MX2016012201A

Gene therapy for retinitis pigmentosa.

Abstract

Methods for treating retinitis pigmentosa using AAV particles encoding miR-708 are provided herein. In one aspect, the viral particles are administered into the eye of a human subject; for example, by subretinal injection. Viral particles comprising AAV5 capsids or mutants thereof are contemplated.

MX2016012201A, drawing sheet 1 — Sheet 1 of 46

Term

10 yearsleft in the term

Expires 20 September 2036.

130 claims: 80 independent, 50 dependent

1
REIVINDICACIONES 1. Un método para tratar la retinitis pigmentaria en un mamífero, que comprende administrar en el ojo del mamífero una partícula vírica de virus adenoasociado recombinante (rAAV) que comprende un vector de rAAV que comprende ácido nucleico que codifica un miR-708.
2
Un método para tratar el estrés del retículo endoplásmico (ER) en una célula de mamífero, que comprende administrar al mamífero una partícula vírica de rAAV que comprende un vector de rAAV que comprende ácido nucleico que codifica un miR-708.
3
El método según la reivindicación 2, en donde la partícula de rAAV se administra en un ojo del mamífero, opcionalmente en donde el mamífero tiene o está en riesgo de tener retinitis pigmentaria.
4
El método según la reivindicación 2 o 3, en donde la célula es una célula ocular.
5
El método según la reivindicación 4, en donde la célula es una célula fotorreceptora.
6
El método según la reivindicación 5, en donde la célula es una célula fotorreceptora tipo bastón.
7
El método según una cualquiera de las reivindicaciones 1-6, en donde el método comprende reducir uno o más marcadores celulares del estrés del RE.
8
El método según la reivindicación 7, en donde el uno o más marcadores celulares del estrés del RE es XBP-1 cortado y empalmado, CHOP o Grp78.
9
El método según una cualquiera de las reivindicaciones 1-8, en donde el vector de rAAV comprende ácido nucleico que codifica miR-708 y rodopsina.
10
El método según una cualquiera de las reivindicaciones 1-8, que además comprende administrar en el ojo del mamífero una segunda partícula vírica de rAAV que comprende un segundo vector de rAAV que comprende ácido nucleico que codifica rodopsina.
11
Un método para tratar la retinitis pigmentaria en un mamífero, que comprende administrar en el ojo del mamífero o la célula una partícula vírica de rAAV que comprende un vector de rAAV que comprende ácido nucleico que codifica un miR708 y rodopsina.
12
El método según una cualquiera de las reivindicaciones 1-11, en donde el ácido nucleico que codifica miR-708 está ligado funcionalmente a un promotor.
13
El método según la reivindicación 12, en donde el promotor es capaz de expresar el miR-708 en células fotorreceptoras.
14
El método según la reivindicación 12 o 13, en donde el promotor comprende un promotor de rodopsina cinasa (RK) o un promotor de opsina.
15
El método según una cualquiera de las reivindicaciones 9-11, en donde el ácido nucleico que codifica rodopsina está ligado funcionalmente a un promotor.
16
El método según la reivindicación 15, en donde el promotor es capaz de expresar la rodopsina en células fotorreceptoras.
17
El método según la reivindicación 15 o 16, en donde el promotor comprende un promotor de RK o un promotor de opsina.
18
El método según la reivindicación 9, en donde i) el ácido nucleico que codifica miR-708 y el ácido nucleico que codifica rodopsina están ligados funcionalmente a un promotor de RK;o ii) el ácido nucleico que codifica miR-708 está ligado funcionalmente a un primer promotor de RK o a un primer promotor de opsina y el ácido nucleico que codifica rodopsina está ligado funcionalmente a un segundo promotor de RK o a un segundo promotor de opsina.
19
El método según la reivindicación 18, en donde el ácido nucleico que codifica miR-708 está en 5' respecto al ácido nucleico que codifica rodopsina.
20
El método según la reivindicación 18, en donde el ácido nucleico que codifica miR-708 está en 3' respecto al ácido nucleico que codifica rodopsina.
21
El método según la reivindicación 12 o 15, en donde el promotor es el promotor de β-actina de pollo (CBA)
22
El método según una cualquiera de las reivindicaciones 12-21, en donde una secuencia obtenida a partir de un intrón de virus diminuto de ratón (MVM) está localizada en 3' respecto al promotor, en donde opcionalmente el intrón de MVM comprende la secuencia nucleotídica de SEQ ID NO:23.
23
El método según una cualquiera de las reivindicaciones 12-22, en donde el promotor comprende además:i) un potenciador de CMV;ii) una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor;iii) una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor de tipo bastón;iv) una secuencia obtenida a partir de un factor con cremallera de carácter básico neurorretinal;v) una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones;vi) un potenciador de CMV y al menos uno o más de una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor, una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor de tipo bastón, una secuencia obtenida a partir de un factor con cremallera de carácter básico neurorretinal;una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones;vii) un factor con cremallera de leucina de carácter básico neurorretinal, un potenciador de CMV y un promotor de Opsina (-500 a +17);viii) un factor con cremallera de leucina de carácter básico neurorretinal, un potenciador de CMV, un promotor de Opsina (-500 a +17) y un intrón de MVM;ix) un potenciador de CMV que comprende SEQ ID NO:29;x) una secuencia de un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30;x¡) una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones que comprende SEQ ID NO:28;xii) un potenciador de CMV que comprende SEQ ID NO:29 y al menos una o más de una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptoras, una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptoras de tipo bastón, una secuencia obtenida a partir de un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30;una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones que comprende SEQ ID NO:28;xiii) un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30, un potenciador de CMV que comprende SEQ ID NO:29 y un promotor de Opsina (-500 a +17) que comprende SEQ ID NO:22;o xiv) un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30, un potenciador de CMV que comprende SEQ ID NO:29, un promotor de Opsina (-500 a +17) que comprende SEQ ID NO:22, y un intrón de MVM que comprende SEQ ID NO:23.
24
El método según una cualquiera de las reivindicaciones 1-23, en donde el ácido nucleico que codifica miR-708 está insertado en un intrón.
25
El método según una cualquiera de las reivindicaciones 1-24, en donde el ácido nucleico que codifica miR-708 comprende un armazón de miR-708 endógeno o un armazón de miR-155.
26
El método según una cualquiera de las reivindicaciones 9-25, en donde la rodopsina es rodopsina humana.
27
El método según una cualquiera de las reivindicaciones 9-26, en donde el ácido nucleico que codifica rodopsina comprende una sustitución, una inserción o una deleción de ácido nucleico en la secuencia diana de miR-708.
28
El método según la reivindicación 27, en donde la sustitución, la inserción o la deleción reduce o previene el reconocimiento a través de miR-708.
29
El método según una cualquiera de las reivindicaciones 9-28, en donde la rodopsina carece de la secuencia diana de miR-708 en la región 3' no traducida (UTR).
30
El método según una cualquiera de las reivindicaciones 9-29, en donde el ácido nucleico que codifica rodopsina comprende una sustitución, una inserción o una deleción de ácido nucleico en la secuencia diana de miR-708, en donde la secuencia diana de miR-708 es SEQ ID NO:19.
31
El método según una cualquiera de las reivindicaciones 9-30, en donde la expresión de la rodopsina es refractaria a la supresión mediante miR-708.
32
El método según una cualquiera de las reivindicaciones 1-31, en donde el ácido nucleico que codifica miR-708 comprende el ácido nucleico de SEQ ID NO:1.
33
El método según una cualquiera de las reivindicaciones 1-31, en donde el ácido nucleico que codifica miR-708 comprende un ácido nucleico que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:1.
34
El método según una cualquiera de las reivindicaciones 9-33, en donde la rodopsina comprende la secuencia de aminoácidos de SEQ ID NO:2.
35
El método según una cualquiera de las reivindicaciones 9-33, en donde la rodopsina comprende una secuencia de aminoácidos que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:2.
36
El método según una cualquiera de las reivindicaciones 9-34, en donde el ácido nucleico que codifica rodopsina comprende el ácido nucleico de SEQ ID NO:3.
37
El método según una cualquiera de las reivindicaciones 9-34, en donde el ácido nucleico que codifica rodopsina comprende un ácido nucleico que tiene una identidad de aproximadamente 85% con SEQ ID NO:3.
38
El método según una cualquiera de las reivindicaciones 1-8 o 10, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido de SEQ ID NO:5.
39
El método según una cualquiera de las reivindicaciones 1-9 u 11, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido de SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 o SEQ ID NO:27.
40
El método según una cualquiera de las reivindicaciones 1-8 o 10, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que 100 comprende un polinucleótido que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:5.
41
El método según una cualquiera de las reivindicaciones 1-9 u 11, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 o SEQ ID NO:27.
42
El método según una cualquiera de las reivindicaciones 1-41, en donde la partícula vírica de AAV y/o la segunda partícula vírica de AAV comprenden una cápside de serotipo AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11, AAV12, AAV2R471A, AAV2/2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV caprina, AAV1/AAV2 quimérica, AAV bovina o AAV de ratón de cápside rAAV2/HBoV1.
43
El método según una cualquiera de las reivindicaciones 1-42, en donde la partícula vírica de rAAV y/o la segunda partícula vírica de rAAV comprenden una cápside de serotipo 5 de AAV.
44
El método según la reivindicación 43, en donde la partícula vírica de rAAV y/o la segunda partícula vírica de rAAV comprenden una cápside muíante en tirosina de serotipo 5 de AAV.
45
El método según una cualquiera de las reivindicaciones 1-44, en donde el vector de rAAV y/o el segundo vector de rAAV comprenden repeticiones terminales invertidas (ITRs) de serotipo AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11 o AAV12, AAV2R471A, AAV DJ, AAV caprina, AAV bovina o AAV de ratón. 101
46
El método según la reivindicación 45, en donde el vector de rAAV y/o el segundo vector de rAAV comprenden ITRs de AAV de serotipo 2.
47
El método según una cualquiera de las reivindicaciones 1-46, en donde la ITR y la cápside de la partícula vírica de rAAV se obtienen a partir del mismo serotipo de AAV.
48
El método según una cualquiera de las reivindicaciones 1-46, en donde la ITR y la cápside de las partículas víricas de rAAV se obtienen a partir de diferentes serotipos de AAV.
49
El método según la reivindicación 48, en donde la partícula vírica de rAAV comprende una cápside de AAV-5, y en donde el vector comprende ITRs de AAV2.
50
El método según la reivindicación 48 o 49, en donde la partícula vírica de rAAV comprende una cápside mutante en tirosina de AAV-5, y en donde el vector comprende ITRs de AAV2.
51
El método según una cualquiera de las reivindicaciones 1-50, en donde las partículas de rAAV se inyectan en el espacio subretiniano de la retina del mamífero.
52
El método según la reivindicación 51, en donde el rAAV se administra en más de un sitio del espacio subretiniano de la retina del mamífero.
53
El método según una cualquiera de las reivindicaciones 1-51, en donde las partículas de rAAV se inyectan por vía intravítrea al mamífero.
54
El método según una cualquiera de las reivindicaciones 1-53, en donde al menos 10-30% de las células fotorreceptoras son transducidas por el AAV.
55
El método según una cualquiera de las reivindicaciones 1-54, en donde el mamífero tiene una mutación en el gen de rodopsina endógeno. 102
56
El método según la reivindicación 55, en donde la mutación en el gen de rodopsina endógeno es una mutación autosómica dominante.
57
El método según una cualquiera de las reivindicaciones 1 o 3-56, en donde la retinitis pigmentaria es retinitis pigmentaria autosómica dominante o retinitis pigmentaria autosómica recesiva.
58
El método según una cualquiera de las reivindicaciones 1-57, en donde el mamífero es un ser humano.
59
El método según la reivindicación 58, en donde el ser humano tiene una mutación P23H en el gen de la rodopsina endógeno.
60
El método según la reivindicación 10, en donde la partícula vírica de rAAV que codifica el miR-708 y la segunda partícula vírica de rAAV que codifica rodopsina se administran al mamífero al mismo tiempo o la partícula vírica de rAAV que codifica el miR-708 y la partícula vírica de rAAV que codifica rodopsina se administran al mamífero de forma secuencial.
61
El método según la reivindicación 60, en donde la partícula vírica de rAAV que codifica el miR-708 se administra primero al mamífero y la partícula vírica de rAAV que codifica rodopsina se administra en segundo lugar al mamífero o la partícula vírica de rAAV que codifica rodopsina se administra primero al mamífero y la partícula vírica de rAAV que codifica el miR-708 se administra en segundo lugar al mamífero.
62
El método según una cualquiera de las reivindicaciones 1-60, en donde las partículas víricas de rAAV están en una composición farmacéutica, en donde opcionalmente la composición farmacéutica comprende además un vehículo farmacéuticamente aceptable.
63
Una partícula de rAAV y opcionalmente una segunda partícula de rAAV de acuerdo con una cualquiera de las reivindicaciones 1-62. 103
64
La partícula de rAAV y opcionalmente la segunda partícula de rAAV según la reivindicación 63 para uso en los métodos según una cualquiera de las reivindicaciones 1-62.
65
Una partícula de rAAV que comprende ácido nucleico que codifica un miR708.
66
La partícula de rAAV según la reivindicación 65, en donde el vector de rAAV que comprende ácido nucleico que codifica un miR708 codifica además rodopsina.
67
La partícula de rAAV según la reivindicación 65, que comprende además una segunda partícula vírica de rAAV que comprende un segundo vector de rAAV que comprende ácido nucleico que codifica una rodopsina.
68
La partícula de rAAV según una cualquiera de las reivindicaciones 6567, en donde el ácido nucleico que codifica miR-708 está ligado funcionalmente a un promotor.
69
La partícula de rAAV según la reivindicación 68, en donde el promotor es capaz de expresar el miR-708 en células fotorreceptoras.
70
La partícula de rAAV según la reivindicación 68 o 69, en donde el promotor comprende un promotor de RK o un promotor de opsina.
71
La partícula de rAAV según una cualquiera de las reivindicaciones 66 o 67, en donde el ácido nucleico que codifica rodopsina está ligado funcionalmente a un promotor.
72
La partícula de rAAV según la reivindicación 71, en donde el promotor es capaz de expresar la rodopsina en células fotorreceptoras.
73
La partícula de rAAV según la reivindicación 71 o 72, en donde el promotor comprende un promotor de RK o un promotor de opsina. 104
74
La partícula de rAAV según una cualquiera de la reivindicación 73, en donde i) el ácido nucleico que codifica miR-708 y el ácido nucleico que codifica rodopsina están ligados funcionalmente a un promotor de RK o a un promotor de opsina;o ii) el ácido nucleico que codifica miR-708 está ligado funcionalmente a un primer promotor de RK o un primer promotor de opsina y el ácido nucleico que codifica rodopsina está ligado funcionalmente a un segundo promotor de RK o un segundo promotor de opsina.
75
La partícula de rAAV según la reivindicación 74, en donde el ácido nucleico que codifica miR-708 está en 5' respecto al ácido nucleico que codifica rodopsina.
76
La partícula de rAAV según la reivindicación 74, en donde el ácido nucleico que codifica miR-708 está en 3' respecto al ácido nucleico que codifica rodopsina.
77
La partícula de rAAV según la reivindicación 68 o 71, en donde el promotor es el promotor de la β-actina de pollo (CBA).
78
La partícula de rAAV según una cualquiera de las reivindicaciones 6877, en donde una secuencia obtenida a partir de un intrón de virus diminuto de ratón (MVM) está localizada en 3' respecto al promotor, en donde opcionalmente el intrón de MVM comprende la secuencia nucleotídica de SEQ ID NO.23.
79
El método según una cualquiera de las reivindicaciones 68-78, en donde el promotor comprende además:i) un potenciador de CMV;ii) una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor;105 iii) una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor de tipo bastón;iv) una secuencia obtenida a partir de un factor con cremallera de carácter básico neurorretinal;v) una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones;vi) un potenciador de CMV y al menos uno o más de una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor, una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor de tipo bastón, una secuencia obtenida a partir de un factor con cremallera de carácter básico neurorretinal;una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones;vii) un factor con cremallera de leucina de carácter básico neurorretinal, un potenciador de CMV y un promotor de Opsina (-500 a +17);viii) un factor con cremallera de leucina de carácter básico neurorretinal, un potenciador de CMV, un promotor de Opsina (-500 a +17) y un intrón de MVM;ix) un potenciador de CMV que comprende SEQ ID NO:29;x) una secuencia de un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30;xi) una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones que comprende SEQ ID NO:28;xii) un potenciador de CMV que comprende SEQ ID NO:29 y al menos una o más de una secuencia obtenida a partir de un factor de transcripción específico de fotorreceptor, una secuencia obtenida a partir de un factor de transcripción específico 106 de fotorreceptor de tipo bastón, una secuencia obtenida a partir de un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30;una secuencia obtenida a partir de una secuencia de un factor de transcripción que contiene una secuencia homeótica de conos y bastones que comprende SEQ ID NO:28;xiii) un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30, un potenciador de CMV que comprende SEQ ID NO:29 y un promotor de Opsina (-500 a +17) que comprende SEQ ID NO:22;o xiv) un factor con cremallera de leucina de carácter básico neurorretinal que comprende SEQ ID NO:30, un potenciador de CMV que comprende SEQ ID NO:29, un promotor de Opsina (-500 a +17) que comprende SEQ ID NO:22 y un intrón de MVM que comprende SEQ ID NO:23.
80
La partícula de rAAV según una cualquiera de las reivindicaciones 6579, en donde el ácido nucleico que codifica miR-708 está insertado en un intrón.
81
La partícula de rAAV según una cualquiera de las reivindicaciones 6580, en donde el ácido nucleico que codifica miR-708 comprende un armazón de miR708 endógeno o un armazón de miR-155.
82
La partícula de rAAV según una cualquiera de las reivindicaciones 6681, en donde la rodopsina es rodopsina humana.
83
El método según una cualquiera de las reivindicaciones 66-82, en donde el ácido nucleico que codifica rodopsina comprende una sustitución, una inserción o una deleción de ácido nucleico en la secuencia diana de miR-708.
84
El método según la reivindicación 83, en donde la sustitución, la inserción o la deleción reduce o previene el reconocimiento a través de miR-708. 107
85
La partícula de rAAV según una cualquiera de las reivindicaciones 6684, en donde la rodopsina carece de la secuencia diana de miR-708 en la 3' UTR.
86
La partícula de rAAV según una cualquiera de las reivindicaciones 6685, en donde el ácido nucleico que codifica rodopsina comprende una sustitución, una inserción o una deleción de ácido nucleico en la secuencia diana de miR-708, en donde la secuencia diana de miR-708 es SEQ ID NO:19.
87
La partícula de rAAV según una cualquiera de las reivindicaciones 6586, en donde la expresión de la rodopsina es refractaria a la supresión mediante miR708.
88
La partícula de rAAV según una cualquiera de las reivindicaciones 6587, en donde el ácido nucleico que codifica miR-708 comprende el ácido nucleico de SEQ IDNO:1.
89
La partícula de rAAV según una cualquiera de las reivindicaciones 6588, en donde el ácido nucleico que codifica miR-708 comprende un ácido nucleico que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:1.
90
La partícula de rAAV según una cualquiera de las reivindicaciones 6689, en donde la rodopsina comprende la secuencia de aminoácidos de SEQ ID NO:2.
91
La partícula de rAAV según una cualquiera de las reivindicaciones 6690, en donde la rodopsina comprende una secuencia de aminoácidos que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:2.
92
La partícula de rAAV según una cualquiera de las reivindicaciones 6690, en donde el ácido nucleico que codifica rodopsina comprende ácido nucleico de SEQ ID NO:3. 108
93
La partícula de rAAV según una cualquiera de las reivindicaciones 6690, en donde el ácido nucleico que codifica rodopsina comprende un ácido nucleico que tiene una identidad de aproximadamente 85% con SEQ ID NO:3.
94
La partícula de rAAV según la reivindicación 65 o 66, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido de SEQ ID NO:5.
95
La partícula de rAAV según una cualquiera de las reivindicaciones 66 o 68-73, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido de SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 o SEQ ID NO:27.
96
La partícula de rAAV según la reivindicación 65 o 67, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:5.
97
La partícula de rAAV según una cualquiera de las reivindicaciones 66 o 68-73, en donde la partícula vírica de AAV comprende un genoma vírico recombinante que comprende un polinucleótido que tiene una identidad de aproximadamente al menos 85% con SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 o SEQ ID NO:27
98
La partícula de rAAV según una cualquiera de las reivindicaciones 6597, en donde la partícula vírica de AAV comprende una cápside del serotipo AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11, AAV12, AAV2R471A, AAV2/2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV caprina, AAV1/AAV2 quimérica, AAV bovina o AAV de ratón de cápside rAAV2/HBoV1. 109
99
La partícula de rAAV según una cualquiera de las reivindicaciones 6598, en donde la partícula vírica de rAAV comprende una cápside de serotipo 5 de AAV.
100
La partícula de rAAV según la reivindicación 98 o 99, en donde la partícula vírica de rAAV comprende una cápside muíante en tirosina de serotipo 5 de AAV.
101
La partícula de rAAV según una cualquiera de las reivindicaciones 65100, en donde el vector de rAAV comprende repeticiones terminales invertidas (ITRs) del serotipo AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11, AAV12, AAV2R471A, AAV DJ, AAV caprina, AAV bovina o AAV de ratón.
102
La partícula de rAAV según una cualquiera de las reivindicaciones 65101, en donde el vector comprende ITRs de AAV de serotipo 2.
103
La partícula de rAAV según una cualquiera de las reivindicaciones 65102, en donde la ITR y la cápside de las partículas víricas de rAAV se obtienen a partir del mismo serotipo de AAV.
104
La partícula de rAAV según una cualquiera de las reivindicaciones 65102, en donde la ITR y la cápside de las partículas víricas de rAAV se obtienen a partir de diferentes serotipos de AAV.
105
La partícula de rAAV según la reivindicación 104, en donde la partícula vírica de rAAV comprende una cápside de AAV5, y en donde el vector comprende ITRs de AAV2.
106
La partícula de rAAV según la reivindicación 105, en donde la partícula vírica de rAAV comprende una cápside muíante en tirosina de AAV5, y en donde el vector comprende ITRs de AAV2. 110
107
Una composición que comprende la partícula de rAAV según una cualquiera de las reivindicaciones 65-106.
108
Una composición que comprende una partícula de rAAV que comprende un vector de rAAV que comprende ácido nucleico que codifica miR-708 según una cualquiera de las reivindicaciones 1-62, y opcionalmente una segunda partícula de rAAV que comprende un vector de rAAV que comprende ácido nucleico que codifica rodopsina, utilizada en los métodos según una cualquiera de las reivindicaciones 1-62.
109
La composición según la reivindicación 107 o 108 para uso en el método según una cualquiera de las reivindicaciones 1-62.
110
La composición según una cualquiera de las reivindicaciones 107-108, en donde la composición es una composición farmacéutica, en donde opcionalmente la composición farmacéutica comprende además un vehículo farmacéuticamente aceptable.
111
Un kit que comprende una cantidad eficaz de partículas de rAAV según los métodos de una cualquiera de las reivindicaciones 1-62.
112
Un kit que comprende una cantidad eficaz de partículas de rAAV según una cualquiera de las reivindicaciones 63-106.
113
Un kit que comprende una cantidad eficaz de la composición según una cualquiera de las reivindicaciones 107-110.
114
Un kit que comprende una cantidad eficaz de partículas de rAAV que comprenden un vector de rAAV que comprende ácido nucleico que codifica miR-708.
115
Un kit que comprende una cantidad eficaz de partículas de rAAV que comprenden un vector de rAAV que comprende ácido nucleico que codifica miR-708 y rodopsina. 111
116
Un kit que comprende una cantidad eficaz de partículas de rAAV que comprende un vector de rAAV que comprende ácido nucleico que codifica miR-708 y una cantidad eficaz de segundas partículas de rAAV que comprenden un segundo vector de rAAV que comprende ácido nucleico que codifica rodopsina.
117
El kit según una cualquiera de las reivindicaciones 111-116, que comprende además instrucciones para usar las partículas de rAAV en el tratamiento de la retinitis pigmentaria y/o el tratamiento del estrés del RE.
118
Un artículo manufacturado que comprende una cantidad eficaz de partículas de rAAV según los métodos de una cualquiera de las reivindicaciones 1-62.
119
Un artículo manufacturado que comprende una cantidad eficaz de partículas rAAV según una cualquiera de las reivindicaciones 63-106.
120
Un artículo manufacturado que comprende una cantidad eficaz de la composición según una cualquiera de las reivindicaciones 107-110.
121
Un artículo manufacturado que comprende una cantidad eficaz de partículas de rAAV que comprenden un vector de rAAV que comprende ácido nucleico que codifica miR-708.
122
Un artículo manufacturado que comprende una cantidad eficaz de partículas de rAAV que comprenden un vector de rAAV que comprende ácido nucleico que codifica miR-708 rodopsina.
123
Un artículo manufacturado que comprende una cantidad eficaz de partículas de rAAV que comprenden un vector de rAAV que comprende ácido nucleico que codifica miR-708 y una cantidad eficaz de segundas partículas de rAAV que comprenden un segundo vector de rAAV que comprende ácido nucleico que codifica rodopsina. 112
124
Un ácido nucleico que comprende un intrón obtenido a partir de un MVM.
125
El ácido nucleico según la reivindicación 124, en donde el intrón de MVM comprende SEQ ID NO:23. 5
126
El ácido nucleico según la reivindicación 124 o 125, que comprende además un promotor y opcionalmente un potenciador.
127
El ácido nucleico según la reivindicación 126, en donde el promotor está localizado en 5' respecto al intrón de MVM.
128
Una estructura artificial de expresión que comprende el ácido nucleico 10 según una cualquiera de las reivindicaciones 124-127.
129
Un vector que comprende el ácido nucleico según una cualquiera de las reivindicaciones 124-127 o la estructura artificial de expresión según la reivindicación 128.
130
Una célula que comprende el ácido nucleico según una cualquiera de 15 las reivindicaciones 124-127, la estructura artificial de expresión según la reivindicación 128 o el vector según la reivindicación 129. 113

Independent claims130

238 paragraphs in 8 sections, as filed

(54) Title: GENE THERAPY FOR PIGMENTARY RETINITIS.

(54) Title: GENE THERAPY FOR RETINITIS PIGMENTOSA.

(57) Summary

(57) Abstract

Provided herein are methods for treating retinitis pigmentosa using an AAV particles encoding miR-708. In one aspect, viral particles are administered to the eye of a human subject; for example, by subretinal injection. Viral particles comprising AAV5 capsids or mutants thereof are contemplated.

GENE THERAPY FOR PIGMENTARY RETINITIS

This application claims the priority benefit of US Provisional Application Serial No. 61 / 969,027, filed March 21, 2014, which is incorporated herein by reference in its entirety.

SEQUENCE LIST

The content of the following ASCII text file presentation is incorporated herein by reference in its entirety: a computer-readable form (CRF) of the Sequence Listing (file name: 159792010040SeqList.txt, recording date: March 17, 2015, size: 63 KB).

FIELD OF THE INVENTION

The present invention relates to AAV vectors and to methods of using AAV vectors for the treatment of retinitis pigmentosa.

BRIEF COMPENDIUM OF THE INVENTION

Retinitis pigmentosa (RP) is the most common cause of inherited retinal degeneration, clinically characterized by night blindness and loss of peripheral vision. Mutations in rhodopsin, the visual pigment of rods, are recognized as the most common cause of autosomal dominant RP (RPAD), and although a number of treatments for rhodopsin-related RP have been proposed and tested in models In animals and clinical studies, the disease remains incurable (Kalloniatis, M., et al. (2004) Clin. Exp. Optom. 87 (2): 65-80). Many data support the view that rhodopsin-related RP is a protein misfolding disease where the misfolding or misassembly of a mutant protein alters its cell fate and induces cell death (Gregersen, N. et al. (2006) Annu. Rev. Genomics Hum. Genet. 7: 103-24). Known RP mutations in the rhodopsin gene include missense mutations and short deletion mutations that alter the reading frame, with a single base substitution in the codon

2. 3 (P23H) of the rhodopsin gene, accounting for ~ 7% of all cases of dominant retinitis pigmentosa in the US (Dryja, TP, et al. (1995) Proc. Nati. Acad. Sel. USA 92 (22): 10177-81). In cultured cells, the mutant protein P23H, unlike the wild type protein (WT), is retained in the ER, leading to an induction of the unfolded protein response (UPR), the 10 inhibition of the proteasome and aggregation of the mutant protein in high molecular weight oligomeric species that form intracellular inclusions (Saliba, RS, et al. (2002) J. Ce // Ser. 115: 2907-18). Similarly, rhodopsin P23H is erroneously localized and / or aggregated in rod-like cells of RP animal models (Olsson, JE, et al. (1992) Neuron 9 (5): 815-30), suggesting that the models of Cell culture can be predictive of in vivo models of this disease. Improvement of the symptoms of RP is needed.

The invention described herein provides methods for treating retinitis pigmentosa in a mammal, comprising administering to the mammalian eye a recombinant adeno-associated virus (rAAV) virus particle comprising a vector encoding a miR-708. In some embodiments, the rAAV vector comprises nucleic acid encoding a miR-708 and rhodopsin. In some embodiments, the invention provides methods for treating retinitis pigmentosa, which comprise administering to the mammalian eye a first rAAV virus particle comprising a first rAAV vector comprising nucleic acid encoding a miR-708, and a second rAAV virus particle comprising a second rAAV vector comprising nucleic acid encoding a rhodopsin. In other embodiments, the invention provides methods for treating retinitis pigmentosa comprising administering to the mammalian eye a rAAV virus particle comprising a rAAV vector comprising nucleic acid encoding a miR-708 and rhodopsin. In some modalities, the treatment of retinitis pigmentosa includes reducing or preventing symptoms associated with retinitis pigmentosa. In some embodiments of the invention, methods of treating retinitis pigmentosa include methods of reducing a symptom associated with RP, methods of preventing retinal degeneration, methods of stopping the progression of RP, methods of increasing photoreceptor function, and the like. Symptoms and / or pathology of RP include, but are not limited to, loss of sight, loss of night vision, loss of peripheral visual fields, loss of ERG function; loss of visual acuity and contrast sensitivity; loss of visually guided behavior, reduced function of rod-like photoreceptors, death of rod-like photoreceptor cells, decreased scotopic vision, reduced changes in retinal cells (loss of photoreceptor structure or function, thinning or thickening of the outer nuclear layer (ONL); thinning or thickening of the outer plexiform layer (OPL); disorganization followed by loss of outer segments of rods and cones; shortening of internal segments of rods and cones; retraction of bipolar cell dendrites; thinning or thickening of the inner retinal layers including the inner nuclear layer, inner plexiform layer, ganglion cell layer, and nerve fiber layer; wrong location of opsin; excess expression of neurofilaments; and the like. In some embodiments, the invention provides methods for preventing rod cell function impairment and rod cell death and cone cell function and cone cell death.

In some aspects, the invention provides methods for treating endoplasmic reticulum (ER) stress in a cell, comprising administering to the mammal a rAAV viral particle comprising a rAAV vector comprising nucleic acid encoding a miR-708. In some embodiments, the mammal has or is at risk of having RP. In some embodiments, the mammal is a human who has or is at risk of having RP. In some embodiments, the rAAV particle is administered into an eye of the mammal. In some embodiments, the cell is an eye cell. In additional embodiments, the cell is a photoreceptor cell. In still other embodiments, the cell is a rod-like photoreceptor cell. In some embodiments, the method comprises reducing one or more cellular markers of ER stress. In additional embodiments, the one or more cellular markers of ER stress is spliced XBP-1, CHOP or Grp78. In some embodiments, the rAAV vector comprises nucleic acid encoding a miR-708 and rhodopsin. In other embodiments, the invention provides methods for treating endoplasmic reticulum (ER) stress in a cell, comprising administering to the mammal a first rAAV vector comprising nucleic acid encoding a miR-708 and a second rAAV viral particle that comprises a second rAAV vector comprising nucleic acid encoding a rhodopsin.

In some embodiments of the invention, the nucleic acid encoding miR-708 is functionally linked to a promoter. In some embodiments, the promoter is capable of expressing miR-708 in photoreceptor cells (eg, a rod-like photoreceptor cell). In additional embodiments, the promoter comprises a rhodopsin kinase (RK) promoter or an opsin promoter. In other embodiments of the invention, the nucleic acid encoding rhodopsin is functionally linked to a promoter. In some embodiments, the promoter is capable of expressing rhodopsin in photoreceptor cells (eg, a rod-like photoreceptor cell). In additional embodiments, the promoter comprises an RK promoter or an opsin promoter.

In some embodiments, the invention provides methods for treating RP and / or ER stress that comprise administering to a mammal an rAAV particle comprising a rAAV vector comprising nucleic acid encoding miR-708 and rhodopsin. In some embodiments, the nucleic acid encoding miR-708 and the nucleic acid encoding rhodopsin are functionally linked to an RK promoter. In other embodiments, the nucleic acid encoding miR-708 is functionally linked to a first RK promoter or a first opsin promoter and the nucleic acid encoding rhodopsin is functionally linked to a second RK promoter or a second opsin promoter. In some embodiments, the first and / or second opsin promoter includes an MVM intron (eg, an intron of SEQ ID NO: 23). In some embodiments, the nucleic acid encoding miR-708 is 5 'to the nucleic acid encoding rhodopsin. In other embodiments, the nucleic acid encoding miR-708 is 3 'to the nucleic acid encoding rhodopsin. In some embodiments, the nucleic acid encoding miR-708 is functionally linked to the chicken β-actin promoter (CBA). In some embodiments, the nucleic acid encoding rhodopsin is functionally linked to the chicken β-actin (CBA) promoter. In some embodiments, a sequence derived from a mouse tiny virus (MVM) intron is located 3 'to the promoter. In some embodiments, the MMV intron comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter further comprises: i) a CMV enhancer; ii) a sequence obtained from a photoreceptor specific transcription factor; Il) a sequence derived from a rod photoreceptor specific transcription factor; iv) a sequence obtained from a neuroretinal basic zipper factor; v) a sequence derived from a transcription factor sequence containing a homeotic rod and cone sequence; vi) a CMV enhancer and at least one or more than one sequence obtained from a photoreceptor-specific transcription factor, a sequence obtained from a rod-like photoreceptor specific transcription factor, a sequence obtained from a basic neuroretinal zipper factor; a sequence derived from a transcription factor sequence containing a homeotic cone sequence; vii) a neuroretinal basic leucine zipper factor, a CMV enhancer and an Opsin promoter (-500 to +17); viii) a neuroretinal basic leucine zipper factor, a CMV enhancer, an Opsin promoter (-500 to +17), and an MVM intron; ix) a CMV enhancer comprising SEQ ID NO: 29; x) a neuroretinal basic leucine zipper factor sequence comprising SEQ ID NO: 30; xi) a sequence obtained from a transcription factor sequence containing a homeotic rod and cone sequence comprising SEQ ID NO: 28; xii) a CMV enhancer comprising SEQ ID NO: 29 and at least one or more of a sequence derived from a photoreceptor-specific transcription factor, a sequence derived from a rod-like photoreceptor specific transcription factor , a sequence obtained from a neuroretinal basic leucine zipper factor comprising SEQ ID NO: 30; a sequence obtained from a transcription factor sequence containing a homeotic rod and cone sequence comprising SEQ ID NO: 28; xiii) a neuroretinal basic leucine zipper factor comprising SEQ ID NO: 30, a CMV enhancer comprising SEQ ID NO: 29 and an Opsin promoter (-500 to +17) comprising SEQ ID NO: 22 ; or xiv) a neuroretinal basic leucine zipper factor comprising SEQ ID NO: 28, a CMV enhancer comprising SEQ ID NO: 29, an Opsin promoter (-500 to +17) comprising SEQ ID NO: 22, and an intron from MVM comprising SEQ ID NO: 23. In some embodiments, the nucleic acid encoding miR-708 is inserted into an intron. In some embodiments, the nucleic acid encoding miR-708 comprises an endogenous miR-708 scaffold or a miR155 scaffold.

In some embodiments, the invention provides methods for treating RP and / or ER stress which comprise administering to a mammal an rAAV particle comprising a rAAV vector comprising nucleic acid encoding miR708. In some embodiments, the nucleic acid encoding miR-708 comprises the nucleic acid of SEQ ID NO: 1. In some embodiments, the nucleic acid encoding miR-708 comprises a nucleic acid that has an identity of about at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with SEQ ID NO: 1.

In some embodiments, the invention provides methods for treating RP and / or ER stress which comprise administering to a mammal, a rAAV particle comprising a rAAV vector comprising nucleic acid encoding rhodopsin. In some embodiments, the rhodopsin is mammalian rhodopsin or a functional equivalent thereof. In some embodiments, the rhodopsin is human rhodopsin or a functional equivalent thereof. In some embodiments, rhodopsin lacks the miR-708 target sequence in the 3 'untranslated region (UTR). In some embodiments, the nucleic acid encoding rhodopsin comprises a nucleic acid substitution, insertion, or deletion in the target sequence of miR-708. In some embodiments, substitution, insertion, or deletion reduces or prevents recognition by miR-708. In some embodiments, the nucleic acid encoding rhodopsin comprises a nucleic acid substitution, insertion, or deletion in the target sequence of miR-708, wherein the target sequence of miR708 is SEQ ID NO: 19. In some embodiments, the Rhodopsin expression is refractory to deletion by miR-708. In some embodiments, rhodopsin comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin comprises an amino acid sequence that has an identity of approximately at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 % with SEQ ID NO: 2. In some embodiments, the nucleic acid encoding rhodopsin comprises the nucleic acid of SEQ ID NO: 3. In some embodiments, the nucleic acid encoding rhodopsin comprises a nucleic acid that has an identity of approximately 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEQ ID NO: 3.

In some embodiments, the invention provides methods for treating RP and / or ER stress that comprise administering to a mammal an rAAV particle comprising a polynucleotide of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7, SEQ ID NO: 8 or SEQ ID NO: 9. In some embodiments, the AAV viral particle comprises a recombinant viral genome comprising a polynucleotide that has an identity of about at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEQ ID NO: 5, SEQ ID NO: 6 SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27.

In some embodiments, the invention provides methods for treating RP and / or ER stress which comprise administering to a mammal an rAAV particle, wherein the AAV viral particle comprises a capsid of serotype AAV1, AAV2, AAV3, AAV4 , AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 V708A, AAV1 caprina, AAV1 caprine / Chimeric AAV2, bovine AAV or mouse capsid AAV rAAV2 / HBoV1. In some embodiments, the rAAV virus particle comprises an AAV serotype 5 capsid. In some embodiments, the rAAV virus particle comprises an AAV serotype 5 tyrosine mutant capsid.

In some embodiments, the invention provides methods of treating RP and / or ER stress which comprise administering to a mammal a first rAAV virus particle comprising nucleic acid encoding miR-708 and a second rAAV virus particle encoding rhodopsin. In some embodiments, the first rAAV particle and / or the second rAAV virus particle comprises a capsid of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAV11rhIO, AAV11 , AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, caprine AAV, chimeric AAV1 / AAV2, bovine AAV, or rAAV2 / HBoV1 capsid mouse AAV. In some embodiments, the first rAAV virus particle and / or the second rAAV virus particle comprise an AAV serotype 5 capsid. In some embodiments, the first rAAV virus particle and / or the second rAAV virus particle comprise an AAV serotype 5 tyrosine mutant capsid.

In some embodiments, the invention provides methods for treating RP and / or ER stress which comprise administering to a mammal a rAAV particle, wherein the AAV vector comprises an ITR of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AV10, AAVrhIO, AAV11,

AAV12, AAV2R47IA, AAV DJ, caprine AAV, bovine AAV, or mouse AAV. In some embodiments, the invention provides methods of treating RP and / or ER stress that comprise administering to a mammal a first rAAV virus particle comprising a first rAAV vector comprising nucleic acid encoding miR-708 and a second rAAV virus particle comprising a second rAAV vector encoding rhodopsin. In some embodiments, the first rAAV vector and / or the second rAAV viral vector comprise an ITR of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11 , AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or mouse AAV.

In some embodiments of the invention, the rAAV vectors of the method comprise AAV serotype 2 ITRs. In some embodiments, the ITR and capsid of the rAAV virus particle are obtained from the same AAV serotype. In other embodiments, the ITR and capsid of the rAAV virus particles are obtained from different AAV serotypes. In some embodiments, the rAAV virus particle comprises an AAV-5 capsid, and wherein the vector comprises AAV2 ITRs. In some embodiments, the rAAV virus particle comprises an AAV-5 tyrosine mutant capsid, and wherein the vector comprises AAV2 ITRs.

In some embodiments, the invention provides methods for treating RP and / or ER stress in a mammal wherein rAAV particles are injected into the subretinal space of the mammal's retina. In some embodiments, rAAV is delivered to more than one site in the subretinal space of the mammalian retina. In other embodiments, the rAAV particles are injected intravitreally into the mammal. In some modalities, at least 10-30% of the photoreceptor cells (eg. g., rod-like photoreceptor cells) are transduced by AAV.

In some embodiments, the invention provides methods for treating RP and / or ER stress in a mammal, wherein the mammal has a mutation in the endogenous rhodopsin gene. In some embodiments, the mutation in the endogenous rhodopsin gene is an autosomal dominant mutation. In some modalities, retinitis pigmentosa is autosomal dominant retinitis pigmentosa. In some embodiments, the mammal is a human. In some embodiments, the human has a P23H mutation in the endogenous gene for rhodopsin.

In some embodiments, the invention provides methods of treating RP and / or ER stress which comprise administering to a mammal a first rAAV virus particle comprising nucleic acid encoding miR-708 and a second rAAV virus particle encoding rhodopsin, wherein the first rAAV virus particle encoding miR-708 and the second rAAV virus particle encoding rhodopsin are administered to the mammal at the same time. In some embodiments, the first rAAV virus particle encoding miR-708 and the rAAV virus particle encoding rhodopsin are administered to the mammal in sequence! In some embodiments, the rAAV virus particle encoding miR-708 is administered first to the mammal and the rAAV virus particle encoding rhodopsin is administered second to the mammal. In some embodiments, the rAAV virus particle encoding rhodopsin is administered first to the mammal and the rAAV virus particle encoding miR-708 is administered second to the mammal.

In some embodiments of the invention, the rAAV virus particles are in a pharmaceutical composition. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the invention provides a composition comprising an rAAV particle comprising an rAAV vector comprising nucleic acid encoding miR-708, used in the methods described herein. In some embodiments, the invention provides an rAAV particle comprising a rAAV vector comprising nucleic acid encoding a m¡R708 for use in treating retinitis pigmentosa or reducing ER stress according to any of the methods. described herein. In some embodiments, the invention provides a first rAAV particle comprising a rAAV vector comprising nucleic acid encoding a miR708 and a second rAAV particle comprising a rAAV vector comprising nucleic acid encoding rhodopsin for use in treatment of retinitis pigmentosa or ER stress reduction according to any of the methods described herein. In some embodiments, the rAAV particle comprises a rAAV vector comprising nucleic acid encoding a m¡R708 and rhodopsin for use in treating retinitis pigmentosa or reducing ER stress according to any of the methods described in the present report.

In some aspects, the invention described herein provides compositions for treating retinitis pigmentosa in a mammal, comprising a recombinant adeno-associated virus (rAAV) virus particle comprising a vector encoding a miR-708. In some embodiments, the rAAV vector comprising nucleic acid encoding miR-708 further comprises nucleic acid encoding rhodopsin. In some embodiments, the invention provides compositions for treating retinitis pigmentosa comprising a first rAAV virus particle comprising a first rAAV vector comprising nucleic acid encoding a miR-708 and a second rAAV virus particle comprising a second vector of rAAV comprising nucleic acid encoding a rhodopsin. In other embodiments, the invention provides compositions for treating retinitis pigmentosa comprising a rAAV viral particle comprising a rAAV vector comprising nucleic acid encoding a miR-708 and rhodopsin.

In some aspects, the invention provides compositions for treating endoplasmic reticulum (ER) stress in a cell, comprising a rAAV virus particle comprising a rAAV vector comprising nucleic acid encoding a miR-708. In some aspects, the invention provides compositions for treating endoplasmic reticulum (ER) stress in a cell, comprising a rAAV virus particle comprising a rAAV vector comprising nucleic acid encoding a miR-708 and rhodopsin. In some embodiments, the ER-stressed mammal has or is at risk for RP. In some embodiments, the ER-stressed mammal is a human who has or is at risk for RP. In some embodiments, the rAAV particle is administered into an eye of the mammal. In some embodiments, the cell is an eye cell. In additional embodiments, the cell is a photoreceptor cell. In further embodiments, the cell is a rod-like photoreceptor cell. In some embodiments, the composition reduces one or more cellular markers of ER stress. In additional embodiments, the one or more cellular markers of ER stress are spliced XBP-1, CHOP, or Grp78. In some embodiments, the rAAV vector comprises nucleic acid encoding miR-708 and further comprises nucleic acid encoding rhodopsin. In other embodiments, the invention provides compositions for treating endoplasmic reticulum (ER) stress in a cell, comprising a first rAAV vector comprising nucleic acid encoding a miR-708 and a second rAAV virus particle comprising a second rAAV vector comprising nucleic acid encoding a rhodopsin.

In some embodiments of the invention, the nucleic acid encoding miR-708 is functionally linked to a promoter. In some embodiments, the promoter is capable of expressing miR-708 in photoreceptor cells (eg, rod-like photoreceptor cells). In additional embodiments, the promoter comprises a rhodopsin kinase (RK) promoter or an opsin promoter. In other embodiments of the invention, the nucleic acid encoding rhodopsin is functionally linked to a promoter. In some embodiments, the promoter is capable of expressing rhodopsin in photoreceptor cells (eg, rod-like photoreceptor cells). In additional embodiments, the promoter comprises an RK promoter or an opsin promoter.

In some embodiments, the invention provides compositions for treating RP and / or ER stress, comprising an rAAV particle comprising an rAAV vector comprising nucleic acid encoding miR-708 and rhodopsin. In some embodiments, the nucleic acid encoding miR-708 and the nucleic acid encoding rhodopsin are functionally linked to an RK promoter. In other embodiments, the nucleic acid encoding miR-708 is functionally linked to a first RK promoter or a first opsin promoter and the nucleic acid encoding rhodopsin is functionally linked to a second RK promoter or a second opsin promoter. In some embodiments, the first and / or second opsin promoter includes an MVM intron (eg, an intron of SEQ ID NO: 23). In some embodiments, the nucleic acid encoding miR-708 is 5 'to the nucleic acid encoding rhodopsin. In other embodiments, the nucleic acid encoding miR-708 is 3 'to the nucleic acid encoding rhodopsin. In some embodiments, the nucleic acid encoding miR-708 is functionally linked to the chicken β-actin promoter (CBA). In some embodiments, the nucleic acid encoding rhodopsin is functionally linked to the chicken β actin promoter (CBA). In some embodiments, the first and / or second opsin promoter includes an MVM intron (eg, an intron of SEQ ID NO: 23). In some embodiments, the nucleic acid encoding miR-708 is 5 'to the nucleic acid encoding rhodopsin. In other embodiments, the nucleic acid encoding miR-708 is 3 'to the nucleic acid encoding rhodopsin. In some embodiments, the nucleic acid encoding miR-708 is functionally linked to the chicken β-actin promoter (CBA). In some embodiments, the nucleic acid encoding rhodopsin is functionally linked to the chicken β-actin promoter (CBA). In some embodiments, a sequence obtained from an intron of a mouse tiny virus (MVM) is located 3 'to the promoter. In some embodiments, the MMV Intron comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter further comprises i) a CMV enhancer; ii) a sequence obtained from a photoreceptor-specific transcription factor, iii) a sequence obtained from a rod-type photoreceptor specific transcription factor; iv) a sequence obtained from a neuroretinal basic zipper factor; v) a sequence obtained from a transcription factor containing a homeotic rod and cone sequence; vi) a CMV enhancer and at least one or more than one sequence obtained from a photoreceptor-specific transcription factor, a sequence obtained from a rod-like photoreceptor specific transcription factor, a sequence obtained from a basic neuroretinal zipper factor; a sequence derived from a transcription factor sequence containing a homeotic rod and cone sequence; vii) a neuroretinal basic zipper factor, a CMV enhancer and an Opsin promoter (-500 to +17); viii) a neuroretinal basic zipper factor, a CMV enhancer, an Opsin promoter (-500 to +17), and an MVM intron; ix) a CMV enhancer comprising SEQ ID NO: 29; x) a neuroretinal basic zipper factor sequence comprising SEQ ID NQ: 30; xi) a sequence obtained from a transcription factor sequence containing a homeotic rod and cone sequence comprising SEQ ID NO: 28; xii) a CMV enhancer comprising SEQ ID NO: 29 and at least one or more of a sequence obtained from a photoreceptor-specific transcription factor, a sequence obtained from a photoreceptor-type specific transcription factor rods, a sequence obtained from a neuroretinal basic zipper factor comprising SEQ ID NQ: 30; a sequence obtained from a transcription factor sequence containing a homeotic rod and cone sequence comprising SEQ ID NO: 28; xiii) a neuroretinal basic zipper factor comprising SEQ ID NQ: 30, a CMV enhancer comprising SEQ ID NO: 29 and an Opsin promoter (-500 to +17) comprising SEQ ID NO: 22; or xiv) a neuroretinal basic zipper factor comprising SEQ ID NO: 28, a CMV enhancer comprising SEQ ID NO: 29, an Opsin promoter (-500 to +17) comprising SEQ ID NO: 22, and an MVM intron comprising SEQ ID NO: 23. In some embodiments, the nucleic acid encoding miR-708 is inserted into an intron. In some embodiments, the nucleic acid encoding miR-708 comprises an endogenous miR-708 scaffold or a miR-155 scaffold.

In some embodiments, the invention provides compositions for treating RP and / or ER stress comprising an rAAV particle comprising an rAAV vector comprising nucleic acid encoding miR-708. In some embodiments, the nucleic acid encoding miR-708 comprises the nucleic acid of

SEQ ID NO: 1. In some embodiments, the nucleic acid encoding miR-708 comprises a nucleic acid that has an identity of about at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with SEQ ID NO: 1.

In some embodiments, the invention provides compositions for treating RP and / or ER stress comprising a rAAV particle comprising a rAAV vector comprising nucleic acid encoding rhodopsin. In some embodiments, the rhodopsin is mammalian rhodopsin or its functional equivalent. In some embodiments, the rhodopsin is human rhodopsin or its functional equivalent. In some embodiments, rhodopsin lacks the miR-708 target sequence in the 3 'untranslated region (UTR). In some embodiments, the nucleic acid encoding rhodopsin comprises a nucleic acid substitution, insertion, or deletion in the target sequence of miR-708. In some embodiments, substitution, insertion, or deletion reduces or prevents recognition by miR-708. In some embodiments, the nucleic acid encoding rhodopsin comprises a nucleic acid substitution, insertion, or deletion in the target sequence of miR-708, wherein the target sequence of miR-708 is SEQ ID NO: 19. In some embodiments , the expression of rhodopsin is refractory to deletion by miR-708. In some embodiments, rhodopsin comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin comprises an amino acid sequence that has an identity of approximately at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 % with SEQ ID NO: 2. In some embodiments, the nucleic acid encoding rhodopsin comprises the nucleic acid of SEQ ID NO: 3. In some embodiments, the nucleic acid encoding rhodopsin comprises a nucleic acid that has an identity of about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with SEQ ID NO: 3.

In some embodiments, the invention provides compositions for treating RP and / or ER stress comprising an rAAV particle comprising a polynucleotide of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9. In some embodiments, the AAV viral particle comprises a recombinant viral genome comprising a polynucleotide that has an identity of about at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 24, SEQ ID NO: 25 , SEQ ID NO: 26 or SEQ ID NO: 27.

In some embodiments, the invention provides compositions for treating RP and / or ER stress, comprising an rAAV particle, wherein the AAV virus particle comprises a capsid of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 , AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV caprine, AAV1 chimeric, AAV1 chimeric, AAV1 / AAV1 chimeric Bovine AAV or mouse capsid AAV rAAV2 / HBoV1. In some embodiments, the rAAV virus particle comprises an AAV serotype 5 capsid. In some embodiments, the rAAV virus particle comprises an AAV serotype 5 tyrosine mutant capsid.

In some embodiments, the invention provides compositions for treating RP and / or ER stress, comprising a first rAAV virus particle comprising nucleic acid encoding miR-708 and a second rAAV virus particle encoding rhodopsin. In some embodiments, the first rAAV particle and / or the second rAAV virus particle comprises a capsid of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAV11rhIO, AAV11 , AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, caprine AAV, chimeric AAV1 / AAV2, bovine AAV, or rAAV2 / HBoV1 capsid mouse AAV. In some embodiments, the first rAAV virus particle and / or the second rAAV virus particle comprise an AAV serotype 5 capsid. In some embodiments, the first rAAV virus particle and / or the second rAAV virus particle comprise an AAV serotype 5 tyrosine mutant capsid.

In some embodiments, the invention provides compositions for treating RP and / or ER stress comprising a rAAV particle wherein the AAV vector comprises an ITR of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV. In some embodiments, the invention provides compositions for treating RP and / or ER stress, comprising a first rAAV viral particle comprising a first rAAV vector comprising nucleic acid encoding miR-708 and a second viral particle of rAAV comprising a second rAAV vector encoding rhodopsin. In some embodiments, the first rAAV vector and / or the second rAAV viral vector comprise an ITR of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhIO, AAV11 , AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV or mouse AAV.

In some embodiments of the invention, the rAAV vectors of the composition comprise AAV serotype 2 ITRs. In some embodiments, the ITR and capsid of the rAAV virus particle are obtained from the same AAV serotype. In other embodiments, the ITR and capsid of the rAAV virus particles are obtained from different AAV serotypes. In some embodiments, the rAAV virus particle comprises an AAV-5 capsid, and wherein the vector comprises AAV2 ITRs. In some embodiments, the rAAV virus particle comprises an AAV-5 tyrosine mutant capsid, and wherein the vector comprises AAV2 ITRs.

In some embodiments, the invention provides compositions for treating RP and / or ER stress in a mammal, wherein the mammal has a mutation in the endogenous rhodopsin gene. In some embodiments, the mutation in the endogenous rhodopsin gene is an autosomal dominant mutation. In some modalities, retinitis pigmentosa is autosomal dominant retinitis pigmentosa. In some embodiments, the mammal is a human. In some embodiments, the human has a P23H mutation in the endogenous rhodopsin gene.

In some embodiments, the invention provides kits for treating RP or for reducing ER stress in a mammal, comprising an effective amount of rAAV particles according to the methods described herein. In some embodiments, the kits comprise an effective amount of a composition as described herein. In some embodiments, the kit comprises an effective amount of rAAV particles comprising an rAAV vector comprising nucleic acid encoding miR-708. In some embodiments, the kit comprises an effective amount of rAAV particles comprising an rAAV vector comprising nucleic acid encoding miR-708 and rhodopsin. In some embodiments, the kit comprises an effective amount of first rAAV particles comprising a rAAV vector comprising nucleic acid encoding miR-708 and an effective amount of second rAAV particles comprising a second rAAV vector comprising nucleic acid. encoding rhodopsin. In additional embodiments, the kit comprises instructions for the use of the rAAV particles in the treatment of retinitis pigmentosa and / or ER stress reduction. In additional embodiments, the kit comprises instructions for use in any one of the methods described herein.

In some aspects, the invention provides an article of manufacture comprising an effective amount of rAAV particles according to the methods described herein. In some embodiments, the article of manufacture comprises an effective amount of any of the compositions described herein. In some embodiments, the article of manufacture comprises an effective amount of rAAV particles comprising a rAAV vector comprising nucleic acid encoding miR-708. In some embodiments, the article of manufacture comprises an effective amount of rAAV particles comprising an rAAV vector comprising nucleic acid encoding miR-708 and rhodopsin. In some embodiments, the article of manufacture comprises an effective amount of rAAV first particles comprising a rAAV vector comprising nucleic acid encoding miR-708 and an effective amount of rAAV second particles comprising a second rAAV vector comprising acid nucleic code that encodes rhodopsin.

In some aspects, the invention provides a nucleic acid comprising an intron obtained from an MVM. In some embodiments, the MVM intron comprises SEQ ID NO: 23. In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid further comprises an enhancer. In some embodiments, the promoter is located 5 'to the MVM intron. In some embodiments, the invention provides an expression construct comprising the nucleic acid. In some embodiments, the invention provides a vector comprising the expression nucleic acid or construct. In some embodiments, the invention provides a cell comprising the nucleic acid, the expression construct, or the vector.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A and 1B show the localization of wild-type rhodopsin (FIG. 1A) and (FIG. 1B) P23H mutant in pigmented epithelial cells of the human retina. Staining is carried out on the cells for rhodopsin (green), α-tubulin (red) and DNA (blue). The wild-type rhodopsin staining pattern is characteristic of a membrane location (solid arrow), whereas the staining pattern of mutant P23H rhodopsin is characteristic of a perinuclear / reticular location (broken arrow).

FIGS. 2A and 2B show that mutant rhodopsin P23H forms unnatural oligomers and conserves ER-specific oligosaccharides. (FIG. 2A) Western blot of detergent-soluble extracts from cells expressing wild-type (wt) or mutant P23H rhodopsin. (FIG. 2B) Western blot of detergent-soluble extracts from cells expressing wild-type (wt) or mutant P23H rhodopsin. The extracts were treated with endoglycosidase H (Endo-H) or left untreated.

FIGS. 3A and 3B show that cells expressing rhodopsin P23H have a higher expression of the UPR markers and a higher propensity for apoptosis. (FIG. 3A) Relative expression of C / EBP homologous protein (CHOP; also known as Ddit3), immunoglobulin-binding protein (BiP; also known as Hspa5) genes, and rhodopsin genes in rhodopsin-expressing cells wild-type (wt) or P23H mutant. The relative expression of each gene was compared with the expression of beta-glucuronidase using the ÁÁC method.t. (FIG.

3Β) Percentage of apoptotic cells in cells expressing control (pcDNA), wild-type rhodopsin or P23H mutant rhodopsin, measured by TUNEL staining.

FIG. 4 shows a diagram of the construct of an expression vector for the expression of miR-708 under the control of a ubiquitous promoter (chicken β-actin, CBA) or a photoreceptor-specific promoter (rhodopsin kinase, RK). DNA encoding the stem and loop sequences of miR-708 was synthesized and cloned between 5 'and 3' of the framework sequence of miR-155. This scaffold sequence contains target sites necessary for Drosha to process pri-miR-708 into pre-miR-708 in the nucleus, allowing post-processing of pre-miR-708 by Dicer in the cytoplasm.

FIG. 5 shows the expression of the rhodopsin protein in cells expressing miR-708 or a control miRNA, relative to non-transfected cells. All cells are HEK-293 cells expressing rhodopsin mP23H which has a target sequence of miR708 in the 3'UTR. The expression of the rhodopsin protein is normalized with respect to the expression of hGAPDH. Rhodopsin protein levels decrease in the presence of miR708 compared to control m¡R.

FIG. 6 shows that HEK-293 cells expressing rhodopsin mP23H have reduced levels of RNA of the marker genes for UPR, CHOP and BiP, after expression of miR-708, compared to cells expressing a control (disordered) miRNA.

FIGS. 7A and 7B show that endogenous miR-708 down-regulation of rhodopsin is dependent on the presence of a miR708 target sequence in the 3 'UTR of rhodopsin. HEK-293 cells were transfected with a mouse rhodopsin P23H gene that included the miR-708 target sequence (FIG. 7A), or with a human P23H rhodopsin gene lacking the miR-708 target sequence (FIG. 7B). Cells were also transfected with a control pre-mRNA or an anti-mR-708 premiRNA to inhibit endogenous miR-708. Rhodopsin protein was measured relative to hGAPDH protein, and rhodopsin mRNA was measured relative to hGAPDH mRNA. Endogenous miR-708 levels are also shown (right axis and the two rightmost columns of FIGS. 7A and 7B).

FIG. 8 represents a diagram of an AAV vector for the expression of miR-708 in rod-like photoreceptors. Relevant characteristics of the vector are marked.

FIGS. 9A and 9B show that the expression of miR-708 using an AAV vector down-regulates mutant rhodopsin P23H. (FIG. 9A) Expression of miR708 in WERI or RPE cells after transfection of a vector encoding miR-708 driven by the RK promoter or a control (disordered) miRNA. Expression is plotted relative to miR-16 expression. (FIG. 9B) Expression of P23H rhodopsin mRNA in WERI cells transfected with a pRK-m¡R-708 plasmid, relative to cells transfected with a control plasmid.

FIGS. 10A-10C show that subretinal delivery of an AAV5 miR-708 vector results in gene inactivation of mouse rhodopsin. (FIG. 10A) Expression of m-rhodopsin in the retinas of mice injected with AAV5 miR-708 or control AAV5 m¡R. (FIG. 10B) Expression of RdCVF in the retinas of mice injected with AAV5 miR-708 or control AAV5 miR. (FIG. 10C) Expression of miR-708 in retinas of mice injected with AAV5 miR-708 or control AAV5 miR.

FIGS. 11A and 11B show that treating the eyes with AAV5 miR708 reduces rod-mediated responses, but not cone-mediated responses. (FIG. 11A) Three representative electroretinograms representing scotopic responses in eyes receiving AAV5 miR-708 or AAV5 miR control (disordered). (FIG. 11 B) Three representative electroretinograms representing photopic responses in the same eyes as in (FIG. eleven A) Receiving AAV5 miR-708 or AAV5 miR control (messy).

FIG. 12 provides a diagram of the suppression / substitution vector of hrodopsin inserted into introns of miR-708.

FIG. 13 shows that a miR-708 vector inserted into introns reduces the expression of m-rhodopsin, hCHOP and hBIP in WERI cells transfected with mrodopsin P23H, compared to a control vector of miR.

FIG. 14 shows that the expression of miR-708 from the vector inserted in introns has a reduced expression, compared to the vector not inserted in WERI cells, except that the vector pRK-hRHO-intron miR-708 inserted in introns also co-expresses the h -rodopsin. All vectors that drive the expression of miR-708 using the RK promoter have lower orders of magnitude of expression than a vector using the CBA promoter.

FIG. 15 shows that h-rhodopsin expression from the intron-inserted suppression / substitution vector is refractory to gene inactivation by co-expressed miR-708. The h-rhodopsin RNA levels are the same in cells transfected with vectors expressing miR-708 or control miR.

FIG. 16 shows that the miR-708 deletion / substitution vector reduces the splicing of XBP-1, a marker of ER stress, in WERI cells expressing mutant rhodopsin. This reduction is observed only if the 3'UTR of the miR-708 target sequence is present in the rhodopsin transcript.

FIG. 17 shows a vector diagram with the framework of the human β-globin miR-708 intron in the 3 'UTR of the rhodopsin cDNA.

FIG. 18 shows that a vector with the framework of the intron of human B-globin m¡R-708 in the 3 'UTR of the rhodopsin cDNA produces higher expression of h-rhodopsin and miR-708 than a vector with the framework in the 5 'UTR.

FIG. 19 shows a diagram of an alternative vector design using different promoters to drive the expression of miR-708 (RK promoter) and hrodopsin (mouse opsin promoter).

FIG. 20 shows the expression of h-rhodopsin (left) and miR-708 (right) in WERI cells transfected with the specified vector. Expression is expressed as a copy number calculated against conventional DNA.

FIGS. 21A-C show the levels of miR-708 (FIG. 21A), mouse rhodopsin (FIG. 21B) and human rhodopsin (FIG. 21C) in mouse retinas three weeks after subretinal injection with an AAV5 capsid vector which directs the expression of human rhodopsin and miR-708 (miR 708/708), or human rhodopsin and miRNA-control (miR-Cont), on a miR-708 scaffold, using the opsin promoter. For each experiment, the expression is shown as expression in many times, compared to the non-injected contralateral eye.

FIG. 22 shows a schematic of the opsin promoter construct, including the sequence of the neuroretinal basic zipper factor (NRL), the CMV enhancer, the opsin promoter, and the intron sequence of MVM, including an intronic sequence hybrid of CBA exon 1 and a mouse tiny virus (MVM) intron.

FIG. 23A shows a schematic of the sequence of miR-708 inserted into a beta-globin intron.

FIGS. 23B and 23C show miR-708 sequence schematics in the context of either the endogenous miR-708 framework (FIG. 23B) or the miR framework.

155 (FIG. 23C), inserted into a beta globin intron. The miR-155 loop sequence between the 5 'and 3' flanking sequences of m¡R is labeled in FIG. 23C.

FIG. 24 shows the evaluation of candidate vectors harboring the sequence of miR-708, either in the framework of miR-155 or in the framework of miR-708 (inserted in the intron of beta-globin), and the coding sequence of Human rhodopsin (h-rhodopsin; which also lacks a miR-708 3'UTR target sequence), driven by either the rhodopsin kinase promoter (GRKI) or the opsin promoter (Ops). All four combinations were tested for their effects on miR-708 and h-rhodopsin expression, as shown.

DETAILED DESCRIPTION

The present invention provides methods for treating retinitis pigmentosa (RP) in a mammal, comprising administering to the mammalian eye a recombinant adeno-associated virus (rAAV) virus particle comprising a vector encoding a miR-708. MiR-708 targets a region in the 3 'untranslated region of the rhodopsin gene, and as such can suppress the activity of mutant rhodopsin associated with RP. In some aspects, the invention provides methods for treating retinitis pigmentosa in a mammal, comprising administering to the mammalian eye a recombinant adeno-associated virus (rAAV) virus particle comprising a vector encoding miR-708 and a rhodopsin nucleic acid. natural type. As such, the vector can suppress the activity of a mutant rhodopsin associated with RP by simultaneously replacing the mutant rhodopsin with a wild-type rhodopsin. In some embodiments, the nucleic acid encoding wild-type rhodopsin does not target the 3 'UTR of miR-708, so miR-708 only targets the expression of the mutant rhodopsin. The invention also provides compositions comprising rAAV particles encoding miR-708 and rAAV particles encoding rhodopsin. In some embodiments, the invention provides compositions comprising rAAV particles encoding both miR-708 and rhodopsin.

I. General techniques

The techniques and procedures described or referred to herein are generally well understood and commonly used by those skilled in the art using conventional methodology, such as for example, the widely used methodologies described in Molecular Cloning: A Laboratory Manual. (Sambrook et al., 4to ed., Coid Spring Harbor Laboratory Press, Coid Spring Harbor, NY, 2012); Current Protocols in Molecular Biology (FM Ausubel, et al. Compilers, 2003); the Methods in Enzymology series (Academic Press, Inc.); PCR 2: Let's Practice! Approach (MJ MacPherson, BD Harnes and GR Taylor compilers, 1995); Antibodies, A Laboratory Manual (Harlow and Lane, editors, 1988); Culture of Animal Cells: A Manual of Basic Tech ñique and Specialized Applications (RI Freshney, 6to ed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (MJ Gait, compiler, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, compiler, Academic Press, 1998); Introduction to Cell and Tissue Culture (JP Mather and P E. Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, editors, J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (DM Weir and CC Blackwell, editors, 1996); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, editors, 1987); PCR: The Polymerase Chain Reaction, (Mullís et al., Compilers, 1994); Current Protocols in Immunology (JE Coligan et al., Compilers, 1991); Short Protocols in Molecular Biology (Ausubel et al., Editors, J. Wiley and Sons, 2002); Immunobiology (CA

Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty, compiler, IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, editors, Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lañe, Coid Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, editors, Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (VT DeVita et al., Editors, JB Lippincott Company, 2011).

II. Definitions

A vector, as used herein, refers to a plasmid or a recombinant virus comprising a nucleic acid that is to be delivered into a host cell, either in vitro or in vivo.

The term "polynucleotide or nucleic acid" as used herein refers to a polymeric form of nucleotides of any length, be they ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single, double, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising puric and pyrimidine bases, or other natural nucleotide bases, chemically or biochemically modified, unnatural or derivatized. The polynucleotide backbone can comprise sugars and phosphate groups (as can typically be found in RNA or DNA), or modified or substituted sugars or phosphate groups. Alternatively, the polynucleotide backbone may comprise a polymer of synthetic subunits such as phosphoamidates and thus may be a phosphoramidate oligodeoxynucleoside (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer. Furthermore, a double-stranded polynucleotide can be obtained from a single-stranded polynucleotide product of chemical synthesis, synthesizing the complementary strand and associating the strands under suitable conditions, or synthesizing the complementary strand again using a DNA polymerase with a suitable primer.

The terms polypeptide and protein are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain unnatural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include post-expression modifications of the polypeptide, eg, glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for the purposes of the present invention, a polypeptide refers to a protein that includes modifications, such as deletions, additions, and substitutions (generally conservative in nature), with respect to the natural sequence, provided that the protein retains activity. desired. These modifications can be deliberate, such as by site-directed mutagenesis, or they can be accidental, such as by host mutations that produce the proteins or errors due to PCR amplification.

A "recombinant viral vector" refers to a recombinant polynucleotide vector that comprises one or more heterologous sequences (ie, a nucleic acid sequence that is not of viral origin). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one, preferably two, inverted terminal repeat sequences (ITRs).

A "recombinant AAV vector" (rAAV vector) refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., a nucleic acid sequence that is not of AAV origin) that are flanked by at least one, preferably two AAV inverted terminal repeat sequences (ITRs). Such rAAV vectors can be multiplied and packaged into infectious viral particles when present in a host cell that has been infected by a suitable helper virus (or is expressing suitable helper functions) and is expressing AAV rep and cap gene products. (ie Rep and Cap proteins from AAV). When an rAAV vector is incorporated into a longer polynucleotide (e.g. g., on a chromosome or other vector such as a plasmid used for cloning or transfection), then the rAAV vector can be called a proctor that can be rescued by replication and encapsidation in the presence of AAV packaging functions and functions suitable cooperators. An rAAV vector can be in any of a number of forms, including, but not limited to plasmids, linear artificial chromosomes, complexed with lipids, encapsulated in liposomes, and most preferably, encapsulated in a viral particle, particularly a particle. by AAV. An rAAV vector can be packaged into an AAV virus capsid to generate a recombinant adeno-associated virus particle (rAAV particle).

Heterologous means obtained from a genotypically different entity from the rest of the entity with which it is compared or into which it is introduced or incorporated. For example, a polynucleotide engineered into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence (p. g., a gene or part thereof) that is incorporated into a viral vector is a nucleotide sequence heterologous to the vector.

The term "transgene" refers to a polynucleotide that is introduced into a cell and that is capable of being transcribed into RNA and optionally, translated and / or expressed under suitable conditions. In some aspects, it confers a desired property on a cell into which it has been introduced, or otherwise leads to a desired therapeutic or diagnostic result. In another aspect, it can be transcribed into a molecule that mediates RNA interference, such as siRNA.

The terms genomic particles (pg), genomic equivalents, or genomic copies as used in reference to a viral titer, refer to the number of virions that the recombinant AAV DNA genome contains, regardless of infectivity or functionality. The number of genomic particles in a particular vector preparation can be measured by procedures, such as those described in the Examples herein, or for example, in Clark et al. (1999) Hum. Gene Ther., 10: 1031-1039; Veldwijk et al. (2002) Mol. Ther., 6: 272-278.

The terms infection unit (ui), infectious particle, or replication unit, as used in reference to a viral titer, refer to the number of infectious and replication competent recombinant AAV vector particles as measured by the assay. infectious center, also known as a replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62: 1963-1973.

The term "transduction unit (ut)" as used in reference to a viral titer, refers to the number of Infectious recombinant AAV vector particles that result in the production of a functional transgene product, measured in functional assays such as described in the Examples herein, or for example in Xiao et al. (1997) Exp. Neurobiol., 144: 113-124; or in Fisher et al. (1996) J. Virol., 70: 520-532 (LFU assay).

An inverted terminal repeat sequence or ITR is a term well known in the art and refers to relatively short sequences found at the ends of viral genomes that are in opposite orientation.

An AAV inverted terminal repeat (ITR) sequence, an expression well known in the art, is a sequence of approximately 145 nucleotides that is present at both ends of the wild-type single-stranded AAV genome. The 125 most extreme nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The 125 most extreme nucleotides also contain several shorter regions of self-complementarity (designated regions A, A ', B, B', C, O, and D), which allow intrachain base pairing to occur within this part of the ITR. .

A terminally resolving sequence or srt is a sequence in the D region of the AAV ITR that is cleaved by AAV rep proteins during viral DNA replication. A mutant end-resolving sequence is refractory to cleavage by AAV rep proteins.

A helper virus for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell. A number of helper viruses have been identified, including adenoviruses, herpes viruses, and smallpox viruses such as vaccinia virus. Adenovirus encompasses a number of different subgroups, although subgroup C adenovirus type 5 (Ad5) is the most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and are available from repositories such as the ATCC. Viruses of the herpes family, which are also available from repositories such as ATCC, include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). ).

The percent (%) sequence identity to a reference polypeptide or nucleic acid sequence is defined as the percentage of nucleotide or amino acid residues in a candidate sequence that are identical to nucleotide or amino acid residues in the reference polypeptide or nucleic acid sequence, after aligning the sequences and inserting gaps, if necessary, to achieve the maximum percent identity, and not considering any conservative substitution as part of sequence identity. Alignment for the purpose of determining percent nucleic acid or amino acid sequence identity can be accomplished in different ways depending on the person skilled in the art, for example, using publicly available computer software, for example those described. in Current Protocol in Molecular Biology (Ausubel et al., compilers, 1987), sup. 30, section 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine suitable parameters to measure alignment, including any algorithms necessary to achieve maximum alignment along the entire length of the sequences being compared. For the purposes of this specification, the% amino acid sequence identity of a given A amino acid sequence to, with, or against a given B amino acid sequence (which may alternatively be expressed as a given amino acid sequence A having or comprising a certain% amino acid sequence identity to, with or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that alignment of the A and B program, and where Y is the total number of amino acid residues in B. It will be appreciated that when the length of the amino acid sequence A is not equal to the length of the amino acid sequence B, the% identity of the amino acid sequence A with respect to B will not equal the% identity of the amino acid sequence. B with respect to A. For the purposes of this specification, the% nucleic acid sequence identity of a given C nucleic acid sequence to, with, or against a given D nucleic acid sequence (which may alternatively be expressed as a sequence A given nucleic acid sequence C having or comprising a certain% nucleic acid sequence identity to, with or to a given nucleic acid sequence D) is calculated as follows: 100 times the W / Z fraction, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that C and D program alignment, and where Z is the total number of nucleotides in D. It will be appreciated that when the length of the nucleic acid sequence C is not equal to the length of the nucleic acid sequence D, the% identity of the nucleic acid sequence of C to D will not be equal to the% identity of the nucleic acid sequence of D relative to C.

An isolated molecule (eg, nucleic acid or protein) or a cell means that it has been identified and separated and / or recovered from a component of its natural environment.

An effective amount is an amount sufficient to produce beneficial or desired results, including clinical outcomes (eg, improvement of symptoms, meeting clinical endpoints, and the like). An effective amount can be administered in one or more administrations. In terms of a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay the development of a disease.

An individual or a subject is a mammal. Mammals include, but are not limited to, domestic animals (eg, cows, sheep, cats, dogs, and horses), primates (eg, humans and non-human primates such as monkeys), rabbits, and rodents (eg, mice. and rats). In some embodiments the individual or subject is a human being.

As used herein, treatment is a procedure for obtaining beneficial or desired clinical results. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, alleviating symptoms, decreasing the extent of the disease, stabilizing (e.g., not worsening) the disease state, preventing the spread (e.g. For example, metastasis) of the disease, delay or slow down the progression of the disease, improve or palliate the state of the disease and remission (whether partial or total), whether detectable or undetectable. Treatment can also mean prolonging survival compared to expected survival if no treatment was received.

Retinitis pigmentosa (RP) refers to a heterogeneous group of diseases characterized by progressive vision loss. Symptoms generally arise from degeneration or abnormalities of the retina, which may include loss of function of photoreceptor cells.

Rhodopsin refers to a member of the family of G protein-coupled receptors that function in the perception of light in the rod-like photoreceptor cells of the retina. A visual pigment, rhodopsin contains an opsin polypeptide reversibly linked to its retinal cofactor. Light causes the isomerization of the retinal from an 11-cis to an all-trans form. This in turn produces a conformational change in the polypeptide that leads to G protein activation. By converting the presence of light into a biochemical response, rhodopsin enables visual perception. Its function is necessary for scotopic vision (that is, vision without color in dim light), and it is also believed to be necessary for the viability of photoreceptor cells.

As used herein, rhodopsin can refer to the entire visual pigment including retinal or simply to the component or amino acid sequence of the molecule. Rhodopsin can also be known as OPN2, Opsin-2, or RP4. Examples of the rhodopsin proteins can include without limitation human, mouse, dog and cat rhodopsin, e.g. e.g. NCBI reference sequences NP_000530, NP_663358, NP_001008277 and NP_001009242. Examples of rhodopsin genes can include without limitation human, mouse, dog and cat rhodopsin genes, e.g. eg GenBank Entrez gene ID 6010 (RHO, also called RP4, OPN2 and CSNBAD1), GenBank Entrez gene ID 212541 (Rho, also called. Ops, RP4, Opn2 and Noergl), GenBank Entrez gene ID 493763 and GenBank Entrez gene ID 493762. The term rhodopsin, as used herein, also includes functional equivalents of rhodopsin (e.g. g. rhodopsin variants) including mutations, truncates, deletions and / or insertions, provided that the functional equivalent retains at least a part of the activity of wild-type rhodopsin to ameliorate the symptoms of retinitis pigmentosa.

As used herein, refractory refers to resistance to modulation. For example, a rhodopsin gene that is refractory to deletion by m¡R-708 is substantially or totally resistant to deletion by miR-708

The "opsin promoter" refers to a polynucleotide sequence derived from an opsin gene (eg, mouse opsin) that directs expression specifically in rod photoreceptor cells (eg, rod photoreceptor cells). . As used herein, "opsin promoter" can refer to an entire promoter sequence or to a fragment of the promoter sequence sufficient to drive specific rod expression, such as the sequences described by Quiambao, AB, et al. (1997) Vis. Neurosci. 14 (4): 617-25 and Le, YZ, et al. (2006) Mol. Vis. 12: 389-98. In some embodiments, the opsin promoter contains a 676 bp fragment that encodes a 400 bp CMV enhancer upstream of a portion of the opsin promoter sequence (-500 bp - + 15 bp). Also included is the 65 bp NRL sequence; it encodes a neuroretinal basic zipper factor (a rod photoreceptor-specific transcription factor).

Rhodopsin kinase (RK) promoter refers to a polynucleotide sequence derived from a rhodopsin kinase gene (eg, human RK, represented by GenBank Entrez gene ID 6011) that specifically directs expression in rod and cone photoreceptor cells, as well as retinal cell lines such as WERI Rb-1. As used herein, "rhodopsin kinase promoter" can refer to a complete promoter sequence or a fragment of the promoter sequence sufficient to drive photoreceptor specific expression, such as the sequences described by Khani, SC , et al. (2007) Invest. Ophthalmol. Vis. Sci. 48 (9): 3954-61 and Young, JE, et al. (2003) Invest. Ophthalmol. Vis. Sci. 44 (9): 4076-85. In some embodiments, the RK promoter ranges from -112 to +180 relative to the transcriptional start site.

miR-708 refers to a micro-RNA polynucleotide (miRNA) sequence comprising the stem and loop sequences shown in FIG. 4. Examples of miR-708 polynucleotides can include without limitation, human, mouse, dog and cat miR-708, e.g. eg, as represented in GenBank Entrez by the gene IDs 100126333, 735284 and 100885899. MiRNAs are small non-coding RNA molecules that regulate the expression of genes (p. g., by down-regulation of the gene transcript) that contain a target site recognized by the miRNA (Bartel, DP (2004) Cell 116 (2): 281-97). MiR-708 is known to be induced by CHOP and may be involved in the regulation of rhodopsin expression (Behrman, S., et al. (2011) J. Cell Biol. 192 (6): 919-27). As used herein, miR-708 can refer to the processed miR-708 polynucleotide or any intermediate compounds in the processing pathway, e.g. eg, pri-miRNA or pre-mRNA. Ta and as used herein, miR-708 can refer to a DNA sequence that is transcribed to provide the RNA of miR-708, or the RNA sequence itself.

Reference to about a value or parameter herein includes (and describes) modalities that are directed to that value or a parameter itself. For example, the description referring to about X includes the description of X

As used herein, the singular forms of the articles a, an, the, and the include plural references unless otherwise indicated.

Aspects and embodiments of the invention described herein are understood to include comprising, consisting of, and / or consisting essentially of the aspects and embodiments.

III. Pigmentary retinitis and experimental models of it

As described above, retinitis pigmentosa (RP) refers to a group of degenerative eye diseases that can cause progressive vision loss, including loss of night vision, loss of peripheral visual fields, and total blindness. In America, the incidence of RP is believed to be approximately 1 in 4,000 people. RP is often inherited, and autosomal dominant, autosomal recessive, and X-linked RP disorders have been described. Mutations have been associated with RP in more than 50 different genes, including components involved in the phototransduction cascade. the retinal cycle and splicing factors, as well as more than 100 different mutations in rhodopsin itself. In many cases, mutations associated with RP lead to loss of rod photoreceptor function and / or cell death. This loss results in decreased scotopic vision and can manifest as night blindness or decreased peripheral vision. Rod cell death has also been associated with subsequent cone cell death, resulting in a loss of high visual acuity, and combined with rod cell death, blindness.

A variety of cell and animal-based models have been established to examine the cellular basis of RP and for testing experimental treatments. A cell-based model for RP is that of cultured human retinal pigmented epithelial cells (RPE) (Adamowicz, M., et al. (2012) Adv. Exp. Med. Biol. 723: 573-9). This model can be used to express mutant proteins involved in RP and assay for the effect of these mutations on protein function, or the effect of mutant proteins on cell function and / or viability. For example, human wild-type and mutant rhodopsin can be expressed using any suitable promoter (eg, CMV). Without wishing to be bound by theory, it is believed that an opsin polypeptide misfolding results in ER retention and stress, induction of the unfolded protein response (UPR), and increased cell death. This model can be used to examine the effect of any mutation associated with RP, for example a rhodopsin mutation such as P23H.

Animal-based RP models can include mice harboring mutations known or suspected to produce RP in mice, or orthologous mutations to those found in humans. In some embodiments, the mouse models can include mice genetically engineered to express a rhodopsin, eg, a mutated human or mouse form, in photoreceptor cells. Examples of mouse models include the P347S rhodopsin mouse (Li, T., et al. (1996) Proc. Nati. Acad. Sel. 93 (24): 14176-81), the mouse Rho7'(Humphries, MM, et al. (1997) Nat. Genet. 15 (2): 216-9) and a mouse expressing mutant rhodopsin P23H (mouse P23H) (Olsson, JE, et al. (1992) Neuron 9 (5): 815-30). In P23H mice, mutant human rhodopsin can be inserted into the mouse germ line. Any promoter known in the art can be used for expression in photoreceptor cells (eg, the mouse opsin or human RK promoter). In some embodiments, rhodopsin can be expressed using an AAV vector.

Other animal models can also be used for RP. In addition to mouse models, rat, dog, pig, frog models can also be used (Tam, BM and Moritz, OL (2006) Invest. Ophthalmol. Vis. Sci. 47 (8): 3234-41), and of non-human primates.

IV. Methods for treating retinitis pigmentosa

In some aspects, the invention provides methods and compositions for treating retinitis pigmentosa in a mammal that comprise administering to the mammal (eg, the retina) an effective amount of rAAV viral particles comprising a vector encoding a miR- 708. The methods can be used to treat a human with RP, to ameliorate the pathologies and deterioration of vision associated with RP. In some embodiments, the invention includes administering an effective amount of rAAV viral particles comprising a vector comprising nucleic acid encoding rhodopsin (eg, a normal or wild-type rhodopsin). In some embodiments, miR-708 serves to suppress the activity of a mutated rhodopsin associated with RP. In some embodiments, normal or wild-type rhodopsin serves to supplement the eye with a functional rhodopsin. In some embodiments, the viral particle comprises an AAV serotype 5 capsid (AAV5 capsid) and AAV 2 or AAV 5 inverted terminal repeats. In some embodiments, the virus particle comprises an AAV serotype 5 mutated tyrosine capsid and Inverted terminal repeats of AAV 2 or AAV 5.

In some aspects, the invention provides methods and compositions for ameliorating a symptom of RP, which comprise administering to the eye of a mammal an effective amount of rAAV viral particles comprising a vector encoding a miR-708. In other aspects, the invention provides methods and compositions for ameliorating a symptom of RP, comprising administering to the eye of a mammal an effective amount of rAAV viral particles comprising a vector encoding a miR-708 and a rhodopsin. In some modalities, symptoms of RP include, but are not limited to, blindness, night blindness, decreased peripheral vision, and loss of high visual acuity. In some modalities, the treatment of retinitis pigmentosa comprises reducing or preventing symptoms associated with retinitis pigmentosa, including, but not limited to, methods of preventing retinal degeneration, methods of arresting the progression of RP, methods of increasing the photoreceptor function and the like. Symptoms and / or pathology of RP include, but are not limited to, loss of sight, loss of night vision, loss of peripheral visual fields, loss of ERG function; loss of visual acuity and contrast sensitivity; loss of visually guided behavior, reduced function of rod-like photoreceptors, death of rod-like photoreceptor cells, decreased scotopic vision, reduced changes in retinal cells (loss of photoreceptor structure or function , thinning or thickening of the outer nuclear layer (ONL); thinning or thickening of the outer plexiform layer (OPL); disorganization followed by loss of outer segments of rods and cones; shortening of inner segments of rods and cones; retraction of bipolar cell dendrites; thinning or thickening of the inner retinal layers including the inner nuclear layer, inner plexiform layer, ganglion cell layer, and nerve fiber layer; wrong location of opsin; excess expression of neurofilaments; and the like. In some embodiments, the invention provides methods for preventing the deterioration of rod-like cell function and the death of rod-like cells and the function of cone-like cells and the death of cone-like cells.

In some aspects, the invention provides methods for preventing or delaying the progression of RP. Autosomal dominant RP is a genetic disease that can be genotyped. The onset and progression of RP can be determined by Optical Coherence Tomography (OCT) which allows examination of the abnormalities of the external plexiform layer (OPL).

Means of determining improvement in RP symptoms are known in the art. For example, measurement of visual fields (eg, Goldmann visual fields), electroretinogram (ERG) determination, fundus photography, optical coherence tomography, and fluorescein angiography. Improvements in visual evoked function can also be used to determine improvement in RP symptoms; For example, statements like I can find things that fall, I can see faces during a candlelight dinner, I can see the stripes on my t-shirt, I can see the stars at night, I can read normal books and sit in the front from the classroom, now I can play soccer and I don't need someone around to help me find the ball, I can ride my bike around my neighborhood by myself, my dream has come true: I have seen my daughter complete a home run and when can I get injected into the other eye?

In some aspects of the invention, the methods and compositions are used for treating humans with RP. RP can be inherited in an autosomal dominant, autosomal recessive, or X-linked form. RP linked to the X chromosome can be recessive, mainly affecting only males, or dominant affecting both males and females. RP can be caused by mutations in the rho gene that encodes the rhodopsin protein. In some embodiments of the invention, the methods are used to treat humans with a mutation in the rho gene and / or the rhodopsin protein. In some embodiments of the invention, the mutation in the rhodopsin protein is a P23H mutation (substitution of proline for histidine at amino acid residue 23 of the rhodopsin protein). In other embodiments, the mutation in the rhodopsin protein is a T58R, P347L, or P347S, or a deletion of residue 1255. Mutations associated with retinitis pigmentosa are provided in McWilliam, P, et al., (1989) Genomics 5: 619-622; Dryja, TP et al., (1990) Nature 343: 364-266; Farrar, GJ et al., (1990) Genomics 8: 35-40; Farrar, GJ et al., (2002) EMBO J. 21: 857-864; all incorporated herein by reference.

miR-708 is a CHOP-regulated micro RNA that regulates rhodopsin expression (Behrman, S., et al. (2011) J. Cell Biol. 192 (6): 919-27). miR-708 is an intronic micro RNA that resides within the CHOP-inducible gene, Odz4 (Tenurin-4). CHOP regulates miR-708 expression during ER stress. There is a putative miR708 sequence in the 3 'UTR of the rhodopsin gene that is highly conserved (see Figure 4 of Behrman et al., Ibid.).

In some embodiments, the invention provides methods for treating a human with RP. In some embodiments, the invention provides methods for treating a human with autosomal dominant RP. In some embodiments, the invention provides methods for treating a human with RP associated with a mutation in the rhodopsin gene. In some embodiments, the invention provides a method of treating a human with RP, administering an effective amount of an AAV vector encoding miR-708 to suppress the activity of a mutated rhodopsin. In some embodiments, the invention provides methods of treating a mammal (eg, a dog or a cat) with RP. In some embodiments, the miR-708 nucleic acid may include, without limitation, the nucleic acid represented by GenBank Entrez gene IDs 100126333, 735284, or 100885899.

In some embodiments of the invention, the suppression of a mutant rhodopsin is complemented by the delivery of an effective amount of AAV vector encoding a wild-type rhodopsin or a rhodopsin with essentially the same activity as a wild-type rhodopsin. In some embodiments, the rhodopsin is a human rhodopsin. In some embodiments, the invention provides a method of treating a human with RP by administering an effective amount of an AAV vector encoding miR-708 to suppress the activity of a mutated rhodopsin and an effective amount of an AAV vector. encoding a human rhodopsin with wild type activity. In some embodiments, the AAV vector encoding miR-708 and the AAV vector encoding human rhodopsin are the same AAV vector. In some embodiments, the AAV vector encoding miR-708 and the AAV vector encoding human rhodopsin are different AAV vectors. In some embodiments, the nucleic acid encoding rhodopsin can include without limitation the nucleic acid provided by the sequences identified by the NCBI reference sequences NP_000530, NP_663358, NP_001008277 and NP_001009242.

In some aspects, the invention provides methods for treating endoplasmic reticulum (ER) stress in a cell comprising administering to the mammal a rAAV viral particle comprising an rAAV vector comprising nucleic acid encoding a miR-708. In some embodiments, the cell is an eye cell. In additional embodiments, the cell is a photoreceptor cell. In still other embodiments, the cell is a rod-like photoreceptor cell. In some embodiments, the method comprises reducing one or more cellular markers of ER stress. In additional embodiments, the one or more cellular markers of ER stress is spliced XBP-1, CHOP or Grp78. In some embodiments, the rAAV vector comprises nucleic acid encoding a miR-708 which further comprises nucleic acid encoding rhodopsin. In other embodiments, the invention provides methods for treating endoplasmic reticulum (ER) stress in a cell, comprising administering to the mammal a first rAAV vector comprising nucleic acid encoding a miR-708 and a second rAAV viral particle that comprises a second rAAV vector comprising nucleic acid encoding a rhodopsin.

In some aspects, the invention provides methods of delivering miR708 or miR-708 and rhodopsin to a mammal with RP, the method comprising administering to the mammalian retina an effective amount of rAAV viral particles comprising a vector encoding miR-708 and / or rhodopsin. Administration delivers the transgenic product to photoreceptor cells, where miR-708 and / or rhodopsin mediate a beneficial effect on the photoreceptor cell and the environment of the photoreceptor cells. In some embodiments, delivery of AAV virus particles to the retina is by injection of virus particles into the subretinal space of the retina. In some embodiments, the delivery of AAV particles to the retina is by intravitreal delivery as long as the AAV particle is capable of penetrating the back of the eye and transducing the photoreceptor cells. In some embodiments, AAV particles are delivered to one or more sites in the subretinal space of the retina.

In some embodiments, administration to the retina of an effective amount of rAAV viral particles comprising a vector encoding miR-708 and / or rhodopsin transduces photoreceptor cells at or near the site of administration. In some modalities, more than approximately any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% , 75% or 100% of the photoreceptor cells are transduced. In some embodiments, from about 5% to about 100%, from about 10% to about 50%, from about 10% to about 30%, from about 25% to about 75%, from about 25% to about 50%, or from about 30% to about 50% of the photoreceptor cells are transduced. Methods for identifying AAV transduced photoreceptor cells expressing miR-708 and / or rhodopsin are known in the art; for example, immunohistochemistry or the use of a marker, such as enhanced green fluorescent protein, can be used to detect the expression of miR-708 and / or rhodopsin.

In some embodiments of the invention, the methods comprise administering to the retina (eg, the subretinal space) of a mammal an effective amount of AAV viral particles comprising a vector encoding a miR708 and / or rhodopsin to treat to a mammal, for example, a human with RP. In some embodiments, the composition is injected into one or more subretinal spaces to allow expression of miR-708 and / or rhodopsin in photoreceptor cells. In some embodiments, the composition is injected into any one of one, two, three, four, five, six, seven, eight, nine, ten, or more than ten sites in the subretinal space of the retina.

[In some embodiments, the rAAV virus particles are delivered to more than one site simultaneously or sequentially. In some embodiments, multiple injections of rAAV virus particles are not more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours, or 24 hours apart.

In some embodiments, the first rAAV virus particles encoding miR-708 and the second rAAV virus particles encoding rhodopsin are delivered at one or more sites simultaneously or sequentially. In some embodiments, multiple injections of rAAV virus particles are not more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours, or 24 hours apart. In some embodiments, the first rAAV viral particles encoding miR-708 are administered prior to administering the second rAAV viral particles encoding rhodopsin. In some embodiments, the first rAAV virus particles encoding miR-708 are delivered after the second rAAV virus particles encoding rhodopsin are administered.

In some embodiments, the invention provides a method of treating a human with RP by administering an effective amount of a pharmaceutical composition comprising an AAV vector encoding miR-708 to suppress the activity of a mutated rhodopsin. In some embodiments, the invention provides a method of treating a human with RP by administering an effective amount of a pharmaceutical composition comprising an AAV vector encoding miR-708 to suppress the activity of a mutated rhodopsin and an amount The efficacy of a pharmaceutical composition comprising an AAV vector encoding rhodopsin to complement photoreceptors with wild-type rhodopsin activity. In some embodiments, the pharmaceutical composition comprising an AAV vector encoding miR-708 and the pharmaceutical composition comprising an AAV vector encoding human rhodopsin are the same pharmaceutical composition. In some embodiments, the pharmaceutical composition comprising an AAV vector encoding miR-708 and the pharmaceutical composition comprising an AAV vector encoding human rhodopsin are different pharmaceutical compositions. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

In some embodiments of the invention, the volume of the composition injected into the subretinal space of the retina or intravitreally is more than about any one of 1 pl, 2 μΙ, 3 μΙ, 4 μΙ, 5 μΙ, 6 μΙ, 7 μΙ, 8 μΙ, 9 μΙ, 10 μΙ, 15 μΙ, 20 μΙ, 25 μΙ, 50 μΙ, 75 μΙ, 100 μΙ, 200 μΙ, 300 μΙ, 400 μΙ, 500 μΙ, 600 μΙ, 700 μΙ, 800 μΙ, 900 μΙ ο 1 ml, or any amount in between.

Compositions of the invention (eg, AAV viral particles comprising a vector encoding miR-708 and / or rhodopsin) can be used alone or in combination with one or more additional therapeutic agents to treat RP. The interval between the administration sequence! it can be in terms of at least (or alternatively less than) minutes, hours, or days.

V. Artificial structures of expression

In some embodiments, the transgene (eg, miRNA 708 and / or rhodopsin) is functionally linked to a promoter. Examples of promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, the phosphoglycerate kinase-1 (PGK) promoter, a simian virus 40 (SV40) promoter, and a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, a hAAT promoter, an LSP promoter, chimeric liver specific promoters (LSP) , the E2F promoter, the telomerase promoter (hTERT); the cytomegalovirus enhancer / chicken beta-actin / rabbit B-globin promoter (CAG promoter; Niwa et al., Gene, 1991, 108 (2): 193-9) and the elongation factor 1-alpha promoter (EF1-alpha) (Kim et al., Gene, 1990, 91 (2): 217-23 and Guo et al., Gene Ther., 1996, 3 (9): 802-10). In some embodiments, the promoter comprises a human β-glucuronidase promoter or a cytomegalovirus enhancer associated with a chicken β-actin (CBA) promoter. The promoter can be a constitutive, inducible, or repressible promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to a CBA promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding rhodopsin (eg, human rhodopsin) functionally linked to a CBA promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 and nucleic acid encoding rhodopsin (eg, human rhodopsin) functionally linked to a CBA promoter.

In some embodiments, the promoter is capable of expressing the transgene in photoreceptor cells. In embodiments, the promoter is a rhodopsin kinase (RK) promoter; p. eg, a human RK promoter. In some embodiments, the promoter is an opsin promoter; p. g., a human opsin promoter or a mouse opsin promoter.

In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to an RK promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding rhodopsin (eg, human rhodopsin) functionally linked to an RK promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 and rhodopsin (e.g. g., human rhodopsin) functionally linked to an RK promoter. In some embodiments, the nucleic acid encoding miR-708 is 5 'to the nucleic acid encoding rhodopsin. In other embodiments, the nucleic acid encoding miR-708 is 3 'to the nucleic acid encoding rhodopsin. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to a first RK promoter and nucleic acid encoding rhodopsin functionally linked to a second RK promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to a first RK promoter is 5 'to the nucleic acid encoding rhodopsin functionally linked to a second RK promoter. In other embodiments, the nucleic acid encoding miR-708 functionally linked to a first RK promoter is 3 'to the nucleic acid encoding rhodopsin functionally linked to a second RK promoter. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1. In some embodiments, rhodopsin comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin comprises an amino acid sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 % identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin is a functional equivalent of wild-type rhodopsin. In some embodiments, the expression of rhodopsin from the AAV vector is refractory to deletion by miR-708. In some embodiments, the nucleic acid encoding rhodopsin lacks the miR708 target site in the 3 'UTR of the rhodopsin gene. In some embodiments, the nucleic acid encoding rhodopsin comprises a mutation (eg, a deletion, a substitution, an insertion, etc.) in the target site of miR-708 in the 3 'UTR of the rhodopsin gene so which is refractory to suppression by miR-708.

In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to an opsin promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding rhodopsin (eg, human rhodopsin) functionally linked to an opsin promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 and nucleic acid encoding rhodopsin (eg, human rhodopsin) functionally linked to an opsin promoter. In some embodiments, the nucleic acid encoding m¡R708 is 5 'to the nucleic acid encoding rhodopsin. In other embodiments, the nucleic acid encoding miR-708 is 3 'to the nucleic acid encoding rhodopsin. In some embodiments, the invention provides an AAV vector comprising miR-708 encoding nucleic acid functionally linked to a first opsin promoter and rhodopsin encoding nucleic acid functionally linked to a second opsin promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to a first opsin promoter is 5 'to the nucleic acid encoding rhodopsin functionally linked to a second opsin promoter. In other embodiments, the nucleic acid encoding miR-708 functionally linked to a first opsin promoter is 3 'to the nucleic acid encoding rhodopsin functionally linked to a second opsin promoter. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 1. In some embodiments, rhodopsin comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin comprises an amino acid sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or

99% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin is a functional equivalent of wild-type rhodopsin. In some embodiments, rhodopsin expression from the AAV vector is refractory to suppression by miR-708. In some embodiments, the nucleic acid encoding rhodopsin lacks the miR-708 target site in the 3 'UTR of the rhodopsin gene. In some embodiments, the nucleic acid encoding rhodopsin comprises a mutation (eg, a deletion, a substitution, an insertion, etc.) in the target site of miR-708 in the 3 'UTR of the rhodopsin gene of so it is refractory to suppression by miR-708 ..

In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to a RK promoter and nucleic acid encoding rhodopsin functionally linked to an opsin promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the RK promoter is 5 'to the nucleic acid encoding rhodopsin functionally linked to an opsin promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the RK promoter is 3 'to the nucleic acid encoding rhodopsin functionally linked to an opsin promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to an opsin promoter and nucleic acid encoding rhodopsin functionally linked to an RK promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the opsin promoter is 5 'to the nucleic acid encoding rhodopsin functionally linked to an RK promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the opsin promoter is 3 'to the nucleic acid encoding rhodopsin functionally linked to an RK promoter. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , or 99% identical to the sequence of SEQ ID NO: 1. In some embodiments, rhodopsin comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin comprises an amino acid sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 % identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin is a functional equivalent of wild-type rhodopsin. In some embodiments, the expression of rhodopsin from the AAV vector is refractory to deletion by miR-708. In some embodiments, the nucleic acid encoding rhodopsin lacks the miR708 target site in the 3 'UTR of the rhodopsin gene. In some embodiments, the nucleic acid encoding rhodopsin comprises a mutation (eg, a deletion, a substitution, an insertion, etc.) in the target site of miR-708 in the 3 'UTR of the rhodopsin gene so which is refractory to suppression by miR-708.

In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to a CBA promoter and nucleic acid encoding rhodopsin functionally linked to a RK promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the CBA promoter is 5 'to the nucleic acid encoding rhodopsin functionally linked to an RK promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the CBA promoter is 3 'to the nucleic acid encoding rhodopsin functionally linked to an RK promoter. In some embodiments, the invention provides an AAV vector comprising nucleic acid encoding miR-708 functionally linked to an RK promoter and nucleic acid encoding rhodopsin functionally linked to a CBA promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the RK promoter is 5 'to the nucleic acid encoding rhodopsin functionally linked to a CBA promoter. In some embodiments, the nucleic acid encoding miR-708 functionally linked to the RK promoter is 3 'to the nucleic acid encoding rhodopsin functionally linked to a CBA promoter. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises the sequence of SEQ ID NO: 1. In some embodiments, miR-708 comprises a nucleotide sequence that is at least about 80%, 85%, 90%, or 95% identical to the sequence of SEQ ID NO: 1. In some embodiments, rhodopsin comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin comprises an amino acid sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, rhodopsin is a functional equivalent of wild-type rhodopsin. In some embodiments, the expression of rhodopsin from the AAV vector is refractory to suppression by miR-708. In some embodiments, the nucleic acid encoding rhodopsin lacks the miR-708 target site in the 3 'UTR of the rhodopsin gene. In some embodiments, the nucleic acid encoding rhodopsin comprises a mutation (eg, a deletion, a substitution, an insertion, etc.) in the target site of miR-708 in the 3 'UTR of the rhodopsin gene of thus it is refractory to deletion by miR-708.

In some embodiments, the nucleic acid encoding miR-708 comprises an endogenous framework of miR-708. In some embodiments, the miR-708 scaffold is provided by SEQ ID NO: 14. In some embodiments, the nucleic acid encoding miR-708 comprises a heterologous framework of miRNA. In some embodiments, the use of a heterologous miRNA framework is used to modulate miRNA expression; for example to increase miRNA expression or to decrease miRNA expression. In some embodiments, the nucleic acid encoding miR-708 comprises an endogenous framework of miR-155. In some embodiments, the miR-155 scaffold is provided by SEQ ID NO: 14.

Recombinant viral vector

The present invention contemplates the use of a recombinant viral genome for the introduction of one or more nucleic acid sequences encoding a miR-708 RNA and / or a rhodopsin protein, described herein for the packaging of a viral particle of AAV. The recombinant viral genome can include any element to establish the expression of a miR-708 RNA and / or a rhodopsin protein, for example, a promoter, a miR-708 RNA and / or a rhodopsin transgene, an ITR, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and / or origin of replication.

Viral particles and methods for producing viral particles

RAAV virus particles

The invention provides methods of using rAAV particles to treat retinitis pigmentosa and provides compositions comprising rAAV particles. In some embodiments, the viral particle is a recombinant AAV particle comprising a nucleic acid comprising a sequence encoding the miR-708 RNA and / or a rhodopsin protein, described herein, flanked by one or two ITRs. The nucleic acid is encapsidated in the AAV particle. The AAV particle also comprises capsid proteins. In some embodiments, the nucleic acid comprises the coding sequence (s) of interest (eg, nucleic acid encoding miR-708 RNA and / or a rhodopsin protein), components functionally linked in the direction of transcription, control sequences including transcription initiation and termination sequences, thus forming an expression cassette. In some embodiments, the nucleic acid encoding miR708 is inserted into an intron. The expression cassette is flanked at the 5 'and 3' ends by at least one functional AAV ITR sequence. By functional AAV ITR sequences it is meant that the ITR sequences act as intended for the rescue, replication and packaging of the AAV virion. See, Davidson et al., PNAS, 2000, 97 (7) 3428-32; Passini et al., J. Virol., 2003, 77 (12): 703440; and Pechan et al., Gene Ther., 2009, 16: 10-16, all of which are incorporated herein in their entirety by reference. For the practice of some aspects of the invention, the recombinant vectors comprise at least all the AAV sequences essential for encapsidation and the physical structures for an infection with rAAV. AAV ITRs for use in the vectors of the invention need not have a wild-type nucleotide sequence (eg, as described by Kotin, Hum. Gene Ther., 1994, 5: 793-801), and can be altered by nucleotide insertion, deletion or substitution, or AAV ITRs can be obtained from any of several AAV serotypes. Currently more than 40 AAV serotypes are known, and new serotypes and variants of existing serotypes continue to be identified. See, Gao et al., PNAS, 2002, 99 (18): 11854-6; Gao et al., PNAS, 2003, 100 (10): 6081-6; and Bossis et al., J. Virol., 2003, 77 (12): 6799-810. The use of any AAV serotype is considered within the scope of the present invention. In some embodiments, an rAAV vector is a vector derived from an AAV serotype, including without limitation AAV capsid serotype ITRs, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.8 , AAVrhSR, AAV9, AAV10, AAVrh.10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or mouse AAV or the like. In some embodiments, the nucleic acid in AAV comprises a capsid serotype ITR of AAV, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.8, AAVrh8R, AAV9, AAV10, AAVrh.10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV or mouse AAV or the like. In some embodiments, the nucleic acid in AAV further encodes miR-708, rhodopsin or miR-708, and rhodopsin as described herein. For example, nucleic acid in AAV can comprise at least one ITR of any AAV serotype contemplated herein and can further encode a miR-708 comprising the nucleic acid of SEQ ID NO: 1 and / or a nucleic acid encoding a human rhodopsin comprising the amino acid sequence of SEQ ID NO: 2. In some embodiments, the nucleic acid in AAV comprises 5 'to 3' nucleic acid encoding the following: an AAV ITR, a filler fragment (e.g. g., SEQ ID NO: 11), a chimeric intron (eg, SEQ ID NO: 10), a miR-708, a bovine growth hormone polyadenylation sequence, a filler fragment, and an ITR of AAV. In some embodiments, nucleic acid in AAV comprises 5 'to 3' nucleic acid encoding the following: an AAV ITR, an RK promoter, a B globin intron, a miR-708 inserted into the β intron globin, a human rhodopsin, a bovine growth hormone polyadenylation sequence, and an AAV ITR. In some embodiments, the nucleic acid in AAV comprises 5 'to 3' nucleic acid that encodes the following: an AAV ITR, a filler fragment (e.g. g., SEQ ID NO: 11), an RK promoter, a chimeric intron (eg, SEQ ID NO: 10), a human rhodopsin, a β globin intron, a miR-708 inserted into the intron of β globin, a bovine growth hormone polyadenylation sequence, a filler fragment, and an AAV ITR. In some embodiments, the nucleic acid in AAV comprises 5 'to 3' nucleic acid encoding the following: an AAV ITR, a filler fragment (e.g. g., SEQ ID NO: 11), an RK promoter, a chimeric intron (eg, SEQ ID NO: 10), a miR-708, a mouse opsin promoter, a human rhodopsin, a sequence of bovine growth hormone polyadenylation and an AAV ITR. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 5. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 5. In some embodiments, the nucleic acid in AAV is the nucleic acid of SEQ ID NO: 6. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 6. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 7. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, or 99% identical to SEQ ID NO: 7. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 8. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 8. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 9. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%,

91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 9. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 24. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 24. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 25. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 25. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 26. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 26. In some embodiments, the nucleic acid in AAV comprises the nucleic acid of SEQ ID NO: 27. In some embodiments, the nucleic acid in AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% identical to SEQ ID NO: 27. In additional embodiments, the rAAV particle comprises capsid proteins of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.8, AAVrh8R, AAV9, AAV10, AAVrh.10, AAV1I, AAV12, AAV2R471A , AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, caprine AAV, chimeric AAV1 / AAV2, bovine AAV, mouse AAV, rAAV2 / HBoV1, or mutants of these capsid proteins. In some embodiments, a mutant capsid protein retains the ability to form an AAV capsid. In some embodiments, the rAAV particle comprises an AAV5 tyrosine mutant capsid (Zhong L. et al., (2008) Proc Nati Acad Sel USA 105 (22): 7827-7832. In additional embodiments, the rAAV particle comprises Capsid proteins of an AAV serotype from Clades AF (Gao, et al., J. Virol. 2004, 78 (12): 6381). In some embodiments, the nucleic acid in AAV comprises the nucleic acid sequence selected from the group consisting of SEQ ID NO: 5-8, and is flanked by at least one AAV2 ITR. In some embodiments, the nucleic acid in AAV comprises the nucleic acid sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% identical to nucleic acid selected from the group consisting of SEQ ID NO: 5-9, and is flanked by at least one AAV2 ITR.

Different AAV serotypes are used to optimize the transduction of particular target cells or to target specific cell types within a particular target tissue (eg, diseased tissue). An rAAV particle can comprise viral proteins and viral nucleic acids with the same serotype or with a mixed serotype. For example, in some embodiments an rAAV particle may comprise AAV5 capsid proteins and at least one AAV2 ITR or it may comprise AAV2 capsid proteins and at least one AAV5 ITR. In other embodiments, an rAAV particle may comprise AAV5 tyrosine mutant capsid proteins and at least one AAV2 ITR. In yet another example, an rAAV particle may comprise both AAV5 and AAV2 capsid proteins, and further comprise at least one AAV2 ITR. Any combination of AAV serotypes for the production of an rAAV particle is provided herein, as if each combination was expressly set forth herein. In some embodiments, the invention provides rAAV particles comprising AAV5 capsid proteins and a nucleic acid encoding miR-708 RNA and / or a rhodopsin transgene, flanked by at least one AAV2 ITR.

Self-complementary AAV viral genomes

In some aspects, the invention provides viral particles that comprise a self-complementary recombinant genome. AAV virus particles with self-complementary genomes and methods of using self-complementary AAV genomes are described in US Pat. No. 6,596,535; 7,125,717; 7,765,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10: 2105-2111, each of which is incorporated herein by reference in its entirety. An rAAV comprising a self-complementary genome will rapidly form a double-stranded DNA molecule by virtue of its partially complementing sequences (eg, complementing coding and non-coding transgene strands). In some embodiments, the invention provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (eg, miR-708 and / or a strand encoding a rhodopsin ) and a second heterologous polynucleotide sequence (e.g. g., a miR-708 antisense strand and / or a rhodopsin antisense or antisense strand) wherein the first heterologous polynucleotide sequence can form intrachain base pairs with the second polynucleotide sequence, along for most of its length. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a sequence that facilitates intrachain base pairing, e.g. eg, a hairpin DNA structure. Hairpin structures are known in the art, for example, in siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a mutated ITR (eg, the

ITR on the right). In some embodiments, the ITR comprises the polynucleotide sequence 5'CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGC C CACGCCCGGGCTTTGCCCGGGCG-3 '(SEQ ID NO: 20). The mutated ITR comprises a deletion of the D region that comprises the terminal resolution sequence. As a result, in the replication of an AAV viral genome, the rep proteins will not cleave the viral genome in the mutated ITR and as such, a recombinant viral genome comprising the following will be packaged in the order of 5 'to 3' in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide reversely oriented to the first heterologous polynucleotide, and a third AAV ITR. In some embodiments, the invention provides AAV viral particles comprising a recombinant viral genome comprising a functional ITR of AAV2, a first polynucleotide sequence encoding miR-708 RNA and / or a rhodopsin transgene, a mutated ITR of AAV2 comprising a deletion of the D region and lacking a functional terminal resolution sequence, a second polynucleotide sequence comprising the sequence complementary to the sequence encoding the miR-708 RNA and / or a rhodopsin, the first polynucleotide sequence and a functional ITR of AAV2.

Production of AAV particles

The rAAV particles can be produced using methods known in the art. See, for example, US Patent Nos. 6,566,118; 6,989,264; and 6,995,006. In the practice of the invention, host cells for producing rAAV particles include mammalian cells, Insect cells, plant cells, microorganisms, and yeast. The host cells can also be packaging cells in which the AAV rep and cap genes are stably conserved in the host cell, or producer cells in which the AAV vector genome is stably conserved. Examples of packaging and producer cells are obtained from 293, A549 or HeLa cells. AAV vectors are purified and formulated using standard techniques known in the art.

In some aspects, a method of producing any rAAV particle as described herein is provided, comprising (a) culturing a host cell under conditions in which rAAV particles are produced, wherein the host cell comprises (i ) one or more AAV packaging genes, wherein each of said AAV packaging genes encodes an AAV replication and / or encapsidation protein; (ii,) an rAAV proctor comprising a nucleic acid encoding the miR-708 RNA and / or any rhodopsin transgene, as described herein, flanked by at least one AAV ITR, and ( iii) a cooperative role of AAV; and (b) recovering the rAAV particles produced by the host cell. In some embodiments, a nucleic acid encodes the miR-708 RNA of SEQ ID NO: 1 and / or a transgene that encodes a rhodopsin; p. eg, a rhodopsin with the amino acid sequence of SEQ ID NO: 2. In some embodiments, said at least one AAV ITR is selected from the group consisting of AAV serotype ITRs of type AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8rh, AAV9, AAV10, AAVIOhr , AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV or mouse AAV, or the like. In some embodiments, said encapsidation protein is selected from the group consisting of capsid protein from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (eg, a wild-type AAV6 capsid, or a capsid variant AAV6 such as ShH10, as described in Pub. PG de

USA 2012/0164106), AAV7, AAV8, AAVrh8, AAVrhSR, AAV9 (eg, a wild-type AAV9 capsid or a modified AAV9 capsid as described in US Pub. PG. 2013/0323226), AAV10, AAVrhIO, AAV11, AAV12, a capsid mutant in tyrosine, a capsid mutant that binds to heparin, an AAV2R471A capsid, an AAVAAV2 / 2-7m8 capsid, a capsid by AAV DJ (p. g., AAV-DJ / 8 capsid, AAV-DJ / 9 capsid, or any of the other capsids described in US Pub. PG 2012/0066783), AAV2 capsid N587A, capsid of AAV2 E548A, AAV2 N708A capsid, AAV V708K capsid, goat AAV capsid, AAV1 / AAV2 chimeric capsid, bovine AAV capsid, mouse AAV capsid, rAAV2 / HBoV1 capsid, AAV capsid described in the document from Pat. from USA No. 8,283,151 or International Publication No. WO / 2003/042397, or mutants thereof. In some embodiments, the encapsidation protein is a mutant AAV5 tyrosine capsid protein. In additional embodiments, the rAAV particle comprises capsid proteins of an AAV serotype from Clades AF. In some embodiments, the rAAV particles comprise an AAV5 capsid and a recombinant genome comprising AAV2 ITRs, a mutant AAV2 ITR, and nucleic acid encoding miR-708 and / or rhodopsin. In some embodiments, the rAAV particles comprise a mutant AAV5 tyrosine capsid and a recombinant genome comprising AAV2 ITRs, a mutant AAV2 ITR, and nucleic acid encoding miR-708 and / or rhodopsin. In a further embodiment, the rAAV particles are purified. The term "purify" as used herein includes a preparation of the rAAV particles that lacks at least some of the other components that may be present as well, wherein the rAAV particles are naturally occurring or are prepared. initially from them. Thus, for example, isolated rAAV particles can be prepared using a purification technique to enrich them from a mixture of sources, such as a culture lysate or production culture supernatant. Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase resistant particles (DRPs) or genomic copies (cg) present in a solution, or by infectivity, or it can be measured in relation to a second interfering substance potentially present in the source mix, such as contaminants, including contaminants from the production crop or contaminants from the process, including helper viruses, media components and the like.

Also provided herein are pharmaceutical compositions comprising a rAAV particle comprising a transgene encoding miR-708 and / or a rhodopsin transgene of the invention and a pharmaceutically acceptable carrier. In some embodiments, the composition comprises rAAV particles comprising a transgene encoding miR-708 and rAAV particles comprising a rhodopsin transgene. In some embodiments, the composition comprises rAAV particles comprising a transgene encoding miR-708 and a rhodopsin transgene. The pharmaceutical compositions can be suitable for any mode of administration described herein. A pharmaceutical composition of an rAAV comprising a nucleic acid encoding miR-708 RNA and / or a rhodopsin transgene, described herein, can be introduced into the eye; for example, by subretinal administration or intravitreal administration.

In some embodiments, pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier are suitable for administration to a human. Such vehicles are well known in the art (see, eg, Remington's Pharmaceutical Sciences, 15to edition, pp. 1035-1038 and 1570-1580). In some embodiments, pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier are suitable for ocular injection. Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline solutions and aqueous dextrose solutions, polyethylene glycol (PEG) and glycerol can also be used as liquid carriers, particularly for injectable solutions. The pharmaceutical composition may further comprise additional ingredients, for example, preservatives, buffers, tonicity agents, antioxidants and stabilizers, non-ionic wetting or rinse agents, viscosity increasing agents, and the like. The pharmaceutical compositions described herein can be packaged in individual unit dosage forms or in multiple dosage forms. The compositions are generally formulated as a sterile and substantially isotonic solution.

Vile. Manufactured Items and Kits

Kits or articles of manufacture are also provided for use in the methods described herein. In aspects, the kits comprise the compositions described herein (eg, rAAV particles comprising nucleic acid encoding miR-708 RNA and / or a rhodopsin transgene) in suitable packaging. Suitable packaging for the compositions (such as eye compositions) described herein are known in the art, and include, for example, vials (such as sealed vials), containers, bottles, jars, flexible packages (eg. , Mylar or plastic sealed bags) and the like. These articles of manufacture can be further sterilized and / or sealed.

The present invention also provides kits that comprise compositions described herein and may further comprise instructions on methods of use of the composition, such as the uses described herein. The kits described herein may further include other materials desirable from a commercial or user point of view, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing any of the methods described herein. memory. For example, in some embodiments, the kit comprises an rAAV comprising a transgene encoding a miR-708 RNA and / or a rhodopsin transgene, for intramolecular delivery of at least 1 x 109 genomic copies to a primate, as described herein, a suitable pharmaceutically acceptable vehicle for infraocular injection, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing eye injections. In some embodiments, the kit comprises instructions for treating retinitis pigmentosa with the rAAV particles described herein. In some embodiments, the kit comprises instructions for reducing ER stress in a cell with the rAAV particles described herein. In some embodiments, the kit comprises instructions for using the rAAV particles described herein according to any one of the methods described herein.

EXAMPLES

The invention will now be more fully understood by reference to the following examples. However, they should not be construed as limiting the scope of the invention. It is understood that the examples and embodiments described herein are for illustrative purposes only and that in view thereof, various modifications or changes will be suggested by those skilled in the art, and should be included within the spirit and scope of this application and the scope of the appended claims.

Example 1: Development of a cellular model of retinitis pigmentosa

A therapeutic strategy for RHO-associated autosomal pigmentary RP would be gene inactivation of both wild-type and mutant rhodopsin and relieving ER stress. This could be achieved by co-delivery of a microRNA (miR) that inhibits rhodopsin alleles and optionally co-delivery of a wild-type rhodopsin sequence refractory to gene inactivation with exogenously delivered miR. A miR regulated by CHOP, miR-708, regulates the expression of rhodopsin (Behrman, S., et al. (2011) J. Cell Biol. 192 (6): 919-27). miR708 is an intronic miR that resides within the CHOP Odz4 (Tenurin4) inducible gene. CHOP regulates the expression of miR-708 during ER stress, and is a putative miR-708 sequence in the 3 'UTR of rhodopsin.

Described herein are methods for using an AAV vector to deliver exogenous miR-708 that targets both wild-type and mutant rhodopsin through the target sequence of miR-708 in the 3 'UTR present in both. alleles. In embodiments, a wild-type rhodopsin substitution sequence is also supplied together. This replacement rhodopsin sequence can be genetically engineered to have lower binding to miR-708 (p. g., nucleotide substitution, deletion or addition at the 3 'UTR) and this will be refractory to gene inactivation by exogenous miR-708. In embodiments, the replacement rhodopsin sequence lacks the miR-708 target sequence at the 3 'UTR. In brief, these AAV vectors would inactivate the expression of ER stress-causing rhodopsin (and thus photoreceptor cell death) and optionally complement the expression of a codon-optimized, wild-type rhodopsin gene that it is refractory to miR-708-induced inactivation, thus restoring normal expression and function of rhodopsin.

Methods

Cell culture

HEK-293 cells were genetically modified to express human or mouse rhodopsin P23H using Invitrogen's T-Rex tetracycline inducible system. Confluent cells in 6-well plates were transfected with 4 pg of miR-708 vector (pcDNA) or a control miRNA vector using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Forty-eight hours after transfection, the medium was replaced with medium containing 2 µΜ tetracycline. Cells were incubated an additional 24 hours and media was removed from each well.

Western transfer

Cells were lysed in 400 pL of RIPA buffer (Thermo Scientific) containing 1 mM PMSF, and passed through a 25 g syringe several times. The Usado was centrifuged at 14,000 rpm for 10 min. The cells were kept at 4 ° C throughout the process. 30 µl of supernatant liquid was loaded onto a 4-12% Bis / Tris gel and SDS-PAGE was carried out in MOPS buffer (Invitrogen). The proteins were then transferred to a nitrocellulose membrane using the Invitrogen I-Blot system. The membrane was blocked for one hour at room temperature in PBS containing 0.05% Tween-20 (PBS-T) and I-Block at

0.1% (Invitrogen). The membrane was incubated overnight at 4 ° C in PBS-T containing 1 pg / mL of 1D4 anti-rhodopsin mAb (Abcam). After washing several times in PBS-T, the membrane was incubated in secondary antibody solution containing a 1: 1000 dilution of HRP-conjugated anti-mouse IgG (R&D Systems) for one hour at room temperature. The membrane was washed in PBS-T several times and developed using ECL reagent (Thermo Scientific). Mrodopsin protein levels were quantified using Image-J software. Proteins were removed from the membrane in PBS containing 0.1 M glycine pH 2 and then washed several times in PBS-T. HGAPDH was then screened on the membrane in PBS-T containing a 1: 20,000 dilution of anti-GAPDH pAb (Sigma) for 2 hours at room temperature. After washing several times in PBS-T, the secondary antibody (anti-rabbit IgG - HRP, R&D Systems) was diluted 1: 1000 in PBS-T and incubated for 1 hour at room temperature. The membrane was washed several times and developed using the ECL reagent (Thermo Scientific). The m-rhodopsin protein levels were then normalized to hGAPDH protein levels using the Image J computer program.

Gene inactivation of endogenous miR-708 in HEK-293 cells

HEK-293 cells expressing human or mouse rhodopsin (described above) were transfected with pre-m¡R-708 100 pmol, anti-miR-708 or control miRNA (Ambion) using the Lipofectamine 2000 protocol for transfection with siRNA molecules (Invitrogen). Forty-eight hours after transfection, the medium was replaced with medium containing 2 pM tetracycline to induce rhodopsin expression. Twenty-four hours later, each well was separated into 2 samples. In one, the detection of m-rhodopsin and hGAPDH was carried out using the previous Western blot protocol, and in the other the RNA was extracted for analysis.

TaqMan® (Life Technologies) for the expression of rhodopsin RNA and miR-708. Total RNA (including small RNAs) was extracted from cells using the Qiagen miRNeasy kit, according to manufacturer's instructions, including DNase treatment of samples. CDNA was synthesized from total RNA using Qiagen's Quantitect reverse transcription system. The cDNA was added to the gene expression assays for m-rhodopsin, hCHOP (Ddit3), hBiP (Hspa5) or hGAPDH TaqMan® (Life Technologies). Gene expression was normalized to hGAPDH using the AAC methodt. The expression of miR-708 was quantified using the TaqMan® miR-708 expression assay (Life Technologies). The expression of miR-708 was presented relative to the expression of endogenous miR-16 using the AÁC methodt.

Promoter-driven expression of miR-708 rhodopsin kinase in WERI Rb-1 cells

The miR-708 sequence was subcloned downstream of the rhodopsin kinase (RK) promoter after cleavage of the pcDNA 6.2 GW vector (Block-iT system, Invitrogen) into the pRK-MVM vector, which contained the hRK promoter. natural and MVM intron sequences. WERI Rb-1 cells (ATCC) were transfected with 2 pg of pRK-miR-708 or vector pRK-miR-Control using Fugene-HD (Promega), according to the manufacturer's instructions. Forty-eight hours after transfection, cells were harvested, and total RNA (including small RNAs) was extracted using the miRNeasy kit protocol (Qiagen). The miR-708 was quantified in each of the samples using the TaqMan® miR-708 Gene Expression Assay as described above (Life Technologies). To quantify the inactivation of mrodopsin in WERI Rb-1 cells expressing miR-708, the cells were cotransfected with 2 pg each of pRK-miR-708 (or control) and m-rhodopsin P23H pSportO, using Fugene-HD according to the manufacturer's instructions (Promega). RNA was extracted as described and mrodopsin RNA levels were quantified as described above using the ÁÁC method.t with respect to hGAPDH RNA levels.

RNA extraction from mouse retinas injected with AAV vectors

RNA was extracted from mouse retinas using the miRNeasy kit according to the manufacturer's instructions (Qiagen). Individual mouse retinas were homogenized in Qiazol lysis buffer using 1mm zirconium / silica beads (Biospec) for 10 min. After homogenization, RNA was extracted according to the manufacturer's instructions. The miR-708 levels in each retina were quantified using the qStar microRNA quantification system (Origene). The cDNA was synthesized using the First Strand cDNA Synthesis Kit (Origene), followed by miR-708 specific amplification and quantification using miR-708 specific primers and a miR-708 copy reference (Origene). For the quantification of rhodopsin levels in the eyes of injected mice, mrodopsin was amplified using specific primers (Life Technologies) and quantified against the reference rhodopsin cDNA. RdCVF levels were qualitatively analyzed against GAPDH expression using the ÁÁCt method.

Rhodopsin deletion / substitution vector

The h-rhodopsin cDNA (without flanking UTR sequences) was cloned into the pRK vector by excising the pcDNA vector and performing blunt-ended ligation in pRK-MCS. CDNA (Biobasic) containing the h-rhodopsin kinase promoter sequence and the β-globin intron was synthesized with an insert of a hm¡R-708 sequence (sequence taken from Genbank / NCBI) located between the acceptor sites / intron splicing donors. This sequence was subcloned from the pUC57 vector, ligated into the h-rhodopsin vector pcDNA, and renamed pRK-miR-708 hRho / wt. The levels of miRNA-708 and h-rhodopsin protein were assayed as described above in the transfected WERI Rb-1 cells.

Quantification of XBP-1 splicing in WERI Rb-1 cells transfected with m-rhodopsin P23H

HWERI Rb-1 cells were co-transfected with the pcDNA vector encoding a non-glycosylated P23H mutated m-rhodopsin and the pRK-miR-708 vector. This rhodopsin P23H cDNA was mutated using site-directed mutagenesis by PCR (Agilent Technologies) to exchange two codons of asparagine (at positions 2 and 5) for alanine. Cells were transfected as described with 2 pg of each of the vectors and incubated for 72 h. Total RNA was collected from cells as previously described. The cDNA was synthesized using the High Throughput cDNA Synthesis Kit (Invitrogen). XBP-1 splicing was evaluated using XBP-1 specific primers and High Fidelity PCR MasterMix (Roche). The amplified sequences were analyzed on a 2% agarose gel and the relative amounts of spliced XBP-1 transcript (~ 280 nt) versus non-spliced (~ 300 nt) were quantified using Image-J software. .

Additional methods

Immunofluorescence, Western blotting with and without endoglycosidase H treatment, UPR marker expression and TUNEL staining of cells expressing wild-type or mutant P23H rhodopsin were carried out, as described by Adamowicz, M., et al. (2012) Adv. Exp. Med. Biol. 723: 573-9.

Results

Human retinal pigmented epithelial cells (RPE) were stably transfected with a gene encoding human wild-type (WT) or mutant human rhodopsin P23H (a RP-linked mutation). The location of rhodopsin was investigated by confocal immunofluorescence microscopy, using an anti-rhodopsin antibody. In the case of the wild-type protein, most of the protein was processed to the plasma membrane (FIG. 1A), indicating normal biogenesis. In contrast, the P23H mutant showed a perinuclear / reticular distribution characteristic of retention in the endoplasmic reticulum (ER), with almost no expression on the cell surface (FIG. 1B). These results show that the mutant rhodopsin P23H cannot be adequately transported to the plasma membrane and is instead retained in the ER.

Rhodopsin aggregation was assessed by SDS-PAGE immunoblot analysis of detergent-soluble extracts from RPE cells transiently expressing wild-type or mutant P23H protein (FIG. 2A). Wild-type rhodopsin migrated predominantly as a diffuse band with a molecular weight of ~ 40 kDa. This species corresponds to the monomeric mature rhodopsin containing glycans linked by N. The mobility of the mutant P23H rhodopsin differed markedly from wild-type rhodopsin, with most of the P23H migrants as higher molecular weight dimers and oligomers (FIG. 2A). P23H was also sensitive to endoglycosidase H treatment, note that endoglycosidase H treatment affects P23H rhodopsin migration, but not wild-type, as shown in FIG. 2B. Endoglycosidase H is specific for N-linked oligosaccharide structures with high mannose content, with glycosylated nuclei, typical of proteins that have not matured beyond the ER.

[Together, these data suggest that wild-type rhodopsin is capable of folding and maturing beyond the ER in RPE cells, whereas the P23H mutant is more prone to forming unnatural oligomers and is retained within the ER, perhaps due to an inability to fold productively.

The ability of rhodopsin P23H to induce ER stress in transfected RPE cells was then evaluated by measuring the levels of two UPR markers, BiP and CHOP. Higher levels of BiP mRNA were detected in cells transiently expressing both wild-type rhodopsin and rhodopsin P23H (FIG. 3A), suggesting that increasing ER folding loading by itself induces UPR. However, BiP mRNA expression was significantly higher in cells expressing rhodopsin P23H (43-fold versus non-transfected cells) compared to cells expressing WT rhodopsin (14-fold versus non-transfected cells) (FIG 3A). Rhodopsin mRNA levels were identical in cells expressing the WT and mutant forms of the protein (FIG. 3A). Therefore, rhodopsin P23H is a more potent inducer of BiP than rhodopsin WT. Without wishing to be bound by theory, this discrepancy may be due to the folding defect of the mutant protein.

CHOP expression was then examined. Cells expressing the WT rhodopsin protein exhibited an induction that was 15 times that of CHOP compared to non-transfected cells, while cells expressing the P23H mutant exhibited an induction even greater than 23 times (FIG. 3A). Since CHOP is a UPR-induced transcription factor that mediates apoptosis (Lee, ES, et al. (2007) FEBS Lett. 581 (22): 4325-32), the relative levels of apoptosis were measured between the cells expressing WT and the P23H mutant. Consistent with CHOP mRNA levels, the TUNEL assay results further suggested that RPE cells transiently expressing the P23H mutant are more prone to apoptosis than those expressing wild-type rhodopsin (FIG. 3B).

Example 2: Modulation of miR-708 levels regulates the expression of rhodopsin and UPR in HEK-293 cells

A consensus sequence corresponding to a putative miR-708 target site has been found in the 3 'UTR of several mammalian rhodopsin genes (Behrman, S., et al. (2011) J. Cell Biol. 192 (6) : 919-27). This example shows that miR-708 regulation of rhodopsin can be used as a tool to modulate rhodopsin expression in cultured cells.

HEK-293 cells expressing a mutant P23H m-rhodopsin gene encoding a target sequence of miR-708 in the 3 'UTR, were transfected with a plasmid expressing miR-708 or R-Control as represented in FIG. . 4. After 72 h, the cells were harvested and the expression of the mrodopsin P23H protein was analyzed using a Western blot (FIG. 5). Expression of the P23H m-rhodopsin protein was reduced to ~ 30% in cells transfected with CBA-miR708, compared to cells transfected with the CBA-miR-Control vector.

UPR (CHOP / BIP) target gene expression was also analyzed by TaqMan® gene expression analysis. HEK-293 cells expressing m¡R708 also showed reduced expression of CHOP and BiP RNA compared to control cells (FIG. 6). These results suggest that reducing the level of misfolded m-rhodopsin P23H produces a concomitant reduction in the expression of the UPR, BiP and CHOP genes.

In the reverse experiment, HEK-293 cells expressing mouse rhodopsin P23H (including a miR-708 target sequence from the 3 'UTR) or human P23H rhodopsin (lacking the miR-708 target sequence from the 3' UTR ) were transfected with anti-miR-708 pre-mRNA or negative control pre-miRNA (FIG. 7). In this experiment exogenous anti-miR-708 was used to inhibit endogenous miR-708 of HEK293. If endogenous miR-708 regulated the expression of rhodopsin by the putative target sequence of miR-708, then changes in the levels of rhodopsin P23H would be observed only if there was a target sequence of miR-708 in the 3 'UTR of the gene of rhodopsin. Cells were transfected with 100 pmol of each RNA. Cellular Uses were generated, and rhodopsin protein was quantified on a Western blot while mRNA levels were analyzed by TaqMan® analysis (FIG. 7). Inhibition of endogenous miR-708 resulted in an increase in both mouse rhodopsin mRNA and protein (FIG. 7A), while levels of both human rhodopsin mRNA and protein remained unaltered (FIG. 7B ), despite low levels of miR-708. These results show that regulation of rhodopsin through miR-708 requires the target sequence of miR708 in the 3 'UTR of rhodopsin.

Taken together, these results show that rhodopsin is a functional target of miR-708, and that modulation of miR-708 activity can be used as a tool to affect rhodopsin expression.

Example 3: Design of an AAV ITR plasml expressing miR-708 under the control of the photoreceptor-specific rhodopsin kinase promoter

Accumulation of the mutant rhodopsin protein in ER is believed to contribute to ER stress that underlies photoreceptor cell death in RP. The previous Example shows that miR-708 expression is capable of regulating general rhodopsin levels. An adeno-associated virus (AAV) -based vector was constructed for the specific expression of miR-708 in photoreceptor cells of the retina, to determine whether lowering total rhodopsin levels (including wild-type and mutant forms) can alleviate stress. ER independent of rhodopsin mutation.

FIG. 8 depicts an AAV inverted terminal repeat (ITR) plasmid designed to express miR-708 specifically in photoreceptor cells of the retina. The expression of miR-708 was driven by the rhodopsin kinase (pRK) promoter, which is specifically expressed in rod-like photoreceptor cells. In this vector, miR-708 was expressed from the m¡R-155 framework shown in FIG. Four.

This AAV ITR plasmid was then validated in cell culture. WERI or RPE cells were transfected with the prevyric plasmid described in FIG. 8, and miR-708 levels were quantified by TaqMan® analysis. FIG. 9A shows that WERI cells transfected with the miR-708 plasmid driven by pRK had a 2000-fold increase in miR-708 levels, compared to WERI cells transfected with a miR-Scramble expressing plasmid (control). In contrast, RPE cells, in which the RK promoter was not significantly expressed, did not show a significant increase in miR-708 levels (FIG. 9A).

The role of miR-708 in the regulation of rhodopsin expression was confirmed by cotransfection of the plasmid pRK-miR-708 (or a control miR plasmid) and a plasmid with the mouse rhodopsin gene P23H harboring a sequence 3 'm¡R708 target in WERI cells. FIG. 9B shows that m-rhodopsin P23H mRNA was reduced in the presence of miR-708, compared to a control miR. These results show that expression of miR-708 using an AAV ITR vector is effective in reducing rhodopsin expression in photoreceptor cells.

Example 4: Gene Inactivation of Rhodopsin in Mouse Retinas Using a miR-708 AAVS Vector

To test whether an AAV vector could be used to reduce rhodopsin expression in the retina in vivo, the plasmid pRK-miR-708 described in FIG. 8 was packaged in an AAV5 capsid to generate AAV5-RK miR-708. In addition, a miR AAV5 control vector was generated. Genetically intact C57bl mice received a 1 x 10 subretinal injection8 vgs of AAV5-RK miR-708 or AAV5 miR-control in the contralateral eye. One month after injection, the mice were sacrificed and the neuroretin was removed and immediately frozen for qPCR analysis of gene expression.

FIG. 10A shows that the eyes of mice injected with an AAV5 vector expressing miR-708 had reduced rhodopsin expression, compared to eyes injected with an AAV5 miR-Control vector. In contrast, the expression of another rod-specific gene, rod-derived cone viability factor (RdCVF), was unaffected (FIG. 10B). FIG. 10C confirms that eyes injected with the AAV5m¡R708 vector showed a significant increase in miR-708 copy number, compared to eyes that received control AAV5m¡R. These results suggest that AAV-based vectors expressing miR-708 in rod-like photoreceptors are effective in reducing endogenous expression of rhodopsin in vivo.

To demonstrate the functional relevance of rhodopsin gene inactivation, the eyes of mice treated with AAV5 miR-708 or AAV5 miR-Control were analyzed by electroretinogram (ERG) to assess retinal function. Eyes that received the AAV5 miR-708 vector showed a lower scotopic response, as expected if rhodopsin levels are reduced (FIG. 11A). Scotopic responses on the ERG are an assessment of rod function, and this measurement can be correlated with rhodopsin levels. However, the function of the cones in the same animals, assessed by photopic ERG, had not changed after the supply of AAV5 miR-708 (FIG. 11B), confirming that miR-708 had a biological effect on rod-like photoreceptor cells. while it was rare in cone-type cells. These data show that delivery of AAV5 mi R-708 results in a biological effect that is restricted to the target cells rods.

Example 5: Construction of a h-rhodopsin deletion / replacement vector with an expression cassette with miR-708 inserted into an intron miR-708 is normally expressed in vivo from the first intron in the ODZ4 gene. Therefore, a new construct was designed based on the miR-708 sequence and its endogenous framework / flanking sequence. The miR-708 sequence was inserted into a synthetic intron and cloned downstream of the photoreceptor-specific rhodopsin kinase (RK) promoter, but upstream of the hrodopsin cDNA. The endogenous miR-708 sequence including its flanking regulatory and processing sequences was cloned into the β-globin intron sequence upstream of the h-rhodopsin cDNA sequence but downstream of the RK promoter. As such, the miR-708 sequence is 5 'to the rhodopsin coding sequence.

FIG. 12 provides a diagram of this 5 'suppression / substitution vector. H-rhodopsin (lacking a miR-708 target sequence from the 3 'UTR) was controlled by the RK promoter. The endogenous miR-708 sequence including the endogenous framework (eg, including any Drosha / Dicer recognition motifs) was inserted into the intron of the β-globin. The h-rhodopsin cDNA (without the miR-708 target sequence of the 3 'UTR) was included downstream of the binding site site. miR-708 was inserted into β-globin, which was located downstream of the RK promoter, and therefore miR-708 was processed after splicing of the intron sequence of β-globin. Furthermore, an addition vector with a similar structure was generated that harbored a control miR.

The vector described in FIG. 12, or a vector with a control miRNA, to transfect WERI cells. WERI cells were used because they express little, if any, of endogenous miR-708, and are permissive of the RK promoter. WERI cells were co-transfected with a cDNA encoding m-rhodopsin P23H (with a 3 'UTR miR-708 sequence). Both the rhodopsin gene inactivation (RNA levels) and the levels of the UPR, CHOP and BIP genes were examined in the transfected cells.

FIG. 13 shows that cells cotransfected with m-rhodopsin (P23H) and the miR-708 vector had reduced levels of m-rhodopsin, compared to cells cotransfected with m-rhodopsin and control miRNA vector. Furthermore, the UPR, CHOP, and BiP genes were also down-regulated in cells transfected with miR-708 compared to control cells. These data suggest that the use of endogenous miR-708 scaffold with intronic expression of miR708 provides an alternative scaffold that supports the processing and expression of miR-708.

Example 6: Comparison of different miR-708 frames

Lower levels of miR-708 expression may be beneficial in reducing any potential off-target effects of miRNA in a clinical setting. Therefore, the strength of the expression of different scaffolds was tested in the human retinoblastoma cell line WERI.

FIG. 14 depicts quantified levels of miR-708 in WERI cells transfected with CBA-targeted miR-708, RK-targeted m¡R708 using the mIR-155 framework shown in FIG. 4, or the miR-708 h-rhodopsin vector inserted into RK introns shown in FIG. 12. The expression of miR-708 in the RK intronic system was not as robust as the CBA-driven system. However, the expression of miR-708 was still well above background and was approximately 5 times lower than pRKm¡R708 using the miR-155 scaffold. Note that h-rhodopsin was coexpressed from intron-inserted vectors, but not from the miR-155 CBA or RK scaffold vectors.

Next, h-rhodopsin mRNA levels were compared in WERI cells expressing the deletion / replacement vector, inserted into miR-708 introns or a control m¡R vector. FIG. 15 shows that WERI cells transfected with the suppression / replacement vector, inserted into miR-708 introns had a similar level of h-rhodopsin compared to cells transfected with the control vector. These results indicate that h-rhodopsin expression from the deletion / substitution vector, lacking the miR-708 target sequence of the 3 'UTR, is refractory to inhibition by miR-708 expression. Both cells showed higher expression of h-rhodopsin than non-transfected WERI cells.

Example 7: Gene inactivation of mutant rhodopsin by the deletion / replacement vector miR-708 reduces a marker of ER stress

The ability of the miR-708 suppression / substitution vector to reduce ER stress in cells expressing mutant rhodopsin was examined. WERI cells expressing a non-glycosylated P23H mutant rhodopsin (N2K / N15K / P23H), with or without a miR-708 target sequence of the 3 'UTR, were transfected with the substitution suppression vector described in FIG. 12. Cells were harvested and RNA was extracted to measure X-box binding protein (XBP-1) splicing. XBP-1 is an important transcription factor in the regulation of ER stress genes. Its splicing is a known marker of ER / UPR cellular stress; cells undergoing UPR had higher levels of spliced XBP-1.

As shown in FIG. 16, cells expressing mutant rhodopsin with a target sequence in the 3 'UTR had lower spliced XBP-1 when transfected with the miR-708 deletion / substitution vector. In contrast, cells expressing mutant rhodopsin P23H lacking the miR-708 target sequence of the 3 'UTR had equivalent levels of XBP-1 splicing, compared to cells transfected with the m¡ sequence. R for control. These results show that gene inactivation of mutant rhodopsin using the deletion / replacement vector miR-708 is effective in reducing ER stress.

Example 8: Expression of miR-708 in the framework of the β-qlobin intron placed in the 3 'UTR of rhodopsin increases the expression of rhodopsin v of miR-708

In order to test whether the position of the miR-708 framework affects its expression, a vector was constructed in which the sequence of miR-708 (including its flanking regulatory / processing sequences) was cloned into the intron sequence. of β-globin downstream of the rhodopsin cDNA, that is, within the 3 'UTR. FIG. 17 shows a diagram of this 3 'suppression / substitution vector, which is similar to that shown in FIG. 12, except that the human Bglobin intron framework of miR-708 is in the 3 'UTR of the rhodopsin cDNA, rather than in the 5' UTR.

To determine whether the position of the framework of the miR-708 human β-globin intron in the vector affected the expression of h-rhodopsin or miR-708 from the vector, WERI cells were transfected with the 5 'UTR vector of FIG. 12 or the 3 'UTR vector of FIG. 17. FIG. 18 shows the expression of h-rhodopsin and miR-708 in these cells. The vector with the miR-708 framework at the 3 'UTR was found to produce higher levels of both h-rhodopsin RNA and miR-708 than the vector using the 5' UTR configuration.

Example 9: Evaluation of the deletion / substitution vector in a P23H mouse model of retinal degeneration

Deletion / substitution constructs are evaluated in a P23H mouse model of retinal degeneration. In this model, the mutant P23H protein expressed in rod-like photoreceptor cells induces ER / UPR stress, causing apoptosis and ultimately the death of rod-like cells (Lee, ES, et al. (2007) FEBS Lett. 581 (22): 4325-32). After the death of rod-like cells, non-autonomous cone-like cell death occurs.

Mouse P23H is treated with a deletion / replacement AAV vector expressing miR-708 and a human rhodopsin gene refractory to inactivation by mIR708 (because it lacks a miR-708 target sequence). The deletion / replacement vector results in mouse rhodopsin inactivation of both WT and P23H, but replacement of the rhodopsin gene compensates for the reduction in rhodopsin WT levels. Thus, the vector provides the rod rhodopsin necessary to maintain the function and integrity of rod cells.

An alternative suppression / replacement construct design is also tested. As shown in FIG. 19, this alternative vector directs the expression of miR-708 from the RK promoter and co-expresses hydrodopsin (refractory to inactivation by miR-708) using the mouse opsin promoter.

These deletion / replacement vectors are also tested as described above in a P23H mouse model in which the endogenous m-rhodopsin gene harbors a loss-of-function single copy allele (e.g., mouse is heterozygous relative to a gene inactivated allele in m-rhodopsin). This heterozygous mouse model can be constructed using standard mouse genetic techniques from an mRhof mouse and the P23H model described above. Without wishing to impose any theory, it is thought that the mouse model P23H mRho+/', which contains a copy of the mutant h-rhodopsin P23H allele and a copy of the wild-type mouse gene, can resemble a human ADRP genotype in which patients have equal copies of the mutant and wild-type rhodopsin allele.

Example 10: Evaluation of additional deletion / substitution vectors

Several vectors expressing both miR-708 (or a control miRNA sequence) and h-rhodopsin were cloned from a single vector. The vectors differ from each other in that the flanking sequences of the miRNA sequence are obtained from mIR-155 (taken from the Invitrogen Block-lt system) or 5 'and 3' flanking sequences of endogenous miR-708. The miRNA sequences are inserted into the hB-globin intron downstream of the rhodopsin kinase promoter and upstream of the h-rhodopsin ORF. The goal was to test whether miRNA expression and processing are similar in each construct. An additional pair of vectors contained the miRNA sequences (control or miR-708) downstream of the h-rhodopsin ORF, also inserted into the β-globin intron.

Only vectors containing endogenous miR-708 3 'and 5' flanking sequences, located downstream of the rhodopsin ORF, were tested in this experiment, and flanking sequences of both endogenous miR708 and miR were tested. -155 in vectors where the β-globin intron is located upstream of h-rhodopsin. WERI cells were transfected with each construct and the expression of both miR-708 and rhodopsin was determined.

The results in Fig. 20 indicate that the miR155 flanking sequences generate better expression (or miRNA processing) of miR-708, compared to endogenous miR-708 flanking sequences. The expression of miR-708 was approximately 10-fold higher in cells transfected with vectors containing the flanking sequences of miR-155, compared to the flanking sequences of miR-708. Vectors containing the miR-708 flanking sequences had lower expression of miR-708, regardless of whether the sequences were upstream or downstream of the h-rhodopsin ORF. The expression of h-rhodopsin was not affected by the overexpression of miR-708, since its expression levels are approximately the same, regardless of the miRNA sequence co-expressed in the vector. The expression of miR-708 was not detected in vectors containing control miRNA sequences, as expected.

Example 11: Evaluation of additional deletion / substitution vectors with a mutated miR-708 target sequence

As described above, a consensus sequence corresponding to a putative miR-708 target site has been found in the 3 'UTR of several mammalian rhodopsin genes (Behrman, S „et al. (2011) J. Cell Biol 192 (6): 919-27). This example shows that a rhodopsin with the mutated miR-708 target sequence can be used in a deletion / replacement vector.

An rAAV vector is constructed comprising nucleic acid encoding miR-708 and a human rhodopsin gene. The human rhodopsin gene is mutated in the target sequence of miR-708 (SEQ ID NO: 19) by nucleotide substitution, deletion or insertion, to reduce or prevent recognition by miR708. In some examples, the entire miR-708 target sequence is removed. In some examples, reduction or prevention via miR-708 is measured with reference to miR-708 recognition of a wild-type rhodopsin 3 'UTR comprising the target sequence of miR-708.

To test for suppression of autosomal dominant rhodopsin via miR-708 with concomitant expression of wild-type rhodopsin, HEK-293 cells expressing a mutant P23H m-rhodopsin gene encoding a miR-708 target sequence from the 3 'UTR, are transfected with a plasmid expressing miR-708 and human rhodopsin with (CBA-m¡R-708-hRho-3'UTR) or without (CBA-miR-708hRho-3'UTR+) a mutated miR-708 target sequence. A control mR is also used as described in Example 2. After 72 h, cells are harvested and the expression of the rhodopsin protein mP23H and human rhodopsin is analyzed using a Western blot. Reduction of the expression of the zmrodopsin P23H protein in cells transfected with CBA-miR-708-hRho-3'UTR 'or CBA-miR708-hRho-3'UTR+ Compared to cells transfected with vector CBA-miRControl indicates activity of miR-708. The expression of human rhodopsin in cells transfected with CBA-m¡R-708-hRho-3'UTR · but not with CBA-miR-708-hRho-3'UTR+ indicates that rhodopsin encoded by CBA-m¡R-708-hRho-3'UTR 'is refractory to deletion by miR-708.

Example 12: AAV-mediated suppression of endogenous rhodopsin and expression of human rhodopsin in mouse retina

Based on the experiments described above, additional experiments were performed to test the rhodopsin suppression / substitution strategy in an intact eye. This example shows the efficiency of an AAV deletion / replacement vector constructed using a miR-708 scaffold in mouse retina.

An AAV5 capsid was constructed with a vector that carried the rod-specific opsin promoter, the miR-708 framework (eg, the endogenous miR-708 framework / flanking sequences), and a replacement gene for human rhodopsin. In one version of this vector, the sequence of miR-708 (p. (g., miR-708 sequence binding to miR-708 target sequence) to drive expression of miR-708 in the context of the m¡R708 scaffold and the human rhodopsin replacement gene (AAV5OPSmiR708708hRHO). In another version of this vector, a control vector was generated that harbored a miR control sequence (AAV50PSmiRcontrol7or8hRHO). In both vectors, the replacement human rhodopsin gene was refractory to miR-708 gene inactivation, as it lacks a miR-708 target sequence. Both vectors were injected subretinally into the retinas of wild-type mice. For each mouse, the contralateral intact eye was not injected, and the expression in each injected retina was normalized as expression by many times relative to the contralateral uninjected retina. Three weeks after injection, retinas were harvested and assayed for levels of miR-708 (FIG. 21A), levels of mouse rhodopsin mRNA (FIG. 21B), and human rhodopsin (FIG. 21C). ).

FIG. 21A shows an increase in miR-708 levels in the mouse retina after injection with the vector AAV5OPSmiR708708hRHO, compared to the contralateral intact eye. A significant reduction in mouse rhodopsin was measured in the eye that received AAV5OPSm¡R708708hRHO, and no reduction in mouse rhodopsin was measured in eyes that received the control vector, AAV5OPSm¡Rcontrol708hRHO (FIG. 21B). In addition, human rhodopsin levels increased up to 100-fold with both vectors, compared to the intact, uninjected contralateral eye (FIG. 21C). These data show that the vector

AAV5OPSm, R708708hRHO was effective in vivo.

In summary, the optimized suppression / replacement vector

AAV5OPSmiR708708hRHO produced mouse rhodopsin gene inactivation via miR-708 (endogenous mouse rhodopsin has a 3'UTR target sequence) with concomitant expression of the replacement human rhodopsin, which was refractory to miR708 gene inactivation (the human rhodopsin replacement gene lacks a 3'UTR miR708 target sequence). These results indicate the efficacy of the suppression / replacement strategy in the intact mammalian eye.

Example 13: Validation of candidate vectors in human cells

Candidate AAV5-based vectors were then tested for the ability to facilitate the expression of miR-708 and human rhodopsin in human cells (HeLa).

Two different promoters were tested: the rhodopsin kinase promoter (GRK1) and the opsin promoter. The rhodopsin kinase promoter has been described above. The opsin promoter (indicated in SEQ ID NO: 22) contains a 676 bp fragment that encodes a 400 bp CMV enhancer upstream of the opsin promoter sequence (-500 bp - + I5 bp). Also included is the 65 bp NRL sequence; it encodes a neuroretinal basic zipper factor (a rod-like photoreceptor-specific transcription factor). Downstream of the promoter construct is a hybrid intron sequence from exon I of CBA and mouse tiny virus (MVM) - termed the MVM intron sequence (indicated in SEQ ID NO: 23). A diagram of this promoter construct is depicted in FIG. 22.

Two different frames were used: the miR-155 frame or the miR-708 frame. Both were inserted into a beta globin intron. In total, 4 candidate vectors were tested: AAV5GRKIm¡R708_155hRho (an AAV5 vector with a rhodopsin kinase promoter that drives the expression of miR-708 in a framework of miR-155 and human rhodopsin minus the target sequence of miR- 708; SEQ ID NO: 24), AAV5GRKIm¡R708_708hRho (an AAV5 vector with a rhodopsin kinase promoter that drives the expression of miR-708 in a framework of miR-708 and human rhodopsin minus the target sequence of miR-708; SEQ ID NO.25), AAV5OPSm¡R708_155hRho (an AAV5 vector with an opsin promoter that drives the expression of miR-708 in a framework of miR-155 and human rhodopsin minus the target sequence of miR-708; SEQ ID NO: 26), and AAV50PSm¡R708_708hRho (an AAV5 vector with an opsin promoter that drives the expression of miR-708 in a framework of miR-708 and human rhodopsin minus the target sequence of miR-708; SEQ ID NO: 27). FIG. 23A shows the sequence of miR-708 inserted into the beta globin intron. The miR-708 and miR-155 scaffolds are indicated in FIGS. 23B and 23C, respectively.

Each of the 4 candidate AAV5 vectors was used to infect HeLa cells (using the AdTs149 helper virus), and miR-708 and hrodopsin levels were measured. As indicated in FIG. 24, all four vectors resulted in the expression of miR-708 and h-rhodopsin in human cells in vivo, compared to the vectors that drove the expression of a control miR from either the opsin promoter or the rhodopsin kinase promoter (Ops m¡R-Cont and RK m¡R-Cont, respectively). These results show the successful validation of several vectors that can be used for suppression / substitution strategies (such as those described above) in human cells.

Contents8

95 members in 37 offices

This recordMember, by publication datePriority claim27 more offices are in the list below

Priority claims3

Priority claims
Document	Office	Kind	Date
61969027	United States of America	–	2014-03-21
201461969027	United States of America	P	2014-03-21
2015021896	United States of America	W	2015-03-20

Members95

Family members, oldest first
Document	Office	Kind
CA2943185A1	Canada	A1	2015-09-24
WO2015143418A2	World Intellectual Property Organization (WIPO)	A2	2015-09-24
UY36044A	Uruguay	A	2015-10-30
WO2015143418A3	World Intellectual Property Organization (WIPO)	A3	2015-11-19
TW201622752A	Taiwan Province of China	A	2016-07-01
AR099837A1	Argentina	A1	2016-08-24
SG11201607005UA	Singapore	A	2016-09-29
PH12016501684A1	Philippines	A1	2016-10-03
AU2015230942A1	Australia	A1	2016-10-13
DOP2016000237A	Dominican Republic	A	2016-10-16
KR20160127832A	Republic of Korea	A	2016-11-04
IL247543A0	Israel	A0	2016-11-30
IL247543D0	Israel	D0	2016-11-30
PE20161252A1	Peru	A1	2016-11-30
CR20160480A	Costa Rica	A	2016-12-14
MX2016012201AThis record	Mexico	A	2017-01-19
EP3119437A2	European Patent Office (EPO)	A2	2017-01-25
EA201691891A1	Eurasian Patent Organization (EAPO)	A1	2017-01-30
CN106456660A	China	A	2017-02-22
ECSP16083000A	Ecuador	A	2017-02-24
JP2017509632A	Japan	A	2017-04-06
CL2016002333A1	Chile	A1	2017-05-26
US2017173183A1	United States of America	A1	2017-06-22
ZA201605924B	South Africa	B	2017-09-27
BR112016021017A2	Brazil	A2	2017-10-03
MA39390A1	Morocco	A1	2017-12-29
SG10201808218YA	Singapore	A	2018-10-30
US10383953B2	United States of America	B2	2019-08-20
EP3119437B1	European Patent Office (EPO)	B1	2019-09-04
UA120050C2	Ukraine	C2	2019-09-25
DK3119437T3	Denmark	T3	2019-12-09
PT3119437T	Portugal	T	2019-12-12
LT3119437T	Lithuania	T	2019-12-27
RS59634B1	Serbia	B1	2020-01-31
SI3119437T1	Slovenia	T1	2020-01-31
US2020046851A1	United States of America	A1	2020-02-13
ES2742887T3	Spain	T3	2020-02-17
HRP20192141T1	Croatia	T1	2020-02-21
SG10201912968WA	Singapore	A	2020-02-27
JP6669664B2	Japan	B2	2020-03-18
HUE046454T2	Hungary	T2	2020-03-30
EP3628334A1	European Patent Office (EPO)	A1	2020-04-01
JP2020059737A	Japan	A	2020-04-16
PL3119437T3	Poland	T3	2020-04-30
ES2760263T3	Spain	T3	2020-05-13
TW202021627A	Taiwan Province of China	A	2020-06-16
IL247543A	Israel	A	2020-07-30
IL247543B	Israel	B	2020-07-30
IL275918D0	Israel	D0	2020-08-31
TWI706789B	Taiwan Province of China	B	2020-10-11
MX2020010694A	Mexico	A	2020-11-06
AU2015230942B2	Australia	B2	2020-11-19
AU2021200988A1	Australia	A1	2021-03-11
IL275918A	Israel	A	2021-07-29
IL275918B	Israel	B	2021-07-29
IL284741A	Israel	A	2021-08-31
IL284741D0	Israel	D0	2021-08-31
US11103598B2	United States of America	B2	2021-08-31
US2022054657A1	United States of America	A1	2022-02-24
JP7048563B2	Japan	B2	2022-04-05
MA39390B2	Morocco	B2	2022-04-29
MY190726A	Malaysia	A	2022-05-12
NZ724622A	New Zealand	A	2022-05-27
CN106456660B	China	B	2022-05-31
JP2022084810A	Japan	A	2022-06-07
IL284741B	Israel	B	2022-10-01
TWI780401B	Taiwan Province of China	B	2022-10-11
CN115252823A	China	A	2022-11-01
KR20230006039A	Republic of Korea	A	2023-01-10
IL284741B2	Israel	B2	2023-02-01
PH12016501684B1	Philippines	B1	2023-03-17
EP3628334B1	European Patent Office (EPO)	B1	2023-06-28
FI3628334T3	Finland	T3	2023-09-15
LT3628334T	Lithuania	T	2023-09-25
PT3628334T	Portugal	T	2023-09-26
DK3628334T3	Denmark	T3	2023-10-02
RS64611B1	Serbia	B1	2023-10-31
NZ762841A	New Zealand	A	2023-11-24
SI3628334T1	Slovenia	T1	2023-11-30
PL3628334T3	Poland	T3	2023-12-18
HRP20231077T1	Croatia	T1	2023-12-22
ES2957840T3	Spain	T3	2024-01-26
HUE063460T2	Hungary	T2	2024-01-28
EP4345165A2	European Patent Office (EPO)	A2	2024-04-03
MY203654A	Malaysia	A	2024-07-11
AU2021200988B2	Australia	B2	2024-08-01
JP7534348B2	Japan	B2	2024-08-14
DK3628334T5	Denmark	T5	2024-09-02
EP4345165A3	European Patent Office (EPO)	A3	2024-09-25
AU2024227776A1	Australia	A1	2024-11-28
US12201698B2	United States of America	B2	2025-01-21
MX376190B	Mexico	B	2025-03-07
CA2943185C	Canada	C	2025-09-16
CA3254798A1	Canada	A1	2025-12-01
KR20250172735A	Republic of Korea	A	2025-12-09

Gene therapy for retinitis pigmentosa.

Abstract

Term

GENE THERAPY FOR PIGMENTARY RETINITIS

SEQUENCE LIST

FIELD OF THE INVENTION

BRIEF COMPENDIUM OF THE INVENTION

BRIEF DESCRIPTION OF THE DRAWINGS

DETAILED DESCRIPTION

EXAMPLES

Priority claims3

Members95

Numbers

Titles2

Classification

Abstract

Term

GENE THERAPY FOR PIGMENTARY RETINITIS

CROSS REFERENCE TO RELATED REQUESTS

SEQUENCE LIST

FIELD OF THE INVENTION

BRIEF COMPENDIUM OF THE INVENTION

BRIEF DESCRIPTION OF THE DRAWINGS

DETAILED DESCRIPTION

EXAMPLES

Priority claims3

Members95

Numbers

Titles2

Classification