Compositions and methods for controlling arthropod parasite and pest infestations.

(54) Title: COMPOSITIONS AND METHODS TO CONTROL INFESTATIONS OF PESTS AND PARASITES OF ARTHROPODS.

(54) Title: COMPOSITIONS AND METHODS FOR CONTROLLING ARTHROPOD PARASITE AND PEST INFESTATIONS.

(57) Summary

The present application provides and describes antiparasitic, antiplague and insecticide nucleic acid molecules and their calmodulin target genes for the control of arthropod parasites and pests: the present application further provides methods and compositions for the control and treatment of parasites and pests in the hives of Apis mellifera (honey bee).

(57) Abstract

This application provides and discloses anti-parasitic, anti-pest or insecticidal nucleic acid molecules and their calmodulin target genes for the control of arthropod parasites and pests. This application further provides methods and compositions for the control and treatment of parasites and pests in Apis mellifera (honey bee) hives.

COMPOSITIONS AND METHODS FOR CONTROLLING ARTHROPOD PEST AND PARASITE INFESTATIONS

INCORPORATION OF THE SEQUENCE LISTING

A computer-readable listing of sequences is submitted electronically with the present application and is incorporated into the present application by reference in its entirety. The sequence listing is contained in the file created on October 27, 2014, which is named P34094US01SEQ.txt and is 64,002 bytes in size (as measured by the MSWindows® operating system).

DESCRIPTION FIELD

Methods and compositions are provided to control arthropod pest and parasite infestations. Methods and compositions are also provided to control Varroa mite infestation in bees.

BACKGROUND OF THE INVENTION

Commercially, the number of arthropods of various species being bred is increasing. Insects and their larvae are nutritious and are eaten raw or cooked in many cultures. Crustaceans, such as crabs, lobsters, crayfish, shrimp, and prawns are raised on a large scale on a commercial level and make up an important part of the human diet. In addition to rearing arthropod species for food, arthropods are also reared as part of pest management strategies, including for the biological control of other arthropods, for example rearing parasitic wasps for control of cockroaches and fire ants. Arthropods can also serve as a source of raw materials, for example, inks, drugs, medications, and antibiotics. Along with the increasing importance of arthropod husbandry, various pests and parasites are also growing that destroy arthropod colonies or greatly reduce the yield of products obtained from arthropod husbandry. Consequently, there is an increasing need for methods to control arthropod pests and parasites.

One of the most important species of arthropod that breeds is the honey bee. Honey bees, Apis mellifera, are necessary for effective pollination of crops and are therefore essential for global agriculture. Honey bees also produce economically important products, including honey and beeswax. Honey bees are susceptible to numerous parasites and pathogens, including the ectoparasitic mite, Varroa destructor.

Varroa mites (Varroa destructor are the main parasites of managed honey bees (Apis mellifera ') and are the world's greatest threat to commercial beekeeping (Rosenkranz et al. 2010). Adult mites typically enter cells breeding of workers and drones before they hatch, primed by the pheromone from the litter of honey bees. The mite is immersed in the larval food that the bees place inside the cell in anticipation of the operculate, most likely to prevent the nurse bees from recognizing and removing them. After suckling of the brood cells by suckler bees, the mite attaches to the larva and begins to ingest hemolymph from the bee larvae. This process promotes oogenesis in mites and continues, several days later, in the laying of male and female eggs. Eventually, the adult Varroa emerges from the cell and clings to the emerging bees. Varroa directly harm honey bees in many ways, mainly by depleting resources, negatively affecting the immune system of innate honey bees, and because it is a very effective vector of viruses (Di Prisco et al., 2011), some of which They are known to replicate in the mite and thus dramatically increase viral load.

A safe, effective and lasting solution to the Varroa problem is an ongoing challenge that still needs to be solved. Currently, beekeepers use a large number of methods to control Varroa levels that include various chemical acaricides, most of which have lost efficacy and are toxic and / or leave residues in wax and honey. Other methods include the application of oxalic or formic acid, monoterpenes (thymol) and many other management practices, with highly variable results, including toxicity to the treated colonies. Breeding Varroa-resistant bees, for example, selection for hygienic behavior leading to the removal of infested brood, has shown limited success in practice.

The colony collapse problem (CCD) of honey bees is threatening to wipe out agriculture in the United States and around the world. In fact, in the recent US CCD outbreak in the winter of 2006-2007, approximately 25% or more of the 2.4 million honeybee hives were lost due to CCD. Approximately 23% of beekeeping operations in the United States suffered CCD in the winter of 2006-2007, affecting an average of 45% of beekeeping operations. In the winter of 2007-2008, the USDA-ARS CCD Task Force estimated that a total of 36% of all hives in commercial operations were destroyed by the CCD.

CCD is characterized by the rapid loss of the adult bee population in a colony; adult bees are often found dead some distance from the colony. In the final stages of collapse, a queen is tended to by only a few newly emerged adult bees. Collapsed colonies often have considerable food reserves and capped offspring. The CCD phenomenon was first reported in 2006; however, beekeepers had already detected single colony declines consistent with CCD in 2004. Various factors such as mites and infectious agents, weather patterns, electromagnetic radiation (cell antennas), pesticides, poor nutrition, and stress They have been mentioned as possible causes. To date, CCD control has focused on Varroa mite control, sanitation and removal of affected hives, treatment of opportunistic infections (such as Nosema), and improved nutrition. To date, no effective preventive measures have been developed.

Varroa mites parasitize pupae and adult bees and reproduce in the pupa's brood cells. Mites use the mouth to pierce the exoskeleton and feed on the hemolymph of bees. These wound sites in the exoskeleton harbor bacterial infections, such as Melissococcus pluton, which is caused by European foulbrood. In addition to parasitic effects, Varroa mites are suspected of acting as vectors for numerous honey bee pathogens, including deformed wing virus (DWV), Kashmir bee virus (KBV), acute paralysis virus from bees (ABPV) and black real cell virus (BQCV) and can weaken the immune systems of their hosts, leaving them vulnerable to infection. If Varroa infestations are not treated, they typically cause mortality at the colony level.

Current methods of treating Varroa infestations are being shown to be ineffective as mites develop resistance to current acaricides. In addition, the use of these acaricides can introduce harmful chemicals into honey intended for human consumption.

BRIEF DESCRIPTION OF THE INVENTION

The present disclosure provides, and includes, selective insecticidal compositions comprising an antiparasitic, antiplagic, or insecticidal nucleic acid molecule having an essentially complementary or essentially identical sequence to a region of a calmodulin gene sequence or RNA transcribed therefrom. In some aspects, the composition further comprises an excipient.

In one aspect, the nucleic acid molecule in the selective insecticidal composition is a dsRNA. In some respects, dsRNA is a siRNA.

In one aspect, the calmodulin gene sequence has at least 80%,%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity of sequence with a sequence selected from SEQ ID NO: 1-4, 6, 23, 26-35 and 69-89. In some aspects, the calmodulin gene sequence comprises at least 18 contiguous nucleotides from a sequence selected from SEQ ID NO: 1-4, 6, 23, 26-35, and 69-89.

In one aspect, the selective insecticidal composition further comprises one or more antiparasitic, antiplague, or insecticidal nucleic acid molecules that are essentially complementary or essentially identical to a first region of a calmodulin gene sequence. In some aspects, the nucleic acid molecule (s) comprise a second nucleic acid sequence complementary to a second region of a calmodulin gene sequence.

In one aspect, the selective insecticidal composition is ingestible by bees, absorbable by bees, ingestible by mites, or absorbable by mites.

In one aspect, the excipient is selected from the group consisting of protein, pollen, carbohydrate, polymer, liquid solvent, sugar syrup, sugar solid, and semi-solid food. In some aspects, the liquid solvent is selected from the group consisting of sucrose solution and corn syrup solution. In some respects, the protein is selected from the group consisting of pollen and soy protein. In another aspect, the excipient is a solid selected from sugar, a sugar substitute, or a sugar supplement. In some aspects, the sugar solid comprises sugar microparticles impregnated with a be RNA nucleic acid sequence.

In one aspect, the present application discloses bee-ingestible compositions comprising a bee diet and a nucleic acid molecule having a sequence that is essentially identical or essentially complementary to one or more regions of a calmodulin gene sequence or an RNA transcribed from this. In some respects, the bee feed comprises a bee feed selected from the group consisting of corn syrup, a pollen substitute, pollen, a pollen pie, and a fondant. In some aspects, the bee's diet further comprises one or more of a mineral salt, an essential oil, brewer's yeast, yeast extract, trehalose, tryptone, dehydrated milk, lecithin, and vitamin C. Some examples of essential oils include, but are not limited to, wintergreen oil, spearmint oil, peppermint oil, citronella oil, and tea tree oil .

In another aspect, the present application describes a nucleic acid construct comprising an antiparasitic, antiplagic, or insecticidal nucleic acid sequence that is essentially identical to or complementary to a region of a calmodulin gene sequence, or a transcript thereof, bound operably to a promoter sequence functional in a host cell and capable of producing a dsRNA when introduced into said host cell. In some aspects, the nucleic acid construct further comprises at least one regulatory element selected from the group consisting of translational leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, pause sequences, and sequences of polyadenylation recognition. In some respects, the host cell is a bacterial or yeast cell.

In another aspect, the present application describes a method of providing a composition to a honey bee, which comprises providing the bee with an effective amount of a composition comprising an antiparasitic, antiplagic or insecticidal nucleic acid that is essentially identical or essentially complementary to a or more regions of a calmodulin gene sequence, or an RNA transcribed from it, whereby nucleic acid is present in the tissue of the honey bee.

In another aspect, the present application describes a method of treating or preventing a disease in a honey bee colony, which comprises providing the bee with an effective amount of a composition comprising an antiparasitic, antiplagic or insecticidal nucleic acid that is essentially identical or essentially complementary to one or more regions of a calmodulin gene sequence to a honey bee, whereby nucleic acid is present in the tissue of the honey bee. In some respects, the calmodulin gene sequence is a sequence of the Varroa destructor calmodulin gene.

In another aspect, the present application describes a method of reducing parasitization of a bee by Varroa destructor, which comprises providing the bee with an effective amount of an antiparasitic, antiplagic or insecticidal nucleic acid composition, where the nucleic acid is essentially identical or essentially complementary to one or more regions of a Varroa destructor calmodulin gene sequence, or an RNA transcribed thereof, whereby the parasite of the bee is reduced by means of Varroa destructor.

In another aspect, the present application describes a method of reducing the parasite load of a honey bee hive, which comprises providing said hive with an effective amount of an antiparasitic, antiplagic or insecticidal nucleic acid that is essentially identical or essentially complementary to a or more regions of a parasitic calmodulin gene sequence, or an RNA transcribed therefrom, thereby reducing the parasite load of said hive.

In another aspect, the present application describes a method of selectively treating an arthropod species against parasites, comprising administering an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid that is essentially identical or essentially complementary to one or more regions of a sequence of the parasitic calmodulin gene, or an RNA transcribed from it, to an arthropod species.

In another aspect, the present application provides and describes a method of treating or preventing colony collapse problem in a honey bee colony, which comprises providing an effective amount of a composition to a honey bee colony comprising an acid molecule. antiparasitic nucleic, antiplage or insecticide having a sequence that is essentially identical or essentially complementary to one or more regions of a Varroa destructor calmodulin gene sequence, whereby the level of Varroa destructor infestation is reduced or prevented.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 presents a phylogenetic tree for the Calmodulin (CAM) genes of different species. The number immediately preceding the species name corresponds to a sequence identification number (SEQ ID NO).

Figure 2 presents the survival rate of mites exposed to a nucleic acid of SEQ ID NO: 3 (CAM373) in a direct feed bioassay 3 days after treatment relative to an untreated control (CNTR) or a non-sequence specific (SCRAM, SEQ ID NO: 5).

Figure 3A presents a gene expression analysis five days after treatment with a nucleic acid of SEQ ID NO: 3 (CAM373) or SEQ ID NO: 4 (CAM 186) with respect to the controls. Figure 3B shows the survival rate of the mites exposed to nucleic acids of SEQ ID NO: 3 (CAM373) and 4 (CAM 186) with respect to the controls.

Figure 4 presents a load of mites / 100 bees from hives treated with respect to the untreated controls during a different period.

Figure 5 presents the% survival of the mites treated with SEQ ID NO: 3, SEQ ID NO: 88 or SEQ ID NO: 89 with respect to the untreated mites (NTC) on day 5 (D%) or day 6 (D6) after treatment.

Figure 6 presents the% survival of the mites treated with SEQ ID NO: 3 or a mixture of SEQ ID NO: 88 and SEQ ID NO: 89 with respect to the untreated (NTC) on day 5 (5), the day 6 (6) and day 7 (7).

Figure 7 presents the load of Varroa mites / 100 bees from treated hives with respect to untreated controls over a period of 17 weeks. The bars on the left represent hives treated with the non-specific sequence (SCRAM, SEQ ID NO: 5), the central bars are the hives that were left untreated and the bar on the right are the hives treated with SEQ ID NO: 3 (CAM 373).

DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise indicated, the technical and scientific terms used herein have the same meaning as is commonly understood by one skilled in the art. One skilled in the art will recognize that many methods can be used in the practice of the present disclosure. Indeed, the present description is in no way limited by the described methods and materials. All references cited herein are incorporated by reference in their entirety. For the purposes of this description, the following terms are defined below.

It is understood that any sequence identification number (SEQ ID NO) described in the present application may refer to a DNA sequence or an RNA sequence, depending on the context in which said SEQ ID NO is mentioned, even if said SEQ ID is NOT expressed alone in a DNA sequence format or in an RNA sequence format. For example, SEQ ID NO: 1 is expressed in a DNA sequence format (eg. eg, says T for thymine), but may refer to a DNA sequence that corresponds to a mature destroyer Varna calmodulin nucleic acid sequence or to the RNA sequence of a Varroa calmodulin molecule nucleic acid sequence mature destroyer. Similarly, although SEQ ID NO: 3 is expressed in an RNA sequence format (e.g. eg says U for uracil), depending on the actual type of molecule being described, SEQ ID NO: 3 can refer either to the sequence of an RNA molecule that comprises a dsRNA or to the sequence of a DNA molecule which corresponds to the RNA sequence shown. In either case, DNA and RNA molecules having the described sequences are contemplated with any substitute.

As used herein, the term "approximately" refers to ± 10%.

As used herein, singular forms one, one, and include plural references unless the context clearly indicates otherwise. For example, the term a compound or at least one compound can include various compounds, including mixtures thereof.

As used herein, "essentially identical or essentially complementary" refers to a nucleic acid (or at least one strand of a double-stranded nucleic acid or a part thereof, or a portion of a single-stranded nucleic acid) that hybridizes under physiological conditions with the endogenous gene, a transcribed RNA thereof, or a fragment thereof, to effect regulation or deletion of the endogenous gene. For example, in some respects, a nucleic acid has sequence identity of 100 percent or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent compared to a region of 10, 11, 12, 13, 14, 15, 16, 17, 18,

19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,

45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some respects, a nucleic acid has sequence complementarity of 100 percent or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent compared to a region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some aspects, a nucleic acid has 100 percent sequence identity or complementarity to an allele or family member of a particular target gene (coding or non-coding sequence of a gene). In some respects, a nucleic acid has at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent sequence identity or complementarity with multiple alleles or with family members of a given target gene. In some respects, a nucleic acid has 100 percent sequence identity or complementarity with multiple alleles or with members of the family of a given target gene.

In some respects, nucleic acid is essentially identical or essentially complementary to at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more contiguous nucleotides of an endogenous calmodulin gene from a target pest, or an RNA transcribed from it. The nucleic acid may be a single-stranded DNA, a single-stranded RNA, a double-stranded RNA, a double-stranded DNA, or a double-stranded DNA / RNA hybrid. In some respects, the calmodulin gene sequence is a sequence of the Varroa destructor calmodulin gene. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 1. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 2. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 3. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 4. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 69. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 70. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 71- 87. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 88. In one aspect, the calmodulin gene sequence is a calmodulin gene sequence selected from SEQ ID NO: 89.

As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing down or reversing the progression of a condition, substantially improving the clinical or aesthetic symptoms of a condition, or substantially preventing the appearance of clinical or aesthetic symptoms of a condition. In one aspect in accordance with the present disclosure, a composition can be used to treat an organism or a colony of organisms for the effects of parasitization. In one aspect, a nucleic acid composition can be used to treat a host organism or colony against parasites. In one aspect, the host organism is a bee and the parasite is the Varroa destructor mite.

As used herein, the phrase RNA silencing refers to a group of regulatory mechanisms (eg, RNA interference (¡RNA), transcriptional gene silencing (TGS), posttranslational gene silencing (PTGS), extinction, cosuppression, and translational repression) mediated by RNA molecules that cause the inhibition or silencing of the expression of a corresponding protein coding gene or RNA sequence of the bee pathogen. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi. In aspects related to the present disclosure, nucleic acid compositions provide for RNA silencing. In certain aspects, nucleic acid compositions provide for the silencing and mortality of RNA in a parasite.

As used herein, the term "RNA silencing agent" refers to a nucleic acid that is capable of inhibiting or silencing the expression of a target gene. In certain aspects, the RNA silencing agent can prevent complete processing (eg, translation and / or complete expression) of an mRNA molecule through a post-translational silencing mechanism. RNA silencing agents can be single-stranded or double-stranded RNA, single-stranded or double-stranded DNA, or double-stranded DNA / RNA hybrids or modified analogues thereof. In some aspects, RNA silencing agents are selected from the group consisting of (a) a single-stranded RNA molecule (mRNA), (b) a mRNA molecule that self-hybridizes to form a double-stranded RNA molecule , (c) a double-stranded RNA (dsRNA) molecule, (d) a single-stranded DNA (ssDNA) molecule, (e) a ssDNA molecule that self-hybridizes to form a double-stranded DNA molecule and (f) a single-stranded DNA molecule that includes a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule that includes a modified Pol III promoter that is transcribed to an RNA molecule, (i) a double-stranded hybridized RNA / DNA molecule, or combinations of these. In some respects, these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In some respects, RNA silencing agents are non-coding RNA molecules, eg, RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. In some respects, the RNA silencing agents are dsRNAs such as siRNA, miRNA and hRNA. In one aspect, the RNA silencing agent is capable of inducing RNA interference. In another aspect, the RNA silencing agent is capable of mediating translational repression. In one aspect, the RNA silencing agent is capable of inhibiting the expression of a calmodulin gene. In another aspect, the RNA silencing agent can be used in methods to inhibit the expression of a target gene and thereby kill a target organism. In certain aspects, the target gene is a calmodulin gene and the target organism is Varroa destructor.

RNA interference refers to the sequence-specific post-translational gene silencing process in animals mediated by small RNAs. The corresponding process in plants is commonly called post-translational gene silencing or RNA silencing and is also called quenching in fungi. Without being limited by any particular theory, the post-translational gene silencing process is thought to be an evolutionary conserved cell defense mechanism used to prevent foreign gene expression and is commonly shared by a diversity of flora and phyla. Such protection of foreign gene expression may have evolved in response to the production of double-stranded RNA (dsRNA) derived from viral infection or the random integration of transposon elements into a host genome through a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. In some respects in accordance with the present disclosure, a nucleic acid composition causes RNA interference in a target organism. In certain aspects, the nucleic acid composition causes RNA interference in Varroa destructor, when present in the host organism, the bee. In accordance with aspects of the present disclosure, a selective insecticide can cause RNA interference in the target organism, even though it does not have RNA interference activity in non-target organisms.

As used herein, "small RNA" refers to any RNA molecule that is at least 15 base pairs in length, generally 15-30 nucleotides in length, preferably 20-24 nucleotides in length. In some respects in accordance with the present disclosure, a small RNA is greater than 50 base pairs in length. In one aspect, the small RNA is greater than 50 base pairs in length, but less than about 500 base pairs. In one aspect, the small RNA is greater than 100 base pairs in length, but less than about 500 base pairs. In one aspect, the small RNA is greater than 200 base pairs in length, but less than about 500 base pairs. A small RNA can be single-stranded or double-stranded. Small RNAs include, without limitation, miRNA (microRNA), siRNA-at (trans-activating siRNA), siRNA, activating RNA (aRNA),

SiRNA-nat (natural antisense siRNA), siRNA-hc (heterochromatic siRNA), siRNA of cis action, siRNA (long siRNA), siRNA (long siRNA) and siRNA (epigenetically activated siRNA) and their respective precursors. In some embodiments, the siRNA molecules in the disclosure are the mRNA molecules, the siRNA molecules, and the aRNA molecules and their respective precursors. A small RNA can be processed in vivo by an organism to an active form. According to the aspects of the present description, a selective insecticide can be a small RNA.

In some respects in accordance with the present disclosure, a small RNA is provided directly in a composition. In other aspects, a small RNA is produced in vivo by an organism from an RNA or DNA precursor. In some respects, small RNA is produced as a product of a transgene in an organism, for example, a bacterial or yeast cell. In certain aspects, a small RNA produced as a product of a transgene is produced as a precursor that is processed in vivo after ingestion or absorption by an organism. In other aspects, a small RNA produced as a product of a transgene is produced as a precursor that is processed in vivo after ingestion or absorption by an organism.

In some respects, the RNA silencing agent may be an artificial microRNA. As used herein, an artificial microRNA (mRNA) is a type of miRNA that is derived by replacing native mRNA duplexes from a natural miRNA precursor. In general, an artificial miRNA is a miRNA molecule that does not exist in nature, produced from a genetically modified prior mRNA molecule scaffold by exchanging an mRNA sequence for a prior miRNA molecule that exists in nature. by a sequence of interest that corresponds to the sequence of an artificial miRNA. In some respects in accordance with the present disclosure, a nucleic acid composition may be a mRNA composition.

Various studies demonstrate that long dsRNAs can be used to silence gene expression without inducing stress response or causing significant off-target effects, see for example (Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 38033810; Bhargava A et al. Brain Res. Protocols 2004; 13: 115-125; Diallo M., et al., Oligonucleotides. 2003; 13: 381-392; Paddison PJ., Et al., Proc Nati Acad. Sci. USA. 2002; 99: 1443-1448; Tran N., et al., FEBS Lett. 2004; 573: 127-134). The present description provides and includes methods and compositions having long dsRNAs.

As used herein, with respect to a nucleic acid sequence, nucleic acid molecule, or gene, the term "natural or native" means that the respective sequence or molecule is present in a wild organism, which has not been genetically modified or manipulated by man. A small RNA molecule naturally targeting a target gene means a small RNA molecule present in a wild organism, the cell has not been genetically engineered or manipulated by man, which targets a target gene that is naturally present in the body respective.

As used herein, the terms homology and identity, when used in relation to nucleic acids, describe the degree of similarity between two or more nucleotide sequences. The percentage of sequence identity between two sequences is determined by comparing two optimally aligned sequences on a comparison window, so that the portion of the sequence in the comparison window can comprise additions or deletions (spaces) in comparison with the reference sequence (not including additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the nucleic acid base or identical amino acid residue appears in both sequences to give the number of coincident positions, dividing the number of coincident positions by the total number of positions in the window for comparison and multiplying the result by 100 to give the percentage of sequence identity. A sequence that is identical at all positions compared to a reference sequence is said to be identical to the reference sequence and vice versa. An alignment of two or more sequences can be performed using any suitable computer program. For example, a widely used and accepted computer program for performing sequence alignments is CLUSTALW vl.6 (Thompson et al. Nucí. Acids Res., 22: 4673-4680, 1994).

As used herein, the terms "exogenous polynucleotide" and "exogenous nucleic acid molecule," relative to an organism, refer to a heterologous nucleic acid sequence that is not naturally expressed within that organism. An exogenous nucleic acid molecule can be introduced into an organism in a stable or transient way. An exogenous nucleic acid molecule may comprise a nucleic acid sequence that is identical or partially homologous to an endogenous nucleic acid sequence of the organism or a pest or pathogen of said organism. In certain aspects, an exogenous polynucleotide and an exogenous nucleic acid molecule can refer to a parasite nucleic acid sequence expressed or present in a host, either transiently or stably. The present disclosure provides and includes compositions comprising exogenous polynucleotides and exogenous nucleic acid molecules and methods for introducing them into a target organism. In some aspects, the present disclosure provides and includes compositions comprising exogenous polynucleotides and exogenous nucleic acid molecules and methods for introducing them into a non-target organism that is a host to the target organism.

As used herein, a control organism means an organism that does not contain the recombinant DNA, small RNA, or other nucleic acid (eg, protein, miRNA, target RNA resistant to small RNA, dsRNA, target mimic) that provides the control of a pest or parasite. Control organisms are generally of the same species and the same stage of development that is obtained under the same growth conditions as the treated organism. Similarly, a control colony means a colony of organisms that do not contain the recombinant DNA, small RNA, or other nucleic acid (eg, protein, mRNA, target RNA resistant to small RNA, target mimic) that provides control. of a pest or parasite. Control organism colonies are generally of the same species and the same stage of development obtained under the same growth conditions as the treated organism colony. As a non-exhaustive example, a control organism can be a bee that receives a composition that does not contain a nucleic acid of the present description. In another non-exhaustive example, a control organism can be a bee that receives a composition that contains a nucleic acid that does not act as an RNA silencer in either a bee or a parasite, such as SEQ ID NO: 5.

As used herein, the terms improve, improved, increase, and increased refer to an increase of at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more in a colony organism or population , in increasing the productivity of an organism or colony (p. eg, increased honey production), increased growth rate of an organism or colony, or increased reproductive rate compared to a control organism or colony. The present disclosure provides methods of improving the health of an organism or colony by supplying a selective insecticidal composition.

As used herein, a reduction in the level of an agent such as a protein or mRNA means that the level is reduced relative to an organism or colony that lacks a nucleic acid capable of reducing the agent. Furthermore, as used herein, a reduction with reference to parasitization or parasite load means that the level is reduced relative to an organism or colony that lacks a nucleic acid, such as a dsRNA molecule, capable of reducing viability, fertility or quantity of the parasite. The present disclosure provides and includes methods and compositions for reducing the level of a protein or mRNA and reducing the level or amount of parasites.

As used herein, the term "at least a partial reduction in the level of an agent such as a protein or mRNA" means that the level is reduced by at least 25% relative to an organism or colony that lacks a nucleic acid, such as a dsRNA molecule capable of reducing the agent. Furthermore, as used herein, at least a partial reduction with reference to parasitization or parasite loading means that the level is reduced by at least 25% relative to an organism or colony that lacks nucleic acid, such as a dsRNA molecule, capable of reducing the viability, fertility or quantity of the parasite. The present disclosure provides and includes methods and compositions for at least partially reducing the level of a protein or mRNA and at least partially reducing the level or amount of parasites.

As used herein, a substantial reduction in the level of an agent such as a protein or mRNA means that the level is reduced relative to an organism or colony that lacks a nucleic acid, such as a dsRNA molecule capable of reducing the agent, in where the agent level reduction is at least 75%. Furthermore, as used herein, a substantial reduction with reference to parasitization or parasite loading means that the level is reduced by at least 75% relative to an organism or colony that lacks a nucleic acid, such as a DsRNA capable of reducing the viability, fertility or quantity of the parasite. The present disclosure provides and includes methods and compositions for substantially reducing the level of a protein or mRNA and substantially reducing the level or amount of parasites.

As used herein, effective removal of an agent such as a protein or mRNA relates to an organism or colony that lacks a dsRNA molecule capable of reducing the agent, where the reduction in the level of the agent is greater than 95%. . An agent, such as a dsRNA molecule, is preferably capable of providing at least a partial reduction, more preferably a substantial reduction or, more preferably, an efficient elimination of another agent such as a protein or mRNA, or a parasite, where the level of a second agent, or host organism, is essentially unaffected, substantially unaffected, or partially unaffected by the agent. Furthermore, as used herein, effective removal with reference to parasitization or parasite loading means that the level is reduced by at least 95% relative to an organism or colony that lacks a nucleic acid, such as a DsRNA capable of reducing the viability, fertility or quantity of the parasite. The present disclosure provides and includes methods and compositions for the efficient removal of a protein or mRNA and the effective removal of parasites.

As used herein, the terms "suppress, repress, and down-regulate," when they refer to the expression or activity of a nucleic acid molecule in an organism, are used equivalently herein and mean that the level of expression or activity of the nucleic acid molecule in a cell of an organism after applying a method of the present disclosure is less than the expression or activity in the cell of an organism before applying the method, or compared to a control organism lacking a nucleic acid molecule of the description. The present disclosure provides and includes methods and compositions for down-suppressing, repressing and down-regulating the level of a protein or mRNA and down-suppressing, down-regulating, or the level of parasites.

The terms "suppressed, repressed, and down-regulated," as used herein, are synonyms and mean less, preferably significantly less, expression or activity of a target nucleic acid molecule herein. Furthermore, as used herein, suppressed, repressed, and down-regulated, with reference to parasitization or parasite load, means that the level of parasite or parasite load is less, preferably significantly less with respect to an organism or colony that lacks a nucleic acid, such as a dsRNA molecule capable of reducing the viability, fertility or quantity of the parasite. The present disclosure provides and includes methods and compositions for suppressing, repressing and downregulating the expression or activity of a protein or mRNA and suppressing, repressing and downregulating the activity of parasites.

As used herein, a suppression, suppression, or down-regulation of the level or activity of an agent such as a protein, mRNA, or RNA means that the level or activity is reduced relative to a substantially identical cell, organism, or colony that grew in substantially identical conditions, lacking a nucleic acid molecule of the description, for example, lacking the complementary region to at least a part of the molecule precursors of a dsRNA or siRNA, the recombinant construct or the recombinant vector of the description. As used herein, a suppression, repression, or down-regulation of the level or activity of an agent, eg, a preRNA, mRNA, rRNA, tRNA, ssRNA, ssRNA expressed by the target gene, and / or the encoded protein product by this means that the amount is reduced by 10% or more, for example, 20% or more, preferably 30% or more, more preferably 50% or more, more preferably 70% or more, more preferably 80% or more, for example 90%, with respect to a cell, organism, or colony that lacks a recombinant nucleic acid molecule of the disclosure. The present disclosure provides and includes methods and compositions for the suppression, repression, and down-regulation of an agent such as a protein, mRNA, RNA, or parasite compared to an untreated organism or colony.

As used herein, the term arthropod refers to adults and pupae of invertebrate animals that have an exoskeleton (external skeleton), a segmented body, and articulated appendages. Arthropods are members of the Arthropoda phylum and include insects, arachnids, and crustaceans. Arthropods in accordance with the present disclosure include, but are not limited to, Apis mellifera, Apis cerana, Trigona minim, Haiictidae, Bombus sp., Fleas, flies, lice, ticks, mites and beneficial insects. The present disclosure provides and includes methods and compositions for treating arthropods as hosts or as a parasite or pest.

In one aspect, an arthropod may be an insect. In certain aspects, an insect can be a bee. As used herein, the term bee refers to an adult bee and the pupal cells of the pupae. According to one aspect, the bee is in a hive. An adult bee is defined as any one of several winged, body-biting insects, generally stinging, of the Apoidea superfamily in the order Hymenoptera, including solitary and social species and characterized by having mouthparts to suck and chew to collect nectar. and pollen. Some examples of bee species include, but are not limited to, Apis, Bombus, Trigona, Osmia, and the like. In one aspect, bees include, but are not limited to, bumble bees (Bombus terrestrís), honey bees (Apis mellifera) (including gatherers and house bees), and Apis cerana. The present disclosure provides and includes methods and compositions for treating bees as hosts for parasites, such as Varroa mites.

According to one aspect, a bee is part of a colony. The term colony refers to a bee population of between dozens and typically several tens of thousands of bees that collaborate with nest building, food gathering, and chicken farming. A colony normally has a single queen, the rest of the bees are worker (female) or drone (male). The social structure of the colony is maintained by the queen and the workers and depends on an effective communication system. The division of tasks within the working caste depends mainly on the age of the bee, but varies with the needs of the colony. Reproduction and the strength of the colony depend on the queen, the amount of food reserves and the size of the working force. Honey bees can also be subdivided into the categories of domestic bees, generally for the first part of the worker's life, during which the domestic bee performs tasks within the hive and the collecting bee during the latter part of the life of the bee, during which the collector locates and collects pollen and nectar from the outside of the hive and brings the nectar or pollen to the hive for consumption and storage. The present description provides and includes methods and compositions for treating insect colonies.

As used herein, the term pest refers to the adult and immature forms of an organism that is invasive or prolific, harmful, troublesome, harmful, destructive, a nuisance to plants or animals or ecosystems. A parasite is a type of pest. An organism may be a pest in one environment, but it may be beneficial, domesticated, or acceptable in another.

As used herein, the term parasite refers to the adult and immature forms of organisms that directly benefit at the expense of another, host organism, for example, feeding on the host's blood or fluids, living intracellularly in an organism cell. host or living within a body of a host organism. Parasites include organisms that are animals, fungi, bacteria, or plants and are identified by negative or harmful interaction with a host. In some respects, a parasite, as used herein, can itself serve as a host for a second parasite. In some respects, a parasite and a host can be the same type of organism (eg, an arthropod host and an arthropod parasite). Parasites include, but are not limited to, Acari (ticks, mites), Hippoboscoidea (flies), Ichneumonoidea (parasitic wasps), Oestridae (horseflies), Phthiraptera (lice), Tantulocarida, mussel crab, and As used here, a pest can include parasitic and non-parasitic stages of life. The present description provides and includes methods and compositions for treating parasites. In one aspect, the parasite may be Varroa destructor.

As provided and included in the present description, parasites and / or pests include Varroa destructor, Ixodes scapuiaris, Sotenopsis invicta, Tetranychus urticae, Aedes aegypti, Cuiex quinquefasciatus, Acyrthosiphon pisum / Pediculus humanus. In some aspects according to the present description, selective insecticides can be selective for Varroa destructor, Ixodes scapuiaris, Soienopsis invicta, Tetranychus urticae, Aedes aegypti, Cuiex quinquefasciatus, Acyrthosiphon pisum and Pediculus humanus and inactive, or significantly less active, against a non-target organism as the host organism.

As used herein, the term "excipient" refers to any inactive substance in a formulation that has an active ingredient such as an antiparasitic, antiplagic, or insecticidal nucleic acid, including but not limited to dsRNA, small RNA, myRNA, and antisense RNA. In some embodiments, an excipient includes substances that can provide additional functionality to a composition, which is different from antiparasitic, antiplague, or insecticidal nucleic acids. The functions of excipients include, but are not limited to, thickening agents, fillers, diluents, and carriers. Thickening allows for convenient and accurate dispensing of the compositions of the present disclosure. Excipients can also serve to facilitate the intake of the compositions by organisms and includes various carbohydrates, proteins, fatty acids, pollen, and pollen substitutes. Excipients can also serve to facilitate the absorption of compositions by organisms and include, for example, aqueous and non-aqueous solutions of active ingredients. Some non-exhaustive examples of excipients include corn syrup, sugar syrup, sugar solids, semi-solid sugar, pollen, soy protein, pollen and protein mixtures. The excipients may also comprise attractants, buffers, and nutritional supplements. The compositions of the present disclosure may be coated, encapsulated, dissolved, in mixtures, or otherwise combined with an excipient. As used herein, the term excipient may refer to a mixture of inactive substances.

The present application provides and describes antiparasitic, antifungal, or insecticidal nucleic acid molecules that are substantially homologous to or complementary to a polynucleotide sequence of a calmodulin target gene or an RNA expressed from the calmodulin target gene or a fragment thereof and which they suppress expression of the calmodulin target gene or produce an inactivation phenotype. Antiparasitic, antiplague, or insecticidal nucleic acid molecules are capable of inhibiting or silencing the expression of a calmodulin target gene. These nucleic acid molecules are generally described in relation to their target sequence. In some embodiments, the target sequence is selected from SEQ ID NO. 1, 2 and 6-77. Antiparasitic, anti-pest or insecticidal nucleic acid molecules can be single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsDNA), double-stranded DNA (dsDNA), or DNA / RNA hybrids double chain. Nucleic acid molecules can comprise natural nucleotides, modified nucleotides, nucleotide analogs, or any combination of these. In some embodiments, an antiparasitic, antiplagic, or insecticidal nucleic acid molecule can be incorporated into a larger polynucleotide, for example, into a pri miRNA molecule. In some embodiments, an antiparasitic, antiplagic, or insecticidal nucleic acid molecule can be processed to obtain a small interfering RNA (siRNA). In some embodiments, nucleic acid molecules that are selectively antiparasitic or acaricidal are provided or described, and methods for modulate the expression or activity of their target genes to reduce or eliminate parasites from a colony or population.

In some aspects in accordance with the present disclosure, an antiparasitic, antiplagic, or insecticidal nucleic acid molecule comprises a nucleotide sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% of sequence identity with a sequence or part of a sequence selected from the group consisting of SEQ ID NO: 1 to 89. In certain aspects, the nucleic acid molecule is selected from the group consisting of ssDNA, ssRNA, dsDNA, dsDNA or DNA / RNA hybrids. Various modalities refer to a dsRNA comprising a nucleotide sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity with a sequence or part of a sequence selected from the group consisting of SEQ ID NO: 1 to 89. In another aspect, a DNA encoding at least one nucleic acid, such as an mRNA or a dsRNA, is provided which comprises a nucleotide sequence or a part of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 89 , or that it has at least 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% of sequence identity with SEQ ID NO: 1 to 89 or a part of it. In another aspect, there is provided a recombinant DNA encoding at least one nucleic acid, such as an mRNA or dsRNA, comprising a nucleotide sequence or a portion of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 89 , a heterologous promoter and a transcription terminator sequence. In another aspect, the present disclosure provides a recombinant DNA encoding at least one nucleic acid, such as an mRNA or dsRNA, comprising a nucleotide sequence having at least 80%, 85%, 88%, 90% , 92%, 95%, 96%, 97%, 98% or 99% of sequence identity with a sequence or part of a sequence selected from the group consisting of SEQ ID NO: 1 to 89 and which further comprises a heterologous promoter and a transcription terminator.

In some respects in accordance with the present disclosure, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 10 to 17 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antifungal, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 18 to 25 or more contiguous nucleotides in the target gene or transcribed RNA of the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 20 to 30 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 25 to 35 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 30 to 40 or more contiguous nucleotides in the target gene or transcribed RNA of the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 40 to 50 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 50 to 60 or more contiguous nucleotides in the target gene or transcribed RNA of the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 45 to 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 60 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 50 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 40 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 25 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 35 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 40 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 50 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 60 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1 to 89. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1. In one aspect, a target gene can be a gene comprising SEQ ID NO: 2. In one aspect, a target gene may be a gene comprising SEQ ID NO: 3. In one aspect, a target gene may be a gene comprising SEQ ID NO: 4. In one aspect, a target gene may be a gene comprising SEQ ID NO: 69. In one aspect, a target gene may be a gene comprising SEQ ID NO: 70. In one aspect, a target gene may be a gene comprising SEQ ID NO: 88. In one aspect, a target gene can be a gene comprising SEQ ID NO: 89. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 71-87. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 6-68.

In some respects in accordance with the present disclosure, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 10 to 17 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 18 to 25 or more contiguous nucleotides in the target gene or transcribed RNA of the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 20 to 30 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 25 to 35 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 30 to 40 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 40 to 50 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal composition comprises a nucleic acid molecule that has 99 percent sequence identity with a region of 50 to 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 45 to 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 60 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 50 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 40 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 25 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 35 contiguous nucleotides in the target gene or transcribed RNA of the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 40 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 50 contiguous nucleotides in the target gene or RNA transcribed from the target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 60 contiguous nucleotides in the target gene or transcribed RNA of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 98 percent sequence identity with a region of the target gene. In one aspect, a nucleic acid to a parasitic river, antiplagen, or insecticide has at least 97 percent sequence identity with a region of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 96 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 95 percent sequence identity with a region of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 94 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 93 percent sequence identity with a region of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 92 percent sequence identity with a region of the target gene. In one aspect, a nucleic acid to a parasitic nti, antiplaga or insecticide has at least 91 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagal, or insecticidal nucleic acid has at least about 83, 84, 85, 86, 87, 88, 89, 90 percent identity with a target gene region as previously provided. In one aspect, a target gene can be a gene comprising SEQ ID NO: 1 to 89. In one aspect, a target gene may be a gene comprising SEQ ID NO: 1. In one aspect, a target gene may be a gene comprising SEQ ID NO: 2. In one aspect, a target gene may be a gene comprising SEQ ID NO: 3. In one aspect, a target gene may be a gene comprising SEQ ID NO: 4. In one aspect, a target gene may be a gene comprising SEQ ID NO: 69. In one aspect, a target gene can be a gene comprising SEQ ID NO: 70. In one aspect, a target gene may be a gene comprising SEQ ID NO: 88. In one aspect, a target gene may be a gene comprising SEQ ID NO: 89. In one aspect, a target gene may be a gene comprising a sequence selected from SEQ ID NO: 71-87. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 6-68.

In some respects in accordance with the present disclosure, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 10 to 17 or more contiguous nucleotides on one allele or member from the family of a given target gene (coding or non-coding sequence of a gene). In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 18 to 25 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 20 to 30 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 25 to 35 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 30 to 40 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 40 to 50 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 50 to 60 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 45 to 60 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 60 nucleotides contiguous to an allele or family member of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 50 nucleotides contiguous to an allele or family member of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 40 nucleotides contiguous to an allele or family member of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 25 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 35 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 40 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 50 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 60 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1 to 89. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1. In one aspect, a target gene may be a gene comprising SEQ ID NO: 2. In one aspect, a target gene may be a gene comprising SEQ ID NO: 3. In one aspect, a target gene may be a gene comprising SEQ ID NO: 4. In one aspect, a target gene may be a gene comprising SEQ ID NO: 69. In one aspect, a target gene may be a gene comprising SEQ ID NO: 70. In one aspect, a target gene can be a gene comprising SEQ ID NO: 88. In one aspect, a target gene may be a gene comprising SEQ ID NO: 89. In one aspect, a target gene may be a gene comprising a sequence selected from SEQ ID NO: 71-87. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 6-68.

In some respects in accordance with the present disclosure, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 10 to 17 or more nucleotides contiguous to an allele or member from the family of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 18 to 25 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 20 to 30 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 25 to 35 or more nucleotides contiguous to an allele or a member of the family of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 30 to 40 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 40 to 50 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 50 to 60 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 45 to 60 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 60 nucleotides contiguous to an allele or family member of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 50 nucleotides contiguous to an allele or family member of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 40 nucleotides contiguous to an allele or family member of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 25 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 35 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 40 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 50 nucleotides contiguous to an allele or family member of a given target gene . In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 60 nucleotides contiguous to an allele or family member of a given target gene . In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 98 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 97 percent sequence identity with a region of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 96 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 95 percent sequence identity with a region of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 94 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 93 percent sequence identity with a region of the target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 92 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 91 percent sequence identity with a region of the target gene. In one aspect, an antiparasitic, antiplagal, or insecticidal nucleic acid has at least about 83, 84, 85, 86, 87, 88, 89, 90 percent identity with a target gene region as previously provided. In one aspect, a target gene can be a gene comprising SEQ ID NO: 1 to 89. In one aspect, a target gene may be a gene comprising SEQ ID NO: 1. In one aspect, a target gene may be a gene comprising SEQ ID NO: 2. In one aspect, a target gene may be a gene comprising SEQ ID NO: 3. In one aspect, a target gene may be a gene comprising SEQ ID NO: 4. In one aspect, a target gene may be a gene comprising SEQ ID NO: 69. In one aspect, a target gene can be a gene comprising SEQ ID NO: 70. In one aspect, a target gene may be a gene comprising SEQ ID NO: 88. In one aspect, a target gene may be a gene comprising SEQ ID NO: 89. In one aspect, a target gene may be a gene comprising a sequence selected from SEQ ID NO: 71-87. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 6-68.

In some aspects according to the present disclosure, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 10 to 17 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 18 to 25 or more nucleotides contiguous to an allele or family member of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 20 to 30 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 25 to 35 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 30 to 40 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 40 to 50 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 50 to 60 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of 45 to 60 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 60 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 50 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of up to 40 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 25 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 35 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 40 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 50 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 100 percent sequence identity with a region of at least 60 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1 to 89. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1. In one aspect, a target gene may be a gene comprising SEQ ID NO: 2. In one aspect, a target gene may be a gene comprising SEQ ID NO: 3. In one aspect, a target gene may be a gene comprising SEQ ID NO: 4. In one aspect, a target gene may be a gene comprising SEQ ID NO: 69. In one aspect, a target gene may be a gene comprising SEQ ID NO: 70. In one aspect, a target gene can be a gene comprising SEQ ID NO: 88. In one aspect, a target gene may be a gene comprising SEQ ID NO: 89. In one aspect, a target gene may be a gene comprising a sequence selected from SEQ ID NO: 71-87. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 6-68.

In some respects in accordance with the present disclosure, a composition comprises a parasitic nti, antiplagen, or insecticide nucleic acid molecule having 99 percent sequence identity with a region of 10 to 17 or more contiguous nucleotides of identity or Complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 18 to 25 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 20 to 30 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 25 to 35 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 30 to 40 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 40 to 50 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 50 to 60 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of 45 to 60 or more contiguous nucleotides of identity or complementarity with multiple alleles or family members of a given target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 60 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 50 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of up to 40 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a gene target determined. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 25 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 35 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 40 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 50 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In one aspect, a composition comprises an antiparasitic, antiplagic, or insecticidal nucleic acid molecule that has 99 percent sequence identity with a region of at least 60 contiguous nucleotides of identity or complementarity with multiple alleles or family members of a determined target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 98 percent sequence identity with a region of a target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 97 percent sequence identity with a region of a target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 96 percent sequence identity with a region of a target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 95 percent sequence identity with a region of a target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 94 percent sequence identity with a region of a target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 93 percent sequence identity with a region of a target gene. In some aspects, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 92 percent sequence identity with a region of a target gene. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid has at least 91 percent sequence identity with a region of a target gene. In one aspect, an antiparasitic, antiplagal, or insecticidal nucleic acid has at least about 83, 84, 85, 86, 87, 88, 89, 90 percent identity with a region of a target gene as provided above. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1 to 89. In one aspect, a target gene can be a gene that comprises SEQ ID NO: 1. In one aspect, a target gene can be a gene comprising SEQ ID NO: 2. In one aspect, a target gene may be a gene comprising SEQ ID NO: 3. In one aspect, a target gene may be a gene comprising SEQ ID NO: 4. In one aspect, a target gene may be a gene comprising SEQ ID NO: 69. In one aspect, a target gene may be a gene comprising SEQ ID NO: 70. In one aspect, a target gene may be a gene comprising SEQ ID NO: 88. In one aspect, a target gene can be a gene comprising SEQ ID NO: 89. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 71-87. In one aspect, a target gene can be a gene comprising a sequence selected from SEQ ID NO: 6-68.

The present application provides and describes compositions comprising an antiparasitic, antiplagic or insecticidal nucleic acid molecule and an excipient substance. In one aspect, the excipient may be a combination of one or more inactive components. In some respects, the excipient comprises a sugar. Some examples of sugars include hexoses, disaccharides, trisaccharides, and higher sugars. Excipient sugars include, for example, fructose, glucose, sucrose, trehalose, lactose, galactose, ribose. In other aspects, the excipient comprises a sugar and a solvent. In other aspects, the excipient comprises a protein. In one aspect, the protein is a soy protein. In other respects, the excipient may be pollen. In some respects in accordance with the present disclosure, the carrier may be a food for bees. In some respects, the excipient comprises tryptone. In some aspects, the excipient comprises yeast extract. In some respects, the excipient comprises an essential oil.

Bee feeding is a common practice among beekeepers to meet nutritional and other needs, for example, complementary. Bees typically feed on honey and pollen, but they are also known to eat unnatural foods. Bees can consume various edible products including but not limited to Wheast (a dairy yeast grown in cottage cheese), soybean meal, yeast (e.g. (eg, brewer's yeast, torula yeast) and yeast products administered alone or in combination and soybean meal administered as a dry mix or as a wet cake inside the hive or as a dry mix in open feeders outside the hive . Sugar or a sugar syrup is also helpful. Adding 10 to 12 percent pollen to a supplement administered to bees improves palatability. The addition of 25 percent pollen improves the quality and quantity of essential nutrients that bees need for vital activity. Cane or beet sugar, isomerized corn syrup and type 50 sugar syrup are satisfactory substitutes for honey in the natural diet of honey bees. The last two can only be administered in liquid form to bees. Liquid feed can be supplied to bees within the hive by, for example, any of the following methods: top friction bucket, honeycombs within the hive body, splitter board feeder, Boardman feeder, etc. Dry sugar can be administered by placing a pound or two on the inverted inner shell. At all times, there must be a water supply available to bees. In one aspect, trays are provided in which floating supports are present, such as wood chips, cork, or plastic sponges. Detailed descriptions of supplemental bee feeds can be found, for example, in the USDA publication of Standifer et al., 1977, entitled Supplemental Feeding of Honey Bee Colonies (USDA, Agriculture Information Bulletin No. 413).

In some aspects according to the present disclosure, an antiparasitic, antiplagic or insecticidal nucleic acid, for example, a dsRNA is absorbable. As used herein, "absorbable" refers to mechanisms to provide absorption of a nucleic acid other than by ingestion. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid can be absorbed through the skin of an organism or the exoskeleton of an arthropod. In one aspect, an absorbable nucleic acid dissolves in an excipient. In other aspects, an absorbable nucleic acid is suspended in an excipient. The excipients for solvation or suspension can be aqueous or non-aqueous. In some respects, the antiparasitic, antiplagic, or insecticidal nucleic acid is absorbed by a host organism and transferred to a parasitic organism by diet. In other aspects, the antiparasitic, antiplagic, or insecticidal nucleic acid is absorbed by a host organism and transferred to a parasitic organism by absorption. In one aspect, an antiparasitic, antiplagic, or insecticidal nucleic acid of the present disclosure is directly absorbed by the parasite.

In some respects in accordance with the present disclosure, an antiparasitic, antiplagic, or insecticidal nucleic acid, for example, a dsRNA is combined with an excipient. In one aspect, the nucleic acid can be provided in a ratio of nucleic acid to excipient. In one aspect, the ratio can be one part of nucleic acid to 4 parts of excipient. In one aspect, the nucleic acid to excipient ratio can be 1: 1, 1: 2, 1: 5, or 1:10. In other aspects, the ratio of nucleic acid to excipient may be 1:20, 1:25, 1:30, 1:40 or more. In one aspect, the nucleic acid to excipient ratio may be 1:50. In some aspects according to the present disclosure, the ratio can be determined as a ratio of volume to volume (v / v), a weight: weight ratio (w / w). In certain aspects, the ratio can be expressed as a weight: volume (w / v) ratio. In certain aspects, a nucleic acid and an excipient can be a dsRNA and an excipient.

In some respects in accordance with the present disclosure, the composition may comprise a weight of anti parasitic, antiplage, or insecticidal nucleic acid combined with an excipient. In one aspect, the nucleic acid can comprise a percentage of the total weight of the composition. In one aspect, the nucleic acid can comprise about 0.1% by weight of the composition. In one aspect, the nucleic acid can comprise about 0.2% by weight of the composition. In one aspect, the nucleic acid can comprise about 0.3% by weight of the composition. In another aspect, the nucleic acid can comprise about 0.4% by weight of the composition. In one aspect, the nucleic acid can comprise up to 0.5% by weight of the composition. In one aspect, the nucleic acid can comprise up to 0.6% by weight of the composition. In one aspect, the nucleic acid can comprise up to 0.7% by weight of the composition. In one aspect, the nucleic acid can comprise up to 0.8% by weight of the composition. In another aspect, the nucleic acid can comprise up to 1.0% by weight of the composition. In other aspects, the nucleic acid can comprise up to 1.5% by weight of the composition. In other aspects, the nucleic acid can comprise up to 2.0% by weight or 2.5% by weight of the composition. In certain aspects, a nucleic acid and an excipient can be a dsRNA and an excipient.

The present disclosure provides and includes compositions having between 0.1% and 5% by weight of one or more nucleic acids to parasitize rivers, antiplages or insecticides. In other aspects, a composition can comprise between 0.1 and 4%, between 0.1 and 3%, between 0.1 and 2%, between 0.1 and 1%, between 0.1 and 2%, between 0.1 and 3% or between 0.1 and 4% by weight of nucleic acid. In one aspect, a composition can comprise between 0.2% and 5% by weight of nucleic acid. In other aspects, a composition can comprise between 0.2 and 4%, between 0.2 and 3%, between 0.2 and 2%, between 0.2 and 1%, between 0.2 and 2%, between 0.2 and 3% or between 0.2 and 4% by weight of nucleic acid. In other aspects, a composition can comprise up to 1%, up to 2%, up to 3%, up to 4% or up to 5% of nucleic acid. In other aspects, a composition can comprise up to 7.5%, up to 10% or up to 15% nucleic acid. In certain aspects, a nucleic acid and an excipient can be a dsRNA and an excipient.

The present disclosure provides and includes compositions having between 0.1 and 10 mg / ml of one or more antiparasitic, antiplague, or insecticidal nucleic acids. In other aspects, a composition can comprise between 0.1 and 1.0 mg / ml, 0.1 and 2.0 mg / ml, 0.1 and 2.5 mg / ml, 0.1 and 5 mg / ml, 0.1 and 10 mg / ml, 0.1 and 15 mg / ml or 0.1 and 20 mg / ml nucleic acid. In certain aspects, a composition can comprise at least 0.1 pg / ml nucleic acid. In other aspects, a composition can comprise at least 1.0 pg / ml nucleic acid. In other aspects, a composition can comprise at least 10 pg / ml nucleic acid. In one aspect, a composition can comprise between 0.5 and 10 mg / ml nucleic acid. In other aspects, a composition can comprise between 0.5 and 1.0 mg / ml, 0.5 and 2.0 mg / ml, 0.5 and 2.5 mg / ml, 0.5 and 5 mg / ml, 0.5 and 10 mg / ml, 0.5 and 15 mg / ml or 0.5 and 20 mg / ml nucleic acid. In one aspect, a composition can comprise between 1.0 and 10 mg / ml nucleic acid. In other aspects, a composition can comprise between 1.0 and 2.0 mg / ml, 1.0 and 2.5 mg / ml, 1.0 and 5 mg / ml, 1.0 and 10 mg / ml, 1.0 and 15 mg / ml or 1.0 and 20 mg / ml nucleic acid. In certain aspects, the nucleic acid to nti parasitic river, antiplaga or insecticide in the composition comprises a dsRNA.

The present disclosure provides and includes selective insecticidal compositions and methods of using the selective insecticidal compositions.

As used herein, a selective insecticidal composition is a composition that is more effective for one or more arthropod species and less effective for one or more different arthropod species. A selective insecticidal composition includes compositions that kill adult or immature arthropods and includes compositions that are larvicides or ovicides.

A selective insecticide can be a systemic insecticide incorporated into treated foods, including blood or hemolymph obtained from host organisms. A selective insecticide can be a contact insecticide, which is toxic to certain insects that is brought into direct contact and which is non-toxic or minimally toxic to other insects. In some embodiments, a selective insecticidal composition is an antiplagen. In some embodiments, a selective insecticidal composition is an antiparasitic. In some embodiments, a selective insecticidal composition is an acaricide. In some embodiments, a selective insecticidal composition is toxic to a parasitic insect or target pest and is non-toxic or minimally toxic to non-target organisms. Some examples of non-target organisms include, but are not limited to, beneficial insects, nematodes, birds, mammals, and plants. In some embodiments, a selective insecticidal composition is toxic to a parasitic insect, eg, the Varroa mite, and is non-toxic or minimally toxic to the host organism, eg, bees. In some embodiments, a selective insecticidal composition is toxic to one or more parasitic insects or pests selected from the group consisting of: Varroa destructor, Ixodes scapularís, Solenopsis invicta, Tetranychus urticae, Aedes aegypti, Cuiex quinquefasciatus, Acyrthosiphon pisum, and Pedicuius humanus.

In certain aspects in accordance with the present disclosure, a selective insecticide can be incorporated into a bacterium or yeast by genetic modification (eg, a genetically engineered transgenic bacterium or yeast to express a nucleic acid of the present disclosure). A selective insecticide introduced by genetic modification of a bacterium or yeast can act directly on the pest organism or indirectly when ingested by a host of the pest organism.

In one aspect in accordance with the present disclosure, a selective insecticide may be an insecticide more effective against one or more primary insects than against one or more secondary insects. In one aspect, a selective insecticide can be toxic to a primary insect and have no effect on a secondary insect. In one aspect, a selective insecticide can be toxic to a primary insect and require significantly higher concentrations or amounts to have an effect on a secondary insect. In one aspect, a selective insecticide can be 2 times more toxic or more to a primary insect compared to a secondary insect. In one aspect, a selective insecticide can be 4 times more toxic or more to a primary insect compared to a secondary insect. In one aspect, a selective insecticide can be 5 times more toxic or more to a primary insect compared to a secondary insect. In one aspect, a selective insecticide can be 10 times more toxic or more to a primary insect compared to a secondary insect.

In one aspect, a selective insecticide can inhibit the growth, development, or fecundity of a primary insect and have no effect on a secondary insect. In one aspect, a selective insecticide can inhibit the growth, development or fertility of a primary insect and require significantly higher concentrations or amounts to have a similar effect on a secondary insect. In one aspect, a selective insecticide may require 2 times more or more of the active ingredient to inhibit the growth, development, or fertility of a secondary insect. In one aspect, a selective insecticide may require 4 times more or more of the active ingredient to inhibit the growth, development, or fertility of a secondary insect. In one aspect, a selective insecticide may require 5 times more or more of the active ingredient to inhibit the growth, development, or fertility of a secondary insect. In one aspect, a selective insecticide may require 10 times more or more of the active ingredient to inhibit the growth, development, or fertility of a secondary insect.

The present disclosure further includes and provides methods of treating or preventing colony collapse problem in a honey bee colony, which comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to a region of a sequence of the calmodulin gene from Varroa destroyer to a honey bee, thereby reducing the level of Varroa destroyer infestation. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 19 contiguous nucleotides of SEQ ID NO: 1. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 19 contiguous nucleotides of SEQ ID NO: 2. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 19 contiguous nucleotides of SEQ ID NO: 69. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 19 contiguous nucleotides of SEQ ID NO: 70. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid according to SEQ ID NO: 3. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid according to SEQ ID NO: 4. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid according to SEQ ID NO: 88. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid according to SEQ ID NO: 89. In one aspect, the method comprises providing an effective amount of a composition comprising two or more nucleic acids that they have a sequence selected from the group consisting of: SEQ ID NO: 3, 4, 88 and 89. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 19 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 23 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 30 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 40 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 50 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 60 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 70 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 80 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 90 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 100 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 110 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 120 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 130 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to at least 140 contiguous nucleotides of a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid that is essentially identical or essentially complementary to a sequence selected from SEQ ID NO: 71-87. In one aspect, the method comprises providing an effective amount of a composition comprising a nucleic acid according to a sequence selected from SEQ ID NO: 71-87.

The present description provides and includes methods for reducing the parasite load of a host organism. In one aspect, parasite load refers to the number of parasites per individual host. In one aspect, parasite load refers to the average number of parasites per 100 host organisms. In one aspect, parasite load can refer to the number of parasites per parasite host colony. In some respects according to the present description, the parasite is Varroa destructor and the host is the honey bee, Apis mellifera. In some respects, parasite load refers to the number of Varroa destructor parasites per 100 honey bees in a colony. In some embodiments, the present disclosure provides and includes methods and compositions for reducing parasite load to less than 6 Varroa destructor parasites per 100 honey bees in a colony. In some embodiments, the present disclosure provides and includes methods and compositions for reducing parasite load to less than 5 Varroa destructor parasites per 100 honey bees in a colony. In some embodiments, the present disclosure provides and includes methods and compositions for reducing parasite load to less than 4 Varroa destructor parasites per 100 honey bees in a colony. In some embodiments, the present disclosure provides and includes methods and compositions for reducing parasite load to less than 2 Varroa destructor parasites per 100 honey bees in a colony.

In one aspect, methods of reducing a parasite load comprise providing an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition to a host organism. An effective amount of a composition of the present disclosure causes a decrease in parasite load over a period. In one aspect, a decrease in parasite load can be measured within one day of delivery of an effective amount of a nucleic acid composition. In one aspect, the parasite load can be measured after two days. In one aspect, the parasite load can be measured after 3 days. In other respects, parasite load can be measured after 5 days or after 1 week.

In another aspect, parasite load can be measured more than once, for example, every 3 days, every 5 days, every week or once a month. In certain aspects according to the present disclosure, a decrease in the amount of parasites can be measured and compared with an untreated control organism or colony. In some respects according to the present description, the parasite is Varroa destructor ^ the host is the honey bee, Apis mellifera.

In some aspects according to the present disclosure, a reduction of the parasite load after a period means a decrease in the amount of parasites. In one aspect, the amount of parasites can decrease by 10%, 20%, 30%, or measurements.

more between measurements.

In another aspect, the amount of parasites can decrease by

40% more between measurements.

In measurements.

In measurements.

In measurements.

In another aspect, another aspect, another aspect, another aspect, another aspect, the number of parasites can decrease the number of parasites can decrease the number of parasites can decrease the number of parasites can decrease the number of parasites can decrease in on in on in the the the the

50%

60%

70%

80%

90% more between more more more more between between between the measurements.

In other aspects, parasite load can be measured as the average number of parasites per host organism. In one aspect, a decreased parasite load may comprise less than 20 parasites per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 15 parasites per 100 host organisms.

In one aspect, a decreased parasite load may comprise less than 10 parasites per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 5 parasites per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 4 parasites per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 3 parasites per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 2 parasites per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 1 parasite per 100 host organisms. In one aspect, a decreased parasite load may comprise less than 20 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 15 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 10 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 5 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 4 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 3 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 2 parasites per 1000 host organisms. In one aspect, a decreased parasite load may comprise less than 1 parasite per 1000 host organisms.

In some respects in accordance with the present disclosure, a host organism colony has an initial parasite load, prior to receiving a source of an effective amount of a nucleic acid. In one aspect, an initial parasite load may comprise less than 20 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 15 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 10 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 5 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 4 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 3 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 2 parasites per 100 host organisms. In one aspect, an initial parasite load may comprise less than 1 parasite per 100 host organisms.

In some aspects according to the present disclosure, an effective amount can be provided periodically or continuously. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided one, two, or three times per day. In other aspects, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided once per day. In another aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided one or more times every other day. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided every other day, every three days, or once a week. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided every two weeks. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided every three weeks. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided once a month. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided every two months. In one aspect, an effective amount of a nucleic acid composition can be continuously provided to an organism in need, eg, by providing a continuous source of food. In one aspect, an effective amount of a nucleic acid composition can be continuously provided as a bee ingestible composition. In some respects according to the present description, the parasite is Varroa destructor and the host is the honey bee, Apis mellifera. In some respects in accordance with the present disclosure, an antiparasitic, antiplagic, or insecticidal nucleic acid may be a dsRNA.

In some respects in accordance with the present disclosure, the parasitic load may decrease over a period. In one aspect, the period necessary for a parasite load to decrease may be 15 weeks. In another aspect, the period for a parasite load to decrease may be 12 weeks. In one aspect, the decrease in parasite load occurs over a period of 10 weeks. In one aspect, the period necessary for a parasite load to decrease may be 5 weeks. In another aspect, the period for a parasite load to decrease may be 2 weeks. In one aspect, the decrease in parasite load occurs over a period of 1 week. In some respects, the parasite load may decrease after one day, two days, or three days.

The present disclosure provides methods of reducing parasitization of a honey bee colony which comprise providing a bee colony with an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition. An effective amount of a composition of the present disclosure results in a reduction of parasitization over a period. In one aspect, a reduction in parasitization can be measured within one day of delivery of an effective amount of an antiparasitic, antiplagen, or insecticidal nucleic acid composition. In one aspect, the reduction of parasitization can be measured after two days. In one aspect, the reduction of parasitization can be measured after 3 days. In other aspects, the reduction of parasitization can be measured after 5 days or after 1 week. In another aspect, the reduction of parasitization can be measured more than once, for example, every 3 days, every 5 days, every week or once a month. In certain aspects according to the present disclosure, a reduction in parasitization can be measured and compared with an untreated control organism or colony.

In some respects according to the present disclosure, a reduction in parasitization after a period means a decrease in the total amount of parasites. In appearance, the amount of parasites can decrease by 10%, 20%, 30% measurements.

In another aspect, the amount of a plus between measurements.

In another aspect, the number of measurements.

In another aspect, the number of measurements.

In another aspect, the number of measurements.

In another aspect, the number of measurements.

In another aspect, the amount of parasites can decrease parasites can decrease parasites can decrease parasites can decrease parasites can decrease parasites can decrease by 40% more among those in in in in in the in the in

50%

60%

70%

80%

90% more more the more the more the more the measurements are.

In other aspects, the reduction of parasitization can be measured as the average number of parasites per host organism. In one aspect, a reduction in parasitization may comprise less than 20 parasites per 100 host organisms. In one aspect, a reduction in parasitization can comprise less than 15 parasites per 100 host organisms. In one aspect, a reduction in parasitization may comprise less than 10 parasites per 100 host organisms. In one aspect, a reduction in parasitization may comprise less than 5 parasites per 100 host organisms. In one aspect, a reduction in parasitization may comprise less than 4 parasites per 100 host organisms. In one aspect, a reduction in parasitization may comprise less than 3 parasites per 100 host organisms. In one aspect, a reduction in parasitization may comprise less than 2 parasites per 100 host organisms. In one aspect, a reduction in parasitization may comprise less than 1 parasite per 100 host organisms.

In some respects in accordance with the present disclosure, an effective amount of nucleic acid can be provided to nti parasitic river, antiplagen, or insecticide which results in a reduction of parasitation periodically or continuously. In one aspect, an effective amount of a nucleic acid composition can be provided one, two, or three times per day. In other aspects, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided once per day. In another aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided one or more times every other day. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided every other day, every three days, or once a week. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided continuously to an organism in need, eg, by providing a continuous source of food. In one aspect, an effective amount of an antiparasitic, antiplagic, or insecticidal nucleic acid composition can be provided continuously as a bee-ungestible composition. In some respects according to the present description, the parasite is Varna destructor and the host is the honey bee, Apis mellifera. In some respects in accordance with the present disclosure, a nucleic acid to river niparasite, antiplaga or insecticide may be a dsRNA.

In some respects according to the present disclosure, the reduction of parasitization may decrease over a period. In one aspect, the period necessary for a reduction in parasitization can be 15 weeks. In another aspect, the period for a reduction of parasitization can be 12 weeks. In one aspect, the reduction of parasitization occurs over a period of 10 weeks. In one aspect, the period necessary for a reduction in parasitization can be 5 weeks. In another aspect, the period for a reduction in parasitization can be 2 weeks. In one aspect, the reduction of parasitization occurs over a period of 1 week. In some respects, reduction of parasitization can occur after one day, two days, or three days.

In some respects in accordance with the present disclosure, a reduction in parasitation is measured by the number of surviving parasites compared to an initial measurement of the amount of parasites in a host organism colony. In one aspect, the parasite may be a Varroa destructor mite and the host may be a honey bee, Apis mellifera. In one aspect, the amount of surviving parasites may be 25% of the initial amount of parasites. In one aspect, the amount of surviving parasites may be 15% of the initial amount of parasites. In one aspect, the amount of surviving parasites may be 10% of the initial amount of parasites. In one aspect, the amount of surviving parasites may be 5% of the initial amount of parasites. In one aspect, the amount of surviving parasites may be less than 5% or even undetectable after providing a host colony with an effective amount of an antiparasitic, antiplagen, or insecticidal nucleic acid composition.

In one aspect, the present disclosure provides methods and compositions for reducing the susceptibility of bees to Varroa mite infestation. In other aspects, the present disclosure provides methods and compositions to prevent infestation of bee colonies. In another aspect, the present disclosure provides methods and compositions to reduce parasitization of honey bees by the Varroa destructor mite.

In accordance with the present disclosure, a host organism receiving a source of antiparasitic, antiplagen, or insecticidal nucleic acid, can accumulate nucleic acid in the body of the host, generally hemolymph. By harboring nucleic acid, these host organisms become resistant or less susceptible to parasitation. In other aspects, a host organism colony, provided with a source of nucleic acid, can accumulate nucleic acid in the host body of multiple members of the colony, thereby providing resistance or less susceptibility to a parasite. Nucleic acid found in host organisms that receive a nucleic acid source can be detected using methods known to those skilled in the art. In some respects in accordance with the present disclosure, an antiparasitic, antiplagic, or insecticidal nucleic acid may be a be RNA.

In one aspect of the present disclosure, methods and compositions are provided for treating Varroa mite infestations in bees by down-regulation of calmodulin and calmrodulin-related Varroa mite gene products. In one aspect, the compositions comprise an antiparasitic, antiplagic, or insecticidal nucleic acid corresponding to the calmodulin sequence of Varroa destructor of SEQ ID NO: 1. In one aspect, the compositions comprise an antiparasitic, antiplagen, or insecticidal nucleic acid that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 2. In one aspect, the compositions comprise an antiparasitic, antiplage, or insecticidal nucleic acid that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 69. In one aspect, the compositions comprise an antiparasitic, antiplagen, or insecticidal nucleic acid that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 70. In some aspects, the compositions comprise an antiparasitic, antiplage, or insecticidal nucleic acid that corresponds to a calmodulin sequence from Varroa destructor selected from SEQ ID NO: 71-87. In another aspect, the compositions comprise an antiparasitic, antiplagic, or insecticidal nucleic acid that corresponds to a Varroa destructor calmodulin sequence selected from SEQ ID NO: 3, 4, 88, and 89. In one aspect, the compositions comprise a small RNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 1. In one aspect, the compositions comprise a small RNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 2. In one aspect, the compositions comprise a small RNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 69. In one aspect, the compositions comprise a small RNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 70. In some aspects, the compositions comprise a small RNA corresponding to a Varroa destructor calmodulin sequence selected from SEQ ID NO: 71-87. In another aspect, the compositions comprise a small RNA that corresponds to a calmodulin sequence from Varroa destructor selected from SEQ ID NO: 3, 4, 88 and 89. In one aspect, the compositions comprise a dsRNA that corresponds to the calmodulin sequence from Varroa destroyer of SEQ ID NO: 1. In one aspect, the compositions comprise a dsRNA corresponding to the calmodulin sequence of Varroa destroyer of SEQ ID NO: 2. In one aspect, the compositions comprise a dsRNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 69. In one aspect, the compositions comprise a dsRNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 70. In some aspects, the compositions comprise a dsRNA corresponding to a calmodulin sequence from Varroa destructor selected from SEQ ID NO: 7187. In another aspect, the compositions comprise a dsRNA that corresponds to a calmodulin sequence from Varroa destructor selected from SEQ ID NO: 3, 4, 88, and 89. In one aspect, the compositions comprise an siRNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 1. In one aspect, the compositions comprise an siRNA that corresponds to the calmodulin sequence of Varroa destructor áe. SEQ ID NO: 2. In one aspect, the compositions comprise an siRNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 69. In one aspect, the compositions comprise an siRNA that corresponds to the calmodulin sequence of Varroa destructor of SEQ ID NO: 70. In some aspects, the compositions comprise an siRNA that corresponds to a Varroa destructor calmodulin sequence selected from SEQ ID NO: 71-87. In another aspect, the compositions comprise an siRNA that corresponds to a Varroa destructor calmodulin sequence selected from SEQ ID NO: 3, 4, 88, and 89. In some aspects according to the present disclosure, the composition may comprise a nucleic acid antiparasitic, antiplagic or insecticide that corresponds to a region of SEQ ID NO: 1 or 2. In other aspects according to the present description, the composition may comprise an antiparasitic, antiplagic or insecticidal nucleic acid corresponding to a region of SEQ ID NO: 69 or 70. In other aspects according to the present description, the composition may comprise a nucleic acid corresponding to a region of a sequence selected from SEQ ID NO: 3, 4, 88, and 89.

Varroa mites parasitize pupae and adult bees and reproduce in the pupa's brood cells. Mites use the mouth to pierce the exoskeleton and feed on the hemolymph of bees. The present inventors unexpectedly discovered that polynucleotide agents administered to bees to treat infestations with the Varroa mite occurred in the hemolymph of bees whereby they became available to the mite.

The present inventors have shown that calmodulin-targeting dsRNA fragments can be successfully transferred to Varroa mites (see, eg, Figure 2), that dsRNA can serve to down-regulate gene expression of calmodulin in the Varroa mite (see, eg, Figure 3A) and, furthermore, that the targeting of calmodulin genes genes for down-regulation can lead to a reduction in the number of Varroa mites (see, p . eg, Figure 3B).

Therefore, in accordance with one aspect of the present disclosure, there is provided a method of preventing or treating an infestation of a bee with the Varroa destructor mite, the method comprising administering to the bee an effective amount of an acidic agent. nucleic comprising a nucleic acid sequence that down-regulates the expression of a calmodulin gene from a Varroa destructor mite, thus avoiding or treating an infestation of a bee with the destructive Varroa mite.

In accordance with this aspect of the present disclosure, the agents of the present disclosure are used to prevent the Varroa destructor mite from living as a parasite on the bee or its larvae. The phrase Varroa destructoi mite refers to the external parasitic mite that attacks honey bees Apis cerana and Apis mellifera. The mite can be found in an adult stage, feeding on the bee, or in a larva stage, inside the honey bee's brood cell.

As mentioned, the agents of the present disclosure are capable of selectively downregulating the expression of a gene product of a Varroa destructor mite. As used herein, the phrase gene product refers to an RNA molecule or protein. According to one aspect, the gene product of the varroa mites destroyers a product that is essential for the viability of the mites. Downregulation of such a gene product would typically cause Varroa mite death. According to another aspect, the gene product of the Varroa destructors mite is a product that is essential for the reproduction of the mites. Downregulation of such a gene product would typically cause the Varroa mite to be prevented from reproducing and the eventual extermination of the mite population. According to another aspect, the gene product of the Varroa destructor mite is a product that is necessary to generate pathogenic symptoms in the bee. In some respects, the gene product of Varroa destructor is a calmodulin gene. In certain aspects, the calmodulin gene may comprise a nucleic acid sequence according to SEQ ID NO: 1 or SEQ ID NO: 2. In certain aspects, the calmodulin gene can comprise a nucleic acid sequence according to SEQ ID NO: 69 or SEQ ID NO: 70.

Some examples of gene products that can be down-regulated in accordance with this aspect of the present disclosure include, but are not limited to, a calmodulin gene.

In an aspect in accordance with the present disclosure, agents capable of down-regulating the expression of a gene product of a Varroa destructor mite or other parasite, can down-regulate the expression of the gene product in other animals to a lesser extent, such as the bee or other non-target organism. Consequently, certain agents of the present description are able to distinguish between the mite gene and the bee gene, downregulating the former to a greater extent than the latter. In some aspects, certain agents of the present disclosure can distinguish between the target gene in the target organism and the orthologs in non-target organisms, downregulating the former to a greater extent than the latter. In other aspects, the target gene of the parasite is down-regulated, whereas the homologous host gene is not. In another aspect, the target gene of the parasite does not have a homolog in the host. According to another aspect, the agents of the present description do not down-regulate the bee gene at all. For example, this can be done by targeting a gene that is differentially expressed in the mite and not in the bee, e.g. eg, the mite sodium channel gene - FJ216963. Alternatively, the agents of the present disclosure can target specific mite sequences of a gene that is expressed in the mite and in the bee.

According to one aspect, the agents of the present description target Varroa gene segments that are at least 100 bases in length and that do not carry any sequence of more than 19 bases that is entirely homologous to any sequence in the bee genome. or sequence of the human genome. Although it will be appreciated that more than one gene can be targeted to maximize the cytotoxic effect on Varroa mites, compositions comprising one or a few small RNAs would increase the likelihood of being a selective insecticidal composition since cross-reactivity with other insects can be reduced .

According to one aspect, a dsRNA composition corresponding to the Calmodulin-1 and Calmodulin-2 genes from Varroa destructor can be prepared (eg, using nucleic acid agents having the sequence as presented in SEQ ID NO: 1 to 4 and 69 to 89, their complements or nucleic acids directed to their regions).

It will be appreciated that in addition to down-regulating a number of genes, the present disclosure further provides and includes the use of various agents to down-regulate the same gene (eg, various nucleic acids or dsRNAs, each of which is hybrid with a different segment of the same gene). For example, in one aspect, a combination of one or more nucleic acids corresponding to a sequence selected from the group consisting of SEQ ID NO: 1 to 4, 6, 23, 26 to 35 and 69 to 89 can be used to increase the Cytotoxicity and effects on nti parasitize rivers of the composition. Tools capable of identifying species-specific sequences can be used for this purpose, e.g. eg, BLASTN and other similar computer programs. US Patent Publications No. 20090118214 and 20120108497 provide the use of dsRNA to prevent and treat viral infections in honey bees. US Patent Publication No. 20120258646 provides the use of dsRNA to control Varroa destructor in honey bees. Each publication is incorporated herein in its entirety.

The present disclosure provides and includes compositions and methods for down-regulating the expression of a gene in a target organism. In one aspect, the target organism may be a parasite. In certain respects, the parasite can be Varroa destructor. As used herein, the term "down-regulated expression" refers to causing, directly or indirectly, a reduction in transcription of a desired gene, a reduction in the amount, stability, or translatability of the transcription products (eg, RNA) of the gene and / or reduction in translation of the polypeptide encoded by the desired gene. Down-regulation of the expression of a gene product of a Varroa destructor mite can be monitored, for example, by direct detection of gene transcripts (for example, by PCR), by detection of polypeptides encoded by the gene or RNA of the bee pathogen (eg, by Western blot analysis or immunoprecipitation), by detection of the biological activity of the polypeptides encoded by the gene (eg, catalytic activity, ligand binding and the like) or by monitoring changes in the Varroa destructor mite (for example, reduced mite proliferation, reduced mite virulence, reduced mite motility, etc.) and by evaluating infectivity / pathogenicity of bees.

Down-regulation of a gene product of a parasite or pest can be performed at the genomic and / or transcriptional level using various agents that interfere with transcription and / or translation (eg, RNA silencing agents, ribozyme , DNAzyme and antisense nucleic acid molecules). Down-regulation of a gene product from a Varroa destructor mite can be performed at the genomic and / or transcriptional level using various agents that interfere with transcription and / or translation (eg, RNA silencing agents, ribozyme , DNAzyme and antisense nucleic acid molecules).

According to one aspect, the agent that down-regulates the expression of a gene product of a parasite or pest is a small RNA, such as an RNA silencing agent. In accordance with the present aspect, small RNA is greater than 15 base pairs in length. In another aspect, small RNA is greater than 50 base pairs in length. In one aspect, the small RNA is greater than 50 base pairs in length, but less than about 500 base pairs. In one aspect, the small RNA is greater than 100 base pairs in length, but less than about 500 base pairs. In one aspect, the small RNA is greater than 200 base pairs in length, but less than about 500 base pairs. In one aspect, the pest or parasite may be a destructive Varroa mite.

Another method of downregulating a gene product of a pest or parasite is by introducing small inhibitory RNAs (siRNAs). Another method of downregulating a Varroa mite gene product is by introducing small inhibitory RNAs (siRNAs).

In one aspect of the present disclosure, synthesis of the RNA silencing agents suitable for use with the present disclosure can be performed as follows. First, the target mRNA of the parasite or pest is scanned below the AUG start codon for AA dinucleotide sequences. The occurrence of each AA is recorded and the 19 adjacent 3 'nucleotides are recorded as potential siRNA target sites. Preferably, the siRNA target sites are selected from the open reading frame, since the untranslated regions (UTR) are richer in regulatory protein binding sites. UTR binding proteins and / or translation initiation complexes can interfere with binding of the siRNA endonuclease complex (Tuschl ChemBiochem. 2: 239-245). However, it will be appreciated that siRNAs targeting untranslated regions may also be effective, as demonstrated for GAPDH, where siRNA targeting 5'UTR mediates approximately 90% decrease in cellular GAPDH mRNA and suppressed protein level completely (available online at www.ambion.com/techlib/tn/91/912.html).

Second, potential target sites are compared to a suitable genomic database (eg, human, bee, monarch butterfly, mouse, rat, etc.) using any sequence alignment software, such as BLAST software available from the NCBI server (available online at www.ncbi.nlm.nih.gov/BLAST/). Putative target sites that show significant homology to other coding sequences are filtered.

Target sequences that qualify as a template for siRNA synthesis are selected. Preferred sequences are those that include a low G / C content, as they have been shown to be more effective in mediating gene silencing compared to those with a G / C content greater than 55%. Several target sites are preferably selected along the length of the target gene or sequence for evaluation. For a better evaluation of the selected siRNAs, preferably, a negative control is used together. The negative control siRNA preferably includes the same nucleotide composition as the siRNAs, but lacks significant genome homology. Therefore, a misaligned siRNA nucleotide sequence is preferably used, provided that it does not present any significant homology to any other gene or target sequence of the parasite or pest. An example of a misaligned nucleotide sequence is provided in SEQ ID NO. 5.

For example, an siRNA that can be used in this aspect of the present disclosure is one that targets a mite-specific calmodulin gene. Examples of siRNAs are provided in SEQ ID NO: 3, 4, 88, and 89.

It will be appreciated that the RNA silencing agent of the present disclosure should not be limited to molecules containing only RNA, but also comprises chemically modified nucleotides and non-nucleotides.

In some aspects, the RNA silencing agent provided herein may be functionally associated with a peptide that penetrates the cell. As used herein, a cell-penetrating peptide is a peptide comprising a short amino acid sequence (approximately 12 residues) or a functional motif that confers the energy independent (i.e. non-endocytotic) translocation properties associated with the transport of the membrane-permeable complex in the plasma and / or nuclear membranes of a cell. The cell-penetrating peptide used in the membrane-permeable complex of the present disclosure preferably comprises at least one non-functional cysteine ​​residue, which is free or is derived to form a disulfide bond with a double-stranded ribonucleic acid that is has modified for that union. Representative amino acid motifs conferring such properties are listed in US Patent No. 6,348,185, the content of which is expressly incorporated herein by reference. The cell-penetrating peptides of the present disclosure preferably include, but are not limited to, penetratin, transportan, plsl, TAT (48-60), pVEC, MTS and MAP.

Another agent capable of down-regulating a gene product of a pest or parasite is a DNAzyme molecule capable of specifically cleaving a mRNA transcript or DNA sequence of the bee pathogen polypeptide. DNAzymes are single-chain polynucleotides capable of cleaving single and double target sequences (Breaker, RR and Joyce, G. Chemistry and Biology 1995; 2: 655; Santoro, SW and Joyce, GF Proc. Nati, Acad. Sci. USA 1997 ; 943: 4262). A general model (model 10-23) has been proposed for the DNAzyme. DNAzymes 10-23 have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can efficiently cleave its substrate RNA at purine: pyrimidine junctions (Santoro, SW and Joyce, GF Proc. Nati, Acad. Sci. USA 199; for a review of DNAzymes, see Khachigian, LM, Curr Opin Mol Ther 4: 119-21 (2002)). In one aspect, the gene product of the parasite or pest may be a gene product of the Varroa mite. Down-regulation of the gene products of a pest or parasite can also be accomplished through the use of an antisense polynucleotide capable of specifically hybridizing to an mRNA transcript encoding the gene product of the pest or parasite. The design of antisense molecules that can be used to effectively down-regulate a gene product of a pest or parasite must be done considering two important aspects of the antisense approach. The first aspect is the administration of the oligonucleotide into the cytoplasm of suitable cells, while the second aspect is the design of an oligonucleotide that specifically binds to the target RNA sequence or designated mRNA within cells in a way that inhibits its translation. In one aspect, the gene product of the parasite or pest may be a gene product of the Varroa mite. In another aspect, the gene product of the parasite or pest can be a calmodulin gene product.

There are multiple delivery strategies that can be used to efficiently deliver oligonucleotides into various cell types (see, for example, Luft J Mol Med 76: 75-6 (1998); Kronenwett et al. Blood 91: 852-62 ( 1998); Rajur et al. Bioconjug Chem 8: 935-40 (1997); Lavigne et al. Biochem Biophys Res Commun 237: 566-71 (1997) and Aoki et al. (1997) Biochem Biophys Res Commun 231: 540- 5 (1997)).

In addition, algorithms also exist to identify sequences with the highest expected binding affinity for their target mRNA based on a thermodynamic cycle that represents the energy of structural modifications to the target mRNA and oligonucleotide (see, for example, Walton et al. Biotechnol Bioeng 65: 1-9 (1999)). Such algorithms have been successfully used to implement an antisense approach in cells. For example, the algorithm developed by Walton et al. allowed scientists to successfully design antisense oligonucleotides for transcripts of rabbit betaglobin (RBG) and mouse tumor necrosis factor alpha (TNF alpha). More recently, the same research group reported that the antisense activities of rationally selected oligonucleotides against three model target mRNAs (human lactate dehydrogenase A and B and rat gpl) in cell culture as evaluated by a kinetic PCR technique were effective in the majority of cases, including tests against three different targets in two cell types with phosphodiester chemistries and phosphorothioate oligonucleotides. Furthermore, various approaches were also published to design and predict the efficiency of specific oligonucleotides using an in vitro system (Matveeva et al., Nature Biotechnology 16: 1374-1375 (1998)).

Another agent capable of down-regulating a gene product of a pest or parasite is a ribozyme molecule capable of specifically cleaving a mRNA transcript encoding the Varroa mite gene product. Ribozymes are increasingly being used for specific sequence inhibition of gene expression by cleavage of mRNAs encoding proteins of interest (Welch et al., Curr Opin Biotechnol. 9: 486-96 (1998)). The ability to design ribozymes to cleave any specific target RNA, including viral RNA, makes them valuable tools in basic research and therapeutic applications. In one aspect, the gene product of the parasite or pest may be a gene product of the Varroa mite. In another aspect, the gene product of the parasite or pest can be a calmodulin gene product.

A further method of down-regulating the expression of a gene product of a pest or parasite in cells is via triplex-forming oligonucleotides (TFO). Recent studies have shown that TFOs can be designed that can recognize and bind to polyurin / polypyrimidine regions in double-stranded helical DNA in a sequence-specific manner. These recognition rules are described in Maher III, L. 1, et al., Science (1989) 245: 725-7; Moser, Η. E., et al., Science, (1987) 238: 645-6; Beal, PA, et al., Science (1992) 251: 1360-1363; Cooney, M., et al., Science (1988) 241: 456-459; and Hogan, Μ. E., et al., EP publication 375408. Modification of the oligonucleotides, as well as the introduction of intercalators and substitutions in the main chain, and the optimization of the binding conditions (pH and concentration of cations) have helped to overcome the obstacles inherent in TFO activity such as the repulsion of loading and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, J Clin Invest 2003; 112: 487-94). In one aspect, the gene product of the parasite or pest may be a gene product of the Varroa mite. In another aspect, the gene product of the parasite or pest can be a calmodulin gene product.

In general, the triplex-forming oligonucleotide has the sequence correspondence:

<td>oligo</td><td>3'-A</td><td>G</td><td>G</td><td>T</td>

<td>duplex</td><td>5'— A</td><td>G</td><td>C</td><td>T</td>

<td>duplex</td><td>3'-T</td><td>C</td><td>G</td><td>TO</td>

However, triplets A-AT and G-GC have been shown to have the highest triple helical stability (Reither and Jeltsch, BMC Biochem, 2002, Sept. 12, Epub). The same authors have shown that TFOs designed according to the A-AT and G-GC rule do not form non-specific triplexes, indicating that triplex formation is, in fact, sequence-specific.

Triplex-forming oligonucleotides preferably have at least 15, more preferably 25, more preferably, or more nucleotides in length up to 50 or 100 bp.

Transfection of cells (eg through cationic liposomes) with TFO and formation of the triple helical structure with the target DNA induces steric and functional changes, blocks transcription initiation and elongation, allowing the introduction of the desired sequence changes in endogenous DNA and what causes specific down-regulation of gene expression.

A detailed description of the design, synthesis and administration of effective TFOs can be obtained from US Patent Publications No. 2003/017068 and 2003/0096980 to Froehler et al., And 2002/0128218 and 2002/0123476 to Emanuele et al., and US Patent No. 5,721,138 to Lawn.

The polynucleotide down-regulation agents of the present disclosure can be generated according to any polynucleotide synthesis method known in the art, such as enzymatic synthesis or solid phase synthesis. Kits and reagents for executing solid phase synthesis are marketed, for example, by Applied Biosystems. Any other method can also be used for said synthesis; actual synthesis of polynucleotides is within the capabilities of those skilled in the art and can be accomplished through established methodologies as described, for example, in Molecular Cloning: A laboratory Manual Sambrook et al., (1989) ; Current Protocols in Molecular Biology volumes I-III Ausubel, RM, ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley &amp; Sons, New York (1988) and Oligonucleotide Synthesis Gait, MJ, ed. (1984) using solid phase chemistry, p. For example, cyanoethyl phosphoramidite followed by deprotection, desalting and purification, for example, by an automatic trifil method or HPLC.

The polynucleotide agents of the present disclosure may comprise heterocyclic nucleosides consisting of purines and pyrimidine bases, attached at a 3 'to 5' phosphodiester linkage. The polynucleotide agents used preferably are those modified either at the backbone, at the internucleoside linkages, or at the bases, as broadly described herein.

Some specific examples of polynucleotide agents useful in accordance with this aspect of the present disclosure include polynucleotide agents that contain modified backbones or unnatural internucleoside linkages. Polynucleotide agents that have modified backbones include those that retain a phosphorus atom in the backbone, as described in US Patent Nos: 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;

5.286.717; 5.321.131; 5.399.676; 5.405.939; 5.453.496; 5.455.233; 5.466.677; 5.476.925;

5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361 and 5,625,050.

The main structures of modified polynucleotides include, for example, phosphorothioates, chiral phosphorothioates, phosphorad itioates, phosphotriesters, aminoalkyl phosphotriesters, methyl phosphonates and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'- phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, Thionoalkyl phosphotryesters and boranophosphates that have normal 3'-5 'linkages, 2'-5' linked analogs of these, and those that have reverse polarity where adjacent pairs of nucleoside units are 3'-5 'to 5'-linked. 3 'or 2'-5' to 5'-2 '. Various salts, mixed salts and free acid forms can also be used.

Alternatively, modified polynucleotide structures that do not include a phosphorous atom in them have structures consisting of short-chain alkyl or cycloalkyl internucleoside linkages, heteroatom mixed alkyl or cycloalkyl internucleoside linkages, or one or more heteroatomic or short-chain heterocyclic internucleoside linkages. These include those that have morpholine linkages (formed in part by the sugar part of a nucleoside); siloxane structures; sulfide, sulfoxide and sulfone structures; formacetyl and thioformacetyl structures; methylene formacetyl and thioformacetyl structures; structures that are suitable for alkene; sulphamate structures; methyleneimino acid and methylenehydrazine structures; sulfonate and sulfonamide structures; amide structures; and others that have mixtures with parts of components N, 0, S and CH₂, as described in US Patent Nos .: 5,034,506; 5,166,315; 5,185,444; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;

5.470.967; 5.489.677; 5.541.307; 5.561.225; 5.596.086; 5.602.240; 5.602.240; 5.608.046;

5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,214,134; 5,466,677; 5,610,289; 5,633,360; 5,677,437 and 5,677,439.

Other polynucleotide agents that can be used in accordance with the present description are those modified in the internucleoside and sugar junction, that is, the main structure of the nucleotide units are replaced by new groups. The base units are maintained for complementation with the appropriate polynucleotide target. An example for such a mimetic polynucleotide includes peptide nucleic acid (PNA). A PNA polynucleotide refers to a polynucleotide where the sugar backbone is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The bases are conserved and attached directly or indirectly to aza nitrogen atoms in the amide part of the main chain. US patents that describe the preparation of PNA compounds include, but are not limited to, US Patent Nos. 5,539,082; 5,714,331 and 5,719,262, each of which is incorporated herein by reference. Other modifications to the main chain, which can be used in the present disclosure, are described in US Patent No. 6,303,374.

The polynucleotide agents of the present disclosure may also include base modifications or substitutions. As used herein, unmodified or natural bases include the purine bases adenine (A) and guanine (G) and the bases of pyrimidine thymine (T), cytosine (C), and uracil (U). Modified bases include, but are not limited to, other synthetic and natural bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiotimine and 2-thiocytosine, 5-halourazyl and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil. (pseudouracil), 4thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3deazaguanine and 3-deazaadenine. Additional bases include those described in US Patent No. 3,687,808, those described in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, JI, ed. John Wiley &amp; Sons, 1990, those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 613, and those described by Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-2, Crooke, ST and Lebleu, B., ed., CRC Press, 1993. These bases are particularly useful for increasing the binding affinity of the disclosed oligomeric compounds. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase duplex stability of nucleic acid by 0.6-1.2 ° C (Sanghvi YS et al., (1993), Antisense Research and Applications, CRC Press, Boca Raton 276 -278) and are currently preferred base substitutions, even more specifically when combined with 2'-Ometoxyethyl sugar modifications.

After synthesis, the polynucleotide agents of the present disclosure can optionally be purified. For example, polynucleotides can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination of these. Alternatively, polynucleotides can be used without purification, or with minimal purification, to avoid losses due to sample processing. The polynucleotides can be dried for storage or can be dissolved in an aqueous solution. The solution may contain buffers or salts to promote hybridization and / or stabilization of duplex chains.

It will be appreciated that a polynucleotide agent of the present disclosure can be provided per se, or as a nucleic acid construct comprising a nucleic acid sequence encoding the polynucleotide agent. Typically, the nucleic acid construct comprises a promoter sequence that is functional in the host cell, as detailed below.

The polynucleotide sequences of the present disclosure, under the control of an operably linked promoter sequence, may be flanked by additional sequences that advantageously affect their t / transcription or the stability of a resulting transcription. Such sequences are generally located above the promoter and / or below the 3 'end of the expression construct.

The term "operably linked," as used with reference to a regulatory sequence and a structural nucleotide sequence, means that the regulatory sequence causes regulated expression of the linked structural nucleotide sequence. Regulatory sequences or control elements refer to nucleotide sequences located above, within, or below a structural nucleotide sequence, and which affect the time and level or amount of RNA transcription, processing, or stability, or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translational leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, pause sequences, polyadenylation recognition sequences, and the like.

It will be appreciated that nucleic acid agents can be administered to the pest or parasite in various ways. According to one aspect, nucleic acid agents are administered directly to the pest or parasite (eg, by spraying on a mite infested hive). Nucleic acid agents, or their coding constructs, can enter the mite's bodies by diffusion. In this regard, the promoter for nucleic acid construction is typically operative in mite cells. In one aspect, the pest or parasite may be Varroa destructor.

It will be appreciated that since many parasites use their mouths to pierce the exoskeleton of the host arthropod and feed on the arthropod hemolymph, the present disclosure contemplates the administration of the polynucleotide agents of the present disclosure to the arthropod, whereby they are presented in the hemolymph of the arthropod and are thus available for the pest or parasite. Therefore, according to another aspect, nucleic acid agents are indirectly administered to the pest or parasite (for example to a mite through a host bee). In this regard, the promoter for nucleic acid construction is typically operational in host cells. In certain respects, the pest or parasite may be Varroa destructor / the host arthropod may be a bee.

According to one aspect, nucleic acid agents are administered to infested hosts by spraying. Nucleic acid agents, or their coding constructs, can enter the bodies of hosts by diffusion. In certain aspects, the pest or parasite may be Varroa destructor and the host arthropod may be a bee.

In accordance with another aspect, nucleic acid agents are administered to the host through its food. The present inventors consider that after ingestion of the nucleic acid agents of the present disclosure, the agents can be presented, for example in a host arthropod in the host hemolymph, whereby it becomes available to the parasite, for example, a Varroa mite.

Therefore, the polynucleotides of the present description can be synthesized in vitro or in vivo, for example, in a bacterial or yeast cell, and can be added to food. For example, double-stranded RNA can be synthesized by adding two opposing promoters (eg, T7 promoters) to the ends of the gene segments, where the promoter is immediately positioned 5 'to the gene and the promoter the gene segment is immediately placed 3 'in the opposite orientation. DsRNA can be prepared by in vitro transcription with T7 RNA polymerase.

Examples of sequences for synthesizing nucleic acids, including dsRNA, are presented in accordance with aspects of the present description in SEQ ID NO: 1 to 4, 6, 23, 26 to 35 and 69 to 89.

It will be appreciated that some pests or parasites cause wound sites in the exoskeleton of a host arthropod. Such wound sites harbor bacterial infections.

For example, a host bee wound site may harbor bacteria such as Melissococcus pluton, which causes European foulbrood. In addition to parasitic effects, parasites are known to act as vectors for multiple pathogens and parasites. For example, Varroa mites are suspected of acting as vectors for numerous honey bee pathogens, including deformed wing virus (DWV), Kashmir bee virus (KBV), acute bee paralysis virus (ABPV) and Royal Black Cell Virus (BQCV) and can weaken the immune systems of their hosts, leaving them vulnerable to infection.

Therefore, by killing the pest or parasite (or preventing its reproduction), the anti-parasitic, anti-pest, or insecticidal agents of the present disclosure can be used to prevent and / or treat bacterial infections of host organisms. For example, Melissococcus pluton and viral infections in host bees caused by the above viruses. Since Varroa mite infestation and viral infections are believed to be responsible for colony collapse problem (CCD), the present agents can also be used to prevent or reduce the susceptibility of a bee colony to CCD.

It will be appreciated that in addition to providing antiparasitic, antiplague, or insecticidal nucleic acid agents for the reduction of infection and infestation of the bee pathogen, the application of adequate sanitation (for example, refraining from reusing infested hives) may increase efficacy. of treatment and prevention of infections.

The present disclosure also includes and provides yeast cells and bacteria that are transgenic and express a selective insecticide. In one aspect, a nucleic acid encoding a small RNA, dsRNA, miRNA, or a small or mRNA resistant target nucleic acid molecule used herein is operably linked to a promoter and, optionally, to a terminator. In some embodiments, yeast cells and transgenic bacteria are killed, for example, by the application of heat or pressure. In some embodiments, yeast cells and transgenic bacteria are lysed before providing the selective insecticide to the target organism. In some embodiments, the yeast cells and transgenic bacteria are not lysed.

In one aspect, an exogenous nucleic acid molecule used herein is either encoding a small RNA, or in a specific aspect a siRNA, which can modulate the expression of a gene in a target organism. In one aspect, an exogenous nucleic acid encodes a small RNA having at least 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98 % or 99% sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1-4 and 6-89. In another aspect, an exogenous nucleic acid molecule used herein is or encodes a dsRNA molecule. In another aspect, an exogenous nucleic acid molecule used herein is or encodes an artificial miRNA. In another aspect, an exogenous nucleic acid molecule used herein is or encodes an siRNA. In one aspect, an exogenous nucleic acid molecule used herein is or encodes a precursor for a small RNA. In another aspect, an exogenous nucleic acid molecule used herein is or encodes a precursor for a miRNA or siRNA. In one aspect, an exogenous nucleic acid molecule used here is a natural molecule. In another aspect, an exogenous nucleic acid molecule used here is a synthetic molecule.

In one aspect, an exogenous nucleic acid molecule used herein is either encoding a stem-loop precursor of a small RNA or in a specific aspect a miRNA comprising a sequence having at least 80%, 85%, 88% , 90%, 92%, 95%, 96%, 97%, 98% or 99% of sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1-4 and 6 -89. A stem-loop precursor used herein comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1-4 and 6-89.

In one aspect, an exogenous nucleic acid molecule used herein is naked or expressed RNA from a nucleic acid expression construct, when operably linked to a regulatory sequence.

In one aspect, a recombinant DNA construct or a transgene described herein further comprises a transcription terminator.

It is hoped that during the life of a patent derived from the present application, many relevant methods can be developed to down-regulate the expression of gene products and the scope of the term down-regulate the expression of a gene product from a mite is intended to be Varroa destructor includes all these new technologies a priori.

It is understood that certain features of the disclosure, which are described in the context of separate aspects for clarity, may also be provided in combination in a single aspect. Rather, various features of the disclosure that are described in the context of a single aspect for brevity may also be provided separately or in any suitable subcombination or as appropriate in any other described aspect of the disclosure. Certain features described in the context of various aspects should not be considered essential features of those aspects, unless the aspect is inoperative without these elements. Various aspects of the present disclosure as set forth above and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

EXAMPLE 1 Varroa mite calmodulin gene sequences

The calmodulin genes (CAM) provided in Table 1 (SEQ ID NO: 1 and 2), or their corresponding transcripts, were used as targets for polynucleotide compositions comprising a polynucleotide with at least 18 contiguous nucleotides identical or complementary to said genes or transcripts. The gene sequences provided in Table 1, the protein sequences encoded by said genes, or the sequences present within said genes were used to obtain orthologous calmodulin (CAM) genes from other arthropod pest and parasite species not listed in table 1. Such orthologous genes and their transcripts can serve as targets for the polynucleotides provided herein or as a source of antiparasitic, antiplague or insecticide polynucleotides that are specifically designed to target orthologous genes or their transcripts.

TABLE 1.

Calmodulin (CAM) genes targeted by Varroa destructor

<td>Gene name</td><td>I KNOW THAT ID</td><td>Open Reading Frame DNA Sequence</td>

<td>CAM-1</td><td> 1</td><td>ATGGCTGATCAGCTAACTGAGGAACAGATCGCCGAGTTCAAAGAGGCGTTTAGCC TGTTTGACAAGGACGGAGATGGCACGATCACGACAAAGGAGCTCGGTACGGTAAT GCGATCTCTCGGCCAGAACCCCACTGAGGCTGAACTGCAGGACATGATCAACGAG GTCGACGCCGACGGCTCCGGAACGATAGATTTCCCTGAGTTCCTCACAATGATGG CAAGAAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGAGAGGCGTTCCGCG TATTCGACAAGGATGGCAACGGTTTCATTTCGGCGGCCGAGCTCAGGCACGTTAT GACCAACCTTGGCGAGAAGCTTACGGACGAGGAGGTAGATGAGATGATTCGGGA GGCAGATATTGACGGTGATGGTCAGGTCAACTACGAGGAGTTCGTCACCATGATG ACGTCCAAGTAA</td>

<td>CAM-2</td><td> 2</td><td>ATGGCGGATCAGCTGACCGAGGAGCAAATCGCCGAATTCAAGGAGGC1 1 1CAGCC TGTTCGATAAAGACGGTGATGGCACAATTACGACCAAGGAACTAGGGACCGTCAT GCGGTCCCTCGGCCAGAACCCTACTGAGGCTGAGCTTCAAGACATGATCAACGAG GTCGACGCTGACGGTAACGGCACTATTGACTTTCCAGAGTTTCTCACGATGATGG CGCGTAAAATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCTTTTAGGG TTTTTGATAAAGACGGAAATGGCTTCATTTCGGCTGCAGAGCTGAGGCACGTAAT GACCAACCTTGGCGAAAAGCTCACGGACGAGGAAGTGGACGAGATGATCCGCGA GGCGGATATCGACGGCGACGGACAGGTCAACTACGAGGAGTTCGTCACGATGAT GACATCAAAATGA</td>

For each calmodulin DNA gene sequence provided in SEQ ID NO:

and 2, either double-stranded or single-stranded RNA or DNA fragments in sense or antisense orientation or both are fed in vitro to Varroa mites grown in a petri dish or topically applied to bee hives to effect expression of the target genes. of CAM and obtain a reduction in the population of the Varroa destructor mites.

EXAMPLE 2

Suppression of calmodulin (CAM) genes from Varroa destructor

Polynucleotides are provided for the suppression of calmodulin gene expression (CAM) in the Varroa cfesírí / ctor mite corresponding to SEQ ID NO: 3 and 4 (Table 2) and were used to suppress calmodulin gene expression ( CAM) in the Varroa destructor mite. SEQ ID NO: 3 and 4 describe a 373 bp dsRNA polynucleotide sequence and a 186 bp dsRNA polynucleotide sequence, respectively, selected from CAM-1 (SEQ ID NO: 1). SEQ ID NO: 3, corresponding to the dsRNA polynucleotide CAM_L / CAM373 covers most of the open reading frame of the CAM-1 gene (SEQ ID NO: 1) of calmodulin. SEQ ID NO 4, corresponding to the dsRNA polynucleotide CAM_S / CAM186 is a partial fragment of CAM_L / CAM373 (SEQ ID NO: 3) and is also derived from CAM-1 (SEQ ID NO: 1). SEQ ID NO: 5 in Table 2 is a polynucleotide sequence of the control dsRNA sequence with a sequence identity not greater than 19 bp with any known Varroa destructor gene.

TABLE 2

DsRNA Targeting Calmodulin (CAM) Genes from Varroa destructor

<td>DsRNA Name</td><td>SEQ ID</td><td>Nucleic acid sequence</td>

<td>CAM L / CAM373</td><td> 3</td><td>ACAGAUCGCCGAGUUCAAAGAGGCGUUUAGCCUGUUUGACAAGGACGGAGAUG GCACGAUCACGACAAAGGAGCUCGGUACGGUAAUGCGAUCUCUCGGCCAGAACC CCACUGAGGCUGAACUGCAGGACAUGAUCAACGAGGUCGACGCCGACGGCUCCG GAACGAUAGAUUUCCCUGAGUUCCUCACAAUGAUGGCAAGAAAGAUGAAGGACA CCGACUCGGAGGAGGAGAUCCGAGAGGCGUUCCGCGUAUUCGACAAGGAUGGC AACGGUUUCAUUUCGGCGGCCGAGCUCAGGCACGUUAUGACCAACCUUGGCGA GAAGCUUACGGACGAGGAGGUAGAUGAGAUGAUUCGGGAGGCAGAUAULIGAC</td>

<td>CAM_S / CAM 186</td><td> 4</td><td>ACAAUGAUGGCAAGAAAGAUGAAGGACACCGACUCGGAGGAGGAGAUCCGAGAG GCGUUCCGCGUAUUCGACAAGGAUGGCAACGGUUUCAUUUCGGCGGGGCACGUUAUGACCAACCUUGGCGAGAAGCU</td>

<td>SCRAM</td><td> 5</td><td>AUACUUACUGGUGCUAAUUUUUAUCGAGGAUGCCCAACUCCCCCCACUUUAAAA CUGCGAUCAUACUAACGAACUCCCGAAGGAGUGAAAGGUGUCUAUGUUGAGCU UAAUAACCUACCUUGCGAGCAAAGAAGGACUAGUUGACCCUGGGCACCCUAUAU UGUUAUGUUGUUUCGAACUGAGUUGGCACCCAUGCUGCACAUGCAACAAACAU GUCGGCCUUCGUGUCUAUCCUAGAAAAGUACCUGUGAACUUGGCUGUCUACAU CAUCAUC</td>

EXAMPLE 3

Bioensavo of Varroa destructor 3 days after treatment with specific dsRNA

Adult female mites were collected from honey bee colonies and placed in a petri dish on an artificial diet solution containing a mixture of 1% tryptone, 0.5% yeast extract, 1% NaCI and 15 mg / mL of agar. In this example, the diet was supplemented with 50 pg of kanamycin per 1 mL of diet solution. The agar / diet solution was further supplemented with 200-500 pg / mL of dsRNA and the resulting solution was poured into a petri dish. The dsRNA in this example consists of SEQ ID NO: 3 (CAM_L / CAM373) or SEQ ID NO: 5 (SCRAM). Fifteen mites were applied to each plate and the experiment was performed in triplicate. The plates of the diet were incubated with the mites at 29 ° C with 50-60% relative humidity. At specific time intervals, the plates were inspected and the dead mites were counted and removed. For mortality studies, mites were counted three days after their placement in the diet (FIG. 2). FIG. 2 shows that all mites died three days after treatment compared to untreated plaques or plaques on which mites were fed a diet supplemented with the non-specific dsRNA polynucleotide (SCRAM).

EXAMPLE 4

Bioensavo of Varroa destructor 5 days after treatment with dsRNA directed to calmodulin

Adult female mites were collected from honey bee colonies and placed in a petri dish on an artificial diet solution. The artificial diet contained a mixture of 1% tryptone, 0.5% yeast extract, 1% NaCI, and 15 mg / mL agar. In this example, the diet was supplemented additionally with antifungal solution (lOOx, Sigma Aldrich) at 8x final concentration, 500 pg / mL of kanamycin and 220 U / mL of nystatin. The agar / diet solution was further supplemented with 200-500 pg / mL of dsRNA and the resulting solution was poured into a petri dish. The dsRNA in this example consists of SEQ ID NO: 3 (CAM_L / CAM373) or SEQ ID NO: 4 (CAM_S / CAM 186) or SEQ ID NO: 5 (SCRAM). Fifteen mites were applied to each plate and the experiment was performed in triplicate. The plates of the diet were incubated with the mites at 29 ° C with 50-60% relative humidity. At specific time intervals, the plates were inspected and the dead mites were counted and removed. For mortality studies, mites were counted five days after their placement in the diet (FIGS. 3A and 3B). For molecular analysis, live mites were removed from the plates, instantly frozen in liquid nitrogen, and TAQMAN ™ analysis was performed to assess calmodulin (CAM) RNA levels. FIG. 3A, RNA levels for calmodulin (CAM) genes in mites exposed to SEQ ID NO: 3 (CAM_L / CAM373) or SEQ ID NO: 4 (CAM_S / CAM186) were greatly reduced compared to nonspecific treatment (SCRAM) or the absence of treatment (CNTR). FIG. 3B, statistically significant mortality was observed in mites exposed to dsRNA against calmodulin (CAM) 5 days after treatment.

EXAMPLE 5

Method for administering dsRNA polynucleotides targeting Varroa genes using a spray-dried or semi-solid formulation

DsRNA used to suppress Varroa target calmodulin (CAM) gene expression was prepared in a formulation containing 1 part dsRNA and ~ 14 parts trehalose in a phosphate buffer (a 1.15mM KH solution₂PO₄ (monobasic) and 8 mM Na₂HPO₄(dibasic), pH 8.0) as illustrated in Table 3. Using a mini Büchi B290 spray dryer, the liquid formulation was sprayed in droplets and heated with gas to produce a fluid powder.

TABLE 3

Preparation of the formulation

<td>DsRNA</td><td>Initial buffer (X% w / v trehalose + buffer phosphate buffer)</td><td>Final buffer (X% w / v trehalose + buffer phosphate buffer)</td><td>Total Vol (mL)</td><td>Initial buffer (mL)</td><td>DsRNA stock solution (mL)</td><td>Proportion</td><td>Active ingredient concentration (IA) (mg / mL)</td><td>Concentration of active ingredient (IA) (% of solids)</td><td>Proportion of IA (dsRNA) to buffer (trehalose + phosphate buffer)</td>

<td>CAM L / CAM373</td><td> 40</td><td> 10</td><td> 1100</td><td> 275.00</td><td> 825.00</td><td>¹/4</td><td> 7.20</td><td> 0.720</td><td> 13.9</td>

<td>CAM S / CAM186</td><td> 40</td><td> 10</td><td> 1285</td><td> 321.21</td><td> 963.75</td><td>V4</td><td> 6.75</td><td> 0.675</td><td> 14.8</td>

The resulting particles were formulated with powdered sugar and applied evenly to the hives by spreading the powdered sugar evenly over the frames.

In other aspects, a semi-solid preparation of the spray dried material was prepared with water and the sugar-water (bee-sweet) formulation is supplied to the bee hives by allowing the bees to feed on it.

EXAMPLE 6 Reduction in v / Vodel Varroa mite in bee hives after treatment with CalRdulin gene targeting RNAse (CAMA

Varroa mites infesting adult honey bees were collected from the hives and counted using a standard mite counting methodology. Hives were treated with spray-dried dsRNA according to Example 7 comprising SEQ ID NO: 3 (CAM-L), SEQ ID NO: 4 (CAM-S) or untreated (CONTROL). The mite load of each hive was evaluated at the beginning of the experiment and 2 weeks, 4 weeks and 12 weeks after treatment. FIG. 4 shows the mite load of the treated hives compared to the hives that did not receive the treatment. The number of mites counted to 100 adult bees was normalized and represents the Varroa mite load.

EXAMPLE 7

Detection of transitive sticky RNAs in Karroa after treatment with Calmodulin (CAM) genes directed to dsRNA,

Varroa mites were collected from hives treated with dsRNA polynucleotides of SEQ ID NO: 3 and collected from the hive 7 days after treatment. Varroa RNA was extracted and small RNA sequencing analysis was performed using the SOLiD platform. Most of the small RNA molecules were detected outside the region of the dsRNA sequence and specifically towards the 3 'part of the dsRNA region of SEQ ID NO: 3. Furthermore, most of the transitive readings were in the antisense orientation relative to the Calmodulin gene transcription sequence (CAM). Furthermore, small RNA specific for CAM-2 (SEQ ID NO: 2) was detected in this experiment despite the fact that the hives were treated with dsRNA for SEQ ID NO: 3, which is predicted to be specific for CAM-1 ( SEQ ID NO: 1). This observation supports the hypothesis that suppression of RNA expression and generation of transitive small RNA in Varroa works even when only a small fragment between the two genes shares complete identity at the DNA level (in this case 23 nucleotides).

EXAMPLE 8

Calmodulin gene homologs (CAM) of arthropod pest and parasite species and corresponding dsRNA polynucleotides

Using a standard bioinformatics technique and sequences SEQ ID NO: 1 and 2 for Varroa destructor, a set of 31 conserved calmodulin (CAM) gene sequences was identified in arthropod pest species that infest either other arthropods or mammals and that will focus on gene regulation. These sequences were identified and presented as a phylogenetic tree in FIG. 1. The DNA sequences in FIG. one they were further analyzed by identifying the 373 bp domain conserved within each sequence corresponding to SEQ ID NO: 3 (CAM_L / CAM373). Table 4 lists the SEQ ID NOs of the newly identified calmodulin (CAM) gene sequences, as well as the corresponding 373 bp dsRNA polynucleotide trigger sequences. The 373 bp polynucleotide dsRNA sequences will be evaluated either alone or in combination in direct feeding assays against their respective arthropod species.

TABLE 4

The identified calmodulin (CAM) gene sequences of arthropod pests or parasites and their corresponding 373 bp RNA polynucleotides

<td>SEQ ID NO</td><td>Gene name</td><td>Organism / species</td><td>Kind</td>

<td> 6</td><td>CAM-3</td><td>Varroa destroyer</td><td>CDNA</td>

<td> 7</td><td>CAM-1</td><td>Ixodes scapularís</td><td>CDNA</td>

<td> 8</td><td>CAM-1</td><td>Aedes aegypti</td><td>CDNA</td>

<td> 9</td><td>CAM-1</td><td>Culex quinquefasciatus</td><td>CDNA</td>

<td> 10</td><td>CAM-1</td><td>Acyrthosiphon pisum</td><td>CDNA</td>

<td> 11</td><td>CAM-1</td><td>Harpegnathos saltator</td><td>CDNA</td>

<td> 12</td><td>CAM-1</td><td>Pediculus humanus corporis</td><td>CDNA</td>

<td> 13</td><td>CAM-1</td><td>Anopheles gambiae</td><td>CDNA</td>

<td> 14</td><td>CAM-1</td><td>Undefeated solenopsis</td><td>CDNA</td>

<td> 15</td><td>CAM-1</td><td>Ixodes scapularís</td><td>RNA</td>

<td> 16</td><td>CAM-1</td><td>Aedes aegypti</td><td>RNA</td>

<td> 17</td><td>CAM-1</td><td>Culex quinquefasciatus</td><td>RNA</td>

<td> 18</td><td>CAM-1</td><td>Acyrthosiphon pisum</td><td>RNA</td>

<td> 19</td><td>CAM-1</td><td>Harpegnathos saltator</td><td>RNA</td>

<td> 20</td><td>CAM-1</td><td>Pedicuius humanus corporis</td><td>RNA</td>

<td> 21</td><td>CAM-1</td><td>Anopheies gambiae</td><td>RNA</td>

<td> 22</td><td>CAM-1</td><td>Undefeated solenopsis</td><td>RNA</td>

<td> 23</td><td>CAM-3</td><td>Varroa destroyer</td><td>RNA</td>

<td> 24</td><td>CAM-1</td><td>Tetranychus urticae</td><td>CDNA</td>

<td> 25</td><td>CAM-1</td><td>Tetranychus urticae</td><td>RNA</td>

<td> 26</td><td>CAM-4</td><td>Varroa destroyer</td><td>ADNC</td>

<td> 27</td><td>CAM-4</td><td>Varroa destroyer</td><td>RNA</td>

<td> 28</td><td>CAM-5</td><td>Varroa destroyer</td><td>CDNA</td>

<td> 29</td><td>CAM-5</td><td>Varroa destroyer</td><td>RNA</td>

<td> 30</td><td>CAM-7</td><td>Varroa destroyer</td><td>CDNA</td>

<td> 31</td><td>CAM-7</td><td>Varroa destroyer</td><td>RNA</td>

<td> 32</td><td>CAM-8</td><td>Varroa destroyer</td><td>CDNA</td>

<td> 33</td><td>CAM-8</td><td>Varroa destroyer</td><td>RNA</td>

<td> 34</td><td>CAM-9</td><td>Varroa destroyer</td><td>CDNA</td>

<td> 35</td><td>CAM-9</td><td>Varroa destroyer</td><td>RNA</td>

<td> 36</td><td>CAM</td><td>Ixodes scapuiarís</td><td>CDNA</td>

<td> 37</td><td>CAM</td><td>Ixodes scapuiarís</td><td>RNA</td>

<td> 38</td><td>CAM</td><td>Ixodes scapuiarís</td><td>CDNA</td>

<td> 39</td><td>CAM</td><td>Ixodes scapuiarís</td><td>RNA</td>

<td> 40</td><td>CAM</td><td>Ixodes scapuiarís</td><td>CDNA</td>

<td> 41</td><td>CAM</td><td>Ixodes scapuiarís</td><td>CDNA</td>

<td> 42</td><td>CAM</td><td>Ixodes scapuiarís</td><td>RNA</td>

<td> 43</td><td>CAM</td><td>Aedes aegypti</td><td>CDNA</td>

<td> 44</td><td>CAM</td><td>Aedes aegypti</td><td>RNA</td>

<td> 45</td><td>CAM</td><td>Aedes aegypti</td><td>CDNA</td>

<td> 46</td><td>CAM</td><td>Aedes aegypti</td><td>RNA</td>

<td> 47</td><td>CAM</td><td>Aedes aegypti</td><td>CDNA</td>

<td> 48</td><td>CAM</td><td>Aedes aegypti</td><td>RNA</td>

<td> 49</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>CDNA</td>

<td> 50</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>RNA</td>

<td> 51</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>CDNA</td>

<td> 52</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>RNA</td>

<td> 53</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>CDNA</td>

<td> 54</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>RNA</td>

<td> 55</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>CDNA</td>

<td> 56</td><td>CAM</td><td>Cuiex quinquefasciatus</td><td>RNA</td>

<td> 57</td><td>CAM</td><td>Acyrthosiphon pisum</td><td>CDNA</td>

<td> 58</td><td>CAM</td><td>Acyrthosiphon pisum</td><td>RNA</td>

<td> 59</td><td>CAM</td><td>Acyrthosiphon pisum</td><td>CDNA</td>

<td> 60</td><td>CAM</td><td>Acyrthosiphon pisum</td><td>RNA</td>

<td> 61</td><td>CAM</td><td>Pedicuius humanus</td><td>CDNA</td>

<td> 62</td><td>CAM</td><td>Pedicles humanus</td><td>RNA</td>

<td> 63</td><td>CAM</td><td>Pediculus humanus</td><td>CDNA</td>

<td> 64</td><td>CAM</td><td>Pediculus humanus</td><td>RNA</td>

<td> 65</td><td>CAM</td><td>Pediculus humanus</td><td>CDNA</td>

<td> 66</td><td>CAM</td><td>Pediculus humanus</td><td>RNA</td>

<td> 67</td><td>CAM</td><td>Pediculus humanus</td><td>CDNA</td>

<td> 68</td><td>CAM</td><td>Pediculus humanus</td><td>RNA</td>

EXAMPLE 9 Varroa calmodulin gene (CAM) transcripts v be RNA trigger sequences

The calmodulin (CAM) sequences provided in Table 5 (SEQ ID NO: 69 and 70), or their corresponding transcripts, were used as targets for polynucleotide compositions comprising a polynucleotide with at least 18 contiguous nucleotides identical or complementary to said genes or transcripts. The 5 'and 3'UTR sequences for the Varroa calmodulin sequences were identified by RNA sequencing.

TABLE 5

Target transcripts for calmodulin genes (CAM) from Varroa destructor

<td>Gene name and species</td><td>SEQ ID NO</td><td>Kind</td>

<td>CAM-1; Varroa destroyer</td><td> 69</td><td>RNA</td>

<td>CAM-2; Varroa destroyer</td><td> 70</td><td>RNA</td>

SEQ ID NO: 69 and 70 overlapped into 150 bp fragments. Table 6 illustrates the top chain (5'-3 ') for the 150 bp overlapping fragments in SEQ ID NO: 69 and 70.

TABLE 6

Overlapping polynucleotide sequences for the CAM-1 and CAM-2 genes

<td>Gene name</td><td>SEQ ID NO</td><td>Position within transcription sequence</td>

<td>CAM-1</td><td> 71</td><td> 1-150</td>

<td>CAM-1</td><td> 72</td><td> 151-300</td>

<td>CAM-1</td><td> 73</td><td> 301-450</td>

<td>CAM-1</td><td> 74</td><td> 451-600</td>

<td>CAM-1</td><td> 75</td><td> 601-750</td>

<td>CAM-1</td><td> 76</td><td> 751-900</td>

<td>CAM-1</td><td> 77</td><td> 901-1050</td>

<td>CAM-1</td><td> 78</td><td> 1051-1200</td>

<td>CAM-1</td><td> 79</td><td> 1201-1350</td>

<td>CAM-1</td><td> 80</td><td> 1351-1500</td>

<td>CAM-2</td><td> 81</td><td> 1-150</td>

<td>CAM-2</td><td> 82</td><td> 151-300</td>

<td>CAM-2</td><td> 83</td><td> 301-450</td>

<td>CAM-2</td><td> 84</td><td> 451-600</td>

<td>CAM-2</td><td> 85</td><td> 601-750</td>

<td>CAM-2</td><td> 86</td><td> 751-900</td>

<td>CAM-2</td><td> 87</td><td> 901-1050</td>

One or more dsRNA comprising a sequence selected from SEQ ID NO: 71-87 is provided in vitro to Varroa mites grown in a petri dish or applied topically to bee hives to effect expression of the CAM target genes and obtain a reduction in the Varroa destructor mite population.

EXAMPLE 10

In Vitro Bioensave of Calmodulin Targeted Triggers (CAM) in the Varroa Mite

Calmodulin-directed polynucleotide trigger sequences (CAM) -l and 2 were generated based on the overlap of conserved sequences between the CAM-1 and CAM-2 sequences. These are presented as SEQ ID NO: 88 and 89 (directed at CAM-1 and CAM-2, respectively).

Selected polynucleotide sequences from SEQ ID NO: 88 and 89 were evaluated in an in vitro bioassay for their ability to suppress the viability of adult Varroa mites. Adult female mites were collected from honey bee colonies and placed in a petri dish on an artificial diet solution. The artificial diet contained a mixture of 1% tryptone, 0.5% yeast extract, 1% NaCI, and 15 mg / mL agar. In this example, the diet was supplemented additionally with antifungal solution (lOOx, Sigma Aldrich) at 8x final concentration, 500 pg / mL of kanamycin and 220 U / mL of nystatin. The agar / diet solution was further supplemented with 200-500 pg / mL of dsRNA and the resulting solution was poured into a petri dish. The dsRNA in this example consists of SEQ ID NO: 3 (CAM373), SEQ ID NO: 88 (CAM-1), or SEQ ID NO: 89 (CAM-2) or untreated control (NTC). Fifteen mites were applied to each plate and the experiment was performed in triplicate. The plates of the diet were incubated with the mites at 29 ° C with 50-60% relative humidity. At specific time intervals, the plates were inspected and the dead mites were counted and removed. For mortality studies, mites were counted five and six days after their placement in the diet (FIG. 5). In addition, the dsRNA for SEQ ID NO: 88 (CAM-1) and SEQ ID NO: 89 (CAM-2) were mixed in an equimolar amount and supplied as described above to the mites. Figure 6 shows the result of this application.

For molecular analysis, live mites were removed from the plates, instantly frozen in liquid nitrogen, and TAQMAN ™ analysis was performed to assess calmodulin (CAM) RNA levels.

EXAMPLE 11

In vivo field reduction of Varroa mite infestation in field-treated bee hives after treatment with dsRNA targeting the Calmodulin gene (CAM)

The dsRNA used to suppress the expression of the calmodulin (CAM) genes directed to Varroa was prepared by mixing the dsRNA stock solution in phosphate buffer with 66% sugar syrup. The liquid formulation was supplied as a syrup to the bees, they were allowed to feed on it until their total consumption (approximately 2-3 days). Each field evaluation group consisted of 33 hives. The groups consisted of untreated hives, treated with a non-specific trigger (SEQ ID NO: 5) and treated with a specific trigger (SEQ ID NO: 3). Bees were treated in two series, each series consisted of two feedings two weeks apart: at the start of administration (week 0) and two weeks later (week 2), then again at week 13 and 15. The Bee survival assessment was performed at weeks 4, 9, 13, 15 and 17 (Fig. 7). Significant suppression of the Varroa population was observed after treatment with the specific trigger (SEQ ID NO: 3) at week 9.