Polypeptides and immunizing compositions containing gram positive polypeptides and methods of use.
Abstract
The present invention provides isolated polypeptides isolatable from a Staphylococcus spp. Also provided by the present invention are compositions that include one or more of the polypeptides, and methods for making and methods for using the polypeptides.

Term
No projected expiry on record.
- Priority
- Filed
- Granted
- Today
12 claims: 4 independent, 8 dependent
- 1CLAIMS REIVINDICACIONES Habiéndose descrito la invención reclama como propiedad lo contenido en las siguientes reivindicaciones:Having described the invention, it claims the property contained in the following claims: 1. Una composición caracterizada porque comprende: un polipéptido aislado que comprende la secuencia de aminoácidos de SEQ ID NO: 397, con la condición de que si el polipéptido aislado incluye aminoácidos adicionales en la terminal amino, los aminoácidos adicionales incluyan por lo menos dos modificaciones de aminoácido en comparación con los aminoácidos 1-26 de SEQ ID NO: 399. one. A composition characterized in that it comprises: an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 397, provided that if the isolated polypeptide includes additional amino acids at the amino terminus, the additional amino acids include at least two amino acid modifications compared to amino acids 1-26 of SEQ ID NO: 399.
- 5The conform composition. £ cai. ,, „. Claim 1, characterized in that the polypeptide comprises an amino acid sequence having at least 92% 5. La composición de conformidad .£cai.,,„.la reivindicación 1, caracterizada porque el polipéptido comprende una secuencia de aminoácidos que tiene al menos 92% 5 sequence identity with the amino acid sequence of 5 de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO:397. SEQ ID NO: 397.
- 8The composition in accordance with 8. La composición de conformidad con la 20 reivindicación 7, caracterizada porque el segundo polipéptido comprende una secuencia de aminoácidos que tiene la secuencia de aminoácidos de cualquiera de:SEQ ID NO: 353, SEQ ID NO: twenty Claim 7, characterized in that the second polypeptide comprises an amino acid sequence having the amino acid sequence of any of: SEQ ID NO: 353, SEQ ID NO: 354, SEQ ID NO : 355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID 354, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO: 361, SEQ NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO: 361, SEQ 25 ID NO: 362, SEQ ID NO: 363, SEQ ID NO: 364, SEQ ID NO: 365, 25 ID NO: 362, SEQ ID NO: 363, SEQ ID NO: 364, SEQ ID NO: 365, 286 286 IMPIAS IMPIAS SEQ ID NO: 366, SEQ ID NO: 367, SEQ ID NO: 36 # ϊ YES, Q ID N0: SEQ ID NO: 366, SEQ ID NO: 367, SEQ ID NO: 36#ϊ SÍ¡Q ID N0: 369, SEQ ID NO: 370, SEQ ID NO: 371, SEQ ID NO: 372, SEQ ID 369, SEQ ID NO: 370, SEQ ID NO: 371, SEQ ID NO: 372, SEQ ID NO: 373, SEQ ID NO: 374, SEQ ID NO: 375, SEQ ID NO: 376, SEQ NO: 373, SEQ ID NO: 374, SEQ ID NO: 375, SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO : 380, ID NO: 377, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO: 380, 5 SEQ ID NO: 381, SEQ ID NO: 382, SEQ ID NO: 383, SEQ ID NO: 5 SEQ ID NO: 381, SEQ ID NO: 382, SEQ ID NO: 383, SEQ ID NO: 384, SEQ ID NO: 385, SEQ ID NO: 386, SEQ ID NO: 387, SEQ ID 384, SEQ ID NO: 385, SEQ ID NO: 386, SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO: 389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ NO: 388, SEQ ID NO: 389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID NO: 393, SEQ ID NO: 394, SEQ ID NO: 395, ID NO: 392, SEQ ID NO: 393, SEQ ID NO: 394, SEQ ID NO: 395, SEQ ID NO: 396 SEQ ID NO: 419, SEQ ID NO: 420, SEQ ID NO: SEQ ID NO: 396 SEQ ID NO: 419, SEQ ID NO: 420, SEQ ID NO: 10 421, SEQ ID NO: 422, SEQ ID NO: 423, SEQ ID NO: 424, SEQ ID 10 421, SEQ ID NO: 422, SEQ ID NO: 423, SEQ ID NO: 424, SEQ ID NO: 425, SEQ ID NO: 426, SEQ ID NO: 427, SEQ ID NO: 428 O SEQ NO: 425, SEQ ID NO: 426, SEQ ID NO: 427, SEQ ID NO: 428 OR SEQ ID NO: 429. ID NO: 429.
- 1010. La composición de conformidad con la The composition in accordance with I I 287 287 Ό ; Ό; 1 XV.i A .7- v n;£-:r' ·-··' v reivindicación 9, caracterizada porque el segundé^óltpépti comprende una secuencia de aminoácidos que tiene -i da al menos 85% a la secuencia de aminoácidos con cualquiera de: one XV.i A .7- vn;£ -: r '· - ··' v claim 9, characterized in that the second ^ olpepti comprises an amino acid sequence having -i gives at least 85% to the amino acid sequence with any of: SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID NO : 410, SEQ ID NO: SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID NO: 410, SEQ ID NO: 5 411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID 5 411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID NO: 415, SEQ ID NO: 416, SEQ ID NO: 417 o SEQ ID NO: 418. NO: 415, SEQ ID NO: 416, SEQ ID NO: 417 or SEQ ID NO: 418.
Independent claims4
3,232 paragraphs in 315 sections, as filed
(54) Title: POLYPEPTIDES AND IMMUNIZING COMPOSITIONS CONTAINING GRAMPOSITIVE POLYPEPTIDES AND METHODS OF USE.
(54) Title: POLYPEPTIDES AND IMMUNIZING COMPOSITIONS CONTAINING GRAM POSITIVE POLYPEPTIDES AND METHODS OF USE.
(57) Summary
The present invention relates to a composition characterized in that it comprises: an isolated polypeptide comprising the amino acid sequence of SEO ID NO: 397, provided that if the isolated polypeptide includes additional amino acids at the amino terminus, the additional amino acids include at least two amino acid modifications compared to amino acids 1-26 of SEQ ID NO: 399.
(57) Abstract
The present invention provides isolated polypeptides isolatable from a Staphylococcus spp. Also provided by the present invention are compositions that inelude one or more of the polypeptides, and methods for making and methods for using the polypeptides.
I KNOW
Institute
Mexican Property
Industrial
<img file="MX339461B_D0001.tif" />
PATENT TITLE NO. 339461
Owner (s): EPITOPIX, LLC
Address: 3735 County Road 5, Willmar, Minnesota, 56201, USA
Name: POLYPEPTIDES AND IMMUNIZING COMPOSITIONS CONTAINING GRAMPOSITIVE POLYPEPTIDES AND METHODS OF USE
Classification: lnt.CI.8: A61K39 / 085; A61K39 / 38; C07K14 / 00
Inventor (s): LISA L. HERRON-OLSON; DREW M. CATRON
Wildebeest
MX / a'2 a'2C®0O994 £
Presentation date i March 2010
PRIORITY
Country:
US
Date: 'March 2009
Number:
61 / 210,772 agency: Twenty years since Vencímientoi March 23, 2030, reference patent is granted cordation in articles 1, 2 fraction V, 6 fraction III, and 59 of the Industrial Property Law.
[i in accordance with article 23 of the Property Law cted as of the date of submission of the Trechos application.
ok subscribe the present title what I ce with I went
<img file="MX339461B_D0002.tif" />
This patent is valid for twenty non-renewable years and will be subject to<sup>1</sup> payment of the fee to keep Agents the articles 6 * tacoones lll and 7 ° bis 2 of jj Law of the ¢ 1 /: ^^ 1 ^ ^ 5/10/1996, 26/12 / 1997,17 / 05/1999 , and 04/09/2012); articles 1, attraction V Industrial piety (DOF 12/14/1999, formed the Organic MdaaMBaMNStMriNaattMriCMMP of the Mexican Institute of Industrial Property (DOF 12/27/1999, amended on 10/10/2002, 07/29/2004, 08/04/2004 and 09/13/2007); 1, 3 and 5 paragraph a) of the Agreement that delegates powers to the Deputy Directors General, Coordinator, Divisional Directors, Heads of Regional Offices, Divisional Deputy Directors, Departmental Coordinators and other subordinates of the Mexican Institute of Industrial Property. (DOF 12/15/1999, amended on 02/04/2000, 07/29/2004, 08/04/2004 and 09/13/2007).
Industrial opportunity (Official Dlarii of 01/01/2004, 06/16/2005, 2! 31/2006, idfclso a), 4th and 12th fraction: s I and lll
137/2004 and the Federation (DOF) ¡/ 05 / 2009,06 / 01/2010, 18/1 il Regulation of the Mexican Institute
Issue Date: May 27, 2016
<img file="MX339461B_D0003.tif" />
&>// /771?
5 ^ 4 Μ> ·
IMMUNIZING POLYPEPTIDES AND COMPOSITIONS QBE.t® <3ldfí¿ÍlSIÍ
INSTnV.'O '¿' XiCANO i ”LA ·
GRAMPOSITIVE POLYPEPTIDES AND METHODS OF USE1 '
BACKGROUND OF THE INVENTION
Gram-positive bacteria are a remarkably diverse group of organisms that cause a variety of diseases in both humans and animals.
Some of the pathogens recognized as important for human and / or animal health include bacteria belonging to the Corynebacteriaceae families,
Enterococcacae, Micrococcaceae, Mycobacteriaceae,
Nocardiaceae and Peptococcaceae, which include bacterial species such as Actinomyces spp., Bifidobacterium spp., Corynebacterium spp., Enterococcus spp., Erysipelothrix spp., Eubacterium spp., Kytococcus spp., Lactobacillus spp.,
Mycrococcus spp., Mobiluncus spp., Mycobacteria spp.,
Peptostreptococcus spp., Propionylbacterium spp., And
Staphylococcus spp. These pathogens cause a multitude of clinical manifestations in many different animal species. Historically, treatment for such infections has been with antibiotics that attack the common structures and functions of gram-positive organisms. However, many of the more ubiquitous gram-positive organisms have developed resistance to various classes of antibiotics, making REF: 223886 infection treatment difficult. Use broaden salting of
<img file="MX339461B_D0004.tif" />
Antibiotics in the treatment of chronic disease in both humans and food-producing animals is probably a major contributing factor in the proliferation of antibiotic-resistant strains of many species of gram-positive organisms. Therefore there is a great need to find different treatments that avoid or eliminate infections by gram-positive organisms in animals as well as in humans.
Staphylococcal Infections in Agricultural Animals
In the agricultural industry many major diseases are caused by gram-positive organisms. Examples of clinical conditions caused by gram-positive bacterial infections include mastitis, septicemia, pneumonia, ostemielitis, meningoencephalitis, lymphangitis, dermatitis, genital tract infections, metritis, perinatal disease, pituitary abscesses, arthritis, bursitis, orchitis, cystitis, and pyelonephritis. , caseous lymphadenitis, tuberculosis, ulcerative lymphangitis, erysipelas, laminitis, tyzzer's disease, tetanus, botulism, enteritis, braxy, bacillary hemoglobinuria, enterotoxemia. Staphylococcus spp., In particular, is capable of infecting many different species of agricultural animals and can cause enormous economic losses. For example, a loss of> *. · Is calculated in the United States dairy industry.
approximately $ 185 per cow annually deíbi r
a disease frequently caused by
<img file="MX339461B_D0005.tif" />
aureus. Given that there are 9.5 million dairy women in the United States, the annual cost of mastitis is approximately $ 1.8 billion. This is approximately 10% of the total value of farm milk sales, and approximately two thirds of these losses. They are due to reduced milk production in subclinically infected cows. Other losses are due to abnormal waste milk and retained milk from antibiotic-treated cows, early replacement costs for affected cows, reduced sales value of damaged cows, cost of drugs and veterinary services, and increased labor costs. In addition to its prevalence within the coil dairy industry, mastitis caused by gram-positive cocci is also common among goats and sheep. Additional animal diseases caused by S. aureus include botryomycosis in horses, purulent synovitis and osteomyelitis in poultry, snuffles in rabbits, abortions in pigs, and tick pyemia in sheep. Other staphylococcal species are major skin pathogens of dogs (S. intermedius) and pigs (S. hycius). In poultry species, staphylococcal pathogens cause endocarditis and septicemia.
Staphylococcal Infections in Humans
Staphylococcus spp., Are also human pathogens that cause a wide variety of infections.
<img file="MX339461B_D0006.tif" />
MEXICAN INSTITUTE OF THE FROHF.DAO e: .ci
<img file="MX339461B_D0007.tif" />
of Staphylococcus aureus, a common colonizer of the 'ííftfé ^ ay<sup>1 </sup>Human skin is an opportunistic pathogen that can cause various human infections. For example, S. aureus is the causative agent of several skin infections including impetigo, furunculosis, cellulite, and scalded skin syndrome as well as life-threatening postsurgical wound infections. Furthermore, the exposure of immunodeteriorated people to S. aureus in hospital settings has resulted in organ infections such as pneumonia, urinary tract infections, osteomyelitis, arthritis, bateremia, and endocarditis. S. aureus is also the causative agent of toxinosis, most notably toxic shock syndrome and food poisoning. Food poisoning caused by staphylococcal enterotoxin B is the most common cause of foodborne illness, even surpassing salmonellosis, campylobateriocis, and listeriosis. Other staphylococcal species also cause disease in humans; S. epidermidis, S. hamolyticus, and S. hominis commonly infect implanted medical devices, and S. saprophyticus is associated with urinary tract infections in women.
Virulence Mechanisms of Staphylococci
Staphylococci infect a variety of host tissues and evade the immune system to gcrrr.ra ^ x ^ through the production of various types í dJ j ^ wteines <sup>1</sup> ; institute:. :: x'- · ,? ·. ·
L OF THE PS -. 'Fil<sup>:</sup>OR'..
secreted, virulence factors expressed <sup>:</sup>'in<sup>:</sup>'the · surface and metabolic systems designed to<sup>1</sup> survive<sup>-</sup>'among the limited resources and active defenses associated with the host environment. Colonization is the first necessary stage in establishing an infection; Numerous factors include capsule, lipoteichoic acid, and teicoic acid as common structural components that contribute to colonization. Furthermore, surface proteins such as staphylococcal fibronectin binding protein and bone sialoprotein binding proteins specifically bind components of the host tissue.
The toxins are commonly produced among staphylococcal pathogens and are highly harmful; Various human diseases, including food poisoning, toxic shock syndrome, and exfoliative skin conditions are a direct result of extracellular secreted toxin proteins. A single isolate can code genes for 20-30 different secreted toxins. Some of the secreted protein products are superantigens that can bind non-specifically to class II CPH molecules of an antigen presenting cell and simultaneously to T lymphocyte receptors of a T lymphocyte. Binding induces signaling of T lymphocytes and generates the release of high levels of proinflammatory factors, which eventually induce
<img file="MX339461B_D0008.tif" />
damage to host due to immune response
<img file="MX339461B_D0009.tif" />
)
Another class of virulence factors expressed in
<img file="MX339461B_D0010.tif" />
surface hide bacteria from the system<img file="MX339461B_D0011.tif" /> host. For example, protein A expressed on the surface of S. aureus inhibits opsomization and phagocytosis by binding of the Fe components of the host antibody. Numerous proteases, hemolysins (alpha, beta, gamma, and delta), nucleases, lipases, hyaluronidase, and collagenase also help bacteria extract nutrients from surrounding cells and protect them against host defenses.
Antibiotic Resistance Among Staphylococci
The CDC estimates that approximately 2 million people in the United States each year acquire nosocomic infections, resulting in 90,000 deaths annually. Of these fatal infections, 70% are caused by antibiotic resistant bacteria. The increase in antibiotic resistance among microbial species is particularly pronounced in skin and mucosa colonizers such as S. aureus. For example, the vast majority of S. aureus isolated from hospital settings are resistant to penicillin and 50% are also resistant to semi-synthetic penicillins such as methicillin, nafeilin, and oxacillin. These isolates, called MRSA (methicillin-resistant S. aureus) were first observed in the 1970s and have now been:
INSTITUTE, 'í'-7 v ;, ,, ·
DEL \ firmly in hospital settings. Recently there have been several cases of MRSA infections in the ~ Tdmünida.'dT '”eTr' where infected people have not previously been exposed to hospitals or healthcare workers. This alarming trend is intensified by the isolation of MRSA isolates that are less susceptible to vancomycin, a glycopeptide used to treat MRSA. Very few strains have been shown to be truly vancomycin resistant according to the CDC definition of vancomycin resistance, but several MRSA strains have been characterized as consisting of populations with reduced susceptibility to vancomycin or VISA (S. aureus intermedia). vancomycin). Since the isolation of vancomycin resistant and vancomycin intermediate strains is a relatively new development, there is little data regarding their prevalence in hospitals and / or the community. Occasionally, VRSA (vancomycin resistant S. aureus) with full vancomycin resistance and presenting a similarly acquired resistance plasmid from Enterococcus spp., Have also been recovered from humans.
Strategies for the Prevention and Treatment of Staphylococcus Infections
The emergence of numerous gram-positive pathogens
<img file="MX339461B_D0012.tif" />
that they are resistant to multiple antibiotics has JrnéWltsMdd! the.-'<sup>1</sup>
INS71T ·. )<sup>1</sup> search efforts with the aim of developing vaccines -......-.....
Preventive measures to protect against diseaseW. ~ 'b'a ^' ^ rattlTias “· '- are designed to be administered to patients in order to induce a long-term memory response from the immune system so that if the pathogen is found at a future time, the immune system can cleanse the pathogen more quickly and effectively. To date, a widely protective vaccine against gram-positive pathogens associated with numerous serious human diseases, particularly those associated with staphylococcal infections, is not available. Vaccine development approaches for the prevention of staphylococcal infections include those reporting the use of adhesion matrix molecules that recognize microbial surface components [MSCRAMMS] (Nilsson et al., 1998, J Clin Invest
101: 2640-9; Menzies et al., 2002. J Infect Dis 185: 937-43;
Fattom et al., 2004. Vaccine 22: 880-7], surface polysaccharides (McKenney et al. 2000; McKenney et al., 199.
Science 284: 1523-7: Maira-Litran et al. 20002. Infect Immun
70: 4433-40; Maira-Litran et al. 2004. Vaccine 22: 872-9; Maira-Litran et al. 2005. Infect Immun 73: 6752-62) and mutated exoproteins (Lowell et al, 1996. Infect Immun 64: 4686-93; Stiles et al. 2001. Infect Immun 69: 2031-6;
Gampfer et al. 2002. Vaccine 20: 3675-84), as antigens in / Τ subunit vaccine compositions as well cAná '^ - Xiría -cepa
Bsstíttj'í or V - '. Ce? ··? '<sup>;</sup>:. <···· .., _,,, _ live avirulent INDLiSTrdAL (Remoso et al. 2002. Can J Vet Res 66: 285-8) and various DNA vaccine approaches (Ohwada et ^ aT "7
Antimicrob Chemother 44: 767-74); Brouillette et al. 2002.
Vaccine 20: 2348-57; Senna et al. 2003. Vaccine 21: 2661-6).
Although many of these compositions have shown some degree of protection, they have obtained little cross-protection against various staphylococcal strains and additionally have not induced substantial immune responses in immunodeteriorated patients, a significant population at risk for nosocomial infections.
The most serious staphylococcal diseases are those mediated by the aforementioned superantigenic pyrogenic exotoxins (SPEs) that non-specifically stimulate T lymphocytes regardless of antigen presentation. Such diseases include toxic shock syndrome, exfoliative skin disease, and possibly Kawasaki syndrome. For these SPE-mediated diseases, immunotherapeutic agents that boost the immune system during a native infection are often more effective than vaccines, which are typically administered prior to infection. The overwhelming nature of the immune response to SPE necessitates rapid reduction in toxin activity as a primary goal in the
F treatment. So far the neutralization Jdjhy | toxinina in ·.
INSTITb'l '' ·· 'Va<sup>¿</sup> S. aureus-mediated disease has been effectively carried out by the administration of intravenous human immunfaglnhulin (IVIG), a concentrated human antibody preparation from several thousand human donors (Takei et al. 1993 J Clin Invest 91: 602-7; Stohl and Elliot. 1996. Clin Iramunol Immunopathol 79: 122-33). The widely disseminated distribution of S. aureus, which colonizes approximately 30% of healthy human adults, coincides with the high exposure rates for most of the population, so the level of antisfalilococcal antitoxin antibodies in IVIG is often sufficient to neutralize the toxin enough to stabilize the immune response until the bacterial load is reduced with antibiotics (Schlievert, 2001. J Allergy Clin Immunol 108 (4 Suppl): S107-110). IVIG preparations from different manufacturers have been shown to neutralize the toxin in proliferation assays with human peripheral blood mononuclear cells, which inhibit toxin-induced B-cell differentiation induced by toxin in vitro (Stohl and Elliot. 1996 Clin Immunol Immunopathol 79: 122-33; Stohl and Elliot.
nineteen ninety five. J Immunol 155: 1838-50; Stohl et al. 1994. J Immunol
153: 117-27) and reduces the secretion of IL-4 and IL-2 in staphylococcal enterotoxin B-stimulated PBMCs (Takei et al.
1993. J Clin Invest 91: 602-7; Darenberg tet jal. 2004. Clin ... ^
Infect Dis 38: 836-42). Treatment with ΐ'ΰΐέίρ which has · demonstrated the ability to neutralize SPE is now a recommended treatment for Kawasaki syndrome and is gaining prominence as a treatment method for staphylococcal toxic shock syndrome (Schlievert 2001. J Allergy Clin Imraunol 108 (4 Suppl): S107-110). The use of IVIG as an immunoprotective wound wash during surgery has also been investigated in mice (Poelstra et al. 2000.
Tissue Eng 6 (4): 401-411). Although standard IVIG is useful in limiting the progression of some staphylococcal SPE mediated diseases, the safety, efficacy, and consistency of human IVIG preparations generated from thousands of unselected human donors remain controversial (Baker et al. 1992, N Engl J Med 327: 123-9; Miller et al. 2001. J Allergy Clin Immunol
108: S91-4; Sacher, 2001. J Allergy Clin Immunol 108: S139-46;
Darenberg et al. 2004. Clin Infect Dis 38: 836-42). Furthermore, the benefit of IVIG in preventing some staphylococcal infections is questionable (Baker et al. 1992. N Engl J Med 327: 213-9; Hill, HR 2000. J Pediatr 137: 595-7; Darenberg et al. 2004. Clin Infect Dis 38: 836-42). In order to increase the efficacy of IVIG in the treatment of staphylococcal infections in certain populations at risk, a donor-selected polyclonal anti-staphylococcal human IgG derived from plasma with the title "IWTéyadjos · de * 1" I <sup>1 :</sup> tKSTñi agfüpamieptQ .. factor A antibody targeting * 5 staphylococcal MSCRAMMS (ClfA) and fibrinogen binding protein G (SdrG) has been successfully created and tested in infants with very low birth weight to avoid staphylococcal sepsis
<td>(Vernachio</td><td>et</td><td>to the.</td><td> 2003 .</td><td>Antimicrob</td><td>Agents</td><td>Chemother</td><td> 47 :3400-</td>
<td>6; Bloom</td><td>et</td><td>to the.</td><td> 2005 .</td><td>Pediatrician</td><td>Infect</td><td>Dis J 24:</td><td> : 858-866:</td>
<td>Capparelli</td><td>et</td><td>to the.</td><td> 2005 .</td><td>Antimicrob</td><td>Agents</td><td>Chemother</td><td> 49 :4121-</td>
7). A humanized monoclonal antibody specific for S. aureus MSCRAMM clustering factor A has also been developed. The antibody has been selected from a pool of thousands of murine anti-ClfA antibodies for its ability to bind ClfA in a manner that suppresses binding of S. aureus to human fibronectin and subsequently humanized by mutation of specific target residues to mimic a antibody from a homologous human germline subgroup (Hall et al. 2003. Infect Immun 71: 6864-70; Domanski et al. 2005. Infect Immun 73: 5229-32). The specific antibody has been designed for use in conjunction with antibiotics for the treatment of severe, life-threatening S. aureus infection, although animal studies have also shown a prophylactic protective effect.
SUMMARY OF THE INVENTION
In one aspect, the present invention provides <sup>!</sup> I TV. <Ο ': Γ / <1-; ·.
compositions including two or more isolated polypeptides *.
OjSTrryy · '/ y
An isolated polypeptide in the composition has' a 'molecular weight determined by electrophoresis on' un''ge I ide sodium dodecyl sulfate-polyacrylamide 88 kDa, 55 kDa, 38 .5 kDa, 37 kDa, 36 kDa, 35 kDa or 33 kDa. For example, a composition can include isolated 88 kDa and 55 kDa proteins. In some aspects, the composition can include isolated polypeptides that have molecular weights of 88 kDa,
5 kDa, 38 kDa, 3 7 kDa, 3 6 kDa, 3 5 kDa or 3 3 kDa. Polypeptides are isolable from Staphylococcus aureus when incubated in a medium that includes an iron chelator and are not isolable when grown in a medium without the iron chelator. The composition protects an animal, such as a mouse or cow, or a human against exposure with an S strain.
aureus such as, for example, ATCC strain 19636. The composition may further include a pharmaceutically acceptable carrier and may additionally include one or more isolated polypeptides having a molecular weight of 150 kDa, 132 kDa, 120 kDa, 75 kDa, 58 kDa, 50 kDa, 44 kDa, 43 kDa, 41 kDa or 40 kDa and isolates of an S. aureus when grown in the medium without the iron chelator. In some respects, the polypeptides in the composition can be isolated from S. aureus
ATCC strain 19636.
In some embodiments, each polypeptide in the composition has a mass fingerprint of at least
<img file="MX339461B_D0013.tif" />
INSTITUTE <sup>:</sup> ···
80% similarity with a 4ha.sa fingerprint. de ítnu., polypeptide of the same molecular weight polypeptide expressed by Staphylococcus aureus ATCC strain 19636, wherein the polypeptide is isolable from a Staphylococcus aureus when incubated in a medium comprising an iron chelator and is not isolable when grown in the medium. without the iron chelator. For example, the isolated polypeptide with a molecular weight of 88 kDa has a mass fingerprint of at least 80% similarity to a mass fingerprint of an 88 kDa polypeptide expressed by Staphylococcus aureus ATCC strain 19636 and the isolated polypeptide with a molecular weight of 55 kDa it has a mass fingerprint of at least 80% similarity to the mass fingerprint of a 55 kDa polypeptide expressed by Staphylococcus aureus
ATCC strain 19636.
In another aspect, the present invention provides compositions that include an isolated polypeptide that has at least 80% sequence similarity to an amino acid sequence that is selected from SEQ ID NO: 408 and SEQ ID NO: 397. The composition may further include at least one second polypeptide, wherein the second polypeptide is isolatable from Staphylococcus aureus when incubated in a medium comprising an iron chelator and is not isolatable when grown in a medium without the iron chelator. In some cases, the second polypeptide may include an amino acid sequence that has a? 1J r | 8Ó% ';' dé ''; 3 f INSTiJy f: ''<sup>c</sup>- '' '' similarity to an amino acid sequence! ', which' is · -selected 'from SEQ ID NO: 353, SEQ ID NO: 364, SEQ NO: 3 86 and SEQ ID NO: 419. In In other cases, the second polypeptide may have a molecular weight, determined by electrophoresis on a 88 kDa, 55 kDa, 38 kDa, 37 kDa, 36 kDa, 35 kDa or 33 kDa sodium dodecyl sulfate gel. The composition may further include one or more isolated polypeptides that can be isolated from an S. aureus when grown in a medium without the iron chelator and having a molecular weight of 150 kDa, 132 kDa, 120 kDa, 75 kDa, kDa, 50 kDa, 44 kDa, 43 kDa, 41 kDa or 40 kDa.
The present invention also provides methods of using the compositions. In one aspect, the method is to treat an infection in a subject, and includes administering an effective amount of a composition of the present invention to a subject who has or is at risk of having an infection caused by Staphylococcus spp. In another aspect, the method is to treat a symptom in a subject and includes administering an effective amount of a composition of the present invention to a subject who has an infection caused by Staphylococcus spp. The subject can be a mammal, such as a human, horse, or cow. Staphylococcus spp can be S. aureus.
The present invention provides methods for
<img file="MX339461B_D0014.tif" />
One aspect, the methods are for treating an infection in a subject, and includes administering an effective amount of a composition, to a subject who has or is at risk of having an infection caused by Staphylococcus spp, wherein the composition includes antibody. specifically binding at least one, and in some cases more than an isolated polypeptide of the present invention. In another aspect, the method is to treat a symptom in a subject and includes administering an effective amount of a composition to a subject who has an infection caused by Staphylococcus spp, wherein the composition includes antibody that specifically binds at least one, and in some cases more than one isolated polypeptide of the present invention. The subject can be a mammal, such as a human, horse, or cow. Staphylococcus spp can be S.
aureus.
Also provided by the present invention are methods of decreasing colonization in a subject. In one aspect, the method includes administering an effective amount of a composition of the present invention to a subject colonized by Staphylococcus spp. In another aspect, the method includes administering an effective amount of a composition to a subject colonized by Staphylococcus spp, where the
<img file="MX339461B_D0015.tif" />
. . . INSTiTi ~ go. - τ. ,, Composition includes antibodies that specifically bind, at least one, and in some cases more than one polypeptide
<td colspan="4">isolated from the present invention.</td>
<td>The</td><td>present invention</td><td>provides a kit</td><td>for</td>
<td>detect a</td><td>.antibody that</td><td>specifically binds</td><td>a</td>
<td>polypeptide.</td><td>The kit includes, in</td><td>separate containers</td><td>, a</td>
isolated polypeptide of the present invention and a reagent
<td>which detects</td><td colspan="2">an antibody that</td><td>specifically binds</td><td>to the</td>
<td>polypeptide.</td><td></td><td></td><td></td><td></td>
<td></td><td>BRIEF</td><td>DESCRIPTION OF</td><td>THE FIGURES</td><td></td>
<td>The</td><td>figure</td><td>1 shows the</td><td>electrophoretic profile</td><td>of</td>
<td>proteins of</td><td>strains</td><td>different</td><td colspan="2">Staphylococcus aureus</td>
derived from different species that grow with and without iron (lanes marked Fe<sup>++</sup> and DP, respectively).
Figure 2 shows the difference in mortality between vaccinated and unvaccinated mice after homologous and heterologous exposure with Staphylococcus aureus.
Figure 3 shows the Kaplan-Meier survival curve showing the percentage of survival after vaccination and homologous exposure with S. aureus,
ATCC 19636.
Figure 4 shows the Kaplan-Meier survival curve showing the percentage of survival after vaccination and heterologous exposure with S. aureus,
ATCC 19636.
<img file="MX339461B_D0016.tif" />
V! I jf ·. ·· ·· · '· ·' · '<£ >> · the curve of its survival Lav \% survival rate
<img file="MX339461B_D0017.tif" />
and homologated exhibition with S.
the survival percentage survival curve
Figure 5 shows Kaplan-Meier showing the after passive aureus immunization, ATCC 19636.
Figure .6 shows Kaplan-Meier showing the after passive immunization and heterologous exposure with S.
aureus, strain 1477.
Figure 7 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus, ATCC.
19636 (SEQ ID NO: 353 /.
Figure 8 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 354).
Figure 9 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 355).
Figure 10 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MRSA252 (SEQ ID NO: 356).
Figure 11 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 357).
Figure 12 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
Newman (SEQ ID NO: 358). Λ Τ ') ·
INSTITI '. ·' Me: - ''
DE I, ·, · '- ··. ......
Figure 13 shows the amino acid sequence cte 'a metal regulated polypeptide obtained from dTS'. áüreüs ~ UH9 ”(SEQ ID NO: 359).
Figure 14 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
USA300 (SEQ ID NO: 360).
Figure 15 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 361).
Figure 16 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
NCTC8325 (SEQ ID NO: 362).
Figure 17 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MSSA476 (SEQ ID NO: 363).
Figure 18 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
ATCC19636 (SEQ ID NO: 364).
Figure 19 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 365).
Figure 20 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 366).
Figure 21 shows the sequence of J ^ ftinkacsiáos ·· institute of '>? \
..........
a metal regulated polypeptide obtained from S. ' <sup>:</sup> auretTs MRSA252 (SEQ ID NO: 367). ------------ Figure 22 shows the amino acid sequence of a me.tal-regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 368).
Figure 23 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
Newman (SEQ ID NO: 369).
Figure 24 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus JH9 (SEQ ID NO: 370).
Figure 25 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
USA300 (SEQ ID NO: 371).
Figure 26 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 372).
Figure 27 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
NCTC8325 (SEQ ID NO: 373).
Figure 28 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MSSA476 (SEQ ID NO: 374).
Figure 29 shows the amino acid sequence of a metal regulated polypeptide obtained <sup>1:<</sup>dp S. ATCC19636 (SEQ ID NO: 375).
Figure 30 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 376).
Figure 31 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 377).
Figure 32 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MRSA252 (SEQ ID NO: 378).
Figure 33 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 379).
Figure 34 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Newman (SEQ ID NO: 380).
Figure 35 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus JH9 (SEQ ID NO: 381).
Figure 36 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus USA300 (SEQ ID NO: 382).
Figure 37 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 383).
Figure 38 shows a sequence regulated polypeptide (of metal obtained "
I.
INST
CE 1 /. Ρ! '' I-Foot;> * DV. JNÍ / jiSTRíAL amino acids
<img file="MX339461B_D0018.tif" />
c ~ 37 aureus
NCTC8325 (SEQ ID NO: 384).
Figure 39 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MSSA476 (SEQ ID NO: 385).
Figure 40 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
ATCC19636 (SEQ ID NO: 386).
Figure 41 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 387).
Figure 42 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 388).
Figure 43 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MRSA252 (SEQ ID NO: 389).
Figure 44 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 390).
Figure 45 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Newman (SEQ ID NO: 391).
<img file="MX339461B_D0019.tif" />
S. aureus JH9 amino acid
Figure 46 shows the sequence of a metal regulated polypeptide obtained (SEQ ID NO: 392).
Figure 47 shows the sequence of a metal regulated polypeptide obtained from S. aureus USA300 (SEQ ID NO: 393).
Figure 48 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 394).
Figure 49 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
NCTC8325 (SEQ ID NO: 395).
Figure 50 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MSSA476 (SEQ ID NO: 396).
Figure 51 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
ATCC19636 (SEQ ID NO: 397).
Figure 52 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 398).
Figure 53 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 399).
Figure 54 shows the amino acid sequence of a metal regulated polypeptide obtained from ^ j- ^ ,. aureus
Dt t "
MRSA252 (SEQ ID NO: 400).
Figure 55 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 401).
Figure 56 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
Newman (SEQ ID NO: 402).
Figure 57 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus JH9 (SEQ ID NO: 403).
Figure 58 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus USA300 (SEQ ID NO: 404).
Figure 59 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 405).
Figure 60 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
NCTC8325 (SEQ ID NO: 406).
Figure 61 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MSSA476 (SEQ ID NO: 407).
Figure 62 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
ATCC19636 (SEQ ID NO: 408).
Figure 63 shows the amino acid sequence of 'ver'ύριλ i
<img file="MX339461B_D0020.tif" />
a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 409).
Figure 64 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 410).
Figure 65 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MRSA252 (SEQ ID NO: 411).
Figure 66 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 412).
Figure 67 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
Newman (SEQ ID NO: 413).
Figure 68 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus JH9 (SEQ ID NO: 414).
Figure 69 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
USA300 (SEQ ID NO: 415).
Figure 70 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 416).
<img file="MX339461B_D0021.tif" />
amino acids of S. aureus amino acids of S. aureus amino acids of
Figure 71 shows the sequence of a metal regulated polypeptide obtained
NCTC8325 (SEQ ID NO: 417).
Figure 72 shows the sequence of a metal regulated polypeptide obtained
MSSA476 (SEQ ID NO: 418).
Figure 73 shows the sequence of a metal regulated polypeptide obtained
ATCC19636 (SEQ ID NO: 419).
Figure 74 shows the sequence of a metal regulated polypeptide obtained from S. aureus RF122 (SEQ ID NO: 420).
Figure 75 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 421).
Figure 76 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
MRSA252 (SEQ ID NO: 422).
Figure 77 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MW2 (SEQ ID NO: 423).
Figure 78 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Newman (SEQ ID NO: 424).
Figure 79 shows the amino acid sequence of
- 27 a metal-regulated polypeptide obtained from sj 'ÍJfl9 institutional' Έ. '': '·.' · -'- :; 'C' '(SEQ ID NO: 425).<sup>c</sup>‘ '<
Figure 80 shows the amino acid sequence — of a metal-regulated polypeptide obtained from S. aureus
USA300 (SEQ ID NO: 426).
Figure 81 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus COL (SEQ ID NO: 427).
Figure 82 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
NCTC8325 (SEQ ID NO: 428).
Figure 83 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MSSA476 (SEQ ID NO: 429).
Figure 84 is a nucleic acid sequence encoding a metal regulated polypeptide obtained from 3. aureus ATCC19636 (SEQ ID NO: 430).
Figure 85 is a nucleic acid sequence encoding a metal regulated polypeptide obtained from
S. aureus RF122 (SEQ ID NO: 431).
Figure 86 is a nucleic acid sequence encoding a metal regulated polypeptide obtained from
S. aureus Mu50 (SEQ ID NO: 432).
Figure 87 is a nucleic acid sequence encoding a metal regulated polypeptide obtained from
S. aureus MRSA252 (SEQ ID NO: 433).
Figure 88 is a sequence of encodes for a polypeptide regulated by
S. aureus MW2 (SEQ ID NO: 434).
Figure 89 is a sequence for encoding a S. aureus Newman regulated polypeptide (SEQ ID NO: 435).
Figure 90 is a sequence of codes for a polypeptide regulated by
S. aureus JH9 (SEQ ID NO: 436).
Figure 91 is a sequence of encodes for a polypeptide regulated by
S. aureus USA300 (SEQ ID NO: 437).
Figure 92 is a sequence of codes for a polypeptide regulated by S. aureus COL (SEQ ID NO: 438).
Figure 93 is a sequence of codes for a polypeptide regulated by
S. aureus NCTC8325 (SEQ ID NO: 439).
Figure 94 is a sequence of encodes for a polypeptide regulated by
S. aureus MSSA476 (SEQ ID NO: 440).
Figure 95 is a sequence of encodes a S. aureus regulated polypeptide ATCC19636 (SEQ ID NO: 441).
<img file="MX339461B_D0022.tif" />
instituto miucuu) acid iíltaleiípó quéj:
<img file="MX339461B_D0023.tif" />
nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid than metal obtained from
Figure 96 is a sequence of encodes a polypeptide regulated by
S. aureus RF122 (SEQ ID NO: 442).
Figure 97 is a sequence of encodes for a polypeptide regulated by
S. aureus Mu50 (SEQ ID NO: 443).
Figure 98 is a sequence of encodes for a polypeptide regulated by
S. aureus MRSA252 (SEQ ID NO: 444).
Figure 99 is a sequence of encodes a S. aureus MW2 regulated polypeptide (SEQ ID NO: 445).
Figure 100 is a sequence encoding a metal regulated polypeptide obtained from S. aureus Newman (SEQ ID NO: 446).
acid <Jqap¿éííco que>
INSTITUTO wEX'CaNO '· -' '' <sub>Λ </sub>FROM THE PROí'ICAD metal obtained from / —— nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid than metal obtained from nucleic acid
<td>The</td><td>figure 101 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>JH9 (SEQ ID NO: 447)</td><td></td><td></td><td></td><td></td>
<td>The</td><td>figure 102 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">USA300 (SEQ ID NO: 448).</td><td></td><td></td><td></td>
<td>The</td><td>figure 103 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>COL (SEQ ID NO: 449)</td><td></td><td></td><td></td><td></td>
<td>The</td><td>figure 104 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
that encodes a lei ^ / í regulated polypeptide
MEXICAN INSTITUTE OF THE PROPERTY of S. aureus NCTC832 5 (SEQ ID NO: 4 50). industrial
<td>The</td><td>figure 105 is a</td><td>sequence</td><td>of</td><td>aciao</td><td>ñUÓlélL'U</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MSSA476 (SEQ ID NO:</td><td> 451) .</td><td></td><td></td><td></td>
<td>The</td><td>figure 106 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>ATCC19636 (SEQ ID NO</td><td> : 452) .</td><td></td><td></td><td></td>
<td>The</td><td>figure 107 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">RF122 (SEQ ID NO: 453).</td><td></td><td></td><td></td>
<td>The</td><td>figure 108 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">Mu50 (SEQ ID NO: 454).</td><td></td><td></td><td></td>
<td>The</td><td>figure 109 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MRSA252 (SEQ ID NO:</td><td> 455) .</td><td></td><td></td><td></td>
<td>The</td><td>figure 110 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MW2 (SEQ ID NO: 456)</td><td> •</td><td></td><td></td><td></td>
<td>The</td><td>figure 111 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">Newman (SEQ ID NO: 457).</td><td></td><td></td><td></td>
<td>The</td><td>figure 112 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
from S. aureus
Lcl Encoding of S. aureus
Lcl Encoding of S. aureus
The one that encodes S. aureus
The.
coding for S. aureus
Lcl Encoding of S. aureus
Lcl Encoding of S. aureus
Lcl Encoding of S. aureus
Lcl encoding
JH9 (SEQ ID NO: 458).
Figure 113 is a sequence for a regulated polypeptide.
USA300 (SEQ ID NO: 459).
Figure 114 is a sequence for a regulated polypeptide.
COL (SEQ ID NO: 460).
Figure 115 is a sequence for a regulated polypeptide.
NCTC8325 (SEQ ID NO: 461).
Figure 116 is a sequence for a regulated polypeptide.
MSSA476 (SEQ ID NO: 462).
Figure 117 is a sequence for a regulated polypeptide.
ATCC19636 (SEQ ID NO: 463).
Figure 118 is a sequence for a regulated polypeptide.
RF122 (SEQ ID NO: 464).
Figure 119 is a sequence for a Mu50 regulated polypeptide (SEQ ID NO: 465).
Figure 120 is a sequence for a regulated S. aureus MRSA252 polypeptide (SEQ ID NO: 466).
1M FI faith
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339461B_D0024.tif" />
of nucleic acid by metal of acid by metal of acid by metal of acid by metal of acid by metal of acid by metal of acid by metal obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained
<td>The</td><td>figure</td><td>121 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td>MW2 (SEQ</td><td>! ID NO: 467)</td><td> •</td>
<td>The</td><td>figure</td><td>122 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td colspan="3">Newman (SEQ ID NO: 468).</td>
<td>The</td><td>figure</td><td>123 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td>JH9 (SEQ</td><td>i ID NO: 469)</td><td> -</td>
<td>The</td><td>figure</td><td>124 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td colspan="3">USA300 (SEQ ID NO: 470).</td>
<td>The</td><td>figure</td><td>125 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td>COL (SEQ</td><td>! ID NO: 471)</td><td> •</td>
<td>The</td><td>figure</td><td>126 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td>NCTC8325</td><td>(SEQ ID NO:</td><td> 472) .</td>
<td>The</td><td>figure</td><td>127 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td>MSSA476</td><td>(SEQ ID NO:</td><td> 473) .</td>
<td>The</td><td>figure</td><td>128 is a</td><td>sequence</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td>
<td>from S. aureus</td><td colspan="2">ATCC19636 (SEQ ID NO</td><td> : 474).</td>
<td>The</td><td>figure</td><td>129 is a</td><td>sequence</td>
efe $ c £; dÓ by me ¥ á'17oL ^ t ^ n'i> dé £ li<sup>i</sup>
<img file="MX339461B_D0025.tif" />
from acid to metal from acid to metal from acid to metal from acid to metal from acid to metal from acid to metal from acid to metal of nucleic acid obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained nucleic obtained nucleic encoding for a polypeptide regulated by ^ étaí obtained • INSTITij'l ·: · '; de S. aureus RF122 (SEQ ID NO: 475).<sup>K</sup>'-'Vilc-ó-.V
Figure 13 0 is a sequence Ha á c ί Hq — nunln i nn-
<td></td><td>which encodes</td><td>for a regulated polypeptide</td><td>by metal</td><td>obtained</td>
<td> 5</td><td>from S. aureus</td><td>Mu50 (SEQ ID NO: 476).</td><td></td><td></td>
<td></td><td>The</td><td>figure 131 is a sequence</td><td>acid</td><td>nucleic</td>
<td></td><td>which encodes</td><td>for a regulated polypeptide</td><td>by metal</td><td>obtained</td>
<td></td><td>from S. aureus</td><td>MRSA252 (SEQ ID NO: 477).</td><td></td><td></td>
<td></td><td>The</td><td>figure 132 is a sequence</td><td>acid</td><td>nucleic</td>
<td> 10</td><td>which encodes</td><td>for a regulated polypeptide</td><td>by metal</td><td>obtained</td>
<td></td><td>from S. aureus</td><td>MW2 (SEQ ID NO: 478).</td><td></td><td></td>
<td></td><td>The</td><td>figure 133 is a sequence</td><td>acid</td><td>nucleic</td>
<td></td><td>which encodes</td><td>for a regulated polypeptide</td><td>by metal</td><td>obtained</td>
S. aureus Newman (SEQ ID NO: 479).
Figure 134 is a nucleic acid sequence encoding a metal regulated polypeptide obtained from S. aureus JH9 (SEQ ID NO: 480).
<td></td><td>The</td><td>figure</td><td>135 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>than</td><td>encode</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S</td><td>. aureus</td><td colspan="3">USA300 (SEQ ID NO: 481).</td><td></td><td></td><td></td>
<td></td><td>The</td><td>figure</td><td>136 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>than</td><td>encode</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S</td><td>. aureus</td><td colspan="2">COL (SEQ ID NO: 482)</td><td> •</td><td></td><td></td><td></td>
<td></td><td>The</td><td>figure</td><td>137 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>than</td><td>encode</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td colspan="2">S. aureus NCTC8325</td><td rowspan="2">(SEQ ID NO: 13 8 is a</td><td rowspan="2">483). sequence</td><td rowspan="2">one of</td><td colspan="2">USSTITU</td>
<td>The</td><td>figure</td><td>i: acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MSSA476</td><td>(SEQ ID NO:</td><td> 484) .</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>13 9 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">ATCC19636 (SEQ ID NO</td><td> : 485).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>14 0 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="3">RF122 (SEQ ID NO: 486).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>141 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">Mu50 (SEQ ID NO: 487</td><td> ) ·</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>142 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MRSA252</td><td>(SEQ ID NO:</td><td> 488) .</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>143 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">MW2 (SEQ ID NO: 489)</td><td> •</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>144 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>Newman (</td><td colspan="2">: SEQ ID NO: 490).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>14 5 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
de S. aureus JH9 (SEQ ID NO: 491).
<td>The</td><td>figure</td><td>146 is a</td><td>sequence</td><td>of</td><td colspan="2">τM <sup>;</sup> 'ΐ ác4dfo '<sup>r</sup> -hueleico INSTITUTE Ct The lKC-<sup>!</sup> OTA</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="3">USA300 (SEQ ID NO: 492).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>14 7 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>what encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>COL (SEO</td><td>ID NO: 493)</td><td> •</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>14 8 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>NCTC8325</td><td>(SEQ ID NO:</td><td> 494) .</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>149 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MSSA476</td><td>(SEQ ID NO:</td><td> 495) .</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>150 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">ATCC19636 (SEQ ID NO</td><td> : 496).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>151 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="3">RF122 (SEQ ID NO: 497).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>152 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="3">Mu50 (SEQ ID NO: 498).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>153 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MRSA252</td><td>(SEQ ID NO:</td><td> 499) .</td><td></td><td></td><td></td>
Figure 154 is a nucleic acid sequence
<td>which encodes from S. aureus</td><td>for a polypeptide MW2 (SEQ ID NO: 500)</td><td>regulated</td><td>by</td><td>m $ tálí to ; INSTíW ci: one!</td><td>obtained</td>
<td>The</td><td>figure 155 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">Newman (SEQ ID NO: 501).</td><td></td><td></td><td></td>
<td>The</td><td>Figure 156 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>JH9 (SEQ ID NO: 502)</td><td> •</td><td></td><td></td><td></td>
<td>The</td><td>Figure 157 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="2">USA300 (SEQ ID NO: 503).</td><td></td><td></td><td></td>
<td>The</td><td>Figure 158 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>COL (SEQ ID NO: 504)</td><td></td><td></td><td></td><td></td>
<td>The</td><td>figure 159 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>NCTC8325 (SEQ ID NO:</td><td> 505) .</td><td></td><td></td><td></td>
<td>The</td><td>figure 160 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MSSA476 (SEQ ID NO:</td><td> 506) .</td><td></td><td></td><td></td>
Figures 161A-161C show Kaplan-Meier survival curves showing the percentage of survival after passive immunization and homologous exposure with S. aureus ATCC 25904. Figure 161A, intravenous exposure after vaccination with rMntC; Figure 16IB, intraperitoneal exposure after vaccinationj2] W £ défe ií con
INS SIRP extract, vaccination 2 times with rSIRP7 or times with rSIRP7; Figure 161C, exposed after vaccination with rSIRP7.
Figure 162 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
RF122 (SEQ ID NO: 543).
Figure 163 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
Mu50 (SEQ ID NO: 544).
ition.
Figure 164 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MRSA252 (SEQ ID NO: 545).
Figure 165 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MW2 (SEQ ID NO: 546).
Figure 166 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
Newman (SEQ ID NO: 547).
Figure 167 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
JH9 (SEQ ID NO: 548).
Figure 168 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
USA300 (SEQ ID NO: 549).
Figure 169 shows the sequence of iMfcÍnócidos
MEXICAN INSTITUTE '<3, i, DE LA? ROH 5CAO of a metal-regulated polypeptide obtained from aureus'
COL (SEQ ID NO: 550).
Figure 170 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus NCTC8325 (SEQ ID NO: 551).
Figure 171 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MSSA476 (SEQ ID NO: 552).
Figure 172 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
RF122 (SEQ ID NO: 553).
Figure 173 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Mu50 (SEQ ID NO: 554).
Figure 174 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus
MRSA252 (SEQ ID NO: 555).
Figure 175 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
MW2 (SEQ ID NO: 556).
Figure 176 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus Newman (SEQ ID NO: 557).
Figure 177 shows the amino acid sequence of a metal regulated polypeptide obtained}] from S. aureus (· LNSTiTC ;:
JH9 (SEQ ID NO: 558). I "And l
Figure 178 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
USA300 (SEQ ID NO: 559.).
Figure 179 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
COL (SEQ ID NO: 560).
Figure 180 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus.
NCTC8325 (SEQ ID NO: 561).
Figure 181 shows the amino acid sequence of a metal regulated polypeptide obtained from S. aureus MSSA476 (SEQ ID NO: 562).
<td> 15</td><td>Lcl</td><td>figure</td><td>182 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td></td><td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td></td><td>from S. aureus</td><td colspan="3">RF122 (SEQ ID NO: 563).</td><td></td><td></td><td></td>
<td></td><td>Lcl</td><td>figure</td><td>183 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td></td><td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td> 20</td><td>from S. aureus</td><td colspan="3">Mu50 (SEQ ID NO: 564).</td><td></td><td></td><td></td>
<td></td><td>I read</td><td>figure</td><td>184 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td></td><td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td></td><td>from S. aureus</td><td>MRSA252</td><td>(SEQ ID NO:</td><td> 565) .</td><td></td><td></td><td></td>
<td></td><td>Lcl</td><td>figure</td><td>185 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td> 25</td><td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
de S. aureus MW2 (SEQ ID NO: 566). ! TV, jl r <_> MFXí '·' '> i ·:' · '-.' · ..
Figure 186 is a coding sequence for a metal regulated polypeptide obtained from S. aureus Newman (SEQ ID NO: 567).
<td>The</td><td>figure</td><td>187 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>JH9 (SEC</td><td>! ID NO: 568)</td><td> •</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>188 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="3">USA300 (SEQ ID NO: 569).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>189 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>COL (SEC</td><td>! ID NO: 570)</td><td> •</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>190 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>NCTC8325</td><td>(SEQ ID NO:</td><td> 571) .</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>191 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td>MSSA476</td><td>(SEQ ID NO:</td><td> 572) .</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>192 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
<td>from S. aureus</td><td colspan="3">RF122 (SEQ ID NO: 573).</td><td></td><td></td><td></td>
<td>The</td><td>figure</td><td>193 is a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td>
<td>which encodes</td><td>for a</td><td>polypeptide</td><td>regulated</td><td>by</td><td>metal</td><td>obtained</td>
S. aureus Mu50 (SEQ ID NO: 574).
The one that encodes S. aureus
The one that encodes S. aureus
The one that encodes S. aureus
The one that encodes S. aureus
The one that encodes S. aureus
The one that encodes S. aureus
The one that encodes S. aureus
The one that encodes S. aureus
Figure 194 is a sequence for a regulated polypeptide
MRSA252 (SEQ ID NO: 575).
Figure 195 is a sequence for a regulated MW2 polypeptide (SEQ ID NO: 576). Figure 196 is a sequence for a regulated polypeptide.
Newman (SEQ ID NO: 577).
Figure 197 is a sequence for a regulated polypeptide.
JH9 (SEQ ID NO: 578).
Figure 198 is a sequence for a regulated polypeptide.
USA300 (SEQ ID NO: 579).
Figure 199 is a sequence for a COL regulated polypeptide (SEQ ID NO: 580).
Figure 2 00 is a sequence for a regulated polypeptide
NCTC8325 (SEQ ID NO: 581).
Figure 201 is a sequence for a regulated MSSA476 polypeptide (SEQ ID NO: 582).
from: iriu¿l'eico tí '¿.A <*' - '·. . . .
by metal obtained from nucleic acid by metal obtained from nucleic acid by metal obtained from nucleic acid by metal obtained from nucleic acid by metal obtained from nucleic acid by metal obtained from nucleic acid by metal obtained from nucleic acid by metal obtained figure 202 shows the Western Blot which shows the union of convalescent sera of mice j ^ d ^ ipeptides l INSTITUTO '7 J \ ·.
D: í.AR'W7íIJ · <,. ·.
recombinantly produced metal regulated<sup>U51</sup> —
Figure 203 shows the Western Bl-ot -qtre-'inuey the binding of sera from healthy humans with recombinantly produced metal-regulated polypeptides.
Figure 204 shows the Western Blot showing the binding of convalescent human sera to recombinantly produced metal-regulated polypeptides.
Figures 205A-205D show flow cytometric data showing the surface expression of S. aureus.
DU5875 of metal regulated polypeptides.
Figure 206 shows cytokine induction after vaccination with rSIRP7 and restimulation with either sIRP or rSIRP7 extract.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides polypeptides and compositions that include polypeptides. As used herein, the term polypeptide refers to a polymer of amino acids linked by peptide bonds. Thus, for example, the terms peptide, oligopeptide, protein, and enzymes are included within the definition of polypeptide. This term also includes post-expression modifications of the polypeptide such as glycosylations, acetylations, phosphorylations and the like. The term polypeptide does not connote a specific length of an amino acid polymer. A polypeptide can either be directly isolable from a natural source or can be
<img file="MX339461B_D0026.tif" />
with the
<img file="MX339461B_D0027.tif" />
aid of recombinant, enzymatic or chemical techniques. In the case of a naturally occurring polypeptide, such a polypeptide is typically isolated.
An isolated polypeptide is one that is extracted from its natural environment, for example an isolated polypeptide is a polypeptide that has been extracted from the cytoplasm or membrane of a cell and many of the polypeptides, nucleic acids and other cellular material from its natural environment. are no longer present.
A polypeptide characterized as isolable from a particular source is a polypeptide that, under appropriate conditions, is produced by the identified source, although the polypeptide can be obtained from alternative sources using, for example, recombinant, chemical or enzymatic techniques well known to experts. in the field. Thus, characterizing a polypeptide as isolatable from a natural source does not imply any specific source from which the polypeptide must be obtained or some particular conditions or procedures under which the polypeptide must be obtained.
A purified polypeptide is one that is at least 60% free, preferably at least 75% free, and much more preferably at least 90% free of other components which are aspci ^ d ^^. way, . natural. Polypeptides that are produced outside the body and in which they are found naturally, for example through chemical or recombinant means, are considered to be isolated and purified by definition since they are never present in a natural environment.
As used herein, a polypeptide fragment refers to a portion of a polypeptide that results from the digestion of a polypeptide with a protease.
Unless otherwise specified, one, one, and at least one are used interchangeably and mean one or more than one. The terms it comprises and variations thereof do not have a limiting meaning when these terms appear in the description and claims.
A polypeptide of the present invention may be characterized by molecular weight, mass fingerprint, amino acid sequence, nucleic acid encoding the polypeptide, immunological activity, o r any com bination of two or more such characteristics. The molecular weight of a polypeptide, typically expressed in kilodalton units (kDa) can be determined using standard methods including, for example, gel filtration, gel electrophoresis including sodium dodecyl sulfate (SDS), polyacrylamide gel electrophoresis (PAGE , for its acronym J English),.
'M-iiCAVJ INSTITUTE
OF PROPERTY V - = ¾ ΐά »· ig>
capillary electrophoresis, spectrometry of <sup>IND! J !,</sup>Wáteas7 '-— liquid chromatography (which includes HPLC) and that —camalá ·' el <sup>1</sup>—— · molecular weight of an observed or predicted amino acid sequence. Unless otherwise indicated, molecular weight refers to the molecular weight determined by resolving a polypeptide using an SDS and polyacrylamide gel having an adhesion gel of approximately 4% and a resolution gel of approximately 10% under conditions reducing and denaturing.
As used herein, a mas s fingerpr int refers to a population of polypeptide fragments obtained from a polypeptide after digestion with a protease. Typically, the polypeptide fragments result from a digestion and a mass spectrometric method is analyzed. Each polypeptide fragment is characterized by a mass or by a mass (m) to charge (Z) ratio, which is referred to as the m / z ratio or an m / z value. Methods for generating a mass fingerprint of a polypeptide are common. An example of this method is described in Example 13.
A polypeptide of the present invention may be a metal regulated polypeptide . As used herein, a metal-regulated polypeptide is a polypeptide that is expressed by a microbe at a higher level when the microbe is grown on.
lithium, low metal, compared to the growth? Low metal and high metal conditions are described herein. For example, a class of metal-regulated polypeptide produced by Staphylococcus spp. it is not expressed at detectable levels during growth of the microbe under high metal conditions but is expressed at detectable levels during growth under low metal conditions.
Examples of isolatable metal-regulated polypeptides of S. aureus after growth under low iron conditions have molecular weights of 88 kDa, 55 kDa, 3 8 kDa, 37 kDa, 3 6 kDa, 35 kDa, and 33 kDa. Examples of isolatable metal-regulated polypeptide of S. aureus after growth under low zinc or low copper conditions have molecular weights of 115 kDa, 88 kDa, 80 kDa, 71 kDa, 69 kDa, 35 kDA, 30 kDa, 29 kDa and 27 kDa.
Additional examples of metal regulated polypeptides include recombinantly produced versions of polypeptides described herein. A recombinantly produced polypeptide can include the entire amino acid sequence translatable from an mRNA transcript. Alternatively, a recombinantly produced metal-regulated polypeptide can
7 'include a fragment or portion of the totach [ipaá de; the
I ??: í <sub>t</sub> » · · ..
translatable amino acid sequence. For example; '·, a metal-regulated polypeptide produced<sup>j</sup>-—- Recombinant manora · · may lack a separable sequence at either the terminal part of the polypeptide - for example one. separable signal sequence at the amino terminus of the polypeptide.
Thus, a metal regulated polypeptide can be a polypeptide that includes the amino acid sequence shown, for example, in SEQ ID NO: 353, SEQ
ID NO: 364, SEQ ID NO: 375, SEQ ID NO: 386, SEQ ID NO: 397,
SEQ ID NO: 408 and SEQ ID NO: 419.
The present invention also includes polypeptides.
<td>not</td><td>They are</td><td>regulated</td><td>by</td><td>metal.</td><td>These polypeptides</td><td>I know</td>
<td>express</td><td>in</td><td>presence</td><td>of</td><td>Union</td><td>metallic such as,</td><td>by</td>
<td>example,</td><td>in</td><td>presence</td><td>of</td><td>chloride</td><td>iron, and also</td><td>I know</td>
they express when they grow in low iron conditions. Examples of these isolatable S. aureus polypeptides have molecular weights of 150 kDa, 132 kDa, 120 kDa, 75 kDa, 58 kDa, 50 kDa, 44 kDa, 43 kDa, 41 kDa, and 40 kDa.
Whether a polypeptide is a metal regulated polypeptide or cannot be determined by useful methods to compare the presence of polypeptides including, for example, gel filtration, gel electrophoresis including sodium dodecyl sulfate48 polyacrylamide gel electrophoresis (SDS-PAGE , for its initials | irrígLés) ,, -: ¾
-Ί Α''Ά '-' ¡, -. ·. Ha! N5; ¡- '<' - · capillary electrophoresis, mass spectrometry. and liquid chromatography that includes HPLC. Cnl ti vna qpp ^ rfldQ.g of a microbe are grown under high metal conditions and under low metal conditions, the polypeptides of the present invention are isolated as described herein and the polypeptides present in each culture are resolved and compare. Usually an equal amount of polypeptides from each culture is used. Preferably, the polypeptides are resolved using an SDS and polyacrylamide gel having an adhesion gel of approximately 4% and a resolution gel of approximately 10% under reducing and denaturing conditions. For example, 30 micrograms (gg) of total polypeptide from each culture can be used and loaded into gel wells. After running the gel and staining the polypeptides with Coomassie Brilliant Blue, the two lanes can be compared. When its polypeptide is determined to be or is not expressed at a detectable level, 30 gg of the total polypeptide from a culture is separated on an SDS-PAGE gel and stained with Coomassie brilliant blue using methods known in the art. A polypeptide that can be visualized with the naked eye is considered to be expressed at a detectable level while a polypeptide that cannot be visualized with the naked eye is considered not to be expressed at a detectable level.
<img file="MX339461B_D0028.tif" />
INSTITUTE
INSTITUTE
Alternately irtil IIVíVJ ·. '. i si -a metal-regulated polygyp £ tid.o or cannot be determined using microarray-based gene expression analysis. Separate cultures of a microbe are grown under high metal conditions and under low metal conditions, RNA is extracted from the cells of each culture and differences in RNA expression in cells growing under high metal conditions versus RNA expression in cells growing under low metal conditions are detected and compared. For example, labeled cDNA can be prepared from 8-10 µg of bacterial RNA using established procedures. The labeled cDNA can be applied to a microarray of the S. aureus genome. Such microarrays are commercially available and gene expression using these arrays is common.
The polypeptides of the present invention can have immunological activity. The term "immunological activity" refers to the ability of a polypeptide to induce an immune response in an animal. An immunological response to a polypeptide is the development in an animal of a cellular and / or antibody-mediated immune response to the polypeptide. Typically, an immune response includes but is not limited to one or more of the following effects: antibody production, B lymphocytes, helper T lymphocytes, <sup>:</sup> suppressors and / or cytotoxic T lymphocytes, targeting μη / and epitope or epitopes of the polypeptide. The term epitope refers to the site on an antigen to which the B lymphocytes and / or the specific T lymphocytes respond so that an antibody is produced. Immunological activity can be protective. Protective immunological activity refers to the ability of a polypeptide to induce an immune response in an animal that prevents or inhibits infection by Staphylococcus spp., Eg, S. aureus. Whether a polypeptide has protective immunological activity can be determined by methods known in the art such as, for example, methods described in Examples 5, 9 or 12. For example, a polypeptide of the present invention or a combination of polypeptides of the present invention protects a rodent such as a mouse against exposure to Staphylococcus spp. A polypeptide of the present invention can have seroactive activity. Seroactive activity refers to the ability of a candidate polypeptide to react with an antibody present in convalescent serum of an animal infected with Staphylococcus spp., Eg S. aureus. In some aspects, the convalescent serum may be from an animal infected with isolated ATCC 19636, strain SAAV1, strain 2176, or strain 1477. The polypeptides of the present invention may have r T ·; \, σ '·' 7 'Τ immunoregulatory activity . Immunoregulated activityLádola is 'ΪΝ5ϊ; 7'; τ ··· '' · ¡E LA? . \ J \ refers to the ability of a polypeptide to act in a 'non-specific way to increase an immune i * éS} 5UéSCá towards a particular antigen. Methods for determining whether a polypeptide has immunoregulatory activity are known in the art.
A polypeptide of the present invention may have the characteristics of a polypeptide expressed by a reference microbe - that is, a reference polypeptide. Features may include, for example, molecular weight, mass fingerprint, amino acid sequence, any combination thereof. The reference microbe may be a gram positive, preferably a member of the Micrococcaceae family, preferably Staphylococcus spp., More preferably Staphylococcus aureus. The preferred examples of strains are listed in Table 1.
TABLE 1. BACTERIAL STRAINS
<td>Bacterial cell</td><td>Laboratory designation</td>
<td>S. aureus</td><td>ATCC isolated 19636</td>
<td>S. aureus</td><td>strain SAAV1</td>
<td>S. aureus</td><td>strain 1477</td>
<td>S. aureus</td><td>strain 2176</td>
When the reference microbe is S. aureus ATCC isolated 19636, a candidate polypeptide can be considered to be a polypeptide of the present invention> 4 • SI has a
INSTI7-J7O '', ·: // bZ The daV 'molecular weight of 88 kDa, 55 kDa, 38 kDa, 37 kDa, 3'6-kDa, '35 -kDa or 33 kDa, and has a fingerprint'err llTdüd that 'e · »· similar to the mass fingerprint of a metal-regulated polypeptide expressed by a reference microbe and having a molecular weight of 88 kDa, 55 kDa, 38 kDa, 37 kDa, 36 kDa, 35 kDa or 33 kDa, respectively.
Preferably, the polypeptides are metal regulated.
<td>For example</td><td></td><td>a candidate polypeptide</td><td>may</td><td>be</td><td>a</td>
<td>polypeptide</td><td>of</td><td>the present invention if</td><td>have</td><td>a</td><td>weight</td>
<td>molecular of</td><td> 88</td><td>kDa and has a footprint</td><td>fingerprint</td><td>in</td><td>mass</td>
similar to the mass fingerprint of an 88 kDa metal-regulated polypeptide produced by the reference strain S. aureus ATCC isolated 19636.
Alternatively, when the reference microbe is S. aureus ATCC isolated 19636, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following , to the amino acid sequence of SEQ ID NO:
353, SEQ ID NO: 364, SEQ ID NO: 375, SEQ ID NO: 386, SEQ ID
NO: 397, SEQ ID NO: 408 or SEQ ID NO: 419.
Alternatively, when the reference microbe is S. aureus RF122, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has a structurally similar sequence, following the amino acid sequence that is as described cd ¥ f<sup>T1</sup>¿^ Ftá £ X ^ of amino acids of SEQ ID NO: 3 54,
<img file="MX339461B_D0029.tif" />
SEQ ID NO: 365, SEQ ID NO: 376, SEQ ID NO: 387, SEQ ID NO:
398, SEQ ID NO: 409 or SEQ ID NO: 420.
Alternatively, when the reference microbe is S. aureus Mu50, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following amino acid sequence of SEQ ID NO: 355,
SEQ ID NO: 366, SEQ ID NO: 377, SEQ ID NO: 388, SEQ ID NO:
399, SEQ ID NO: 410 or SEQ ID NO: 421.
Alternatively, when the reference microbe is S. aureus MRSA252, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following, to the amino acid sequence of SEQ ID NO:
356, SEQ ID NO: 367, SEQ ID NO: 378, SEQ ID NO: 389, SEQ ID
NO: 400, SEQ ID NO: 411 or SEQ ID NO: 422.
Alternatively, when the reference microbe is S. aureus MW2, a candidate polypeptide can be considered to be a polypeptide of the present invention if it has an amino acid sequence that is ί ·. 't,,, rr - .....
Structurally similar, as described in detail in 1ο '\ Α below, to the amino acid sequence of SEQ ^ ED ΝΘ-ί-—
357, SEQ ID NO: SEQ ID NO: 363, SEQ ID NO: -3-79, CEQ ID ΝΘτ390, SEQ ID NO: 401, SEQ ID NO: 412 or SEQ ID NO: 423.
Alternatively, when the reference microbe is S. aureus Newman, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following amino acid sequence of SEQ ID NO: 358,
SEQ ID NO: 369, SEQ ID NO: 380, SEQ ID NO: 391, SEQ ID NO:
402, SEQ ID NO: 413 or SEQ ID NO: 424.
Alternatively, when the reference microbe is S. aureus JH9, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following amino acid sequence of SEQ ID NO: 359,
SEQ ID NO: 370, SEQ ID NO: 381, SEQ ID NO: 392, SEQ ID NO:
403, SEQ ID NO: 414 or SEQ ID NO: 425.
Alternatively, when the reference microbe is S. aureus USA300, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following
SEQ ID NO:
404, SEQ ID la
371
NO:
amino acid sequence of, SEQ ID NO: 3 82, SEQ ID NO: '· 415 or SEQ ID NO: 426.
ID NO:
Ínstíti! ';
393 eg:
THH
360
<img file="MX339461B_D0030.tif" />
Alternatively, when the reference microbe is S. aureus COL, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following amino acid sequence of SEQ ID NO: 361,
SEQ ID NO: 372, SEQ ID NO: 383, SEQ ID NO: 394, SEQ ID NO:
405, SEQ ID NO: 416 or SEQ ID NO: 427.
Alternatively, when the reference microbe is S. aureus NCTC 8325, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following, to the amino acid sequence of SEQ ID NO:
362, SEQ ID NO: 373, SEQ ID NO: 384, SEQ ID NO: 395, SEQ ID
NO: 406, SEQ ID NO: 417 or SEQ ID NO: 428.
Alternatively, when the reference microbe is S. aureus MSSA476, a candidate polypeptide may be considered to be a polypeptide of the present invention if it has an amino acid sequence that is structurally similar, as described in detail in the following, to the amino acid sequence of SEQ ID NO:
Γ ·<sup>;</sup>
363, SEQ ID NO: 374, SEQ ID NO: 385, SEQ ID SEQ ID '··. INSTITUTE «· X: C7 .: -Ώ, /, 7- --.-.:.-. - Λ-, Ν ') Dt L'- S
NO: 407, SEQ ID NO: 418 or SEQ ID NO: 429. ¡.vi · .. ,,,.;.
When the reference microbe 'S'5 ..... ........
isolated SAAV1, a candidate polypeptide can be considered to be a polypeptide of the present invention if it has a molecular weight of 88 kDa, 55 kDa, 38 kDa, 37 kDA, 36 kDa, kDa or 33 kDA and has a mass fingerprint that it is similar to the mass fingerprint of a polypeptide expressed by a reference microbe and having a molecular weight of 88 kDa, 55 kDa, 38 kDa, 37 kDA, 36 kDa, 35 kDa, or kDA, respectively. Preferably, the polypeptides are metal regulated. For example, a candidate polypeptide may be a polypeptide of the present invention if it has a molecular weight of 88 kDa and a mass fingerprint similar to the mass fingerprint of an 88 kDa metal-regulated polypeptide produced by the reference strain. S. aureus isolated SAAV1.
When the reference microbe is S. aureus CEPA
2176, a candidate polypeptide can be considered to be a
<td>polypeptide</td><td>of</td><td>the</td><td>present invention</td><td>yes</td><td>have</td><td>a</td><td>weight</td>
<td>molecular of</td><td> 88</td><td>kDa,</td><td>80 kDa, 65 kDa, 55</td><td>kDA,</td><td>37 kDa,</td><td> 36</td><td>kDa,</td>
<td colspan="2">3 5 kDa, 3 3 kDa</td><td>or 32</td><td colspan="2">kDA and it has a footprint</td><td>fingerprint</td><td>in</td><td>mass</td>
which is similar to the mass fingerprint of a polypeptide expressed by a reference microbe and has a molecular weight of 88 kDa, 80 kDa, 65 kDa, 55 kDA, 37 kDa, 36 kDa, kDa, 33 kDa, or 32 kDA , respectively. Prefé ^ i ^ letóéfíté ^^. polypeptides are metal regulated. For example, a candidate polypeptide may be a polypeptide of the present invention if it has a molecular weight of 88 kDa and has a mass fingerprint similar to the mass fingerprint of an 88 kDa metal-regulated polypeptide produced by the strain of Reference S. aureus isolated 2176.
When the reference microbe is S. aureus strain 1477, a candidate polypeptide can be considered to be a polypeptide of the present invention if it has a molecular weight of 88 kDa, 80 kDa, 65 kDa, 55 kDA, 37 kDa, 36 kDa, kDa, 33 kDa or 32 kDA and it has a mass fingerprint that is similar to the mass fingerprint of a polypeptide expressed by a reference microbe and has a molecular weight of 88 kDa, 80 kDa, 65 kDa, 55 kDA, 37 kDa, 36 kDa, kDa , 33 kDa or 32 kDA, respectively. Preferably, the polypeptides are metal regulated. For example, a candidate polypeptide may be a polypeptide of the present invention if it has a molecular weight of 88 kDa and has a mass fingerprint similar to the mass fingerprint of an 88 kDa metal-regulated polypeptide produced by the strain of Reference isolated S. aureus 1477.
As used herein, a polypeptide may be structurally similar to a reference polypeptide if the amino acid sequence of the polypeptide has a specified amount of similitiji sequence \
INSTITUTE? / F ~ - J and / or sequence identity compared to ei ^ poLipeptidCLÍ / reference. A polypeptide also. -. -pn.ua da—- be structurally similar to a reference polypeptide if the polypeptide has a mass fingerprint having a specified amount of identity compared to a comparable mass fingerprint of the reference polypeptide. Therefore, a polypeptide may be structurally similar to a reference polypeptide if, in comparison to the reference polypeptide, it possesses a sufficient level of amino acid sequence identity, amino acid sequence similarity, mass fingerprint similarity, or any combination thereof.
SIMILARITY OF POLYPEPTIDIC SEQUENCE AND SEQUENCE IDENTITY
POLIPEPTIDICA
The structural similarity of two polypeptides can be determined by aligning the residues of the two polypeptides (eg, a candidate polypeptide and any appropriate reference polypeptide described herein) to optimize the number of identical amino acids along their lengths. sequences; Separations in either or both sequences are allowed when performing the alignment in order to use the number of identical amino acids, although the amino acids in each sequence must, however, remain in their proper order. A reference polypeptide can be a polypepjjidb; described herein or any 'po-r regulated polypeptide. metal · known, as appropriate. A polypeptide is.
polypeptide that is compared to the reference polypeptide. A candidate polypeptide can be isolated, for example, from a microbe, or can be produced using recombinant techniques, or can be synthesized chemically or enzymatically.
Unless otherwise modified or described herein, a paired comparison analysis of amino acid sequences can be carried out using the BESTFIT algorithm in the GCG package (version 10.2, Madison WI). Alternatively, the polypeptides can be compared using the Blastp program of the BLAST 2 search algorithm, as described by Tatiana et al., (FEMS Microbiol Lett, 174, 247-250 (1999)) and available from the National Center for Biotechnology Information (NCBI) network. Implicit values for all BLAST 2 search parameters can be used, which includes array = BLOSUM62; open separation punishment = 11, separation extension punishment = 1, separation x_abandon = 50, hope = 10, word size = 3 and filter on.
In the comparison of the two amino acid sequences the structural similarity can be denominated as the percentage of identity or it can be denominated # -domo tr JC 'INSTITUTO MEXICANO
INDüSTjUAt 'CL * percentage of similarity. The term identity refers to the presence of identical amino acids. Similarity refers to the presence not only of identical amino acids but also the presence of conservative substitutions. A conservative substitution for an amino acid in a polypeptide of the invention can be selected from other members of the class to which the amino acid belongs. For example, it is well known in the field of protein biochemistry that an amino acid belonging to a group of amino acids having a particular size or characteristic (such as charge, hydrophobicity and hydrophilicity) can be replaced by another amino acid without altering the activity of a protein, particularly in regions of the protein that are not directly associated with biological activity. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively (basic) amino acids include arginine, histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Conservative substitutions include, for example, Lys for Arg and vice versa to maintain a positive charge; Glu for Asp and vice versa loaded
Usina e to maintain a negative charge; Be for ThrXdM.tíianer, that
MEXICAN INSTITUTE
OF THE FROFiiiVÜ;
a free -OH is maintained; and Gln for Asn for maintenance.
<img file="MX339461B_D0031.tif" />
free. Likewise, biologically atrclVOS analogues of a polypeptide containing deletions or additions of one or more contiguous or non-contiguous amino acids that do not eliminate functional activity - such as, for example, immunological activity - of the polypeptide is also contemplated.
Therefore, as used herein, reference to a polypeptide of the present invention and / or reference to the amino acid sequence of one or more of the
SEQ ID NOS: may include a polypeptide with at least 50%, at least 55%, at least 6 0%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 96%, at least 97%, at least 98%, or at least
99% similarity in amino acid sequence compared to reference amino acid sequence.
Alternatively, as used herein, reference to a polypeptide of the present invention and / or reference to the amino acid sequence of one or more of SEQ ID NOS: may include a polypeptide with at least 50% , at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least A éóé at least
WSrffUTO ΜΕΧίΓ /, ΝΩ OF THE PRO HE DAD '
INDUSTRIAL at least 90%, minus 93%, by Tó 97%, at least of reference sequence.
minus 80%, at least 85%, at least
87%, at least 88%, at least 89%, at least 91%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99 % amino acid identity with amino acid sequence
Accordingly, a polypeptide of the present invention may include certain variants that include, for example, homologous polypeptides that originate - biologically and / or recombinantly - from microbial species or strains other than the microbial species or strains from which they were originally derived. isolated and / or identified the polypeptide.
For example, a polypeptide of the invention can include a polypeptide commonly known as formate acetyltransferase (PflB). An embodiment of this polypeptide is reflected in SEQ ID NO: 353. Variant embodiments are reflected in SEQ ID NO: 354, SEQ ID NO: 355, SEQ ID NO:
356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID
NO: 360, SEQ ID NO: 361, SEQ ID NO: 362 and SEQ ID NO: 363.
As another example, a polypeptide of the invention can include a polypeptide commonly known as permease oligopeptide, protein-binding peptide (OpplA). An embodiment of this polypeptide is reflected in SEQ ID NO:
364. Variant modalities are reflected in SEQ ID NO:
365, SEQ ID NO: 366, SEQ ID NO: 367, SEQ ID NO: 368, SEQ ID
NO: 369, SEQ ID NO: 370, SEQ
ID NO: 373 and SEQ ID NO: 374.
ID NO: 371,
SEQ .ΙϋΟ
DI / • ί r; ; j: 372,
PrOr-ur ·, · .;)
INLUSTiU / .l
I KNOW THAT
<img file="MX339461B_D0032.tif" />
As another example, a polypeptide of the invention can include a polypeptide commonly known as the siderophore compound (SirA) ABC transporter binding protein. An embodiment of this polypeptide is reflected in SEQ ID NO: 375. Variant embodiments are reflected in SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO:
378, SEQ ID NO: 379, SEQ ID NO: 380, SEQ ID NO: 381, SEQ ID
NO: 382, SEQ ID NO: 383, SEQ ID NO: 384 and SEQ ID NO: 385.
As another example, a polypeptide of the invention can include a polypeptide sometimes referred to herein as SYN2. An embodiment of this polypeptide is reflected as SEQ ID NO: 386. Variant embodiments are reflected in SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO:
389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID
NO: 393, SEQ ID NO: 394, SEQ ID NO: 395 and SEQ ID NO: 396.
As another example, a polypeptide of the invention can include a polypeptide commonly known as ferric hydroxamate binding lipoprotein (FhuD). An embodiment of this polypeptide is reflected in SEQ ID NO:
397. Variant modalities are reflected in SEQ ID NO:
398, SEQ ID NO: 399, SEQ ID NO: 400, SEQ ID NO: 401, SEQ ID
NO: 402, SEQ ID NO: 403, SEQ ID NO: 404, SEQ ID NO: 405, SEQ
ID NO: 406 and SEQ ID NO: 407.
£·
Ό ϊ · As another example, a JLa & '/ üiVeneión polypeptide
Inuit LNST may include a polypeptide sometimes referred to as<sup>J</sup>herein as SYN1. An embodiment of this £> olipept í'dó 'is reflected in SEQ ID NO: 408. Variant modalities are reflected in SEQ ID NO: 409, SEQ ID NO: 410, SEQ ID NO:
411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID
NO: 415, SEQ ID NO: 416, SEQ ID NO: 417 and SEQ ID NO: 418.
As another example, a polypeptide of the invention can include a polypeptide commonly known as manganese transport system (MntC) membrane protein. An embodiment of this polypeptide is reflected in the
<td>I KNOW THAT</td><td>ID</td><td>NO:</td><td> 419 .</td><td>The</td><td>modalities</td><td>variants are</td><td>reflect</td><td>in</td><td>the</td>
<td>I KNOW THAT</td><td>ID</td><td>NO:</td><td> 420,</td><td>I KNOW THAT</td><td>ID NO: 421,</td><td>SEQ ID NO:</td><td>422, SEQ</td><td>ID</td><td>NO:</td>
<td> 423,</td><td colspan="2">SEQ ID</td><td>NO:</td><td> 424,</td><td>SEQ ID NO:</td><td>425, SEQ ID</td><td>NO: 426,</td><td>I KNOW THAT</td><td>ID</td>
NO: 427, SEQ ID NO: 428 and SEQ ID NO: 429.
As another example, a polypeptide of the invention can include a polypeptide commonly known as ferricrome ABC transporter lipoprotein (SstD). The modalities of this polypeptide are reflected in SEQ ID NO:
543, SEQ ID NO: 544, SEQ ID NO: 545, SEQ ID NO: 546, SEQ ID
NO: 547, SEQ ID NO: 548, SEQ ID NO: 549, SEQ ID NO: 550, SEQ
ID NO: 551 and SEQ ID NO: 552.
As another example, a polypeptide of the invention can include a polypeptide commonly known as the iron compound ABC transporter (FhuD2). The modalities of this polypeptide are reflected in 1¿-ÉEÍQ -ID NO:
DEIafscmllao <sub>t</sub>
553, SEQ ID NO: 554, SEQ ID NO: 555, SEQ ID NO: 556, '' ^ SEQ<sup>L</sup> ID ~
NO: 557, SEQ ID NO: 558, SEQ ID NO: 559, SEQ ID NO: 560, SEQ
ID NO: 561 and SEQ ID NO: 562.
A polypeptide of the present invention is also designated to provide one or more additional sequences such as, for example, the addition of coding sequences for aggregated C-terminal and / or N-terminal amino acids that can facilitate purification by column retention or use of antibodies . The labels include, for example, histidine-rich labels that allow the purification of polypeptides on nickel columns. Such suitable additional sequence and gene modification techniques are well known in the art of molecular biology.
A polypeptide of the present invention can also be designated so that certain amino acids in the C-terminal and / or N-terminal part are deleted. For example, a difference between the amino acid sequences of SEQ ID
NO: 364 and SEQ ID NO: 365 is that SEQ ID NO: 365 has an activity of 29 amino acids of the N-terminal part that are not expressed in the amino acid sequence of the reference polypeptide of SEQ ID NO: 364. Similar exemplary N-terminal additions, which typically vary from about 20 amino acids to about amino acids are evident when one compares,
INSTITUTO MSX'C'.KO. '...
DE LA FROf ·: · ;;. '. » V. - '..- jtt' the amino acid sequence of the reference peptide<sup>:</sup>ct<sup>1JÍ</sup>SÉQ ÍÜ ~ “- '
NO: 353, SEQ ID NO: 364, SEQ ID NO: 375, SEQ Efr-ΝΟτ 'SEQ
ID NO: 397, SEQ ID NO: 408 or SEQ ID NO: 419 with certain variant modalities of the respective reference popeptide. Other additions and / or deletions of amino acids, either in the N-terminal or C-terminal part are possible.
A modification of a polypeptide of the present invention includes polypeptides (or analogs thereof such as, for example, fragments thereof) that chemically or enzymatically form derivatives of one or more constitutive amino acids. These modifications include, for example, side chain modifications, backbone modifications, and modifications to the N and C terminal parts such as, for example, acetylation, hydroxylation, methylation, amidation, and the binding of carbohydrates or lipid moieties, factors, and similar and combinations thereof. The modified polypeptides of the invention can retain the biological activity - such as, for example, immunological activity - of the unmodified polypeptide or can show reduced or increased biological activity.
The polypeptides of the present invention (including biologically active analogs thereof and modifications thereof) include native polypeptides re
For example / Un— pu ende<sup>1</sup>· Prep arra'T »»! ™ '- 67 (naturally found) synthesized chemically or enzymatically. The polypeptide of the present invention can isolate the polypeptide from a natural source or it can be recombinantly prepared by well known methods including, for example, preparation of fusion proteins in bacteria or other host cells.
Polypeptides expressed by a reference microbe can be obtained by growing the reference microbe under low metal conditions and subsequent isolation of a polypeptide by the procedure described herein. Alternatively, polypeptides expressed by a reference microbe can be obtained by identifying genes expressed at higher levels when the microbe is grown under low metal conditions ie, genes regulated by metal. Metal-regulated genes can be cloned and expressed, and expressed metal-regulated polypeptides can be identified by the procedure described herein. A candidate polypeptide can be isolable from a microbe or can be identified from a microbe, preferably a gram positive microbe, more preferably a member of the Micrococcaceae family, preferably
Staphylococcus spp., More preferably
Staphylococcus aureus.
which ones
Other microbes can isolate and / or gram positive
<img file="MX339461B_D0033.tif" />
<img file="MX339461B_D0034.tif" />
identify polypeptides include
Corynebacterium spp., Enterococcus spp., Erysipelothrix spp., Kytococcus spp., And Micrococcus spp., Mycobacterium spp., And Erysipelothrix spp. A candidate polypeptide can also be produced using enzymatic or chemical techniques.
SIMILARITY OF FINGERPRINT IN MASS
A candidate polypeptide can be evaluated by mass spectrometric analysis to determine whether the candidate polypeptide has a mass fingerprint similar to one of the polypeptides expressed by a reference microbe and referred to above by molecular weight. Typically, the candidate polypeptide can be isolated, for example, by separating the candidate polypeptide by gel electrophoresis and by cutting off the portion of the gel containing the candidate polypeptide. Any gel electrophoresis method can be used that separates polypeptides based on different characteristics including one-dimensional or two-dimensional gel electrophoresis as well as liquid chromatographic separation based, for example, on hydrophobicity, pl, or size. These candidate polypeptides can be fragmented, for example, by digestion with a protease. Preferably, the protease can break the peptide bond at the carboxy terminal side of the amino acid lysine and the amino acid arginine, except for lysine or t! TtTíiesinz.No - I.NtOTOCAP this protease is trypsin.
trypsin polypeptide are
Τ ΆΛ Ό τ <
when the amino acid that proline follows. An example of the methods to digest a usual and known in the field. An example of this method is described in Example 13.
Methods for polypeptide mass spectrometric analysis are common and well known in the art and include, but are not limited to, matrix-assisted laser desorption / time-of-flight and ionization mass spectroscopy (MALDI-TOF MS). Typically, a mixture containing the polypeptide fragments obtained from a candidate polypeptide is mixed with a matrix that functions to transform laser energy to the sample and produce ionized, preferably monoisotopic, polypeptide fragments. Examples of matrices that can be used include, for example, synapinic acid or cyano-4-hydroxycinnamic acid. An example of a method for MALDITOF MS analysis of polypeptides is described in Example 13. Ionized polypeptide fragments are separated according to their m / z ratio and detected to provide a spectrum of m / z ratio versus intensity. The spectrum includes m / z values representing the polypeptide fragments derived from the candidate polypeptide. For any given polypeptide, the amount of each polypeptide fragment that results from one! Saw ?
by
INSTIT'JTí? . ·. of the 1¼ 'S. i, l · trypsin must be equimolar. However, trypsin digestion is not always 10-0-¾ — eIi-ca'g ”/ - for example, some sites are more efficiently separated. Therefore, when MALDI-TOF MS is used to determine m / z values, the intensity of each m / z value is typically not identical. Generally, a spectrum has a background noise level present through most of the abscissa axis (ie, the axis that has the values of the m / z ratios). This background noise level varies depending on the operating conditions on the machine used and is easily identified by visual inspection of the spectrum. An m / z value is generally considered to represent a polypeptide fragment when the intensity is at least 2 times higher, at least 3 times higher, or at least 4 times higher than the background noise level. The spectrum typically includes other m / z values that are artifacts that result, for example, from incomplete digestion, excessive digestion, other polypeptides that may be present in the mixture, or the protease used to digest the polypeptide includes m / z values that result from protease autolysis. This method of digesting a polypeptide with a protease is recognized in the field of Vi<sub>Λ</sub> ______to-<sup>1</sup> of great
INSTITUI! I ”'- ·'. ··. '
Say LA \ as a result of a fingerprint on specificity and can be used to accurately characterize the polypeptide and distinguish it from other polypeptides.
In this aspect of the invention, when a candidate polypeptide is analyzed by mass spectroscopy, preferably both the candidate polypeptide and the polypeptide from the reference microbe are prepared and analyzed together, thereby decreasing any potential artifacts resulting from the differences in the handling and development conditions of the sample. Preferably, all the reagents used to prepare and analyze the two polypeptides are the same. For example, the reference microbe polypeptide and candidate polypeptide are isolated under substantially the same conditions, fragmented under substantially the same conditions, and analyzed by MALDI-TOF MS in the same machine under substantially the same conditions. A candidate polypeptide can be considered to be structurally similar to a reference polypeptide if it shows a mass fingerprint that has at least 80%, at least 90%, at least 95%, or substantially all of the m / values. z present in the spectrum of the reference microbe polypeptide and above the background noise level are also the spectrum of the candidate polypeptide (see, eg, US Application Publication No. 2006/0233824 Al).
In another aspect, a polypeptide can be considered to be a polypeptide of the present invention if it has a molecular weight of a reference polypeptide described in Table 2, 3, 4 or 5 and has a mass fingerprint that includes a subpopulation that includes at least a specified percentage of the polypeptide fragments of the reference polypeptide to which is included in Table 2, 3, 4 or 5. For example, a polypeptide of the present invention includes an 88 kDa polypeptide and a mass fingerprint that includes a specified percentage of polypeptide fragments having HVDVR masses (SEQ ID NO: 1),
YSYER (SEQ ID NO: 2), IIGDYRR (SEQ ID NO: 3), IFTDYRK (SEQ ID NO: 4), ELKELGQK (SEQ ID NO: 5), YAQVKPIR (SEQ
ID NO: 6), QMQFFGAR (SEQ ID NO: 7), SMQPFGGIR (SEQ ID
NO: 8) VSGYAVNFIK (SEQ ID NO: 9), NHATAWQGFK (SEQ ID NO:
10), LWEQVMQLSK (SEQ ID NO: 11), SLGKEPEDQNR (SEQ ID NO:
12), DGISNTFSIVPK (SEQ ID NO: 13), AGVITGLPDAYGR (SEQ ID
NO: 14), TSTFLDIYAER (SEQ ID NO: 15), SMQPFGGIRMAK (SEQ
ID NO: 16), THNQGVFDAYSR (SEQ ID NO: 17), KAGVITGLPDAYGR (SEQ ID NO: 18), TLLYAINGGKDEK (SEQ ID NO: 19),> <> 'Τ'
IEMALHDTEIVR (SEQ ID NO: 20), AGEPFAPGANPMW ^^ gE ^ ID,
INL'iJSTklAL
NO: 21), VALYGVDFLMEEK (SEQ ID NO: 22), KTHNQGVFDAYSR (SEQ ID NO: 23), YGFDLSRPAENFK (SEQ ID NO: 24),
TSSIQYENDDIMR (SEQ ID NO: 25), KAGEPFAPGANPMHGR (SEQ ID
NO: 26), RVALYGVDFLMEEK (SEQ ID NO: 27), LWEQVMQLSKEER (SEQ ID NO: 2 8), MLETNKNHATAWQGFK (SEQ ID NO: 29),
MHDFNTMSTEMSEDVIR (SEQ ID NO: 30), YGNNDDRVDDIAVDLVER (SEQ ID NO: 31), ETLIDAMEHPEEYPQLTIR (SEQ ID NO: 32),
YAQVKPIRNEEGLVVDFEIEGDFPK (SEQ ID NO: 33).
The mass fingerprint of a candidate polypeptide can be determined by a mass spectrometric method, for example by MALDI-TOF MS.
The mass fingerprint of a candidate polypeptide will generally have additional polypeptide fragments, and therefore may have additional m / z values different from those included for a polypeptide in Table 2, 3, 4, or 5. When a candidate polypeptide is comparable to a polypeptide in Table 2, 3, 4, or 5, the candidate polypeptide can be isolable from a microbe, preferably a gram-positive microbe, more preferably a member of the Micrococcaceae family, preferably Staphylococcus spp. , more preferably Staphylococcus aureus. Other gram positive microbes include Corynebacterium spp., Enterococcus spp., Erysipelothrix spp., Kytococcus spp. , Listeria spp., Micrococcus spp. , and
OF .·.·
INDUS7 P.íAL __ spp., And Erysipelothrix spp.
A candidate polypeptide can be obtained by growth of a microbe under low metal conditions and subsequent isolation of a polypeptide by the procedure described herein. Alternatively, a candidate polypeptide can be obtained by recombinant expression of a polynucleotide that encodes the candidate polypeptide.
It is well known in the art that amino acid modifications can be accidentally introduced during sample handling, such as oxidation and formation of carbamidomethyl derivatives. Furthermore, these types of modifications alter the m / z value of a polypeptide fragment. For example, if a polypeptide fragment contains an oxidizing methionine, the m / z value will increase by 16 relative to the same fragment that does not contain the oxidized methionine. Consequently, the polypeptide fragments in Table 2, 3, 4, or 5 that have the oxidation notation (M) have an m / z value that increases by 16 relative to the same fragment that does not contain the oxidized methionine. It is understood that the polypeptide fragments of Table 2, 3, 4 or 5 can be modified during sample handling.
<img file="MX339461B_D0035.tif" />
SIMILARITY OF POLYNUCLEOTIDIC SEQUENCE
<img file="MX339461B_D0036.tif" />
<D DE
POLYNUCLEOTIDIC SEQUENCE
<img file="MX339461B_D0037.tif" />
The polypeptides of the i
<img file="MX339461B_D0038.tif" />
they can identify in terms of polynucleotide that encodes the polypeptide. Thus, the invention includes polynucleotides that encode a polypeptide of the invention or that hybridize, under standard hybridization conditions, to a polynucleotide that encodes a polypeptide of the invention and the complements of such polynucleotide sequences.
As used herein the reference to a polynucleotide of the present invention and / or the reference to the nucleic acid sequence of one or more of SEQ ID NOS: 1 may include polynucleotides having a sequence identity of at least 50%, of at least 55%, of at least 60%, of at least
65%, of at least 70%, of at least 75%, of at least 80%, of at least 85%, of at least 86%, of at least 87%, of at least 88 %, at least
89%, of at least 89%, of at least 90%, of at least 91%, of at least 92%, of at least 93%, of at least 94%, of at least 95 %, at least
96%, at least 97%, at least 98%, or at least 99% sequence identity with an identified reference polynucleotide sequence.
CHARACTERISTICS OF POLYPEPTIDES OBTAINED FROM S. aureus ATCC ISOLATED 19636
<img file="MX339461B_D0039.tif" />
or in in r-1
<img file="MX339461B_D0040.tif" />
ID
Lf)
Ά Τ Τ: '3' / ·
Η-
<td> 36</td><td>Γ- ΓΟ</td><td>C0 ΓΟ</td><td> 39</td><td> 40</td><td> 41</td><td> 42</td><td>ΓΟ -Φ</td><td>φ φ</td><td> 45</td><td> 46</td><td> 47</td><td> 48</td><td>σ φ</td><td>Ο ιη</td><td> 51</td><td>ΪΝ. THE</td><td>ΤΓ. · ”Li. ιη</td><td>Λ. ..Ή. ιη</td><td>ιη</td><td>AQtíUj ω</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>CD</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td>Μ</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>to</td><td></td><td>Ω</td><td>Ω</td><td> 3</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td></td><td></td><td></td><td>to</td><td>to</td><td>to</td><td>Μ</td><td>Ω</td><td>m</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>and</td><td></td><td>hey</td><td> ></td><td>hey</td><td>to</td><td>to</td><td> 2</td><td> ></td><td>Ω</td><td> 3</td><td>ο</td><td>Ω</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td> «</td><td>to</td><td>g</td><td>to</td><td>Ω</td><td> «3</td><td>Η</td><td>P.S</td><td>to</td><td>cn</td><td> 3</td><td>Η</td><td>Η</td><td>ΕΗ</td><td>> ι</td>
<td></td><td></td><td></td><td></td><td>to</td><td>to</td><td> ></td><td>to</td><td></td><td> ></td><td>Ω</td><td>Ω</td><td>Ω</td><td> 3</td><td>Ω</td><td>Ω</td><td>Ω</td><td>Ω</td><td>to</td><td> 3</td><td>Μ</td>
<td></td><td>to</td><td>hey</td><td>to</td><td>faith</td><td>Ω</td><td>Η</td><td> 0</td><td> 2</td><td>Ω</td><td>Η</td><td> 3</td><td> 2</td><td>Ω</td><td>Μ</td><td>CD</td><td> 3</td><td> 2</td><td>Ω</td><td>Ω</td><td> 3</td>
<td></td><td></td><td>g</td><td> 0</td><td> >3</td><td>i *</td><td>Η</td><td> >3</td><td>Ε</td><td>Ω</td><td>pL |</td><td>Ω</td><td>Ω</td><td>Ω</td><td> 3</td><td> 3</td><td>Ω</td><td>Ω</td><td>m</td><td>to</td><td>Ο</td>
<td>Ω</td><td>Ω</td><td></td><td>Ω</td><td>Ω</td><td>¡X</td><td>> Η</td><td>Μ</td><td> 0</td><td> 2</td><td> 3</td><td>fu</td><td>P.S</td><td>Η</td><td>ο</td><td>Η</td><td>Ω</td><td>Ω</td><td>Η</td><td>Μ</td><td></td>
<td>Ω</td><td> 0</td><td> 2</td><td>W</td><td>Ω</td><td></td><td>Η</td><td>Ω</td><td>Η</td><td>Ω</td><td>b</td><td>Ω</td><td>to</td><td>W</td><td>Ω</td><td>ω</td><td>Ω</td><td>to</td><td>Μ</td><td>σ</td><td></td>
<td>Κ</td><td>Η</td><td>Κ</td><td>σ</td><td>Μ</td><td>5j</td><td>Ω</td><td>Ω</td><td> 3</td><td>Ε</td><td>to</td><td>Η</td><td>Η</td><td>g</td><td>> ι</td><td> 0</td><td>Η</td><td>Η</td><td> 0</td><td> 0</td><td>ΟΙ</td>
<td>faith</td><td> 0</td><td> 0</td><td> ></td><td>C0</td><td></td><td>θ '</td><td>Ω</td><td> 0</td><td>fu</td><td>Η</td><td> 0</td><td>Ω</td><td>Jh</td><td>Ω</td><td> 3</td><td> 0</td><td>Ω</td><td>to</td><td>Ω</td><td>cn</td>
<td></td><td>Ω</td><td>Η</td><td>Ω</td><td>g</td><td>ω</td><td> ^4</td><td>ω</td><td>TO</td><td>Η</td><td>ω</td><td>Ω</td><td>Η</td><td>Η</td><td> 3</td><td>Ω</td><td>Ω</td><td>Η</td><td>Η</td><td>Ω</td><td>cn</td>
<td>ί *</td><td>Ω</td><td> 3</td><td> ¡2</td><td>£ d</td><td>Ω</td><td>to</td><td>ω</td><td></td><td>> ι</td><td> 0</td><td>to</td><td></td><td>to</td><td>σ</td><td></td><td>Ε</td><td></td><td>to</td><td>Η</td><td>cn</td>
<td>Η</td><td>to</td><td>σ</td><td> ►2</td><td>Η</td><td>Í3</td><td>Μ</td><td> <3</td><td>Η</td><td>Η</td><td>to</td><td>Ω</td><td></td><td>Ω</td><td>W</td><td> ></td><td>P.S</td><td> 3</td><td>Ω</td><td>W</td><td> 0</td>
<td></td><td></td><td>to</td><td>to</td><td>to</td><td>tO</td><td> ></td><td>Ι></td><td> 00</td><td> 00</td><td>r-</td><td>r-</td><td>οο</td><td> 00</td><td> 00</td><td> 00</td><td>σ</td><td>σ</td><td>σ</td><td>rd</td><td>rd</td>
<td>to</td><td>Ό</td><td> •</td><td> •</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> •</td><td></td>
<td> •</td><td> •</td><td>ιη</td><td>ΓΟ</td><td>ω</td><td>ι></td><td>Φ</td><td>to</td><td>γ1</td><td>φ</td><td>OR</td><td>σ</td><td>CN</td><td> 00</td><td>ΓΟ</td><td>σ</td><td>ο</td><td>Ο</td><td>σ</td><td>οο</td><td>OR</td>
<td> ></td><td>LD</td><td>(Ν</td><td>to</td><td> 00</td><td></td><td>CN</td><td>φ</td><td> 00</td><td>σ \</td><td>or</td><td>rd</td><td>rq</td><td>oq</td><td> 00</td><td>Ο</td><td>φ</td><td>ιη</td><td>ιη</td><td> 00</td><td>ΓΟ</td>
<td>ro</td><td>σ</td><td>ο</td><td>ο</td><td>Η</td><td>η</td><td>ΓΟ</td><td>ΓΟ</td><td>Γ0</td><td>Γ0</td><td>φ</td><td>Φ</td><td>φ</td><td>Φ</td><td>φ</td><td>ιη</td><td>ιη</td><td>ιη</td><td>ιη</td><td></td><td>σ</td>
<td>σι</td><td>σ</td><td>rd</td><td>rd</td><td>ί — 1</td><td>rd</td><td>Η</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
ιη
LD
<img file="MX339461B_D0041.tif" />
Lfi
THE
<img file="MX339461B_D0042.tif" />
<img file="MX339461B_D0043.tif" />
ω
THE
<img file="MX339461B_D0044.tif" />
Lfl
THE
<td> 00</td><td> 07</td><td>OR</td><td>rd</td><td>CN</td><td> 04</td>
<td>m</td><td>in</td><td>ΤΓ</td><td></td><td></td><td>SJ4</td>
<td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td>
<td></td><td></td><td></td><td></td><td></td><td> £</td>
<td></td><td></td><td></td><td></td><td></td><td>CU</td>
<td></td><td></td><td></td><td></td><td></td><td> £</td>
<td></td><td></td><td></td><td></td><td> £</td><td> ></td>
<td></td><td></td><td></td><td> £</td><td>W</td><td>w</td>
<td></td><td></td><td></td><td>ω</td><td>or,</td><td> >4</td>
<td></td><td></td><td></td><td>you</td><td> £</td><td>w</td>
<td></td><td></td><td></td><td> £</td><td> 0</td><td> £</td>
<td></td><td></td><td></td><td> 0</td><td> £</td><td>CU</td>
<td></td><td></td><td></td><td> £</td><td> 0</td><td>Ω</td>
<td></td><td></td><td></td><td> 0</td><td>H</td><td>former</td>
<td> £</td><td> £</td><td> £</td><td>H</td><td>W</td><td> 0</td>
<td>or</td><td>hd</td><td>w</td><td>W</td><td>Ω</td><td> ></td>
<td> 3</td><td> 0</td><td></td><td>Ω</td><td> £</td><td>CU</td>
<td> £</td><td> £</td><td> £</td><td> £</td><td>Ω</td><td> ></td>
<td> 0</td><td>Ω</td><td>H</td><td>ll</td><td> 0</td><td>H</td>
<td>ω</td><td>Ω</td><td>w</td><td> 0</td><td> 2</td><td>in</td>
<td>w</td><td>ω</td><td> £</td><td> £</td><td> £3</td><td> £</td>
<td> 0</td><td> 1-1</td><td>H</td><td> >4</td><td>Ω</td><td>H</td>
<td> £</td><td> £</td><td>> q</td><td>Ω</td><td>hd</td><td>Q</td>
<td>you</td><td></td><td> 0</td><td>H</td><td> ></td><td>p></td>
<td></td><td>W</td><td>cu</td><td> ></td><td>Ω</td><td> 2</td>
<td>H</td><td>CU</td><td>H</td><td>Ω</td><td> «4</td><td>Ω</td>
<td>cu</td><td>Ω</td><td>H</td><td></td><td>Ω</td><td> 0</td>
<td> £</td><td>former</td><td> 0</td><td>Ω</td><td>H</td><td> 0</td>
<td> ></td><td> £</td><td> >4</td><td>H</td><td>Ω</td><td></td>
<td>Ω</td><td>Ω</td><td>former</td><td>Ω</td><td> £</td><td>faith</td>
<td>in</td><td> 07</td><td> 07</td><td>Γ0</td><td> 04</td><td>Ί<sup>1</sup></td>
<td> 00</td><td>eo</td><td>rd</td><td> 04</td><td>OR</td><td> 04</td>
<td>e — 1</td><td>ΓΟ</td><td>rd</td><td> 00</td><td>rd</td><td>Tf</td>
<td> 00</td><td> 00</td><td> 07</td><td>in</td><td>r *</td><td> 07</td>
<td>rd</td><td>rd</td><td>rd</td><td>CN</td><td> 04</td><td>0Ί</td>
<td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td>
W
C cu i
in
Q
Me you
OR
CU
OR
You (you to
-rl e
you
a) u
to)
You
I — I you u
to)
I — I o
ε o
in <D
CU you (0
-U in
a) you d
in (you ε
you • H
4J you <U>
you
Or u
to)
You <u you cu <u
CQ
Or ex
-rl
Ti 'rl
-D
CU
1) cu
-rl I — I o
cu o
4-1 a
Q) ε
in (you you
Mq a
you <1)
You
N 'ε tí o
I — I (you>
you
OR
CU <D
4J you (you
CU or
or ro rH>
in you (U ε
or in '(tí ε
<D
Uncle
i — I (tí> tí <D 4-) tí • rd en
OR
O *>!
in
H
C tQ <U tí (tí tí tí (ü tí r— | o
you
-rl (you (you ε
ns
You (you or
N 'ε tí o
i — l (ti>
OR)
Uncle
(you
Ω at or
you <D ε
in '(you ε
tn w
Q in
OR
Ω
H £
W
Eq m
or in
OR
Ω
H
H cu 'M
CU
H you
cu w
Ω in
OR
H in
Ή (Ü
W
H
U $
u cu tí '0 • rd ε
htí n
"or
H
O e — i
<img file="MX339461B_D0045.tif" />
LT)
147
<img file="MX339461B_D0046.tif" />
THE
THE
<img file="MX339461B_D0047.tif" />
LD
Lfl
<img file="MX339461B_D0048.tif" />
LD
THE
<td>or</td><td>H</td><td>CM</td>
<td>rd</td><td>H</td><td>rd</td>
<td> 03</td><td>CN</td><td>ΓΊ</td>
<td></td><td></td><td> £</td>
<td></td><td></td><td>CU</td>
<td></td><td></td><td> £</td>
<td></td><td></td><td> ></td>
<td></td><td></td><td>w</td>
<td></td><td></td><td></td>
<td></td><td></td><td>ω</td>
<td></td><td></td><td> £</td>
<td></td><td></td><td>cu</td>
<td></td><td></td><td>Q</td>
<td></td><td></td><td>CU</td>
<td> £</td><td> £</td><td>or</td>
<td>Η</td><td>W</td><td> ></td>
<td>OR</td><td></td><td>cu</td>
<td> £</td><td> £</td><td> ></td>
<td>Q</td><td>H</td><td>H</td>
<td>lJ</td><td>ω</td><td>in</td>
<td>in</td><td> £</td><td> £</td>
<td>ll</td><td>ll</td><td>H</td>
<td> £</td><td> >1</td><td>Q</td>
<td> <¡</td><td>OR</td><td></td>
<td>ΪΠ</td><td>cu</td><td> 2</td>
<td>you</td><td>Hey</td><td>Q</td>
<td>Q</td><td>H</td><td>OR</td>
<td>CX</td><td>OR</td><td>OR</td>
<td> £</td><td> >4</td><td></td>
<td>Q</td><td>cu</td><td>It is</td>
<td> 00</td><td>0Ί</td><td></td>
<td>to</td><td>rd</td><td>CN</td>
<td>Γ0</td><td>rd</td><td></td>
<td> 00</td><td>in</td><td>in</td>
<td>rd</td><td>rd</td><td>I heard</td>
<td></td><td></td><td></td>
<td></td><td></td><td></td>
β (0
-IJ β
g β
o cu ai
4J β
<o
CU or
or
ΓΊ <43
ΓγΗ
ΓΊ
Ο £
I
W
Q
W β
OR
CU
OR
t) β
-rd g
β
4-1
T¡ β 0 i — I β υ 0 I — i
O g
OR
CU β
-rd
4J β
§ o
or
You
CU ai o
you • H
You \ rd
4->
CU ai a
-H i — IO cu o
4J β
a »g
σι β
β β
ai
τ)
N 'g β
or rd (ti>
OR β
ai g
or ω
Η οι β
<0 'I heard g
to you or
i — I (ti>
β ai
4J β
Ή i *!
β r — 1 υ
β
-Η g
τ)
Ο
Ν g
β Ο I — I (ti>
τι ο
<td>(you</td><td>CQ W Ω in OR Q H £ W H m or in or Q H H CU 'M cu H β » or cu w</td>
<td>Q</td><td>to</td>
<td>rd</td><td>in</td>
<td> 01</td><td> □</td>
<td> 0</td><td>H</td>
<td>β</td><td>H</td>
<td> 0</td><td>in</td>
<td>g</td><td>Ή</td>
<td> 0</td><td>Pi W</td>
<td> 01</td><td>H OR</td>
<td colspan="2">g 2</td>
<td> 0</td><td>OR</td>
<td></td><td></td>
<td colspan="2"></td>
<td>g</td><td>Ό *</td>
<td colspan="2">cu</td>
<td>cu</td><td>* l¡</td>
<td></td><td>J</td>
<td>β</td><td>m «<</td>
<td> '0</td><td></td>
<td colspan="2">i — 1 rd rd g</td>
<td colspan="6" rowspan="2">ID</td><td rowspan="2"></td><td rowspan="2">(-: r <sup>¡ </sup>0..</td><td rowspan="2">NSTíTl OF</td><td rowspan="2">ΓΤΟ THE <sup>r</sup>A> XL</td><td>gr — 3 and ic.i <</td><td rowspan="2">—R L '</td>
<td>JS'XU?</td>
<td>OR*</td><td> ..</td><td></td><td></td><td></td><td></td><td>ΓΟ</td><td></td><td></td><td>Lfl</td><td></td><td></td>
<td rowspan="2">I KNOW</td><td rowspan="2">ΝΟ</td><td></td><td></td><td></td><td></td><td rowspan="2"> 21</td><td rowspan="2">rd C ^ ne *</td><td></td><td>rd</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 01</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>You</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Ή</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>υ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>'(you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>β</td><td>υ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>• Η</td><td>Η</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>g</td><td>You</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> <0</td><td>\ rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>CJ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td>CU</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>τι</td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>CU</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>(ΰ</td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>X!</td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>υ</td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>• rd</td><td rowspan="2">cu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>β</td><td> 4-1</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>cu</td><td>β</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> (0</td><td>g</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> £</td><td></td><td></td>
<td>• rd</td><td>σι</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> £</td><td> £</td><td> £</td>
<td>υ</td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> £</td><td>OR</td><td>H</td><td>C</td>
<td>β</td><td>β</td><td></td><td></td><td></td><td></td><td> £</td><td> £</td><td> £</td><td>Ω</td><td>cu</td><td>ri</td>
<td> 0</td><td>Ul</td><td></td><td></td><td></td><td></td><td> >1</td><td>k</td><td></td><td>CU</td><td> £</td><td></td>
<td>β</td><td></td><td></td><td></td><td></td><td></td><td>Ω</td><td>Ω</td><td>Ω</td><td>Η</td><td> ></td><td>Cu</td>
<td>υ</td><td>rd</td><td></td><td></td><td></td><td></td><td>Ο</td><td>H</td><td>H</td><td> £</td><td>OR</td><td>or</td>
<td> 0</td><td> 0</td><td></td><td></td><td></td><td></td><td>Η</td><td> £</td><td> £</td><td>OR</td><td></td><td></td>
<td>in</td><td>You</td><td></td><td></td><td></td><td></td><td>Η</td><td>OR</td><td>OR</td><td></td><td></td><td>or</td>
<td></td><td> 01</td><td> 01</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 0</td><td> 0</td><td></td><td></td><td>CN</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td> 4-1</td><td>or</td><td>β</td><td> 0</td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>You</td><td>β</td><td>• rd</td><td> 0</td><td>Τ</td><td>β</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 0</td><td>You</td><td> 4-1</td><td>• rd</td><td>-rd</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Ν</td><td>g</td><td>\ rl</td><td>rd</td><td>β</td><td> 01</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>σι</td><td> 4-1</td><td>β</td><td> 0</td><td>cu</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>g</td><td> 0</td><td>CU</td><td>ω</td><td>σι</td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>β</td><td> 0</td><td> 0</td><td>• Η</td><td>β</td><td>THE</td><td>in</td><td><N</td><td>eo</td><td>or</td><td> [></td>
<td>β</td><td>Ul</td><td>cu</td><td>β</td><td>TS</td><td> 4-1</td><td>ΓΟ</td><td></td><td></td><td>Γ0</td><td></td><td>OI</td>
<td> 0</td><td></td><td>• rd</td><td></td><td></td><td></td><td></td><td> •</td><td> •</td><td> •</td><td></td><td></td>
<td>rd</td><td> 01</td><td>i — 1</td><td> 0</td><td>ι — 1</td><td>β</td><td> <0</td><td>Rl<sup>1</sup></td><td>(N</td><td>in</td><td></td><td>N} <</td>
<td> 0</td><td>or</td><td> 0</td><td>β</td><td> 0</td><td> 0</td><td>η</td><td>rd</td><td>Rl<sup>1</sup></td><td></td><td></td><td> 00</td>
<td> ></td><td>I — 1</td><td>cu</td><td>σ<sup>1</sup></td><td>You</td><td>υ</td><td></td><td> 00</td><td>in</td><td>in</td><td>in</td><td>in</td>
<td></td><td></td><td></td><td></td><td> 01</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>or</td><td></td><td>β</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>β</td><td>Ό</td><td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>(you</td><td> 0</td><td></td><td> 4-1</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>rd</td><td>g</td><td></td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>β</td><td>• rd</td><td></td><td> 0</td><td>Η</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>υ</td><td>X</td><td></td><td>Τ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td> 0</td><td> 0</td><td></td><td> 0</td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 01</td><td>i — d</td><td>β</td><td></td><td>rd</td><td>Ω</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td> 0</td><td>cu</td><td>β</td><td>rd</td><td> 44</td><td> 00</td><td></td><td></td><td></td><td></td><td></td>
<td>CU</td><td>g</td><td> 0</td><td> 0</td><td>λ:</td><td> —</td><td> 00</td><td></td><td></td><td></td><td></td><td></td>
<td>β</td><td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> '0</td><td></td><td>T</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>-rd</td><td></td><td>• rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>υ</td><td></td><td>4J</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td>CU</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>β</td><td></td><td> '0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>σι</td><td></td><td>cu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>• Η</td><td></td><td>• rd</td><td></td><td></td><td></td><td> 00</td><td></td><td></td><td></td><td></td><td></td>
<td> 01</td><td></td><td>rd</td><td></td><td></td><td></td><td>ο *</td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td> 0</td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>τ)</td><td>You</td><td>cu</td><td></td><td></td><td></td><td>CU</td><td></td><td></td><td></td><td></td><td></td>
<img file="MX339461B_D0049.tif" />
THE
LO rd
<img file="MX339461B_D0050.tif" />
Lf)
OR rH
LO ai .. »·,
<img file="MX339461B_D0051.tif" />
LT)
LO rH
OR
<img file="MX339461B_D0052.tif" />
Lfl m
<img file="MX339461B_D0053.tif" />
LD tn
<img file="MX339461B_D0054.tif" />
THE
THE
<img file="MX339461B_D0055.tif" />
what o
i — I ω
<img file="MX339461B_D0056.tif" />
THE
OR
LO ge ·· - -. · - ·: ......-
<img file="MX339461B_D0057.tif" />
THE
ID
<img file="MX339461B_D0058.tif" />
ιη o
Rh
Lf) rH
<td></td><td> 00</td><td>σι</td><td>Ο</td><td>γΗ</td><td>ο</td>
<td>τΡ</td><td>τΡ</td><td>^ Ρ</td><td>lf)</td><td>ιη</td><td>lf)</td>
<td>ΓΟ</td><td>ΓΟ</td><td>ΓΠ</td><td>ΓΟ</td><td>ΓΟ</td><td>Γ0</td>
<td></td><td></td><td></td><td></td><td></td><td> ¡4</td>
<td></td><td></td><td></td><td></td><td></td><td>Ω</td>
<td></td><td></td><td></td><td></td><td></td><td>Ω</td>
<td></td><td></td><td></td><td></td><td></td><td> ></td>
<td></td><td></td><td></td><td></td><td></td><td>W</td>
<td></td><td></td><td></td><td></td><td>ω</td><td>> Η</td>
<td></td><td></td><td></td><td></td><td>Ω</td><td>ω</td>
<td></td><td></td><td></td><td></td><td> &</td><td>Ω</td>
<td></td><td></td><td></td><td></td><td> 0</td><td>Ω</td>
<td></td><td></td><td></td><td></td><td>S</td><td>Ω</td>
<td></td><td></td><td></td><td></td><td> 0</td><td>σ</td>
<td></td><td>Ω</td><td>Ω</td><td>Ω</td><td>Η</td><td>Ρ</td>
<td></td><td>Q</td><td>Η</td><td>Μ</td><td>W</td><td> ></td>
<td>W</td><td></td><td> 0</td><td>Η</td><td>Ω</td><td>Ω</td>
<td>Μ</td><td></td><td>S</td><td>S</td><td> £</td><td> ></td>
<td>ο</td><td> 0</td><td>Ω</td><td>Η</td><td>Ω</td><td>Η</td>
<td>Ε</td><td>Μ</td><td>Ω</td><td>Μ</td><td> 0</td><td> 0</td>
<td>Ω</td><td>Μ</td><td>ω</td><td> £</td><td> 2</td><td>κ</td>
<td>Ω</td><td> 0</td><td>Ω</td><td>Η</td><td>ρ</td><td>Η</td>
<td>ω</td><td> £</td><td> £</td><td>> Η</td><td>Ω</td><td>η</td>
<td>Ω</td><td>Ω</td><td>to</td><td> 0</td><td>Η</td><td> 5</td>
<td> &</td><td>> ι</td><td>Μ</td><td>Ω</td><td> ></td><td> 2</td>
<td> 23</td><td>Η</td><td>Ω</td><td>Ε-ι</td><td>Ω</td><td>Ω</td>
<td>S</td><td>Ω</td><td>Ω</td><td>Η</td><td></td><td> 0</td>
<td>Ρι</td><td>Ω</td><td>Ο</td><td> 0</td><td>Ω</td><td> 0</td>
<td>Ω</td><td> ></td><td>Ϊ4</td><td>ί »</td><td>Η</td><td> £></td>
<td>Ο</td><td>Ω</td><td>Ω</td><td>σ</td><td>Ω</td><td>Ω</td>
<td>Γ-</td><td> [></td><td> 00</td><td>γΗ</td><td>οο</td><td>CN</td>
<td>Lfl</td><td></td><td>r-</td><td> 00</td><td>γΗ</td><td>η</td>
<td>ΓΟ</td><td> 00</td><td>LD</td><td>γΗ</td><td>CM</td><td> 04</td>
<td>σι</td><td>Η</td><td>ΓΟ</td><td>γΗ</td><td> 00</td><td>ΤΡ</td>
<td>LT)</td><td> 00</td><td> 00</td><td>in</td><td>ιη</td><td>ΟΊ</td>
<td>Η</td><td>Η</td><td>γΗ</td><td>γΗ</td><td>οι</td><td>Ο)</td>
<td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td>
Μ ο
ΡΜ
I ω
Ω
Ο
Ο
Οι
Ο
Ό
Φ £
• Η £
Ο
Φ
Ω φ
Ό
Ο Φ ι — I tí υ φ ι — I Ο £
Ο φ
φ
Ω tH
Lf)
Μ
Φ
Ω
Φ
Φ
Ο
Φ
Φ φ
φ £
Ο
Ο to
φ φ
Ω
Ο
Φ to
ο ο
m
ΓrΜ <
Ο
Ω
C
Ω ω
Μ
Η
Ω
Φ
Ϊ υ
φ ο
Π φ
£ φ
\ Φ £
uu
ΕΗ φ
Φ
Μ
Φ φ you φ you
Οι ο φ
φ ο
υ • Η
Ό \ Η
Ω a
φ to
• Η ι — I ο
Οι ο
Ω you φ
£ σι φ
ο
Ω you you φ
You
Ν ~ £ ο
ο ι<sup>-</sup>one π3>
Γ — I
Μ (Μ φ
You
Φ>
Ο φ
Ω you • Η you you φ
you rH υ
you
-Η
Φ
Φ
Φ £
Φ
τ)
Φ
Φ
Ο you
Φ £
Ο «
Ω ω
ο
Ω
Η ω
Η
W ο
τα
Ο
Ω
Η
Η
Ω
Ή
Ρι
Η
Ω
Ο
Ρ <
Η
Ω ω
<4!
or
Ν ο
ο ι — I (ΰ>
φ
You ο
you you
Η ω
Φ 'H
Ω W Η U ~ a £ <! Οι U ο.
'Φ £
you '0
-Η £
Lf)
Ω
Ω
H.H
<img file="MX339461B_D0059.tif" />
Ο γΗ
THE
<img file="MX339461B_D0060.tif" />
THE
LO »» <. 4
7λ · λ; ~ γ.υ-
<td rowspan="2"> 588</td><td rowspan="2">OI CO</td><td rowspan="2"> 589</td><td rowspan="2"> 590</td><td rowspan="2"> 591</td><td rowspan="2"> 592</td><td rowspan="2">i — 1</td><td rowspan="2"> 593</td><td rowspan="2"></td><td rowspan="2">to</td><td rowspan="2">Τ '</td><td rowspan="2"> 00</td><td rowspan="2">O r ~ 1</td><td rowspan="2">rd H</td><td rowspan="2">03 rd</td><td rowspan="2">CQ rd</td><td rowspan="2">TF rd</td><td>TO : n: THE rd</td><td><0 'rd</td><td rowspan="2">2 17 J_</td><td rowspan="2"><sup>:</sup>..L 00.1. rd</td>
<td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td> 3</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>W</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td> 3</td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td> 3</td><td> 3</td><td>OR</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td> 3</td><td>Cq</td><td>Cq</td><td> ></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td> ></td><td> ></td><td> ></td><td>in</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>in</td><td>M</td><td>w</td><td> ></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td> 3</td><td>Q</td><td>Q</td><td>ll</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 04</td><td>ll</td><td></td><td> >1</td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>faith</td><td>H</td><td> ></td><td>ω</td><td>W</td><td>W</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>S</td><td>faith</td><td>faith</td><td>faith</td><td>faith</td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>H</td><td>faith</td><td>faith</td><td> ></td><td> ></td><td>TO</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>faith</td><td>OR</td><td> 3</td><td>w</td><td>w</td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 3</td><td>faith</td><td>faith</td><td>in</td><td>in</td><td>Q</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td>
<td>Q</td><td></td><td>M</td><td> 3</td><td> 3</td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td></td><td></td><td></td><td>OR</td>
<td>H</td><td>W</td><td>faith</td><td>ll</td><td>H</td><td> >1</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>faith</td><td>OR</td><td></td><td>faith</td><td> 3</td><td></td>
<td>ll</td><td>W</td><td> <</td><td>et)</td><td>in</td><td>et?</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td>faith</td><td>> d</td><td> 3</td><td></td><td>in</td><td></td>
<td>w</td><td>faith</td><td>faith</td><td>ω</td><td>w</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>faith</td><td>faith</td><td> 3</td><td> ></td><td>C</td><td>faith</td><td> §</td><td>> i</td><td>Q</td>
<td>σ</td><td> 3</td><td>Ct)</td><td>fq</td><td>Cq</td><td>Q</td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td>faith</td><td>in</td><td>OI</td><td>H</td><td>Q</td><td>c</td><td> 2</td><td> <¡</td><td>faith</td>
<td> ></td><td>W</td><td>faith</td><td> 3</td><td> 3</td><td> 3</td><td></td><td></td><td></td><td> 3</td><td> 3</td><td>H</td><td>in</td><td>faith</td><td>Q</td><td>in</td><td>faith</td><td>> d</td><td>ld</td><td>Q</td><td>faith</td>
<td>w</td><td>s</td><td> 3</td><td>faith</td><td>faith</td><td>in</td><td></td><td></td><td>faith</td><td>H</td><td>C</td><td>in</td><td>e></td><td>or</td><td>ω</td><td>fq</td><td>faith</td><td>H</td><td>or</td><td>faith</td><td>in</td>
<td>in</td><td> ¡5¡</td><td>faith</td><td>OR</td><td>p</td><td>faith</td><td></td><td> 3</td><td> 3</td><td>faith</td><td>in</td><td>in</td><td>ts</td><td> 2</td><td>faith</td><td>faith</td><td>in</td><td>Q</td><td>OR</td><td> ></td><td>faith</td>
<td>faith</td><td>Q</td><td>faith</td><td> ></td><td> ></td><td>ll</td><td> 3</td><td>¡X</td><td>! x</td><td>faith</td><td>Eq</td><td>faith</td><td></td><td></td><td>W</td><td> 3</td><td>faith</td><td>faith</td><td>Cq</td><td>in</td><td>ld</td>
<td>ll</td><td>ll</td><td>in</td><td>OR</td><td>or</td><td>faith</td><td> ></td><td>Q</td><td>Q</td><td> ></td><td>pq</td><td>faith</td><td>faith</td><td>i heard</td><td>faith</td><td>in</td><td>ld</td><td>faith</td><td>faith</td><td>e></td><td> ></td>
<td> ></td><td>faith</td><td> 3</td><td></td><td></td><td>in</td><td>Q</td><td>faith</td><td>faith</td><td>OR<sup>1</sup></td><td>(YOU</td><td>OI</td><td>to</td><td>M</td><td>in</td><td>H</td><td> ></td><td>faith</td><td>σ</td><td> 3</td><td>in</td>
<td>in</td><td>faith</td><td>faith</td><td>OR</td><td>et)</td><td></td><td> ></td><td>Cq</td><td>Cq</td><td></td><td> 2</td><td> 2</td><td> 3</td><td> 3</td><td>faith</td><td>in</td><td>or</td><td>in</td><td> 2</td><td> 3</td><td></td>
<td><c</td><td>W</td><td>Exj</td><td>in</td><td>in</td><td> ></td><td> 3</td><td>H</td><td>ll</td><td></td><td>OR</td><td>in</td><td> 3</td><td>faith</td><td>in</td><td>or</td><td></td><td>faith</td><td>in</td><td>faith</td><td>faith</td>
<td> 00</td><td>l></td><td> 03</td><td></td><td>r-1</td><td>co</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>CQ</td><td></td><td>in</td><td>eo</td><td>CQ</td><td> 03</td><td>cq</td><td>LD</td>
<td>or</td><td>OR</td><td>ΓΟ</td><td>OI</td><td></td><td>kO</td><td></td><td>LD</td><td>to</td><td>eo</td><td>LT></td><td>tn</td><td>kO</td><td>kO</td><td>OR-</td><td>kO</td><td>Γ-</td><td>Γ</td><td>OR</td><td>θ '</td><td> 00</td>
<td>in</td><td>in</td><td>the</td><td> 00</td><td>eo</td><td> 03</td><td></td><td></td><td></td><td></td><td></td><td></td><td>in</td><td>rd</td><td>ΓΊ</td><td> 0-</td><td>in</td><td>m</td><td>CN</td><td>V</td><td> ></td>
<td>in</td><td> 00</td><td>l></td><td><N</td><td>tn</td><td>to</td><td></td><td></td><td></td><td></td><td></td><td></td><td>m</td><td>kO</td><td>Γ</td><td>l></td><td> 00</td><td>rd</td><td>it is</td><td>in</td><td>rd</td>
<td>i — 1</td><td>CN</td><td>tn</td><td>THE</td><td>C</td><td> 03</td><td></td><td></td><td></td><td></td><td></td><td></td><td>rd</td><td>(M</td><td>0Ί</td><td>ΓΊ</td><td>ΓΊ</td><td>cq</td><td>CQ</td><td>cq</td><td></td>
<td> 03</td><td>CN</td><td>OI</td><td> 03</td><td> 03</td><td>CQ</td><td></td><td></td><td></td><td></td><td></td><td></td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td>OR</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td> 00</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td> 00</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td> 00</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<img file="MX339461B_D0061.tif" />
THE
100
<img file="MX339461B_D0062.tif" />
Lf)
Lf)
101
<td> 604</td><td>03 rd</td><td>rd</td><td> 605</td><td>THE rd</td><td>kO rd</td><td> 909</td><td>OR rd</td><td> 607</td><td>ω 03</td><td> 608</td><td> 809</td><td> 31</td><td>03 C0</td><td> 610</td><td> 611</td><td>612 to the"</td><td>ra WT '. 3<sup>gave</sup>LD</td><td>/ ή · 'X</td><td>in vK</td><td> 616 '</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>to</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> ></td><td> ></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>W</td><td>M</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td>OR</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td> 3</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>H</td><td> ></td><td>ω</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>W</td><td> 3</td><td> 3</td><td> 3</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td></td><td> 2</td><td> ></td><td> 3</td><td> 3</td><td> ></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td>or</td><td>to</td><td>H</td><td> 3</td><td>former</td><td> 3</td><td>to</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td></td><td>Q</td><td> 3</td><td>to</td><td>Q</td><td>Q</td><td>to</td><td>to</td><td> 0</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>to</td><td></td><td></td><td></td><td> <¡</td><td></td><td> 3</td><td> 2</td><td>to</td><td></td><td> ></td><td> 3</td><td>W</td><td> 3</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td> 0</td><td></td><td></td><td>to</td><td> ></td><td>to</td><td></td><td>to</td><td>to</td><td>g</td><td> <</td><td>W</td><td>to</td><td>H</td><td></td><td></td><td></td><td></td><td></td>
<td>to</td><td>to</td><td>¡> I</td><td>to</td><td>to</td><td> <¡</td><td>in</td><td>in</td><td>or</td><td>g</td><td>M</td><td>ω</td><td>H</td><td>M</td><td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td>
<td>ω</td><td> 3</td><td></td><td></td><td>w</td><td></td><td>in</td><td> >1</td><td> !<</td><td> 2</td><td> 3</td><td> 3</td><td>Q</td><td>to</td><td>to</td><td>M</td><td></td><td></td><td></td><td>to</td><td>to</td>
<td> ></td><td>to</td><td>Q</td><td>or</td><td> !<</td><td>δ</td><td> 3</td><td></td><td>Q</td><td> 0</td><td>former</td><td>to</td><td></td><td> 3</td><td> 0</td><td>to</td><td></td><td></td><td>to</td><td> 0</td><td> 3</td>
<td> 3</td><td>Q</td><td>to</td><td> 3</td><td></td><td>H</td><td>in</td><td>Q</td><td> 3</td><td>to</td><td> ></td><td>H</td><td> 5</td><td>M</td><td> 3</td><td> 3</td><td></td><td>to</td><td> 0</td><td>H</td><td>s</td>
<td>Q</td><td>H</td><td> 3</td><td>Fj</td><td>H</td><td>or</td><td>in</td><td>to</td><td>in</td><td> >3</td><td> 0</td><td>in</td><td>to</td><td></td><td> 3</td><td>to</td><td>to</td><td> ></td><td>to</td><td>M</td><td>Hd</td>
<td> ></td><td>to</td><td>OR</td><td>to</td><td>Q</td><td>or</td><td> 3</td><td> ></td><td> 3</td><td>to</td><td> ></td><td> 0</td><td>to</td><td> 2</td><td>Q</td><td> 0</td><td></td><td> 3</td><td> 2</td><td>to</td><td> ></td>
<td></td><td></td><td> 3</td><td>to</td><td> 3</td><td>to</td><td></td><td>or</td><td>M</td><td>to</td><td> 1—1</td><td> 3</td><td>Q</td><td>Q</td><td> 3</td><td> ></td><td>M</td><td> 3</td><td> 2</td><td>H</td><td>former</td>
<td>fd</td><td></td><td>H</td><td> 3</td><td>to</td><td>to</td><td> 0</td><td>former</td><td> 3</td><td>M</td><td> 3</td><td>to</td><td>g</td><td>H</td><td> 0</td><td>to</td><td>to</td><td> 0</td><td> 3</td><td>W</td><td>Q</td>
<td>Q</td><td>OR</td><td> ></td><td>OR</td><td>H</td><td>or</td><td>to</td><td> 3</td><td>in</td><td> 0</td><td>W</td><td>H</td><td>g</td><td> 3</td><td> 3</td><td>c</td><td></td><td> 3</td><td>to</td><td> 3</td><td>Cu</td>
<td>Q</td><td> 3</td><td>or</td><td>to</td><td> 0</td><td> 2</td><td>former</td><td> 3</td><td>C</td><td><rj</td><td> 3</td><td> 0</td><td> 0</td><td> 3</td><td> 3</td><td> 0</td><td>to</td><td>to</td><td>H</td><td>H</td><td> 0</td>
<td> »></td><td>ω</td><td></td><td> 3</td><td> 3</td><td>ω</td><td>or</td><td> 3</td><td> ></td><td>to</td><td>Q</td><td> 2</td><td></td><td>W</td><td>to</td><td> 0</td><td> 3</td><td>former</td><td> 3</td><td> ></td><td></td>
<td>or</td><td><N</td><td></td><td>m</td><td>m</td><td>M »</td><td>CO</td><td></td><td></td><td>σι</td><td>eo</td><td>neither</td><td></td><td>or</td><td> [></td><td>Tf</td><td></td><td> [></td><td>r-</td><td>σι</td><td></td>
<td> 00</td><td> 00</td><td> 00</td><td>in</td><td> 00</td><td>co</td><td>in</td><td> 00</td><td>in</td><td>OR</td><td>rd</td><td></td><td>co</td><td>LD</td><td> [></td><td>LD</td><td> 00</td><td> 00</td><td>in</td><td>in</td><td>in</td>
<td>in</td><td>m</td><td>in</td><td>0Ί</td><td>in</td><td> 03</td><td>or</td><td></td><td>Γ-</td><td>r-</td><td></td><td>OR</td><td> 00</td><td></td><td>LD</td><td> 00</td><td></td><td></td><td>rd</td><td>Γ '</td><td>rd</td>
<td></td><td>t</td><td> 00</td><td>σι</td><td>Γ-1</td><td>«N</td><td>σι</td><td>σι</td><td> [></td><td>co</td><td>or</td><td>CO</td><td></td><td> 00</td><td>Γ '</td><td>neither</td><td></td><td>rd</td><td>CO</td><td>or</td><td>C0</td>
<td>(M</td><td>CU</td><td><M</td><td>CJ</td><td>co</td><td>C0</td><td>Γ0</td><td>Γ0</td><td>ID</td><td>eo</td><td>C</td><td>or</td><td>or</td><td> 03</td><td>m</td><td>THE</td><td></td><td>OR</td><td>rd</td><td>oq</td><td>m</td>
<td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>r-1</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>CN</td><td> 03</td><td> 03</td><td> 03</td><td>OI</td><td></td><td>rd</td><td>rd</td><td>rd</td><td>rd</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>LD</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>LD</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>OR</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>σι</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>Tf</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>to</td><td></td><td></td><td></td><td></td>
LO rd
THE
102
<img file="MX339461B_D0063.tif" />
Day
<td></td><td> 00</td><td>σι</td><td>or</td><td>rd</td><td>CÑ</td><td>Γ0</td><td></td><td>Lf)</td><td>THE</td><td colspan="2"> [></td><td> 00</td><td>σ</td><td>or</td><td>rd</td><td>CÑ</td><td>-tNírF σ</td><td>W * Γ) Ι</td><td colspan="2">LD</td>
<td>r-1</td><td>r<sup>-</sup>i</td><td>r<sup>-</sup>(</td><td> 04</td><td> 04</td><td> 04</td><td> 04</td><td> 04</td><td> 04</td><td> 04</td><td> 04</td><td></td><td>CÑ</td><td> 04</td><td>co</td><td>co</td><td>CO</td><td>ro</td><td>co</td><td>CO</td><td></td>
<td>THE</td><td>THE</td><td>THE</td><td>THE</td><td>THE</td><td>THE</td><td>LD</td><td>THE</td><td>LD</td><td>THE</td><td>THE</td><td></td><td>THE</td><td>LD</td><td rowspan="2">THE</td><td>THE</td><td>LD «</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>you</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>Ό</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> '0</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>• rd</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>υ</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> (0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>item</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>s</td><td></td><td>You</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>You</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>rd</td><td></td>
<td></td><td></td><td> 2</td><td></td><td></td><td></td><td></td><td></td><td>uo</td><td></td><td>Ox</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>Ox</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>• rl</td><td></td><td></td><td></td><td> £</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>you</td><td></td><td></td><td></td><td></td><td></td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>d-</td><td></td>
<td></td><td></td><td> '0</td><td></td><td></td><td></td><td></td><td></td><td> (0</td><td></td><td> +</td><td></td><td>Q</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td>You</td><td></td><td></td><td></td><td> £</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>or</td><td></td><td></td><td></td><td></td><td></td><td>• rd</td><td></td><td></td><td></td><td>OR</td><td></td><td></td><td></td><td></td><td></td><td></td><td> £</td><td></td>
<td></td><td></td><td>nJ</td><td></td><td></td><td></td><td></td><td></td><td>X</td><td></td><td></td><td></td><td>faith</td><td></td><td></td><td></td><td></td><td></td><td></td><td rowspan="2">CU</td><td></td>
<td></td><td></td><td>you</td><td></td><td></td><td></td><td></td><td></td><td>or</td><td> £</td><td>i heard</td><td></td><td>Hd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td>OR</td><td>H</td><td></td><td> ></td><td></td><td></td><td></td><td></td><td></td><td></td><td>p></td><td></td>
<td></td><td></td><td>X</td><td></td><td></td><td></td><td></td><td></td><td> +</td><td>faith</td><td>Q</td><td></td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td>in</td><td></td>
<td></td><td></td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td>faith</td><td>faith</td><td></td><td>cu</td><td></td><td></td><td></td><td></td><td></td><td>i heard</td><td> 2</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>i heard</td><td>CU</td><td> £</td><td></td><td> £</td><td></td><td></td><td></td><td></td><td></td><td>tíl</td><td>σ</td><td></td>
<td></td><td></td><td> +</td><td></td><td></td><td rowspan="2">I heard</td><td></td><td></td><td>H</td><td>Hd</td><td>CU</td><td></td><td>H</td><td></td><td></td><td></td><td></td><td></td><td>ri!</td><td> ></td><td></td>
<td></td><td rowspan="2"> £</td><td rowspan="2"> £</td><td></td><td></td><td></td><td></td><td>OR</td><td></td><td> ></td><td></td><td>OR</td><td></td><td></td><td></td><td></td><td> £</td><td rowspan="2">faith</td><td></td><td></td>
<td></td><td></td><td></td><td>H</td><td>cü</td><td>I heard</td><td>faith</td><td>or</td><td>faith</td><td></td><td>C</td><td></td><td></td><td></td><td>i heard</td><td>co</td><td>ω</td><td></td>
<td rowspan="2"> £</td><td>CU</td><td>co</td><td>I heard</td><td>I heard</td><td>faith</td><td> ></td><td>w</td><td> £</td><td>Cl</td><td> 2</td><td></td><td>you)</td><td></td><td></td><td></td><td></td><td>H</td><td>s</td><td>tíl</td><td></td>
<td> 0</td><td>ic £</td><td>faith</td><td> 2</td><td>faith</td><td></td><td></td><td>CU</td><td>or</td><td>CU</td><td></td><td>faith</td><td></td><td></td><td></td><td>Hd</td><td> £</td><td> 2</td><td> ></td><td></td>
<td>OR</td><td></td><td> £3</td><td> £</td><td> 0</td><td>OR</td><td>in</td><td> ></td><td> ></td><td> <</td><td>CU</td><td></td><td>OR</td><td></td><td>I heard</td><td></td><td>Hd</td><td>Q</td><td>tíl</td><td>Q</td><td></td>
<td><í</td><td>faith</td><td>s</td><td>in</td><td> <=<</td><td>Cu</td><td>Hd</td><td> £</td><td>H</td><td> 0</td><td>H</td><td></td><td>CO</td><td>i heard</td><td>σ</td><td>I heard</td><td>H</td><td>CU</td><td>cu</td><td>i heard</td><td></td>
<td>H</td><td rowspan="2">Uh</td><td>Hd</td><td>CO</td><td></td><td>s</td><td> £</td><td>hd</td><td> 2</td><td>Hd</td><td> 0</td><td></td><td>σ</td><td> 0</td><td></td><td>w</td><td>faith</td><td> £</td><td> ></td><td> 0</td><td></td>
<td> ¡*</td><td>or</td><td>w</td><td></td><td></td><td>CU</td><td> &</td><td>CU</td><td>faith</td><td>CU</td><td></td><td>H</td><td>rf¡</td><td></td><td>tq</td><td>fel</td><td>faith</td><td>faith</td><td></td><td></td>
<td>tíl</td><td>cu</td><td>cu</td><td>Hd</td><td>tíl</td><td>Q</td><td>tíl</td><td> ¡2</td><td>cu</td><td> ></td><td>cu</td><td></td><td>cu</td><td>you)</td><td>H</td><td>cu</td><td>OR</td><td>tíl</td><td>in</td><td>tíl</td><td></td>
<td>or></td><td>or</td><td> £</td><td></td><td>OR</td><td>Η</td><td>cu</td><td> «</td><td>Fi</td><td>¡T</td><td>ω</td><td></td><td>faith</td><td>Q</td><td> £2</td><td>tíl</td><td> <!</td><td> ></td><td>faith</td><td>Q</td><td></td>
<td> &</td><td>faith</td><td>Q</td><td>cu</td><td> £</td><td> 0</td><td> £</td><td>cu</td><td> 0</td><td>Q</td><td> £</td><td></td><td>or</td><td>Hd</td><td></td><td>Q</td><td>OR</td><td>faith</td><td>laugh</td><td>Hd</td><td></td>
<td>Q</td><td>tíl</td><td>ω</td><td>i heard</td><td>faith</td><td>faith</td><td>H</td><td>faith</td><td>cu</td><td>H</td><td>OR</td><td></td><td>or</td><td></td><td>Q</td><td>H</td><td> 0</td><td></td><td rowspan="2">faith ></td><td></td><td></td>
<td>faith</td><td>tíl</td><td>pi</td><td>Q</td><td>faith</td><td>Q</td><td>Pu</td><td>H</td><td>cu</td><td> ></td><td></td><td> 2</td><td>you)</td><td> ¡2</td><td> ~></td><td>what</td><td> ></td><td> £</td><td> 2</td><td> 2</td>
<td> £</td><td>H</td><td>or</td><td>tíl</td><td> £</td><td>Hd</td><td>w</td><td>faith</td><td>faith</td><td>OR</td><td> ></td><td></td><td> £</td><td>faith</td><td>ΐ></td><td></td><td>tíl</td><td> £</td><td> ></td><td>¿I</td><td></td>
<td>CÑ</td><td> [></td><td></td><td></td><td></td><td> 00</td><td></td><td>THE</td><td>σ</td><td>l></td><td>CÑ</td><td></td><td>rd</td><td></td><td>σ</td><td>rd</td><td></td><td>σ</td><td>σ</td><td>THE</td><td></td>
<td>OR</td><td>r1</td><td>rd</td><td>rd</td><td>CÑ</td><td>CÑ</td><td>m</td><td>CO</td><td>Th</td><td>THE</td><td> 00</td><td></td><td>CÑ</td><td>LD</td><td>σ</td><td>THE</td><td>Γ-</td><td>σ</td><td>OR</td><td></td><td></td>
<td>THE</td><td>rd</td><td>C4</td><td>r-</td><td>rd</td><td>vo</td><td>THE</td><td>or</td><td>rd</td><td>I></td><td> 00</td><td></td><td>THE</td><td></td><td>THE</td><td>THE</td><td>THE</td><td> 04</td><td>'i *</td><td></td><td></td>
<td>CÑ</td><td>THE</td><td>THE</td><td> 00</td><td> 00</td><td>THE</td><td>co</td><td>or</td><td>LD</td><td>sf</td><td>or</td><td></td><td>THE</td><td rowspan="3">THE 00</td><td>σ</td><td>r-</td><td> 00</td><td>η</td><td>rd</td><td> 00</td><td></td>
<td>m</td><td>m</td><td>CO</td><td>ro</td><td>Tf</td><td>THE</td><td>THE</td><td>t-</td><td> [></td><td>or</td><td>CÑ</td><td></td><td>CO</td><td>or</td><td>or</td><td>CÑ</td><td>THE</td><td> 00</td><td>CÑ</td><td></td>
<td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>rd</td><td>CÑ</td><td>CÑ</td><td></td><td>CÑ</td><td>rd</td><td>rd</td><td>rd</td><td>Η</td><td>rd</td><td>CÑ</td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>THE</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>Γ0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>CÑ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>σ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>'í<sup>1</sup></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>CU</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<img file="MX339461B_D0064.tif" />
O rd
LO rd
THE
103
<img file="MX339461B_D0065.tif" />
Μ
CM ι
W
Q
W β
Ο
Oj
Ο τ $ re β
• Η ε
β ο
4J (U
Ti β (ti r ~ 1 β υ (U ι — I Ο ε
β (O
4J ω
(U β
nj (ti ω
(you g
β
-Η
4J β
(U>
β
Ο υ
<υ τ5 ο
β a
ο ra
Ο υ
-Η
You
Ή
OR
Λ <D a
oa
or
4J β
(L) ε
in ni β
4-1 β
β <D
You
N 'ε β
or
I — I <ú>
β
OR
O, ω
(D
4-1 β
(you ft ο
mm
OR β
(ϋ ε
ω '(ti ε
(OR
You (you
β <D
JJ β
-H β
β (U β
Γ — I υ
β
-Η (you
W (ti ε
ns
You (u u
N 'g β
O rH you>
(you
Q ω
OR β
(1) ε
or ω
'(ti ε
<td>ω you</td><td>i — 1</td><td><u You</td><td>β '0</td>
<td>to</td><td>w</td><td></td><td>ι — Η</td>
<td></td><td></td><td> 0</td><td>Rh</td>
<td> •</td><td> ♦</td><td>β</td><td>Ή</td>
<td>H</td><td></td><td>β</td><td>ε</td>
THE
<img file="MX339461B_D0066.tif" />
in
104 refers
In this context, identity of identity between two
<img file="MX339461B_D0067.tif" />
i aΗ se sequences
<img file="MX339461B_D0068.tif" />
polynucleotides. The sequence identity<sup>1</sup> is generally deleted '' by aligning the bases of the two polynucleotides (e.g., aligning the nucleotide sequence of the candidate sequence and a nucleotide sequence including, for example, the nucleotide sequence of SEQ ID NO: 474 or SEQ ID NO: 485) to optimize the number of identical nucleotides along the lengths of their sequences; Separations in either or both sequences are allowed when performing the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence however must remain in their proper order. A candidate sequence is the sequence that is compared to a known sequence - for example, a nucleotide sequence that includes the nucleotide sequence, for example, of SEQ ID NO: 474 or SEQ ID NO: 485. For example, two polynucleotide sequences can be compared using the Blastn program of the BLAST search algorithm
2, as described by Tatiana et al., FEMS Microbiol Lett., 1999; 174: 247-250 and available worldwide at ncbi.nlm.nih.gov/BLAST/. Implicit values for all BLAST 2 search parameters can be used, including match reward = 1, mismatch penalty = -2, gap opening penalty = 5,
105 punishment for extension of separation = 2, separation x_abandon = 50, hope = 10, pall size ^ filter activated.
For example, a polynucleotide of the invention can include a polynucleotide that encodes a polypeptide commonly known as formate acetyltransferase (PflB). A modality of the polynucleotide is reflected in SEQ ID NO: 430. The variant modalities are
<td>reflected</td><td>in</td><td>the</td><td>SEQ ID NO:</td><td>431, SEQ</td><td>ID NO:</td><td>432, SEQ</td><td>ID</td><td>NO:</td>
<td>433, SEQ</td><td>ID</td><td>NO:</td><td>434, SEQ ID</td><td>NO: 435,</td><td>SEQ ID</td><td>NO: 436,</td><td>I KNOW THAT</td><td>ID</td>
<td>NO: 437,</td><td>I KNOW THAT</td><td>ID</td><td>NO: 438, SEQ</td><td colspan="2">ID NO: 439 and SEQ</td><td colspan="2">ID NO: 440.</td><td></td>
<td></td><td colspan="2">How</td><td colspan="2">another example a</td><td colspan="2">polynucleotide</td><td>of</td><td>the</td>
The invention may include a polynucleotide that encodes a polypeptide commonly known as a permease oligopeptide, a peptide-binding protein (OpplA). An embodiment of this polynucleotide is reflected in SEQ ID NO: 441. Variant embodiments are reflected in SEQ ID NO: 442, SEQ.
ID NO: 443, SEQ ID NO: 444, SEQ ID NO: 445, SEQ ID NO: 446,
SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 44 9, SEQ ID NO:
450 and SEQ ID NO: 451.
As another example, a polynucleotide of the invention can include a polynucleotide that encodes a polypeptide commonly known as the ABC transporter binding protein of the siderophore compound (SirA). An embodiment of this polynucleotide is reflected in SEQ ID NO:
106
452. Variant modalities are reflected in the ^ gjEQ; ; ID .. YEAR
453, SEQ ID NO: 454, SEQ ID NO: 455, SEQ ID NO: 456, ^ SEQ ID
<img file="MX339461B_D0069.tif" />
NO: 457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID NO: 460, SEQ
ID NO: 461 and SEQ ID NO: 462.
As another example, a polynucleotide of the invention can include a polynucleotide that includes a polypeptide referred to herein as SYN2. An embodiment of this polynucleotide is reflected in SEQ ID NO:
463. Variant modalities are reflected in SEQ ID NO:
464, SEQ ID NO: 465, SEQ ID NO: 466, SEQ ID NO: 467, SEQ ID
NO: 468, SEQ ID NO: 469, SEQ ID NO: 470, SEQ ID NO: 471, SEQ
ID NO: 472 and SEQ ID NO: 473.
As another example, a polynucleotide of the invention can include a polynucleotide that encodes a polypeptide commonly known as FhuD. An embodiment of this polynucleotide is reflected in SEQ ID NO: 474. Variant embodiments are reflected in SEQ ID NO: 475, SEQ.
ID NO: 476, SEQ ID NO: 477, SEQ ID NO: 478, SEQ ID NO: 479,
SEQ ID NO: 480, SEQ ID NO: 481, SEQ ID NO: 482, SEQ ID NO:
483 and SEQ ID NO: 484.
As another example, a polynucleotide of the invention can include a polynucleotide that encodes a polypeptide referred to herein as SYN1. An embodiment of this polynucleotide is reflected in SEQ ID NO: 485. Variant embodiments are reflected in
107
SEQ ID NO: 486, SEQ ID NO: 487, SEQ ID NO: 48 | 7 ^ ÉQ'.3 $
489, SEQ ID NO: 490, SEQ ID NO: 491, SEQ ID NO: 492, SEQ'l
NO: 493, SEQ ID NO: 494 and SEQ ID NO: 495. _________
As another example, a polynucleotide of the invention can include a polynucleotide that encodes a polypeptide commonly known as MntC. An embodiment of this polynucleotide is reflected in SEQ ID NO: 496. Variant modalities are reflected in SEQ ID NO: 497, SEQ.
ID NO: 498, SEQ ID NO: 499, SEQ ID NO: 500, SEQ ID NO: 501,
SEQ ID NO: 502, SEQ ID NO: 503, SEQ ID NO: 504, SEQ ID NO:
505 and SEQ ID NO: 506.
As another example, a polynucleotide of the invention may include a polynucleotide that encodes a polypeptide commonly known as ferricrome ABC transporter lipoprotein (SstD). The modalities of this polynucleotide are reflected in SEQ ID NO: 563, SEQ ID
NO: 564, SEQ ID NO: 565, SEQ ID NO: 566, SEQ ID NO: 567, SEQ
ID NO: 568, SEQ ID NO: 569, SEQ ID NO: 570, SEQ ID NO: 571 and
SEQ ID NO: 572.
As another example, a polynucleotide of the invention may include a polynucleotide that encodes a polypeptide commonly known as the ABC transporter of iron compound (FhuD2). The modalities of this polynucleotide are reflected in SEQ ID NO: 573, SEQ ID NO:
574, SEQ ID NO: 575, SEQ ID NO: 576, SEQ ID NO: 577, SEQ ID
108
NO: 578, SEQ ID NO: 579, SEQ ID NO:
ID NO: 582.
<img file="MX339461B_D0070.tif" />
Complete cell preparations of a microbe are also provided in the present invention, wherein the microbe expresses one or more of. the polypeptides of the present invention. The cells present in a whole cell preparation are preferably inactivated so that the cells cannot replicate but the immunological activity of the polypeptides of the present invention expressed by the microbe is maintained. Typically, cells are destroyed by exposure to agents such as glutaraldehyde, formalin, or formaldehyde.
Compositions
A composition of the present invention may include at least one isolated polypeptide described herein or multiple polypeptides that are an integer greater than one (eg, at least two, at least three, at least four). For example, a composition can include an isolated polypeptide that includes the amino acid sequence of SEQ ID NO: 408 and / or an isolated polypeptide that includes the amino acid sequence of SEQ ID NO: 397. Unless a specific level of sequence similarity and / or identity is expressly indicated herein (eg, at least 80% sequence similarity, at least 90% sequence identity, etc.), the reference to
109 similarity of i *** -
<img file="MX339461B_D0071.tif" />
the amino acid sequence of a SEQ ID ÑO i;
includes variants having the sequence levels and / or the sequence identity levels 'Tíé'scrip'tós' herein in the section headed Polypeptide Sequence Similarity and Polypeptide Sequence Identity.
In some embodiments, the composition can include one or more additional isolated polypeptides. In some embodiments, the additional isolated polypeptide or polypeptides can include one or more metal-regulated polypeptides. Thus, a composition can include at least one isolated metal-regulated polypeptide that includes an amino acid sequence shown in one or more of SEQ ID NO: 353 to SEQ ID NO: 429 and / or one or more of SEQ ID NO. : 543 to SEQ ID NO: 562. Additionally or alternatively, a composition may include at least one isolated metal-regulated polypeptide having a molecular weight of 88 kDa, 55 kDa, 38 kDa, 37 kDa, 36 kDa, 3 5 kDa, or 33 kDa. Additionally or alternatively, a composition may include at least one isolated metal-regulated polypeptide that includes an amino acid sequence encoded by a polynucleotide encoding a nucleotide sequence shown in one or more of SEQ ID NO: 430 to SEQ ID. NO: 506 and / or one or more of SEQ ID NO: 563 to SEQ ID NO: 582.
In one embodiment, the composition includes a
110 polypeptide including an amino acid sequence shown by! NS ~ IT! / 7 "l ·. ' · ·: V in SEQ ID NO: 397 (or a variant thereof such as, for example, any of the sequences d "é<sup>m</sup>"S'iffTñQáel'dO'g ^" shown in SEQ ID NO: 398, SEQ ID NO: 399, SEQ ID NO:
400, SEQ ID NO: 401, SEQ ID NO: 402, SEQ ID NO: 403, SEQ ID
NO: 404, SEQ ID NO: 405, SEQ ID NO: 406 OR SEQ ID NO: 407).
In another embodiment, the composition includes a polypeptide that includes an amino acid sequence shown in SEQ ID NO: 408 (or a variant thereof such as, for example, any of the amino acid sequences shown in SEQ ID NO: 409 , SEQ ID NO: 410, SEQ ID NO:
411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID
NO: 415, SEQ ID NO: 416, SEQ ID NO: 417 or SEQ ID NO: 418).
In another embodiment, the composition includes a polypeptide that includes an amino acid sequence shown in SEQ ID NO: 419 (or a variant thereof such as,
<img file="MX339461B_D0072.tif" />
<td>by</td><td>example,</td><td>any of</td><td>the sequences</td><td>of</td><td>amino acids</td>
<td colspan="2">shown in</td><td>SEQ ID NO:</td><td>420, SEQ ID NO:</td><td> 421</td><td>, SEQ ID NO:</td>
<td> 422,</td><td>SEQ ID</td><td>NO: 423, SEQ ID</td><td>NO: 424, SEQ ID</td><td>NO:</td><td>425, SEQ ID</td>
<td>NO:</td><td>426, SEQ</td><td>ID NO: 427, SEQ</td><td>ID NO: 428 or SEQ</td><td>ID</td><td>NO: 429).</td>
<td></td><td>In</td><td colspan="3">another modality, the composition</td><td>includes a</td>
polypeptide including an amino acid sequence shown in SEQ ID NO: 375 (or a variant thereof such as, for example, any of the amino acid sequences shown in SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO:
111
378
NO:
SEQ ID NO: 379, SEQ ID NO
382, SEQ ID NO: 383, SEQ ID
380, SEQ ID NO: 1 381, EQ 1ID. NO: 384 or SEQ ID NO: 385}.
<img file="MX339461B_D0073.tif" />
In another embodiment, the compos ici oft ^ - ^ d.-neluye ·· polypeptide including an amino acid sequence shown in SEQ ID NO: 3 86 (or a variant thereof, such as, for example, any of the amino acid sequences shown in SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO:
389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID
NO: 393, SEQ ID NO: 394, SEQ ID NO: 395 OR SEQ ID NO: 396).
In another embodiment, the composition includes a polypeptide that includes an amino acid sequence shown in SEQ ID NO: 364 (or a variant thereof such as, for example, any of the amino acid sequences shown in SEQ ID NO: 365 , SEQ ID NO: 366, SEQ ID NO:
367, SEQ ID NO: 368, SEQ ID NO: 369, SEQ ID NO: 370, SEQ ID
NO: 371, SEQ ID NO: 372, SEQ ID NO: 373 or SEQ ID NO: 374).
In another embodiment, the composition includes a polypeptide that includes an amino acid sequence shown in SEQ ID NO: 353 (or a variant thereof such as,
<td>by</td><td>example,</td><td>any of</td><td>the sequences</td><td>of</td><td>amino acids</td>
<td colspan="2">shown in</td><td>SEQ ID NO:</td><td>354, SEQ ID NO:</td><td> 355 ,</td><td>SEQ ID NO:</td>
<td> 356,</td><td>SEQ ID</td><td>NO: 357, SEQ ID</td><td>NO: 358, SEQ ID</td><td>NO:</td><td>359, SEQ ID</td>
<td>NO:</td><td>360, SEQ</td><td>ID NO: 361, SEQ</td><td>ID NO: 362 or SEQ</td><td colspan="2">ID NO: 363).</td>
<td></td><td>In</td><td colspan="3">another modality, the composition</td><td>includes a</td>
polypeptide that includes an amino acid sequence or a
112 variant of it from any of the
3. 2 V..ÍL Ji / 'dé'
INS amino acids shown in SEQ ID NO: 54 3, 'SEQ ID NO:, 544,
SEQ ID NO: 545, SEQ ID NO: 546, SEQ ID NO: 547, SEQ ID NO:
548, SEQ ID NO: 549, SEQ ID NO: 550, SEQ ID NO: 551 or SEQ ID
NO: 552.
In another embodiment, the composition includes a polypeptide that includes an amino acid sequence, or variant thereof, of any of the amino acid sequences shown in SEQ ID NO: 553, SEQ ID NO: 554,
SEQ ID NO: 555, SEQ ID NO: 556, SEQ ID NO: 557, SEQ ID NO:
558, SEQ ID NO: 559, SEQ ID NO: 560, SEQ ID NO: 561 or SEQ ID
NO: 562.
In some embodiments, the composition may include a combination of two or more polypeptides that are selected from the following: a polypeptide is SYN1, a MntC polypeptide, a FhuD polypeptide, a SYN2 polypeptide, a SirA polypeptide, an OpplA polypeptide, and a polypeptide.
PflB.
Thus, the composition can include at least one or any combination that includes at least two, at least three, at least four, at least five, at least six, or at least seven of: a polypeptide SYN1, an MntC polypeptide, a FhuD polypeptide, a SYN2 polypeptide, a SirA polypeptide, an OpplA polypeptide, and a PflB polypeptide. The exemplary compositions that
113 ti include combinations of the polypeptides you identify:; §n
<img file="MX339461B_D0074.tif" />
table 6.
<td>Composition</td><td>SYN1</td><td>MntC</td><td>FhuD</td><td>SYN2</td><td>SirA</td><td>OpplA</td><td>Pflb</td>
<td>2 peptides *</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 1</td><td>X</td><td>X</td><td></td><td></td><td></td><td></td><td></td>
<td> 2</td><td>X</td><td></td><td>X</td><td></td><td></td><td></td><td></td>
<td> 3</td><td>X</td><td></td><td></td><td>X</td><td></td><td></td><td></td>
<td> 4</td><td>X</td><td></td><td></td><td></td><td>X</td><td></td><td></td>
<td> 5</td><td>X</td><td></td><td></td><td></td><td></td><td>X</td><td></td>
<td> 6</td><td>X</td><td></td><td></td><td></td><td></td><td></td><td>X</td>
<td> 7</td><td></td><td>X</td><td>X</td><td></td><td></td><td></td><td></td>
<td> 8</td><td></td><td>X</td><td></td><td>X</td><td></td><td></td><td></td>
<td> 9</td><td></td><td>X</td><td></td><td></td><td>X</td><td></td><td></td>
<td> 10</td><td></td><td>X</td><td></td><td></td><td></td><td>X</td><td></td>
<td> 11</td><td></td><td>X</td><td></td><td></td><td></td><td></td><td>X</td>
<td> 12</td><td></td><td></td><td>X</td><td>X</td><td></td><td></td><td></td>
<td> 13</td><td></td><td></td><td>X</td><td></td><td>X</td><td></td><td></td>
<td> 14</td><td></td><td></td><td>X</td><td></td><td></td><td>X</td><td></td>
<td> 15</td><td></td><td></td><td>X</td><td></td><td></td><td></td><td>X</td>
<td> 16</td><td></td><td></td><td></td><td>X</td><td>X</td><td></td><td></td>
<td> 17</td><td></td><td></td><td></td><td>X</td><td></td><td>X</td><td></td>
<td> 18</td><td></td><td></td><td></td><td>X</td><td></td><td></td><td>X</td>
<td> 19</td><td></td><td></td><td></td><td></td><td>X</td><td>X</td><td></td>
<td> 20</td><td></td><td></td><td></td><td></td><td>X</td><td></td><td>X</td>
<td> 21</td><td></td><td></td><td></td><td></td><td></td><td>X</td><td>X</td>
<td>3 peptides *</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 22</td><td>X</td><td>X</td><td>X</td><td></td><td></td><td></td><td></td>
<td> 23</td><td>X</td><td>X</td><td></td><td>X</td><td></td><td></td><td></td>
114
<img file="MX339461B_D0075.tif" />
<td rowspan="2"> 24</td><td rowspan="2">X</td><td rowspan="2">X</td><td rowspan="2"></td><td rowspan="2"></td><td rowspan="2">X</td><td rowspan="2">π ikst; -</td><td>vi r jí</td>
<td> ; - <sup>1</sup> and ../ · K,</td>
<td> 25</td><td>X</td><td>X</td><td></td><td></td><td></td><td>X</td><td></td>
<td> 26</td><td>X</td><td>X</td><td></td><td></td><td></td><td></td><td>X</td>
<td> 27</td><td>X</td><td></td><td>X</td><td>X</td><td></td><td></td><td></td>
<td> 28</td><td>X</td><td></td><td>X</td><td></td><td>X</td><td></td><td></td>
<td> 29</td><td>X</td><td></td><td>X</td><td></td><td></td><td>X</td><td></td>
<td> 30</td><td>X</td><td></td><td>X</td><td></td><td></td><td></td><td>X</td>
<td> 31</td><td>X</td><td></td><td></td><td>X</td><td>X</td><td></td><td></td>
<td> 32</td><td>X</td><td></td><td></td><td>X</td><td></td><td>X</td><td></td>
<td> 33</td><td>X</td><td></td><td></td><td>X</td><td></td><td></td><td>X</td>
<td> 34</td><td>X</td><td></td><td></td><td></td><td>X</td><td>X</td><td></td>
<td> 35</td><td>X</td><td></td><td></td><td></td><td>X</td><td></td><td>X</td>
<td> 36</td><td>X</td><td></td><td></td><td></td><td></td><td>X</td><td>X</td>
<td> 37</td><td></td><td>X</td><td>X</td><td>X</td><td></td><td></td><td></td>
<td> 38</td><td></td><td>X</td><td>X</td><td></td><td>X</td><td></td><td></td>
<td> 39</td><td></td><td>X</td><td>X</td><td></td><td></td><td>X</td><td></td>
<td> 40</td><td></td><td>X</td><td>X</td><td></td><td></td><td></td><td>X</td>
<td> 41</td><td></td><td>X</td><td></td><td>X</td><td>X</td><td></td><td></td>
<td> 42</td><td></td><td>X</td><td></td><td>X</td><td></td><td>X</td><td></td>
<td> 43</td><td></td><td>X</td><td></td><td>X</td><td></td><td></td><td>X</td>
<td> 44</td><td></td><td>X</td><td></td><td></td><td>X</td><td>X</td><td></td>
<td> 45</td><td></td><td>X</td><td></td><td></td><td>X</td><td></td><td>X</td>
<td> 46</td><td></td><td>X</td><td></td><td></td><td></td><td>X</td><td>X</td>
<td> 47</td><td></td><td></td><td>X</td><td>X</td><td>X</td><td></td><td></td>
<td> 48</td><td></td><td></td><td>X</td><td>X</td><td></td><td>X</td><td></td>
<td> 49</td><td></td><td></td><td>X</td><td>X</td><td></td><td></td><td>X</td>
<td> 50</td><td></td><td></td><td>X</td><td></td><td>X</td><td>X</td><td></td>
<td> 51</td><td></td><td></td><td>X</td><td></td><td>X</td><td></td><td>X</td>
<td> 52</td><td></td><td></td><td>X</td><td></td><td></td><td>X</td><td>X</td>
<td> 53</td><td></td><td></td><td></td><td>X</td><td>X</td><td>X</td><td></td>
115
<img file="MX339461B_D0076.tif" />
<td> 54</td><td></td><td></td><td></td><td>X</td><td>X</td><td>ΙΝΤΤ</td><td></td>
<td> 55</td><td></td><td></td><td></td><td>X</td><td></td><td>X</td><td><sup>1</sup> X</td>
<td> 56</td><td></td><td></td><td></td><td></td><td>X</td><td>X</td><td>X</td>
<td>4 peptides</td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td></td><td></td>
<td> 57</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td></td><td></td>
<td> 58</td><td>X</td><td>X</td><td>X</td><td></td><td></td><td>X</td><td></td>
<td> 59</td><td>X</td><td>X</td><td>X</td><td></td><td></td><td></td><td>X</td>
<td> 60</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td></td><td></td>
<td> 61</td><td>X</td><td>X</td><td></td><td>X</td><td></td><td>X</td><td></td>
<td> 62</td><td>X</td><td>X</td><td></td><td>X</td><td></td><td></td><td>X</td>
<td> 63</td><td>X</td><td>X</td><td></td><td></td><td>X</td><td></td><td></td>
<td> 64</td><td>X</td><td>X</td><td></td><td></td><td>X</td><td>X</td><td></td>
<td> 65</td><td>X</td><td>X</td><td></td><td></td><td>X</td><td></td><td>X</td>
<td> 67</td><td>X</td><td>X</td><td></td><td></td><td></td><td>X</td><td>X</td>
<td> 68</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td></td><td></td>
<td> 69</td><td>X</td><td></td><td>X</td><td>X</td><td></td><td>X</td><td></td>
<td> 70</td><td>X</td><td></td><td>X</td><td>X</td><td></td><td></td><td>X</td>
<td> 71</td><td>X</td><td></td><td>X</td><td></td><td>X</td><td>X</td><td></td>
<td> 72</td><td>X</td><td></td><td>X</td><td></td><td>X</td><td></td><td>X</td>
<td> 73</td><td>X</td><td></td><td>X</td><td></td><td></td><td>X</td><td>X</td>
<td> 74</td><td>X</td><td></td><td></td><td>X</td><td>X</td><td>X</td><td></td>
<td> 75</td><td>X</td><td></td><td></td><td>X</td><td>X</td><td></td><td>X</td>
<td> 76</td><td>X</td><td></td><td></td><td></td><td>X</td><td>X</td><td>X</td>
<td> 77</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td></td>
<td> 78</td><td></td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td></td>
<td> 79</td><td></td><td>X</td><td>X</td><td>X</td><td></td><td></td><td>X</td>
<td> 80</td><td></td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td></td>
<td> 81</td><td></td><td>X</td><td>X</td><td></td><td>X</td><td></td><td>X</td>
<td> 82</td><td></td><td>X</td><td>X</td><td></td><td></td><td>X</td><td>X</td>
<td> 83</td><td></td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td></td>
116
<img file="MX339461B_D0077.tif" />
<td> 84</td><td></td><td>X</td><td></td><td>X</td><td>X</td><td><sup>1</sup></td><td>Ί · <sup>X</sup> I;</td>
<td> 85</td><td></td><td>X</td><td></td><td>X</td><td></td><td>Xstit'ú '</td><td>/ X ·· 1</td>
<td> 86</td><td></td><td>X</td><td></td><td></td><td>X</td><td>X</td><td>X</td>
<td> 87</td><td></td><td></td><td>X</td><td>X</td><td>X</td><td></td><td></td>
<td> 88</td><td></td><td></td><td>X</td><td>X</td><td>X</td><td></td><td>X</td>
<td> 89</td><td></td><td></td><td>X</td><td>X</td><td></td><td>X</td><td>X</td>
<td> 90</td><td></td><td></td><td>X</td><td></td><td>X</td><td>X</td><td>X</td>
<td> 91</td><td></td><td></td><td></td><td>X</td><td>X</td><td>X</td><td>X</td>
<td>5 peptides *</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 92</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td></td>
<td> 93</td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td></td>
<td> 94</td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td></td><td>X</td>
<td> 95</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td></td>
<td> 96</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td></td><td>X</td>
<td> 97</td><td>X</td><td>X</td><td>X</td><td></td><td></td><td>X</td><td>X</td>
<td> 98</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td></td>
<td> 99</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td></td><td>X</td>
<td> 100</td><td>X</td><td>X</td><td></td><td>X</td><td></td><td>X</td><td>X</td>
<td> 101</td><td>X</td><td>X</td><td></td><td></td><td>X</td><td>X</td><td>X</td>
<td> 102</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td></td>
<td> 103</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td></td><td>X</td>
<td> 104</td><td>X</td><td></td><td>X</td><td>X</td><td></td><td>X</td><td>X</td>
<td> 105</td><td>X</td><td></td><td>X</td><td></td><td>X</td><td>X</td><td>X</td>
<td> 106</td><td>X</td><td></td><td></td><td>X</td><td>X</td><td>X</td><td>X</td>
<td> 107</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td></td>
<td> 108</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td>
<td> 109</td><td></td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td>
<td> 110</td><td></td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td>
<td> 111</td><td></td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td>
<td> 112</td><td></td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td>
117
<td>6 peptides *</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 113</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td>l my</td><td></td>
<td> 114</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X.</td><td>Of</td><td>X ·.</td>
<td> 115</td><td>X</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td>
<td> 116</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td>
<td> 117</td><td>X</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td>
<td> 118</td><td>X</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td>
<td> 119</td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td>
* pPeptides = polypeptides
X identifies polypeptides included in a particular composition.
In this description, a SYN1 polypeptide can be characterized by one or more of the following: an amino acid sequence that includes the amino acid sequence shown in any of SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID
NO: 410, SEQ ID NO: 411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ
ID NO: 414, SEQ ID NO: 415, SEQ ID NO: 416, SEQ ID NO: 417 or
SEQ ID NO: 418, which is encoded by a polynucleotide that
<td>It includes</td><td>a</td><td>sequence</td><td>of</td><td>acid</td><td>nucleic</td><td>displayed</td><td>in</td>
<td colspan="2">any of</td><td>the SEQ ID</td><td>NO:</td><td>485, SEQ</td><td colspan="2">ID NO: 486, SEQ ID</td><td>NO:</td>
<td>487, SEQ</td><td colspan="2">ID NO: 488, SEQ</td><td>ID</td><td>NO: 489,</td><td>SEQ ID NO:</td><td>490, SEQ</td><td>ID</td>
<td>NO: 491,</td><td>I KNOW THAT</td><td>ID NO: 492,</td><td>I KNOW THAT</td><td colspan="2">ID NO: 493, SEQ ID</td><td>NO: 494,</td><td>I KNOW THAT</td>
ID NO: 495 and / or a calculated molecular weight of approximately
33.1 kDa.
In this description, an MntC polypeptide can be characterized by one or more of the following: having a weight
118
<img file="MX339461B_D0078.tif" />
Molecular, determined by SDS-PAGE of 33 kDa fingerprint mass of at least 80% similar to the fingerprint mass of a regulated polypeptide
<img file="MX339461B_D0079.tif" />
kDA produced by the reference strain S. aureus ATCC isolated 19636, an amino acid sequence that includes the amino acid sequence shown in any of SEQ ID
NO: 419, SEQ ID NO: 420, SEQ ID NO: 421, SEQ ID NO: 422, SEQ
ID NO: 423, SEQ ID NO: 424, SEQ ID NO: 425, SEQ ID NO: 426,
SEQ ID NO: 427, SEQ ID NO: 428, or SEQ ID NO: 429, which is encoded by a polynucleotide including a nucleic acid sequence shown in any of SEQ ID NO: 496,
SEQ ID NO: 497, SEQ ID NO: 498, SEQ ID NO: 499, SEQ ID NO:
500, SEQ ID NO: 501, SEQ ID NO: 502, SEQ ID NO: 503, SEQ ID
NO: 504, SEQ ID NO: 505, SEQ ID NO: 506 and / or a calculated molecular weight of approximately 34.6 kDa.
In this description, a FhuD polypeptide can be characterized by one or more of the following: an amino acid sequence that includes the amino acid sequence shown in any of SEQ ID NO: 3 97, SEQ ID NO: 398, SEQ ID
NO: 399, SEQ ID NO: 400, SEQ ID NO: 401, SEQ ID NO: 402, SEQ
ID NO: 403, SEQ ID NO: 404, SEQ ID NO: 405, SEQ ID NO: 406 or
SEQ ID NO: 407, which is encoded by a polynucleotide that includes the nucleic acid sequence shown in any of SEQ ID NO: 474, SEQ ID NO: 475, SEQ ID NO: 476, SEQ ID
NO: 477, SEQ ID NO: 478, SEQ ID NO: 479, SEQ ID NO: 480, SEQ
119
ID NO: 481, SEQ ID NO: 482, SEQ ID NO: 483 ,. Yes inst; ·· .. · i '' '· and / or a calculated molecular weight of approximately 35.4 kDa .'— In this description, a polypeptide is-- · characterized by one or more of the following: a molecular weight, determined by 36 kDa SDS-PAGE, a mass fingerprint of at least 80% similar to the mass fingerprint of a 36 kDa metal-regulated polypeptide produced by reference strain S. isolated ATCC aureus 19636, an amino acid sequence that includes the amino acid sequence shown in any of SEQ ID
NO: 386, SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO: 389, SEQ
ID NO: 390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID NO: 393,
SEQ ID NO: 394, SEQ ID NO: 395 or SEQ ID NO: 396, which is encoded by a polynucleotide that includes the nucleic acid sequence shown in any of SEQ ID NO: 463,
SEQ ID NO: 464, SEQ ID NO: 465, SEQ ID NO: 466, SEQ ID NO:
467, SEQ ID NO: 468, SEQ ID NO: 469, SEQ ID NO: 470, SEQ ID
NO: 471, SEQ ID NO: 472, SEQ ID NO: 473 and / or a calculated molecular weight of approximately 36.5 kDa.
In this description, a SirA polypeptide can be characterized by one or more of the following: a molecular weight determined by SDS-PAGE of 37 kDa, a mass fingerprint of at least 80% similar to the mass fingerprint of a 37 kDa metal-regulated polypeptide produced by the reference strain S. aureus ATCC
120 ί 'Τ Τ \ V VI V / VV isolated 19636, an amino acid sequence; quíg £ - | aLc | tiy ^ ·, '· \
I: ...,.
amino acid sequence shown in any of SEQ ID
NO: 375, SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO: 3T8 ·; —SBQ '
ID NO: 379, SEQ ID NO: 380, SEQ ID NO: 381, SEQ ID NO: 382,
SEQ ID NO: 383, SEQ ID NO: 384, or SEQ ID NO: 385, which is encoded by a polynucleotide that includes the nucleic acid sequence shown in any of SEQ ID NO: 452,
SEQ ID NO: 453, SEQ ID NO: 454, SEQ ID NO: 455, SEQ ID NO:
456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID
NO: 460, SEQ ID NO: 461, SEQ ID NO: 462 and / or a calculated molecular weight of approximately 36.6 kDa.
In this description, an OpplA polypeptide can be characterized by one or more of the following: a molecular weight, determined by SDS-PAGE of 55 kDa, a mass fingerprint of at least 80% similar to the mass fingerprint of a 55 kDa metal-regulated polypeptide produced by the reference strain S. aureus ATCC isolated 19636, an amino acid sequence that includes the amino acid sequence shown in any of SEQ ID
NO: 364, SEQ ID NO: 365, SEQ ID NO: 366, SEQ ID NO: 367, SEQ
ID NO: 368, SEQ ID NO: 369, SEQ ID NO: 370, SEQ ID NO: 371,
SEQ ID NO: 372, SEQ ID NO: 373, or SEQ ID NO: 374, which is encoded by a polynucleotide that includes the nucleic acid sequence shown in any of SEQ ID NO: 4441
SEQ ID NO: 442, SEQ ID NO: 443 SEQ ID NO: 444, SEQ ID NO:
121
NO: 447, SEQ ID NO: J páíjj, <¿D .νΛ. ''
INSTITI
ID NO: 451 and / or uri 'molecular weight
59.9 kDa. __
445, SEQ ID NO: 446, SEQ ID
NO: 449, SEQ ID NO: 450, SEQ calculated from approximately
In this description, a PflB polypeptide can be characterized by one or more of the following: a molecular weight, determined by SDS-PAGE of 88 kDa, a mass fingerprint of at least 80% similar to the mass fingerprint of an 88 kDa metal-regulated polypeptide produced by the reference strain S. aureus ATCC isolated 19636, an amino acid sequence that includes the amino acid sequence shown in any of SEQ ID
NO: 353, SEQ ID NO: 354, SEQ ID NO: 355, SEQ ID NO: 356, SEQ
ID NO: 357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360,
SEQ ID NO: 361, SEQ ID NO: 362 or SEQ ID NO: 363, which is encoded by a polynucleotide that includes the nucleic acid sequence shown in any of SEQ ID NO: 430,
SEQ ID NO: 431, SEQ ID NO: 432, SEQ ID NO: 433, SEQ ID NO:
434, SEQ ID NO: 435, SEQ ID NO: 436, SEQ ID NO: 437, SEQ ID
NO: 438, SEQ ID NO: 439, SEQ ID NO: 440 and / or a calculated molecular weight of approximately 84.7 kDa.
In another particular embodiment, the composition can include a combination of polypeptides such as, for example, an MntC polypeptide, a FhuD polypeptide, a SirA polypeptide, and a SYN2 polypeptide (composition 77 in Table 6), each polypeptide is characterized as
122 describe immediately before.
<img file="MX339461B_D0080.tif" />
INSTiru '. Saw,
In some embodiments, a composition / may include one or more polypeptides that are produced from the recombinant Mars. For example, a composition can include a recombinantly produced PflB polypeptide such as, for example, a polypeptide that includes the amino acid sequence shown in SEQ ID NO: 353, although a recombinantly produced PflB polypeptide can be characterized in any manner in which a PflB polypeptide can be characterized, as described above, in addition to being recombinantly produced. This composition may include one or more recombinantly produced polypeptides, one or more isolated S. aureus polypeptides, or any combination thereof.
<img file="MX339461B_D0081.tif" />
As another example, a composition can include a recombinantly produced OpplA polypeptide such as, for example, a polypeptide that includes the amino acid sequence shown in SEQ ID NO: 364, although a reco mbinantly p roduced OpplA polypeptide can be characterized as any manner in which the OpplA polypeptide can be characterized, as described above, in addition to being recombinantly produced. The composition may further include one or more recombinantly produced polypeptides, one or more isolated S. aureus polypeptides, or any combination thereof.
123
As another example, a composition can <^ J ^ fi; uir un instituto m'- '· t;'
Dt The '* recombinantly produced SirA polypeptide such as ^ eOmo'and for example a polypeptide including the - »ee« ae »eá? A»' - of 'amino acids shown in SEQ ID NO: 375, although a polypep Recombinantly produced SirA can be characterized in any way in which the SirA polypeptide can be characterized, as described above, in addition to being recombinantly produced. The composition may further include one or more recombinantly produced polypeptides, one or more isolated S. aureus polypeptides, or any combination thereof.
As another example, a composition can include a recombinantly produced SYN2 polypeptide such as, for example, a polypeptide that includes the amino acid sequence shown in SEQ ID NO: 386, although a recombinantly produced SYN2 polypeptide can be characterized as any way in which the SYN2 polypeptide can be characterized, as described above, in addition to being recombinantly produced. The composition may further include one or more recombinantly produced polypeptides, one or more isolated S. aureus polypeptides, or any combination thereof.
As another example, a composition may include a recombinantly produced FhuD polypeptide such as, for example, a polypeptide that includes the sequence of
124 amino acids shown in SEQ ID NO: 3 97 j [JÜhuL.c | ueí.
'«N
INSTITUTE
DL La! '·. <:' 7 J Recombinantly produced FhuD polypeptide can be characterized in any way in which 'βΓ' ρ'οΙΤρβρΈϊΠδ FhuD can be characterized, as described above, in addition to being produced recombinant. The composition may further include one or more recombinantly produced polypeptides, one or more isolated S. aureus polypeptides, or any combination thereof.
As another example, a composition can include a recombinantly produced SYN1 polypeptide such as, for example, a polypeptide that includes the amino acid sequence shown in SEQ ID NO: 408, although a recombinantly produced SYN1 polypeptide can be characterized as any way in which the SYN1 polypeptide can be characterized, as described above, in addition to being recombinantly produced. The composition may further include one or more recombinantly produced polypeptides, one or more isolated S. aureus polypeptides, or any combination thereof.
As another example, a composition can include a recombinantly produced MntC polypeptide such as, for example, a polypeptide that includes the amino acid sequence shown in SEQ ID NO: 419, although the recombinantly produced MntC polypeptide can be characterized as any way in which the polypeptide
125 descJklU / A ¿n · * · ío- '·' '' 7
INSTii ·. '. ·. '-'i
GAVE. THE ; "Uu;<sup>7</sup> :; '' recombinant. The more polypeptides the more DolioéDtidos
MntC can be characterized, as above, in addition to being produced compositionally it may further include one or recombinantly produced, one or isolates of S. aureus or any combination thereof.
In some embodiments, a recombinantly produced polypeptide can represent an immunologically active fragment of the original version of the polypeptide. An immunologically active fragment may include amino acid additions to the amino terminal and / or carboxy terminal part of the nucleus (for example, the amino acid sequence of SEQ ID NO: 353, SEQ ID NO: 364, SEQ ID NO:
375, SEQ ID NO: 386, SEQ ID NO: 397, SEQ ID NO: 408 or SEQ ID
NO: 419) of the immunologically active fragment. In some embodiments, any addition to the amino terminal part of the nucleus of the immunologically active fragment may include one or more additions, deletions, or substitutions (collectively referred to as modifications) of amino acids or any combination of modifications compared to a larger version - for example natural or other native form of the polypeptide. Thus, for example, in embodiments in which the immunologically active fragment includes SEQ ID NO: 397, addition to the amino terminal part of SEQ ID NO: 397 may include at least 1, at least 2, so minus 3, at least 4, at least 5, at least
126
6, at least 7, at least 8, at least <jsj ^ ifj 5 ° ½
<td>minus 10,</td><td>by</td><td>least</td><td>11 so</td><td>less</td><td> 12,</td><td>DELA ··· il · ·· - ·? so we have 13 7 ~</td>
<td colspan="2">at least</td><td>14 for</td><td>at least 15</td><td>, by</td><td>the</td><td>menoe ~ -i6v - by'-io '' '·</td>
<td>minus 17,</td><td>by</td><td>least</td><td>18 so</td><td>less</td><td> 19,</td><td>at least 20,</td>
<td colspan="2">at least</td><td>21, for.</td><td>least 22</td><td>, by</td><td>the</td><td>minus 23 so</td>
<td>minus 24,</td><td>by</td><td>least</td><td>25 or so</td><td>less</td><td> 26</td><td>modifications in</td>
amino terminal addition compared, for example, to amino acids 1-26 of SEQ ID NO: 399. As another example, in embodiments in which the immunologically active fragment includes SEQ ID NO: 408; An addition of the amino terminal part of SEQ ID NO: 408 may include at least 1, at least 2, at least 3, at least 4, or at least 5 modifications in the amino terminal addition in comparison, for example, with amino acids 1-26 of SEQ
ID NO: 415.
When comparing the amino acid sequence similarity and / or the amino acid sequence identity of a reference polypeptide and a candidate polypeptide of a different length (eg, an immunologically active fragment of the reference polypeptide), the similarity and / or identity they can be calculated over the full length of the largest polypeptide, by counting each longest amino acid residue in the longest contributing polypeptide as a mismatch.
Therefore, in some modalities, a
127
<img file="MX339461B_D0082.tif" />
Isolated polypeptide of the invention can ui-t d a polypeptide having at least 92%, at least * 93%, pcfr * »-
<img file="MX339461B_D0083.tif" />
at least 94%, at least 95%, so m
<img file="MX339461B_D0084.tif" />
less than 97%, at least 98% or at least 99% sequence similarity and / or identity with the amino acid sequence of SEQ ID NO: 397, provided that if the isolated polypeptide includes one or more additional amino acids in the amino terminal part, one or more additional amino acids include at least one amino acid deletion or at least one amino acid substitution compared to amino acids
1-26 of SEQ ID NO: 399.
In other embodiments, an isolated polypeptide of the invention may include a polypeptide having at least 98% or at least 99% and / or sequence identity with the amino acid sequence of SEQ ID NO: 4 08, with the proviso that if the isolated polypeptide includes one or more additional amino acids in the amino terminal part, one or more additional amino acids include at least one amino acid deletion or at least one amino acid substitution compared to amino acids 1 -5 of SEQ ID NO: 415.
As indicated in the foregoing in the headed selection such as polypeptide sequence similarity and polypeptide sequence identity, a polypeptide identified with reference to the amino acid sequence of a particular SEQ ID NO: may include a polypeptide with
128
i.
<img file="MX339461B_D0085.tif" />
75%, so try us for "ltf''TTfgnós 8'7%, minus 90%, so
93%, at least at least 97%, at least 50%, at least 55%, at least 65%, at least 70%, at least
80%, at least 85%, at least 86%, at least 88%, at least 89%, at least 91%, at least 92%, at least 94%, at least 95% , at least 96%, at least 98%, or at least 99% amino acid sequence similarity to the reference amino acid sequence (eg, the amino acid sequence provided in SEQ ID NO: specified) and / or a polypeptide with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least minus 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity with the reference amino acid sequence (for example the amino acid sequence provided in a
SEQ ID NO: specified).
A recombinantly produced polypeptide can be expressed from a vector that allows expression of the polypeptide when the vector is introduced into an appropriate host cell. A host cell can be constructed to produce one or more produced polypeptides
129 Recombinantly of the invention and therefore -s'úaiTtqfy \ 1Iva include one or more vectors that includes por'iln, polynucleotide that encodes a polypeptide of the invention. In this way, each vector can include one or more polynucleotides of the invention - that is, a polynucleotide that encodes a polypeptide of the invention.
Some compositions such as, for example, those that include recombinantly produced polypeptides can include a maximum number of polypeptides. In some embodiments, the maximum number of polypeptides can refer to the maximum total number of polypeptides. For example, some compositions may include a maximum of 50 polypeptides such as, for example, a maximum of 40 polypeptides, a maximum of 30 polypeptides, a maximum of 25 polypeptides, a maximum of 20 polypeptides, a maximum of 15 polypeptides, a maximum of 10 polypeptides, a maximum of eight polypeptides, a maximum of seven polypeptides, a maximum of six polypeptides, a maximum of five polypeptides, a maximum of four polypeptides, a maximum of three polypeptides, a maximum of two polypeptides or a maximum of one polypeptide. In other embodiments, a maximum number of recombinantly produced polypeptides can be specified in a similar way. In still other embodiments, the maximum number of non-recombinantly produced polypeptides
ΛΑ
- " 'OR
130 it can be specified in a similar way.
A composition can include ^
<img file="MX339461B_D0086.tif" />
Ui. THE IBAI? v + 4V * pol ip'épfc'i-doS '· can be isolated from a microbe or it can be isolated
<img file="MX339461B_D0087.tif" />
a combination of two or more microbes. For example, a composition may include agalable polypeptides of two or more Staphylococcus spp., Or Staphylococcus spp., And a different microbe that is not a member of the genus Staphylococcus. The present invention also provides compositions that include a complete cellular preparation, wherein the complete cell expresses one or more of the polypeptides of the present invention. For example, the whole cell may be Staphylococcus spp. In some respects, a composition may include complete preparations of two, three, four, five, or six strains.
Optionally, a polypeptide of the present invention can be covalently linked or conjugated to a carrier polypeptide to enhance the immunological properties of the polypeptide. Useful carrier polypeptides are known in the art. The chemical coupling of the polypeptides of the present invention can be carried out using known and systematic methods. For example, various homobifunctional and / or heterobifunctional crosslinking reagents such as bis (sulfosuccinimidyl) suberate, bis (diazobenzidine), dimethyl adipimidate, dimethyl pimelimidate, dimethyl superimidate, suberate
131 ~ disuccinimidyl hydroxysuccinimide aiPMUMWIMi glutaraldehy
<img file="MX339461B_D0088.tif" />
crcíohexarrcT-i;
4- (N-maleimidomethyl), 4- (p-maleimido-phenyl) sulfosuccinimidyl butyrate, and (l-ethyl-3- (dimethylaminopropyl) carbodiimide hydroxysuccinimide can be used (see, for example, Harlow and Lañe, Antibodies , A Laboratory Manual, generally and Chapter 5, Coid Spring Harbor Laboratory, Coid Spring Harbor, New York, NY (1988)).
The compositions of the present invention optionally additionally include a pharmaceutically acceptable carrier. Pharmaceutically acceptable refers to a diluent, carrier, excipient, salt, etc., that is compatible with the other ingredients of the composition and is not harmful to the recipient. Typically, the composition includes a pharmaceutically acceptable carrier when the composition is used as described herein. The compositions of the present invention can be formulated into pharmaceutical preparations in a variety of forms adapted to the selected route of administration including suitable routes to stimulate an immune response to an antigen. Thus, a composition of the present invention can be administered by means of known routes including, for example, oral; parenteral including intradermal, transcutaneous and
132 subcutaneous; intramuscular, intravenous, intraAejp / Í <¿e ^ l ^ 'INSTITUTO i<sup><Γν ,,</sup>~ ΛΝΟ CE L \ <sup>r</sup> - u>
etc., and topically such as intranasal, intrapuTmorí.á'r, intramammary, intravaginal, intrauterine, transcutaneous and rectal TntTádé rirri'ca, etc. It is anticipated that a composition can be administered to a mucosal surface eg by administration to the nasal or respiratory mucosa (eg via a spray or aerosol), in order to stimulate mucosal immunity, eg by antibody production IgA secretors, through the body of the animal.
A composition of the present invention can also be administered by means of a delayed or sustained release implant. Implants suitable for use in accordance with the invention are known and include, for example, those described in Emery and Straub (WO 01/37810 (2001)), and Emery et al., (WO 96/01620 (1996)). Implants can be produced in sizes small enough to be administered by aerosol or spray. Implants can also include nanospheres and microspheres.
A composition of the present invention can be administered in an amount sufficient to treat certain conditions as described herein. The amount of polypeptides or whole cells present in a composition of the present invention can vary. For example, the dosage of polypeptides can be between 0.01 micrograms (gg) and 300 mg, usually between 0.1 mg and
133 bacteria / ml, bacteria / ml, mg. When the composition is a preparation ^^ ¿celluláá:
PE l. '. \ '
INUUJ:! «·.!. '* complete, cells may be present in for example one of 10<sup>4</sup> bacteria / ml,
10<sup>7</sup> bacteria / ml, concentration,
10<sup>3</sup> bacteria / ml, 10<sup>6</sup> bacteria / ml,
1010 'bacteria / ml,
10<sup>9</sup>bacteria / ml. For an injectable composition (eg, subcutaneous, intramuscular, etc.), the polypeptides may be present in the composition in an amount such that the total volume of the composition administered is 0.5 ml to 5.0 ml, typically 1.0 to 2.0 ml. When the composition is a whole cell preparation, cells are preferably present in the composition in an amount such that the total volume of the administered composition is 0.5 ml to 5.0 ml, typically 1.0 to 2.0 ml. The amount administered will vary based on various factors including, but not limited to, the specific polypeptides selected, the weight, physical condition, and age of the animal and the route of administration. Thus, the absolute weight of the polypeptide included in a given unit dosage form can vary widely and depends on factors such as the species, age, weight, and physical condition of the animal as well as the method of administration. These factors can be determined by a person skilled in the field. Other examples of dosages suitable for the invention are described in Emery et al., (US patent
134
6,027,736).
<img file="MX339461B_D0089.tif" />
The formulations can be ^ '' ¿Bpp ^ sept ar
<img file="MX339461B_D0090.tif" />
conveniently in unit dosage form
<img file="MX339461B_D0091.tif" />
They can prepare by methods well known in the field of pharmacy. Methods of preparing a composition with a pharmaceutically acceptable carrier include the step of associating the active compound (eg, a polypeptide or the entire cell of the present invention) with a carrier that constitutes one or more additional ingredients. In general, formulations are prepared by uniformly and scrupulously associating the active compound in association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into the desired formulations.
A composition that includes a pharmaceutically acceptable carrier can also include an adjuvant. An adjuvant refers to an agent that can act in a non-specific way to increase the immune response to a particular antigen, and therefore potentially reduces the amount of antigen needed in a given immunizing composition and / or the injection frequency required with in order to generate an adequate immune response to the antigen of interest. Adjuvants can include, for example, IL-1, IL-2, emulsifiers, muramyl dipeptides, dimethyl dioctadecyl ammonium bromide
135 .VÍPi'V
J ^ STITIJTO MEXICANO ».
(DDA), avridine, hfdljÓXig ^ aluminum, oils, saponins, alpha-tocopherol, polysaccharides<sub>x </sub>emulsified paraffins (including, for example, those available under the tradename EMULSIGEN from MVP Laboratories, Ralston, Nebraska), ISA-70, RIBI and other substances known in the art. It is expected that the polypeptides of the present invention will have immunoregulatory activity and that such polypeptides can be used as adjuvants that act directly as activators of T and / or B lymphocytes or that act on specific cell types that increase the synthesis of various cytokines or that activate intracellular signaling pathways. Polypeptides are expected to enhance the immune response to increase the protection index of the existing composition,
In another embodiment, a composition of the invention that includes a pharmaceutically acceptable carrier can include a biological response modifier such as, for example, IL-2, IL-4 and / or IL-6, TNF, IFN-alpha, IFN- gamma and other cytokines that alter immune cells. An immunizing composition can also include other components known in the field such as an antibiotic, a preservative, an antioxidant or a chelating agent.
Production methods
The present invention also provides methods
136 to obtain the polypeptides described in
KLa7 „? ;; .-, i> O polypeptides and whole cells of the present invention can be isolated from a member of the M iu 1Όcoctraceare ^ r family, preferably Staphylococcus spp., More preferably Staphylococcus aureus. Other gram positive microbes from which the polypeptides can be isolated include Corynebacterium spp., Erysipelothrix spp., Mycohacterium spp., And Erysipelothrix spp. Microbes useful for obtaining polypeptides of the present invention and making whole cell preparations are commercially available from a repository such as the American Type Culture Collection (ATCC). Furthermore, microbes can be easily obtained by usual and well-known techniques in the field. The microbes can be derived from an infected animal as a field isolate and can be used to obtain polypeptides and / or whole cell preparations of the present invention, or they can be stored for later use, for example in a -20 frozen repository. ° C to -95 ° C or -40 ° C to -50 ° C in bacteriological medium containing 20% glycerol and another similar medium.
When a polypeptide of the present invention is to be obtained from a microbe, the microbe can be incubated under low metal conditions. As used herein, the phrase "low metal conditions" refers to an environment, typically a bacteriological medium, which
<img file="MX339461B_D0092.tif" />
137 it contains quantities of a free metal which prSvetá £ 'ίφφ / ja. iv.fi- A ¿L \, iNSTiTiir; iy; 'o microbe expresses metal-regulated polypeptides
..- • iA'íí detectable. The way it is used in the present. The 1st phrase high metal conditions refers to an environment that contains amounts of a free metal and that causes a microbe to not stress one or more of the polypeptides.
<td>regulated</td><td>by</td><td>metal</td><td>described in</td><td colspan="2">the present on one level</td>
<td>detectable</td><td>or</td><td>than</td><td>express that</td><td>polypeptide a</td><td>a level</td>
<td>diminished</td><td>in</td><td colspan="2">compared to</td><td>expression of</td><td>polypeptide</td>
<td colspan="2">regulated by</td><td>metal</td><td colspan="2">under metal conditions</td><td>low. In</td>
In some cases, high metal conditions may include a metal-rich environment and / or natural culture in a metal-rich medium without a metal chelator. In contrast, in some cases, low metal conditions may include culturing in a medium that includes a metal chelator, as described in more detail in the following. The metals are those present in the periodic table under groups 1 to 17 (IUPAC notation; also called groups IA, IIA, III-B, IV-B, VB, VI-B, VII-B, VIII, IB, II -B, III-A, VAT, VA, VI-A and VII-A, respectively under the notation of CAS). Preferably, the metals are those in groups 2 to 12, more preferably groups 3-12. Even more preferably the metal is iron, zinc, copper, magnesium, nickel, cobalt, manganese, molybdenum or selenium, more preferably iron.
138
Low metal conditions generálm ^ nj ^ | sj ^ ñ '] ei -.- /. A • MEXICAN INSTITUTE F,. ·. OF THE PROILY \ '•• i result of the addition of a compound that 1 metal ante' · a bacteriological medium, the use of a bare-ter-iological medium ---- containing low amounts of a metal or the combination thereof. High metal conditions are generally present when a chelator is not present in the medium, when metal is added to the medium, or a combination of both. Examples of metal chelators include natural and synthetic compounds. Examples of natural compounds include plant phenolic compounds such as flavenoids. Examples of flavenoids include copper and catechin and naringenin chelators, and iron chelators myricetin and quercetin. Examples of synthetic copper chelators include, for example, tetrathiomolybdate and examples of synthetic zinc chelators include, for example, N, N, Ν ', Ν'-tetrakis (2pyridylmethyl) -ethylenediamine. Examples of synthetic iron chelators include 2,2'-dipyridyl (also referred to in the art as a, a'-bipyridyl), 8-hydroxyquinoline, ethylenediamino-di-O-hydroxyphenylacetic acid (EDDHA) , desferrioxamine (desferol) methanesulfonate, transferrin, lactoferrin, ovotransferrin, biological siderophores such as catecholates and hydroxamates and citrate. An example of a general divalent cation chelator is CHELEX resin. Preferably it
139
Typically uses 2,2'-
<img file="MX339461B_D0093.tif" />
ei ζ, δ -αιριπιο is added to the meaio in a concentration of at least 3 0 micrograms (milliliter ^ g / ml), at least 600 gg / ml or at least 900 gg / ml. High concentrations of 2,2'-dipyridyl can be 1200 μg / ml, 1500 gg / ml or 1800 μρ / ιηΐ.
The S. aureus genome codes for three Fur homologs: Fur, PerR, and Zur. While the Zur and PerR proteins appear to be primarily involved in regulation of zinc homeostasis and peroxide stress genes, respectively, the Fur protein has been shown to regulate various iron-siderophor uptake systems in response to iron limitation. Fur protein also plays a role in resistance to oxidative stress and virulence. It is expected that a gram-positive organism, preferably an S. aureus with a mutation in a fur gene, will result in the constitutive expression of many, if not all of the metal-regulated polypeptides of the present invention. The production of a fur mutation in a gram positive, preferably an S. aureus can be produced using systematic methods including, for example, chemical, site-directed, or transposon mutagenesis, useful for generating mutations where gene expression is blocked in gram-positive bacteria.
The medium used to incubate the microbe and the
140 —----- »V volume of medium used to incubate mi (jc ^^) '| pu ^ (^ eñ<sup>;</sup> ,.<sub>ιΖ</sub><«Λ<sub>λ</sub> Ability to produce one or more of the polypeptides described herein, the microbe can grow in a suitable volume, for example 10 milliliters to 1 liter of medium. When a microbe is grown to obtain polypeptides for use, for example, in its administration to animals, the microbe can be grown in a fermenter to allow isolation of larger amounts of polypeptides. Methods for growing microbes in a fermenter are common and known in the art. The conditions used to grow a microbe preferably include a metal chelator, more preferably an iron chelator, for example 2,2'-dipyridyl at a pH between 6.5 and 7.5, preferably between 6.9 and 7.1 and a temperature of 37 ° C.
In some aspects of the invention, a microbe can be harvested after growth. Harvesting includes concentrating the microbe in a smaller volume and suspending it in a medium other than the growth medium. Methods for concentrating a microbe are customary and known in the art and include, for example, filtration or centrifugation. Typically, the concentrated microbe is suspended in an appropriate buffer. An example of a shock absorber that can be used contains Tris-base
141 ] 'KM Ip K ¡7.3 grams / liter) at a pH of 8.5. Option ^ TíQfitáíe &
Final buffer also minimizes proteolytic degradation. This can be accomplished by having a final buffer at a pH of greater than 8.0, preferably at least 8.5, and / or including one or more proteinase inhibitors (eg, phenylmethanesulfonyl fluoride). Optionally and preferably, the concentrated microbe is frozen at -20 ° C or lower until it breaks.
When the microbe is to be used as a complete cell preparation , the harvested cells can be processed using standard and known methods to inactivate cells. Alternatively, when the microbe is to be used to prepare polypeptides of the present invention, the microbe can be cleaved using standard and known chemical, physical or mechanical methods in the field including, for example, boiling, French press, sonication, peptidoglycan digestion (for example by lysozyme digestion) and homogenization. An example of a suitable suitable device for homogenization is a model C500-B AVESTIN homogenizer (Avestin Inc, Ottawa Canada). As used herein, the term "breakdown" refers to the breakdown of a cell. The breakdown of a microbe can be measured by methods that are customary and known in the art, including, for example, changes in optical density. Typically a
142 microbe undergoes rupture until the 'INSTITUTE: ΛΗα' € ΛΑ'Ο í?; -.
(DtL. '·. <sup>1</sup> ’<sup>or</sup>'' 'h ...' '. · percentage of transmittance in 2 0% when fhidid <sup>:</sup> nail * 1: 100 dilution. When methods are used<sup>1</sup> Mechanical 'lystes' Ud', typically the temperature during rupture is kept low, preferably at 4 ° C to further minimize proteolytic degradation. When chemical methods are used, the temperature can be increased to optimize cell disruption. A combination of chemical, physical, and mechanical methods can also be used to solubilize the cell wall of the microbe. As used herein, the term solubilize refers to dissolving cellular materials (eg, polypeptides, nucleic acids, carbohydrates) in the aqueous phase of the buffer in which the microbe breaks and the formation of aggregates of materials insoluble cell phones. Without intending to be limited by any theory, it is considered that the conditions for solubilization result in the aggregation of polypeptides of the present invention in insoluble aggregates that are sufficiently high to allow easy isolation, for example, by centrifugation.
Insoluble aggregates that include one or more of the polypeptides of the present invention can be isolated by methods that are customary and known in the art. Preferably, the insoluble aggregates are isolated by
143 centrifufápfípn 'de <sup>1</sup> membrane can be 100,000 x g. Use centrifugation. Typically, polypeptides such as polypeptides carried out by centrifugal forces from these centrifugal forces require the use of ultracentrifuges and augmentation to processes at large sample volumes is often difficult and not economical with this type of centrifuge. The methods described herein provide the production of insoluble aggregates large enough to allow the use of continuous flow centrifuges, for example Tl Sharples (Alfa Laval Separations, Warminster, PA), which can be used at a flow rate of 250 ml / minute at 117 kPa (17 psi) at a centrifugal force of 46,000 xg to 60,000 x g. Other large-scale centrifuges such as tubular bowl, chamber, and disk configurations can be used. These centrifuges are commonly used and known in the art and are commercially available from manufacturers such as Pennwalt, Westphalia, and alpha-Laval.
The final harvested proteins are washed and / or dialyzed against an appropriate buffer using methods known in the art, for example diafiltration, precipitation, hydrophobic chromatography, ion exchange chromatography or affinity chromatography, or ultrafiltration and washing of polypeptides, for example in alcohol , by diafiltration. After isolation, the
144
<img file="MX339461B_D0094.tif" />
institute u uy and V '·.
low temperature, for example at -20 ° C or a tefijjerafcúra
<img file="MX339461B_D0095.tif" />
lower.
In those aspects of the present invention where a whole cell preparation is also to be made, after growth of a microbe it can be destroyed with the addition of an agent such as glutaraldehyde, formalin or formaldehyde in a concentration sufficient to inactivate the cells. in cultivation. For example, formalin can be added at a concentration of 0.3% (vol: vol). After a period of time sufficient to inactivate the cells, the cells can be harvested, for example, by diafiltration and / or centrifugation and can be washed.
In other aspects, an isolated polypeptide of the invention can be prepared recombinantly. When recombinantly prepared, a polynucleotide encoding the polypeptide can be identified and cloned into an appropriate expression host as described in Example 14 below. The recombinant expression host can be grown in an appropriate medium, it can break down and the polypeptides are isolated as described above.
Methods of use
One aspect of the present invention is related
145
<img file="MX339461B_D0096.tif" />
additionally with methods of using the compos present invention. The methods include administering to an animal an effective amount of a composition of the present invention. The animal may be, for example, avian (which includes, for example, chickens or turkeys), bovine (which includes, for example, livestock), goat (which includes, for example, goats), sheep (which includes, for example , sheep), pig (including, for example, pigs), bison (including, for example, buffalo), equine (including, for example, horses), a pet (including, for example, dogs or cats), members of the Cervidae family (including, for example, deer, elk, moose, caribou and reindeer) or human.
In some aspects, the methods may additionally include additional administrations (eg, one or more booster administrations) of the compositions to the animal to enhance or stimulate the secondary immune response. A booster may be administered at a time after the first administration, for example, one to eight weeks, preferably two to four weeks after the first administration of the composition. Subsequent boosters may be administered one, two, three, four, or five times annually. Without intending to be limited by any theory, it is expected that in some aspects the present invention will not require annual reinforcements, since the
146 animal will be exposed in the field by exposures <sup>;</sup> INST¡TUTOy! Xií '/ XO y.', · '··' - '.'.;.
expressing the polypeptides present in the coparts that have epitopes that are identical or that are structurally related to the epitopes present in the polypeptides in the present composition administered to the animal.
In one aspect, the invention relates to methods of making antibodies, for example by inducing antibody production in an animal or by recombinant techniques. The antibody produced includes antibody that specifically binds to at least one polypeptide present in the composition. In this aspect of the invention, an effective amount is an effective amount that results in the production of antibody in the animal. Methods for determining whether an animal has produced antibodies that specifically bind polypeptides present in a composition of the present invention can be determined as described herein. The present invention further includes antibodies that specifically bind to a polypeptide of the present invention and compositions that include these antibodies.
The methods can be used to produce the antibody that specifically binds polypeptides expressed by a different microbe than the microbe from which the polypeptides of the composition are isolated. As used herein, an antibody that can bind
147
IM; ¿specifically for a polypeptide is an ant & ueipó- qú'é / '¡iwrrrvfc - “'
·. cit t ·; '7 777'9 interacts with the epitope of the antigen that induces the synthesis of the antibody or that interacts with an epitope "" re 1 ationally structurally. At least part of the polypeptides present in the compositions of the present invention typically include epitopes that are conserved on polypeptides of different species and different genera of microbes. Accordingly, an antibody produced using a composition derived from a microbe is expected to bind to polypeptides expressed by other microbes and to provide broad-spectrum protection against gram-positive organisms. Examples of gram-positive microbes to which the antibody can specifically bind are
Micrococcaceae, preferably,
Staphylococcus spp., More preferably Staphylococcus aureus; members of the Streptococcaceae family, preferably Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus uberis, Streptococcus bovis, Streptococcus equi, or Streptococcus dysgalactiae; and Bacillus spp., Clostridium spp., Corynebacterium spp., Enterococcus spp., Erysipelothrix spp., Listeria spp., Micrococcus spp., Kytococcus spp., and Erysipelothrix spp. Therefore, the antibody produced using a polypeptide composition of the invention can be used to
148
OTA '· identify and characterize ld polypeptides<sup>NSTI</sup>.J ^ yenci, on 'lNr> U-Í71.tL independent of the origin, source and / or way of obtaining the polypeptide.
The present invention also relates to the use of the antibody to direct it to a microbe that expresses a polypeptide of the present invention or a polypeptide that has an epitope structurally related to an epitope present on a polypeptide of the present invention. A compound can be covalently linked to an antibody, where the compound can be, for example, a toxin. Similarly, compounds can be covalently linked to a bacterial siderophor to target the microbe. The chemical coupling or conjugation of an antibody of the present invention or a portion thereof (such as a Fab fragment) can be carried out using known and customary methods.
In one aspect, the present invention is also related to the treatment of an infection in an animal, including a human, caused by a gram positive microbe, preferably by a family member. Micrococcaceae, preferably Staphylococcus spp., Most preferably S. aureus; members of the Streptococcaceae family, preferably Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus agalactiae,
Streptococcus uberis, Streptococcus bovis, Streptococcus
149
EnterococcuS app. ',
Erysipelothrix spp.
'Fí * V \ Γ' i 'is' equi, or Streptococcus aysgalactiae,
Clostridium spp., Corynebacterium spp.,
Erysipelothrix spp., Kytococcus spp.
Micrococcus spp., Mycobacterirum spp., And
As used herein, the term infection refers to the presence of a gram positive microbe in the body of an animal which may or may not be clinically visible. An animal with an infection may be a member of the genus Staphylococcus that is clinically undetectable and is often referred to as an asymptomatic carrier.
Treatment of an infection can be prophylactic or, alternatively, can be started after the animal has been infected by the microbe. Treatment that is prophylactic - for example, initiated before the subject is infected by the microbe or while any infection remains subclinical - is referred to herein as treatment of a subject who is at risk of infection. As used herein, the term "at risk" refers to an animal that may or may not actually present the described risk. Thus, typically, an animal at risk of microbe infection is an animal present in an area where animals have been identified as being infected with the microbe and / or are likely to be exposed to the microbe even if the animal
150 from tec tlb ^ áí- aíü. gánS * 'ÁV can harbor a consequence and not yet indicated indication of infection by the microbe, regardless of whether the animal has a subclinical amount of the microbe. In administration of a composition it can be done before, during or after. that the animal has had a first contact with the microbe. Treatment initiated after the animal's first contact with the microbe may result in decreased severity of symptoms and / or clinical signs of infection by the microbe, completely removing the microbe and / or decreasing the likelihood of experiencing a clinically evident infection in comparison with an animal to which the composition is not administered. The method includes administering an effective amount of the composition of the present invention to an animal that has or is at risk of having an infection caused by a gram positive microbe and determining if the number of microbes causing the infection has decreased. In this aspect of the invention, an effective amount is an amount effective to reduce the number of specified microbes in an animal or to reduce the likelihood of the animal experiencing a clinically invisible infection compared to an animal to which a composition has not been administered. . Methods for determining whether an infection is caused by a gram-positive microbe are common and well known in the art, such as methods for determining whether an infection has decreased.
151
In another aspect, the present invention
<img file="MX339461B_D0097.tif" />
with methods of treating one or more clinical signs or symptoms ·
<img file="MX339461B_D0098.tif" />
of certain conditions in an animal that can— by infection by a gram-positive microbe, preferably by a member of the Micrococcaceae family, preferably Staphylococcus spp., most preferably, S. aureus; members of the Streptococcaceae family, preferably Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus uberis, Streptococcus bovis, Streptococcus egui, or Streptococcus dysgalactiae; and Bacillus spp., Clostridium spp., Corynebacterium spp., Enterococcus spp., Erysipelothrix spp., Kytococcus spp.,
Listeria spp., Micrococcus spp., Mycobacterirum spp., And Erysipelothrix spp. The method includes administering an effective amount of a composition of the present invention to an animal that has or is at risk of having a condition or displaying clinical symptoms and / or signs of a condition and determining whether at least one symptom and / or Clinical sign of the condition has changed, preferably if it has decreased. Examples of clinical conditions and / or signs caused by microbial infections may include, for example, mastitis, septicemia, pneumonia, meningoencephalitis, lymphangitis, dermatitis, genital tract infections, equine adenitis, metritis, perinatal disease, pituitary abscesses, arthritis, bursitis, orchitis, cystitis and
152
I ¡á Ό 'ii' pyelonephritis, caseous lymphadenitis, turbeculosisi / si <sup>Dl;</sup>-777 / 77-77 v
i.> .jUt-iaIaL ulcerative, listeriosis, erysipelas, laminitis, anthrax, and * 'tyzzer's disease, tetanus, botulism, enteritis, malignant edema, carbuncular fever, bacillary hemoglobinuria, enterotoxemia, necrotic skin lesions, and acquired nosocomial infections . Examples of conditions caused by S. aureus also include, for example, botryomycosis in horses, purulent synovitis and osteomyelitis in poultry, abortion in pigs, and mite piemia in sheep. Examples of conditions caused by Streptocuccus spp. They also include, for example, pharyngitis, scarlet fever, impetigo, ulcerative endocarditis, rheumatic fever and cervicitis, post streptococcal glomerulonephritis in humans, cervicitis in equines and pigs, and meningitis and abscesses in the jaw in pigs.
Treatment of clinical symptoms and / or signs associated with these conditions may be prophylactic or, alternatively, may be initiated after the development of a condition described herein. As used herein, the term symptom refers to subjective tests of disease or condition experienced by the patient and caused by infection by a microbe. As used herein, the term clinical sign, or simply sign, refers to objective evidence of disease or condition caused by infection.
153 by a microbe. Symptoms and / clinical signs
INSTITUTE V .'- X'C. '. B'C
ΓΕ I-Λ Wí-O-OÁO '<sub>k</sub> · With conditions referred to herein and symptom assessments are common and well known in the field. Treatment that is prophylactic, for example, is started before. the subject manifests the symptoms or signs of a condition caused by a microbe, is referred to herein as a treatment of a subject who is at risk of developing the condition. Thus, typically, an animal at risk of developing a condition is an animal present in an area where animals that have the condition are being diagnosed and / or are not likely to be exposed to a microbe causing the condition even if the animal has not yet manifested the symptoms or signs of any conditions caused by the microbe, Accordingly, the administration of a composition can be performed before, during or after the presentation of the conditions described herein. Treatment that is started after the development of a condition may result in lessening the severity of symptoms of one or more of the conditions or completely eliminating symptoms. In this aspect of the invention, an effective amount is an amount effective to prevent the manifestation of symptoms of a disease, decrease the severity of symptoms of a disease, and / or completely eliminate symptoms. Successful treatment of
154
Τ Β 'ί á τ / ί Βΐ;
(; 0. · '<& VV' Τ 'an infection by gram-positive microbes in uariraRinial.' 'Is described in Example 5, which demonstrates protection .Λ against a disease caused by S. aureus in mouse models when administered A composition of the present invention These mouse models are usually accepted as models for the study of human diseases caused by these microbes. Successful treatment of a gram positive microbe infection in an animal is also described in Examples 10-12 which demonstrate that administration of the composition of the present invention provides protection against disease caused by S.
aureus in cows.
The present invention also provides methods for decreasing colonization of gram-positive microbes, for example by blocking gram-positive microbe binding sites including tissues of the skeletal system (eg, bones, cartilage, tendons, and ligaments), the muscular system (eg, skeleton and smooth muscles), circulatory system (eg, heart, blood vessels, capillaries, and blood), nervous system (eg, brain, the spinal cord and peripheral nerves), the respiratory system (eg nose, trachea, lungs, bronchi, bronchioles, and alveoli), the digestive system (eg mouth, salivary glands, esophagus, liver, stomach, large and small intestines), the excretory system (by
155
<img file="MX339461B_D0099.tif" />
(eg, ovaries, oviducts, uterus, vagina, mammary gland, testes, and seminal vesicles.), the lymphatic / immune systems (eg, lymph, lymph nodes, and lymphatic vessels, mononuclear cells, or leukocytes, such as macrophages, neutrophils, monocytes, eosinophils, basophils, and lymphocytes including T and B lymphocytes) and specific cell lines (eg, precursor cells, epithelial cells, blast cells), and the like. Preferably, the gram positive microbe is a member of the Micrococcaceae family, preferably Staphylococcus spp. , most preferably, S. aureus; a member of the Streptocooccaceae family, preferably Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus uberis, Streptococcus bovis, Streptococcus equi or Streptococcus dysgalactiae; Bacillus spp., Clostridium spp., Corynebacterium spp., Enterococcus spp., Erysipelothrix spp., Kytococcus spp., Listeria spp., Micrococcus spp., Mycobacterium spp., And Erysipelothrix spp.
Decreased colonization in an animal can be carried out prophylactically or, alternatively, can be started after the animal has been colonized by the microbe. The treatment that is
156
Τ ϊ V j ( <sup>;;</sup>· 3 prophylactic -for example, which starts ant é-b / í'Ste<sup>1</sup>Where the subject is colonized by a microbe or while any colonization remains undetected - it is referred to herein as treatment of a subject who is at risk of colonization by the microbe. Thus, typically an animal at risk of colonization by a microbe is an animal present in an area where animals have been identified as colonized by the microbe and / or are likely to be exposed to the microbe even if the animal has not yet has indicated an indication of any detectable colonization by the microbe and regardless of whether the animal may harbor a number of microbe subcolonization. Consequently, the administration of a composition can be carried out before, during or after the animal has had first contact with the microbe. Treatment that begins after the animal's first contact with the microbe may result in decreased degree of colonization by the microbe, complete elimination of the microbe, and / or decreased likelihood of the animal being colonized by the microbe compared to an animal to which the composition is not administered. Thus, the method includes administering an effective amount of a composition of the present invention to an animal colonized by or at risk of colonization by a gram positive microbe. In this aspect of the invention, a quantity
157 d ^^^ vib the
LA A ···. · -'I!
INCBITSIAL where the one or more of:
the microbe, linución. of the effective is an amount sufficient for colonization of the animal by the microbe, decreased colonization refers to decreased degree of colonization by complete elimination of the microbe and / or decreased likelihood of the animal being colonized by the microbe compared to a animal to which the composition is not administered. Methods for evaluating colonization of an animal by a microbe are common and well known in the art. For example, colonization of an animal's intestinal tract by a microbe can be determined by measuring the presence of the microbe in the animal's feces. Decreasing colonization of an animal by a microbe is expected to reduce transmission of the microbe to humans.
A composition can be used in the invention to provide active or passive immunization against bacterial infection. Generally, the composition can be administered to an animal to provide active immunization. However, the composition can also be used to induce production of immune products such as antibodies which can be collected from the producer animal and can be administered to another animal to provide passive immunity. Immune components such as antibodies can be collected to prepare compositions (which preferably contain antibody) from
158
<img file="MX339461B_D0100.tif" />
passive immunization. The compositions of arit icuerp ^ P '- ^ which institute Míwcwo De LA PH.CKrDAD / -1Ί Ί is V — rt> ÍC'J5TJrtAll A' Ί «. '*' * *,
<img file="MX339461B_D0101.tif" />
include monoclonal antibodies and / or antiidiotype ^ ee-'t-amb-ián can be prepared using known methods. Chimeric antibodies include human-derived constant regions of both the heavy and light chains and mouse-derived variable regions that are antigen-specific (Morrison et al., Proc. Nati. Acad. Sci. USA, 1984, 81 (21): 6851-5, - LoBuglio et al., Proc. Nati. Acad. Sci. USA,
1989, 86 (11): 4220-4; Boulianne et al., Nature, 1984,
312 (5995): 643-6). Humanized antibodies replace the murine constant and infrastructure (FR) (variable region) regions with their human counterparts (Jones et al., Nature, 1986, 321 (6069): 522-5, - Riechmann et al., Nature,
1988, 332 (6162): 323-7, - Verhoeyen et al., Science, 1988, 239 (4847): 1534-6, - Queen et al., Proc. Nati. Acad. Sci. USA,
1989, 86 (24): 10029-33, - Daugherty et al., Nucleic Acids Res., 1991, 19 (9): 2471-6). Alternatively, some mouse strains that have been genetically engineered can be used to produce antibodies that are almost entirely human in origin; after immunization the B lymphocytes from these mice are harvested and immortalized for the production of human monoclonal antibodies (Bruggeman and Taussig, Curr. Opin. Biotechnol., 1997, 8 (4): 455-8, Lonberg and Huszar, Int. Rev. Immunol. , 1995,13 (1): 65-93,159
Lonberg et al., Nature, 1994, 368: 856-9; Tay al
X Iki X 'A. „
Nucleic Acids Res., 1992, 20: 6287-95). Passive antibody cortices and fragments thereof, eg scFv, Fab, (ab ')<sub>2</sub> or Fv or other modified forms thereof can be administered to a recipient in the form of serum, plasma, blood, colostrum and the like. However, antibodies can also be isolated from serum, plasma, blood, colostrum and the like using known methods for subsequent use in a concentrated or reconstituted form such as, for example, washing solutions, impregnated dressings and / or topical agents and Similar. Passive immunization preparations can be particularly useful for the treatment of acute systemic disease or passive immunization of young animals that do not require adequate levels of passive immunity through maternal colostrum. Antibodies useful for passive immunization may also be useful for conjugating the various drugs or antibiotics that may be directly targeted to bacteria that are expressed during a systemic or localized infection of a polypeptide of the present invention or a polypeptide having an epitope structurally related to an epitope present in a polypeptide of the present invention.
Animal models, particularly mouse models, are available to evaluate
160 í¡ “λ V VA ί '.
-i<sup>¡|</sup> vrj experimentally the compositions of this invepólpft, X, jE $ tós mouse models are models commonly accepted for the! áo?: £ / aü WCVSTStAt
<img file="MX339461B_D0102.tif" />
study of human diseases caused by members of the genus Staphylococcus, and in particular S. aureus. In those cases where the member of the genus Staphylococcus causes a disease in an animal, for example a cow, the natural host can be used to experimentally evaluate the compositions of the present invention.
However, protection in a mouse model is not the only way to determine if a composition can confer protection to an animal against infection by Staphylococcus spp. The adaptive immune response consists of two primary divisions: the humoral (antibody) response and the cellular response (T lymphocytes). Following infection by a bacterial pathogen, dendritic cells at the site of infection encounter microbial antigens and produce signaling molecules such as, for example, surface receptors and cytokines in response to conserved molecular patterns associated with the specific bacteria. These signals are shared by the nature of the pathogen and ideally lead to the appropriate antibody and T lymphocyte responses that protect the host from disease. Although some bacterial diseases are controlled primarily through antibody functions, others require responses from the
161 T lymphocytes or both antibodies and rd tNSTITÍ.TO MEXICANO V '' '--'- · ® · .J -. .. BE IAjXC! '! FJ5a1>
T lymphocytes for protection. The objective of biology »- of * ·.
Vaccine is to identify immune responses. --φβ · provide protection and then design a vaccine to reproduce one or more of these responses in humans.
Antibodies can have many different functions to confer protection against infection such as, for example, complement fixation, opsonization, neutralization and / or agglutination. Furthermore, some antibody subclasses are better than others in specific functions; for example, for complement fixation the following hierarchy exists for subclasses of human IgG:
IgG3> IgGl> IgG2> IgG4.
Antibody immunological functions can be studied in a variety of ways. For example, Western blotting is used to identify antigen-specific binding based on size of separated proteins while standard enzyme-linked immunosorbent analysis (ELISA) is used to produce quantitative information about antibody titers within of the serum. Antibody surface binding studies are used to determine whether the serum antibody is capable of recognizing antigens on the surface of intact bacteria, an important indicator of whether the antibodies have the potential to function in vivo.
162
Thus, a person skilled in the field | gú ©
INSTITUTO MFZICAMO antibody binding assays such as Western fí ^ lct ELISA (eg using human antisera) and / xa—: surface binding are positively correlated with specifically bound antigens providing immunological activity against Staphylococcus spp infection (Vytvytska et al., 2002, Proteomics 2: 580-590; Kuklin et al., 2006, Infect. Immun. 74 (4): 2215-2223; Dryla et al. 2005,
Clin. Diag. Lab. Immunol. 12 (3): 387-398). However, a person skilled in the art further recognizes that a lack of antibody binding in an assay such as Western Blot, ELISA or surface binding assay does not mean that the antigen tested does not provide immunological activity against Staphylococcus spp infection. . (Kim HK et al., IsdA and IsdB antibodies protect mice against Staphylococcus aureus abcess formation and lethal challenge.
<img file="MX339461B_D0103.tif" />
<td colspan="4">Vaccine (2010), doi: 10.1016 / j</td><td colspan="4">.vaccine.2010.02.097).</td>
<td colspan="2">The figure</td><td colspan="3">202 shows the</td><td>unions</td><td colspan="2">mouse serum</td>
<td>convalescent</td><td>to</td><td>by</td><td></td><td>the</td><td>less</td><td>MntC</td><td>produced</td>
<td>recombinantly</td><td></td><td>(I KNOW THAT</td><td>ID</td><td>NO:</td><td> 419),</td><td>SYN2</td><td>produced</td>
<td>recombinantly</td><td></td><td>(I KNOW THAT</td><td>ID</td><td>NO:</td><td> 386) ,</td><td>SirA</td><td>produced</td>
<td>recombinantly</td><td></td><td>(I KNOW THAT</td><td>ID</td><td>NO:</td><td>375) and</td><td>OpplA</td><td>produced</td>
<td>recombinantly</td><td colspan="2">(SEQ ID</td><td>NO:</td><td> 364) ,</td><td colspan="2">indicating that</td><td>each one of</td>
<td>the polypeptides</td><td colspan="3">produced</td><td colspan="4">recombinantly linked</td>
can induce immunological activity against infection by
163
Staphylococcus spp.
<img file="MX339461B_D0104.tif" />
Figure 204 shows that convalescent human serum '' binds to recombinantly produced PflB meri'E'e '“' f ID NO: 353), recombinantly produced OpplA (SEQ ID NO: 364), recombinantly produced SirA (SEQ ID NO: 375), recombinantly produced SYN2 (SEQ ID NO: 386), FhuD produced
<img file="MX339461B_D0105.tif" />
<td>recombinantly</td><td>(I KNOW THAT</td><td>ID</td><td>NO:</td><td> 397) ,</td><td>SYN1</td><td>produced</td>
<td>recombinantly</td><td>(I KNOW THAT</td><td>ID</td><td>NO:</td><td>408) and</td><td>MntC</td><td>produced</td>
<td>recombinantly</td><td>(SEQ ID</td><td>NO:</td><td> 419)</td><td>indicating</td><td>than</td><td>each one of</td>
Recombinantly produced polypeptides can induce immunological activity against infection by
Staphylococcus spp.
Figure 205 shows that the recombinantly produced antibody to FhuD (SEQ ID NO: 397), recombinantly produced OpplA (SEQ ID NO: 364) and recombinantly produced PflB (SEQ ID NO: 353) binds to the surface of Staphylococcus spp cells indicating that each of the polypeptide targets of the cell-binding antibody can induce immunological activity against infection by
Staphylococcus spp.
Techniques such as opsonophagocytosis (OPA) assays in which the antibody and a complement-bound bacterium are combined with human or mouse phagocytes to determine levels of bacterial destruction are useful for studying the function of
164 ) Μ Ρ ϊ 6 '. · V ·
JL Γ »- · ύ .. Hee. Ha ί> · '·' '' '·· MEXICAN INSTITUTE' -, jj antibodies. Positive OPA results correlate5í ± Vá3 ^ .tCÓil¿. ~ 2USJ ^ —fin rat,
<td>induced protection</td><td>by</td><td>vaccine</td><td>in a modeiX</td>
<td>(Stranger-Jones et</td><td>to the.</td><td> 2006,</td><td>Proc. Nati.</td>
<td> 103 (45) : 16942-16947) .</td><td>I know</td><td>may</td><td>use a</td>
<td>oxidative discharge</td><td colspan="2">similar for</td><td>decide</td>
Reactive oxygen species (ROS) by fresh human or mouse neutrophils after interaction with antibody and complement-bound bacteria.
In some cases one can determine that a candidate polypeptide possesses cell-mediated immune activity, and therefore the candidate polypeptide may exhibit immunological activity in the absence of induction of antibody production (Spellberg et al. 2008, Infect.
Immun. 76 (10): 4575-4580). Cytotoxic or CD8 T lymphocytes primarily destroy infected cells directly through various effector mechanisms while CD4 helper T cells function to provide important signaling in the cytokine pathway. These classes of T lymphocytes can be further subdivided based on the cytokines they produce and the different subclasses are effective against different bacterial pathogens. T lymphocytes are frequently studied by determining their genotypes with flow cytometry, where antibodies are used to visualize the levels of specific surface markers that allow the
165 classification of T lymphocytes such as, for
You * '“Λ ry' ¡'.' •• Λ
UA4, .IV • o, A CD4 T lymphocyte <sup>+</sup> newly activated, a CD8 T lymphocyte<sup>+</sup> memory, etc. In addition, cytokines and other T lymphocyte products can be studied by isolating T lymphocytes from lymphoid tissue and restimulating them with an antigen in order. After antigen stimulation, T lymphocytes produce cytokines that can be visualized, for example, by staining intracellular cytokine coupled with flow cytometry or by collecting cell supernatants and using Luminex sphere technology to simultaneously measure cytokines 15-25.
Figure 206 shows that a composition (rSIRP7) including recombinantly produced PflB (SEQ ID NO: 353), recombinantly produced OpplA (SEQ ID NO: 364), recombinantly produced SirA (SEQ ID NO: 375), recombinantly produced SYN2 (SEQ ID NO: 386), recombinantly produced FhuD (SEQ ID NO: 397), recombinantly produced SYN1 (SEQ ID NO: 408) and recombinantly produced MntC (SEQ ID NO: 419) induces a cytokine profile similar to the cytokine profile induced by the SIRP extract which is shown to provide immunological activity against Staphylococcus spp. Infection. The rSIRP7 composition induces the production, for example, of IL2, IL-6, IL-17, IFN-Y, MIP-2 and GM-CSF.
In this way, in addition to the mouse models,
166 _ 1 ν 'i Jí Jl, a person ordinarily skilled in the field redóSpc ^ xá' qú® «'' 4 'itOÍ'L-TAÍAL immune activity commensurate with the methods described herein can be correlated with either one or more of the following: Western Blot data showing that serum from animals exposed to Staphylococcus spp contains antibody that specifically binds a candidate polypeptide, binding analysis
<td>cell surface</td><td>than</td><td>show that</td><td>the antibody that</td><td>I know</td>
<td>specifically binds</td><td>to</td><td>a polypeptide</td><td>candidate is</td><td>unites</td>
<td>specifically to</td><td>a</td><td>Staphylococcus</td><td>spp, data</td><td>of</td>
opsonophagocytosis and cytokine induction.
Another aspect of the present invention provides methods for detecting antibody that specifically binds polypeptides of the present invention. These methods are useful, for example, in detecting whether an animal has an antibody that specifically binds polypeptides of the present invention and diagnosing whether an animal may have
<td colspan="2">a condition caused</td><td>by</td><td>a</td><td>microbe</td><td>than</td><td>express the</td>
<td>polypeptides</td><td>described</td><td>in</td><td>the</td><td>Present</td><td>or</td><td>to express</td>
<td>polypeptides</td><td colspan="2">they share</td><td colspan="2">epitopes with</td><td>the</td><td>polypeptides</td>
described herein. These diagnostic systems may be in the form of a kit. Methods include contacting an antibody with a preparation that includes a polypeptide of the present invention resulting in a mixture. The antibody may be present in a sample
167 Biological, '' '', eg blood, milk, or colostrum ^ 1_ jirtétodo further includes incubating the mixture under conditions to allow the antibody to specifically bind to the polypeptide to form a polypeptide: antibody complex. As used herein, the term polypeptide: antibody complex refers to the complex that results when an antibody specifically binds to a polypeptide. The preparation that includes the polypeptides of the present invention also includes reagents, for example a buffer that provides appropriate complexing conditions for polypeptides: antibody.
the
The polypeptide: antibody complex is then detected. Antibody detection is known in the art and may include, for example, immunofluorescence or peroxidase. Methods for detecting the presence of antibodies that specifically bind to the polypeptides of the present invention can be used in various formats that have been used to detect antibodies, including radioimmunoassays and enzyme-linked immunosorbent assays.
The present invention also provides a kit for detecting antibody that specifically binds polypeptides of the present invention. The detected antibody can be obtained from an animal suspected of having an infection caused by a gram-positive microbe, more
168
<img file="MX339461B_D0106.tif" />
preferably Staphylococcus spp and more preferably S. aureus; Streptococcus spp., Bacillus spp., Clostridium spp., Corynebacterium spp., Enterococcus spp., Erysipelothrix spp.,. Kytococcus spp., Listeria spp., Micrococcus spp., Mycobcterium spp., And Erysipelothrix spp.
The kit includes at least one of the polypeptides of the present invention (eg, one, at least two, at least three, etc.), in a suitable packaging material in an amount sufficient for at least one assay. Optionally other reagents such as buffers and solutions necessary for the practice of the invention are also included. For example, a kit may also include a reagent to enable detection of an antibody that specifically binds to a polypeptide of the present invention, such as a detectably labeled secondary antibody designed to specifically bind to an antibody that is derived from a animal. Instructions for use of packaged polypeptides are also typically included. As used herein, the phrase packaging material refers to one or more physical structures used to house the contents of the kit. The packaging material is constructed by well-known methods, generally to provide a sterile environment, free of contaminants. Packaging material may have a tag
169 f 'which indicates that the polypeptides can be pueddblWiíj.zar to
INSTITUTE DL LA detect antibody that specifically binds poly<sup>1</sup> the present invention. In addition, the matefícTT SffipSüá & ó 'contains instructions that indicate how the materials, inside the kit, are used to detect the antibody. As used herein, the term "packaging" refers to a container such as glass, plastic, paper, thin foil, and the like capable of retaining within fixed limits polypeptides and other reagents, for example a secondary antibody. Thus, for example, a package may be a microtiter plate well in which microgram amounts of the polypeptides have been fixed. A package may also contain a secondary antibody. Instructions for use typically include a tangible expression that describes the reagent concentration of at least one test method parameter such as the amounts of reagent and relative samples to be mixed, the holding time periods for reagent mixtures / sample, temperature, damper conditions and the like.
The present invention is illustrated by the following examples. It should be understood that the particular examples, materials, quantities and procedures are to be broadly interpreted in accordance with the scope and spirit of the invention as set forth herein.
170
EXAMPLES
EXAMPLE 1
<img file="MX339461B_D0107.tif" />
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX339461B_D0108.tif" />
PREPARATION OF REGULATED PROTEINS PQB-HJBBR &
LABORATORY SCALE
Compositions derived from different strains of Staphylococcus aureus include novel proteins expressed under iron myring and / or other degrees of metal ion chelation were evaluated to determine efficacy against virulent exposure in mice. The efficacy of the composition was evaluated by collecting data on the following parameters: (1) the efficacy of each composition in providing homologous and heterologous protection against live virulent exposure in mice, (2) the efficacy of each composition in reducing necrotic skin lesions and (3) the efficacy of Stpahylococcus-derived compositions that grow under depleted and iron-filled conditions to provide protection.
The Staphylococcus aureus strains evaluated in this study originate from three animal species: avian, human, and bovine. The SAAV1 avian isolate is a field isolate that originates from a flock of sick turkeys that have a high degree of osteomyelitis and synovitis. Bovine isolates (strain 1477 and strain 2176) were isolated from two different commercial milk-producing herds that have a high incidence of clinical mastitis. The isolated
171 r
Human was obtained from ATCC (strain 19636) and was a patient presenting with clinical ostiomelitis.
Master seed concentrates from each isolate are prepared by inoculating the appropriate isolate into 200 ml of tryptic soy broth (TSB, Difeo Laboratories, Detroit MI) containing 2.2, -dipyridyl 300 µΜ (SigmaAldrich St. Louis, MO). The culture is grown while shaking at 200 rpm for 6 hours at 37 ° C and harvested by centrifugation at 10,000 x g. The bacterial pellet is resuspended in 100 ml of TSB broth containing 20% glycerol and is supplied sterile in 2 ml cryogenic flasks (1 ml per bottle) and stored at -90 ° C until use.
Each master seed concentrate is expanded into one working seed. One vial of each master seed isolate is inoculated into 200 ml of tryptic soy broth (TSB, Difeo Laboratories, Detroit MI) containing 2,2, -dipyridyl 1000 μΜ (Sigma-Aldrich St. Louis, MO). The culture is grown while shaking at 200 rpm for 6 hours at 37 ° C and harvested by centrifugation at 10,000 x g. The bacterial pellet is resuspended in 100 ml of TSB broth containing 20% glycerol and is supplied sterile in 2 ml cryogenic flasks (1 ml per bottle) and stored at -90 ° C until use. The working seed is used for the production of compositions enriched with iron-regulated membrane proteins including proteins from
<img file="MX339461B_D0109.tif" />
172
MEXICAN INSTITUTE V ''; , I grew up ^^^ eri '
Hprir, medin miP iron-regulated membrane. ,
All strains were adapted for medium highly decreased in iron (it contains very low concentrations of free iron). This is carried out by subculturing the bacterium in TSB containing increasing concentrations of 2,2-dipyridyl (from 300 to 1600 µΜ).
Proteins are prepared from bacteria as follows. The bacteria are grown from the frozen working seed concentrates by subculturing in 25 ml of low iron medium (containing 2,2'-dipyridyl 1000 μΜ) and iron-filled medium and then incubated at 37 ° C while shake at 400 rpm. After 12 hours of incubation, 5 ml of each culture is transferred to 500 ml of iron-free or iron-filled medium pre-incubated at 37 ° C. The cultures are incubated for 8 hours at 37 ° C while shaking at 100 rpm, then the cells are pelleted by centrifugation at 10,000 xg for 20 minutes. The bacterial pellets are resuspended in 100 ml of sterile physiological saline and centrifuged at 1000 xg for 10 minutes. The pellets are then resuspended in 45 ml of Tris buffered saline, pH 7.2 (TBS; 25 mM Tris, 150 mM NaCl) and the resulting bacterial suspensions are supplied as 9 ml aliquots in 5 individual tubes. One milliliter of
TBS containing 50 units of lysostaphin (Sigma, St.
173 <sup>r</sup> ΙΜ> ϊ ¢ Louis, MO) is added to each tube to provide ^ z ^^ VoIürneri i '' Ósl'á c; ; JNDJ · -. '>) AT the end of 5 units / ml. After incubation at 37 ° C for 30 minutes while shaking at 200 rpm, 1 ml of TBS containing 0.1 mg of lysozyme (Sigma) is added to each tube. The bacterial suspensions are then incubated for an additional 45 minutes while shaking at 200 rpm. The suspensions are then centrifuged 3050 xg for 12 min at 4 ° C to pellet large cell debris. Supernatants are collected by aspiration without disturbing the sediment. The supernatant is then centrifuged at 39,000 xg for 2.5 hours. The resulting pellets containing the proteins are resuspended in 200 μΐ of Tris buffer, pH 7.2, without saline. The protein solution from each isolate is combined for a total volume of 1 ml and stored at -90 ° C.
Protein-enriched extracts derived from S. aureus are size fractionated on SDS-PAGE gels using a 4% stacking gel and a 10% resolution gel. Samples for electrophoresis are prepared by combining 10 µΐ of sample with 30 µΐ of reducing sample buffer with SDS (62.5 mM Tris-HCl, pH 6.8, 20% glycerol, 2% SDS, 5% β-mercaptoethanol) and subjected boil for 4 minutes. Samples are electrophoresed at a constant current of 1 ^ 8 mA for 5 hours at 4 ° C using protein II xi cell power supply (BioRad
174
Laboratories, Richmond, CA, Model lOOO / 5oJ) r. ,The weight
INS-IT 'I /' · '/' molecular of each individual protein is' Visually observed on the SDS-PAGE gel and calcnd ^ XTiriTT'Z ^ ['íiaS “' ™ '' '' ™ a GS- densitometer 800 (BioRad) using a wide range molecular weight marker as a reference standard (BioRad).
SDS-PAGE patterns of protein from each isolate grown in the presence of 1600 µ dip dipyridyl show a very different protein expression pattern compared to the same strain when grown in the presence of 300 µΜ dipyridyl. For example, when grown in 300 μΜ dipyridyl, the SAAV1 isolate results in metal-regulated proteins of 90 kDa, kDa, 72 kDa, 66 kDa, 36 kDa, 32 kDa, and 22 kDa, while growth in dipyridyl 1600 μΜ results in metal regulated proteins of 87.73 kDa, 54.53 kDa,
38.42 kDa, 37.37 kDa, 35.70 kDa, 34.91 kDa and 33.0 kDa. Similarly, when grown on 300 μΜ dipyridyl, isolate 19636 results in 42 kDa and 36 kDa proteins while growth in 1600 μΜ dipyridyl results in 87.73 kDa, 54.53 kDa metal-regulated proteins,
38.42 kDa, 37.37 kDa, 35.70 kDa, 34.91 kDa and 33.0 kDa.
All conditions, including growth in iron-packed medium, result in the expression of the following proteins that are probably unregulated
175 per metal: 150 kDa, 132 kDa, 120 kDa, 75 kDaJ. JIM ÍDali, 'É #<sup>;</sup>
INSTITUI
OF THE <sup>;</sup> 'kDa, 44 kDa, 43 kDa, 41 kDa and 40 kDa. '<sup>J</sup>
Furthermore, the growth of the different S. aureus cePT in dipyridyl 1600 μΜ results in similar protein expression patterns. . Compositions enriched with proteins from iron-regulated membranes of avian isolate (SAAV1) include proteins with molecular weights of 87.73 kDa, 54.53 kDa, 38.42 kDa,
37.37 kDa, 35.70 kDa, 34.91 kDa and 33.0 kDa. The molecular weights of the proteins from the ATCC 19636 isolate are essentially identical to those of the avian isolate.
Both bovine isolates, when grown in 2,2dipyridil 1600 μΜ, express similar band formation profiles as avian and ATCC isolates for most proteins (87.73 kDa, 54.53 kDa, 38.42 kDa, 3 7.37 kDa, 35.70 kDa , 34.91 kDa and 33.0 kDa). However, neither the bovine isolates produced the 38.42 kDa protein observed with the avian isolates and ATCC and the bovine isolates expressed three proteins (80.46 kDa, 65.08 kDa and 31.83 kDa) not observed with the avian and ATCC strains (see figure 1 and table 7). All conditions resulted in the expression of the following proteins that were not metal regulated: 150 kDa, 132 kDa, 120 kDa, 75 kDa, 58 kDa, 50 kDa, 44 kDa, 43 kDa, 41 kDa and 40 kDa.
176
TABLE 7. MOLECULAR WEIGHTS OF POLYPEPTID & S JEGULADOgPÓR /, METAL OBTAINED FROM ISOLATES OF Staphylocbccus aureus
<img file="MX339461B_D0110.tif" />
<td>Avian</td><td>Human</td><td>Bovine</td><td>Bovine</td>
<td>SAAV1</td><td> 19636</td><td> 1477</td><td> 2176</td>
<td> 87.73</td><td> 87.73</td><td> 87.73</td><td> 87.73</td>
<td> -</td><td> -</td><td> 80.46</td><td> 80.46</td>
<td> -</td><td> -</td><td> 65.08</td><td> 65.08</td>
<td> 54.53</td><td> 54.53</td><td> 54.53</td><td> 54.53</td>
<td> 38.42</td><td> 38.42</td><td> -</td><td> -</td>
<td> 37.37</td><td> 37.37</td><td> 37.37</td><td> 37.37</td>
<td> 35.70</td><td> 35.70</td><td> 35.70</td><td> 35.70</td>
<td> 34.91</td><td> 34.91</td><td> 34.91</td><td> 34.91</td>
<td> 33.0</td><td> 33.0</td><td> 33.0</td><td> 33.0</td>
<td></td><td></td><td> 31.83</td><td> 31.83</td>
Interestingly, there is no difference in protein profiles as examined by SDS-PAGE between the clarified supernatant and the bacterial pellet after treatment of the bacterium with lysostaphin / lysozyme.
Both the extracted bacterial pellet and the supernatant have exactly the same protein profiles as those examined by SDS-PAGE. The same observation also occurred when bacterial cells are disrupted using an AVESTIN homogenizer at 207 mpa (30,000 psi). He
177 Bacterial pellet resulting after low-speed centrifugation is identical in its '^' Sotein profile compared to the clarified supernatant after high-speed centrifugation at 30,000 xg for 2.0 hours at 4 ° C.
EXAMPLE 2
PREPARATION OF IMMUNIZING COMPOSITIONS ARISING FROM
Staphylococcus aureus
Proteins from human isolate ATCC 19636 and bovine isolate 1467, which were grown under reduced iron conditions and prepared as described in Example 1 were used to formulate two vaccine compositions. The proteins of the ATCC isolate have molecular weights of 87.73 kDa, 54.53 kDa, 38.42 kDa, 37.37 kDa, 35.70 kDa, 34.91 kDa and 33.0 kDa, while the bovine isolate expresses proteins that have molecular weights of 87.73 kDa, 80.46 kDa, 65.08 kDa , 54.53 kDa, 37.37 kDa, 35.70 kDa, 34.91 kDa, 33.0 kDa and 31.83 kDa. Each composition also contains the following proteins that are not metal regulated: 150 kDa, 132 kDa, 120 kDa, 75 kDa, 58 kDa, 50 kDa, 44 kDa, 43 kDa, 41 kDa and 40 kDa. Concentrated vaccines were prepared from two strains by emulsifying each aqueous protein suspension (500 pg total protein / ml) in a commercial adjuvant (EMULSIGEN, MVP Laboratories, Raltson, Nebraska) using an IKA Ultra Turrax T-50 homogenization vessel. (IKA,
178
Cincinnati, OH) to provide a final dose of 35.0 jg of
MLX INSTITUTE; C'.77. DS LA, total protein in 0.1 ml of injectable volume with 'adjuvant concentration of 22.5%, vo 1 / vo 1. As * control vaccination, a protein composition was prepared from bovine isolate 1477 which was grown under iron-filled conditions ( TSB supplemented with 300 μΜ ferric chloride) as described in Example 1. A placebo vaccine was prepared by replacing physiological saline with the aqueous protein suspension in the previous protocol.
<img file="MX339461B_D0111.tif" />
MT
EXAMPLE 3
VACCINATION OF MICE
Seventy female (N = 70) CF-1 mice from Harian Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were distributed equally among seven groups (10 mice / group). Mice were housed in polycarbonate mouse cages (Ancore Corporation, Bellmore, NY). A single cage was used for each treatment group, and feed and water were supplied at will for all mice. All mice were vaccinated intraperitoneally with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Vaccinated with placebo
Group 2: Vaccinated with ATCC 19636 proteins that are expressed under iron restriction
Group 3: Vaccinated with placebo
179
Xihás, - 1477. <saw. - '·
Group 4: Vaccinated with proteins
INSTIT expressed under iron restriction. <sup>c</sup>
Group 5: Vaccinated with bovinag proteins „.. JA22 ^<sub>m</sub>expressed under iron restriction.
Group 6: Vaccinated with ATCC 1963.6 proteins expressed under iron restriction.
Group 7: Vaccinated with bovine 1477 FeCl<sub>3</sub> where bovine 1477 FeCl<sub>3</sub> refers to proteins obtained from bovine 1477 that were grown in TBS supplemented with 300 pM ferric chloride.
EXAMPLE 4
PREPARATION OF THE EXHIBITION AGENCY
The Staphylococcus aureus strains previously described, ATCC 19636 and strain 1477 were used as exposure organisms. Briefly, the frozen concentrate isolates (previously described) are streaked on blood agar plates and incubated at 37 ° C for 18 hours. A unique colony of each isolate is subcultured in 50 ml of tryptic soy broth (Difeo) containing 2,2'-dipyridyl 1600 pM. Cultures are incubated at 37 ° C for 6 hours while spinning at 200 rpm, then centrifuged at 10,000 xg for 10 min at 4 ° C to pellet bacteria. Bacterial pellets are washed twice by centrifugation in TBS at 4 ° C. Final sediments are resuspended in TBS to a density
180 42% transmittance (T) optics at about 562nm about 2.5mL TBS and are used
Just prior to challenge, 1 ml of these bacterial suspensions is serially diluted and plated on agar to determine the number of colony forming units (CFUs) per mouse dose.
EXAMPLE 5
EXPOSITION
Fourteen days after the second vaccination, mice in all groups (1-7) were exposed subcutaneously at the back of the neck with 0.1 ml of the appropriate organism. The seven groups of mice were exposed as follows:
Group 1 (Vaccinated with placebo): Exposed with ATCC
19636
Group 2 (Vaccinated with ATCC 19636 proteins that are expressed under iron restriction): Exposed with ATCC 19636
Group 3 (Vaccinated with placebo): Exposed with 1477 bovine
Group 4 (Vaccinated expressed under restriction of
Group 5 (Vaccinated expressed under restriction of
Group 6 (Vaccinated expressed under restriction of
<td>with</td><td>protein</td><td>bovine</td><td> 1477</td>
<td>iron)</td><td>: Exposed</td><td colspan="2">with bovine 1477</td>
<td>with</td><td>protein</td><td>bovine</td><td> 1477</td>
<td>iron)</td><td>: Exposed</td><td>with ATCC</td><td> 19636</td>
<td>with</td><td>protein</td><td>ATCC</td><td> 19636</td>
<td>iron)</td><td>: Exposed</td><td colspan="2">to 1477 bovine</td>
181
JL Ji .., ·· ,. / · '-. <·· 'Group 7 (Vaccinated with bovine 1477 FaGlr ^ i> Exposed with bovine 1477.
As determined by the enumeration procedure
<td>described in example 4,</td><td>the</td><td>concentration of S.</td><td>aureus 19636</td>
<td>used for exhibition</td><td>was</td><td>1.35 x 10<sup>8</sup> UFC</td><td>per dose of</td>
<td>mouse and concentration</td><td>of</td><td colspan="2">S. aureus 1477 used for</td>
<td>exposure was 1.65 x</td><td> 10<sup>8</sup></td><td>CFU by colonies</td><td>per dose of</td>
mouse. Morbidity, mortality and general pathology were recorded daily for 7 days after exposure.
When the exposed mice are compared with the ATCC 19636 isolate, 70% of the mice in group 1 vaccinated with placebo in the following 7 days of the exposure (Table 8 and Figure 2). This document demonstrates that strain 19636 causes a high mortality in mice at the administered dose level. In contrast to mice in group 1, only 10% of mice in group 2 died within 7 days of challenge. These results illustrate that mice exposed with strain 19636 are significantly protected by vaccination with composition 19636 (p = 0.020, Fischer's exact test). Furthermore, Kaplan-Meier analysis of time-to-death data indicates that the vaccine provides significant protection (p = 0.0042, log interval test) against homologous exposure (Figure 3). Furthermore, only 20% of group 5 mice died in the following 7 days of exposure, indicating that the
182 composition 1477 bovine offers significant protection ^ j ^ a | A: ^ n0ra · INSTITUTO MEXICANO exposure with the ATCC 19636 strain (p = 0.015 test Sfe --- logarithm of interval for mortality). When —Aes— data- ^ are analyzed by the Kaplan-Meier survival curve and the interval logarithm test (Figure 4), it is determined that the protection against mortality is significant (p = 0.015 in the logarithm test of mortality interval), indicating that the vaccine composition derived from strain 1477 provides heterologous protection against exposure with strain 19636.
TABLE 8. MORTALITY OF VACCINATED AND UNVACCINATED MICE
AFTER EXPOSURE WITH Staphylococcus aureus (ISOLATED
HUMAN ATCC 19636 AND ISOLATED BOVINE 1477)
<td>Groups</td><td>Number of mice</td><td>Number of deaths</td><td>Percentage of mortality (%)</td>
<td>Group 1 * (Placebo, exhibition with ATCC 19636)</td><td> 10</td><td> 7/10</td><td> 70</td>
<td>Group 2 * (ATCC 19636, exhibition homologous)</td><td> 10</td><td> 1/10</td><td> 10</td>
<td>Group 3 * (Placebo, bovine exhibition 1477)</td><td> 10</td><td> 2/10</td><td> 20</td>
<td>Group 4 * (bovine 1477, exposure homologous)</td><td> 10</td><td> 1/10</td><td> 10</td>
<td>Group 5 * (Bovine 1477, exhibition heterologous)</td><td> 10</td><td> 2/10</td><td> 20</td>
<td>Group 6 * (ATCC 19636, exhibition heterologous)</td><td> 10</td><td> 0/10</td><td> 0</td>
<td>Group 7 * (Bovine 1477 FeCl<sub>3</sub>, bovine exhibition 1477)</td><td> 10</td><td> 2/10</td><td> 20</td>
* Group 1, (Vaccinated with placebo / exposed with ATCC 19636) * Group 2 (Vaccinated with proteins ATCC 19636 expressed under
183
<img file="MX339461B_D0112.tif" />
institute x: t'.no * Group 3 (Vaccinated with placebo / exposed with 1477 "bovine)
<img file="MX339461B_D0113.tif" />
* Group 4 (Vaccinated with bovine proteins 147-7— © xpresadae. Iron restriction / exposed with 1477 bovine) * Group 5 (Vaccinated with 1477 bovine proteins expressed under iron restriction / exposed with ATCC 19636) * Group 6 (Vaccinated with ATCC 19636 proteins expressed under iron restriction / exposed with 1477 bovine) * Group 7 (Vaccinated with bovine 1477 FeCl<sub>3</sub>/ exposed with bovine
1477) .
<img file="MX339461B_D0114.tif" />
When the exposed mice are compared to the bovine isolate 1477, only 20% of the mice in the placebo-vaccinated group (group 3) died within the next 7 days of exposure. However, exposure to bovine isolate 1477 induces the development of necrotic skin lesions in 6 (75%) of the surviving group 3 mice. These lesions are measured and the average size of the lesions in the surviving mice is 18.5 mm (Table 9). In contrast, 20% of group 4 mice died within 7 days after challenge but only three (38%) of the surviving mice developed lesions (average diameter, 2.7 mm). These results indicate that bovine composition 1477 provides significant homologous protection against development.
184 of lesions in mice exposed with the ib 4V7 strain
Ϊ
<img file="MX339461B_D0115.tif" />
(p = 0.009, Student's t-test). In addition, the Vacuñádión
<img file="MX339461B_D0116.tif" />
with the composition ATCC 19636 prote exposure with strain 1477 since no mice died in group 6 and only three (30%) of the mice developed skin lesions (average diameter, 3.7 mm). Taken together, the reduced mortality and / or lesion development in mice in groups 5 and 6 demonstrates a significant cross-protective nature of the compositions derived from strains 19636 and 1477 (p = 0.012, Student's t-test based on lesion size). As a demonstration of the efficacy of the composition compared to non-iron-regulated proteins, 20% of the mice in group 7 died and 4 of the survivors developed skin lesions (average diameter, 15.8 mm). Mice in group 7 showed some degree of protection by vaccination with isolate 1477 proteins since fewer mice developed lesions compared to group 3 vaccinated with placebo. However, the skin lesions observed in the mice in group 7 were more frequent and of a larger diameter than the lesions in the mice in group 4, indicating that, in relation to the proteins isolated from cells that grew under conditions
-£±. \
ΙΝ5Ί <sup>1</sup> '
<img file="MX339461B_D0117.tif" />
185 packed with iron, the isolated protein proteins
INSTi '.
which grew under iron restriction provide superior protection against idé'i'ftd-ea exposure -: --- The cross-protective nature of the proteins observed in the mouse exposure study is supported by similar molecular weights of the proteins from the S. aureus strains described in Example 1 (Figure 1). Although there are perceptible differences in the SDS-PAGE profile of the proteins and isolates derived from bovine, specifically the absence of a 38.4 kDa protein and the presence of 3 additional proteins, the proteins of both strains 1477 and ATCC 19636 induced protection. heterologous. These results indicate that similar proteins between strains 19636 and 1477 are probably responsible for the cross protection observed in groups 5 and 6. In contrast, the protein profiles of strain 1477 that grew under iron suppressed and iron-filled conditions are significantly different. These proteins isolated under decreased iron conditions are more protective when compared to proteins isolated under iron-depleted conditions, demonstrated by the reduction in lesion development among group 4 mice compared to group 7 mice.
186
W
Q ra w
£>
cu ω
wo
ω
C w
H
M
H ω
σι
Μ
R
OR
Η to
§
Γ 'rΊ <
Rh
OR
Η>
O m
or
Q <i μΐ ω
H rt!
LO m
LO σι
OR
O rf¡
J ω
H <!
H
H
O (Ü
OR
W ¡Z¡ in ω
year
H in w
what
W
Q
R
OR
H u
or
Ϊ3 u
H <
H μΐ
3 Φ k 3 <8
Q 3 Ü 0) OOO Ή £
& 4J in
RO u
RO σ »h μΐ (Q
C
H
OR
H in o
cu
X!
W
<td></td><td></td><td></td><td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>'G</td><td>'G</td><td>'G</td><td> '0</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td></td><td></td>
<td> ></td><td></td><td></td><td></td><td></td><td>in</td><td>in</td><td>in</td><td>in</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td>Φ</td><td>Φ</td><td>Φ</td><td><D</td><td> 0</td><td> 0</td>
<td> 0</td><td></td><td></td><td></td><td></td><td>j — 1</td><td>i — 1</td><td>i — I</td><td>rtí</td><td>X</td><td>X</td>
<td>to</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>X</td><td>X</td>
<td>you</td><td></td><td></td><td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>Φ</td><td>Φ</td>
<td>X</td><td>in</td><td>Lf)</td><td>or</td><td></td><td>•you</td><td>•you</td><td>• rl</td><td>you</td><td>you</td><td>you</td>
<td> 0</td><td> 04</td><td>OI</td><td>r4</td><td>m</td><td>in</td><td>in</td><td>in</td><td>in</td><td> 2</td><td> 2</td>
<td></td><td></td><td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td>
<td></td><td></td><td></td><td></td><td> '0</td><td> '0</td><td> '0</td><td> '0</td><td> '0</td><td> '0</td><td>'G</td>
<td></td><td></td><td></td><td></td><td>you</td><td>•you</td><td>•you</td><td>•you</td><td>• η</td><td>•you</td><td>•you</td>
<td>ID</td><td></td><td></td><td></td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td>
<td></td><td></td><td></td><td></td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td>
<td> 0</td><td></td><td></td><td></td><td>r4</td><td>i — 1</td><td>i — 1</td><td>rtí</td><td>rtí</td><td></td><td></td>
<td>or.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you</td><td></td><td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td>
<td>X</td><td></td><td></td><td></td><td>•you</td><td>•you</td><td>•you</td><td>you</td><td>•you</td><td>•you</td><td>you</td>
<td>or</td><td>ID</td><td>THE</td><td>rtí</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td>
<td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td></td><td></td>
<td></td><td></td><td>HJ</td><td>Ό</td><td> '0</td><td>Ό</td><td>'G</td><td>Ό</td><td>'G</td><td></td><td></td>
<td></td><td></td><td>•you</td><td>•you</td><td>you</td><td>you</td><td>•you</td><td>•you</td><td>you</td><td></td><td></td>
<td>the</td><td></td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td></td><td></td>
<td></td><td></td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td> 0</td><td>or</td>
<td>OR</td><td></td><td>i — 1</td><td>i — 1</td><td>i — 1</td><td>i — 1</td><td>i — 1</td><td>r4</td><td>rtí</td><td>X</td><td>X</td>
<td>u <</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>X</td><td>X</td>
<td>you</td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>QJ</td><td>φ</td>
<td>X</td><td></td><td>•you</td><td>-you</td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td>you</td><td>you</td>
<td> 0</td><td>lf]</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>s</td><td> 2</td>
<td></td><td></td><td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td></td>
<td></td><td></td><td></td><td></td><td> '0</td><td>Ό</td><td>'G</td><td>Ό</td><td>Ό</td><td> '0</td><td></td>
<td></td><td></td><td></td><td></td><td>• η</td><td>η</td><td>• η</td><td>you</td><td>•you</td><td>•you</td><td></td>
<td></td><td></td><td></td><td></td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td></td>
<td></td><td></td><td></td><td></td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td> 0</td>
<td> 0</td><td></td><td></td><td></td><td>i — 1</td><td>i — 1</td><td>i — 1</td><td>i — 1</td><td>i — 1</td><td></td><td>X</td>
<td>or.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>X</td>
<td>you</td><td></td><td></td><td></td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>c</td><td>Φ</td>
<td>X</td><td></td><td></td><td></td><td>-you</td><td>-you</td><td>-you</td><td>-l — l</td><td>-you</td><td>-you</td><td>you</td>
<td>or</td><td>in</td><td>OI</td><td>r4</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td> 2</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>you</td><td>you</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> '0</td><td> '0</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>• η</td><td>•you</td><td></td><td></td>
<td>m</td><td></td><td></td><td></td><td></td><td></td><td></td><td>in</td><td>in</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>Φ</td><td>Φ</td><td> 0</td><td> 0</td>
<td>OR</td><td></td><td></td><td></td><td></td><td></td><td></td><td>i — l</td><td>r4</td><td>X</td><td>X</td>
<td>or.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>X</td><td>X</td>
<td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td>you</td><td>you</td><td>Φ</td><td>Φ</td>
<td>X</td><td>»D</td><td>THE</td><td></td><td></td><td></td><td></td><td>•you</td><td>•you</td><td>you</td><td>you</td>
<td> 0</td><td></td><td> 04</td><td> 04</td><td> 04</td><td>or-</td><td>lfl</td><td>in</td><td>in</td><td> 2</td><td> 2</td>
<td></td><td>to</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>Π</td><td></td>
<td></td><td>'or</td><td> '0</td><td>'G</td><td> '0</td><td> '0</td><td> '0</td><td> '0</td><td>Ό</td><td> '0</td><td></td>
<td></td><td>•you</td><td>♦ you</td><td>•you</td><td>Ή</td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td></td>
<td>CM</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td></td>
<td></td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td>Φ</td><td> 0</td>
<td>OR</td><td>rtí</td><td>i — 1</td><td>rtí</td><td>rtí</td><td> 1—1</td><td>i — 1</td><td>rtí</td><td>r4</td><td></td><td>X</td>
<td>to</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>X</td>
<td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>Φ</td>
<td>X</td><td>-you</td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td>•you</td><td>you</td><td>•you</td><td>•you</td><td>you</td>
<td> 0</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td>in</td><td> 2</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>you</td><td>you</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td> '0</td><td>Ό</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>• η</td><td>•you</td><td>•you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>"you</td><td>in</td><td>in</td><td>in</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>Φ</td><td>Φ</td><td>Φ</td><td> 0</td><td>or</td><td> 0</td><td>or</td><td>OR</td><td> 0</td><td>OR</td>
<td> 0</td><td>r4</td><td>r4</td><td>rtí</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td>
<td>or.</td><td></td><td></td><td></td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td>
<td>you</td><td>you</td><td>you</td><td>you</td><td>φ</td><td>φ</td><td>Φ</td><td>φ</td><td>Φ</td><td>Φ</td><td>Φ</td>
<td>X</td><td>-you</td><td>you</td><td>•you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td><td>you</td>
<td> 0</td><td>in</td><td>in</td><td>in</td><td> 2</td><td></td><td>to</td><td>to</td><td>s</td><td> 2</td><td> 2</td>
ID n
ID
C!
or
EI
AND
OR
OR
OR
4J
O] <1) &
Φ o
X
X
0) φ
Ό you '0 • you or
or • you
X x
in
0)
For you
XI in (you
Ό (you in
Φ
For
X φ
LO in
LD σ »in
Φ you a
x φ
\ o
Λ
Φ g
nj i — 1 a
uncle
go
Ti <you you you g
ns>
ou
H in (you you
Ή
Φ
X
OR
For
uncle
υ o
T3 (you you you
Ü (you>
or you
Ή ¡>
OR
XI>
"to*
<td>fti</td><td>14. o. -</td>
<td>you •you</td><td>rNS ^, /</td>
<td>> Γ)</td><td></td>
<td>XI</td><td>you 0</td>
<td>(you</td><td>G</td>
<td>Φ</td><td> 0</td>
you
O g
or
X in
Φ you a
x φ
\ o
For you
Φ
Φ
Ό you '0 you ü
g • tí tí
X in
Φ you in
Φ you
8*
Φ \
OR
X
Φ ü
(you went to
ΰ o
υ o
Ό fti tí tí u
(you>
(you
X in (you
Ό (you in
Φ you a
x φ
r * «you
W (you)
H>
OR
X at rti tí
Ή
Φ
X
Or you
uncle
go
Ό (you you you or
fti>
• r * -;
'd' (ti * Tf ν '
X in
Φ you a
X φ
or you you φ
Ή
X
Φ
Ό tí '0 • il g
g • tí tí
X in
Φ you (you
X in (you
Ό (you in
Φ you a
X
Φ o
you • H>
OR
X (you to
φ
G
Φ
Ό in (you you
Ή
Φ
X
Or you
uncle
G o
Τ3 (you you you ü
(you>
>
or
X (you to
φ u
uncle
ü o
X in
Φ you a
x φ
or you you φ
•you
X
Φ
Ό you
Ό you ü
ü • tí tí
X in φ
uncle
ΓΊ (ti x
<you (you in φ
aunt
X φ
<0 (Ό 'Φ r4 rti tí • η>
OR
X (you to
φ υ
uncle
ü o
X
M
Φ you &
Φ u
or
H in (ti tí 'tí
Φ x
Or you
uncle
ü o
Ό (0 you you
G (ti>
OR
Φ>
Γ * · (you you you>
OR
X (you to
φ
G you or
G o
Ό fti tí tí
G (ti>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> --</td>
<td>i-1</td><td> 04</td><td>in</td><td></td><td></td><td>lf)</td><td></td><td>kO</td><td></td>
<td>OR</td><td>OR</td><td>OR</td><td>OR</td><td></td><td>OR</td><td> ,_<sub>Λ</sub></td><td>or</td><td>or</td>
<td>to</td><td>to</td><td>to</td><td>IX</td><td></td><td>ft</td><td></td><td>to</td><td>to</td>
<td>you</td><td>you</td><td>you</td><td>you</td><td>r ·</td><td>you</td><td>(OR</td><td>you</td><td>you</td>
<td>X</td><td>X</td><td>X</td><td>X</td><td></td><td>X</td><td>KD</td><td>X</td><td>X</td>
<td>OR</td><td>or</td><td> 0</td><td>or</td><td></td><td> 0</td><td>in</td><td> 0</td><td>or</td>
<td> *</td><td> *</td><td> *</td><td> *</td><td>rtí</td><td> *</td><td>c4</td><td> *</td><td> *</td>
in
THE
187
EXAMPLE 6 '«yu TU a> i .5
Ββτιτυτο / - / - 77, - / 1.
In mammals it has been shown that the response to tissue damage or bacterial infection i? eau 1 fc to ..... in - ^ - nT / a 'acute inflammatory response. This response increases capillary permeability and phagocytic infiltration resulting in clinical signs recognized as inflammation; swelling, fever, pain, and redness; if left untreated, this can lead to death. Activation of humoral factors and cytokine release mediate systemic events collectively known as the acute phase protein response resulting in a cascade of physiological and biochemical events. The duration of this response is directly related to the severity of the damage and the magnitude of the systemic infection. It has been well documented that during bacterial sepsis, major surgery, burns, or other bodily trauma, there is an alteration in the concentration of the number of metal ions in serum such as iron, copper, and zinc. For example, during the acute phase of an infection there is a decrease in plasma iron and zinc concentrations and an increase in copper. Altering these trace metal ions in serum can directly alter the severity or progression of any bacterial infection.
In this study we examined the expression of Staphylococcus aureus proteins under various conditions
188 of metal ion restriction in order c | e? itnitat 'la
17,' .
expression of novel proteins that can be expressed during systemic invasion. The strains of nr-r »qc,<sup>;?</sup>? Aureus evaluated in this study originate from clinical samples of three different species of animals: avian (strain SAAV1), human (strain 19636) and bovine (strains 1477 and 2176). Briefly, the cultures of each isolate are prepared from master planting concentrates in 2,00 ml of tryptic soy broth (TSB). Each culture is grown while stirring at 200 rpm for 6 hours at
37 ° C. Ten ml of each culture is transferred to 500 ml of deleted TSB containing one of the four metal ion chelators; 2,2-dipyridyl (Dp), 2pyridylmethyl-ethylenediamine (TPEN), catechin, and naringenin (all obtained from Sigma, St. Louis, MO). In addition, each culture is also grown in cation-packed medium containing ferric chloride, zinc chloride, and / or copper chloride prepared in 300 pM concentrations. Metal ion chelators are used in the following concentrations: 2,2-dipyridyl (800 pM), catechin and naringenin are used at 300 pM and 2-pyridylmethyl-ethylenediamine is used in a concentration of 100 pM. Cultures are grown with each chelator for 8 hours, at which point the culture is subcultured a second time for an additional 12 hours. Each crop is subcultured with three passes
189 consecutive at 12-hour intervals. At the end d ^^ ihérceifa /
De'lÁ EROU; At ... INDUSTRIAL past, each culture is harvested by centrifugation at 10,000 xg for 20 minutes. Each culture is washed twice by centrifugation at 10,000 xg and resuspended in 20 ml of Tris buffered saline, pH 7.2 at 4 ° C.
Each bacterial pellet is resuspended in 45 ml of Tris buffered saline, pH 7.2 (25 mM Tris and 150 mM NaCl) and the resulting bacterial suspensions are supplied as 9 ml aliquots in 5 individual tubes, tubes in total. One milliliter of TBS containing 50 units of lysostaphin (Sigma, St. Louis, MO) is added to each tube to provide a final concentration of 5 units / ml. After incubation at 37 ° C for 30 minutes while stirring at 2,00 rpm, 1 ml of TBS containing 0.1 mg of lysozyme (Sigma) is added to each tube. The bacterial suspensions are then inoculated for an additional 45 minutes while stirring at 200 rpm. The suspensions are then centrifuged at 3050 xg for 12 min at 4 ° C to pellet large cell debris. Supernatants are collected by aspiration without disturbing the sediment. The supernatant is then centrifuged at 39,000 xg for 2.5 hours. The resulting sediments enriched for metal-regulated membrane proteins are resuspended in 200 μΐ of Tris buffer, pH 7.2. The protein solutions for each isolate are combined for a
<img file="MX339461B_D0118.tif" />
190 total volume of 1 ml and stored at -90 ° C. ¡Γ Ρ \ A<sup>z</sup>
A ÁV A / - 'iNíTi njTe.'
Proteins obtained from isolates ^ Adé // S * aureus SAAV1, 19636, 1477 and 2176 are made. _ _ GrfíC.er <sub>L</sub>, fo o j conditions in which iron, zinc and copper have been deleted include metal regulated polypeptides.
The cell extracts derived from each isolate are size fractionated on SDS-PAGE gels using a 4% stacking gel and a 10% resolution gel. Samples for electrophoresis were prepared by combining 10 µΐ of sample with 30 µl of reducing SDS sample buffer (62.5 mM Tris-HCl, pH 6.8, 20% glycerol, 2% SDS, 5% β-mercaptoethanol) and boiled for 4 minutes. The samples are electrophoresed at 18 mA of constant current for 5 hours at 4 ° C using the
<td>supply of</td><td>Energy</td><td>of</td><td>cells</td><td>Protein</td><td>II xi</td><td>(BioRad</td>
<td>Laboratories,]</td><td colspan="2">R.ichmond, CA,</td><td colspan="2">model 1000/500).</td><td></td><td></td>
<td>The</td><td>patterns</td><td>of</td><td>SDS-PAGE</td><td>of the</td><td colspan="2">proteins that</td>
<td>they grew low</td><td>chelation</td><td>of</td><td>zinc and / or</td><td colspan="2">copper showed</td><td>patterns</td>
single-band formation in all isolates that were different when compared to the same isolates grown under iron restriction conditions in the presence of 2.2<sup>1</sup>-dipyridyl. For example, when isolate 19636 is grown under iron restriction or in the presence of the 2,2'dipyridyl chelator, unique iron-regulated proteins are expressed
191 in the 87.73 kDa, 54.53 kDa, 38.4jkDá, 37.-37 regions
INSTITU Λ '- -; V <'. <
kDa, 35.70 kDa, 34.91 kDa and 33.0 kDa. These proteins,.:. are, .. down-regulated when the isolate becomes γ ^ -<sup>ργργ</sup> ° i presence of ferric chloride. However, when the same isolate is made. growing in the presence of a zinc and / or copper chelator novel protein subsets are expressed relative to proteins expressed under iron restriction; the new proteins have molecular weights of approximately 115 kDa, 8 8 kDa, 8 0 kDa, 71 kDa,. 69 kDa, 35 kDa, 30 kDa, 29 kDa and 27 kDa. Furthermore, an 87.73 kDa protein is expressed under conditions of iron restriction or copper restriction but not when cultures are restricted in zinc. Proteins expressed under iron restriction appear to be down-regulated when growth is under either zinc and / or copper restriction, but are not completely inactivated, as seen when the isolate is grown in ferric chloride.
There appear to be novel proteins expressed when the organism is growing under copper restriction and / or zinc restriction that are not expressed when the same isolate is grown under iron restricted conditions. Since transition metals are used by organisms to build enzymes that catalyze various biochemical reactions,
192 Metal ions can play a vit ^ I role. ' 'In microbial survival during systemic infection, it is perhaps for this reason that during sepsis there is a transient decrease in the availability of these transition metals which renders them unavailable for organism growth. . These novel proteins may very well increase the protective efficacy of the existing growth composition under iron restriction because they can also be expressed by bacteria under metal ion restriction experienced during systemic invasion.
EXAMPLE 7
THE COMPOSITIONS OF THE PRESENT INVENTION CAN ALSO BE
PRODUCE UNDER LARGE-SCALE BUSINESS CONDITIONS
Fermentation
A cryogenic flask from the working seed was used (2 ml to 190<sup>9</sup> CFU / ml) as described in Example 1 to inoculate 500 ml of tryptic soy broth (TSB) without dextrose (Difeo) preheated to 37 ° C containing 0.125 g / 1 2,2-dipyridyl (Sigma), 2.7 grams of BiTek yeast extract (Difeo) and 3%, vol / vol glycerol. The culture is incubated at 37 ° C for 12 hours while shaking at 200 rpm, at which time it is used to inoculate 2 liters of the above medium and allowed to grow for an additional 4 hours at 37 ° C. This culture is used to inoculate a fermenter
193 which is placed on top of a gabí | iéíÉév iáeí ío ικετ> τ: .γο. '<sup>:</sup> liters VIRTIS (Virtis, Gardiner, NY) loaded with 13-liters of the medium described above. PH is maintained
6.9 and 7.1 by automatic titration with 50% NaOH and 10% HCl.
The stirring speed is adjusted to 400 revolutions / minute and the culture is aerated with 11 liters of air / minute at 37 ° C. Foam production is automatically controlled by the addition of 11 ml of defoamer (Mazu DF 2 04 Chem / Serv, Minneapolis, MN). The culture is allowed to continuously grow under these conditions for 4 hours, during which time it is sterile pumped to a 150 liter fermenter (WB Moore, Easton, PA). The fermenter is loaded with 120 liters of dextrose-free tryptic soy broth (3,600.0 grams), 600 grams of BiTek yeast extract, 3,600 ml of glycerol, 3.0 grams of 2,2-dipyridyl and 60 ml of Mazu DF 204 defoamer. The parameters of the fermentation are as follows: the dissolved oxygen (DO) remains at 30% +/- 10% by increasing the agitation to 220 revolutions / minute purged with 60 liters of air / minute and a back pressure of 69 kPa (10 pounds per square inch (psi)). The pH is kept constant between 6.9 and 7.1 by automatic titration with 50% NaOH and 10% HCl and is maintained at a temperature of 3 7 ° C. At 4.5 hours (D0<sub>54</sub>or,
8-9) From the fermentation the culture is transferred to a 1500 liter New Brunswick Scientific fermenter, IF-15000
194 loaded with 1200 liters of itryptic soy broth without inst ·
L) 3 The. ...
dextrose (36,000 grams), 6,000 grams of 'BiTek yeast extract, 36,000 ml of glycerol and 30.0' grams “'He'“ '2T2'<sup>: rr</sup>'dipyridyl as well as 600 ml of Mazu DF 2004 defoamer. The parameters of the fermentation are as follows: Dissolved oxygen (DO) is maintained at 60% +/- 10% with additional oxygen by increasing the agitation to 300 revolutions / minute purged with 300 to 1,100 liters of air / minute and a back pressure of 34 kPa (5 pounds per square inch (psi)). As the fermentation progresses, supplemental oxygen is added at 0-90 liters / minute to help control dissolved oxygen. The pH is kept constant between 6.9 and 7.4 by automatic titration with 50% NaOH and 10% HC1 and the temperature is maintained at 37 ° C.
Approximately 5 hours after inoculation of the large heater, the culture is supplemented with additional nutrients by feeding 70 liters of medium containing 18,000 grams of TBS without dextrose, 3,000 grams of yeast extract, 30.0 grams of 2,2-dipyridyl and 18,000 ml. glycerol. The feed rate is adjusted to approximately 28 liters / hour while agitation is increased. At the end of the feeding the fermentation is allowed to continue for an additional 4 hours, at which point the fermentation ends by lowering the temperature of the heater to 18 ° C (DO<sub>540</sub>, 35-40 at a 1: 100 dilution).
195
Harvest j [
IHS'ITUT-i '
Ι1Ξ 1.Λ '<·' .. '<You' <)
Bacterial fermentation is concentrated and washed using a Pall Filtron Tangential kit (Pall Filtron Corporation, Northboro, MA) equipped with three Alpha 30.0-K 2.8m open channel filters<sup>2</sup> (30 square feet), catalog number AS300C5, (Pall Filtron) connected to a Waukesha Model U-6 0 feed pump (Waukesha
Cherry-Burrell, Delevan, WI). The original 1250 liter culture volume is reduced to 50 liters (2.5 liters / minute) using a filter inlet pressure of 207 kPa (30 psi) and a retentate pressure of 34 kPa-41 kPa (5-6 psi) . Bacterial retentate is back pressure adjusted to 150 liters using Tris buffered saline, pH 8.5 and then concentrated back to 50 liters to help remove any contaminating exogenous proteins, such as exoproteins, to include secreted toxins and proteases. The high pH of Tris-buffered saline helps avoid much of the proteolytic degradation that can occur during storage of a whole cell suspension. Protease inhibitors can be used instead of or additionally at high pH. The retentate is scrupulously mixed while in a 200 liter tank using a bottom mount magnetically driven mixer. The retentate is supplied sterile (3.5 liters) in Nalgene containers of 4
196
<img file="MX339461B_D0119.tif" />
sterile liters Number 2122 and is placed in a <$ k ^ éíad.gx a
<img file="MX339461B_D0120.tif" />
-20 ° C for storage as a breaking point in processing, or can be further processed. The sediment mass is calculated by centrifuging 30 ml samples of the fermented culture and the final harvest. Briefly, pre-weighed 50 ml Nalgene conical tubes are centrifuged at 39,000 xg for 90 minutes in a centrifuge
Beckman J2-21 using a JA-21 rotor (Beckman Instruments,
Palo Alto CA). At the end of the run, the supernatant is shaken off and the tubes are weighed again. The sediment mass is calculated for each stage. The fermentation procedure provides a wet sediment mass of approximately 60 kilograms.
<img file="MX339461B_D0121.tif" />
Breaking off
80 kg of bacterial cell suspension in Tris buffered saline, pH 8.5, is aseptically transferred into a stream instead of the 1000 liter jacket processing tank (Lee, Model 259LU) with a top mounted mixer ( Eastern, model TME-1/2, EMI Incorporated, Clinton, CT) containing 900 liters of TBS, pH 8.5. The bulk bacterial suspension is cooled to 4 ° C with continuous mixing for 18 hours at 200 rpm during which time it is broken by homogenization. Briefly, a 1000 liter tank containing the bacterial suspension is connected to an AVESTIN homogenizer
197 model C-500-B (Avestin Inc, Otawa,
<img file="MX339461B_D0122.tif" />
IKDL'STRÍii '' MÍL'W process tank with jacket, 1000 liters (empty) is ”connected to the homogenizer so that the fluid in the processing tank can be passed through the homogenizer, inside an empty tank, and back again, allowing multiple homogenization cases while still maintaining a closed system. The temperature during homogenization is maintained at 4 ° C. At the start of the first pass fluid is circulated at 482 kPa (70 psi) via a Waukesha model IODO (Waukesha) pump through the homogenizer (500 gallons / hour (1892.70 1 / hour))) while the pressure of the homogenizer is adjusts to 207 MPa (30,000 psi). Before the first pass, two samples of prehomogenize are withdrawn from the homogenizer to establish an initial value to determine the degree of rupture and monitor the pH. The degree of rupture is monitored by transmittance (% T at 540 nm at a 1: 100 dilution) compared to the non-homogenized sample. The number of passes through the homogenizer is stabilized to provide a final transmittance percentage between 78-91% T at a 1: 100 dilution, preferably between 86-91%. After homogenization, the tank is removed from the homogenizer and placed in a cooling circuit at 4 ° C and mixed at 240 rpm.
Protein Harvest
The broken bacterial suspension it contains
198 iron-regulated proteins as illustrated
<img file="MX339461B_D0123.tif" />
í la! Fig. 1 is collected by centrifugation using the T'-li / Sha-rples kit;
<img file="MX339461B_D0124.tif" />
(Alfa Laval Separations, Warminster, PA).
1000 liter jacket processing tank containing the broken bacterial homogenate is supplied as feed in 12 Sharples with a feed rate of 250 ml / minute at 117 kPa (17 psi) at a centrifugal force of 60,000 x g. The effluent is collected in a second 1000 liter jacket process tank through a closed sterile loop allowing multiple passes through the centrifuges while maintaining a closed system. The temperature during centrifugation is kept at 4 ° C. The homogenate is passed 8 times through the centrifuges. Approximately 50% of the protein is collected after the second pass, at which point the homogenized fluid is concentrated to 1/3 of its original volume, which shortens the process time in the following 6 passes. The homogenate tank is aseptically disconnected from the centrifuges and connected to a Millipore Pellicon tangential flow filter assembly (Millipore Corporation, Bedford, MA), equipped with a 2.3m screen channel filter.<sup>2</sup> (25 square feet) Alpha 30K series (Pall Filtron) connected to a Waukesha model U30 feed pump for concentration. After concentration, centrifugation continues until the process ends.
199
After each pass the protein is collected. ifL¡á protéíná —te.
INSTÍTUTC: ·· .. j is collected, resuspended and supplied in 50 <sup>[</sup>-'<sup>Ε</sup>1 ^^^ de., Tris buffered saline, pH 8.5 qpg contains 0.15% formulin (Sigma) as a preservative.
Diafiltration
The protein suspension is washed by diafiltration at 4 ° C to remove any exogenous protein (proteases, toxins, cytoplasmic and metabolic enzymes, etc.). Briefly, the 50 liters of protein are sterile transferred into a 200 liter process tank containing 150 liters of sterile Tris buffered saline, pH 8.5 equipped with a Dayton bottom mount mixer, model 2Z846 (Dayton Electric, Chicago, IL) that rotates at 125 revolutions / minute. The processing tank is sterilely connected to a Millipore Pellicon tangential flow filter assembly (Millipore Corporation) equipped with a 2.3m screen channel filter<sup>2</sup> (25 square feet), Alpha 30K Centrassette (Pall Filtron) connected to a Waukesha Model U30 Feeding Pump. The 200 liters of protein solution are concentrated by filtration to a target volume of 50 liters, at which point 150 liters of sterile saline are added. The protein suspension is then concentrated to approximately 50 liters. Protein concentrate is stored in a 50 liter process tank, with jacket, equipped with a mounted mixer
<img file="MX339461B_D0125.tif" />
200 at the top and stored at 4 ° C
<img file="MX339461B_D0126.tif" />
¡Nstííu.
It is interesting to note that the derivative of the large-scale procedure ^ ^ jjJtilizajidQ, homogenization as a rupture medium generated band formation profiles identical to those examined by SDS-PAGE compared to the smaller-scale procedure described in Example 1. These results show that lysostaphin can be substituted as a bacterial lysing agent using the AVESTIN C500-B homogenizer. This discovery allows the low-cost generation of large volumes of iron-regulated proteins from staphylococci.
EXAMPLE 8
HYPERIMMUNIZATION OF MICE AND PREPARATION OF ANTIBODY
POLYCLONAL
Passive immunization with purified antibody isolated from mice vaccinated with proteins derived from S. aureus strain ATCC 19636 that grows under iron limiting conditions is protective against homologous and heterologous exposure of S. aureus. Fifteen adult CD1 mice are vaccinated as described in Example 3 with the protein composition derived from S. aureus strain ATCC 19636 that grows under decreased iron conditions, as described in Examples 1 and 2. Mice were vaccinated intraperitoneally 3 times at 7 day intervals with 50 pg of protein composition in each vaccination. Seven days
201 after the third immunization to mice · • 1 V. .A ·<sup>;</sup>· Completely extracted blood by cardiac puncture. The serum was accumulated and the antibodies were purified using conventional ammonium sulfate precipitation. Exogenous serum proteins were first separated before antibody precipitation by adding 0.5 volumes of saturated ammonium sulfate, pH 7.2. The solution is stirred at 100 rpm for 24 hours at 4 ° C. The solution is centrifuged again at 3000 xg for 30 minutes. The supernatant is collected and precipitated again by adding enough saturated ammonium sulfate to bring the final concentration to 55% saturation. The solution is stirred at 100 rpm for 24 hours at 4 ° C. The precipitate is centrifuged at 3000 xg for 30 minutes. The final pellet from each sample is resuspended in 2 ml of PBS, pH 7.2. The precipitated antibodies are then dialyzed using a 50,000 molecular limit dialysis tubing (Pierce, Rockford IL) for 30 hours against three 1 liter changes of phosphate buffered saline to remove ammonium sulfate. The first two liter changes were preserved with sodium azide
0.02%. The final change of 1 liter damper does not contain preservative. The dialysate is collected and centrifuged again to remove any remaining residue, at 3000 xg for 30 minutes. The antibody solution is stored at 4 ° C for less than 48 hours before use. Each sample
202
INSTITUTE ·.? ''
FROM EA!. · '·. ¡
INDUii i · plated on blood agar for 7fvé'rif i car i sterility before infusion.
EXAMPLE 9
PASSIVE IMMUNIZATION AND EXPOSURE
In order to assess the protective effect of the infusion-supplied antibody generated against S. aureus proteins expressed during iron limitation, two groups of 15 mice each were infused intraperitoneally with either the purified antibody preparation (group 1) or physiological saline solution (group 2) in an infusion of 200 μΐ. Two additional groups of 15 mice each were supplied by subcutaneous infusion with either the purified antibody preparation (group 3) or physiological saline (group 4). After 60 minutes, the two groups of 15 mice received an intraperitoneal infusion and were exposed intraperitoneally with 1.3 x 10<sup>8</sup> CFU of S. aureus strain 19636. Similarly, the two groups of 15 mice that received a subcutaneous infusion were exposed subcutaneously with 1.3 x 10<sup>8</sup> CFU of S. aureus strain 1477 to test cross protection against exposure by a different strain of S. aureus. Mortality and / or lesion size was recorded for 5 days and the livers of all mice were excised post-mortem, homogenized, and plated to determine the number of S. aureus.
203 present as a measure of systemic infection ^. fbíásÍ / 'Ciirvas ínst:
Kaplan-Meier survival (Figures 5 and 6) showed the protective effect provided by the infusion of anticucrpo-s from mice vaccinated with S. aureus proteins expressed during iron restriction. Although the difference between the groups supplied by infusion and the control for the groups exposed to ATCC 19636 is not significant (p = 0.076, logarithmic classification test), the liver of a single mouse that died within the group at that was subjected to antibody infusion on day 1 was cultured on blood agar to determine the absence and / or presence of the exposure organism (S. aureus). The culture derived from this mouse was negative for Staphylococcus and showed no growth on the blood agar plate or culture medium. In contrast, the livers of mice that died within the placebo group were all positive for the presence of Staphylococcus, in fact, pure cultures were obtained on each agar plate of blood derived from the livers of these mice. Although the liver data do not preclude the possibility that the mouse that died within the group infused with the antibody died from S. aureus infection, the infection was not systemic and as in the placebo group, and the mouse probably died for other reasons. By not taking into account the death of the mouse that was administered by
204 antibody infusion results in a difference ^ rto * r<sup>tlva</sup> between supply treatments by <sup>neither</sup>antibody and placebo (p = 0.015, logarithmic classification test). The data for cross-exposure, where mice were infused with antibody generated after vaccination with proteins derived from ATCC 19636 and exposed by S. aureus strain 1477 also show a protective trend. Between 7 and 14 days post challenge all mice in the infusion and non-infusion groups began to develop necrotic skin lesions. However, the general examination of the mice clearly showed a visible delay in the formation of an observable lesion as well as in the severity of the lesion between the groups. Mice given the infusion developed lesions more slowly compared to control mice not given the infusion, which developed lesions faster than the mice given the infusion and to a degree of greater severity. Mice given the infusion healed faster than mice that were not given the infusion. This is clearly evident at 21 and 35 days after exposure. Overall examination of the mice at 35 days post challenge showed that the mice that were not
205 supply the infusion were seriously deformed <sup>z</sup>and 'MEivcve institute <sup>;</sup>J showed a higher degree of scarring. In fact V, bííÍÜ) Sh¿> e .____ of these mice lost their normal posture in ,, Ja., Measure. ,, jsn. ·, ________ which showed a crooked appearance, in contrast to the mice supplied with the infusion which did not nearly develop extensive scar tissue and / or disfigurement as illustrated by the crooked appearance of mice that were not infused. Overall, these data suggest that intraperitoneal infusion of antibodies generated against iron-induced proteins from S. aureus may protect and limit the severity of S. aureus infection.
EXAMPLE 10
EVALUATION OF A VACCINE COMPOSITION DERIVED FROM
Staphylococcus Aureus IN A MILK PRODUCING HERD
CHRONICALLY INFECTED
A commercial milk producer herd exhibiting a history of chronically high somatic cell counts attributable to Staphylococcus aureus was selected for evaluation of a vaccine composition as described in Example 1. The criterion for establishing the vaccine efficacy of this experimental study is: 1) decreased incidence of clinical mastitis caused by Staphylococcus aureus among vaccinates compared to non-vaccinated controls, 2) improvement (i.e. a decrease)
206 in somatic cell count between
<img file="MX339461B_D0127.tif" />
VA T dp's': en
IN3TJ71 comparison with controls and 3) decrease in as - tasab * ....... of positive isolation of culture of S. '' aureus * entiv · ^ 'vaccinated and unvaccinated controls. Blood will be taken at the time of the first vaccination (day 0) and again 3 and 6 weeks after the initial immunization. Injection site reactions or systemic reactions after vaccination were monitored during the study. In addition, bulk tank milk samples were taken and quantitatively enumerated to determine if there was a decrease in the number of CFUs of Staphylococcus aureus cultured after vaccination.
Three of the Staphylococcus isolates derived from chronically infected lactating cows within the herd were grown under conditions of iron restriction and under conditions without iron restriction as described in Example 1. The three isolates were named
TTX101, TTX102 and TTX103. The extracted samples were examined by SDS-PAGE to compare the profiles of band formation between the isolates. Identical band information profiles were observed among the isolates examined; Compositions made from each isolate included proteins having molecular weights of 87.73 kDa, 80.46 kDa, 65.08 kDa, 54.53 kDa, 37.37 kDa,
35.70 kDa, 34.91 kDa, 33.0 kDa and 31.83 kDa. These proteins
207 they are of the same molecular weights at |> s; \ 'described by institute? · previously in Table 7. Furthermore, when they were deleted'. isolated log, fnrniani on profiles of ......... bagrja identical with those proteins that are expressed in all conditions and that were not regulated by iron are observed: 150 kDa,
132 kDa, 120 kDa, 75 kDa, 58 kDa, 50 kDa, 44 kDa, 43 kDa, 41 kDa and 4 0 kDa. These results agree with previous observations. An isolate designated as PTX101 was selected as the isolate for the manufacture of a composition to be used in this study.
EXAMPLE 11
PREPARATION OF VACCINE OF Staphilococcus aureus (TTX101)
A composition was prepared as described in Example 1 using isolate TTX101. The composition includes proteins expressed under decreased conditions of
<td>iron that</td><td>present weights</td><td>molecular</td><td>of</td><td> 87.73</td><td>kDa,</td>
<td>80.46 kDa,</td><td>65.08 kDa, 54.53</td><td>kDa, 37.37</td><td>kDa,</td><td> 35.70</td><td>kDa,</td>
<td>34.91 kDa,</td><td>33.0 kDa and 31.83</td><td colspan="2">kDa as well as</td><td>protein</td><td>no</td>
<td colspan="3">regulated by metal presenting weights</td><td colspan="2">molecular</td><td>of</td>
<td colspan="2">150 kDa, 132 kDa, 120 kDa, 75</td><td>kDa, 5 8 kDa,</td><td> 50</td><td>kDa, 44</td><td>kDa,</td>
kDa, 41 kDa and 40 kDa. The immunizing composition derived from the TTX101 strain was used to prepare the experimental vaccine by emulsifying the suspension of this extracted protein (400 gg of total protein per milliliter) in a commercial adjuvant (EMULSIGEN, MVP Laboratories, Ralston NE)
208 using an IKAlultiaj Turrax homogenization container
INSTITUTE ····'·:-· ' :
OF THE Γ: ??,
T-50 (IKA, Cincinnati, OH) to provide a doéTsf<sup>1</sup> Final— 800 gg of total protein in 2.0 ml of vo 1 ümefr myecva'Bl'g 'with an adjuvant concentration of 22.5%, volume / volume. The vaccine was administered subcutaneously 2 times at 21-day intervals.
EXAMPLE 12
EXPERIMENTAL DESIGN AND VACCINATION OF THE HERD
Eighteen days before the first vaccination all lactating cows included in the study (N = 80) were tested for the presence of S. aureus by standardized aerobic bacteriological culture method by culturing individual milk samples derived from each cow infant. In addition, somatic cell counts (SCC) were listed by the Dairy Herd Improvement Association using conventional methods. Forty of the 80 cows were clinically diagnosed with mastitis and had positive cultures for S. aureus. The remaining cows (N = 66) gave a negative test for S. aureus. The 80 cows were divided equally into two groups designated as group 1, vaccinated (N = 40) and group 2, unvaccinated (N = 40). The 14 clinically positive cows diagnosed with Staphilococcus were distributed equally between both groups so that each study group contained 7 cows with clinical mastitis. SCCs averaged across groups before
209 the first vaccination was 203,219 in the Jc ^^ rS ^ l ^ s £> no
INST¡T; J<sup>r</sup>OV üt. '·. A ':' 'i vaccinated compared to 24 0.443 in the vaccinated- (not statistically different, p = 0.7). —-—-— · - ·
Eighteen days after the first sampling all cows in group 1 were vaccinated subcutaneously in the upper right shoulder with two ml of vaccine as described in Example 11. Ten days after the first vaccination milk samples were taken in this period of DHIA time for enumeration of somatic cells from each individual cow. Milk samples were not bacteriologically tested in this time period to determine the presence of Staphylococcus. The difference in SCCs between groups in this time period was 125,241 (vaccinated) compared to 196,297 (controls).
There is a 36% difference in somatic cell number between the vaccinated compared to the unvaccinated controls. The difference in SCC between controls and vaccinates in this sampling period is not statistically different (p = 0.5). The lack of statistical difference in SCC between groups in both sampling periods is due to the large variation in individual SCC between cows. The injection site of each vaccinated cow was also examined in this same time period. None of the cows showed an adverse tissue reaction at the injection site by physical examination. Furthermore, there was no measurable loss in
210 milk due to vaccination. Ί5Γ 'at 70 tf
JL 17.1 At .1 days after the first- 'vátChl ^ Lahíon in group 1 (vaccinated) they were administered the production of
To all cows their second vaccination or booster. During the period of time between the first and second vaccination, cows in both groups (both vaccinated and controls) developed teat damage due to a noticeable decrease in ambient temperature resulting from the formation of lesions at the end of the theta, which results in the development of infected teats and potentially increases Staphylococcus isolation during sampling, which was observed in the third sampling period. 23 days after the second vaccination, milk samples were taken by DHIA to enumerate somatic cells from each individual cow. Milk samples were also bacteriologically tested to determine the presence of Staphylococcus aureus. There was a notable increase in the isolation rate of S. aureus in this time period in cows that tested negative in the first sampling period. In the unvaccinated controls, 42.9% of these cows now tested positive for S. aureus, in contrast to the vaccinated which only showed an increase of 35.5%. This is a 7.4% difference between vaccinates and comparison with unvaccinated controls. It is difficult to say that the improvement in the isolation rate of S.
211 aureus in the vaccinated group was due to the effect ^ cfé; ':; Í3' vhóuna *. only. One cannot help but consider the difficulty in obtaining samples of clean milk which —- that - »- showed damage to the teats which may increase the potential contamination of milk by S. aureus when the sample is obtained. However, there was a significant difference in the average SCC between those vaccinated, compared to controls. The average SCCs of the vaccinated group were 222,679 compared to 404,278 somatic cells measured in the control group. This is a 44.9% difference between the vaccinates when compared to the unvaccinated controls. It is interesting to speculate that the difference observed in the SCCs between these groups also coincide with the differences in the isolation rate of S.
aureus between groups. However, due to the large variation in SCC between individual animals and the small sample size of the experimental trial in the number of animals, the difference was not statistically different (p = 0.28).
In this same time period, the vaccinated cow injection site was examined for any adverse tissue reactions that may have been caused by the vaccine composition. None of the cows examined showed any adverse reaction at the injection site by physical examination. The vaccine compositions appear to be highly tissue compatible and did not cause measurable loss in
212 milk production after each vaccination
<img file="MX339461B_D0128.tif" />
Cow monitoring was continued by measuring 1-aS:
<img file="MX339461B_D0129.tif" />
SCC and milk samples to determine ™ ia. ~ ^ £ eseíie.i¿u - Ofc- »~» ~ w absence of Staphylococcus aureus. Some of the cows in each group were vaccinated a third time 42 days after the second vaccination. There appears to be a difference that favors the use of the vaccine composition to decrease somatic cell counts and control Staphylococcus aureus infection. Additional monitoring includes serology based on antibody titers to the vaccine composition, changes in milk production in vaccinated cows due to improved health, and decreased SCC of vaccinated animals compared to unvaccinated groups. In addition, other experiments were carried out to investigate the protection index of the vaccine based on the dose response after exposure to virulent S. aureus.
EXAMPLE 13
Since the molecular weights of the proteins between the different strains of S. aureus have been shown to be similar and since heterologous protection is observed in the exposure study in mice, we seek to determine the proteins that share molecular weights similar to that of Figure 1 are similar proteins. The technique selected to characterize proteins was
213 desorption / ion mass spectrometry ^^ ijoñ'- .iláSer. . · Matrix Assisted (MALDI-MS)<sup>T</sup>'áaagl.aes ^ ?. portion of the composition was resolved using SDS-PAGE
................. tj. 7 · Γ. · [· Ί? ΊίιΓ: 7πνη — βμ · ιτ as described in Example 1 and the gel was stained with bright Coomassie blue. to visualize proteins.
MATERIALS AND METHODS
Cut and wash. The gel was washed for 10 minutes with water, twice, each protein band of interest was cut as close to the protein band as possible to reduce the amount of gel present in the sample.
Each gel cut was cut into 1 x 1 mm cubes and placed in a 1.5 ml tube. The gel pieces were washed with water for 15 minutes. All the volumes of solvent used in the washing steps were approximately equal to twice the volume of the gel cut. The gel cut is then washed with water / acetonitrile (1: 1) for 15 minutes. When the proteins have been silver stained, the water / acetonitrile mixture is removed, the gel pieces are dried in a SPEEDVAC concentrator / vacuum dryer (ThermoSavant, Holbrook, NY) and then reduced and rented as described below . When the gel pieces are not silver stained, the water / acetonitrile mixture is removed and the acetonitrile is added to coat until the gel pieces turn a sticky white color, at which point
214
<img file="MX339461B_D0130.tif" />
which acetonitrile is removed. The pieces rehydrate in 10 mM NH4HCO3 and after 5 volume of acetonitrile equal to twice pieces of gel is added. This is incubated for 15 minutes, the liquid and the seeds are separated. gel pieces are dried in a kit
SPEEDVAC.
Reduction and alkylation. The dried gel pieces are rehydrated in 10mM DTT and 100mM NH4HCO3 and incubated for minutes at 56 ° C. After allowing the tubes to cool to room temperature, the liquid is separated and the same volume of a mixture of 55mM iodoacetamide and 100mM NH4HCO3 is added immediately. This is incubated for 30 minutes at room temperature in the dark. The liquid separates, acetonitrile is added to coat until the gel pieces turn a sticky white, at which point the acetonitrile is removed. The gel pieces are rehydrated in 100 mM NH4HCO3 and, after 5 minutes, a volume of acetonitrile equal to twice the volume of the gel pieces is added. This is incubated for 15 minutes, the liquid is removed and the gel pieces are dried in a Speed vac kit. If the gel pieces are stained with Coomassie blue, the residual coomassie still remains, washing with 100mM NH4HCO3 / acetonitrile is repeated.
Gel digestion. The gel pieces are completely reduced by drying in a Speed Vac kit. The pieces are
215 rehydrate in digestion buffer (NH<sub>4</sub>HCOíj 50. imM /: C4Cl2>
jnstttüt: '<·. ; · ···; '<' -τυ ··.
mM, 12.5 nanograms per microliter (ng / μΐ) 'of typhipsin)
4 ° C. Enough buffer is added for gel ctfhr and more is added as required. The gel pieces are incubated on ice for .45 minutes and the supernatant is separated and replaced with 5-2 µΐ of the same buffer without trypsin. This is incubated at 37 ° C overnight in an air incubator.
Peptide extraction. Sufficient volume of NH is added<sub>4</sub>HCO<sub>3</sub> 25 mM to cover the gel pieces and incubate for 15 minutes (typically on a bath sonicator). The same volume of acetonitrile is added and incubated for 15 minutes (in a bath sonicator, if possible) and the supernatant is recovered. Extraction is repeated twice, using 5% formic acid instead of NH<sub>4</sub>HCO<sub>3</sub>. A sufficient volume of 5% formic acid is added to cover the gel pieces and incubated for 15 minutes (typically on a bath sonicator). The same volume of acetonitrile is added and incubated for 15 minutes (typically in a bath sonicator) and the supernatant is recovered. The extracts are accumulated and 10mM DTT is added to a final concentration of 1mM DTT. The sample is dried in a SPEEDVAC vacuum dryer / concentrator to a final volume of approximately 5 µΐ.
Salt removal of the peptides. The
216 salt the samples using pipet tips<sup>-</sup> ΖΙΡΪΓΉ? KC18, ·
JL - ~
Millipore, Billerica, MA) as suggested by the '<sup>1</sup> 'manufacturer.', .. Briefly, a sample is reconstituted in acetonitrile: H reconstitution solution 5:95<sub>2</sub>Or, trifluoroacetic acid 0.1% - 0.5%), is centrifuged and the pH is verified to determine that it is less than 3. A ZIPTIP is hydrated by aspirating 10 μΐ of solution (acetonitrile: H<sub>2</sub>OR 50:50, trifluoroacetic acid 0.1%) and aspirated aliquots are discarded. This is followed by aspiration of 10 μΐ of solution 2 (0.1% trifluoroacetic acid in H<sub>2</sub>Or deionized) and aspirated aliquots are discarded. The sample is loaded onto the tip by aspirating 10 µΐ of sample slowly into the tip, expelling it into the test tube and repeating these 5 to 6 times. 10 microliters of solution 2 are aspirated into the tip, the solution is discarded when expelled and this procedure is repeated 5-7 times to wash. The peptides are eluted by aspirating 2.5 μΐ of ice-cold solution (acetonitrile:
H<sub>2</sub>Or 60:40, 0.1% trifluoroacetic acid), expelling and then sucking the same aliquot in and out of the tip, three times. After the solution has been expelled from the tip, the tube is capped and stored on ice.
Mapping of the peptide by mass spectrometry. Peptides are suspended in 10 µΐ to 30 µΐ of 5% formic acid and analyzed by MALDI-TOF MS (Bruker Daltonics Inc.,
217
Billerica, MA). The mass spectrum of the ifrágtnept ^ s<sup>7</sup> of ,·
JÁ. -TO. IbiS'i ?.
peptide is determined as suggested by irahricánfce.
Briefly, a sample containing 1 or s ___. Peptides ...
result from a tryptic digest mixed with matrix cyano-4-hydroxycinnamic acid. transferred to a target and allowed to dry. The dry sample is placed on a mass spectrometer, irradiated and the time of flight of each ion is detected and used to determine the mass fingerprint of peptide for each protein present in the composition. Known polypeptides are used to standardize the machine.
Analysis of data. Experimentally observed masses for peptides in each mass spectrum are compared to expected protein masses using the Mascot search engine peptide mass fingerprint search method (Matrix Science Ltd., London, UK and www.matrixscience .com, see Perkins et al., Electrophoresis 20, 3551-3567 (1999)). Search parameters include: databases, MSDB or NCBInr; taxonomy, bacteria (eubacteria) or
Firmicutes (gram-positive bacteria); search type, peptide mass fingerprint; enzyme, trypsin; fixed modifications, carbamidomethyl (C) or none; variable modifications, oxidation (M), carbamidomethyl (C), or a combination, or none; mass values, monoisotopic; protein mass,
218 not restricted; peptide mass tolerance, in |; i | <vj £ gj
IKSTITilJ'- '' * NO 'i A i -, ·'. í ΐ *. ·<sub>t</sub>^. 3 * · and ± 430 ppm or ± 1 Da; peptide charge state, - My? *;
maximum loss separations 0 or 1; number of questions, 20.
RESULTS
The results of this investigation are a mass fingerprint for each protein present in the composition shown in Tables 2, 3, 4 and 5.
EXAMPLE 14
IDENTIFICATION OF IRON REGULATED PROTEIN FAMILIES
USING GENE EXPRESSION ANALYSIS BASED ON
S. Aureus MICROAREGLE THAT GROWS UNDER LOW CONDITIONS OF
IRON
For microarray analysis, bacteria are grown in chemically defined media (CDM) made from individual concentrated solutions (Table 10).
TABLE 10; CHEMICALLY DEFINED MEDIA (CDM) FOR
<td>Salts (20X)</td><td>[Final] g / i</td><td>Composition concentrated, g / 500 mi</td><td>Add to 1 1 50 mi</td>
<td>K<sub>2</sub>HPO<sub>4</sub></td><td> 7</td><td> 70</td><td></td>
<td>kh<sub>2</sub>po<sub>4</sub></td><td> 2</td><td> 20</td><td></td>
<td>Na citrate<sub>3</sub></td><td> 1.47</td><td> 14.7</td><td></td>
(NH<sub>4</sub>)<sub>2</sub>SW<sub>4</sub>
219
<td>Carbohydrates (40X)</td><td>g / i</td><td>g / 500 mi</td><td>IMPW MEXICAN INSTITUTE And? / Ζ'Γν'λ ».</td>
<td>Glucose</td><td> 5</td><td> 100</td><td></td>
<td>Vitamins</td><td>mg / 1</td><td>mg / 100 ml</td><td>1 mi</td>
<td>(1000X)</td><td></td><td></td><td></td>
<td>Thiamine</td><td> 1</td><td> 100</td><td></td>
<td>Acid</td><td> 0.5</td><td> 50</td><td></td>
<td>nicotinic</td><td></td><td></td><td></td>
<td>Biotin</td><td> 0.005</td><td>dilution*</td><td></td>
<td>Pantothenate of</td><td> 0.25</td><td> 25</td><td></td>
<td>calcium</td><td></td><td></td><td></td>
<td>Nucleotides</td><td>mg / 1</td><td>mg / 100 ml *</td><td>10 mi</td>
<td>(100X)</td><td></td><td></td><td></td>
<td colspan="2">* Dissolve in 100</td><td></td><td></td>
<td>my from HC1 2N</td><td></td><td></td><td></td>
<td>Adenine</td><td> 5</td><td> 50</td><td></td>
<td>Guanina</td><td> 5</td><td> 50</td><td></td>
<td>Cytosine</td><td> 5</td><td> 50</td><td></td>
<td>Uracil</td><td> 5</td><td> 50</td><td></td>
<td>Timina</td><td> 10</td><td> 200</td><td></td>
220
<td>GM Micronutrients</td><td>mg / 100 ml of J] VI Jl & á '♦,</td>
<td>(1000X)</td><td>• "TO concentrate AB * u: 'st.-ial</td>
★ Make concentrates A and B, then add ^^^ l ^ de ^ -each ^^^ · one to 98 ml of ddH<sub>2</sub>Or to make a final concentrate (A)
<td>CaCl<sub>2</sub> 0.5</td><td> 735</td>
<td>H<sub>3</sub>BO<sub>3</sub> 0.5</td><td> 309</td>
<td>CoCl<sub>2</sub> 0.05</td><td> 118</td>
<td>(NH<sub>4</sub>)<sub>6</sub>Mo<sub>7</sub>0<sub>24</sub> 0.0 0 5</td><td> 62</td>
<td>(B)</td><td></td>
<td>CuS0<sub>4</sub> 0.1</td><td> 125</td>
<td>MnSO<sub>4</sub> 0.1</td><td> 169</td>
<td>ZnSO<sub>4</sub> 0.05</td><td> 144</td>
<td>Individual</td><td></td>
<td>MgSO<sub>4</sub> 100</td><td></td>
<td>FeSO<sub>4</sub> or another 10-50</td><td></td>
<td>Amino acids mg / ml</td><td>g / 100 mi 5 mi</td>
<td>(200X)</td><td></td>
★ Autoclave, unless otherwise indicated
<td>Refrigerate</td><td></td>
<td>Aspartic acid 90</td><td> 1.8</td>
<td>(0.1 M HCl)</td><td></td>
<td>Proline 80</td><td> 1.6</td>
221 jíB ίθ-ii<sup>1</sup>
<td>To the girl</td><td> 60</td><td> 1.2</td>
<td>Histidine</td><td> 20</td><td> 0.4</td>
<td>Valine</td><td> 80</td><td> 1.6</td>
<td>Arginine</td><td> 50</td><td> 1.0</td>
<td>Serine</td><td> 30</td><td> 0.6</td>
<td>Methionine</td><td> 3</td><td> 0.06</td>
<td>Isoleucine</td><td> 30</td><td> 0.6</td>
<img file="MX339461B_D0131.tif" />
I jL A
ÍKSTIT'JTO MSXfO.NO DS LA? ΚΤ? 1'ΌΑΓ> r-'D'J-STRJAL
<img file="MX339461B_D0132.tif" />
Refrigerated filtering in the dark
<td>Tryptophan</td><td> 10</td><td> 0.2</td>
<td>Tyrosine (NaOH,</td><td> 50</td><td> 1.0</td>
<td>0.5 M)</td><td></td><td></td>
<td colspan="2">Room temperature</td><td></td>
<td>Glutamic acid</td><td> 100</td><td> 2.0</td>
<td>Leucine</td><td> 90</td><td> 1.8</td>
<td>Phenylalanine</td><td> 40</td><td> 0.8</td>
<td>Glycine</td><td> 50</td><td> 1.0</td>
<td>Threonine</td><td> 30</td><td> 0.6</td>
<td>Lysine</td><td> 50</td><td> 1.0</td>
<td>Daily</td><td></td><td></td>
<td>cool</td><td></td><td></td>
<td>Cysteine</td><td> 20</td><td> 0.4</td>
PREPARATION METHOD. To make iron-free medium, combine all concentrated solutions except the
222 F
rfj.'aarvf s
<img file="MX339461B_D0133.tif" />
cations and micronutrients and a volumetric flask using MilliQ purified water is brought to volume ^ -j ^^^ g ^ p 'gn' and sufficient volume is left empty to accommodate the addition of cations. Add 15 g of CHELEX resin per 1 1 of medium and stir at room temperature for at least 2 hours.
Filter the solution into a glass bottle treated with sulfuric acid (10%) using a filter at the top of the 2 μπι bottle. Filtered concentrated cation solutions are added and stored at 4 ° C in the dark for up to 2 weeks.
S. aureus strains RF122 (isolated from bovine mastitis) and MSA553 (isolated from human toxic shock syndrome) were used. Both isolates were streaked on tryptic soy broth agar directly from frozen concentrates by secondary passage before use in the experiments. The CDM contained the final citrate concentrations approximately analogous to those of bovine milk (5 mM). For iron-free CDM the following components (total volume 0.998 1) were combined and added to 15 g of CHELEX resin (BioRad Laboratories, Hercules, CA) and then stirred for 1.5 hours at room temperature: salt, glucose, amino acids, vitamins and nucleotides. The iron-free base medium is then filtered using filters at the top of the 2 μπι bottle (Nalgene Nunc International, Rochester NY) into bottles treated with
223
ΙΝΓΤΠ
Τα «'Ύτ:> ν
Μ. r i.
sulfuric acid after which added f ^ Uf ^ S 'micronutrients and MgCl<sub>2</sub> 100 μΜ (both solutions g ..... propagated-in glass kit treated with acid, with MilliQ water). CDM was stored at 4 ° C in the dark until use.
A single bacterial colony is inoculated in 3 ml of
Iron-free CDM in 2 5 ml acid-treated glass culture tube and shake overnight at 25 0 rpm in an incubator, at 37 ° C. One milliliter of the subculture is then used to inoculate 500 ml of CDM in a 2,500 ml Erlenmeyer flask the next day. Cultures are incubated at 37 ° C with shaking at 250 rpm. Cultures of iron-decreased CDM require approximately 2 times as much as CDM +
FeSO<sub>4</sub> 50 μΜ to reach an OD of 1.0 (18 hours versus hours). In the middle of the logarithmic phase (OD = 0.600), 4 x 100 ml aliquots of culture are distributed in 500 ml Erlenmeyer flasks and allowed to shake in the incubator for 10 minutes before the addition of the iron solutions experimental. To a flask, 300 µΐ of bovine lactoferrin (50 ml / ml, SigmaAldrich, St. Louis, MO) is added for a final concentration of 150 gg / ml. To another flask, 50 μΐ of ferric citrate (100 mM) are added. The remaining two control flasks received no supplementation. At 5, 30, 60 and 12 0 minutes, 7.5 ml of culture were collected and added to 5 ml of guanidine thiocyanate solution containing β-mercaptoethanol and
224 sodium lauryl sarcosine 0.5%
The solutions
IMTIí '
OF THE rüOFitLAC
XJSTKIAL
<td>esc rupulously</td><td>for</td><td>stop the</td><td>transcription</td><td>and</td><td>I know</td>
<td>centrifuged</td><td> 4,000</td><td>xg during</td><td>8 minutes to</td><td>8 ° C;</td><td>he</td>
<td>supernatant is</td><td>To stop</td><td>by pouring and</td><td>cells are</td><td colspan="2">freeze</td>
<td>in 250 μΐ of</td><td>Trizol</td><td>(Invitrogen)</td><td>using a</td><td>bath</td><td>. of</td>
ethanol / dry ice, then stored at -80 ° C until RNA extraction.
For RNA extraction, the cell pellets were reheated on ice and 750 µΐ of Trizol (Invitrogen, Carlsbad CA) was added. The cells were swirled and the suspension was transferred to a 2 ml screw cap tube containing silica-zirconium beads of
0.1 mm, then shake 3 x 2 minutes in a BeadBeater kit (Biospec Products, Inc., Bartlesville, OK) with ice incubation between repeats. The suspensions were incubated for an additional 20 minutes at room temperature, followed by centrifugation to sediment the beads and the cellular components. 400 µΐ of chloroform were added and mixed by inversion, incubated for 10 minutes at room temperature and the tubes were centrifuged for 8 minutes at 12,000 X g at 8 ° C. The aqueous layer was separated and the RNA was precipitated with 400 µΐ of isopropanol followed by washing with 1 ml of 70% ethanol. Clear RNA pellets were air-dried briefly and resuspended in 100 µΐ H-free ribonuclease<sub>2</sub>0. DNA is digested using the DNase kit
225 Pl
<img file="MX339461B_D0134.tif" />
MÍXICANO INSTITUTE. ,,. ...? ROP1F.QAD V (Qiagen, Valencia CA) standard following by l'a.impa-eza 'according to the manufacturer's recommendations
RNase (Qiagen). Finally, a Turbo DNA-free kit (Ambion, Austin TX) is used to ensure DNA removal from the preparation. RNA is measured on an otometer spectrograph and run in an Agilent Bioanalyzer Kit (Agilent, Palo Alto CA) to verify quality and quantity prior to generation of the cDNA for microarray hybridization.
Microarray analysis is carried out according to established procedures. This array, showing 3,841 70-unit oligonucleotides (Illumina, San Diego CA) representing the open reading frames (ORFs) of nine sequenced S. aureus genomes including RF122 and MSA553, plate triplicate dots coated with aminosaline Gaps II (Corning, Acton MA) using the BioRobotics Microgrid II Array Spotter Kit (BioRobotics, Cambridge UK). The slides were rehydrated, UV crosslinked, and stored until dry. Immediately before hybridization the
<td>slides were incubated for</td><td> 1</td><td>hour</td><td>to</td><td> 42</td><td>° C</td><td>in</td>
<td>prehybridization buffer which</td><td colspan="2">consists</td><td>of</td><td> 25</td><td>me</td><td>of</td>
<td>formamide, 12.5 mi from SSC 20X, 12 mi</td><td>of</td><td>dH<sub>2</sub>OR,</td><td> 500</td><td>μΐ</td><td>of</td><td>SDS</td>
<td>10% and 0.5 g of BSA. The slides</td><td>I know</td><td colspan="2">incubated</td><td>with</td><td> 2 1</td><td>of</td>
MilliQ water and dried by centrifugation. To prepare the samples, 8-10 μg total bacterial were incubated with 20 μg
226 random hexamer at 70 ° C for
<img file="MX339461B_D0135.tif" />
TZ nüt¿s' \
<img file="MX339461B_D0136.tif" />
followed by reverse transcription with amino-allyl incorporation using Superscript II (Invitrogen) and amino-allyl coupled to dUTP (Sigma). The labeled cDNA is neutralized, purified, dried and resuspended with Cy3 or Cy5 fluorescent dyes (Amersham Biosciences Corp., Piscataway NJ); the coupling takes place for hours. Fluorescently labeled cDNA samples (12 µΐ each) are washed using the Qiagen PCR Purification Kit, combined and added to 9.8 µΐ of formamide, 6.8 µΐ of 20X SSC, 3.4 µΐ of salmon sperm DNA ( 10 mg / ml, Invitrogen) and 1 μΐ of 10% SDS. The samples are incubated for 2 minutes at 99.9 ° C in a thermal cycler and allowed to cool prior to application to the array. The probes are then applied to the array, covered with a glass coverslip, and incubated overnight at 42 ° C in a water bath. Slides are scrupulously washed in diluted SSC buffers after 12-16 hours of incubation and scanned using an Axon 4100B Scanner Kit and Axon GenePix program (Axon Instruments, Union City CA). The raw intensity data is exported to GeneSpring (Agilent Technologies, [Silicon Genetics], Palo Alto CA) for normalization and filtering. Points are normalized
227 globally, they are filtered based on<sup>1</sup> H of • in? · · '· · <- <l minimum untreated intensity (> 1500) and tripl<sub>:</sub>icados - <sup>x,</sup>'i are averaged. Each experiment is 1 cam ^ a ^ jcaU ^^ as ^^ - times and a single slide is run for each use of a dye sweep between coincident time points. In this way, at least 6 dye-scanned data points are generated for each gene at each time point, representing at least 2 biological duplicates. Data is further analyzed by hierarchical grouping (Euclidean distance, average link, UPGMA) and grouping
K-medium (measured distance based on non-centered correlation) and EPCLUST (Jaak Vilo, EBI) and SpotFire (SpotFire, Somerville, MA). Significance analysis for SAM microarrays, (157)) was used in median-centered logarithm relationships using the one-class model across all time points to determine if gene expression differs significantly from zero. Strict delta values were used so that the percentage of false positive results was calculated to be zero.
Table 11 shows a summary of the operons that show similar up or down regulation by SAM analysis, which supports the ability of the arrays to detect responses.
- 228 biological ϊ-u-í.
i. TMBT4 '·' jlVa x it V '> - ·> ·' ίΓ.'ί'Τί'υτο “* λ ·; γ. <? 4ο M '\
TABLE 11. OPERATIONAL GROUPINGS WITH ANSWERS
COORDINATED TRANSCRIPTIONAL IDENTIFIED USING
MICROAREGAL ANALYSIS OF THE EXPRESSION OF THE GENE OF S. aureus
<td></td><td></td><td></td><td colspan="2">No. of expressed probes of coordinated way</td>
<td>Operon ID</td><td>Function</td><td rowspan="2">Reply</td><td>Contiguous genes</td><td>Functionally</td>
<td></td><td></td><td>unregulated</td><td>related</td>
<td></td><td></td><td></td><td></td><td>but no</td>
<td></td><td></td><td></td><td></td><td>contiguous</td>
<td>Sir</td><td>Transport</td><td>regulated by increase</td><td> 3</td><td> 0</td>
<td></td><td>cations</td><td>in low iron</td><td></td><td></td>
<td>Fhu</td><td>Transport</td><td>regulated by increase</td><td> 3</td><td> 1</td>
<td></td><td>cations</td><td>in low iron</td><td></td><td></td>
<td>Opp</td><td>Transport</td><td>regulated by increase</td><td> 9</td><td>N / A</td>
<td></td><td>oligopeptides</td><td>in low iron</td><td></td><td></td>
<td>Mnt</td><td>Transport</td><td>regulated by increase</td><td> 3</td><td> 1</td>
<td></td><td>cations</td><td>in low iron</td><td></td><td></td>
<td>Pfl (Format</td><td>Fermentation</td><td>regulated by increase</td><td> 2</td><td> 4</td>
<td>acetyl-</td><td></td><td>in the presence of</td><td></td><td></td>
<td>transferase)</td><td></td><td>lactoferrin</td><td></td><td></td>
For standard protein cloning, the appropriate genes were amplified from DNA extracted from S. aureus (strain ATCC19636) by polymerase chain reaction
229 standard. Primers are endonuclease sites shown below.
designed to incorporate,, ltj> s constraint Stul and Kphl. and ..... & e
<img file="MX339461B_D0137.tif" />
TABLE 12. CLONING PRIMERS;
<td>Gene (primer)</td><td>Priming sequence</td><td>SEQ ID NO</td>
<td>Pflb (5 'to 3')</td><td>GCAGGCCTTTAGAAACAAATAAAAATCATG</td><td> 507</td>
<td>Pflb (3 'to 5')</td><td>TATGGTACCTTACATACTTTCATGGAATGTACG</td><td> 508</td>
<td>OpplA (5 'to 3')</td><td>GCAGGCCTAAAAAAGAAAACAAGCAATTAA</td><td> 509</td>
<td>OpplA (3 'to 5<sup>1</sup>)</td><td>TATGGTACCTTATTTATACTGCATTTCATTGAA</td><td> 510</td>
<td>SirA (5<sup>1</sup> to 3 ')</td><td>GCAGGCCTTCATCTGATAGCA AAGATAAGG</td><td> 511</td>
<td>SirA (3 'to 5')</td><td>TATGGTACCTTATTTTGATTGTTTTTCAATATT</td><td> 512</td>
<td>SYN2 (5 'to 3')</td><td>GCAGGCCTAAAGAATCATCAACTAAA</td><td> 513</td>
<td>SYN2 (3 'to 5')</td><td>TATGGTACCCTTTTGTTCTTTTTTTGA</td><td> 514</td>
<td>FhuD (5 'to 3<sup>1</sup>)</td><td>GCAGGCCTACTGAAGAGAAAACTGAAATGA</td><td> 515</td>
<td>FhuD (3<sup>1</sup> to 5')</td><td>TATGGTACCTTATTTTGCTTTTTCTGCAATTTT</td><td> 516</td>
<td>SYN1 (5 'to 3')</td><td>GCAGGCCTGGTAGCGACGATAATGGCTCGT</td><td> 517</td>
<td>SYN1 (3 'to 5')</td><td>TATGGTACCTTATTTTCTATAAATTGCATCTC</td><td> 518</td>
<td>MntC (5 'to 3')</td><td>GCAGGCCTAGTGATAAGTCAAATGGCAAACTA</td><td> 519</td>
<td>MntC (3 'to 5')</td><td>TATGGTACCTTATTTCATGCTTCCGTGTACAG</td><td> 520</td>
<td>SstD (5 'to 3')</td><td>GCAGGCCTTCAGAAACTAAAGGTTCTAAAGAT</td><td> 521</td>
<td>SstD (3 'to 5')</td><td>TATGGTACCTTATTTTACAACTTTTTCAAGTT</td><td> 522</td>
<td>FhuD2 (5 'to 3')</td><td>GCAGGCCTACTAAATCTTATAAAATGGACGAT</td><td> 523</td>
<td>FhuD2 (3 'to 5')</td><td>TATGGTACCTTATTTTGCAGCTTTAATTAATT</td><td> 524</td>
DNA extracted from S. aureus ATCC19636 is used as the template. DNA amplicons are verified by
230 Gel electrophoresis and the amplified Ide 'DNA' bands are 'cut, purified, digested and ligated into the' pQES.Q .-. Xa cut vector, transformed into competent XL-1 E. rnli — and ____ s £ screened for resistance to ampicillin. The resistant clones are screened for plasmid inserts using
Colony PCR.
EXAMPLE 15
PROTEIN CANDIDATE IMMUNORRECTIVITY SCREENING
PROTECTIVE
To assess the antibody reactivity of proteins identified from MALDI-TOF analysis (Example 13) and / or microarray in genomic analysis (Example 14), a two-part screen is used to evaluate individually expressed staphylococcal proteins. The first rapid screen uses transcriptionally active PCR fragments to analyze antibody binding to small amounts of expressed candidate protein using a cell-free E. coli lysate. The second screen uses standard PCR-based cloning, expression, and protein purification in E. coli using a commercial vector (pQE30Xa, Qiagen, Valencia CA) in order to validate positive chondidates from the first screen. The second screen also generates E. coli host cell master seed concentrates
231 <sup>r</sup> ΊΓ 'Λ /' * 'that contain the expression vector that corEafe ^ óiídeji a .. INSTIBJT, ο. „.
each immunoreactive protein candidate for protein production and purification undergoes vaccination and experimentation.
A high throughput method is used to generate individual SIRP antigens to test various candidate genes encoding the S proteins.
aureus involved in metal metabolism. This method generates a transcriptionally active PCR amplicon (TAP) using a two-step PCR reaction with primers that add a promoter, terminator, and Hisg C-terminal tag. The resulting transcriptionally active amplicons are used as a template for protein production in a cell-free in vitro transcription / translation reaction consisting of E-cell lysate. coli, buffer amino acids. The reaction of
Two-step PCR requires a first set of primers specific for the gene of interest and also includes a linker sequence that matches the second set of primers. Each set of first stage PCR primers are designed to exclude membrane processing signal sequences to avoid integration into the cell membrane and are shown below.
232
I.
Γ
TABLE 13. TAP PRIMERS:
<td>Gene (primer)</td><td>-► · r ¿. Priming sequence</td><td>SEQ ID "'" NO ™ in'</td>
<td>Pflb (5 'to 3')</td><td>AGAAGGAGATATACCATGTTAGAAACAAAT</td><td> 525</td>
<td>Pflb (3 'to 5')</td><td>TTAATGATGATGATGATGATGCATACTTTCATG</td><td> 526</td>
<td>OpplA (5 'to 3')</td><td>AGAAGGAGATATACCATGAGAAAACTAACT</td><td> 527</td>
<td>OpplA (3 'to 5')</td><td>TTAATGATGATGATGATGATGTTTATACTGCAT</td><td> 528</td>
<td>SirA (5 'to 3')</td><td>ATAAGGAGATATACCATGAATAAAGTAATT</td><td> 529</td>
<td>SirA (3 'to 5')</td><td>TTAATGATGATGATGATGATGTTTTGATTGTT</td><td> 530</td>
<td>SYN2 (5 'to 3')</td><td>AGAAGGAGGATATACCATGAGAGGTCTAAAAACTTTT</td><td> 531</td>
<td>SYN2 (3 'to 5')</td><td>TTAATGATGATGATGATGATGCTTTTGTTCTTTTTTTGA</td><td> 532</td>
<td>FhuD (5 'to 3')</td><td>AGAAGGAGGATATACCATGAATAGGAATATCGTTAAA</td><td> 533</td>
<td>FhuD (3 'to 5')</td><td>TTAATGATGATGATGATGATGTTTTGCTTTTTCTGCAAT</td><td> 534</td>
<td>SYN1 (5 'to 3')</td><td>AGAAGGAGGATATACCATGAAGAAATCGTTAATTGCT</td><td> 535</td>
<td>SYN1 (3 'to 5')</td><td>TTAATGATGATGATGATGATGTTTTCTATAAATTGCATC</td><td> 536</td>
<td>MntC (5 'to 3')</td><td>AGAAGGAGATATACCAAAAAATTAGTA</td><td> 537</td>
<td>MntC (3 'to 5')</td><td>TTAATGATGATGATGATGATGTTTCATGCTTCC</td><td> 538</td>
<td>SstD (5 'to 3')</td><td>AGAAGGAGATATACCATGAAGAAAACAGTC</td><td> 539</td>
<td>SstD (3 'to 5')</td><td>TTAATGATGATGATGATGATGTTTTACAACTTT</td><td> 540</td>
<td>FhuD2 (5 'to 3')</td><td>AGAAGGAGATATACCATGAAAAAAACTATTA</td><td> 541</td>
<td>FhuD2 (3<sup>1</sup> to 5')</td><td>TTAATGATGATGATGATGATGTTTTGCAGCTTT</td><td> 542</td>
A standard 50 µΐ PCR reaction is performed using 1 unit of High Fidelity Taq DNA Polymerase (Invitrogen), 0.2 µΜ primers, 2 mM dNTP (each), Mg<sup>++ </sup>final 2 mM and approximately 5 ng of DNA template
233 <sup>;</sup> I? 'Λ ΊΓ <
initial, damped with TrisSO<sub>4</sub> 60 mM (pH 8.9j ^ ¿dlíáto '';; · 18 mM ammonium). The PCR cycle formation procedure includes 1 minute of initial denaturation at 94 ° C, followed by 30 cycles as follows: Denaturation / 94 ° C / 30 sec; , association / 55 ° C / 30 sec; extension / 68 ° C, 90 sec. Identical primers with the appropriate overlap are used for the second stage of the PCR reaction and are supplied by the manufacturer (Gelantis). The resulting DNA PCR product is purified to remove residual primer, salt, and DNA fragments and used as a template for a second reaction with a standard set of primers to add the promoter and terminator sequences using similar conditions. The DNA template is then purified and added to an E. coli cell-free RTS 100 Rapid Translation System reaction mixture (Roche) containing 12 µΐ of E lysate. coli, 12 µΐ amino acids, 10 µΐ reaction mixture, 1 µΐ added methionine, 5 µ, reconstitution buffer, and 10 µΐ DNA template purified from the two-step PCR reaction. After incubation for 5 hours at 30 ° C, a
<td>microliter of each</td><td>shows</td><td>protein</td><td colspan="3">(approximately</td>
<td>0.5 μg / ml protein</td><td>total)</td><td>to the membrane</td><td>of</td><td>fluoride</td><td>of</td>
<td>polyvinylidene (PVDF)</td><td>after</td><td>saturation</td><td>with</td><td>methanol.</td><td>The</td>
<td colspan="2">stain crashes during</td><td colspan="2">night with NFDM</td><td>5% / TTBS,</td><td>I know</td>
incubates in iron-limited protein, mouse serum
2. 3. 4 diluted hyperimmunized enhanced (IRPE) (1: 500) i Xiit icu £ rpo j INSTTU - '. jj anti-His<sub>6</sub> (1: 500), washed and incubated with conjugatesi.
Goat Secondary anti-fnsfahasa alralin antibody? Mouse hp (AP) (1: 3000), washed and developed chromatographically (Bio-Rad AP Color Development Kit) for 20 minutes. Lysates containing seroreactive polypeptides are identified.
Clones produced as described in
Example 14 They are grown to mid-log phase, induced with 1mM IPTG and grown for 4 hours. Cells are pelleted, washed and lysed on boiling SDS-PAGE charged buffer. The crude lysates are separated by SDS-PAGE and stained by Coomassie. A second set of prepared proteins are transferred to a PVDF membrane and immunoblotted with IRPE vaccine hyperimmunized mouse serum diluted 1: 500 in 1% NFDM / TTBS. The stain is washed, incubated with alkaline phosphatase (AP) conjugated goat anti-mouse secondary antibody, washed and developed with chromogenic substrate.
EXAMPLE 16
PREPARATION OF IMMUNIZING COMPOSITIONS FOR POLYPEPTIDES
PRODUCED IN A RECOMBINANT WAY
In order to isolate the recombinant S. aureus polypeptides to formulate a vaccine, the E. coli clones
235
37 ° ψ
-1 .. ·.
------ ··· 'in ll ^ d ^ zgal-do. ^ Hours with B described in Example 14 are grown to the semi-log phase (D0<sub>6</sub>oo = O.4-O.6) of triptych soybean and then induced during
1mM isopropyl D-1-thiogalactopyranoside (IPTG). The pellets are grown for 10 minutes at 4 ° C in a Sorvall centrifuge (4000 xg) and frozen at -80 ° C before undergoing the purification procedure. The bacterial pellets are then processed by two different methods, which depend on the solubility of the overexpressed S. aureus polypeptide.
For soluble polypeptides (eg MntC,
FhuD, SYN2, SirA, or SYN1), the bacterial pellets are resuspended in 25 ml of BUGBUSTER reagent (Novagen) and undergo 15 minutes of sonication on ice using a Branson sonifier fitted with a microtip (65% duty cycle, 5 Departures). The insoluble material is separated by 10 minutes of centrifugation (4000 xg). The soluble supernatant is filtered (0.2 μπι) and subjected to metal affinity chromatography (Ni-NTA His-Bind, Novagen) according to the instructions provided by the manufacturer.
For insoluble polypeptides (eg PflB or OpplA), the bacterial pellets are resuspended in 25 ml of BUGBUSTER reagent (Novagen), placed on an oscillating platform for 10 minutes and then subjected to centrifugation (15,000 xg for 12 minutes). Sediment
236 Resulting is resuspended in 10 ml of BUGBUSTER. plus 20 ml of diluted BUGBUSTER (1:10 in PBS) and centrifuge-acióxi · ^ (5000 xg for 12 minutes). The sediment —— & is suspended in 20 ml of diluted BUGBUSTER and undergoes a final 5 stage. centrifugation (15,000 xg for 12 minutes). The final sediment is resuspended in 10 ml of buffer A (NaH<sub>2</sub>PO<sub>4</sub> 0.1M, Tris-HCl 0.01, 8M urea, pH
8.0) and incubate for 10 minutes on a rocking platform at room temperature. The samples are then centrifuged (12,000 xg for 20 minutes) and the resulting supernatant is separated by metal affinity chromatography (Ni-NTA His-Bind, Novagen) according to the instructions provided by the manufacturer, but with the following modifications. After loading the column, 10 ml of buffer A is used to balance the resin. After binding of the polypeptide the column is washed with 15 ml of buffer B (NaH<sub>2</sub>PO<sub>4</sub> 0.1 M, Tris-HCl 0.01, 8M urea, pH 6.0) and elute using 15 ml of buffer C (NaH<sub>2</sub>PO<sub>4</sub> 0.1M, Tris-HCl 0.01, 8M urea, pH
4.5).
The isolated recombinant polypeptides are eluted from the columns in a volume of 15 ml and placed in 20 kDa limit dialysis boxes (Pierce) for dialysis against 2 1 of phosphate buffered saline (PBS). After three shock changes
237
<img file="MX339461B_D0138.tif" />
using Centricon 20kDa limit devices (Millipore). The concentrations of the purified polypeptides are determined using the standard BCA method (Pierce).
pg of each polypeptide are combined and the volumes adjusted to 100 µΐ with PBS to form an immunizing composition.
EXAMPLE 17
VACCINATION OF MICE
Exposure IV (Study A)
Fifty (N = 50) female BALB / C mice were obtained from Harian Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams and distributed into three groups (10-20 mice / groups). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. All vaccines were formulated with IFA 50% as an adjuvant. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (70 µg / 100 µΐ) (Placebo, 20 mice).
Group 2: vaccinated with ATCC 25904 proteins that
238 express under iron restriction (70 gg / 100 lll »), (extract
LI ÍV.V i; Á 1 \ h I instituted o.mlxicw ·, V .., »· .A
SIRP, 20 mice). t delapfcfiedau; ·,>
& · ;, INDUSTRIAL
t.
Group 3: vaccinated with recombinant MntC_ polypeptides (10 gg / 100 µΐ) (rMntC, 10 mice).
IP exposure (study B).
Forty female BALB / C mice (N = 40) from Harían Breeding Laboratories (indianapolis, IN) weighing 16-22 grams were equally distributed into 4 groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). The element and water were freely supplied to all mice. All vaccines were formulated with IFA 50% as an adjuvant. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition at 14-day intervals using either two vaccinations (groups 1-3) or three vaccinations (group 4) as follows:
Group 1: Placebo, vaccinated twice with ovalbumin (70 gg / 100 gl) (Placebo).
Group 2: Vaccinated twice with ATCC 25904 proteins expressed under iron restriction (70 gg / 100 gl) (SIRP extract).
Group 3: vaccinated twice with recombinant PflB, OpplA, SirA, SYN2, FhuD, SYN1, and MntC polypeptides (each 10 gg / 100 gl, total protein 70 gg / 100 gl) (rSIRP7 (twice)).
239
Group 4: vaccinated three times with stiff J]
- M £ XZCa INSTITUTE: OY recombinants PflB, OpplA, SirA, SYN2, FhuD, SYN1, '<sup>Mü</sup>^<sup>l</sup>$ i<sub>n</sub>CÑYes '' (each 10 gg / 100 μΐ, total protein - * 70 μ ^ / ΙΟΟ μΐ) (rSIRP7 (three times)).
IC exposure (Study C)
Thirty female BALB / C mice (N = 30) obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams, were distributed equally into 3 groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition 2 times at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (70 μg / 100 μΐ) (Placebo).
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (70 µg / 100 µΐ) (SIRP extract).
Group 3: vaccinated with recombinant PflB, OpplA, SirA, SYN2, FhuD, SYN1, and MntC polypeptides (each 10 µg / 100 µΐ, total protein 70 µg / 100 µΐ) (rSIRP7).
EXAMPLE 18
PREPARATION OF THE EXHIBITION AGENCY
Exposure IV (Study A)
Staphylococcus aureus strain ATCC 25904 was used
240 as an exhibition body. Previously, unyfa-sa-rde ;, Ir μΐ .i'y'Á Jí .1 of bacteria from a congealed glycerol concentrate grown in standard TSB (without iron restriction) was used to inoculate a 2 0 culture. ml of TSB and incubated at 37 ° C for 18 hours. 2.5 ml of this crop are passed to 500 ml of
Cool TBS. The culture is incubated at 37 ° C for approximately 2 hours while spinning at 250 rpm until the optical density (D0<sub>6</sub>oo) of 0.4 (absorbance) is reached (semi-logarithmic phase), then cells are centrifuged at 10,000 xg for 10 min at 4 ° C to pellet bacteria. The bacterial pellet is washed by centrifugation in PBS at 4 ° C. The final pellet is resuspended in 20 ml of PBS. The final exposure dose is prepared by adding an aliquot of this concentrated bacterial culture to PBS to generate a solution with a D0<sub>6</sub>oo of 4.0 (A) corresponding to approximately 6.67 x 10<sup>8</sup> CFU / ml. Just prior to challenge, 1 ml of these bacterial suspensions are serially diluted and plated on agar to list the number of colony forming units (CFUs) per mouse dose.
IP exposure (Study B)
Staphylococcus aureus strain ATCC 25904 was used as an exposure organism. Previously, a 1 μΐ loop of bacteria from frozen glycerol concentrate that has grown in standard TSB (without iron restriction) was
241 used to inoculate a 20 ml culture of TSBjyp ^ μ / ncíubá
INSTITUTE Ά
DE P at 37 ° C for 18 hours. 2.5 ml of this crop are spent 'a
500 my TBS cool. The culture is incubated at 3-7-<sup>to</sup>G'-xferaefce.
about 2 hours while spinning at 250 rpm 5 until the optical density (DO<sub>600</sub>) of. 0.4 (absorbance) is reached (semi-logarithmic phase), then cells are centrifuged at 10,000 xg for 10 min at 4 ° C to pellet bacteria. The bacterial pellet is washed by centrifugation in PBS at 4 ° C. The final pellet is resuspended in 20 ml of PBS. The final exposure dose is prepared by adding an aliquot of this concentrated bacterial culture to PBS to generate a solution with a D0<sub>60</sub>or 6.0 (A) which corresponds to approximately 3.33 x 10<sup>9</sup> CFU / ml. Just prior to challenge, 1 ml of these bacterial suspensions are serially diluted and plated on agar to enumerate the number of Colony Forming Units (CFU) per mouse dose.
Exposure IV (Study C)
Staphylococcus aureus strain ATCC 25904 was used
0 as an exhibition body. Briefly, a 1 µΐ loop of bacteria from a frozen glycerol concentrate that has grown in standard TSB (without iron restriction) is used to inoculate a 20 ml culture of TSB and incubated at 37 ° C for 18 hours. 2.5 ml of this crop are spent in
500 my TBS cool. The culture is incubated at 37 ° C for
242 approximately 2 hours while turning at 250 rpm until an optical density is reached (D &<sup>S</sup>6 0.04 (absorbance) (semi-logarithmic phase), then cells are centrifuged at 10,000 xg for 10 min at 4 ° C to pellet bacteria. The bacterial pellet is washed by centrifugation in PBS at 4 ° C. The final pellet is resuspended in 20 ml of PBS. The final exposure dose is prepared by adding an aliquot of this concentrated bacterial culture to PBS to generate a solution with a D0<sub>60</sub>or 4.0 (A), which corresponds to approximately 6.67 x 10<sup>8</sup> CFU / ml. Just prior to challenge, 1 ml of these bacterial suspensions are serially diluted and plated on agar to enumerate the number of colony forming units (CFUs) per mouse dose.
EXAMPLE 19
EXPOSITION
Exposure IV (Study A)
Fourteen days after the second vaccination, mice in all groups (1-3) were exposed intravenously in the lateral tail vein with 0.3 ml of the appropriate organism. The three groups of mice were identically exposed with 2 x 10<sup>8</sup> CFU of S. aureus strain ATCC 25904 per mouse. Mortality was recorded daily for 10 days after exposure.
When the exposed mice are compared to the
243 ATCC 25904 isolate, 80% of mice -, ded <
group,. l
JT / / ·.
Hee
vaccinated with placebo they died in the following<sup>:</sup>. .10 days of exposure (table 14). This demonstrates that the ATCC 25904 strain causes a high mortality rate in mice at the administered dose level. In contrast to the mice in group 1, only 25% of the mice in group 2 (vaccinated with proteins extracted from the ATCC 25904 strain after growth under suppressed iron conditions, SIRP extract) died in the following 10 days after to the exhibition. These results illustrate that mice exposed with the ATCC 25904 strain are significantly protected by vaccination with the protein composition derived from ATCC 25904 suppressed in iron (p = 0.0006, log classification test for mortality). Furthermore, only 50% of the mice in group 3 (vaccinated with recombinant MntC polypeptides, rMntC) died within 10 days of exposure, indicating that the recombinant proteins provide protection against exposure with the ATCC 25904 strain (p = 0.100, logarithmic classification test for mortality).
IP exposure (Study B)
Fourteen days after the second vaccination, mice in all groups (1-4) were exposed intraperitoneally with 0.5 ml of the appropriate organism. All three groups of mice were exposed from
244 identical way with 1 x 10<sup>9</sup> UFC of S. aureus cépaff
J. k<sup>v</sup>· / By mouse. Mortality was recorded daily<sup>:;</sup>'- during \; 10 days after exposure.
<td></td><td>When they are compared</td><td>the</td><td>mice exposed</td><td>with</td><td>he</td>
<td>isolated</td><td>ATCC 25904, 60%</td><td>of</td><td>the mice of the</td><td>group</td><td> 1</td>
<td>vaccinated</td><td>with placebo they died</td><td>in</td><td>the next 10</td><td>days</td><td>of</td>
exposure (table 14). This demonstrates that the ATCC 25904 strain causes a moderate mortality rate in mice at the administered dose level. In contrast to the mice in group 1, only 30% of the mice in group 2 (vaccinated with proteins extracted from the ATCC 25904 strain after growth under suppressed iron conditions, SIRP extract) died in the following 10 days after The exhibition. These results illustrate that mice vaccinated with the iron-deleted ATCC 25904 derived protein composition die at half the rate of placebo-vaccinated mice when challenged with the ATCC 25904 strain (p = 0.143, logarithmic classification test). for mortality). Mice vaccinated with the combination of seven recombinant proteins showed a higher level of protection relative to placebo. Only 20% of mice in group 3 (vaccinated twice with the recombinant polypeptides, rSIRP7, 2 times) died within 10 days of exposure, and only 10% of mice in group 4 (vaccinated 3 times with polypeptides
245 recombinants, rSIRP7, 3 times) died 10 days after exposure, indicating that the three v ^ curaag ^ ones with the recombinant proteins provide significant protection against exposure with the ATCC 25904 strain (p = 0.040, logarithmic test of classification for mortality).
Exposure IV (Study C)
Fourteen days after the second vaccination, mice in all groups (1-3) were exposed intravenously in the lateral tail vein with 0.3 ml of the appropriate organism. The three groups of mice were identically exposed with 2 x 10<sup>8</sup> CFU of S. aureus strain ATCC 25904. Mortality was recorded daily for 10 days after exposure.
<td> 15</td><td>When they are compared</td><td>the</td><td>mice exposed</td><td>with</td><td>he</td>
<td>isolated</td><td>ATCC 25904, 90%</td><td>of</td><td>the mice of the</td><td>group</td><td> 1</td>
<td>vaccinated</td><td>with placebo they died</td><td>in</td><td>the next 10</td><td>days</td><td>of</td>
exposure (table 14). This demonstrates that the ATCC 25904 strain causes a high mortality rate in mice at the administered dose level. In contrast to the mice in group 1, only 40% of the mice in group 2 (vaccinated with proteins extracted from the ATCC 25904 strain followed by growth under conditions suppressed in iron, SIRP extract) died in the following 10 days after The exhibition. These results illustrate that mice
246 «Üax.¿M £ iiT3 exposed with the ATCC 25904 strain were protégic ^ a ^^ e ^ iatfiejra .. significant by vaccination with the composition ¡sT: ¿ef; protein derived from ATCC 25904 knocked down in iron (p = 0.0164, logarithm classification test for mortality). Furthermore, only 40% of 5 mice in group 3 (vaccinated with recombinant polypeptides, rSIRP7) died within 10 days of exposure, indicating that the recombinant proteins provide significant protection against exposure with the ATCC 25904 strain (p = 0.0255, logarithmic classification test for mortality).
The results are shown in Table 14 and in Figures 161A-161D.
TABLE 14. MORTALITY OF VACCINATED AND UNVACCINATED MICE
AFTER EXPOSURE WITH Staphylococcus aureus ATCC,
ISOLATED 25904
<td>Groups</td><td># of mice</td><td># of dead</td><td>percentage of mortality (%)</td>
<td>exhibition IV (study A)</td><td></td><td></td><td></td>
<td>Group 1 (placebo)</td><td> 20</td><td> 16/20</td><td> 80</td>
<td>Group 2 (extract from SIRP)</td><td> 10</td><td> 5/20</td><td> 25</td>
<td>Group 3 (rMntC)</td><td> 10</td><td> 5/10</td><td> 50</td>
<td>IP exposure (study B)</td><td></td><td></td><td></td>
<td>Group 1 (placebo)</td><td> 10</td><td> 6/10</td><td> 60</td>
247
<img file="MX339461B_D0139.tif" />
<td rowspan="7"> 5 10</td><td>Group 2 (extract from SIRP)</td><td> 10</td><td> 3/10</td><td>—ItuemiiUJ. ' nniirmMiwPi —--------- 30 '' IMPI v</td>
<td>Group 3 (rSIRP, 2 times))</td><td> 10</td><td> 2/10</td><td>ί<sup>1</sup> INL t '; i -v τL</td>
<td>Group 4 (rSIRP, 3 times))</td><td> 10</td><td> 1/10</td><td></td>
<td>exhibition IV (study C)</td><td></td><td></td><td></td>
<td>Group 1 (placebo)</td><td> 10</td><td> 9/10</td><td> 90</td>
<td>Group 2 (extract from SIRP)</td><td> 10</td><td> 4/10</td><td> 40</td>
<td>Group 3 (rMntC)</td><td> 10</td><td> 4/10</td><td> 40</td>
<img file="MX339461B_D0140.tif" />
EXAMPLE 20
PASSIVE IMMUNIZATION USING PREPARED POLYPEPTIDES OF
RECOMBINANT WAY
<img file="MX339461B_D0141.tif" />
A polyclonal antibody composition is prepared as described in Example 8 except that the mice were vaccinated with a recombinant polypeptide composition prepared as described in Example 16.
The resulting antibody composition is used to passively immunize mice, as described in Example 9. Immunized mice are exposed as described in Example 9.
Immunized mice will show decreased mortality compared to unvaccinated or placebo vaccinated mice.
248
EXAMPLE 21
FERMENTATION AND ISOLATION AT LARGE SCALE OF
<img file="MX339461B_D0142.tif" />
PRODUCED IN A RECOMBINANT WAY.
A recombinant E. coli master seed concentrate from Example 14 can be prepared to grow the organism in 2000 ml of sterile RM medium (20 g of casamino acids, 60 g of Na<sub>2</sub>HPO<sub>4</sub>, 30 g of KH<sub>2</sub>PO<sub>4</sub>, 5 g of NaCl, 10 g of NH<sub>4</sub>C1 per liter and 100 pg / ml ampicillin) for 8 hours at 37 ° C. Bacteria can be harvested by centrifugation at 10,000 xg for 30 minutes. The culture can be washed twice by centrifugation (10,000 xg) and the final bacterial pellet is resuspended in 500 ml of medium
Sterile MRI containing 20% sterile glycerol. A 1 ml amount of the culture will be transferred to a 2 ml cryoplask and stored at -85 ° C.
A cryoplask (1 ml) of the recombinant master seed concentrate can be used to inoculate a 100 ml culture flask containing the medium described above with the exception of having 2 g of casamino acids and 0.5% glucose (modified RM medium) . The culture can be incubated at 37 ° C for 7 hours, during which time it can be inoculated in 2 liters of modified RM medium and allowed to grow for an additional 4 hours at 37 ° C. This culture can be used to inoculate a heater located on top of the New Brunswick BIOFLOW cabinet 4 of 30
249 ν 'liters loaded with 20 liters of medium RM modij ^^ a¿ <! jó éXcept the final concentration of casaminoaccldos cs'-e.ra q<sup>and</sup> v¿0 g / liter (fermentation RM medium). The pH of the fermentation medium can be maintained between 6.9 and 7.2 by automatic titration with 30% NaOH and 10% HC1. The fermentation culture can be shaken at 350 revolutions / minute and the culture can be aerated with 11 liters / minute at 37 ° C. Foaming can be automatically controlled by the addition of 0.4% silicone defoamer (Antifoam-B, JT Baker, NJ). The crop can be allowed to grow continuously under these conditions for 4 hours (D0<sub>60</sub>o = 4.0-6.0), time in which the culture is pumped into a 150 liter fermenter (W.
B. Moore, Easton PN), loaded with 110 liters of fermentation RM medium and 0.2% defoamer. The fermentation parameters can be the following: 650 rpm, DO 60%, 50 slpm of air, back pressure of 69 KPa (10 psi), 37 ° C and pH that is maintained at 7.2 with NaOH. After reaching a late exponential growth phase (approximately six hours, D0<sub>6</sub>oo = 15.0) Recombinant proteins can be induced by adding 150 pg / ml IPTG. Fermentation can be allowed to grow for an additional three hours, at which point fermentation can end by lowering the fermenter temperature to 18 ° C (D0<sub>6</sub>oo 20-25 at a dilution
1:100) .
After fermentation, the polypeptides
250
ΙΖ '· Λ J-Λ;
recombinantly produced can be XJ ^ icfiarí by
MEXICAN INSTITUTE Vx '^' - · »DELA PROPERTY <sub>η</sub> . . -,,,,. .INDUSTRIAL conventional means. Cells are disrupted (eg, by homogenization) to release recombinantly produced polypeptides, some of which are soluble and some of which are insoluble.
Soluble polypeptides can be concentrated by tangential flow filtration, solubilized by detergent, and can be harvested by metal affinity chromatography.
The collected soluble polypeptides can be isolated as described for the isolation of the soluble polypeptides in Example 16.
Insoluble proteins can be harvested by high speed centrifugation. The pellet of the insoluble polypeptides can be collected and then isolated as described for the isolation of the insoluble polypeptides in Example 16.
EXAMPLE 22
VACCINATION OF MICE
Recombinantly produced SirA, SYN2, FhuD and MntC polypeptides 20 are prepared and isolated as described in Example 16.
A quantity of thirty (N = 30) female BALB / C mice obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were equally distributed into three groups (10 mice / group).
251
Mice were housed in polycarjiojiate cages to
INSTITUTOMípp '->? \ ;. T.
mice (N = 5 mice per cage). They fed and freely supplied all mice. Fpfírpp mice vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (40 pg / l00 pl)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (40 pg / 100 μΐ).
Group 3: Vaccinated with recombinant SirA, SYN2, FhuD and MntC polypeptides (each 10 pg / 100 pl, total protein, 40 pg / 100 pl).
Mice were exposed as described in Example 19. Mice in group 3 will show reduced mortality compared to mice in group 1.
EXAMPLE 23
VACCINATION OF MICE
Recombinantly produced PflB polypeptide is prepared and isolated as described in Example 16.
A quantity of thirty (N = 30) female BALB / C mice obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were equally distributed into three groups (10 mice / group). The mice were housed in polycarbonate cages to
252 mice (N = 5 mice per cage). Feed and. Water were supplied Ad libitum to all mice. The mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / 100 μΐ)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 pl).
Group 3: Vaccinated with recombinant PflB polypeptide (each, 10 pg / 100 pl).
Mice were exposed as described in Example 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
EXAMPLE 24
VACCINATION OF MICE
The recombinant, example 16.
OpplA polypeptide is prepared and isolated produced as described in thirty (N = 30) BALB / C mice
Breeding Laboratories weighing 16-22 grams would make three groups (10 mice / group). in polycarbonate cage cages). Food and water are
A quantity of female obtained from (Indianapolis, IN) with equally distributed in
Mice were housed mice (N = 5 mice ¿> or freely supplied to all mice. Mice were
253 vaccinated subcutaneously with 0.1 ml of lía -composicióíi í ¡N5 -, - ¡..rv appropriate twice at intervals of 14 days, as if ^ ÜeP ..
Group 1: Placebo, vaccinated with oval bovine i na IOL.
pg / l00 pl)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 pl).
Group 3: Vaccinated with recombinant OpplA polypeptide (each, 10 pg / 100 pl).
Mice were exposed as described in Example 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
EXAMPLE 2 5
VACCINATION OF MICE
<td>He</td><td>polypeptide</td><td>SirA</td><td>produced from</td><td>way</td>
<td>recombinant,</td><td>gets ready</td><td>and isolate</td><td>as described</td><td>at</td>
<td>example 16.</td><td></td><td></td><td></td><td></td>
<td>A</td><td>amount of</td><td>thirty</td><td>(N = 30) mice</td><td>BALB / C</td>
<td colspan="2">female obtained from</td><td>Would</td><td colspan="2">Breeding Laboratories</td>
<td>(Indianapolis,</td><td>IN) with</td><td>a weight</td><td colspan="2">16-22 grams</td>
distributed equally in three groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
254
Group 1 pg / l00 μΐ)
Placebo, vaccinated with
<img file="MX339461B_D0143.tif" />
ENSTIT '
He
<img file="MX339461B_D0144.tif" />
Group 2: Vaccinated with proteins of.,., ATCC ... expressed under iron restriction (10 pg / 100 μΐ).
Group 3: Vaccinated with recombinant SirA polypeptide (each, 10 pg / 100 µΐ).
Mice were exposed as described in Example 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
EXAMPLE 26
VACCINATION OF MICE
Recombinantly produced SYN2 polypeptide is prepared and isolated as described in Example 16.
A quantity of thirty (N = 30) female BALB / C mice obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were equally distributed into three groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / 100 μΐ)
255
Group 2: Vaccinated with T proteins? 59 0-4
IL
SYN2 expressed under iron restriction (10 pg / 100 pTLl.
Group 3: Vaccinated with recombinant polypeptide (each, 10 pg / 100 pl).
Mice were exposed as described in Example 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
EXAMPLE 27
VACCINATION OF MICE
Recombinantly produced FhuD polypeptide is prepared and isolated as described in Example 16.
A quantity of thirty (N = 30) female BALB / C mice obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were equally distributed into three groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / 100 pl)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 pl).
256
Group 3: Vaccinated with recombinant (each, 10 pg / 100 μΐ).
Mice were exposed as described in Example 1, 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
EXAMPLE 28
VACCINATION OF MICE ri
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX339461B_D0145.tif" />
<td>He</td><td>polypeptide</td><td>SYN1</td><td>produced from</td><td>way</td>
<td>recombinant,</td><td>gets ready</td><td>and isolate</td><td>as described</td><td>at</td>
<td>example 16.</td><td></td><td></td><td></td><td></td>
<td>A</td><td>amount of</td><td>thirty</td><td>(N = 30) mice</td><td>BALB / C</td>
<td colspan="2">female obtained from</td><td>Would</td><td colspan="2">Breeding Laboratories</td>
<td>(Indianapolis,</td><td>IN) with</td><td>a weight</td><td colspan="2">16-22 grams</td>
distributed equally in three groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / 100 pl)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 pl).
Group 3: Vaccinated with recombinant SYN1 polypeptide (each, 10 pg / 100 pl).
257
Mice were exposed as
Ji 'a' eh el
INSTITUTE example 19. Mice in group 3 showed Tc / r '·<sup>1</sup>'' 'reduced compared to mice in growl 1,
EXAMPLE 29
VACCINATION OF MICE
Recombinantly produced MntC polypeptide is prepared and isolated as described in Example 16.
A quantity of thirty (N = 30) female BALB / C mice obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were equally distributed into three groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / 100 pl)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 μΐ).
Group 3: Vaccinated with recombinant MntC polypeptide (each, 10 pg / 100 µΐ).
Mice were exposed as described in Example 19. Mice in group 3 showed mortality.
258 reduced compared to mice in the gru ^ c ^ lj!
; INSTITUTE 7 777 .77
EXAMPLE 30 <sup>ΕίίΛ</sup>777·; 77 <
VACCINATION OF MICE ...............................
Recombinantly produced SstD polypeptide is prepared and isolated as described in Example 16.
A quantity of thirty (N = 30) female BALB / C mice obtained from Harían Breeding Laboratories (Indianapolis, IN) weighing 16-22 grams were equally distributed into three groups (10 mice / group). Mice were housed in polycarbonate mouse cages (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / lOO pl)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 pl).
Group 3: Vaccinated with recombinant SstD polypeptide (each, 10 pg / 100 pl).
Mice were exposed as described in Example 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
259
EXAMPLE 31
VACCINATION OF MICE
<td></td><td>He</td><td>polypeptide</td><td>FhuD2</td><td colspan="2">produced from</td><td></td>
<td colspan="2">recombinant,</td><td>gets ready</td><td>and isolate</td><td>how I know</td><td>describes</td><td>at</td>
<td>example</td><td> 16 .</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>A</td><td>amount of</td><td>thirty</td><td>(N = 30)</td><td>mice</td><td>BALB / C</td>
<td>female</td><td colspan="2">obtained from</td><td>Would</td><td>Breeding</td><td colspan="2">Laboratories</td>
<td>(Indianapoli s,</td><td>IN)</td><td>with a</td><td>weight</td><td>16-22 grams</td><td>I know</td>
<td>distributed</td><td>by</td><td>same</td><td>in</td><td>three groups</td><td> (10</td>
<td>mice / group).</td><td>The</td><td>mice</td><td colspan="2">they were housed in cages</td><td>of</td>
polycarbonate for mice (N = 5 mice per cage). Food and water were freely supplied to all mice. Mice were vaccinated subcutaneously with 0.1 ml of the appropriate composition twice at 14-day intervals, as follows:
Group 1: Placebo, vaccinated with ovalbumin (10 pg / 100 μΐ)
Group 2: Vaccinated with ATCC 25904 proteins expressed under iron restriction (10 pg / 100 μΐ).
Group 3: Vaccinated with recombinant FhuD2 polypeptide (each, 10 pg / 100 µΐ).
Mice were exposed as described in Example 19. Mice in group 3 showed reduced mortality compared to mice in group 1.
260
EXAMPLE 32 'JA
RECOMBINANT POLYPEPTIDES THAT BIND SPECIFlÓ ^ MEag ^<sub>s</sub>; PpR
SERUMS GENERATED BY INFECTION WITH S. aureus_
S. aureus are prepared as challenge organisms as described in Example 4 and are used to challenge mice as described in Examples 5 or 19. Sera are obtained from mice either prior to challenge or from mice which have received a placebo vaccine, and have been exposed to S. aureus Newman and have recovered (convalescent). Blood is collected from exposed and unexposed mice and the sera are obtained by centrifugation. Sera are used to assess the reactivity of the recombinantly produced individual polypeptides using the immunoblot method as described in Example 15.
Sera collected from mice before challenge did not react with any of the recombinant polypeptides.
<td>He</td><td>antibody</td><td>of</td><td>the serums produced</td><td>how</td><td>a</td>
<td>result of</td><td>exposition</td><td>of</td><td>S. aureus reacted</td><td>with</td><td>the</td>
<td>polypeptides</td><td>produced</td><td>of</td><td>recombinantly,</td><td>how</td><td>I know</td>
shown in Figure 202. Antibodies generated against polypeptides expressed during S. aureus infection recognize variants of the recombinantly produced polypeptides. In this way, the recombinant polypeptides
261 Immunological substituents for polypeptides are S. aureus exposure.
for -for example]
INETI · immunological: expr'eSa.dos ^ 'poi ^ ·
<img file="MX339461B_D0146.tif" />
EXAMPLE 33
THE ANTIBODY AGAINST MANUFACTURED POLYPEPTIDES
RECOMBINANT AND IRON-REGULATED MEMBRANE POLYPEPTIDES
DIRECTLY REMOVED FROM CELLS OF S. aureus GIVE REACTION
CRUSADE
Recombinant iron-regulated polypeptides are expressed and purified as described in Example 16. Iron-regulated membrane polypeptides are directly extracted from S. aureus cells growing under low iron conditions as described in Example 1. Recombinant polypeptides are formulated in a vaccine as described in Example 16 and used to vaccinate mice as described in Example 17. The polypeptides extracted from S. aureus are formulated into vaccines as described in Example 2 and used to vaccinate mice as described in Example 3. For recombinant polypeptide vaccines, a single recombinant polypeptide will be formulated into the vaccine. Antisera from vaccinated mice are collected and used for immunoblots, as described in Example 15.
Antisera from animals vaccinated with iron-regulated polypeptides produced
262 Recombinant recombinants are further used for ^ -evaluation and reactivity with iron-regulated polypeptides extracted after removal of iron-regulated polypeptides extracted by SDS-PAGE. Antisera from animals vaccinated with recombinant polypeptides will bind to the extracted polypeptides and separated by appropriate SDS-PAGE where the antibody epitopes are conserved between the extracted polypeptides and the recombinantly produced polypeptides.
Antisera from animals vaccinated with extracted iron-regulated polypeptides are further used to assess reactivity with individual recombinantly produced iron-regulated polypeptides after separation of iron-regulated or recombinant SDS-PAGE polypeptides. Antisera from animals vaccinated with extracted polypeptides will bind to appropriate recombinant polypeptides separated by appropriate SDS-PAGE where the antibody epitopes are conserved between the recombinantly produced polypeptides and the extracted polypeptides.
EXAMPLE 34
WESTERN BLOT ANALYSIS OF S. aureus PROTEINS
RECOMBINANTS
Recombinant S. aureus proteins are prepared as described in Example 16, and then subjected to
263 dodecyl sulfate and is transferred m'éftí & fanast i de
1, Hercules, CA) for Western electrophoresis analysis in 10% nitrocellulose polyacrylamide (BioRa
Blot. The individual spots are reacted with serum from healthy human donors (in whom Staphylococcus infection has not been reported) or convalescent (methicillin resistant S. aureus).
As a control to identify each recombinant histidine tagged protein, each blot should be co-incubated with anti-histidine antibodies (Rockland Immunochemicals, Inc., Gilbertsville, PA and Qiagen GmbH, Hilden, Germany) to identify the recombinant proteins using assays from two colors. All primary antisera were used in a 1: 1000 dilution and incubated for 1 hour on an oscillator. After several washes with TBS + 0.05% Tween to remove unbound antibody, the membranes were subsequently incubated with a 800 CW dye-conjugated human secondary antibody (Rockland Immunochemicals, Inc.,
Gilbertsville, PA), dye-conjugated mouse secondary antibody 680 (Li-cor Biosciences, Lincoln, NE) or dye-conjugated rabbit secondary antibody 800 CW (Li-Cor Biosciences) at a manufacturer-recommended dilution during 1 hour, in the dark. The membranes were washed an additional three to five times with TBS + 0.05% Tween
264 with the last wash only on TBS. Fluorescent tNSTiT / y / '(680 and 800) were detected using the Odyssey'Infrared Imaging System kit (Li-Cor Biosciences). They are shown in figure 203 (healthy) and in figure 204 (convalescent).
EXAMPLE 35
SURFACE EXPRESSION OF S. aureus DU5875 OF POLYPEPTIDES
REGULATED BY METAL
S. aureus strain DU5875 (cap-, spa-) is grown under conditions packed with iron (TSB + 0.3 mM ferric chloride) or suppressed iron (TSB + 1 mM dipyridyl) at a
DOsoo of about 0.6.
In panels AC of figure 205, S. aureus strain DU5875 is grown under low iron conditions up to a D0<sub>60</sub>or about 0.75 and freezes. The bacteria are reheated, washed in PBS and resuspended in PBS + 1% Pig IgG + 1% BSA as a blocking step. Mouse antiserum generated against FhuD, OpplA, or PflB was used in a 1: 100 dilution to stain approximately 2x10<sup>s </sup>bacteria. Serum from preimmune mice was used as a negative control. The bacteria were then washed in blocking buffer and incubated with a secondary anti-mouse goat antibody conjugated to AF633 and analyzed on a flow cytometer. Bacteria incubated with the preimmune mouse serum, 1: 100 was used as a
265
YY f VT 'T negative control. To the·. '; ¿I<sup>, Ν3Τ</sup>· Υ ^<sub>υ;</sub>.γ<sub>?</sub>
In panel D of figure 205, S. aureus<sup>-</sup> strain **
DU5875 is grown under low conditions in the water up to € a 'D0<sub>60</sub>or about 2.0 and it freezes. The bacteria are reheated, washed in PBS and resuspended in PBS + 0.2% pig IgG + 1% BSA as a blocking step. Most of the antiserum generated against rSIRP7 is used at a 1:50 dilution to stain approximately 5x10<sup>7</sup> bacteria with preimmune mouse serum used as a negative control. The bacteria were then washed in blocking buffer and incubated with a secondary anti-mouse goat antibody conjugated to AF633 and analyzed on a flow cytometer.
The results of this analysis indicate that the murine antibodies generated against the SIRP proteins bind to S. aureus cells. Cells that grew under low iron conditions bind more antibody than cells that grew under iron-depleted conditions, providing further evidence that FhuD, OpplA, and PflB are expressed at higher levels under low iron conditions and are antigens. that can induce immunological activity against Staphylococcus spp. The increase in median fluorescence intensity (MFI) demonstrates the relative increase in fluorescence when anti-SIRP antibodies bind to S. aureus cells compared to
266
MFI or preimmune mouse serum. The results sejjmüe ^ trafí 'en
INSTITu · ;; ·. ·:. ·.
figure 2 05. · front. >,
EXAMPLE 3 6 _
Luminex analysis is used to evaluate cytokine expression by splenocytes from mice immunized with the combination (rSIRP7) of the recombinant SIRP component, PflB (SEQ ID NO: 353), OpplA (SEQ ID NO: 364), SirA (SEQ ID NO : 375), SYN2 (SEQ ID NO: 386), FhuD (SEQ ID NO: 397); SYN1 (SEQ ID NO: 408, and MntC (SEQ ID NO: 419) or placebo, and then restimulated with SIRP extract (SIRPE) or rSIRP7. Several cytokines are up-regulated by restimulation and the SIRPE-induced cytokine profiles and restimulation with rSIRP7 were similar. The overall cytokine profile in response to re-estimation with rSIRP7 or SIRPE is reminiscent of what is expected from a Thl / Thl7 type immune response and demonstrates that vaccination with recombinant SIRP components induces a cellular immune response that can be measured based on cytokine expression.
<td colspan="2">Methods:</td><td>Get vaccinated</td><td>mice</td><td>twice,</td><td>with</td><td>a</td>
<td>Difference of</td><td> 14</td><td>days, with 70</td><td>μg of</td><td colspan="2">total protein</td><td>(OVA,</td>
<td>excerpt from</td><td>SIRP</td><td>or rSIRP7)</td><td colspan="2">formulated with IFA</td><td> 50%</td><td>. I know</td>
purified CD4 T lymphocytes<sup>+</sup> of splenocyte suspensions by negative selection using the CD4 T lymphocyte isolation kit<sup>+</sup> and LD columns (Miltenyi Biotec, Inc., Auburn, CA). Briefly, biotinylated antibodies were used
267 to label all cells except the lymphocytes ^ 9 ^ JT: 'f ^ ES4t <T then streptavidin-conjugated magnetic beads were used to remove these cells from the mix with a magnetic column, leaving CD4 T lymphocytes<sup>+ </sup>highly purified. CD4 T lymphocytes<sup>+</sup> Resultants are found to be greater than 95% pure based on the expression of CD3 and CD4. Previously unexposed splenocytes were treated with mitomycin C to generate mitotically inactive antigen presenting cells. 4x10 added<sup>5</sup> 5 x 10 APC<sup>5</sup> CD4 T lymphocytes<sup>+</sup> plus stimulation antigen, followed by 42 hours of incubation. Supernatants were analyzed by Luminex using standard analysis parameters. The results are shown in the figure
206 .
EXAMPLE 37
S. aureus extracts from various strains (Newman, Reynolds) were prepared using the method described in Example 1. S. aureus cells were grown either in iron-limited medium containing 2,2-dipyridyl 1000 µΜ (Sigma -Aldrich St. Louis, MO) or medium packed with iron containing FeCl<sub>3</sub> 300 μΜ (Sigma-Aldrich St. Louis, MO).
Proteins within S. aureus membrane extracts from iron-replete and iron-suppressed cultures are identified and quantified using ITRAQ and LCQ mass spectrometry. The amine modified marking
268 of membrane extracts for the iron-deficient and iron-filled strain of St ^ flyTococcus aureus Newman co-reagents ITRAQ-8plex (Applied Biosystems, Inc. Foster City, CA) were performed using 40.0 gg of membrane extract (reagents 113 versus 115 ) according to the manufacturer's 8Plex procedure. Cation exchange chromatography was applied using an MCX column (Waters Corp., Milford, MA) and the peptides were separated using a ULTIMATE 3000 NANO LC system (Dionex Corp. Bannockburn, IL) coupled to the ESI mode using a mass spectrometer.
QSTAR XL (Applied Biosystems, Inc., Foster City, CA).
The ratio of metal regulated polypeptides produced to cells growing in iron restricted medium compared to iron packed medium was measured. The ratio is a relative measure of protein expression and does not provide data indicating an absolute amount of protein present in the extract. The results are shown in Table 15.
<img file="MX339461B_D0147.tif" />
TABLE 15
<td>Protein</td><td>identified</td><td>at</td><td>multiples of</td>
<td></td><td>abstract</td><td></td><td>low rise</td>
<td></td><td></td><td></td><td>iron</td>
<td>MntC</td><td colspan="2">Yes</td><td> 22</td>
<td>SYN1</td><td colspan="2">Yes</td><td>undetermined</td>
<td>FhuD</td><td colspan="2">Not</td><td>undetermined</td>
269
<td>SYN2</td><td>Yes</td><td>to</td>
<td>SirA</td><td>Yes</td><td>INSTITU · '··.? * ' OF THE/<sup>1</sup> OR 36</td>
<td>OpplA</td><td>Yes</td><td>not from t o-rmi naéte—</td>
<td>PflB</td><td>Yes</td><td>undetermined</td>
<td>FhuD2</td><td>Yes</td><td> 6</td>
<td>SstD</td><td>Yes</td><td> 14</td>
EXAMPLE 38
An oxidative discharge analysis can be used to measure the production of reactive oxygen species by neutrophils, an indication of an inflammatory response. To obtain fresh blood neutrophils, fresh human blood erythrocytes are used by addition of lysis buffer (NH<sub>4</sub>C1 150 mM, KHCO<sub>3</sub> 10mM, 1mM disodium EDTA, pH 7.4) at 1:10 dilution incubated for 10 minutes at room temperature and centrifuged for 10 minutes at 430 x g. The supernatant is removed by tube inversion and the pellets are washed twice with PBS, then resuspended in 5 ml of RPMI-Hepes, 5% FCS + glutamine (complete RPMI) and enumerated using a MULTISIZER (Beckman Coulter, Inc. Brea, CA) after a 1/500 dilution of cell suspension in ISOTON (20 µΐ of cells in 10 ml of ISOTON, Beckman Coulter, Inc. Brea,
CA).
For the preparation of bacteria,
270 sows S. aureus Lowenstein strain on me
Your P? gave T BE Asé na ce
INSTITUTE -M:
DE LA f> </. · Grow for 20 hours at 37 ° C in 50 ml of mectibí from this culture, settle for 5 ml of 'Sur áñt'é' ™ TTr ”minutes at 4000 rpm at 4 ° C. The pellet is then washed with 50 ml of PBS and re-sedimented by centrifugation for 10 minutes at 4000 rpm, at 4 ° C. The washing step is repeated and the bacterial pellet is resuspended in 5 ml of PBS. Bacteria conform to a theoretical density of 1.10<sup>9</sup> CFU / ml and cell dilutions are plated on agar and incubated for exact enumeration the next day.
To remove the complement from the sera, all sera are incubated for 30 minutes at 56 ° C. The mixtures of sera and cells are made on sterile polypropylene DW plates in a final volume of 500 μΐ per well, the following reagents are added to each well (as shown in Table 16) in order:
culture medium (RPMI-Hepes, glutamine, 5% FCS), live bacteria at the appropriate concentration, sera at the appropriate dilution, complement, hPMN and at the appropriate concentration and finally, the DHR molecule (Life technologies, Inc ., Carlsbad, CA) as the marker for oxidative discharge. plates are incubated for 25 minutes at 37 ° C with shaking. The reaction is stopped by incubating the plates for five minutes on ice.
271
TABLE 16
<img file="MX339461B_D0148.tif" />
INsiiti.it. ', · DE L „
'.I and
<td>reagent</td><td>ID</td><td>concentration of work</td><td>volume / poze-</td><td>final (in 500 μΐ)</td>
<td>bacterium live</td><td>TSB, 20 h, 37 ° C, 10<sup>9</sup>CFU / ml</td><td> 1.25. 10<sup>8</sup>CFU / ml</td><td>200 μΐ</td><td> 5. 10<sup>7</sup> CFU / ml</td>
<td>leukocytes of blood total</td><td>from 2 donors different after lysis of erythrocytes</td><td> 2.5. 10<sup>6</sup>cells / ml</td><td>100 μΐ</td><td> 0.5. 10<sup>6</sup>cells / ml</td>
<td>DHR</td><td>Life technologies Inc. Cat. No. D632 (10 mg / ml)</td><td>100 gg / ml</td><td>50 μΐ</td><td>10 μ9 / τη1</td>
<td>complement rabbit baby</td><td>produced in The laboratory</td><td> 1/10</td><td>50 μΐ</td><td> 1/100 (1%)</td>
<td rowspan="3">Serums</td><td>serum of mice immunized with adjuvant only</td><td> 1/10</td><td>50 μΐ</td><td> 1/100</td>
<td>anti-control cells Complete</td><td> 1/100</td><td>50 μΐ</td><td> 1/1000</td>
<td>anti-protein S. aureus</td><td>1/10 and 1/100</td><td>50 μΐ</td><td>1/100 and 1/1000</td>
For flow cytometric analysis, PMNs
272
<img file="MX339461B_D0149.tif" />
surface of the specific markers (• GR4-<sub>r</sub>
<img file="MX339461B_D0150.tif" />
etc.), and after the oxidative discharge marker. Data are provided in terms of percentage of activated hPMN capable of inducing oxidative discharge compared to a negative control group (Didier, 2003; Ploppa, 2008).
EXAMPLE 39
OPSONOPHAGOCITICAL ANALYSIS
An opsonophagocytic assay (OPA) has been developed to calculate serum functional phagocytic activity for Staphylococcus aureus by measuring serum complement-dependent opsonic activity. The OPA is summarized in Table 17. Two strains of S. aureus are used in this analysis. The DU5875 strain, which does not produce capsule or protein A, is used to better control the analysis. The LST4 Lowenstein strain, which expresses the capsule and protein A, is used as a natural strain in the analysis. The number of bacteria used in the analysis depends on the source of the effector leukocytes and varies in concentration from 1 x 10<sup>5</sup> cfu / ml at 5 x 10<sup>7</sup> cfu / ml. Leukocytes from healthy human volunteers or from a human promyelocytic leukemia cell line, HL 60 is used as phogocytic effector cells. As Table 17 indicates, the number
273 of effector cells used in the analysis (3.a, - INST! TU 7 7, 7 .7 777 7; tu; -. T / '7' source of the cells. Rabbit serum is used<sup>L</sup>You must .. as a source of complement and it is diluted da ——, .. a. 10% -, -------- depending on the batch of serum in order to maximize the full functional activity of rabbit serum while minimizing toxicity. Sera that undergo testing for opsonic activity, before or after immunization, have their complement removed at 56 ° C for minutes and tested in the assay at a 1:20 to 1: 2,000,000 dilution. Phagocytosis is determined by viable counts (ufe) of S. aureus. Test serum which demonstrates a significant loss of ufe in combination with the active complement when compared to preimmune serum, is considered opsonic. Analysis data is analyzed by Student's t-test using a tail distribution with unequal variance (Kim 2010; Stranger-Jones 2006; Dryla 2005).
TABLE 17
<td>Reagent</td><td>Final concentration</td>
<td>Live bacteria</td><td>about 1 x 10<sup>5</sup> cfu / ml when use HL-60 effector cells about 5 x 10<sup>7</sup> cfu / ml when they use leukocytes from healthy human</td>
<td>Effector cells</td><td>HL-60 induced human cell line chemically to differentiate with N, N-</td>
274
<td rowspan="2"></td><td>dimethylformamide diluted to 10 or * - INSTITUTE CE LA human leukocytes from healthy volunteers</td>
<td>diluted to 1 x 10<sup>7</sup>/ ml</td>
<td>Complement</td><td>Baby rabbit serum diluted 1% to 10%, from according to batch of serum</td>
<td>Test serum</td><td>Serum obtained after the last immunization, in which the complement and has been diluted so serial from 1:20 to 1: 2,000,000</td>
EXAMPLE 40
IMMUNE MECHANISM STUDIES (in vivo)
In another example, the immune mechanism by which the vaccine proteins confer protection to the mice will be determined. These experiments can include two types: (1) using mice in which gene expression has been blocked in vaccine exposure experiments to determine if specific immune components are required for protection; and (2) adoptive transfer experiments, where the immune cells of immunized donor mice are transferred to previously unexposed recipients prior to bacterial exposure, in order to determine if the transferred components are sufficient to confer protection.
For examples involving vaccine exposure experiments in mice in which the
275 gene expression, mice can be 'acquired' from
INSTITVi ''; ·
DEL> \.
commercial vendors and may include several characterized biet + cepa-s such as, for example, mice<sup>11</sup> ciriog<sup>1</sup> than·<sup>11</sup> B lymphocytes (μΜΤ) have been blocked, in which T lymphocytes (TCRoí) and a variety of cytokine expression blocks such as IFN-γ, IL-la, TNFa, IL-17, etc. have been blocked. ). Mice can be immunized as described in Example 3 and then exposed with S. aureus as described in Example 5. The use of wild type mice with the same genetic background (Balb / c) can provide adequate controls to measure the effect of expression blocking on vaccine mediated protection against S. aureus. For example, if mice in which the expression of vaccinated B lymphocytes has been blocked die faster or in greater numbers relative to vaccinated control mice in response to bacterial exposure, it can be concluded that B lymphocytes (or their products ) are important for vaccine-mediated protection against S. aureus. These strategies are standard practice in the field of measuring contributions of various immune components to vaccine protection (Spellberg, 2008; Lin, 2009).
For examples involving adoptive transfer of immune components, wild-type Balb / c donor mice can be immunized as described in
276
Example 3 in order to generate tissue for
<img file="MX339461B_D0151.tif" />
Adoptive INSTiTU. These mice are then sacrificed 2-4 weeks after the second immunization and the sangt »- ·. rec & l & i by cardiac function and lymphoid tissue is collected to secondary (lymph nodes and spleen). Collected lymph nodes may include: axillary, brachial, mesenteric, inguinal, superficial cervical, deep cervical, and lumbar. Serum can be isolated from blood using standard methodology, such as centrifuge-based serum separators, and then transferred back to a separate set of recipient mice by intravenous or intraperitoneal injection. The use of 1-3 donor mice per recipient is a reasonable ratio for serum transfer and can be carried out in volumes up to 0.5 ml. In addition, T lymphocytes from donor lymphoid tissue can be purified using antibodies and magnetic sphere enrichment technology (Miltenyi Biotec) which is standard practice in the field. It is common to obtain 95-99% similar purity using these methods, as determined by staining cell surface proteins with antibodies to specific line markers and examining cells by flow cytometry. Populations of cells of interest (eg CD4 T lymphocytes<sup>+</sup>CD8 T lymphocytes<sup>+</sup>etc.) can be transferred back to animals
277 intravenous (between ΐ21.ν®0.ϋ) 000 and íNsiiTvro ·.
DI L /. - '<sup>;</sup>
T per receiver). T lymphocyte mice (or both.
recipients via injection
5,000,000 receptor lymphocytes can receive T) lymphocytes, immune serum
As a negative control, placebo immunized animals can also be used for serum and T lymphocyte isolation followed by transfer back to previously unexposed recipients. As a positive control, a group of recipients is immunized with the standard protective vaccine can be included in order to provide an initial value determination of the protective efficacy against bacterial exposure.
Once the recipient mice have received the various transferred cells or sera, they can be exposed to S. aureus, as described in Example 5. Based on the percentage of death and the death rate, the relative contribution can be determined of various immune components to vaccine protection. For example, if recipients who have been administered T lymphocytes from vaccinated donors are protected against exposure at the same rate as the positive control, it can be concluded that T lymphocytes are sufficient for vaccine-mediated protection. This experimental strategy is standard practice in the field to determine vaccine immunological mechanisms (Spellberg, 2008; Lin, 2009).
278
EXAMPLE 41
<img file="MX339461B_D0152.tif" />
INHIBITION OF THE IRON CAPTURE ANALYSIS
To determine whether antibodies directed against SIRP components inhibit cell growth by blocking iron uptake, an iron uptake / transport assay can be performed using bacterial cells that are preincubated with anti-SIRP antisera. S. aureus cells of any strain are grown overnight and chelated in an iron-rich medium. Cells are subcultured in the same medium and grown to the logarithmic mid or late phase, pelleted, and incubated with anti-SIRP antibodies and control antisera in PBS for up to one hour. Cells are then harvested by filtration using 0.45 µΜ filters, then resuspended in Chelex-100 treated minimal medium to remove ambient iron. The cells are briefly shaken. Meanwhile a source of iron (for example ferricrome) is mixed with<sup>55</sup>FeCl<sub>2</sub> radiolabeled (or other radiolabeled iron molecule) with nitrilotriacetic acid and allowed to incubate for several minutes.
To initiate iron uptake, a small aliquot (eg 10 µΐ) of the radiolabelled iron mixture is added to the cells (in a volume of 1 ml) in a 10 ml Fe-free culture tube. The tube is incubated with periodic swirling and sampling of the filtered aliquots
279 on membrane filters and washed with LiCl.
You .Idéf '
INSTITUTE '-O.'. UC-O- O DE 'OO. or dried, the membranes are scintillated to "~" scintillation to quantify uptake of lllerTO ..... 'Ea'S' cells preincubated with anti-SIRP antiserum must be slower to take up iron compared to preincubated cells with control antisera (Sebulsky, 2000; Goel,
<img file="MX339461B_D0153.tif" />
2001) .
EXAMPLE 42
HIGH PERFORMANCE PROTEIN PURIFICATION PROCEDURE
In some cases, the recombinant rSIRPs are purified using a high throughput method. This method is optimized for higher yields and higher purity of the polypeptide. The method is performed by resuspending the bacterial pellet containing the recombinantly produced polypeptide in 20 mM Tris, pH 9; 300 mM NaCl supplemented with lysozyme (100 gg / ml final) and MgCl<sub>2</sub> (Final 1 mM). The sample is then incubated with gentle shaking for 15 minutes at 4 ° C. After 15 minutes, 1U / ml of benzonase are added and the sample is incubated for one hour at room temperature. The soluble lysate obtained after centrifugation (20,000 xg, 20 min at 4 ° C) must be filtered with a 0.45 μπι filter and added to a gravity-balanced 5 ml column packed with nickel-His binding resin ( Novagen 69670-4, EMD Chemicals, Inc., Gibbstown, NJ). N-His purification<sub>6</sub>-protein is made
280 maker. The Xú-ío-ification
DE LA F (using a HiLoad 26/60 preparative column following the instructions of the N-His<sub>6</sub>-protein is finished grade size exclusion
Superdex 75 (GE Healthcare Biosciences, Piscataway, NJ). The column is balanced with. 20 mM Tris, pH 9; 300 mM NaCl using BioCAD FPLC (Applied Biosystems Inc., Foster City, CA) and 15 ml of the protein sample is loaded onto the HiLoad column at a flow rate of 1.5 ml / min. The sample is eluted after 3.5 hours run time at a flow rate of 1.8 ml / min using 20 mM Tris, pH 9; 300 mM NaCl as the mobile phase.
The polypeptide is quantified using the modified version of the BCA procedure (Termo Fisher Scientific,
Inc., Rockford, IL) where 15% sodium dodecyl sulfate (SDS), 8M urea, and 3 ([3-colamidopropyl] dimethylammonium) 2-hydroxy-l-propanesulfonate (CHAPS) are used to ensure complete solubility of all protein within the sample. The analysis also consists of 5% SDS added to the BCA working reagent to maintain protein solubility during the BCA reactive phase. The reading and analysis of BCA is done according to the product literature.
For densitometric analysis, 3.0 gg of the final product antigen is quantified for purity using 10% SDS PAGE, stained with Coomassie and an image is generated
281 ιμ:
using the ODYSSEY explorer (LiCor Bioscien <w ^ mXwroQlh<sub>and</sub>
DE LA; · · .. - '.? ·> ¿I -, - xL
NE). The stained gel is scanned and the areas of the main components are determined in relation to the total area. The residual endotoxin is removed using the Endotrap blue one / endosafe kit (Iglos GMBH, Regendburg, Germany). The final batch is stored at a concentration range of 1.0 mg / ml to 4.0 mg / ml in PBS storage buffer at less than -70 ° C in the appropriate aliquots.
The full description of all patents, patent applications and publications and electronically available material (including, for example, submission of nucleotide sequences in, for example, GenBank and RefSeq, and shipments of amino acid sequences in, for example, SwissProt , PIR, PRF, PDB, and translations from coding regions noted in GenBank and RefSeq) mentioned herein are incorporated by reference. In the event of any inconsistency between the description of this application and one or more of the descriptions of any document incorporated herein by reference, the description of the present application shall prevail. The above detailed description and examples are provided for clarity and for understanding only. They should not be removed from the same unnecessary limitations. The invention is not limited to the exact details shown and described, for obvious variations by one skilled in the art.
282 scope which will be included within
<img file="MX339461B_D0154.tif" />
iv jk invénc i ón instituto me: ·;:;: /,
OF THE
INDUSTRIAL defined by the claims.
Unless otherwise indicated
<img file="MX339461B_D0155.tif" />
numbers expressing quantities of components, molecular weights, etc., used in the. specification and in the claims it should be understood that they are modified, in all cases, by the term approximately. Accordingly, unless otherwise indicated, the numerical parameters set forth in the specification and claims are approximations which may vary depending on the desirable properties sought to be obtained by the present invention. Finally, and without trying to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should be considered constituted based on the number of significant digits reported and applying standard rounding techniques.
However, the numerical ranges and parameters that are established, the broad scope of the invention are approximations, the numerical values established in the specific examples are reported as accurately as possible. However, all numerical values inherently contain a range necessarily resulting from the standard deviation found in the respective test measurements.
All headings are for the convenience of the
283
<img file="MX339461B_D0156.tif" />
reader and should not be used to limit the non-s text following the heading, unless you specify to that effect.
It is noted that in relation to this date, the best method known by the applicant to carry out said invention is the one that is clear from the present description of the invention.
<img file="MX339461B_D0157.tif" />
be the la the
284
<img file="MX339461B_D0158.tif" />
Contents315
633 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130 Sheet 131 Sheet 132 Sheet 133 Sheet 134 Sheet 135 Sheet 136 Sheet 137 Sheet 138 Sheet 139 Sheet 140 Sheet 141 Sheet 142 Sheet 143 Sheet 144 Sheet 145 Sheet 146 Sheet 147 Sheet 148 Sheet 149 Sheet 150 Sheet 151 Sheet 152 Sheet 153 Sheet 154 Sheet 155 Sheet 156 Sheet 157 Sheet 158 Sheet 159 Sheet 160 Sheet 161 Sheet 162 Sheet 163 Sheet 164 Sheet 165 Sheet 166 Sheet 167 Sheet 168 Sheet 169 Sheet 170 Sheet 171 Sheet 172 Sheet 173 Sheet 174 Sheet 175 Sheet 176 Sheet 177 Sheet 178 Sheet 179 Sheet 180 Sheet 181 Sheet 182 Sheet 183 Sheet 184 Sheet 185 Sheet 186 Sheet 187 Sheet 188 Sheet 189 Sheet 190 Sheet 191 Sheet 192 Sheet 193 Sheet 194 Sheet 195 Sheet 196 Sheet 197 Sheet 198 Sheet 199 Sheet 200 Sheet 201 Sheet 202 Sheet 203 Sheet 204 Sheet 205 Sheet 206 Sheet 207 Sheet 208 Sheet 209 Sheet 210 Sheet 211 Sheet 212 Sheet 213 Sheet 214 Sheet 215 Sheet 216 Sheet 217 Sheet 218 Sheet 219 Sheet 220 Sheet 221 Sheet 222 Sheet 223 Sheet 224 Sheet 225 Sheet 226 Sheet 227 Sheet 228 Sheet 229 Sheet 230 Sheet 231 Sheet 232 Sheet 233 Sheet 234 Sheet 235 Sheet 236 Sheet 237 Sheet 238 Sheet 239 Sheet 240 Sheet 241 Sheet 242 Sheet 243 Sheet 244 Sheet 245 Sheet 246 Sheet 247 Sheet 248 Sheet 249 Sheet 250 Sheet 251 Sheet 252 Sheet 253 Sheet 254 Sheet 255 Sheet 256 Sheet 257 Sheet 258 Sheet 259 Sheet 260 Sheet 261 Sheet 262 Sheet 263 Sheet 264 Sheet 265 Sheet 266 Sheet 267 Sheet 268 Sheet 269 Sheet 270 Sheet 271 Sheet 272 Sheet 273 Sheet 274 Sheet 275 Sheet 276 Sheet 277 Sheet 278 Sheet 279 Sheet 280 Sheet 281 Sheet 282 Sheet 283 Sheet 284 Sheet 285 Sheet 286 Sheet 287 Sheet 288 Sheet 289 Sheet 290 Sheet 291 Sheet 292 Sheet 293 Sheet 294 Sheet 295 Sheet 296 Sheet 297 Sheet 298 Sheet 299 Sheet 300 Sheet 301 Sheet 302 Sheet 303 Sheet 304 Sheet 305 Sheet 306 Sheet 307 Sheet 308 Sheet 309 Sheet 310 Sheet 311 Sheet 312 Sheet 313 Sheet 314 Sheet 315 Sheet 316 Sheet 317 Sheet 318 Sheet 319 Sheet 320 Sheet 321 Sheet 322 Sheet 323 Sheet 324 Sheet 325 Sheet 326 Sheet 327 Sheet 328 Sheet 329 Sheet 330 Sheet 331 Sheet 332 Sheet 333 Sheet 334 Sheet 335 Sheet 336 Sheet 337 Sheet 338 Sheet 339 Sheet 340 Sheet 341 Sheet 342 Sheet 343 Sheet 344 Sheet 345 Sheet 346 Sheet 347 Sheet 348 Sheet 349 Sheet 350 Sheet 351 Sheet 352 Sheet 353 Sheet 354 Sheet 355 Sheet 356 Sheet 357 Sheet 358 Sheet 359 Sheet 360 Sheet 361 Sheet 362 Sheet 363 Sheet 364 Sheet 365 Sheet 366 Sheet 367 Sheet 368 Sheet 369 Sheet 370 Sheet 371 Sheet 372 Sheet 373 Sheet 374 Sheet 375 Sheet 376 Sheet 377 Sheet 378 Sheet 379 Sheet 380 Sheet 381 Sheet 382 Sheet 383 Sheet 384 Sheet 385 Sheet 386 Sheet 387 Sheet 388 Sheet 389 Sheet 390 Sheet 391 Sheet 392 Sheet 393 Sheet 394 Sheet 395 Sheet 396 Sheet 397 Sheet 398 Sheet 399 Sheet 400 Sheet 401 Sheet 402 Sheet 403 Sheet 404 Sheet 405 Sheet 406 Sheet 407 Sheet 408 Sheet 409 Sheet 410 Sheet 411 Sheet 412 Sheet 413 Sheet 414 Sheet 415 Sheet 416 Sheet 417 Sheet 418 Sheet 419 Sheet 420 Sheet 421 Sheet 422 Sheet 423 Sheet 424 Sheet 425 Sheet 426 Sheet 427 Sheet 428 Sheet 429 Sheet 430 Sheet 431 Sheet 432 Sheet 433 Sheet 434 Sheet 435 Sheet 436 Sheet 437 Sheet 438 Sheet 439 Sheet 440 Sheet 441 Sheet 442 Sheet 443 Sheet 444 Sheet 445 Sheet 446 Sheet 447 Sheet 448 Sheet 449 Sheet 450 Sheet 451 Sheet 452 Sheet 453 Sheet 454 Sheet 455 Sheet 456 Sheet 457 Sheet 458 Sheet 459 Sheet 460 Sheet 461 Sheet 462 Sheet 463 Sheet 464 Sheet 465 Sheet 466 Sheet 467 Sheet 468 Sheet 469 Sheet 470 Sheet 471 Sheet 472 Sheet 473 Sheet 474 Sheet 475 Sheet 476 Sheet 477 Sheet 478 Sheet 479 Sheet 480 Sheet 481 Sheet 482 Sheet 483 Sheet 484 Sheet 485 Sheet 486 Sheet 487 Sheet 488 Sheet 489 Sheet 490 Sheet 491 Sheet 492 Sheet 493 Sheet 494 Sheet 495 Sheet 496 Sheet 497 Sheet 498 Sheet 499 Sheet 500 Sheet 501 Sheet 502 Sheet 503 Sheet 504 Sheet 505 Sheet 506 Sheet 507 Sheet 508 Sheet 509 Sheet 510 Sheet 511 Sheet 512 Sheet 513 Sheet 514 Sheet 515 Sheet 516 Sheet 517 Sheet 518 Sheet 519 Sheet 520 Sheet 521 Sheet 522 Sheet 523 Sheet 524 Sheet 525 Sheet 526 Sheet 527 Sheet 528 Sheet 529 Sheet 530 Sheet 531 Sheet 532 Sheet 533 Sheet 534 Sheet 535 Sheet 536 Sheet 537 Sheet 538 Sheet 539 Sheet 540 Sheet 541 Sheet 542 Sheet 543 Sheet 544 Sheet 545 Sheet 546 Sheet 547 Sheet 548 Sheet 549 Sheet 550 Sheet 551 Sheet 552 Sheet 553 Sheet 554 Sheet 555 Sheet 556 Sheet 557 Sheet 558 Sheet 559 Sheet 560 Sheet 561 Sheet 562 Sheet 563 Sheet 564 Sheet 565 Sheet 566 Sheet 567 Sheet 568 Sheet 569 Sheet 570 Sheet 571 Sheet 572 Sheet 573 Sheet 574 Sheet 575 Sheet 576 Sheet 577 Sheet 578 Sheet 579 Sheet 580 Sheet 581 Sheet 582 Sheet 583 Sheet 584 Sheet 585 Sheet 586 Sheet 587 Sheet 588 Sheet 589 Sheet 590 Sheet 591 Sheet 592 Sheet 593 Sheet 594 Sheet 595 Sheet 596 Sheet 597 Sheet 598 Sheet 599 Sheet 600 Sheet 601 Sheet 602 Sheet 603 Sheet 604 Sheet 605 Sheet 606 Sheet 607 Sheet 608 Sheet 609 Sheet 610 Sheet 611 Sheet 612 Sheet 613 Sheet 614 Sheet 615 Sheet 616 Sheet 617 Sheet 618 Sheet 619 Sheet 620 Sheet 621 Sheet 622 Sheet 623 Sheet 624 Sheet 625 Sheet 626 Sheet 627 Sheet 628 Sheet 629 Sheet 630 Sheet 631 Sheet 632 Sheet 633
32 members in 14 offices
Priority claims9
| Document | Office | Kind | Date |
|---|---|---|---|
| 21077209 | United States of America | P | |
| 21077209 | United States of America | P | |
| 61210772 | United States of America | – | |
| 2010028326 | United States of America | W | |
| 2010028326 | United States of America | W | |
| 61210772 | – | – | – |
| US1028326 | – | – | – |
| US20090210772P | – | – | – |
| WO2010US28326 | – | – | – |
Members32
| Document | Office | Kind | |
|---|---|---|---|
| CA2756313A1 | Canada | A1 | |
| WO2010111273A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AR075933A1 | Argentina | A1 | |
| MX2011009949A | Mexico | A | |
| AU2010229498A1 | Australia | A1 | |
| IL215330A0 | Israel | A0 | |
| KR20120005471A | Republic of Korea | A | |
| EP2411046A1 | European Patent Office (EPO) | A1 | |
| US2012034258A1 | United States of America | A1 | |
| CN102448489A | China | A | |
| ZA201106959B | South Africa | B | |
| JP2012521441A | Japan | A | |
| EP2411046A4 | European Patent Office (EPO) | A4 | |
| NZ595231A | New Zealand | A | |
| NZ614557A | New Zealand | A | |
| KR20150093774A | Republic of Korea | A | |
| JP2015164949A | Japan | A | |
| AU2016201992A1 | Australia | A1 | |
| CN105582524A | China | A | |
| MX339461BThis record | Mexico | B | |
| KR20160064237A | Republic of Korea | A | |
| KR20160114744A | Republic of Korea | A | |
| KR101684292B1 | Republic of Korea | B1 | |
| IL215330A | Israel | A | |
| IL248523A0 | Israel | A0 | |
| JP6092933B2 | Japan | B2 | |
| KR101770321B1 | Republic of Korea | B1 | |
| EP2411046B1 | European Patent Office (EPO) | B1 | |
| AU2016201992B2 | Australia | B2 | |
| US9932373B2 | United States of America | B2 | |
| US2018237481A1 | United States of America | A1 | |
| BRPI1011856A2 | Brazil | A2 |
1 legal event, as the office reported them to INPADOC
Events
| Event | Code | |
|---|---|---|
| Grant or registrationFG | FG |
Numbers
- Publication
- 339461
- Publication, DOCDB
- 339461
- Publication, EPODOC
- MX339461
- Application
- 2011009949
- Application, DOCDB
- 2011009949
- Application, EPODOC
- MX20110009949
Titles2
- English
- POLYPEPTIDES AND IMMUNIZING COMPOSITIONS CONTAINING GRAM POSITIVE POLYPEPTIDES AND METHODS OF USE.
- Spanish
- POLIPEPTIDOS Y COMPOSICIONES INMUNIZANTES QUE CONTIENEN POLIPEPTIDOS GRAMPOSITIVOS Y METODOS DE USO.
Classification
- CPC, 10
- A61K39/085
- C07K14/31
- A61K38/00
- A61P31/04
- A61P37/04
- A61P43/00
- A61K38/16
- A61K39/38
- A61K39/395
- A61K2039/505
- IPC, 3
- A61K39 085
- A61K39 38
- C07K14 00