

In another aspect, the variant comprises alterations in positions corresponding to positions 492 and 573 in SEQ ID NO. 2, such as those described above.

In another aspect, the variant comprises alterations in positions corresponding to positions 492, 503 and 573 in SEQ ID NO. 2, such as those described above.

In one embodiment, the albumin variant or its fragments, or fusion polypeptides comprising the albumin variant or its fragments according to the invention, contain a substitution of the position corresponding to the HSA position selected from the group consisting of 417 , 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573 , 574, 575, 577, 578, 579, 580, 581, 582 and 584 in SEQ ID NO: two provided that the albumin variant is not the variant consisting of SEQ ID NO: 2 with the replacement D494N, E501K, K541E, D550G.A, K573E or K574N. The albumin variant, its fragment or fusion polypeptides comprising the albumin variant or its fragment according to the invention, may comprise additional substitutions, insertions or deletions in one or more (several) positions corresponding to the other positions in HSA.

In another embodiment, the albumin variant or its fusion fragments or polypeptides comprise the albumin variant or its fragments according to the invention, contains two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or even more substitutions in the positions corresponding to the positions in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501,

503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541,542, 550, 573, 574, 575, 577, 578, 579, 580, 581, 582 and 584 of SEQ ID NO: 2. The albumin variant or its fusion fragments or polypeptides comprising the albumin variant or its fragments according to the invention may comprise additional substitutions, insertions or deletions at positions corresponding to other positions in HSA.

In a further embodiment, the albumin variants or their fusion fragments or polypeptides comprising albumin variants or their fragment according to the invention, have a plasma half-life that is greater than the plasma half-life of the precursor albumin, its fusion fragment or polypeptide comprising the precursor albumin or its fragment. Examples according to this embodiment include variants of albumin or its fragments, or fusion polypeptide comprising albumin variant or its fragment comprising a substitution at the position corresponding to 492, 503, 542, 550, 573, 574, 580, 581 , 582 or 584 in SEQ ID NO: 2. Preferred substitutions according to this embodiment of the invention include the replacement of the amino acid residue at the position corresponding to 492 in SEQ ID NO: 2 with a residue G, replacement of the amino acid residue at the position corresponding to 503 in SEQ ID NO: 2 with a residue H or a K, substitution of the amino acid residue at the position corresponding to 550 in SEQ ID NO: 2 with a residue E, the substitution of the amino acid residue at a position corresponding to 573 in SEQ ID NO: two with a Y, W, P, H, F, V, I, T, N, S, G, M, C, A, E, Q, R, L or a D, replacing the amino acid residue in a corresponding position to 574 in SEQ ID NO: 2 with a residue N, or the substitution of the amino acid residue in the position corresponding to 580 in SEQ ID NO: 2 with a residue K. Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID NO: 2 with a residue G and a substitution at the position corresponding to 573 in SEQ ID NO: 2 with a residue A or P. Another preferred variant has a number of substitutions corresponding to position 492 in SEQ ID NO: 2 with a residue H in position 503 in SEQ ID NO: 2.

Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID NO: 2 with a residue G and a substitution in the position corresponding to position 503 in SEQ ID NO: 2 corresponding to an H or a K and a substitution in position 573 in SEQ ID NO: 2 with a residue A or a P.

In a further embodiment, the albumin variants or their fusion fragments or polypeptides comprising albumin variant or its fragments according to the invention, have a plasma half-life that is shorter than the plasma half-life of the precursor albumin , its fusion fragment or polypeptide comprising the precursor albumin or its fragment. Examples according to this embodiment include variants of albumin or its fragments, or fusion polypeptides comprising albumin variant or its fragment comprising a substitution at the position corresponding to 417, 440, 494, 495, 496, 499, 500, 501 , 536, 537, 538, 541, 494 + 496 or 492 + 493 in SEQ ID NO: 2. Preferred substitutions include substitutions corresponding to Q417A, H440Q, D494E + Q417H, D494N, Q, A, E495Q.A, T496A, D494N + T496A or, P499A, K500A, E501A, E501Q, K536A, P537A, K538A, K538A, K538A, K538A, K538A or D550N in SEQ ID NO: 2.

In another embodiment of the invention, albumin variants or their fusion fragments or polypeptides comprising albumin variant or its fragment according to the invention have lost their ability to ligate FcRn. In this connection, albumin variants or their fusion fragments or polypeptides comprising albumin variant or its fragments, are considered to have lost the ability to bind FcRn if the resonance units measured for the variant in the SPR assay described below is less than 10% of the resonance units measured for the precursor albumin or its corresponding fragment. Examples according to this embodiment include albumin variants or fragments thereof, or fusion polypeptides comprising albumin variant or fragments thereof comprising a substitution at a position corresponding to 464, 500, 510 or 535 in SEQ ID NO: 2. Substitutions Preferred include substitutions corresponding to H464Q, K500A, P, C, S, A, DG H510Q or H535Q in SEQ ID NO: 2.

In addition to the one or more substitutions in one or more positions corresponding to positions 417, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501, 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574, 580 581,582 and 584 in SEQ ID NO: two the albumin variant or its fusion fragment or polypeptides comprising albumin variant or its fragments according to the invention may contain additional substitutions, deletions or insertions at other positions of the molecules. These additional substitutions, deletions or insertions may be useful in order to alter other properties of the molecules such as but not limited to altered glycosylation; introduction of surface reactive groups such as thiol groups, withdraw / generate a carbamoylation site; etc.

Wastes that can be altered in order to provide reactive residues on the surface and that can be advantageously applied to the present invention, have been described in unpublished Patent Application WO 2010/092135 (included by reference). Particularly preferred wastes include the positions corresponding to the positions in SEQ ID NO: 2.

As examples of alterations that can be made in SEQ ID NO: 2 or in corresponding positions in other albumins, in order to provide a reactive thiol group on the surface, include alterations corresponding to the following alterations in SEQ ID NO: 2: L585C, D1C , A2C, D562C, A364C, A504C, E505C, T79C,

E86C, D129C, D549C, A581C, D121C, E82C, S270C, A578C, L595LC, D1DC, A2AC, D562DC, A364AC, A504AC, E505EC, T79TC, E86EC, D129DC, D549DC, A581AC, A581AC, D121DC, E82EC, S270SC, A579AC, C360 *, C316 *, C75, C168, C558, C36Í, C91 *, C124 *, 0169 'and C567 *. Alternatively, a cysteine ​​residue can be added to the terminal No. C of the albumin.

Polynucleotides

The present invention also relates to isolated polynucleotides encoding any of the variants of the present invention.

Nucleic Acid Constructions

The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention, operably linked to one or more (several) control sequences that direct expression of the coding sequence in a convenient host cell. under conditions compatible with the control sequences.

A polynucleotide can be manipulated in a variety of ways to provide expression of a variant. Manipulation of the polynucleotide before insertion into a vector may be convenient or necessary depending on the expression vector. Techniques for modifying polynucleotides that use recombinant DNA methods are well known in the art.

The control sequence may be a promoter sequence, which is recognized by a host cell for expression of the polynucleotide. The promoter sequence contains transcription control sequences that mediate variant expression. The promoter can be any nucleic acid sequence, which shows transcription activity in the host cell including mutant, truncated and hybrid promoters and can be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

In a yeast host, useful promoters are obtained from the genes for enochase Saccharomyces cerevisiae (ENO-1), Saccharomyces cerevisiae protease A (PRA1), Saccharomyces cerevisiae protease B (PRB1), Saccharomyces cerevisiae translation elongation factor ( TEF1), translation elongation factor of Saccharomyces cerevisiae (TEF2), Saccharomyces cerevisiae galactokinase (GAL1), alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase from Saccharomyces cerevisiae (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other promoters useful for yeast host cells are described by Romanos et al., 1992, Yeasf 8: 423-488.

The control sequence may also be a convenient transcription terminator sequence, which is recognized by a host cell to terminate transcription. The terminator sequence is operatively linked to the 3 'end of the polynucleotide encoding the variant. Any terminator that is functional in the host cell can be employed.

Preferred terminators for yeast host cells are obtained from the genes of Saccharomyces cerevisiae enolasa, cytochrome C Saccharomyces cerevisiae (CYC1), alcohol dehydrogenase Saccharomyces cerevisiae (ADH1) and glyceraldehyde-3-phosphate dehydrogenase from Saccharomyces cerevisiae. Other terminators useful for yeast host cells are described by Romanos et al., 1992, supra.

The control sequence can also be a convenient leader sequence, an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operatively linked to the 5 'end of the polynucleotide encoding the variant. Any leader sequence that is functional in the host cell can be employed.

Suitable leaders for yeast host cells are obtained from the genes of Saccharomyces cerevisiae (ENO-1), 3-phosphoglycerate kinase Saccharomyces cerevisiae, alpha-factor of Saccharomyces cerevisiae, and alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase of Saccharomyces (Saccharomyces cerevisiae). ADH2 / GAP).

The control sequence can also be a polyadenylation sequence, a sequence operatively linked to the 3 'end of the variant coding sequence and when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. . Any polyadenylation sequence that is functional in the host cell can be employed.

Useful polyadenylation sequences for yeast host cells are described by Guoand Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant in the cell's secretory pathway. The 5 'end of the polynucleotide coding sequence may inherently contain a signal peptide coding region naturally linked in the translation frame / reading frame with the segment of the coding region encoding the variant. Alternatively, the 5 'end of the coding sequence may contain a signal peptide coding region that is foreign or foreign to the coding sequence. The coding region of the foreign signal peptide may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region can simply replace the natural signal peptide coding region in order to improve secretion of the variant. However, any signal peptide coding region that directs the variant expressed in the secretory pathway of a cell can be employed.

Useful signal peptides for yeast host cells are obtained from the alpha factor genes of Saccharomyces cerevisiae and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romans etaL, 1992, supra.

When both regions of the propeptide and signal peptide are present at the N-terminus of a variant, the propeptide region is located near the N-end of the variant and the signal peptide region is located near the N-end of the propeptide region.

Production Methods

Variants of the present invention can be prepared using techniques well known to the person skilled in the art. A convenient way is to clone nucleic acid encoding the precursor albumin or its fusion fragment or polypeptide comprising albumin or its fragment, modifying the nucleic acid to introduce the desired substitution or substitutions into one or more (several) positions corresponding to the positions 417, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501,503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541, 542, 550, 573, 574 and 580 in SEQ ID NO: 2, where the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501K, K541E, D550G.A, K573E or K574N., Prepare a convenient genetic construct where the modified nucleic acid is placed in operational connection with convenient regulatory genetic elements, such as promoter, terminator, activation sites, ribosome binding sites, etc., introducing the genetic construct into a convenient host organism, cultivate the transformed host organism under conditions that lead to expression of the variant and recover the variant. All these techniques are known in the art and it is within the skill of the average practitioner to design a convenient method to prepare a particular variant according to the invention.

The polypeptide variant of the invention can also be connected to a signal sequence in order to have the polypeptide variant secreted in the growth or development medium during culture of the transformed host organism. In general it is advantageous to cause the polypeptide variant to be secreted in the growth medium in order to facilitate recovery and purification.

Techniques for preparing polypeptide variants have also been described in WO 2009019314 (included by reference) and these techniques can also be applied to the present invention.

Albumin has been successfully expressed as recombinant proteins in a range of hosts including fungi (including but not limited to Aspergillus (WO06066595), Kluyveromyces (Fleer 1991, Bio / technology 9, 968-975), Pichia (Kobayashi 1998 Therapeutic Apheresis 2, 257 -262) and Saccharomyces (Sleep 1990, Bio / technology 8, 42-46)), bacteria (Pandjaitab 2000, J. Allergy Clin. Immunol. 105, 279-285)), animals (Barash 1993, Transgenic Research 2, 266-276) and plants (including but not limited to potatoes and tobacco (Sijmons 1990, Bio / technology 8, 217 and Parran 2002, Transgenic Research 11, 337-346) The polypeptide variant of the invention is preferably produced recombinantly in a convenient host cell. In principle, any host cell capable of producing a polypeptide in convenient amounts can be used and it is within the skill of the average practitioner to select a suitable host cell according to the invention. A preferred host organism is yeast, preferably selected from Saccharomycacae, Saccharomyces cerevisiae is more preferred.

Polypeptide variants of the invention can be recovered and purified from the growth medium using a combination of known separation techniques such as filtration, centrifugation, chromatography and affinity separation techniques, etc. It is within the skills of the average practitioner to purify the variants of the invention using a particular combination of these known separation steps. As an example of purification techniques that can be applied to the variants of the present invention, the teachings of W00044772 can be mentioned.

The polypeptide variants of the invention can be used to deliver a beneficial therapeutic compound to an animal or to a human individual that requires it. These therapeutic beneficial compounds include, but are not limited to labels and compounds easily detectable for use in diagnostics, such as various imaging techniques; active pharmaceutical compounds such as drugs, or specifically binding portions such as antibodies. Variants of the invention can even be connected to two or more different beneficial therapeutic compounds, for example an antibody and a drug, which provide the combined molecule, the ability to specifically bind to a desired target or target and thus provide high concentration of the drug connected at that particular target or site.

Fusion polypeptides

The albumin variants or their fragments according to the invention can also be fused with a non-albumin polypeptide fusion partner. The fusion partner may in principle be any polypeptide, but in general it is preferred that the fusion partner be a polypeptide having therapeutic or diagnostic properties. Fusion polypeptides comprising albumin or its fragments are known in the art. It has been found that this fusion polypeptide comprising albumin or its fragment and a fusion partner polypeptide, have a longer plasma half-life compared to the fusion-free fusion fusion polypeptide. According to the invention, it is possible to alter the plasma half-life of the fusion polypeptides according to the invention compared to the corresponding fusion polypeptides of the prior art.

One or more therapeutic polypeptides can be fused to the N-terminus, to the C-terminus of albumin, inserted into a loop in the albumin structure or any combination thereof. It may or may not comprise linker sequences that separate the various components of the fusion polypeptide.

The teachings concerning albumin fusions or their fragment are known in the art and the person with skill will appreciate that these teachings can also be applied to the present invention. WO 2001/79271 A and WO 2003/59934 A also contain examples of therapeutic polypeptides that can be fused to albumin or its fragments, and those examples also apply to the present invention.

Conjugates

The albumin variants or their fragments according to the invention can be conjugated to a second molecule using techniques known in the art. The second molecule may comprise a diagnostic portion, and in this embodiment, the conjugate can be used as a diagnostic tool such as in imaging; or the second molecule can be a therapeutic compound and in this embodiment, the conjugate can be used for therapeutic purposes where the conjugate will have the therapeutic properties of the therapeutic compound as well as the prolonged plasma life of the albumin. Albumin conjugates and a therapeutic molecule are known in the art and it has been verified that these conjugates have prolonged half-life in plasma compared to the 5 free unconjugated therapeutic molecule as such. The conjugates can be conveniently linked by a free uncle group present on the surface of HSA (amino acid residue 34 of mature HSA) using well known chemistry.

In a particular preferred aspect, the albumin variant or its fragment is conjugated to a beneficial therapeutic compound and the conjugate is used for the treatment of a condition in a patient that requires it, this condition responds to the particular selected therapeutic compound. Techniques for conjugating this therapeutic compound to the albumin variant or its fragment are known in the art. WO 2009/019314 describes examples of suitable techniques for conjugating a therapeutic compound with a polypeptide, these techniques can also be applied to the present invention. Furthermore WO 2009/019314 describes examples of compounds and portions that can be conjugated to substituted transferrin and these examples can also be applied to the present invention. The teaching of WO 2009/019314 is included here by reference.

HSA naturally contains a free thiol group that can be conveniently used for conjugation. As a particular embodiment within this aspect, the albumin variant or its fragment may comprise additional modifications that are provided to generate additional free thiol groups on the surface. This has the benefit that the loading of the albumin variant or its fragment is increased, so that more than one molecule of the therapeutic compound can be conjugated to each molecule of the albumin variant or its fragment, 25 or two or more compounds Different therapeutics can be conjugated with each molecule of the albumin variant or its fragment, for example, a compound having target or target properties, such as a specific antibody such as a tumor; and a cytotoxic drug conjugated to the albumin variant or its fragment, thereby creating a highly specific drug against a tumor. The teaching of particular residues that can be modified to provide additional free thiol groups on the surface can be found in the co-pending patent application WO 2010/092135, which is incorporated by reference.

Associates

The albumin variants or their fragments can also be used in the form of associates. In this connection, the associated term is intended to mean a compound comprising an albumin variant or its fragment and another compound bound or associated with the albumin variant or its non-covalent bond fragment. As an example of this associate, an associate consisting of albumin variant and a lipid associated with albumin by a hydrophobic interaction can be mentioned. These associates are known in the art and can be prepared using well known techniques. As an example of a preferred partner according to the invention, an associate comprising albumin variant and paclitaxel may be mentioned.

Other uses

The albumin variant or its fusion fragments or polypeptides comprising albumin variant or its fragments according to the invention have the benefit that their plasma half-life is altered compared to the precursor albumin or its fusion fragments or polypeptides that they comprise precursor albumin or its fragments. This has the advantage that the plasma half-life of conjugates comprising albumin variant or its fragment or fusion polypeptide comprising albumin variant or its fragment, or an associate comprising albumin variant or its fragment according to the invention can be selected according to the particular therapeutic purpose.

For example, for a fusion conjugate, partner or polypeptide used for imaging purposes in animals or humans, in which the imaging portion has very short half-life and a conjugate or fusion polypeptide comprising HSA , has a plasma half-life that is much longer than that required for imaging purposes, it would be advantageous to use an albumin variant or its fragment of the invention that has a shorter plasma half-life than the precursor albumin or its fragment, to provide conjugates of fusion polypeptides having plasma half-life that is sufficiently prolonged for purpose of imaging but short enough to be removed from the body of the particular patient in which it is applied.

In another example for a conjugate, a fusion partner or polypeptide 15 comprising a therapeutic compound effective to treat or alleviate a particular condition in a patient requiring this treatment, it would be advantageous to use the albumin variant or its fragment that has a longer life. plasma media than the precursor albumin or its fragment, to provide associated or conjugates or fusion polypeptides that have longer plasma half lives having the benefit that administration of the fusion partner or conjugate or polypeptide of the invention would require less frequent or reduced doses with less side effects compared to the situation where the precursor albumin or its associates or its fragment was employed.

In a further aspect, the invention relates to compositions comprising the albumin variant, its associates or fragments or a fragment thereof, the albumin variant fragment or its associates or fusion polypeptide comprising albumin variant or its fragment according to the invention. Preferred compositions are pharmaceutical compositions. The composition can be prepared using techniques known in the area as described in manuals recognized within the pharmaceutical field.

In a particular embodiment, the compositions comprise an albumin variant or its fragment according to the invention and a compound comprising a beneficial pharmaceutical portion and an albumin binding domain (ABD = Albumin Binding Domain). According to the invention, ABD means a site, portion or domain capable of binding albumin in circulation in vivo and thus conferring transport in the circulation of ABD and any compound or portion linked to ABD. ABD is known in the art and it has been shown that it binds very strongly to albumin so that a compound comprising an ABD bound to albumin to a certain extent will behave as a single molecule. The inventors have realized when using the albumin variant or its fragment according to the invention together with a compound comprising a beneficial pharmaceutical portion and an ABD, it makes it possible to alter the plasma half-life of the compound comprising a beneficial pharmaceutical portion and an ABD compared to the situation where the compound is injected as such in a patient that requires it or administered in a formulation comprising natural albumin or a fragment Of the same.

The albumin variant or its fragments, conjugates comprising albumin variant or a fragment thereof or fusion polypeptide comprising albumin variant or its fragment, or an associate comprising albumin variant or its fragment according to the invention also It can be incorporated into nano- or microparticles using techniques well known in the art. A preferred method for preparing nano- or microparticles that can be applied to albumin variants or their fragments according to the invention is described in WO 2004/071536, which is incorporated herein by reference.

Compositions

The present invention is also directed to the use of an albumin variant or its fragment or fusion polypeptides comprising albumin variant or its fragments, or a conjugate comprising an albumin variant or its fragment, or an associate comprising a variant of albumin or its fragment, for the manufacture of a pharmaceutical composition, wherein the albumin variant or its fragment or fusion polypeptides comprising albumin variant or its fragments, or a conjugate comprising an albumin variant or its fragment, or an associate comprising an albumin variant or its fragment, has an altered plasma half-life compared to HSA or its corresponding fragment or fusion polypeptide comprising HSA or its fragment or conjugate comprising HSA.

In this connection, the corresponding HSA fragment is intended to mean an HSA fragment that aligns with and has the same number of amino acids as the albumin variant fragment with which it is compared. Similarly, the corresponding fusion polypeptide comprising HSA or conjugate comprising HSA, is intended to mean molecules that have the same size and amino acid sequence as the conjugate fusion polypeptide comprising albumin variant, with which it is compared .

Preferably, the albumin variant or its fragment or fusion polypeptides comprising albumin variant or its fragments, its fragment, or a conjugate comprising an albumin variant or its fragment has a plasma half-life that is longer than life plasma media of HSA or its corresponding fragment or fusion polypeptide comprising HSA or its fragment.

Alternatively, this can be expressed as the albumin variant or its fragment or fusion polypeptides comprising albumin variant or its fragments, its fragment, or a conjugate comprising an albumin variant or its fragment has a KD to FcRn that is less than the corresponding KD for HSA or its corresponding fragment or fusion polypeptide comprising HSA or its fragment. Preferably, it is KD for the albumin variant or its fragment or fusion polypeptides comprising albumin variant or its fragments, its fragment, or a conjugate comprising an albumin variant or its fragment with less than 0.9X KD for HSA, more is preferred with less than 0.5X KD for HSA, more is preferred less than 0.1 X KD for HSA, even more is preferred less than 0.05X KD for HSA, even more is preferred less than 0.02X KD for HSA and in particular less than 0.01X KD for HSA is preferred.

The albumin variant or its fusion fragment or polypeptides comprising albumin variant or its fragments, its fragment, or a conjugate comprising an albumin variant or its fragment, preferably is the albumin variant or its fusion fragment or polypeptides comprising albumin variant or its fragments, its fragment or a conjugate comprising an albumin variant or its fragment according to the invention.

The present invention is further described by the following examples that should not be considered as limiting the scope of the invention.

Examples Materials and Methods

ELISA:

Wells were coated with wild-type HSA or variants diluted in phosphate buffered saline (PBS) at established concentrations, incubated overnight at 4 C and then blocked with 4% skim milk (Acumedia) for 1 hour at room temperature . The wells were then washed four times with PBS / 0.005% TWEEN® 20 (PBS / T) pH 6.0 before () shFcRn fused to glutathione-S-transferrase (GST) (0.5 χ / g / ml) as described in FEBS J. 2008 Aug; 275 (16): 4097-110. Pre-incubated with a polyclonal anti-GST conjugated with horseradish peroxidase (HRP) (1: 5000; GE Healthcare), diluted in 4% skim milk PBS / TWEEN® 20 0.005% (PBS / T) pH 6.0 is added to each well and incubate for 1.5 h at room temperature followed by washing four times with PBS / T pH 6.0. One hundred µ \ of the tetramethylbenzidine (TMB) substrate (Calbiochem) is added to each well and incubated for 45 minutes before 100 µ \ of 0.25 M HCI is added. Absorbance was measured at 450 nm using a Sunrise TECAN spectrophotometer (TECAN, Maennedorf, Switzerland).

The same ELISA was repeated with PBS / T pH 7.4.

Surface Plasmon Resonance (SPR):

SPR experiments were carried out using a Biacore 3000 instrument (GE Healthcare). Flow of CM5 sensor chip cells were coupled with shFcRn-GST (-1400-5000RU) using amine coupling chemistry as described in the protocol provided by the manufacturer. The coupling was performed by injecting 10 / vg / ml of the protein into 10 mM sodium acetate pH 5.0 (GE healthcare). Phosphate buffer (67 mM phosphate buffer, 0.15 M NaCI, TWEEN® 20 0.005%) at pH 6.0) was used as a buffer or run buffer solution and dilution buffer. Surface regeneration was achieved using HBS-EP buffer injections (0.01 M HEPES, 0.15 M NaCI, 3 mM EDTA, 0.005% P20 surfactant) at pH 7.4 (Biacore AB). For binding to immobilized shFcRn-GST, 1.0-0.5 μΜ of each HSA variant were injected onto the surface at constant flow expense (40 μΙ / ml) at

C. In all experiments, the data was set to zero and the reference cell was subtracted. Data evaluation was performed using the BIAevaluation 4.1 program (BIAcore AB).

The same SPR test was repeated with HBS-EP buffer pH 7.4.

For the purposes of this patent unless otherwise established HSA, WT HSA, rHA refer to recombinant human serum albumin commercially available under the trademark RECOMBUMIN (available from Novozymes Biopharma UK Ltd, Nottingham UK) was used for examples.

Serum albumin from other species: The albumins were recombinant as established, produced using sequences that are provided from publicly available databases. Or they are acquired from commercial suppliers.

Expression and purification of Human, soluble (shFcRn) and Mouse (smFcRn) FcRn FcRn: Methods for generating shFcRn and smFcRn expression plasmids, expression and purification of each heterodimer can be found in Berntzen et al. (2005) J. Immunol. Methods 298: 93-104). Alternatively, the shFcRn FcRn heterodimer was produced by GeneArt AG (Germany). Sequences for the two sub-units of the heterodimer can be found in SEQ ID NO: 3 and SEQ ID NO: 4. The soluble receptor was expressed in HEK293 cells and purified from the culture supernatant using Ni-HiTrap chromatography columns.

Example 1. Preparation of variants

Preparation of specific HSA mutein expression plasmids

Methods for the expression of HSA mutant variants and HSA fusion variants were produced using various techniques. Standard molecular biology techniques were employed from start to finish as described by Sambrook, J. and DW

Russell, 2001. Molecular Cloning: a laboratory manual, 3rd ed. Coid Spring Harbor

Laboratory Press, Coid Spring Harbor, NY

Method 1. Amino acid substitutions in HSA detailed in Table 1

Synthetic DNA fragments Ncol / Sacl (859 bp) were generated by assembly or assembly of genes (GeneArt AG, Germany) containing point mutations within the gene encoding HSA (SEQ ID NO: 1) to introduce the desired amino acid substitution into The translated protein. Table 2 details the codons used to introduce amino acid substitutions in the gene encoding HSA. The nucleotide sequence of the synthetic fragment encoding amino acids without change (ie of the natural type) was identical to that in pDB2243 (described in WO 00/44772). Synthetic nucleotide fragments were ligated into pDB2243 digested with Ncol / Sacl to produce plasmids pDB3876-pDB3886 (Table 1). For the production of expression plasmids, pDB3876-pDB3886 (see Table 1) each digested with Notl and Pvul, the DNA fragments were separated through a 0.7% TAE gel (w / v), and 2992bp fragments (cassettes Notl including PRB1 promoter, DNA encoding the fusion leader sequence (FL) (described in WO 2010/092135), nucleotide sequence encoding HSA and ADH1 terminator; See Figure 1) They were purified from agarose gel using a Qiagen Gel Extraction Kit following the manufacturer's instructions. Not "cassettes were ligated into a disintegration plasmid pSAC35 treated with Alkaline Phosphatase A / ofl / Shrimp (Roche), described in EP-A-286 424 and described by Sleep, D., et al. (1991) Bio / Technology 9, 183-187. Ligation mixtures were used to transform E. col! DH5a chemically competent. Expression plasmids pDB3887 - pDB3897, pSAC35 derivatives containing the A / oil cassettes, were identified using standard techniques. Disintegration plasmids pDB3887 - pDB3897 and pDB2244 (for the expression of wild-type HAS, described in WO 00/44772) (Table 1) were used to transform S. cerevisiae BXP10cir ° (as previously described

WO / 2001/079480 as described below.

Table 1: Plasmid, amino acid substitution introduced in HSA

<td>Plasmid</td><td>Building</td>

<td>PDB2244</td><td>HSA</td>

<td>PDB3876</td><td>HSA D494N</td>

<td>PDB3877</td><td>HSA D494A</td>

<td>pDB3878</td><td>HSA E495Q</td>

<td>pDB3879</td><td>HSA E495A</td>

<td>PDB3880</td><td>HSA D494Q</td>

<td>pDB3881</td><td>HSA D494N, T496A</td>

<td>pDB3882</td><td>HSA T496A</td>

<td>pDB3883</td><td>HSA E492G</td>

<td>pDB3884</td><td>HSA E492G, V493P</td>

<td>pDB3885</td><td>HSA E492P</td>

<td>pDB3886</td><td>HSA E492H</td>

<td>pDB3887</td><td>HSA D494N</td>

<td>pDB3888</td><td>HSA D494A</td>

<td>pDB3889</td><td>HSA E495Q</td>

<td>pDB3890</td><td>HSA E495A</td>

<td>PDB3891</td><td>HSA D494Q</td>

Plasmid pDB3927 (described in WO 2010/092135) (containing an identical nucleotide sequence encoding HSA as in pDB2243) was manipulated in amino acid substitutions within the mature HSA protein. Synthetic DNA fragments were generated (GeneArt AG, Germany or DNA2.0 Inc, USA) (Nco \ IBsu36 \, Avrt \ / Sph \ or Sac \ ISph \ fragments), which contain point mutations within the gene encoding HSA to introduce the desired amino acid substitutions in the translated protein sequence. Table 2 details the codons used to introduce amino acid substitutions in the gene encoding HSA. The nucleotide sequence of the synthetic fragment encoding amino acids without change (for example, natural type) was identical to those in pDB3927. Synthetic DNA fragments were subcloned into pDB3927 digested with NcoUBsu36 \, Avrt / Sph \ -, SacUSph (described in PCT 11527.204-WO) to generate pDB4006-pDB4010, pDB4083-pDB4101 and pDB4103-pDB41 11, pDB41 11, pDB200 11, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB194, pDB2004, pDB2004, pDB2004, pDB2004, pDB2004, pDB194 Table 3).

Similarly, BamHI / Sa / l fragments containing point mutations in the nucleotide sequence encoding HSA were generated by gene assembly (DNA2.0 Inc, USA) and ligated into pDB3964 digested with BamVSall (described in WO 2010/092135) for produce plasmids pDB3986-pDB3989 (Table 3).

The C-terminal amino acid chain of position 573-585 (KKLVAASQAALGL) (SEQ ID NO: 9) in HSA was mutated to those in macaque serum albumin (PKFVAASQAALA) (SEQ ID NO: 10), mouse (PNLVTRCKDALA) (SEQ ID NO: 11), rabbit (PKLVESSKATLG) (SEQ ID NO: 12) and sheep (PKLVASTQAALA) (SEQ ID NO: 13). The codons used to introduce each amino acid substitution are given in Table 2. Synthetic DNA fragments (SadISphl) were generated (DNA2.0 Inc, USA) by gene assembly (the nucleotide sequence of the synthetic fragment encoding amino acids without change (i.e., natural type) was identical to that of pDB3927) and was sub-cloned in pDB3927 digested with Sac \ ISph \ to produce plasmids pDB41

14-41 17 (Table 3).

Plasmids pDB3883 (Table 1), pDB4094 and pDB4095 (Table 3) were digested with Nco \ ISac \ and 857bp fragments of each digestion purified before binding on pDB4006 digested with NcoVSac \ or pDB41 10 (8,688kb) (Table 3) to produce pDB4156-pDB4161.

Expression plasmids were generated in vivo (ie by homologous recombination in S. cerevisiae, a technique referred to as opening repair or cloning in vivo - see Orr-Weaver &amp; Szostak. 1983. Proc. Nati. Acad. Sci. USA. 80 : 4417-4421). Modified plasmids cited in Table 3 were digested with BsfEII / fisrBI and the linearized DNA molecules were purified using standard techniques. One hundred ng of each DNA digested with BstEWIBsrBl, purified using a Qiagen PCR kit purification kit following the manufacturer's instructions, was mixed individually with 100ng of pDB3936 digested with Acc65l / BamHI (described in WO 2010/092135) and used to directly transform S Cerevisiae BXPI Ocir⁰ using the Sigma Yeast Transformation Transformation kit described below. Table 3.

<td>Plasmid</td><td>Amino acid substitution in HSA</td>

<td>PDB3986</td><td>HSA H440Q</td>

<td>pDB3987</td><td>HSA H464Q</td>

<td>pDB3988</td><td>HSAH510Q</td>

<td>PDB3989</td><td>HSA H535Q</td>

<td>PDB4006</td><td>HSA K573A</td>

<td>pDB4007</td><td>HSA E492T / N503K / K541A</td>

<td>pDB4008</td><td>HSA K541G</td>

<td>pDB4009</td><td>HSA K541D</td>

<td>pDB4010</td><td>HSA D550N</td>

<td>PDB4083</td><td>HSA D494E / Q417H</td>

<td>PDB4084</td><td>HSAQ417A</td>

<td>pDB4085</td><td>HSA P499A</td>

<td>pDB4086</td><td>HSA K500A</td>

<td>pDB4087</td><td>HSA K536A</td>

<td>pDB4088</td><td>HSA P537A</td>

<td>pDB4089</td><td>HSA K538A</td>

<td>pDB4090</td><td>HSA E492G / V493P / K538H / K541N / E542D</td>

<td>PDB4091</td><td>HSA E492P / N503K / K541G / E542P</td>

<td>pDB4092</td><td>HSA N503K</td>

<td>pDB4093</td><td>HSA N503H</td>

<td>pDB4094</td><td>HSA E492G / N503K</td>

<td>pDB4095</td><td>HSA E492G / N503H</td>

<td>pDB4096</td><td>HSA E492T</td>

<td>pDB4097</td><td>HSA N503D</td>

<td>pDB4098</td><td>HSA E492T / N503D</td>

<td>pDB4099</td><td>HSA K538H</td>

<td>pDB4100</td><td>HSA K541A</td>

<td>pDB4101</td><td>HSA K541N</td>

<td>PDB4103</td><td>HSA E542D</td>

<td>pDB4104</td><td>HSA E542P</td>

<td>PDB4105</td><td>HSA D550E</td>

<td>pDB4106</td><td>HSA E492H / E501P / N503H / E505D / T506S / T540S / K541E</td>

<td>pDB4107</td><td>HSA A490D / E492T / V493L / E501P / N503D / A504E / E505K / T506F / K541D</td>

<td>PDB4108</td><td>HSA E501A</td>

<td>pDB4109</td><td>HSA E501Q</td>

<td>pDB4110</td><td>HSA K573P</td>

<td>pDB4111</td><td>HSA E492G / K538H / K541N / E542D</td>

<td>pDB4114</td><td>HSA K573P / L575F / G584A</td>

<td>pDB4115</td><td>HSA K573P / K574N / A577T / A578R / S579C / Q580K / A581D / -584A</td>

<td>pDB4116</td><td>HSA K573P / A577E / A578S / Q580K / A582T</td>

<td>pDB4117</td><td>HSA K573P / A578S / S579T / G584A</td>

<td>pDB4156</td><td>HSA E492G K573A</td>

<td>pDB4157</td><td>HSA E492G N503K K573A</td>

<td>pDB4158</td><td>HSA E492G N503H K573A</td>

<td>pDB4159</td><td>HSA 492G K573P</td>

<td>PDB4160</td><td>HSA E492G N503K K573P</td>

<td>pDB4161</td><td>HSA E492G N503H K573P</td>

<td>pDB4194</td><td>HSA D550E</td>

<td>pDB4200</td><td>HSAK574N</td>

<td>PDB4202</td><td>HSAQ580K</td>

Table 4: K500 primers and plasmids

<td></td><td>Original primers</td><td colspan="2">CODONS EMPLOYEES</td>

<td>xAP216</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAGGTGAA TTCAACGCTG (SEQ ID NO: 14)</td><td>Gly</td><td>GGT</td>

<td>17217</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAGAAGAA TTCAACGCTG (SEQ ID NO: 15)</td><td>Glu</td><td>GAA</td>

<td>xAP218</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAGACGAA TTCAACGCTG (SEQ ID NO: 16)</td><td>Asp</td><td>GAC</td>

<td>xAP219</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAGTTGAA TTCAACGCTG (SEQ ID NO: 17)</td><td>Val</td><td>GTT</td>

<td>XAP220</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAAGAGAA TTCAACGCTG (SEQ ID NO: 18)</td><td>Arg</td><td>AGA</td>

<td>XAP221</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAAACGAA TTCAACGCTG (SEQ ID NO: 19)</td><td>Asn</td><td>AAC</td>

<td>ΧΑΡ222</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAATGGAA TTCAACGCTG (SEQ ID NO: 20)</td><td>Met</td><td>ATG</td>

<td>XAP223</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAATTGAA TTCAACGCTG (SEQ ID NO: 21)</td><td>I have</td><td>ATT</td>

<td>XAP224</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCAACCGAA TTCAACGCTG (SEQ ID NO: 22)</td><td>Thr</td><td>ACC</td>

<td>XAP225</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCA TGGGAATTCAACGCTG (SEQ ID NO: 23)</td><td>Trp</td><td>TGG</td>

<td>XAP226</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCATGTGAA TTCAACGCTG (SEQ ID NO: 24)</td><td>Cys</td><td>TGT</td>

<td>XAP227</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCATACGAA TTCAACGCTG (SEQ ID NO: 25)</td><td>Tyr</td><td>CT</td>

<td>ΧΑΡ228</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCATTGGAA TTCAACGCTG (SEQ ID NO: 26)</td><td>Leu</td><td>TTG</td>

<td>XAP229</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCATTGGAA TTCAACGCTG (SEQ ID NO: 27)</td><td>Phe</td><td>TTC</td>

<td>XAP230</td><td>CTTTGGAAGTCGACGACGAAACTTACGTTCCATCT GAATTCAACGCTG (SEQ ID NO: 28)</td><td>Be</td><td>TCT</td>

<td>xAP231</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCACAAGAA TTCAACGCTG (SEQ ID NO: 29)</td><td>Gln</td><td>CAA</td>

<td>XAP232</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCACACGAA TTCAACGCTG (SEQ ID NO: 30)</td><td>His</td><td>CAC</td>

<td>XAP233</td><td>CTTTGGAAGTCGACGAAACTTACGTTTCCACCAGA ATTCAACGTCTG (SEQ ID NO: 31)</td><td>Pro</td><td>CCA</td>

<td>XAP234</td><td>CTTTGGAAGTCGACGAAACTTACGTTCCATAAGAA TTCAACGCTG (SEQ ID NO: 32)</td><td>STOP</td><td>sooo</td>

<td></td><td></td><td></td><td></td>

<td>XAP235</td><td>GAATTAAGC7TATTACAAACCCAAAGCAGCTTGGG AAGC (SEQ ID NO: 33)</td><td></td><td></td>

Table 5: K573 primers and plasmids

<td colspan="2">Original primers</td><td colspan="2">EMPLOYED CODONS</td>

<td>XAP187</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT T CCACCCTCCTCG (SEQ ID NO: 34)</td><td>Gly</td><td>GGT</td>

<td>xAP188</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TT T CACCCTCCTCG (SEQ ID NO: 35)</td><td>Glu</td><td>GAA</td>

<td>ΧΑΡ189</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TTCACCCTCCTCG (SEQ ID NO: 36)</td><td>Asp</td><td>Cat</td>

<td>ΧΑΡ190</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAACACCCTCCTCG (SEQ ID NO: 37)</td><td>Val</td><td>GTT</td>

<td>XAP191</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TTCTACCCTCCTCG (SEQ ID NO: 38)</td><td>Arg</td><td>AGA</td>

<td>XAP192</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAI TACCCTCCTCG (SEQ ID NO: 39)</td><td>Asn</td><td>AAT</td>

<td>XAP193</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TCATACCCTCCTCG (SEQ ID NO: 40)</td><td>Met</td><td>ATG</td>

<td>xAP194</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAATACCCTCCTCG (SEQ ID NO: 41)</td><td>lie</td><td>ATT</td>

<td>XAP195</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAGTACCCTCCTCG (SEQ ID NO: 42)</td><td>Thr</td><td>ACT</td>

<td>XAP196</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TCC ACCCTCCTCG (SEQ ID NO: 43)</td><td>Trp</td><td>TGG</td>

<td>XAP197</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TACAACCCTCCTCG (SEQ ID NO: 44)</td><td>Cys</td><td>TGT</td>

<td>XAP198</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAT AACCCTCCTCG (SEQ ID NO: 45)</td><td>Tyr</td><td>TAT</td>

<td>XAP199</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TCAAACCCTCCTCG (SEQ ID NO: 46)</td><td>Leu</td><td>TTG</td>

<td>xAP200</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAAAACCCTCCTCG (SEQ ID NO; 47)</td><td>Phe</td><td>TTT</td>

<td>XAP201</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAGAACCCTCCTCG (SEQ ID NO: 48)</td><td>Be</td><td>TCT</td>

<td>XAP202</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TAGAACCCTCCTCG (SEQ ID NO: 49)</td><td>Gln</td><td>CAA</td>

<td>XAP203</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TATGACCCTCCTCG (SEQ ID NO: 50)</td><td>His</td><td>CAT</td>

<td>XAP204</td><td>ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTT TTTAACCCTCCTCG (SEQ ID NO: 51)</td><td>STOP</td><td>sooo</td>

<td>XAP205</td><td>AATGCTGCCTAAGGAGATCTGCTTGAATGTGCTGAT G (SEQ ID NO: 52)</td><td></td><td></td>

Method 4. HSA permutation library K500 and K573

PCR was used to produce two permutation libraries where the codons encoding the amino acid 500 or 573 of mature HSA were changed (mutated) to unnatural type amino acids and termination codons (K5XXSTOP). Mutagenic oligonucleotides (Table 4 and Table 5), were designated to amplify DNA encoding HSA and incorporate the desired changes. That is, for changes in position 500, pDB4082 (Figure 1) was used as a template DNA. pDB4082 is a derivative of pDB2305 (described in EP1788084) and was produced as follows. pDB2305 (Figure 2) was digested with NsNSpel and the Nsil 8.779kb fragment obtained was self-ligated to produce pDB4005 (Figure 3). A synthetic DNA fragment (Bsa \ / Sph \) was generated by gene assembly (DNA2.0 Inc, USA) (SEQ ID NO: 1) (containing the 3 'region of the PRB1 promoter, the modified fusion leader sequence , nucleotide sequence encoding HSA and 5 'region of the ADH terminator) (modified), and ligated into pDB4005 digested with HindWVSphl (Figure 3) to produce pDB4082. Note that the Hind \\\ site at the PRBI promoter site has been removed and a Sadl site within the nucleotide sequence encoding HSA has been introduced.

For the permutation library for position 500 of HSA, the nucleotide sequence encoding HSA corresponding to between SalVHindlW sites (see plasmid map pDB4082, Figure 1) was generated using the New England Biolabs Phusion kit (Table 6) and oligonucleotides cited in Table 4. Table 7 describes the PCR method used.

The permutation library at amino acid position 573 in HSA was generated using pDB3927 as a template DNA and involved amplifying the DNA encoding albumin corresponding to that between the Nco \ and Bsu36 \ sites using the oligonucleotides detailed in Table 5.

Table 6: PCR ingredients

<td></td><td>500 library</td><td>Library 573</td>

<td>200 pl HF shock absorber (5X)</td><td></td><td></td>

<td>2 μΙ dNTP mixture (10 mM)</td><td></td><td></td>

<td>2 μΙ oligonucleotide (10 μΜ)</td><td>xAP235</td><td>XAP205</td>

<td>2 μΙ oligonucleotide (10 μΜ)</td><td>XAP216 -xAP234</td><td>XAP187 -XAP204</td>

<td>1 μΙ Phusion polymerase</td><td></td><td></td>

<td>1 μΙ of template DNA (~ 5 ng)</td><td>PDB4082</td><td>pDB3927</td>

<td>72 μΙ of dH₂OR</td><td></td><td></td>

Table 7: PCR conditions:

<td>98 ° C for 2 minutes</td><td>1 cycle</td>

<td>98 ° C for 10 sec</td><td rowspan="3">35 cycles</td>

<td>57 ° C for 30 sec</td>

<td>72 ° C for 20 sec</td>

<td>72 ° C for 5 min</td><td>1 cycle</td>

For albumin variants based on positions 500 and 573, each PCR product was purified using a Qiagen PCR-clean up kit (according to the manufacturer's instructions), digested with SaNHindlü (library position 500) or Nco \ / Bsu36 \ (library position 573). The digested DNAs were then purified using a Qiagen PCR-clean up kit and ligated into pDB4082 or pDB3927 digested with Sal \ / Hind \\\ - or Nco \ IBsu3Ql, respectively replacing the equivalent native sequence. Ligaments were transformed into E. coli DH5a, subsequent plasmids isolated from transformants using Qiagen miniprep equipment (according to the manufacturer's instructions) and the correct constructs identified by restriction analysis. This produced a collection of plasmids pDB4204 - pDB4222 (library position 500) pDB4173 to pDB4190 (library position 573), which contain albumin genes that differ only in their sequence corresponding to the codon for the amino acid

9 '5 »*' * in position 500 or 573 (Tables 4 and 5, respectively). Specific changes in each plasmid were confirmed by sequence.

The resulting plasmids were used to generate expression and yeast plasmids that produce albumin fusion by cloning in vivo as described above. That is, S. cerevisiae was transformed using the Sigma Yeast Transformation kit (described below), using a mixture of 100 ng of plasmid containing HSA variant digested with Bs / EII / fisrBI and 100 ng of pDB3936 digested with Acc65l / BamHI .

Transformation of S. cerevisiae

S. cerevisiae BXP10 cir ° (as previously described WQ / 2001/079480) or Cepa A cir ° (described in WO / 2005/061718) was scratched on YEPD plates (1% (w / v) yeast extract, 2 % (w / v) Bactopeptone, 2% (w / v) glucose), 1.5% agar) and allowed to grow for 4 days at 30 ° C before transformation. One pg of whole plasmid (i.e. circular plasmids) or for opening repair 100 ng of HSA variant digested with BsíEll / fisrBI- or Nsi \ / Pvu \ or HSA variant fusion containing plasmid and 100 ng of pDB3936 digested with Acc65l / BamHI were used to transform S. cerevisiae using a Sigma Yeast Transformation kit transformation kit using a modified lithium acetate method (Sigma yeast transformation kit, YEAST-1, protocol 2; Ito et al. (1983) J. Bacteríol., 153, 16; Elble, (1992) Biotechniques, 13, 18). The protocol was slightly modified by incubating the transformation at room temperature for 4 h before thermal shock. After thermal shock, the cells were centrifuged briefly before resuspended in 200 µl of 1M sorbitol then spread on BMMD agar plates, the BMMD composition is described by Sleep et al., (2001), Yeast, 18, 403. Plates were incubated at 30 ° C for 4 days before individual colonies were patched on fresh BMMD plates. Numbers of yeast strains are detailed in Table 1.

Materials were prepared for each yeast strain as follows: BMMD Broth was inoculated with a heavy loop of each yeast patch and grown for 24h at 30 ° C with orbital shaking at 200 rpm. The cells were collected by centrifugation at

1900 ^x g for 5 minutes in a Sorval RT600.15 mL centrifuge of supernatant are removed and replaced with 40% trehalose (w / v). The cells were resuspended and transferred to cryo ampoules (1 mL) for storage at -80 ° C.

Growth in shake flask of S. cerevisiae

BMMD (recipe 0.17% (w / v) of yeast nitrogen base without amino acid and ammonium sulfate (Different), 37.8 mM ammonium sulfate, 29 mM citric acid, dehydrated hydrogen orthophosphate 142 mM pH 6.5, 2% (p / v) glucose) medium (10 mL) was inoculated with each yeast strain and developed for 12 h at 30 ° C with orbital shaking at 200 rpm. An aliquot of each starter culture (4 mL) was used to inoculate 2 x 200 mL of BMMD medium and was grown for 36 h at 30 ° C with orbital shaking to

200 rpm Cells were harvested by filtration through vacuum filter membranes

0.2 pm (Stericup, Millipore) including a GF-D prefilter (Whatman) and the supernatant retained for purification.

Primary Concentration

Retained culture supernatant was concentrated using Tangential Flow Filtration 20 using a Pall Filtran LV system adapted with a 10 KD Omega filter (0.093 m2) (LV CentramateTM cassette, Pall Filtran) with a transmembrane pressure of 138 kPa (20 psi) and a recirculation rate of 180 mL.min '¹.

Fermentation

Batch-fed fermentations were carried out in a Sartorius Biostat C fermenter of 10 L at 30 ° C; pH was monitored and adjusted by the addition of ammonia or sulfuric acid as appropriate. Ammonia also provided the source of nitrogen for the crops. The dissolved oxygen level was monitored and linked to the agitator speed, to maintain the level at&gt; 20% saturation. Inoculae developed in shake flasks in a minimum buffer (recipe). For the batch phase, the cultures were inoculated in a thermostat medium (approximately 50% of the volume of the termentator) containing 2% (w / v) sucrose. The feeding stage was automatically activated by a marked increase in the level of dissolved oxygen. Sucrose was maintained at limiting growth concentrations by controlling the feed rate at a set nominal growth rate. The io feed consisted of fermentation medium containing 50% (w / v) sucrose, all essentially as described by Collins. (Collins, SH, (1990) Production of secreted proteins in yeast, in: TJR Harris (Ed.) Protein production by biotechnology, Elsevier, London, pp. 61-77).

GP-HPLC quantification

Variants of purified albumin, fusions and conjugates were analyzed by

GP-H PLC and quantification as follows. Injections of 25 μ \ were made in a 7.8 mm column of DI x 300 mm length TSK G3000SWXL (Tosoh Bioscience), with a 6.0 mm protection column of DI x 40 mm length TSK SW (Tosoh Bioscience). Samples were chromatographed on 25 mM sodium phosphate, 100 mM sodium sulfate, 0.05% (w / v) sodium azide, pH 7.0 at 1 mL / min. The samples were quantified by UV detection at 280 nm, per peak area, with respect to a norm of recombinant human albumin of known concentration (10 mg / mL) and corrected for their relative extinction coefficients.

Purification of albumin variants from shake flask

Albumin variants were purified from shake flask (either culture supernatant or concentrated culture supernatant) using a simple chromatographic step using an albumin affinity matrix (AlbuPure ™ ProMetic Biosciences, Inc.). Chromatography was performed at a constant linear speed of 240 cm / h from start to finish. The culture supernatant was applied to a bed 6 cm high, packed 2.0 ml_, pre-equilibrated with 50 mM sodium acetate pH 5.3. After loading, the column was washed with 10 column volumes (CV = Column Volume) of equilibrium buffer, then 50 mM ammonium acetate pH 8.0 (10CV). The product was eluted with either 50 mM ammonium acetate, 10 mM octanoate, pH 8.0, 50 mM Ammonium Acetate, 30 mM Sodium Octanoate, 200 mM Sodium Chloride pH 7.0 or

200 mM Potassium Thiocyanate. The column was cleaned with 0.5M NaOH (3cv) and 20mM NaOH (3.5cv). The eluate fractions of each albumin variant were concentrated and diafiltered against 10 volumes of 50 mM sodium chloride (Vivaspin20 10,000 MWCO PES with optional diafiltration cups, Sartorios). Variants of purified albumin were quantified by GP-HPLC as described above.

Purification of Fusion Variants of Stir Flashing Albumin

Albumin fusion variants were purified from shake flask culture supernatant using a single chromatographic stage using an albumin affinity matrix (AlbuPure ™ - ProMetic Biosciences, Inc.). Chromatography was performed at a constant linear speed of 240 cm / h from start to finish.

Culture supernatant or concentrated culture supernatant was applied at a bed height of 6 cm, 2.0 mL of pre-equilibrated packed bed with 50 mM sodium acetate pH 5.3. After loading, the column was washed with 10 column volumes (cv) of equilibrium buffer, then 50 mM ammonium acetate pH 8.0 (10cv). The product was eluted with either 50 mM ammonium acetate, 10 mM octanoate pH 8.0,

5 50 mM Ammonium Acetate, 30 mM Sodium Octanoate, 200 mM Sodium Chloride pH 7.0,

50 mM Ammonium Acetate, 100 mM Sodium Octanoate pH 9.0 or 200 mM Potassium Thiocyanate. The column was cleaned with 0.5 M NaOH (3cv) and 20 mM NaOH (3.5cv). The eluate fractions of each albumin variant fusion were concentrated and diafiltered against 10 volumes of 25 mM Tris, NaC1150 mM, KCI2 mM, pH 7.4 (Vivaspin20 10,000 MWCO PES with optional diafiltration cups, Sartorius). Purified albumin fusion variants were quantified by GP-HPLC as described above.

Purification of Albumin Variants from Fermentation

Albumin variants were purified from high-density cell-feed batch fermentation supernatants after centrifugation separation, using a Sorvall RC 3C centrifuge (DuPont). Culture supernatant was chromatographed through a column with a bed height of 11 cm, 8.6 mL of packed bed, packed with a custom synthesized albumin affinity matrix (AlbuPure ™ - ProMetic Biosciences, Inc.) as described above. The product was eluted using elution dampers described above at a flow rate of 120 cm / h. The eluate fraction (s) were analyzed by GP-HPLC (previously) and SDS-PAGE reduction for purity and if concentrate is required (Vivaspin20 10,000 MWCO PES) and applied to a 2.4x96 cm column packed with Superdex 75 that is operated at a flow rate of 39 cm / h in 25 mM Tris, 150 mM NaCI, 2 mM KCI, pH 7.4. The peak was fractionated, tested by GP-HPLC and collected and grouped or combined in order to generate the monomeric protein of interest. The grouped or assembled fractions were concentrated (Vivaspin20 10,000 MWCO PES, Sartorius).

All proteins to be tested for receptor binding properties (FcRn) and other analyzes were quantified by GP-HPLC as described above, corrected for their relative extinction coefficients.

Example 2. Determination of HSA receptor binding properties (shFcRn) derived from recombinant human albumin and blood.

Essentially free fatty acid HSA (Sigma-Aldrich) was further purified by size exclusion chromatography as described by Andersen et al (2010). J. Biol. Chem. 285, (7), 4826-4836. Ten μΜ of monomeric HSA and rHA were analyzed using SPR as described above and the data is presented in Figure 4.

A direct comparison of HSA (blood derived) with recombinant human albumin (Recombumin) at the same concentration (10 μΜ) (Figures 4A and 4B) illustrates for both immobilized shFcRn binding samples (pH 6.0, pH 7.4 10 respectively) was reversible and pH dependent. In addition, comparison of HSA against recombinant human albumin by Bosse et al (2005). J. Clin. Pharmacol Four. Five; 5767, demonstrated an equivalent half-life in human studies in vivo.

Example 3. Determination of receptor binding properties (shFcRn) of albumin variants

Two established FcRn binding assays were employed. ELISA and SPR.

There are major differences between the tests: In the ELSA HSA system it is coated directly in wells and shFcRn-GST is added in solution while in the SPR shFcRn-GST test it is immobilized to a CM5 chip and HSA is injected in solution. The pH can be varied in both systems.

Variants were analyzed using ELISA at pH 6.0 and pH 7.4. The results are described in Figure 5. ELISA values ​​represent the average of duplicates.

Variants were analyzed using SPR analysis at pH 6.0 and pH 7.4. The results are described for a representative number of variants in Figure 6 25 using a concentration of the variants of 0.2 μΜ and in Figure 7 using a concentration of the variants of 1 μΜ.

The SPR data described in Figures 6 and 7 were normalized and the relative linkage of variants in each concentration is shown in Figures 8A and B respectively.

The conclusions of the analysis are that all the variants tested have the characteristic link to the receptor at pH 6.0 but without the link to pH 7.4. Variants D494N, Q, A, E495Q.A, T496A, and D494N + T496A show reduced link to the receptor compared to HSA.

Example 4. Determination of receptor binding properties (shFcRn / smFcRn) of albumin variants

Using the SPR analysis method below, the Ka association constant, the Kd dissociation constant and the KD binding constant calculated for HSA and mouse serum albumin binding (MSA) with human and mouse FcRn (Table 8) .

SPR analysis - SPR analysis were performed on a BIAcore 3000 instrument (GE Healthcare) using CM5 chips and immobilization of smFcRn-GST and shFcRn-GST variants or smFcRn was performed using the amine coupling kit (GE Healthcare). Protein samples (10 g / ml) were injected into 10 mM sodium acetate at pH 4.5 (GE Healthcare), all as described by the manufacturer. Unreacted portions on the surface were blocked with 1 M ethanolamine. for all experiments, phosphate buffer (67 mM phosphate buffer, 0.15 M NaCI, TWEEN® 20 0.005%) at pH 6.0 or pH 7.4, or HBS-P buffer (0.01 M HEPES, 0.15 M HCI, P20 0.005% surfactant ) at pH 7.4, they were used as a running buffer or dilution buffer. Kinetic measurements were performed using a low density immobilized surface (100-200 resonance units (RU = Resonance

Units)). Serial dilutions of hlgG1 (2000.0-31.2 nM), hlgG1 (1000.0-15.6 nM), MSA (20.0-0.3 μΜ) and HSA (200.0-3.1 μΜ) were injected at pH 6.0 or pH 7.4, at a flow expense of 50 μΙ / minute at 25 ° C. Additive binding was recorded when injecting HSA (10 μΜ), MSA (5 μΜ), hlgG1 (100 nM) or mlgG1 (100 nM) alone or two at a time at 25 ° C or at 20 pl / minute at pH 6.0 on immobilized shFcRn (-600 RU) or smFcRn (-600 RU). Competitive binding was measured by injecting shFcRn (50 nM) or smFcRn (100 nM) alone or in conjunction with different amounts of HSA or MSA (10.0-0.05 μΜ) on immobilized HSA (-2600 RU) or MSA (-2000 RU). In all cases, to correct non-specific binding and volume damping effects, responses obtained from control surfaces and control injections were subtracted from each interaction curve. Kinetic velocity values ​​were calculated using predefined models (Langmuir 1: 1 ligand model, heterogeneous ligand model and stable state affinity model) were provided by the BIAevaluation 4.1 program. The proximity of the adjustment, described by the statistical value χ² which represents the quadratic mean, was less than 2.0 in all 15 affinity estimates.

Table 8: HSA and MSA shFcRn and smFcRn binding constants.

<td>Species</td><td>Espe-</td><td>Ka</td><td>Kd</td><td>KD</td><td>KD</td>

<td>of Albú-</td><td>cies of</td><td> (10³/ Ms)</td><td> (10³/ s)</td><td>(μΜ)</td><td>Req. (PM)</td>

<td>mine</td><td>FcRn</td><td></td><td></td><td></td><td></td>

<td>MSA</td><td>Mouse</td><td> 4.2+0.5</td><td> 39.4+3.1</td><td> 9.3+0.4</td><td>ND^d</td>

<td>MSA</td><td>Human</td><td> 3.8+0.0</td><td> 3.1+0.1</td><td> 0.8+0.2</td><td>ND</td>

<td>HSA</td><td>Mouse</td><td>NA</td><td>NA</td><td>NA</td><td> 86.2+4.1</td>

<td>HSA</td><td>Human</td><td> 2.7+1.3</td><td> 12.2+5.9</td><td> 4.5+0.1</td><td> 4.6+0.5</td>

KDs were generated using the BIAevaluation program 4.1) Langmuir A 1: 1 ligand model was used from start to finish. Kinetic values ​​represent the average of triplicates. ND means: Not determined. NA means: Not acquired

Example 5. Binding of albumins of other species with human FcRn

Commercially available animal albumin (either Sigma-Aldrich or

Calbiochem) is further purified as described in Andersen et al (2010).

J.Biol.Chem. 285, (7), 4826-4836. Donkey serum albumin bond, bovine serum albumin, goat serum albumin, sheep serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, rabbit serum albumin Indies, rat serum albumin, chicken serum albumin at 10 shFcRn, was determined using the techniques described in Materials and Methods. The ELISA results are described in Figures 9 AD and the relative links are summarized in Figure 9E.

The SPR results are shown in Figure 10, where the bond at pH 6.0 and pH 7.4 for each albumin species is illustrated. Table 10 shows an overview of the relative link responses measured using ELISA and SPR:

Table 10: Albumin-FcRn binding across species

<td rowspan="3">Albumin species</td><td colspan="4">shFcRn</td>

<td colspan="2">ELISA</td><td colspan="2">SPR</td>

<td>pH6.0</td><td>pH7.4</td><td>pH6.0</td><td>pH7.4</td>

<td>Human</td><td> ++(+)</td><td> -</td><td> ++(+)</td><td> -</td>

<td>Donkey</td><td> +++</td><td> -</td><td> ++</td><td> -</td>

<td>Cow</td><td> ++</td><td> -</td><td> ++</td><td> -</td>

<td>Sheep</td><td> +/-</td><td> -</td><td> -</td><td> -</td>

<td>Goat</td><td> +/-</td><td> -</td><td> -</td><td> -</td>

<td>Rabbit</td><td> ++++</td><td> -</td><td> +++</td><td> -</td>

<td>Dog</td><td>ND^to</td><td>ND</td><td> +++</td><td> -</td>

<td>Guinea pig</td><td> ++++</td><td> +</td><td> ++++</td><td> +</td>

<td>Hamster</td><td> +++</td><td> -</td><td> +++</td><td> -</td>

<td>Rat</td><td> +++</td><td> -</td><td> +++</td><td> -</td>

<td>Mouse</td><td> +++</td><td> -</td><td> +++</td><td> -</td>

<td>Chicken</td><td> -</td><td> -</td><td> -</td><td> -</td>

Relative link responses are categorized from the strongest (++++) to the weakest (+) and no link from (-) to: Not determined (ND = Not Determined).

A hierarchy in the strongest to weakest link interval is as follows; guinea pig = /&gt; rabbit&gt; hamster / dog&gt; rat / mouse&gt; donkey&gt; human&gt; bovine&gt; goat / sheep&gt; chicken. These data show that animal albumins have 15 different affinities for shFcRn.

Example 6. Kinetics of the HSA variant for shFcRn

The binding constants for the variants according to the invention were determined according to the methods described in Materials and Methods.

Table 11: HSA variant link constants for shFcRn

<td>Variant Albumin</td><td>from</td><td>Ka (10³/ Ms)</td><td>Kd (10³/ s)</td><td>KD (μΜ)</td><td>KD Req. (PM)</td>

<td colspan="2">Wt</td><td> 3.210.2</td><td> 15.512.5</td><td> 4.8</td><td> 5.4</td>

<td colspan="2">D494N</td><td> 1.710.0</td><td> 18.610.0</td><td> 10.9</td><td> 11.8</td>

<td colspan="2">D494A</td><td> 2.310.1</td><td> 53.4+0.3</td><td> 23.2</td><td> 17.0</td>

<td>D494Q</td><td> 2.110.0</td><td> 58.213.8</td><td> 27.7</td><td>ND</td>

<td>E495Q</td><td> 2.510.0</td><td> 24.110.2</td><td> 9.6</td><td> 10.9</td>

<td>E495A</td><td> 2.110.0</td><td> 14.010.0</td><td> 7.0</td><td> 8.6</td>

<td>D494N + T496A</td><td> 2.510.0</td><td> 11.010.0</td><td> 4.4</td><td> 5.5</td>

<td>T496A</td><td> 2.310.0</td><td> 11,710.5</td><td> 5.1</td><td> 7.1</td>

<td>E492G</td><td> 4.110.0</td><td> 11.010.0</td><td> 2.7</td><td>ND</td>

The KD's were generated using the BIAevaluation 4.1 program, a Langmuir 1: 1 ligand model was used from start to finish. Kinetic values ​​represent the average of triplicates. ND means: Not determined.

The results correspond to the conclusions made in Example 3 based on SPR and ELISA data but also show that E492G has increased affinity to its receptor.

Example 7. Competitive analysis of HSA variants

Competitive analysis of the HSA variants prepared in example 7 and WT

HSA was performed using the methods described in Example 4. The results are shown in Figure 15. The results show that the E492G variant, unlike E492H E492P and E492G + V493P, has stronger bond to shFcRn than HSA.

Example 8. Analysis of substitutions Q417

Using the method of Example 1, the HSA variants that have the substitutions Q417A and D494E + Q417H were constructed. The kinetic properties of these variants were tested using the methods in Materials and Methods and are shown in Table 12.

Table 12: HSA variant link constants for shFcRn

<td>Variant⁹ albumin</td><td>Ka (10³/ Ms)</td><td>Kd (10 '³/ s)</td><td>KD^b(μΜ)</td><td>KD Req^c (μΜ)</td>

<td>Wt</td><td> 3.210.2</td><td> 15.512.5</td><td> 4.8</td><td> 5.4</td>

<td>Q417A</td><td> 3.210.1</td><td> 26.010.0</td><td> 8.1</td><td>ND</td>

<td>D494E + Q417H</td><td> 3.110.1</td><td> 20.510.5</td><td> 6.6</td><td>ND</td>

a: Dilutions of HSA variants were injected on immobilized shFcRn (-1500 RU).

b: Kinetic velocity constants were obtained using a simple first order bimolecular interaction model (1: 1).

c: The steady state affinity constant was obtained using an equilibrium link model (Req) provided by the BIAevaluation 4.1 program. Kinetic values ​​represent the average of triplicates.

d: Not determined (ND).

The data shows that the Q417A and D494E + Q417H variants bind the receptor weaker than wild or natural type HSA.

Example 9. Analysis of HSA variants at positions 499, 500, 536, 537, 538 and 573.

Using the method of Example 1, HSA variants having the substitutions P499A, K500A, K536A, P537A, K538A and K573A were constructed. The receptor binding properties of these variants were tested as described in Materials and Methods. The results are shown in Figure 11.

The data showed that the variants P499A, K536A, P537A and K538A had reduced affinity for binding to shFcRn with respect to HSA. The K500A variant almost completely lost its ability to bind shFcRn and K573A had an increased binding affinity to shFcRn both with respect to HSA.

Example 10. Analysis of variants at position 501 of HSA.

Using the method of Example 1, HSA variants that have the substitutions E501A and E501 Q were constructed. The kinetic properties of these variants were tested as described in Materials and Methods.

Table 13: HSA variant binding constants for shFcR.

<td>Variant⁹ albumin</td><td>Ka (10³/ Ms)</td><td>Kd (10 '³/ s)</td><td>KD^b(μΜ)</td><td>KD Req^c (μΜ)</td>

<td>Wt</td><td> 3.2+0.2</td><td> 15.512.5</td><td> 4.8</td><td> 5.4</td>

<td>E501A</td><td> 3.310.0 ·</td><td> 26.010.0</td><td> 7.8</td><td>ND</td>

<td>E501Q</td><td> 2.710.1</td><td> 15.510.5</td><td> 5.7</td><td>ND</td>

a: Dilution of HSA variants were injected on immobilized shFcRn (~ 1500 RU).

b: Kinetic velocity constants were obtained using a simple first order bimolecular interaction model (1: 1).

c: The steady state affinity constant was obtained using an equilibrium link model (Req) provided by the BIAevaluation 4.1 program. Kinetic values ​​represent the average of triplicates.

d: Not determined (ND).

The data shows that the variants E501A and E501 Q have a slightly diminished binding affinity to shFcRn relative to HSA.

Example 11. Analysis of HSA variants at position 573

Using the method of Example 1, HSA variants that have a substitution at position 573 were constructed. All variants at position 573 were generated and the receptor binding properties of these variants were tested as described in Materials and Methods but with SPR analysis performed at pH 5.5. The results are shown in Table 14 below and Figures 12 and 13.

Table 14: HSA K573 single point mutant kinetics

<td>Variant⁸ albumin</td><td>Ka (10³/ Ms)</td><td>Kd (10 '³/ s)</td><td>KD^b(nM)</td>

<td>Wt</td><td> 9.010.0</td><td> 6.910.1</td><td> 766</td>

<td>K573A</td><td> 7:410.0</td><td> 2.210.0</td><td> 297</td>

<td>K573C</td><td> 4.210.0</td><td> 1.110.2</td><td> 262</td>

<td>K573D</td><td> 7.9±0.2</td><td> 4.110.3</td><td> 518</td>

<td>K573E</td><td> 9.010.0</td><td> 2.910.0</td><td> 322 ¹</td>

<td>K573F</td><td> 7.810.1</td><td> 0.510.1</td><td> 74</td>

<td>K573G</td><td> 8.510.0</td><td> 1.810.1</td><td> 212</td>

<td>K573H</td><td> 12.010.2</td><td> 0.810.0</td><td> 68</td>

<td>K573I</td><td> 8.610.0</td><td> 0.810.2</td><td> 99</td>

<td>K573L</td><td> 5.110.2</td><td> 2.310.1</td><td> 451</td>

<td>K573M</td><td> 8.610.0</td><td> 1.910.0</td><td> 221</td>

<td>K573N</td><td> 7.310.2</td><td> 1.110.3</td><td> 151</td>

<td>K573P</td><td> 9.810.0</td><td> 0.610.1</td><td> 61</td>

<td>K573Q</td><td> 7.710.2</td><td> 2.610.0</td><td> 338</td>

<td>K573R</td><td> 8.510.0</td><td> 3.010.2</td><td> 353</td>

<td>K573S</td><td> 7.910.2</td><td> 1.210.2</td><td> 1.52</td>

<td>K573T</td><td> 8.710.2</td><td> 1.110.1</td><td> 126</td>

<td>K573V</td><td> 8.110.0</td><td> 0.610.2</td><td> 80</td>

<td>K573W</td><td> 15.010.2</td><td> 0.410.3</td><td> 29</td>

<td>K573Y</td><td> 22.010.1</td><td> 0.510.1</td><td> 23</td>

<td>K573STOP</td><td>ND</td><td>ND</td><td> 141000</td>

a: Dilution of HSA variants were injected on immobilized shFcRn (-1500 RU).

b: Kinetic velocity constants were obtained using a simple first order biomolecular interaction model (1: 1).

c: The steady state affinity constant was obtained using an equilibrium link model (Req) provided by the BIAevaluation 4.1 program. Kinetic values ​​represent the average of duplicates.

d: Not determined (ND).

The results show that all variants that have substitution at position 573, have improved binding to shFcRn compared to WT HSA. In particular, the variants K573F, K573H, K573P, K573W and K573Y have more than 10 times less KD to shFcRn than precursor HSA. The K573STOP variant is a truncated albumin that has a stop codon at position 573. The sensogram for the K573STOP variant shows significantly reduced binding compared to WT HSA and generated a high KD. The increased affinity we have shown for the K573E variant, a natural variant characterized by Otagiri (2009). Biol. Pharm. Bull. 32 (4) 527-534, is predicted to have increased half-life in vivo.

Example 12. Analysis of additional HSA variants

Using the method of Example 1, HSA variants having the substitutions E492G, E492G + N503H, N503H, D550E, E492G + N503K, E542P, H440Q, K541G, K541D, D550N E492G + K538H + K541 N + E542D, E492 +50 K541A, E492P + N503K + K541 G + E542P, E492H + E501 P + N503H + E505D + T506S + T540S + K541E, A490D + E492T + V493L + E501P + N503D + A504E + E505K + T506F + T41D

E492G + V493P + K538H + K541 N + E542D were built. The receptor binding properties of these variants were tested as described in Materials and Methods and the results are shown in Table 15 and Figure 14.

Table 15: HSA variant binding constants for shFcR.

<td>Variant * of Albumin</td><td>Ka (10³/ Ms)</td><td>Kd (10 '³/ s)</td><td>KD^b(μΜ)</td><td>KD Req^c(μΜ)</td>

<td>Wt</td><td> 3.210.2</td><td> 15.512.5</td><td> 4.8</td><td> 5.4</td>

<td>E492G</td><td> 4.110.0</td><td> 11,0±0.0</td><td> 2.7</td><td>ND</td>

<td>E492G / N503H</td><td> 6.910.1</td><td> 14.510.5</td><td> 2.1</td><td>ND</td>

<td>N503H</td><td> 5.410.0 ’</td><td> 24.010.1</td><td> 4.4</td><td>ND</td>

<td>D550E</td><td> 3.210.4</td><td> 11.810.0</td><td> 3.6</td><td>ND</td>

<td>E492G / N503K</td><td> 5.910.1</td><td> 16.0+0.0</td><td> 2.7</td><td>ND</td>

<td>E542P</td><td> 3.410.0</td><td> 15.710.2</td><td> 4.7</td><td>ND</td>

<td>H440Q</td><td> 3.210.1</td><td> 20.810.0</td><td> 6.5</td><td>ND</td>

<td>K541G</td><td> 3.210.0</td><td> 23.010.0</td><td> 7.1</td><td>ND</td>

<td>K541D</td><td> 2.610.0</td><td> 24.010.0</td><td> 9.2</td><td>ND</td>

<td>D550N</td><td> 2.510.0</td><td> 30.010.0</td><td> 12.0</td><td>ND</td>

a: Dilution of HSA variants were injected on immobilized shFcRn (~ 1500 RU).

b: Kinetic velocity constants were obtained using a simple first order biomolecular interaction model (1: 1).

c: The steady state affinity constant was obtained using an equilibrium link model (Req) provided by the BIAevaluation 4.1 program. Kinetic values ​​represent the average of triplicates.

d: Not determined (ND).

The results show that for position 550, a substitution to E results in increased affinity while the substitution to N results in reduced affinity for shFcRn at pH 6.0. When this analysis is repeated for substitution D550E at pH 5.5, however, no observable increase in affinity was seen. The substituted amino acid (E) maintains and improves the bond. However, substitution for a 5-amino acid amide without charge reduces the bond to pH 6.0. Based on this observation, we will predict for this position that substitutions to basic amino acids (Η, K, and R) result in additional bond reductions.

Example 13. Mutations in His residues

The following variants were generated using the methods described in Example 1: H440Q, H464Q, H510Q and H535Q. Figure 15 shows SPR sensograms of these variants that interact with shFcRn as described in Materials and Methods.

It was found that the H440Q variant linked with affinity comparable to HSA.

In contrast H464Q, H510Q and H535Q had significantly reduced affinity to

1.5 shFcRn. This supports previously published observations that the mutagenesis of these Histidine residues significantly reduces HSA binding to shFcRn (Wu et al (2010). PEDS, 23 (10) 789-798). Wu et al shows a reduced half-life for diabody fusion proteins (scFv-DIII) 2 in mice with an order of elimination from the slowest to the fastest: Db-DIII WT&gt; H535A&gt; H510A&gt; H464A&gt; Db. Based on the affinity to shFcRn and when compared with smFcRn (example 5) we will predict the order of elimination in humans as (for glutamine (Q) substitutions) WT&gt; H440Q&gt; H510Q&gt; H464Q&gt; H535Q.

Example 14. Additional variants.

The following variants were generated using the methods described in Example 1: K574N and Q580K in HSA. Linkage of variants to FcRn was tested using the SPR assay as described in Materials and Methods and the results are shown in Table 16.

The results show that variants K574N and Q580K bind stronger to shFcRn.

Table 16: The following kinetic data are found for these variants:

<td>Variant³ albumin</td><td>Ka (10³/ Ms)</td><td>Kd (10 '³/ s)</td><td>KD (μΜ)</td>

<td>Wt</td><td> 9.7±0.0</td><td> 30.0+0.1</td><td> 3.1</td>

<td>K574N</td><td> 4.9±01</td><td> 8.4±0.1</td><td> 1.7</td>

<td>Q580K</td><td> 6.0±0.0</td><td> 9.3±0.0</td><td> 1.5</td>

Example 15. Analysis of HSA variants at position 500

Using the method of Example 1, HSA variants that have a substitution at position 500, were constructed. All variants at position 500 were generated and the receptor binding properties of these variants were tested. Biacore X, Biacore X100 and Sensor Chip CM5 were used for all analyzes, all supplied by GE Healthcare. shFcRn produced by GeneArt AG (Germany) (diluted to 10 pg / mL in 10 mM sodium acetate pH 5.0 (GE Healthcare)) was immobilized in flow cell 2 (FC2) at levels between 1600 - 2200 response units (RU = Response Units) by standard amine coupling according to manufacturers instructions (GE Healthcare). A target freeze was performed in flow cell 1 (FC1) to serve as a reference cell. To stabilize the test, 3 to 5 start cycles were run first, with run buffer (67 mM phosphate buffer, 0.15 M NaCI, 0.005% Tween 20 at pH 5.75 ± 0.25) only, followed by regeneration. WT rHA and K500 library variants were injected into various

9Ί concentrations (1 μΜ - 150 μΜ) for 90s at a constant flow expense of (30 μΙ / min) at 25 ° C followed by surface regeneration using HBS-EP buffer pH 7.4 (GE Healthcare) until line RU Approximate initial base was restored (usually 12s pulse is sufficient).

The results are shown in Table 17 and Figure 16.

Table 17: KSA K500 single point mutants kinetics.

<td>Variant³ from Albumin</td><td>Ka (10³/ Ms)</td><td>Kd (10 '³/ s)</td><td>KD^b(μΜ)</td><td>KD Req^c (μΜ)</td>

<td>K500R</td><td> 4.42</td><td> 7.21</td><td> 1.63</td><td></td>

<td>K500I</td><td> 5.18</td><td> 10.9</td><td> 2.1</td><td></td>

<td>Wt</td><td> 4.24</td><td> 9.2</td><td> 2.2^to</td><td></td>

<td>K500L</td><td> 3.73</td><td> 11.9</td><td> 3.2</td><td></td>

<td>K500Q</td><td> 1.07</td><td> 3.4</td><td> 3.2</td><td></td>

<td>K500V</td><td> 3.29</td><td> 11.0</td><td> 3.3</td><td></td>

<td>K500Y</td><td> 3.97</td><td> 14.6</td><td> 3.7</td><td></td>

<td>K500M</td><td> 2.48</td><td> 21.5</td><td> 8.7</td><td></td>

<td>K500T</td><td> 1.2</td><td> 13.4</td><td> 11.2</td><td></td>

<td>K500W</td><td> 0.5</td><td> 5.4</td><td> 11.7</td><td></td>

<td>K500N</td><td> 1.3</td><td> 18.2</td><td> 14</td><td></td>

<td>K500F</td><td> 5.17</td><td> 73.7</td><td> 14.3</td><td></td>

<td>K500H</td><td> 4</td><td> 63.8</td><td> 16</td><td></td>

<td>K500P</td><td>ND</td><td>ND</td><td>ND</td><td> 51*</td>

<td>K500C</td><td> 2.38</td><td> 124</td><td> 52</td><td></td>

<td>K500S</td><td>ND</td><td>ND-</td><td>ND</td><td> 70.2*</td>

<td>K500A</td><td> 2.61</td><td> 208</td><td> 79.9</td><td></td>

<td>K500D</td><td>ND</td><td>ND</td><td>ND</td><td> 83.3*</td>

<td>K500G</td><td>ND</td><td>ND</td><td>ND</td><td> 95.4*</td>

<td>K500E</td><td colspan="4">KD cannot be calculated see Figure 16</td>

<td>K500 STOP</td><td colspan="4">Null Binder</td>

a: Average of 4 values.

b: Kinetic velocity constants were obtained using a simple first order bimolecular interaction model (1: 1).

c: The steady state affinity constant was obtained using an equilibrium link model (Req) provided by the BIAevaluation 4.1 program.

The results shown for the K500R and K500I variants have increased and comparable affinity for shFcRn compared to WT HSA respectively. The K500E variant binds tightly or tightly to immobilized shFcRn but still demonstrates the characteristic pH- dependence of the FcRn interaction. This complex was very stable, so that kinetic analysis was not possible (Figure 16). All other variants have reduced link to shFcRn that wt rHA.

All variants linked to shFcRn (to some extent) at pH 5.5. There was no binding of K500 library variants to shFcRn detectable at pH 7.4.

Example 16. Fusion Polypeptides

The generation of albumin functions that contain albumin muteins.

Plasmids containing expression cassettes for the production of scFv (vHvL) genetically fused to HSA, at either end N- or C- or both (described in, Evans et al., 2010. Protein Expression and Purification. 73,113-124 ) were modified to allow the production of albumin fusions using in vivo cloning (described above). That is, pDB3017 (Figure 17), pDB3021 (Figure 18), pDB3056 (Figure 19) were digested with Nsi \ / Spe \ and Nsil fragments corresponding to 9.51 1 kb, 9,569 kb and 8,795 kb, respectively, were purified using standard techniques . Nsi? Purified fragments were self-ligated and used to transform E. coli DH5a chemically competent to produce pDB4168, pDB4169 and pDB4170, respectively (Table 18).

Similarly, pDB3165 (containing the bivalent fusion) (Figure 20) was digested with Not \ and the expression cassette (fragment 4,506 kb) was purified before binding on pDB3927 digested with Noti to produce pDB4172 (Figure 21, Table 18 ).

Synthetic SaHIBsu3Q \ DNA fragments (269 bp), which contain point mutations with the nucleotide sequence encoding albumin to introduce amino acid substitutions corresponding to K500A, or D550N or K573P in the translated albumin protein sequence, were generated by assembling genes (GeneArt AG, Germany). The Sal \ IBsu3 fragments (H \ were individually ligated into pDB4168-pDB4170 digested with SañlBsu3Q \ and pDB4172 used to transform E. chemically competent DH5a coli using standard techniques to generate plasmids PDB4265 - pDB4276 (Table 18).

Table 18: Albumin variant fusions

<td>Plasmid</td><td>Building</td>

<td>PDB3017</td><td>scFv (anti-FITC) -HSA-FLAG</td>

100

<td>pDB3021</td><td>HSA-GS linker-scFv (anti-FITC) -FLAG</td>

<td>pDB3056</td><td>HSA-FLAG</td>

<td>pDB3165</td><td>SCfV (anti-FITC) -HSA-GS linker-scFv (anti-FITC) -FLAG</td>

<td>PDB4168</td><td>scFv (anti-FITC) -HSA-FLAG</td>

<td>PDB4169</td><td>HSA-GS linker-scFv (anti-FITC) -FLAG</td>

<td>PDB4170</td><td>HSA-FLAG</td>

<td>PDB4172</td><td>scFv (anti-FITC) -HSA-GS linker-scFv (anti-FITC) -FLAG</td>

<td>PDB4265</td><td>scFv (anti-FITC) -HSA K500A-FLAG</td>

<td>pDB4266</td><td>scFv (anti-FITC) -HSA D550N-FLAG</td>

<td>PDB4267</td><td>scFv (anti-FITC) -HSA K573P-FLAG</td>

<td>PDB4268</td><td>HSA K500A-GS linker-scFv (anti-FITC) -FLAG</td>

<td>pDB4269</td><td>HSA D550N-GS linker-scFv (anti-FITC) -FLAG</td>

<td>pDB4270</td><td>HSA K573P-GS linker-scFv (anti-FITC) -FLAG</td>

<td>pDB4271</td><td>HSA K500A-FLAG</td>

<td>pDB4272</td><td>HSA D550N-FLAG</td>

<td>pDB4273</td><td>HSA K573P-FLAG</td>

<td>pDB4274</td><td>scFv (anti-FITC) -HSA K500A-GS linker-scFv (anti-FITC) - FLAG</td>

<td>pDB4275</td><td>scFv (anti-FITC) -HSA D550N-GS linker-scFv (anti-FITC) - FLAG</td>

<td>pDB4276</td><td>scFv (anti-FITC) -HSA K573P-GS linker-scFv (anti-FITC) - FLAG</td>

<td>pDB4277</td><td>scFv (anti-FITC) -HSA K573A-FLAG</td>

101

<td>pDB4278</td><td>HSA K573A-GS linker-scFv (anti-FITC) -FLAG</td>

<td>pDB4279</td><td>HSA K573A-FLAG</td>

<td>PDB4280</td><td>scFv (anti-FITC) -HSA K573A-GS linker-scFv (anti-FITC) - FLAG</td>

<td>PDB4281</td><td>HSA K500A-GS linker-scFv (anti-FITC)</td>

<td>PDB4282</td><td>HSA D550N-GS linker-scFv (anti-FITC)</td>

<td>PDB4283</td><td>HSA K573P-GS linker-scFv (anti-FITC)</td>

<td>PDB4284</td><td>HSA-GS linker-scFv (anti-FITC)</td>

<td>PDB2613</td><td>HSA-GS linker-IL1RA (N84Q)</td>

<td>pDB4285</td><td>HSA K573A-GS linker-IL 1RA (N84Q)</td>

<td>pDB4286</td><td>HSA D550N-GS linker-IL 1RA (N84Q)</td>

<td>pDB4287</td><td>HSA K500A-GS linker-IL 1RA (N84Q)</td>

<td>pDB4288</td><td>HSA K573P-GS linker-IL 1RA (N84Q)</td>

Similarly, a DNA fragment was generated by PCR (using standard techniques), to introduce a K573A substitution into the translated albumin protein sequence. PCR was performed using the New England Biolabs Phusion kit using pDB4267 (Figure 22) as template DNA and oligonucleotides xAP238 (SEQ ID NO: 53) and xAP239 (SEQ ID NO: 54):

Table 19 describes the PCR cycling.

Table 19: PCR cycling

<td>98 ° C for 2 min</td><td>1 cycle</td>

<td>98 ° C for 10sec</td><td>35 cycles</td>

<td>57 ° C for 30sec</td><td></td>

102

<td>72 ° C for 10sec</td><td></td>

<td>72 ° C for 5 min</td><td>1 cycle</td>

The PCR product was purified, digested with Sa / l / Bsu36l, and the isolated fragment (269bp) was ligated into pDB4168-pDB4170 and pDB4172 digested with SañlBsu36 \ and used to transform chemically competent E. coli DH5a. Resulting plasmids (pDB4277 pDB4280) are cited in Table 18.

The nucleotide sequence encoding the FLAG tag was removed from plasmids pDB4168 and pDB4268-4270 (plasmids for the expression of scFv terminally fused in N to HSA and HSA muteins K500A, D550N and K573P, respectively. PDB4168 and pDB4268-4270 (Table 18) were digested with Bsu36VSph \ to remove a 231 bp product comprising the 3 'region of the gene encoding HSA, nucleotide sequence encoding the FLAG tag and the 5' region of the ADH 1 terminator. A Bsu3Q \ / Sphl fragment (207bp), comprising the 3 'region of the gene encoding HSA and the 5' region of the mADH1 terminator (SEQ ID1) of pDB4181 was ligated into pDB4168 and pDB4268pDB4270 digested with Bsu36 \ / Sph \ using techniques standard. Ligation mixtures were used to transform E. coli 0Η5σ chemically competent using standard techniques to generate plasmids pDB4281 -pDB4284 (Table 18) pDB4265-pDB4284 were digested with BstEII / BsrBI and linearized DNA molecules were purified using standard techniques. One hundred ng of BstEII / BsrBI DNA samples were mixed with 100 ng of pDB3936 digested with Acc65l / BamHI and used to transform S. cerevisiae BXP10cir ° using the Sigma Yeast Transformation kit kit described below. In each case, the expression plasmid was generated in the yeast by homologous recombination (in vivo cloning) between the plasmid containing albumin fusion (pDB4265-pDB4280) (Table 18) and pDB3936.

103

Plasmids pDB3017, pDB3021, pDB3056 and pDB3165 (wild-type HSA fusions, described by Evans et al., 2010. Protein Expression and Purification. 73.1

13-124) were used to transform S. cerevisiae Strain Acir⁰ (described in

WO / 2005/061718) using the Sigma Yeast Transformation kit described below.

The nucleotide sequence encoding human IL-1RA (interleukin-1 receptor antagonist) (accession number: CAA59087) can be synthetically generated by gene assembly. The nucleotide sequence of the synthetic 708bp fragment (Bsu36VSph \ fragment) is given in SEQ ID NO: 55 and includes the 3 'region of the gene encoding HSA, the nucleotide sequence encoding a GS linker, the nucleotide sequence encoding IL -1RA human (N84Q to nullify the N-linked glycosylation motif) and the 5 'region of the ADH 1 terminator. The synthetic DNA fragment can be ligated into pDB3927 digested with Bsu36 \ ISph \ to produce pDB2588.

Plasmids containing the expression cassettes for the production of genetically fused IL-1RA at the C-terminus of HSA and the HSA variants K500A, D550N, K573A and K573P were prepared as follows. pDB2588 was digested with Bsu36 \ ISph \ and a 705bp fragment containing the 3 'region of the gene encoding HSA, nucleotide sequence encoding a GS linker, nucleotide sequence encoding human IL1-RA (N84Q) and region 5 'of an ADH 1 terminator of S. Modified cerevisiae (SEQ ID3) was purified using standard techniques then ligated into pDB4006 digested with Bsu36 \ ISph \ (containing the HSA K573A expression cassette), pDB4010 (containing the HSA D550N expression cassette), pDB4086 (containing the cassette of HSA expression K500A), pDB4110 (containing the HSA expression cassette K573P) to generate pDB4287, pDB4286, pDB4285 and pDB4288, respectively (for example, see Figure 23). pDB4285-pDB4288 was digested with Nsil / Pvul and the linearized DNA molecule was

104 purified using standard techniques. One hundred ng of DNA samples digested with Nsil / Pvul were mixed with 100 ng of pDB3936 digested with Acc65l / BamHI (9721 bp) (i.e. cloning in vivo) and used to transform S. cerevisiae (i.e. by cloning in vivo) using the Sigma Yeast Transformation kit described below.

The preparation of a S. cerevisiae strain expressing wild or wild type HSA, genetically fused to a GS and IL1-RA linker (N84Q) (see Table 18) could also be generated following the methods described above.

Fusion polypeptides were analyzed by binding to FcRn using the SPR method described above and the following results were obtained:

Table 20: Kinetics of HSA fusion variants.

<td>Variant³ albumin</td><td>ka (10³/ MS)</td><td>kd (10 '³/ s)</td><td>KD^b(μΜ)</td>

<td>HSAWT</td><td> 9.710.0</td><td> 30.010.1</td><td> 3.1</td>

<td>K574N</td><td> 4.9101</td><td> 8.410.1</td><td> 1.7</td>

<td>Q580K</td><td> 6.010.0</td><td> 9.310.0</td><td> 1.5</td>

<td>K573P</td><td> 2.810.0</td><td> 0.410.0</td><td> 0.1</td>

<td>HSA-WT-FLAG</td><td> 8.210.2</td><td> 24.010.2</td><td> 2.9</td>

<td>HSA-D550N-FLAG</td><td> 5.910.0</td><td> 49.010.1</td><td> 8.3</td>

<td>HSA-K500A-FLAG</td><td>ND^C</td><td>ND</td><td>ND</td>

<td>HSA-K573A-FLAG</td><td> 6.110.1</td><td> 7.110.1</td><td> 1.1</td>

<td>HSA-K573P-FLAG</td><td> 6.210.1</td><td> 1.210.1</td><td> 0.2</td>

<td>HSA-WT-IL 1RA</td><td> 6.210.0</td><td> 25.010.2</td><td> 4.0</td>

<td>HSA-K500A-IL 1RA</td><td>ND</td><td>ND</td><td>ND</td>

<td>HSA-D550N-IL 1RA</td><td> 7.310.2</td><td> 38.010.0</td><td> 5.2</td>

105

<td>HSA-K573A-IL 1RA</td><td> 6.110.0</td><td> 7.110.1</td><td> 1.1</td>

<td>HSA-K573P-IL 1RA</td><td> 6.210.1</td><td> 1.310.1</td><td> 0.2</td>

<td>scFv-HSA-K500A-FLAG</td><td>ND</td><td>ND</td><td>ND</td>

<td>scFv-HSA-D550N-FLAG</td><td> 6.210.0</td><td> 18.010.0</td><td> 2.9</td>

<td>scFv-HSA-K573A-FLAG</td><td> 6.410.1</td><td> 5.710.2</td><td> 0.9</td>

<td>scFv-HSA-K573P-FLAG</td><td> 5.810.0</td><td> 1.110.1</td><td> 0.2</td>

<td>scFv-HSA-WT-scFv-FLAG</td><td> 7.510.0</td><td> 15.010.2</td><td> 2.0</td>

<td>scFv-HSA-K500A-scFv-FLAG</td><td>ND</td><td>ND</td><td>ND</td>

<td>scFv-HSA-D550N-scFv-FLAG</td><td> 4.110.1</td><td> 27.0+0.2</td><td> 6.6</td>

<td>scFv-HSA-K573P-scFv-FLAG</td><td>6o ± o2</td><td> 0.710.1</td><td> 0.1</td>

<td>HSA-K500A-scFv-Flag</td><td>ND</td><td>ND</td><td>ND</td>

<td>HSA-K500N-scFv-Flag</td><td> 7.310.1</td><td> 42.010.3</td><td> 5.8</td>

<td>HSA-K573A-scFv-Flag</td><td> 6.410.1</td><td> 5.710.1</td><td> 0.9</td>

<td>HSA-K573P-scFv-Flag</td><td> 4.710.1</td><td> 0.710.1</td><td> 0.1</td>

<td>scFv-HSA-K500A</td><td>ND</td><td>ND</td><td>ND</td>

<td>scFv-HSA-D550N</td><td> 7.510.1</td><td> 19.010.2</td><td> 2.5</td>

<td>scFv-HSA-K573P</td><td> 7.410.1</td><td> 0.810.1</td><td> 0.1</td>

a: Dilutions of HSA variants were injected on immobilized shFcRn (--1500 RU).

b: Kinetic velocity constants were obtained using a simple first order bimolecular interaction model (1: 1). Kinetic values ​​represent the average of duplicates.

c: Not determined due to weak link (ND).

In Example 8, it was shown that the K500A variant does not significantly bind shFcRn, in Example 10 it was shown that variants K573P and K573A bind shFcRn more

106 stronger than HSA and in Example 11 it was shown that the D550N variant binds to FcRn weaker than HSA.

In the present example, it is shown that these differences observed in binding properties are also reflected in fusion polypeptides in different configurations: C-terminal fusions with a small portion (HSA-FLAG), C-terminal fusions with a larger polypeptide (HSA-IL1 RA); N-terminal fusions with polypeptide (scFv-HSA); N- and C-terminal fusions (scFv-HSA-FLAG and scFv-HSA-scFvFLAG) ,.

Example 17. Conjugation of Horseradish Peroxidase Protein with 10 Albumin and the K573P Variant.

For conjugation analysis, commercially available recombinant albumin (Recombumin ™) was used as a control molecule. For this example, a final K573P variant of albumin in 200 mg / mL of the invention was purified from batch fermentation fed by means described in Materials and Methods. A two stage purification was carried out;

The first stage used a column (bed volume of approximately 400 mL, bed height 11 cm) packed with AlbuPureTM matrix (ProMetic). This was equilibrated with 50 mM sodium acetate, pH 5.3 and loaded with net culture supernatant, at approximately pH 5.5-6.5, at approximately 20-20 mg / mL matrix. The column was then washed with approximately 5 column volumes, each with 50 mM sodium acetate, pH 5.3, 50 mM sodium phosphate, pH 6.0, 50 mM sodium phosphate, pH 7.0 and 50 mM ammonium acetate, pH 8.0 respectively. Bound protein was eluted using approximately two column volumes of 50 mM ammonium acetate, 10 mM octanoate, pH 7.0. The flow rate for the entire purification was 154 mL / min.

107

For the second stage, the eluate of the first stage was diluted approximately twice with water to give a conductivity of 2,510.5 mS / cm after adjustment to pH 5,510.3 with acetic acid. This was loaded onto the DEAESepharose Fast Flow column (GE Healthcare) (bed volume approximately 400 mL, bed height 11 cm), equilibrated with 80 mM sodium acetate, 5 mM octanoate, pH 5.5. The load was approximately 30 mg of protein / mL matrix. The column was washed with approximately 5 column volumes of 80 mM sodium acetate, 5 mM octanoate, pH 5.5. Followed by approximately 10 column volumes of 15.7 mM potassium tetraborate, pH 9.2. The bound protein was eluted using two column volumes of 110 mM potassium tetraborate, 200 mM sodium chloride, approximately pH 9.0. The flow expense was 183 mL / min during the loading and washing stages, and 169 mL / min during the elution stage.

The eluate was concentrated and diafiltered against 145 mM NaCl, using a Pall Centramate Omega membrane of 10,000 MWCO Nominal, to give the final protein concentration of approximately 200 mg / mL.

Both 200 mg / mL material solutions of the rHA and K573P albumin variant were diluted to 5 mg / mL, using phosphate buffered saline (PBS), pH adjusted to pH 6.5-6.7. This ensured a favorable pH environment for the maleimide reactive group of EZ-Link® Maleimide Horseradish Peroxidase (Thermo Scientific) to react with free sulfhydryl, to form a stable thioester bond. two mg of Horseradish Peroxidase (HRP) Activated with Maleimide EZLink® were mixed with either 1 mL of the 5 mg / ML rHA or albumin variant K573P. This mixture ensured an approximate 2-fold molar excess of albumin or the albumin variant K573P. This mixture was incubated at a minimum at 4 degrees C, for 24 hours. The reaction mixtures were then verified for conjugation, using GP-HPLC.

108 .-10

To separate unconjugated species (rHA, or the unreacted albumin variant K573P and HRP) from the corresponding conjugate species, the samples were first concentrated (Vivaspin20, 10,000 MWCO PES, Sartorius), and then applied individually to a Tricom Superdex column ™ 200, 10/300 GL (GE Healthcare), which runs at a flow rate of 45 cm / hr in PBS. The elution peak was fractionated and analyzed by GP-HPLC. Fractions containing the conjugate species were collected, concentrated and diafiltered against 50 mM NaCl and analyzed by GP-HPLC for demonstration (Figure 24).

These samples were then tested using the Biacore method described here (Table 21). This example demonstrates that K573P maintains its affinity increased by shFcRn compared to WT HSA.

Example 18. Conjugation of Fluorescein in Albumin and the K573P variant.

The same two albumin samples used in Example 17 were also the starting materials for this example. That is approximately 200 mg / mL of rHA or the albumin variant K573P.

Fluorescein-5-Maleimide, Thermo Scientific (F5M) was dissolved in dimethylformamide, to give a final concentration of 25 mg / mL. This was further diluted in 18 ml of PBS, pH adjusted to approximately pH 6.5. To this solution any 1 ml of 200 mg / mL of rHA or 1 mL of 200 mg / mL of variant K573P were added. This gave an approximate final molar excess of 20 times of F5M. These samples are incubated and allowed to conjugate overnight at 4 degrees C, in the dark, to allow maleimide groups in F5M to react predominantly with free sulfhydryl, present in both albumin species.

Next, overnight incubation aliquots of the reaction mixtures were extensively diafiltered against 50 mM NaCl to remove unconjugated F5M,

109 (Vivaspin20, 10,000 MWCO PES, Sartorius). The conjugation was confirmed by ultraviolet visualization of Fluorescein :: Conjugated albumin following standard SDS-PAGE (Figure 25).

These diafiltered samples were then tested using the Biacore method described here (Table 21). This example demonstrates that the conjugation of a small molecule of either rHA or a variant, for example K573P does not affect the tendency in affinities of binding to shFcRn.

Table 21: Representative Biacore test KD values ​​of conjugated rfjA or a variant (K573P) when bound to immobilized shFcRn.

<td>Analyte</td><td>KD (pM)</td>

<td>rHA :: HRP</td><td> 3.6</td>

<td>K573P :: HRP</td><td> 0.02</td>

<td>rHA ::</td><td> 7.3</td>

<td>K573P :: F5M</td><td> 2.5</td>

Example 19. Additional variants of albumin.

The following variants were generated using the methods described in Example 1E492T, N503D, E492T + N503D, K538H, E542D, D494N + E495Q + T496A, E495Q + T496A, N403K, K541A and K541N. SPR analysis were carried out as described in Example 15 and the results are presented in Figure 26 and Figure 27.

Figures 30A and 30B show the shFcRn bond effect for albumin variants.

Substitutions N503D, D494N + E495Q + T496A E492T + N503D,

E495Q + T496A within HSA had a negative impact on the binding to shFcRn at pH 5.5.

Example 20. Albumin variants at the C ends.

110

The following variants were generated using the methods described in Example 1. The binding to shFcRn was determined as described in Materials and Methods and the results are presented in Table 22.

Table 22: Kinetics of exchanged variant interactions of C-terminal HSA with shFcRn.

<td>Variant⁹ albumin</td><td>ka (10³/ MS)</td><td>kd (10 '³/ s)</td><td>KD^b(μΜ)</td>

<td>You have</td><td> 4.410.0</td><td> 24.010.1</td><td> 5.4</td>

<td>MacSA</td><td> 3.110.1</td><td> 8.610.1</td><td> 2.7</td>

<td>HSA-Macc</td><td> 4.110.1</td><td> 5.610.0</td><td> 1.3</td>

<td>MouseSA^c</td><td> 3.810.0</td><td> 3.110.1</td><td> 0.8</td>

<td>HSA-MouseC</td><td> 3.710.1</td><td> 1.310.0</td><td> 0.3</td>

<td>RabbitSA^d</td><td> 1.910.3</td><td> 1.710.1</td><td> 0.9</td>

<td>HSA-RabC</td><td> 3.510.0</td><td> 1.610.0</td><td> 0.4</td>

<td>SheepSA</td><td>ND</td><td>ND</td><td>ND</td>

<td>HSA-SheepC</td><td> 3.310.0</td><td> 2.110.0</td><td> 0.6</td>

a: Dilutions of HSA variants were injected on immobilized shFcRn (-1500 RU).

b: Kinetic velocity constants were obtained using a simple first order bimolecular interaction model (1: 1).

c: Data from Table 2 d: Data from Table 3

Not determined due to weak link (ND)

This example demonstrates that for all C-terminal exchanges to

111 Human albumin tested an increase in bonds on donor albumin was observed. All donor sequences containing the K573P substitution showed that they significantly increase binding but less than K573P alone (Table 20).

Example 21. Competitive binding analysis of albumin variant fusions

Competitive binding studies, using albumin variant fusions and a selection of albumin variants prepared as described in Example 1, were performed as described in Example 4. The results are presented in Figures 28-31.

The competitive link hierarchy was identical for the HSA-FLAG and scFv HSA-FLAG N + C terminal mergers to the hierarchy of the individual HSA variants (no merge and merge) affinity data. For the IL1Ra variants K573P, K573A and K500A were as predicted, however D550N seems to inhibit more efficiently than WT fusion.

Example 22. Additional HSA variants

The following variants were generated using the methods described in Example 1: HSA E492G + K573A, HSA E492G + N503K + K573A, HSA E492G + N503H + K573A, HSA E492G + K573P, HSA E492G + N503K + K573P, HSA E492G + N3H3 +3. SPR analysis was performed as described in Materials and Methods. Results (Figure 32) showed that all HSA variants bound more strongly to shFcRn compared to wild-type or wild-type HSA at pH 5.5. No link was observed at pH 7.4.

HSA E492G + K573A, HSA E492G + N503K + K573A, unlike HSA E492G + N503H + K573A, had marginally improved link beyond that of HSA K573A. The combination variants containing K573P do not show improved link on the simple variant K573P.