Methods and compositions for selective regulation of protein expression.

(54) Title: METHODS AND COMPOSITIONS FOR THE SELECTIVE REGULATION OF THE EXPRESSION OF PROTEINS.

(54) Title: METHODS AND COMPOSITIONS FOR SELECTIVE REGULATION OF PROTEIN EXPRESSION.

(57) Summary

The present invention relates to methods and compositions for selectively suppressing the expression of a recombinant protein in a male reproductive tissue of a transgenic plant; The invention also features methods and compositions for inducing male sterility in a transgenic plant; plants, plant cells, plant parts, seeds and consumer products including such compositions constitute aspects of the invention.

(57) Abstract

The invention provides methods and compositions for selectively suppressing the expression of a recombinant prote in in a male reproductive tissue of a transgenic plant. The invention also provides methods and compositions for inducing male sterility in a transgenic plant. Plants, plant cells, plant parts, seeds, and commodity products including such compositions are aspects of the invention.

YES.

PATENT TITLE No. 354471

IMPI ντ.γ, i; 'iuvt

I -I WJ-W

<td>Headlines):</td><td>MONSANTO TECHNOLOGY LLC</td>

<td>Home:</td><td>800 North Lindbergh Blvd., St. Louis, Missouri, 63167, USA</td>

<td>nomination:</td><td>METHODS AND COMPOSITIONS FOR THE SELECTIVE REGULATION OF THE EXPRESSION OF PROTEINS.</td>

Classification:

C07H21 / Q4? A C07H21 / 04&gt;, C12N15 / 8275; C12N15 / 8289 CSetl: AQ1Ñ37 / 46; A01N65 // 4? JINT ^ I HUANG; I KNOW

CIP: CPC:

<img file="MX354471B_D0001.tif" />

A01N65 / 44; C12N15 / 8218;

No.

MX / a / 20

Validity: \ Aeir # years

F chadeV? J ^ i0i

Expi sheet

Inventor (s)

The referei patent

<img file="MX354471B_D0002.tif" />

E. WIGGINS; YUANJI industrial.

In accordance with article 2b Λ the Law »» 4th Property from the date on which the international request was presented to him Who subscribes to this title (Official Gazette of the Federation $ 25/01/2006, 06/05/2009, 01/06/2010, Regulations of the Mexican Institute articles 1^or, 3^or, 4^or, 5^or fraction V in &lt;12/27/1999, amended on 10/10/2002, Deputy Generals, Coordinator, Departmental Directors and other subordinates of the Mexi Institute 08/04/2004 and 09/13/2007).

Number:

61 / W, 102

I '»* í the PfópMitf twenty arMIM extendable, counted to' igen ^ s kjírderechos.

2 of the Industrial Property Law -1 ^ 55/1999, 01/26/2004, 06/16/2005, ipcjeo a), 4 "and 12th sections I and III of / 2004, 07/28/2004 and 7 / 09/2007); No of Industrial Property (DOF Arfllrdo that delegates powers to the Directors, Divisional Assistant Directors. Coordinators 5/12/1999, amended on 02/04/2000, 07/29/2004,

This letter is signed with an advanced electronic signature (FIEL), based on articles 7 BIS 2 of the Industrial Property Law; 3 of its Regulations, and 1 fraction III, 2 fraction V, 26 BIS and 26 TER of the Agreement establishing the guidelines for the use of the Electronic Payment and Services Portal (PASE) of the Mexican Institute of Industrial Property, in the procedures indicated.

THE DIVISIONAL DIRECTOR OF PATENTS

NAHANNY CANAL REYES

<img file="MX354471B_D0003.tif" />

Original string:

NAHANNY MARISOL CANAL REYES | 00001000000403252793 | Administration Service

Tax | 1695 || MX / 2018/19535 | MX / a / 2013/015338 | PCT patent title | 1223 | GAGV | Page (s) | DtOq + L4irXagyKGdKGYAJ9V74OQ =

Digital stamp:

KjZ7f5n9llcAJggGjT76CAM4rnJEA2nrWm5uZcJ0fwUMKXgV9WkegGTt7fUrFe6tjY / 0MjV35NhN0YhnCEqF2Fzyb T58Qr7F9GozDcXRzZB459X31HJZE0Dd + RDzdKHqJy4OquVNxJUk¡2hnFINukKo + G9LcxSvGYi / Zik7U09ICzON5H3d aMkhaV6Jzs1tDJpq5BdcDP8AQoWCqhOn2KOkVo3X09jDKwOxD C4kGyFJeGwJy + + + c7nJd dJziU / s2aoWlrhyOjOIJ5 D + Nk2DhRdGj8zOGQjFSk1yGbMumo28IPdZuH / 5HYbN3 / 5M96IK / == jDFEKOSNrLJw8U7IS7N2Q

Arenal No 550. Piso 1, Pueblo Santa María Tepepan, Xochimilco, 16020, Mexico City (55) 53340700 www.gob.mx/impi

<img file="MX354471B_D0004.tif" />

<img file="MX354471B_D0005.tif" />

ΙΝ5ΤΙ Τ1 IT &lt;.) MLXlCa, \ O

Ot LA FMir.Ap

INDUSTRIAL

METHODS AND COMPOSITIONS FOR THE SELECTIVE REGULATION OF

THE EXPRESSION OF PROTEINS

CROSS REFERENCE TO RELATED REQUESTS

This application claims the priority benefit of United States Provisional Application 61 / 504,102, which was filed on July 1, 2011, which is incorporated herein by reference in its entirety.

Incorporation of sequence listing

The list of sequences contained in the file called “MONS294US.txt”, which is 40.5 kilobytes in size (size measured in Microsoft Windows®) and was generated on June 15, 2012, is presented together with this document by electronic submission and is incorporated herein by reference.

FIELD OF THE INVENTION

The invention relates generally to the fields of agriculture, plant breeding and molecular biology. More specifically, the invention relates to methods and compositions for recombinantly suppressing protein expression in male reproductive tissue of transgenic plants and to uses thereof.

IMPI

<img file="MX354471B_D0006.tif" />

BACKGROUND OF THE INVENTION

Hybrid seed, i.e. seed produced by hybridization or cross-fertilization of closely related plants, can be cultivated to obtain hybrid plants from progeny by processing a convenient combination of traits that none of the parent plants possess. Hybrid plants can exhibit superior agronomic characteristics, including improved plant size, yield, nutritional composition, disease resistance, herbicide tolerance, stress tolerance, climate adaptation, and other advantageous traits. Efficient production of hybrid seeds requires that the plant's own pollen not be allowed to self-fertilize the plant.

In hybrid seed production, pollen production and / or spread in a female parent plant can be prevented in order to facilitate female cross-pollination rather than self-pollination. Such prevention can be achieved, for example, by manual removal of pollen-containing structures (eg, manual or mechanical clearance in the case of maize), the use of a genetic means of pollination control (eg ., male cytoplasmic sterility, male nuclear sterility) and / or the use of a chemical agent.

<img file="MX354471B_D0007.tif" />

<img file="MX354471B_D0008.tif" />

BRIEF DESCRIPTION OF THE INVENTION ·

IWSTIT1Π ·&gt; MKXICaN DE LA PR Plt '/ A INDuSTÍaUI

The invention relates generally to methods for selectively suppressing the expression of recombinant proteins in the male reproductive tissue of transgenic plants, to recombinant DNA constructs useful in such methods, as well as to transgenic plants, cells, and seeds containing said recombinant DNA constructs. Recombinant DNA constructs and transgenic plants, cells and seeds containing such constructs offer a much improved way of using herbicides to induce male sterility in transgenic plants for the production of hybrid seeds.

In one aspect, the invention features a recombinant DNA construct that includes a protein coding sequence encoding a recombinant protein and a male tissue-specific siRNA element (the mts-siRNA) operatively linked to the protein coding sequence. In one embodiment, the mts-siRNA element is included within the 3 'untranslated region of the protein coding sequence. In another embodiment, the mts-siRNA element is located between the protein coding sequence and a polyadenylation sequence that is part of an untranslated 3 'region. In another embodiment, the mts-siRNA element includes at least one mts-siRNA sequence. In another embodiment, the mts-siRNA element includes at least one mts-siRNA sequence selected from the group consisting of SEQ ID NO: 1-56 and 105-149. In another modality, the

<img file="MX354471B_D0009.tif" />

IMPI

MEXICAN INSTITUTE OF THE PK 'PI £ C. · .:

INDUíTMai element mts-siRNA is selected from the group consisting of i SEO ID 'NO' 57-94 and 96-104. In another embodiment, expression of the recombinant protein in a transgenic plant confers at least vegetative tolerance to herbicides on the plant. In another embodiment, the recombinant protein is a glyphosate tolerant EPSPS.

Another aspect of the invention features a method of generating a recombinant DNA construct that includes identifying an mtssiRNA element that includes at least one mts-siRNA sequence and operably linking the mts-siRNA element to a protein-encoding sequence, for example a DNA sequence encoding a recombinant protein. In one embodiment, the mts-siRNA element includes at least one mts-siRNA sequence selected from the group consisting of SEQ ID NO: 1-56 and 105-149, or is at least one mts-siRNA element selected from the group that It consists of SEQ ID NO: 57-94 and 96-104. In another embodiment, the mts-siRNA element is panicle specific.

In another aspect, the invention provides a transgenic plant that includes a recombinant DNA construct of the invention, as well as a seed, cell, or part of the transgenic plant. In one embodiment, the plant is a monocot plant. In another embodiment, the plant is a corn plant (Zea mays).

In another aspect, the invention also features a method of selectively suppressing the expression of a recombinant protein in a male reproductive tissue of a transgenic plant by expression

<img file="MX354471B_D0010.tif" />

<img file="MX354471B_D0011.tif" />

in the transgenic plant of a recombinant DNA construct that includes a protein coding sequence operably linked to a DNA sequence that includes an mts-siRNA element. In one embodiment, the mts-s¡RNA element includes at least one mts-s¡RNA sequence. In another embodiment, the male reproductive tissue is a panicle from a corn plant. In another embodiment, the mts-s¡RNA element includes at least one mts-siRNA sequence selected from the group consisting of SEQ ID NO:

1-56 and 105-149. In another embodiment, the mts-siRNA element is at least one element selected from the group consisting of SEQ ID NO: 57-94 and 96104. In another embodiment, expression of the recombinant protein in a transgenic plant confers the plant by the least vegetative tolerance to herbicides. In another embodiment, the recombinant protein is a glyphosate tolerant EPSPS.

The invention further presents a method of inducing male sterility in a transgenic plant, including the step of applying herbicide to a transgenic plant that has, in its genome, a recombinant DNA construct comprising a protein coding sequence operably linked to a DNA sequence that includes an mtssiRNA element that gives the transgenic plant at least vegetative tolerance to herbicides, where the herbicide is applied during the development of the male reproductive tissue of the transgenic plant, thus inducing male sterility in the transgenic plant. In one embodiment, the transgenic plant is a corn plant. In another modality, the application of herbicide prevents

IMPIO-INSTITUTO MEXICANA · i '' '' j

DELA PR-. »Ht-A; · Ό- .O, · ^

INuUSTRiaL V *. '** 2 * ^ 0 at least pollen spread or extrusion' of the anthers in the treated transgenic plant. In another embodiment, the stage of development of the male reproductive tissue during which the herbicide is applied is a stage selected from the group consisting of stages V4, V5, V6, V7, V8, V9, V10, V11, V12, V13 and V14 of the development of the corn plant. In another embodiment, the herbicide is selected from the group consisting of acetyl coenzyme A carboxylase (ACCase) inhibitors, acetolactate synthase (ALS) inhibitors, photosystem II (PSII) inhibitors, protoporphyrinogen oxidase (PPO) inhibitors, 4-hydroxyphenyl dioxygenase (HPPD) inhibitors, 5-enolpiruvil shikimate 3-phosphate synthase (EPSPS) inhibitors, glutamine synthetase (GS) inhibitors and synthetic auxins. In another embodiment, the herbicide is glyphosate and the recombinant protein is a glyphosate tolerant EPSPS.

The invention also features a method of producing hybrid seeds that includes applying an effective amount of a herbicide to a transgenic plant that includes in its genome a recombinant DNA construct that comprises a protein coding sequence operably linked to a DNA sequence that includes a mtssiRNA element, where the herbicide is applied during the development of the male reproductive tissue of the transgenic plant, to thereby induce male sterility in the transgenic plant; fertilize the transgenic plant with pollen from a second plant; and harvest hybrid seeds from the transgenic plant. In one embodiment, the transgenic plant is corn. An effective amount of

<img file="MX354471B_D0012.tif" />

<img file="MX354471B_D0013.tif" />

Herbicide is a sufficient herbicide dose for * trai lyluilHáí in a sterile inactioT a transgenic plant comprising a recombinant DNA construct of the invention (an effective dose). In another embodiment, the herbicide is glyphosate and the recombinant protein is a glyphosate tolerant EPSPS. In another embodiment, glyphosate is applied during development at an effective dose of about 0.125 pounds of acid equivalent per acre (0.14 kg / ha) to about 8 pounds of acid equivalent per acre (8.96 kg / ha). Other specific embodiments of the invention are explained in the following detailed description. Throughout this specification and in the claims, unless the context requires otherwise, the term "understand" and its variations, such as "comprises" and "comprising" should be understood to imply the inclusion of a number integer, element or step or group of integers, elements or steps, although it does not exclude any other integer, element or step or group of integers, elements or steps.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 illustrates the mapping of mts-siRNA sequences onto an mts-siRNA element (SEQ ID NO: 85), described in Example 1. The X axis from left to right represents the orientation of the mts-siRNA element where the upper strand is represented in the upper half of the graph and the lower strand is represented in the lower half of the graph; the position of

IMPI ^

INSTITUTO MRXIQAN K 'BE LA «ΩΜΕΓΑ; · _w· _ INDUSTKIAL:

nucleotides in the 5 'to 3' orientation are exposed from left to right at the top and from right to left at the bottom. The mts-siRNA sequences are exposed at their relative alignment positions. The Y axis represents the relative abundance of mts-siRNA expressed in panicle tissue in terms of transcripts per quarter of a million sequences (tpq). The mts-siRNAs with high representation in the library are surrounded by circles.

Figure 2 illustrates Northern blot analysis to measure panicle-specific RNA expression, as described in Example

2.

Figure 3 illustrates the mapping of the mts-siRNA sequences onto an mts-siRNA element (SEQ ID NO: 87), as described in Examples 2 and 8. The X axis from left to right represents the orientation of the mts-siRNA element where the upper strand is represented in the upper half of the graph and the Lower strand is represented in the lower half of the graph; the position of the nucleotides in the 5 'to 3' orientation is exposed from left to right at the top and from right to left at the bottom. The mts-siRNA sequences are exposed at their relative alignment positions. The three mts-siRNA sequences used to design three specific probes (SR648011 (SEQ ID NO: 8), sR1372590 (SEQ ID NO: 26) and SR410590 (SEQ ID NO: 33)) are indicated.

Figure 4 illustrates Northern blot analysis of expression.

<img file="MX354471B_D0014.tif" />

temporal maturity of the panicles of an mts-s¡RNA element (SEQ ID NO: 87) using RNA from a different inbred germplasm, as described in Example 2.

Figure 5 illustrates the in situ localization of siRNA expression in mature anthers using antisense (left panel) or coding (right panel) probes for an mts-siRNA sequence (sR648011, SEQ ID NO: 8), according with what is described in Example 2

Figures 6A-6B illustrate the location of the CP4EPSPS protein in the anthers of non-sprayed plants corresponding to construct 3 (Figure 6A) or construct 4 (Figure 6B), as described in Example 4. Transgenic maize plants of the Construct 3 contain an expression cassette of the CP4-EPSPS / mts-siRNA element. Plants with construct 4 are a control.

Figures 7A-7E illustrate transgenic maize plants generated from constructs containing a CP4-EPSPS / mts-siRNA element expression cassette, which were vegetatively tolerant to glyphosate and had male sterility induced by late glyphosate application, as described in Example 7. Figure 7A illustrates glyphosate sprayed and unsprayed transgenic corn plants. Figure 7B shows panicles from non-sprayed transgenic plants and Figure 7C illustrates pollen grains from non-sprayed transgenic plants. Figure 7D illustrates panicles of sprayed transgenic plants and Figure 7E illustrates pollen grains of sprayed transgenic plants.

<img file="MX354471B_D0015.tif" />

Figures 8A-8C illustrate data from one year of field trials measuring Male Fertility Rate (MFR) after late glyphosate spray. Figure 8A illustrates the average MFR produced by three different glyphosate spray treatment regimens (Trt1, Trt2, and Trt3) corresponding to NK603 (GM corn with CP4EPSPS), MON 87427 (GM corn with CP4-EPSPS male glyphosate-induced sterility), and two events of construct 3, as described in Example 5; the dashed line indicates the industry standard for male sterility, MFR 2. Figure 8B illustrates a panicle of a plant treated with a spray treatment of weeds only. Figure 8C illustrates a panicle of a plant treated with a glyphosate late mist treatment to induce male sterility.

Figure 9 illustrates the results of field trials measuring the number of plants per batch with male sterility, as measured by extrusion of anthers using S90, S90 + 3, and S90 + 6 in two different glyphosate treatment regimens. (Trt 2 and Trt 3) corresponding to NK603 (CP4-EPSPS), MON 87427 (CP4-EPSPS transgenic corn with male glyphosate-inducible sterility) and four events of construct 3, as described in Example 5.

Figures 10A-10D illustrate the results of pollen viability studies described in Example 5. Figures 10A and 10B illustrate an example of extrusion of late-breaking anthers in panicles of an event of construct 3 sprayed for sterility. . The box in Figure 10A is

IMPI

INSTITUTO MfcXlO.N zp

IX LA r * MCAL »„ _vJNL US I klÁL the enlarged portion of Figure 10B. An example of extruding late break anthers is surrounded by a circle in Figure 10B. Alexander staining of pollen from extruded late-breaking anthers sprayed to induce sterility of construct 3 sprayed events demonstrates only nonviable pollen (irregularly shaped, translucent light blue pollen grains) (Figure 10C). Pollen from anthers not sprayed with construct 3 was fully viable and appears opaque, dark violet in color and spherical with Alexander staining (Figure 10D).

Figure 11 illustrates the results of field trial tests of NK603 plants and events of construct 3 corresponding to inbred grain yield and male fertility, as described in Example 6. Inbred yield was measured in terms of bushels / acre (Bu / acre) and male sterility was measured in terms of Male Fertility Rate (MFR). The horizontal bar indicates the industry standard for male sterility, MFR 2. Trt 1, Trt 2 and Trt 3 refer to treatment regimens 1,2 and 3.

Figure 12 illustrates the results of field trial tests of a non-transgenic female inbred line, the MON87427 line and three events of construct 3, all with the same genetic background, which were cross-pollinated with a male standard of MON810 / MON88017 analysis to generate F1 hybrid seeds. The yield of the hybrid grains was measured in terms of bushels / acre (Bu / acre). Trt 1, Trt2, and Trt3 refer to treatment regimens 1, 2, and 3.

IMPIí ^

INSTITUTO MEXICANA η? * '»* / DF LA FHOPIEUAt' \&gt;“ Mí '»4F industrial

Figure 13 illustrates the analysis of the pollen grains of F1 hybrid plants, as described in Example 7. The panels show the results of the Alexander staining of the pollen of three different F1 hybrid crosses: non-transgenic female x male MON88017; female MON87427 x 5 male MON88017 and event female construct 3 x male MON88017.

Panicle fertility was functionally restored in F1 hybrids produced by plants with the event of construct 3 using pollen MON88017.

Figure 14 illustrates schematic drawings of modalities of the recombinant DNA constructs (exposed in the 5 'to 3' direction from left to right) including (top) a protein coding sequence (eg, DNA encoding a Glyphosate-resistant EPSPS) operably linked to a DNA sequence comprising an mts-siRNA element (eg, one or more selected from the group consisting of SEQ ID

NO: 57-94 and 96-104) (upper part). In a specific non-restrictive embodiment (bottom) the recombinant DNA construct includes a promoter operably linked to, in that order, an intron, a transit peptide, CP4-EPSPS encoded by SEQ ID NO: 95, an mts-siRNA element (SEQ ID NO: 81) and a 3'UTR.

DETAILED DESCRIPTION OF THE INVENTION ·

IΜ ΡI

MEX INSTITUTE * Ca: &lt;''^ζI

DF LA PR Ι'ίΡ ', Αϋ &lt;'

INLUSTkíAl · -. ·. · '·'

Recombinant DNA constructs

The invention features compositions and methods for selectively suppressing recombinant expression in a male reproductive tissue of a transgenic plant and the uses thereof. In one aspect, the invention provides a recombinant DNA construct that includes a protein coding sequence operably linked to a DNA sequence that includes an mts-s¡RNA element, i.e., a chimeric transgene that includes a coding sequence for protein encoding the recombinant protein and at least one mts-s¡RNA element operatively linked to the protein coding sequence. In one embodiment, those recombinant DNA constructs are useful for selectively suppressing the expression of a recombinant protein in a male reproductive tissue of a transgenic plant. In one aspect, the invention features a recombinant DNA molecule comprising the recombinant DNA construct and methods of use thereof. Nucleic acid sequences can be presented in the form of DNA or RNA, as indicated; the description of one necessarily defines the other, as is known to the person with normal training in the technique. Furthermore, the description of a given nucleic acid sequence defines the exact complement of that sequence, as is known to the person with normal training in the art.

A "male tissue specific siRNA" or "mts-s¡RNA"

Τ 1 XV _

<img file="MX354471B_D0016.tif" />

it is a small RNA (RNAs) of approximately 18-a-QpreM¡madamofíto-26. . nucleotides (eg 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides) specifically enriched or expressed in the male reproductive tissue (s) (eg, male inflorescence) of a plant, i.e. , which has a specific tissue expression pattern. Male tissue-specific siRNAs are naturally occurring in plants and can be detected using methods known in the art, such as low molecular weight northern analysis. A DNA sequence that is complementary to an mts-siRNA is referred to herein as "mts-siRNA sequence". Examples of mts-siRNA sequences corresponding to endogenous mts-siRNA from plants are presented as SEQ ID NO: 1-56 and 105-149. In one embodiment, an mts-siRNA sequence is the exact DNA complement (without pairing errors) of a given mts-siRNA. In other modalities, an mts-siRNA sequence varies in mismatches of 1-3 nucleotides compared to a given mts-siRNA, and yet is sufficiently complementary to bind or hybridize, eg, under typical physiological conditions, to those mts-siRNA. "Complementarity" refers to the ability of the nucleotides of one polynucleotide chain to nucleotides of another polynucleotide chain according to the Watson-Crick rules of complementarity (ie, guanine pairs with cytosine (G: C) and pairs of Adenine with thymine (A: T) or with uracil (A: U); intra-chain hybridization may occur between two or more regions of complementarity of a single polynucleotide. When included in a recombinant DNA construct described herein, an mfs-siRNA has the ability for RNAi mediated suppression or alteration of the expression of a gene and / or a protein.

At least one, at least two, at least three or more than three mts-siRNA sequences may be grouped or even overlapped within a single DNA molecule. This type of DNA molecule is referred to herein as “male tissue-specific siRNA element” or “mts-siRNA element” and is defined as including at least one, at least two, at least three or more than three mts-siRNA sequences within a sequence window of approximately 500 nucleotides. An mts-siRNA element can be any length, such as approximately 20 nucleotides (nt), approximately 25 nt, approximately 30 nt, approximately 40 nt, approximately 50 nt, approximately 60 nt, approximately 70 nt, approximately 80 nt, approximately 100 nt, about 150 nt, about 200 nt, about 250 nt, about 300 nt, about 350 nt, about 400 nt, about 450 nt, about 500 nt, about 550 nt or about 600 nt.

A recombinant DNA construct of the invention is a DNA molecule that includes at least one protein coding sequence operably linked to a DNA sequence that includes an mts-siRNA element. The term "recombinant" refers to a molecule or a cell or organism that has been created by man through

<img file="MX354471B_D0017.tif" />

<img file="MX354471B_D0018.tif" />

<img file="MX354471B_D0019.tif" />

Genetic engineering and, therefore, is the product that would not normally appear in nature. In the present context, a recombinant DNA construct is a recombinant DNA molecule that includes two or more heterologous DNA sequences. The term "heterologous" refers to the relationship between two or more nucleic acid or protein sequences that are derived from different sources (eg, from different locations in a genome or from different species). In one example, a promoter and a protein-coding DNA sequence are heterologous to each other if the promoter is not the native promoter of the DNA sequence encoding the protein. In another example, a protein coding sequence is heterologous to an mts-siRNA element if that combination is not normally found in nature, such as a plant mts-siRNA element operably linked to a gene for herbicide tolerance, such as CP4-EPSPS. Furthermore, a specific sequence may be "heterologous" with respect to a cell or organism into which it is introduced (ie, a sequence that does not naturally occur in that specific cell or organism).

The term "operably linked" refers to two polynucleotide molecules linked in such a way that one can affect the expression of the other. For example, a first polynucleotide molecule is operably linked to a second polynucleotide molecule when the polynucleotide molecules are arranged in such a way that the first polynucleotide molecule can affect the expression of the second molecule.

<img file="MX354471B_D0020.tif" />

Polynucleotide IMPI. The two polynucleotide molecules can be part of one. single contiguous polynucleotide molecule and may be adjacent or separate. For example, an mts-siRNA element is operably linked to a protein coding sequence if, after transcription into the cell of the male reproductive tissue, the presence of the mts-siRNA element results in suppression of recombinant protein expression in the cell. Operational linkage of the protein coding sequence and the mts-siRNA element can be accomplished, for example, by incorporating an mts-siRNA element adjacent to the protein coding sequence (such as located 5 'or 3' with respect to the protein coding sequence, although not necessarily at a contiguous link) in or adjacent to an untranslated region (UTR) of the recombinant DNA construct (eg located at or adjacent to the 5 'UTR or 3' UTR ), and / or after the protein coding sequence and before the polyadenylation signal. In one embodiment, there are one or more mts-siRNA elements located between the protein coding sequence and the polyadenylation sequence, ie, 3 'with respect to and adjacent to the protein coding sequence. In another embodiment, one or more mts-siRNA elements are located between the stop codon of the protein coding sequence and the polyadenylation sequence. In another embodiment, one or more mts-siRNA elements are located within the 3 'UTR sequence adjacent to the protein coding sequence.

The DNA sequence of the mts-siRNA element can be varied

<img file="MX354471B_D0021.tif" />

using different combinations and locations — of the individual mts-siRNA sequences — and / or incorporating 1-3 nucleotide mismatches in an mts-siRNA element (relative to a given mts-siRNA sequence). Examples of mts-siRNA elements with the titles SEQ ID NO: 57-94 and 96-104 and in the Working Examples are presented here. An mts-siRNA element can work in any direction, that is, it is non-directional and, for this reason, it can be used in the 5 'to 3' orientation or in the 3 'to 5' orientation in a recombinant DNA construct .

The mts-siRNA elements, mts-siRNA sequences, and mtssiRNAs can be identified by methods known to those skilled in the art, such as by bioinformatic analysis of plant RNAs and cDNA libraries. An example of such an identification method is presented in the Examples below. In particular, the mts-siRNA and the mts-siRNA sequences can be identified from RNA libraries. The identified mts-siRNA sequences can be compared with the cDNA and / or genomic sequence collections to identify the mts-siRNA elements (i.e., DNA regions that include at least one, at least two, at least three or more than three mts-siRNA sequences within a 500 nucleotide sequence window), which serve to develop recombinant DNA constructs as described herein.

In some embodiments, these mts-siRNA elements are synthesized or modified in vitro to contain more, less, or

<img file="MX354471B_D0022.tif" />

different mts-siRNA sequences and / or to relocate the cellative position of one or more mts-siRNA sequences, where said modification is advantageous to increase or decrease the effect of the mts-siRNA element. Methods for synthesizing or for in vitro modification of an mts-siRNA element and for determining optimal variation for the desired level of deletion are known to those skilled in the art. Chimeric mts-siRNA elements can also be designed using methods known to those skilled in the art, such as by inserting advantageous additional mts-siRNA sequences internally into an mts-siRNA element or by linking additional 5 'mts-siRNA sequences or 3 'with respect to an mts-siRNA element. Non-exclusive modalities of a chimeric mts-siRNA element include mts-siRNA elements that are about 80 nt, about 100 nt, about 150 nt, about 200 nt, about 250 nt, or about 300 nt of SEQ ID NO: 86; about 80 nt, about 100 nt, about 150 nt, about 200 nt, about 250 nt, or about 300 nt of SEQ ID NO: 87; and / or approximately 80 nt, approximately 100 nt, approximately 150 nt, approximately 200 nt, approximately 250 nt, approximately 300 nt, approximately 350 nt, approximately 400 nt, approximately 450 nt, approximately 500 nt or approximately 550 nt of SEQ ID NO : 85. Other modalities are presented in the Work Examples.

The recombinant DNA construct can be used to

<img file="MX354471B_D0023.tif" />

selectively suppress the expression of the protein recómBíñarite'érTTo's male reproductive tissues of a transgenic plant that express the construct, that is, that give rise to the expression in at least the vegetative tissues, although not in the male reproductive tissues. In the present context, "expression of a recombinant protein" refers to the production of a recombinant protein from a protein coding sequence the transcript thus obtained (mRNA) in a cell. In the present context the term "suppress" refers to reduce; for example, suppressing the expression of a recombinant protein means reducing the level of recombinant protein produced in a cell, eg, by means of post RNAi-mediated gene transcription suppression.

Selective deletion of recombinant protein refers, in the present context, to a reduction in the production of recombinant proteins in a cell or tissue compared to a reference cell or tissue of at least about 75%, at least about 80 %, at least about 85%, at least about 90%, at least about 95%, or at least about 99%. A reference cell or tissue may be, eg, a vegetative cell or tissue from the same or transgenic plant or a similar one that expresses the recombinant protein or, for example, a vegetative cell or tissue from a transgenic plant that has a transgene similar or expressing the recombinant protein but lacking the mts-s¡RNA element. Suppression of protein expression can be determined using

<img file="MX354471B_D0024.tif" />

any method known to those skilled in the art, such as by directly measuring the accumulation of the protein in a tissue cell sample using a technique such as ELISA or western blot analysis, measuring the enzymatic activity of the protein or determining by phenotypes protein expression. In one embodiment, selective deletion of recombinant proteins refers to a sufficient reduction in the expression of a recombinant protein with the ability to confer herbicide tolerance in the male tissue of a transgenic plant, resulting in a detectable male fertility phenotype. altered in a transgenic plant to which the herbicide was applied in the form of a sterilizing spray. Detection of impaired male fertility in that transgenic plant would therefore indicate selective suppression of the recombinant protein.

In the present context, the term "protein coding sequence" refers to a polynucleotide molecule that has a nucleotide sequence that encodes a polypeptide or protein sequence, ie, a polynucleotide sequence that encodes a recombinant protein. Depending on the conditions, the nucleotide sequence may or may not actually translate into a polypeptide molecule in a cell. The boundaries of a protein coding sequence are generally delineated by a translation initiation codon at the 5 'terminus and a translation termination codon at the 3' terminus. A protein coding sequence of the invention includes, but is not limited to, a

<img file="MX354471B_D0025.tif" />

Protein coding sequence that provides a convenient characteristic associated with morphology, physiology, growth and development, performance, nutritional improvement, resistance to diseases or pests, tolerance to herbicides, or environmental or chemical tolerance. In one embodiment, a protein coding sequence of the invention encodes a recombinant protein that, when expressed in a transgenic plant, confers tolerance to herbicides in at least one cell and / or tissue in which the expressed protein occurs; Selective suppression of the herbicide tolerance protein in the male reproductive tissue of the transgenic plant together with the timely application of the herbicide results in at least reduced male fertility or male sterility. Such male sterility, combined with vegetative tolerance to herbicides can be exploited to increase the efficiency with which hybrid seeds are produced, for example by eliminating or reducing the need to physically emasculate the corn plant used as a female in a given cross during hybrid seed production. Herbicide-male-inducible sterility systems have been described, for example, in Pat. from USA No. 6,762,344 and in the Sol. De Pat. from the USA USA 2011/0126310. Examples of herbicides useful in practicing the invention include, but are not limited to, acetyl coenzyme A carboxylase (ACCase) inhibitors (eg, fops and dims), acetolactate synthase (ALS) inhibitors. ) (eg, sulfonylureas (SUs) and imidazolinones (IMIs)), inhibitors of photosystem II (PSII) (eg, triazines and phenyl ethers), inhibitors of protoporphyrinogen oxidase (PPO) (eg.

<img file="MX354471B_D0026.tif" />

<img file="MX354471B_D0027.tif" />

flumioxazine and fomesaphene), - 4-I i id roxiféhir 'pyruvate dioxygenase (HPPD) inhibitors (eg, isoxaflutol and tricetonones such as mesotrione), 5-enolpiruvil shikimate 3-phosphate synthase (EPS) inhibitors eg, glyphosate), glutamine synthetase (GS) inhibitors (eg, glufosinate and phosphinothricin), synthetic auxins (eg, 2,4-D and dicamba). Examples of recombinant protein and / or protein coding sequence for use in practicing the invention include, but are not limited to, genes encoding recombinant proteins that confer tolerance to HPPD inhibitors (such as HPPD insensitive to herbicides), genes that encode recombinant proteins that confer tolerance to glufosinate (such as pat and bar), genes encoding recombinant proteins that confer glyphosate tolerance (such as the glyphosate tolerant EPSPS known as CP4-EPSPS, presented here as SEQ ID NO: 95) and genes encoding recombinant proteins that confer tolerance to dicamba (such as dicamba monooxygenase (BMD)).

The recombinant DNA constructs of the invention are prepared by methods known in the art and in various embodiments include a plant transformation vector, plasmid and plastid DNA. Such recombinant DNA constructs are useful for producing transgenic plants and / or cells, and therefore may also be contained in the genomic DNA of a transgenic plant, seed, cell, or plant part. Therefore, the present invention includes modalities in

<img file="MX354471B_D0028.tif" />

IMPIs which the recombinant DNA construct is located within a transformation vector or in a biolistic particle for transformation of a plant cell or within a chromosome or plastid of a transgenic plant cell or within a transgenic cell, transgenic plant tissue, seed from a transgenic plant, transgenic pollen grain, or a transgenic or partially transgenic plant (eg grafted). A vector is any DNA molecule that can be used for the purpose of plant transformation, that is, for the introduction of DNA into a cell. The recombinant DNA constructs of the invention can be inserted, for example, into a plant transformation vector and used to produce transgenic plants, seeds, and cells. Methods for constructing plant transformation vectors are known in the art. Plant transformation vectors of the invention generally include, but are not limited to, a promoter suitable for expression of an operably linked DNA, an operably linked recombinant DNA construct, and a polyadenylation signal (which may be included in a 3'UTR sequence). Promoters useful in practicing the invention include those that function in a plant for expression of an operably linked polynucleotide. Such promoters are varied and well known in the art and include those that are inducible, viral, synthetic, constitutive, temporally regulated, spatially regulated, and / or spatio-temporally regulated. Other optional components include, but are not limited to, one or more of the

IMPI

OC INSTITUTO MtXlCAN &lt;

DB LA FRÚFIfL A0

INDUSTRIAL following elements: 5 'UTR, powered action element e'ncís; Signal sequence, transit peptide sequence and one or more selectable marker genes. In one embodiment, a plant transformation vector comprises a recombinant DNA construct.

The recombinant DNA constructs and plant transformation vectors of the present invention are prepared by any method suitable for the application for which they are intended, taking into account, for example, the type of expression intended, the protein coding sequence (and therefore intended herbicide tolerance) and suitability for use in the plant in which the recombinant DNA construct is to be expressed. General methods useful for manipulating DNA molecules for the preparation and use of recombinant DNA constructs and plant transformation vectors are well known in the art and have been described in detail, for example, in laboratory texts and manuals including that of Sambrook and Russell, "Molecular Cloning: A Laboratory Manual" (third edition), Coid Spring Harbor Laboratory Press, NY, 2001. The recombinant DNA constructs of the invention can be modified by methods known in the art, either in whole or in part, for example, for the convenience of DNA manipulation (such as restriction enzyme recognition sites or cloning sites based on recombination) or to include preferred sequences for plants (such as the use of plant codons or consensual Kozak sequences) or to include sequences useful for

<img file="MX354471B_D0029.tif" />

<img file="MX354471B_D0030.tif" />

design of recombinant DNA constructs (such as spacer or ligand sequences). In certain embodiments, the DNA sequence of the recombinant DNA construct includes a DNA sequence whose codons have been optimized for the plant in which the recombinant DNA construct is to be expressed. For example, codons of all or part of the sequence of a plant can be optimized for expression in a plant by methods known in the art. The recombinant DNA constructs of the invention can be stacked with other recombinant DNA to impart additional traits (eg, in the case of transformed plants, traits including resistance to herbicides, resistance to pests, tolerance to germination in cold, tolerance to water deficit) eg, by expression or deletion of other genes.

Transgenic plant cells and transgenic plants

One aspect of the invention includes transgenic plant cells, transgenic plant tissue, and transgenic plants or seeds that include a recombinant DNA construct of the invention. A further aspect of the invention includes artificial or recombinant plant chromosomes that include a recombinant DNA construct of the invention. Suitable methods for transforming host plant cells for use with the present invention include virtually any method by which DNA can be introduced into a cell (eg, where a recombinant DNA construct is integrated

<img file="MX354471B_D0031.tif" />

stable on a plant chromosome) and are very cognacid in the technique.An illustrative and widely used method of introducing a recombinant DNA construct into plants is the Agrobacterium transformation system, which is well known to those skilled in the art. Transgenic plants can be regenerated from a transformed plant cell by plant cell culture methods. A transgenic plant homozygous with respect to a transgene can be obtained by its sexual pairing (selfing) of an independent segregating transgenic plant containing a single exogenous gene sequence with itself, for example an F0 plant, to produce F1 seeds. A quarter of the F1 seed produced is homozygous with respect to the transgene. Plants grown from germinating F1 seeds can be analyzed for heterozygosity, usually using a SNP assay or a thermal amplification assay that results in the distinction between heterozygotes and homozygotes (i.e., a zygosity assay).

The invention presents a transgenic plant that has, in its genome, a recombinant DNA construct of the invention, including, but not by way of limitation, alfalfa, cotton, corn, cane, rice, soybeans and wheat, among others. The invention further presents transgenic plant cells, plant parts and the progeny of said transgenic plant. In the present context, "progeny" includes any plant, seed, plant cell, and / or part of a plant produced or regenerated from a plant, seed, plant cell, and / or part of a plant that included a

<img file="MX354471B_D0032.tif" />

Recombinant DNA of the invention. The transgenic plants, strains, parts and seeds produced from such plants can be homozygous or heterozygous for the recombinant DNA construct of the invention.

Also included in the present invention are modalities in which the recombinant DNA construct is found in a consumer product produced from a transgenic plant, seed, or plant part of the present invention; Such consumer products include, but are not limited to, parts of a plant, crushed or whole grains or seeds of a plant, or any food or non-food product comprising the recombinant DNA construct of the present invention.

Methods for Inducing Male Sterility in Transgenic Plants and for Producing Hybrid Seeds

Another aspect of the invention includes a method of inducing male sterility in a transgenic plant that includes applying an effective amount of a herbicide to a transgenic plant that includes a recombinant DNA construct that includes a protein coding sequence that encodes a recombinant protein that confers to the transgenic plant herbicide tolerance operably linked to a DNA sequence that includes an mts-siRNA element that confers on the plant transgenic at least vegetative tolerance to herbicides, where the application of the herbicide is carried out during the development of the male reproductive tissue of the

<img file="MX354471B_D0033.tif" />

transgenic plant, to induce male sterility in the transgenic plant.

In one embodiment, the transgenic plant is a corn plant. In one embodiment, application of the herbicide prevents at least the spread of pollen or the extrusion of anthers. In one embodiment, the development of male reproductive tissue is a stage selected from the group consisting of stage V4, V5, V6, V7, V8, V9, V10, V11, V12, V13, and V14 of development of the corn plant.

In one embodiment, the herbicide is selected from the group consisting of acetyl coenzyme A carboxylase (ACCase) inhibitors, acetolactate synthase (ALS) inhibitors, photosystem II (PSII) inhibitors, protoporphyrinogen oxidase (PPO) inhibitors, 4-hydroxyphenyl pyruvate dioxygenase (HPPD) inhibitors, 5-enolpiruvil shikimate 3-phosphate synthase (EPSPS) inhibitors, glutamine synthetase (GS) inhibitors and synthetic auxins. In one embodiment, the herbicide is glyphosate and the recombinant protein is a glyphosate tolerant EPSPS.

A further aspect of the invention includes a method of producing hybrid seeds that includes: (a) application of herbicide to a transgenic plant that includes a recombinant DNA construct that contains a protein coding sequence that encodes a recombinant protein that gives the transgenic plant tolerance to herbicides operably linked to a DNA sequence that includes an element mts-siRNA, where the application of the herbicide is carried out during the development of the male reproductive tissue of the transgenic plant, thus inducing male

<img file="MX354471B_D0034.tif" />

sterility in the transgenic plant; (b) the fertilization of the transgenic plant ”with the pollen of a second plant and (c) the harvest of the hybrid seed of the transgenic plant. In one embodiment, the transgenic plant is corn. In one embodiment, the herbicide is glyphosate and the recombinant protein is a glyphosate tolerant EPSPS. In one embodiment, glyphosate is applied during development at an effective dose of about 0.125 pounds of acid equivalent per acre (0.14 kg / ha) to about 8 pounds of acid equivalent per acre (8.97 kg / ha).

Another aspect of the invention includes hybrid seed harvested from a male-sterile transgenic plant that has been fertilized with pollen from a second plant, where the male-sterile transgenic plant includes a recombinant DNA construct that includes a protein coding sequence that encodes a recombinant protein that gives the transgenic plant tolerance to herbicides, operably linked to a DNA sequence that includes an mts-siRNA element and where male sterility has been induced in the transgenic plant by applying an effective amount of herbicide during the development of the male reproductive tissue of the transgenic plant. In one embodiment, the hybrid seed is hybrid transgenic corn seed. In one embodiment, the herbicide is glyphosate and the recombinant protein is a glyphosate tolerant EPSPS. In one embodiment, glyphosate is applied during development at an effective dose of about 0.125 pounds of acid equivalent per acre (0.14 kg / ha) to about 8 pounds of acid equivalent per acre (8.97 kg / ha).

<img file="MX354471B_D0035.tif" />

IMPI.

INETITI 'TO MEXICXN- 1 r&gt; F THE INDUSTRIAL PROPERTY

In one embodiment, application of the herbicide prevents at least the spread of pollen or the extrusion of anthers. In one embodiment, the development of male reproductive tissue is a stage selected from the group consisting of stage V4, V5, V6, V7, V8, V9, V10, V11, V12, V13, and V14 of development of the corn plant.

EXAMPLES

EXAMPLE 1

This example describes the identification of the mtssiRNA elements and the mts-siRNA elements. Bioinformatic analysis of sequencing data from multiple small corn RNA libraries identified a group of small RNAs (RNAs) that were either enriched or specifically expressed in corn panicle. The relative abundance of these mts-siRNAs in corn panicles ranged from approximately 50 to 631 transcripts per quarter of a million sequences, which is normalized abundance. These RNAs are identified as siRNAs due to their length (18-26 nucleotides) and their probable origin of a dsRNA precursor. Due to their expression pattern, male tissue-specific siRNAs are referred to as "mts-siRNA". In the present context, an "expression pattern" is any differential expression pattern of DNA, RNA, or protein. For example, a panicle-specific expression pattern refers to a

<img file="MX354471B_D0036.tif" />

iNSTiTirro mexican

Dt LA «UFUiT'A:

INDUSTRIAL specific or enriched expression of DNA, RNA or protein in tissue 'and / or' panicle cell. The examples of the corresponding DNA sequence of the mts-s¡RNA, referred to herein as "mts-siRNA sequences", are titled SEQ ID NO: 1-56 and 105-149.

These mts-siRNA sequences were then compared with collections of cDNA sequences. A comparison of mts-siRNA sequences against a collection of maize unigen (compiled cDNA sequences) using BLAST yielded the surprising result that large numbers of mts-siRNA were accumulated, and even overlapped, within a region of DNA found in several closely related, yet distinct, cDNA sequences. The entire set of cDNA sequences contained that region, although the DNA sequence of the region varied due to different combinations and locations of the individual mts-siRNA sequences and / or 1-3 nucleotide mismatches with the individual sequences. of mts-siRNA. That region, defined by having at least one mts-siRNA sequence within a nucleotide sequence window, is referred to herein as mts-siRNA. " In various embodiments, the nucleotide sequence window includes at least about 20 contiguous nucleotides (nt) (eg, at least 18, 19, 20, 21, 22, 23, or 24 nt), at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, or at least about 150 nt. Examples are set forth herein

<img file="MX354471B_D0037.tif" />

of the DNA sequence corresponding to the elements rmts = siRNA with the title SEQ ID NO: 57-94 and 96-104. An mts-s¡RNA element can have more than one mts-siRNA sequence, for example, at least two, at least three, at least four, at least five, or more than five mts-siRNA sequences within of a certain window of the nucleotide sequence. Two or more mts-siRNA sequences within a given mtssiRNA element may overlap because at least a portion of their nucleotide sequences is identical (see Table 5 for examples of mts-siRNA with overlapping nucleotide sequences).

Bioinformatic analysis indicated that multiple mts-siRNA could be generated from the same RNA transcript, for example a transcript produced from one of the cDNA sequences described above that includes an mts-siRNA element. All mts-siRNAs were also found to have 1-3 mismatches compared to mts-siRNA elements from the entire group of closely related cDNA sequences. This is believed to indicate that these mts-siRNA are generated from multiple closely related transcripts that give rise to a large closely related group of mts-siRNA. Accordingly, an RNA transcript produced from a cDNA that includes an mts-siRNA element (containing multiple mts-siRNA sequences) would be complementary, and at least capable of hybridizing to multiple mts-siRNAs and / or their complements. . Therefore, a naturally occurring mts-siRNA has an RNA sequence that is a perfect or near perfect complement of

IMPI

Q / 1 ΙΝ.ΠΤΠΓΓΙ'MEXICAN

FROM THE INUUSTKIAL "oriEQA", —— a sequence of mts-siRNA (eg, where the mts-siRIMA fl ^ ñeuña sequenceRNA that has no more than about 1-3 mismatches with respect to the mts-siRNA sequence); it follows that the mtssiRNA itself has an RNA sequence that is a perfect or near perfect complement of a segment of an mts-siRNA element.

A search for sequence similarity of the mts-siRNA in a corn genomic DNA database using BLAST identified multiple loci with significant similarity to the mts-siRNA element. These loci were then analyzed to detect open reading frames (ORFs), although the identified putative polypeptides were not found to have significant homology to any known proteins. Bioinformatic analysis of the mts-siRNA-producing cDNA sequences indicated that there was no significant sequence homology at the nucleotide level with any plant gene. These data suggest that mtssiRNA from such loci could be produced by processing the dsRNA formed between transcripts of opposite polarity or by processing dsRNAs from aberrant transcripts due to RNA-dependent RNA polymerase activity. Processing of mts-siRNA from secondary dsRNA structures that can form in some mts-siRNA-producing transcripts is also possible.

Reverse transcription of the mts-siRNA produced Mts-siRNA sequences that were mapped onto one of the mts-siRNA elements (SEQ ID NO: 87). This is represented in Figure 1 where the X axis

<img file="MX354471B_D0038.tif" />

represents the position of the nucleotides in the 5 'to 3' orientation from left to right at the top and from right to left at the bottom. The relative abundance of mts-siRNA is given in terms of transcripts per quarter of a million sequences (tpq) represented on the Y axis. As can be seen in Figure 1, some mts-siRNA (surrounded by circles) are highly represented in the panicle-specific RNA library (Y axis). The predicted mts-siRNA sequences are also unevenly distributed across all mts-siRNA elements (X-axis).

EXAMPLE 2

This example illustrates the analysis of endogenous expression of the panicles of the mts-siRNAs. The native in planta expression patterns of the mts-siRNA were analyzed using several different methods. These 15 analyzes confirmed that the RNAs that hybridize to mts-siRNA elements are enriched and / or specifically expressed in the panicles of all maize germplasms (i.e. that the mts-siRNA are enriched and / or specifically expressed in panicles) and that, in one embodiment, an mts-siRNA is enriched and / or specifically expressed in the 20-pollen grain in the uninucleated microspore stage of pollen development.

To demonstrate the specific in planta accumulation of the mts-siRNA panicles, three representative mts-siRNA sequences were used (SEQ ID NO: 26 (1372590), SEQ ID NO: 8 (648011), SEQ ID

<img file="MX354471B_D0039.tif" />

IMPI

NO: 33 (410590)) to design probes for low molecular weight (LMW) northern blot analysis of RNAs prepared from corn or rice. For these experiments, total RNA was extracted from the plant tissue using the TRIzol® reagent (Invitrogen, Carlsbad, CA). RNA (7.5 pg) from each sample was denatured at 95 ° C for 5 minutes before separation on a 17% PAGE gel containing 7M urea in 0.5X TBE buffer (Alien et al. (2004) Nature Genetics 36 : 1282-1290). After electrophoresis, the gel was transferred to a Nytran SuPerCharge® membrane (Whatman-Schleicher &amp; Schuell, Florham Park, NJ) using a Trans-Blot® SD Semi-dry Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA) according with the manufacturer's protocol. The transfer thus obtained was crosslinked at 1200 microjoules / cm² x 100 in a Stratalinker® 1800 (Stratagene, Cedar Creek, TX). To prepare the probes, an RNA probe template was generated by PCR containing the T7 promoter at one end and one of the small RNA sequences at the opposite end. RNA sequences incorporated into the RNA probe template included: [1] Gma-m¡R159a (miRBase.org accession number MI0001773), which was used as a control for loading; [2] sR1372590 (SEQ ID NO: 26); [3] sR648011 (SEQ ID NO: 8) and [4] SR410590 (SEQ ID NO: 33). RNA probes were transcribed using T7 RNA polymerase and labeled with digoxigenin (DIG) using the DIG Northern Starter Kit (Roche, Indianapolis, IN), according to the manufacturer's protocol. Hybridization was performed with 100 ng of the DIG-labeled probe in the PerfectHyb ™ hybridization buffer (Sigma, St. Louis, MO) at 38 ° C

<img file="MX354471B_D0040.tif" />

for 16 h. Detection was performed with the DIG Northern Starter Kit according to the manufacturer's protocol, prior to exposure to Kodak ® Biomax ™ XAR Film (Sigma, St. Louis, MO). Samples analyzed included all or a subset of the following: corn leaves of plants grown under nitrogen stress, corn shoots, root or endosperm of plants grown under cold stress, leaves and corn roots of plants grown under drought stress , corn stigmas, young corn ear buds, mature corn ear buds, unpolished corn kernels, corn embryos 24 days after pollination (DAP); corn kernels - 22 DAP; ripe corn kernels; grains (mature dry -corn embryos; corn endosperm - dry; rice grains and rice seedlings. The results obtained with the northern LMW analysis using at least three different Mts-siRNA probes (sR1372590, sR648011 and sR410590) exhibited signal only in the bands corresponding to young panicles and bands of mature panicles, confirming the bioinformatic analysis and the conclusion that mts-siRNA expression is highly enriched or specific for panicle tissue.

Tissue specificity and RNA accumulation that would recognize an mts-siRNA element was evaluated across a broad spectrum of corn germplasm using northern LMW analysis. For this analysis, an mts-siRNA element was selected (SEQ ID NO: 87, which contains multiple mts-siRNA sequences). This mts-siRNA element includes the three mts-siRNA sequences used to design the siRNA probes

<img file="MX354471B_D0041.tif" />

sR1372590, sR648011 and sR410590, which enables

IMPI

-paths- for northern LMW analysis of corn germplasm samples. For these experiments, RNA was prepared from twenty different inbred lines of corn with diverse genetic backgrounds, for example with a relative maturity classified from 83 to 120 (Table 1). In the case of three of these inbred lines (91DUA6, 01DKD2 and LH244), the tissue of young panicle, old panicle, leaf, ear and root was collected. Table 1 shows the corresponding stage V and the size of the panicles at the time of harvesting of the young panicles and the old panicles. Total RNA was extracted using the TRIzol® solution. LMW RNA was isolated with the mirVana ™ mRNA Isolation Kit (Cat. No. AM1560, Ambion, Austin, TX). Northern LMW analysis was performed using a 15% TBE-urea acrylamide gel Bio-Rad Criterion ™ Precast (Cat. No. 345-0092, BioRad, Hercules, CA). The gel was transferred to a positively charged membrane (Cat. No. 11209272, Roche Applied Systems, Mannheim, Germany). The probes were labeled with (1) 32-P-random primers or (2) with DIG DNA using the Roche POR Label Kit or (3) with the DIG RNA probe described above. All probes used to probe northern blots were the reverse complement to endogenous transcription or the ctsDNA sequence of the mts-s¡RNA element. The presence of RNAs that hybridized to the mts-siRNA transgenic element was panicle-specific; No signal was detected for the leaf, ear or root of any of the 91DUA6, 01DKD2 and LH244 inbred maize genotypes (Figure 2).

<img file="MX354471B_D0042.tif" />

ΙΜ

INSTITUTO MtXlCAN ['€ PRWUD INDUST ¿JAL

Northern LMW analysis was performed to determine the growth pattern of the panicles of the RNAs that would recognize an mtssiRNA element (SEQ ID NO: 87). RNA from young and old panicles of different inbred lines of corn was prepared; see Table 1. RNA preparation and northern LMW techniques were essentially as described above.

TABLE 1

<img file="MX354471B_D0043.tif" />

Endogamic germplasm, classification of maturity and stage of development of panicles

<td></td><td></td><td colspan="2">young pussy</td><td colspan="2">old panicle</td>

<td>Endogamic</td><td>Maturity classification</td><td>Stage</td><td>Panicle size (inches) (cm)</td><td>Stage</td><td>Panicle size (inches) (cm)</td>

<td>C3SUD402</td><td> 108</td><td>V9</td><td> 5(12.7)</td><td>V12</td><td> 10(25.40)</td>

<td>HIQA202</td><td> 113</td><td>V9-10</td><td> 4.5(11.43)</td><td>V13</td><td> 13 (33.02)</td>

<td>BEBE788</td><td> 83</td><td>V10-11</td><td> 10(25.40)</td><td>V13</td><td> 7.5(19.95)</td>

<td>BIQA207</td><td> 103</td><td>V10</td><td> 7 (17.78)</td><td>V11</td><td> 9.5(24,13)</td>

<td>DIDA404</td><td> 112</td><td>V10</td><td> 2.5-3 (6.35-7.62)</td><td>V11</td><td> 9.5(24,13)</td>

<td>5DA92</td><td> 107</td><td>V10-11</td><td> 5.7 (14.48)</td><td>V12</td><td> 11 (27.94)</td>

<td>DIDA406</td><td> 109</td><td>V10</td><td> 6.5(16.51)</td><td>V12</td><td> 9 (22,86)</td>

<td>80DJD5</td><td> 114</td><td>V10</td><td> 6.5(16.51)</td><td>V11</td><td> 10(25.40)</td>

<td>JEDO115</td><td> 120</td><td>V9</td><td> 2.5 (6.35)</td><td>V11-12</td><td> 10(25.40)</td>

<td>IFAD240</td><td> 116</td><td>V9-10</td><td> 2.5 (6.35)</td><td>V12</td><td> 11 (27.94)</td>

<td>BIQA347</td><td> 99</td><td>V9-10</td><td> 3.5 (8.89)</td><td>V11-12</td><td> 10,5-11 (26.6727.94)</td>

<td>HOQA203</td><td> 105</td><td>V10-11</td><td> 5.5(13.97)</td><td>V12-13</td><td> 11 (27.94)</td>

<td>91DUA6</td><td> 90</td><td>V10-11</td><td> 10 (25.49)</td><td>V12-13</td><td> 10(25.40)</td>

<td>BIDA345</td><td> 95</td><td>V10</td><td> 5 (12.70)</td><td>V12-13</td><td> 10(25.40)</td>

<td>01DKD2</td><td> 111</td><td>V9-10</td><td> 5 (12.70)</td><td>V13</td><td> 10,5-11 (26.6727.94)</td>

<td>DIDA403</td><td> 108</td><td>V10</td><td> 2.5-3 (6.35-7.62)</td><td>V12</td><td> 10,5-11 (26.6727.94)</td>

<td>64DJD1</td><td> 105</td><td>V9-10</td><td> 2.5-3 (6.35-7.62)</td><td>V12</td><td> 10,5-11 (26.6727.94)</td>

<td>DIQA423</td><td> 108</td><td>V9-10</td><td> 3 (7.62)</td><td>V12</td><td> 9.5(24,13)</td>

<td>BIQA208</td><td> 102</td><td>V10</td><td> 5.5(13.97)</td><td>V13</td><td> 9.5 (24,13)</td>

<td>LH244</td><td> 111</td><td>V9-10</td><td> 1 - 2.5 (2.45 - 6.35)</td><td>V13</td><td> 10 (25.40)</td>

<img file="MX354471B_D0044.tif" />

IMPI

Ai INSTITUTO MÜXiCAN “· ι-t la.“ Iv. Μ- ·; .χη in: ustkial

As can be seen in Figure 4, a DUE'7 \ RNlYi3rC3da · sound that corresponds to the inverse complement of an mts-s¡RNA element (SEQ ID NO: 87) hybridized to RNAs both in the young panicle and in the old one, with the exception of the young panicle from 2.5 inches to 3 inches (6.35-7.62cm) in length: lanes 5 (endogamic DIDA404), 9 (endogamic JEDO115), 10 (endogamous FIDA240), 16 (endogamous DIDA403), 17 (inbred 64DJD1), 18 (inbred DIQ423) and 20 (inbred LH244). Furthermore, this experiment confirmed the lack of detection of RNAs that hybridize to the mts-s¡RNA element of the leaf samples (lanes 21 and 22) or the ears (lanes 23 and 24) of the inbreeding BIQA208 and LH244. Taken together, these data indicate that RNAs hybridizing to the mts-siRNA element are specifically expressed in the panicle of each inbred genotype analyzed when the panicle is more than approximately 3.5 inches (8.89 cm).

In situ hybridization analysis was performed to investigate cell-specific expression of an mts-siRNA sequence (sR648011, SEQ ID NO: 8). In corn anthers, microspores are produced through meiosis and develop into mature pollen. The microsporogenesis of maize can be broadly divided into the following stages: meiosis of sporagenic cells, release of tetrads in the form of free microspores, mitosis of uninucleated microspores to produce tricellular pollen and mature pollen grains. For these experiments, the ear panicle before the anthesis, obtained

<img file="MX354471B_D0045.tif" />

INSTITUTO MtXtCAN- IX LA FR.fFICC'Af: · ΙΙΜΑΠΙΜ.

of corn plants grown under standard conditions in a greenhouse. Closed nucleic acid (LNA or Locked Nucleic Acid) probes (Integrated DNA Technologies, Coralville, IA) were used as indicated below, where the position of the LNA is indicated by a symbol The noncoding probe was intended to detect the mts -siRNA corresponding to SR648011 (SEQ ID NO: 8) (5-BiotinCAT + GCA + CTG + GTG + AGT + CAC + TGT-3 '), whereas the coding probe was the inverse complement of the non-coding probe (5Biotin-ACA + GTG + ACT + CAC + CAG + TGC + ATG-3 ') to use as a negative control. LNA probes allow for high stringency washes and therefore guarantee highly specific hybridization (Válóczi et al., 2006; Nuovo et al., 2009). All probes were labeled with biotin. Corn panicle samples were fixed in 4% paraformaldehyde in 1 * PBS at 4 ° C for 36 h and then dehydrated at 4 ° C by means of a graduated series of ethanol: H2O. Panicles were then placed in 75% EtOH and 25% Histoclear (National Diagnostics, Atlanta, GA) for 1.5 h, 50% EtOH and 50% Histoclear for 1.5 h, EtOH 25 % and Histoclear at 75% for 1.5 h and Histoclear at 100% for 3x1.5 h, all at 25 ° C. The Histoclear was then gradually replaced with molten paraplast at 50 ° C and the panicles were transferred to molds and stored at 4 ° C before sectioning. Paraffin-embedded panicles were sectioned in a microtome at a thickness of 8 pm. A series of sections were made from the same anthers and then adjacent sections were used to probe with

<img file="MX354471B_D0046.tif" />

the probe in the encoder and non-encoder direction, respectively. · ΔΗΐΙσνό ”carried out prehybridization and hybridization at 42 ° C and washing at 55 ° C. Detection of the biotin-labeled LNA probes annealed to the transcripts was performed with a 1 to 400 dilution of Alkaline Phosphatase Antibiotin (AP) and Substrate Purple AP BM (Roche Applied Science, Indianapolis, IN). Images were captured from a camera under an Olympus microscope (Center Valley, PA). Sections from the same anthers were divided into two groups - one was used for the antisense probe (Figure 5, left panel) and the other for the sense probe (Figure 5, right panel). The hybridization signal (dark violet) was detected only in the sections that hybridized to the antisense probe, but not in those incubated with the sense probe (Figure 5). The strong signal obtained with the antisense probe indicates that this mts-siRNA was abundant (highly expressed) in the pollen grain in the uninucleated microspore stage of pollen development.

EXAMPLE 3

This example illustrates constructs for plant transformation and the production of transgenic plants. An mts-siRNA element was incorporated into the 3'UTR of a transgene expression cassette and used to produce transgenic corn plants to assess the effect of the element on transgene expression in transgenic plants. An mts-siRNA element (SEQ ID NO: 87) was inserted into the 3'UTR of a

<img file="MX354471B_D0047.tif" />

I

Λ λ INSTITUTO MeXlCAN · **** Í *. the «· ΗΕ: -A:. —Σ- * k_

INI jUST-U AL and.

expression of the CP4-EPSPS transgene for transformation of corn. This mts-siRNA element was chosen because of its abundant content of mts-siRNA sequences (Figure 3), including sequences corresponding to three of the siRNA probes (sR1372590, SR648011 and SR410590) used for the northern LMW analysis of Example 2 This mts-siRNA element also allowed evaluating the effect of mts-siRNA mismatches. The mts-siRNA element analyzed here (SEQ ID NO: 87) has a nucleotide change (ΟΔΤ: AAGCTATTGATTCCCTAAGTGCCA) compared to one of the underlying mts-siRNA sequences (SEQ ID NO: 33, used to design the sR410590 Probe ). The mts-siRNA element was inserted into the transgene cassette in the reverse complement orientation with respect to its position in the endogenous cDNA, although it is believed that the element works similarly in both orientations, since complementarity of the panicle-specific siRNA sequences with either strand of the mts-siRNA element in the corn panicle (Figures 1 and 3).

Several CP4EPSPS / mts-siRNA element expression cassettes were constructed (Table 2) and used to transform corn plants. Different combinations of expression elements were analyzed in the CP4-EPSPS / mtssiRNA element expression cassettes. Expression elements such as promoters, guides, introns, chloroplast transit peptides, and 3'UTR's necessary for efficient and stable expression of a transgene are well known in the art. The

<img file="MX354471B_D0048.tif" />

<img file="MX354471B_D0049.tif" />

CP4-EPSPS / mts-s¡RNA element expression cassettes were designed to include one of two individual promoters, operably linked to a DNA from one of the two individual guides, operably linked to a DNA from one of the two introns ; operably linked to one of the two DNA molecules encoding the same chloroplast transit peptide (CTP); operably linked to a DNA molecule derived from an aroA gene of the Agrobacterium sp. CP4 and encoding the CP4-EPSPS protein; operably linked DNA encoding an mts-siRNA element; operably linked to one of two DNA molecules 3'UTR. Construct 4 contained the wild type CP4-EPSPS gene and all other vectors contained a codon optimized version of a plant of the CP4-EPSPS gene. Constructs 3, 5 and 6 (Table 2) were designed to determine whether an mts-siRNA element incorporated into the 3'-UTR would produce plants with panicle-specific glyphosate sensitivity and vegetative tolerance to glyphosate. Constructs 4 and 7 are control constructs, lacking an mts-siRNA element.

<img file="MX354471B_D0050.tif" />

<img file="MX354471B_D0051.tif" />

IMPI ÍN.STITim »Mr.XlCANí

ΟΪ LA PH IPIBI AL · industrial

TABLE 2

Constructions for plant transformation

<td>Construct</td><td>Promoter</td><td>Guide</td><td>Intron</td><td>CTP</td><td>Transgene</td><td>mts-siRNA</td><td>3'UTR</td>

<td> 3</td><td>TO</td><td>TO</td><td>TO</td><td>TO</td><td>CP4</td><td>SEQ ID NO: 87</td><td>TO</td>

<td> 4</td><td>TO</td><td>TO</td><td>TO</td><td>TO</td><td>CP4</td><td> **</td><td>TO</td>

<td> 5</td><td>B</td><td>B</td><td>B</td><td>B</td><td>CP4</td><td>SEQ ID NO: 87</td><td>TO</td>

<td> 6</td><td>B</td><td>B</td><td>B</td><td>B</td><td>CP4</td><td>SEQ ID NO: 87</td><td>B</td>

<td> 7</td><td>B</td><td>B</td><td>B</td><td>B</td><td>CP4</td><td> **</td><td>TO</td>

Transgenic corn plants transformed with one of each of the five cassettes were produced using methods well known in the art. Briefly, corn cells were transformed by Agrobacterium-mediated transformation with one of each of the constructs listed in Table 2 (individually) and regenerated to obtain intact corn plants. Individual plants were selected from the plant population that exhibited transgene expression cassette integrity and glyphosate resistance. Rooted plants with normal phenotypic characteristics were selected and transferred to the soil for cultivation and subsequent evaluation. The R0 plants were transferred to the soil for development, sprayed with 0.75 pound / acre (0.84 kg / ha) of glyphosate in V3-V4 followed by 0.75 pound / acre (0.84 kg / ha) of glyphosate in V7-V9 and they were then cross-pollinated with pollen from non-transgenic corn plants of the same germplasm (in the case of events of constructs 3, 5, and 6) or self-pollinated (in the case of events of constructs 4 and 7) to produce R1 seeds. Then the

<img file="MX354471B_D0052.tif" />

IMPI

INSTITUTE _;v, e; í'LaN.

Plants were selected using a combination of analytical techniques, including TaqMan, POR analysis, and vegetative tolerance to herbicide spray and reduced male fertility (convenient) after herbicide spray (glyphosate).

EXAMPLE 4

This example illustrates methods for analyzing transgenic plants in a greenhouse. Transgenic plants transformed with the CP4-EPSPS / mts-siRNA element expression cassettes were analyzed to assess vegetative tolerance to glyphosate and male sterility. Transgenic plants generated by the constructs containing the CP4-EPSPS / mts-siRNA element expression cassettes were found to have vegetative tolerance to glyphosate and induce male sterility with late application of glyphosate.

R0 plants were grown in duplicate in the greenhouse and either left un-sprayed or sprayed with 0.75 Ib./acre (0.84 kg / ha) glyphosate at stage V6 (early) followed by 0.75 Ib./acre (0.84 kg / ha) of glyphosate in stage V9 (late). (Figures 7A-7E and Table 3) The R0 events analyzed were multiple copy events. All R0 plants that were left without spraying had normal extrusion of the anthers and fully fertile pollen as determined by Alexander staining. All the R0 plants that were sprayed had vegetative tolerance to glyphosate. The R0 plants produced

<img file="MX354471B_D0053.tif" />

Constructs 4 and 7, which did not contain the element mts-siRNA, did not exhibit panicle sensitivity to glyphosate or male induced sterility. The R0 plants produced by constructs 3, 5 and 6, which did contain the element mts-siRNA, exhibited panicle sensitivity to glyphosate and male induced sterility; these plants did not have or had very little extrusion of the anthers and&gt; 99% of the pollen was not viable, as determined by Alexander staining.

TABLE 3

Glyphosate spray data

<td>Construct</td><td>Vegetative Tolerance to Early Glyphosate Dew</td><td>Male Glyphosate Late Dew Induced infertility</td>

<td> 3</td><td>Yes</td><td>Yes</td>

<td> 4</td><td>Yes</td><td>No</td>

<td> 5</td><td>Yes</td><td>Yes</td>

<td> 6</td><td>Yes</td><td>Yes</td>

<td> 7</td><td>Yes</td><td>No</td>

These observations demonstrated that the presence of the mts-siRNA element in the 3'UTR of a transgene cassette led to silencing of the panicle-specific transgene. The panicle-specific loss of the mRNA transcript produced by the CP4EPSPS / mts-siRNA expression cassette gave rise to panicles that were sensitive to glyphosate, producing a male-induced sterility plant, whereas the other plant tissues were tolerant to glyphosate, producing tolerance

<img file="MX354471B_D0054.tif" />

iNSTmrr ·&gt; mexicafh ot; the vegetative ΓκορίΕΟΑ.υ .'NÜUSTKÍaL to glyphosate and good female fertility. -----------------—

Immunolocalization was then used to measure the CP4-EPSPS protein in the tissues of the transgenic plant. Panicles of plants transformed with construct 3 or construct 4 u were obtained from non-transgenic corn (LH198). The plants were grown in a greenhouse with 14 hours of light at 80 ° F (26.6 ° C) and 8 hours of darkness at 70 ° F (21.1 ° C). One seed per pot was planted. The pots were randomly arranged on the greenhouse floor. Plants were watered as needed and fertilized with a 20-20-20 mixture of nitrogen, potassium, and phosphorus, respectively. Plants from construct 3 or construct 4 were sprayed with glyphosate at a rate of 0.75 Ib./acre (0.84 kg / ha) in stage V2 to confirm vegetative tolerance to glyphosate. Young panicles were harvested in V10-V11 to obtain tissues from the anthers in the microspore and free microspore stem cell stages; mature panicles were harvested in stage T7, 1-2 days before pollen spread, to obtain tissues from the anthers with fully developed pollen. Anthers were removed from the spikelets of the panicle using dissection forceps and immediately fixed in 3.7% formaldehyde in phosphate buffered saline (PBS) under gentle vacuum. After washing in PBS, the tissues were placed in an encrustation medium and immediately frozen. The frozen tissue blocks were stored at 80 ° C until sectioned at the microtome at -20 ° C and collected on the loaded slides.

<img file="MX354471B_D0055.tif" />

IMPT

Tissue sections were blocked with t5phaque agtfntU' (10% normal goat suei'U ', 5% bovine serum albumin, 0.1% Triton X-100 in PBS) for 2 hours. Sections were incubated with antiCP4-EPSPS antibody (1/500 in PBS). After washing the sections three times in PBS, the tissue sections were incubated with the secondary antibody, goat anti-mouse IgG with the fluorophore Alexa 488 (Invitrogen, Eugene, Oregon). To include a negative control, incubation of the CP4EPSPS antibody was omitted. As a positive control, an antibody to α-tubulin (Sigma, St. Louis, MO), a cytoskeletal protein that is expressed in most cell types, was used in place of the CP4-EPSPS antibody in separate sections. Both primary and secondary antibodies were incubated at room temperature for 2-4 hours and then incubated overnight at 4 ° C. After washing, tissue images were taken with the Zeiss Confocal Laser Scanning Microscope (LSM) 510 META using a 488nm laser for excitation and 500-550nm for the series of emission filters. The same image capture parameter was applied to all samples, including controls. Bright and fluorescent light field images of each section were scanned and merged using the LSM software later to display the structural information. A strong signal was obtained with the antiCP4-EPSPS antibody in the filament tissue (Figure 6A, short arrow) and pollen (Figure 6A, long arrow) in the mature panicle of the plants generated with construct 4 (Figure 6A). , which lacked the mts-siRNA element. The plant of

<img file="MX354471B_D0056.tif" />

IMPI

1Ν $ ΤΙΤ «ΓΓ? .ΜΕΧ: Ο · .. '^: DS LA FKOHÍ-.JA1_ 'íK'USTaíal Figure 6A is homozygous for the transgene cassette; therefore, only about 50% of the pollen exhibited the positive CP4-EPSPS signal. In contrast, a strong signal was obtained with the anti-CP4-EPSPS antibody only in the filamentous tissue (Figure 6B, short arrow) and no signal was observed in the pollen (Figure 6B, long arrow) of the mature panicle of the plants generated with construct 3 that contained the element mts-siRNA (Figure 6B). The positive control antibody (anti-alpha-tubulin) exhibited signal in pollen within the mature panicle of plants generated with construct 4 or construct 3. Data from negative controls yielded the expected absence of signal. Data corresponding to conventional non-transgenic control exhibited the expected absence of signal from anti-CP4-EPSPS antibody staining and positive signal from anti-alpha-tubulin antibody staining. These data indicate that none or very few of the transcripts from the transformation cassette containing the mts-siRNA element were transferred to pollen, although the transcript was transferred to vegetative filamentous tissue. The loss of expression of the CP4-EPSPS protein in pollen is correlated with the panicle-specific glyphosate sensitivity observed in plants generated with construct 3.

EXAMPLE 5

This example illustrates field trial tests to assess male fertility or sterility. Thirteen transgenic plant events

IMPI

<img file="MX354471B_D0057.tif" />

R1-R3 single copy commits generated by the Jransfnrmanirin rnn. ^ J. CP4-EPSPS expression cassette / mts-siRNA element (construct 3) were analyzed in field trials to determine the efficacy of the expression cassette. In the first year, thirteen events were analyzed at one location in the field. In the second year, eight events were analyzed at four field locations. In the third year, four events were analyzed at four field locations During the three years of the field trials, the male fertility rate (MFR) corresponding to the events generated from construct 3 was approximately or less than MFR 2 , which is considered the industry standard for male sterility.

Data for one year of efficacy field trials are presented in Figures 8A-8C, where the average MFR produced under three different glyphosate fumigation treatment regimes presented in the graph (Figure 8A) corresponding to NK603 (CP4- Transgenic corn EPSPS), MON87427 (CP4-EPSPS transgenic corn with glyphosate-inducible male sterility) and two events of construct 3. Photos of panicles of plants grown during this particular field efficacy trial illustrate fertile panicles when plants are sprayed with glyphosate at 0.75 lb./acre (0.84 kg / ha) only in V3 (Figure 8B). ); and sterile panicles (without or with little extrusion of the anthers) in the plants sprayed with glyphosate 0.75 Ib./acre (0.84 kg / ha) in V3 followed by 0.75 Ib./acre (0.84 kg / ha) in V8 and then 0.75 Ib./acre (0.84 kg / ha) in V10 (Figure 8C). For this field trial, fumigation regimes

INSTITUI »J Μ kx ICa Ν&gt; -Λ

DE la ruOritOAA x¿4

INDUSTRIAL 'ΤΤΥ r:' were: treatment 1 consisted of 0.75 Ib./acre (0.84'1cg / ha) glifasatoenTa—— V3 (weed control); Treatment 2 consisted of 0.75 Ib./acre (0.84 kg / ha) of glyphosate in V3 (weed control) followed by 0.75 Ib./acre (0.84 kg / ha) in V8 and then 0.75 Ib./acre (0.84 kg / ha) in V10; Treatment 3 consisted of 0.75 Ib./acre (0.84 kg / ha) of glyphosate in V3 (weed control) followed by 1.25 Ib./acre (1.40 kg / ha) in V8 and then 1, 25 Ib./acre (1.40 kg / ha) in V10. The last two fumigations (i.e., V8 and V10) are referred to as sterility fumigations. These results indicate that with glyphosate fumigation treatment 1 only for weed control, all plants (NK603, MON87427 and events of construct 3) were fertile males. With glyphosate fumigation treatment 2 for sterility, NK603 plants had an MFR = 5, MON87427 were sterile with MFR = 2, and events 2 and 3 of construct 3 were partially male fertile with an MFR &lt;3. With glyphosate sterility fumigation treatment 3, the NK603 plants had an MFR = 5, the MON87427 were sterile males with an MFR &lt;2, and events and 3 of construct 3 were sterile males with an approximate or lower MFR score. of 2.

Although the average MFR was approximate or less than a score of 2, extrusion of the anthers was observed in events of construct 3 treated with glyphosate in S90 + 3 and S90 + 6 (Figure 9). For these data, four separate events from construct 3 were compared with plants MON87427 and NK603 with respect to two fumigation regimes with

<img file="MX354471B_D0058.tif" />

<img file="MX354471B_D0059.tif" />

glyphosate: Treatment 2 consisted of 1.5 Ib./acre (1.68 kg / ha) of glyphosate in V2 / V3 (weed control) followed by 0.75 Ib./acre (0.84 kg / ha) of glyphosate in the units degree of growth (GDU) 875 (~ V8) and then 0.75 Ib./acre (0.84 kg / ha) of glyphosate in GDU 1025 (~ V10) and treatment 3 consisted of 1.5 Ib./acre (1 , 68 kg / ha) of glyphosate in V2 / V3 (weed control), followed by 1.25 Ib./acre (1.40 kg / ha) of glyphosate in GDU 875 (~ V8) and then 1.25 Ib./acre (1.40 kg / ha) of glyphosate in GDU 1025 (~ V10). Scoring was assigned to the number of plants per lot (68 - 74 plants / lot) exhibiting anther extrusion in S90, S90 + 3, and S90 + 6, where S90 is the day that 90% of field plants exhibit filaments ; S90 + 3 is 3 days after S90; and S90 + 6 is 6 days after S90. As seen in Figure 9, in S90 there were 70 (± 15) NK603 plants per batch exhibiting anther extrusion in both glyphosate treatment regimens. In contrast, in the case of MON87427 and the four events of construct 3, there was 1 (± 12) plant per batch exhibiting extrusion of anthers in S90 in both glyphosate treatment regimens. In S90 + 3 and S90 + 6, there were 30 (+12) to 70 (± 12) plants per lot corresponding to the four events of construct 3 that exhibited anther extrusion with any of these glyphosate treatment regimens, approaching the observed in the case of NK603. The extrusion of the anthers corresponding to the event MON87427 was maintained at the S90 level at both the S90 + 3 and S90 + 6 time points and for each glyphosate treatment regimen. Every plant with&gt; 1 extruded anther was assigned a positive rating with respect to

<img file="MX354471B_D0060.tif" />

to the extrusion of the anthers. This late extrusion of the anthers, i.e. ~ S90 + 3 and S90 + 6, occurs at a period of maize development when there is a maximum growth height of the panicle and there is enough distance to allow machine cutting of the panicle with minimal damage caused to the upper two leaves of the corn plant, and therefore a minimal impact on inbreeding performance. Also, extrusion of anthers at S90 + 3 or later is considered to have little impact on seed purity.

Pollen viability analysis was carried out to determine whether low-level, but persistent, extrusion of the anthers observed in S90 + 3 to S90 + 6 was an indication of late breakdown of male fertility. Figures 10A and 10B illustrate an example of extrusion of late-breaking anthers in the panicle of an event of construct 3 sprayed for sterility. The box in Figure 10A is the enlarged portion of Figure 10B. An example of extruding late break anthers is indicated by a circle in Figure 10B. To determine the viability of pollen, pollen was collected from extruded anthers with late breakage and stained with Alexander stain, Figure 10C. Pollen was also collected from construct 3 events not sprayed the same day and stained with Alexander stain for comparison, Figure 10D. The results of this Alexander staining demonstrate only non-viable pollen (irregularly shaped pollen grains, translucent light blue) from late-breaking anthers from the events of construct 3 sprayed (Figure 10C). Fully viable pollen appears

<img file="MX354471B_D0061.tif" />

opaque, dark violet and spherical with Alexander staining (Figure 10D). In addition to staining pollen collected from individually isolated extruded late-breaking anthers, pollination bags were placed at some sprayed construct 3 events to determine pollen spread. Pollen was not appreciably disseminated in these pollination bags, which were unable to generate seed when used for cross-pollination of recipient ears. This result suggests that pollen was not disseminated from the anthers with late extrusion or that the pollen that can be disseminated is not viable.

Taken together, these data indicate that while there is a low level of anther extrusion in construct 3 events sprayed for sterility, these extruded anthers do not spread viable pollen.

EXAMPLE 6

This example illustrates field trials with transgenic plants to assess yield. The R2 plants of construct 3 were analyzed to evaluate the performance of inbreeds and hybrids. In the case of inbreeding yield, R2 plants of construct 3 were analyzed at four field locations to determine yield, vegetative tolerance to glyphosate fumigation, and male sterility with glyphosate fumigation. For these field tests, four events of construct 3 were planted in lots of 68-74 plants / lot. Treatments

IMPIOUS?

MEXlONO V INSTITUTE

Dii THE PH; / I ff t ·. ··. ”'·

INMJSTk./.l fumigation were: treatment 1 consisted of 1.5 Ib./aere &lt;1-, 68kg / ha) of glyphosate in V3 (weed control); Treatment 2 consisted of 1.5 Ib./acre (1.68 kg / ha) of glyphosate in V3 followed by 0.75 Ib./acre (0.84 kg / ha) in V8 and then 0.75 Ib./acre (0.84 kg / ha) in V11; Treatment 3 consisted of 1.5 Ib./acre (1.68 kg / ha) of glyphosate in V3 followed by 1.25 Ib./acre (1.40 kg / ha) in V8 and then 1.25 Ib./acre (1.40 kg / ha) in V11. As can be seen in Figure 11, the events of construct 3 in the three glyphosate treatment regimens exhibited good vegetative tolerance (white bars) measured by plant height, and good inbred performance (black bars) measured in terms of bushels (Bu) / acre. These same events were completely male fertile when treated with the glyphosate treatment regimen for weed control only (treatment 1), but were sterile males with an MFR score equal to or less than 2 (gray bars) when treated. with glyphosate 2 or 3 treatment regimens. The horizontal bar in Figure 11 indicates the industry standard for sterility, MFR

2. NK603 is presented for comparative purposes. The inbred grain yield measurements corresponding to the events of construct 3 and NK603 with glyphosate fumigation are reported in Table 4, where MST =% grain moisture, TWT = analytical weight (usually a density score in pounds per bushel) and S50D is the number of days until 50% cob filament appears in the batch. There was no significant difference (nd) measured in performance corresponding to any

<img file="MX354471B_D0062.tif" />

of the four events of construct 3 analyzed óóh 'áltjüho de Tós treatments 2 or 3 with glyphosate, compared to the NK603 control.

TABLE 4

Yield measurements of inbred grains

<td></td><td colspan="3">Comparison of Treatments 2 and 3 with Treatment 1</td>

<td>Events</td><td>MST</td><td>TWT</td><td>S50D</td>

<td>CNK603</td><td>na</td><td>na</td><td>na</td>

<td>Event 1</td><td>na</td><td>na</td><td>na</td>

<td>Event 2</td><td>na</td><td>na</td><td>na</td>

<td>Event 4</td><td>na</td><td>na</td><td>na</td>

<td>Event 3</td><td>na</td><td>na</td><td>na</td>

Regarding the performance of F1 hybrid grains, the events of construct 3 R3 were analyzed in four field locations. For these hybrid performance assays, cross-pollination of a non-transgenic female inbred line (Null) MON87427 and three events of construct 3, all with the same genetic background, was performed with a male MON810 / MON88017 test line to generate seeds F1 hybrids. The F1 hybrid seed generated from each of these crosses was planted in standard lots of 68-74 plants / lot. Fumigation treatments consisted of treatment 1 without glyphosate fumigation; Treatment 2 of 2.25 Ib./acre (2.5 kg / ha) of glyphosate in V4 followed by

2.25 Ib./acre (2.5 kg / ha) in the V7; Treatment 3 of 2.25 Ib./acre (2.5 kg / ha) of glyphosate in V4 followed by 2.25 Ib./acre (2.5 kg / ha) in V7 followed by

<img file="MX354471B_D0063.tif" />

2.25 Ib./acre (2.5 kg / ha) in V10. F1 plants were committed to open pollination to generate F2 grain, which is the yield measured in bushels / acre (Bu / acre). All three events in construct 3 exhibited equivalent F1 hybrid grain performance in all glyphosate treatment regimens compared to control crosses of NuloxMON810 / MON88017 and MON87427xMON810 / MON88017 (Figure 12).

EXAMPLE 7

This example illustrates the restoration of male fertility in F1 hybrid plants. F1 hybrid plants generated by an event cross of construct 3 as a female parent were analyzed to assess male fertility. Three different F1 hybrid crosses were established: non-transgenic female x MON88017 male; female MON87427 x male MON88017; and female of construct event 3 x male MON88017. The F1 hybrid seed was harvested from each of the three crosses, planted in a field and sprayed with glyphosate at a rate of 1,125 Ib./acre (1.26 kg / ha) in V4 followed by 1,125 Ib. / acre (1.26 kg / ha) in V10. Male fertility in F1 was evaluated by calculating the male fertility rate (MFR) and using Alexander viability staining of pollen. For each of the crosses, the MFR of the F1 hybrid plants was 5 or completely fertile. Alexander viability staining showed that 50% of the pollen produced by the F1 hybrid from each of the crosses was viable, as

IMPI ινλίίτητο mlxiCanc * Dt LA a ¹

INDUSTRIAL ¹⁷ ·· ... L ..- 1- · 'expected. (Figure 13) These data indicate that male fertility can be functionally restored in F1 hybrid plants produced from transgenic plants with male glyphosate-inducible sterility transformed with a CP4-EPSPS expression cassette / mtssiRNA element.

EXAMPLE 8

This example illustrates the construction of chimeric and variant mts-siRNA elements. Individual mts-siRNAs were mapped onto an mts-siRNA element presented in Figure 3; the X axis indicates the position of the nucleotides in the 5 'to 3' orientation from left to right at the top and from right to left at the bottom and the Y axis indicates that the relative abundance of mts-siRNA is indicated in terms of transcripts per quarter of a million sequences (tpq). The mts-siRNA were also distributed non-uniformly across all the mts-siRNA (X-axis).

Using this information, variants of an mts-siRNA element and / or chimeras produced using one or more mtssiRNA elements were designed so that they contained more (or less) total mtssiRNA sequences (optionally, or otherwise, added (or deleted) ) one or more mts-siRNA sequences, to result in more (or less) silencing of an operatively linked protein coding sequence, Such chimeric mts-siRNA variants or elements are useful in increasing or

<img file="MX354471B_D0064.tif" />

reduce the selective suppression of the expression of a recombinant protein__ in a male reproductive tissue of a transgenic plant.

Examples of mts-siRNA element variants and chimeras were constructed using fragments of SEQ ID NO: 87. The first variant (SEQ ID NO: 88) was constructed using a 104 nucleotide fragment at the 5 'end of SEQ ID NO: 87. The second variant (SEQ ID NO: 89) was constructed using an 80 nucleotide fragment from the 3 'half of SEQ ID NO: 87. Chimeric mts-siRNA elements were constructed by attaching a fragment (SEQ ID NO: 88) to another fragment (SEQ ID NO: 89) to form new chimeric mts-siRNA elements (SEQ ID NO: 90 and SEQ ID NO: 91). Additional chimeric mts-siRNA elements were constructed by bringing together three individual mts-siRNAs contained within SEQ ID NO: 87: a first chimera (SEQ ID NO: 92) was constructed by joining the mtssiRNA sequences SEQ ID NO: 26, 27 and 8; a second chimera (SEQ ID NO: 93) was constructed by joining the mts-siRNA sequences SEQ ID NO: 10, 33 and 5; a third chimera (SEQ ID NO: 94) was constructed by joining the mts-siRNA sequences SEQ ID NO: 26, 10 and 33. These variants and chimeras can be operably linked to a protein coding sequence to produce recombinant DNA constructs (see Figure 14) that can be analyzed in plants and plant cells to detect selective deletion of a recombinant protein encoded by the coding sequence of protein in a male reproductive tissue of a transgenic plant.

EXAMPLE 9

This example illustrates the design of variant and chimeric mts-siRNA elements. Variant and chimeric mts-siRNA elements were designed based on a 300 nucleotide (nt) long mts-siRNA element that has SEQ ID NO: 81, which is similar to the 300 nucleotide mts-siRNA element that has the SEQ ID NO: 82 and 87. A highly conserved consensual sequence regarding the mts-siRNA elements SEQ ID NO: 81, 82 and 87 is provided by SEQ ID NO: 96. Individually, each of these is also useful as an mts-siRNA element or as a basis for the design of variant or chimeric mts-siRNA elements, eg, by selecting fragments of an identified mts-siRNA element from the genomic sequence or CDNAs, such as fragments that include at least one mts-siRNA sequence and the combination or concatenation of such fragments.

Two fragments of SEQ ID NO: 81 were selected; fragment A (SEQ ID NO: 97) contained 104 contiguous nucleotides from the 5 'region (positions 1-104) of SEQ ID NO: 81 and fragment B (SEQ ID NO: 98) contained 80 contiguous nucleotides from region 3 '(positions 215-294) of SEQ ID NO: 81; it is evident that both fragment A (SEQ ID NO: 97) and fragment B (SEQ ID NO: 98) individually, are mts-siRNA elements that contain at least one mts-siRNA sequence. The location of fragments A and B (indicated by the underlined text) is exposed in the

IMPI

INSTITUI 'MIXHA ·' ·

LE La UU: -i; - · Co ÍNUUS1 ¿iA following complete sequence of SEQ ID NO: 81, which also indicates the location of the mts-siRNA sequences (indicated by the text in italics; Italicized segments of more than 18 contiguous nucleotides may include more than one overlapping mts-s¡RNA sequence) which was shown to map against this mts-siRNA element: GGACAACAAGCACCTTCTTGCCTTGCMGGCCTCCCTTCCCTATGGTAGC C ACTTG AGTG G ATG ACTTCAC CTTAAAGCTA TOGA TTCCCTAA G TGCCAG ACATAATAGGCTATACATTCTCTCTGGTGGCAACAATGAGTCATTTTGGTT GGTGTGGTAGTCTATTATTGAGTTTGTTTTGGCACCGTACTCCCATGGAG AGTACAAGACAAACTC TTCA CCG TCG TTG TA G TTGA TGGTA TTGG TGGTG ACGACATCCTTGGTGTGCATGCACTGGTGAGTCACTGTTGTACTCGGCG (SEQ ID NO: 81). Variant mts-siRNA elements were designed using fragments "A" and "B", which included the mts-siRNA element "A + B" (SEQ ID NO: 99) and an mts-siRNA element "B + A (SEQ ID NO: 100). A chimeric element (SEQ ID NO: 101) was designed to include the mts sequences of mts-siRNA (appearing in the italicized text above of SEQ ID NO: 81) and found to be mapped against the element mtssiRNA (SEQ ID NO: 81).

Similarly, a 251 nt long mts-siRNA element was identified (SEQ ID NO: 102) and a 121— nt long mts-siRNA element was identified (SEQ ID NO: 103, a fragment of SEQ ID NO : 102, i.e. the contiguous segment located at nucleotide positions 47-167 of SEQ

<img file="MX354471B_D0065.tif" />

ID NO: 102) of the genomic sequence of corn ______ (Zm_B73_CR10 :: Segment {75361491..75361742}) as panicle specific and corresponding to the mts-siRNA of young panicles (maize LH244, library 347; the mts-siRNAs Identified individually in some cases they overlap much of their sequence and vary only by a few nucleotides; see Table 5). Based on SEQ ID NO: 102 and 103, an mts-siRNA chimeric element was designed (SEQ ID NO: 104).

TABLE 5 mts-siRNA managed against SEQ ID NO: 103

<td>Bibl ID.</td><td>IDARNs (specific to each library)</td><td>start mapping</td><td>end mapping</td><td>strand</td><td>expression (tpq in case of Iib9. thick counts in other cases)</td><td>SEQ ID NO:</td><td>Sequence (in terms of DNA equivalent)</td>

<td> 347</td><td> 710618</td><td> 48</td><td> 72</td><td> -1</td><td> 1</td><td> 105</td><td>ACCAAAGCC GCAATACTT AGCCCTA</td>

<td> 347</td><td> 325</td><td> 49</td><td> 72</td><td> -1</td><td> 667</td><td> 106</td><td>ACCAAAGCC GCAATACTT AGCCCT</td>

<td> 9</td><td> 75221</td><td> 49</td><td> 72</td><td> -1</td><td> 14.0375</td><td> 107</td><td>ACCAAAGCC GCAATACTT AGCCCT</td>

<td> 9</td><td> 79587</td><td> 49</td><td> 70</td><td> -1</td><td> 1.7547</td><td> 108</td><td>CAAAGCCG CAATACTTA GCCCT</td>

<td> 347</td><td> 1443964</td><td> 49</td><td> 70</td><td> -1</td><td> 1</td><td> 109</td><td>CAAAGCCG CAATACTTA GCCCT</td>

<td> 347</td><td> 1798947</td><td> 50</td><td> 72</td><td> -1</td><td> 1</td><td> 110</td><td>ACCAAAGCC GCAATACTT AGCCC</td>

<td> 9</td><td> 993198</td><td> 51</td><td> 74</td><td> 1</td><td> 5.264</td><td> 111</td><td>GGCTAAGTA TTGCGGCTT TGGTAG</td>

<img file="MX354471B_D0066.tif" />

<img file="MX354471B_D0067.tif" />

<td> 346</td><td> 2511625</td><td> 56</td><td> 79</td><td> -1</td><td> 1</td><td> 112</td><td>GACAACTAC CAAAGCCG CAATACT</td>

<td> 347</td><td> 1978935</td><td> 62</td><td> 84</td><td> -1</td><td> 1</td><td> 113</td><td>GATATGACA ACTACCAAA GCCGC</td>

<td> 347</td><td> 955660</td><td> 63</td><td> 86</td><td> -1</td><td> 1</td><td> 114</td><td>TAGATATGA CAACTACCA AAGCCG</td>

<td> 347</td><td> 1183103</td><td> 64</td><td> 84</td><td> -1</td><td> 1</td><td> 115</td><td>GATATGACA ACTACCAAA GCC</td>

<td> 347</td><td> 36752</td><td> 73</td><td> 96</td><td> -1</td><td> 12</td><td> 116</td><td>ATCAAAAGT TTAGATATG ACAACT</td>

<td> 347</td><td> 151532</td><td> 75</td><td> 98</td><td> 1</td><td> 4</td><td> 117</td><td>TTGTCATAT CTAAACTTT TGATAG</td>

<td> 347</td><td> 1372</td><td> 97</td><td> 120</td><td> -1</td><td> 197</td><td> 118</td><td>ACGAGTACT CTAACATAT AAGACT</td>

<td> 347</td><td> 316040</td><td> 97</td><td> 117</td><td> -1</td><td> 2</td><td> 119</td><td>AGTACTCTA ACATATAAG ACT</td>

<td> 347</td><td> 1310155</td><td> 98</td><td> 121</td><td> 1</td><td> 1</td><td> 120</td><td>GTCTTATAT GTTAGAGTA CTCGTT</td>

<td> 347</td><td> 26503</td><td> 99</td><td> 122</td><td> 1</td><td> 15</td><td> 121</td><td>TCTTATATG TTAGAGTAC TCGTTA</td>

<td> 347</td><td> 490490</td><td> 109</td><td> 132</td><td> -1</td><td> 2</td><td> 122</td><td>ATCAAAACC CTAACGAGT ACTCTA</td>

<td> 347</td><td> 1125767</td><td> 114</td><td> 137</td><td> -1</td><td> 1</td><td> 123</td><td>AGACAATCA AAACCCTAA CGAGTA</td>

<td> 347</td><td> 442804</td><td> 115</td><td> 138</td><td> -1</td><td> 2</td><td> 124</td><td>GAGACAATC AAAACCCTA ACGAGT</td>

<td> 347</td><td> 965720</td><td> 118</td><td> 141</td><td> -1</td><td> 1</td><td> 125</td><td>CAGGAGAC AATCAAAAC CCTAACG</td>

<td> 345</td><td> 1549424</td><td> 119</td><td> 142</td><td> -1</td><td> 1</td><td> 126</td><td>ACAGGAGA CAATCAAAA CCCTAAC</td>

<td> 347</td><td> 311196</td><td> 120</td><td> 143</td><td> -1</td><td> 2</td><td> 127</td><td>CACAGGAG ACAATCAAA ACCCTAA</td>

<td> 347</td><td> 190</td><td> 121</td><td> 144</td><td> -1</td><td> 1018</td><td> 128</td><td>ACACAGGA GACAATCAA AACCCTA</td>

&lt;.· ·

IΜ PI ικίπτυτ. * lxíCa¡:&gt;_Λ ^ * 1 tBLAWMiJ.v) _v* '· ** &lt;£ ** INOUSTMa »* · * · &lt;.

<td> 346</td><td> 591709</td><td> 121</td><td> 144</td><td> -1</td><td> 2</td><td> 129</td><td>ACACAGGA GACAATCAA AACCCTA</td>

<td> 347</td><td> 363241</td><td> 121</td><td> 143</td><td> -1</td><td> 2</td><td> 130</td><td>CACAGGAG ACAATCAAA ACCCTA</td>

<td> 347</td><td> 1603891</td><td> 121</td><td> 141</td><td> -1</td><td> 1</td><td> 131</td><td>CAGGAGAC AATCAAAAC COTA</td>

<td> 347</td><td> 135176</td><td> 122</td><td> 144</td><td> -1</td><td> 4</td><td> 132</td><td>ACACAGGA GACAATCAA AACCCT</td>

<td> 347</td><td> 48157</td><td> 123</td><td> 146</td><td> 1</td><td> 9</td><td> 133</td><td>GGGTTTTGA TTGTCTCCT GTGTAT</td>

<td> 347</td><td> 1866298</td><td> 123</td><td> 144</td><td> -1</td><td> 1</td><td> 134</td><td>ACACAGGA GACAATCAA AACCC</td>

<td> 347</td><td> 1707358</td><td> 124</td><td> 147</td><td> -1</td><td> 1</td><td> 135</td><td>AATACACAG GAGACAATC AAAACC</td>

<td> 347</td><td> 1788406</td><td> 129</td><td> 146</td><td> 1</td><td> 1</td><td> 136</td><td>TGATTGTCT CCTGTGTAT</td>

<td> 347</td><td> 519539</td><td> 130</td><td> 153</td><td> &gt; 1</td><td> 2</td><td> 137</td><td>GATTGTCTC CTGTGTATT TACCCT</td>

<td> 347</td><td> 383791</td><td> 133</td><td> 156</td><td> -1</td><td> 2</td><td> 138</td><td>GAGAGGGT AAATACACA GGAGACA</td>

<td> 347</td><td> 273115</td><td> 135</td><td> 158</td><td> 1</td><td> 2</td><td> 139</td><td>TCTCCTGTG TATTTACCC TCTCGC</td>

<td> 345</td><td> 1244664</td><td> 135</td><td> 157</td><td> -1</td><td> 1</td><td> 140</td><td>CGAGAGGG TAAATACAC AGGAGA</td>

<td> 346</td><td> 1460995</td><td> 135</td><td> 157</td><td> -1</td><td> 1</td><td> 141</td><td>CGAGAGGG TAAATACAC AGGAGA</td>

<td> 347</td><td> 697148</td><td> 135</td><td> 157</td><td> 1</td><td> 1</td><td> 142</td><td>TCTCCTGTG TATTTACCC TCTCG</td>

<td> 347</td><td> 1716970</td><td> 136</td><td> 159</td><td> 1</td><td> 1</td><td> 143</td><td>CTCCTGTGT ATTTACCCT CTCGCA</td>

<td> 347</td><td> 839648</td><td> 137</td><td> 157</td><td> -1</td><td> 1</td><td> 144</td><td>CGAGAGGG TAAATACAC AGGA</td>

<td> 347</td><td> 8578</td><td> 145</td><td> 168</td><td> -1</td><td> 38</td><td> 145</td><td>TACAATAAG TGCGAGAG GGTAAAT</td>

I íVl ΡI

MEXICAN INSTITUTE

DE LA P¿ '&gt; l'IEDAl&gt; &lt;V ,. JlgT &lt;

INUIiSTKIAL

<td> 9</td><td> 519321</td><td> 145</td><td> 168</td><td> -1</td><td> 8.7734</td><td> 146</td><td>TACAATAAGT GCGAGAGGG TAAAT</td>

<td> 347</td><td> 423280</td><td> 145</td><td> 167</td><td> -1</td><td> 2</td><td> 147</td><td>ACAATAAGT GCGAGAGGG TAAAT</td>

<td> 347</td><td> 377787</td><td> 146</td><td> 168</td><td> -1</td><td> 2</td><td> 148</td><td>TACAATAAGT GCGAGAGGG TAAA</td>

<td> 9</td><td> 444803</td><td> 146</td><td> 167</td><td> -1</td><td> 1.7547</td><td> 149</td><td>ACAATAAGT GCGAGAGGG TAAA</td>

nucleotide position within SEQ ID NO: 103

EXAMPLE 10

This example illustrates transgenic vectors and cells, tissues, and plants containing recombinant DNA constructs that include a protein coding sequence encoding a recombinant protein and an mts-siRNA element operably linked to the protein coding sequence.

A plant transformation vector comprising a recombinant DNA construct is used for Agrobacterium-mediated transformation of corn cells. This transformation vector includes DNA for Agrobacterium-mediated transfer of T-DNA, an expression cassette (promoter operably linked to a DNA sequence of interest), a selectable marker expression cassette (for convenient selection of cells or transformed corn plants) and DNA for vector maintenance in E. coli (eg, an E. coli replication origin sequence). In one embodiment, the transformation vector is IMPI θθ INSTTTVTG MEXICANO

FROM ΚΚ '^ ΙΓ' TO&gt;

includes an expression cassette comprising a recombinant DNA construct flanked by Agrobacterium right and left border sequences, where the recombinant DNA construct includes the herbicide tolerance transgene CR-AGRtu.aroA-CP4.nat (presented as SEQ ID NO: 95) as a DNA coding sequence encoding a recombinant protein. The herbicide tolerance transgene CRAGRtu.aroA-CP4.nat is operably linked to the mts-siRNA presented as SEQ ID NO: 81 as a DNA sequence encoding an mtssiRNA element.

Transformation vectors are constructed to express different recombinant DNA constructs by inserting a polynucleotide that includes an mts-siRNA element (eg, SEQ ID NO: 57-94 or 97-104) into the plant transformation vector. The mts-siRNA element is inserted adjacent to the DNA sequence encoding a recombinant protein or within the 3 'untranslated region of the DNA sequence encoding a recombinant protein. Those plant transformation vectors are advantageous for generating transgenic plants in which male-sterility can be induced by the application of herbicide.

Methods for transforming plants are well known in the art. For example, corn plants from a transformable line are grown in the greenhouse and the ears are harvested when the embryos are 1.5 to 2.0 mm long. The surface of the ears is sterilized with 80% ethanol, followed by air drying. The

<img file="MX354471B_D0068.tif" />

<img file="MX354471B_D0069.tif" />

immature embryos from the individual kernels of the sterilized ears. Prior to inoculation of the maize cells, individual Agrobacterium cultures are maintained, each containing a transformation vector to express at least one of the recombinant DNA constructs of the present invention overnight at temperature environment. Corn embryonic cell cultures are inoculated with Agrobacterium, incubated at room temperature with Agrobacterium for 5 to 20 minutes, co-cultured with Agrobacterium for 1 to 3 days at 23 degrees Celsius in the dark, harvested Transfer to selection medium and cultivate for approximately 2 weeks to result in development of embryogenic callus. The embryogenic callus is transferred to a culture medium containing 100 mg / l paromomycin and subcultured at intervals of approximately two weeks. Multiple transformed plant cell events are recovered 6 to 8 weeks later, once selection has been initiated.

Transgenic corn plants are regenerated from transgenic plant cell callus for each of the transgenic events that occur as a result of transformation and selection, by placing transgenic callus of each event in a medium to initiate outbreaks and root development in seedlings that are transferred to potting soil for initial development in a growth chamber at 26 degrees Celsius, followed by cultivation in a fumigation bench before transplanting them into pots where the plants are grown to maturity. Regenerated plants

<img file="MX354471B_D0070.tif" />

<img file="MX354471B_D0071.tif" />

they are self-fertilized. The first generation-of-se.milla.s (“R1”) is harvested.

Plants grown from R1 seeds ("R2" plants) are used to produce progeny.

EXAMPLE 11

This example illustrates methods for selecting mts-siRNA sequences and mts-siRNA elements for use in recombinant DNA constructs that include a protein coding sequence encoding a recombinant protein and an mts-siRNA element operatively linked to the coding sequence of protein.

A method of verifying the efficacy of an mts-siRNA element to selectively suppress the expression of a recombinant protein in a male reproductive tissue of a transgenic plant involves the use of a protoplast assay in which the protoplasts of plant cells are co- transformed with: (a) a vector containing a recombinant DNA construct that includes a protein coding sequence and an mts-siRNA element operably linked to the protein coding sequence and (b) RNA (s) having the sequence of the siRNA (s) ( s) corresponding to the mts-siRNA element or elements (or, on the other hand, the mts-siRNA sequence (s)), where it is estimated that the expression level of the recombinant protein has to be inversely proportional to the degree to which the mts-siRNA element is cleaved by the RNA (s).

<img file="MX354471B_D0072.tif" />

This is illustrated by the following gompin nn limitonto cl assay was carried out on two mts-siRNA sequences (corresponding to two siRNAs that were shown to be expressed profusely in corn panicle). Briefly, foliar corn protoplasts are cotransformed with: (a) a plasmid (3 micrograms / 320,000 cells) containing a recombinant DNA construct that includes a protein coding sequence encoding a recombinant protein (CP4-EPSPS, SEQ ID NO: 95) and an mtssiRNA element (SEQ ID NO: 81) and (b) a first dsRNA in which a first strand has the sequence SEQ ID NO: 150 in the 5 'to 3' direction and a second strand that is the complement of the first and a second dsRNA in which a first strand has the sequence SEQ ID NO: 151 in the 5 'to 3' direction and a second strand that is the complement of the first. The dsRNAs (from Integrated DNA Technologies, Inc., Coralville, Iowa) were analyzed at a rate of 0, 5, 25 or 50 nanograms / 320,000 cells, adjusting the total RNA used in each cotransformation assay with a "fill" RNA that it consisted of miRNA395 (in the form of mature 21-mer, provided in the form of dsRNAs) or in yeast tRNA up to 50 nanograms / 320,000 cells. The CP4-EPSPS protein level was determined by ELISA and used to assess the ability of the analyzed dsRNAs to suppress the expression of the recombinant protein. The results are reported in Table 6.

<img file="MX354471B_D0073.tif" />

TABLE 6

CP4-EPSPS protein level ί ·

..i. F:

MEXICAN INSTITUTE i *. · ..- C »LA PR *&gt; P * tDAL · Ϊ” · ...

INDUSTKlAi * - /

<td>DsRNAs analyzed</td><td>DsRNAs (ng)</td><td>Filled RNA (ng)</td><td>CP4EPSPS protein (ng / mg total protein)</td>

<td>none (control)</td><td> 0</td><td> 50</td><td> 317</td>

<td>SEQ ID NO: 150</td><td> 5</td><td> 45</td><td> 294</td>

<td></td><td> 25</td><td> 25</td><td> 167*</td>

<td></td><td> 50</td><td> 0</td><td> 114*</td>

<td>SEQ ID NO: 151</td><td> 5</td><td> 45</td><td> 315</td>

<td></td><td> 25</td><td> 25</td><td> 223*</td>

<td></td><td> 50</td><td> 0</td><td> 91*</td>

statistically significant with respect to control

Each of the dsRNAs (SEQ ID NO: 150 and 151) vigorously suppressed CP4-EPSPS expression (indicated by reduced accumulation of CP4-EPSPS protein) when co-transformed with the plasmid containing the recombinant DNA construct that includes the CP4-EPSPS protein coding sequence and the mts-siRNA element. The observed suppression of CP4-EPSPS was dose-dependent on the amount of dsRNA and independent of the type of fill RNA. Suppression of CP4-EPSPS was not observed in control samples co-transformed with the fill RNA instead of the dsRNA from the assay.

<img file="MX354471B_D0074.tif" />

<img file="MX354471B_D0075.tif" />

EXAMPLE 12

This example illustrates recombinant DNA constructs, vectors, and transformed plants of the invention. Vectors and transformation methods similar to those described in Example 10 were used to produce stably transformed corn plants containing, in their genome, a recombinant DNA construct that includes a protein coding sequence operably linked to a DNA sequence comprising an mts-siRNA element. Six design combinations of the mts-siRNA construct / element were analyzed (see Table 7). Plants were sprayed twice (in V5 and V8) with 0.75 Ib. ae / A (0.84 kg / ha) of Roundup WeatherMAX®. The results are reported in Table 7. For each design of the mts-siRNA construct / element combination, approximately 20 plants were left without spraying to compare with glyphosate sprayed plants. All non-sprayed plants spread pollen and exhibited good male fertility (no data presented). Corn plants transformed with the construct B design exhibited more pronounced male sterility than corn plants transformed with the construct A design. The designed constructs (5 'to 3', from left to right) were: Construct A which is promoter A / intron A / transit peptide A / CP4-EPSPS (SEQ ID NO: 95) / element mts-siRNA / 3 'UTR and Construct B is promoter B / intron B / transit peptide B / CP4EPSPS / element mts-siRNA / 3'UTR. In the following context, "nm" means

<img file="MX354471B_D0076.tif" />

<img file="MX354471B_D0077.tif" />

not measured. The masetriine fertility rate (MFR) calculation scale is.-5 · the emergence of the anthers is normal, the volume of pollen is equal to that of the non-fumigated lots but may or may not spread pollen; 4 = anther emergence is 50% of normal, but scatter poorly or do not spread normal amounts of pollen; 3 = panicle appears normal although there is sporadic extrusion of the anthers (&gt; 10 anthers per panicle) and little or no pollen is scattered or scattered; 2.5 = pollen is not spread, anthesis is considerably reduced (&lt;10 anthers per panicle) or it is very late (1 week) with respect to the end of the formation of filaments; 2 = pollen is not spread, there is no anthesis or it is very late (1 week) with respect to the end of the formation of filaments; and 1 = no pollen is spread, the panicle has an abnormal stem phenotype, or the anthesis is delayed two or more weeks after the appearance of the filaments. S90 is when 90% of the plants have filaments ready for pollination and S90 + 3 is 3 days after S90.

TABLE 7

Design of the construct / dew data with the element mts-siRNA

<td>Construct design *</td><td>mts-siRNA element, SEQ ID NO</td><td>Vegetative damage</td><td>Pollen spread to S90</td><td>MFR from S90 to S90 + 2</td><td>% of abnormal pollen</td>

<td>TO</td><td> 97</td><td>No</td><td>No</td><td> 5</td><td> 100%</td>

<td>TO</td><td> 97</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>TO</td><td> 97</td><td>No</td><td>No</td><td> 2</td><td> 100%</td>

<td>TO</td><td> 98</td><td>No</td><td>Yes</td><td> 5</td><td>nm</td>

<td>TO</td><td> 98</td><td>No</td><td>No</td><td> 3</td><td> 60%</td>

<td>TO</td><td> 98</td><td>No</td><td>No</td><td> 5</td><td> 70%</td>

IMPT ^ j

INSTITUT tft-C '! ·' ·.

COOKING POT ?'·.'. .

iNbm / .ί

<td>TO</td><td> 98</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>TO</td><td> 104</td><td>No</td><td>No</td><td> 4</td><td>nm</td>

<td>TO</td><td> 104</td><td>No</td><td>No</td><td> 2</td><td> 50%</td>

<td>TO</td><td> 104</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2</td><td>nm</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 4</td><td>nm</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2</td><td>nm</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2.5</td><td>nm</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2</td><td> 100%</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2.2</td><td>nm</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 3</td><td> 20%</td>

<td>B</td><td> 101</td><td>No</td><td>No</td><td> 2</td><td> 100%</td>

<td>B</td><td> 97</td><td>No</td><td>No</td><td> 2.5</td><td>nm</td>

<td>B</td><td> 97</td><td>No</td><td>No</td><td> 2</td><td> 100%</td>

<td>B</td><td> 97</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>B</td><td> 97</td><td>No</td><td>No</td><td> 4</td><td> 100%</td>

<td>B</td><td> 97</td><td>No</td><td>No</td><td> 2</td><td>nm</td>

<td>B</td><td> 98</td><td>No</td><td>No</td><td> 2</td><td> 100%</td>

<td>B</td><td> 98</td><td>No</td><td>No</td><td> 2.5</td><td> 100%</td>

<td>B</td><td> 98</td><td>No</td><td>No</td><td> 2</td><td>nm</td>

<td>B</td><td> 98</td><td>No</td><td>No</td><td> 2.5</td><td>nm</td>

All the materials and methods described and claimed herein can be prepared and used without undue experimentation, according to the indications of the preceding description. The examples set forth are included to demonstrate the embodiments of the invention. Those skilled in the art should appreciate that the techniques described in the examples represent techniques that the inventor has found to be successful in practicing the invention and therefore may be considered preferred embodiments of practicing it. However, the

<img file="MX354471B_D0078.tif" />

IMPI people with training in the technique should apprpriar, to the Iht- h_p ι_αIn this description, numerous changes can be made to the specific modalities presented and a similar or similar result is obtained in any case without departing from the spirit and scope of the invention. All such similar substitutions and obvious modifications for a person of ordinary skill in the art are considered to be within the spirit, scope and concept of the invention defined by the appended claims.