Decreasing lactate level and increasing polypeptide production by downregulating ldh and pdhk expression.

(54) Title: DECREASE THE LACTATE LEVEL AND INCREASE THE PRODUCTION OF POLYPEPTIDES BY LOWERING THE EXPRESSION OF LACTATE DEHYDROGENASE AND PYRUVATE DEHYDROGENASE KINASE.

(54) Title: DECREASING LACTATE LEVEL AND INCREASING POLYPEPTIDE PRODUCTION BY DOWNREGULATING LDH AND PDHK EXPRESSION.

(57) Summary

The present invention relates to methods and compositions for reducing lactate production and increasing polypeptide production in cultured cells. In one aspect, the invention provides a method comprising culturing cells expressing a) a small interfering RNA (siRNA) specific for a lactate dehydrogenase (LDH) and b) a siRNA specific for a pyruvate dehydrogenase kinase (PDHK). In another aspect, the invention provides cultured cells or vectors comprising a siRNA specific for an LDH and a siRNA specific for a PDHK.

(57) Abstract

The present invention provides methods and compositions for reducing lactate production and increasing polypeptide production in cultured cells. In one aspect, the invention provides a method comprising culturing cells expressing a) a small interfering RNA (siRNA) specific for a lactate dehydrogenase (LDH) and b) an siRNA specific for a pyruvate dehydrogenase kinase (PDHK). In another aspect, the invention provides cultured cells or vectors comprising an siRNA specific for a LDH and an siRNA specific for a PDHK.

<img file="MX343604B_D0001.tif" />

Institute

Mexican Property

Industrial

I KNOW

ÍECittMfa Bt «SWJMIA

<img file="MX343604B_D0002.tif" />

PATENT TITLE NO. 343604

Owner (s): GENENTECH, INC.

Address: 1 DNA Way, South San Francisco, California, 94080, USA

Name: DECREASE LACTATE LEVEL AND INCREASE PRODUCTION OF POLYPEPTIDES BY DOWN REGULATION OF THE EXPRESSION OF LACTATE DEHYDROGENASE AND PYRUVATE DEHYDROGENASE KINASE.

Classification: lnt.CI.8: C12N15 / 11; C12N15 / 113; C12P21 / 00

Inventor (s): MEIXIA ZHOU: BRADLEY RICHARD SNEDECOR; CHI KIN DOMINGOS NG;

AMY SHEN

Number:

MX / a / 2012/013579

Country: „= ·

US ¹ I

REQUEST

International filing date:

May 2011 í;

PRIORITY

Date: Number: / May 2010 61 / 349,727Ϊ

Validity: Twenty years.

Expiration Date: May 26, 2031

The reference patent / is granted based on articles 1, 2, section V, 6-rationale, and SS of the Industrial Property Law.

Faith in accordance with the 23rd Article of the Industrial Property Law, this patent has a validity of twenty years, renewable, foolish from the filing form of the international application and will be subject to payment of the rights in force. , · T jjíulen subscribes the presarte title-.fc based on the gamete by articles β tractions I&gt; | and 7 ° bis 2 ¡fe the Industrial Property Law (Official Gazette of the Federation (OOF) 06/27/1991, refoi uja e&gt;? Cft / lPB ¿? * 10/1996, 12/26/19Í7, 17 / 05/1999, 126/01/2004, 06/06/200%, 01/25/2006, 06/05 / 2009,06 / 01 / 2ΠΟ, 06/18/2010, 06/28/2010, 27i01 / 2012 and 04/09/2012); Articles 1 * 3rd fraction V subsection a), 4th and 12th fractions I and III of the Regulation of the Mexican Institute of Industrial Property (DOF 14/12/1999, amended on HI / 07/2002, 07/15/2004 , 07/28/2084 and 09/07/2007); Articles 1, 3, 4 »and #» Ise »eV Panting a), 16 sections I and III and 30 of the Entufo Orgánica ifel Instituto Mexicano d» la Industria Industnal (DOF 12/27/1999 amended on 10/10/2002, 07/29/2004, 08/04/2004 and 09/13/2007); 1, 3 and 5 * subsection a) of the Agreement that delegates powers to all Deputy Directors General, Coordinator, Divisional Directors, Heads of Regional Offices, Divisional Deputy Directors, Departmental Coordinators and other subordinates of the Mexican Institute of Industrial Property. (DOF 12/15/1999, amended on 02/04/2000, 07/29/2004, 08/04/2004 and 09/13/2007).

Issue Date: November 11, 2016

<img file="MX343604B_D0003.tif" />

IMPI

MEXICAN INSTITUTE

DECREASE LACTATE LEVEL AND INCREASE PROfíttófelW

<img file="MX343604B_D0004.tif" />

POLYPEPTIDES BY REGULATION DOWN WITH TA F.yppp. STÓN DE _p

LACTATE DEHYDROGENASE AND PYRUVATE DEHYDROGENASE KINASE

CROSS REFERENCE TO RELATED REQUESTS

This application claims the benefit of the priority of the US Provisional Patent Application Serial Number 61 / 349,727 filed on May 28, 2010, the contents of which are incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

The field of this invention relates generally to methods and compositions for reducing lactate production and increasing polypeptide production in cultured cells.

BACKGROUND OF THE INVENTION

The biopharmaceutical market is growing rapidly, with the industry projected to reach $ 70 billion by 2010. See Genetic Engineering in Livestock: New Applications and Interdisciplinary Perspectives (Engelhard et al., 2009) Springer Berlin Heidelberg. Given the increase in demand for therapeutic proteins and the increase in market competencies shared by companies, there is a need to improve technologies to achieve better productivity in therapeutic proteins. Towards this goal, different approaches such as host cell engineering have been explored. See Kuystermans et al.,

ΙΜΡΙ

INSTITUTO MF.XICANr. Df THE RROWF.DAD

INDUSTRIAL

<img file="MX343604B_D0005.tif" />

Cytotechnology 53 (1-3): 3-22 (2007); and O'Callaghan and James,

Brief Funct. Genomic Proteomic 7 (2): 95-110 (2008). Cultured cells such as Chinese Hamster Ovary (CHO = Chinese Hamster Ovary) cells are widely used to produce therapeutic proteins. For example, pH-controlled batch-fed bioreactor culture has been widely used to produce recombinant monoclonal antibodies. Langheinrich and Nienow, Biotechnol. Bioeng. 66 (3): 171-9 (1999). Lactate is one of the major accumulated waste products during batch-fed culture, and has been shown to inhibit cell growth and protein production. See Glacken et al., Biotechnol. Bioeng. 32: 491-506 (1988); and Lao and Toth, Biotechnol. Prog. 13: 688-691 (1997). This in turn leads to an increase in the amount of alkali required to add to the culture medium to control the pH. Dietl et al., J. Immunol. 184 (3): 1200-9 (2010); Langheinrich and Nienow, Biotechnol.

Bioeng, 66 (3): 171-9 (1999). An increased addition of alkali to the cell culture medium to maintain pH can result in an increase in osmolality, and this increase can lead to inhibition of cell growth and decreased antibiotic productivity. Cruz et al., Enzyme Microb. Technol. 27 (1-2): 43-52 (2000); Iran et al., Biotechnol. Bioeng. 66: 238-246 (1999). Therefore, it is desired to reduce the lactate level for the development of polypeptide or a

<img file="MX343604B_D0006.tif" />

higher-titer antibody production process.

There are many factors that can influence lactate production in cell culture, such as controlling the level of pyruvate. See Liu et al., J. Biol. Chem., 284 (5): 2811-22 (2009); and Samuvel et al., J. of Immunol. 182 (4): 2476-84 (2009). Pyruvate is the substrate for the enzymes pyruvate dehydrogenase (PDH) and lactate dehydrogenase (LDH).

The PDH complex is a multi-enzyme unit consisting of three catalytic enzymes, El, E2, and E3. Patel and Korotchkina, Exp. Mol. Med. 33 (4): 191-7 (2001). This complex catalyzes the rate-limiting conversion reaction to convert from pyruvate to acetyl-CoA, which is the entry point of the tricarboxylic acid cycle (TCA = Tricarboxylic Acid). PDH activity is regulated by the enzymes pyruvate dehydrogenase kinases (PDHK (s)) and pyruvate dehydrogenase phosphatases (PDHPs). PDHKs phosphorylates PDH to suppress its enzymatic activity, while PDHP dephosphorylates and thereby activates PDH. See Patel and Korotchkina, Exp. Mol. Med. 33 (4): 191-7 (2001); Roche and Hiromasa, Cell Mol. Life Sci. 64 (7-8): 830-49 (2007); Holness and Sugden, Biochemical Society Transactions, 31: 1143-1151 (2003). There are four isotypes of PDHK in mammalian cells (PDHK1, PDHK2, PDHK3, and PDHK4) with tissue-specific distributions. See Harris et al., Adv. Enzyme Regul. 42: 249-59

<img file="MX343604B_D0007.tif" />

MEXICAN INSTITUTE &amp; £ DE LA TRONE DA t. INDUSTRIAL (2002); and Bowker-Kinley et al., (1998).

Biochem. J. 329 (1): 191-6

LDH directly catalyzes pyruvate and lactate interconversion with concurrent NADH and NAD + interconversion. In mammalian cells, LDHs exist as either homo- or heterotetramers that primarily consist of A and B subunits (or H and M subunits, respectively) encoded by LDHa and LDHb genes, and sometimes C-subunit homotetramers encoded by LDHc genes. See Baumgart et al., J. Biol. Chem. 271 (7): 3846-55 (1996); Li et al., J. Biol. Chem. 258 (11): 7029-32 (1983); Skory CD, Appl. Environ. Microbiol. 66 (6): 2343-8 (2000); and Read et al., Proteins 43 (2): 175-185 (2001). For example, in CHO cells, LDH isotypes have been shown to be intermediates of A3B and the A2B2 tetramer. Jeong et al., Biochem. Biophys. Res. Commun. 289 (5): 1141-9 (2001). Previous studies have shown that down-regulation of LDHa in CHO cells by dissociation of the gene by homologous recombination (Chen et al., Biotechnol. Bioeng. 72 (1): 55-61 (2001)), antisense technology (Jeong et al., Biochem. Biophys. Res. Commun. 289 (5): 1141-9 (2001)), or small or short interfering RNA ( siRNA) (Kim and Lee, Appl. Microbiol. Biotechnol. 74 (1): 152-9 (2007)) can reduce lactate level but does not achieve appreciable improvement in protein productivity. For example, in the case of LDHa-specific siRNA, even when a reduction in

IMPI

INSTITUTO MfcXICANO Ut LA INDUSTRIAL ROOTS

<img file="MX343604B_D0008.tif" />

45-79% at lactate level, there is no significant improvement in Specific Productivity (Qp) and product title (antibody), suggesting that decreased LDHa expression only in CHO cells is not sufficient to improve Qp and product performance efficiently. Thus, more efficient methods of reducing lactate production are required to achieve better therapeutic polypeptide production.

All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes in the same proportion as if each individual publication, patent and patent application were specifically indicated and individually so incorporated by reference.

BRIEF SUMMARY OF THE INVENTION

The present invention provides methods and compositions for reducing lactate production and increasing polypeptide production in cultured cells. The inventors have found that concomitant downregulation of LDH and PDHKs by siRNAs in cultured cells that express polypeptides (eg, antibodies) decreases lactate level, lactate production rate, and osmolality and increases the productivity of the specific polypeptide (eg Specific Productivity) and polypeptide production (eg

<img file="MX343604B_D0009.tif" />

<img file="MX343604B_D0010.tif" />

example, productivity). Furthermore, these cells grown with down-regulated LDH and PDHKs do not exhibit negative impact on cell growth, cell viabilities and the quality of the polypeptides produced.

In one aspect, the invention provides a method of reducing lactate production in cultured cells, the method comprises culturing cells expressing a) small interfering RNA (siRNA = Small Interfering RNA) specific for a lactate dehydrogenase (LDH) and b) a siRNA specific for a pyruvate dehydrogenase kinase (PDHK).

In another aspect, the invention provides cultured cells comprising a) a siRNA specific for LDH and a siRNA specific for PDHK.

In some embodiments, the cultured cells further express a siRNA specific for a second PDHK. In some embodiments, the cultured cells further express a siRNA specific for a third PDHK. In some embodiments, cultured cells further express a siRNA specific for a fourth PDHK.

In another aspect, the invention provides a method of reducing lactate production in cultured cells, the method comprises culturing cells comprising a first heterologous nucleic acid sequence encoding a small interfering RNA (siRNA) specific for a lactate dehydrogenase (LDH) and a second nucleic acid sequence

<img file="MX343604B_D0011.tif" />

INSTITUTO MEXICANA DELA FROPIEDAD INDUSTRIAL heterologous encoding a siRNA specific for a pyruvate dehydrogenase kinase (PDHK), where the first heterologous nucleic acid sequence is operably linked to a first promoter, and where the second heterologous nucleic acid sequence is operably linked with a second promoter.

In another aspect, the invention provides cultured cells comprising a first heterologous nucleic acid sequence encoding a first siRNA specific for an LDH and a second heterologous nucleic acid sequence encoding a second siRNA specific for a PDHK, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

In some embodiments, the cells further comprise a third heterologous nucleic acid sequence encoding a siRNA specific for a second PDHK and wherein the third heterologous nucleic acid sequence is operably linked to a third promoter. In some embodiments, the cells further comprise a fourth heterologous nucleic acid sequence encoding a siRNA specific for a third PDHK and wherein the fourth heterologous nucleic acid sequence is operably linked to a fourth promoter. In some embodiments, cells in addition

ΙΜΡΙ

<img file="MX343604B_D0012.tif" />

MEXICAN INSTITUTE.

DI LA I'KOEIEDAP ⁴ -*·&gt; *

INDUSTKIAL _____ comprise a fifth heterologous nucleic acid sequence encoding a siRNA specific for a fifth PDHK and wherein the fifth heterologous nucleic acid sequence is operably linked to a fifth promoter.

In some embodiments, LDH is LDHa, LDHb, or LDHc.

In some embodiments, PDHK is chosen from the group consisting of PDHK1, PDHK2, PDHK3, and PDHK4. In some embodiments, PDHK is chosen from the group consisting of PDHK1, PDHK2, and PDHK3. In some embodiments, PDHK is chosen from the group consisting of PDHK1 and PDHK2. In some embodiments, PDHK is chosen from the group consisting of PDHK1 and PDHK3. In some embodiments, PDHK is chosen from the group consisting of

PDHK2 and PDHK3.

In some embodiments, the method of reducing lactate production in cultured cells comprises culturing cells comprising a first heterologous nucleic acid sequence encoding a siRNA specific for lactate dehydrogenase (LDH) and a second, third and fourth heterologous nucleic acid sequences. encoding three different siRNAs specific for a first, second and third PDHKs, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter and where the second, third and fourth heterologous nucleic acid sequences are operably linked to a second, third and fourth promoters respectively. In some

-Λ. V JSL INSTITUTO M feX ICA NO

GIVE INDUSTRIAL PROPERTY

<img file="MX343604B_D0013.tif" />

modalities, LDH is LDHa, where the first PDHK is PDHK1, the second PDHK is PDHK2, and the third PDHK is PDHK3.

In some embodiments, the cultured cells comprise a first heterologous nucleic acid sequence encoding a first siRNA specific for an LDH and a second, third, and fourth heterologous nucleic acid sequences encoding three different siRNAs specific for a first, second, and third PDHKs, where the first heterologous nucleic acid sequence is operably linked to a first promoter, and where the second, Third and fourth heterologous nucleic acid sequences are operably linked to a second, third and fourth promoters respectively. In some embodiments, LDH is LDHa, where the first PDHK is PDHK1, the second PDHK is PDHK2, and the third PDHK is PDHK3.

In some embodiments, cultured cells produce a heterologous polypeptide. In some embodiments, the heterologous polypeptide is an antibody.

In some modalities, the rate of lactate synthesis of cultured cells is less than the rate of lactate consumption. In some modalities, the average lactate production rate is less than approximately negative 0.02 mg / 10⁶ cells / day.

In some modalities, cultured cells containing siRNAs specific for LDH and PDHK (s) have a

ΙΜΡΙ

MEXICAN INSTITUTE Dt LA PHOMEDAD osmolality less than approximately 300 mOsm. '*

In some modalities, the CélUláa óUltlvaffaS 'have a Specific Productivity (Qp) of at least approximately 75% higher than the cultured cells without the

<img file="MX343604B_D0014.tif" />

<td>sequence</td><td>of</td><td>heterologous nucleic acid</td><td>than</td><td colspan="2">comprises the</td>

<td>PDHK (s) and</td><td>LDH</td><td> •</td><td></td><td></td><td></td>

<td></td><td>In</td><td>some modalities,</td><td colspan="2">cells</td><td>cultivated</td>

<td colspan="2">they have one</td><td>Specific Productivity</td><td>(Qp)</td><td>of</td><td>at least</td>

approximately 75% higher than cultured cells without the specific siRNAs for LDH and PDHK (s).

In some embodiments, cultured cells have a polypeptide productivity (eg, productivity or antibody titer in g / L) of about 10% to about 800% higher than cells grown without the heterologous nucleic acid sequence comprising PDHKs. (s) and LDH. In some embodiments, cultured cells have approximately 55% higher polypeptide productivity than cultured cells without the heterologous nucleic acid sequence comprising PDHK (s) and LDH. In some embodiments, cultured cells have a polypeptide productivity of at least about 68% higher than cultured cells without the heterologous nucleic acid sequence comprising PDHK (s) and LDH.

In some modalities, cultured cells

<img file="MX343604B_D0015.tif" />

they have a polypeptide productivity of about 10% to about 800% higher than cells grown without specific siRNAs for PDHK (s) and LDH. In some modalities, cultured cells have approximately 55% higher polypeptide productivity than cultured cells without specific siRNAs for PDHK (s) and LDH. In some modalities, cultured cells have a polypeptide productivity of at least about 68% higher than cultured cells without siRNAs specific for P'DHK (s) and LDH.

In some embodiments, the cultured cells are mammalian cells. In some embodiments, the cultured cells are non-mammalian cells.

In another aspect, the invention provides a method of silencing or down-regulating LDH and PDHK transcription in a cultured cell comprising: introducing into the cell a vector comprising a first heterologous nucleic acid sequence encoding an LDH-specific siRNA and a second heterologous nucleic acid sequence encoding a PDHK-specific siRNA, wherein the first heterologous nucleic acid sequence is operably linked with a first promoter and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter, where siRNAs are expressed in this way by silencing or down-regulating ^{, N! FT |}TW.'MEXICANO

OF THE PROFIEDAr.

INDUSTRIAL transcription of LDH and PDHK genes.

In another aspect, the invention provides a method of producing a cell that exhibits decreased lactate production in culture, which comprises introducing into a cell a vector comprising a first heterologous nucleic acid sequence encoding an LDH-specific siRNA and a second sequence of heterologous nucleic acid encoding a PDHK-specific siRNA, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

In another aspect, the invention provides a vector comprising a first heterologous nucleic acid sequence encoding a small interfering RNA (siRNA) specific for lactate dehydrogenase (LDH) and a second heterologous nucleic acid sequence encoding a pyruvate dehydrogenase specific siRNA. kinase (PDHK), wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows a siRNA construct that targets LDHa / PDHKl, 2, 3. siRNAs that target LDHa,

ΙΜΡΪ

MEXICAN INSTITUTE Df LA SMW.DAL ·

INDUSTRIAL

PDHK1, PDHK2 and PDHK3 were cloned using a single hygromycin vector pSilencer 3.1. Directed sequence for LDHa was under U6 promoter regulation while siRNAs for PDHK1, 2, and 3 were under Hl promoter regulation.

Figure 2 shows relative expression levels of LDHa, PDHK1, 2, and 3 mRNA in 12 select siRNA clones (as illustrated in light gray). Expression levels of LDHa and PDHKs were normalized to the b-microglobulin gene for decreased expression. The average mRNA expression levels of 12 simulated clones are shown in dark gray.

Figure 3 (comprising of Figures 3A-3C) shows lactate profiles, average lactate production rates and pH values ​​from day 14 in batch fed stirring flask evaluation. Lactate concentrations were measured using a Nova analyzer apparatus on days 3, 7, 10 and 14 during a 14-day shake flask evaluation. 3A). Lactate profile of simulated clones (dark gray) and siRNA (light gray); 3B). Average lactate production rate between days 3 and 14 (mg / 10⁶ cells / day); and 3C). PH values ​​on day 14. Batch fed shake flask experiments were performed 3 times and data shown is from 1 experiment.

<img file="MX343604B_D0016.tif" />

IMPI

- "Ta"? J

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

Figure 4 (comprising of Figures 4A-4C) shows titers, Specific Productivity (Qp) and cell growth profiles in evaluation of batch fed shake flask. 4A). Day 14 title (productivity) in g / L; 4B). Specific Productivity in pg / cell / day; and 4C). Measurement of cell growth by integrated viable cell count (IVCC = Integrated Viable Cell Count) at 100 million cells per day per liter. Simulated clones are dark gray and siRNA clones are light gray.

Figure 5 (comprising of Figures 5A-5C) shows lactate profile, average lactate production rates, and osmolality profile in 2L bioreactor evaluations. 5A). Lactate profile; 5B). Average lactate production speeds; and 5C). Osmolality profile.

Figure 6 shows productivity profile of cultured cells containing siRNA, simulated clones or precursors under evaluation of 2L bioreactor.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides methods and compositions to reduce lactate production and increased polypeptide production in cultured cells. The inventors have discovered that the concomitant downregulation of LDH and PDHKs by siRNAs by a process known as RNA (RNAi) interference in cells that express polypeptides (eg, cultured χ

a

UO VSedO IAL antibodies) decrease lactate level, speed of

MEXICAN INSTITUTE «íSUwá de la ηοηεΟΛΟ OeasSíSC, W INDUSTRIAL XenarffiP 'metabolic.

increase lactate production, and cellular osmolality and increased specific polypeptide productivity (eg, Specific Productivity) and polypeptide production (eg, productivity). Furthermore, these cells grown with down-regulated LDH and PDHKs do not exhibit negative impact on cell growth, cell viabilities and the quality of polypeptides produced. Thus, without wishing to be bound by theory, decreasing pyruvate-lactate conversion by decreasing LDH expression and promoting pyruvate in tricarboxylic acid cycle (TCA or Krebs cycle) by decreasing expression of one or more PDHKs can create a synergistic effect in lactate reduction and provide cells with more energy and intermediates. These effects in turn can lead to production of polypeptide (eg, antibody) in cultured cells.

Accordingly, in one aspect of the invention, there is provided a method of reducing lactate production in cultured cells, comprising cultures of cells expressing a) an LDH-specific siRNA and b) a PDHK-specific siRNA.

In another aspect, cultured cells are provided comprising a) a siRNA specific for an LDH and a · siRNA specific for a PDHK.

<img file="MX343604B_D0017.tif" />

In another aspect, the invention provides a method of reducing lactate production in cultured cells, comprising culturing cells comprising a first heterologous nucleic acid sequence encoding a siRNA specific for LDH and a second heterologous nucleic acid sequence encoding a siRNA specific for a PDHK, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

In yet another aspect, the invention provides cultured cells comprising a first heterologous nucleic acid sequence encoding a first siRNA specific for LDH and a second heterologous nucleic acid sequence encoding a second siRNA specific for PDHK, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within skill in the art. These techniques are fully explained in the literature, such as

IMPI

INSTITUTO MÍXICANO Dt LA ríOPIF.DAEJ INDUSTRIAL

<img file="MX343604B_D0018.tif" />

Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989) Coid Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1998) Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds., 1993-1998) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., Eds., 1987); PCR: The Polymerase Chain Reaction, (Mullís et al., Eds., 1994); Current Protocols in Immunology (JE Coligan et al., Eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., Ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lañe (Coid Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995).

ΙΜΡΙ

MEXICAN INSTITUTE

OF THE FMOFUOAD INOUSTXIAL

<img file="MX343604B_D0019.tif" />

Definitions

As used herein, the term "cultured cells or cultured cells" refers to two or more cells in a solution (eg, a cell medium) that allows the cells to undergo one or more cell divisions.

The term polynucleotide or nucleic acid as used interchangeably herein, refers to nucleotide polymers of any length, and includes DNA and RNA. The nucleotides can be deoxyribonucieotides, ribonucleotides, modified nucleotides or bases, and / or their analogues, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure can be imparted before or after assembly of the polymer. The nucleotide sequence can be interrupted by nonucleotide components. A polynucleotide can further be modified after polymerization, such as by conjugation with a label component. Other types of modifications include, for example caps, substitution of one or more of the naturally occurring nucleotides with an analogue, internucleotide modifications such as, for example, those with uncharged linkages (eg, methyl! *. ** «&lt;r . TO

<img file="MX343604B_D0020.tif" />

INSTITUTO MRX1CANC DH LA Í'ROPIEDAÍ »

INDUSTRIAL phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (eg, phosphorothioates, phosphorodithioates, etc.), those containing secondary portions, such as, for example, proteins (eg, nucleases, toxins, antibodies, signal peptides, ply-Llisin, etc.), those with intercalators (eg acridine, psoralen, etc.), those containing chelators (eg metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (eg, alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide (s). Furthermore, any of the hydroxyl groups ordinarily present in sugars can be replaced, for example by phosphonate groups, phosphate groups, protected by standard protection groups, or activated to prepare additional linkages with additional nucleotides, or they can be conjugated with solid supports. The 5 'and 3' terminal OH can be phosphorylated or substituted with amines or organic end termination group portions with from 1 to 20 carbon atoms. Other hydroxyls can also be derivatized to standard protecting groups. Polynucleotides may also contain analogous forms of ribose or dioxiribose sugars which are generally known in the art, including for example 2'-0-methyl-, 2'-O-allyl, 2'-fluoro- or 2'-azido20

<img file="MX343604B_D0021.tif" />

OF THE PROP'EPAf. » INDUSTRIAL ribose, carbocyclic sugar analogs, anomeric sugars, epimeric sugars such as arabinose, xyloses or lixoses, pyranose sugars, furanose sugars, pseudoheptulose, acyl analogs, and abasic nucleoside analogs such as methyl riboside. One or more phosphodiester bonds can be replaced by alternate bond groups. These alternate linking groups include, but are not limited to modalities where phosphate is replaced by P (0) S (thioate), P (S) S (dithioate), (0) NR₂ (amidate), P (O) R, P (O) OR ', CO or CH₂ (formacetal), wherein each of R or R 'is independently H or substituted or unsubstituted (1-20 C) alkyl, optionally containing an ether (—O—), aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl bond . Not all links in a polynucleotide need to be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and

DNA.

The term "RNA interference" (RNAi) refers to sequence-specific transcriptional gene silencing (eg, post-transcriptional gene silencing) processes mediated or initiated by siRNA. Without wishing to be bound by theory, during RNAi, in practice the methods of the invention, siRNA can induce degradation of target mRNA with consequent sequence-specific inhibition of gene expression of an LDH and one or more

<img file="MX343604B_D0022.tif" />

<img file="MX343604B_D0023.tif" />

MEXICAN INSTITUTE!)

OF INDUSTRIAL PROPERTY

PDHKS.

The term heterologous nucleic acid or heterologous polypeptide refers to a nucleic acid or polypeptide whose sequence is not identical to that of another nucleic acid or polypeptide that occurs naturally in the same host cell.

The term small interfering RNA, short interfering RNA, or siRNA refers to a nucleotide RNA duplex, or in some alternate respects, a single RNA molecule that targets a nucleic acid of interest, eg LDH or PDHK ( s). The siRNA comprises a sense strand of RNA and a complementary antisense strand of RNA together by standard Watson-Crick base pairing interactions. SiRNA can already be directly transfected or otherwise produced without a cultured cell.

In one variation, the sense RNA strand and the complementary antisense RNA strand are linked by a spacer bearing the expression of a hairpin or hairpin structure called short hairpin RNA (shRNA). The hairpin is then cleaved by an endonuclease (eg, Dicer) to generate a siRNA. In another variation, shRNA is a bi-functional shRNA consisting of two hairpin structures, with a looped structure consisting of a fully coupled sequence that guides the duplex RNA for mRNA degradation by loading

<img file="MX343604B_D0024.tif" />

OF INDUSTRIAL PROPERTY

<img file="MX343604B_D0025.tif" />

dissociation-dependent RNA-induced silenced complex (RISC), with the second hairpin structure consisting of an uncoupled or mismatched mismatch strand that inhibits mRNA translation through load mRNA sequestration RISC independent of decoupling.

As used here, a specific siRNA for a

LDH or PDHK refers to a siRNA that targets a nucleic acid of interest (eg, an LDH or PDHK (s)) and that the nucleotide sequence of the duplex portion of siRNA is complementary to a nucleotide sequence of the gene Targeted (eg, an LDH or PDHK (s)).

As used herein, "operably linked" refers to a functional relationship between two or more nucleic acid segments (eg, DNA). Typically, it refers to the functional relationship of transcriptional regulatory sequence to a transcribed sequence. For example, a promoter is operably linked to a coding sequence, such as a nucleic acid of the invention, if it stimulates or modulates transcription of the coding sequence in a host cell or other appropriate expression system. In general, promoter transcription regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, ie, act cis. However, some sequences í - Ji X 'ΛΦ

<img file="MX343604B_D0026.tif" />

Pi

Transcriptional regulatory institutions, such as enhancers, do not need to be physically contiguous or located in immediate proximity to the coding sequences whose transcription they enhance.

As used herein, the term "promoter" includes all sequences capable of directing transcription of a coding sequence into a cultured cell, eg, a mammalian cell. Thus, promoters employed in the constructs of the invention include cis-acting transcription control elements and regulatory sequences that are involved in regulating or

<td>modular</td><td>timing and / or</td><td>speed</td><td>transcription</td><td>of</td>

<td>a gene</td><td>(for example, LDH or</td><td>PDHK (s)).</td><td>For example,</td><td>a</td>

<td>promoter</td><td>can be an item</td><td>of control</td><td>transcription</td><td>of</td>

<td>action</td><td>cis, including a</td><td>jojo me,</td><td>a promoter,</td><td>a</td>

transcription terminator, an origin of replication, a chromosomal integration sequence, 5 'and 3' untranslated regions or an intronic sequence, which are involved in transcription regulation. These cis action sequences typically interact with proteins or other biomolecules to carry out (activation / deactivation, regulation, modulation, etc.) of transcription. Constitutive promoters are those that drive expression continuously under most environmental conditions and states of cell development or differentiation. Promoters

<img file="MX343604B_D0027.tif" />

MEXICAN INSTITUTE OF THE ERCOIO3A, ', INDUSTRIAL

<img file="MX343604B_D0028.tif" />

inducible or regulable direct the expression of the nucleic acid of the invention under the influence of environmental conditions or developmental conditions. Examples of environmental conditions that can affect transcription by inducible promoters include anaerobic conditions, elevated temperature, drought, or the presence of light.

As used herein, "vector" means a construct, which is capable of supplying and preferably expressing one or more genes or sequences of interest (eg, LDHa and PDHK (s)) in a host cell. Examples of vectors include but are not limited to viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensation agents, DNA or RNA expression vectors. encapsulated in liposomes and certain eukaryotic cells such as producer cells. Convenient vectors are those that are compatible with the host cell employed. Convenient vectors can be derived for example from a bacterium, a virus (such as T7 bacteriophage or a phage derived from M-13), a cosmid, a yeast or a plant. Protocols for obtaining and using these vectors are known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^na ed., Coid Spring Harbor, 1989).

As used here, the production speed of

<img file="MX343604B_D0029.tif" />

Average lactate is calculated as the rate of lactate synthesis minus the rate of lactate consumption in mg / cells / day.

As used herein, Specific Productivity or Qp refers to the specific protein, eg, antibody, production rate in pg / cell / day. Specific productivity is calculated as protein titer (pg / cell / day) / IVCC (calculates count of viable integrated cells; cell / day).

The terms polypeptide and protein are used interchangeably herein to refer to amino acid polymers of any length. The polymer can be linear or branched, can comprise modified amino acids, and can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a label component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.) as well as other modifications known in the art.

The term antibody is used in the broadest sense and specifically covers monoclonal antibodies.

IMPI

INSTITUTO MSXICANO DE LA PROPISIJAD industrial _ (including full-length monoclonal antibodies),

<img file="MX343604B_D0030.tif" />

polyclonal antibodies, multispecific antibodies (eg, bispecific antibodies) and antibody fragments.

Antibody fragments comprise a portion of an antibody of integral length, generally its antigen-binding or variable region. Examples of antibody fragments include Fab, Fab ', F (ab') 2, and Fv fragments; single chain antibody molecules; diabodies; linear antibodies; and multispecific antibodies formed from antibody fragments.

The term monoclonal antibody as used herein refers to an antibody that is derived from a substantially homogeneous population of antibodies, that is, the individual antibodies that comprise the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. . Monoclonal antibodies are highly specific, they are directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The monoclonal modifier indicates the character of the antibody that is obtained from a population substantially

IMPI

INSTITUTO MEXICANO DI LA MONEDA »industrial

<img file="MX343604B_D0031.tif" />

Homogeneous antibody, and will not be construed to require production of the antibody by any particular method. For example, monoclonal antibodies for use in accordance with the present invention can be made by the hybridoma method first described by Kohler et al, Nature 256: 495 (1975), or can be made by recombinant DNA methods (see, for example , US Patent Number 4,816,567). Monoclonal antibodies can also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature 352: 624-628 (1991) and Marks et al., J. Mol. Biol. 222: 581-597 (1991), for example.

Monoclonal antibodies herein specifically include chimeric antibodies (immunoglobulins) wherein a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class or subclass of antibody, while the rest of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from other species or belonging to another class or subclass of antibody, as well as fragments of these antibodies as long as they exhibit the desired biological activity (Patent of US Number 4,816,567, and Morrison et al., Proc. Nati. Acad.

Sci. USA 81: 6851-6855 (1984)).

ΜΡΙ

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

The term hypervariable region when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region comprises amino acid residues from a complementarity determining region or CDR (i.e. residues 24-34 (Ll), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31 -35 (Hl), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al., Sequences of Proteins of Immunológica 1 Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)) and / or those residues of a hypervariable loop (i.e. residues 26-32 (Ll), 50-52 (L2) and

91-96 (L3) in the light chain variable domain and 26-32 (Hl), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain; Chothia and Lesk J. Mol. Biol. 196: 901-917 (1987)). Frame residues or FR are those variable domain residues other than the hypervariable region residues as defined here.

Humanized forms of non-human antibodies (eg, murine) are chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) where hypervariable region residues from the container are replaced by hypervariable region residues from a non-human species (antibody

<img file="MX343604B_D0032.tif" />

IMPI donor) such as mouse, rat

MÍXICANO INSTITUTE I heard LA ÍRORIEPAD. . INDUSTRIAL rabbit or non-human primate

<img file="MX343604B_D0033.tif" />

that have the desired specificity, affinity and capacity. '¹ Ύ1Ύ In some cases, Fv framework region (FR) residues of human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies can comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one and typically two variable domains, where all or substantially all hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all FR regions are those of a sequence of human immunoglobulin. The humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321: 522-525 (1985); Riechmann et al., Nature 332: 323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992).

As used herein, the term immunoadhesin designates antibody-like molecules that combine the binding domain of a heterologous adhesin protein (eg, a receptor, ligand, or enzyme) with the effector functions of a

<img file="MX343604B_D0034.tif" />

DB LA FROPIÍOAU MEXICAN INSTITUTE

INDUSTRIAL

<img file="MX343604B_D0035.tif" />

constant immunoglobulin domain. Structurally, immunoadhesins comprise a fusion of the adhesin amino acid sequence with the desired binding specificity that is different from the antigen recognition and binding site (antigen combining site) of an antibody (i.e. is heterologous) and a constant immunoglobulin domain. The immunoglobulin constant domain sequence in immunoadhesin is preferably derived from γΐ, γ2, or γ4 heavy chains, since the immunoadhesins comprising these regions can be purified by Protein A chromatography (Lindmark et al., J. Immunol. Meth. 62: 1-13 (1983)).

The term "ligand binding domain" as used herein, refers to any native cell surface receptor or any region or its derivative that retains at least one qualitative ligand binding of a corresponding native receptor. In a specific embodiment, the receptor is from a cell surface polypeptide that has an extracellular domain that is homologous with a member of the immunoglobulin family of supergenes. Other receptors, which are not members of the immunoglobulin supergene family but are nevertheless specifically covered by that definition, are cytokine receptors, and in particular receptors with tyrosine kinase activity (tyrosine kinase receptor), members of the

ΙΜΡΙ

INSTITUTO MEJICANO • E rtOFIEtAD in »ustiuai superfamilies of hematopoietin and factor receptor

<img file="MX343604B_D0036.tif" />

growth of nerves and cell adhesion molecules, for example (E-, L- and P-) selectins.

The term receptor binding domain is used to designate any native ligand for a receptor, including cell adhesion molecules, or any region or derivative of this native ligand that retains at least one qualitative receptor binding ability of a corresponding native ligand. This definition, among others, specifically includes ligand binding sequences for the aforementioned receptors.

An antibody-immunoadhesin chimera comprises a molecule that combines at least one binding domain of an antibody (as defined herein) with at least one immunoadhesin (as defined in this application). Exemplary antibody-immunoadhesin chimeras are the bispecific CD4-IgG chimeras described in Berg et al., PNAS (USA) 88: 47234727 (1991) and Chamow et al., J. Immunol. 153: 4268 (1994).

The term osmolality refers to the number of solute particles dissolved in 1 liter of solution. Solutes that can be added to the culture medium to increase its osmolality include proteins, peptides, amino acids, unmetabolized polymers, vitamins, ions, salts (for example sodium, potassium salts), sugars, metabolites, organic acids, lipids, here, the abbreviation mOsm means

IMPI

USTITUTO MEXICANO D »LA PROFIRDAÍ 'INDUSTRIAL

<img file="MX343604B_D0037.tif" />

etc. When milliosmoles / Liter of

H₂OR.

As used herein, a host cell includes a single cell, cultured cells, or cultured cell that can or has been a recipient for one or more vectors or siRNA (s) for incorporation of polynucleotide inserts to produce polypeptide. Host cells include progeny from a single cultured cell, and the progeny may not necessarily be completely identical (in morphology or in complement of genomic DNA) to the original precursor cell due to deliberate or accidental natural mutation.

For use herein, unless clearly indicated otherwise, the use of the terms one, one, and the like refers to one or more.

With reference to about a value or parameter here, they include (and describe) modalities that target a value or parameter per se. For example, the description that refers to approximately X^{z /} includes description of X. Numeric ranges are inclusive of the numbers that define the range.

It is understood that when modalities are described herein with language comprising, otherwise analogous modalities described in terms of consists of and / or consists essentially of, are also provided.

IMPI

INSTITUTO MUlCANO DE LA RROMEOAD INDUSTRIA '·

<img file="MX343604B_D0038.tif" />

When aspects or embodiments of the invention are described in terms of a Markush group or other grouping of alternatives, the present invention encompasses not only the entire group cited as a whole, but each group member individually and all possible subgroups of the group. main, but also the main group absent from one or more of the group members. The present invention also provides for the explicit exclusion of one or more of any of the group members in the claimed invention.

Methods to Reduce Lactate Production

The method here involves culturing cells that express siRNAs specific for an LDH and at least one or more PDHKs to reduce lactate production by RNA interference (RNAi). In one aspect, the method comprises culturing cells expressing a) an LDH-specific siRNA and b) a PDHK-specific siRNA.

In some embodiments, cultured cells further express a specific siRNA for a second PDHK. In some embodiments, the cultured cells further express a siRNA specific for a third PDHK. In some embodiments, cultured cells further express a siRNA specific for a fourth PDHK.

In another aspect, the method comprises a first heterologous nucleic acid sequence encoding a siRNA specific for an LDH and a second acid sequence

ΙΜΡΪ CINSTITUTE MfcXICANl, heterologous nucleic encoding a specific siRNA for

PDHK, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, and where the second heterologous nucleic acid sequence is operably linked to a second promoter.

M INDUSTRIAL PROPERTY

<img file="MX343604B_D0039.tif" />

In another aspect, a method is provided for silencing or down-regulating LDH and PDHK transcription in a cultured cell comprising: introducing into a cell a vector comprising a first heterologous nucleic acid sequence encoding an LDH-specific siRNA and a second heterologous nucleic acid sequence encoding a PDHK-specific siRNA, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, and where the second heterologous nucleic acid sequence is operably linked to a second promoter, where the siRNAs are expressed, thus silencing or down-regulating the transcription of LDH and PDHK genes.

In some embodiments, the cultured cells further comprise a third heterologous nucleic acid sequence encoding a siRNA specific for a second PDHK and wherein the third heterologous nucleic acid sequence is operably linked to a third promoter. In some embodiments, the cultured cells further comprise a fourth nucleic acid sequence.

IMPI

INSTITUTO MtXlCANO Df THE "heterologous industrial" OriEDA · encoding a siRNA specific for a third PDHK and wherein the fourth heterologous nucleic acid sequence is operably linked to a fourth promoter. In some embodiments, the cultured cells further comprise a fifth heterologous nucleic acid sequence encoding a siRNA specific for a fifth PDHK and wherein the fifth heterologous nucleic acid sequence is operably linked to a fifth promoter.

In some embodiments, LDH is LDHa, LDHb, or LDHc. In some embodiments, PDHK is chosen from the group consisting of PDHK1, PDHK2, PDHK3, and PDHK4. In some embodiments, PDHK is chosen from the group consisting of PDHK1, PDHK2, and PDHK3. In some embodiments, PDHK is chosen from the group consisting of PDHK2, PDHK3, and PDHK4. In some embodiments, PDHK is chosen from the group consisting of PDHK1, PDHK3, and PDHK4. In some embodiments, PDHK is chosen from the group consisting of PDHK1 and PDHK2. In some embodiments, PDHK is chosen from the group consisting of PDHK1 and PDHK3. In some embodiments, PDHK is chosen from the group consisting of PDHK2 and PDHK3. In some embodiments, PDHK is chosen from the group consisting of PDHK2 and PDHK4. In some embodiments, PDHK is chosen from the group consisting of PDHK3 and PDHK4.

In some embodiments, the method comprises culturing cells expressing a) a specific siRNA for

<img file="MX343604B_D0040.tif" />

<img file="MX343604B_D0041.tif" />

MEXICAN INSTITUTE! ' Say THE PROPERTY

INDUSTRIAL

<img file="MX343604B_D0042.tif" />

LDHa and b) a siRNA specific for PDHK1, PDHK2 and PDHK3, respectively. In some embodiments, the method comprises culturing cells expressing a) a specific siRNA for LDHb and b) a siRNA specific for PDHKl, PDHK2 and PDHK3, respectively. In some embodiments, the method comprises culturing cells expressing a) a specific siRNA for LDHc and b) a siRNA specific for PDHKl, PDHK2 and PDHK3, respectively.

In some embodiments, the method comprises culturing cells expressing a) a specific siRNA for LDHa, LDHb or LDHc and b) a specific siRNA for two PDHKs, wherein the PDHK is chosen from the group consisting of PDHKl, PDHK2, PDHK3 and PDHK4. For example, the method comprises culturing cells expressing a) a specific siRNA for LDHa and b) a siRNA specific for PDHKl and PDHK2, respectively.

In some embodiments, the level of mRNA expression for an LDH is reduced by at least about 75% and the level of mRNA expression for a PDHK is reduced by at least about 25% in cultured cells expressing a) a specific siRNA for an LDH and b) a siRNA specific for a PDHK, compared to cultured cells without the siRNAs specific for an LDH and a PDHK. In some embodiments, LDH is LDHa, LDHb, or LDHc, and the level of mRNA expression for LDH is reduced by at least

I Λί Ρ ί Mexican institute w LA moheda r&gt; í “^ approximately 7 5%, at least approximately ^ Ό ^ Τ '^ Ι approximately 8 5%, at least approximately TT5 ^^,W7 ~ i! R-a4 — ibexics. about 95%. In some modalities, the PDHK is

PDHK1, PDHK2 or PDHK3, and the level of mRNA expression for the

<td>PDHK is reduced</td><td>in</td><td>to the</td><td>less</td><td>approximately</td><td> 25%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 30%,</td><td>to the</td><td>less</td><td>approximately</td><td> 35%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 40%,</td><td>to the</td><td>less</td><td>approximately</td><td> 45%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 50%,</td><td>to the</td><td>less</td><td>approximately</td><td> 55%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 60%,</td><td>to the</td><td>less</td><td>approximately</td><td> 65%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 70%,</td><td>to the</td><td>less</td><td>approximately</td><td> 75%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 80%,</td><td>to the</td><td>less</td><td>approximately</td><td> 85%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 90%,</td><td colspan="3">or at least approximately</td><td> 95%.</td><td></td><td></td>

In some embodiments, in cultured cells expressing a) a specific siRNA for LDHa and b) a specific siRNA for PDHK1, PDHK2 and PDHK3, the level of mRNA expression for LDHa is reduced by approximately 90% and the level of expression of mRNAs for PDHK1, PDHK2, and PDHK3 are reduced by approximately 32%, 83%, and 70%, respectively, compared to cultured cells without the specific siRNAs for LDHa, PDHK1, PDHK2, and PDHK3.

In some embodiments, the method comprises a first heterologous nucleic acid sequence encoding a siRNA specific for LDHa, LDHb, or LDHc, a second heterologous nucleic acid sequence encoding a siRNA specific for PDHK1, a third nucleic acid sequence

INSTITUTO MEXICANO DI LA PROPERTY heterologous that encodes a specific siRNA for ^or? ¥ fÉK27 '~ yTma fourth heterologous nucleic acid sequence qfl'é (JULtlfica u »· siRNA specific for PDHK3, where the first heterologous nucleic acid sequence is operably linked to a first promoter, and where the second, third and fourth heterologous nucleic acid sequence is operably linked to a second promoter.

In some embodiments, the method comprises a first heterologous nucleic acid sequence encoding a siRNA specific for LDHa, LDHb, or LDHc, a second heterologous nucleic acid sequence encoding a siRNA specific for a PDHK, and a third heterologous nucleic acid sequence encoding a siRNA specific for a PDHK, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter, wherein the second and third heterologous nucleic acid sequences are operably linked to a second promoter, and where PDHK is chosen from the group consisting of PDHK1, PDHK2, PDHK3, and PDHK4.

In some embodiments, the level of mRNA expression for an LDH is reduced by at least about 75% and the level of mRNA expression for a PDHK is reduced by at least about 25% in cultured cells comprising a first nucleic acid sequence. heterologous that encodes a specific siRNA for an LDH and a second

<img file="MX343604B_D0043.tif" />

heterologous nucleic acid sequence encoding a siRNA specific for a PDHK compared to cultured cells without the heterologous nucleic acid sequence comprising LDH and PDHK (s), wherein the first heterologous nucleic acid sequence is operably linked to a first promoter , and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter. In some embodiments, LDH is LDHa, LDHb, or LDHc, and the level of mRNA expression for LDH is reduced by at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at less about 95%. In some modalities, the PDHK is

<td>PDHK1, PDHK2 or</td><td>PDHK3</td><td>, and</td><td>the level of expression of</td><td>mRNA</td><td>for</td>

<td>PDHK are reduced</td><td>in</td><td>to the</td><td>minus about 25%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 30%,</td><td>to the</td><td>less about 35%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 40%,</td><td>to the</td><td>minus approximately 45%,</td><td>ai</td><td>less</td>

<td>approximately</td><td> 50%,</td><td>to the</td><td>minus approximately 55%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 60%,</td><td>to the</td><td>less about 65%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 70%,</td><td>to the</td><td>minus about 75%,</td><td>to the</td><td>less</td>

<td>approximately</td><td> 80%,</td><td>to the</td><td>minus about 85%,</td><td>to the</td><td>less</td>

<td>approximately</td><td>90% or</td><td>to the</td><td>less about 95%.</td><td></td><td></td>

In some embodiments, in cultured cells comprising a first heterologous nucleic acid sequence encoding a siRNA specific for LDHa, with a second heterologous nucleic acid sequence encoding a siRNA.

ΙΜΡΙ

MEXICAN INSTITUTE

SAY THE ΜΟΜEDA Ο

INDUSTRIAL -5&gt; ** specific for PDHK1, a third heterologous nucleic acid sequence encoding a siRNA specific for PDHK2, and a fourth heterologous nucleic acid sequence encoding a siRNA specific for PDHK3, wherein the first 5 nucleic acid sequence heterologous is operably linked to a first promoter, and wherein the second, third and fourth heterologous nucleic acid sequences are operably linked to a second promoter, the level of mRNA expression for LDHa is reduced by approximately 90% 10 and the expression levels of mRNAs for PDHK1, PDHK2 and PDHK3 are reduced by approximately 32%, 83% and 7 0%, respectively, compared to cultured cells without specific siRNAs for LDHa, PDHK1, PDHK2 and PDHK3.

The siRNA employed in the invention described herein can be obtained or made from a variety of sources, eg, produced in vitro, ex vivo, or in vivo, as described herein. In some embodiments, the siRNA can contain from about 1 to about 200 nucleotides, from about 5 nucleotides, from about 10 nucleotides, from about 15 nucleotides, or from about 19 to about 25 nucleotides. In some embodiments, the siRNA length is less than 30 nucleotides. In some embodiments, the length of siRNAs is more than 30 nucleotides. In some to about 100 to about 50 to about 30

<img file="MX343604B_D0044.tif" />

modalities, the

34, 33, 32, 31,

19, 18, 17, 16, siRNA can be 40, 30, 29, 28, 27, 26, 25

15, 14, 13, 12, 11, 10,

<img file="MX343604B_D0045.tif" />

<img file="MX343604B_D0046.tif" />

MEXICAN INSTITUTE OF THE IROPIEJAI)

INDUSTRIAL

39, 38, 37, 36, 35,

24, 23, 22, 21, 20, or less nucleotides in length.

In some embodiments, siRNA can be generated by chemical synthesis, by in vitro transcription using a polymerase, or by endoribonuclease (eg, Dicer) digestion of long double stranded RNA (dsRNA). In some embodiments, siRNA may, in whole or in part, comprise synthetic nucleotides, natural bases, or modified bases.

In some embodiments, siRNA can be expressed intracellularly. siRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include one or more promoters. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, sense and antisense strands of the duplex RNA can be produced from two independent promoters and hybridize to the cultured cell. In some embodiments, the sense and antisense strands of the duplex RNA can also be linked by a base pair spacer (for example, a base pair spacer may comprise a single or multiple base pair) or a hairpin to form a shRNA and expressed by a promoter only. In some embodiments, shRNA can be a shRNA

IMPI

MEXICAN I industrial PROPERTY

MEXICAN INSTITUTE OF bi-functional PROPERTY. The hairpin can be cleaved by an endoribonuclease (eg, Dicer) to generate effective siRNA molecules. The spacer or hairpin is placed between the sense and antisense strands that make up the duplex. The fork may vary in length. In some embodiments, the hairpin is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more nucleotides in length. The fork structure may also contain 3 'or 5' protruding portions. In some embodiments, the overhang is a 3 'or 5' overhang of 1, 2, 3, 4, or 5 nucleotides in length. Compositions and methods for RNA mediated gene regulation by siRNA, shRNA, or bifunctional shRNA are described, for example, in US Patent Application. Number 20090215860, Rutz and Scheffold, Arthritis Research &amp; Therapy, 6 (2): 78-85 (2004), and Rao et al., Advanced Drug Delivery Reviews 61: 746-759 (2009).

In some embodiments, siRNA employed in the present invention may have perfect homology to targeted sequences to produce targeted targeted responses. In some embodiments, siRNA employed in the present invention has approximately any of 99%, 98%, 97%, 96%, 95%, 94%, 92%, 91%, 90%, 88%, 86%, 84%, 82%, 80%, 78%, 76%, 74%, 72%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20% , 15%, 10% or 5% homology with directed sequences. In one variation, siRNA employed in the present invention can hybridize under physiological conditions to

<img file="MX343604B_D0047.tif" />

MEXICAN INSTITUTE OF PROPERTY

INDUSTRIAL - A targeted nucleic acid sequence, for example, can hybridize specifically to a targeted sequence in a cell, for example in vivo. In another variation, siRNA is targeted more than a targeted sequence, a targeted marker, or reporter gene.

The extent of sequence identity (homology) necessary to in vivo target a siRNA to a targeted nucleic acid (eg, specific binding of a siRNA to a targeted sequence in a cell under physiological conditions) can be tested under routine screening conditions , for example in cell culture and the like.

In some embodiments, the target sequence for PDHK1 is GCAGTTCCTGGACTTCGGA (SEQ ID NO: 2). In some embodiments, the target sequence for PDHK2 is CATTCAGTACTTCTTGGAC (SEQ ID NO: 3). In some embodiments, the target sequence for PDHK3 is TGTAGCTGATGTCGTGAAA (SEQ

ID NO: 4).

Lactate dehydrogenase (LDH) converts pyruvate to lactate. The accession number of exemplary LDH polypeptides and nucleic acids (eg, LDHa, LDHb, or LDHc) includes, but is not limited to, DQ912661 (LDHa in CHO cells), BC067223 (human LDHa), BC084698 (rat LDHa),

BC094428 (mouse LDHa), BC002362 (human LDHb),

NM_012595 (rat LDHb), NM_008492 (mouse LDHb), BC090043 (human LDHc), NM_017266 (rat LDHc) and NM_013580 (LDHc Mexican institute)

INDUSTRIAL PROPERTY OF MOUSE). Standard methods known to those skilled in the art can be used to determine whether an LDH polypeptide has LDH activity by measuring the ability of the polypeptide to convert pyruvate to lactate in vitro, in a cell extract, or in vivo.

Priuvate dehydrogenase kinase (PDHK) inhibits the conversion of pyruvate to acetyl-CoA. Nucleic acid and exemplary PDHK1 polypeptide accession numbers include, but are not limited to L42450 (human), BC089783 (rat), and NM_172665 (mouse). Exemplary PDHK2 nucleic acid and polypeptide accession numbers include, but are not limited to NM_002611 (human), NM_030872 (rat), and NM_133667 (mouse). Exemplary PDHK3 nucleic acid and polypeptide accession numbers include, but are not limited to, L42452 (human), BC169078 (rat), and NM_145630 (mouse). Exemplary PDHK4 nucleic acid and polypeptide accession numbers include, but are not limited to, NM002612 (human), NM_053551 (rat), and NM_013743 (mouse). Standard methods known to the person skilled in the art can be used to determine whether a PDHK polypeptide has PDHK activity by measuring the ability of the polypeptide to inhibit the conversion of pyruvate to acetyl-CoA in vitro, in a cell extract, or in vivo.

Promoters are well known in the art.

Any promoter that functions in the host cell can *: U. &lt;LTW '

MEXICAN INSTITUTE OF PROPERTY

INDUSTRIAL

<img file="MX343604B_D0048.tif" />

used for expression of siRNAs specific for an LDH and one or more PDHK in the host cell. Virtually any promoter capable of directing this is siRNAs is suitable for the present invention including, but not limited to, U6, Hl, CYC1, HIS3, GAL1, GAL4, GALIO, ADH1, PGK, PHO5, GAPDH, T7, CMV, SV40 , and EFla. For example, in some embodiments, the method comprises a first heterologous nucleic acid sequence encoding an LDHa-specific siRNA, a second heterologous nucleic acid sequence encoding a PDHK1-specific siRNA, a third heterologous nucleic acid sequence encoding a siRNA specific for PDHK2, and a fourth heterologous nucleic acid sequence encoding a siRNA specific for PDHK3, wherein the first heterologous nucleic acid sequence is operably linked to a first U6 promoter, and where the second, third, and fourth heterologous nucleic acid sequences are operably linked to a second Hl promoter. In one variation, the first heterologous nucleic acid sequence encoding a siRNA is specific for LDHb. In another variation, the first heterologous nucleic acid sequence encoding a siRNA is specific for LDHc.

In another aspect, a method is provided for producing a cell that exhibits decreased lactate production to the culture, which comprises introducing into the cell a ® w I / £? MEXICAN INSTITUTE '·' VA ^ u -. 'T

Dt LA ΡΜΟΡΗίλΜ.

. . . ,, Industrial Sk¿! 2í_23 * vector comprising a first heterologous nucleic acid sequence encoding a siRNA specific for lDH 'and 11ΓΤ3 "" second heterologous nucleic acid sequence encoding a siRNA specific for PDHK, wherein the first sequence of heterologous nucleic acid is operably linked to a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

The first heterologous nucleic acid sequence encoding an LDH-specific siRNA and the second heterologous nucleic acid sequence encoding the PDHK-specific siRNA can be inserted into a vector by a variety of procedures. For example, the LDH and PDHK siRNA sequences are ligated at the desired position in the vector after digestion of the insert and the vector with appropriate restriction endonucleases, such as KasI, BamHI, HindIII or BhlII. In some embodiments, a vector containing siRNAs specific for LDHa and PDHK1, PDHK2 and PDHK3 is constructed by inserting the LDHa siRNA sequence into the KasI site of the vector (eg, vector pSilencer 3.1-H1 hygro) with addition of the U6 promoter. at its immediate 5 'end, insert PDHK1 and the PDHK2 siRNA sequences at the BamHI / HindIII and HindIII sites, respectively and insert the PDHK3 siRNA sequence into BglII with addition of the HI promoter at the immediate 5 'ends of PDHK1, PDHK2 and

IXICANG

JHELJAP

MEXICAN INSTITUTE;

FROM THE MtOPtEDAP ·

INDUSTRIAL ^&gt; to—

PDHK3. Cultured cells expressing decreased lactic acid production can then be generated by transfection oe ~ lO'y "" vectors containing LDHa and PDHK1, PDHK2 and PDHK3 siRNA.

Compositions

Cultured cells that are produced by the methods described herein are also provided in the present invention. The compositions of the present invention can be practiced in vivo, ex vivo, or in vitro. In one aspect, cultured cells are provided which express a) a specific siRNA for LDH and b) a siRNA specific for a PDHK. In some embodiments, cultured cells further express a specific siRNA for a second PDHK. In some embodiments, the cultured cells further express a siRNA specific for a third PDHK. In some embodiments, cultured cells further express a siRNA specific for a fourth PDHK.

In some embodiments, cultured cells express a) an LDHa-specific siRNA and b) a PDHK1, PDHK2, and PDHK3-specific siRNA, respectively. In some embodiments, cells in culture express a) a specific siRNA for LDHb and b) a siRNA specific for PDHK1, PDHK2 and PDHK3, respectively. In some embodiments, cells in culture express a) a specific siRNA for LDHc and b) a siRNA specific for PDHKl, PDHK2 and PDHK3, respectively.

<img file="MX343604B_D0049.tif" />

SAY THE INOUSTRIAL PROPERTY

In some modalities, cultured cells express

a) a specific siRNA for LDHa and b) a specific siRNA for two PDHKs, where PDHK is chosen from the group consisting of PDHK1, PDHK2, PDHK3, and PDHK4. In some embodiments, cells in culture express a) one siRNA specific for LDHb and b) one siRNA specific for two PDHKs, where PDHK is chosen from the group consisting of PDHK1, PDHK2, PDHK3, and PDHK4. In some embodiments, cultured cells express a) one siRNA specific for LDHc and b) one siRNA specific for two PDHKs, where PDHK is chosen from the group consisting of

PDHK1, PDHK2, PDHK3, and PDHK4.

In another aspect, cultured cells are provided comprising a first heterologous nucleic acid sequence encoding a siRNA specific for an LDH and a

<td colspan="4">second heterologous nucleic acid sequence</td><td rowspan="2">than the</td><td rowspan="2">encode first</td>

<td>a siRNA</td><td>specific</td><td>for</td><td>a PDHK, where</td>

<td>sequence</td><td colspan="3">heterologous nucleic acid</td><td>I know</td><td>binds</td>

operably with a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter. In some embodiments, the cell further comprises a third heterologous nucleic acid sequence encoding a siRNA specific for a second PDHK and wherein the third heterologous nucleic acid sequence is operably linked to a third promoter. In some embodiments, cells in addition

<img file="MX343604B_D0050.tif" />

encoding a siRNA specific for a third where the fourth heterologous nucleic acid sequence is operably linked to a fourth promoter. In some embodiments, the cells further comprise a fifth heterologous nucleic acid sequence encoding a siRNA specific for a fifth PDHK and wherein the fifth heterologous nucleic acid sequence is operably linked to a fifth promoter.

In some embodiments, cultured cells comprise a first heterologous nucleic acid sequence encoding an LDHa-specific siRNA, a second heterologous nucleic acid sequence encoding a PDHK1-specific siRNA, a third heterologous nucleic acid sequence encoding a specific siRNA. for PDHK2, and a fourth heterologous nucleic acid sequence encoding a siRNA specific for PDHK3, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter (eg, U6), and where the second, third, and fourth heterologous nucleic sequences are operably linked to a second promoter (eg, Hl). In one variation, the first heterologous nucleic acid sequence encoding a siRNA is specified for LDHb. In another variation, the first heterologous nucleic acid sequence encoding a siRNA

IMPI

INSTITUTO MSXICANO oe THE INDUSTRIAL PROPERTY

<img file="MX343604B_D0051.tif" />

it is specified for LDHb.

In some embodiments, cultured cells comprise a first heterologous nucleic acid sequence encoding an LDHa-specific siRNA, a second heterologous nucleic acid sequence encoding a PDHK-specific siRNA, a third heterologous nucleic acid sequence encoding a specific siRNA. for PDHK, where the PDHK is chosen from the group consisting of PDHK1, PDHK2, PDHK3, and PDHK4, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter (eg, U6), and where the second and third heterologous nucleic acid sequences are operably linked to a second promoter (eg, Hl). In one variation, the first heterologous nucleic acid sequence encoding a siRNA is specific for LDHb. In another variation, the first heterologous nucleic acid sequence encoding a siRNA is specific for LDHc.

In some modalities, cell culture includes at least about 5, 10, 15, 20, 50, 75, 100, 200, 500, 750, 1,000, 5,000, 7,500, 10,000, 15,000 or more cells.

In another aspect, cultured cells are provided having a rate of lactate synthesis that is less than a rate of lactate consumption. In some modalities, cultured cells have an average lactate production rate of less than about

<img file="MX343604B_D0052.tif" />

ΙΜΡΙ

MIXICAN INSTITUTE Dt LA eR 'ipieoAL)

INDUSTRIAL any negative 0.2 mg / 10 cells / day, negative mg / 10⁶ cells / day, negative 0.08 mg / 10⁶ cells / day, negative '0.06 mg / 10⁶ cells / day, negative 0.04 mg / 10⁶ cells / day, negative 0.02 mg / 10⁶ cells / day, negative 0.01 mg / 10⁶ cells / day, negative 0.008 mg / 10⁶ cells / day, negative 0.006 mg / 10⁶ cells / day, negative 0.004 mg / 10⁶ cells / day or negative 0.002 mg / 10⁶ cells / day.

In some embodiments, cultured cells comprise a first heterologous nucleic acid sequence encoding an LDHa-specific siRNA, a second heterologous nucleic acid sequence encoding a PDHKl-specific siRNA, a third heterologous nucleic acid sequence encoding a specific siRNA. for PDHK2, and a fourth heterologous nucleic acid sequence encoding a siRNA specific for PDHK3, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter (eg, U6), wherein the second, third, and fourth heterologous nucleic acid sequences are operably linked to a second promoter (eg, Hl), and where the cells in culture have an average lactate production rate of approximately negative 0.02 mg / 10⁶ cells / day.

In another aspect, cultured cells are provided that contain siRNA specific for LDH and PDHK (s) having decreased osmolality. In some modalities, cells

<img file="MX343604B_D0053.tif" />

in culture containing specific siRNA

PDHK (s) have an osmolality to monea ..... d?

either 500 mOsm, 450 mOsm, 400 mOsm, 350 mOsm, 300 mOsm, 250 mOsm, 200 mOsm, or 150 mOsm.

In some embodiments, cultured cells comprise a first heterologous nucleic acid sequence encoding an LDHa-specific siRNA, a second heterologous nucleic acid sequence encoding a PDHK1-specific siRNA, a third heterologous nucleic acid sequence encoding a specific siRNA. for PDHK2, and a fourth heterologous nucleic acid sequence encoding a siRNA specific for PDHK3, wherein the first heterologous nucleic acid sequence is operably linked to a first promoter (eg, U6), wherein the second, third, and fourth heterologous nucleic acid sequences are operably linked to a second promoter (eg, Hl), and wherein the cells in culture have an osmolality of approximately 300 mOsm.

In another aspect, cultured cells are provided that have an increased Specific Productivity (Qp). In some embodiments, the cells in culture have a Specific Productivity of at least about 60% higher, at least about 65% higher, at least about 70% higher, at least about 75% higher, at least about 80% higher, at least

IMPI

MEX / CANO INSTITUTE &lt;¿i

Dt THE PROPERTY approximately 85% higher, at least approx. SDSWfentí superior, or at least approximately 95¾ higher than Lao. cultured cells without the heterologous nucleic acid sequence comprising the PDHK (s) and LDH. In some modalities, cultured cells have a Productivity

<td colspan="2">Specific to</td><td>approximately</td><td> 67%</td><td>higher,</td><td>approximately</td>

<td> 69%</td><td>higher,</td><td>approximately</td><td> 71%</td><td>higher,</td><td>approximately</td>

<td> 72%</td><td>higher,</td><td>approximately</td><td> 73%</td><td>higher,</td><td>approximately</td>

<td> 74%</td><td>higher,</td><td>approximately</td><td> 75%</td><td>higher,</td><td>approximately</td>

<td> 76%</td><td>higher,</td><td>approximately</td><td> 77%</td><td>higher,</td><td>approximately</td>

<td> 78%</td><td>higher,</td><td>approximately</td><td> 79%</td><td>higher,</td><td>approximately</td>

<td> 81%</td><td>higher,</td><td>approximately</td><td> 83%</td><td>higher,</td><td>approximately</td>

<td> 85%</td><td>higher,</td><td>approximately</td><td> 87%</td><td>higher,</td><td>approximately</td>

<td> 89%</td><td>higher,</td><td>approximately</td><td> 91%</td><td>higher,</td><td>approximately</td>

<td> 93%</td><td>higher,</td><td>approximately</td><td> 95%</td><td>higher,</td><td>approximately</td>

<td> 97%</td><td>higher,</td><td colspan="2">to about 99%</td><td>higher</td><td>that the cells</td>

cultured without the heterologous nucleic acid sequence comprising PDHK (s) and LDH.

In some embodiments, cultured cells comprise a first heterologous nucleic acid sequence encoding an LDHa-specific siRNA, a second heterologous nucleic acid sequence encoding a PDHK1-specific siRNA, a third heterologous nucleic acid sequence encoding a specific siRNA. for PDHK2, and a fourth heterologous nucleic acid sequence

ΙΜΡΙ &lt;&gt; ^

MEXICAN INSTITUTE -V / 4 oe the property v luniiíTum *** ^ 2 · ^. _,._z INDUSTRIAL —_ ^ encoding a specific siRNA for PDHK3, where the first nucleic acid sequence heCéYdlogá "is operably linked to a first promoter (eg, U6), where the second, third, and fourth sequences of Heterologous nucleic acid is operably linked to a second promoter (eg Hl), and where the cultured cells have a Specific Productivity of approximately 75% higher.

In another aspect, cultured cells produced by the present method are provided with increased polypeptide productivity (eg, antibody or titer productivity in g / L). In some embodiments, cultured cells have a polypeptide productivity of about 10% to about 800% higher than cells cultured without the heterologous nucleic acid sequence comprising PDHK (s) and LDH. In some embodiments, cultured cells have a

<td colspan="5">polypeptide productivity of about 10%</td><td rowspan="2">higher, higher, higher,</td>

<td>approximately approximately</td><td> 15% 25%</td><td>higher, higher,</td><td>approximately approximately</td><td> 20% 30%</td>

<td>approximately</td><td> 35%</td><td>higher,</td><td>approximately</td><td> 40%</td><td>higher,</td>

<td>approximately</td><td> 45%</td><td>higher,</td><td>approximately</td><td> 50%</td><td>higher,</td>

<td>approximately</td><td> 55%</td><td>higher,</td><td>approximately</td><td> 58%</td><td>higher,</td>

<td>approximately</td><td> 60%</td><td>higher,</td><td>approximately</td><td> 65%</td><td>higher,</td>

<td>approximately</td><td> 70%</td><td>higher,</td><td>approximately</td><td> 71%</td><td>higher,</td>

ΙΜΡΙ

IHSTITUTO MEXICANO fe'-v'— Z j íA de la non coa or approximately 75% superior, approximately δ'δτΓ ^ superior, approximately 8 5% superior, approximately yu% superior ™ ^ '· approximately 95% superior, approximately 100% superior, approximately 125% superior, approximately 150%, approximately 200% superior, approximately 250% superior, approximately 300% superior, approximately 350% superior, approximately 400% superior, approximately 450% superior, approximately 500 superior, approximately 550% superior, approximately 600% superior, approximately 650% superior, approximately 700% superior, approximately 750% superior, or approximately 800% superior than the cells cultured without the heterologous nucleic acid sequence comprising the PDHKs ( s) and LDH. In some embodiments, cultured cells have a polypeptide productivity of at least about 55% higher, at least about 60% higher, at least about 65% higher, at least about 68% higher, at least about 70% higher, at least about 80% higher, at least about 85% higher, or at least about 90% higher than cultured cells without the heterologous nucleic acid sequence comprising PDHK (s) and LDH.

In some embodiments, cells in culture comprise a first heterologous nucleic acid sequence encoding a siRNA specific for LDHa, a second heterologous nucleic acid sequence encoding a siRNA.

IMPI ¢ 31¾¾

INSTITUTO MEXICANO BE LA PROPERTY specific for PDHK1, a third nucleic acid sequence that encodes a specific siRNA for pST3^,^,PüHK2^l, ¹'and typhia fourth heterologous nucleic acid sequence encoding a siRNA specific for PDHK3, where the first heterologous nucleic acid sequence is operably linked to a first promoter (eg, U6), where the second, third and fourth sequences of Heterologous nucleic acid is operably linked to a second promoter (for example, Hl), and where the cultured cells have an antibody productivity (for example, in g / L) of at least about 68% higher than cells cultured without the heterologous nucleic acid sequence comprising PDHK1, PDHK2, PDHK3, and LDHa.

In some embodiments, cultured cells have a polypeptide productivity of about 10% to about 800% higher than cells grown without specific siRNAs for PDHK (s) and LDH (in some embodiments, an antibody). In some modalities, the cultured cells have a productivity of polypeptides.

<td rowspan="2">of about 10% higher, approximately</td><td colspan="2">higher,</td><td rowspan="2">approximately approximately</td><td rowspan="2"> 15% 25%</td>

<td> 20%</td><td>higher,</td>

<td>higher, approximately</td><td> 30%</td><td>higher,</td><td>approximately</td><td> 35%</td>

<td>higher, approximately</td><td> 40%</td><td>higher,</td><td>approximately</td><td> 45%</td>

<td>higher, approximately</td><td> 50%</td><td>higher,</td><td>approximately</td><td> 55%</td>

<td>higher, approximately</td><td> 60%</td><td>higher,</td><td>approximately</td><td> 65%</td>

I

EX ICANO

MEXICAN INSTITUTE

GIVE PROPERTY Oiicv '- ^ Yes ~ * .ώ aproxiiftcíÉ ^ ÍÍfenl superior, approximately 70% superior, superior, approximately 80% superior, dpi υ Miniad dHteⁱrrt'eⁱQ ^% higher, approximately 90% superior, approximately 95% superior, approximately 100% superior, approximately 125% superior, approximately 150%, approximately 200% superior, approximately 250% superior, approximately 300% superior, approximately 350% superior, approximately 400% higher, approximately 450% higher, approximately 500 higher, approximately 550% higher, approximately 600% higher, approximately 650% higher, approximately 700% higher, approximately 750% higher, or about 800% higher than cultured cells without the specific siRNAs for PDHK (s) and LDH. In some embodiments, cultured cells have a polypeptide productivity of at least about 65% higher, at least about 68% higher, at least about 70% higher, at least about 80% higher, at least about 85% higher, or at least less approximately 90% higher than cultured cells without the specific siRNAs for PDHK (s) and LDH. In some embodiments, the antibody productivity is at least about 68% higher than cells grown without the PDHK (s) and LDH-specific siRNAs.

In another aspect, a vector is provided comprising a first heterologous nucleic acid sequence

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL FRORIETY encoding a siRNA specific for LDH and a second heterologous nucleic acid sequence encoding a siRNA specific for PDHK, where the first heterologous nucleic acid sequence is operably linked to a first promoter, and wherein the second heterologous nucleic acid sequence is operably linked to a second promoter.

In some embodiments, the vector contains a nucleic acid under the control of an expression control sequence. As used herein, an expression control sequence means a nucleic acid sequence that directs transcription of a nucleic acid of interest. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. An inducible promoter is a promoter that is active under developmental or environmental regulation. The expression control sequence is operably linked to the nucleic acid segment to be transcribed.

In some embodiments, the vector also includes a termination sequence. Control regions of

<img file="MX343604B_D0054.tif" />

<td colspan="2">termination</td><td>too</td><td>they can</td><td>derive from</td><td>various genes</td>

<td>native to</td><td>the</td><td>cell</td><td colspan="2">host. In some</td><td>modalities, the</td>

<td>sequence</td><td>of</td><td colspan="2">termination and</td><td>sequence</td><td>promoter</td>

<td>derive from</td><td>the</td><td>same</td><td>source.</td><td colspan="2">In another embodiment, the sequence</td>

termination is endogenous to the host cell.

Optionally, a termination site can be included. For carbenicillin antibiotics,

ΙΜΡΙ

INJTITUTO MWI'TAWO Ά

Di L »(industrial HOPIElTAD ^ ¾¾¾¾.» Α effective expression of polypeptides, DNA encoding the polypeptide is operably linked to tra'Vé5 'd'é'T^rStart 'OT'ÓTO "S ~' with select expression control regions such that expression results in the formation of the appropriate messenger RNA.

In some embodiments, the vector contains a selective marker. The term selective marker refers to a nucleic acid capable of expression in a host cell that allows ease of selection of those host cells that contain an introduced vector or nucleic acid. Examples of selectable markers include, but are not limited to, nucleic acids resistant to (eg, kanamycin, gentamicin, hygromycin, bleomycin, neomycin, or chloramphenicol) and / or nucleic acids that confer a metabolic advantage, such as a nutritional advantage in host cell. In some embodiments, the selective marker is hygromycin nucleic acid.

Polypeptides

The polypeptide or protein to be produced using the methods and cultured cells described herein includes, but is not limited to, antibodies or immunoadhesin. Techniques for generating these molecules are discussed below.

Antibodies

Antibodies within the scope of the present ampicillin, phleomycin,

IMPI

Jjí MEXICAN INSTITUTE

Say THE MONETY. ,. . ,,. . , INDUSTRIAL.

Invention include but are not limited to: anti-CD20 antibodies such as chimeric anti-CD20 ⁿc2ts8 'άύΤΠϋ in ia - US Patent No. 5,736,137 (RITUXAN®); anti-VEGF antibodies, including affinity matured humanized and / or anti-VEGF antibodies such as the humanized anti-VEGF antibody huA4.6.1 AVASTIN® (Kim et al., Growth Factors, 7: 53-64 (1992), Publication International No. WO 96/30046, and WO 98/45331, published October 15, 1998) and V3LA;

anti-MUC16 antibody; anti-CD4 antibodies such as cM-7412 antibody (Choy et al. Arthritis Rheum. 39 (1): 52-56 (1996)) and the Ibalizumab antibody (TNX355); anti-MET antibodies such as the C-Met 5D5 antibody from an arm; an.ti-HER2 antibodies Trastuzumab (HERCEPTIN®) (Carter et al., Proc. Nati. Acad. Sci. USA, 89: 4285-4289 (1992), US Patent No. 5,725,856) and humanized 2C4 (W001 / 00245, Adams et al.), A chimeric or humanized variant of the 2H7 antibody as in US Patent No. 5,721,1O8B1, or Tositumomab (BEXXAR®); anti-IL-8 antibodies (St John et al., Chest, 103: 932 (1993), and Publication

International No. WO 95/23865); anti-prostate stem cell antigen (PSCA = Anti-Prostate Stem Cell Antigen) antibodies (W001 / 40309); anti-CD40 antibodies, including S2C6 and its humanized variants (WOOO / 75348); antiCD1 antibodies (US Patent No. 5,622,700, WO 98/23761, Steppe et al., Transplant Intl. 4: 3-7 (1991), and Hourmant et al.,

I JMI. Ρ ί

Transplantation 58: 377-380 (1994)); anti-CD18

USA No. 5, 622,700, issued April 22, —1997. Or as in WO 97/26912, published July 31, 1997); anti-antibodies

<td>IgE (including E25,</td><td colspan="2">E26 and E27;</td><td>Patent</td><td>the</td><td>USA</td><td>No.</td>

<td>5,714,338, awarded</td><td>in</td><td>February</td><td>3, 1998 or</td><td colspan="2">Patent</td><td>the</td>

<td colspan="2">USA No. 5,091,313,</td><td>awarded</td><td>in February</td><td> 25,</td><td> 1992,</td><td>WO</td>

<td>04/93173 published</td><td>in</td><td>March 4</td><td>, 19-93, or</td><td>the</td><td colspan="2">Request</td>

<td colspan="3">International No. PCT / US98 / 13410</td><td>filed</td><td>in</td><td>j joined</td><td> 30,</td>

<td>1998, Patent of the</td><td>EU</td><td>.TO. No. 5</td><td colspan="2">, 714,338, Presta</td><td>et al.</td><td>, J.</td>

Immunol. 151: 2623-2632 (1993), and International Publication No. WO 95/19181); anti-Apo-2 receptor antibodies (WO 98/51793 published November 19, 1998); antiTNF-α antibodies, including cA2 (REMICADE®), CDP571 and MAK-195 (See, US Patent No. 5,672,347 issued September 30, 1997, Lorenz et al. J. Immunol. 156 (4): 1646-1653 (1996), and Dhainaut et al., Crit Care Med. 23 (9): 1461-1469 (1995)); Anti-Tissue Factor (TF) antibodies (European Patent No. 0 420 937 B1 issued on November 9, 1994); anti-human α4β7 integrin antibodies (WO 98/06248 published February 19, 1998); anti-epidermal growth factor receptor (EGFR) antibodies (eg, chimerized or humanized 225 antibody as in WO 96/40210 published Dec. 19, 1996); anti-CD3 antibodies such as OKT3 (US Patent No. 4,515,893 issued May 7, 1985); anti-CD25 or anti-Tac antibodies

(1995);

(CEA

MEXICAN INSTITUTE jCy'Luitales as CHI-621 (SIMULECT® and ZENAPAX® (See ^ SSwQtSSK ^^ s USA No. 5, 693,762 issued in diiiigiTihrp 2. 1997);

anti-CD52 antibodies such as CAMPATH-1H (Riechmann et al. Nature 332: 323-337 (1988)); anti-Fc receptor antibodies such as the M22 antibody directed against Fcy RI as in Graziano et al. J. Immunol. 155 (10): 4996-5002 antibodies to anti-carcinoembryonic antigen Carcinoembryonic Antigen) such as hMN-1 4 (Sharkey et al. Cancer Res. 55 (23Suppl): 5935s-5945s (1995); antibodies directed against breast epithelial cells including huBrE-3, hu-Mc 3 and CHL6 (Ceriani et al. Cancer Res. 55 (23): 5852s-5856s (1995); and Richman et al. Cancer Res. 55 (23 Supp): 5916s-5920s (1995)); antibodies that bind to colon carcinoma cells such as C242 (Litton et al. Eur J Immunol. 26 (1): 1-9 (1996)); anti-CD38 antibodies, for example AT 13/5 (Ellis et al. J. Immunol. 155 (2): 925-937 (1995)); anti-CD33 antibodies such as Hu M195 (Jurcic et al. Cancer Res 55 (23 Suppl): 5908s-5910s (1995) and CMA-676 or

CDP771; anti-CD22 antibodies such as LL2 or LymphoCide (Juweid et al. Cancer Res 55 (23 Suppl): 5899s-5907s (1995));

anti-EpCAM antibodies such as 17-1A (PANOREX®); anti-GpIIb / IIIa antibodies such as abciximab or c7E3 Fab anti-RSV antibodies such as MEDI-493 anti-CMV antibodies such as PROTOVIR®;

(REOPRO); (SYNAGIS®);

anti-HIV antibodies such as PRO542; anti63 antibodies

IMP

MEXICAN INSTITUTE OF INDUSTRIAL FROFIEDAD

<img file="MX343604B_D0055.tif" />

hepatitis such as the anti-Hep B antibody OSTÁVÍR; anti-CA 125 antibodies such as OvaRex; antibody 3e "" anti-idiotypic GD3 epitope BEC2; anti-avp3 antibodies, including VITAXIN®; anti-human renal cell carcinoma antibody such as ch-G250; ING-1; anti-human antibody 17-1A (3622W94); anti-human colorectal tumor antibody (A33); anti-human R24 melanoma antibody directed against GD3 ganglioside; antihuman squamous cell carcinoma (SF-25); and anti-human leukocyte antigen (HLA = Human Leukocyte Antigen) antibodies such as Smart ID10 and anti-HLA DR Oncolym antibody (Lym-1).

Aside from the antibodies specifically identified above, the skillful practitioner can generate antibodies directed against an antigen of interest, for example using the techniques described below.

(i) Selection and Preparation of Antigen

The antibody present is directed against an antigen of interest. Preferably, the antigen is a biologically important polypeptide, and administration of the antibody to a mammal suffering from a disease or disorder may result in therapeutic benefit in that mammal. However, antibodies directed against non-polypeptide antigens (such as tumor associated glycolipid antigens; see US Patent No. 5,091,178) are also

IMPI

MEXICAN INSTITUTE Dt LA RRORIDaU, industrial

<img file="MX343604B_D0056.tif" />

contemplate. When the antigen is a polypeptide, it can be a transmembrane molecule (eg receptor !; ü 'ligand such as a growth factor. Exemplary antigens include those proteins described in section (3) below. Exemplary molecular targets for antibodies encompassed by the present invention include CD proteins such as CD3, CD4, CD8, CD19, CD20, CD22, and CD34; members of the ErbB receptor family such as the EGFR, HER2, HER3 or HER4 receptor; cell adhesion molecules such as LFA-1, Macl, pl 50.95, VLA-4, ICAM-1, VCAM and αν / β3 integrin including either its α or β sub-units (eg anti-CDlla, anti -CDl8 or anti-CDllb); growth factors such as VEGF; IgE; blood group antigens; flk2 / flt3 receptor; obesity receptor (OB); mpl receptor; CTLA-4; protein C, or any of the other antigens mentioned here.

Soluble antigens or their fragments, optionally conjugated to other molecules, can be used as immunogens to generate antibodies. For transmembrane molecules, such as receptors, fragments of these (eg, the extracellular domain of a receptor) can be used as the immunogen. Alternatively, cells that express the transmembrane molecule can be used as the immunogen. These cells can be derived from a natural source (for example cancer cell lines) or they can be

IMPI

MEXICAN INSTITUTE,&gt;

DELA PROPirOAl · *

INDUSTRIAL cells that have been transformed by recombinant techniques to express the transmembrane molecule.

Other antigens and their useful ways to prepare antibodies will be apparent to those in the art.

(ii) Polyclonal Antibodies

Polyclonal antibodies preferably are developed in animals by multiple subcutaneous (se) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It may be useful to conjugate the antigen with a protein that is immunogenic in the species to be immunized, for example, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example, maleimidobenzoyl sulfosuccinimide ester (conjugation via cistern residues), N-hydroxysuccinimide (via lysine residues), glutaraldehyde, succinic anhydride, SOCI2, or R¹N = C = NR, where R and R¹ they are different alkyl groups.

Animals are immunized against the antigen, immunogenic conjugates or derivatives by combining for example 100 pg or 5 pg of the protein or conjugate (for rabbits or mice respectively) with 3 volumes of complete Freund's adjuvant and injecting the solution intradermally at multiple sites. . One month later, the animals are reinforced with 1/5 to {fraction (1/10)} the

ΙΜΡΙ

Ζ '. INDUSTRY original amount of conjugated antigen in adjuvant

INSTITUTO MEXICANO OE LA RRORIEDAO, INDUSTRIAL

<img file="MX343604B_D0057.tif" />

de Freund by subcutaneous injection in multiple sitlflS. At 14 days later, the animals are bled and the serum is tested for antibody titer. Animals are reinforced until the title is established or leveled on a plateau. Preferably, the animal is fortified with the conjugate of the same antigen, but conjugated to a different protein and / or through a different entanglement reagent. Conjugates can also be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are conveniently employed to enhance the immune response.

(iii) Monoclonal Antibodies

Monoclonal antibodies can be made using the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or can be made by recombinant DNA methods (US Patent Number

4,816,567).

In the hybridoma method, a mouse or other appropriate host animal such as a hamster or macaque monkey, is immunized as described above to produce lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes can be immunized in vitro. The lymphocytes then fuse with cells from

<img file="MX343604B_D0058.tif" />

IMPI

MEXICAN INSTITUTE Dt LA HtOFllDA »

INDUSTRIAL myeloma using a suitable fusion agent, such as polyethylene glycol to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).

The hybridoma cells thus prepared are seeded and grown in a suitable culture medium which preferably contains one or more substances that inhibit the growth or survival of the precursor myeloma cells without fusion. For example, if the precursor myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for hybridomas will typically include hypoxanthine, aminopterin, and thymidine (HAT medium), these substances prevent cell growth deficient in HGPRT.

Preferred myeloma cells are those that fuse efficiently, support stable high-level production of antibody by selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines are murine myeloma lines such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif. USA, and in SP-2 or X63-Ag8-653 cells available from American Type Culture Collection, Rockville, Ed. USA. Human myeloma and mouse-human heteromyeloma cell lines have also been

IMPI ______________

SAY THE PRÜPlíOAC,. x. i,. ,,. industrial - «jbC-aj-eaa&gt; decnto for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (14); Bfo'd'éTTr ^ fr ^^ TMonoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).

Culture medium in which hybridoma cells grow is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells are determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

After hybridoma cells that produce antibodies of the desired specificity, affinity, and / or activity are identified, the clones can be subcloned by limiting dilution procedures and developed by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)). Culture medium suitable for this purpose includes for example D-MEM or RPMI-1640 medium. Furthermore, hybridoma cells can develop in vivo as ascites tumors in an animal.

Monoclonal antibodies secreted by the subclones are conveniently separated from the culture medium, ascites fluid, or serum by purification procedures.

IMPI

INSTITUTO mexican · DS LA MONEDAD INDUSTRIAL

<img file="MX343604B_D0059.tif" />

of conventional immunoglobulins, such as for example Protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. Preferably, the Protein A affinity chromatography procedure using a pH gradient described herein is employed.

DNA encoding monoclonal antibodies is easily isolated and sequenced using standard procedures (eg, using oligonucleotide probes that are capable of specifically binding to genes encoding the heavy and light chains of monoclonal antibodies). Hybridoma cells serve as a preferred source of this DNA. Once isolated, the DNA can be placed into expression vectors, which are then transfected into host cells such as E. coli cells, ape COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells, which otherwise they do not produce immunoglobulin protein to obtain the synthesis of monoclonal antibodies in the recombinant host cells.

DNA can also be modified for example by substituting the coding sequence for human heavy and light chain constant domains in place of homologous murine sequences (US Patent Number 4,816,567; Mor rison, et al., Proc. Nati Acad. Sci. USA,

MBXfCANU INSTITUTE # £ «ááf = -C5J A OF THE JNJ industrial PROPERTY -¾¾¾

81: 6851 (1984)), or by covalent binding to the whole or pair immunoglobulin coding sequence^-~ 3 ^ "~ TS '"' * coding sequence for a polypeptide without immunoglobulin.

Typically, these immunoglobulin-free polypeptides are substituted by the constant domains of an antibody or are substituted by the variable domains of an antigen combining site of an antibody to create a bivalent chimeric antibody comprising an antigen combining site having specificity for an antigen and another antigen combining site that has specificity for a different antigen.

Monoclonal antibodies can be isolated from antibody phage libraries generated using the techniques described in McCafferty et al., Nature, 348: 552-554 (1990). Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 581-597 (1991) describe the isolation of murine and human antibodies respectively using phage libraries. Subsequent publications describe the production of high affinity human antibodies (nM interval) by chain exchange (Marks et al., Bio / Technology, 10: 779-783 (1992)), as well as combinatorial infection and recombination in vivo as a strategy for building very large phage libraries (Waterhouse et al., Nuc. Acids. Res., 21: 2265-2266 (1993)). In this way, you are

ΙΜΡΙΓ

INSTITUTE Μ EX ICANü 1

I HEARD THE INDUSTRIAL PROPERTY,

<img file="MX343604B_D0060.tif" />

techniques are viable alternatives to traditional hybrid techniques for isolation of IftóhóClUlidltíS antibodies. (iv) Humanized and Human Antibodies

A humanized antibody has one or more amino acid residues introduced into it from a non-human source.

These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be performed essentially by following the method of Winter et al. (Jones et al., Nature, 321: 522-525 (1986);

Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, these humanized antibodies are chimeric antibodies (US Patent Number 4,816,567) wherein substantially less than an intact human variable domain has been replaced by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies where some CDR residues and possibly some FR residues are replaced by residues from analogous sites in rodent antibodies.

Selection of human variable domains, both light and heavy, for use in producing humanized antibodies is very important in reducing the

<img file="MX343604B_D0061.tif" />

MíXíCANC INSTITUTE OF PROPERTY

INDUSTRIAL

<img file="MX343604B_D0062.tif" />

antigenicity. In accordance with the so-called best-fit method, the rodent antibody variable domain sequence is screened against the entire library of known human variable domain sequences. The human sequence that is closest to that of the rodent is then accepted as the human FR for the humanized antibody (Sims et al., J. Iminunol., 151: 2296 (1993)). Another method uses a particular framework derived from the consensus sequence of all human antibodies from a particular heavy or light chain subgroup. The same framework can be used for several different humanized antibodies (Carter et al., Proc. Nati. Acad, Sel. USA, 89: 4285 (1992); Presta et al., J. Immnol., 151: 2623 (1993)) .

Furthermore, it is important that antibodies are humanized with high affinity retention for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the precursor sequences and various conceptual humanized products using three-dimensional models of the precursor and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those of skill in the art. Computer programs are available that illustrate and display three-dimensional shaping structures.

<img file="MX343604B_D0063.tif" />

IMPI

INSTITUTO MEXICANO DS THE INDUSTRIAL PROPERTY of selected candidate immunoglobulin sequences. Inspection of these expressions allows analysis of the probable role of the residues in the functioning of the candidate immunoglobulin sequence, that is, the analysis of residues that influence the capacity of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the container and import sequence such that the desired antibody characteristic, such as increased affinity for it or the targeted or targeted antigens, is achieved. In general, CDR residues are directly and more substantially involved to influence antigen binding.

Alternatively, it is now possible to produce transgenic animals (eg mice) that are capable of immunization, to produce a complete repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, the homozygous deletion of the antibody heavy chain binding region (JH) gene in germline and chimeric mutant mice has been reported to result in complete inhibition of endogenous antibody production. Transfer of the human germline immunoglobulin gene matrix in these germline mutant mice will result in the production of human antibodies upon antigen testing. See for

ΙΜΡΙ

MEXICAN INSTITUTE OF LA PRORIEDA »

INDUSTRIAL example, Jakobovits et al., Proc. Nati. Acad. Sci. USA,

<img file="MX343604B_D0064.tif" />

90: 2551 (1993); Jakobovits et al., Nature, 362: 255-258 (1993); Bruggermann et al., Year in Immuno., 7:33 (1993); and

Duchosal et al. Nature 355: 258 (1992). Human antibodies can also be derived from phage display libraries (Hoogenboom et al., J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581-597 (1991 ); Vaughan et al. Nature

Biotech 14: 309 (1996)).

(v) Antibody Fragments

Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were derived by proteolytic digestion of intact antibodies (see, eg, Morimoto et al. Journal of Biochemical and Biophysical Methods 24: 107-117 (1992) and Brennan et al., Science, 229: 81 (1985) ). However, these fragments can now be produced directly by recombinant host cells. For example, the antibody fragments can be isolated from the antibody phage libraries discussed above. Alternatively, Fab'-SH fragments can be recovered directly from E. coli and chemically coupled to form F (ab ') fragments.₂ (Carter et al., Bio / Technology 10: 163-167 (1992)). According to another approach, fragments F (ab ')₂ they can be isolated directly from recombinant host cell culture. A single-chain Fv fragment (scFv)

Pi

MKXICANV INSTITUTE OF PROPERTY

INDUSTRIAL

<img file="MX343604B_D0065.tif" />

it can also be isolated. See WO 93/16185. Other techniques for &lt;———— B »-« WWWffWKMMrwn Bill producing antibody fragments will be apparent to the skillful practitioner.

(vi) Multispecific Antibodies

Multispecific antibodies have binding specificities for at least two different antigens. While these molecules will normally only bind two antigens (ie bispecific antibodies, BsAbs), antibodies with additional specificities such as triespecific antibodies are encompassed by this expression when used herein.

Methods of producing bispecific antibodies are known in the art. Traditional production of full-length bispecific antibodies is based on the co-expression of two immunoglobulin light chain-heavy chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305: 537-539 (1983 )). Due to the assortment or variety of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture · of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually carried out by affinity chromatography steps, is rather problematic, and product yields are low. Similar procedures are

MEXICAN INSTITUTE faith

M LA FROFIEDAD, «íú

INDUSTRIAL describe in WO 93/08829, and in Traunecker et al., EMBO J., 10: 3655-3659 (1991).

βϋ «» 3Λ * Λ ^

In accordance with another approach described in W096 / 27011, the interface describes a pair of antibody molecules that can be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture. The preferred interface comprises at least a part of domain C_H3 of a constant domain of antibody. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). Compensatory cavities of identical or similar size to the large side chain (s) are created at the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (eg alanine or threonine). This provides a mechanism to increase the performance of the heterodimer over other unwanted end products such as homodimers.

Bispecific antibodies include heteroconjugated or cross-linked antibodies. For example, one of the antibodies in the heteroconjugate can be coupled with avidin, the other with biotin. These antibodies for example have been proposed to target unwanted cell immune system cells (US Patent Number

MÁXICANO JÁ INSTITUTE

Dt la raoprcnAi »Oa-wI ^ aLSaP

INDVSTSIAL

4, 676, 980), and for the treatment of HIV infection (HIV) '(WO

91/00360, WO 92/200373, and EP 03089). Heteroconjugate antibodies can be made using any convenient crosslinking methods. Convenient entanglement agents are well known in the art and are described in US Patent Number 4,676,980, along with a number of entanglement techniques.

Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical binding. Brennan et al., Science, 229: 81 (1985) describe a procedure where intact antibodies are proteolytically cleaved to generate F (ab ') fragments₂. These fragments are reduced in the presence of the complexing agent dithiol sodium arsenite to stabilize neighboring dithiols and prevent intermolecular disulfide formation. The Fab 'fragments generated later are converted to thionitrobenzoate derivatives (TNB). One of the Fab'-TNB derivatives is then reconverted to Fab'tiol by reduction with mercaptoethylamine and mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.

Recent progress has made recovery easier

-TV··.·

IMPI

MEXICAN INSTITUTE

OF THE PROTIÉdaU k INDUSTRIAL '

<img file="MX343604B_D0066.tif" />

direct from Fab'-SH fragments from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., &lt;J. Exp. Med., 175: 217-225 (1992) describes the production of an F (ab ') antibody molecule.₂ fully humanized bispecific. Each Fab 'fragment was secreted separately from E. coli and subjected to in vitro directed chemical coupling to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells that over-express the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against targets of human breast tumor.

Various techniques for producing and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol., 148 (5): 1547-1553 (1992). The leucine zipper peptides of the Fos and Jun proteins were ligated to the Fab 'portions of two different antibodies by gene fusion. Antibody homodimers were reduced in the hinge region to form monomers and then re-oxidized to form antibody heterodimers. This method can also be used for the production of antibody homodimers. The diabody technology described by Hollinger et al., Proc. Nati. Acad.

IΜ P i

MEXICAN INSTITUTE

SAY PROPERTY C ** aeSw— f NBU5TKIAL

Sci. USA, 90: 6444-6448 (1993) has provided an alternate mechanism for producing fragments of anti-Epoe DiespecífrCóS. The fragments comprise a heavy chain variable domain (V_H) connected to a light chain variable domain (V_L) by a linker that is too short to allow mating between two domains on the same chain. Accordingly, domains V_H and V_L fragments are forced to mate with V domains_L and V_H complementary to another fragment, thus forming two antigen binding sites. Another strategy for producing bispecific antibody fragments by the use of Fv single-chain dimers (sFv) has been reported. See Gruber et al., J. Immunol., 152: 5368 (1994). Alternatively, the antibodies can be linear antibodies as described in Zapata et al. Protein Eng. 6 (10): 1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Ed segments (V_H -Cjfl- V_H and V¿) that form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.

Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol 147: 60 (1991).

Immunoadhesins

The simplest and most direct immunoadhesin design combines the binding domain (s) of adhesin

IMPIOINSTITUTO MEXICANO Y

Dt PROPERTY * (ie the extracellular domain (ECD) of a —σοη the hinge and Fe regions of a chain^{1 1,1} peaada ~ —immunoglobulin. Ordinarily, when preparing the immunoadhesins of the present invention, nucleic acid encoding the binding domain of the adhesin will be terminally fused with nucleic acid encoding the N-terminus of an immunoglobulin constant domain sequence, however N fusions are also possible -terminals.

Typically, in these fusions the encoded chimeric polypeptide will retain at least the functionally active hinge, C domains._H2 and Cj / 3 of the constant region of an immunoglobulin heavy chain. Mergers also made to the C-terminus of the Fe portion of a constant domain, or N-terminal immediate to C_Hone of the heavy chain from the corresponding region of the light chain. The precise site at which the fusion is made is not critical; Particular sites are well known and can be selected to optimize immunoadhesin biological activity, secretion, or binding characteristics.

In some embodiments, the adhesin sequence is fused to the N-terminus of the Fe domain of immunoglobulin Gi (Ig Gi). It is possible to fuse the entire heavy chain constant region to the adhesin sequence. However, preferably, a sequence that begins in the hinge region just upstream of the papain cleavage site that

<img file="MX343604B_D0067.tif" />

IMPI

MEXICAN INSTITUTE OF PROPERTY

INDUSTRIAL __ defines IgG Fe chemically (i.e. residue 216, taking the first residue from the heavy chain constant region as immunoadhesins

114), or analogous sites of other immunoglobulins, is used in the fusion. In some embodiments, the adhesin amino acid sequence fuses to (a) the hinge region and / or Ch2 and C_h3 or (b) C_H1, the hinge region, C domains_H2 and C_H3, from an IgG heavy chain.

For bispecific immunoadhesins, they are assembled as multimers, particularly as heterodimers or heterotetramers.

and

In assemblies these immunoglobulins will generally have known unit structures. A basic four-chain structural unit is how IgG, IgD, and IgE exist. A four chain unit is repeated in the higher molecular weight immunoglobulins; IgM generally exists as a pentamer of four basic units that are held together by disulfide bond. IgA globulin, and occasionally IgG globulin, may also exist in multimeric form in serum. In the case of multimers, each of the four units can be the same or different.

Various exemplary assembled immunoadhesins within the present scope are schematically shown below:

(a) AC_L-AC_L;

(b) ACh^- (ACh, ACl^_ACh, ACl^-VhCh, or VlCl-ACh)

<img file="MX343604B_D0068.tif" />

ΙΜΡΪ

INSTITUTO MSXICANO DE LA RRORliL'AD INDUSTRIAL (c) AC_l-ACh- (AC_l-AC_h, AC_l-V_hCh, VlC_l-AC_h, or VlC_l-V_hCh) (d) ACl^_VhCh ^- (ACh, or ACl^-VhCh, or V_lCl^_ACh)!

(e) VlCl^- ACh - (ACl^-Vh Ch, or V_lCl^-ACh); and (f) (AY)_n- (V_LC_L-V_HC_H) ₂, where each A represents identical or different adhesin amino acid sequences;

<td>V_L is</td><td>a</td><td>domain</td><td>variable</td><td>of</td><td>chain</td><td>light</td><td>of</td>

<td>immunoglobulin;</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Vh is immunoglobulin;</td><td>a</td><td>domain</td><td>variable</td><td>of</td><td>chain</td><td>heavy</td><td>of</td>

<td>C_L is immunoglobulin;</td><td>a</td><td>domain</td><td>constant</td><td>of</td><td>chain</td><td>light</td><td>of</td>

<td>Ch is immunoglobulin;</td><td>a</td><td>domain</td><td>constant</td><td>of</td><td>chain</td><td>heavy</td><td>of</td>

n is an integer greater than;

Y designates the residue of a covalent entanglement agent.

For brevity, the above structures only show key features; they do not indicate binding (J) or other immunoglobulin domains, nor are disulfide bonds shown. However, when these domains are required for binding activity, they will be constructed to be present at the ordinary locations they occupy in immunoglobulin molecules.

Alternately, the adhesin sequences can

ΙΜΡΪ

MEXICAN INSTITUTE

OF THE PROPERTY _r inserted between heavy chain sequences ^ "YíK &amp; éna'rrgera immunoglobulin, such that an immunoglobU'liria¹ that · ϋυιιιριυιΐύβ “a chimeric heavy chain is obtained. In this embodiment, the adhesin sequences are fused to the 3 'end of an immunoglobulin heavy chain in each arm of an immunoglobulin, either between the hinge and the C domain._H2, or between domains C_H2 and C_H3. Similar constructions have been reported by Hoogenboom, et al., Mol. Immunol. 28: 1027-1037 (1991).

Although the presence of an immunoglobulin light chain is not required in the immunoadhesins of the present invention, an immunoglobulin light chain may be present either covalently associated with an immunoglobulin adhesin heavy chain fusion polypeptide, or fused directly to the adhesin . In the above case, DNA encoding an immunoglobulin light chain is typically co-expressed with DNA encoding the adhesin immunoglobulin heavy chain fusion protein. Upon secretion, the hybrid heavy chain and light chain will covalently associate to provide an immunoglobulin-like structure comprising two disulfide-linked immunoglobulin light chain-heavy chain pairs. Suitable methods for preparing these structures for example are described in US Patent Number 4,816,567, issued March 28, 1989.

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

<img file="MX343604B_D0069.tif" />

Immunoadhesins are most conveniently constructed by fusion of the cDNA sequence encoding the in-frame adhesin portion to an immunoglobulin cDNA sequence. However, fusion to genomic immunoglobulin fragments can also be employed (see, for example, Aruffo et al., Cell 61: 1303-1313 (1990); and

Stamenkovic et al., Cell 66: 1133-1144 (1991)). This latter type of fusion requires the presence of lg regulatory sequences for expression. cDNAs encoding IgG heavy chain constant regions can be isolated based on published sequences from cDNA libraries derived from peripheral blood lymphocytes or spleen by hybridization or by polymerase chain reaction (PCR) techniques. The cDNAs encoding the adhesin and the immunoglobulin parts of the immunoadhesin are inserted in tandem into a plasmid vector that directs poor expression in selected host cells.

Expression of Polipéphidos

The polypeptide (eg, antibody) to be produced using the method described herein is generally produced using recombinant techniques.

Suitable host cells for cloning or expressing siRNAs in vectors here are prokaryotic, yeast or higher eukaryotic cells. Suitable prokaryotes for this purpose include eubacteria, such

IMPI

INSTITUTO MUCICAND Dt LA PtOntDAD INDUSTRIAL

<img file="MX343604B_D0070.tif" />

as Gram-negative or Gram-positive organisms, eg, Enterobacteriaceae such as Escherichia, eg, E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, eg, Salmonella typhimurium, Serratia, eg, Serratia marcescans, and Shigella , as well as Bacilli such as B. subtilis and B. licheniformis (eg, B. licheniformis 41P described in DD 266,710 published April 12, 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are convenient expression or cloning hosts for vectors that encode polypeptide. Saccharomyces cerevisiae, or baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful here, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as, for example, K. lactis, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces such as Western Schwanniomyces; and filamentous fungi such

L * 8

MEXICAN INSTITUTE

DS LA Wi. «A» ⁴

INDUSTRIAL '* such as, for example, Neurospora, Penicillium, Tolypocladium and Aspergillus hosts such as A. nidulans and A. niger. ***

Convenient cultured cells for expression of glycosylated polypeptide are derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells. Numerous baculovirus strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), and Bombyx mori, have been identified. A variety of viral strains for transfection are publicly available, for example, the Ll variant of Autographa cali fornica NPV and the Bm-5 strain of Bombyx mori NPV, and these viruses can be employed as the virus herein in accordance with the present invention, particularly for transfection of Spodoptera frugiperda cells. Cell cultures of cotton, corn, potato, soy, petunia, tomato and tobacco plants can also be used as hosts.

However, interest has been greatest in vertebrate cells, and the propagation of cultured vertebrate cells (tissue culture) has become a routine procedure. Examples of useful mammalian cell lines include, but are not limited to, monkey kidney CV1 cells transformed by SV40 (COS-7, ATCC CRL 1651); cells

<img file="MX343604B_D0071.tif" />

of human embryonic kidney (293 or cell for growth in suspension culture l'7 "5T'áh'UIÍl t? L ¿A 1:¹; ‘¹J:¹Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster / DHFR ovary cells (CHO, Urlaub et al., Proc. Nati. Acad. Sci. USA 77: 4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23: 243-251 (1980)); monkey kidney cells (CV1 ATCC CCL

70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals NY Acad. Sci. 383: 44-68 (1982)); MRC 5 cells; FS4 cells; and human hepatoma cells (Hep G2).

Host cells are transformed with the cloning or expression vectors described above for polypeptide production and cultured in modified conventional nutrient medium as appropriate to induce promoters, selecting transformants, or amplifying genes encoding the desired sequences.

Host cells used to produce the polypeptide used in the methods of this invention can be cultured in a variety of media. Media

IMPI

HSTITUTO MMICANO "

Of. LA RROriELiAI) C commercially available such as Ham's (;

Minimum Essential Medium ((MEM), (Sigma), RPMi ·· -1640 (Sigmap »—and Dulbecco's Modified Eagle Medium ((DMEM = Dulbecco's Modified Eagle Medium), (Sigma), or Dulbecco's Modified Eagle Medium: GIBCO®: Mixture Nutrient F-12 (Invitrogen) are suitable for culturing host cells In addition, any of the media described in Ham et al., Meth. Enz. 58:44 (1979), Barnes et al., Anal. Biochem. 102: 255 (1980),

US Patents Numbers 4,767,704; 4,657,866;

4,927,762; 4,560,655; or 5,122,469; WO 90/03430; WO 87/00195; o US Patent Number Re. 30,985 can be used as culture media for host cells. Other synthetic or defined growth media may also be employed, and the appropriate medium for growth of a specific type of host cell is known to a person skilled in the art of molecular and cellular biology. Any of these media can be supplemented as needed with hormones and / or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium, calcium, magnesium, and phosphate chloride), buffers ( such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCIN ™, hygromycin), trace elements (defined as inorganic compounds usually present in

final concentrations in the

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL MONEDAD

<img file="MX343604B_D0072.tif" />

a source of energy to its required elements (micromolar range), and glucose or equivalent. Any others can be included at appropriate concentrations that will be known to those skilled in the art. Culture conditions, such as temperature, pH, and the like, are those previously employed with the host cell selected for expression, and will be apparent to the person of ordinary skill in the art.

Standard cell culture conditions can be used to cultivate cells. Cells are grown and maintained under appropriate conditions of temperature, gas mixture, and pH (such as about 20 ° C to about 37 ° C, at about 6% to about 84% CO2, and at a pH between about 5 to about 9 ). In some modalities, cells grow in an appropriate cell medium at 37 ° C for the first 48 hours and change at 33 ° C for the following 12 days. Reactions can be performed under aerobic or anoxic conditions based on the requirements of the host cells. In some embodiments, cells are grown using any known fermentation mode, including but not limited to batch, batch-feed, or continuous processes.

When recombinant techniques are used, the polypeptide can be produced intracellularly, in the

ΙΜΡΙ

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

<img file="MX343604B_D0073.tif" />

periplasmic space, or directly secreted into the environment. If the polypeptide is produced intracellularly, as a first step, the particulate debris, either host cells or Used cells (eg resulting from homogenization) are removed, eg by centrifugation or ultrafiltration. When the polypeptide is secreted into the medium, supernatants from these expression systems are generally first concentrated using a commercially available protein concentration filter, for example an Amicon or Millipore Pellicon filter unit.

Teams

The present invention also provides kits comprising compositions and instructions for use comprising a description of the methods of the invention. The kits may comprise cultured cells, siRNAs, targeted sequences, transfection agents, instructions for the methods of the present invention, or any combination thereof.

The following examples are provided to illustrate but not to limit the invention.

EXAMPLES

It is understood that the examples and modalities described herein are for illustrative purposes only and that various modifications or changes in light of the same will be suggested to persons skilled in the art and

MBXICAN INSTITUTE OF PROPERTY

INDUSTRIAL will include in the spirit and scope of this application.

Example 1: Deactivation of PDHK1, PDHK2, PDHK3, and LDHa

Reduces Lactate Production and Increases Productivity / Antibody Titer

Materials and methods

Construction of the Target Making Vector in LDHa / PDHKl, 2, 3

The targeted sequence for LDHa is chosen as previously described by Kim and Lee et al, Appl. Microbiol. Biotechnol. 74 (1): 152-159 (2007), and the LDHa siRNA sequence is CTCGATTCCGTTATCTGAT (SEQ ID NO: 1). To designate cDNA sequences, cloned siRNA sequences for PDHKs, partial for CHO PDHK1, 2, and 3 reverse transcription of polymerase chain reaction (RTPCR) with primers located within highly conserved regions of PDHKs. Partially cloned sequences were used to design siRNA sequence according to the method described by Elbashier et al (2002)).

(Methods 26: 199-213

<td>Sequence that</td><td>make</td><td>White</td><td>in</td><td>PDHK1</td><td>(siRNA):</td>

<td>GCAGTTCCTGGACTTCGGA</td><td>(SEQ ID</td><td>NO: 2).</td><td></td><td></td><td></td>

<td>Sequence that</td><td>make</td><td>White</td><td>in</td><td>PDHK2</td><td>(siRNA):</td>

<td>CATTCAGTACTTCTTGGAC</td><td>(SEQ ID</td><td>NO: 3).</td><td></td><td></td><td></td>

<td>Sequence that</td><td>make</td><td>White</td><td>in</td><td>PDHK3</td><td>(siRNA):</td>

<td>TGTAGCTGATGTCGTGAAA</td><td>(SEQ ID</td><td>NO: 4).</td><td></td><td></td><td></td>

<td colspan="2">Construction</td><td>simple</td><td>than</td><td>contains</td><td>sequences</td>

IMPI

MEXICAN INSTITUTE OF PROPERTY directed for LDHa and PDHKs is built '' 'ffFi' ^ 'izarTdd ^¹ the pSilencer 3.1-H1 hygro vector (Catfr: .......

Biosystems / Ambion, Austin, TX). LDHa siRNA is inserted into KasI site of pSilencer 3.1, with addition of p6ilencer 2.1 U6 promoter at its immediate 5 'end. SiRNA sequences for PDHK1 and 2 siRNAs are inserted at BamHI / HindIII and HindIII sites respectively. A BglII site is introduced on the 3 'side of PDHK2 siRNA and used for insertion of PDHK3 siRNA. For negative control, pSilencer 3.1 vector containing a disorganized siRNA sequence was used.

Cell culture

Hydrofolate reductase (DHFR) deficient CHO cells were grown in proprietary DMEM / F12 based medium in shake flask containers at 37 ° C and 5% C0₂. Cells are transferred every three to four days. Development of Stable siRNA Cell Line (siRNA clone)

A 25 nM methotrexate resistant (MTX) CHO cell line expressing a recombinant monoclonal antibody was transfected using Lipofectamine 2000 CD (Cat # 12566014, Invitrogen, Carlsbad, CA) according to the manufacturer's recommendation (Invitrogen, Carlsbad, CA ). Transfected cells were centrifuged and seeded in selective DMEM / F-12 based medium (glycine, hypoxanthine, and thymidine free) containing 25 nM MTX and 400 ug / ml hygromycin (Cat # 10687010, Invitrogen, Carlsbad, CA). Cells

IMPI

INSTITUTO MÍXICAWO DF THE PROPERTY

INDUSTRIAL _ 96-well plates for SiRNA were derived from containing the resuspended sequences coated on to generate individual clones. Plasmid siRNA transfection clones were targeted for LDHa and PDHKs genes, whereas mock plasmid transfection clones (Cat # AM5766, Applied Biosystems / Ambion, Austin, TX) containing a disorganized sequence designed for manufacturing without appreciable homology were derived with known genes.

Quantitative Real-Time PCR Analysis (qRT-PCR or

Taqman)

Total RNA from individual clones was isolated using RNeasy 96 kit (Cat # 74181, Qiagen) and treated with DNase digestion (Cat # 79254, RNase free DNase set, Qiagen) to remove residual DNA possibly present in isolated RNA samples. Taqman was performed using universal qRT-PCR master mix according to the manufacturer's instructions (Cat # 4309169, Applied Biosystems) and expression levels of PDHKs and LDHa were normalized to the constitutive β-microglobulin gene.

The probe and primer sequences used for Taqman analysis were as follows:

PDHK1 primer direct: GCCCATCTCATCGAAAACA (SEQ ID NO: 5). Reverse PDHK1 primer: AGCCATCTTTAATGACTTCGACTAC (SEQ ID NO: 6).

PDHK1 probe: TCGCAGTTTGGATTTATGCTTCCAATG (SEQ ID NO: 7).

IMPI ^

GATCTGTCCATCAAAATGAGTGA^NDU{'3^IEQ

PDHK2 Direct Primer

8) .

Reverse PDHK2 primer:

<img file="MX343604B_D0074.tif" />

TGTGGAGTACATGTAGCTGAAGAG (SEQ ID NO:

9) ·

PDHK2 probe: CTCTCAATCTTCCTCAAGGGGACACC (SEQ ID NO: 10).

Primer PDHK3 primer: CAGCCTGGAGCCTACAAGA (SEQ ID NO: 11).

Reverse PDHK3 primer: GGCATACAGTCGAGAAATTGG (SEQ ID NO: 12).

PDHK3 probe: AAGCCATAACCAAATCCAGCCAAGG (SEQ ID NO: 13).

Direct LDHa primer: GCCGAGAGCATAATGAAGAA (SEQ ID NO: 14).

Reverse LDHa primer: CCATAGAGACCCTTAATCATGGTA (SEQ ID NO:

15) .

LDHa probe: CTTAGGCGGGTGCATCCCATTT (SEQ ID NO: 16).

Direct β-microglobulin primer: TCCTCTCAGTGGTCT GCT TGG (SEQ ID NO: 17).

Reverse β-microglobulin primer: TGGCGTGTGTAGACTTGCACTT (SEQ ID NO: 18).

Β-microglobulin probe: TGCCATCCAGCGTCCCCCA (SEQ ID NO: 19). Clone Evaluation in a Shake Flask Fed by

Lots

Twelve siRNA clones and twelve simulated clones were seeded in the proprietary production medium with a pH of 7.15 using a 14 day batch feed culture process with a bolus feed on day 3 and a temperature change of 37 ° C. at 33 ° C on day 2. Cell viability and cell counts were monitored.

ΙΜΡΙ INSTRUMENT Mixicano DC LA FtOPltDAD

INDUSTRIAL

<img file="MX343604B_D0075.tif" />

Viable by exclusion of Triptan blue dye using a Vicell (Beckman Coulter). Lactate concentrations were measured on days 3, 7, 10 and 14 using a Nova Bioprofile analyzer (Nova biomedical). The average cell-specific lactate production rate, q_s calculated as the slope of the graph of integrated total cell number and cumulative lactate produced [S_t-S_or], based on the lactate mass balance equation formulated on the entire culture medium:

where S_t is the total amount of lactate in the culture volume {mg) at time t, S_or is the total amount of lactate in the culture volume {mg) at time t = 0, X is the total number of cells in the culture volume at any given time t, and q_s is the rate of specific lactate production in mg / cell / day. Since the above equation is written for the time interval between t = 0 and t = t, q_s is the average lactate production rate over this time interval. By the convention used in that work, if more lactate is produced than is consumed by the cell, then the value of q_s is positive.

Bioreactor Batch Feeding Operation

Bioreactor experiments were performed in

£.4

MEXICAN INSTITUTE ¿7i

DÍ LA PROW.PA »2 L agitated tank bioreactors (Applikon ^^ fVy ^ er ^ lSí ^, CA) operated at 1.5 L inter-j ^ volume» v. £ io &amp; p.uée concentrated nutrient feed at 72 hours after inoculation, glucose was added as required during the 14-day batch feed culture. Dissolved oxygen and agitation were maintained in the bioreactor cultures at the 30% air saturation and 275 rpm set points, respectively. The culture pH was controlled at 7.0 by addition of CO gas₂ or Na₂1M CO3. Culture temperature was maintained at 37 ° C for the first 48 hours and changed to 33 ° C thereafter. Process control in each bioreactor was accomplished using a B. Braun Biotech Digital Control Unit (Allentown, PA).

Sample Analysis

Antibody titer was determined using standard protein A affinity chromatography with UV detection. See Fahrner et al., Biotechnol. Appl. Biochem. 30: 121-128 (1999). Culture samples were analyzed for viable cell concentration and viability by ViCell AS cell counter (Beckman Coulter, Fullerton, CA), pH and lactate by Bioprofile 400 bioanalyzer (Nova Biomedical, Waltham, ΜΑ), and osmolality by an osmometer of multiple samples (Advanced Instruments, Norwood, MA).

Statistic analysis

Two-tailed student t-tests are carried out

<img file="MX343604B_D0076.tif" />

INSTITUTO MiXICAN »« DE IA PROPIEDAD

<img file="MX343604B_D0077.tif" />

using the JMP program.

Results

Construction of a siRNA vector targeting PDHKs and LDHa

There are four PDHK genes reported by Harris et al. (Adv. Enzyme Regul. 42: 249-59 (2002) in mammalian cells.

To estimate whether all four PDHK genes were present in CHO cells, four sets of RT-PCR primers were designed based on the conserved regions between human and mouse PDHK sequences. The PCR results revealed that even though all four PDHK mRNAs can be detected in CHO cells, the level of PDHK4 mRNA is minimal and much lower than 3 other PDHKs in DHFR deficient (dihydrofolate reductase deficient) CHO cells. Therefore, only the expression of the PDHKl, 2, and 3 genes was blocked along with the LDHa gene. For LDHa and each PDHK, three siRNA sequences were designed and tested in CHO cells to choose the siRNA sequence that exhibits the best down-regulation of the target gene. The best siRNA sequence for LDHa was chosen based on the findings by Kim and Lee. Appl. Microbiol. Biotechnol. 74 (1): 152-9 (2007). The siRNA sequence for LDHa and PDHKs is constructed in a single vector where siRNA for LDHa was under the control of the U6 promoter, while siRNAs for each PDHK was driven by Hl promoters (Figure 1). Generation of Stable Clones with Reduced Expression of

PDHKl, 2, 3, and LDHa

<img file="MX343604B_D0078.tif" />

ΙΜΡΪ

MEXICAN INSTITUTE Dt LA PROFISOAD INDUSTRIAL

The siRNA construct that targets PDHKs and LDHa is transfected into CHO cells expressing a monoclonal antibody to obtain individual clones named siRNA clones. Individual siRNA clones were assayed for mRNA expression of four genes, PDHK1, 2, 3 and LDHa, using Taqman analysis. Twelve siRNA clones exhibiting the majority of reduced expression of approximately four genes were identified (Figure 2) for further analysis. The mock vector containing disorganized sequence was also transfected into the same cells expressing antibody to obtain individual clones called mock clones.

Twelve sham clones were randomly selected as a control and their expression levels of LDHa and PDHK1 mRNA, 2, and 3 genes were also analyzed by Taqman. On average, mRNA expression levels for LDHa, PDHK1, 2, and 3 in twelve select siRNA clones were reduced by 90%, 32%, 83%, and 70% respectively compared to sham clones (Figure 2).

Feeding Shake Flask Evaluation by Batches of Simulated Clones and siRNA (a) Reduced Lactate Levels and High pHs in Medium

Culture Observed in siRNA Clones

To assess the effect of siRNA-mediated downregulation of LDHa and PDHKs on lactate production, 12 siRNA clones and 12 sham clones were evaluated in

<img file="MX343604B_D0079.tif" />

MkXICAN INSTITUTE l

Ot LA «σΠΕί, ΛΡ O» shake flask containers in nué'S't'fW- m &amp; sSfer ^ owned using a process άο.- ·· ^ · ^ 3 * ρ4 · ο · ¥ € ΐτι »τ? Ηί o · · É &lt;* · 14 days batch feed temperature. The experiment has been repeated three times and similar results were observed. The results of a set of experiments are illustrated as representative in the figures. The results showed that compared to sham clones, siRNA clones have reduced lactate levels (Figure 3) overall. On day 14, siRNA clones showed 91% less lactate on average than sham clones (p &lt;0.0001) (Figure 3A). Consistent with the lowest lactate level in siRNA clones over the 14-day production period, the average lactate production rate for siRNA clones was negative at 0.02 mg / 10⁶cells / day, suggesting that the rate of lactate synthesis is less than the rate of consumption. In contrast, the average lactate production rate was 0.01 mg / 10⁶ cells / day for simulated clones indicating that the rate of total lactate synthesis is higher than the rate of consumption. This difference in lactate production rate between simulated and siRNA clones was statistically significant (p &lt;0.002) (Figure 3B). Since the lactate level in the medium affects the pH, by day 14, the average pH for simulated clones fell to 6.54, while the average pH for siRNA clones was 7.04 (Figure 3C). The

100

<img file="MX343604B_D0080.tif" />

IMPI

INITITUTO MUICANO DI LA «OMKOAD INDUSTRIAL observed lower average pH agrees with higher average lactate level for simulated clones.

b) Increased Antibody and Productivity Title

Specific (Qp) Observed in siRNA Clones

To investigate whether gene expression blocking of PDHKs and LDHa affects antibody production, samples from batch-fed shake flask experiments were collected on days 3, 7, 10, and 14 to measure antibody titers by protein chromatography. TO. The data showed that on average siRNA clones produce 68% more antibody than sham clones (Figure 4A, p &lt;0.022), and average cell specific productivity (Qp) measured in pg / d-cell for siRNA clones was 75% higher. than for simulated clones (Figure 4B, p &lt;0.006). To assess cell growth, shake flask samples were collected on days 3, 7, 10, and 14 to measure viable cell counts and viabilities to calculate the integrated viable cell count (IVCC = Integrated Viable Cell Count). In contrast to antibody and Qps titers, no appreciable cell growth differences were observed between the two groups (Figure 4C). Antibody product quality attributes including glycan profile, loading variants, and percent aggregation were comparable between sham and siRNA clones.

Bioreactor Batch Feed Culture Evaluation

101

<img file="MX343604B_D0081.tif" />

ϊ

MEXICAN INSTITUTE OF IA PROPERTY of Simulated Clones siRNA, industrial

<img file="MX343604B_D0082.tif" />

Since pH-controlled batch-fed bioreactor culture is the standard downscaled model for large-scale manufacturing, the performance of some simulated clones and siRNAs in 2L bioreactors was further investigated. Given the limitation in bioreactor availability and experimental complexity, 12 siRNA clones and 12 simulated clones were not run because they were not practical. Two representative siRNA clones and two representative simulated clones whose metabolic profiles best represent the average performance for each group to minimize selection bias, along with the precursor line used for simulated plasmid transfections and siRNA for 2L bioreactor evaluation, were selected. Cell culture samples were collected daily (except days 6 and 13) for lactate, glucose, osmolality, and titer analysis. Lactate levels for siRNA clones generally remained flat while lactate levels for simulated and precursor clones continued to increase during the 14-day production period. On day 14, the two siRNA clones had an 86% lower lactate level on average than the simulated clones or precursor clones (Figure 5A) and had a lower rate of specific lactate production.

102

MEXICAN INSTITUTE 'í &amp; tess.Ceí' DF LA PROPIEDAD industrial

ΙΜΡΙ

MEXICAN INSTITUTE Dt LA FVOPSCAi '

INDUSTRIAL than the simulated clones and precursor line (Figure ~ 5B).

Similarly, the osmolalities for siRNA clones remained around 300 mOsm while the osmolalities for simulated clones or precursor clone continued to increase during the 14-day production period. On day 14, average osmolalities for 2 siRNA clones were 60% lower than those of the simulated and precursor clones (Figure 5C). Importantly, on day 14, the siRNA clones on average produced 125% more antibody than those of the sham clones (Figure 6). As seen in evaluation of batch-fed shake flask, simulated and siRNA clones have comparable cell growth and viability in 2L bioreactors.

Discussion

Previous study showed that downregulating LDHa gene expression was only able to reduce lactate production. Kim and Lee, Appl. Microbiol. Biotechnol.

74 (1): 152-9 (2007). However, in their study despite the 45-79% reduction in lactate level, there was no significant improvement in Qp and product title suggesting that blocking LDHa alone in CHO cells is not sufficient to improve Qp and performance of product efficiently. Furthermore, simultaneous downregulation of PDHK1, 2 and 3 in CHO cells was neither sufficient to reduce lactate level nor to increase antibody productivity.

103

ΙΜΡΙ

INSTITUTO MSXICANO Dt LA MOnSDAI »INDUSTRIAL

<img file="MX343604B_D0083.tif" />

Since the only way cells would generate lactate through pyruvate reduction, and pyruvate not only^- can be converted to lactate by LDH but also converted to acetyl-CoA by PDH which enters the TCA cycle to oxidize, reduce lactate production by blocking LDHa expression and promoting pyruvate in the TCA cycle by blocking PDHKs, can do synergy to reduce lactate level and provide cells with more energy and possibly metabolic intermediates leading to increased antibody production.

LDHa, PDHK2, and PDHK3 expression was reduced substantially and PDHK1 expression was moderately reduced in all tested clones. The moderate reduction in PDHKl expression is likely due to a non-optimal siRNA targeting sequence since a moderate reduction was observed with three PDHKl siRNA sequences tested. Variations in lactate production and antibody production in simulated clones and siRNA were observed, since each clone had different levels of expression of LDHa and PDHKs. However, on day 14, the average lactate level in the siRNA group was lower than in the sham group leading to a lower average pH for sham clones than for siRNA clones in batch-fed shake flask culture. More importantly, in addition to reducing the rate of specific lactate production, the average Qp titer

104 for siRNA clones increased by 68% and 75%

<img file="MX343604B_D0084.tif" />

comparison with those of clones simnlaHn &lt;; ςίη notable diigronriag in cell growth and product quality between simulated and siRNA clones. Interestingly, for day 14 titers versus day 14 lactate levels, there was a good inverse relationship between titers and lactate levels between sham clones, but not between siRNA clones. The observed differences in lactate titers and levels between sham clones may likely be that the parent clone is heterogeneous in antibody productivity and cell metabolism even though the cell line was derived from a single clone. A total of 12 simulated clones were evaluated to take into account clonal variation. The data indicates that blocking LDHa and PDHKs simultaneously reduces lactate level and improves antibody reduction in CHO cells. Therefore, for the development of robust and productive antibody production processes, a simultaneous down-regulation of both LDHa and PDHKs provides an efficient approach.

The performance of simulated clones and 2 siRNAs in 2L bioreactors with duplicates was further investigated. These 4 clones were selected to best represent average productivity in each group based on batch fed shake flask evaluations. Similar to the observations of the experiment

105

IMPI

INSTfTUT · MÍXICANO DI LA FROHÍDAD. INDUSTRIAL

<img file="MX343604B_D0085.tif" />

from the shake flask, the siRNA clones had lower lactate levels and higher titers ¿jllé ÍUS T.'Iuhl.j · simulated in 2L bioreactor evaluation. Since pH is controlled in batch-fed 2L bioreactors, all 5 simulated cultures exhibited increased osmolality than siRNA cultures since higher lactate levels in simulated clones require more alkali addition to maintain pH benchmark.

In summary, data from the batch-fed shake flask and 2L bioreactor evaluations showed that simultaneous blocking of LDHa, PDHK1, 2 and 3 in CHO cells is effective in reducing lactate level and increasing antibody titer without impacting the cell growth and product quality.

IMPI

<img file="MX343604B_D0086.tif" />

106