Lipid comprising docosapentaenoic acid.

(54) Title: LIPID INCLUDING DOCOSAPENTAENOIC ACID.

(54) Title: LIPID COMPRISING DOCOSAPENTAENOIC ACID.

(57) Summary

Plant-extracted lipids or microbial lipids comprising docosapentaenoic acid, and processes for producing the extracted lipids.

(57) Abstract

The present invention relates to extracted plant lipid or microbial lipid comprising docosapentaenoic acid, and processes for producing the extracted lipid.

LIPID INCLUDING DOCOSAPENTAENOIC ACID

FIELD OF THE INVENTION

The present invention relates to a lipid comprising docosapentaenoic acid, obtained from plant cells or microbial cells, and processes for the production and use of the lipid.

BACKGROUND OF THE INVENTION.

Omega-3 long chain polyunsaturated fatty acids (LC-PUFAs) are now widely recognized as important compounds for human and animal health. These fatty acids can be obtained from sources such as the diet or by conversion of linoleic (LA, 18: 2ω6) or oilinolenic (ALA, 18: 3ω3) fatty acids, both considered essential fatty acids in the human diet. Although humans and many other vertebrate animals have the ability to convert LA or ALA, obtained from plant sources, to C22, this conversion is carried out at a very low rate. Additionally, most modern societies have unbalanced diets in which at least 90% of polyunsaturated fatty acids (FUFA) is from ωβ fatty acids, instead of 4: 1 or less for ω6: ω3 fatty acids. , which is considered the ideal (Trautwein, 2001). The immediate source of LC-PUFA from the diet such as eicosapentaenoic acid (EPA, 20: 5ω3), docosapentaenoic acid (DPA) and docosahexaenoic acid (DHA, 22: 6ω3) for humans, is mainly from fish or oil of fish. Therefore, health professionals have recommended the regular inclusion of fish containing significant levels of LC-PUFA in the human diet. Fish derived LC-PUFA oils are increasingly being incorporated into food products and infant formulas, for example. However, due to a decline in the global and national fishing industry, alternative sources of these oils are required that beneficially improve health.

Plants that flourish, unlike animals, lack the ability to synthesize polyunsaturated fatty acids with long chains greater than 18 carbons. In particular, cultivated and horticultural plants along with other angiosperms do not have the enzymes needed to synthesize the longer chain ω3 fatty acids such as EPA, docosapentaenoic acid (DPA, 22: 5ω3) and DHA that are derived from ALA. Therefore, an important goal in plant biotechnology is the design of plants for cultivation that produce substantial amounts of LC-PUFA, thus providing an alternative source of these compounds.

LC-PUFA Biosynthesis Pathways

LC-PUFA biosynthesis in organisms such as microalgae, mosses, and fungi usually occurs as a series of oxygen-dependent elongation and desaturation reactions (Figure 1). The most common pathway that EPA produces in these organisms includes a Δδ-desaturation, Δβ-elongation, and Δ5-desaturation (called the A6-desaturation pathway) while a less common pathway uses an A9-elongation, Δ8-desaturation, and Δ5-desaturation ( called the h9-desaturation pathway). These consecutive desaturation and elongation reactions can begin with the ácido6 LA fatty acid substrate, shown schematically as the upper left in Figure 1 (ωβ) or the ω3 ALA via EPA substrate, shown as the lower right of the Figure 1 (ω3). If the initial Δ6 desaturation is carried out on the ω6 LA substrate, the LC-PUFA product of the three enzyme series will be the ω6 ARA fatty acid. Organisms that synthesize LC-PUFA can convert ω6 fatty acids to ω3 fatty acids using an α3-desaturase, as shown in the Δ17desaturase step in Figure 1 for the conversion of arachidonic acid (ARA, 20: 4ω6) to EPA. Some members of the ω3-desaturase family can act on a variety of substrates ranging from LA to ARA. Plant ω3 desaturases often specifically catalyze the Δ15-desaturation of LA to ALA, while fungal and yeast ω3-desaturases may be specific for the A17-desaturation of ARA to EPA (Pereira et al., 2004a; Zank et al. ., 2005). Some reports suggest that there may be non-specific ω3-desaturases that can convert a wide variety of ωδ substrates to their corresponding ω3 products (Zhang et al., 2008).

The conversion of EPA to DEA in these organisms occurs by a Δ5-elongation of EPA to produce DPA, followed by a A4-desaturation to produce DHA (Figure 1). In contrast, mammals use the pathway called 4

Sprecher converting DPA to DHA by three separate reactions that are independent of an L4-desaturase (Sprecher et al., 1995).

Terminal desaturases generally found in plants, mosses, microalgae, and lower animals such as Caenorhabditis elegans predominantly accept esterified fatty acid substrates at the sn-2 position of a phosphatidylcholine (PC) substrate. For this reason, these desaturases are known as terminal acyl-PC desaturases, linked to lipids (Domerguey col., 2003). In contrast, terminal desaturases from higher animals generally accept acyl-CoA substrates where the fatty acid substrate is bound to CoA rather than PC (Domerguey col.,

2005). Some microalgae desaturases and a plant desaturase are known to use fatty acid substrates esterified to CoA (Table 2).

Each PUFA elongation reaction consists of four steps catalyzed by a muiticomponent protein complex: first, a condensation reaction results in the addition of a 2C unit of malonyl-CoA to the fatty acid, giving the formation of a β-ketoacyl intermediate. . This is then reduced by NADPH, followed by dehydration to give an enoyl intermediate. This intermediate is finally reduced a second time to produce the elongated fatty acid. The condensation step of these four reactions is generally thought to be substrate specific while the other steps are not. In practice, this means that the natural elongation machinery of the plant has the ability to elongate PUFA on the condition that the condensation enzyme (typically called an elongase) specific to PUFA is provided, despite the fact that the efficiency of the machinery The natural elongation of the plant to elongate unnatural PUFA substrates may be low. In 2007 the identification and characterization of the elongation cycle dehydratase in yeasts was published (Denic and Weissman, 2007).

PUFA desaturation in plants, mosses, and microalgae occurs naturally on fatty acid substrates predominantly in the acyl-PC pool while elongation occurs on substrates in the acylCoA pool. The transfer of fatty acids from acylPC molecules to a CoA transporter is carried out by phospholipases (PLA) while the transfer of acyl-CoA fatty acids to a PC transporter is carried out by lysophosphatidylcholine acyltransferases (LPCAT) (Singhy col ., 2005).

LC-PUFA Engineered Production

Most of the metabolic design of LC-PUFA has been performed using the Δ6-desaturation / elongation aerobic pathway. The biosynthesis of y-linolenic acid (GLA, 18: 3ωβ) in tobacco was first reported in 1996 using a Δ6-desaturase from the cyanobacterium Synechocystis (Reddy and Thomas, 1996). More recently, GLA has been produced in crop plants such as safflower (73% GLA in seed oil, WO 2006/127789) and soybean (28% GLA; Satoy col., 2004). The production of LC-PUFAs such as EPA and DHA involves a more complicated design due to the increasing number of desaturation and elongation steps involved. EPA production in a land plant was first reported by Qiy col. (2004) who introduced genes that code for an A9-elongase from Isochrysis galbana, a

Δδ-desaturase from Euglena gracilis and a A5-desaturase from Mortierella alpina in Arabidopsis resulting in up to 3% EPA. This work was continued by Abbadiy col. (2004) who reported the production of up to 0.8% EPA in flax seeds using genes encoding a Δ6-desaturase and A6-elongase from Physcomitrella patens and a Δ5-desaturase from Phaeodactylum tricornutum.

This first report of DHA production was in WO 04/017467 where the production of 3% of DHA in soybean embryos, but not seeds, is described by introduction of genes that encode for the Δβ-desaturase of Saprolegnia diclina, Δβ- Mortierella alpina desaturase, Mortierella alpina A5-desaturase, Saprolegnia diclina A4-desaturase, Saprolegnia diclina A17-desaturase, Mortierella alpina Δβ-elongase and Pavlova lutheri Δδ-elongase. The maximum level of EPA in embryos also producing DHA was 19.6%, indicating that the efficiency of conversion of EPA to DHA was poor (WO 2004/071467). This finding was similar to that published by Roberty col. (2005), where the flux from EPA to DHA was low, with the production of 3% EPA and 0.5% DHA in Arabidopsis using Δ5 / 6-desaturase from Danio rerio, Δβelongase from Caenorhabditis elegans, and A5-elongase and Δ4desaturase from Pavlova salina. Also in 2005, Wu et al. published the production of 25% ARA, 15% EPA, and 1.5%

DHA in Brassica júncea using Δ6-desaturase from Pythium irregulare, a Δ5-desaturase from Thraustochytrid, Δ6elongase from Physcomitrella patens, Δ12-desaturase from Calendula officianalis, a Δδ-elongatura from Thraustochytridsa, Phraustochytridse infestation, A17-desaturase LC-PUFA elongase from Oncorhyncus mykiss, a Δ4-desaturase from Thraustochytrid and a LPCAT from Thraustochytrid (Wuy col., 2005). In Venegas-Caleron et al. (2010) and Ruiz-Lopez et al. (2012) provides a summary of efforts to produce oilseed crops that synthesize LC-PUFA ω3. As indicated in Ruiz-Lopez et al. (2012), the results obtained to date for the production of DHA in transgenic plants have not even been close to the levels observed in fish oils. More recently, Petrie et al. (2012) reported the production of approximately 15% DHA in Arabidopsis thaliana seeds, and WO2013 / 185184 reported the production of certain seed oils that have between 7% and 20% DHA. However, there are no reports of the production of vegetable oils that have more than 20% DHA.

There are no reports of the production of DPA in recombinant cells at significant levels without the concomitant production of DHA. In fact, the present inventors are not aware of any published suggestion or motivation to produce DPA in recombinant cells without the production of DHA.

Therefore there is a need for more efficient production of LC-PUFA in recombinant cells, in particular of DPA in oilseed plant seeds.

SUMMARY OF THE INVENTION

Few organisms produce oil with DPA greater than 1-2% and therefore there are limited options, if any, for producing DPA on a large scale from natural sources. The present inventors have identified methods and plants for producing lipids with much higher levels of DPA than natural sources.

In a first aspect, the invention provides an extracted lipid, preferably extracted vegetable lipid or extracted microbial lipid, which comprises fatty acids in an esterified form, wherein the fatty acids comprise oleic acid, palmitic acid, ω6 fatty acids comprising linoleic acid ( LA), ω3 fatty acids comprising α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), where the level of DPA in the total fatty acid content of the extracted lipid is between approximately 7% and

35%. In embodiments of this aspect, the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8%, about 9%, about 10%, about 12%, about 15%, about 18%. , about 20%, about 22%, about 24%, about 26%, about 28%, about 30%, between about 7% and about 28%, between

<td>approximately</td><td> 7%</td><td colspan="2">and approximately 25%, between</td>

<td>approximately</td><td>10% and</td><td>35%, between approximately 10%</td><td>Y</td>

<td>approximately</td><td> 30%,</td><td>between about 10%</td><td>Y</td>

<td>approximately</td><td> 25%,</td><td>between about 10%</td><td>Y</td>

<td>approximately</td><td colspan="3">22%, between approximately 14% and 35%, between</td>

<td>approximately</td><td>16% and</td><td>35%, between approximately 16%</td><td>Y</td>

<td>approximately</td><td> 30%,</td><td>between approximately 16%</td><td>Y</td>

about 25%, or between about 16% and about 22%.

In an embodiment of the foregoing aspect, DHA is present at a level of less than 2% or less than 0.5% of the total fatty acid content of the extracted lipid and more preferably it is absent from the total fatty acid content of the lipid.

In another aspect, the invention provides an extracted lipid, preferably extracted vegetable lipid or extracted microbial lipid, which comprises fatty acids in an esterified form, wherein the fatty acids comprise docosapentaenoic acid (DPA), wherein at least 35% of the DPA esterified in the form of triacylglycerol (TAG) is esterified at the sn-2 position of the TAG. In one embodiment, the extracted lipid is further characterized by one or more or all of (i) comprising fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids comprising linoleic acid (LA), ω3 fatty acids comprising acid α-linolenic (ALA) and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), (ii) at least about 40%, at least about 45%, at least about 48%, between 35% and about 60%, or between 35% and about 50%, of the DPA esterified in the form of triacylglycerol (TAG) is esterified at the sn-2 position of the TAG, and (iii) the level of DPA in the total fatty acid content of the extracted lipid is between about 1% and 35%, or between about 7% and 35% or between about 20.1% and 35%. In embodiments of this aspect, the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8%, about 9%, about 10%, about 12%, about

15%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, about 30%, between about 7% and about 28%, between about 7% and about 25%, between approximately 10% and 35%, between approximately 10% and approximately 30%, between approximately 10% and approximately 25%, between approximately 10% and approximately 22%, between approximately 14% and 35%, between approximately 16% and 35%, between about 16% and about 30%, between about 16% and about 25%, or between about 16% and about 22%. In preferred embodiments, the extracted lipid is characterized by (i) and (ii), (i) and (iii) or (ii) and (iii), more preferably all of (i), (ii) and (iii ). Preferably, the extracted lipid is further characterized by a level of palmitic acid in the total fatty acid content of the extracted lipid which is between about 2% and 16%, and a level of myristic acid (C14: 0) in the content of Total fatty acids from the extracted lipid, if present, less than 1%.

The embodiments of each of the foregoing aspects are described in greater detail below. As the experienced person would understand, any¹³ .

feature of a described embodiment that is broader than the corresponding feature in a preceding aspect does not apply to that aspect.

In one embodiment, the extracted lipid has one or more of the following characteristics

i) the level of palmitic acid in the total fatty acid content of the extracted lipid is between approximately 2% and 18%, between approximately 2% and 16%, between approximately 2% and 15%, or between approximately 3% and approximately 10 %, ii) the level of myristic acid (C14: 0) in the total fatty acid content of the extracted lipid is less than 6%, less than 3%, less than 2%, less than 1%, or approximately 0.1 %, iii) the level of oleic acid in the total fatty acid content of the extracted lipid is between about 1% and about 30%, between about 3% and about 30%, between about 6% and about 30%, between about 1% and about 20%, between about 30% and about 60%, between about 45% and about 60%, about 30%, or between about 15% and about 30%, iv) the level of linoleic acid (LA) in the total fatty acid content of the extracted lipid is between about 4% and about 35%, between about 4% and about 20%, between about 4% and about 17%, or between about 5% and about 10%,

v) the level of α-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is between approximately 4% and approximately 40%, between approximately 7% and approximately 40%, between approximately 10% and approximately 35%, between about 20% and about 35%, between about 4% and 16%, or between about 2% and 16%, vi) the level of γ-linolenic acid (GLA) in the total fatty acid content of the extracted lipid is less of 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, between 0.05% and about 7%, between 0.05% and about 4%, between 0.05 % and about 3%, or between 0.05% and about 2%, vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipid is less than about 10%, less than about 8%, less than about 7%, less than about 6%, less than about 4%, less than about 3%, between about 0.05% and about 7%, between

<td>approximately</td><td> 0,05%</td><td>Y</td><td>approximately</td><td> 6%,</td><td>between</td>

<td>approximately</td><td> 0,05%</td><td>Y</td><td>approximately</td><td> 4%,</td><td>between</td>

<td>approximately</td><td> 0,05%</td><td>Y</td><td>approximately</td><td> 3%,</td><td>between</td>

<td>approximately</td><td>0.05% and</td><td colspan="2">about 10%, or</td><td>between</td><td>0.05% and</td>

<td>approximately</td><td> 2%,</td><td></td><td></td><td></td><td></td>

viii) the level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipid is less than about 6%, less than about 5%, less than about 4%, less than about 1%, less than about 0, 5%, between 0.05% and about 6%, between 0.05% and about 5%, between 0.05% and about 4%, between 0.05% and about 3%, or between 0.05% and about 2%, ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipid is less than 4%, less than approximately 2%, less than approximately 1%, between 0.05% and 4%, between 0, 05% and 3%, or between 0.05% and about 2%, or between 0.05% and about 1%,

x) the level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted lipid is between 4% and 15%, less than 4%, less than about 3%, less than about 2%, between 0.05% and 10%, between 0.05% and 5%, between 0.05% and about 3%, or between 0.05% and about 2%, xi) the lipid comprises ω6 docosapentaenoic acid (22: 5^Δ4-⁷'¹⁰-¹³'¹⁶) in its fatty acid content, xii) the lipid comprises less than 0.1% docosapentaenoic acid ω6 (22: 5 ^ 4,7,10,13,16) _{in its} fatty acid content,.

xiii) the lipid comprises less than 0.1% of -one or more or all of SDA, EPA and ETA in its fatty acid content, xiv) the level of total saturated fatty acids in the total fatty acid content of the extracted lipid it is between about 4% and about 25%, between about 4% and about 20%, between about 6%. and about 20%, or between about 6% and about 12%, xv) el. level of total monounsaturated fatty acids in the total fatty acid content of the extracted lipid is between approximately 4% and approximately 40%, between approximately 4% and approximately 35%, between approximately 8% and approximately 25%, between 8% and approximately 22 %, between about 15% and about 40% or between about 15% and about 35%, xvi) the level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipid is between approximately 20% and approximately 75%, between 30% and 75%, between approximately 50% and approximately 75%, approximately 60%, approximately 65%, approximately

<td>70%, about 75%,</td><td>or between approximately</td><td> 60%</td><td>Y</td>

<td>about 75%,</td><td></td><td></td><td></td>

<td colspan="2">xvii) the level of total fatty acids ω6</td><td>in</td><td>the</td>

<td>fatty acid content</td><td colspan="2">total lipid extracted</td><td>it is</td>

<td>between about 35%</td><td>and about 50%,</td><td colspan="2">between</td>

<td>about 20% and</td><td>about 35%,</td><td colspan="2">between</td>

<td>about 6% and 20</td><td colspan="2">%, less than 20%, less</td><td>from</td>

<td>about 16%, less</td><td>of about 10%,</td><td colspan="2">between</td>

<td>about 1% and</td><td>about 16%,</td><td colspan="2">between</td>

<td colspan="2">about 2% and about 10%, or</td><td colspan="2">between</td>

<td colspan="2">about 4% and about 10%,</td><td></td><td></td>

<td>xviii) the level of</td><td>new fatty acids ω6</td><td>in</td><td>the</td>

total fatty acid content of the extracted lipid is less than about 10%, less than about 8%, less than about 6%, less than 4%, between about 1% and about 20%, between about 1% and about 10%, between 0.5% and approximately 8%, or between 0.5% and 4%, xix) the level of total ω3 fatty acids in the total fatty acid content of the extracted lipid is between 36% and approximately 65%, between 36 % and approximately

70%, between 40% and approximately 60%, between approximately 30% and approximately 60%, between approximately 35% and approximately 60%, between 40% and approximately 65%, between approximately 30% and approximately 65%, between approximately 35% and about 65%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65% or about 70%, xx) the level of new ω3 fatty acids in the total fatty acid content of the extracted lipid is between 21% and about 45%, between 21% and about 35%, between about 23% and about 35%, between about 25% and about 35%, between about 27% and about 35%, about 23%, about 25%, about 27%, about 30%, about 35%, about 40% or about 45%, xxi) the proportion of total ω6 fatty acids: Total ω3 fatty acids in the fatty acid content of the extracted lipid is between about 1.0 and about 3.0, between about 0.1 and about 1, between about 0.1 and about 0.5, less than about 0, 50, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, about 1.0, about 0.1, between about 0.10 and about 0.4 , or about 0.2, xxii) the proportion of new ωβ fatty acids: New ω3 fatty acids in the fatty acid content of the extracted lipid is between about 1.0 and about 3.0, between about 0.02 and about 0.1, between about 0.1 and about 1, between about 0.1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, about 0.02, about 0.05 , about 0.1, about 0.2 or about 1.0, xxiii) the fatty acid composition of the lipid is based on a Δ12-desaturase conversion efficiency of oleic acid to LA of at least about

<td>60%, so</td><td colspan="3">minus about 70%, at least</td><td>enos</td>

<td>approximately</td><td>80%, between</td><td>approximately</td><td> 60%</td><td>Y</td>

<td>approximately</td><td>98%, between</td><td>approximately</td><td> 70%</td><td>Y</td>

<td>approximately</td><td>95%, or between</td><td>approximately</td><td> 75%</td><td>Y</td>

<td colspan="2">about 90%, xxiv) the acid composition</td><td>fat from lipid</td><td>I know</td><td>based</td>

in an efficiency of conversion of ALA to SDA by the

Δ6-desaturase of at least about 30%, at least about 40%, at least about 50%,

<td>at least</td><td>approximately</td><td>60%, so</td><td>less</td>

<td>approximately</td><td>70%, between</td><td>approximately</td><td>30% and</td>

<td>approximately</td><td>70%, between</td><td>approximately</td><td>35% and</td>

<td>approximately</td><td>60%, or between</td><td>approximately</td><td>50% and</td>

<td>about 70</td><td>to.</td><td></td><td></td>

<td colspan="2">xxv) acid composition</td><td>fat from lipid</td><td>is based</td>

at a conversion efficiency of SDA to acid ΕΤΆ by A6-elongase of at least about 60%, at least about 70%, at least about 75%, between about 60% and about 95%, between about 70% and about 88%, or between about 75% and about 85%, xxvi) the fatty acid composition of the lipid is based on a conversion efficiency of ETA to EPA by Δ5-desaturase of at least about 60 %, at least about 70%, at least about 75%, between about 60% and about 99%, between about 70% and about 99%, or between about 75% and about 98%, xxvii) the fatty acid composition of lipid is based on a A5-elongase conversion efficiency of EPA to DPA of at least about 80%, at least about 85%, at least about 90%, between about 50% and about 99% , between about 85% and about 99%, between about 50% and about 95%, or between about 85% and about 95%, xxviii) the fatty acid composition of the lipid is based on an oleic acid to DPA conversion efficiency of at least about 10%, at least about 15%, at least about 20%, at least about 25%, about 20%, about 25%, about 30%, between approximately 10% and approximately 50%, between approximately 10% and approximately 30%, between approximately 10% and approximately 25% or between approximately 20% and approximately 30%, xxix) the fatty acid composition of the lipid is based on an efficacy conversion of LA to DPA of at least about 15%, at least about 20%, at least about 22%, at least about 25%, at least about 30%, at least about 40%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, between about 15% and about 50%, between about 20% and about 40%, or between about 20% and about 30%, xxx) the fatty acid composition of the lipid is based on a conversion efficiency of ALA to DPA of at least about 17%, at least about 22%, at least about 24%, at least about 30%, about 30%, about 35%, about

<td>40%, approximately</td><td>45%, approximately</td><td> 50%,</td>

<td>about 55%,</td><td>about 60%,</td><td>between</td>

<td>about 22% and</td><td>about 70%,</td><td>between</td>

<td>about 17% and</td><td>approximately 55%,</td><td>between</td>

<td>about 22% and</td><td>about 40%, or</td><td>between</td>

about 24% and about 40%, xx xi) the total fatty acids in the extracted lipid have less than 1.5% C20: l, less than 1% C20: lo about 1% C20: l, xxxii) the content of triacylglycerol (TAG) of the lipid is at least about 70 %, at least about 80%, at least about 90%, at least 95%, between about 70% and about 99%, or between about 90% and about 99%, xxxiii) the lipid comprises diacylglycerol (DAG), where DAG preferably comprises DPA, xxxiv) the lipid comprises less than about

10%, less than about 5%, less than about 1%, or between about 0.001% and about 5%, of free fatty acids (non-esterified) and / or phospholipids, or is essentially free thereof, xxxv) at the same time less 70%, at least 72% or at least 80%, of the DPA esterified in the TAG form is in the sn-1 or sn-3 position of the TAG, xxxvi) the most abundant DPA-containing TAG species in the lipid is DPA / 18: 3/18: 3 (TAG 58:12), the lipid comprises tri-DPA TAG (TAG 66:18), and xxxvii) the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8%, about 9%, about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, about 31%, between about 7% and about 31%, between about 7% and

<td>approximately</td><td>28%, between</td><td>about 10%</td><td>and 35%,</td><td>between</td>

<td>approximately</td><td>10% and</td><td>approximately</td><td> 30%,</td><td>between</td>

<td>approximately</td><td>10% and</td><td>approximately</td><td> 25%,</td><td>between</td>

<td>approximately</td><td>10% and</td><td>approximately</td><td> 22%,</td><td>between</td>

<td>approximately</td><td>14% and 35%,</td><td colspan="2">between approximately 16%</td><td>and 35%,</td>

<td colspan="2">between approximately 16%</td><td>and approximately</td><td> 30%,</td><td>between</td>

about 16% and about 25%, or between about 16% and about 22%, optionally wherein the DHA level is less than 0.5% of the total fatty acid content of the extracted lipid.

In another embodiment, the extracted lipid has one or more of the following characteristics

i) the level of palmitic acid in the total fatty acid content of the extracted vegetable lipid is between 2% and 15%, 'ii) the level of myristic acid (C14: 0) in the total fatty acid content of the extracted vegetable lipid is approximately 0.1%, iii) the level of oleic acid in the total fatty acid content of the extracted vegetable lipid is between 1% and 30%, iv) the level of linoleic acid (LA) in the content of total fatty acids of the extracted vegetable lipid is between 4% and 20%,

v) the level of α-linolenic acid (ALA) in the total fatty acid content of the extracted vegetable lipid is between 4% and 40%, vi) the level of γ-linolenic acid (GLA) in the total fatty acid content of the extracted vegetable lipid is between 0.05% and 7%, vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted vegetable lipid is between 0.05% and 10%, viii) the level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted vegetable lipid is less than 6%, ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted vegetable lipid is less than 4%,

x) the extracted plant lipid comprises less than 0.1% docosapentaenoic acid ω6 (22: 5Δ4,7, ιο, ΐ3, ΐ6) _{in its} fatty acid content, xi) the level of new ω6 fatty acids in the total fatty acid content of the extracted vegetable lipid is less than 10%, xii) the proportion of total ω6 fatty acids: total ω3 fatty acids in the acid content fatty acids of the extracted vegetable lipid is between 1.0 and 3.0, or between 0.1 and 1, xiii) the proportion of new ω6 fatty acids: New ω3 fatty acids in the fatty acid content of the extracted plant lipid is between 1.0 and 3.0, between 0.02 and 0.1, or between 0.1 and 1, xiv) the fatty acid composition of the lipid The extracted plant lipid is based on a conversion efficiency of oleic acid to DPA of at least 10%, xv) the fatty acid composition of the extracted plant lipid is based on a conversion efficiency of LA to DPA of at least 15%, xvi) the fatty acid composition of the extracted plant lipid is based on a conversion efficiency of ALA to DPA of at least 17%, xvii) the total fatty acids in the extracted plant lipid have less than 1.5% C20: l, and xviii) the triacylglycerol (TAG) content of the extracted vegetable lipid is at least 70%, and can be characterized by one or more of the following characteristics xix) the extracted vegetable lipid comprises diacylglycerol (DAG) which comprises DPA, xx) the extracted plant lipid comprises less than 10% free (non-esterified) fatty acids and / or phospholipids, or is essentially free thereof, xxi) at least 70% of the esterified DPA in the form of TAG is in the position sn-1 or sn-3 of the TAG, xxii. ) the most abundant DPA-containing species in the extracted plant lipid is DPA / 18: 3/18: 3 (TAG 58:12), and xxiii) the extracted plant lipid comprises tri-DPA TAG (TAG 66:18).

In one embodiment, the level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted plant lipid is between 0.05% and 10%.

In a further embodiment, the level of DHA in the total fatty acid content of the extracted plant lipid is less than 2%, preferably less than 1% or between 0.1% and 2%, more preferably not detected. Preferably, the plant, or part thereof such as a seed or microbial cell, does not have any polynucleotide encoding an A4-desaturase or does not have any · A4-desaturase polypeptide. In another embodiment, the extracted lipid is in the form of an oil, wherein at least about 90%, at least about 95%, at least about 98%, or between about 95% and about 98%, by weight of the oil is the lipid.

Preferably, the extracted lipid is Brassica sp. Seed oil lipid. or Camelina sativa seed oil lipid.

In a preferred embodiment of the preceding aspect, the lipid or oil, preferably a seed oil, more preferably a seed oil of Brassica sp. o Camelina sativa seed oil has the following characteristics: In the total fatty acid content of the lipid or oil, the DPA level is between about 7% and 30% or between about 7% and 35%, the palmitic acid level is between about 2% and about 16%, the level myristic acid is less than 1%, the oleic acid level is between about 1% and about 30%, the LA level is between about 4% and about 3-5%, ALA is present, the level of total saturated fatty acids in the total fatty acid content of the extracted lipid is between about 4% and about 25%, the proportion of total ω6 fatty acids: Total ω3 fatty acids in the fatty acid content of the extracted lipid is between 0.05 and about 3.0, and the triacylglycerol (TAG) content of the lipid is at least about 70%, and optionally the lipid is essentially free of cholesterol and / or lipid comprises tri-DPA TAG (TAG 66:15). More preferably, the lipid or oil, preferably a seed oil, additionally has one or more or all of the following characteristics: at least 70% of the DPA is esterified at the sn-1 or sn-3 position of triacylglycerol (TAG), ALA is present at a level between 4% and 40% of the total fatty acid content, GLA is present and / or the GLA level is less than 4% of the total fatty acid content, the SDA level is between 0.05% and about 10%, the ETA level is less than about 4%, the EPA level is between

0.05% and about 10%, the level of total monounsaturated fatty acids in the total fatty acid content of the extracted lipid is between about 4% and about 35%, the level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipid is between approximately 20% and approximately 75%, the proportion of new ω6 fatty acids: New ω3 fatty acids in the fatty acid content of the extracted lipid is between about 0.03 and about 3.0, preferably less than about 0.50, the fatty acid composition of the lipid is based on: a conversion efficiency of oleic acid to LA by Δ12-desaturase of at least about 60%, an efficiency of conversion of SDA to ETA acid by Δ6elongase of at least about 60%, a conversion efficiency EPA to DPA by A5-elongase between about 50% and about 95%, an oleic acid to DPA conversion efficiency of at least about 10%. More preferably, at least 81% of the DPA is esterified at the sn-1 or sn-3 position of triacylglycerol (TAG).

In another preferred embodiment of the second preceding aspect, the lipid or oil, preferably a seed oil, more preferably a seed oil of Brassica sp. o Camelina sativa seed oil comprising DPA has the following characteristics: In the total fatty acid content of the lipid or oil, the level of palmitic acid is between about 2% and about 16%, the level of myristic acid is less than 1%, the level of oleic acid is between about 1% and about 30%, the level of LA is between about 4% and about 35%, ALA is present, the level of total saturated fatty acids in the total fatty acid content of the extracted lipid is between about 4% and about 25%, the proportion of total ω6 fatty acids: Total ω3 fatty acids in the fatty acid content of the extracted lipid is between 0.05 and about 3.0, the triacylglycerol (TAG) content of the lipid is at least about 70%, and optionally the lipid comprises tri-DPA TAG (TAG 66:15), where at least 35% of the DPAesterified in the triacylglycerol (TAG) form is esterified at the sn-2 position of the TAG. More preferably, the lipid or oil, preferably a seed oil, additionally has one or more or all of the following characteristics: ALA is present at a level between 4% and 40% of the total fatty acid content, GLA is present and / or the GLA level is less than 4% of the total fatty acid content, the SDA level is between 0.05 % and about 10%, the ETA level is less than about 4%, the EPA level is between 0.05% and about 10%, the level of total monounsaturated fatty acids in the total fatty acid content of the extracted lipid is between about 4% and about 35%, the level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipid is between about 20% and about 75%, the ratio of new ω6 fatty acids: new ω3 fatty acids in the fatty acid content of the extracted lipid is between about 0.03 and about 3.0, preferably less than about 0.50, the fatty acid composition of the lipid is based on: a conversion efficiency of oleic acid to LA by Δ12-desaturase of at least about 60%, a conversion efficiency of SDA to ETA acid by Δ6elongase of at least about 60%, a conversion efficiency EPA to DPA by ΔΕ-elongase of between about 50% and about 95%, an oleic acid to DPA conversion efficiency of at least about 10%.

In the context of the extracted lipid or oil of the invention, in one embodiment the level of DPA in the extracted lipid or oil has not increased, or is substantially the same as, the level of DPA in the lipid or oil of the part of the plant or microbe before extraction. In other words, no procedure has been performed to increase the level of DPA in the lipid or oil relative to other fatty acids after extraction. As would be apparent, the lipid or oil can be further processed by fractionation or other procedures to alter the fatty acid composition.

In another preferred embodiment, the lipid or oil, preferably a seed oil and more preferably a Brassica seed oil such as mustard oil or cañola oil or C. sativa, has the following characteristics: In the total fatty acid content of the lipid or oil, the DPA level is between about 7% and 3-5%, the palmitic acid level is between about 2% and about 16%, the myristic acid level is less than about 6% and preferably less than 1%, the oleic acid level is between about 1% and about 30%, the LA level is between about 4% and about 35%, ALA is present, the SDA level is between about 0.05% and about 10%, the ETA level is less than about 6%, the EPA level is between about 0.05% and about 10%. DHA is preferably not detectable in lipid or oil. Preferably, if DHA is present, it is present at a level of not more than 2% or not more than 0.5% of the total fatty acid content of the lipid or oil and more preferably it is absent from the total fatty acid content of the lipid or oil. oil. Optionally, the lipid is essentially free of cholesterol and / or the lipid comprises tri-DPA TAG (TAG 66:15). More preferably, the lipid or oil, preferably a seed oil, additionally has one or more or all of the following characteristics: at least 70% of the DPA is esterified at the sn-1 or sn-3 position of triacylglycerol (TAG), ALA is present at a level between 4% and 40% of the total fatty acid content, GLA is present and / or the GLA level is less than 4% of the total fatty acid content, the SDA level is between 0.05% and about 10%, the ETA level is less than about 4%, the EPA level is between 0, 05% and about 10%, the level of total monounsaturated fatty acids in the total fatty acid content of the extracted lipid is between about 4% and about 35%, the level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipid is between about 20% and about 75%, the proportion of new ω6 fatty acids: New ω3 fatty acids in the fatty acid content of the extracted lipid is between about 0.03 and about 3.0, preferably less than about 0.50, the fatty acid composition of the lipid is based on: a conversion efficiency of oleic acid to LA by Δ12-desaturase of at least about 60%, an efficiency of conversion of SDA to ETA acid by Δ6elongase of at least about 60%, a conversion efficiency EPA to DPA by A5-elongase between about 50% and about 95%, an oleic acid to DPA conversion efficiency of at least about 10%. In one embodiment, at least 81% of the DPA is esterified at the sn-1 or sn3 position of triacylglycerol (TAG). Alternatively, at least 35% of the DPA esterified in the TAG form is esterified at the sn-2 position of TAG.

In a further embodiment, the extracted lipid of the invention further comprises one or more sterols, preferably plant sterols.

In another embodiment, the extracted lipid is in the form of an oil, and comprises less than about 10 mg sterols / g oil, less than about 7 mg sterols / g oil, between about 1.5 mg and about 10 mg sterols / g oil, or between about 1.5 mg and about 7 mg sterols / g oil.

Examples of sterols that may be in the extracted lipid include, but are not limited to, one or more or all of campesterol / 24-methylcholesterol, Δ5-stigmasterol, eburicol, p-sitosterol / 24-ethylcholesterol, Δ5avenasterol / isofucosterol, A7-stigmasterol / stigmast-7-en3β-ο1, and A7-avenasterol.

In one embodiment, the plant species is one of those listed in Table 11, such as cañola, and the level of sterols is approximately the same as that listed in Table 11 for that particular plant species. The plant species can be B. napus, mustard (B. júncea) or C. sativa and comprise a level of sterols approximately that found in oil extracted from mustard B. wild-type napus, mustard, or C. sativa, respectively.

In one embodiment, the extracted plant lipid comprises one or more or all of campesterol / 24methylcholesterol, Δ5-stigmasterol, eburicol, 3-sitosterol / 24ethylcholesterol, A5-avenasterol / isofucosterol, Δ7-stigmasterol / stigmast-7-en-3p-ol , and A7-avenasterol, or which has essentially the same sterol content as wild-type rapeseed oil.

In one embodiment, the extracted lipid has a sterol content that is essentially the same as wild-type rapeseed oil, mustard oil, or C. sativa oil.

In one embodiment, the extracted lipid comprises less than about 0.5 mg cholesterol / g oil, less than about 0.25 mg cholesterol / g oil, between about 0 mg and about 0.5 mg cholesterol. / g oil, or between about 0 mg and about 0.25 mg cholesterol / g oil, or that is essentially free of cholesterol.

In a further embodiment, the lipid is an oil, preferably oil from an oilseed. Examples of such oils include, but are not limited to, Brassica sp. such as for example rapeseed oil or mustard oil, Gossypium hirsutum oil, Linum usitatissimum oil, Helianthus sp. oil, Carthamus tinctorius oil, Glycine max oil, Zea mays oil, Arabidopsis thaliana oil, Sorghum bicolor, Sorghum vulgare oil, Avena sativa oil, Trifolium sp. Oil, Elaesis guineenis oil, Nicotiana benthamiana oil, Hordeum vulgare oil, Lupinus angustífolius oil, Oryza sativa oil, Oryza glaberrima oil, Camelina sativa oil, Crambe abyssinica oil, Miscanthus x giganteus oil, or Miscanthus sinensis oil. Most preferably the oil is a Brassica sp. Oil. , a Camelina sativa oil or a Glycine max (soy) oil. In one embodiment the lipid comprises or is Brassica sp. Oil. such as Brassica napus oil or Brassica júncea oil, Gossypium hirsutum oil, Linum usitatissimum oil, Helianthus sp. oil, Carthamus tinctorius oil, Glycine max oil, Zea mays oil, Elaesis guineenis oil, Nicotiana benthamiana, Lupinus angustífolius oil, Camelina sativa oil, Crambe abyssinica oil, Miscanthus x giganteus oil, or Miscanthus sinensis oil. In a further embodiment, the oil is canola oil, mustard oil (B. júncea), soybean oil (Glycine max), Camelina sativa oil, or Arabidopsis thaliana oil. In an alternative embodiment, the oil is a vegetable oil different from A. thaliana oil and / or other than C. sativa oil. In one embodiment, the vegetable oil is a different oil from G. max (soybean) oil. In one embodiment, the oil was obtained from a plant grown under standard conditions, for example as described in Example 1, or from a plant grown in the field or in a nursery under standard conditions.

In a further aspect, the invention provides a process for producing the extracted plant lipid or microbial lipid, comprising the steps of

i) obtaining a plant part, preferably a Brassica seed or Camelina sativa seed or microbial cells that comprise a lipid, wherein the lipid comprises fatty acids in an esterified form, wherein the fatty acids comprise oleic acid, palmitic acid, 6 fatty acids comprising linoleic acid (LA), ω3 fatty acids comprising α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), where the level of DPA in the total fatty acid content of the lipid of the plant part or microcyan cells is between approximately 7% and 35%, and ii) extracting the lipid from the part of plant or microbial cells, wherein the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 35%. In one embodiment, the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 20%, or between 20.1% and 35%. In one embodiment, the DPA level is between 7% and 20% or between 20.1% and 30%, preferably between 20.1% and 35%, more preferably between 30% and 35%. In one embodiment, the level of DPA in the total fatty acid content of the extracted lipid is between 8% and 20% or between 10% and 20%, preferably between 11% and 20% or between 12% and 20%.

In an embodiment of the preceding aspect, the invention provides a process for producing extracted plant lipid or microbial lipid, comprising the steps of

i) obtain a plant part, preferably Brassica seed or C. sativa, or microbial cells comprising lipid, wherein the lipid comprises fatty acids in an esterified form, wherein the lipid has a fatty acid composition comprising oleic acid, palmitic acid, ω6 fatty acids comprising linoleic acid (LA) , ω3 fatty acids comprising α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), where (i) the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 30% or between 7% and 35%, preferably between 30% and 35%, (ii) the level of palmitic acid in the total fatty acid content of the extracted lipid is between 2% and 16%, (iii) the level of myristic acid (C14: 0) in the total fatty acid content of the extracted lipid is less than 6%, preferably less than one%, (iv) the level of oleic acid in the total fatty acid content of the extracted lipid is between 1% and 30%, (v) the level of linoleic acid (LA) in the total fatty acid content of the extracted lipid is between 4 % and 35%, (vi) the level of α-linolenic acid (ALA) in the total fatty acid content 5 of the extracted lipid is between 4% and 40%, (vii) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipid is less than 4%, (viii) the level of total saturated fatty acids in the total fatty acid content of the extracted lipid is between 4% and 25%, 10 (ix) the proportion of total ωβ fatty acids: ω3 total fatty acids in the fatty acid content of the extracted lipid is between 0.05 and 1, (x) the triacylglycerol (TAG) content of the lipid is at least 70%, and (xi) at least 70% of the DPA esterified in the form of TAG is in the sn-1 or sn-3 position of the TAG and ii) extracting the lipid from the plant part, where the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 30% or between 7% and 35%, preferably between 30% and 35%.

Preferably, at least 81% or at least 90% of the DPA esterified in the TAG form is at the sn-1 or sn-3 position of the TAG.

In another aspect, the present invention provides a process for producing extracted lipid, comprising the steps of

i) obtaining cells, preferably a plant part comprising the microbial cells or cells, more preferably Brassica seed or C. sativa, comprising the lipid, wherein the lipid comprises fatty acids in an esterified form, wherein the fatty acids comprise docosapentaenoic acid (DPA), wherein at least 35% of the esterified DPA in the form of triacylglycerol (TAG) is esterified at the sn-2 position of the TAG, and ii) extracting lipid from cells, wherein at least 35% of the DPA esterified in the form of triacylglycerol (TAG) in the total fatty acid content of the extracted lipid is esterified at the sn-2 position of the TAG. In one embodiment, the extracted lipid produced by the process is further characterized by one or more or all of (i) comprising fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids comprising linoleic acid (LA), fatty acids ω3 comprising oi-linolenic acid (ALA) and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), (ii) at least about 40%, at least about 45%, at least about 48%, between 35% and about 60%, or between 35% and about 50%, of the DPA esterified in the triacylglycerol (TAG) form is esterified at the sn-2 position of the TAG, and (iii) the level of DPA in the total fatty acid content of the extracted lipid is between about 1% and 35%, or between about 7% and 35% or between about 20.1% and 35%. In embodiments of this aspect, the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8%, about 9%, about 10%, about 12%, about 15%, about 18%. , about 20%, about 22%, about 24%, about 26%, about 28%, about 30%, between

<td>approximately</td><td>7% and approximately 28%, between</td>

<td>approximately</td><td>7% and approximately 25%, between</td>

<td>approximately</td><td>10% and 35%, between approximately 10% and</td>

<td>approximately</td><td>30%, between approximately 10% and</td>

<td>approximately</td><td>25%, between approximately 10% and</td>

<td>approximately</td><td>22%, between approximately 14% and 35%, between</td>

<td>approximately</td><td>16% and 35%, between approximately 16% and</td>

<td>approximately</td><td>30%, between approximately 16% and</td>

<td>approximately</td><td>25%, or between approximately 16% and</td>

<td>approximately</td><td>22%. In preferred embodiments, the</td>

The extracted lipid is characterized by (i) and (ii), (i) and (iii) or (ii) and (iii), more preferably all of (i), (ii) and (iii).

Preferably, the extracted lipid is further characterized by a level of palmitic acid in the total fatty acid content of the extracted lipid which is between about 2% and 16%, and a level of myristic acid (C14: 0) in the content of Total fatty acids from the extracted lipid, if present, is less than 1%.

In an embodiment of the preceding aspect, the invention provides a process for producing extracted lipid, comprising the steps of

i) obtaining cells, preferably a plant part comprising the microbial cells or cells, more preferably Brassica seed or C. sativa, comprising lipid, wherein lipid comprises fatty acids in an esterified form, wherein fatty acids comprise docosapentaenoic acid (DPA) and further comprise oleic acid, palmitic acid, ω6 fatty acids comprising linoleic acid (LA), ω3 fatty acids comprising α-linolenic acid (ALA), and one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), where (i) the level of palmitic acid in the total fatty acid content of the extracted lipid is between 2% and 16%, (ii) the level of myristic acid (C14: 0) in the total fatty acid content of the lipid extracted is less than 1%, (iii) the level of oleic acid in the total fatty acid content of the extracted lipid is between 1% and 30%, (iv) the level of linoleic acid (LA) in the fatty acid content total lipid extracted is between 4% and 35%, (v) the level of α-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is between 4% and 40%, (vi) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipid is less than 4%, (vii) the level of total saturated fatty acids in the total fatty acid content of the extracted lipid is between 4% and 25%, (viii) the proportion of total ωβ fatty acids: Total ω3 fatty acids in the fatty acid content of the extracted lipid is between 0.05 and 1, (ix) the triacylglycerol (TAG) content of the lipid is at least 70%, and (x) at least 35% of the DPA esterified in the form of triacylglycerol (TAG) is esterified at the sn-2 position of the TAG, and ii) extracting the lipid from the plant part, wherein at least 35% of the DPA esterified in the form of triacylglycerol (TAG) in the total fatty acid content of the extracted lipid is esterified at the sn-2 position of the TAG.

The step of obtaining the plant part or microbial cells may comprise collecting the plant parts, preferably seeds, from plants that produce the plant parts, recovering the microbial cells from cultures of said cells, or obtaining the plant parts. or microbial cells by purchasing them from a producer or supplier, or by importation. The process may comprise a step of determining the fatty acid composition of the lipid in a sample of the plant parts or microbial cells, or of the extracted lipid.

In a preferred embodiment, the extracted lipid obtained by a process of the invention has, where relevant, one or more of the characteristics defined herein, for example as defined above in relation to the first two aspects.

The embodiments of the foregoing aspects of the invention are described in greater detail below. As the skilled person could understand, any feature described in embodiment which is broader than the corresponding feature in the preceding aspect does not apply to that aspect.

In one embodiment, the plant part is a seed, preferably an oilseed. Examples of such seeds include, but are not limited to, Brassica sp., Gossypium hirsutum, Linum usitatissimum, Helianthus sp., Carthamus tinctorius, Glycine max, Zea mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum • vulgare, Avena sativa, Trifolium sp. , Elaesis guineenis, Nicotiana benthamiana, Hordeum vulgare, Lupinus angustífolius, Oryza sativa, Oryza glaberrima, Camelina sativa, or Crambe abyssinica, preferably a seed of Brassica sp. , a C. sativa seed or a G. max (soybean) seed, more preferably a Brassica napus, B. júncea or C. sativa seed. In one embodiment, the plant part is a seed, preferably an oilseed such as Brassica sp. such as Brassica napus or Brassica júncea, Gossypium hirsutum, Linum usitatissimum, Helianthus sp., Carthamus tinctorius, Glycine max, Zea mays, Elaesis guineenis, Nicotiana benthamiana, Lupinus angustífolius, Camelina sativa, or Crambicapuse abyssinica seed, preferably a seed of Brassica B júncea or C. sativa. In one embodiment, the seed is rapeseed, mustard seed, soybean, Camelina sativa seed, or Arabidopsis thaliana seed. In an alternative embodiment, the seed is a different seed from A. thaliana seed and / or a different seed from C. sativa. In one embodiment, the seed is a seed other than soybean. In one embodiment, the plant part is a Brassica sp. The plant part is preferably Brassica sp. Seed. or Camelina sativa seed. In one embodiment, the seed was obtained from a plant grown under standard conditions, for example as described in Example 1, or from a plant grown in the field or in a nursery under standard conditions.

In another embodiment, the seed comprises at least about 18 mg, at least about

<td>22 mg, per</td><td>least</td><td>about 26</td><td>mg,</td><td>between</td>

<td>approximately</td><td>18 mg and</td><td>about 100</td><td>mg,</td><td>between</td>

<td>approximately</td><td>22 mg</td><td>and approximately</td><td> 70</td><td>mg,</td>

<td>approximately</td><td>80 mg,</td><td>between approximately</td><td> 30</td><td>mg and</td>

<td>approximately</td><td>80mg, or</td><td>between approximately</td><td> 24</td><td>mg and</td>

<td>approximately</td><td colspan="2">50 mg, DPA per gram of seed</td><td></td><td></td>

In a further embodiment, the part of the plant such as a seed comprises exogenous polynucleotides that code for one or more of the following groups of enzymes;

i) a ω3-desaturase, a Δ6-desaturase, a Δ5desaturase, an A6-elongase and an A5-elongase, ii) an A15-desaturase, an A6-desaturase, a Δ5desaturase, a Δβ-elongase and a ΔΒ-elongase, iii) an A12-desaturase, a Δ6-desaturase, a Δ5desaturase, a Δβ-elongase and a Δδ-elongase, iv) a Δ12-desaturase, a ω3-desaturase and / or a Δ15-desaturase, a Δβ-desaturase, a Δδ- desaturase, a Δ6-elongase and a Δ5-elongase,

v) a ω3-desaturase, a Δδ-desaturase, a Δ5desaturase, an A9-elongase and an A5-elongase, vi) an A15-desaturase, a Δδ-desaturase, a Δ5desaturase, an A9-elongase and a A5-elongase, vii) an A12-desaturase, a Δδ-desaturase, a Δ5desaturase, an A9-elongase and an A5-elongase, viii) an A12-desaturase, a ω3-desaturase and / or a Δ15desaturase, a Δδ-desaturase, a ΔΞ- desaturase, a Δ4desaturase, an A9-elongase and a A5-elongase, and wherein each polynucleotide is operably linked to one or more promoters that have the ability to direct the expression of said polynucleotides in a cell of the plant part.

In a further embodiment, the part of the plant such as a seed or recombinant cells such as microbial cells comprise exogenous polynucleotides that code for one or more of the following groups of enzymes;

i) a ω3-desaturase and / or an A15-desaturase, a Δδdesaturase, an A5-desaturase, a Δδ-elongase and a Δ5elongase, ii) an A12-desaturase, a Δδ-desaturase, a Δ5desaturase, a Δδ-elongase and a A5-elongase, iii) an A12-desaturase, a ω3-desaturase and / or a Δ15 desaturase, a Δβ-desaturase, an A5-desaturase, a Δ6elongase and an A5-elongase, iv) an o3-desaturase and / or an A15 -desaturase, a Δ8desaturase, a Δ5-desaturase, an A9-elongase and a Δ55 elongase,

v) a Δ12-desaturase, a Δδ-desaturase, a Δ5desaturase, an A9-elongase and an A5-elongase, vi) an A12-desaturase, a ω3-desaturase and / or a Δ15 desaturase, a Δδ-desaturase, a Δ5- desaturase, a Δ9-elongase and an A5-elongase, and wherein each polynucleotide is operably linked to one or more promoters that have the ability to direct the expression of said polynucleotides in a cell of the plant part or cells.

In one embodiment, if the part of the plant or cell comprises delipid that comprises fatty acids in an esterified form, wherein the fatty acids comprise docosapentaenoic acid (DPA), wherein at least 3-5% of the DPA and / or DHA (if present) esterified in the form of triacylglycerol (TAG) is esterified at the sn-2 position of the TAG, the part of the plant such as a seed or recombinant cells such as microbial cells comprise an exogenous polynucleotide encoding a 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT), wherein the polynucleotide is operably linked to one or more promoters having the ability to direct the expression of the polynucleotide in a cell of the plant part or cells. In a further embodiment, the cell comprises exogenous polynucleotides that code for one or more of the following groups of enzymes;

i) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a ω3-desaturase, a Δβ-desaturase, a Δ5-desaturase, an A6-elongase and a Δβ-elongase,.

ii) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a Δΐβ-desaturase, a Δβ-desaturase, a Δ5desaturase, a Δβ-elongase and a Δβ-elongase, iii) an l-acyl-glycerol-3 -phosphate acyltransferase (LPAAT), an A12-desaturase, a Δβ-desaturase, a Δ5desaturase, a Δβ-elongase and a Δβ-elongase, iv) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12- desaturase, a ω3-desaturase and / or a Δ15 desaturase, a Δβ-desaturase, a Δβ-desaturase, a Δβelongase and a Δβ-elongase,

v) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a ω3-desaturase, a Δ8-desaturase, a Δβdesaturase, an A9-elongase and a Δβ-elongase, vi) an l-acyl-glycerol-3 -phosphate acyltransferase (LPAAT), a Δΐβ-desaturase, a Δδ-desaturase, a Δ5-desaturase, an A9-elongase and an A5-elongase, vii) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a A12-desaturase, an A8-desaturase, a Δ5desaturase, a u9-elongase and a ΔΞ-elongase, viii) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12-desaturase, a ω3-desaturase and / or a Δ15-desaturase, a Δ8-desaturase, a Δ5-desaturase, a Δ9elongase and an A5-elongase, wherein each polynucleotide is operably linked to one or more promoters that have the ability to direct the expression of said polynucleotides in the cell. Preferably, the LPAAT may use a C22 polyunsaturated fatty acyl-CoA substrate such as DPA-CoA.

Preferably, the plant or parts thereof, such as a seed, or microbial cell do not have any polynucleotide encoding an A4-desaturase, or do not have any Δ4-desaturase polypeptide.

In one embodiment, the Δ12-desaturase also has ω3-desaturase and / or A15-desaturase activity, ie the activities are conferred by a single polypeptide. Alternatively, Δ12-desaturase has no ω3-desaturase activity and has no ΔΙΞ-desaturase activity, ie, Δ12-desaturase is a separate polypeptide from polypeptide that has o3-desaturase and / or A15-desaturase activity.

In still another embodiment, the part of the plant such as a seed or recombinant cells such as microbial cells have one or more or all of the following characteristics:

i) ñl2-desaturase converts oleic acid to linoleic acid in one or more cells of the plant part or in recombinant cells with an efficiency of at least about 60%, at least about 70%, at least about 80 %, between about 60% and about 95%, between about 70% and about 90%, or between about 75% and about 85%, ii) 3-desaturase converts ω6 fatty acids to ω3 fatty acids in one or more cells of the plant part or in recombinant cells with an efficiency of at least about 65%, at least about 75%, at least about 85%, between about 65% and about 95%, between about 75% and about 91%, or between about 80% and about 91%, iii) A6-desaturase converts ALA to SDA in one or more cells of the plant part or in the recombinant cells with an efficiency of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 30% and about 70%, between about 35% and about 60%, or between about 50% and about 70%, iv) A6-desaturase converts linoleic acid to γ-linolenic acid in one or more cells of the plant part or in

<td>recombinant cells with an efficiency of</td><td>less</td><td>from</td>

<td>about 5%, less than about 2.5%,</td><td>less</td><td>from</td>

<td>about 1%, between about</td><td> 0,1%</td><td>Y</td>

<td>about 5%, between about</td><td> 0,5%</td><td>Y</td>

<td>about 2.5%, or between about</td><td> 0,5%</td><td>Y</td>

<td colspan="2">about 1%, v) A6-elongase converts SDA to ETA in one or</td><td>plus</td>

cells of the plant part or in the recombinant cells with an efficiency of at least about 60%, at least about 70%, at least about 75%, between about 60% and about 95%, between about 70% and about 80%, or between about 75% and about 80%, vi) A5-desaturase converts ETA to EPA in one or more cells of the plant part or in the recombinant cells with an efficiency of at least about 60%, at least about 70%, at least about 75%,

<td>at least</td><td>approximately</td><td>80%, so</td><td>less</td>

<td>approximately</td><td>90%, between</td><td>approximately</td><td>60% and</td>

<td>approximately</td><td>95%, between</td><td>approximately</td><td>70% and</td>

<td>approximately</td><td>95%, or between</td><td>approximately</td><td>75% and</td>

about 95%, vii) A5-elongase converts EPA to DPA in one or more cells of the plant part or in the recombinant cells with an efficiency of at least about 80%, at least about 85%, at least about 90%, between about 50% and about 90%, or between about 85% and about 95%, ix) the conversion efficiency of oleic acid to DPA in one or more cells of the plant part or in the recombinant cells is at least about 10%, at least about 15%, at least about 20%, at least minus about 25%, about 20%,

<td>approximately</td><td>25%, about 30%,</td><td>between</td>

<td>approximately</td><td>10% and about 50%,</td><td>between</td>

<td>approximately</td><td>10% and about 30%,</td><td>between</td>

<td>approximately</td><td>10% and approximately 25%, or</td><td>between</td>

about 20% and about 30%,

x) the conversion efficiency of LA to DPA in one or more cells of the plant part or in the recombinant cells is at least about 15%, at least about 20%, at least about 22%, at least about 25%, at least about 30%, about 25%, about 30%, about 35%, between about 15% and about 50%, between about 20% and about 40%, or between about 20% and about 30% , xi) the conversion efficiency of ALA to DPA in one or more cells of the plant part or in the recombinant cells is at least about 17%, at least about 22%, at least about 24%, at least about 30%, about 30%,

<td>approximately</td><td>35%, approximately</td><td> 40%,</td><td>between</td>

<td>approximately</td><td>17% and approximately</td><td> 55%,</td><td>between</td>

<td>approximately</td><td>22% and approximately 35</td><td>%, or</td><td>between</td>

<td>approximately</td><td>24% and approximately 35%,</td><td></td><td></td>

<td>xi) one or</td><td>more cells from the part of</td><td>plant</td><td>waves</td>

Recombinant cells comprise at least about 25%, at least about 30%, between about 25% and about 40%, or between about 27.5% and about 37.5%, more ω3 fatty acids than corresponding cells that they lack exogenous polynucleotides, xii) A6-desaturase preferentially desaturates α-linolenic acid (ALA) relative to linoleic acid (LA),

<td>xiii)</td><td>the</td><td>Δ6-elongase</td><td>too</td><td>have</td><td>exercise</td><td>Δ9-</td>

<td>elongasa, xiv)</td><td>the</td><td>Δ12-desaturase</td><td>too</td><td>have</td><td>exercise</td><td>Δ15-</td>

<td colspan="2">desaturase, xv) the</td><td>Δβ-desaturase</td><td>too</td><td>have</td><td>exercise</td><td>Δ8-</td>

<td>desaturase, xvi)</td><td>the</td><td>Δ8-desaturase</td><td>too</td><td>have</td><td>exercise</td><td>Δ6-</td>

<td>desaturase xvii)</td><td colspan="4">o has no Δβ-desaturase activity, Δ15-desaturase also has</td><td>exercise</td><td>ω3 -</td>

desaturase over GLA, xviii) ω3-desaturase also has Δ15 desaturase activity on LA, xix) ω3-desaturase desaturase LA and / or GLA, xx) ω3-desaturase preferentially desaturates GLA relative to LA, xxi) one or more or all desaturases, preferably Δβ-desaturase and / or A5-desaturase, have higher activity on an acyl-CoA substrate than on a corresponding acyl-PC substrate, xxii) Δ6-desaturase has higher Δβdesaturase activity on ALA than on LA as a fatty acid substrate, xxiii) Δ6-desaturase has higher Δβdesaturase activity on ALA-CoA as a fatty acid substrate than on ALA attached to the sn-2 position of PC as a fatty acid substrate, xxiv) Δ6-desaturase has at least approximately 2 times higher activity than Δ6-desaturase, at least 3 times higher activity, at least 4 times higher activity, or at least 5 times higher activity on ALA as a substrate compared to LA, xxv) Δδ-desaturase has greater activity on ALACoA as a fatty acid substrate than on ALA attached to the sn-2 position of PC as a fatty acid substrate, xxvi) Δ6-desaturase has at least about 5-fold higher activity of Δ6-desaturase, or at least 10-fold activity, on ALA-CoA as a fatty acid substrate than on ALA attached to the sn-2 position of PC as fatty acid substrate, xxvii) desaturase is a terminal desaturase, and xxviii) Δ6-desaturase has no detectable Δ5-desaturase activity on ETA.

In still another embodiment, the part of the plant such as a seed, preferably a Brassica seed or a C. sativa seed, or the recombinant cell such as microbial cells has one or more or all of the following characteristics

i) Δ12-desaturase comprises amino acids that have a sequence as provided in SEQ ID NO: 4, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 4, ii) the ω3-desaturase comprises amino acids that have a sequence as provided in SEQ ID NO: 6, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 6, iii) the Δβ-desaturase comprises amino acids that have a sequence as provided in SEQ ID NO: 9, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 9, iv) Δβ-elongase comprises amino acids having a sequence as provided in SEQ ID NO: 16, a biologically active fragment thereof such as SEQ ID NO: 17, or an amino acid sequence that is at least less 50% identical to SEQ ID NO: 16 and / or SEQ ID NO: 17,

v) the Δδ-desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 20, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 20, and vi) A5-elongase comprises amino acids that have a sequence as provided in SEQ ID NO: 25, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 25.

In one embodiment, the plant part such as a seed or the recombinant cells such as microbial cells further comprise an exogenous polynucleotide that encodes a diacylglycerol acyltransferase (DGAT), monoacylglycerol acyltransferase (MGAT), glycerol-3phosphate acyltransferase (GPAT ), l-acyl-glycerol-3-phosphate acyltransferase (LPAAT) preferably an LPAAT that can use a C22 polyunsaturated fatty acyl-CoA Substrate such as DPA-CoA, acyl-CoA: lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A₂ (PLA₂), phospholipase C (PLC), phospholipase D (PLD), CDP-choline diacylglycerol choline phosphotransferase (CPT), phosphatidylcholine diacylglycerol acyltransferase (PDAT), phosphatidylcholine: diacylglycerol choline phosphotransferase (PDACT), or acyl-CoSCT without an acyl-CoSCT combination of two or more of them.

In another embodiment, the plant part such as a seed or the recombinant cells such as microbial cells further comprise an introduced mutation or an exogenous polynucleotide that decreases the production and / or activity of an endogenous enzyme in a cell of the part. of selected plant from FAE1, DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA₂, PLC, PLD, CPT, PDAT, a thioesterase such as FATB, or a Δ12-desaturase, or a combination of two or more thereof.

In a further embodiment, at least one, or preferably all, of the promoters are seed-specific promoters. In one embodiment, at least one or all of the promoters have been derived from a biosynthesis or oil accumulation gene such as a gene encoding oleosin, or from a gene for storage protein of the seed such as a gene encoding conlinin.

In another embodiment, the promoter (s) that drive the expression of the exogenous polynucleotides encoding A5-elongase initiate the expression of the polynucleotides in the developing seed of the plant or in recombinant cells such as microbial cells before, or they reach the expression peak before, the promoter (s) direct the expression of the exogenous polynucleotides that encode for Δ12-desaturase and la3-desaturase.

In a further embodiment, the exogenous polynucleotides are covalently bound into a DNA molecule, preferably a T-DNA molecule, integrated into the genome of plant part cells or recombinant cells such as microbial cells and preferably wherein the number of said DNA molecules integrated into the genome of the cells of the plant part or the recombinant cells is not more than one, two or three, or is two or three.

In yet another embodiment, the plant part comprises at least two different exogenous polynucleotides, each encoding a Δ6-desaturase having the same or different amino acid sequence.

In a further embodiment, the total oil content of the plant part comprising the exogenous polynucleotides is at least about 40%, at least about 50%, at least about 60%, at least about 70%. , between about 50% and about 80%, or between about 80% and about 100% of the total oil content of a corresponding plant part lacking the exogenous polynucleotides. In a further embodiment, the seed comprising the exogenous polynucleotides has a seed weight of at least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 50%. % and about 80%, or between about 80% and about 100% of the weight of a corresponding seed that lacks the exogenous polynucleotides.

In another embodiment, the lipid is in the form of an oil, preferably a seed oil of an oilseed, and wherein at least about 90%, or about at least 95%, at least about 98% , or between about 95% and about 98%, by weight of the lipid are triacylglycerols.

In a further embodiment, the process further comprises treating the lipid to increase the level of DPA as a percentage of the total fatty acid content. For example, the treatment comprises hydrolysis of the esterified fatty acids to produce free fatty acids or transesterification. For example, the lipid such as rapeseed oil can be treated to convert the fatty acids in the oil to alkyl esters such as methyl or ethyl esters, which can then be fractionated to enrich the lipid or oil for DPA. In embodiments, the fatty acid composition of the lipid after said treatment comprises at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% DPA. In one embodiment, the level of DHA in the total fatty acid content of the lipid after treatment is less than 2.0% or less than 0.5%, preferably it is not detected in the lipid.

Also provided is lipid, or oil comprising the lipid, such as free fatty acids or alkyl esters, produced using a process of the invention.

In another aspect, the present invention provides a process for producing methyl or ethyl esters of polyunsaturated fatty acids, wherein the process comprises reacting triacylglycerols in the extracted plant lipid, or during the extraction process, with methanol or ethanol, respectively, wherein the extracted plant lipid comprises esterified fatty acids in the form of TAG, wherein the fatty acids comprise oleic acid, palmitic acid, 6 fatty acids comprising linoleic acid (LA), ω3 fatty acids comprising α-linolenic acid (ALA), and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), where the level of DPA in the total fatty acid content of the extracted lipid is between approximately 7% and 35%, preferably between 20.1% and 30% or between 20.1% and 35%, thereby producing the methyl or ethyl esters of polyunsaturated fatty acids.

In another aspect, the present invention provides a process for producing docosapentaenoic acid (DPA) methyl or ethyl esters, wherein the process comprises reacting triacylglycerols (TAG) in the extracted plant lipid, or during the extraction process, with methanol or ethanol, respectively, wherein the extracted plant lipid comprises fatty acids in an esterified form, wherein the fatty acids comprise docosapentaenoic acid (DPA), wherein at least 35% of the DPA esterified in the TAG form is esterified at the sn-2 position of the TAG, thereby producing the methyl or ethyl esters of polyunsaturated fatty acids.

In a preferred embodiment, the lipid that is used in the process of the two preceding aspects has one or more of the characteristics defined herein in the context of the extracted lipid or oil of the invention.

In another aspect, the present invention provides an oilseed plant or part thereof such as a seed, preferably a Brassica plant or a C. sativa plant, comprising lipid in its seed, or a microbial cell, comprising

a) lipid comprising fatty acids in an esterified form, and

b) exogenous polynucleotides encoding one or more of the following groups of enzymes;

i) an A12-desaturase, a ω3-desaturase and / or Δ15 desaturase, a Δδ-desaturase, a Δδ-desaturase, a Δδelongase and a Δδ-elongase, ii) an A12-desaturase, a ω3-desaturase and / or Δίδdesaturase , a Δδ-desaturase, a Δδ-desaturase, a Δ9elongase and a Δδ-elongase, iii) a w3-desaturase and / or Δΐδ-desaturase, a Δδdesaturase, a Δδ-desaturase, a Δδ-elongase and a Δδelongase, or iv ) a ω3-desaturase and / or Δίδ-desaturase, a Δδ-desaturase, a Δδ-desaturase, an A9-elongase and a Δδelongase, wherein each polynucleotide is operably linked to one or more seed-specific promoters that have the ability to direct the expression of said polynucleotides in the developing seed of the plant, or one or more promoters that have the ability to direct the expression of said polynucleotides in the microbial cell, where the fatty acids comprise oleic acid, palmitic acid, ωδ fatty acids comprising linoleic acid (LA) and optionally γ-linolenic acid (GLA), ω3 fatty acids comprising α-linolenic acid (ALA), stearidonic acid (SDA), and docosapentaenoic acid (DPA), and optionally eicosapentaenoic acid ( EPA) and / or eicosatetraenoic acid (ETA), and where the level of DPA in the total fatty acid content of the lipid of the seed or microbial cell is between 7% and 35%. In a preferred embodiment of this aspect, DHA is present at a level of less than 2% or less than 0.5% of the total fatty acid content of the seed lipid and the extracted lipid and more preferably is not detected in the total fatty acid content of lipids.

In another aspect, the present invention provides a cell, preferably a cell in or of a plant such as an oilseed plant or part thereof such as a seed, or an oilseed plant or part thereof, preferably a Brassica plant or a C. sativa plant, or a microbial cell, comprising

a) fatty acids in an esterified form, where the fatty acids comprise docosapentaenoic acid (DPA), where at least 35% of the esterified DPA in the triacylglycerol (TAG) form is esterified at the sn-2 position of the TAG , Y

b) exogenous polynucleotides encoding one or more of the following groups of enzymes;

i) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a ω3-desaturase, a Δδ-desaturase, a Δ5-desaturase, an A6-elongase and an A5-elongase, ii) an l-acyl-glycerol-3 -phosphate acyltransferase (LPAAT), a Δΐδ-desaturase, a Δδ-desaturase, a Δ5desaturase, a Δδ-elongase and a Δδ-elongase, iii) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12- desaturase, a Δδ-desaturase, a Δ5desaturase, a Δδ-elongase and a Δδ-elongase, iv) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12-desaturase, a ω3-desaturase and / or a Δ15-desaturase, a Δδ-desaturase, a Δδ-desaturase, a Δδelongase and a ΔΞ-elongase,

v) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a ω3-desaturase, a Δδ-desaturase, a Δ5-desaturase, an A9-elongase and a Δδ-elongase, vi) an l-acyl-glycerol-3 -phosphate acyltransferase (LPAAT), a Δΐδ-desaturase, a Δδ-desaturase, a Δδdesaturase, an A9-elongase and a Δδ-elongase, vii) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a Δ12- desaturase, a Δδ-desaturase, a Δδdesaturase, an A9-elongase and a Δδ-elongase, viii) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a Δ12-desaturase, a ω3-desaturase and / or a Δίδdesaturase, a Δδ-desaturase, a Δδ-desaturase, a Δ9elongase and a Δδ-elongase, wherein each polynucleotide is operably linked to one or more promoters that have the ability to direct the expression of said polynucleotides in the cell. Preferably, the LPAAT can use a C22 polyunsaturated fatty acyl-CoA substrate such as DPA-CoA and the level of DPA in the total fatty acid content of the extracted lipid is between about 1% and 35%, or between about 7% and 35%. % or between approximately 20.1% and 35%. In embodiments, at least about 40%, at least about 45%, at least about 48%, between 35% and about 60%, or between 35% and about 50%, of the DPAesterified in the triacylglycerol form (TAG) is esterified at the sn-2 position of the TAG.

In preferred embodiments of each of the preceding two aspects, the A15-desaturase is a fungal Δ15-desaturase and the 3-desaturase is a fungal ω3-desaturase.

In a preferred embodiment, the inventive oilseed plant, microbial cell or cell has, where relevant, one or more of the characteristics defined herein, for example as defined above in relation to the extracted plant lipid, extracted microbial lipid or a process for the production thereof.

Examples of oil plants include, but are not limited to, Brassica sp., Gossypium hirsutum, Linum usitatissimum, Helianthus sp., Carthamus tinctorius, Glycine max, Zea mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum vulgare, Avena sativa, Trifolium sp., Elaesis guineenis, Nicotiana benthamiana, Hordeum vulgare, Lupinus angustifolius, Oryza sativa, Oryza glaberrima, Camelina sativa, or Crambe abyssinica. In one embodiment, the plant is a Brassica sp. Plant, a C. sativa plant, or a G. max (soybean) plant. The plant is preferably Brassica sp. or Camelina sativa. In one embodiment, the oilseed plant is a Canola plant, B. júncea, Glycine max, Camelina sativa, or Arabidopsis thaliana. In an alternative embodiment, the oilseed plant is different from A. thaliana and / or different from C. sativa. In one embodiment, the oilseed plant is a different plant from G. max (soybean). In one embodiment, the oilseed plant is in the field, or grown in the field, or grown in a nursery under standard conditions, for example as described in Example 1.

In one embodiment, one or more of the desaturases used in a process of the invention or present in a cell, or plant or part thereof of the invention, has the ability to use an acyl-CoA substrate. In a preferred embodiment, one or more of Δ6-desaturase, Δ5desaturase and Δδ-desaturase, if present, has the ability to use an acyl-CoA substrate, preferably each of i) Δδ-desaturase and ΔΞ-desaturase or ii) ΔΞ-desaturase and Δδ-desaturase has the ability to use an acylCoA substrate. In one embodiment, a Δ12-desaturase and / or a Δ3-desaturase has the ability to use an acylCoA substrate. The acyl-CoA substrate is preferably an ALA-CoA for A6-desaturase, ETA-CoA for ΔΞ-desaturase and ETrA-CoA for Δδ-desaturase, oleoyl-CoA for A12-desaturase, or one or more of LA -CoA, GLA-CoA, and ARA-CoA for ω3desaturase.

In one embodiment, the mature seed collected from the plant has a DPA content of at least about 23 mg per gram of seed, preferably at least about 32 mg per gram of seed, at least about 36 mg per gram. of seed, at least about 40 mg per gram of seed, more preferably at least about 44 mg per gram of seed or at least about 46 mg per gram of seed, about 60 mg per gram of seed, or between about 30 mg and about 60 mg per gram of seed.

In another aspect, the present invention provides a plant

Brassica napus, B. júncea or Camelina sativa that has the ability to produce seeds comprising DPA, wherein the mature seed collected from the plant has a DPA content of at least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed, more preferably at least about 44 mg per gram of seed or at least about 48 mg per gram of seed, about 80 mg per gram of seed, or between about 30 mg and about 80 mg per gram of seed.

In another aspect, the present invention provides a plant cell of a plant of the invention comprising the exogenous polynucleotides defined herein.

Also provided are a plant part, preferably a seed, or recombinant cells such as microbial cells having one or more of the following characteristics

i) is from a plant of the invention, ii) comprises lipid as defined herein, or iii) can be used in a process of the invention.

In yet another aspect, the present invention provides mature seed collected from Brassica napus, B. júncea or

Camelina sativa comprising DPA and a moisture content of between about 4% and about 15% by weight, preferably between about 6% and about 8% by weight or between about 4% and about 8% by weight, more preferably between about 4% % and about 6% by weight, wherein the DPA content of the seed is at least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed, more preferably at least about 44 mg per gram of seed or at least about 48 mg per gram of seed, about 80 mg per gram of seed, or between about 30 mg and about 80 mg per gram of seed.

In one embodiment, the cell of the invention, the oilseed plant of the invention, the Brassica napus, B. júncea or Camelina sativa plant of the invention, the part of the plant of the invention, or the seed of the The invention can be used to produce extracted lipid comprising one or more or all of the characteristics defined herein.

In yet another aspect, the present invention provides a method for producing a plant or cell that can be used to produce the extracted lipid of the invention, wherein the method comprises

a) testing the level of DPA in the lipid produced by one or more parts of plants such as seeds or recombinant cells such as microbial cells of a plurality of plants or recombinant cells such as microbial cells, wherein each plant or recombinant cell such as a microbial cell comprises one or more exogenous polynucleotides encoding one or more of the following groups of enzymes;

i) a ω3-desaturase, a Δ6-desaturase, a Δ5desaturase, a Δβ-elongase and an A5-elongase, ii) a Δ15-desaturase, a Δδ-desaturase, a Δ5-desaturase, an A6-elongase and an A5-elongase, iii) a Δ12-desaturase, a Δδ-desaturase, a Δ5desaturase, a Δβ-elongase and a Δδ-elongase,, iv) an A12-desaturase, a ω3-desaturase or a Δΐδ-desaturase, a Δβ-desaturase, a Δδ -desaturase, a Δ6elongase and a A5-elongase,

v) a ω3-desaturase, a Δ8-desaturase, a Δ5desaturase, an A9-elongase and a ΔΞ-elongase, vi) an A15-desaturase, a Δδ-desaturase, a Δ5-desaturase, an A9-elongase and an A5-elongase, vii) a Δ12-desaturase, a Δδ-desaturase, a Δ5-desaturase, an A9-elongase and an A5-elongase, viii) a Δ12-desaturase, a ω3-desaturase or an A15-desaturase, a Δδ-desaturase, a Δδ-desaturase, a Δ4desaturase, an A9-elongase and an A5-elongase, ix) an o3-desaturase, a Δβ-desaturase, a Δ5-desaturase, a Δβ-elongase and a A5-elongase,

x) an A15-desaturase, a Δβ-desaturase, a Δ5desaturase, a Δβ-elongase and an A5-elongase, or xi) an A12-desaturase, a Δβ-desaturase, a Δ5desaturase, a Δβ-elongase and a ΔΞ-elongase , wherein each polynucleotide is operably linked to one or more promoters that have the ability to direct the expression of said polynucleotides in a recombinant cell or plant part cell, and

b) identifying a recombinant plant or cell, out of a plurality of recombinant plants or cells, which can be used to produce extracted plant lipid or cell lipid of the invention in one or more of its parts, and

c) optionally, producing progeny plants or recombinant cells of the identified recombinant plant or cell, or seed thereof.

In one embodiment, the recombinant plant or cell further comprises an exogenous polynucleotide encoding an LPAAT as defined herein.

Preferably, the progeny plant is at least a second or third generation drawn from the identified plant, and is preferably homozygous for the one or more polynucleotides. More preferably, the one or more polynucleotides are present in the progeny plant at a single insertion locus. That is, the invention provides a method that can be used as a screening method to identify a plant or seed thereof from a plurality of transformed candidate plants or seeds, wherein the identified plant or its progeny plant produces lipid of the invention, preferably in its seed. Said plant or progeny plant or its seed is selected if it produces lipid of the invention, in particular having the specified level of DPA level, or is not selected if it does not produce lipid of the invention.

In one embodiment, the exogenous polynucleotide (s) present in a cell such as a microbial cell, or plant or part thereof as defined herein, becomes stably integrated into the genome of the cell, plant or part. of the plant such as seed. Preferably, the exogenous polynucleotide (s) become stably integrated into the genome of the cell, plant or plant part such as seed at a single locus in the genome, and is preferably homozygous for insertion.

More preferably, the plant, plant part or seed is further characterized as lacking exogenous polynucleotides other than the one or more T-DNA molecules. That is, no exogenous vector sequences are integrated into the genome other than T-DNA sequences.

In one embodiment, prior to step a) the method includes introducing the one or more exogenous polynucleotides into one or more cells of the plant.

Also provided are a plant produced using a method of the invention, and seeds of said plants.

In one embodiment, the plant of the invention has male and female fertility, preferably has male and female fertility levels that are at least 70% relative to, or preferably are approximately the same as, a type plant corresponding wild. In one embodiment, the pollen produced by the plant of the invention or the plant produced from the seed of the invention is between 90 and 100% viable as determined by staining with a viability dye. For example, pollen viability can be assessed as described in Example 1.

In another aspect, the present invention provides a method of producing seed, wherein the method comprises,

a) growing a plant of the invention, or a plant that produces a part of the invention, preferably in a field as part of a population of at least 1000 or 2000 or 3000 of said plants or in an area of ​​at least 1 hectare or 2 hectares or 3 hectares planted with a standard planting density, alternatively in a nursery under standard conditions,

b) collecting the seed of the plant or plants, and

c) optionally, extracting lipid from the seed, preferably to produce oil with a total APD yield of at least 60 kg or 70 kg or 80 kg APD / hectare.

In one embodiment, the plant, plant cell, part of plant or seed, or recombinant cell, of the invention has one or more of the following characteristics

i) its oil is as defined herein, or ii) the recombinant plant or seed part or cell has the ability to be used in a process of the invention.

For example, the seed can be used to produce a plant of the invention. The plant can be grown in the field or in a nursery under standard conditions, for example as described in Example 1.

In another aspect, the present invention provides lipid, or oil, produced by, or obtained from, using the process of the invention, the cell of the invention, the oilseed plant of the invention, the Brassica sp. Plant, Brassica napus, B. júncea, G. max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, or the plant, plant cell, part of plant or seed of the invention. Preferably, the lipid or oil is purified to remove contaminants such as nucleic acid (DNA and / or RNA), protein and / or carbohydrate, or pigments such as chlorophyll. The lipid or oil can also be purified to enrich the proportion of TAG, for example by removal of free fatty acids (FFA) or phospholipids.

In one embodiment, the lipid or oil can be obtained by extracting oil from an oilseed. Examples of oilseed oil include, but are not limited to, rapeseed oil (Brassica napus, Brassica rapa sp.), Mustard oil (Brassica júncea), other Brassica oil, sunflower oil (Helianthus annus), flax oil (Linum usitatissimum), soybean oil (Glycine max), safflower oil (Carthamus tinctorius), corn oil (Zea mays), tobacco oil (Nícotiana tabacum), peanut oil (Arachis hypogaea), palm, Cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucífera), avocado oil (Persea americana), olive oil (Olea europaea), cashew oil (Anacardium occidentale), macadamia oil (Macadamia intergrifolia) , almond oil (Prunus amygdalus) or Arabidopsis seed oil (Arabidopsis thaliana).

In one embodiment, a cell (recombinant cell) of, or used in, the invention is a microbial cell such as a cell suitable for fermentation, preferably an oleaginous microbial cell having the ability to accumulate triacylglycerols to a level of at least minus 25% on a weight basis. The preferred fermentation processes are anaerobic fermentation processes, which are well known in the art. Suitable fermenting cells, typically microorganisms, have the ability to ferment, that is, convert, sugars, such as glucose or maltose, directly or indirectly to the desired fatty acids. Examples of killer microorganisms include fungal organisms, such as yeast. As used herein, yeast includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces starkey, and preferably Yarrowia lipolytica.

In another aspect, the present invention provides fatty acid produced by, or obtained from, using the process of the invention, the cell of the invention, the oilseed plant of the invention, the Brassica sp. Plant, Brassica napus, B. júncea, G. max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, or the plant, plant cell, plant part or seed of the invention. Preferably the fatty acid is DPA. The fatty acid can be a mixture of fatty acids having a fatty acid composition as described herein, or it can be enriched such that the fatty acid, preferably DPA, comprises at least 40% or at least 90% of the fatty acid. fatty acid content of the mixture. In one embodiment, the fatty acid is not esterified. Alternatively, the fatty acid is esterified such as, for example, with a methyl, ethyl, propyl or butyl group.

Seed-based food obtained from the seed of the invention or obtained from a plant of the invention is also provided. Preferred seed-based food includes, but is not limited to, seed-based food from Brassica sp., Brassica napus, B. júncea, Camelina sativa, or Glycine max. In one embodiment, the seed-based food comprises one or more exogenous polynucleotides and / or genetic constructs as defined herein. In a preferred embodiment, the seed-based food retains some of the lipid or oil produced in the seed from which the seed-based food is obtained, but at a low level (e.g., less than 2% in weight) after extraction of most of the lipid or oil. The seed-based feed can be used as animal feed or as an ingredient in food production.

In another aspect, the present invention provides a composition comprising one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell according to the invention, the oilseed plant of the invention, the Brassica plant sp., Brassica napus, B. júncea, Glycine max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, or the seed-based food of the invention. In embodiments, the composition comprises a carrier suitable for pharmaceutical, food, or agricultural use, a seed treatment compound, a fertilizer, another food or feed ingredient, or added proteins or vitamins.

Also provided are foods, cosmetics or chemicals comprising one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell according to the invention, the oilseed plant of the invention, the Brassica sp. Plant. , Brassica napus, B. júncea, Glycine max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, the seed-based food of the invention, or the composition of the invention. A preferred food is infant formula comprising the lipid or oil of the invention.

In another aspect, the present invention provides a method of producing a food, preferably infant formula, wherein the method comprises mixing one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell according to the invention, the oilseed plant of the invention, the Brassica sp. plant, Brassica napus, B. júncea, Glycine max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, the seed-based food of the invention, or the composition of the invention, with at least one other food ingredient . The method can comprise the steps of mixing, cooking, baking, extruding, emulsifying or otherwise formulating the food, or packaging the food, or analyzing the amount of lipid or oil in the food.

In another aspect, the present invention provides a method for treating or preventing a condition that could benefit from a PUFA, preferably DPA, wherein the method comprises administering to a subject one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell according to the invention, the oilseed plant of the invention, the Brassica sp. , Brassica napus, B. júncea, Glycine max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, the seed-based food of the invention, the composition of the invention, or the food of the invention. In a preferred embodiment, the PUFA is administered in the form of a pharmaceutical composition comprising an ethyl ester of the PUFA. The subject can be a human or an animal other than a human.

Examples of conditions that could benefit from a PUFA include, but are not limited to, elevated serum triglyceride levels, elevated serum cholesterol levels such as elevated LDL cholesterol levels, cardiac arrhythmias, angioplasty, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, fetal alcohol syndrome, Attention deficit hyperactivity disorder, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenoleukodystrophy, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease, ulcerative colitis, post-angioplasty restenosis, eczema, high blood pressure, platelet aggregation, gastrointestinal bleeding, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue after viral infections or eye disease.

Also provided is the use of one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell according to the invention, the oilseed plant of the invention, the Brassica sp. Plant, Brassica napus, B. júncea, Glycine max or Camelina sativa of the invention, the part of the plant of the invention, the seed of the invention, the seed-based food of the invention, the composition of the invention, or the food of the invention for the manufacture of a medicament to treat or prevent a condition that could benefit from a PUFA preferably DPA.

Production of the medicament may comprise mixing the oil of the invention with a pharmaceutically acceptable carrier, for the treatment of a condition as described herein. The method may comprise first purifying the oil and / or transesterifying, and / or fractionating the oil to increase the level of DPA. In a particular embodiment, the method comprises treating the lipid or oil such as canola oil to convert the fatty acids in the oil to alkyl esters such as methyl or ethyl esters. Additional treatment such as fractionation or distillation can be applied to enrich the lipid or oil for DPA. In a preferred embodiment, the drug comprises ethyl esters of DPA. In an even more preferred embodiment, the level of DPA ethyl esters in the drug is between 30% and 50%, or at least 80% or at least about 85% or at least 90% or at least minus about 95%. The drug may further comprise EPA ethyl esters, such as between 30% and 50%, or at least 90%, of the total fatty acid content in the drug. Such medicaments are suitable for administration to human or animal subjects for the treatment of medical conditions as described herein.

In another aspect, the present invention provides a method of marketing the seed, which comprises obtaining the seed of the invention, and marketing the seed obtained for monetary gain.

In one embodiment, obtaining the seed comprises growing plants of the invention and / or collecting the seed from the plants.

In another embodiment, obtaining the seed further comprises placing the seed in a container and / or storing the seed.

In a further embodiment, obtaining the seed further comprises transporting the seed to a different location.

In yet another embodiment, the method further comprises transporting the seed to a different location after the seed is marketed.

In a further embodiment, the marketing is done using electronic means such as a computer.

In yet another aspect, the present invention provides a process for producing seed depots comprising:

a) furrowing, row forming and / or harvesting above-ground plant parts comprising the seed of the invention,

b) shelling and / or separating the plant parts to separate the seed from the rest of the plant parts, and

c) sieving and / or selecting the seed separated in step b), and loading the sieved and / or selected seed into tanks, thereby producing seed tanks.

In one embodiment, where relevant, the lipid or oil, preferably seed oil, of, or useful for, the invention has fat levels approximately as provided in a Table in the Examples section.

Any embodiment herein is to be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.

The present invention is not limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps, or group of compositions of matter should be taken as encompassing one and a plurality (ie one or more) of those steps, compositions of matter, groups of steps, or group of compositions of matter.

The invention is described hereinafter by means of the following non-limiting Examples and with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE ANNEXED FIGURES.

Figure 1. DPA aerobic biosynthesis pathways.

Figure 2. Map of the T-DNA insertion region between the left and right edges of pJP3416-GA7. RB indicates right border; LB, left border; TER, transcription / polyadenylation termination region; PRO, promoter; Coding regions are indicated above arrows, promoters and terminators below arrows. Micpu-A6D, Micromonas pusilla Δ6-desaturase; Pyrco-ΔβΕ, Δβ-elongase from Pyramimonas cordata; Pavsa-á5D, Δ5desaturase from Pavlova salina; Picpa-m3D, ω3-desaturase from Pichia pastoris; Pavsa-á4D, Δ4-desaturase from P. salina; Lackl-Δ12D, Δ12-desaturase from Lachancea kluyveri; Pyrco-á5E, ΔΒ-elongase Pyramimonas cordata. NOS indicates the Agrobacterium tumefaciens nopaline synthase transcription / polyadenylation terminator region; FP1, truncated napine promoter from Brassica napus; FAE1, Arabidopsis thaliana FAE1 promoter; Lectin, lectin polyadenylation / transcription terminator region of Glycine max; Cnll and Cnl2 indicate the conlininal or conlinin2 promoter or terminator from Linum usitatissimum. MAR indicates the Rb7 matrix binding region of Nicotiana tabacum.

Figure 3. (A) Phytosterol basic structure with ring and side chain numbering.

(B) Chemical structures of some of the phytosterols.

Figure 4. Map of the T-DNA insertion region between the left and right edges of pJP3662. RB, indicates right border; LB, indicates left border; TER, transcription / polyadenylation termination region; PRO, promoter; Coding regions are indicated above arrows, promoters and terminators below arrows. Micpu-A6D, Micromonas pusilla Δδ-desaturase; Pyrco-ΔβΕ, Δδ-elongase from Pyramimonas cordata; Pavsa-A5D, Δ5desaturase from Pavlova salina; Picpa-o3D, o3-desaturase from Pichia pastoris; Lackl-A12D, Lachancea kluyveri Δ12-desaturase; Pyrco-A5E, ΔΕ-elongase from Pyramimonas cordata. NOS indicates the region of the transcription terminator / polyadenylation of nopaline synthase from Agrobacterium turnefaciens; FP1, Brassica napus truncated napine promoter; FAE1, Arabidopsis thaliana FAE1 promoter; Lectin, Glycine max lectin polyadenylation / transcription terminator region; Cnll indicates the conlininal or conlinin2 promoter or terminator of Linum usitatissimum. MAR indicates the matrix binding region Rb7deNicotíana tabacum.

KEYS IN THE SEQUENCE LIST

SEQ ID N0: 1 - nucleotide sequence of pJP3416-GA7.

SEQ ID NO: 2 - nucleotide sequence of pGA7-mod_B.

SEQ ID NO: 3 - Codon-optimized open reading frame for Δ12-desaturase expression from Lachancea kluyverien plants.

SEQ ID NO: 4-Δ12-desaturase from Lachancea kluyveri.

SEQ ID NO: 5 - Codon optimization open reading frame for expresión3-desaturase expression from Pichia pastorisen plants.

SEQ ID NO: 6 - ω3-desaturase from Pichia pastoría.

SEQ ID NO: 7 - Open reading frame encoding Micromonaspusilla Δ6-desaturase.

SEQ ID NO: 8 - Codon-optimized open reading frame for Micromonaspusilla plant Δ6-desaturase expression.

SEQ ID NO: 9 - Δ6-desaturase from Micromonaspusilla.

SEQ ID NO: 10 - Open reading frame encoding Ostreococcus lucimarinus Δ6-desaturase.

SEQ ID NO: 11 - Codon-optimized open reading frame for the expression of Ostreococcus lucimarinus Δ6-desaturase in plants.

SEQ ID NO: 12 - Δ6-desaturase from Ostreococcus lucimarinus.

SEQ ID NO: 13 - Δ6-desaturase from Ostreococcus tauri.

SEQ ID NO: 14 - Open reading frame encoding Δ6-elongasade Pyramimonas cordata.

SEQ ID NO: 15 - Codon-optimized open reading frame for expression of Pyramimonas cordata Δ6-elongase in plants (truncated at the 3 'end and encoding functional elongase).

SEQ ID NO: 16 - Δ6-elongasade Pyramimonas cordata.

SEQ ID NO: 17 -Δ6-truncated elongase from Pyramimonas cordata.

SEQ ID NO: 18 - Open reading frame coding for Δ5-desaturase from Pavlova salina.

SEQ ID NO: 19 - Codon optimization open reading frame for expression of Δ5-desaturase Pavlova salina in plants.

SEQ ID NO: 20 - Δ5-desaturase from Pavlova salina.

SEQ ID NO: 21 - Open reading frame encoding Pyramimonas cordata Δ5-desaturase.

SEQ ID NO: 22 - Δ5-desaturase from Pyramimonas cordata.

SEQ ID NO: 23 - Open reading frame encoding Pyramimonas cordata Δ5-elongase.

SEQ ID NO: 24 - Codon optimization open reading frame for expression of Pyramimonas cordata Δ5-elongase in plants.

SEQ ID NO: 25 - Δ5-elongase from Pyramimonas cordata.

SEQ ID NO: 26 - Open reading frame encoding for Pavlova salina A4-desaturase.

SEQ ID NO: 27 - Codon-optimized open reading frame for the expression of Pavlova salina Δ4-desaturase in plants.

SEQ ID NO: 28 - Δ4-desaturase from Pavlova salina.

SEQ ID NO: 29 - Δ9-elongasade Isochrysis galbana.

SEQ ID NO: 30 - Codon-optimized open reading frame for expression of Emiliania huxleyi A9-elongase in plants.

SEQ ID NO: 31 - CCMP1516 A9-elongasa from Emiliania huxleyi.

SEQ ID NO: 32 - Open reading frame encoding Δ9-elongase from Pavlova pinguis.

SEQ ID NO: 33-A9-elongase from Pavlova pinguis.

SEQ ID NO: 34 - Open reading frame encoding Δ9-elongase from Pavlova salina.

SEQ ID NO: 35-A9-elongase from Pavlova salina.

SEQ ID NO: 36 - Open reading frame encoding Δ8-desaturase Pavlova salina.

SEQ ID NO: 37 - Δ8-desaturase from Pavlova salina.

SEQ ID NO: 38 - viral suppressor V2.

SEQ ID NO: 39 - Open reading frame encoding viral suppressor V2.

SEQ ID NO: 40 - LPAAT2 Arabidopsis thaliana.

SEQ ID NO: 41 - LPAAT from Limnanthes alba.

SEQ ID NO: 42 -LPAAT from Saccharomyces cerevisiae.

SEQ ID NO: 43 - LPAAT from Micromonas pusilla.

SEQ ID NO: 44 -LPAAT from Mortierella alpina.

SEQ ID NO: 45 -LPAAT from Braccisa napus.

SEQ ID NO: 46 -LPAAT from Brassica napus.

SEQ ID NO: 47 - ω3-desaturase from Phytophthora infestans.

SEQ ID NO: 48 - ω3-desaturase from Thalassiosira pseudonana.

SEQ ID NO: 49 - th3-desaturase from Pythium irregulare. '

SEQ ID NOs: 50 to 58 - oligonucleotide primers / probes.

DETAILED DESCRIPTION OF THE INVENTION General techniques and definitions

Unless specifically defined otherwise, all technical and scientific terms used herein should be considered as having the same meaning as that commonly understood by a person of ordinary skill in the art (e.g., in cell culture, molecular genetics, fatty acid synthesis, transgenic plants, recombinant cells, protein chemistry, and biochemistry). .

Unless otherwise indicated, the protein, cell culture, and immunological techniques used in the present invention are standard procedures, well known to those of skill in the art. Such techniques are described and explained throughout the literature in sources such as J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Coid Spring Harbor Laboratory Press (1989), TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), DM Glover and BD Hames (editors), ADN Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), FM Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to present), Ed Harlow and David Lañe (editors), Antibodies: A Laboratory Manual, Coid Spring Harbor Laboratory, (1988), and JE Coligan et al. (editors), Current Protocols in Immunology, John Wiley &amp; Sons (including all updates to date).

The term and / or, for example, X and / or Y should be construed to refer to X and Y or X or Y and should be considered to provide explicit support for both meanings or for each meaning.

As used herein, the term "about" unless otherwise indicated refers to +/- 10%, more preferably +/- 5%, more preferably +/- 1% of the designated value.

Throughout this specification the word comprising, or variations such as comprising or comprising, will be construed as implying the inclusion of an indicated element, integer or step, or group of elements, integers or. steps, but without excluding any other element, integer or step, or group of elements, integers or steps.

Selected definitions

As used herein, the terms "extracted plant lipid" and "isolated plant lipid" refer to a lipid composition that has been extracted from, for example by crushing, a plant or part thereof such as a seed. The extracted lipid can be a relatively crude composition obtained by, for example, breaking a plant seed, or a more purified composition where most, or all, of one or more or each of the water has been removed, nucleic acids, proteins and carbohydrates derived from plant material. Examples of purification methods are described below. In one embodiment, the extracted or isolated plant lipid comprises at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (weight by weight) of lipid by weight of the composition. The lipid can be solid or liquid at room temperature, when it is liquid it is considered an oil. In one embodiment, the extracted lipid of the invention has not been mixed with another lipid such as DPA produced from another source (eg, DPA from fish oil). In one embodiment, after extraction the ratio of one or more or all of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total ω6 fatty acids: total ω3 fatty acids, has not been significantly altered. (eg, no more than 10% or 5% alteration) compared to the ratio in the intact seed or cell. In another embodiment, the extracted plant lipid has not been exposed to a procedure, such as hydrogenation or fractionation, which can alter the ratio of one or more or all of oleic acid to DPA, palmitic acid to DPA, linoleic acid. to DPA, and total ω6 fatty acids: total ω3 fatty acids, compared to the ratio in the seed or intact cell. When the extracted vegetable lipid of the invention is comprised of an oil, the oil may further comprise non-fatty acid molecules such as sterols.

As used herein, the terms "extracted vegetable oil" and "isolated vegetable oil" refer to a substance or composition comprising the extracted vegetable lipid or isolated vegetable lipid and which is a liquid at room temperature. The oil is obtained from a plant or part of it such as a seed. The extracted or isolated oil can be a relatively crude composition obtained by, for example, breaking a plant seed, or a more purified composition where most, or all, of one or more or each of water, nucleic acids, proteins and carbohydrates derived from plant material. The composition can comprise other components that can be lipid or non-lipid. In one embodiment, the oil composition comprises at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (weight by weight ) of extracted vegetable lipid. In one embodiment, the extracted oil of the invention has not been mixed with any other oil such as DPA produced from another source (eg fish oil DPA). In one embodiment, after extraction, the ratio of one or more or all of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total 6 fatty acids: total ω3 fatty acids has not been significantly altered (eg, no more than 10% or 5% alteration) compared to the ratio in the intact seed or cell. In another embodiment, the extracted vegetable oil has not been exposed to a process, such as hydrogenation or fractionation, which can alter the ratio of one or more or all of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total ω6 fatty acids: total ω3 fatty acids, compared to the ratio in the seed or intact cell. The extracted vegetable oil of the invention may comprise non-fatty acid molecules such as sterols.

As used herein, terms such as extracted microbial lipid or extracted microbial oil have analogous meanings to the corresponding terms extracted vegetable lipid and extracted vegetable oil respectively, the main difference being the source of the lipid or oil.

As used herein, an oil is a composition that predominantly comprises lipid and which is a liquid at room temperature. For example, the oil of the invention preferably comprises at least 75%, at least 80%, at least 85% or at least 90% lipid by weight. Typically, a purified oil comprises at least 90% triacylglycerols (TAG) by weight of the lipid in the oil. Minor components of an oil such as diacylglycerols (DAG), free fatty acids (FFA), phospholipids, and sterols can be present as described herein.

As used herein, the term "fatty acid" refers to a carboxylic acid (or organic acid), often with a long, saturated or unsaturated aliphatic tail. Fatty acids typically have a chain of carbon-carbon bonds at least 8 carbon atoms in length, more preferably at least 12 carbons in length. The preferred fatty acids of the invention have carbon chains of between 18 and 22 carbon atoms (C18, C20, C22 fatty acids), more preferably 20-22 carbon atoms (C20, C22) and more preferably 22 carbon atoms ( C22). Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate that has two carbon atoms. The fatty acids can be in a free (non-esterified) state or in an esterified form such as part of a linked triglyceride, diacylglyceride, monoacylglyceride, acyl-CoA (thio-ester), or other attached form. The fatty acid can be esterified as a phospholipid such as a phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol form,

100 phosphatidi-linositol or diphosphatidylglycerol. In one embodiment, the fatty acid is esterified to a methyl or ethyl group, such as, for example, a methyl or ethyl ester of a C20 or C22 PUFA. Preferred fatty acids are the methyl or ethyl esters of EPA or DPA, or EPA, DPA and DHA, or EPA and DPA.

Saturated fatty acids do not contain any double bonds or other functional groups along the chain. The term saturated refers to a hydrogen, at all carbons (apart from the carboxylic acid group [-COOH]) it contains as many hydrogens as possible. In other words, the omega end (ω) contains 3 hydrogens (-CH3-) and each carbon within the chain contains 2 hydrogens (-CH2)

Unsaturated fatty acids are similar in form to saturated fatty acids, except that one or more alkali functional groups exist along the chain, with each alkylene substituting a single-chain link -CH2-CH2- part with a -CH = CH- moiety with double bonds (ie, a carbon double bonded to another carbon). The next two carbon atoms in the chain that are attached to either side of the double bond may be in a cisotrans configuration, preferably in the cis configuration. In one embodiment, the lipid or

101 oil or the invention has a fatty acid composition comprising less than 1% fatty acids having a carbon-carbon double bond in the trans configuration (trans fatty acids).

As used herein, the term "monounsaturated fatty acid" refers to a fatty acid that comprises at least 12 carbon atoms in its carbon chain and only one alkylene group (carbon-carbon double bond) in the chain. As used herein, the terms "polyunsaturated fatty acid" or "PUFA" refer to a fatty acid that comprises at least 12 carbon atoms in its carbon chain and at least two alkylene groups (carbon-carbon double bonds).

As used herein, the terms long chain polyunsaturated fatty acid and LC-PUFA refer to a fatty acid that comprises at least 20 carbon atoms in its carbon chain and at least two carbon-carbon double bonds. , and therefore include VLC-PUFA. As used herein, the terms "very long chain polyunsaturated fatty acid" and "VLC-PUFA" refer to a fatty acid comprising at least 22 carbon atoms in its carbon chain and at least three carbon-double bonds. carbon. Ordinarily, the number of carbon atoms in the carbon chain of fatty acids is

102 refers to an unbranched carbon chain. If the carbon chain is branched, the number of carbon atoms excludes those in the side groups. In one embodiment, the long chain polyunsaturated fatty acid is a ω3 fatty acid, that is, it has a desaturation (carbon-carbon double bond) at the third carbon-carbon bond of the methyl end of the fatty acid. In another embodiment, the long chain polyunsaturated fatty acid is a ω6 fatty acid, that is, it has a desaturation (carbon-carbon double bond) at the sixth carbon-carbon bond of the methyl end of the fatty acid. In a further embodiment, the long chain polyunsaturated fatty acid is selected from the group consisting of; Arachidonic acid (ARA, 20: 4Δ5,8,11,14; ω6), eicosatetraenoic acid (ETA, 20: 4Δ8,11,14,17, ω3), eicosapentaenoic acid (EPA, 20: 5Δ5,8,11,14 , 17; ω3), docosapentaenoic acid (DPA, 22: 5Δ7,10,13,16,19, ω3), or docosahexaenoic acid (DHA, 22: 6Δ4,7,10,13,16,19, ω3). The LC-PUFA can also be dihomo-Y-linoleic acid (DGLA) or eicosatrienoic acid (ETrA, 20: 3Δ11,14,17, ω3). It will be readily apparent that the LC-PUFA produced in accordance with the invention may be a mixture of any or all of the foregoing and may include other LC-PUFAs or derivatives of any of these LC-PUFAs. In one embodiment

103 preferred, the ω3 fatty acids are at least DPA, or DPA and DHA, or EPA, DPA and DHA, or EPA and DPA. In one embodiment, DPA is present at a level between about 7% and 30% or 35% and DHA is absent or, if present, is present at a level less than 2.0%, preferably less than 1, 0%, more preferably less than 0.5% of the total fatty acid composition and more preferably absent or not detectable. This can be achieved by the absence of a Δ4-desaturase activity in the cell. In one embodiment, the level of DPA is greater than the level of EPA, more preferably greater than the level of each of EPA and DHA, more preferably greater than the combined level of EPA and DHA. In this embodiment, DHA may be absent or, if present, present at a level less than 0.5% of the total fatty acid composition.

Furthermore, as used herein, the terms long chain polyunsaturated fatty acid (LC-PUFA) and very long chain polyunsaturated fatty acid (VLC-PUFA) refer to the fatty acid being in a free state (not esterified) or in an esterified form such as a part of a triglyceride (triacylglycerol), diacylglyceride, monoacylglyceride, attached acyl-CoA, or other attached form. In triglyceride, LC-PUFA or VLC-PUFA such as DPA may be

104 esterified at the sn-1/3 or sn-2 positions, or the triglyceride may comprise two or three acyl groups selected from the acyl groups LC-PUFA and VLC-PUFA. For example, the triglyceride can comprise DPA at both the sn-1 and sn-3 positions. The fatty acid can be esterified as a phospholipid such as phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol. Therefore, LC-PUFA can be present as a mixture of forms in the lipid of a cell or a purified oil or lipid extracted from cells, tissues or organisms. In preferred embodiments, the invention provides oil comprising at least 75% or at least 85% triacylglycerols, with the remainder present as other lipid forms such as those mentioned, wherein at least said triacylglycerols comprise the LCPUFA. The oil can subsequently be purified or further treated, for example by hydrolysis with a strong base to liberate free fatty acids, or by transesterification, distillation or the like.

As used herein, total ω6 fatty acids or total ω6 fatty acid content or the like refer to the sum of all the 6 fatty acids, esterified and unesterified, in the extracted lipid,

105 oil, recombinant cell, plant or seed part, as determined by the context, expressed as a percentage of the total fatty acid content. These 6 fatty acids include (if present) LA, GLA, DGLA, ARA, EDA, and ωδ-DPA, and exclude any 3 fatty acids and monounsaturated fatty acids. The Δδ fatty acids present in the plants, seeds, lipid or oils of the invention are all included in the class of polyunsaturated fatty acids (PUPA).

As used herein, new ωδ fatty acids or content of new or similar ωδ fatty acids refers to the sum of all the ωδ fatty acids excluding LA, esterified and unesterified, in the extracted lipid, oil, recombinant cell, part of plant or seed, as determined by the context, expressed as a percentage of the total content of fatty acids. These novel ωδ fatty acids are the fatty acids that are produced in the cells, plants, plant parts and seeds of the invention by the expression of the genetic constructs (exogenous polynucleotides) introduced into the cells, and include (if present) GLA, DGLA, ARA, EDA and ωδ-DPA, but exclude LA and any ω3 fatty acids and monounsaturated fatty acids. The total contents of exemplary new ωδ fatty acids and contents of ωδ fatty acids are

106 determined by conversion of fatty acids in a sample to FAME and by GC analysis, as described in Example 1.

As used herein, total ω3 fatty acids or total 3 fatty acid content or the like refers to the sum of all the ω3 fatty acids, esterified and unesterified, in the extracted lipid, oil, recombinant cell, part of plant or seed, as determined by the context, expressed as a percentage of the total fatty acid content. These 3 fatty acids include (if present) ALA, SDA, ETrA, ETA, EPA, DPA, and DHA, and exclude any 6 fatty acids and monounsaturated fatty acids. The 3 fatty acids present in the plants, seeds, lipid or oils of the invention are all included in the class of polyunsaturated fatty acids (PUFA).

As used herein, new 3 fatty acids or content of new or similar ω3 fatty acids refers to the sum of all the ω3 fatty acids excluding ALA, esterified and unesterified, in the extracted lipid, oil, recombinant cell, part of plant or seed, as determined by the context, expressed as a percentage of the total content of fatty acids. These new ω3 fatty acids are the '3 fatty acids that are produced in cells, plants, plant parts and seeds of the

107 invention by the expression of genetic constructs (exogenous polynucleotides) introduced into cells, and include (if present) SDA, ETrA, ETA, EPA, DPA, and DHA, but exclude ALA and any ω6 fatty acids and monounsaturated fatty acids. The total content of exemplary new o3s fatty acids and content of ω3 fatty acids are determined by conversion of fatty acids in a sample to FAME and by GC analysis, as described in Example 1.

As the person of skill would appreciate, the term obtaining a plant part as a step in the process of the invention may include obtaining one or more plant parts for use in the process. Obtaining the plant part includes collecting the plant part from a plant such as with a mechanical picker, or purchasing the plant part, or receiving the plant part from a supplier. In another example, obtaining a plant part could be acquiring the plant from someone else who has collected the plant part.

The desaturase, elongase and acyl transferase proteins and the genes encoding them that can be used in the invention are any of those known in the art or homologues or derivatives thereof. Examples of such genes and encoded protein sizes are listed in Table 1. Desaturase enzymes that have been shown to

108 they participate in the biosynthesis of LC-PUFA all belong to the group 'of the so-called front end desaturases. Preferred proteins, or protein combinations, are those encoded by the genetic constructs provided herein as SEQ ID NOs: 1 and 2.

As used herein, the term "terminal desaturase" refers to a member of a class of enzymes that introduces a double bond between the carboxyl group and a pre-existing unsaturated portion of the lipid acyl chain, which are structurally characterized by the presence of an N-terminal cytochrome b5 domain, along with a typical fatty acid desaturase domain that includes three highly conserved histidine boxes (Napier et al., 1997).

The activity of any of the elongases or desaturases for use in the invention can be assayed by expression of a gene encoding the enzyme in a cell such as, for example, a plant cell or preferably in somatic embryos or transgenic plants, and determine whether the cell, embryo, or plant has an increased ability to produce LC-PUFA compared to a comparable cell, embryo, or plant where the enzyme is not expressed.

In one embodiment, one or more of the desaturases and / or elongases for use in the invention can be purified from a microalgae, i.e. it is identical in

109 amino acid sequence to a polypeptide that can be purified from a microalgae.

While certain enzymes are specifically described herein as bifunctional, the absence of such a term does not necessarily imply that a particular enzyme does not possess activity other than specifically defined.

Table 1. Cloned genes involved in LCPUFA biosynthesis

<td>Enzi ma</td><td>Organism type</td><td>Species</td><td>Access Nos.</td><td>Tam year of protection (aa)</td><td>References</td>

<td>Δ6desa ture sa</td><td>Mammals</td><td>Homo sapiens</td><td>NM_01340 2</td><td> 444</td><td>Cho et al., 1999a; Leonard et al., 2000</td>

<td></td><td></td><td>Mus musculus</td><td>NM_01969 9</td><td> 444</td><td>Cho et al., 1999a</td>

<td></td><td>Nemato des</td><td>Caenorhab ditis elegans</td><td>Z70271</td><td> 443</td><td>Napier et al., 1998</td>

<td></td><td>Plants</td><td>Borago officinal it is</td><td>U79010</td><td> 448</td><td>Sayanova et al., 1997</td>

<td></td><td></td><td>Echium</td><td>AY055117 AY055118</td><td></td><td>Garcia-Maroto and col., 2002</td>

<td></td><td></td><td>Primrose vialii</td><td>AY234127</td><td> 453</td><td>Sayanova et al., 2003</td>

<td></td><td></td><td>Anemone leveillei</td><td>AF536525</td><td> 446</td><td>Whitney et al., 2003</td>

110

<td></td><td>Mosses</td><td>Ceratodon purpureas</td><td>AJ25073 5</td><td> 520</td><td>Sperling et al., 2000</td>

<td></td><td></td><td>Marchantía polymorpha</td><td>AY58346 3</td><td> 481</td><td>Ka j ikawa et al., 2004</td>

<td></td><td></td><td>Physcomitrel the patens</td><td>CAA1103 3</td><td> 525</td><td>Girke and col., 1998</td>

<td></td><td>Mushrooms</td><td>Alpine mortierella</td><td>AF11051 0 AB02003 2</td><td> 457</td><td>Huang and cabbage. , 1999; Sakuradani et al., 1999</td>

<td></td><td></td><td>Pythium irregulare</td><td>AF41929 6</td><td> 459</td><td>Hong and cabbage. , 2002a</td>

<td></td><td></td><td>Mucor circinelloid is</td><td>AB05208 6</td><td> 467</td><td>NCBI *</td>

<td></td><td></td><td>Rhizopus sp.</td><td>AY32028 8</td><td> 458</td><td>Zhang and col., 2004</td>

<td></td><td></td><td>Saprolegnia diclina</td><td></td><td> 453</td><td>WO02081668</td>

<td></td><td>Diatom s</td><td>Phaeodactylu m tricornutum</td><td>08239 3</td><td> 477</td><td>Domergue et al., 2002</td>

<td></td><td>Bacteria s</td><td>Synechocysti s</td><td>L11421</td><td> 359</td><td>Reddy and col., 1993</td>

<td></td><td>Algae</td><td>Thraustochyt rium aureum</td><td></td><td> 456</td><td>WO02081668</td>

<td>Δ5 / Δ6desatur bifunctional handle</td><td>Fish</td><td>Danio rerio</td><td>AF30955 6</td><td> 444</td><td>Hastings et al., 2001</td>

<td>C20 Δ8desatur handle</td><td>Algae</td><td>Euglena gracilis</td><td>AF13972 0</td><td> 419</td><td>Wallis and Browse, 1999</td>

<td></td><td>Plants</td><td>Borago officinales</td><td>AAG4327 7</td><td> 446</td><td>Sperling et al., 2001</td>

111

<td>Enzyme</td><td>Type of organism</td><td>Species</td><td>Access Nos.</td><td>Protein size (aa)</td><td>References</td>

<td>Δ6elongasa</td><td>Nematodes</td><td>Caenorhabdi tis elegans</td><td>NM_069288</td><td> 288</td><td>Beaudoin et al., 2000</td>

<td></td><td>Mosses</td><td>Physcomitrella patens</td><td>AF428243</td><td> 290</td><td>Zank and col., 2002</td>

<td></td><td></td><td>Marchantía polymorpha</td><td>AY583464</td><td> 290</td><td>Ka j ikawa et al., 2004</td>

<td></td><td>Mushrooms</td><td>Alpine mortierella</td><td>AF206662</td><td> 318</td><td>Parker- Barnes and col., 2000</td>

<td></td><td>Algae</td><td>Pavlova lutheri **</td><td></td><td> 501</td><td>WO 03078639</td>

<td></td><td></td><td>Thraustochytrium</td><td>AX951565</td><td> 271</td><td>WO 03093482</td>

<td></td><td></td><td>Thraustochytrium sp **</td><td>AX214454</td><td> 271</td><td>WO 0159128</td>

<td>PUFAelongasa</td><td>Mammals</td><td>Homo sapiens</td><td>AF231981</td><td> 299</td><td>Leonard et al., 2000b; Leonard et al., 2002</td>

<td></td><td></td><td>Rattus norvegicus</td><td>AB071985</td><td> 299</td><td>Inagaki et al .., 2002</td>

<td></td><td></td><td>Rattus norvegicus **</td><td>AB071986</td><td> 267</td><td>Inagaki et al., 2002</td>

<td></td><td></td><td>Mus musculus</td><td>AF170907</td><td> 279</td><td>Tvrdik and col., 2000</td>

<td></td><td></td><td>Mus musculus</td><td>AF170908</td><td> 292</td><td>Tvrdik and col., 2000</td>

<td></td><td>Fish</td><td>Danio rerio</td><td>AF532782</td><td> 291 (282)</td><td>Agaba and col., 2004</td>

<td></td><td></td><td>Danío rerio **</td><td>NM_199532</td><td> 266</td><td>Lo et al., 2003</td>

<td></td><td>Worm</td><td>Caenorhabditis elegans</td><td>Z68749</td><td> 309</td><td>Abbott and col., 1998 Beaudoin et al., 2000</td>

<td></td><td>Algae</td><td>Thraustochytrium aureum **</td><td>AX464802</td><td> 272</td><td>WO 0208401- A2</td>

<td></td><td></td><td>Pavlova lutheri **</td><td></td><td> 320</td><td>WO 03078639</td>

<td>Δ9elongasa</td><td>Algae</td><td>Isochrysis galbana</td><td>AF390174</td><td> 263</td><td>Qi et al., 2002</td>

<td></td><td></td><td>Euglena gracilis</td><td></td><td> 258</td><td>WO 08/128241</td>

<td>Δ5elongasa</td><td>Algae</td><td>Ostreococcus tauri</td><td>AAV67798</td><td> 300</td><td>Meyer and col., 2004</td>

<td></td><td></td><td>Pyramimonas cordata</td><td></td><td> 268</td><td>WO 2010/057246</td>

<td></td><td></td><td>Pavlova sp. CCMP459</td><td>AAV33630</td><td> 277</td><td>Pereira et al., 2004b</td>

<td></td><td></td><td>Saline pavlova</td><td>AAY15135</td><td> 302</td><td>Robert and col., 2009</td>

112

<td></td><td>Diatoms</td><td>Thalassiosira pseudonana</td><td>AAV67800</td><td> 358</td><td>Meyer and col., 2004</td>

<td></td><td>Fish</td><td>Oncorhynchus mykiss</td><td>CAM55862</td><td> 295</td><td>WO 06/008099</td>

<td></td><td>Mosses</td><td>Marchantía polymorpha</td><td>BAE71129</td><td> 348</td><td>Ka j ikawa and col., 2006</td>

* http://www.ncbi.nlm.nih.gov/ ** Function not tested / not demonstrated

Desaturates

As used herein, the term desaturase refers to an enzyme that has the ability to introduce a carbon-carbon double bond into the acyl group of a fatty acid substrate that is typically in an esterified form such as, for example, esters. acyl-CoA. The acyl group can be esterified to a phospholipid such as phosphatidylcholine (PC), or to an acyl transport protein (ACP), or in a preferred embodiment to CoA. Therefore desaturases can generally be categorized into three groups. In one embodiment, the desaturase is a terminal desaturase.

As used herein, an A4-desaturase refers to a protein that carries out a desaturase reaction that introduces a carbon-carbon double bond at the 4^to carbon-carbon bond of the carboxyl end of a fatty acid substrate. The Δ4-desaturase at least has the ability to convert DPA to DHA. Preferably, the Δ4

113 desaturase has the ability to convert DPA-CoA to DHACoA, ie it is an acyl-CoA 'desaturase. In one embodiment, Δ4-desaturase has the ability to convert DPA esterified at the sn-2 position of PC to DHAPC. Preferably the Δ4-desaturase has greater activity on DPA-CoA than on DPA-PC. The desaturation step to produce DHA from 'DPA is catalyzed by a Δ4desaturase in organisms other than mammals, and a gene encoding this enzyme has been isolated from the freshwater protist species Euglena gracilis and the marine species Thraustochytrium. sp. (Qiu et al., 2001; Meyer et al., 2003). In one embodiment, the A4-desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 28, or an A4-desaturase from Thraustochytrium sp., A biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO: 28. In one embodiment, a plant, plant part (such as seed) or cell of, or used in, the invention that produces high levels of DPA, such as between 5% and 35% of the total content of fatty acids that can extracted is DPA, it does not comprise a gene encoding a functional Δ4-desaturase.

As used herein, an A5-desaturase refers to a protein that carries out a reaction of

114 desaturase that introduces a carbon-carbon double bond at 5^to carbon-carbon bond of the carboxyl end of a fatty acid substrate. In one embodiment, the fatty acid substrate is ETA and the enzyme produces EPA. Preferably, the A5-desaturase has the ability to convert ETA-CoA to EPA-CoA, ie it is an acyl-CoA desaturase. In one embodiment, the A5-desaturase has the ability to convert ETA esterified at the sn-2 position of PC. Preferably the Δ5-desaturase has greater activity on ETA-CoA than on ETA-PC. Examples of A5-desaturases are listed in Ruiz-Lopez et al. (2012) and Petrie et al. (2010a) and in Table 1 here. In one embodiment, the A5-desaturase comprises amino acids that have a sequence as provided in SEQ ID NO: 20, a biologically active fragment thereof, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 20. In another embodiment, the Δ5-desaturase comprises amino acids that have a sequence as provided in SEQ ID NO: 22, a biologically active fragment thereof, or an amino acid sequence that is at least 53% identical to SEQ ID NO: 22. In another embodiment, the Δ5-desaturase is from Thraustochytrium sp or Emiliania huxleyi.

As used herein, an A6-desaturase refers to a protein that carries out a reaction of

115 desaturase that introduces a carbon-carbon double bond at 6^to carbon-carbon bond of the carboxyl end of a fatty acid substrate. In one embodiment, the fatty acid substrate is ALA and the enzyme produces SDA. Preferably, A6-desaturase has the ability to convert ALA-CoA to SDA-CoA, ie it is an acyl-CoA desaturase. In one embodiment, the Δ6-desaturase has the ability to convert ALA esterified at the sn-2 position of PC. Preferably the Δ6-desaturase has greater activity on ALA-CoA than on ALA-PC. The Δ6desaturase can also have activity as a Δ5desaturase, being called a bifunctional Δ5 / Δ6 desaturase, provided that it has higher Δ6-desaturase activity on ALA than Δδ-desaturase activity on ETA. Examples of A6-desaturases are listed in Ruiz-Lopez et al. (2012) and Petrie et al. (2010a) and in Table 1 here. Preferred Δ6-desaturases are from Micromonas pusilla, Pythium irregulare, or Ostreococcus taurii.

In one embodiment, the Δδ-desaturase is further characterized by having at least two, preferably all and preferably in a plant cell, of the following: i) higher activity of Δ6-desaturase on α-linolenic acid (ALA, 18 : 3Δ9,12,15, ω3) than on linoleic acid (LA, 18: 2Δ9,12, ω6) as a fatty acid substrate; ii)

116 greater activity of Δδ-desaturase on ALA-CoA as a fatty acid substrate than on ALA attached to the sn-2 position of PC as a fatty acid substrate; and iii) Δ8-desaturase activity on ETrA. Examples of such Δ6-desaturases are provided in Table 2.

In one embodiment, Δδ-desaturase has higher activity on a ω3 substrate than the corresponding ωδ substrate and has activity on ALA to produce octadecatetraenoic acid (stearidonic acid, SDA, 18: 4Δ6,9,12, 15, ω3) with an efficiency of at least 30%, more preferably at least 40%, or more preferably at least 50% when expressed from an exogenous polynucleotide in a recombinant cell such as a plant cell, or at least 3-5% when expressed in a yeast cell. In one embodiment, Δδ-desaturase has higher activity, eg, at least about 2-fold greater activity of Δδ-desaturase, on ALA than LA as a fatty acid substrate. In another embodiment, the Δδ-desaturase has higher activity, for example, at least about 5 times the activity of Δδ-desaturase or at least 10 times the activity, on ALA-CoA as a fatty acid substrate than on bound ALA to the sn-2 position of PC as a fatty acid substrate. In a further embodiment, the Δδ-desaturase has

117 activity on both ALA-CoA fatty acid substrates and on ALA attached to the sn-2 position of PC.

Table 2. Desaturases demonstrated to have activity on

<td>Enzyme</td><td>Type of organism</td><td>Species</td><td>Nos. Of access</td><td>Protein size (aa)</td><td>References</td>

<td>Δ6 desaturase</td><td>Algae</td><td>Mantoniella squamata</td><td>CAQ30479</td><td> 449</td><td>Hoffmann and col., 2008</td>

<td></td><td></td><td>Ostreococcus taurí</td><td>AAW70159</td><td> 456</td><td>Domergue and col., 2005</td>

<td></td><td></td><td>Micromonas pusilla</td><td>EEH58637</td><td></td><td>Petrie and col., 2010a (SEQ ID NO: 7)</td>

<td>Δ5desaturase</td><td>Algae</td><td>Mantoniella squamata</td><td>CAQ30478</td><td> 482</td><td>Hoffmann and col., 2008</td>

<td></td><td>Plants</td><td>Anemone leveillei</td><td>N / A</td><td></td><td>Sayanova and col., 2007</td>

<td>ω3 - desaturase</td><td>Mushrooms</td><td>Pythium aphanidermatum</td><td>FW362186.1</td><td> 359</td><td>Xue et al., 2012; WO2008 / 054565</td>

<td></td><td>Fungi (oomycetes)</td><td>Phytophthora sojae</td><td>FW362214.1</td><td> 363</td><td>Xue et al., 2012; WO2008 / 054565</td>

<td></td><td>Fungi (oomycetes)</td><td>Phytophthora ramorum</td><td>FW362213.1</td><td> 361</td><td>Xue et al. , 2012; WO2008 / 054565</td>

In one embodiment, the Δδ-desaturase has no detectable ΔΒ-desaturase activity on ETA. In another embodiment, the Δδ-desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 9, SEQ ID NO: 12 or SEQ ID NO: 13, a biologically active fragment thereof, or a amino acid sequence that is at least 77% identical to SEQ ID NO: 9, SEQ ID NO: 12 or SEQ ID

118

NO: 13. In another embodiment, the Δδ-desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 12 or SEQ ID NO: 13, a biologically active fragment thereof, or an amino acid sequence that is by at least 67% identical to one or both SEQ ID NO: 12 or SEQ ID NO: 13. The Δ6-desaturase can also have Δδ-desaturase activity.

As used herein, a Δδ-desaturase refers to a protein that carries out a desaturase reaction that introduces a carbon-carbon double bond at the δ^νο carbon-carbon bond of the carboxyl end of a fatty acid substrate. Δδ-desaturase has at least the ability to convert ETrA to ETA. Preferably, the Δδdesaturase has the ability to convert ETrA-CoA to ETACoA, ie it is an acyl-CoA desaturase. In one embodiment, the Δδ-desaturase has the ability to convert ETrA esterified at the sn-2 position of PC. Preferably the Δδ-desaturase has greater activity on ETrA-CoA than on ETrA-PC. A6 * -desaturase can also have activity as a Δδ-desaturase, being called a bifunctional Δδ / Δδ desaturase, provided that it has higher Δδdesaturase activity on ETrA than Δδ-desaturase activity on ALA. Examples of Δδ-desaturases are listed in Table 1. In one embodiment, the

Δδ-desaturase comprises

119 amino acids having a sequence as provided in SEQ ID NO: 37, a biologically active fragment thereof, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 37.

As used herein, a ω3-desaturase refers to a protein that carries out a desaturase reaction that introduces a carbon-carbon double bond at the 3^er carbon-carbon bond of the methyl end of a fatty acid substrate. Therefore an ω3-desaturase can convert LA to ALA and GLA to SDA (all C18 fatty acids), or DGLA to ETA and / or ARA to EPA (C20 fatty acids). Some ω3-desaturases (group I) have activity only on C18 substrates, such as plant and cyanobacterial ω3-desaturases. These o3-desaturases are also Δ15-desaturases. Other ω3-desaturases have activity on C20 substrates with no activity (group II) or some activity (group III) on 018 substrates. Said ω3-desaturases are also A17-desaturases. Preferred ω3-desaturases are of the group III type that convert LA to ALA, GLA to SDA, DGLA to ETA and ARA to EPA, such as the 3-desaturase from Pichia pastoris (SEQ ID NO: 6). Examples of ω3-desaturases include those described by Pereira et al. (2004a) (ω3desaturase from Saprolegnia diclina, group II), Horiguchi et al. (1998), Berberich et al. (1998) and Spychalla et al.

120 (1997) (C. elegans ω3-desaturase, group III). In a preferred embodiment, the 3-desaturase is a fungal ω3-desaturase. As used herein, a fungal ω3-desaturase refers to an ω3-desaturase that is from a fungal source, including a source of oomycetes, or a variant thereof whose amino acid sequence is at least 95% identical to the same. Genes encoding different ω3-desaturases have been isolated from fungal sources such as, for example, Phytophthora infestans (Accession No. CAJ30870, WO2005083053; SEQ ID NO: 47), Saprolegnia diclina (Accession No. AAR20444, Pereira et al., 2004a &amp; US 7211656), Pythium irregulare (WO2008022963, Group II; SEQ ID NO: 49), Mortierella alpina (Sakuradani et al., 2005; Accession No. BAD91495; WO2006019192), Thalassiosira pseudonana (Armbrust et al. , 2004; No. access XP_002291057; WO2005012316, SEQ ID NO: 48), Lachancea kluyveri (also known as Saccharomyces kluyveri; Oura et al., 2004; Accession No. AB118663). Xue et al. (2012) describe ω3-desaturases from the oomycetes Pythium aphanidermatum, Phytophthora sojae, and Phytophthora ramorum that had the ability to efficiently convert ω6 fatty acid substrates to the corresponding ω3 fatty acids, with preference for C20 substrates, that is, they had an A17- activity. desaturase stronger than Δ15 activity

121 desaturase. These enzymes grew from Δ12 desaturase activity, but could use fatty acids in both acyl-CoA and phospholipid fractions as substrates.

In a more preferred embodiment, the fungal ω3-desaturase is the o3-desaturase / A15-desaturase from Pichia pastoris (also known as Komagataella pastoris) (Zhang et al., 2008, - Accession No. EF116884; SEQ ID NO: 6 ), or a polypeptide that is at least 95% identical to it.

In one embodiment, the ω3-desaturase has at least the ability to convert one of ARA to EPA, DGLA to ETA, GLA to SDA, ARA to EPA and DGLA to ETA, ARA to EPA and GLA to SDA, or the three of the same.

In one embodiment, the ω3-desaturase has A17-desaturase activity on a C20 fatty acid that has at least three carbon-carbon double bonds, preferably ARA. In another embodiment, the ω3-desaturase has A15-desaturase activity on a C18 fatty acid that has three carbon-carbon double bonds, preferably GLA. Preferably, both activities are present.

As used herein, an A12-desaturase refers to a protein that carries out a desaturase reaction that introduces a carbon-carbon double bond at 12^vo carbon-carbon bond of the carboxyl end of a

122 fatty acid substrate. The Δ12-desaturases typically convert oleoyl-phosphatidylcholine or oleoyl-CoA to linoleoylphosphatidylcholine (18: 1-PC) or linoleoyl-CoA (18: 1-CoA), respectively. The subclass using the PC-bound substrate is referred to as phospholipid-dependent Δ12-desaturases, the latter subclass as acyl-CoA-dependent Δ12-desaturases. Plant and fungal Δ12-desaturases are generally of the first subclass, while animal Δ12-desaturases are of the last subclass, for example the Δ12-desaturases encoded by genes cloned from insects by Zhou et al. (2008). Many other A12-desaturase sequences can be easily identified by searching a sequence database.

As used herein, a U15-desaturase refers to a protein that carries out a desaturase reaction that introduces a carbon-carbon double bond at the 15^to carbon-carbon bond of the carboxyl end of a fatty acid substrate. Several genes coding for U15-desaturases have been cloned from plant and fungal species. For example, US 5952544 describes nucleic acids encoding plant A15-desaturases (FAD3). These enzymes comprise amino acid motifs that were characteristic of plant A15-desaturases. WO200114538 describes a gene encoding FAD3 from

123 soy. Many other A15-desaturase sequences can be easily identified by searching a sequence database.

As used herein, an A17-desaturase refers to a protein that carries out a desaturase reaction that introduces a carbon-carbon double bond at the I7^mo carbon-carbon bond of the carboxyl end of a fatty acid substrate. A Δ17-desaturase is also referred to as a ω3-desaturase if it acts on a C2 0 substrate to introduce a desaturation at the ω3 bond.

In a preferred embodiment, the A12-desaturase and / or A15-desaturase is a fungal U12-desaturase or fungal Δ15-desaturase. As used herein, a fungal Δ12-desaturase or a fungal U15-desaturase refers to a Δ12-desaturase or A15-desaturase that is from a fungal source, including an oomycete source, or a variant thereof whose sequence amino acid is at least 95% identical to it. Genes encoding different desaturases have been isolated from fungal sources. In US 7211656 a Δ12 desaturase from Saprolegnia diclina is described. WO2009016202 describes fungal desaturases from Helobdella robusta, Lacearia bicolor, Lottia gigantea, Microcoleus chthonoplastes, Monosiga brevicollis, Mycosphaerella fijiensis, Mycospaerella graminicola, Naegleria gruben,

124

Nectria haematococca, Nematostella vectensis, Phycomyces blakesleeanus, Trichoderma resii, Physcomitrella patens, Postia placenta, Selaginella moellendorffii, and Microdochium nivale. WO2005 / 012316 describes a Δ12-desaturase from Thalassiosira pseudonana and other fungi. WO2003 / 099216 describes genes encoding fungal Δ12-desaturases and Δ15-desaturases isolated from Neurospora crassa, Aspergillus nidulans, Botrytis cinerea and Mortierella alpina. WO2007133425 describes fungal Δ15 desaturases isolated from: Saccharomyces kluyveri, Mortierella alpina, Aspergillus nidulans, Neurospora crassa, Fusarium graminearum, Fusarium moniliforme and Magnaporthe grísea. A preferred Δ12 desaturase is from Phytophthora sojae (Ruiz-Lopez et al., 2012).

A distinct subclass of fungal A12-desaturases, and fungal A15-desaturases, are the fungal bifunctional A12 / A15-desaturases. The genes encoding for these have been cloned from Fusarium monoliforme (Accession No. DQ272516, Damude et al., 2006), Acanthamoeba castellanii (Accession No. EF017656, Sayanova et al., 2006), Perkinsus marinus (WO2007042510), Claviceps purpurea (Accession No. EF536898, Meesapyodsuk et al., 2007) and Coprinus cinereus (No. accession AF269266, Zhang et al., 2007).

In another embodiment, the ω3-desaturase has for

125 at least some activity on, preferably more activity on, an acyl-CoA substrate than a corresponding acyl-PC substrate. As used herein, a corresponding acyl-PC substrate refers to the fatty acid esterified at the sn-2 position of phosphatidylcholine (PC) where the fatty acid is the same fatty acid as in the acyl-CoA substrate. For example, the acyl-CoA substrate can be ARA-CoA and the corresponding acyl-PC substrate is sn-2 ARA-PC. In one embodiment, the activity is at least twice as high. Preferably, the ω3-desaturase has at least some activity on an acylCoA substrate and its corresponding acyl-PC substrate and has activity on C18 and C20 substrates. Examples of such ω3-desaturases are known among the fungal desaturases. cloned ones listed above.

In a further embodiment, the ω3-desaturase comprises amino acids that have a sequence as provided in SEQ ID NO: 6, a biologically active fragment thereof, or an amino acid sequence that is at least 60% identical. to SEQ ID N0: 6, preferably at least 90% or at least 95% identical to SEQ ID NO: 6.

In yet another embodiment, a desaturase for use in the present invention has greater activity on an acyl-CoA substrate than a corresponding acyl-PC substrate. In

126 In another embodiment, a desaturase for use in the present invention has greater activity on an acyl-PC substrate than a corresponding acyl-CoA substrate, but has some activity on both substrates. As detailed above, a corresponding acyl-PC substrate refers to the fatty acid esterified at the sn-2 position of phosphatidylcholine (PC) where the fatty acid is the same fatty acid as in the acyl-CoA substrate. In one embodiment, the highest activity is at least twice as high. In one embodiment, the desaturase is a Δ5 or Δ6-desaturase, or a ω3-desaturase, examples of which are provided, by way of example but not limited to, those listed in Table 2. To study on which substrate a desaturase, ie an acyl-CoA or an acyl-PC substrate, assays can be performed on yeast cells as described in Domergue et al. (2003 and 2005). The acyl-CoA substrate capacity for a desaturase can also be inferred when an elongase, when expressed together with the desaturase, has an enzymatic conversion efficiency in plant cells of at least about 90% where the elongase catalyzes the elongation of the product of desaturase. Thus, the Δ5desaturase and Δ4-desaturase expressed from the GA7 construct (see, Example 2, Figure 2 and SEQ ID

127

NO: 1) and variants thereof (Example 3) have the ability to desaturate their respective acyl-CoA, ETA-CoA and DPA-CoA substrates.

Elongases

Biochemical evidence suggests that fatty acid elongation consists of 4 steps: condensation, reduction, dehydration, and a second reduction. In the context of this invention, an elongase refers to a polypeptide that catalyzes the condensation step in the presence of other members of the elongation complex, under suitable physiological conditions. It has been shown that the heterologous or homologous expression in a cell of only the condensation component (elongase) of the elongation protein complex is required for the elongation of the respective acyl chain. Thus, the introduced elongase has the ability to successfully recruit the dehydration and dehydration activities of the transgenic host to carry out successful acyl elongations. The specificity of the elongation reaction with respect to chain length and degree of desaturation of fatty acid substrates is thought to reside in the condensation component. This component is also thought to be the limiting step in the elongation reaction.

As used herein, an A5-elongase has

128 at least the ability to convert EPA to DPA. Examples of A5-elongases include those described in WO2005 / 103253. In one embodiment, A5-elongase has activity on EPA to produce DPA with an efficiency of at least 60%, more preferably at least 65%, more preferably at least 70%, or more preferably at least 80%. or 90%. In a further embodiment, A5-elongase comprises an amino acid sequence as provided in SEQ ID NO: 25, a biologically active fragment thereof, or an amino acid sequence that is at least 47% identical to SEQ ID NO: 25. In a further embodiment, the A6-elongase is from Ostreococcus taurii or Ostreococcus lucimarinus (US2010 / 088776).

As used herein, a Δ6-elongase has at least the ability to convert SDA to ETA. Examples of A6-elongases include those listed in Table 1. In one embodiment, the elongase comprises amino acids having a sequence as provided in SEQ ID NO: 16, a biologically active fragment thereof (such as the fragment provided as SEQ ID N0: 17), or a sequence amino acid that is at least 55% identical to one or both of SEQ ID NO: 16 or SEQ ID NO: 17. In one embodiment, the Δδ-elongase is from Physcomitrella patens (Zank

129 et al., 2002; Accession No. AF428243) or Thalassiosira pseudonana (Ruiz-Lopez et al., 2012).

As used herein, a Δ9-elongase has at least the ability to convert ALA to ETrA. Examples of A9-elongases include those listed in Table 1. In one embodiment, A9-elongase comprises amino acids having a sequence as provided in SEQ ID NO: 29, a biologically active fragment thereof, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 29. In another embodiment, the Δ9-elongase comprises amino acids that have a sequence as provided in SEQ ID NO: 31, a biologically active fragment thereof, or an amino acid sequence that is at least 81% identical to SEQ ID NO: 31. In another embodiment, the A9-elongase comprises amino acids having a sequence as provided in SEQ ID NO: 33, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 33. In another embodiment, the Δ9elongase comprises amino acids that have a sequence as provided in SEQ ID NO: 35, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 35. In a further embodiment, A9-elongase has increased activity

130 on a ω6 substrate than on the corresponding ω3 substrate, or vice versa.

As used herein, the term "has greater activity on a ω6 substrate than the corresponding ω3 substrate" refers to the relative activity of the enzyme on substrates that differ in the action of an ω3 desaturase. Preferably, the ωβ substrate is LA and the ω3 substrate is ALA.

An elongase with Δδ-elongase and A9-elongase activity has at least the ability to (i) convert SDA to ETA and (ii) convert ALA to ETrA and has higher Δδ-elongase activity than A9-elongase activity. In one embodiment, elongase has a conversion efficiency on SDA to produce ETA that is at least 50%, more preferably at least 60%, and / or a conversion efficiency on ALA to produce ETrA that is at least minus 6% or more preferably at least 9%. In another embodiment, elongase has at least about 6.5-fold higher Δδ-elongase activity than Δ9-elongase activity. In a further embodiment, elongase has no detectable Δ5elongase activity.

Other enzymes

The transgenes introduced into the recombinant cell such as a microbial cell, or transgenic plant or part

131 they can also code for a LPAAT. As used herein, the term l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), also called lysophosphatidic acid-acyltransferase or acylCoA-lysophosphatidate acyltransferase, refers to a protein that acylates sn-1acyl-glycerol-3- phosphate (sn-1 G-3-P) at the sn-2 position to form phosphatidic acid (PA). Therefore, the term 1-acyl-glycerol-3-phosphate acyltransferase activity refers to acylation of sn-1 G-3-P at the sn-2 position to produce PA (EC 2.3.1.51). Preferred LPAATs are those that can use a polyunsaturated C22 acyl-CoA as a substrate to transfer the polyunsaturated C22 acyl group to the sn-2 position of LPA, forming PA. In one embodiment, the polyunsaturated C22 acyl-CoA is DPA-CoA. Such LPAATs are exemplified in Example 6 and can be studied as described herein. In one embodiment, a LPAAT useful for the invention comprises amino acids that have a sequence as provided in any of SEQ ID NOs: 40 to 46, a biologically active fragment thereof, or an amino acid sequence that is by at least 40% identical to any one or more of SEQ ID NOs: 40 to 46. In another embodiment, the LPAAT does not have amino acids that have a sequence as provided in SEQ ID NO: 44. In one form of

132 preferred embodiment, a LPAAT useful for the invention that can use a polyunsaturated C22 fatty acyl-CoA substrate, preferably DPA-CoA, comprises amino acids that have a sequence as provided in any of SEQ ID NOs: 41, 42 and 44, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to any one of or more of SEQ ID NOs: 41, 42 and 44. In a preferred embodiment, an LPAAT useful for the invention that can use a polyunsaturated C22 fatty acyl-CoA substrate, preferably DPA-CoA, comprises amino acids that have a sequence as provided in any of SEQ ID NOs: 41 or 42, a biologically active fragment thereof, or an amino acid sequence that is at least 40% identical to either one or both of SEQ ID NOs: 41 and 42. In one embodiment, the LPAAT preferably is the Mortierella alpina LPAAT whose amino acid sequence is indicated as SEQ ID NO: 44 or another LPAAT that has the ability to use DPA-CoA as a substrate to transfer DPA to LPA, forming DPA that has DPA at position sn-2.

Transgenes introduced into the recombinant cell, transgenic plant or part thereof can also code for a DGAT. As used herein, the term diacylglycerol acyltransferase (EC 2.3.1.20; DGAT)

133 refers to a protein that transfers a fatty acyl group from acyl-CoA to a diacylglycerol substrate to produce a triacylglycerol. Therefore, the term "diacylglycerol acyltransferase activity" refers to the transfer of acyl-CoA to diacylglycerol to produce triacylglycerol. There are three known types of DGAT referred to as DGAT1, DGAT2 and DGAT3 respectively. DGAT1 polypeptides typically have 10 transmembrane domains, DGAT2 typically has 2 transmembrane domains, while DGAT3 is typically soluble. Examples of DGAT1 polypeptides include polypeptides encoded by the Aspergillus fumigatus DGAT1 genes (No. access XP_755172), Arabidopsis thaliana (CAB44774), Ricinus communis (AAR11479), Vernicia fordii (ABC94472), Vernonia galamensis (ABV21945, ABV21946), Euonymus alatus (AAV31083), Caenorhabditis noromovegic9 (AAF824 noromovegic9) (AAF824109us elegans sapiens (NP_036211), as well as variants and / or mulants thereof. Examples of DGAT2 polypeptides include polypeptides encoded by the Arabidopsis thaliana DGAT2 genes (No. accession NP_566952), Ricinus communis (ΆΑΥ16324), Vernicia fordii (ABC94474), Mortierella ramanniana (AAK84179), Homo sapiens (Q96PD7, Q58HT5), Bos taurus (Q70VD8), Mus musculus (ΑΆΚ84175), Micromonas also CC variants and / or mulantes of the

134 themselves. Examples of DGAT3 polypeptides include polypeptides encoded by peanut DGAT3 genes (Arachis hypogaea, Saha, et al., 2006), as well as variants and / or mutants thereof.

Polypeptides / Peptides

The terms polypeptide and protein are generally used synonymously.

A polypeptide or class of polypeptide can be defined by the extent of identity (% identity) of its amino acid sequence to a reference amino acid sequence, or by having a greater% identity of one reference amino acid sequence than another. The% identity of a polypeptide with a reference amino acid sequence is typically determined by GAP analysis (Needleman and Wunsch, 1970; GCG program) with parameters of a no-match creation penalty = 5, and an extension penalty of no. coincidence = 0.3. The search sequence is at least 15 amino acids long, and GAP analysis aligns the two sequences in a region of at least 15 amino acids. More preferably, the search sequence is at least 50 amino acids long, and GAP analysis aligns the two sequences in a region of at least 50 amino acids. Most preferably, the search sequence is at least 100 amino acids.

135 in length and GAP analysis aligns the two sequences in a region of at least 100 amino acids. Even more preferably, the search sequence is at least 250 amino acids long and GAP analysis aligns the two sequences in a region of at least 250 amino acids. Even more preferably, GAP analysis aligns two sequences over their entire length. The polypeptide or class of polypeptides may have the same enzymatic activity as, or a different activity from, or lacks the activity of, the reference polypeptide. Preferably, the polypeptide has an enzymatic activity of at least 10%, at least 50%, at least 75% or at least 90%, of the activity of the reference polypeptide.

As used herein a "biologically active fragment" is a portion of a polypeptide defined herein that maintains a defined activity of a full-length reference polypeptide, eg, that possesses desaturase and / or elongase activity or other enzymatic activity. Biologically active fragments as used herein exclude the full length polypeptide. Biologically active fragments can be of any size portion as long as they maintain defined activity. Preferably, the biologically active fragment maintains at least 10%,

136 at least 50%, at least 75% or at least 90%, of the activity of the full-length protein.

With respect to a defined polypeptide or enzyme, it will be appreciated that the figure of% identity greater than those provided herein will encompass preferred embodiments. Therefore, where applicable, in light of the figures of% minimum identity, it is preferred that the polypeptide / enzyme comprises an amino acid sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least minus 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, plus

<td>preferably by</td><td>the</td><td>less</td><td> 99,1%,</td><td>plus</td><td>preferably</td><td>by</td>

<td>least 99.2% plus</td><td colspan="3">preferably</td><td>by</td><td>at least 99.3%,</td><td>plus</td>

<td>preferably by</td><td>the</td><td>less</td><td> 99,4%,</td><td>plus</td><td>preferably</td><td>by</td>

<td>the least 99.5% plus</td><td colspan="3">preferably</td><td>by</td><td>at least 99.6%,</td><td>plus</td>

<td>preferably by</td><td>the</td><td>less</td><td> 99,7%,</td><td>plus</td><td>preferably</td><td>by</td>

137 at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.

The variant / mutant amino acid sequence of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes to a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide. Such variants / mutants include, for example, deletions, insertions or substitutions of residues in the amino acid sequence. A combination of removal, insertion and substitution can be done to obtain the final construct, provided that the final peptide product possesses the desired enzymatic activity.

Mutant (altered) peptides can be prepared using any technique known in the art. For example, a polynucleotide defined herein can be subjected to in vitro mutagenesis or DNA disorder techniques as widely described by Harayama (1998). The products of DNA mutated / altered can be screened using techniques described herein to determine if they possess, for example, desaturase or elongase activity.

In designing mutant amino acid sequences, the location of the mutation site and the nature of the

138 mutation will depend on the characteristic (s) to be modified.

Mutation sites can be modified individually or serially, for example, by (1) substitution first with conservative amino acid alternatives and then 5 with more radical selections depending on the results obtained, (2) removal of the white residue, or (3 ) insertion of other residues adjacent to the localized site.

Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues, and typically about 1 to 5 contiguous residues.

Substitution mutations have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites that are not conserved among naturally occurring desaturases or elongases. These sites are preferably substituted in a relatively conserved manner in order to maintain enzymatic activity. Such conservative substitutions are shown in Table 3 under the heading of exemplary substitutions.

In a preferred embodiment a mutant / variant polypeptide has only, or no more than, one or two or three or

139 four conservative amino acid changes compared to a naturally occurring polypeptide. Details of the conservative amino acid changes are provided in Table 3. As the skilled person would realize, it can be reasonably predicted that such minor changes will not alter the activity of the polypeptide when expressed in a recombinant cell.

Table 3. Examplifying amino acid substitutions.

<td>Original residue</td><td>Exemplary substitutions</td>

<td>Wing (A)</td><td>val; leu; ile; gly</td>

<td>Arg (R)</td><td>lys</td>

<td>Asn (N)</td><td>gln; his</td>

<td>Asp (D)</td><td>glu</td>

<td>Cys (C)</td><td>to be</td>

<td>Gln (Q)</td><td>asn; his</td>

<td>Glu (E)</td><td>asp</td>

<td>Gly (G)</td><td>pro wing</td>

<td>His (H)</td><td>asn; gln</td>

<td>He (I)</td><td>leu; val; to</td>

<td>Leu (L)</td><td>ile; val; met; to; phe</td>

<td>Lys (K)</td><td>arg</td>

<td>Met (M)</td><td>leu; phe</td>

<td>Phe (F)</td><td>leu; val; to</td>

<td>Pro (P)</td><td>giy</td>

<td>Ser (S)</td><td>thr</td>

<td>Thr (T)</td><td>to be</td>

<td>Trp (W)</td><td>tyr</td>

<td>Tyr (Y)</td><td>trp; phe</td>

<td>Val (V)</td><td>ile; leu; met; phe wing</td>

Polynucleotides

The invention also provides the use of polynucleotides that

140 they can be, for example, a gene, an isolated polynucleotide, a chimeric genetic construct such as a T-DNA molecule, or a chimeric DNA. It can be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein, or other materials to carry out a particular activity defined herein. The term polynucleotide is used synonymously herein with the term nucleic acid molecule.

In one embodiment, the polynucleotide is not naturally occurring. Examples of non-naturally occurring polynucleotides include, but are not limited to, those that have been mutated (such as with the use of methods described herein), and polynucleotides in which an open reading frame encoding a protein is operably linked to a promoter with which it is naturally not associated (such as in the constructs described herein).

As used herein, the term gene should be considered in its broadest context and includes the deoxyribonucleotide sequence that comprises the transcribed region and, if translated, the region that encodes the protein, of a structural gene and including sequences located adjacent to the coding region at the 5 'and 3' ends to

141 a distance of at least about 2 kb at each end and that are involved in gene expression. In this sense, the gene includes control signals such as promoters, enhancers, termination and / or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a chimeric gene. Sequences that are located 5 'to the coding region of the protein and that are present in the mRNA are referred to as 5' untranslated sequences. Sequences that are located 3 'or downstream of the protein coding region and that are present in the mRNA are referred to as 3' untranslated sequences. The term gene encompasses cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region that can be interrupted with non-coding sequences called introns or intervening regions or intervening sequences. Introns are segments of a gene that are transcribed into nuclear RNA (nhRNA). Introns can contain regulatory elements such as enhancers. Introns are removed or removed by splicing the nuclear or primary transcript; therefore introns are absent in the messenger RNA (mRNA) transcript. The mRNA works during translation to specify the sequence or order of

142 amino acids in a nascent polypeptide. The term "gene" includes a synthetic or fusion molecule that encodes all or part of the proteins described herein and a nucleotide sequence complementary to any of the foregoing.

As used herein, a chimeric DNA or chimeric genetic construct or the like refers to any DNA molecule that is not a native DNA molecule in its native location, also referred to herein as a DNA construct. Typically, a chimeric DNA or chimeric gene comprises sequences that are regulatory and transcribed or that encode proteins that are not naturally operably linked, that is, they are heterologous to each other. Accordingly, a chimeric DNA or chimeric gene can comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a way different from that found in nature.

An endogenous gene refers to a native gene in its natural location in the genome of an organism. As used herein, recombinant nucleic acid molecule, recombinant polynucleotide, or variations thereof refer to a nucleic acid molecule.

143 that has been constructed or modified by recombinant DNA technology. The terms "foreign polynucleotide or exogenous polynucleotide or heterologous polynucleotide and the like" refer to any nucleic acid that is introduced into the genome of a cell by experimental manipulations. The foreign or exogenous genes can be genes that are inserted into a non-native organism, native genes introduced in a new location in the native host, or chimeric genes. A transgene is a gene that has been introduced into the genome by a transformation procedure. The terms genetically modified, transgenic and variations thereof include introducing genes into cells by transformation or transduction, mutating genes in cells, and altering or modulating the regulation of a gene in a cell or organisms in which these acts or their progeny have been done. . A genomic region as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a set), has been inserted into a cell, or an ancestor thereof. . Such regions only comprise nucleotides that have been incorporated by human intervention such as by methods described herein.

The term "exogenous" in the context of a polynucleotide refers to the polynucleotide when it is present in a

144 cell in an altered amount compared to its native state. In one embodiment, the cell is a cell that does not naturally comprise the polynucleotide. However, the cell can be a cell that comprises a non-endogenous polynucleotide that results in an altered amount of production of the encoded polypeptide. An exogenous polynucleotide includes polynucleotides that have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in said cells or cell-free systems that are subsequently purified. of at least some other components. The exogenous polynucleotide (nucleic acid) can be a contiguous region of naturally occurring nucleotides, or comprise two or more contiguous regions of nucleotides from different sources (naturally occurring and / or synthetic) joined together to form a single polynucleotide. Typically such chimeric polynucleotides comprise at least one open reading frame encoding a polypeptide operably linked to a suitable open reading frame transcription directing promoter in a cell of interest.

Regarding the defined polynucleotides, it will be appreciated that the figures of% identity greater than those

145 provided above will encompass preferred embodiments. Therefore, when applicable, in light of the figures of minimum% identity, it is preferred that the polynucleotide comprises a polynucleotide sequence that is at least 60%, more preferably at least 65%, more preferably at least less 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92 %, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least minus 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.

Polynucleotides may possess, compared to naturally occurring molecules, one or more mutations that are

146 nucleotide residue deletions, insertions, or substitutions. Polynucleotides having mutations relative to a reference sequence can be naturally occurring (i.e. isolated from a natural source) or synthetic (e.g. by site-directed mutagenesis or DNA disorder in the nucleic acid as described above. ). It is therefore clear that the polynucleotides can be from a naturally occurring or recombinant source. Preferred polynucleotides are those that have coding regions that are codon optimized for translation in plant cells, as is known in the art.

Recombinant Vectors

Recombinant expression can be used to produce recombinant cells, or plants or plant parts of the invention. Recombinant vectors contain heterologous polynucleotide sequences, that is, polynucleotide sequences not naturally found adjacent to polynucleotide molecules defined herein that are preferably derived from a different species than the species from which the polynucleotide molecule (s) is derived. The vector can be RNA or DNA and is typically a plasmid. Plasmid vectors typically include additional nucleic acid sequences that provide a

147 easy selection, amplification, and transformation of the expression cassette in prokaryotic cells, for example, vectors derived from pUC, vectors derived from pSK, vectors derived from pGEM, vectors derived from pSP, vectors derived from pBS, or preferably binary vectors containing a or more T-DNA regions. Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites that provide multiple sites for inserting nucleic acid sequences, or genes encoded in the nucleic acid construct, and sequences that enhance the transformation of prokaryotic or eukaryotic cells (especially plants). The recombinant vector may comprise more than one polynucleotide defined herein, for example three, four, five, or six polynucleotides defined herein in combination, preferably a chimeric genetic construct described herein, each polynucleotide being operably linked to control sequences expression that are operable in the cell of interest. Preferably, the expression control sequences include, or are all, heterologous promoters, that is, they are heterologous with respect to the coding regions.

148 that they control. More than one polynucleotide defined herein, for example 3, 4, 5 or 6 polynucleotides, preferably 7 or 8 polynucleotides each encoding a different polypeptide, are preferably covalently linked in a single recombinant vector, preferably in a molecule of Simple T-DNA, which can then be introduced as a simple molecule into a cell to form a recombinant cell according to the invention, and preferably integrated into the genome of the recombinant cell, for example in a transgenic plant. Integration into the genome can be into the nuclear genome or into a plastid genome in the transgenic plant. Therefore, polynucleotides that are linked in this way will be inherited as a single genetic locus in the progeny of the recombinant cell or plant. The recombinant vector or plant may comprise two or more such recombinant vectors, each containing multiple polynucleotides, for example where each recombinant vector comprises 3, 4, 5 or 6 polynucleotides.

"Operatively linked" as used herein refers to a functional relationship between two or more nucleic acid segments (eg, DNA). Typically, it refers to the functional relationship of the transcriptional regulatory element (promoter) with a transcribed sequence. By

149 For example, a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates transcription of the coding sequence in an appropriate cell. Generally, promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, ie, they are cis-acting. However, some transcriptional regulatory elements, such as enhancers, need not be physically contiguous or located in proximity to the coding sequences whose transcription they enhance.

When multiple promoters are present, each promoter can independently be the same or different. Preferably, at least 3 and up to a maximum of 6 different promoter sequences are used in the recombinant vector to control the expression of the exogenous polynucleotides.

Recombinant molecules such as chimeric DNAs or genetic constructs may also contain (a) one or more secretory signals encoding signal peptide sequences, to allow a presently defined expressed polypeptide to be secreted from the cell producing the polypeptide or which provides the location of the expressed polypeptide, for example for retention of

150 polypeptide in the endoplasmic reticulum (ER) in the cell or transfer it to the plastid, and / or (b) contains fusion sequences that lead to the expression of nucleic acid molecules as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion or localization of a polypeptide defined herein. Recombinant molecules can also include intervening and / or untranslated sequences around and / or in the nucleic acid sequences of nucleic acid molecules defined herein.

To facilitate the identification of transformants, the nucleic acid construct desirably comprises a selection or screening marker gene as, or in addition to, the foreign or exogenous polynucleotide. By marker gene is meant a gene that imparts a different phenotype to cells expressing the marker gene and therefore allows such transformed cells to be distinguished from cells that do not have the marker. A selection marker gene confers a trait for which one can select based on resistance to a selective agent (eg, a herbicide, antibiotic, radiation, heat, or other treatment that damages non-transformed cells). A screening marker gene (or reporter gene) confers a trait that one can

151 identify by observation or assay, ie, by screening (eg, β-glucuronidase, luciferase, GFP, or other enzymatic activity not present in non-transformed cells). The marker gene and the nucleotide sequence of interest do not have to be linked. The actual selection of a marker is not crucial as long as it is functional (i.e. selective) in combination with the selection cells such as a plant cell.

Examples of selection markers are markers that confer resistance to antibiotics such as resistance to ampicillin, erythromycin, chloramphenicol or tetracycline, preferably resistance to kanamycin. Exemplary selection markers for the selection of plant transformants include, but are not limited to, a hyg gene encoding resistance to hygromycin B; a neomycin phosphotransferase (nptll) gene that confers resistance to kanamycin, paromomycin, G418; a rat liver glutathione-S-transferase gene that confers resistance to glutathione-derived herbicides such as those described in EP 256223; a glutamine synthetase gene that confers, with its overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, those described in WO 87/05327, an acetyltransferase gene from Streptomyces viridochromogenes that

152 confers resistance to the selective agent phosphinothricin as, for example, described in EP 275957, a gene that codes for a 5-enolshikimate-3-phosphate synthase (EPSPS) that confers tolerance to N-phosphonomethylglycine as, for example, described by Hinchee and cabbage. (1988), or preferably a bar gene conferring resistance against bialaphos as, for example, described in WO91 / 02071.

Preferably, the nucleic acid construct is stably incorporated into the genome of the cell, such as the plant cell. Accordingly, the nucleic acid may comprise appropriate elements that allow the molecule to be incorporated into the genome, preferably the edges of the right and left sequences of a T-DNA molecule, or the construct is placed in an appropriate vector that can be incorporated. on a chromosome of the cell.

Expression

As used herein, an expression vector is a DNA vector that has the ability to transform a cell and to effect the expression of one or more specific polynucleotide molecules. The expression vectors of the present invention can direct the expression of genes in plant cells or in recombinant cells such as microbial cells. The expression vectors useful for the invention contain regulatory sequences such as

153 transcriptional control sequences, translational control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention. In particular, polynucleotides or vectors useful for the present invention include transcriptional control sequences. Transcriptional control sequences are sequences that control the initiation, elongation, and termination of transcription. Particularly important transcriptional control sequences are those that control the initiation of transcription, such as promoter and enhancer sequences. Suitable transcriptional control sequences include any transcriptional control sequence that can function in at least one of the recombinant cells of the present invention. The selection of the regulatory sequences used depends on the target organism such as a plant and / or target organ or tissue of interest. Said regulatory sequences can be obtained from any eukaryotic organism such as plants or plant viruses, or they can be chemically synthesized. A variety of such transcriptional control sequences are known to those of skill in the art. Transcriptional control sequences particularly

154 Preferred are promoters active in the direction of transcription in plants, constitutively or stage and / or tissue specific, depending on the use of the plant or parts thereof.

A number of vectors suitable for the stable transfection of plant cells or for the establishment of transgenic plants have been described in, for example, Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987, - Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Klüwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more plant genes cloned under the transcriptional control of 5 'and 3' regulatory sequences and a dominant selection marker. Such plant expression vectors may also contain a promoter regulatory region (e.g., a regulatory region that controls inducible or constitutive, environmentally or developmentally regulated, or cell or tissue specific expression), a site of initiation of initiation of transcription, a ribosome binding site, an RNA processing signal, a transcription termination site, and / or a polyadenylation signal.

A number of constitutive promoters have been described that

155 they are active in plant cells. Promoters suitable for constitutive expression in plants include, but are not limited to, the 35S promoter from cauliflower mosaic virus (CaMV), the 35S promoter from scrofularia mosaic virus (FMV), and the light-inducible promoter from the small subunit of ribulose-1,5-bis-phosphate carboxylase.

For the purpose of expression in plant source tissues, such as leaf, seed, root, or stem, it is preferred that the promoters used in the present invention have relatively high expression in these specific tissues. Many examples are well known in the art. A variety of plant gene promoters that are regulated in response to environmental, hormonal, chemical, and / or developmental signals can also be used for gene expression in plant cells, or it may also be advantageous to employ organ specific promoters.

As used herein, the term "seed specific promoter or variations thereof" refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a developing seed of a plant, preferably a plant. Brassica sp. , Camelina sativa or G. max. In one embodiment, the seed specific promoter is expressed at least 5 times more potently in the developing seed.

156 of the plant relative to the leaves and / or stems of the plant, and is preferably expressed more potently in the developing seed embryo compared to other plant tissues. Preferably, the promoter only drives the expression of a gene of interest in the developing seed, and / or the expression of the gene of interest in other parts of the plant such as leaves cannot be detected by Northern blot and / or RT-analysis. PCR. Typically, the promoter directs gene expression during seed growth and development, particularly during the phase of synthesis and accumulation of storage compounds in the seed. Said promoters can direct the expression of genes in the entire plant storage organ or only part thereof such as the integument, or cotyledon or cotyledons, preferably in embryos, in seeds of dicotyledonous plants or the endosperm or each aleuron of a seed of monocotyledonous plants.

Preferred promoters for seed-specific expression include i) promoters from genes encoding enzymes involved in the biosynthesis and accumulation of fatty acids in seeds, such as fatty acid desaturases and elongases, ii) promoters from genes encoding storage proteins in seeds, and iii) promoters of genes that code for enzymes involved in the

157 biosynthesis and accumulation of carbohydrates in seeds. Suitable seed-specific promoters are the rapeseed oilseed napin promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO98 / 45461), the phaseolin promoter from Phaseolus vulgaris (US 5,504,200), the Bce4 promoter from Brassica (WO91 / 13980) or the LeB4 promoter from Vicia faba legumin (Baumlein et al., 1992), and promoters that lead to seed-specific expression in monocots such as corn, barley, wheat, rye, rice, and the like. Notable promoters that are suitable are the promoter of the barley lpt2 or lptl gene (WO95 / 15389 and WO95 / 23230) or the promoters described in WO99 / ​​16890 (promoters of the barley hordein gene, the rice glutelin gene, the rice oryzin, rice prolamine gene, wheat gliadin gene, wheat glutelin gene, corn zein gene, oat glutelin gene, sorghum kasirin gene, rye secalin gene). Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US20070192902 and US20030159173. In one embodiment, the seed-specific promoter is preferentially expressed in defined parts of the seed such as the embryo, cotyledon or cotyledons, or the endosperm. Examples of such specific promoters

158 include, but are not limited to, the FP1 promoter (Ellerstrom et al., 1996), the pea legumin promoter (Perrin et al., 2000), the bean phytohemagglutinin promoter (Perrin et al., 2000) , the conlinin 1 and conlinin 2 promoters for the genes encoding flax 2S storage proteins (Cheng et al., 2010), the promoter of the Arabidopsis thaliana FAE1 gene, the BnGLP promoter of the protein-like gene Brassica napus globulin, the LPXR promoter of the Linum usitatissimum peroxyredoxin gene.

The 5 'untranslated leader sequence can be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide of the present invention, or is preferably heterologous to the coding region of the enzyme to be produced, and can be specifically modified if desired to increase the translation of mRNA. For a review of the optimization of transgene expression, see Koziel et al. (nineteen ninety six). The 5 'untranslated regions can also be obtained from plant viral RNAs (tobacco mosaic virus, tobacco etching virus, corn dwarf mosaic virus, alfalfa mosaic virus, etc.) of suitable eukaryotic genes, genes plant (leader of the wheat and corn chlorophyll a / b binding protein gene), or a sequence

159 synthetic gene. The present invention is not limited to constructs where the untranslated region is derived from the 5 'untranslated sequence that accompanies the promoter sequence. The leader sequence could also be derived from an unrelated promoter or coding sequence. Leader sequences useful in the context of the present invention include the maize Hsp70 leader (US 5,362,865 and US 5,859,347), and the omega element of TMV.

Termination of transcription occurs by a 3 'untranslated DNA sequence operably linked in the chimeric vector to the polynucleotide of interest. The 3 'untranslated region of a recombinant DNA molecule contains a polyadenylation signal that acts in plants to cause the addition of adenylate nucleotides to the 3' end of RNA. The untranslated region 3¹ it can be obtained from different genes that are expressed in plant cells. The 3 'untranslated region of nopaline synthase, the 3' untranslated region of the pea Rubisco small subunit gene, and the 3 'untranslated region of the soybean 7S storage protein gene are commonly used with this ability. or a flax conlinin gene. Also suitable are 3 'transcribed, untranslated regions that contain the polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes.

160

Recombinant DNA technologies can be used to enhance the expression of a transformed polynucleotide molecule by manipulating, for example, the copy number of the polynucleotide molecule in a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resulting transcripts are translated, and the effectiveness of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotide molecules defined herein include, but are not limited to, integration of the polynucleotide molecule into one or more chromosomes of the host cell, addition of stability sequences to mRNA, substitutions, or modifications of transcriptional control signals (e.g. promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules to correspond to the codon usage of the host cell, and deletion of sequences that destabilize the transcripts.

Transgenic plants

The term plant as used herein as a

161 noun refers to whole plants, but when used as an adjective it refers to any substance that is present in, derived from, derived from, or related to a plant, such as for example plant organs (for example leaves, stems, roots, flowers), simple cells (eg pollen), seeds, plant cells and the like. The term "plant part" refers to all plant parts that comprise the plant DNA, including vegetative structures such as, for example, leaves or stems, roots, flower organs or structures, pollen, seed, seed parts such as as an embryo, endosperm, scutellum or seed coat, plant tissue such as, for example, vascular tissue, cells and progeny thereof, with the proviso that the part of the plant synthesizes the lipid according to the invention.

A transgenic plant, genetically modified plant, or variations thereof refers to a plant that contains a gene construct (transgene) that is not found in a wild-type plant of the same species, variety, or cultivar. Transgenic plants as defined in the context of the present invention include plants and their progeny that have been genetically modified using recombinant techniques to generate the production of the lipid or at least one polypeptide defined herein.

162 on the desired plant or plant organ. Transgenic plant cells and transgenic plant parts have corresponding meanings. A transgene as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence that has been produced or altered by recombinant DNA or RNA technology and that has been introduced into a plant cell. The transgene may include genetic sequences derived from a plant cell that may be of the same species, variety, or cultivar as the plant cell into which the transgene is introduced or of a different species, variety, or cultivar, or of a different cell of a plant cell. Typically, the transgene has been introduced into the cell, such as a plant, by human manipulation such as, for example, transformation but any method can be used as will be recognized by one of ordinary skill in the art.

The terms seed and grain are used synonymously herein. Grain refers to a mature grain such as harvested grain or grain that is still on a plant but ready for harvest, but also refers to a grain after imbibition or germination, depending on the context. The mature grain or seed commonly has a moisture content of less than about 18-20%, preferably less than 10%. Brassica seed such as

163 Canola seed typically has a moisture content of about 4-8% or 6-8% when mature, preferably between about 4% and about 6%. "Developing seed" as used herein refers to a seed before maturity, typically found in the reproductive structures of the plant after fertilization or anthesis, but can also refer to such seeds before maturity that are isolated from a plant.

As used herein, the term "obtaining a plant part or obtaining a seed" refers to any means of obtaining a plant part or seed, respectively, which includes collecting the plant parts or plant seed in the field or in containers such as a nursery or growth chamber, or by purchase or receipt from a supplier of the plant parts or seed. Standard growing conditions in a nursery include a daytime temperature of 22-24 ° C and a night temperature of 16-18 ° C, with natural sunlight. The seed may be suitable for planting i.e. it has the ability to germinate and produce progeny plants, or alternatively it has been processed in such a way that it no longer has the ability to germinate, for example split, rubbed or ground seed that is useful for applications in food or

164 I think, or for extraction of the lipid of the invention.

As used herein, the term "plant storage organ" refers to a part of a plant specialized in storing energy in the form of, for example, proteins, carbohydrates, fatty acids and / or oils. Examples of plant storage organs are seed, fruit, tuberous roots, and tubers. A preferred plant storage organ is the seed.

The plants or plant parts of the invention or used in the invention are preferably phenotypically normal. As used herein, the term phenotypically normal refers to a genetically modified plant or plant organ, particularly a storage organ such as a seed, tuber, or fruit that does not have a significantly reduced ability to grow and reproduce. compared to an unmodified plant or plant organ. In one embodiment, the genetically modified plant or organ of the plant that is phenotypically normal has an ability to grow or reproduce that is essentially the same as an isogenic plant or organ that does not comprise the exogenous polynucleotide (s). Preferably, biomass, growth rate, germination rate, storage organ size, pollen viability, male and female fertility, size

165 seed and / or the number of viable seeds produced are not less than 90% of that of a plant lacking said exogenous polynucleotide when grown under identical conditions. Preferably the viability of the pollen of the plant of the invention, or plants produced from the seed of the invention, is approximately 100% relative to the viability of the pollen of a corresponding wild type plant. This term does not encompass characteristics of the plant that may be different from those of the wild-type plant but does not affect the utility of the plant for commercial purposes such as, for example, a seedling leaf ballerina phenotype.

Plants provided by or contemplated for use in the practice of the present invention include monocots and dicots. In preferred embodiments, the plants of the present invention are growing plants (eg, cereals and legumes, corn, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or peas), or other legumes. The plants can be grown for the production of edible roots, tubers, leaves, stems, flowers or fruits. Plants can be vegetable or ornamental plants. Plants of, or useful for, the invention may be: corn {Zea mays), ravine {Brassica napus, Brassica rapa spp.), Mustard {Brassica

166 júncea), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolour, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean ( Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoea batatus), cassava (Manihot escalenta), coffee (Cofea spp.), Coconut (Cocos nucifera), pineapple (Anana comosus), citrus tree (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avocado (Persea americana), figs (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), beet (Beta vulgaris), oats, or barley.

In a preferred embodiment, the plant is an angiosperm.

In one embodiment, the plant is an oilseed plant, preferably an oilseed crop plant. As used herein, an oilseed plant is a plant species used for the commercial production of oils from the seeds of the plant. The oilseed plant can be oilseed rape plant (such as rapeseed), corn, sunflower,

167 soybeans, sorghum, flax (linseed) or beets. Furthermore, the oilseed plant can be other than Brassicas, Cotton, Peanut, Poppy, Mustard, Castor, Sesame, Sunflower, Safflower, Camelina, Crambe or Nut-producing plant. The plant can produce high levels of oil in its fruit, such as olive, palm oil, or coconut. Horticultural plants to which the present invention can be applied are vegetable lettuce, endive, or brassicas including cabbage, broccoli, or cauliflower. The present invention can be applied to tobacco, curcubita, carrot, strawberry, tomato, or pepper.

In another preferred embodiment, the non-transgenic plant used to produce a transgenic plant of the invention produces oil, especially in the seed, which has i) less than 20%, less than 10% or less than 5% of fatty acids 18 : 2 and / or ii) less than 10% or less than 5% 18: 3 fatty acids.

In a preferred embodiment, the transgenic plant or part thereof is homozygous for each and every gene (exogenous polynucleotide) that has been introduced (transgene) such that the progeny do not secrete the desired phenotype. The transgenic plant can also be heterozygous for the introduced transgene (s), preferably uniformly heterozygous for the transgene,

168 such as for example in the F1 progeny which have been grown from a hybrid seed. Such plants can provide advantages such as hybrid vigor, well known in the art, or they can be used to cross or backcross 5 plants.

When relevant, the transgenic plant or part thereof may also comprise additional transgenes that encode enzymes involved in the production of LC-PUFAs such as, but not limited to, a Δ61.0 desaturase, an A9-elongase, a A8-desaturase, a Δ6-elongase, an A5-desaturase, a ω3-desaturase, a Δ5elongase, diacylglycerol acyltransferase, LPAAT, a Δ17-desaturase, an A15-desaturase and / or a Δ12-desaturase. Examples of such enzymes with one or more of these activities are known in the art and include those described herein. In specific examples, the transgenic plant comprises at least one set of exogenous polynucleotides encoding;

a) an A5-desaturase, a Δδ-desaturase, a ΔΒ-elongase 20 and a Δ6-elongase,

b) an A5-desaturase, a Δδ-desaturase, an A5-elongase and an A9-elongase,

c) an AS-desaturase, a Δδ-desaturase, a Δδ-elongase, a Δδ-elongase, and a ΔΙΒ-desaturase,

169

<td>d) a Δδ-desaturase, a Δδ-desaturase,</td><td>a</td><td>Δδ-</td>

<td>elongase, an A9-elongase, and a Δΐδ-desaturase,</td><td colspan="2"></td>

<td>e) a Δδ-desaturase, a Δδ-desaturase,</td><td>a</td><td>Δδ-</td>

<td>elongase, a Δδ-elongase, and an A17-desaturase,</td><td colspan="2"></td>

<td>f) a Δδ-desaturase, a Δδ-desaturase,</td><td>a</td><td>Δδ-</td>

<td>elongasa, an A9-elongase, and an A17-desaturase,</td><td colspan="2"></td>

<td>g) a ω3-desaturase or a Δΐδ-desaturase,</td><td>a</td><td>Δ6-</td>

<td>desaturase, a Δδ-desaturase, a Δδ-elongase and</td><td>a</td><td>Δδ-</td>

<td>elongasa,</td><td colspan="2"></td>

<td>h) a ω3-desaturase or a Δΐδ-desaturase,</td><td>a</td><td>Δ8-</td>

<td>desaturase, a Δδ-desaturase, an A9-elongase and</td><td>a</td><td>Δδ-</td>

<td>elongasa,</td><td colspan="2"></td>

<td>i) an A12-desaturase, a ω3-desaturase or</td><td>a</td><td>Δ15-</td>

<td>desaturase, a Δδ-desaturase, a Δδ-desaturase,</td><td>a</td><td>Δ6-</td>

<td>elongase and a Δδ-elongase,</td><td colspan="2"></td>

<td>j) an A12-desaturase, a ω3-desaturase or</td><td>a</td><td>Δ15-</td>

<td>desaturase, a Δδ-desaturase, a Δδ-desaturase,</td><td>a</td><td>Δ9-</td>

elongase and a Δδ-elongase,

k) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a ω3-desaturase, a Δδ-desaturase, a Δ5desaturase, a Δδ-elongase and a Δδ-elongase,

1) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a Δΐδ-desaturase, a Δδ-desaturase, a Δ5desaturase, a Δδ-elongase and a Δδ-elongase,

170

m) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12-desaturase, a Δδ-desaturase, a Δ5desaturase, a Δδ-elongase and a Δδ-elongase,

n) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a Δ12-desaturase, a ω3-desaturase and / or a Δίδdesaturase, a Δδ-desaturase, a Δδ-desaturase, a Δδelongase and a Δδ-elongase,

o) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a «3-desaturase, a Δδ-desaturase, a Δ510 desaturase, an A9-elongase and a Δδ'-elongase,

p) a 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT), a Δΐδ-desaturase, a Δδ-desaturase, a Δ5desaturase, an A9-elongase and a Δδ-elongase,

q) an l-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12-desaturase, a Δδ-desaturase, a Δδdesaturase, an A9-elongase and a Δδ-elongase, or

r) a 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT), an A12-desaturase, a ω3-desaturase and / or a Δ15-desaturase, a Δδ-desaturase, a Δ-desaturase, a Δ920 elongase and a Δδ-elongase .

In one embodiment, the exogenous polynucleotides encode a set of polypeptides that are a Δδ-desaturase from Pythium irregulare, a Δδ-desaturase from Thraustochytrid or a Δδ-desaturase from Emiliana huxleyi, a

171

Δδ-elongase from Physcomitrella pateas, an A5-elongase from Thraustochytrid or an A5-elongase from Ostreocccus taurii and a 3-desaturase from Phytophthora infestans or an o3-desaturase from Pythium irregular.

In one embodiment, the plants of, or used for, the invention were grown in the field, preferably as a population of at least 1,000, 1,000,000, or 2,000,000 plants that are essentially the same, or in a area of ​​at least 1 hectare or 2 hectares. Planting densities differ according to plant species, plant variety, climate, soil conditions, fertilization rates, and other factors known in the art. For example, canola is typically grown with a planting density of between 1.2 and 1.5 million plants per hectare. The plants are harvested as is known in the art, which may comprise furrowing, windrowing and / or harvesting of the plants, followed by shelling and / or separation of the plant material to separate the seed from the rest of the plant parts. the plant frequently in the form of forage. Alternatively, the seed can be collected from plants in the field in a simple process, that is, by combination.

Plant transformation

Transgenic plants can be produced using techniques

172 known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).

As used herein, the terms stable transformation, stably transformed, and variants thereof refer to the integration of exogenous nucleic acid molecules into the genome of the cell so that they are transferred to progeny cells. during cell division without the need to positively select for their presence Stable transformants, or progeny thereof, they can be selected by any means known in the art such as Southern blotting of chromosomal DNA or in situ hybridization to genomic DNA. Preferably, the transformation of plants is carried out as described in the Examples herein.

Agrobacterium-mediated transformation is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues or plant organs or explants in tissue culture, for transient expression or for stable integration of the DNA of

173 genome of plant cells The use of Agrobacterium-mediated plant integration vectors to introduce DNA into plant cells is well known in the art (see for example, US 5177010, US 5104310, US 5004863 or US 5159135) including the methods of flower dip using Agrobacterium or other bacteria that can transfer DNA to plant cells. The DNA region to be transferred is defined by the border sequences, and the intervening DNA (T-DNA) is usually inserted into the plant genome. Furthermore, T-DNA integration is a relatively precise process that results in few rearrangements. In those plant varieties where Agrobacterium-mediated transformation is effective, it is the method of choice due to the easy and defined nature of gene transfer. The vectors for transformation of Agrobacterium impregnated are capable of replicating in E. eolias! as well as Agrobacterium, allowing for convenient manipulations as previously described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer-Verlag, New York, pp. 179-203 (1985) .

Acceleration methods that can be used include, for example, microprojectile bombardment and the like. An example of a method for delivering transforming nucleic acid molecules to plant cells is

174 Microprojectile bombardment. This method has been reviewed in Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) can be coated with nucleic acids and delivered to cells by a propelling force. Examples of particles include those comprising tungsten) gold, platinum, and the like. A particular advantage of microprojectile bombardment, in addition to being an effective means of reproducible monocot transformation, is that protoplast isolation is not required, nor is susceptibility to infection with Agrobacterium.

In another alternative embodiment, plastids can be stably transformed. Disclosed methods for transformation of plastids into higher plants include gun delivery of DNA particles containing a selection marker and targeting of DNA to the plastid genome through homologous recombination (US 5,451,513, US 5,545,818 , US 5,877,402, US 5,932479, and WO99 / ​​05265).

Other methods of cell transformation can also be used and they include, but are not limited to, the introduction of DNA into plants by direct transfer of DNA into pollen, by direct injection.

175 of DNA into the reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by rehydration of the dried embryos.

The regeneration, development, and cultivation of plants from individual plant protoplast transformants or from various transformed explants are well known in the art (Weissbach et al., In: Methods for Plant Molecular Biology, Academia Press, San Diego, Calif. ., (1988). This regeneration and growth process typically includes the steps of selecting transformed cells and culturing individual cells through the usual stages of embryonic development through the rooted seedling stage. Transgenic embryos and seeds regenerate in a similar way. Resulting transgenic rooted shoots are then planted in a suitable plant growth medium such as soil.

The development and regeneration of plants containing the foreign exogenous gene are well known in the art. Preferably, regenerated plants are self-pollinated to provide homozygous transgenic plants.On the other hand, pollen obtained from regenerated plants is crossed with plants grown from seeds of agronomically important lines. On the contrary, pollen from

176 these important line plants are used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well known to one of ordinary skill in the art.

To confirm the presence of the transgenes in transgenic cells and plants, an amplification by polymerase chain reaction (PCR) or Southern blot analysis can be carried out using methods well known in the art. transgenes can be detected in any of a variety of ways, depending on the nature of the product, and include Western blotting and enzyme assay. Once transgenic plants have been obtained, they can be grown to produce plant tissues or parts having the desired phenotype. Plant tissue or plant parts, seeds can be harvested, and / or collected. The seed can serve as a source for growing additional plants with tissues or parts that have the desired characteristics.

A transgenic plant formed using Agrobacteriumu. Other transformation methods typically contain a single genetic locus on a chromosome. Such transgenic plants may be referred to as hemizygous for the or

177 the aggregated genes. Most preferred is a transgenic plant that is homozygous for the aggregated gene (s); that is, a transgenic plant that contains two aggregated genes, one gene at the same locus on each chromosome of a chromosomal pair.A homozygous transgenic plant can be obtained by self-fertilization of a hemizygous transgenic plant, by germinating some of the seeds produced and analyzing the resulting plants for the genes of interest.

It is also to be understood that two different transgenic plants containing two independently segregating exogenous genes or loci can also interbreed (mate) to produce offspring containing both sets of genes or loci. Self-pollination of appropriate Fl progeny can produce plants that are homozygous for both exogenous genes or loci. Backcrossing with a parent plant and crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other methods of crossing can be found. that are commonly used for different traits and crops in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed. , American Society of Agronomy, Madison Wis. (1987).

178

Increased exogenous RNA levels and stabilized expression

Silence Suppressors

In one embodiment, a plant cell, plant, or plant part comprises an exogenous polynucleotide that encodes a suppressor silencing protein.

Post-transcriptional gene silencing (PTGS) is a nucleotide sequence specific defense mechanism that can reach both cellular and viral mRNAs for degradation. PTGS occurs in plants or fungi stably or transiently transformed with foreign (heterologous) or endogenous DNA and results in less accumulation of RNA molecules with sequence similarity to the introduced nucleic acid.

It has been widely considered that coexpression of a silencing suppressor with a transgene of interest will increase the levels of RNA present in the cell that are transcribed from the transgene. While this has been proven to be true for cells in vitro, it has been observed that significant side effects in many whole plant co-expression studies. More specifically, as described in Mallory et al. (2002), Chapman et al. (2004), Chen et al. (2004), Dunoyer et al. (2004), Zhang et al. (2006), Lewsey et al. (2007) and Meng and

179 cabbage. (2008) plants expressing silencing suppressors, generally under constitutive promoters, are often phenotypically abnormal to the extent that they are not useful for commercial production.

It has recently been found that the levels of RNA molecules can be increased, and / or the levels of RNA molecules can be stabilized over numerous generations by limiting the expression of the silencing suppressor to a plant seed or part thereof (WO2010 / 057246). As used herein, A silencing suppressor protein or SSP is any polypeptide that can be expressed in a plant cell that increases the level of expression product from another transgene in the plant cell, in particular over several generations from the initially transformed plant. One embodiment, the SSP is a viral silencing suppressor or mutant thereof. A large number of viral silencing suppressors are known in the art and include, by way of example, but not limited to, P19, V2, P38, Pe-Po and RPV-PO In one embodiment, the viral silencing suppressor comprises amino acids having a sequence as provided in SEQ ID NO: 38, a biologically active fragment thereof, or an amino acid sequence that is at least 50% identical to SEQ ID NO: 38 and that has activity as a

180 squelch suppressor.

As used herein, the terms stabilizing, stably expressed, stabilized expression, and variants thereof refer to the level of the RNA molecule that is essentially the same or greater in progeny plants over repeated generations, for example at least three, at least five or at least 10 generations, compared to isogenic plants that lack the exogenous polynucleotide that codes for the silencing suppressor. However, this or these terms do not exclude the possibility that in repeated generations there is some loss of the levels of the RNA molecule compared to a previous generation, for example not less than 0% loss per generation.

The suppressor can be selected from any source e.g. plant, viral, mammalian, etc. See W02010 / 057246 for a list of viruses from which the suppressor and protein can be obtained (e.g. B2, P14 etc.) or coding region designation for the suppressor of each particular virus. Multiple copies of a suppressor can be used. Different suppressors can be used together (for example, in tandem).

RNA molecules

Essentially any molecule of

181

RNA that is desirable to express in a plant seed with the silencing suppressor. The encoded polypeptides may be involved in the metabolism of oil, starch, carbohydrates, nutrients, etc., or may be responsible for the synthesis of proteins, peptides, fatty acids, lipids, waxes, oils, starches, sugars, carbohydrates, flavorings, odorants, toxins, carotenoids, hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc., preferably in the biosynthesis or assembly of TAG.

In a particular example, the plants produced increased levels of enzymes for oil production in plants such as Brassicas, for example hemp or sunflower, safflower, flax, cotton, soybean, Camelina or corn.

Levels of LC-PUFAs produced

The levels of LC-PUFA or of the combination of LC-PUFA that are produced in the cell or part of the recombinant plant such as a seed, are of importance.The levels can be expressed as a composition (in percent) of the total fatty acid that is a particular LC-PUFA or group of related LC-PUFAs, for example 3 LC-PUFAs or los6 LC-PUFAs, or VLC-PUFAs, or others that can be determined by methods known in the art. The level can also be determined express as

182 a content of LC-PUFA, such as for example the percentage of LC-PUFA in the dry weight of material comprising the recombinant cells, for example the percentage of the seed weight which is made up of LC-PUFA. It will be appreciated that LC-PUFA that is produced in an oil seed can be considerably higher in terms of LC-PUFA content than in a vegetable or a grain that is not grown for oil production, even both can have similar LC-PUFA compositions, and both can be used as sources of LC-PUFA for human or animal consumption.

LC-PUFA levels can be determined by any of the methods known in the art.In a preferred method, total lipids are removed from cells, tissues, or organisms and fatty acids are converted to methyl esters prior to analysis by gas chromatography. (GC). Such techniques are described in Example 1. The position of the peak in the chromatogram can be used to identify each particular fatty acid, and the area under each peak is integrated to determine its amount. As used herein, unless otherwise specified. Otherwise, the percentage of a particular fatty acid in a sample is determined as the area under the peak for that fatty acid as a percentage of the total area for fatty acids on the chromatogram. This corresponds essentially to a percentage

183 by weight (weight by weight) The identity of the fatty acids can be confirmed by GC-MS. Total lipids can be separated by techniques known in the art to purify fractions such as the TAG fraction. For example, analytical-scale thin layer chromatography (TLC) can be performed to separate TAGs from other lipid fractions such as DAGs, acyl-CoAs, or phospholipids in order to determine the specific fatty acid composition of TAGs. .

In one embodiment, the total sum of ARA, EPA, DPA, and DHA in the fatty acids in the extracted lipid is between about 21% and about 40% of the total fatty acids in the cell. In a further embodiment, the total of fatty acids in the cell is less than 1% C20: 1. In preferred embodiments, cell-extractable TAGs comprise fatty acids at the levels referred to herein. Every possible combination of lipid-defining characteristics as described herein is also encompassed.

The level of LC-PUFA production in the recombinant cell, plant, or plant part such as a seed can also be expressed as a percentage conversion of a specific substrate fatty acid to one or more fatty acid products, which is also referred to in present it as one

184 conversion efficiency or enzyme efficiency. This parameter is based on the composition of fatty acids in the lipid extract of the cell, plant, part of the plant or seed, that is, the amount of LC-PUFA formed (including other LC-PUFA derived from it) as a percentage. of one or more fatty acids substrates (including all other fatty acids derived therefrom) The general formula for a percentage conversion is: 100 x (the sum of the percentages of the LC-PUFA product and all the products derived from it) / (the sum of the percentages of the substrate fatty acid and all the products derived from it). With regard to DPA, for example, this can be expressed as the ratio of the level of DPA (as a percentage of the total content of fatty acids in the lipid) to the level of a substrate fatty acid (for example OA, LA, ALA, SDA, ETA or EPA) and all products including DPA derived from the substrate. Percentage conversion or conversion efficiency can be expressed by for a single enzymatic step in a pathway, or for part or the entire pathway.

Specific conversion efficiencies are calculated herein according to the formulas:

one. OA to DPA = 100 x (% DHA +% DPA) / (sum of% for OA, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

185

2. LA to DPA = 100 x (% DHA + DPA) / (sum of% for

LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and

DHA).

3. ALA at DPA = 100 x (% DHA +% DPA) / (sum of% for ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

Four. EPA at DPA = 100 x (% DHA + DPA) / (sum of% for EPA, DPA and DHA).

5. DPA to DHA (A4-desaturase efficiency) = 100 x (% DHA) / (sum of% for DPA and DHA).

6. Δ12-desaturase efficacy = 100 x (sum of% for LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA) / (sum of% for OA, LA, GLA, DGLA , ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

7. Ω3-desaturase efficiency = 100 x (sum of% for

ALA, SDA, ETrA, ETA, EPA, DPA and DHA) / (sum of% for LA, GLA,

DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

8. OA to ALA = 100 x (sum of% for ALA, SDA, ETrA,

ETA, EPA, DPA and DHA) / (sum of% for OA, LA, GLA, DGLA, ARA,

EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

9. Efficacy of Δβ-desaturase (on ω3 ALA substrate) = 100 x (sum of% for SDA, ETA, EPA, DPA and DHA) / (% ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

10. Efficacy of Δδ-elongase (on o3SDA substrate) = 100 x (sum of% for ETA, EPA, DPA and DHA) / (sum of% for

186

SDA, ETA, EPA, DPA and DHA).

eleven. A5-desaturase efficiency (on ω3ΕΤΑ substrate) = 100 x (sum of% for EPA, DPA and DHA) / (sum of% for ETA, EPA, DPA and DHA).

12. A5-elongase efficacy (on ω3ΕΡΑ substrate) = 100 x (sum of% for DPA and DHA) / (sum of% for EPA, DPA and DHA).

The fatty acid composition of the lipid, preferably seed oil, of the invention is also characterized by the ratio of fatty acids ωβ: fatty acids ω3 in the total content of fatty acids, whether for total fatty acids ωβ: total fatty acids ω3 or for new fatty acids ω6: new fatty acids ω3. The terms β total fatty acids, ω3 total fatty acids, new ωβ fatty acids, and new o3 fatty acids have the meanings as defined herein. The proportions are calculated from the fatty acid composition in the lipid extracted from the cell, plant, plant part, or seed, as exemplified herein. It is desirable to have a higher level of fatty acids or 3 than fatty acids εβεη the lipid, and therefore a ratio ωβ: ω3 of less than 1.0 is preferred. A ratio of 0, O indicates a complete absence of the defined ωβ fatty acids; a ratio of 0.03 was achieved. Said casualties

187 proportions can be achieved through the combined use of a Δβ-desaturase having a ω3 substrate preference together with a 3-desaturase, in particular a fungal ω3-desaturase such as the Pichia pastoris ω3-desaturase as exemplified herein.

The yield of LC-PUFAs per seed weight can also be calculated based on the total oil content in the seed and the% APD in the oil. For example, if the oil content of the hemp seed is about 40% (weight by weight) and about 12% of the total fatty acid content of the oil is DPA, the DPA content of the seed is about 4.8% or about 48 mg per gram seed. For a DPA content of approximately 21%, the cañola seed or Camelina sativa seed has a DPA content of approximately 84mg per gram of seed. The present invention therefore provides plants of Brassica napus, B. júncea and Camelina sativa, and seeds obtained therefrom, comprising at least about 80 mg or at least about 84 mg of DPA per gram of seed.The seed has a standard moisture content for a mature seed harvested after its drying (between 4 and 15% humidity). The invention also provides a process for obtaining oil, which comprises obtaining the seed and extracting the

188 oil from the seed, and uses of the oil and methods for obtaining the seed which comprise harvesting the seeds from plants according to the invention.

The amount of DPA produced per hectare can also be calculated if the seed yield per hectare is known or can be estimated. For example, canola in Australia typically yields about 2.5 tonnes of seed per hectare, which at 40% oil content yields about 100kg of oil. For 20.1% DPA and / or DPA in total oil, this provides about 200kg of oil. DPA per hectare. If the oil content is reduced by 50%, this still provides approximately 100 kg of DPA / ha.

To date, the evidence suggests that some desaturases expressed heterologously in yeast or plants have relatively low activity in combination with some elongases. This can be improved by providing a desaturase with an ability to use an acyl-CoA form of the fatty acid as a substrate. in the synthesis of LC-PUFA, and this is believed to be advantageous in recombinant cells particularly plant cells. A particularly advantageous combination for efficient DPA synthesis is a fungal 3-desaturase, for example such as the Pichia pastoris ω3-desaturase (SEQ ID NO: 6), with a 66-desaturase having a preference for substrates.

189 or 3-acylotals such as, for example, Micromonas pusilla A6-desaturase (SEQ ID NO: 9), or variants thereof that have at least 95% amino acid sequence identity.

As used herein, the term "essentially free" means that the composition (e.g. lipid or oil) comprises little (e.g., less than about 0.5%, less than about 0.25%, less than about 0.1% , or less than about 0.01%) or none of the defined component.In one embodiment, essentially free means that the component is undetectable using a routine analytical technique, for example a specified fatty acid (such as ω6 docosapentaenoic acid) cannot be detected using gas chromatography as described in Example 1.

In one embodiment, the extracted lipid, extracted oil, a plant or part thereof such as a seed (of the invention or used in a process / method of the invention), a food, or a composition of the invention does not comprises all-cis-6,9,12,15,18-heneicosapentaenoicp (n3 HPA) acid.

Oil production

Techniques that are routinely practiced in the art can be used to extract, process, and analyze oils

190 produced by the cells, plants, seeds, etc., of the present invention. Typically, plant seeds are cooked, pressed, and extracted to produce crude oil, which is then degummed, refined, bleached, and deodorized. In general, techniques for breaking seeds are known in the art, for example oil seeds can be tempered by spraying them with water to raise the moisture content to, for example, 8.5%, and cut into sheets using a fine roller with a cutting gap between 0.23 and 0.27 mm. Depending on the type of seed, no water may be added before breaking. The application of heat deactivates enzymes, facilitates cell rupture, gathers the drops of oil, and agglomerates the protein particles, all of which facilitate the extraction process.

In one embodiment, most of the seed oil is released by passage through a screw press. The cakes made in the screw press are then solvent extracted, for example hexane, using a heat column. As an alternative, The crude oil produced by the pressing operation can be passed through a settling tank with a top ribbed hose drain to remove the solids that are squeezed out with the oil during the pressing operation. Clarified oil can be passed through a filter

191 plate and frame to remove remaining fine solid particles. If desired, the oil that is recovered from the extraction process can be combined with the clarified oil to produce a mixed crude oil.

Once the solvent is removed from the crude oil, the pressed and extracted portions are combined and subjected to normal oil processing procedures. As used herein, the term purified when used in connection with the lipid or oil of the crude oil. Invention typically means that the extracted lipid or oil has undergone one or more processing steps to increase the purity of the lipid / oil component. For example, A purification step may comprise one or more or all of those from the group consisting of: degumming, deodorizing, decolorizing, drying, and / or fractionating the extracted oil. However, as used herein, the term "purified" does not include the transesterification process or other process that alters the fatty acid composition of the lipid or oil of the invention in order to increase the DPA content as a percentage of the total fatty acid content. In other words, the fatty acid composition of the purified lipid or oil is essentially the same as that of the crude oil or lipid.

192

Degummed

Degumming is an early step in the refinement of oils and its primary purpose is to remove most of the phospholipids from the oil, which can account for approximately 1 to 2% of the total lipid extracted. The addition of ~ 2% water, typically containing phosphoric acid, between 70 and 80 ° C to the crude oil results in the separation of most of the phospholipids accompanied by trace metals and pigments. The insoluble material that is removed is primarily a mixture of phospholipids and triacylglycerols and is also known as lecithin. Degumming can be accomplished by adding concentrated phosphoric acid to crude seed oil to convert the non-hydratable phosphatides to a hydratable form, and to chelate minor metals that are present. The gum is separated from the seed oil by centrifugation.

Alkali refining

Alkali refining is one of the refining processes for treating crude oil, sometimes also called neutralization. It usually follows degumming and precedes bleaching. After degumming, the seed oil can be treated by adding a sufficient amount of an alkaline solution to titrate all the fatty acids and phosphoric acids, and to remove the soaps that form.

193

Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate, and ammonium hydroxide. This process is typically carried out at room temperature and removes the fatty acid fraction. The soap is removed by centrifugation or by extraction in a soap solvent, and the neutralized oil is washed with water. If required, excess alkali in the oil can be neutralized with a suitable acid such as hydrochloric acid or sulfuric acid.

Whitening

Bleaching is a refining process where the oil is heated between 90 and 120 ° C between 10 and 30 minutes in the presence of a bleaching earth (between 0.2 and 2.0%) and in the absence of oxygen by operation with nitrogen or steam. or empty. This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol, etc.), and the process also removes oxidation products, trace metals, sulfur compounds, and traces of soap.

Deodorization

Deodorization is a treatment of oils and greases at a high temperature (between 200 and 260 ° C) and low pressure (between 0.1 and 1 mm Hg). This is typically achieved by

194 introduction of steam into the seed oil at a rate of approximately 0.1 ml / minute / 100 ml of seed oil After approximately 30 minutes of spraying, The seed oil is allowed to cool under vacuum. The seed oil is typically transferred to a glass container and treated with argon before being stored under refrigeration. This treatment improves the color of the seed oil and removes most of the volatile substances or odoriferous compounds including any of the free fatty acids, monoacylglycerols, and oxidation products.

Winterization

Winterization is a process sometimes used in commercial oil production for the separation of oils and fats into solid (stearin) and liquid (olein) fractions by crystallization at sub-ambient temperatures. It was originally applied to cottonseed oil to produce a solids-free product. It is typically used to decrease the saturated fatty acid content of oils.

Transest erification

As used herein, transesterification refers to a process that exchanges the fatty acids within and between the TAGs or transfers the fatty acids to another alcohol to form an ester. This may initially involve the release of fatty acids from the TAGs as acids

195 free fatty acids or it can directly produce fatty acid esters, preferably methyl esters or ethyl fatty acid esters. In a transesterification reaction of TAG with an alcohol such as methanol or ethanol, the alkyl group of the alcohol forms an ester linkage with the acyl groups (including DPA) of the TAG. When combined with a fractionation process, transesterification can be used to modify the fatty acid composition of lipids (Marangoni et al., 1995). Transesterification can use chemical means (for example catalyzed by strong acid or base) or enzymatic, where the latter uses lipases that can be position specific (specific for sn-1/3 or sn-2) for the fatty acid of TAG, or that they have a preference for some fatty acids over others (Speranza et al, 2012). Fractionation of fatty acids to increase the concentration of LC-PUFA in an oil can be done by any of the methods known in the art, such as, for example, freeze crystallization, complex formation using urea, molecular distillation, supercritical fluid extraction, Counterionic chromatography and complexation with silver ions. Complexing with urea is a preferred method for its simplicity and effectiveness in reducing the level of saturated fatty acids and

196 monounsaturated in oil (Gamez et al., 2003). Initially, the TAGs in the oil are separated into their constituent fatty acids, often in the form of fatty acid esters, by hydrolysis under acid or base catalyzed reaction conditions, whereby one mole of TAG is reacted thereby less 3 moles of alcohol (for example ethanol for ethyl esters or methanol for methyl esters) with excess alcohol used to allow separation of the formed alkyl esters and the glycerol that is also formed, or by lipases. These free fatty acids or fatty acid esters, which are not usually altered in fatty acid composition by treatment, can then be mixed with an ethanolic urea solution for complex formation. Saturated or monounsaturated fatty acids easily complex with urea and crystallize out on cooling, and can subsequently be removed by filtration. The fraction not complexed with urea is then enriched with LC-PUFA.

Foods

The present invention includes compositions that can be used as foods. For the purposes of the present invention, foods include any food or preparation for human or animal consumption that when taken by the

197 body (a) serves to nourish or build tissues or provide energy; and / or (b) maintain, restore or support adequate nutritional status or metabolic function. Foods of the invention include nutritional compositions for infants and / or young children such as, for example, infant formula, and seed-based food of the invention .

The foods of the invention comprise, for example, a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention, or a composition together with one or more appropriate carriers. The term carrier is used in its broadest sense to encompass any component that may or may not have nutritional value. Experienced persons will appreciate that the carrier may be suitable for (or in a sufficiently low concentration) in a food so that it has no deleterious effects on an organism that consumes the food.

The food of the present invention comprises an oil, fatty acid ester, or fatty acid produced directly or indirectly for use in the methods, cells, or plants disclosed herein. The composition may be or

198 either in solid or liquid form. In addition, the composition may include edible macronutrients, protein, carbohydrate, vitamins, and / or minerals in amounts desired for a particular use.The amounts of these ingredients will vary depending on whether the composition is intended for use with normal individuals © for use with individuals who have special needs, such as individuals suffering from metabolic disorders and the like.

Examples of suitable carriers with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates, and proteins.Examples of such edible fats include, but are not limited to, coconut oil, borage oil , fungal oil, black currant oil, soybean oil, and mono and diglycerides. Examples of such carbohydrates include (but are not limited to): glucose, edible lactose, and hydrolyzed starch. In addition, examples of proteins that can be used in the nutritional composition of the invention include (but are not limited to) soy proteins, electrodialyzed whey, electrodialyzed skim milk, whey, or the hydrolysates of these proteins.

With regard to vitamins and minerals, they can be

199 add the following to the food compositions of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E, D, C, and the B complex. Other vitamins and minerals can also be added.

The components that are used in the food compositions of the present invention can be of semi-purified or purified origin. Semi-purified or purified refers to a material that has been prepared by purification of a natural material or by de novo synthesis.

A food composition of the present invention can also be added to meals even when dietary supplementation is not required.For example, the composition can be added to meals of any type, including (but not limited to): margarine, butter modified, cheeses, milk, yogurt, chocolate, candies, sandwiches, salad oils, cooking oils, cooking fats, meat, fish and beverages.

In addition, the fatty acids that are produced in accordance with the present invention or the host cells transformed to contain and express the genes of the invention can be used as supplements to animal feed to alter the fatty acid composition of animal tissue, egg or milk to a higher level. desirable for human or animal consumption.

200 examples of such animals include sheep, cattle, horses, birds such as chickens, and the like.

Furthermore, the foods of the invention can be used in aquaculture to increase the levels of fatty acids in fish or crustaceans such as, for example, shrimp for human or animal consumption. The favorite fish are salmon.

The preferred foods of the invention are plants, seed and other plant parts such as leaves and stems that can be used directly as food or food for humans or other animals. For example, animals can graze directly on said field-grown plants or can be fed more measured amounts in controlled feeding. The invention includes the use of said plants and plant parts as food to increase LC-PUFA levels in humans and other animals.

In one embodiment, a food is infant formula comprising the lipid or oil of the invention. As used herein, infant formula means a composition of non-natural origin that satisfies at least a portion of the nutritional requirements of an infant. An infant means a human subject with an age ranging from birth to not more than one year of age and includes 0 to 12 months of corrected age. The phrase age

201 corrected means the infant's chronological age minus the amount of time the infant was born preterm. Therefore, the corrected age is the age of the infant if it had come to term. As used herein, non-naturally occurring means that the product is not found in nature but has been produced by human intervention. As used herein, the infant formula of the invention excludes pure human breast milk (Koletzko et al., 1988) and pure milk produced by non-human animals, although the infant formula of the invention may comprise components derived from milk such as protein or dairy carbohydrates, for example, whey or lactose. The infant formula of the invention excludes naturally occurring meats such as beef, seal meat, whale meat, or fish, although the infant formula of the invention may comprise components such as proteins from these sources. The infant formula of the invention always comprises lipid comprising the DPA of the invention, preferably at a level of between 0.05% to about 0.5% by weight of the total fatty acid content. DPA can be present as TAG, as phospholipid, or as unesterified fatty acid, or a mixture thereof. The lipid or oil of the invention can be

202 incorporating into infant formula using procedures known in the art. For example, an expert can easily produce infant formula of the invention generally using the procedures described in WO 2008/027991, US20150157048, US2015094382 and US20150148316, where the DPA is added in addition to, or in place of, one or more of the fatty acids polyunsaturated described -in them.

In one example, the infant formula comprises DPA (i.e., omega-3 DPA as described herein), optionally with prebiotics, especially polydextrose (PDX) and galacto-oligosaccharides (GOS), lactoferrin from a non-human source, and other acids. long chain polyunsaturated fats (LC-PUFAs). In some embodiments, the nutritional composition further comprises SDA and / or gamma-linolenic acid (GLA). In certain embodiments, the infant formula comprises up to about 7 g / 100 kcal from a fat or lipid source, more preferably about 3 g / 100 kcal to about 7 g / 100 kcal from a fat or lipid source, where the fat or lipid source comprises at least about 0.5 g / 100 kcal, and more preferably from about 0.5 g / 100 kcal to about 7 g / 100 kcal; up to approximately 7 g / 100 kcal of a protein or protein equivalent source, plus

203 preferably about! g / 100 kcal to approximately 7 g / 100 kcal from a protein source or protein equivalent source; and at least about 5 g / 100 kcal of a carbohydrate, more preferably about 5 g to about 25 g / 100 kcal of a carbohydrate. The infant formula may further comprise one or more or all of the) at least about 10 mg / 100 kcal of lactoferrin, more preferably from about 10 mg / 100 kcal to about 200 mg / 100 kcal of lactoferrin; 2) approximately 0.1 g / 100 kcal to approximately! g / 100 kcal of a prebiotic composition comprising PDX and GOS; and 3) at least about 5 mg / 100 kcal of an additional LC-PUFA (i.e. an LC-PUFA other than DPA) comprising DHA, more preferably about 5 mg / 100 kcal to about 75 mg / 100 kcal of an LC- Additional PUFA comprising DHA.

In one embodiment, the ratio of DPA: DHA in the total fatty acid content of the infant formula is between 1: 3 and 2: 1. EPA may also be present, but is preferably absent. If present, the ratio of EPA: DPA in total fatty acid content is preferably less than 1: 2, more preferably less than 1: 5. ARA may also be absent, but is preferably present, preferably in the ratio

204 of ARA: DPA in the content of total fatty acids between 1: 3 and 2: 1. More preferably, the levels of each LC-PUFA in the lacquer formula are approximately the same as those found in any human breast milk, which naturally exhibits variation as a function of the mother's age, genetic factors, dietary intake, and nutritional status. . For example, see Koletzko et al. (1988). In a preferred embodiment, the lacquer formula does not contain detectable levels of heneicosapentaenoic acid (ΗΡΑ, 21: 5ω3)

Infant formula can refer to, for example, liquids, powders, gels, pastes, solids, concentrates, suspensions or ready-to-use forms of enteric formulas, oral formulas, infant formulas.

Prebiotics useful in the present disclosure may include polydextrose, powdered polydextrose, lactulose, lactose-sucrose, raffinose, gluco-oligosaccharide, inulin, fructo-oligosaccharide, isomalto-oligosaccharide, soy oligosaccharides, lactosaccharide, xyl-oligosaccharide, chito-oligosaccharide , aribino-oligosaccharide, sialyl-oligosaccharide, fuco-oligosaccharide, galactooligosaccharide and gentio-oligosaccharides.

Lactoferrin can also be included in the nutritional composition of the present disclosure.

205

Laslactoferrines are approximately 80 kD single chain polypeptides than 1-4 glycans, depending on the species. The en3-D structures of lactoferrin from different species are very similar, but not identical. Each lactoferrin comprises two homologous lobes, called N and C lobes, referring to the N-terminal part and the C-terminal part of the molecule, respectively.

The protein source or protein equivalent can be any used in the art, for example, skim milk, whey protein, casein, soy protein, hydrolyzed protein, amino acids, and the like. Sources of bovine milk protein useful in practicing the present disclosure include, but are not limited to, milk protein powders, milk protein concentrates, milk protein isolates, skim milk solids, skim milk, skim milk powder, whey protein, whey protein isolates, whey protein concentrates, sweet whey, acid whey, acid casein, caseinate (for example, sodium caseinate, sodium calcium caseinate, calcium caseinate) and any combination thereof.

Suitable carbohydrate sources can be any used in the art, for example lactose, glucose, fructose, corn syrup solids, maltodextrins,

206 sucrose, starch, rice syrup solids, and the like. The amount of carbohydrate components in the nutritional composition is at least about 5 g / 100 kcal and typically can range from about 5 g to about 25 g / 100 kcal. In some embodiments, the amount of carbohydrate is between about 6 g and about 22 g / 100 kcal. In other embodiments, the amount of carbohydrate is between about 12 g and about 14 g / 100 kcal. In some embodiments, corn syrup solids are preferred. In addition, hydrolyzed, partially hydrolyzed, and / or extensively hydrolyzed carbohydrates may be desirable for inclusion in the nutritional composition due to their easy digestibility. Specifically, hydrolyzed carbohydrates are less likely to contain allergenic epitopes. Non-limiting examples of carbohydrate materials suitable for use herein include hydrolyzed or intact, naturally or chemically modified starches of corn, tapioca, rice or potato, in waxy or non-waxy form. Non-limiting examples of suitable carbohydrates include various hydrolyzed starches characterized as hydrolyzed cornstarch, maltodextrin, maltose, corn syrup, dextrose, corn syrup solids, glucose, and various other glucose polymers.

207 and combinations thereof. Non-limiting examples of other suitable carbohydrate sources include those often referred to as sucrose, lactose, fructose, higher fructose corn syrup, indigestible oligosaccharides such as fructooligosaccharides, and combinations thereof.

Preferably, one or more vitamins and / or minerals can also be added to the infant formula in amounts sufficient to satisfy the daily nutritional requirements of a subject. One skilled in the art will understand that vitamin and mineral requirements will vary, for example, depending on the age of the child. The nutritional composition may optionally include, but is not limited to, one or more of the following vitamins or derivatives thereof: vitamin B1 (thiamine, thiamine pyrophosphate, TPP, thiamine triphosphate, TTP, thiamine hydrochloride, thiamine mononitrate), vitamin B2 (riboflavin, flavin mononucleotide, FMN, adenine flavin dinucleotides, FAD, lactoflavin, ovoflavin) vitamin B3 (niacin, nicotinic acid, nicotinamide, niacinamide, adenine and nicotinamide dinucleotides, NAD, nicotinic acid mononucleotides, NicMN, pyridine-3-carboxylic acid), tryptophan vitamin B3 precursor, vitamin B6 (pyridoxine, pyridoxal, pyridoxamine, pyridoxine hydrochloride), pantothenic acid (pantothenate, panthenol), folate (folic acid,

208 folacin, pteroylglutamic acid), vitamin B12 (cobalamin, methylcobalamin, deoxyadenosylcobalamin, cyanocobalamin, hydroxycobalamin, adenosylcobalamin), biotin, vitamin C (ascorbic acid), vitamin A (retinol, retinyl acetate, retinyl palmitate with other retinyl esters, long-chain fatty, retinal, retinoic acid, retinol esters), vitamin D (calciferol, cholecalciferol, vitamins, 1,25, -dihydroxyvitamin D), vitamin E (α-tocopherol, Dea-tocopherol acetate, a-tocopherol succinate, deatocopherol nicotinate, a-tocopherol), vitamin K (vitamin Kl, phylloquinone, naphthoquinone, vitamin K2, menaquinone-7, vitamin K3, menaquinone-4, menadione, menaquinone-8, menaquinone- 8H, menaquinone-9, menaquinone-9H, menaquinone10, menaquinone-11, menaquinone-12, menaquinone-13), choline, inositol, β-carotene and other combinations thereof. In addition, the nutritional composition may optionally include, but is not limited to, one or more of the following minerals or derivatives thereof: boron, calcium, calcium acetate, calcium gluconate, calcium chloride, calcium lactate, calcium phosphate, calcium sulfate, chloride, chromium, chromium chloride, chromium picolonate, copper, copper sulfate, copper gluconate, cupric sulfate, fluoride, iron, carbonyl iron, ferric iron, ferrous fumarate, ferric orthophosphate, iron grinding,

209 polysaccharide iron, iodide, iodine, magnesium, magnesium carbonate, magnesium hydroxide, magnesium oxide, magnesium stearate, magnesium sulfate, manganese, molybdenum, phosphorus, potassium, potassium phosphate, potassium iodide, potassium chloride, acetate of potassium, selenium, sulfur, sodium, docusate sodium, sodium chloride, sodium selenate, sodium molybdate, zinc, zinc oxide, zinc sulfate, and mixtures thereof. Exemplary non-limiting derivatives of mineral compounds include salts, alkali salts, esters, and chelates of any mineral compound. Minerals can be added to nutritional compositions in the form of salts such as calcium phosphate, calcium glycerol phosphate, sodium citrate, potassium chloride, potassium phosphate, magnesium phosphate, ferrous sulfate, zinc sulfate, cupric sulfate, manganese sulfate, and sodium selenite. Additional vitamins and minerals can be added as known in the art.

In one embodiment, the infant formula of, or produced using the invention, does not comprise human or animal breast milk or an extract thereof comprising DPA.

In another embodiment, the level of omega-6 DPA in the total fatty acid content of the infant formula is less than 2%, preferably less than 1%, or

210 between 0.1% and 2%, more preferably it is absent.

Compositions

The present invention also encompasses particulate pharmaceutical compositions comprising one or more of the resulting fatty acids and / or oils which are produced using the methods of the invention, preferably in the form of ethyl esters of fatty acids.

A pharmaceutical composition may comprise one or more of the fatty acids and / or oils, in combination with a standard, well-known, non-toxicpharmaceutically acceptable carrier, adjuvant or vehicle such as phosphate buffered saline, water, ethanol, polyols, vegetable oils, an agent. humectant or an emulsion such as a water / oil emulsion. The composition may be in liquid or solid form. For example, the composition may be in the form of a tablet, capsule, injectable, digestible liquid or powder, or topical ointment or cream. Appropriate fluidity may be maintained, for example, by maintaining the desired particle size in the case of dispersions and through the use of surfactants. It may also be desirable to include isotonic agents, eg, sugars, sodium chloride, and the like. In addition to such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifiers, and

211 suspending agents, sweetening agents, flavoring agents and perfuming agents.

Suspensions, in addition to active compounds, may comprise suspending agents such as isostearyl ethoxylated alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth or mixtures of these substances.

Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art. For example, the fatty acids produced in accordance with the present invention can be compressed with conventional tablet bases such as lactose, sucrose, and cornstarch. in combination with binders such as acacia, corn starch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipients in a gelatin capsule together with antioxidants and the fatty acid (s) of interest.

For intravenous administration, the fatty acids produced in accordance with the present invention or derivatives thereof can be incorporated into commercial formulations.

A typical dosage of a particular fatty acid is

212 0.1 mg to 20 g, taken between one and five times per day (up to 100 g per day) and preferably is in the range of between about 10 mg and about 1, 2, 5, or 10 g per day (taken in a or multiple doses) .As is known in the art, a minimum of about 300 mg / day of fatty acid, especially LC-PUFA, is desirable. However, it is to be appreciated that any amount of fatty acid will be beneficial to the subject. .

Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteric (eg, oral and rectal) and parenteral. For example, a liquid preparation can be administered orally or rectally. In addition, a homogeneous mixture can be dispersed. Completely in water, mix under sterile conditions with physiologically acceptable diluents, preservatives, buffers, or propellants to form a spray or inhalant.

The dosage of the composition to be administered to the patient can be determined by a person skilled in the art and depends on various factors such as the weight of the patient, age of the patient, general health of the patient, past history of the patient, immune status of the patient. , etc.

Furthermore, the compositions of the present invention may

213 used for cosmetic purposes. They can be added to pre-existing cosmetic compositions to form a mixture, or a fatty acid produced according to the present invention can be used as the only active ingredient in a cosmetic composition.

EXAMPLES

Example 1 Materials and methods

Gene expression in plant cells in a transient expression system

Exogenous genetic constructs were expressed in plant cells in a transient expression system essentially as described in Voinnet et al. (2003) and Wood et al. (2009).

Fatty Acid Gas Chromatography (GC) Analysis

FAME were analyzed by gas chromatography using an Agilent Technologies 7890A GC (Palo Alto, California, USA) equipped with a SGE-BPX70 30m column (70% cyanopropyl polysylphenylene-siloxane, 0.25mm internal diameter , 0.25mm film thickness), an FID, one splitter / non-splitter inlet and one Agilent Technologies 7693 Series autosampler and injector Helium was used as carrier gas Samples were injected in splitter mode (50: 1 ratio) at oven temperature of 150

214 ° C. After injection, the oven temperature was kept at 50 ° C for 1 min, then raised to 210 ° C at 3 ° C / min, again raised to 240 ° C at 50 ° C / min and finally maintained for 1 , 4 min at 240 ° C. Peaks were quantified with the Agilent Technologies ChemStation program (Rev B.04.03 (16), Palo Alto, California, USA) based on the response of the known quantity of the external standard GLC411 ( Nucheck) and the internal standard C17: 0-ME.

Lipid analysis by liquid chromatography10 mass spectrometry (LC-MS)

Total lipids were extracted from freeze-dried developing seeds, twelve days after flowering (daf), and mature seeds after adding a known amount of tri-C17: 0-TAG as an internal quantification standard. The extracted lipids were dissolved in 1 mL of mM hydroxytoluene butylatedolO in butanol: methanol (1: 1 v / v) per 5 mg of dry material and were analyzed using an Agilent 1200 series LC and a quadrupole LC-MS with trile electrospray ionization 6410b. Lipids were separated chromatographically using an Ascentis Express RP-Amide column. (50 mm x 2.1 mm, 2.7 pm, Supelco) operating with a binary gradient with a flow rate of 0.2 mL / min. The mobile phases were: A. 10 mM ammonium formate in H2O: methanol: tetrahydrofuran ( 50:20:30 v / v / v); B.

215 10 mM ammonium formate in H2O: methanol: tetrahydrofuran (5:20:75, v / v / v) Multiple reaction monitoring lists (MRM) were based on the following major fatty acids: 16: 0, 18: 0, 18: 1, 18: 2, 18: 3, 18: 4, 20: 1, 20: 2, 20: 3, 20: 4, 20: 5, 22: 4, 22: 5, 22: 6 using collision energy of 30 V and fragmentor of 60 V. Individual MRM TAGs were identified based on precursor ion with ammonium and ionic product from neutral loss of 22: 6. quantified using an external standard of μΜ tristearin. .

Lipid profile by LC-MS

Total lipids extracted were analyzed using an Agilent 1200 series LC coupled to an Agilent 6410B electrospray ionization QQQ-MS (Agilent, Palo Alto, California, USA). A 5 pL injection volume of each total lipid extract was separated by chromatography with a 50 mm x 2.1 mm, 2.7 pm Ascentis Express RP-Amide HPLC column (Sigma-Aldrich, Castle Hill, Australia) using a binary gradient with a flow rate of 0.2 mL / min The mobile phases were: A. 10 mM ammonium formate in H₂O: methanol: tetrahydrofuran (50:20:30, v / v / v.); B.

10 mM ammonium formate in Η₂Ο: methanol: tetrahydrofuran (5:20:75, v / v / v.). Selected neutral lipids (TAG and DAG) and phospholipids (PL, including

216

PC, PE, PI, PS, PA, PG) by multiple reaction monitoring (MRM) using a collision energy of 30 V and a fragmentation energy of 60 V. Neutral lipids were analyzed for the following major fatty acids: 16: 0 (palmitic acid), 18: 0 (stearic acid), 18: 1ω9 (oleic acid, OA), 18: 2ω6 (linoleic acid, LA), 18: 3ω3 (alinolenic acid, ALA), 18: 4ω3 ( stearidonic acid, SDA), 20: 1, 20: 2, 20: 3, 20: 4ω3, 20: 5ω3, 22: 4ω3, 22: 5ω3, 22: 6ω3, while phospholipids containing the species Cie, Cie, C20 and C22 with double bonds of 0-3, 0-4, 0-5, 46 respectively.

TAG was identified by MRM based on ammoniated precursor ion and the ion product of the neutral loss of 20: 1, SDA, EPA and DHA was quantified. TAG and DAG using 50 μΜ of tristearin and distearin as external standards. PL were quantified with 10μΜ of di-18: 0-PC, di-17: 0-PA, di17: 0-PE, 17: 0-17: 1-PG, di-18: I-PI and di-17 : 0-PS as external standards (Avanti Polar Lipids, Alabaster, Alabama, USA). In addition, selected species of TAG, DAG and PL were confirmed by Agilent 6520 Q-TOF MS / MS.

Determination of seed fatty acid profile and oil content

To determine the oil content of the seeds, the seeds were dried in a desiccator for 24 h and

217 They transferred approximately 4 mg of seed to a 2 ml glass vial containing Teflon-lined screw cap. 0.05 mg of triheptadecanoin dissolved in 0.1 ml of toluene was added to the vial as an internal standard.

Seed FAME were prepared by adding 0.7 ml of IN methanolic HC1 (Supelco) to the vial containing the seed material, vortexed briefly, and incubated at 80 ° C for 2h. After cooling to room temperature, 0.3 ml of 0.9% NaCl (w / v) and 0.1 ml of hexano were added to the vial and mixed well for 10 min in a Heidolph Vibramax 110. The FAME were collected in a 0, glass insert. 3 ml and analyzed by GC with a flame ionization detector (FID) as mentioned previously.

The peak areas of the individual FAME were first corrected based on the peak area responses of known amounts of the same FAME present in a commercial standard GLC-411 (NU-CHEK PREP, INC., USA). GLC-411 contains equal amounts of 31 fatty acids (% by weight), in the range between C8: O and C22: 6. In the case of fatty acids, which were not present in the standard, the inventors took the peak area responses of the most similar FAME. For example, the 16: ld9 DMARD peak area response was used for 16: ld7 and the C22: 6 DMARD response was used for C22: 5. The corrected areas were used for

218 calculate the mass of each FAME in the sample by comparison with the mass of the internal standard. The oil is stored mainly in the form of TAG and its weight was calculated based on the weight of the FAME. The total moles of glycerol were determined by calculating the moles of each FAME and dividing the total moles of the FAME by three. The TAG was calculated as the sum of the glycerol and fatty acyl portions using a relationship: % oil by weight = 100x ((41x total moles of FAME / 3) + (total g of FAME- (15x total moles of FAME))) / g of seed, where 41 and 15 are the molecular weights of the glyceroly portion of the methyl group, respectively.

Sterol content analysis of oil samples

Samples of approximately! 0 mg of oil were saponified along with an added aliquot of C24: 0 monol as internal standard using 4mL of 5% KOH in 8% MeOH and heating for 2h at 80 ° C in a pink-capped glass tube. After cooling the reaction mixture, 2mL of Milli-Q water were added and the sterols were extracted in 2 mL of hexane: dichloromethane (4: 1 v / v) by shaking and vortexing. The mixture was centrifuged and the sterols were removed and washed with 2 mL of Milli-Q Water. Then the sterols extract was removed by shaking and

219 centrifugation. The extract was evaporated using a stream of nitrogen gas and the sterols were silylated using 200mL of BSTFA and heating for 2h at 80 ° C.

For the Analysis of sterols by GC / GC-MS, the sterol-OTMSi derivatives were dried under a stream of nitrogen gas in a heating block at 40 ° C and then redissolved in chloroform or hexane immediately before analysis by GC / GC-MS. Sterol-OTMS derivatives were analyzed by gas chromatography (GC) using an Agilent Technologies 6890A GC (Palo Alto, California,

USA) with a Supelco Equity fused silica capillary column^TM-l (15 mx 0.1 mm id, 0.1 μm film thickness), one FID, one splitter / no splitter injector, and one Agilent Technologies 7683B 15 Series autosampler and injector. The carrier gas was Helium. Samples were injected in dividerless mode at an oven temperature of 120 ° C. After injection, the oven temperature was raised to 270 ° C at 0 ° C min *¹and finally at 300 ° C to 5 ° C min^-1. Peaks were quantified with Agilent Technologies 20 ChemStation (Palo Alto, California, USA). GC results are subject to an error of ± 5% of the individual component areas.

GC-mass spectrometric (GC-MS) analyzes were carried out on a Finnigan Thermoquest GCQ GC-MS and a Finnigan

220

Thermo Electron Corporation GC-MS; Both systems including a column injector and the Thermoquest Xcalibur program (Austin, Texas, A capillary column of polarity similar to that previously described was placed in each GC. Individual components were identified using mass spectral data and by comparison of retention time data with those obtained by authentic standards. and laboratory. A full procedural blank analysis was performed concurrently with the batch of samples.

RT-PCR conditions

Reverse transcription PCR (RT-PCR) amplification was typically carried out with the Superscript III OneStep RT-PCR system (Invitrogen) in a volume of 25 pL using 10 pmol of the forward primer and 30 pmol of the reverse primer, MgSO4a concentration. 2.5 mM final, 400 ng total RNA with buffer and nucleotide components according to the manufacturer's instructions. Typical temperature regimes were: Icycle 45 ° C for 30 minutes for reverse transcription to occur; then I cycle 94 ° C for 2 minutes followed by 40 cycles of 94 ° C for 30 seconds, 52 ° C for 30 seconds, 70 ° C for 1 minute; then cycle at 72 ° C for 2 minutes before cooling the reaction mixtures to 5 ° C.

221

Determination of transgene copy number by digital PCR

To determine the copy number of transgenes in a transgenic plant, a digital PCR method was used as follows. This method can also be used to determine if a plant was transgenic for the genetic constructs described herein. Approximately one square centimeter of leaf area was harvested from each individual plant and placed in a collection microtube (Qiagen). The samples were then freeze-dried between 24 and 48 hours. To break up the samples for DNA extraction, stainless steel spheres were added to each dry sample and the tubes were shaken on a Qiagen Tissue lysis kit. 375pL of extraction buffer (0.1M Tris-HCl pH8, 0.05M EDTA at pH8 and 1.25% SDS) were added to each tube, the mixtures were incubated at 65 ° C for 1 hour, and They were then cooled before adding 187pL of 6M ammonium acetate (4 ° C) to each tube with vigorous shaking. The samples were then centrifuged for 30 min at 3000 rpm. The supernatant from each tube was transferred to new microtubes each containing 220pl of isopropanol for the precipitation of DNA at room temperature for 5 min. DNA was collected by centrifuging the tubes at 3000 rpm for 30 min, the DNA pellets were washed with 320 pL of 70% ethanolal and dried.

222 before resuspending the DNA in 225 pL of water. Undissolved material was pelleted by centrifugation at 3000 rpm for 20 min, and 150 pL of each supernatant was transferred to 96-well plates for long-term storage.

For efficient and quantitative digital PCR (ddPCR) the DNA was digested with restriction enzymes prior to the amplification reactions, to ensure that the multiple copies of the transgenes or the multiple insertions were physically separated. Therefore, aliquots of the DNA preparations were digested with EcoRI and BamHI, together, in volumes of 20 pL using 10x buffer for BcoRI, 5 pL of DNA and approximately 4 units of each enzyme per sample, incubated overnighta 37 ° C.

The primers that were used in these PCR reactions were designed using the Primer3 program to confirm that the primers of the target and reference genes would not interact, or that such interaction would not be a problem under the conditions used. The reference gene that was used in the test was the Hmg (high mobility group) gene of canola, present in one gene per caninola genome (Weng et al., 2004). Because the cañola is an allotetraploid, it was assumed that there were 4 copies of the Hmg gene, or 2 alleles of each of the two genes, in Brassica napus.

223

Reference gene reactions used the primer pair and a dual labeled probe, as follows: Forward primer, CanilGCGAAGCACATCGAGTCA (SEQ ID NO: 50); Reverse primer, Canl2GGTTGAGGTGGTAGCTGAGG (SEQ ID NO: 51); Probe, Hmg-P35'-Hex / TCTCTAC / zen / CCGTCTCACATGACGC / 3IABkFQ / -3 '(SEQ ID NO: 52). The size of the amplification product was 73 bp.

In a target gene amplification reaction that detected a region of the PPT selection marker gene to screen all transgenic plants, the direct primer was Canl7, ATACAAGCACGGTGGATGG (SEQ ID NO: 53); the reverse primer, Canl8TGGTCTAACAGGTCTAGGAGGA (SEQ ID N0: 54 ); the probe, PPT-P35 '/ FAM / TGGCAAAGA / zen / GATTTCGAGCTTCCTGC / 3IABkFQ / -3' (SEQ ID NO: 55). The size of this target gene amplification product was 82bp. In some cases, an assay for a second target gene was carried out in parallel to detect partial insertions of the T-DNA. This second assay detected a region of the A6-desaturase gene using a forward primer, Can23CAAGCACCGTAGTAAGAGAGCA (SEQ ID NO: 56), the reverse primer, Can24CAGACAGCCTGAGGTTAGCA (SEQ ID NO: 57); the probe, D6des-P35 '/ FAM / TCCCCACTT / zen / CTTAGCGAAAGGAACGA / 3IABkFQ / -3' (SEQ ID NO: 58). The size of this target gene amplification product was 89bp. Reactions routinely used 2pL

224 of the digested DNA preparations. The reaction composition per sample was: forward reference primer (10 pM), 1 pL; reverse reference primer (10 pM), 1 pL; reference gene probe (10 pM), 0.5 pL; target gene forward primer (10 pM), 1 pL; target gene reverse primer (10 pM), 1 pL; target gene probe (10 pM), 0.5 pL; ddPCR Reagent Mix, 12.5 pL; water 5.5 pL in a total volume of 25 pL.

The mixtures were then placed in a QX100 drop generator, which partitioned each sample into 20,000 nanoliter size drops. This was done in 8-well cartridges until all samples were processed and transferred to a 96-well PCR plate. This plate was then sealed with a pierceable foil using a plate sealing machine. The samples were then treated under the following reaction conditions: 95 ° C, 10 min, with a ramp of 2.5 ° C / s; then 39 cycles of 94 ° C, 30s with a ramp of 2.5 ° C / s; 61 ° C, 1 min, with a ramp of 2.5 ° C / s; 98 ° C, 10 min, followed by cooling to 2 ° C. Following the DNA amplification reactions in the drops, the plate was placed in a QXIOO drop reader that analyzed each drop individually using a two-color detection system (configured to detect FAM or Hex). The digital PCR data in droplets was viewed as a 1-D plot with each droplet of a sample plotted on the

225 fluorescence intensity graph, or a 2-D graph where fluorescence (FAM) is plotted against fluorescence (Hex) for each drop. The program measured the number of positive and negative droplets for each fluorophore (FAM or Hex) in each sample. The program then adjusted the fraction of positive droplets to a Poisson algorithm to determine the concentration of the target DNA molecule in units of copies / pL of sample. The variation in copy number was calculated using the formula: CNV = (Ά / Β) * Nb, where A = concentration of target gene, B = concentration of reference gene, and Nb = 4, the number of copies of the reference gene in the genome.

Pollen viability assessment

Fluorescein diacetate (FDA) was dissolved in acetone at 2 mg / ml to provide a stock solution. Dilutions of FDA were prepared just before use by adding drops of the stock solution of FDA to 2 ml of a sucrose solution (0.5 M) until reaching the saturation indicated by the appearance of a persistent cloudiness.

Propidium iodide (PI) was dissolved in mg / ml sterile distilled water to provide a stock solution. Just prior to use, 100 pL of the stock solution was added to Oml of sterile distilled water to make a working solution. To verify the proportion of viable and unleashable pollen,

226 they mixed the PI and PDA stock solutions in a 2: 3 ratio.

Wild-type and transgenic rapeseed and mustard plants were grown under standard conditions in a greenhouse at 22 + 2 ° C with a photoperiod of 16hr per day. Ripe flower buds that were ready to open the next day were marked and harvested the next morning between 9 and 10 am. Pollen from open flowers was stained with the FDA / PI mixture and visualized using a Leica MZFLIII fluorescence microscope. GFP-2, a 510 nm long pass emission filter (transmitting red and green light) with an excitation filter at 480/40 nm was used to detect viable and novicable pollen. The bride pollen that took the PI staining appeared red under the fluorescence microscope while the viable pollen appeared bright green when stained with PI and FDA.

Example 2: Stable expression of a transgenic DHA pathway in Camelina sativa seeds

The binary vector pJP3416-GA7 (see Figure 2 and SEQ ID NO: 1) was introduced as previously described in A. turnefaciens of strain AGL1 and cells from a culture of the transformed Agrobacterium were used to treat flowering C. sativa plants using a method of floral immersion for its transformation (Lu and Kang, 2008) .After growth and

227 During the maturation of the plants, the Ti seeds were harvested from the treated plants, they were sown in the soil and the resulting plants were treated by spraying with the BASTA herbicide to detect plants that were transgenic, and that express, the selection marker gene bar present in the TDNA of pJP3416 -GA7. Tique plants were tolerant to the herbicide, they were grown to maturity after being allowed to self-fertilize, and the resulting T2 seeds were harvested. Five transgenic plants were obtained, only three of which contained the complete T-DNA.

Lipids were extracted from a pool of approximately twenty seeds from each of the three plants containing the complete T-DNA. Two of the pooled samples contained very low, barely detectable levels of DHA, but the third pool contained approximately 4.7% DHA. Therefore, The lipids were extracted from the individual T2 seeds of this plant and the fatty acid composition was analyzed by GC. The data of the fatty acid composition of the individual seeds for this transformed line is also shown in Table 4. The data compiled from profiles of total seed lipid (Table 4) are shown in Table 5.

DHA in six of the individual seeds. The other four seeds had no DHA and were presumed to be

228 Null segregates that did not have T-DNA, based on the hemizygosity of the insertion of T-DNA in the parental plant. Lipids extracted from individual seeds with the highest level of DHA had 9.0% DHA while the sum of the percentages for EPA, DPA and DHA was 11.4%.

Table 4. Fatty acid composition of total seed lipids of T2 transgenic Camelina sativa seeds transformed with the T-DNA of pJP3416-GA7. Fatty acid composition is shown for a grouped seed lot (FD5.46) and for 10 individual seeds ranked (left to right) from highest to lowest DHA content.

K¡ or

<td>Fatty acid</td><td>FD5,46 grouped</td><td> # 2</td><td> # 4</td><td> * 8</td><td> # 7</td><td> # 9</td><td> # 1</td><td> # 3</td><td> # 5</td><td> * 6</td><td> # 10</td>

<td> 14:0</td><td> 0</td><td> 0,2</td><td> 0,2</td><td> 0,1</td><td> 0,2</td><td> 0,2</td><td> 0,2</td><td> 0,2</td><td> 0,1</td><td> 0,2</td><td> 0,2</td>

<td> 16:0</td><td> 11, 6</td><td> 12,1</td><td> 12,3</td><td> 12,1</td><td> 13,2</td><td> 12,3</td><td> 12,8</td><td> 11, 9</td><td> 11,4</td><td> 11,5</td><td> 11,7</td>

<td> 16:1</td><td> 0,2</td><td> 0,0</td><td> 0,1</td><td> 0,1</td><td> 0,0</td><td> 0,2</td><td> 0,0</td><td> 0,2</td><td> 0,2</td><td> 0,2</td><td> 0,2</td>

<td> 16:3</td><td> 0,3</td><td> 0</td><td> 0, 0</td><td> 0,0</td><td> 0,0</td><td> 0, 0</td><td> 0,0</td><td> 0, 0</td><td> 0, 0</td><td> 0, 0</td><td> 0,0</td>

<td> 18:0</td><td> 3,7</td><td> 3,3</td><td> 3,2</td><td> 3,2</td><td> 3,0</td><td> 3,1</td><td> 3,2</td><td> 3, 3</td><td> 3,1</td><td> 3,2</td><td> 3,2</td>

<td> 18:1</td><td> 10,8</td><td> 8,0</td><td> 8, 0</td><td> 8,6</td><td> 8,5</td><td> 9,4</td><td> 11,0</td><td> 10,2</td><td> 8,3</td><td> 9,4</td><td> 8,6</td>

<td>18: ldll</td><td> 1,7</td><td> 1,3</td><td> 1, 4</td><td> 1, 4</td><td> 1,7</td><td> 1,4</td><td> 1, 5</td><td> 1,3</td><td> 1,3</td><td> 1, 3</td><td> 1,3</td>

<td> 18:2</td><td> 24,7</td><td> 18,2</td><td> 19,5</td><td> 19,2</td><td> 18,5</td><td> 20,1</td><td> 23,8</td><td> 32,2</td><td> 30,3</td><td> 29,8</td><td> 31, 6</td>

<td>18: 3ω3</td><td> 27,4</td><td> 26,7</td><td> 26, 6</td><td> 27,3</td><td> 28,9</td><td> 28,2</td><td> 27,4</td><td> 28,3</td><td> 29,2</td><td> 29,5</td><td> 28,2</td>

<td>18: 3ω6</td><td> 0,2</td><td> 1,4</td><td> 0, 3</td><td> 0,3</td><td> 0,4</td><td> 0,2</td><td> 0, 5</td><td> 0, 0</td><td> 0, 5</td><td> 0, 4</td><td> 0, 6</td>

<td> 20:0</td><td> 1,6</td><td> 1,4</td><td> 1,3</td><td> 1,4</td><td> 1,2</td><td> 1,4</td><td> 1,4</td><td> 1,8</td><td> 2,1</td><td> 1,9</td><td> 2,0</td>

<td>18: 4ω3</td><td> 2,2</td><td> 6,8</td><td> 6,4</td><td> 5,7</td><td> 7,2</td><td> 5,7</td><td> 4,1</td><td> 0, 0</td><td> 0, 0</td><td> 0, 0</td><td> 0, 0</td>

<td>20: ldll</td><td> 5,3</td><td> 4,4</td><td> 4,6</td><td> 4,8</td><td> 3,3</td><td> 4,1</td><td> 3, 5</td><td> 4, 4</td><td> 6,1</td><td> 5, 8</td><td> 5,5</td>

229

Cn in

<td>20: smooth</td><td> 0, 4</td><td> 0,3</td><td> 0, 3</td><td> 0,3</td><td> 0,3</td><td> 0,3</td><td>ο Ο</td><td> 0,5</td><td> 0, 6</td><td> 0,5</td><td> 0,5</td>

<td>20: 2ω6</td><td> 0, 8</td><td> 0,8</td><td> 0, 9</td><td> 0, 8</td><td> 0, 6</td><td> 0,8</td><td> 0,7</td><td> 1,3</td><td> 1,5</td><td> 1,4</td><td> 1,4</td>

<td>20: 3ω3</td><td> 0, 6</td><td> 0, 8</td><td> 0, 8</td><td> 0,8</td><td> 0,7</td><td> 0, 8</td><td> 0,7</td><td> 0, 6</td><td> 0,7</td><td> 0, 7</td><td> 0, 6</td>

<td> 22:0</td><td> 0, 4</td><td> 0,5</td><td> 0,5</td><td> 0,5</td><td> 0, 4</td><td> 0,5</td><td> 0,5</td><td> 0, 6</td><td> 0,6</td><td> 0,6</td><td> 0,6</td>

<td>20: 4ω3</td><td> 0,2</td><td> 0, 3</td><td> 0,3</td><td> 0,3</td><td> 0,4</td><td> 0,4</td><td> 0,5</td><td> 0, 0</td><td> 0, 0</td><td> 0, 0</td><td> 0, 0</td>

<td> 22:1</td><td> 1,1</td><td> 1,1</td><td> 1,2</td><td> 1,1</td><td> 0, 5</td><td> 0,9</td><td> 0,8</td><td> 1, 6</td><td> 2,2</td><td> 1,9</td><td> 2,0</td>

<td>20: 5ω3</td><td> 0,7</td><td> 1, 3</td><td> 1,6</td><td> 1,5</td><td> 1,6</td><td> 1,1</td><td> 1,7</td><td> 0,0</td><td> 0, 0</td><td> 0, 0</td><td>ο, ι</td>

<td>22: 2ω6.</td><td> 0,1</td><td> 0, 0</td><td> 0, 0</td><td> 0,0</td><td> 0, 0</td><td> 0,0</td><td> 0,0</td><td> 0,2</td><td> 0, 3</td><td> 0,2</td><td> 0,2</td>

<td>22: 4ω6 + 22: 3ω3</td><td> 0,3</td><td> 0,2</td><td> 0,3</td><td> 0,3</td><td> 0,0</td><td> 0, 3</td><td> 0, 0</td><td> 0,4</td><td> 0, 6</td><td> 0,5</td><td> 0,5</td>

<td> 24:0</td><td> 0, 3</td><td> 0,3</td><td> 0,3</td><td> 0,3</td><td> 0, 0</td><td> 0,3</td><td> 0,0</td><td> 0,4</td><td> 0, 4</td><td> 0,4</td><td> 0,4</td>

<td> 24:1</td><td> 0,3</td><td> 0, 4</td><td> 0, 4</td><td> 0,3</td><td> 0, 0</td><td> 0, 3</td><td> 0, 0</td><td> 0,5</td><td> 0, 6</td><td> 0, 5</td><td> 0, 5</td>

<td>22: 5ω3</td><td> 0, 3</td><td> 1,1</td><td> 1,2</td><td> 1,1</td><td> 1,1</td><td> 0,9</td><td> 0,8</td><td> 0,0</td><td> 0,0</td><td> 0,0</td><td> 0,0</td>

<td>22: 6ω3</td><td> 4,7</td><td> 9,0</td><td> 8,5</td><td> 8,3</td><td> 8,3</td><td> 7,1</td><td> 4,9</td><td> 0,0</td><td> 0,0</td><td> 0,0</td><td> 0,0</td>

23C

231

Table 5. Data compiled from transgenic seed seed total lipid profiles as shown in Table 4. The calculations do not include the 'minor fatty acids' from Table 4.

<td>OR</td><td>0Ί</td><td>co</td><td> &lt;0</td><td></td><td></td><td></td>

<td>rd</td><td>faith</td><td></td><td> 03</td><td></td><td></td><td>OJ</td>

<td></td><td> 03</td><td> 03</td><td>or.</td><td></td><td>faith.</td><td>faith</td>

<td>4b</td><td>oq</td><td>CO</td><td>OR</td><td>rd</td><td>OR</td><td>i heard</td>

<td></td><td></td><td> 03</td><td>THE</td><td>THE</td><td></td><td></td>

<td> «0</td><td></td><td>faith</td><td>σι</td><td>OR</td><td></td><td></td>

<td></td><td>or</td><td>rd</td><td></td><td></td><td></td><td></td>

<td>4b</td><td>co</td><td>CO</td><td>or</td><td>rd</td><td>or</td><td>OI</td>

<td></td><td>σι</td><td> &lt;0</td><td>fxl</td><td>in</td><td></td><td></td>

<td>tf)</td><td></td><td>faith</td><td>in</td><td>or</td><td></td><td>in</td>

<td></td><td>ch</td><td>OJ</td><td></td><td></td><td></td><td> ..</td>

<td></td><td>CM</td><td>in</td><td>or</td><td>rd</td><td>or</td><td>&lt;N</td>

<td></td><td>σϊ</td><td></td><td>L0</td><td></td><td></td><td></td>

<td> &lt;*&gt;</td><td></td><td>w</td><td>CO</td><td>H</td><td></td><td> 10</td>

<td></td><td> 03</td><td> 03</td><td>X.</td><td>faith</td><td></td><td></td>

<td>4b</td><td>oq</td><td> 03</td><td>OR</td><td>rd</td><td>or</td><td>rd</td>

<td></td><td>rd</td><td></td><td>OR</td><td> 04</td><td></td><td></td>

<td>rd</td><td>w</td><td></td><td>MD</td><td> &lt;0</td><td></td><td>CN</td>

<td></td><td>or</td><td>THE</td><td>faith</td><td>faith</td><td>OJ</td><td></td>

<td>4b</td><td></td><td>oq</td><td>rd</td><td>OR</td><td>rd</td><td>rd</td>

<td></td><td>cq</td><td></td><td>CTi</td><td> 03</td><td>OR)</td><td></td>

<td>σι</td><td></td><td></td><td>or</td><td></td><td>faith</td><td></td>

<td></td><td>Sf</td><td>τΉ</td><td>faith</td><td>faith</td><td>THE</td><td></td>

<td>4b</td><td></td><td>oq</td><td>CN</td><td>OR</td><td>rd</td><td>rd</td>

<td></td><td>cq</td><td>the</td><td>r-</td><td>OR</td><td>L0</td><td></td>

<td>r *</td><td></td><td>"or</td><td></td><td></td><td>faith</td><td></td>

<td></td><td> 03</td><td>ch</td><td>x.</td><td>faith</td><td> 03</td><td></td>

<td>4b</td><td>Tf</td><td>rd</td><td></td><td>OR</td><td>rd</td><td>rd</td>

<td></td><td></td><td> 03</td><td>&lt;N</td><td>the</td><td>σ</td><td></td>

<td> 00</td><td></td><td></td><td></td><td></td><td>faith</td><td>rd</td>

<td></td><td>THE</td><td>OR</td><td></td><td>or.</td><td>k0</td><td>s</td>

<td>4b</td><td></td><td>OJ</td><td>i heard</td><td>OR</td><td>rd</td><td>rd</td>

<td></td><td></td><td>C-</td><td>σ&gt;</td><td> &lt;0</td><td></td><td></td>

<td>xr</td><td>x.</td><td>faith</td><td>rd</td><td></td><td></td><td>OJ</td>

<td></td><td>THE</td><td>OR</td><td>k.</td><td>faith</td><td> 03</td><td>faith</td>

<td> *</td><td></td><td></td><td>OI</td><td>OR</td><td>rd</td><td>rd</td>

<td></td><td></td><td></td><td>THE</td><td></td><td>THE</td><td></td>

<td></td><td></td><td></td><td>CSI</td><td></td><td>faith.</td><td>CN</td>

<td></td><td> &lt;0</td><td>OR</td><td>X.</td><td>faith</td><td> 00</td><td></td>

<td> *</td><td></td><td>oq</td><td>OI</td><td>or</td><td>rd</td><td>OJ</td>

<td>Mq</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Ό</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>* ά</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> &gt;· 3·</td><td>rd</td><td>co</td><td>or</td><td>rd</td><td></td><td></td>

<td>UI p</td><td></td><td>faith</td><td></td><td>r *</td><td>rd</td><td></td>

<td>p tn</td><td> &lt;0</td><td>a</td><td>K</td><td>faith</td><td>faith</td><td>x.</td>

<td>you 1 «</td><td>co</td><td>Or |</td><td>rd</td><td> ©</td><td> 03</td><td>rd</td>

<td></td><td>(% S)</td><td>{% s)</td><td>/ ε</td><td>• V, LO</td><td> 3 ¹³</td><td>ω6 of</td>

<td></td><td> „ ·</td><td></td><td> 3</td><td> 3</td><td></td><td></td>

<td></td><td> «&gt; ^H</td><td></td><td></td><td></td><td>dP</td><td> &lt;»</td>

<td></td><td>«Rt</td><td>Φ 10</td><td>you</td><td>you</td><td>W</td><td>'X *'</td>

<td> 0</td><td>d *</td><td>Η -P</td><td>Ό</td><td>Ό</td><td>Φ</td><td></td>

<td>M</td><td></td><td>S ⁰</td><td>rl</td><td>Ή</td><td>H</td><td></td>

<td>4J</td><td>4J p</td><td></td><td>or</td><td> □</td><td>n «d</td><td>n</td>

<td></td><td></td><td> 0 .</td><td>you</td><td> &gt;4</td><td>Μ Φ 4J</td><td>V) 0)</td>

<td>i</td><td></td><td>* Rf</td><td>Q</td><td> 0</td><td>0 H 0</td><td>0 H</td>

<td> '3</td><td></td><td>you</td><td></td><td>CU</td><td>&gt; «1 -P</td><td>t »id</td>

<td>Pair</td><td>ω3 of</td><td>ω6 of</td><td>pro ω6</td><td>pro ω3</td><td>new FA tot</td><td>new tot</td>

<td>Total FA)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>proportion of new ω3 / _ωθ</td><td> 7, 36</td><td> 8,41</td><td> 15,00</td><td> 15,36</td><td> 18,60</td><td> 15,20</td><td> 10,00</td><td></td><td></td><td></td><td> 0,05</td>

<td>proportion of new ω6 / ω3</td><td> 0,14</td><td> 0,12</td><td> 0,07</td><td> 0,07</td><td> 0,05</td><td> 0, 07</td><td> 0,10</td><td></td><td></td><td></td><td> 22,00</td>

<td>Efficacy from OA to EPA</td><td> 8,2%</td><td> 15, 6%</td><td> 15,5%</td><td> 15,1%</td><td> 15,1%</td><td> 12,8%</td><td> 10,5%</td><td> 0, 0%</td><td> 0,0%</td><td> 0, 0%</td><td> 0,1%</td>

<td>Efficacy of OA to DHA</td><td> 6, 7%</td><td> 12,3%</td><td> 11, 6%</td><td> 11, 5%</td><td> 11,4%</td><td> 10, 0%</td><td> 7,0%</td><td> 0, 0%</td><td> 0, 0%</td><td> 0, 0%</td><td> 0,0%</td>

<td>Efficiency from I&gt; A to EPA</td><td> 9,2%</td><td> 17,2%</td><td> 17,1%</td><td> 16,7%</td><td> 16,2%</td><td> 13,9%</td><td> 11,4%</td><td> 0,0%</td><td> 0,0%</td><td> 0, 0%</td><td> 0,2%</td>

<td>LA to DHA efficacy</td><td> 7,6%</td><td> 13,6%</td><td> 12,9%</td><td> 12,7%</td><td> 12,3%</td><td> 10, 9%</td><td> 7,5%</td><td> 0,0%</td><td> 0,0%</td><td> 0,0%</td><td> 0,0%</td>

<td>Efficacy of ALA to EPA</td><td> 15,8%</td><td> 24, 8%</td><td> 24, 9%</td><td> 24,2%</td><td> 22,8%</td><td> 20, 6%</td><td> 18,5%</td><td> 0, 0%</td><td> 0, 0%</td><td> 0,0%</td><td> 0,3%</td>

<td>Efficacy of AZA to DHA</td><td> 13,0%</td><td> 19, 6%</td><td> 18,7%</td><td> 18,4%</td><td> 17,2%</td><td> 16,1%</td><td> 12,2%</td><td> 0,0%</td><td> 0,0%</td><td> 0,0%</td><td> 0,0%</td>

232 to o

<td>saturated totals</td><td> 17,6</td><td> 17,8</td><td> 17,8</td><td> 17,6</td><td> 18</td><td> 17,8</td><td> 18,1</td><td> 18,2</td><td> 17,7</td><td> 17,8</td><td> 18,1</td>

<td>monounsaturated totals</td><td> 19,8</td><td> 15,5</td><td> 16</td><td> 16,6</td><td> 14,3</td><td> 16,6</td><td> 16,8</td><td> 18,7</td><td> 19,3</td><td> 19,6</td><td> 18,6</td>

<td>polyunsaturated totals</td><td> 62,5</td><td> 66, 6</td><td> 66,4</td><td> 65, 6</td><td> 67,7</td><td> 65,6</td><td> 65,1</td><td> 63</td><td> 63,1</td><td> 62,5</td><td> 63,2</td>

<td>total C20</td><td>&lt;0 in</td><td> 9,3</td><td>CO</td><td> 9,9</td><td> 8,1</td><td> 8,9</td><td> 8,5</td><td> 8,6</td><td> 11</td><td> 10,3</td><td> 10,1</td>

<td>total C22</td><td> 5,4</td><td> 10, 3</td><td> 10</td><td> 9,7</td><td> 9,4</td><td> 8,3</td><td> 5,7</td><td> 0,6</td><td> 0,9</td><td> 0,7</td><td> 0,7</td>

<td>Proportion C20 / C22</td><td> 1,78</td><td> 0,90</td><td> 0,98</td><td> 1,02</td><td> 0,86</td><td> 1,07</td><td> 1,49</td><td> 14,33</td><td> 12,22</td><td> 14,71</td><td> 14,43</td>

233

234

Homozygous seeds of this line were obtained in the T4 generation. Up to 10.3% DHA was produced in the FD546-18-110 event with an average of 7.3% DHA observed across the entire T4 generation. A subsequent generation (T5) was established to retest the stability of PUFA production over multiple generations, in particular for DHA. The maximum DHA levels observed were found to be stable in the fifth generation, even when the DHA content of the pooled seeds had stabilized until the T4 generation due to the presence of multiple transgenic loci. Batches of Ts seeds were also germinated in in vitro MS medium together with parental seeds of C. sativas with no obvious difference in efficacy or germination rate observed. Subsequent generations of the transgenic line (generations T6, T7 etc) did not show any reduction in seed DHA level. The transgenic plants were fully fertile male and female, and the pollen showed approximately 100% viability for wild-type plants. Analysis of the oil content of seeds with different levels of DHA did not identify any correlation between the level of DHA and the oil content, contrary to the correlation seen in Arabidopsis thaliana.

In several additional transgenic lines, the content

235 DHA from individual seeds from independent events exceeded 12%. The transgenic: null ratio of these lines was found between approximately 3: 1 and 15: 1. The analysis of the representative fatty acid profiles of the samples with the highest DHA content of each construct found only between 1.2 and 1.4% GLA with no other new PUFA ω6 detected. On the contrary, new PUFA ω3 (SDA) LC-PUFA ω3 (ETA, EPA, DPA, DHA) were found that accumulated 18.5% with a DHA level of 9.6% of the total fatty acid content . The A6-desaturation was 32% and the EPA was 0.8% of the total fatty acid content. The efficiency of A5-elongation was 93% and the efficiency of A6-elongation was 60%. DHA was detected in the polar fraction of the seed lipids of the GA7 lines.

Notably, the observed segregation ratios (between ~ 3: 1 and -15: 1) indicated that one or at most two transgenic loci were required to produce fish oil-like levels of DHA in C. sativa. This had important implications for the ease with which transgenic traits can mate as well as for the stability of the transgene.

Homozygous seeds were planted in various greenhouses to generate a total of more than 600 individual plants. Seed oil was extracted using a variety of

236 methods including soxhlet extractions, with acetone and hexane.

A regiospecificity analysis was carried out by ¹³C NMR on the seed oil of transgenic C. sativa to determine the positional distribution of LC-PUFA ω3 in TAGs. An event with approximately equal amounts of EPA and DHA was selected to maximize the response for these fatty acids and a sn-1,3asn-2 ratio of 0.75: 0.25 for EPA and 0.86: 0.14 for EPA was found. DHA where an unbiased distribution would be 0.66: 0.33. In other words, 75% of EPA and 86% of DHA were located in the snl, 3 position of the TAGs. This indicated that both fatty acids were preferentially located at sn-1,3 positions in C. sativa TAGs even though the preference for EPA was weaker than that of DHA. The finding that DHA was predominantly in the snl, 3 position was similar to the results previously described in A. thaliana seeds (Petrie et al., 2012).

Because only a small number of independent transgenic lines were obtained in the transformation experiment previously described, additional transformations of C. sativa were carried out using the GA7-modB construct (Example 3). More transformants were obtained and identified. homozygous lines

237 they produce more than 20.1% DHA.

Example 3: Modifications to the T-DNAs encoding the DHA pathways in plant seeds

With the aim of improving the level of DHA production in B. napus above the levels described in WO2013 / 185184, the binary vectors pJP3416GA7-modA, pJP3416-GA7-modB, pJP3416-GA7-modC, pJP3416-GA7modD, pJP3416-GA7-modE and pJP3416-GA7-modF were constructed as described in WO2013 / 185184 and were tested in transgenic plants. These binary vectors were variants of the pJP3416-GA7 construct and were designed to further increase DHA synthesis in plant seeds, in particular to improve the functions of Δδ-desaturase and Δδ-elongase. It had been observed that SDA accumulates in some seeds transformed with the GA7 construct due to the relatively low elongation efficiency in Δ6 compared to Δδ-elongase, therefore among others modifications, the positions of the two elongase genes in the T-DNA were swapped.

The positions of the two elongase coding sequences in pJP3416-GA7 were swapped in the T-DNA to give pJP3416-GA7-modA by first cloning a new P. cordata Δ6elongase cassette between the Sbfl sites of pJP3416-GA7 to replace the ΔΒ-elongase P cassette. cordata.This

238 The construction was further modified by exchanging the FPl promoter that directs the M. pusilla Δδ-desaturase for a conlinin Cnl2 promoter (pLuCnl2) to give pJP3416-GA7-modB. This modification was made as an attempt to increase the expression of Δδ-desaturase and thus its enzymatic efficiency. It was thought that the Cnl2 promoter could give a higher expression of the transgene in B. napus compared to the truncated napine promoter.

Eight transgenic events of A. thaliana were generated with pJP3416-GA7-modB and 15 transgenic events of A. thaliana with pJP3416-GA7-modG. Between 3.4% and 7.2% DHA was observed in the pooled seeds of pJP3416-GA7-modB and between 0.6 and 4.1% of DHA in the pooled T2 seeds of pJP3416-GA7-modG. Several of the best events were seeded with pJP3416-GA7-modB in selection medium and surviving seedlings were passed on to the next generation. The seeds are being tested for DHA content. Because the pooled Tl seeds represented populations that were segregating for the transgenics and included all null segregants, homozygous seeds from progeny plants are expected to have increased levels of DHA, up to 30% of the total fatty acid content in the seed oil. seed. The other modified constructs were used to transform A. thaliana. Even though I know

239 obtained only a small number of transformed lines, none yielded higher DHA levels than the modB construct.

The pJP3416-GA7-modB construct was also used to generate transformed plants of B. napus from cultivar Oscar and from a series of breeding lines designated as NX002, NX003, NX005, NX050, NX052 and NX054. A total of 1558 transformed plants were obtained including 77 independent transformed plants (T0) for the Oscar transformation, and 1480 independent plants for the breeding lines including 189 for NX005 which is a line that has a high content of oleic acid in its seed oil thanks to mutations in the genes of FAD2 The other breeding lines had higher levels of LA and ALA. Transgenic plants that exhibited more than 4 copies of the T-DNA determined by a digital POR method (Example 1) were discarded; approximately 25% of TO plants were discarded by this criterion. Approximately 53% of the T0 transgenic plants had 1 or 2 copies of the T-DNA determined by the digital PCR method, 12% had approximately 3 copies, and 24% had 4 or more copies. The seeds (TI seeds) of approximately 450 of the transgenic lines were harvested after self-fertilization, which was achieved by bagging the plants during flowering to avoid self-crosses. I know

240 harvest the Tía seeds from the rest of the transgenic plants when they are mature. Approximately between 1 and 2% of the plant lines were male or female sterile and did not produce viable seeds, these T plants were discarded.

Seed clusters (20 T1 seeds in each cluster) were tested for DHA levels in the oil of the pooled seeds, and the lines showing the highest levels were selected. In particular, lines with a DHA content of at least 2% of the total fatty acid content in the pooled TI seeds were selected. About 15% of the transgenic lines were selected in this way; the other 85% were discarded. Some of these were designated as lines CT132-5 (in cultivar Oscar), CT133-15, -24, -63, -77, -103, -129 and -130 (in NX005). Selected lines from NXOSO included CT1364, -8, -12, -17, -19, -25, -27, -49, and -51. Twenty seeds of the selected lines including CT132.5 and 11 seeds of CT133.15 were soaked and, after two days, the oil was extracted from a half cotyledon of each of the individual seeds. The other half of the cotyledons with embryonic axes were preserved and cultured in medium to maintain the specific progeny lines. The composition of fatty acids in the oil was determined; the data is

241 shown in Table 6 for CT132.5. The level of DHA in 10 of the 20 seeds analyzed was in the range between 7 and 20% of the total content of fatty acids according to the determination by GC analysis. Other seeds contained less than 7% DHA and may have contained a partial (incomplete) copy of the T-DNA of pJP3416-GA7-modB. The transgenic line appeared to contain multiple transgenic insertions that were genetically unlinked. The seeds of the transgenic line CT133.15 exhibited levels of DHA in the range between 0 and 5%. The seeds without DHA were probably null segregating. These data confirmed that the modB construct performed well for DHA production in hemp seeds.

20 or 40 individual seeds (T2 seeds) obtained from each of multiple TI plants, after self-fertilization, from the transformed lines selected for fatty acid composition were individually tested. Seeds with DHA at levels greater than 20% were identified (Table 7). Two representative samples, CT136-27-182 and CT136-27-18-19 had 21.2% and 22.7% DHA, respectively. The total content of ω3 fatty acids in these seeds was approximately 60% as a percentage of the total content of fatty acids, and the content of u6 was less than 10%. Other groups of 20 or 40 seeds were tested T2

242 of each of the plants Tl for fatty acid composition. Seeds comprising up to 34.3% DHA were identified, for example in seed CT136-27-47-25 (Table 9). The fatty acid composition for seed oil that was obtained from CT136-27-47-25 is shown in Table 9. Fatty acid composition included 34.3% DHA along with approximately 1.5% DPA, 0.6% EPA and 0.5% ETA. The SDA level was approximately 7.5%, ALA approximately 21.9% and LA approximately 6.9%. The new PA6 PUPAs exhibited 1.1% GLA but no ω6-Ο20 or C22 LC-PUFA. The total saturated fatty acids were: 9.6%; monounsaturated fatty acids, 12.5%; the total PUFAs, 75.2%; the total o6-PUFA (including LA), 7.2%; the total o3-PUFA, 66.9%; the ratio of total fatty acids wG: ω3, 9.3: 1; new fatty acids ω6: new ω3, 37: 1. The efficiencies of each enzymatic step from oleic acid to DHA were as follows: A12-desaturase, 90%; A15 / m3-desaturase, 89%; A6-desaturase, 67%; A6-elongase, 83%; A5-desaturase, 99%; A5-elongase, 98%; A4-desaturase, 96%. The overall conversion efficiency of oleic acid to DHA was about 50%. Therefore it was clear that seeds that produce DHA in the range between 20.1 and 35% of the total fatty acid content of the seed oil could be identified and selected, including seeds with between 20.1% and 30%

243 of DHA or between 30% and 35% of DHA in the total content of fatty acids.

The oil content in some seeds decreased from about 44% in the wild-type seeds to about 31-39% in some of the DHA-producing seeds, but was similar to the wild-type levels in other DHA-producing seeds.

. Several transformed plant lines producing DHA at levels of at least 10% in the T2 seed are crossed and the Fl progeny self-pollinated with the goal of producing an F2 progeny that is homozygous for multiple T-DNA insertions. The seed oil from homozygous seeds is analyzed and contains up to 30% or 35% of the total fatty acid content of seed oil in the form of DHA.

The TAG in the oil obtained from CT136-27-18-2 and CT136-27-18-19 was analyzed by regiospecificity test by ¹³C NMR for the positional distribution of DHA in the glycerol backbone of TAG molecules. DHA bound preferentially at the sn-1,3 position. More than 70%, in fact more than 90% of the DHA was in the sn-1,3 position.

In several other transgenic lines, the DHA content of individual seeds from independent events exceeded 12%. The proportion of transgenic: null of these

244 lines was found at approximately 3: 1, which corresponds to a single transgenic locus, or 15: 1, which corresponds to two transgenic loci. The analysis of representative fatty acid profiles of the samples of each construct with the highest levels of DHA found only between 1.2 and 1.4% of GLA with no other new or detected PUFAs. In contrast, the new PFA ω3 (SDA) and LC-PUFA ω3 (ETA, EPA, DPA, DHA) accumulated to a sum of 25.8% for the modF construction and 21.9% for the modG construction in comparison. with 8.5% for the seeds transformed with GA7. The levels of DHA in the oil of these seeds were 9.6%, 12.4% and 11.5%, respectively. The Δ6-desaturation was found to be lower in the seeds transformed with GA7 compared to the seeds transformed with modF and modG (32% vs 47% and 43%) and this resulted in a reduction of ALA in the modF and modG seeds in relation to GA7. Another important difference was the accumulation of EPA of the modF seeds (3.3% vs 0.8% in the other two transgenic seeds) and this was reflected in a lower A5-elongation observed in the modF seeds (80%) in relation to the seeds GA7 and modG (93% and 94%). There was a slight increase in Δ6-elongation in these seeds (66% vs 60% and 61%) even though the amount of SDA actually increased due to the slightly more active Δ6-desaturation, DHA was detected in the polar fraction of lipids of seed lines

245

GA7.

The lipid fatty acid composition in the Tl seeds of 70 independent transgenic plants of the breeding line B. napus NX54 transformed with the T-DNA of the modB construct was analyzed. It was observed that one of these transgenic plants produced seeds with DPA but without DHA in seed oil. The Tl seed of this line (CT-137-2) produced approximately 4% DPA with no DHA detectable in the pooled TI seeds. The inventors evaluated whether this was caused by the inactivation of the A4-desaturase gene in that T-DNA particular inserted, through a spontaneous mutation. PCR analysis and DNA sequencing showed the presence of a deletion, which was defined to have nucleotides 12988-15317 deleted from the GA7-modB T-DNA (SEQ ID NO: 2). The deleted nucleotides correspond to a portion of the Cnl2 Linus promoter that drives the expression of the Δ4desaturase coding region as well as the Δ4desaturase coding region itself, which explains why the seeds transformed with the T-DNA comprising the deletion did not produce DHA.

About 50Tl seeds of this transgenic line were germinated and one cotyledon emerged from each was analyzed for fatty acid composition in the remaining oil. Then the selected seedlings exhibiting

246 more than 5% DPA until maturity and T2 seeds were harvested. The fatty acid compositions of pooled seeds are shown in Table 8, more than 7% DPA was observed in these lines. The T4 seed was produced from the B. napus DPA line CT-1372 and was analyzed for the fatty acid profile. Up to 13% DPA was observed in pooled mature seed samples.

The oil from the seeds having about 10% DPA was treated with mild alkali to hydrolyze the fatty acids.

Another transgenic line designed B0003-514 exhibited approximately 10-16% DPA in the T2 seed. The seed containing 8% of DPA, 0.2-0.9% of DHA and 0.12.5% ​​of EPA was selected. The T2 seed population exhibited a segregation ratio of: 2: l to high: medium: none of DPA, which indicates the presence of a single genetic locus for DPA production in said transgenic line.

The oil was extracted by a screw press from seed samples that produced LC-PUFA, thus producing seed meal.

Construction design

While the focus of this experiment was the demonstration of DHA production in oilseed cultured species, the differences previously noted

247 They were also interesting from a building design perspective. First, swapping the locations of the Δ6- and Δ5elongase coding region in the modF construct resulted in the expected profile change with more EPA accumulated due to low Δ5 elongation. A concomitant increase in Δ6 elongation was observed but this was not the result of the lower levels of SDA. This was due to an increase in Δ6 desaturation in the modF transformed seed, caused by the addition of an extra expression cassette of M. pusilla Δ6-desaturase as well as by the replacement of the truncated napine promoter (FP1) by a more highly active promoter from conlinina 2de flax. The somewhat lower increase in Δ6 desaturation seen with the modG construct was caused by the capitalization of the highly expressed cassette of A5-elongasa in GA7. The exchange of the positions of the coding regions of Δβ-desaturase and A5-elongase resulted in a greater Δβ-desaturation. The A5-elongase activity was reduced in this case due to the replacement of the FPl promoter by the Cnl2 promoter.

These data confirmed that the modB, modF and modG constructs performed well for DHA production in Camelina seeds, such as Arabidopsis and Cañola.

The inventors considered that, in general,

248 efficiencies of reaction limiting enzymatic activities in the DHA pathway may be higher in multicopy T-DNA transforms compared to single copy T-DNA transformants, or they can be increased by the insertion into the T-DNA of multiple genes that code for the enzyme that could be the limiting pathway. Evidence of the possible importance of multicopy transients was seen in Arabidopsis seeds transformed with the construct GA7, where the DHA highest yielding event had three T-DNAs inserted into the host genome. Multiple genes may be identical, or they are preferably different variants encoding the same polypeptide, or they are under the control of different promoters that have overlapping expression patterns. For example, higher expression can be achieved by the expression of multiple A6-desaturase coding regions, even though it occurs the same protein.In pJP3416-GA7-modF and pJP3416-GA7-modC, for example, two versions of the Δδ desaturase from M. pusillay were expressed by different promoters, the coding sequences had different codon usage and therefore different nucleotide sequences, to reduce potential silencing or cosuppression effects, but resulting in the production of

249 the same protein.

Table 6. Fatty acid composition of lipid in half cotyledons of germinating B. napus TI transgenic seeds containing the T-DNA of the GA7modB construct. The lipids also contained 0.1-0.3¾ of each of

C16: 1, C16: 3, C24; 0 and C24: 1, and no C2O; 1A11.

<td rowspan="2">Seia 111 to</td><td colspan="9">Ή</td><td rowspan="2">C18: 4e »3</td><td rowspan="2">3 or 0</td><td rowspan="2">My «Or 0</td><td rowspan="2">m 8 m OR 0</td><td rowspan="2">O ¿i 0</td><td rowspan="2">S to 0</td><td rowspan="2">8 in or 0</td><td rowspan="2">3 or 8</td><td rowspan="2">m S to CM CM</td><td rowspan="2">«*» You Λ0 0</td>

<td>or laugh u</td><td>or rJ O</td><td>or CD or</td><td>▼ 4 CD rl U</td><td>3 w Ή or</td><td>Uncle</td><td>8 rt co YOU ​​ü</td><td>m 8 m &lt;0 0</td><td>or or M Ü</td>

<td> 1</td><td>0 r</td><td> 4 /</td><td> 1 9</td><td> 2 9</td><td> 2 '</td><td> 9</td><td> 0 ' 9</td><td> 3 8</td><td> 0</td><td>0 r</td><td> 1</td><td> 0</td><td> 2</td><td> 0 9</td><td> 2</td><td> 0</td><td>0 f</td><td> 0</td><td> 3</td>

<td></td><td> 1</td><td> 2</td><td> 8</td><td> 9</td><td> 5</td><td> 9</td><td> 1</td><td>F 4</td><td> 5</td><td> 8</td><td>or</td><td> 1</td><td> 1</td><td> 3</td><td> 8</td><td> 3</td><td> 1</td><td> 5</td><td> 9</td>

<td> 2</td><td> 0</td><td> 4</td><td> 4</td><td> 2</td><td> 2</td><td> 7</td><td> 0</td><td> 2</td><td> 1</td><td> 4</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> €</td><td> 1</td><td> 0</td><td> 1</td><td> 9</td>

<td></td><td>r</td><td></td><td>r</td><td> 3</td><td>r</td><td>F</td><td> /</td><td> 9</td><td> 9</td><td>r</td><td> 9</td><td>F</td><td> 9</td><td>F</td><td>F</td><td> 9</td><td>F</td><td> 9</td><td> 9</td>

<td></td><td> 1</td><td> 7</td><td> 0</td><td>/ n</td><td> 3</td><td> 4</td><td> 3</td><td></td><td> 0</td><td> 3</td><td> 1</td><td> 1</td><td> 9</td><td> 4</td><td> 9</td><td> 0</td><td> 0</td><td> 7</td><td> 5</td>

<td> 3</td><td> 0</td><td> 3</td><td> 1</td><td>V 5</td><td> 1</td><td> 4</td><td> 0</td><td>or one</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td></td><td>F</td><td>r</td><td>F</td><td> 5</td><td>Y</td><td>F</td><td>r</td><td> 5</td><td>F</td><td>r</td><td> 9</td><td>F</td><td> ’ 9</td><td> 9</td><td> 1</td><td>F</td><td>F</td><td> 9</td><td> 9</td>

<td></td><td> 1</td><td> 7</td><td> 8</td><td> 1</td><td> 9</td><td> 7</td><td> 2</td><td> 9 2</td><td> 8</td><td> 8</td><td> 4</td><td> 1</td><td> 3</td><td> 5</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td> 4</td><td> 0</td><td> 4</td><td> 2</td><td> 2</td><td> 1</td><td> 6</td><td> 0</td><td> 2</td><td> 1</td><td> 7</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 8</td>

<td></td><td> /</td><td>F</td><td>r</td><td> 2</td><td>g</td><td>F</td><td> 9</td><td> 6</td><td>r</td><td> /</td><td> /</td><td>r</td><td> 9</td><td>j</td><td> 1</td><td> /</td><td>g</td><td></td><td> 9</td>

<td></td><td> 1</td><td> 6</td><td> 9</td><td> 1</td><td> 8</td><td> 6</td><td> 4</td><td> 5</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 8</td><td> 5</td><td> / 2</td><td> 9</td><td> 0</td><td> 7</td><td> 7</td>

<td> 5</td><td> 0</td><td> 4</td><td> 1</td><td> 2</td><td> 2</td><td> 8</td><td> 0</td><td> 2</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 1.</td><td> 0</td><td> 7</td><td> 1</td><td> 0</td><td> 1</td><td> 1</td>

<td></td><td>F</td><td>r</td><td>r</td><td> 7</td><td>r</td><td> 9</td><td>F</td><td> 6</td><td>r</td><td> 9</td><td>F</td><td>r</td><td> 9</td><td>r</td><td>F</td><td>r</td><td> 9</td><td> 9</td><td> 2</td>

<td></td><td> 1</td><td> 0</td><td> 7</td><td>r 4</td><td> 1</td><td> 1</td><td> 3</td><td>F 4</td><td> 6</td><td> 8</td><td> 0</td><td> 1</td><td> 5</td><td> 3</td><td> 6</td><td> 5</td><td> 0</td><td> 8</td><td> 9 2</td>

<td> 6</td><td> 0</td><td> 3</td><td>1 f</td><td>5 Q</td><td> 2 /</td><td> 4 9</td><td> 0 9</td><td> 1 8</td><td>0 r</td><td>0 t</td><td> 1</td><td> 0 9</td><td> 0 9</td><td>0 f</td><td> 6 9</td><td>0 F</td><td>0 f</td><td>0 JF</td><td> 0 9</td>

<td></td><td>i</td><td> 5</td><td> 6</td><td>r 8</td><td> 0</td><td> 3</td><td> 1</td><td>r 5</td><td> 6</td><td> 5</td><td> 3</td><td> 0</td><td> 7</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td> 7</td><td> 0</td><td> 6</td><td> 1</td><td> 1</td><td> 2</td><td> 2</td><td> 1</td><td> 2</td><td> 0</td><td> 5</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 1</td><td> 9</td>

<td></td><td>F</td><td></td><td> /</td><td> 6</td><td> 9</td><td> 3</td><td> 9</td><td> 3</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td>t</td><td> 9</td><td>r</td><td> 9</td><td> 9</td>

250

<td></td><td> 8</td><td> 1 0</td><td> 0 4</td><td> 7 2</td><td>F 6 one</td><td> 6 1</td><td>F 9 one</td><td> 0 0</td><td>F 2 3</td><td> 6 0</td><td> 4 5</td><td>B 0</td><td> 2 0</td><td> 6 2</td><td> 4 0</td><td> 6 4</td><td> 1 1</td><td> 0 0</td><td> 7 1</td><td> 9 1</td>

<td></td><td></td><td>F</td><td>F</td><td></td><td>²</td><td>F</td><td> 1</td><td>F</td><td> 4</td><td>t</td><td>r</td><td>F</td><td>F</td><td></td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td>³</td>

<td></td><td></td><td> 1</td><td> 9</td><td>Ί</td><td>F</td><td> 4</td><td></td><td> 3</td><td>F</td><td> 9</td><td> 0</td><td> 9</td><td> 2</td><td> 4</td><td> 5</td><td> 1</td><td> 3</td><td> 0</td><td> 8</td><td>F</td>

<td></td><td></td><td></td><td></td><td></td><td> 9</td><td></td><td> 7</td><td></td><td> 3</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 8</td>

<td rowspan="2"> 5</td><td> 9</td><td> 0</td><td> 3</td><td> 2</td><td> 4</td><td> 1</td><td> 2</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td></td><td></td><td></td><td>F</td><td> 1</td><td></td><td> 1</td><td>F</td><td> 3</td><td>t</td><td>r</td><td>F</td><td>F</td><td></td><td>r</td><td>F</td><td>r</td><td>r</td><td>r</td><td></td>

<td></td><td></td><td> 1</td><td> 9</td><td> 4</td><td> 9</td><td> 7</td><td>F</td><td> 0</td><td>F</td><td> 7</td><td> 0</td><td> 2</td><td> 1</td><td> 2</td><td> 4</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td>

<td></td><td></td><td></td><td></td><td></td><td> 6</td><td></td><td> 5</td><td></td><td> 4</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> 10 .</td><td> 0</td><td> 3</td><td> 2</td><td> 3</td><td> 1</td><td> 1</td><td> 0</td><td> 2</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> €</td>

<td></td><td></td><td>F</td><td>r</td><td>F</td><td> 0</td><td>F</td><td> 9</td><td>F</td><td> 3</td><td> /</td><td></td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td>

<td></td><td></td><td> 1</td><td> 7</td><td> 1</td><td>i</td><td> 7</td><td></td><td> 4</td><td>F</td><td> 7</td><td> 1</td><td> 1</td><td> 1</td><td> 5</td><td> 4</td><td> 6</td><td> 6</td><td> 0</td><td> 7</td><td> 9</td>

<td></td><td></td><td></td><td></td><td></td><td> 9</td><td></td><td></td><td></td><td> 6</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> 11</td><td> 0</td><td> 5</td><td> 3</td><td> 4</td><td> 2</td><td> 2</td><td> 2</td><td> 7</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td>OR</td><td> 4</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td></td><td></td><td></td><td></td><td></td><td>¹</td><td>r</td><td> 6</td><td>F</td><td>ΐ</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>• F</td><td>F</td><td>F</td><td>r</td><td>F</td>

<td></td><td></td><td> 1</td><td> 7</td><td> 8</td><td></td><td> 4</td><td></td><td> 1</td><td> 2</td><td> 3</td><td> 3</td><td> 2</td><td> 2</td><td> 3</td><td> 8</td><td> 8</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td></td><td></td><td></td><td></td><td></td><td> 2</td><td></td><td> 7</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> 10</td><td> 12</td><td> 0</td><td> 4</td><td> 2</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 2</td><td> 0</td><td> 3</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 3</td><td> 0</td><td> 0</td><td> 1</td><td> 6</td>

<td></td><td></td><td></td><td></td><td></td><td> 5</td><td>F</td><td> 6</td><td></td><td> 8</td><td> /</td><td>F</td><td>F</td><td></td><td></td><td>F</td><td>F</td><td>r</td><td>r</td><td>F</td><td>F</td>

<td></td><td></td><td> 1</td><td> 6</td><td> 4</td><td></td><td> 7</td><td>r</td><td> 3</td><td>F</td><td> 8</td><td> 9</td><td> 1</td><td> 1</td><td> 9</td><td> 4</td><td> 9</td><td> €</td><td> 0</td><td> 1</td><td> 2</td>

<td></td><td></td><td></td><td></td><td></td><td> 5</td><td></td><td> 1</td><td></td><td> 9</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> 13</td><td>⁰</td><td> 4</td><td> 4</td><td> 1</td><td> 1</td><td>g</td><td> 0</td><td> 4</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 5</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 3</td>

<td></td><td></td><td>F</td><td>r</td><td></td><td> 9</td><td>F</td><td>F</td><td>F</td><td> 5</td><td>F</td><td>F</td><td>F</td><td>F</td><td> #</td><td>F</td><td>F</td><td>_r</td><td>F</td><td>F</td><td>F</td>

<td></td><td></td><td> 1</td><td> 3</td><td> 2</td><td></td><td> 6</td><td> 2</td><td> 1</td><td>r</td><td> 0</td><td> 2</td><td> 1</td><td> 1</td><td> 2</td><td> 4</td><td> 6</td><td> 3</td><td> 2</td><td> 4</td><td> 4</td>

<td></td><td></td><td></td><td></td><td></td><td> 4</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td> 14</td><td> 0-</td><td> 6</td><td> 4</td><td> 1</td><td> 2</td><td> 8</td><td> 0</td><td> 3</td><td> 1</td><td> 3</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 4</td><td> 1</td><td> 0</td><td> 2</td><td> 1</td>

<td></td><td></td><td>F</td><td></td><td>F</td><td>⁰</td><td>r</td><td>F</td><td>F</td><td>¹</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td></td><td>F</td><td>F</td><td>F</td><td>F</td><td> 8</td>

<td></td><td></td><td> 1</td><td> 3</td><td> 0</td><td> 9</td><td> 3</td><td> 4</td><td> 3</td><td>F</td><td> 3</td><td> 9</td><td> 8</td><td> 1</td><td> 3</td><td> 6</td><td> 6</td><td> 8</td><td> 1</td><td> 5</td><td>F</td>

<td></td><td></td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 1</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td>

<td> 15</td><td> 15</td><td> 0</td><td> 5</td><td> 3</td><td> 1</td><td> 2</td><td> 1</td><td> 0</td><td> 2</td><td> 1</td><td> 4</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 3</td><td> 1</td><td>or-</td><td> 1</td><td> 1</td>

<td></td><td></td><td>t</td><td></td><td>F</td><td> 6</td><td>F</td><td> 1</td><td>r</td><td> 8</td><td>r</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td>r</td><td>F</td><td>F</td><td> 5</td>

<td></td><td></td><td> 1</td><td> 1</td><td> 3</td><td> 9</td><td> 4</td><td>F</td><td> 3</td><td>t</td><td> 0</td><td> 5</td><td> 9</td><td> 1</td><td> 1</td><td> 6</td><td> 2</td><td> 5</td><td> 1</td><td> 8</td><td>F</td>

<td></td><td></td><td></td><td></td><td></td><td> 8</td><td></td><td> 2</td><td></td><td> 8</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td>

<td></td><td> 16</td><td> 0</td><td> 4</td><td> 4</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 3</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 3</td><td> 0</td><td> 4</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td>

<td></td><td></td><td>r</td><td></td><td></td><td> 6</td><td>F</td><td> 1</td><td>F</td><td> 3</td><td>F</td><td>F</td><td></td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td> 2</td>

<td></td><td></td><td> 1</td><td> 4</td><td> 0</td><td> 9</td><td> 5</td><td>F</td><td> 2</td><td>F</td><td> 9</td><td> 8</td><td> 1</td><td> 2</td><td> 7</td><td> 4</td><td> 6</td><td> 7</td><td> 1</td><td> 3</td><td>F</td>

<td></td><td></td><td></td><td></td><td></td><td> 2.</td><td></td><td> 6</td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td>

<td></td><td> 17</td><td> 0</td><td> 7</td><td> 4</td><td> 1</td><td> 2</td><td> 8</td><td> 0</td><td> 2</td><td> 1</td><td> 5</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 4</td><td> 2</td><td> 0</td><td> 2</td><td> 1</td>

<td></td><td></td><td>F</td><td>F</td><td>F</td><td> 5</td><td>r</td><td>r</td><td>F</td><td> 5</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td>r</td><td>F</td><td> 5</td>

<td></td><td></td><td> 2</td><td> 2</td><td> 9</td><td></td><td> 1</td><td> 9</td><td> 3</td><td></td><td> 4</td><td> 1</td><td> 9</td><td> 0</td><td> 6</td><td> 8</td><td> 9</td><td> 1</td><td> 0</td><td> 2</td><td> 9</td>

<td></td><td></td><td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td> 9</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0</td>

<td> 20</td><td> 18</td><td> 0</td><td> 4</td><td> 2</td><td> 6</td><td> 1</td><td> 7</td><td> 0</td><td> 1</td><td> 1</td><td> 3</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td>OR</td><td> 0</td>

<td></td><td></td><td>r</td><td></td><td>r</td><td> 4</td><td></td><td>F</td><td>F</td><td> 2</td><td>F</td><td>F</td><td></td><td>F</td><td>F</td><td>r</td><td>r</td><td>F</td><td>F</td><td>F</td><td>F</td>

<td></td><td></td><td> 1</td><td> 0</td><td> 3</td><td>t</td><td> 2</td><td></td><td> 1</td><td></td><td> 0</td><td> 5</td><td> 5</td><td> 1</td><td> 0</td><td> 7</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

251

Table 7. Fatty acid composition of lipid in T2 transgenic B. napus seeds containing the T-DNA of the GA7-modB construct.

<td>Sample (seed T2)</td><td>OR VHU</td><td>or 0 »u</td><td>"•4 CO or</td><td>C18: Idll</td><td>a&gt; wu</td><td>C18: 3cj6</td><td>00 V</td><td>I know 00 w P</td><td>H 3 or 8</td><td>M) 8 I heard or 8</td><td>3rd s</td><td>ms or CM O</td><td>in á O Ci u</td><td>in 5 and 8</td><td>in s I 3</td><td>Total e&gt; 3 W</td><td>Total © 6 (%&gt;</td><td>• 0 Ή a 8 S &amp; ^wmea «</td><td>Total understood POTA m</td>

<td>CT13627-18-1</td><td>SW</td><td> 2,6</td><td> 25,4</td><td> 3, 6</td><td> 6,7</td><td> 0,2</td><td> 37, 5</td><td> 1,4</td><td> 1,0</td><td> 0,1</td><td> 2,1</td><td> 0,8</td><td> 0,4</td><td> 0,9</td><td> 10,2</td><td> 53,4</td><td> 7,1</td><td> 0,13</td><td> 60, 5</td>

<td>CT13627-18-2</td><td> 7,1</td><td> 2,8</td><td> 9</td><td> 4,3</td><td> 5,5</td><td> 0,4</td><td> 29,1</td><td> 5,4</td><td> 0,8</td><td> 0,1</td><td> 1,2</td><td> 0,5</td><td> 0,5</td><td> 1,9</td><td> 21,2</td><td> 59, 8</td><td> 6,1</td><td> 0,10</td><td> 66,0</td>

<td>CT13627-18-3</td><td> 5,4</td><td> 2,5</td><td> 26, 5</td><td> 3,8</td><td> 6,4</td><td> 0,4</td><td> 26,4</td><td> 4,7</td><td> 1,0</td><td> 0,1</td><td> 0,7</td><td> 1,1</td><td> 0,6</td><td> 1,2</td><td> 17,3</td><td> 52,0</td><td> 6,9</td><td> 0,13</td><td> 58,9</td>

<td>CT13627-18-4</td><td> 5,3</td><td> 2,4</td><td> 34, 7</td><td> 4,0</td><td> 5,9</td><td> 0,3</td><td> 30,3</td><td> 1,3</td><td> 1,1</td><td> 0,1</td><td> 1,1</td><td> 1,5</td><td> 0,3</td><td> 0,4</td><td> 9/3</td><td> 44,4</td><td> 6,3</td><td> 0,14</td><td> 50,7</td>

<td>CT13627-18-5</td><td> 4,8</td><td> 2,7</td><td> 34,5</td><td> 3, 8</td><td> 5,6</td><td> 0,3</td><td> 23,5</td><td> 3, 9</td><td> 1,2</td><td> 0,1</td><td> 0,7</td><td> 1,1</td><td> 0,5</td><td> 1,1</td><td> 14,2</td><td> 45, 1</td><td> 6,0</td><td> 0,13</td><td> 51, 1</td>

<td>CT13627-18-6</td><td> 5,0</td><td> 2,1</td><td> 54, 3</td><td> 3, 8</td><td> * 7 &lt;</td><td> 0,2</td><td> 18,2</td><td> 0, 6</td><td> 1, 5</td><td> 0,1</td><td> 1,1</td><td> 0,7</td><td> 0,1</td><td> 0,2</td><td> 4,4</td><td> 25, 5</td><td> 6,1</td><td> 0,24</td><td> 31, 5</td>

<td>CT13627-18-7</td><td> 5,3</td><td> 2,1</td><td> 43, 9</td><td> 4,2</td><td> 5,6</td><td> 0,4</td><td> 18,3</td><td> 2,2</td><td> 1,3</td><td> 0,2</td><td> 0,6</td><td> 1,5</td><td> 0,4</td><td> 0,5</td><td> 11,6</td><td> 35,2</td><td> 6,2</td><td> 0,18</td><td> 41,4</td>

<td>CT13627-18-8</td><td> 5,4</td><td> 2,7</td><td>25, S</td><td> 4,1</td><td> 6,7</td><td> 0,4</td><td> 26,6</td><td> 5,7</td><td> 1,0</td><td> 0,1</td><td> 0,6</td><td> 1,3</td><td> 0,6</td><td> 1,2</td><td> 15,8</td><td> 51,9</td><td> 7,1</td><td> 0,14</td><td> 59,0</td>

<td>CT13627-18-8</td><td> 4,6</td><td> 1,6</td><td> 53,3</td><td> 3,7</td><td> 17, 5</td><td> 0,5</td><td> 9,2</td><td> 0,5</td><td> 1,6</td><td> 0, 3</td><td> 0,6</td><td> 0,4</td><td> 0,1</td><td> 0,1</td><td> 3,7</td><td> 14,5</td><td> 18,3</td><td> 1,26</td><td> 32,8</td>

<td>CT13627-18-10</td><td> 4,8</td><td> 2,4</td><td> 44, 1</td><td> 3,7</td><td> 5,4</td><td> 0,4</td><td> 19,1</td><td> 2,3</td><td> 1,1</td><td> 0,1</td><td> 0,6</td><td> 1,5</td><td> 0, 5</td><td> 0,8</td><td> 11,4</td><td> 36,1</td><td> 5,9</td><td> 0,16</td><td> 42,0</td>

<td>CT13627-18-11</td><td> 5,1</td><td> 2,2</td><td> 48,3</td><td> 4,1</td><td> 10, 9</td><td> 0,7</td><td> 12,5</td><td> 1,2</td><td> 1,3</td><td> 0,2</td><td> 0,5-</td><td> 1,5</td><td> 0,3</td><td> 0,3</td><td> 9,1</td><td> 25,3</td><td> 11,8</td><td> 0,47</td><td> 37,1</td>

<td>CT13627-18-12</td><td> 5,3</td><td> 2,7</td><td> 23, 3</td><td> 3,7</td><td> 6,0</td><td> 0,4</td><td> 27,9</td><td> 4,9</td><td> 0,9</td><td> 0,1</td><td> 0,7</td><td> 1,3</td><td> 0,8</td><td> 1,5</td><td> 18,5</td><td> 55,7</td><td> 6,6</td><td> 0,12</td><td> 62,2'</td>

<td>CT13627-18-13</td><td> 5, 5</td><td> 3,4</td><td> 30, 7</td><td> 5, 6</td><td> 5,1</td><td> 0,4</td><td> 23,1</td><td> 3, 5</td><td> 1,1</td><td> 0,1</td><td> 1,2</td><td> 1,1</td><td> 0,6</td><td> 1,2</td><td> 14, 9</td><td> 45,8</td><td> 5,5</td><td> 0,12</td><td> 51,3</td>

<td>CT136-</td><td> 5,4</td><td> 2,3</td><td> 23, 9</td><td> 3,5</td><td> 6,0</td><td> 0,4</td><td> 30,1</td><td> 3,7</td><td>1, G</td><td> 0,1</td><td> 1,0</td><td> 0,7</td><td> 0,6</td><td> 1/2</td><td> 18,2</td><td> 55,5</td><td> 6,6</td><td> 0,12</td><td> 62, 1</td>

<td>27-18-14 CT13627-18-15</td><td> 5,0</td><td> 2,3</td><td> 45,4</td><td> 4,0</td><td> 5,3</td><td> 0,4</td><td> 16,</td><td> 2</td><td> 2,3</td><td> 1,2</td><td> 0,1</td><td> 0,5</td><td> 1,9</td><td> 0,6</td><td> 0,7</td><td> 12.3</td><td> 34,4</td><td> 5,8</td><td> 0,17</td><td> 40, 3</td>

<td>CT13627-18-18</td><td> 5,1</td><td> 2,3</td><td> 29, 0</td><td> 3, 6</td><td> 5,7</td><td> 0,4</td><td> 26,</td><td> 5</td><td> 3,8</td><td> 1,1</td><td> 0,2</td><td> 0,8</td><td> 0,8</td><td> 0,6</td><td> 1,0</td><td> 17,4</td><td> 50,8</td><td> 6,3</td><td> 0,12</td><td> 57,1</td>

<td>CT13627-18-19</td><td> 5,8</td><td> 2,3</td><td> 19,7</td><td> 4,2</td><td> 6,7</td><td> 0,7</td><td> 23,</td><td> 7</td><td> 7,7</td><td> 0,9</td><td> 0,1</td><td> 0,4</td><td> 0,7</td><td> 0,6</td><td> 1,7</td><td> 22,7</td><td> 57,6</td><td> 7,5</td><td> 0,13</td><td> 65,1</td>

<td>CT13Ó27-18-20</td><td> 5,7</td><td> 2,9</td><td> 23, 2</td><td> 4,0</td><td> 5,6</td><td> 0,3</td><td> 35,</td><td> 8</td><td> 2,4</td><td> 1,0</td><td> 0,1</td><td> 1,3</td><td> 1,1</td><td> 0,5</td><td> 1,0</td><td> 13,0</td><td> 55,1</td><td> 6,1</td><td> 0,11</td><td> 61,2</td>

ARA (C20: 4o6) and ϋΡΑωβηο were detected in none of the samples. The samples also contained 0.1% C14: O about 0.2% or 0.3% C16: l, about 0.10, 3% C16: 3, between about 0.7% and 0.10% C20: 0, about 0.3 % C22: 0, and some samples contained trace levels (&lt;0.1%) of C2O: 1A13, Ο22: 3ω3, C24: 0, and C24: l

252

Table 8 «Fatty acid composition of the lipid in the T2 transgenic seeds of B. napus transformed with the T-DNA of the GA7-modB construct, with a mutation in the deA4desaturase gene. Lipids also contained approximately 0.1% 14: 0, 0.2% 16: 3, 0.2-0.4% GLA, 0.1% 20: 1Δ13, 0.3-0.4%

22: 0 and ARA, ΡΡΑω6 (22: 5ω6), 16: 2, and 22: l were not detected.

<td rowspan="2"></td><td rowspan="2">or H u</td><td rowspan="2">WO</td><td colspan="2">Or «4</td><td rowspan="2">ττντ · bto</td><td rowspan="2">co H υ</td><td rowspan="2">&lt;n 3 in 00 OR</td><td rowspan="2">OR O CM u</td><td rowspan="2">3 «0 OR</td><td rowspan="2">Rh 3 or 8</td><td rowspan="2">KO 3 CM OR 8</td><td rowspan="2">3 (*) or 8</td><td rowspan="2">C7 3 m or 8</td><td rowspan="2">in $ or not</td><td rowspan="2">in 3 n or 8</td><td rowspan="2">&lt;6 N 8</td><td rowspan="2">in 3 in 8</td><td rowspan="2">OR V 8</td><td rowspan="2">w 8</td><td rowspan="2">in 3 tn ¿I CM U</td><td rowspan="2">1 N 8</td>

<td>CO OR</td><td>co H u</td>

<td>CT-137-2-</td><td> 5,</td><td> 0,</td><td> 3,</td><td> 2€,</td><td> 3,</td><td> 12,</td><td> 29,</td><td> 0,</td><td> 7</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 1,</td><td> 1,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 10,</td><td> 0,</td>

<td> 34</td><td> 3</td><td> 7</td><td> 7</td><td> 8</td><td> 1</td><td> 4</td><td> 1</td><td> 8</td><td>s</td><td> 8</td><td> 1</td><td> 0</td><td> 1</td><td> 7</td><td> 8</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td>

<td>CT-137-2-</td><td> 5</td><td>OR,</td><td> 4,</td><td> 24,</td><td> 3,</td><td> 12,</td><td> 29,</td><td> 0,</td><td> 2,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 1,</td><td> 7,</td><td> 0,</td><td>0r</td><td> 0/</td><td> 0,</td><td> 0/</td><td> 10,</td><td> 0,</td>

<td> 33</td><td> 3</td><td> 2</td><td> 7</td><td> 4</td><td> 0</td><td> 6</td><td> 4</td><td> 9</td><td>ε</td><td> 8</td><td> 1</td><td> 0</td><td> 3</td><td> 7</td><td> 9</td><td> 0</td><td> 1</td><td></td><td> 1</td><td> 8</td><td> 0</td>

<td>CT-137-2-</td><td> 5,</td><td> 0,</td><td> 4,</td><td> 24,</td><td> 3,</td><td> 11,</td><td> 31,</td><td> 0,</td><td> 2.</td><td>Or</td><td></td><td> 0,</td><td> 1,</td><td> ·?</td><td> 1,</td><td>0r</td><td>or.</td><td>or,</td><td> 0,</td><td> 10,</td><td> 0,</td>

<td> 48</td><td> 0</td><td> 7</td><td> 7</td><td> 1</td><td> 1</td><td> 9</td><td> 0</td><td> 9</td><td> 4</td><td> 9</td><td></td><td> 0</td><td> 5</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 5</td><td> 0</td>

<td>CT-137-2-</td><td> 5,</td><td> 0,</td><td> 4,</td><td> 22,</td><td> 3,</td><td> 12,</td><td> 34,</td><td> 1,</td><td> 2,</td><td> 0,</td><td>or,</td><td> 0,</td><td> 1,</td><td> 1,</td><td> 0,</td><td> 0,</td><td>or.</td><td> 0,</td><td>Qr</td><td></td><td> 0,</td>

<td>YES</td><td> 7</td><td></td><td> 6</td><td> 3</td><td> 4</td><td> 7</td><td> 5</td><td> 0'</td><td> 0</td><td> 8</td><td> 1</td><td> 0</td><td> 9</td><td> 2</td><td> 5</td><td> 0</td><td> 1</td><td> 7</td><td>Z</td><td> 7,9</td><td> 0</td>

<td>CT-137-2-</td><td> 5,</td><td> 0,</td><td> 3,</td><td> 25,</td><td> 3,</td><td> 12,</td><td> 7 7</td><td> 0,</td><td> 2,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 1,</td><td>To go</td><td> 0,</td><td> 0,</td><td>0r</td><td> 0,</td><td> 0,</td><td> 11,</td><td> 0,</td>

<td> 58</td><td> 4</td><td> 7</td><td> •9</td><td> 7</td><td> 4</td><td> 9</td><td> 8</td><td> 9</td><td> 6</td><td>s</td><td> 1</td><td> 0</td><td> 0</td><td> 9</td><td> 9</td><td> 0</td><td> 1</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td>

Table 9. Seed oil fatty acid composition of the T2 seed of B. napus transformed with the T-DNA of GA7-modB.

<td>or wo</td><td>or »t&gt;</td><td>&lt;Λ a ♦ * «or</td><td>t- * ♦ ® OR</td><td>® H ü</td><td>"or &lt;0 HU</td><td>• OR</td><td>oo o</td><td>in 60 H u</td><td>0 OR OR</td><td>C20: 2w6 + C21: 0</td><td>in S or 8</td><td>i or CM ü</td><td>n ♦ or NO</td><td>á u</td><td>u u</td><td>»» YES or</td>

<td> 6,</td><td> 2,</td><td> 8,</td><td> 3,</td><td> 6,</td><td>I,</td><td> 21,</td><td> 0,</td><td> 7,</td><td> 0,</td><td>or,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 1,</td><td> 34,</td>

<td> 3</td><td> 4</td><td> 4</td><td> 1</td><td> 9</td><td> 1</td><td> 9</td><td> 7</td><td> 5</td><td> 7</td><td> 1</td><td> 5</td><td> 5</td><td> 6</td><td> 2</td><td> 5</td><td> 3</td>

The seed oil samples also contained 0.1% C14: 0; 0.2% C16: 1; 0.1% C20: 3t06; no C22: l and C22: 2o6; 0.1% C24: 0 and 0.2% C24: 1, 2.6% of other fatty acids.

253

Example 4: TAG analysis of transgenic A. thaliana seeds producing DHA

The positional distribution of DHA in the TAGs of the transformed seeds of A. thaliana by NMR. The total lipids of approximately 200 mg of seed were extracted by breaking them first under hexane before transferring the broken seeds to a glass tube with 10 mL of hexane. The tube was warmed to approximately 55 ° C in a water bath and then passed vortex and centrifuged. The hexane solution was separated and the procedure was repeated another 4 times with 10 mL. The extracts were combined, were concentrated by rotary evaporation and the TAGs were purified from the extracted lipid separating them from the polar lipids by passage through a short column of silica using 20 mL of 7% diethyl ether in hexane. The positional distributions of the acyl groups in the TAGs were determined quantitatively purified as previously described (Petrie et al., 2010a and b).

Analysis showed that most of the DHA in the total seed oil was located at the snl / 3 positions of the TAGs with a little found at the sn-2 position. This was contrary to the TAGs of the seeds that produce ARA which showed that 50% of the ARA (20: 4 ^ 5,8,11,14) was located in the sn-2 position of the transgenic cane oil while

254 only 33% would be expected in a random distribution (Petrie et al., 2012).

The total lipids of the transgenic seeds of A. thaliana were also analyzed by triple quadrupole LC-MS to determine the major DHA-containing species (TAG) .The most abundant DHA-containing TAG species was DHA-18: 3-18: 3 (TAG 58:12; non-descriptive nomenclature positional distribution) where the second most abundant species was DHA-18: 3-18: 2 (TAG 58:11). Tri-DHA TAG (TAG 66:18) was observed in total seed oil, although Navajo levels but spot them. Other major TAG species that contained DHA included DHA-34: 3 (TAG 56: 9), DHA36: 3 (TAG 58: 9), DHA-36: 4 (TAG 58:10), DHA-36: 7 ( TAG 58:13) and DHA-38: 4 (TAG 60:10). The identities of the two major DHA-containing TAGs were further confirmed by QTOF MS / MS.

Example 5: Test of the content and composition of sterols in oils

Phytosterols from 12 vegetable oil samples purchased from commercial Australian sources were characterized by GC and GC-MS analysis as derivatives of Otrimethylsilyl ether (OTMSi ether) as described in Example 1. Sterols were identified by retention time, interpretation of mass spectra and comparison with

255 Mass spectral data from the literature and laboratory. Sterol was quantified using an internal standard of 5β (H) -Colan-24-ol. The basic structure of the phytosterols and the chemical structures of some of the identified sterols are shown in the

Figure 3 and Table 10.

The vegetable oils that were analyzed were from: sesame {Sesamum indicum), olive {Olea europaea), sunflower {Helianthus annus), castor {Ricinus communis), cane {Brassica napus), safflower (Carthamus tinctorius), peanut {Arachis hypogaea), flax {Linum usitatissimum) and soybean {Glycine max). In decreasing relative abundance across all oil samples, the main phytosterols were: β-sitosterol (range between 28 and 55% of total sterol content), Δ515 avenasterol (isofucosterol) (between 3 and 24%), campesterol ( 2-33%), A5-stigmasterol (0.7-18%), Δ7stigmasterol (1-18%), and A7-avenasterol (0.1-5%). Several other minority sterols were identified, these were: cholesterol, brassicasterol, calinasterol, campestanol and eburicol. Four other C29: 2 and two C30: 2 sterols were also detected, but further investigation is required to complete the identification of these minor components. In addition, several other unidentified sterols were present in some of the

256 oils, but due to their very low abundance, the mass spectra were not intense enough to allow the identification of their structures.

Table 10. Systematic IUPAC names of the identified estroles.

<td>Sterol No.</td><td>Common names</td><td>IUPAC / Name systematic</td>

<td> 1</td><td>cholesterol</td><td>cholest-5-en-3p-ol</td>

<td> 2</td><td>brassicasterol</td><td>24-methylcholesta-5,22Edien-3 β-οΐ</td>

<td> 3</td><td>chalinasterol / 24-methylene cholesterol</td><td>24-methylcholesta- 5.24 (28) Ε-άίεη-3β-θ1</td>

<td> 4</td><td>campesterol / 24methylcholesterol</td><td>24-methylcholest-5-en- 3β-θ1</td>

<td> 5</td><td>campestanol / 24-methylcholestanol</td><td>24-methíIcolestan-3β-οΐ</td>

<td> 7</td><td>A5-stigmasterol</td><td>24-ethylcholesta-5,22Eάίβη-3β-ο1</td>

<td> 9</td><td>ergost-7-en-3p-ol</td><td>24-methylcholest-7-en- 3β-θ1</td>

<td> 11</td><td>eburicol</td><td>4,4,14- trimethylergosta- 8.24 (28) -dien-3β-ol</td>

<td> 12</td><td>β-sitosterol / 24-ethyl cholesterol</td><td>24-ethylcholest-5-en-3βol</td>

<td> 13</td><td>D5-avenasterol / isofucosterol</td><td>24-ethylcholesta- 5.24 (28) Ζ-άϊθη-3β-ο1</td>

<td> 1’9</td><td>D7-stigmasterol / stigmast-7-en3b-ol</td><td>24-ethylcholest-7-en-3βol</td>

<td> 20</td><td>D7-avenasterol</td><td>24-ethylcholesterol 7.24 (28) -άίβη-3β-ο1</td>

The sterol contents in mg / g of oil in decreasing quantity were: cane oil (6.8 mg / g), sesame oil (5.8 mg / g), linseed oil (between 4.8 and 5.2 mg / g ),

257 sunflower oil (between 3.7 and 4.1 mg / g), peanut oil (3.2 mg / g), safflower oil (3.0 mg / g), soybean oil (3.0 mg / g), olive (2.4 mg / g), castor oil (1.9 mg / g). The compositions% of sterols and the total content of sterols are presented in Table 11.

Among all the seed oil samples, the majority phytosteol was in general β-sitosterol (range between 30 and 57% of total sterol content). There was a wide range among the oils in the proportions of the other major sterols: campesterol ( between 2 and 17%), A5-stigmasterol (between 0.7 and 18%), A5-avenasterol (between 4 and 23%), A7-stigmasterol (between 1 and 18%). The oils of the different species had a different sterol profile with some having somewhat distinctive profiles. In the case of cane oil, it had the highest proportion of campesterol (33.6%), while the samples of the other species in general had lower levels, for example up to 7% in peanut oil. Safflower oil had a relatively high proportion of A7-stigmasterol (18%), while this sterol was usually low in the samples of the other oils, up to 9% in sunflower oil. Because they were distinctive for each species, sterol profiles can therefore be used to aid in the identification of plant or vegetable oils.

258 specific and to verify if they are genuine or if they are adulterated with other oils.

Two samples each were compared from sunflower and safflower, producing in each case one by cold pressing the seeds and unrefined, while another was not cold pressed and refined. Although some differences were observed, the two oil sources had similar sterol compositions and total sterols contents, suggesting that processing and refining had little effect on these two parameters. The sterols content between the samples varied three times and ranged from 1.9 mg / g to 6.8 mg / g. Canoe oil had the highest sterol content and castor oil the least.

Example 6: Increased accumulation of DHA and DPA in the sn-2 position of TAGs

The present inventors considered that the accumulation of DHA and / or DPA in the sn-2 position of TAGs could be increased by co-expression of an 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) together with the DHA or DPA biosynthetic pathway conferred by the GA7 construction or its variants. The preferred LPAATs are those that can act on polyunsaturated fatty acyl-CoA C22 as a substrate, preferably DHA-CoA and / or DPA-CoA, especially those

259 that can utilize DHA-CoA and DPA-CoA as substrates, resulting in greater insertion of the C22 polyunsaturated chain at the sn-2 position of LPA to form PA, relative to endogenous LPAAT. Cytoplasmic LPAAT enzymes often show varied preferences for substrate, particularly when it synthesizes and accumulates unusual fatty acids in TAGs. An LPAAT2 from Limnanthes douglasiide demonstrated the use of erucoyl-CoA (C22: l-CoA) as a substrate for PA synthesis, contrary to a LPAATl from this same species that could not use C22 as a substrate (Brown et al., 2002).

260

Table 11. Sterol content and composition of vegetable oils tested.

<td rowspan="2">Sterol name common</td><td rowspan="2">Sés amn</td><td colspan="2">Ol</td><td rowspan="2">Laugh ino</td><td colspan="5">Co</td>

<td>iv o</td><td>Turn solf</td><td>Iz to</td><td>Cari; year</td><td>Ma neither</td><td>Li no</td><td>SW Ha</td>

<td></td><td></td><td> 0,</td><td></td><td></td><td> 0,</td><td></td><td> 0,</td><td> 0,</td><td> 0,</td>

<td>cholesterol</td><td> 0,2</td><td> 8</td><td> 0,2</td><td> 0,1</td><td> 3</td><td> 0,2</td><td> 2</td><td> 4</td><td> 2</td>

<td></td><td></td><td>or,</td><td></td><td></td><td> 0,</td><td></td><td>or.</td><td> 0,</td><td> 0,</td>

<td>brassicasterol </td><td> 0,1</td><td>or </td><td> 0,0</td><td> 0,3</td><td> 1</td><td> 0,0</td><td> 0</td><td> 2</td><td> 0</td>

<td>calinast er ol / 24-</td><td></td><td>or,</td><td></td><td></td><td> 2,</td><td></td><td> 0,</td><td> 1,</td><td> 0,</td>

<td>methylene cholesterol</td><td> 1,5</td><td> 1</td><td> 0,3</td><td> 1,1</td><td> 4</td><td> 0,2</td><td> 9</td><td> 5</td><td> 8</td>

<td>campesterol / 24-</td><td>1G,</td><td> 2,</td><td></td><td></td><td> 33</td><td></td><td> 17</td><td> 15</td><td> 16</td>

<td>stet i Icole s terol</td><td> 2</td><td> 4</td><td> 7,4</td><td>B, 4</td><td> , 6</td><td> 12,1</td><td> ,4</td><td> ,7</td><td> ,9</td>

<td>campestanol / 24-</td><td></td><td> 0,</td><td></td><td></td><td>or,</td><td></td><td>or,</td><td> 0,</td><td>or.</td>

<td>methylcholestanol</td><td> 0,7</td><td> 3</td><td> 0,3</td><td> 0,9</td><td> 2</td><td> 0, 8</td><td> 3</td><td> 2</td><td> 7</td>

<td></td><td></td><td>or.</td><td></td><td></td><td>or.</td><td></td><td> 0,</td><td> 1,</td><td>or,</td>

<td>C29: 2 *</td><td>Or or</td><td> 0</td><td> 0,1</td><td> 0,0</td><td> 1</td><td> 0,5</td><td> 0</td><td> 2</td><td> 1</td>

<td></td><td></td><td> 1,</td><td></td><td> 18,</td><td> 0,</td><td></td><td> 6,</td><td> 5,</td><td> 17</td>

<td>A5-stigmasterol</td><td> 6,4</td><td> 2</td><td> 7,4</td><td> 6</td><td> 7</td><td> 7,0</td><td> 9</td><td> 1</td><td> ,6</td>

<td></td><td></td><td>I,</td><td></td><td></td><td>or,</td><td></td><td> 0,</td><td>or.</td><td> 1,</td>

<td>unknown</td><td> 0,5</td><td> 3</td><td> 0,7</td><td> 0,8</td><td> 7</td><td> 0,7</td><td> 4</td><td> 7</td><td> 3</td>

<td></td><td></td><td>or.</td><td></td><td></td><td>or,</td><td></td><td> 1,</td><td> 1,</td><td> 1,</td>

<td>ergost-7-en-3p-ol</td><td> 0,1</td><td> 1</td><td> 1,9</td><td> 0,2</td><td> 4</td><td> 2,7</td><td> 4</td><td> 4</td><td> 0</td>

<td></td><td></td><td>I,</td><td></td><td></td><td> 0,</td><td></td><td> 1,</td><td>or,</td><td> 0,</td>

<td>unknown</td><td>or * or</td><td> 3</td><td> 0,9</td><td> 1,2</td><td> 9</td><td> 1,8</td><td> 2</td><td> 7</td><td> 7</td>

<td>eburicol</td><td> 1,6</td><td> 1,</td><td> 4,1</td><td> 1,5</td><td> 1,</td><td> 1,9</td><td> 1,</td><td> 3,</td><td> 0,</td>

261

<td></td><td> 8</td><td> 0</td><td> 2</td><td> 5</td><td> 9</td>

<td>p-sitosterol / 24-</td><td> 55, 45 37,</td><td> 50</td><td> 57</td><td> 29</td><td> 40</td>

<td>ethyl cholesterol.</td><td> 3 ,6 43,9 7</td><td> ,8 40,2</td><td> ,2</td><td> .9</td><td> ,2</td>

<td>AS-avenasterol /</td><td> 16 19,</td><td> 4,</td><td> 5,</td><td> 23</td><td> 3,</td>

<td>isofucosterol</td><td> 8,6 ,9 7,2 3</td><td> 4 7,3</td><td> 3</td><td> ,0</td><td> 3</td>

<td>alcohol</td><td> 2,</td><td>or,</td><td>or,</td><td>or.</td><td>or,</td>

<td>triterpenoid</td><td>bear * OV © * or</td><td> 0 1,6</td><td> 0</td><td> 0</td><td> 9</td>

<td>alcohol</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 0,</td>

<td>triterpenoid</td><td> 0,0 0 0,7 0,0</td><td> 0 2,8</td><td> 0</td><td> 0</td><td> 0</td>

<td>Δ7-</td><td></td><td></td><td></td><td></td><td></td>

<td>st igma ster ol / sti gma.s</td><td> 7,</td><td> 0,</td><td> 1,</td><td> 7,</td><td> 5,</td>

<td>t-7-en-3p-ol</td><td> 2,2 1 9,3 2,3</td><td> 9 10,5</td><td> 1</td><td> 9</td><td> 6</td>

<td></td><td> 0,</td><td>or,</td><td> 0,</td><td>or,</td><td> 0,</td>

<td>Λ7 — avenasterol</td><td> 1,3 1 4,0 0,6</td><td> 2 2,0</td><td> 7</td><td> 4</td><td> 6</td>

<td>Total sterol (mg / g</td><td> 2,</td><td> €,</td><td> 3,</td><td> 4,</td><td> 3,</td>

<td>oil)</td><td>I heard * Ή Ή «rw *</td><td> 8 3,2</td><td> 2</td><td> 8</td><td> 0</td>

C29: 2 * indicates a C29 sterol with two double bonds

Known LPAATs were considered and several were selected for testing, including some that were not expected to increase DHA incorporation at the sn-2 position, as controls. Known LPAATs included: LPAAT2 from Arabidopsis thaliana: (SEQ ID NO: 40, Accession No. ABG48392, Kim et al., 2005), LPAAT from Limnanth.es alba (SEQ ID NO: 41, Accession No. AAC49185 , Lassner et al., 1995), Saccharomyces cerevisiae Slclp (SEQ ID NO: 42, No. Accession NP_010231, Zou et al., 1997), LPAAT1 from Mortierella alpina (SEQ ID NO: 44, Accession No. AED33305; US 7879591) and LPAAT from Brassica napus (SEQ ID NO: 45 and SEQ ID NO: 46, Accession Nos. ADC97479 and ADC97478, respectively).

262

Arabidopsis LPAAT2 (also called LPAT2) is an enzyme that is located in the endoplasmic reticulum that shows activity on C16 and C18 substrates, however the activity on C20 or C22 substrates was not tested (Kim et al., 2005). LPAAT2 from Limnanthes alba was shown to insert an acyl-C22: len chain at the sn-2 position of PA, although its ability to use DHA or DPA as a substrate was tested (Lassner et al., 1995). The selected LPAAT of S. cerevisiae Slclp was shown to have activity using 22: 1-CoA in addition to 18: 1-CoA as substrates, indicating broad substrate specificity with respect to chain length (Zou et al., 1997). Again, DHA-CoA, DPA-CoA, and other LC-PUFAs were not tested as substrates. Mortierella's LPAAT had previously been shown to have activity on EPA and DHA fatty acids as substrates in transgenic Yarrowia lipolitica (US 7879591) but its activity in plant cells was unknown.

Other LPAATs were identified by the inventors. Micromonas pusilla is a microalgae that produces and accumulates DHA in its oil, although the positional distribution of DHA in the TAGs of this species has not been confirmed. The LPAAT of Micromonas pusilla (SEQ ID NO: 43, Access No. XP_002501997) was identified by searching for

263 Micromonas pusilla genomic sequence using Arabidopsis LPAAT2 as the BLAST entry sequence. Several candidate sequences emerged and the sequence from XP_002501997 was synthesized for testing in C22 LC-PUFA. The LPAAT Ricinus communis was annotated as putative LPAAT in the castor genomic sequence (Chan et al., 2010). Four candidate LPAATs were synthesized from the beaver genome and tested in crude leaf lysates of N-infiltrated leaf tissue. . benthamiana. The candidate sequence described herein showed activity as LPAAT.

Several candidate LPAATs were aligned with known LPAATs in a phylogenetic tree. It should be noted that the putative LPAAT from Micromonas did not cluster with the putative LPAATs from C22, but was a divergent sequence.

As an initial test for the various LPAATs to study their ability to use DHA-CoA and / or DPA-CoA as a substrate, chimeric genetic constructs were made for constitutive expression of exogenous LPAATs in N. benthamiana leaves, each under the control of the promoter. 35S, as follows: 35S: Arath-LPAAT2 (LPAAT from Arabidopsis ER); 35S: LimalLPAAT (LPAAT from Limnanthes alba); 35S: Sacce-Slclp (LPAAT from S. cerevisiae); 35S: Micpu-LPAAT (LPAAT from Micromonas pusilla); 35S: Moral-LPAATl (Mortierella alpina LPAAT); 35S: Brana-LPAATl.13 (LPAAT1.13 from Brassica napus); 35S: Brana

264

LPAAT1.5 (LPAAT1.5 from Brassica napus). A 35S: pl9 construct lacking an exogenous LPAAT was used as a control in the experiment; it was included in each inoculation of N. benthamiana. Each of these constructs was introduced by Agrobacteriumen leaves of N. benthamiana as described in Example 1, and after infiltration, the treated leaf areas were cut and ground to make leaf lysates. Each lysate included the exogenous LPAAT as well as the endogenous enzymes for the synthesis of LPA. The in vitro reactions were set up to separately add OA and DHA labeled with¹⁴Ca lysates. The reactions were incubated at 25 ° C and the level of incorporation of the fatty acids marked with¹⁴C in the PA by TLC. The ability of each LPAAT to use DHA was evaluated in relation to ARA and C18 fatty acids. Prairie grass (Limnanthes alba), Mortierella and Saccharomyces LPAATs were found to have activity on the DHA substrate, with radiolabelled PA appearing to these but not for the other LPAAT. All LPAATs were confirmed as active using the oleic acid control.

To test the activity of LPAAT in seeds, several of the protein coding sequences or LPAAT were inserted into a binary vector under the control of a conlinin promoter (pLuCnl2) .Genetic constructs

265 The resulting genes, containing the chimeric genes, Cnl2: ArathLPAAT (negative control), Cnl2: Limal-LPAAT, Cn2: Sacce-Slclp, and Cnl2: Moral-LPAAT, respectively, are then used to transform A. plants. thaliana that produce DHA in their seed to generate stable transormants that express the LPAATs and the transgenic DHA pathway in a seed-specific form to test whether increased incorporation of DHA is possible at the sn-2 position of TAGs. Constructs are also used to transform plants of B. napus γ C. sativa that already contain the GA7 construct and variants thereof (Examples 2 and 3) to generate progeny that carry both the parental LPAAT and the genetic constructs. The greater incorporation of DHA and / or DPA in the sn-2 position of the TAGs is tested in relation to the incorporation in plants that lack the LPAATs that encode for the transgenes. It also improves the oil content in the seeds, particularly for seeds that produce higher levels of DHA.

The seed-specific construct pCnl2: Moral-LPAATl was used to transform an already transgenic Arabidopsis thaliana line that was homozygous for the T-DNA of the GA7 construct and whose seeds contained approximately! 5% DHA in seed lipids (Petrie et al., 2012). For this, the selection marker gene kanamycin was used in

266 the pCnl2: Moral-LPAATl construct, which was different from the selection marker gene already present in the transgenic line. Transgenic seedlings that were resistant to kanamycin were selected and grown to maturity in a greenhouse. T2 seeds were harvested and the fatty acid composition of their total seed lipids was analyzed by GC (Table 12). Three phenotypes were observed among the 331 independent transformed lines. In a first group (6/331 lines), DPA increased significantly to a level substantially higher than the level of DHA, up to approximately 10.6% of total seed lipids. This came at the expense of DHA which was strongly depleted in this group of lines. In two of the lines of this first group, the sum of DPA + DHA was reduced, but not in the other 41 lines. In a second group (5/33), the levels of DPA and DHA were approximately equal, where the sum of DPA + DHA was approximately the same as in the parental seed. In the third group, the levels of DPA and DHA were similar to those of the párenteles seeds. A possible explanation for the higher level of DPA in the first and second groups is that LPAAT competes with Δ4-desaturase for the DPA-CoA substrate and preferentially incorporates DPA in PA and therefore in TAGs, in relation to the A4-desaturation. A second possible explanation is that the Δ4-desaturation is

267 partially inhibited.

The seeds of the Arabidopsistransí plants were harvested. formed with the T-DNA of the GA7 construct that had been further transformed with the Cnl2: ¡Moral-LPAAT vector and the oil was extracted from the seeds. The TAG fraction was then isolated from the extracted oil by TLC methods and recovered from the TLC plate. These TAG samples and seed oil samples were analyzed prior to fractionation by Rhizopus lipase digestion to determine the positional distribution of DHA. The lipase is specific for acyl groups esterified at the sn-1 or sn-3 position of TAGs. This was carried out by emulsifying each lipid sample in 5% gum arabic using an ultrasonicator, adding the 0.1M Rhizopusen lipase solution of Tris-HCI at pH 7.7 containing 125 mM CaC and incubating the mixtures at 30 ° C with continuous stirring. Each reaction was stopped by adding chloroform: methanol (2/1, v / v) and a volume of KC10, 1 M to each mixture. The lipids were extracted into the chloroform fraction and the relative amounts of the sn-2 MAG, sn-1/3 FFA, DAG and TAG components of the resulting lipids were determined by separation on TLC impregnated with 2.3% boric acid using hexane / diethyl ether / acetic acid (50/50/1, v / v). The lipid bands were visualized by spraying 0.01% primulin in

268 acetone / water (80/20, v / v) on the TLC plate and visualized under UV light. Individual lipid bands were identified based on standard lipid spots that were resolved on the same TLC plate. TLC lipid bands were collected in glass vials and their fatty acid methyl esters were prepared using methanol-HCl IN (Supelco) and incubated at 80 ° C for 2h. The fatty acid composition of individual lipids was analyzed by GC.

This assay demonstrated that DHA in GA7 transformed parental seeds (lines 22-2-ll and 22-2-38-7) was preferentially esterified at the sn-1 or sn-3 position of TAGs. On the contrary, DHA from NYU and NY15 seeds transformed with both with the GA7s construct and the transgene that codes for LPAAT was enriched in the sn-2 position, with 35% of DHA in one of the lines and 48% of DHA in the other line esterified in the position sn-2 of the TAGs, that is, after lipase digestion, DHA was present as sn-2-MAG (Table 13). Analogous results are obtained for B. napus and B. júncea seeds transformed with the T-DNA of the GA7-modB construct, as well as with the T-DNA encoding the LPAAT gene and producing DHA and with B. napus and B seeds. júncea that produces DPA.

In order to determine if Mortierella's LPAAT

269 or another LPAAT had a preference for DPA-CoA or for DHA-CoA, reactions are set up in vitro by adding separately DPA-CoA or DHA-CoA labeled with ¹⁴C to N. benthamiana leaf lysates that transiently express the candidate LPAAT under the control of a constitutive promoter as previously described. The reactions are incubated at 25 ° C and the level of incorporation of the fatty acids labeled with¹⁴C in PA by analysis of lipids by TLC. The ability of each LPAAT to use DHA-CoA is evaluated in relation to DPACoA. Genes encoding LPAAT that were confirmed to have good LPAAT activity for DHA incorporation are used to produce transformed DHA-producing plants and hemp seeds.

Genes encoding LPAATs having high activity using DPA-CoA are used to transform DPA-producing plants and seeds, to increase the amount of DPA that is esterified at the sn-2 position of TAGs.

Table 12. Fatty acid composition (% of total fatty acids) A. thaliana transgenic seeds transformed with a LPAAT1 construct as well as with the GA7 construct T-DNA for DHA production. C20: 4o6 was not detected in the seeds. The seeds also contained 0.3-0.9% C22: 0 and 0.4-1.5% C22: 1.

270

<td colspan="2"></td><td colspan="5"></td><td> &lt;0</td><td>in</td><td colspan="3">«H</td><td>in</td><td>L0</td><td></td><td></td><td>&lt;n</td><td colspan="2"></td>

<td></td><td></td><td>OR M3 H or</td><td>or 3v * V</td><td>w 2 Ή Y</td><td>18 í 1M</td><td>«4 Ó» • 4 ü</td><td>$ »HV</td><td>£ ® HU</td><td>QO and</td><td> 3 ¿&gt;</td><td>3 H^:Or heard</td><td>3 H OR</td><td>á or » Q "4 V</td><td>or «4 V</td><td>3 RV</td><td>to or &lt;4 V</td><td>3 sn CM</td><td>one yes or</td>

<td></td><td>Ν</td><td> 9,</td><td> 3</td><td> 9,</td><td> 6</td><td> 9,</td><td> 0</td><td> 23</td><td> 1</td><td> 4</td><td> 7</td><td> 5</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 7,</td><td> 4,</td>

<td></td><td>Y one</td><td> 3</td><td>F 2</td><td> 1</td><td> 8</td><td> 4</td><td>F 5</td><td> ,8</td><td>r 6</td><td>F one</td><td> 9</td><td>F one</td><td>F 6</td><td>r 9</td><td> 6</td><td>F 2</td><td> 9</td><td> 5</td>

<td> 5</td><td> »</td><td> 10</td><td> 3</td><td> 6,</td><td> 4</td><td> 7,</td><td> 0</td><td> 28</td><td> 1</td><td> 4</td><td>and.</td><td> 3</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 1,</td><td> 11</td>

<td></td><td>Y 2</td><td> ,7</td><td>í 3</td><td> 5</td><td>F 4</td><td> €</td><td>F 3</td><td> ,1</td><td> 9</td><td>F 3</td><td> 5</td><td> * 7</td><td>r 7</td><td>to one</td><td>F one</td><td> 9 4</td><td> 1</td><td> ,6</td>

<td></td><td>N</td><td> 9,</td><td> 2</td><td> 6_F</td><td> 3</td><td> 10</td><td> 0</td><td> 32</td><td> 2</td><td> 2</td><td> 6,</td><td> 3</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1,</td><td> 10</td>

<td></td><td>Y 3</td><td> 3</td><td>re</td><td> 3</td><td>r 4</td><td> , 3</td><td>r 2</td><td> ,8</td><td> 2</td><td>F 7</td><td> 2</td><td>F 6</td><td>F one</td><td>F 9</td><td>F 4</td><td> 9 7</td><td> 0</td><td> ,7</td>

<td></td><td>NT</td><td> 11</td><td> 3</td><td> 4,</td><td> 3</td><td> 7,</td><td> 0</td><td> 32</td><td> 2</td><td> 4</td><td>yes,</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0,</td><td> 14</td>

<td></td><td>Y 4</td><td></td><td> / 5</td><td> 5</td><td>r one</td><td> 0</td><td>r 3</td><td> ,5</td><td>F one</td><td>F 7</td><td>s</td><td>F 3</td><td>or</td><td>F 9</td><td>F 8</td><td>F one</td><td> 9</td><td> »3</td>

<td rowspan="2"> 10</td><td>N</td><td> 14</td><td> 4</td><td> 7,</td><td> 7</td><td> 6,</td><td> 0</td><td> 20.</td><td> 2</td><td> 5</td><td> 5,</td><td> 4</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td>b</td><td> 11</td>

<td>Y</td><td> / 6</td><td>F 5</td><td> 0</td><td>F 7</td><td> 7</td><td>F 3</td><td></td><td> 2</td><td>F 7</td><td> 4</td><td>F 8</td><td> 9 4</td><td>F 9</td><td> 9 8</td><td>F 2</td><td> 0</td><td> ,7</td>

<td></td><td>N</td><td> 7,</td><td> 2</td><td> 12</td><td> 2</td><td> 18</td><td> 0</td><td> 24</td><td> 1</td><td> 0</td><td> 15</td><td> 3</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 3,</td><td> 0,</td>

<td></td><td>Y 6</td><td> 8</td><td>F 7</td><td> ,5</td><td>r 2</td><td> ,0</td><td>F one</td><td> ,9</td><td>F 8</td><td>F 7</td><td> ,5</td><td> 1</td><td>F 4</td><td>F 2</td><td> 5</td><td> 9 3</td><td> 0</td><td> 8</td>

<td></td><td>N</td><td> 9,</td><td> 2</td><td> 6,</td><td> 3</td><td> 9,</td><td> 0</td><td> 31</td><td> 2</td><td> 3</td><td> 1,</td><td> 3</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1,</td><td> 10</td>

<td></td><td>Y 7</td><td> 3</td><td> 9 9</td><td> 7</td><td>F 8</td><td> 2</td><td>F 7</td><td> ,5</td><td>F one</td><td>F 2</td><td> 5</td><td> / 7</td><td>r 9</td><td>F 6</td><td> 3</td><td>F 8</td><td> 1</td><td> ,9</td>

<td></td><td>N</td><td> 8,</td><td> 3</td><td> 8,</td><td> 5</td><td> 11</td><td> 0</td><td> 25</td><td> 1</td><td> 3</td><td> 8,</td><td> 5</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 6,</td><td> 6,</td>

<td> 15</td><td>Y to</td><td> 8</td><td>F 2</td><td> 2</td><td>F 5</td><td> ,0</td><td>F 3</td><td> ,3</td><td>F 9</td><td> ? 0</td><td> 3</td><td> 4</td><td>r 0</td><td>F</td><td> 9 8</td><td>F 8</td><td> 1</td><td> 0</td>

<td></td><td>H</td><td> 12</td><td> 3</td><td> 5,</td><td> 4</td><td> 7,</td><td> 0</td><td> 28</td><td> 2</td><td> 4</td><td> 5,</td><td> 3</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 1,</td><td> 13</td>

<td></td><td>Y 9</td><td> ,3</td><td>t Ί</td><td> 0</td><td>r 6</td><td> 1</td><td>F 2</td><td> ,3</td><td>F 3</td><td>F 2</td><td> 6</td><td>F 8</td><td>F 8</td><td> 9 6</td><td> / 7</td><td>r one</td><td> 2</td><td> »8</td>

<td></td><td>N</td><td> 8,</td><td> 3</td><td> 8,</td><td> 3</td><td></td><td> 0</td><td> 31</td><td> 1</td><td> 3</td><td> 8,</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 10</td><td> 1,</td>

<td></td><td>Y 1 0</td><td> 6</td><td> 9</td><td> 5</td><td>F one</td><td> 7</td><td> / 3</td><td> ,5</td><td>F 6</td><td>F 4</td><td> 7</td><td>F 8</td><td> / 0</td><td>F 3</td><td> 9</td><td>F one</td><td> /6</td><td> 0</td>

<td rowspan="2"> 20</td><td>N</td><td> 11</td><td> 3</td><td> 4,</td><td> 2</td><td> 7,</td><td> 0</td><td> 33</td><td> 2</td><td> 3</td><td> 5,</td><td> 1</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 1,</td><td> 15</td>

<td>Y one one</td><td> ,5</td><td> 9</td><td> 5</td><td>F 5</td><td> 1</td><td>F 3</td><td> ,3</td><td>F one</td><td>F 9</td><td> 7</td><td>F 9</td><td>F 9</td><td> 9 0</td><td>F 7</td><td> 8</td><td> 0</td><td> ,6</td>

<td></td><td>N</td><td> 8,</td><td> 3</td><td> 7,</td><td> 5</td><td> 8,</td><td> 0</td><td> 26</td><td> 2</td><td> 3</td><td> 8,</td><td> 5</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 10</td><td> 2,</td>

<td></td><td>Y</td><td> 7</td><td>F</td><td> 5</td><td>r</td><td> 5</td><td>F</td><td> ,8</td><td> #</td><td>.F</td><td> 7</td><td>F</td><td>F</td><td>F</td><td>t</td><td> 9</td><td> ,0</td><td>β</td>

271

<td>1 2 Ν and 1 3 Μ Y 1 4 Ν Y 1 5 Μ Y 1 6 Η Y 1 7 Ν Y 1 8 Μ Y 1 9 Ν Y 2 0 Ν Y 2 1 Η Y 2 2</td><td>2 1 2 07 19 2 12 ' 11 3 5, 3 8, 0 30 2 5 6, 3 0 1 1 1 1, 11 , 5, 2, 3,, 0 ,, 2 ,,,,, 0.6 4 4 3 20 29 751 9, 2 6, 2 10 0 34 1 3 7, 1 1 1 1 0 0, 11 2.6,, 3,, 7,, 7 ,,,,, 0.1 9 0 2 93 62 829 10 3 4, 2 7, 0 34 1 5 5, 2 0 1 0 1 1, 14 , 9, 6, 0,, ​​1,, 5,,,,, 0, 7 3 7 3 91 09 880 10 3 6, 4 7, 0 30 14 5, 20101 1, 14 , 5, 0, 8,, 3,, 4,,,,, 3, 2 4 6 3 8 4 9 7 5 9 1 9, 2 5, 2 10 0 35 1 3 6, 2 1 1 1 1 0, 11 1.9,, 4,, 4 ,, 4, ,,,, 9.7 4 5 2 6 € 11920 9, 3 8, 6 12 0 21 1 4 8, 5 0 0 0 1 5, 5, 7, 8,, 1, , 0,, ​​3,,,,, 7 1 6 2 3 90 98 960 8, 3 12 3 14 0 28 1 1 11 3 1 1 0 0 3, 1, 4,, 0,, ​​€,, 8,,, 3,,,,, 9 2 1 1 2 7 € 2 0 4 6 6 10 3 5, 3 8, 0 32 2 4 5, 2 1 1 1 0 1, 12 , 1, 4, 9,, 8,, 5,,,,, 1, 1 2 3 3 1 1 8 0 9 1 9 10 3 5, 3 8, 0 31 2 4 5, 2 0 1 0 1 0, 12 , 5, 6, 2,, 9, 9,,,,, 9, 5 6 8 3 06 8 9 7 Β 0 8, 3 7, 2 9, 0 33 1 3 8, 2 1 1 1 1 5, 6, 4, 4, 4,, 5,, 8,,,,, 5 1 3 3 2 8 4 22 730</td>

272

Table 13. Presence of DHA in the sn-2 position of TAGs or in the total oil of transgenic A seeds. thaliana transformed with the Cnl2 :: Moral-LPAAT gene as well as the T-DNA of the GA7 construct, showing the distribution of DHA positions in TAGs. The fatty acid compositions of the TAGs and sn-2 MAGs also contained between 0 and 0.4% of each of 14: 0, 16: lal3t, 16: 2, 16: 3, 22: 0, and 24: 0. . The seeds contained no

Ο20: 3ω6, C20: 4o4 not detected.

<td>Teacher</td><td>O ©</td><td>to ©</td><td>or 3</td><td> 3</td><td>C18: 1Δ1</td><td>IM ·· 3</td><td> © 3</td><td>ε «€ ϊ8Τ0</td><td>or §</td><td> © 3</td><td>C20: 1Δ1</td><td>to 8 u</td><td>C20: 2®6</td><td></td><td>1st</td><td></td><td>á u</td><td> ©</td><td> §</td><td>yes u</td><td>to</td>

<td>22-21-1 TAG</td><td colspan="21" rowspan="2">* 04 637 0 ^ 149 2 0 ^ 11 0 2 0 0 * ffffrrtfrfffrftrr '44492 8' 637 37 3 061 0 7 ' 2 8 1 fifteen § 0 0 0 8 2 ^ 0 ^ 060 0 0 0 003 0 2 6 1 335 '7' 253 113 208 0 3 ¹ 1 9</td>

<td>2-MAG</td>

<td colspan="22">DHA in sn-2 = 30%</td>

<td>22-23B-7 olí</td><td colspan="21" rowspan="2">i ........ 0 03 626 0 ^ 13 ^ 101001 ° 1 rrrrrr, rrrrfrtr '27074 4' 67 '883962 1' 0 3 3 6 0 0092 * 0 ^ 030 0 0 0 0 0 2 0 1 6 1 u tf * gtftttift! iiftt 5 1374 '6θ 163 11 4 2 01 137</td>

<td>2 — MAG</td>

<td colspan="22">DHA in sn-2 = 19%</td>

<td colspan="22">Further transformed with a gene encoding LPAAT from Alpine Mortierella:</td>

<td>NY11- TAG</td><td colspan="21" rowspan="2">* 03 629 0 '136 1110 0' 0 000 * / fftttftfl! tl II f&gt;! '240 8 2 3' 663 8 0S769016 ' 0 0 2 0 0 0 611 04 030 10 1 00 0 0 01 1 rfffrf $ 9 / fg</td>

<td>2-MAG</td>

273

<td></td><td> 7</td><td> 1</td><td> 2</td><td> 7</td><td> 1</td><td>r 8</td><td> 3</td><td>F 8</td><td></td><td> 7</td><td> 5</td><td> 5</td><td> 3</td><td> 6</td><td> €</td><td> 1</td><td> 8</td><td> 1 2</td><td> €</td><td> 9 8</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>DHA</td><td>in</td><td>sn-2</td><td> =</td><td> 48%</td>

<td>oil</td><td> 1</td><td> 0</td><td> 3</td><td> 4</td><td> 2</td><td> €</td><td> 0</td><td> 3</td><td> 2</td><td> 5</td><td> 5</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0'</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td>

<td rowspan="2">e NY-</td><td rowspan="2"> 1</td><td></td><td></td><td></td><td></td><td></td><td></td><td rowspan="2"> 3</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 4</td>

<td>r</td><td>r</td><td>Y</td><td>F</td><td></td><td></td><td>F</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td>r</td><td>r</td><td> 9</td><td>t</td><td>F</td><td></td>

<td> 15</td><td>r 0</td><td> 0</td><td> 3</td><td> 6</td><td> 8</td><td> 5</td><td> 3</td><td>F 6</td><td> 0</td><td> 1</td><td> 5</td><td> 1</td><td> 9</td><td> 9</td><td> 7</td><td> 6</td><td> 9</td><td> 4</td><td> (9</td><td> 9 9</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td rowspan="2"> 1</td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td>

<td rowspan="3">2-MAG</td><td rowspan="2"> 0</td><td rowspan="2"> 0</td><td rowspan="2"> 0</td><td rowspan="2"> 6</td><td rowspan="2"> 1</td><td rowspan="2"> 0</td><td rowspan="3"> 0</td><td rowspan="2"> 0</td><td rowspan="2"> 4</td><td rowspan="2"> 0</td><td rowspan="2"> 1</td><td rowspan="2"> 0</td><td rowspan="2"> 1</td><td rowspan="2"> 0</td><td rowspan="2"> 0</td><td rowspan="2">Q</td><td rowspan="2"> 0 0</td><td rowspan="2"> 1</td><td rowspan="3"> 6</td>

<td rowspan="2">í</td>

<td>r</td><td>F</td><td></td><td> 9</td><td> /</td><td>r</td><td> /</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td>t</td><td> 9</td><td> 9</td><td> 9 9</td><td>F</td>

<td></td><td> 8</td><td> 1</td><td> 3</td><td rowspan="2"> 4</td><td rowspan="2"> 3</td><td>F</td><td> 3</td><td> 9</td><td> 2</td><td rowspan="2"> 9</td><td rowspan="2"> 4</td><td rowspan="2"> 4</td><td> 2</td><td> 5</td><td> 6</td><td> 1</td><td> 9</td><td> 0 2</td><td> 6</td><td rowspan="2">Λ 7</td>

<td></td><td></td><td></td><td></td><td> 4</td><td></td><td> 2</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>DHA</td><td>in</td><td>sn-2</td><td> =</td><td> 37%</td>

Example 7: Further analysis of transgenic Camelina sativa seeds

Total lipid content

Seeds of C. sativa that were homozygous for the GA7 construct T-DNA and that contained DHA in their total fatty acid content were analyzed for their total content and lipid composition as follows. Two consecutive solvent extraction steps were carried out on the seeds, first using hexane and then using chloroform / methanol. No antioxidants were added during extractions or analysis. The Soxhlet extraction method that is commonly used to extract lipids from seed by prolonged heating and reflux of the lipid / solvent mixture was not used here, due to the potential degradation or oxidation of ω3 PUFAs such as DHA.

Hexane was used as a solvent in the first extraction because it is the standard in the industry of

274 oil seeds. Also, it preferably extracts TAG-containing oil due to its solvation properties and its relatively low solubilization of polar lipids, particularly at room temperature. Transformed seeds and Camelina control (130g and 30g, respectively) were moistened with hexane and broken using an electric mortar and agate latch (Retsch Muhle, Germany). The mixtures were transferred to separating vessels and extracted four times using a total of 800 mL of hexane, including a static extraction overnight for the third extraction. For each extraction, extracts were filtered to remove fine particles through GFC glass fiber filter under vacuum, and then rotary evaporated at 40 ° C under vacuum. The extracts were pooled and these constituted the TAG-rich hexane extracts.

After extraction with hexane, the rest of the seed meal was further extracted using chloroformomethanol (CM, 1: 1 v / v) using the hexane extraction procedure. The flour was then removed by filtration and the combined extracts were rotary evaporated. The pooled crude lipid extracts of total MC were then dissolved using a one-phase methanol-chloroform-water mixture (2: 1: 0.8 v / v / v). The

275 phases by adding chloroform-water (final solvent ratio, 1: 1: 0.9 v / v / v methanol-chloroform-water). The purified lipid from each extract was partitioned into the lower chloroform phase, concentrated using rotary evaporation and these constituted the polar lipid rich CM extracts. The lipid content in each of these extracts was determined by gravimetry.

For the fatty acid composition analysis, the hexane and CM extracts were trans-methylated according to the method of Christie et al. (1982) to produce fatty acid methyl esters (FAME) using methanol-chloroform-concentrated hydrochloric acid (3mL, 10: 1: 1, 80 ° C, 2h). The FAME were extracted in hexane-chloroform (4: 1, 3 xl, 8mL). Samples of the remaining seed meal (between 1 and 2g) were also transmethylated after the extractions with hexane and CM to measure the residual lipids as FAME by gravimetry. The total lipid content of the seeds was calculated by summing the lipid contents of the hexane and CM extracts and the FAME content of the transmethylated flour after solvent extraction.

Transgenic seeds contained slightly less total lipids at 36.2% seed weight compared to wild-type Camelina sativa seeds at 40.9% seed weight. For the

276 seeds including oil seeds, total lipids were determined as the sum of solvent-extractable lipids through consecutive extractions with hexane, then chloroform-methanol, plus the residual lipid released by transmethylation of the extracted flour after solvent extractions, as exemplified in the present. This total lipid consisted mainly of fatty acid containing lipids such as triacylglycerols and polar lipids and small amounts of lipids without fatty acids, for example phytosterols and fatty alcohols which may be present in free non-esterified or esterified with fatty acids. In addition, the esters of sterols or esters of waxes and hydrocarbons such as carotenoids, eg p-carotene, if present, were also included in the solvent-extractable lipid. These were included in the overall gravimetric determination and indicated in the TLC-FID analysis (Table 14). '

Of the total lipids, between 31% and 38% of the lipids by weight of seed were extracted with hexane, for the transgenic and control seeds, respectively, which accounted for 86% and 92% of the total lipids in the seeds. Extraction with CM recovered another 4.8% and 2.4% (of the seed weight), mainly as extract rich in polar lipids at

277 starting from transgenic and control seeds, respectively. The residual lipid that was released by transmethylation of the rest of the oilseed meal extracted with solvent was 0.3% and 0.4% of the seed weight, respectively. That is, the first and second solvent extraction together extracted 99% of the total lipid content of the seeds (that is, 36.2% or 40.9% of the seed weight, which is mostly lipid containing fatty acids). as triglycerides and polar lipids consisting of glyco and phospholipids (see next section - Analysis of lipid classes)).

Analysis of lipid classes

The lipid classes of the hexane and CM extracts were analyzed by flame ionization detection thin-layer chromatography (TLC-FID; latroscan Mark V, latron Laboratories, Tokyo, Japan) using hexane / diethyl ether / glacial acetic acid (70: 10: 0.1, v / v / v) as a developing solvent system in combination with Chromarod S-III quartz and silica rods. Suitable calibration curves were prepared using representative standards obtained from Nu-Chek Prep, Inc. (Elysian, MN, USA). The data were processed using the SIC-480II program (SISC Version: 7.0-E). The phospholipid species were separated by applying the purified phospholipid fraction obtained from the chromatography

278 on a silica column and developing the rods in chloroform / methanol / glacial acetic acid / water (85: 17: 5: 2, v / v / v) before detection by FID.

To separate the TAG, glycolipid and phospholipid fractions from the CM extracts, silica gel 60 (100-200 mesh) (0.3-1 g) was used in a short glass column or Pasteur pipette capped with glass wool to purify 10 mg of the purified CM lipid extract. The residual fraction of TAG in the MC extract was eluted using 20 mL of 10% diethyl ether in hexane, the glycolipids were eluted with 20 mL of acetone and the phospholipids were eluted in two steps, first with 10 mL of methanol then with 10^: mLd.e ,. methanol-chloroform-water (5: 3: 2). This second elusion increased phospholipid recovery. The yield of each fraction was determined by gravimetry and the purity was verified by TLC-FID. All extracts and fractions were stored in dichloromethane at -20 ° C until subsequent analysis by GC and GC-MS.

The TAG-rich hexane extracts from each of the transgenic and control seeds contained approximately 96% TAG. The CM extracts contained residual amounts of TAG of 44% and 13% by weight of the CM extracts, respectively, for the transgenic and wild-type seeds. Contrary to hexane extracts,

279 CM extracts were rich in polar lipids, namely phospholipids and glycolipids, with an amount of 50% and 76% by weight of the CM extracts, respectively, for the transgenic and control seeds (Table 14). The main phospholipid was phosphatidylcholine (PC) and with a quantity of between 70% and 79% of total phospholipids followed by phosphatidylethanolamine (PE, between 7% and 13%) with relatively low levels of phosphatidic acid (PA, between 2% and 5%) and phosphatidylserine (PS, &lt;2%).

Fatty acid composition

In general, for seeds that produce DHA and / or DPA, the inventors observed that the fatty acid composition of the total lipids in the seeds, determined by direct transmethylation of all lipids in the seed, was similar to that of the fraction by TAG. This was because more than 90% of the total lipids present in the seed were in the form of TAG.

The fatty acid composition of the different lipid classes in the hexane and CM extracts was determined by gas chromatography (GC) and GC-MS analysis using an Agilent Technologies 6890A GC instrument (Palo Alto, CA, USA). provided with a Supelco Equity ™ -1 fused silica capillary column (15 mx 0.1 mm id, 0.1 pm film thickness, Bellefont, ΡΆ, USA), an FID, an injector with

280 splitter / splitterless and an Agilent Technologies 7683B Series autosampler and injector. The carrier gas was Helium. Samples were injected in no-divider mode at an oven temperature of 120 ° C. After injection, the oven temperature was raised to 270 ° C at 10 ° C min^-1 and finally at 300 ° C to 5 ° C min^-1. The eluted compounds were quantified with the Agilent Technologies ChemStation program (Palo Alto, CA, USA). The GC results contained an error of more than ± 5% of the individual component areas.

Table 14. Composition of lipid classes (% of total lipids obtained for each extraction step) of hexane and CM extracts from transgenic seeds and Camelina sativa control. SE, WE and

HC did not separate from each other.

<td rowspan="2">Kind of lipid</td><td colspan="2">Transgenic seeds</td><td colspan="2">Control seeds</td>

<td>Hexane</td><td>CM</td><td>Hexane</td><td>CM</td>

<td>se / we / hc *</td><td> 1,0</td><td> 1,4</td><td> 1,0</td><td> 1,4</td>

<td>TAG</td><td> 95,6</td><td> 44,2</td><td> 96,0</td><td> 13,1</td>

<td>FFA</td><td> 0,9</td><td> 1,3</td><td> 0,8</td><td> 1,4</td>

<td>A**</td><td> 0,9</td><td> 1,1</td><td>* or</td><td> 1,2</td>

<td>ST</td><td>Or σι</td><td> 0,7</td><td> 0,4</td><td> 0,4</td>

<td>MAG</td><td> 0,7</td><td> 1,1</td><td>O *. CP</td><td> 6,2</td>

<td>PL</td><td> 0,3</td><td> 50,3</td><td>* OR</td><td> 76,3</td>

<td>Total</td><td> 100,0</td><td> 100,0</td><td> 100, 0</td><td> 100,0</td>

Abbreviations: sterol esters (SE), wax esters (WE), hydrocarbons (HC), triacylglycerols (TAG), free fatty acids (FFA), unknown (UN), sterols (ST), monoacylglycerols (

281

MAG), polar lipids (PL) consisting of glycolipids and phospholipids; * SE, WE and HC coelute with the use of this system; ** May contain fatty alcohols and diacylglycerols (DAG).

Analysis by GC-mass spectrometry (GC-MS) was carried out on a Finnigan Trace ultra QuadrupoleGC-MS (model: ThermoQuest Trace DSQ, Thermo Electron Corporation). The data were processed with the ThermoQuest Xcalibur program (Austin, TX, USA). The GC had a column injector and an HP-5 Ultra Agilient J &amp; W capillary column (50m x 0.32mm id, 0.17 pm film thickness, Agilent Technologies, Santa Clara, CA, USA) similar in polarity to that previously described. Individual components were identified using mass spectral data and by comparison of retention time data with those obtained by authentic and laboratory standards. A full procedure blank analysis was performed concurrently with the batch of samples.

The data for the composition of fatty acids in the different classes of lipids in the extracts are shown in Table 15. In Camelina seeds that produce DHA, DHA was distributed in the major lipid fractions (TAG, phospholipids and glycolipids) in a proportion in the range between 1.6% and 6.8% with an inverse relationship between

282 proportions of DHA and ALA. The TAG-rich hexane extract from the transgenic seeds contained 6.8% DHA and 41% ALA (Table 15). The CM extract rich in polar lipids contained 4.2% DHA and 50% ALA, that is, relatively less DHA and more ALA. The residual TAGs of the polar lipid rich MC extract contained 6% DHA and 40% ALA. The glycolipid fraction isolated from the MC extract contained 3% DHA and 39% ALA and the phospholipid fraction contained the lowest level of DHA (1.6%) and the highest levels of ALA (54%). The transgenic seeds of Camelina contained higher levels of ALA and lower levels of LA (linoleic acid, 18: 2ω6) compared to the control seeds in the major lipid classes (TAG, glycolipids and phospholipids). The proportions of ALA and LA were: ALA between 39% and 54% and LA between 4% and 9% for the transgenic seeds and ALA between 12% and 32% and LA between 20% and 29% for the control seeds. The relative level of erucic acid (22: 1ω9) was lower in all fractions in the transgenic seeds than in the control seeds, for example, in the hexane extracts 1.3% versus 2.7% (Table 15).

Composition of sterols in seeds

To determine the sterol content and the composition in the extracted lipids, samples of approximately 10 mg of total lipids from the extract were saponified.

283 TAG-rich hexane and the polar lipid-rich CM extract using 4 mL of 5% KOH in 80% MeOH and heated for 2 h at 80 ° C in a Teflon-lined screw-cap test tube. After cooling the reaction mixtures, 2 mL of Milli-Q water were added and the sterols and alcohols were extracted three times in 2 mL of hexane: dichloromethane (4: 1, v / v) by stirring and vortexing. The mixtures were centrifuged and each extract in the organic phase was washed with 2 mL of Milli-Q water by shaking and centrifugation. After separating the upper organic phase containing sterol, the solvent was evaporated using a stream of nitrogen gas and the sterols and alcohols were silylated using 200 pL of Bis (trimethylsilyl) trifluoroacetamide (BSTFA, Sigma-Aldrich) heating for 2 h at 80 ° C in a sealed GC vial. By this method, the free hydroxyl groups were converted to their trimethylsilyl esters. The OTMSi derivatives of sterol and alcohol were dried under a stream of nitrogen gas in a heating block (40 ° C) and redissolved in dichloromethane (DCM) immediately prior to GC / GC-MS analysis as previously described.

284

Table 15. Fatty acid composition (% of total fatty acids) of lipid extracts and fractions of transgenic seeds and control of C. sativa.

<td colspan="7">Transgenic seeds</td><td colspan="6">Control seeds</td>

<td rowspan="2">Acid</td><td>Hex</td><td colspan="3">CM</td><td></td><td>Bari</td><td>Hexa</td><td colspan="4">CM</td><td>Bari</td>

<td>TA 6</td><td>To ta</td><td>TA G</td><td>GL</td><td>PL</td><td>Bes idu</td><td>TAG</td><td>To ta</td><td>TAS</td><td>GL</td><td>PL</td><td>Bes idu</td>

<td> 16:</td><td> 0,1</td><td> 0,</td><td> 0</td><td> 0,</td><td> 0</td><td> 0,2</td><td> 0,1</td><td> 0,</td><td> 0,2</td><td></td><td></td><td> 0,3</td>

<td> 16:</td><td> 6,2</td><td> 12</td><td> 6</td><td> 21,</td><td> 19</td><td> 10,4</td><td> 6,7</td><td> 12</td><td> 7,8</td><td> 29</td><td> 13</td><td> 10,3</td>

<td> 18:</td><td> 3,7</td><td> 3,</td><td> 3</td><td> 2,</td><td> 2</td><td> 3,6</td><td></td><td></td><td></td><td> ”</td><td> ”·</td><td></td>

<td> 18:</td><td> 7,1</td><td> 3,</td><td>S</td><td> 7,</td><td> 3</td><td> 8,8</td><td> 22,2</td><td> 28</td><td> 29,</td><td> 20</td><td> 29</td><td> 27,9</td>

<td> 18:</td><td> 41,9</td><td> 50</td><td> 3</td><td> 30,</td><td> 54</td><td> 38,9</td><td> 32,0</td><td> 20</td><td> 19,</td><td> 13</td><td> 12</td><td> 20,0</td>

<td>IB:</td><td> 1</td><td> 4,</td><td> 9</td><td> 7,</td><td> 2</td><td> 8,1</td><td> 14,0</td><td> 25</td><td> 13,</td><td> 14</td><td> 35</td><td> 14,3</td>

<td> 18:</td><td> 1,4</td><td> 2,</td><td> 2</td><td> 3,</td><td> 3</td><td> 2,8</td><td> 1,0</td><td> 1,</td><td> 2,2</td><td> 4,</td><td> 2</td><td> 7 7</td>

<td>IB:</td><td> 3,2</td><td> 4,</td><td> 3</td><td> 4,</td><td> 5</td><td> 3,1</td><td> 3,0</td><td> 2,</td><td> 2,9</td><td> 5,</td><td> 3</td><td> 2,7</td>

<td> 20:</td><td> 0,4</td><td> 0,</td><td> 0</td><td> -</td><td> —</td><td> 0,3</td><td> —</td><td> —</td><td> —</td><td> -</td><td> -</td><td> —</td>

<td> 20:</td><td> 0,4</td><td> 0,</td><td> 0</td><td></td><td> 0</td><td> 0,3</td><td> -</td><td> -</td><td> -</td><td> -</td><td> -</td><td> -</td>

<td> 20:</td><td> 0,7</td><td>or,</td><td>Q</td><td> 0,</td><td> 0</td><td> 0,7</td><td>i, e</td><td> 0,</td><td> 2,1</td><td> 1,</td><td> -</td><td> 1,8</td>

<td> 20:</td><td> 0, 8</td><td> 1,</td><td> 0</td><td> 0,</td><td> 1</td><td> 0,5</td><td> 0,9</td><td> 0,</td><td> -</td><td> -</td><td> -</td><td> 0,4</td>

Abbreviations: triacylglycerols (TAG), glycolipids (GL), phospholipids (PL); Total: extract rich in polar lipids containing GL and PL from extraction with CM; TAG, GL and PL were separated by silica column chromatography from the CM extracts; * Sum of minority fatty acids

The majority sterols in both transgenic and control seeds were 24-ethyl cholesterol (sitosterol, between 43% and 54% of the total sterols), 24-methyl cholesterol

285 (campesterol, between 20% and 26%) with lower cholesterol levels (between 5% and 8%), brasicasterol (between 2% and 7%), isofucosterol (A5-avenasterol, between 4% and 6%), stigmasterol ( between 0.5% and 3%), cholest-7-en-3p-ol, (between 0.2% and 0.5%), 24-methylcholestanol (campestanol, between 0.4% and 1%) and 24-dehydrocholesterol (between 0.5% and 2%) (Table 16). These nine sterols constituted between 86% and 95% of the total sterols, where the remaining components were sterols only partially identified by the numbers of carbons and double bonds. The overall sterol profiles were similar between the transgenic seeds and the controls for both hexane and CM extracts.

Fatty Alcohol Analysis

The fatty alcohols in the seeds were derivatized and analyzed as for sterols. A series of fatty alcohols was identified from C₁₆-C₂₂, with accompanying isobranched fatty alcohols, both in hexane-hexane and CM extracts. Similar profiles were observed for transgenic seeds and control seeds, with some variation in the proportions of the individual components observed. Phytol, derived from chlorophyll, was the majority aliphatic alcohol and constituted 47% and 37% of the total fatty alcohols in the hexane fractions in the transgenic seeds and controls, respectively. The

286 Odd-chain alcohols were present at higher levels in the MC extract (between 37% and 38% of the total fatty alcohol content) compared to the hexane extract (between 16% and 23%). Iso-17: 0 (between 16% and 5 38%) predominated over 17: 0 (between 0.3% and 5.7%). Another odd-chain alcohol present was 19: 0 (between 4, 5% and 6.5%). Other alcohols detected included iso16: 0.16: 0, iso-18: 0.18: 1.18: 0, with lower levels of iso20: 0.20: 1.20: 0 , iso-22: 0.22: 1 and 22: 0 also present.

Discussion

The results indicated that breaking with the use of a motorized mortar and latch with multiple extractions with room temperature hexane was effective in recovering most of the TAG-containing oil from the transgenic seeds. In addition to the oil from the transgenic seeds containing moderate levels of DHA, the transgenic seeds also had markedly higher levels of ALA in the major lipid classes (triacylglycerols, glycolipids, and phospholipids) compared to the control seeds. This showed that A15-desaturase activity was considerably increased in transgenic seeds during seed development. Interestingly, there were some slight differences in the fatty acid composition and the proportion of DHA in the

287 various extracts and fractions with DHA levels being higher in the hexane extract rich in TAG and TAG from the extraction with CM (between 6% and 6.8%) and lower in the polar lipid fractions (3% in the glycolipids and 1.6% in phospholipids). The 16: 0 level was higher in the polar lipid fractions of glycolipids and phospholipids in the CM extracts (between 19% and 21%) compared to the hexane extract rich in TAG and TAG from the extraction with CM (between 6% and 7%).

288

Table 16 Composition of sterols (% of total sterols) of transgenic seeds and Cameli control

<td></td><td colspan="2">Transgenic seeds</td><td colspan="2">Control seeds</td>

<td>Sterols</td><td>'Hexane</td><td>CM</td><td>Hexane</td><td>CM</td>

<td>24-dehydrocholesterol</td><td> 0,8</td><td> 1,8</td><td> 0,5</td><td> 1,4</td>

<td>Cholesterol</td><td> 5,7</td><td> 7,6</td><td> 4,7</td><td> 7,2</td>

<td>brasicasterol</td><td> 4,4</td><td> 6,5</td><td> 1, 9</td><td> 4,2</td>

<td>cholest-7-en-3p-ol</td><td> 0,2</td><td> 0,5</td><td> 0,3</td><td> 0,4</td>

<td>campesterol</td><td> 24,5</td><td> 20,8</td><td> 25,7</td><td> 21,7</td>

<td>countryman1</td><td> 0,4</td><td> 1,1</td><td> 0,4</td><td> 0,9</td>

<td>stigmasterol</td><td>i, .o</td><td> 2,6</td><td> 0,5</td><td> 1,6</td>

<td>sitosterol</td><td> 54,3</td><td> 43,7</td><td> 53,8</td><td> 42,9</td>

<td>Δ5avenasterol (isofucos</td><td> 4,2</td><td> 5,2</td><td> 4,7</td><td> 5,5</td>

<td>Sum</td><td> 95,5</td><td> 89,6</td><td> 92,6</td><td> 85,9</td>

<td>Others</td><td></td><td></td><td></td><td></td>

<td>UNlC281db</td><td> 0,6</td><td> 1,2</td><td> 0,7</td><td> 1,2</td>

<td>UN2C291db</td><td> 1,2</td><td> 2,0</td><td> 1,2 ’</td><td> 2,4</td>

<td>UN3C292db</td><td> 0,9</td><td> 1,8</td><td> 1,3</td><td> 2,4</td>

<td>UN4C281db</td><td> 0,3</td><td> 0,9</td><td> 0,6</td><td> 1,1</td>

<td>UN5C302db</td><td> 1,2</td><td> 1,8</td><td> 1,4</td><td> 1,8</td>

<td>UN6C291db + C302db</td><td> 0,3</td><td> 2,7</td><td> 2,2</td><td> 5,2</td>

<td>Sum of others</td><td> 4,5</td><td> 10,4</td><td> 7,4</td><td> 14,1</td>

<td>Total</td><td> 100</td><td> 100</td><td> 100</td><td> 100</td>

Abbreviations: UN designates an unknown sterol, the number after C indicates the number of carbon atoms and db designates the number of double bonds

289

The composition of sterols of the transgenic seeds and control seeds was similar to that found in refined Camelina oil (Shukla et al., 2002) with the same majority sterols present, which indicates that the gene aggregates did not affect the synthesis of sterols in the seeds. . The cholesterol level in Camelina oil was higher than that of most vegetable oils. Brasicasterol was present, which is a characteristic sterol found in the Brassicaceae family that includes Camelina sativa.

Example 8. Production of LC-PUFA in seeds of Brassica júncea

Transgenic Brassica júncea plants were produced using the GA7-modB construct (Example 3) for the production of DHA, as follows. Seeds of B. júncea of ​​a day length sensitive variety were sterilized using chlorine gas as described in Kereszt et al. (2007). The sterilized seeds were germinated in medium strength 1/2 MS (Murashige and Skoog, 1962) solidified with 0.8% agar, adjusting the pH to 5.8 and grown at 24 ° C under fluorescent light (50 pE / m²s) with a photoperiod of 16/8 hours (light / dark) between 6 and 7 days. Cotyledon petioles with 2-4 mm cane were isolated aseptically from these seedlings and used as explants. I know

290 transformed Agrobacterium tumefaciens from strain AGL1 with the GA7 binary construct. Agrobacterium culture was started and processed for infection as described in Belide et al. (2013). For all transformations, approximately 50 freshly isolated cotyledon petioles were infected with 10 ml of A. tumefaciens culture for 6 minutes. The infected petioles were transferred to sterile filter paper to remove excess A. tumefaciens and transferred to a co-culture medium (MS with 1.5 mg / L BA,

0.01 mg / L of NAA and 100 μΜ of acetosyringone, also supplemented with L-cysteine ​​(50 mg / L), ascorbic acid (15 mg / L) and MES (250 mg / L). All plates were sealed with microporous tape and incubated in the dark at 24 ° C for 48 hours of coculture. The explants were then transferred to preselection medium (MS-agar with 1.5 mg / L BA, 0.01 mg / L NAA, 3 mg / L AgNOa, 250 mg / L cefotaxime and 50 mg / L timentine) and were cultured between 4 and 5 days at 24 ° C with a photoperiod of 16/8 hours before transferring the explants to selection medium (MS-agar with 1.5 mg / L BA, 0.01 mg / L of

NAA, 3 mg / L of AgNOa, 250 mg / L of cefotaxime, 50 mg / L of timentine and 5 mg / L of PPT) and were cultured for 4 weeks at 24 ° C with a photoperiod of 16/8 hours. The explants with green calli were transferred to shoot regeneration medium (MS-agar with 2.0 mg / L BA, 3 mg / L AgNOa, 250 mg / L

291 cefotaxime, 50 mg / L timenthine and 5 mg / L PPT) and were cultured for another 2 weeks. Regenerating small shoot bulbs were transferred to hormone-free MS medium (MS-agar with 3 mg / L AgNO, 3,250 mg / L cefotaxime, 50 mg / L timentine and 5 mg / L PPT) and were they cultivated for another 2 to 3 weeks.

Potential transgenic shoots of at least 1.5 cm in size were isolated and transferred to root induction medium (MS-agar with 0.5 mg / L NAA, 3 mg / L AgNOa, 250 mg / L of cefotaxime and 50 mg / L of timenthine) and were cultured for 2 to 3 weeks. Transgenic shoots confirmed by PCR and with prolific roots were transferred to soil in a greenhouse and grown under a 16/8 h photoperiod (light / dark) at 22 ° C. Three confirmed transgenic plants were obtained. The transformed plants were grown in the greenhouse, allowed to self-fertilize, and the TI seeds were harvested. The lipid fatty acid composition of TI seed clusters of each transformed T0 plant was analyzed, which showed the presence of 2.8% DPA and 7.2% DHA in a line designated as JT14, while another line designated JT1-6 exhibited 2.6% DPA.

Seed oil from individual TI seeds was analyzed for fatty acid composition; some of

292 data is shown in Table 17. Several TI seeds produced DHA at a level between 10% and about 21% of the total fatty acid content, including JT1-4-A13, JT1-4-A -5, and JT1 -4-B-13. Surprisingly and unexpectedly, some of the TI seeds contained DPA at levels between 10% and about 18% of the total fatty acid content and no detectable DHA (&lt;0.1%). The inventors concluded that the Δ4-desaturase gene in the T-DNA that was inserted into these plants was inactive due to a spontaneous mutation, similar to that described in Example 2. TI seeds were germinated and once they appeared, they were analyzed the cotyledons of each for fatty acid composition in the remaining oil. The remainder of each seedling was kept and grown to maturity to provide T2 seeds.

Transgenic plants that were homozygous for individual T-DNA insertions were identified and selected. Plants from a selected line designated JT1-4-17 had a single T-DNA insert and produced DHA only with low levels of DPA, while those from a second selected line designated JT1-4-34 also had a single T-DNA insert. individual T-DNA but produced DPA without producing DHA. The inventors concluded that the original transformant contained two T-DNAs

293 separated, one of which conferred DHA production and the other conferred DPA production without DHA. The B. júncea plants that produce DHA in their seeds were crossed with the plants that produce DPA in their seeds. The F1 progeny included plants that were heterozygous for both insertions of the T-DNA. The seeds of these progeny plants were found to produce about 20% DHA and about 6% DPA, for a total DHA + DPA content of 26%. F1 plants are self-fertilizing and progeny that are homozygous for both T-DNA insertions are expected to produce up to 35% DHA and DPA.

Approximately 18% DPA was observed in the lipid of the pooled seeds of the T3 progeny designated JT14-34-11. Similarly, approximately 17.5% DHA was observed in the lipid of pooled seeds of the T3 progeny JT1-4-17-20. The fatty acid compositions of the JT1-4 pooled TI seeds, individual TI seeds, pooled T2 seeds, individual T2 seeds, and pooled T3 seeds, individual T3 seeds are in Tables 18 to 21. The T3 segregator of JT1-4, JT-1-4-34-11, had a DPA content of the pooled T3 seeds of 18% and the individual seeds of this particular segregator had a DPA content of approximately 26%, each one as a percentage of the content

294 total fatty acids.

The following parameters were calculated for the oil of a seed with 17.9% of DPA: total saturated fatty acids, 6.8%; total monounsaturated fatty acids, 36.7%; total polyunsaturated fatty acids, 56.6%, 6 total fatty acids, 7.1%; new ω6 fatty acids, 0.4% of which were all GLA; 3 total fatty acids, 46.5%; new fatty acids ω3, 24.0%; ratio of total fatty acids ω6: total ω3, 6.5; ratio of new fatty acids ω6: new ω3, 60; efficiency of conversion of oleic acid to LA by Δ12-desaturase, 61%; conversion efficiency of ALA to SDA by A6-desaturase, 51%; efficiency of conversion of SDA to ETA acid by A6-elongase, 90%; efficiency of conversion of ETA to EPA by A5-desaturase, 87%; conversion efficiency of EPA to DPA by Δ5elongase ,. 98%.

In order to produce more transgenic plants in B. júncea with the modB construct, the transformation was repeated five times and 16 putative transgenic shoots / seedlings were regenerated. TI seed analysis is carried out to determine the content of DPA and DHA.

In order to produce more seeds with DPA and without DHA, a genetic construct was produced that was a

295 variant of the modB construct, lacking the Δ4desaturase gene, viz. Two DNA fragments, EPA-DPA fragment 1 and EPA-DPA fragment 2, (Geneart, Germany) with suitable restriction sites were synthesized. An intermediate cloning vector, pJP3660, was generated by cloning the Aatll-Mlul fragment of EPA-DPA fragment 1 at the AscI-AatlI sites in a designated vector llABHZHC_GA7-frag_d6D_pMS, a vector previously used in the construction of GA7-modB that contained a Δ6 desaturase cassette. PJP3661 was then generated by cloning the Pmel-PspOMI fragment of pJP3660 into the Pmel-PspOMI sites of modB. The DPA vector, pJP3662 (Figure 4), was then assembled by cloning the BsiWI-PspOMI fragment from EPA-DPA fragment 2 into the BsiWI-PspOMI sites of pJP3661. This vector contained the fatty acid biosynthesis genes that encode enzymes that converted oleic acid to ΌΡΑω3 and the corresponding 6 fatty acid. The resulting construct to transform B. júncea and B. napus. Progeny seeds are produced with up to 3-5% DPA in the total fatty acid content of the seed lipid.

When the oil extracted from the seeds of a DHA-producing plant was examined by NMR, it was observed that at least 95% of the DHA was present at the sn-1,3 position of the TAG molecules.

296

Table 17. Seed oil fatty acid composition of TI seeds of B. júncea transformed with GA7 DNAT.

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 8</td><td> 9</td><td></td><td> 8</td><td>r4</td><td> &amp;</td><td>and</td><td>S</td><td>R</td><td>and</td><td>Θ</td>

<td></td><td>sestile</td><td>or</td><td></td><td>OR</td><td> *4</td><td>«5 Ή</td><td>CM</td><td>M</td><td></td><td></td><td>w</td><td>&lt;H</td><td>you</td><td></td><td></td><td>1O</td><td></td><td></td>

<td> 5</td><td>laTl</td><td>¿Í w</td><td rowspan="2">e 9X0</td><td>wh</td><td></td><td></td><td></td><td></td><td> 00</td><td>or CM</td><td></td><td>OR</td><td>or CM</td><td> 0 01</td><td>0 CM</td><td>¿Í CM</td><td>CM CM</td><td>Λ CM</td>

<td></td><td>No,</td><td>or</td><td>or</td><td>or</td><td></td><td>or</td><td>or «</td><td>u &lt;* »</td><td>or</td><td colspan="2">ü WH</td><td>ow</td><td>Or r</td><td>Or «</td><td>O í *</td><td>O &lt;n</td><td>u &lt;n</td>

<td></td><td></td><td> 5</td><td> 0 '</td><td> 2</td><td></td><td> 3 '</td><td></td><td> ' 0 '</td><td></td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td></td><td></td>

<td></td><td>JT1—</td><td>r</td><td>F</td><td>F</td><td> 23</td><td>F</td><td> 17</td><td>F</td><td> 24</td><td>F</td><td>t</td><td>F</td><td>F</td><td>F</td><td> /</td><td>F</td><td> 2,</td><td> 9,</td>

<td></td><td>4-Al</td><td> 0</td><td> 2</td><td> 7</td><td> ,5</td><td> 4</td><td> ,0</td><td> 7</td><td> ,6</td><td> 7</td><td> 0</td><td> 1</td><td> 2</td><td> 8</td><td> 0</td><td> 6</td><td> 4</td><td> 9</td>

<td></td><td></td><td> 4</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td>or·</td><td> 1</td><td> 0</td><td> 1</td><td> 3</td><td> 0</td><td></td><td></td>

<td></td><td>JT1-</td><td>F</td><td>F</td><td>F</td><td> 37</td><td>F</td><td> 11</td><td>F</td><td> 22</td><td>i</td><td>F</td><td>F</td><td>F</td><td> /</td><td>F</td><td>F</td><td> 9,</td><td> 0,</td>

<td></td><td>4-A-2</td><td> 3</td><td> 3</td><td> 6</td><td> ,2</td><td> 2</td><td> ,0</td><td> 3</td><td> ,1</td><td> 7</td><td> 9</td><td> 3</td><td> 2</td><td> 4</td><td> 2</td><td> 3</td><td> 4</td><td> 0</td>

<td></td><td></td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 1</td><td> 4</td><td> 0</td><td></td><td></td>

<td></td><td>JT1-</td><td>F</td><td>F</td><td>F</td><td> 20</td><td> /</td><td> 16</td><td>F</td><td> 24</td><td></td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td> 3,</td><td> 11</td>

<td></td><td>4-A-3</td><td> 6</td><td> 3</td><td>Ί</td><td> ,8</td><td> 7</td><td> ,0</td><td> 6</td><td> ,4</td><td> 7</td><td> 0</td><td>s</td><td> 2</td><td> 1</td><td> 5</td><td> 7</td><td> 1</td><td> ,4</td>

<td></td><td></td><td> 4</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 3</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td></td><td></td>

<td> 10</td><td>JT1-</td><td>F</td><td>F</td><td>F</td><td> 36</td><td></td><td> 10</td><td>r</td><td> 24</td><td>F</td><td>t</td><td>F</td><td>r</td><td>F</td><td>F</td><td>F</td><td> 2,</td><td> 0,</td>

<td></td><td>4-A-4</td><td> 6</td><td> 4</td><td> 8</td><td> ,2</td><td> 4</td><td> , 6</td><td> 3</td><td> ,5</td><td> 8</td><td> 9</td><td> 7</td><td></td><td> 3</td><td> 5</td><td> 0</td><td> 5</td><td> 0</td>

<td></td><td></td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 3</td><td></td><td>S</td><td></td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 1</td><td> 4</td><td> 1</td><td></td><td></td>

<td></td><td>JT1-</td><td> *</td><td>F</td><td> #</td><td> 20</td><td></td><td> 13</td><td>F</td><td> 25</td><td></td><td>r</td><td>F</td><td>r</td><td>F</td><td>r</td><td>F</td><td> 1,</td><td> 13</td>

<td></td><td>4-A-5</td><td> 0</td><td> 2</td><td> 2</td><td> ,3</td><td> €</td><td> ,7</td><td> 7</td><td> ,9</td><td> 7</td><td> 0</td><td> 9</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td><td> 6</td><td> ,5</td>

<td></td><td></td><td> 4</td><td> 0</td><td> 3</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td></td><td> 0,</td>

<td></td><td>JT1-</td><td>F</td><td>r</td><td>F</td><td> 37</td><td>F</td><td> 7,</td><td>F</td><td> 19</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td> 13</td><td> 0</td>

<td></td><td></td><td> 8</td><td> 4</td><td> 4</td><td> ,9</td><td> 7</td><td> 4</td><td> 4</td><td> ,9</td><td> 9</td><td> 4</td><td> 4</td><td> 1</td><td> 8</td><td> 9</td><td> 4</td><td> ,9</td><td></td>

<td></td><td></td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 3</td><td> 1</td><td></td><td></td>

<td></td><td>JT1-</td><td>r</td><td>F</td><td>F</td><td> 26</td><td>F</td><td> 8,</td><td>F</td><td> 26</td><td></td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td> 2,</td><td> 11</td>

<td></td><td>4-A-7</td><td> 6</td><td> 3</td><td> 0</td><td> ,2</td><td> 0</td><td> 9</td><td> 3</td><td> , 6</td><td> 6</td><td> 8</td><td> 0</td><td> 1</td><td> 8</td><td>Ί</td><td> 3</td><td> 2</td><td> ,3</td>

<td></td><td></td><td> 4</td><td> 0</td><td> .2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td></td><td></td>

<td></td><td>&lt;JTX "</td><td>r</td><td>F</td><td>t</td><td> 40</td><td>J</td><td> 7,</td><td>F</td><td> 22</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td> 9,</td><td> 0,</td>

<td> 15</td><td>4-A-8</td><td> 8</td><td> 4</td><td> 9</td><td> ,3</td><td> 4</td><td>to</td><td> 3</td><td> , 2</td><td> 8</td><td> 4</td><td> 3</td><td> 1</td><td> 8</td><td> 4</td><td> 4</td><td> €</td><td> 0</td>

<td></td><td></td><td> 7</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 1</td><td> 2</td><td> 0</td><td> 0</td><td> 1</td><td> 3</td><td> 0</td><td></td><td></td>

<td></td><td>JT1-</td><td>F</td><td>F</td><td>F</td><td> 17</td><td>F</td><td> 17</td><td>F</td><td> 23</td><td>F</td><td>F</td><td>F</td><td>F</td><td> /</td><td>F</td><td>F</td><td> 2,</td><td> 11</td>

<td></td><td>4-A-9</td><td> 1</td><td> 3</td><td> 6</td><td> ,7</td><td> 3</td><td> ,9</td><td> 7</td><td> 4</td><td> 0</td><td> 1</td><td> 8</td><td> 2</td><td> 5</td><td> €</td><td> 8</td><td> 0</td><td> ,9</td>

<td></td><td>JT1-</td><td> 5</td><td> 0</td><td> 4</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 7</td><td> 0</td><td></td><td></td>

<td></td><td>4-A-</td><td>F</td><td>F</td><td></td><td> 22</td><td>F</td><td> 19</td><td>F</td><td> 21</td><td>t</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td> 1,</td><td>and,</td>

<td></td><td> 10</td><td> 1</td><td> 2</td><td> 2</td><td> ,3</td><td> 4</td><td> ,5</td><td> 7</td><td> ,7</td><td>s</td><td> 5</td><td> 9</td><td> 7</td><td> 7</td><td> 8</td><td> 9</td><td> 0</td><td> 5</td>

<td></td><td>JT1-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td></td><td></td>

<td></td><td>4 -A-</td><td>F</td><td>r</td><td>F</td><td> 37</td><td>F</td><td> 7,</td><td>F</td><td> 19</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td>F</td><td>F</td><td> 15</td><td> 0,</td>

<td></td><td> 11</td><td> 0</td><td> 5</td><td> 8</td><td> ,6</td><td> 0</td><td> 1</td><td> 4</td><td> ,2</td><td> 7</td><td> 9</td><td> 4</td><td> 2</td><td> 5</td><td> 6</td><td> 3</td><td> ,5</td><td> 0</td>

<td></td><td>JT1-</td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 3</td><td> 1</td><td></td><td></td>

<td></td><td>4-A-</td><td>F</td><td>F</td><td>F</td><td> 28</td><td>F</td><td> 9,</td><td>F</td><td> 27</td><td>t</td><td> /</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td> 1,</td><td> 10</td>

<td></td><td> 12</td><td> 2</td><td> 3</td><td> 0</td><td> ,2</td><td> 0</td><td> 2</td><td> 3</td><td> ,4</td><td> 6</td><td> 9</td><td> 9</td><td> 1</td><td> 5</td><td> 2</td><td> 1</td><td>β</td><td> ,2</td>

<td> 20</td><td>JT1-</td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 1</td><td> 2</td><td> 1</td><td></td><td></td>

<td></td><td>4-A-</td><td></td><td>r</td><td>F</td><td> 16</td><td></td><td> 9,</td><td>F</td><td> 29</td><td>F</td><td>r</td><td>r</td><td>r</td><td>F</td><td>F</td><td>F</td><td> 2,</td><td> 17</td>

<td></td><td> 13</td><td> 4</td><td> 2</td><td> 0</td><td> ,7</td><td> 1</td><td> 9</td><td> 6</td><td> ,9</td><td> 7</td><td> 2</td><td> 0</td><td> 2</td><td> 7</td><td> 0</td><td> 1</td><td> 0</td><td> ,9</td>

297

<td>JTl-</td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td></td><td></td>

<td>4-A—</td><td></td><td>t</td><td>F</td><td> 30</td><td>F</td><td> 11</td><td> 9</td><td> 27</td><td> 9</td><td> /</td><td>t</td><td> /</td><td>F</td><td>Λ</td><td> 9</td><td> 1,</td><td> 7,</td>

<td> 14</td><td> 1</td><td> 4</td><td> 1</td><td> ,0</td><td> 0</td><td>F ^w</td><td> 3</td><td> »7</td><td>Ί</td><td> 2</td><td> 0</td><td> 1</td><td> 6</td><td> 4</td><td>B</td><td> 3</td><td> 8</td>

<td>JTl-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td> 9</td><td> 9</td><td> 9</td><td> 34</td><td>Λ</td><td> 6,</td><td></td><td> 20</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td>r</td><td>t</td><td> 15</td><td> 0,</td>

<td> 15</td><td> 1</td><td> 4</td><td> 5</td><td> , 2</td><td> 6</td><td> 9</td><td> 6</td><td> ,4</td><td> 7</td><td> 6</td><td> 1</td><td> 2</td><td> €</td><td>Ί</td><td> 9</td><td>₉ 2</td><td> 0</td>

<td></td><td> 5</td><td> 0</td><td></td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 1</td><td> 4</td><td> 0</td><td></td><td></td>

<td>JTl—</td><td> /</td><td>i</td><td> 9</td><td> 18</td><td> 9</td><td> 17</td><td>F</td><td> 24</td><td>F</td><td> /</td><td>t</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 2,</td><td> 11</td>

<td>4-Bl</td><td> 5·</td><td> 2</td><td>Ί</td><td> ,9</td><td> 0</td><td> ,6</td><td> 8</td><td> ,1</td><td> 8</td><td> 2</td><td> 0</td><td> 2</td><td> 2</td><td> 6</td><td> 9</td><td> 2</td><td> ,5</td>

<td></td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 8</td><td> 1</td><td></td><td></td>

<td>JTl-</td><td>F</td><td> 9</td><td>r</td><td> 20</td><td> *</td><td> 14</td><td></td><td> 25</td><td>F</td><td> 9</td><td> /</td><td>i</td><td>r</td><td>F</td><td>F</td><td>F</td><td>δ,</td>

<td>4— B-2</td><td> 5</td><td> 2</td><td> 7</td><td> ,2</td><td> 0'</td><td> , 3</td><td> 5</td><td> ,5</td><td>Ί</td><td>Ί</td><td> 9</td><td> 2</td><td> 6</td><td> 7</td><td> 3</td><td> .2</td><td> 5</td>

<td>JTl-</td><td> 5</td><td> 0</td><td> 3</td><td> 34</td><td> 3</td><td> 35</td><td> 0</td><td> 9,</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0,</td><td> 2,</td>

<td>4 -B-3</td><td> 9</td><td> 9</td><td>F</td><td></td><td>F</td><td> ,0</td><td>r</td><td> 3</td><td>g</td><td></td><td>t </td><td>i</td><td>F</td><td>r</td><td> 9</td><td> 3</td><td> 1</td>

<td></td><td> 3</td><td> 3</td><td> 6</td><td></td><td> 5</td><td></td><td> 6</td><td></td><td> 8</td><td></td><td> 4</td><td> 4</td><td>δ</td><td> 9</td><td> 1</td><td></td><td></td>

<td></td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td></td><td></td>

<td>JTl-</td><td>F</td><td> 9 </td><td></td><td> 25</td><td>Λ</td><td> 17</td><td></td><td> 24</td><td> 9</td><td></td><td>F</td><td> 9</td><td>t</td><td>r</td><td> 9</td><td>7 f</td><td> 7,</td>

<td>4-B-4</td><td> 3</td><td> 3</td><td> 1</td><td> ,2</td><td> 6</td><td> ,0</td><td> 7</td><td> ,1</td><td>Ί</td><td> 9</td><td> 0</td><td> 2</td><td>to</td><td> 3</td><td> 5</td><td> 3</td><td> 8</td>

<td></td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td></td><td></td>

<td>* JT1—</td><td>F</td><td> /</td><td>t</td><td> 30</td><td> 9</td><td> 10</td><td>F</td><td> 21</td><td>F</td><td>F</td><td> 9</td><td></td><td>F</td><td>F</td><td> 9</td><td> 1€</td><td> 0,</td>

<td>4— B — 5</td><td> 5</td><td> 5</td><td> 2</td><td> ,1</td><td> 6</td><td> ,2</td><td> 5</td><td> ,7</td><td> 6</td><td> 4</td><td> 1</td><td> 2</td><td> 9</td><td> 4</td><td> 5</td><td> 4</td><td> 0</td>

<td></td><td> 6</td><td> 0</td><td> 1</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td></td><td></td>

<td></td><td></td><td> /</td><td>r</td><td> 33</td><td> 9</td><td> 30</td><td>F</td><td> 12</td><td> 9</td><td> 9</td><td>r</td><td>t</td><td> 9</td><td>F</td><td> 9</td><td> 4,</td><td> 0,</td>

<td>4-B-8</td><td> 2</td><td> 5</td><td> 9</td><td> ,1</td><td> 0</td><td> ,0</td><td> 5</td><td> ,7</td><td> 6</td><td> 3</td><td> 3</td><td> 4</td><td> 4</td><td> 9</td><td> 1</td><td> 4</td><td> 0</td>

<td>JTl-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 1</td><td> 2</td><td> 0</td><td></td><td></td>

<td>4 —B—</td><td>r</td><td> 9</td><td> 9</td><td> 20</td><td> 9</td><td> 11</td><td>r</td><td> 27</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td>Γ</td><td> 9</td><td> 4,</td><td> 13</td>

<td> 13</td><td> 6</td><td> 3</td><td> 8</td><td> ,9</td><td> 9</td><td> ,9</td><td> 4</td><td>, c</td><td> 7</td><td> 0'</td><td> 0</td><td> 2</td><td> 7</td><td> 3</td><td>Ί</td><td> 1</td><td> ,5</td>

The oil from the seed samples also contained 0.1% C14: 0; 0.1-0.2% C16: 3; between 0.0 and 0.1% of each of C20: IA13, C2O: 3o) 6 and C20: 4o6; between 0.3 and 0.4% C22: 0; none of C22: l and C22: 2m6; 0.2% C24: 0 and between 0.2 and 0.4% C24: 1.

Table 18. Fatty acid composition of lipids of

298 Ti seeds (pooled) of B. júncea transformed with GA7-modB DNAT. Lipids also contained approximately 0.1% of each of 14: 0, 16: 3, 20: ldl3, and 16: 2, 22: 1 were not detected.

<td>I know</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>r »</td><td></td><td rowspan="2">4 * 1 i</td><td></td><td> 40</td><td> &lt;0</td><td> «0</td><td></td><td></td><td>m</td><td> &lt;*&gt;</td><td> 40</td><td></td><td></td><td></td><td></td><td></td>

<td>me</td><td>OR</td><td>H</td><td>OR</td><td> *&gt;»</td><td></td><td>CM »»</td><td colspan="2">nn</td><td>or</td><td rowspan="2">H</td><td>to</td><td colspan="3"> £ 5 1</td><td>OR</td><td colspan="4">no</td><td>OR</td><td>«Ί</td><td>s</td><td></td>

<td>IX</td><td> 40</td><td></td><td></td><td></td><td></td><td> 4»</td><td></td><td> «*</td><td>or</td><td> ««</td><td></td><td> *»</td><td> ·*.</td><td> »«</td><td rowspan="2">S</td><td> « »</td><td> « *</td><td> «»</td><td> «·</td><td></td><td></td><td>EC</td><td></td>

<td></td><td>H</td><td>W</td><td></td><td>H</td><td></td><td></td><td>"X"</td><td>co</td><td>&lt;m</td><td>ω</td><td rowspan="2">OR</td><td>or</td><td>or</td><td>OR</td><td>or</td><td>or</td><td>or</td><td>CM</td><td>CM</td><td>CM</td><td>CM</td><td> &lt;1</td><td></td>

<td>to</td><td></td><td rowspan="2">or</td><td rowspan="2">or</td><td rowspan="2">or</td><td rowspan="2">OR</td><td rowspan="2">or</td><td rowspan="2">HO</td><td>w</td><td>or</td><td>w</td><td>CM</td><td>CM</td><td>w</td><td>CM</td><td>or</td><td>CM</td><td>CM</td><td>CM</td><td rowspan="2">CM O</td><td>or</td><td>or</td><td>CM</td><td>CM</td>

<td></td><td></td><td>or</td><td></td><td>or</td><td> 0</td><td>or</td><td>OR</td><td>or</td><td>OR</td><td></td><td>OR</td><td>or</td><td>or</td><td></td><td></td><td>or</td><td>or</td>

<td>όϊ</td><td> 4</td><td> 0</td><td> 2</td><td> 4</td><td> 3</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td> 1-</td><td>r</td><td>F</td><td>g</td><td> 2</td><td>F</td><td> 7</td><td>F</td><td> 6</td><td>r</td><td>F</td><td>F</td><td>r</td><td>g</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td><td>F</td><td> /</td><td>F</td><td></td><td>F</td>

<td> 2</td><td> 2</td><td> 3</td><td> 5</td><td>t</td><td> 2</td><td>l</td><td> 1</td><td>F</td><td> 6</td><td> 0</td><td>Λί</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 4</td><td> 0</td><td> 0</td>

<td></td><td></td><td></td><td></td><td> 4</td><td></td><td> 7</td><td></td><td> 4</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>JT</td><td> 4</td><td> 0</td><td> 2</td><td> 4</td><td> 3</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td>Q</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td>or·</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td> 1—</td><td></td><td>r</td><td></td><td> 4</td><td>F</td><td> 6</td><td>F</td><td> 4</td><td>F</td><td>F</td><td>F</td><td>F</td><td>g</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td>t</td><td>F</td><td>g</td><td>F</td><td> /</td><td>F</td>

<td> 3</td><td> 5</td><td> 3</td><td> 7</td><td>F</td><td> 1</td><td>F</td><td> 1</td><td>F</td><td>Ί</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2.</td><td> 4</td><td> 0</td><td> 0</td>

<td></td><td></td><td></td><td></td><td> 6</td><td></td><td> 8</td><td></td><td> 8</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>JT</td><td> 5</td><td> 0</td><td> 3</td><td> 2</td><td> 3</td><td> 1</td><td> 0</td><td> 2</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 7</td>

<td> 1-</td><td>F</td><td>F</td><td>F</td><td> 6</td><td>F</td><td> 7</td><td>F</td><td> 2</td><td>r</td><td>l</td><td>F</td><td>F</td><td> /</td><td>F</td><td>F</td><td> /</td><td>g</td><td>F</td><td>t</td><td> /</td><td>F</td><td>F</td><td>F</td><td>F</td>

<td> 4</td><td> 1</td><td> 3</td><td> 2 '</td><td></td><td> 5 '</td><td>t</td><td> 5</td><td>F</td><td> 7</td><td> 5</td><td> 1</td><td> 2</td><td> 0</td><td> 0</td><td> 2</td><td> 3</td><td> 9</td><td> 7</td><td> 0</td><td> 1</td><td> 2</td><td> 3</td><td> 8</td><td> 2</td>

<td></td><td></td><td></td><td></td><td> 8</td><td></td><td> 4</td><td></td><td> 8</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>JT</td><td> 4</td><td> 0</td><td> 2</td><td> 4</td><td> 3</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td> 1-</td><td>F</td><td>F</td><td>g</td><td> 1</td><td> ?</td><td> 8</td><td>F</td><td> 5</td><td>g</td><td>F</td><td>F</td><td>r</td><td>F</td><td>F</td><td>F</td><td>t</td><td>F</td><td>F</td><td>F</td><td>r</td><td>t</td><td>F</td><td>r</td><td>F</td>

<td> 5</td><td>Ί</td><td> 4</td><td> 4</td><td> 6</td><td> 4</td><td> 4</td><td> 1</td><td> 8</td><td> 7</td><td> 0</td><td> 2</td><td> 1</td><td>Q</td><td> 0</td><td> 0</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 4</td><td> 0</td><td>to</td>

<td>JT</td><td> 4</td><td> 0</td><td> 2</td><td> 3</td><td> 3</td><td> 3</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td>

<td> 1-</td><td>r</td><td>F</td><td>F</td><td> 7</td><td>t</td><td> 0</td><td>F</td><td> 3</td><td>r</td><td>F</td><td>F</td><td>F</td><td>F</td><td>g</td><td>F</td><td>F</td><td>g</td><td>g</td><td>F</td><td>F</td><td>F</td><td>F</td><td>F</td><td>r</td>

<td> &amp;</td><td> 0</td><td> 4</td><td> 3</td><td>F</td><td> 3</td><td>g</td><td> 4</td><td>F</td><td> 7</td><td> 2</td><td> 4</td><td> 3</td><td> 0</td><td> 0</td><td> 7</td><td> 3</td><td> 6</td><td> 1</td><td> 0</td><td> 3</td><td> 2</td><td>s</td><td> 6</td><td> 0</td>

<td></td><td></td><td></td><td></td><td> 3</td><td></td><td> 2</td><td></td><td> 2</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

299

Table 19. Seed oil fatty acid composition of TI (individual) seeds of B. júncea transformed with GA7-modB T-DNA.

<td>You sessile lia Ho,</td><td>or Hu</td><td>3 Φ « Hl U</td><td>or H OR</td><td>WH u</td><td>rt rt OR&gt;</td><td>«Η O</td><td>8 m Me &lt;0 0</td><td>s » ⁿ0</td><td>OR or I heard Ü</td><td>ei * d</td><td>H rt or the</td><td>s 8</td><td>t</td><td>8 or ^r 8</td><td>e a •or ^σto</td><td>e « ¿I « 8</td><td></td>

<td>JT1-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td>X</td><td>r</td><td>F</td><td> 23</td><td>X</td><td> 17</td><td>X</td><td> 24</td><td>F</td><td> 2,</td><td>F</td><td>X</td><td>X</td><td>X</td><td>X</td><td> 2,</td><td> 9,</td>

<td> 1</td><td> 0</td><td> 2</td><td> 1</td><td> ,5</td><td> 4</td><td> ,0</td><td>Ί</td><td> ,8</td><td> 7</td><td> 0</td><td> 1</td><td> 2</td><td>to</td><td> 0</td><td> 6</td><td> 4</td><td> 9</td>

<td>JT1-</td><td> 4</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 1</td><td> 3</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td> /</td><td>F</td><td>r</td><td> 37</td><td>X</td><td> 11</td><td>F</td><td> 22</td><td>r</td><td> 0,</td><td>X</td><td>X</td><td>X</td><td>X</td><td>X</td><td> 9,</td><td> 0,</td>

<td> 2</td><td> 3</td><td> 3</td><td> 6</td><td> ,2</td><td> 2</td><td> ,0</td><td> 3</td><td> ,1</td><td> 7</td><td> 9</td><td> 3</td><td> 2</td><td> 4</td><td> 2</td><td> 3</td><td> 4</td><td> 0</td>

<td>JT1-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 0</td><td> 0</td><td> 1</td><td> 4</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td>r</td><td>r</td><td>F</td><td> 20</td><td>F</td><td> 16</td><td>F</td><td> 24</td><td>.F</td><td> 2,</td><td>F</td><td>F</td><td>X</td><td>X</td><td> 9</td><td> 3,</td><td> 11</td>

<td> 3</td><td> 6</td><td> 3</td><td> 7</td><td>, B</td><td> 7</td><td> ,0</td><td> 6</td><td> ,4</td><td> 7</td><td> 0</td><td> 9</td><td> 2</td><td> 1</td><td> 5</td><td>Ί</td><td> 1</td><td> ,4</td>

<td>&lt;JT1-</td><td> 4</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td>JF</td><td>r</td><td>X</td><td> 36</td><td></td><td> 10</td><td>F</td><td> 24</td><td>r</td><td> 9,</td><td>X</td><td>F</td><td>F</td><td>X</td><td> 9</td><td> 2,</td><td> 0,</td>

<td> 4</td><td> 6</td><td> 4</td><td>B</td><td> ,2</td><td> 4</td><td> ,6</td><td> 3</td><td> ,5</td><td> 8</td><td> 9</td><td> 7</td><td></td><td> 3</td><td> 5</td><td> 0</td><td> 5</td><td> 0</td>

<td>JT1-</td><td> 5</td><td> 0</td><td> .3</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 0</td><td> 0</td><td> 1</td><td> 4</td><td> 1</td><td></td><td></td>

<td>4-A-</td><td> /</td><td> 9</td><td>X</td><td> 20</td><td>t</td><td> 13</td><td>F</td><td> 25</td><td>F</td><td> 2,</td><td>t</td><td>X</td><td> 9</td><td>X</td><td>X</td><td> 1,</td><td> 13</td>

<td> 5</td><td> 0</td><td> 2</td><td> 2</td><td> ,3</td><td> 6</td><td> ,7</td><td> 7</td><td>Item</td><td> 7</td><td> 0</td><td> 9</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td><td> 6</td><td> ,5</td>

<td>JT1-</td><td> 4</td><td> 0</td><td> 3</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td> /</td><td>X</td><td>F</td><td> 37</td><td>t</td><td> 7,</td><td>r</td><td> 19</td><td>r</td><td> 1,</td><td> 9</td><td> /</td><td> /</td><td>r</td><td>X</td><td> 13</td><td> 0,</td>

<td> 6</td><td> 8</td><td> 4</td><td> 4</td><td> ,9</td><td> 7</td><td> 4</td><td> 4</td><td> ,9</td><td> 9</td><td> 4</td><td> 4</td><td> 1</td><td> 8</td><td> 9</td><td> 4</td><td> ,9</td><td> 0</td>

<td>JT1-</td><td> 5 '</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 1</td><td> 3</td><td> 1</td><td></td><td></td>

<td>4-A-</td><td>F</td><td>r</td><td>JF</td><td> 26</td><td>t</td><td> 8,</td><td>X</td><td>2fi</td><td>F</td><td> 1,</td><td>F</td><td></td><td>X</td><td>X</td><td> 9</td><td></td><td> 11</td>

<td> 7</td><td> 6</td><td> 3</td><td> 0</td><td> ,2</td><td> 0</td><td> 9</td><td> 3</td><td> ,6</td><td> 6</td><td> 8</td><td> 0</td><td> 1</td><td> 8</td><td> 7</td><td> '3</td><td> 2</td><td> ,3</td>

<td>JT1-</td><td> 4</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td>OR</td><td> 2</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td>F</td><td>F</td><td> /</td><td> 40</td><td>i</td><td> 7,</td><td>t</td><td> 22</td><td>F</td><td> 1,</td><td>X</td><td>X</td><td>F</td><td>X</td><td> 9</td><td> 9,</td><td> 0,</td>

<td> 8</td><td> 8</td><td> 4</td><td> 9</td><td> ,3</td><td> 4</td><td> 8</td><td> 3</td><td> ,2</td><td> 8</td><td> 4</td><td> 3</td><td> 1</td><td> 8</td><td> 4</td><td> 4</td><td> 6</td><td> 0</td>

<td>JT1-</td><td> 7</td><td> 0</td><td> 3</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 1</td><td></td><td>or</td><td> 0</td><td> 1</td><td> 3</td><td> 0</td><td></td><td></td>

<td>4-A-</td><td>X</td><td>r</td><td> 9</td><td> 17</td><td>F</td><td> 17</td><td>F</td><td> 23</td><td>F</td><td> 2,</td><td>F</td><td>X</td><td>X</td><td>X</td><td>JF</td><td>X</td><td> 11</td>

<td> 9</td><td> 1</td><td> 3</td><td> 6</td><td> ,7</td><td> 3</td><td> ,9</td><td> 7</td><td> ,1</td><td> 0</td><td> 1</td><td> 8</td><td> 2</td><td> 5</td><td> 6</td><td>B</td><td> 0</td><td> ,9</td>

<td>JT1-</td><td> 5</td><td> 0</td><td> 4</td><td> 22</td><td> 3</td><td> 19</td><td> 0</td><td> 21</td><td> 0</td><td> 1,</td><td> 0</td><td> 0</td><td> 1</td><td> 7</td><td> 0</td><td> 1,</td><td> 6,</td>

<td>4-A-</td><td>JF</td><td>r</td><td>r</td><td> ,3</td><td>t</td><td> ,5</td><td>F</td><td> ,7</td><td>r</td><td> 5</td><td>F</td><td>X</td><td>X</td><td>X</td><td>X</td><td> 0</td><td> 5</td>

300

<td> 10</td><td>i</td><td> 2</td><td colspan="2"> 2</td><td> 4</td><td colspan="2"> 7</td><td colspan="2"> 8</td><td colspan="3"> 9 2</td><td> 7</td><td> 8</td><td colspan="3"> 9 '</td>

<td>&amp; JTJL^-4 — A—</td><td> 5</td><td> 0 /</td><td> 2 9</td><td> 37</td><td> 4 9</td><td> 7,</td><td> 0 9</td><td> 19</td><td> 0 9</td><td> 1,</td><td> 1 9</td><td> 0 9</td><td> 0 9</td><td> 1 9</td><td> 0 9</td><td> 15</td><td> 0,</td>

<td> 11</td><td> 0</td><td> 5</td><td>Θ</td><td> , 6</td><td> 0</td><td> 1</td><td> 4</td><td> ,2</td><td> 7</td><td> 9</td><td> 4</td><td> 2</td><td> 5</td><td> 6</td><td> 3</td><td> ,5</td><td> 0</td>

<td>JT14-A-</td><td>5 r</td><td> 0 /</td><td>3 f</td><td>2B</td><td> 4 9</td><td> 9,</td><td>0 r</td><td> 27</td><td> 0</td><td> 1,</td><td> 0 9</td><td> 0 9</td><td> 1 /</td><td> 3 9</td><td> 1 9</td><td> 1,</td><td> 10</td>

<td> 12</td><td> 2</td><td> 3</td><td> 0</td><td>e ώ</td><td> 0</td><td></td><td> 3</td><td> ,4</td><td> 6</td><td> 9</td><td> 9</td><td> 1</td><td> 5</td><td> 2</td><td> 1</td><td> 8</td><td> ,2</td>

<td>JT14-A-</td><td>5 F</td><td> 0 9</td><td> 3 9</td><td> 16</td><td> 4 9</td><td> 9,</td><td> 0 9</td><td> 29</td><td> 0 9</td><td>• n</td><td> 1 9</td><td> 0 9</td><td> 1 9</td><td> 2 9</td><td>one t</td><td> 2,</td><td> 17</td>

<td> 13</td><td> 4</td><td> 2</td><td> 0</td><td> ,7</td><td> 1</td><td> 9</td><td> 6</td><td> ,9</td><td>Ί</td><td></td><td> 0</td><td> 2</td><td> 7</td><td> 0</td><td> 1</td><td> 0</td><td> ,9</td>

<td>JT1- 4-A-</td><td> 5 9</td><td> 0 9</td><td> 3 9</td><td> 30</td><td> 4 9</td><td> 11</td><td> 0 9</td><td> 27</td><td> 0</td><td>^ F</td><td> 1 9</td><td> 0 9</td><td> 0</td><td> 2 9</td><td> 0 9</td><td> 1,</td><td> 7,</td>

<td> 14</td><td> 1</td><td> 4</td><td> 1</td><td> ,0</td><td> 0</td><td> , 5</td><td> 3</td><td> ,7</td><td> 7</td><td></td><td> 0</td><td> 1</td><td> 6</td><td> 4</td><td> 8</td><td> 3</td><td> 8</td>

<td>JT1- 4-A-</td><td> 5 /</td><td> 0 9</td><td> 2 9</td><td> 34</td><td> 3 9</td><td> 6,</td><td> 0 9</td><td> 20</td><td> 0 9</td><td>i,</td><td> 1 9</td><td> 0 9</td><td> 0 9</td><td> 4 9</td><td> 0 9</td><td> 15</td><td> 0,</td>

<td> 15</td><td> 1</td><td> 4</td><td> 5</td><td> ,2</td><td> 6</td><td> 9</td><td> 6</td><td> ,4</td><td> 7</td><td> 6</td><td> 1</td><td> 2</td><td> 6</td><td> 7</td><td> 9</td><td> ,2</td><td> 0</td>

<td>JT1- 4-B-</td><td> 5 /</td><td> 0 9</td><td> 2 9</td><td> 18</td><td> 4</td><td> 17</td><td> 0 9</td><td> 24</td><td> 0 9</td><td> 2,</td><td> 1 9</td><td> 0</td><td> 1 9</td><td> 4 9</td><td> 0 9</td><td>²'</td><td> 11</td>

<td> 1</td><td> 5</td><td> 2</td><td> 7</td><td> ,9</td><td> 0</td><td> ,6</td><td>s</td><td> ,1</td><td> 8</td><td> 2</td><td> 0</td><td> 2</td><td> 2</td><td> 6</td><td> 9</td><td></td><td> ,5</td>

<td>JT1- 4 — B—</td><td> 5</td><td> 0 9</td><td> 2 9</td><td> 20</td><td> 4</td><td> 14</td><td>0 f</td><td> 25</td><td> 0 9</td><td> 1,</td><td> 0 9</td><td> 0 9</td><td> 1 9</td><td> 6 9</td><td> 1 9</td><td> 2,</td><td> 8,</td>

<td> 2</td><td> 5</td><td> 2</td><td> 1</td><td> ,2</td><td> 0</td><td> , 3 9</td><td> 5</td><td> ,5</td><td> 7</td><td> 7</td><td> 9</td><td> 2</td><td> 6</td><td> 7</td><td> 3</td><td> 2</td><td> 5</td>

<td>JT1- 4-B-</td><td>5 Λ</td><td> 0 9</td><td> 3</td><td> 34</td><td> 3 9</td><td> 35</td><td> 0 9</td><td> 9,</td><td> 0 9</td><td> 0,</td><td> 1 9</td><td>0 f</td><td> 0 9</td><td> 0 9</td><td> 0</td><td> 0,</td><td> 2, 1</td>

<td> 3</td><td> 3</td><td> 3</td><td> 6</td><td> ,1</td><td> 5</td><td> ,0</td><td> 6</td><td> 3</td><td>s</td><td> 2</td><td> 4</td><td> 4</td><td> 6</td><td> 9</td><td> 1-</td><td> 3</td><td></td>

<td>JT1- 4-B-</td><td>5 F</td><td> 0 9</td><td> 3 9</td><td> 25</td><td> 3</td><td> 17</td><td> 0 9</td><td> 24</td><td>0 r</td><td> 1,</td><td> 1 9</td><td> 0 9</td><td> 0 9</td><td> 4 9</td><td> 0 9</td><td> 2,</td><td> 7 ^S 9</td>

<td> 4</td><td> 3</td><td> 3</td><td> 1</td><td> ,2</td><td> 6</td><td> ,0</td><td> 7</td><td> ,1</td><td> 7</td><td> 9</td><td> 0</td><td> 2</td><td> 8</td><td> 3</td><td> 5</td><td> 3</td><td> 8</td>

<td>JT14-B^—</td><td>5 r</td><td> 0 9</td><td> 2 9</td><td> 30</td><td> 4 9</td><td> 10</td><td> 0 9</td><td> 21</td><td> 0 9</td><td> 1,</td><td> 1 9</td><td> 0 9</td><td> 0 9</td><td>7 r</td><td> 0 9</td><td> 16</td><td> 0,</td>

<td> 5</td><td> 5</td><td> 5</td><td> 2</td><td> ,1</td><td> 6</td><td> ,2</td><td> 5</td><td> ,7</td><td> 6</td><td> 4</td><td> 1</td><td> 2</td><td> 9</td><td> 4</td><td> 5</td><td> , 1</td><td> 0</td>

<td>JT1- 4-B-</td><td> 5</td><td> 0 9</td><td>2 r</td><td> 19</td><td> 3</td><td> 15</td><td> 0 9</td><td> 27</td><td> 0</td><td> 2,</td><td> 0 9</td><td> 0 9</td><td> 1 9</td><td> 3 9</td><td>Q 9</td><td> 3,</td><td> 11</td>

<td> 6</td><td> 6</td><td> 3</td><td> 5</td><td> ,5</td><td> 8</td><td> ,2</td><td> 5</td><td> ,7</td><td> 6</td><td> 1</td><td> 9</td><td> 2</td><td> 1</td><td>Ί</td><td> 6</td><td> 3</td><td> ,1</td>

<td>JT1- 4-B—</td><td>5 r</td><td> 0 9</td><td> 2 9</td><td> 29</td><td> 4 9</td><td> 11</td><td> 0 9</td><td> 26</td><td> 0 9</td><td> 11</td><td> 1 9</td><td> 0 9</td><td> 0</td><td> 0 9</td><td> 0 9</td><td> 4,</td><td> 0,</td>

<td> 7</td><td> 9</td><td> 5</td><td> 0</td><td> ,9</td><td> 0</td><td> ,2</td><td> 3</td><td> ,2</td><td> 6</td><td> ,5</td><td> 4</td><td> 2</td><td> 3</td><td> 4</td><td> 0</td><td> 1</td><td> 1</td>

<td>JT1- 4-B-</td><td> 6 #</td><td>0 F</td><td> 1 9</td><td> 33</td><td> 4 9</td><td> 30</td><td> 0 9</td><td> 12</td><td> 0 9</td><td> 0,</td><td> 1 9</td><td> 0 9</td><td> 1 9</td><td> 0 9</td><td>0 ^ í</td><td> 4,</td><td> 0,</td>

<td> 8</td><td> 2</td><td> 5</td><td> 9</td><td> ,1</td><td> 0</td><td> ,0</td><td> 5</td><td> ,7</td><td> 6</td><td> 3</td><td> 3</td><td> 4</td><td> 4</td><td> 9</td><td> 1</td><td> 4</td><td> 0</td>

<td>JTl- 4-B-</td><td> 4 9</td><td> 0 9</td><td> 3</td><td> 24</td><td> 3 9</td><td> 18</td><td> 0 9</td><td> 26</td><td> 0 9</td><td>i,</td><td> 1 9</td><td> 0 9</td><td>2 f</td><td> 5 9</td><td> 0 9</td><td> 0,</td><td> 5,</td>

<td> 9</td><td> 9</td><td> 2</td><td> 4</td><td> ,6</td><td> 0</td><td> ,5</td><td> 3</td><td> ,2</td><td> 8</td><td> 3</td><td> 1</td><td> 2</td><td> 0</td><td> 5</td><td> 6</td><td>to</td><td> 2</td>

<td>JT1- 4-B-</td><td> 5 /</td><td> 0 9</td><td> 2 9</td><td> 19</td><td> 4 9</td><td> 12</td><td> 0 9</td><td> 30</td><td> 0 9</td><td> 1,</td><td> 1 9</td><td> 0 9</td><td> 1 9</td><td> 4 9</td><td> 1 9</td><td> 3,</td><td> 10</td>

<td> 10</td><td> 2</td><td> 3</td><td>Ί</td><td> ,0</td><td> 0</td><td> ,0</td><td> 6</td><td> &lt;5</td><td> 7</td><td> 6</td><td> 0</td><td> 2</td><td> 7</td><td> 9</td><td> 1</td><td> 0</td><td></td>

<td>JT1- 4-B-</td><td>4 r</td><td> 0 9</td><td> 3 9</td><td> 23</td><td> 3 9</td><td> 18</td><td> 0 9</td><td> 23</td><td> 0 9</td><td>i,</td><td> 1 9</td><td> 0 9</td><td> 1 9</td><td> 4 9</td><td>or 9</td><td> 1,</td><td> 9,</td>

<td> 11</td><td> 8</td><td> 2</td><td> 0</td><td> ,7</td><td> 1</td><td> ,1</td><td> 6</td><td> ,5</td><td>Ί</td><td> 6</td><td> 2</td><td> 2</td><td> 5</td><td> 5</td><td> 8</td><td> 6</td><td> €</td>

<td>JT1- 4 — B-</td><td> 5 /</td><td> 0 9</td><td> 2 9</td><td> 19</td><td> 3 9</td><td> 12</td><td> 0 9</td><td> 26</td><td> 0 9</td><td> 3,</td><td> 1 9</td><td> 0 9</td><td> 0 9</td><td> 5 9</td><td> 0 9</td><td> 3,</td><td> 11</td>

<td> 12</td><td> 0</td><td> 2</td><td> 6</td><td> ,6</td><td> 4</td><td> ,5</td><td> 6</td><td> ,9</td><td> 8</td><td> 1 ,</td><td> 1</td><td> 2</td><td> 9</td><td> 6</td><td> 9</td><td> 5</td><td> /7</td>

301

<td>JT1-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 1</td><td> 2</td><td> 0</td><td></td><td></td>

<td>4-B-</td><td> /</td><td>F</td><td> 9</td><td> 20</td><td> 9</td><td> 11</td><td> 9</td><td> 27</td><td>r</td><td> 2,</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 4,</td><td> 13</td>

<td> 13</td><td> 6</td><td> 3</td><td> 8</td><td> ,9</td><td> 9</td><td> ,9</td><td> 4</td><td> ,0</td><td> 7</td><td> 0</td><td> 0</td><td> 2</td><td> 7</td><td> 3</td><td> 7</td><td> 1</td><td> , 5</td>

<td>JT1-</td><td> 5</td><td> 0</td><td> 3</td><td></td><td> 3</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td></td><td></td>

<td>4-B-</td><td> 9</td><td> 9</td><td> 9</td><td> 25</td><td> 9</td><td> 16</td><td>F</td><td> 23</td><td> 9</td><td> 1,</td><td> 9</td><td>t</td><td>F</td><td> 9</td><td> 9</td><td></td><td> 9,</td>

<td> 14</td><td> 1</td><td> 3</td><td> 1</td><td> ,5</td><td> 3</td><td> ,7</td><td> 7</td><td> ,9</td><td> 8</td><td> 8</td><td> 2</td><td> 2</td><td> 9</td><td> 6</td><td> 4</td><td> 9</td><td> 2</td>

<td>JT1-</td><td> 5</td><td> 0</td><td> 2</td><td></td><td> 4</td><td></td><td> 0</td><td></td><td> 0</td><td></td><td> 0</td><td> 0</td><td> 0</td><td> 9</td><td> 1</td><td></td><td></td>

<td>4-B-</td><td> 9</td><td>F</td><td> 9</td><td> 19</td><td> 9</td><td> 14</td><td>r</td><td> 24</td><td>r</td><td> ^9</td><td> 9</td><td>F</td><td>F</td><td>r</td><td> /</td><td> 2,</td><td> 8,</td>

<td> 15</td><td> 6</td><td> 3</td><td> 7</td><td> ,5</td><td> 1</td><td> ,0</td><td> 8</td><td> ,6</td><td> 7</td><td> 7</td><td> 9</td><td> 2</td><td> 7</td><td> 4</td><td> 3</td><td> 5</td><td> 5</td>

The oil from the seed samples also contained 0.1% C14: 0; 0.1-0.2% C16: 3; between 0.0 and 0.1% each of C20: IA13, C20: 3-6 and C20: 4-6; between 0.3 and 0.4% C22: 0; none of C22: l and C22: 2o6; 0.2% C24: 0 and between 0.2 and 0.4% C24: 1.

Table 20. Seed oil fatty acid composition of individual T2 seeds of B. júncea transformed with GA7-modB T-DNA. The lipids also contained 0, ΙΟ, 2% C16: 1A9, C16: 3 and C20: 2o6, 0.5-0.6% C20: 0, they are C20i3o6, C20: 4o6 and C22; 2o6

<td>Be ill</td><td>or</td><td>or</td><td>Ή</td><td></td><td>CM</td><td></td><td></td><td> **</td><td>saw</td><td>Λ</td><td>or</td><td>&lt;* »E</td><td>and</td><td>and Λ</td><td>or</td><td>w »S</td><td>rn 8</td><td></td><td>&lt;n £</td><td>«N</td>

<td>to</td><td>or</td><td>C18</td><td>C18</td><td>C18</td><td>C18</td><td>C18</td><td>C18</td><td>C18</td><td>C20. -I</td><td>Or 0</td><td> 0</td><td>or S</td><td>OR 8</td><td></td><td> 8</td><td>CM 8</td><td>CM s</td><td> 8</td><td> 22:</td><td>C22</td>

<td> 1</td><td> 4</td><td> 1</td><td> 3</td><td> 2</td><td> 8</td><td> 0</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td> 0</td><td>or</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td>F</td><td> 6</td><td>r</td><td>F</td><td> 9</td><td> 2</td><td> 9</td><td> 9</td><td>r</td><td>Y</td><td>F</td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td> /·</td><td> 9</td><td> 2</td><td> 9</td>

<td></td><td> 4</td><td> 7</td><td>F</td><td> 9</td><td> 3</td><td> 5</td><td> 9</td><td> 4</td><td> 2</td><td> 4</td><td> 3</td><td> 2</td><td> 6</td><td> 1</td><td> 1</td><td> 0</td><td> 8</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 3</td><td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td><td></td>

<td> 2</td><td> 5</td><td> 1</td><td> 3</td><td> 3</td><td> 8</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td>F</td><td> 9</td><td> 9</td><td>F</td><td> /</td><td> 9</td><td> 8</td><td></td><td> /</td><td>r</td><td> 9</td><td>F</td><td>F</td><td></td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 2</td><td></td>

<td></td><td> 6</td><td> 9</td><td> 9</td><td> 1</td><td> 4</td><td> 4</td><td> 9</td><td> 2</td><td> 3</td><td> 5</td><td> 3</td><td> 5</td><td> 4</td><td> 1</td><td> 2</td><td> 0</td><td> 5</td><td> 4</td><td> 9</td><td> 0·</td>

<td></td><td></td><td></td><td> 1</td><td></td><td></td><td></td><td> 9</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 6</td><td></td>

<td> 3</td><td> 5</td><td> 1</td><td> 4</td><td> 3</td><td> 9</td><td> 0</td><td> 2</td><td> 5</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td></td><td></td><td> 2</td><td>r</td><td></td><td> #</td><td> 4</td><td></td><td></td><td>r</td><td></td><td></td><td></td><td> 9</td><td>F</td><td></td><td></td><td></td><td></td><td> 9</td>

<td></td><td> 5</td><td> 8</td><td></td><td> 2</td><td> 9</td><td> 3</td><td></td><td> 9</td><td> 5</td><td> 2</td><td> 4.</td><td> 5</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 4</td><td> 4</td><td> 5</td><td> 0</td>

<td></td><td></td><td></td><td> 3</td><td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> 4</td><td> 5</td><td> 1</td><td> 3</td><td> 3</td><td> 9</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

302

<td rowspan="2"></td><td rowspan="2">F 6</td><td rowspan="2">r 5</td><td rowspan="2"> 6 8</td><td rowspan="2"> 7 7</td><td rowspan="2"> 4</td><td rowspan="2"> / 3</td><td colspan="2"> 9 ,</td><td rowspan="2"> 9 4</td><td rowspan="2">F 4</td><td colspan="2" rowspan="2"> 9 7 3 9</td><td rowspan="2"> 9 3</td><td colspan="2" rowspan="2"> 7 7 2 2</td><td rowspan="2"> / 0</td><td rowspan="2"> 9 6</td><td rowspan="2"> 9 4</td><td rowspan="2"> 3 7 1</td><td rowspan="2"> 9 0</td>

<td> 7 6</td><td> 6</td>

<td> 5</td><td> 4</td><td> 1</td><td> 3</td><td> 2</td><td> 7</td><td> 0</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 7</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td> 7</td><td> 6</td><td>F</td><td> 7</td><td></td><td> 2</td><td>F</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td>r</td><td> 7</td><td>jr</td><td></td><td> 9</td><td>F</td><td> 4</td><td>F</td>

<td></td><td> €</td><td> 7</td><td> / 3</td><td> 7</td><td> 2</td><td> 3</td><td>, r 6</td><td> 0</td><td> 5</td><td> 1</td><td> 3</td><td> 1</td><td> 3</td><td> 1</td><td> 2</td><td> 0</td><td> 2</td><td> 3</td><td> 9 4</td><td> 0</td>

<td> 6</td><td> 4</td><td> 1</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td>F</td><td> 7</td><td>S</td><td> 9</td><td>F</td><td> 9</td><td> 0</td><td> 7</td><td> #</td><td>F</td><td>F</td><td> 7</td><td> 9</td><td>r</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 3</td><td>r</td>

<td></td><td> 9</td><td> 8</td><td> 9 3</td><td> 1</td><td> 4</td><td> 3</td><td> 9 2</td><td> 8</td><td> 3</td><td> 8</td><td> 3</td><td> 7</td><td> 5</td><td> 2</td><td> 2</td><td> 0</td><td>Ί</td><td> 3</td><td>9 Ί</td><td> 0</td>

<td> 7</td><td> 4</td><td> 1</td><td> 3</td><td> 3</td><td> 8</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td>r</td><td> 7</td><td> 6</td><td>F</td><td> /</td><td> 9</td><td> 0</td><td> 7</td><td> 9</td><td>r</td><td> 7</td><td> 7</td><td> 9</td><td> 9</td><td> 7</td><td> 9</td><td> 9</td><td> 7</td><td> 4</td><td> 7</td>

<td></td><td> 7</td><td>Ί</td><td> 7</td><td> 0</td><td> 7</td><td> 4</td><td> 9 9</td><td>Ί</td><td> 3</td><td> 9</td><td> 3</td><td> 9</td><td> 5</td><td> 2</td><td> 2</td><td> 0</td><td> 0</td><td> 3</td><td> 7 2</td><td> 0</td>

<td> 8</td><td> 4</td><td> 2</td><td> 4</td><td> 3</td><td> 9</td><td> 0</td><td> 2</td><td> 4</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td>

<td></td><td> 9</td><td> 9</td><td> 1</td><td> 9</td><td> 7</td><td>F</td><td> 7</td><td> ' 7</td><td> 9</td><td>F</td><td> 7</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td>F</td><td> 9</td><td>r</td><td> 9</td><td> 7</td>

<td></td><td> 8</td><td> 2</td><td>r 0</td><td> 0</td><td>and</td><td> 2</td><td> 9 0</td><td> 7</td><td> 8</td><td> 3</td><td> 3</td><td> 5</td><td> 0</td><td> 1</td><td> 2</td><td> 0</td><td>Ί</td><td> 3</td><td> 2</td><td> 0</td>

<td> 9</td><td> 5</td><td> 1</td><td> 3</td><td> 3</td><td> 9</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td> 7</td><td> 6</td><td>F</td><td> 7</td><td> /</td><td> 1</td><td> 7</td><td> 9</td><td>F</td><td> 9</td><td> 7</td><td> 9</td><td> 7</td><td>t</td><td> 9</td><td> 9</td><td>F</td><td> 2</td><td>F</td>

<td></td><td> 8</td><td>Ί</td><td> 9 6</td><td> 7</td><td> 1</td><td> 3</td><td> 7 3</td><td> 9</td><td> 4</td><td> 8</td><td> 3</td><td> 5</td><td> 3</td><td> 1</td><td> 2</td><td> 0</td><td> 2</td><td> 4</td><td>F 7</td><td> 0</td>

<td> 10</td><td> 4</td><td> 2</td><td> 4</td><td> 2</td><td> 7</td><td> 0</td><td> 2</td><td> 4</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td> 7</td><td> 7</td><td>F</td><td> 9</td><td> 7</td><td> 3</td><td> 7</td><td> 9</td><td>r</td><td> 7</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td> 9</td><td> 9</td><td> 9</td><td> 7</td><td>F</td>

<td></td><td> 8</td><td> 1</td><td> 9 1</td><td> 9</td><td> 4</td><td> 2</td><td> 9 9</td><td> 8</td><td>Ί</td><td> 2</td><td> 3</td><td> 5</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 5</td><td> 3</td><td> 5</td><td> 0</td>

<td> 11</td><td> 5</td><td> 1</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td>r</td><td></td><td> 7</td><td> 9</td><td> 7</td><td> 9</td><td> 0</td><td> 7</td><td>F</td><td>F</td><td>F</td><td> 7</td><td> 7</td><td>F</td><td> 7</td><td> 9</td><td> 9</td><td>F</td><td> 3</td><td>F</td>

<td></td><td> 1</td><td> 7</td><td> 4</td><td> 3</td><td> 7</td><td> 3</td><td> 9 7</td><td> 9</td><td> 4</td><td> 8</td><td> 3</td><td> 5</td><td> 4</td><td> 1</td><td> 2</td><td> 0</td><td>and</td><td> 4</td><td> 7 6</td><td> 0</td>

<td> 12</td><td> 4</td><td> 1</td><td> 3</td><td> 2</td><td> 7</td><td> 0</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 7</td><td>r</td><td> 7</td><td>F</td><td> 7</td><td> 9</td><td> 0</td><td> 7</td><td> 9</td><td> 9</td><td>F</td><td> 7</td><td> 9</td><td>F</td><td>F</td><td> 9</td><td></td><td>r</td><td> 2</td><td> 7</td>

<td></td><td> 7</td><td> 8</td><td> 3</td><td> 7</td><td> 9</td><td> 4</td><td> 9 €</td><td> 1</td><td> 3</td><td> 5</td><td> 3</td><td> 3</td><td> 6</td><td> 1</td><td> 1</td><td> 0</td><td> 2</td><td> 3</td><td> 7 3</td><td> 0</td>

<td> 13</td><td> 4</td><td> 2</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 4</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td> 9</td><td> 7</td><td>F</td><td> 7</td><td> 9</td><td> 0</td><td> /</td><td> 9</td><td>r</td><td> 9</td><td> 7</td><td> 9</td><td> 9</td><td> 7</td><td> 9</td><td> 9</td><td> 7</td><td> 2</td><td> /</td>

<td></td><td> 9</td><td> 0</td><td> 7 9</td><td> 0</td><td> 1</td><td> 4</td><td> 7 1</td><td> 1</td><td> 3</td><td> 6</td><td> 3</td><td> 1</td><td> 5</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 3</td><td> 7 6</td><td> 0</td>

<td> 14</td><td> 4 9</td><td>one r</td><td> 3 5</td><td>3 F</td><td> € 7</td><td> 0 9</td><td> 2 2</td><td> 0 7</td><td> 1 9</td><td>1 r</td><td> 0 7</td><td> 3 7</td><td> 0 9</td><td> 0 7</td><td> 0</td><td> 0 9</td><td> 1 9</td><td>0 F</td><td> 1 4</td><td>0 F</td>

<td></td><td> 1</td><td> €</td><td>9 Ί</td><td> 2</td><td> 9</td><td> 3</td><td> 7 4</td><td>Ί</td><td> 4</td><td> 3</td><td> 3</td><td> 0</td><td> 5</td><td> 2</td><td>í</td><td> 0</td><td> 9</td><td> 3</td><td>F 0</td><td> 0</td>

<td> 15</td><td> 4</td><td> 1</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td> 7</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td> 3</td><td> 7</td><td> 9</td><td> 9</td><td> 7</td><td> 7</td><td> 9</td><td>F</td><td> 7</td><td> 9</td><td> 9</td><td>F</td><td> 1</td><td> 9</td>

<td></td><td> 7</td><td> 8</td><td> 6</td><td> 4</td><td> 8</td><td> 3</td><td>7 Ί</td><td> €</td><td> 5</td><td> 2</td><td> 2</td><td> 7</td><td> 3</td><td> 2</td><td> 1</td><td> 0</td><td> 8^</td><td> 3</td><td> 9 4</td><td> 0</td>

<td> 16</td><td> 5</td><td> 1</td><td> 3</td><td> 3</td><td> 8</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 3</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

303

<td rowspan="2"></td><td colspan="2" rowspan="2">rf 3 6</td><td rowspan="2"> 5 3</td><td rowspan="2">F 5</td><td rowspan="2"> 7 1</td><td colspan="4"> , 1 , ,</td><td rowspan="2">9 Ί</td><td rowspan="2"> 3</td><td rowspan="2">r one</td><td rowspan="2"> 7 5</td><td rowspan="2"> 9 2</td><td rowspan="2"> 7 1</td><td rowspan="2"> 9 0</td><td rowspan="2"> 9</td><td rowspan="2"> 9 3</td><td rowspan="2"> 3 9 9</td><td rowspan="2"> 7 0</td>

<td> 5</td><td> 9 1</td><td colspan="2"> 8 2</td>

<td> 17</td><td> 4</td><td> 1</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td>r</td><td> 7</td><td> 9</td><td>r</td><td> 7</td><td> 7</td><td> 1</td><td>F</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td>r</td><td> 9</td><td> 7</td><td> 7</td><td>r</td><td> 9</td><td> 2</td><td> 7</td>

<td></td><td> 9</td><td> 7</td><td> 9</td><td> 3</td><td> 7</td><td> 3</td><td> 9</td><td> 7</td><td> 4</td><td> 8</td><td> 3</td><td> 0</td><td> 3</td><td> 2</td><td> 1</td><td> 0</td><td> 7</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 4</td><td></td><td></td><td></td><td> 1</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td></td>

<td> 18</td><td> 5</td><td> 1</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 7</td><td> 9</td><td> 8</td><td> 9</td><td> 7</td><td> 7</td><td> 0</td><td>F</td><td> 9</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 9</td><td> 3</td><td> 9</td>

<td></td><td> 0</td><td> 8</td><td> 9</td><td> 1</td><td> 8</td><td> 4</td><td>F</td><td> 8</td><td> 3</td><td> 8</td><td> .2</td><td> 3</td><td> 3</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td><td></td>

<td> 19</td><td> 5</td><td> 1</td><td> 3</td><td> 2</td><td> 9</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 9</td><td></td><td> 9</td><td> 9</td><td> 7</td><td> 7</td><td> 2</td><td></td><td> 9</td><td> 7</td><td> 7</td><td>r</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td> 9</td><td> 9</td><td> 0</td><td> 9</td>

<td></td><td> 1</td><td> 8</td><td></td><td> 9</td><td> 0</td><td> 2</td><td> 9</td><td> €</td><td> 5</td><td> 0</td><td> 3</td><td> 7</td><td> 2</td><td> 1</td><td> 7</td><td> 0</td><td> 6</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td> 2</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 2</td><td></td>

<td> 20</td><td> 4</td><td> 1</td><td> 3</td><td> 3</td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td></td><td></td><td>B</td><td> 7</td><td> 7</td><td> 7</td><td> 1</td><td>F</td><td> 9</td><td> 7</td><td>F</td><td>F</td><td> 7</td><td> 9</td><td>F</td><td> 9</td><td> 7</td><td>F</td><td> 3</td><td> 9</td>

<td></td><td> 8</td><td> 8</td><td>F</td><td> 2</td><td> 8</td><td> 4</td><td> 7</td><td> 7</td><td> 4</td><td> 7</td><td> 3</td><td> 1</td><td> 4</td><td> 2</td><td> 1</td><td> 0</td><td> 7</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 2</td><td></td><td></td><td></td><td>¹</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3</td><td></td>

<td> 21</td><td> 5</td><td> 2</td><td> .3</td><td></td><td> 7</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td> 7</td><td> 7</td><td> 9</td><td>r</td><td> 7</td><td> 7</td><td> 0</td><td> 9</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 7</td><td> 9</td><td> 7</td><td> 9</td><td> 2</td><td> 9</td>

<td></td><td> 0</td><td> 0</td><td> 9</td><td> 9</td><td> 9</td><td> 4</td><td> 7</td><td> 7</td><td> 3</td><td> 7</td><td> 3</td><td> 3</td><td> 3</td><td> 2</td><td> 1</td><td> 0</td><td> 9</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 7</td><td></td><td></td><td></td><td> £</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 2</td><td></td>

<td> 22</td><td> 4</td><td> 1</td><td> 3</td><td> 3</td><td> 8</td><td> 0</td><td> 2</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td></td><td> 7</td><td> 6</td><td> 7</td><td> ?</td><td> »</td><td> 3</td><td></td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td>r</td><td></td><td> 9</td><td> 9</td><td> 7</td><td> 9</td><td> 2</td><td></td>

<td></td><td> 7</td><td> 6</td><td> 9</td><td> 3</td><td> 3</td><td> 3</td><td></td><td> 6</td><td> 5</td><td> 2</td><td> 3</td><td> 7</td><td> 3</td><td> 2</td><td> 1</td><td> 0</td><td>s</td><td> 3</td><td> 9</td><td> 0</td>

<td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td> 7</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td><td></td>

<td> 23</td><td> €</td><td> 2</td><td> 3</td><td> 4</td><td> 7</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td>

<td></td><td></td><td> 7</td><td> 2</td><td> 7</td><td> 7</td><td> 7</td><td> 9</td><td> 7</td><td> 7</td><td> 9</td><td>F</td><td> 7</td><td> 7</td><td> 7</td><td>r</td><td> 7</td><td>F</td><td> 9</td><td> 7</td><td> 9</td>

<td></td><td> 2</td><td> 1</td><td>F</td><td> 4</td><td> 2</td><td> 6</td><td> 9</td><td> 2</td><td> 2</td><td> €</td><td> 4</td><td> 2</td><td> 5</td><td> 3</td><td> .2</td><td> 0</td><td> 6</td><td> 4</td><td> 7</td><td> 0</td>

<td></td><td></td><td></td><td> 0</td><td></td><td></td><td></td><td> 4</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 6</td><td></td>

Table 21. Seed oil fatty acid composition of individual T3 seeds of B. júncea transformed with GA7-modB T-DNA. The seeds also contained 0.1-0.2% each of C16: 3, C2O: 1A13, C20; 2o6. No C20; 3q6, C20: 4ta6, C22; 2a6, C22; 5ta6 and C22i6a3 were detected.

304

<td>.lia</td><td>ο</td><td>01 Ή</td><td>OR</td><td></td><td></td><td>CM</td><td></td><td>&lt;n $</td><td>or</td><td></td><td> «-4</td><td></td><td>or</td><td> §</td><td></td><td></td><td>s</td><td></td><td></td>

<td>1 Μ</td><td>S Ο.</td><td>Rh Q.</td><td>® OR</td><td>® rM U</td><td>OR</td><td>® iH □.</td><td>® wt _LL</td><td>® fH o.</td><td>or CM O.</td><td>® or,</td><td>or CM O.</td><td>or CM u,</td><td>CM O.</td><td>or CM O.</td><td>O &lt;MO,</td><td>M CM U,</td><td>CM CM u.</td><td>CM U</td><td>CM CM U</td>

<td> 1</td><td> 4</td><td> 0</td><td> 2</td><td> 38</td><td> 3</td><td> 5</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 16</td>

<td></td><td> 9</td><td> 9</td><td> 9</td><td> ,4</td><td>F</td><td>F</td><td> /</td><td> ,0</td><td></td><td> 9</td><td>F</td><td>F</td><td></td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> , 3</td>

<td></td><td> 8</td><td> 4</td><td> 8</td><td></td><td> 7</td><td>Ί</td><td> 4</td><td></td><td> 7</td><td> 0</td><td> 5</td><td> 1</td><td> 3</td><td> 4</td><td> 4</td><td> 3</td><td> 4</td><td> 5</td><td></td>

<td> 2</td><td> 4</td><td> 0</td><td> 3</td><td> 43</td><td> 3</td><td> 5</td><td> 0</td><td> 18</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 12</td>

<td></td><td> 9</td><td> &lt;9</td><td>r</td><td> ,3</td><td> 9</td><td>F</td><td> 9</td><td> ,5</td><td></td><td>F</td><td>F</td><td>F</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> ,4</td>

<td></td><td> 3</td><td> 4</td><td> 0</td><td></td><td> 6</td><td> 2</td><td> 2</td><td></td><td> 7</td><td> 8</td><td> 7</td><td> 4</td><td> 3</td><td> 2</td><td> 3</td><td> 2</td><td> 2</td><td> 3</td><td></td>

<td> 3</td><td> 4</td><td> 0</td><td> 2</td><td> 33</td><td> 4</td><td> 5</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 20</td>

<td></td><td>r</td><td> 9</td><td> 9</td><td> ,1</td><td> 9</td><td> 9</td><td> 9</td><td> ,5</td><td></td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,8</td>

<td></td><td> 6</td><td> 4</td><td> 8</td><td></td><td> 1</td><td> 1</td><td> 4</td><td></td><td> 7</td><td> 2</td><td> 4</td><td> 1</td><td> 3</td><td> 6</td><td> 5</td><td> 3</td><td> 4</td><td> 4</td><td></td>

<td> 4</td><td> 4</td><td> 0</td><td> 2</td><td> 39</td><td> 3</td><td> 6</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0'</td><td> 14</td>

<td></td><td> 9</td><td> 9</td><td> 9</td><td> ,5</td><td> 9</td><td>r</td><td> 9</td><td> , 5</td><td></td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td>t</td><td></td><td> 9</td><td> 9</td><td> 9</td><td> ,2</td>

<td></td><td> 5</td><td> 4</td><td> 9</td><td></td><td> 3</td><td> 3</td><td> 4</td><td></td><td> 8</td><td> 2</td><td> 5</td><td> 0</td><td> 3</td><td> 7</td><td> 3</td><td> 2</td><td> 8</td><td> 3</td><td></td>

<td> 5</td><td> 4</td><td> 0</td><td> 2</td><td> 32</td><td> 3</td><td> 4</td><td> 0</td><td> 20</td><td> 0</td><td> 1</td><td> 1</td><td> . 2</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 19</td>

<td></td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> ,7</td><td></td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td>t</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> ,4</td>

<td></td><td> 9</td><td> 5</td><td> 8</td><td></td><td> 9</td><td> 7</td><td> 3</td><td></td><td> 8</td><td> 2</td><td> 4</td><td> 0</td><td> 3</td><td> 4</td><td> 5</td><td> 3</td><td> 2</td><td> 4</td><td></td>

<td>δ</td><td> 4</td><td> 0</td><td> 3</td><td> 38</td><td> 3</td><td> 5</td><td> 0</td><td> 19</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 16</td>

<td></td><td></td><td> *</td><td></td><td> ,1</td><td> 9</td><td></td><td> 9</td><td> ,4</td><td></td><td>F</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td>r</td><td></td><td> .0</td>

<td></td><td> 3</td><td> 3</td><td> 0</td><td></td><td> 2</td><td> 8</td><td> 3</td><td></td><td> 7</td><td> 1</td><td> 5</td><td> 2</td><td> 3</td><td> 5</td><td> 4</td><td> 2</td><td> 3</td><td> 4</td><td></td>

<td> 7</td><td> 5</td><td> 0</td><td> 3</td><td> 29</td><td> 4</td><td> 4</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 22</td>

<td></td><td> 9</td><td> 9</td><td>F</td><td> ,3</td><td> 9</td><td> 9</td><td></td><td> ,6</td><td></td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,9</td>

<td></td><td> 4</td><td> 5</td><td> 2</td><td></td><td> 0</td><td> 6</td><td> 4</td><td></td><td> 9</td><td> 7</td><td> 3</td><td> 2</td><td> 4</td><td> 6</td><td> 7</td><td> 3</td><td> 4</td><td> 5</td><td></td>

<td>β</td><td> 5</td><td> 0</td><td> 3</td><td> 34</td><td> 4</td><td> 4</td><td> 0</td><td> 17</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 19</td>

<td></td><td> 9</td><td> 9</td><td> 9</td><td> ,5</td><td> 9</td><td> 9</td><td> 9</td><td> ,2</td><td></td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> ,4</td>

<td></td><td> 2</td><td> 5</td><td> 7</td><td></td><td> 1</td><td> 5</td><td> 3</td><td></td><td> 0</td><td> 4</td><td> 4</td><td> 5</td><td> 4</td><td> 4</td><td> 6</td><td> 3</td><td> 2</td><td> 5</td><td></td>

<td> 9</td><td> 5</td><td> 0</td><td> 3</td><td> 33</td><td> 3</td><td> 4</td><td>Q</td><td> 17</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 20</td>

<td></td><td>F</td><td> 9</td><td> 9</td><td> ,4</td><td> 9</td><td> 9</td><td> 9</td><td> ,6</td><td></td><td>r</td><td> 9</td><td>F</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,7</td>

<td></td><td> 3</td><td> 5</td><td> 4</td><td></td><td> 7</td><td> 6</td><td> 3</td><td></td><td> 9</td><td> 7</td><td> 2</td><td> 1</td><td> 4</td><td> 5</td><td> 6</td><td> 2</td><td> 2</td><td> 5</td><td></td>

<td> 1</td><td> 4</td><td> 0</td><td> 3</td><td> 39</td><td> 3</td><td> 5</td><td> 0</td><td> 17</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 16</td>

<td> 0</td><td>r</td><td> 9</td><td> 9</td><td> ,5</td><td> 9</td><td> 9</td><td> 9</td><td> ,8</td><td></td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td>r</td><td>F</td><td>F</td><td>F</td><td> .1</td>

<td></td><td> 6</td><td> 4</td><td> 0</td><td></td><td> 5</td><td> 1</td><td> 3</td><td></td><td>B</td><td> 0</td><td> €</td><td> 4</td><td> 4</td><td> 3</td><td> 4</td><td> 3</td><td> 3</td><td> 4</td><td></td>

<td> 1</td><td> 4</td><td> 0</td><td> 3</td><td> 41</td><td> 3</td><td> 5</td><td> 0</td><td> 19</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 12</td>

<td> 1</td><td> 9</td><td> 9</td><td> 9</td><td> ,7</td><td> 9</td><td> 9</td><td> 9</td><td> ,0</td><td></td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,7</td>

<td></td><td> 3</td><td> 4</td><td> 1</td><td></td><td> 5</td><td> €</td><td> 2</td><td></td><td> 7</td><td> 9</td><td> 6</td><td> 3</td><td> 3</td><td> 4</td><td> 3</td><td> 2</td><td> 5</td><td> 3</td><td></td>

<td> 1</td><td> 4</td><td> 0</td><td> 2</td><td> 33</td><td> 4</td><td> 5</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 20</td>

<td> 2</td><td> 9</td><td> 9</td><td> 9</td><td> , 8</td><td> 9</td><td> 9</td><td> /</td><td> ,2</td><td></td><td> 9</td><td>r</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,1</td>

<td></td><td> 8</td><td> 5</td><td> 8</td><td></td><td> 0</td><td> 3</td><td> 4</td><td></td><td> 7</td><td> 4</td><td> 3</td><td> 2</td><td> 3</td><td> 6</td><td> 6</td><td> 3</td><td> 3</td><td> 4</td><td></td>

<td> 1</td><td> 4</td><td> 0</td><td> 3</td><td> 40</td><td> 3</td><td> 5</td><td> 0</td><td> 19</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 13</td>

<td> 3</td><td> 9</td><td> 9</td><td> 9</td><td> , 3</td><td> 9</td><td> 9</td><td>F</td><td> ,1</td><td></td><td> 9</td><td> 9</td><td>r</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> ,8</td>

<td></td><td> 4</td><td> 4</td><td> 5</td><td></td><td> 5</td><td> 2</td><td> 2</td><td></td><td> 7</td><td> 0</td><td> 5</td><td> 6</td><td> 3</td><td> 4</td><td> 4</td><td> 2</td><td> 4</td><td> 3</td><td></td>

<td> 1</td><td> 4</td><td> 0</td><td> 3</td><td> 36</td><td> 3</td><td> 5</td><td> 0</td><td> 19</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 15</td>

<td> 4</td><td> 9</td><td> 9</td><td> 9</td><td> ,1</td><td> 9</td><td> 9</td><td> 9</td><td> ,9</td><td></td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> .9</td><td>F</td><td> ,4</td>

<td></td><td> 9</td><td> 4</td><td> 2</td><td></td><td> 1</td><td> 9</td><td> 3</td><td></td><td> 7</td><td> 4</td><td> 3</td><td> 1</td><td> 3</td><td> 9</td><td> 5</td><td> 2</td><td> 7</td><td> 3</td><td></td>

<td> 1</td><td> 4</td><td> 0</td><td> 2</td><td> 37</td><td> 3</td><td> 4</td><td> 0</td><td> 19</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 17</td>

<td> 5</td><td>r</td><td> 9</td><td> 9</td><td> ,2</td><td> 9</td><td> 9</td><td> 9</td><td> ,6</td><td></td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,9</td>

305

<td rowspan="2"> 1</td><td rowspan="2"> 0 4</td><td colspan="3"> 3 8</td><td rowspan="2"> 2 ' 3</td><td rowspan="2"> 9 ' 4</td><td colspan="2"> 3</td><td rowspan="2"> 8 0</td><td rowspan="2"> 9 1</td><td rowspan="2"> 6 1</td><td rowspan="2"> 5 1</td><td rowspan="2"> 4 0</td><td rowspan="2"> 3 1</td><td rowspan="2"> 5 0</td><td rowspan="2"> 3 0</td><td rowspan="2"> 1 ¹ 1</td><td colspan="2"> 4</td>

<td> 0</td><td> 3</td><td> 36</td><td> 0</td><td> 19</td><td> 0</td><td> 17</td>

<td> 6</td><td> 9'</td><td> /</td><td> 9</td><td> ,7</td><td>F</td><td> /</td><td> 9</td><td> ,0</td><td>r</td><td> 9</td><td>t</td><td>t</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> ,8</td>

<td></td><td> 5</td><td> 4</td><td> 8</td><td></td><td> 2</td><td> 5</td><td> 7</td><td></td><td> 9</td><td> 1</td><td> 4</td><td> 8</td><td> 4</td><td> 7</td><td> 5</td><td> 2</td><td> 0</td><td> 5</td><td></td>

<td> 1</td><td> 5</td><td> 0</td><td> 2</td><td> 27</td><td> 3</td><td> 5</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 24</td>

<td> 7</td><td>r</td><td></td><td> 9</td><td> ,8</td><td> *</td><td> 9</td><td>r</td><td> ,3</td><td></td><td>r</td><td> 9</td><td> 9</td><td>r</td><td> 9</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> ,7</td>

<td></td><td> 2</td><td> 4</td><td> 8</td><td></td><td> 7</td><td> 3</td><td> 5</td><td></td><td> 8</td><td>Ί</td><td> 3</td><td> 0</td><td> 4</td><td> 9</td><td> 7</td><td> 3</td><td> 7</td><td> 5</td><td></td>

<td> 1</td><td> 5</td><td> 0</td><td> 2</td><td> 31</td><td> 4</td><td> 4</td><td> 0</td><td> 18</td><td> 0</td><td> 1</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 21</td>

<td> 8</td><td></td><td>F</td><td></td><td> ,7</td><td>r</td><td> /</td><td> 9</td><td> ,5</td><td>F-</td><td>F</td><td> /</td><td>F</td><td> 9</td><td> 9</td><td> 9</td><td> 9</td><td> /</td><td> /</td><td> ,8</td>

<td></td><td> 4</td><td> 6</td><td> 8</td><td></td><td> 1</td><td> 6</td><td> 3</td><td></td><td> 8</td><td> 3</td><td> 3</td><td> 4</td><td> 4</td><td> 4</td><td> 6</td><td> 2</td><td> 3</td><td> 4</td><td></td>

<td> 1</td><td> 6</td><td> 0</td><td> 2</td><td> 30</td><td> 3</td><td> 4</td><td> 0</td><td> 16</td><td> 0</td><td> 2</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 25</td>

<td> 9</td><td></td><td></td><td>r</td><td> ,3</td><td></td><td>r</td><td>r</td><td> ,1</td><td>r</td><td> 9</td><td> 9</td><td></td><td>r</td><td> 9</td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td> ,8</td>

<td></td><td> 4</td><td>s</td><td> 7</td><td></td><td> 5</td><td> 1</td><td> 4</td><td></td><td> 8</td><td> 1</td><td> 1</td><td> 9</td><td> 4</td><td> 4</td><td> 7</td><td> 2</td><td> 1</td><td> 5</td><td></td>

<td> 2</td><td> 4</td><td> 0</td><td> 3</td><td> 39</td><td> 3</td><td> 5</td><td> 0</td><td> 20</td><td> 0</td><td> 0</td><td> 1</td><td> 1</td><td> 0</td><td> 1</td><td> 0</td><td>ΰ</td><td> 1</td><td> 0</td><td> 14</td>

<td> 0</td><td>r</td><td></td><td>t</td><td> ,2</td><td> 9</td><td> 9</td><td>r</td><td> ,1</td><td> 9</td><td> 9</td><td>F</td><td> 9</td><td>r</td><td> 9</td><td>r</td><td>F</td><td> 9</td><td> 9</td><td> ,1</td>

<td></td><td> 3</td><td> 3</td><td> 2</td><td></td><td> 3</td><td> 7</td><td> 2</td><td></td><td>Ί</td><td> 9</td><td> =6</td><td>Ί</td><td> 3</td><td> 3</td><td> 3</td><td> 2</td><td> 3</td><td> 3</td><td></td>

Example 9: Additional analysis of transformed plants and field trials

Southern blot hybridization analyzes were carried out on selected B. napus T2 plants with the T-DNA of the GA7-modB construct. DNA extracted from plant tissue samples was digested with various restriction enzymes for Southern blot hybridization analysis. A radioactive probe corresponding to part of the T-DNA was hybridized with the membranes, which were washed under severe conditions, and the membranes were exposed to a film to detect the hybridization bands. Some of the samples exhibited individual hybridization bands for each of the restriction digests, corresponding to insertions

306 individual T-DNA bands in plants, while others showed two bands and others again showed multiple T-DNA bands, corresponding to between 4 and 6 insertions. The number of hybridizing bands observed in the Southern blot analysis correlated well with the number of T-DNA copies in the transgenic plants determined by the digital PCR method, up to a copy number of approximately 3 or 4. At a higher copy number of approximately 5, the digital PCR method was less reliable.

Some of the selected lines were used as pollen donors in crosses with a series of approximately 30 different varieties of B. napus with different genetic backgrounds. Additional crosses are carried out to demonstrate whether the multiple T-DNA insertions are genetically linked or not, and allowing for the segregation of genetically unlinked transgenic loci. In this way, lines containing individual transgenic loci are selected.

Single primer PCR reactions are performed on the transgenic lines, using primers adjacent to the left and right edges of the T-DNA, and any lines showing the presence of inverted repeats of the T-DNAs are discarded.

307

Several of the transgenic lines showed a delayed flowering, while others had a lower number of seeds and therefore lower seed yield per plant after growth in the greenhouse, consistent with lower male or female fertility. The morphology of the flowers in these plants was examined and it was observed that in some cases, dehiscence and pollen release from the anthers were delayed so that the styles had been praised before the dehiscence occurred, distancing the anthers from stigmata. Full fertility could be restored by artificial pollination. Furthermore, the viability of pollen to dehiscence was determined by staining with the vital stains PDA and PI (Example 1) and it was shown to be reduced in some of the lines, while in most of the transgenic lines, the viability of the pollen was approximately 100% compared to wild type controls. As another test for another possible cause of lower seed yield in some plants, the fatty acid content and composition of the flower bulbs including anthers and stigmas / styles of some T3 and T4 plants were tested. DHA was not detected in the extracted lipids, indicating that the genes of the genetic construct were not expressed in the flower bulbs during plant development.

308 and ruling out this as a cause of lower seed yield.

The oil content was measured by NMR and the level of DHA was determined in the total content of fatty acids for T2 seeds. Transgenic lines with less than 6% DHA were discarded. The number of T-DNA copies in plant leaf samples of the TI, T2 and T3 generations was determined by means of the digital PCR method (Example 1).

Selected seed lots T3 and T4 were sown in the field at two sites in Victoria, Australia, each with 10m lines at a planting density of approximately 10seeds / m. The selected seed lots included a derived line B003-5-14 that showed DHA levels in pooled seeds of between approximately 8 and 11% and individual T2 seed DHA levels of up to approximately 19%, with a T-DNA copy number in the TO plant 3. The selected seed lots also included lines derived from B0050-27 that had shown T2 seed DHA levels of greater than 20%, and a T2 plant T-DNA copy number of 1 or 2. Field-sown seeds germinated and seedlings emerged with the same rate as wild-type seeds. The plants that grew from most, but not all, of the seed lots planted were phenotypically normal, for

309 Examples showed morphology, growth rate, plant height, male and female fertility, pollen viability (100%), seed laying, silique size, and morphology that were essentially the same as wild-type control plants grown under the same conditions. Seed yield per plant was similar to wild type controls that were grown under the same conditions. Other seed samples were sown in larger areas to accumulate the selected transgenic lines. The total DHA content in the harvested seeds was at least 30 mg / g of seed.

Those of skill in the art will appreciate that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit and scope of the invention in its widely described form. therefore, they should be considered in all respects as illustrative and not restrictive.

Any discussion of documents, minutes, materials, devices, articles or the like that is included in the present specification is for the sole purpose of providing a context for the present invention. It should not be taken as an admission that any or all of these points form part of the basis of the prior art that were

310 part of the common general knowledge in the field of interest for the present invention as it existed prior to the priority date of each claim of this application.

REFERENCES

Abbadi et al. (2004) Plant Cell 16: 2734-2748.

Abbott et al. (1998) Science 282: 2012-2018.

Agaba et al. (2004) Marine Biotechnol. (NY) 6: 251-261.

Alvarez et al. (2000) Theor Appl Genet 100: 319-327.

Armbrust et al. (2004) Science 306: 79-86.

Baumlein et al. (1991) Mol. Gen. Genet. 225: 459-467.

Baumlein et al. (1992) Plant J. 2: 233-239.

Beaudoin et al. (2000) Proc. Nati. Acad. Sci. USA 97: 64216426.

Belide et al. (2013) Plant Cell Tiss Organ Cult. 113: 543-553.

Berberich. et al. (1998) Plant Mol. Biol. 36: 297-306.

Broun et al. (1998) Plant J. 13: 201-210.

Brown et al. (2002) Biochem J. 364: 795-805.

Chan et al. (2006) Nature Biotechnology 28: 951-956.

Chapman et al. (2004) Gen. Dev. 18: 1179-1186.

Chen et al. (2004) The Plant Cell 16: 1302-1313.

Cheng et al. (1996) Plant Cell Rep. 15: 653-657.

Cheng et al. (2010) Transgenic Res 19: 221-229.

Cho et al. (1999a) J. Biol. Chem. 274: 471-477.

311

Cho et al. (1999b) J. Biol. Chem. 274: 37335-37339.

Christie (1982) J. Lipid Res. 23: 1072-1075.

Damude et al. (2006). Proc Nati Acad Sci USA 103: 9446-9451.

Denic and Weissman (2007) Cell 130: 663-677.

Domergue et al. (2002) Eur. J. Biochem. 269: 4105-4113.

Domergue et al. (2003) J. Biol. Chem. 278: 35115-35126.

Domergue et al. (2005) Biochem. J. 1 389: 483-490.

Dunoyer et al. (2004) The Plant Cell 16: 1235-1250.

Ellerstrom et al. (1996) Plant Mol. Biol. 32: 1019-1027.

Gamez et al. (2003) Food Res International 36: 721-727.

Garcia-Maroto et al. (2002) Lipids 37: 417-426.

Girke et al. (1998) Plant J. 15: 39-48.

Harayama (1998). Trends Biotechnol. 16: 76-82.

Hastings et al. (2001) Proc. Nati. Acad. Sci. USA 15 98: 14304-14309.

Hinchee et al. (1988) Biotechnology 6: 915-922.

Hoffmann et al. (2008) J Biol. Chem. 283: 22352-22362.

Hong et al. (2002a) Lipids 37: 863-868.

Horiguchi et al. (1998) Plant Cell Physiol. 39: 540-544.

Huang et al. (1999) Lipids 34: 649-659.

Inagaki et al. (2002) Biosci. Biotechnol. Biochem. 66: 613621.

Kajikawa et al. (2004) Plant Mol. Biol. 54: 335-52.

Kajikawa et al. (2006) FEBS Lett 580: 149-154.

312

Kereszt et al. (2007) Nature Protoc 2: 948-952.

Kim et al. (2005) Plant Cell. 20051073-89.

Knutzon et al. (1998) J. Biol Chem. 273: 29360-6.

Koletzko et al. (1988) Am. J. Clin. Nutr. 47: 954-959.

Koziel et al. (1996) Plant Mol. Biol. 32: 393-405.

Lassner (1995) Plant Physiol. 109: 1389-94.

Leonard et al. (2000) Biochem. J. 347: 719-724.

Leonard et al. (2000b) Biochem. J. 350: 765-770.

Leonard et al. (2002) Lipids 37: 733-740.

Lewsey et al. (2007) Plant J. 50: 240-252.

Lo et al. (2003) Genome Res. 13: 455-466.

Lu and Kang (2008) Plant Cell Rep. 27: 273-8.

Mallory et al. (2002) Nat. Biotech. 20: 622-625.

Marangoni et al. (1995) Trends in Food Sci. Technol. 6: 329335.

Meesapyodsuk et al. (2007) J Biol Chem 282: 20191-20199.

Meng et al. (2008) J. Gen. Virol. 89: 2349-2358.

Meyer et al. (2003) Biochem. 42: 9779-9788.

Meyer et al. (2004) Lipid Res 45: 1899-1909.

Michaelson et al. (1998a) J. Biol. Chem. 273: 19055-19059.

Michaelson et al. (1998b) FEBS Lett. 439: 215-218.

Murashige and Skoog (1962) Physiologia Plantarum 15: 473-497.

Napier et al. (1998) Biochem. J. 330: 611-614.

Needleman and Wunsch (1970) J. Mol. Biol. 48: 443-453.

313

Parker-Barnes et al. (2000) Proc. Nati. Acad. Sci. USA 97: 8284-8289.

Pereira et al. (2004a) Biochem. J. 378: 665-671.

Pereira et al. (2004b) Biochem. J. 384: 357-366.

Perrin et al. (2000) Mol Breed 6: 345-352.

Petrie et al. (2010a) Metab. Eng. 12: 233-240.

Petrie et al. (2010b) Plant Methods 11: 6: 8.

Petrie et al. (2012) Transgenic Res. 21: 139-147.

Potenza et al. (2004) In Vitro Cell Dev Biol-Plant 40: 1-22.

Qi et al. (2002) FEBS Lett. 510: 159-165.

Qi et al. (2004) Nat. Biotech. 22: 739-745.

Qiu et al. (2001) J. Biol. Chem. 276: 31561-31566.

Reddy and Thomas (1996) Nat. Biotech. 14: 639-642.

Reddy et al. (1993) Plant Mol. Biol. 22: 293-300.

Robert et al. (2005) Fuñe. Plant Biol. 32: 473-479.

Robert et al. (2009) Marine Biotech 11: 410-418.

Ruiz-Lopez et al. (2012) Transgenic Res. 21: 139-147.

Saha et al. (2006) Plant Physiol. 141: 1533-1543.

Saito et al. (2000) Eur. J. Biochem. 267: 1813-1818.

Sakuradani et al. (1999) Gene 238: 445-453.

Sato et al. (2004) Crop Sci. 44: 646-652.

Sakuradani et al. (2005) Appl. Microbiol. Biotechnol. 66: 648654.

Sayanova et al. '(2006) J Biol Chem 281: 36533-36541.

314

Sayanova et al. (1997) Proc. Nati. Acad. Sci. USA 94: 42114216.

Sayanova et al. (2003) FEBS Lett. 542: 100-104.

Sayanova et al. (2006) Plant 224: 1269-1277.

Sayanova et al. (2007) Plant Physiol 144: 455-467.

Shukla et al. (2002) J. Amer. Oil Chem. Soc. 79: 965-969.

Singh et al. (2005) Curr. Opin. in Plant Biol. 8: 197-203.

Speranza et al. (2012) Process Biochemistry (In Press).

Sperling et al. (2000) Eur. J. Biochem. 267: 3801-3811.

Sperling et al. (2001) Arch. Biochm. Biophys. 388: 293-8.

Sprecher et al. (1995) J. Lipid Res. 36: 2471-2477.

Spychalla et al. (1997) Proc. Nati. Acad. Sci. USA 94: 1142-1147.

Tonon et al. (2003) FEBS Lett. 553: 440-444.

Trautwein (2001) European J. Lipid Sci. And Tech. 103: 45-55.

Tvrdik (2000) J. Cell Biol. 149: 707-718.

Venegas-Galerón et al. (2010) Prog. Lipid Res. 49: 108-119.

Voinnet et al. (2003) Plant J. 33: 949-956.

Wallis and Browse (1999) Arch. Biochem. Biophys. 365: 307-316.

Watts and Browse (1999b) Arch. Biochem. Biophys. 362: 175-182.

Weiss et al. (2003) Int. J. Med. Microbiol. 293: 95: 106.

Weng et al., (2004) Plant Molecular Biology Reporter 22: 289300.

Whitney et al. (2003) Plant 217: 983-992.

315

Wood (2009) Plant Biotechnol J. 7: 914-24.

Wu et al. (2005) Nat. Biotech. 23: 1013-1017.

Yang et al. (2003) Plant 216: 597-603.

Zank et al. (2002) Plant J. 31: 255-268.

Zank et al. (2005) WO 2005/012316

Zhang et al. (2004)

Zhang et al. (2006)

Zhang et al. (2007)

Zhang et al. (2008)

Zhou et al. (2007)

Zhou et al. (2008)

FEBS Lett. 556: 81-85.

20:3255-3268.

FEBS Letters 581: 315-319.

Yeast 25: 21-27.

Phytochem. 68: 785-796.

Insect Mol Biol 17: 667-676

Zou et al. (1997) Plant Cell. 9: 909-23.

316