Chiral nucleic acid adjuvant.
Abstract
[Problem] The purpose of the present invention is to provide: a stereoisomer of a novel CpG oligonucleotide, which has excellent stability; and a CpG oligonucleotide which has a capability of producing interferon-alpha (IFNalpha). [Solution] The present invention relates to an oligonucleotide which contains two to four sequences each represented by the formula 5'-X1X2CpGX3X4-3' (formula (I)) and has a length of 14 to 32 nucleotides. In formula (I), CpG represents a non-methylated CpG residue having a phosphate skeleton modification, X1X2 represents any one of AA, AT, GA and GT, and X3X4 represents any one of TT, AT, AC and CG. The oligonucleotide has at least one phosphate skeleton modification at an S-form stereoisomer located at a site other than the CpG.

Term
6.8 yearsleft in the term
Expires 12 July 2033.
- Priority
- Filed
- Granted
- Today
- Expires
9 claims: 2 independent, 7 dependent
- 1NOVEDAD DE LA INVENCIÓN Habiendo descrito la presente invención, se considera como novedad, y por lo tanto se reclama como propiedad lo contenido en las siguientes:REIVINDICACIONES 1. Un adyuvante de vacuna que comprende un oligonucleótido que comprende dos a cuatro secuencias cada una representada por 5'-X1X2CPGX3X4-3' y tiene una longitud de 14 a 32 nucleótidos, en donde el CpG es CpG no metilado sin estructuras de fosfato modificadas, en donde el oligonucleótido comprende al menos una estructura de fosfato modificada en un sitio diferente de las partes representadas por 5 1 -X1X2CPGX3X4-3 ', en donde el X1X2 es cualquiera de AA, AT, GA, o GT sin estructuras de fosfato modificadas, y en donde el X3X4 es TT, AT, AC, TC o CG sin estructuras de fosfato modificadas, en donde el oligonucleótido comprende cualquiera de las secuencias representadas por las Secuencias Nos. 1-7, 10-12, 21-24, 26, 29-33, 36, 39, 42, 43, 49-51, 60-62, 64-71, 75, 76, 81-90, 95-97, 99-103, 106, 107, 109-113, y 118, IMPI IMPI INSTrnrro mexicano DE LA «WBltDAO INOIISTRIAL 60 T*C*GACGTT*T*T*GACGTT*T*T*G*G*G*G*G 61 T*C*GACGTT*T*T*GACGTT*T*T*G*A*G*G*G*G 62 T*C*GACGTT*T*T*GACGTT*T*T*G*T*G*G*G*G 64 C*C*GACGTT*T*T*GACGTT*T*T*GACG*G*G 65 T*C*GACGTT*T*A*GACGTT*T*A*GACG*G*G 66 T*C*GACGTT*T*T*GACGTT*T*T*GACG*A*A 67 T*C*GACGTT*T*T*GACGTT*T*T*GAGG*T*T 68 T*C*AACGTT*T*T*AACGTT*T*T*GACG*G*G 69 T*C*GACGTT*T*T*GACGTT*T*T*GGG 70 T*C*GACGTT*T*T*GACGTT*T*T*GACGTTGG 71 T*C*GACGTT*GACGTT*G*G*G 75 T*C*GACGTA*GACGTA*GACG*G*G 76 T*A*GACGAT*T*C*GTCGTC*T*A*GACG*G*G 81 T*C*ATCGAT*T*T*ATCGAT*T*T*GACG*G*G 82 T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGA*T*G*G*G 83 T*C*ATCGAT*T*T*ATCGAT*T*T*AT*C*G*G*G 84 T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*ATCG*G*G 85 T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G 86 T*C*ATCGAT*T*T*ATCGAT*T*T*ATCGAT*A*T*C*G*G*G 87 T*T*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*G*G 88 T*C*ATCGATATCGAT*T*T*G*A*C*G*G*G 89 TCATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G 90 T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*A*T 95 T*C*GACGTTTGACGTTT*G*A*C*G*G*G 96 T*C*ATCGAT*T*T*ATCGAT*T*T*A*T*C*G*G*G 97 G*G*GACGATATCGTCG*G*G*G*G*G 99 G*G*GACGACGTCGTCG*G*G*G*G 100 T*C*GACGACGTCGTCG*G*G*G*G*G 101 T*C*GACGACGTCGTCT*T*T*G*G*G 102 T*A*GACGACGTCGTCT*T*T*G*G*G 103 T*T*GACGACGTCGTCA*A*A*G*G*G IMPI INSTITUTO MEXICANO •E U MOHEDA» INDUTriUAl 106 T*C*ATCGATATCGATT*T*T*G*G*G 107 T*T*ATCGATATCGATA*A*A*G*G*G 109 T*C*GACGAC*T*T*GACGAC*T*T*G*A*C*G*G*G 110 T*C*GACGAC*T*T*GTCGTC*T*T*G*A*C*G*G*G 111 T*T*ATCGATATCGATA*T*C*G*A*T*G*G*G 112 T*T*ATCGATATCGATT*T*A*A*A*G*G*G 113 T*C*ATCGAT*T*T*ATCGAT*T*T*G*A*C*G*T*T 118 T*C*GTCGTTGTCGTTG*A*C*G*A*C*G*G*G en la fórmula anterior, * se refiere a un estereoisómero que tiene estructura de fosfato modificada y al menos uno de Ί Ω * en cada fórmula es el estereoisómero Sp, en la fórmula anterior, CG en un sitio que corresponde a 5'-X1X2CPGX3X4-3' siqnifica CpG no metilado sin estructuras de fosfato modificadas.
- 2El adyuvante de vacuna de conformidad con la -*-5 reivindicación 1, caracterizado porque el X1X2 es GA, y en donde el X3X4 es TT o AC.
- 3El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque al menos una estructura de fosfato modificada en el sitio diferente de la parte representada por 5'-X1X2CPGX3X4-3' comprende fosforotioato.
- 4El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque el oliqonucleótido comprende una secuencia representada como - (G) m - (m es un 69 ¡MPI iiemuio mbocaho , , . ot la monto* c entero de 2 a 10) en cualquier lado de extremo 5' SP'lWdo extremo 3' de la porción CpG, la porción Cps.....siendo 1 'ía· secuencia de 5'-X1X2CPGX3X4-3'.
- 5El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque el oligonucleótido comprende una secuencia representada como - (G) m - (m es un entero de 1 a 6) en lado de extremo 3' de la porción CpG, la porción CpG siendo la secuencia de 5' -X1X2CPGX3X4-3 1 .
- 6El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque el oligonucleótido comprende una secuencia representada como TC, TA, TG, o CC en el lado de extremo 5' de la porción CpG, la porción CpG siendo la secuencia de 5 '-X1X2CPGX3X4-3 ' .
- 7El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque el oligonucleótido comprende al menos una primera porción CpG y una segunda porción CpG, la primera y la segunda porciones CpG siendo la secuencia de 5 '-X1X2CPGX3X4-3 ' , el oligonucleótido no comprende ninguna secuencia entre la primera porción CpG y la segunda porción CpG, o comprende una secuencia representada como -(T) n - (n es un entero de 1 a 3), TA o TC entre la primera porción CpG y la segunda porción CpG.
- 8El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque el oligonucleótido IMPI INSTITUTO MEXICANO DE LA RROHEOAD INDUSTRIAL siguientes secuencias o las consiste de ya sea una de las siguientes secuencias en las substituyen, insertan, eliminan, que 1, 2, o 3 bases se o agregan:t s Pc s Pgacgtt s Pt s Pt s Pgacgtt s Pt s Pt s Pgacggg (SEQ No. 13);t s Pc s Pgacgt s Pt s Pgacgt s Pt s Pgacggg (SEQ No. 18);y g s Pg s Pgacgacgtcgtcg s Pg s Pg s Pg s Pg s Pg (SEQ No. 44), en las secuencias cg indica CpG no metilado sin estructura de fosfato modificada y sp indica que la estructura de fosfato modificada tipo S se agrega entre nucleótidos vecinos.
- 9El adyuvante de vacuna de conformidad con la reivindicación 1, caracterizado porque el oligonucleótido consiste de cualquiera de las siguientes secuencias:t s Pc s Pgacgtt s Pf s Pt s Pgacgtt s Pt s Pt s Pgacggg (SEQ No. 13);t s Pc s Pgacgt s Pt s Pgacgt s Pt s Pgacggg (SEQ No. 18);y gspgspg aC gacgtcgtcg s Pg s Pg s Pg s Pg s Pg (SEQ No. 44), en las estructura estructura secuencias de fosfato de fosfato cg indica CpG no metilado sin modificada y s p indica que la modificada tipo S se agrega entre nucleótidos vecinos. * IMPI
Independent claims9
899 paragraphs in 82 sections, as filed
(54) Title: ADJUVANTE DE NUCLEICO ACIDO QUIRAL. (54) Title: CHIRAL NUCLEIC ACID ADJUVANT.
(57) Summary
The present invention relates to an oligonucleotide containing two to four sequences each represented by the formula 5'-X1X2CpGX3X4-3 '(formula (I)) and having a length of 14 to 32 nucleotides. In formula (I), CpG represents an unmethylated CpG residue having a phosphate backbone modification, X1X2 represents any one of AA, AT, GA and GT, and X3X4 represents any one of TT, AT, AC and CG. The oligonucleotide has at least one phosphate backbone modification in a S-form stereoisomer located at a different site than the CpG.
(57) Abstract [Problem] The purpose of the present invention is to provide: a stereoisomer of a novel CpG oligonucleotide, which has excellent stability; and a CpG oligonucleotide which has a capability of producing interferon-alpha (IFNalpha). [Solution] The present invention relates to an oligonucleotide which contains two to four sequences each represented by the formula 5'-X1X2CpGX3X4-3 '(formula (I)) and has a length of 14 to 32 nucleotides. In formula (I), CpG represents a non-methylated CpG residue having a phosphate skeleton modified, X1X2 represents any one of AA, AT, GA and GT, and X3X4 represents any one of TT, AT, AC and CG. The oligonucleotide has at least one phosphate skeleton modification at an Sform stereoisomer located at a site other than the CpG.
IM Pl ί • '·
<img file="MX356830B_D0001.tif" />
PATENT TITLE No. 356830
Headlines): SHIN NIPPON BIOMEDICAL LABORATORIES, LTD .; WAVE LIFE SCIENCES JAPAN,
ALSO DOING BUSINESS LIKE WAVE LIFE SCIENCES JAPAN, INC.
Address: 2438, Miyanoura-Cho, 8911394, Kagosh¡ma-Sh¡, Kagoshima, JAPAN
Name: ADJUVANT OF OUIRAL NUCLEIC ACID.
Classification:
CIP: C12N15 / 117; A61K39 / 39
CPC: C12N15 / 117; .Α61Κ3 $ / 39; Α01Κ2Ο3 »5 ^ 61; C12N2310 / 17; C12N2310 / 315
To vxrvx. ivInventor (s): TAKEFUMIGEMB / •. SOLteftÜD
Number:
MX / a / 2015/000497
International:
<^ 2áW »<Jí2013. '
Country:
US de -july-de 2Ó12 '
Number:
617671,654
Validity: Twenty years Expiration Date: July 12, 2033 <
Issue Date: June 15, 2018 '' <sup>5</sup>'' '-aC ·' The reference patent, e & oW§a with fundamero-a ^ tobait ^ los 1 ·, 2® fraction V, feaccii ^ ^, / 59 dc ^ aLaw ι P r ^ let ^^ ndra<sup>-</sup>*<sup>-</sup> interpácfenat ye · déla
Industrial.
Inte patert ^ feae. «Ga; yig ^ aa of νβιφ high non-extendable, counted at ¡(É ^ ugly rate ^ rarantener current valid right s.
Who subscribes to this title loM «* '» q. fundamentoWMo di®uesto '»oftlos artlcul® 6 ° ¿« lugs lll / 7 * 6 «Jhde the Law of Industrial Property (Official Gazette of the Federation (DlO» F.) i37 / (je / 199l ^ XBftinna | a el & / M994, BlfflW 12/26 / .W, -47 ^ 999, 01/26/2004, 06/16/2005, 01/25/2006, 06/05/2009, 06/01/2010, '® » Í ^ dB / 0éSúBr2) »dbxi2 yh ^ 4 /.? 0 ^ aWáculo3ri °,» rajf®Wsoa), 4 ° and 12 ° fractions I and lll of the Regulations of the Mexican Institute of the PitoWad KuUisMel (D.0.T * WMÍÍ8 «r reforjad®®. 01% $ 2 «M5 / 07/2004, 07/28/2004 and 09/07/2007); articles 1, 3, 4, 5 “section V subsection a). rie fradS & Wiisrhir statuta. graiWfeg ^ deMilslitutdhMexIcano of Industrial Property (DOF
12/27/1999, amended on 10/10/2002, 07/29/20Μ? Μ®8ββ04ι * Agreement that delegates powers to the Deputy Directors General, Coordinator, Directors DivfSiomdás ^ ritutol ^ ya ^ lsg XdicindbjRegiehñtes Deputy Directors Divisionales, Departmental Coordinators and other subordinates of the Mexican Institute of the iffiM (^ EW | jistrial. (ϋθΐ. 12/15/1999, amended on 02/04/2000, 07/29/2004, 08/04/2004 and 09/13/2007) . '”
This letter is signed with an advanced electronic signature (FIEL), based on articles 7 BIS 2 of the Industrial Property Law; 3rd of its Regulations, and 1 section III, 2 section V, 26 BIS and 26 TER of the Agreement establishing the guidelines for the use of the Electronic Payment and Services Portal (RASE) of the Mexican Institute of Industrial Property, in the procedures indicated.
Pursuant to article III of the WJ Law as of the filing date of (upon request ii
THE DIVISIONAL DIRECTOR OF PATENTS
<img file="MX356830B_D0002.tif" />
NAHANNY CANAL REYES
Original string:
NAHANNY MARISOL CANAL REYESl00001000000403252793 | Tax Administration Service | 1695 || MX / 2018/49629 | MX / a / 2015/000497 | Patent title PCT) 1027 | RGZ | Pág (s) | ng0bhsfXQkMLhjdcxY5VxN NzS lo =
Di gital stamp:
n / KEqUwKD85VuBUPUERK9X8XqHxE¡lfrkzMeZpQlpbzMghvzspWouek4Z50zGDogUjUxknAHcN0j0IP3jGtrO¡SQQu
3 + 5AagAX0) urwmZSIF6jH9vTU0F953jj1XXpw52wHVqqdYbwCe0rfG3eHskX4b1CKPdBcmBf3CJ1yOHU8tJnN1vMS3
M5QhA3SYIP3qSnhe24LvCrGv2rO0awSvlY / ySjkhZU33fAM8O / 06f82CVamQvG4 + tEFGWcw3F0eQNIqYWUKKDD8KQJKKDQZBQDQJQQQQQJQ
Arenal No. 5515. Floor 1, Pueblo Santa María Tepepan, Xochimilco, 15020. Mexico City.
. (55) 53340700 www.gob.mx/impi
<img file="MX356830B_D0003.tif" />
<img file="MX356830B_D0004.tif" />
IMPI MEXICAN INDUSTRIAL PROPERTY STATUTE
CHIRAL NUCLEIC ACID ADJUVANT
<img file="MX356830B_D0005.tif" />
FIELD OF THE INVENTION
This invention is directed to CpG oligonucleotides and a method of using them. In more detail, this invention is directed at curing diseases that are caused by an immune cell that is controlled by dendritic cell activation using CpG oligonucleotide stereoisomer and its stereoisomer.
BACKGROUND OF THE INVENTION
JP 2002-513763 A (Patent Literature 1), JP 2002154397 A (Patent Literature 2), JP 200-2-521489 A (Patent Literature 3) describe CpG oligonucleotide and the method of its manufacture.
JP 2010-504750 A (Patent Literature 4) describes that oligonucleotides, having lipophilic substituted nucleotide analogs outside the CpG portion, cause the production of interferon-ot (IFN-oc).
The following Non-Patent Literature 1 discloses that the CpG oligonucleotide trimer S-form stereoisomer promotes the MAPK signal. All of the descriptions in this reference are incorporated herein by reference.
The following Non-Patent Literature 1 describes PF<sub>2</sub> IMPI <sup>ζ</sup> . INSTITUI »MIXICANO • DE LA WOTOOAP
IWDUPrtlAt
3512676 (Sequence No. 128), all parts of the sequence are phosphorothioate and S-form stereoisomer. Natural oligonucleic acid is readily reduced in vivo.
Whereas phosphoric acid ester linkage is changed from oligonucleic acid (P-0 bond) to phosphoric acid thioester bond (PS bond), the modifications
PS are difficult to reduce in vivo.
Appointment List
Patent Literature
<td>Literature</td><td>of</td><td>Patent</td><td> 1</td><td>JP</td><td> 2002-513763</td><td>TO</td>
<td>Literature</td><td>of</td><td>Patent</td><td> 2</td><td>JP</td><td> 2002-154397</td><td>TO</td>
<td>Literature</td><td>of</td><td>Patent</td><td> 3</td><td>JP</td><td> 2002-521489</td><td>TO</td>
<td>Literature</td><td>of</td><td>Patent</td><td> 4</td><td>JP</td><td> 2010-504750</td><td>TO</td>
Non-Patent Literature
Non-Patent Literature 1 Authur M. Krieg et al.
OLIGONUCLROTIDES 13: pp.491-499 (2003)
Non-Patent Literature 2 Clin Cáncer Res. 2008 Jul 15;
14(14): 4532-42.
SUMMARY OF THE INVENTION
Technical problem
For example, everything from the sequence of the oligonucleotide
CpG described in Non-Patent Literature 2 are phosphorothioate.
Therefore, the CpG oligonucleotides described in
<img file="MX356830B_D0006.tif" />
IMPI
Non-Patent Literature 2 have problems ^^^ TO ^^ tTTÜTOOT ****** · **<sup>1 </sup>inflammation and toxic reaction. When the modification of the phosphorothioate structure is removed from the CpG oligonucleotides described in the Non-Patent Literature
2, nucleotide stability decreases.
An object of the present invention is to provide a stable CpG oligonucleotide stereoisomer.
Another object of the present invention is to provide a CpG oligonucleotide stereoisomer with the ability to produce interferon a (LFN-cz).
Another object of the present invention is to provide a cure for a specific disease by activating dendritic cells with CpG oligonucleotide.
Another object of the present invention is to provide a less cytotoxic CpG oligonucleotide stereoisomer.
Means to Reach the Object
This invention is basically based on the following new finding. It is possible to improve the in-vivo stability of the oligonucleic acid by controlling the molecular conformation of the oligonucleic acid. Thus, it becomes possible to provide a stable oligonucleotide in vivo, without introducing the bond
PS to all of the sequences. Because not all of the sequences have PS binding modification, the oligonucleotide of the present invention has excellent
IMPI
<img file="MX356830B_D0007.tif" />
biocompatibility.
At least one of the above objects is solved by the following invention. That is, the first aspect of the invention relates to an oligonucleotide containing two to four sequences each represented by the formula
5 '-X1X2CPGX3X4-3' (formula (I)) and is 14 to 32 nucleotides in length.
In formula (I), CpG represents unmethylated CpG without modifications of phosphate structure.
Χ1.Χ2 is either AA, AT, GA or GT which may have phosphate structure modification. The AA, AT, GA or GT that can have phosphate structure modification means that it can have 1 or 2 phosphate structure modifications in any of AA, AT, GA or GT. The same as the previous.
X3X4 is TT, AT, AC, TA, it is a TC or CG that can have phosphate structure modification.
The oligonucleotide may have phosphate structure modification at a site other than 5'-XiX<sub>2</sub>C<sub>p</sub>GX3X<sub>4</sub>3'. That is, the oligonucleotide may have a phosphate structure modification in the different section of a CpG portion consisting of 5 '-X1X2CPGX3X4-3'. However, the oligonucleotide having at least one phosphate structure modification in the different section of one of the CpG portions is preferred.
IMPI
<img file="MX356830B_D0008.tif" />
This oligonucleotide is preferred to be VjYq is AT.
GT or GA that can have phosphate structure modification and X3X4, is TT, AT, AC, TA, CG or TC that can have phosphate structure modification.
This oligonucleotide is preferred to be that XiX<sub>2</sub>, is either AA, AT, GA or GT with no phosphate structure modifications and X3X4 is, TT, AT, AC, TC or CG with no phosphate structure modifications preferred.
The site having minus one of the phosphate site structure modification other than 5'-XiX<sub>2</sub>C<sub>p</sub>GX<sub>3</sub>X4-3 'is preferred to be a S-form stereoisomer.
The oligonucleotide of this invention is preferred to include any of the following sequences or to be an oligonucleotide consisting of any of the following sequences.
Formula 1
IMPI
MSMCANO INSTITUTE
OF THE OWN AD INDUSTRIAL
<img file="MX356830B_D0009.tif" />
<td>SEQ No.</td><td>Sequence</td>
<td> 1</td><td></td>
<td> 2</td><td>G ^ * CTCGn * T * T * GTCGn * T * T * GTCGGG</td>
<td> 3</td><td>T * C * AACGTT * T * C * AACGTT * T * T</td>
<td> 4</td><td>TX * AACGTW ^ *. AACGTT * T * T * GG</td>
<td> 5</td><td>T * C * MCGl'r * T * C * MCGn * G * G</td>
<td> 6</td><td>TX * AACOT * TX * íUCGWXXX</td>
<td> 7</td><td>M * MCGn * T * T * AAOGII * T * T * AACGGG</td>
<td> 8</td><td>WAAC (nW * A * AC (nT * I * r</td>
<td>fi</td><td>T * C * AACGT * TAACGTT * T * T</td>
<td> 10</td><td>T * C * AACGTT * T * A * AACGTT * T * A * AACGGG</td>
<td> 11</td><td>M * AACGTTAACGTTAACGGG</td>
<td> 12</td><td>T <stGACGTT * T * T * GACGn * T * T * = GACGGG</td>
<td>IS</td><td>G ^ <XlACGT * T + T * TGACtT + r * T * TGACGGGGG</td>
<td> 16</td><td>T ^ COrWWTGAOT ^</td>
<td> 17</td><td>WCACGT * 1 * GACGT * T * GAOGGG</td>
<td> 20</td><td>M ^ ACGT * T * GACGT * T * GACGT * T * GACGGG</td>
<td> 21</td><td>TK> OCGTT * T * A * AACGTT * T * A * AACGTT * T * A * AACGGG</td>
<td> 22</td><td>TX> GACGTWM * MCG1T * T * A * GACGTT * T * A * AACGG €</td>
<td> 23</td><td>TXXSACGTTAAQjTTAACGTTAACGGG</td>
Formula 2
<td> 2-1 25</td><td>«ZÍAa7n * T * A * .WffiTC7AGACaX _ __ .............................. TKX ^ Í * AD3T '«GT *« SGG</td>
<td> 26</td><td></td>
<td> 29</td><td>Tcoanw'íw, AroTiw</td>
<td>M</td><td>T ^ <ACVrT * T * I *; MOT * T * T * GACGT * G * <</td>
<td> 31</td><td></td>
<td> 32</td><td></td>
<td> 33</td><td></td>
<td> 36</td><td></td>
<td> 37</td><td></td>
<td> 38</td><td></td>
<td> 3!)</td><td>WATOT <«« TOAT * T * T * ATOGG</td>
<td> 10</td><td></td>
<td> 11</td><td></td>
<td> 12</td><td>(ΧΧΛΧΑΤΑΤσ.'ΓΟΧΧΧΧΧ.</td>
<td> 13</td><td>GXXAÍ'ÍAOTOCTOÍXIXXXX)</td>
<td>ifi</td><td>i ^ GaiACGATCGTCCXXlKXlX;</td>
<td> «</td><td>(XXACGCCCGTCCXXXXXXX-</td>
<td> }8</td><td>fi * eWrO0TOWW</td>
<img file="MX356830B_D0010.tif" />
Formula 3
IMPI
MHBCANO INSTITUTE
BC THE PROPERTY INOU5TMAI
<td> 49</td><td></td>
<td> 50</td><td>ixxiAa; nTreMcmw ^ A «^ G ^</td>
<td> 51</td><td>TCAÚACGTlTrCAa} Tm<sup>5</sup>K5 * A ^ * GMX;</td>
<td> 52</td><td>TOGACGT * W5ACGT * T <AOSG * G</td>
<td> 53</td><td>TKMA (XW ^ OT * WA03 * 3 * G</td>
<td> 54</td><td>το6Αα; τ * τ «Ααίτ * τ ^ αΒ <» <ί</td>
<td>Sa</td><td>T <^ CAix * 1> GAOGW * GACT<sup>s</sup>*€</td>
<td> 56</td><td>T ^ ACGT * T * GACGT * T »G * A * C * G * G * G</td>
<td> 57</td><td>T <MlACGHGAOGl * TKr * A <Xl * G * G</td>
<td>to</td><td>t ^ atotatoga * toa * cx: * g <:</td>
<td> 59</td><td></td>
<td> 60</td><td>T «OtGOt1WflW ^</td>
<td> 61</td><td>Τ <Χ5ΑΟΠΤ * ϊ * τ * ^^</td>
<td> 62</td><td>WKMCGTWWACOT ^</td>
<td> 63</td><td>T ^ xMCGW7 * Aa; mi * A <: <xx;</td>
<td> 64</td><td>(xwAaaww ^^</td>
<td> 65</td><td>T </ * GACGn ^ * A <7ACGn * T * A * GAOG * G * G</td>
<td> 66</td><td>ΤίόΐίΑβιΓΤ ^</td>
<td> 67</td><td>T <X.ACGK * T * T «AajTM> 4X¿A (Ii * T * T</td>
<td> 68</td><td>τ <> Μα'Π ^ * Μα5ΤΊ * τ * τ · αοχ> κ ^</td>
<td> 69</td><td></td>
<td> 70</td><td>TC ^ CtHWWOffiT ^^</td>
<td> 71</td><td>T <XACGTPH3A0GTr * G * G * G</td>
<td> 72</td><td>T ^ ACGn ^ T ^ MACXni ^ WMCGMX »</td>
<td> 73</td><td>Τ ^^ Αθπ «Φ) Φ» € * Αί ^ ΤΤ (} ΑΟβ ^</td>
<td> 74</td><td>T <^ ACGn * T * l ^ ACGn * T * T <> ACGOG</td>
<td> 75</td><td>TM? AGACGTA * GACGTA * GAC & w> G</td>
<td> 76</td><td>T * A «AOT <W« jW (> r * A ^ C »* G * e</td>
<td> 77</td><td>T * A ^ m <XlTCGT * A * GACG * (j * G T * C ^ A07riWW «^</td>
<td> 79</td><td>T <M ^ ACGn * T ^ m ^ <^ C <r * W ^ A * C = »€ <* G</td>
IMPI
<img file="MX356830B_D0011.tif" />
Formula 4
<td> 80</td><td>T <X7 * AOíTn * T * MOJAC * T * T ^ * A'K: = <lX> G</td>
<td> 81</td><td>T ^ ATO1AW «* AT« 3AI * T * T ^ CX? IW</td>
<td> 82</td><td></td>
<td> 83</td><td>WATWAWWT ^^^</td>
<td> 84</td><td>TmmW ^ ATa »ATW * AWTW * ATO <<sub>I</sub><G</td>
<td> 85</td><td></td>
<td> 86</td><td>Τ<sup>!</sup>ΟΑΤ (ΌΑΤ * Φ ^ * ΑΤ € 6Αΐ ^ Τ * Φ ·<sup>,</sup>ΑΤϋΰΑΤ * Α * Τ * € * 0 * € * 0</td>
<td> 87</td><td>T> TMTCX¡AW ^ AT0} AT * W ^ * O «* G * G</td>
<td> 88</td><td>T ^ ATffiATATffiAT + T + WWÍXS + ÍM,</td>
<td> 89</td><td></td>
<td> 90</td><td>WtATOJAWWAT ^^</td>
<td> 91</td><td>TOGADCT * WACGWOOGWOG ^</td>
<td> 92</td><td>T = i <X1 * AG ^<sup>i</sup>K1 * ACX1T * T4GM'KX * G * G</td>
<td> 93</td><td>Tm * ^ WW ^ ATW ^ AC-to *> G</td>
<td> 94</td><td>W * AnC6AT * .W ^^</td>
<td> 95</td><td>T ^ XiACGTnGACGTTT + frFA ^ frt'G + G</td>
<td> 96</td><td>T <* ATreAT * T * T * ATOGAT * T * T * A * T * t> G * G'Kj</td>
<td> 97</td><td>G * G * GACGATAT3GTCG * G * 3 * G * G * G</td>
<td>i »</td><td>G ^ ACíMXW ^</td>
<td> 99</td><td>(W * GACGAa7PX, TC [? <XMl * (.;</td>
<td> 100</td><td>T * C ^ ACGAan''3GTCG ^ * G * G * G * G</td>
<td> 101</td><td>T<sup>i</sup>OGACG7iCGT (7GTCT * T * T * G * G<sup>i</sup>w5</td>
<td> 102</td><td>T * A4GACGACGTCGTCT * T * 1 '* G * GX1</td>
<td> 103</td><td>W'f «^ A (STOTaMM>«> G * G</td>
<td> 10-1</td><td>T * C * GACGTAGACGTCT * T * T * G * G * G</td>
<td> 105</td><td>TOGACGTAGACGTTT * A * G * G4GK1</td>
<td> 106</td><td>T * C * ATCCATATCGATT * T * T * G * G * G</td>
<td> 107</td><td>T * MTOATATCGATAMM * S * G * G</td>
<td> 108</td><td>T * C * GAra'AGAO3ATCGA »WG * G</td>
<td> 109</td><td>WGACGA (M ^ ACXJAC * W ^ AOG * G * G</td>
<td> 110</td><td>T ^^ A (XjAC * T * T * GTCXjTC * T * 7 * G * A * C * & * G * <5</td>
<td>lll</td><td>TmTCímw, Tw * »or * A * r * cxw;</td>
<td> 112</td><td>WtAl <XATATOGATT »1WA * A« <> G * G</td>
<td> 113</td><td>T ^ ATCGAW ^ * ATCX ^ I * T * r * ^ Á * (Xi <r<sup>!</sup>n '</td>
<td> 1.14</td><td>T * C5AT € GA * T * AT <OAn ^ A <:<sup>!</sup>KM? «} ^</td>
<td> 115</td><td>W * ATCXSAT * ATCCA * T * G * G * G</td>
<td> 116</td><td>M: * GTCGTTGTffiT * T * G * A * tXl * i.Xl</td>
<td> 117</td><td>Ί * ίΧ * 1ίΌΊΊ * Ι * Τ ^^</td>
<td> 118</td><td>T ^ T «WrOGnXA <> G * A ^ XX * G</td>
In the previous formula * indicates the ester ^^ -
<img file="MX356830B_D0012.tif" />
mkicajio INSTIFUTo orsomer of the PROR1FDAD caused by the structure modification ¿^ “fosTato, 'at least one of the * is stereoisomer of form S. The CG of the section that corresponds to 5' -XiX<sub>2</sub>C<sub>p</sub>GX3X<sub>4</sub>-3 in the formula above means unmethylated CpG without phosphate structure modifications.
The oligonucleotide of this invention is preferred to be that ΧχΧ<sub>2</sub> is GA, and X<sub>3</sub>X<sub>4</sub> it is TT or AC.
The oligonucleotide of this invention is preferred to be that at least one of the phosphate structure modifications of different sites of 5'-XxX<sub>2</sub>C<sub>p</sub>GX<sub>3</sub>X<sub>4</sub>-3 'is an oligonucleotide having phosphorothioate.
The sequence consisting of 5'-XxX2C<sub>p</sub>GX<sub>3</sub>X<sub>4</sub>-3 'of formula (I) is defined as CpG portion. The oligonucleotides of this invention are preferred to have a sequence of (G)<sub>m</sub>- (m is 2 to 10 integers) per 5 'end or 3' end of the CpG portion.
<td>The</td><td>oligonucleotide</td><td>of</td><td>this invention</td><td>I know</td><td>prefer</td><td>for</td>
<td colspan="2">have a sequence of</td><td>- (G</td><td colspan="2"> )<sub>m</sub> - (m is 1 to</td><td>6 integers)</td><td>by</td>
<td>extreme</td><td>5 'or 3' end</td><td colspan="2">of the CpG portion.</td><td></td><td></td><td></td>
<td>The</td><td>oligonucleotide</td><td>of</td><td>this invention</td><td>I know</td><td>prefer</td><td>for</td>
<td colspan="2">have a sequence of</td><td>TC,</td><td>TA, TG or CC in</td><td>the</td><td>point that</td><td>this</td>
<td>near</td><td colspan="2">at the 5 'end of the</td><td>CpG portion.</td><td></td><td></td><td></td>
<td>The</td><td>oligonucleotide</td><td>of</td><td>this invention</td><td>I know</td><td>prefer</td><td>for</td>
ΙΜΡΙ ί η mwicano institute <sup>υ</sup> DfLA «OPIEDAD
INDUSTRIAL include at least the first CpG portion and the second portion
CpG. The first CpG portion and the second CpG portion are directly linked or the first CpG portion and the second CpG portion include a partial sequence which are represented as - (T)<sub>n</sub> - (n is an integer from 1 to 3), TA or TC between the first CpG portion and the second CpG portion.
The oligonucleotide consists of either one of the following sequences or sequences in which 1, 2, or 3 bases are substituted, inserted, deleted, or added:
t<sup>sp</sup>c<sup>sp</sup>gacgtt<sup>sp</sup>t<sup>sp</sup>t<sup>sp</sup>gacgtt<sup>sp</sup>t<sup>sp</sup>t<sup>sp</sup>gacggg (SEQ No. 13);
t<sup>sp</sup>c<sup>sp</sup>gacgt<sup>sp</sup>t<sup>sp</sup>gacgt<sup>sp</sup>t<sup>sp</sup>gacggg (SEQ No. 18); yg<sup>sp</sup>g<sup>sp</sup>gacgacgtcgtcg<sup>sp</sup>g<sup>sp</sup>g<sup>sp</sup>g<sup>sp</sup>g<sup>sp</sup>g (SEQ No. 44), in the sequences cg indicates unmethylated CpG with modification of the phosphate structure and sp indicates that the modification of form S of the phosphate structure is added between neighboring nucleotides.
These oligonucleotides are preferred to show the same stability or activity as Sequences Nos. 13, 18 or 44.
In the sequence, the cg indicates unmethylated CpG with a phosphate structure modification.
The oligonucleotide of this invention is preferred to be t<sup>Sp</sup>c<sup>Sp</sup>gacgtt<sup>Sp</sup>t<sup>Sp</sup>t<sup>Sp</sup>gacgtt<sup>Sp</sup>t<sup>Sp</sup>t<sup>Sp</sup>gacggg (Sequence No. 13), t<sup>Sp</sup>c<sup>Sp</sup>gacgt<sup>Sp</sup>t<sup>Sp</sup>gacgt<sup>Sp</sup>t<sup>Sp</sup>gacggg (Sequence No. 18) og<sup>Sp</sup>g<sup>Sp</sup>gacgacgtcgtcg<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g (Sequence No. 44).
IMPI
<img file="MX356830B_D0013.tif" />
In the sequence, cg indicates unmethylated CpG with a phosphate structure modification.
This invention also provides a composition comprising the oligonucleotides described above.
This invention also provides a vaccine adjuvant comprising the oligonucleotides described above.
This invention also provides a dendritic cell interferon-oi (IFN-α) production inducer with any of the oligonucleotides described above.
This invention also provides a medical agent having an effective amount of the oligonucleotide described above as an active ingredient, wherein the medical agent is for the cure of infectious diseases, cancer, respiratory diseases, allergic diseases, autoimmune disease, or wounds.
Effect of the Invention
In accordance with the present invention, it is possible to provide a new CpG oligonucleotide with superior stability.
In accordance with the present invention, it is possible to provide a CpG oligonucleotide with immune adjusting power.
In accordance with the present invention, it is possible to provide a medical agent comprising factors
IMPI
<img file="MX356830B_D0014.tif" />
immunomodulators, which comprise a CpG oligonucleotide as an active ingredient.
In accordance with the present invention, it is possible to provide CpG oligonucleotide having less cytotoxicity.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a photograph of gel electrophoresis related to sequences Nos. 26 to 28 to evaluate the stability of serum of the oligonucleotide of form S and form R.
Figure 2 is a photograph of gel electrophoresis · related to sequences Nos. 43 to 45 to evaluate the stability of serum of the oligonucleotide of form S and form R.
Figure 3 is a photograph of gel electrophoresis related to sequences Nos. 33 to 35 to evaluate the stability of serum of the oligonucleotide of form S and form R.
DETAILED DESCRIPTION OF THE INVENTION
The first aspect of the present invention relates to oligonucleotides 14-32 nucleotides in length comprising
5'-XiX2C<sub>p</sub>GX<sub>3</sub>X4-3 '(Formula 1) sequences 2 to 4 times.
MEXICAN INSTITUTE <r? Fe
CE LA MOHIOAO Ó »,
INDUSTRIAL
Oligonucleotide or oligo means multiple sugar link nucleotides (for example ribose or deoxyribose) * (i.e. groups of phosphate and substituted organic bases (either of substituted pyrimidines (for example cytosine (C), thymine (T) or uracil ( U)) or substituted purine (eg adenine (A) or guanine (G))). As used in this specification, the term "oligonucleotide" means both oligoribonucleotide (ORN) and oligodeoxyribonucleotide (ODN). The term oligonucleotide also includes oligonucleoside (that is, the phosphate-free oligonucleotide) and any other organically based polymer. Oligonucleotides can be obtained from existing nucleic acid sources (eg genome or cDNA), but synthetic (eg produced by oligonucleotide synthesis) are preferred.
In formula (I), CpG represents unmethylated CpG without modification of phosphate structure. C is 2'-deoxycytidine.
G is 2'-deoxyguanosine. p is a bond between nucleoside with phosphodiester.
In formula (I), X1X2 is any of AA, AT, GA or GT that can have phosphate structure modification. In formula (I), X3X4 is any of TT, AT, AC, TA, TC or CG that can have phosphate structure modification.
The oligonucleotide of the present invention may have phosphate structure modification at the site in addition to the
IMPI
<img file="MX356830B_D0015.tif" />
CpG. The oligonucleotide may have phosphate structure modification in the part in addition to the CpG portion consisting of 5'-XiX<sub>2</sub>C<sub>p</sub>GX3X4-3 '. On the other hand, there is the previously mentioned problem in phosphate structure with modification of the phosphorothioate structure among all of the nucleotides, it may be preferable that the oxygen atoms are replaced by sulfur atoms by more than 20% less than 95%, can be more than 30% less than 95%, more than 20% less than 90%, more than 40% less than 95%, more than 40% less than
90%, more than 40% less than 80%, more than 50% less than 95%, more than
50% less than 90%, more than 20% less than 80%.
The X1X2 of this oligonucleotide is preferred to be any of AT, GA or GT which may have phosphate structure modification and X3X4 is preferred to be any of TT,
AT, AC, TA, TC or CG that may have a phosphate structure modification.
This oligonucleotide is preferred than XiX<sub>2</sub> it is any of AA, AT, GA or GT without phosphate structure modification and X3X4 is any of TT, AT, AC, TC or CG without structure modification.
In the event that the site other than the CpG portion with phosphate structure modification is phosphorothioate, the site having at least one phosphate portion structure modification different from the CpG portion may be s IMPI
-THE MEXICAN INSTITUTE
OF THE FROFIEDAD
INDUSTRIAL S-form stereoisomer.
In the event that at least one of the different phosphate structure modifications of CpG portion is replaced by different atoms or bases of sulfur atoms, it may be preferred that the site take s-type conformation when the oxygen atoms are replaced by atoms sulfur.
The oligonucleotide of the present invention is preferred to have the following, or that comprises any sequence, it is preferable that an oligonucleotide has any of the following sequences.
Formula 5
<td>SEQ No.</td><td>Sequence</td>
<td> 1</td><td>TOGTCGn * T * T ^ a; w * T <rcGGG</td>
<td> 2</td><td>(W ^ GTOTT + T + T ^ WTI ^ W ^ TCGGG</td>
<td> 3</td><td>T * C * AACCTT * T * C * AACGTT * T * T</td>
<td> 4</td><td>T * C * AACGTT * T * C * AACGTT * T * T * GG</td>
<td> 5</td><td>T * C * AACGTT * T * C * AACGTT * G * G</td>
<td> 6</td><td></td>
<td> 7</td><td>T = * OAACGTT * T * T * AACGTr * T * T * AACGGG</td>
<td> 8</td><td>T * C * AACGTT * r * A * ACGTT * T * T</td>
<td> 9</td><td>T * C * AACGT * TAACGTT * T * T</td>
<td> 10</td><td>IX> AAO¡1WM * AA («TIWA * AACGGG</td>
<td> 11</td><td>T * C * AACG'ITMCGnAACGGG</td>
<td> 12</td><td>TMOGACGnWT * GAO} Tl * T * T * GACGGG</td>
<td> 15</td><td>G << AaíT * W * TGACGT * T * T * TGACGGGGG</td>
<td> 16</td><td>T> t <»= GAOTU * WGAa; W ^</td>
<td> 17</td><td>T * C * GACGT * T * GACGT * T * GACGGG</td>
<td> 20</td><td>txx; acgt * t * gacgt * t * gacgt * t * gacggg</td>
<td> 21</td><td>T = (<> GACGTT + T * A * AACGn * T * A * AACGn * T * A * AACGGG</td>
<td> 22</td><td>T * C * GACGTT * T * A * A / iCGn * T * A * GACGTT * T * A * AACGGG</td>
<td> 23</td><td>T * O * GACGTTAACGTTAACGTTAACGGG</td>
IMPI
<img file="MX356830B_D0016.tif" />
Formula 6
<td> 24</td><td colspan="2">mCCTI * WAACGTCTAGM «»</td>
<td> 25</td><td colspan="2">TOCMOW »T * Aa; T * ACOGG</td>
<td>2i</td><td>T * O * QráT * T * T <l «3Gl1 ^ r *> ^ KXMM</td><td></td>
<td></td><td>^ • GwrrT »i * T * <; ^ aiTT * T * w.Ararxxi</td><td></td>
<td> 30</td><td></td><td></td>
<td> 31</td><td colspan="2"></td>
<td> ‘|9</td><td colspan="2">TXxacGrm * P <^^</td>
<td> 33</td><td colspan="2"></td>
<td> 36</td><td colspan="2"></td>
<td> 37</td><td colspan="2">1WOT <W * (»fC«</td>
<td> 38</td><td colspan="2">OWMM> «TaiAT * GC * A *> G * G» 0 «J« G</td>
<td> :»</td><td>W> ATOGAW * TMTOA1 * I * T ^ TCGGG</td><td></td>
<td> 40</td><td>0X> T4 <XXiA (W <Xl * A * G * & w> (Ȓ; * (;</td><td></td>
<td> '11</td><td colspan="2">IXXX? »GAa7ATCGTCC <ÜG * 3 * (> C</td>
<td> 42</td><td colspan="2">G *> <MCATAraTOS * ^^</td>
<td> 43</td><td colspan="2">(MWWXACCWTCG * & WKW</td>
<td> 16</td><td colspan="2"></td>
<td> 17</td><td colspan="2"><xx; Aa »7a; TO7 *> cxx> fM * c</td>
<td> 48</td><td colspan="2">MXMXKXnTCfr «G * G * G</td>
IMPI
<img file="MX356830B_D0017.tif" />
Formula 7
<td> 49</td><td>TX * ATCGAT * T * T * ATCGAT * T * T * A * AXX- * G * G</td>
<td> 30</td><td>TWKjACXtTITTGACGTT * T * TX * AX * G * & »G</td>
<td> 51</td><td>TXXACGTTTTGACGTTTTX * AXXX * G</td>
<td> 52</td><td>T * OGAaT * TX> AOffr * T * GAOGG * G</td>
<td> 53</td><td>Τ ^ ΟΤ> Φ «05Τ * Τ * 5ΑβΟ« ΰ * 6</td>
<td> 54</td><td>lXXAffil * TWX7r * T * GACG (XXí</td>
<td> 55</td><td>TXXAa7T * TXACGT * TXACTX</td>
<td> 56</td><td>TXXACGT * TXAaiT * TX * AXX * G * G</td>
<td> 57</td><td>TXXAO} TOAtUr ^^ A <* G * (XS</td>
<td> 58</td><td>TX ^ 'WATATCa * WAXM * 3 »G</td>
<td> .59</td><td>TX «MTOW1XAOCTXXACG * GXX</td>
<td> 60</td><td>T * ÓKyrawiw ^^</td>
<td> 61</td><td>TXXAOJT1> W «A (WKIXTX * A <* G * G * G</td>
<td> 62</td><td>ΤΧΧ; Ααπ * Τ * ΤΧΑ € ΰπ * Τ * 1Χτ * ΤΧ * ('ΧΧί</td>
<td> 63</td><td>TXX * ACGnX * ACGnX * AKXXX,</td>
<td>rt</td><td>CXXACGn * T * TXACGn * WXACG *> G</td>
<td> 65</td><td></td>
<td> 66</td><td>MXACGTTW ^ CGn * W®0G * A * A</td>
<td> 67</td><td>TXXACGnXXXiACGrr * T * rXAC6 * T * T</td>
<td> 65</td><td>l «> AAainX * l> AACGrXf * TXrAaX'X¡</td>
<td>ω</td><td>TXXAffiHX * r * GAtKITX * IXWi</td>
<td> 70</td><td>TXXACGTT * T * TXACGrr * T * TX. '\ CGTTGG</td>
<td> 71</td><td>TXXA0GHXA0GTT * G * GXi</td>
<td> 72</td><td>T * íXAff, rrx * Tx. * ACGrr * T * Tx * Acwxi</td>
<td> 73</td><td></td>
<td> 74</td><td>ΤΧΧ * ΟΤ> ΤΧ ^ ΜΧΠΊ «ι · ΦΜ> ιΛαϊΧ«</td>
<td> 75</td><td>TXXACGTAXA0GTAXA03XX</td>
<td> 76</td><td>ΧΑ ^ ίΑατΑΤΧχχιιαί'ΚΧΓ + Α ^ ϊΑαχ ^ ύ</td>
<td>you</td><td>T * A ^ m <XTCGI * AXACX> C * G</td>
<td> 79</td><td>TXX * AraTT * lXXAOTT * l '* TX * AXXX * G</td>
<td> 79</td><td>TXX * ACGn * T * T * TMM0SAC * T * T'K5 * A * C <X> G</td>
IMPI
8 MEXICAN INSTITUTE
OF THE PROPERTY
INDUSTRIAL
Formula 8
<td> 80</td><td></td>
<td> 81</td><td>T ^> ATOGAW * TOTOAT * T * T ^ AOi * G * G</td>
<td> 82</td><td>TX * ATCGAT * T * T * ATCGAT * T * W ^</td>
<td> 83</td><td>T ^ TOAT «W * AT0 ^^</td>
<td> 84</td><td>WATOAW ^ ATC ^^</td>
<td> 85</td><td>Τ ^ ΑΤ (ΧΪΑΤ <1 * Τ * Α1Ό & ΑΤ * Τ * Τ * ΑΤβΜΤ * Τ * 1 * Α * Γ * Ο * 6 * Ο * 0</td>
<td> 86</td><td>ΪΚ * ΑΟΑΤ * Φ * Τ * ΑΤ ^</td>
<td> 87</td><td>M * ATOAWmTOW ^ ** AX »K5 * C</td>
<td> 88</td><td>WATOATATC »W * r'HMAKXXMl</td>
<td> 89</td><td>TCATCGAT ^ * AIÜ} AT * T * T * A * T * CXX1 * 6</td>
<td> 90</td><td>TC * AT0GÁT * T * T * ATW ^ T * T * T * G * A * CX5 * A * T</td>
<td> 91</td><td>T <! <ÍACGT * T * € ACGT * T * GACGT * T * G * G * G</td>
<td>I know</td><td>T <; ^ * ACGT * T ^ ACGT * Ti <> A <XX: * G</td>
<td> 93</td><td>T * C * A * TCGAT * T * T * A * TCGAT * T * T * G * A * C * G * G * G</td>
<td> 94</td><td>Tc * A * TOT * A * mT «<> AaT * T * w ^</td>
<td> 95</td><td>TC> <; ACGTTTGAaim * G * A * C * G * C * G</td>
<td> 96</td><td>TOATOAW * T * ATO ^ W * I * MTX> G * GC</td>
<td> 97</td><td>GK> GAOGATATCGrCG * CX> G * G * G</td>
<td> 98</td><td>ίΧΧ: ΑαΑϋ ^ * Τ (1ΠΠΧΧΧΧ> 0</td>
<td></td><td>CXXJACGACWGTCGXXXX;</td>
<td> 100</td><td></td>
<td>10E</td><td>T * C * GACGACG1OGTCÍ * T * T * G * C * G</td>
<td> 102</td><td>T * A * GACGACGTCGTCT * T + T * G * G <1</td>
<td>I «í</td><td>T »MM» OTO3Ta * A * A * G * G ^</td>
<td> 104</td><td>T * C * GACGTAGACGTCT * T * T * G * G * G</td>
<td> 105</td><td>Τ <! · Κ! ΑΟ0ΤΑΓ, Α € θπΤ * Α> «1 * Ο * & Κ;</td>
<td> 106</td><td>TKMRXATATOGAT ^^</td>
<td> 10?</td><td>WATtX; ATAT0GATA * A * A * (MM;</td>
<td> 1«</td><td>TXXJAÍGTAGMXIATCWTKXXÍ</td>
<td> 109</td><td>T ^ WGAC * MWX ^ T * ÍX; * A <> G * G * G</td>
<td>you</td><td>ΤΚΧίΑΟΙΑΟΐΦ * ^^</td>
<td> 11!</td><td>T * T * ATQGATATO »W ^</td>
<td> 112</td><td>τ * τ * Αΐα; ΑΤΑταΐΑΤΓ * τ * Α * Α * Α *> (χ;</td>
<td> 113</td><td>TX> ATOAT <M * ATOJAT * T * T '* G * AKXM * r</td>
<td> 114</td><td>W> Am <* AKX ^ * T * G * AX> K> ^^</td>
<td> 115</td><td>T * C * AT0GAT * ATCCA * T * G * G4G</td>
<td> 116</td><td>TMXlTaiTOTQíTiW ^ A ^ JWX ^ G</td>
<td> 117</td><td></td>
<td> 118</td><td>TXXTtWGTO¡nG * A <: x> A'C * G * G * G</td>
In the above formula * indicates the stereoisomer by modification of phosphate structure. CG of the section that
IMPI
<img file="MX356830B_D0018.tif" />
corresponds to 5'-X1X2CPGX3X4-3 in the formula above means
Unmethylated CpG without phosphate structure modifications.
Examples of phosphate structure modifications are phosphothioate structure modifications, phosphorodithioate structure modifications, or phosphoramidate structure modifications. In these phosphate structure modifications, phosphothioate structure modifications are preferred. Phosphothioate structure modifications mean that one of the two unbonded oxygen atoms bonded to phosphorous atoms comprising phosphodiester linkage from neighboring nucleotides is converted to sulfur atoms. At least one of the * is form S stereoisomer. Here, the form S stereoisomer means, as described above, the stereoisomer that takes the form S when its atoms or bases introduced in place of oxygen atoms are sulfur atoms.
The oligonucleotide of the present invention is preferred if the sequence satisfies item (I) or describes sequences above, and X1X2 is GA, and X3X4 is TT or AC.
The oligonucleotide of the present invention is preferred to be one of the nucleotides described above, and the phosphate structure modifications that exist at least one of the different sites in the CpG portion are oligonucleotides that include phosphorothioate. I mean, like
IMPI
<img file="MX356830B_D0019.tif" />
explained above, it is preferred that the oligonucleotide has phosphorothioate structure modification also at the different CpG sites. In this case, as explained above, the S-form stereoisomer is preferred. However, in the present invention, it is preferred that no modification of the phosphorothioate structure exists between each sequence.
The sequence consisting of 5'-XiX2C<sub>p</sub>GX<sub>3</sub>X<sub>4</sub>-3 'of formula (I) is defined as CpG portion. Then, the oligonucleotide of the present invention is preferred to have a sequence - (G)<sub>m</sub>- (m is 2 to 10 integers) per 5 'end or 3' end of the CpG portion.
The oligonucleotide of this invention is preferred to have a sequence composed of TC, TA, TG or CC per end
5 'from the CpG portion.
The oligonucleotide of this invention is preferred to include at least the first CpG portion and the second. The first and second CpG portions are directly linked to or include (T) n- (n is an integer representing 1 to 3), TA, TC between the first and second CpG portions.
The oligonucleotide of this invention is preferred to have the sequences 1, 2, or 3 bases are substituted for, inserted into, removed from, or added to t<sup>Sp</sup>c<sup>Sp</sup>gacgtt<sup>Sp</sup>t<sup>Sp</sup>t<sup>Sp</sup>gacgtt<sup>Sp</sup>t<sup>Sp</sup>t<sup>Sp</sup>gacggg (Sequence No. 13),
IMPIf ~ - INSTITUTO MEXICANO í ¿1 DE LA W0WEDAD '
INDUSTRIAL t<sup>Sp</sup>c<sup>Sp</sup>gacgt<sup>Sp</sup>t<sup>Sp</sup>gacgt<sup>Sp</sup>t<sup>Sp</sup>gacggg (Sequence No. 18) og<sup>Sp</sup>g<sup>Sp</sup>gacgacgtcgtcg<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g (Sequence No. 44)
These oligonucleotides are preferred to exhibit stability or activity the same as Sequence No. 13, 18 or 5 44. Here, cg indicates unmethylated CpG and<sup>Sp</sup> indicates that
Modification of S-form phosphate structure is introduced between neighboring nucleotides.
The oligonucleotide of this invention is preferred to include t<sup>Sp</sup>c<sup>Sp</sup>gacgtt<sup>Sp</sup>t<sup>Sp</sup>t<sup>Sp</sup>gacgtt<sup>Sp</sup>t<sup>Sp</sup>t<sup>Sp</sup>gacggg (Sequence No. 13), t<sup>Sp</sup>c<sup>Sp</sup>gacgt<sup>Sp</sup>t<sup>Sp</sup>gacgt<sup>Sp</sup>t<sup>Sp</sup>gacggg (Sequence No. 18) og<sup>Sp</sup>g<sup>Sp</sup>gacgacgtcgtcg<sup>Sp</sup>g<sup>sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g<sup>Sp</sup>g (Sequence No. 44)
Here, cg indicates unmethylated CpG with phosphate structure modification and <sup>Sp</sup> indicates that the S-form phosphate structure modification is introduced between neighboring nucleotides.
Synthetic nucleotide method
The synthetic nucleotide method is publicly known. The nucleotides in the present invention can be produced by the publicly known method. For example, you can adopt the methods described in patent declaration No. 450870 and brochure No.2010 / 064146 of international application.
The other examples of the method to synthesize the
IMPI
<img file="MX356830B_D0020.tif" />
Nucleotides are introduced in Official Patent Report No. 4942646 and US Patent No. 5912332. The last, the use of the solid support linker linker to parallel synthesis or generic solid support, such as phosphate salt that binds controlled pore glass.
Furthermore, the nucleotide can be produced by the method for example described in patent No. 4383534 A. For example, they can be produced by the method of β-cyanoethyl phosphoramidate (SL Beaucage, MH Caruthers, Tetrahedron
Lett. 1981, 22, 1859-62) and nucleoside H-phosphonate method (Per J. Garegg et al., Tetrahedron Lett. 1986, 27,
4051-4; Brian C. Froehler et al., Nucí Acid Res 1986, 14,
5399-407; Per J. Garegg et al., Tetrahedron Lett. 1988, 27,
4055-8; Barbara L. Gaffney et al., Tetrahedron Lett., 29,
2619-22). These chemicals can be synthesized by a variety of commercially available automated nucleic acid synthesizers. These nucleic acids are called synthetic nucleic acid. Alternatively, it is possible to generate nucleic acids of the present invention on a large scale in a plasmid. (Sambrook T. et al., Molecular
Cloning: A Laboratory Manual, Coid Spring Harbor Laboratory
Press, New York, 1989) The nucleic acid of this invention can be separated into smaller pieces or administered whole. Nucleic acid is produced from the nucleic acid sequence
<img file="MX356830B_D0021.tif" />
<img file="MX356830B_D0022.tif" />
IMPI (eg genomic sequence and cDNA sequence) with the use of known techniques (eg techniques using restriction enzymes, exonuclease or endonuclease). The nucleic acid that has been prepared in this way is called isolated nucleic acid. An isolated nucleic acid, in general, is a nucleic acid that is separated from components that naturally associate normally. For example, isolated nucleic acid is a nucleic acid that separates from cells, nuclei, mitochondria, and chromatin. The combination portion nucleic acid of the present invention includes both synthesized combination portion nucleic acids and isolated combination portion nucleic acids.
Combination portion oligonucleotides, if necessary, have a relatively resistant to degradation (eg, stabilize) are preferred in in vivo use. A stabilized nucleic acid molecule means a nucleic acid molecule that is relatively resistant to degradation in vivo (eg, exonuclease or endonuclease). Nucleic acid stabilization is achieved through modification of the phosphate structure.
The stabilized nucleic acid that is preferred in the present invention has a modified structure. This modification of the nucleic acid structure provides increased activity of the combination portion oligonucleotide
<img file="MX356830B_D0023.tif" />
IMPI when administered live. In some cases, the phosphorothioate linker combination oligonucleotides provide maximum activity and protect the nucleic acid from degradation by intracellular exonucleases and cellular endonucleases. Other modified nucleic acids, modified phosphodiester nucleic acids, combinations of phosphodiester nucleic acids and phosphorothioate (ie chimeric) nucleic acids, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof are mentioned.
Modified structures (eg, phosphorothioates) can be synthesized using automated techniques that employ either phosphoramidate chemistry or H-phosphonate chemistry. Aryl phosphonate and alkyl phosphonates can be generated, for example, as described in US Patent No.US4,469,363. And alkyl phosphotriester (charged oxygen is alkylated as described in the patent of
USA No.US5,023,243 and EP Patent No. 092,574) can be produced using commercially available reagents by automated solid phase synthesis. Methods for making modifications and substitutions for other DNA structures have been described, (eg, Uhlmann E and Peyman A, Chem.
Rev. 1990, 90, 544; Goodchild J., Bioconjugate Chem. 1990, 1,
IMPI
<img file="MX356830B_D0024.tif" />
165)
The oligonucleotides obtained by the synthesis can be purified by known methods, for example, purified, deprotected, desalted and dialyzed by reverse phase HPLC. In this way, the oligonucleotides of the present invention can be isolated and purified.
This invention provides composition with one of the above oligonucleotides. This composition is a composition of medicine. The composition contains an effective amount of any of the oligonucleotides described above and may contain an appropriate known carrier. The carrier can be a solvent such as water or alcohol. The carrier may be optional excipients, diluents, fillers, salts, buffers, stabilizers, solubilizers, lipids, or other substances that are well known for drug composition in the art.
This invention also provides an oligonucleotide vaccine adjuvant described above. The vaccine adjuvant, if necessary, may contain a pharmaceutically acceptable carrier. Patent No. 4126252 describes oligonucleotide vaccine adjuvant. The vaccine adjuvant with the oligonucleotide of this invention can include the elements described in this publication correctly.
This invention also provides for the production of
<img file="MX356830B_D0025.tif" />
IMPI
<img file="MX356830B_D0026.tif" />
interferon-a (IFN-α) agent-inducing dendritic cells including any of the above oligonucleotides. The present invention also provides a cure for infection, cancer, respiratory diseases, allergic diseases, autoimmune disease, or wound healing comprising an effective amount of any of the oligonucleotides described above as an active ingredient.
Examples of the cure for infection of this invention are fungal infection, persistent fungal infection, bacterial infection, candidiasis, chronic mucocutaneous candidiasis (CMC), aspergillosis, cryptococcal disease, viral infection, persistent viral infection, immunodeficiency virus infections human (HIV), hepatitis B virus infection (HBV), hepatitis C virus infection, persistent bacterial infection, mycobacterial infection, tuberculosis infection Μ., infection by M. bovis, and infection by M. leprae. For example, official patent report No. 4688815 indicates that interferon-α is effective in treating infections that include infection with the hepatitis C virus (HCV), and US4607452 indicates that interferon-α is effective in treatment of infections (for example, disease
IMPI
<img file="MX356830B_D0027.tif" />
mycobacterial, malaria, leishmaniasis, toxoplasmosis.
schistosomiasis and fasciola liver disease). The cure of this invention is also effective in treating infections by producing interferon-a.
The cancer in cancer cure of this invention includes known tumors and cancer. For example, official patent report No. 4607452 and official patent report No. 201111303039 describe that interferon-a (IFN-α) is effective in the treatment of cancer and tumors. For this reason, the cancer cure is effective in treating cancer and tumors.
Examples of respiratory disease in the respiratory disease cure of this invention are blasphemy, asthma, allergic rhinitis, bronchitis, pneumonia, acute respiratory stress syndrome (ARDS), and allergic bronchopulmonary aspergillosis. For example, official patent report No.2004-505046 indicates that interferon-a is effective in the treatment of respiratory diseases.
Examples of allergic disease in the cure of allergic disease of this invention are systemic inflammatory response syndrome (SIRS), anaphylaxis or anaphylactoid reaction, allergic vasculitis, hepatitis, nephritis, kidney disease, pancreatitis, rhinitis, arthritis, inflammatory eye diseases (by example, conjunctivitis, etc.), inflammatory bowel disease
<img file="MX356830B_D0028.tif" />
IMPI (for example, ulcerative colitis, Crohn's disease, gastrointestinal eosinophilic disease, etc.), diseases of the brain and cardiovascular system (for example, arteriosclerosis, thrombosis, ischemia / reperfusion injury, restenosis, infarction, etc.), the skin (for example, dermatitis (for example, atopic dermatitis, psoriasis, contact dermatitis, eczema, hives, pruritus, etc.), etc.), autoimmune diseases (such as multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, type I diabetes, glomerulonephritis, Sjogren's syndrome, etc.), rejection of the transplanted organ.
For example, official patent report No.2004-50546 indicates that interferon-α is effective in the treatment of allergic disease. For this reason, the cure for allergic diseases of this invention, by producing interferon-α, is effective in the treatment of allergic diseases.
Examples of autoimmune disease in the autoimmune disease cure of this invention are acute idiopathic thrombocytopenic purpura, chronic idiopathic thrombocytopenic purpura, Sydenham's chorea, myasthenia gravis, lupus erythematosus, rheumatic fever, polyglandular syndromes, Henoch-Schonlein purpura, nephritis of
IMPI
<img file="MX356830B_D0029.tif" />
Posterior streptococcus (post-streptococcalnephritis), erythema nodosum, Takayasu arteritis, Addison's disease, rheumatoid arthritis, multiple sclerosis, sarcoidosis, ulcerative colitis, erythema multiforme, IgA nephropathy, multiple nodule syndrome, ankylosing spondylitis thromboangiitis obliterans (thromboangiitis subiterans), Sjogren's syndrome, primary biliary cirrhosis, Hashimoto's ciroiditis, thyrotoxicosis, scleroderma, chronic active hepatitis, polymyositis / dermatomyositis, polychondritis, pemphigus vulgaris (parnphigus vulgaris), Wegener's granulomatosis, membranous nephropathy, amyotrophic lateral sclerosis, giant cell arteritis / polymyalgia pain, pernicious anemia, glomerulonephritis rapidly fibrosing. For example, JP 2007528209 A indicates that interferon-α is effective in treating this autoimmune disease. For this reason, the cure for the autoimmune diseases of this invention, by producing interferon-α, is effective in the treatment of autoimmune diseases.
The wounds in wound healing of this invention include skin disorders, wounds caused by surgery, hypertrophic scars, keloid. For example, the official patent report No.2003-503313 describes that
<img file="MX356830B_D0030.tif" />
IMPI interferon-a (IFN-α) is effective in the treatment of skin disorders. For this reason, wound healing is also effective in treating wounds by producing interferon-a.
The interferon-α (IFN-a) production inducer and these drugs can be produced, for example, by the method described in patent No. 4383534.
The nucleotide of this invention can be used to induce type 1 IFN (that is, IFN-α and IFN-β). This method includes a progress that the cell capable of expressing type 1 IFN is contacted with an effective amount of combination portion oligonucleotides of this invention to induce expression of type 1 IFN with the cell. It has recently been recognized that the main type of IFN-α producer cell in humans is plasmacytoid dendritic cell (pDC). This cell type exists by very low frequency (0.2-0.4%) and this cell type is characterized by negative lineage (that is, CD3, CD14, also CD19 are not stained), negative CDllc and phenotypic positive for
CD4, CD123 (IL-3Ra) and class II major histocompatibility complex (class II MHC). Methods for measuring type 1 IFN are known to one of ordinary skill in the art, and examples of such methods are enzyme-linked immunosorbent assay (ELISA), bioassay, and
<img file="MX356830B_D0031.tif" />
IMPI
one MIMCANO INSTITUTE
- * · FROM THE «OtBOAD Industrial Fluorescence Cell Analysis (FACS). These types of assays can be performed by readily available reagents and kits.
This oligonucleotide is effective in inducing the systemic immune response and / or mucosal immune response. The combination portion oligonucleotide of this invention can be delivered to a subject exposed to antigens to induce enhancement of the immune response to antigens. Therefore, for example, the combination portion nucleotide is useful · for vaccine adjuvant.
Examples of the main agent acting as an adjuvant are a variety of vaccines. The adjuvant can increase the efficacy of antigen to incorporate into immune cells. The adjuvant is preferred to be able to enhance or enhance or assist the original action with the active ingredient of the main agent.
Examples for vaccines are virus vaccines and vaccines for hepatitis B, hepatitis A, Japanese encephalitis, pediatric pneumococcal, diphtheria, hundred-day cough, tetanus, measles, rubella, mumps, chickenpox, and tuberculosis (vaccine
BCG). Examples of the virus vaccine are influenza vaccine, polio vaccine, human papilloma virus vaccine, rotavirus vaccine, non-relapse vaccine, polio vaccines, and AIDS vaccine. The oligonucleotide of this
<img file="MX356830B_D0032.tif" />
IMPI fwflTTVTO MIXICANO
MUmOlJEDAD industrial invention works as an adjuvant for a very small amount. Therefore, the oligonucleotide of this invention is low cytotoxic compared to the conventional adjuvant and there are very few side effects. This makes the vaccine that is administered for many purposes very useful.
This oligonucleotide can be administered with an adjuvant without nucleic acid. The nucleic acid-free adjuvant is an arbitrary molecule or compound, except for the oligonucleotides herein that can stimulate humoral immune responses and / or cellular immune responses. Examples of the non-nucleic acid are adjuvants causing deposition effect, immune stimulating adjuvants, and adjuvants causing deposition effect and stimulating immune system. As used herein, the nucleic acid free mucosal adjuvant is an adjuvant that can induce the mucosal immune response when administered to a mucosal surface with antigen in the subject.
The oligonucleotide of this invention can be formulated as a pharmaceutical composition in a pharmaceutically acceptable carrier. This oligonucleotide can be administered to a subject directly or with a nucleic acid delivery complex. Nucleic acid delivery complex means a nucleic acid that associates (for
<img file="MX356830B_D0033.tif" />
IMPI
MEXICAN INSTITUTE
1 TO INDUSTRIAL PROPERTY example, ionic bond or covalent bond, or encapsulated in that manner) with a targeting manner (eg, molecules that generate high affinity bond to target cells (eg, cell surface B) and / or increase in cellular absorption by target cells.). Examples of the nucleic acid delivery complex are nucleic acid associated with sterols such as cholesterol, lipids (eg, cationic lipids, virosomes, or liposomes) or target cell specific binding factors (egg, ligands recognized by specific target cell receptor ). The preferred complex may be stable enough in vivo to prevent significant decoupling prior to internalization by the target cell. But the complex can be cleaved under appropriate conditions in the cells so that the nucleic acid is released in a functional form.
This oligonucleotide and / or antigen and / or other therapeutic agents can be administered separately (eg, in saline or buffer), and can also be administered using any of the known delivery vehicles.
The dose of the compounds described herein for mucosal delivery or topical delivery is typically in the range of about 0.1 pg / dose up to
IMPI
<img file="MX356830B_D0034.tif" />
IWnyiD MBUCANO Dt U PROPltDAD
INDUSTRIAL -va.
lOmg / dose. Doses depend on whether they are administered daily, weekly, or monthly, and at any other time. More typically, mucosa doses or local doses are in the range of about lOpg / dose to 5mg / dose. Most typically, it is around 100 pg / dose up to 1 mg / dose, and 2-4 times administrations are done separately for a few days or weeks. More typically, the dose for immune booster is in the range of about lpg / dose to 10mg / dose, more typically in the range of about 10 pg dose to 1mg / dose. Then administrations are performed daily or weekly. The dose of the compounds (this compound is supplied with an antigen, not supplied with another therapeutic agent) described herein for parenteral delivery for the purpose of inducing an antigen-specific immune response, is typically 5 to 10,000 times more doses effective mucosa for vaccine adjuvant or applied immune stimulant. More typically, it is 10 to 1,000 times greater, and more typically up to 100 times greater. In case the oligonucleotide is administered in combination with other therapeutic agents or administered using specialized delivery vehicles, the dose of the compounds is to induce an innate immune response, which increases ADCC or induces a
<img file="MX356830B_D0035.tif" />
INSTITUTO MiXlCANÍJ
ΟΕ THE PROPERTY
INDUSTRIAL antigen-specific immune response, described herein for parenteral delivery, is typically in the range of about 0.1 pg / dose to 10mg / dose. Doses depend on whether they are administered daily, weekly, or monthly, and at any other time. More typically, parenteral doses for these purposes are in the range of about 10 pg / dose to 5 mg / dose. Most typically, it is around 100 pg / dose up to 1 mg / dose, and 2-4 times administrations are done separately for a few days or weeks. However, in some modalities, parenteral doses for these purposes can be used in the range of 5 to 10,000 times greater than the typical doses described above.
In the present specification, the term "effective amount" means the amount required or sufficient to achieve the desired biological effect. For example, an effective amount of a nucleic acid to treat an infection means the amount required to treat the infection. Combined with the teachings provided herein, in selecting the various active compounds and weight factors (eg, potency, relative bioavailability, patient body weight, severity of adverse side effects, and preferred mode of administration), the effective prevention regimen and the therapeutic regimen
IMPI
<img file="MX356830B_D0036.tif" />
Effective, which are very effective in treating a particular subject without causing substantial toxicity, may be the plan. The effective amount for any particular application can vary depending on factors, such as the disease or condition being treated, the particular oligonucleotide being administered, antigen, size of the subject, and the severity of the disease and conditions. One of skill in the art can empirically determine the effective amount of a of a particular oligonucleotide and / or antigen and / or other therapeutic agents without the need for improper experiments.
A therapeutically effective amount for any of the compounds described herein can first be determined based on knowledge obtained in animal experiments. An effective dose for treatment can also be determined based on data around CpG oligonucleotide that has been tested in humans (human clinical trials have been initiated) and data when local or mucosal administration of known compounds that have Similar pharmacological activities [eg, other mucosal aids (eg, LT and other antigens for vaccination)]. For parenteral administration, it is necessary to use a higher dose.
The applied dose can be adjusted based on the
<img file="MX356830B_D0037.tif" />
IMPI relative bioavailability and potency of administered compounds. Adjusting the dose to achieve maximum efficacy using the methods and other methods is well known in the art. Additionally, an expert person can easily adjust the dose.
When administered, the formulation of the present invention dissolves in pharmaceutically demanding solutions. The solution may conventionally include salts of pharmaceutically acceptable concentrations, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
For use in therapy, the oligonucleotide of the effective amount can be administered to a subject using any way to deliver the nucleic acids to the desired surface (eg, a mucosal surface and a systematic surface). Administering the pharmaceutical compositions of this invention can be accomplished by any means known to those of skill in the art. The preferred routes of administration are orally, parenterally, intramuscularly, intranasally, intratracheally, inhalationally, ocularly, sublingually, vaginally, rectally, and the like, but not limited to those listed herein.
IMPI
<img file="MX356830B_D0038.tif" />
For oral administration, the compounds (ie, oligonucleotides, antigens, and other therapeutic agents) can be easily prepared by combining the active compound with pharmaceutically acceptable carriers known in the art. Such carriers allow the compounds of the present invention to be formulated as tablets to be taken orally by a subject to be targeted, pills, dragees, capsules, liquids, gels, syrups, thick suspensions, suspensions, and the like. Pharmaceutical preparations for oral administration can be obtained as a solid carrier by adding suitable auxiliaries if necessary, then grinding the resulting mixture and forming the tablet cores or the dragee cores when processing the granule mixture. In particular, suitable excipients are fillers (for example, sugar (lactose, sucrose, mannitol and sorbitol); cellulose preparations (for example, corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum , methyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose) and / or polyvinylpyrrolidone (PVP)]. If necessary, disintegrating agents [eg, cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof (eg, sodium alginate)] can be added. If necessary, oral formulations can also be
<img file="MX356830B_D0039.tif" />
IMPI
MEXICAN INSTITUTE
OF THE NUMBER
INDUSTRIAL administer in saline or buffer solution to neutralize the internal acid state. Additionally, oral formulations can be administered without carriers.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions can be used. If necessary, concentrated sugar solutions may contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol and / or titanium dioxide, lacquer solutions, suitable organic solvents, or solvent mixtures. In order to identify or characterize different combinations of doses of active compound, dyes or pigments, they can be added to tablets or dragee coatings.
Examples of orally administrable pharmaceutical preparations are a pressure-fitted capsule made of gelatin, and a soft sealed capsule made of gelatin and a plasticizer (eg, glycerol or sorbitol). The pressure-fitted capsule can contain the active ingredient, if necessary, mixed with fillers (eg lactose), binders (eg starch) and / or lubricants (eg talc or magnesium stearate) and stabilizers. In the soft capsule, the active compounds can be dissolved or suspended in suitable liquids
IMPI
<img file="MX356830B_D0040.tif" />
(eg, fatty oils, liquid paraffin, or liquid polyethylene glycol). Additionally, the stabilizer can be added. Microspheres formulated for oral administration can also be used. Such microspheres have been well known in the art. All formulations for oral administration can be used in appropriate dosage.
For buccal administration, the compositions can take the form of tablets or lozenges formulated in a conventional manner.
For administration by inhalation, the compounds of the present invention can be administered by aerosol spray from pressurized containers or a nebulizer using a suitable propellant (for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas) as with a conventional use.
When using a pressurized aerosol, the dosing unit can be determined by providing a valve to supply a metered quantity. For use in an inhaler or insufflator, such gelatin capsules and cartridges, containing a powder mix of the compound and a suitable powder base, can be provided.
If the compound is to be delivered routinely, the compound can be provided in a form that can be administered parenterally by injection (eg,
ΙΜΡΙ
<img file="MX356830B_D0041.tif" />
bolus injection or continuous infusion). Formulations for injection can be provided in unit dosage form (eg, a vial or multi-dose containers) with a preservative. The compounds can take such forms as solutions, emulsions or suspension in oily or aqueous vehicles.
Additionally, they may contain the formulations (eg, suspending agents, stabilizing agents, and / or dispersing agents).
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds that are soluble water. Additionally, suspensions of the active compounds can be provided as appropriate oily injection suspensions. Suitable lipophilic solvents or carriers include fatty oils (eg, sesame oil), synthetic fatty acid esters, eg, ethyl oleate or triglycerides), or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension (eg, sodium carboxymethyl cellulose, sorbitol, or dextran). In order to prepare highly concentrated solutions, the suspension may also include agents that increase the solubility of appropriate stabilizers or compounds thereof as appropriate.
IMPI
<img file="MX356830B_D0042.tif" />
necessary.
Alternatively, the active compounds may be in the form of a powder that can be configured before use with a suitable vehicle (eg, sterile pyrogen-free water).
The compounds can be provided in the form for rectal or vaginal administration (eg, suppositories or retention enemas that may contain conventional suppository bases such as cocoa butter or other glycerides).
In addition to the above, the compounds can also be provided as a depot preparation. Such long-acting formulations can be provided by using suitable hydrophobic or polymeric materials (for example, as an emulsion in an acceptable oil), by using an ion exchange resin, or by using sparingly soluble derivatives (such as sparingly soluble salts).
Pharmaceutical compositions can also include carriers or excipients that are a suitable solid or gel phase. Examples of such carriers or excipients include calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers (eg, polyethylene glycol), but are not limited thereto.
The suitable liquid pharmaceutical preparation form or solid pharmaceutical preparation forms are micro43
IMPI
<img file="MX356830B_D0043.tif" />
MIXICAN INSTITUTE oe la raontDA »
INDUSTIUAL.
encapsulated, chelated, coated in microscopic gold particles, included in liposomes, contained in the aerosol to be sprayed, included in the pellet for implantation in the skin, dried in a sustained manner on the object to scratch the skin, the aqueous solution for inhalation or Saline solution. Additionally, the pharmaceutical compositions include granules, powders, tablets, coated tablets, (micro) capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations, which can release the active compound over a long period of time. As described above, the formulations contain excipients, additives, and / or adjuvants (eg, disintegrants, binders, coating agents, sweetening agents, lubricants, flavoring agents, sweetening agents, or solubilized agents) conventionally. Pharmaceutical compositions are suitable for use in a variety of drug delivery systems. Brief review of methods for drug delivery is mentioned in Langer (1990) Science 249: 1527-33 (incorporated herein by reference).
The oligonucleotide and containing other therapeutic agent and / or antigen as required, can be administered without any processing, or can be administered in the form of a pharmaceutically salt
<img file="MX356830B_D0044.tif" />
IMPI
4 WwwrvTO Mincuvo
KLAraSn ^ acceptable industrial. When administered in the form of a pharmaceutically-pharmaceutically salt, the salt must, however, be acceptable, acceptable. Without pharmaceutically acceptable it can be used to prepare the pharmaceutically acceptable salts. Examples of such salts are as follows, but not limited to: HCI, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, p-toluene sulfonic acid, tartaric acid salt, citric acid, methan sulfonic acid, formic acid, malonic acid, succinic acid, naphthalen-2-sulfonic acid, and expire sulfonic acid. Additionally, such salts can be prepared as alkali metal salts or alkaline earth metal salts (eg, carboxylic acid sodium salts, potassium salt, or calcium salt).
Examples of suitable buffering agents are as follows: acetic acid and its salt (1-2% w / v); citric acid and its salt (1-3% w / v); boric acid and its salt (0.5-2.5% w / v); and phosphoric acid and its salt (0.8-2% w / v). Examples of suitable preservatives are as follows: benzalkonium chloride (0.003-0.03% w / v); chlorobutanol (0.3-0.9% w / v); parabens (0.01-0.25% w / v), and thimerosal (0.004-0.02% w / v).
The pharmaceutical compositions of the present invention may contain an effective amount of the oligonucleotide, the
IMPI
<img file="MX356830B_D0045.tif" />
antigen and / or other agents in a pharmaceutically acceptable carrier as needed. The term pharmaceutically acceptable carrier means one or more compatible filler, diluent, or encapsulating agent that is solid or liquid and is suitable for administration to humans or other vertebrates. The term "carrier" means a natural or synthetic, organic or inorganic component that is added to in order to facilitate the application of the active ingredient. The components of the pharmaceutical compositions can be mixed with the compounds of this invention and each component in a way that the components do not interact with each other.
For the treatment of individual subjects, different capabilities of the pharmaceutical compositions of the present invention are required based on the activity of the compound, the mode of administration, the purpose of immunization (i.e., prophylactic immunization or immunotherapy), the nature and severity of the disorder, the age of the patient and weight of the patient. Administration of a desired dose can be accomplished by administering an amount corresponding to dosage units at one time or by administering a smaller amount multiple times.
Examples of other delivery systems include extended release system, delivery system
IMPI
6 INSTITUTO MEXICANO delayed, or sustained supply system. Such systems can avoid repeated administrations of the compound, and can increase the convenience to the subject and the physician. Many types of delivery delivery systems are available, and are known to those of skill in the art. Examples of delivery delivery systems include a polymer-based system (eg, poly (lactide-glycolide), copoly oxalate, polycaprolactone, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides). For example, the microcapsules of the polymer containing the pharmaceutical compositions are described in US Patent No.
5,075,109. Delivery systems also include a non-polymeric system. Examples of the non-polymeric system are as follows: lipids (sterols (eg, cholesterol, cholesterol ester), and fatty acids or natural fats (eg, monoglycerides, diglycerides, and triglycerides) and the like); hydrogel delivery systems; silastic system; peptide based systems;
wax coating; tablets compressed using conventional binders and excipients; partial fused to the implant. In particular, the system includes, but is not limited to, the following: (a) an erosion-based system that the agent of the present invention is contained in a matrix-located form (US Patent No. 4,452,775,
IMPI
MEXICAN INSTITUTE
OF INDUSTRIAL PROPERTY
US Patent No. 4,675,189 and US Patent No.
5,736,152); (b) a diffusion system that the active ingredient penetrates at a controlled rate of the polymer (Pat.
No. 3,854,480, Pat. No. 5,133,974 and Pat.
No. 5,407,686). Additionally, pump based hardware supply systems can be used.
Some of them are adapted for implantation.
The invention is further illustrated by the following examples. The following examples are not to be construed as an additional limitation. Throughout this specification, all of the contents of the cited documents are incorporated herein.
EXAMPLES
Work Example 1
Synthesis of CpG oligonucleic acid chiral CpG oligonucleic acid (mixture)
The oligonucleic acid (mixture) that has been synthesized using the phosphoramidite method and purified using HPLC was purchased from GeneDesign, Inc.
The synthesis of the CpG oligonucleotide from which the three-dimensional structure is modified.
Nucleic acid chain extension was performed by
IMPI
<img file="MX356830B_D0046.tif" />
repeat the following steps (i) - (iv).
(i) DCA 3% (dichloroacetic acid) / CH<sub>2</sub>C1<sub>2</sub> (15 sec), (ii) Condensation reaction [A mixture of 0.1M monomer solution in MeCN (See below) and 1M PhIMT solution (Trifluoromethanesulfonic acid N-phenylimidazolium) in MeCN in ratio 1: 1.5 min], (iii) Capping reaction [A mixture of CF3Colm 0.5 M in
THF and DMAN 1 Μ (1,8-bis (dimethylamino) naphthalene)) in THF in 1: 1 ratio, 30 sec], (iv) Sulfurization reaction (0.1 M DDTT in MeCN, 90 sec) or oxidation reaction ( 12 0.02 M in solution H<sub>2</sub>0Pyridine-THF, 15 sec).
After nucleic acid chain elongation, a solid phase carrier was collected in a 1.5 ml microtube. The solid phase carrier was treated with high concentrated aqueous ammonia (1.2 ml, 55 degrees, 48 hours). The solid phase carrier was removed by filtration. A filtrate was dried under reduced pressure, and dissolved in water (1.0 ml).
Then, the oligomer was isolated and purified using reverse phase HPLC.
A procedure for adjusting 0.1M monomer solution in MeCN (in case of Rp-Th).
The thymidilic acid H-phosphonate monoester (25 pmol) was azeotropically dried with dehydrated pyridine and toluene
ΙΜΡΙ
<img file="MX356830B_D0047.tif" />
dehydrated. This was dissolved in We'C'N ^ eMP —- f-WCianomethylpiperidine) solution (9: 1, v / v; 250pL). Later,
Ph3PCl<sub>2</sub> (62.5 pmol) was added, and the solution was stirred for 10 min. Then AA-L (30 pmol; AA-D was used when the Sp form was selected.) Was added, and the solution was stirred for 10 min. In this way, the monomer solution was obtained.
In the description above, DDTT, AA-L and AA-D means the abbreviated designation of the following compounds respectively. The obtained oligonucleic acids are shown in Table 1.
Formula 1
AA-L
AA-D ss
<img file="MX356830B_D0048.tif" />
HO HN
Ph<sup>1</sup>
Ph
HO HN— \
<img file="MX356830B_D0049.tif" />
<img file="MX356830B_D0050.tif" />
ηβπτυτο Mexican), • eaa promBad
4DUSTR1AI
Table 1-1
Table 1 The oligonucleic acids obtained in Mode 1
<td>SEQ No.</td><td>Sequence</td>
<td> 1</td><td>T + O * GTCGTT + r + rXTOTr * T * T * GTCGGG</td>
<td> 2</td><td>(X ^ iraT «* WTCGH4T * T * GTCGGG</td>
<td> 3</td><td>T * C * AACGH * T * C * AACG1T * T * T</td>
<td> 4</td><td>T * C * AACGTT * T * C * MCGTT * T * T * GG</td>
<td> 5</td><td>T * C * AACGn + T * C * MCGW * OG</td>
<td>δ</td><td>TOMCGn * IX * MCGn * G * GX * G</td>
<td> 7</td><td>T * C * AACGn * T * 7 * AA0Gn * T * T * AACGGG</td>
<td> 3</td><td>T * C * AACGTT * T * A * ACGTT * T * T</td>
<td> 9</td><td>r * C * AACGT * T.AACGn * T * T</td>
<td> 10</td><td>T * C * AACGTT * I * A * AAOGTT * T * A * AAOGGG</td>
<td> 11</td><td>T * C * AACGTTAAOGTTAACGGG</td>
<td> 12</td><td>TOGACGn ^ * I * GAOGTT * T * T * GACGGG</td>
<td> 13</td><td>TsCsGACGTTsTslsGACGTTsTsTsGACGGG</td>
<td> 14</td><td>TrCrGAOGHrTrTi ^ OinrTrTrGACGGG</td>
<td>IS</td><td>G * G * GACG1 * T * T * TGAOGT * T * T * TGAOGGGGG</td>
<td> 16</td><td>T ^ HjACGT4W4TXjACGW * T * TGACGThW * TGACGGG</td>
<td> 17</td><td>T * C * GACGT * T * GACGT * T * GACGGG</td>
<td> 18</td><td>TsCsGACGTsTsGAOGTsTsGACGGG</td>
<td> 19</td><td>TrCrGACGTrTrGACGTrTrfACGGG</td>
<td> 20</td><td>T <* GACGT * TtGACGT * T * GACGT * T * GACGGG</td>
<td> 21</td><td>T <* GACGn * T * A * AACGH * T * A * AACGTT * T * A * AACGGG</td>
<td> 22</td><td>T * OGACGTT + T * A * AACGTT * T * A * GAOjTT * T * A * AACGGG</td>
<td> 23</td><td>T * C * GACGnAACGri'AACG'lTAACGGG</td>
<td> 24</td><td>GGGACGTT * T * A * AAOGTCTAGAOGGG</td>
<td> 25</td><td>T * C * GACGT * ACCT * ACGT * ACGGG</td>
<td> 26</td><td></td>
<td> 27</td><td>TsCsGACGTT sT sT sGACGTT sT sT sGsAsCsGsGsG</td>
<td> 28</td><td>TrCrGACGTTrTrTrGACGTTrTrTrGrArCrGrGrG</td>
<td> 29</td><td>T ^ XACGH * T * TXACX; n * MX: A03G * G * G</td>
IMPI
<img file="MX356830B_D0051.tif" />
Table 1-2
<td> 30</td><td>T <XJACGTW * T <AffiK * T * T * GACGT'iG * G</td>
<td> 31</td><td>T <XiACGnWm (K'mWKlACGlWi <</td>
<td> 32</td><td>T4 <xiAreTO * ma; nw4 <> Ai <xi * G * G</td>
<td> 33</td><td>T * o «ucGTT * T * T ^ <rT ^</td>
<td> 34</td><td>TsCsGACGTTsTsTsGACGTTsTsTsGACGGsGsGsGsG</td>
<td> 35</td><td>TrCtGACGTTrTrTr-GACGTTrTrTrGAOSGrGrGrGrG</td>
<td> 36</td><td>T> Ci «AC (HW * T ^ a ^^</td>
<td> 37</td><td>W * GACGT * T * GAOGT<sup>,</sup>* T * GACGTG * G * G</td>
<td> 38</td><td>& »Ό * Τ ^^ * ΑΤ (ΧΑΤ4 <Χ; * Α ^ · ΚΧΧ} * (Χ;</td>
<td> 39</td><td>T <* ATCGATW * ATOAM ^ * ATOGGG</td>
<td> 40</td><td>G ^ T<sup>!</sup><XXiACGAT'KX> A <XX> << ^</td>
<td> 41</td><td>G * GKXX! ACGAT (XT (tGG * G * G * G</td>
<td> 42</td><td>(> G4 «ACGATATCGT (» ig<sup>!</sup>K? K> * G * G</td>
<td> 43</td><td>G * G «4ACCACCTCGTCGíG>«; * G * G * C</td>
<td> 44</td><td>GsGsGACGACGTCGTCGsGsGsGsGsG</td>
<td> 45</td><td>GrGrGACGACGTCGTOGrGrGrGrGrG</td>
<td>4b</td><td>g + g * «igcgatcgtc & k; * g * g * g * g</td>
<td> 47</td><td></td>
<td> 48</td><td>G * G * G * G * TCGnaXXi * G</td>
In the above tables, * indicates the position that the modification of the phosphorothioate form S structure and the modification of phosphorothioate form R were induced in the structure at random. In the table above, the modification of phosphorothioate of form S is indicated. In the table above, the modification of phosphorothioate of form R is indicated.
Work example 2
Induction of IFN-α production in simian peripheral blood mononuclear cells (PBMC)
Blood derived from Macaca fascicularis that has tested negative for virus B, diluted up to 3 times with Solution
IMPIf
2 MEXICAN INSTITUTE f οε la nonaoAn k
INIMJSTIUAI. '
Hanks Balanced Salt Flats. The sample was then layered in Ficoll-Paque PLUS centrifugation medium and centrifuged (2,600 rpm, 30 min). A fraction containing peripheral blood mononuclear cells (PBMC) was obtained. After the PBMC was washed with RPMI medium (1% penicillin and streptomycin), the PBMC was suspended in RPMI medium (10% FBS, 1% penicillin and streptomycin) at a cell density of 3xl0<sup>6</sup> cells / ml. Cells were cultured with various oligonucleic acids (mixture containing oligo DNA and DOTAP in a 1: 3.2 ratio) in 96-well round bottom plate for 17-24 hours using 5% CO2 incubator. After cultivation, the cell culture supernatant was obtained by centrifugation (500 rpm, 5 min) of the culture medium. Then, the concentration of IFN-α in the cell culture supernatant was measured using ELISA kit (PBL Assay Science).
The result was shown in Table 2. Table 2 indicates the production of IFN-α induced by the oligonucleic acids of SEQ No: 1-48 in simian peripheral blood mononuclear cells.
Table 2
Table 2 Inductive effect of INF-α production in simian peripheral blood mononuclear cells
<td rowspan="2">SEQ No.</td><td colspan="2">IFN- (i (pg / inL)</td>
<td>Average</td><td>+ 3E</td>
<td> 1</td><td> 3583</td><td> 1634.84</td>
<td> 9</td><td> 1006</td><td> 1161.33</td>
<td> 3</td><td> 583</td><td> 299. 44</td>
<td> 1</td><td> 2151</td><td> 1259.16</td>
<td> 5</td><td> 388</td><td> 144.35</td>
<td> 6</td><td> 1767</td><td> 1176. 08</td>
<td> 7</td><td> 3982</td><td> 1588.50</td>
<td> 8</td><td> 2887</td><td> 1080. 05</td>
<td> 9</td><td> 2815</td><td> 1127. 16</td>
<td> 10</td><td> 256</td><td> 173. 70</td>
<td> 11</td><td> 1100</td><td> 508, 94</td>
<td> 12</td><td> 1001</td><td> 607, 38</td>
<td> 13</td><td> 2776</td><td> 1020.29</td>
<td> 14</td><td> 3966</td><td> 1155.61</td>
<td> 15</td><td> 1453</td><td> 314, 77</td>
<td> 16</td><td> 3719</td><td> 849, 99</td>
<td> 17</td><td> 2694</td><td> 441,82</td>
<td> 18</td><td> 3207</td><td> 763, 07</td>
<td> 19</td><td> 2583</td><td> 711.25</td>
<td> 20</td><td> 2157</td><td> 507. 22</td>
<td> 21</td><td> 2287</td><td> 857. 17</td>
<td> 99</td><td> 2192</td><td> 985. 99</td>
<td> 23</td><td> 3082</td><td> 1379. 50</td>
<td> 24</td><td> 1329</td><td> 302. 81</td>
<td> 25</td><td> 2373</td><td> 1062.95</td>
<td> 26</td><td> 2404</td><td> 306. 42</td>
<td> 29</td><td> 1359</td><td> 250. 85</td>
<td> 39</td><td> 1778</td><td> 478. 20</td>
<td> 31</td><td> 1934</td><td> 600. 05</td>
<td> 32</td><td> 1582</td><td> 608. 10</td>
<td> 33</td><td> 850</td><td> 417. 75</td>
<td> 36</td><td> 581</td><td> 263. 23</td>
<td> 37</td><td> 1880</td><td> 661. 38</td>
<td> 38</td><td> 558</td><td> 365. 34</td>
<td> 39</td><td> 1580</td><td> 2131.02</td>
<td> 10</td><td> 142</td><td> 19.37</td>
<td> -11</td><td> 398</td><td> 33.01</td>
<td> 12</td><td> 121-1</td><td> 532. 80</td>
<td> 43</td><td> 3776</td><td> 1429. 12</td>
<td> 46</td><td> 1178</td><td> 624. 04</td>
<td> 47</td><td> 297</td><td> 132. 99</td>
<td> 18</td><td> 929</td><td> 115.51</td>
Work example 3
Evaluation of Stability of Oligonucleics in Monkey Serum
IMPI
MtXíCAN INSTITUTE *
M THE PROPERTY iNnrsTwiAt the acids
IMPI
<img file="MX356830B_D0052.tif" />
Preparation of sample _.
Monkey serum was obtained by centrifuging (3000 rpm, 15 min) blood derived from Macaca fascicularis that was negative for virus B (Blood was purchased from Shin
Níppon Biomedical Laboratories, LTD). Oligonucleic acids (13.4 ng / μΙ) were incubated in 50% monkey serum at 37 degrees using a water bath. Samples were treated in degrees for 1.5 hour using Proteinase K 0.3 mg / ml. Then an equal volume of phenol / chloroform was added. After centrifugation (1000 rpm, 5 min), the water layer was collected as a sample for analysis by SDS-PAGE.
Perform the SDS-PAGE
The sample obtained above (100.5 ng) was loaded onto gel
SDS-20% polyacrylamide. SDS-PAGE was performed at 20 mA for 120 min. Then, the gel was stained for 40 min using SYBR-Gold solution diluted 1000 times. Oligonucleotides were visualized as fluorescent bands using UV transilluminator. The fluorescence intensity of each band was measured using an image analyzer (IMAGE STATION:
Koda).
The results are shown in Fig. 1-3 and Table 3. The
Fig. 1 is a photo of gel electrophoresis as a substitute for a diagram, illustrating the stability of Form S and Form R oligonucleic acids of SEQ No: 27IMPI
5 M EXICA INSTITUTE NO
OF IA PROPERTY
INDUSTRIAL in the serum. Fig. 2 is a photo of gel electrophoresis as a substitute for a diagram, illustrating the stability of Form S and Form R oligonucleic acids of SEQ No: 43-45 in serum. Fig. 3 is a photo of gel electrophoresis as a substitute for a diagram, illustrating the stability of oligonucleic acids in a form
S and R form of SEQ No: 33-35 in serum.
Table 3
Table 3. Serum stability evaluation.
<td colspan="3"></td><td colspan="2">Residual ratio (%)</td>
<td>SEQ No.</td><td>Serum (%)</td><td>Time (min)</td><td>Sp</td><td>Rp</td>
<td>1 3, Ί 4</td><td> 30</td><td> 120</td><td> 46.1</td><td> 33.5</td>
<td> 2 7,28</td><td> 50</td><td> 120</td><td> 41.8</td><td> 27.5</td>
<td> 4 4,45</td><td> 50</td><td> 180</td><td> 73.3</td><td> 17.2</td>
<td> 3 4, 35</td><td> 50</td><td> 180</td><td> 51.7</td><td> 19.7</td>
<sup>15</sup> Work Example 4
The induction test for the production of antigen-specific antibodies in mice
Administration of the test substance
OVA (Wako) and oligonucleic acids that were prepared in a concentration of 0.2 mg / ml respectively using physiological saline were used as the test substance delivery solution.
Preparation of sample
8 week old BALB / cAnCrlCrlj mice were used
<img file="MX356830B_D0053.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE Ρϊ LA fRORIEOAl? INDUSTRIAL in the experiment. Using general anesthesia equipment, the mice were anesthetized by isoflurane (2.0% -4.0%, Forane,
<td>Abbott Japan Co.</td><td> • !</td><td colspan="2">LTD.), And maintained</td><td>anesthesia.</td><td>Then the</td>
<td>back</td><td>of</td><td>the rats</td><td>I know</td><td>they shaved</td><td>solution of</td>
<td>administration</td><td>of</td><td>substance</td><td>of</td><td>try it</td><td>administered</td>
<td>subcutaneously</td><td>in</td><td>50pl / body</td><td>of</td><td>dose using</td><td>a syringe</td>
disposable and needle. After two weeks from the first administration, the test substance administration solution was administered again. A week later, the mice were sacrificed, and the spleen and whole blood were collected.
Measurement of antibody titer
Plasma obtained from mouse blood collected 5 days before and 16 days after administration was used as samples for analysis. The solid lag solution was placed in plate holes by ELISA at 0.1 ml / well. The plate was sealed, and placed overnight in a refrigerator.
Then, the solution was removed and the washed solution was poured from the plate into 0.3 ml / well, and the solution was removed. The same operation was repeated twice. In other words, the well was washed three times in total. Then, the blocking solution was placed in wells of the plate at 0.2 ml / well. The plate was sealed, and placed at room temperature for 1-4 hours. Then the solution was removed, and the well was
IMPI
<img file="MX356830B_D0054.tif" />
washed three times in the same manner as described above.
The sample (plasma) to be measured was diluted up to 1000 times using a dilution solution. The sample was then diluted 7 or more times with common rate 2 (As a result of this process, 100-12800 times diluted samples were obtained.). Samples were placed in plate wells by ELISA at 0.1 ml / well. As a blank, the dilution solution was put into another well. The plate was sealed, and incubated for 1 hour at 37 degrees in the plate incubator. After incubation, the solution was removed. The well was washed three times in the same manner as described above. The detection antibody solution was poured at 0.1 ml / well. The plate was sealed, and incubated for 1 hour at degrees in the plate incubator. After incubation, the solution was removed. The well was washed four times in the same manner as described above.
The staining solution was placed in a well at 0.1 ml / well.
The plate was incubated for 30 min at room temperature.
Then, the stop solution was added at 0.1 ml / well in order to stop the reaction. The absorbance of each well was measured using multiple plate absorption spectrometer (Dominant wavelength was 450nm, Vice wavelength was 620nm).
The result was shown in Table 4. Table 4 indicates
<img file="MX356830B_D0055.tif" />
IMPI
MEXICAN INSTITUTE
Dt. PROPERTY ___ the result of the measurement of the anti-OVASEQ title No: 27-28. Fig. 4 indicates that form S olignucleic acids cause higher antibody titer than form R oligonucleic acids.
Table 4
Table 4. The effect on the anti-OVA antibody titre of chiral CpG oligonucleic acids.
<td>Group</td><td>IgG titration</td>
<td>OVA only</td><td> 100</td>
<td>SEG No. 27</td><td> 1000</td>
<td>SEQ No. 28</td><td> 433</td>
Spleen weight measurement
The spleen obtained was washed with cold physiological saline. Spleen weight was measured using an electronic balance (HR-200, A&D Company, Limited).
The result was shown in Table 5. Table 5 indicates the effect on spleen weight of the oligonucleic acids of SEQ ID No. 27-28. Table 5 indicates that spleen weight was increased in the mouse treated with Form R oligonucleic acids. This result indicates that Form R oligonucleic acids have toxicity. On the other hand, the spleen weight was not increased in the mouse treated with form S oligonucleic acids. This indicates that the oligonucleic acids of form S have no toxicity or have
IMPI
<img file="MX356830B_D0056.tif" />
low toxicity.
Table 5
<td colspan="3">Table 5. The effect on spleen weight of chiral CpG nucleic acids.</td>
<td>Group</td><td>Spleen ing / 100gBW</td><td>I KNOW</td>
<td>OVA only</td><td> 570. 4</td><td> 9.6</td>
<td>SEQ No, 27</td><td> 566. 7</td><td> 8.2</td>
<td>SEQ No. 28</td><td> 607. 2</td><td> 7.6</td>
Work Example 5
The CpG oligonucleic acids of which the three-dimensional structure is modified were synthesized in the same manner as described in embodiment 1. The sequences of the synthesized oligonucleic acids were shown in Table 6. The notation in the table is the same as one described in Mode 1. Additionally, for reference, a known nucleic acid sequence is known in SEQ No. 119.
Table 6. Nucleic acids obtained in Mode 5
<img file="MX356830B_D0057.tif" />
<td> 49</td><td>T * Ot'A7CGAW * T * ATCGAW * T * A * A * C * G<sup>!</sup>tG * G</td>
<td> 50</td><td>T * C ^ ACG7THGACGH ^<sup>:</sup>* T * G * A * C * G * G * G</td>
<td> 51</td><td>T * C ^ ACGHHGACGW ^ AK: * G * G * G</td>
<td> 52</td><td>T * C * GACGT * T * GACGT * T * GACGG * G</td>
<td> 53</td><td>T * OGACGT * T * GACGT * T * GACG * G * G</td>
<td> 54</td><td>T <XAOGT * W ^ CGT * TiO (X «* G * G</td>
<td> 55</td><td>T * C * GACGT * T * GACGT * T * GACT * G</td>
<td> 56</td><td>T * OMjACXjT<sup>5</sup>^ T<sup>5</sup>KjACGT * T * G * á * C * G * G * G</td>
<td> 57</td><td>T * (XÍA0GnGACGT * TTG * A * (Xl * G * G</td>
<td> 58</td><td>T * C * ATCGATATCGA * T * G * A * OG * G * G</td>
<td> 59</td><td>T> C * GACGT * T * GACGT * T * GACG * G * G * G</td>
<td> 60</td><td>T * C ^ ACT * T * GACGTT * T * T ^ (X * G «}</td>
<td> 61</td><td>T * C ^ ACGn ^<sup>,</sup>tl * GACGTT * T * T * G * A * G * G * G * G</td>
<td> 62</td><td>T = KXjACGTT * W<sup>s</sup>KiACGTT * T * T * G * T * G * G<sup>i</sup>K3 * G</td>
<td> 63</td><td>T * C ^ ACGn ^ ACGTT * G * A * C * G * G * G</td>
<td> 64</td><td>(^ C ^ AaW ^ WjACGTTW ^ Al ^ KX</td>
<td> 65</td><td>T * C = KjACGTT ^ M'I4jACGTT * T * A * GACG * G * G</td>
<td> 66</td><td>T * O5ACG'rT * T * T * GACGTT * T * T * GACG * A * A</td>
<td> 67</td><td>T * C * GACGTT * T * T * GACGTT * T * T * GACG * T * I</td>
<td> 68</td><td>T * C * AAOin ^ * T * AACGn * T * T ^ CG * G * G</td>
<td> 69</td><td>T * 0W5AO5W ^ * GACGTT * T * T * GGG</td>
<td> 70</td><td>T * C * GACGH * T * T * GACGTT * T * T * GACGTTGG</td>
<td> 71</td><td>T * C ^ ACGTT * GACGTT * G * G * G</td>
<td> 72</td><td>T * C * GACGH * T * T * G * ACGTT * T * T * G * ACG * G * G</td>
<td> 73</td><td>T * C * G * A * CGn * T * T * G * ACGTTn'GACGGG</td>
<td> 74</td><td>TK> 41 * ACGTT ^ T ^ h <> ACGTTkT * T * G * ACG = * G * G</td>
<td> 75</td><td>T * C * GACGTA * GACGTA * GACG * G * G</td>
<td> 76</td><td>T * A ^ A ^ AWC * GTCGTC> 4 * A * GACG * G * G</td>
<td> 77</td><td>T * A * GACGA * C * GTCGT * A * GACG * G * G</td>
<td> 78</td><td>7 * (> <> ACGTTT * T * G * ACGTT * T * T * G * A * C * G * G * G</td>
<td> 79</td><td>T * C * G * ACGTT * I * T * T * A * ACGAC * T * T * G * A * C * G * G * G</td>
Table 6-2
IMPI
<img file="MX356830B_D0058.tif" />
MEXICAN INSTITUTE Dt LA tRORWMD
INDUSTRIAL
<td> 80</td><td>T + O * <* A (Xm * T * MC «AC * T <T * G * A * C * G =« 4 * G</td>
<td> 81</td><td>IX> ATOGAW «* ATOGAT * W * GAOG * G * G</td>
<td> 82</td><td>TX> ATCGAW<sup>)</sup>l4 * ATCGAT * T * r * ATCGA * T * G * G * G</td>
<td> 83</td><td>T * C * ATCGAT * T * T * ATCGAT * T * T * AT * C * G * G * G</td>
<td> 84</td><td>T * C * ATCXlAT * T * r * ATCGAT * T * T * ATCGAT * T * T * ATCG * G * G</td>
<td> 85</td><td>TWt<sup>t</sup>ATCGAT * T * T * ATCGAT * T * T * ATCGAT * 'I * T * A * T * C * G * G * G</td>
<td> 86</td><td>T * C * ATCGAT * T * r * ATCGAT * T * T * ATCGAT * A * T * C * G * G * G</td>
<td> 87</td><td>T * T * ATCGAT * T * T * ATCGAT * T * T<sup>i</sup>Kr * A * C * G * G * G</td>
<td> 88</td><td>T ^ ATCGATATCGAT * W * G * A * C * G * G * G</td>
<td> 89</td><td>TCATCGAT * T * T * ATCGAT * T * T * A *<sup>i</sup>r * C * G * G> Kl</td>
<td> 90</td><td>TW * ATCGAT * T * T * ATCGAT * T * T * G * A * O * G * A * T</td>
<td> 91</td><td>1 * C * GAOT = WÍACGT * T ^ CGW1 «4W</td>
<td> 92</td><td>T * C ^ * ACGT * T * 3 * ACGT * T * G * A * C * G * G * G</td>
<td> 93</td><td>T * C * A * TCGAT * T * T * A * TCGAT * T * T * G * A * C + G * G * C</td>
<td> 94</td><td>Τ * 0 * Α ^ € 0ΑΊ * Α * Τ00ΑΤ <<> Αϋ0ΤΐφΚΤΐ <ΧΧ1</td>
<td> 93</td><td>TKXlACGTnGA'jGTTT * G * A * C * G * G * G</td>
<td> 96</td><td>T * C> ATCGAT * T * T * ATCGAT * T * T * A * T * C * G + G * G</td>
<td> 97</td><td>G * G * GACGATATCCTCG * G * G * G * G * G</td>
<td> 98</td><td>G * G4GACGACXj * TCGTCG <<> G * G * G * G</td>
<td> 99</td><td>G * G ^ ACGACGTOSTCGKrK> G * G</td>
<td> 100</td><td>t * c * cacgacgtcgtcc * c * g * g * g * g</td>
<td> 101</td><td>T * C * GAGGACGTCGTCT * T * T * G * G * G</td>
<td> 102</td><td>T * A * GACGACGTCGTCT * T * T * G * G * G</td>
<td> 103</td><td>T * T * GACGACGTCGTCA * A * A * G * G * G</td>
<td> 104</td><td>T * C * GACGTAGACGTCT * T * T * G * G * G</td>
<td> 105</td><td>T * C * GAOGTAGAOGTTT * A «i * ©» G * G</td>
<td> 106</td><td>T * C * ATGGATATCGATT * T * T * G * G * G</td>
<td> 107</td><td>T * T * ATCGATATCGATA * A * A * G * G * G</td>
<td> 108</td><td>T * C * GACGTAGACGATCGA * T * G * G * G</td>
<td> 109</td><td>T * C = K3ACGAC ^^^ ACGAC * T * T * G * A * C * G'iG * G</td>
<td> 110</td><td>T * (X1ACGAC <4 * T ^ TCGTC * T <T ^ A <; << X ^ G</td>
<td>lll</td><td>T * T * ATCGATATCGATA * T * C * G * A * T * G * G * G</td>
<td> 112</td><td>T * T * ATCGATATCGATT * T * A * A * A * G * G * G</td>
<td> 113</td><td>T * C * ATCGAT * T * T * ATCGAT * T * T * G * A * C * G * T * T</td>
<td> 114</td><td>T * C * ATCGA * T * ATCGA * T * G * A * C * G * G * G * G</td>
<td> 115</td><td>T * C * ATCGAT * ATCGA * T * G * G * G</td>
<td> 116</td><td>T * C * GTCGTTGTCGT * T * G * A * C * G * G * G</td>
<td> 117</td><td>TKXl * T (XiTT * T * T<sup>:</sup>K> TCGn * T <T * G * A * C * G * G * G</td>
<td> 118</td><td>T * C> <TCGTrGTOGlTG * A * C * G * A * C * G * G * G</td>
<td> 119</td><td>T * C * G * T <4G * T <T * T * TKj * T * C * G * T * 1 '* T * 1' * G * T * C * G * T * T</td>
<img file="MX356830B_D0059.tif" />
IMPI
MEXICAN INSTITUTE
OF THE RRORBTY
INDUSTRIAL
Work Example 6
Using the same method as described in Mode 2, induction of IFN-α production from oligonucleic acids in peripheral blood mononuclear cells (PBMC) was investigated. The values in the table show the relative values compared to the nucleic acid value of SEQ No. 128. The result was indicated in Table 7.
Table 7-1
Table 7. Inductive effect of INF-α production in simian peripheral blood mononuclear cells.
<td> 6«.</td><td rowspan="2">Sequence (* indicates modification of form S), τχ; * ΑταΑΐ * ιχτ * Ατα; ΑΤ * 7 * τ * ΑΜ «χ?« * ο</td><td rowspan="2">Relationship 195</td><td>± SE</td><td>Number of 1 individuals </td>
<td> 49</td><td> 40</td><td> 4</td>
<td> 50</td><td>W ^ ACGTITTGAaT ^ T'WrrA + C + G ^ + C</td><td> 241</td><td> 32</td><td> 1</td>
<td> 51</td><td>ΤΗΧΑ (£ ΊΤΠ6Ασ / ΓΤη ^ * Α ^ * 6Η ^</td><td> 265</td><td> 52</td><td> 3</td>
<td> 52</td><td>T * C * GACGT * T * GACGT * T * OACGG * G</td><td> 297</td><td> 71</td><td> 3</td>
<td> 53</td><td>t * c * gacgt * t * gacct * t * <; acg * g * g</td><td> 361</td><td> 60</td><td> 5</td>
<td> 54</td><td>T * C * GACGT * T * GAOGT * T * GAOGG * G * G</td><td> 225</td><td> 101</td><td> 3</td>
<td> 55</td><td>T * C * GAaT * T * GAa-TtT> <ACT * G</td><td> 124</td><td> 30</td><td> 1</td>
<td> 56</td><td>T4WAa3W * CAttT4 <WA * C * 3 * G * 6</td><td> 210</td><td> 60</td><td> 6</td>
<td> 57</td><td>THXACGTTGACGT + TKHAHXXX!</td><td> 269</td><td> 71</td><td> 3</td>
<td> 58</td><td>T * C * ATCGATATCGA * T * G * A * C * G * G * G</td><td> 265</td><td> 42</td><td> 4</td>
<td> 59</td><td>TH4> 45AOT «lCACGWl« Aa> G * G * G</td><td> 139</td><td> 23</td><td> 1</td>
<td> 60</td><td>T * C ^ ACGn * T * TxTA (Or »T * T ^ -i <- * G * G</td><td> 123</td><td> 36</td><td> 5</td>
<td> 61</td><td>TC + GACGTT + T + T ^ ACG'T ^ TiO + AK '+ C + GK;</td><td> 123</td><td> 30</td><td> 5</td>
<td> 62</td><td>W </ AC6n * T ^^ ACGr ^ * TK ^ T <* G * GX;</td><td> 117</td><td> 17</td><td> 5</td>
<td> 63</td><td>T4 <> <> ACGrT * G * ACGTT * G * A * C * G * GH <-</td><td> 155</td><td> 20</td><td> 3</td>
<td> 64</td><td>C * C «SACGTT * T * T * 6ACGrfT * T * GACG * G * G</td><td> 84</td><td> 36</td><td> 1</td>
<td> 65</td><td>TWM5AC (HW »A4CAam * I * AíGACGi6 * G</td><td> 246</td><td> 20</td><td> 1</td>
<td> 66</td><td>T * W, AC6TT * T * T * GACC> 7T * T * T * GACG * A * Á</td><td> 188</td><td> 56</td><td> 5</td>
<td> 67</td><td>Wi <ACGn * T * T46AaiT> T * r * GACG + T * T</td><td> 244</td><td> 93</td><td> 5</td>
<td> 68</td><td>T * C * AACGTT * T * T * AACGT7 * T '»T * GACG<sup>i</sup>* G<sup>i</sup>l <;</td><td> 220</td><td> 07</td><td> 5</td>
<td> 69</td><td>W> <A (XjTT * T * WACGTT * T * T * GGG</td><td> 98</td><td> 41</td><td> 5</td>
<td> 70</td><td>T * C * GAOGTT * T * T * 6ACG1T * T * T * GACGT1'GG</td><td> 242</td><td>me</td><td> 4</td>
<td> 71</td><td>Wi «ACGTT * GA0GTr * G * G * G</td><td> 238</td><td> 48</td><td> 3</td>
<td> 72</td><td>T «XAamw ^ ACffTT4T * T ^ Aawi * G</td><td> 225</td><td> 76</td><td> 3</td>
<td> 73</td><td>TlCW ^ AKBTTíW ^ AffiTrrTGACGGG</td><td> 102</td><td> 22</td><td> 3</td>
<td> 74</td><td>W ^ ACGTI4W ^ AaTT * Wí <> ACG * G * G</td><td> 247</td><td> 120</td><td> 5</td>
<td> 75</td><td>T * C * OACGTA * GACGTA * GACG * G + G</td><td> 188</td><td> 54</td><td> 4</td>
<td> 76</td><td>> A «A« AM <> iCTaÍTC * T * A * GAC & »G * G</td><td> 260</td><td> 49</td><td> 3</td>
<td> 77</td><td>T * A * GACGAOGTOGT * A * GACG * & «</td><td> 86</td><td> 17</td><td> 4</td>
<td> 78</td><td>T <X> A (mm * T ^ ACGK * T * T «> rA> iC * G * G * G</td><td> 98</td><td> 6</td><td> 3</td>
<td> 79</td><td>WK ^ ACtnW4T * T * A * AffiAClW ^ Al <4G * G * G</td><td> 142</td><td> 26</td><td> 3</td>
—...............
Table 7-2
IMPI
MEXICAN INSTITUTE D € LA WO «U> AD INDUSTRIAL
<img file="MX356830B_D0060.tif" />
<td> 80</td><td>T ^ <Xl * ACGm * T * MCGAC * T * T * G * AK> «W ^</td><td> 223</td><td> 22</td><td> 3</td>
<td> 81</td><td>T * C * ATCGAT * T * T * ATOAT * T * T * GACG * G * G</td><td> 389</td><td> 163</td><td> 3</td>
<td> 82</td><td>1X> ATCGAW ^ ATCGATW * ATCGA * T «> ^</td><td> 263</td><td> 38</td><td> 4</td>
<td> 83</td><td>T ^ ATCGAM ^ ATÜGAT * M * ATX> G * G * G</td><td> 308</td><td> 55</td><td> 4</td>
<td> 8-1</td><td>TK1 * ATCGAT * T * T * ATCGAT * T * T * ATCGAT * T * T * ATCG * G * G</td><td> 33-1</td><td> 40</td><td> 3</td>
<td> 85</td><td>T ^ ATCGATW * ATCGAW * T * ArcGAT * T * T * A * T * C * G * G * G</td><td> 170</td><td> 21</td><td> 4</td>
<td> 86</td><td>T4A> ATCGAT * W * AT (XM * OT * ATCGAT * A * WKMM¡</td><td> 170</td><td> 25</td><td> 4</td>
<td> 87</td><td>IWATOMW ^ ATCGAW ^^</td><td> 208</td><td> 86</td><td> 3</td>
<td> 88</td><td>TOATQ5ATATCGAT * T * TK1 * A * C * G * G * G</td><td> 288</td><td> 135</td><td> 3</td>
<td> 89</td><td>TCATCGAT * T * T * ATCGAT * T * T * A * T * C * G * G * G</td><td> 279</td><td> 45</td><td> 3</td>
<td> 90</td><td>TX> ATCGAW ^ * ATCGAWPT ^ A * C * G * A * T</td><td> 374</td><td> 205</td><td> 3</td>
<td> 91</td><td>T> K> GACGT * T<sup>;</sup>t<sup>:</sup>GACGT<sup>i</sup>lT * GAfflT * T * G * G * G</td><td> 135</td><td> 41</td><td> 5</td>
<td> 92</td><td>TXX <} * ACGW ^ ACGT * T * G * A * C * G * G * G</td><td> 97</td><td> 25</td><td> 3</td>
<td> 93</td><td>TOA * TttlAW * T * A * rCGAT * T * T * G * A * C * G * G<sup>1</sup>K;</td><td> 109</td><td> 31</td><td> 3</td>
<td> 94</td><td>T * C * A * TCGAT * A * TCGAT * G * ACGT * T * T * G * G * G</td><td> 103</td><td> 7</td><td> 2</td>
<td> 95</td><td>TKX5ACGniGACGTTT * G * AKl * íW! * G</td><td> 222</td><td> 37</td><td> 4</td>
<td> 96</td><td>T * C * ATCGAT * T * 7 * ATCGAT * T * T * A * T * C * G * G * G</td><td> 129</td><td> 35</td><td> 3</td>
<td> 97</td><td>G * ^ ACGATATCGTCG * G * G »G * G * G</td><td> 167</td><td> 11</td><td> 5</td>
<td> 98</td><td>GKXlAa; AC + G * TCOTaXWX> G * G</td><td> 138</td><td> 107</td><td> 3</td>
<td> 99</td><td>G ^ <XáCGACGTCGTCG * G * G * G * G</td><td> 230</td><td> 87</td><td> 4</td>
<td> 100</td><td>T * O * GACGACGTCGTC (XXí * G * G * G</td><td> 125</td><td> 53</td><td> ·}</td>
<td> 101</td><td>TK1 * GACGACGTCGTCT * T * T * G * G * G</td><td> 404</td><td> 52</td><td> 3</td>
<td> 102</td><td>T * A * GACGACGTGGTCT * T * T * G * G * C</td><td> 387</td><td>IZ (i</td><td> 3</td>
<td> 103</td><td>T * T * GACG \ CG7CGTCA * A * A * G * G * G</td><td> 302</td><td> 64</td><td> 5</td>
<td> 10-1</td><td>T * € * CACGTAGACGTCT * T * T * G * G * G</td><td> 354</td><td> 75</td><td> 4</td>
<td> 105</td><td>T'OGACGTAGACGTTT * A * G * G * G * G</td><td> 297</td><td> 65</td><td> 4</td>
<td> 106</td><td>T * C * ATCG \ TATCGAn * T * T * G * G * G</td><td> 224</td><td> 26</td><td> 1</td>
<td> 107</td><td>T * 1 * ATCGATATOATA * A * A * G * G * G</td><td> 154</td><td> 61</td><td> 6</td>
<td> 108</td><td>T <* GACGTAGACGATCGA * T * G * G * G</td><td> 370</td><td> 70</td><td> 4</td>
<td> 109</td><td>TK ^ CGAOfW ^^</td><td> 235</td><td> 76</td><td> 3</td>
<td> 110</td><td></td><td> 133</td><td> 42</td><td> 4</td>
<td>lll</td><td>T ^ ATOÍATATC & ATA * W ^</td><td> 200</td><td> 8</td><td> 1</td>
<td> 112</td><td>T * T * ATCGATATCGATT * T * A * A * A * G * G * G</td><td> 257</td><td> 40</td><td> 4</td>
<td> 113</td><td>TOATCGAT * W * ATOAT * W * G * A * C * G * T * T</td><td> 209</td><td> 27</td><td> 4</td>
<td> 114</td><td>TK> ATCGA * mT (»A * T * G * A<sup>1</sup>KXWW</td><td> 155</td><td> 37</td><td> 3</td>
<td> 115</td><td>tk * atcgat * atcga * t * g * g<sup>|</sup>k;</td><td> 95</td><td> 12</td><td> 2</td>
<td> 116</td><td>T ^ TOTTGTOT + WAK'KXXl</td><td> 235</td><td> 23</td><td> 4</td>
<td> 117</td><td>T <L <> TCGTT * T * W> TCGnLT * T <i * A * C * G * G * G</td><td> 177</td><td>(il</td><td> 4</td>
<td> 118</td><td>T> <> GTCGTOTCGn & »A ^ <* A4OtC« 3 * G</td><td> 88</td><td> 14</td><td> 4</td>
<td> 119</td><td>TK <* TKlKj * T »r * T * T * G * T * C * G * T * T * T * T * G * T * C * G * T * T</td><td> 100</td><td> 0</td><td> -11</td>
Using the same method as described in Mode
2, the concentration of IFN-α in case of administering the oligonucleic acids of SEQ No. 119 was measured. The result was shown in the Table
IMPI
MEXICAN INSTITUTE, DELAFROFUDAD
INBIIÍTRIAI.
Table 8
Table 8, IFN-a concentration
<td colspan="3">11N-a 1 f'a (ng / ml,)</td>
<td> 52.2</td><td> 6.2</td><td>Measured value</td>
Industrial Applicability
The present invention can be used in the field of the pharmaceutical industry.
aesaae * »
IMPI
<img file="MX356830B_D0061.tif" />
Contents82
128 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128
29 members in 13 offices
Priority claims3
| Document | Office | Kind | Date |
|---|---|---|---|
| 61671654 | United States of America | – | |
| 201261671654 | United States of America | P | |
| 2013069107 | Japan | W |
Members29
| Document | Office | Kind | |
|---|---|---|---|
| CA2879066A1 | Canada | A1 | |
| WO2014010718A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU2013287630A1 | Australia | A1 | |
| IL236685A0 | Israel | A0 | |
| IL236685D0 | Israel | D0 | |
| KR20150028352A | Republic of Korea | A | |
| SG11201500243WA | Singapore | A | |
| SG11201500243WA | Singapore | A | |
| EP2873674A1 | European Patent Office (EPO) | A1 | |
| CN104684923A | China | A | |
| MX2015000497A | Mexico | A | |
| MX2015000497A | Mexico | A | |
| US2015166999A1 | United States of America | A1 | |
| EP2873674A4 | European Patent Office (EPO) | A4 | |
| JPWO2014010718A1 | Japan | A1 | |
| RU2015100198A | Russian Federation | A | |
| RU2015100198A | Russian Federation | A | |
| US9617547B2 | United States of America | B2 | |
| AU2013287630B2 | Australia | B2 | |
| BR112015000723A2 | Brazil | A2 | |
| JP6246121B2 | Japan | B2 | |
| KR101835401B1 | Republic of Korea | B1 | |
| MX356830BThis record | Mexico | B | |
| CN104684923B | China | B | |
| RU2677639C2 | Russian Federation | C2 | |
| IL236685A | Israel | A | |
| IL236685B | Israel | B | |
| CA2879066C | Canada | C | |
| EP2873674B1 | European Patent Office (EPO) | B1 |
1 legal event, as the office reported them to INPADOC
Events
| Event | Code | |
|---|---|---|
| Grant or registrationFG | FG |
Numbers
- Publication
- 356830
- Application
- 497
Titles2
- Spanish
- ADYUVANTE DE ACIDO NUCLEICO QUIRAL.
- English
- CHIRAL NUCLEIC ACID ADJUVANT.
Classification
- CPC, 15
- A61K39/39
- C12N15/117
- C07H21/04
- A61K2039/55561
- A61P11/00
- A61P17/02
- A61P31/00
- A61P35/00
- A61P37/00
- A61P37/02
- A61P37/06
- A61P43/00
- C12N2310/17
- C12N2310/315
- C12N15/00
- IPC, 2
- C12N15 117
- A61K39 39