Tailored oils produced from recombinant heterotrophic microorganisms.
Abstract
Methods and compositions for the production of oil, fuels, oleochemicals, and other compounds in recombinant microorganisms are provided, including oil-bearing microorganisms and methods of low cost cultivation of such microorganisms. Microalgal cells containing exogenous genes encoding, for example, a lipase, a sucrose transporter, a sucrose invertase, a fructokinase, a polysaccharide-degrading enzyme, a keto acyl-ACP synthase enzyme, a fatty acyl-ACP thioesterase, a fatty acyl-CoA/aldehyde reductase, a fatty acyl-CoA reductase, a fatty aldehyde reductase, a fatty aldehyde decarbonylase, and/or an acyl carrier protein are useful in manufacturing transportation fuels such as renewable diesel, biodiesel, and renewable jet fuel, as well as oleochemicals such as functional fluids, surfactants, soaps and lubricants.

Term
4.7 yearsleft in the term
Expires 27 May 2031.
- Priority
- Filed
- Granted
- Today
- Expires
17 claims: 4 independent, 13 dependent
- 1REIVINDICACIONES IMPI WfTflWO mCX'Cawu O» LA THOHÍVAO INOUÍTRIAL 1. Una célula de microalga que comprende un ácido nucleico exógeno, en donde el ácido nucleico exógeno (a) codifica una enzima cetoacil-ACP sintasa o (b) interrumpe o regula descendentemente la expresión de una cetoacil-ACP sintasa endógena, en donde la célula de microalga es una célula del género Prototheca.
- 2La célula de la reivindicación 1, que además comprende uno o más ácidos nucleicos exógenos que codifican una acil-ACP tioesterasa, una sacarosa invertasa, o ambas.
- 3La célula de las reivindicaciones 1 o 2, que además comprende un ácido nucleico exógeno que interrumpe o regula descendentemente la expresión de una desaturasa endógena.
- 4La célula de la reivindicación 3, en donde la desaturasa endógena es seleccionada del grupo que consiste de estearoil ACP desaturasa y desaturasa de ácido graso delta 12.
- 5La célula de la reivindicación 2, en donde el uno o más ácidos nucleicos exógenos codifican una acil-ACP tioesterasa seleccionada del grupo que consiste de:acil graso-ACP tioesterasa de Umbellularia cali fornica (SEQ ID Nos. 203 o 285);434 IMPI l*WrUTO MEXICANO t>i LA MUPIEt AD INDUSTRIAL acil graso-ACP tioesterasa de . camphora (GenBank #Q39473 registrado el 9 febrero 2010);acil graso-ACP tioesterasa de Umbellularia cali fornica (GenBank #Q41635 registrado el 9 febrero 2010);5 acil graso-ACP tioesterasa de Myristica fragrans (SEQ ID Nos. 224 o 222);acil graso-ACP tioesterasa de Elaeis guineensis (SEQ ID NO:204 o GenBank #AAD42220 registrado el 11 marzo 2010);acil graso-ACP tioesterasa de Populus tomentosa (SEQ ID 10 NO:207);acil graso-ACP tioesterasa de Arabidopsis thaliana (SEQ ID NOS:208, 209 o 210) ;acil graso-ACP tioesterasa de Gossypium hirsutum (SEQ ID N0:211);15 acil graso-ACP tioesterasa de Cuphea lanceolata (SEQ ID NO:212);acil graso-ACP tioesterasa de Cuphea hookeriana (SEQ ID NO:202 o 197) ;acil graso-ACP tioesterasa de Cuphea calophylla subsp. 20 Mesostemon (SEQ ID NO:213);435 ΙΜΡΙ INSTITUTO MEXICANO DE LA PROP!feDAL> INDUSTRIAL acil graso-ACP tioesterasa de Cuphea lanceolata (GenBank #CAC19933 registrado el 15 noviembre 2006);acil graso-ACP tioesterasa de Elaeis guineensis (SEQ ID NO:2 0
- 66) ; acil graso-ACP tioesterasa de Gossypium hirsutum (SEQ ID NO:214);acil graso-ACP tioesterasa de Vitis vinífera (SEQ ID NO:215);acil graso-ACP tioesterasa de Garcinia mangostana 10 (GenBank #AAB51525 registrado el 30 noviembre 2009);acil graso-ACP tioesterasa de Brassica júncea (SEQ ID NO:216);acil graso-ACP tioesterasa de Madhuca longifolia (SEQ ID NO:217);15 acil graso-ACP tioesterasa de Brassica napus (GenBank #ABH11710 registrado el 15 agosto 2006);acil graso-ACP tioesterasa de Oryza sativa (SEQS ID NOS:218, 219 o 220);acil graso-ACP tioesterasa de Cuphea hookeriana (GenBank 20 #Q39513 registrado el 9 febrero 2010 o GenBank #AAC49269 registrado el 30 noviembre 2009);436 IMPI INSTmiTO MEXICANO r>E LA PROMBPAD INDUSTRIAL acil graso-ACP tioesterasa de Ulmus Americana (GenBank #AAB71731 registrado el 30 noviembre 2009);acil graso-ACP tioesterasa de Cuphea lanceolata (SEQ ID NO:221);5 acil graso-ACP tioesterasa de Cuphea palustris (GenBank #AAC49180 registrado el 30 noviembre 2009);acil graso-ACP tioesterasa de Iris germánica (GenBank #AAG43858 registrado el 11 marzo 2010 o GenBank #AA43858.1 registrado el 11 marzo 2010) ;10 acil graso-ACP tioesterasa de Cuphea palustris (GenBank #AAC49179 registrado el 30 noviembre 2009;acil graso-ACP tioesterasa de Myristica fragrans (GenBank #AA71729 registrado el 30 noviembre 2009 o GenBank #AAB71729.1 registrado el 30 noviembre 2009);15 acil graso-ACP tioesterasa de Cuphea wrightil (SEQ ID NO:183);acil graso-ACP tioesterasa de Ricinus communis (SEQ ID NO:198);y combinaciones de éstas. 20 6. La célula de la reivindicación 2, en donde el uno o más ácidos nucleicos exógenos comprenden un gen de tioesterasa 437 de Carthamus tinctorus (SEQ ID NO:253) IMPI DE LA PROPIEDAD INSTITUTO MEXICANO DE LA PROPIEDAD _±2&' J un gerí N W IA tio de Elaeis guiniensis (SEQ ID NO:261), un gen de tioesteráéá dff Cuphea hookeriana (SEQ ID NO: 94, 244, 259) o un gen de tioesterasa de Brassica napus(SEQ ID NO:255).
- 7La célula de la reivindicación 2, en donde el ácido nucleico exógeno comprende un gen KAS IV de Cuphea hookeriana (SEQ ID NO:246) y un gen FATB2 de Cuphea wrightii (SEQ ID NO:278) .
- 8La célula de la reivindicación 1, en donde el ácido 10 nucleico exógeno comprende una construcción diseñada para interrumpir un gen KAS II endógeno.
- 9La célula de la reivindicación 3, en donde el ácido nucleico exógeno comprende una combinación de un gen FATB2 de Cuphea wrightii (SEQ ID NO:278) y una construcción diseñada 15 para interrumpir un gen SAD2B endógeno.
- 10La célula de la reivindicación 3, en donde el ácido nucleico exógeno comprende una combinación de un gen de tioesterasa de U. californica (SEQ ID NO:92, 251, 285) y una construcción diseñada para interrumpir un gen SAD2B endógeno. 20
- 11La célula de la reivindicación 3, en donde el ácido nucleico exógeno comprende una combinación de un gen de 438 tioesterasa construcción de Garcinia mangostana diseñada para interrumpir (SEQ ID NO:253) una un gen SAD2B endógeno.
- 12La célula de la reivindicación 3, en donde el ácido nucleico exógeno comprende un gen de tioesterasa de U. americana (SEQ ID NO:93, 275) diseñado para interrumpir un gen SAD2B endógeno.
- 13La célula de cualquiera de las reivindicaciones 1-12, que es una célula seleccionada del grupo que consiste en Prototheca wickerhamii, Prototheca stagnora, Prototheca portoricensis, Prototheca moriformis, and Prototheca zopfii.
- 14La célula de la reivindicación 13, que es una célula de la especie Prototheca moriformis.
- 15La célula de cualquiera de las reivindicaciones 1 a 14, en donde el(los) ácido(s) nucleico (s) exógeno(s) son optimizados en su codón para la expresión en Prototheca.
- 16Un método para producir una composición de aceites triglicéridos de microalgas, que comprende:a. cultivar una población de células de microalgas de acuerdo con cualquiera de las reivindicaciones 1 a 15 en un medio de cultivo y b. aislar la composición de aceites triglicéridos de 439 microalgas de las células de microalgas.
- 17Un método para hacer un producto con base de aceite, el método comprende:a. someter la composición de aceites triglicéridos de microalgas de la reivindicación 16 a por lo menos una reacción química seleccionada del grupo que consiste en: saponificación;metátesis;hidrólisis ácida;hidrólisis alcalina;hidrólisis enzimática;hidrólisis catalítica;hidrólisis con agua comprimida caliente;una reacción de hidrólisis catalítica en donde el lipido se separa en glicerina y ácidos grasos;una reacción de aminación para producir compuestos de nitrógeno grasos;una reacción de ozonólisis para producir ácidos mono y dibásicos;una reacción de separación de triglicéridos seleccionada del grupo que consiste de separación enzimática y separación por presión;una reacción de condensación que sigue una reacción de hidrólisis;una reacción de hidroprocesamiento;una reacción de hidroprocesamiento y una reacción de desoxigenación o una reacción de condensación antes de o simultánea a la reacción de hidroprocesamiento;una reacción de eliminación de gas;una reacción de desoxigenación seleccionada del grupo que consiste de una reacción de hidrogenólisis, hidrogenación, una reacción 440 de hidrogenación-hidrogenólisis consecutiva, una reacción de hidrogenólisis-hidrogenación consecutiva, y una reacción de hidrogenación-hidrogenólisis combinada;una reacción de condensación siguiendo una reacción de desoxigenación;una 5 reacción de esterificación;una reacción de interesterificación;una reacción de transesterificación;una reacción de hidroxilación;y una -reacción de condensación siguiendo una reacción de hidroxilación;b. aislar el producto de la reacción. 10 18. El método de la reivindicación 17, en donde los productos con base de aceite se seleccionan del grupo que consiste en: jabón, combustible, fluido dieléctrico, fluido hidráulico, plastificante, lubricante, fluido de transferencia de calor y fluido de trabajo de metales. 15 19. El método de la reivindicación 17, en donde el producto con base de aceite es un producto de combustible seleccionado del grupo que consiste en biodiesel, diésel renovable y combustible de reactor. 441 para la
Independent claims17
3,771 paragraphs in 321 sections, as filed
(54) Title: SPECIFIC OILS PRODUCED FROM RECOMBINANT HETEROTROPHIC MICROORGANISMS.
(54) Title: TAILORED OILS PRODUCED FROM RECOMBINANT HETEROTROPHIC MICROORGANISMS.
(57) Summary
The present invention relates to a microalgae cell comprising an exogenous nucleic acid, wherein the exogenous nucleic acid (a) encodes a ketoacyl-ACP synthase enzyme or (b) disrupts or down-regulates the expression of an endogenous ketoacyl-ACP synthase , where the microalgae cell is a cell of the genus Prototheca. Methods and compositions are provided for the production of oil, fuels, oleochemicals, and other compounds in recombinant microorganisms, including oil-bearing microorganisms, and low-cost culture methods of such microorganisms. Microalgae cells containing exogenous genes encoding, for example, a lipase, a sucrose transporter, a sucrose invertase, a fructokinase, a polysaccharide-degrading enzyme, a ketoacyl-ACP synthase enzyme, an acyl-ACP thioesterase fat, a acyl-CoA / fatty aldehyde reductase, a fatty aldehyde decarbonylase and / or an acyl carrier protein are useful in the manufacture of transportation fuels, such as renewable diesel, biodiesel and renewable jet fuel, as well as oleochemicals, such as functional fluids, surfactants, soaps and lubricants.
(57) Abstract
Methods and compositions for the production of oil, fuels, oleochemicals, and other compounds in recombinant microorganisms are provided, including oil-bearing microorganisms and methods of low cost cultivation of such microorganisms. Microalgal cells containing exogenous genes encoding, for example, a lipase, a sucrose transporter, a sucrose invertase, a fructokinase, a polysaccharide-degrading enzyme, a keto acyl-ACP synthase enzyme, a fatty acyl-ACP thioesterase, a fatty acyl-CoA / aldehyde reducíase, a fatty acyl-CoA reductase, a fatty aldehyde reductase, a fatty aldehyde decarbonylase, and / or an acyl carrier protein are useful in manufacturing transportation fuels such as renewable diesel, biodiesel, and renewable jet fuel, as well as oleochemicals such as functional fluids, surfactants, soaps and lubricants.
Institute
Mexican Property
Industrial iIh
<img file="MX339639B_D0001.tif" />
PATENT TITLE NO. 339639
Headlines):
Home:
Denomination:
Classification:
Inventor (s):
SOLAZYME, INC,
225 Gateway Boulevard, South San Francisco, California, 94080, USA,
SPECIFIC OILS PRODUCED FROM RECOMBINANT HETEROTROPHIC MICROORGANISMS.
lnt.CI.8: C10L1 / 02: C10M101 / 04; C12N1 / 13: C12N15 / 09: C12N15 / 74: C12P7 / 64
SCOTT FRANKLIN: ARAVIND SOMANCHI; JANICE WEE: GEORGE RUDENKO; JEFFREY L. MOSELEY: WALT RAKITSKY
REQUEST
Numbers
MX / a / 2012/013777
International filing deadline: May 27, 2011
PRIORITY
Country:
US
US
US
US
Date:
May 2010, „August 18, 2010November 16, 2010 December 29, 2010
Number:
61/349,774
61/374,992
61/414,393
61/428,192
- * - s
- | W ψ A!
Validity: Twenty years · Expiration Date: May 27, 2031 • r '' '..................' <sup>1</sup>
The% jj> reference attempt is granted based on articles · V, 3 * fraction V, 6th useful fraction, and SS of the Industrial Property Law.
D # in accordance with article 23 of the Industrial Property Law, cost from the date of preseeation of the sotidhjjSJnternai dapchos. - 'the patent has a validity of twenty non-expendable years, it will be subject-toLpsoóWla' 'Sarita to keep people il. : Yes' -ST
Qaten subscribes this Bulo does so based on the dtapueato by the aniorios O tracciones III and 7 ° bis 2 of the Industrial Property Law (Diario flfici al déte Federación (DOF) 06/27/1991, réfcrtwWtalf 02 / Ó8 / 1994, 10/25/1996, 12/26/1997, 07/05/1999, ^ WWSOS ^ · - ^<sup>72006</sup>Attraction V
07/01/2002, 07/15/2004, 07/28/2004 and 09/07/2007); Articles 1, 3, 4, 5, section V, subsection a), 16 sections I and III and 30 of the Organic Statute of the Mexican Institute of Industrial Property (DOF) 12/27/1999, amended on 10/10/2002, 07/29/2004, 08/04/2004 and 09/13/2007); 1, 3 and 5, subsection a) of the Agreement that delegates powers to the Deputy Directors General, Coordinator, Divisional Directors, Heads of Regional Offices, Divisional Deputy Directors, Departmental Coordinators and other subordinates of the Mexican Institute of Industrial Property. (DOF 12/15/1999, amended on 02/04/2000, 07/29/2004, 08/04/2004 and 09/13/2007).
Issue Date: June 2, 2016
<img file="MX339639B_D0002.tif" />
<img file="MX339639B_D0003.tif" />
33763*,
SPECIFIC OILS PRODUCED 1Γ START LIR - RECOMBINANT HETEROTROPHIC MICROORGANISMS
CROSS REFERENCE TO RELATED REQUESTS
This application claims the benefit under 35 USC
119 (e) of the United States provisional patent application
United no. 61 / 349,774, filed May 28, 2010, U.S. Provisional Patent Application No.
61 / 374,992, filed August 18, 2010, U.S. Provisional Patent Application No. 61 / 414,393, filed on November 16, 2010, and U.S. Provisional Patent Application No. 61 / 428,192, filed on December 2010. Each of these applications is incorporated herein by reference in its entirety for all purposes.
REFERENCE TO THE SEQUENCE LISTING
This application includes a sequence listing shown on pages 1-195, attached hereto.
FIELD OF THE INVENTION v
The present invention relates to the production of oils, fuels, and oleochemicals prepared from microorganisms. In particular, the description relates
IMPI
IA FRCWEOAR 'WllSTRIAL
<img file="MX339639B_D0004.tif" />
of tools, including cranberries. aldehydes.
with oleaginous microalgae, the same methods for the production of lipid compounds, fatty acid esters, alcohol acids, and alkanes, as well as methods and reagents to genetically modify them with the aim of improving production efficiency and modifying the type and composition of the oils they produce.
BACKGROUND OF THE INVENTION
Fossil fuel is a general term for buried geological fuel deposits of organic materials, formed from rotting plants and animals that have been converted to crude oil, coal, natural gas, or heavy oils from exposure to heat and pressure in the bark. of the earth for billions of years.
Fossil fuels are a finite, non-renewable resource.
The increase in energy demand by the global economy has also brought increased pressure on the cost of hydrocarbons. Aside from energy, many industries, including plastics and chemical manufacturers, rely heavily on the availability of hydrocarbons as a raw material for their manufacturing processes. Cost-effective alternatives to current sources of
<img file="MX339639B_D0005.tif" />
Supply could help mitigate the upward pressure on energy and raw material costs.
PCT publication no. 2008/151149 describes methods and materials for cultivating microalgae for oil production and particularly exemplifies the production of diesel fuel from oil produced by Chlorella protothecoides microalgae. There remains a need for improved methods of producing oil in microalgae, particularly methods that produce oils with shorter chain lengths and a higher degree of saturation and without pigments, with increased performance and efficiency. The present invention satisfies this need.
SUMMARY OF THE INVENTION
The present invention provides oil-bearing microbial cells, preferably microalgae cells, that have different lipid profiles, and includes recombinant cells that express exogenous genes encoding proteins such as acyl fatty-ACP thioesterases. The present invention further provides methods for preparing lipids and oil-based products, including fuels such as biodiesel, renewable diesel, and reactor fuel, from such cells.
<img file="MX339639B_D0006.tif" />
IMPIOUS"
In a first aspect, the present invention provides oil-bearing microbial cells, preferably microalgae cells, that have a lipid profile that is at least
1% or at least 5%, preferably at least 3%, C8: 0. In some cases, the lipid profile is at least 10% or at least 15%, preferably at least 12%, C8: 0. In some embodiments, the cell is a recombinant cell. In some cases, the recombinant cell comprises an exogenous gene encoding an acyl-ACP thioesterase protein that has hydrolysis activity towards C8 chain length acyl fatty substrates. In some embodiments, exogenous genes encode an acyl-ACP thioesterase Cuphea palustris. In some cases, the cell is a cell
Prototheca. In some cases, the cell is from a genus or species of microalgae selected from the microalgae identified in Table 1.
In a second aspect, the present invention provides oleaginous microbial cells, preferably microalgae cells, that have a lipid profile that is at least 4% C10: 0. In some cases, the lipid profile is at least 20%, at least 25%, or at least 30%, preferably at least 24%, C10: 0. In some cases, the ratio of C10: 0 to
C12: 0 is at least 6: 1. In some embodiments, the cell is a recombinant cell. In some cases, the recombinant cell comprises an exogenous gene encoding an acyl-ACP thioesterase protein that has hydrolysis activity towards CIO chain length acyl fatty-ACP substrates. In some embodiments, exogenous genes encode an acyl-ACP thioesterase protein from a species selected from the group consisting of Cuphea hookeriana and Ulmus americana. In some cases, the cell is a Prototheca cell. In some embodiments, the cell is from a genus or species selected from the microalgae identified in Table 1.
In a third aspect, the present invention provides oil-bearing microbial cells, preferably microalgae cells, that have a lipid profile that is at least
10% or at least 15%, preferably at least 13%, C12: 0. In some cases, the lipid profile is at least 30%, at least
35% or at least 4 0%, preferably at least 34%, C12-.0. In some cases, the ratio of C12 to C14 is at least 5: 1. In some cases, the cell is a recombinant cell. In some embodiments, the recombinant cell comprises an exogenous gene encoding an acyl-ACP thioesterase protein that has hydrolysis activity towards C12 chain length acyl fatty-ACP substrates. In some cases, the
ΙΜΡΙ
MEXICAN INSTITUI
<img file="MX339639B_D0007.tif" />
Df. IA INDUSTRIAL PROPERTY
<img file="MX339639B_D0008.tif" />
encode acyl-ACP thioesterase proteins from
Umbellularia californica and Cinnamomum camphora that have hydrolysis activity towards C12 chain length acyl fatty substrates. In some embodiments, the cell is a Prototheca cell.
In a fourth aspect, the present invention provides oleaginous microbial cells, preferably microalgae cells, that have a lipid profile that is at least
5% or at least 15%, preferably at least 10%, C14: 0. In some cases, the lipid profile is at least 40%, at least
45%, or at least 50%, preferably at least 43%, C14: 0. In some cases, the ratio of C14: 0 to C12: 0 is at least 7: 1.
In some cases, the cell is a recombinant cell. In some embodiments, the recombinant cell comprises an exogenous gene encoding an acyl-ACP thioesterase protein that has hydrolysis activity towards C14 chain length acyl fatty-ACP substrates. In some embodiments, the acyl-ACP thioesterase protein is from a species selected from the group consisting of Cinnamomum camphora and
Ulmus americana. In some cases, the cell is a cell
Prototheca. In some embodiments, the cell is of a
<img file="MX339639B_D0009.tif" />
IMPI
IkJíTiTi itc utrir »κιλ genus or species selected from the mirmaigag idpnt-ί f-icadas in Table 1.
In a fifth aspect, the present invention provides oil-bearing microbial cells, preferably microalgae cells, that have a lipid profile that is at least
10% or at least 20%, preferably at least 15%, C16: 0. In some cases, the lipid profile is at least 30%, at least
35% or at least 40%, preferably at least 37%, C16: 0. In some cases, the cell is a recombinant cell. In some embodiments, the recombinant cell comprises an exogenous gene encoding an acyl-ACP thioesterase protein that has hydrolysis activity towards C16 chain length acyl fatty-ACP substrates. In some embodiments, the recombinant cell comprises at least two exogenous genes encoding the acyl-ACP thioesterase protein of
Umbellularia cali fornica and Cinnamomum camphora that have hydrolysis activity towards C16 chain length acyl fatty substrates. In some cases, the cell is a Prototheca cell.
In a sixth aspect, the present invention provides oil-bearing microbial cells, preferably microalgae cells, that have a lipid profile that is at least
55% or at least 65%, preferably at least 60%, acids
IMPI
MEXICAN INSTITUTE Dt IA PROPERTY
INDUSTRIAL
<img file="MX339639B_D0010.tif" />
saturated fatty. In some cases the cells have a lipid profile that is at least 80%, at least 85%, or at least 90%, preferably at least 86%, saturated fatty acids. In some cases, the cell is a recombinant cell. In some embodiments, the recombinant cell comprises an exogenous gene encoding an acyl-ACP thioesterase protein that has hydrolysis activity towards C10C16 chain length acyl fatty-ACP substrates. In some embodiments, the cell comprises an exogenous gene that encodes a ketoacyl synthase protein. In some cases, the cell is a Prototheca cell.
In a seventh aspect, the present invention provides oil-bearing microbial cells, preferably microalgae cells, comprising a mutated endogenous desaturase gene, wherein the mutation inactivates the gene or desaturase. In some cases, the cell has a lipid profile that is at least 4 0% or at least 50%, preferably at least 45%, saturated fatty acids. In some cases, the cell has a lipid profile that is at least 15%, at least 20%, or at least 25%, preferably at least 19%,
C18: 0. In some embodiments, the cell comprises a mutated endogenous desaturase gene that results in at least a 2-fold increase in C18: 0 fatty acid, compared to a
<img file="MX339639B_D0011.tif" />
wild cell. In some cases, the microalgae cell has a lipid profile that is not greater than 1% or not greater than 5%, preferably not greater than 2%, C18: 2. In some embodiments, the microalgae cell has a lipid profile that is not greater than 5% or not greater than 10%, preferably not greater than 7%, 18: 1.
In some embodiments of the recombinant cells discussed in the present disclosure, the cell comprises a mutated endogenous desaturase gene, wherein the mutation inactivates the gene or desaturase.
In an eighth aspect, the present invention provides a method of preparing lipids. In one embodiment, the method comprises (a) culturing a cell as discussed above until the cell is at least 15% or at least
25%, preferably at least 20%, lipid by dry weight, and (b) separating the lipid from the water soluble biomass components.
In a ninth aspect, the present invention provides another method for preparing lipids. In one embodiment, the method comprises (a) cultivating an oil-bearing microbe, preferably a microalgae cell, containing exogenous genes encoding two distinct acyl-ACP thioesterases, wherein the lipid profile of the cell is distinct from (i)
<img file="MX339639B_D0012.tif" />
IMPI
MEXICAN INSTITUTE Dt LA PtOPlEOAO iNOUSTlIAl.
the cell profile without the exogenous genes and (ii) the cell profile with only one of the exogenous genes, and (b) separating the lipid from the water soluble biomass components. In some cases, at least one of the exogenous genes encodes an acyl fatty ACP thioesterase selected from the group consisting of the thioesterases identified in Table 4.
In a tenth aspect, the present invention provides a method of preparing an oil-based product. In one embodiment, the method comprises (a) culturing a cell as discussed above until the cell is at least 5% or at least 15%, preferably at least 10%, lipid by dry weight, (b) separating the lipid from the water soluble biomass components, and (c) subjecting the lipid to at least one chemical reaction selected from the group consisting of:
saponification; metathesis; acid hydrolysis; alkaline hydrolysis; enzymatic hydrolysis; catalytic hydrolysis;
hydrolysis with hot compressed water; a catalytic hydrolysis reaction where the lipid is separated into glycerin and fatty acids; an amination reaction to produce fatty nitrogen compounds; an ozonolysis reaction to produce mono and dibasic acids; a triglyceride separation reaction selected from
MEXICAN INSTITUTE
OF THE FRDFIEDAP
INDI ISTRIAI.
group consisting of enzymatic separation and pressure separation; a condensation reaction that follows a reaction
<td>hydrolysis;</td><td>a reaction</td><td>of</td><td>hydroprocessing;</td><td>a</td>
<td>reaction of</td><td colspan="2">hydroprocessing</td><td>and a reaction</td><td>of</td>
<td>deoxygenation</td><td>or a reaction</td><td>of</td><td>condensation before</td><td>of or</td>
simultaneous to the hydroprocessing reaction; a gas elimination reaction; a deoxygenation reaction selected from the group consisting of a hydrogenolysis reaction, hydrogenation, a consecutive hydrogenation hydrogenation reaction, a consecutive hydrogenolysis and hydrogenation reaction, and a combined hydrogenation hydrogenation reaction; a condensation reaction following a deoxygenation reaction; an esterification reaction; an interesterification reaction; a transesterification reaction; a hydroxylation reaction; and a condensation reaction following a hydroxylation reaction, whereby an oil-based product is produced.
In some cases, the oil-based product is selected from soap or a combustible product. In some embodiments, the oil-based product is a fuel product selected from the group consisting of biodiesel, renewable diesel, and jet fuel. In some
IM ----
<img file="MX339639B_D0013.tif" />
INSTITUTO MEXICANO Dt LA EROflEDAD cases, the fuel product is biodiesel with one or more of the following attributes: (i) 0.01-0.5 mcg / g, 0.025-0.3 mcg / g, preferably 0.05-0.244 mcg / g, total carotenoids; (ii) less than 0.01 mcg / g, less than 0.005 mcg / g, preferably less than 0.003 mcg / g, lycopene; (iii) less than 0.01 mcg / g, less than 0.005 mcg / g, preferably less than 0.003 mcg / g, beta carotene; (iv) 0.01-0.5 mcg / g, 0.0250.3 mcg / g, preferably 0.045-0.268 mcg / g, chlorophyll A; (v) 1-500 mcg / g, 35-175 mcg / g, preferably 38.3-164 mcg / g, gamma tocopherol; (vi) less than 1%, less than 0.5%, preferably less than 0.25%, brassicasterol, campesterol, stignasterol, or beta-sitosterol; (vii) 100-500 mcg / g, 225350 mcg / g, preferably 249.6-325.3 mcg / g, total tocotrienols; (viii) 0.001-0.1 mcg / g, 0.0025-0.05 mcg / g, preferably 0.003-0.039 mcg / g, lutein; or (ix) 10-500 mcg / g, 50-300 mcg / g, preferably 60.8-261.7 mcg / g, tocopherols. In some cases, the fuel product is renewable diesel that has a T10-T90 of at least 20 ° C, 40 ° C, or 60 ° C. In some cases, the fuel product is reactor fuel that meets HRJ-5 and / or ASTM specification D1655.
In an eleventh aspect, the present invention provides a triglyceride oil comprising (a) a lipid profile
IM
<img file="MX339639B_D0014.tif" />
INSTITUTO MEXICANO DE LA mOHBDAO of at least 3% C8: 0, at least 4% C10: 0, at least 13% C12: 0, at least 10% C14: 0, and / or at least 60% saturated fatty acids, and (b) one or more of the following attributes: (i)
0.01-0.5 mcg / g, 0.025-0.3 mcg / g, preferably 0.05-0.244 5 mcg / g, total carotenoids; (ii) less than 0.01 mcg / g, less than 0.005 mcg / g, preferably less than 0.003 mcg / g, lycopene; (iii) less than 0.01 mcg / g, less than 0.005 mcg / g, preferably less than 0.003 mcg / g, beta carotene; (iv)
0.01-0.5 mcg / g, 0.025-0.3 mcg / g, preferably 0.045-0.268 10 mcg / g, chlorophyll A; (v) 1-300 mcg / g, 35-175 mcg / g, preferably 38.3-164 mcg / g, gamma tocopherol; (vi) less than 1%, less than 0.5%, preferably less than 0.25%, brassicasterol, campesterol, stignasterol, or beta-statosterol; (vii) 100-500 mcg / g, 225-350 mcg / g, preferably 249.6-325.3 mcg / g, total tocotrienols;
(viii) 0.001-0.1 mcg / g, 0.0025-0.05 mcg / g, preferably
0.003-0.039 mcg / g, lutein; or (ix) 10-500 mcg / g, 50-300 mcg / g, preferably 60.8-261.7 mcg / g, tocopherols.
In a twelfth aspect, the present invention provides an isolated microalgae oil having a C8: C10 fatty acid ratio of at least 5: 1. In a related aspect, the present invention provides an oil isolated from microalgae with at least 50% to 75%,
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL preferably at least 60%, of saturated fatty acids. In another related aspect, the present invention provides an isolated microalgae oil having a C16: 14 fatty acid ratio of about 2: 1. In yet another related aspect, the present invention provides an isolated microalgae oil having a C12-.C14 fatty acid ratio of at least 5: 1. In some embodiments, the microalgae contains at least one exogenous gene. In some cases, the microalgae is of the genus Prototheca.
In a thirteenth aspect, the present invention provides a triglyceride oil comprising (a) a lipid profile of less than 5% or less than 2%, preferably less than 1%, <C12; between l% -10%, preferably 2% -7%, C14: 0; between 20% -35%, preferably
23% -30%, C16: 0; between 5% -20%, preferably 7% -15%, C18: 0;
between 35-60%, preferably 40-55%, C18: 1; and between l -20%, preferably 2-15%, C18: 2 fatty acids; and (b) one or more of the following attributes: (i) 0.01-0.5 mcg / g, 0.025-0.3 mcg / g, preferably 0.05-0.244 mcg / g, total carotenoids; (ii) less than 0.01 mcg / g, less than 0.005 mcg / g, preferably less than 0.003 mcg / g, lycopene; (iii) less than 0.01 mcg / g, less than 0.005 mcg / g, preferably less than 0.003 mcg / g, beta carotene; (iv) 0.01-0.5 mcg / g, 0.02515
IMPI
MEXICAN INSTITUTE OF f, A PROPERTY INDI 15TR1AI.
<img file="MX339639B_D0015.tif" />
0.3 mcg / g, preferably 0.045-0.268 mcg / g, chlorophyll A; (v) 1-300 mcg / g, 35-175 mcg / g, preferably 38.3-164 mcg / g, gamma tocopherol; (vi) less than 1%, less than 0.5%, preferably less than 0.25%, brassicasterol, campesterol, 5 stignasterol, or beta-sitosterol; (vii) 100-500 mcg / g, 225350 mcg / g, preferably 249.6-325.3 mcg / g, total tocotrienols; (viii) 0.001-0.1 mcg / g, 0.0025-0.05 mcg / g, preferably 0.003-0.039 mcg / g, lutein; or (ix) 10-500 mcg / g, 50-300, preferably 60.8-261.7 mcg / g, tocopherols. 10 In some cases, triglyceride oil is isolated from a microbe that comprises one or more exogenous genes. In some embodiments, the one or more exogenous genes encode an acyl fatty-ACP thioesterase. In some cases, acyl fatty acp thioesterase has hydrolysis activity towards C14 chain length acyl fatty acp substrates. In some embodiments, the microbe further comprises a mutated endogenous desaturase gene, where the mutation inactivates the gene or desaturase.
In a fourteenth aspect, the present invention provides a method of producing a triglyceride oil comprising a lipid profile of less than 5%, or less than 2%, preferably less than 1%, <C12; between l% -10%, preferably 2% -7%, C14: 0; between 20% -35%, preferably
<img file="MX339639B_D0016.tif" />
iMPir
23% -30%, C16: 0; between 5% -20%, preferably 7% -15%, C18: 0;
between 35% -60%, preferably 40-55%, C18: 1; and between l -20%, preferably 2-15%, C18: 2 fatty acids, where the triglyceride oil is isolated from a microbe comprising one or more exogenous genes. In some cases, the triglyceride oil comprises a lipid profile of 1-10%, preferably 3-5%, C14: 0; 20% -30%, preferably 25-27%,
C16: 0; 5% -20%, preferably 10-15%, C18: 0; and 35% -50%, preferably 40-45%, C18: 1. In some embodiments, the one or more exogenous genes encode an acyl fatty-ACP thioesterase. In some cases, acyl fatty acp thioesterase has hydrolysis activity towards C14 chain length acyl fatty acp substrates. In some cases, the microbe further comprises a mutated endogenous desaturase gene, where the mutation inactivates the gene or desaturase. In some cases, the one or more exogenous genes are a sucrose invertase. In some embodiments, the mutated endogenous desaturase gene is a stearoyl-acyl-bearing desaturase protein (SAD) (eg, seq.
199-200). In some embodiments, the mutated endogenous desaturase gene is a fatty acid desaturase (FAD).
In a fifteenth aspect, the present invention provides an oil microbial cell, preferably
ΙΜΡΙ
MfcXlCAN · OS INSTITUTE THE INOI ISTRIAL PROPERTY
<img file="MX339639B_D0017.tif" />
a microalgae cell, comprising a triglyceride oil, wherein the fatty acid profile of the triglyceride oil is selected from the group consisting of at least about 1% C8: 0, at least about 1%
C10: 0, at least about 1% C12: 0, at least about 2% C14: 0, at least about 30% C16: 0, at least about 5% C18: 0, at least about 60% C18: l, less than about 7% C18: 2, and at least about 35% saturated fatty acids. In some cases, the oil microbial cell comprises an exogenous gene, and optionally, an endogenous oil microbial cell desaturase is inactivated or mutated to have less enzyme activity.
In some cases, the fatty acid profile of triglyceride oil is similar to the fatty acid profile of a naturally occurring oil. In some cases, oil of natural origin is selected from the group consisting of cocoa butter, coconut oil, palm oil, palm kernel oil, shea butter, bait, and beef butter.
In some cases, the fatty acid profile of triglyceride oil comprises a profile selected from the group consisting of, the total combined amounts of C8: 0 and
CIO: 0 is at least about 10%, the total amount
<img file="MX339639B_D0018.tif" />
Combined IMPI of C10: 0, C12: 0, and C14: 0 is at least about 50%, the total combined amount of C16: 0,
C18: 0 and C18: 1 is at least about 60%, the combined total amount of C18: 0, C18: l and C18.-2 is at least about 60%, the combined total amount of C14: 0,
C16: 0, C18: 0, and C18: 1 is at least about 60%, and the combined total amount of C18: 1 and C18: 2 is less than about 30%. In some cases, the fatty acid profile of triglyceride oil comprises a ratio of fatty acids selected from the group consisting of ratio
C8: 0 to C10: 0 of at least about 5 to 1, CIO: 0 to C12: 0 ratio of at least about 6 to 1, ratio
C12: 0 to C14: 0 of at least about 5 to 1, ratio
C14: 0 to C12: 0 of at least about 7: 1, and ratio
C14: 0 to C16: 0 of at least about 1 to 2.
In some cases, the endogenous desaturase is selected from the group consisting of stearoyl ACP desaturase and delta 12 fatty acid desaturase. In some cases, the exogenous gene is selected from the group consisting of a gene encoding an acyl-ACP thioesterase. In some cases, the exogenous gene encodes an acyl-ACP thioesterase selected from the group consisting of those identified in Table 4. In some cases, the microbial cell
<img file="MX339639B_D0019.tif" />
IMPI
INSTITUTO MEXICANO DE LA RROHEDAU INDUSTRIAL oleaginosa also includes a gene that encodes a sucrose invertase.
In various embodiments, the oil microbial cell is a cell of a microalgae genus or species selected from Achnanthes orientalis, Agmenellum,
Amphiprora hyaline, Amphora coffeiformis, Amphora coffeiformis linea, Amphora coffeiformis punctata, Amphora coffeiformis taylori, Amphora coffeiformis tenuis, Amphora delicatissima, Amphora delicatissima capitata, Amphora sp.,
Anabaena, Ankistrodesmus, Ankistrodesmus falcatus, Boekelovia hooglandií, Borodinella sp., Botryococcus braunii,
Botryococcus sudeticus, Cartería, Chaetoceros gracilis,
Chaetoceros muelleri, Chaetoceros muelleri subsalsum,
Chaetoceros sp. , Chlorella anitrata, Chlorella Antarctica,
Chlorella aureoviridis, Chlorella candida, Chlorella capsúlate, Chlorella desiccate, Chlorella ellipsoidea,
Chlorella emersonii, Chlorella fusca, Chlorella fusca var.
vacuolata, Chlorella glucotropha, Chlorella infusionum,
Chlorella infusionum var. actophila, Chlorella infusionum var. auxenophila, Chlorella kessleri, Chlorella lobophora (strain SAG 37.88), Chlorella luteoviridis, Chlorella luteoviridis var. aureoviridis, Chlorella luteoviridis var.
lutescens
Chlorella miniata
Chlorella minutissima
<img file="MX339639B_D0020.tif" />
IMPI
INSTITUTO MEXICANO DE IA PROPIEDAD INCIIISTPIAI.
Chlorella mutabilis, Chlorella nocturnal, Chlorella parva,
Chlorella photophila, Chlorella pringsheimii, Chlorella protothecoid.es (which includes any strain of UTEX 1806, 411,
264, 256, 255, 250, 249, 31, 29, 25, and CCAP strains 211/17 and
211 / 8d), Chlorella protothecoides var. acidicola, Chlorella regularis, Chlorella regularás var. minimal, Chlorella regularas var. umbricata, Chlorella reisiglii, Chlorella saccharophila, Chlorella saccharophila var. elllpsoidea,
Chlorella salina, Chlorella simplex, Chlorella sorokiniana,
Chlorella sp., Chlorella sphaerica, Chlorella stigmatophora,
Chlorella vanniellii, Chlorella vulgaris, Chlorella vulgaris,
Chlorella vulgaris f. tertia, Chlorella vulgaris var.
autotrophica, Chlorella vulgaris var. viridis, Chlorella vulgaris var. vulgaris, Chlorella vulgaris var. vulgaris f.
tertia, Chlorella vulgaris var. vulgaris f. viridis,
Chlorella xanthella, Chlorella zofingiensis, Chlorella trebouxioides, Chlorella vulgaris, Chlorococcum infusionum,
Chlorococcum sp., Chlorogonium, Chroomonas sp., Chrysosphaera sp., Cricosphaera sp., Cryptomonas sp., Cyclotella cryptica,
Cyclotella meneghiniana, Cyclotella sp., Dunaliella sp.,
Dunaliella bardawil, Dunaliella bíoculata, Dunaliella granulate, Dunaliella maritime, Dunaliella minuta, Dunaliella parva, Dunaliella peircei, Dunaliella primolecta, Dunaliella
ΙΜΡΙ
INSTITI IT »MEXICAN» E LA ΑΑΟΓΙΑΟΑΓ
INH.imiAl
<img file="MX339639B_D0021.tif" />
saline, Dunaliella terrícola, Dunaliella tertiolecta,
Dunaliella viridis, Dunaliella tertiolecta, Eremosphaera viridis, Eremosphaera sp., Ellipsoidon sp., Euglena, Franceia sp., Fragilaria crotonensis, Fragilaria sp. Gleocapsa sp. ,
Gloeothamnion sp. Hymenomonas sp. , Isochrysis aff. galbana,
Isochrysis galbana, Lepocinclis, Micractinium, Micractinium (UTEX LB 2614), Monoraphidium minutum, Monoraphidium sp. ,
Nannochloris sp., Nannochloropsis salina, Nannochloropsis sp., Navicula acceptata, Navicula biskanterae, Navicule pseudotenelloides, Navicule pelliculosa, Navicula saprophila,
Navicula sp., Nephrochloris sp. , Nephroselmis sp., Nitschia communis, Nitzschia alexandrina, Nitzschia communis,
Nitzschia dissipata, Nitzschia frustulum, Nitzschia hantzschiana, Nitzschia inconspicua, Nitzschia intermedia,
Nitzschia microcephala, Nitzschia pusilla, Nitzschia pusilla elliptica, Nitzschia pusilla monoensis, Nitzschia quadrangular, Nitzschia sp. , Ochromonas sp., Oocystis parva,
Oocystis pusilla, Oocystis sp., Oscillatoria limnetica,
Oscillatoria sp., Oscillatoria subbrevis, Pascheria acidophila, Pavlova sp. , Phagus, Phormidium, Platymonas sp. ,
Pleurochrysis portfolio, Pleurochrysis dentate, Pleurochrysis sp., Prototheca wickerhamii, Prototheca stagnora, Prototheca portoricensis, Prototheca moriformis, Prototheca zopfii
IMPI
MEXICAN INSTRUMENT OR THE INDUSTRIAL COMPANY
<img file="MX339639B_D0022.tif" />
Pyramimonas
Scenedesmus sp. , Pyrobotrys, Sarcinoid chrysophyte, armatus, Spirogyra, Spirulina platensis,
Stichococcus sp. Synechococcus sp. , Tetrahedra, Tetraselmis sp., Tetraselmis suecica, Thalassiosira weissflogii, and
Viridiella fridericiana.
In some cases, the oil microbial cell is a cell of the genus Prototheca. In some cases, the oil microbial cell is a cell of the genus
Prototheca moriformis.
In some cases, the oil microbial cell is
<td>an oil yeast cell.</td><td>In</td><td>Some</td><td>cases,</td><td>the</td>
<td>oil microbial cell is</td><td>a</td><td>cell</td><td colspan="2">bacterial</td>
<td>oleaginous.</td><td></td><td></td><td></td><td></td>
<td>In some cases, the oil</td><td>of</td><td>origin</td><td>natural</td><td>is</td>
<td>cocoa butter and the exogenous gene</td><td colspan="2">understands</td><td>a gene</td><td>of</td>
<td>Carthamus tinctorus thioesterase.</td><td>In</td><td>Some</td><td>cases,</td><td>the</td>
<td>oil of natural origin is oil</td><td>of</td><td colspan="2">coconut nut.</td><td>In</td>
In some cases, the naturally occurring oil is palm oil and the exogenous gene comprises an Elaeis guiniensis thioesterase gene, a Cuphea hookeriana thioesterase gene, a combination of a Cuphea hookeriana KAS IV gene and a gene
Cuphea wright ii FATB2, or a construct designed to interrupt an endogenous KAS II gene. In some cases, the
<img file="MX339639B_D0023.tif" />
Natural naturally occurring oil is palm kernel oil and the exogenous gene comprises a combination of a FATB2 gene from
Cuphea wrightii and a construct designed to interrupt an endogenous SAD2B gene. In some cases, the oil of natural origin is shea butter. In some cases, the oil of natural origin is beef bait. In some cases, the oil of natural origin is butter and the exogenous gene comprises a combination of the thiosterase U gene. californica and a construct designed to interrupt an endogenous SAD2B gene, a combination of a Garcinia mangostana thiosterase gene and a construct designed to interrupt a gene
Endogenous SAD2B, a Brassica napus thiosterase gene, or a Cuphea hookeriana thiosterase gene.
In a sixteenth aspect, the present invention provides an oleaginous microbial triglyceride oil composition, wherein the fatty acid profile of the triglyceride oil is selected from the group consisting of at least about 1% C8: 0, at least about 1%
C10: 0, at least about 1% C12: 0, at least about 2% C14: 0, at least about 30% C16: 0, at least about 5% C18: 0, at least about
60% C18: 1, less than about 7% C18: 2, and at least about 35% saturated fatty acids.
In several
<img file="MX339639B_D0024.tif" />
<sup>Z4</sup> IMPI
MEXICAN INSTITUTE ΠΕ THE PROPERTY, INDUSTRIAL modalities, the composition of triglyceride oil by cultivating a population of recombinant oil microbial oil cells or oil microbial cells in a culture medium, where the oil microbial cells as described above, particularly those previously described in relation with the fifteenth aspect of the invention.
In some cases, the composition of oleaginous microbial triglyceride oil further comprises an attribute selected from the group consisting of: (i) less than 0.3 mcg / g total carotenoids; (ii) less than 0.005 mcg / g lycopene; (iii) less than 0.005 mcg / g beta carotene; (iv) less than 0.3 mcg / g chlorophyll A; (v) less than 175 mcg / g gamma tocopherol, - (vi) less than 0.25% brassicasterol, campesterol, stignasterol, or beta-sitosterol; (vii) less than 350 mcg / g total tocotrienols; (viii) less than 0.05 mcg / g lutein; or (ix) less than 275 mcg / g tocopherols.
In a seventeenth aspect, the present invention provides a method of producing an oleaginous microbial triglyceride oil composition having a fatty acid profile selected from the group consisting of at least about 1% C8: 0, at least about 1% C10: 0 , at least about 1% C12: 0, at least about
IMPI
MEXICAN INSTITUTE r »IA FROFItPAD INBIISTRIAI.
<img file="MX339639B_D0025.tif" />
2% C14: 0, at least about 30% C16: 0, at least about 5% C18: 0, at least about 60% C18: l, less than about 7% C18: 2, and at least about 35% fatty acids saturated, wherein the method comprises the steps of: (a) culturing a population of oil microbial oil cells in a culture medium up to at least 10% of the dry cell weight of the oil microbial oil cells is triglyceride oil; and (b) isolating the triglyceride oil composition from the oil microbial cells. In various embodiments, the triglyceride oil composition is produced by cultivating a population of recombinant microbial oil cells or recombinant oil microbial cells as described above, particularly those described above in connection with the fifteenth aspect of the invention.
In an eighteenth aspect, the present invention provides a method for preparing an oil-based product, wherein the method comprises the steps of: (a) subjecting the composition of oleaginous microbial triglyceride oil, as described above in connection with the sixteenth aspect of the invention, to at least one chemical reaction selected from the group consisting of:
<img file="MX339639B_D0026.tif" />
IMPI
INSTITU I · MEXICANO OE LA AROAUdad INnilSTRIAI saponification; metathesis; acid hydrolysis; alkaline hydrolysis; enzymatic hydrolysis; catalytic hydrolysis, hydrolysis with hot compressed water; a catalytic hydrolysis reaction where the lipid is separated into glycerin and fatty acids; an amination reaction to produce fatty nitrogen compounds; an ozonolysis reaction to produce mono and dibasic acids; a triglyceride separation reaction selected from the group consisting of enzymatic separation and pressure separation; a condensation reaction that follows a hydrolysis reaction; a hydroprocessing reaction; a hydroprocessing reaction and a deoxygenation reaction or a condensation reaction prior to or simultaneous with the hydroprocessing reaction; a gas elimination reaction; a deoxygenation reaction selected from the group consisting of a hydrogenolysis reaction, hydrogenation, a consecutive hydrogenation-hydrogenation reaction, a consecutive hydrogenolysis-hydrogenation reaction, and a combined hydrogenation-hydrogenation reaction; a condensation reaction following a deoxygenation reaction; an esterification reaction; an interesterification reaction; a transesterification reaction; a hydroxylation reaction;
IMPI Mexican Institute '
DE LA MtOREDAD fV / * indust »i * i. Xg'ff * and a condensation reaction following a hydroxylation reaction; and (b) isolating the reaction product from other components.
In some cases, the oil-based product is selected from the group consisting of a soap, a fuel, a dielectric fluid, a hydraulic fluid, a plasticizer, a lubricant, a heat transfer fluid, and a metalworking fluid. . In some cases, the oil-based product is a combustible product selected from the group consisting of: (a) biodiesel; (b) renewable diesel; and (c) reactor fuel.
In some cases, the fuel product is biodiesel with one or more of the following attributes: (i) less than 0.3 mcg / g total carotenoids; (ii) less than 0.005 mcg / g lycopene; (iii) less than 0.005 mcg / g beta carotene; (iv) less than 0.3 mcg / g chlorophyll A; (v) less than 175 mcg / g gamma tocopherol; (vi) less than 0.25% brassicasterol, campesterol, stignasterol, or beta-sitosterol; (vii) less than 350 mcg / g total tocotrienols; (viii) less than 0.05 mcg / g lutein; or (ix) less than 275 mcg / g tocopherols.
In some cases, the fuel product is renewable diesel that has a T10-T90 of at least 20 ° C, 40 ° C, or
60 ° C.
IMPI
MSXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX339639B_D0027.tif" />
In some cases, the fuel product is reactor fuel that meets HRJ-5 and / or ASTM specification D1655.
These and other aspects and embodiments of the invention are described in the accompanying figure, the brief description of which follows immediately, the detailed description of the invention below, and is exemplified in the examples below. Any or all of the features discussed above and throughout the application may be combined in various embodiments of the present invention.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a chromatogram of renewable diesel produced from oil. triglyceride of
Prototheca.
DETAILED DESCRIPTION OF THE INVENTION
The present invention arises from the discovery that Prototheca and certain related microorganisms have unexpectedly advantageous properties for the economical and high-volume production of oils, fuels, and other hydrocarbon or lipid compositions, as well as the discovery of methods and reagents for genetically alter these microorganisms to improve these properties. The oils produced by these
IMPI
MEXICAN INSTITUTE
OE ΙΑ ΓΚΙΚΙΠΑΓ »» 3 — INDUSTRIAL> ^, - ro Microorganisms can be used in fuel for transportation, in the oleochemical and / or food and cosmetic industries, among other applications. Transesterification of lipids produces esters of long chain fatty acids useful as biodiesel. Other enzymatic and chemical processes can be adjusted to produce fatty acids, aldehydes, alcohols, alkanes, and alkenes. In some applications, renewable diesel, jet fuel, or other hydrocarbon compounds are produced. The present invention also provides methods for cultivating microalgae with high productivity and high lipid yield, and / or for the most cost-effective production of the compositions described herein.
This detailed description of the invention is divided into sections for the convenience of the reader. Section I provides the definitions of the terms used herein. Section II provides a description of the culture conditions useful in the methods of the invention.
Section III provides a description of genetic engineering materials and methods. Section IV provides a description of the genetic modification of microorganisms (eg Prototheca) to allow the use of sucrose. Section V provides a
ΙΜΡΙ
MEXICAN INSTITUTE • E LA MOPIBDAD
INOI ISTRIAL
<img file="MX339639B_D0028.tif" />
description of the genetic modification of microorganisms (eg Prototheca) to modify lipid biosynthesis. Section VI describes methods for producing fuels and chemicals. Section VII describes the examples and embodiments of the invention. The detailed description of the invention is followed by examples illustrating various aspects and embodiments of the invention.
I. DEFINITIONS [0001] Unless defined otherwise, all technical and scientific terms used in the present description have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide a skilled person with a general definition of many of the terms used in this invention: Singleton et al.,
Dictionary of Microbiology and Molecular Biology (2nd ed.
1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R.
Rieger et al. (Eds.), Springer Verlag (1991); and Hale &
Marham, The Harper Collins Dictionary of Biology (1991). As used throughout this document, the following terms have the meanings attributed to them, unless otherwise specified.
<img file="MX339639B_D0029.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Active in microalgae refers to a nucleic acid 'that is functional in microalgae. For example, a promoter that has been used to drive an antibiotic resistance gene to impart antibiotic resistance to a transgenic microalgae is active on the microalgae.
Acyl Carrier Protein or ACP is a protein that binds to a growing acyl chain during fatty acid synthesis as a thiol ester to the distal thiol portion of 4<sup>1</sup>-phosphopantothein and comprises a component of the fatty acid synthase complex.
[0002] An acyl-CoA or acyl-CoA molecule, is a molecule comprising an acyl moiety covalently attached to coenzyme A through a thiol ester bond in the distal thiol of the 4 moiety<sup>1</sup>-phosphopantothein from coenzyme A.
Area Percent refers to the area of peaks observed using the FAME GC / FID detection methods, in which each fatty acid in the sample is converted to a fatty acid methyl ester (FAME) prior to detection. For example, a separate peak is observed for a fatty acid of
14 unsaturated carbon atoms (C14: 0) compared to any other fatty acid such as C14: 1. The peak area for each FAME class is directly proportional to its percent composition in the mix and is calculated based on the
<img file="MX339639B_D0030.tif" />
IMPI sum of all the peaks present in the sample (i.e.
[area under specific peak / total area of all measured peaks] X 100). When referring to the lipid profiles of the oils and cells of the invention, at least 4% of
C8-C14 means that at least 4% of the total fatty acids in the cell or in the composition of the extracted glycerolipids, has a chain length that includes 8, 10, 12 or 14 carbon atoms.
Axenic is a culture of an organism free of contamination by other living organisms.
Biodiesel is a biologically produced fatty acid alkyl ester suitable for use as fuel in a diesel engine.
Biomass is the material produced by the growth and / or propagation of cells. Biomass can contain cells and / or intracellular content, as well as extracellular material, includes, but is not limited to, compounds secreted by a cell.
Bioreactor, is a total or partial enclosure where cells are grown, optionally in suspension.
Catalyst is an agent, such as a molecule or a macromolecular complex, capable of facilitating or promoting a chemical reaction of a reactant to its product without
IMPI
MEXICAN INSTITUTE r »INDUSTRIAL PROPERTY
<img file="MX339639B_D0031.tif" />
become a part of the product. A catalyst increases the speed of a reaction, after which the catalyst can act on another reactant to form the product. A catalyst generally lowers the total activation energy required for the reaction, so that it occurs more quickly or at a lower temperature. Thus, a balance of the reaction can be achieved more quickly. Examples of catalysts include enzymes, which are biological catalysts; heat, which is a non-biological catalyst; and metals used in the refining processes of fossil oils.
Cellulosic material, is the product of the digestion of cellulose, including glucose and xylose, and optionally additional compounds such as disaccharides, oligosaccharides, lignin, furfurals and other compounds. Non-limiting examples of sources of cellulosic material include sugarcane bagasse, beet sugar pulp, corn stubble, wood chips, sawdust, and rod grass.
Co-culture, and variants of it such as co-cultivation and co-fermentation, refer to the presence of two or more cell types in the same bioreactor. The two or more cell types can be both microorganisms, such as microalgae, or can be a cultured microalgae cell
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0032.tif" />
with a different cell type. Culture conditions may be those that promote the growth and / or spread of the two or more cell types or those that facilitate the growth and / or proliferation of one, or a subset of the two or more cells, while maintaining the cell growth for the rest.
Cofactor is any molecule, other than the substrate, necessary for an enzyme to perform its enzymatic activity.
Complementary DNA, or cDNA, defines a copy of
DNA of the mRNA, normally obtained by reverse transcription of the messenger RNA (mRNA) or by amplification (for example, via polymerase chain reaction (PCR)).
Cultured, and variants of this as cultured and fermented, refer to the intentional promotion of growth (increase in cell size, cell content, and / or cell activity) and / or spread (increase in the number of cells via mitosis) of one or several cells by using selected and / or controlled culture conditions. The combination of both growth and propagation can be called proliferation. Examples of selected and / or controlled conditions include the use of a defined medium (with characteristics <sup>35</sup> IMPíSfc '
MEXICAN INSTITUTE • E LA RRORIEOAÍJ
IN9USTRIAL * »«. "*, Ti known as pH, ionic strength, and carbon source), and specific conditions of temperature, oxygen tension, carbon dioxide levels, and growth in a bioreactor. Cultivating does not refer to the growth or spread of microorganisms in nature or elsewhere without human intervention; for example, it is not a crop the natural growth of an organism that finally becomes a fossil to produce oil.
Cytolysis is the lysis of cells in a hypotonic environment. Cytolysis is caused by excessive osmosis, or by the movement of water, into a cell (hyperhydration). The cell cannot resist the osmotic pressure of the water inside it, and it explodes.
Delipid food and delipidated microbial biomass, is the microbial biomass after the oil (including lipids) is extracted or isolated from it, either through the use of mechanical extraction (that is, exerted by a press) or solvent extraction, or both of them. The delipidated food has a reduced amount of oils / lipids compared to the microbial biomass before the extraction / isolation of the oils / lipids, but contains some residual amount of oils / lipids.
<img file="MX339639B_D0033.tif" />
Expression vector or expression construct o
IMPI
INSTITUTO MEXICAN · »f THE NAME», 'NBUSTRIAL plasmid or recombinant DNA construct, refers to a nucleic acid that has been generated by human intervention, including recombinant or direct chemical synthesis methods, with a series of specific nucleic acids that allow the transcription and / or translation of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or a nucleic acid fragment. Typically, the expression vector includes a nucleic acid that is transcribed operably linked to a promoter.
Exogenous gene, is a nucleic acid that codes for the expression of an RNA and / or protein that has been introduced (transformed) in a cell. A transformed cell can be defined as a recombinant cell, into which an additional exogenous gene (s) can be introduced. The exogenous gene can be from a different species (heterologous), or from the same species (homologous) with respect to the cell being transformed. Thus, an exogenous gene can include a homologous gene that occupies a different location in the cell genome or is under different control, with respect to the endogenous copy of the gene. An exogenous gene can be present in more than one copy in the cell. An exogenous gene can<sup>37</sup> IMPIAS
MLXICANt INSTITUTE
Dt LA FRONEDAI 'industrial be maintained in a cell as an insert in the genome or as an episomal molecule.
Exogenously provided, refers to a molecule provided to the culture medium of a cell culture.
Pressed with an ejector, it is a mechanical method to extract oil from raw materials such as soybeans and rapeseed. An ejector press is a screw machine which presses the material through a caged, barrel-shaped cavity 10. The raw material enters on one side of the press and the cake leaves on the other side, while the oil filters between the bars of the cage and is collected.
The machine uses friction and continuous pressure from the screw units to move and compress the raw material. The oil comes out through small openings that do not allow solids to pass through. Since the raw material is pressed, friction typically causes heating.
Acyl Fatty-ACP Thioesterase, is an enzyme that catalyzes the cleavage of a fatty acid from an acyl carrier protein (ACP) during lipid synthesis.
Acyl Fat-CoA / Aldehyde Reductase, is an enzyme that catalyzes the reduction of an acyl-CoA molecule to a primary alcohol.
ΙΜΡΙ
JN> TTT »fTO MtXICAMO re la wepiti'At INPUSTWIAL
<img file="MX339639B_D0034.tif" />
Acyl fatty-CoA reductase, is an enzyme that catalyzes the reduction of an acyl-CoA molecule to an aldehyde.
Fatty aldehyde decarbonylase, is an enzyme that catalyzes the conversion of a fatty aldehyde to an alkane.
Fatty aldehyde reductase, is an enzyme that catalyzes the reduction of an aldehyde to a primary alcohol.
Fixed carbon source is a carbon-containing molecule or molecules, typically an organic molecule that is present at room temperature and pressure in solid or liquid form, which can be used by a microorganism grown there.
Homogenate is biomass that has been physically separated.
Hydrocarbon is (a) a molecule that contains only hydrogen and carbon atoms, where the carbon atoms are covalently linked to form a linear, branched, cyclic, or partially cyclic backbone to which the hydrogen atoms are attached. The molecular structure of hydrocarbon compounds varies from the simplest, in the form of methane (CH<sub>4</sub>), which is a constituent of natural gas, a very strong and complex, such as some molecules such as asphaltenes found in crude oil, petroleum, and bitumen. Hydrocarbons can be found in gaseous form,
ΙΜΡϊ @>
INSTITUTO MEXICANC DE IA FROMEDAP
IW'STRIAL S «» »liquid, or solid, or in any combination of these forms, and may have one or more double or triple bonds between the carbon atoms adjacent to the main chain. Therefore, the term includes linear, branched, cyclic, or partially cyclic linear alkanes, alkenes, lipids, and paraffins. Examples include propane, butane, pentane, hexane, octane, and squalene.
Hydrogen: carbon ratio is the ratio of hydrogen atoms to carbon atoms in a molecule on an atom-to-atom basis. The ratio can be used to refer to the number of carbon and hydrogen atoms in a hydrocarbon molecule. For example, the hydrocarbon with the highest ratio is methane CH<sub>4</sub> (4:1).
Hydrophobic fraction, is the portion, or fraction of a material that is more soluble in a hydrophobic phase compared to an aqueous phase. A hydrophobic fragment is substantially insoluble in water and is normally nonpolar.
Increased lipid yield, refers to the increase in the productivity of a microbial culture, for example, increasing the dry weight of cells per liter of culture, increasing the percentage of cells that make up lipids, or increasing the total amount of lipids per liter of crop volume per unit time.
<sup>40</sup> ΙΜΡΙ
MEXICAN INSTITUTE,.
ΙΈ Ι.Α PROHIfΠΑΙ INOUSTRIAI,
The inducible promoter is a promoter that mediates the transcription of operably linked genes in response to a particular stimulus. Examples of such promoters may be promoter sequences that are induced under conditions of changing pH or nitrogen levels.
In operative junction, it is the functional junction between two nucleic acid sequences, such as a control sequence (typically a promoter) and the linked sequence (typically a sequence that encodes a protein, also called a coding sequence). A promoter is in operative binding to an exogenous gene if it can mediate transcription of the gene.
In situ means in place or in its original position.
Limiting concentration of a nutrient is the concentration of a compound in a crop that limits the spread of an organism in the crop. A non-limiting concentration of a nutrient is a concentration that aids maximum propagation during a given period of the crop.
Thus, the number of cells produced during a given period of culture is lower in the presence of a limiting concentration of a nutrient than when the nutrient is non-limiting. A nutrient is said to be in excess in a
<img file="MX339639B_D0035.tif" />
<img file="MX339639B_D0036.tif" />
<sub>41</sub> IMPI ______ MEXICAN INSTITUTE
OF INDUSTRIAL RORTHY culture, when the nutrient is prpspnts in a concentration greater than that necessary for maximum propagation.
Lipase is a water soluble enzyme that catalyzes the hydrolysis of esters bound to lipid substrates insoluble in water. Lipases catalyze the hydrolysis of lipids in glycerols and fatty acids.
Lipid modifying enzyme, refers to an enzyme that alters the covalent structure of a lipid. Examples of lipid modifying enzymes include a lipase, an fatty acyl-ACP thioesterase, an fatty acyl CoA / aldehyde reductase, an fatty acyl-CoA reductase, a fatty aldehyde reductase, a desaturase, including a stearoyl acyl carrier desaturase protein. (SAD) and a fatty acyl destaurase (FAD), and a fatty aldehyde decarbonylase.
Lipid pathway enzyme, is any enzyme that plays a role in lipid metabolism, that is, in lipid synthesis, modification, or degradation, and any protein that chemically modifies lipids, as well as proteins carriers.
[0003] Lipids are a class of molecules that are soluble in non-polar solvents (such as ether and
<img file="MX339639B_D0037.tif" />
ΙΜΡΙ - chloroform) and are relatively or completely insoluble in water. Lipid molecules have these properties because they are made up of long hydrocarbon tails that are hydrophobic in nature. Examples of lipids 5 include fatty acids (saturated and unsaturated); glycerides or glycerolipids (such as monoglycerides, diglycerides, triglycerides or neutral fats, and phosphoglycerides or glycerophospholipids); non-glycerides (sphingolipids, sterol lipids including cholesterol and steroid hormones, prenol lipids including terpenoids, fatty alcohols, waxes, and polyketides); and complex lipid derivatives (sugar-bound lipids, or glycolipids, and protein-bound lipids). Fats are a subgroup of lipids called triacylglycerides.
Lysate is a solution that contains the content of lysed cells.
Lysis is the rupture of the plasma membrane and optionally of the cell wall of a biological organism sufficient to release at least some intracellular content, often by mechanical, viral or osmotic mechanisms that compromise its integrity.
Lysar is the disturbance of the cell membrane and optionally the cell wall of a biological organism or
<img file="MX339639B_D0038.tif" />
IMPI
MEXICAN INSTITUTE *
Dt THE PROPERTY »» 'STRIaL cell sufficient to release at least some intracellular content.
Microalgae is a eukaryotic microbial organism that contains a chloroplast or plastid, and optionally is capable of photosynthesis, or a prokaryotic microbial organism that is capable of photosynthesis. Microalgae include obligate photoautotrophs, which cannot metabolize a fixed source of carbon into energy, as do heterotrophs, which can live only at the cost of a fixed source of carbon. Microalgae include single-celled organisms that separate from sister cells shortly after cell division, such as Chlamydomonas, as well as microbes, such as, for example, Volvox, which is a simple photosynthetic multicellular microbe from two different cell types. Microalgae include cells such as Chlorella, Dunaliella, and Prototheca. Microalgae also include other microbial photosynthetic organisms that exhibit cell-cell adhesion, such as Agmenellum, Anabaena, and Pyrobotrys.
Microalgae also include obligate heterotrophic microorganisms that have lost the ability to photosynthesize, such as certain dinoflagellate algae species and Prototheca genus species.
<img file="MX339639B_D0039.tif" />
Microorganism and microbe, are organisms
<img file="MX339639B_D0040.tif" />
unicellular microscopy.
Naturally co-expressed, referring to two proteins or genes means that the proteins or their genes co-express naturally in a tissue or organism from which they are derived, for example, because the genes encoding the two proteins are low control of a common regulatory sequence or because they are expressed in response to the same stimulus.
Osmotic shock is the breakdown of cells in a solution after a sudden reduction in osmotic pressure. Osmotic shock is sometimes induced to release the cellular components of these cells into a solution.
Polysaccharide degradation enzyme, is any enzyme capable of catalyzing the hydrolysis or saccharification of any polysaccharide. For example, cellulases catalyze the hydrolysis of cellulose.
Polysaccharides, or glycans, are carbohydrates made from monosaccharides linked by glycosidic bonds. Cellulose is a polysaccharide that is part of certain cell walls of plants. Cellulose can be depolymerized by enzymes to produce monosaccharides such as
IMPI
MEXICAN INSTITUTE OF IA FWOPIFOaD INDUSTRIAL
<img file="MX339639B_D0041.tif" />
glucose and xylose, as well as larger disaccharides and oligosaccharides.
Promoter is a nucleic acid control sequence that directs the transcription of a nucleic acid.
As used in the present description, a promoter includes the necessary nucleic acid sequences near the transcription start site, such as, in the case of a type II polymerase promoter, a TATA element. A promoter optionally also includes the distal enhancer or repressor elements, which can be located up to several thousand base pairs from the transcription start site.
Recombinant is a cell, nucleic acid protein or vector, which was modified due to the introduction of an exogenous nucleic acid or the alteration of a native nucleic acid. Thus, for example, recombinant cells express genes that are not found in native (non-recombinant) cells or express native genes differently than how these genes are expressed by a non-recombinant cell. A recombinant nucleic acid is a nucleic acid originally formed in vitro, generally by nucleic acid manipulation, for example using polymerases and endonucleases, or otherwise in a <sup>46</sup> IMPI »*
MEXICANC INSTITUTE
DE LA FROREDAD 'C * »w3¿LJÍ
INDUSTRIAL form that is not normally found in nature. Recombinant nucleic acids can be. produce, for example, to place two or more nucleic acids in operative linkage. Thus, an isolated nucleic acid or an expression vector formed in vitro by the ligation of molecules of
DNAs that do not normally bind in nature are considered recombinant for the purposes of the present invention. Once a recombinant nucleic acid is obtained and introduced into a host cell or organism, it can be replicated using the in vivo cellular machinery of the host cell; however, these nucleic acids, once produced by recombinant methods, although subsequently replicated intracellularly, are still considered recombinant for the purposes of the present invention. Similarly, a recombinant protein is a protein produced using recombination techniques, that is, through the expression of a recombinant nucleic acid.
Renewable diesel is a mixture of alkanes (like
C10: 0, C12: 0, C14: 0, C16: 0 and C18: 0) produced by the hydrogenation and deoxygenation of lipids.
Saccharification is a process to convert biomass, usually cellulosic or lignocellulosic biomass, into sugars
<img file="MX339639B_D0042.tif" />
IMPIAS
MBÍICANO INSTITUTE DF LA ΤΜΟΤΙΪΟΛΟ inbiistwal monomers, such as glucose and xylose. Saccharified or depolymerized cellulosic material or biomass refers to the cellulosic material or biomass that is converted to monomeric sugars through saccharification.
The similar term, when used in the context of a comparison with a naturally occurring oil, without further qualification, means that the oil being compared to the naturally occurring oil contains approximately +/- 15%, or +/- 10 % of the two upper triglycerides of the oil of natural origin. For example, shea butter (B. Parkii oil) contains 41,256.8% C18: 0 and 34.0-46.9% C18: 1 as the two most common triglyceride components (see Table 5). A similar oil that is within +/- 10% can contain approximately
37% to approximately 62% C18: 0 and from 31% to approximately
52% C18: 1 as the two most common triglyceride components.
When used in this context, the similar term includes +/- 9%, +/- 8%, +/- 7%, +/- 6%, +/- 5%, +/- 4%, +/- 3%, + / 2%, or +/- 1%, and may also represent a comparison with the three or four higher triglycerides of the oil of natural origin, or two outside the three higher triglycerides, or three outside the four triglycerides superior.
<img file="MX339639B_D0043.tif" />
biological, such as a cell, by using the energy of sound waves.
Furfural species, it is 2-furancarboxaldehyde or a derivative that retains the same basic structural characteristics.
Stubble, are the dried stems and leaves of a crop that remain after the grain is harvested.
Sucrose utilization gene is a gene that, when expressed, aids the ability of a cell to use sucrose as an energy source. Proteins encoded by a sucrose utilization gene are referred to herein as sucrose utilization enzymes and include sucrose transporters, sucrose invertases, and hexokinases such as glucokinases and fructokinases.
II. CULTURE
The present invention generally relates to the cultivation of microorganisms (eg, microalgae, oil yeast, fungi, and bacteria), particularly recombinant microalgal strains, including Prototheca strains, for lipid production. For the convenience of the reader, this section is subdivided into subsections. The
IMPI
MEXICAN INSTITUTE OF PROPERTY
IN »USTRIAL
<img file="MX339639B_D0044.tif" />
Subsection 1 describes the Prototheca species and strains and how to identify new Prototheca species and strains and related microalgae by comparison of genomic DNA as well as other microorganisms. Subsection 2 describes useful bioreactors for cultivation. Subsection 3 describes the culture media. Subsection 4 describes oil production according to illustrative cultivation methods of the invention. These descriptions are also more generally applicable to other microorganisms.
one. Species and strains of Prototheca and other microorganisms
Prototheca is a remarkable microorganism for use in lipid production, because it can produce high levels of lipids, particularly lipids suitable for fuel production. Lipids produced by
Prototheca have shorter hydrocarbon chains and a higher degree of saturation than those produced by other microalgae. Furthermore, Prototheca's lipids are generally free of pigments (low to undetectable levels of chlorophyll and certain carotenoids) and in any case contain much less pigments than lipids of other microalgae. Furthermore, the recombinant Prototheca cells provided by the invention can be used to produce
<img file="MX339639B_D0045.tif" />
ΙΜΡΙ lipids with higher performance and efficiency, and at a reduced cost, in relation to the production of lipids from other microorganisms. Illustrative strains of
Prototheca for use in the methods of the invention include Prototheca moriformis, Prototheca krugani,
Prototheca stagnora or Prototheca zopfii. Furthermore, these microalgae grow heterotrophically and can be genetically modified such as Prototheca wickerhamii,
Prototheca stagnora (including UTEX 327), Prototheca portoricensis, Prototheca moriformis (including strains of
UTEX 1441, 1435), and Prototheca zopfii. Species of the genus Prototheca are obligate heterotrophs.
The Prototheca species for use in the invention can be identified by the amplification of certain target regions of the genome. For example, the identification of a specific species or variety of Prototheca can be accomplished by amplification and sequencing of nuclear DNA and / or chloroplasts using primers and methodology using any region of the genome, for example, using the methods described in Wu et al., Bot. Bull. Acad. Without. (2001) 42: 115-121.
Identification of Chlorella spp. isolates using ribosomal DNA sequences. Well-established methods for phylogenetic analysis, such as amplification and sequencing of the
<img file="MX339639B_D0046.tif" />
Dt THE PROPERTY - Atl
INDUSTRIAL <sup>M</sup> rJT ribosomal internal transcribed spacer (ITS1 and ITS2 rDNA), _
23S rRNA, 18S rRNA, and other conserved regions of the genome, can be used by those skilled in the art to identify species not only of Prototheca but also other lipid and hydrocarbon-producing organisms with similar lipid profiles and production capacity. For examples of algae identification and classification methods, see also, for example, Genetics, August 2005;
170 (4): 1601-10 and RNA, April 2005; ll (4): 361-4.
In this way, comparison of genomic DNA can be used to identify suitable species of microalgae that are used in the present invention. Conserved genomic DNA regions, such as but not limited to DNA encoding 23S rRNA, can be amplified from microalgae species and compared to consensus sequences to select microalgae species that are taxonomically related to the preferred microalgae used in the present invention. Examples of comparing DNA sequences for species of the genus Prototheca are shown below. Comparison of genomic DNA can also be helpful in identifying microalgae species that have been misidentified in a collection of strains. Often a collection of strains will identify species
<img file="MX339639B_D0047.tif" />
industrial ^ 5f of microalgae based on their tenoLipltas — ymorfológicas characteristics. The use of these characteristics can lead to the incorrect categorization of the species or genus of a microalgae. Using genomic DNA comparison may be a better method of categorizing microalgae species based on their phylogenetic relationship.
Microalgae for use in the present invention typically have genomic DNA sequences encoding 23S rRNA with at least 99%, at least 95%, at least 90%, or at least 85% nucleotide identity with at least one of the sequences listed in sec. with no. Ident .:
11-19.
For sequence comparison to determine percent nucleotide or amino acid identity, typically a sequence acts as a reference sequence, against which the sequences being compared are compared.
When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, if necessary posterior coordinates are designated, and the program parameters of the sequence algorithm are designated. The sequence comparison algorithm then calculates the percentage sequence identity for the test sequence (s) relative to the
<img file="MX339639B_D0048.tif" />
reference sequence, based on parameters - de - jM = © g £ ama. designated.
Optimal sequence alignment for comparison can be done, for example, by the Smith & Waterman local homology algorithm, Adv. Appl. Math. 2: 482 (1981), by the Needleman & Wunsch homology alignment algorithm, J. Mol. Biol. 48: 443 (1970), by searching for the Pearson & Lipman similarity method,
Proc. Nati. Acad Sci., USA 85: 2444 (1988), for computerized implementations of these algorithms (GAP,
BESTFIT, FASTA, and TFASTA of the Wisconsin Software Package
Genetics, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al., Supra).
Another example of an algorithm that is suitable for determining sequence identity and sequence similarity is the BLAST algorithm, which is described in
Altschul et al., J. Mol. Biol. 215: 403-410 (1990). The software for running BLAST analyzes is publicly available 20 through the National Center for Information.
Biotechnology (on the website www.ncbi.nlm.nih.gov). This algorithm involves first identifying high-scoring sequence pairs (HSP) by
IMPI »
-> 4 MEXICAN INSTITUTE
Ot THE fXOPIBOAD.
INDUSTRIAL Xte g identification of short words of length W in — X problem sequence, which combine or satisfy some threshold score greater than parameter T, when they are aligned with a word of the same length in a database sequence. Parameter T is referred to as the neighbor word score threshold (Altschul et al., Supra.).
The hits of neighboring words behave like seeds to start searches and find longer HSPs that contain them. The hits of neighboring words are then extended in both directions throughout each sequence until the cumulative alignment score is increased. For nucleotide sequences, cumulative alignment scores are calculated using parameters M (reward score for a pair of residues that combine; always> 0) and N (punishment score for residues that do not combine; always <0). For amino acid sequences, the cumulative score is calculated using a scoring matrix. The extensions of the hits of the neighboring words in each direction are stopped when: the cumulative alignment score decreases by an amount X from its maximum value reached;
cumulative score goes to zero or below zero due to accumulation of one or more alignments of
<img file="MX339639B_D0049.tif" />
negative scoring residuals; or the end of 'any of the sequences is reached. To identify whether the nucleic acid or the polypeptide is within the scope of the invention, the parameters defined in the BLAST programs are adapted. The BLASTN program (for nucleotide sequences) uses as default a word length (W) of 11, an expectation (E) of 10, M = 5, N = -4, and a comparison of both strings. For amino acid sequences, the BLASTP program defaults to a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. The TBLATN program (which using protein sequences to sequence nucleotides) uses by default a word length (W) of 3, a hope (E) of 10, and a BLOSUM score matrix 62. (see Henikoff &
Henikoff, Proc. Nati Acad Sci., USA 89: 10915 (1989)).
In addition to calculating the percentage identity of the sequence, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Nati. Acad Sci., USA
90: 5873-5787 (1993)). A measure of the similarity provided by the BLAST algorithm is the probability of the smallest sum (P (N)), which provides an indication of the probability with which two nucleotide sequences or
IMPI
<img file="MX339639B_D0050.tif" />
amino acids randomly match. For example, a nucleic acid is considered similar to a reference sequence if the probability of the smallest sum in a comparison between the test nucleic acid and a reference nucleic acid is less than about 0.1, more preferably if it is less than about 0.01. and more preferably if it is less than approximately 0.001.
Other considerations affecting the selection of microorganisms for use in the invention, in addition to the production of lipids or hydrocarbons suitable for the production of oils, fuels and oleochemicals, are: (1) high lipid content as a percentage of cell weight ; (2) ease of growth; (3) ease of genetic modification; and (4) ease of biomass processing. In particular modalities, the wild or genetically engineered microorganism produces cells that contain at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, or at least 70% or more of lipids. Preferred organisms grow heterotrophically (in sugar in the absence of light).
Examples of algae that can be used to practice the present invention include, but are not limited to, the following algae listed in Table 1.
IMPI
IKSTrjUK) MtXlCANO n »LA« OPIfDAII industrial
<img file="MX339639B_D0051.tif" />
Table 1. Examples of algae.
Achnanthes orientalis, Agmenellum, Amphiprora hyaline, Amphora coffeiformis, Amphora coffeiformis linea, Amphora coffeiformis punctata, Amphora coffeiformis taylori, Amphora coffeiformis tenuis, Amphora delicatissima capitata,
Amphora sp., Anabaena, Ankistrodesmus, Ankistrodesmus falcatus, Boekelovia hooglandii, Borodinella sp., Botryococcus braunii, Botryococcus sudeticus, Cartería, Chaetoceros gracilis, Chaetoceros muelleri subsalsum, Chaetoceros muelleri subsalumum, Chaetoceros muelleri subsalsum, Ch.
Antarctic, Chlorella aureoviridis, Chlorella candida,
Chlorella capsule, Chlorella desiccate, Chlorella ellipsoidea, Chlorella emersonii, Chlorella fusca, Chlorella fusca var. vacuolata, Chlorella glucotropha, Chlorella infusionum, Chlorella infusionum var. actophila, Chlorella infusionum var. auxenophila, Chlorella kessleri, Chlorella lobophora (strain SAG 37.88), Chlorella luteoviridis, Chlorella luteoviridis var. aureoviridis, Chlorella luteoviridis var.
lutescens, Chlorella miniata, Chlorella minutissima, Chlorella mutabilís, Chlorella nocturnal, Chlorella parva, Chlorella photophila, Chlorella pringsheimii, Chlorella protothecoides (including any of the UTEX 1806, 411, 264, 256,
<img file="MX339639B_D0052.tif" />
IMPI
255, 250, 249, 31, 29, 25, and CCAP strains 211/17 and 211 / 8d),
Chlorella protothecoides var. acidicola, Chlorella you will regulate,
Chlorella will regulate var. minimum, Chlorella will regulate var.
umbricata, Chlorella relsiglii, Chlorella saccharophila,
Chlorella saccharophila var. ellipsoidea, Chlorella salina,
Chlorella simplex, Chlorella sorokiniana, Chlorella sp.,
Chlorella sphaerica, Chlorella stigmatophora, Chlorella vanniellii, Chlorella vulgaris, Chlorella vulgaris, Chlorella vulgaris f. tertia, Chlorella vulgaris var. autotrophica,
Chlorella vulgaris var. viridis, Chlorella vulgaris var.
vulgaris, Chlorella vulgaris var. vulgaris f. tertia,
Chlorella vulgaris var. vulgaris f. viridis, Chlorella xanthella, Chlorella zofingiensis, Chlorella trebouxioides,
Chlorella vulgaris, Chl orococcum infusionum, Chlorococcum sp.,
Chlorogonium, Chroomonas sp., Chrysosphaera sp., Cricosphaera sp., Cryptomonas sp., Cyclotella cryptica, cyclotella meneghiniana, cyclotella sp., Dunaliella sp., Dunaliella bardawil, Dunaliella bioculata, Dunaliella granulate,
Dunaliella maritime, Dunaliella minuta, Dunaliella parva,
Dunaliella peircei, Dunaliella primolecta, Dunaliella salina,
Dunaliella terrícola, Dunaliella tertiolecta, Dunaliella viridis, Dunaliella tertiolecta, Eremosphaera viridis,
<img file="MX339639B_D0053.tif" />
Eremosphaera sp., Ellipsoidon sp., Euglena, Franceía sp.,
Fragilaria crotonensis, Fragilaria sp., Gleocapsa sp.,
Gloeothamnion sp., Hymenomonas sp., Isochrysis aff. galbana,
Isochrysis galbana, Lepocinclis, Micractinium, Micractinium (UTEX LB 2614), Monoraphidium minutum, Monoraphidium sp. ,
Nannochloris sp., Nannochloropsis salina, Nannochloropsis sp. ,
Navicula acceptata, Navicula biskanterae, Navicule pseudotenelloides, Navicule pelliculosa, Navicula saprophila,
Navicula sp., Nephrochloris sp., Nephroselmis sp., Nitschia communis, Nitzschia alexandrina, Nitzschia communis, Nitzschia dissipata, Nitzschia frustulum, Nitzschia hantzschiana,
Nitzschia inconspicua, Nitzschia intermedia, Nitzschia microcephala, Nitzschia pusilla, Nitzschia pusilla elliptica,
Nitzschia pusilla monoensis, Nitzschia quadrangular, Nitzschia sp., Ochromonas sp., Oocystis parva, Oocystis pusilla,
Oocystis sp., Oscillatoria limnetica, Oscillatoria sp.,
Oscillatoria subbrevis, Pascheria acidophila, Pavlova sp.,
Phagus, Phormidium, Platymonas sp., Pleurochrysis portfolio,
Pleurochrysis dentate, Pleurochrysis sp., Prototheca wickerhamii, Prototheca stagnora, Prototheca portoricensis,
Prototheca moriformis, Prototheca zopfii, Pyramimonas sp.,
Pyrobotrys, Sarcinoid chrysophyte, Scenedesmus armatus,
<img file="MX339639B_D0054.tif" />
IMPI ιυτητιιτ · mexican »rw | J * *« · ΠΕΠΑ · '~ DTT »IAL
Spirogyra, Spirulina platensis, Stichococcus sp.,
Synechococcus sp., Tetraedron, Tetraselmis sp., Tetraselmis suecica, Thalassiosira weissflogii, and Viridiella fridericiana
Examples of oil yeast that can be used to practice the present invention include, but are not limited to, the following oil yeasts listed in Table 26.
Table 26. Examples of oil yeast.
Cryptococcus curvatus, · Cryptococcus terricolus, Candida sp.,
Lipomyces starkeyi, Lipomyces Upo fer, Endomycopsis vernalis,
Rhodotorula glutinis, Rhodotorula gracilis, and Yarrowia lipolytica
Examples of other mushrooms that can be used to practice the present invention include, but are not limited to, the following mushrooms listed in Table 27.
Table 27. Examples of fungi.
Mortierella, Mortierrla vinacea, Mortierella alpine, Pythium debaryanum, Mucor circinelloides, Aspergillus ochraceus,
Aspergillus terreus, Pennicillium iilacinum, Hensenulo,
<img file="MX339639B_D0055.tif" />
Chaetomium, Cladosporium, Malbranchea, Rhizopu'3 ', ~ Y' ^ and Lhiuiw
In some embodiments of the present invention, the microorganism is a bacterium. Examples of exogenous gene expression in bacteria, such as E. coli, are well known; see for example Molecular Cloning: A Laboratory
Manual, Sambrook and others (3rd edition, 2001, Coid Spring
Harbor Press).
2. Bioreactor
Microorganisms are cultivated for two purposes, that of performing genetic manipulations and for the production of hydrocarbons (for example, lipids, fatty acids, aldehydes, alcohols and alkanes). The first type of culture is carried out on a small scale and initially, at least, under conditions in which the initial microorganism can grow. Cultivation for hydrocarbon production purposes is usually performed on a large scale (for example, 10,000 1, 40,000 1, 100,000 1 or greater bioreactors) in a bioreactor. Microalgae, including Prototheca species, are typically grown in the methods of the invention in a liquid medium within a bioreactor.
Typically, the bioreactor does not allow light to enter.
<img file="MX339639B_D0056.tif" />
The bioreactor or fermenter is used to filter oil microbial cells, preferably microalgae cells, through various phases of their physiological cycle.
Bioreactors offer many advantages for use in heterotrophic growth and propagation methods. To produce biomass for use in food, the microalgae are preferably fermented in large amounts of liquid, such as suspension cultures as shown in one example. Bioreactors such as steel fermenters can accommodate very large volumes of culture (bioreactors of 40,000 liters and more capacity are used in various embodiments of the invention). Bioreactors typically also allow control of culture conditions such as temperature, pH, oxygen tension, and carbon dioxide levels. For example, bioreactors are typically configured, for example using ports attached to pipes, to allow gaseous components such as oxygen or nitrogen to be bubbled through the culture liquid. Other parameters of the culture, such as the pH of the culture medium, the identity and concentration of the trace elements, and other constituents of the medium, can be easily manipulated using the bioreactor.
<img file="MX339639B_D0057.tif" />
The bioreactors can be configured so that the culture medium flows through the bioreactor throughout the period of time in which the microalgae reproduce and increase their number. In some embodiments, for example, the medium can be infused into the bioreactor after inoculation, but before the cells reach the desired density. In other cases, the bioreactor is filled with the culture medium at the start of a culture, and no further culture medium is infused after the culture is inoculated. In other words, the microalgae biomass is cultivated in an aqueous medium for a period of time in which the microalgae reproduce and increase their number; however, during this time period the amounts of the aqueous culture medium do not flow through the bioreactor.
Thus, in some embodiments, the aqueous culture medium does not flow through the bioreactor after inoculation.
Bioreactors equipped with devices such as stirring blades and impellers, balancing mechanisms, stirring bars, means for infusing pressurized gas, can be used to mix microalgae cultures. Mixing can be continuous or intermittent. For example, in some embodiments, a turbulent flow regime of gas inlet and media inlet is not maintained for
<img file="MX339639B_D0058.tif" />
reproduction of the microalgae until the desired increase in the number of said microalgae has been reached.
The bioreactor ports can be used to introduce, or extract gases, solids, semisolids and liquids from the reactor chamber containing the microalgae. Although many bioreactors have more than one port (for example, one for medium entry and one for sampling), it is not necessary for only one substance to enter or exit the port. For example, a port can be used to flow the culture medium into the reactor and subsequently for sampling, gas inlet, gas outlet, or other purposes. Preferably, a sampling port can be used repeatedly without compromising the axenic nature of the culture. A sampling port can be configured with a valve or other device that allows the sample circulation to be stopped or started or to provide a continuous sampling means. Typically, bioreactors have at least one port that allows the inoculation of a culture and said port can be used, in addition, for other purposes such as the entry of medium or gas.
The ports of the bioreactors allow to manipulate the gaseous content of the microalgae cultures. To illustrate, part of the volume of a bioreactor may be gas
ΙΜ
<img file="MX339639B_D0059.tif" />
INSTm. »T '> MEXICANO OR ΙΆ RRORIEDAD instead of liquid, and the gas inlets of the bioreactor allow gases to be pumped into the bioreactor. Gases that can be pumped beneficially into a bioreactor include air, air / CO mixtures<sub>2</sub>, noble gases, such as argon and other gases. Bioreactors are typically equipped to allow the user to control the rate of gas entry into the bioreactor. As noted above, increasing the gas flow within the bioreactor increases the culture mix.
[0004] The increase in gas flow also affects the turbidity of the crop. Turbulence can be achieved by placing a gas inlet port below the level of the aqueous culture medium so that the gas entering the bioreactor bubbles to the culture surface. One or more gas outlet ports allow gas to escape, thereby preventing pressure from gradually increasing in the bioreactor. Preferably, the gas outlet port leads to a valve in a single direction that prevents contaminating microorganisms from entering the bioreactor.
3. Means, medium
The microalgae culture medium is generally composed of a fixed source of nitrogen, a source
<img file="MX339639B_D0060.tif" />
fixes carbon, trace elements, upciuiially a buffer solution to maintain pH, and phosphate (typically provided as the phosphate salt). Other components can include salts such as sodium chloride, particularly for marine microalgae. Nitrogen sources include organic and inorganic nitrogen sources, including, for example, without limitation, molecular nitrogen, nitrate, nitrate salts, ammonia (pure or in salt form, such as (NH<sub>4</sub>)<sub>2</sub>SW<sub>4</sub> and NH<sub>4</sub>OH), protein, soy flour, steep corn liqueur, and yeast extract. Examples of trace elements include zinc, boron, cobalt, copper, manganese, and molybdenum in, for example, the respective forms of ZnCl.<sub>2</sub>, H<sub>3</sub>BO<sub>3</sub>, CoCl<sub>2</sub>-6H<sub>2</sub>0, CuCl<sub>2</sub>-2H<sub>2</sub>OR,
MnCl<sub>2</sub>-4H<sub>2</sub>O and (NH<sub>4</sub>) <sub>6</sub>Mo<sub>7</sub>0<sub>24</sub> 4H<sub>2</sub>OR.
According to the methods of the present invention useful microorganisms are found in various places and environments throughout the world. As a consequence of its isolation from other species and its resulting evolutionary divergence, the particular growth medium for optimal growth and generation of lipid and / or hydrocarbon constituents may be difficult to predict. In some cases, certain strains of microorganisms may be unable to grow in a particular growth medium due to
ΙΜΡΙ
INSTITUTO MiXICANC),, OF THE PROPERTY
INDUSTRIAL X,
<img file="MX339639B_D0061.tif" />
presence of some inhibitory component e- ° <sup>Ί</sup> = absence of an essential nutritional requirement required by a particular strain of the microorganism.
Solid and liquid growth media 5 are generally available from a wide variety of sources, and instructions for preparing a particular medium that is suitable for a wide range of varieties of microorganisms can be found, for example, on-site. web http://www.utex.org/, a site maintained by the University of Texas at Austin, 1 University Station A6700, Austin, Texas, 78712-0183, for its algae culture collection (UTEX). For example, various freshwater and saltwater media include those described in PCT publication no. 2008/151149, incorporated herein by reference.
In a particular example, Proteose medium is suitable for axenic cultures, and an 11 volume of medium (pH ~ 6.8) can be prepared by adding 1g of proteose peptone to 1 liter of Bristol Medium. The Bristol medium comprises 2.94 mM of
NaN0<sub>3</sub>0.17 mM CaCl<sub>2</sub>-2H<sub>2</sub>Or, 0.3 mM MgSO<sub>4</sub>-7H<sub>2</sub>Or, 0.43 mM,
1.29 mM KH<sub>2</sub>PO<sub>4</sub>, and 1.43 mM NaCl in an aqueous solution.
For 1.5% agar medium, 15 g of agar can be added to 1 of the solution. The solution is covered and subjected to
<img file="MX339639B_D0062.tif" />
IMPI
INSTITUTO MUC1CAN4 DE LA PRONIftAD industrial autoclave, and then store at refrigerated temperature before use. Another example is the insulation medium of
Prototheca (PIM), comprising 10g / l Potassium Hydrogen Phthalate (KHP), 0.9g / l Sodium Hydroxide, 0.1g / l Magnesium Sulfate, 0.2g / l Potassium Hydrogen Phosphate, 0.3g / l of ammonium chloride, 10g / l of glucose, 0.001g / l of thiamine hydrochloride, 20g / l of agar, 0.25g / l of 5-fluorocytosine, in a pH range of 5.0 to 5.2 (see
Pore, 1973, App. Microbiology, 26: 648-649). Other suitable means for use with the methods of the invention can be easily identified by consulting the URL identified above, or by consulting other organizations that maintain cultures of microorganisms, such as SAG, CCAP or CCALA. SAG refers to the Algae Culture Collection at the University of Gottingen (Gottingen, Germany), CCAP refers to the collection of algae and protozoa cultures managed by the Association
Scottish Marine Sciences (Scotland, UK), and CCALA refers to the collection of laboratory algae cultures at the Institute of Botany (Treboñ, Czech Republic).
Additionally, U.S. Patent No. 5,900,370 describes media formulations and conditions suitable for the heterotrophic fermentation of the Prototheca species.
<img file="MX339639B_D0063.tif" />
For oil production, it is lmpuiLariLu tt — i »selection of a fixed carbon source, since the cost of the fixed carbon source must be low enough for oil production to be economical. Thus, although suitable carbon sources include, for example, acetate, floridoside, fructose, galactose, glucuronic acid, glucose, glycerol, lactose, trickle, Nacetylglucosamine, rhamnose, sucrose, and / or xylose, the selection of raw materials containing Such compounds is an important aspect of the methods of the invention. Suitable raw materials useful in accordance with the methods of the invention include, for example, black liquor, corn starch, depolymerized cellulosic material, buttermilk, molasses, potato, sorghum, sucrose, beet sugar, sugar cane, rice, and wheat. Carbon sources can also be provided as a mixture of sucrose and depolymerized beet sugar pulp. One or more carbon sources can be supplied at a concentration of at least about 50 QM, at least about 100 QM, at least about 500 ÜM, at least about 5 mM, at least about 50 mM, and at least about 500 mM, from one or more exogenously supplied fixed carbon sources. Carbon sources of
<img file="MX339639B_D0064.tif" />
Of particular interest for the purposes of the present invention include cellulose (in depolymerized form), glycerol, sucrose, and sorghum, each of which is discussed in more detail below.
In accordance with the present invention, the microorganisms can be grown using depolymerized cellulosic biomass as a raw material. Cellulosic biomass (eg, stubble like corn stubble) is cheap and readily available; however attempts to use this material as a raw material for yeast have failed. In particular, these raw materials have been found to have an inhibitory effect on yeast growth, and yeast cannot use the 5-carbon sugars produced from cellulosic materials (eg, xylose from hemicellulose). In contrast, microalgae can grow on processed cellulosic material.
Cellulosic materials generally include about 40-60% cellulose, about 20-40% hemicellulose; and 10-30% lignin.
Suitable cellulosic materials include residues of herbaceous and woody energy crops, as well as agricultural crops, i.e. parts of plants, mainly stems and leaves not removed from fields with
ΙΜΡΙ
MEXICAN INSTITUTE PE LA PtORIEPAP INDUSTRIAL
<img file="MX339639B_D0065.tif" />
the main food or fiber product. Examples include agricultural wastes such as sugarcane bagasse, rice husk, corn fiber (including stalks, leaves, husks and cobs), wheat straw, rice straw, beet sugar pulp, citrus pulp, citrus peel, forest waste such as wood and softwood thinning, hard and softwood, and waste from wood operations, wood waste such as factory waste (wood chips, sawdust) and pulp mill waste, urban waste, such as pieces of paper from urban solid waste, urban wood waste and green urban waste such as municipal grass clippings and wood construction waste. Additional cellulosic materials include dedicated cellulosic crops such as rod grass, hybrid poplar wood, miscanthus, reed fibers, and sorghum fibers. The 5-carbon sugars produced from these materials include xylose.
Cellulosic materials are treated to increase the efficiency with which the microbe can use the sugar (s) contained in the materials. The invention provides new methods for the treatment of materials
ΙΜΡΙ
MEXICAN INSTITUTE EU LA RROR1RDA ·
INDUSTRIAL
<img file="MX339639B_D0066.tif" />
cellulosic after acid blast to make materials suitable for use in a heterotrophic culture of microbes (eg, microalgae and oil yeasts). As discussed above, lignocellulosic biomass is comprised of several fractions, including cellulose, a crystalline beta-bond polymer.
1,4-glycosidics (a 6-carbon sugar), hemicellulose, a more closely associated polymer composed predominantly of xylose (a 5-carbon sugar), and to a lesser extent, crafty, galactose, arabinose, lignin, a complex aromatic polymer consisting of synapyl alcohol and its derivatives, and pectins, which are linear chains of a linked 1,4-polygalacturonic acid. Due to the polymeric structure of cellulose and hemicellulose, the sugars (eg, glucose and monomeric xylose) in them are not found in such a way that they can be used (metabolized) efficiently by many microbes. For these microbes, further processing of the cellulosic biomass to generate the monomeric sugars that make up the polymers can go a long way in ensuring that the cellulosic materials are used efficiently as a raw material (carbon source).
<img file="MX339639B_D0067.tif" />
IMPI
MEXICAN INSTITUTE
OF THE INDUSTRIAL ERT IgllDAD
Cellulosic or cellulose biomass — SS — 3ΠΠΤ5Γ5 — a — ΠΓΓ process, called an explosion, in which the biomass is treated with dilute sulfuric acid (or other) at elevated pressure and temperature. This process conditions the biomass so that it can be efficiently subjected to the enzymatic hydrolysis of the cellulosic and hemicellulosic fractions in glucose and xylose monomers. The monomeric sugars that are obtained are called cellulose sugars. Cellulosic sugars can subsequently be used by microorganisms to produce various metabolites (eg lipids). The acid blasting step results in partial hydrolysis of the hemicellulose fraction to obtain moñosaccharides. These sugars are completely released from the biomass. by means of a subsequent treatment. In some modalities, this treatment consists of a hydrothermal treatment that includes washing the exploited material with hot water, which removes contaminants such as salts. This stage is not necessary for cellulosic ethanol fermentations because more dilute concentrations of sugars are used in these processes. In other modalities, post treatment is additional acid treatment. In still other modalities, post treatment is hydrolysis
<img file="MX339639B_D0068.tif" />
enzymatic of the exploited material. These treatments can also be used in any combination. The type of treatment can affect the type of sugar released (for example, five-carbon sugars versus six-carbon sugars) and the stage at which they are released in the process.
As a consequence, different sugar currents can be created, which can be five or six carbon atoms. These enriched streams of five or six carbon atoms can then be targeted to specific microorganisms with different carbon utilization capabilities.
The methods of the present invention typically involve fermentation at higher cell densities than is achieved in ethanolic fermentation. Due to the high densities of the cultures for the heterotrophic production of cellulosic oil, the fixed carbon source (for example, the sugar stream (s) of the cellulosic derivative) is preferably in a concentrated form. The glucose level of the depolymerized cellulosic material is preferably at least 300 g / liter, at least 400 g / liter, at least 500 g / liter or at least 600 g / liter before the culture step, which is optionally a fed batch culture, in which cells are fed with the
<img file="MX339639B_D0069.tif" />
material as they grow and accumulate lipids. In the production of cellulosic ethanol, cellulosic sugar streams are not used at or near these concentration ranges.
Thus, to generate and maintain the high cell densities during the production of lignocellulosic oil, the carbon raw material (s) must be supplied to the heterotrophic cultures in a highly concentrated form. However, any component in the feed stream that is not a substrate and that is not metabolized by the oil-bearing microorganism will accumulate in the bioreactor, leading to problems if the component is toxic or has inhibitory activity on the production of the desired end product. . Although lignin, and by-products derived from lignin, by-products derived from carbohydrates, such as furfurals and hydroxymethylfurfurals and the salts derived from the generation of cellulosic materials (during the explosion process and the subsequent neutralization process), and even unmetabolized sugars pentose / hexose, can present problems in ethanolic fermentations, These effects are significantly amplified in processes in which their concentration in the initial raw material is high. To achieve sugar concentrations in the range of 300g / l (or
ΙΜΡΪ
INSTITUTO MEXICANA, DE LA RRORIEDAF 'industrial
<img file="MX339639B_D0070.tif" />
above) For six-carbon sugars that can be used in large-scale productions of the lignocellulosic oils described in the present invention, the concentration of these toxic materials may be 20 times higher than the concentration typically present in ethanolic biomass fermentations. cellulosic.
The treatment with the explosion process of the cellulosic material uses significant amounts of sulfuric acid, heat and pressure, therefore releasing byproducts of specifically furfural and hydroxymethylfurfural carbohydrates. Furfurals and hydroxymethylfurfurals are produced during the hydrolysis of hemicellulose by dehydrating xylose in furfural and water. In some embodiments of the present invention, these by-products (eg, furfurals and hydroxymethylfurfurals) are removed from the saccharified lignocellulosic material prior to introduction into the bioreactor. In some embodiments of the present invention, the carbohydrate by-product removal process is performed by hydrothermal treatment of the exploited cellulosic materials. Furthermore, the present invention provides methods in which strains capable of tolerating compounds such as furfurals and
ΙΜΡΙ
<img file="MX339639B_D0071.tif" />
INWISTRIAL hydroxymethylfurfurals are used for the production of lignocellulosic oils. In another embodiment, the present invention also provides methods and microorganisms that are not only capable of tolerating furfurals in the fermentation medium, but are actually capable of metabolizing these by-products during the production of lignocellulosic oil.
The explosion process also generates significant levels of salts. For example, typical blast conditions can result in conductivities greater than 5 mS / cm when the exploited cellulosic biomass is resuspended in a 10: 1 water: solids (dry weight) ratio. In certain embodiments of the present invention, the diluted exploited biomass is subjected to enzymatic saccharification, and the obtained supernatant is concentrated up to 25 times for use in the bioreactor. The salt level (measured by conductivity) in the concentrated sugar stream (s) can be unacceptably high (up to 1.5 M Na<sup>+ </sup>equivalents). Additional salts are generated with the neutralization of the exploited materials for the subsequent enzymatic saccharification process. The present invention provides methods for removing these salts so that the concentrated cellulosic sugar stream (s)
<img file="MX339639B_D0072.tif" />
resulting can be used in tieLeiútiuf us processes - to produce lignocellulosic oil. In some embodiments, the method of removing these salts is deionization with resins, such as, but not limited to, DOWEX Marathon
MR3. In certain embodiments, the resin deionization step occurs prior to sugar concentration or pH adjustment and hydrothermal treatment of the biomass prior to saccharification or any combination of the procedure; in other modalities this stage is carried out after one or more of these processes. In other embodiments, the blast process itself is changed to prevent generation of salts at unacceptable high levels.
For example, a suitable alternative for the explosion of cellulosic biomass with sulfuric acid (or another acid) is the manufacture of mechanical pulp to make the cellulosic biomass receptive to enzymatic hydrolysis (saccharification). In still other embodiments, native strains of microorganisms resistant to high levels of salt or genetically engineered strains with resistance to high levels of salt are used.
A preferred embodiment for the process of preparing exploited cellulosic biomass for use in the production of heterotrophic lignocellulosic oil using microbes
<img file="MX339639B_D0073.tif" />
ΙΜΡΙ oilseeds. A first stage involves adjusting- θ · ί · - · ρί · ί — of --- í-exploded cellulosic abiomass resuspended in the interval of
5.0-5.3 followed by washing the cellulosic biomass three times. This washing step can be performed using a variety of means including the use of desalting and ion exchange resins, reverse osmosis, hydrothermal treatment (as described above), or simply by repeated re-suspension in deionized water and centrifugation. This washing step results in a cellulosic current whose conductivity is between 100-300 pS / cm and the elimination of significant amounts of furfurals and hydroxymethylfurfurals. The decantation of this washing stage can be saved to concentrate the five-carbon sugars released from the hemicellulose fraction.
A second stage comprises the enzymatic saccharification of the washed cellulosic biomass. Accellerase (Genencor) is used in a preferred embodiment. A third stage involves the recovery of sugars by centrifugation or decantation and washing of the saccharified biomass. The resulting biomass (solids) is an energy-dense, lignin-rich component that can be used as fuel or disposed of as waste. The sugar stream recovered during the spin / decant and rinse process is collected. A fourth
<img file="MX339639B_D0074.tif" />
IMPI
MEXICAN INSTITUTE OF THE W «FIIDAD INOI ISTRIAL stage comprises microfiltration to remove solid contaminants and recover the permeate. A fifth stage comprises a concentration stage that can be performed using a vacuum evaporator. This step may optionally include the addition of antifoaming agents such as P'2000 (Sigma / Fluka), which is sometimes needed due to the protein content of the resulting sugar raw material.
In another embodiment of the methods of the invention, the carbon source is glycerol, including the acidified and unacidulated glycerol by-products obtained from the transesterification of biodiesel. In one embodiment, the carbon source includes glycerol and at least one other carbon source. In some cases, all glycerin and at least 15 other attached carbon source are supplied to the microorganism at the start of fermentation. In some cases, glycerin and the at least one other attached carbon source are supplied to the microorganism simultaneously at a predetermined ratio. In some cases, glycerol and at least one of the other fixed carbon sources are fed to the microbes at a predetermined rate during the course of fermentation.
<img file="MX339639B_D0075.tif" />
Some microalgae undergo cell division more rapidly in the presence of glycerol than in the presence of glucose (see PCT Pub. No. 2008/151149). In these cases, two-stage growth processes in which cells are first fed with glycerol to rapidly increase cell density, and then fed with glucose to accumulate lipids, can improve the efficiency with which lipids are produced. The use of the glycerol by-product from the transesterification process provides significant economic benefits by putting it back into the production process. Other feeding methods such as glycerol and glucose mixtures are also provided. Feeding such mixtures also provides the same economic benefits. Furthermore, the invention provides methods for feeding the microalgae with alternative sugars, such as sucrose in various combinations with glycerol.
In another embodiment of the methods of the invention, the carbon source is invert sugar. Invert sugar is produced by the separation of sucrose into its monosaccharide, fructose and glucose components. Invert sugar production can be achieved through various methods that are known in the art. One such method is to heat
<img file="MX339639B_D0076.tif" />
an aqueous sucrose solution. Frequently catalysts are used to accelerate the conversion of sucrose to invert sugar. These catalysts can be biological, for example enzymes such as invertases and sucrases can be added to sucrose to accelerate the hydrolysis reaction to produce invert sugar. Acid is an example of a non-biological catalyst, when combined with heat it can accelerate the hydrolysis reaction. Once invert sugar is prepared, it is less prone to crystallization compared to sucrose, and thus provides advantages for storage and fed batch fermentation, which in the case of heterotrophic cultivation of microbes, including microalgae , there is a need for a concentrated carbon source. In one embodiment, the carbon source is invert sugar, preferably in a concentrated form, preferably at least 800g / liter, at least 900g / liter, at least 1,000g / liter or at least 1,100g / liter prior to the step of culture, which is optionally a fed batch culture. Invert sugar, preferably in a concentrated form, is fed to cells over time as cells grow and accumulate lipids.
<img file="MX339639B_D0077.tif" />
ιμριγ ^
MEXICAN INSTITUTE
In another embodiment of the invpnrjón methods, the carbon source is sucrose, including a complex sucrose-containing raw material, such as thick cane juice from sugarcane processing. Due to the higher 5 densities of the cultures for heterotrophic oil production, the fixed carbon source (eg sucrose, glucose, etc.) is preferably in a concentrated form, preferably at least 500 g / liter, at least 600 g / liter, at least 700 g / liter or at least 800 g / liter of the fixed carbon source before the cultivation stage, which is optionally a fed batch culture in which the material is fed to the cells over time as the cells grow and accumulate lipids.
In some cases, the carbon source is sucrose in the form of thick cane juice, preferably in a concentrated form, preferably at least 60% solids or approximately 770 g / liter of sugar, at least 70% solids or approximately 925 g / liter of sugar, or at least
80% solids or approximately 1125 g / liter of sugar before the cultivation stage, which is optionally a fed batch culture. The thick juice from the concentrated cane feeds the cells over time as the cells grow and accumulate lipids.
IMPI
M £ X1CAN <i INSTITUTE
OF INDUSTRIAL PROPERTY
In one modality, the culture medium<sup>1</sup> UlC'lliytí, —also, 'at least one sucrose utilization enzyme. In some cases, the culture medium includes a sucrose invertase. In one embodiment, the sucrose invertase enzyme is a secretable sucrose invertase enzyme encoded by an exogenous sucrose invertase gene expressed by the population of microorganisms. Thus, in some cases, as described in more detail in Section IV, below, the microalgae was genetically modified to express a sucrose utilizing enzyme, such as a sucrose transporter, - a sucrose invertase, a hexokinase, a glucokinase, or a fructokinase.
Complex sucrose-containing raw materials include molasses waste from sugarcane processing; the use of these low-value sugar cane processing waste products provides significant cost savings from the production of hydrocarbons and other oils. Sorghum is another complex sucrose-containing raw material that is useful in the methods of the invention, including sorghum syrup and pure sorghum. Sorghum syrup is produced from the juice of sweet sorghum cane. Its sugar profile is mainly made up of glucose (dextrose), fructose and sucrose.
<img file="MX339639B_D0078.tif" />
<img file="MX339639B_D0079.tif" />
IMPI
MEXICAN INSTITUTE ». _,. . -. . OF RROFIÍDAD
Four. Industrial oil production
For the production of oil according to the method of the invention, it is preferred to cultivate the cells in the dark, as is the case, for example, when using very large fermenters (40,000 liters and of greater capacity) that do not allow the light reach the crop. Prototheca species are cultivated and propagated for oil production in a medium containing a fixed carbon source and in the absence of light; such growth is known as heterotrophic growth.
As an example, an inoculum of lipid-producing oil-bearing microbial cells, preferably microalgae cells are introduced into the medium; there is a lag period (lag phase) before the cells start to spread. After the latency period, the propagation speed increases at a constant rate and enters the log or exponential phase. The exponential phase, in turn, is followed by a slowdown in propagation due to decreased nutrients such as nitrogen, increased toxic substances, and quorum detection mechanisms. After this deceleration, the propagation stops and the cells enter a stationary phase or constant state, depending on the particular environment provided by the Mexican Institute.
ΠΕ THE OWN
INDUSTRIAL '• J **** · * · * .— to cells. To obtain h-io ™ ^<sup>3</sup> τ-i <-a in lipids, the crop typically harvests well after the end of the exponential phase, which can end early by allowing nitrogen or another key nutrient (other than carbon) to be depleted, forcing cells to convert excess carbon sources into lipids. The parameters of the culture conditions can be manipulated to optimize the total oil production, the combination of lipid species produced and / or the
1θ production of a specific oil.
As mentioned above, a bioreactor or fermenter is used to allow cells to undergo the various phases of their growth cycle. As an example, an inoculum of the lipid-producing cells can be introduced into a medium, followed by a latency period (lag phase) before the cells begin to grow.
After the latency period, the growth rate increases steadily and enters the log or exponential phase. The exponential phase, in turn, is followed by a slowdown in growth due to decreased nutrients and / or increased toxic substances. After this slowdown, growth stops, and cells enter a stationary phase or constant state,
<img file="MX339639B_D0080.tif" />
ΙΜΡΙ
MHKICAN INSTITUTE · depending on the particular environment provided to the cells. The production of lipids by the cells described in the present may occur during or after the exponential phase, including the stationary phase where nutrients are supplied, or are still available, to allow continued lipid production in the absence of cell division. .
Preferably, the microorganisms that grow using the conditions described herein and known in the art comprise at least about 20% by weight of lipids, preferably at least about 40% by weight, more preferably at least about 50% by weight. weight, and most preferably at least approximately
60% by weight. Process conditions can be adjusted to increase the performance of lipids suitable for a particular use and / or to reduce production costs. For example, in certain embodiments, a microalgae is grown in the presence of a limiting concentration of one or more nutrients, such as nitrogen, phosphorus, or sulfur, while providing excess fixed carbon energy such as glucose. Nitrogen limitation tends to increase the performance of microbial lipids, above the performance of microbial lipids in a culture in the
<img file="MX339639B_D0081.tif" />
ΙΜΡΙ
INSTITUTO MEXICANC UE LA FRORtDAP 'NnnSTRlAL that nitrogen is supplied in excess. In particular embodiments, the lipid yield increase is at least about: 10%, 50%, 100%, 200%, or 500%. The microbe can be grown in the presence of a limiting amount of a nutrient for a portion of the total culture period or for the entire period. In particular modalities, the nutrient concentration moves between a limiting concentration and a non-limiting concentration, at least twice during the total cultivation period. The lipid content of the cells can be increased by continuing the culture for longer periods of time, while providing excess carbon, limiting or not nitrogen.
[0005] In another embodiment, the yield in lipid production is increased by culturing a lipid-producing microorganism (eg, microalgae) in the presence of one or more cofactors of an enzyme of the lipid metabolic pathway (eg, an enzyme for the synthesis of fatty acids). In general, the concentration of the cofactor (s) is sufficient to increase the performance of microbial lipids (for example, fatty acids) above the performance of microbial lipids in the absence of the cofactor (s). In a modality
IMPI
MEXICAN INSTITUTE OF THE rtORBOAC INDUSTRIAL
<img file="MX339639B_D0082.tif" />
In particular, the cofactor (s) are provided to the culture by including a microbe in the culture (eg, microalgae) containing an exogenous gene encoding the cofactor (s). Alternatively, the cofactor (s) can be provided to a culture by including a microbe (eg, microalgae) containing an exogenous gene that encodes a protein that participates in cofactor synthesis. In certain embodiments, suitable cofactors include any vitamins required by a lipid pathway enzyme, such as, for example: biotin, pantothenate. Genes encoding cofactors suitable for use in the invention or involved in the synthesis of such cofactors are well known and can be introduced into microbes (eg, microalgae), using constructs and techniques as described above.
Specific examples of bioreactors, culture conditions, and heterotrophic growth and propagation methods described herein, can be suitably combined to improve the efficiency of microbial growth and the production of lipids and / or proteins.
Microalgae biomass with a high percentage of accumulated oils / lipids per dry weight is generated using
<img file="MX339639B_D0083.tif" />
different cultivation methods
DE IA RROglgOAP ινρι.ητμιαι.
that are known in the raa (see Pub. PCT no. 2008/151149). The microalgae biomass generated by the cultivation methods described herein and useful in accordance with the present invention comprises at least 10% microalgae oil per dry weight. In some embodiments, the microalgae biomass comprises at least 25%, at least 50%, at least 55%, or at least 60% microalgae oil per dry weight. In some embodiments, the microalgae biomass contains 10-90% microalgae oil, 25-75% microalgae oil, 40-75% microalgae oil, or 50-70% microalgae oil per dry weight.
The microalgae oil from the biomass described herein, or extracted from the biomass for use in the methods and compositions of the present invention, may comprise glycerolipids with one or more different esterified fatty acid side chains. Glycerolipids comprise one esterified glycerol molecule for one, two or three fatty acid molecules, which can be of different lengths and have different degrees of saturation. The length and saturation characteristics of fatty acid molecules (and microalgae oils) can be manipulated to modify the properties or
<img file="MX339639B_D0084.tif" />
ratios of fatty acid molecules in the microalgae ace of the present invention, via culture conditions or via lipid genetic engineering, as described in more detail below in Section IV. Therefore, specific mixtures of algae oil can be prepared from a single species of algae, by mixing biomass or algae oil from two or more species of microalgae, or by a mixture of algae oil of the invention. with oils from other sources such as soybean, rapeseed, cane, palm, palm kernel, coconut, corn, plant residues, Chinese tallow, olive, sunflower, cottonseed, chicken fat, beef tallow, porcine tallow, microalgae , macroalgae, microbes, cufea, flax, peanut, select white fat, lard, camelina sativa, mustard seeds, cashew nuts, oats, lupine, kenaf, marigold, hemp, coffee, flaxseed (flax), hazelnut, euphorbia, pumpkin seeds, coriander, camellia, sesame, safflower, rice, tung tree, cocoa, copra, opium poppy, castor beans, walnut, jojoba, macadamia, walnuts
Brazil, avocado, oil, or a distilled fraction of any of the above oils.
The composition of the oil, that is, the properties and proportions of the fatty acids that make up the
IMPI
ΤΓΠ5ΤΓΠ TO MEXICANO □ E LA FR «INDUSTRIAL FBDAD
<img file="MX339639B_D0085.tif" />
glycerolipids, can also be manipulated by combining the biomass or oil of at least two different species of microalgae. In some modalities, at least two of the different microalgae species have different glycerolipid profiles. The various microalgae species can be cultivated together or separately, as described herein, preferably under heterotrophic conditions, to generate the respective oils. Different species of microalgae may contain different percentages of the different fatty acids that make up the glycerolipids in the cell.
Generally, Prototheca strains have little or no C8-C14 chain length fatty acids. For example, Prototheca moriformis (UTEX 1435), Prototheca krugani (UTEX 329), Prototheca stagnora (UTEX 1442), and
Prototheca zopfii (UTEX 1438) do not contain (or contain undetectable amounts) of C8 fatty acids, between 0-0.01% CIO fatty acids, between 0.03-2.1% C12 fatty acids and between 1.0-1.7% C14 fatty acids.
In some cases, Prototheca strains containing a transgene encoding an acyl fatty ACP thioesterase that has activity towards the acyl fatty substrate ACP of C8 or C8-10 chain lengths have at least .- •. = S ' 2. 3
IMP I
MEXICAN INSTITUTE
DK LA MONffMD V INDUSTRIAL
1%, at least 1.5%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 12%, or at least 15% or more, fatty acids of length chain C8. In other cases, Prototheca strains containing a transgene encoding an acyl fatty ACP thioesterase that has activity towards the acyl fatty acp substrate of CIO chain lengths are at least 1%, at least 5%, at least 10 %, at least 15%, at least 20%, at least 24%, or at least 25% or more, CIO chain length fatty acids. In other cases, strains of
Prototheca containing a transgene encoding an acyl fatty acp-thioesterase that has activity towards the C12 chain length acyl fatty acp substrate has at least
1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 34%, at least 35% or at least 40% or more, C12 chain length fatty acids. In other cases, Prototheca strains containing a transgene encoding an acyl fatty ACP thioesterase that has activity towards the C14 chain length acyl fatty ACP substrate have at least 1%, at least 2%, at least 3 %, at least 4%, at least 5%, at least 6%, at least 7%, at least 10%, at least 15%, at least 30%, at least 43%, or at least 45% or more, C14 chain length fatty acids.
<img file="MX339639B_D0086.tif" />
IMPI
INSTITUT # MEXICANO • P LA rtOMBDAD
INDUSTRIAL
In non-limiting examples, Prototheca strains containing a transgene encoding an acyl fatty acp thioesterase that has activity towards the C8 chain length acyl fatty acp substrate have between 1% -25%, or between 1% - 15%, preferably 1.8-12.29%, of C8 chain length fatty acids. In other non-limiting examples, Prototheca strains containing a transgene encoding an acyl fatty ACP thioesterase that has activity towards the CIO chain length fatty acyl CIO-ACP substrate are between 1% -50%, or between l % -25%, preferably 1.9123.97% CIO chain length fatty acids. In other non-limiting examples, Prototheca strains containing a transgene encoding an acyl fatty acp thioesterase that has activity towards the acyl fatty acp substrate of C12 chain length is between 5% -50%, or between 10% -40, preferably 13.55-34.01%, of C12 chain length fatty acids. In other non-limiting examples, strains of
Prototheca containing a transgene encoding an acyl fatty acp-thioesterase that has activity towards the C14 chain length acyl fatty acp substrate has between 1% 60%, or between 2% -45%, preferably 2.59-43.27%, of C14 chain length fatty acids. In other non-limiting examples, the Prototheca strains containing a transgene
<img file="MX339639B_D0087.tif" />
ΙΜΡΙ encoding a fatty acyl-ACP thioesterase that has broad specificity towards variable carbon chain length acyl fatty-ACP substrates has up to 30%, up to 35%, or preferably up to 39.45% of 5-length fatty acids chain C16. In some cases, strains of
Prototheca containing a transgene encoding an acyl fatty acp thioesterase that has activity towards the acyl fatty acp substrate of chain lengths between C8 and C14 are between 1% -75%, or between 2% -60%, preferably 2.6910 57.98%, of medium chain fatty acids (C8-C14). In some cases, Prototheca strains containing a transgene encoding an acyl fatty-ACP thioesterase that has activity towards the acyl fatty-ACP substrates of chain lengths between C12 and C14 are at least 3 0%, at least 40 %, or at least 49% of C12-C14 fatty acids. In some cases, keeping the transgenic Prototheca strains under constant and high selective pressure to conserve exogenous genes is advantageous in increasing desired fatty acids of a specific chain length. High levels of exogenous gene retention can also be achieved by inserting exogenous genes into the nuclear chromosomes of cells using homologous vector recombination and the methods described herein. The cells
IMPI
MEXICAN INSTITUTE. • E LA RRORIJT-AD INDUSTRIAL
<img file="MX339639B_D0088.tif" />
Recombinants containing exogenous genes integrated into nuclear chromosomes are an object of the invention.
The microalgae oil can also include other components produced by the microalgae, or incorporated into the microalgae oil of the culture medium. These other constituents may be present in a greater or lesser amount depending on the culture conditions used to cultivate the microalgae, the microalgae species, the extraction method used to recover the microalgae oil from the biomass and other factors that may affect the composition of microalgae oil. Non-limiting examples of these constituents include carotenoids, present at 0.01-0.5 mcg / g, 0.025-0.3 mcg / g, preferably 0.05 to 0.244 micrograms / gram, of oil; chlorophyll A present from 0.01-0.5 mcg / g, 0.025-0.3 mcg / g, preferably 0.045 to 0.268 micrograms / gram, of oil;
total chlorophyll of less than 0.1 mcg / g, less than 0.05 mcg / g, preferably less than 0.025 micrograms / gram, of oil; gamma tocopherol present from 1-300 mcg / g, 35-175 mcg / g, preferably 38.3-164 micrograms / gram, of oil;
total tocopherols present of 10-500 mcg / g, 50-300 mcg / g, preferably 60.8 to 261.7 microgram / gram, of oil;
less than 1%, less than 0.5%, preferably less than 0.25%
ΙΜΡΙ
MEXICAN INSTITUTE • E LA PROPItOAO INDUSTRIAL
<img file="MX339639B_D0089.tif" />
brassicasterol, campesterol, stigmasterol, or beta-sytosterol; total tocotrienols less than 400 mcg / g, preferably less than 300 micrograms / gram, of oil; or total tocotrienols present at 100-500 mcg / g, 225-350 mcg / g, preferably 249.6 to 325.3 micrograms / gram, of oil.
The other components may include, without limitation, phospholipids, tocopherols, tocotrienols, carotenoids (for example, alpha-carotene, beta-carotene, lycopene, etc.), xanthophylls (for example, lutein, zeaxanthin, alpha-10 cryptoxanthine and beta-cryptoxanthin), and various organic or inorganic compounds. In some cases, the oil extracted from Prototheca species ranges from 0.001-0.01 mcg / g,
0.0025-0.05 mcg / g, preferably 0.003 to 0.039 microgram lutein / gram, oil, less than 0.01 mcg / g, less than
0.005 mcg / g, preferably less than 0.003 micrograms of lycopene / gram, of oil; and less than 0.01 mcg / g, less than
0.005 mcg / g, preferably less than 0.003 microgram of beta carotene / gram, of oil.
In some embodiments, the present invention 20 provides an oil microbial cell comprising a triglyceride oil, wherein the fatty acid profile of the triglyceride oil is selected from the group consisting of:
at least about 1%, at least about 2%, at
IΜ ΡI $ 5 ^^
INSTITUT · MEXICANO »F LA RRORIEDAD
INDUSTRIAL minus about 5%, at least about 7%, at least about 10%, or at least about 15%,
C8: 0; at least about 1%, at least about
5%, at least about 15%, at least about
20%, at least about 25%, or at least about
30%, C10: 0; at least about 1%, at least
<td>approximately</td><td>5%, at least approximately</td><td> 10%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>15%, at least approximately</td><td> 20%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>25%, at least approximately</td><td> 30%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>35%, at least approximately</td><td> 40%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>45%, at least approximately</td><td> 50%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>55%, at least approximately</td><td> 60%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>65%, at least approximately</td><td> 70%,</td><td>to the</td><td>less</td>
<td>approximately</td><td colspan="2">75%, or at least about 80</td><td> %,</td><td>C12: 0;</td>
at least about 2%, at least about 5%, at
<td>less</td><td>approximately</td><td> 10%,</td><td>to the</td><td>less about</td><td>15%, at</td>
<td>less</td><td>approximately</td><td> 20%,</td><td>to the</td><td>less about</td><td>25% at</td>
<td>less</td><td>approximately</td><td> 30%,</td><td>to the</td><td>less about</td><td>35% at</td>
<td>less</td><td>approximately</td><td> 40%,</td><td>to the</td><td colspan="2">minus approximately 45%, or at</td>
<td>less</td><td>approximately</td><td> 50%,</td><td colspan="3">C14: 0; at least about</td>
<td> 30%,</td><td>to the</td><td>less</td><td>approximately</td><td> 35%,</td><td>to the</td><td>less</td><td>approximately</td>
<td> 40%,</td><td>to the</td><td>less</td><td>approximately</td><td> 45%,</td><td>to the</td><td>less</td><td>approximately</td>
<td> 50%,</td><td>to the</td><td>less</td><td>approximately</td><td> 55%,</td><td>to the</td><td>less</td><td>approximately</td>
ΙΜΡΪ
MEXICAN INSTITUTE OF LA PRORÍT »A¡ · 'INDUSTRIAL
<img file="MX339639B_D0090.tif" />
60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about
<td>90%, C16-.0;</td><td>to the</td><td>minus about 5%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 10%,</td><td>at least about 15%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 20%,</td><td>at least about 25%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 30%,</td><td>at least about 35%,</td><td>to the</td><td>less</td>
about 40%, at least about 45%, or at least about 50%, C18: 0; at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90%,
<td>C18: l; less</td><td colspan="2">than</td><td>about 7%,</td><td colspan="2">less</td><td>than</td>
<td>approximately</td><td> 5%,</td><td colspan="2">less than about</td><td> 3%,</td><td colspan="2">less than</td>
<td>approximately</td><td> 1%,</td><td colspan="2">or about 0%, C18:</td><td>2; and</td><td>to the</td><td>less</td>
<td>approximately</td><td> 35%,</td><td>to the</td><td>less about</td><td> 40%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 45%,</td><td>to the</td><td>less about</td><td> 50%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 55%,</td><td>to the</td><td>less about</td><td> 60%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 65%,</td><td>to the</td><td>less about</td><td> 70%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 75%,</td><td>to the</td><td>less about</td><td> 80%,</td><td>to the</td><td>less</td>
<td colspan="3">about 85%, or saturated fatty acids.</td><td colspan="2">at least about</td><td> 90</td><td>%, of</td>
100
In some embodiments, the oil microbial cell
<img file="MX339639B_D0091.tif" />
It comprises triglyceride oil, which comprises the fatty acid profile selected from the group consisting of:
<td>total combined quantities</td><td>from C8: 0 and CIO: 0 from to</td><td>less</td>
<td>about 10% at least</td><td>approximately 20%,</td><td>less</td>
<td>about 3 0%, at least</td><td>approximately 40%, at</td><td>less</td>
<td>about 50% at least</td><td>approximately 60%, at</td><td>less</td>
<td>about 7 0%, at least</td><td>approximately 80%, at</td><td>less</td>
<td colspan="3">about 90%, or about 100%; quantities</td>
<td>combined totals of C10: 0,</td><td>C12: 0, and C14: 0 from to</td><td>less</td>
<td>about 50% at least</td><td>approximately 60%, at</td><td>less</td>
<td>about 70% at least</td><td>approximately 80%, at</td><td>less</td>
<td colspan="3">about 90%, or about 100%; quantities</td>
<td>combined totals of C16: 0,</td><td>C18: 0 and C18: 1 from to</td><td>less</td>
<td>about 60% at least</td><td>approximately 70%, at</td><td>less</td>
<td colspan="3">about 80%, at least about 90%, or</td>
approximately 100%; total combined amounts of C18: 0,
C18: 1 and C18: 2 of at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; total combined amounts of C14: 0, C16: 0, C18: 0 and C18: 1 of at least about 60%, at least about 70s%, at least about 80%, at least about 90%, or
101
<img file="MX339639B_D0092.tif" />
approximately 100%; and total combined amounts of
C18: 1 and C18: 2 of less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, or about 0%.
In some embodiments the oil microbial cell comprises triglyceride oil with a fatty acid profile comprising a ratio of fatty acids selected from the group consisting of: a C8: 0 ratio to
C10: 0 of at least about 5 to 1, at least 6 to 1, at least 7 to 1, at least 8 to 1, at least 9 to 1, or at least 10 to
one; a C10: 0 to C12: 0 ratio of at least about 6 to
1, at least 7 to 1, at least 8 to 1, at least 9 to 1, or at least to 1; a C12: 0 to C14: 0 ratio of at least about 5 to 1, at least 6 to 1, at least 7 to 1, at least 8 to 1, at least 9 to 1, or at least 10 to 1; A relationship
C14: 0 to C12: 0 of at least 7 to 1, at least 8 to 1, at least 9 to
1, or at least 10 to 1; and a C14: 0 to C16: 0 ratio of at least 1 to 2, at least 1 to 3, at least 1 to 4, at least 1 to 5, at least 1 to 6, at least 1 to 7, at least 1 at 8, at least 1 at
9, or at least 1 to 10.
In some embodiments, the present invention provides an oil microbial cell comprising
ΙΜ
102
<img file="MX339639B_D0093.tif" />
INSTITUTO MEXICANI1 γ DE LA PROntDAD \ a triglyceride oil composition, wherein the fatty acid profile of the triglyceride oil is selected from the group consisting of: at least about 1%, at least about 2%, at least about 5%, at less than about 7%, at least about 10%, or at least about 15%, C8: 0; at least about 1%, at least about 5%, at least about 15%, at least about 20%, at least about 25%, or at least about 30% C10: 0; at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80%, C12: 0; at least about 2%, at least about 5%, at least about 10%, at least about
15%, at least about 20%, at least about
25%, at least about 30%, at least about
35%, at least about 40%, at least about
45%, or at least about 50%, C14: 0; at least
103
<img file="MX339639B_D0094.tif" />
i ívi ri
MEXICAN INSTITUTE OE INOIISTRJAL PROPERTY
<td>approximately</td><td> 30%,</td><td>at least about 35%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 40%,</td><td>at least about 45%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 50%,</td><td>at least about 55%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 60%,</td><td>at least about 65%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 70%,</td><td>at least about 75%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 80%,</td><td>at least about 85%, or</td><td>to the</td><td>less</td>
<td>approximately</td><td> 90%,</td><td colspan="2">C16: 0; at least about 5</td><td>% al</td>
<td>less</td><td>approximately</td><td>10% at</td><td>less</td><td>approximately</td><td> 15%,</td><td>to the</td>
<td>less</td><td>approximately</td><td>20% at</td><td>less</td><td>approximately</td><td> 25%,</td><td>to the</td>
<td>less</td><td>approximately</td><td>30% at</td><td>less</td><td>approximately</td><td> 35%,</td><td>to the</td>
less than about 40%, at least about 45%, or at least about 50%, C18: 0; at least about
<td> 60%,</td><td>to the</td><td>less</td><td>approximately 65%, at</td><td>less</td><td>approximately</td>
<td> 70%,</td><td>to the</td><td>less</td><td>approximately 75%,</td><td>less</td><td>approximately</td>
<td> 80%,</td><td>to the</td><td>less</td><td>about 85%, or at</td><td>less</td><td>approximately</td>
90%, C18: l; less than about 7%, less than
<td>approximately</td><td colspan="2">5% less than</td><td>approximately</td><td> 3%,</td><td colspan="2">less than</td>
<td>approximately</td><td colspan="3">1%, or about 0%, C18:</td><td>;2; and</td><td>to the</td><td>less</td>
<td>approximately</td><td>35% at</td><td>less</td><td>approximately</td><td> 40%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>45% at</td><td>less</td><td>approximately</td><td> 50%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>55% at</td><td>less</td><td>approximately</td><td> 60%,</td><td>to the</td><td>less</td>
<td>approximately</td><td>65% at</td><td>less</td><td>approximately</td><td> 70%,</td><td>to the</td><td>less</td>
about 75%, at least about 80%, at least
104
<img file="MX339639B_D0095.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE J ^ · PE LA ΕΜΟΡΙίΠΑΓ; Λ
Τ ΓΓ \ ν * ΓΙΓΜΛ »<
INDD'STIUAL about 85%, or at least about 90%, of saturated fatty acids.
In some embodiments, the oleaginous microbial triglyceride oil composition comprises triglyceride oil comprising a fatty acid profile in which: the total combined amount of C10: 0, C12: 0 and C14: 0 is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the total combined amount of C16: 0, C18: 0 and C18: l is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the total combined amount of C18: 0,
C18: l and C18: 2 is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the total combined amount of C14: 0, C16: 0, C18: 0 and C18: l is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% ; the total combined amount of C8: 0 and
C10: 0 is less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than
<img file="MX339639B_D0096.tif" />
105 about 25%, less than about 2 0%, more than about 15%, less than about 10%, less than about 5%, or about 0%.
In some embodiments, the oleaginous microbial triglyceride oil composition comprises triglyceride oil with a fatty acid profile comprising a ratio of fatty acids selected from the group consisting of: a C8: 0 to C10: 0 ratio of at least about 5 to
1, at least about 6 to 1, at least about 7 to, at least about 8 to 1, at least about 1, or at least about 10 to 1; a C10: 0 to C12: 0 ratio of at least about 6 to 1, at least about 7 to 1, at least about 8 to 1, at least about 9 to 1, or at least about 10 to
one; a C12: 0 to C14: 0 ratio of at least about 5 to
1, at least about 6 to 1, at least about 7 to, at least about 8 to 1, at least about 1, or at least about 10 to 1; a C14: 0 to C12: 0 ratio of at least about 7 to 1, at least about 8 to 1, at least about 9 to 1, or at least about 10 to 1; a C14: 0 to C16: 0 ratio of at least about 1 to 2, at least about 1 to
3, at least about 1 to 4, at least about 1
106
<img file="MX339639B_D0097.tif" />
to 5, at least about 1 to 6, at least, about 7, at least about 1 to 8, at least about 1 to 9, or at least about 1 to 10.
In some embodiments, the present invention provides a method of producing an oleaginoidal microbial triglyceride oil composition with a fatty acid profile selected from the group consisting of: at least about 1%, at least about 2%, at least about 5%, at least about 7%, at least about 10%, or at least about 15%, C8: 0; at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, or at least about 30%, C10: 0; at least about
1%, at least about 5%, at least about
10%, at least about 15%, at least about
20%, at least about 25%, at least about
30%, at least about 35%, at least about
40%, at least about 45%, at least about
50%, at least about 55%, at least about
60%, at least about 65%, at least about
70%, at least about 75%, or at least about
80%, C12: 0; at least about 2%, at least
<img file="MX339639B_D0098.tif" />
107
IMPÍ
INSTITUTO MWüCANO Ot LA MOWSDAU INOUSTMIAL
<td>approximately</td><td> 5%,</td><td>to the</td><td>less</td><td>approximately</td><td> 10%.</td><td>to the</td><td>mPTins ..</td>
<td>approximately</td><td> 15%,</td><td>to the</td><td>less</td><td>approximately</td><td> 20%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 25%,</td><td>to the</td><td>less</td><td>approximately</td><td> 30%,</td><td>to the</td><td>less</td>
<td>approximately</td><td> 35%,</td><td>to the</td><td>less</td><td>approximately</td><td> 40%,</td><td>to the</td><td>less</td>
about 45%, or at least about 50%, C14: 0;
<td>to the</td><td>minus about 30%,</td><td>to the</td><td>less</td><td>approximately</td><td> 35%,</td>
<td>to the</td><td>minus about 40%,</td><td>to the</td><td>less</td><td>approximately</td><td> 45%,</td>
<td>to the</td><td>minus about 50%,</td><td>to the</td><td>less</td><td>approximately</td><td> 55%,</td>
<td>to the</td><td>minus about 60%,</td><td>to the</td><td>less</td><td>approximately</td><td> 65%,</td>
<td>to the</td><td>minus about 70%,</td><td>to the</td><td>less</td><td>approximately</td><td> 75%,</td>
<td>to the</td><td>minus about 80%,</td><td colspan="4">at least about 85%, or</td>
<td>to the</td><td>minus about 90%,</td><td>C16:</td><td>0; to the</td><td colspan="2">less about</td>
<td> 5%,</td><td>at least about</td><td> 10%</td><td>to</td><td colspan="2">less about</td>
<td> 15%,</td><td>to the</td><td>minus about 20%,</td><td>to the</td><td>less</td><td>approximately</td>
<td> 25%,</td><td>to the</td><td>minus about 30%,</td><td>to the</td><td>less</td><td>approximately</td>
<td> 35%,</td><td>to the</td><td>minus about 40%,</td><td>to the</td><td>less</td><td>approximately</td>
<td> 45%,</td><td>or</td><td>at least about</td><td colspan="3">50% C18: 0; at least</td>
about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90%, C18: 1; less than about 7%, less than about 5%, less than about 3%, less than about 1%, or about 0%, C18: 2; and
108
Mexicano Mexican Institute of Industrial _ Industrial Proneness * »
<img file="MX339639B_D0099.tif" />
at least about 35 'at least about 45' at least ^ .pTú.-imndnm ^ tA 4 0%.
at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least minus approximately 90%, of saturated fatty acids, where the method comprises the steps of: (a) culturing a population of oil microbial cells in a culture medium up to at least 10% of the dry cell weight of the oil microbial cells is triglyceride oil; and (b) isolating the triglyceride oil composition from the oil microbial cells.
In some embodiments, the method of producing oleaginous microbial triglyceride oil compositions produces triglyceride oils comprising a fatty acid profile in which: the total combined amount of C10: 0,
C12: 0 and C14: 0 is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the total combined amount of C16: 0,
C18: 0 and C18: 1 is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the amount
109
IMPI
DELA PROREDAB INDUSTRIAL MEXICAN INSTITUTE
<img file="MX339639B_D0100.tif" />
combined total of C18: 0, C18: l and C18: 2 is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the total combined amount of C14: 0,
C16: 0, C18: 0 and C18: l is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%; the
<td>combined quantity</td><td>total</td><td>of</td><td>C8: 0 and CIO: 0</td><td>is</td><td>less</td><td>than</td>
<td>about 50%,</td><td>less</td><td>than</td><td>approximately</td><td> 45%,</td><td>less</td><td>than</td>
<td>about 40%,</td><td>less</td><td>than</td><td>approximately</td><td> 35%,</td><td>less</td><td>than</td>
<td>about 30%,</td><td>less</td><td>than</td><td>approximately</td><td> 25%,</td><td>less</td><td>than</td>
<td>about 20%,</td><td>less</td><td>than</td><td>approximately</td><td> 15%,</td><td>less</td><td>than</td>
<td>about 10%</td><td colspan="2">, less</td><td colspan="3">that about 5%,</td><td>or</td>
about 0%.
In some embodiments, the method of producing oleaginous microbial triglyceride oil compositions produces triglyceride oils with a fatty acid profile comprising a ratio of triglyceride oils selected from the group consisting of: a C8: 0 ratio to
C10: 0 of at least about 5 to 1, at least about 6 to 1, at least about 7 to 1, at least about 8 to 1, at least about 9 to 1, or at least about 10 to 1; a C10: 0 to C12: 0 ratio
110
IMPI
MfXICAN INSTITUTE · say the INDUSTRIAL noneuAD
<img file="MX339639B_D0101.tif" />
at least about 6 to 1, at least about 7 to, at least about 8 to 1, at least about 1, or at least about 10 to 1; a C12: 0 to C14: 0 ratio of at least about 5 to 1, at least about 6 to 1, at least about 7 to 1, at least about 8 to 1, at least about 9 to 1, or at least about 10 to 1; a C14: 0 to C12: 0 ratio of at least about 7 to 1, at least about 8 to 1, at least about 9 to 1, or at least about 10 to 1; and a C14: 0 to C16: 0 ratio of at least about 1 to 2, at least about 1 to 3, at least about 1 to 4, at least about 1 to 5, at least about 1 to 6, at least about 1 to 7, at least about 1 to 8, at least about 9, or at least about 1 to 10.
III. GENETIC ENGINEERING METHODS AND MATERIALS
The present invention provides methods and materials for genetically modifying microorganisms, including Prototheca cells and recombinant host cells, useful in the methods of the present invention, including but not limited to, Prototheca moriformis host cells,
Recombinant Prototheca zopfii, Prototheca krugani, and Prototheca stagnora. The description of these methods and lll
IMPI
DELA WilFIBDAD MEXICAN INSTITUTE
INDUSTRIAL
<img file="MX339639B_D0102.tif" />
Materials is divided into subsections for the convenience of the reader. In subsection 1, the transformation methods are described. In subsection 2, genetic engineering methods are described through the use of homologous recombination. In subsection 3, expression vectors and components are described.
In certain embodiments of the present invention, it is preferred to genetically modify a microorganism to improve lipid production, modify the properties or proportions of components generated by the microorganism, or improve or re-provide growth characteristics in a variety of raw material materials.
Chlorella, particularly Chlorella protothecoides,
Chlorella minutissima, Chlorella sorokiniana, Chlorella ellipsoidea, Chlorella sp., And Chlorella emersonii are the preferred microorganisms for use in the genetic modification methods described in the present disclosure, although other Chlorella species as well as other varieties of microorganisms may be used.
Promoters, cDNA, and 3'UTR, as well as other elements of the vectors, can be generated through cloning techniques using fragments isolated from native sources (see, for example, Molecular Cloning: A Laboratory
112
IMPI
INSTITUTO MiXICAN '
PROPERTY i ^ .. ~ industpial Sjria
Manual, Sambrook and others (3rd edition, 2001, Coid Spring
Harbor Press; and US Patent 4,683,202).
Alternatively, the elements can be generated synthetically using known methods (see, for example,
Gene. 1995 Oct 16; 164 (1): 49-53).
one. Engineering Methods - Transformation [0006] Cells can be transformed by any suitable technique including, for example, biolistics, electroporation (see Maruyama et al., (2004) Biotechnology Techniques 8: 821-826), transformation by glass beads and transformation by whiskers of silicon carbide. Another method that can be used involves protoplast formation and the use of CaCl<sub>2</sub> and polyethylene glycol (PEG) to introduce recombinant DNA into microalgae cells (see Kim et al. (2002), Mar. Biotechnol. 4: 63-73, reporting the use of this method for the transformation of Chorella ellipsoidea). Microalgae co-transformation can be used to introduce two different vector molecules into a cell simultaneously (see eg Protist 2004
Dec; 155 (4): 381-93).
[0007] Biolistic methods (see, for example, Sanford,
Trends In Biotech. (1988) 6: 299 302, U.S. Patent
United no. 4,945,050; electroporation (Fromm et al., Proc.
113
IMPI
MOUCANO INSTITUTE delapmomedau INDUSTRIAL
<img file="MX339639B_D0103.tif" />
Nati. Acad Sci., (USA) (1985) 82: 5824 5828); Using a laser beam, microinjection or any other method capable of introducing DNA into a microalgae can also be used for the transformation of a Prototheca cell.
Any convenient technique for introducing a transgene into a microorganism, such as Chorella, can be used in the present invention. Dawson et al. (1997) (supra) describe the use of microprojectile bombardment to introduce the nitrate reductase (NR) gene from Chlorella vulgaris into mutants of Chlorella sorokiniana
NR-deficient, resulting in stable transformants.
Briefly, 0.4 micron tungsten beads were plasmid coated; 3 X 10<sup>7</sup>C. sorokiniana cells were spread in the third center of a non-selective agar plate and bombarded with the PDS-1000 / He Biolistic Partióle system
Delivery® (Bio-Rad).
A preferred method of introducing a transgene into a microorganism, such as Chlorella, is the method described by Kim et al. (2002), Mar. Biotechnol. 4: 63-73. Kim reports the transformation of Chorella elllpsoidea protoplasts using
CaCl<sub>2</sub> and polyethylene glycol (PEG). In particular, protoplasts were prepared by culturing C. ellipsoidea cells at a density of 1-2 X 10<sup>8</sup>/ Ml. The cells are
114
MEXICAN INSTITUTE '/ L · DE LA FROPIEDAC
INDUSTRIAL recovered and washed by centrifugation for 5 minutes at 1600 g and resuspended in 5 ml of phosphate buffer (Ph 6.0) containing 0.6 M sorbitol, 0.6 M mannitol, 4% (w / v) cellulose (Calbiochem), 2 % (weight / volume) of macerase (Calbiochem), and 50 units of pectinase (Sigma). The cell suspension was incubated at 25 ° C for 16 hours in the dark with gentle shaking. The resulting protoplasts were recovered by centrifugation at 400g for 5 minutes. The pellet was delicately resuspended in 5 ml of f / 2 medium containing 0.6M sorbitol and 0.6M mannitol and centrifuged at 400g for 5 minutes. This pellet was resuspended in 1 ml of a 0.6 M sorbitol / mannitol solution containing 50 mM CaCl<sub>2</sub>. Then 5 mg of the transgene DNA was added, along with 25 ug calf thymus DNA (Sigma), to 10<sup>7</sup>-10<sup>8</sup> protoplasts at 0.4 Mi. After 15 minutes at room temperature, 2 00 di of PNC (40% polyethylene glycol 4000, 0.8 M NaCl, 50 Mm CaCl) were added<sub>2</sub>) and carefully mixed for 30 minutes at room temperature. Following this, 0.6 ml of the f / 2 medium supplemented with a 0.6 M sorbitol / mannitol solution, 1% yeast extract and 1% glucose was added, and the transformed cells were incubated at 25 ° C for 12 hours in the dark. for the regeneration of the cell wall.
A
115
<img file="MX339639B_D0104.tif" />
ΙΜΡΙ
INSTITUTO MEXICANL DE LA ntOHEDAD INDUSTRIAL similar method was used by Huang et al. (2007) (supra) to introduce a transgene encoding mercuric reductase in
Chlorella sp. DT.
Furthermore, electroporation was used to transform microorganisms, such as Chorella. As reported
Maruyama et al. (2004), Biotechnology Techniques 8: 821-826 (incorporated by reference in its entirety herein), this technique was used to introduce a transgene into Chlorella saccharophila c-211-la protoplasts prepared from cells in stationary phase. The transient expression of the introduced plasmid was observed under a resistance field of between 600 and 900 V / cm, and a pulse duration of around 400 ms, where a membrane permeability greater than 70-kDa FITCdextran was verified.
Examples of expression of transgenes in microorganisms, such as Chlorella, can be found in the literature (see for example Current Microbiology Vol. 35 (1997), pp. 356-362; Sheng Wu Gong Cheng Xue Bao. 2000
Jul; 16 (4): 443-6; Current Microbiology Vol. 38 (1999), pgs.
335-341; Appl Microbiol Biotechnol (2006) 72: 197-205; Marine Biotechnology 4, 63-73, 2002; Current Genetics 39: 5, 365-370 (2001); Plant Cell Reports 18: 9, 778-780, (1999); biology
116
IMPI
<img file="MX339639B_D0105.tif" />
Plantarium 42 (2): 209-216, (1999);
20, (2 005)). See also the examples in the present description.
Examples of expression of transgenes in oil yeast (eg, Yarrowia lipolytica) can be found in the literature (see, eg, Bordes et al., J Microbiol Methods, Jun 27 (2007)). Examples of expression of transgenes in 'fungi (for example, Mortierella alpine, Mucor circinelloid.es, and Aspergillus ochraceus) can also be found in the literature (see, for example,
Microbiology, Jul; 153 (Pt. 7): 2013-25 (2007); Mol Genet
Genomics, Jun; 271 (5): 595-602 (2004); Curr Genet,
Mar; 21 (3): 215-23 (1992); Current Microbiology, 30 (2): 83-86 (1995); Sakuradani,. NISR Research Grant, Studies
Metabolic Manipulation of Useful Lipid-Producing Microorganisms (2004); and PCT / JP2004 / 012021). Examples of exogenous gene expression in bacteria such as E. coli are well known; see for example Molecular Cloning: A
Laboratory Manual, Sambrook et al. (3rd edition, 2001, Coid
Spring Harbor Press.
Vectors for the transformation of microorganisms in accordance with the present invention can be prepared by familiar techniques known to those experienced in <sup>117</sup> IMPI
INSTITUTO MEXICANA DE IA RRORIEDAD INDUSTRIAL the subject. The nucleotide sequence of the construct used for transformation of multiple Chlorella species corresponds to sec. with no. ID: 8. In one embodiment, an illustrative vector design for expression of a lipase gene in a microorganism such as a microalgae contains a gene encoding a lipase in operable linkage with an active promoter in microalgae.
Alternatively, if the vector does not contain a promoter in operative linkage to the gene of interest, the gene can be transformed in cells such that it becomes operably linked to an endogenous promoter at the point of vector integration. The promoter-free transformation method was shown to work on microalgae (see for example Plant Journal 14: 4, (1998), pp. 441-447). The vector may further contain a second gene that encodes a protein that, for example, imparts resistance to an antibiotic or herbicide, i.e., a selectable marker.
Optionally, one or both genes is / are followed by a 3 'untranslated sequence containing a polyadenylation signal. The expression cassettes encoding the two genes can be physically linked in one vector or in separate vectors. Co-transformation of microalgae can also be used, in which different vector molecules are used
<img file="MX339639B_D0106.tif" />
118
<img file="MX339639B_D0107.tif" />
ΙΜΡΙ simultaneously to transform cells (see, eg, Protist 2004 Dec; 155 (4): 381-93). Transformed cells can optionally be selected based on the ability to grow in the presence of the antibiotic or other selectable marker under conditions where cells lacking the resistance cassette would not grow.
2. Engineering Methods - Homologous Recombination
Homologous recombination is the ability of complementary DNA sequences to align and exchange regions of homology. Transgenic (donor) DNA containing sequences homologous to the target genomic (template) sequences is introduced into the body and then recombination within the genome takes place at the site of the corresponding homologous genomic sequence. The mechanistic steps in this process, in most cases, include: (1) pairing the homologous DNA segments, (2) the introduction of double-stranded breaks in the donor DNA molecule, (3) invasion of the standard DNA molecule by the free ends of the donor's DNA followed by DNA synthesis; and (4) resolution of repair events for double-strand breaks that result in the end products of recombination.
<img file="MX339639B_D0108.tif" />
The ability to carry out recombination
119
Homologous IMPI in a host organism has many practical implications, so it can be carried out at the molecular genetic level and is useful in generating an oleaginous microbe that can produce specific oils. By its very nature homologous recombination is a precise gene-targeting event, therefore most transgenic lines that are generated with the same targeting sequence will be essentially identical in terms of phenotype, thus requiring the evaluation of far fewer transformation events. Homologous recombination also targets gene insertion events on the host chromosome, resulting in excellent genetic stability, even in the absence of genetic selection. Because different chromosomal loci could impact gene expression, even from heterologous / UTR promoters, homologous recombination may be a method of searching for a locus in an unfamiliar genomic environment and evaluating the impact of these environments on gene expression.
A particularly useful application of genetic engineering using homologous recombination is to co-opt host-specific regulatory elements such as promoters / UTRs to drive expression of heterologous genes.
120
<img file="MX339639B_D0109.tif" />
in a highly specific way. For example, ablation or gene inactivation of the desaturase gene / gene families could be expected to increase the total percentage of saturated fatty acids produced in the host cell by a heterologous gene encoding a selective marker. The
Example 11 describes the homologous recombination directed at the constructs and an example of such ablations or inactivations of the desaturase gene generated in Prototheca moriformis.
Because homologous recombination is a precise gene-directed event, it can be used to precisely modify any nucleotide (s) within a gene or sequence of interest, as long as enough flank regions are identified. Therefore, homologous recombination can be used as a means to modify regulatory sequences that affect gene expression of
RNA and / or proteins. It can also be used to modify protein coding regions in an effort to modify enzyme activities such as substrate specificity, affinities, and Km, and thus affect the desired change in host cell metabolism. . Homologous recombination provides a powerful means of manipulating the host genome, resulting in targeted mutagenesis, gene conversion,
121
IMPI
<img file="MX339639B_D0110.tif" />
gene deletion, gene duplication, gene reversal, and the exchange of gene expression regulatory elements such as promoters, enhancers, and
3'UTR.
Homologous recombination can be accomplished through the use of targeting constructs containing pieces of endogenous sequences to target the gene or region of interest in the endogenous host cell genome. Such targeting sequences can be located either 5 'from the gene or region of interest, 3' from the gene / region of interest, or even flank the gene / region of interest. Such targeting constructs can be transformed within the host cell, either as a supercoiled DNA plasmid with an additional vector backbone, a PCR product without a vector backbone, or as a linear molecule. In some cases, it may be advantageous to first expose the homologous sequences within the transgenic DNA (donor DNA) with a restriction enzyme. This stage can increase the efficiency of recombination and decrease the occurrence of unwanted events. Other methods to increase recombination efficiency include the use of PCR to generate transformed transgenic DNA containing linear ends homologous to the target genomic sequences.
<img file="MX339639B_D0111.tif" />
122
IMPI
For non-limiting illustration purposes, donor DNA sequence regions that are useful for homologous recombination include the KE858 region of DNA in
Prototheca moriformis. KE858 is a 1.3 kb genomic fragment, spanning part of the coding region for a protein that shares homology with the transfer RNA (tRNA) family of proteins. Southern blotting demonstrated that the KE858 sequence was present in a single copy in the Prototheca moriformis genome (UTEX 1435). This region and the examples of use of this region for homologous targeted recombination are described in PCT application no. PCT / US2009 / 66142. Another donor DNA region that is useful in portions of the 6S region genomic sequence. The use of this sequence in homologous recombination in Prototheca morifomis is described below in the examples.
3. Vectors and vector components
Vectors for transforming microorganisms in accordance with the present invention can be prepared by familiar techniques known to those skilled in the art in view of the description herein. A vector typically contains one or more genes in which each gene encodes for the expression of a desired product (the
123
ΙΜΡΙ rNSTTT'JTO MtXICANi; PE THE FWOWBDAI? INDUSTRIAL
<img file="MX339639B_D0112.tif" />
gene product) and operably binds to one or more control sequences that regulate gene expression or direct the gene product to a location in the recombinant cell. To assist the reader, this subsection is divided into subsections. Subsection A describes the control sequences that are typically found in vectors, as well as new control sequences that are provided in the present invention. Subsection B describes genes that are typically found in vectors, as well as new codon optimization methods and genes that are prepared by using the same provided by the invention.
A. Control sequences
Control sequences are nucleic acids that regulate the expression of a coding sequence or direct a gene product to a particular location inside or outside the cell. Control sequences that regulate expression include, for example, promoters that regulate transcription of a coding sequence and terminators that terminate transcription of a coding sequence.
Another control sequence is a 3 'untranslated sequence that is located at the end of a coding sequence that encodes a polyadenylation signal. The sequences of
124
IMPI
MEXICAN INSTITUTE • E LA ΓΚΟΓΙΕΟαΓ, industrial
<img file="MX339639B_D0113.tif" />
Controls that target gene products to a particular location include those that encode signal peptides, which target the protein to which they are attached to a particular location inside or outside the cell.
Therefore, an exemplary vector design for expression of an exogenous gene in a microalgae contains a sequence that encodes a product of the desired gene (for example, a selection marker, an enzyme that modifies the lipid pathway, or a sucrose utilizing enzyme) in an operative link with an active promoter in microalgae. Alternatively, if the vector does not contain a promoter in operative linkage to the coding sequence of interest, the coding sequence can be transformed within cells such that it becomes operably linked to an endogenous promoter at the point of vector integration. . The promoter-free transformation method was shown to work on microalgae (see for example Plant Journal 14: 4, (1998), pp. 441-447).
[0008] Many promoters are active on microalgae, including promoters that are endogenous to transforming algae, as well as promoters that are not endogenous to transforming algae (ie promoters of other algae, promoters of higher plants , and the promoters of
<img file="MX339639B_D0114.tif" />
125
IMPI plant virus or algae virus). Illustrative exogenous or endogenous promoters that are active in microalgae (as well as genes for resistance to functional antibiotics in microalgae) are described in PCT publication no.
2008/151149 and references cited there).
The promoter that is used to express an exogenous gene can be the promoter that naturally binds to that gene or it can be a heterologous gene. Some promoters are active in more than one species of microalgae. Other promoters are species specific. Illustrative promoters include promoters such as Chlamydomonas reinhardtii β-tubulin, which is used in the examples below, and viral promoters, such as cauliflower mosaic virus (CMV) and Chlorella virus, which were shown to be active. in multiple microalgae species (see, for example, Plant Cell Rep. 2005 Mar, -23 (10-11): 727-35; J
Microbiol. 2005 Aug; 43 (4): 361-5; Mar Biotechnol (NY). 2002
Jan; 4 (1): 63-73). Another promoter that is suitable to use for the expression of exogenous genes in Prototheca is the Chlorella sorokiniana glutamate dehydrogenase / 5'UTR promoter. Optionally, at least 10, 20, 30, 40 are used,
50, or 60 nucleotides or more of these sequences containing a promoter. Illustrative promoters useful for
126
ΙΜΡΪ
MIXlUA INSTITUTE. '»Say LA MOREDAP INDUSTRIAL
<img file="MX339639B_D0115.tif" />
Exogenous gene expression in Prototheca are listed in the sequence listing of this application, such as the Chlorella HUPl gene promoter (sec. with ID #: 1) and the Chlorella ellipsoidea nitrate reductase promoter (sec.
with no. Ident .: 2). Chlorella visrus promoters can also be used to express genes in Prototheca, such as sec. with numbers Ident .: 1-7 of the patent of
United States 6,395,965. Additional promoters active in Prototheca can be found, for example, in Biochem Biophys Res Commun. 1994 Oct 14; 204 (1): 187-94; Plant Mol Biol. 1994 Oct; 26 (1): 85-93, - Virology. 2004 Aug 15, -326 (1): 1509; and Virology. 2004 Jan 5, -318 (1): 214-23. Other useful promoters are described in detail in the Examples below.
A promoter can be generally characterized as constitutive or inducible. The constitutive promoters are generally active or function to guide expression at all times (or at certain points in the cell's life cycle) at the same level. Inducible promoters, on the other hand, are significantly activated (or made inactive) or up-regulated or down-regulated only in response to a stimulus. Both types of promoters find application in the methods of the invention. Inducible promoters useful in the invention include
127
ΙΜΡΙ
ÍMSTlTUTe MtXlCANCDE LA MOHEDAL
INDUSTRIAL
<img file="MX339639B_D0116.tif" />
those that mediate transcription of an operatively linked gene in response to a stimulus, such as an exogenously supplied small molecule (eg, glucose, as in seq. with ID #: 1), temperature (hot or cold) , the lack of nitrogen in the culture media, etc. Suitable promoters can activate transcription of an essentially silent gene or upregulate, preferably substantially, the transcription of an operably linked gene that is transcribed at a low level. The examples below describe additional inducible promoters that are useful in Prototheca cells.
The inclusion of the termination region control sequence is optional, and if employed, then the choice will be one of convenience, since the termination region is relatively interchangeable. The termination region can be native to the transcription initiation region (the promoter), can be native to the DNA sequence of interest, or can be obtained from another source. See for example
Chen and Orozco, Nucleic Acids Res. (1988) 16: 8411.
The present invention also provides control sequences and recombinant genes and vectors containing them which provides compartmentalized expression of a gene for
128
<img file="MX339639B_D0117.tif" />
IMPI <sup>INST</sup>n?<sup>T</sup>· «EXICaNO
INBUSTRmy interest. Organelles for orientation are chloroplasts, plastids, mitochondria, and the endoplasmic reticulum. Furthermore, the present invention provides control sequences and the recombinant genes and vectors that contain them which provides for the secretion of a protein outside the cell.
Proteins that are expressed in the nuclear genome of
Prototheca can be directed at plastids by signals directed at plastid. Sequences targeting endogenous plastids for Chlorella are known, such as genes in the Chlorella nuclear genome that encode proteins that target plastids; see, eg, accession numbers AY646197 and AF499684 at GenBank, and in one embodiment, such control sequences are used in the vectors of the present invention to direct expression of a protein to a Prototheca plastid.
The examples below describe the use of algae plastid targeting sequences to target heterologous proteins to the correct compartment in the host cell.
The cDNA libraries were made using Prototheca moriformis and Chlorella protothecodies cells and are described in PCT application no. PCT / US2009 / 066142.
129
IMPIOUS
MEXICAN INSTITUTE
W LA ΜβΕΙΕΠΑΓ). 2
INWISTRIAL
In another embodiment of the present invention, the expression of a polypeptide in Prototheca is directed to the endoplasmic reticulum. The inclusion of an appropriate retention or classification signal in an expression vector ensures that the proteins are retained in the endoplasmic reticulum (ER) and do not go down into the Golgi. For example, the vector IMPACTVECT0R1.3, from Wageningen UR-Plant Research International, includes the well-known KDEL retention or classification signal. With this vector, RE retention has a practical advantage since it was reported to improve expression levels 5 times or more. The main reason for this appears to be that ER contains lower concentrations and / or different proteases responsible for posttranslational degradation of expressed proteins than those present in the cytoplasm. Functional ER retention signals in green microalgae are known. For example, see Proc Nati
Acad sci USA. 2005 Apr 26, -102 (17): 6225-30.
In another embodiment of the present invention, a polypeptide is targeted for secretion outside the cell in the culture medium. See Hawkins et al., Current
Microbiology Vol. 38 (1999), pgs. 335-341 for examples of active secretion signals in Chlorella that can
<img file="MX339639B_D0118.tif" />
130
IMPI
MEXICAN INSTITUTE DF. INDUSTRIAL PROPERTY used, in accordance with the methods of the invention, in
Prototheca.
[0009] Many promoters are active on microalgae, including promoters that are endogenous to transforming algae, as well as promoters that are not endogenous to transforming algae (ie promoters of other algae, promoters of higher plants , and promoters of plant viruses or algae viruses). Exogenous and / or endogenous promoters that are active in microalgae, and genes for resistance to functional antibiotics in microalgae are described, for example, by Curr Microbiol. Dec 1997; 35 (6): 356-62 (Chlorella vulgaris); Mar Biotechnol (NY).
2002 Jan; 4 (1): 63-73 (Chlorella ellipsoidea); Mol Gen Genet.
nineteen ninety six Oct 16, -252 (5): 572-9 (Phaeodactylum tricornutum); Plant
Mol Biol. 1996 Apr; 31 (1): 1-12 (Volvox carteri); Proc Nati
Acad Sci US A. 1994 Nov 22, -91 (24): 11562-6 (Volvox carteri);
Falciatore A, Casotti R, Leblanc C, Abrescia C, Bowler C,
PMID: 10383998, 1999 May; 1 (3): 239-251 (Laboratory of
Molecular Plant Biology, Stazione Zoológica, Villa Comunale,
1-80121 Naples, Italy) (Phaeodactylum tricornutum and
Thalassiosira weissflog'ii); Plant Physiol. 2002 May; 129 (1): 712. (Porphyridium sp.); Proc Nati Acad Sci USA. 2003 Jan
21, -100 (2): 438-42. (Chlamydomonas reinhardtii); Proc Nati Acad
131
<img file="MX339639B_D0119.tif" />
Sci USA. 1990 Feb; 87 (3): 1228-32. (Chlamydomonas reinhardtii); Nucleic Acids Res. 1992 Jun 25; 20 (12): 2959-65;
Mar Biotechnol (NY). 2002 Jan, -4 (1): 63-73 (Chlorella); Biochem
Mol Biol Int. 1995 Aug; 36 (5): 1025-35 (Chlamydomonas reinhardtii); J Microbiol. 2005 Aug; 43 (4): 361-5 (Dunaliella);
Yi Chuan Xue Bao. 2005 Apr; 32 (4): 424-33 (Dunaliella); Sea
Biotechnol (NY). 1999 May; 1 (3): 239-251. (Thalassiosira and
Phaedactylum); Koksharova, Appl Microbiol Biotechnol 2002
Feb; 58 (2): 123-37 (various species); Mol Genet Genomics. 2004
Feb; 271 (1): 50-9 (Thermosynechococcus elongates); J.
Bacteriol. (2000), 182, 211-215; FEMS Microbiol Lett. 2003
Apr 25, -221 (2): 155-9, - Plant Physiol. 1994 Jun; 105 (2): 635-41;
Plant Mol Biol. 1995 Dec; 29 (5): 897-907 (Synechococcus PCC
7942); Sea Pollut Bull. 2 002, -45 (1-12): 163-7 (Anabaena PCC
7120); Proc Nati Acad Sci USA. 1984 Mar; 81 (5): 1561-5 (Anabaena (various strains)); Proc Nati Acad Sci USA. 2001 Mar
27, -98 (7): 4243-8 (Synechocystis); Wirth, Mol Gen Genet 1989
Mar; 216 (1): 175-7 (various species); Mol Microbiol, 2002 Jun; 44 (6): 1517-31 and Plasmid, 1993 Sep; 30 (2): 90-105 (Fremyella diplosiphon); Hall et al. (1993) Gene 124: 75-81 (Chlamydomonas reinhardtii); Gruber et al. (1991). Current Micro. 22: 15-20; Jarvis et al. (1991) Current Genet. 19:
132
IMPÍ
MM1CAN INSTITUTE. i • E LA MOREDAI, INDUSTRIAL
<img file="MX339639B_D0120.tif" />
317-322 (Chlorella); for additional promoters see also Table 1 of US Patent 6,027,900).
The promoter that is used to express an exogenous gene can be the promoter that naturally binds to that gene or it can be a heterologous gene. Some promoters are active in more than one species of microalgae. Other promoters are species specific. Preferred promoters include promoters such as RBCS2 from Chlamydomonas reinhardtii and viral promoters such as cauliflower mosaic virus (CMV) and Chlorella virus which were shown to be active in multiple microalgae species (see for example Plant Cell Rep . 2005 Mar; 23 (10-11): 727-35; J Microbiol. 2005 Aug; 43 (4): 361-5; Mar Biotechnol (NY). 2002
Jan, -4 (1): 63-73). In other embodiments, the Botryococcus malate dehydrogenase promoter, a
<td>nucleic acid</td><td>of that type that</td><td>understands</td><td>any</td><td>part</td><td>of</td>
<td colspan="2">the sec. with no. of ident. :</td><td>150, or the</td><td>promoter</td><td>RBCS2</td><td>of</td>
<td>Ch1amydomonas</td><td>reinhardtii (sec</td><td>with no.</td><td colspan="3">of ident. : 151).</td>
<td>Optionally,</td><td colspan="2">at least 10, 20 are used,</td><td> 30, 40,</td><td>50, or</td><td> 60</td>
<td>nucleotides or</td><td>more of these</td><td>sequences</td><td colspan="2">that contain</td><td>a</td>
promoter. Preferred endogenous promoters for species of the genus Chlorella are sec. with no. of ident.:1 and sec. with no. of ident.:2.
133
<img file="MX339639B_D0121.tif" />
[0010] Preferred promoters useful for
IMPI exogenous gene expression in Chlorella are listed in the sequence listing for this application, such as the Chlorella HUP1 gene promoter (sec. With ID #: 1) and the Chlorella ellipsoidea nitrate reductase promoter ( section with ID number: 2). Chlorella visus promoters can also be used to express genes in Chlorella, such as sec. with numbers Ident: 1-7 of US Patent 6,395,965. Additional promoters active in Chlorella can be found, for example, in Biochem Biophys Res Commun. 1994 Oct
14; 204 (1): 187-94; Plant Mol Biol. 1994 Oct; 26 (1): 85-93;
Virology. 2004 Aug 15; 326 (1): 150-9; and Virology. 2004 Jan
5;318 (1) :214-23 .
B. Optimization of genes and codon
Typically, a gene includes a promoter, the coding sequence, and termination control sequences. When assembled by recombinant DNA technology, a gene can be called an expression cassette and can be flanked by restriction sites for proper insertion into a vector that is used to introduce the recombinant gene into a host cell.
The expression cassette can be flanked by sequences of
<img file="MX339639B_D0122.tif" />
134
ΙΜΡΙ
Genome DNA or other target nucleic acids to facilitate stable integration of the expression cassette into the genome by homologous recombination. Alternatively, the vector and its expression cassette may remain unintegrated, in which case, the vector typically includes an origin of replication that is capable of providing replication of the
Heterologous vector DNA.
A common gene present in a vector is a gene that codes for a protein, the expression of which allows the recombinant cell containing the protein to differentiate itself from cells that do not express the protein. Such a gene and its corresponding gene product is called a selection marker. Any of a wide variety of selection markers can be employed in a transgenic construct useful for transforming Prototheca. Examples of suitable selectable markers include the G418 resistance gene, the nitrate reductase gene (see Dawson et al. (1997), Current Microbiology 35: 356-362), the hygromycin phosphotransferase gene (HPT; see Kim et al. (2002),
Mar. Biotechnol. 4: 63-73), the neomycin phosphotransferase gene, the ble gene, which confers resistance to phleomycin (Huang et al. (2007), Appl. Microbiol.
Biotechnol.
72: 197-205), aminoglycoside-3'-0135
IMPI
MEXICAN INSTITUTE • and INDUSTRIAL PROPERTY
<img file="MX339639B_D0123.tif" />
phosphotransferase (sec. with ID no .: 194), which confers resistance to kanamycin. Methods for determining the sensitivity of microalgae to antibiotics are well known. For example, Mol Gen Genet. 1996 Oct
16;252(5):572-9.
Other selectable markers that are not based on antibiotics can also be used in a transgene construct useful for transforming microalgae generally, including Prototheca species. Genes that confer the ability to use certain carbon sources that were previously unable to be used by the microalgae can also be used as a selectable marker. By way of illustration, Prototheca moriformis strains typically grow poorly, if at all, in sucrose. Using a construct that contains a sucrose invertase gene can confer the ability of positive transformants to grow on sucrose as a carbon substrate. Additional details on the use of sucrose as a selectable marker in conjunction with other selectable markers are discussed in Section IV below.
For the purposes of the present invention, the expression vector that is used to prepare a host cell
136
IMPI
MEXICAN INSTITUTE OF LA MONEDAD
INDUSTRIAL
<img file="MX339639B_D0124.tif" />
Recombinant of the invention will include at least two, and often three, genes, if one of the genes is a selection marker. For example, a genetically engineered Prototheca of the invention can be made by transformation with vectors of the invention that comprise, in addition to a selection marker, one or more exogenous genes, such as, for example, the sucrose invertase gene or the acylc ACP-thioesterase gene. One or both genes can be expressed through the use of an inducible promoter, which allows controlling the relative expression time of these genes to improve lipid performance and conversion to fatty acid esters. The expression of the two or more exogenous genes can be under the control of the same inducible promoter or under the control of different inducible (or constitutive) promoters. In the latter situation, the expression of a first exogenous gene can be induced for a first period of time (during which the expression of a second exogenous gene may or may not be induced) and the expression of a second exogenous gene can be induced by a second time period (during which the expression of the first exogenous gene may or may not be induced).
In other modalities, the two or more exogenous genes (in addition to any selection marker) are: an acyl
137
<img file="MX339639B_D0125.tif" />
fatty ACP thiosterase and an acyl fatty CoA / aldehyde reductase, the combined actions of which yield an alcohol product.
In addition other combinations of exogenous genes are provided;
including, without limitation, an acyl fatty acp thiosterase and an acyl fatty CoA reductase to generate aldehydes. In one embodiment, the vector provides the combination of an acyl fatty acp thiosterase, an acyl fatty CoA reductase and a fatty aldehyde decarbonylase to generate allenes. In each of these modalities, one or more of the exogenous genes can be expressed through the use of an inducible promoter.
Other illustrative vectors of the invention expressing two or more exogenous genes include those encoding both a sucrose transporter and a sucrose invertase enzyme and those encoding a selection marker and a secreted sucrose invertase. Recombinant Prototheca transformed with any type of vector produces lipids at a lower manufacturing cost due to the engineering-generated ability to use sugarcane (and sugars derived from cane sugar) as a carbon source. Insertion of the two exogenous genes described above can be combined with disruption of polysaccharide biosynthesis through targeted and / or random mutagenesis, which directs flow
<img file="MX339639B_D0126.tif" />
138
IMPI increasing carbon to lipid production.
Individually and in combination, trophic conversion, modifications to alter lipid production, and treatment with exogenous enzymes alter the lipid composition produced by a microorganism. The alteration may be a change in the amount of lipids produced, the amount of one or more hydrocarbon species produced relative to other lipids, and / or the types of lipid species that are produced in the microorganism. For example, the microalgae can be modified to produce a higher amount and / or percentage of TAG.
For optimal expression of a recombinant protein, it is beneficial to employ coding sequences that produce mRNA with codons that are preferably used by the host cell to be transformed. Thus, proper expression of the transgenes may require that the use of the transgene codon coincide with the specific codon with bias in the organism in which the transgene is expressed. The exact mechanisms underlying this effect are many, but include proper balancing of available aminoacylated tRNA stores with proteins that are synthesized in the cell, coupled with more efficient translation of messenger RNA (mRNA) transgenics when satisfied. this <sup>139</sup> IMPI
MEXICAN INSTITUTE Of LA fROflíDAt. ·
INDUSTRIAL need. When codon usage in the transgene is not optimized, the available tRNA stores are not sufficient to allow efficient translation of the heterologous mRNA resulting in stagnation and ribosomal termination and possible instability of the transgenic mRNA.
The present invention provides codon optimized nucleic acids useful for the successful expression of recombinant proteins in Prototheca. The use of codons in Protothecase species was analyzed by studying the sequences of
Isolated cDNA from Prototheca moriformis. This analysis represents the question about 24,000 codons and resulted in Table 2 below.
Table 2. Use of preferred codons in strains of
<img file="MX339639B_D0127.tif" />
Prototheca.
<td>To</td><td>GCG</td><td> 345 (0.36)</td><td>Asn</td><td>AAT</td><td> 8 (0.04)</td>
<td></td><td>GCA</td><td> 66 (0.07)</td><td></td><td>AAC</td><td> 201 (0.96)</td>
<td></td><td>GCT</td><td> 101 (0.11)</td><td></td><td></td><td></td>
<td></td><td>GCC</td><td> 442 (0.46)</td><td>Pro</td><td>CCG</td><td> 161 (0.29)</td>
<td></td><td></td><td></td><td>CCA</td><td> 49</td><td> (0.09)</td>
<td>Cys</td><td>TGT</td><td> 12 (0.10)</td><td></td><td>CCT</td><td> 71 (0.13)</td>
<td></td><td>TGC</td><td> 105 (0.90)</td><td></td><td>CCC</td><td> 267 (0.49)</td>
<img file="MX339639B_D0128.tif" />
140
IMPI
<td>Asp</td><td>GAT</td><td> 43</td><td> (0.12)</td><td>Gln</td><td>CAG</td><td> 226 (0.82)</td>
<td></td><td>GAC</td><td> 316</td><td> (0.88)</td><td></td><td>CAA</td><td> 48 (0.18)</td>
<td>Glu</td><td>GAG</td><td> 377</td><td> (0.96)</td><td>Arg</td><td>AGG</td><td> 33 (0.06)</td>
<td></td><td>GAA</td><td> 14</td><td> (0.04)</td><td></td><td>AGA</td><td> 14 (0.02)</td>
<td></td><td></td><td></td><td></td><td>CGG</td><td> 102</td><td> (0.18)</td>
<td>Phe</td><td>TTT</td><td> 89</td><td> (0.29)</td><td></td><td>CGA</td><td> 49 (0.08)</td>
<td></td><td>TTC</td><td> 216</td><td> (0.71)</td><td></td><td>CGT</td><td> 51 (0.09)</td>
<td></td><td></td><td></td><td></td><td>CGC</td><td> 331</td><td> (0.57)</td>
<td>Gly</td><td>GGG</td><td> 92</td><td> (0.12)</td><td></td><td></td><td></td>
<td></td><td>GGA</td><td> 56</td><td> (0.07)</td><td>To be</td><td>AGT</td><td> 16 (0.03)</td>
<td></td><td>GGT</td><td> 76</td><td> (0.10)</td><td></td><td>AGC</td><td> 123 (0.22)</td>
<td></td><td>GGC</td><td> 559</td><td> (0.71)</td><td></td><td>TCG</td><td> 152 (0.28)</td>
<td></td><td></td><td></td><td></td><td>TCA</td><td> 31</td><td> (0.06)</td>
<td>His</td><td>CAT</td><td> 42</td><td> (0.21)</td><td></td><td>TCT</td><td> 55 (0.10)</td>
<td></td><td>CAC</td><td> 154</td><td> (0.79)</td><td></td><td>CBT</td><td> 173 (0.31)</td>
<td>lie</td><td>ATA</td><td></td><td> 4 (0.01)</td><td>Thr</td><td>ACG</td><td> 184 (0.38)</td>
<td></td><td>ATT</td><td> 30</td><td> (0.08)</td><td></td><td>HERE</td><td> 24 (0.05)</td>
<td></td><td>ATC</td><td> 338</td><td> (0.91)</td><td></td><td>ACT</td><td> 21 (0.05)</td>
<td></td><td></td><td></td><td></td><td>ACC</td><td> 249</td><td> (0.52)</td>
<td>Lys</td><td>AAG</td><td> 284</td><td> (0.98)</td><td></td><td></td><td></td>
(0.02)
Val
GTG 308 (0.50)
AAA
IMPI
MEXICAN INSTITUTE OE LA PHONtOAO INDI ISTRIAL
<img file="MX339639B_D0129.tif" />
141
<td></td><td></td><td></td><td></td><td>GTA_</td><td></td><td>9 ín.ni)</td>
<td>Leu</td><td>TTG</td><td> 26</td><td> (0.04)</td><td></td><td>GTT</td><td> 35 (0.06)</td>
<td></td><td>TTA</td><td></td><td> 3 (0.00)</td><td></td><td>GTC</td><td> 262 (0.43)</td>
<td></td><td>CTG</td><td> 447</td><td> (0.61)</td><td></td><td></td><td></td>
<td></td><td>CTA</td><td></td><td></td><td> 20 (0.03)</td><td></td><td>Trp TGG</td>
<td></td><td> 107</td><td> (1.00)</td><td></td><td></td><td></td><td></td>
<td></td><td>CTT</td><td> 45</td><td> (0.06)</td><td></td><td></td><td></td>
<td></td><td>CTC</td><td> 190</td><td> (0.26)</td><td>Tyr</td><td>TAT</td><td> 10 (0.05)</td>
<td></td><td></td><td></td><td></td><td>TAC</td><td> 180</td><td> (0.95)</td>
<td>Met</td><td>ATG</td><td> 191</td><td> (1.00)</td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td colspan="2">Termination</td><td>TGA / TAG / TAA</td>
In other embodiments, the gene in the recombinant vector was codon optimized with reference to a microalgal strain
<td>it's not</td><td>a</td><td>Prototheca strain</td><td>. For example,</td><td>the</td><td>methods</td><td>of</td>
<td>to register</td><td>the</td><td>genes for the</td><td>expression in</td><td colspan="2">microalgae</td><td>I know</td>
<td>describe</td><td>in</td><td>the patent of</td><td>United States</td><td> 7,</td><td> 135,290.</td><td>The</td>
<td colspan="3">additional information for</td><td>optimization</td><td>by</td><td colspan="2">codon is</td>
<td>available,</td><td colspan="2">for example in</td><td colspan="2">the database</td><td>of use</td><td>of</td>
2θ GenBank codons.
Other non-limiting examples of codon usage in
Chlorella pyrenoidosa, Dunaliella salina, and Chlorella
142
ΙΜΡΙ
MEXICAN INSTITUTE OF LA PROUBDAL; INDUSTRIAL protothecoides are shown in Tables 78 ·, »- 2P; and respectively.
[0011] Table 28. Use of codons in Chlorella pyrenoidosa
<td>Phe</td><td>UUU</td><td> 39</td><td> (0.82)</td><td>To be</td><td>UCU 50 (1.04)</td>
<td></td><td>UUC</td><td colspan="2"> 56 (1.18)</td><td>UCC</td><td> 60 (1.25)</td>
<td>Leu</td><td>UUA</td><td> 10</td><td> (0.20)</td><td>UCA</td><td> 6 (0.96)</td>
<td></td><td>UUG</td><td> 46</td><td> (0.91)</td><td>UCG</td><td> 43 (0.89)</td>
<td>Tyr</td><td>UAU</td><td> 15</td><td> (0.59)</td><td>Cys</td><td>UGU 46 (0.77)</td>
<td></td><td>UAC</td><td> 36</td><td> (1.41)</td><td>UGC</td><td> 73 (1.23)</td>
<td>ter</td><td>UAA</td><td> 9</td><td> (0.00)</td><td>ter UGA</td><td> 43 (0.00)</td>
<td>ter</td><td>UAG</td><td> 15</td><td> (0.00)</td><td>Trp</td><td>UGG 69 (1.00)</td>
<td>Leu</td><td>CUU</td><td> 49</td><td> (0.97)</td><td>Pro</td><td>CCU 80 (0.98)</td>
<td></td><td>CUC</td><td> 73</td><td> (1.45)</td><td>CCC</td><td> 88 (1.08)</td>
<td></td><td>CUA</td><td> 22</td><td> (0.44)</td><td>CCA</td><td> 93 (1.14)</td>
<td></td><td>CUG</td><td colspan="2"> 103 (2.04)</td><td></td><td>GCC 65 (0.80)</td>
<td>His</td><td>CAU</td><td> 50</td><td> (0.88)</td><td>Arg</td><td>CGU 39 (0.76)</td>
<td></td><td>CAC</td><td> 3</td><td> (1.12)</td><td>CGC</td><td> 63 (1.23)</td>
<td>Gln</td><td>CAA</td><td> 59</td><td> (0.84)</td><td>CGA</td><td> 46 (0.90)</td>
<td></td><td>CAG</td><td> 2</td><td> (1-16)</td><td>CGG</td><td> 47 (0.92)</td>
<td>lie</td><td>AUU</td><td> 24</td><td> (0.69)</td><td>Thr</td><td>ACU 32 (0.67)</td>
<td></td><td>AUC</td><td> 61</td><td> (1.76)</td><td>ACC</td><td> 76 (1.60)</td>
<td></td><td>AUA</td><td> 19</td><td> (0.55)</td><td>HERE</td><td> 41 (0.86)</td>
143
IMPI • MEXICAN INSTITUTE OF THE INDUSTRIAL RRORIEOAU
<td>Met</td><td>AUG</td><td> 42</td><td> (1.00)</td><td>ACG</td><td> 41</td><td> (0.86)</td>
<td>Asn</td><td>AAU</td><td> 26</td><td> (0.75)</td><td>To be</td><td>AGU</td><td> 23 (0</td>
<td></td><td>AAC</td><td> 3</td><td> (1.25)</td><td>AGC</td><td> 67</td><td> (1.39)</td>
<td>Lys</td><td>AAA</td><td> 32</td><td> (0.54)</td><td>Arg</td><td>AGA</td><td> 51 (1</td>
<td></td><td>AAG</td><td> 86</td><td> (1.46)</td><td>AGG</td><td> 61</td><td> (1.19)</td>
<td>Val</td><td>GUU</td><td> 36</td><td> (0.75)</td><td>To</td><td>GCU</td><td> 57 (0</td>
<td></td><td>GUC</td><td> 54</td><td> (1.13)</td><td>GCC</td><td> 97</td><td> (1.34)</td>
<td></td><td>GUA</td><td> 30</td><td> (0.63)</td><td>GCA</td><td> 89</td><td> (1.23)</td>
<td></td><td>GUG</td><td> 71</td><td> (1.49)</td><td>GCG</td><td> 47</td><td> (0.65)</td>
<td>Asp</td><td>GAU</td><td> 60</td><td> (0.95)</td><td>Gly</td><td>GGU</td><td> 35 (0</td>
<td></td><td>GAC</td><td> 66</td><td> (1.05)</td><td>GGC</td><td> 78</td><td> (1.33)</td>
<td>Glu</td><td>GAA</td><td> 41</td><td> (0.68)</td><td>GGA</td><td> 54</td><td> (0.92)</td>
<td></td><td>GAG</td><td> 80</td><td> (1.32)</td><td>GGG</td><td> 67</td><td> (1.15)</td>
48)
00)
79)
60)
Table 29. Use of preferred codons in Dunaliella salina.
<td></td><td>TTC</td><td>(Phe)</td><td>TAC</td><td>(Tyr)</td><td>TGC</td><td>(Cys)</td>
<td></td><td></td><td>TAA</td><td colspan="2">(termination)</td><td></td><td></td>
<td></td><td>TGG</td><td>(Trp)</td><td>CCC</td><td>(Pro)</td><td>CAC</td><td>(His)</td>
<td> 20</td><td></td><td>CGC</td><td>(Arg)</td><td></td><td></td><td></td>
<td></td><td>CTG</td><td>(Leu)</td><td>CAG</td><td>(Gln)</td><td>ATC</td><td>(He)</td>
ACC (Thr)
<img file="MX339639B_D0130.tif" />
ATG (Met)
144
<td></td><td>AAC</td><td>(Asn)</td><td>AGC</td><td>(To be)</td>
<td></td><td></td><td>AAG</td><td>(Lys)</td><td></td>
<td></td><td>GCC</td><td>(To)</td><td>GAC</td><td>(Asp)</td>
<td></td><td></td><td>GTG</td><td>(Val)</td><td></td>
<td> 5</td><td>GAG</td><td>(Glu)</td><td></td><td></td>
GGC (Gly)
Table 30.
protothecoids.
Use of preferred codons in Chlorella
<td>TTC</td><td>(Phe)</td><td>TAC</td><td>(Tyr)</td>
<td colspan="3">termination)</td><td></td>
<td>TGG</td><td>(Trp)</td><td>CCC</td><td>(Pro)</td>
<td></td><td>CGC</td><td>(Arg)</td><td></td>
<td>CTG</td><td>(Leu)</td><td>CAG</td><td>(Gln)</td>
<td></td><td>ACC</td><td>(Thr)</td><td></td>
<td>GAC</td><td>(Asp)</td><td>CBT</td><td>(To be)</td>
<td>GCC</td><td>(To)</td><td>AAC</td><td>(Asn)</td>
<td>GAG</td><td>(Glu)</td><td></td><td></td>
<td>TGC</td><td>(Cys)</td><td>TGA</td><td> (</td>
<td></td><td>CAC</td><td>(His)</td><td></td>
<td></td><td>ATC</td><td>(He)</td><td></td>
<td>ATG</td><td>(Met)</td><td>AAG</td><td>(Lys)</td>
<td>GGC</td><td>(Gly)</td><td>GTG</td><td>(Val)</td>
C. Inducible expression
The present invention further provides the use of an inducible promoter to express a gene of interest. In particular, the use of an inducible promoter to express a
145
IΜ Ρ1
INSTITUTO MUiCaNDE LA «OFIEDAI industrial μ g lipase gene allows the production of lipase after cultivation of the microorganism when conditions have been adjusted, if necessary, to improve transesterification, for example, after cell disruption, reduction of the water content of the reaction mixture, and / or addition of sufficient alcohol to drive the conversion of TAGs to fatty acid esters.
[0012] Inducible promoters useful in the invention include those that mediate transcription of an operatively linked gene in response to a stimulus, such as an exogenously supplied small molecule (eg, glucose, as in seq. ident .: 1), temperature (hot or cold), light, etc. Suitable promoters can activate transcription of an essentially silent gene or upregulate, preferably substantially, the transcription of an operably linked gene that is transcribed at a low level. In the latter case, the level of lipase transcription preferably does not significantly interfere with the growth of the microorganism in which it is expressed.
Expression of transgenes in Chlorella can be induced inducibly through promoters such as the promoter that drives the hexose transporter gene
<img file="MX339639B_D0131.tif" />
146
IMPí enChlorella (sec. With ID number: 1). This promoter is strongly activated by the presence of glucose in the culture media.
D. Expression of two or more exogenous genes
Furthermore, a genetically modified microorganism, such as a microalgae, could comprise and express two or more exogenous genes, such as, for example, a lipase and a lytic gene, for example, one that encodes a polysaccharide degradation enzyme. One or both genes can be expressed through the use of an inducible promoter, which allows controlling the relative expression time of these genes to improve lipid performance and conversion to fatty acid esters. The expression of the two or more exogenous genes can be under the control of the same inducible promoter or under the control of different inducible promoters. In the latter situation, the expression of a first exogenous gene can be induced for a first period of time (during which the expression of a second exogenous gene may or may not be induced) and the expression of a second exogenous gene can be induced by a second time period (during which the expression of the first exogenous gene may or may not be induced). Vectors and methods for modifying the microbes they produce are provided herein.
147
<img file="MX339639B_D0132.tif" />
IMPI lipids to metabolize sucrose, which is an advantageous trait because it allows modified cells to convert sugar cane raw materials into lipids.
Additionally provided are genetically modified microbial strains (eg, microalgae, oil yeast, bacteria, or fungi) that express two or more exogenous genes, such as, for example, an acyl fatty ACP thioesterase and an acyl fatty CoA / aldehyde reductase, the combined action of which produces an alcoholic product. In addition, other exogenous gene combinations are provided, including, without limitation, an acyl fatty acp thiosterase and an acyl fatty CoA reductase to generate aldehydes. Furthermore, this application provides the combination of an acyl fatty acp thioesterase, an acyl fatty CoA reductase and a fatty aldehyde decarbonylase to generate alkanes. One or more of the exogenous genes can be expressed through the use of an inducible promoter.
Examples of other suitable modifications for use in the present invention include genetically modified strains of microalgae to express two or more exogenous genes, one encoding a transporter of a fixed carbon source (such as sucrose) and a second encoding an enzyme. sucrose invertase. Fermentable organisms
148
MEXICAN INSTITUTE OF LA RROPIEDAI '
INDUSTRIAL> l ^ * W »g produce hydrocarbons at a lower manufacturing cost than those obtained by previously known biological hydrocarbon production methods. Insertion of the two exogenous genes described above can be combined with disruption of polysaccharide biosynthesis through targeted and / or random mutagenesis, which directs the increasing flow of carbon to hydrocarbon production. Individually and in combination, trophic conversion, modifications to alter hydrocarbon production, and treatment with exogenous enzymes alter the composition of hydrocarbons produced by a microorganism. The alteration may be a change in the amount of hydrocarbons produced, the amount of one or more hydrocarbon species produced relative to other hydrocarbons, and / or the types of hydrocarbon species produced in the microorganism. For example, the microalgae can be modified to produce a higher amount and / or percentage of TAG.
E. Compartmentalized expression
The present invention further provides for the compartmentalized expression of a gene of interest. In particular, in particular modalities, it may be advantageous to direct the
149
ΙΜΡΙ
MEXICAN INSTITUTE Dt LA RROR1ÍOAI1 INDUSTRIAL
<img file="MX339639B_D0133.tif" />
lipase expression to one or more cellular compartments where it is sequestered from most of the cellular lipids until the start of the transesterification reaction. The preferred organelles for targeting are chloroplasts, mitochondria, and the endoplasmic reticulum.
(1) Expression in chloroplasts
In one embodiment of the present invention, expression of a polypeptide in a microorganism is directed to chloroplasts. Methods for directing the expression of a heterologous gene to the chloroplast are known and can be used in the present invention. Methods for targeting foreign gene products are described in Shrier et al.,
EMBO J. (1985) 4:25 32. See also Tomai et al. Gen. Biol.
Chem. (1988) 263: 15104 15109 and United States patent.
no. 4,940,835 for the use of transit peptides for nuclear translocation of gene products in the chloroplast. Methods for directing protein transport to the chloroplast were further reviewed in Kenauf
TIBTECH (1987) 5:40 47. Chlorella endogenous chloroplast targeting sequences are known, such as the genes in the Chlorella nuclear genome that encodes
150
IMPI
MEXICAN INSTITUTE PE LA PROflíDAI? INDUSTRIAL
<img file="MX339639B_D0134.tif" />
proteins that target the chloroplast; see, for example, the GenBank accession numbers AY646197 and AF499684.
Wageningen UR- Plant Research International sells an IMPACTVECTOR1.4 vector, which uses the secretion signal of the small protein subunit of Chrysanthemum morifolium to deliver a heterologous protein into the environment of the chloroplast stroma (cytoplasmic), moving through a double membrane system. The protein fuses with the first 11 amino acids of the mature rubisco protein to allow adequate processing of the signal peptide (Wong et al., Plant Molecular Biology 20: 81-93 (1992)). The signal peptide contains a natural intron of the gene
RbcS.
In another approach, the chloroplast genome is genetically engineered to express the heterologous protein. Stable transformation of Chlamydomonas reinhardtii chloroplasts (a green algae) has been described using bombardment of recipient cells with high-speed tungsten microprojectiles coated with foreign DNA. See, for example, Boynton et al., Science (1988) 240: 1534 1538; Blowers and others Plant Cell (1989)
1: 123 132 and Debuchy et al., EMBO J. (1989) 8: 2803 2809. The transformation technique, using microprojectiles from
151 ΙΜΡΪ »*
MEXICAN INSTITUTE. .
OF. LA FROPIEI) AI - '
INDUSTRIAL * «», 'g tungsten, is described in Klein et al., Nature (London) (1987) 7:70 73. Other methods of transforming chloroplast for plants and microalgae are known. See for example United States Patents 5,693,507; 6,680,426;
and Plant Physiol. 2002 May; 129 (1): 7-12; and Plant Biotechnol J.
2007 May; 5 (3): 402-12.
As described in United States Patent No.
6,320,101 (published November 20, 2001 by Kaplan et al .; incorporated herein by reference), all 10 cells can be chemically treated to reduce the number of chloroplasts per cell to approximately one.
The heterologous nucleic acid can then be introduced into cells through particle bombardment with the aim of introducing at least one heterologous nucleic acid molecule into the chloroplasts. Heterologous nucleic acid is selected so that it is integrated into the chloroplast genome through homologous recombination that is easily carried out by the enzymes of chloroplasts. To this end, heterologous nucleic acid includes, in addition to a gene of interest, at least one nucleic acid sequence that is derived from the chloroplast genome. Furthermore, heterologous nucleic acid typically includes a selection marker. Details
152
IMPI
MUICANC INSTITUTE OF TROPHY
INDUSTRIAL
<img file="MX339639B_D0135.tif" />
Additional related to this technique are found in United States Patent Nos. 4,945,050 and 5,693,507 which are incorporated herein by reference. A polypeptide can be produced in this way by the chloroplast protein expression system.
United States Patent No. 7,135,620 (published November 14, 2006 by Daniell et al., Incorporated herein by reference) describes chloroplast expression vectors and related methods. Expression cassettes are DNA constructs that include a suitable coding sequence and control sequences to provide correct expression of the coding sequence in the chloroplast. Typical expression cassettes include the following components: the 5 'untranslated region of a microorganism gene or chloroplast gene such as psbA to be provided for transcription and translation of a DNA sequence encoding a polypeptide of interest in the chloroplast ; a DNA sequence encoding a polypeptide of interest; and a translation and transcription termination region, such as an inverted repeat 3 'region of a chloroplast gene that can stabilize the RNA of the introduced genes, thereby improving the expression of foreign genes. The
153
<img file="MX339639B_D0136.tif" />
INDUSTRIAL cassette can optionally include an antibiotic resistance gene.
Typically, the expression cassette is flanked by convenient restriction sites for insertion into a suitable genome. The expression cassette can be flanked by DNA sequences from the chloroplast DNA to facilitate stable integration of the expression cassette into the chloroplast genome, particularly by homologous recombination.
Alternatively, the expression cassette may remain unintegrated, in which case, the expression cassette typically includes an origin of replication of the chloroplast, which is capable of providing replication of the heterologous DNA in the chloroplast.
The expression cassette generally includes a promoter region of a gene capable of expression in the chloroplast. The promoter region could include promoters obtainable from chloroplast genes, such as the spinach or pea psbA gene, or the rbcL and atpB promoter region from maize and rRNA promoters. Examples of 20 promoters are described in Hanley-Bowdoin and Chua, TIBS (1987)
12:67 70; Mullet et al., Plant Molec Biol. (1985) 4:39 54;
Hanley-Bowdoin (1986) PhD. Dissertation, the Rockefeller
University; Krebbers et al., Nucleic Acids Res. (1982) 10:
<sup>154</sup> IMPI mexicanc institute OF industuial PAOftíDAD
4985 5002, - Zurawaki et al., Nucleic Acids Res. (1981) 9: 3251
3270; and Zurawski et al., Proc. Nat'1 Acad Sci. USA (1982)
79: 7699 7703. Other promoters can be identified and the relative strength of the promoters thereby identified identified, by placing a promoter of interest 5 'to a marker gene minus the promoter and observing its efficacy in relation to the transcription obtained from from, for example, the psbA gene promoter, a relatively strong chloroplast promoter. The efficiency of heterologous gene expression can be further enhanced by any of a variety of techniques. These include the use of multiple promoters inserted in tandem 5 'to the heterologous gene, eg, a double psbA promoter, the addition of enhancer sequences and the like.
Numerous promoters active in the chloroplast of
Chlorella can be used for the expression of exogenous genes in Chlorella chloroplast such as those found in GenBank accession number NC_001865 (Chlorella vulgaris complete chloroplast genome).
Where it is desired to provide the inducible expression of the heterologous gene, an inducible promoter and / or an untranslated 5 'region containing sequences that are provided for regulation by can be included in the expression cassette.
<img file="MX339639B_D0137.tif" />
155
IMPI
MEXICAN INSTITUTE OF LA RROPI £ »AV INDUSTRIAL
<img file="MX339639B_D0138.tif" />
level of transcription and / or translation (at the 3'TT end For example, the 5 'untranslated region may be from a gene where expression is light dimmable. Similarly, the 3' inverted repeat regions can be use to stabilize RNA in heterologous genes Inducible genes can be identified by improved expression in response to a particular stimulus of interest and low or absent expression in the absence of the stimulus. For example, a light-inducible gene can be identified where enhanced expression occurs during light irradiation, while substantially reduced expression or non-expression occurs in little or no light. Light-regulated promoters from green microalgae are known (see, eg, Mol Genet Genomics. 2005 Dec, -274 (6): 62536).
The termination region employed will be primarily one of convenience, since the termination region appears to be relatively interchangeable between chloroplasts and bacteria. The termination region can be native to the transcription initiation region, can be native to the DNA sequence of interest, or can be obtained from another source. See for example Chen and
Orozco, Nucleic Acids Res. (1988) 16: 8411.
156
IMPI ^ s
INSTITUTO MÍXJCANo DE LA RROFIE D AI ·
INDUSTRIAL
Expression cassettes can be transformed into a plant cell of interest by any of a number of methods. These methods include, for example, biolistic methods (see, for example, Sanford, Trends In Biotech.
(1988) 6: 299 302, US Patent No. 4,945,050;
electroporation (Fromm et al., Proc. Nati. Acad Sci., (United States) (1985) 82: 5824 5828); use of a laser beam, microinjection or any other method capable of introducing
DNA in a chloroplast.
Additional descriptions of chloroplast expression vectors suitable for use in microorganisms such as microalgae are found in
United States no. 7,081,567 (published July 25,
2006, de Xue et al.); 6,680,426 (published January 20,
2004, by Daniell et al.) And 5,693,507 (published December 2, 1997, by Daniell et al.).
Proteins expressed in the Chlorella nuclear genome can be directed to the chloroplast using signals directed to the chloroplast. Chlorella-endogenous chloroplast targeting sequences are known, such as genes in the Chlorella nuclear genome that encode chloroplast-targeting proteins; see, for example, the GenBank accession numbers AY646197 and AF499684. The
157
ΙΜΡΙ
IIUTHVf MEXICANO Dt LA FXOFMaI INDUSTRIAL
<img file="MX339639B_D0139.tif" />
Proteins can also be expressed in the chloroplast of
Chlorella by insertion of genes directly into the chloroplast genome. Transformation of the chloroplast typically occurs through homologous recombination, and can be performed if the sequences of the chloroplast genome are known from the creation of targeted vectors (see, for example, the entire genome sequence of a Chlorella chloroplast; number access to GenBank
NC_001865). See the previous sections in this for details of the transformation of the chloroplast.
(2) Expression in the mitochondria
In another embodiment of the present invention, expression of a polypeptide in a microorganism is directed to the mitochondria. Methods for the selection of foreign gene products in mitochondria have been described (Boutry et al., Nature (London) (1987) 328: 340 342) including in green microalgae (see, eg, Mol Gen Genet. 1993
Jan; 236 (2-3): 235-44).
For example, an expression vector that encodes the appropriate secretion signal can direct a heterologous protein to the mitochondria. The vector IMPACTVECTOR1.5, from
Wageningen UR- Plant Research International, uses the yeast CoxIV secretion signal, which was shown to release
158 proteins in the mitochondrial matrix.
IMPI
<img file="MX339639B_D0140.tif" />
Protein fuses
<img file="MX339639B_D0141.tif" />
with the first 4 amino acids of the yeast CoxIV protein to allow adequate processing of the signal peptide (Kohler et al., Plant J 11: 613-621 (1997)). Other mitochondrial targeted sequences are known, including those functional in green microalgae. For example, see FEBS Lett. 1990 Jan 29; 260 (2): 165-8; and J Biol Chem. 2002
Feb 22; 277 (8): 6051-8.
Proteins expressed in the nuclear genome of
Chlorella can be targeted to the mitochondria using targeted mitochondrial signals. See the previous sections in the present description for the details of selection and transformation of the mitochondrial protein.
(3) Expression in the endoplasmic reticulum
In another embodiment of the present invention, expression of a polypeptide in a microorganism is directed to the endoplasmic reticulum. The inclusion of an appropriate retention or classification signal in an expression vector ensures that the proteins are retained in the endoplasmic reticulum (ER) and do not go down into the Golgi. For example, the vector IMPACTVECTOR 1.3, from Wageningen URPlant Research International, includes the well-known KDEL retention or classification signal. With this vector, the
159
IMPT
INSTITUTO MRXICANl dí la ruoniDAb
INDUSTRIAL
<img file="MX339639B_D0142.tif" />
Retention in the ER has a practical advantage since it was reported to improve expression levels 5 times or more. The main reason for this appears to be that ER contains lower concentrations and / or different proteases responsible for post-translational degradation of proteins that are expressed than those present in the cytoplasm. Functional ER retention signals in green microalgae are known. For example, see Proc Nati Acad Sci USA.
2005 Apr 26, -102 (17): 6225-30.
Although the methods and materials of the invention allow the introduction of any exogenous gene into a microorganism, for example Prototheca, genes related to the use of sucrose and the modification of the lipid pathway are of particular interest, as discussed in the following sections.
IV. SELECT MARKERS
one. USE OF IA SACAROSA
In one embodiment, the recombinant Prototheca cell of the invention further contains one or more exogenous sucrose utilization genes. In various embodiments, the one or more genes encode one or more proteins selected from the group consisting of a fructokinase, a glucokinase, a hexokinase, a sucrose invertase, a transporter of
<img file="MX339639B_D0143.tif" />
160
IMPI sucrose. For example, expression of a sucrose transporter and a sucrose invertase allows Prototheca to transport sucrose into the cell from the culture medium and hydrolyzes sucrose to produce glucose and fructose. Optionally, a fructokinase may also be expressed in cases where endogenous hexokinase activity is insufficient for maximum fructose phosphorylation. Examples of suitable sucrose transporters are the Genbank accession numbers.
CAD91334, CAB92307, and CAA53390. Examples of suitable fructokinases are Genbank accession numbers P26984, P26420 and CAA43322.
In one embodiment, the present invention provides a Prototheca host cell that secretes a sucrose invertase. Secretion of a sucrose invertase avoids the need for the expression of a transporter that can transport sucrose into the cell. This is because the secreted invertase catalyzes the conversion of a sucrose molecule to a glucose molecule and a fructose molecule, both of which can be transported and used by the microbes provided by the invention. For example, the expression of a sucrose invertase (such as sec. With ident number: 3) with a secretion signal (such
<img file="MX339639B_D0144.tif" />
<img file="MX339639B_D0145.tif" />
I
161 as sec. with no. Ident: 4 (yeast), sec. with no.
Ident: 5 (from upper floors), sec. with no. from ident:
(consensus signal of eukaryotic secretion), and sec. with no. Ident: 7 (combination of sequence signals from higher plants and eukaryotic consensus) generates invertase activity outside the cell. Expression of that protein, as allowed by the genetic engineering methodology described herein, allows cells that are already capable of using extracellular glucose as an energy source to use sucrose as an extracellular energy source.
Prototheca species expressing an invertase in sucrose-containing media are a preferred species of microalgae for oil production. The expression and extracellular directionality of this fully active protein allows the resulting host cells to grow in sucrose, whereas their untransformed counterparts cannot. Therefore, the present invention provides recombinant Prototheca cells with codon optimized for the invertase gene, includes but is not limited to the yeast invertase gene, integrated into its genome such that the invertase gene is expressed as assessed by invertase activity and hydrolysis of sucrose. The present invention also provides the genes for the
162
<img file="MX339639B_D0146.tif" />
IMPÍ
INSTITUTO MEXICANO DF IA PMIHBUAD INDUSTRIAL invertasa useful as selection markers in cells
Recombinant prototheca, as these cells are capable of growing in sucrose, whereas their untransformed counterparts cannot, and methods for the selection of recombinant host cells through the use of an invertase as a powerful selection marker for molecular genetics algae.
Successful expression of sucrose invertase in
Prototheca also illustrates another aspect of the present invention as it demonstrates that heterologous (recombinant) proteins can be expressed in the algae cell and successfully transit outside the cell and in the culture medium in a fully active and functional form. Therefore, the present invention provides methods and reagents for expressing a wide and diverse range of heterologous proteins in microalgae and secreting them out of the host cell. Such proteins include, for example, industrial enzymes, such as, for example, lipases, proteases, cellulases, pectinases, amylases (eg, sec. No.
Ident .: 190-191), esterases, oxidoreductases, transferases, lactases, isomerases and invertases, as well as therapeutic proteins such as, for example, growth factors, cytokines, full-size antibodies that
163
IMPI
Mexican INSTITUTE OE LA FRORIEL'AP INDUSTRIAL
<img file="MX339639B_D0147.tif" />
they comprise two light and two heavy chains, Fab, scFv (single stranded variable fragment), camel-like antibodies, antibody fragments, antibody fragment fusions, antibody-receptor fusions, insulin, interferons, and insulin-like growth factors.
The successful expression of a sucrose invertase in
Prototheca also illustrates another aspect of the present invention, as it provides methods and reagents for the use of fungal transit peptides in algae to direct protein secretion in Prototheca; and the methods and reagents for determining whether a peptide can function, and its ability to function, as a transit peptide in Prototheca Prototheca cells. The methods and reagents of the invention can be used as a tool and platform to identify other peptides to successfully transport proteins to the outside of a cell, and that yeast invertase has great utility in these methods. As demonstrated in this example, removal of the yeast endogenous invertase transit peptide and its replacement by other transit peptides, either endogenous to host algae or from other sources (eukaryotes, prokaryotes, and viruses), can identify whether any peptide of interest
<img file="MX339639B_D0148.tif" />
<img file="MX339639B_D0149.tif" />
164
<img file="MX339639B_D0150.tif" />
can function as a transit peptide to guide
m.sTRiM.
<img file="MX339639B_D0151.tif" />
proteins on their way out of the cell.
Examples of suitable sucrose invertases include those identified by Genbank accession numbers.
CAB95010, NP_012104 and CAA06839. Non-limiting examples of suitable invertases are listed below in Table 3. Amino acid sequences for each listed invertase were included in the sequence listing below. In some cases, the exogenous sucrose utilization gene suitable for use in the methods and vectors of the invention encode a sucrose invertase having at least 40, 50, 60,
75, or 90% or greater amino acid identity with a sucrose invertase selected from Table 3.
Table 3. Sucrose invertases.
<td>DESCRIPTION</td><td>Organism</td><td>Access to</td><td>Sec. With no. of</td>
<td>Reverse</td><td>Chicorium intybus</td><td>Y11124</td><td>Sec. With no. of</td>
<td></td><td></td><td></td><td>ident .: 20</td>
<td>Reverse</td><td>Schizosaccharomyces</td><td>AB011433</td><td>Sec. With no. of</td>
<td></td><td>pombe</td><td></td><td>ident.:21</td>
<td>beta-</td><td>Anomalous pichia</td><td>X80640</td><td>Sec. With no. of</td>
<td>fructofuranosidase</td><td></td><td></td><td>ident.:22</td>
<td>(invertase)</td><td></td><td></td><td></td>
<td>Reverse</td><td>Debaryomyces</td><td>X17604</td><td>Sec. With no. of</td>
<td></td><td>occidentalis</td><td></td><td>ident .: 23</td>
<td>Reverse</td><td>Oryza sativa</td><td>AF019113</td><td>Sec. With no. of</td>
<img file="MX339639B_D0152.tif" />
165
ΙΜΡΙ
INSTITUTO MtXICANC · (LA MRORIiDAL) INDUSTRIAL
<td></td><td></td><td></td><td colspan="2">ident .: 24</td>
<td>Reverse</td><td>Allium strain</td><td>AJ006067</td><td>Sec. With no.</td><td>of</td>
<td></td><td></td><td></td><td>ident .: 25</td><td></td>
<td>Reverse</td><td>Beta vulgaris</td><td>AJ278531</td><td>Sec. With no.</td><td>of</td>
<td></td><td>subsp. Vulgaris</td><td></td><td>ident .: 26</td><td></td>
<td>beta-</td><td>Bifidobacterium</td><td>AAT28190</td><td>Sec. With no.</td><td>of</td>
<td>fructofuranosidase</td><td>brief UCC2003</td><td></td><td>ident .: 27</td><td></td>
<td>(invertase)</td><td></td><td></td><td></td><td></td>
<td>Reverse</td><td>Saccharomyces</td><td>NP_012104</td><td>sec. with no.</td><td>of</td>
<td></td><td></td><td></td><td>sec. with no.</td><td>of</td>
<td></td><td>cerevisiae</td><td></td><td>ident.:28</td><td></td>
<td></td><td></td><td></td><td>(amino acid)</td><td></td>
<td>Invest A</td><td>Zymomonas mobilis</td><td>AAO38865</td><td>Sec. With no.</td><td>of</td>
<td></td><td></td><td></td><td>ident .: 29</td><td></td>
<td>Reverse</td><td>Arabadopsis</td><td>NP_566464</td><td>Sec. With no.</td><td>of</td>
<td></td><td>thaliana</td><td></td><td>ident .: 188</td><td></td>
The secretion of an invertase into the culture medium by
Prototheca enables cells to grow also in residual molasses from sugarcane processing as they do in pure reagent-grade glucose; The use of this low-value waste product from sugar cane processing can provide significant cost savings in the production of lipids and other oils. Therefore, the present invention provides a culture of microorganisms containing a population of Prototheca microorganisms, and a culture medium comprising (i) sucrose
166
ΙΜΡΙ
MEXICANCΓΗ INSTITUTE. IA PROPERTY
IAL »'STRIAL and (ii) an enzyme sucrose invertase. In various forms, sucrose in cultivation comes from sorghum, sugar beets, sugar cane, molasses, or depolymerized cellulosic material (which may optionally contain lignin).
In another aspect, the methods and reagents of the invention significantly increase the number and types of raw materials that recombinant Prototheca can use. While the microbes exemplified herein are altered in such a way that they can use sucrose, the methods and reagents of the invention can be applied so that the raw materials, such as cellulosics, are usable by a modified host microbe of the invention with the ability to secrete cellulases, pectinases, isomerases, or the like, such that the breakdown products of enzyme reactions are no longer simply tolerated, rather, they are used as a carbon source by the host. An example of this is described below and in the examples of microbes manipulated to express a secretable α-galactosidase, which confers the ability to hydrolyze agalactosyl bonds in oligosaccharides such as those contained in raffinose and stachyose which are two oligosaccharides that are necunetranized. in agricultural waste streams.
. Alpha-galactosidase expression
167
IMPI ΐΝ.τπτυτυ mexican «LA RRORIgOAL industrial
<img file="MX339639B_D0153.tif" />
Although the expression of a sucrose invertase, as described above, confers the ability on Prototheca cells to use sucrose more efficiently as a carbon source (through the enzymatic hydrolysis of the a-bond between the fructose and glucose molecules in the disaccharide sucrose), Expression of other enzymes that hydrolyze other types of α-bonds in oligosaccharides may confer the ability for Prototheca cells to use other sources of carbon. The expression of these enzymes (and the resulting ability to use carbon sources that Prototheca and other microalgae cells would not ordinarily be capable of) can be used as a selective marker for these transgenic Prototheca cells by allowing the selection of positive clones that are able to grow on these carbon sources.
In one embodiment, the recombinant Prototheca cell of the invention further contains one or more exogenous genes encoding polysaccharide degrading enzymes. In various embodiments, the one or more genes that encode polysaccharide degrading enzymes is a gene that encodes a secreted agalactosidase. Expression of an exogenously secreted α-galactosidase in a Prototheca cell confers the ability of such a transformed strain to grow on sugars
168 IΛ4ΡI
MLUCAN INSTITUTE ·
Μ LA ΜΟΜΒΟΑΓ)
INDUSTRIAL (carbon sources) containing D-galactosyl linkages, such as o-linkages between galactose monosaccharide units and glucose. Prototheca strains expressing an exogenous, secreted agalactosidase will be able to use disaccharides such as melibiosa (disaccharide composed of aD-galactose-glucose).
Sugars such as raffinose (a trisaccharide made up of α-linked galactose-glucose-fructose) and stachyose (a tetrasaccharide made up of two linked 10-D-galactose units, followed by α-linked glucose and fructose) occur in significant proportions in streams from agricultural waste such as beet pulp (raffinose) and soybean meal (stachyose). Such agricultural residues represent a significant unused carbon source for oil conversion by microbes (including Prototheca) capable of using them.
[0013] Prototheca are unable to use oligosaccharides such as raffinose and stachyose in any significant amount at all. In the case of raffinose and stachyose, although transgenic strains expressing a sucrose invertase (as described above) have the ability to hydrolyze the α-link between fructose and glucose in an α-galactosyl derivative of sucrose, but the
<img file="MX339639B_D0154.tif" />
169
IMPI
MEXICAN INSTITUTE • í la norteo * · inmjütwial
<img file="MX339639B_D0155.tif" />
The rest of the oligosaccharide remains unused, since sucrose invertase does not cleave the remaining α-bonds in such sugars and the resulting disaccharides are not usable.
In another embodiment, the recombinant Prototheca cell of the invention comprises an exogenous gene encoding a sucrose invertase and an exogenous gene encoding an agalactosidase. Thus, strains expressing a sucrose invertase and an α-galactosidase will be able to fully hydrolyze oligosaccharides such as raffinose and stachyose, allowing consumption of the monomer components. Additionally, genes encoding agalactosidase can be used as a selectable marker for transformation. Clones containing the exogenous agalactosidase gene will have the ability to grow on melibiosa. Examples of α-galactosidase genes suitable for use in Prototheca strains include the MEL1 gene from
Saccharomyces carlbergehsis, the AglC gene from Aspergilus niger.
Remarkably, not all α-galactosidase genes are functional in Prototheca species, even if the genes are optimized according to the use of preferred codons in Prototheca strains. The examples below demonstrate the ability of transgenic Prototheca cells to grow in melibiosa when transformed with an optimized MEL1 gene.
170
IMPI
Ε · .πτ> ιτο MEXICAN ru · .. <• 'TOklEDAÓ
<img file="MX339639B_D0156.tif" />
by codon from S. carlbergensis and the AglC gene from A. niger, but not a gene that encodes α-galactosidase from the top plant, Cyamopsis tetragonobola (guar seed).
3. Thiamine auxotrophic supplementation
Prototheca strains that include Prototheca moriformis are known to be thiamine auxotrophic (see, for example, Ciferri, 0. (1956) Nature, v.178, pp. 1475-1476), meaning that these strains require thiamine in the nutrient medium for growth. Thiamine auxotrophy may be the result of mutations or loss of enzyme expression in the thiamine biosynthetic pathway. Complemented transgenic strains expressing the enzyme (s) missing from the thiamine biosynthetic pathway can then grow without adding thiamine, thus reducing the cost of the nutrient medium as well as making the resulting microalgae biomass more desirable from the point of animal nutrition. Supplementation with an enzyme of the thiamine biosynthetic pathway can also be used as a selectable marker since the transgenic gene confers the ability to grow on plates / media that do not contain thiamine.
In one embodiment, the recombinant Prototheca cell of the invention further contains one or more exogenous genes that
171
ΙΜϊ
<img file="MX339639B_D0157.tif" />
encode the enzyme of the thiamine biosynthetic pathway. In another embodiment, the recombinant Prototheca cell of the invention comprises an exogenous gene encoding hydroxymethylpyrimidine phosphate synthases (eg, sec.
with no. Ident .: 192) from algae, plants or cyanobacterial sources. In still other embodiments, hydroxymethylpyrimidine phosphate synthase is encoded by a THIC gene. In still other modalities, the THIC gene is THIC C169 from Coccomyxa, THIC from Arabidopsis thaliana, THIC PCC 6803 from Synechocystis sp, or THIC from Salmonella enterica subsp. Enteric serovar Typhimurium str. (section with ID number: 193). The examples below detail the modification of Prototheca moriformis UTEX 1435 with the restored thiamine prototype.
Other selectable markers
Any of a wide variety of selectable markers can be used in the construct of a transgene useful for the transformation of microorganisms, such as Chlorella. Examples of suitable selectable markers include the nitrate reductase gene, the hygromycin phosphotransferase (HPT) gene, the neomycin phosphotransferase gene, and the ble gene, which
172
<img file="MX339639B_D0158.tif" />
OF THE INDUSTRY NAME !.
confers resistance to phleomycin. Methods for determining the sensitivity of microalgae to antibiotics are well known. For example. Mol Gen
Genet. 1996 Oct 16, -252 (5): 572-9.
More specifically, Dawson et al. (1997), Current
Microbiology 35: 356-362 (incorporated by reference in its entirety herein), describe the use of the Chlorella nitrate reductase (NR) gene as a selectable marker for NR-deficient Chlorella soroklniana mutants. Kim et al. (2002), Mar. Biotechnol.4: 6373 (incorporated by reference herein in its entirety), describe the use of the HPT gene as a selectable marker to transform Chorella ellipsoidea. Huang et al. (2007), Appl. Microbiol. Biotechnol. 72: 197-205 (incorporated by reference herein in its entirety), reported the use of Sh ble as a selectable marker for Chlorella sp. DT
V. LIPIDIC ENGINEERING
In addition to altering the capacity of microorganisms (for example, microalgae.
oil yeast, fungi, or bacteria), such as Prototheca to use raw materials as sucrose-containing raw materials, the present invention further provides
173
IMPI
IMÍT + T'VC MUCAMO
ΤΤ! .ΠΌ MUCAMO M LA rttOMfPAD
<img file="MX339639B_D0159.tif" />
Recombinant microorganisms (eg Prototheca) that were modified to alter the properties and / or proportions of lipids produced. The pathway can also be, or alternatively, modified to alter the properties and / or proportions of various lipid molecules that are produced through enzymatic processing of lipids and intermediates in the fatty acid pathways. In various embodiments, the recombinant microorganisms (eg Prototheca cells) of the invention have, compared to their untransformed counterparts, an optimized lipid yield per unit volume and / or per unit time, chain length of carbon (for example, for renewable diesel production or for chemical industry applications requiring lipid raw materials), reduced number of double or triple bonds, optionally zero, and an increase in the hydrogen: carbon ratio of a particular lipid species or a different lipid population. Additionally, desirable hydrocarbon-producing microorganisms can be manipulated to produce such components in higher amounts, or with greater specificity.
In the case of microalgae, some wild cells already have good growth characteristics but do not produce
<img file="MX339639B_D0160.tif" />
174 the desired types or amounts of lipids ^ Tros- example ^ include, but are not limited to, Pyrobotrys, Phormidium,
Agmenellum, Cartería, Lepocinclis, Pyrobotrys, Nitzschia,
Lepocinclis, Anabaena, Euglena, Spirogyra, Chlorococcum,
Tetraedron, Oscillatoria, Phagus, and Chlorogonium, which have the desired growth characteristics in municipal drainage or wastewater. Such cells, as well as Chlorella, Prototheca, and other microbe species, can be engineered to have improved lipid production characteristics. Desired characteristics include optimizing lipid yield per unit volume and / or per unit time, carbon chain length (for example, for biodiesel production or for industrial applications requiring hydrocarbon feedstocks), reducing the number of double or triple bonds, optionally to zero remove or remove rings and cyclic structures and increase the hydrogen ratio: carbon of a particular lipid species or a different lipid population. Furthermore, the microalgae that produce suitable hydrocarbons can be further modified to have even more desirable hydrocarbon yields. Examples of such microalgae include species of the genus Chlorella and the genus
Prototheca.
IMPI
MEXICAN INSTITUTE
MEXICAN INSTITUTE
OF THE Ε «0ίΙΕΟΑΓ,
<img file="MX339639B_D0161.tif" />
In particular modalities, one or more enzymes that control branch points in the metabolismTsmÓ "" of '"± a · ~ fatty acid synthesis were regulated up or down to improve lipid production. Up-regulation can be achieved, for example, by transforming cells with expression constructs in which a gene encoding the enzyme of interest is expressed, for example, through the use of a strong promoter and / or enhancer elements that increase transcription. Such constructs may include a selection marker such that transformants can be screened, which can result in an amplification of the construct and an increase in the level of expression of the encoded enzyme. Examples of enzymes suitable for upregulation according to the methods of the invention include pyruvate dehydrogenase, which plays a role in the conversion of pyruvate to acetyl-CoA (examples, some from microalgae, include accession numbers in Genbank NP_415392; AAA53047; Q1XDM1; and CAF05587). Upregulation of pyruvate dehydrogenase can increase acetyl-CoA production, and thereby increase fatty acid synthesis. Acetyl-CoA carboxylase catalyzes the initial stage in the synthesis of fatty acids. In
176
IMPÍ
INSTITUTO MEXICANO consequently, this enzyme can be regulated áaeeaSáí & nSí to increase the production of acids — fatty— (eg, some of microalgae, include access numbers of Genbank
BAA94752; AAA75528; AAA81471; YP_537052; YP_536879; NP_045833 and BAA57908). Fatty acid production can also be increased by upregulation of acyl carrier protein (ACP), which transports growing acyl chains during fatty acid synthesis (eg, some from microalgae, include accession numbers in Genbank AOTOF8; P51280; NP_849041; YP_874433). Glycerol-3-phosphate acyl transferase catalyzes the rate limiting step of fatty acid synthesis. Upregulation of this enzyme can increase fatty acid production (some microalgae, for example, include accession numbers in Genbank AAA74319;
AAA33122; AAA37647; P44857 and ABO94442).
Up-regulation or down-regulation of genes can be applied to global regulators that control gene expression of fatty acid biosynthetic pathways. Consequently, one or more global regulators of fatty acid synthesis are positively or negatively regulated, as appropriate, to inhibit or increase, respectively, the expression of a plurality of genes
<img file="MX339639B_D0162.tif" />
177
ΙΜΡΙ synthetic fatty acids and, in úH-íma-'nnt-mnia increase lipid production. Examples include sterol regulatory element binding proteins (SREBPs), such as SREBP-la and SREBP-lc (for examples see Genbank accession numbers NP_035610 and Q9WTN3).
The present invention further provides recombinant microorganisms (eg, Prototheca cells) that were modified to contain one or more exogenous genes encoding lipid-modifying enzymes such as, for example, fatty acyl-ACP thioesterases (eg.
C. callophylla (sec. With ID no .: 145 and sec. With no.
Ident .: 146; see also Table 4), fatty acyl CoA / aldehyde reductase (see Table 6), acyl fatty CoA reductase (see Table 7), fatty aldehyde decarbonylase (see Table 8), fatty aldehyde reductase, desaturase (such as desaturase of stearoyl-ACP (for example, an R.
communis SAD, sec. with no. Ident .: 147 and sec. with no. Ident .: 148) optimized for codon and fatty acyl desaturases and squalene synthases (see accession number to GenBank
AF205791). In some embodiments, genes encoding acyl fatty ACP thioesterase and a naturally co-expressing acyl carrier protein are transformed within a Prototheca cell, optionally with one or more genes that
178
<img file="MX339639B_D0163.tif" />
encode other enzymes for lipid modification. In other embodiments, ACP and acyl fatty acp thioesterase may have an affinity for each other that gives an advantage when the two are used together in the microbes and methods of the present invention, regardless of whether they co-express naturally. or not in a particular tissue or organism. Therefore, the present invention contemplates both pairs of these naturally co-expressing enzymes and those that share an affinity to interact with each other to facilitate cleavage of a carbon chain of specific length from ACP.
In still other modalities, an exogenous gene encoding a desaturase is transformed within the microorganism (eg, a Prototheca cell) in conjunction with one or more genes encoding other lipid modifying enzymes to provide modifications with respect to saturation of lipids. In other embodiments, an endogenous desaturase gene is overexpressed (eg, by introducing additional copies of the gene) into the microorganism (eg, a Prototheca cell). Stearoyl ACP desaturase (see, for example, GenBank accession numbers AAF15308; ABM45911; and AAY86086), for example, catalyzes the conversion of stearoyl acp to oleoyl ACP. Regulation
179
IMPI
MEXICAN INSTITUTE OC THE MCPIPDAH
INDUSTRIAL
<img file="MX339639B_D0164.tif" />
Upregulation of this gene can increase the proportion of monounsaturated fatty acids produced by a cell, whereas downregulation can reduce the proportion of monounsaturated fatty acids. For illustrative purposes, stearoyl5 ACP desaturases (SAD) are responsible for the synthesis of C18 fatty acids: the starting of C18: 0 precursors. Another family of desaturases are acyl fatty desaturases (FAD), which include delta 12 fatty acid desaturases (Δ12 FAD).
These desaturases further provide modifications with respect to lipid saturation. For illustrative purposes, delta 12 fatty acid desaturases are responsible for the synthesis of C18: 2 fatty acids from C18: 1 precursors. Likewise, the expression of one or more glycerolipid desaturases can be controlled to alter the ratio of unsaturated to saturated fatty acids such as ω-6 desaturase fatty acid, ω-6-desaturase fatty acids, or ω-6-oleate desaturase. In some embodiments, the desaturase can be selected with reference to a desired carbon chain length, such that the desaturase is capable of making modifications at specific locations within a substrate of specified carbon length, or substrates having a length of carbons within a specified range. In another modality, if the
180
<img file="MX339639B_D0165.tif" />
desired fatty acid profile is. an increase in monounsaturates (such as C16: 1 and / or C18: l) the over-expression of a SAD or the expression of a heterologous SAD can be coupled with silencing or inactivation (eg, through mutation, iRNA, knockout of an endogenous desaturase gene, etc.) of an acyl fatty desaturase (FAD).
In other embodiments, the microorganisms (eg, Prototheca cells) were modified to have a mutated endogenous desaturase gene, where the mutation inactivates the gene or enzyme desaturase. In some cases, the mutated endogenous desaturase gene is a fatty acid desaturase (FAD). In other cases, the mutated endogenous desaturase gene is a stearoyl acyl desaturase (SAD) transporter protein. Example 11 below describes the directed ablation or knockout of stearoyl-ACP desaturases and delta 12 fatty acid desaturases.
In some cases, it may be advantageous to pair one or more genetic engineering techniques to achieve a transgenic cell that produces the desired lipid profile. In one embodiment, a microorganism (eg, a Prototheca cell) comprises an endogenous desaturase mutated gene and one or more exogenous genes. In non-limiting examples, a Prototheca cell with a mutated desaturase gene
181
<img file="MX339639B_D0166.tif" />
IMPI 'NSTnyro Mexican Dt IA PROPlrr »A | j
Endogenous IMNICTRIAL _ may further express an exogenous acyl fatty acp-thioesterase gene and / or a sucrose invertase gene.
Example 11 below describes a transgenic cell of
Prototheca that contains a directed or knockout ablation of an endogenous SAD and further expresses a C14-preferred thioesterase and a sucrose invertase from Cinnamomum camphora. In this case, the transgenic Prototheca cell produces a lipid profile that closely approximates the lipid profile found in the sebum. Tallow is typically derived from molten beef or sheep fat, is solid at room temperature, and is used in a variety of applications in the food, cosmetic, and chemical industries. The fatty acid profile of sebum is: 4% C14: 0; 26%
C16: 0; 3% C16: l; 14% C18: 0; 41% C18: l; 3% C18: 2; and 1% C18: 3.
As shown in Example 11 below, clones of transgenic Prototheca cells with targeted or knockout ablation of endogenous SAD and expressing a thioesterase that prefers C. camphora C14 have a lipid profile of: less than 1% C12 and fatty acids of shorter carbon chain length; 2.74% to 6.13% C14: 0; 23.07% to 25.69%
C16: 0; 7.02% to 11.08% C18: 0; 42.03% to 51.21% C18: l; and 9.37% a
13.45% C18: 2 expressed as a percentage of area). In some cases, transgenic Prototheca cells have profiles
<img file="MX339639B_D0167.tif" />
182
Lipid IMPI of: 3-5
C14: 0; 25-27
C16: 0; 10-15
C18: 0; and 4045% C18: 1.
Thus, in particular embodiments, the microbes of the present invention are genetically engineered to express one or more exogenous genes selected from an acyl acp thioesterase, an acyl-CoA / aldehyde reductase, an acyl fatty-CoA reductase, a fatty aldehyde reductase, a fatty aldehyde decarbonylase, or a naturally expressed acyl transporter protein. Suitable expression methods are described above in relation to expression of a lipase gene, including, but not limited to, inducible expression and compartmentalized expression. An acyl fatty ACP thioesterase cleaves a fatty acid from an acyl carrier protein (ACP) during lipid synthesis. Through additional enzymatic processing, the cleaved fatty acid combines with a coenzyme to produce an acyl-CoA molecule. This acylCoA is the substrate for the enzymatic activity of acyl fatty-CoA reductase to yield an aldehyde, as well as for an acyl fatty CoA / aldehyde reductase to produce an alcohol. The aldehyde that is produced by the action of the acyl fatty CoA reductase identified above is the substrate for additional enzyme activity by either an aldehyde
183
<img file="MX339639B_D0168.tif" />
fatty reductase to produce an alcohol, or a fatty aldehyde decarbonylase to produce an alkane or alkene.
In some embodiments, the fatty acids, glycerolipids, or corresponding primary alcohols, aldehydes, allenes, or alkenes, which are generated by the methods described herein, contain 8, 10, 12, or 14 carbon atoms. The preferred fatty acids for the production of diesel, biodiesel, renewable diesel, or jet fuel, or the corresponding primary alcohols, aldehydes, allenes and alkenes, for industrial applications contain from 8 to 14 carbon atoms. In certain embodiments, the above fatty acids, as well as the other corresponding hydrocarbon molecules, are saturated (without any carbon-carbon double or triple bond), monounsaturated (single double bond); unsaturated poly (two or more double bonds); it is linear (non-cyclical) or branched.
For fuel production, higher saturation is preferred.
The enzymes described directly above have preferential specificity for the hydrolysis of a substrate containing a specific number of carbon atoms. For example, an acyl fatty acp thioesterase may have a preference for cleavage of a fatty acid that has
184
MEXICAN INSTITUTE OF LA FROFieOAÚ
INDUSTRIAL carbon atoms of acp. In some embodiments, length-specific ACP and thioesterase may have an affinity for each other that makes them especially useful in combination (eg, exogenous acp and thioesterase genes can naturally co-express in a given tissue or organism from which they are derived). Thus, in various embodiments, the recombinant Prototheca cells of the invention may contain an exogenous gene that encodes a protein with specificity to catalyze enzymatic activity (eg, cleavage of a fatty acid from an ACP, reduction of a acyl-CoA to an aldehyde or an alcohol, or the conversion of an aldehyde to an alkane) with respect to the number of carbon atoms contained in the substrate. Enzymatic specificity may, in various embodiments, be for a substrate having 8 to carbon atoms, preferably 8 to 18 carbon atoms, and more preferably 8 to 14 carbon atoms. A preferred specificity is for a substrate that has less, ie 12, better than more, ie 18 carbon atoms.
Other suitable acyl-ACP fatty thioesterases for use with the microbes and methods of the invention include, but are not limited to, those listed in Table 4.
185
<img file="MX339639B_D0169.tif" />
Table 4. Acyl Fatty-ACP Thioesterases and GenBank Access Numbers.
fatty acyl-ACP thioesterase from Umbellularia cali fornica (GenBank # AAC49001) (ID no.: 203) fatty acyl-ACP thioesterase from Cinnamomum camphora (GenBank # Q39473) fatty acyl-ACP thioesterase from Umbellularia californica (GenBank # 041635) Myristica fragrans fatty acyl-ACP thioesterase (GenBank # AAB71729) (sec. With ID #: 224) Myristica fragrans fatty acyl-ACP thioesterase (GenBank # AAB71730) (sec. No. ID: 222) Fatty acyl-ACP thioesterase from Elaeis guineensis (GenBank # ABD83939) (Sec. ID: 204) Fatty acyl-ACP thioesterase from Elaeis-guineensis (GenBank # AAD42220) Fatty acyl-ACP thioesterase Populus tomentosa (GenBank # ABC47311) (Sec. ID #: 207) Acyl Fatty-ACP Thioesterase from Arabidopsis thaliana (GenBank # NP_172327) (Sec. ID #: 208) Acyl Fatty-ACP Thioesterase from Arabidopsis thaliana (GenBank # CAA85387), (sec. with ID no .: 2 09)
186
ΙΜΡΙ <sup>ΙΝ5Τ |</sup>τυτο MtxicAN »: FROM THE EROPISDAr ΙΝ · Ι ISTRIAL
<img file="MX339639B_D0170.tif" />
Arabidopsis fatty acyl-ACP thioesterase (GenBank # CAA85388) (sec. with ID #: 210) Gossypium hirsutum fatty acyl-ACP thioesterase (GenBank # Q9SQI3) (sec. with ID #: 211) acyl fatty-ACP thioesterase from Cuphea lanceolata (GenBank # CAA54060) (sec. with ID #: 212) acyl fatty-ACP thioesterase from Cuphea hookeriana (GenBank # AAC72882) (sec. with ID #: 202) acyl fatty-ACP thioesterase from Cuphea calophylla subsp.
mesostemon (GenBank # ABB71581) (ID no.: 213) Fatty acyl-ACP thioesterase from Cuphea lanceolata (GenBank # CAC19933) Fatty acyl-ACP thioesterase from Elaeis guineensis (GenBank # AAL15645) (sec no. ID: 206) Fatty acyl-ACP thioesterase from Cuphea hookeriana (GenBank # Q39513) Fatty acyl-ACP thioesterase from Gossypium hirsutum (GenBank # AAD01982) (section with ID no .: 214) Fatty acyl-ACP thioesterase from Vitis vinifera (GenBank # CAN81819) (sec. With no. ID: 215) Garlicia mangostana acyl fatty acp-thioesterase (GenBank # AAB51525)
<img file="MX339639B_D0171.tif" />
187 fatty acyl-ACP thioesterase from Brassica júncea (GenBank # ABI18986) (sec. with ID #: 216) acyl fatty-ACP thioesterase from Madhuca longifolia (GenBank # AAX51637) (sec. with ID #: 217) fatty acyl-ACP thioesterase from Brassica napus (GenBank # ABH11710) fatty acyl-ACP thioesterase from Oryza sativa (indica cultivar group) (GenBank # EAY86877) (sec. with ID no .: 218) fatty acyl-ACP thioesterase from Oryza sativa (cultivar group japanica) (GenBank # NP_001068400) (sec. with no. Ident .:
219) Fatty acyl-ACP thioesterase from Oryza sativa (indica cultivar) (GenBank # EAY99617) (ID no .: 220) Fatty acyl-ACP thioesterase from Cuphea hookeriana (GenBank # AAC49269) Fatty acyl-ACP thioesterase of Ulmus Americana (GenBank # AAB71731) Fatty acyl-ACP thioesterase from Cuphea lanceolata (GenBank # CAB60830) (sec. with ID no .: 221) Fatty acyl-ACP thioesterase from Cuphea palustris (GenBank # AAC49180) Fatty acyl-ACP Germanic Iris thioesterase (GenBank
188
IMPIAS,
MEXICAN INSTITUTE IA
DE LA FROFIÍDAO # AAG4 3858) ____ „_____ fatty acyl-ACP thioesterase from Germanic Iris (GenBank # AAG43858.1) fatty acyl-ACP thioesterase from Cuphea palustris (GenBank # AAC49179) fatty acyl-ACP thioesterase from Myristica
AAB71729) fatty acyl-ACP thioesterase from Myristica fragrans (GenBank #
AAB717291.1) Cuphea hookeriana fatty acyl-ACP thioesterase (GenBank # U39834) (ID no .: 197) Umbilluaria cali fornica fatty acyl-ACP thioesterase (GenBank # M94159) (Sec. No. ident .: 285) Fatty acyl-ACP thioesterase from Cinnamomum camphora (GenBank # U31813) (sec. with ID no .: 223) Fatty acyl-ACP thioesterase from Cuphea wrightii (GenBank # U56103) (sec. ident .: 183) Ricinus communis fatty acyl-ACP thioesterase (GenBank # ABS30422) (sec. no. ID: 198)
The examples below describe the directionality and successful expression of heterologous acyl fatty acp-thioesterases.
189
ΙΜ— MEXICAN INSTITUTE OF THE ('¡ΗΨΙΕΟΛΟ INDUSTRIAL
<img file="MX339639B_D0172.tif" />
of Cuphea hookeriana, Umbellularia cali fornica, Cinnamomun camphora, Cuphea palustris, Cuphea lanceolata, Iris germanica, Myristica fragrans and Ulmus americana in Prototheca species. Additionally, alterations in the fatty acid profile were confirmed in the expression of the host cells of these heterologous acyl fatty ACP thioesterases. These results were unexpected given the lack of sequence identity between algae and higher plant thioesterases in general, and between Prototheca moriformis acyl fatty ACP thioesterases and the heterologous acyl fatty ACP thioesterases listed above. As shown in the Examples, expression of these heterologous thioesterases in Prototheca generates a transgenic microalgae that is capable of producing oil / lipids with truly unique fatty acid profiles that are not currently available from commercial seed crops, even at through the mixing of various seed cultivation oils. Table 5 shows the fatty acid profiles of common commercial seed oils. All commercial seed oil data below was compiled from the United States Pharmacopeia Food and Chemical Codes, 7<sup>ma</sup> Ed. 2010-2011. The data of the
190
I -Μ Ρ ί
INSTITUT »ι MEXICAN» 'DE LA RRORIÍUAl:
INDUSTRIAL tallow are from the National Research Council: Fat content and composition of animal products (1976).
Table 5. Lipid profiles of commercial seed oils (in percentages).
<td></td><td>C8: 0</td><td>cio : 0</td><td>Cl2: 0</td><td>C14: 0</td><td>C16: 0</td><td>C18: 0</td><td>C18 :one</td><td>C18: O- diOH</td><td>C18: l -OH</td><td>C18: 2</td><td>C18: 3 a</td>
<td>R. communis</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0.9-</td><td> 1.0-</td><td> 3.7</td><td> 0.4-</td><td> 83.6-</td><td> 0</td><td> 0.2-0.6</td>
<td>(Oil of</td><td></td><td></td><td></td><td></td><td> 1.6</td><td> 1.8</td><td> -</td><td> 1.3</td><td> 89.0</td><td></td><td></td>
<td>castor bean)</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 6.7</td><td></td><td></td><td></td><td></td>
<td>C. nucífera</td><td> 5.0</td><td> 4.0</td><td> 44-52</td><td> 15-21</td><td> 8.0-</td><td> 1.0-</td><td> 5.0</td><td> 0</td><td> 0</td><td> 0-2.5</td><td> 0</td>
<td>(Oil of</td><td> -</td><td> -</td><td></td><td></td><td> 11.0</td><td> 4.0</td><td> -</td><td></td><td></td><td></td><td></td>
<td>walnut</td><td> 9.0</td><td> 8.0</td><td></td><td></td><td></td><td></td><td> 8.0</td><td></td><td></td><td></td><td></td>
<td>coconut)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Z. mays</td><td> 0</td><td> 0</td><td> 0</td><td> < 1.0</td><td> 8.0-</td><td> 0.5-</td><td> 19-</td><td> 0</td><td> 0</td><td> 38-65</td><td> < 2.0</td>
<td>(Oil of</td><td></td><td></td><td></td><td></td><td> 19.0</td><td> 4.0</td><td> 50</td><td></td><td></td><td></td><td></td>
<td>corn)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>G.</td><td> 0</td><td> 0</td><td> < 0.1</td><td> 0.5-</td><td> 17-29</td><td> 1.0-</td><td> 13-</td><td> 0</td><td> 0</td><td> 40-63</td><td> 0.1-2.1</td>
<td>barbadense</td><td></td><td></td><td></td><td> 2.0</td><td></td><td> 4.0</td><td> 44</td><td></td><td></td><td></td><td></td>
<td>(Oil of</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>seed of</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>cotton)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>B. rapa, B</td><td> 0</td><td> 0</td><td> < 0.1</td><td> < 0.2</td><td> < 6.0</td><td> < 2.5</td><td> >50</td><td> 0</td><td> 0</td><td> < 40</td><td> < 14</td>
<td>napus, B.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>júncea</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>(Canda)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0. European</td><td> 0</td><td> 0</td><td> 0</td><td> < 0.1</td><td>β .5-</td><td> 0.5-</td><td> 56-</td><td> 0</td><td> 0</td><td> 3.5-</td><td> < 1.2</td>
<td>(Olive)</td><td></td><td></td><td></td><td></td><td> 20.0</td><td> 5.0</td><td> 85</td><td></td><td></td><td> 20.0</td><td></td>
<td>A. hypoqaea</td><td> 0</td><td> 0</td><td> < 0.1</td><td> < 0.2</td><td> 7.0-</td><td> 1.3-</td><td> 35-</td><td> 0</td><td> 0</td><td> 13.0-</td><td> < 0.6</td>
<td>(Peanut)</td><td></td><td></td><td></td><td></td><td> 16.0</td><td> 6.5</td><td> 72</td><td></td><td></td><td> 43</td><td></td>
<td>AND.</td><td> 3.0</td><td> 2.5</td><td> 40-52</td><td> 14.0-</td><td> 7.0-</td><td> 1.0-</td><td> 11.</td><td> 0</td><td> 0</td><td> 0.5-</td><td> 0</td>
<td>guineensis</td><td> -</td><td> -</td><td></td><td> 18.0</td><td> 10.0</td><td> 3.0</td><td> 0-</td><td></td><td></td><td> 4.0</td><td></td>
191
<img file="MX339639B_D0173.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE OF THE ER: TIE<sup>r,</sup>AI '' INDUSTRIAL
<td>(Almond</td><td> 5.0</td><td> 6.0</td><td></td><td></td><td></td><td></td><td> 19.</td><td></td><td></td><td></td><td></td>
<td>Palm)</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td></td>
<td>AND.</td><td> 0</td><td> 0</td><td> 0</td><td> 0.5-</td><td> 32.0-</td><td> 2.0-</td><td> 34-</td><td> 0</td><td> 0</td><td> 7.2-</td><td> 0</td>
<td>guineensis</td><td></td><td></td><td></td><td> 5.9</td><td> 47.0</td><td> 8.0</td><td> 44</td><td></td><td></td><td> 12.0</td><td></td>
<td>(Palm)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>C.</td><td> 0</td><td> 0</td><td> < 0.1</td><td> < 0.1</td><td> 2.0-</td><td> 1.0-</td><td> 7.0</td><td> 0</td><td> 0</td><td> 72-81</td><td> < 1.5</td>
<td>tinctorus</td><td></td><td></td><td></td><td></td><td> 10.0</td><td> 10.0</td><td> -</td><td></td><td></td><td></td><td></td>
<td>(Safflower)</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 16.</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td></td>
<td>H. annus</td><td> 0</td><td> 0</td><td> < 0.1</td><td> < 0.5</td><td> 3.0-</td><td> 1.0-</td><td> 14-</td><td> 0</td><td> 0</td><td> 20-75</td><td> < 0.5</td>
<td>(Sunflower)</td><td></td><td></td><td></td><td></td><td> 10.0</td><td> 10.0</td><td> 65</td><td></td><td></td><td></td><td></td>
<td>G. max</td><td> 0</td><td> 0</td><td> < 0.1</td><td> < 0.5</td><td> 7.0-</td><td> 2.0-</td><td> 19-</td><td> 0</td><td> 0</td><td> 48-65</td><td> 5.0-10.0</td>
<td>(Bean from</td><td></td><td></td><td></td><td></td><td> 12.0</td><td> 5.5</td><td> 30</td><td></td><td></td><td></td><td></td>
<td>soy)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>L.</td><td> 0</td><td> 0</td><td> < 0.1</td><td> < 0.5</td><td> 2.0-</td><td> 2.0-</td><td> 8.0</td><td> 0</td><td> 0</td><td> 40-80</td><td> < 5.0</td>
<td>usitatissim</td><td></td><td></td><td></td><td></td><td> 9.0</td><td> 5.0</td><td> -60</td><td></td><td></td><td></td><td></td>
<td>um</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>(Solin-</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>linseed)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>B. parkii</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 3.8-</td><td> 41.2-</td><td> 34 .</td><td> 0</td><td> 0</td><td> 3.7-</td><td> 0</td>
<td>(Seed of</td><td></td><td></td><td></td><td></td><td> 4.1</td><td> 56.8</td><td> 0-</td><td></td><td></td><td> 6.5</td><td></td>
<td>shea)</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 46.</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 9</td><td></td><td></td><td></td><td></td>
<td>Butter</td><td></td><td> 0-1</td><td> 0-1</td><td> 0-4</td><td> 22-30</td><td> 24-37</td><td> 29-</td><td></td><td></td><td> 0-3</td><td></td>
<td>ca cao</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 38</td><td></td><td></td><td></td><td></td>
<td>Tallow</td><td></td><td></td><td></td><td> 3-4</td><td> 23-28</td><td> 14-23</td><td> 36-</td><td></td><td></td><td> 1-4</td><td> < 1</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 43</td><td></td><td></td><td></td><td></td>
<td>Lardo</td><td></td><td></td><td></td><td> 1-2</td><td> 22-26</td><td> 13-18</td><td> 39-</td><td></td><td></td><td> 8-15</td><td> 0.5-1.5</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td><td></td>
As an example, none of these common seed oils contain high amounts of C8 or CIO fatty acids,
192
ΙΜΡϊ
INSTITUTO MEXICANO 3 mlafkohedad r / j industrial ΝμΓ * · «<sup>1</sup>* where coconut oil and palm kernel oil are the major sources, but both in a 1: 1 ratio (C8: C10 fatty acids). As shown in the examples, the
Prototheca transformed with Cuphea palustris thioesterase of preference C: 8 was able to achieve not only a C8 fatty acid level above 12%, but also, the ratio of C8: C10 fatty acids was approximately 5: 1.
Changes in fatty acid levels are useful in producing oils that contain a fatty acid profile adapted for a variety of commercial applications.
Furthermore, changes in the relationships between different lengths of fatty acid chains is something that is not commercially available in oils that did not go through even more expensive chemical processes (such as esterification, distillation, fractionation, and reesterification). As another example, palm oil is the oil with the highest C16: 0 fatty acid content (32-47%), but palm oil has very few C14: 0 fatty acids. Prototheca containing thioesterase U. americana reaches approximately 33-38% C16: 0 fatty acids and approximately 10-16% C14: 0 fatty acids (approximately a 2: 1 ratio C16: 0 to C14: 0). This fatty acid profile is unattainable through the mixing of
<img file="MX339639B_D0174.tif" />
193
ΙΜΡΙ
MEXICAN INSTITUTE OF I. » INDUSTRIAL FROFIEDAD commercially available oils because ios oils<sup>-</sup><35 · Seeds that are high in 16: 0 fatty acids usually do not contain many 14: 0 fatty acids.
The examples below further describe, for the first time, the successful directionality and expression of at least two acyl fatty-ACP thioesterases in one clone. Alterations in fatty acid profiles were confirmed in these clones and depending on which two thioesterases were co-expressed in one clone, the fatty acid profiles were impacted differently. As an example, from Table 5 above, both coconut oils and palm kernel oil have C12: C14 ratios of approximately 3: 1.
As described in the examples below, a Prototheca transformant containing two heterologous thioesterase genes was able to produce levels of fatty acids
C12: C14 at a ratio of approximately 5: 1. The type of C12: C14 fatty acid ratio was, until now, unattainable at commercial levels (i.e., through mixing of seed oils).
Another novel aspect of oils produced by transgenic microalgae is the degree of saturation of fatty acids. Palm oil is currently the largest source of saturated oil, with total saturates at
194
IMPI
MLXlCANO INSTITUTE OF THE INDUSTRIAL FROPfEOAD
<img file="MX339639B_D0175.tif" />
unsaturated from 52% to 48%. As shown in the examples below, Prototheca with heterologous thioesterases from U.
americana γ C. camphora reached total saturation levels above 60% in the oil they produced.
In addition, it is shown in the examples below that Prototheca with heterologous thioesterases from U. americana reached total saturation levels above 86% in the oil it produced.
Acyl fatty CoA / aldehyde reductases suitable for use with the microbes and methods of the invention include, but are not limited to, those listed in Table 6.
Table 6. Acyl Fat-CoA / Aldehyde Reductases listed by GenBank Accession Numbers.
AAC45217, YP_047869, BAB85476, YP_001086217, YP_580344,
YP_001280274, YP_264583, YP_436109, YP_959769, ZP_01736962,
ZP_01900335, ZP_01892096, ZP_01103974, ZP_01915077,
YP_924106, YP_130411, ZP_01222731, YP_550815, YP_983712, YP_001019688, YP_524762, YP_856798, ZP_01115500, YP_001141848, NP_336047, NP_216059, YP_882705, YP_88607, YP_88607, YP_88608
AAR88762, ABK28586, NP_197634, CAD30694, NP_001063962,
BAD46254, NP_001030809, EAZ10132, EAZ43639, EAZ07989,
195
IMPI
MEXICAN INSTITUTE of the nrornn »n INDUSTRIAL
NP_001062488, CAB88537, NP_001052541, CAH66597, CAE02214,
CAH66590, CAB88538, EAZ39844, AAZ06658, CAA68190, CAA52019, and BAC84377
Acyl fatty CoA reductases suitable for use with the microbes and methods of the invention include, but are not limited to, those listed in Table 7.
Table 7. Acyl Fat-CoA Reductases Listed by GenBank Access Numbers.
NP_187805, ABO14927, NP_001049083, CAN83375, NP_191229,
EAZ42242, EAZ06453, CAD30696, BAD31814, NP_190040, AAD38039,
CAD30692, CAN81280, NP_197642, NP_190041, AAL15288, and
NP 190042
Fatty aldehyde decarbonylases suitable for use with the microbes and methods of the invention include, but are not limited to, those listed in Table 8.
Table 8. Fatty aldehyde decarbonylases listed by GenBank accession numbers.
NP_850932, ABN07985, CAN60676, AAC23640, CAA65199, AAC24373,
CAE03390, ABD28319, NP_181306, EAZ31322, CAN63491, EAY94825,
EAY86731, CAL55686, XP_001420263, EAZ23849, NP_200588,
<img file="MX339639B_D0176.tif" />
196
<img file="MX339639B_D0177.tif" />
ΙΜΡΙ
NP_001063227, CAN83072, AAR90847, and AAR97643
Combinations of naturally co-expressed acyl fatty ACP thioesterases and acyl carrier proteins are suitable for use with the microbes and methods of the invention.
Additional examples of lipid or hydrocarbon modifying enzymes include amino acid sequences contained in, referenced in, or encoded by nucleic acid sequences contained or referenced in, any of the following United States patents:
6,610,527; 6,451,576; 6,429,014; 6,342,380; 6,265,639;
6,194,185; 6,114,160; 6,083,731; 6,043,072 ; 5,994,114;
5,891,697; 5,871,988; 6,265,639, and further described in
GenBank with access numbers: AAO18435; ZP_00513891;
Q38710; AAK60613; AAK60610; AAK60611; NP_113747; CAB75874;
AAK60612; AAF20201; BAA11024; AF205791; and CAA03710.
Other enzymes in the lipid biosynthetic pathway are further suitable for use with microbes and methods of the invention. For example, keto acyl-ACP synthase (Kas) enzymes work in conjunction with some of the enzymes listed above in the lipid biosynthetic pathway. There are different classes of Kas enzymes: Kas I participates in
197
IMPI Mexican Institute Oí ia rRontfuo inoustriai
<img file="MX339639B_D0178.tif" />
successive stages of condensation between la9 — eadenaja „, de_ acil
Increasingly increasing ACP and malonyl-ACP. Kas II typically participates in the final condensation stage and carries from C16: 0-ACP to C18: 0-ACP and incorporates malonyl-ACP. As such, in higher plants and some species / strains of microalgae that predominantly synthesize fatty acids
C16-C18: 0 (and its unsaturated derivatives), Kas II enzymes interact with FatA gene products (acyl-ACP thioesterases).
Acyl-ACP thioesterases are terminators of fatty acid biosynthesis in higher plants (and some species of microalgae), - and in most of these plant species, this is carried out by members of the FatA gene family , whose role is to finish the elongation in step C16: 0 to C18: 0. In species that synthesize shorter fatty acid chains (such as Cuphea,
Elaeis, Myristica, or Umbellularia), a different group of acyl-ACP thioesterases encoded by FatB genes carry out this termination step (see, for example, the codon-optimized coding region of Cocos nucifera FatB3-B, seq. Ident .: 189). The interaction between enzymes
Kas II and acyl-ACP thioesterases is important for the correct elongation of the fatty acid chain. Like a
198
IMPI
INSTITUTO MEXICANO Dt LA MOHEDAL INDUSTRIAL consequently, in higher plant species (and microalgae species) that evolved FatB genes capable of shorter chain lipid biosynthesis, there is a corresponding coevolution of an additional class of genes
Kas, called Kas IV genes. The KasIV genes are responsible for the chain length elongation of a specific size range of fatty acids, 4-14 carbons in length.
Other enzymes suitable for use with the microbes and the methods of the invention include those that have at least 70% amino acid identity with one of the proteins, listed in Tables 4, 6-8, and that exhibit the Corresponding desired enzymatic activity (eg cleavage of a fatty acid from an acyl carrier protein, reduction of an acyl-CoA to an aldehyde or alcohol, or conversion of an aldehyde to an alkane). In additional embodiments, the enzyme activity is present in a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about a
99% identity with one of the sequences described above, all of which are incorporated
199
IMPI
INSTITUTO MSXICAITO ΓΈ l A MOREDA Γ) INDUSTRIAL
<img file="MX339639B_D0179.tif" />
by reference herein as fully provided.
By selecting the desired combination of exogenous genes to be expressed, the product generated by the microbe can be adapted, which can be extracted from the aqueous biomass. For example, the microbe may contain: (i) an exogenous gene encoding an acyl fatty-ACP thioesterase; and, optionally, (ii) a co-expressed acyl carrier protein or other acyl carrier protein that has an affinity for acyl fatty-ACP thioesterase (or vice versa), and optionally (iii) an exogenous gene encoding an acyl fatty-CoA / aldehyde reductase or an acyl fatty -CoA reductase and, optionally, (iv) an exogenous gene encoding a fatty aldehyde reductase or a fatty aldehyde decarbonylase. The microbe, under the culture conditions described herein, synthesizes a fatty acid bound to an ACP and the acyl fatty-ACP thioesterase catalyzes the cleavage of the fatty acid from the ACP to produce, by further enzymatic processing, a molecule of acyl-CoA. When present, acyl fatty CoA / aldehyde reductase catalyzes the reduction of acyl CoA to an alcohol. Similarly, acyl fatty CoA reductase, when present, catalyzes the reduction of acyl CoA to an aldehyde. In those modalities in which a
<img file="MX339639B_D0180.tif" />
200
<img file="MX339639B_D0181.tif" />
IMPI '<sup>T</sup>f5Éw '<sub>P</sub>'ííí' '<sup>SPOUT</sup> • Exogenous nwistrial gene encoding an acyl fatty-PnA reductase is present and is expressed to yield an aldehyde product, a fatty aldehyde reductase, encoded by the third exogenous gene, catalyzes the reduction of the aldehyde to an alcohol. Similarly, a fatty aldehyde decarbonylase catalyzes the conversion of the aldehyde to an alkane or alkene, when present.
In another embodiment, the microbe may contain: (i) an exogenous gene encoding an acyl fatty-ACP thioesterase; (ii) optionally, a naturally co-expressed acyl transporter protein or an acyl transporter protein that has an affinity for acyl fatty acid-ACP thioesterase; (iii) a mutated endogenous desaturase gene, wherein the mutation renders the desaturase gene or protein desaturase inactive, such as a desaturase knockout;
(iv) overexpression of an endogenous stearoyl acyl desaturase transporter protein or expression of a heterologous SAD; and (v) any combination of the above.
Genes encoding such enzymes, such as acyl fatty ACP thioesterases, can be obtained from cells that are already known to exhibit significant lipid production, such as Chlorella protothecoides. Genes already known have a role in lipid production, by
201
IMPI
INSTITUTO MEXICANC Dt LA PXOHEDAP
INDUSTRIAL
<img file="MX339639B_D0182.tif" />
For example, a gene encoding an enzyme that saturates double bonds can be transformed individually in recipient cells. However, in the practice of the invention it is not necessary to make a priori assumptions as to which genes are necessary. Methods for identifying genes that can alter (enhance) lipid production in microalgae are described in PCT publication no. 2008/151149.
Therefore, the present invention provides a microorganism (eg, a Prototheca cell) that was genetically engineered to express a lipid pathway enzyme at an altered level compared to a wild cell of the same species. In some cases, the cell produces more lipids compared to the wild type cell when both cells are cultured under the same conditions. In some cases, the cell is genetically modified and / or selected to express a lipid pathway enzyme at a higher level than that of wild-type cells. In some cases, the lipid pathway enzyme is selected from the group consisting of pyruvate dehydrogenase, acetyl-CoA carboxylase, acyl carrier protein, and glycerol-3 phosphate acyltransferase. In some cases, the cell is genetically modified and / or
202
ΙΜΡΙ
MEXICAN INSTITUTE OE LA RROI'IEUaD
INDUSTRIAL
<img file="MX339639B_D0183.tif" />
selects to express a lipid pathway enzyme at a lower level than the wild-type cell. In at least one embodiment in which the cell expresses the lipid pathway enzyme at a lower level, the lipid pathway enzyme comprises citrate synthase.
In some embodiments, the cell is genetically engineered and / or selected to express a global regulator of fatty acid synthesis at an altered level compared to the wild-type cell, thereby expressing levels of a plurality of genes Synthetic fatty acids are altered compared to wild-type cell. In some cases, the lipid pathway enzyme comprises an enzyme that modifies a fatty acid. In some cases, the lipid pathway enzyme is selected from a stearoyl-ACPdesaturase and a glycerolipid desaturase. In some cases, the cell is genetically modified and / or selected to express a lower level of an enzyme in a lipid pathway, or to not express a specific enzyme in a lipid pathway at all (i.e., where a lipid pathway enzyme is knockout, or is replaced with an exogenous gene).
Some microalgae produce significant amounts of non-lipid metabolites, such as, for example,
<img file="MX339639B_D0184.tif" />
polysaccharides. Because polysaccharide biosynthesis can use a significant proportion of the total metabolic energy available to cells, mutagenesis of lipid-producing cells followed by detection of reduced or eliminated polysaccharide production generates new strains that are capable of producing high lipid yields.
In other embodiments, the present invention is directed to an oil-producing microbe containing one or more exogenous genes, where the exogenous genes encode the protein (s) selected from the group consisting of an acyl fatty ACP thioesterase, a fatty acyl-CoA reductase, a fatty aldehyde reductase, an fatty acyl-CoA / aldehyde reductase, a fatty aldehyde decarbonylase, a desaturase, and an acyl carrier protein. In another embodiment, an endogenous desaturase gene is overexpressed in a mic containing one or more of the above exogenous genes. In one embodiment, the exogenous gene is in operative link with a promoter, which is inducible or repressible in response to a stimulus. In some cases, the stimulus is selected from the group consisting of a small molecule that is supplied exogenously, heat, cold, and limited nitrogen in the culture medium. In some cases, the exogenous gene is
204
IMPI
INSTITUTO MEXICAN »t» LA «OFIÍOAD INtUSTRIAL
<img file="MX339639B_D0185.tif" />
expressed in a cellular compartment. In some embodiments, the cell compartment is selected from the group consisting of a chloroplast, a plastid, and a mitochondria. In some modalities the microbe is Prototheca moriformis, Prototheca krugani, Prototheca stagnora or Prototheca zopfii.
In one embodiment, the exogenous gene encodes a fatty acyl-ACP thioesterase. In some cases, the thioesterase that is encoded by the exogenous gene catalyzes the cleavage of an 8 to 18 carbon fatty acid from an acyl carrier protein (ACP). In some cases, thioesterase that is encoded by the exogenous gene catalyzes the cleavage of a 10 to 14 carbon fatty acid from an ACP. In one embodiment, the thioesterase that is encoded by the exogenous gene catalyzes the cleavage of a 12-carbon fatty acid from a
ACP.
In one embodiment, the exogenous gene encodes an acyl fatty CoA / aldehyde reductase. In some cases, reductase encoded by the exogenous gene catalyzes the reduction of an 8 to 18 carbon acyl fatty CoA to the corresponding primary alcohol. In some cases, reductase encoded by the exogenous gene catalyzes the reduction of a 10-14 carbon acyl fatty CoA to the corresponding primary alcohol. In one embodiment, reductase encoded by the exogenous gene
205
ΙΜΡΙ
MEXICAN INSTITUTE OF LA FROFIEDAL ·
INDUSTRIAL
<img file="MX339639B_D0186.tif" />
It catalyzes the reduction of a 12-carbon fatty acyl-CoA to dodecanol.
The present invention also provides a cell for
Recombinant prototheca containing two exogenous genes, wherein a first exogenous gene encodes an acyl-ACP thioesterase and a second exogenous gene encodes a protein that is selected from the group consisting of an acyl-CoA reductase, an acyl fatty-CoA / aldehyde reductase , and an acyl carrier protein. In some cases, the two exogenous genes are each in an operable link with a promoter, which is induced in response to a stimulus. In some cases, each promoter is inducible in response to an identical stimulus, such as limited or no nitrogen in the culture medium. The limitation or total absence of nitrogen in the culture medium stimulates oil production in some microorganisms, such as the Prototheca species, and can be used as a trigger to induce oil production at high levels. When used in combination with the genetic engineering methods described herein, lipid as a percentage of the dry weight of cells can be brought to high levels such as at least 30%, at least 40%, at least 50%, at least 60%, at least 70% and at least 75%; the methods described herein provide cells with
<img file="MX339639B_D0187.tif" />
206 those lipid levels where the lipid is at least 1% -
<td colspan="4">5%, preferably at least 4%,</td><td>C8-C14,</td><td>to the</td><td>minus 0.</td><td>.25% -l%,</td>
<td>preferably</td><td>to the</td><td>less</td><td> 0.3%</td><td>, C8,</td><td>to the</td><td>less</td><td>l% -5%,</td>
<td>preferably</td><td>to the</td><td>less</td><td> 2%,</td><td>CIO,</td><td>to the</td><td>less</td><td>l% -5%,</td>
<td>preferably</td><td>to the</td><td>less</td><td> 2%,</td><td>C12, and</td><td>to the</td><td>less</td><td>l% -5%,</td>
<td>preferably</td><td colspan="2">at least 2%,</td><td>C14.</td><td colspan="2">In some</td><td colspan="2">modalities the</td>
cells are above 10%, above 15%, above 20%, or above 25% lipid per dry cell weight and contains lipid that is at least 5%, at least
10% or at least 15% C8-C14, at least 10%, at least 15%, at least 20%, at least 25% or at least 30% C8-C14, at least 20%, at least 25%, at minus 30%, at least 35% or at least 40%, C8C14, 5% -40%, preferably 10-30%, C8-C14 and 10% -40%, preferably 20-30%, C8-C14.
The novel oils described herein are distinct from other naturally occurring oils high in medium chain fatty acids, such as palm oil, palm kernel oil, and coconut oil. For example, levels of contaminants such as carotenoids are much higher in palm oil and palm kernel oil than in the oils of the invention. Palm and palm kernel oils, in particular, contain alpha and beta carotenes and lycopene in
207
IMPI
MUUCAWO INSTITUTE OF THE INDUSTRIAL MWWFQAÜ
<img file="MX339639B_D0188.tif" />
much higher amounts than there are in the oils of the invention. In addition, more than 20 different carotenoids are found in palm kernel oil, while the Examples demonstrate that the oils of the invention contain very few carotenoid species and very low levels. Additionally, the levels of vitamin E compounds such as tocotrienols are much higher in palm, palm kernel and coconut oils than in the oils of the invention.
In one embodiment, the thioesterase encoded by the first exogenous gene catalyzes the cleavage of an 18-carbon fatty acid from an ACP. In some embodiments, the exogenous second gene encodes an acyl fatty CoA / aldehyde reductase that catalyzes the reduction of an 8 to 18 carbon acyl fatty CoA to a corresponding primary alcohol. In some cases, thioesterase encoded by the first exogenous gene catalyzes the cleavage of a 10-14 carbon fatty acid from an ACP, and reductase encoded by the second exogenous gene catalyzes the reduction of an acyl-fatty CoA from 10-14 carbon to the corresponding primary alcohol, where thioesterase and reductase act on the same carbon chain length. In one embodiment, thioesterase encoded by the first exogenous gene catalyzes the cleavage of
<img file="MX339639B_D0189.tif" />
208
ΙΜΡΙ a 12-carbon fatty acid from an ACP, and reductase encoded by the second exogenous gene catalyzes the reduction of a 12-carbon fatty acyl-CoA to dodecanol. In some embodiments, the exogenous second gene encodes an acyl fatty CoA reductase5 that catalyzes the reduction of an 8 to 18 carbon acyl fatty CoA to a corresponding aldehyde. In some embodiments, the second exogenous gene encodes an acyl transporter protein that is naturally co-expressed with acyl fatty-ACP thioesterase.
In some embodiments, the second exogenous gene encodes an acyl-CoA reductase, and the microbe also contains a third exogenous gene encoding a fatty aldehyde decarbonylase. In some cases, thioesterase encoded by the first exogenous gene catalyzes the cleavage of an 8 to 18 carbon fatty acid from an ACP, reductase encoded by the exogenous second gene catalyzes the reduction of an acyl fatty acid-CoA from 8 to 18 carbons to a corresponding fatty aldehyde, and the decarbonylase encoded by the third exogenous gene catalyzes the conversion of an 8 to 8-carbon fatty aldehyde to a corresponding alkane, where thioesterase, reductase, and decarbonylase act on the same carbon chain length.
<img file="MX339639B_D0190.tif" />
209
In some embodiments, the second exogenous gene encodes
IMPÍ. ' an acyl carrier protein, and the microbe further contains an exogenous third gene encoding a protein selected from the group consisting of an acyl-CoA reductase and an acyl fatty-CoA / aldehyde reductase. In some cases, the exogenous third gene encodes an acyl fatty CoA reductase, and the microbe also contains an additional fourth exogenous gene encoding a fatty aldehyde decarbonylase.
The present invention also provides methods for producing an alcohol comprising culturing a population of recombinant microorganisms (eg, cells of
Prototheca) in a culture medium, where the cells contain (i) a first exogenous gene that encodes an acyl fatty-ACP thioesterase, and (ii) a second exogenous gene that encodes an acyl fatty-CoA / aldehyde reductase, and cells synthesize a fatty acid linked to an acyl carrier protein (ACP), acyl fatty-ACP thioesterase catalyzes the cleavage of fatty acid from ACP to produce, through subsequent transformation, an acyl fatty-CoA, and fatty acyl-CoA / aldehyde reductase catalyzes the reduction of acyl-CoA to an alcohol.
The present invention further provides methods for producing a lipid molecule in a microorganism (for
210
IMPI
MIX1CANO INSTITUTE Dt THE PROPERTY
INDUSTRIAL
<img file="MX339639B_D0191.tif" />
example, a Prototheca cell). In one embodiment, the method comprises culturing a population of Prototheca cells in a culture medium, wherein the cells contain (i) a first exogenous gene encoding an acyl-ACP thioesterase, and (ii) a second exogenous gene encoding an acyl. fatty-CoA reductase, and where microbes synthesize a fatty acid linked to an acyl carrier protein (ACP), acylACP thioesterase catalyzes the cleavage of fatty acid from the
ACP to produce, through subsequent transformation, fatty acyl-CoA reductase, and fatty acyl-CoA reductase catalyzes the reduction of acyl-CoA to an aldehyde.
The present invention also provides methods for producing a fatty acid molecule having a specified carbon chain length in a microorganism (eg, a Prototheca cell). In one embodiment, the method comprises culturing a lipid-producing population of Prototheca cells in a culture medium, where the microbes contain an exogenous gene encoding an acyl fatty ACP thioesterase, which has a specific or preferential activity for a certain length of carbon chain, such as 8, 10, 12, or 14 carbon atoms, and where the microbes synthesize a fatty acid bound to an acyl carrier protein (ACP) and thioesterase catalyzes the
IM
211
<img file="MX339639B_D0192.tif" />
MEXICAN PROPERTY INSTITUTE fatty acid cleavage from ACP when the fatty acid was synthesized to the specific length of the carbon chain.
In the various modalities described above, the microorganism (eg, a Prototheca cell) can contain at least one exogenous gene encoding a lipid pathway enzyme. In some cases, the lipid pathway enzyme is selected from the group consisting of a stearoyl ACP desaturase, a glycerolipid desaturase, a pyruvate dehydrogenase, an acetyl-CoA carboxylase, an acyl carrier protein, and a glycerol-3 phosphate acyltransferase. In other cases, the, the microorganism (eg Prototheca cell) contains a lipid modifying enzyme selected from the group consisting of an acyl fatty ACP thioesterase, an acyl fatty CoA / aldehyde reductase, an acyl fatty CoA reductase , a fatty aldehyde reductase, a fatty aldehyde decarbonylase, and / or an acyl carrier protein.
A number of illustrative cassettes or transformation constructs that are used to express a variety of lipid pathway enzymes and lipid modifying enzymes that are discussed in the present disclosure are presented in the Examples. Other useful constructs, without limitation, are listed in Table 37, below.
212
<img file="MX339639B_D0193.tif" />
Table 37. Illustrative transformation constructs, codon-optimized coding regions, and enzymes.
<td>Transformation construct / Region</td><td>sec.</td>
<td>coding / enzyme</td><td>with no. of ident.</td>
<td>C10: 0 specific C thioesterase construct. hookerian</td><td> 243</td>
<td>coding region for C. hookeriana C10: 0 specific thioesterase (codon optimized)</td><td> 244</td>
<td>C. hookeriana KAS IV enzyme construct</td><td> 245</td>
<td>coding region for C. hookeriana the enzyme KAS IV (codon optimized)</td><td> 246</td>
<td>C. hookeriana KAS IV enzyme</td><td> 247</td>
<td>C. hookeriana C10: 0 specific thioesterase plus C. hookeriana KAS IV enzyme construct</td><td> 248</td>
<td>coding region for C. lanceolata CIO: 0 specific thioesterase with acid desaturase fatty UTEX 1435 Ü12</td><td> 249</td>
<td>U-specific C12: 0 thioesterase construct.</td><td> 250</td>
<img file="MX339639B_D0194.tif" />
213
IMPI
INSTITUTO MSXICANO OE LA PROPIEDAD INDUSTRIAL
<td>ra 1 7 fnrn i ca</td><td></td>
<td>coding region for U. californios C12: 0</td><td> 251</td>
<td>specific thioesterase (codon optimized)</td><td></td>
<td>G. mangostana C16: 0 thioesterase construct</td><td> 252</td>
<td>coding region for G. mangostana C16: 0</td><td> 253</td>
<td>thioesterase (codon optimized)</td><td></td>
<td>B. napus C18: 0 thioesterase construct</td><td> 254</td>
<td>coding region for B. napus C18: 0 thioesterase</td><td> 255</td>
<td>(optimized by codon)</td><td></td>
<td>Stearoyl-ACP desaturase construct of 0.</td><td> 256</td>
<td>europaea</td><td></td>
<td>coding region for 0. europaea estearoil-ACP</td><td> 257</td>
<td>desaturase (codon optimized)</td><td></td>
<td>C. hookeriana thioesterase construct C16: 0</td><td> 258</td>
<td>coding region for C. hookeriana C16: 0</td><td> 259</td>
<td>thioesterase (codon optimized)</td><td></td>
<td>E. guineensis C16: 0 thioesterase construct</td><td> 260</td>
<td>coding region for E. guineensis C16: 0</td><td> 261</td>
<td>thioesterase (codon optimized)</td><td></td>
214
<img file="MX339639B_D0195.tif" />
<td>C. tinctorius ACP-thioesterase in the construct of the Ü12 fatty acid desaturase locus</td><td> 262</td>
<td>coding region for C. tinctorius ACP- thioesterase (codon optimized)</td><td> 263</td>
<td>broad specificity thioesterase construct C14: 0-C18: 0 of M. fragrans</td><td> 264</td>
<td>coding region for M. fragrans C14: 0-C18: 0 broad specificity thioesterase (optimized by codon)</td><td> 265</td>
<td>coding region for specific thioesterase C: 14: 0 from M. fragrans</td><td> 266</td>
<td>Specific thioesterase C14: 0 of M. fragrans with the transit peptideDl2 FAD</td><td> 267</td>
<td>Ricinus communis ACP-thioesterase construct</td><td> 268</td>
<td>coding region for Ricinus ACP-thioesterase communis (codon optimized)</td><td> 269</td>
<td>C. camphora thioesterase construct C14: 0</td><td> 270</td>
<td>coding region for thioesterase C14: 0 C. camphora (codon optimized)</td><td> 271</td>
<td>C14: 0 specific C thioesterase construct.</td><td> 272</td>
<img file="MX339639B_D0196.tif" />
215
IMPI
INSTITUTO MEXICANO OE LA RRORIEOAO INDUSTRIAL
<td rowspan="2"></td><td></td>
<td></td>
<td>C14: 0 specific C thioesterase construct. camphora</td><td> 273</td>
<td>specific thioesterase C10: 0-C16: 0 of U. Americana at a SAD locus</td><td> 274</td>
<td>coding region for specific thioesterase CIO: 0-C16: 0 of U. Americana (codon optimized)</td><td> 275</td>
<td>C. wrightii KASA1 + C. wrightii FatB2 thioesterase + suc2 construct</td><td> 276</td>
<td>coding region for C. wrightii KASA1 (optimized by codon)</td><td> 277</td>
<td>coding region for FatB2 thioesterase from C. wrightii (codon optimized)</td><td> 278</td>
SAW. FUELS AND CHEMICAL PRODUCTION PRODUCTION
For the production of fuel according to the methods of the invention, the lipids produced by the cells of the invention are collected, or are collected in another way, by any convenient means. Lipids can be isolated by extraction of whole cells. First the cells are broken, and then the intracellular and associated lipids
216
<img file="MX339639B_D0197.tif" />
ΙΜΡΙ
INSTITUTO MEXICANO DE IA RRORPPAD INDUSTRIAL cell membrane / wall as well as extracellular hydrocarbons can be separated from the cell mass, such as by using centrifugation as described above. Intracellular lipids produced in microorganisms, in some modalities, are removed after lysing the cell of the microorganism. Once extracted, the lipids are further refined to produce oils, fuels, or oleochemicals.
After the completion of the culture, the 10 microorganisms can be separated from the fermentation broth. Optionally, the separation is carried out by centrifugation to generate a concentrated paste. Centrifugation does not remove significant amounts of intracellular water from the microorganisms and is not a drying step. The biomass can optionally be washed with a washing solution (eg DI water) to get rid of the fermentation broth and cell debris.
Optionally, the washed microbial biomass can also be dried (oven dried, lyophilized, etc.) prior to cell disruption. Furthermore, cells can be lysed without separation of part or all of the fermentation broth, when the fermentation is complete. For example, cells may be in a ratio of less than 1: 1, v: v of
<img file="MX339639B_D0198.tif" />
217
ΙΜΡΙ cells with respect to the pvtrarplnlar liquid they are lysed.
The lipid-containing microorganisms can be lysed to produce a lysate. As detailed herein, the step of lysing a microorganism (also known as cell lysis) can be accomplished by any convenient means, including heat-induced lysis, addition of a base, addition of an acid, use of enzymes such as proteases. and polysaccharide degradation enzymes such as amylases, using ultrasound, mechanical lysis, using osmotic shock, infection with a lytic virus, and / or expression of one or more Utic genes. Lysis is done to release intracellular molecules that have been produced by the microorganism. Each of these methods for lysis of a microorganism can be used as a single method or in simultaneous or sequential combination. The magnitude of cell disruption can be observed by microscopic analysis.
Using one or more of the methods described herein, more than 70% cell disruption is typically observed.
Preferably the cell breakdown is more than 80%, more preferably it is more than 90% and more preferably a
100%.
<img file="MX339639B_D0199.tif" />
In particular modalities, the microorganism is lysed
218
IMPI after growth, for example to increase cell lipid and / or hydrocarbon exposure to extraction or further processing. The timing of lipase expression (eg, via an inducible promoter) or celqlar lysis can be adjusted to optimize lipid and / or hydrocarbon performance. A series of lysis techniques are described below.
These techniques can be used individually or in combination.
In an embodiment of the present invention, the lysis step of a microorganism comprises heating a cell suspension containing the microorganism. In this embodiment, the fermentation broth containing the microorganisms (or a suspension of microorganisms isolated from the fermentation broth) is heated until the microorganisms, i.e. the cell walls and membranes of the microorganisms are degraded or ruptured . Typically, the applied temperatures are at least 50 ° C.
Higher temperatures, such as at least 30 ° C at least
60 ° C, at least 70 ° C, at least 80 ° C, at least 90 ° C, at least
100 ° C, at least 110 ° C, at least 120 ° C, at least 130 ° C or higher are used for more efficient cell lysis. The
219
IMPI
MEXICAN INSTITUTE PE LA INDUSTRIAL HOFFICITY
<img file="MX339639B_D0200.tif" />
Cell lysing by heat treatment can be performed by boiling the microorganism. Alternatively, heat treatment (without boiling) can be done in an autoclave. The thermally treated lysate can be cooled for further treatment. Cell disruption can also be accomplished by steam treatment, that is, by adding steam under pressure. Vapor treatment of microalgae for cell disruption is described, for example, in US Patent No. 6,750,048. In some embodiments, steam treatment can be accomplished by spraying steam into the fermenter and maintaining the broth at a desired temperature for less than about 90 minutes, preferably less than about 60 minutes, and more preferably less than about 30 minutes. .
In another embodiment of the present invention, the lysis step of a microorganism comprises adding a base to a cell suspension containing the microorganism. The base must be strong enough to hydrolyze at least a portion of the protein compounds of the used microorganisms. Bases that are useful for solubilizing proteins are known in the art of chemistry. The exemplary bases that are useful in the methods
220
IMPI
MEXICAN INSTITUTE · OF THE FR IfltOAP INDUSTRIAI
<img file="MX339639B_D0201.tif" />
of the present invention include, but - *<sup>ίη</sup> i-im-it-arge <sub>to</sub> hydroxides, carbonates and bicarbonates of lithium, sodium, potassium, calcium and mixtures thereof. A preferred base is KOH. Microalgae-based treatment for cell disruption is described, for example, in US Patent No. 6,750,048.
In another embodiment of the present invention, the lysis step of a microorganism comprises adding an acid to a cell suspension containing the microorganism. Acid lysis can be carried out using an acid at a concentration of 10 to 500 mN or preferably 40 to 160 nM. Acid lysis is preferably carried out above room temperature (for example, 40-160 °, and preferably at a temperature of 50-130 °. For moderate temperatures (eg, room temperature at 100 ° C and particularly room temperature at 65 °), acid treatment can be usefully combined with sonication or other cell disruption methods.
In another embodiment of the present invention, the lysis step of a microorganism comprises the lysis of the microorganism by using an enzyme. Preferred enzymes for lysis of a microorganism are proteases and polysaccharide degrading enzymes such
221
IMPí '•' ^ JTOMEXICANü ro <sup>the</sup>«OífeOAD INDUSTRIAL
<img file="MX339639B_D0202.tif" />
such as hemicellulase (for example, hemicellulase from
Aspergillus niger; Sigma Aldrich, St. Louis, MO; # H2125), pectinase (eg, Rhizopus sp. Pectinase; Sigma
Aldrich, St. Louis, MO; # P2401), Mannaway 4.0 L (Novozymes), cellulase (for example, Trichoderma viride cellulose; Sigma
Aldrich, St. Louis, MO; # C9422), and driselase (for example, driselase from Basidiomycetes sp.; Sigma Aldrich, St. Louis,
MO; # D9515.
In other embodiments of the invention, lysis is carried out using an enzyme, such as, for example, a cellulase such as a polysaccharide degradation enzyme, optionally derived from Chlorella or a virus of
Chlorella, or a protease, such as the protease of
Streptomyces griseus, chymotrypsin, proteinase K, the proteases listed in Degradation of Polylactide by
Commercial Proteases, Oda Y. et al., Journal of Polymers and the Environment, Volume 8, Number 1, January 2000, pp. 2932 (4), Alcalase 2.4 FG (Novozymes), and Flavourzyme 100 L (Novozymes). Any combination of a protease and a polysaccharide degrading enzyme can also be used, including any combination of the above proteases and polysaccharide degrading enzymes.
222
ΙΜΡΙ
MEXICO INSTITUTE OF IA MONEDAD
INDUSTRIAL
<img file="MX339639B_D0203.tif" />
In another embodiment, lysis can be performed using an ejector press. In this process, the biomass is forced through a high-pressure screw-type device, using the cells and causing the intracellular lipids to be released and separate from the protein and fiber (and the other components) in the cell.
In another embodiment of the present invention, the lysis step of a microorganism is performed by ultrasound, that is, sonication. In this way, the cells can also be used with high frequency sound. Sound can be produced electronically and is transported through a metal tip to an appropriately concentrated cell suspension. This sonication (or ultrasound) alters cellular integrity based on the formation of cavities in the cell suspension.
In another embodiment of the present invention, the lysis step of a microorganism is carried out by mechanical lysis. Cells can be mechanically lysed and optionally homogenized to facilitate collection of hydrocarbons (eg, lipids). For example, a pressure disruptor can be used to pump a mixture containing cells through a restricted orifice valve. High pressure is applied (up to 1500
<img file="MX339639B_D0204.tif" />
223 bar), followed by instantaneous expansion through the outlet nozzle. Cell rupture is carried out by three different mechanisms: impact on the valve, high shear of the liquid in the orifice, and the sudden drop in pressure after discharge, causing an explosion of the cell. The method releases the intracellular molecules.
Alternatively a ball mill can be used. In a ball mill, cells are shaken in suspension with small abrasive particles, such as granules. The cells rupture due to shear forces, grinding between the granules, and collisions with the granules. The granules break down the cells to release the cellular contents. Cells can also be broken by shear forces, such as with the use of mixing (such as with a high-speed blender or Waring as examples), French press, or even centrifugation in the case of weak cell walls, to break the cells.
In another embodiment of the present invention, the lysis step of a microorganism is performed by applying an osmotic shock.
In another embodiment of the present invention, the step of lysis of a microorganism comprises infection of the microorganism with a lytic virus. A wide variety of
224
IMPI
MEXICAN INSTITUTE Ot LA PROPICOAD
INDUSTRIAL
<img file="MX339639B_D0205.tif" />
Viruses are known to lyse microorganisms suitable for use in the present invention, and the selection and use of a particular lytic virus for a particular microorganism is within the level of skill in the art. For example, the virus paramecium bursaria chlorella (PBCV-l) is the prototype of a group (family
Phycodnaviridae, genus Chlorovirus) of large, icosahedral, plaque-forming, double-stranded DNA viruses that replicate in and lyse certain green, single-celled, eukaryotic chlorella-like algae. Consequently, any sensitive microalgae can be lysed by infecting the culture with a suitable chlorella virus. Methods of infecting Chlorella species with a chlorella virus are known. See, for example, Adv. Virus Res.
2006; 66: 293-336; Virology, 1999 Apr 25; 257 (1): 15-23, Virology, 2004 Jan 5; 318 (1): 214-23; Nucleic Acids Symp.
Ser. 2000; (44): 161-2; J. Virol. 2006 Mar; 80 (5): 2437-44; and
Annu. Rev. Microbiol. 1999; 53: 447-94.
In another embodiment of the present invention, the lysis step of a microorganism comprises autolysis. In this embodiment, a microorganism of the invention is genetically engineered to produce a lytic protein that lyses the microorganism. This lytic gene can be expressed with
<img file="MX339639B_D0206.tif" />
225 IMPI
INSTITUTO MEXICANO M LA PROPIEDAD INDUSTRIAL an inducible promoter, whereby cells can first be grown to a desirable density in a terminator, followed by induction of the promoter to express the lytic gene to lyse the cells. In one embodiment, the lytic gene encodes a polysaccharide degradant. In certain other embodiments, the lytic gene is a gene from a lytic virus. For example, a lytic gene from a Chlorella virus can be expressed in an algae cell; see virology 260, 308-315 (1999); FEMS Microbiology Letters 180 (1999) 45-53; Virology 263, 376-387 (1999); and Virology 230,
361-368 (1997). Expression of the lytic genes is preferably performed using an inducible promoter, such as an active promoter in microalgae that is induced by a stimulus, such as the presence of a small molecule, light, heat, and other stimuli.
There are several methods to separate the lipids from the cellular uses produced by the previous methods. For example, lipids and lipid derivatives, such as fatty aldehydes, fatty alcohols, and hydrocarbons, such as alenes, can be extracted with a hydrophobic solvent such as hexane (see Frenz et al.,
1989, Enzyme Microb. Technol., 11: 717). Lipid and lipid derivatives can also be extracted using<sub>226</sub> IMPI »Mexican Institute ot the MuHetiAP industrial liquefaction (see, for example, Sawavama and others, 1999,
Biomass and Bioenergy 17: 33-39 and Inoe et al., 1993, Biomass
Bioenergy 6 (4): 269-274); liquefaction of oil (see, for example, Minowa et al., 1995, Fuel 74 (12): 1735-1738); and extraction of C0<sub>2</sub> supercritical (see, for example, Mendes et al., 2003, Inorganánica Chimica Acta 356: 328-334). Miao and Wu describe a protocol for the recovery of lipids from microalgae from a culture of Chlorella prototheocoides, in which the cells were collected by centrifugation, washed with distilled water and dried by lyophilization. The resulting cell powder was pulverized in a mortar and then extracted with n-hexane (Miao and Wu, Biosource Technology (2006) 97: 841-846).
In this way, the lipids, lipid derivatives and hydrocarbons generated by the microorganisms of the present invention can be recovered by extraction with an organic solvent. In some cases, the preferred organic solvent is hexane. Typically, the organic solvent is added directly to the lysate without prior separation of the lysate components. In one embodiment the lysate generated by one or more of the methods described above is contacted with an organic solvent for a period of time sufficient to allow the
227
IMPI
MEXICAN INSTITUTE □ and industrial property
<img file="MX339639B_D0207.tif" />
lipids and / or hydrocarbon components form a solution with the organic solvent. In some cases, the solution may be further refined to recover the desired lipids or specific hydrocarbon components. Hexane extraction methods are well known in the art.
Lipids and lipid derivatives, such as fatty aldehydes, fatty alcohols, and hydrocarbons, such as alkanes produced by cells, as described herein, can be modified through the use of one or more enzymes, including a lipase, as described above. When hydrocarbons are in the extracellular environment of cells, one or more enzymes can be added to that environment under conditions in which the enzyme modifies the hydrocarbon or completes its synthesis from a hydrocarbon precursor. Alternatively, the hydrocarbons can be partially or completely isolated from the cellular material prior to the addition of one or more catalysts such as enzymes. These catalysts aggregate exogenously, and their activity occurs outside the cell or in vitro.
In this way, lipids and hydrocarbons produced by cells in vivo or modified
<img file="MX339639B_D0208.tif" />
228
IMPI
INSTITUTO MEXICANO Ot LA RRORIÍOA INDUSTRIAL enzymatically in vitro, as described herein, can optionally be processed by conventional means. Processing may include cracking (molecular decomposition) to reduce size, and therefore increase the hydrogen: carbon ratio of hydrocarbon molecules. Catalytic and thermal cracking methods are routinely used in the processing of hydrocarbons and triglyceride oils. Catalytic methods involve the use of a catalyst, such as a solid acid catalyst. The catalyst may be silica-alumina or a zeolite, which result in the heterolytic or asymmetric cleavage of a carbon-carbon bond to result in a carbocation and a hydride anion. These reactive intermediates then undergo either a rearrangement or transfer of the hydride with another hydrocarbon. The reactions, therefore, can regenerate the intermediaries to give rise to a self-multiplying chain mechanism. Hydrocarbons can also be processed to reduce, optionally to zero, the number of carbon-carbon double or triple bonds thereof. Hydrocarbons can also be processed to remove or remove a ring or ring structure in them. Hydrocarbons can also be processed to increase the
229
<img file="MX339639B_D0209.tif" />
ΙΜΡΙ
INSTITUTO MEXICANO DI LA WOWIDAf »hydrogen: carbon ratio. This can<sup>, N</sup>° include the addition of hydrogen (hydrogenation) and / or ¿1 cracking of hydrocarbons in other smaller hydrocarbons.
Thermal methods involve the use of elevated temperature and pressure to reduce the size of the oil. An elevated temperature of approximately
800 ° C and a pressure of approximately 700kPa. These conditions generate light, a term sometimes used to refer to hydrogen-rich hydrocarbon molecules (as opposed to photon flux), while also generating, by condensation, heavier hydrocarbon molecules which are relatively devoid of hydrogen. The methodology provides homolytic or symmetric cleavage, and produces alkenes that can be optionally enzymatically saturated, as described above.
Catalytic and thermal methods are standard in hydrocarbon processing and oil refining plants. In this way, the hydrocarbons that are produced by the cells, as described herein, can be collected and processed or refined by conventional means. See Hillen et al., (Biotechnology and
Bioengineering, Vol. XXIV: 193-205 (1982)) for a report on hydrocracking of hydrocarbons produced by
230
ΙΜΡΙ
MEXICAN INSTITUTE »
OE THE PROPERTY jggl
INDUSTRIAL BT-jl · »microalgae. In alternative embodiments, the fraction is treated with another catalyst, such as an organic compound, heat, and / or an inorganic compound. For the processing of lipids in biodiesel, a transesterification process is used as described later in this
Section.
The hydrocarbons produced through the methods of the present invention are useful in a variety of industrial applications. For example, the production of linear alkylbenzene sulfonate (LAS), an anionic surfactant used in almost all types of detergents and cleaning products, uses hydrocarbons that generally comprise a chain of 10-14 carbon atoms. See, for example, US Patent Nos .: 6,946,430; 5,506,201; 6,692,730; 6,268,517; 6,020,509;
6,140,302; 5,080,848; and 5,567,359. Surfactants such as LAS can be used in the manufacture of personal care compositions and detergents such as those described in US Patent Nos .:
5,942,479; 6,086,903; 5,833,999; 6,468,955; and 6,407,044.
Increasing interest is directed to the use of components of biologically derived hydrocarbons in fuels, such as biodiesel, renewable diesel and
231
IMPI
INSTITUTO MkXICANO DELA rROFIF.DAI
INDUSTRIAL
<img file="MX339639B_D0210.tif" />
reactor fuel, since renewable biological raw materials can replace the raw materials derived from fossil fuels that are available, and their use is therefore desirable. There is an urgent need for methods for the production of hydrocarbon components from biological materials. The present invention satisfies this need by providing methods for the production of biodiesel, renewable diesel, and reactor fuel using the lipids generated by the methods described herein as a biological material for producing biodiesel, renewable diesel, and reactor fuel.
[0014] Traditional diesel fuels are petroleum distillates rich in paraffin hydrocarbons.
They have boiling ranges as wide as
370 ° to 780 ° F, both of which are suitable for combustion in a compression starter, such as a diesel-powered vehicle. The American Society of Testing and Materials (ASTM) sets the grade of diesel according to the boiling range, along with the allowable ranges for other fuel properties, such as cetane number, cloud point, flash point, viscosity, aniline point, sulfur content, water content,
232
ΙΜΡΙ
MEXICAN INSTITUTE OF EA INDUSTRIAL PROPERTY
<img file="MX339639B_D0211.tif" />
ash content, corrosion of the copper strip, and carbon residues. Technically, any distilled material from biomass-derived or other hydrocarbons that meets the appropriate ASTM specification can be defined as diesel fuel (ASTM D975), reactor fuel (ASTM D1655), or as biodiesel or if it is a Fatty Acid Methyl Ester (ASTM D6751).
After extraction, the lipids and / or hydrocarbon components recovered from the microbial biomass described herein can be subjected to chemical treatment to make a fuel for use in diesel vehicles and jet engines.
[0015] Biodiesel is a liquid that varies in color between gold and dark brown - depending on the raw material used in production. It is practically immiscible in water, has a high boiling point and low vapor pressure. Biodiesel refers to a processed fuel equivalent to diesel for use in vehicles with a diesel engine. Biodiesel is biodegradable and non-toxic. An added benefit of biodiesel over conventional diesel fuels is less engine wear. Typically, biodiesel comprises C14-C18 alkyl esters. Various processes convert biomass or lipid
<img file="MX339639B_D0212.tif" />
233 produced and isolated as described herein, in diesel fuels. A preferred method of producing biodiesel is transesterification of a lipid as described herein. A preferred alkyl ester for use as biodiesel is a methyl ester or ethyl ester.
[0016] Biodiesel produced by a method described herein can be used alone or mixed with conventional diesel fuel at any concentration in most modern diesel engine vehicles. When mixed with conventional diesel fuel (petroleum diesel), biodiesel can be present from about 0.1% to about 99.9%. Much of the world uses a system known as the B factor to establish the amount of biodiesel in any fuel mixture. For example, fuel that contains 20% biodiesel is labeled B20. Pure biodiesel is referred to as
B100.
[0017] Biodiesel can also be used as heating fuel in domestic and commercial boilers. Existing oil boilers may contain rubber parts, and may require conversion to run on biodiesel. The conversion process is relatively simple, which involves the exchange of
<img file="MX339639B_D0213.tif" />
2. 3. 4 rubber parts by synthetic parts due to my biodiesel is a strong solvent. Due to its strong solvent power, burning biodiesel will increase the efficiency of the boilers. Biodiesel can be used as an additive in diesel formulations to increase the lubricity of pure Ultra-Low Sulfur Diesel (ULSD) fuel, which is advantageous as it has virtually no sulfur content. Biodiesel is a better solvent than petrodiesel and can be used to separate deposits of debris in the fuel lines of vehicles that have previously run on petrodiesel.
Biodiesel can be produced by transesterification of triglycerides contained in oil-rich biomass. Therefore, in another aspect of the present invention there is provided a method of producing biodiesel. In a preferred embodiment, the method for producing biodiesel comprises the steps of (a) cultivating a lipid-containing microorganism using the methods described herein, (b) lysing a lipid-containing microorganism to produce a lysate, (c) isolating the lipids from the lysed microorganism and (d) transesterify the lipid composition, whereby biodiesel is produced. Methods for the growth of a microorganism, lysing a
235
<img file="MX339639B_D0214.tif" />
INDUSTRIAL microorganism to produce a lysate, treat the Used in a medium comprising an organic solvent to form a heterogeneous mixture and separate the treated lysate into a lipid composition, have been described above and can also be used in the biodiesel production method.
The lipid profile of biodiesel is usually very similar to the lipid profile of oil as a raw material. Other oils provided by the methods and compositions of the invention can be transesterified to produce biodiesel with lipid profiles that include (a) at least 1-5%, preferably at least 4%, C8-C14; (b) at least 0.25% -l%, preferably at least 0.3%, C8; (c) at least 1-5%, preferably at least 2%, CIO; (d) at least 1-5%, preferably at least 2%, C12; and (3) at least 20% 40%, preferably at least 30%, C8-C14.
The lipid compositions can be transesterified to produce esters of long chain fatty acids, useful as biodiesel. Preferred transesterification reactions are described below and include base catalyzed transesterification and transesterification using recombinant lipases. In a base catalyzed transesterification process, triglycerides are reacted with an alcohol, such as
236
IMPI
INSTITUTO MiXICANO PE LA PWOMPDAO INDUSTRIAL
<img file="MX339639B_D0215.tif" />
methanol or ethanol, in the presence of an alkaline catalyst, typically potassium hydroxide. This reaction forms methyl or ethyl esters and glycerin (glycerol) as a by-product.
[0018] Animal and vegetable oils are typically made from triglycerides that are esters of free fatty acids with the trihydric alcohol, glycerol. In transesterification, glycerol in a triacylglyceride (TAG) is replaced by a short-chain alcohol such as methanol or ethanol. A typical reaction scheme is as follows:
—0 OCR<sub>1</sub> base cat —Q <sub>0CRn</sub> -w R, COOEt + FGCOOEt + R<sub>3</sub>COOEt + C<sub>3</sub>H<sub>5</sub>(OH)<sub>3</sub> * 3 EtOH ',.,. .
_q 0PR<sub>3</sub> Ethyl esters of Ghcenna fatty acids
TriaJicérido
In this reaction, the alcohol is deprotoned with a base to make it a stronger nucleophile. Commonly, ethanol or methanol are used in large excess (up to 50 times).
Typically, this reaction will either take place too slowly or will not occur at all. Heat, as well as an acid or a base, can be used to help the reaction to proceed more quickly. The acid or base is not consumed by the transesterification reaction,
<img file="MX339639B_D0216.tif" />
237
IMPI
INSTITUTO MÜXICaNÍ DE LA PROPIEDAD industrial so they are not reactive but catalysts. Almost all biodiesel has been produced using the base catalysis technique, since it only requires low temperatures and pressures and produces over 98% conversion efficiency (as long as the starting oil is low in humidity and free of fatty acids).
Transesterification is also carried out, as mentioned above, using an enzyme, such as a lipase instead of a base. The lipase catalyzed transesterification can be carried out, for example, at a temperature between room temperature and 80 ° C, and a molar ratio of TAG to alcohol less than 1: 1, preferably approximately 3: 1. Lipases suitable for use in transesterification include, but are not limited to, those listed in Table 9. Other examples of
Useful steps for transesterification are found in, for example, US Patent Nos. 4,798,793; 4,940,845 5,156,963; 5,342,768; 5,776,741 and W089 / 01032. Such lipases include, but are not limited to, lipases produced by microorganisms from Rhizopus, Aspergillus, Candida, Mucor,
Pseudomonas, Rhizomucor, Candida, and Humicola and lipas from the pancreas.
<img file="MX339639B_D0217.tif" />
238
IMPI
Table 9. Lipases suitable for use in transesterification.
Lipase from Aspergillus niger ABG73614, Lipase B from Antarctic (novozym-435) CAA83122, Lipase from Candida 5 cylindraceaAAR24090, Lipase from Candida lipolytica (Lipase L; Amano Pharmaceutical Co., Ltd.), Lipase from Candida rugosa (eg. -OF; Meito Sangyo Co., Ltd.), Mucor laiehei lipase (Lipozyme IM 20), Pseudomonas fluorescens AAA25882 lipase, lipase from Rhizopus japónicas (Lilipase 10 A-10FG) Q7M4U7_1, lipase from Rhizomucor miehei B34959, lipasa de Rhizomucor F) AAF32408, Serratia marcescens lipase (SM Enzyme) ABI13521, Thermomyces lanuginosa lipase CAB58509, Lipase P (Nagase ChemteX Corporation), and Lipase QLM (Meito Sangyo Co., Ltd., Nagoya, Japan)
A challenge in using a lipase for the production of fatty acid esters suitable for biodiesel is that the price of lipase is much higher than the price of sodium hydroxide (NaOH) used by strong base 20 processes. This challenge was addressed using an immobilized lipase, which can be recycled. However, the activity of the immobilized lipase must be maintained after recycling for a minimum number of cycles to allow a process based on
239 IMPI Ol
MEXICAN INSTITUTE
D € THE PROPERTY Í%> jS
INOUSTMIAL ^ 5J3E lipase that competes with the strong base process in terms of cost of production. United States Patent No.
6,398,707 (issued June 4, 2002 to Wu et al.) Describes methods of increasing the activity of immobilized lipases and the regeneration of immobilized lipases with reduced activity. Some suitable methods include immersing an immobilized lipase in an alcohol having a number of carbon atoms not less than for a period of time, preferably 0.5-48 hours, and most preferably 0.5-1.5 hours. Some suitable methods also include washing a deactivated immobilized lipase with an alcohol having a carbon atom number of not less than 3, and then immersing the deactivated immobilized lipase in a vegetable oil for
0.5-48 hours.
In particular embodiments, a recombinant lipase is expressed in the same microorganisms that produce the lipids on which the lipase acts. Suitable recombinant lipases include those listed in Table 9 above and / or having GenBank accession numbers listed in Table 9 above, or a polypeptide having at least 70% amino acid identity with one of the lipases listed above
<img file="MX339639B_D0218.tif" />
240 in Table 9 and that exhibits activity
IMPI
MRXICAND INSTITUTE of INDUSTRIAL property
<img file="MX339639B_D0219.tif" />
In further embodiments, the enzyme activity is present in a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at minus about a
99% identity with one of the sequences described above, all of which are incorporated by reference herein as fully set forth. The DNA encoding the lipase and the selectable marker is preferably codon optimized cDNA. Methods of recoding genes for expression in microalgae are described in United States Patent No. 7,135,290.
The international common standard for biodiesel is EN
14214. ASTM D6751 is the most common biodiesel standard referenced in the United States and Canada. Germany uses DIN EN 14214 and the United Kingdom requires compliance with BS EN 14214. Basic industrial tests to determine whether products conform to these standards typically include gas chromatography, HPLC, and others. Biodiesel that meets quality standards is not very toxic, with a toxicity index (DL<sub>50</sub>) greater than 50 ml / kg.
<img file="MX339639B_D0220.tif" />
241
IMPI
Mexican INSTITUTE
OF THE PROPERTY <% _ industrial >>
Although biodiesel that meets ASTM standards has to be non-toxic, there may be contaminants that tend to crystallize and / or precipitate out of the solution as sediment. Sediment or precipitates can cause problems such as decreased fuel flow, clogged fuel lines, clogged filters, etc. There are processes well known in the art that specifically deal with the removal of these pollutants and sediments from biodiesel, in order to produce a higher quality product. Sediment or precipitates can cause problems such as decreased fuel flow, clogged fuel lines, clogged filters, etc. There are processes well known in the art that specifically deal with the removal of these pollutants and sediments from biodiesel, in order to produce a higher quality product. Examples of these processes include, but are not limited to, oil pretreatment to remove contaminants such as phospholipids and free fatty acids (eg, degumming, caustic refining, and silica adsorbent filtration) and cold filtration. This process cools the biodiesel and filters any of the sediments or
<img file="MX339639B_D0221.tif" />
242 precipitates that may form when
IMPI
MÍXICANC INSTITUTE. Γ> Ε THE IRROIDITY
INDUSTRIAL
<img file="MX339639B_D0222.tif" />
use at a lower temperature. This process cools the biodiesel and filters out any sediments or precipitates that may form when the fuel is used at a lower temperature. This process is well known in the art and is described in US Patent Application Publication No. 2007-0175091. Suitable methods may include cooling the biodiesel to a temperature below about 38 ° C, so that impurities and contaminants precipitate out as particles in the biodiesel liquid. Diatomaceous earth or other filter material can then be added to the cooled biodiesel to form a paste, which can then be filtered through a pressure sheet or other filter to remove particulates. Filtered biodiesel can then be passed through a polishing filter to remove remaining sediment and diatomaceous earth, in order to produce the final biodiesel product.
Example 13 describes the production of biodiesel using Prototheca moriformis triglyceride oil. Filterability by cold immersion by ASTM D6751 method
The biodiesel produced in Example 13 was 120
243
<img file="MX339639B_D0223.tif" />
INSTITUI »; AEXlCANL PE LA PMOWEDAD industrial seconds for a volume of 3 00ml. Eata ^ prneba in the filtration of 300 ml of B100, chilled at 40 ° F for hours, allowed to warm to room temperature, and vacuum filtered with 0.7 micron glass fiber with stainless steel support. The oils of the invention can be transesterified to generate biodiesel with a cold immersion time of less than 120 seconds, less than 100, and less than 90 seconds.
Subsequent processes can also be used if biodiesel is used particularly at cold temperatures. These processes include winterization and fractionation. There are several approaches to winterize biodiesel. There are several approaches to winterize biodiesel. One method is to mix biodiesel with petroleum diesel. Another approach is to remove saturated methyl esters indiscriminately, by mixing them in additives, allowing the saturated fats to crystallize and then filtering the crystals. Another approach is to remove saturated methyl esters indiscriminately, by mixing them in additives, allowing the saturated fats to crystallize and then filtering the crystals. Fractionation selectively separates methyl esters into components or
<img file="MX339639B_D0224.tif" />
244
IMPI individual fractions, allowing the removal or inclusion of specific methyl esters.
Another valuable fuel provided by the methods of the present invention is renewable diesel, which comprises alloys, such as C10: 0, C12: 0, C14: 0, C16: 0 and
C18: 0, and therefore is distinguished from biodiesel. High quality renewable diesel is obtained in accordance with the ASTM standard
D975. The lipids produced by the methods of the present invention can serve as raw material to produce renewable diesel. The lipids produced by the methods of the present invention can serve as raw material to produce renewable diesel. Renewable diesel can be produced by at least three processes: hydrothermal processing (hydrotreating); hydroprocessing; and indirect liquefaction. These processes produce distillates without ester. During these processes, the triacylglycerides produced and isolated as described herein are converted to alkanes.
In one embodiment, the method for the production of renewable diesel comprises (a) cultivating a lipid-containing microorganism using the methods described herein, (b) lysing the microorganism to produce a lysate, (c) isolating the lipid from the lysed microorganism, and (d)
245
ΙΜΡΙ
INSTITUTO MUICAN * DE LA η · ΒΙ (· Α · INWISTWAI
<img file="MX339639B_D0225.tif" />
deoxygenate and hydrotreat the lipid to produce an alkane, thus producing renewable diesel. Lipids suitable for the manufacture of renewable diesel can be obtained through the extraction of microbial biomass using an organic solvent such as hexane, or through other methods, such as those described in the
United States no. 5,928,696. Some suitable methods may include mechanical pressing and centrifugation.
In some methods, the microbial lipid is first cracked in conjunction with hydrotreatment to reduce the length of the carbon chain and saturate the double bonds, respectively. The material is then isomerized, also in conjunction with hydrotreating. The naphtha fraction can then be removed by distillation, followed by further distillation to evaporate and distill the desired components into the diesel fuel in order to comply with an ASTM D975 standard, while the heavier components than desired are left to comply with the norm
D975. Hydrotreating, hydrocracking, deoxygenation, and isomerization methods of chemically modified oils, including triglyceride oils, are well known in the art. See for example the European patent applications EP1741768 (Al); EP1741767 (Al); EP1682466
246
<img file="MX339639B_D0226.tif" />
EP1795576 (Al); and the
6,630,066; 6,596,155;
(To the); EP1640437 (Al); EP1681337 (Al);
United States patents 7,238,277;
6,977,322; 7,041,866; 6,217,746; 5,885,440; 6,881,873.
In one embodiment of the renewable diesel production method, lipid treatment to produce an alkane is carried out by hydrotreating the lipid composition. In hydrothermal processing, biomass is typically reacted in water at elevated temperature and pressure to form oils and solid waste. Conversion temperatures are typically 300 ° to 660 ° F, with pressure sufficient to hold water primarily as a liquid, 100 to 170 atmospheres as standard. Reaction times are on the order of 15 to 30 minutes. After the reaction is complete, the organics are separated from the water. In this way a distillate suitable for diesel is produced.
In some methods of preparing renewable diesel, the first stage of triglyceride treatment is hydroprocessing to saturate the double bonds, followed by deoxygenation at elevated temperature in the presence of hydrogen and a catalyst. In some methods, hydrogenation and deoxygenation occur in the same reaction.
In other methods deoxygenation occurs before
<img file="MX339639B_D0227.tif" />
247
IMPI ~ tuwtniTn hydrogenation. The isomerization is then optionally carried out, also in the presence of hydrogen and a catalyst. The naphtha components are preferably removed by distillation. As examples, see United States Patents 5,475,160 (triglyceride hydrogenation), 5,091,116 (deoxygenation, hydrogenation, and gas extraction), 6,391,815 (hydrogenation), and 5,888,947 (isomerization).
An appropriate method for the hydrogenation of triglycerides includes preparing an aqueous solution of copper, zinc, magnesium and lanthanum salts and another alkali metal solution or preferably, ammonium carbonate. The two solutions can be heated to a temperature of about 20 ° C to about 85 ° C and are measured together in a beaker in ratios such that the pH in the beaker is kept between 5.5 and 7.5 with the aim of forming a catalyst. Additional water can be used initially in the precipitation vessel or added at the same time as the salt solution and the precipitation solution. The resulting precipitate can then be thoroughly washed; dry, calcine at 300 ° C and activate on hydrogen at temperatures in the range of 100 ° C to 400 ° C. One or
248
IMPI
INSTITUTO MEXICA, '- ΜΙΤΕ IA PHOPttDAD
INDUSTRIAL
<img file="MX339639B_D0228.tif" />
more triglycerides can then be contacted and reacted with hydrogen in the presence of the catalyst described above in a reactor. The reactor may be a drip bed reactor, a fixed bed gas-solid reactor, a packed bubble column reactor, a continuous agitation tank reactor, a slurry phase reactor, or any other suitable type of reactor. known in the art. The process can be carried out in batches or continuously. Reaction temperatures are typically in the range of about 170 ° C to about 250 ° C, while reaction pressures are typically in the range of about 300 psig to about 2000 psig. Furthermore, the molar ratio of hydrogen to triglycerides in the process of the present invention is typically in the range of from about 20: 1 to about 700: 1. The process is typically carried out at a weight hourly space velocity (WHSV) in the range of about 0.1 h '<sup>1</sup> at about 5 h '<sup>1</sup>. One skilled in the art will recognize that the time period required for the reaction will vary as a function of the temperature used, the molar ratio of hydrogen to triglycerides, and the partial pressure of hydrogen. Products produced by such
249
IMPI
MEXICAN INSTITUTE Dt LA FfcOHEDAL · INDUSTRIAL
<img file="MX339639B_D0229.tif" />
Hydrogenation processes include fatty alcohols, glycerol, traces of paraffins, and unreacted triglycerides. These products are normally separated by conventional means such as, for example, distillation, extraction, filtration, crystallization, and the like.
[0019] Oil refineries use hydroprocessing to remove impurities by treating the sources with hydrogen. Hydroprocessing conversion temperatures are typically 300 ° to 700 ° F. Pressures are typically 40 to 100 atmospheres. Reaction times are typically in the order of 10 to minutes. Solid catalysts are used to increase certain reaction rates, improve the selectivity of certain products, and optimize hydrogen consumption.
Suitable methods for deoxygenation of an oil include heating an oil to a temperature in the range of about 350 ° F to about 550 ° F and keeping the hot oil continuously in contact with nitrogen, under at least one pressure that is at the range from about atmospheric pressure to above, for at least about 5 minutes.
<img file="MX339639B_D0230.tif" />
250
ΙΜΡΙ
MEXICAN INSTITUTE DF. IA INDUSTRIAL MONEDAD
Suitable methods for isomerization include the use of alkaline isomerization and other oil isomerization known in the art.
Hydrotreating and hydroprocessing ultimately lead to a reduction in the molecular weight of the triglyceride source. The triglyceride molecule is reduced to four hydrocarbon molecules under hydroprocessing conditions: one propane molecule and three heavier hydrocarbon molecules, typically in the range of C8 to C18.
Thus, in one embodiment, the product of one or more chemical reaction (s) carried out on the lipid compositions of the invention, is a mixture of allenes comprising renewable diesel according to the standard ASTM D975. Hydrocarbon production by micro-organisms is reviewed by Metzger et al., Appl Microbiol
Biotechnol (2005) 66: 486-496 and A Look Back in the US
Department of Energy's Aquatic Species Program: Biodiesel from Algae, NREL / TP-580-24190, John Sheehan, Terri Dunahay,
John Benemann and Paul Roessler (1998).
The distillation properties of a diesel fuel are described in terms of T10-T90 (temperature at 10% and 90%, respectively, distilled volume). Diesel
251
IMPI
MEXICAN INSTITUTE I? E IA phoNídai; INDUSTRIAL
<img file="MX339639B_D0231.tif" />
Renewable was produced from triglyceride oil from
Prototheca moriformis and is described in Example 13. The
T10-T90 of the material produced in Example 13 was 57.9 ° C.
Hydrogen treatment methods, isomerization, and other covalent modification of oils described herein, as well as distillation and fractionation methods (such as cold filtration) described herein, may be employed. to generate renewable diesel compositions with other T10T90 ranges, such as, 20, 25, 30, 35, 40, 45, 50, 60 and 65 ° C by using triglyceride oils that are produced according to the methods described herein.
The TIO of the material produced in Example 13 was
242.1 ° C. Hydrogen treatment methods, isomerization, and other covalent modification of oils described herein, as well as distillation and fractionation methods (such as cold filtration) described herein, can be employed to generate renewable diesel compositions with other TIO values, such as TIO between 180 and 295, between 190 and 270, between 210 and 250, between 225 and 245, and at least 290.
The T90 of the material produced in Example 13 was
300 ° C. Hydrogen treatment methods, the
252
IMPI »^
INSITO ΙΤΟ MEXICANO • Ε la MoneoAij ι · ϊ5γ ha *
ΙΝ »Ι ISTRIAL ^ te <sup>M</sup> rPr isomerization, and other covalent modification of the oils described herein, as well as the distillation and fractionation methods (such as cold filtration) described herein, can be employed to generate renewable diesel compositions with other T90 values, such as T90 between 280 and 380, between 290 and 360, between 300 and 350, between 310 and 340, and at least 290.
The FBP of the material produced in Example 13 was
300 ° C. Hydrogen treatment methods, isomerization, and other covalent modification of oils described herein, as well as distillation and fractionation methods (such as cold filtration) described herein, can be employed to generate renewable diesel compositions with other values
<td>15 FBP, such as</td><td>FBP</td><td>between 290 and 400,</td><td>between 300</td><td colspan="2">and 385, between</td>
<td>310 and 370, between</td><td> 315</td><td>and 360, and at least</td><td> 300.</td><td></td><td></td>
<td colspan="2">Other oils</td><td>p roporc i onado s</td><td>for the</td><td>methods</td><td>and</td>
<td>compositions</td><td>of</td><td>the invention</td><td>they can</td><td>undergo</td><td>to</td>
combinations of hydrotreating, isomerization, and other covalent modification including oils with lipid profiles including (a) at least 1-5%, preferably at least 4%, C8-C14; (b) at least 0.25% -l%, preferably at least 0.3%, C8; (c) at least l% -5%, preferably at least
<img file="MX339639B_D0232.tif" />
253
IMPI
2%, CIO; (d) at least l% -5%, preferably at least 2%,
C12; and (3) at least 20% -40%, preferably at least 30% C8C14.
[0020] A traditional ultra low sulfur diesel can be produced from any form of biomass by a two-step process. First, the biomass is converted into a synthetic gas, a gaseous mixture rich in hydrogen and carbon monoxide. The synthetic gas is then catalytically converted to liquids. Typically, the production of liquids is accomplished using the synthesis of
Fischer-Tropsch (FT). This technology is applied to coal, natural gas, and heavy oils. Therefore, in another preferred embodiment of the method for the production of renewable diesel, the treatment of the lipid composition to produce an alkane is carried out by indirect liquefaction of the lipid composition.
The present invention also provides methods for producing reactor fuel. The reactor fuel is light to straw colored. The most common fuel is an unleaded / paraffin oil-based fuel classified as Airplane Al, which is produced to a set of internationally standardized specifications. Jet fuel is a mixture of a large number of
254
A i Vi £ A (
<img file="MX339639B_D0233.tif" />
different hydrocarbons, possibly as many as a thousand or more.
The range of its size (molecular weight or carbon numbers) is limited by the requirements for the product, for example, the freezing point or the smoke point. Kerosone type jet fuel (including
Jet A and Jet Al) have a carbon number distribution between approximately 8 and 16 carbon numbers. Naphtha or wide-cut type jet fuel (including
Jet B) typically has a carbon number distribution of between about 5 and 15 carbons.
Both planes (Jet A and Jet B) can contain a number of additives. Useful additives include, but are not limited to, antioxidants, antistatic agents, corrosion inhibitors, and fuel system freeze inhibitor (FSII) agents. Antioxidants prevent gumming and are usually based on alkylated phenols, for example, AO-30, AO-31, or AO-37. Antistatic agents dissipate static electricity and prevent sparks. The
Stadis 450 with dinonylnaphthylsulfonic acid (DINNSA) as the active ingredient, is an example. Corrosion inhibitors, for example, DCI-4A, is used for civil and military fuels and DCI -6A is used for fuels
255
ΙΜΡΙ
<img file="MX339639B_D0234.tif" />
<img file="MX339639B_D0235.tif" />
EGME.
In one embodiment of the invention, a reactor fuel is produced by mixing algae fuels with existing fuels. The lipids produced by the methods of the present invention can serve as a raw material to produce jet fuel. Therefore, in another aspect of the present invention, a method of producing reactor fuel is provided. 10 Two methods are provided herein for producing aircraft fuel from the lipids produced by the methods of the present invention: fluid catalytic cracking (FCC), and hydrodeoxygenation (HDO).
[0021] Fluid catalytic cracking (FCC) is a method that is used to produce olefins, especially propylene, from heavy fractions of crude oil. The lipids produced by the method of the invention can be converted to olefins. The process involves the flow of lipids produced through an FCC zone and a stream of the olefin compound product is collected, which is useful as reactor fuel. The lipids produced are contacted with a cracking catalyst under cracking conditions to provide a product stream that
256
ΙΜΡΙ
MEXICAN INSTITUTE OF RtOWIDAD
INDUSTRIAL
<img file="MX339639B_D0236.tif" />
It includes defined and hydrocarbons, useful as reactor fuel.
In one embodiment, the method for producing reactor fuel comprises (a) culturing a lipid-containing microorganism using the methods described herein, (b) lysing the lipid-containing microorganism to produce a lysate, (c) isolating the lipid from the lysate, and (d) treating the lipid composition, thereby producing the reactor fuel. In one embodiment of the method for producing a reactor fuel, the lipid composition may flow through a catalytic cracking zone of the fluid, which, in one embodiment, may comprise contacting the lipid composition with a cracking catalyst. under cracking conditions to provide a product stream comprising olefins C<sub>2</sub>-C<sub>5</sub>.
In certain embodiments of this method, it may be desirable to remove contaminants that may be present in the lipid composition. Therefore, before flowing the lipid composition through a fluid catalytic cracking zone, the lipid composition is pretreated. Pretreatment may include contacting the lipid composition with a resin of
257
<img file="MX339639B_D0237.tif" />
IMPI ion exchange. Resin exchanged<sup>0</sup> ionic ^ is ^ an acidic ion exchange resin, such as * Amberlyst ™ -15 and can be used as a bed in a reactor through which the lipid composition flows, either up or down. Other pretreatments may include mild acid washes by contacting the lipid composition with an acid, such as sulfuric, acetic, nitric, or hydrochloric acid. Contact is made with a dilute solution of the acid, usually at room temperature and atmospheric pressure.
The lipid composition, optionally pretreated, is flowed to an FCC zone, where the hydrocarbon components are cracked to olefins. Catalytic cracking is carried out by contacting the lipid composition in a reaction zone with a catalyst composed of a finely divided particulate material. The reaction is catalytic cracking, unlike hydrocracking, and is carried out in the absence of added hydrogen or hydrogen consumption. As the cracking reaction proceeds, substantial amounts of coke are deposited on the catalyst. The catalyst is regenerated at high temperatures by burning the catalyst coke in a regeneration zone. Coke-containing catalyst,
258
IMPI
<img file="MX339639B_D0238.tif" />
which is referred to herein as coked catalyst, is continuously transported from the reaction zone to the regeneration zone to regenerate and be replaced by an essentially coke-free regenerated catalyst from the regeneration zone. The fluidization of the catalyst particles by means of various gas streams allows the transport of the catalyst between the reaction zone and the regeneration zone. The methods for cracking the hydrocarbons, such as those for the lipid composition described herein, in a fluidized stream of the catalyst, transport of the catalyst between the reaction and regeneration zones, and combustion of coke in the regenerator, are well known to those skilled in the art of FCC processes. Exemplary FCC Applications and Useful Catalysts to Crack the Lipid Composition to Produce Olefins C<sub>2</sub>-C<sub>5</sub> are described in United States Patent Nos. 6,538,169 and 7,288,685, which are incorporated in their entirety by reference.
Appropriate FCC catalysts generally comprise at least two components that may or may not be in the same matrix. In some embodiments, both components can be distributed throughout the entire
<img file="MX339639B_D0239.tif" />
259 reaction. The first component generally includes any of the known catalysts used in the fluidized catalytic cracking material, such as an amorphous active clay type catalyst and / or a high activity crystalline molecular sieve. Molecular sieve catalysts may be preferred over amorphous catalysts, due to their greatly improved selectivity for desired products. In some preferred embodiments, zeolites can be used as a molecular sieve in FCC processes. Preferably, the component of the first catalyst comprises a large pore zeolite, such as a Y-type zeolite, an active alumina material, a binder material, comprising either silica or alumina, and an inert filler such as kaolin.
In one embodiment, the cracking of the lipid composition of the present invention is performed in the elevator section, or alternatively the elevator section, of the FCC zone. The lipid composition is introduced into the elevator via a nozzle, resulting in rapid evaporation of the lipid composition. Before contacting the catalyst, the lipid composition will normally have a temperature of about 149 ° C to about 316 ° C (300 ° F to
260
ΙΜΡΙ
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX339639B_D0240.tif" />
600 ° F). The catalyst is flowed from a mixing container to the elevator, where it comes in contact with the lipid composition for a time of 2 seconds or less.
The mixed catalyst and the vapors of the reacted lipid composition are discharged from the top of the riser through an outlet connection, and separated into a stream of steam from the cracked product as defined and a collection of catalyst particles covered with amounts substantial coke which is generally referred to as coked catalyst. In an effort to minimize the contact time of the lipid composition and the catalyst, which can promote further conversion of the desired products to other unwanted products, any spacer arrangement, such as a spiral arm arrangement, can be use to remove the coked catalyst from the product stream quickly. The separator, for example the spiral arm separator, is located in an upper portion of a chamber with an extraction zone located in the lower portion of the chamber. The catalyst separated by the spiral arm arrangement drips into the extraction zone. The vapor stream of the cracked product comprising the cracked hydrocarbons including light and
261
IMPI
MEXICAN INSTITUTE Of LA PROBIBÍIAL · INDUSTRIAL
<img file="MX339639B_D0241.tif" />
Some catalysts leave the chamber through a duct that is in communication with the cyclones. Cyclones remove catalyst debris from the product vapor stream to reduce particle concentrations to very low levels. The product vapor stream then exits from the top of the separation vessel. The catalyst, separated by the cyclones, is returned to the separation vessel and then to the extraction area. The extraction zone removes the hydrocarbons adsorbed from the surface of the catalyst by the countercurrent contact with the steam.
[0022] The low partial pressure of hydrocarbons operates in favor of the production of light olefins. Consequently, the riser pressure is set to approximately 172 to 241 kPa (25 to 35 psia) with a hydrocarbon partial pressure of approximately 35 to 172 kPa (5 to 25 psia), with a preferred hydrocarbon partial pressure of approximately 69 to 138 kPa (10 to 20 psia). twenty This relatively low partial pressure for hydrocarbons is achieved through the use of steam as a diluent insofar as the diluent is 10-55wt-% by weight of the lipid composition, and preferably of
262
IMPI
MEXICAN INSTITUTE OF THE INDUSTRIAL PRORIROAD
<img file="MX339639B_D0242.tif" />
approximately 15wt-% by weight of the lipid composition.
Other diluents, such as dry gas, can be used to achieve equivalent hydrocarbon partial pressures.
[0023] The temperature of the cracking current at the elevator outlet will be approximately 510 ° C to 621 ° C (950 ° F to 1150 ° F). However, riser outlet temperatures above 566 ° C (1050 ° F) produce more dry and sharper gas. While elevator outlet temperatures below 566 ° C (1050 ° F) produce less ethylene and propylene. Accordingly, it is preferred to carry out the FCC process at a preferred temperature of from about 566 ° C to about 630 ° C, preferred pressure from about 138 kPa to about 240 kPa (20 to 35 psia). Another condition for the process is the ratio of the catalyst to the lipid composition, which can vary from about 5 to about 20 and preferably from about 10 to about 15.
In one embodiment of the method for producing a reactor fuel, the lipid composition is introduced into the elevator section of a FCC reactor. The temperature in the elevator section will be very hot and in the range from about 700 ° C (1292 ° F) to rPt ^ a ^ r to about 760 ° C (1400 ° F) with a ratio<sup>l</sup>ft<sup>5T</sup>¿<sup>l</sup>to<sup>t</sup>taTt '
<img file="MX339639B_D0243.tif" />
Mexican Institute
ΠΕ THE PROPERTY L ·. τ _ _J HMftURTliAli__ composition of approximately 100 to approximately 150. 'and do you anticipate that the introduction of the lipid composition into the elevator section will produce considerable amounts of propylene and ethylene.
In another embodiment of the method for producing a reactor fuel with the lipid composition or lipids produced as described herein, the structure of the lipid composition or the lipids is broken by a process known as hydrodeoxygenation (HDO).
HDO means the removal of oxygen by means of hydrogen, that is, oxygen is removed while the structure of the material is broken. The olefinic double bonds are hydrogenated and all the sulfur and nitrogen compounds are removed. The removal of sulfur is called hydrodesulfurization (HDS). The pre-treatment and the purity of the raw materials (lipid or lipid composition) contribute to the useful life of the catalyst.
Generally in the HDO / HDS stage, hydrogen is mixed with the source stock (lipid or lipid composition) and then the mixture is passed through a bed of catalyst, as a co-current flow, either as a single phase or a two-phase source stock. After the
<img file="MX339639B_D0244.tif" />
264 HDO / MDS stage, the product fraction is 'separated and a separate isomerization reactor'. An isomerization reactor for biological starting material is described in the literature (Fl 100 248) as a co-current reactor.
The process for producing a fuel by hydrogenation of a hydrocarbon source, for example, the lipid composition or lipids herein, can also be performed by passing the lipid composition or lipids as a stream of co-current with hydrogen gas to through a first hydrogenation zone, and subsequently the hydrocarbon effluent is further hydrogenated in a second hydrogenation zone, passing hydrogen gas to the second hydrogenation zone as a counter current flow with respect to the hydrocarbon effluent.
Illustrative Applications of HDO and Useful Catalysts to Crack the Lipid Composition to Produce Definas C<sub>2</sub>-C<sub>s</sub> are described in the patent of the
United States no. 7,232,935, which is incorporated by reference in its entirety.
Typically, in the hydrodeoxygenation step, the structure of the biological component, such as the lipid composition or lipids thereof, breaks down, the
265
ΙΜΡΙ
INSTITUTO MfJUCANO nt la ρ »πει> ΛΓ>
INDVSTRlAl
<img file="MX339639B_D0245.tif" />
Oxygen, nitrogen, phosphorous and sulfur compounds, and light hydrocarbons as gas are removed, and olefinic bonds are hydrogenated. In the second stage of the process, that is, in the so-called isomerization stage, isomerization is carried out for branching the hydrocarbon chain and the performance of the paraffin is improved at low temperatures.
In the first stage, i.e. in the HDO stage of the cracking process, the hydrogen gas and the lipid composition or lipids herein to be hydrogenated are passed to an HDO catalyst bed system, either as co-current or counter-current flows, said catalyst bed system comprising one or more catalyst beds (es), preferably 1-3 catalyst beds. The HDO stage typically works in a co-current manner. In the case of an HDO catalyst bed system, which comprises two or more catalyst beds, one or more of the beds can operate using the countercurrent flow principle. In the HDO stage, the pressure varies between 20 and 150 bar, preferably between 50 and 100 bar, and the temperature varies between 200 and 500 ° C, preferably in the range of 300-400 ° C. In the stage of
HDO, hydrogenation catalysts can be used
<img file="MX339639B_D0246.tif" />
VTT and / or VIB of the Pd, Pt, Ni,
266 known to contain metals from the periodic system. Preferably hydrogenation are catalysts sopi
NiMo or a CoMo catalyst, being silica. NiMo / Al catalysts are typically used<sub>2</sub>0<sub>3</sub> and CoMo / Al<sub>2</sub>0<sub>3</sub>.
Prior to the HDO step, the lipid composition or lipids herein, optionally, can optionally be treated by prehydrogenation under milder conditions, thus avoiding side reactions of the double bonds. Said prehydrogenation is carried out in the presence of a prehydrogenation catalyst at temperatures of 50,400 ° C and at hydrogen pressures of 1-200 bar, preferably at a temperature between 150 and 250 ° C and at a hydrogen pressure between 10 and 100 bar. The catalyst may contain Group VIII and / or VIB metals from the periodic system. Preferably, the prehydrogenation catalyst is a Pd, Pt, Ni, NiMo supported catalyst or a CoMo catalyst, the support is alumina and / or silica.
[0024] A gas stream from the stage of
HDO containing hydrogen is cooled and then compounds of carbon monoxide, carbon dioxide, nitrogen, phosphorous and sulfur, gaseous light hydrocarbons and others
<img file="MX339639B_D0247.tif" />
267
IMPI <sup>I</sup>* ICANO OF THE PROPERTY industrial impurities, are removed from it. After compression, the purified hydrogen or recycled hydrogen is returned back to the first catalyst bed and / or between the catalyst beds to compensate for the removed gas stream. The water is removed from the condensed liquid. Liquid is passed to the first catalyst bed or between the catalyst beds.
[0025] After the HDO step, the product undergoes an isomerization step. It is important to the process that the impurities are removed as completely as possible before the hydrocarbons come into contact with the isomerization catalyst. The isomerization step comprises an optional separation step, in which the reaction product from the HDO stage can be purified by separation with steam or a suitable gas, such as light hydrocarbons, nitrogen or hydrogen. The optional separation step is carried out as a countercurrent in a unit located upstream of the isomerization catalyst, in which the gas and liquid are in contact with each other, or before the existing isomerization reactor in one unit. independent separation using the countercurrent principle.
<img file="MX339639B_D0248.tif" />
the hydrogenated lipids from the mixture of n-oarafin. I know
After the step of and the lipid composition or present, and, optionally, they pass to a reactive isomerization unit comprising one or more beds of the catalyst (s). The catalyst beds of the isomerization stage may operate as a co-current or counter current.
[0026] It is important to the process that the countercurrent flow principle is applied in the isomerization step. In the isomerization step, this is done by carrying out any optional separation steps or the isomerization reaction step or both in countercurrent form. In the isomerization stage, the pressure varies in the range of 20-150 bar, preferably in the range of 20-100 bar, the temperature is between 200 and
500 ° C, preferably between 300 and 400 ° C. In the isomerization step, isomerization catalysts known in the art can be used. Suitable isomerization catalysts contain the molecular sieve and / or a Group VII metal and / or a vehicle. Preferably, the isomerization catalyst contains SAPO-11 or SAPO41 or ZSM22 or ZSM-23 or ferrierite and Pt, Pd or Ni and Al<sub>2</sub>OR<sub>3</sub> and SiO<sub>2</sub>. Typical isomerization catalysts are, for example,
269
ΙΜΡΙ
<img file="MX339639B_D0249.tif" />
Pt / SAPO-ll / Al<sub>2</sub>OR<sub>3</sub>, Pt / ZSM-22 / Al<sub>2</sub>OR<sub>3</sub>, Pt / ZSM-23 / Al<sub>2</sub>OR<sub>3</sub> and Pt / SAPOll / SiO<sub>2</sub>. The isomerization step and HDO step can be carried out in the same pressure vessel or in separate pressure vessels. The optional prehydrogenation can be carried out in a separate pressure vessel or in the same pressure vessel as the HDO and isomerization steps.
Thus, in one embodiment, the product of one or more chemical reactions is a mixture of alkanes that comprises
HRJ-5. In another embodiment, the product of one or more chemical reactions is an alkane mixture comprising reactor fuel according to ASTM D1655. In some embodiments, the composition that meets ASTM 1655 aircraft fuel specifications has a sulfur content that is less than 10 ppm. In other embodiments, the composition that meets ASTM 1655 aircraft fuel specifications has a TIO value of
<td colspan="2">distillation curve</td><td>less</td><td>of</td><td>205 ° C.</td><td>. In another modality,</td><td>the</td>
<td>composition</td><td>That</td><td>adjusts</td><td>to</td><td>the</td><td>Specifications</td><td>of the</td>
<td>fuel</td><td colspan="3">ASTM 1655 aircraft</td><td>has</td><td colspan="2">a boiling point</td>
<td>final (FBP)</td><td>less</td><td colspan="2">than 300 ° C</td><td>In</td><td>another modality,</td><td>the</td>
<td>composition</td><td>That</td><td>adjusts</td><td>to</td><td>the</td><td>Specifications</td><td>of the</td>
ASTM 1655 aircraft fuel has a point of
270
<img file="MX339639B_D0250.tif" />
IMPI
INSTITUTO MEXICANO DE IA PROPIEDAD indi ISTRIAL inflammation of at least 38 ° C. In another embodiment, the composition that conforms to ASTM 1655 aircraft fuel specifications has a density between
775K / M<sup>3</sup> and 840K / M<sup>3</sup>. In yet another embodiment, the composition that conforms to ASTM 1655 reactor fuel specifications has a freezing point that is below -4 7 ° C. In another embodiment, the composition that conforms to fuel specifications reactor
ASTM 1655 has a net heat of combustion that is at least
42.8 MJ / K. In another embodiment, the composition that conforms to ASTM 1655 reactor fuel specifications has a hydrogen content that is at least 13.4 mass%. In another embodiment, the composition that conforms to ASTM 1655 reactor fuel specifications has thermal stability, as assessed by quantitative gravimetric JFTOT at 260 ° C, which is below
3mm Hg. In another embodiment, the composition that meets ASTM 1655 aircraft fuel specifications has an existing gum that is below 7 mg / dl.
Therefore, the present invention describes a variety of methods in which the chemical modification of lipids of microalgae is performed to yield useful products in a variety of applications
271
<img file="MX339639B_D0251.tif" />
industrial and other. Examples of the processes for modifying oils produced by the methods described herein include, but are not limited to, hydrolysis of the oil, hydroprocessing of the oil, and esterification of the oil. Other chemical modification of the microalgae lipid includes, but is not limited to, epoxidation, oxidation, hydrolysis, sulfation, sulfonation, ethoxylation, propoxylation, amidation, and saponification. Modification of the microalgae oil produces basic oleochemicals that can be further modified into selected derived oleochemicals for a desired function. In a manner similar to that described above in connection with the fuel production process, these chemical modifications can also be made in the oils generated by the microbial cultures described herein. Examples of basic oleochemicals include, but are not limited to, soaps, fatty acids, fatty esters, fatty alcohols, fatty nitrogen compounds, fatty acid methyl esters, and glycerin. Examples of derived oleochemicals include, but are not limited to, fatty nitriles, esters, acid dimers, quats, surfactants, fatty alkanolamides, fatty alcohol sulfates, resins, emulsifiers, fatty alcohols, olefins,
272
ΙΜΡΙ
<img file="MX339639B_D0252.tif" />
drilling muds, polyols, polyurethanes, polyacrylates, rubber, candles, cosmetics, metal soaps, soaps, alpha-sulfonated methyl esters, fatty alcohol sulphates, fatty alcohol ethoxylates, fatty alcohol ether sulfates, imidazolines, surfactants, detergents, esters , quats, ozonolysis products, fatty amines, fatty alkanolamides, ethoxysulfates, monoglycerides, diglycerides, triglycerides (including medium chain triglycerides), lubricants, hydraulic fluids, greases, dielectric fluids, mold release agents, metal working fluids, heat transfer fluids, other functional fluids, industrial chemicals (eg cleaners, textile processing aids, plasticizers, stabilizers, additives), surface coatings, paints and lacquers, electrical wiring insulation, and higher alkanes.
The hydrolysis of the fatty acid constituents from the glycerolipids produced by the methods of the invention produces free fatty acids that can be derivatized to produce other useful chemicals. Hydrolysis occurs in the presence of water and a catalyst that can be an acid or a base. The released fatty acids can be derivatized to produce a variety of products, as reported in the following:
<img file="MX339639B_D0253.tif" />
273 ΙΜΡΙ
MfcXICANO INSTITUTE
OE LA RRORICBa ·
INDUSTRIAL United States Patent Nos. 5,304,664 (Highly Sulfated Fatty Acids); 7,262,158 (Cleaning Compositions);
7,115,173 (Fabric softening compositions); 6,342,208 (Emulsions for skin treatment); 7,264,886 (Compositions that repel water); 6,924,333 (Paint additives); 6,596,768 (Lipid-enriched ruminant feed raw material); and 6,380,410 (Surfactants for detergents and cleaners).
With respect to hydrolysis, in one embodiment of the invention, a triglyceride oil is first optionally hydrolyzed in a liquid medium such as water or sodium hydroxide, with the aim of obtaining glycerin and soaps.
There are several suitable triglyceride hydrolysis methods, including but not limited to, saponification, acid hydrolysis, alkaline hydrolysis, enzymatic hydrolysis
<td>(called</td><td>here</td><td colspan="4">as fractionation), and hydrolysis using</td>
<td colspan="2">compressed water</td><td>with heat.</td><td>An expert in</td><td>the</td><td>matter</td>
<td>will recognize</td><td>than</td><td>an oil of</td><td>triglycerides</td><td>not</td><td>needs to</td>
<td>hydrolyze</td><td>with</td><td>the objective</td><td>to produce</td><td>a</td><td>product</td>
<td>oleochemical;</td><td colspan="2">rather the</td><td>oil can</td><td colspan="2">become</td>
directly to the desired oleochemical by another known process. For example, triglyceride oil
274
IMPI
MEXICAN INSTITUTE OF PROHÍBA L>
INDUSTRIAL
<img file="MX339639B_D0254.tif" />
It can be converted directly to a fatty acid methyl ester by esterification.
In some embodiments, the catalytic hydrolysis of the oil produced by the methods described herein, by fractionation of the oil into glycerin and fatty acids. As mentioned above, fatty acids can then be processed through various other modifications to obtain oleochemical derivatives. For example, in one embodiment, the fatty acids can undergo an amination reaction to produce fatty nitrogen compounds. In another embodiment, fatty acids can undergo ozonolysis to produce mono and dibasic acids.
In other embodiments, hydrolysis can occur through the separation of oils produced in the present disclosure to create oleochemicals. In some preferred embodiments of the invention, a triglyceride oil can be separated before other processes are carried out. One skilled in the art will recognize that there are many suitable methods for triglyceride fractionation, including but not limited to enzyme fractionation and pressure fractionation.
Generally, the enzymatic fractionation methods of oil use enzymes, lipases, which act as
275
ΙΜΡΙ
MEXICAN INSTITUTE • i LA PROFICUA ·
Industrial i
<img file="MX339639B_D0255.tif" />
Biocatalysts in a mixture of water and ana-itc Rl enzymatic fractionation then fractionates the oil or fat, respectively, into glycerol and free fatty acids.
Glycerol can then migrate to the water phase, while the organic phase is enriched with free fatty acids.
Enzymatic fractionation reactions generally take place in the delimitation between the organic phase and the aqueous phase, where the enzyme is present only in the delimitation of the phases. The triglycerides that gather in the delimitation of the phases then contribute to or participate in the fractionation reaction. As the reaction proceeds, the density or concentration of fatty acids, still chemically bound as glycerides, compared to free fatty acids, decreases in phase delineation, so that the reaction is slower. In certain modalities, enzymatic fractionation can occur at room temperature. A person skilled in the art will know the appropriate conditions for the fractionation of the oil into the desired fatty acids.
As an example, the reaction rate can be accelerated by increasing the surface of
<img file="MX339639B_D0256.tif" />
276
IMPí
MEXICAN INSTITUTE
Say LA ΤΤΟΡ | «Ί<sub>Α</sub>ρ
INDUSTMIAL delimitation of the interface. Once the reaction is complete, the fatty acids are then separated from the organic phase released from the enzyme, and the residue, which still contains chemically bound fatty acids such as glycerides, is either fed back or recycled and mixed with the oil or fat to undergo fractionation. In this way, the recycled glycerides undergo an additional enzymatic fractionation process. In some embodiments, free fatty acids are extracted from an oil or partially fractionated fat in such a manner. Thus, if the chemically bound fatty acids (triglycerides) are
<td>they return or</td><td>I know</td><td>feed back</td><td>in</td><td>the</td><td>process</td><td>of</td>
<td>division,</td><td>the</td><td>consumption of the</td><td>enzyme</td><td>I know</td><td colspan="2">can reduce</td>
<td>drastically.</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>15 degree</td><td>of</td><td>division</td><td colspan="3">is determined as</td><td>the</td>
ratio of the measured acidity value divided by the theoretically possible acidity value, which can be calculated for a given oil or fat.
Preferably, the acidity value is measured by titration, according to common standard methods.
Alternatively, the density of the aqueous phase of glycerol can be taken as a measure of the degree of fractionation.
In one modality, the fractionation process as
<img file="MX339639B_D0257.tif" />
277
IMPI describes herein also arior-uaHn for the fractionation of the mono-, di- and triglycerides found in the so-called residual soap from the alkaline refining processes of the oils produced. In this way, the residual soap can be converted quantitatively, without prior saponification of neutral oils, into fatty acids. To this end, the fatty acids that are chemically bound in the soaps are released, preferably before fractionation, through an acid addition. In certain embodiments, a buffer solution is used in addition to water and enzyme for the fractionation process.
In one embodiment, the oils produced according to the methods of the invention can also be subjected to
15 'saponification as a method of hydrolysis. Vegetable and animal oils are typically made from triaglycerols (TAG), which are esters of fatty acids with the trihydric alcohol, glycerol. In an alkaline hydrolysis reaction, glycerol in a TAG is removed, leaving three carboxylic acid anions, which can associate with alkali metal cations such as sodium or potassium, to produce fatty acid salts. In this scheme, the constituents of carboxylic acids dissociate from the
IMPI
<img file="MX339639B_D0258.tif" />
278 glycerol fraction and are replaced ^ with biH-m-yi ir groups »The amount of base (eg KOH) used in the reaction is determined by the desired degree of saponification. If the goal is, for example, to produce a soap product comprising some of the oils originally present in the TAG composition, an amount of base sufficient to convert all TAGs into fatty acid salts is introduced into the reaction mixture. This reaction is normally carried out in an aqueous solution and occurs slowly, but can be accelerated by adding heat. Precipitation of the fatty acid salts can be facilitated by the addition of salts, such as the water soluble alkali metal halides (eg, NaCl or KC1), to the reaction mixture.
Preferably, the base is an alkali metal hydroxide, such as NaOH or KOH. Alternatively, other bases, such as alkanolamines, including for example triethanolamine and aminomethylpropanol, can be used in the reaction scheme. In some cases, these alternatives may be preferable to produce a clear soapy product. In one embodiment, the lipid composition subject to saponification is a mimetic tallow (i.e., a lipid composition similar to that of a tallow) that is produced as described in
279
IMPI
<img file="MX339639B_D0259.tif" />
it, or a mixture of a mimetic tallow with another triglyceride oil.
In some methods, the first stage of chemical modification may be hydroprocessing to saturate the double bonds, followed by deoxygenation at elevated temperature in the presence of hydrogen and a catalyst. In other methods, hydrogenation and deoxygenation can occur in the same reaction. In still other methods, deoxygenation occurs before hydrogenation. The isomerization can then be carried out optionally, also in the presence of hydrogen and a catalyst. Finally, gases and naphtha components can be removed if desired. For example, see United States Patent Nos. 55,475,160 (triglyceride hydrogenation); 5,091,116 (deoxygenation, hydrogenation, and gas removal);
6,391,815 (hydrogenation); and 5,888,947 (isomerization).
In some embodiments of the invention, triglyceride oils are partially or fully deoxygenated. Deoxygenation reactions form desired products, including but not limited to, fatty acids, fatty alcohols, polyols, ketones, and aldehydes. In general, without being limited by any particular theory, deoxygenation reactions involve a combination of several pathways of
280
<img file="MX339639B_D0260.tif" />
different reactions, including but not limited to:
hydrogenolysis, hydrogenation, consecutive hydrogenation-hydrogenolysis, consecutive hydrogenolysis-hydrogenation, and combined hydrogenation-hydrogenolysis reactions, resulting in at least partial removal of oxygen from fatty acids or fatty acid esters to produce reaction products , such as fatty alcohols, which can be easily converted to the desired chemicals by post-processing. For example, in one embodiment, a fatty alcohol can be converted to olefins by the FCC reaction or to higher alkanes through a condensation reaction.
One such chemical modification is hydrogenation, which is the addition of hydrogen to the double bonds in the constituent fatty acids of glycerolipids or free fatty acids. The hydrogenation process allows the transformation of liquid oils into semi-solid or solid fats, which may be more suitable for specific applications.
The hydrogenation of oils that are produced by the methods described in the present description can be carried out in conjunction with one or more of the methods and / or materials that are provided in the present description,
281 χ ιτι jt i
INSTITUTO MiXICAN. - <
oe LA eHOFUOA »industrial as reported in the following: US Patent Nos. 7,288,278 (Food or drug additives);
5,346,724 (Lubrication Products); 5,475,160 (fatty alcohols); 5,091,116 (Edible oils); 6,808,737 (Structural fats for margarine and spreads); 5,298,637 (Fat substitutes with reduced calories); 6,391,815 (Hydrogenation Catalyst and Sulfur Adsorbent); 5,233,099 and 5,233,100 (fatty alcohols); 4,584,139 (Hydrogenation catalysts); 6,057,375 (Foam Suppressing Agents); and 7,118,773 (Edible Spread Paste Emulsions).
A person skilled in the art will recognize that various processes can be used to hydrogenate carbohydrates. A convenient method includes contacting the carbohydrates with hydrogen or hydrogen mixed with a suitable gas and a catalyst, under conditions sufficient in a hydrogenation reactor to form a hydrogenated product. The hydrogenation catalyst can generally include Cu, Re, Ni, Fe, Co, Ru, Pd, Rh, Pt, Os, Ir, and alloys or any combination thereof, either alone or with promoters, such as W, Mo, Au, Ag, Cr, Zn, Mn, Sn, Β, P, Bi, and alloys or any combination thereof. Other effective hydrogenation catalyst materials
282
IMPI
MEXICAN INSTITUTE OE INDUSTRIAL PROPERTY
<img file="MX339639B_D0261.tif" />
They include both supported nickel or rhenium modified ruthenium. In one embodiment, the hydrogenation catalyst also includes any of the supports, depending on the desired functionality of the catalyst. Hydrogenation catalysts can be prepared by methods known to those skilled in the art.
In some embodiments, the hydrogenation catalyst includes a supported Group VIII metal catalyst and a metal sponge material (eg, a nickel sponge catalyst). Raney nickel provides an example of an activated nickel sponge catalyst suitable for use in this invention. In another embodiment, the hydrogenation reaction in the invention is carried out using a catalyst comprising a nickel-rhenium catalyst or a modified nickel-tungsten catalyst. An example of a suitable catalyst for the hydrogenation reaction of the invention is a carbon supported nickel-rhenium catalyst.
In one embodiment, a suitable Raney nickel catalyst can be prepared by treating an alloy of approximately equal amounts by weight of nickel and aluminum with an aqueous alkaline solution, for example, containing approximately 25% by weight of
<img file="MX339639B_D0262.tif" />
283
ΙΜΡΙ
MEXICAN INSTITUTE ne ia propibdaL ·
INpUSTtlAL sodium hydroxide. Aluminum is selectively dissolved by the aqueous alkaline solution, resulting in a sponge-like material comprising mostly nickel with small amounts of aluminum. The initial alloy includes promoter metals (namely molybdenum and chromium) in amounts such that about 1 to 2% by weight is held in the catalyst in the form of a nickel sponge.
In another embodiment, the hydrogenation catalyst is prepared using a ruthenium (III) nitrosyl nitrate / ruthenium (III) chloride solution in water to impregnate a suitable support material. The solution is then dried to form a solid that has a water content of less than about 1% by weight. The solid can then be reduced to atmospheric pressure in a stream of hydrogen at 300 ° C (without calcining) or 400 ° C (calcined) in a rotary ball furnace for 4 hours. After cooling and giving rise to the inert catalyst with nitrogen, the
5% by volume of the oxygen in the nitrogen is passed over the catalyst for 2 hours.
In certain embodiments, the disclosed catalyst includes a catalyst support. The catalyst support stabilizes and supports the catalyst. The type of catalyst support used depends on the chosen catalyst and the
284 reaction conditions. Suitable supports for the invention include, but are not limited to, carbon, silica, silica-alumina, zirconia, titania, ceria, vanadium, nitride, boron nitride, heteropoly acids, hydroxyapatite, zinc oxide, chromium, zeolite, carbon nanotubes , carbon fullerene and any combination of these.
The catalysts used in this invention can be prepared by conventional methods known to those skilled in the art. Suitable methods may include, but are not limited to, incipient wetting, evaporative impregnation, chemical vapor deposition, coating washing, sputtering techniques, and the like.
The conditions for carrying out the hydrogenation reaction may vary depending on the type of raw material and the desired products. One skilled in the art, with the benefit of this disclosure, will recognize the appropriate reaction conditions. In general, the hydrogenation reaction is carried out at temperatures from 80 ° C to 250 ° C, and preferably from 90 ° C to 200 ° C, and more preferably from 100 ° C to 150 ° C. In some embodiments, the hydrogenation reaction is carried out at pressures of 500 kPa to 14,000 kPa.
<img file="MX339639B_D0263.tif" />
285
IMPI
The hydrogen used in the hydrogenolysis reaction of the present invention can include external hydrogen, recycled hydrogen, hydrogen generated in situ, and any combination thereof. As used herein, the term "external hydrogen" refers to hydrogen that does not originate from the biomass reaction itself, but is added to the system from another source.
In some embodiments of the invention, it is desirable to convert the starting carbohydrates into a smaller molecule that will be easier to convert to the desired higher hydrocarbons. A convenient method for this conversion is through a hydrogenolysis reaction. Several processes are known to perform the hydrogenolysis of carbohydrates. An appropriate method includes contacting a carbohydrate with hydrogen or hydrogen mixed with a suitable gas and a hydrogenolysis catalyst in a hydrogenolysis reactor, under conditions sufficient to form a reaction product comprising smaller molecules or polyols. As used herein, the term "smaller molecules" or "polyols" includes any molecule that has a smaller molecular weight, which may include fewer carbon or oxygen atoms than carbohydrates.
<img file="MX339639B_D0264.tif" />
286
IMPI
INSTITUTO MtXICANt)
OF INDUSTRIAL PROPERTY IA starting carbon. In one embodiment, the reaction products are smaller molecules that include polyols and alcohols. A person with common knowledge in the field would be able to select the appropriate method to carry out the hydrogenolysis reaction.
In some embodiments, a 5- or 6-carbon sugar or sugar alcohol can be converted to propylene glycol, ethylene glycol, and glycerol with a hydrogenolysis catalyst. The hydrogenolysis catalyst can
<td>include</td><td>Cr,</td><td>Mo,</td><td>W, Re, Mn,</td><td>Cu, Cd, Fe, Co, Ni, Pt,</td><td>P.S,</td><td>Rh,</td>
<td>Ru, Go,</td><td>You</td><td>, AND</td><td>alloys</td><td>or any combination</td><td>of</td><td>the</td>
<td>themselves,</td><td>already</td><td>be</td><td colspan="2">alone or with promoters such as</td><td>Au,</td><td>Ag,</td>
<td>Cr, Zn,</td><td>Mn,</td><td>Sn,</td><td>Bi, B, 0 and</td><td colspan="3">alloys or any combination</td>
thereof. The hydrogenolysis catalyst may also include a transition metal carbonaceous pyropolymer catalyst (eg, chromium, molybdenum, tungsten, rhenium, manganese, copper, cadmium) or group VIII metals (eg, iron, cobalt, nickel , platinum, palladium, rhodium, ruthenium, iridium and osmium). In certain embodiments, the hydrogenolysis catalyst can include any of the above metals, combined with an alkaline earth metal oxide or adhered to a catalytically active support. In certain modalities, the
287
ΙΜΡΙ
<img file="MX339639B_D0265.tif" />
catalyst in the hydrogenolysis reaction
<img file="MX339639B_D0266.tif" />
catalyst support as described above for the hydrogenation reaction.
The conditions for carrying out the hydrogenolysis reaction may vary depending on the type of raw material and the desired products. One skilled in the art, with benefit of this disclosure, will recognize the appropriate conditions to use to carry out the reaction. In general, the hydrogenolysis reaction is carried out at temperatures from 110 ° C to 300 ° C, and preferably from 170 ° C to
220 ° C, and more preferably from 200 ° C to 225 ° C. In some embodiments, the hydrogenolysis reaction is performed under basic conditions, preferably at a pH of 8 to 13, and even more preferably at a pH of 10 to 12. In some embodiments, the condensation reaction is carried out at pressures. in a range between 60 KPa and 16500 KPa, and preferably in a range between 1700 KPa and 14000 KPa, and even more preferably between 4800 KPa and 11000 KPa.
The hydrogen used in the hydrogenolysis reaction of the present invention can include external hydrogen, recycled hydrogen, hydrogen generated in situ, and any combination thereof.
288
IMPI
MEXICAN INSTITUTE OF THE PROFIERA D INDUSTRIAL
<img file="MX339639B_D0267.tif" />
In some embodiments, the aforementioned reaction products can be converted to higher hydrocarbons through a condensation reaction in a condensation reactor. In such embodiments, condensation of the reaction products occurs in the presence of a catalyst capable of forming higher hydrocarbons. Although not intended to be limited by theory, it is believed that the production of higher hydrocarbons occurs through a stepwise addition reaction, which includes the formation of carbon-carbon bonds or carbon-oxygen bonds. The resulting reaction products include any number of compounds containing these residues, as described in more detail below.
In certain embodiments, suitable condensation catalysts include an acid catalyst, a basic catalyst, or an acid / basic catalyst. As used herein, the term "acid / basic catalyst" refers to a catalyst that has an acidic functionality and a base. In some embodiments, the condensation catalyst may include, but is not limited to, zeolites, carbides, nitrides, zirconia, alumina, silica, aluminosilicates, phosphates, oxides of titanium, oxides of
289
ΙΜΡΙ
MEXICAN INSTITUTE OF THE MllfWif ΑΓ IN »UST» IAl
<img file="MX339639B_D0268.tif" />
zinc, vanadium oxides, lanthanum oxides, yttrium oxides, scandium oxides, magnesium oxides, cerium oxides, baric oxides, calcium oxides, hydroxides, heteropoly acids, inorganic acids, modified acid resins, modified basic resins, and any Combination of these In some embodiments, the condensation catalyst may further include a modifier. Suitable modifiers include La, Y, Se, Ρ, B, Bi, Li, Na,
K, Rb, Cs, Mg, Ca, Sr, Ba, and any combination of these.
In some embodiments, the condensation catalyst may further include a metal. Suitable metals include
Cu, Ag, Au, Pt, Ni, Fe, Co, Ru, Zn, Cd, Ga, In, Rh, Pd, Go,
Re, Mn, Cr, Mo, W, Sn, Os, alloys, and any combination of these.
In certain embodiments, the catalyst described in the condensation reaction may include a catalyst support as described above for the hydrogenation reaction. In certain embodiments, the condensation catalyst is self-sufficient. As used herein, the term "self-sufficient" means that the catalyst does not need any other material to support it. In other embodiments, the condensation catalyst is used in conjunction with a separate support
<img file="MX339639B_D0269.tif" />
290
IMPI appropriate to suspend the rat.alizadnr. In one embodiment, the support for the condensation catalyst is silica.
The conditions under which the condensation reaction occurs can vary depending on the type of raw material and the desired products. One skilled in the art, with benefit of this disclosure, will recognize the appropriate conditions to use to carry out the reaction. In some embodiments, the condensation reaction is carried out at a temperature at which the thermodynamics of the proposed reaction is favorable. The temperature for the condensation reaction can vary depending on the specific starting polyol or alcohol. In some embodiments, the temperature of the condensation reaction is in a range from 80 ° C to 500 ° C, and preferably from
125 ° C to 450 ° C, and more preferably from 125 ° C to 250 ° C. In some embodiments, the condensation reaction is carried out at pressures in a range from 0 kPa to 9000 kPa, and preferably in a range from 0 kPa to 7000 KPa, and even more preferably from 0 kPa to 5000 KPa.
The higher alkanes formed by the invention include, but are not limited to, straight or branched chain alkanes having 4 to 30 carbon atoms, straight or branched chain alkenes having 4 to 30 carbon atoms.
291
IMPI
<img file="MX339639B_D0270.tif" />
carbon, cycloalkanes having 5 to 30 carbon atoms, cycloalkenes having 5 to 30 carbon atoms, aryls, fused aryl, alcohols, and ketones. Suitable allenes include, but are not limited to, butane, pentane, pentene, 2-methylbutane, hexane, hexene, 2-methylpentane, 3methylpentane, 2,2-dimethylbutane, 2,3-dimethylbutane, heptane, heptene, octane, octene, 2,2,4-trimethylpentane, 2,3-dimethyl hexane, 2,3,4-trimethylpentane, 2,3-dimethylpentane, nonane, niene, decane, decene, undecane, undecene, dodecane, dodecene, tridecane, tridecene, tetradecane , tetradecene, pentadecane, pentadecene, nonildecano, nonildecene, eicosano, eicoseno, uneicosan, uneicosen, doeicosan, doeicosen, trieicosan, trieicosen, tetraeicosan, tetraeicosen, and isomers thereof. Some of these products may be suitable for use as fuels.
In some embodiments, the cycloalkanes and cycloalkenes are unsubstituted. In other embodiments, the cycloalkanes and cycloalkenes are mono-substituted. In still other embodiments, the cycloalkanes and cycloalkenes are multi-substituted. In embodiments comprising substituted cycloalkanes and cycloalkenes, the substituted group includes, but is not limited to, a straight-chain or branched alkyl having 1 to 12 carbon atoms, an alkylene<sup>292</sup> IMPI ιη «γπτοτο m * icanc DE LA MOHEDA! · Straight or branched chain having 1 to 12 carbon atoms, a phenyl, and any combination of these. Cycloalkanes and cycloalkenes include, but are not limited to, cyclopentane, cyclopentene, cyclohexane, cyclohexene, methyl cyclopentane, methyl cyclopentene, ethyl cyclopentane, ethyl cyclopentene, ethyl cyclohexane, ethyl cyclohexene, isomers, and any combination of these.
In some embodiments, the formed arils are unsubstituted. In another embodiment, the arils formed are mono-substituted. In embodiments comprising substituted aryl, the substituted group includes, without limitation, a straight or branched chain alkyl having to 12 carbon atoms, a straight or branched chain alkylene having 1 to 12 carbon atoms, a phenyl, and any combination of these. Aryls suitable for the invention include, but are not limited to, benzene, toluene, xylene, ethyl benzene, for xylene, meta xylene, and any combination of these.
The alcohols produced in the invention have from 4 to carbon atoms. In some embodiments, alcohols are cyclic. In other embodiments, the alcohols are branched. In another embodiment, the alcohols are straight chain. Suitable alcohols for the invention include,
293
IMPI
<img file="MX339639B_D0271.tif" />
but not limited to, butanol, pentanol, hexanol, heptanol, octanol, nonanol, decanol, undecanol, dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol, heptildecanol, octildecanol, eildeanol, uneicosanol, doeicosanol, trieicos, these.
The ketones produced in the invention have from 4 to 30 carbon atoms. In one embodiment, ketones are cyclic. In another embodiment, ketones are branched.
In another embodiment, ketones are straight chain. Ketones suitable for the invention include, but are not limited to, butanone, pentanone, hexanone, heptanone, octanone, nonanone, decanone, undecanone, dodecanone, tridecanone, tetradecanone, pentadecanone, hexadecanone, heptildecanone, octildecanone, noniIdeeanone, eicosanone, , trieicosanone, tetraeicosanone, and their isomer.
Another such chemical modification is interesterification. Naturally produced glycerolipids do not have a uniform distribution of fatty acid constituents. In the context of oils, interesterification refers to the exchange of acyl radicals between two esters of different
<img file="MX339639B_D0272.tif" />
294
IMPI glycerolipids. The interesterification process provides a mechanism by which the fatty acid constituents of a glycerolipid mixture can be rearranged to modify the distribution pattern. Interesterification is a known chemical process, and generally involves heating (to about
200 ° C) of a mixture of oils for a period of time (eg, 30 minutes) in the presence of a catalyst, such as an alkali metal or alkylated alkali metal (eg, sodium methoxide). This process can be used to randomly select the distribution pattern of the fatty acid constituents of an oil mixture, or it can be directed to produce a desired distribution pattern. This chemical lipid modification method can be carried out on the materials provided herein, such as microbial biomass, with a lipid dry cell weight percentage of at least 20%.
Targeted interesterification, in which a specific distribution pattern of fatty acids is sought, can be performed by maintaining the oil mixture at a temperature below the melting point of some TAGs that could be obtained. This results in the selective crystallization of these TAGs, which eliminates them
295
IMPI <sup>, NST</sup>FTI'TO MEXICANO OE LA RRORIEDAD INDUSTWal
<img file="MX339639B_D0273.tif" />
efficiently from the reaction mixture where they crystallize. The process can continue until most of the fatty acids in the oil have precipitated, for example. A targeted interesterification process can be used, for example, to produce a product with a lower caloric content through the replacement of long chain fatty acids with their shorter chain counterparts. Targeted interesterification can also be used to produce a product with a mixture of fats that can provide the desired melting characteristics and structural features sought in food additives or products (eg, margarine) without resorting to hydrogenation, which It can produce unwanted trans isomers.
The interesterification of oils produced by the methods described in the present disclosure can be carried out in conjunction with one or more of the methods and materials, or to produce products, as reported in the following: US Patent Nos. 6,080,853 (Nondigestible Fat Substitutes); 4,288,378 (Peanut Butter Stabilizer); 5,391,383 (Edible atomized oil); 6,022,577 (Edible fats for food products); 5,434,278 (Edible fats
296
IMPI
MEXICAN INSTITUTE UB LA PROPIEDAD INDUSTRIAL
<img file="MX339639B_D0274.tif" />
for food products); 5,268,192 (Low Calorie Nut Products); 5,258,197 (low calorie edible compositions); 4,335,156 (Edible fat products);
7,288,278 (Food or drug additives) 7,115,760 (Fractionation process); 6,808,737 (structural fats); 5,888,947 (Engine lubricants); 5,686,131 (Edible Oil Blends); and 4,603,188 (Curable urethane compositions).
In an embodiment in accordance with the invention, the transesterification of the oil, as described above, is followed by the reaction of the transesterified product with polyol, as disclosed in US Patent No. 6,465,642, to produce the fatty acid polyester polyol. This process of esterification and separation can comprise the following steps d:
reacting a lower alkyl ester with the polyol in the presence of soap; remove soap residue from product mix; wash with water and dry the product mix to remove impurities; bleach the product mix for refining; separating at least a portion of the unreacted lower alkyl ester from the fatty acid polyester polyol in the product mixture; and recycling the unreacted lower alkyl ester separately.
297
IMPI
<img file="MX339639B_D0275.tif" />
Transesterification can also be performed on the microbial biomass with short chain fatty acid esters, as reported in the US patent.
6,278,006. In general, transesterification can be carried out by adding a short chain fatty acid ester to an oil in the presence of a suitable catalyst and heating the mixture. In some embodiments, the oil comprises from about 5% to about 90% of the reaction mixture by weight. In some embodiments, the short chain fatty acid esters can make up about 10% to 50% of the reaction mixture by weight. Non-limiting examples of catalysts include basic catalysts, sodium methoxide, acidic catalysts, including inorganic acids such as sulfuric acid and acidified clays, organic acids such as methane sulfonic acid, benzenesulfonic acid and toluenesulfonic acid, and acidic resins, such as Amberlyst 15 .
Metals like sodium and magnesium, and metal hydrides are also useful catalysts.
Another such chemical modification is hydroxylation, which involves the addition of water to a double bond which results in saturation and incorporation of a hydroxyl radical. The hydroxylation process provides
298
IMPI • NSTtTinr, MEXICANO
OE IA BROBUDAn.
'NOI ISTUIAL S?
<img file="MX339639B_D0276.tif" />
a mechanism for the conversion of one or more tuteners of fatty acids from a glycerolipid to a hydroxyl fatty acid. Hydroxylation can be carried out, for example, by the method reported in US Patent No. 5,576,027. Hydroxylated fatty acids, including castor oil and its derivatives, are useful as components in various industrial applications, including food additives, pigments, wetting agents, defoaming agents, waterproofing additives, plasticizing agents, cosmetic emulsifiers and / or deodorant agents, as well as in electronics, pharmaceuticals, adhesive ink paints, and lubricants. An example of how a glyceride can be hydroxylated is as follows: the fat can be heated, preferably to approximately
30-50 ° C combined with heptane and held at temperature for thirty minutes or more; then acetic acid can be added to the mixture followed by an aqueous solution of sulfuric acid followed by an aqueous solution of hydrogen peroxide which is added in small increments to the mixture for one hour; after aqueous hydrogen peroxide, the temperature can increase to at least about 60 ° C and stir for at least six hours;
299 after stirring the mixture is allowed to stand and a lower aqueous layer formed by the reaction can be removed while the upper layer of heptane formed by the reaction can be washed with hot water at a temperature of about 60 ° C, the heptane layer washed it can be neutralized with an aqueous solution of potassium hydroxide at a pH of about 5 to 7 and then it is removed by vacuum distillation; The reaction product can be vacuum dried at 100 ° C and the dry product is steam deodorized under vacuum conditions and filtered at approximately 50 ° C.
60 ° C using diatomaceous earth.
Hydroxylation of microbial oils produced by the methods described in the present description can be carried out in conjunction with one or more of the methods and / or materials, or to produce products, as reported in the following: US patents United Nos.
6,590,113 (Oil-based coatings and inks);
4,049,724 (Hydroxylation processes); 6,113,971 (olive oil butter); 4,992,189 (Lubricants and lubricant additives); 5,576,027 (Hydroxylated milk); and 6,869,597 (cosmetics).
Hydroxylated glycerolipids can be converted to stolides. Stolides consist of a glycerolipid in the
300
IΜ Ρ ί
MÜX1CANO INSTITUTE
FROM THE RROTFDAI V «^ SSLJ®
INDUSTRIAL as a hydroxylated fatty acid constituent has been esterified to another fatty acid molecule. The conversion of hydroxylated glycerolipids to stolides can be carried out by heating a mixture of glycerolipids and fatty acids, and contacting the mixture with a mineral acid, as described by Isbell et al., JAOCS 71 (2): 169 -174 (1994). Stolides are useful in a variety of applications, including without limitation those reported in the following: US Patent Nos. 7,196,124 (Elastomeric materials and floor covering); 5,458,795 (thickened oils for high temperature applications); 5,451,332 (Fluids for industrial applications); 5,427,704 (Fuel additives); and 5,380,894 (Lubricants, greases, plasticizers, and printing inks).
Another such chemical modification is olefin metathesis. In olefin metathesis, a catalyst cuts the alkylidene carbons into an alkene (olefin) and forms new alkenes by pairing each of them with different alkylidene carbons. The olefin metathesis reaction provides a mechanism for processes such as truncating alkyl chains of unsaturated fatty acids to alkenes by ethenolysis, crosslinking of fatty acids to
301
IMPI
<img file="MX339639B_D0277.tif" />
through alkene bonds by auto-metathesis, and incorporation of new groups in fatty acids by inter-metathesis with derivatized alkenes.
In conjunction with other reactions, such as transesterification and hydrogenation, olefin metathesis can transform unsaturated glycerolipids into various end products. These products include glycerolipid oligomers for waxes, - short-chain glycerolipids for lubricants; bifunctional alkyl homo and hetero chains for chemicals and polymers; short chain esters for biofuel; and short-chain hydrocarbons for reactor fuel. Olefin metathesis can be carried out on derivatives of triacylglycerols and fatty acids, for example, using catalysts and methods that were reported in US Patent No. 7,119,216, US Patent Publication No. 2010/0160506, and United States Patent Publication No. 2010/0145086.
Bio-oil olefin metathesis generally comprises adding a Ru catalyst solution at a load of about 10 to 250 ppm under inert conditions to unsaturated fatty acid esters in the presence (intermetathesis) or absence (auto-metathesis) of other alkenes.
Reactions are typically allowed to proceed for hours.
<img file="MX339639B_D0278.tif" />
302 days and ultimately yield a distribution of alkene products. An example of how olefin metathesis can be carried out in a fatty acid derivative is as follows: A solution of the first generation Grubbs catalyst (dichloro [2 (1-methylethox-aO) phenyl] methyleneα-C] (tricycloheil -phosphamine) in toluene at a catalyst charge of 222 ppm can be added to a container containing degassed and dry methyl oleate. The container can then be pressurized with approximately 60 psig of ethylene gas and maintained at or below approximately 30 ° C for 3 hours, so that approximately 50% yield of methyl 9-decenoate can be produced.
The olefinic metathesis of product oils by the methods described herein can be performed in conjunction with one or more of the methods and / or materials, or to produce products, as reported in the following documents: sol. Patent Patent PCT / US07 / 081427 (α-olefin fatty acids) and sol. of United States Patent Nos. 12 / 281,938 (petroleum creams), 12 / 281,931 (paintball gun capsules), 12 / 653,742 (plasticizers and lubricants), 12 / 422,096 (bifunctional organic compounds), and 11 / 795,052 (candle wax).
303
IMPí mlxicaw institute
DE AI RRORIDad industrial
<img file="MX339639B_D0279.tif" />
Other chemical reactions that can be performed on microbial oils include reacting triglycerides with a cyclopropane agent to increase fluidity and / or oxidative stability, as disclosed in US Patents 6,051,539 (manufacture of waxes from triacylglycerols) , 6,770,104 (epoxidation of triacylglycerols), as disclosed in The effect of fatty acid composition on the acrylation kinetics of epoxidized triacylglycerols, Journal of the American Oil
Chemists' Society, 79: 1, 59-63, (2001) and in Free Radical
Biology and Medicine, 37: 1, 104-114 (2004).
The generation of oil-bearing microbial biomass for fuels and chemicals as described above, results in the production of delipidated biomass flour. Delipidized flour is a by-product of algae oil preparation and is useful for animal feed for farm animals, eg ruminants, poultry, pigs and for aquaculture. The resulting flour, although the oil content is low, still contains high-quality protein, carbohydrates, fiber, ash, oil residues and other nutrients suitable for animal feed. Because cells are predominantly lysed by the process of separating the
304
IMPI
INSTITUT # MUICANO ΠΕ LA Μ · Ηί · ΛΓ> INDUSTRIAL
<img file="MX339639B_D0280.tif" />
oils, delipid flour is easily digestible by these animals. The delipidized flour can optionally be combined with other ingredients, such as grains, in an animal feed. Because delipid flour has a powder consistency, it can be compressed into granules using an extruder or extender or other type of machine, which are commercially available.
The invention, which is described in detail above, is exemplified in the following examples, which are offered to illustrate but not to limit the claimed invention.
VII. EXAMPLES
EXAMPLE 1: Methods for growing Prototheca
The Prototheca strains were cultivated to achieve a high percentage of oil per dry weight of cells. Cryopreserved cells were thawed at room temperature and 500 µΐ of cells were added to 4.5 ml of medium (4.2 g / 1 K<sub>2</sub>HPO<sub>4</sub>, 3.1 g / 1 NaH<sub>2</sub>PO<sub>4</sub>0.24 g / 1 MgSO<sub>4</sub> · 7H<sub>2</sub>Or, 0.25 g / 1 citric acid monohydrate, 0.025 g / 1 of
CaCl<sub>2</sub> 2H<sub>2</sub>Or, 2 g / 1 of yeast extract) plus 2% glucose and grown for 7 days at 28 ° C with shaking (200 rpm) in a 6-well plate. The dry weight of the cells is
<img file="MX339639B_D0281.tif" />
305
IMPIAS determined by centrifuging 1 ml of culture at 14,000 rpm for 5 min in a pre-weighed Eppendorf tube. The culture supernatant was discarded and the resulting cell pellet was washed with 1 ml of deionized water. The culture was centrifuged again, the supernatant was discarded, and the cell pellet was placed at -80 ° C until frozen. The samples were then lyophilized for 24 hours and the dry weight of the cells was calculated. For the determination of total lipids in the cultures, 3 ml of culture were withdrawn and subjected to analysis using a system of
Ankom (Ankom Inc., Macedonian, NY), according to the manufacturer's protocol. The samples were subjected to solvent extraction with an Amkom XT10 extractor according to the manufacturer's protocol. Total lipids were determined as the difference in mass between the acid hydrolyzed dry samples and the solvent extracted dry samples. Measurements of the oil percentage of the dry weight of the cells are shown in Table 10.
Table 10. Percentage of oil per dry weight of the cell
<td>Species</td><td>Strain</td><td>% Oil</td>
<td>Prototheca stagnora</td><td>UTEX 327</td><td> 13.14</td>
<td>Prototheca moriformis</td><td>UTEX 1441</td><td> 18.02</td>
306
IMPí
M tXICANL INSTITUTE
OF THE INDUSTRIAL RROMFOAD
<img file="MX339639B_D0282.tif" />
<td>Prototheca moriformis</td><td>UTEX 1435</td><td> 27.17</td>
Microalgae samples from multiple strains of the genus Prototheca were genotyped. Genomic DNA was isolated from the algal biomass as follows. Liquid culture cells (approximately 200 mg) were centrifuged 5 min to resuspended then centrifuged 5 min to
<td> 14,000</td><td>x g. The</td><td>cells</td><td>I know</td>
<td>Water</td><td>distilled</td><td>sterile,</td><td>I know</td>
<td> 14,000</td><td>xg and se</td><td>scrapped</td><td>the</td>
supernatant. A single glass bead of ~ 2mm diameter was added to the biomass and the tubes were placed at -80 ° C for at least 15 minutes. Samples were removed and 150 μΐ of milling buffer (Sarkosil 1%, 0.25 M sucrose, 50 mM NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH, added.
8.0, RNase A 0.5 pg / μΐ). The pellets were resuspended with brief agitation, followed by the addition of 40 µΐ of
5M NaCl. The samples were shaken briefly, followed by the addition of 66 µΐ of 5% CTAB (cetyl trimethylammonium bromide) and a final brief shake. The samples were then incubated at 65 ° C for 10 minutes after which they were centrifuged at 14,000 xg for 10 minutes. The supernatant was transferred to a new tube and extracted once with 300 μΐ of phenol: chloroform: isoamyl alcohol at 12: 12: 1, followed by
<img file="MX339639B_D0283.tif" />
307
IMPI ustituto MEXICANO be la moni »* ·
INDUSTRIAL centrifugation for 5 minutes at 14,000 x g. The resulting aqueous phase was transferred to a fresh tube containing 0.7 vol of isopropanol (~ 190 pl), mixed by inversion, and incubated at room temperature for 30 minutes or overnight at 4 ° C. DNA was recovered through centrifugation at 14,000 xg for 10 minutes. The resulting precipitate was washed twice with 70% ethanol, followed by a final wash with 100% ethanol. The pellets were air dried for 20-30 minutes at room temperature, followed by resuspension in 50 µl of 10 mM TrisCl, 1 mM EDTA (pH 8.0).
Five μΐ of the total algae DNA, prepared as described above, was diluted 1:50 in 10 mM Tris, pH
8.0. PCR reactions, the final volume of 20 µΐ, were set as follows. Ten µΐ of iProof HF 2x Master Mix (BIO-RAD) was added to 0.4 µΐ of primer
SZ02613 (5'-TGTTGAAGAATGAGCCGGCGAC-3 '' (sec. With ID #: 9) at a standard concentration of 10mM). This primer sequence runs from position 567-588 at no.
Gen Bank access code L43357 and is highly conserved in the genomes of higher plants and algae plastids. This was followed by the addition of 0.4 μΐ of primer SZ02615 (5'CAGTGAGCTATTACGCACTC-3 '(sec. With ID #: 10) to the
<img file="MX339639B_D0284.tif" />
308 IMPI
JσΟ MEXICAN INDUSTRIAL EROMEDAD standard concentration of 10 mM). This primer sequence is complementary to position 1112-1093 at no. Gen Bank access code L43357 and is highly conserved in the genomes of higher plants and algae plastids. Next, 5 µΐ of the diluted total DNA and 3.2 µΐ dH were added<sub>2</sub>O. The PCR reactions were carried out as follows:
98 ° C, 45``, 98 ° C, 8 '', 53 ° C, 12``, 72 ° C, 20 '' for 35 cycles followed by 72 ° C for 1 min and held at 25 ° C. For purification of the PCR products, 20 µΐ of 10 mM Tris, pH 8.0 was added to each reaction, followed by extraction with 40 µΐ of phenol: chloroform: isoamyl alcohol
12:12: 1, shaking and centrifugation at 14,000 xg for minutes. The PCR reactions were applied to S400 columns (GE Healthcare) and centrifuged for 2 minutes at
3,000 x g. Subsequently purified PCR products were cloned into TOPO in the PCR8 / GW / TOPO and positive clones were selected on LB / Spec plates. The purified plasmid DNA was sequenced in both directions using forward and reverse M13 primers. In total, twelve strains of
Prototheca were selected to have their 23S rRNA DNA sequenced and the sequences are listed in the sequence listing. A summary of strains and sequence listing numbers are included below. The sequences are
<img file="MX339639B_D0285.tif" />
309 analyzed for general divergence to go-go <sup>one to</sup> UTEX 1435 sequence (section with ID number: 15).
Two pairs emerged (UTEX 329 / UTEX 1533 and UTEX 329 / UTEX 1440) as the maximum divergence pairs. In both cases, pairwise alignment resulted in 75.0% pairwise sequence identity. The percentage of sequence identity with UTEX 1435 was also included below:
Species Strain sec. with no. of ident.
nt identity
Prototheca kruegani with no. ident .: 11
UTEX 329
75.2
Prototheca wickerhamii UTEX 1440 sec. with no. ident .: 12
Prototheca stagnora with no. ident .: 13
Prototheca moriformis with no. ident .: 14
UTEX 1442
UTEX 288
75.7
75.4
Prototheca moriformis UTEX 1439; 1441; 100 with no. ident .: 15 sec
1435; 1437
Prototheca wikerhamii UTEX 1533
99.8 sec. with no. ident .: 16
310
ΙΜΡΙ PMMtDA muican iNSTmrro »inbusvmai
<img file="MX339639B_D0286.tif" />
<td>Prototheca</td><td>moriformis</td><td>UTEX</td><td> 1434</td><td> 75.9</td><td>sec.</td><td>with</td>
<td>no. ident</td><td> . : 17</td><td></td><td></td><td></td><td></td><td></td>
<td>Prototheca</td><td>zopfii</td><td>UTEX</td><td> 1438</td><td> 75.7</td><td>sec.</td><td>with</td>
<td>no. ident</td><td> . : 18</td><td></td><td></td><td></td><td></td><td></td>
<td>Prototheca</td><td>moriformis</td><td>UTEX</td><td> 1436</td><td> 88.9</td><td>sec.</td><td>with</td>
no. ident .: 19 [0027] Lipid samples from a subset of the strains listed above were analyzed for lipid profile using HPLC. The results are shown below in Table 11.
Table 11. Diversity of lipid chains in Prototheca species
<td>Strain</td><td>C14: 0</td><td>C16: 0</td><td>C16: l</td><td>C18: 0</td><td>C18: l</td><td>C18: 2</td><td>C18: 3</td><td>C20: 0</td><td>C20: l</td>
<td>UTEX 327</td><td> 0</td><td> 12.01</td><td> 0</td><td> 0</td><td> 50.33</td><td> 17.14</td><td> 0</td><td> 0</td><td> 0</td>
<td>UTEX 1441</td><td> 1.41</td><td> 29.44</td><td> 0.70</td><td> 3.05</td><td> 57.72</td><td> 12.37</td><td> 0.97</td><td> 0.33</td><td> 0</td>
<td>UTEX 1435</td><td> 1.09</td><td> 25.77</td><td> 0</td><td> 2.75</td><td> 54.01</td><td> 11.90</td><td> 2.44</td><td> 0</td><td> 0</td>
Oil extracted from Prototheca moriformis UTEX 1435 (via solvent extraction or using an expeller press was analyzed for carotenoids, chlorophyll,
<img file="MX339639B_D0287.tif" />
311
IMPI
INSTITUTO MEJICAN '
FROM LA rROFUDAI INDUSTRIAL tocopherols, other sterols and tocotrienols. The results are summarized below in Table 12.
Table 12. Analysis of carotenoid, chlorophyll, tocopherol / sterols and tocotrienol in the oil extracted from
Prototheca moriformis (UTEX 1435).
<td></td><td>Oil</td><td>Oil</td>
<td></td><td>pressing</td><td>extracted from</td>
<td></td><td>(mcg / ml)</td><td>solvent</td>
<td></td><td></td><td>(mcg / ml)</td>
<td>cis-Lutein</td><td> 0.041</td><td> 0.042</td>
<td>trans-Lutein</td><td> 0.140</td><td> 0.112</td>
<td>trans-</td><td> 0.045</td><td> 0.039</td>
<td>Zeaxanthin</td><td></td><td></td>
<td>cis-Zeaxanthin</td><td> 0.007</td><td> 0.013</td>
<td>t-alpha-</td><td> 0.007</td><td> 0.010</td>
<td>Crytoxanthin</td><td></td><td></td>
<td>t-beta-</td><td> 0.009</td><td> 0.010</td>
<td>Crytoxanthin</td><td></td><td></td>
<td>t-alpha-carotene</td><td> 0.003</td><td> 0.001</td>
<td>c-alpha-Carotene</td><td>none</td><td>none</td>
<td></td><td>detected</td><td>detected</td>
<td>t-beta-Carotene</td><td> 0.010</td><td> 0.009</td>
<td>9-cis-beta-</td><td> 0.004</td><td> 0.002</td>
<td>Carotene</td><td></td><td></td>
<td>Lycopene</td><td>none</td><td>none</td>
312
<td></td><td>detected</td><td>detected</td>
<td>Total of Carotenoids</td><td> 0.267</td><td> 0.238</td>
<td>Chlorophyll</td><td><0.01 mg / kg</td><td><0.01 mg / kg</td>
<td colspan="3">Tocopherols and Sterols</td>
<td></td><td>Oil</td><td>Oil</td>
<td></td><td>pressing</td><td>extracted from</td>
<td></td><td>(mg / lOOg)</td><td>solvent (mg / lOOg)</td>
<td>gamma Tocopherol</td><td> 0.49</td><td> 0.49</td>
<td>Campesterol</td><td> 6.09</td><td> 6.05</td>
<td>Stigmasterol</td><td> 47.6</td><td> 47.8</td>
<td>Beta-sitosterol</td><td> 11.6</td><td> 11.5</td>
<td>Others sterless</td><td> 445</td><td> 446</td>
<td colspan="2">Tocotrienols</td><td></td>
<td></td><td>Oil</td><td>Oil</td>
<td></td><td>pressing</td><td>taken from</td>
<td></td><td>(mg / g)</td><td>solvent (mg / g)</td>
<td>alpha Tocotrienol</td><td> 0.26</td><td> 0.26</td>
<td>beta Tocotrienol</td><td> < 0.01</td><td> < 0.01</td>
<td>gamma Tocotrienol</td><td> 0.10</td><td> 0.10</td>
MEXICAN INSTITUTE • E LA PROFIEOAD industrial
<img file="MX339639B_D0288.tif" />
313
IMPÍS-MEXICAN INSTITUTE BE IA BRORIEDAO INDUSTRIAL
<td>such Tocotrienol</td><td> < 0.01</td><td> < 0.01</td>
<td>Total of</td><td> 0.36</td><td> 0.36</td>
<td>Tocotrienols</td><td></td><td></td>
Oil extracted from Prototheca moriformis, from four separate batches, was refined and bleached using standard vegetable oil processing methods. In summary, the crude oil extracted from Prototheca moriformis was clarified in a horizontal decanter, where the solids were separated from the oil. The rinsed oil was then transferred to a tank with citric acid and water and allowed to settle for approximately 24 hours. After 24 hours, the mixture in the tank formed 2 separate layers. The bottom layer was composed of water and gums which were then decanted off before transferring the de-gummed oil into the bleach tank. The oil was then heated together with another dose of citric acid. The bleaching clay was then added to the bleaching tank and the mixture was further heated under vacuum in order to evaporate any water that was present. The mixture was then pumped through a leaf filter in order to remove the bleaching clay. The filtered oil was then passed through a
<img file="MX339639B_D0289.tif" />
314
IMPI
MEXICAN INSTITUTE
OF LA FROFKDAO
INDUSTRIAL polishing filter final 5pm and then collected for storage until use. The refined and bleached oil (RB) was then analyzed for carotenoids, chlorophyll, sterols, tocotrienols, and tocopherols. The results of these analyzes are summarized in Table 13 below. Nd denotes none detected and the detection sensitivity is listed below:
Detection sensitivity
Carotenoids (mcg / g) nd = <0.003 mcg / g Chlorophyll (mcg / g) nd = <0.03 mcg / g
Sterol (%) nd = 0.25%
Tocopherols (mcg / g); na = 3 mcg / g
Table 13. Analysis of carotenoids, chlorophyll, sterols, tocotrienols and tocopherol from oil of Prototheca moriformis refined and bleached
<td></td><td>Lot Ά</td><td>Lot B</td><td>Lot C</td><td>Lot D</td>
<td colspan="5">Carotenoids (mcg / g)</td>
<td>Lutein</td><td> 0.025</td><td> 0.003</td><td>ND</td><td> 0.039</td>
<td>Zeaxanthin</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>cis-</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
315
<img file="MX339639B_D0290.tif" />
IMPI
MEXICAN INSTITUTE Dt LA RROMÍDAL) INDUSTRIAL
<td>lutein / zeaxanthin</td><td></td><td></td><td></td><td></td>
<td>trans-alpha-</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>cryptoxanthin</td><td></td><td></td><td></td><td></td>
<td>trans-beta-</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>cryptoxanthin</td><td></td><td></td><td></td><td></td>
<td>trans-alpha-</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>carotene</td><td></td><td></td><td></td><td></td>
<td>cis-alpha-carotene</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>trans-beta-</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>carotene</td><td></td><td></td><td></td><td></td>
<td>cis-beta-carotene</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Lycopene</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Unidentified</td><td> 0.219</td><td> 0.066</td><td> 0.050</td><td> 0.026</td>
<td>Total of</td><td> 0.244</td><td> 0.069</td><td> 0.050</td><td> 0.065</td>
<td>Carotenoids</td><td></td><td></td><td></td><td></td>
<td colspan="5">Chlorophyll (mcg / g)</td>
<td>Chlorophyll A</td><td> 0.268</td><td> 0.136</td><td> 0.045</td><td> 0.166</td>
<td>Chlorophyll B</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Total Chlorophyll</td><td> 0.268</td><td> 0.136</td><td> 0.045</td><td> 0.166</td>
<td colspan="5">Sterols (%)</td>
<td>Brassicasterol</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Campesterol</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Stigmasterol</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Beta-sitosterol</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>Total Sterols</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td colspan="5">Tocopherols (mcg / g)</td>
<img file="MX339639B_D0291.tif" />
316
IMPI
MEXICAN INSTITUTE OF LA RROHÍDAL 'INDUSTRIAL
<td>alpha-tocopherol</td><td> 23.9</td><td> 22.8</td><td> 12.5</td><td>, „G.,. S</td>
<td>beta-tocopherol</td><td> 3.72</td><td>ND</td><td>ND</td><td>ND</td>
<td>gamma-tocopherus1</td><td> 164</td><td> 85.3</td><td> 43.1</td><td> 38.3</td>
<td>delta-tocopherol</td><td> 70.1</td><td> 31.1</td><td> 18.1</td><td> 14.3</td>
<td>Tocopherols</td><td> 262</td><td> 139.2</td><td> 73.7</td><td> 60.8</td>
<td>Totals</td><td></td><td></td><td></td><td></td>
<td colspan="5">Tocotrienols (mcg / g)</td>
<td>alpha-Tocotrienol</td><td> 190</td><td> 225</td><td> 253</td><td> 239</td>
<td>beta-tocotrienol</td><td>ND</td><td>ND</td><td>ND</td><td>ND</td>
<td>gamma-tocotrienol</td><td> 47.3</td><td> 60.4</td><td> 54.8</td><td> 60.9</td>
<td>delta-Tocotrienol</td><td> 12.3</td><td> 16.1</td><td> 17.5</td><td> 15.2</td>
<td>Total of</td><td> 250</td><td> 302</td><td> 325</td><td> 315</td>
<td>Tocotrienols</td><td></td><td></td><td></td><td></td>
The same four oil batches of Prototheca moriformis were further analyzed for trace elements and the results are summarized below in Table 14.
Table 14. Elemental analysis of refined and bleached oil of Prototheca moriformis.
<td></td><td>Lot A</td><td>Lot B</td><td>Lot C</td><td>Lot D</td>
<td colspan="5">Elemental Analysis (ppm)</td>
<td>Calcium</td><td> 0.08</td><td> 0.07</td><td> < 0.04</td><td> 0.07</td>
<td>Match</td><td> < 0.2</td><td> 0.38</td><td> < 0.2</td><td> 0.33</td>
<td>Sodium</td><td> < 0.5</td><td> 0.55</td><td> < 0.5</td><td> < 0.5</td>
<td>Potassium</td><td> 1.02</td><td> 1.68</td><td> < 0.5</td><td> 0.94</td>
317
<img file="MX339639B_D0292.tif" />
<td rowspan="2">Magnesium</td><td rowspan="2"> < 0.04</td><td rowspan="2"> < 0.04</td><td> < 0.04</td><td> 0.07</td>
<td></td><td></td>
<td>Manganese</td><td> < 0.05</td><td> <0.05</td><td> < 0.05</td><td> < 0.05</td>
<td>Iron</td><td> < 0.02</td><td> <0.02</td><td> <0.02</td><td> <0.02</td>
<td>Zinc</td><td> < 0.02</td><td> < 0.02</td><td> < 0.02</td><td> < 0.02</td>
<td>Copper</td><td> < 0.05</td><td> < 0.05</td><td> < 0.05</td><td> < 0.05</td>
<td>Sulfur</td><td> 2.55</td><td> 4.45</td><td> 2.36</td><td> 4.55</td>
<td>Lead</td><td> < 0.2</td><td> < 0.2</td><td> < 0.2</td><td> < 0.2</td>
<td>Silicon</td><td> 0.37</td><td> 0.41</td><td> 0.26</td><td> 0.26</td>
<td>Nickel</td><td> < 0.2</td><td> < 0.2</td><td> < 0.2</td><td> < 0.2</td>
<td>Organic chloride</td><td> < 1.0</td><td> < 1.0</td><td> < 1.0</td><td> 2.2</td>
<td>Inorganic chloride</td><td> < 1.0</td><td> < 1.0</td><td> < 1.0</td><td> < 1.0</td>
<td>Nitrogen</td><td> 4.4</td><td> 7.8</td><td> 4.2</td><td> 6.9</td>
<td>Lithium</td><td> < 0.02</td><td> <0.02</td><td> <0.02</td><td> < 0.02</td>
<td>Boron</td><td> 0.07</td><td> 0.36</td><td> 0.09</td><td> 0.38</td>
<td>Aluminum</td><td> —</td><td> < 0.2</td><td> < 0.2</td><td> < 0.2</td>
<td>Vanadium</td><td> < 0.05</td><td> < 0.05</td><td> <0.05</td><td> < 0.05</td>
<td></td><td></td><td></td><td></td><td></td>
<td colspan="5">Lovibond Color (° L)</td>
<td>Red</td><td> 5.0</td><td> 4.3</td><td> 3.2</td><td> 5.0</td>
<td>Yellow</td><td> 70.0</td><td> 70.0</td><td> 50.0</td><td> 70.0</td>
<td></td><td></td><td></td><td></td><td></td>
<td colspan="5">Mono & Diglycerides by HPLC (%)</td>
<td>Diglycerides</td><td> 1.68</td><td> 2.23</td><td> 1.25</td><td> 1.61</td>
<td>Monoglycerides</td><td> 0.03</td><td> 0.04</td><td> 0.02</td><td> 0.03</td>
<td>Fatty acids</td><td> 1.02</td><td> 1.72</td><td> 0.86</td><td> 0.83</td>
<td>free (FFA)</td><td></td><td></td><td></td><td></td>
318
ΙΜΡΙΟ «
MEXICAN INSTITUTE te-HenM de ia nonnun
INDUSTRIAL Xa »
<td>Soaps</td><td> 0</td><td> 0</td><td> 0</td><td></td>
<td></td><td></td><td></td><td></td><td></td>
<td colspan="5">Oxidized and Polymerized Triglycerides</td>
<td>Triglycerides Oxidized (%)</td><td> 3.41</td><td> 2.41</td><td> 4.11</td><td> 1.00</td>
<td>Triglycerides Polymerized (%)</td><td> 1.19</td><td> 0.45</td><td> 0.66</td><td> 0.31</td>
<td>Peroxide value (meg / kg)</td><td> 0.75</td><td> 0.80</td><td> 0.60</td><td> 1.20</td>
<td>P-value Anisidine (dimensionless)</td><td> 5.03</td><td> 9.03</td><td> 5.44</td><td> 20.1</td>
<td colspan="3">Water and other impurities</td><td colspan="2"> %)</td>
<td>Karl Fisher Humidity</td><td> 0.8</td><td> 0.12</td><td> 0.07</td><td> 0.18</td>
<td>Polar compounds totals</td><td> 5.02</td><td> 6.28</td><td> 4.54</td><td> 5.23</td>
<td>No matter saponifiable</td><td> 0.92</td><td> 1.07</td><td> 0.72</td><td> 1.04</td>
<td>Impurities insoluble</td><td> < 0.01</td><td> < 0.01</td><td> 0.01</td><td> < 0.01</td>
<td colspan="5">Total Oil (%)</td>
<td>Neutral oil</td><td> 98.8</td><td> 98.2</td><td> 99.0</td><td> 98.9</td>
319
<img file="MX339639B_D0293.tif" />
IMPI
MEXlCAN INSTITUTE »
DE IA «ORIEDAI INDUSTRIAL
EXAMPLE 2: General methods for Prototheca biolistic transformation
Seashell Gold 550 nanometer microcarriers were prepared according to the manufacturer's protocol. The plasmid (20 µ5) was mixed with 50 µΐ of the binding buffer and 6.0 µΐ (30 mg) of the S550d gold carriers and incubated on ice for 1 min. The precipitation buffer (100 µΐ) was added, and the mixture was incubated on ice for 1 min. After stirring, the particles of
Coated DNA was pelleted by rotation at 10,000 rpm in an Eppendorf 5415C microcentrifuge for 10 seconds. The gold precipitate was washed once with 500 µΐ of 100% cold ethanol, pelleted in the microcentrifuge by brief rotation, and resuspended with 50 µΐ of ice-cold ethanol. After a brief (1-2 sec) sonication, 10 µΐ of coated DNA particles were immediately transferred to the carrier membrane.
The Prototheca strains were grown in protease medium (2g / l yeast extract, 2.94mM NaNO3, 0.17mM
CaC12 * 2H2O, 0.3mM MgSO4 »7H2O, 0.4mM K2HPO4, 1.28mM
KH2PO4, 0.43mM NaCI) with 2% glucose on a rotary shaker until a cell density of 2x10 is reached<sup>6</sup>cells / ml. Cells were harvested, washed one
<img file="MX339639B_D0294.tif" />
320 ΙΜΡΙ
MEXICAN INSTITUTE
FROM THE FKONKIMD industrial once with sterile distilled water, and resuspended in 50 μΐ of the medium. 1 x 10<sup>7</sup> cells were dispersed in the third center of a plate of non-selective protease medium. Cells were bombarded with the PDS-1000 / He Biolistic Particle Delivery System (Bio-Rad). The rupture discs (1350 psi) were used and the plates were placed 6 cm below the sieve / macro-transporter assembly. Cells were allowed to recover at 25 ° C for 12-24 h. After recovery, cells were scraped from the plates with a rubber spatula, mixed with 100 µΐ of medium, and dispersed on the plates containing the appropriate antibiotic selection. After 7-10 days incubation at ° C, colonies representing transformed cells were visible on the plates. Colonies were harvested and stained on selective agar plates (antibiotic or carbon source) for a second round of selection.
EXAMPLE 3: Chlorella transformation
Vector Construction
A BamHI-SacII fragment containing the CMV promoter, a hygromycin resistance cDNA, and a 3 'UTR CMV (seq. With ID no .: 152, a subsequence of vector pCAMBIA1380, Cambia, Canberra, Australia) is cloned in
321 BamHI and SacII sites of pBluescript present description as pHyg.
Chlorella Biolistic Transformation
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0295.tif" />
and is referred to in the [0028] Seashell S550d Gold Bearers
Technology were prepared according to the manufacturer's protocol. The linearized pHyg plasmid (20 pg) was mixed with 50 µΐ of binding buffer and 60 µΐ (30 mg) of the S550d gold carriers and incubated on ice for 1 min. The precipitation buffer (100 µΐ) was added, and the mixture was incubated on ice for 1 min. After stirring, the coated DNA particles were pelleted by rotation to
10,000 rpm in an Eppendorf 5415C microcentrifuge for 10 seconds. The gold precipitate was washed once with 500 µΐ of 100% cold ethanol, pelleted by brief rotation in the microcentrifuge, and resuspended with 50 µΐ of ice-cold ethanol.
After a brief (1-2 sec) sonication, 10 µΐ of coated DNA particles were immediately transferred to the carrier membrane.
The Chlorella protothecoides culture (University of Texas Culture Collection 25 0) was grown in protease medium (2g / L yeast extract, 2.94mM NaN03,
0.17mm CaC12 »2H2O, 0.3mm MgS04 * 7H2O, 0.4mm K2HPO4,
1.28mM KH2PO4, 0.43mM NaCl) on a rotary shaker
<img file="MX339639B_D0296.tif" />
<sub>322</sub> ΙΜΡΙ
INSTITUTO MÍXICANC DE LA FRORIEDAD INDUSTRIAL under continuous light at 75 pmol photons m<sup>2</sup> q ^ g '<sup>1</sup> until a cell density of 2xl0 is reached<sup>6</sup>cells / ml. Cells were harvested, washed once with sterile distilled water, and resuspended in 50 µΐ of medium. 1 x 10<sup>7</sup> cells were dispersed in the third center of a plate of non-selective protease medium. Cells were bombarded with the PDS-1000 / He Biolistic Particle Delivery System (BioRad). Rupture discs (1100 and 1350 psi) were used and the plates were placed 9 and 12 cm below the sieve / macro-transporter assembly. Cells were allowed to recover at 25 ° C for 12-24 h. After recovery, the cells were scraped from the plates with a rubber spatula, mixed with 100 µΐ of the medium and dispersed on the plates containing hygromycin (200 pg / ml). After
7-10 days incubation at 25 ° C, colonies representing transformed cells were visible on plates from the 1100 and 1350 psi rupture discs and from 9 and 12 cm apart. Colonies were collected and spotted on selective agar plates for a second round of selection.
Chlorella transformation by electroporation
The culture of Chlorella protothecoides was grown in protease medium on a rotary shaker under continuous light at
323
IMPÍ
MEXICAN INSTITUTE ΠΕ LA HOBIEGAI INtUSTRIAl
<img file="MX339639B_D0297.tif" />
pmol photons m '<sup>2</sup> according to<sup>1</sup> until a cell density of 2xl0 is reached<sup>6</sup>cells / ml. Cells were harvested, washed once with sterile distilled water, and resuspended in tris-phosphate buffer (20mm Tris-HCl, pH 7.0; 1mM potassium phosphate) containing 50mM sucrose at a density of 4xl0<sup>8</sup>cells / ml. Approximately 250 μΐ of the cell suspension (lxl0<sup>8</sup>cells) were placed in a 4 mm gap disposable electroporation cuvette. To the cell suspension, 5 pg of the linearized pHyg plasmid DNA and 200 pg of the DNA carrier (salmon sperm DNA) were added. The electroporation cuvette was then incubated in a 16 ° C water bath for 10 minutes. An electrical pulse (1100 V / cm) was then applied to the cuvette at a capacitance of 25 pF (no shunt resistor was used for electroporation) through the use of a Gene Pulser II electroporation apparatus (Bio-Rad Labs, Hercules, CA).
The cuvette was then incubated at room temperature for 5 minutes, after which the cell suspension was transferred to 50 ml of proteose medium, and shaken on a rotary shaker for 2 days. After recovery, cells were harvested by low speed centrifugation, resuspended in protease medium, and plated at low density on plates supplemented with 200 pg /
IMPI
<img file="MX339639B_D0298.tif" />
324 my hygromycin. The plates were inserted haj <~ »<sup>Ίι</sup>ΐ3 -l-Iíí '<sup>111</sup> at 75 pmol photons m '<sup>2</sup> according to<sup>1</sup>. Transformants appeared as colonies in 1-2 weeks. Colonies were collected and spotted on selective agar plates for a second round of selection.
Genotyping
A subset of colonies that survived a second round of selection was cultivated in small volume and harvested. The approximately 5-10 ul volume pellets were resuspended in 50 ul lOmM NaEDTA by vigirisa shaking and then incubated at 100 ° C for 10. The tubes were then shaken vigorously briefly and sonicated for seconds, and then centrifuged at 12,000 xg for 1 minute. 2 ul of supernatant as standard was used in a 50 ul PCR reaction. The primers used for genotyping were sec. with no. Ident .: 153 and sec.
with no. Ident .: 154. The PCR conditions were as follows: 95 ° C 5 min x 1 cycle; 95 ° C 30 sec - 58 ° C 30 sec - 72 ° C 1 min 30 sec x 35 cycles; 72 ° C 10 min x 1 cycle.
The expected 992 bp fragment was found in 6 out of 10 biolistic method colonies and from a single electroporation colony. A smaller non-specific band was present in all lanes. To confirm the
325
ΙΜΡΙ
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0299.tif" />
Identity of the 992bp amplified fragment, two biolistic bands and the electroporation band were excised from the gel and sequenced individually. The sequence of the three bands corresponded to the expected 992 bp fragment. (DNA scale: Bionexus ”All Purpose Hi-Lo® DNA ladder catalog number BN2050).
EXAMPLE 4: Promoters and genes derived from algae for use in microalgae
A. Chlorella pro tothecoides promoter and 5'UTR sequences
A cDNA library was generated from Chlorella protothecoid.es (UTEX 250) which was cultured mixotrophically using standard techniques. Based on the sequences of
CDNA, the primer sequences were designed into certain 15 known domestic genes, to walk upstream of the coding regions using the kit
DNA Walking from Seegene (Rockville, MD). Isolated sequences include an actin (SEQ ID NO: 155) and the elongation factor-la (EFla) promoter (SEQ. No.
Ident .: 156) / UTR, which contain introns (as shown in lowercase) and exons (uppercase in italics) and the predicted start site (in bold) and two elements of the
<img file="MX339639B_D0300.tif" />
326 beta-tubulin promoter / UTR: Isofowwg<sup>1</sup>· A (sec. Ewi aÚB. »Of ident .: 157) and Isoforma B (sec. With ident. No .: 158).
B. Enzymes of lipid biosynthesis and sequences directed at C plastids, protothecoids
From the cDNA library described above, three cDNAs encoding functional proteins in lipid metabolism in Chlorella protothecoides (UTEX
250) were cloned using the same methods described above. The nucleotide and amino acid sequences for one acyl ACP desaturase (sec. With ID #: 159 and 160) and two geranyl geranyl diphosphate synthases (sec. With ID #: 161-164) are listed. of sequences below. Furthermore, three cDNAs with the putative signal sequence directed at the plastids were also cloned.
Nucleotide and amino acid sequences for a glyceraldehyde-3-phosphate dehydrogenase (sec. With ID #: 165 & 166), a complex OEE33 oxygen release protein (sec. With ID #: 167 & 168 ) and a Clp protease (SEQ ID NO: 169 and 170) were included in the sequence listing below. The putative plastid targeting sequence was underlined, both in the nucleotide and amino acid sequences. The sequences
327
IMPI
INSTITUTO MUICANO BE LA ERONEBAB INBUSTIÜAL
<img file="MX339639B_D0301.tif" />
Targeted plastids can be used to target the products of the transgenes to the plastids of the microbes, such as lipid-modifying enzymes.
EXAMPLE 5: Genetic engineering of Chlorella protothecoides to express an exogenous sucrose invertase
Strains and Medium: Chlorella protothecoides (UTEX 250) was obtained from the algae culture collection at the University of Texas (Austin, TX, United States). Feed cultures were maintained in modified protease medium. The modified protease medium consists of 0.25 g NaNO<sub>3</sub>0.09 g
K<sub>2</sub>HPO<sub>4</sub>0.175 g KH<sub>2</sub>PO<sub>4</sub> 0.025 g, 0.025 g CaCl<sub>2</sub>-2H<sub>2</sub>O, 0.075 g
MgSO<sub>4</sub>-7H<sub>2</sub>Or, and 2 g of yeast extract per liter (g / 1).
Construction of the plasmid: To express the secreted form of invertase in Chlorella protothecoides, a gene of Saccharomyces cerevisiae SUC2 was placed under the control of three different promoters: 35S promoter of cauliflower mosaic virus (CMV), promoter of Chlorella virus (NC -1A), and Chlorella HUP1 promoter. A yeast SUC2 gene was synthesized to accommodate C-optimized codon usage. protothecoids and includes a signal sequence required to direct extracellular secretion of invertase. Each construct was built in pBluescript KS +,
328
IMPI
<img file="MX339639B_D0302.tif" />
and the EcoRI / AscI, Ascl / Xhol, and Xhol / BamHI sites were introduced to each promoter, the invertase gene, and the CMV 3'UTR, respectively, by PCR amplification using specific primers. The PCR products were cloned sequentially.
Transformation of Chlorella protothecoides: A culture of Chlorella protothecoides was grown in modified protease medium on a rotary shaker with continuous light at 75 pmol photons m '<sup>2</sup> according to<sup>1</sup> until they reached a cell density of 6xl0<sup>and</sup>cells / ml.
For biolistic transformation, Seashell Technology S550d gold carriers were prepared according to the manufacturer's protocol. In summary, a linearized construct (20 pg) by Bsal was mixed with 50 µΐ of binding buffer and 60 µΐ (3 mg) of the S550d gold carriers and incubated on ice for 1 min. The precipitation buffer (100 µΐ) was added, and the mixture was incubated on ice for 1 min. After gentle shaking, the DNA coated particles were pooled by rotation at 10,000 rpm in an Eppendorf microcentrifuge for 10 seconds. The gold precipitate was washed once with 500 µΐ of 100% cold ethanol, pelleted in the microcentrifuge by brief rotation, and resuspended with 50 µΐ of ice-cold ethanol.
<img file="MX339639B_D0303.tif" />
329
IMPI
MEXICAN INSTITUTE D € LA MOITtOAI.
INDUSTRIAL
After a brief (1-2 sec) sonication, 10 µΐ of coated DNA particles were immediately transferred to the carrier membrane. Cells were harvested, washed once with sterile distilled water, 5 were resuspended in 50 μΐ of medium (1 χ 10<sup>7</sup> cells), and were dispersed in the third center of a non-selective Proteous plate. Cells were bombarded with the PDS-1000 / He Biolistic Particle Delivery System (Bio-Rad). Rupture discs (1100 and 1350 psi) were used and the plates were placed 9-12 cm 10 below the sieve / macro-transporter assembly. Cells were allowed to recover at 25 ° C for 12-24 hours.
After recovery, cells were scraped from the plates with a rubber spatula, mixed with 100 µΐ of medium and dispersed on the plates with 1% sucrose modified proteose. After 7-10 days incubation at 25 ° C in the dark, the colonies representing the transformed cells were visible on the plates.
For transformation by electroporation, cells were harvested, washed once with sterile distilled water, and resuspended in Trisphosphate buffer (20mm
Tris-HCl, pH 7.0; 1 mM potassium phosphate) containing 50 mM sucrose at a density of 4xl0<sup>8</sup>cells / ml.
Approximately
250 μΐ of cell suspension
330
<img file="MX339639B_D0304.tif" />
IMPÍ (lxl0<sup>8</sup>cells) were placed in a disposable cuvette with a 4 mm gap. To the cell suspension, SS added 5 pg of linearized plasmid DNA and 200 pg of
Carrier DNA (salmon sperm DNA). The electroporation cuvette was then incubated in an ice-water bath at 16 ° C for 10 min. An electrical pulse (1100 V / cm) was then applied to the cuvette at a capacitance of 25 pF (no shunt resistance was used for electroporation) through the use of a Gene Pulser II electroporation apparatus (Bio10 Rad Labs, Hercules , CA). The cuvette was then incubated at room temperature for 5 minutes, after which the cell suspension was transferred to 50 ml of modified protease medium, and shaken on a rotary shaker for 2 days. After recovery, the cells were harvested at low speed (4000 rpm), resuspended in modified protease media, and plated at low density in 1% sucrose modified protease plates. After
7-10 days incubation at 25 ° C in the dark, the colonies representing the transformed cells were visible on the plates.
Screening and genotyping of transformants: Colonies were harvested from 1% sucrose-grown dark protease plates, and
331
<img file="MX339639B_D0305.tif" />
IMPI
INSTITUTO MEXICANO DE LA PRORfOAl · · 'IOIISTRIAL _____ approximately the same number of cells were transferred to 24-well plates containing 1 ml of liquid protease medium modified with 1% sucrose. The cultures were kept in the dark and shaken using a Labnet (Berkshire, UK) orbital shaker at 430 rpm for days.
To verify the presence of the invertase gene introduced into the Chlorella transformants, the DNA of each transformant was isolated and amplified with a set of specific gene primers (the CMV construct: direct primer (CAACCACGTCTTCAAAGCAA) (sec. No. Ident .:
<td>153) / reverse primer</td><td colspan="2">(TCCGGTGTGTTGTAAGTCCA)</td><td>(SEC.</td><td>WITH NO.</td>
<td>OF IDENT .: 171), LOS</td><td>CV CONSTRUCTS</td><td colspan="2">primer</td><td>direct</td>
<td>(TTGTCGGAATGTCATATCAA)</td><td>(sec. with no.</td><td>of</td><td>ident.</td><td> : 172)/</td>
<td colspan="2">reverse primer (TCCGGTGTGTTGTAAGTCCA)</td><td>(sec.</td><td>with</td><td>no. of</td>
<td>ident .: 171), and the</td><td>HUP1 construct</td><td colspan="2">primer</td><td>direct</td>
<td>(AACGCCTTTGTACAACTGCA)</td><td>(sec. with no.</td><td>of</td><td>ident.</td><td> 173)/</td>
<td colspan="2">reverse primer (TCCGGTGTGTTGTAAGTCCA)</td><td>(sec.</td><td>with</td><td>no. of</td>
ident .: 171)). For rapid DNA isolation, a volume of 20 cells (approximately 5-10 ul in size) was resuspended in 50 ul of 10 mM Na-EDTA. The cell suspension was incubated at 100 ° C for 10 min and sonicated for sec. After centrifugation at 12000g for 1 min, 3 ul
332
<img file="MX339639B_D0306.tif" />
of the supernatant was used for the PCR reaction. PCR amplification was performed in the thermal cycler of
DNA (Perkin-Elmer GeneAmp 9600). The reaction mixture (50 ul) contained 3 ul of the extracted DNA, 100 pmol from each of the respective primers described above, 200 uM of dNTP, 0.5 units of Taq DNA polymerase (NEB), and the polymerase buffer DNA Taq according to the manufacturer's instructions. DNA denaturation was carried out at 95 ° C for 5 min for the first cycle, and then for 30 sec. Hybridization and extension reactions were carried out at 58 ° C for 30 sec and 72 ° C for 1 min respectively. The PCR products were then visualized on 1% agarose gels stained with ethidium bromide.
Growth in liquid culture: After five days of growth in the dark, the positive genotype transformants showed growth in minimal liquid protease medium + 1% sucrose in the dark, while the wild cells showed no growth in the same media in Darkness.
EXAMPLE 6: Transformation of algae strains with a secreted invertase derived from S. cerevisiae
<img file="MX339639B_D0307.tif" />
333
Secreted invertase: A gene encoding a secreted sucrose invertase (Genbank accession number NP_012104 from Saccharomyces cerevisiae) was newly synthesized as a 1599 bp Ase I-Xho fragment that was subsequently subcloned into a pUC19 derivative that it possessed cauliflower mosaic virus 35s promoter and 3 'UTR as cassettes
EcoR I / Asc I and Xho / Sac I, respectively.
Algae cell growth: The medium used in these experiments was liquid base medium (2g / l yeast extract, 2.94mM NaNO<sub>3</sub>0.17mM CaCl<sub>2</sub>»2H<sub>2</sub>Or, 0.3mM
MgSO<sub>4</sub>* 7H<sub>2</sub>O, 0.4mm K<sub>2</sub>HPO<sub>4</sub>1.28mm KH<sub>2</sub>PO<sub>4</sub>, 0.43mM NaCl) and solid base medium (+ 1.5% agarose) containing fixed carbon or in the form of sucrose or glucose (as designed) at 1% final concentration. The strains used in this experiment did not grow in the dark on the base medium in the absence of an additional fixed carbon source. The species were seeded onto the plates, and grown in the dark at 28DC. Individual colonies were selected and used to inoculate 500 ml of liquid base medium containing 1% glucose, grown in the dark to semi-log phase, cell counts measured each day. Each of the following strains was previously tested for growth in the dark in
<img file="MX339639B_D0308.tif" />
334
ΙΜΡΙ
IWTITUTC MEXICANC PROPERTY industrial sucrose as the sole carbon source and exhibited no growth, and thus were chosen for transformation with a secreted invertase: (1) Chlorella protothecoides (UTEX
31); (2) Chlorella minutissima (UTEX 2341); and (3) Chlorella emersonii (CCAP 211/15).
Algae cell transformation through particle bombardment: enough culture was spun to give approximately 1-5 x 10<sup>8</sup> total cells. The resulting sediment was washed with the base medium without adding any fixed carbon sources. The cells were centrifuged again and the pellet was resuspended in a volume of base medium sufficient to give 5x10<sup>7</sup> at 2 x 10® cells / ml. Then 250-1000 µΐ cells were seeded in solid base medium supplemented with 1% sucrose and allowed to dry on the plate in a sterile hood. Plasmid DNA was precipitated onto gold particles according to the manufacturer's recommendations (Seashell Technology, La
Jolla, CA). Transformations were accomplished using a BioRad PDS He20 1000 Particle Delivery System using 1350 psi Rupture Discs with the macrocarrier assembly set 9cm from the Rupture Disc Holder. After transformations, the plates were incubated in the dark at 28 ° C. All strains
335
<img file="MX339639B_D0309.tif" />
they generated multiple transformed control colonies without the rest prepared from one colonies.
Analysis of
IMPI
MEXICAN INSTITUTE
Ot LA Pltí'AO _, -. .INDUSTRIAL-, transformants. The invertase insert plates, but identically, did not contain t rans f ormant is of
Chlorella protothecoides: Genomic DNA was extracted from wild cells and transforming Chlorella protothecoides colonies as follows: Cells were resuspended in 100 ul of extraction buffer (87.5mM Tris Cl, pH 8.0, 50mM NaCl, 5 mM EDTA, pH 8.0, 0.25% of
SDS) and incubated at 60 ° C, with occasional mixing via the inversion route, for 30 minutes. For PCR, samples were diluted 1: 100 in 20mM Tris Cl, pH 8.0.
Genotyping was performed on genomic DNA extracted from WTs, transformants, and plasmid DNA. The samples were genotyped for the marker gene. Primers 2383 (5 'CTGACCCGACCTATGGGAGCGCTCTTGGC 3') were used (sec.
with no. Ident .: 174) and 2279 (5 '
CTTGACTTCCCTCACCTGGAATTTGTCG 3 ') (sec. With no.
175) in this PCR for genotyping. The profile of was as follows: denaturation at min; 35 cycles of 94 ° C -30 sec, 60 ° C - 30 sec, ID:
the used PCR
94 ° C during
72 ° C -3 min;
72 ° C -5 min. A band of identical size was amplified to
336
ΙΜΡΙ
MEXICAN INSTITUTE OF PUBLICTY
INDUSTRIAL
<img file="MX339639B_D0310.tif" />
from the positive controls (plasmid) and two transformants of Chlorella protothecoides (UTEX 31).
Analysis of Chlorella minutissima and Chlorella emersonii transformants: Genomic DNA was extracted from
Chlorella WT and transformants as follows: Cells were resuspended in 100 ul of extraction buffer (87.5mM Tris Cl, pH 8.0, 50mM NaCI, 5mM EDTA, pH 8.0, 0.25% SDS) and incubated at 60 ° C, with occasional mixing via the inversion, for 30 minutes.
For PCR, samples were diluted 1: 100 in 20mM Tris
Cl, pH 8.0. Genotyping was performed on genomic DNA extracted from WTs, transformants, and plasmid DNA.
The samples were genotyped for the marker gene. Primers 2336 (5 'GTGGCCATATGGACTTACAA 3') (sec. With ID #: 176) and 2279 (5 'CTTGACTTCCCTCACCTGGAATTTGTCG 3') (sec. With ID #: 175) were a designated primer set 2 ( 1215 bp expected product), while primers 24 65 (5 'CAAGGGCTGGATGAATGACCCCAATGGACTGTGGTACGACG
3 ') (section with ID number: 177) and 2470 (5'
CACCCGTCGTCATGTTCACGGAGCCCAGTGCG 3 ') (SEQ ID NO: 178) were a designated primer set 4 (1442 bp expected product). The PCR profile used was as follows: 94 ° C denaturation for 2 min; 29 cycles
337
IMPI
INSTITUTO MEXICA NU UE LA rROPINLAP
INDUSTRIAL
<img file="MX339639B_D0311.tif" />
from 94 ° C -30 sec, 60 ° C - 30 sec, 72 ° C - 1 min, 30 sec; 72 ° C -5 min. A control plasmid containing the secreted invertase was used as a control PCR.
The sequence of the invertase construct corresponds to sec. with no. Ident .: 8.
EXAMPLE 7: Homologous recombination in species of
Prototheca
Homologous recombination of transgenes has many advantages. First, the introduction of transgenes without homologous recombination can be unpredictable, because there is no control over the copy number of the plasmid that is introduced into the cell. Furthermore, the introduction of transgenes without homologous recombination can be unstable because the plasmid can remain episomal and is lost in subsequent cell divisions. Another advantage of homologous recombination is the ability to deactivate target genes, to introduce epitope tags, to change endogenous gene promoters, and to other types of target gene modifications (for example, the introduction of point mutations.
Two vectors were constructed using a specific region of the Prototheca moriformis genome (UTEX
338
IMPI
INSTITUT · MEXICANO I heard LA »χ ·· | £ θχθ
KHIÍTÍIAI
<img file="MX339639B_D0312.tif" />
1435), designated KE858. KE858 is a genomic fragment of
1.3 kb, spanning part of the coding region for a protein that shares homology with the transfer RNA (tRNA) family of proteins. Southern blotting demonstrated that the KE858 sequence was present in a single copy in the Prototheca moriformis genome (UTEX 1435). The first type of vector to be built, designated
SZ725 (SEQ ID NO: 179), consisted of the complete 1.3 kb KE858 fragment cloned into a pUC19 vector backbone that also contained the optimized yeast invertase gene (suc2). The KE858 fragment contained a unique SnaBl site that did not appear anywhere else in the target construct. The second type of vector that was constructed, designated SZ726 (sec. No. Ident .: 80), consisted of the sequence KE858 that was interrupted by the insertion of the yeast invertase gene (suc2) at the site
SnaBl within the KE858 genomic sequence. The fragment of
DNA containing the KE858 sequences flanking the yeast invertase gene can be excised from the vector backbone by EcoRI digestion, which cuts at each end of the KE858 region.
Both vectors were used to direct the homologous recombination of the yeast invertase gene (suc2) in the
<img file="MX339639B_D0313.tif" />
339
Correspondiente corresponding KE858 region of the Prototheca moriformis genome (UTEX 1435). The ends of the linear DNA homologous to the genomic region that was the target of homologous recombination were exposed by digestion of the vector construct SZ725 with SnaBl and the vector construct SZ726 with
EcoRI. The digested vector constructs were then introduced into Prototheca moriformis cultures using the methods described above. Transformants from each vector construct were then selected using sucrose plates. Ten independent, clonally pure transformants from each transformation vector were analyzed for successful recombination of the yeast invertase gene at the desired genome site (using Southern blot) and for transgene stability.
Southern blot analysis of SZ725 transformants showed that 4 of the 10 transformants collected for analysis contained the predicted recombinant bands, indicating that a single crossover event occurred between the KE858 sequences in the vector and the KE858 sequences. in the genome. In contrast, all ten SZ726 transformants contained the predicted recombinant bands, indicating that double-ended events occurred
340
IMPí
MEXICAN INSTITUTE OF INDUSTRIAL FRUITTY
<img file="MX339639B_D0314.tif" />
junction between the EcoRI fragment of pSZ726 carrying the KE858 sequence flanking the yeast invertase transgene and the corresponding KE858 region of the genome.
Sucrose invertase expression and transgene stability were assessed by growth of transformants for more than 15 generations in the absence of selection. The four SZ725 transformants and the ten SZ276 transformants that tested positive for the Southern blot transgene were selected and 48 individual colonies from each of the transformants were serially cultured: first without selection in glucose medium and then with selection from media containing sucrose as the sole carbon source. The ten transformants
SZ276 (100%) maintained their ability to grow in sucrose after 15 generations, while approximately 97% of the SZ725 transformants retained their ability to grow in sucrose after 15 generations. Transgenes that were introduced by a double crossover event (vector
SZ726) have very high stability during dubbing of generations. In contrast, transgenes that were introduced by a single cross (vector SZ725) may give rise to some instability during dubbing of the generations because tandem copies of the
341
ΙΜΡΙ
MEXICAN INSTITUTE Dt LA MOFWOAl
INrilSTRlAI.
<img file="MX339639B_D0315.tif" />
transgenes, the repeat homologous regions flanking the transgenes can be recombined and removed from the transgenic DNA between them.
These experiments demonstrate the successful use of homologous recombination to generate transformants of
Prototheca containing a heterologous gene for sucrose invertase that is stably integrated into the body's nuclear chromosomes. The success of homologous recombination allows for other genomic alterations in Prototheca, including gene deletions, point mutations, and the labeled epitope of a desired gene product. These experiments also demonstrate the first documented system for homologous recombination in the nuclear genome a of a eukaryotic microalgae.
Bear recombination homologous for the knockout of an endogenous gene of Endogenous Prototheca moriformis: In a cDNA / genomic screening for Prototheca moriformis, as described above in Example 4, the
CDNA. of an endogenous stearoyl ACP desaturase (SAPD). Stearoyl ACP desaturase enzymes are part of the lipid synthesis pathway and have the function of introducing double bonds in acyl fatty chains. In some cases, it may be an advantage to disable or reduce the
342
<img file="MX339639B_D0316.tif" />
ΙΜΡΪ expression of lipid pathway enzymes in order to modify a fatty acid profile. A homologous recombination construct was created to assess whether the expression of an endogenous stearoyl ACP desaturase enzyme could be reduced (or deactivated) and whether the corresponding reduction in unsaturated fatty acids in the lipid profile of the host cell could be observed. A coding sequence of approximately 1.5kb of a stearoyl gene
Prototheca moriformis ACP desaturase (UTEX 1435) was identified and cloned (sec. With ID #: 181). The homologous recombination construct was constructed using 0.5 kb of the SAPD coding sequence at the 5 'end (5' targeting site), followed by the β-tublin promoter from Chlamydomonas reinhardtii that carried a suc2 gene from the yeast sucrose invertase with optimized codon, with 3 'UTR of Chlorella vulgaris. The remainder (~ 1 kb) of the coding sequence of the Prototheca moriformis SAPD was then inserted, after the 3'UTR of
C. vulgaris to form the 3 'target site. The sequence for this homologous recombination cassette is listed in sec. with no. ID: 182. As shown above, the success rate for integration of the homologous recombination cassette into the nuclear genome can be increased
343
IMPI
MEXICAN INSTITUTE OF THE INDUSTRIAL FROI'ISOAD
<img file="MX339639B_D0317.tif" />
by linearizing the caseto-- ani-oo i <sub>to</sub> transformation of the microalgae, leaving the ends exposed. The endogenous SAPD enzyme homologous recombination cassette in Prototheca moriformis was linearized and then transformed into the host cell (Prototheca moriformis, UTEX 1435). Successful integration would remove the endogenous SAPD enzyme coding region from the host genome through a reciprocal double recombination event, while the expression of the newly inserted suc2 gene would be regulated by the C. tubinulin promoter of C. reinhardtii. The resulting clones can be examined using plates / media containing sucrose as the sole carbon source. Clones containing successful integration of the homologous recombination cassette will have the ability to grow in sucrose as the sole carbon source, and changes in the overall saturation of fatty acids in the lipid profile will serve as a secondary confirmation factor. Furthermore, Southern blot assays using a probe specific for the yeast sucrose invertase suc2 gene and RT-PCR may also confirm the presence and expression of the invertase gene in positive clones. Alternatively, the same construct without the β-tubulin promoter can be
344
IMPI
INSTO UTO MiXICANv Ufc LA PtOPIBDAi? INTUSTtiAl
<img file="MX339639B_D0318.tif" />
use to cut the coding region of the endogenous SAPD enzyme. In this case, the newly incorporated yeast sucrose invertase suc2 gene will be regulated by the endogenous SAPD / 5'UTR promoter.
EXAMPLE 8: Expression of various thioesterases in Prototheca
The methods and effects for expressing a heterologous thioesterase gene in Prototheca species were previously described in PCT application no.
PCT / US2009 / 66142, hereby incorporated by reference.
The effect of other thioesterase gene / gene products from higher plant species was further investigated. These thioesterases include thioesterases from the following higher plants:
GenBank
Species Accession number Specificity sec.
with no. Ident .:
Cinnamomum camphora Q39473 C14 sec. with numbers ID: 30-31
Umbellularia californica Q41635 C10-C12 sec.
with numbers ID: 34-35
Cuphea hookeriana AAC49269 C8-C10 sec. with numbers ID: 32-33
345
<img file="MX339639B_D0319.tif" />
CIO
IMPIMP
Cuphea palustris AAC49179 ident .: 36-37
Cuphea lanceolata nos. ID: 38-39
Germanic Iris no. ID: 40-41
Myristica fragrans with nos. ID: 42-43
Cuphea palustris AAC49180 ident .: 44-45
Ulmus americana AAB71731 ident .: 46-47
CAB60830
C8
AAG43858.1
AAB717291.1
C14
C14 sec. with numbers of sec. with sec. with
C14 sec.
sec. with numbers wide sec. with numbers of
In all cases, each of the above thioesterase constructs was transformed into Prototheca moriformis (UTEX 1435) using biolistic particle bombardment.
Other transformation methods including homologous recombination as described in PCT application no.
PCT / US2009 / 66142, would also be suitable for the heterologous expression of genes of interest. The transformation of
Prototheca moriformis (UTEX 1435) with each of the above thioesterase constructs was performed using the methods described in Example 2. Each of the constructs contained a NeoR gene and selection for positive clones was carried out using 100 pg / ml G418. Everybody
<img file="MX339639B_D0320.tif" />
346
IMPI regions were optimized by codon to reflect the inherent codonic preference in nuclear genes of
Prototheca moriformis UTEX 1435 (see Table 2). Both the amino acid sequences and the cDNA sequences for the construct used are listed in the sequence identity list. The transit peptide for each of the higher plant thioesterases was replaced with a codon optimized algae transit peptide from Prototheca moriformis delta 12 fatty acid desaturase (sec. No. Ident .: 48)) or from the Chlorella protothecoides stearoyl ACP desaturase (sec.
with no. Ident .: 49). All thioesterase constructs were powered by the Chlamydomanas reinhardtii betatubulin promoter / 5'UTR. The growth and lipid production of the selected positive clones were compared with those of wild Prototheca moriformis (UTEX 1435) (untransformed). Selected and wild positive clones were grown in 2% glucose G418 plates. The analysis of the lipid profiles in the positive clones selected for each construct are summarized below (expressed in area%) in Table 15.
Table 15. Lipid profiles of Prototheca moriformis expressing various heterologous thioesterases.
<img file="MX339639B_D0321.tif" />
347
ΙΜΡΙ
INSTITUTO MSXICANC DE LA FRORIEDAD INDUSTRIA!
<td rowspan="2">Acid fatty</td><td rowspan="2">UTEX 1435 Kind wild re</td><td colspan="11"></td>
<td><3 0 tea he has H- i p. 0 tea</td><td>p 0 one 2</td><td colspan="2">H * 8 Φ to μ. 0 η</td><td>5 n> To the to to</td><td>C. palustris C8: 0</td><td>C. hookeriana</td><td>n he has s Φ 0 he has tea ri- tea</td><td colspan="2">OR or Ό H Bi £ £ OR (0</td><td>U. americana ¡</td>
<td>C8: 0</td><td> 0</td><td> 0</td><td colspan="2"> 0</td><td> 0</td><td></td><td> 3.1</td><td> 1.8</td><td colspan="2"> 0</td><td> 0</td><td> . 09</td>
<td>CIO: 0</td><td> 0.02</td><td> . 07</td><td colspan="2"> . 02</td><td> . 01</td><td> . 09</td><td> .56</td><td> 6.85</td><td colspan="2"> 1.91</td><td> . 01</td><td> 2.85</td>
<td>C12: 0</td><td> 0.05</td><td> 14</td><td colspan="2"> 1.82</td><td> .09</td><td> .05</td><td> .25</td><td> .2</td><td colspan="2"> .29</td><td> .06</td><td> .74</td>
<td>C14: 0</td><td> 1.65</td><td> 3</td><td colspan="2"> 17.3</td><td> 2.59</td><td> 5.31</td><td> 1.45</td><td> 1.8</td><td colspan="2"> 1.83</td><td> 2.87</td><td> 10.4 5</td>
<td>C16: 0</td><td> 28.0</td><td> 21.4</td><td colspan="2"> 24.3</td><td> 26.5 2</td><td> 31.0 8</td><td> 22.8 4</td><td> 23.9</td><td colspan="2"> 25.5 5</td><td> 27.2 3</td><td> 33.3</td>
<td>C18: 0</td><td> 2.9</td><td> 2.9</td><td colspan="2"> 2.7</td><td> 3.11</td><td> 2.71</td><td> 3.24</td><td> 2.8</td><td colspan="2"> 3.26</td><td> 3.62</td><td> 3.47</td>
<td>C18: 1</td><td> 53.8</td><td> 45.2</td><td colspan="2"> 41.3</td><td> 49.9 6</td><td> 39.7 7</td><td> 56.6 2</td><td> 49.8</td><td colspan="2"> 55.4 3</td><td> 51.0 4</td><td> 38.7 1</td>
<td>C18: 2</td><td> 10.95</td><td> 10</td><td colspan="2"> 9.7</td><td> 11.8 6</td><td> 14.1 7</td><td> 8.24</td><td> 9.7</td><td colspan="2"> 8.17</td><td> 10.8 1</td><td> 7.38</td>
<td>C18: 3 a</td><td> 0.8</td><td> .86</td><td colspan="2"> .8</td><td> .40</td><td> . 64</td><td> . 61</td><td> .9</td><td colspan="2"> . 58</td><td> .97</td><td> .52</td>
<td>Saturate you totals (area %)</td><td> 32.62</td><td> 44.9 7</td><td colspan="2"> 46.1 4</td><td> 32.3 2</td><td> 39.2 4</td><td> 31.4 4</td><td> 37.3 5</td><td colspan="2"> 32.8 4</td><td> 33.7 9</td><td> 50.9</td>
The results demonstrate that all thioesterases expressed impaired fatty acid profiles at some level.
348
IMPI
MEXICAN INSTITUTE. ” . · OE LA FROFieDAD
INOUSTRIAL
<img file="MX339639B_D0322.tif" />
When looking at the row of total satrurates, the degree of - W ', 1 - ^ -1 I _ saturation was extremely shocked by the expression of several of the thioesterases, including those of U. cali fornica, C. camphora, and more notably, U. americana.
These changes in the percentage of total saturates were unexpected in that the heterologous expression of higher plant thioesterases may apparently affect more than just lipid chain lengths; they can also affect other attributes of the lipid profiles produced by the microalgae, specifically the degree of saturation of fatty acids.
Selected clones transformed with thioesterase
C. palustris C8, C. hookeriana thioesterase, U. cali fornica thioesterase, and C. camphorase were further grown in varying amounts of G418 (from 25 mg / 1 to 50 mg / 1) and at varying temperatures (from 22 ° C to 25 ° C) and the lipid profile was determined by these clones. Table 16 summarizes the lipid profile (in% e area) of representative clones containing each thioesterase. A second construct containing U thioesterase. americana was constructed and transformed into Prototheca moriformis (UTEX 1435) using the biolistic methods described above. This second construct was introduced into the cell through the
349
<img file="MX339639B_D0323.tif" />
IMPI
INSTITUTO MEXICANO Dt LA MOFKLMD INDUSTRIAL homologated recombination. The methods for homologous recombination in Prototheca species were previously described in PCT application no. PCT / US2009 / 66142. The homologous DNA that was used was from the genomic DNA sequence of the 6S region of Prototheca moriformis UTEX 1435. The selection agent had the ability to grow in sucrose, using a codon optimized suc2 gene from S. cereveisiae driven by the promoter of beta tubulin C. reinhardtii. The natural U. americana transit peptide was replaced by the stearoyl ACP desaturase transit peptide from
Chlorella protothecoides (UTEX 250). The cDNA of this construct is listed in the sequence list as sec.
with no. Ident .: 50. The selection of positive clones was carried out in 2% sucrose plates and the resulting cultures for the determination of the lipid profile were also grown in medium containing 2% sucrose. A representative lipid profile for this homologously recombined heterologous U. americana thioesterase-containing strain of Prototheca moriformis is summarized in Table
16.
Table 16. Lipid profiles of Prototheca moriformis strains containing heterologous thioesterase genes.
350
<img file="MX339639B_D0324.tif" />
IMPI
MEXICAN INSTITUTE
<td rowspan="2"></td><td rowspan="2">C. Palustris C8</td><td rowspan="2">C. hookerian</td><td>C.</td><td>-iNQUSTRbu-> or.</td><td></td>
<td>camphora</td><td>American<sup>1</sup>· 2</td><td></td>
<td>C8: 0</td><td> 12.28</td><td> 2.37</td><td> 0</td><td> 0</td><td></td>
<td>C10: 0</td><td> 2.17</td><td> 12.09</td><td> 0.02</td><td> 4.69</td><td></td>
<td>C12: 0</td><td> 0.34</td><td> 0.33</td><td> 3.81</td><td> 1.02</td><td></td>
<td>C14: 0</td><td> 1.59</td><td> 2.08</td><td> 32.73</td><td> 16.21</td><td></td>
<td>C16: 0</td><td> 15.91</td><td> 20.07</td><td> 24.03</td><td> 38.39</td><td></td>
<td>C18: 0</td><td> 1.59</td><td> 1.57</td><td> 1.21</td><td> 2.83</td><td></td>
<td>C18: l</td><td> 50.64</td><td> 41.80</td><td> 18.64</td><td> 27.22</td><td></td>
<td>C18: 2</td><td> 13.02</td><td> 16.37</td><td> 16.57</td><td> 7.65</td><td></td>
<td>C18: 3 a</td><td> 1.52</td><td> 1.75</td><td> 1.66</td><td> 0.74</td><td></td>
<td>Saturated totals</td><td> 33.88</td><td> 38.51</td><td> 61.80</td><td> 63.14</td><td></td>
As with the clones described above, all transformants containing a heterologous thioesterase gene showed impacted fatty acid profiles at some level, and the total percentage of saturated fatty acids also changed compared to wild (untransformed) Prototheca moriformis. Prototheca moriformis containing thioesterase U. americana introduced by homologous recombination had the largest increase in total saturates.
Furthermore, transgenic clones containing C. hookeriana thioesterase, C. camphora, U. cali fornica or
351
IMPI
MEXICAN INSTITUTE »)
OF THE IX »TIIJ.Al '
INDUSTRIAL ^> 7 · *
Exogenous U. americana were evaluated for new lipid profiles. The clone containing C. thioesterase
hookeriana reached the following lipid profile when cultured in 2% glucose, 25mg / ml G418 at 22 ° C: 5.10% C8: 0;
18.28% C10: 0; 0.41% C12: 0; 1.76% C14: 0; 16.31% C16: 0; 1.40%
C18: 0; 40.49% C18: l; and 13.16% C18: 2. The clone containing C. camphora thioesterase (also containing an exogenous sucrose invertase) reached the following lipid profile when cultured in 2% sucrose at 25 ° C: 0.04% C10: 0;
6.01% C12: 0; 35.98% C14: 0; 19.42 C16: 0; 1.48% C18: 0; 25.44%
C18: l; and 9.34% C18: 2. The clone containing thioesterase from
U. fornica cal reached the following lipid profile when cultured in 2% glucose, 25-100 mg / ml G418 at 22 ° C: 0% C8: 0;
0.11% C10: 0; 34.01% C12: 0; 5.75% C14: 0; 14.02% C16: 0; 1.10%
C18: 0; 28.93% C18: l; and 13.01% C18: 2. The clone containing thioesterase from U. americana reached the following lipid profile when cultured in 2% glucose at 28 ° C: 1.54%
C10: 0; 0.43% C12: 0; 7.56% C14: 0; 39.45% C16: 0; 2.49% C18: 0;
38.49% C18: 1; and 7.88% C18: 2.
EXAMPLE 9: Prototheca transformation with multiple exogenous heterologous thioesterase genes
<img file="MX339639B_D0325.tif" />
352
<img file="MX339639B_D0326.tif" />
IMPI ¿«ICANO fw LA FRflFlBrjAn
INDUSTRY!
The Prototheca moriformis microalgae strain (UTEX 1435) was transformed using the methods described above to express multiple thioesterases in a single clone. Expression of multiple thioesterases in a single clone allows microalgae to produce oils with completely different fatty acid profiles than those made when any single thioesterase expresses itself (as demonstrated in the preceding Examples). Prototheca moriformis (UTEX 1435) was first transformed with Cinnamomum camphora thioesterase (a thioesterase that prefers C14) at the same time as a sucrose invertase gene, suc2 from S. cerevisiae (selection was the ability to grow in sucrose) through the use of homologous recombination. The DNA used for this homologous recombination construct was from the KE858 region of the Prototheca moriformis genomic DNA as described in
Section III above. The relevant portion of this construct is listed in the Sequence List as sec. with no. Ident .: 51. Positive clones were detected on plates containing sucrose. A positive clone was then re-transformed with one of the three cassettes, each encoding G418 antibiotic resistance as well as an additional thioesterase: (1) the thioesterase gene from
353
<img file="MX339639B_D0327.tif" />
Cuphea hookeriana (who prefers C8-1O). sec. with no. Ident .: 52; (2) the Umbellularia californica thioesterase gene (which prefers C12), sec. with no. Ident .: 53;
or thioesterase from Ulmus americana (broad; which prefers
C10-C16), sec. with no. Ident .: 54. Included in the sequence list is the sequence of the relevant portion of each construct. The clones expressing the genes of both thioesterases were detected in a medium containing sucrose with 50 pg / ml of G418. Positive clones were selected and grown and lipid profiles were tested. Table 17 summarizes the lipid profile of representative positive clones (expressed in% of area).
Table 17. Lipid profiles of Prototheca moriformis transformed with multiple thioesterases.
<td>Acid</td><td>UTEX</td><td>UTEX 1435</td><td colspan="3">UTEX 1435 + C genetic background.</td>
<td>fatty</td><td> 1435</td><td> +</td><td></td><td>camphora TE</td><td></td>
<td></td><td></td><td>c.</td><td> +</td><td> +</td><td> +</td>
<td></td><td></td><td>camphora</td><td>c.</td><td>OR.</td><td>OR.</td>
<td></td><td></td><td>TEA</td><td>hookerian</td><td>California</td><td>American</td>
<td></td><td></td><td></td><td>TEA</td><td>TEA</td><td>TEA</td>
<td>C8: 0</td><td> 0</td><td> 0</td><td> 0.19</td><td> 0</td><td> 0.06</td>
<td>CIO: 0</td><td> 0.02</td><td> 0.02</td><td> 2.16</td><td> 0.07</td><td> 1.87</td>
<td>C12: 0</td><td> 0.05</td><td> 0.66</td><td> 0.53</td><td> 13.55</td><td> 1.61</td>
<td>C14: 0</td><td> 1.65</td><td> 10.52</td><td> 7.64</td><td> 8.0</td><td> 14.58</td>
354
<td>C16: 0</td><td> 28.0</td><td> 22.56</td><td> 22.31</td><td> 19.98</td><td> 29.53</td>
<td>C18: 0</td><td> 2.9</td><td> 6.67</td><td> 3.23</td><td> 2.24</td><td> 2.93</td>
<td>C18: l</td><td> 53.8</td><td> 47.78</td><td> 48.54</td><td> 42.55</td><td> 37.3</td>
<td>C18: 2</td><td> 10.95</td><td> 12.3</td><td> 11.76</td><td> 10.13</td><td> 8.9</td>
<td>C18: 3 a</td><td> 0.8</td><td> 0.93</td><td> 0.91</td><td> 0.91</td><td> 0.76</td>
<td>Saturated</td><td> 32.62</td><td> 40.43</td><td> 36.06</td><td> 43.84</td><td> 50.58</td>
<td>Totals</td><td></td><td></td><td></td><td></td><td></td>
<td>(Area %)</td><td></td><td></td><td></td><td></td><td></td>
Furthermore, a double thioesterase clone with thioesterase from C. camphora and U. cali fornica was grown in 2% sucrose containing 50 mg / 1 G418 medium at 22 ° C. The fatty acid profile obtained from this strain under these growth conditions was: C8: 0 (0); C10: 0 (0.10); C12: 0 (03.31); C14: 0 (7.47); C16: 0 (15.20); C18: 0 (0.90); C18: l (30.60); C18: 2 (12.44); and C18: 3a (1.38), CCO with a total of saturates of 54.7.
Double thioesterase clones were produced with two homologous recombination constructs (one targeting the 6S region and the other targeting the KE858 region) containing C. camphora thioestease. A positive representative clone had a fatty acid profile of: 0% C8: 0; 0.06% C10: 0;
5.91% C12: 0; 43.27% C14: 0; 19.63% C16: 0; 0.87% C18: 0; 13.96%
C18: l; and 13.78% C18: 2, with a total saturation of 69.74%.
355
<img file="MX339639B_D0328.tif" />
IMPI
INSTITUTC MEXICANl; OE LA morí EDA I) industrial
This clone had a C12-C14 level above 4.9%, it is 37 times above the C12-C14 level in wild cells.
The above data showed that multiple thioesterases could be successfully co-expressed in microalgae. Co-expression of multiple thioesterases resulted in altered fatty acid profiles that differed significantly not only from the wild strain, but in addition to the fatty acid profile obtained by expression of any one of the individual thioesterases. Expression of multiple thioesterases with overlapping chain length specificity can result in cumulative increases in specific fatty acids.
Expression of heterologous thioesterases (either alone or together) in Prototheca moriformis not only alters the fatty acid / lipid profiles of the host strain, but when compared to currently available oils from a variety of seed crops (Table 5 ), these profiles are truly unique oils not found in any other system currently available. Not only do the transgenic strains show significant differences from the wild non-transformed strain, they have very different profiles from any of the oils
356
ΙΜΡΙ ne. and commercial "A'LANí> DE LA ΓβΟΗΕΡΛΓ) fNDUfTRJAL shown in Table 5. As an example, both coconut and palm kernel oils have levels of C8-C10 fatty acids that are in the range from 5.5-17%. The transgenic strain expressing the thioester that prefers C8 of C. palustris or the thioester that prefers CIO of C. hookeriana accumulates anywhere from 3.66 to 8.65%, respectively. These levels of C8-C10 fatty acids are similar to those of coconut and palm kernel oil, however, the transgenic algae strains lack the fatty acids significantly higher than C12: 0, and they have very high
C16: 0 (23% in transgenics vs. 11-16% in coconut and palm kernel oil, respectively and / or 18: 1 (50-57% in transgenics vs. 8-19% in walnut oil coconut and palm kernel, respectively.
EXAMPLE 10: Identification of endogenous promoters of
Nitrogen dependent prototheca
A. Identification and characterization of endogenous nitrogen-dependent promoters.
A cDNA library was generated from Prototheca moriformis (UTEX 1435) using standard techniques.
Prototheca moriformis cells were cultured for 48
357
IMPIg
<img file="MX339639B_D0329.tif" />
ΙΝΪΤΠνΚ »M * ICA NO
DI LA F * OW «DAD Λ» INDUSTRIAL '- «í hours in abundant nitrogen conditions. Then a 5% (v / v) inoculum was transferred to low nitrogen and the cells were harvested every 24 hours for seven days.
After approximately 24 hours in culture, the nitrogen supply in the medium was completely depleted. The samples that were collected were immediately frozen using dry ice and isopropanol. Total RNA was subsequently isolated from frozen cell pellet samples and a portion of each sample was kept in reserve for RT-PCR studies. The rest of the total RNA that was harvested from the samples was screened for polyA. Equimolar amounts of selected polyA RNA from each condition were then pooled, and used to generate a cDNA library in the pcDNA 3.0 vector (Invitrogen). About 1200 clones from the resulting cDNA library were randomly selected and pooled and sequenced on both strands.
Approximately 68 different cDNAs were selected from the
1200 sequences and were used to design the specific cDNA primers for use in real-time RT-PCR studies.
The RNA that was isolated from the sediment samples of cells that were reserved was used as a substrate in the
358
IMPI 'NSTITUTOMUUCan ,. OF THE industrial PROfrrDAP
<img file="MX339639B_D0330.tif" />
real-time RT-PCR studies using the set of cDNA-specific primers that were previously generated. This pool of RNA was converted to cDNA and used as a substrate for RT-PCR for each of the set of 68 gene-specific primers. The threshold cycle or C numbers<sub>T</sub> they were used to indicate the relative abundance of transcription of each of the 68 cDNAs within each RNA sample that was collected over time. The cDNAs that showed a significant increase (more than three times) between the conditions of abundant nitrogen and depleted nitrogen were identified as possible genes whose expression was upregulated by nitrogen depletion. As discussed in the specification, Nitrogen Depletion / Limitation, is known to be an inducer of lipogenesis in oil-bearing microorganisms.
In order to identify the putative sequences of the cDNA promoters / 5'UTR whose expression was upregulated during nitrogen depletion / limitation, total DNA was isolated from Prototheca moriformis (UTEX 1435) which grew under abundant conditions of Nitrogen and subjected to sequencing using 454 sequencing technology (Roche). CDNAs marked as upregulated based on results
359
ΙΜΡΙ
MEXICAN INSTITUTE OE LA PROPIfDAL 'INDUSTRIAL
<img file="MX339639B_D0331.tif" />
from previous RT-PCRs, were compared by using BLAST against the assembled contigs that came from 454 sequencing readings of the genome. The 5 'ends of the cDNA were correlated with specific contigs, and if possible, more than 500bp of the 5' flank of DNA was used to identify putative promoters / UTRs. The presence of the / 5'UTR promoters was subsequently confirmed and cloned by PCR amplification of the genomic DNA. The individual 5 'ends of the cDNA were used to design the 3' primers and the 5 'ends of the contig 454 assemblies were used to design the gene-specific 5' primers.
As a first screening, one of the putative promoters, the 5'UTR / Aat2 isolated promoter (ammonium transporter, sec. ID #: 63), was cloned into the Cinnamomum camphora C14 thioesterase construct with the transit peptide of the stearoyl ACP desaturase from Chlorella protothecoides, replacing the promoter of glutamate dehydrogenase from C. sorokinana. This construct is listed as sec. with no. Ident .: 81. To test the putative promoter, the thioesterase construct was transformed into Prototheca moriformis cells to confirm the actual activity of the promoter by detecting an increase in
<img file="MX339639B_D0332.tif" />
360
IMPI
MBXICAN INSTITUTE OF PROPERTY industrial C14 / C12 fatty acids under low / no nitrogen conditions, using the methods described above. Similar tests for putative nitrogen-regulating promoters that are isolated from cDNA / genome detection can be done using the same methods.
Other putative 5'UTR / nitrogen-regulated promoters that were isolated from cDNA / genome detection were:
sec. with no. ident ..
times
5'UTR / boost promoter
5'UTR / FatB / A promoter n / a
5'UTR / NRAMP promoter
9.65 sec. with no. ident .: 55 sec. with no. ident .: 56 metal conveyor
5 'UTR / protein promoter sec. with no. ident.
4.92
Associated Flagellar Flap
5'UTR / sulfite promoter
10.91 sec. with no. ident .: 58 SulfRed reductase
361
ΙΜΡΙ <sup>, NST</sup>'íi7? * l «' CAN» l of the property
INDUSTRY!
<img file="MX339639B_D0333.tif" />
5'UTR / transporter promoter sec. with no. ident .: 59
SugT sugar 17.35
5'UTR / transporter promoter sec. with no. ident.
10.1 Ammonium 03 Amt03
5'UTR / transporter promoter sec. with no. ident.
10.76 ammonium 02 Amt02
5'UTR / transporter promoter sec. with no. ident.
6.21 Amino Acid 01 AatOl
5'UTR / transporter promoter sec. with no. ident.
6.5 Amino Acid 02 Aat02
5'UTR / transporter promoter sec. with no. ident,
7.87 from amino acid 03 Aat03
5'UTR / transporter promoter sec. with no. ident.
10.95 Amino Acid 04 Aat04
5'UTR / transporter promoter sec. with no. ident.
6.71
362
IMPI
INSTITUTO MEXICAIK Ot LA RROPIEDAI. INDUSTRIAL
<img file="MX339639B_D0334.tif" />
amino acid 05 Aat05
The times of increase refers to the times of increase in abundance of cDNA after 24 hours of culture in low nitrogen medium.
To gain a better understanding of the potential regulation of these putative promoters / 5'UTRs, eight of the sequences were selected for further testing: (1) FatB / A; (2) sulfite reductase SulfRed; (3) SugT sugar transporter; (4) ammonium transporter 02 Amt02; (5) amino acid transporter 01 AatOl; (6) amino acid transporter 03 Aat03; (7) amino acid transporter 04 Aat04; and (8) amino acid transporter 05 Aat05. High resolution transcriptome analysis using Illumina sequencing readings were performed on RNA isolated from cells of
Prototheca moriformis from various time points: T0 (seed); 20 hours; 32 hours; 48 hours; 62 hours; and 114 hours after seed inoculation. The medium at T0 (seed) was filled with nitrogen, whereas at time points of 20 hours and longer, the medium contained little or no nitrogen. The assembled transcribed contigs, generated from RNA isolated from each of the time points, were then compared
363
IMPI
<img file="MX339639B_D0335.tif" />
MEXICAN INSTITUTE OE LA «ΟΝΒΠαΟ
INIXISTRIAI _ independent with each of the eight previously identified transcripts. The results are summarized in the
Table 18 below.
Table 18. Transcriptome expression profiles for eight putative 5'UTR / promoters.
<td></td><td>CDNA</td><td></td><td>Ts</td><td>T20</td><td>T32</td><td>T48</td><td>T62</td><td>T114</td>
<td>aa</td><td>trans 01</td><td>absolute</td><td> 98</td><td> 96</td><td> 321</td><td> 745</td><td> 927</td><td> 1300</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 0.98</td><td> 3.28</td><td> 7.61</td><td> 9.47</td><td> 13.28</td>
<td>aa</td><td>trans_03</td><td>absolute</td><td> 7</td><td> 21</td><td> 51</td><td> 137</td><td> 102</td><td> 109</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 2.95</td><td> 7.2</td><td> 19.42</td><td> 14.47</td><td> 15.45</td>
<td>aa</td><td>trans 04</td><td>absolute</td><td> 1</td><td> 6</td><td> 25</td><td> 90</td><td> 131</td><td> 160</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 5.16</td><td> 21.29</td><td> 74.97</td><td> 109.35</td><td> 133.31</td>
<td>aa</td><td>trans 05</td><td>absolute</td><td> 109</td><td> 88</td><td> 123</td><td> 210</td><td> 214</td><td> 273</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 0.81</td><td> 1.13</td><td> 1.93</td><td> 1.97</td><td> 2.51</td>
<td colspan="2">trans ammon 02</td><td>absolute</td><td> 683</td><td> 173</td><td> 402</td><td> 991</td><td> 1413</td><td> 1397</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 0.25</td><td> 0.59</td><td> 1.45</td><td> 2.07</td><td> 2.04</td>
<td colspan="2">fatA / B-l_cDNA</td><td>absolute</td><td> 13</td><td> 36</td><td> 654</td><td> 617</td><td> 544</td><td> 749</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 2.8</td><td> 51.57</td><td> 48.65</td><td> 42.9</td><td> 59.1</td>
<td>sug</td><td>trans 01</td><td>absolute</td><td> 25</td><td> 25</td><td> 106</td><td> 261</td><td> 266</td><td> 251</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 1</td><td> 4.22</td><td> 10.4</td><td> 10.63</td><td> 10</td>
<td>sulphite</td><td>reductase 01</td><td>absolute</td><td> 634</td><td> 238</td><td> 138</td><td> 145</td><td> 163</td><td> 155</td>
<td></td><td></td><td>relative</td><td> 1</td><td> 0.38</td><td> 0.22</td><td> 0.22</td><td> 0.26</td><td> 0.24</td>
From the results summarized above, several of the transcripts show increased accumulation over time, although interestingly, the mRNA of the
364
IMPI
Mexican INSTITUTE «LA AROPIPDAl, industrial
<img file="MX339639B_D0336.tif" />
Sulfite reductase shows a clear decrease in the accumulation of mRNA over time.
These eight putative promoter / 5'UTR regions were cloned upstream of the C. camphora thioesterase coding region with their natural transit peptide removed and replaced with the Chlorella protothecoides stearoyl ACP desaturase transit peptide (UTEX 250). . Each construct of the putative promoter / 5'UTR region was introduced into Prototheca moriformis UTEX 1435 via the homologous recombination pathway using DNA from the 6S region genomic sequences. Also within the construct is a gene for sucrose invertase suc2 from S.
cerevisiae for selection of positive clones in sucrose-containing media / plates. The cDNA sequence for the relevant portions of the construct for AatOl is listed in the sequence list as sec. with no. Ident .: 67. For the other constructs, the same backbone was used, the only variable being the putative promoter / 5'UTR sequence. An additional transgenic control strain was generated in which the C beta tubulin promoter. reinhardtii was used to boost expression of the C. camphora thioesterase gene. This promoter has been shown to drive the constitutive expression of the gene of interest, and
365
IMPI
MUICANO INSTITUTE Dt LA rXBntDA · INBUSTKIAI
<img file="MX339639B_D0337.tif" />
thus it provides a useful control against which to measure the expression of the same thioesterase message when driven by several putative N-regulated / 5'UTR promoters tested.
Once the transgenic clones were generated, three separate experiments were carried out. The first two experiments evaluated the nitrogen regulatory potential of the eight putative promoters by measuring the steady state of thioesterase mRNA levels via RT-PCR, fatty acid profiles, and ammonia levels in the supernatant. Of crops. The clones were initially grown at 28 ° C with shaking (200rpm) in nitrogen rich seeding medium (lg / 1 ammonium nitrate — 15mM nitrogen as ammonia, 4g / l yeast extract) for 48 hours, at which time OD units (A<sub>750</sub>) were used to inoculate 50 ml of low nitrogen medium (0.2 g / 1 ammonium sulfate — 3mM nitrogen as ammonia, 0.2 g / 1 yeast extract). Cells were sampled every 24 hours for 6 days and a sample was also collected before switching to low nitrogen conditions. A portion of the cells from each sample was then used for extraction of the total RNA through the use of the Trizol reagent (according to the methods suggested by the manufacturer). Ammonia tests revealed that
366
IMPI
MEXICAN INSTITUTE OE LA FROFIOAV INDUSTRIA!
<img file="MX339639B_D0338.tif" />
Ammonia levels in the supernatants fell below the detection limits (~ ΙΟΟμΜ) after 24 hours in low nitrogen medium.
For real-time RT-PCR, all RNA levels were normalized to the levels of an internal control RNA expressed in Prototheca moriformis (UTEX 1435) for each time point. Internal control RNA, designated cdl89, is a product of the ARG9 gene that encodes N-acetyl ornithine aminotransferase. The primer sets used for real-time RT-PCR in these experiments were:
<td>Specific gene</td><td>Primer sequence</td><td>Sec. With</td>
<td>for</td><td> 5' -3'</td><td>no. Ident .:</td>
<td>C. camphora TE</td><td>TACCCCGCCTGGGGCGACAC</td><td>Sec. With</td>
<td>direct</td><td></td><td>no. ident .: 68</td>
<td>C. camphora TE</td><td>CTTGCTCAGGCGGCGGGTGC</td><td>Sec. With</td>
<td>reverse</td><td></td><td>no. ident .: 69</td>
<td>cdl89 direct</td><td>CCGGATCTCGGCCAGGGCTA</td><td>Sec. With</td>
<td></td><td></td><td>no. ident .: 70</td>
<td>cd! 89 inverse</td><td>TCGATGTCGTGCACCGTCGC</td><td>Sec. With</td>
<td></td><td></td><td>no. ident .: 71</td>
The lipid profiles of transformants from each time point were also generated and compared with the RT-PCR results. Based on levels
367
IMPI '<sup>NST</sup>'ní7 ?.<sup>M £ x, CAN</sup><> Dt U PMWE »Aü <sup>IN</sup>l »l'STm<sub>TO</sub>,
<img file="MX339639B_D0339.tif" />
of ammonia, RT-PCR results and changes in C12-C14 fatty acid levels, it was concluded that the amino acid transporter 01 (Aat-01), amino acid transporter 04 (Aat-04), and amino acid 02 (Amt-02) if they contain a 5'UTR / functional nitrogen-regulatable promoter.
Based on the RT-PCR results, Aat-01 demonstrated the ability to boost the steady state of C. camphora thioesterase mRNA levels up to four times greater than the control (beta tubulin promoter from C. reinhardtii). MRNA levels were further correlated with nitrogen limitation and a marked increase in C12-C14 fatty acid levels. These results demonstrated that the 5'UTR associated with the promoter
Aat-Oles is probably more effective in driving protein synthesis under lipid biosynthesis than the C. reinhardtii control promoter. Like the Aat-01 promoter, the Aat-04 promoter was able to drive mRNA accumulation up to five times greater than that of the C control promoter.
reinhardtii. However, the Aat-04 promoter construct produced only a modest ability to impact C12-C14 fatty acid levels. These data demonstrated that the Aat-04 promoter is clearly dimmable by depletion of
368
IMPI
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX339639B_D0340.tif" />
nitrogen, but the UTR associated with the promoter probably works poorly as a translation enhancer. Lastly, the Amt-02 promoter was similar to the Aat-01 promoter, in that it was able to drive mRNA accumulation up to three times greater than that of the control promoter. MRNA levels were further correlated with nitrogen limitation and a marked increase in C12-C14 fatty acid levels. Together these three promoters were shown to be nitrogen regulated.
B. Further characterization of the ammonium transporter 3 promoter (amt03) and expression of various thioesterases.
As described above, the
Partial cDNAs called ammonium transporters 02 and 03 15 (amt02 and amt03). Along with these two partial cDNAs, a third partial cDNA called ammonium transporter 01 (amtOl) was further identified. The alignment of the translated amino acid sequences of the putative and partial cDNAs were compared. The results showed that amtOl was more distant in relation to the three sequences, whereas amt02 and amt03 differed only in a single amino acid.
The / 5'UTR promoters were initially generated in silico by comparing the sequences of the partial cDNA against the
369
IMPI
INSTITUTO MSXICAM. OF THE P 'P | 1¡><sub>AD </sub>INDUSTRIAL
<img file="MX339639B_D0341.tif" />
Roche 454 genomic DNA assemblies and Illumina transcriptome assemblies as described above. The transcribed contigs were identified that showed identity with the cDNA encoding amtOl, amt02, and amt03, however, the transcribed contigs could not be differentiated between the three mRNAs since the contigs contained sequences shared by all three. Roche 454 genomic DNA assemblies gave access to the sequences of
CDNAs amt02 and amt03 and contained N-terminal protein sequences. PCR was carried out to clone the 5 'flanking regions. The PCR primers used to validate the promoter / UTR of the clone amt02 and amt03 were:
Direct amt03: 5'-GGAGGAATTCGGCCGACAGGACGCGCGTCA-3 '(sec. With ID #: 85)
Reverse Amt03: 5'-GGAGACTAGTGGCTGCGACCGGCCTGTG-3 '(Sec. With ID #: 86)
Direct amt02: 5'-GGAGGAATTCTCACCAGCGGACAAAGCACCG-3 '(sec.
with no. ID: 87)
Reverse Amt02: 5'-GGAGACTAGTGGCTGCGACCGGCCTCTGG-3 '(Sec. With ID #: 88)
370
ΙΜΡΙ
INSTITUTO MEXICANO r »e la mofiídad ¡NOUSTRIAL
<img file="MX339639B_D0342.tif" />
In both cases, the 5 'and 3' primers contained restriction sites for early cloning into expression vectors to validate the functionality of these regions.
5 'UTR / promoter.
Pairwise alignment was performed between the cloned DNAs by this method based on the combination of the PCR and in silico and the original cDNA encoding amt02 (sec. With ID no .: 61) and amt03 (sec. With no. Ident .: 60).
The results of these alignments showed significant differences between the original cDNAs and the cloned genomic sequences, indicating that the ammonium transporters probably represent a diverse gene family. In addition, the / 5'UTR promoter clone based on the combined method for amt03 was different from the original amt03 sequence, whereas the amt02 sequences were identical. Additional experiments to characterize the promoter / UTR sequence amt03 (sec. With ID #: 89) were performed and described below.
The amt03 promoter / UTR sequence identified above (SEQ ID NO: 89) was tested by cloning this putative promoter / UTR sequence to drive expression of four different thioesterases. The cassette of
<img file="MX339639B_D0343.tif" />
371 expression contained recombination sequences homologous upstream and downstream to the 6S locus of the genome (seq. with ID #: 82 and 84, respectively). The cassette further contained a S. sucrose invertase cDNA.
cerevisiae SUC2 to allow selection of positive clones in medium containing sucrose. Expression of sucrose invertase was driven by the C. reinhardtii beta tubulin promoter and further contained a C. vulgaris nitrate reductase 3'UTR the promoter / UTR sequence amt03 was then cloned downstream of the sucrose invertase cassette followed by the thioesterase in-frame cDNA sequence of one of the four thioesterase genes of: (1) C14 thioesterase C. camphora; (2) thioesterase C12 from U.
californica; (3) C10-C16 thioesterase from U. americana; or (4) CIO thioesterase from C. hookeriana and also contained a C. vulgaris nitrate reductase 3'UTR. Thioesterase C14 from
C. camphora, U. californica thioesterase C12, and U. americana thioesterase C10-C16 all contained the transit peptide of a stearoyl ACP desaturase from
Chlorella protothecoides. C. hookeriana CIO thioesterase contained the transit peptide of a Prototheca moriformis delta 12 fatty acid desaturase (FAD). In all cases, the sequences were optimized by codon for the
<img file="MX339639B_D0344.tif" />
372 expression in Prototheca moriformis. The methods for the above thioesterase constructs are described in
Sequence List:
promoter / UTR amt03 :: thioesterase construct sec. with no. Ident .: 90 of C. camphora C. camphora thioesterase construct with no. ID: 91 U. californica thioesterase construct with no. ID: 92 U. americana thioesterase construct with no. ID: 93 C. hookeriana thioesterase construct with no. Ident .: 94 sec.
sec.
sec.
sec.
The transgenic lines were generated via the biolistic transformation methods as described above in Example 2 in the wild cells of
Prototheca moriformis and selection was carried out on plates / medium containing sucrose. Positive lines were then selected for the degree to which their fatty acid profiles were altered. Four lines, one resulting from the transformation with each of the
373
ΙΜΡΙ »MEXICAN INSTITUTE Say THE INWISTRIAL PROPERTY s ^ gan» four constructs described above, then
<td>subdued</td><td>to analysis</td><td>additional.</td><td>Line 76</td><td>express</td><td>the</td>
<td>thioesterase</td><td>C14 of C.</td><td>. camphora,</td><td>line 37</td><td>express</td><td>the-</td>
<td>thioesterase</td><td>C12 from U.</td><td>calli fornica,</td><td>line 60</td><td>express</td><td>the</td>
<td>thioesterase</td><td>C10-C16 from</td><td>U. americana,</td><td>and line 56</td><td>express</td><td>the</td>
<td>thioesterase</td><td>CIO of C.</td><td>hookeriana.</td><td>Each line</td><td colspan="2">it was cultivated</td>
<td>for 48</td><td colspan="3">hours in medium containing sucrose</td><td colspan="2">as unique</td>
carbon source and cell samples were taken at 14,
24, 36 and 48 hours (seed culture) for the determination of the fatty acid profile through the direct transesterification of fatty acid methyl esters and the subsequent analysis by GC-FID (described above) and for the isolation of total RNA . At the end of 48 hours, these cells were used to inoculate cultures with low or no nitrogen levels (contained sucrose as the sole carbon source) maintained at pH 5.0 (citrate-buffered, final concentration 0.05M) or pH 7.0 (buffered with HEPES). , final concentration 0.1 M). Samples were taken from the culture at
12, 24, 72 and 108 hours (lipid production) for the fatty acid profile and the isolation of total RNA. Ammonia tests of these cultures revealed that ammonia levels fell below the detection limits (ca.
100 μΜ) after 24 hours in low nitrogen medium.
374
IMPI
MEXICAN INSTITUTE OE INDUSTRIAL PROPERTY
<img file="MX339639B_D0345.tif" />
Real-time RT-PCR assays on thioesterase mRNA levels were performed on total RNA from each of the time points collected above and all mRNA levels were normalized to the levels of a control internal RNA (cdl89). The primer sets used in the real-time PCR are shown in Table 19 below:
Table 19. Primer sets for real-time PCR.
<td colspan="2">Specific gene for</td><td>Primer sequence 5'-</td><td>Sec.</td><td>with</td><td>no.</td>
<td></td><td></td><td> 3'</td><td colspan="2">Ident .:</td><td></td>
<td>C.</td><td>camphora TE direct</td><td>TACCCCGCCTGGGGCGACAC</td><td>Sec.</td><td>with</td><td>no.</td>
<td></td><td></td><td></td><td>ident</td><td> . : 68</td><td></td>
<td>C.</td><td>reverse camphora TE</td><td>CTTGCTCAGGCGGCGGGTGC</td><td>Sec.</td><td>with</td><td>num</td>
<td></td><td></td><td></td><td>ident</td><td> . : 69</td><td></td>
<td>or.</td><td>Californica TE</td><td>CTGGGCGACGGCTTCGGCAC</td><td>Sec.</td><td>with</td><td>num</td>
<td colspan="2">direct</td><td></td><td>ident</td><td> . : 95</td><td></td>
<td>OR.</td><td>Californica TE</td><td>AAGTCGCGGCGCATGCCGTT</td><td>Sec.</td><td>with</td><td>num</td>
<td colspan="2">reverse</td><td></td><td>ident</td><td> . : 96</td><td></td>
<td>OR.</td><td>American TE direct</td><td>CCCAGCTGCTCACCTGCACC</td><td>Sec.</td><td>with</td><td>num</td>
<td></td><td></td><td></td><td>ident</td><td> . : 97</td><td></td>
<td>or.</td><td>American reverse TE</td><td>CACCCAAGGCCAACGGCAGCGCCGTG</td><td>Sec.</td><td>with</td><td>num</td>
<td></td><td></td><td></td><td>ident</td><td> . : 98</td><td></td>
<td>c.</td><td>hookeriana TE</td><td>TACCCCGCCTGGGGCGACAC</td><td>Sec.</td><td>with</td><td>num</td>
direct ident .: 99
C.
hookeriana reverse cdl89 reverse
375
TE AGCTTGGACAGGCGGCGGGT
TCGATGTCGTGCACCGTCGC
IMPI
MEXICAN INSTITUTE. OF THE PROPERTY
INDUSTRIAL
<img file="MX339639B_D0346.tif" />
Sec. With ID number: 100
Sec. With no.
Ident .: 71 cd! 89 direct
CCGGATCTCGGCCAGGGCTA
Sec. With no.
ident .: 70
The results of the fatty acid profiles at each of the time points in the seed culture phase showed very little impact of thioesterases. With the beginning of the lipid production phase, fatty acid profiles were significantly affected, with increases being much more dramatic for cultures maintained at pH 7.0 compared to cultures at pH 5.0. Although the magnitude of the difference between pH 7.0 and 5.0 varied the accumulation of the target fatty acid with each test thioesterase, the overall effect was the same: that the cells grown at pH 5.0 showed significantly lower levels of the accumulated target fatty acids , but more than compared to wild control cells.
Analysis of the RNA isolated from these same samples correlated very well with the fatty acid profile data, in which there was a clear impact of culture pH on steady state mRNA levels for each of the
376
<img file="MX339639B_D0347.tif" />
thioesterases. Taken together the fatty acid accumulation data and the mRNA data, the pH regulation of the expression of the thioesterase gene driven by the promoter / UTR of amt03 was clearly mediated either at the level of transcription, of the stability of MRNA or both.
Furthermore, it was observed that the equilibrium levels of the mRNA of
U. cali fornica were four logs lower compared to the steady state levels of C mRNA.
hookeriana. This observation is consistent with the hypothesis that individual mRNA sequences may play a role in controlling expression. These data imply that ammonium uptake in Prototheca moriformis by the amt03 transporter family is directly coupled to pH.
Further analysis of the fatty acid profile was performed on twelve lines generated from the transformation of Prototheca moriformis cells with the amt03 promoter / UTR construct that drives the expression of U. americana thioesterase C10-C16. Line 60, described above, was a part of the following analysis. The Table below shows the lipid profiles of three of the twelve lines that were analyzed together with the wild-type control.
377
Table 20.
Transformant Fatty Acid Profiles
IWSTmTO MÍXICANC OF THE PROPERTY
INDUSTRIAL containing U. americana TE powered by the
UTR / amt03 promoter.
<td>Area%</td><td>C8: 0</td><td>C10: 0</td><td>C12: 0</td><td>C14: 0</td><td>C16: 0</td><td>C18: 0</td><td>C18: l</td><td>C18: 2</td><td>Saturated totals</td>
<td>wild</td><td> 0.00</td><td> 0.01</td><td> 0.04</td><td> 1.27</td><td> 27.20</td><td> 3.85</td><td> 58.70</td><td> 7.18</td><td> 32.36</td>
<td>Line 40</td><td> 2.38</td><td> 20.61</td><td> 3.41</td><td> 28.41</td><td> 29.92</td><td> 1.91</td><td> 8.57</td><td> 3.74</td><td> 86.64</td>
<td>Line 44</td><td> 1.50</td><td> 20.16</td><td> 4.44</td><td> 31.88</td><td> 26.66</td><td> 1.88</td><td> 6.95</td><td> 5.42</td><td> 86.50</td>
<td>Line 60</td><td> 0.98</td><td> 14.56</td><td> 3.15</td><td> 27.49</td><td> 31.76</td><td> 2.14</td><td> 12.23</td><td> 6.36</td><td> 80.06</td>
As shown in the table above, the total saturated levels increased dramatically over the wild in the case of line 4 0 compared to the wild (the total saturates of the twelve lines analyzed were in the range from about 63% to over 86%). Furthermore, thioesterase from U. americana, when expressed at these levels, dramatically reduced the level of unsaturates, especially C18: ly
C18: 2 (see lines 40 and 44), where in line 44 C18: 1 levels were reduced by more than 8 times compared to wild. In addition, U. americana thioesterase (driven by the amt03 promoter) greatly increases levels of medium chain fatty acids. The
<img file="MX339639B_D0348.tif" />
378
ΙΜΡΙ
MEXICAN INSTITUTE OF PROEIEDAI. '.
INDUSTRIAL line 44 shows C10: 0-C14: 0 levels greater than 56%, approximately 42 times greater than the levels observed in the wild strain and C8: 0-C14: 0 levels greater than 57%.
Additional strains transformed with an Amt03 promoter construct that drives expression of thioesterase from
U. americana had the representative lipid profile of:
0.23% C8: 0; 9.64% C10: 0; 2.62% C12: 0; 31.52% C14: 0; 37.63%
C16: 0; 5.34% C18: 0; 7.05% C18: l; and 5.03% C18: 2, with a total percentage of saturates at 86.98%.
The additional lipid profiles generated from the transformation of Prototheca moriformis cells with the promoter / UTR construct amt03 (seq. With ID no .: 89) that drives the expression of thioesterase CIO from
C. hcokeriana (section with ID number: 94). Positive clones expressing this construct were selected and grown under pH 7.0 conditions. The representative lipid profile of a positive clone was: 9.87% C8: 0; 23.97%
C10: 0; 0.46% C12: 0; 1.24% C14: 0; 10.24% C16: 0; 2.45% C18: 0;
42.81% C18: l; and 7.32% C18: 2. This clone had a percentage of
C8-C10 from 33.84
Taken together, the data suggests that the amt03 promoter / UTR, and other similar promoters, can be used as a strictly regulated promoter, which may be
<img file="MX339639B_D0349.tif" />
379
IMPI
INSTITUTO MEX1CA Nf DE LA PROPUDAt INDUSTRIAL particularly useful for expressing a c <
potentially toxic and for the rigorous control of gene expression that is required. The ability of Prototheca moriformis to grow under a wide variety (at least pH
5.0 to 7.0) pH regimes makes this organism particularly useful in conjunction with regulatory elements such as the amt03 promoter / UTR. Furthermore, the lipid profile data above demonstrates the strong ability of the amt03 promoter / UTR to drive gene expression.
EXAMPLE 11: Alteration of saturated fatty acid levels in Prototheca moriformis microalgae
As part of genomic screening using a bioinformatics-based approach based on cDNA sequencing, Illumia transcriptome and Roche 454 15 genomic DNA from Prototheca moriformis (UTEX 1435), two specific groups of genes involved in the desaturation of fatty acids the following were identified:
ACP desaturases (SAD) and delta 12 fatty acid desaturases (Δ12 FAD). Stearoyl ACP desaturase enzymes are part of the lipid synthesis pathway and function to introduce double bonds into fatty acyl chains, for example, the synthesis of C18 fatty acids: splitting
<img file="MX339639B_D0350.tif" />
380
ΙΜΡΙ
INSTITUTO MÉXICANO of the industrial propibdat of fatty acids C18: 0. Delta 12 fatty acid desaturases are also part of the lipid synthesis pathway and function to introduce double bonds into already unsaturated fatty acids, eg, fatty acid synthesis
C18: 2 from C18: 1 fatty acids. Southern blot analysis using probes based on the two classes of fatty acid desaturase genes identified during bioinformatics efforts indicated that each class of desaturase genes was likely composed of multiple family members. Furthermore, the genes encoding the stearoyl ACP desaturases were divided into two distinct families. Based on these results, three gene disruption constructs were designed to potentially interrupt multiple members of the gene family by targeting the most conserved coding regions within each family of desaturase enzymes.
Three homologous recombination targeting constructs were designed using: (1) highly conserved portions of the coding sequence for members of the delta 12 fatty acid desaturase family (dl2FAD) and (2) two targeting constructs to each of the two different SAD families, each with
381
<img file="MX339639B_D0351.tif" />
IMPÍ
INSTITUTE M EX ICA Ni OF INDUSTRIAL PROPERTY conserved regions of the coding sequences of each family. This strategy would integrate a selectable marker gene (the suc2 invertase sucrose cassette from S. cerevisiae that confers the ability to hydrolyze sucrose) in these highly conserved coding regions (by targeting multiple family members) rather than the classic gene replacement strategy where homologous recombination would be targeting the flanking regions of the target gene.
All constructs were introduced into cells by biolistic transformation using the methods described above and the constructs were linearized prior to firing into cells. Transformants were selected on plates / medium containing sucrose and changes in lipid profile were assayed using the method described above. The relevant sequences of each of the three targeting constructs are listed below.
Description sec. with no. Ident .:
sequence 5 'of the coding region of dl2FAD sec. with no. ID: 72
<img file="MX339639B_D0352.tif" />
from dl2FAD
382 of the 3 'sequence targeting construct of the coding region sec. with no. Ident .: 73 of the targeting construct cDNA sequence of construct no. Ident .: 74 directionalization dl2FAD sequence 5 'of the coding region with no. Ident .: 75 sequence 3 'of the coding region with no. Ident .: 76 cDNA sequence of construct no. Ident .: 77 SAD2A targeting 5 'sequence of coding region with no. Ident .: 78 sequence 3 'of the coding region with no. Ident .: 79 cDNA sequence of construct no. Ident .: 80 sec. with SAD2A sec.
from SAD2A sec.
sec. with SAD2B sec.
from SAD2B sec.
sec. with SAD2B addressing
383
IMPI
MEXICAN INSTITUTE OF INOUSTRIAL PROPERTY
<img file="MX339639B_D0353.tif" />
The positive clones representative of the transformations with each of the constructs were collected and the lipid profiles of these clones were determined (expressed in% of the area) and are summarized in the
Table 21 below.
Table 21. Lipid profiles for desaturase knockouts.
<td></td><td>Acid</td><td>dl2FAD KO</td><td>SAD2A KO</td><td>SAD2B KO</td><td>wt UTEX</td>
<td></td><td>fatty</td><td></td><td></td><td></td><td> 1435</td>
<td> 10</td><td>C8: 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>
<td></td><td>C10: 0</td><td> 0.01</td><td> 0.01</td><td> 0.01</td><td> 0.01</td>
<td></td><td>C12: 0</td><td> 0.03</td><td> 0.03</td><td> 0.03</td><td> 0.03</td>
<td></td><td>C14: 0</td><td> 1.08</td><td> 0.985</td><td> 0.795</td><td> 1.46</td>
<td></td><td>C16: 0</td><td> 24.42</td><td> 25.335</td><td> 23.66</td><td> 29.87</td>
<td> 15</td><td>C18: 0</td><td> 6.85</td><td> 12.89</td><td> 19.555</td><td> 3.345</td>
<td></td><td>C18: l</td><td> 58.35</td><td> 47.865</td><td> 43.115</td><td> 54.09</td>
<td></td><td>C18: 2</td><td> 7.33</td><td> 10.27</td><td> 9.83</td><td> 9.1</td>
<td></td><td>C18: 3 alpha</td><td> 0.83</td><td> 0.86</td><td> 1</td><td> 0.89</td>
<td></td><td>C20: 0</td><td> 0.48</td><td> 0.86</td><td> 1.175</td><td> 0.325</td>
<td> 20</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>Every</td><td>one of the</td><td>constructs</td><td>had an impact</td><td>measurable</td>
<td></td><td colspan="2">the desired class of</td><td>fatty acid</td><td>and in all three</td><td>cases</td>
C18: 0 levels increased markedly, particularly with
384
IMPí
ΙΝαΤΠΤ / το m SX1CANI. OE LA MOHEDAL-, industrial
<img file="MX339639B_D0354.tif" />
the two SAD knockouts. Further comparison of multiple clones from SAD knockouts indicated that the -SAD2B knockout lines had significantly greater reductions in C18: 1 fatty acids than the C18: 1 fatty acid levels observed with the SAD2A knockout lines.
Fatty acid desaturase knockouts were generated
Additional Δ12 (FAD) in a Prototheca moriformis background by using the methods described above. In order to identify the homologous potential of A12FAD, the following primers were used in order to amplify a genomic region encoding a putative FAD:
Primer. 1 5'-TCACTTCATGCCGGCGGTCC-3 'sec. with no. ID: 101
Primer 2 5'- GCGCTCCTGCTTGGCTCGAA-3 'sec. with no. ID: 102
The sequences resulting from genomic amplification of Prototheca moriformis genomic DNA by use of the above primers were very similar, but indicated that several genes or alleles of FAD Δ12 exist in
Prototheca.
Based on this result, two gene disruption constructs were designed that sought to deactivate one or more of
<img file="MX339639B_D0355.tif" />
385
IMPI
INSTITUTO MEXICANO at LA PROPIEDAD INDUSTRIA!
the A12FAD genes. The strategy would integrate a sucrose invertase cassette (S. cerevisiae suc2), thus conferring the ability to hydrolyze sucrose as a selectable marker, into the highly conserved coding regions rather than using a classical gene replacement strategy. The first construct, designated pSZ1124, contained 5 'and 3' genomic targeting sequences flanking a C-β-tubulin promoter.
reinhardtii to drive expression of the S. cerevisiae suc2 gene and a Chlorella vulgaris nitrate reductase 3'UTR (S. cerevisiae suc2 cassette). The second construct, designated pSZ1125, contained 5 'and 3' genomic targeting sequences flanking a C. reinhardtii β-tubulin promoter to drive expression of the S. cerevisiae suc2 gene and a 3'UTR of nitrate reductase from Chlorella vulgaris. The relevant sequences of the constructs are listed in the sequence list:
5 'genomic targeting sequence of sec. with no. ID: 103 pSZ1124 (FAD2B) 3 'genomic targeting sequence of sec.
with no. ID: 104 pSZ1124 (FAD2B)
386 S. cerevisiae suc2 cassette no. Ident .: 105 genomic targeting sequence sec. with no. ID: 106
IMPI
MEXICAN INSTITUTE OE LA PtOFíBPAD INDUSTRIAL
<img file="MX339639B_D0356.tif" />
sec. with pSZ1125 (FAD2C) 3 'genomic targeting sequence of sec.
with no. Ident .: 107 pSZ1125 (FAD2C) pSZ1124 and pSZ1125 were each introduced into a Prototheca moriformis background and positive clones were selected based on the ability to hydrolyze sucrose. Table 22 summarizes the lipid profiles (in% of area, generated by using the methods described above) obtained in two transgenic lines in which the targeting vectors pSZ1124 and pSZ1125 were used.
Table 22. Lipid profiles of Δ12 knockouts
FAD
<td></td><td>CIO: 0</td><td>C12: 0</td><td>C14: 0</td><td>C16: 0</td><td>C16: 1</td><td>C18: 0</td><td>C18: 1</td><td>C18: 2</td><td>C18: 3a</td>
<td>father</td><td> 0.01</td><td> 0.03</td><td> 1.15</td><td> 26.13</td><td> 1.32</td><td> 4.39</td><td> 57.20</td><td> 8.13</td><td> 0.61</td>
<td>FAD2B</td><td> 0.02</td><td> 0.03</td><td> 0.80</td><td> 12.84</td><td> 1.92</td><td> 0.86</td><td> 74.74</td><td> 7.08</td><td> 0.33</td>
<td>FAD2C</td><td> 0.02</td><td> 0.04</td><td> 1.42</td><td> 25.85</td><td> 1.65</td><td> 2.44</td><td> 66.11</td><td> 1.39</td><td> 0.22</td>
387
<img file="MX339639B_D0357.tif" />
IMPÍ • MSTITUTO MEXICANl>
OE THE PROPERTY
INDUSTRIAL ___
The transgene containing the FAD2B construct (pSZ1124) gave a very interesting and unexpected result in the lipid profile, in which the levels of C18: 2, which would be expected to decrease, only decreased by approximately a% of area. However, C18: l fatty acid levels decreased significantly, almost exclusively at the expense of C16: 0 levels, which decreased significantly. The transgenic that contained the construct
FAD2C (pSZ1125) also gave a change in lipid profile: C18: 2 levels were significantly reduced along with a corresponding increase in C18: 1 levels.
Mimetic beef tallow
A positive clone generated from the above SAD2B knockout experiment as described above was selected for use as the background for further introduction of a C14-preferred fatty acyl thioesterase gene. The construct that introduces thioesterase that prefers C14 to C. camphora contained targeting sequences to the genomic region of the genomic region (allowing for directional integration of transformant DNA via homologous recombination) and the expression construct contained the β-tubulin promoter of
C. reinhardtii that drives the expression of the Rneo gene with
<img file="MX339639B_D0358.tif" />
388
IMPI
Mexican INSTITUTE.
I HEAR THE INOUSTMIAL MOÍIÍOAO
Chlorella vulgaris nitrate reductase 3'UTR, followed by a second C. reinhardtii β-tubulin promoter that drives expression of a C. camphora codon-optimized thioesterase with a transit peptide of the Chlorella protothecoides stearoyl ACP desaturase with a second 3'UTR of Chlorella vulgaris nitrate reductase. The genomic 5 'donor sequence of the 6S region is listed in sec. with no. Ident .: 82; the 3 'genomic donor sequence of the 6S region is listed in sec. with no. Ident .: 84; and the relevant expression construct for C. camphora thioesterase is listed in sec. with no. Ident .: 83.
The transformation was carried out through the use of biolistic methods as described above and the cells were allowed to recover for 24 hours on plates containing 2% sucrose. After this time, the cells were resuspended and re-seeded in plates containing 2% sucrose and 50 pg / ml G418 for selection. Nine clones of the generated positive clones were selected for lipid production and lipid profile. All nine transgenic clones (with SAD2B KO and expressing C. camphora C14-preferred thioesterase) were grown as described above and analyzed for lipid profile. The results are
389 summarized below in Table 23.
IMPI Mexican Institute of LA MOHEDA Γ INfHISTWIAI
<img file="MX339639B_D0359.tif" />
The lipid profile for sebum was also included in Table 23 below (National
Research Council 1976: The fat content and composition of animal product).
Table 23. Lipid profile of the thioesterase transformed clones.
<td></td><td>CIO: 0</td><td>C12: 0</td><td>C14: 0</td><td>C16: 0</td><td>C16: l</td><td>C18: 0</td><td>C18: l</td><td>C18: 2</td><td>C18: 3</td><td>C20</td>
<td>SAD2BKO</td><td> 0.01</td><td> 0.33</td><td> 6.13</td><td> 24.24</td><td> 0.19</td><td> 11.08</td><td> 42.03</td><td> 13.45</td><td> 0.98</td><td> 0.73</td>
<td>C. camphora TE clone 1 SAD2BKO</td><td> 0.01</td><td> 0.16</td><td> 3.42</td><td> 23.80</td><td> 0.40</td><td> 9.40</td><td> 50.62</td><td> 10.2</td><td> 0.62</td><td> 0.70</td>
<td>C. camphora TE clone 2 SAD2BKO</td><td> 0.01</td><td> 0.20</td><td> 4.21</td><td> 25.69</td><td> 0.40</td><td> 7.79</td><td> 50.51</td><td> 9.37</td><td> 0.66</td><td> 0.63</td>
<td>C. camphora TE clone 3 SAD2BKO</td><td> 0.01</td><td> 0.21</td><td> 4.29</td><td> 23.57</td><td> 0.31</td><td> 9.44</td><td> 50.07</td><td> 10.07</td><td> 0.70</td><td> 0.70</td>
<td>C. camphora TE clone 4 SAD2BKO</td><td> 0.01</td><td> 0.18</td><td> 3.87</td><td> 24.42</td><td> 0.32</td><td> 9.24</td><td> 49.75</td><td> 10.17</td><td> 0.71</td><td> 0.71</td>
<td>C. camphora TE clone 5 SAD2BKO</td><td> 0.01</td><td> 0.28</td><td> 5.34</td><td> 23.78</td><td> 0.33</td><td> 9.12</td><td> 49.12</td><td> 10.00</td><td> 0.68</td><td> 0.70</td>
<td>C. camphora TE clone 6 SAD2BKO</td><td> 0.01</td><td> 0.15</td><td> 3.09</td><td> 23.07</td><td> 0.32</td><td> 10.08</td><td> 51.21</td><td> 10.00</td><td> 0.66</td><td> 0.74</td>
C. camphora
TE clone 7
390
<img file="MX339639B_D0360.tif" />
<td>SAD2BKO</td><td> 0.01</td><td> 0.29</td><td> 5.33</td><td> 24.62</td><td> 0.37</td><td> 7 .</td><td> 02</td><td> 49.67</td><td colspan="2">W LA PR »ιρ<sub>) ΕϋΑ |</sub>, wnomuAi 10.74 0.69</td>
<td>C. camphora TE clone 8 SAD2BKO</td><td> 0.01</td><td> 0.12</td><td> 2.74</td><td> 25.13</td><td> 0.30</td><td> 10</td><td> .17</td><td> 50.18</td><td> 9.42</td><td> 0.71</td>
<td>C. camphora TE clone 9 Wt UTEX</td><td> 0.01</td><td> 0.02</td><td> 0.96</td><td> 23.06</td><td> 0.79</td><td> 3 .</td><td> 14</td><td> 61.82</td><td> 9.06</td><td> 0.46</td>
<td>1435 SAD2BKO</td><td> 0.01</td><td> 0.03</td><td> 0.80</td><td> 23.66</td><td> 0.13</td><td> 19</td><td> .56</td><td> 43.12</td><td> 9.83</td><td> 1.00</td>
<td>Tallow</td><td> 0.00</td><td> 0.00</td><td> 4.00</td><td> 26.00</td><td> 3.00</td><td> 14</td><td> .00</td><td> 41.00</td><td> 3.00</td><td> 1.00</td>
0.71
0.27
1.18
0.00
As can be seen in Table 23, the lipid profiles of the transgenic lines are very similar to the lipid profile of the sebum. Taken together, the data demonstrate the utility of combining specific transgenic backgrounds, in this case a SAD2B knockout with a C14-preferred thioesterase (from C. camphora), to generate a transgenic algae strain that produces oil similar to the lipid profile. sebum.
The construct was used for the down-regulation of β-ketoacyl synthetase II (KASII) expression by the dlrecclonalized knockout approach.
The downregulation vector of KASII gene expression was introduced by the directionalized knockout approach into a derivative mutated in the classical manner.
391
UTEX 1435, S1331.
industry
The Sacch invertase gene
INSTITUTO MEXICANO OE LA PROPIEDAD INDUSTRIAL are
<img file="MX339639B_D0361.tif" />
cerevísiae was used as a selectable marker, by conferring the ability to grow in sucrose. The invertase expression cassette under the control of the promoter of the
C. reinhardtii B-tubulin was inserted into the medium of the 315bp long genomic region of KASII to allow for directionalized integration (pSZ1503).
Relevant restriction sites in pSZ1503 were indicated in lowercase, bold and underlined and are 5'-3 '
BspQ 1, Κρη I, AscI, Xho I, Sac I, BspQ I, respectively.
BspQI sites delimit the 5 'and 3' ends of the transforming DNA. The lowercase and bold sequences represent the S1331 genomic DNA that enables directional integration at the KASII locus via homologous recombination. The B-tubulin promoter from
C. reinhardtii acts in the 5 'to 3' direction, and drives expression of the yeast sucrose invertase gene (by conferring the ability of S1331 to metabolize sucrose) indicated by the text in the box. The ATG initiator and TGA terminator for the invertase were indicated in capital letters, bold italics while the coding region was indicated in lower case italics. The 3 'UTR of nitrate reductase
392
<img file="MX339639B_D0362.tif" />
IMPI <sup>1NST,</sup>i57? <sup>M £ X (</sup>Can <
<sup>rt</sup> the PROriEOALi
Chlorella vulgarisse indicated by the text ^ fí '^' fttirr underlined. - [0029] Nucleotide sequence of the transforming DNA contained in pSZ1503_ [KASII_btub-y.inv-nr_KASII]:
gctcttcccgcaccggctggctccaccccaacttgaacctcgagaaccccgcgcctgqcqt cgaccccgtcgtgctcgtggggccgcggaaggagcgcgccgaagacctggacgtcgtcctc tccaactcctttggctttggcgggcacaattcgtgcgtcggtacc | ctttcttgcgctatga cacttccagcaaaaggtagggcgggctgcgagacggcttcccggcgctgcatgcaacaccgl atgatgcttcgaccccccgaagctccttcggggctgcatgggcgctccgatgccgctccagl
Iggcgagcgctgtttaaatagccaggcccccgattgcaaagacattatagcgagctaccaaa gccatattcaaacacctagatcactaccacttctactacacaggccactcgagcttgtgatccgq actccgctaagtcctcttcgtttcagtcaccacc
TGc t ga t cct gca ggc c 11 cc t t gt t gc ggc cgc cgc ca CGGC 11 ga ca gcgcc t t t cea gacgaacgagacgtccgaccgccccctggtgcacttcacccccaacaagggctggatgaac gaccccaacggcctgtggtacgacgagaaggacgccaagtggcacctgtacttccagtaca acccgaacgacaccgtctgggggacgcccttgttctggggccacgccacgtccgacgacct gaccaactgggaggaccagcccatcgccatcgccccgaagcgcaacgactccggcgccttc tccggctccatggtggtggactacaacaacacctccggcttcttcaacgacaccatcgacc cgcgccagcgctgcgtggccatctggacetacaacaccccggagtccgaggagcagtacat ctcctacagcctggacggcggctacaccttcaccgagtaccagaagaaccccgtgctggcc gccaactccacccagttccgcgacccgaaggtcttctggtacgagccctcccagaagtgga tcatgaccgcggccaagtcccaggactacacctcc
393
<img file="MX339639B_D0363.tif" />
<img file="MX339639B_D0364.tif" />
gtcctggaagctggagtccgcgttcgccaacgagggcttcctcgg <
cccggcctgatcgaggtccccaccgagcaggaccccagcaagt cctactgggtgatijLLCa · te tecatcaaccccggcgccccggccggcggctccttcaaccagtacttcgtcggcagctt caacggcacccacttcgaggccttcgacaaccagtcccgcgtggtggacttcggcaaggac tactacgccctgcagaccttcttcaacaccgacccgacctacgggagcgccctgggcatcg cgtgggcctccaactgggagtactccgccttcgtgcccaccaacccctggcgctcctceat gtccctcgtgcgcaagttctccctcaacaccgagtaccaggccaacccggagacggagctg atcaacctgaaggccgagccgatcctgaacatcagcaacgccggcccctggagccggttcg ccaccaacaccacgttgacgaaggccaacagctacaacgtcgacctgtccaacagcaccgg caccctggagttcgagctggtgtacgccgtcaacaccacccagacgatctccaagtccgtg ttcgcggacctctccctctggttcaagggcctggaggaccccgaggagtacctccgcatgg gcttcgaggtgtccgcgtcctccttcttcctggaccgcgggaacagcaaggtgaagttcgt gaaggagaacccctacttcaccaaccgcatgagcgtgaacaaccagcccttcaagagcgag aacgacctgtcctactacaaggtgtacggcttgctggaccagaacatcctggagctgtact tcaacgacggcgacgtcgtgtccaccaacacctacttcatgaccaccgggaacgccctggg ctccgtgaacatgacgacgggggtggacaacctgttctacatcgacaagttccaggtgcgc gaggtcaagTGAcaattggcagcagcagctcggatagtatcgacacactctggacgctggt cgtgtgatggactgttgccgccacacttgctgccttgacctgtgaatatccctgccgcttt tatcaaacagcctcagtgtgtttgatcttgtgtgtacgcgcttttgcgagttgctagctgc ttgtgctatttgcgaataccacccccagcatccccttccctcgtttcatatcgcttgcatc ccaaccgcaacttatctacgctgtcctgctatccctcagcgctgctcctgctcctgctcac tgcccctcgcacagccttggtttgggctccgcctgtattctcctggtactgcaacctgtaa accagcactgcaatgctgatgcacgggaagtagtgggatgggaacacaaatggaggatcgt
394
IMPI
MEXICAN INSTITUTE Ot LA RMWBDAD IN »USTRIA1
<img file="MX339639B_D0365.tif" />
agagctcatcttccgaaagtacgacgagtgagcgagctgattctctttgagcggggtcggg tggttcggggagaggtgcgcgggaaaggcgcagagacgtgcgtgcgcgcgtcgcgcgcgtcgcgcgccgcgcgcgcgcgcgcgcgcgcgcgcgcgg
with no. ID: 149)
KAS II allele 1 and allele 2 cDNAs were identified in sec. with numbers Ident .: 279 and 280, respectively. The amino acid sequences of alleles and 2 were identified in sec. with numbers ID: 281 and
282, respectively.
To determine the impact of KASII inactivation on lipid composition, the DNA vector pSZ1503 was transformed into S1331 to generate a knockout phenotype of
KASII directionalized. The individual starting clones were isolated and cultured under standard lipid production conditions at pH5.0. The profiles resulting from the best representative clone and from the wild cells are shown below in Table 31
Table 31. Fatty acid profiles in S1331 and a derived transgenic line transformed with the pSZ1503 DNA.
395
<img file="MX339639B_D0366.tif" />
S> S¡s »a
1331-5
D69S2
<td>C1ft0</td><td>C12D</td><td>C14S</td><td>C1ft0</td><td>C1 & 1</td>
<td> 001</td><td> 0.03</td><td> 096</td><td> 2428</td><td> 064</td>
<td> 001</td><td> 0.01</td><td> 0.83</td><td>3S36</td><td> 1 38</td>
Prototheca
394 571- "W
2.21 40 760 3 65
EXAMPLE 12
Modifying with alternate selectable markers
A. Expression of a secretory α-galactosidase in
Prototheca moriformis
Methods and effects for expressing a heterologous sucrose invertase gene in Prototheca species have been previously described in PCT application no. PCT / US2009 / 66142, thus incorporated by reference. The expression of other heterologous polysaccharide degradation enzymes was examined in this Example. The ability to grow in protibody (α-D-gal-glu) of Prototheca moriformis UTEX 1435 was tested with one of the following exogenous genes encoding an α-galactosidase: the Saccharomyces carlbergensis gene MELl (amino acid sequence corresponding to the number of access to NCBI, P04824 (sec. with ID no .: 108)), the AglC gene from Aspergillus niger (amino acid sequence corresponding to NCBI access number, Q9UUZ4 (sec. with no. Ident .: 116)), and agalactosidase from the top plant Cyamopsis tetragobobola (guar seed) (amino acid sequence
396
<img file="MX339639B_D0367.tif" />
corresponding to the access number to the NCBIP14749 (section with ID number: 120). The above accession numbers and corresponding amino acid sequences are thus incorporated by reference. In all cases, genes were optimized according to the use of preferred codons in
Prototheca moriformis. The relevant portions of the expression cassette are listed below along with the numbers in the sequence list. All expression cassettes used the 5 'and 3' Clp homologous recombination targeting sequences for stable genomic integration, the Chlamydomonas reinhardtii TUB2 / 5'UTR promoter, and the Chlorella vulgaris nitrate reductase 3'UTR.
S. carlbergensis MEL1 amino acid sequence sec. with no. ID: 108
S. carlbergensis MEL1 sequence, from amino acid sec.
with no. Ident .: 109 of the signal peptide
S. carlbergensis MEL Transformation cassette sec.
with no. ID: 110
S. carlbergensis MEL1 sequence (optimized by codon) sec. with no. Ident .: 111 recombination targeting sequence sec.
with no. ID: 112
<img file="MX339639B_D0368.tif" />
397
IMPI homologous to Clp 5 '——————————— recombination targeting sequence with no. Ident .: 113 homolog of Clp 3 '
Chlamydomonas reinhardtii TUB2 promoter / 5'UTR sec.
no. ID: 114
Chlorella vulgaris 3'UTR of nitrate reductase with no. Ident .: 115 amino acid sequence of A. niger AlgC with no. Ident .: 116 amino acid sequence of the signal peptide sec. with no. Ident .: 117 of A. niger AlgC sequence of A. niger AlgC (codon optimized) sec. with no. Ident .: 118 A. niger AlgC transformation cassette with no. ID: 119
C. tetragonoball amino acid sequence of sec.
no. Ident .: 120 α-galactosidase sequence of α-galactosidase from C. tetragonobola sec. with no. Ident: 121 (codon optimized) sec.
with sec.
sec.
sec.
with
<img file="MX339639B_D0369.tif" />
398
<img file="MX339639B_D0370.tif" />
ΙΜΡΙ a-galactosi transformation cassette with no. ID: 122
C. tetragonoball
Prototheca moriformis cells were transformed with each of the three expression cassettes containing the S. carlbergensis MEL1, A. α-galactosidase gene.
niger AlgC, or C. tetragonobola through the use of biolistic transformation methods as described in the
Example 2 above. Positive clones were screened using plates containing 2% melibiosa as the sole carbon source. No colony appeared on the plates for the C expression cassette transformants.
tetragonoball. Positive clones were collected from plates containing S. carlbergensis transformants
MEL1 and the transformants of A. niger AlgC. Integration of the transforming DNA was confirmed by use of PCR with primers that targeted a portion of the 3'UTR and the targeting sequence of the homologous 3'Clp recombination of C. vulgaris.
C. vulgaris 3'UTR 5 'primer: downstream Clp sequence (sec. with ID #: 123)
ACTGCAATGCTGATGCACGGGA
399
IMPI
INSTITUTO muiCam, Ot LA PRONFficiente INDUSTRIAL
<img file="MX339639B_D0371.tif" />
downstream C. vulgaris 3'UTR 3 'primer: sp.oiengia-Clp downstream (Sec.
TCCAGGTCCTTTTCGCACT
As a negative control, genomic DNA from Prototheca moriformis untransformed cells was further amplified with the primer set. No product was amplified from genomic DNA from wild cells.
Several positive clones from each of the S. carlbergensis MEL1 transformants and the A. niger AlgC transformants (as confirmed by PCR) were tested for their ability to grow on melibiosa as the sole source of carbon in liquid medium. These selected clones were grown for 3 days under the conditions and base medium described in Example 1 above with melibiosa as the sole carbon source. All clones containing any of the coding genes for ogalactosidase grew robustly during this time, while the wild non-transformed strain and
Prototheca moriformis expressing a sucrose invertase from
Saccharomyces cerevisiae SUC2 both grew poorly in the melibiosa medium. These results suggest that α-galactosidase coding genes can be used as a selectable marker for transformation. Further,
400
IMPI
INSTITUTO MEXICANO DS LA PAOFltDAD industrial
<img file="MX339639B_D0372.tif" />
these data indicate that the natural signal peptides present in S. carlbergensis MEL1 (sec. with ID #: 109) or A. niger AlgC (sec. with ID #: 117) are useful for targeting proteins to the Periplasm in Prototheca moriformis cells.
B. THIC Genes Supplement Thiamine Auxotrophy in Prototheca
The prototrophy for thiamine was examined in cells of
Prototheca moriformis through the use of exogenous THIC gene expression. The biosynthesis of thiamine in plants and algae typically takes place in the plastid, therefore most of the nuclear encoded proteins involved in its production will need to be targeted to the plastid efficiently. DNA sequencing and transcriptome sequencing of Prototheca moriformis cells revealed that all genes encoding thiamine biosynthetic enzymes were present in the genome, with the exception of THIC.
To analyze the lesion responsible for thiamine auxotrophy at the biochemical level, the growth of
Prototheca moriformis under five different regimens were examined: (1) in the presence of 2 µΜ thiamine hydrochloride;
(2) without thiamine; (3) without thiamine, but with 2 pM of
401
IMPI
Mexican Institute of Industrial Property
<img file="MX339639B_D0373.tif" />
hydroxyethyl thiazole (THZ); (4) without thiamine, but with 2 µΜ 2-methyl-4-amino-5- (aminomethyl) pyrimidine (PYR); and (5) without thiamine, but with 2 µΜ of THZ and 2 µΜ of PYR. The results of growth experiments under these 5 different conditions indicated that Prototheca moriformis cells are capable of de novo synthesis, but can only produce thiamine pyrophosphate (TPP) if the PYR precursor is provided.
This result is consistent with the hypothesis that the thiamine auxotrophy of Prototheca moriformis is due to the inability to synthesize hydroxymethylpyrimidine phosphate (HMP-P) from aminoimidazole ribonucleotide, which is the conversion catalyzed by the enzyme THIC.
Prototheca moriformis cells were transformed using the biolistic transformation methods described above in Example 2, which express C-169 THIC from
Coccomyxa (the amino acid sequence corresponding to JGI protein ID 30481, and hereby incorporated by reference) and a S. cerevisiae sucrose invertase SUC2 as a selectable marker. This expression construct contained the sequence of the Coccomyxa C169 THIC natural transit peptide, upstream and downstream sequences that direct recombination homologous to the 6S region of genomic DNA, a promoter / 5'UTR region of
<img file="MX339639B_D0374.tif" />
402
ΙΜΡΙ
C. reinhardtii TUB2 (sec. With ID no .: 104) .. and one.
3 'UTR of Chlorella vulgaris nitrate reductase (sec. With ID no .: 115). Expression of S. cerevisiae SUC2 was further driven by a C-promoter / 5'UTR region.
reinhardtii TUB2 (sec. with ID no .: 114) and contained a 3'UTR of Chlorella vulgaris nitrate reductase (sec.
with no. Ident .: 115). Genes were optimized according to the use of preferred codons in Prototheca moriformis. The relevant expression cassette sequences are listed in the sequence list and are detailed below:
C-169 THIC amino acid sequence of Coccomyxa sec.
with no. Ident .: 125 amino acid sequence of the transit peptide sec.
with no. ID: 126 natural C-169 THIC from Coccomyxa transformation cassette from C-169 THIC from Coccomyxa sec.
with no. ID: 127 sequence of C-169 THIC from Coccomyxa sec. with no. Ident .: 128 (codon optimized) S. cerevisiae SUC2 sequence (codon optimized) sec. with no. ID: 129
403
IMPI
INSTITUTO MfcXICANC DB LA FKOFIBDA »
INOUSTMIAL
<img file="MX339639B_D0375.tif" />
recombination targeting sequence sec.
with no. ID: 82 homologous 6S 5 'recombination targeting sequence sec.
with no. Ident .: 84 6S 3 'homolog
Selection of positive clones was performed on plates without thiamine and containing sucrose as the sole carbon source. Positive clones were confirmed by using PCR with a 5 'primer that binds within the
Coccomyxa C-169 THIC and a 3 'primer that hybridizes downstream of the transforming DNA at the 6S locus. Postitive clones confirmed by PCR were further confirmed through the use of Southern blot assays.
To observe the thiamine auxotrophy of wild Prototheca moriformis cells, it was necessary to deplete the cells internal thiamine reserve. To test growth in medium without thiamine, cells were first cultured to stationary phase in medium containing 2 µΜ of thiamine and then cells were diluted to an optical density at 750nm (OD750) of approximately 0.05 in medium without thiamine. The diluted cells were then grown once more to the stationary phase in medium without thiamine
404
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0376.tif" />
(about 2-3 days). These thiamine depleted cells were used to inoculate the cultures for growth studies in medium without thiamine. Wild cells were grown in medium with glucose as the carbon source (with or without thiamine) and clones positive with the natural transit peptide of construct C-169 THIC from
Coccomyxa were grown in medium with sucrose as the sole carbon source. Growth was measured by monitoring the absorbance at 750nm. The results of the growth experiments showed the considerably larger growth in thiamine-free medium of the strain expressing the transgene compared to wild cells in thiamine-free medium. However, the transformants did not meet the growth rate and cell densities of wild cells in thiamine containing medium. Furthermore, there was a strong correlation between the amount of growth in the transforming clones in thiamine-free medium and the number of copies of the integrated Cocomyxa enzyme transgene (that is, the higher the number of copies of the transgene, the better growth of cells in thiamine free medium).
Additional transformants were generated through the use of expression constructs containing the Coccomyxa
<img file="MX339639B_D0377.tif" />
405
IMPÍ ~
INSTITl ITO MEXICANO gl ·<sup>-</sup>·<sup>5</sup>Tajá?<sup>5</sup>OF THE PRORBDAP
INDI ISTMIAL ----- *
THIC, the gene Arabidopsis thaliana -THIC, 'y · el <sup>1</sup> g ~ eir
Synechocystis sp. PCC 6803 thiC. In the case of Coccomyxa and the A. thaliana THIC gene, the sequence of the natural transit peptide was replaced with the sequence of the transit peptide of a steloyl-ACP desaturase (SAD) gene from Chlorella protothecoides. Synechocystis sp. it is a cyanobacterium and the thiC protein does not contain a naturally occurring peptide sequence. In the Synechocystis sp thiC construct, the transit peptide sequence of a Chlorella protothecoides SAD gene was fused to the N-terminus of Synechocystis sp. thiC. In all cases, the sequences were optimized by codon for expression in Prototheca moriformis. All three of the above constructs contained an upstream and downstream homologous recombination targeting sequence to the 6S region of the genome (seq. No. Ident .: 82 and 84), a promoter / 5 'UTR of actin from
Chlorella protothecoides, and a 3'UTR gene from Chlorella protothecoides EF1A. All three constructs contained a neoR gene driven by the C. reinhardtii TUB2 / 5'UTR promoter (sec. With ID #: 114) and contained the C. 3'UTR.
vulgaris (sec. with ID number: 115), to confer selection by G418. The amino acid sequence of THIC from
A. thaliana corresponded to the NCBI access number
406
ΙΜΡΙ
MEXICAN INSTITUTE OS THE INDUSTRIAL PROPERTY
<img file="MX339639B_D0378.tif" />
NP_180524 and the amino acid sequence of Svnechocystis sp. thiC corresponded to NCBI access number NP_442586, both sequences thus incorporated by reference.
The relevant expression cassette sequences are listed in the sequence list and are detailed below:
Coccomyxa THIC expression construct with the C. protothecoides sec. transit peptide.
with no. ID: 13 0
Coccomyxa THIC with the transit peptide with no. ID: 131 C. protothecoides
C. protothecoides promoter / 5 'UTR of actin no. ID: 132
C. protothecoides EF1A 3'UTR ident .: 133
A. thaliana THIC expression construct with no. ID: 134
A. thaliana THIC with the transit peptide with no. ID: 135 C. protothecoides THIC amino acid sequence of A. thaliana no. Ident .: 136 sec. with sec. with sec. with no. of with the natural transit peptide
407 expression construct Synechocystis sp.
<img file="MX339639B_D0379.tif" />
with no. ID: 137
Synechocystis sp. thiC with the transit peptide with no. Ident .: 138 C. protothecoides
Synechocystis sp. amino acid sequence of thiC sec.
sec.
with no. Ident .: 139 neoR gen sec. with no. ID: 140
Positive clones were screened on plates containing G418 and several clones from each transformation were collected for verification by PCR.
Integration of the transforming DNA constructs containing Coccomyxa C-169 (with the C. protothecoides transit peptide), A. thaliana and Synechocystis sp. The PCC 6803 THIC genes, respectively at the 6S locus of the genome were confirmed by using PCR analysis with the following primers:
5 'THIC confirmation primer sequence from
Coccomyxa (section with ID number: 141)
ACGTCGCGACCCATGCTTCC 3 'THIC Confirmation Primer Sequence (sec.
with no. ID: 142)
408
<img file="MX339639B_D0380.tif" />
GGGTGATCGCCTACAAGA A 5 'THIC confirmation primer sequence.
thaliana (sec. with ID no .: 143)
GCGTCATCGCCTACAAGA thiC 5 'confirmation primer sequence from
Synechocystis sp. (section with ID number: 144)
CGATGCTGTGCTACGTGA
Growth experiments on thiamine depleted cells (as described above) were performed using the confirmed positive clones selected from the transformants of each of the different constructs in the medium containing G418. All transformants were able to grow (with varying degrees of robustness) in the thiamine-free medium. Comparison of growth of transformants in thiamine-free medium with wild cells in medium containing thiamine showed the following classification with respect to their ability to support growth in thiamine-free medium: (1) transformants of A. thaliana; (2) the transformants of Coccomyxa C-169 (with the C. protothecoides transit peptide); and (3) the transformants Synechocystis sp. . These results suggest that while a single copy of A. thaliana THIC was able to complement the auxotrophy to
<img file="MX339639B_D0381.tif" />
409
IMPI
MEXICAN INSTITUTE * OF PROPERTY
INDUSTRIAL thiamine in Prototheca moriformis cells, multiple copies of Coccomyxa C-169 (with either the natural transit peptide sequence or a transit peptide sequence from C. protothecoides) and Synechocystis sp.
THIC was necessary to allow rapid growth in the absence of thiamine. Given the variability in the results of different THICs from different sources, the ability of any particular THIC gene to fully complement the injury present in the Prototheca species is not predictable.
An alignment of the three amino acid sequences of THIC was performed. Although considerable sequence conservation existed between the thiC of Synechocystis sp.
Compared to THIC from Coccomyxa and A. thaliana (41% identity at the amino acid level), the cyanobacterial protein lacks an N-terminal domain that is highly conserved in algae and plant proteins. Despite the missing domain (and presumably resulting in structural differences), the construct that expresses the
Synechocystis sp. thiC was able to at least partially restore the prototrophism for thiamine in the cells of
Prototheca moriformis.
<img file="MX339639B_D0382.tif" />
410
ΙΜΡΙ
EXAMPLE 13: Fuel production
A. Extraction of the microalgae oil, using an ejector press and an auxiliary pressure
The microalgae biomass containing 38% oil per
DCW was dried using a drying drum which resulted in the resulting moisture content of 5-5.5%. The biomass was introduced into a French L250 press. 30.4 kg (67 lbs.) Of biomass was introduced to the press and no oil was recovered.
The same dry microbial biomass was combined with different percentages of forage grass as an auxiliary pressure that was introduced through the press. The combination of dry microbial biomass and 20% w / w of forage grass yielded the best overall oil yield percentage. The pressing cakes were subjected to extraction with hexane and the final yield of the 20% forage grass condition was 61.6% of the total available oil (calculated by weight). Biomass above 50% of the dry weight of the oil cells does not require the use of an auxiliary pressure, such as forage grass to release the oil. Other methods of extracting oil from microalgae through the use of an ejector press are described in PCT application no. PCT / US2010 / 31108 and is hereby incorporated by reference.
411
IMPI
MEXICAN INSTITUTE
SAY THE INDUSTRIAL PROPERTY
B. Production of biodiesel from olive oil
<img file="MX339639B_D0383.tif" />
Prototheca
Prototheca moriformis UTEX 1435 degummed oil, which was produced according to the methods described above, was transesterified to produce fatty acid methyl esters. The results are shown in Table 24 below.
The lipid profile of the oil was:
<td>CIO: 0</td><td> 0.02</td>
<td>C12: 0</td><td> 0.06</td>
<td>C14: 0</td><td> 1.81</td>
<td>C14.1</td><td> 0.07</td>
<td>C16: 0</td><td> 24.53</td>
<td>C16: l</td><td> 1.22</td>
<td>C18: 0</td><td> 2.34</td>
<td>C18: l</td><td> 59.21</td>
<td>C18: 2</td><td> 8.91</td>
<td>C18: 3</td><td> 0.28</td>
<td>C20: 0</td><td> 0.23</td>
<td>C20: l</td><td> 0.10</td>
<td>C20: l</td><td> 0.08</td>
<td>C21: 0</td><td> 0.02</td>
<td>C22: 0</td><td> 0.06</td>
412
<img file="MX339639B_D0384.tif" />
I
INS
C24: O O.1O
Table 24. The biodiesel profile from Prototheca moriformis triglyceride oil.
<td>Method</td><td colspan="2">Proof</td><td>Outcome</td><td>Units</td>
<td></td><td>Filterability of</td><td>Time of</td><td> 120</td><td>sec.</td>
<td>ASTM</td><td>cold impregnated</td><td>filtration</td><td></td><td></td>
<td>D6751</td><td>mixing</td><td>Volume</td><td> 300</td><td>Me</td>
<td>To the</td><td>fuel from</td><td>Filtered out</td><td></td><td></td>
<td></td><td>biodiesel</td><td></td><td></td><td></td>
<td>ASTM</td><td>Point of inflammation in</td><td>Process used</td><td>TO</td><td></td>
<td>D93</td><td>closed glass Pensky-Martens</td><td>Point of inflammation corrected</td><td> 165.0</td><td>° C</td>
<td>ASTM</td><td>Water and sediment</td><td>Sediment and</td><td> 0.000</td><td>vol%</td>
<td>D2709</td><td>in fuels</td><td>Water</td><td></td><td></td>
<td></td><td>distillates</td><td></td><td></td><td></td>
<td></td><td>intermediate</td><td></td><td></td><td></td>
<td></td><td>(Method</td><td></td><td></td><td></td>
<td></td><td>centrifuge)</td><td></td><td></td><td></td>
<td>IN</td><td>Determination of</td><td>Sum of (Ca</td><td> <1</td><td>mg / kg</td>
<img file="MX339639B_D0385.tif" />
413
IMPI
MEXICAN MSTITUTE • E INDUSTRIAL PROPERTY
<td></td><td> 14538</td><td>Ca content and</td><td>and Mg)</td><td></td><td></td>
<td></td><td></td><td>Mg by ICP OES</td><td></td><td></td><td></td>
<td></td><td>IN</td><td>Determination of</td><td>Sum of (Na</td><td> <1</td><td>mg / kg</td>
<td></td><td> 14538</td><td>Ca content and</td><td>and K)</td><td></td><td></td>
<td> 5</td><td></td><td>Mg by ICP OES</td><td></td><td></td><td></td>
<td></td><td>ASTM</td><td>Vicosity</td><td>viscosity</td><td> 4.873</td><td>mm<sup>2</sup> / s</td>
<td></td><td>D445</td><td>kinematic /</td><td>cinematic @</td><td></td><td></td>
<td></td><td></td><td>dynamic</td><td>104 ° F / 40 ° C</td><td></td><td></td>
<td></td><td>ASTM</td><td>Sulfated ash a</td><td>Ash</td><td> < 0.005</td><td>% in</td>
<td> 10</td><td>D874</td><td>from oils</td><td>sulfated</td><td></td><td>weight</td>
<td></td><td></td><td>lubricants and</td><td></td><td></td><td></td>
<td></td><td></td><td>additives</td><td></td><td></td><td></td>
<td></td><td>ASTM</td><td>Determination of</td><td>Sulfur, mg</td><td> 1.7</td><td>mg / kg</td>
<td></td><td>D5453</td><td>total sulfur in</td><td>/ kg</td><td></td><td></td>
<td> 15</td><td></td><td>hydrocarbons</td><td></td><td></td><td></td>
<td></td><td></td><td>light,</td><td></td><td></td><td></td>
<td></td><td></td><td>fuel for</td><td></td><td></td><td></td>
<td></td><td></td><td>ignition engine</td><td></td><td></td><td></td>
<td></td><td></td><td>by spark,</td><td></td><td></td><td></td>
<td> 20</td><td></td><td>fuel for</td><td></td><td></td><td></td>
<td></td><td></td><td>diesel engine, and</td><td></td><td></td><td></td>
<td></td><td></td><td>Motor oil</td><td></td><td></td><td></td>
414
<img file="MX339639B_D0386.tif" />
IMPI
MEXICAN INSTITUTE Ofc THE INDUSTRIAL PROPERTY
<td></td><td></td><td>by fluorescence</td><td></td><td></td><td></td>
<td></td><td></td><td>ultraviolet.</td><td></td><td></td><td></td>
<td></td><td>ASTM</td><td>Corrosion - strip</td><td>Corrosion Cu-</td><td>the</td><td></td>
<td></td><td>D130</td><td>coppermade</td><td>Biodiesel</td><td></td><td></td>
<td> 5</td><td></td><td></td><td>50 ° C</td><td></td><td></td>
<td></td><td></td><td></td><td>(122 ° F) / 3 hr</td><td></td><td></td>
<td></td><td>ASTM</td><td>Turbidity point</td><td>Point of</td><td> 6</td><td>° C</td>
<td></td><td>D2500</td><td></td><td>turbidity</td><td></td><td></td>
<td></td><td>ASTM</td><td>Micro residue</td><td>Average of</td><td> < 0.10</td><td>% in</td>
<td> 10</td><td>D4530</td><td>carbon</td><td>residue of</td><td></td><td>weight</td>
<td></td><td></td><td></td><td>carbon</td><td></td><td></td>
<td></td><td></td><td></td><td>micro method</td><td></td><td></td>
<td></td><td></td><td>Acidity index</td><td>Process</td><td>TO</td><td></td>
<td></td><td>ASTM</td><td>of the products</td><td>used</td><td></td><td></td>
<td> 15</td><td>D664</td><td>of oil by assessment potentiometric</td><td>index of acidity</td><td> 0.20</td><td>mg KOH / g</td>
<td></td><td></td><td>Determination of</td><td>Glycerin</td><td> < 0.005</td><td>% in</td>
<td rowspan="2"> 20</td><td>ASTM</td><td>free glycerin</td><td>free</td><td></td><td>weight</td>
<td rowspan="2">D6584</td><td rowspan="2">and total in methyl biodiesel ester B-100 by</td><td rowspan="2">Glycerin total</td><td rowspan="2"> 0.123</td><td rowspan="2">% in weight</td>
<td></td>
415
IMPI
MEXICAN INSTITUTE DB LA FROFIEDAC industrial
<img file="MX339639B_D0387.tif" />
<img file="MX339639B_D0388.tif" />
<img file="MX339639B_D0389.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE DS INDUSTRIAL PROPERTY
<td rowspan="11"></td><td rowspan="11"> •</td><td>Re cupe rae i ón</td><td></td><td></td>
<td></td><td></td><td></td>
<td>AET @ 80% Recovery</td><td> 349</td><td>° C</td>
<td>AET @ 90% Recovery</td><td> 351</td><td>° C</td>
<td>AET @ 95% Recovery</td><td> 353</td><td>° C</td>
<td>FBP</td><td> 362</td><td>° C</td>
<td>% Recovered</td><td> 98.5</td><td> %</td>
<td>% lost</td><td> 1.5</td><td> %</td>
<td>% Residual</td><td> 0.0</td><td> %</td>
<td>Volume of the cheat for cold</td><td> 0.0</td><td>ME</td>
<td>IBP</td><td> 248</td><td>° C</td>
<td rowspan="2">IN 14112</td><td rowspan="2">Determination of the stability of oxidation (test oxidation accelerated)</td><td>Stability oxidation</td><td> >12</td><td>h</td>
<td>Temp. of operation (usually 110 degrees C)</td><td> 110</td><td>° C</td>
<td>ASTM</td><td>Density of</td><td>API weight @</td><td> 29.5</td><td>° API</td>
IMPI
KSTITU7U MEXICANO DE LA PMOPI £ »Al) • NRUSTRIAL
<img file="MX339639B_D0390.tif" />
417
<td></td><td>D4052</td><td>liquids by</td><td>60 ° F</td><td></td><td></td>
<td></td><td></td><td>meter of</td><td></td><td></td><td></td>
<td></td><td></td><td>digital density</td><td></td><td></td><td></td>
<td></td><td>ASTM D</td><td>Determination of</td><td>Number of</td><td> > 61.0</td><td></td>
<td> 5</td><td> 6890</td><td>delay in</td><td>cetane</td><td></td><td></td>
<td></td><td></td><td>ignition (ID) and</td><td>derivative</td><td></td><td></td>
<td></td><td></td><td>cetano number</td><td>(DCN)</td><td></td><td></td>
<td></td><td></td><td>derivative (DCN)</td><td></td><td></td><td></td>
The lipid profile of biodiesel was very similar to the lipid profile of oil as raw material. The other oils provided by the methods and compositions of the invention can be transesterified to yield biodiesel with the lipid profiles, including 15 (a) at least 4% C8-C14, (b) at least 0.3% C8; (c) at least 2%
CIO, (d) at least 2% C12 and (3) at least 30% C8-C14.
Filterability of cold impregnation by method
ASTM D6751 Al of biodiesel production, was 120 seconds for a volume of 3,00 ml. This test consists of filtration of 300 ml of B100, refrigerated at 40 ° F for 16 hours, allowed to warm to room temperature, and vacuum-filtered with 0.7 micron fiberglass with stainless steel support. The oils of the invention can be
418
<img file="MX339639B_D0391.tif" />
IMPI
INSTITUTO MEXICANO oe the INDUSTRIAL currency transesterify to generate biodiesel with a cold immersion time of less than 120 seconds, less than 10 0 and less than 90 seconds.
C. Renewable diesel production
Prototheca moriformis UTEX 1435 degummed oil, made according to the methods described above and having the same lipid profile as the oil used to produce biodiesel in this Example, above, underwent transesterification to produce renewable diesel.
The oil was first treated with hydrogen to remove oxygen and the glycerol backbone, which produced nparaffins. The n-paraffins were subjected to cracking and isomerization. A chromatogram of the material is shown in
Figure 1. The material was then subjected to cold filtration, which removed approximately 5% of the C18 material.
After cold filtration the total volume of material was reduced to the flash point and the flash point, the distribution of the ASTM D-86 distillation, the cloud point and the viscosity were evaluated. The flash point was 63 ° C, the viscosity was 2.86 cSt (centistokes), the cloud point was 4 ° C. Distillation values
ASTM D86 are shown in Table 25:
Table 25. ASTM D86 distillation values.
419
IMPI
INSTITUTO MEXICANO OE LA MOHEDAL) industrial
<img file="MX339639B_D0392.tif" />
Readings in ° C:
<td></td><td>Volume</td><td>Temperature</td>
<td></td><td>IBP</td><td> 173</td>
<td> 5</td><td> 5</td><td> 217.4</td>
<td></td><td> 10</td><td> 242.1</td>
<td></td><td> 15</td><td> 255.8</td>
<td></td><td> 20</td><td> 265.6</td>
<td></td><td> 30</td><td> 277.3</td>
<td> 10</td><td> 40</td><td> 283.5</td>
<td></td><td> 50</td><td> 286.6</td>
<td></td><td> 60</td><td> 289.4</td>
<td></td><td> 70</td><td> 290.9</td>
<td></td><td> 80</td><td> 294.3</td>
<td> 15</td><td> 90</td><td> 300</td>
<td></td><td> 95</td><td> 307.7</td>
<td></td><td>FBP</td><td> 331.5</td>
The T10-T90 of the material produced was 57.9 ° C. Hydrogen treatment methods, isomerization, and other covalent modification of oils described herein, as well as distillation and fractionation methods (such as cold filtration) that are
<img file="MX339639B_D0393.tif" />
420
IMPI
INSTrn rro mexican • í the industrial rrorude described herein, can be used to generate renewable diesel compositions with other intervals T90
TIO, such as, 20, 25, 30, 35, 40, 45, 50, 60, and 65 ° C by using triglyceride oils that are produced according to the methods described herein.
The TIO of the material produced was 242.1 ° C. The hydrogen treatment methods, isomerization, and other covalent modification of the oils described herein, as well as the distillation and fractionation methods (such as cold filtration) described herein, can be employed to generate renewable diesel compositions with other TIO values, such as TIO between 180 and 295, between 190 and 270, between 210 and 250, between 225 and 245, and at least 290.
The T90 of the produced material was 300 ° C. Hydrogen treatment methods, isomerization, and other covalent modification of oils described herein, as well as distillation and fractionation methods (such as cold filtration) described herein, can be employed to generate renewable diesel compositions with other T90 values, such as T90 between 280 and 380, between 290 and 360, between 300 and 350, between 310 and 340, and at least 290.
<img file="MX339639B_D0394.tif" />
421 ΙΜΡΙ
MEXICAN INSTITUTE
OE THE PROPERTY
INDUSTRIAL
The FBP of the material produced was 300 ° C. Hydrogen treatment methods, isomerization, and other covalent modification of oils described herein, as well as distillation and fractionation methods (such as cold filtration) described herein, can be employed to generate renewable diesel compositions with other FBP values, such as FBP between 290 and 400, between 300 and 385, between 310 and 370, between 315 and 360, and at least 300.
Other oils provided by the methods and compositions of the invention can be subjected to combinations of hydrotreating, isomerization, and other covalent modification, including oils with lipid profiles that include (a) at least 4% C8-C14, (b ) at least
0.3% C8, (c) at least 2% CIO; (d) at least 2% C12 and (3) at least 30% C8-C14.
EXAMPLE 14: Production of specific oils
Using the methods and materials as described in the present description, various specific oils were produced. Table 32 shows the strain, gene, and Genbank accession numbers of the genes that confer the phenotype and the various fatty acid profiles produced by the strain.
422
ΙΜΡΙ
MEXICAN INSTITUTE OF THE INDUSTRIAL MOHEDAL
<img file="MX339639B_D0395.tif" />
indicated. Strains A and B are both Prototheca moriformis (UTEX 1435) strains, both were mutated in the classical way to improve oil yield by a laboratory that charges fees for service. Strains A and B were then genetically modified as described herein with the appropriate DNA construct to express the desired genes. The strains were further modified to inactivate endogenous desaturases, as indicated. The nucleotide sequences of thioesterases were codon optimized for expression and use in Prototheca.
The fatty acid profile of the wild, unmodified Prototheca is shown in the first line of Table 32.
As can be seen, the fatty acid profile was radically altered in different ways in the different strains.
For example, the percentage of C8: 0 produced by genetically unmodified P. moriformis cells is 0%. However, P. moriformis cells modified to express a C. hookeriana thioesterase increased C8: 0 production from 0% to 13.2% of total triglycerides.
As another example, the combined total amount of C8: 0 and
CIO: 0 in the modified strains was approximately 39% of the total fatty acids. In contrast, the combined total amount of C8: 0 and C10: 0 in the wild cells was
423
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0396.tif" />
0.01%. In another example, the amount of saturated fatty acids increased from about 32% to about
90% by the expression of a U. thioesterase in cells in which the expression of endogenous SAD2b was interrupted. This is an increase of almost 300%.
The various fatty acid profiles as described below are useful in a myriad of applications involving triglyceride oils. For example, high levels of lower carbon chain length saturated fatty acids comprising triglycerides (C12: 0, C14: 0, C16: 0) are particularly useful in the production of renewable reactor fuel. For the production of biodiesel, large quantities of C18 are desired: l. For bar soap production, you want to control and strike the right balance between saturation levels and shorter chain fatty acids. As an example, large amounts of C12: 0 are desirable for foaming properties while longer chain lengths provide more structure, while linoleic and linolenic containing triglycerides are less desirable since they contribute to oxidative instability. For liquid soaps, large amounts of C12: 0 and
C14: 0. In addition, for the production of both bar soap and
424
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0397.tif" />
of liquid soap, low amounts of C6: 0 are desirable,
C8: 0 and C10: 0 since these shorter chain triglycerides are skin irritants.
Table 32. Genes and access numbers that confer the phenotype of diverse triglyceride profiles.
<td>Feature</td><td>Access to the Genbank and description ion</td><td>Gene that confers the phenotype</td><td>Construc to *</td><td>Sec. with num . from iden t. no.</td><td>Background gene ico of the strain</td><td>C8: 0</td><td>CIO : 0</td><td>C12 : 0</td><td>C14 : 0</td><td>C16 : 0</td><td>C18 : 0</td><td>C18 :one</td><td>C18 :2</td><td>Satura two total s</td>
<td>silves tre</td><td></td><td></td><td>NA</td><td></td><td>UTEX 1435</td><td> 0.0 0</td><td> 0.0 1</td><td> 0.0 4</td><td> 1.2 7</td><td> 27. 20</td><td> 3.8 5</td><td> 58. 70</td><td> 7.1 8</td><td> 32.36</td>
<td>C8 maximum</td><td>U39834</td><td>C. hookeria na TE</td><td>pSZ 1458</td><td></td><td>TO</td><td> 13. 20</td><td> 25. 84</td><td> 0.5 1</td><td> 1.4 1</td><td> 10. 22</td><td> 1.3 9</td><td> 38. 21</td><td> 7.4 2</td><td> 52.57</td>
<td>CIO maximum</td><td>U39834</td><td>C. hookeria na TE</td><td>pSZ 1458</td><td></td><td>TO</td><td> 13. 20</td><td> 25. 84</td><td> 0.5 1</td><td> 1.4 1</td><td> 10. 22</td><td> 1.3 9</td><td> 38. 21</td><td> 7.4 2</td><td> 52.57</td>
<td>C12 maximum</td><td>U56104 and 067317 (sec. with no. of ident .: 185)</td><td>C. wrightii TE + C. wrightii KASA1</td><td>pSZ 1491 (sec. with ident .: 232)</td><td></td><td>B</td><td> .02</td><td> 13. 63</td><td> 50. 59</td><td> 6.4 9</td><td> 6.6 4</td><td> 0.8 7</td><td> 13. 74</td><td> 6.8 3</td><td> 78.00</td>
<td>C14 maximum</td><td>U31813</td><td>Cinnamcan TT77T namphnra TEA</td><td>pSZ 941 (sec. with ident. : 236) / 944 (Sec. ident. : 228)</td><td></td><td>UTEX 1435</td><td> 0.0 0</td><td> 0.0 6</td><td> 5.9 1</td><td> 43. 27</td><td> 19. 63</td><td> 0.8 7</td><td> 13. 96</td><td> 13. 78</td><td> 69.74</td>
<td>sure maximum</td><td>Q39513.1</td><td>C. hookeria na TE</td><td>pSZ 1417 (sec. with no. of ident. : 226)</td><td></td><td>TO</td><td> 0.0 0</td><td> 0.0 2</td><td> 0.1 1</td><td> 10. 62</td><td> 69. 92</td><td> 2.1 8</td><td> 12. 95</td><td> 5.1 5</td><td> 80.35</td>
<td>C18 maximum</td><td>056104 as the interruption of the SAD2B gene</td><td>C. wrightii TEA</td><td>pSZ 1410 (sec. with ident .: 230)</td><td></td><td>TO</td><td> 0.0 0</td><td> 0.1 1</td><td> 1.2 8</td><td> 1.8 2</td><td> 24. 55</td><td> 37. 38</td><td> 23. 51</td><td> 7.8 8</td><td> 65.14</td>
<td>C8-C10</td><td>U39834</td><td>C.</td><td>pSZ 1458</td><td></td><td>TO</td><td> 13.</td><td> 25.</td><td> 0.5</td><td> 1.4</td><td> 10.</td><td> 1.3</td><td> 38.</td><td> 7.4</td><td> 52.57</td>
425
<img file="MX339639B_D0398.tif" />
<img file="MX339639B_D0399.tif" />
IMPI
MEXICAN INSTITUTE r> E industrial PROPERTY
<td rowspan="2">maximum</td><td rowspan="2"></td><td rowspan="2">hookeria na TE</td><td rowspan="2"></td><td rowspan="2"></td><td rowspan="2"></td><td rowspan="2"> 20</td><td rowspan="2"> 84</td><td rowspan="2"> 1</td><td> 1</td><td> 22</td><td> 9</td><td> 21</td><td> 2</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td><sup>1</sup></td>
<td>C8-C14 maximum</td><td>U56104</td><td>C. wrightii TEA</td><td>pSZ 1283 (sec. ident .: 229)</td><td></td><td>TO</td><td> .22</td><td> 17. 64</td><td> 45. 85</td><td> 10. 94</td><td> 5.5 5</td><td> 0.7 9</td><td> 13. 49</td><td> 4.6 8</td><td> 74.65</td>
<td>C10- C14 maximum</td><td>U56104</td><td>C. wrightii TEA</td><td>pSZ 1283 (sec. ident. : 229)</td><td></td><td>TO</td><td> .22</td><td> 17. 64</td><td> 45. 85</td><td> 10. 94</td><td> 5.5 5</td><td> 0.7 9</td><td> 13. 49</td><td> 4.6 8</td><td> 74.65</td>
<td>C12- C14 maximum</td><td>ABB71579 .1 (sec. With ident .: 286)</td><td>C. callophy lia TE</td><td>pSZ 1570 (sec. with ident .: 235)</td><td></td><td>B</td><td> .01</td><td> 0.8 8</td><td> 28. 04</td><td> 34. 08</td><td> 19. 82</td><td> 1.0 0</td><td> 10. 52</td><td> 4.4 2</td><td> 83.83</td>
<td>18: 1 minimum</td><td>AAB71731 (sec. With no. of ident .: 287) such as disruption of the SAD2B gene</td><td>Dimus american to TE</td><td>pSZ 1321 (sec. with no. of ident. : 242)</td><td></td><td>TO</td><td> .12</td><td> 10. 39</td><td> 3.5 5</td><td> 35. 21</td><td> 33. 54</td><td> 4.9 0</td><td> 5.1 5</td><td> 5.6 9</td><td> 87.71</td>
<td>Maximum 18: 1</td><td>Interruption of FADc with Carthantu s tincorus TEA AAA33019 .one</td><td>Carthamu s tinctoru s TE</td><td>pSZ 1500 (sec. with no. of ident .: 233)</td><td></td><td>TO</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 16. 49</td><td> 0</td><td> 83. 51</td><td> 0.0 0</td><td> 16.49</td>
<td>18: 2 minimum</td><td>Interruption of FADc with Carthamu s tincorus TEA AAA33019 .one</td><td>Carthamu s tinctoru S TE</td><td>pSZ 1501 (sec. with ident .: 234)</td><td></td><td>TO</td><td> 0</td><td> 0</td><td> .03</td><td> 1.0 5</td><td> 18. 01</td><td> 1.4 4</td><td> 77. 11</td><td> 0.0 0</td><td> 20.53</td>
<td>Satura two maximum</td><td>AAB71731 as the interruption of SAD2B</td><td>Dimus american to TE</td><td>pSZ 1321 (sec. with no. of ident .: 242)</td><td></td><td>TO</td><td> .30</td><td> 13. 07</td><td> 3.5 7</td><td> 33. 58</td><td> 33. 52</td><td> 5.1 6</td><td> 5.3 6</td><td> 4.5 0</td><td> 89.20</td>
426
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339639B_D0400.tif" />
Palm kernel oil
A microbial mimetic palm kernel oil was produced that was similar to palm kernel oil (PKO). To produce the mimetic palm kernel oil, a plasmid was constructed and used to transform strain A and oil production was carried out. The construct, pSZ1413 (sec. With ID no .: 231), comprised the FATB2 codon optimized gene (sec. With no.
Ident .: 284) (Genbank Accession No. U56106) of Cuphea wrightii and the interrupted gene SAD2B (stearoyl ACP desaturase).
As shown in Table 33 below, the mimetic palm kernel oil was similar to palm kernel oil. The percentages of the three most abundant fatty acids of the PKO mimetic (C12: 0, C14: 0 and C18-.1) were identical or within 10% of the palm kernel oil.
Table 33. Triglyceride profile of mimetic palm kernel oil.
<td></td><td>C8: 0</td><td>C10: 0</td><td>C12: 0</td><td>C14: 0</td><td>C16: 0</td><td>C18: 0</td><td>C18: l</td><td>C18: 2</td>
<td>AND.</td><td> 3.0-</td><td> 2.5-</td><td> 40-52</td><td> 14.0-</td><td> 7.0-</td><td>1. Ο-</td><td> 11.0-</td><td> 0.5-</td>
<td>guineensis</td><td> 5.0</td><td> 6.0</td><td></td><td> 18.0</td><td> 10.0</td><td>Ι.0</td><td> 19.0</td><td> 4.0</td>
(Almond
<img file="MX339639B_D0401.tif" />
8.33 37.45 18.22 13.52 1.25 15.29 4.95
41Ί palm) pSZ1413
Palm oil
A microbial mimetic palm oil was produced that was similar to palm oil. Some different plasmids were individually constructed and transformed into strain A and oil production was carried out. The construct, pSZ1503 (SEQ ID NO: 283), was designed to interrupt an endogenous KASII gene. The construct, pSZ1439
<td>(sec. with</td><td>num</td><td>of</td><td colspan="2">ident .: 237), included</td><td>a</td><td>gen</td><td>TEA</td>
<td>optimized</td><td>by</td><td>codon</td><td>by Elaeis guiniensis</td><td>(sec.</td><td>with</td><td>no.</td><td>of</td>
<td colspan="3">Ident .: 205) (no.</td><td colspan="3">of access to the Genbank AAD42220</td><td> .2) .</td><td>The</td>
<td>construct,</td><td colspan="2">pSZ1420</td><td>(sec. with no.</td><td colspan="2">Ident .:</td><td colspan="2"> 225) ,</td>
<td>understood</td><td>a</td><td>gen</td><td>TE optimized by</td><td>codon</td><td>of</td><td colspan="2">Cuphea</td>
<td>hookerian</td><td>(sec</td><td>. with</td><td>no. ID: 201)</td><td>(no.</td><td colspan="2">access</td><td>to the</td>
<td colspan="2">Genbank Q39513)</td><td>. The</td><td>construct, pSZ1119</td><td>(sec.</td><td>with</td><td>no.</td><td>of</td>
ident. : 227), comprised a codon optimized KAS IV gene from Cuphea hookeriana (sec. With ID no .: 186) (Genbank accession no. AF060519) as well as a FATB2 gene from Cuphea wrightii (sec. With no. Ident .: 184) (access number to
Genbank U56104).
428
IMPI
MEXICAN INSTITUTE ^ * · «ϊΒ3Λ-Ι» 1 day Cs-taJ property »
INDUSTRIAL
As shown in Table 34 below, mimetic palm oil was similar to palm oil. The percentages of the three most abundant fatty acids in mimetic palm oil (C16: 0, C18: l and C18: 2) were identical or within 10% of palm oil.
Table 34. Mimetic palm oil triglyceride profile.
<td></td><td>C10: 0</td><td>C12: 0</td><td>C14: 0</td><td>C16: 0</td><td>C18: 0</td><td>C18: l</td><td>C18: 2</td>
<td>AND.</td><td> 0</td><td> 0</td><td> 0.5-</td><td> 32.0-</td><td> 2.0-</td><td> 34-44</td><td> 7.2-</td>
<td>guineensis</td><td></td><td></td><td> 5.9</td><td> 47.0</td><td> 8.0</td><td></td><td> 12.0</td>
<td>(Palm)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>pSZ1503</td><td> 0.01</td><td> 0.01</td><td> 0.83</td><td> 38.36</td><td> 2.21</td><td> 48.31</td><td> 7.60</td>
<td>pSZ1439</td><td> 0.01</td><td> 0.04</td><td> 1.88</td><td> 43.50</td><td> 3.32</td><td> 39.95</td><td> 9.16</td>
<td>pSZ1420</td><td> 0.02</td><td> 0.04</td><td> 2.44</td><td> 48.04</td><td> 2.76</td><td> 35.62</td><td> 8.91</td>
<td>pSZ1119</td><td> 1.77</td><td> 0.40</td><td> 7.85</td><td> 35.45</td><td> 2.47</td><td> 42.85</td><td> 8.15</td>
Cocoa butter
A microbial mimetic cocoa butter was produced that was similar to cocoa butter. The construct, pSZ1451, was constructed and transformed into strain A and oil production was carried out. The construct, pSZ1451 (SEQ ID NO: 239), comprised the TE gene optimized by
429
ΙΜΡΙ
MEXICAN INSTITUTE OE LA PROPItnAU INDUSTRIAL
<img file="MX339639B_D0402.tif" />
Carthamus tinctorus codon (section with ID number: 187) (Genbank accession number AAA33019.1).
As shown in Table 35 below, mimetic cocoa butter oil was similar to cocoa butter.
The percentages of the three most abundant fatty acids in mimetic cocoa butter (C16.-0, C18: 0 and C18: l) were identical or within 10% of cocoa butter.
Table 35. Triglyceride profile of mimetic cocoa butter.
<td> 10</td><td colspan="2">C8:</td><td>CIO:</td><td>C12:</td><td>C14:</td><td>C16:</td><td>C18:</td><td>C18:</td><td>C18:</td>
<td></td><td></td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 2</td>
<td></td><td>Butter</td><td> 0</td><td> 0-1</td><td> 0-1</td><td> 0-4</td><td> 22-</td><td> 24-</td><td> 29-</td><td> 0-3</td>
<td></td><td>cocoa</td><td></td><td></td><td></td><td></td><td> 38</td><td> 37</td><td> 38</td><td></td>
<td></td><td>pSZ1451</td><td></td><td> 0.05</td><td> 0.14</td><td> 0.99</td><td> 28.3</td><td> 27.3</td><td> 29.4</td><td> 10.2</td>
<td> 15</td><td></td><td></td><td></td><td></td><td></td><td> 4</td><td> 9</td><td> 0</td><td> 6</td>
Lardo
A microbial mimetic lard was produced that was similar to the lard. Some different plasmids were individually constructed and transformed into strain A and oil production was carried out. The construct, pSZ1493 (SEQ ID NO: 241), was designed to interrupt the SAD gene
430
IMPI
INSTITUTE Μ (XICANO Dt LA PROPIEDAD INDUSTRIAL
<img file="MX339639B_D0403.tif" />
2B endogenously and simultaneously express a codon optimized TE gene from Umbellularia cali fornica (sec. With ID #: 285) (Genbank accession number M94159). The construct, pSZ1452 (sec. With ID #: 240), was designed to interrupt the endogenous SAD 2B gene and express a codon optimized TE gene from Garcinia mangostana (sec. With ID #: 196) ( Genbank accession number AAB51525.1). The construct, pSZ1449 (sec. With no. ID: 238), was designed to express the Brassica napus codon-optimized TE gene (sec. with ID no .: 195) (accession no.
Genbank CAA52070.1). The polynucleotide sequence of the construct pSZ1458 was identical to pSZ1449 except that a codon optimized polynucleotide sequence encoding a Cuphea hookeriana thioesterase (accession no.
Genbank U39834) replaced the nucleotide sequence encoding the TE gene for Brassica napus (sec. With ID #: 195) (Genbank accession number CAA52070.1).
As shown in Table 36 below, the mimetic lard was similar to the lard. The percentages of the three most abundant fatty acids in the mimetic lard (C16: 0, C18: 0 and C18: l) were identical or within 10% of the lard.
Table 36. Triglyceride profile of mimetic lard.
<img file="MX339639B_D0404.tif" />
431 . IMPI
MEXICAN INSTITUTE
OF INDUSTRIAL PROPERTY
<td></td><td>C14: 0</td><td>C16: 0</td><td>C18: 0</td><td>C18: l</td><td>C18: 2</td>
<td>Lardo</td><td> 3-4</td><td> 22-26</td><td> 13-18</td><td> 39-45</td><td> 8-15</td>
<td>pSZ1493</td><td> 1.32</td><td> 24.79</td><td> 17.49</td><td> 41.87</td><td> 10.01</td>
<td>pSZ1452</td><td> 1.16</td><td> 24.49</td><td> 17.94</td><td> 45.49</td><td> 8.05</td>
<td>pSZ1449</td><td> 1.16</td><td> 23.98</td><td> 15.79</td><td> 47.88</td><td> 8.29</td>
[0030] Although this invention was described in connection with specific embodiments, it will be understood that it is capable of further modifications. This application is intended to cover any variations, uses, or adaptations of the invention generally following the principles of the invention and such deviations from the present description are included that come within the known or habitual practice in the matter to which it belongs the invention and how it can be applied to the essential characteristics previously exposed.
All references cited in this description including patents, patent applications, and publications, including Genbank accession numbers, are hereby incorporated by reference in their entirety, whether or not they have been specifically incorporated previously. The publications mentioned in the present description are cited for the purpose of describing and disclosing the reagents,
<img file="MX339639B_D0405.tif" />
432
<img file="MX339639B_D0406.tif" />
IMPI m la nvntOAl, industrial methodologies and concepts that can be ii.qa.-r in relation to the present invention. Nothing herein is to be construed as an admission that these references are prior matter in connection with the inventions described herein. In particular, the following patent applications are hereby incorporated by reference in their entirety for all purposes: PCT application no. PCT / US2008 / 065563, filed June 2, 2008, titled
Oil production in microorganisms, PCT application no. PCT / US2010 / 31108, filed April 14, 2010, entitled Methods of Microbial Oil Extraction and Separation, and PCT Application No. PCT / US2009 / 066142, filed on November 30, 2009, titled Production of Specific Oils in Heterotrophic Microorganisms.
433
Contents321
680 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130 Sheet 131 Sheet 132 Sheet 133 Sheet 134 Sheet 135 Sheet 136 Sheet 137 Sheet 138 Sheet 139 Sheet 140 Sheet 141 Sheet 142 Sheet 143 Sheet 144 Sheet 145 Sheet 146 Sheet 147 Sheet 148 Sheet 149 Sheet 150 Sheet 151 Sheet 152 Sheet 153 Sheet 154 Sheet 155 Sheet 156 Sheet 157 Sheet 158 Sheet 159 Sheet 160 Sheet 161 Sheet 162 Sheet 163 Sheet 164 Sheet 165 Sheet 166 Sheet 167 Sheet 168 Sheet 169 Sheet 170 Sheet 171 Sheet 172 Sheet 173 Sheet 174 Sheet 175 Sheet 176 Sheet 177 Sheet 178 Sheet 179 Sheet 180 Sheet 181 Sheet 182 Sheet 183 Sheet 184 Sheet 185 Sheet 186 Sheet 187 Sheet 188 Sheet 189 Sheet 190 Sheet 191 Sheet 192 Sheet 193 Sheet 194 Sheet 195 Sheet 196 Sheet 197 Sheet 198 Sheet 199 Sheet 200 Sheet 201 Sheet 202 Sheet 203 Sheet 204 Sheet 205 Sheet 206 Sheet 207 Sheet 208 Sheet 209 Sheet 210 Sheet 211 Sheet 212 Sheet 213 Sheet 214 Sheet 215 Sheet 216 Sheet 217 Sheet 218 Sheet 219 Sheet 220 Sheet 221 Sheet 222 Sheet 223 Sheet 224 Sheet 225 Sheet 226 Sheet 227 Sheet 228 Sheet 229 Sheet 230 Sheet 231 Sheet 232 Sheet 233 Sheet 234 Sheet 235 Sheet 236 Sheet 237 Sheet 238 Sheet 239 Sheet 240 Sheet 241 Sheet 242 Sheet 243 Sheet 244 Sheet 245 Sheet 246 Sheet 247 Sheet 248 Sheet 249 Sheet 250 Sheet 251 Sheet 252 Sheet 253 Sheet 254 Sheet 255 Sheet 256 Sheet 257 Sheet 258 Sheet 259 Sheet 260 Sheet 261 Sheet 262 Sheet 263 Sheet 264 Sheet 265 Sheet 266 Sheet 267 Sheet 268 Sheet 269 Sheet 270 Sheet 271 Sheet 272 Sheet 273 Sheet 274 Sheet 275 Sheet 276 Sheet 277 Sheet 278 Sheet 279 Sheet 280 Sheet 281 Sheet 282 Sheet 283 Sheet 284 Sheet 285 Sheet 286 Sheet 287 Sheet 288 Sheet 289 Sheet 290 Sheet 291 Sheet 292 Sheet 293 Sheet 294 Sheet 295 Sheet 296 Sheet 297 Sheet 298 Sheet 299 Sheet 300 Sheet 301 Sheet 302 Sheet 303 Sheet 304 Sheet 305 Sheet 306 Sheet 307 Sheet 308 Sheet 309 Sheet 310 Sheet 311 Sheet 312 Sheet 313 Sheet 314 Sheet 315 Sheet 316 Sheet 317 Sheet 318 Sheet 319 Sheet 320 Sheet 321 Sheet 322 Sheet 323 Sheet 324 Sheet 325 Sheet 326 Sheet 327 Sheet 328 Sheet 329 Sheet 330 Sheet 331 Sheet 332 Sheet 333 Sheet 334 Sheet 335 Sheet 336 Sheet 337 Sheet 338 Sheet 339 Sheet 340 Sheet 341 Sheet 342 Sheet 343 Sheet 344 Sheet 345 Sheet 346 Sheet 347 Sheet 348 Sheet 349 Sheet 350 Sheet 351 Sheet 352 Sheet 353 Sheet 354 Sheet 355 Sheet 356 Sheet 357 Sheet 358 Sheet 359 Sheet 360 Sheet 361 Sheet 362 Sheet 363 Sheet 364 Sheet 365 Sheet 366 Sheet 367 Sheet 368 Sheet 369 Sheet 370 Sheet 371 Sheet 372 Sheet 373 Sheet 374 Sheet 375 Sheet 376 Sheet 377 Sheet 378 Sheet 379 Sheet 380 Sheet 381 Sheet 382 Sheet 383 Sheet 384 Sheet 385 Sheet 386 Sheet 387 Sheet 388 Sheet 389 Sheet 390 Sheet 391 Sheet 392 Sheet 393 Sheet 394 Sheet 395 Sheet 396 Sheet 397 Sheet 398 Sheet 399 Sheet 400 Sheet 401 Sheet 402 Sheet 403 Sheet 404 Sheet 405 Sheet 406 Sheet 407 Sheet 408 Sheet 409 Sheet 410 Sheet 411 Sheet 412 Sheet 413 Sheet 414 Sheet 415 Sheet 416 Sheet 417 Sheet 418 Sheet 419 Sheet 420 Sheet 421 Sheet 422 Sheet 423 Sheet 424 Sheet 425 Sheet 426 Sheet 427 Sheet 428 Sheet 429 Sheet 430 Sheet 431 Sheet 432 Sheet 433 Sheet 434 Sheet 435 Sheet 436 Sheet 437 Sheet 438 Sheet 439 Sheet 440 Sheet 441 Sheet 442 Sheet 443 Sheet 444 Sheet 445 Sheet 446 Sheet 447 Sheet 448 Sheet 449 Sheet 450 Sheet 451 Sheet 452 Sheet 453 Sheet 454 Sheet 455 Sheet 456 Sheet 457 Sheet 458 Sheet 459 Sheet 460 Sheet 461 Sheet 462 Sheet 463 Sheet 464 Sheet 465 Sheet 466 Sheet 467 Sheet 468 Sheet 469 Sheet 470 Sheet 471 Sheet 472 Sheet 473 Sheet 474 Sheet 475 Sheet 476 Sheet 477 Sheet 478 Sheet 479 Sheet 480 Sheet 481 Sheet 482 Sheet 483 Sheet 484 Sheet 485 Sheet 486 Sheet 487 Sheet 488 Sheet 489 Sheet 490 Sheet 491 Sheet 492 Sheet 493 Sheet 494 Sheet 495 Sheet 496 Sheet 497 Sheet 498 Sheet 499 Sheet 500 Sheet 501 Sheet 502 Sheet 503 Sheet 504 Sheet 505 Sheet 506 Sheet 507 Sheet 508 Sheet 509 Sheet 510 Sheet 511 Sheet 512 Sheet 513 Sheet 514 Sheet 515 Sheet 516 Sheet 517 Sheet 518 Sheet 519 Sheet 520 Sheet 521 Sheet 522 Sheet 523 Sheet 524 Sheet 525 Sheet 526 Sheet 527 Sheet 528 Sheet 529 Sheet 530 Sheet 531 Sheet 532 Sheet 533 Sheet 534 Sheet 535 Sheet 536 Sheet 537 Sheet 538 Sheet 539 Sheet 540 Sheet 541 Sheet 542 Sheet 543 Sheet 544 Sheet 545 Sheet 546 Sheet 547 Sheet 548 Sheet 549 Sheet 550 Sheet 551 Sheet 552 Sheet 553 Sheet 554 Sheet 555 Sheet 556 Sheet 557 Sheet 558 Sheet 559 Sheet 560 Sheet 561 Sheet 562 Sheet 563 Sheet 564 Sheet 565 Sheet 566 Sheet 567 Sheet 568 Sheet 569 Sheet 570 Sheet 571 Sheet 572 Sheet 573 Sheet 574 Sheet 575 Sheet 576 Sheet 577 Sheet 578 Sheet 579 Sheet 580 Sheet 581 Sheet 582 Sheet 583 Sheet 584 Sheet 585 Sheet 586 Sheet 587 Sheet 588 Sheet 589 Sheet 590 Sheet 591 Sheet 592 Sheet 593 Sheet 594 Sheet 595 Sheet 596 Sheet 597 Sheet 598 Sheet 599 Sheet 600 Sheet 601 Sheet 602 Sheet 603 Sheet 604 Sheet 605 Sheet 606 Sheet 607 Sheet 608 Sheet 609 Sheet 610 Sheet 611 Sheet 612 Sheet 613 Sheet 614 Sheet 615 Sheet 616 Sheet 617 Sheet 618 Sheet 619 Sheet 620 Sheet 621 Sheet 622 Sheet 623 Sheet 624 Sheet 625 Sheet 626 Sheet 627 Sheet 628 Sheet 629 Sheet 630 Sheet 631 Sheet 632 Sheet 633 Sheet 634 Sheet 635 Sheet 636 Sheet 637 Sheet 638 Sheet 639 Sheet 640 Sheet 641 Sheet 642 Sheet 643 Sheet 644 Sheet 645 Sheet 646 Sheet 647 Sheet 648 Sheet 649 Sheet 650 Sheet 651 Sheet 652 Sheet 653 Sheet 654 Sheet 655 Sheet 656 Sheet 657 Sheet 658 Sheet 659 Sheet 660 Sheet 661 Sheet 662 Sheet 663 Sheet 664 Sheet 665 Sheet 666 Sheet 667 Sheet 668 Sheet 669 Sheet 670 Sheet 671 Sheet 672 Sheet 673 Sheet 674 Sheet 675 Sheet 676 Sheet 677 Sheet 678 Sheet 679 Sheet 680
74 members in 13 offices
Priority claims9
| Document | Office | Kind | Date |
|---|---|---|---|
| 61349774 | United States of America | – | |
| 61374992 | United States of America | – | |
| 34977410 | United States of America | P | |
| 37499210 | United States of America | P | |
| 61414393 | United States of America | – | |
| 41439310 | United States of America | P | |
| 61428192 | United States of America | – | |
| 201061428192 | United States of America | P | |
| 2011038463 | United States of America | W |
Members74
| Document | Office | Kind | |
|---|---|---|---|
| CA2801024A1 | Canada | A1 | |
| CA2801057A1 | Canada | A1 | |
| CA3039432A1 | Canada | A1 | |
| US2011293785A1 | United States of America | A1 | |
| US2011294174A1 | United States of America | A1 | |
| WO2011150410A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2011150411A1 | World Intellectual Property Organization (WIPO) | A1 | |
| WO2011150410A3 | World Intellectual Property Organization (WIPO) | A3 | |
| US2012324784A1 | United States of America | A1 | |
| US2013004646A1 | United States of America | A1 | |
| AU2011257982A1 | Australia | A1 | |
| AU2011257983A1 | Australia | A1 | |
| SG185780A1 | Singapore | A1 | |
| SG185781A1 | Singapore | A1 | |
| MX2012013756A | Mexico | A | |
| MX2012013777A | Mexico | A | |
| EP2575486A1 | European Patent Office (EPO) | A1 | |
| EP2576800A2 | European Patent Office (EPO) | A2 | |
| US2013096211A1 | United States of America | A1 | |
| US2013102039A1 | United States of America | A1 | |
| CN103097540A | China | A | |
| CN103124499A | China | A | |
| JP2013528383A | Japan | A | |
| KR20130085374A | Republic of Korea | A | |
| KR20130087410A | Republic of Korea | A | |
| JP2013533735A | Japan | A | |
| US8592188B2 | United States of America | B2 | |
| ZA201209185B | South Africa | B | |
| ZA201209186B | South Africa | B | |
| US8765424B2 | United States of America | B2 | |
| US2014315267A1 | United States of America | A1 | |
| SG10201504187YA | Singapore | A | |
| SG10201504197SA | Singapore | A | |
| US9109239B2 | United States of America | B2 | |
| JP2016005484A | Japan | A | |
| US2016024538A1 | United States of America | A1 | |
| US9255282B2 | United States of America | B2 | |
| AU2011257983B2 | Australia | B2 | |
| JP5868962B2 | Japan | B2 | |
| US9279136B2 | United States of America | B2 | |
| EP2575486A4 | European Patent Office (EPO) | A4 | |
| AU2016202905A1 | Australia | A1 | |
| MX339639BThis record | Mexico | B | |
| JP2016104024A | Japan | A | |
| US2016186191A1 | United States of America | A1 | |
| EP2576800A4 | European Patent Office (EPO) | A4 | |
| JP5996527B2 | Japan | B2 | |
| CN103124499B | China | B | |
| CN106135460A | China | A | |
| US9657299B2 | United States of America | B2 | |
| AU2011257982B2 | Australia | B2 | |
| JP2017104132A | Japan | A | |
| JP6150911B2 | Japan | B2 | |
| CN107058116A | China | A | |
| MX352746B | Mexico | B | |
| BR112012030329A2 | Brazil | A2 | |
| AU2016202905B2 | Australia | B2 | |
| BR112012030333A2 | Brazil | A2 | |
| AU2018203211A1 | Australia | A1 | |
| MX356949B | Mexico | B | |
| US10006034B2 | United States of America | B2 | |
| KR101899938B1 | Republic of Korea | B1 | |
| KR101916421B1 | Republic of Korea | B1 | |
| KR20180122486A | Republic of Korea | A | |
| US2018327758A1 | United States of America | A1 | |
| EP2576800B1 | European Patent Office (EPO) | B1 | |
| JP2019062919A | Japan | A | |
| CA2801057C | Canada | C | |
| ES2718489T3 | Spain | T3 | |
| JP6542283B2 | Japan | B2 | |
| CN106135460B | China | B | |
| KR102148462B1 | Republic of Korea | B1 | |
| EP2575486B1 | European Patent Office (EPO) | B1 | |
| ES2898678T3 | Spain | T3 |
1 legal event, as the office reported them to INPADOC
Events
| Event | Code | |
|---|---|---|
| Grant or registrationFG | FG |
Numbers
- Publication
- 339639
- Application
- 13777
Titles2
- Spanish
- ACEITES ESPECIFICOS PRODUCIDOS A PARTIR DE MICROORGANISMOS HETEROTROFOS RECOMBINANTES.
- English
- TAILORED OILS PRODUCED FROM RECOMBINANT HETEROTROPHIC MICROORGANISMS.
Classification
- CPC, 26
- A23D7/00
- C12P7/64
- C12N15/79
- A23D9/00
- C11B1/00
- C12N9/0071
- C12N9/16
- C12N9/2431
- C12N9/2465
- C12P7/6463
- C12Y114/19001
- C12Y301/02
- C12Y301/02014
- C12Y302/01022
- C12Y302/01026
- C12N15/67
- C12P7/6458
- C12P7/6445
- Y02T50/678
- A23K20/158
- Y02E50/10
- C12N15/74
- C12P1/00
- C12N15/8216
- Y02P30/20
- C11C3/00
- IPC, 8
- C12N1 13
- C10L1 02
- C10M101 04
- C12N15 09
- C12N15 74
- C12P7 64
- C12P7 6445
- C12P7 6458