MX366909B

Methods and compositions for weed control.

Abstract

Novel compositions are provided for use for herbicide activity; specifically, the present application provides methods and compositions that modulate the expression of a protein import system to the plastid of a plant; combinations of compositions and methods that improve weed control are also provided.

MX366909B, drawing sheet 1 — Sheet 1 of 428

Term

7.5 yearsleft in the term

Expires 13 March 2034.

31 claims: 2 independent, 29 dependent

1
Un método para el control de plantas, caracterizado porque comprende:aplicar tópicamente a una superficie de una planta resistente a herbicidas una composición herbicida que comprende un polinucleótido, un tensoactivo de organosilicona, y un herbicida no polinucleotídico que es un inhibidor de una proteína importada dentro de un cloroplasto, en donde dicho polinucleótido es idéntico o complementario a por lo menos 19 nucleótidos contiguos de una secuencia de un gen que codifica para un componente de un sistema de importación de proteínas al cloroplasto seleccionado del grupo que consiste de un traslocón en la membrana de envoltura externa de un cloroplasto (TOC), un traslocón en la membrana de envoltura interna de un cloroplasto (TIC), una peptidasa de procesamiento de estroma (SPP), y una proteína tipo chaperona asociada con el sistema de importación de proteínas al cloroplasto, y en donde dicha planta resistente a herbicidas es más sensible a dicho herbicida no polinucleotídico, con respecto a una planta resistente a herbicidas no tratada.
2
El método de conformidad con la reivindicación 1, caracterizado además porque dicho gen es un TOC seleccionado del grupo que consiste de TOC159, TOC33, TOC34, TOC75, OEP80, TOC132 y TOC64.
3
El método de conformidad con la reivindicación 2, caracterizado además porque dicho gen TOC159 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1-117.
4
El método de conformidad con la reivindicación 2, caracterizado además porque dicho gen TOC33 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:118-155.
5
El método de conformidad con la reivindicación 2, caracterizado además porque dicho gen TOC34 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:156-247.
6
El método de conformidad con la reivindicación 2, caracterizado además porque dicho gen TOC75 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:248-348.
7
El método de conformidad con la reivindicación 2, caracterizado además porque dicho gen OEP80 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:349-485.
8
El método de conformidad con la reivindicación 2, caracterizado además porque 104 dicho gen TOC132 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:486-569.
9
El método de conformidad con la reivindicación 2, caracterizado además porque dicho gen TOC64 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1628-1638.
10
El método de conformidad con la reivindicación 1, caracterizado además porque dicho gen es un TIC seleccionado del grupo que consiste de TIC110, TIC20, TIC21, TIC40, TIC 100, TIC56, TIC22, TIC55, y TIC62.
11
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC110 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:570-722.
12
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC20 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:723-771.
13
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC21 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:772-840.
14
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC40 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:841-912.
15
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC100 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1131-1207.
16
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC56 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1208-1263.
17
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC22 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1609-1615.
18
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC55 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1616-1623.
19
El método de conformidad con la reivindicación 10, caracterizado además porque dicho gen TIC62 comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:1624-1627. 105
20
El método de conformidad con la reivindicación 1, caracterizado además porque dicho gen es un SPP que comprende una secuencia de polinucleótidos seleccionada del grupo que consiste de las SEQ ID NOs:913-1130.
21
El método de conformidad con la reivindicación 20, caracterizado además porque dicha secuencia de polinucleótidos se selecciona del grupo que consiste de las SEQ ID NOs:15741582.
22
El método de conformidad con la reivindicación 1, caracterizado además porque dicha composición herbicida comprende cualquier combinación de dos o más de dichos polinucleótidos.
23
El método de conformidad con la reivindicación 1, caracterizado además porque dicho tensoactivo de organosilicona está a una concentración de entre aproximadamente 0.1 por ciento y aproximadamente 2 por ciento.
24
El método de conformidad con la reivindicación 23, caracterizado además porque dicho tensoactivo de organosilicona está a una concentración de entre aproximadamente 0.5 por ciento y aproximadamente 1 por ciento.
25
Una composición herbicida, caracterizada porque comprende una mezcla de un polinucleótido, un tensoactivo de organosilicona, y un herbicida no polinucleotídico que es un inhibidor de una proteína importada dentro de un cloroplasto, en donde dicho polinucleótido es idéntico o complementario a por lo menos 19 nucleótidos contiguos de una secuencia de un gen que codifica para un componente de un sistema de importación de proteínas al cloroplasto seleccionado del grupo que consiste de un traslocón en la membrana de envoltura externa de un cloroplasto (TOC), un traslocón en la membrana de envoltura interna de un cloroplasto (TIC), una peptidasa de procesamiento de estroma (SPP), y una proteína tipo chaperona asociada con el sistema de importación de proteínas al cloroplasto, y tras una aplicación tópica de dicha composición herbicida a una superficie de una planta resistente a herbicidas, dicha planta resistente a herbicidas es más sensible a dicho herbicida no polinucleotídico, con respecto de una planta resistente a herbicidas no tratada.
26
La composición herbicida de conformidad con la reivindicación 25, caracterizada además porque dicha secuencia de dicho gen se selecciona del grupo que consiste de las SEQ ID NOs:1-1534 y 1584-1638.
27
La composición herbicida de conformidad con la reivindicación 25, caracterizada además porque dicho polinucleótido se selecciona del grupo que consiste de las posiciones de polinucleótido 369-701, 1016-1168, 1364-1622, y 1683-1792 de la SEQ ID NO:365.
28
La composición herbicida de conformidad con la reivindicación 25, caracterizada además porque comprende adicionalmente un pesticida, en donde dicho pesticida se selecciona del 106 grupo que consiste de insecticidas, fungicidas, nematocidas, bactericidas, acaricidas, reguladores de crecimiento, quimioesterilizantes, semioquímicos, repelentes, atrayentes, feromonas, estimulantes de alimentación y biopesticidas.
29
El método de conformidad con la reivindicación 1, caracterizado además porque 5 dicho herbicida no polinucleotídico es glifosfato.
30
El método de conformidad con la reivindicación 1, caracterizado además porque dicho herbicida no polinucleotídico en un herbicida inhibidor de HPPD.
31
La composición herbicida de conformidad con la reivindicación 25, caracterizada además porque dicho herbicida no polinucleotídico es glifosfato. 10 32. La composición herbicida de conformidad con la reivindicación 25, caracterizada además porque dicho herbicida no polinucleotídico en un herbicida inhibidor de HPPD. 107

Independent claims31

1,881 paragraphs in 65 sections, as filed

The modalities described herein generally refer to the field of weed management. More specifically, the modalities described herein refer to compositions containing polynucleotide molecules to alternate plant physiology and modulate the effect of herbicide treatment. In addition, methods and compositions useful for weed control are provided.

BACKGROUND OF THE INVENTION

Weeds are plants that compete with plants grown in an agronomic environment and cost billions of dollars annually to farmers in crop loss and the expense of efforts to keep weeds under control. Weeds also serve as hosts for crop diseases and insect pests. Losses caused by weeds in agricultural production environments include decreased crop yield, reduced crop quality, increased irrigation costs, higher collection costs, reduced land value, livestock injuries and crop damage due to insects and diseases housed by weeds. The main means by which weeds cause these effects are: 1) compete with crop plants for water, nutrients, sunlight and other essential elements for growth and development, 2) production of irritating or toxic chemicals that cause problems to human or animal health, 3) production of immense quantities of seeds or vegetative reproductive parts, or both, that contaminate agricultural products and perpetuate the species on agricultural land, and 4) production on agricultural and non-agricultural land of large amounts of vegetation that should be available. Weed-tolerant weeds are a problem with almost all herbicides in use, there is a need to handle these weeds effectively. There are more than 365 weed biotypes currently identified as being resistant to herbicides in one or more herbicides by the Action Committee against Resistance to

Herbicides (HRAC), the Action Committee Against Herbicide Resistance of

North America (NAHRAC), and the Weed Science Society of

America (WSSA).

Plants have chloroplasts in which nuclear encoded proteins are imported. The import function is a key process related to the normal activity of chloroplast. The genes associated with the import and processing of chloroplast proteins include but are not limited to the structural genes that code for translocon in the outer development membrane of a chloroplast (Toe), a translocon in the inner shell membrane of a chloroplast ( Tic), a stromal processing peptidase (SPP) and chaperone-like proteins associated with the chloroplast protein import system. The importation of essential proteins into the chloroplast can be achieved by modulating the level of import proteins produced by nuclear encoded genes of plants. Many enzymes that are targets for herbicidal action are coded nuclear and imported into chloroplast.

Modalities of the present invention provide polynucleotide compositions useful for modulating gene expression in a plant, in particular weed plants, for the purpose of improving seed control in an agronomic environment and for the management of herbicide resistant weeds.

BRIEF DESCRIPTION OF THE INVENTION

Several embodiments refer to a method for plant control that comprises treating a plant or a part of a plant in need of control with a herbicidal composition comprising a polynucleotide, an organosilicone surfactant and a non-polynucleotide herbicide, wherein the polynucleotide is essentially identical or essentially complementary to a segment of a gene polynucleotide sequence, wherein the protein encoded by the gene coding sequence is a component of a protein import system to the protoplast selected from the group consisting of a translocon in the outer envelope membrane of a chloroplast (Toe), a translocon in the Chloroplast inner envelope membrane (Tic), a stromal processing peptidase (SPP), and chaperone-like proteins associated with the protein import system to the protoplast, wherein such a treated plant is more sensitive to the non-polynucleotide herbicide contained in the herbicidal composition relative to a similar plant treated with a herbicidal composition that does not contain the polynucleotide.

The polynucleotide alters the rate or activity of protein importation or processing of proteins in a chloroplast of plant or plastid cells thereby providing the plant with increased sensitivity to a herbicide. The import and processing of doroplast proteins, chloroplast metabolism trajectories, chlorophyll function proteins that are provided by genes encoded in plant nuclei are key in the normal physiology of the plant and in the plant's response to chemical stress, such as the action of a herbicide or the provision of proteins and enzymes whose activity is inhibited by a herbicide. The target gene sequences of representative weeds are aspects of the invention, these include but are not limited to Tocl59 (SEQ ID NO: 1-117), Toe 33 (SEQ ID NO: 118-155), Toc34 (SEQ ID NO: 156 -247), Toc75 (SEQ ID NO: 248-348), OEP80 (349-485), Tocl32 (SEQ ID NO: 486-569), Toc64 (SEQ ID NO: 1628-1638), Tic 110 (SEQ ID NO : 570-722), Tic20 (SEQ ID NO: 723-771), Tic21 (SEQ ID NO: 772-840), Tic40 (SEQ ID NO: 841-912), stroma processing peptidase (SPP) (SEQ ID DO NOT: 913-1130), TiclOO (SEQ ID NO: 1131-1207), Tic56 (SEQ ID NO: 1208-1263), Tic22 (SEQ ID NO: 1609-1615), Tic55 (SEQ ID NO: 1616-1623), Tic62 (SEQ ID NO: 1624-1627), and chaperone proteins of the chloroplast protein import system, for example HSP93 (SEQ ID NO: 1596-1608) and HSP70 (SEQ ID NO: 1584-1595).

In some embodiments, the invention comprises a composition comprising a polynucleotide molecule of at least 19 contiguous nucleotides and at least 85 percent identical to a part of a gene sequence encoding an import protein of plant chloroplast and a composition or compound of organosilicone In some embodiments, the invention comprises a composition comprising a polynucleotide molecule of at least 25, 30, 35, 40, 45, 50 or more contiguous nucleotides and at least 85 percent identical to a part of a gene sequence encoding a Import protein from vegetable chloroplast and an organosilicone composition or compound. The polynucleotide fragment may be mDNA, mRNA, mRNA, cDNA, or sense / antisense RNA / cDNA hybrids, and are referred to herein as polynucleotides that activate the chloroplast protein import system. Representative activating polynucleotide sequences of chloroplast import protein system genes include but are not limited to those polynucleotides illustrated in Tables 2, 3, 5 and 6 and are aspects of the invention.

In some embodiments, the invention comprises a herbicidal composition further comprising any combination of two or more such polynucleotides wherein at least one is a polynucleotide essentially identical or essentially complementary to a segment of a gene polynucleotide sequence, wherein the protein encoded by the gene coding sequence is a component of a protein import system to the protoplast selected from the group consisting of a translocon in the outer envelope membrane of a chloroplast (Toe), a translocon in the membrane of an inner envelope of a chloroplast (Tic), a stromal processing peptidase (SPP), a chaperone-like protein, and the other is a polynucleotide essentially identical or essentially complementary to a segment of a gene sequence of herbicidal target protein polynucleotides, wherein the gene sequence encoding a herbicidal target protein or a herbicide detoxifying enzyme is selected from the group consisting of in 5-enolpiruvilshik¡mato-3-phosphate syntheses (EPSPS), an acetohydroxy acid syntheses or an acetolactatosyntase (ALS), an acetyl-coenzyme A carboxylase (ACCase), a dihydropteroatosintase, a phytoene desaturase (PDS), a protoporphyrin IX oxygenase (PPO), a hydroxyphenylpyruvadioxygenase (HPPD), a para-aminobenzoatosintase, a glutamine synthase (GS), a glutamine synthase glutainate-D-de-xylulose-D-1-deoxyulosa 5-phosphate (DOXP) synthase, a dihydropteroate (DHP) synthase, a phenylalanine ammonia lyase (PAL), a glutathione S-transferase (GST), a DI protein from photosystem II, a monooxygenase, a cytochrome P450, a cellulose synthase, a beta-tubulin, and a serine hydroxymethyltransferase.

The composition may include one or more polynucleotide fragments essentially identical or essentially complementary to a part of an import protein enzyme chloroplast or polynucleotide import protein and one or more non-polynudeotide herbicides, for example, a herbicide that can include but is not limited to members of amide herbicides, aromatic acid herbicides, arsenic herbicides, benzothiazole herbicides, benzoylcyclohexandione herbicides, benzofuranyl alkylsulfonate herbicides, carbamate herbicides, cyclohexene oxime herbicides, cyclopropylsiloxazole herbicides, dicarboximide herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenyl etheric acidic herbicides, diphenyl etheric acidic herbicides inorganic herbicides, nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenoxy herbicides, phenylenediamine herbicides, pyrazole herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyrimidinediamine herbicides, pyrimidinyloxybenzylthio triocyanoiumiumiumicide, pyrimidiumthiothiocytoiumiumiumicide herbicides , thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazinone herbicides, triazole herbicides, triazolone herbicides, triazolopyrimidine herbicides, uracil herbicides, and urea herbicides.

In a further aspect of the invention, a composition containing a polynucleotide molecule as described herein may be applied before, at the same time or after treatment of the plant with one or more herbicidal compounds to provide control of unwanted plants in A field of cultivated plants.

BRIEF DESCRIPTION OF THE FIGURES

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The modalities described herein may be better understood by reference to one or more of these drawings in combination with the detailed description of the specific modalities presented herein. The present modalities can be more fully understood from the following description of the figures:

Figure 1. Treatment of Amaranthus palmen with mRNA activating polynucleotides directed at ΘΕΡ80.

DETAILED DESCRIPTION OF THE INVENTION

Methods and compositions are provided that contain a polynucleotide that provides regulation and / or modulation of the protein import system to the plant chloroplast or import processing enzyme genes, for example, which include but are not limited to Tocl59, Toe 33, Toc34, Toc75 OEP80, Tocl32, Tic 110, Tic20, Tic21, Tic40, TiclOO, Tic56, Toc64, Tic22, Tic55, Tic62, stroma peptidase and chaperone proteins of the chloroplast protein import system, for example Hsp93 and Hsp70.

Chloroplasts must import more than 95 percent of their protein supplement from the cytosol post-translationally. The vast majority of chloroplast proteins are synthesized as precursor proteins (preproteins) in the cytosol and are imported posttranslationally into the organelle. Most of the proteins that are destined for the thylakoid membrane, the stroma and its inner envelope are synthesized with an amino-terminal extension called a presequence, or transit sequence, which is removed proteolytically after importation. Preproteins that contain a cleavable transit peptide are recognized in a GTP-regulated manner by recipients of the outer envelope translocon, which is called the TOC complex. The preproteins cross the outer envelope through an aqueous pore and are then transferred to the translocon in an inner envelope, which is called the TIC complex. The TOC and TIC translocs work together during the translocation process. The termination of importation requires energy, which probably comes from the ATP-dependent functioning of the molecular chaperones in the stroma. The stromal processing peptidase then cleaves the transit sequence to produce the mature form of the protein, which can double in its natural form. The polynucleotide sequences of the plant gene that regulate the expression or encode the enzymes involved in the import system of the protoplast protein of target weed species are illustrated in SEQ ID NO: 1-1263 and SEQ ID NO: 1584-1638 . Representative polynucleotide activating molecules that are homologous or complementary to a segment of a gene from the protein import system to the protoplast are illustrated in Table 2 (SEQ ID NO: 1264-1483), Table 3 (SEQ ID NO: 1483-1534), Table 5 (SEQ ID NO: 1535-1573) and Table 6 (SEQ ID NO: 1574-1583) and SEQ ID NO: 1639 and 1640.EI Treatment of plants with one or more of the activating polynucleotides improves the sensitivity of the plant to one or more chemical herbicides.

Chloroplasts are critical organelles for the plant. Not only are they the centers for photosynthesis, but amino acids, lipid components and fatty acids of cell membranes are synthesized by chloroplasts and reduce nitrogen in ammonia and other compounds.

Aspects of the method can be applied to manage various weed plants in agronomic environments and other cultivated environments.

The following definitions and methods are provided to better define the present invention and to guide those skilled in the art in the implementation of the modalities described herein. Unless otherwise indicated, the terms are being understood in accordance with conventional employment by those skilled in the relevant art. Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of such term.

Weed plants are plants that compete with cultivated plants, those of particular importance include, but are not limited to important harmful and invasive weeds and herbicide resistant biotypes in crop production, for example, Amaranthus -A species. albus, A. bütoides, A. hybridus, A. palmen, A. poweHii, A. retrofiexus, A. spinosus, A. tubercuiatus, and A. viridis; Ambrosia species - A. trífida, A. artemisifoHa; Lolium species -L. multiflorum, L. rigididium, perennial L; Digita species -D. insular; Euphorbia species -E. heterophythy; Kochia species - K. scoparia; Sorghum species -S. haiepense; Conyza species -C. bonaerenses, C. canadensis, C. sumatrensis; Chioris species -C. truncate species of Chineóla E. cotona, E. crus-galli; Eleusino species -E. indicates; Poa species -P. anua; Planted species -P. lanceolate; Oat species - A. fatua; Chenopodium species - C. album; Setaria-S. species viridis; Abutilon species - A. theophrasti, Ipomoea Sesbania species, Cassia species, Sida species, Brachiaría species, and Solanum species.

Plant species additional weeds found in cultivated areas include Atopecurus myosuroides, Avena Steri / is, Avena tudoviciana sterilis, Brachiaria piantaginea, Bromus Diandrus, Bromus rigidus, cynosurus echinatus, Fingered cHiaris, Digitaria ischaemum, Digitaria sanguinaüs, Echinochtoa oryzicoia, Echinochtoa phyitopogon , Eriochtoa punctata, Hordeum glaucum, Hordeum toporínum, Ischaemum rugosum, Leptochtoa chinensis, Lolium persicum, Phaiarís minor, Phaiarís paradoxa, Rottboellia exalta, Setaria faberi, Setaria viridis var, robusta-aiba schreiber, Setaria viridis var, robusta -purpurea, Snowdenia poiystachea, Sorghum sudanese, Aiisma piantago aquatica, Amaranthus Hvidus, Amaranthus quitensis, Ammania aurículata, Ammania coccíicapera, Ammania coccíicapera, Ammania coccíicapera, Ammania coccíicapera, Ammania spiticapera -venti, Bacopa rotundifoíia, Bidens pilosa, Bidens subalternaos, Brassica tournefortü, Bromus tectorum, Camelina microcarpa, Chrysanthemum coronaríum, Cuscuta campestrís, Cyperus difformis, Damasonium minus, Descurainia sophia, Diplotaxis tenuifoiia, Echium plantagineum, Elatine triandra var, pediceiiata, Euphorbia heterophyíía, Fallopia convolvulus, miíiacea FimbristyHs, Gaíeopsis tetrahit, Gaíium Spurium, Heíianthus annuus, Iva xanthifoiia, ixophorus, Ipomoea indica, Ipomoea purpurea, Ipomoea sepiaria , Ipomoea aquatic, Ipomoea triioba, Lactuca semolina, Limnocharís flava, Limnophila erecta, LimnophHa sessüiflora, Lindernia dubia, Lindernia dubia var, major, Lindernia micrantha, Lindernia procumbens, Mesembryanthemum crystallinum, Monochoria korsakowü, Monochoria vaginalis, Nesiia panicuiata, rhoeas Papaver, Parthenium hysterophorus, sufíruticosa pentzia, Phaiaris minor, Raphanus raphanistrum, Raphanus sativus, Rapistrum Rugosum, Rotaia indica var, uliginosa, Sagittaria guyanensis, Sagittaria montevidensis , Sagittaria pygmaea, Iberian Salsola, Scirpus juncoides var, ohwianus, Scirpus mucronatus, Setaria iutescens, Sida spinosa, Sinapis arvensis, Sisymbrium orientale, Sisymbrium theiiungii, Soianum ptycanthum, Sonchus asper, Sonchus oteraceus, Sorghum bicolor, half SteHaría, Thlaspi arvense, Xanthium strumarium, Arctotheca calendula sumatrensis Conyza, Crassocephaium crepidiodes, Cuphea carthagenenis, EpHobium adenocauion, Erigeron phiiadeiphicus, Landoitia punctata, Lepidium virginicum , Monochoria korsakowü, Soianum americanum, Soianum nigrum, Vuipia bromoides, Youngia Japónica, HydríHa verticiiiata, Carduus nutans, Carduus pycnocephaius, Centaurea soistitiaiis, Cirsium arvense, CommeÜna diffusa, Convolvulus arvensis, Daucus carota, Digitaria ischaemum, Echinochioa crus-pavonis, FimbristyHs miiiacea, Gaieopsis tetrahit, Gaiium spurículisumria, Conceavitae spiraeus, Limiusais spriaculus, Semi-spinais, Semi-spurisumiae, Semi-spurisumiae, Peri Sphenociea zeyianica, SteHaría media, Nasseiia trichotoma, Stipa neesiana, Agrostis stoionifera, Poiygonum avicuiare, Aiopecurus Japonicus, Beckmannia syzigachne, Bromus tectorum, Chioris ínflate, Echinochioa erecta, Portulaca olerácea, and Senecio vulgaris. All plants contain genes from the doroplast import protein system, whose sequence can be isolated and the polynucleotides can be selected in accordance with the methods described herein that are useful for altering the physiology of the plant and making the plant more sensitive to a herbicide.

Numerous chemical herbicides are available, referred to herein as non-polynucleotide herbicides, which can be added to a composition as described herein that provides weed control of multiple species or alternative modes of action for weed species difficult to control, for example, members of the herbicide families that include but are not limited to 1,5-diarylpyrazole herbicides, 2-thiopyrimidine herbicides, 3-CF3benzene herbicides, acetamide herbicides, amide herbicides, aminoacrylate herbicides, aminotriazine herbicides, aromatic acid herbicides, arsenic herbicides, arylaminopropionic acid herbicides, arylcarboxamide herbicides, arylcyclodione herbicides, aryloxamidoazoic acid azidoazaminoazoic acid azidoazamide, aryloxamidoazoic acid azidoazamide , azolotriazine herbicides, benzamide herbicides, benzenesulfonamide herbicides, benzhydryl herbicides, benzimidazole herbicides, herbicides benzofuran herbicides alkylsulfonate benzofuranyl, herbicides benzohydrazide, herbicides benzoic acid herbicides benzofenilmetanona, herbicides benzothiadiazinone, herbicides benzothiazole herbicides benzotiazolacetato, herbicides benzoxazole, herbicides benzoilciclohexandiona, herbicides benciloximetilisoxazol, herbicides benzylpyrazole , benzylpyridine herbicides, benzylpyrimidone herbicides, bipyridyl herbicides, carbamate herbicides, chloroacetamide herbicides, chloroacetamide herbicides, chlorocarbonic acid herbicides, cyclohexandione herbicides, cyclohexenoxime herbicides, cyclopropylsiloxazole herbicides, diaryl ether herbicides, dicarboximide herbicides, dihydrazide dihydroxy herbicides, dihydroxy dihydroxy herbicides , dinitroaniline herbicides, dinitrophenol herbicides, diphenyl ether herbicides, diphenylfuranone herbicides, dithiocarbamate herbicides, fluoroalkene herbicides, glyphosate herbicides, halogenated aliphatic herbicides, hydantocidine herbicides, hydroxypyrazole herbicides, imidazolinone herbicides, indazole herbicides, isondix herbicides, isozolium herbicides , isoxazolidinone herbicides, nicotinohydrazide herbicides, nitrile herbicides, nitril-amide herbicides, nitropyrazole herbicides, n-phenylphthalimide herbicides, organoarsenic herbicides, organophosphate herbicides, organophosphorus herbicides, oxabicycloheptane herbicides, oxadiazole herbicides, oxadiazolbenzamide herbicides, oxadiazolone oxidiazoline herbicides, herbicide oxidic acid oxidized herbicides, herbicide oxidic acid herbicides phenoxy, phenoxyalkine herbicides, phenoxycarboxylic acid herbicides, phenoxypyridazinol herbicides, phenylalcanoate herbicides, Phenylcarbamate herbicides, phenylenediamine herbicides, phenylethylurea herbicides, phenylimidazole herbicides, phenylisoxazole herbicides, phenylpyrazole herbicides, phenylpyrazoline herbicides, phenylpyridine herbicides, phenylpyridinep phosphatic acidic, herbicide phosphate herbicides phosphoramidate, phosphorodithioate herbicides, phthalamate herbicides, propionamide herbicides, pyrazole herbicides, pyrazole-aryl ether herbicides, pyrazolium herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyridinecarboxamide herbicides, pyridinecarboxylic acid herbicides, pyridinone herbicides, pyridylbenzylamide pyridide-carboxamide herbicides pyrimidinecarboxylic acid herbicides, pyrimidinediamine herbicides, pyrimidinedione herbicides, pyrimidintrione herbicides, pyrimidinone herbicides, pyrimidinyl (thio) benzoate herbicides, pyrimidinyloxybenzylamine herbicides, pyrimidylmethanol herbicides, pyrrolidone herbicides, quaternary ammonium herbicides, quinoline carboxylic acid herbicides, quinoxaline herbicides, semicaronazonazonazonazonazonazonazonazonazonazonazonazonazonazonazonazoazamone sulfonylurea herbicides, sulfonylurea herbicides, tetrazolinone herbicides, thiadiazole herbicides, thiatriazine herbicides, thienopyrimidine herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, tolíltriazole herbicides, triazine herbicides, triazindione herbicides, sulfonanilide-triazine herbicides, triaziniazia triazamide triazineamide, herbicides triaziniazole, trichiazamide, herbicides triazamiazole triazamide, herbicides triazineamide, herbicides triazineamide, herbicides triazamide, trichiazamide, herbicides triazineamide, herbicides triazineamide, herbicides triazineamide, herbicides triazineamide, herbicides triazamiazia, trichiazamide, herbicides triazamiazoids triazolinone herbicides, triazolone herbicides, triazolopyrimidine herbicides, triacetone herbicides, uracil herbicides and urea herbicides. In particular, the use rates of the added herbicides can be reduced in compositions comprising polynucleotides as described herein. The use rate reductions of the additional aggregate herbicides can be achieved can be 10-25 percent, 26-50 percent, 51-75 percent or more, which improve the activity of the polynucleotides and herbicidal composition and is contemplated as An aspect of the invention.

Additional herbicidal compounds of modes of action not specified as described in documents CN101279950A, CN101279951A, DE10000600A1, DE10116399A1, DE102004054666A1, DE102005014638A1, DE102005014906A1, DE102007012168A1,

DE102010042866A1, DE10204951A1, DE10234875A1, DE10234876A1, DE10256353A1,

DE10256354A1, DE10256367A1, EP1157991A2, EP1238586A1, EP2147919A1, EP2160098A2,

JP03968012B2,

JP2002220389A,

JP2005008583A,

JP2007153847A,

JP2008133207A,

JP2009126792A,

JP2001253874A,

JP2003064059A,

JP2005239575A,

JP2007161701A,

JP2008133218A,

JP2009137851A,

JP2002080454A,

JP2003096059A,

JP2005314407A,

JP2007182404A,

JP2008169121A,

US20060111241A1,

JP2002138075A,

JP2004051628A,

JP2006232824A,

JP2008074840A,

JP2009067739A,

US20090036311A1,

JP2002145707A,

JP2004107228A,

JP2006282552A,

JP2008074841A,

JP2009114128A,

US20090054240A1,

US20090215628A1, US20100099561A1, US20100152443A1, US20110105329A1, US20110201501A1,

W02001055066A2, W02001056975A1, W02001056979A1, WO2001090071A2, W02001090080A1,

W02002002540A1, W02002028182A1, W02002040473A1, W02002044173A2, W02003000679A2,

W02003006422A1, W02003013247A1, W02003016308A1, W02003020704A1, WQ2003022051A1,

W02003022831A1, W02003022843A1, W02003029243A2, W02003037085A1, WQ2003037878A1,

W02003045878A2, W02003050087A2, W02003051823A1, W02003051824A1, W02003051846A2,

W02003076409A1, W02003087067A1, W02003090539A1, W02003091217A1, W02003093269A2,

W02003104206A2, W02004002947A1, W02004002981A2, W02004011429A1, WQ2004029060A1,

W02004035545A2, W02004035563A1, W02004035564A1, WQ2004037787A1, WQ2004067518A1,

W02004067527A1, W02004077950A1, W02005000824A1, W02005007627A1, WQ2005040152A1,

W02005047233A1, W02005047281A1, W02005061443A2, W02005061464A1, W02005068434A1,

W02005070889A1, W02005089551A1, W02005095335A1, WQ2006006569A1, WQ2006024820A1, W02006029828A1, W02006029829A1, WQ2006037945A1, W02006050803A1, W02006090792A1, W02006123088A2, WO2006125687A1, WO2006125688A1, W02007003294A1, W02007026834A1, W02007071900A1, W02007077201A1, W02007077247A1, W02007096576A1, WO2007119434A1, WO2007134984A1, W02008009908A1, W02008029084A1, W02008059948A1, W02008071918A1, W02008074991A1, W02008084073A1, W02008100426A2, W02008102908A1, W02008152072A2, W02008152073A2, WQ2009000757A1, W02009005297A2, W02009035150A2, W02009063180A1, W02009068170A2, W02009068171A2, W02009086041A1, WQ2009090401A2, W02009090402A2, WO2009115788A1, WO2009116558A1, WQ2009152995A1, WO2009158258A1, W02010012649A1, W02010012649A1, W02010026989A1, W02010034153A1, W02010049270A1, W02010049369A1, W02010049405A1, W02010049414A1, W02010063422A1, W02010069802A1, W02010078906A2, W02010078912A1, W02010104217A1, W02010108611A1, WO2010112826A3, W02010116122A3, W02010119906A1, W02010130970A1, W02011003776A2, WO2011035874A1, W02011065451A1, whose chemical compositions are incorporated herein by reference and are useful to be included in combination with polynucleotides directed to the import protein of the chloroplast plant or import processing enzyme genes.

In some embodiments, a composition includes a non-polynucleotide herbicide component such as a glyphosate (N-phosphonomethylglycine) herbicide that inhibits the pathway of shikimic acid, which leads to the biosynthesis of aromatic compounds that include amino acids, plant hormones and vitamins. Specifically, glyphosate slows the conversion of phosphoenolpyruvic acid (PEP) and 3-phosphoshikimic acid to 5-enolpiruvil-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpiruvilsh¡k¡mato-3-phosphates¡ntase (later referred to as EPSP synthase or EPSPS) .For the purposes of these modalities, The term glyphosate should be considered to include any herbically effective form of N-phosphonomethylglycine (which includes any salt thereof) and other forms which result in the production of glyphosate anion in a plant. Glyphosate is an example of an EPSPS inhibitor herbicide. Herbicides are molecules that affect the growth, development or reproductive capacity of the plant. Glyphosate is commercially available in numerous formulations. Examples of these glyphosate formulations include, but are not limited to, those sold by Monsanto Company (St Louis, MO) as ROUNDUP®, ROUNDUP® ULTRA, ROUNDUP®ULTRAMAX, ROUNDUP®CT, ROUNDUP®EXTRA, ROUNDUP®BIACTIVE, ROUNDUP herbicides ® BIOFORCE, RODEO®, POLARIS®, SPARK® and ACCORD®, of which all contain glyphosate as their sopropylammonium salt, ROUNDUP® WEATHERMAX, which contains glyphosate as their potassium salt; ROUNDUP® DRY and RIVAL® herbicides, which contain glyphosate as their ammonium salt; ROUNDUP® GEOFORCE, which contains glyphosate as its sodium salt; and herbicide

TOUCHDOWN® (Syngenta, Greensboro, NC), which contains glyphosate as its trimethylsulfonium salt or monopotassium salt. Several other glyphosate salts are available, for example, dimethylamine salt, isopropylamine salt, trimesium salt, potassium salt, monoammonium salt and diamonium salt.

In some embodiments, a composition may include a polynudeotide-free herbicide component that is an acetolactatosyntose inhibitor (ALS) herbicide which includes but is not limited to amidosulfuron, azimsulfuron, bensulfuron-methyl, chlorimuron-ethyl, chlorofulfuron, cinosulfuron, cyclosulfamuron, etametsulfuron-methyl, ethoxisulfuron, flazasulfuron, flupirsulfuronmethyl-Na, foramsulfuron, halosulfuron-methyl, imazosulfuron, iodosulfuron, metsulfuron-methyl, nicosulfuron, oxasulfuron, primisulfuron-methyl, prosulfuron, pyrazosulfuron-ethyl, rimsulfuron, sulfometuron-methyl, sulfosulfuron, thifensulfuron-methyl, triasulfuron, tribenuron-methyl, trifloxysulfuron, triflusulfuron-methyl, tritosulfuron, imazapic, imazamethabenz-methyl, imazamox, imazapyr, imazaquin, imazethapyr, chloransulam-methyl, diclosulam, florasulam, flumetsulam, metosulam, bispiribac-Na, pyribenzoxim, pyriftalide, piritiobac-Na, pyriminobac-methyl, flucarbazone Na, and procarbazone-Na

In some embodiments, a composition may include a polynudeotide-free herbicidal component that is an acetyl-CoA carboxylase inhibitor herbicide (ACCase), which includes members of the chemical families of aryloxyphenoxypropionates, cyclohexandiones and phenylpyrazoline that include, but are not limited to aryloxyphenoxypropionate comprising clodinafop (Propanoic acid, 2- [4 - [(5-doro-3-fluoro-2-pyridinyl) ox¡] phenoxy] -, 2-propynyl ester, (2R)), cyhalofop (butyl (2R) 2- [4- (4-cyano-2-fluorophenoxy) phenoxy] propionate), didofop (2- (4- (2,4-dichlorophenoxy) phenoxy] methyl propanoate), phenoxaprop ((R ) -2- [4- (6-doro-l, 3-benzoxazol-2-loxy) phenoxy] ethyl propionate), fluazifop (acid (2R) -2- [4 - [[5- ( trfluoromethyl) -2-pyridinyl] oxy] phenoxy] propanoic acid), haloxyfop (2- [4 - [[3-chloro5- (trifluoromethyl) -2-pyridinyl] oxy] phenoxy] propane), propaquizafop ((2R) -2- [4 - [(6-chloro2quinoxal¡nil) ox¡] phenoxy] propanoate of 2 - [[(l-methylethylidene) amino] oxy] ethyl) and acid quizalofop (2R) 2- [4 - [(6-chloro-2-quinoxalinyl) oxy] phenoxy] propanoic acid; a cyclohexandione comprising aloxidim (2,2-dimethl-4,6-dipox-5 - [(lE) -l - [(2-propen-l-lox!) min] butyl] methyl cyclohexanecarboxylate), butroxydim (2- [l- (ethoxy-amino) propyl] -3-hydroxy-5- [2,4,6-trimethyl-3- (l-oxobutyl) phenol] -2-cyclohexen-canvas), detod¡m (2- [l - [[[(2E) -3-doro-2-propen-l-¡l] oxy] ¡mino] propyl] -5- [2- (ethyltium) propyl] -3-hydroxy-2-cyclohexen-l-one), cycloxidim (2- [l- (ethoxyimino) butyl] -3-hydroxy-5- (tetrahydro-2H-topyran-3-l) -2cyclohexen-l-one), profoxidim (2- [ l - [[2- (4-dorophenoxy) propoxy] imino] butyl] -3-hydroxy-5- (tetrahydro2H-thiopyran-3-yl) -2-cyclohexen-l-one), setoxidim (2- [ l- (ethoxyimino) butyl] -5- [2- (ethylthio) propyl] -3-hydroxy2-cyclohexen-l-one), tepraloxidim (2- [l - [[[(2E) -3-chloro-2-propen-l-yl] oxy] imino] propyl] -3-hydrox¡-5 (tetrahydro-2H-piran-4-yl) -2-c¡clohexen-l-one) and tralcoxidim (2- [l- (ethoxyimino) propyl] -3-hydroxy-5 (2,4,6-trimethylphenyl) -2- cyclohexen-l-one); a phenylpyrazoline comprising pinoxaden (8- (2,6-diethyl12

4-methylphenyl) -l, 2,4,5-tetrahydro-7-oxo-7H-prazol [1, 2-d] [1, 4,5] oxadosezin-9-yl 2,2-dimethylpropanoate).

In some embodiments, a composition may include a non-polynucleotide herbicidal component which is a dehydroxyphenyl pyruvate dioxygenase (HPPD) inhibitory herbicide which includes but is not limited to Tricetonas, such as mesotrione, tefuriltrione, trembling, and sulcotrione; Isoxazoles, such as isoxaclortol, pyrasulfotoleisoxaflutol; Pyrazoles, such as benzofenap, pyrazolinate, topramezone and pyrazoxyfen. Additional HPPD inhibitors include benzobicidon and bicyclopirone.

In some embodiments, a composition may include a non-polynucleotide herbicidal component that is a glutamine synthase (GS) inhibitor herbicide, which includes members of the phosphic acid herbicide group such as glufosinate-ammonium and bialaphos.

In some embodiments, a composition may include a non-polynucleotide herbicidal component that is a phytoeno desaturase inhibitor (PDS) herbicide, which includes but is not limited to norflurazon, diflufenican, picolinafen, beflubutamide, fluridone, flurochloridone and flurtamone.

In some embodiments, a composition may include a non-polynucleotide herbicidal component that is a protoporphyrinogen IX oxidase inhibitor herbicide (PPG oxidase), which includes but is not limited to acifluorfen-Na, bifenox, domethoxyfen, fluoroglycoen-ethyl, fomesafen, halosafen , lactofen, oxyfluorfen, fluazolate, piraflufen-ethyl, cinidon-ethyl, flumioxazin, flumicloracpentyl, flutiacet-methyl, thidiazimin, oxadiazon, oxadiargyl, azafenidin, carfentrazon-ethyl, sulfentrazone, pentoxazone, benzfendizona, butafenacil, pyrazogyl, and profluazole.

In some embodiments, a composition may include a non-polynucleotide herbicidal component that is a dihydropteroate synthetase inhibitor (DHPS) herbicide including but not limited to sulfonamides and asulam.

In some embodiments, a composition may include a non-polynucleotide herbicidal component that is a herbicide inhibitor of the photosystem II (psbA) DI protein that includes but is not limited to the chemical families of Triazines, Triazinones, Triazolinone, Uracils, Pyridazinones, Phenyl- carbamates, Ureas, Amides, Nitriles, Benzothiadiazinone, Phenyl-pyridazines and includes members such as [3- (3,4-dichlorophenyl) -l, l-dimethlurea)], dortoluron, isoproturon, linuron, tebutiuron, bentazone, oxadiazone, bromacil, ametrine, atrazine, cyanazine, hexazinone, metribuzine, simazine, and terbutylazine.

An agronomic field in need of plant control is treated by applying a composition as described herein directly to the surface of growing plants, such as by atomization. For example, the method is applied to control weeds in a field of crop plants by atomizing the field with the composition. The composition a simultaneous treatment or mixing of one or more of the components of the composition from separate containers. Field treatment can occur as frequently as necessary to provide weed control and the components of the composition can be adjusted to target specific weed species or weed families through the use of specific polynucleotides or polynucleotide compounds capable of Selectively direct specific species or plant families to be controlled. The composition can be applied at effective use rates in accordance with the time of application to the field, for example, pre-planting, in planting, post-planting, post-harvest. The herbicidal components of the composition may be applied at the manufacturer's recommended usage rates or reduced usage rates, for example, 10-25 percent, 26-50 percent or 51-75 percent of the recommended usage rate . The polynucleotides of the composition can be applied at rates of 1 to 30 grams per 4047 m2, depending on the number of activating molecules necessary for the reach of weeds in the field.

Growing plants in which weed control may be necessary include but are not limited to corn, soy, cotton, cane, sugar beet, alfalfa, sugar cane, rice, and wheat; Vegetable plants that include but are not limited to tomato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, sweet corn, Chinese cabbage, leek, fennel, zucchini, squash or pumpkin, radishes, brussels sprouts, tomatillo, beans, dried beans, or quimbombo; culinary plants that include but are not limited to basil, parsley, coffee or tea; or fruit plants that include but are not limited to apple, pear, cherry, peach, peach, plum, banana, male banana, palm oil, rubber tree, table grape, wine grape, citrus, avocado, mango or berries ; a tree that grows for ornamental or commercial use, which includes, but is not limited to a fruit or nut tree; ornamental plant (for example, an ornamental flower plant or shrub or lawn). The methods and compositions provided herein may also be applied to plants produced by a process of cuttings, cloning, or grafting (i.e., a plant that does not grow from a seed) that includes trees and fruit plants that include, but are not limited to Avocados, tomatoes, eggplants, cucumbers, melons, watermelons and grapes, as well as several other ornamental plants.

Polynucleotides

As used herein, the term "DNA, DNA molecule, DNA polynucleotide molecule" refers to a single stranded DNA molecule (mDNA) or double stranded DNA (cDNA) of genomic or synthetic origin, such as, a deoxyribonucleotide base polymer or a DNA polynucleotide molecule. As used herein, the term DNA sequence, DNA nudeotide sequence or DNA polynucleotide sequence refers to the nucleotide sequence of a DNA molecule. As used herein, the term RNA, RNA molecule, RNA polynucleotide molecule refers to a single stranded RNA molecule (mRNA) or double stranded RNA molecule (dsRNA) of genomic or synthetic origin, such as a ribonudeotide base polymer comprising single or double stranded regions. Unless stated otherwise, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5'a3 'direction, and generally represent the strand or sense of a polynucleotide double strand. It is recognized that the negative or antisense strand may be the functional moiety of a double stranded polynucleotide in the present embodiments, unless indicated, the polynucleotide sequences described will represent the positive or sense strand polynucleotide sequence. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations § 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1, 2 , and 3.

As used herein, "polynucleotide" refers to a DNA or RNA molecule that contains multiple nucleotides and generally refers to both oligonucleotides (a polynucleotide molecule typically 50 or some nucleotides in length) and polynucleotides 51 or more. nucleotides The embodiments include compositions that include oligonucleotides that are 19-25 nucleotides in length (19-mers, 20-mers, 21-mers, 22mers, 23-mers, 24-mers, or 25-mers), for example, oligonucleotides essentially homologous or essentially complementary to a component of a chloroplast protein import system, for example, SEQ ID NO: 1264-1483 (Table 2) or fragments thereof or medium length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 , 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, approximately 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, approximately 130, approximately 140, approximately 150, approximately 160, approximately 170, approximately 180, approximately 190, approximately 200, approximately 210, approximately 220, approximately 230, approximately 240, approximately 250, approximately 260, approximately 270, approximately 280, approximately 290, or approximately 300 nucleotides), for example, polynucleotide fragments thereof or long polynucleotides having a length greater than about 300 nucleotides (for example, polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the full length of a target gene that includes coding or non-coding or both coding and non-coding parts of the components of a target gene of the system. import of chloroplast proteins), for example, polynucleotides of SEQ ID NO: 1-1263 and 1584-1638, wherein the selected polynucleotides or fragments thereof are homologous or complementary to a segment of SEQ ID NO: 1-1263, SEQ ID NO: 1584-1638 or SEQ ID NO: 1639-1641 and suppress, repress or otherwise retard the expression of the import protein of the target chloroplast or import processing enzyme genes. Where a polynucleotide is double stranded, its length can be similarly described in terms of base pairs. An objective gene comprises any polynucleotide molecule in a plant cell or fragment thereof for which the modulation of the expression of the target gene is provided by the methods and compositions. A gene has non-coding genetic elements (components) that provide the function of the gene, these elements are polynucleotides that provide regulation of gene expression, such as, a promoter, an enhancer, a 5 'non-translated region, intron regions, and a region not translated 3 '. The oligonucleotides and polynucleotides can be made to any of the genetic elements of a gene and to polynucleotides that cross the junction region of a genetic element, such as an intron and exon, the promoter binding region and a transcribed region, the region of union of a leader 5 'and a coding sequence, the union of a non-translated region 3' and a coding sequence.

The polynucleotide compositions used in the various embodiments include compositions that include oligonucleotides or polynucleotides or a mixture of both that include RNA or DNA or RNA / DNA hybrids or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In some embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In some embodiments, the polynucleotide includes non-canon nucleotides such as inosine, thiouridine, or pseudouridine. In some embodiments, the polynucleotide includes chemically or enzymatically modified nucleotides. Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, U.S. Patent Publication 20110171287, U.S. Patent Publication20110171176, and U.S. Patent Publication20110152353, U.S. Patent Publication, 20110152346, U.S. Patent Publication20110160082, here incorporated in their entirety by reference to these. For example, even non-taxatively, the naturally occurring phosphodiester main structure of an oligonucleotide or polynucleotide can be partially or completely modified with internucleotide modifications of phosphorothioate, phosphoradithioate, or methylphosphonate, modified nucleoside bases or modified sugars can be used in synthesis of oligonucleotides or polynucleotides, and the oligonucleotides or polynucleotides can be labeled with a fluorescent moiety (for example, fluorescein or rhodamine) or another tag (for example, biotin).

The polynucleotides can be single or double stranded RNA or single or double stranded DNA or double stranded DNA / RNA hybrids or modified analogs thereof, and can be oligonucleotide lengths or longer. In more specific embodiments, polynucleotides that provide single stranded RNA in the plant cell are selected from the group consisting of (a) a single stranded RNA molecule (mRNA), (b) a single stranded RNA molecule which self-hybridizes to form a double stranded RNA molecule, (c) a double stranded RNA molecule (dsRNA), (d) a single stranded DNA molecule (mDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, and (f) a single-stranded DNA molecule that includes a modified Pol III gene that is transcribed to a molecule of RNA, (g) a double stranded DNA molecule (cDNA), (h) a double stranded DNA molecule that includes a modified Pol III gene that is transcribed to an RNA molecule, (i) an RNA molecule / Double stranded hybridized DNA, or combinations thereof. In some embodiments, these polynucleotides include chemically modified or non-canon nucleotides. In some embodiments, the oligonucleotides may be blunt-end or may comprise a 3 'protrusion from 1-5 nucleotides of at least one or both of the strands. Other oligonucleotide configurations are known in the field and are contemplated herein. In embodiments of the method, polynucleotides include double stranded DNA formed by intramolecular hybridization, double stranded DNA formed by intermolecular hybridization, double stranded RNA formed by intramolecular hybridization, or double stranded RNA formed by intermolecular hybridization. In one embodiment, polynucleotides include single stranded DNA or single stranded RNA that self-hybridize to form a hairpin structure that has at least partially double stranded structure that includes at least one segment that will hybridize to transcribed RNA from the gene. target for suppression. Without intending to limit itself to any mechanism, it is believed that such polynucleotides are or will produce single stranded RNA with at least one segment that will hybridize to transcribed RNA from the gene targeted for suppression. In certain other embodiments the polynucleotides further include a promoter, in general a functional promoter in a plant, for example, a pol II promoter, a pol III promoter, an IV promoter, or a pol V promoter.

The term "gene" refers to components comprising chromosomal DNA, plasmid DNA, cDNA, intron and exon DNA, artificial DNA polynucleotide, or other DNA encoding a peptide, polypeptide, protein, or RNA transcribed molecule, and the elements genetics that flank the coding sequence that are involved in the regulation of expression, such as promoter regions, 5 'leading regions, 3 'untranslated region that may exist as natural genes or transgenes in the genome of a plant. A component of a gene or a fragment thereof of a component of a protein import system to chloroplast is isolated and subjected to polynucleotide sequencing methods that determine the order of nucleotides that comprise the gene. Any of the components of the gene are potential targets for an oligonucleotide and polynucleotide activators.

Activating polynucleotide molecules are designed to modulate expression by inducing regulation or suppression of a gene from the endogenous chloroplast import protein system in a plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence. of a gene from the endogenous protein system of chloroplast import from a plant or to the transcribed RNA sequence of an endogenous protein from import of the chloroplast or import processing enzyme or chaperone-like protein associated with the gene of the import protein system of a plant, the sequence thereof determined by isolation of the gene or a fragment of the gene from the plant, which can be a coding sequence or non-coding sequence. Effective molecules that modulate expression are referred to as an activating molecule, or activating polynucleotide. By essentially identical or essentially complementary it means that the activating polynucleotides (or at least one strand of a double stranded polynucleotide or part thereof, or a part of a single stranded polynucleotide) are designed to hybridize to the non-coding sequence of the endogenous gene or to transcribed RNA (known as messenger RNA or an RNA transcript) from the endogenous gene to affect the regulation or suppression of endogenous gene expression. Activator molecules are identified by tessellation of the target genes with partially superimposed probes or non-superimposed probes of antisense or sense polynucleotides that are essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene. Multiple target sequences can be aligned and sequence regions with common homology, in accordance with the methods, are identified as potential activating molecules for multiple targets. Multiple activating molecules of various lengths, for example 19-25 nucleotides, 26-40 nucleotides, 41-50 nucleotides, 51-59 nucleotides, 60-100 nucleotides, 101-200 nucleotides, 201-300 nucleotides or more can be combined into some treatments in order to investigate polynucleotide molecules that cover a part of a gene sequence (for example, a part of a coding region against a part of a non-coding region, or a 5 'against 3' part of a gene) or a complete gene sequence that includes coding and non-coding regions of a target gene. The polynucleotide molecules of the combined activator molecules can be divided into smaller combinations or unique molecules in order to identify activator molecules that provide the desired effect.

The RNA and DNA polynucleotide molecules of the target gene (SEQ ID NO: 1-1263 and 1584-1638) are sequenced by any number of available methods and equipment. Some of the sequencing technologies are commercially available, such as the hybridization sequencing platform from Affymetrix Inc. (Sunnyvale, Calif.) And synthesis sequencing platforms of 454 Life Sciences (Bradford, Conn.), Illumina / Solexa (Hayward, Calif.) And Helicos Biosciences (Cambridge, Mass.), And the ligation sequencing platform of Applied Biosystems (Foster City, Calif.), as described below. In addition to single molecule sequencing performed using Helicos Biosciences synthesis sequencing, other single molecule sequencing technologies are encompassed and include Pacific Biosciences SMRT ™ technology, Ion Torrent ™ technology, and nanopore sequencing being developed, for example, by Oxford Nanopore Technologies. An import protein system of the chloroplast or import processing enzyme gene comprising DNA or RNA can be isolated using primers or probes essentially complementary or essentially homologous to SEQ ID NO: 1-1263 and 1584-1638 or a fragment of the same. A fragment of the polymerase chain reaction (PCR) gene can be produced using primers essentially complementary or essentially homologous to SEQ ID NO: 1-1263 and 1584-1638 or a fragment that is useful for isolating an import protein from the Chloroplast or import processing enzyme gene from a plant genome. SEQ ID NO: 11263 and 1584-1638 or fragments thereof can be used in various sequence capture technologies to isolate additional sequences from the target gene, for example, which include but are not limited to Roche NimbleGen® (Madison, WI ) and Streptavdin-coupled Dynabeads® (Life Technologies, Grand Island, NY) and US20110015084, incorporated herein by reference in their entirety.

Single strand functional polynucleotide modalities have sequence complementarity that does not need to be 100 percent, but is at least sufficient to allow hybridization to transcribed RNA from the target gene or target gene DNA to form a duplex to allow a mechanism. of gene silencing. Thus, in embodiments, a polynucleotide fragment is designed to be essentially identical, or essentially complementary, to a sequence of 19 or more contiguous nucleotides in either the target chloroplast import protein or the processing enzyme gene sequence. Import or messenger RNA transcribed from the target gene. In some embodiments, a polynucleotide fragment is designed to be essentially identical, or essentially complementary, to a sequence of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 , 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55 or more contiguous nucleotides in either the target chloroplast import protein or gene sequence of the import processing enzyme or messenger RNA transcribed from the target gene. By essentially identical it means that it has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 19 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene; By essentially complementary means that it has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 19 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene. In some embodiments, polynucleotide molecules are designed to have 100 percent sequence identity or complementarity to an allele or family member of a given target gene (coding or non-coding sequence of a gene); In other embodiments, polynucleotide molecules are designed to have 100 percent sequence identity or complementarity to multiple alleles or family members of a given target gene in one or more plant species.

Identity refers to the degree of similarity between two protein sequences or polynucleic acid. An alignment of the two sequences is performed by a suitable computer program. An accepted and widely used computer program to perform sequence alignments is CLUSTALW vi.6 (Thompson, et al. Nucí. Acids Res., 22: 4673-4680, 1994). The number of amino acids or mating bases is divided by the total number of bases or amino acids, and is multiplied by 100 to obtain a percentage of identity. For example, if two sequences of 580 base pairs have 145 paired bases, it could be 25 percent identical. If the two sequences compared are of different lengths, the number of pairings is divided by the shortest of the two lengths. For example, if there are 100 paired amino acids between a protein of 200 and 400 amino acids, they are 50 percent identical with respect to the shortest sequence. If the shortest sequence is less than 150 bases or 50 amino acids in length, the number of pairings is divided by 150 (for nucleic acid bases) or 50 (for amino acids), and multiplied by 100 to obtain an identity percentage.

Activating molecules for specific gene family members can be identified from coding and / or non-coding sequences of the gene families of a single plant or multiple plants, by alignment and selection of 200-300 polynucleotide fragments from less homologous regions between sequences aligned and evaluated using topically applied polynucleotides (such as mDNA, mRNA, CRNA or sense or antisense cDNA) to determine its relative effectiveness by providing the herbicidal phenotype. The effective segments are further subdivided into 50-60 polynucleotide fragments, prioritized by lower homology, and reevaluated using topically applied polynucleotides. In some embodiments, the 50-60 effective polynucleotide fragments are further subdivided into 19-30 polynucleotide fragments, prioritized by lower homology, and again evaluated by induction of the herbicidal phenotype. Once the relative effectiveness is determined, the fragments are used individually, or again evaluated in combination with one or more other fragments to determine the activating composition or mixture of activating polynucleotides to provide the herbicidal phenotype.

Activating molecules for broad activity can be identified from coding and / or non-coding sequences of families of the gene of one plant or multiple plants, by alignment and selecting 200-300 polynucleotide fragments from the most homologous regions between the sequences aligned and evaluated using topically applied polynucleotides (such as mDNA, mRNA, CRNA or sense or antisense cDNA) to determine its relative effectiveness by inducing the herbicidal phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized for greater homology, and reevaluated using topically applied polynucleotides. In some embodiments, effective 50-60 polynucleotide fragments are used individually, or in combination with one or more other fragments to determine the activating composition or mixture of activating polynucleotides to provide the herbicidal phenotype. In some embodiments, fragments of 50-60 effective polynucleotides are subdivided into fragments of 19-30 polynucleotides, prioritized by higher homology, and again evaluated by induction of the herbicidal phenotype. Once the relative efficacy is determined, the fragments can be used individually, or in combination with one or more other fragments to determine the activating composition or mixture of activating polynucleotides to provide the herbicidal phenotype.

Methods for making polynucleotides are well known in the art. The methods and compositions of chemical synthesis, in vivo synthesis and in vitro synthesis are known in the art and include various viral elements, microbial cells, modified polymerases, and modified polynucleotides. Commercial oligonucleotide preparation often provides two deoxyribonucleotides at the 3 'end of the sense strand. Long polynucleotide molecules can be synthesized from commercially available kits, for example, Applied Biosystems / Ambion kits (Austin, TX) have 5 'end-linked DNA in a microbial expression cassette that includes a bacterial T7 polymerase promoter that It makes strands of RNA that can be assembled into dsRNA and kits provided by various manufacturers including T7 RiboMax Express (Promega, Madison, WI), AmpliScribe T7-Flash (Epicenter, Madison, WI), and TranscriptAid T7 High Yield (Fermentas, Glen Burnie, MD) .RNA molecules can be produced from microbial expression cassettes in bacterial cells (Ongvarrasopone et al. ScienceAsia 33: 35-39; Yin, Appl. Microbiol. Biotechnol 84: 323-333, 2009; Liu et al., BMC Biotechnology 10:85, 2010) that have regulated or deficient RNaselII enzymatic activity or the use of several viral vectors to produce sufficient amounts of cRNA. The chloroplast import protein or fragments of the import processing enzyme gene are inserted into the microbial expression cassettes in a position in which the fragments are expressed to produce mRNA or mRNA useful in the methods described herein to regulate The expression of an objective gene. Long polynucleotide molecules can also be assembled from multiple RNA or DNA fragments. In some modalities design parameters such as Reynolds register (Reynolds et al. Natura Biotechnology 22, 326-330 (2004), Tischo rules (Pie Tischo, Natura Methods 3 (9): 670-676, 2006), i-record ( Nucleic Acids Res 35: el23, 2007), I-registration designer tool and associated algorithms (Nucleic Acids Res 32: 936-948, 2004. Biochem Biophys Res Commun 316: 1050-1058, 2004, Nucleic Acids Res 32: 893-901, 2004, Cell Cycle 3: 790-5, 2004, Nat Biotechnol 23: 995-1001, 2005, Nucleic Acids Res 35: e27, 2007, BMC Bioinformatics 7: 520, 2006, Nucleic Acids Res 35: el23, 2007, Nat Biotechnol 22: 326-330, 2004) are known in the art and can be used in the selection of polynucleotide sequences effective in silencing genes In some embodiments, the sequence of a polynucleotide is selected against the genomic DNA of the proposed plant to minimize unintentional silencing of other genes.

The ligands can be attached to a polynucleotide, for example an mRNA, mRNA, cDNA or mDNA. Ligands in general may include modifiers, for example, to improve absorption; diagnostic compounds or indicator groups for example, to monitor distribution; crosslinking agents; residues that confer nuclease resistance; and natural or non-usual nudeobases. General examples include lipophilic, lipid (for example, cholesterol, a bile acid, or a fatty acid (for example, lithocolic-oleyl, lauroyl, docosnyl, stearoyl, palmitoyl, myristoyl oleoyl, linoleoyl), steroids (for example, uvaol, hecigenin, diosgenin), terpenes (for example, triterpenes, for example, sarsasapogenin, Friedelina, lithocolic acid derived from epifriedelanol), vitamins (for example, folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binding agents, integrin target molecules, polycationic, peptides, polyamines, and peptide mimetics. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, for example, polyethylene glycol (PEG), PEG-40K, PEG-20K and PEG-5K. Other examples of ligands include lipophilic molecules, for example, cholesterol, colic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, glycerol (for example, esters and ethers thereof, for example, Ci alkyl0, Cu, C12, Ci3, Ci4, Ci5, Ci6, C17, Ci8, Ci9 or C20; for example, lauroyl, docosnyl, stearoyl, oleoyl, linoleoyl l, 3-bis-O (hexadecyl) glycerol, 1,3-bisO (octaadecyl) glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03- (oleoyl) lithocolic acid, 03 (oleoyl) collenic acid, dodecanoyl, lithocolyl, 5p-colanyl, Ν, Ν-distearyl-lithocolamide, 1,2-di-Westaroylglyceride, dimethoxytrityl or phenoxazine) and PEG (for example, PEG-5K, PEG-20K, PEG-40K). Preferred lipophilic moieties include lipid, cholesterols, oleyl, retinyl or cholesteryl residues.

Conjugating a ligand to a dsRNA can improve its cellular absorption, lipophilic compounds that have been conjugated to oligonucleotides include 1-pyrebutbutic acid, 1,3bis-O- (hexadecyl) glycerol and menthol. An example of a ligand for receptor-mediated endocytosis is folic acid. Folic acid enters the cell by endocytosis radiated by the folate receptor. RNAbc compounds that carry folic acid could be efficiently transported to the cell via folate-mediated endocytosis. Other ligands that have been conjugated to oligonucleotides include polyethylene glycols, carbohydrate clusters, crosslinking agents, porphyrin conjugates, delivery peptides and lipids such as cholesterol. In certain cases, conjugation of a cationic ligand to oligonucleotides results in improved resistance to nucleases. Representative examples of cationic ligands are propylammonium and diethylpropylammonium. Interestingly, antisense oligonucleotides were reported to retain their high binding affinity for mRNA when the cationic ligand was dispersed, through the oligonucleotide. See M. They will stain Antisense & Nudeic Acid Drug Development 2002, 12, 103 and references therein.

A biological delivery can be performed by a variety of methods that include, without limitation, (1) loading of liposomes with a dsRNA molecule provided herein and (2) complexing of a dsRNA molecule with lipids or liposomes to form liposome-nucleic acid or lipid-nucleic acid complexes. The liposome can be composed of cationic and neutral lipids commonly used to transfect cells in vitro. Cationic lipids can form complexes (eg, associated load) with negatively charged nucleic acids, to form liposomes. Examples of cationic liposomes include, without limitation, lipofectin, lipofectamine, lipofectace, and DOTAP. Procedures for forming liposomes are well known in the art. The liposome compositions may be formed, for example, from phosphatidylcholine, dimiristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, dimiristoyl phosphatidylglycerol, dioleoyl phosphatidylethanolamine or liposomes comprising dihydrosphingomyelin (DHSM). Numerous lipophilic agents are commercially available, including Lipofectin® (Invitrogen / Life Technologies, Carlsbad, Calif.) And Effectene ™ (Qiagen, Valencia, Calif.) In addition, systemic delivery methods can be optimized using commercially available cationic lipids such as DDAB or DOTAP, each of which can be mixed with a neutral lipid such as DOPE or cholesterol. In some cases, liposomes such as those described by Templeton et al. (Natura Biotechnology, 15: 647-652 (1997)) can be used. In other embodiments, polycations such as polyethyleneimine can be used to achieve in vivo and ex wza delivery (Boletta et al., J. Am Soc. Nephrol. 7: 1728 (1996)). Additional information regarding the use of liposomes for Nucleic acid delivery can be found in US Patent No. 6,271,359, PCT Publication WO 96/40964 and Morrissey, D. et al. 2005. Nat Biotechnol. 23 (8): 1002-7.

In certain embodiments, an organosilicone preparation that is commercially available with Silwet® L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, New York, can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a preatomization treatment of plant leaves or other plant surfaces, newly prepared concentrations in the range of about 0.1 to about 2 percent by weight (percent by weight ) (for example, approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 percent by weight) are effective in preparing a leaf or other plant surface for the transfer of polynucleotide molecules into plant cells from a topical surface application. In certain embodiments of the methods and compositions provided herein, a composition comprising a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.1 to about 2 percent by weight (weight percent ) (for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3 , 2.5 percent by weight) is used or provided.

In certain embodiments, any of the commercially available organosilicone preparations such as the following Breakthru S 321, Breakthru S 200 Cat. 76767-67-3, Breakthru OE 441 Cat. 68937-55-3, Breakthru S 278 Cat. 27306-78-1, Breakthru S 243, Breakthru S 233 Cat. 134180-76-0, available from the manufacturer Evonik Goldschmidt (Germany), Silwet® HS 429, Silwet® HS 312, Silwet® HS 508, Silwet® HS 604 (Momentive Performance Materials, Albany, New York) can be used as agents transfer in a polynucleotide composition. In certain embodiments where an organosilicone preparation is used as a pre-atomization treatment of plant leaves or other surfaces, newly prepared concentrations in the range of about 0.1 to about 2 percent by weight (percent by weight) (for example , 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 percent by weight) are effective in preparing a leaf or other plant surface for transferring polynucleotide molecules into plant cells from a topical application to the surface. In certain embodiments of the methods and compositions provided herein, a composition comprising a polynucleotide molecule and an organosilicone preparation in the range of about 0.1 to about 2 percent by weight (percent by weight) (for example, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 percent by weight ) is used or provided.

Organosilicone preparations used in the methods and compositions provided herein may comprise one or more effective organosilicone compounds. As used herein, the phrase "effective organosilicone compound" is used to describe any organosilicone compound found in an organosilicone preparation that allows a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound may allow a polynucleotide to enter a plant cell in a manner that allows a polynucleotide-mediated suppression of an expression of the target gene in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that may comprise: i) a major trisiloxane group that is covalently bound to ii) an alkyl linker that includes, but is not limited to, a linker of n-propyl, which is covalently linked to iii) a polyglycol chain, which is covalently linked to iv) a terminal group. The main trisiloxane groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers may include, but are not limited to, an n-propyl linker. Polyglycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Polyglycol chains may comprise a mixture that provides an average chain length n of about 7.5. In certain embodiments, the average chain length "n may vary from about 5 to about 14. Terminal groups may include, but are not limited to. a, alkyl groups such as a methyl group. It is believed that effective organosilicone compounds include, but are not limited to, trisiloxane ethoxylate or heptamethyl trisiloxane surfactants modified with polyalkylene oxide.

yes

or.

> I / O: yes .0.

(Compound I: polyalkylene oxide heptamethyltrisiloxane, average n = 7.5).

In certain embodiments, an organosilicone preparation comprising an organosilicone compound comprising a major trisiloxane group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation comprising an organosilicone compound comprising a major group of heptamethyltrisiloxane is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition comprising Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition comprising Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition comprising a polynucleotide molecule and one or more organosilicone compounds effective in the range of about 0.1 to about 2 percent by weight (percent by weight) (per example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 by weight percent) is used or provided.

The compositions include but are not limited to components that are one or more essentially identical, or essentially complementary, polynucleotides, to a chloroplast import protein or gene sequence of the import processing enzyme gene (promoter, intron, exon, region untranslated 5 ', untranslated region 3'), a transfer agent that facilitates the polynucleotide entering a plant cell, a herbicide that complements the action of the polynucleotide, one or more additional herbicides that further improve the herbicide activity of the composition or provide an additional mode of action different from the complementation herbicide, various salts and stabilizing agents that improve the usefulness of the composition as a mixture of the components of the composition.

In certain aspects, the methods include one or more applications of a polynucleotide composition and one or more applications of a transfer agent for conditioning a plant for polynucleotide permeation. When the permeation conditioning agent is an organosilicone composition or compound contained therein, modalities of the polynucleotide molecules are double stranded RNA oligonucleotides, single stranded RNA oligonucleotides, double stranded RNA polynucleotides, polynucleotides of

Single stranded RNA, double stranded DNA oligonucleotides, single stranded DNA oligonucleotides, double stranded DNA polynucleotides, single stranded DNA polynucleotides, chemically modified DNA or RNA oligonucleotides or polynucleotides or mixtures thereof.

The compositions and methods are useful for modulating the expression of a protein from an endogenous gene, where the protein is imported into a chloroplast and is a target of a herbicide, for example, an EPSPS gene or a transgenic EPSPS gene (e.g., EPSPS CP4, U.S. Patent No. RE39,247 and 2mEPSPS, U.S. Patent No. 6,040,497) in a plant cell. In several embodiments, an EPSPS gene includes a coding sequence (protein coding or translatable), non-coding sequence (non-translatable), or both coding and non-coding sequences. The compositions may include polynucleotides and oligonucleotides designed to target one or more chloroplast import genes and a target herbicide gene, or multiple segments of one or more of the genes. The gene may include multiple consecutive segments, multiple non-consecutive segments of a target gene, multiple alleles of a target gene or multiple target genes of one or more species.

A method is provided to modulate the expression of a chloroplast import gene or chloroplast protein processing gene in a plant that includes (a) conditioning a plant for polynucleotide permeation and (b) treating the plant with molecules of polynucleotide, wherein polynucleotide molecules include at least one segment of 19 or more, 25 or more, 30 or more, 40 or more, 45 or more, or 50 or more contiguous nucleotides cloned from or otherwise identified from the target gene in either the sense or antisense orientation, whereby the polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene. The application of polynucleotide and conditioning can be carried out separately or in a single stage. When the polynucleotide application and conditioning are performed in separate stages, the conditioning can precede or follow the application of the polynucleotide within minutes, hours or days. In some embodiments more than one stage of conditioning or more than one application of polynucleotide molecule can be performed in the same plant. In modalities of the method, the segment can be cloned or identified from (a) coding parts (protein coding), (b) non-coding (promoter and other gene related molecules) or (c) both coding and non-coding parts coding of the target gene. Non-coding parts include DNA, such as promoter regions of RNA transcribed by DNA that provide RNA regulatory molecules, which include but are not limited to: introns, 5 'or 3' untranslated regions, and microRNA (miRNA), ARNipira / is-actuators, natural antisense siRNAs and other small RNAs with regulatory function or RNA that have enzymatic or structural function that include but are not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers, and ribo switches.

All publications, patents and patent applications are incorporated herein by reference as if it were specifically and individually indicated that each patent application or individual publication is incorporated by reference.

The following examples are included to demonstrate examples of certain preferred embodiments. Those skilled in the art should note that the techniques described in the following examples represent procedures that the inventors have found work well in practice, and thus can be considered as constituting examples of preferred modes for their practice. However, those skilled in the art, in view of the present description, should appreciate that many changes can be made in the specific modalities described and still obtain a similar or similar result without departing from the spirit and scope.

EXAMPLES

EXAMPLE 1 Polynucleotides related to the chloroplast protein import system and target gene sequences thereof.

The import system of proteins to the objective chloroplast occurs naturally in the genome of plants, which include but are not limited to Abutilon theophrasti, Alopecuros myosuroides, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus Hvidus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Ambrosia artemisifolia, Ambrosia trifida, Avena fatua, Chenopodium album, Commelina diffusa, Convolvulus arvensis, Conyza canadensis, Cyperus esculentus, Digita sanguinalis, Echinochloa cotona, Echinochfoa crus-galli, Euphorbia heterophylla, Festuca arundinacea, Ipomoea hederacea, Kochia scoparia, LoHum arundinaceum, Lolumna obtidumumus, Septumumumus, Septumumumus, Septumumumusus Sorghum halepense, Spirodela polyrrhiza, Taraxacum officinale, Trifolium repens, Xanthium strumarium and other weed species that include molecules related to the expression of a polypeptide identified as an enzyme or protein from a chloroplast import protein system, which includes regulatory molecules, cDNAs that comprise coding and non-coding regions of the gene and fragments thereof as shown in SEQ ID NO: 1-1263 and SEQ ID NO: 1584-1683, summarized in Table 1.

The polynucleotide molecules are extracted from these plant species by standard methods in the field, for example, the total RNA is extracted using Trizol Reagent (Invitrogen Corp, Carlsbad, CA Cat. No. 15596-018), following the protocol of the manufacturer or modifications thereof by those skilled in the polynucleotide extraction technique that can improve the recovery or purity of the extracted RNA. In summary, it starts with 1 gram of plant tissue crushed by extraction. Pre-aliquots of 10 milliliters (mL) of Trizol reagent are made to 15 mL conical tubes. Crushed powder is added to the tubes and shakes to homogenize. The homogenized samples are incubated for 5 minutes (min) at room temperature (RT) and then 3 mL of chloroform are added. The tubes are shaken vigorously by hand for 15-30 seconds (sec) and incubated at RT for 3 min. The tubes are centrifuged at 7,000 revolutions per minute (rpm) for 10 min at 4 ° C (centigrade). The aqueous phase is transferred to a new 1.5 mL tube and 1 volume of cold isopropanol is added. The samples are incubated for 20-30 min at RT and centrifuged at 10,000 rpm for 10 min at 4 ° C. The precipitate was washed with 80% ethanol Sigma grade. The supernatant is removed and the precipitate is air dried briefly. The RNA precipitate is dissolved in approximately 200 microliters of water treated with DEPC. Briefly heat to 65 ° C to dissolve the precipitate and vortex or pipette to resuspend the RNA precipitate. The RNA is adjusted to 1-2 micrograms / microliters.

DNA is extracted using EZNA SP Plant Mini DNA Kit (Omega Biotek, Norcross GA, Cat. No. D5511) and Lisis Matrix E tubes (Q-Biogen, Cat. No. 6914), following the manufacturer's protocol or modifications thereof by those skilled in the art of polynucleotide extraction that can improve the recovery or purity of the extracted DNA. In summary, the crushed tissue subjected to aliquot to a Lisis Matrix E tube in dry ice, 800 pl SP1 buffer is added to each sample, homogenized in a beater for 34-45 sec, incubated on ice for 45 -60 sec, centrifuged at> 14000 rpm for Imin at RT, 10 microliters of RNase A are added to the lysate, incubated at 65 ° C for 10 min, centrifuged for 1 min at RT, 280μΙ of SP2 Shock absorber are added and vortexes to mix, the samples are incubated on ice for 5min, centrifuged at> 10O.OOOg for 10min at RT, the supernatant is transferred to a homogenizing column in a 2 ml collection tube, centrifuged at 10,000bg for 2min at RT, transferred the separated lysate in a 1.5 ml microfuge tube, 1.5 volumes of SP3 buffer are added to the separated lysate, vortexed immediately to obtain a homogeneous mixture, transfer up to 650μΙ of supernatant to the Hi-Bind column, centrifuged at 10 ° C for Imin, repeated, 100μΙ of Elution Buffer at 65 ° C are applied to the column, centrifuged at 10 ° C for 5min at RT.

Next-generation DNA sequencers are used, such as 454-FLX (Roche, Branford, CT), SOLiD (Applied Biosystems) and Genome Analyzer (HiSeq2000, Illumina, San Diego, CA) to provide polynucleotide sequences to from DNA and RNA extracted from plant tissues. The raw sequence data is assembled in chips. The sequence of condyles is used to identify activating polynucleotide molecules that can be applied to the plant to allow regulation of gene expression and result in an agronomic benefit.

TABLE 1

DNA sequence codes of the target chloroplast import protein system from various plant species

<td>SEO ID</td><td>GEN</td><td>Species</td><td>SEC TYPE</td>

<td>i</td><td>TOUCH</td><td>Theophrasti abutilón</td><td>M> ÑC</td>

<td> 2</td><td>TOC159</td><td>Totephrasti Abutilon</td><td>CDNA</td>

<td> 3</td><td>TótiSé</td><td>Thepphrasti abutilón</td><td>ADNgr</td>

<td> 4</td><td>TOC159</td><td>Theophrasti abutilón</td><td>ADÑg</td>

<td>S</td><td>TOC159</td><td>Thepphrasti abutilón</td><td>GDNA</td>

<td>and</td><td>I got</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 7</td><td>T0C159</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td>to</td><td>TOUCH</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td>δ</td><td>TOC159</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 10</td><td>TOC159</td><td>Abutilón the <^> hrasfci</td><td>GDNA</td>

<td> 11</td><td>TOC159</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td>ii</td><td>TOC159</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 13</td><td>fóúiáá</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 14</td><td>TOC159</td><td>Ayosuroid alopecurus</td><td>CDNA</td>

<td>IS</td><td>TOC159</td><td>Aoaranthus albus</td><td>CDNA</td>

<td>you</td><td>Tóóifié</td><td>Anaranthus albus</td><td>ÁbÑc</td>

<td> 17</td><td>ίόάιέό</td><td>Aaaranthus albus</td><td>CDNA</td>

<td> 18</td><td>TOC159</td><td>Anaranthus chlorostachys</td><td>CDNA</td>

<td> 19</td><td>TOC159</td><td>Aaaranthus graecizans</td><td>CDNA</td>

<td>he went</td><td>TOC159</td><td>Anaranthus graecizans</td><td>CDNA</td>

<td> ¿1</td><td>TOCÍ59</td><td>Anaranthus hybrxdus</td><td>CDNA</td>

<td> 22</td><td>TOC159</td><td>An.aranth.us hybndus</td><td>CDNA</td>

<td></td><td>TOC159</td><td>Aaaranthus livid</td><td>AfiÑC</td>

<td> 24</td><td>TOC159</td><td>Anaranthus palmer!</td><td>CDNA</td>

<td>2S</td><td>TOC1 ¿9</td><td>Anaranthus palmer!</td><td>CDNA</td>

<td> 26</td><td>TOC159</td><td>Anaranthus palneri</td><td>CDNA</td>

<td></td><td>TOC159</td><td>Amaranthus Palmeri</td><td>ÁCÑg</td>

<td>to</td><td>TOOSIS</td><td>Amaranthus palaeri</td><td>ADÑg</td>

<td> 29</td><td>7oCi65</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 33'</td><td>Τδό155</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 31</td><td>TSC1S5</td><td>Amaranthus rudis</td><td>ABÑg</td>

<td> 32</td><td>TOO155</td><td>Amaranthus rudis</td><td>AÜÑg</td>

<td> 3'3</td><td>IOC159</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 34</td><td>TOC1S3</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> ......35</td><td></td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 35</td><td>'Τδΰ 153 1 .................................</td><td>toaranthus thunbergii</td><td>ÁbÑc</td>

<td> 37..........................................................</td><td>TfiCiSS</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td>3S</td><td>Τδόϊδδ</td><td>Amaranthus thunbergii</td><td>ÁñÑc</td>

<td> .....3'5'.......................</td><td>Τδϋϊδδ</td><td>Jtaaranthus viridis</td><td>Do '</td>

<td> 40</td><td>TK1S51</td><td>Amaranthus viridis</td><td> .....</td>

<td> 41</td><td>'W155</td><td>Ambrosia artemisa folia</td><td>Wg</td>

<td> .....42........</td><td>..... Τδό'ΪΕδ </td><td>Ambrosia artemisíifolia</td><td>GDNA</td>

<td> 43</td><td>..... ΤδδΠ'5 ....................................</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 44</td><td>TOC153</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 45</td><td>TOC155</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 46</td><td>tóiSá</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 47</td><td>1ÓC159</td><td>Ambrosia trifida</td><td>GDNA</td>

<td>4 δ</td><td>TOÓ159</td><td>trifid globiness</td><td>ADHg</td>

<td>...... '4'S1</td><td>'Τδδίδδ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 50</td><td>Τδϋ'ϊδδ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td>5i</td><td>TKiSé</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 5¿</td><td>ίόόΐδδ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 5'3'</td><td>W1E5 .....</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 54</td><td>'Τδδϊδδ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 55</td><td>TÜC1S5</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 5<5</td><td>..... TSÜS9</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 57</td><td>TOC155</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> .....53</td><td>1OC159</td><td>^ Rosia Trifida</td><td>AJbÑg</td>

<td> ......3'3'...................................................</td><td>T0C1S5</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 33...........</td><td>..... T3CIS§ '.....................</td><td>Avena fatua</td><td>CDNA</td>

<td>YOU</td><td>TWÍ55</td><td>Avena fatua</td><td>CDNA</td>

<td> 53</td><td>Τδύΐδδ</td><td>Chenopodium album</td><td>CDNA</td>

<td> 53</td><td>TóóiSé</td><td>Chenopodium album</td><td>CDNA</td>

<td> 54...................................</td><td>..... Τ'ύόίδδ</td><td>Chenppodíum album</td><td>AfiNc</td>

<td> 65</td><td>Τδόΐδδ</td><td>Convolvulus arvensis</td><td>ABMc</td>

<td> .....55........</td><td>TOC159</td><td>Convolvulus arvensis</td><td>CDNA</td>

<td> 57</td><td>TOC155</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 68</td><td>Wü55 ..............</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> .....55...................................</td><td>ΤδδϊΕδ ................................</td><td>Cyperus esculentus</td><td>ÁfiÑg</td>

<td>7th</td><td>Τΰύίδδ</td><td>Digitana sanguinalis</td><td>CDNA</td>

<td> 71</td><td>TOC159</td><td>Digitaria sanguinalis</td><td>Affiliate</td>

<td> 7¿</td><td>lociSé</td><td>Digitaria sanguinalis</td><td>AfiÑc</td>

<td> 73</td><td>Τύόΐδδ</td><td>Cigitaria sanguinalis</td><td>CDNA</td>

<td> 74</td><td>T <K1S§</td><td>Digitaria sanguinalis</td><td>AfiNc</td>

<td> ......75...........................................................</td><td>Theos</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 73</td><td>Τδσϊδδ</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td>S7 ...........</td><td>TÓÓ1S5</td><td>Echinochioa Colona</td><td>CDNA</td>

<td> 78</td><td>Τδόΐδδ</td><td>Echinochioa Colona</td><td>AfiNc</td>

<td> ......7'5............</td><td>ίόύίδδ</td><td>Echinochioa crus-galli</td><td>CDNA</td>

<td>S3</td><td>T6C153</td><td>Euphorbia heterophyila</td><td>CDNA</td>

<td>3Ϊ</td><td>TCC1S5</td><td>Euphorbia heterophyila</td><td>Adnc</td>

<td> 82</td><td>TOC159</td><td>Etg> horJbia heterophylla</td><td>CDNA</td>

<td> 83</td><td>TOC159</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 84</td><td>TOC159</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 85</td><td>TOC159</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 86</td><td>TOC159</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 87</td><td>TOC159</td><td>Ipomoea heirá cea</td><td>CDNA</td>

<td> 88</td><td>TOC159</td><td>Kochia scoparía</td><td>GDNA</td>

<td> 89</td><td>TOC159</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 90</td><td>TOC159</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 91</td><td>TOC159</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 92</td><td>TOC159</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 93</td><td>TOC159</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 94</td><td>TOC159</td><td>Lolitzin multiflorum</td><td>GDNA</td>

<td> 95</td><td>TOC159</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 96</td><td>TOC159</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 97</td><td>TOC159</td><td>LoÜuib multiflorum</td><td>GDNA</td>

<td> 98</td><td>TOC159</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 99</td><td>TOC159</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 100</td><td>TOC159</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 101</td><td>T0C159</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 102</td><td>TOC159</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 103</td><td>TOC159</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 104</td><td>TOC159</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 105</td><td>TOC159</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 106</td><td>TOC159</td><td>Sorghum halepense</td><td>CDNA</td>

<td> 107</td><td>TOC159</td><td>Sorghum halepense</td><td>CDNA</td>

<td> 108</td><td>TOC159</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 109</td><td>TOC159</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 110</td><td>TOC159</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 111</td><td>TOC159</td><td>Trifolium repens</td><td>GDNA</td>

<td> 112</td><td>TOC159</td><td>Trifolium repens</td><td>GDNA</td>

<td> 113</td><td>TOC159</td><td>Trifolium repens</td><td>GDNA</td>

<td> 114</td><td>TOC159</td><td>Trifolium repens</td><td>GDNA</td>

<td> 115</td><td>T0C159</td><td>Trifolium repens</td><td>GDNA</td>

<td> 116</td><td>TOC159</td><td>Xanthinm strumarium</td><td>CDNA</td>

<td> 117</td><td>TOC159</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 118</td><td>TOC33</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 119</td><td>TOC33</td><td>Amaz-antJius palmer!</td><td>GDNA</td>

<td> 120</td><td>TOC33</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 121</td><td>TOC33</td><td>Amarantiius palmer!</td><td>GDNA</td>

<td> 122</td><td>TOC33</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 123</td><td>TOC33</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 124</td><td>TOC33</td><td>Rudrant Amarantlius</td><td>GDNA</td>

<td> 125</td><td>TOC33</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 126</td><td>T0C33</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 127</td><td>TOC33</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 128</td><td>TOC33</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 129</td><td>TOC33</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 130</td><td>TOC33</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 131</td><td>TOC33</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 132</td><td>TOC33</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 133</td><td>TOC33</td><td>Commelina diffusa</td><td>CDNA</td>

<td> 134</td><td>TOC33</td><td>Cyperus esculentus</td><td>GDNA</td>

<td> 135</td><td>TOC33</td><td>Cyperns esculentus</td><td>GDNA</td>

<td> 136</td><td>TOC33</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 137</td><td>TOC33</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 138</td><td>TOC33</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 139</td><td>TOC 3 3</td><td>Arundinacea fescue</td><td>GDNA</td>

<td> 140</td><td>TOC 33</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 141</td><td>TOC33</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> 142</td><td>TOC33</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 143</td><td>TOC33</td><td>Oleraceous Portillara</td><td>GDNA</td>

<td> 144</td><td>TOC33</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 145</td><td>TOC33</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 146</td><td>TOC33</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 147</td><td>TOC33</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 148</td><td>TOC33</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 149</td><td>TOC33</td><td>Taraxactm officinale</td><td>GDNA</td>

<td> 150</td><td>TOC33</td><td>Taraxactm officinale</td><td>GDNA</td>

<td> 151</td><td>TOC33</td><td>Trifolitm repens</td><td>GDNA</td>

<td> 152</td><td>TOC33</td><td>Trifolitm repens</td><td>GDNA</td>

<td> 153</td><td>TOC33</td><td>Trifolitm repens</td><td>GDNA</td>

<td> 154</td><td>TOC33</td><td>Trifoliam repens</td><td>GDNA</td>

<td> 155</td><td>TOC33</td><td>Xanthium strumaríum</td><td>CDNA</td>

<td> 156</td><td>TOC34</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 157</td><td>TOC34</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 158</td><td>TOC34</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 159</td><td>TOC34</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 160</td><td>TOC34</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 161</td><td>TOC34</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 162</td><td>TOC34</td><td>Aiopecurus myosuroides</td><td>CDNA</td>

<td> 163</td><td>TOC34</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 164</td><td>TOC34</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 165</td><td>TOC34</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 166</td><td>TOC34</td><td>Amaranthus hybrídus</td><td>CDNA</td>

<td> 167</td><td>TOC34</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 168</td><td>TOC34</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 169</td><td>T0C34</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 170</td><td>TOC34</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 171</td><td>TOC34</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 172</td><td>TOC34</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 173</td><td>TOC34</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 174</td><td>TOC34</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 175</td><td>TOC34</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 176</td><td>TOC34</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 177</td><td>TOC34</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 178</td><td>T0C34</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 179</td><td>TOC34</td><td>Amaranthus thunbergíí</td><td>CDNA</td>

<td> 180</td><td>TOC34</td><td>Amaranthus saw rías</td><td>CDNA</td>

<td> 181</td><td>TOC34</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 182</td><td>T0C34</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 183</td><td>TOC34</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 184</td><td>TOC34</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 185</td><td>TOC34</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 186</td><td>TOC34</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 187</td><td>TOC34</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 188</td><td>TOC34</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 189</td><td>TOC34</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 190</td><td>TOC34</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 191</td><td>TOC34</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 192</td><td>TOC34</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 193</td><td>TOC34</td><td>Chenopodíum album</td><td>CDNA</td>

<td> 194</td><td>TOC34</td><td>Coaunelína diffusa</td><td>CDNA</td>

<td> 195</td><td>TOC34</td><td>COmmelína diffusa</td><td>CDNA</td>

<td> 196</td><td>TOC34</td><td>Commelina diffusa</td><td>CDNA</td>

<td> 197</td><td>TOC34</td><td>Conyza Canadensís</td><td>CDNA</td>

<td> 198</td><td>TOC34</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 199</td><td>TOC34</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 200</td><td>TOC34</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 201</td><td>TOC34</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 202</td><td>TOC34</td><td>I would say sanguínaiís</td><td>CDNA</td>

<td> 203</td><td>TOC34</td><td>Ecbiiiociiloa crus-galli</td><td>CDNA</td>

<td> 204</td><td>TOC34</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 205</td><td>TOC34</td><td>Et ^ phorbía heterophylla</td><td>GDNA</td>

<td> 206</td><td>TOC34</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 207</td><td>TOC34</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 208</td><td>TOC34</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 209</td><td>TOC34</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 210</td><td>TOC34</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 211</td><td>TOC34</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 212</td><td>TOC34</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 213</td><td>TOC34</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 214</td><td>TOC34</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 215</td><td>TOC34</td><td>They hurt arundinaceum</td><td>GDNA</td>

<td> 216</td><td>TOC34</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 217</td><td>TOC34</td><td>They hurt arundinaceum</td><td>GDNA</td>

<td> 218</td><td>TOC34</td><td>They hurt multiflorum</td><td>CDNA</td>

<td> 219</td><td>TOC34</td><td>They hurt multiflorum</td><td>GDNA</td>

<td> 220</td><td>TOC34</td><td>Dolium multiflorum</td><td>GDNA</td>

<td> 221</td><td>TOC34</td><td>They hurt multiflorum</td><td>GDNA</td>

<td> 222</td><td>TOC34</td><td>Dolium multiflorum</td><td>GDNA</td>

<td> 223</td><td>TOC34</td><td>They hurt stiff</td><td>GDNA</td>

<td> 224</td><td>TOC34</td><td>They hurt stiff</td><td>GDNA</td>

<td> 225</td><td>TOC34</td><td>They hurt stiff</td><td>GDNA</td>

<td> 226</td><td>TOC34</td><td>They hurt stiff</td><td>GDNA</td>

<td> 227</td><td>TOC34</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 228</td><td>TOC34</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td></td><td>TOC34</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 230</td><td>TOC34</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 231</td><td>TOC34</td><td>Smile obtusifolia</td><td>CDNA</td>

<td> 232</td><td>TOC34</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 233</td><td>TOC34</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 234</td><td>TOC34</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 235</td><td>TOC34</td><td>Spyrol polyrrhiza</td><td>GDNA</td>

<td> 236</td><td>TOC34</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 237</td><td>TOC34</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 230</td><td>TOC34</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 239</td><td>TOC34</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 240</td><td>TOC34</td><td>Trif01 ium repens</td><td>GDNA</td>

<td> 241</td><td>TOC34</td><td>Trífolium repens</td><td>GDNA</td>

<td> 242</td><td>TOC34</td><td>Tri folium repens</td><td>GDNA</td>

<td> 243</td><td>TOC34</td><td>Trífolium repens</td><td>GDNA</td>

<td> 244</td><td>TOC34</td><td>Trífolium repens</td><td>GDNA</td>

<td> 245</td><td>TOC34</td><td>Trífolium repens</td><td>GDNA</td>

<td> 246</td><td>TOC34</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 247</td><td>TOC34</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 248</td><td>TOC75</td><td>Theqphrastí abutilón</td><td>CDNA</td>

<td> 249</td><td>TOC75</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td> 250</td><td>TOC75</td><td>Theopiirastí abutilón</td><td>GDNA</td>

<td> 251</td><td>TOC75</td><td>Theqphrastí abutilón</td><td>GDNA</td>

<td> 252</td><td>TOC75</td><td>Theqphrastí abutilón</td><td>GDNA</td>

<td> 253</td><td>TOC75</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td> 254</td><td>TOC75</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 255</td><td>TOC75</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 256</td><td>TOC75</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 257</td><td>TOC75</td><td>Amarantbus graecizans</td><td>CDNA</td>

<td> 258</td><td>TOC75</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 259</td><td>TOC75</td><td>Amaranthus 1life</td><td>CDNA</td>

<td> 260</td><td>TOC75</td><td>Amarantíius palmer!</td><td>CDNA</td>

<td> 261</td><td>TOC75</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 262</td><td>TOC75</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 263</td><td>TOC75</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 264</td><td>TOC75</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 265</td><td>TOC75</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 2€6</td><td>TOC75</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 267</td><td>TOC75</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 268</td><td>TOC75</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 269</td><td>TOC75</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 270</td><td>TOC75</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 271</td><td>TOC7S</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 272</td><td>TOC75</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 273</td><td>TOC75</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 274</td><td>TOC75</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 275</td><td>TOC75</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 276</td><td>TOC75</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 277</td><td>TOC75</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 278</td><td>TOC75</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 279</td><td>TOC75</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 230</td><td>TOC75</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 231</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 282</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 283</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 284</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 285</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 236</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 237</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 288</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 289</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 290</td><td>TOC75</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 291</td><td>TOC75</td><td>Chenopodíura albura</td><td>CDNA</td>

<td> 292</td><td>TOC75</td><td>Couimelína diffusa</td><td>CDNA</td>

<td> 293</td><td>TOC75</td><td>Commelina diffusa</td><td>CDNA</td>

<td> 294</td><td>TOC75</td><td>Convolvulus arvensis</td><td>CDNA</td>

<td> 295</td><td>TOC75</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 296</td><td>TOC75</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 297</td><td>TOC75</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 298</td><td>TOC75</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 299</td><td>TOC75</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 300</td><td>TOC75</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 301</td><td>TOC75</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 302</td><td>TOC75</td><td>I would say sanguínaüs</td><td>GDNA</td>

<td> 303</td><td>TOC75</td><td>Ecünochloa crus-galli</td><td>CDNA</td>

<td> 304</td><td>TOC75</td><td>Echínochloa crus-gallí</td><td>CDNA</td>

<td> 305</td><td>TOC75</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 306</td><td>TOC75</td><td>Euphorbia heterophylla</td><td>ADMg</td>

<td> 307</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 308</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 309</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 310</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 311</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 312</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 313</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 314</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 315</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 316</td><td>TOC75</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 317</td><td>TOC75</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 318</td><td>TOC75</td><td>Kochía scoparia</td><td>GDNA</td>

<td> 319</td><td>TOC75</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 320</td><td>TOC75</td><td>Kochía scoparia</td><td>GDNA</td>

<td> 321</td><td>TOC75</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 322</td><td>TOC75</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 323</td><td>TOC75</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 324</td><td>TOC75</td><td>Loliunt arundinaceum</td><td>GDNA</td>

<td> 325</td><td>TOC75</td><td>Lolium arundínaceunt</td><td>GDNA</td>

<td> 326</td><td>TOC75</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 327</td><td>TOC75</td><td>Lolíum arundinaceum</td><td>GDNA</td>

<td> 328</td><td>TOC75</td><td>Lolíum arundinaceum</td><td>GDNA</td>

<td> 329</td><td>TOC75</td><td>Loline rigidium</td><td>GDNA</td>

<td> 330</td><td>TOC75</td><td>Loline rigidium</td><td>GDNA</td>

<td> 331</td><td>TOC75</td><td>Loline rigidium</td><td>GDNA</td>

<td> 332</td><td>TOC75</td><td>Loline rigidium</td><td>GDNA</td>

<td> 333</td><td>TOC75</td><td>Loline rigidium</td><td>GDNA</td>

<td> 334</td><td>TOC75</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 335</td><td>TOC75</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 336</td><td>TOC75</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 337</td><td>TOC75</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 338</td><td>TOC75</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 339</td><td>TOC75</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 340</td><td>TOC75</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 341</td><td>TOC75</td><td>Taraxacua officinale</td><td>GDNA</td>

<td> 342</td><td>TOC75</td><td>Tri f olium repens</td><td>GDNA</td>

<td> 343</td><td>TOC75</td><td>Trifolium repens</td><td>GDNA</td>

<td> 344</td><td>TOC75</td><td>Trifolium repens</td><td>GDNA</td>

<td> 345</td><td>TOC75</td><td>Trifolium repens</td><td>GDNA</td>

<td> 346</td><td>TOC75</td><td>Trifolium repens</td><td>GDNA</td>

<td> 347</td><td>TOC75</td><td>Trifolium repens</td><td>GDNA</td>

<td> 348</td><td>TOC75</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 349</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 350</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 351</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 352</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 353</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 354</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 355</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 356</td><td>ΟΕΡΒΟ</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 357</td><td>ΟΕΡΒΟ</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td>35Β</td><td>ΟΕΡΒΟ</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 359</td><td>ΟΕΡΒΟ</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 360</td><td>ΟΕΡΒΟ</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 361</td><td>ΟΕΡ0Ο</td><td>Amarantiius hybridus</td><td>CDNA</td>

<td> 362</td><td>ΟΕΡΒΟ</td><td>Amaranthus Lívídus</td><td>CDNA</td>

<td> 363</td><td>ΟΕΡΒΟ</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 364</td><td>ΟΕΡΘΟ</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 365</td><td>ΟΕΡΒΟ</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 366</td><td>ΟΕΡΒΟ</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 367</td><td>ΟΕΡΒΟ</td><td>Amaranthus rudis</td><td>CDNA</td>

<td>36Θ</td><td>ΟΕΡΘΟ</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 369</td><td>EP80</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 370</td><td>ΟΕΡΒΟ</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 371</td><td>ΟΕΡΒΟ</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 372</td><td>ΟΕΡΒΟ</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 373</td><td>ΟΕΡΒΟ</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 374</td><td>ΟΕΡΒΟ</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 375</td><td>ΟΕΡΘΟ</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 376</td><td>ΟΕΡΒΟ</td><td>Amaranthus spínosus</td><td>CDNA</td>

<td> 377</td><td>ΟΕΡΒΟ</td><td>Amaranthus spínosus</td><td>CDNA</td>

<td>37Β</td><td>ΟΕΡΒΟ</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 379</td><td>ΟΕΡΒΟ</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 380</td><td>ΟΕΡΒΟ</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 381</td><td>ΟΕΡΒΟ</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 3 82</td><td>ΟΕΡΒΟ</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 383</td><td>ΟΕΡΒΟ</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 384</td><td>ΟΕΡΒΟ</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 385</td><td>ΟΕΡΒΟ</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 386</td><td>ΟΕΡΒΟ</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 387</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 388</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 389</td><td>EPEP0</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 390</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 391</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 392</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 393</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 394</td><td>ΟΕΡΒΟ</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 395</td><td>ΟΕΡΒΟ</td><td>Chenopodium album</td><td>CDNA</td>

<td> 396</td><td>ΟΕΡΒΟ</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 397</td><td>ΟΕΡΒΟ</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 390</td><td>ΟΕΡΒΟ</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 399</td><td>ΟΕΡΒΟ</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 400</td><td>ΟΕΡΘΟ</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 401</td><td>ΟΕΡΒΟ</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 402</td><td>ΟΕΡΒΟ</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 403</td><td>ΟΕΡΒΟ</td><td>Echinochloa colana</td><td>CDNA</td>

<td> 404</td><td>ΟΕΡΒΟ</td><td>Echinochloa crus-galli</td><td>CDNA</td>

<td> 405</td><td>ΟΕΡΒΟ</td><td>Echinochloa crus-galli</td><td>CDNA</td>

<td> 406</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 407</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 400</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 409</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 410</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 411</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 412</td><td>ΟΕΡΒΟ</td><td>Euphorhia heterophylla</td><td>GDNA</td>

<td> 413</td><td>ΟΕΡΒΟ</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 414</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 415</td><td>ΟΕΡΒΟ</td><td>Arandinacea fescue</td><td>GDNA</td>

<td> 416</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 417</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 410</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 419</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 420</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 421</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 422</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 423</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 424</td><td>ΟΕΡΒΟ</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 425</td><td>ΟΕΡΒΟ</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 426</td><td>ΟΕΡΒΟ</td><td>Ipomoea heirá cea</td><td>CDNA</td>

<td> 427</td><td>ΟΕΡΒΟ</td><td>Kochia scoparía</td><td>GDNA</td>

<td> 428</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 429</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 430</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 431</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 432</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 433</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceunt</td><td>GDNA</td>

<td> 434</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 435</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 436</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 437</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 438</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 439</td><td>ΟΕΡΒΟ</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 440</td><td>ΟΕΡΒΟ</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 441</td><td>ΟΕΡΒΟ</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 442</td><td>ΟΕΡΒΟ</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 443</td><td>ΟΕΡΒΟ</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 444</td><td>ΟΕΡΒΟ</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 445</td><td>όΕΡδί)</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 446</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 447</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 448</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 449</td><td>ΟΕΡΒΟ</td><td>Lolium rigid</td><td>GDNA</td>

<td> 450</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 451</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 452</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 453</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 454</td><td>ΟΕΡΒΟ</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 455</td><td>ΟΕΡΒΟ</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 456</td><td>ΟΕΡΒΟ</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 457</td><td>ΟΕΡΒΟ</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 458</td><td>ΟΕΡΒΟ</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 459</td><td>ΟΕΡΒΟ</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 460</td><td>ΟΕΡΒΟ</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 461</td><td>όΕΡδδ</td><td>Senna obtusifolía</td><td>CDNA</td>

<td> 462</td><td>ΟΕΡΒΟ</td><td>Senna obtusifolía</td><td>CDNA</td>

<td> 463</td><td>ΟΕΡΒΟ</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 464</td><td>ΟΕΡΒΟ</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 465</td><td>ΟΕΡΒΟ</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 466</td><td>ΟΕΡΒΟ</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 467</td><td>ΟΕΡΒΟ</td><td>Sorghunt halepense</td><td>GDNA</td>

<td> 468</td><td>ΟΕΡΒΟ</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 469</td><td>ΟΕΡΒΟ</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 470</td><td>ΟΕΡΒΟ</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 471</td><td>ΟΕΡΒΟ</td><td>Taraxacum off iconic</td><td>GDNA</td>

<td> 472</td><td>ΟΕΡΒΟ</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 473</td><td>ΟΕΡΒΟ</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 474</td><td>ΟΕΡΒΟ</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 475</td><td>ΟΕΡΒΟ</td><td>Taraxacum offline</td><td>GDNA</td>

<td> 476</td><td>ΟΕΡΒΟ</td><td>Trifolum repens</td><td>GDNA</td>

<td> 477</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 478</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 479</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 480</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 481</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 482</td><td>ΟΕΡΒΟ</td><td>Trifoli um repens</td><td>GDNA</td>

<td> 483</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 484</td><td>ΟΕΡΒΟ</td><td>Trifolium repens</td><td>GDNA</td>

<td> 485</td><td>ΟΕΡΒΟ</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 486</td><td>TOC132</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 487</td><td>TOC132</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 488</td><td>TOC132</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 489</td><td>TOC132</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 490</td><td>TOC132</td><td>Alopecurus nyosuroides</td><td>CDNA</td>

<td> 491</td><td>TOC132</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 492</td><td>TOC132</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 493</td><td>TOC132</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 494</td><td>TOC132</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 495</td><td>TOC132</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 496</td><td>TOC132</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 497</td><td>TOC132</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 498</td><td>TOC132</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 499</td><td>TOC132</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 500</td><td>TOC132</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 501</td><td>TOC132</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 502</td><td> 100132</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 503</td><td>TOC132</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 504</td><td>TOC132</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 505</td><td>TOC132</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 506</td><td>TOC132</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 507</td><td>TOC132</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 508</td><td>TOC132</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 509</td><td>TOC132</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 510</td><td>TOC132</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 511</td><td>TOC132</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 512</td><td>TOC132</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 513</td><td>TOC132</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 514</td><td>TOC132</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 515</td><td>T0C132</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 516</td><td>T0C132</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 517</td><td>TOC132</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 518</td><td>TOC132</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 519</td><td>TOC132</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 520</td><td>TOC132</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 521</td><td>TOC132</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 522</td><td>TOC132</td><td>Avena fatua</td><td>ADHc</td>

<td> 523</td><td>TOC132</td><td>Chenopodium album</td><td>CDNA</td>

<td> 524</td><td>TOC132</td><td>Gñenopodiura album</td><td>CDNA</td>

<td> 525</td><td>TOC132</td><td>Ccmmellna diffusa</td><td>CDNA</td>

<td> 526</td><td>TOC132</td><td>Arvensis convolvules</td><td>CDNA</td>

<td> 527</td><td>TOC132</td><td>Convolvulus arvensis</td><td>CDNA</td>

<td> 528</td><td>TOC132</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 529</td><td>TOC132</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 530</td><td>TOC132</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 531</td><td>TOC132</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 532</td><td>TOC132</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 533</td><td>TOC132</td><td>Scary Cyperas</td><td>GDNA</td>

<td> 534</td><td>TOC132</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 535</td><td>TOC132</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 536</td><td>TOC132</td><td>Echinochloa Colona</td><td>CDNA</td>

<td> 537</td><td>T0C132</td><td>Ecbinocltloa crus-galli</td><td>CDNA</td>

<td> 538</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 539</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 540</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 541</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 542</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 543</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 544</td><td>TOC132</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 545</td><td>T0C132</td><td>Festuca arondinacea</td><td>GDNA</td>

<td> 546</td><td>TOC132</td><td>Festuca arondinacea</td><td>GDNA</td>

<td> 547</td><td>TOC132</td><td>Arundinacea fescue</td><td>GDNA</td>

<td> 548</td><td>TOC132</td><td>Festuca arondinacea</td><td>GDNA</td>

<td> 549</td><td>TOC132</td><td>Arundinacea fescue</td><td>GDNA</td>

<td> 550</td><td>T0C132</td><td>Festuca arundmaoea</td><td>GDNA</td>

<td> 551</td><td>TOC132</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 552</td><td>TOC132</td><td>Kochia scoparía</td><td>GDNA</td>

<td> 553</td><td>TOC132</td><td>Kochia take her</td><td>GDNA</td>

<td> 554</td><td>TOC132</td><td>Loliunt arundinaceunt</td><td>GDNA</td>

<td> 555</td><td>TOC132</td><td>Lolium arundinaceunt</td><td>GDNA</td>

<td>S56</td><td>TOC132</td><td>Lolium Rigidium</td><td>GDNA</td>

<td> 557</td><td>TOC132</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 558</td><td>TOC132</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 559</td><td>TOC132</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 560</td><td>TOC132</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 561</td><td>TOC132</td><td>Senna obtusi £ olia</td><td>CDNA</td>

<td> 562</td><td>TOC132</td><td>Sorghtm halepense</td><td>GDNA</td>

<td> 563</td><td>TOC132</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 564</td><td>TOC132</td><td>Taraxacuzi officinale</td><td>GDNA</td>

<td> 565</td><td>TOC132</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 566</td><td>TOC132</td><td>Trifolum repens</td><td>GDNA</td>

<td> 567</td><td>TOC132</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 568</td><td>TOC132</td><td>Xanthi uní strimarium</td><td>CDNA</td>

<td> 569</td><td>TOC132</td><td>Xanthi um struuiarium</td><td>CDNA</td>

<td> 570</td><td>TIC110</td><td>Thecphrastí abutilón</td><td>CDNA</td>

<td> 571</td><td>TIC110</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td> 572</td><td>TIC110</td><td>Theoplirastí abutilón</td><td>GDNA</td>

<td> 573</td><td>TIC110</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 574</td><td>TIC110</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 575</td><td>TIC11O</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 576</td><td>TIC110</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 577</td><td>ICT</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td> 578</td><td>ICT</td><td>Alopecurus nyosuroides</td><td>CDNA</td>

<td> 579</td><td>ICT</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 580</td><td>ICT</td><td>Amaranthus aibus</td><td>CDNA</td>

<td> 581</td><td>ICT</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 582</td><td>ICT</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 583</td><td>ICT</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 584</td><td>ICT</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 585</td><td>ICT</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 586</td><td>ICT</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 587</td><td>ICT</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 588</td><td>ICT</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 589</td><td>ICT</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 590</td><td>ICT</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 591</td><td>ICT</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 592</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 593</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 594</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 595</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 596</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 597</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 598</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 599</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 600</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 601</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 602</td><td>ICT</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 603</td><td>ICT</td><td>Amaranthus spínosus</td><td>CDNA</td>

<td> 604</td><td>ICT</td><td>Amaranthus thunbergií</td><td>CDNA</td>

<td> 605</td><td>ICT</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 606</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 607</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 608</td><td>ncuo</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 609</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 610</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 611</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 612</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 613</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 614</td><td>ICT</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 615</td><td>ICT</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 616</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 617</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 618</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 619</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 620</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 621</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 622</td><td>ICT</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 623</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 624</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 625</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 626</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 627</td><td>ICT</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 628</td><td>ICT</td><td>Avena fatua</td><td>CDNA</td>

<td> 629</td><td>ICT</td><td>Chenopodium albura</td><td>CDNA</td>

<td> 630</td><td>ICT</td><td>Chenopodium album</td><td>CDNA</td>

<td> 631</td><td>ICT</td><td>Convolvulus arvensis</td><td>CDNA</td>

<td> 632</td><td>TIC11O</td><td>Convolvulus arvensis</td><td>CDNA</td>

<td> 633</td><td>TIC11O</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 634</td><td>TIC11O</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 635</td><td>TIC11O</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 636</td><td>TIC11O</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 637</td><td>TIC110</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 638</td><td>TIC11O</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 639</td><td>TIC11O</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 640</td><td>TIC11O</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 641</td><td>TIC11O</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 642</td><td>TIC11O</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 643</td><td>TIC11O</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 644</td><td>TIC11O</td><td>Digítaria sanguinalis</td><td>GDNA</td>

<td> 645</td><td>TIC110</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 646</td><td>TIC110</td><td>Digítaria sanguinalis</td><td>GDNA</td>

<td> 647</td><td>TIC11O</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td>64 to</td><td>TIC11O</td><td>Echinochloa Colona</td><td>CDNA</td>

<td> €49</td><td>TIC11O</td><td>Echinochloa crus-galli</td><td>CDNA</td>

<td> 650</td><td>TIC110</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 651</td><td>TIC11O</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 652</td><td>TIC11O</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 653</td><td>TIC11O</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 654</td><td>TIC110</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> €55</td><td>TIC11O</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> €56</td><td>TIC11O</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 657</td><td>TIC11O</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 658</td><td>TIC11O</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 659</td><td>TIC110</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 660</td><td>TIC11O</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 661</td><td>TIC110</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 662</td><td>TIC110</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 663</td><td>TIC11O</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 664</td><td>TIC11O</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 665</td><td>TIC11O</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 666</td><td>TIC11O</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 667</td><td>TIC11O</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 668</td><td>TIC110</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> 669</td><td>TIC110</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> €70</td><td>TIC110</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> €71</td><td>TIC11O</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> 672</td><td>TIC11O</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> €73</td><td>TIC11O</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> €74</td><td>TIC11O</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> €75</td><td>TIC11O</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> 676</td><td>TIC11O</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 677</td><td>TIC11O</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 67 8</td><td>TIC110</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 67 9</td><td>TIC11O</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 680</td><td>TIC110</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 681</td><td>TIC110</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 682</td><td>TIC11O</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 683</td><td>TIC110</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 684</td><td>TIC11O</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 685</td><td>TIC11O</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 686</td><td>TIC11O</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 687</td><td>TICUO</td><td>Lolium muitifloride</td><td>GDNA</td>

<td> 688</td><td>ICT</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 689</td><td>TICUO</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 690</td><td>TICUO</td><td>Lolium rigididum</td><td>GDNA</td>

<td> 691</td><td>TICUO</td><td>Lolium Rigidiinn</td><td>GDNA</td>

<td> 692</td><td>TICUO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 693</td><td>TICUO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 694</td><td>TICUO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 695</td><td>ICT</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 696</td><td>TICUO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 697</td><td>'Ticiio</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 698</td><td>TICUO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 699</td><td>TIC110</td><td>Senna obtusifolía</td><td>CDNA</td>

<td> 700</td><td>TIC110</td><td>Setaria Vridís</td><td>CDNA</td>

<td> 701</td><td>TICUO</td><td>Sorghum halepense</td><td>CDNA</td>

<td>7Ό2</td><td>TICUO</td><td>Sorghum halepense</td><td>CDNA</td>

<td> 703</td><td>ICT</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 704</td><td>ICT</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 705</td><td>ICT</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 706</td><td>ICT</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 707</td><td>TICUO</td><td>Taraxacm offícinale</td><td>GDNA</td>

<td> 708</td><td>TICUO</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 709</td><td>ICT</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 710</td><td>ICT</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 711</td><td>TICUO</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 712</td><td>TICUO</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 713</td><td>TICUO</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 714</td><td>ICT</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 715</td><td>TICUO</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 716</td><td>blended</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 717</td><td>TICUO</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 718</td><td>TICUO</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 719</td><td>TICUO</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 720</td><td>ICT</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 721</td><td>ICT</td><td>Trífolíum repens</td><td>GDNA</td>

<td> 722</td><td>ICT</td><td>Xanthium strumaríum</td><td>CDNA</td>

<td> 723</td><td>TIC20</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 724</td><td>TIC20</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 725</td><td>TIC20</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 726</td><td>TIC20</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 727</td><td>TIC20</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 728</td><td>TIC20</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 729</td><td>TTCíó</td><td>Amaranthus hybrídus</td><td>CDNA</td>

<td> 730</td><td>TIC20</td><td>Amaranthus Lívídus</td><td>CDNA</td>

<td>73L</td><td>TIC20</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 732</td><td>TIC20</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 733</td><td>TIC20</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 734</td><td>TIC20</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 735</td><td>TIC20</td><td>Rudis amaranthus</td><td>CDNA</td>

<td> 736</td><td>TIC20</td><td>Rudis amaranthus</td><td>GDNA</td>

<td> 737</td><td>TIC20</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 738</td><td>TIC20</td><td>Thimbergi Amaranthus!</td><td>CDNA</td>

<td> 739</td><td>TIC20</td><td>Amaranthus vísís</td><td>CDNA</td>

<td> 740</td><td>TIC20</td><td>Ambrosia artemi yes ifolia</td><td>GDNA</td>

<td> 741</td><td>TIC20</td><td>Trifid ambrosia</td><td>CDNA</td>

<td> 742</td><td>TIC20</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 743</td><td>TIC20</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 744</td><td>TIC20</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 745</td><td>TIC20</td><td>Chenopodíum albura</td><td>CDNA</td>

<td> 746</td><td>TIC20</td><td>Ccaaraelina diffusa</td><td>CDNA</td>

<td> 747</td><td>TIC20</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 748</td><td>TIC20</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 749</td><td>TIC20</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 750</td><td>TIC20</td><td>Digitaria sanguínalis</td><td>CDNA</td>

<td> 751</td><td>TIC20</td><td>Echinochloa Colona</td><td>CDNA</td>

<td> 752</td><td>TIC20</td><td>Echinochloa crus-gallí</td><td>CDNA</td>

<td> 753</td><td>IIC20</td><td>Eupborbia heterophylla</td><td>CDNA</td>

<td> 754</td><td>TIC20</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 755</td><td>TIC20</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 756</td><td>TIC20</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 757</td><td>TIC20</td><td>Ipomoea hederacea</td><td>AMtc</td>

<td> 758</td><td>TIC20</td><td>Kochia scoparía</td><td>GDNA</td>

<td> 759</td><td>TIC20</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 760</td><td>TIC20</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 761</td><td>TIC20</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 762</td><td>TIC20</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 763</td><td>TIC20</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 764</td><td>IIC20</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 765</td><td>TIC20</td><td>Senna obtusifolía</td><td>CDNA</td>

<td> 766</td><td>TIC20</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 767</td><td>TIC20</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 768</td><td>TIC20</td><td>Offical Taraxacum</td><td>GDNA</td>

<td> 769</td><td>TIC20</td><td>Trífolium repens</td><td>GDNA</td>

<td> 770</td><td>TIC20</td><td>Xanthium strumaríum</td><td>CDNA</td>

<td> 771</td><td>TIC20</td><td>Xanthium strumaríum</td><td>CDNA</td>

<td> 772</td><td>TIC21</td><td>Theophrastí abutilón</td><td>CDNA</td>

<td> 773</td><td>TIC21</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td> 774</td><td>TIC21</td><td>Theophrastí abutilón</td><td>GDNA</td>

<td> 775</td><td>TIC21</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 776</td><td>TIC21</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 777</td><td>TIC21</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 778</td><td>TIC21</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 779</td><td>TIC21</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 780</td><td>TIC21</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 781</td><td>TIC21</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 782</td><td>TIC21</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 783</td><td>TIC21</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 784</td><td>TIC21</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 785</td><td>TIC21</td><td>Amaranthus rudis</td><td>GDNA</td>

<td></td><td>TIC21</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 787</td><td>TIC21</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 788</td><td>TIC21</td><td>Amaranthus thunbergií</td><td>CDNA</td>

<td> 789</td><td>TIC21</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 790</td><td>TIC21</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 791</td><td>TIC21</td><td>Ambrosia artemisiifolía</td><td>GDNA</td>

<td> 792</td><td>TIC21</td><td>Ambrosia artemisiifolía</td><td>GDNA</td>

<td> 793</td><td>TIC21</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 794</td><td>TIC21</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 795</td><td>TIC21</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 796</td><td>TIC21</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 797</td><td>ΤΙ «1</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 798</td><td>TIC21</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 799</td><td>TIC21</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 800</td><td>TIC21</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 801</td><td>TIC21</td><td>Chenopodium album</td><td>CDNA</td>

<td> 802</td><td>TIC21</td><td>Commelina Diphusa</td><td>CDNA</td>

<td> 803</td><td>TIC21</td><td>Ctonvolvulus arvensis</td><td>CDNA</td>

<td> 804</td><td>TIC21</td><td>Conyza Canadensís</td><td>CDNA</td>

<td> 805</td><td>TIC21</td><td>Conyza Canadensís</td><td>GDNA</td>

<td> 806</td><td>TIC21</td><td>Cypertis Scalentas</td><td>GDNA</td>

<td> 807</td><td>TIC21</td><td>Cyperus escalentus</td><td>GDNA</td>

<td> 808</td><td>TIC21</td><td>Digititar sanguinalís</td><td>CDNA</td>

<td> 809</td><td>TIC21</td><td>I would say sanguinalís</td><td>GDNA</td>

<td> 810</td><td>TIC21</td><td>I would say sanguinalís</td><td>GDNA</td>

<td> 811</td><td>TIC21</td><td>Echinochloa Colona</td><td>CDNA</td>

<td> 812</td><td>TIC21</td><td>Echinochloa crus-galli</td><td>CDNA</td>

<td> 813</td><td>TIC21</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 814</td><td>TIC21</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 815</td><td>TIC21</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 816</td><td>TIC21</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 817</td><td>TIC21</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 818</td><td>TIC21</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 819</td><td>TIC21</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 820</td><td>TIC21</td><td>Kochía scoparia</td><td>GDNA</td>

<td> 821</td><td>TIC21</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 822</td><td>TIC21</td><td>Lolíum arundinaceum</td><td>GDNA</td>

<td> 823</td><td>TIC21</td><td>Loline rigidium</td><td>GDNA</td>

<td> 824</td><td>TIC21</td><td>Loline rigidium</td><td>GDNA</td>

<td> 825</td><td>TIC21</td><td>Loline rigidium</td><td>GDNA</td>

<td> 826</td><td>TIC21</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 827</td><td>TIC21</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 828</td><td>TIC21</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 829</td><td>TIC21</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 830</td><td>TIC21</td><td>Setaria viridís</td><td>CDNA</td>

<td> 831</td><td>TIC21</td><td>Sorghum halepense</td><td>CDNA</td>

<td> 832</td><td>TIC21</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 833</td><td>TIC21</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 834</td><td>TIC21</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 835</td><td>TIC21</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 836</td><td>TIC21</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 837</td><td>TIC21</td><td>Trífolium repens</td><td>GDNA</td>

<td> 838</td><td>TIC21</td><td>Trifolium repens</td><td>GDNA</td>

<td> 839</td><td>TIC21</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 840</td><td>TIC21</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 841</td><td>TIC40</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 842</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 843</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 844</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 845</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 846</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 847</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 848</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 849</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 850</td><td>TIC40</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 851</td><td>TIC40</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 852</td><td>TIC40</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 853</td><td>TIC40</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 854</td><td>TIC40</td><td>Amaranthus chiorostaohys</td><td>CDNA</td>

<td> 855</td><td>TIC40</td><td>Amaranthus graeciians</td><td>CDNA</td>

<td> 856</td><td>TIC40</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 857</td><td>TIC40</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> ¿58</td><td>TIC40</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 859</td><td>TIC40</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td></td><td>TIC40</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 861</td><td>TIC40</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 862</td><td>TIC40</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 863</td><td>TIC40</td><td>Amaranthus Palmeri</td><td>ÁbNg</td>

<td> 864</td><td>TIC40</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 865</td><td>TIC40</td><td>Amaranthus rudis</td><td>M> Hg</td>

<td> 866</td><td>TIC40</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 867</td><td>TIC40</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 868</td><td>TIC40</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 869</td><td>TIC40</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 870</td><td>TIC40</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 871</td><td>TIC4Ó</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 872</td><td>TIC40</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 873</td><td>TIC40</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 874</td><td>TIC40</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 875</td><td>TIC40</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 876</td><td>TIC40</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 877</td><td>TIC4O</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 878</td><td>TIC40</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 879</td><td>TIC40</td><td>Ambrosia trifida</td><td>GDNA</td>

<td>S80</td><td>TIC40</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 881</td><td>TIC40</td><td>Ambrosia trifida</td><td>GDNA</td>

<td>sas</td><td>TIC4A</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 883</td><td>TIC40</td><td>Chenopodíura albura</td><td>CDNA</td>

<td> 884</td><td>TIC40</td><td>Gonimelina diffusa</td><td>CDNA</td>

<td> 885</td><td>TIC40</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 886</td><td>TIC40</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 887</td><td>TIC40</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td>88Θ</td><td>TIC40</td><td>Echinochloa colana</td><td>CDNA</td>

<td>S39</td><td>TIC40</td><td>Echinochloa crus-galli</td><td>CDNA</td>

<td> 890</td><td>TIC40</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 891</td><td>TIC40</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 892</td><td>TIC40</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 893</td><td>TIC40</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 894</td><td>TIC40</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td>S95</td><td>TIC40</td><td>Arundinacea fescue</td><td>GDNA</td>

<td> 896</td><td>TIC40</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td>S97</td><td>TIC40</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 898</td><td>TIC40</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 899</td><td>TIC40</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 900</td><td>TIC40</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 901</td><td>TIC40</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 902</td><td>TIC40</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 903</td><td>TIC40</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 904</td><td>TIC40</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 905</td><td>TIC40</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 906</td><td>TIC40</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 907</td><td>TIC40</td><td>Sorghum halepense</td><td>CDNA</td>

<td> 909</td><td>TIC40</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 909</td><td>TIC40</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 910</td><td>TIC40</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 911</td><td>TIC40</td><td>Trifolium repens</td><td>GDNA</td>

<td> 912</td><td>TIC 40</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 913</td><td>SPP</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 914</td><td>SPP</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 915</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 916</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 917</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 918</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 919</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 920</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 921</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 922</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 923</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 924</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 925</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 926</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 927</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 929</td><td>SPP</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 930</td><td>SPP</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 931</td><td>SPP</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 932</td><td>SPP</td><td>Alopecurus myosuroides</td><td>CDNA</td>

<td> 933</td><td>SPP</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 934</td><td>SPP</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 935</td><td>SPP</td><td>Amaranthus albus</td><td>CDNA</td>

<td> 936</td><td>SPP</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 937</td><td>SPP</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 939</td><td>SPP</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 939</td><td>SPP</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 940</td><td>SPP</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 941</td><td>SPP</td><td>Amaranthus hybrídus</td><td>CDNA</td>

<td> §42</td><td>SPP</td><td>Amaranthus hybrídus</td><td>CDNA</td>

<td> 943</td><td>SPP</td><td>Amaranthus hybrídus</td><td>CDNA</td>

<td> 944</td><td>SPP</td><td>Amaranthus hybrídus</td><td>CDNA</td>

<td> 945</td><td>SPP</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 946</td><td>SPP</td><td>áaaranthus livid</td><td>CDNA</td>

<td> 947</td><td>SPP</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 949</td><td>SPP</td><td>Livid Amaranthus</td><td>CDNA</td>

<td> 950</td><td>SPP</td><td>Amaranthus paimeri</td><td>CDNA</td>

<td> 951</td><td>SPP</td><td>Amaranthus paimeri</td><td>GDNA</td>

<td> 952</td><td>SPP</td><td>Amaranthus paimeri</td><td>GDNA</td>

<td> 953</td><td>SPP</td><td>Amaranthus paimeri</td><td>GDNA</td>

<td> 954</td><td>SPP</td><td>Amaranthus paimeri</td><td>GDNA</td>

<td> 955</td><td>SPP</td><td>Amaranthus paimeri</td><td>GDNA</td>

<td> 956</td><td>SPP</td><td>Amaranthus paimeri</td><td>GDNA</td>

<td> 957</td><td>SPP</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 959</td><td>SPP</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 959</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 960</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 961</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 962</td><td>SPP</td><td>Antaranthus rudis</td><td>GDNA</td>

<td> 963</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 964</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 965</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 966</td><td>SPP</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 967</td><td>SPP</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 968</td><td>SPP</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 969</td><td>SPP</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 970</td><td>SPP</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 971</td><td>SPP</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 972</td><td>SPP</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 973</td><td>SPP</td><td>Amaranthus thunbergii</td><td>CDNA</td>

<td> 974</td><td>SPP</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 975</td><td>SPP</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 976</td><td>SPP</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 977</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 978</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 979</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 980</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 981</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 982</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 983</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 984</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 985</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 986</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 937</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 988</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 989</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 990</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 991</td><td>SPP</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 992</td><td>SPP</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 993</td><td>SPP</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 994</td><td>SPP</td><td>Trifid ambrosia</td><td>CDNA</td>

<td> 995</td><td>SPP</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 996</td><td>SPP</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 997</td><td>SPP</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 998</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 999</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1000</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1001</td><td>SPP</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1002</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1003</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1004</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1005</td><td>SPP</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1006</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1007</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1008</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1009</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1010</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1011</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1012</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1013</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1014</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1015</td><td>SPP</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1016</td><td>SPP</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1017</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td>1Ο1Β</td><td>SPP</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1019</td><td>SPP</td><td>Avena fatua</td><td>CDNA</td>

<td> 1020</td><td>SPP</td><td>Chenopodíum album</td><td>CDNA</td>

<td> 1021</td><td>SPP</td><td>Chenopodíum album</td><td>CDNA</td>

<td> 1022</td><td>SPP</td><td>Convolvulus arvensís</td><td>CDNA</td>

<td> 1023</td><td>SPP</td><td>Conyza Canadensís</td><td>CDNA</td>

<td> 1024</td><td>SPP</td><td>Conyza Canadensís</td><td>GDNA</td>

<td> 1025</td><td>SPP</td><td>Cyperus Scalentas</td><td>AÜÑg</td>

<td> 102 6</td><td>SPP</td><td>Cyperus Scalentas</td><td>GDNA</td>

<td> 1027</td><td>SPP</td><td>Digitar sanguinalis</td><td>CDNA</td>

<td>102 B</td><td>SPP</td><td>Digitar sanguinalis</td><td>CDNA</td>

<td> 1029</td><td>SPP</td><td>Digitar sanguinalis</td><td>GDNA</td>

<td> 1030</td><td>SPP</td><td>Digitar sanguinalis</td><td>GDNA</td>

<td> 1031</td><td>SPP</td><td>Digitar sanguinalis</td><td>GDNA</td>

<td> 1032</td><td>SPP</td><td>Digitar sanguinalis</td><td>GDNA</td>

<td> 1033</td><td>SPP</td><td>Echinochloa Colona</td><td>CDNA</td>

<td> 1034</td><td>SPP</td><td>Echinochloa Colona</td><td>CDNA</td>

<td> 1035</td><td>SPP</td><td>Echinochloa crus-galli</td><td>CDNA</td>

<td> 1036</td><td>SPP</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 1037</td><td>SPP</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 1038</td><td>SPP</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 1039</td><td>SPP</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1040</td><td>SPP</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1041</td><td>SPP</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1042</td><td>SPP</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1043</td><td>SPP</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1044</td><td>SPP</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1045</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1046</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1047</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1048</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1049</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1050</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1051</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td>1YES</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1053</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1054</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1055</td><td>SPP</td><td>Festuca arundinacea</td><td>GDNA</td>

<td> 1056</td><td>SPP</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 1057</td><td>SPP</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td>105B</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1059</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1060</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1061</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1062</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1063</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1064</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1065</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1066</td><td>SPP</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1067</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1066</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1069</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1070</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1071</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1072</td><td>SPP</td><td>Lolium arundmaceum</td><td>GDNA</td>

<td> 1073</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1074</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1075</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1076</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1077</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1070</td><td>SPP</td><td>Lolium arundmaceum</td><td>GDNA</td>

<td> 1079</td><td>SPP</td><td>Lolium arundínaceum</td><td>GDNA</td>

<td> 1000</td><td>SPP</td><td>Lolium arundmaceum</td><td>GDNA</td>

<td> 1001</td><td>SPP</td><td>Lolium arundinaceum</td><td>GDNA</td>

<td> 1002</td><td>SPP</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 1083</td><td>SPP</td><td>Lolium multiflorum</td><td>CDNA</td>

<td> 1084</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1085</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1006</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1007</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1000</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1089</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1090</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1091</td><td>SPP</td><td>Lolium multiflorum</td><td>GDNA</td>

<td> 1092</td><td>SPP</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 1093</td><td>SPP</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 1094</td><td>SPP</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 1095</td><td>SPP</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 1096</td><td>SPP</td><td>Lolium rigidium</td><td>GDNA</td>

<td> 1097</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1090</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1099</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1100</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1101</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1102</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1103</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1104</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1105</td><td>SPP</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1106</td><td>SPP</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 1107</td><td>SPP</td><td>Sorghum halepense</td><td>CDNA</td>

<td> 1100</td><td>SPP</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 1109</td><td>SPP</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 1110</td><td>SPP</td><td>Sorghum halepense</td><td>GDNA</td>

<td>lili</td><td>SPP</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 1112</td><td>SPP</td><td>Sorghum halepense</td><td>GDNA</td>

<td> 1113</td><td>SPP</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 1114</td><td>SPP</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 1115</td><td>SPP</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 1116</td><td>SFF</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 1117</td><td>SPP</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 1110</td><td>SPP</td><td>Taraxacum officinale</td><td>GDNA</td>

<td> 1119</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1120</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1121</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1122</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1123</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1124</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1125</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1126</td><td>SPP</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1121</td><td>SPP</td><td>Trifolxum repens</td><td>GDNA</td>

<td>112 Β</td><td>SPP</td><td>Xan thxum strumarium</td><td>CDNA</td>

<td> 112 9</td><td>SPP</td><td>Xanthium s plot rhyme</td><td>CDNA</td>

<td> 1130</td><td>SPP</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 1131</td><td>TICIOO</td><td>Theophrasti abutilón</td><td>CDNA</td>

<td> 1132</td><td>TICIOO</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1133</td><td>TIC1OO</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1134</td><td>TICIOO</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1135</td><td>TICIOO</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1136</td><td>TICIOO</td><td>Amaranthus chlorostachys</td><td>CDNA</td>

<td> 1137</td><td>TICIOO</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td>113Θ</td><td>TICIOO</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 1139</td><td>TICIOO</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 1140</td><td>TICIOO</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 1141</td><td>TICIOO</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 1142</td><td>TICIOO</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1143</td><td>TICIOO</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1144</td><td>TICIOO</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1145</td><td>TICIOO</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 1146</td><td>TICIOO</td><td>Amaranthus rudis</td><td>CDNA</td>

<td> 1147</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td>114Θ</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1149</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1150</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1151</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1152</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1153</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1154</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1155</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1156</td><td>TICIOO</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1157</td><td>TICIOO</td><td>Amaranthus spínosus</td><td>CDNA</td>

<td> 1158</td><td>TICIOO</td><td>Amaranthus thunbergíi</td><td>CDNA</td>

<td> 1159</td><td>TICIOO</td><td>Amaranthus thunbergíi</td><td>CDNA</td>

<td> 1160</td><td>TICIOO</td><td>Virgin Amaranthus</td><td>CDNA</td>

<td> 1161</td><td>TICIOO</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 1162</td><td>TICIOO</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1163</td><td>TICIOO</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1164</td><td>TICIOO</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1165</td><td>TICIOO</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1166</td><td>TICIOO</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1167</td><td>TICIOO</td><td>Ambrosia trifida</td><td>CDNA</td>

<td>116Β</td><td>TICIOO</td><td>Ambrosia tri fi da</td><td>GDNA</td>

<td> 1169</td><td>TICIOO</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1170</td><td>TICIOO</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1171</td><td>TICIOO</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1172</td><td>TICIOO</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1173</td><td>TICIOO</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1174</td><td>TICIOO</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1175</td><td>TICIOO</td><td>Chenopodíum album</td><td>CDNA</td>

<td> 1176</td><td>TICIOO</td><td>Chencpodiura sapwood</td><td>CDNA</td>

<td> 1177</td><td>TICIOO</td><td>Chenopodium albura</td><td>CDNA</td>

<td> 1178</td><td>TICIOO</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 1179</td><td>TICIOO</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 1180</td><td>TICIOO</td><td>Digitaria sanguinalis</td><td>CDNA</td>

<td> 1181</td><td>TICIOO</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 1182</td><td>TIC100</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 1183</td><td>TIC100</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 1184</td><td>TIC1OO</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 1185</td><td>TICIOO</td><td>Digitaria sanguinalis</td><td>GDNA</td>

<td> 1186</td><td>TICIOO</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 1187</td><td>TICIOO</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1188</td><td>TICIOO</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 1189</td><td>TICIOO</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1190</td><td>TICIOO</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1191</td><td>TICIOO</td><td>Kochia scoparia</td><td>GDNA</td>

<td> 1192</td><td>TICIOO</td><td>Kcchia scoparia</td><td>GDNA</td>

<td> 1193</td><td>TICIOO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1194</td><td>TICIOO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1195</td><td>TICIOO</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1196</td><td>TICIOO</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 1197</td><td>TICIOO</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 1198</td><td>TICIOO</td><td>Tarazacum officinale</td><td>GDNA</td>

<td> 1199</td><td>TICIOO</td><td>Tarazacum officinale</td><td>GDNA</td>

<td> 1200</td><td>TICIOO</td><td>Taraxaoum officinale</td><td>GDNA</td>

<td> 1201</td><td>TICIOO</td><td>Taraxaoum officinale</td><td>GDNA</td>

<td> 1202</td><td>TICIOO</td><td>Trifoiium repens</td><td>GDNA</td>

<td> 1203</td><td>TICIOO</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1204</td><td>TICIOO</td><td>Trifolum repens</td><td>GDNA</td>

<td> 1205</td><td>TICIOO</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1206</td><td>TICIOO</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1207</td><td>TICIOO</td><td>Xanthium strumaríuni</td><td>CDNA</td>

<td> 1208</td><td>TIC56</td><td>Cheutilus abutilón</td><td>CDNA</td>

<td> 1209</td><td>TIC56</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1210</td><td>TIC56</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1211</td><td>TIC56</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1212</td><td>TIC56</td><td>Theophrasti abutilón</td><td>GDNA</td>

<td> 1213</td><td>TIC56</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 1214</td><td>TIC56</td><td>Amaranthus graecizans</td><td>CDNA</td>

<td> 1215</td><td>TIC5 6</td><td>Amaranthus hybridus</td><td>CDNA</td>

<td> 1216</td><td>TIC56</td><td>Amaranthus lividus</td><td>CDNA</td>

<td> 1217</td><td>TIC56</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> -218</td><td>TIC56</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1219</td><td>TIC56</td><td>Amaranthus palmen</td><td>GDNA</td>

<td> 1220</td><td>TIC56</td><td>Amaranthus roars</td><td>CDNA</td>

<td> 1221</td><td>TIC56</td><td>Amaranthus roars</td><td>GDNA</td>

<td> 1222</td><td>TIC56</td><td>Amaranthus roars</td><td>GDNA</td>

<td> 1223</td><td>TIC56</td><td>Amaranthus roars</td><td>GDNA</td>

<td> 1224</td><td>TIC56</td><td>Amaranthus roars</td><td>GDNA</td>

<td> 1225</td><td>TIC56</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1226</td><td>TIC56</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 1227</td><td>TIC56</td><td>Amaranthus rudis</td><td>GDNA</td>

<td> 122 8</td><td>TIC56</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 1229</td><td>TIC56</td><td>Amaranthus spinosus</td><td>CDNA</td>

<td> 1230</td><td>TIC5 6</td><td>Amaranthus thunbergn</td><td>CDNA</td>

<td> 1231</td><td>TIC56</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 1232</td><td>TIC56</td><td>Amaranthus viridis</td><td>CDNA</td>

<td> 1233</td><td>TIC56</td><td>Ambrosia artemisisifolia</td><td>GDNA</td>

<td> 1234</td><td>TIC56</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1235</td><td>TIC56</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1236</td><td>TIC56</td><td>Ambrosia artemisiifolia</td><td>GDNA</td>

<td> 1237</td><td>TIC56</td><td>Ambrosia trifida</td><td>CDNA</td>

<td> 1238</td><td>TIC56</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1239</td><td>TIC56</td><td>Ambrosia trifida</td><td>GDNA</td>

<td> 1240</td><td>TIC56</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1241</td><td>TIC56</td><td>Trifid ambrosia</td><td>GDNA</td>

<td> 1242</td><td>TIC56</td><td>Chenopodium album</td><td>CDNA</td>

<td> 1243</td><td>TIC56</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 1244</td><td>TIC56</td><td>Conyza Canadensis</td><td>CDNA</td>

<td> 1245</td><td>TIC56</td><td>Conyza Canadensis</td><td>GDNA</td>

<td> 1246</td><td>TIC56</td><td>Digitaria sanguinalís</td><td>CDNA</td>

<td> 1247</td><td>TIC56</td><td>Digitaria sanguinalís</td><td>GDNA</td>

<td> 1248</td><td>TIC56</td><td>Digitaria sanguinalís</td><td>GDNA</td>

<td> 1249</td><td>TIC56</td><td>Euphorbia heterophylla</td><td>CDNA</td>

<td> 1250</td><td>TIC56</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1251</td><td>TIC56</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1252</td><td>TIC56</td><td>Euphorbia heterophylla</td><td>GDNA</td>

<td> 1253</td><td>TIC56</td><td>Ipomoea hederacea</td><td>CDNA</td>

<td> 1254</td><td>TIC56</td><td>Kochia would collect</td><td>GDNA</td>

<td> 1255</td><td>TIC56</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1256</td><td>TIC56</td><td>Oleanaceous Portulaca</td><td>GDNA</td>

<td> 1257</td><td>TIC56</td><td>Senna obtusifolia</td><td>CDNA</td>

<td> 1258</td><td>TIC56</td><td>Spirodela polyrrhiza</td><td>GDNA</td>

<td> 1259</td><td>TIC56</td><td>Taraxacum offícinale</td><td>GDNA</td>

<td> 1260</td><td>TIC56</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1261</td><td>TIC56</td><td>Trifolium repens</td><td>GDNA</td>

<td> 1262</td><td>TIC56</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 1263</td><td>TIC56</td><td>Xanthium strumarium</td><td>CDNA</td>

<td> 1584</td><td>HSP70</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 1585</td><td>HSP70</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1586</td><td>HSP70-1</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 1587</td><td>Η3Ρ70-1</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td>15ΘΒ</td><td>HSP70-1</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1589</td><td>HSP70-1</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1590</td><td>HSP70T-1</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1591</td><td>HSP70T-1</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1592</td><td>HSP70T-1</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1593</td><td>HSP70T-2</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1594</td><td>HSP70T-2</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1595</td><td>HSP70T-2</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1596</td><td>HSP93III</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1597</td><td>HSP93IIIb</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1598</td><td>HSP93IIIb</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1599</td><td>HSP93IIIb</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1600</td><td>HSP93IIIb</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1601</td><td>HSP93IIIb</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 1602</td><td>HSP93IIIb</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 1603</td><td>HSP93V</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 1604</td><td>HSP93V</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1605</td><td>HSP93V</td><td>Amaranthus palmer!</td><td>CDNA</td>

<td> 1606</td><td>HSP93V</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1607</td><td>HSP93V</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1608</td><td>HSP93V</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1609</td><td>TIC22-liJre</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1610</td><td>TIC22-lilce</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1611</td><td>TIC22-liJrel</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1612</td><td>TIC22-llkel</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1613</td><td>TIC22-like2</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1614</td><td>TIC22-like2</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1615</td><td>TIC22-like2</td><td>Amaranthus paleen</td><td>GDNA</td>

<td> 1616</td><td>TIC55II</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1617</td><td>TIC55II</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td>161S</td><td>TIC55II</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1619</td><td>TIC55II</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1620</td><td>TIC55IV</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1621</td><td>TIC55IV</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1622</td><td>TIC55IV</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 162 3</td><td>TIC55IV</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1624</td><td>TIC62</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1625</td><td>ICT 62</td><td>Amaranthus palmen</td><td>GDNA</td>

<td> 162 6</td><td>TIC 6 2</td><td>Amaranthus palmer!</td><td>GDNA</td>

<td> 1627</td><td>TIC62</td><td>Amaranthus palmen</td><td>GDNA</td>

<td> 1628</td><td>T0C64I</td><td>Amaranthus palmen</td><td>CDNA</td>

<td> 162 9</td><td>T0C64I</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1630</td><td>T0C64III</td><td>Amaranthus palmen</td><td>CDNA</td>

<td> 1631</td><td>T0C64III</td><td>Amaranthus palmen</td><td>GDNA</td>

<td> 1632</td><td>TOC64III</td><td>Amaranthus Palmeri</td><td>GDNA</td>

<td> 1633</td><td>TOC64V</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1634</td><td>T0C64V</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1635</td><td>TOC64V</td><td>Amaranthus Palmeri</td><td>CDNA</td>

<td> 1636</td><td>TOC64V</td><td>Amaranthus palaen</td><td>GDNA</td>

<td> 1637</td><td>T0C64V</td><td>Amaranthus pslíieri</td><td>GDNA</td>

<td> 1638</td><td>TOC64V</td><td>Amaranthus Palmeri</td><td>GDNA</td>

EXAMPLE 2

Homologous polynucleotide molecules in weed species

The gene sequences and fragments of SEQ ID NO: 1-1263 were compared and 25-mers of contiguous polynucleotides were identified that have homology through the various gene sequences for each series of genes in the chloroplast protein import system and through of the various target weed species. The purpose is to identify activating polynucleotide molecules that are useful alone or in combination with a herbicide to provide improved weed control over a range of weed species, including glyphosate and other herbicide resistant weed biotypes. The method can be applied to any series of target gene sequences to identify activating polynucleotides common to more than one weed species. The method can also be applied to identify medium-length activating polynucleotides, for example 26-mer, 27-mer, 28-mer, 29-mer, 30-mer, 31-mer, 32-mer, 33-mer, 34- mer, 35-mer, 36-mer, 37-mer, 38-mer, 39-mer, 40-mer, 41-mer, 42-mer, 43-mer, 44-mer, 45mer, 46-mer, 47- mer, 48-mer, 49-mer, 50-mer, 51-mer, 52-mer, 53-mer, 54-mer, 55-mer, 56-mer, 57-mer, 58-mer, 59-mer, 60-mer, common to more than one species of weeds.

The sequences shown in Table 2 represent the 25-mers of the respective gene sequences in SEQ ID NO: 1-1263 that have homology to eight or more weed species. It is contemplated that other 25-mers may be selected from the gene sequences that are specific for a single weed species or some weed species within a genus or activating polynucleotide molecules that have at least 19 contiguous nucleotides and at least 85 percent identical to a gene sequence of SEQ ID NO: 1-1263.The 25-mer oligonucleotides are combined in a cumulative set of 5-10 polynucleotides and tested for efficacy against the wide range of weed species in which the polynucleotide is essentially identical or essentially complementary to a gene sequence in 10 the genome of the weed species treated. Effective assemblies are divided into smaller series of 2-3 polynucleotides or individually tested to determine efficacy. Each set of polynucleotides is prepared with the transfer agent and applied to a plant or a field of plants in combination with a herbicide, or followed by a herbicide treatment one to three days after the application of the oligonucleotide, to determine the effect in the 15 susceptibility of the plant to the herbicide. The effect is measured as growth retardation and / or elimination of the plant and is measured 8-14 days or 21 days after treatment with the polynucleotide assembly and the herbicide.

TABLE 2

Activating polynucleotides of the plant chloroplast import system gene

<td>SDQ ID NO</td><td>Sec</td><td>G «e¡</td><td>Number of species</td><td>Species</td>

<td></td><td>TTTGGTAATGJATGSGGTTGSeC G ~</td><td>cepsci</td><td>and</td><td>Amaranthus graeci aass F Amaranthus hybrí.dus, Amaranthus lividus, ^ ££££ * aaChus palmer !, Amaranthus rudis, Amaranthus spfjiasas r Amaranthus viridis, Chenopodiura albura</td>

<td> 12 «5</td><td>TTGGTAATGJUITGTGGTTGA & CGTG</td><td>donkey</td><td>g</td><td>AEjríflthur graecisans, Amaranthus hjrb & iáas rÁzzFzazhvis Lívídus tThey will love thus palmes »! F• Amaran Chus rudis r Amaranthus spin-osus, Amarazxthus viridis r Oieappodicza. sapwood</td>

<td> 12</td><td>TTGATTTGGTÜZGAATGSGGTIGS.</td><td></td><td>B</td><td>You will love thus graeci «ana, AmaraatZius hybrc..duí FLivid Amaraathus. You will love fchus palmer! Amaranthus rudis, Amaranthus spiacsus, Amaranthus viridis, Ches op-odíua sapwood.</td>

<td> 1267</td><td>TGGTAAIG & A.-G-GGTTGAGCGTGr</td><td><ZM0</td><td>and</td><td>Amaranthus graecisans, Amaran ¿h as hybridus, Amaraathus livid, Amaran thus palmer !, Amaran thus rudis, Amaranthus spiacsus, Amaranthus viridis, Chencp-ndíum. album</td>

<td>I2 € 8</td><td>2GG1TTGAAGGTGATGA7AAGCGTA</td><td>OESSO</td><td>and</td><td>You will love Chus graecisans, Amaranthus hybridusFJssAsaxi'thxiz lividus, Amaran thuj palmeri, Amaranthus rudis, limaran rhus spinosus, Amaranthus viridis, fflgaqp aflítai album</td>

<td>126S</td><td>TGMTTGGTAlTGMiTGTGGTT GAG</td><td>ΟΕΣ-SI</td><td>B</td><td>Amaranthus graecisans, Amaranthus hyhr-idus, Amaranthus lividus. They will love ur palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus viridis, Chencr ^ odíus albura.</td>

<td>12.7a</td><td>TCACACKTaCAACCACATTCATTAC</td><td> 0</td><td>g</td><td>Sun's bitter graec¿> ans, fafzzznzhM, hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus raw, Colombia prickly, Amarantims green, Chenopodium album</td>

<td> 1271</td><td>TCAACCACATKATTACCAAATCAA</td><td>OEFBO</td><td>g</td><td>Amaranthus graesisans, Amaranthus hybrsdirr, Amaranthus Ixvidus, Warning th un palmeri, Amaranthus rudis, Amaranthus spxnesuz, Amaranthtis viridis, Chenopodium albura</td>

<td> 1272</td><td>TACGCTIATCATCACCTTCAATCCA</td><td>0EP8Ü</td><td> 8</td><td>Amaranthus graeeiaans, Amaran thus hybridus, Amaras th us 1ivi dus, Amaranthus pal ^ ri, Amaranthus rudis, Amaranthus spinosus, Amaranthus viridis, Chenopodius albura</td>

<td> 1273</td><td>TAATGAATGTGGTTGAGCGTGTGAG</td><td>□ EP80</td><td>B</td><td>Amaranthus graecisans, Amaranthus hybridus.</td>

<td></td><td></td><td></td><td></td><td>Livid Amaranthus, Amaranth.US naliMPt F^ & £ ^ s & thus ffadis-, Aaaranthus spduosvs, Amaranthus víridís, Ch «wpudxus albus</td>

<td> 1274</td><td>GTTGiTTTG ^ TJULTGAATGTGGTW</td><td>DEP80</td><td> 8</td><td>ABExx'snthus g'saesíasnr, Ameraiithus hyfarídus, livid Amaranthus, Amaranthus palmer! , Amaranthus rudís, Amaranthus spín-ssus, Amaranthus víridís, Chenepodius albus</td>

<td> 1275</td><td>GTACGCTTATCATCACCTTCAATCC</td><td>OE ^ íO</td><td> 8</td><td>Awtíatflus gtíerizínj, They will love thus hybrids, Livid Amaranthus, They will love trun palme rx, Arz-aranihus rudís, Aaaranthus spinosus, Aaaranthus víridís, Chen-opodius albas</td>

<td> 1275</td><td>GTAATGAATGTGGTTGa.GCGTGTGA</td><td>OEF8Q</td><td> 8</td><td>Amaran thus jrierisjr.j, ^ tírísiáu; hybridst Amaran th as livid, Amaran thus palaerí, Amaran thus rudís, Amaranthus spxnrsus, Amaranthus víridís, C & ea-opodi ua album</td>

<td> 1277</td><td>GGTAATG2LATGTGGTTGAGCGTGTG</td><td>OEFBO</td><td> 8</td><td>ñasrsn thus crjerisár ^, Amsraathus iLybxidizs rfi ^ nsathas Ixvxdus, Love £ palstesi bus tAt & szsnthüs mdís-f Aaáráníhus rpíausus, Am ^ raathur rirídís, Ós.encpodxuM il-buas</td>

<td> 1278</td><td>GGTaA & GTTS & TTTSGTAlTGJÜTG</td><td>OE ^ SO</td><td> 8</td><td>Aburilen cheophr <scx, fis & a & sa th us gr «-ec¿ s¿ns, Asaras rh us hyhr id'-is, Ascxrau th us lírí-dus, ÁE * r-.n “hus p.Jjoerx ^ Amer & nthus rudís, Am ^ r ^ nchus spxnesus, As ^ rüjrhus víridís</td>

<td> 1279</td><td>Í ^ TTG & AG ^ T ^ TCATAaGCGT & C</td><td>0EF30</td><td>to</td><td>Am ^ r & urhus grrAerxs-ens, Asaras thus hybrxdus F Asaras tdus 2 ¿vxdus, Azsaranrhus paZraerx, Asaran íhus rudís, A¡s¿ran £ hus spínus, Amaranthus rírxdxs, ChenepodíuM albus</td>

<td> 1285</td><td>GCTCAACCACATTCATTACCAAATC</td><td>OEFBQ</td><td>p</td><td>Azsaranthus gr «eci an: Asaranshas hybrídus, Jtaarantbus livid, Asaraaebus palaeri, Amaranthus rudís, Amaranthus spínss'us, Amaranthus vridís, Chenpp-odius albus</td>

<td> 1281</td><td>GATTT ^ TAATGAATGTGGTTGAGC</td><td>ΟΞΡ30</td><td> 8</td><td>Amaran thus crraecxzans, Jbxaranthus hybrídus, Axsaran thus 2 i vidus ,. Amaranthus palmerx, Amaranthus rudís, Amaranthus sEiaosus, Amaranthus víridís, ührnopodxus albus</td>

<td> 1282</td><td>CTC & CACGCTCAACCACATTC5CTA</td><td> 0080</td><td> 8</td><td>Asaran th us rra e si si r. ', Amaranthus hybridus, Livid Amaranthus, Amaranthus palmer i, Amaranthus rudís, Amaranthus spinosus, Amaranthus víridís, Chtíwrtdxus albus</td>

<td> 1282</td><td>CTaUW2CaCA2TCATX & CCA & ATC &</td><td>ΟΞΡ80</td><td> 8</td><td>Amaran th us graesí tans, They will love thus hybri dus,</td>

<td></td><td></td><td></td><td></td><td>Saran thus 1 x vz das.s. , Aeraashus palBuezi., Jtos & rasithtis rudis, ¿znjrenthur sp¿xiosus, ¿aaasATkth. ' as viridxs, Chenopedzuss alfana.</td>

<td> 1284</td><td>TT TCCACCCTCATC7T-GATC Τ CC7</td><td>TTC1Ü0</td><td> 9</td><td>Will th th usr hl © res te chys FZüsas & zithus cFraecxsans, ώκζζπ thus ¿íyb ^ i.'diís _ ,. A & ssathus Ixvxdiis, Will T. Tiuíz Palnseri, ¿Earaa .thu s rudLs, ¿airaníhur SpXHOSUS, ¿merenthus thunbergxi, miranthus riridis</td>

<td> 128-5</td><td>TTTaGCTTCMCGJtóTTTCGGGTCT</td><td>Ticiao</td><td> 9</td><td>¿Saran i & as chlores techys FNarant & us gxaeexsens, Did thsx s hybrx.dus rum,. Amaranthus li ^ xdiss, Palm tree F fysa & snthus zudis, ^ mazszthus spznesvs., sux '^ th'uir £ huabergzxr'rxx.idís</td>

<td> ¿286-</td><td>TTCTGGTACGGCT & CATG & T7CATG</td><td>TIC10C</td><td> 9</td><td>.Í £ eeZ »to Xhus chlosOS r-echys F^ & £ zsathüs ^ eecxr ^ a ^, && is ^ azhüs ¿yisxxdiss, ^ arentrent lividas, Amax «a thus pxlnseri F^ s & s ^ xath ^ s ru <áx.5> iSsúirdne & ur 5pBBStSt.s F & ur¿stin2¿r eiuaber ^ xi, ^ ear ^ afc & ax vizxdis</td>

<td> 1287</td><td>TTCC & CCCTCATCTTTGATCTCCTC</td><td>TICIO'J</td><td> &</td><td>Α®βχ · * ηίΛΒ5 ZAcays, fasa'szn xhuí ^ xsAecxxaas F& ssacs.nthu5 iiybzx.dus, Sazrast.aus Iz'rz-d'zx, A »aa? Aathu5 '^ aZ« erxF& sazr & a £ ¿iuf radu, ¿auz'azitx.izz apxaaxux ,, Aí'sxr ^ rtehux thuahex '^ rzi ^ Anixx'jznih.L'r vixidis</td>

<td> 12.8'8</td><td>ZTCCAOATGMTCATGTÁGCC-GTAC</td><td>TICiüC</td><td> 9</td><td>Aa ^ r'xnthus ehieres techys, Aiseranthus CFreecxsens ^ Asax-aathus hybrxdiís FAx & aTrzsithus IzTxdts, .Iiseranthus pelserx FAzMrxathBS rudir, do fflirjnsiur spxnosns, jlmereashus táunhez-crzz, ^ reashus viriazs</td>

<td> 128$</td><td>rraiCGAGTTTCGGGTCTGTTTCA</td><td>TICIOj</td><td> 9</td><td>& Barea £ iiu5 celeres tec-hys FOsaren th.ua graecxtesr, «Eren rhus hyhtz-dus ¿Asaren rh us livxtEuar, ¿Asaran Thua Palmerx ,, ¿Seranthus roas, ¿Meranthus spiBosos ^ ¿Merantrus thunhergrxi, serarthus ^ iridia</td>

<td> 1250</td><td>TTAGCTTCKTCGXGTTTCGCGTCTG</td><td>TI.C100</td><td> 9</td><td>© oren th usc Jsl © res te chyz r&& s.s? & atíii¿s ^ reerxsans, Maron thus Hybrishss, Earentaus lividus, Do they dwell thus po2n »rx, ¿Maranthus Rudis, ¿Nsarenthas Spizxesus, ¿Inereashus thunber ^ rxx, do maranthus rxridis</td>

<td> 1291</td><td>TTACTTCTGGTACGGCTACATGATT</td><td>TIC1OG</td><td> 9</td><td>Will it be chlorestaehys, Saranthus araeexsan.s,</td>

<td></td><td></td><td></td><td></td><td>Aaaraschus hyhridttg, .Asaron Chus lividus. Asaran Chus J ^ acaathas roas-,, Amarenrhus SplSlOSUS, AflXaranCJíUS rhuaberyii., Amarantius vari di s</td>

<td> 1292</td><td>TGGTACGGCTACATGATTCATG ”GG</td><td>TIC1Q1</td><td>s</td><td>&&& 3ZAa have you chl oros ta chys? & ΖΛ, Σ? · Αα £ ίίαζ graecl sans F. ^. sz'isnthus hybridixs F% & £ X! S £ LthMS ÜvidlSS tAsaran Chus palmer! tAsaranChus rudxs, Amaranthus .spisosus, Amaranrhus thunbergii .. Aisaraathus viridis</td>

<td> 1293</td><td></td><td>TC10Ü</td><td> 9</td><td>AwriEtAus gr-aeor healthy, $ s & z <asithxi-s hj ^ ridns. Asaron ehue Xivi I will say, Asaran th us palmer! Aa ^ s-sníhus roras, AmaranChus spinosus, Aisaraschus riunbergü t Asaranthur T-lridis, Can5 ^ a canadensís</td>

<td> 1299</td><td>ZaTTaSCTTClTCGiGTrTCGGG</td><td>TIC1OO</td><td> 9</td><td>Asaran th us chl oros ra cáys tAseranddus graecisansF.Asaran Chus hybrídiss ,. Asaran Chus li vi dixs, Asaranch-us palmer! AsaranChus rudis ^ Amaranthus sp! Nosusz Aisaranthus thtxabergi.!, Aisaranrhus viridis</td>

<td> 1295</td><td>TGATGATTTAGCTTCATCGAGTTTC</td><td>TICIOO</td><td> 9</td><td>Asaranchus chlorosra chys Fgraeci sane, Asaran Ch us hybri dssF.Asaran. Chus livldusFAsaran Chus palmer! Asaran Chus rudir., Amaranrhus jpxaasw, Afsarasthtxs thuaberg ·. !!, Amaranth-us viridís</td>

<td> 1296</td><td>7GiTGAGATTTAC-CTCATC-GÁG “</td><td>¿ZC1QT</td><td>G</td><td>Asaranthus chlaresfcachys ,. Asaranthus ^ raeci sans Asaranthus hybridixs, Asarsnchus lividm, Asaranthus Nelmeri Asaranthus rudis »Amaranthus say so, Amaranthus rhuahergiiF Amoranthus viridis</td>

<td> 1297</td><td>TGATGATGATGATTTAGCTTCATCG</td><td>ticigg</td><td>Q</td><td>Asaran ch us chlorosrachy s, Iasií '& a th us graeci healthy, Asaranchus .hyhxidus. Asaran Chus Xividus, Asaranthus palme rx, Asaran Chus rud! S_F Asaranchus spinosasF Amaranthus ChunJber ^ i! Amaranihus vlridi.s</td>

<td> 1293</td><td>TGATGATGATGATGATTTAGCTTCA</td><td>Ticiae</td><td> 9</td><td>Asaranchus Rhlocoorachj's. Asaran Chus g'raecx sajir, Asaras Chus ht'jbrxiiuo, AsaranChus liridus, Asaran Chus palmer! Asaranthus ¿* udisz Amaranthus opin-osus ^ Amaranth'us Chuabergri! Amaranthus viridio</td>

<td> 1299</td><td>TGAATCATGTAGCCGTACCAGAAGT</td><td>TTCIDO</td><td>Q</td><td>Asaranchus cixcrostifr.yí,</td>

<td></td><td></td><td></td><td></td><td>Asarant / lUS ^ TiSií »215. 3s & zssnthi¿s .hybr-xdut, Asaranthus Ixvxdus, AsaxantjlU.5 Bjjmprt Asaraatnar rudí-r, Asarant hux spxnoruf, AsarantSut t & wshergríí, 3rasraat¿u5 vi ri di 5</td>

<td>lao ·:</td><td>IGaAGCTAAATCATCAZC & TCKTCA</td><td>ZXC1.00</td><td>B</td><td>Asaran tbus ch2ox <? Rtarhy3. Afearan tac 5 ^ raecxsanr, Afearan tá us hybr i -ctiis FAsarantaus Lívxdur. They will so parlmerx, Afearan-bus rudís, Amarantbus spxnosns, Affiacanthus tbunber-níi, Amarastbus virídis</td>

<td> 1301</td><td>TGAAACA € ^ € CGAiACTCGATG-AA</td><td>lid 00</td><td>S</td><td>Afearan tau s CILLISS ^ ST »CNY FAearantbus do pcaerisans FAsaran.tiius hyhcxdus, Amaranthus 2x lives, Atearanthus palmerx, Asaranthus rudxr, Anaras ^ hur rpxno sus, Asa can £ ¿ur ehunber ^ xi ,. AnarantSur vixidis</td>

<td> 1202</td><td>TCTGGTACGGCTACÍTG3OTCA7GT</td><td>T2C100</td><td> 9</td><td>Asarantísus ehloreetarhys, Asarancárs Afearan tinas hpJbrxdus ΛAsarantAur Lívi-Dce, Afearanthus pa2®er¿, Asír-n th'jx rudír, Aaarantnux rpíjscsuc, Asarantítur tJxttabergií., AwraníAuc viridir</td>

<td> 1303</td><td>JCTGAXACAGACCCGAAACTCGiTG</td><td>TIC100</td><td> 9</td><td>Afearaarhus c¿2 © z-rrracáj * 5rAsaranínus graeriians <, Afearaatiius .hyhrid-us FAfearanehas 2i vidrr ΛAfearan tJsur jjlneri, Asaranehuis rudir ,, Asarajte & ixff rpxn ^ su sy Asaras £ hur tñunbergrii Asarazirnuc viridis</td>

<td> 1204</td><td>AGOTCTSUULTGCCCGSCGCTGTT</td><td>Ticm</td><td> 12</td><td>Aaaranthur sFrase ^ isanr Ffüs> s.x9nthusí Áybridur, Asaran tis lis lividus FAzcaraarhur pa Imeri, fiss & EAnthus rudxr ,. Asaraníhur cpxncxux, Amarasíhur tauaber-gíi Λ Anaraníhur viridix, Asbrcria trifida, Cdnyea canadenrir, digitaría rasguixsalic, iantñxora straaaciwe</td>

<td>us</td><td>J ^ C ^ GOGTCGGGCAmCAGB & GCT</td><td>ncno</td><td> 12</td><td>Asarantisur g ^ aetixant FAfearantnu ^ hphridus, Asarantla lividus. Asaranth vs Palmer!,. Asaran thus rudir, Aaaraathuc rp¿sc5urr Aoarartáux táunbercrxxr AnarantSux viridic, Ambrosia trifida, Cssysa • ran.aden.rxs., Ui ^ íría sargaina ¿isF Xan thx um stmsarimt</td>

<td>130C</td><td>TGTGCTGCTTTCCTTACAGATGCTT</td><td>rare</td><td>THE</td><td>Asaranfhus albur, Asarantbur chlomstaffhys, Asarantnur ^ raerisans, Asarantbur hybrxdur. Asaranth.cs · Ixvxd.us, Asaraatiius palmerx.</td>

<td></td><td></td><td></td><td></td><td>Amaraníhus rudis, Am-rarthus íeme SUS F Mistress Sh'Uff rail rhuaberg.it, Amaranthus viridis</td>

<td> 1307</td><td>GTGCTGCTTTCCITAC3kGS.TG <CnT</td><td>TIC110</td><td> 10</td><td>ÍSírjBtíim albus, Amaranthus C'hlokjso'.stashys, Amaranthus grieciíifii, Aaírj.nthus hyhridus, Amaranchas lividus,. As ^ & AOihus palmer !, AiEaranthur rudis, Amaranthus spiaosus, Amaranthus thuabergii, Amaranthus viridis</td>

<td> 1309</td><td>GCTTCTGAAATGCCC ^ CGCTGTTC</td><td>Have</td><td> 10</td><td>Amaranthus graeeisans, íjwrí.ntáüí hybridus, AxiriBífiu; lividus, AwrínüiLJB pilaíri, Amaranthus rudis, Amaranthus spiaosus, Amaranthus thunbergiiF Amaranthus viridis, Asbrosia trifida, ConytíA sanadensis</td>

<td> 1305</td><td>GtoCaGCCTCGSGCATTrcaGiaGC</td><td>Have</td><td> 10</td><td>Amaranthus grr <aeriüns, Amaranthus hybrldixs. Amarasrhas ¿ividus. Amaran thur palmer !, Asaran thus rudis, Amaranthus spinrsus, Amaranthus thuaJbergii, Amaranthus viridis, Ambrosia trifida, Conysa sanadensis</td>

<td> 1310</td><td>AAGZATCTGTAAGGAAAGCAGIkeA</td><td>Have</td><td> 10</td><td>Asaranthus albur, Amaranthus chlsrostachys t Amaranthus ^ saerisans, Amaranthus hybridus, Aaaranthus lividus. Amaran th us palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thusber ^ rii, Amaranthus viridis</td>

<td> 1311</td><td>AAASmXTSTA & GGAAAGCAGCAC</td><td>baby</td><td> 10</td><td>Amaranthus albur, Amaranthus chlorostarhys, AMgjnglwg graecizans, Amaranthus hybridus, Amaranthus lividus. Amaran thur palneri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1312</td><td>TTTG & GC31TATTCTGCA5GCAGCCC</td><td>IT CUS</td><td> 9</td><td>Amaranthus albur, Amaranthus graecisana, Amaranthus hybridus, Amarasthas lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus ihunbergli, Amaranthus viridis</td>

<td> 1313</td><td>7T7CTCTGCCT ^ 2AAT3AAC-CCACGG</td><td>TIC11G</td><td> 9</td><td>Amaranthus albur, Amaranthus fxaecíuas, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinesus, Amaranthus thudbexcrii, Amaranthus visidi 5</td>

<td> 1314</td><td>TTTC ^ ATGG € & ^ Aí ^: - CkTCTTT &.</td><td>baby</td><td> 9</td><td>Amaranthus albur, Amaranthus ^ raecisans, Amaranthus hybridus, Amaranthus liridus, Amatan th us palme rx, Amaranthus rudis, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>spiMsos, Amaranthus thunbergrii, .Amaranthus Fizidií</td>

<td> 1315</td><td>7TTAGACAGCAGGCCGAGGTCATTI</td><td>TICl.lv</td><td> 9</td><td>Amaranthus albus, Amaranthus graerizans, Azs ^ nghus hybridus, Amaranthus livichss, Amaranthus palmeri FRudis, Amaranthus spinesus, Amaranthus thunber ^ xx, Amaranthus viridis</td>

<td> 1215</td><td>TTGGTTCAAGCCGTGGCTTTATTGA</td><td>baby</td><td> 9</td><td>Amaranthus albur, Amaranthus graecisans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spiaesus, Amaranthus thunhesgii, Amaranthus viridis</td>

<td> 1317</td><td>TTGCTGAAGCTTCTGTCGATATATT</td><td>baby</td><td> 9</td><td>Amaranthus irhlmortarhys, Amaranthus graetizans. Amaran th us hyhridiss fa & sifsnthiis lividus, Amaranthus palmeri, ^ Zaranthus Rudis, Amaranthus spinesus amaranthus thunbergii, amaranthus viridis</td>

<td> 1312</td><td>TTGCCA & GhATT & ACATAGCAGCr?</td><td>Tici n</td><td> 9</td><td>Amaranthus albur, Amaranthus chlorostashys, Amaranthus graeeisans, Amaranthus hj ^ hridus, Amaranthus 2i vidus, Amaran thus yalmeri., Amaranthus rudir, Amaranthus thunbergrii, Amaranthus viridis</td>

<td> 1319</td><td>TTCTGTCGATATATTTCTTCATGGA</td><td>Have</td><td>Q</td><td>Amaranthus thloras R.ashys, Amaranthus gratrizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spintsus, Amaranthus thunber ^ ii, Amaranthus viridis</td>

<td>132G</td><td>TTCTCTGCCTCA & TMAGCCiC & GC</td><td>Have-</td><td>c</td><td>Amaranthus albus, ^ Baranthus grraeei sans, Amaranthus hybridus, Amaranthus lividus, Amaranthus pai ^ ri, Amaranthus rudis, Amaranthus spinssus, Amaranthus thunbergrii, Amaranthus viridis</td>

<td> 1321.</td><td>TTCAATGGC.AGGAGCCATCT7TGAA</td><td>ICT</td><td>Q</td><td>Amaranthus albus, Amaranthus ^ raetizans, Amaranthus hybridus, Amaranthus Ixvidus, / toaran thus palmer !, Amaranthus rudis, Amaranthus ^ isssus, Amaranthus th.unbergrii, Amararíhus viridis</td>

<td> 1322</td><td>TTCAAGCCGTGGC: TTTAT7GAGG * 2A</td><td>baby</td><td>Cí</td><td>Amaranthus albus, Amaranthus sraetizans, Amaranthus hybridus, Amaranthus lividas, Amaran th us palmeri, Amaranthus rudis, Amaranthus spintsus, Amaranthus thunber ^ rii, Amaranthus viridis</td>

<td> 1322</td><td>TTCAAAGATGGCTGCTGCCATTGAA</td><td>mn</td><td> 9</td><td>Amaraníñus albus, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>gcraeri sa ns, Amaranthus hybridus, Amaranthus lividus, Aurinthur pslaesF Amaranthus roars, jtajrajitáu; spinosus, Amaranthus tbunfeffs-gxx, Asaranthus viridis</td>

<td>13Ζ4</td><td>TGCT & CATiTATCCiAS.TTCCKTiT</td><td>TIC20</td><td>or</td><td>Abutilón theophrasti, Amaraaihus ilius, Amaranthus ohlorostachys, Amaranthus grraeciasnr, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmerx, Amaranthus rudis, Amaranthus spxacsus ,. Amaranthus thunber§ii, -Amaranthus visidís</td>

<td> 1225</td><td>TCaTATGGAA3TTGGATATATGC3LG</td><td>TIC2Q</td><td> 11</td><td>Abutilón theophrasti, Amaranthus albur, Amaranthus rblorostaohys ,, Ajaaraathus grjeciíJLí, Amaranthus hjrBridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spino sus, Amaraathus thuabesgií, Amaranthus viridis</td>

<td> 2225</td><td>TATGGAATTT & GATATATGCAGCAT</td><td>IT € 20</td><td> 11</td><td>Abutilón theephrasti, Amaranthus albur, Amaranthus odious taohys r Amaranthus «gpaeoi saris, Amaranthus hybridus, Amaranrbus llridus, Amaranthus palmer !, Amaranthus rudis, Amaranthus splzzosus, Amaranthus thunbergíi, Amaranthus viridls</td>

<td> 1327</td><td>GCTGCAS & SATC'C & MTTrCaTATG</td><td>TIC2Ú</td><td> 12</td><td>They bore you theophras, Amaranthus albus, Amaranthus chl ores ta chyz, Amaran thu s ^ Raeei Zans, Amaranthus hybridus, Amaranthus 11ridus, Amaranthus pslssesí Ffas> a && SLthu5 rudis, Amaranthus spínosus, Amaranthus thunbes ^ li, Amaranthus virídis</td>

<td> 1223</td><td>GKT5CTGCATATATCCAAATTCCAT</td><td>TIC2.Ü</td><td> 11</td><td>Theophrasti abutilon, Amaranthus albus, Amaranthus chl bears ta e-hy s, Ama ran thu s fr.eciwrs, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmer! Atarantaus rudis, Amaraníhus spínosus, Amaranthus th unbergri i, ama ran thu s vi ri di s</td>

<td>132S</td><td>CTGCMATiTCCi »TTCCATiZSi</td><td>HC20</td><td> 11</td><td>Abutilón theophrasti, Amaranthus albur, Amaranthus chloTostaohys, Amaranthus ^ tiecisaes, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaran thus “¿urbe rail, Amaranthus virídis</td>

<td> 2222</td><td>CATATGGSATTTG-SATATATGCJUsC</td><td>TIC2Ü</td><td> 12</td><td>Abutilón theáphras you, Amaranthus albur, Amaranthus rhlosostachys, Amaranthus ^ raecisans, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>hybridus, Amaran Chus lividus, Amaranthus palias r ±, Amaranthus rudis, Amsrar.thus spirals us F Amaranthus thunbergii, AiMranthus viridis</td>

<td> 1331</td><td></td><td>TIC20</td><td> 11</td><td>Abutilón theopinas ex FAmaranthus slbus, Jüaazsnthus chl ores ta chys, Ama raz. La s Graecisans , Amarztlius hybridus, Amaranthus lividus, Amaranthus palmeri, ktsrmthus eüdist Amaranthus spxncsus, Amaranthus thunbergii r Amaranthus viridis</td>

<td> 1332</td><td>ATGCTGCATATA “CCAAATTCCA.TA</td><td>Stiff</td><td> 11</td><td>Butyl thesphrasti tfteavanthiis slhusF SxüacAtith ^ s chlorcstachys, Amaranthes ^ sixteen r Amaranthus hybridus, Amaranthus lividus, Amaranthus psln ^^ j, Asaraathus rudis, Amaranthus sp.inosuzr Love ranthes thuni? exg-¿ r & O £ S £ RtÁt23 viriíiic</td>

<td> 1333</td><td>ATATGGAATTIGGAr.AGATGCAGCA</td><td>TIC2O</td><td> 11</td><td>^ hutxloe theqf! ¿Er.c elt^ s & SDsathiis sl & us, BL »sastth.v: s chl C- / 3OS t ¿chyc, Λα» r¿r. ehe x Greeks anzy AWC ^ athujs hybridus, Anarasthus lirxdus, AssriaCiU5 pslm ^ Ti && sr £ n £ hu.s rudis , & & £ r¿3tehus spinesus, An «rinthü5 Shunberyxi, Asxrinehus viridis</td>

<td> 1339</td><td>TTTGTGCTTACCTT ^ GGGATCGTGAG</td><td>TIC20</td><td> 10</td><td>Am ^ r ^ aihus «Ibas, AmiCíathus chlcrsstíchys ,. Amar ^ nihus ^ r ^ ecisans, Aaarasíhtas hybridus, Aaiaraathus lividus, AEüZ'.nchus palmeri, Ai £ ar £ sziiu5 rudis, Anazaaehus spiaosus, Asar ^ aihus ihunbergii, Asuranfhus viridis</td>

<td> 1335</td><td>TTTEZATGCGATG € TGCATAZ'ATCC</td><td>UC2Q</td><td> 10</td><td>Asaras ti ur albas, Amaraschus chlerestachys, Amaraaihus ^ raeciwaí, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinrsus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1325</td><td>TTTGG ^ TATAZGC ^ GCAT CGCATAC</td><td>TIC20</td><td> 10</td><td>Amaranthus albur, Amaranthus chl & rastachys, Amaranthus graecisans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaraathus rudis, Amaranthus spinesus, Amaranthus thunbergrii, Amaranthus viridis</td>

<td> 1337</td><td>mGCjMSGTTGTTGSTACTSTCX.GT</td><td>TIC20</td><td> 10</td><td>As & aranthus albas, Amaranthus ch 2crestachysF Amaranthus graecisans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri. Amarontñ es rudis, Amaranthus spxncsus, Amaranthus thasbergxi, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>viridis</td>

<td> 133'</td><td>TT7077CTCACGATCCCAAGGTAAG</td><td>T2C2Ü</td><td>1G</td><td>You attack albos, Anaranthus chl & r-ostxchys, Asias ^ rLt.hus ^ rsccimrs r Aasr ^ nchus hybrxdus, Anaranthas lividiís. Asaran th ur palmeri, Asaran Chus rudis, Asarantinus spinosus, Amaranthus xhunbergxi, Acarar.xhur viridis</td>

<td> 1325-</td><td>TTGTTS & TACTGTCAGTCGTTGGCT</td><td>TIC2 0</td><td>THE</td><td>Atarantaos albus, Acaranthor chloro'Staohys, Aoaranthus grte-cisans, Asaranthus hybrxdus, Asaran.th.ixs livid. Acaran-bus palmeri, Atarasthus rudis, Anaranthus rcissíUí, Aurjítla thunbergii, ABaxanthus viridis</td>

<td> 1340</td><td>7TGTG * 0TTACCTTGGGACGTGAGG</td><td>no</td><td>ία</td><td>Asaranthus albus, Asaranthus shle-ro-s'tsehys r Asar ^ nshus §Raecd sana, Aoaranthus hybrxdus, Asaranchus Ixvidus, .íasríBiÍiuj you, Asaraa sh.ua rudxaz Anaranth.ua spxnca ur r Amarajithur thuBberjxx, Asaxaníhua vir-idir</td>

<td> 1341</td><td>ZT & TArGCGAZGCr & OAZATATCCA</td><td>TIC2Ü</td><td> 10</td><td>Asaranthijr aLbuaz Anaranthur rhloxO'Stachyr ,. Anaranthua jríeciiíJis r Anaraashur hyhrxicfus, Asaranthua ixrxdua, Asaran thua palmerx FRudis, Anaranthua Apir Oauf, Asaranthua taunber ^ rxx, ^ snr.t. '' ^ risidis</td>

<td> 1342</td><td>TTGGTACTGTCAGTCGTTGGCTGCC</td><td>TIC2.0</td><td>lü</td><td>A ^ arantñua ilhur, Anaranthua cal & s & stfC'hys r ABaranthur jSAsriMBí, Aaaranthua ñybrldua, AmarantiEur Ixvides. They end up thus palneri, Asarantbus rudis. Roasting spinosus, Asaranthus tbunbex ^ rxx, Aaaranrhus viridis</td>

<td> 1343</td><td>TTGGGA.T-CGTGAGGAGAAAGGAGTG</td><td>TIC20</td><td> 10</td><td>Asaras th us albur, Anarasthus chlazc-s ta enys, Asaran th □ a ^ raecxzans, Asaranchus hybridus Asaranth.es lividus. Asaran taus palaeri, Asaranthus rudis, Asaranthus spinosus, Asaxanthus th unbergrii, anaranthus viridis</td>

<td> 1344</td><td>TT7GGAAT7GTTGCGATCAG7GACA</td><td>TI.C2.1</td><td> 10</td><td>Asarantñus albus, Anaranthus chlardataobys, Aaaranthus rraesisans, Anaranthus hyhridus, Asarantula Ixvidus, Acaran thus palmeri, Asarantdus rudis, Asaranthus spinosus, Aoarssthua tñunbe'Z ^ xi, Asaranthus viridis</td>

<td> 1345</td><td>TTTGAATCTT CTTGGTAT GGGdC T</td><td>TTC21</td><td> 10</td><td>They will tie tbus albur, Asaranthus ehloxeataffhys, Anaranthes praesizanr, Amaranthus hybridus, Amaranthus lividus, Attack you us palmer i ,. Asaranthus rudis, Anaranthus</td>

<td></td><td></td><td></td><td></td><td>ssiaaras, Amaranthus thunbergii, Amaranthus vasás</td>

<td> 1345</td><td>TTTCCTCTTTGGMTTGTWOGiTC</td><td>TIC21</td><td> 10</td><td>albus, Amaranthus chl.iS-r-OStAshy £. r Anxa?% S? TtJ? Ng Graerisans, Amaranthus hybridus, Aoaranthas lividus, Amaran th us palmer !, Amaranthus rouen, Amaranthus spinesus, Amarazirhus ehuaberg-ii, Amaranthus viridis</td>

<td> 1347</td><td>TTTATTGCTGTTGBZMTTGTGOLG</td><td>TIC21</td><td> 10</td><td>Roasting thus albus, Amaranthus c'hlorc-starhys, Amaranthus graesisaBs, Amaranthus hyJbridus, Aaaraathus livid, Amaranshus palmer !, Azearanthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Aaassstthus víridis</td>

<td> 1348</td><td>TTGTTGCGATCAGTG & l & TCACCTA</td><td>TTC21</td><td> 10</td><td>Amaran thus albus, Amaranthus chlhrostacbys, Amaranthus Graeci Sajas, Amaranthus hybridus, livid Amaranthus, Amaranthus palmer *!,. AsaraB.th.tas roas, Amaranthus OTÍassus, Amaranthus th.unberg.ii, Amaranthus vir-dí s</td>

<td> 1345</td><td>TT & GThTGC <^ TCTG € GGT € TTGGG</td><td>Z1C21</td><td> 10</td><td>Amaranthus albus, Amaranthus rhxsse.stac.hys, Amaranthus ftsftci «ins, Amaranthus hybrxdus, Amaranthus liviáus, Amaranthus psljaesi ^ Ji & ¿a ^ BBíhas isdis., Amaranthus spinrs us, Amarasthu s tbunbergii, Amaranthus visidis</td>

<td> -350</td><td>ZTGGAATTGTTGCGATCAGTGACA2</td><td>TIC21</td><td> 10</td><td>Amaran tñuf alhuj, Amaranthus rhlcrr sta chy s, Ama ra a thu s Graesisans, Amaranthus hybridus, livid Amaranthus. Amarantaus palmer! Amaranthus rouen, Amaranthus sp.inrsus, Amaranthus tñunbesgii, Amaranthus viridis</td>

<td> 1351</td><td>TTGCGATO.GTGACATCACCTAGCG</td><td>TIC21</td><td> 10</td><td>Amaranthus albur, Amaranthus chlrrcstachys, Amaranthus graeri sans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus roras, Amaranthus spinrsus, Arnaranthus thuabergxi, Amaranthus viridir</td>

<td> 1352</td><td>TTGCiXTCceaaGM: cGía.Gieccc</td><td>TIC21</td><td> 10</td><td>Amaranthus albur, Amaranthus shlrrcstarhys, Amasasihus graeri sans, Amarasehus hybridus, Amaranthus lividsss, Amaran rhus palmer !, Amarasrhus rois, Amaranthus spinrsus, Amaranthus ehuabergli, Amaranthus vi riáis</td>

<td> ¿353</td><td>TTGACCGCTAGGTGATGTCACTGAT</td><td>TI-C21</td><td> 10</td><td>Amaranthus albur, Amaranthus chlsRr-cstarhys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lívidu-s.</td>

<td></td><td></td><td></td><td></td><td>Amaran thus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaranthus thunbergxi, Amaranthus viridis</td>

<td> 1354</td><td>TTGAATCTTCTT ^ TATGGGCTCTG</td><td>TIC21</td><td> 10</td><td>Amaranthus albus, Amaranthus ohlo-sostashys, Amaranthus graecizans, Amaranthus hyhrxdus, Amaranthus lividus. Amanan th us palmeri, ÜBBiassaith ^ s rudis, Amaranthus spinnsus, Amaranthus thufibergxi, Amarar, thus viridis</td>

<td>iass</td><td>TTCTTGGTiTGGGCTCTGCGGTCTT</td><td>TIC2.1</td><td> 10</td><td>Amaranthus albus. Amarar, thus chZsrcr ta ehiy s, Asa rar. t hu s -graecizans, Amaranthus hybridus, Amaranthus 11 lives, ^ BAXdaSitih.} 2s palmer! Amarantius rudis, Amaranthus spínosus, Amaranthus th unbe-rgil, amasan thus viridis</td>

<td></td><td>TrCGGM: TI5TTTCCTCT ~ TGGAAT</td><td>TIC2.1</td><td> 10</td><td>Amaranthus albur, Amaranthus rhlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus. Amaran thus palmeri, -% EirAat¿uí rudis, Amasanthus spinosur, Amaranthus thunberg-ii, Amaranthus viridis</td>

<td> 1557</td><td>TTCCTCTTTGGaATTGTrGCGATa.</td><td>TIC21</td><td> 10</td><td>Amaranthus albus, Amaranthus chlsrestachys, Amaranthus graecizacs, Amaranthus hybridus, Amaranthus lividus, Amaran thus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaranthus thusbergii, Amaranthus viridis</td>

<td> 1358</td><td>ITCCAAA ^ GGAAACAAGTCCGAAG</td><td>TXC21</td><td> 10</td><td>Amaranthus albus, Amaranthus tHurcstashys, Amarajithus graerlzans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus th unbersrii, Amaranthus viridis</td>

<td> 1359</td><td>TTATTGCTGTTGATAATTGTGCIGT</td><td>HC21</td><td> 10</td><td>Amaranthus albus, Amaranthus rhlc-rnstachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus apiñesus, Amaranthus thunbergii, Amaranthus viridis</td>

<td>€ 13 S</td><td>J ^ TTTCCTCTTTGGaATTGTTCCGA</td><td>nc2.i</td><td> 10</td><td>Amaranthus albus, Amaranthus rhlnr «'5tashys, Amaranthus graeci sans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaranthus thwsbergrii, Amaranthus viridis</td>

<td> 13«!</td><td>TGTTKGMCiGTG & CATCACCTAG</td><td>TIC21</td><td> 10</td><td>Amaranthus albur, Amaranthus chlnrcs tachys, Azarar, thus</td>

<td></td><td></td><td></td><td></td><td>graerisans, Amaranthus hybridus, Amaranthus Ixvxdus, Amaranthus palmeri, Amaranthus' rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1362</td><td>7C'7a \ C “GATC & ZAACAATTCCAAA</td><td>Ti: C21</td><td> 10</td><td>Amaran thus albas, Amaranthus ohloros ta chys, Amara nt hu s graeci taxis, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1363</td><td>TGGTATGGGCTCTGCGGTCTTGGGX</td><td>TIC21</td><td> 10</td><td>Amaranthus albur, Amaranthus ehlorostaohys, Amaranthus graecisans, Amaranthus hybridus, Amaranthus livxdus, Amaranthus palmeri, AoASOxithus rudis, Amaranthus spino su 3, Ama ranthus thunbergii, Amaranthus</td>

<td> 1364</td><td>TT7GCTATG * CAACAAACTTTCAA '> SA</td><td>TIC4Ü</td><td> 10</td><td>Amaranthus albur, Amaranthus rhl oros ta chysand Ama ran thus graerisans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1365</td><td>TTTCX ^ G & CT & TGATGKGCCAGATG</td><td>nc40</td><td> 10</td><td>Amaranthus albur, Amaranthus zhloT '& st-zc'hys, Amaranthus Graecisans, Amaranthus hybridus, Amaranthus lividus. They will love thus palmer! Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, amaranthus viridis</td>

<td> 126€</td><td>TTGTSSCiTMCMATTrCTTCMC</td><td>TIC40</td><td> 10</td><td>Ás & asiajsshus albur, Amaranthus chlosostacñys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbesgii, Amaranthus viridis</td>

<td> 1367</td><td>ttgctatgca & cmíctttcmgm:</td><td>ΪΚΜ</td><td> 10</td><td>Amaranthus albur, Amaranthus chlo-rostac-hys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividxss, Amaranthus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1368</td><td>TTSChThíCAAAITTCTlCAACCAT</td><td>TIC40</td><td> 10</td><td>Ajrantrant albur, Amaranthus rhl ores ta ohys, Ama ra nt hu s graesisans, Amaranthus hybridus, Amaranthus lividus, Amaran thur palmert, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 13¿5</td><td>TTCAA ^ CTATGhTGAGCCAGATGG</td><td>TIC40</td><td> 10</td><td>Amaranthus albur, Amaranthus rhlorsstachys, Amaranthus yríecisjnrF Amaranthus hybridus, Amaranthus lividiis, Atearanthas palmer! FRudis, Amaranthus spinesus, Amaranthus rhuabergii, amaranthus viridis</td>

<td> 127'2</td><td>TGTTGCATAGCAAATTTCTTCAACr</td><td>TIC40</td><td> 10</td><td>Amaranthus albur, Amaranthus rhXrmstashys, Amaranthus graeci zans, Amaranthus hybriaus ,. Aasaranthus lividus, Amaranthus palmer !, Amaranrhus rudis, Amaranthus spinnsus, Amaranthus thuziberg'ii, Amaranthus viridis</td>

<td> 1371</td><td>T ^ TTGAAGAAATTTOTATGCAAC</td><td>TIC40</td><td> 10</td><td>Amaranthus albur, Amaranthus shlorostachys, 3aas¿athaz graecizanr, Amaranthus hybridus, Amaranthus liridus, Amaranthus pals »ri, Amaranthus rudis, Amaranthus spinorus, Amaranthus thuabergii, Amaranthus viridis</td>

<td> 1372</td><td>^ GCTCATCATAGTCTTGAAAGTrT</td><td>TIC40</td><td> 10</td><td>Amaranthus albur, Amaranthus chlozo'Stachys, Amaranthus graesizans, Amaranthus ñybrxdus, Amaranthus lividns, Amaranthus palmer !, Anaranthur rudis, Amaranthus spinrsur, Amaranthus Xhunbergi !. Amaranthus viridis</td>

<td> 1373</td><td>TOTATtXiMa & ACTTTCAlGACT</td><td>TIC40</td><td> 10</td><td>Amaranthus albur, Amaranthus ellowstachys, Amaranthus graesizans, Amaranthus hybridus, Amaranthus lividus. Amaranshas palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thanberg-ii,. ^ Laranthus viridis</td>

<td> 1374</td><td>TGC ^ AGCAAATTTCTT € AACCATG</td><td>HC40</td><td> 10</td><td>Amaranthus albur, Amaranthus rhlo-rostashys, Amaranthus graecisans, Amaranthus hybridus, Amaranthus liridus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spiaesus, Amaranthus thunbergii, Riasz & ñtiixsz vizÁdii. ::</td>

<td> 1275</td><td>SC? JiCA-J-.C "T ~ CAAGACrATGA"</td><td>IT CIO</td><td> 10</td><td>Amaranthus albur, Amaranthus rhlumstathys, Amaranthus graecisans, Amaranthus hybridus, Amaranthus lir.id.us, Amaran th us palmer !, Amaranthus rudis, Amaranthus spiaorus, Amaranthus thunbercrii, Amaranthus viridis</td>

<td> 1376</td><td>TGAAGAAATTTGCTATGCAACAAAC</td><td>IT CIO</td><td> 10</td><td>Amaranthus albur, Amaranthus chlozitstsehys, Amaranthus graecizans, Amaranthus h; / hridus, Amaranthus liridus, Amaranthus palmer !, Amaranthus rudis, Amaranthus sp! Ne sus. Asa ra n thus ihunbercrii; Amaranthus</td>

<td></td><td></td><td></td><td></td><td>rÍTÍdjx</td>

<td> 1377</td><td>TCTTGAAAGTTTGTTGCATAGCAAA</td><td>TIC4O</td><td> 10</td><td>Amaranthus albas, Amarantbus chlorost'aohys, Aearantbus grraeoxsans, Amarantbus hybridus, Amaran Chus lividiís, Amaranthus palmer! Asaranthus · roras, Amarantbus spinosus, Amaranth.us thunbergrix, Ajsarasthtjs vxridis</td>

<td> 1373</td><td>TCTGGCTCATCAlAGTCTTGaAAGT</td><td>TIC40</td><td> 10</td><td>Attack idus alfae, Amarantbus c'hlorastaohys, Amaranthus grraecísans, ABMrantbus hybrxdus, Amaras Chus 1! vidus; Acaran th us palme rx, Amaranthus rouen, Asarastbus spinosus, Amaranthus fñunbercFxi, Amaranthur viridis</td>

<td> 1379</td><td>TCCCATCTGGCTCATCATAGTCTTG</td><td>TTC40</td><td> 10</td><td>AmaroEthas albur, Asaranthus chlorostaoáys, Amaranthus ^ raecisans, Amarsstbus hybridus, Amarastbus lirxdus, Asaranthus palmer !, Amaran thus roéis, Amaranthus spiaosus, Amarasthus thunbercrxi, AmarasShus viridxs</td>

<td>Χ38ΰ</td><td>TCMCKiAETCTISM ^ ITTSTrG</td><td>TIC40</td><td> 10</td><td>Asaran i¿ us albur, Asarar.thus chlorestacñys, Amaraníhur grraecx * a as, Amaranthus hybrxdus, Amarantbus Ix-rxdus, Asaranehus palmer! Asarantisus roras, Amarasrlius spxsosus, Amaraninur tbunhergii, AmaranChus irirxdis</td>

<td> 1381</td><td>TCXTAGTCTTGAAAGTTTGTTGCAT</td><td>TXC40</td><td> 10</td><td>Amaraathus albur, Amarasrbur chlorostachys, Amaransbur grraeei sans, AMSistsa; hybridus, Amaraschus Ixvxdus, Asaras Chus palmer !, Asarantbur rouen, Aasaranthus spxnosus, Amaranrhus tbunbergxi, .Amaraachus ídridis</td>

<td> 1382</td><td>TCAAGACTATGATGAGCCAGATGGG</td><td>ΤΣΓ4Ο</td><td> 10</td><td>AtEaronÉhus albas F Asaranthiss c'hloro-sracnys, Amaranebus • Graeri Sans, Amaranehus hybrxdus, Amaranthtir líviáise, Asaran idus palmer! Asaran rh us roras, Amaranehus spxnosus, AmarasxÉur thunbesgxi, Amarar.tbus viridis</td>

<td> 1383</td><td>TAKCAiC & i & CTTZCi * GMT & TG</td><td>TIC40</td><td> 10</td><td>Asarasibas albur, Amaranthus c¿il oro acby s, Ama ra ai bu s ^ Raecisans, Amaranebus hybridus, Amaranthus Ixrxdus, Asaran tñ us palmer! They will love us. Arnarar.tbus spinorur, Amarantbus ehunbergxi, Amaranebus viridis</td>

<td> 1384</td><td>TraAfiTISAMCaECTCACMSGTC</td><td>TIC5 €</td><td> 6</td><td>Ajearan th us rraesiaans, Amaran th us hybxxdxzs, Amaraathus Ixvxdus, Roast antis us palmer !. You will love Chus rpinosiJS, Asaraathus chunbezMfxi,</td>

<td></td><td></td><td></td><td></td><td></td><td colspan="2">Amaranthus CSenepodium album.</td><td>viridis,</td>

<td> 5</td><td> 1385</td><td>TCTTCTCGGAACATATTCATGGCTT</td><td>TIC5Í</td><td>B</td><td>Amaran thus Amaranthus Ameron th os Amaranthus Amaranthus spiuosus, rhuaberfiá, viridis</td><td>rudis,</td><td>gFreeriians, hybridus, lividus, palmer !, Anaranthus Amaranthus Amaranthus</td>

<td></td><td> 1385</td><td>TCTTAAGTTGAATCAGCTCACATGG</td><td>TIC55</td><td>δ</td><td>Amaranthus Afearan th ur feg-s r> jnth 13 g · Amaranthus Amaranthus Amaranthus Amaranthus Seappodius</td><td>album</td><td>yxaecxieos, hybridus ,. lividus, palmer !, spinosus, thunbergíi, viridis.</td>

<td> 10</td><td> 1387</td><td>TCATGTCCTTGATTACAGCTTTACT</td><td>TIC55</td><td> 8</td><td>Amaranthus Amaranthus Amaranthus Amaran th us Amaranthus spxnosus, thunbe-rgii, viridis</td><td>rudis</td><td>greeriiasis, hybridus, lividus, palseri, Amaranthus Amaranthus Amaranthus</td>

<td> 15</td><td> 1368</td><td>raMTTGaiTCAGCTOLClTGGTCC</td><td>ncsí</td><td> £</td><td>Amaranthus Amaran th n «i Amaranthus Amaranthus Ama y-gw th us Amaranthus Amaranthus Ch enepodi se</td><td>album</td><td>grraecisans, hybridus, Ixvidus, palmer !, spinosus, viridis ,.</td>

<td></td><td> 1385</td><td>TAAA ^ TGTAATCAAGGhCATGAGG</td><td>TIC58</td><td>and</td><td>Amaranthus Amaranthus Asaran thus Amaran th us Amaranthus spinosus, tñumbergrii vi ~ i dis</td><td>rudxs,</td><td>graeciians hybxidusF lividus ,. Amaranthus Amaranthus Amaranthus</td>

<td> 20</td><td>138ΰ</td><td>GTCriAAGTTGAATCAGCTCACATG</td><td>TIC55</td><td>β</td><td>Amaranthus Amaranthus Amaranthus Amaranthus Amaronthus Amaran th us Amaranthus Chenspodi urn</td><td>album</td><td>greeriaens, hphridus, lividus, palmeri ,, spixosus, thimbergi !, vixidls,</td>

<td> 25</td><td>13 YES</td><td>GTAAS.SCTGTASTCAAGSa.CATGA &</td><td>ticsí</td><td>and</td><td>Amaranthus Amaranthus Amaranthus Asaran ib us Asaran th us spinosus, thtujbergii, viridis</td><td>rudis</td><td>graeoi i ans, hybridus, lividus, pAlacrz, Aearajithus Amaranthus Amaranthus</td>

<td rowspan="2"> 30</td><td> 1382</td><td>GBa.ccMeTSiGa®a.TTcaACSTA</td><td>TICS €</td><td> 5</td><td>Amaran thus Amaranthus Amaranthus Amaren thus Amaron idus Amaran thus Amaranthus Chenppodíu®</td><td>albas</td><td>graecízans, hybridus, lividus, palíEíri, spinosus, rhunbezglx, viridis,</td>

<td> 1383</td><td>& CCTCATGTCCTTGATXÁCAGCTTT</td><td>TIC58</td><td> 6</td><td>Araranthus Amaranthus Amaran th us Anuyan th US</td><td></td><td>groecisans, hybridus, lividus, palmer!</td>

<td></td><td></td><td></td><td></td><td></td><td>Amaran thus spinosus, th ushergii, vísís</td><td>rudis</td><td>Amaranthus Love rasthus Amaranthus</td>

<td> 5</td><td> 1394</td><td>GCCATGAATAZGTTC CGAGAAGATG</td><td>TIC55</td><td>ε</td><td>Amaran thus Amaran thus Arearathus Airaran thvs Amaranthus spínssus, thunbergi i, vi ri ais</td><td>rudis</td><td>graerxians, hpbridus, livid, palmer !, Amaranthus Amaranthus Amaranthus</td>

<td> 10</td><td> 2295</td><td>GCA.TCTTCI € & GA & CAZATTCAIGG</td><td>TIC56</td><td> 8</td><td>Amaran thus Amaranthus Amaran thus Amaranthus Amaranthus ípíaofos, thunbergi.i, vísís</td><td>rudis,</td><td>jr.eí ·! sans hybridusF lividus, paimeri Amaranthus Amaranthus Amaranthus</td>

<td></td><td> 13 96</td><td>GMGiCCATGTGiGCTGATTCAACT</td><td>TIC5Í</td><td> 8</td><td>Amaranthus Amaranthus Asaran thu.5 Amaran thus Amaran thus Amaranthus Amaran thus Ches «could</td><td>album</td><td>graecisans ,, hybridus t livid, palmer !, spíncsus, thunbergií, Timáis t</td>

<td> 15</td><td> 1397</td><td>GÉ £ Cl ”GTGMCTGlTTCA £ CTTat</td><td>TIC56</td><td> &</td><td>Amaranthus Amaran thus Amaranthus Amaranthus Amaranthus Amaranthus Amaranthus Chenapodiuaa</td><td>albaas</td><td>graesísans, hybrídixs, livid, palmer !, spinesus, chi ^ nbes ^ rii, vísís,</td>

<td> 20</td><td> 1293</td><td>CTTAAGTTGAATCAGCZCiCATGGT</td><td>laugh</td><td>B</td><td>Amaranthus Amaranthus As & ara & tiius Asaranthus Amaranthus Amaranthus Amaranthus ChenopDdi us</td><td>album</td><td>graecísans, hy-brídiís, livid, palmer !, spinesus, thunbergi i, vívís,</td>

<td></td><td> 1399</td><td>CTCATGTCCTTGiTTACaSCTTTM:</td><td>TIC5Í</td><td>s</td><td>Asearan thus Amaranthus Amaran th us Amaranthus Amaranthus spinesus, t-susbergii, vísís</td><td>rudis</td><td>graerísanr, hybridus, livid, palme ri, Anjyjriy ^ ti «r Amaranthus Amarxzit'hus</td>

<td> 25</td><td> 1400</td><td>CGCCTCATGTCCSTGMTACAGCTT</td><td>TIC56</td><td>B</td><td>Amaranthus Amaranthus Amaranthus Alearan thus Amaranthus spínosus, ihunbergrí i, vísís</td><td>rudis,</td><td>graetrxsans, hybridus, livid, palmer !, Amaran t¿ * us Aisara.n.tht¡s Amaranthus</td>

<td> 30</td><td> 1401</td><td>CCOCATGTCCTTGATTA'IAGCTTTA</td><td>TI.C5Í</td><td> &</td><td>Amaran th us Amaran thus Amaranthus Amaranthus Amaranthus spinosus, rhunbergii, vísís</td><td>rudis</td><td>graerisx.tr, hybrddus, livid, palmer !, Amarant hus Amaranthus Amaranthus</td>

<td></td><td> 1402</td><td>COLTGTGAGCTGATTCAACTZAAGA</td><td>ICT5</td><td> 8</td><td>Amaranthus Amaranthus</td><td></td><td>graecisans, hybrids,</td>

<td></td><td></td><td></td><td></td><td>They will love thus lividus. Amaranthus palmer !, Amaran thus spinosusF Amaran thus thunbergii, Amaranthus viridis, Chenopodiuat album</td>

<td> 1403</td><td>CCXTG¿a.TiTGTTCCGiGMGATGC</td><td>nc!5«</td><td>B</td><td>Amaran th us graeoisans F Amaran chus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus SpinOSUSArttsr ^ s-nfhvi ·: thunbergii, Amaranthus viridis</td>

<td> 1404</td><td>TTGGTACTGG ~ aATGATGCAGCa.CC</td><td>TOC132</td><td> 9</td><td>Amaranthus albur, Amaranthus graecisans, Amaranthus hybridus, Amaranthus lividus, AmarantAus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1405</td><td>TGGTGGTGCTGChTCATThCCAGTA</td><td>Tüciai</td><td> 9</td><td>Jto & caathus albus, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis ,. Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1405</td><td>TGGTGCTGCATCaTTACCASTACCA</td><td>TCC132</td><td> 9</td><td>Amaranthus albur, Amaranthus jweciiaos, Amaranthus hybridus, Aaaraixthus lividus, Amaran th us pshss ri, Anuraa.ehi2S rudis, Amaranthus spinosus, Amaranthus thunbergii, amaranthus viridis</td>

<td> 1407</td><td>TGGTACTC ^ TAATGATGCAGCACCA</td><td>TOC132</td><td> 9</td><td>Amaranthus albur, Amaranthus graeci zans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1403</td><td>WGTAATGATGCAGCACCACChGAT</td><td>TOC132</td><td> §</td><td>Amaranthus albur, Amaranthus granelzana, Amaranthus hybridus, Amaranthos lividus. Amaran thus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Aawrazthus viridis</td>

<td>14 oe</td><td>TGCTGCATCaTTACCAGTACCAATG</td><td>TOC132</td><td>Q</td><td>Amaranthus albur, Amaranthus graecisars, Amaranthus hybridus, Amaranthus lividus, Amaran Chus palmer !, Amas ^ snthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1410</td><td>TGCAGCACCACCSSATTCTTCATCa</td><td>TCC132</td><td> 9</td><td>Amaranthus albur, Amaranthus graeoisans, Amaranthus hybridus, Amaranthus lividus, Amaranthus pals ^ ri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis.</td>

<td> ¿411</td><td>TGATGCAGCACCACCA & ATTCTTCA</td><td>T0C132</td><td> 9</td><td>Amarantbus albus, Amaranthus graeci z-ans, Amaranthus hybcídus., Amasanthus lividus, Amaranthus palme ri, Amaranthus rouen, Amaranthus spinosus,. Amaranthus thunbergii, Amaranthus viridir</td>

<td> 1412</td><td>GATGÍAGA? .TC ”GGT & Í ~ -SCTSCA</td><td>TOC132</td><td> 9</td><td>Amaranthus albur, Amaranthus graecisaos, Amaranthus hybridus, Amaranthus lavidus,. Amaranthus palmer !, Amaranthus roars, Amaranthus spinosus, Amaranthus thuabergii, Amaranthus viciáis</td>

<td> 1413</td><td>TGAAGAATCTGGTGGTGCTGCATCA</td><td>7CC132</td><td> 9</td><td>Amaranthus albus, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lívidus, Amzrasithu.j palmetí, Amaranthus rouen, Amaranthus spinosus, Amaranthus thuabergíi, Amaranthus vira di s</td>

<td> 1414</td><td>TCTGGTGGTscrscarcjOTaccas</td><td>3X132</td><td> 5</td><td>Amaranthus albur, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividxrs, Amaranthus palmeri, Amaranthus roras-, Amaranthus spinosus, Amaranthus thunbmgii, Bssazantii'us viciáis</td>

<td> 14 ’ 5</td><td>TACTGGTAATGATGCAGCACCAC-CA</td><td>TOC132</td><td> 9</td><td>Amaranthus albus, Amaranthus graecisans, Aaaxantbus hybridus, Amaranthus lividus, Amaranthus palmer !, Azsaranthus royans, Amaranthus spinosus, Amaranthus thunbesgü, Amaranthus viciáis</td>

<td> 141€·</td><td>TAATGAZeCAGCACCACCASATTCT</td><td>TW2132</td><td> 9</td><td>Amaranthus albus, Amaranthus graecizans, Amaranthus hybridus, Amaranthus l-ividus, Amaranthus palmer !, Amaranthus roras, Amaranthus spinosus, Amaranthus Shunbergrii, Amaranthus virtáis</td>

<td> 1417</td><td>GTG ^ TGCTGCATCATTACCAGTACC '</td><td>TOC132</td><td> 9</td><td>Amaranthus albus, Amaranthus graecizans, Amaranthus hybrídus, Amaranthus livid, Amaranthus palmerí, Amaranthus roras, Amaranthus. ^ Ínosus, Amaranthus thunbergií, Amaranthus vi riáis</td>

<td> 1412</td><td>GTGCIGCATCATT ^ ChGTACCAAT</td><td>T0C122</td><td> 9</td><td>Amaranthus albus, Amaranthus graecizans, Amaranthus hybridus, Amaranthus livid, Amaranthus palmer !, AmaranChus rouen, Amaranthus spinosus, Amaranthus thunbergíi, Amaranthus vi riáis</td>

<td> 1415</td><td>GTACTGGTAATGAT ^ MCj ^ CACC</td><td>TOC132</td><td> 9</td><td>Amaranthus albus, Arnaranthus graecizans, Amaranthus hybridus, Amaranthtis livid, Amaranthus palmer !, Amaranthus rouen, Amaranthus spinosus, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>cbusbercrii, amaranthus viridís</td>

<td> 1420</td><td>GTAATGATGCAGCMXACCAGA.TTC</td><td>TCC122</td><td> 9</td><td>Amaran Chus albur, Amaranrhus sraerxsanr, Amarantbus hybsidas, Asasazttiixts livid, Amaranthus palmer! .. They tie tñur rudis, Amaranthus spiassas, AmarasChus Chunbergrii, Asarartnur víridis</td>

<td> 1421</td><td>GGTGGTGCTGCATC & TTA.C'CAGTAC</td><td>T0C132</td><td> 9</td><td>Asarantbus albur, Anaranthus ^ raeoízans, Amaranthus hybrxdus, AsaranChus Iividas. They will love Chus palmer! , Asaranthus rudis, Anaranthur spiaosus, Amaranthus tbunber ^ ií, Acarasthur virídís</td>

<td> 1422</td><td>GGIGCTGCATCATTACOíGiriCCAA</td><td>TCC132</td><td> 9</td><td>Amaranthus albur, §Raec¿ sans, Amaranthus hyhridus, Anaranthur Livid, Artaran Ch us p-aleerx, AsacanChus rudir, Aaarantbus spÁaosus j, Asaran thus thunbergxi, Amaraxthus virídír</td>

<td> 1423</td><td>GGTACTGGTAiTGATGCAGCACCAC</td><td>TCC132</td><td> 9</td><td>Amarantbur albur, Amarasthus ^ raeoizans, Amaranthus hyJbridus, Amaranthus livid. Asaran Chus palmer! Asacan, thus rudis, Asaranthus rpis-csus, Asaranthus Chunbergrií, Asarant-hus I saw yes say s</td>

<td> 1424</td><td>- • GGACACCA-GG - C «ACi2A» GJ.</td><td>T0C1SS</td><td> 10</td><td>Aburilen theopátrasci, Asaranthus albur, Asaranthur ^ raerí zans, Asaran t.hus hybcidus Ataranthus lividas. AmaranChus palmer! Asearan Ch us spxn & rus. Amaran íh us thunbergrí i, They will love thus viridisFCheíjrpodi.us album</td>

<td> 1425</td><td>TCATGGTCCCAACCATGGGTGTCCA</td><td>ICC1S9</td><td> 10</td><td>Abutilón tb-ecphras cc, Amaran tñus albur, Ataranthus praecizans, Amaranthus hyhridus, Amaranthas livid, Amaran Chus palmer !. They will love Chus spínssus. AmaranChus chunber ^ li, Aisaraa Chus viridi s, Chenopodíum albos</td>

<td> 1426</td><td>GCCTGaTTCMaGSC & MaGATCT</td><td>7CC15 &</td><td> 10</td><td>Azaranthus albur, Amarasthus ^ raeoízams, Amaranthus hyhridus, Livid Amarasthus, Amaras Chus palmer !, Amaranfchus rudij, Amaranthus spinosus, Amaranthus thunbergxí, Amaraníhus vixídis, Chenopo-dium album</td>

<td> 1427</td><td>GACACCCaiGGTTGGGAeCA ^ GATT</td><td>2ÜC15S</td><td> 10</td><td>Abutilon Theophrasti, Amaran. t¿ur albur, Amaran thur graeoí zans, AmarasChus hybridus, Amaranthur livid, Asaran Ch us palmer !, Amaran Chus spmosus. Amaran thus thanbergrii, A & arenthus viridis, Senna obtnsí fblia</td>

<td>142Β</td><td>CAATCATGGTCCCAACCATGGGTGT</td><td>7OC1S9</td><td> 10</td><td>Abutx 1 on theophrse ex,</td>

<td></td><td></td><td></td><td></td><td>Maros th us albur, do rearantius ^ reecisans, do asaranthus hybridus, livid rearasthusF Asaran tias paimeri, ¿Rearanthus spinosas, ¿Sarán thus rhanbergri ¿, Asarant & us viridis F Sanca «btusifelia</td>

<td> 1425</td><td>AGiTCTCTTGTCTGTGAATCCA & CC</td><td>T0CL5S</td><td> 10</td><td>Will Ahur Albur, Maranthcs Fraecisaas, Aaras & Hns? Hybridus, Maranthar Livid, Asarenthus F&& 3z-ABt¿ii3s ¡nsdís ·, do maranthus spíaosus, do maranthas thunbergrdi, maranthus viridis, Chenopodiua album</td>

<td> 1430</td><td>ACACCCATGGTTGGC-ACCATGATTC-</td><td>T0C159</td><td>THE</td><td>Bu tile® thesphras ti, ¿tide thus albur, ¿maranthur -jraífiíañj, ¿earaaehus hybridus, ¿rearanthur livid, ¿rearanthus paimeri, ¿marasthus spinesns, rearan. so tñaaber ^ í i, will you be us viridís, ^ enna • obtusífolie</td>

<td> 1431</td><td>AATCATG «TCCCMCCATra; TGTC</td><td>TOC1SS</td><td> 10</td><td>Abutilón íLecyhrastí ,, ¿rearaathus albur, ¿aaranthus fraeriMjas, ¿maranthus hybrídus, ¿marasithar livid, ¿serenthus paJLsesi, ¿stares thus spinosas, ¿ssareathus thusbergzz, maranfcbus ^ ¿rídís, Sesea obtusitclia</td>

<td> 1432</td><td>ITSBTGGSaaGCGTMTCATATTA</td><td>3OC15S</td><td> 9</td><td>¿Saranihus albur, ¿narant¿us ^ rroeci sans, ¿maran.t¿us hybridus, will livid serasthus, Asaren rhus palioeri, ¿Merasthuz rudis, ¿aaranthus .spínesus, ¿maren-e & us sbuabergíl, ¿zsarant & us I saw you</td>

<td> 1433</td><td>TTTGGTTACCTSCACAGTTACTGCT</td><td>WC159</td><td> 9</td><td>Do you just ahur albur, do aeransbus groecisane, do marantsus hybridus, do lrant nsaranthus, do morenti us paimeri, do rudis reboots, do marasthus spxnosus, do thuabergí maranthus, anaraíit? Us viridis</td>

<td> 1«4</td><td>TTTGAGCGAGTAGCJ.TAGCAA <2AAT</td><td>TCC1S9</td><td> 9</td><td>Asaranihus albur, Anaranthus ^ Roeci Zans, Maranthus hybridus, Asarantbas livid, do they dwell th as pelase rí, Do you seas as rudis, do nsaranthus spínosus, do marasthur sobergíi, maranthus virid s</td>

<td> 1435</td><td>TTICCTTGiACATCCT & GITCTTGG</td><td>TOC159</td><td>g</td><td>Do you rea th th albur, do saranthur jrreecí sans, do maranthus hybridus, do livid maresthus, do maranrhus paimeri, do saranthus rudis, do marantñus spínssus, do rearanthus thunbergíi, asaranthar riridis</td>

<td> 142€</td><td>TErcCTCCGaTTKCMSTCTCCTC:</td><td>XX155</td><td> 9</td><td>Attack me albur, ¿sarenthus ^ xeecí sess, ¿maranthus hybrídus, ¿rearanthus livid, maraatáuM; paimeri</td>

<td></td><td></td><td></td><td></td><td>AzEaranthus r ^ áir, jbux * anthus SpiaOSUS, Αμμ »? Αιί« r ihunberg-ií, you attack viridis</td>

<td> 1437</td><td>TTTCOCAAGAACCAGGATGTTCAAG</td><td>TCC155-</td><td> 9</td><td>Tár albur, Amaranthus ^ raeci sans, Amaranthus hybridus, Aasaranthus livid, Atarantáis palmerx. You attack roya, Amaranthus spinosus, Amaranthus thunbergi.i, Amaranthus viridis</td>

<td> 1425</td><td>TTTATGTGGATAGGCTGGATTCACA</td><td>T0C1SS</td><td> 9</td><td>Amaranhus albur, Amaranthus graeoi sans, Amaranthus hyhridus, Asaranthus livides. You attack palmer! , Amaranthus roras, Amaranthus spinosus, Amaranthus tñunhergrii, Amaransbus viridis</td>

<td> 1435</td><td>TTTACCTTCTCTTCACCAAATATTG</td><td>ICC159</td><td> §</td><td>Amaranthus albur, Acaranthus graeci zans, Amaranthus hybridus, livid Anaranthus. They will love us, Roast it like this roaring, Amaranthus spinosus, Amaranthus thunbes ^ xi, Amararrbus viridis</td>

<td>144Q</td><td>TTGTGGGACAGCGTAGTCATATTAT</td><td>7CCL59</td><td>c</td><td>Amaranthus albus, Amaranthus graerxsans, Amaranthus hybridus, Amaranthus livxdus. Amaran thus palm tree, Amaranthus roras, Amaranthus spinosus, Amaranthus' tñunbergii, Amaranthus viridis</td>

<td> 1441</td><td>TTGTCTGTGAATCCAGCCTATCCAC</td><td>T0C159</td><td> 9</td><td>Amaranthus albur, Amaranthus ^ raecisans, .Amaranthus hybridus, Amaranthus 11 vines. Ajearan £ ¿us palm, Amaranthus rudas, Amaranthus spinosus, Amaranthus th.unhergái., Amacanthus viridis</td>

<td> 1442</td><td>TTGTCCTCAAGATGGGTAGATCAT ^ '</td><td>TCC159</td><td> 9</td><td>Amaranthus albur, Amaranthus ^ traecizans, Amaranthus hyhridus, Amaranthus 1¿vides, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergi.i, Amaranthus viridis</td>

<td> 1443</td><td>TTGSrrACCTGCACAGTTACTGCTG</td><td>TX159</td><td> 9</td><td>Amaranthus albur, Amaranthus ^ raecisans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus roya, Amaranthus spinosus, Amara nthusr Amaranthus viridis</td>

<td> 1444</td><td>TTTGGTCA & GACTATCATTGATGTT</td><td>TOC34</td><td> 9</td><td>Amaranthus albur, Amaranthus Arreeoisans, Amaranthus hybridus, Amaranthus livid, AiEaranthus paljBerx, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1445</td><td>TTICTTCTGGATAAGMr ^ ATCGATG</td><td>TOC34</td><td>Q</td><td>Amaranthus alhus, Amaranthus araecisansr Amaranthus</td>

<td></td><td></td><td></td><td></td><td>hybcddus, Amaranthus lividus, Amaranthus palm, Amaranthus rudis, Amaranthus spinos us, Amaranthus thunbergii, Amaranthus viridis</td>

<td>144c</td><td>rTTCATG¡aTicc & AATrreGTOüL</td><td>TOC34</td><td> §</td><td>Amaranthus albus, Amaranthus graesísaraz, Amaranthus hybridus. Amaranthtss lividus, Amaran thus palsarz, fezasaathas soáis, Bias'aB.thas spi.nosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1447</td><td>77GTCTTAT € CAGAAGAAA.GCTTTT</td><td>TÜC34</td><td> §</td><td>Amaranthus albur, Amaranthus graeci zaras, Amaranthus hybridus, Ama.ras.thu5 lívidus. Amaran thus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1448</td><td>TTGTCM.CC & iGiTACCCTrACTTC</td><td>7ÜC34</td><td> &</td><td>Amaranthus albur, Amaranthus graeoisans, AnaFjg? * N <hybridus, Amaranthus lividus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spinosus, As-aranthus th usbergii, Amaranthus viridis</td>

<td> 1445</td><td>TTGGICAAGBCCaTCAÍTGATGTrG</td><td>TOC24</td><td> &</td><td>Amaranthus albur, Amaranthus gz-aecisniss, Aaasanthas hybridus, Amerasthus 1.1 vibrate, Amaranthus palmeri ,, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, .Amaranthus viridis</td>

<td> 1450</td><td></td><td>TÜC34</td><td> $</td><td>Amaranthus albur, Amaranthus grae chalk, Amaranthus hybridus, Amaranthss livides, t¿ □ S FAmaranthus rudis, Amaranthus spinosus, Amaranthus thunhesgii, amaranthus viridis</td>

<td> 1451</td><td>TTCTTCTSGKrAlGiCMTCGXTGT</td><td>TÜC34</td><td> 9</td><td>Amaran Chus albur, Amarajíthus fN & eiwfls, Amaranthus hybridus, Amaranthus livídur, Arnaraa thus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus th unbesgii, Amaranthus viridis</td>

<td> 1452</td><td>TTCTGGAIXAGACA & TCGÍTGTX.TT</td><td>TOC-M</td><td> 9</td><td>Amaranthus albus, Amaranthus grae sisaras, & aas ^ jitiius hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbesgii, Amaranthus viridis</td>

<td> 1453</td><td>ITCAT ^ ATAC-CAAATTTG-GTCAAG</td><td>TOC34</td><td> 9</td><td>Amaranthus albur, Amaranthus graeci zaras, Amaranthus hybridus, Amarar.t.tus ¿ividus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus rh unbergii, Amaranthus viridis</td>

<td> 1454</td><td>TSTCAACCAAGATAeCCTT & CTTCC</td><td>TOC34</td><td> 9</td><td>Amaranthus albus, Amaranthus graeoizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spinos u 5 j. Ama ra n thus thunbergíi, Amaranthus viridis</td>

<td> 1455</td><td>T ^ TCAAGACIATCATTGATGTTGT</td><td>TOC34</td><td> 9</td><td>Amaranthus albus, Amaranthus graerizans, Amaranthus hybridus, Amaranthus lividiis, Amaran Ch us palmeri, Amaranthus rudis, Amaranthus spino sus, Amaran thus th unbergii, Amaranthus viridis</td>

<td> 1455</td><td></td><td>TOC34</td><td> 9</td><td>Amaranthus albus, Amaranthus graesizans, Amaranthus hybridus, Amaranthus llvidus, Amaranthus palmeri, Amaranthus rudis, Amaranthus ¡piaos-vis ,. Amaranthus thuabergii, Amaranthus viridis</td>

<td> 1457</td><td>TGGA¿AAO.CAAT € GATGTAXTGCT</td><td>zoca 4</td><td> 9</td><td>Amaranthus albus, Amaranthus graecizans, Amaranthus hybridus, Amaranthus livid, Amararthus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaranthus thunbergii, Asaranthus viridis</td>

<td>uses</td><td>TGGAIGTÜGGGTKJCTTGGTTGAC</td><td>TGC34</td><td> 9</td><td>Amaranthus albur, Amaranthus graeoi zans, Amaranthus hybridus, Amaranthus livid. Shave well palmer! , Amaranthus rudis, Amaranthus spínosus, Amaranthus thuabergíi, Amaranthus viridis</td>

<td> 1459</td><td>IGATGGATTGhGZIACGlAGiCnX:</td><td>TOC34</td><td> 9</td><td>Altaran thus albus, Acurantlus ¡grraeri zans, Amaranthus aybaf-dusF Azsarant & us lividus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spínosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 14 €0</td><td>KATAGTCTTGACCAJaTTTGSaT</td><td>70C34</td><td> 9</td><td>Altaran thus albus, Amaranthus grae-sizans, Amaranthus hybridus, Amaranthus lividus. Amaran thus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaranthus thunberoii, Amaranthus viridis</td>

<td> 1441</td><td>TGACCAAATTTGGTATCCATGAAAC</td><td>TOC34</td><td> 9</td><td>Amaranthus albus, Amaranthus graeci zans, Amaranthus hybridus, Jtaaranthtts lividiss. Artaran thus palmeri, Amaranthus rudis, Amaranthus spínosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1452</td><td>rCTTGACCAAATTT & GTATCCATGA</td><td>TÜC34</td><td> 9</td><td>Amaranthus albur, Amaranthus jraecízans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeri, Amaranihus rudis, Amaranthus spínosus, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>ihuabergi !, ^ isAzs-rtimn viridis</td>

<td> 1462</td><td>TCTTCTGGATAAGACAATCGATGTA</td><td>TCC3Í</td><td> 9</td><td>Amaranthus albus, Amaranthus graeci sars, Amaranthus hybridus, Amaranthus lividus. Amaran th us palme ri, Amatanthus rudis, Amaranthus spiaosus, Amaranthus th unbergii ,. Amaranthus viridis</td>

<td> 1464</td><td>TACAGGAGAAl'GGGC'A-GGG'TCGT</td><td>TÜC75</td><td> 10</td><td>Asaran th us rhlorcs tac'hys, Amaranthus grxerisans, Amaran th us hyhridiss, They will love you lividus, Asaran thus palmer! , Amaranthus rudis, Amaranthus spxsssus, Amaranthus thunbergii, amaranthus viridis, Zuphorbia het ersph yl1a</td>

<td> 2465</td><td>racGjacccTiGcccjiTTCTceTGT</td><td>TOC75</td><td> 10</td><td>Amaras, th us chlrrostarhys,. Amaranthus graesisans, Amaranefr »? hyhridus, jMriathuB lividus, Amaran th us palmer !, Amaranthus rudis, Amaranthus rpxn-osus, Amaranthus rhunrergxi, Amaranthus viridis, Zuphcrbia heterophylla</td>

<td>€ 24 t</td><td>ACGAACCCTrKCCATTCTCCTGTA</td><td>T0C7S</td><td> 10</td><td>You will love your ehioros carhys, Amaranthus graeciians, They will love thus hybrid ^ s ,. They will love thus lividus, They will love thus palmer! Amaranthus rudis, Amaranthus sp.inss us, Amaranthus thunbergii, amaranthus viridis, Zuphsrbxa het erophyl la</td>

<td> 24.67</td><td>ACAGGa & AiTGGGCMCCGTTCGTC</td><td>T0C75</td><td> 10</td><td>Amaranthus chlerostachys, Aztaran thus graerxzans, Amaranthus hybridus. Amaran th us lividus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spisssus, Amaranthus tñunbergxi, Amaranthus viridis, Suphotrbia hetesGphvlla</td>

<td>246S</td><td>TTTGCTGAACATGGAAACGATCTTG</td><td>TOC75</td><td> 9</td><td>Amaran thus shlorostachys, Amaranthos graecisans, Amaran thus hyhridirs, Amaranth us lividus, Amaranthus palmer !, Amaranthus rudis, Amaranthus spxaesus, Amaranthus thimbergü, Amaranthus viridis</td>

<td> 2469</td><td>TTTwAAATGGTTTCTTTGAGACCTG</td><td>7GC7S</td><td> 9</td><td>Amaranthus albus, Amaranthus grae ci zans, Amaranthus hybrxdus, Amaranthus lividus, Amaranthus palmer!,. Amaranthus rudis, Amaranthus spiaosus, Amaranthus thusbexgii, Amaranthus viridis</td>

<td> 2470</td><td>TTTCJTCAMGGTGGAAACGGMG ”</td><td>TOC7S</td><td> 9</td><td>Amaranthus albur, Amaranthus graecizans, Amaranthus hyhridus, Amaranthus lividus.</td>

<td></td><td></td><td></td><td></td><td>They will love Ch us palmer! , Amaranthus rouen, Amaranthus opinesus, Amaranthus thunbergü, Amaranthus viridis</td>

<td> 1471</td><td>TTTCTCAAAGCTTGCTTGCCTGCTT</td><td>T0C75</td><td> 9</td><td>Amaranthus albur, Amaranthus graesi sans, Amaranthus hybridus, Amaranthus lividus. Amarasthus palmer !, Amaranthus rudas, Amaranthus spinosus, Amaranthus thuabergü, Amaranthus viridis</td>

<td> 1472</td><td>ITTCAGirATATCA & GATCCATCTC</td><td>T0C75</td><td> 9</td><td>Amaranthus albur, Amaranthus graesisans, Amaranthus hybridus, Amaranthus lividus, Amaran th as palm tree, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1473</td><td>TTTCAAAGAATGAATCTTCAGTACC</td><td>TOC75</td><td> §</td><td>Amaranthus albas, Amaranthus groes! zans, Amaranthus hybridus, Amaranthus lividus, Amaranthus palmeos, Amaranthus rudas, Amaranthus opines us, Amsranthus thunbergii, Amaranthus viridis</td>

<td> 1474</td><td>tttazattxctcaaa.gcttgcttgc</td><td>T2C75</td><td> 9</td><td>Amaranthus albas, Amaranthus greco! Sans, Amaranthus hybridus, Amaranthus lividus, Amaran th us palmeri, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1475</td><td>TTTAGTTACTTGTGGIATGTTTGAG</td><td>T0C73</td><td> 9</td><td>Amaranthus albur. AmaraπChus groes! sane, Amaranthus hybridus, Amasanthas lividus. Amararth us palmer !, Amaranthus rudis, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis</td>

<td> 1476</td><td></td><td>7QC75</td><td> 9</td><td>They will love thus shlorostarhys, Amaranthus, Amaranthus hybridus, Amaranthus lividus. Amaros th as pxlsaesi, Amaranthus rudis, Amaranthus spxnosus, Amaranthus th.unbergii, Amaranthus viridis</td>

<td> 1477</td><td>TrTAATATASAAGCAGGOAGCAAG</td><td>T0C75</td><td>G</td><td>Amaranthus albur, Amaranthus groes! zojss, Amaranthus hybridus, Amaranthus lividus-, Amaranthus palmer !, Amaranthus rudis, Amaranthus spinosus, Amorasthas thunbergii, Amaranthus viridis</td>

<td> 1478</td><td>rrGTGTGGGAGACCTTCCAAGTTA ”</td><td>ZOC75</td><td> 9</td><td>Amaranthus chlorostachys, Asaranehus groasisans, Amaranthus hybridus. Amaran thus lividus, Amaran thus palmer !, Amaranthus rudis, Amaranthus spinosus, Amasanthus thunbergii, Amaranthus</td>

<td></td><td></td><td></td><td></td><td>vixxdis</td>

<td> 1475</td><td>TTSGTGCM-CTUGaSjkCMKTTSA</td><td>TOC75</td><td> 9</td><td>Amaren thu s ckl ore: te ehps, Amaxanthas graecisan ?, Amaraasiius hybridus. Amanansha? 21vidus, Amaraa Shas palmeri, Amarafithus rudis, spdaesuSj, Amaranthus thunhexgii> r Assaranthus · vixidis</td>

<td> 1480</td><td>TTGGIACTGAAGATTCATzCTTTGA</td><td></td><td> 9</td><td>Asaran chas albur, Amaranthus groed san ?, Amaranthus hybridus, Amaranthas lividus, Asaren thus palmeri, Amarenthus rudis, Amaranthus spinssus ,, Amaranthus thunbergxi, Araerenthus viridis</td>

<td> 1481</td><td>TTGCTTGGCTGCTTCTATATTAXAG</td><td>7OC75</td><td> 9</td><td>Asaranthus albur, Araaran.th.us graeti seas, Aniaranthus hybridus, Amaranthas lividus. Asaranthus palmer !, Amaranthus rudis, Aniaranthus spinesus, Amaranthus thunbexgii, Amaranthus vixidis</td>

<td> 1482</td><td>TTGCTGAííATGSMaaaTCTTGE</td><td>TOC7 5</td><td> 9</td><td>Ameran thus th.2 «roí tsshy s FAmeianthus grae-riians (hybridus, Asaren thus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus spxaesoe, .Amavanthus thunbexgii, amaranthus vixidis</td>

<td> 1483</td><td>rrficc-CATTCTCCTGTM & crrcAS</td><td>KC75</td><td> 9</td><td>Asaran thus rhlososcechys, Amaraashus gxaesieans, Amaranthus hybridus, Amaranthus lividus ,. Amaranthus palmeri, Amaranthus rudis, Amaraníhus spiaosus. Amaranthus thusbergii, »Amaranthus virtáis</td>

EXAMPLE 3

Improved sensitivity of the plant to qlifosate

In this example, growing Amaranthus palmeri is treated with a topically applied composition to induce modulation of a target gene in a plant that includes (a) an agent for conditioning a plant to permeation by polynucleotides and (b) polynucleotides that include the at least one polynucleotide strand that includes at least a segment of 19-25 contiguous nucleotides or more of the target gene of SEQ ID NO: 1-1263 or SEQ ID NO: 1584-1638.The target genes associated with the protein import system to the protoplast include but are not limited to the structural genes encoding proteins of the translocon outer membrane complex (Toe), proteins of the translocon internal membrane complex (Tic ), stroma processing peptidase and chaperone-like proteins.

The following procedure is used for all the tests described in this example. Amaranthus palmen plants approximately four weeks old (glyphosate resistant Palmer amaranth, R-22) are used in this test. The plants are treated with 0.51.0 percent of Silwet L-77 solution recently made with ddH2O. Two fully expanded leaves per plant (one cotyledon, one true leaf) are treated with the polynucleotide / Silwet L-77 solution. The final concentration for each dsRNA polynudeotide was 25 microM) unless otherwise indicated. Twenty microliters of the solution are applied to the upper surface of each of the two pretreated sheets to provide a total of 40 microliters (1-4 nmol polynudeotide) for each plant.

Atomization solutions were prepared on the same day of the atomization. The single oligonucleotide molecules are applied at speeds between 0.04 and 0.18 mg / ml in 20mM potassium phosphate buffer (pH 6.8) are added to atomization solutions 15 to 50 minutes before atomization. One to two ml atomization solutions were applied using a usual low dead volume atomizer (mili applicator) at 75-281 It / h (liters per hectare) to plants 2.54 to 10.16 centimeters high. The treated plants are placed in a greenhouse establishment for either a 14/10 hour temperature and complementary light program of 26.7 / 21.1 ° C or 29.4 / 21.1 ° C. The amount of response relative to non-atomized treatments is collected at various time intervals up to 21 days after treatment.

A common atomizer nozzle used for all applications made with the path atomizer is the Turbo Teejet (015) air induction nozzle with air pressure set to a minimum of 20 psi (pounds per square inch or 160 kpa). In style it is currently being used to decrease shear forces that can damage or otherwise change large macromolecules that can be seen with other nozzle styles. The height of the spray nozzle should be 41-46 centimeters above the top of the plant material. Treatments should be performed when the plants reach the desired size, height or stage of the leaf.

Application rates are chosen in order to achieve percentages of control speeds in the range of 50 percent at the lowest speed up to 90 percent control at the highest speed. The speeds in this control range provide the best efficacy comparisons between the formulations, allowing the separation of relative performance from test samples. The herbicide rate used in these studies is typically at the rate of use recommended by the manufacturer. Occasionally, lower or higher speeds may be necessary, depending on the test objectives. The speed structure used for a given test will depend on the environmental conditions at the time of application of the atomization (time of year), the plant species to be treated (highly susceptible or difficult to eliminate) and the age (or size) of The plants to be treated.

When several Toc75 activating tRNA polynucleotides (Table 3, SEQ ID NO: 1484-1534) were applied to a glyphosate-resistant A. palmen biotype (R22) followed by glyphosate herbicide (fb) treatment (WeatherMax®, Monsanto Co. , St Louis, hereinafter referred to as WMAX), the results shown in Table 4 show the percentage of treated plants 5 demonstrating a reduction in growth. Controls are: untreated (no formulation, no polynudeotide), fb 2X WMAX untreated, formulation (polynudeotide solution / Silwet L-77) fb 2X WMAX, the positive oligo target control of EPSPS (5enolpyruvilimikimato-3-phosphate synthase) were four polynucleotides (1, 3, 4, 5 to 4nm / plant) that target the EPSPS coding sequence of A. palmer !. The treatments are combinations of 10 Toc75 fb 2X WMAX polynucleotides with the formulation. The plants were evaluated 7, 14, and 21 days after treatment (DAT). The experimental results shown in Table 4 show that the glyphosate resistant plants treated become more sensitive to the glyphosate herbicidal effect when the treatment includes homologous polynucleotides or complementary to a gene of the import system of proteins to the chloroplast of the plant.

TABLE 3

Toc75 polynucleotides

<td>> Oligo</td><td>SEQ ID NO:</td><td>Polynucleotide sequence</td>

<td> 52</td><td> 1484</td><td>CTITCTTGCCTGCTTCAATGTTATA</td>

<td> 53</td><td> 14 85</td><td>CCCAGAGAGGTTATATTTCTCAAAG</td>

<td> 54</td><td> 1486</td><td>ATGGACT TCAATGTTTGAAAATAAT</td>

<td> 55</td><td> 1487</td><td>CTTCATTCTGTTCATCATGCCGAGT</td>

<td> 55</td><td>14BB</td><td>CTICATTCTGTTCATCATGCCGAGT</td>

<td> 56</td><td> 1489</td><td>AGC TTAATCTCAACAATAATTCCIC</td>

<td> 56</td><td> 1490</td><td>AGCTTAATCTCAACAATAATTCCIC</td>

<td> 57</td><td> 1491</td><td>CAATATTCCACTCTGTAGTTAGTTC</td>

<td> 58</td><td> 14 92</td><td>CAATATTCCACTCTGTAGTTAGTTC</td>

<td> 59</td><td> 1493</td><td>TTIGGACGACCATGAGGCCCAGGAA</td>

<td> 60</td><td> 1494</td><td>CCCACCTGGCTGTAAAGAAGCCAGT</td>

<td> 61</td><td> 14 95</td><td>TGTTTCGGTGTTGAAAAGAGACGGT</td>

<td> 62</td><td> 1456</td><td>TGTAATGATCTATTAAGACCTTTGA</td>

<td> 63</td><td> 1497</td><td>GTAGTTATCAGTGGTTACTGAACCA</td>

<td> 64</td><td> 1438</td><td>ATGCAAGATCGTCCTTTGGATTAAG</td>

<td> 65</td><td> 1499</td><td>TAC GGATGCACATATTCAAACT TGA</td>

<td> 66</td><td> 1500</td><td>GCTAGGATTATATACACCATCAATA</td>

<td> 67</td><td> 1501</td><td>AGCAGCTTGCTTTGAAAGTTCGGTT</td>

<td> 68</td><td> 1502</td><td>ACAGGACTCAGCTTTCTGCTATTGA</td>

<td> 65</td><td> 1503</td><td>ATCCAGTCCTGGGCCACCGGTAAAC</td>

<td> 70</td><td> 1504</td><td>TATCAACCCAAATAGGAGGAACTIC</td>

<td> 71</td><td> 1505</td><td>GTAATATTTGCTTTCAGACCAGATC</td>

<td> 72</td><td> 1506</td><td>CTTACTCTGCCTTGTGTAATTCTCG</td>

<td> 73</td><td> 1507</td><td>CTTCACATACAAGCCCATAAGTAAA</td>

<td> 74</td><td> 1508</td><td>CTGCTTTCATCCCGTGTTGTAATCT</td>

<td> 75</td><td> 150 9</td><td>CCTCTGGCCAGTAGTGGCAATATGG</td>

<td> 76</td><td> 1510</td><td>CACTAATTCCAC0ATTTGGCAAAAT</td>

<td> 77</td><td> 1511</td><td>CTTAAAGTTGTTGGAGGCCCATCAG</td>

<td> 78</td><td> 1512</td><td>CACCATACGATCAACACCAGTACCA</td>

<td> 79</td><td> 1513</td><td>CTCTTGTAATATTTGCCTGTGCGAA</td>

<td>ao</td><td> 1514</td><td>GCACCATTTACAAACTTTGTATTAT</td>

<td> 81</td><td> 1515</td><td>AAACACATTTCTGTCACCAACTATA</td>

<td> 82</td><td> 1516</td><td>CTATCCCAAGGCCTTGGTCTACCTG</td>

<td> 03</td><td> 1517</td><td>CGGTTGAAAATTGGGAATTTAGTGC</td>

<td> 84</td><td> 1518</td><td>GAACTTGGTTAGTGTCAGTTGATGA</td>

<td> 85</td><td> 1519</td><td>CTTCTTCAACTTCCGTCAGTTGGAG</td>

<td> 86</td><td> 1520</td><td>ACTGGTGGTGGTGATTTTCCAGCAC</td>

<td> 87</td><td> 1521</td><td>AGCATAGTGACCATGTAGGACAAGA</td>

<td>8Θ</td><td> 1522</td><td>AACTTGGAAGGTCTCCCACACAACC</td>

<td> 89</td><td> 1523</td><td>GGIC CCCCAAGGGTGAAAGCCTCAT</td>

<td> 90</td><td> 1524</td><td>CATGTTGTAACCCCTAACTGAATAG</td>

<td> 91</td><td> 1525</td><td>TGTTTCTAGCTGCACCAAGTTCCCC</td>

<td> 92</td><td> 1526</td><td>CGTAACTCAGCAGCAAGCTCAAGAA</td>

<td> 93</td><td> 1527</td><td>CACATGTGTGGTCTTGACAGGTATC</td>

<td> 94</td><td>152 B</td><td>CGTTTCCATGirCAGCAAACGCATA</td>

<td> 95</td><td>152 S</td><td>TTCACGTCTTTAGAGGTTCCAAGAT</td>

<td> 56</td><td> 1530</td><td>CCTGTAAACTTCAGTGGGATTACCC</td>

<td> 97</td><td> 1531</td><td>CATAAGACGAACCCTTGCCCATTCT</td>

<td> 98</td><td> 1532</td><td>ACAAGACCAAGCTTGACACCAACTC</td>

<td> 99</td><td> 1533</td><td>ATGATCGACAGCATACTCGGCTCGA</td>

<td> 100</td><td> 1534</td><td>AAAATAATGAGCCGGTACCAGAATT</td>

TABLE 4

Plants of A, oaZ / ne / 7 treated with activating polynucleotides TOC75 and qlifosato show improved sensitivity to glyphosate, percentage of growth reduction 7, 14, and 21 DAT

<td></td><td></td><td></td><td colspan="3">Days after treatment</td>

<td>Plant</td><td>Polynucleotide treatment</td><td>herbicide</td><td> 7</td><td> 14</td><td> 21</td>

<td>R22</td><td>Untreated control</td><td>do not</td><td> 0</td><td> 0</td><td> 0'</td>

<td>R22</td><td>Untreated control</td><td>do not</td><td> 0</td><td>or</td><td> 0'</td>

<td>R22</td><td>Untreated control fb 2X WMAX</td><td>2X WeatherMAX</td><td> 0</td><td> 30</td><td> 25</td>

<td>R22</td><td>Untreated control fb 2X WMAX</td><td>ZX WeatherMAX</td><td> 0</td><td> 20</td><td> 0</td>

<td>R22</td><td>Untreated control fb 2X WMAX</td><td>2X WeatherMAX</td><td> 0</td><td> 20</td><td> 0'</td>

<td>R22</td><td>Formulation control fb 2X WMAX</td><td>2X WeatherMAX</td><td> 25</td><td> 50</td><td> 40</td>

<td>R22</td><td>Formulation control fb 2X WMAX</td><td>ZX WeatherMAX</td><td> 25</td><td> 50'</td><td> 30</td>

<td>R22</td><td>Formulation control fb ZX WMAX</td><td>ZX WeatherMAX</td><td> 25</td><td> 50·</td><td> 40</td>

<td>R22</td><td>Formulation control fb 2X WMAX</td><td>2X WeatherMAX</td><td> 25</td><td> 40</td><td>3Ü</td>

<td>R22</td><td>EPSPS objective (oligo 1, 3, 4, 5 84nm / pl * nta)</td><td>2X WeatherMAX</td><td> 75</td><td>SW1</td><td> 80</td>

<td>R22</td><td>Objective EPSPS íoligo 1, 3, 4, S ® 4nm / plant)</td><td>2X WeatherMAX</td><td> 85</td><td> 90'</td><td> 90</td>

<td>R22</td><td>Objective EPSPS (oligo 1, 3, 4, 5 ® 4nm / plant)</td><td>ZX WeatherMAX</td><td> 75</td><td> 90</td><td> 90</td>

<td>R22</td><td>EPSPS objective (oligo 1, 3, 4, 5 ® 4nm / plant)</td><td>2X WeatherMAX</td><td> 85</td><td> 90</td><td> 90</td>

<td>R22</td><td>TOC75 Set 1 Coligo 52, 53, 54, 55, yes 8 4nm / plant)</td><td>2X WeatherMAX</td><td> 50</td><td>trust'</td><td> 45</td>

<td>R22</td><td>TOC75 Set 1 (oligo 52, 53, 54, 55, 56 8 4nm / plant)</td><td>2X WeatherMAX</td><td> 85</td><td>H.H</td><td> 70</td>

<td>R22</td><td>TOC75 Set 1 Coligo 52, S3, 54, 55, 56 8 4nm / pl * nta)</td><td>2X WeatherMAX</td><td> 85</td><td> 85</td><td> 70</td>

<td>R22</td><td>TOC75 Set 1 (oligo 52r 53 r54, 55, 5 € § 4nm / plant)</td><td>2X WeatherMAX</td><td> 75</td><td> 80</td><td> 60</td>

<td>R22</td><td>TOC7 & Set 2 (oligo 57, 58, 59, fiO, 61 8 4nm / plant)</td><td>ZX WeatherMAX</td><td> 65</td><td> 80'</td><td> 70</td>

<td>R22</td><td>TOC75 Set 2 Coligo 57, 5B, 59, fiO, 61 8 item / floor)</td><td>2X WeatherMAX</td><td> 75</td><td>SW</td><td>trust</td>

<td>R22</td><td>TOC75 Set 2 (oligo 57, 58, 59, 60, 61 8 4nm / plant)</td><td>2X WeatherMAX</td><td> 75</td><td> 80</td><td> 75</td>

<td>R22</td><td>TOC7S Set 2 (oligo 57, 58, 59, 60, 61 β 4nm / plant)</td><td>2X WeatherMAX</td><td> 75</td><td> 70</td><td> 60</td>

<td>R22</td><td>TOC7S Set 3 (oligo 62, 63, 64, 65, 66 8 4nm / plant)</td><td>2X WeatherMAX</td><td> 50</td><td> 50</td><td> 60</td>

<td>R22</td><td>TQC75 Set 3 (oligo 62, 63, € 4, 65, fifi 8 4nm / plant)</td><td>2X WeatherMAX</td><td> 25</td><td> 50</td><td> 60</td>

<td>R22</td><td>TOC7S Set 3 Coligo 62, 63, 64, 65, 66 8 4nm / plant)</td><td>ZX WeatherMAX</td><td> 25</td><td> 50</td><td> 40</td>

<td>R22</td><td>TOC75 Set 3 Coligo 62, 63, 64, 65, 66 8 4nm / plant)</td><td>2X WeatherMAX</td><td> 25</td><td> 40</td><td> 40</td>

<td>R22</td><td>TOC75 Set 4 (oligo 69. 70, 71 8 4nn / plant)</td><td> 67,</td><td> €8,</td><td>2X WeathezMAX</td><td> 10</td><td> 30’</td><td> 30</td>

<td>R22</td><td>T0C7S Set 4 (oligo 63, 70, 71 @ 4nEí / plant)</td><td> 67,</td><td> 68,</td><td>2X WeathezMAX</td><td> 25</td><td> 40</td><td> 30</td>

<td> 522</td><td>TOC75 Set 4 (oligo 6 9, 70> 71 f 4n »/pla:nt.a)</td><td> €7,</td><td> 68,</td><td>2X WeathezMAX</td><td> 40</td><td> 60</td><td> 50</td>

<td> 523</td><td>TOC7S Set 4 (I say 69, 70, 71 8 4nm / plant)</td><td> 67,</td><td> 66,</td><td>2X WeathezMAX</td><td> 25</td><td> 40</td><td>2S</td>

<td> 522</td><td>TOC75 Set 5 (oligo 74, 75, 76 8 4nm / plant)</td><td> 72,</td><td> 73,</td><td>2K Wea the rMAX</td><td> 25</td><td> 50</td><td></td>

<td> 522</td><td>TCC7S Set 5 {oligo 74, 75, 76 ® 4nn / plant)</td><td> 72,</td><td> 73,</td><td>2X WeathezMAX</td><td> 25</td><td> 50</td><td> 50</td>

<td> 522</td><td>TOC75 Set 5 (oligo 74, 75, 76 8 4nm / plant!</td><td> 72,</td><td> 73,</td><td>2X WeathezMAX</td><td> 25</td><td> 50</td><td> 50</td>

<td> 522</td><td>TOC75 Set 5 (oligo 74, 75, 76 B 4nm / plant)</td><td> 72,</td><td> 73,</td><td>2X WeathezMAX</td><td> 25</td><td> 30</td><td> 25</td>

<td> 522</td><td>TOC7S Set 6 (I say 79, 8-0, 81 B 4nm / plant-a ^</td><td> 77,</td><td>7B,</td><td>2X WeathezMAX</td><td> 35</td><td> 50</td><td> 25</td>

<td> 522</td><td>TOC7S Set 6 (oligo 79, SO, 91 8 4nn / plant)</td><td> 77,</td><td> 78,</td><td>2X WeathezMAX</td><td> 25</td><td>SW</td><td> 30</td>

<td> 522</td><td>TOC7S Set 6 (oligo 79, 30, 91 8 4nn / plant)</td><td> 77,</td><td> 78,</td><td>2X WeathezMAX</td><td> 35</td><td> 50</td><td> 30</td>

<td> 522</td><td>TOC75 Set 6 (oligo 79, 80, 91 8 4nm / plant)</td><td> 77,</td><td> 78,</td><td>2X WeathezMAX</td><td> 50</td><td> 60</td><td> 50</td>

<td> 522</td><td>TOC75 Set 7 (oligo 94, 85, 86 8 4nm / plantJ</td><td> 82,</td><td> 83,</td><td>2X WeathezMAX</td><td> 25</td><td> 30</td><td> 30</td>

<td> 522</td><td>TOC75 Set 7 (oligo 84, 85, 86 8 4nm / plant)</td><td>S2,</td><td> •3,</td><td>2X WeathezMAX</td><td>Ci</td><td> 10</td><td> 30</td>

<td> 522</td><td>T0C7S Set 7 (oligo 84, 85, 86 8 4th / floor)</td><td> 82,</td><td> 83,</td><td>2X WeathezMAX</td><td>3S</td><td> 40</td><td> 30</td>

<td> 522</td><td>T0C75 Set 7 {oligo 84, 85, BS 8 4th / floor)</td><td> 52,</td><td> 83,</td><td>2X WeathezMAX</td><td> 10</td><td> 30</td><td> 20</td>

<td> 522</td><td>TOC75 Set 8 (oligo 89, 90, 91 8 4nn / plant)</td><td> 87,</td><td>SB,</td><td>2X WeathezMAX</td><td> 25</td><td> 30</td><td> 25</td>

<td> 522</td><td>T0C7S Set 8 (oligo 89, 90, 91 8 4nm / plant)</td><td> 87,</td><td> 89,</td><td>2X WeathezMAX</td><td> 25</td><td> 20</td><td> 25</td>

<td> 522</td><td>TOC75 Set 8 Coligo 8 9, 90, 91 8 4ru / plant)</td><td> 87,</td><td>SB,</td><td>2X WeathezMAX</td><td> 25</td><td>5C</td><td> 40</td>

<td> 522</td><td>TOC75 Set 8 (oligo 89, 90, 91 8 4rm / plant)</td><td>to?.</td><td>SB,</td><td>2X WeathezMAX</td><td> 35</td><td> 50</td><td> 40</td>

<td> 522</td><td>TOC75 Set 9 (oligo 94, 95, 96 8 4th / plant¡</td><td> 92,</td><td> 93,</td><td>2X WeathezMAX</td><td> 50</td><td>ÍC</td><td> 40</td>

<td> 522</td><td>TOC75 Set 9 Coligo 94, 95, 96 8 4nm / plant)</td><td> 92,</td><td> 93,</td><td>2X WeathezMAX</td><td> 50</td><td> €0’</td><td> 50</td>

<td> 522</td><td>TOC75 Set 9 Coligo 94, 95, 96 8 4nm / plant)</td><td> 92,</td><td> 93,</td><td>2X WeathezMAX</td><td> 75</td><td> 80</td><td> 60</td>

<td> 522</td><td>TOC75 Set 9 Coligo 94, 95, 96 8 4nm / plant)</td><td> 92,</td><td> 93,</td><td>2X WeathezMAX</td><td> 75</td><td>6S</td><td> 50</td>

<td> 522</td><td>TOC7S Set 10 {oligo 99, 100 and 4nm / plantJ</td><td> 97,</td><td> 98,</td><td>2X WeathezMAX</td><td> 60</td><td> 65</td><td> 65</td>

<td> 522</td><td>TCC75 Set 10 {oligo 99, 100 8 4nm / plant)</td><td> 97,</td><td> 98,</td><td>2X WeathezMAX</td><td> 60</td><td> 70</td><td> 70</td>

<td> 522</td><td>TOC75 Set 10 (oligo 9 9, 10 0 8 4 nja / plant)</td><td> 97,</td><td> 98,</td><td>2X WeathezMAX</td><td> 60</td><td> 75</td><td> 70</td>

99, ICO β 4nzi / plant> WeathezMAX

EXAMPLE 4

Results of the stromal processing peptidase gene and QEP80 gene

Amaranthus palmer ^ bKÑpo plants resistant to glyphosate R22) were treated following the protocol described in Example 3. The activating mRNA polynucleotides shown in Table 5 (SEQ ID NO: 1535-1573, plus strand sequence illustrated) are directed to the coding region of the OEP80 gene of A. palmeri (SEQ ID NO: 365). The polynucleotides were applied topically to 8 nmol / plant in a composition comprising 0.5-1.0 percent Silwet L-77 and buffer after one day after treatment with 2X WeatherMAX (WMAX). The lesion assessment of the treated plants was carried out 14 days after the WMAX treatment. The control treatments were single buffer and 2 rates (4 nmol and 8 nmol) of activating polynudeotide (oligo 5.3) which is directed to the EPSPS coding gene sequence of A. palmen. The initial average level of shock effect of the shock absorber plus WMAX was adjusted to 40 percent for this experiment. The results illustrated in Figure 1 demonstrate that at least 18 polynucleotides (T25452, T25454, T25455, T25456, T25457, T29847, T29848, T25464, T25465, T25466, T25471, T25472, T25473, T25474, T254752, T254292, T2542925, T2542925 They were able to improve the effect of WMAX on this glyphosate resistant biotype. Additionally, 4 regions of the target gene sequence were identified in which polynucleotides in these regions were particularly effective, these regions are between nucleotide positions 369701, 1016-1168, 1364-1622 and 1683-1792 of SEQ ID NO : 365.

TABLE 5

Polynudeotide activating molecules for QEP80 from A. palmen

<td>SEQ ID DO NOT</td><td>Oligo test ID</td><td>Polynucleotide sequence</td>

<td> 1535</td><td>T25445</td><td>GTTATCCCTGAGTCGACCCACTAACTCAACTCAGTCCAAAAACCCTTCAATT TC</td>

<td> 1536</td><td>T25446</td><td>GTCCAAAAACCCTTCAATTTCCTTCTGTCAATCCCTAAATTCTACTCTC</td>

<td> 1537</td><td>T25447</td><td>GTCAATCCCTAAATTCTACTCTCTTACAAGCCAAATTCTCAATTACCCAGTT CATTAATGGC</td>

<td> 1530</td><td> 125448</td><td>GCATCAAACTCCACGGAAACCCCGTTAAGTTTCAATCTTCTCCATCACCATT GC</td>

<td> 1539</td><td> 125449</td><td>GCTATGCTCTTCAACATTGTCTTTGAACGACTCAACTCAGCCTCCAGC</td>

<td> 1540</td><td>T25450</td><td>GCCGGAAGTGGTAGTGTGGTTGAGGTTAGTCAATCGAAATCGGCTTCAGTGA GTCGTAC</td>

<td> 1541</td><td>T25451</td><td>GTACTCGAAGGGAGGATGAAGAGAGAGTGTTGATTAGTGAGGTGTTAGTGAG GAGTAAAGAT GGAGAAGAAT T AGAGAGGAAAG AT T TGGAAT C</td>

<td> 1542</td><td>T25452</td><td>GGAGGCATTAATGGCATTGAAAGCTTGCCGGGCGAATTCAGCTTTGACTGTG C</td>

<td> 1543</td><td>T25453</td><td>GAGAGGTTCAGGAGGATGTTCACAGAATTATTGATAGTGGGTATTTTTCTTC ATGTATGCCAGTTGCAGTGGATAC</td>

<td> 1544</td><td>T25454</td><td>GATACTAGGGATGGTATTAGATTGGTCTTTCAGGTAGAACCAAACCAGGAGT TTAGAGGACTGGTGTGC</td>

<td> 154 5</td><td> 125455</td><td>GCGAAGGAGCTAATGTTCTCCCTTCCAAGTTTGTAGAGGATTCATTTC</td>

<td> 1546</td><td>T25456</td><td>GTGATGGATATGGGAAAGTGGTCAATATCAGGCGTTTGGATGAAGTGATTGA TTC</td>

<td> 1547</td><td> 125457</td><td>GATTCTATAAATGGATGGTACATGGAGCGTGGTCTTTTIGGCATGGTTTC</td>

<td> 1540</td><td> 125458</td><td>GTTTCTGGTGTTGAGATACTTTCAGGGGGTATACTAAGGTIACAAATTTCTG AAGC</td>

<td> 1549</td><td> 125459</td><td>GCTGAGGTCAATGATGTTTCAATCCGCTTCCTTGATCGTAAGACACGTGAGC CAAC</td>

<td> 1550</td><td>T25460</td><td>GCCAACTGTTGGGAAGACAAAGCCAGAAACAATACTTCGACAACTTACAACA AAAAAAGGAC</td>

<td> 1551</td><td>T25461</td><td>GACAGGTATACAGTTTGAATCAAGGGAAAAGGGATGTTGAGACTGTTTTGAC</td>

<td> 1552</td><td> 125462</td><td>GACGATGGGAATCATGGAAGATGTAAGCATTTTTCCCCAGCCTGCTGGAGAT AC</td>

<td> 1553</td><td>T25463</td><td>GATACAGGTAAAGTTGATTTGGTAATGAATGTGGTTGAGCGTGTGAGTGGTG GTTTC</td>

<td> 1554</td><td> 125464</td><td>GTTTCTCGGCTGGTGGTGGTATTTCGAGCGGGATAACGAGCGGACCGC</td>

<td> 1555</td><td>T25465</td><td>GCTATCAGGTTTAATTGGAAGCTTTGCATATTCTCACAGGAATCTGTTTGGA AAAAATC</td>

<td> 1556</td><td> 125466</td><td>GAAAAAATCAAAAAGTAAAT GTCTC TCT TGAAAGAGGCCAAATC GACTCTAT CTTCC</td>

<td> 1557</td><td> 125467</td><td>GGATAAATTATACAGTC CCAT GGATTGAAGGTGATGATAAGCGTACTCAAAG GTC</td>

<td> 155 0</td><td>Τ2546Θ</td><td>GTCAATCATTATTCAGAACTCAAGGACTCCGGGTACTTTGGTCCATGGTAAT C</td>

<td> 1559</td><td> 125469</td><td>GTAATCAAGCTGAAAATAGTAACTTAACTAIT GGCCGTGTAACAGCTGGC</td>

<td> 1560</td><td>T25470</td><td>GCATCGAATTCAGCCGGCCCCTAAGACCCAAATGGAGCGGAACAGCTGGAC</td>

<td> 1561</td><td>T25471</td><td>GACTTACGTTTCAGCATGCTGGTGTCCGTGATGAAAAAGGGAACCCCGTC</td>

<td> 1562</td><td> 125472</td><td>GTCATAAAAGATTTCTACAACAGCGCTCTTACGGCAAGTGGGAATACTCATG ATAATATGC</td>

<td> 1563</td><td>T25473</td><td>GCTGCTTGCCAAAGGCGAGTGTGCCTACACGGGTGACTTAGGATCCTCAATG TTAGTC</td>

<td> 1564</td><td>T25474</td><td>GTCTTAAGCATGGAACAAGGTCTTCCTATCTATCCTGAGTGGCTGTGTTTTA</td>

<td> 1565</td><td>T25475</td><td>GT TTTAATCGAGTCAACGCTCGTGCTAGGTCAGGGGTGGACATTGGTC CAGO</td>

<td> 1566</td><td>T25476</td><td>GCTAATCTTTTTCTCAGTTTGTCTGGTGGTCATGTGGTCGGTAAATTTCCTC CTCATGAAGC</td>

<td> 1567</td><td>T25477</td><td>GTTTGCGATCGGTGGTACAAATAGTGTGAGAGGATATGAAGAAGGTGCCGTT GGC</td>

<td>156Θ</td><td>T2547S</td><td>GCTCAGGCCTTTCATACGTAGTGGGCTGTGGAGAAGTTTCCTTCCCTCTGTA TGGTC</td>

<td> 1569</td><td>T25479</td><td>G'TCCAGTAGATGGCGCTCTTTTTGCTGATTATGGAACGGATCTCGGATCAGG Tic</td>

<td> 1570</td><td>ΤΞ5480</td><td>GTTCATTGGTTCCTGGTGATCCTGCTGGTGCGAGATTAAAACCCGGGAGTGG ATAC</td>

<td> 1571</td><td>T25481</td><td>GGCTATGGATTTGGTATCCGTGTCGAGTCTCCATTAGGTCCTCTACGGTTAG AGTATGC</td>

<td> 1572</td><td>T25482</td><td>GCATTTAACGACAGACAAGCGAGGCGGTTTCATTTTGGCGTAGGTCATCGGA AC</td>

<td> 1573</td><td>T29213</td><td>GGATATGAAGAAGGTGCCGTTGGC</td>

Stroma processing peptidase is a key enzyme in the protein import system to plant chloroplast. Amaranthus palmeri plants (R22 glyphosate-resistant biotype) were treated following the protocol described in Example 3. The activating mRNA polynucleotides shown in Table 6 (SEQ ID NO: 1574-1583, plus the strand sequence illustrated) were direct to the stromal processing peptidase of A. palmen (SPP, SEQ ID NO: 936) or coding region of the Toc75 gene (SEQ ID NO: 260). SPP polynucleotides were applied topically in 2 combinations of polynucleotides, oligos 1, 4, 5 and 6, and oligos 2, 7, 8 and 9, at 3nmol / plant in a composition comprising 0.1 percent Silwet L-77 and buffer followed one day later by treatment with 2X WeatherMAX (WMAX). The injury rate of the treated plants was conducted 21 days after WMAX treatment. The control treatments were buffer alone and a combination of 4 nmol of each of the 4 activating polynucleotides (oligo 1, 2, 3 and 5) that target the EPSPS coding gene sequence of A. palmen. The average initial level of the WMAX treatment injury effect was 41 percent for this experiment. The results shown in Table 7 demonstrate that directing the stromal processing peptidase gene with homologous or complementary activating polynucleotides to the gene coding sequence improves plant sensitivity to glyphosate herbicidal effects.

TABLE 6 Sequence of activating molecules for Toc75 v stromal processing peotidase gene targets

<td># Oligo</td><td>SEQ ID NO</td><td>Sequence</td><td>Target gene</td>

<td> 1</td><td> 1574</td><td>TCAAGAAGTGGGATGTTGATAAAATAAAAAAATTTCATGA</td><td>SPP</td>

<td> 2</td><td> 1575</td><td>TGAAAGGTGTTCTAGAGGATGACATTCAAAAAGTCGAAGA</td><td>SPP</td>

<td> 3</td><td> 1576</td><td>GCAaGAAAGCTTTGAGAAaTATAACCTCTcTGGGATtATT</td><td>TOC75</td>

<td> 4</td><td> 1577</td><td>CGGAGAAGAGGGTCATTAATAAAAAATGTTCGTTCAAGAT</td><td>SPP</td>

<td> 5</td><td> 1578</td><td>ATTTAGTCAGACTGGCTTGGAGAATGAGACAGAGGCTTCCC</td><td>SPP</td>

<td> 6</td><td> 1579</td><td>ATTAAAGACACTGATGAAAGAGCCTGTGCCTATATTGCTGG</td><td>SPP</td>

<td> 7</td><td> 1580</td><td>AGAAATATCCCGCTGGTGATGGCGGTGATTTAAAGAAAAAG</td><td>SPP</td>

<td> 8</td><td> 1581</td><td>TGACATGAGTTTCTTGAAGCAAGAGCTACTTTCATTAGTA</td><td>SPP</td>

<td> 9</td><td> 1582</td><td>CTGTGGCATCTCCAGAAGACGTCGAAGCTGTAAAGAAAAT</td><td>SPP</td>

<td> 10</td><td> 1583</td><td>TCTTGAGCTTGCTGCTGAGTTACGGATACCTGTCAAGACCA</td><td>TOC75</td>

TABLE 7

Results of stromal processing peptidase v Toc75

<td>Treatment</td><td>replications</td><td>Control percentage 14 DAT</td><td>Dev. est.</td>

<td>Single shock absorber</td><td> 4</td><td> 0</td><td> 0</td>

<td>EPSPS objective (oligo 1, 3, 4, 5 at 4 nm / plant)</td><td> 4</td><td> 97</td><td> 4</td>

<td>Stroma processing peptidase 1 (oligo 1, 4, 5, 6 at 3 nm / plant)</td><td> 4</td><td> 64</td><td> 6</td>

<td>Stroma 2 processing peptidase (oligo 2, 7, 8, 9 at 3 nm / plant)</td><td> 4</td><td> 65</td><td> 17</td>

<td>TOC75 (oligo 3.10 at 3 nm / plant)</td><td> 4</td><td> 83</td><td> 12</td>

<td>Shock absorber + glyphosate</td><td> 4</td><td> 41</td><td> 15</td>

EXAMPLE 5

Enhanced qlifosate sensitivity of the herbicide resistant plant

In this example, Amaranthus pa / mer {R-22) herbicide resistant plants were treated with a topically applied composition comprising a cRNA molecule comprising a sequence of antisense strand polynucleotides identified as SEQ ID NO: 1639 (GAUUACCCUUGACGUCUUUAGAGCUUCCAAGAUCGUUUCCAUGUUCCUUUCCAUGUUCCUUUCCAUGUUCCUUUCCAUGCAUCCA or a dsRNA molecule comprising the antisense strand polynucleotide sequence identified as SEQ ID NO: 1640 (GACCCUUGAUGUUUCUGUGUUCAAAAGAGACAGUUCCGCCUGGCUGGAAGGAAGC) to induce the modulation of the expression of a TOC75 target gene in the Amaranthus plant which includes an agent for conditioning a permeation plant by polynucleotides of

DsRNA

Approximately four-week Amaranthus palmeri plants (glyphosate resistant Palmer amaranth, R-22) propagated by cuttings were initially used in this test. The plants were treated with a 0.5 percent Silwet L-77 formulation composition, 20 mM sodium phosphate buffer, 2 percent ammonium sulfate with or without dsRNA polynucleotides (SEQ ID NO: 1639 or SEQ ID NO: 1640). The amount of mRNA polynucleotide applied to each plant in the treatments was 2, 4, 8 and 16 nmol. Four replications of each treatment were carried out. Treatment with the TOC75 activating tRNA polynucleotides (SEQ ID NO: 1639 or SEQ ID NO: 1640) at several doses of nanomoles (nmol) was followed by a treatment (fb) with a glyphosate herbicide (WeatherMax®, Monsanto Co., St Louis, hereinafter referred to as WMAX) 24 hours after formulation treatment. 2X WMAX is equal to 2058 grams of active ingredient / hectare (g ai / ha). The results in Table 8 show the average percentage of treated plants that demonstrate a reduction in growth measured as plant height in relation to untreated control plants (no formulation or WMAX applied). Formulation control is without polynucleotides and fb 2X WMAX. All formulation treatments that contain the dsRNA polynucleotides are fb 2X WMAX. The plants were evaluated 11 days after treatment (DAT). The results of the experiments show that the herbicide resistant plants treated became more sensitive to the glyphosate herbicidal effect when the treatment included the rRNA polynucleotides of SEQ ID NO: 1639 at a dose as low as 2 nmol or SEQ ID NO : 1640 at a dose as low as 8 nmol.

TABLE 8

A, paimeri glyphosate resistant plants treated with activated polynucleotides

TOC75 v glyphosate showed improved sensitivity to glyphosate, percentage growth reduction 11 DAT

<td>Treatments</td><td>Average percentage of growth reduction of 4 replications</td><td>Dev. est.</td>

<td>2b fb control formulation WMAX</td><td> 28</td><td> 13</td>

<td>Formulation + tRNA SEQ ID NO: 1639 2 nmol fb 2X WMAX</td><td> 96</td><td> 3</td>

<td>Formulation + tRNA SEQ ID NO: 1639 4 nmol fb 2X WMAX</td><td> 93</td><td> 5</td>

<td>Formulation + tRNA SEQ ID NO: 1639 8 nmol fb 2X WMAX</td><td> 91</td><td> 3</td>

<td>Formulation + tRNA SEQ ID NO: 1639 16 nmol fb 2X WMAX</td><td> 97</td><td> 3</td>

<td>Formulation + tRNA SEQ ID NO: 1640 2 nmol fb 2X WMAX</td><td> 18</td><td> 19</td>

<td>Formulation + siRNA SEQ ID NO: 1640 4 nmol fb 2X WMAX</td><td> 29</td><td> 10</td>

<td>Formulation + siRNA SEQ ID NO: 1640 8 nmol fb 2X WMAX</td><td> 52</td><td> 27</td>

<td>Formulation + siRNA SEQ ID NO: 1640 16 nmol fb 2X WMAX</td><td> 99</td><td> 0</td>

EXAMPLE 6

Improved sensitivity of the herbicide plant resistant to glyphosate WMAX) or mesotrionaíCallisto)

In this example, glyphosate-resistant palmen Amaranthus plants (R-22 or BL65, isolated glyphosate-resistant field variants) were treated with a topically applied composition comprising a cRNA molecule comprising an antisense strand polynucleotide sequence identified as SEQ ID NO: 1641 to induce the modulation of the expression of a target OEP80 gene in the Amaranthus plant that includes a conditioning agent of a plant for permeation by polynucleotides of dsRNA.

Amaranthus palmen plants of approximately four weeks (resistant to glyphosate R-22 or BL65) propagated from cuttings were used in this test. The plants were treated with a 0.5 percent Silwet L-77 formulation composition, 20 mM sodium phosphate buffer, 2 percent ammonium sulfate with or without dsRNA polynucleotides (SEQ ID NO: 1641). The amount of mRNA polynucleotide applied to each plant in the treatments was 16 nmol. Four replications of each treatment were conducted. Upon treatment with the OEP80 activating mRNA polynucleotides comprising an antisense polynucleotide (SEQ ID NO: 1641, 5GAAACCAUGCCAAAAAGACCACGCUCCAUGUACCAUCCAUUUAUAGAAUC-3 ') and its complementary sense polynucleotide SEQ ID NO: 1547, also referred to as T25457) at 16 nmol was followed by a treatment (fb) with a glyphosate herbicide (WeatherMax®, Monsanto Co., St Louis, now referred to as WMAX) or mesotrione (Callisto®, Syngenta, Greensboro, NC) 24 hours after formulation treatment. 2X WMAX is equal to 2058 grams of active ingredient / hectare (g ai / ha) and 0.05X and 0.125X Callisto are equal to 5.2 and 13 grams of active ingredient / hectare (g ai / ha), respectively. All treatments of the formulation containing the dsRNA polynucleotides are fb 2X WMAX or 0.05X Callisto or 0.125X Callisto. The plants were evaluated 14 days after the treatment (DAT). The results of the experiments shown in Tables 9-12 show that the herbicide-resistant plants treated became more sensitive to the herbicidal effect of glyphosate or Callisto® when the treatment included T25457 mRNA polynucleotides at a dose of 16 nmol or T43701 (a mRNA polynucleotide that has an excess of 2 nucleotides at each 3 'end consisting of nucleotides at position 8-28 of SEQ ID NO: 1641 (underlined segment above) and nucleotides at position 25-45 of SEQ ID NO: 1547) at a dose of 16 nmol.

The results in Table 9 and 10 show the results of two experiments that include the dsRNA polynucleotides (T25457 or T43701) that increase the average percentage of glyphosate treated plants that demonstrate a reduction in growth measured as fresh weight of the plant with relation to the control plants (fb 2X WMAX formulation without the RNAbc molecules).

TABLE 9

A. paimeri (BL65) glyphosate resistant plants treated with QEP80 v glyphosate activating polynucleotides show improved glyphosate sensitivity, growth reduction percentage 14 DAT

<td>Treatments</td><td>Average percentage of growth reduction of 4 replications</td><td>Standard deviation</td>

<td>Formulation) of control fb 2X WMAX</td><td> 49</td><td> 19</td>

<td>Formulation + tRNA T25457 16 nmol fb 2X WMAX</td><td> 97</td><td> 3</td>

TABLE 10

A. paimeri (Β22Ί glyphosate resistant plants treated with OEP8Q and glyphosate activating polynucleotides show improved glyphosate sensitivity, percent growth reduction 14 DAT

<td>Treatments</td><td>Average percentage of growth reduction of 4 replications</td><td>Standard deviation</td>

<td>Formulation of control fb 2X WMAX</td><td> 16</td><td> 15</td>

<td>Formulation + tRNA T25457 16 nmol fb 2X WMAX</td><td> 86</td><td> 8</td>

<td>Formulation + tRNA T43701 16 nmol fb 2X WMAX</td><td> 85</td><td> 13</td>

The results in Table 11 and 12 show the results of two experiments that include the dsRNA polynucleotides (T25457 or T43701) that increase the average percentage of plants treated with Callista® that demonstrate a reduction in growth measured as fresh plant weight with relation to untreated control plants (fb Callista® formulation without the RNAb polynucleotides).

TABLE 11

A. palmeri (BL65) plants resistant to qlifosate with QEP80 v calist activating polynucleotides show improved sensitivity to Callisto®, growth reduction percentage 14 DAT

<td rowspan="2"> 5 10</td><td colspan="2">Treatments</td><td>Average percentage of growth reduction of 4 replications</td><td>Deviation standard</td>

<td>Control formulation 0,125X Callisto®</td><td>fb</td><td> 30</td><td> 17</td>

<td> 15</td><td>Formulation + tRNA t25457 nmol fb 0,125X Callisto®</td><td> 16</td><td> 91</td><td> 5</td>

TABLE 12

A. palmen (R22) glyphosate resistant plants treated with activator polynucleotides QEP80 and Callisto® show improved sensitivity to Callisto®, growth reduction percentage 14 DAT

<td colspan="2">Treatments</td><td>Average percentage of growth reduction of 4 replications</td><td>Deviation standard</td>

<td>Control formulation 0,125X Callisto®</td><td>fb</td><td> 23</td><td> 17</td>

<td>Formulation + tRNA t25457 nmol fb 0,125X Callisto®</td><td> 16</td><td> 65</td><td> 5</td>

<td>Control formulation 0.05X Callisto®</td><td>fb</td><td> 2</td><td> 31</td>

<td>Formulation + tRNA T43701 nmol fb 0,05X Callisto®</td><td> 16</td><td> 49</td><td> 13</td>

EXAMPLE 7

A method to control weeds in a field.

A method for controlling weeds in a field comprises the use of one or more activating polynucleotides of the chloroplast protein import system that can modulate the expression of an endogenous weed gene in one or more target weed plant species. A weed control composition comprising multiple herbicides and multiple polynucleotides can be used in a field environment to control the growth of A. palmeri plants. An analysis of the gene sequences of the chloroplast protein import system of 20 plant species provides a collection of 25-mer polynucleotides (SEQ ID NO: 1264-1483) that can be used in compositions to affect growth, development or sensitivity the glyphosate herbicide to control multiple weed species in a field. A composition containing 1, 2, 3, 4 or more of the polynucleotides of SEQ ID NO: 1264-1483 or at least one polynucleotide of at least 19 contiguous polynucleotides and at least 85 percent identical to SEQ ID NO: 1264 -1483 that could allow extensive activity of the composition against multiple weed species or variant populations that occur in a field environment.

The method further includes creating an agricultural chemical composition comprising components that include at least one polynucleotide of at least 19 contiguous polynucleotides and at least 85 percent identical to SEQ ID NO: 1-1263 or SEQ ID NO: 1584-1638 or any another polynucleotide that modulates the expression of the effective gene essentially identical or essentially complementary to SEQ ID NO: 1-1263 or SEQ ID NO: 1584-1640 or fragment thereof and a transfer agent that mobilizes the polynucleotide in a plant cell and a glyphosate-containing herbicide and, optionally, a polynucleotide that modulates the expression of an essential gene and, optionally, a herbicide that has a mode of different action in relation to glyphosate. The polynucleotide of the composition includes a dsRNA, mRNA or cDNA or a combination thereof. A composition containing a polynucleotide can have a usage rate of approximately 1 to 30 grams or more per 4047 m2 depending on the size of the polynucleotide and the number of polynucleotides in the composition. The composition may include one or more additional herbicides as necessary to provide effective control to multiple weed species. For example, a composition comprising a gel activating polynucleotide of the chloroplast protein import system, wherein the composition further includes a co-herbicide that includes, but it is not limited to acetochlor, acifluorfen, adfluorfensodium, aclonifen, acrolein, laclor, aloxidim, allyl alcohol, ametrine, amicarbazone, amidosulfuron, aminopiralid, amitrole, ammonium sulfamate, anilofos, asulam, atrazine, bichlorchin, atrazine, atrazine, azethum, atrazine, azetham , beflubutamide, benazolin, benfluralin, be nfuresate, bensulfuron, bensulfuronmethyl, bensulide, bentazone, benzfendone zone, benzobic, clone, benzofenap, bifenox, bánfos, bisp¡ribac, bisp iribacsodium, borax, bromacil, bromobutide, bromoxynil, butachlor, butafenacil, butamifos, butraline, butroxidim, bu tilato, cacodylic acid, broth chlorate, cafenstrol, carbetamide, carfentrazone, carfentrazonaethyl, CDEA, CEPC, chlorflurenol, chlorflurenol-methyl, chloridazone, dor¡muron, chlorimuron-et, lo, chloroacetic acid , cinosulfurone, dsanil¡da, cletodim, clodinafop, clodinafoppropargyl, clomazone, clomeprop, clop¡ral¡d, chloransulam, chloransulam-methyl, CMA, 4-CPB, CPMF, 4CPP, CPPC, cresol, cumiluron, cyanamide, cánana¡na, dcloato, cclosulfamuron, c¡cloxid¡m, cihalofop, cihalofo p-butyl, 2,4-D, 3,4-DA, daimuron, dalapon, dazomet, 2,4-DB, 3 , 4-DB, 2,4DEB, desmedifam, dicamba, dichlorbenyl, ortho-dichlorobenzene, para-dichlorobenzene, dichlorprop, dichlorprop98

P, didofop, didofop-methyl, diclosulam, diphenzoquat, d¡fenzoquat methyl sulfate, d¡flufen¡can, diflufenzopir, dimefuron, dimepiperate, dimetachlor, dmetamethrin, dimetenamide, dimetenamide-P, dimethipinz dimethylarsinic acid, dinitramine, dinoterb, d¡fenamid, diquat, diquat dibromide, dithiopir, diuron, DNOC, 3,4DP, DSMA, EBEP, endotal, EPTC, esprocarb, etalfluralin, etametsulfuron, etametsulfuronmethyl, ethofumesate, ethoxyphatrazide ethoxybenzenesulfide , phenoxaprop-P, phenoxaprop-Petyl, fentrazamide, sulfate Ferrous, flamprop-M, flazasulfuron, florasulam, fluazifop, fluazifopbutilo, fluazifop-P, fluazifop-P-butyl, flucarbazone, flucarbazone-sodium, flucetosulfuron, fludoralina, flufenacet, flufenpyr, flufenpiretilo, flumetsulam, flumiclorac, flumidoracpentilo, flumioxazin, fluometuron, fluoroglycofen, fluoroglicofenoetilo, flupropanate, flupyrsulfuron, flupyrsulfuron-methyl-sodium, flurenol, fluridone, fluoroclor¡dona, fluroxypyr, f1urtamona, flut¡acet, flutiacetmetilo, fomesafen, foramsulfuron, fosamine, glufosinate, glufos¡nato ammonium, halosulfuron, halosulfurónmetilo, haloxyfop, haloxifop- P, HC-252, hexazinone, imazamethabenz, imazamethabenz, imazamox, imazapic, mazapir, imazaquin, imazethapyr, imazosulfuron, indanofan, iodomethane, iodine sulfided, iodosulfuron-methyl-sodium, ioxin¡lo, isoproturon, isouron, soxaben, soxaclortol, isoxaflutol, karbut¡lato, lactofeno, read it, linuro η, Μ AA, Μ AM A, MCPA,MCPA-thioeti lo, MCPB, mecoprop, mecoprop P, mefenacet, mefluidide, mesosulfuron, mesosulfuronmethyl, mesotrione, metam, metamifop, methamitron, metazachlor, meta benzthiazuron, methylarsonic acid, methyldmronate, isothiocyanatolate, methylthiocyanate, methylthiocyanate Metosulam, Methoxuron, Metribuzin, Metsulfuron, Metsulfuron-Methyl, MK66, Molinate, Monolinuron, MSMA, Naproanilide, Napropamide, Naptalam, Neburon, Nitrosulfuron, Acidononanoic Acid, Norflurazone, Oleic Acid (Fatty Acids) Arglolo, oxadiazon, oxasulfuron, oxaziclomephone, oxfluoro rfen, paraquat, paraquat dichloride, pebulato, pendimethalin, penoxsulam, pentachlorophenol, pentanochlor, pentoxazone, petoxamid, petroleum ceites, fenmedifamthyl Chloram, pinacholine, pinoxaden, plperophores, potassium arsenite, potassium azide, pretilator, primisulfuron, primisulfuron, prodiamine,profluazol, profox¡d¡m, prometon, prometräna, propachlor, propanyl, propaquizafop, pro pazina, profam, propisoclor, propoxycarbazone, propoxycarbazonease, propizamide, prosulfocarb, prosulfuron, praclon, pylorfluphene, piloraphile , pyrazolinate, pyrazulfuron, pyrazulfuronyl, pyrazoxin, pyribenzoxim, pibutylcarb, pyridafol, pyrdada, pyriftalid, p¡r¡m¡nobac, methyl pyriminobac, pimimulfan, piritiobac, piritiobacsodio, quinclorac, quinmerac, quinoclamine, quizalofop, qu¡zalofop, r¡msulfuron, setox¡d¡m, siduron, simazina, symmetry, SMA, sodium arsenite, sodium azide, sodium chlorate, sulcotrione, sulfentrazone, sulfometuron, sulfometuron-methyl, sulphosphate, sulfosulfuron, sulfuric acid, tar oils, 2,3,6-TBA, TCA, TCAsodium, tebutyuron, tepraloxidim, terbacillus, terbumeton, terbutylazine, terbutrine, tenlchlorine , t¡azop¡r, tifensulfur ón, tifensulfuron-methyl, thiobencarb,thiocarbazil, topramezone, tralcoxidim, triamate, trisasulfuron, triaziflam, tribenuron, tribenuronmethyl, tricamba, triclop¡r, tr¡etazine, trifloxisulfuron, trifloxisulfuronium, trifluralin, triflusulfuron, triflusulfur, triflusulfur, triflusulfur, triflusulfur, triflusulfur, triflusulfur, triflusulfurd, triflusulfurd tosulfuron, [3- [2-chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl-2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy acid ethyl ester ¡] 2-Pyridyloxy] acetic acid (CAS RN 353292-3-6), 4 - [(4,5-d¡hydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl -sulfamoyl] -5-methylthiophene-3-carboxylic (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy ) methyl] -6- (trifluoro-methyl) -3-pyridi-nyl] carbonyl] -bicyclo [3.2.] oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡ -3 - [[2- (3methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] -bicyclo [3.2.] Oct-3-en-2-one.trisulfuron, triaziflam, tribenuron, tribenuronmethyl, tricamba, triclop¡r, tr¡etazina, trifloxisulfuron, trifloxisulfuronodium, trifluralin, triflusulfuron, triflusulfuron-methyl, trih¡droxitr¡az¡na, 3-trifthyl acid, ester - [2-Chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl-2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy,] 2-pyridyloxy] acetic ( CAS RN 353292-3-6), 4 - [(4,5-d¡hydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl-sulfamoyl] -5-methylthiophene- 3-carboxylic (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl] -6- (trifluoro -methyl) -3pyridi-nyl] carbonyl] -bicyclo [3.2.] oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡-3 - [[2- ( 3methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] -bicyclo [3.2.] Oct-3-en-2-one.trisulfuron, triaziflam, tribenuron, tribenuronmethyl, tricamba, triclop¡r, tr¡etazina, trifloxisulfuron, trifloxisulfuronodium, trifluralin, triflusulfuron, triflusulfuron-methyl, trih¡droxitr¡az¡na, 3-trifthyl acid, ester - [2-Chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl-2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy,] 2-pyridyloxy] acetic ( CAS RN 353292-3-6), 4 - [(4,5-d¡hydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl-sulfamoyl] -5-methylthiophene- 3-carboxylic (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl] -6- (trifluoro -methyl) -3pyridi-nyl] carbonyl] -bicyclo [3.2.] oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡-3 - [[2- ( 3methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] -bicyclo [3.2.] Oct-3-en-2-one.trifloxisulfuron, trifloxisulfuronodium, trifluralin, triflusulfuron, triflusulfuron-methyl, trihydroxitrile, trichthosulphon, ethyl ester of [3- [2-chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl- 2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy, 2-pyridyloxy] acetic acid (CAS RN 353292-3-6), 4 - [(4,5-d¡] hydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl-sulfamoyl] -5-methylthiophene-3-carboxylic acid (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl] -6- (trifluoro-methyl) -3pyridi-nyl] carbonyl] -bicyclo [3.2.] Oct- 3-en-2-one (CAS RN 35200-68-5), and 4-hydroxy-3 - [[2- (3-methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] - bicycle [3.2.] oct-3-en-2-one.trifloxisulfuron, trifloxisulfuronodium, trifluralin, triflusulfuron, triflusulfuron-methyl, trihydroxitrile, trichthosulphon, ethyl ester of [3- [2-chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl- 2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy, 2-pyridyloxy] acetic acid (CAS RN 353292-3-6), 4 - [(4,5-d¡] hydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl-sulfamoyl] -5-methylthiophene-3-carboxylic acid (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl] -6- (trifluoro-methyl) -3pyridi-nyl] carbonyl] -bicyclo [3.2.] Oct- 3-en-2-one (CAS RN 35200-68-5), and 4-hydroxy-3 - [[2- (3-methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] - bicycle [3.2.] oct-3-en-2-one.[3- [2-Chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl-2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy "] ethyl ester 2-pyridyloxy] acetic acid (CAS RN 353292-3-6), 4 - [(4,5-dihydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl-sulfamoyl ] -5-methylthiophene-3-carboxylic (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl ] -6- (trifluoro-methyl) -3pyridi-nyl] carbonyl] -bicyclo [3.2.] Oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡-3 - [[2- (3methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] -bicyclo [3.2.] Oct-3-en-2-one.[3- [2-Chloro-4-fluoro-5 - (- methyl-6-trifluoromethyl-2,4-dioxo-, 2,3,4-t-etrahydropyrimidin-3-yl) phenoxy "] ethyl ester 2-pyridyloxy] acetic acid (CAS RN 353292-3-6), 4 - [(4,5-dihydro-3-methoxy-4-methyl-5-oxo) -H-2,4-triazolylcarbonyl-sulfamoyl ] -5-methylthiophene-3-carboxylic (BAY636), BAY747 (CAS RN 33504-842), topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl ] -6- (trifluoro-methyl) -3pyridi-nyl] carbonyl] -bicyclo [3.2.] Oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡-3 - [[2- (3methoxypropyl) -6- (difluoromethyl) -3-pyridinyl] carbon-yl] -bicyclo [3.2.] Oct-3-en-2-one.topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl] -6- (trifluoro-methyl) -3pyridi-nyl] carbonyl] -biccclo [3.2 .] oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡-3 - [[2- (3methoxpropyl) -6- (difluoromethyl) -3-pyridinyl] carbon -il] -bic¡clo [3.2.] oct-3-en-2-one.topramezone (CAS RN 2063-68-8), 4-hydroxy-3 - [[2 - [(2-methoxyethoxy) methyl] -6- (trifluoro-methyl) -3pyridi-nyl] carbonyl] -biccclo [3.2 .] oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydrox¡-3 - [[2- (3methoxpropyl) -6- (difluoromethyl) -3-pyridinyl] carbon -il] -bic¡clo [3.2.] oct-3-en-2-one.

A field of crop plants in need of weed plant control is treated by application of atomization of the composition. The composition may be provided as a tank mixture, a sequential treatment of components (in general, the polynucleotide followed by the herbicide), a simultaneous treatment or mixing of one or more of the components of the composition from separate containers. Field treatment can occur as frequently as necessary to provide weed control and the components of the composition can be adjusted to target weed families or specific weed species.

EXAMPLE 8

Herbicidal compositions comprising pesticidal agents

A method for controlling weeds and pests of plants and pathogens in a field of glyphosate tolerant crop plants is provided by applying a herbicidal composition having a polynucleotide, an organosilicone surfactant (approximately 0.1 percent or greater), and a non-polynucleotide herbicide. and an agent for pest control. The polynucleotide is essentially identical or essentially complementary to a segment of a gene sequence that is a component of a chloroplast protein import system of one or more of the target weed species. The activating oligonucleotide has at least 19 nucleotides of

100 length and is at least 85 percent identical to a segment of a gene sequence of SEQ ID NO: 1-1263 and 1584-1638 isolated from weed species. The nonpolyudeotidic herbicide is preferably a glyphosate composition and the pest control agent is preferably an insecticide, fungicide, nematocide, bactericide, acaricide, growth regulator, chemosterilizer, semi-chemical, repellent, attractant, pheromone, food stimulant or other compounds. biologically active or biological agents, such as microorganisms.

For example, the mixture comprises a fungicidal compound for use in a glyphosate tolerant crop plant to prevent or control plant diseases caused by a plant fungal pathogen. The fungicidal compound of the mixture can be a contact or systemic fungicide or mixtures of each. More particularly, the fungicidal compound includes, but is not limited to members of the chemical groups: strobilurins, triazoles, chloronitriles, carboxamides and mixtures thereof. The composition may additionally have a mixture comprising an insecticidal compound or agent.

The activating polynucleotides of the chloroplast protein import system and WeatherMAX® tank mixtures (WMAX) with fungicides, insecticides or both are tested for use in soy. Soy rust is a significant problematic disease in South America and a serious problem in the United States. The tests are conducted to develop a method for using mixtures of the WMAX formulation and various commercially available fungicides for weed control and soybean rust control. Field plots are planted with Soyas Ready®. All plots receive a post-plant application of the trigger EPSPS + WMAX trigger approximately 3 weeks after planting. Mixtures of activator + WMAX or activator + WMAX + fungicide + insecticides are used to treat the plots in the Rl stage of soybean development (first flowering) of treatment. Data are taken by weed control percentage at 7 and 21 days after Rl treatment, soy safety (percentage of necrosis, chlorosis, growth rate): 5 days after treatment, disease classification, and yield of soy (busheles / Acre). These mixtures and treatments are designed to provide simultaneous weed and pest control for soy, such as fungal pest control, for example, soybean rust diseases; and insect pest control, for example, aphids, soldier worms, borers, beetles, bed bugs and leaf borers.

Agricultural chemicals are provided in containers suitable for transport, distribution and safe storage, stability of chemical compositions, mixed with solvents and instructions for use. A container of a mixture of an activating oligonucleotide + glyphosate + fungicidal compound, or a mixture of an activating oligonucleotide + glyphosate compound and an insecticidal compound, or an activating oligonucleotide + a

101 glyphosate compound and a fungicidal compound and an insecticidal compound (for example, lambdacihalotrin, Warrier®). The container can also provide instructions on the effective use of the mixture. The containers of the present modalities can be of any material that is suitable for the storage of the chemical mixture. The containers of the present modalities can be of any material that is suitable for the shipment of the chemical mixture. The material can be cardboard, plastic, metal or a composite of these materials. The container can have a volume of 0.5 liters, 1 liter, 2 liters, 3-5 liters, 5-10 liters, 10-20 liters, 20-50 liters more, depending on the need. A tank mixture of an activating oligonucleotide + glyphosate compound and a fungicidal compound is provided, those skilled in the art know the methods of application to the culture to achieve an effective dose of each compound and can be refined and further developed depending on the culture, conditions Climate and application equipment used.

Insecticides, fungicides, nematocides, bactericides, acaricides, growth regulators, chemosterizers, semiochemicals, repellents, attractants, pheromones, food stimulants or other biologically active compounds can be added to the activating oligonucleotide to form a multi-component pesticide giving a protective spectrum agricultural even wider. Examples of such agricultural protectors with which the compounds of the present embodiments can be formulated are: insecticides such as abamectin, acetate, azinphos-methyl, biphentrine, buprofezin, carbofuran, chlorphenapir, chlorpyrphos, chlorpyrifos-methyl, ciflutrin, beta-ciflutrin, cihalotrine, lambda-cihalotrine, deltamethrin, diaphentiuron dimethylzuron dimethyltinthiozethane, dimethyltinthiozethane , phenoxycarb, fenpropatrin, fenvalerate, fipronil, flucitrinate, tau-fl uval innate, phonophores, imidacloprid, isophenphos, malathion, metaldehyde, methamidophos, methioning, methtyl, methoprene, methoxychlor, 7-Chloro-2,5-dihydro-2 - [[N- (methoxycarbonyl) -N- [4 (trifluoromethoxy!) Phenyl] amino] carbonl] ndene [1, 2-e] [1, 3, 4] oxad¡az¡n-4a (3H) -methyl carboxylate (DPX-JW062), monocrotophos, oxamyl, parathion, parathion-methyl, permethrin, forate, phosalone, phosmet, phosphatidon, pyrimicarb, prophenophos, rotenone, sulprophos, tebufenozido, teflutrina, terbufos, tetradorvinfos, thiodicarb, tralometrina, trichlorfón and triflumuron; more preferably a glyphosate compound is formulated with a fungicidal compound or combinations of fungicides, such as azoxystrobin, benomyl, blasticidine-S, Bordeaux mixture (tribasic copper sulfate), bromuconazole, captafol, captane, carbendazim, chloroneb, chlorothalonil, oxidoride. copper, copper salts, cymoxanil, cyproconazole, cyprodinyl (CGA 219417), diclomezine, dichloro, diphenoconazole, dimetomorph, diniconazole, diniconazole-M, dodine, ediphenphos, epoxiconazole (BAS 480F), famoxadone, fenarimol, fenbuconazole, fenpiclonil, fenpropidin, fenpropimorph, fluazinam, fluquinconazole, flusilazole, flutolanil, flutriafol, folpet, fosetyl-aluminum, furalaxyl, hexaconazole, ipconazole, iprobenfos, iprodione, isoprothiolane, kasugamycin, kresoxim-methyl, mancozeb, maneb, mepronyl, metalaxyl, metconazole,

102

S-methyl 7-benzothiazolcarbthioate (CGA 245704), miclobutanyl, neo-asozine (ferric methanosonate), oxadixyl, penconazole, pencicurone, probenazole, prochlorazine, propiconazole, pyrifenox, piroquilon, quinoxiphene, spiroxamzol, tephoconazole, spiroxamconazole, spiroxamcinate , thiabendazole, thiophanate-methyl, tiram, triadimefon, triadimenol, triciclazole, trifloxystrobin, triticonazole, validamycin and vinclozoline; combinations of fungicides are common, for example, ciproconazole and azoxystrobin, diphenoconazole, and metalaxyl-M, fludioxonyl and metalaxyl-M, mancozeb and metalaxyl-M, copper hydroxide and metalaxyl-M, ciprodinyl and fludioxonil, ciproconazole and propiconazole; Commercially available fungicide formulations for Asian soybean rust disease control include, but are not limited to Quadris® (Syngenta Corp), Bravo® (Syngenta Corp), Echo 720® (Sipcam Agro Inc), Headline® 2,09EC (BASF Corp), Tilt® 3,6EC (Syngenta Corp), PropiMax ™ 3,6EC (Dow AgroSciences), Bumper® 41,8EC (MakhteshimAgan), Folicur® 3,6F (Bayer CropScience), Laredo® 25EC (Dow AgroSciences), Laredo ™ 25EW (Dow AgroSciences), Stratego® 2.08F (Bayer Corp), Domark ™ 125SL (Sipcam Agro USA), and Pristine®38% WDG (BASF Corp) may be combined with glyphosate compositions as described herein to provide enhanced protection from soybean rust disease; nematicides, such as aldoxicarb and fenamiphos; bactericides, such as streptomycin; acaricides, such as amitraz, quinomethionat, chlorobenzylate, cyhexatin, dicofol, diene chloro, ethoxazole, fenazaquin, fenbutatin oxide, fenpropatrin, fenpyroximate, hexithiazox, propargite, pyridaben and tebufenpirad; and biological agents such as Bacillus thuringiensis, BaciHus thuringiensis delta endotoxin, baculovirus, and entomopathogenic bacteria, viruses and fungi.

Contents65

428 sheets

Sheet 1
Sheet 2
Sheet 3
Sheet 4
Sheet 5
Sheet 6
Sheet 7
Sheet 8
Sheet 9
Sheet 10
Sheet 11
Sheet 12
Sheet 13
Sheet 14
Sheet 15
Sheet 16
Sheet 17
Sheet 18
Sheet 19
Sheet 20
Sheet 21
Sheet 22
Sheet 23
Sheet 24
Sheet 25
Sheet 26
Sheet 27
Sheet 28
Sheet 29
Sheet 30
Sheet 31
Sheet 32
Sheet 33
Sheet 34
Sheet 35
Sheet 36
Sheet 37
Sheet 38
Sheet 39
Sheet 40
Sheet 41
Sheet 42
Sheet 43
Sheet 44
Sheet 45
Sheet 46
Sheet 47
Sheet 48
Sheet 49
Sheet 50
Sheet 51
Sheet 52
Sheet 53
Sheet 54
Sheet 55
Sheet 56
Sheet 57
Sheet 58
Sheet 59
Sheet 60
Sheet 61
Sheet 62
Sheet 63
Sheet 64
Sheet 65
Sheet 66
Sheet 67
Sheet 68
Sheet 69
Sheet 70
Sheet 71
Sheet 72
Sheet 73
Sheet 74
Sheet 75
Sheet 76
Sheet 77
Sheet 78
Sheet 79
Sheet 80
Sheet 81
Sheet 82
Sheet 83
Sheet 84
Sheet 85
Sheet 86
Sheet 87
Sheet 88
Sheet 89
Sheet 90
Sheet 91
Sheet 92
Sheet 93
Sheet 94
Sheet 95
Sheet 96
Sheet 97
Sheet 98
Sheet 99
Sheet 100
Sheet 101
Sheet 102
Sheet 103
Sheet 104
Sheet 105
Sheet 106
Sheet 107
Sheet 108
Sheet 109
Sheet 110
Sheet 111
Sheet 112
Sheet 113
Sheet 114
Sheet 115
Sheet 116
Sheet 117
Sheet 118
Sheet 119
Sheet 120
Sheet 121
Sheet 122
Sheet 123
Sheet 124
Sheet 125
Sheet 126
Sheet 127
Sheet 128
Sheet 129
Sheet 130
Sheet 131
Sheet 132
Sheet 133
Sheet 134
Sheet 135
Sheet 136
Sheet 137
Sheet 138
Sheet 139
Sheet 140
Sheet 141
Sheet 142
Sheet 143
Sheet 144
Sheet 145
Sheet 146
Sheet 147
Sheet 148
Sheet 149
Sheet 150
Sheet 151
Sheet 152
Sheet 153
Sheet 154
Sheet 155
Sheet 156
Sheet 157
Sheet 158
Sheet 159
Sheet 160
Sheet 161
Sheet 162
Sheet 163
Sheet 164
Sheet 165
Sheet 166
Sheet 167
Sheet 168
Sheet 169
Sheet 170
Sheet 171
Sheet 172
Sheet 173
Sheet 174
Sheet 175
Sheet 176
Sheet 177
Sheet 178
Sheet 179
Sheet 180
Sheet 181
Sheet 182
Sheet 183
Sheet 184
Sheet 185
Sheet 186
Sheet 187
Sheet 188
Sheet 189
Sheet 190
Sheet 191
Sheet 192
Sheet 193
Sheet 194
Sheet 195
Sheet 196
Sheet 197
Sheet 198
Sheet 199
Sheet 200
Sheet 201
Sheet 202
Sheet 203
Sheet 204
Sheet 205
Sheet 206
Sheet 207
Sheet 208
Sheet 209
Sheet 210
Sheet 211
Sheet 212
Sheet 213
Sheet 214
Sheet 215
Sheet 216
Sheet 217
Sheet 218
Sheet 219
Sheet 220
Sheet 221
Sheet 222
Sheet 223
Sheet 224
Sheet 225
Sheet 226
Sheet 227
Sheet 228
Sheet 229
Sheet 230
Sheet 231
Sheet 232
Sheet 233
Sheet 234
Sheet 235
Sheet 236
Sheet 237
Sheet 238
Sheet 239
Sheet 240
Sheet 241
Sheet 242
Sheet 243
Sheet 244
Sheet 245
Sheet 246
Sheet 247
Sheet 248
Sheet 249
Sheet 250
Sheet 251
Sheet 252
Sheet 253
Sheet 254
Sheet 255
Sheet 256
Sheet 257
Sheet 258
Sheet 259
Sheet 260
Sheet 261
Sheet 262
Sheet 263
Sheet 264
Sheet 265
Sheet 266
Sheet 267
Sheet 268
Sheet 269
Sheet 270
Sheet 271
Sheet 272
Sheet 273
Sheet 274
Sheet 275
Sheet 276
Sheet 277
Sheet 278
Sheet 279
Sheet 280
Sheet 281
Sheet 282
Sheet 283
Sheet 284
Sheet 285
Sheet 286
Sheet 287
Sheet 288
Sheet 289
Sheet 290
Sheet 291
Sheet 292
Sheet 293
Sheet 294
Sheet 295
Sheet 296
Sheet 297
Sheet 298
Sheet 299
Sheet 300
Sheet 301
Sheet 302
Sheet 303
Sheet 304
Sheet 305
Sheet 306
Sheet 307
Sheet 308
Sheet 309
Sheet 310
Sheet 311
Sheet 312
Sheet 313
Sheet 314
Sheet 315
Sheet 316
Sheet 317
Sheet 318
Sheet 319
Sheet 320
Sheet 321
Sheet 322
Sheet 323
Sheet 324
Sheet 325
Sheet 326
Sheet 327
Sheet 328
Sheet 329
Sheet 330
Sheet 331
Sheet 332
Sheet 333
Sheet 334
Sheet 335
Sheet 336
Sheet 337
Sheet 338
Sheet 339
Sheet 340
Sheet 341
Sheet 342
Sheet 343
Sheet 344
Sheet 345
Sheet 346
Sheet 347
Sheet 348
Sheet 349
Sheet 350
Sheet 351
Sheet 352
Sheet 353
Sheet 354
Sheet 355
Sheet 356
Sheet 357
Sheet 358
Sheet 359
Sheet 360
Sheet 361
Sheet 362
Sheet 363
Sheet 364
Sheet 365
Sheet 366
Sheet 367
Sheet 368
Sheet 369
Sheet 370
Sheet 371
Sheet 372
Sheet 373
Sheet 374
Sheet 375
Sheet 376
Sheet 377
Sheet 378
Sheet 379
Sheet 380
Sheet 381
Sheet 382
Sheet 383
Sheet 384
Sheet 385
Sheet 386
Sheet 387
Sheet 388
Sheet 389
Sheet 390
Sheet 391
Sheet 392
Sheet 393
Sheet 394
Sheet 395
Sheet 396
Sheet 397
Sheet 398
Sheet 399
Sheet 400
Sheet 401
Sheet 402
Sheet 403
Sheet 404
Sheet 405
Sheet 406
Sheet 407
Sheet 408
Sheet 409
Sheet 410
Sheet 411
Sheet 412
Sheet 413
Sheet 414
Sheet 415
Sheet 416
Sheet 417
Sheet 418
Sheet 419
Sheet 420
Sheet 421
Sheet 422
Sheet 423
Sheet 424
Sheet 425
Sheet 426
Sheet 427
Sheet 428

16 members in 11 offices

This recordMember, by publication datePriority claim1 more office is in the list below

Priority claims7

Priority claims
Document	Office	Kind	Date
201361787620	United States of America	P	2013-03-15
201361787620	United States of America	P	2013-03-15
61787620	United States of America	–	2013-03-15
2014025305	United States of America	W	2014-03-13
2014025305	United States of America	W	2014-03-13
US201361787620P	–	–	–
WO2014US25305	–	–	–

Members16

Family members, oldest first
Document	Office	Kind
US2014274712A1	United States of America	A1	2014-09-18
CA2905871A1	Canada	A1	2014-09-25
WO2014151255A1	World Intellectual Property Organization (WIPO)	A1	2014-09-25
AU2014235180A1	Australia	A1	2015-10-01
AR095529A1	Argentina	A1	2015-10-21
MX2015013103A	Mexico	A	2015-12-01
EP2970973A1	European Patent Office (EPO)	A1	2016-01-20
UY35474A	Uruguay	A	2016-01-29
CN105452462A	China	A	2016-03-30
BR112015021618A2	Brazil	A2	2017-10-10
MX366909BThis record	Mexico	B	2019-07-30
US10568328B2	United States of America	B2	2020-02-25
AU2014235180B2	Australia	B2	2020-04-16
UA121456C2	Ukraine	C2	2020-06-10
AU2014235180C1	Australia	C1	2020-07-30
EP2970973B1	European Patent Office (EPO)	B1	2020-10-14