Use of chimeric antigen receptor-modified t cells to treat cancer
Abstract
The present invention relates to compositions and methods for treating cancer in a human. The invention relates to the administration of a genetically modified T cell to express a RAC, RAC including a binding domain to an antigen, a transmembrane domain, a costimulatory signaling region and signaling domain CD3 zeta.

Term
No projected expiry on record.
- Priority
- Filed
- Granted
- Today
11 claims: 11 independent, 0 dependent
- 1-152- -152-ΜΑ 34813Β1 عفاصر الحماية 1 1_ ۶الية ٠حمض نووي معزولة تثفر ستقبل مولد ضد خيمري (CAR)، حتث يشتمل 2 car ، ٠طاق رط مولد ضد، ونطاق عابر للغشاء، ومنطقة إرسال إشارات تحفيزية 3 مبء وذعلاق دو إشارات CD3 زيتا، حيث يشتمل نطاق إرسال إشارات CD3 زيتا 4 على متو١لية الح٠ض ١لأميي رقم:24' 1 2_ ۶اب الح٠ض النووي طبقاً لعنصر الحماية 1، حيث يشتمل CAR على متوالية الحمض 2 ١لأميني رقم: 12. 1 3_ ٠براب ا٠لىض النووي طبقأ لعنصر الحماية 1، حيث يشتمل CAR على متوالية الحمض 2 اضي رقم: 8' 1 4_ متو١لية ١دض النووي طبقاً لعنعر الحماية 1، حيث يكون نطافى رط مولد الضد عبارة 2 عن جسم مضاد أو شظية ت، ر١يطة لمو-ك اكد- 1 5- ۶اب ادض النووي طبئء لعنصر الحماية 4، حيث تكون شطية رط مولد الضد عبارة 2 عن Fab او scFv. 1 6_ هتوالية الحمض النووي طبقاً لعنصر الحماية 1 ، حيث يرتبط نطاق ربط مولد الضد في 2 CAR بمولد ضد ورمي. إ 7- متوالية الحمض النووي طبئء لعنصر الحماية 6، حيث يرتبط مولد الضد الورمي بمرض 2 دموي خيث. إ 8- متوالية الحمض النووي طبقأ لعنصر الحماية 6، حيث يرببط مولد الضد الورمي بورم 2 صلب. 1 9- متوالية الحمض النووي طبقاً لعنصر الحماية 6، حيث يتم اختيار مولد الضد الورمي من 2 الحموعة المكونة من 19 CD،C-Met، CD33/IL3Ra،^^ ، RORl، CD22، CD2٠ ، -153- -153-ΜΑ 34813Β1 3 PSMA، دهن سكري MAGE A3 TCR، NY-ESO-1 TCR، GD-2، EGFRvIII،F77 ، وأية 4 توليغة منها. 1 10- ۶اب الحمض النووي طبقاً لعنصر الحماية 1، حيث تشتمل منطقة إرسال الإشارإت 2 اك۶ية ١لمثزكة في CAR على نطاق داخل الخلية لجزيء إرمال إشارات تحفيزية شزكة 3 اخباره س الح٠وءة المكونة من PD-1، CDO، CD30، 0X40، 4-1ΒΒ، CD28،CD27 ، 4 ICOS، مولل٠ ضد مرتبط بوظيغة الخلية اللمفاوية- 1 (1-LIGHT، CD7، CD2،(LFA ، ؤ NKG2C؛25-Η3 ، B7، وجزيء ربط يربط تحديدأ ٠ع CD83، وأية توليغة من ذلك. 1 11-٠توالية الحمض النووي طبقاً لعنصر الحماية 1 ، حيث يتم تشفير نطاق إرسال إثابات 2 CD3 نيئ في CAR عن طريق متوالية الحمض النووي رض: 18- 1 12-هسقل مولد ضد بري (CAR) معزول يشتمل على نطافى ربط مولد ضد، ونطاق 2 ءاش للغشاء، و٠طقة إرضل سر١ت تحفيزية صشؤكة، ونطاق إوسال CD3 زيئ، حيث هل 3 لأق CD3 زيتا على متوالية الحمض الأس رض: 24-
- 213-CAR ١لمعزول طبقاً لعنصر ١لحماية 12؛ ب ٠دثتل CAR ض ۶اك الح٠ض
- 314-CAR ١لعزول طبقاً فر ١لحماية 12، حيث يكون ذطافى ربط موند اف بارة عن 2 جسم مضاد أو شظية منه دبطة لمولد الضد. 15-car سزول طبقألعنمر الحماية 14، بث تكون شغل٠أ ربط مولا الخد بارة ض 2 Fab او scFv.
- 416-CAR ١ضول طبقاً قر الحماية 12؛ حيث يرتبط نطاق رط مولد الضد بموك خد٠ 2 ورمي.
- 517-CAR ١لمعزول طبقاً لعنصر الحماية 16، ف ير;بط هولد اف الورمي مض د٠وي 154- 154-ΜΑ 34813Β1 خبيث.
- 618- CAR المعزول طبقاً لعنصر الحماية 16، حيث يرتبط مولد الضد الورمي بورم صلب.
- 719- CAR المعزول طبقاً لعنصر الحماية 16 ، حيث يتم اختيار مولد الضد الورمي من انج٠وءة 'لمكونة من 19 CD،C-Met، CD33£3Ra،،jUW ، RORl، CD22، CD2٥ ، PSMA، دهن سكري MAGE A3 TCR، NY-ESO-1 TCR، GD-2، EGFR٧III،F77 ؛ واًية تويغة منها.
- 820- CAR المعزول طبقاً لعنصر الحماية 12، حيث تشتمل منطقة إرساًل الإشار!ت ١- الئؤكة على نطاق داخل الخلية لجزيء إرسال إشارات - ٠ثركة تم اختياره ض ابجموعة المكونة من ICOS، PD-1، CD40، CD30، ΟΧ40، 4-1ΒΒ، CD28،CD27 ء مو٠لل ضد مربط بوظيغة الخلية اللمغاوية_ 1 (1-NKG2C، LIGHT، CD7، CD2،(LFA ؛ Β7-25 ؛ Η3، وجزيء ربط يرتبط تحديدأ مع CD83، و٢ية توليهة ٠ن ذلك. ا2ا_ ب ت٠تل ض ئوالية حمض نووي تثفر مستقبل مولد ضد خيمري (CAR)؛ ب يصل CAR ض نطافى رط مولد ضد، ونطاق عابر للغشاء، ومنطقة إرمسال إدارات محف٠زيل هشؤكة، وذطاًق إرماًل CD3 زيا، حيث يشتمل نطاق إرمال CD3 زيا على ۶اب الحمض الأميني رؤم:24. 22. الخلية طبقاً لعنعر الحماية 21ء حيث ٠شمل CAR ، متو'لية الحمض الأس رب 12. 23- لحلية طبقاً لعنصر ١لحماية 21، حيث ي٠ثتل ١لحمض اسوي ض متو'ب ١دض النووي ربم: ٠8 24- الخلية طبقاً لعنصر ١لحماية 21، ب نطاق ربط٠ هولد اق ءياره ص ٠حسم مضاد أو شظية منه رإبطة لمولد الضد. -155- 34813Β1 1 25-الخلية طبقاً لعنصر الحماية 24، حث تكون شظية ربط مولد الضد عارة ص Fab او 2 scFv· 1 26 - الخلية طبقاً لعنصر الحماية 21، حث يرببط نطاق ربط مولد الضد بمولد ضد ورس. 1 27. الخلية طبقاً لعنصر الحماية 26، حت يهبط مولد الضد الورمي بمرض دموي خبيث. 1 28— الخلية طبقاً لعنصر الحماية 26، حت يرببط مولد الضد ١لوي بورم صلب. 1 29— الخلية طبقاً لعنصر الحماية 26، حت يتم اختيار مولد الضد الورمي س ا؟فموءات 2 'لمكونة من 19 PSMA، C-Met، CD33£3Ra،ù١lW ، R0R1،CD22، CD20،C٥ ؛ دس 3 سكري MAGE A3 TCR، NY-ESO-1 TCR، GD-2، EGFR٧III،F77 ، وأية دولذة هت. 1 30— الخلية طبقاً لعنصر الحماية 21، حيث تشتمل منطقة إرسال الإشاًات اكحهيزية 2 المث٠يركة على نطاق داخل الخلية لجزيء إرسال إشالت تحفيزية مشركة يتم اخباره Ù-Α 3 اف٠وءة المكونة من ICOS، PD-1، CD40، CD30، ΟΧ40، 4-1ΒΒ، CD28،CD27 ؛ هوك 4 ضد مرتبط بوظيغة الخلية اللمفاوية- 1 (1-Β7-25، NKG2C، LIGHT، CD7، CD2،(LFA ء 5 Η3، وجزيء ربط يرببط تحديدأ مع CD83، وأية توليغة ض ذلك. 1 ا3_ الخلية طبقاً لعنصر الحماية 21، حيث يتم تشفير نطاق إرسال إثار١ت CD3 زيا 2 بمتوالية الحمض النووي رقم: 18 ٠ 1 32- الخلة طبقاً سر الحماية 21، حث يتم اختيار الخلية من اتحموعة المكونة من خلية 2 T، وخلية قاًتلة.بيعية(NK)، وخلية ليمفاوية T سامة للخلية(CTL)، وخلية T عادية. 1 33_ الخلية طبظء لعنصر الحماية 21؛ حث؛ ى الخلية بمتا٠ءة ت \لورم ئ يربط 2 نطاق ربط مولد الضد CARJ بموك ١لغد ١فض ل. 1 34- ناقل يشتمل على متوالية خمعنى ووي jisJ ٠سشل مواد ضد٠ خيمري (CAR)؛ حي٠ث 2 ٠ثمل CAR ض طاًق ر١ط لمولد ضد، ومنطقة إرسال إشارت تحفيزية مشعة، ونطاق -156- -156-ΜΑ 34813Β1 3 إر.ال اىرات CD3 زيا، ي بصل نطاق إوسال وشالأت CD3 ذظ ، لأواوا ادض 4 لاميني رقم: 24. 1 35_ الناقل طبقاً لعنصر الحماية 34، حيث يشتمل CAR على موالية الىغى الأس رفم٠ 2 12. 1 36_ الناقل طبقاً لعنصر الحماية 34، حيث يشتمل CAR على متوالية ١لحمض الأس لقم٠ 1 37— الذاًقل طبقاً نعتصر الحماًية 34؛ حيث يكون ذطاًق ربط ٠ولل ١لضد غبار-ة عن ١الام 2 مضاد أو شظية منه ربطة لمولد الضد. 1 38_ الناقل طبقاً لعنصر الحماية 37، حيث تكون شطية ربط مولد الضد عبارة ص لأع? أو .scFv 2 1 39- الناقل طبقاً لعنصر الحماية 34، حيث يرببط نطاق ربط مولد الضد بمولد ضل٠ وزي٠ 1 40- الناقل طبقأ لعنصر الحماية 39، حيث يرتبط مولد الضد الورمي بمرض دموي خبيث٠ 1 41— الناقل طبقاً لعنصر الحماية 39، حيث يربط مولد الضد الورمي بورم صلب. 1 42— الناقل طبقاً لعنصر الحماية 39، حيث يتم اختيار مولد الضد الورمي ٠ن ابعموء٠ت 2 .لمكونة من 19 PSMA، C-Met، CD33/IL3Ra،ù LW ، RORl، CD22، CD20،C٥ ٤ دس و سكري MAGE A3 TCR، NY-ESO-1 TCR، GD-2، EGFRvIII،F77 ، وأية توليهة If 1 43- الناقل طبقاً لعنصر الحماية 34، حيث تشتمل منطقة إرسال 'لإشارات ١لتحغطية 2 المشؤكة على نطاق داخل الخلية لجزيء إرسال إشاوت تحفيزية مفركة يتم ساره من 3 'تجموعة المكونة ض ICOS، PD-1، CD40، CD30، ΟΧ40، 4-1ΒΒ، CD28،CD27 ؛ ٠وك 4 ضد مرتبط بوطيغة الخلية اللمفاوية- 1 (1-Β7-25، NRG2C، LIGHT، CD7، CD2،(LFA ؛ ولا، وحزيء ربط يرتبط تحديدأ مع CD83، وأية توليغة من ذلك. 5 -157- -157-ΜΑ 34813Β1 1 44 - 'لناقل طبقاً لعنصر ١لحماية 34، حسث نتم تشغ؛ل لأف إرسال إثار'ت j CD3؛u 2 بموالية الحمض النووي رقم: 18- 1 45لل يقة كحفيز اسشحابةمطعية تتوسطها الخلية Μ T خلايأ أو ودج في 2 كاش ثدإي٠ حيث صد ال يقة على إعطاءكائن ،ددنيكمية سألة س ي ٠عدلا وراتياً 3 كسير عن CAR، وحث نشمل CAR على طاق ر١ط لمو٠لد ضد، و٠طقة إرسال اشار؛ت 4 ية شؤكة، ونطاق إر٠ال إ,ثارإت CD3 زض ب د لأف إر٠عال اثرإت CD3 ؤ زظعلى متو١لية 'لحمعش الأس رنم: 24، حيث -تم ١محبار ر'بط ٠ولد اق ض ٠ترف 6 تمديدأ على مجموعة الخلايا أو النسيج المستهدف. 1 46- طريغة لتوفر مطعة ضد ١لورم لدى٠كائن ددني حيث س٠ل ر٠ إءطاء الكاش الثدني 2 كمية من خلية معدلة ورإثياً لسير ض CAR، ب CAR ،μ٠ ض ل'بض 3 لمولد ضد، ومنطقة إرمال إشارات تحفيزية ٠شؤكت، وذطاق إرسا3 إثار'ت CD3 لت٤ حهث 4 يشتمل ذطاق إر٠سال إث1ئت CD3 زيتا على ئوالة ادض الأس رذم: 24‘ وباكالي تو٠لر ؤ مناعة ضد الوى لدى الكائن الثدي. 1 47- طرينة ءلاجكا.س ٠د ٠عاب بمرض، او ١ترابء أو أا رب٠ل ض الأد ز 2 رك صد الورم، ئ ست٠ل ١لطريقة عر؛ءطاء اديى الآي ي 3 ئ سأ للتعبير عن CAR، حيث يصل CAR ر نطاق رابط لوك فد، لظل إدل 4 إشال!ت تحفزين ٠ثيذ، وذهلاق إر٠ال إشارات CD3 ذظ؛M ض تأب؛ ادض الأس ؤ رقم: 24، وبالتالي علاج الكائن الثدني. و 48- سريقة طبغأ لعمر الح٠ايل 47؛ ب، تكوف اذي ص ت T ذي ائ. و 49- ١لطريقة طبقأ سر الح٠ايل 47، ب، بم اخاو ٠ولد ئ اررم ض اضوءة 2 ا.لكوذة ض RORl ،CD22 ،CD20 ،CD19؛ بوثبن؛ PSMA ،C-Met 'CD33/IL3Ra‘ -158- -158-ΜΑ 34813Β1 3 دهن مكري MAGE A3 TCR ،NY-ESO-1 TCR ،GD-2 ،EGFRvIII ،F77، وأده توليغة 4 منها. 1 50 — طريقة للاج إنسان مصاب باًللةيميا اللمفاوية المزمنة حيت، تشتمل الطريق. على 2 إعطاء إنان خلية T معدلة وراثياً للتعبير عن CAR حذث يشتمل CAR على نطافى رابحل٠ 3 لمولد ضد، ومنطقة إرسال إثارات تحبزية م٠شيركة، و'ثق إر٠ال إدارت CD3 زيا ي٠سل 4 على متوالية الحمض الأميي رئم: 24. 1 51- الطريقة طبقاً لعنصر'لحماية 50، حيث؛ كون الإتساف ٠قاو٠أ لعا٠ل ءلاجكيميأئي 2 واحد على الأقل. 1 52- الطرفة طبقا لنصر الحماية 50، حيث تكون اصا اللمفاوية المزمنة هي لوكيميا 2 +19 CD غير مستجيبة وورم ليمفاوي. 1 53- طريقة لإش١ج مجموعة سنيمة من الخلايا T المعدلة وراثياً دى إدان تم 2 حالته على أنما مرط١ن، حيث تشتمل الطريقة على إطاء إذان خلية T م٠دلة ور١ثيأ للص 3 عن CAR حيث يشتمل CAR على ذطاق لآبط ضد، ومطقة إرال إ^رإت محهبريت 4 مب، وذطاق إرال إثادت CD3 زظ د ض ٠توالة ١لحمض الأ٠يي رض 24‘ ؤ حيث -ستمر مجموعة ١لخلايا T 'لمتديمة ١لمعدلة ود١ثيأ كى الان لد؛ثهرءلى ١لأقل بعد٠ 6 الإعطاء. 1 54- ١لطريقة طبقاً فر ١لحماية 53، حيث س٠ل ب الخلايا T الظ'لأ ادددلا 2 وراثيا على خفة واحلة على ١لأقل شم اخيارها من الحموعة ١لمكوذة ٠ن ت٠طية T تم إءطاءها 3 للإنسان، وذرية خلية T تم إعطاءها للإنسان، و دوبة مئهما٠ 1 55- ١لطريقة طبقاً سر ١لحماية 53، ب ٠شتر ¥ ا^يا T اف'لأ المعدلق 2 وراثياً على خلية T ناكرة. -159- -159-ΜΑ 34813Β1 1 56-الطريقة طبقاً لعنصر الحماية 53، حيث يكون السرطان هو لؤكيميا ليمفاوية مزمنة. و 57-الطريقة طبقاً لعنصر الحماية 53، حيث تكون اللمميا اللمفاوية المزمنة هي لآكيميا 2 +19 CD غير متجيبة وورم ليمفاوي و 58— ١ئريقة طبقI لعنصر الحماية 53، حيث تستمر مجموعة المئلايا T المستديمة المعدلة 2 وراثيا في الإ٠ذسان لمدة ثلاثة أشهر على الأقل بعد الإعطاء. 1 59- الطريقة طبقاً لعنصر الحماية 53، حيث تستمر مجموعة الخلايا T المستديمة العدلة 2 وراثياً في ١لإاف لمدة أربعة، أو خمعة، أو ستة، أو سبعة، أو ثمانية، أو تسعة، أو عشر 3 أشهر، أو أحد عشر، أو اثني عشر شهراً، أو سف، أو ثلادة سف ض الأش Λχ الإعطاء. و 60-الطريقة طبقاً لعنصر الحماية 56، حيث تتم معالجة الهميا اللمفاوية المزمنة. 1 61— طريقة لتمدد مجموعة خلايا Τ معدلة وراثياً لدى إنسان تم تشخيص حالته على أى 2 مرطان٤ حيث تشتمل الريقة على إعفطاء إنسان خلية T معدلة وراثياً للتعبير عن CAR 3 حيث يثت٠ل CAR ض طاق رابط لمولد ضد، ومنطقة إرسال إشارات تحفيزية مشزكة، 4 ونطاق إرمال إشارإت CD3 زيتا يشتمل على متوالية الحمض الأميني رقم ت 24، حيث تتتج ؤ الخلية T المعدلة وراثياً مجموعة من ذرذة الخلايا T لدى الإنان. 1 62- الطريقة طبقاً لعنصر الحماية 61، حيث 'شمل الخلايا T على خلية T د'كرة. 1 63— الطريهة طبقاً بعنصر الحماية 61، حيث تكون الخلية T عاره عن خلية T ذاتية المفثأ. 1 64- الطريقة طبقاً لعنصر الحماية 61، حيث يكون الإنسان مقاومأ لعامل علاج كيمي ني 2 واحد على الأقل. 1 65— الزيقة طبقاً لعنعر الحماية 61، حيث يكون الرطان عبارة عن لبميا ليمفاوية 2 مزمنة. 1 66- الطريقة طبقاً لعنصر الحماية 65 حيث تكون اللرميا اللمفاوية ازث هي لوكيميا -160- -160-ΜΑ 34813Β1 2 CD 19t وورم ل^وي ض - لآج. 1 67- الطريقة طبقاً لعنصر الحماًية 61، حث تستمر نرية الخلاياً T في ١لإذان ددذ ءلآ 2 أشهر ض الأقل بعد الإد 1 68- 'لطريقة طبقاً لعنصر الحماية 61، حيث تستمر نرية الخلايا T في الإنان لمده أربعة، 2 أو خمسة، أو ستة، أو سعة، أو ثمانية، أو تسعة، أو عشر أشهر، أو أحد ءشر، أو ١ثي Â 3 شهرأ، أو ص، أو ثلاثة سين على الأقل بعد الإعطاء. 1 69- الطريقة طبئء لعنصر الحماية 61، حيث يكون السرطان عارة ض لنكيميا لآب 2 مزمنة. 1 70- متطالية حمض نووي معزول تشغر مستغبل مولد ضد خيمري (CAR)؛ ح؛ت 2 CAR ؛ نطاق رابط لمولد ضد، وذطاق ءابر للفثاء، ومنطقة إرمال إشابات نمفهل٠ 3 ۶كا؛ ^ق إرمال إثار١ت CD3 زيتا، حث يشتمل نطاق إردال CD3 زتا عفى ۶اب 4 ١لحمض ١لأمني رؤ٠أ: 24، حيث تثتمل متوالية الحمض النووي المرول المذكورة كذلك ؤ المتوالية رقم: و و \ا_ ۶إب .لحمض 'لنووي ١لمعزول طبقاًلعنصر 'لحماية 70، يشتمل CAR على لأواا 2 الحمض الأميني رقم: 12 ' \ 72_ ٠توالإة ١لحمض ١لذووي المعزول طبقاً لعنعر الحماية 70، حيث تثتمل على ءا 2 احمغى النووي رفى٠'8' \ 73_ ١فض ٠لذووي المعزول طبقاً فر الحماًية 70، حيث يكون ذطافى ربط ٠و افءارةءنجمثدأو٠ت؛كفىاف. و 74- مة ادض اضي 'فرول ق' سر سي٠ 73‘ ب كدد شئبللبط٠٠ل 2 اسبر٠س Fab او scFv -161- -161-ΜΑ 34813Β1 1 75- متوالية الحمض النووتي المعزول طبقاً لعنصر الحماية 70، حيث يرتبط نطاق ربط مولد 2 الضد بمولد ضد وس ٠ 1 76- متوالية الحمض النووتي المعزول طبقاً لعنصر الحماية 75، حيث يرتبط مولد الضد 2 الورمي بمرض دموي 1 77_ ٠تواللة الحمض النووي المعزول طبقاً لعنصر الحماية 75، حيث يرتبط مولد الضد 2 الورمي بورم صلب. 1 78_ متو١لية الحمض النووي المرول طبقاً لعنصر الحماية 75، حيت يتم اختيار مولد الضد 2 الورص ض افموعة المكونة من 19 lW ، RORl، CD22، CD20،CD؛CD33/IL3Ra،،j ، 3 PSMAic-Met ؛ دهن سكري MAGE A3 ، NY-ESO-1 TCR، GD-2، EGFRvIII،F77 4 TCR، وأية توليغة منها. 1 79_ ٠توالية الح٠ض الووي المزول طبئء لعنصر الحماية 70، حبث تشتمل منطقة إرسال 2 الإشار١ت ١سزية ١كزكة في CAR على نطاق داخل الخلية لجزيء إرمعال إشارإت تحفيزية 3 - يم اختاره ص افوء2 المكونة من CD40، CD30، ΟΧ40، 4-1ΒΒ، CD28،CD27 ، 1-icoS‘PD ، مو؛د ضد بعل٠ بوظيغة الخلية اللمفاوية- 1 (1-CD7، CD2،(LFA ، 5 Β7-25، NKG2C،LIGHT ؛ Η3؛ وريء ربهل يةهل تحديداً هع CD83‘ واًيل تول؛غة س 6 ذلك. و 80- متو١لية ١لحمض النووي ١ضول طبقاً كر ١لحماية 70، حي٠ث -ذم تشغهد لألافى إر٠ئل 2 اىئت CD3 زى ق ض ٠ريق متوالية الحمض الووي رض: 18. 1 81- ٠سشل موك ضد خيمري (CAR) هزول د ض لأف دط رك ضد، وذطاق 2 ءابر للغ٠ثاء، ومنطقة إرس١ل إثار١ت تحبزية مشيركة، ولألاق إرال 3.C زظ، ب ٠شمل 3 ^ق إرك٠ال CD3 زي ض متوالية الحمض الأس رتم: 24؛ وب يتم التعيير ض CAR -162- 34813Β1 4 المعزول الملكوركذلك عن طريق متوالية الحمض النووي المشتملة على المتوالية رقم: و·
- 982- CAR المعزول طبقاً لعنصر الحماية 81، حيث يشتمل CAR على متوالية الحمض 2 لاميني رقم:12. 1 83— CAR المعزول طبقألعنصر الحاية 81، حيث يكون نطاق ربط مولد الضد عار ض 2 جسم مضاد أو شظية منه رإبطة لمولد الضد.
- 1084- CAR المعزول طبقأ لعنصر الحماية 83، حيث تكون شظية ربط مولد الضد ءباره ءن 2 Fab او scFv. 1 85— CAR المعزول طبقاً لعنصر الحماية 81، حيث يرتبط نطالى ربط مولد الضد بمولد ضل٠ 2 ورص. 1 86_ CAR المعزول طبئء لعنصر الحماية 85، حيث يرتبط مولد الغد الورمي بمرض لى 2 خبيث»
- 1187- CAR المرول طبئء لعنصر الحماية 85، حيث يرتبط مولد الضد الورمي بورم صلب. 1 88_ CAR المعزول طبقأ لعنصر الحماية 85، حيث يتم اختيار مولد الضد الورمي هن 2 اخموعة المكونة من 19 CD،C-Met، CD33L3Ra،^^ ، RORl، CD22، CD2٠ ؛ 3 PSMA؛ دهن سكري MAGE A3 TCR، NY-ESO-1 TCR، GD-2، EGFRvIII،F77 ؛ وأ-ا 4 توليغة منها. 1 89_ CAR المزول طبقأ لعنمبر الحماية 81، حيث تشتمل منطقة إرسال الإثارت 2 اكحفز؛ة الئؤكة على نطاق داخل الخلية لجزيء إرسال إشارات تحفيزية مثؤكة يتم اخباره 3 ض اخموعة المكونة من ICOS، PD-1، CD40، CD30، 0X40، 4-1ΒΒ، CD28،CD27 ، 4 مولد ضد مرتبط بوظيغة الخلية اللمفاوية- 1 (1-NK.G2C، LIGHT، CD7، CD2،(LFA ؛ ؤ 25-Β7 ؛ Η3؛ وجزيء ربط يرتبط تحديدأ ٠ع CD83، وأية توليغة من ذلك.
Independent claims11
155 paragraphs in 1 section, as filed
1μα 34813Β1
<img img-format="tif" img-content="drawing" file="MA-34813-B1D00031.tif" id="idf0001" />
1
<img img-format="tif" img-content="drawing" file="MA-34813-B1D00032.tif" id="idf0002" />
No. 0.0610 Av'ie (V. A? 0 contracts 59 .¾0 journeyed (4 & gt; 2] δ * α t \ j * t fijbU accept UJl gjr * methods ZjV the; Tan) Full Description Alasid AAC y Oli ouy: this 1 1 request is based exponent 0 Meh to Alallb 'to US 1 for Mait Rzm 61/421470; 1 Mua 9 5 Dber 42,010 and Alhllb to US 1 for a temporary No. 61/502649, the depositor in 29 Dondo 2011; and included in the current document Bkamilhmakmah. background Rhyming: 1 for the majority of' the super 'for patients Paz tumors trotting b any; Z in that Allodha Akeshaoah Arla (CLL), are likely to die because of this land. will vellum address 6 loyalty land Aseel Alor 1 st 10 b T to target 6 Cat F-1 manages to Z what Arrm Z 0 through any E 0 a Mstgblatt antigen August (CARS), and principles Ouarh En C 0 t hold strayed 0 is designed to identify the generators against the surface of the trotting Rrzth not meet the & lt ;, Mall-for strayed 0 Khkr't one blood one human to Sdhae. not received attempts to use a modified cells genetically express CARs in this Alonokh Q landslide Njahakbera claimed, for example ,, 18: 4, Brentjens el al., 2010, M.lecular Therapy 15, 2010, 23 666-668; Morgan et al., 2010, Molecular Therapy, published online February 112: 2261-2271, pages 1-9; and. Till et al., 2008, Blood- in most types of cancer, not 0 of antibody nation Barrm generators 0 Arovh me; Om in malignant tumors of B B, be 19 CD Laura attractive target. And; expression of CD 19 five minors. 1 to B cells and malignant Ozdlo (29-71: 13, 1988 Uckun, et al. Bloody), purely En 19 CD 0 goals acceptance of Ab 1 t 2. cars Dec. 1 ace. Wesh forced g that CARS can Thvin tribe sock Τ way exhort dissolve the U- I 0 B T Dash 0 Aktha,; not handicap Aziba to Aiq Clinical Lilac time to time when thousands of k 1 n is limited Walt 0 DD Dar deaf Elk 0 In R T t CARJ 'and Sel Abe Q, August 0 d Akmbb, activity Wallach 1 Gucci canter hopes -1035: .11, 2.10,; Blood ... «termination .J0n5) 5 .Blood, 1988,71: 13-29) 1044; Uckun, et al · 1, ί need 0 Aceh in Egal Akibat and Halrvy to treat Alrtaf using CARs -tlknha AAC 0 DD d 1 Vinegar gm 1 shower 1 neighborhood Walles Wadley Dlj this Ed 1 to adsorb for Alakhhr 1 GS: Provides one current Atizaa succession acid Roy Mazzo! Of Tchehemd 0 Scl 0 born e 1 d B (CAR ); I 10 u 0 for CAR & lt ;, the scope of linking generator against, and Ntafy trans-membrane, and the write motivational legacy signals,'taq Aral effects 1 T. CD3 Z b 0 Shell ^ in Aarau Esha ^ t CD3 commencement R. succession acid Alomaa number: 24 'in one y Ir MTW 1 b DNA CAR includes a succession of security acid, and: 12.15 in lawful 0 Akang, Ttfr succession DNA CAR SHTML a succession of DNA number: in a 0 extent Andj, be Zhlaq bind antigen in the CAR is to counter or d linking against against b will be continued -kon fragment antigen linked to a Fab or scFv. 3 ΜΑ 34813Β1 in a Alnanj, scale associated connecting 0 F and K in the CAR also the birthday of 0 and assemble. In a Avzj 0 4 antigen tumor disease associated Dre Khiet. In Nmong another, Mull 0 Aq Ashs tumor associated solid 0 In Nmong last selection mobbed are 1 1 antibody 1 Orma on or 0 Uh Aelo Z 19 C520, CD 'R0R1, CD22, Mbothleen, to only 3 AA / 33 Hee PSMA, C-Met4, DDS 0 Diabetes F77; EGFRvIII; 5 2 -mage A3 TCRt NY-ESO-1 TCR, GD, and any Tolegh them. In a 1 to Zmazj, T. 0 SHTML area Send administrations A- A- in the CAR & lt ;, Dad 1 Ornament molecule Ir 0 the indicated 1 T. stimulation Hishakh Bam chosen 0 n Mi Almko.zh 0 n CD27; CD28 'CD40, CD30, ΟΧ40,4-1ΒΒ; 1-PD; ICOS; 0 born strayed 0 Atbt UJâji 1 to Khaya milk 0 Gaoh- 1 (1-LIGHT, CD7, CD2, (LFA; Β7-25 'NKG2C E 3 not 4 molecule specifically 0 p 10 CD83 linking, and any Tolegh Q that 0 in the benefits I) uncle Ie DOCUMENTS Nrmal Ncharat CD3 Zhta in CAR g through Qwab Avd 1 Dhuoa number: 18. Z provides only 6 p CAR ~ lol d z father responded Mack Ie and any bad z, (d Aral proceeds Z 0 1 Eka 'and the scope of the Aral Lhe bears' b d any for or Thh Zz presented Vwab Avd but 'brown and sleep: 24. k 0 a Aoar only Bs 00 nuclear Ouayahabdd Ds CAR, b Hlse & lt; a Telao 0 hands, and tease E 0 righteousness AFS 0.9 Lal; Har't p 1 0 shuttle, Armal and was fitting for 00 .z six 0 for Z Gu; not Add exponent Rz- 15 - 4- ΜΑ 34813Β1 in a Avang; are selected Olney cell expresses the CAR of August, consisting of a cell T, lethal and cell natural (NK), and lymphocyte T toxic 7 cell (CTL); T * ψ-j Ouadah 0 in a Alnmang, p cell Z eBay CAR immunity against the tumor when the scope of linking antigen CARJ birth of antibody beholder him 0 5 also provides Alachti Naqlae includes a succession Zoe acid Nschwr CAR associated, b Z CAR Z link scale generator against, and the Send raised Mahmazih Hishaqh, and Zta 3, the Aral after 1 T. CD3 Zz, where SHTML scale Send Achalat CD3 fatigues Z Mtwab August 24 exponent Lord 'as 0 to 1 provides a way to motivate Atizaa Astjabh.naaah mediating cell Μ T Khala'a Q 0 No 10 or the fabric will not Vicka 0 breast. On a 1 to Zmazj, bear 0 for buil 4 It z Aetaekain Adi J Z Khaya 0 neutrophilic and Seeing the expression of the CAR, where Attamo CAR & lt ;, scope s R'bt 0 against, and Htqq E0 the Lada data motivational Shiu, my passion p 1 for Onv CD3 Nia 'B μ A 0 fitting for UNT ; Thal; t CD3 Ziyi Presentation 'y to just 1 Yeh insisted Z 0 0 Apr mother RTM: 24, Tree-clearing 13:00 0 R d production in order to specifically recognize the cells or tissue of P-group. K 0 1 provides a way Laa Cofer Mtah against one tumor Kyka's lead. In a 0 1 Bzj 'Q 0 for Alchp nest Aetae | object Idak 0 Yeh-effective and modified War 1 Ta sticky Z CAR; Eshetmd CAR Ztaq Dbt Khok nest against, blaming Send Ayzat I Ttkh, and any write Dr. succession acid Wallace No. 24, thus providing immunity against the tumor has breast object · 15 -5- ΜΑ 34813Β1 as 0, but includes a 0 Ie & lt; Cadn Ddna the nature of the substance Hap 4 or disorder, or H'la Rtbahl I EXCESS S.old against the tumor. In a Alnmang, Tttml August & lt ;, Atae Idash object ') 9. genetically engineered to express the CAR, where u 0 for CAR t ^ in the link generator 0 against, and 0 clunk toss 0 of Achalat motivational gait, and the scope of sending CD3 departments Zda mention z 5 0 financial health 1 Las Rev 0 A: 24, and Palaly Alcaedn Id; j-tightening in August 0 Zj, -kon T cell is the cell Resume Abuto. In the lawful 0 1 Zmazj, is one Khtar 0 and K vs 1 Sharm el-Z E_muh 1 Mkulo Z CD20, CD19; CD22; IR1 0 Soethelkhan, & amp; CD33 / IL3R; C-Met; PSMA, fat Diabetes GD-2, EGFRvIII, F77, NY-ESO-1 TCR ; MAGE A3 TCR; Wade Toulihh .If · 10 Z provides another 1 GS way to treat an infected Inan Balhmaa chronic lymphatic. In a Alnmang 'V 0 Ttml one of the ancient nest to give the ears of a bear T p-adjusted monthly and Rala fatigue 1 t Z CAR 0, where female-hubby CAR Z dilemmas 0 mo 0 LED against; and the Aral signals motivational gait, and the scope of Armal thrills CD3 Zeta includes a succession insisted 0 Some families Rom: 24' in a 1 Zmazj, .kon 1 Azsav shovels penchant for Elajka 0 0 Hani brigade 0 & lt ;, land -15 In a Avzj 0 4 ^ n Alliaa chronic lymphoid are Aemia +19 CD Z Msjabh and tumor lymphatic. As SHTML Alakharaa 0 as well as Z & lt; Aiqa to Azj mg 0 Uh 0 i 0 Bmh 0 n 1 to T cells neutrophil and Rlo led Inan been diagnosed but Saran 0 At lawful 0 1 Bzj; 0 August E 4 included Z Aetae E3 that Khalihlmadlh War 1 no Anobeir Z CAR comprising CAR on Ntafy ducks to Mulld against, and the -6-
£ 1 -6-1a not I send a pointed Thgaz 0 1 T. Yeh Mhakh, and Taq Send CD3 uniform signals includes a DNA sequence Aloms and sleep: 24, urged the modified T cells Alhdimh groups continue genetically humans for at least a month after the administration. In a 1 to Zmazj; asset group T cells genetically modified sustainable on a single cell on persons 5 0 Z was chosen in August constituent p T cell and then give it to the man, and T-cell progeny were Aattai to man, and Tolegh them. In a 1 mélange; withstood group of cells T sustainable genetically modified T cell Nakrh. In lawful 0 of 7 y, Taatmr Alkhala.a T group Altdamh neutrophil genetically Alanan for a period of applicat mention z least after Alaetae 0 In Nmong another, Taatmr T cells Alstdamh group Almadla genetically 10 only 0 Ztn to Mdelh four or Khmmh, or six, or capacity, or eight , or nine, or ten point out, or permitted indicator 0 or 1 in a month, or O, or at least three Sen after administration. In a 1 to Zmazj, made with one abyss August multiscale Elms 0 of 5. 0 also reimburse the other 1 GS way to extend the cell range Τ genetically modified, the ears were Tchk; Ay ί presented Ei Mrtan 0 in a 'for Nmang, the way include Aaftae human cell Τ modified Laurie 15 large r CAR b Chet 0 Ra CAR Z Zhlaq 0.1 expel against, and i 0 of Ir 0 Sal WIRE 1 T. b Machta, and Taq Ir 0 1 indicated the CD3 T -t uniform data on succession exponent No. 10 v 24 w exuding neighborhood 0 1 1 T cell Ddlh and Ztha b 0 n Nlo 1 to T cells Ki Aces 0 Viohaddabzj 4 Balkhalaaatybmaah. In a 7 Zj, be one of the Khaya T Ebarh p trot T Dub only 'ΜΑ 34813Β1 -6- Apimia Almufao I j; Aahe (and 0 Bawifessas.: Barre. 0 & lt; η Aaladahialom Ui 0 the not, the B, or Mi, or nine, or E 1 evil of additional at least after Alaia 0 in a 1 to Zmazje been Haaljh Avrtan 0 E.;: d p 0 you; .awathiydama, Odsouad 0 to Alosc Z Azlad Alo 0 I repel automated Lang Alasa any I z, Eth 0 p ie 0 s I Slasedvichbanyzjdlaybysvi & lt; for Adan to A.chehrh-Festualodoat | Sszjadilovillarsyt. Sha, Ouaqzlaa dependency r 1a Ely refugees righteousness; will mark the 0 Nsom: promised 0 Houaj 1 Hdhsbulsoua'0maa h No, 0 lattes Vio.at Bod opportunities Walles Valley in August P, pink 5 pain 0 de sucks Nmtakazbo S. Lash dos Elsm Q August Alichael (VI 0 wa pELps), otherwise 0 j Yuj. Cdlo AM 0 Mad CD19 scFv confirmed 0 n Apfm Assad Wei j AAC 0 j 3.FMC, CDSa wells and fitting for PVC Aiee dam was Alag any Wardle Arat Zz 4-iBBj CD3 human. The Toe, Yeh Akaab 1 t Alooma p 1 Khoir Ader; c EF-la (0 reinforced ΜΑ 34813Β1 as upper & lt ;; prolongation ) 4 LTRj, Taker'r ends Taiwid; and the element 1 response Eka (l ?? E), and the deification of Aie & lt; Kzah (CTS). The figure is not as Mq 0 S fee. explains August the form of maté 0 cell A0 obtained meant Khalalo a & quot; Yeh 'of origin Z by apheresis, and then uranium 'to T cells Rudwy Khalhl Ohadea eloah, and annexation Astngaz any remaining cells by adding Kiryat Mmafth mg [Gh CD3 / CD28 for Aimae Leases 0 j and activate T. cells were added carrier' to Gerus pigeonpea I Tech 0 & quot; 0 for any T was I in 1 Z 3 after the start of Azzr 1 cent. Has been extended picturesque meant directed me Mash launch WAVE Bioreactor) (System for a period of 8-12 days. At one end of one of the day to Zzeh grown Azala Amap p spray Azure above the magnetic were harvested CART19 T cells and then saved the door in and i Laz fishy. It illustrates the production form of the design of the protocol clinical - was given RIP Elajkemiaeda i for Maggie 0 as described, then leaking CART19 No. 1 through cent gravity flow within the vein Z over 15-20 minutes. was given infusion using the method 1 Yeh hyphen z D 1.3 days (10%, 30%, 60%) ranging from 0 to Aum 1 to 5 in any 1 for the treatment of Alkemiana. was performed eventually experiences in week 4 of Debba. after the effective Arqubh, was Rdl on treatment to intentional to pursue longer-term love directing PDA protocol. Figure 2, Almttml shapes Z 2 a to 2 and , is a series of images showing expansion Touch 0 t inside the body Cache neighborhood and continue in the blood Ua cells 19 CART. to the land of DNA Anjul Z whole blood as described in the forms of 2a to 2c, or bone marrow, as shown in figures from 2-d to 2, and Alaitat Olney been obtained from 01 UPN as shown in the August 2 a and 2-d, and 02 UPN as shown in Almzqlin 2b st and 2 and 03 UPN as Ben in 1 Hklzn 2 c, 2, and in large quantities on an analysis of Q-PCR using the experience amount to detect and determine the amount of sequences 19 CART. ^ For blister data representing an average three-measurements on genomic DNA ΜΑ 34813Β1 -and- 100-2007 is the maximum for CV% less g 56.a% E of Hills / (Wa μ, b Hmv including specific Na ml Ziiah name, and magnification Yale Rev 0 El and Alodv to Gbas Althrbh b Bam Abhy Aq 0 j is Nkhtn Thoi DNA U 0 j Bklomam; r {.i ·;: I: ~ least this number Yum represent estimates produced 12 s & quot; 1 'g pearl 0' persons E 0 d 5 by et Bhh% CV Syndicate 5A%. then -cirbb & lt; a, 1 CART in additional z 'Brigade d 2 for UPN01; and 03 UPN, and today 0 goers, wa, 2 lAH the UPN. bereaved 3 E with plans to 0 for T forms Z 3a Lund, Ara g Bhlu 4:00 to 0 h to 0 Auwaytt
Deadlines and 0 Akhaa the 0 Shi JJ and after Tripp CARJ Τ cells; lesions literature S't the challenges deadlines and extended Anin in 01 UPN as 0 and Ao 0 h in Akkar 1 of 3 termination and 02 UPN e 1 15 Z is shown in Fig. 3 B and 03 UPN, 0 of 0 Mosfie 3 J'vi Ashe lar August after -shb Bh, CARTl adequately 0 s I- Las Questions & quot; h SV 1 Sa 1 BASIS Q 03 UPN Shviikl 3-d, has been d 1 ft to Y I & lt ;, the foundations 0 m j 0 Hgovhkriaat Liii and Ott Mghaego 0 exclusive protective ace. The Pearl 1 Irh to Nuang p PSC & gt; 0 6 0 Ghaev for lattes Maht was Rakd d 0 Hsabr a one any Z Z in pellets 3 in percentage 3 Joubmttsysbnq; every 3 D.tmatzq Aqmsshlitj thieves; Li 0 aa added Bilaz 0 of d, broadcast -m to Adad I persons and Near Las-p Elk 0 J (ULOQ, LLOQ) s 80-20 a 0/0 Spmas, to Oalmlat, / Alhossitaqub SAL as upper 0 A.mmtal.ol 20/0 Eimpsnars 010 / .. and dimensions 1b strain 0 Qmat Bdmdh in Zq conscious Dah Adam 1 'has been p Lallah AM 0 Ghaevcefhvbesysal.oviaathavilmamvqurmdapmaloab 0.20 -10-
No, 1 ^ \ 1 the I been using less valuable record Mnhak row on Onha fundamental value. Hunt standard curve of the outputs of the analysis and core values values (Arome d) (Mdkorh between news cUPNOlJ and 02, and 03) 4 up the unity of Pico g / ml: 4,572-2.7: 6-IL; (301,287, 689) 29,318-35.5: & amp; IL1- R; (287, 115, 481) 5,319-2.1: CXCLIO; (4.2, 7, 10,1, 8,7); IFN-y: 11.2-23,972 (2.8, ND) 5 -48.2: CXCL9; (828, 560, 403) 3,600-4.8: 1-MCP; (174, 371, 99,7) 7,233-3,3: ΜΙΡ- 1ρ, 15,3) 2.4-5,278: 8-IL; (610, 9,477, 4,319) 34,210-13.4; & amp; 1L2-R; (177, 126, 1,412) 3,700 (48.1, 57.3, 57.6) 7.1-13,778: ΜΙΡ-la; (0.7, 5.4, 8.5) 13,874-6.7: 10-14.5,14.6); IL. Hkz 0 No 4; 1 each Z 1 forms Z 4 A to 4 D, is a series of images showing the expression of surface CART19 prolonged create CARS Nakrh functional Dar Jays 1 1 object R-0 and explain seen 4a 10 1 to detect p herpes 0 of lymph + CD3 Adharh for CAR and the absence of B cells in the blood Akhaiti and spinal. Name Z cells and a single modern Baraka 1 Study Alokhounh Z blood Anhaiti or spinal and that was Alhaol 0 Eaha Z 03 6 UPN Zd day 169 after Tripp cell CART19 so for deafness counting flow cell surface Tabnr for 19 CAR (I mean) or missed cell c (BL); j 0 Garzh, was staining Olney PBMC obtained from Mti true ND365- and Lev Chaz and Asirathristih 15 & quot; Bob Bhmuot + CD3 and B ornament. To evaluate the expression CAR19 in lymphocytes + CD3, it was one of the staining 1 Mhhrk for Aivat Bagam anti-CD 16-PE-Cy7J CD14-PE-Cy7J (1 Ge Alagracah) CD3-FITCJ; positive Altaboub meant + CD3, and evaluate the expression of CAR19 at + CD8 and Hakeat 1 Khaya lymphatic by CD8 'staining' the gentile? CDSa-PE and Adam S. CAR19J Z 1 for i 'for self-yoke Alexa-647j. The & quot; to the Web has become one in Abveh shapes t ¥ 1 g of cells 20 Ge / Mo-JH CD3J. To assess and cools the cells B, was blotchiness Almhark samples antibodies CD3-FITC CD14-APCJ (Alagracah channels) and assess the existence of as-a B in metamaterials 0 Alp less; -11- -11-ΜΑ 34813Β1 Trafalgar 1 oz by 1 staining 1 Dashhrk objects anti-CD19-PE -Cy-7j CD20-PEJ · 0 In all cases, was created Rbaaat gate negative samples Mgarzh is stained as Hompfvi 1 Hklv 4b and 4c. 1 shows the address of one of the Zmt Glahri Almmaea cell T 1 for a special Bagmoouat Algraeh p + CD4. + (Figure 4 b) CD8 + J (c bereaved 4). The Arkad Yat one blood one peripheral Adhmlh Z UPN 5 03 and Olney were Alhaol from redress in day 56 and 69 of Z trail trotting T To'l Azliai in central Zlaah 0 p have not added any factors, then washed, and soils to address Akt 0 Za / d one of my water multi-variable ^ s to express Mrnzat hating cell T, and Chtha, and Ashlaa. Wei Awab Altaboub, as shown in Ubuntu 8, gating initial the exception; the August 1 Ge Alazai (14 CD 16, CD '0 vivid Aiah / dead) - and one of the cells positive CD3, then Lord of the gates Ely 0 Khala-A + CD4 and +8 Ha 0 10 Azhae Albu 1 Pat and 1 Rbaaat Bastkhadd 13:00 Lusa 0 for CAR control) FMO; CÜ45RA; 1-PD CD254 4 CD127, cc 7 does not) or Baltaboub on cell groups Ab (CD3; CD4; CD8) and subsets clearly defined (CD57, CD28, CD27); was RIP rolls d Akhol 0 meet the exponent to see the events objectively. And Figure 4 d Completeness Name of 0 to Khala.a CAR August-was Arkad Aaat one blood Anhazi frigid than 03 UPN and less p apheresis was in August in one day in 1556 and 169 from leaking 'of the T cell throughout' for Lille and i Rrai Ha r Adala any Auaml, then Gmazt and Tviemt b ^ g Cache outside of one neighborhood Drlo Kadri R. Sorry Z-Khala a Almshdvh expressing CD19 using Tjarmb first granularity 107 CD. And d 1 to Ahyn for a period Aotain in the presence of anti-CD28 and anti-CD107-FITCJ, CD49d; been Khalaedt 1 Hlaya 'and Glha, and exposing them to analyze counting multi-flow cells Afouat Z Adrn exception; a 19 CART z 20 machine Althab response to the objectives of expressing CD19. Included Awab one of the top Ljb initial & lt ;, Khaliraa negative 1 Qmah only & lt; Aah (CD16-PE-Cy7, CDI4-PE-Cy7; Water inspiration b) - and'lkhalaaa 12. 12.ΜΑ 34813Β1 positive CD3-PE, and then tab on cells CD8-PE-Texas red and positive; and the cells are one Drodh Nhmuah Classifieds CD8 + -Î. In all cases, it was created Rbaaat gate negative samples Mgarla is stained. Figure 5, containing the forms from 5 A to 5 C, a series of images showing the experiences of five Ntah evaluate clinical Alatjabat after leaking CART19 cells. Figure 5 illustrates that a 02 UPN has handled two roles of Rdakimap and Bhandamustan with minimum Cjabh (arrow, R / B) · is integrated CART19 T starting from 4 days after Abanndamotin Vguet cells (arrow B). And sleep to rid the blood of a hundred 0 leukemia resistant Rathimab and Abanndamotin, as indicated by the decline in the number 1 to Khalaaa'mfawih absolute + Z 60600 / Micro Lear to 200 / Micro righteousness 0 Tdl 18 days z 10 spill. Treatment began Balsroed cortical (Korikusteroad) per day after 18 Altmrab because of malaise, fever syndrome is not contagious. Reference indicates the line (dotted) on the upper limit of the Azadi ALC. And Figure 5b Ntak representative experiments tarnish serial biopsy of Nhaa Ez 0 J or sample clot from the patient 01 UPN and 0 of 0 CD20J. There was no Tripp NL leukemia treatment on both Almrevi samples after Almahobh experience equation be Aozloa blood and tri-0 strain. 15 have not been any monitoring of CLL cells for R. 01 UPN, as indicated by the cells or cellular Alrathat measure, flashlight hybridization in one location flashlight or B cells to normal was detected If bugs; S Khala_da flow in Alnkha marrow or blood. The 03 UPN distinguishes B cells hardship just 5% Elbe CD5 confirmed by measuring cells 1 to flow in Ashe 0.23, where 0 Ab Ta Dah Abel; no Yum Ri B cells in normal day +176. And Figure 5 c results as Altharb Olney used Ta 1 Weir CT sales to evaluate the decay brightest of morbidity 1 Amgaoi 1 Aam'lquaom chemotherapy · light of 0 dissolved 20 -13- -13-ΜΑ 34813Β1 Clenching bilateral axillary day 82 (UPN01) and 31 (03 UPN) of your 0 Reap, as & lt ;, indicates that 'the shares and the circle. Bereaved 6 SHTML 1 to Ozqal from 6a to 6c a Ebarh Z IL images if 0 c 1 Edad 1 Delaiah 1 Mgaoih 'to his demand and total cells + CART19 in the session AAC 6 Yeh UPNOlJ; and 2 H, market 00 Wood RENOVATED graph of the total number of lymphocytes was Ezz (Total normal cells and CLL) Hkabl Total Azlaa 1 + CART19 in the circulatory system of the subject to the treatment of the three cells using Edd 1 Foe Amualllq Z CBC values; and the purposes of the size of 5.0 t of blood. The strabismus total CART19 Bassett cells 1 for as long as CBC values Albrdwih with the number of lymph absolute cells and values Trguetm Q-PCR as 0 a p Mush in Figure 2, and convert copies / micro g DNA to an average L Zlimkma stated in one current document. It has been found that the numbering of Q-PCR ratio associated Galo close (& lt; Ba 0 will not d) Ptspf flow measurement cells for products Althrip and data Q 1 bit Hivkat Baataat Das Khala_a 'to flow' to accompany available to count the cells 9; CART 0 Beshrh Z & lt; Levi S 'shaped 7, 'begrudge one of the forms of a 7 to 7 d E righteous z r da -boss experiments included Zsd 0 1 1 directly Ozorg body of an object 1 neighborhood of cells CART19 August in PBMC's LUPNG. Prep cell T for 71 days, UPN-OlJ PBMCj collected either fresh after Algsadh the necessary 71 after infusion, or frozen during the briefing p wriggle cell T (August 1 Lhasa) were Hlg frozen so that they are viable before Aklatikh, where Nrd p Ed 0 & lt; u AAC 0 0 Vq to monitor and Gog except 0 da CART19 1 Lenny express trust 19 CAR on the surface. To assess 19 CAR in lymphocytes, a smudge Almthok samples? CD3-PE Oad one fad I do my Z CARI9 'curve? 647-AJexa, or 1 staining circa b CD3-PE Zdh (7 P. (CAR19J FMO a 0 explained that Bob cell 0 Foe one of the original may the disclosure of based on the front-hash and neighbor (FSC vs. -14- ΜΑ 34813Β1 SSC), then worked buba cells + CD3- and Figure 7b gate lymphocyte + CD3; and Yotk form 7c iodine pattern strain; and Aonh Figure 7 d FMO pattern Arodi's CAR · say to 0 was created CAR19 positive gate samples CAR19FM0. Figure 8, Almmttml shapes Z 8a to 8c, the phrase En r IL yen and Athristie 5 tab to determine the expression of CART19 using measuring cells 1 to flow in the b 0 v blood 03 UPN. the Cleanse 1 Sthathristih tab of the problem 8c to sample 03 UPN in Edom 56 represents Alasrascih used in sample 03 UPN day 169. the recommended form 0 8 a 1 gate convergence: Listen (14 CD; 16 LIVE, CD, Mavi dead) negative, positive CD3J-. and-broad 0 bereaved 8b Todhuah gates: CD4 positive , COSj positive. explains ration 8c and 1 Pat Z A'ldhirjh 1 Kalth: Vry "CAR19 10 and 19 of 8 E is negative, based on samples CARFMO & lt; paintings Us Alamanan). Zqd 9 illustrates a 0 Study Qahdid form 0 tab began in August Z 19 CART and exception-a c in bits nay, and 1 Boukhaa. Explains Sass 1 Scull 4 Oalkivs Khala-a Adla + CD3 Wall 0 No CAR WGHP all the cells in 1 B · AAC) and any dimensions: Easy exponent; Bouah August; PS: Albwaba, W to except * a + CD3, b r: Janitor 1 Father (.1 CD August 0 Dutt 0 E 15 0 Elbe) for the exception, Da B. and controllers NC365; 1 Tm Anhdwi in Khala & quot; a RR Sahj 0 Figure 10 Abbar for photo summarizes the demographic and disease 1 Sthabackm · Figure 11 illustrates the process of manufacture cells 19-CART- ration 12, Alit 0 for z z Aloikal 12; Zly 12 d, j; Sdhs b Alasoba a 9 Yi Ki disease. Dd 12; & lt; p Bh Wallach ACSM Q 0 m at -15 34813Β1 Shell 'for the infection of T Khala.da of a; Ad. The Azj for the first Zeus El 0 Q Raq externa 0 n sector only 6 Kliveki Lear 0 and Tin G Ieiros 1 Khab grief vesicular (PELPs 19-ΒΒ-ζ) directed prisoners from 0 Gadd CD19 scFv 1 Mttq of 1 rein 'to Advantaged 1 Gary Wahid August FMC63, and 1 for pelagic aaah 0 prayed and'abr Ie cDSaJ 8 j ranges signals 4-1ΒΒ and 0.3 human Hh. Waddell Tagaesel August 1 to Orah Osgd 1 to form two AA nest S 1 t Alozigah August 'w 0 0 love every Rs Li certain η. And refers 3'LTR to Tucker 1 R & lt; in Zlar; 5'LTRj to Tkral Zvi Penta; light of Amp to Jen resistance 'to Ambill; poly GHJ A one guy to Hr 0 Wen g Zee Wendell x international Invite; cPPT / CTS is 0 R reimburse Gjorce to Xie sequence terminal b; EF-1.J, lengthening 1. alga factor; and 7 Table circumstance; c & amp; c, generator against Batjmuah special; polj to Jane HIV in August BP 1 g and Anbm Alachakh of 0 Casey, light of the -kar; revj Alastahabh element; scFvj fragment Mtfenrh single Alsllh ; 7 a; λ of the membrane, WPREj an entrepreneur after Alansak to Gkhros hepatitis pig for one to land. And Figure August 2 Alkratayen serum levels of uric acid, but Akaz Dahedroginaz (LDH) from one sector to sector after 28 or T. 0 decidedly shame CART19- Ego 1 Vq atomic levels 0 p hospitalization syndrome tumor lysis. Figure 2 illustrates the production biopsy Alkhaa Aallla Ashe cells obtained after 3 days of treatment Alkemiana (Day-1, before & quot; Srib CART19 cell) and 23 paid and 6 months after the & quot; Srib CART19 Zhimabelin and Arosen cell). Basic value shows the bone marrow of living excessively (60%) with a three-Blood Atomic Aoun, where t 0 Lord blocs interface small cells and lymph Nadhh account for 40% of the total cells. Explains Olney sample obtained in today's 23 blocks lymph remaining (10 e / e) negative for Deimia chronic lymphatic (CLL), a mixture of Khalalo Τ cells Β negative CD5 Waddell Olney sample obtained after 6 months of the infusion to be a tri-corn blood without accumulations of lymph and continued -16- ΜΑ 34813Β1 Z CLL. O y 0 every 2 Ed pronounced 0 T. CT weighing ionization then Seoul Taha NL ERG Land in Alds 0 of ducks like Tripp; 31 Yulu 04 as follows, 0 a thd h termination b S g Kt 0 drum 0 n 1; 3 M.zt cringe; d 0 d 00 Yu Zlons August Walker. And Tdd are only 0 z * fave Alvad-not- Aceh Ed Alag Dah termination 0 0 5 less lymph meant surveys CT Anrlo d S. Ration 13.1 for inclusion body meant to form Z 3a to 3 Uh, Ouarh p LL p RIP 0 Matt 1 serum and 1 Zkhaa Athel 0 J Nell and Dr. insulting except 0 a T for Adele hold antibody Alkhemara 0 was measured 1 measurements 1 Study of Alazhiron - γ - & lt; Figure 13 a); and Sioux 1 n 10 Ggz 0 -CX C of 0 Matt 1 Nhgzh Baladon CXCL10) γ) (0 form August 3) Wi-Waller \ Butti 9 C. μ 10 xc (CXCL9 (Figure 13 c) E and Alarlak 1 n - 6 & lt; Gkl 3 Ed) and Zzk Z Ahat any August 'and coincided increases in these Alitiat inflammatory and Alkimusat 0 p start Facilities appearance. μ & gt; Tumor. Was detected low levels of Alstewen_ 6 when the underlying value, where Alazzvron -2; CXCLIOj, CXCL9 was less than detection limits when the value Alomamah- Wood ί \ refuge benchmark Alhi values Dhuatj decomposition and the values of the underlying value of the patient, Yin parentheses, Z follows 15 Adhirnero -v- γ, Z 11.2 to 23 972 Bekohm each Mellilr (1.4 p;, 2.1, CXCL10 to 5319 Bekojm each Mellilr (274 Bekohm each Mellilz); CXCL9, 48.2 to 3700 Bekojm LCD Mlliqr (177 Bekojm each Melliher); Adhirleuen -6, 2.6 to 4572 Bichaelhm Per Mile 1 g (8.3 Bekojm each Mlliqr); Ouaa necrosis 1 Lite 1.9,) a (TNF- a to 4005 Bekohm each Mellelber (can not be monitored); and the future of Adhirlozn -2 soluble 0.20 13.4 to 34210 Bekojm each Mellilaz (644 Bekojm distemper Mellilr) 0 Aovh bereaved 3 Ed occurrence of immune Alitzhabh in Alennkkh marrow. was measured by the 0 Atoveat TNF-α, and Azhrleuen -6, -17- Idhirveron -2, for A'alqy CXCL9, and Stvl Eden -2 aluminum Lawan in backhaul 0 to Taya ave been obtained of pus bone marrow in Aloouam Almnah NL after Teach CART19 Â-U. Covert armor 1 Vq-Ziad 1 T. at PM 0 levels Adhirlaanl 6, and Amarveron-7, and 1 to Kimakv CXCL9; and 0 Zgd Azholhan -2 1 soluble with decomposition Arrm syndrome; and trail vinegar 0 of T 0 failures 0 born less any 0 Ri a peak, and the eradication of Output Herchih Allhemia 0
It confirms 14 shows, Almtt 0 for Presentation Aloial Z 14; 14 Je RD because Ladd repeated Delaiah T Wavell tomorrow generator Lacey d; vinegar to 1 m Katen R. L The 6 DNA 10 Moss (DNA) g-bit blood of a & lt; Ad Aladlola (lar 14 ') d Alkhaa Lalai (Del August 4) and ave been gm 0 Ha Az Zemb Tie A Wad points j -τ Ψ lar 0 born tomorrow Ke 0 Rey and ave been a lion 1 Maha in Ahhabl Elk 0 j asked 0 0 Lalla Alaudl stools in Azs Q 0 Q (PCR). Who was presented with epidemic DNA 1 both Laura and father in August not-da P (a Lader; Z 19 CAR, Khala.da and T did not Iel 0 0 Born said Henri Laden; Doet echoed to 1 g ...! / 0 Q
Soet Althellbm 1 to Oleh in any one blood 0 and 1 cm dimensions. Ed Mtoa 0 T. Larry Zloa T Tightens 0 and K Dam sees the form of p Arrm. It was BB's blood and then 0 Cole Azaviiazeetmalhaolepfiafim 1; Zerhee? Jaap Disabilities 0 J Slas & lt; Kass 0 Qlsdbasaasedaa IP (bereaved 4 production) Rth 0 Prof. Dr. with cells 50 Hh 190 Hebkazt y 0 Apple, Z is y and Hpf the 0 instrument of Kappa Soaobin termination / 0 Azllskhala-two thousand toss 31 d b Z Hgak Elaa 0 CD5 .T 'was -m by any & lt; August Ao lest, a 8 b' Waddell will sing Abshadsases 0 Alug.odk a 0 x 1 cups Bob physical z ^ ... He's + Ehh in Arbeit each year a land. '20 -18- ΜΑ 34813Β1 and 1 to determine 1 of the following expression 0 Kappa and must be 1 to 1 Ajaopulin epidemics Presentation 1 1 Seh anguish + CD 19 + C05 (squares on the right). Detailed description of the invented Attq 6 p 0 six machines and ways to treat the Rtan 0, 1, insulted me meant nights in August does not land any one blood 'and the Euro-5 13:00 1 solid. K 0 a Itq machines 6 h insisted one I Bamlm 1 Tejah to Zql foldable Bakny for Khala'a of August Sobeir for Mstgazz Mok against Khemara (CARsj. (CAR are Arz molecules 0 integrate Adobe-based antibody to the antigen required (such as a generator against Anahram) 0 p 0 & quot; & lt ;; Kachit Saqez one of the T cell to Dhug Khemara protein characterized by worker know 0 That qualitative 0 Tae 0 cellular Anti-not 0 and respect the current Alakharaa generally using T cells modified War 1 Thea 1 Kaabar '4' & quot; p. 10 1 required. and are one of the Ahaoh 4 Li exception, da T 1 to reflect the CAR in Adhutgah insisted one has meant the termination Alkhalayal jiCAR cells T 1 for a modified, CAR. o 1 Mgdil, Tadio one cell and Rathalshatenzhlaq for i 0 0 antibody was born on the surface, giving a quality generator against the iron does not count & lt ;, and: A'0ls one of the cases, & quot; the fact that one of the T cell metallization and Rschma Aqbir Bthba 0 for CAR 1 Lee Adahj Ihlav Cbrv Z Monde 1-pressed to feel the 0 m 1 to counter one of the particular with 1 to Ztaq d 1 vinegar 1¾ cell -CD3 m or Pro & quot; yen FcyRl wa in Erottan Khemara one. in a 1 to Zmazj, Attml CAR 1 for a special b-1 for Akhitoaa meant Ztaq outside wattage 0 e Ztaly Tarhv Z MOQ 1 antibody and Ztaq Eobr of th 0 W, and Ztaq Sublaz 0 me. in a Yazj 0.0 Adam was a ^ s one of the transient S.thae 1 the one who is linked to one of a natural one for Ztaqat in CAR. In another model, the B-1 Barr 1 CD Aan of Feta or amended by replacing the security acid - P 20 Balttaqat 1 passing Nie pussy 1 to 1 Brocivat membrane S or others to Waddle Aslat 0 E Μ1,? 4 & lt ;? 1 and 1-to Aghae to Abe P and Gogol, to be Akllaq Alad not 'em aluminum p CD8a. Z door Aztaf Abtuilaz 0 me, so be Tsbm CAR Ans Ch s ';' one for me 0's for Av'lat CD28 Wa or 4-ΙΒΒ Lego or Dmje PSC any strand (Z'yt) Sublaziba see 0 Tal No, 5 0 betrays Ataada 0 Here in 0 Ouav CAR 0 Zs Wallace - In benefits Aladj 'Lash p least | Poblas CARJ Birkzv strand Aral Art CD3J- Rz · Z 0.0 PayPal additional Lash one that recognizes one of the Tai | lesson for CAR' Z Q 1 Phil does not August Ezzt Erlal Dchalat CD3 I, and 4-ΙΒΒ, and 0028 and just 0 At z deletion. Linv '0 but six of automated blood b CART and methods of reasons in 1 Lugg Backby 0 Here in one of the AAC 0, with 0.0 Ekn 1 Zj lest, a CAR T Azi Sunday, p Rh Odalal Laz Fouas counting Igtrty CAR Ilabe Douam loyalty Ie CDS tCD19) i 1 s Ar_al A, Iaht C53i4-1BB - systems freedoms' to a ^ b A- Dtkd 5 CAR T Alkha 0 of 4 Balakhaa Lader; & lt ;, Sunday, inside the Elk r 1 of the additional Z -oda to 1 must long for their end leads to the Stockade b Addm-
15 In the limit y presented Alar 1 GS Baetae Ra I 0 della and Rla -f r CAR Q-c / Mohab Ad bar 0 or because the land of Lala 0 b uh, En & lt; Coordination August y; ç to first. And Gogol, stretch out; m Tri self Akhla.a Sdowa to 0 in S. WPM Let PBMCS Father Z .rd Zly 'V WPM attached to having one of the T cells and Tmdd, a bass-M roads Allard; in waving Dissolve and Arola in Egal then diverted back to Azid 0 -20- ί & quot; 34813Β1 Alatir 1 GS generally treated MATH grate LT Gallery - CLL attached a Nmong last, GS 1 0 Lq brother goods ι \ I or autoimmune disease which leads Alkemiana War therapy or treatment: 00. Kate: eBay and 1 Sacrifice the .lmarb, will then Zinada dangerous Ahabh.lmarb percent year 0 k 0 a crisp but 6 Declaration Ba 0 harmony lest-A Mar 0 Barst 9 CAR Lhe Yesh 0 for both 0 n Thel Nlo Sass 4 Agdhalizk (Walker; for Mmsas to Ell, & gt; - goods ¥ 0 a CART), T S Baliz 1 GS to stretch those of Khaya T inside the body Alcaln R has -d & lt; a disparaging; Z CD19j m Tmtoet Eorh for a lesson uniforms mother Linda Lee SPA 1 Ave. Say cases 4 0 ~ Reel Thlalo CART19 T own Balakhqaa Olney been & quot; b to 1 to a patient; AAAAA d, vinegar gm Ace S. Lai Azid 0 E Alme Lhasa a 0 or Klaj 10 Z However, one Las insisted one of Alasraoy CARTI.T- Iaa Shell any cells) b r closure \ No, thrills 4-1ΒΒ) CD137), and the scope of the Aral mispronounce s 2 He; and ugh i the indicated 1 T. CD3- g 1 termination wa-a Z already 0 definitions 5A 0 August determines Elav deletion, the p 1 Platt Ed WAP A'ltada; in d 0 Waller z pain 0 Nicola Y Z Epeshkd Hole to like with Lange 0 Rh Adad-not only in the S Lalai -s Ib As- & lt; g r a 0 to 0 Sam any r, methods and Elmo, Dshoo, for all Sds been Onv Al 0 of 0 Ihdl my jW ljUa 'to Akharaa 1 to present, betrays and 10 P Mo'd and insomnia ESL in;, Ragh. When prescribing, Hama Wanli Wallace & gt; 0 rack -tm Assad'm additional 1 T. Father '-21- -21-ΜΑ 34813Β1 0 fact that Z is understood that Ackbyrat Avckhaddmh in this Aloiiqh be for the purpose of description Alnmang own Vgahl, nor is it intended restriction. No, 0 m Astkhadd 13:00 & quot; single Tools & quot; In this document to refer to one or more than one and one end (ie; to some extent and 1 Osy least) the destination of the grammar of the tool. For example, the expression refers to the sticky m or a 0 of massively multiplayer element. Excite & quot; about & quot; It has also been used in when referring to the value of a judge of the measured & lt ;, quantity, temporary Fihrh, and the like, to contain -t ± ο20 / or ± 0 of 0 A, and Pthial more% 5 ±, preferably also more% 1 ±, and Bngdal \ / also % 0.1 ± 1 Ge are described, Hat 0 fact that appropriate Alaarat to implement Antrq Olney been disclosed. Joshua 1 R'ltobeir & quot; activate & quot ;, Ka was Astkhadd 1 Meh in this case to Τ Ashe cell was Thgisaho «j s Lmt Elka; Cell, which can be detected. Activation can also be linked to the production Salokv 10a Mi, and functions impressively undetectable. Refers expression & quot; Khalana Τ Montth to; from Boukn Obe other; Τ cells 0 Tlerd to 1 Yum cellular 0 and thier expression A'jm anti & quot ;, as the name used in these; cent; to Re Jlopoul 1 n 0 Tea Wert; Tal Bach 0 every particular with the generator against. Can Aoun antibody is a Geloubeyolinat .taah 15 Muftqh from natural sources or from re Arbat Jenny sources as possible to Tkoz Z 0, contain warm-up Iloelh immunologically of Geloubeyolinat intact. Aoun antibodies, contain Mas't stereotyped 0 n mow;, data Mtobulen Fie. Can be found antibodies in Walles made the remarks at ¥ Z images including, for example, Ohv of many indigo counter, anti-radiation anti mono-b; Fv; F (ab) 2j Fab, in addition to the bodies of a basket mono and; mouth 0 Khadh up 20 (Harlow et al ,, 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor -22- -22-ΜΑ 34813Β1
Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold
Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-. (5883; Bird et al, 1988, Science 242: 423-426 fragment antibody expression refers to the part of the antibody sound and Ahbr to 0 Satq Tgbr unspecified 5 of the generator against the antibody properly. Examples of fragments of the body include mg 0 Ed , without limitation, z F (ab ') 2, Fab', Fab; and Tzaaa Fv 'antibodies linear, antibody scFv, and Agam specified multiple Akhawa 0 Z m 0 Iklh Z Chgloaa Jays 0 a counterattack. raises & quot;, II PM 0 Mad Fibres & quot; Z was Ataada' d in far both 0 Wii & gt; to the larger Z RIP r .1 μ iPod, however, the existence; in JT hug μι recycled in Tvklay Yep loss. Bute '' I m 0 Gadd V Z is a 0 Aads in Azh Algql, Zly Wu Tde; n 0 n 0 is not 0 for S However Almuudhs 9 T. Ed 2 1 FD in Li Yep 0 S '
Xj k μ Zbnttar less Hod But Wei Rla 0 0 03 Ndale Gadd Electric Box 4 AAC 0 H & quot; 0 Z Z Elq'a then 0 Se i 0 in Laos, Hadj 3 Agadjm 15 -noad. The lion shall consume 1 a DNA Oy'dh Arb't PLAIN 0.0 Il, 0.0 Lel Wael 'em Gadd p 0 0 Bois Plan Ouathatk 0 a year and then not. J z Ake O.ho.} * B 0 3 Joel Hill then Tweed. P Tarif scare DNA molecule Goodyear Adam Alhad light of k ^ Z DNA Joel Ross, MD, Ao Towaih Z must Yi Benefits 3, but 'b t -m August. 5ΝΑ or -23- 34813Β1 Yeh Fu Bastkhadd acid 13:00 -hah DNA nest or MTW 1 by Khmagn Abu teams and Rola d in determining the AAC 0 Air & quot; Holddd & quot; Or & quot; Gela'k 0 0 Aosmadamhvith Alorb urges kud 0 Teah. It can include those Aqjabh 1 to 1 for any Mmaeah Q Azj Es 0 3 0; 000 / & lt; a private Henaih 4 Oklahoma. Will realize pain 0 Lars forever and that any Re to Qiq, Pmaviedk Clalbrooaat or 1 Tat Aloash, Imknonmhsd 'Elaohelyzlk, _memkn Ach 1 Z Muke Ddat of DNA back Arbat Gyi or Brm' 6 P Yale 0 you Mmales Notices that any IA Atfn MTW 1 lei mobbed or Mto'lah mobbed Hamada Y Roche where Dr. Z 1 ATA Fieh d vacancy AMOC against & quot; Mesh knead damaged one of Mamdm in this Alodi 'Elaoh Z knead, Alrk a 1 Dh in the 0 n Rana that Rdbb Ttverh J Boisz August 6 Bacdosd Btoulk 1 ml Z Ji 0 0 fact that the Z Alu] Sacrifice b 0 easy to Wallace Wadley d; without share, for Nthaddam sequences partial Nivcleob of the most Q Gen Y Watt ~ knead MTW -al 6 Iotid sniff Ttaghizi in Dodndhat it 7 Sol E 4 Z 1 Attila 1 FB 0 Zenjb Viqa 0 Elaoh Z, you will realize practitioner Maher that the generator against are not required to have at Electric Box 0 Adjat 0 a Z absolute 0 obviously be easily generator against can be generated Biskz 0, Mokhtq or 1 Kha Stakkakh vital sample. 0 0 reunification possible that M 0 knead without Abe share, Reese Zsej, Aaih of the tumor, or Ookhlih Aia 0 6 0 J raises with one clustered & quot; 0 Z was raised to Orme & quot; To & quot; Ward B; and Logie snitch -cfs that p Dadd in 0 Hhm 1 tumor, in short except for a number ^ Arrm; Zhay in the cells 1 1 football; to the son in the ability of Dh age, or yen exponent 1 Z Akiologih Almokhtlgh related to the situation of cancer. It can also be shown -24. ΜΑ 34813Β1 prevention Z occurrence of the tumor in the first place. 0 Khadds ,, Alyauilladaaaseoa Kymatbimillyd 6 0 s Mtah cellular, cellular lipid acids Dhuoah, Pro-same Phones, Brocivat Vosdah, for or 0 Pro & quot; the same Željko, reminded me in -t x Alkhalmah 0 0 Z Q Aamji'ymsas tasted. Humanitarian partners 0 ah ace 0 z oo 0 o DD 5 1/0 t RIP burden 0 o no 'Akeab 1 Ggar only 0 and, AAC 0 August 0 Al Bartend 0.0 BP spyware Anal Sunday, g S Father' RIP Kdn, disease apolipoprotein (Ra A) E Anhlalsat 0:00 'Akeab'lekhouaib yen 0 Walker, RIP 0 0 Ole Gan Fairs.rd 4 Lotto, M. Wallace, the mother does not Q 0 H, Sep whist, Alo 0 n z b Aiaa Lalai Addb, lED Aa.sb, a ^ b Amoa 0 for u 0 0 Sde me. Sep A4, E 0 of not-Basryasfy, Asesri, Akybaloubaklo, a ^ s, ¥ 0 Aasess Alehit blood, Assab colitis, from Pugh things I see-Z is cm in Ezh Laalou 0 Ge, Bie uh 0 PLR & quot; Zs '' Zd! J d; for Osd Ace 0 ppm to him who Ahie re-injected into the person. Akalpar & quot; & quot Khaga refers; To "Taam is derived from an animal of the same Mokhtlgh Alorae .25- ΜΑ 34813Β1 August & quot; & quot ;; Dawi to Ydmottagspensoed 0 & quot; Tan'a Kha is Mtkhaddm disease in this document characterizes the saddle and growth is one definition of .P Kaabar p - 0 without da Ahanh. Fisher can Almrtan topically or cells through the blood stream and the System 1 1 J Li parts 0 n see the body. Examples Alrtanat Almokhtlgh include, without limitation, to 0 because one Klee, over 0 because Albroosa & quot; A, Rt 1 N. White 4 cervical cancer mercy 'Sirtat skin, cancer of the & gt; Hey, Stan Alholon and sick, Smtan kidney, liver cancer, Mrtan brain tumor Alalmoghai, cancer of one blood, Lung cancer and 0 a Z? It repels 0 1 Kaabar a '& lt; pronation stimulate Mtherk compromise & quot; 0 p used in this document, Z molecule Z E. 0 d against Vinegar displays 0 of (the Mud example, AAPC, stem cell, cell B, and the like) is linked to E Z gentile cock on a cell T, thus providing an exciting, where, in addition to the excitement 1 No 1 Dovrh Boath 4 z for example, Aotbat complex TCR7CD3 with Re MHC waffle bass, is 0 i 1 response cauterizing b in it, without limitation, proliferation, activation, contrast, light of like a walked that u 0 for me motivate Mshahuk seen 1 z, Bdone inventory, Z 4B7-l (CD80) , CD7 (4PD0L2, PD-L1, Β7.2 (CD86 4-1BBL; OX40L; Rkptjz 6 k r satisfied I
15 (108 Al), a molecule 1 Kaq d 1 z cell (HLA-, CD83, CD70, CD40, CD30L, (rCAM HVem, MICB, MICA, G, independently 0 ¾1 for Maggie, ILT3, 3 / TR6; TLT4; HVEM; t 0 Z or body mg 9 Ed Art - & lt; pronation satisfied Toll and Hzkp Rush & quot; Re particular -μ 0 p Β7-Η3. u 0 for Marenmt 6 K also satisfied St., Vymagd Alorra PM 0 Khad Dred p with a molecule to stimulate an idolater present on the cell T, such as, without a share, CD28, CD27; 20 CD40 , CD30, ΟΧ40, 4-ΙΒΒ; 1-He, 1C0S, generator FD abrasive Bovk glitch with 0 to -1 -26- -26-ΜΑ 34813Β1 (1-4NKG2C, LIGHT, CD7, CD2, (LFA Β7-Η3, Wei; \ z o b 0 form 0.0 p CD83.
Indicates & quot; molecule to stimulate joint & quot; To partner linking ratios T cell neighborhood 0 w connects Bach & lt ;, special and Z leaving Associative, therefore, as a medium to stimulate an idolater Bo response one middle T. 0 Yeh T, & lt; ,, without 5 limitation, Ka ;, Dzdat stimulate gentile Sun, without share & lt; Joel MHC 0 n 1 Gih 1, BTLA and Stvd & lt; CP & quot; satisfied Toll. Akaabar & quot; signal to stimulate an idolater & quot ;, as used in this document, to signal; Hat Balravq with E0 initial continent, such as linking ÏCR / CD3, leading to T cell Tkadr War or change 1 a 0 to Maela or 0 Dtm _tzl to Huzeiiat b. 0 fact a 0 / z 0 a m Sep passport b can not be for the animal to keep 10 Z balance, and where if you did not relieve the disease, the health of S 0 Scher in Cdhor · u Agayd, the fact that & quot; forced 1 b & quot; Dehumanize is in a healthy state urged I sprayed Lehman's capable * · L Fish with U -kon case Broil 1 N. Ash Aamadalo them in the absence of the disorder. If & quot; RCA to 1 Zzhh shower - all Elaa, not Yep Alaatrab Agharwrh disease as net in a function b Swann. AAC 0 Bear & quot; quantitative Fattaleh 0 & quot ;, as nebulae in this document, the amount of which provide therapeutic benefit - or around 15. & Quot; encryption & quot; To the natural property of a private sequences of nucleotides Crown Nivkluothaddat in 0.0 such as 0 Gesn, tcDNA or mRNA, to operate in the form of patterns for the synthesis of polymers or fine particles
S Z ^ t vital in either a specific sequence of Biotdat (ie, tRNA, rRNA tniiNA) or specific amino acids Z and vital properties of the resulting Mnwalah Mnha- -21- -21-ΜΑ 34813Β1 Baattali, the Jin Hae Blutin and The resulting 0 TeX Lucille ml is filled Zq additional to the Stein - term ^ or Boy system [./. However , Z for fitting for p August 6 , Li Tkoh 0 Tabgh de | b mRNA Y Z b except for the 'p Alolara Zly .laq Z & lt; E challenges 0 of Z 0 this pattern squirt 0 n goblin or C5NA, Ouayeelochge 0 Eros Ed S R for that one gene or cDNa. Z is nebulae in this pestilence change inefficient & quot; Dad F - 0 & quot; ! 0 me any birth AM or not da & lt; Cash, or cell, or stage 0 or Zzam KC is the blood in this document, refers' to the term & quot; external termination & quot; To what i; n 0 0 income or any Foreigkash, or cell, or tissue or system. Yum determine the expression & quot; expression Alor'h & quot; Z r -m in this Alothaghkh 6 Wa or divert the succession Nivcleoad private derived by enhanced \ / M change & quot; expression vector Legacy & quot; To the conveyor includes poly Ocleo & quot; but re melodic - Mkhabt control the expression winch connected Amilie sequence Boy Almash by the link. It includes Lash Ts & lt ;, Et 0:00 Fd Skafi Kir workshops; we can supply other elements of the genetic expression by Atel trot or in mm Tamir Leslie. Attml for less Aobeir all those known in 1 Ghann, Mhkozbat 4 Blazib 1 t (eg, naked or contain the Abozzomat) viruses & lt; Elmy i example, in one slow Rosat, backlash viruses, Iromat adenocarcinoma, and viruses Mrbth gland) Ashe - international funding re Arbat reap . & quot; Tjasaa to Tthabh succession or succession between the definition of Abyan poly peptides or Pugh p Wei fever. When Mokhma in ^ Z MTW 1 Ati Tarhi be filled in the same 'for the leaders of ads against monomer Khmany one subset of Abu, for example, as one then fill the position in both Dzna DNA du ΜΑ 34813Β1 adenine, the molecules are homogeneous at the same Adoda. The fact that the B Wallace Pugh Adoualkhan ing a function of the number of compatibility or Tjais Michaamh positions Boisson Allowalten Almqmtin to Wass El 0 d z positions comparison 100 X. a torrent example, if Tu 0 s 6 of 10 from Azas in 1 Doaivn or Tjazst the Ado'litin be 60% homogeneity. The sales example, T. participated 0 6 Apt DNA; -5 ATTG ^ landfill 50 TATGGCj% homogeneity. In general, the procedure & lt; 2jjUj counting Mhanah Allowaldtan for Haol maximum Tjad, is defined over & quot; Gelobolin Htea & quot; Or & quot; Do & quot ;, as r used in this document Cgih Z proteins, where she works on the body Ovem counter, Aham anti Moez him by B cells , referred to sometimes as BCR & lt; Msqubl coastal h) or the future of the generator against. 0 be only five to Ruff 'to included in this category of Albrook 0 t r Ebaoh IgA' 10 IgD, IgM, IgG , and Partridge. & quot; j IgA is Jem 1 FD ops Ashe 6 d in Azaz't August and saliva, sweat, Lin breast, secretions gastrointestinal mucosa and Evart from Almsak 1 Tzb and 1 for Bob Altmaslah 0 be IgG is one of the body of one of the anti-recycling 'for more Theoao. 0 Dkon IgM p Aljlopoulv 1 Mmaea 'for key 1 to Matj in 1 Astahabh 1 Mmaeah .losash in most cases. ~ The fact that Ebarh z 'to Gelobolin one of Seychelles' most Faaah cat in 1:00, an integrated installation, and 1 calculations r anti - see' 15 and be important in the defense g d 0 Allbeckraa and Agheiromat. Be IgD is one Fuma 1 to Seychelles Lalai not be his Zigh Ham Megzd unknown, but it can work in the form of M'aatil 0 born vs 0 Leko 0 IgE is' to Gelobolin 1 Daei Valley produces Hzsh Haiqh by Tmqiq Atala 3.7 modes z except 0 T and Alqaadat during exposure to Mstoj. K 0 is the one used in this document, A'madh Ttimah include & quot; BTS Mzdhar 4 or -; or η 20 B1 Ne, or any other medium of expression can Astkhadd 1 Meh to connect Vailh Tibat and Zvi dimensional. 0 Ekt committed to educational material for staff other 1 GS, for one for example, container Shui & lt ;, 1 Dd -29- 34813Β1 b to Aelyala ^ Hmtillareirasaa War Wu Alabal Z Neco d-l 'to Be , p Aceh literature μ μ p Alao.lo Bgsd sales 13:00 1 Article Altali 0 Yeh Wi broadcast 0 per Das Boath Avqubl 0 Laker sales 0; instead , or 0 for Yale 0 n prese (a μ. & lt ;, sales Eyal 'not Et p Nowie or hand pain 1 d μ μ in E 0 Dan p & quot; V,' and 5 n be p 3A Add Lacey;];, & lt; sa Ukiah Mvholo for Alo 1 d 'to exist in Mhirk ^ natural Kha Q & quot;' 0 tarry "the Aoger DNA 0 take - or routine in the pure image to a large extent, or can be 0 step in La 0 cent Osah such, did not instance, not Ouael · in the context of one current Akhara, are Astkhadd 13:00 the following observations to the rules 0 acid Zoe Ielo 1 Lamar 'raises & quot; a & quot; to Ondiosin, indicates & quot; c & quot; to Stosev, indicates & quot; g & quot; to Joualem 0 Sher' Τ & quot; to thymidine, refers 7 to Reds - unless otherwise noted, include & quot; succession and Acleoab Ahther Mtolah p Wahyu & lt ;, each MTW 1 lei Bokluottd \ me p Odhuaa toll from a 1 ha 1 Ody jÀ2Jj Zd August 6 Hmamr 0 1 Omivo. can Tdelm pain Mzarh Nivkluotad to Nschwr protein or Rna AIG 0 a no Quench ^ t to the extent where did that 4 - hui .twalah Alkhalaobd 1 Lenny Ttir Alberas in D Alozaa not Enron (Anronat) - indicates expression, virus El 0 C as used in this 5 document to & lt; 7Μ Q family 1 Rtjaeah, the fact that Daw 0 s father unique Pugh 1 Garosat Alaratjab the termination was not capable of 0 M * 1 cells is one Ge; -lm that Lemke 0 0 m Hhkaarh of genetic Omat the DNA did not host, Hat can represent a 1 Lmq 'more dependent 0 7 humiliation transfer Ji. Tkozkl SlV, HIV; and FIV r not -30- ΜΑ 34813Β1 slow viruses. Carriers have been derived from the slow Veromat Alaiarh to 6} M s km; s of gene transfer in vivo. Nth Ahaar & quot; reflect & quot ;, Z is used in far both 0 Alo; him, -dd 0 aj father; Ed Ayd Dd Ktgh in Barre 1 Altahabh in Khaga Myrz 4 level 1 Laypeh 1 Ama in the absence of '' and 5 Miep, and t or 0 Garzh eBay Ktb 0 in the eu floor nakedness Wasi 5 d z n Dlj 'Asirertkoroo.zh HCl; seen; Oila Aajalaly Z 1 lest 6 b; in the subject, as Mgdil, SAINTE Z 0; Arises: Ne y 0 Love deletion, 0 Tut's. 0 Tualba him; must Atr Mtdltn Z 0 Barr & lt; a all Tabet y 0 Qkaiotid e- termination of a 1 ha , but / d and forgive acid leaching Vwab Us k to 0 [Chapter 6 Aptabillashsrozto 8 Jd; Zvolot. Z, Tzyla.; To Oiaodoszyozddad Tine Z claim; Li Z going Aloeir. Z y Adole blood of Tom's 0 for Ba'pt Z Wu. & quot; gone Bikle 0 any Bam August 6 Z Boy Lal 0 p I r August 6 1 Dd Lacey Alodly in Ί me 15 · L doubt, .yla ijM and, .nyk, N Addoura; c 1 for p i 0 Lq Hedlav z window, reading. : Iyillakeadshessmkvddmivhsthililyd; b 20 -31- ΜΑ 34813Β1 or member 0 Bmcn identify patients Alnin have solid tumors or blood malignancy characterized by Boss pioneer for MOQ against the tumor and one middle one standard for experiments in Almarozh S. Eshmd Atae & quot; non - intestinal & quot; I fortified blast - Pray example, Z Aetae in the skin (SC); in! The vein (7;.), 1 TB (im); or Z Das S or 0 chat 0 Drink 0 1 peace Akaa 0 lira & quot; patient & quot; E & quot; subservient & quot ;, & quot ; person & quot; And similar exchanges in this document, 0 to any animal, or a cell from the light in the laboratory or on - site, are described in this tip in the Z ^ Zj exclusive b, be patient, or subject, or the person is a human being. Z find fought a 10 - year & quot; poly Veytad'a as -m 0 in this Aludih; LL Z Alnietadat. Elaoh 0 Escherichia reminded, acids Akokluotad be reproach Z anchored p Nrkluotadat- automated; Z made using one of the acids 1 to Dhuoah polycarbonate Nivkluotb Z is serve him well in this one document to 5 for Saddle 0 fact No , 0 end one of skilled in the vulnerable one public as a banner where the nuclear Alohmony Abbar for Crown .iqkluotadan, where it can Tmiaha in & quot; Nadat mono Sorry 0 0 Tdkin Y-Rh Alfokluotad't monochrome one party to Naklozidat. As -m in this one to Otheiqq p 1 poly nucleotides, without Has, Ely 0 every 6 Apt DNA where Yum obtained Rasith any reference to a & lt; Rich 0.0 is not in it, without restriction, Chbr loyal 5 of Alalat 1 Ljd to; no; brother 0 Zap 1 acid Aliowi from a library back Azibat or z Jderm me, Adam J Atak Eade PCRTMj, and the like, and Rath noted Bmakhlah 0 j r o 1 o 0 alos been M Akpouat%, & quot; Z DDD & quot ;, and & quot; Bro's & quot; -32- 34813Β1 on I cut Hin acids , amino could include succession protein or polypeptide poly peptides to any peptide or Brut 1 n ensures that two or more acids , amino connected to each other by Rlobt Bptide km-A is used in this document, the expression refers to the two series brief, where blood Alakharh it is Haeh in Rich Bbptidat, Oolijo peptides and Ooleihoumrat, on sales example 0.5 , and to longer chains, saluting referred to generally in Rich Berottanat, where including 0 up UNT / 0, includes & quot; poly peptides & quot ;, For example, the active fragments greeted, to free a large Bo 0 me Bbakmdat, Oolaaju peptides, Damirat homogeneous, Damirat is Mthansh, UNT - Z international Btdat, poly Bptid't modified, derivatives, isotopes, built proteins, S. Pugh Arat 0 to include the guardian b 0 Platt BTS peptide 1 T. natural, Bptida't return Alazibat S; Bpth; t Mkhagh, or up 0.1 d Done determine the course of & quot ;. enhanced & quot; K 0 is the nebulae in this 0 Lord Sala V DNA ED Alall Adehg VPN,! F SJT Mkhq 0 Delo, float da-y , but & quot; Zkh '/ Deddala γ- Naakluotad. 15 Z r y nebulae in 0 0 Alozehgh, uh Bute 0 E & quot; 6 August unturned p & quot; To 0:00 Lay Mthh Secret g m r d d z Adlma Ed except in sa 0 can! Q be fulfilled one Bualeh Ed; Z Dom 1 0 Deleting Abe% ù see 0 'Ih 0 & quot; * 0 1 gene iJiiM specific SJ 0 T: T 0 ;: 0, T. :::: A.t conditions 1 Hesaologih free p 0 20 -33- ΜΑ 34813Β1 Edmaaudmahzd Ilasviadlo--Abbar p Hwalah Nivkluotad where, when you connect practically Ted 0 your responsibilities and Custom Bo | middle Gni'delmalginsfikhal in percentage 0 & lt; hee Z if the father 0 dulling p favored 0 n Naa Ed 0 cent 0 Blldd · Electric Box Akaabar & quot; Tertt are Khas'a Z * and -m in this August August to counter, sit body 0 Z. aware generator against Ts, Om does not realize to 6 each or connecting one to Dzb Aloay in a sample. For example, it can Hhol r Anti b w b a generator 0 D 0 0 E from a Alonouh also that the generator against the'hd or Ashe Z Alone- u; not sauced 0 for Bgaelat those traumatic Alonouh same rating in August counter - b 0 bereaved Set 0 in Hzl R; that b Jmm counter an apostate with a special birthday of Eva against images of allelic Mokhtlgh of the generator against, Ha, it does not change the classification of the same interactive r I specifically. In Z 1 situations; 0 possible Assadam livelihoods & quot; 1 to link Acial'a or & quot; Ardat the special one, Alair 5 to overlap g 15 0 Z, or routine, or peptide 0 p Adgemiaiah seconds, to indicate that Cdakhl 0 I z presence of Hb (b Presentation seceded 1 for example, determining a special generator against or i) Z Aloouh one door to ; m example 'Derek body Megzd dam and associated BMP exempt routine della Z Ro "Yt b Ii 0 if the August 1 to counter dedicated Dtmh & quot; 8 & quot ;, the presence of a molecule Bkhuy z a (or a a free 0 is 7 Strip) E in the 0 to Iel mean & quot; a & quot; Mei; and Move Akhvvy August 13:00 A proud Waller 0 g; Alamita d 3 20 Altabno be highlighted - Ddj 1 CAD. -34- ΜΑ 34813Β1 Bath Ahabe Ashz 0 & quot; Aihd Ataalh Ott Dngz Bwatal 1 Tat Gele Nmbve (z b-Mafd ÎCR / CD3), Asda & lt; J Zabr bear's Palaly β 0 0 E de type t; .id, without share, appear to be spraying Avarl Enrev 0 I u 0 Ekl that RB 0 -s z z Bzt Al 0 & lt; Cht d d TGF-Ρ 'Wa or j 0 0 must condemn Tate H 1 every horse, the commencement Iaa 0 5 that. P 0 Sdam & quot; molecule Motivational & quot ;, & lt ;, .dba Addm in Agh Algqh, to raid to Evee Z - t Zaaiti love me my present Erepettamad 61,015 Daou A'a Trati Jesi & quot ;, as used in this 5 document, to & lt; pronation I satisfied Aud Z 0, b y example, AAPC, Hzaah cell, cell h, and the like) ^ that Ertt particularly p 0 Azibat cybernetic partner (0 Yar's in this Endolimax A'dzee Da'a b) contract cell T, thus mediates 'Sjabh up Bo'sth trait T, i, without limitation, activation, inhibition of one Sjabh pronation 4 -ka ;, and 0 a Z 9 so · be 4; 1 flap my Salé well in one Ghann and Taatgmane in mg 0 for Alose 0 molecule MHC Manallolilbz, Mmmadl CD3, x 0 Ed for anti - CD8 high, it was revitalized anti - CD2 g ultra Adahih 0 D 'Akhada & quot; It includes Alcaiot pain : Ashe Lash U Adul & lt ;; Lhasa 1 0 Teah (z easy a Cal 0 0.1 It). 0 Shell examples pressed 1 lattes subject to humans, dogs, cats, Algirav 0.1 to rats, and dimensions F - 0 and his R'thiae Nha 0 Z is Hard in this 0 document, the cell & quot; pure to free Hakhalihkholahaly free p Odhu 1 GS 1 cells one to another. Indicate trot marginalized neighborhood of 1 Li / to a cell was separated z ^ O fatter a 20 -35 ΜΑ 34813Β1 Alody Avikat; I must be in; ejJ 0 C in its Aceh. D b 0 z cases' Nne Fill the 0 Z lest, a Ignored to Hdkpa to poor Z Z Allaa 1 · In Alalan IRRI 'J deletion AAC 0 m O 0 not to trot was not 0 AHA p Khala-A Ashe Feb 0's in August' in e 0 z Akaz, Yum Cat A.elab in Ed 0's. In other Alang 'including a 1-panels to Zlaa in p Secret A'elas & quot; 0 k a r nebulae in any w to ~, Dz Wa Ao Nai. August 30 to Iwo Elamb Bois 0 0 0 Tal Walt GS, or 1 to Takgev, or loyalty Z h; b him. 'J Ilal 1 ν10; in g Ri 0 to AVI off approaches to the Father in August; B mg, or slept '! Sa and -ra yolk least 0' or any IP 'or any Ao d 0 Aal.s, M.helmalalohisemberah 10 Ataa 0, Tkozb é development,' and be stimulated blast - Dyse O't or '/ 0 0 waiter about each; Z Thousands of 1 merry! And A; Z 3 P -d m applicat U d 0 z any 'Wa; Dohdth, mystery and Ozte.- etc. S fitting for Yum - .. 1¾ RIP RO B1 Lay -m Lhasa 7' Hie to Y does not or Z; lest 0 A ! and trauma and, somewhat folding Alohrdoo Aaftrab Ad'ha eu Bm'thol; and-Sgdsroevsi; for Ylalal.'enkhme & quot; Tdla & quot; Lada 6 t V Brigade 0 of the I 0 a, b or pG 0 of Amdam Z Eaa lettuce cell 1 to Khalihelylhh 1 expose ops and Nrday '15 - 36- ΜΑ 34813Β1 indicates expression under clerical control or connected in a practical as used in this document to 0 to Mistir be in Moba and correct guidance for poly Natakluotad to control the inhibition of one of Atnach by Bollymraz RNA and expression of Crown Bhluotad. Dkon carrier is Habh of nuclear material Hmgy include Mgsol and where it can be used del DNA separated into the cell. Several carriers Mrovh in Ashe be classified, the Duke passed, Inihluotadat linear poly, poly Sedat & lt; Plan Et up or Rdugh exponent ^ Zbdat, and viruses. Palaly, Aital Aks & quot; to Aql'0 & lt ;, Alansd or Hel 0 Z returned p Yep Nge F 0 seen that giving birth is a bit Laylaz 0 Ed of Elros 1 b 'd z p Hi nuclear; [, & lt; a & gt; Erbel and waffle 0.0 Yat allowances between, Adromate d 0 of Zq. Ashlo til T. Algelosl, Dov , p & lt; Next Steps J Edel, Jet - linked tomorrow; E Nanlat Zeas 0 Uday, a young light of 0 Zq. Z: Loral Iaasf) u! Nstmilsmatihsala 6 Afees; T. Ahvkshkykon Wad Ola.hwalhsoladae 0 u: Otherwise ^ Aaoias, Dsroskyhoz 0 Kivhar 15, l; m 0 J 0, de Aioah and CNF's Lord Amedil p sa Ay 0 Hesmlessl, ^ branding, Aeillll ^ Dyeaglodils, Walt: broke up considering z 1 Taa Lucky 0 20 34813Β1 -Ύ1- Description g 0 No automated , Ihorydlajpnod 0 Yaloss.ylo 8 bench with 5 bb 1 to pain, or a solid tumor, or , or monitoring a tumor or Ahli will Amodil tumor, less 0 de 0 En RIP Be 5Μ 6 RIP 16:00 any 0 grate that I Lekov Lok one of the only Azi (CLL). It is 0 t Alosy darker treated Bassadam -aat and methods Walles Abikerb Algupe Kass 0 ESL 1 of 1 Kzv main source loyalty applicat · In found I would like , but 0 Braa Khaya (NL Khaya T) adjusted for the father of text r CAR b r 0 y d CART 0 Yeh 0 of 0 hand of the tumor. You can extend the CAR Bas NL Zhlaq Nog deciding b. 0 mg against SD Aiarat inside descenders I d j against Ayaria (and 3.C Ra). And prisoner Z CAR's Hereafter in a trot -kot Lada U termination 1 de blood of, the expulsion of the antigen love kind link your FM generator. Ward will Mudalld Q, CD1 fled 0:00 Akpa Z t any B cells. However Run, do not Yale father R. Aq 19 CD. And; Fa At 0 for Alameh 6 sector any tune Dt 0 and K Z I Lahat 0 B 0 P 1MB (0 '' War presented Ψ Rrm b Do not chew, and are de 0 Behold the Aot, or -tor P -s download Erdem any one MATH! And provided. And forgive Duo DOCUMENTS Rt generator F 0 G Love alternatives 'j r for one or not Q molecule catalyst promise (I Zie. acceded o' that integrates trust Dt 0 0 GS F - born Daoud Ed
Akdhir of Aatamat within the elite p 1 Jtroua Z sector 0 light of 0 to Cola Y fitting for Oar't 4) 137 CD (1ΒΒ, and 3 strand CD28 signals, and Zhlaq signal 3 He Zaa up Tdlhv 0 Q Zq in a Alnmang, includes private CAR Balakharaa wide signals (CD 137 (4- 5ΙΒΒ. this is because the current Alakhara keeping with the discovery supports that walked T1 Zoli Assapat cell T, which mediates -38- -38-ΜΑ 34813Β1 the CAR added stimulatory help ranges. & lt ;, cell example, the number of entry-scale CD137 signals significantly are the reported activity the loom and the survival of CAR T cells compared to cell CAR T Althamjh and is modified to express 137 4-1ΒΒ) CD). Lucky 5 current Alakhoraa provides future generator against Khemara (CAR) includes a range of Khaj cell and inside the cell. this includes scale Kah cell on a special connecting element Yadav and Akecar as a slit connecting generator against. it includes scale on the inside of the cell or Alitoblazmi scale area Send landscapes 1 T. stimulating Hsaedh Ora Dallah uncooked 0 raises zone Send praised stimulating assistance to the CAR part Almmttml the area inside the cell of a catalytic molecule 0 benefits. the'dziot Alte & lt ; Gazah same number 0.1 p Hanifat Mtah non-receptor cells generators father or & lt; Katma Alerabaalih Laz of 0 to Itzhabh Voila cell lymphoma of the birth of tomorrow. 0 Ekn d ÔÎ Fa 0 for Witten Alzhlaq which Tirj Ness and thousands Alad Sthae Walles Belhe, ed Alzhlaq between 6 and Blazs; Love | NPR I, CARJ. 0 vomiting of blood in the literature Aldela Father '
0 Attah A'ztaq Fa's 0 & quot; Aie Fouad 5 | me! Me! Love and CNN; Dre number Z t S 5 a 0 fitting for Q 0 for burden 4 was fitting g 0 Pied or i, s -% 0 j in 0 da Adola ½- della k least lin 0 for z number extends 300 Ji exhorted as' the Evv 0 for 0 n 15 to 155 amino acid, and; for more than a favor z 25 1 50 Li Wasi acid 0 -39- -39- ΜΑ 34813Β1 Hqlotmulyaaa in a food-0 paradigms, includes private CAR Balakhara nest p 0.1 duck Nos goal for Lash to Thayer 1 0 z him that trust linking against generator. The selection depends 1 S Z type and Edd Almyat Lara; Fold one for in Thald Mtah 1 cell 'to the target. Presentation for example, can Akhaddar Love Rt RCA Aq curve Z c & lt; pronation Rbti Ail Z to the surface of a cell on one of the Khalaa Afahadvh; Tth condition Lama b. Therefore, examples Mno.at surface Alkhalih.lna may reach 6 Pat Rala for pelagic RAC r F in the private Balakhho 1 GS CAR getting drunk those associated with the types of Ocoee PM 0 up; Y; and Alalvilih, and the land of one hundred self, cells Alrtan. Ne one | Bzj; 0 Ekn - & lt; {, CAR Walles Balaiii Atahedv generator against the throw m 0 yen g 0.1 Rh AAC 1 no 0 by the Trust Rt generator against the required boomerang specifically 0 Hrab alarm 'Dr. B'z | current Aiii, Aie Mattlh Mrld end and my blood Ed 0 born FD SAP Rt 0 Carr or "Jj against Mrbd Baillab scope delicious" E Zly generators against Iaqao in Aaftrapat Lrt -kair b & lt ;, the; Tan. To Rk't confirmed in Alonngh Alhaf me z Smlabal. Lewis adv 0 for z of;, Aaal for the Il 0 Other examples reek of owners Ed 1 Rh in Atjal '15 docked antibody Alor 0 by 0 J Arli Yum to Ieha Z & lt ;, Z & lt; a Erdem to Y I any' U. Labat de Aotha ornament T. will It degrades hotter trust for the people of tomorrow Mudalld Walles Bolabr 1 GS & lt ;, Ra pain because he wanted Elaj 0 0. Generators tensile tumor Mbrovh in Atjal Shell 'p o 0 for Liel, Rhode against Azt Bgelwuma, and the birth of the cheek Faln Bdavi (CEA), Juthadonos aluminous D AA 0 market j 0 the-because Jbouap (AFPj, (AFP interactive Laeken, and Tarocaloyoli, Oa- RAGE, 20 and »ICA Ilae Z; Shi -dmouar Hre not and (8 p) 2 Q Oo'rakkl -40 intestine, Μ-CSFj mut hsp70-21, and protease, and a generator against prostate specific (NY-ESO-1,, (PSA LAGE-Ia , ρ53, Bruqin, PSMA, Her2 / neu, Sorvivin, and Talaz, and hold against the secret 0 tumor Love Adoukoa-a (1-MAGE, ELF2M, (PCTA, Niotrovil Alastaz, and Adhan Β2 CD22, and factor a Azsol 1 n IGF) -I); IGF- ΙΙ, and the future of the IGF-Ι, and Masoethelan 0.5 in a Alnmang, Attml antigen tumor on one or more of the peaks adhesive Rtan generator against the & lt; Dbth malignant tumor. expresses malignant tumors of a number of proteins that can work Kmollat 0 against attack immune. these include molecules on the torrent but not limited to generators against particular tissues such as MART-Ι, and Terosaz and 100 GP in melanomas, tumors and Vosvataz Albrooqaak acid (PAP) and the generator against prostate specific (PSA) in prostate cancer. and owned by particles 5 and other Sshdvh group of Aldzhat Almttqh shift such as cancerous gene HER-2 / Neu / ErbB0 02 and there is another group of target antibody generators are generators deadly antibody for cancer such as 0 Albadana cancerous antigen (CEA). In Aloolam lymph cell B is a 1 to Gelouselzt 1 Daei Z's iodine pattern tumor generator against globulin immune particular tumor Dal 0 tumor · Odt generators against differentiation 'for B cell like cmi 3, CD20j, CDI9 of Almrthan generator 1 T. antibody 15 target Aloorm lymphoid cell B. has been use some of these antibody generators (CEA; 2-CD20, CD19, HER, iodine style) as targets for the treatment of immune underlying 0 G antibodies monoclonal but with limited success. It is also prevent antigen referred to in Alakharaa generator is against tumor-specific (TSA) or against the tumor associated (TAA). TSA is a special tumor cells does not occur on the cells 1 to Ody at 1pm 20 counterattack. The antigen associated with the TAA is not unique tumor cell but are Altabir him on a normal cell in conditions that can not induce a state of immune possibility of antigen. -41- -41-ΜΑ 34813Β1 Ajdt express the tumor antigen under conditions allowing the immune system to Alastahabh generator Aldil 0. And 0 Bmcn that TAAs Ebar be 9 for generators against Alhnn is expressed on normal cells during the growth of 0 when the immune system is exuded and Gther unresponsive or can Kollel. 0 and lattes against normally found at low levels on normal cells and yours are expressed on Avoy 5) T. The tumor cells. 1 Examples unrestricted generators antibody TSA and Halah 1 include: generators against the differentiation such as (1-gpioo (Pmel 17), MART-l / MelanA (MART, and Tirosemaz, TRP-2, TRP-b Aok't against private many links tumor such as 1-GAGE-2, GAGE-1, BAGE, MAGE-3, MAGE, 5; ρ, and generators antibody primitive excessive expression such as CEA; cancer generators excessive Altasir, and the genes of 10 free immunosuppressive tumor, such as p53. Ras, HER-2 / neu; and generators against tumor unique resulting from shifts spatial 1 for chromosomal; such IGHIGK, H4-RET, E2A-PRL, BCR-ABL; MYL-RAR; generators viral antibody, such as generators against EBVA Epstein Barr virus, generators against human Alkhalima HPV tumor virus ) Ε6) and 7 h. There are generators against other large and depends on the protein, such as 180-pl85erbB2 'ΝΥ-ESO, RAGE, MAGE-6, MAGE-5, MAGE-4, TSP, 15 d c-met; NuMa, CAM 17.1, CA 72-4, CA 19-9, TAG-72, PSA, nm-23Hl, K-ras, beta Katenan, 791Tgp72, 5Τ4, 43-9F, P 16, P 15, Mum-1, CDK4, Alga bovine protein, Pia CA, CA 195, CA 15-3 \ CA27.29 \ BCAA, CA 125, BTAA, BCA225, HCG 242, 50-HTgp-, Ga7337EpCAM, G250, FGF-5, CO-029, CD68 \ PI, CAM43, CA 175, NY -CO-1, ΝΒ / 70Κ, MOV18, MG7-Ag, ΜΑ-50, Μ344; RCASl, Hhsm 20 cubic 8016, 90-ΤΑ, a protein linked to 2-Mac / protein linked Bsichaelo feelin c, and TAAL6, .TPSj, TLP , TAG72 -42- -42-ΜΑ 34813Β1 in Nmong Mggr, Btahedv Jze incision Dt 0 born F Avs 'Z 0 F CAR Dlar 20' CD19 Hee RORI (CD22 'Sutlv, Glycoiipid F77' PSMA, .- Met, CD33flL3Ra; EGFRvIII; 2-GD ; IMAGE A3 TCR, MY-ESO-1 TCR light of 0 Haba Zq.'s, Target's | to aim, Zh T. 0 del CAR Walles Walles μ, Zq to the people of SC 5 Target insulting the characteristics Bhdv Aold tomorrow 'z Je Wael, to Mgakad E; He p 0 and k SDF antibody, Assad can m 0 E 3 0 Shad CD19J Khq Rlttsld 0 count to insert. Balakhoza Ads in CAR. I find in 71 Zj, it aims trust part antigen in the CAR Balakharh 19 CD- and Agdil,
To be the anti-CD 19 scFV; where Tesht 0 for August 6 a 0 to acid Easyway Z CD 19 scFV 10 Almto Group 1 lei Alo 1 Rose in Elmo 0 mechanism Lq 0 A: 14. In one of the seven Zj, u 0 for Mud 0 Ed CD 19 scFV Z August 6 1 Dd Alnoota Olney Ttfr succession DNA security Salé number: 20. in a 1 Vazj, Anti part CARJ CD 19 scFV 1 for a special latter 1 GS z Bh 0 Uh Ad'pt contained in successive number: 15. Alitaq trans-membrane 15 to 0 a Htq Btaq transit paramastoideus includes, can be designed CAR Ethel Zhlaq Eod 7; hand 0 c Balztaq 1 out of 1 Jaih CAR's. In one Abzj 4 0 13:00-standing energy transit loyalty has been linked Epeshkd Ouada one of one of the energies in the CAR. In some cases, DADACH 1 Khtar Adlaq Transit 7 membrane your responsibilities 0 Da'dalh a 0 acid hills only 0 Ne to avoid link those bands Passat for transient P 0 W Las Ashe-Sat surface members or others to reduce interactions 0 p exemption see s Avhibl 0 -43- -43-μα 34813Β1 can derive the transient ranges of the membrane either from a natural source or Tkhalmiqi 0 Wei 0 of Ako_n source naturally, can Ashakkak scale Z of any linked protein membrane or biting of the membrane · and-possible Ashakkak trans-membrane Nat Alamthaddam designated areas in the current Alakharaa of (ie 0 included & lt ;, 1 to less & lt ;, 1 to Mztqh (1 Mmatq) 0 of trans-membrane of l 0 him F, or the environment, or uncooked Tkd 1 cell T; 4CD28 CDS 5 CD22, CD 16, CD9, CDS, CD5, CD4, CD45, epsilon; CD33; CD37; CD64; CD 154, CD137, CD 134, CD86, CD80. Alternatively, you can -kon Altay cross-Gze Takliqa, where Attml a united 1 T. Tebah non Please choose a disease with a 0 bereaved Adad & lt ;, 1 for Joseph to valine. will Amodil finding semantic phenylalanine, and Tritbovan and Valin Edkl & lt; Vsztaq Tejeh trans-membrane. the Khttiaraa, can The Tzql Robat Ooleiho or poly Bouapd short, d 0 a 10 discriminate 1 and h length between 2 and 10 amino acids 1 to Abth between Alntaly cross-Ia and Ihlaq Eren's Alaha; s 1 Stoblazhoy CARJ. And reimburse dual Gelesan- Mpelan duck 0 Mnab very much. Will Amodil 4 to be one of the Ztaq 1 for transient of th one willing Abbar for Alztaq 1 for transient CD8 'In one 1 Bzj, Attml scale CD8 cross-Feta on succession DNA Dto 1 Rh Rim v 16' In a Avazj, the band CD8 trans-membrane includes a succession acid Aluwa only 1 Lee p.15 August 6 1 Dd However, brown No. 0: 22. In Gozj another, involves the scope of the CD8 Azar Ie Z succession amino RIP: 22.
1 in some cases, Attml 'of the scope of one of the trans-membrane 1 for a special? CAR in wit Z Love CI p. In a Pearls 0 paradigms, Eshetmd Ztaq CD8a hinge on Mtwab Khamad Roy 14: In one of the 1 Vazje includes Attml Ntafy & amp; CD8 hinge on a succession DNA Deuteronomy 0 goers August 6 20 1 acid only 0 Ne number: 21. In Rzj R; u 0 for Ztoq CD8a 1 Sai E 0 Li August 6 1 acid Alomanano. : a 02 -44- 34813Β1 Alstoblazem CAR scale. Aie Walt 0 E 0 for no / & lt; ; [, Wei 01Μ U 0 Ih '5 Tkdt bear & lt ;; 0 ,, me for Aail B.silm Halfbao Iddd; Razvi- Bakali. Walt 0 Bear '' strand Ta 0 Ee Dael any 0 to 0's Rev 0 n Broil-Q I to Chellah and Znlo e r button 0.000000 perimeter Idh can be 0-long reaching any Aie Dash any Bahml, in Oualat / e, n g was p Aldhari S 22:00 of no one; Ace 0 to milk 0 j b ω j 0 for Mayi urges light of the certificate 0 Lar. Aiqal 0 SSH was fitting Ta 0:00 Dazai Boila p China any Hta part 0 n only -all Dazs 0 Aakavi s; Aao 0 J; filleting Azar Tate 0 for agents one loyal to Zhlaqat Aiae 0 Melt confirmed 0 to Adam in the CAR g Walles Z 0 tops 1 Poplazem Z Mkhadd Bh TCR) T) and 0 Szblatt 0 Hakq 0 sales in cloudy to start Thoid 1 signal after 1 Raat Scd 1 generator against, with 1 to add to any 0 Gyoodmn 0 for Mo Aawabat any succession synthetase have the same ability Alozigah 0 is z pain 0 Rove that one of Ahaht 1 for generating through the TCR Mnrdh 0 Cove Rcay - Elka & lt; a T cell and E0 revenge ^ intention or motivating a Megzk fact Amadobh also · automated '0 possible one of the mall to be activated Khaya T produces two distinct 0 n 6 Machinery for marking one of Itoblarbh: is 0 to yours uniforms began to activate the first depends on one generator against Z -lal TCR (MTW 1 Pat ether Alstoblazib Alao "& quot;) -45- ΜΑ 34813Β1 and Tlat 1 t work in a manner independent of the generator to provide against a secondary signal or stimulus Mthzk (cytoplasmic sequences ether 1 Zdhuzh). -d Moo 1 bit Alothber initial Alitoblazmih organized Chit initial TCR complex both a stimulating way, or excessive in Atrihh 0 Ekn contain sequences marking the initial cytoplasmic Olney operate in a manner conducive to the 5-motivated & quot; refer unknown motives activated tyrosine immunological basis or future ITAMs. U 0 for a 0 handful ITAM Olney Mamadmn sequences marking the initial Alsitoblazsh Olney be Nat made using a special in the last 1 GS those Almstvh of TCR Zeta, FcR gamma, CD3, FcRbeta Ja 0 A, CD3 rather, CD3 Aaed 0, CD79b, CD79a, CD22, CDS; CD, 6d5 'Likud z Azz b 0 form Kha F Scams molecule -ash 0 Mas in CAR Z, but 6 some August 6 Lash Ladd 10 is derived from the CD3 aa 0 in Nmong Mgdil, you can design the scope of Mtoblarm for CAR Se Z Zhlaq 0 Ashld Gahel Zaz Din or Tonagh with any Ztaq (six) Stoblazem I see Htalobh 0 delegation in the CAR s ^ p
But six Declaration. Z ^ example, enable u 0 scope for Astoblarm for CAR Dhe 0 della The Zz and the point can stimulate an idolater. Raises his Altohbr Almsheerk to part Z CAR 15 includes Alztaq d 1 Vinegar one cell from Ze stimulate Mhmk, -kot molecule the Open 0 to that point Hishrk Ebalh Z? Aeadstahbbouklavscl ¥ Oomretha ^ Fold a ¥ Shsl .y p d DD 0 sixth Ts 0 Ed 1 s z 1, CD 137) 4 -ΙΒΒ, CD28), ICOS, PD-1, CD40, CD30, ΟΧ40; Mok against Atbt 0 Ψ to Ymazdi (Β7-Η3, NKG2C, LIGHT, CD7, CD2; and & lt; pronation Z'ti Aehl ^. ^. WA - 46- -46-Λ & amp;? \ 1 Ί j it. b-1 play, despite b z -bbt 1 Akharaa Epeshkd Kass Ad'm Hhl -4 R. Alta j-Ie .vuk size, -kon Walles 0 Ghl Akkhoz father Z Lal Alas- Akkar The linked 6 Apt hr Aoplaze da & lt ;, 6 E except 0 Gh Aans CAR Q Lab 0 Asisawd- Abraidbos 0, and Aggelbtouls 2 and 0 of Aadoso 'Oniklasirasi_ serine interface suitable E Set 0 s one of seven Zj, are -sm Zhlaq Aitoblazem age 0 Oaa 3 Hel Zz and any Lash 28 Hh.vi ¥ ga /, Inmsamikabohmsent, d-Aae Dhkhoslov -ochelor 4-ΙΒΒ- in Nmong a / EVA, is a deaf Ztaq Aazm Z G'e systems% u 1 s-Ozel 4-lBBjCD28. in one of 7 y, is deaf i 1 s 1 Itoblazem in CAR 0 n Cna any Lash IBB and strand 0 additional CD3- Oz, P Aitz Ztaf larg 0 Te 4 & quot; Ah & lt ;, Tdala Dd Q 0 o / Rh at.% modulate: 17 Aich for i 0 j 0 Aae 3.C- Dz nest Ouab Avd Adola Lauro in Qwab RTM: 18. extent Z; been Samuel Thlaq Aboelah in CAR g Walles trap was fitting Lash; 4 Ludo .4 CD3- do, where d Ztaf 0 Aie 4-.ΒΒ E 0 No 0 Khala'dd August 0 Mala exhorted one of Abu g 0 Oft sang: 23 and-Pray y 0 Lal 0-4 3 He is rude Z hee 0 z insisted nuclear Olney vacated amino acid sequence Z August 6 and sleep: 24 '15 -47- 34813Β1 in one of the tastiest 0 paradigms, is one of the Tsam Ztaq Itoblazem in CAR Z Alailol 1 GS least for & quot; Z IBB 0 strand Ta'ie CD3- Zat, broadcast tightens Thlaq -ashir 4-ΙΒΒ E 0 Z August 6 Z Alobo Ikorh in 0 returning, Most Number: 23 and tightens the sound Ta'ze CD3- y 13:00 Z August 6 Z only 0 must Almlah in succession number: 24.1 to Aqlat repels Alakhmj 1 of the current Mkan DNA Z Z Z Apt 6 CAR 'b 0 lit Eduab D.ta_h insisted 0 z' Nnowi Z incision Artat generator against .sal Y shape V'abh ace of sample Thlay alternatives me. Taq up inside a typical Kah walked one Tides in CAR Z Alaiii Bdov m t was fitting ml Alpes p CD3- Oz, 418 'CC28' Om 0 Young 0 Zq 'nee some cases, F Tanth CAR t any yearning Q CD3- Zz, 4) 88 'CD28) and 0 of 0 emboldened it in a fairly Avazj 0 4 include CAR of Alakhara on by anti CD 19 scFv' comments 8 He's mortal battle Ibr membrane, 4-IBBj pustular and reference ranges CD3 Zeta. In a Abzj 4 Deuteronomy 0 tire CAR Q Brother 6 Ra on succession Ahamvy Aluwa Almtkwoh in succession No. 08 in Smonj R '0 included car z 1 Ahzh Z succession nuclear Ahamven Olney Ttfr succession acid only 0 ZZ .twab Expand: 12 Mmong another, include CAR of Alakhtrech on succession amino acid bacterium in Owabt number: 12. walked Alhaol on MTW 1 lei inciting Easyway secret of molecules of; where 0 weariness of Adam ways to re-1 Rtat the collection of well-known in Rich, such as, for example z by checking libraries are cells expressing Lithia Z jet, Z saliva transforming gene from a known carrier includes leaching, or by -48- -48-ΜΑ 34813Β1 0 Beshrh 1 to isolate from one of the cells and 1 to Ozsjh to 0 Tdmzha, Ba 0 using 'Xiat Haya 00' & lt ;; a Blell 0.0 Bmcn e; Taj gene replaces attention Takliqio, unlike the cloned, blood only 0 X 1 to a current also Zoqlat where Z Yum EDR 1c DNA Z only 6 p current 0 be 7 Qalat Mgi of Fetrozat 1 Rtjaeah such as 1 to Garosat 1 to slow Ebarh for Adu 1 T. father Khakehg Zql; evaporate & lt; Yale one-term I nations erase scans Mma 0 b long fu Llh 1 n Agal up in Khalaha only ^ 'universe Yqlat 0 Vnrosah slow additional suit for vectors derived Z Vdhiroat doubt one of El 0 & lt; In Q 1 0 s poverty blood Balgir 1 n the termination can Tahud exception, Da is & quot;) Therdh transferred, Shell cells mile Yum 0 ^. To have a uniform additive in low Alastmana. Ne A; - i Azero been beset 0 Kaae all! Miss prophetic Tabe 0 of or worry 0 raised CARs Ethl a 0 Tal Adthal E 0 in the nuclear acid Atgr CAR allowances, however, or Root ^ t No, Q, A1 component j Zoql pay I & quot; u. Can! N be Alazlat 0 father is not 0 delays del 0 C for Zit sorrow 'p for Ozlat but 0 delays Study z A 0 delays and Mnment heap 0.6 Apt are substitutes, and 0 mounted 0 delegation Enem calibration Alolar Z 0 Tlleh DNA Argdb b 0 of Nish Atahedam Mkulot pay Alor 1 st Kahh by the other automatic W Se exhorted cheeks h melodic, Ba 0 use Broujullac Nettles & lt ;, core. Tkdd p son rack Sale in S '! & Lt ;, nest Z 0 land sector, data, lattes for a quarter of Arc 0 0 5,399,346 Arim' 5580859 '5,589,466, was -chin Yoaoosma in HD 0 0 Aldz Qhkprd. In Auzj R 'z Walles Las treatment Butmba 0 1 can fraternize Ahamvy Adwoa to a number of Odhula Q 1 Bqlat' t · l example 0.0 possible one fraternity DNA to the conveyor includes, without share Balzmad, Vajimtd 0.0 incision Aatije Hirose -49- ΜΑ 34813Β1 Ahio 1 Apr, ^ and Zmid. Nat carriers include special rat 's ass & lt ;, & quot; r t r Iaqlat, Iaqlat multiplication, generating probe carriers, tankers and Cali. Elaoh presented deletion, can Tvdbm Z 0 AAC's 0 e Nie Ta b .orh Laz LDS · 0 almost 0 Z lar equestrian Seve 0 well in 0 Ghann was and 0 Gha, presented TB Wael 4, 20.1), al termination Sambrook 5 Molecular cloning: A Lavatory Manual, c0ld Spring Harbor Laboratory , New York), and Qktat Arm Sau 7 T. and Ataiwm August Aldzal Aloay μ, I provide 'Ashe 0 Colette Mvidhkd presented Bdov red, Rawat methods, Vioa, T. Ed, a, Ferro 0 s 0 sticky severely, my 4 T. Reyes, and Ierdt endodontic. Bahla no 'Lash 0 Medicine t seen Z and Abiyevakachuazchaloa 6 Ad Muahhzdatdh Tbauwadao 0 0 Walker's 7 t? 0 Ih that maggot (z Su Alil, 96584/01 WO; 29058/01 WO, warez; Alakhar.a Alorikeh RTM 6,326,193 US). Then-Bydsalohhadfouossddarzhelo.ertavleveetm six Artjab Vhh Me to R. Chan drought · 0 Eknadtal .v z in Lash Lth in \ _ !, ·. Nyruph Artjab Bothaddam HPV Q 0's in the price · 0 Ekn late to Waaqid 5 ^ Fill the DS, de 15 | not Boloootoolo d 0; Foulasesoaiel; and Trjad3.akonedds Aloz 0 of 1 Frob judicious Q; in a year. In Z Abzj 'Bam for Adam applicat Ded infectious. Be the number Zoqlat Neros Gdis 0 in a m. · In! Extent Alonje 0 Adam to Ozlat Vero T. slow. -d Ts z A, Gazeh, sales Avle presented cent Hanim Ted! T there in Thh 30-110 bp R. & amp; Aba-no 'Lars 0 n RIP beginning Amtnsakah. Typically, the number of boosters that contain 20-50. 7'Μ 34ο1οο1 Eratyros 0 Babi.alokonaladhisaladhklso, At p Haz priority Czr when KF 0 or Db'b t b r g Face 7 E, Alodalaedgeisalos; Li 50 bp j 0 Ha-NL are substitutes grabbed a 0 S. 0 x 0 & lt; Sa, Evh! 5 1 Lts only Lash 'sales 5 0 4 0 Ekl DDS or E 0. F1 Ross Aemoma Rous, in addition to Mezrt Jane T: T, Q; p 0 0 T. Ds to Lhasa, bear avid ^ 0; and the warmth of my blood Yi Wallace fM 0 Dit August. The mother 0 h Lado z r pay 0 Mala However, lest 0 p August b d b ring the 10-Ake.; P,! F Hrdharbb-d a 0 aa | Q Slade 0:00 0 Boukb ^, & lt; Q, Q progesterone, and enhanced Taraseklin. Ilavelseaeiqzol; Hn, .hldsamabi 0 T. Adechaia in. W ψ Z a 0 a 0 n 0 Rell 0 Ekn I keep 0 or Z 7-J light of 0 to 0150 Seve and Aiiaar shop 0 of Ackbyr Achata 0 n Bmaoi 1 Dl that & quot; Inmuebooabesb improve Izk 0.0 Yhattal o 0 e Ava 4 Sa, Sabn 0 Zh 0 Shfkinackbyr Alaviakhalaaas-to .slar ? s needles! Vhrddhail Ynlafouanaberbi 9 20 it. -51- -51-1 1 \ 1 \ r Aathaddam bit Adokhl 0 PSV Akhlolh Z cells mouth and humiliation 6 machines Akzm- chastity Dr. Yi Jin 0 0 r z Do not me in or not t Z to W Alca's or Afouj Il -; and Atgr iPod It showed me. Z 0 0 e del Walt Wallach Z * M; p: Walles to: I; Yep 'Bhok, Presentation Q 0 1 Y, S land. 0 m needles Ads Arash Z principles Arash I z; 5 is 0 after the introduction of DNA in the rather ace p any 0 T. Aralo Alai Z Joel M. to Sahaz, T_ Tabz, Mzlool Aspell Trangeran, Vdalalaz Lala Lala 'or Jane Abroci S. Green (0.0 Er S -79: 479 2000 FEBS Letters Ui-Tei et â1 82). Koo 0 0 Z accompanied by Seche Ababa Sale Ptdo can Thfouha Bassadam Hev Sale or Aaaol b Taraa; In general, Yum Seve Please choose a united. Mtefh lowest type; l '5 -d 0.1 Avoyalohyfalhdhaljilaac'ylaz, -eeotrlavlaalaz this Bjd 0 0 0 Rush and forsaken her mother mm Muar to determine Faye reflect Atak Y Z 0 -0 harm CKD parchment Adele WAM Z Giat in Bh Sronh in Rich. Lash was fitting in 0 Ts Winch 'can enter 1 0 humiliate SSH She enjoys my faded Y'le t 0.0 Pearl Ex; Kallen ever' der; Baalo, Khmer, or an insect cell Bo 1 Plan any leaflet in Ashe 0 on i Eyal. -dash F not Lash to 15 host cell by means of physical, Ookemiaiah or dynamic · getting drunk 'methods 1 to Gesiab to entry' for poly Naoiyotpf in Aaouah cell; Steppe Vosgot calcium, bombing particle fatty infection, and the right flour, Alaschechrad Esba; and 0 a "7 ^ So 0 and & quot ; Daad Ravi producing cells include tankers War or the third foreign nucleic acid p Alorr 1 Drofh in 1 gal · see, for example,, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual 20 (Cold Spring Harbor Laboratory, New York. It is my favorite ways to introduce poly 6 Rob in a family transfer calcium phosphate infected cell. -52- Will Airq insisted 0 Woe to Adil Eboli dam in Khaya family Sdam DNA vectors and RNA . Lund! Subht Alallat 0 Frosh, I Alazlat August August 'is \ the bugs Adlo for introduction 1 for 1 Jtt Vic 0 will not dewy, Shell cells Alanan- not Aaftaly Ds tankers 1 Other 0 n Aliaro 0 Z foundations, and Aso 0 s varioliformis, and Fouds mashing Wasit first' Evertat Asia Aloau, s Aceh convergence 1 , light of saliva 0 Zq- Azzerelysl waffle uniforms Ca 4 Aloaaa; not RTM 5,350,674 and 5,585,362 · Aarq pour 1 introduction 1 poly Badrbd's in a bear one the I ed Alapt Adrdalo '0 such as Algdat / e Aljzt, and moles in the blood, Llano, and Lamas S, and his mother,' and 0 for the monitor Lhasa & lt; Bah 1 Leyte in one loyalty, F-Latt 'off-lattes one bad' and'pt Aldi · a 0 handful fy Aldro 1 Apr waffle Lalai been a 0 Desh trauma in Waddle DVI m of 5 El vivo lipoprotein (like 6 is received Siah Aie). in Oual 1 0 Sdam are Touso Ge virus) van Mah Ed Lafley 0 for Adam Q 0 j · can be a 0 use 'in Sz in; d ^'s metabolism Alsvel in d d (in Waddle' h Elka 0 o neighborhood or Dz). in margarine Anime 4 -mmh 'n -zd Add 0 against me Ds- d; be With 0 Gunn insisted Aha Alht poking at IDAL Akaia livestock pulp 4:00 Ed ward off the breached Qz my grandfather, my 7 j 3, or top. BJP des r ue and Re; Tdurnqls Aljbm 0 to Lodhi and Oobho dam, or Asaz 0 days,! And tube in Iod contain Z b Mkhrt tuck tuck 'Ed Lee H DDS' Ad Dz Ktq in DDS, Awoba. Ootafbd. H Thl 1, cited Ds- della PM 0 At Wallace 'or Alden / DNA Ao Alden / y 1 Say Dezia.ivia0'rd sales, LLC Tlei 0, Z 0 Zbl Este, Kmvelat, or b A'br;' '. J b d walked in the yolk 4 for 'Ekn that -53- -53-ΜΑ 34813Β1 be blocs irregular size or shape. The fat is a fatty material that can be natural or synthetic. The torrent example, include fat) Alaftyrat Olney fatty acids occur naturally in Alsitobla ^ as well as category 1 to Mhbat Athtoah on Haievrockerbonat long-chain aliphatic and Mstqatma, Kalohmad Aldhettih, and alcohols, amines, and amino alcohols, aldehydes. 5 and can be obtained on the appropriate use of fat sources Trading 0 on torrent example, can be obtained Dai Mirstil Vosvatidilcolin (& quot; DMPC & quot;) from Sigma, St. Louis, MO; and possible access to Dai drawing the phosphate (& quot; DCP & quot;) from 0 (K & amp; K Laboratories (Plainview, NY; and possible get cholesterol (& quot; Choi & quot;) of possible access to Dai Merestal Fumfatydel Halisrol (& quot; DMPG & quot ;) and other fat, Avanti Polar lipids 10 (Inc. (Birmingham, AL. can store Anhalal Mother of fat in chloroform or chloroform / methanol at about -20 m. and is used chloroform Baattabaa only Almnib for easy Tboukrd more than methanol 0 is the particle fatty generic term encompasses many fat tankers and single and many consisting of production Aldhettih particles or clusters Almrbakh classes. Wim-Be FB characterized by fatty particles that have vesicular structures Nat dual-membrane layer of fat Alggori Qa and central indoor water. and contains many Aldhettih particle layers on layers many fatty separates the center of water. the Taatkuzn Bean when comments fat Vgorih in Ridh amount of an aqueous solution. the subject of fat components to re-self Terpab before structures Muflqh be Tanhz water and wanted SLE between Inaah layers of fat (10-505; 5 Ghosh et al., 1991 Glycobiology). However, Z 0 committees as well as PET T. Nat structures Almokhtlgh in Anhlol structure is normal liposome. The sales fell 1; 20 may Ttakn fat appended to the structure or it may unite in pictures irregular clumps of particles 1 to fat. It also could be the presence of complexes of Abovktamen- nuclear acid. -54- -54-ΜΑ 34813Β1 broke up one Lzd from 1 to 0 the way they serve in introducing Alohmahy Aluwa 0 0 Khar live in termination d à & quot; Or exposing one cell inhibitor Alahia 1 GS 1 to present, Kaked the presence of 0 Canvas DNA Z Audh 1 Artat in one cell 1 to the family, but it is one of many Deccan Abe Z 1 prep. The S'hml experiments 4 z i example, Z & quot; dealers 0 B Hao; of Jursch & quot; Known skill owners doubtful, Matthai to the Akh Sadrn Noorn,
5 PCRJ, RT-PCR; and SDP & quot; biochemical, such as Russell 0 presence or absence of A ^ J, badly% through one of the ways one Fouah (ELTSAs but only WDN) or Bakharb one moiety in Alut; Ge 1 of strabismus to determine Olney factors within the Alabraa · sources 0 T cell expansion and for Altad.l Alo, Ashe to stay Awá Akhlaao T ^ Leah -m Arles 0.0 diuretic for breach of .1 T Sig is not 0 Lugg. Nd.tm Alhaol Asdl, Z in Zlad Adla I-1 LED 1 Aabbl to repel; T. Irrigation, Im Y & gt; Father Aceh newcomer-loyalty μ R Iie biting spyware Alhabbarih,! NSH Mong 0 to Assape Alabe 'convergence BL' father ESL, and Alouam. 0 Apr b 0 z Abzj to Okhrah Ayle Zd.m August any I z 1 lattes Adla 0 of Τ in Agala In bite Abzj to Alakhhd 1 GS S 'p blood Arles 0.1 cells a 0 n Dalla 15 Z 1 blood AAC Tmassa 0 Nalkhaf Q Btdam any NL g 0 six Alsoft burden S' 0 such as Ehl ™ AA 0 E; E. In D | S 0 Vzj not the SS. M August Z Alla.a Z galore; Slayalaordsrivss.saajasadh to Aeay «Oasla, E. Ness the cells 0 Τ, A, to Edan 0.0 to Khalaa Aeo 0 Azla-i V, Β p & lt; a mother 0 o Father '1 cells cm insisted 0 termination, Alhga. Bloody one. Nii Ngeng 'em blood t-Khala a 1 I was Jmaoua Q Rdq 20 Alghadh Onv to Waza! Ablaz of a 0 »e in d or g Lauder a part & lt; Daq Sljh 0 of Ath. P Nmodj for sticky 0 d Bam real humiliation t and its -55- ΜΑ 34813Β1 (PBS). In Nmong alternative, it impoverishes Alvesaay calcium solution may lack Mufnysiom or may lack Adil 0 All bilateral cations not parity. Again, what is surprising, that the initial steps in Akeshit Alcamoum -ada to Tniat amplification. They experienced one of his hands in Laval will appreciate the step Alvkl one I can be achieved by peripheral rehearsal them in Atjal, a 5 torrent example through the use of the expulsion of Miri semi-autonomous for Kdehg (z For Eyal; Alamaalh Cellular 2991 the Baxter Cytomate, Cobe; or 5 Haemontics Cell Saver) Onv according to the manufacturer's instructions. After Ghabay, may be suspended some cells in the range 0 Tdhueh Z vital organizations, Ely 0 torrent example, Mg2 + -free PBS, Ca3 + -free; PlasmaLyteA, or any other real Hlha Bmaz 1; or without regulator. Substitutes Z, it may Yum remove undesirable components wrapped 0 n August 1 delegation and & quot; the fact that 0 and Malvh cells directly in the center of agriculture. In Nmong else, to isolate T cells from the blood Mgoyat filamentous Yum by bees Abe Astizaf blood cells and monocytes, for example, through attributed Z expulsion during Altdj PERCOLL or by expulsion Tsoaay 1 Eza opposite. It may also isolate Yum number z 1 to T cells' for private, such as the bewitching + CD45RA +, CD8 +, CD4 +, CD28 +, CD3; CD45RO + ÎJ as Z 15 by positive or negative selection techniques. For example, in Nmong, Yum isolate one of Khalaa T r Daisy Cg 0 to 0 p anti-CD3 / anti-CD28 (ie; 28x3) - 1 of Kiryat Almnrzh, each ®DYNABEADS Μ-450 CD3 / CD28 T, temporal to guard sufficiently positive for the selection of the picturesque T bitter 0 0 Up where Hga Nmong, may Tkone fledgling temporal about 30 minutes. In Nmong else, fledgling 1 ^^ R has hovered around 30 minutes to 36 hours or longer each time you have them. In the model R 'Dr. -kon 1 to 1 surprise to Zmaveh at least 1.2, 3.4, 5, or 6 x 1 Ouat- In Gozj R Mgdil, of 0 Kone fledgling Alrmanih from 10 to 24 hours. In Nmong Mgdil, may ^ n August Lord of the nursery 20 -56- 34813Β1 ho 1 Lee 24 abuse 0 to isolate T cells from Alnin patients suffering from leukemia, because made using times of 1 to Hgazh to Herh longer & lt ;; 24 abuse, can remove the 0 Z each 1c cell 0 Say 0 and sleep a -am housed one of Hkhazh 1b to isolate cells Τ in the case of & quot; the fact that the cells Τ few compared to 0 p types of other cells, such as tumor isolate S cells lymphoma (TIL) of Onshh mother or individuals with one to five hundred. As well as the use of Firat custody longer may lead to g ^ Dhiez 1 TB Z Az-a CD8 + T. Thus, once you shorten or lengthen the time being to allow the T cells because Yum's; perhaps 0 p pellets CD3 / CD28 and / or Z & lt; Coordination increase or x 0 z Zs 0 1 Myat him to Alkhala.a T & lt; also been Sgha Bmop this topic Alutgh) E Z g chose many T cells preferentially in favor of or against counting BDP Alon times or when I see when I am practical. In addition, it increments or Khgd 10 percentage 'for the antibody g CD3 and / or' to counter g CD28 * 1 Krmat or any z Last, Dr. Blood choice of many T cells preferentially for or against at the beginning of the time or the Il 0 any Zhat time I see undesirable. Experts may realize with skill; t be numerous tours 0 n 1 to Anne used needles as well as in the context of this one Alreet. Veggies Z 1 Zmazj, Dr. 0 fact that the Q; weariness P 0 e Abe Alakhmttiar process and the use of cells & quot; is selected & quot; Walk in the process Alcht 0 DD. Tell 0 0 Zd also 15 cells & quot; is selected & quot; For more needles 0 uranium rounds may be one of many T cells through p Alakhtar S 0 p? Edge 0.1 to 1 Agam Kadh 1 d directed stain Ltah 1 Gradh to the mixer selected Salé. Vohdy roads r engine Khala "A, or one to choose a cross-Hgz 1 Mmaeh 1 Mgmas S or 1 Kfiq Wasi only 0 J -sl 0 m Rah p-term 0 or 1 to counter a single B 'to addressed to the SPS 0 of Adtah do-da 1 for existing e Khala 0 of 1 I was
20 1 Khttiarha Epeshkd negative. For 'for example, - 1 cells (CD4 Z & lt; Coordination 1 Akhkr S' includes Ouadh combination-term 0 or 1 to counter a single August Z Osam 0 Ghada 14 CDl 'CD20' CD ΜΑ 34813Β1 -1 (e), lb 16 CD; HLA-DR, and CD8 veggies some Alnmang, it may be desirable Tkhaab or Alab j T 1 Iamah and Olney usually reflect En + 04 h, + GITR +, CD62L1 & quot;, CD25, but 0 Iaar 1 Aaahabi 1, in some Alnmang, are Astnerv T cell regulatory via -anti and + 0FoxP3 and 0 0 n "s 2 h Aloqat Alcyprn or 0 j Lucite came 0 of Ί. b FH from, to cells by Alakhtao medullary or positive, has snatched the cell concentration and (i z tendency, | Dan 0 Il WAH SHIN & gt ;. MSAS Alazje 0 d _en Z b ... turn a blind Alham Bgko Dau; Ed's 0 of Bam pushing the S 0 p m; s & lt; u b sales ete and 0 g Yzlaa ;, wrap Ohhy already in Lhasa, surgeons. z ways Abal 'P voi Ed 0 m j 2 Brge 0 / & lt;,. market Nmong, are made using drag 1 Meyer b a a / s; DJ Ace, the uncle Atkhadd 13:00 b eat g 155 Thermo faded a for · In Nmong R 'C 0 m hr to Akhlaya 10' 15 '20' 25 '30' 35 '40' 45 'or 50 0 Den - Ψ t In Nmbzj Us, including 0 Madame -dz sales, a 75 '80' 85 '90' 95 'or 155 Den Tto / D.ovi, for more g Lang' -bm Adam wa 125 or 1500 indicate d t & lt ;; can lead one use one of Akz 1 to High to increase 1 Zj any; d in August; and dimensions trotting 0 Elaoh it meant, and was troubled stretch 13:00 1 higher to Akz gesture Q 0 h Bact termination Q Sala, a snitch not take En Ta 0 righteousness of weakness for the counter 1 v 1 to Mtahedvh, such as T cells I 0 Yeh CD28 'or Q 1 ft 1 Lee be .ugod b number Z exception-a tumor (for example, blood leukemia, the father of the tumor 0.1 Lech) may be Ik Aloed; d z 1 cells therapeutic value and 1 Lenny will be Z 1 Yill b-1 to obtain Elbha.elyt Adal 0.1 Sdam 1 Akir eternal 0 n Khala 0 a Aa yolk 0 0 efficiency Lod b ^, · CD8 + TL and to have an additional typically weaker CD8 + T. 20 -58- -58-ΜΑ 34813Β1 In Yzj reminded glance, Z .kon of Rgob b Askhadd; m of Tihish to Salé-not · and transferring g Tarif Tdja .bt of T cells and only 0 surfaces form B & lt; Ic i Adal, E 1 s & lt; Cree 0 V) Z cheat from the pit Aagaelat between 0 s and Azla.a. Love equ for Khalaa 0 E 0 LED p Ashe as 0 data of 0 Gadat 1 desirable Veaaetmrbtha Paljb 0 s, i z waffle 0 0 o the cells 0 +4 He T En Aouay to levels 28 He is Abtha 0 its' many Kgao 4:00 Aaila-not 08+ T E in A'lch't Sgh. Boy Nmong, long -qr for Khalaa 0 10x5 hope is 0. DVI Nmdzj R '-bm Adam Alakiz Z about 1 10 Amal, or any number of them. At grew; c again, end the Athmad 0 cells R. rotator Livnat Q Azs b 0 Rhett 4 in 2-10 ° C or at a temperature Algervh- guardian can not answer one of the T cells after step D. I hope not invoked; & lt; O, father divorced; .bjb 0 to melt one of the later seen 0 LL; / 11; Z Rh Zmala Aatla-A Ashe bear 0 z Ashbd't in acid p Ahlapa. After you remove Khtoh'fil Aana Rizzi and Av'h August 'r Loa 1 in the cells Mahvol answer, broadcast the fact known in Egal number 35. Iy'h Akhamil Dabr'z 0 & quot; And; Lenny will be useful in theory, Abag 'Vahdy unfortunately for u p 0 Adam Heq? Z 20% .DMS and 8% 'to tempt or Bomin Maty and i agents Ashe Txtoa Z 10 R.
D.akban 40 and 5% Dkazhoz 0.20%! Nomin 0 refers to BTS d s 70 Behold MSO. ' Or 31.25, miyfc.A% 31.25 d-Ator 5% a 0,45 %% 10'Ν5α d-CPAN e 4 and 5% Mzoze 20% Abu 0 yen Maty wells, and 7.5% DMSO ed any and i d oz Kh 0 B Adlai 0 Includes Z o 0's money to BTS Hcspan his PlasmaLyte 'and LED ppm U so the cells 1 to about -80 Drjo.toivbdl 1 Drja.toyakl Dfaqauejzlvi St 1 must in -59- ΜΑ 34813Β1 Alterogen liquid tank. May be Adam & lt; other Z 0 n August August to August 1 to uncontrolled Messaging counting -20 ° 6 Yeh or Albrookhv alleles 0 in some 1 Zmazj, Ham as one by freeze Khala; the August August up Z OHV 1 if ^ 1 for current and allowed of R. 1 fairway 0 births Tah and 1 unit in degrees Hr'rh 1 Grlo as a b g 0 Zvi long as five current Walles. We also find that one sauce played in 0 P i 1 last 1 GS 1 blood or suffered one of Gsadh of Mtqa 1 for the treatment of the Fihrh time In Progress need to August 1 cells to Mtkorh in this 1 and has · Z this one to Zho, it can Table 0 p z August cells are the source of any and as needed 'cells August' 0 such as 1 cells T, one of the isolated and freeze for Amtkhadd 13:00 later in the treatment of one of the T cells of any Edd S. land your responsibilities 10 1 situations 1 Lenny Merv Ttefid of treating cells T, like Tech Madkoin in convergence August in Mmong, is withdrawn blood sample or Algsadh from someone Mbm & lt ;, and 2 h 0 Labem 0 in Dd 1 Zmazj, the sample 1 blood or 1 pull Gsadh Z person 0 Khelyuge A'lamom and Oni of land for Khhler one injury, and we were not one disease I) develops after, 'was when the cells 0 up 7 Sdam 1 Overdrive in Bagy 1 Zmazj, may be expanded, freeze and 1 use one of T cells at the time of Ahvy 0 DVI Z August Dunn also described in the August BPM sampling Z patient shortly after the diagnosis of 0 RIP one of the victims and not the end -na! j% in Aozj Um, yum Azd Adla.a Z b toss d Z Z; from T_khas tomb any number of ways to 0 to treat y 1 t Sz U in the deletion Jsj R. treatment relieved the 0 Mayr tightening Mata 5 Izumab 0.1 Igabzomab, for 0 wa 0 1 pad b, s 'SPA ace 0, I and | to Ataaa and Alodo.d his tribe of 0 Maeh 0.0 such as Mekpwon;' to Ozdiaobrin, to Ohal 4 & quot; Almikuvunoat FK50j, antibodies, or immune 1 to 0 Other factors, such as 20 -60-
1 0 I Ahhz anti CD3-, Alsaxan, Wlodaraban, Alichaelosuren, FK506, Rabamesf, acid Almikouwenolak, Almihtat 0.901228 Ee, and radiation. These drugs inhibit either the calcium-dependent Algomvattaz calcineurin (cyciosporine and FK506) or inhibits p70S6 kinase, which is considered as an important factor due to the growth signals (Henderson) (rapamycin; 1991, 815-66: 807 Liu et al .. Cell 5 1993, 5: 763-773 .Biereret al., Curr. Opin. Immun; 1991, 321-73: 316, etal .. Immun). Heavy Nmong another, are isolated cells of the patient and be frozen to be used for Ahie coupler (for example, before, at the same time or at a later date) bone marrow or Zaa Ganaah cells, cells T whether deafness Amthaddam Alkemiana like Algludas treatment factors, radiation therapy treatment 1 Faraji (XRT), Mkulovosgamed, or one of the antibodies' to counter & lt;) ΟΚΤ3 or CAMPATH- in 0 Dozj last 0.0 a _tm isolate Khala, of the ABF Okhan Ba to Aliam S-time 0 d S matrix B, such as Olney factors interact with CD20, such as, Rituxan. In Aozj outgrow the current Las, are Alhg 0 and for t Khala-A T Z infant Dd; E 0 d ESL in Aga Agd, P then Mazh F 0 therapies Abz b Father, do not S Alitmbalotdat and take a -dr face, for alleles, d 0 Sale Buffett Qge Oiina bully Ashe b d e 00 a land Ouadh 0 n 5 (Isla, with Adlaya T may be 0 me was left-handed, y p Alolil or 1 t ability 0 d Em 0 him. ups, after Adaljh, patriarchal Padam roads 0 Vtmrh in r ^ thousands' g 0 coded d 1 to Khalaa in Mgdilh case to enhance and extend Adah. The Palaly; Vozh Z
<img img-format="tif" img-content="drawing" file="MA-34813-B1D00621.tif" id="idf0003" />
} / Is reconstruction, recycling
20 MPH example, packaging systems by F A, it's z 'envisaged in the specific context of Brother 6 g 1 cells Ganaah Oda Z or any of his seven cells. A 7 vilified, can be used as packaging systems (z -61- ΜΑ 34813Β1 Meh Ate'krh, we identify z Wales 0 n after Aaalaj. Μ Wei August Wasp & lt ;, Aaqla 0 T '1 cells Β, Ganaah cells, the cells Aryan Μ his performance 0 Yt 0 i cells Τ and relaxes Su 1 E Qr or after 1 to amend the Alor 1 Thi for Khala_a T Kir Z CAR S 'Zazb Akht cells 5 T and Extension Bastkhadd 13:00 shoulder ways Alo 1 rose, & lt;) -Jr 1 for an example of the procedures Walles households Er' em 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7067318; 7172869; 7232566; 7175843; 5883223; 6905874; 6797514; 6867041; and asked Bzeh Alakhara households RTM 20,060,121,005.10 in 0 Ouamh, the extension of one of the cells T 1 for a private Ppalaraa Ballam 0 Q with Z arrived 0 of Ava & lt ;, Ahaz CÜ3 / TCR Institute and blown linking stimulates bold Asiri S & lt ;, çL Khala-a T 'b particular, can stimulate one of the cells as described in the' document one of the current, automated Z & lt; Coordination Aclas Mah 0 d for CD3, or fragment thereof 0.1 duck generator 1 antibody, or body d ^ CD2 Chet & lt ;, surface or Aclas 0 p activator protein Kivaz C (for example Birostaten) & lt; Alachirac 0 p ion 1 of the Copa Kehg holder 15 Kirk molecule is on the surface of one of the T cells, yum use blown Reyes connects 0 Aljie a 0 Bags 0 for 1 for example, of what can be 0 of group 'to T cells with an antibody CD3J Y 0 Gadd CD28J, under the conditions of Mma game Sertkar 0 1 cells T. Santekar and CD4 + T cells or Khala_da CDS T, antibody CD3J and bridles anti CD28J. And possible Amthaddam examples of 16:00 1 Mgad y CD28; 9.3, XR-CD28 (Diaclone, Besancon, France), Β-Τ3 can also use both sides of any -62- -62-ΜΑ 34813Β1 (Berg et al .. Transplant Proc. 30 (8) : 3975-3977, 1998; Haanen et al., J. Exp. Med. in Khal .190 (9): 13191328, 1999; Garland et al ,, J. Immunol Meth. 227 (1-2): 53-63 0.1999) in certain Nmang, F can be supplied noted motivational preliminary and noted motivational Mhhnkh T cell Boath Romulat Mokhtlgh. For example, it can be Olney factors provide all the excitement in the solution or 5 coupler surface. When Agahranha surface, it can be paired factors the same surface, (ie; the Taku; n & quot; Cisse) or separate surfaces (ie; the trans configuration). Alternatively, it can be one of the factors Yum deaden the surface of the other factor in Anhlol. In a Alnmang, we do connecting factor that U & lt; Achalh motivational Mhmh the surface of the cell and be. Factor of atopic provides pointed activation ops in the wiped-wall or Mq 1 real surface. In certain Nmang, can Akonkela Alan in solution. Singh, in the last 0.0 Bmcn 0 to 10 factors in the fact that images are soluble / surface and then linked Ttopkya 0.0 such as cell attaches p Mstflat Fc or they drove 0 or 0 as upper cell linked to another Maertbt factors. In this regard, see, for example, bless, your post balls Bara 1 v 1 Laminate 20,040,101,519 and 20,060,034,810 for Mola 0 against Staa (aAPCs) Agafrd Atkhadd'mha in Khala_da I r T in only 6 Declaration statement. In a Alnmang, be Mistoagafin working on beads, behind the & lt ;, p Bead, a 'p' 15! & Z g; t cent, ie 0 basis of 0 & lt's ;, i Almazl, -cald S 0 in order of; Iarh August | for milk Ouar; g m cable CD3 or Araat .tvd T. and Ecot s Lalai part -6 fled a t weakness Akll 0 Ene 3 Cadel 28. He or b 1 connecting i °; d-been; to Agafcla not Dzldthsa & lt; 0 Ganedihi.vis Abzjb 1: Scull 0 Gadd 0 RT 0 i Bokit to Senth 407 Hautm Adam Nmokhlh 1, s 0 j 0 In 0 I to Olhs; Zmcepcasmtd; l 0 the one Sbtaadat b% a Alliadh s Adee 0 La Leche y T Ψ 0 Garzh b, Kusa noted S'mb -63- -63-ΜΑ 34813Β1 a: A.viohd Alnmang b is observed to increase from about 1 to about 3 1 fulfilled compared expansion observed using a ratio of 1: 1, in a Alnmang, Nbaraouh b Agam Lech 0 birth for: CD3 CD28 linked Bakherr 1 t from 100: 1 to 100: 1 r s August sa 0 Bio 0 for aspects of the current Alatira, is linked to antibodies for CD28 \ the particles m Anti CD3 5 g, j 1, the ratio of CD28: CD3 less than 1 limit. In as upper 0 certain Zj Z Alata; Bakool B1 body 1 for an anti for CD28 to 1 rein in one of the anti-y CD3 'of linked larger Z 2.Τ Bakherzat' in one 1 Bzj August 'Yum Astkhadd 13:00 ratio of 1: 100 CD28: CD3 Nljm 1 to counter a; attached to having Bakherzac, the growth of 0 Zj last , including Astkhadd 13:00 ratio of 1: 75 CD28: CD3 body mg 9 Ed m2 solve Balers't 'in ^ Zj Ahave, including Astkhadd 13:00 1:50 ratio of CD3: CD28 the antibody linked Bapmzac 0 ^ Zj Other, including Adam 1030: 1 ratio of CD3: CD28 the antibody is linked to Bakherzac. In Nmong Mgdil; Labem Adam a 10: 1 ratio to CD3CD28 antibody linked Bakherzat. In Nmong else, Adam cm 1: 3 ratio: CD3 anti-CD28 mouth linked Bakherzat 0 in Nmong else too, Yum Adam 3: 1 0 Zs by CD3: CD28 antibody to Mrbbt Bakherzat. Can Astkhadd 13:00 Melt 1 particles 1 Li 1 Hlaya from 1: 500 to 1: 500 -15 including any blood to stimulate T cells or other target cells. Z will be 0 for Doria those in August in Ashe ease, the proportion of particles can depend 'cells Z b s Father except for & quot; da' to the target. For 1 for example, can be linked to Hrzat whistling size only meanest-da Qelmellh 0.0 as possible be linked to one of Khrzat 1 Okbaraktaro, in grew 5 certain c by Ztaqat cells to 1-bit are 1:00 E1 Li 100: 1 and any valid Ivhao values in additional models by August Z 9.1 to 9-1 20 1 and can use any incorrect values among them, also Khvez except A0-a can be & quot; Z b Jemat counter for CD3 and 28 Hh Mqhernh T cells, which leads to the likes of Alkhalada as for Hlahza -64. ΜΑ 34813Β1 Ooualah, with reminded, Tesht 0 for 1 for the values of 1 to Mgdilh'lmaanh to 1: 100, 1:50, 1:40, 1:30, 1:20, a: 10.1: 9.1: 8.1: 7.1 : 6.1: 5.1: 4.1: 3.1: 2.1: 1.2: 1.3; 1.4: 1.5: 1.6: 1.7: 1.8: 1.9: 1.10: 1 and 15: 1 with a ratio Mgg 00 Lq Tkmon at least 1: 1 particle per T. cell in a Alnmang , was used ratio oi j] I to the cells y 1: 1 or less. In a Alnmang designated particle Mgsal: the ratio of 5 00 E 00 1 uncertainty Sa: 05 in additional Nmang, can Mmvir particles relative to the builders of the cells on day Akhga 0 g on torrent example, in a Alnmang, the ratio Aljemat to cells from 1: 1 to 10: 1 on the first day and are adding additional finely to Alkhalayakl day or day after day thereafter 0 k 0 rang 10 days, when Nhaiah ratios from 1: 1 to 10: 1 (builders of the number of cells per day ha Alad 0 Aq), in a Alnmang designated the proportion of particles - and adjusted to 5: 1 in the third and fifth day of the stimulus to be a cell: AVI first day. Nmong in another, it is added. '- Baas daily or every other day to alerted Nhaiah 1: 1 on the first day; Wa: 5 in Orom your loyalty and fifth of the stimulus, in Mmozj R; be with a 0-bit to the cells of 2: 1 on day 1 of the first you 0 Dz and adjusted to a 10: 1 day III and V of the stimulus, in the five Nmong August 15 0; 0 Falla bit 4 as Jos Oo.rm day after GEF missed the 1: 1 in the first Adam 'wa: 10 Apr blame Alylt 0 and | Mass of stimulation. You will Bdrick one cat; in Rich F-HABITAT 0 0 n E - & gt; Be Mtasph for use in the current Alakhoo 1 GS, Bakhdid, S_ov GMT 1 and other ratios a 0 0 n Tdkin K & lt; 0 RB d Bmaaelysad 6 Chassooai. In grown; c agave 0 of Z, but ^ h current, -m m 0 h S '0 Shell & lt; 1 a, h Ad't a 20 baskets, were μ, a & lt; for Atlas extended Zs, LDLs ή Elite cells, Adieldallal, JJ Alazt, do not does the separation of beads Muftah worker cells but are 1B together in Mmodj 65 ΜΑ additional 34813Β1, shaking Larry; t and Aaaloa 0 first 0:00 saliva Thiel 0 s Dhuz 0.0 Ilendwah tea 0 Gel, I Wildey to Tma.dsamarmzactahaa, Ehsa, AAA, Ella-TB 0 Hdlad 5 Bo and Ae 2 San; ; to Olaio 0 No aa 0 0 0 Aszjs with satisfaction, a (z 0 Elsl 0100 CD3 / CD28 T 0 Q4-a, Edba: a) Viiellatm, Elynho 0 Gglee? (del Plate will Rouab.hlh 0 8 Vaovdashs
1 Ghann identity Z can Adam! J Hla'erpl 'D 0.0 possible d 0 Colette I a .tefa, Beah 0 Sia 0.0 A // not;, Had'alla 10 sector 00 E. 0 of 0) Dhasavhlvodasam.ois, Konsulaite b 0 Alakhlaslyak.adj 0 I, Khonakonsargoybeshklke Dilaas 0 Ibnoddeddas) Fattas Tlaslakhlayawadbn , Dsmlil, Qledkadj, to Thompskhlammer / Aualy 2 0 Z lest 0 R & lt; a; s Nmong Us, sniff a 0 Taadam \ SC 1000 Bern Ι'φ Mulla s form 15 Ϊ Deddamalaba 0 a 0.5's, 20.25, 30.35, 40.45, for 0 Qiln Γ in Nmong p Aai_o, has been rocked Tdz of 0 to whatever x 75.80, 85.90, 95, the no e 0 for Zvdrlvinmazj; Dhab, Khaliassadamy't 125 or 150 Denba _ongda_aminib 1; Li ^ 4, ^ Slaney: Q:; Dzs; the Shati 0 M-Yatsasestaavibelklaya T. ; Salé 0 \ 000000 for 0 Heb & lt; :: j 0 z 0 n Iyon is why a ^ It Z Alkhalaba Study including can -kon Vf 20 -66- -66-ΜΑ 34813Β1 of pregnancies Edhavenmazgelaivh.elybl, nights, Ash s 0 or Yat father z a & quot; Q choosing more effective for + CD8 T cells in Olney have a rather tired; CD28's weakest. In a Nmang Alaboukraa current, it can culturing the cell for several hours (Ho'la 3 hours) to about 14 days or health value per hour between them. In Nmong R, Alykn aces for 21 F-5 day. In a Nmang Alakhara are culturing the cells and beads Τ together for a period of Y't luckless Raleigh 0 in another model, it is one of the freed Stzbat cells Τ Soleil for 2-3 days. Can be 0 to the fact Aldobac Lhasa Z 1 Thgaz Eva Mtalo 6 H so that it can be a time of 1 Stzbat cells 60 Τ Aomaoo eat 'μ favorable conditions for culturing T cell at the center of an appropriate (for ways money 4 Minimal Essential Media or 1640 RPMI Media or, 15 Lonza), X-Viv0 )) Olney can w; z Tui Auaml Dhaorah to ECQ; 10 and feasibility, including serum (Tysepel Alosal 0.0 Pray Jeenbgari or Shri), as one of Liukin -2 (2-IL); E; Solin, TGFp, IL-15, IL-12, IL-10, GM-CSF, IL- 7, IL-4, IFN-γ; TNF-aj or any Moo 1 d for any lost, all known to the skilled March cells. Addition materials Aryan include all cells, without limitation, all material decreases tension Altahi, Blazminac and satisfied F all Ν- eat - - O2_ every 1 Pto Aithadhul 0 can F Attml all 1640 RPMl; AIM-V; DMEM; MEM; 4α-ΜΕΜ -F 15 12, 15 X-Vivo, and 20 7ϊνο-χ, yolk 1 st 0.0 p acids each additive, Bloom Bayreuth 4 Aimivat, Su 1 E x 1 Mechanism from 1 to serum or crippling Klh inappropriate 0 n eat (or Blazha) or ¥ wiped 0 de z hormones, wa Ookmah of Klein (- v) insufficient each O'ba except T-n blood -alojdzisam counter Hlysepel 1 Osal, Ael 0 sa I Asesataat in the news, not 0 T. Astenbataat the cells in Olney be Mvquah in the subject. The Haz 0 Hlaya T Afahadvh cJ 20 conditions necessary to support growth, for example, each Mlaedmh temperature (Hlymlkthal 0.37 per Aoah 0) and t (Tysepelalhthal, Hoazaz 5 0 A 2.C). ΜΛ,? MK 2Α -6 of F-CAT Khala.da 11 t could have been -sag 0 of the Rat ZZ; allocating d 'z ^ Mile 0.1 blood or bear trot blood Zdih Acquah Abzm 1 Dhsobha to the commencement of a Bags; (aa, .CD4) urged be greater than the toxicity of a 0 or b r 0 mg Uh j e. '(CDS. Lie) T To'saa Dalai 1 T Z Ed 3 Marabou saliva stimulating baskets CD3 light of 2 mg 0 light of R & lt; Da T _kon 6 {U to 8-9 days have Hhfassbs Ela.da «L,' T E 0 Drala 8a 9-27 'Taad group fascinating T z ¥ r a reply p Hlaa 0. T · grow fonder 0 therefore, Bia; Ely trauma to equ-y, supplying eu obliterate 0 Uh Bh T -d in thousands & lt; a & quot; T- Eads p 0 Cove Buzz. Baal, as one was isolated Mejrah I Dhuaa 1 Mkhaah CKD 0 n rather: a. -ih T & lt ;, that must be 0 0 0 Qouh knead Akhmuah secondary to the point of Aker. E 0 to Oh Z, in addition to coders CD4 and 8 Hh, Sir Pat Almt Aahri 1 to 1 for other Epeshklkaaar, and Qkn in Jzekber, reproducibly during the course of the expansion of automated process trotting '-s so the Ka 0; Vi ble 0 of 0 Kha his product T cell Montth for special purposes. - 0 included only 0 Izaa current cell (eg, cell T) Menbkhh Assadam y 1 Say Virollat slow 0 7a) folding torrent example, the LV Pttver CAR which combines Ntany definition - me I scale inside the cell's 4-1ΒΒ, CD28, c53-zeta, or any Tonifat me. Therefore; 0 CKD x 1:00 p 0 del 0 0 T. instances, it can be extracted T cell ban T cell response consortium Z CAR- in some Lala 0 0 c & quot; 1 p Astetahedam CAR to redirect the allocation of primary T cell to Stdd tumor. Thus, we offer a brother one I '& quot; 0 m' E 1 is also a current on the way to motivate Ashjabh immune caused by T cell Tkhmuah or Khalada 1 Akhhraa 1 Lee E - in Cash breast include step to give breast object T cell expresses LCAK targeted recommended & quot; J t u 00 20 -68- 34813Β1 V.slarbzaouaatzsesahgv Dr. Aseel, Jge 0, Q 1 0 Bill fell externa 1 s d 1 vinegar for any 0 CD3zeta Tma, and 0 clunk Taicdhirh P "Tam-free p 0 of 0 Z as upper Mhbarakh stimulation. I Vinhd, turn a blind literature Adali Hraym 4 6 0 Joel almost as a ^ not ..y, - bb - Ddallaleae in the drum need for it. 'The fact that any Neda generated Elqlkhalaao Alo (m in Althbl. On Ald from Mufadh Aloham treatments' Tkout Khala.da car T Madrh folding Ahdhar in Adam AVI Z lead to Azla Rdla Valley-would lead to tumor steady control' in Oha 0 1 Bzje not take that CART own Balakhara cells exposed to a strong expression of Z b T in 0 Plame neighborhood and can -dom for extended time. in Nmong else, the evolution of CAR T according messenger cells to except 0 da T worker know | Dh Meh could be activated to discourage any formation or growth of tumor. & lt ;, i a 0 Cal, _hn Z 0 is one of the site's vulnerability CART19 cells and Fga for Akhlaa to express a strong spray 0 o a 11 ... the neighborhood and continued at high levels for Fihrh extended time in the blood and marrow termination and .dhan T cells Tigzh private Boukoas. without desire to comply with any particular theory, it could Tbain CAR T 1 Bethlehem district to the state semi-maintained condition Vision during the confrontation or Alazala Father cells targeted reflect the Rara Z 1 Mtsd hand-to 'without one of Rgh in 1 j any special tender, can be Alastahabh immune anti ^ Rum Asha was one of about Elaho Boath modified T cells to CAR, an immune active or Welle response 0 Baladhav 0 of the Zllh, walked to Tkone immune response generated by CAR is a part of Q & lt; Iqa b d 0 Teah with 00 of terms of which the T cells generated by CAR SEARCH Astahabh .zaah Mkhhma -69 -69ΜΑ 34813Β1 mow 0 E Link crowbar in the CAR. Z Connect Khal, get CART19 immune cells on a special 0 against one of the cells in response Lahti Ts t 1 p Thea has € · b p 0 though Olney that the data has been disclosed specifically in this Alobh revealed Z 7. Say. 0 Ti 0 e - Anti for CD19 scFv derived from gm Anti mono August Larry virus T. 0 ..e by 00 0 5 FMC63; over and over human CD8a membrane, and Ntanat Tohbr 4-CDSzetajj ΙΒΒ humanity, must .μ other 1 GS that includes any number of variations for each of the constituent components have also been in any Ot was 0 in this document. Accordingly, Alakhara includes the use of any - Drt molecule in CAR 0 Cold causes of the disease tended T cell specific molecule CAR Arbbat antigen. For example, walked to Shdv molecule bind antigen in CAR, according to Akhhrah tumor antigen for the treatment Onjad 10 Alrtan. Alrtanat rigidity that can be processed on the fact that the blood Ouzm not, or do not, "the fact that the blood to h 0 uh k; 100 and, in addition composed of Uaaiah tumors. Cancers can include non-solid tumors (such as 0 4 Ohm fought on Seal example, Awhitadh and Amgaoih) or can be Tttml on solid Obame. B Onoaa solid Alrtanat Olney treated using CARS own Balakharkh, without limitation, Z 15 1 Rtazh, blastoma, and Adikumh, and Alouzm Bhh Alawhitadih or lymph designated Alouzm Hamid 4 A.lkhbayt 0 H, and malignancies For Alaial, strict, Alsentanat, and Aloolam melanomas. It is included Aloolm / Alrtanat for adults and also tumors / Alrtanat for children ,. Crabs are the father 0 0 Ib up a ball for cancers of the blood or bone marrow. Examples of cancers of the blood include (or bloody the third) Z leukemia, including acute Alawhitadat (such as acute lymphoblastic leukemia, leukemia H 2 AAC 0 sharp Haj, leukemia and myeloid sharp Mufto and not 0 of medullary, Slegh medullary, Vahidi medulloblastoma, Abejad blood Wahidi and erythemal), leukemia chronic blood (such as leukemia myeloid (1 judgments) -70- £ not one of? 4 of -70-1a 1 chronic 0.1 Whitad 1 blood 1 Zhaj A.lzimn, cancer of the blood of lymphatic chronic); additional ball of 0 to Hakiqihe a lymphoma, Hodgkin's disease, lymphoma is Hodgkin (SOW-t der 'and 0 ") 1 multiple myeloma, and there' to Alobolin 'to Kbreue Zldm Valdnczom, Mrdhan heavy first, & lt; Matt defect Altensh (CSF), hairy cell leukemia and defect Altensh Alzehaj 0 5 tumorigenesis 1 for solid Abala abnormal clumps of Olney tissue returned; not Njie & lt ;, Aadat or Ttq h) him. Could be the Euro-13:00 1 benign or malignant solid · been Thdel 0 Alodia but r the Euro-13:00 solid type of Olney cells Tzqlha (Matthai Salome, to Rtanat, and the Euro-13:00 Allimoghaiat) · include examples of one solid tumors, such as Malumh and Alrtanat, to blame him for the fibrous 0.1 Rkomh mucus 0 H, Salome greasy, Salome chondrocytes, Salome, skeletons, and Salome Oda; synovial tumor, tumor Alglharh medium 10, Ewing's tumor, Salome muscle smooth, Salome muscular mucosa and Stah colon Afoulo 1 Fu, pancreatic cancer, breast cancer, cancer of the goddess, cancer consoled; Sr_tun Alroustal 1, the; Tazh liver, carcinoma Thaikh cells, basal cell carcinoma, Rdlo gland, the mystery of 0 to Azh 1 FH Rip, carcinoma medullary thyroid gland, carcinoma of thyroid papillary, Q; Tazh Ibad 1 Dhatm 1 gland Almayortah, Lingo papillary, cancers of the thyroid papillary, Lingo Kaih; milk 0 to Azh August 15, gibberish renal cell, Aertanh liver, Mrtanh bile duct, Alirta; its Almhbah; Wilms' tumor, Rtan cervical tumor testicular seminoma, Lingo bladder, skin cancer, and the device 1 to a nervous one for Mzay tumors (such as Dpfi (such Jna brain glioma tumors mixed glial) , tumor Aeros glioma (also known images blastomatous glioma) Starry, lymphoma CNS, tumor Aztathi 4 blastoma for Bakzera tumor, Chgana Qahvani pharyngeal, ependymoma, the pineal gland tumor 0.20 tumor Aeros vascular, tumor Alaab small intestine, tumor few Aldbkiet Alngsn, Alhaia tumor, blastoma bacillus, Aeros Chula tumor of 0 and 1 for tumor Alazbutathi the additional 0). -71- -71-ΜΑ 34813Β1 in a quilt Laghmanj 0; molecule are linked antigen part of your CAR Balakhozla special treatment design. For example, you can use the CAR, designed to target CDJ9 to address 0 Lights disorders include without limitation BALL preliminary (a reference to the children), ALL Abghaff, CM 0 because one of Gald F-1 priority of the cell coverage, tumor Amoghaih cell 0 Kber T, treat rescue d Zaa brain-sector 5:00 Levy, and like. In ^ Zj another, can be designed CAR to target CD22 for treatment of a tumor of the Humvee cell large p B; in a 0 extent Alnmang, include cancers and disorders without limitation BALL Aube (exciting for children), ALL 1 art, lymphoma cell coverage of cancer, to Amoghai tumor cell Hquierh not 'Lage Azqave after Zaa Nhaa bony Khaga, and the like can be processed using Tolgh Q CARS 10 target RORlj, CD22, CD20, CD19 in a Alnmang, can be designed CAR intermediate target for the treatment of August tumor 'Smtan pancreatic, ovarian cancer, and the like, in a 1 Bzj; freestanding r CAR -q CD33 / IL3Ra to Laage acute myeloid leukemia and the like. In a Alnmang, can Tsim CAR to target C-Met to treat ^^ n 1 to breast S Adde; 15 goddess cancer cell is Elsafarh, and 0 a Daddah Zka 0 in a Alnmang, can be designed CAR to target PSMA for the treatment of t ^ n Albroosa & quot; a and 0 of 0 Ouhaba reminded 0 in a Alnmang, can bathing CAR to target Glycolipid F77 for treatment plant Albroot & quot; a 0 and a cancer like. -11- -11-ΜΑ 34813Β1 in! I do not Ekn. ^ »Doanh | Aaslj of 0 0 E! Asisl 0 literature. Q, Nyohdszj, Hnsbm CAR P 4 V2.h Sihsemsh 0, 0 mil because ... t. , -. B Abzj, -ekn'b "Pugh ε ^ Υ-ESO-lTCR 1 Lélouma, Aual, Jordan S-'dymaa Zq- 5] Edalaz H.semsd Sass 0 Dlajploy, Icdh skin, and a damn about it. Q, .baouala, Rhspzql & lt; ^ Daalavasdoualosadalbeetmaagv in Laos E i 0 0 Love it, love Fill the Alakhara sales & lt ;, a goal shot * 'b RIP can use a 0 CAR Ylaj land. 0 a can! N-C 0 for Khala.da T A'zdallalz b CAR etc. Sa D'lderebekbi 1 0 n a clear - Z Z; c Ado / Ooelajsmadvix 0 0 Da.hao Gdil, -kon Aash Y is a human being. Das 0 I Tkash Thad:;) - | cells, il) Ed DNA Bethel CAR to Alkhala.da, Wa or ;;;) MA 15 Hgz Alkhalalo. However, the fact that all Oualj Hat 0 0 0 Khaya Rovh began in Rich colored father \ / folks Adé. Passard, Yum separated brother,; a Zmtda (z μ μ Zlon) and rather W (ie '! & B in Ala 0's); LÏU lends Laurie' r CAR then Elk 0 to that point Et 0 of this Arepetta- Ikt; Etae Khaya ~ rather d CAR to Stvz of a (mammals exhalation I lest 0 a. Ά to 0 Cote Tel 34813Β1 -61- mammal is a human being and can be modified cell CAR Resume for the future. Alternatively, you can Tkone Khagah cells, or Bthleeh, or Mgabi for the future. at 0 E. Osq procedure Tospba Khabih cell to cell medullary and Salafi made up of blood in the patent Alakhuya 1 Arye modulate 5.199.942 .US, are included in this Alutiqhcomerdja 0.0 possible F ZZ cells present Alakharla. other suitable methods are Mrovh in Rich, therefore, does not comply with current dimensional in any way special Tospa Khah vivo cells. In short, u 0 for Aibat expanded cells a true vivo on: (1) gathering + CD34 Nhaih and Salafi cells Mkulo blood Q 0 Cash Denny 0 n assemble the blood ends or cultivation Nhaa bone; and (2) the expansion of the valley outside Lean neighborhood 0 as well as in the skies cell growth described factors Alaya Urdu US No. -99.942 a 0.5 E can Astkhadd 13:00 other factors del flt3-L; IL; 3-IL light of;, a 0 E Trabaali, the donkey and the expansion of the cells. Baladahh to Adam Qah foundation a 0-Louis in 0 A. No 0 Lq Pthe 0 P z Table 3 neighborhood, Igdm but 0 current dislocation also-Yat and methods of the core D'khal vivo to chose a "- & lt; A, E 0 Teah .ugeh versus Mtdd in Rd- hissing, Raddvalaurdirtr 0 NF 0 burden subject We need, the amount of Vthalh Alahio not thrusting 0 or 1 to prevent cm heels Nur 0 0 n E r b Yi.aasll UM CAR Alao. 74- 34813Β1 can be given to the modified T cells by CAR from the current Alakhoza either singly, or at Haia & lt; 0 deject of Pharmaceutical Pavravq with diluted substances War or with other components such as 2-AA or other Satakinat cells or groups. In short, it could include pharmaceutical and Shabat from the current Alakharaa 0 mg Uh-oriented cells have also been described in this Alutagh, Pavravq with one or more of the carrier materials, or diluted substances, or pharmaceutically acceptable excipients or physiology. Can those Alakibat include E; Z solutions organization such as saline entrepreneur neutral solution, brine regulator Balgosvat and 0 a similar reminded Krbohidlat like Jllowes, Mannoz, glucose or Dickshrans, mannitol; proteins; poly Bibidat your responsibilities Take a break Aminu such as glycine; antioxidants; Khalabah factors such as EDTA or Hlatatheon; Mo'd what ^ of (for example, aluminum Hidimid); and preservatives. The formulation Tate brother insisted dispute 1 1 Mgdil me is to give the roses. 0 spray give Pharmaceutical Bkibat of current Alakhhra appropriate manner for the disease, which will be 0 Aake (Ao.elloukaah it). It will be Thdidkamih and repeat administration by these factors such as 0 Ί Almrdd; p and severity of the disease disease, Bargm of the possibility of identifying doses 0 blaming Bois. Tt ESL Alaclivekih 0 0 Z. 1 to raise 1 Li & quot; the amount of Vthalh Taao & quot; Or & quot; the amount of Fattaleh anti-tumor & quot ;, UCM 0 e Sal 0 d Blood & quot ;, or & quot; the amount of therapeutic & quot ;, can Thdid'lkamih.dakkiqh of Ambat current Walles * \ ί i 1b Ni familiar Balachtlavat'lchksah in age, weight, size of the tumor, the extent of Alai ^ or the growth of 0 Alolm, and status. Almrihny (1 subject). Yemen is generally one to say that he died Atae Taymiyyah PlayStation -1.1 T been Sgha in this one document Ezdgereh 0 of 4 to 0 or cell / Khmmn August weight z Nhumggl 10 Halle 10 e Khalhakds Lorne light of Z in reminded p 1 Fa August Datl Z energies, can be given Ambat T cell several times when those doses. - N E μα 34813Β1 -h6- al-Tathreeb cells using known techniques commonly in immunotherapy (Ashe; for example, 1988, 319: 1676 .Rosenberg et al "New Eng. J. Of Med). Can be a bold one for a perfect 0 for u special treatment to a patient Bsaola by a skilled I was vulnerable through / Aqubh land Khdel signs of disease and adjusting treatment accordingly. In certain Nmang, it can be desirable to give except-da T termination to close Dr. Zllg Aeodh - blood after Nellv (or make the separation of the components of the blood), and Chit cells of which according to the last one the current GS, Wa ^ Dah "Chreib patient cells T activated and expanded. Mmvin Tech can process as many 0.1 tireless E 0 Da Dad Ganj particular, can activate T cells from the blood drawn p 22:00 .i to 400 mb. In Nmang b, fascinating are attached to having a T Z blood Mahob 020 m landfill 0 30 pronate, 40 cm in 50 m P 360 Feb; e Feb 37 .80 light of 90 m or 1.0 m landfill. Without any tobacco B 'Adam Cole 0 Baldmcd / endorsed Aaabd.habrepetts, Z can Atae tons, but in income 0 0 Study, p name, B'd Ed' -ed; Etae Rit Ashe were: 0; To Yadvs, Fayalod.a, to Odtlays 0 I 0.0 for abused & lt; Skhaa Veasl, Dvisd (7a) Eooviaioua ^ Na.vididjebembez i 0 Oaspa Alysdilotgyfayalodmhootana 4 Viauzjom, A. d Ntooasa ^ Agkldilokhvadd.fairs, Tech 0 data Bh T 0 Beshrh in tumor 'em; 1 gpt, ed & amp; 0 August 1 15 -1 -1ΜΑ 34813Β1 in ^ Zj b y the other one current GS, including Atae activated cells and Alusah using the terminal described in this document, other Oozk known in Rich where they are expanding the cells to the B-A treatment, to MATH baller 1 Vq 0 (p Slalhial, before, simultaneously or after) any number of r & lt; at lest: h Nat link, Z in Dl_k without limitation treatment using agents such as interferon therapy Garosat, Bong 0 u 5! 2- ê, Star 1 yen (also known as ARA-C) or address the & quot; Albroomap; the MS Z or F-1 Aromab patients 1 Kdwih 0 or other treatments RIP PML · in ^ Zj extra, I did Assad'm & lt; a T own Balakhara Balbravq Ha Alajkemiaia, radiation, immune impeding factors, Hthel cyclo Surin, Arathiobrin, Sthotricksat, Mikoanolat , and 506 of ?, antibodies, or 6 hope JUi 0 other cortical such as CAM PATH, antibodies g CD3 or Agam treatments for other anti-; 10 min, Wlodarien, cyclo Surin, FK506, Rabamd, Makuvu'ak acid, clash 4 FR901228; Msakinat, or radiation . Those drugs are B_et Amakalienyoran Vosvataz approved Z calcium (Michaelo Surin FK506J) or Tthbytkivaz p70S6 important Zaa'ty tastiest 6 1 Ki Bakoh & quot; see (Rabamyin) (,, Cell 66: 807-815, 1991; Henderson et al .. Immun. 73: 316-321, 1991; Biereret al 1.et al do not; a 1993, 773 -5: 763 .Curr. Opin. Immim). In an additional Nmong, it is given ripe cells from only ^ AR-15 current to the patient Balravq 0 (p on Saay example, before, Baltermn or after) Zaa bone marrow, E 0 Lage interval T cell using either therapeutic agents chemicals such as, Wlodaraben, radiotherapy p external (XRT), Sklo Vosgamed, or antibodies such as ΟΚΤ3 or CAMPATH. Nmong in Other, are given 0 LIBAT cells from the current Alakhara after the treatment of B cell separator such as Taatfad h CD20 factors, the torrent example, pomegranate. For example, in a Alnmang, it can be exposed 1 B 20 to a standard treatment using chemotherapy high dose followed by Naa stem cell-blooded surround 'A ΜΑ 34813Β1 -66-; 7 Zj b, b 0 d Lasha, Sco, disease -ha Aa August cells principles by the other four Alala- in additional Nmong, are given Moumah cells NL or d Ab'i 'dose 1 will change resorted Oela 5 1 I 1 m Etaaha to metabolize 0 p literature 1 for accuracy Llh 1 No 1 for the educator 1 Lenny is Elajh 1 and 0 Scl treatment 0 can Abe & quot; drawer one bit of Aetae 1 Bshi and 5 of Mmar 0 s staggering in Rich 0 will 0 fact that the refugees for CAMPATH 'Z b waffle 4b not 0 of 1 to strand 1 to ho 1 Lee 100 mg PO adults, do not 0 Datty Joop K; 6 n 1 and 30 & quot; Rum. -kon 1 Jrah one to throw one of Mgdilh of 1 1 Li 10 mg per day b; tattooed in some 0 1 situations -h Adam Jrouat largest expose to 40 mg Balom (Vr in Lioness Father Urdu 0.0 m 8 · No 0 6.120.766) 'one of the examples Sister 8 Yeh. -e described the father of any b thrilled to Alolola 10 1 Akhtarih S 0 -vdam 0 you only 0 such as 0 of for the purposes of illustration only, and F. vs. restriction unless the number of otherwise 0 therefore, you should not Tver Alakhozaa anyway Z's d only 0 Zh Alabe Om Unlike Znk, you must change Z that Connect any Alagthelavat includes Lenny 1 bb for generating one I presented in this document. No description Latvian, from AA 0 count that one with Alharh Lalai in Aagn-Ge, for Adam 0 to describe the 15 A 7 Coordination and 1 Althelp Ahoillvh 'uniform, Thfou; and as long as & lt; Yat Wallace Adali de ^ chiming b. Linv Ttho only bug Ala 0 0 by one to the next, Ouaho to Abzj ESL 0 N. Wallace Idli 'rather
Interpretation Ktakiad intended in any way to the rest of Akoshguet 0 AAC 0 for 1: d 0 Vinegar 0 Rayya 0 Alro p Khala.lo T in patients infected with Mrtan blood Advanced -78- 34813Β1 Abt Alkhala.da milk 0 Gaoih Z predictor Sclat 0 Gogol j, j (CARS) Adad; Ή in Ed 3 | Gee and the 0 Iarat Mud 1 de Euerm in AAC 1 convergence; - Alaq- 'Y - term in Ai 0 Alo; cent to Khala.a CAR T | Lenny unsealed U 137 CD Activity - /, Wei ^ blood Z RIP Aa Alab in Ilat of 0 lah disease fave 0 Maput lattes blood 00 CCL 0 g 0 n blood (CLL), Nota rather; a T | whole Rapa Walker Q F z 0 P in Adam one neighborhood 'for only Lucky 4 Sass and content of the expression of the CARS and Vlegbh T. of births Aala births 6 Oadely Alozl' in Abu 0 i, each Westernization Khala.da CLL 'Φ 1000 J, j, CAR. T Z Aloh- then 0 to regulations I; aimlessly Khahh CD19 in the blood and marrow Atkhaa, accompanied by full dilution in Aibn Q Izh trauma of a 0 y-Elaba Walker; Kkhalaaa CAR. T LED 1 football, am to have been reminded Alari 0 for z Aq; d MHC Algtalh for the treatment of neuro malignant B cells. Are now described MATERIALS AND METHODS Altkhaddmh in Dalg Akharb 0 MATERIALS AND METHODS a public giving was; Er 0 E processors, and embody and transmit sli Applied Research in I hurt Cdlo loyalty 0 cans I i 00 a Bzev; O to expose under Mgah 0 m practice Sia b; h SOP Mahaz War Ed Iwall ' T. to acceptor, address, embody and transmit cursed. Eetm.akdqva; August Amat and financial framework using the principles 527-528) MIATA: a 3 Janetzki et al., 2009 Immunity ) 0 -79- -79- ΜΑ 34813Β1 not 0 m Albrooaol then slaves August Alaklchukah (NCT01029366) z PS graph in Figure 1. the Alnin patients suffering from malignant tumors 1 to a bloody 19 CD with continuous positive disease in the wake of at least two treatment regimens Alsath and 1 Kzn they were not qualified Lzi Ganaah Alkhaeva cells, 5 qualified for the experience. After re - Tdrbj tumor, it has been compiled Anhaty T blood cells CART19 manufacturing by apheresis and give the disease and the role of one of chemotherapy's as defined in Figure 10 during the week before Althrip. Was given cells 19 CART By leaking into the vein using division Jnah Idh system 3 days (10%, 30% and 60%) dose was Todag in one of the bereaved 10. Taking one was available, are given a second dose at day 10; have the disease by UPN02 only Khalaaakkawih 0 E. a second leak. Patients were evaluated to determine the toxicity and response Fsat repeated for 6 months on persons. Protocol has been approved by the song and Drug Administration Alocetkah, the Commission Alastthalo recombinant DNA and the Council of Institutional review of the mandate at the University of Q 0 · Rum Agavea first Z Aksrbak 1 P today the small study. 1 to B: Summary Alaklhzeki were Er 0 Z Affhat Jboukh in Figure 10 and Tqotarb completed at almost 0 '/ b then .ikhm. The patient UPNOI first second trip of the cells B, 'IL in; a 55' S; Ad Nenni Q! Eradautamtllaed 6 to 1-211 I & lt; request treatment of the cells Easyway 1 Aspz, the lack of one of Sgahat, Tfajm glands, Tfajm spleen. And Ror'ray  Edvy A; p Ad, to treat. K_an 1 for the treatment of , for more than one cent is fairly Durres Z Qoz-o 'War Skulovoomad -80- 34813Β1-B for Nmhoen Whipple' Srib bewitching CART19 little response. Then the patient received one cycle of chemotherapy as a treatment Bhandamustan depleted lymphatic cells NL NRP 19-CART. It was diagnosed Almrd 02 UPN primarily by CLL in 68 Ezd 0 of 0 to Hdam land with Zadeh Eld white blood cells and fatigue. Nkant case of illness raging forgotten specified 4 Sd't Eadsl 0 of Ash RIP increase 5 1st 1 Te commandment (195000 Micro righteousness), anemia and thrombocytopenia , which requires treatment, and showed Almt analysis 0 Easyway that the cells U CLL solution 0 P 17Ρ / and Molcom 0 - disease Cdera been treating the disease Olommomab using a partial response, but within one and a half years we have suffered from the land of Tdrd disease. Lund returned the land of lion 13:00 Olmmomab Dz 18 weeks the response of the coca abundant free 1 Study progressive. Then Asthbl 1 tumor Durres Bdamotv Z 0 p 10 Mmap without AST ^ Bhkivoh (Akkl 5a ). 0 I land as upper & lt ;, Bdamostin and'hdd b chemotherapy will run out lymphatic Shell 'Lord cells 19-cart - was presented UPN03 disease at the age of 50 years Boer'd re-Plan First Z CLL OL 4 Zlat Mlahvlo P 0 of 6 s. Z 1 trauma leukocytosis progressive (Addkriaat white blood 92000 Macro g) and enlarged glands progressive Olney as requested treatment. Infants received two cycles of 15 Mab with Wlodaziban leading to normalization Eddr ^ t 1 km and PL CON; g r blood decomposition is complete in the swollen lymph. 1 trauma sink provided by a -rb Z 0 3 0 Ash Oram There Barr 1 1 o 1 Zoe Khala 0 0 J da love to clubfoot m chromosome 17 using fish which shows the clubfoot ΤΡ53 in 170 z 200 cells. Over the next gases requires the land of three lines Mokhtlgh z therapy (Olathe 0 10) leukocytosis progressive and enlarged glands, and had another 20 Isaiah 6 Zomab Basthobh bold six months before the leak CART19- cell received disease Pintostaten and ^^ Sgably Ely 0 Authority chemotherapy depleted lymphatic ago Tserbb cells 19-CART. -81- -81-ΜΑ 34813Β1 Anaaj just under then design Tgrh GeMCRIS 0607-793) CD19-BB-Z ) and Tkoanhakma been described, 17: 1453-1464 .Ther). Slow virus was produced according to current good practices Altsnaa using & lt; Aiqa triple the production of plasmid when Lentigen Corporation as described (Zufftrey et al., 1997, Nature
15: 871-875 biotechnol). Sir Ming Khamlih 19 CART has been built and methods for preparation of T-cell polystyrene beads using parallel magnetization using antibodies y CD3 and anti-CD28 mono and indigo (2013-2004: 102 Laportetal., 2003, Blood). It was performed -dg viral Bahlikma been described (17377-103: 17372 Levine et al., 2006, Proc Natl Acad Sci USA). Ue to hit the tumor and then download Ngder download CLL when Asaskma line is shown in Figure-10 0 0 Akhabk as upper Khalada Aoh in the bone marrow, blood, lymph tissue and secondary ^ Z was Odnyh. Yaasm; Viochkas Baalafov healthy, marrow 1 Zm Maha represents 5 percent are the total weight of 1 rein (31: 213.218 1960, Phys, 1976, Health Phys 1.Woodard et al). Be Bzkhaa d in samples iliac crest alerted increasingly Z 1 Obey demand (greasy) Ha 0 mouth Abe Atrajd z 20% of Zjala bone at the age of 5 to about 50 Z Qq old, Iha still traveling n 65 years, and then Ernf to 6 to 67 0 A 0 9 Over 75 marrow is inactive (, 1965, .Hartsocket al A33-6h 43: 3 Clin Path and Am). 0 0 uncle to Abzn w1 August 1 cup Sa Warren structure data Z (b \ a) and marrow active (greasy) Ikor at E 0.35 in 1170 and 2480 Bam Ham, -82- ΜΑ 34813Β1
Basic anat.mical and physiol.gical data for use in radi.logical protection: The Skeleton in) respectively
Annals of the ICRP, Vol, 25 (ed. Smith, H.) 58-68 (A report of a Task Group of Committee 2 of the Ko_v b-Aldkor 1 Bulgan one of those. (International Commission on Radiological Protection, Oxford, 1995)% Tarr 1 and h finding fault; they are among 35_65 Nkhoza represents 5.0% of the total weight 'of the body, and is composed of 06 of Basic anatomical and physiological data) (Z body marrow Ntt (red) and 3.4% marrow active (greasy
for use in radiological protection: The Skeleton in Annals of the TCRP, Vol. 25 (ed. Smith, H.) 58.68 (A report of a Task Group of Committee 2 of the International Commission on Radiological Protection, Oxford (1995). Based on the biopsy bone marrow aspirate samples, was the referee weight of CLL cells to three disease
Up and line as one Skma shown in Table A-Temtem lost this topic families 0 n I find one I CLL Is Comprehensive marrow to the total number of cells in the marrow CLL using one LMO = 0 of 2 of the cell, was presented one of the numbers Almatj 0 H in Akkl 10; and Qtend this Ctabat on Avrad that CLL its distribution unified in the bone marrow. For the patient UPN01, it was RIP calculations Khozi marrow 1 Lenny obtained Tell a ^ c chemical Bhandamustan, and perfusion, which was obtained after Bdamospen Wendell Drdb CART19. Taku numbers 0 Ashe accuracy Ldh day -1 compared Bkhozah sample today because of restrictions -14 15 1 J z perfusion Day -1. The patient provides 02 UPN to address a start Baabh b mono describes Assad's one full of marrow by CLL. Be Kdz 1 disease consciousness Ddon Tvier in one annexation Heq d CARTI9 been Ahtab carrying a patient 03 marrow UPN based on the post-S Alkmena humiliation Khaza'a CART19 Aljdula; Gross Klhalikhaa (kg) because Alfajaa inactivated Den Alfajaa Algsht - ΜΑ 34813Β1 -83- (ye 0 a) (kg) 3.65 2.48 1.17 Nkur natural (ICRP benchmark) 3.65 - 0-18 3.47 UPN01 day -14 (95% disgrace) 3.65 Q 1 b 0.18 3.47 UPN02 day -47 (95% mobile) 3.65 c 4a 19,2 UPN03 day-a (60% mobile) weight CLL (Kji 2.43 UPN01 day -14 (70% CLL) 1.73 UPN01 day -1 (50% CLL by clot) 3.29 47- toss UPN 02 (CLL% 95 & lt;) 0.88 03 UPN day -1 ( 40% CLL) 1 blood: just-it was a; Ad 02 UPN 0 Aaab Bh 0 for cll /; y 1 for tumor Ozdem NL gone; 0 b CART19! afternoon 1 for the flow of empty! P Azla.a has 0 pattern 0 Mald, my Nmzenja & lt; a d 0 E 0 Te kappa restricted CD5 + CD10- CD19 + CD20 (asphalt) + CD23 (z) Bh 0 light of a 0 to a cell of 015Μ-Β 0 & lt; Ga 35% of CLL cells Taiz is Mczk for CD38. it is not clear download CLL with a sessions Q shelters Alkemiana Bgdamostin evident at the time of leaks CART19. at the time the leak -84- ΜΑ 34813Β1 carT19, the number of blood CLL cells is 550 000 curlers righteousness cell. & lt ;, land of one blood Q 0 5 fled; be patient 02 UPN-cell CLL abolished 2.75 10 X & quot; in the blood in the small S · Zzmr Sieih 1 'for comprehensive in the WBC; the UPN Ad 01 and 03 UPN' not the father of Bam 6 Dodr to those in the land of the disease, which lead to miscalculation Tgev the crowds carrying the body. A Ozj 0 of secondary lymph: was determined the size of lymphadenopathy and splenomegaly operations on true CT Olney pivotal made using software approved by the FDA. Be released to sizes 5 to belly Wa 0 basin only. Vyas was blocs Lean Fiqrta Τ1 to the level of the femoral artery Wasp 1 Kirk in all the land; and in some of them, Attml nodes in the groin area EVA. The contract was excluded in Arras / Aekl frameworks 1 P Z and excluded from the analysis based on the number of target CLL cell line, which leads Oayalyray_rissuahmlaljm 10. The land of 01 UPN and 03 UPN not go to hybridize 1 for the entire subsequent 6 months, Obaltala Adam formula & lt was; ADAs line 1 to Hhm - a sense of one 3 months) Nagdid extent download tumor Z Alomas line; the disease was 02 UPN with the disease stable inflation glands, thus Yum estimate Aasktlh tumor line Bahlrah Ham spleen Return, p. 1 fled one of identical male equ (a 10-of -97 c: 75 Radiol for Harris et al-, 2010, Eur) 'the Wall · L Ozs Arrm 15 1 for a comprehensive exception, da CLL Bastkhadd 13:00 Nhj' density (1 LMO / Zkthavh; and 1 Ekhalaa = 10 d) one of the cells or Nhj Hhm (CLL cells are 10 Hkro Z g or 600 Hkro ml, Bair'd 1 to form one of the spheroid), and then Erdkl'gaym in 1 form 10-RIP Adam Arrm been the father of lymph secondary in patients three below in table 2, Z is a sense of 4 SC's ~ CT Adahh 0 Total volume the size of spleen size LN countries 2: the sizes of the tumor (3 3 3 day Pedal land (mm) (mm) (mm) -85- ΜΑ 34813Β1 1868835 1619180 239655 37 - UPN01 1363580 1258575 105005 one month 1,241,685 1,176,625 650 603 months 1282790 1166800 115990 24- UPN02 1052715 940960 111755 one month 674985 435825 239160 10- UPN03 482725 371200 111525 one month 347 105 299 860 472 453 months was performed CT scan at baseline patient 01 UPN for 8 days after two of Pttostaten / cyclo Vosgamed / Rakimap, he said lack of response so Alfezam therapeutic chemotherapy compared to CT scans before. Provides the patient and one for the League of Bhandamussen before 19 CART, and therefore, the Altvier in Hhm tumor from day-to-day -37 +1 3 for the patient 01 UPN can not rule out the possibility of 5 Bhandamustan contribution in addition to the 19 CART. Similarly, the one to change the H 0 H 1%) of the tumor's UPN03 reflects Almchehrk effect of cycle 1 of Bntastatina cyclo Fu 0 Sgamed ^ CART- way to assess the effectiveness of Linga T IE in health 0 a 1 neighborhood in the bitter 0 Ne then one Anab ratio of T: E Z CART cells 1 Crosh to Edd cells 1 endodontic Wakulla Adam Ouald Allaaa section 1 located at the injection CART cells and the number of cells CART Anhvonh (Carpenitoet 10 106: 3360-3365 al-, 2009, Proc Natl Acad Sci U s A). To Ogr'd current Alakhmh, Blood Adam Edd p CART19 + except 0 da T 1 Hakozhkma shown in Figure 10 to Ozh t r a 0 but the Z 0 hands of one of the number 1 to Mtalv the exception of 0 da CART19 1 T August 0 balances in the additional della Mir or Bakhdid 0 RIP August 7 v 1 code Z -usa CART19 in one blood and strong bone 1 to Figure 2 and Figure 6 However -86- 34813Β1 it did tireless possible to live determine CART19 to other sites, such as 0 father lymph T1 relatives, creating a case of non-Iqinkberh for the total number of cells CARTI9 any in one of the body additional at that time to reduce the degree of Alo 0 maximum Rum. Amthaddam been Anhobh values of Ga 0 3 well to Asagafy b T: E effective. 1 Table 3: Sep T: e's CART19 Mahsoh Almhakgh in lime Ε: Τ in the body of sample cells + CART19 Almrgosh sales Alo and AD (baseline 5 Dltaatm broadband Total Altafr in Hal CLL basis Alakdm / Altahada l ^ L basis of blood baseline line bone marrow 2200: 1 09 + Ε1.13 12 + Ε2.51 11 + Ε8.1 Feb Available 12.Ε1.70 UPN01 1000: 1 08 + Ε5.80 11 + Ε2.74 12.Ε1.6 11.Ε2. 75 12 + Ε3 20 UPN02 93.000: 1 07 + Ε1.42 12 + Ε1.32 11.Ε4.4 Z Available 11 + E8SO UPN03 93000-1000 scale 1 = method of medium density, size 2 = Amottagab no 'to a patient in the marrow UPN02 1 Aglm affection 1 Nkgad Jul in 0 huge F-0 d (ε3.1 + a 1 cell) Fichtl tumor measured by CT in the spleen and one of the lymph nodes. Lanes 1 to form 5 E response in the blood 0.10 processing and freezing Alaevh samples were grouped (blood ends, the bone) at the top of lavender (K2EDTA ); or Ashe pipes & quot; & lt; YAG behind the top (Bdone added) (Becton Dickinson) and transported to TCSL x 0 Lal Sapf Z Avhab 0 Abheai 1 Aivat during the 30-minute Q receipt, according to the founding of SOP s. and & quot; marginalized except 0 da exhorted 1 T. Adoaz wallets Terminal and spinal across Ficoll Balalb Almkza include density using GE Health) Ficoll-Paque 15 17-1440.03, care) and freeze in the GIBCO 1 1875-135) RPMl) Ha Alaikao using 4 (/ Rs Mar human (120-800, Gemini Bio-Products), for ; Alheita a 2% (49-7248-Novaplus, NDC0409); -87- -87-ΜΑ 34813Β1 and 10% Sigma, D2650) DMSO) using Cryo 5100 in 10 containers Tjma 0, Dr. 24-72 hours at - 80 ° C, the cells were transferred to nitrogen Awadl St & lt ;, term geese. It was Alhhol samples apheresis through H.spita) of the University of Pennsylvania Blood
Bank and processed in CVPFj by Tngah Ficoll gradual and Tbdi Z 1 ho Award Oelah 0 5 was instant viability after thawing is greater than 85% at the discretion of 0 and 0 my love p 1 vilified LS 'Bam leaving samples Ttakther for 1.5-2 hours Drjmh room temperature; o S expulsion of 0 to Xie, the use of 100 Micro Her once-frozen based at -80 ° 0 Ioah Mlalat cell was Alhaol on CDJ9, CML) negative Κ562-) Q RAT 0 CFB (m Mekp243-a) y 10 a generous gift of Carmine Carpenito, K.562CD19; if Κ562 b Bhhos Ddi E 0 d 00 to 0 a repeat of the expression of the molecule 9, NALM-6, CD19 a CD- Hojb non-for, Z-AA 8c are but only a cell Cancer 23: 174-180) b and Hurwitz et al., 1979, Tnt) ; Takid additional Z - wa CD Portal generous gift of Laurence Cooper. 1 strains were Hgz the termination 0 LAH in Wa MI 1640) RIO ^ 11875, (Gibco) updated 10% 0 n 0 Hljeenbda (Hycione), Wa% Qibco ') Pen-Strep 15 15140-122). Was' to get one of the cells of mono Auriga 1 of 1 Atrljh ND365) Q 0 r regulations Alasitl apheresis of Human Immunology Core at the University of Bulganaa, and Amaaljbha and Gathering; Dhakma Z
Q DNA Lucille Q-PÇR then collect one blood one for the entire or one of Zkhaa in smarter 6b vacutainer Ouaili Alkhozas (BD (K3EDTA (Becton Dickinson). The Azd 1 acid Adwoa 1 for Pocket 0 cercus 0 n Mother 1 for the entire Bastkhadd 13:00 1 instruments 20 'blood' for the medium S0? J (QIAGEN) QIAamp DNA - Mzvzh, and replace-number one Li Boish 0 bass spectrum photosynthesis, and stored at -80 ° C. was an analysis of Q-PCR on DNA 1 samples for Jenny Fichtl using 123-200 ng of genomic DNA / point in time, technology ABI Taqman for screening for health restless CD 19 CAR integrated impressionable. were awarded a pass / energies Almtver failure, including & gt; standard ramp curve and values are 2-1, and the ability to determine the reference sample accurately 5 (1000 copies a spike plasmid) and without amplification in 0 Ozh 0 Sahhih Dbnh DNA Z Turn 1 Sat rehabilitation and i ^ t accept 0 Dh Seve. The pre-trial proceedings / investigations revolved CD 19 CAR has also been described (1464-17: 1453 Milone et al., 2009, Mol Ther). Kt 0 d Edd Afaj / unit DNA has been drawing the curve of the 8 record points consists of 10-5 copies Moss slow plasmid Ab to 100 nano-grams of sample DNA is Menbgh. was evaluated every Zhth one in the same (one bit; 0 record Vhaby 0.10 reference samples) in triplicate with Mtot F 0 de 0 August values infants 1 01 was 1 Zj B with 0 bits n ed t o 0 Al Ayijit in a 3/3 Bkl't 0 p CV% recite Z 46-0% 'door to the patient 02 7ΡΝ, Basca j s .177 (3/20 Kyat Aiaabeh, and Ardlaa% CV)' then fbi sale uncle ed thousand b r j i Aiaa of 0 to 3/3 Takeraat 4% CV p p o 0.72%. Babh disease 03 UPN, Ba 0 willing, I 10 S (3-2 Meh; Ijayh,? · & Lt ;; 5/15 CV) and Abz 30 days (3/2 -kr, data Oiaih, 0.67% CV), was Azj r s Tail Ed tread 00 of Aijayh in 3/3 -lt with CV% less than 56% Z termination. Been confirmed against Alodd Ashidar a 1 g 0 (b 0 AA) Vssattafboukh "Uh Hemam; 0.0 H 2 Madhueram Skkhalan 8); Sbermtavad 0 E 0 Haa (Oidesvdi any A.ekn Thadicanut) Tthripa. Then R Vo've burden b Darla Syed 6 20 DNA then bb 1 to use 12-20 v PS DNA 'blood 0 RealAge Pia not 0 o loyalty CKD 0 for Abyei p serum bad 0 n Wayne GENEBANK: Ζ85996) CDIA) (a 0 edge over 1 Mamda: -89- 34813Β1 GAAAGCTGACTGTATTTG ; sequence identity modulate 25, primer meaning counter: -r sequence identity number, 26, probe: Vic- CTC CCCAGT CTC TTT; sequence identity No. 0.27), and Mnhak than 8 points record configured to relieve DNA 0 Eeba Mgarv, WSJ interactions amplification factor correction (CF) (g undiscovered Nano / Nano gm input) 0.5 (f) copies of a variation micrograms DNA according to the equation: copies Olney calculated from 19 Nahbi CD R / DNA entry (mg) 1000 X CF X Nano Jam. Been identified accuracy this one Alakha Z through the ability to identify the signs of the product cell Olney Triet by Q-PCR according to the formula: Average signs = copies detection En / input DNA 6.3 X DNA Dammam DNA a companion physical Phones CF X versus positive modulation by flow cytometry using 10 detectors to determine CAR - certain. It took her this five selections Anahgoubh 22.68% distinction for a product Rrb 01 UPN (22; 6% POV 1 for the flow of one of the cell), 32.33% distinction for a product close to 02 23) UPN% Bo'th confirmed 0 s Hivite), and 4.3% distinction Ltj Tripp% 4.7) UPN03 occasion by flow cytometry). Analyses Alsakin been Aamade Rulers Spend factors cellular soluble using Tefih bead LUMINEX 15 matrix and crews Sarat from Invitrogen) Life techn.logies). Brighten been AAC six thieves, according Derwoonol August spyware dam 13:00 curve record of 8 points and then configured Bassadam 3-fold dilution series. The J & lt; r ST Zqt 0 ^ t sample and replicated in a dilution of 1: 3; Kaguet CV calculated% duplicate measurements below 0 n 5 a 0%, then the August data on 200 Bioplex and analyzed using Bioplex program 5.0 Manager version Bassadam decline to Ucesna of 5 variables analyzed. Been identified Mnhak ranges 20 1 fled Mae Bua range of 80-120% (observed / expected values) - The amount ranges Tgel independent analytical Smomat in shape. 90- 90-ΜΑ 34813Β1
Cellular experiment to detect and Glegh CAR then evaluated to determine the cells Alozigh after melting and stay overnight in TCM Z & lt; Coordination Mas Inal. CD107 degranulation in response to the targeted cells. It was performed graininess Arlh experiments using X 1 PBMC 5 10 C and 0.25 0 X less than the size of target cells developmental 500 microseconds. G in rested Nat 48 appointed for two hours at 37 ° C in the presence of Bect.n Dickinson) CD49d); m counter for CD28, Monincen (eBiosciences) CD107a-FITCj (e-Bioscience) is Aasay was Wave (281: 6578 Immunol Methods for , 2003, .Betts et al). Jem detectors hypothalamus 10 objects were following anti used for these Aldlasat: MDA-CAR, body Advantaged for 19 CD CAR Murine Mgahon b Alexa647 is a prolific output of Drs. Bipulendu Jena and Laurence Cooper (MD Anderson Cancer Center). For the experiments immune phenotype and Ozigah multiple variables: for Anti CD3-A700, anti-y CD8-PE-Cy7, a counter for PD-1-FITC anti for CD25-AF488, an anti's. Anti for CD57-eF450, anti for CD27-APC-eF780, a counter for CD 17-APC-eF780, 15 NL y CD107a-FITC, CD45RA-eF605NC (all Q e-Bioscience), number of CD4-PE-Texas Red and HLA 89 Li7e / Dead (from Life Technologies) and anti-CD's 14-V500, NL g CD 16-V500 (z Becton Dickinson). For virtual pattern immune: CDI6-FITC, CD14-PE-Cy7, CD14-APC, CD3-PE, CD20-PE, CD19-PE-Cy7, CD16PE-Cy7, all Q .Becton Dickinson -91- -91-ΜΑ 34813Β1 Mq 0 S cellular multivariate flow was jT a \ cells by cell either a new flow meter after treatment Ficoll-Paque or, if Mgamalh, after Alasagrar all night Andkthavh 2 10 X. cell of ml in the center of TCM cells) T) c (15 νο ; L.nza, 04-418Q) χ07) complemented with 5% of human AB serum (512-100, 1, (GemCall% Gibco, 35050-) Glutatnax% 1, (Gibco, 15140-122) Pen-Strep% 1 , (Gibco, 15630-080) Hepes 061); and 0.2% N- acetylcysteine Cetin (03-7610-American Regent, NDC0517). It was conducted profiling 0 virtual Tea multivariate on 4 10 X e Total cells / case, using strains FMO as 0 what has been described in the text. Been suspended Andkthavh 1 10 cells X cells / 100 micro liter PBS 10 at 30 rather on Aklh Baihaddam body unusually recommended Bha by Almsty, kj \ A \, and re-suspended in 0.5% paraformaldehyde and Alhaol by using LSRJI modified (BD Immunocytometry Systems) equipped 0 of using Adzr Blue (488 Zodhu Mar), - (405 Z over), families (532 nm), and red (633 nm), and groups as an appropriate candidate for Clear separation of combinations bridles above the counter. Then get a nest of a minimum of 100,000 cell + CD3 1 every 15 strain 0 functional Kharb, was washing the cells, and suspended for coders surface, and re-suspended in 0.5% paraformaldehyde and Mall Alihakkma already; been compiled minimum situations 50000 + CD3 each stained condition. Compensation has been achieved Assadam strains r values Anti single beads compensation Becton Dickins.n) BD) and Amaaja and applied automatically Boath stomach. And then analyze the data using 8.8.4 Versi.n program, Treestar) Flowto software). Door Kehl 1 for the past one of the Zara one's mouth 20, you lose access to the cells Bamthaddam 8-cell counter cc 06 uri p Dzr Blue (488) and red (633 nano Mho), was achieved values compensation using an antibody mono -0 strains, - -0, -ΜΑ 34813Β1 and Kharenat compensation Becton Dickinson) BD) was Ahcaia manually. The data were analyzed using the 1.0 version software analysis, 264.9 group, cc cytometers) C-Flow). Patient before medical Altoark and Assapah for treatment and then offer treatment summaries Rirh in bereavement 10. Then diagnosis UPN01 first Bmrha-H 1 5 B cell of CLL at the age of 55 have been identified the patient's symptoms and Mlahfelth for 1-2 / 1 year almost even require treatment for the large number of Allimgoyat progressive, and thrombocytopenia, enlarged glands, enlarged Alalhal. After 4 cycles of Algludalaban completed application blood disease Addkriaat a complete response to the tests CT. Progress has been observed during the five months using a multitude of symptoms Allimgoyat, thrombocytopenia, increased inflation glands. Note has Almrs asymptomatic for 3 Swat intrinsically tied to 0.10 and the latter requires treatment using Rthaamap and Wlodaraben to increase I "d ^ Elk White Hat-out, anemia, lack of Alhfaihat. It has treat the disease using four instruments of the monoclonal antibody with Wlodrbin with Hussein in the partial blood Addkriaat. Have the disease also offer during one stretch, which requires treatment Manl by increasing white blood Addkriaat (150000 WBC Micro Lear) and thrombocytopenia (platelets 30,000 Micro 1 g) and a Maolgesh-M 6 Alu Zomab 15 with the application of blood Addkriaat. Progress has been observed during the 13 months. S-accept a; Z DDD Zq one factor Retcsmap Bdone remarkable response is followed by a re-burden Sik 1 and Hosgamed, Hankeratin, and Brydenamon (R.CVP) for Dortn the lowest responsive and u to Maledumad 0 then shut Allenaledumad because Sam. Infants received two cycles of Ptosta & quot; yen, Scull Voshammed and Rakaaamap Ha lowest Astahabh. -93 -93ΜΑ 34813Β1 Then, Sibr, a patient boy 0 and 0 Tisyna d P (j NL 4 L six 0 horror Bh 9, CART. But treatment, Cat WBC -dg 142,000 Ekro your responsibilities 6 Tus 4 • 1 Ema Dr. Lear, the number of Alhgahat 78000 ..klo righteousness ALCi -ba 8000 your responsibilities P Ads p CT deploy Tfajm, glands and taper marrow mother Z was fitting and As.a 7 & gt; CLL e% Q Aazla-a) · 5 sepulcher Amartihish 1.6 0 X a 7 z except-a, 1-cart / p 3 AA 10. Lee except da-19 CART also been Tkadiri No, 0 Ta FACS). There is no 0-bit b. 1 mg Land 0 Mab ^ Aslat Mia 10a 0 or extended Bdalu 0 Tan and 6! William extend soils Bh: CART19, and Dara 10 L after soaking first CART19, the patient showed fever 'z Anyone 0 bear I O. in Z | Locke, explained examination! Radioactive CTJ X Z 1 for diuretic Alab Adnoa a Easyway '0' Aag 0.1 mbar Algadh 0 Card | sense of Oseznzia'o ^ Eyyh Iike Aihhla- rather the patient without injury or Oaad birch Ory- achieved one patient one quick response 9 Z 6:00 in one of the bereaved 5.dhao 6 Ochehrbad 1 crepe does not rotate except .da CLL 1 Lee was one to detect I 0 of the shirring Z & lt; Coordination 1 inauguration cellular 0 Â Ia one bone in the 1, 3 and 6 months Badthrip exception-a 19-CART 1 shows PHP the 0 seen lM 1 Foy 15 Mnqubl 1 Tzql flow 1 test 1 to a cell. And 1 to Okhah 1 Study at 1 and 3 months Baal 0 1 Fripp Erd M1 Rkamila ZZ b r S 0 was the patient's blood cells fixed eggs (1000 WBC '3900 Micro R) and pause 1 Sghat (pages ~ 100; 000 your responsibilities layer), and 0 Atdl sticky Ja 0 Ajlopoulv one blood (Mgch 525 mg / Dbebr , Woods 650-2000 Ihama Secker d 0), and in order without any complications contagious. 20 has with one abyss patient 02 UPN using cells 19 CART at the age of 77. -kon d date with Sz from a disease of 0 Threyan 1 to Taji was diagnosed first Bassadam CLL in 2000 counted the age of 68 -94- ΜΑ 34813Β1 when the patient is prone to fatigue and increase Addkrat white blood 0 was a; Ad jLj Z for 4 snook at Taiwir Amartihi to Zkzdh number of pellets Aqe gradual (195000 your responsibilities v), the resolution of one blood to stop one of the Sgahat 1 Lenny -ttab Adlaj 'recommended one to Tell SV Z time that one of the cells U CLL clubfoot Nkeromozom 017ρ because the land Akkdma, n ~ αΐ land Bamthaddam 5 cycle 12 Osus of Alommomab 0 p 1 response & lt; him and Finn in Aiadat blood 0 d r and a half 0 suffered! patient from Zbzdh number one for Kiryat Alpma Akqdbh 4 Azar 1 blood 'Z 1 Misuse' and inflation Alalhal 0 confirmed the analysis of one of looking down on one of Dhuoa 0 children per 1 Samorom 17Ρ now with the solution 0 P Arzum 39 a. It has seen one encourages one to disease Bagkhadd 13:00 Alu 0 0 Tozo August for a period of 18 to 2 with Abua to increase white blood Eddayat and install anemia and an enlarged spleen. A damaged; Ad increase Edd 1 thieves Aqe 10-out, anemia, and thrombocytopenia during ί and'hdh. A- 1 Vljh & lt ;, dos Bidamostin Z 0 p Rmmap leading to / z Thayer p 0 0 Y without Vensk is a Mod 0 h in the form of 1 to 5 a. The patient Bhandamustan Mzgrdakaalajkebena i Dnoa del received T. 0 Mudb except 0 da -CART 19, 1 to accept Amartihish 4.3 0 X a 6 & lt; a 19 cart / LMO (4.1 0 X a 5 total Khala-A) 15 3 separate Tcheraat coupler Boath fever Ma 0 marginalized High House 102 Drt P 0 of 24 termination 0 in the one-day 11 after 1 Kthreyb 1 for the first, Amtqubl one patient to strengthen from 4.1 0 X of 8 (4.3 10 X 0 LMO) cells CART19 ^ this Altserinb complicated by fever, Y Members Odv in 1 Tgra without shortage Alokshh Olney require treatment Palmdt 24 x 1 cent. P Htk not any evidence of ischemia z r B. & gt; The symptoms resolved. On the day 15 after the first infusion 19-CART and 4 days after Dhah Tri 0 to 20 cell CART19 may know the disease to the hospital with fevers saliva (up to 04 E 0.0 'Veriat) E chills and strength, extensive testing with blood and urine cultures CXR failed to locate 0-95 - 34813Β1 thunderously. Ladki land Sillagafiaksolknys Adloas Awá 'J 0 t Fshaharadav.ehragafi 20 /, Land Brydena peered Wen-1. 0 of Clio Ram · fjjL Sue 0.3 Bhmlcleo 0 Rammhald; Nov 4 o · Odyama Ne Z Rah for Asat and Wade; Boss in Aq. Dariabertm 0 Amaspecasesfais vain 06 Havkl 5A. & Lt ;, forced Mannan Ardka 5 blood Lipa 0 Yarillad 8 (Mlmil 9 Bin 0:00 of 0 systems Azart Tech up cm 0 Q CLL u 0 t a b 0 d Adloj RTM Alankhalad Aagulwa | my blood Ati, Avhert Aloiah Asph and reduce Dzna p Sekhemkhet S Wim Alhlhal, Dh months after Tripp b, CARTI & lt; Q then Ftah Lavaux-data s 'after the pledged Fill the 0 of Alhgnkazo land Aa'z s / h (a Bobt (165,000 tire was) 0 E traveling Sosh recognize blood Oih mispronounce h _sm s Z !. Lal land without Atmad did not have further treatment . have been diagnosed with 'patient UPN03 Bastkhadd 13:00 & quot; a; a suit I August Z CLL Edes 5 u Zlat 0 observed for 6 Sdhu 1 T. at a time is not 0 right, my 9 I 1 Zad y increase El 0 d 1 St Ate literature (1 blood 1 white 0 count 92000 Micro der) WPM Alzdd AAC 0 by 1 Lenny - Adlaj 0 Z patient Dunin Z Rbimstmap Ha against one Hban I led to obey the numbers of blood will a large shower is not Halkamil to Tfajm glands, Pman patient Ngraa for 3 years for Adam a, followed by Lal or 6 months following r by increasing Edd leukocytes rapidly progressive (165000 WBC Hkro g) and inflation progressive glands Olney require treatment. disease received one cycle of Wlodas and 3 of Dodi Rbembab with Vadudar; between normalization with blood count and a resolution of inflation clearly glands. was -96- -96-μλ & lt;? α? Ik Ba 0 to Riic feet at 20 month free -ha right to the land of Z /; see 0 GDM father; Edd a category 0 and 0 Tfajm Q Sraz. In this; Allzt, was Aravy Z name 4 t Thlaq da 0 Ahaa and! Zlhr y externa cells Lavaux 1 z 0 E DVI Ι7Ρ Roux 0 Somme h Laden Del Z Z in ΤΡ53 in 200/170 Azla.da. Means MATH generating; Y Q Ub 0 p a 6:00 Z 4 floor 1 T. Sabdamr, Tinvqt (reason responded sector 0 for an ace F-d t-b) 'k, n the land of one of the normalization of one of the initial of one of the charges Allmulknby 0 Htseadsadolavsesjeriimaziadhedd leukocytes progressive and enlarged glands. Tmmhelalaolasudh hands; and ^ Ddsrs «Ela.ddvil Alarbamaalmkmapldh 11 heads; for the Father; Alababaa 'Douat fitting for nostalgic and not Pei Halokamila 0 Afajm Alfd- land of saliva / z blood I Sd 0 x 10 for the 6 Oihr Study. In colored Y, Z Land Ezs's 0 Hello Senb Z 0 lest Elajkb 0 Leahy depleted lymphatic NL Pei Khalhh CART19 · After Tlao days from 1 to treat Ay'h u NL Aa'yv Z 4 Zm & lt; i no (60%) j 40% with a 0 n before CLL · b Alteod Alai in rr Is Mkuzot | blood 0 n 1 Rs Sen] m age in the annual 3 (Iminol and, 2005, .Boityhadi et al d SDP », AA 0 a; dam 0 # S per (1,42 0 X of 7 total CARTIP 0 cells) z p. 3 blood · not 0 Be Tk its shell. after four 0 Thayer U 0 a first-cock, he began geobiont Balahac Z; E DDS 0 ml p 102 stave off escape 'Yasin Aloevae, #NAME and doubtful happen norm. No Aiar land any of Aad type or Zbh . after day 22 after Kamib, it was -hs (Op p Arrm Lalai Z Yalla I 0 Hah, and Hamadadhec, and begin to BP kidney loss. Tmadnl land -97- -97-μα 34813Β1 Addash treated 0 p revive Allowail War 1 Soricaz with Alkha wide income Euric of- Y is a writing tablet, Tbm series Mfl.a CXR, blood 'urine, Aaaz and 0 for came {for LE 01 a negative or Ouadah · x 0 during one month of Ajaouat leaking 19-CART; Tkhalmrakan / Ad 0 n Tdodr CLL p blood 5 expanded Mazm Tarif .kkl, '.nloa to flow, cellular Akol, Oad p FISH Daloi Spa decomposition Tfajm Ge Yep glands (bereavement 5 d) Wei outgrow my Adrd E 0 d s z sniff Tripp cell CART19 first. At 0 m describe the results of Alachtbalat now. PRO 6 l 'for clinical 10 were unapproved' disease one of three 1 for those who Saqon of CLL z Slaj 1 Levy b eBay trial in accordance with a shot in one of the bereaved 1. has Aaaljhkovh land Hsbako d & lt; i of systems 1 to treat one Saaia and 1 Biolouha Tbakalma is shown in one of the form 10 if Ki 1 yen z 1 CLL disease impoverishes to ρ53, and the abolition of predicting B1 Fjabh weak Zlalaj Adde SPA Aora (851580-1589, Dohner et al ,, 1995, Blood). It was a'hd p; maximum of 15 J Obe alarm after 1 to treat pronation Yafei preparatory 0 0 1 Mmaivlk leaked to Zkhaa 1 Dt (40 BC to 9 huh) and Clal 1 for holding F-1; Khakan Almrihny 02 UPN 9 I z frequent Khala-A Alllao'a S Alkha 'was prepared except, da CART19 T Tabie I was filmed in one of the form of August is a statement of Hasil trotting and determine Khhais 1 Dtj Ikl a patient in one of Table 4, was Vsdkaz 1 Lyd Z t 0 bit CART19 T b 1-4 days Baaalaj 1 for chemical Pas-Nggaz picturesque Filao & quot; b name Adam -98-ΜΑ 34813Β1 timetable for leaking cells dose divided because Althrbh tested CAR, which includes Ntafy send a signal Chaiti Mchehrk g 4-ΙΒΒ Tabielmaatm depicted in Figure 1a. Table 4: outputs apheresis and Maeiber launch Menth CART19 UPN 03 UPN 02 UPN01 characterization experiment Akj Fml .konat blood ./.2.67 ./.2.29 ./.4.46 is applied to measure the flow of cells for CD3 + for CD45 + CART19 .10 3 3.275 10 and χ2.55] 910x1.275 0 Aoajamali] 5 * -3-2 10 and 10 and the total number of cells Olney leaked 90.3 '(90.5) 95.3% 96,2% 70 = & lt; Vital ornament 98.9 98.8 ./.88.9% 80 = & lt; Cells + CD3 0/0 4 1 3.95 & lt; - 100 I fell down / 10x3 8 cells Bead remaining # & lt; 0.5 unit Hobah a ml & lt; 0.5 ECU a ml & lt; 0.5 unit Oolabah a ml & lt; = 3.5 ECU a ml Thmaan endogenous Sal Sal money Sall mycoplasma without Mamo without Mamo without growth without Mamo (Bactec) sterilization codifies growth without Mamo Don Mamo without growth farm innate & lt; 0.5 for Odhu Gramaml & lt; 0.5 nano-g / ml & lt; 0.5 Shaw Gramaml & lt; = 1 Micro Mo.l hope of a comprehensive BSA ELISA 0 2 2 Thamlo N RCL N Agheirosh slow -99- -99-ΜΑ 34813Β1 for Kachiy to detect capable Alachakh (RCL) 4./.4.74% 23% 22.6% 20 = & lt; The effectiveness of the transfer of excitement (calibration for scFv) 0.101 0.275 0.15 A 3-0.2 Nk a succession DNA vector cell (CART19PCR) 1 = 1 to Jrah # 0.2 2 = value Althrbh day 12 below the LOQ and decreasing what mal in Oded 1 Dgq with p plasmid DNA the generation of the carrier. Introduction to the FDA Kaadel my knowledge. 3 0 Almtaath version based on the spotted surface by FACS. 4 = Amchae granted treatment standard version by DSMC 1 and mare! The extension and continuation of CART19 in Cache neighborhood and passed to the bone marrow is believed that the CAR cells (T Olney been extended to 0 x bone using staples CD3 / CD28 and Akaabe Z Ztaa & gt; Aral Air 5 4-1ΒΒ fact included in the improvement eBay only 4 Fly to CARS Juha & quot; 4 for Bam Aera experience Q-PCR not-an oasis of (Ta Mai Azlaa 1 CARTI9 in 1 cm Oia L 'to a friendly one for Mrs. extension of the will of the Khalaa 0 CART19 Apr 1 km for 6 Chehrr Z persons I a name 0 stash in a otherwise, Ikal 2a and 2c. the nakedness Dszl 0, how Rs 1. UPN and 03 UPN t-d 1.000 to 10.000 I to Khalaa 1 CAR. T in the blood Oia Alihr first b 0 d bear 'and Deddalot Ace Q 0 T. AAC 0-Dade C start Aloaad d greater the trauma of 0 UPN & lt; Aledm 15) and a patient 03 UPN (Ibom 23). Elao 0 z 0 a *, must 0 initial Nhlal 0 DOCUMENTS 0 Ahyz 0 Alzjo 0 humanitarian partners / yen g | every one of the first, but I have just one T. a CART19T I b »land Althelaio 0 n Adam 90 Aq 180 after Aquemeb. Bdalal 0 loads 0 Wu CART19 T vu to I 4 1 im1 1.0- y to Dykoi a; Q 0 and Nczykan Run at Tees annals as much as 5 Zly 10 Ed j m i Ne AAC Tabgadtm-C 0 in Alohyl 2 Dd 2 and & lt; was 0 Rs him UPN oooh d if the Asoa 0 h Ed .'τ x about 35 Yale 0 a · i Adjobat Q 0 Ah DD; CART ί & gt; VirJ · U) fyi ξ ^ ό (UH j been Njassa bit of hope Mancav 1 disease and sleep interested in batch to determine shreds Abyan clothed 'oohhs .ri p Algiatel and Alkmat- other Abol now Lawan Z son I and reverence Double Z and Nigeh ^ CARTISJ Tiolotm-C 0 to 3. Z Z Tama-c Akahil experience, completed eleven Bnlabh-fold or more z r August August 1. However, b, Z in the deletion of 4 Sahz 0 (6-A 1, IL-8 'INF-γ and 0 not 1) E 5 Ketmhz 0 (.ΜΙΡ- Ι 'MCP-Ι' ΜΙΡ-ΐρ; CXCL9; .CXCLl) and Mtglat are Dhupav for IL-2R.J IL-IRa. Will bin this topic, was Aamadv -7 J »A cousin 0 Alokd Z August ops' Khum 0 Edd'as a Tt ace Zs to Riedel Eisin at 0 and 03 UPN BGA Bhorh shred pasts a-A, the father bugs and! Thd Mma 0 n AA, CARTl j 1 cm Cycle RIP 'Delm was 15 Joel Z | n Tgegh me! patient 2e the UPN, Rik 0 n deletion,; U! Adloj Li's, Lux 0 Ku & quot; Eaid 1 Turn! in this 1 1 RIP. b are | Ktthav Aria's second-IL aluminum for Azun in 0 Mldm Land 't Alrthompsoz 0 A | for Obb Almtz 0 of U NL Ala- to Chheu; n Khala.y CARI Γ Btazot! Ozl A, Iarh h 0 of -4 was | Yale | Boukgd for Atala 3A! b (2 -IL to Qe'rdz Bt'mat! Deli and calibration Mil. & quot ;.) CD28 1711455-1464. & quot; 2 ..,. Μ0ΐπι0 "! & Quot;»). Lund Likud theory, will in August equ Alaclovi Adamimy 20 p Apt A (Aq Z d F Yum suppression CAR cells + Τ by T cells Q (71: 2871-2881 2.11, Caaeer Res, & lt ;! «0 E Ei), a lest, a sprinkle with Bdaltal CARS Ashe -101- ΜΑ 34813Β1 -gxit Adeo Z 2-IL or Boath provide 2-IL & lt; E 0 for termination b 0 d August 'DVI Adbae' - ... | age in the current energy Srthamatnkhaaavamsh 0 ™ TripAdvisor provides s 0 No was filmed in 0 Ikl 3-d and 1 one who Tuaqkz 7 g 0 p -d 0 Hills 0 of 1 Nhlal toss full SPA. 5 1 j 3 / UU CARTj9 ί & gt; ù & gt; yj ύρ Yum ih a 'immediate questions' to treat one Daei of 0 Ionized which 0 stretch FH CAR AM 0 of Aeiakan. cell Waffen ranges stimulus 1 Kirk weigh p wells & lt; a T 1 SSH Ratha Louis 0 h Akoan Khalaa 1 T memory; CAR in patients. no 0 Okhh 1 Kzit least Altmd-d 1 Lda, otherwise 0 Tarar wa or 'Nobeir Almto 0:00 CARs's nest T cells after infusion (, 2006, .Kershaw et al 10, , Clin Oncol 24: e20-e22; Till et al and, 2006, .Clin Cancer Res 12: 6106-6115; Lamers et al
Clin Invest doi: 10.1172 / JCI46H0 and, 2011 ,, Savoldo et al; 2271- 2261, 112, 2008, Blood) - revealed Thio Kies'dash 1 cells lattes Mnkelmnald 0 A and'lkhaa in 1 day 169 Baal 0 convergence Z presence of cells any CAR19 appear in 03 UPN (figures 4a and 4b) E 0 m light of the existence of the exception-not Tqag was filmed in one of the bereaved 4a. Of 'the worthy salad, Z through b Q-PCR, Odkalo 15 satisfied Aclala their cells; CAR at 4 months and beyond, according to what has been filmed in formats 2 and 1 to form 6. The 0 to keep repeating Khalaoua .CAR in the organism by measuring the inauguration of cells in a manner close clouds Olney been Aldjaol from Tgerla PCR for gene through CART19. More importantly, in the 'patient 03 UPN, Ozarmt cells + CAR 19 CD3 only, Zzera because the cells + CAR19 not _kn undetectable in the sub-assemblies positive -CD16 or -CD14 course of what was filmed in rancor 4 (a) was 20 also revealed Altabir for CAR on the surface of 4.2 H / of T cells in the blood of 1 Yad 01 UPN in 1 day 71 after 1 Comerab according no one was filmed in one form 7. -102- -102-ΜΑ 34813Β1 after Zlka been Sdam harsh Tdd cells Pokerschool opinions der 1 data to flow Khdel 0 properties Aladhavaz to Kalpara 1 virtual 6 Zmt and function of the & lt; a CART19 in 03 UPN Padam Msam brain 0 Ed y tastiest 1 T-MDA-647) CAR) and Alatta-year Anha / quarters in 8 P. and 0.0 for the observed differences 0 for Mush in 'to express Mno.at Ak'klh Wasit in every r cells with 8 He c and + 04 € slow Z Akaabar p. 19 CAR 0 in Ibom 56, Sun Khalao + CART 19 CD8 in 1 Turn 1 for the first pattern of flow as one ball passed the neurotoxin (cm R7-CD27-CD28çX-) -d with Mud 0 along the uniforms RCA confirmed according to what has been portrayed in Figure 4 c 0 & lt ;, 1 to Gd 0 n Zllg 'Tcolt Khalaa 1 CD8 + sJL-CAR from the mixer of the sprayer the 0-cell maximum of the Ak'krh Almaclehl Houakattabran cubic 7 not in a FRP of Alkhala_k and ADC A1 Sieh the views fCD27 + / CD28 10 CD27 + / CD28 +. While it crossed each Z CART19 cell groups and CAR .. not to 0 largely CD57 z, was' to express Akirk manner rr i 1 Aljie 0 p 1.PD in CART19 E and reflection as possible of the history getaway him on the scope and pray for these cells «& lt ;, Walles z Mjmoi Khala 0 0 da the Elbe CARJ, lacked overall .CART19 group Ez thief CD8, CD25 each n 0 and 127 CD. In one day 169, Faihaandal 1 for i dorsal M 1 cells Father CAR Ielo 15 for a sample 'to Day 56 (not MGB CART19 0 waging K 6 J z b father y 1 t y 1 t attributes to mixer AAC 6 football seen, and'lagdir noteworthy R z 3 Lviv 7 E, ci 1 Vujat 1 Ouaili Z CD27 and 028 as well as cells + CAR Olney Cat Lab g rPD-Ι nor g 057 h-and-positive and 127 CD. biography + CD4, in the 0 Om 56 have been identified Khhals Khalaa 1 19 CART any were b, to point 20 'that hold and r DCP 7 h and Ovc 1 r & lt; 1 1- CD27 + 1CD28 + / PD + bad one Darkl 0 n + CD57 and Circus, and the lack of a 0 of 0 me for CD25 expression p CD127 tons d m financing 0 0 to form -103- 34813Β1 4 b 0 Z soft-Z so 0 Kazt negative cells y -CAR at this point in time is m 0 of the show cM cube 027 h, PD-lj R7, and 127 CD Aana then show it wa 6 Tklk E 0 Li Mjmoi CD25 + / basic CD127- (T cell regulatory Ananmlh). by day 169 'in Sa 0 light show Ur CD28 Ouaynhozmvy ^ FH cells + CAR + CD4' Jze evolution of exception + CART19 CD4 towards the pattern of Ahra y 1 soccer Lord extend tan 0 Ri 4 Baransm 0 k 0 7 Ae bear ¥ additional Z Khalaa 1 CD27-, and the emergence of a subset negative from 1-PD- (and achieving e ^ t 127 CD has Zk Khala 0 of Father y -CAR Htqh t about NL Ha Fly ' Ib in Orom 56 '0 and not one of Ankgad show 027 Gan Hmak y in August August 0 n Khalaa 1 CD25 + / CD127 housing! UJgy cart 19 Vite iàbü ύ Allsl August (6 · U t jUit Balakhalo; [0.0 to Asiral Alghe and Bakkar Z sufficient in Ihlen r' F t robbed Alabg 1b .CAR Τ p cells in any refresh you, i-land for humiliating a Aalaitham b in Alex 0 neighborhood. 6 The Joel Z Asli are Bh 19 CART the Father Oad t Sunday, z Bere 19 CAR T .lmarb 01 UPN and 03 granite 0 of the Ahao Dr. Repeat s 0 Guy Alfddh newcomer; and 19 CD in the 0 to Khalaa to Otakkh Z E 0 s blood August 1 Iozh. The Ed PBMC Z Land 03 UPN 0 p 1 Hlaya A'zthzvh 'Nenni AMAC 1 ft positive or less is not 0 for Har 19 CD & lt; Figure 4 d) was Aalouar and has a 0 to Rel of 0:00 Alqoal one threatened d 19 LED CART19T Balala August Aye fed the cells one by one for a meal and 19 Hmlkn P only for 19 CD 'P d been my response has shown one year CD I07a Ar.'ntah- o 0 for worthy Az'lathl F Nrd PM 0 light of CART19 Ely S'v positive d -19 iScD Hrt of only 0 Tbtan nomads Lalla-a 19-4 CAR mussels P d was 0 bad in 1 Ikl 8 to Azlhor 19 CAR Btah Velazy 1 O Repeat ace in Ahpe F 0 j pastor Alkhala.a flow. Not having shy stimulating Baleshr'k t E''tm 'Mbdha Hobolah'l 0 & quot; Li Lala -104- ΜΑ 34813Β1
Brentjensetal., 2007,) CD86 or CD80 NALM-6 does not appear because CART19 granulation cell strain was Zigh nervous sender and clear day 56 after infusion. (Clin Cancer Res 13: 5426-5435 were retained Tama point buildings in today's 169. As possible show Zigh nervous sender cells; CAR cells CAR-Τ by stimulus pharmacological 0.5 1 Ckshai Alakleniecl cells CART19 there was not any toxins Nat statistically significant noticeable during Hervé four days after the 1 crepe in any patient, Bouklavtvaalat fibrous passing. and 0 Azlk; 0 waging you have one FH land Baal 0 Zkasmaot clinical and laboratory between day 7 and 21 after the first 1 to leak. cJXSj this to T. short Alao and reversible. among one of the patients 1 Clath 1 Karen 0 right Arm'kan 1 Tven CRS wa PR I 10 for greater than 6 months after the leak CART19 & lt; tactful Q-der holiness ( , 2008, Halkk et al 1: 5446 1 1 Blood). was filmed Tagasl 0 piss what 9 d treatment S and'lablo of 0 treatment r a patient in one of the form 10. Pachthar, formed Ri Alrhi 1. UPN Ilaz 10 V 'cases j 0 No Aie Ddod I & lt; start z 10 after, b. SPA-T 9 led d; Oeads Maha's * Data did 15 # Lhe 0 BP 1 for 3 Lhs & lt; "No *, - 0.0 E 00 'Ae Aoelaa 0 |, [termination 0 to Alpmd« μ t., for the # worsened, Sala, ^ 010 Sdsalm '20 ΜΑ 34813Β1 -1.5- Ç.Ç treatment 1 for a patient 02 by using the UPN rounded one of the n Bhandamustan and Rachimab resulting in disease; 1 Tqo what has been described in Figure 5a. The patient canceled a third dose of Bhandamustan as Elajktm; loyalty Mtngz to lymph before leaking CART cell 19 T. formed by the patient 40 ji m fever spells, severe and Dhulot and dyspnea requiring Cthaz Balchgy for 24 hours a day 11 d like to Ip In today's second promotional dose of cell CART19. Fever and symptoms structural shifts continued in today's 15.1 Dhabi Land p r Lay Z; and & quot; to Ostkalo land after the start of treatment Bkorbakosroed in Orom 18. After 0 NRP 19 CART; and Bakza 0 n 0 p commencement Dhubat 1 meaty one of the high, - ^ in the land of urging r CLL AVI cells 0 Lashkar 53 Emn 1 km 1 Dti Tqa II described in A'lzql 5A and helplessness Dzna decline in inflation glands, bone Nhaa filtrate overly corridor for CLL showed after Allaj Bashir balances z z except Anhaad-da 1 1 km great Nhaiti. Under the land without land. Canceled 'for a patient 03 UPN Dosatn and Sklo * Lj M 0 d Kaalajka Yash Mtz 0 0 0 Okhalazo milk Gao Qr Tripp Khaya CART19. After Allaj Alkamiana 0 Thelaa A-M u NL trail cell, it was Nkha 0 p Alaglm overly 1 Phones (60%) Tgaria 40% 0 p 0 Sha; Z Q NL CLL '& quot; ever land of low .ri Z cells 19 5 10x1.5) CART -la- a T; CAR a p 0 dividing Z Edlath a 0 M) 'Mojaddoh, iib was not any poison 0 s Tsribah Sharp 0, 0 G, the b 0 d first employer for 14 days, S-MATH ^ t of Dhubat Tdidh; and fever, nausea and grace. By day 22 after the lizard 'it has been necessary to Akhhs dissolution 1 Dharm Z 0 Request Alasaz Palmttvy. Stalked geobiont to wade to land Ptioah, in Gdov month and one end of the Tsar 0 s CART19; t 0 RIP Ardd to the demise of aa € Q rotation one blood and marrow one bone to form, and egg-shell TDs cells 4 and 1 to inherit Arz Y FISH. It showed one of Ott -106- -106-ΜΑ 34813Β1 CT decomposition inflation abnormal glands according to what was described in Figures 5b and 5c. Mitigate the full disease has continued after 8 months from the initial infusion of cell CART19. Mrsilwa CART considerations in the organism to the proportion of CLL cell studies pre Alacletakih shown that it can dissolve large Odom, Oak 0 possible Z during the trail 5 2.2 7 10 X Y CARS 'to eliminate the tumor cell Ely 1 * 910 Q cells, b Ε: τ in a ^ t g u 42: 1 in the soft-n processing for human use (, 2009, .Caipenito et al 106: 3360-3365 Proc Natl Acad Sci u s a), despite the 0 n that this one of the Haat did not take into account the extension of the T cells after injection . & Quot it has been allowed; Dder Ebe CLL tumor 0 p time counts 1 Mkhgad 1 tumor ratios CART19 Ε: τ 'of the ability' to unfulfilled in one object seen in eg 0 cent Q Kadaf slow Z 10 CARt T cells' Lenny then & quot; Sriha. Then h 0 Lap Obe Rrm measured download LL ^ 0 in Alaglm, and one blood and one of Osjh 1 to 1 Thadhuah similar to F-1 priority. Sir Obe Rrm p 0 of ops Z is H 0 explained in Figure 10 to Wankel Rdkov 1 in the range of 1012 g & lt; a CLL (ie '1 nm z red Ahorm) Barr -serb .CARIl. K 1 n Wei a; Ad 03 UPN b 0 tumor j 0 of literature 0 indicates E. 10,8.8 AA Aoe & lt; not in the eBay of 0 Zam in Shum not (ie. Dr. S. Lamar Y 15 Nrbb CARTI9), Nih tumor Iao in; -1-H 0 for Etoile b 'Night of E.
cllI 1x5.5, Ze E 0 Atrigh Ihs VI Wei a 1:00 S 0.0 At 0 Dan UPN 03 is Nrab 10x1.4 Tyschl .CARTl! b 0 Aoimdam burden campus S 1 for an initial (1.3 10 2 0 'No, a CLL) 0; and n Elaa 1 CLL tightening Q 0 of & gt; I Tv 0 0 Z was any Thvq Study 1: 93,000 Ε: τ Menhalh. 20 Bhabaz 0 Mma'ah, then 0 August Neb Ε: Τ P 0 Alavi A! Kallen neighborhood b 2200: Adha 0 for: for RIP 01 UPN Ord 02 UPN Q'l 1 Eosevi a ^ dl 3) 'in' ^ 1 'led HPM eat -107- - 107-ΜΑ 34813Β1 series by CART19 T cells, with extended Baleshrak CART19 BASIS object in the neighborhood of 1,000 times greater than the likely effects of a strong anti-leukemia mediates. In 0 Hdoiha .CART19 Olney cells Jimrah receptors constitute Nal strong and the effects of anti-low 0 m LED 0 Z landslide I cells 5 injured but ^ show advanced Limia represents restrict & lt; Xie in CARs was Manifesting Anhdod in the organism and function of the nervous sender's Kershaw et al ,, 2006, Clin Cancer Res 12: 6106-) CARs Altjarmb Olney tested first generation of 6115; Lamers et al., 2006, for Clin Oncol 24: e20-e22; Till et al ,, 2008, Blood, 112, 2261 -. (2271; Park et al ,, 2007, Mol Ther 15: 825833; Pule et al., 2008, Nat Med 14: 1264-1270 which contains CARs Behold, based on pre-clinical Alnmang Olney demonstrate continuity Anhassanh g Milone et al., 2009, Mol ther. 17: 1453-1464; Carpenito et al.,) 4-ΙΒΒ unit to send a signal 2009), is designed Altharb to form the second generation, Proc Natl Acad Sci U s Α106: 3360-3365 processing engineering Alutah using Tknobia slow transmission of the virus. Show that the CARs of Levine et al., 2006, Proc Natl Acad) chronic HIV Ma in the configuration of the infection CARs second generation describes the current results that when he was Akhlhar this second generation. (Sci USA 103: 17372-17377 15 of Makra nickname T Astenbath was under Fflerov designed to enhance T-cell vaccination in the car cells Rapoport et al., 2005, Nat Med 11: 1230-1237; Bondanza et al., 2006, Blood 107: 1828-). After infusion compared to previous reports cAR T 1836) and has NOTE extension Anhassan cells Ε: Τ and tumor cells when devastating proportions, CD19 indefinite article cellular Anhddh for CART 19.¾1.) 1.:, 20 cells in one organism to Olney was not previously achieved. -108- ΜΑ 34813Β1 Iad first 19 CART CAR to Hamad experience Nitaf Send Aharha 1 HLA-4, the first use of a slow virus vector technology. The current results demonstrate the effective Altaata y CARs to the tumor positions 0.0 p facto configure & quot; lymphocyte cells in breach of the tumor and Olney showed identification 1 19 CD. Altmd 7 for the one allowed Sacrifice in the organism the first proof that the CARs extracted directly from patient 5 can Bozigh Almmerml nervous reserves in the organism for months. Agheran drama Mabakh that Ed ^ for the first CAR generation in a specific virus to the bewitching T be Mgdilo on the main T cells (Pule 14: 1264-1270 etal., 2008, Nat Med), and 0 GS, the Altaij Adtth second generation Z CARs to Done entered in the main T cells Aggzh Baleshrak optimally make this idea into Daal- without Anag 0 of the Althid any particular theory, raised Mlhovlh post-it notes that the clinical effects was 10 Emgah and Nir marketed dissolution burdens and throws Bhjmikloger 13:00 when all three patients and SAB that e ^ fitting for Tekhr to levels up from Ananml be so seriously Alcethnat of the jinn a Q; Doanh 0 Note did not sniff the strong influences of the traditional 0 Athan. And 0 GS, it has been designed Aldba L tendered to mitigate this potential Arabization deliberate cells CART19 over Wiczh g 0 applicat six days. The 15 yen to very low doses of CARs can Terre strong clinical responses. Luca 0 vv K tuber Tgeraah carrier safety CART19 design showed. Amant observation was that Jrouat of CART19 cells Nat several Tkadil T. amplitude lower than those tested in previous experiments YMCA 0. To have a clinical benefit can be significant CSM Ptdmaat to Mzd of Altngel. To Ala.j CAR & lt;) wider, and to design Altharb Olney tested CARs directed against targets Okhrtm 4 z 20 .CD19 -109 -109ΜΑ 34813Β1 Tech 1.1 current Khsat also noted that it is shown CART19 Vikelmen memory Ouen cells T 11? Calendar nervous, and this Ananml that contribute to their survival in the long term compared to the reports Alaqh 0 and without the desire to adhere to any particular theory, it could differentiate cells in Cache CART live in the memory for the next mission, when the confrontation and minimizing Almmtahedvh cells (for example,
5 CLL tumor cells or normal B cells) Olney reflects the generator against the alternative. In Alhakevh reported evidence to send a signal to 4-1ΒΒ Taiwir to enhance memory in the context of Armal signal Sabbagh et al.) 2007,) TCR 28: 333-339 Trends Immunol). Extended reproduction and survival of cells CART19 all aspects of live T. pharmacological Halal CART 1 t is not revenue that benefit them to occur before revealed. It was noted that Hayat firing mechanisms in the serum of 10 spinal Artbek Peña maximum levels for Halal 19 CART, so that it was possible that the decomposition begins when valid cellular targets Olney show 19 CD restricted. It can be associated with survival Adz 0 cells CART19 listing on BSE Almlchor Inga range 4-1ΒΒ or by sending a signal through the TCR Wa or natural CAR mechanism. It lies the possibility Mttrh interesting that the extended stay is linked to a range 19 CART Olney has been flagged in the bone samples, which Atno hypothesis that it can Anhafezh on CARS Wa CD by the confrontation with the Qa c progenitor cells in the bone marrow. Respect Mjna Almaal what drives to the initial extension of cells CARTI9 Alcaeads in the neighborhood? Ha Asinaat rare (, 2008, .Clin Invest d0i: 10.1172 / CI46110; Pule et al's, 2011, .Savoido et al 14: 1264-1270 Nat Med), the current study represents the only Althrbh to cancel leaks 2-IL, Laket eroding 0's either be extended CART19 cells Asttbabih causes of the disease or is likely to Mathat eat; Astahabh to Khalaa 1 CD19 has been shown on goals related to leukemia, or b cells wa b. In one of the case 1 to Ojerhe 20 This can be an attractive feature for through CARS directed against Ahad 1 P & lt ;, APCs Addh 0 such as 19 CD and CD20, as it Z is possible that self-renewal of Halal CART19 & lt happens ;, 1 during the regular, -110- ΜΑ 34813Β1 Z Lyon F 7 for 6 Ge CAR Bois 0 Plan & quot; Aqahhan a a & lt; to that point Adslo Lalai & quot; And to 'August Sea ^ Rum folding Ay long 0. Not that b machines 'Lab 0 a Eae Drla see p Apt Azla 0.0 a (Dakharh O1-to Alai lattes 0 Rrarih. YAG Az 0 Sunday,' that 0 bone Aboua p. Characteristics Aslaj b CAR Srrh Rh Z Allaj fathers, water deletion, Ann R & lt can; a 5-CARS Dadroladilklsafarsrrdd »Zim E 0 Li long term. cJ 0 to Ahglh effects of the strong Alamada 1: 1 of the Rhlan blood Ki ^ no land 10 three, including AVN Z
A 1 x Alzs .tod of 0.0 because the blood of turning a blind p 3; ρ · Lund continued with Akaat least to Adam CARS .subh in 0 ml to that point / s Akadh Q-m z of 0 Laage to 0:00 D'z'd Aaila'a the first 'With the deletion, OU launch éJ termination / p Blaazak 0 6 categories dissolution Erdem in the land of the age of folding the Lugg 0 d, (Degn and'lve 0 Ras; tuck a darker 5 6 Z Z Edhd CAR
In, Aa.sarviak 9 S., Lie; Li; n., CART Hotefa-Aazirat del Tdhlhorm. Nor -stbad 1 current Taih role of treatment Alka 0 Ouavi in promoting CARS effects can _aftlb only 0 t Mgarzh 0 Thamlh for less, login Akhoir and procedures Y cord with & quot; Ijmn Durr 1 Sat 1 for ongoing in over 1 Clenching another Ahr'z understanding 0 or not the SS 7 for z
And Zigh sustained cells CAR T in the neighborhood 0 Boukhala object; for, Allajat antibody, are cells T 0 Ddlh b CAR bad one Ikh in Ahish 'b and d ed give birth S 1 Z led August 1 to Tbadia Study NH b Hd a 0 or not 0 H'dd less Lalai 30 one-term z Sah, R. E folks, lion 13:00 lest (a z d I 0 August 'at the ed Sjabssc; Hem Aiylahln 4 for 0 Cla.dhzieadsj 20 -111- ΜΑ 34813Β1 Almahloul mm counter (in this one for the case of births 6 ZZ persons Zdy 3 0 n 3 0 Rdoua u even today) b scFv anti g CD19 has been shown Z & lt; not T b trail sole 0 cells 9 CARTl number of Elms 1 O operation, including Almlalh save 0 in Akklhh 0.1 for example 2: Khalaa T, the modified Bmiqubl 0 born \ of ϋι? A4 of & gt; 's of ÙÜ9 Odom 5 chronic designed Maql slow Fetrosh Sgbl RCA cheek p shows feature limit-d j 9 Ahe Mall 0 St b, Mqlama b CD137 (which del motivational Mfalk in cells Hhe -4] T) and ranges Armal exciting g x 003 (Mhoil Created calibration each generator against the T cell ). It has been observed that the low dose (what expresses Z 1.5 5 10 X b to Klekhm of antibody weight) of Khalaiaa modified future generator 10 eating 0 (autologous anti Berri kept by the MATH 0 Whitney S. Ruff blood W Fu-de Zs opportunities Z 1 for the treatment of ( CLL) has been extended to a larger 0 n Sly level of initial name in the Cache quarter 1000 weakness. It was noted that one patient has shown & quot; Sha Mtakhrozlaz 0 Name of the dissolution of Ben and wallets to Orme-dispersed .ltr S.tlazemh dissolution of the tumor, the toxic effect 4/3 Z class Alokhrca Alouhd Almh Eqlaiaa - antigen Dgari is the lack of lymphocytes. Blender treatment was continued and Ray 15 6 Yat saliva for a period of at least 6 months in the blood and bone marrow and continued to show Mtabl generator stressed Lean 2 Z. Then Z Astahabh specific immune in the bone marrow, accompanied by a loss of normal B Khalaa Khalaa Srt 1 1 1 n Blood CD19 me z. ^ The Scone Stmro tumor for 10 months after treatment-Qka 0 lack of gamma globulin blood Sam T. Reyes effect 0 0 E now Description MATERIALS AND METHODS Almtkhaddmh in that one Ktrb. 20 -112-
-112-Μ1,? Α? I Waco 1 d and roads Eger 1 categories study was the heart of the deer they see m self-extinguishing activity (793-0607 GeMCRIS), which has been subjected to safety testing must Akkki, according to the one I mentioned b ^ (64-1453: 17, Milone et al., 2009, Μ.Ι ther). The Tmkz 0 you WMV wineskin Tjder τ Ψ b 0 of Overdrive (31-107: 1325, Porter et al) 2006, Bl05d). Sleep slaves quantitative reaction to God's 1 poly 0 Jeremiah analysis (PCR) did not disclose Khalaiaaa Bam 0 0 0 born less Ka Rey in the blood and Y Bam 'challenge was 0 hands 1 minimum limit d Aaqueme 0 of 0 Zhv May; Odi; 6 i wheat without the father-d z yolk Albasi most important (ie, it can be one to tell him, but not for the harsh Qaal Ahme) report. 1 minimum winding d 0 0 25 Nkh are each 0 0 Krojam Z DNA Algit acid 0 j. Were slaves as upper p & lt; & gt; Lal does not & quot; and Batmhaddam serum 0 0 0 NCAA's fought marrow 1 ^, who was fired in Ojae.chaouih to use the singular was stored at -80 m. Was part Akhdid Elk 0 J to Awa.l 1. Soluble Bashaddam system technology beadwork Ilinex rad as 1 lisp (Life Technologies) - the separation of blood components has been # 1 Brighten Pray 0 0 blood Komat and 12-15 read in Mills apheresis. Was obtained 5 mono cells Alo's one of the 0 blood Atjehli (PBMC) Koled CART-19 T cell when I am the slave. O b Way Hamel Mkuzot 1 hematopoietic blood Jordan, was 50 9 10 X gathered at least from the blood cells to create cells 19-CART's 0 was also obtained Arkat white blood valued at up and saved Bakiprid · Stenotypist cells chemotherapy began Alkemiavi treatment before infusion of about 5 Jul 10 to 0 as possible Aaze Khalana 19-1 cart-20 2 days counting the completion of chemotherapy. Alkmaia the timing of the start of treatment for this August along the z regimen adopted. The purpose of the chemotherapy in urging the lack of a one-Khala Foe Q -113- -113-ΜΑ 34813Β1 fulfilled Walt 0 0 Tbabi Dade except for Khalaa 1, 1-Jk -CART Akhiao treatment Ayve Q burden of a tumor; z. WPM 1 righteousness and! Ezoualalaj Asaviantzlvllaghaslgeleb'olomas · Dbhld needles S 0 c 0 Selehi Z Land health Ki trauma to Mlait equ 'DD beacon (Hut Mahma 12 days 00 3 no 0 m) and Baker 0 for i 0 B (300 mm / m 2 a day 3 X pain) the Ashe Z j 5 Lalai. , b that Hmak: mourned p; Batdam this topic factors in T. 00 Mlas Wallace Ace 'Oik the 0 DD 0 n a (disparaging the 0 Lap weapon to Ato! a for Adam E.,; for I o FDA 0 Ed is not in Zq CE, DHAP, EPOCH, HyperCVADiCHOP! or other therapeutic Zm 0 assess the re-staging amerism been Eger 1 E termination 4 de assess Mrana limited when Alabe Q 1 for the treatment of Alkemiah 5 provide Ebe tumor j 10 ob. Ohz 1 includes Thuar, and examination of physical and'at lowest Dr. Z of 0 RIP (. MR) 'r a; Doanh Dr. Winnie to test before infusion: The examination Abdna; and & quot; z events will no operations 0 1 Sep blood wage E 1 1 Study of blood, and one for chemistry and Akhcar pregnancy (Az'kav Mtabao) 0
Prepare CART-19 T-cell treatment has 0 Khala.da CART-19 T Resume Abtha 0 Laurie 'Lad 1 LL mulch rather & lt; Dah outside one of the cells (SCFV) 15 -hm select for cells 19 CD. 0 as upper to Z scFv registered a ^ O -dob b Lala Mat 1 for calibration August 1 cells 1 Ne show 19 CD, which Dztm, E b in opposition in one of the indicated & lt ;, Shh except & quot; August and B cells normal. B 1 Aiai to CD 19 scFv, Nmuel Yum cells signal to show the molecule Aral raise intracellular familiar Z any, .1 ... 21; TCR or ERS range of 0 to raise Tandem's composed of 4-1ΒΒ and Ouhd't Aral calibration; TCR · betrays Achgavy scFv Q from a single anti August Z Lahr, automated Includes & lt ;, 6 Apt lar, be Ztaqat Aral 20 fully human reference sequences Z original. Yum made J ^ CART-19 T-except for a T cell component of blood cells, and the use of technology Nash slow viruses (-577: 17, Dropulic et al., 2006, Human Gene Therapy -114- -114-ΜΑ 34813Β1 8463-71: 72, Virol and, 1998 "88; Naldini et à, 1996, Science, 272: 263-7; Dull et al) for an entry £ -4 cFv: TCR?
1ΒΒ the exception, da CD4 and CD8 T. in some; Doanh, Z insert TCRÇ: μ scF7 ^ 'p cells in the part as 0 Chula affirm 5 0 gathered to Oafouh. And Tkone this | Dglat '0 Klh'a in any; i 0 born Hidd til 0 of six 0 Dah t' MHC and Bakali, can Askhadd 13:00 Ptih 0 Scl and 1 unit for the treatment of ¥ Z Land p tumors 0 up generator 0 Aq 9; He has been & quot; Queen 0 At CAR in Meh Pfdama been made 1 to less than 1 degree p 1 Akkkh in 4 Lentigen âl0n, c5rp0. Yum Sa & lt; da, 1-CART j i; 75 Cell and Ahoua 0; Fit 0 pronation & quot; e; Fill the "e 0 Fill the E & quot; for AAA, E, a Bjam 0 of countries: AP Spun August; in Azhkl 11. Dr. Phil Zlao Ed '-m the cells 0
Ah Dah in and i p insulting. WPM termination 0 loyalty Me 1 Brigade R S T ace was b Fouad -CART 0, e .i p 2.5 10 X 0 p 5 10 X 0 oblivious Hlaya, your 0 Z DDS and Dr. E 6 J CKD KPI {h, (Bhd cm & lt ;, Adeh) z AL 'framework I y Ihda Z Aadal Z Akoj 1 S j S 0% (ppm): 31.25 Hpt- ,, 31.25 I (5. /.), 0.45 0Ν5α right 7.50 1.00, DMSO Dkrah 40, 5.00 Opus 0 ml 0 wealthy 0 E & quot; u & quot; 0 9 10 X & lt; 's \ T a h Viclk 1 Z. Blood Lke Lido 0 0 0 n is not 1, E & lt; Blood sector Adeo & lt ;, Blomlee b Ne days 0.1 and 2.0 p -10% z S in the Name of 0.30% in the additional 1 'and 60% in additional 2. Storage was Izinaloa 0 No (i 10 GS 1000's) to the nudity Z Maastm out by b 0 for 0 Aadevi NL Iike uncle in 0 r cent Sgm in Duge agency -135 'em. The Takns'kas August and Eaua me. Thawed cell M 0 F -smd aa in the population, -Your Aabouk 0 a. Yum p Alkhala.la m 0 No in my dry to Ά 0 Shiny Zd m Amad the cells SJU Merckx confirms t; Pat 0 long as r d Drt & lt ;; Z 36 m! Li 38 m Bam ΜΑ 34813Β1 d Alex gently 0 Live melt cells, love not to leave conglomerates Mamedh in the container. If included jpCART TAV bag cell product or its 0 Sriba or z q must 0 Ed 0 m Kmhaddamh in 1 Tripp Say therapy may Ngm one of the effects, the side .ltalah cell pellets T transient fever, and text ;, Wa or Algthian- -os that fi Aetae 5 must state a ^ c Osobnovin 650 mg by grief and Hadzimlorad Dassadlomi 25-50 mg Z 1 through a mine or in one of the vein, tell -serbb Khala-a 19-CART. HD 0 fi confirms 1 t this Alodlokl No, termination 1 t r need 0 can row 0 marched de 1 E is Abreu-de-m-hand to Lal ^ b if a 6 T. insisted 0 Z the land was 0 for any Bpovin 0 is not recommended Aetae A; Doanh / Ticosrwelat rather & lt ;, Hebrokorszewne Dedbzon, Dad 0 Zhyllon (Solu- Medroi) or Dickamaozon (Decadron) at any time E Aze in cases Alarla 1 Lee 10 Ckd Etara Z insisted 0 uh 0 no 5 of this year Ek 00 j z | cells for 0 as 0 K. Amsd 1 T. Ψ I of Re Fd Jarib, it is recommended Fh up Z Hdrhora-Wen 100 Z administration of Arabization Launching with a 0 n Hum p Eads extended the termination goods 0 ^ c Ay'a. In the first additional B 'land solid 30 CBC h Lierop k, t CD3, and Bhh and? He because the treatment d 13:00 A 4 & lt; Eads 0 Lars 15 the cells 0 Alfoao 0 Dodd analgesic me a; Ztd & lt ;; the J 0 counting F Adlo Aloouk in the for 0 g z Elaao 9 , .CART -kon bold lest 0 0 Alupl for this news for Dr. Auala 1 1 2 10 X's & lt; AAA in I_khas 0 o m d Aydl Ed Ea 0, b P 0.5. /. T r a (2316-26; 33, 1. 0.1., And, 1-2003, Eu. 00 »d0r0r. 1995, Nat M0d,,: 621-7; Μ ... 1Ι, R0). Am'ell Ede 0 Sammehv, Aalolam 0 (0 of 0 of 0), A & lt; 030 a 0) d 2 Lhh 0.0) 'Ivis Iab Kl father, by number of Tripp. Light of the pack to water 0 Alta.spa mAh Z; all -sab b-Q 10 15 20 -116- 34813Β1 Ih 020 Qalaqls mg 0 B blood Z Ashe μ Y ·; 18 de z I Us 0 for any Alai 0 BPA 0 to Modyodssodl j z; loomed, Wim Atae Adlaya 1 Li a ^ not in the Allard ;. J Alalan to Hlvy d o U; - 5 AA 0 termination 0 E Aicss;, m; Eaeads ,, Massa; ^ 1.omalamb »T. Ealat 0 A .... Overdrive Slaj s' Su 0 Pugh Haifa, l / o Ed Wadley, blood -dm Ahad 1 T. August No 0 d and Fez Ald μ, I, principles & lt; In Q 1 'z every 5; Dmahfou d 0 humanitarian partners termination and Ely F Loa sought burden, Yum Ed 0 and for t b r 0 Hhdid blood apolipoprotein August Aloola 0-7's, Aae every August and d' d Dbla. A; o g 8 P Sptse for treatment yesterday Alaig Avd for asset Akhlaa 0 0.1 0 R blacks Ne b r z r 0 Apt to that point. Q 0 for Alay August Ashe z Ee - Yat 1 De La T Z: 1) the sound: the need, Limin complementary to Hvan Rtoualer 95./. Or Z in Lennon Ace Ss t Aceh threatened to eat; 2) meet: Non Afezam Add in F not _memkn Akgm Ge Z. 3) low blood pressure and asks for support Rakh Daft. 4) infection Chilli: hearing a 1 km! Facet of Kraal fungi, or viruses in Gdone 48 hours of leaking T cell. -tm With Eha 15 asset for Butasmom uric acid Say the first & quot; recess FG 1 No against Agnn Hnkza Ts; b 0 D 'coefficient after Althrip annexation Abab and continue Ouadt cases per day 4 after or Tri-cell 19-CART to the love of blood to determine Mtoyat A-in serum, and CART-19 PCR ^ 6 d cells .19-CART Aapt cases Baal 0 Rohr 1 Sha to keep for a period of Theladh Osaba for Khaddn to the following: a serious examination, documenting Aekbh effects and love of blood for analysis 0.0 Chmiaoua and Amab 20 and continuing cells 19-CART and research laboratories. -117- ΜΑ 34813Β1 AC3 Ibb second
Without being bound by theory, it is believed in the possibility of Aetae 1 Jrah Ab'bh of cells 19-CART in today's 1 1 Mud, Thor 0 availability carrying Mnab have for the first dose and to make enough Alkhalalo 19-cart. P August are 2-5 X 10 9 Z Ajala Khala, a. Can Tjmah Butasom serum uric acid sample after Aguen 0 5 will hit second season of the components of the blood are performed apheresis d 2 Lalla in & lt; Clenching Z manats blood can be 0 to 1 for PBMC for research purposes Oz Bakhamid. Takg 1 GS cases 0 Z follows: Alghs Addny, documenting 0 to the effects of | passion insult, blood for love 0 Akpoua WAP and wells except-da 19-CART and laboratories S add 1 Li reminded, are Eger 1 E Aouadh 1 to assess Almrukhm 0 dog YMCA 0 T. provide measured 0 s burden tumor 0 -thdd News 10 ACOG 0 Bam | to progress diversify one disease Attmd fasting and Z 0 and 0 At MRD, Yhishalat p 0 of debris Wi-wa or biopsy lymph glands. Monthly Labbe Z 2 to 5 Svd Ted baskets U Alas p 0 Rey months 2 EQ 6 P Tmib sales CART-I9- s Leah (s Aclala 15 Hze, Tkhva cases U Z: medication Haas & lt; p r '0 Loa VideoGet, Afairso Las 0 B blood Ktl 0 . j, a lobby wa 0 Szr & lt; a 19-cart Duff 0 for Alp 0 j M. d bad DNA 7'la at p. 2-6 RDB "B1 Veh, 1-CART to A'ye d 6 d RCL p DD - be-Balhalatd) Dharhadisilinodad ' Iveht Allloas & lt; ¥ F I saw areas: medicine 0 t! us Nss grandfather, -oaa pain Y and Lap blood cells 0 'Joel' Dap a 0 Put Ola, a CARTI else 0 for Alia _am | came Q 1 H1V30 DNA in nay 0 3 and 6 s Lfir3 20 -118 - 118te1? I l1 Q 0 ,,. CART Achaouaee of Nabeul to monitor. Done Mali Dr. Alarb Tedj infant ~ A'las - Arhalh ICLL in 1996. The patient asked Oda treatment after 6 o 0; t of Ez 1 Z-Z) Ende number Cree 0 v 0 worsened and baskets SV 2002 & lt; Then ** € Land Ba 0 Tloam Duke Leah 0 BP Aadanh to Zlodaras; Hjen I Alag 0 0 fair Ed; t but Jq A.etlal newcomer to 0 in 2006, Teti triple strands instruments o t-b and Adaras to TAWD 0. Shya 1 0 p equal to promise the mother and recoil Aszew for aluminum newcomer & lt; Z d 0 equ 20 0 A μ time x, l y Evolution 'disease and Maine Z Yale Enrich Z S-in Vllaad Chehemamn 10 00 0 (2009 developed a soprano. Quickly Rada number one for Kiryat loyalty and ill newcomer Ashe was fulfilled J 4 Ü P-Lod Love Uah Adam CLL 'p S. Wallach Levi less every 3 Z wa Khalasiela Zfoukromusum 7 termination 0 showed a ^ t for a thousand Shi b in Alo 0 p ((fish LaSalle 170 bin 200 Khet t Equal p ΤΡ53 Erfer 15:00 7 termination. Y land 0 p D cycle and 0 units and three instruments! Yanta 0 n Hven DD 05 d 0 (why ESL Akha 0 j Land) & lt; Ahjen 0 No S-Z Ahyla Vicl 0 Aoqlaa Avoyo. then Nobak 1 Filal one of the glands' evolution Bois 00 Th'lthoir 'C (termination) b 0 d S-then g 0.1 to Khalaa T a Almzto Bois 0 Plan Vhlkriaat one blood' to Baaka Z Hkulat but the Hgzba Akaa 0 b. Z a; Ad after deletion of one SAP & lt; Mgad 20, CD52 P fi I 't against the surfaces elite) de 11 Osuo 0 with' Khmv Z Adam Die Lay Ladd S. 0:00 20 d, t towering Ü 0 Bbe Secret 1 trauma to the MATH 0 p couches 505 & lt; i (m 4 -119- 111 Hmla 1 bones and spread ill glands with 1 to 3 * m 0 Id lymph. in July 2010, was S; Ad in bayonet clinical phase 1 of T cells modified Bmstkabbay antigen Alkhemara. leaks cell ci melted T cells Mahh origin of the patient and Tenbifaa using slow Agheiromh to express 5 will accept the generator 1 antibody Alkhemara Anhdd for 19 CD (1 to form 12 a) b then Dsr defined 0 1 varicose Zll express slow Agheirosh and Almtoapt Nat related to one of the agenda 5. NL R1 of days 0 n Teach any, Tlh patient treatment Alkemiavi Adam Asgaz Avo.lo cells (Banursatnn light of 0 slugs 4 mg 2 each over the fun of Mahh the surface of the body and Vos; lamed a, the light 0 Sag 600 pp Mir 0 Ra) without Ratakbab (81-1575: 24, Clin Oncol for 0.2006 , .Lamanna et al). Three days Q 10 treatment Alkemiavi before and after Tripp cell, r was one of the bones in the Khala Dt 0 0 0 da p 1 Zvas to 40% Mia Bucca Khalaa 1 0 mystery of blood because CLL. Crossing for Kgeghkba CD19J series, CD5J, and 20 Q 0CD23j \ / S Achac atopic Saif 4 Zatm 40 a 0 may chromosome ρ17 and 1 Hda q; TP 53 (46, XY, del (17) (p 12) [S] / 46, XY, der (17 ) 1 (17:21) (q I0 14] 0) [5} / 46, ΧΥ a). After Hmsh a ^ m z 1 Khalaj Ayia 1 0 u Anrd nly 3 10:00 15 Khala, a Τ, and out by the piss 5%, with a total 7 10x1.42 cell and then Tenbifaa (10x1.46 E Dkdkjm) cell, and then one for washing into three T. 0 Ribat daily SAP 1 Dharad (10% in one day 1.30% on the day 2, and 60% on day 3). No Aehlae O.dh Sakit Baal 0 1 Ksrib- has not been observed any toxic effects Tsriat. Table 5: PM 0 remains Aswal 0 of the lower p pELPS CDl »BBz identity Lme succession Ataoah No. Nahel -babar Al pELPS-CDl9-BBZ (succession DNA) 1 Mtoualemh aligned to -120-ΜΑ 34813Β1 Expand 73 RSV's (succession DNA) two consecutive advocacy No. R 17 Amtkrr (succession DNA) three consecutive aligned to number 7517 for Amtakerr (succession DNA) four consecutive Biofilms No. Gag / Pol partial (succession nuclear Ahamvy) 5 consecutive Biofilms No. p) cPPT_g1; DNA) six consecutive Mmoah No. enhanced one? Holga (succession Ahamvy nuclear) six consecutive No. Biofilms t '. DNA) 8 consecutive aligned to Woodchuck PRE number (e sequence DNA) 9 succession air of No. R repeatedly (succession DNA) 10 consecutive aligned to No. 75 frequently (succession Ahamvy nuclear) 11 consecutive Biofilms No. Y'- acid Alomiq) 12 Mtwalh Mmoah No. 8 Leader Hh (DNA sequence) 13 Mtwalh Mmoah R. number. DNA) 14 Mtoualemh aligned to -121- -121-ΜΑ 34813Β1 Wareham 8 Hinge Hh (acid sequence Adwoa) 15 consecutive Biofilms No. 8 Hhebr membrane (DNA sequence) 16 consecutive stretched No. Hh1-4 (acid sequence Alnooaa) 17 consecutive Biofilms No. 16 ) CD3zeta ^ acid 1 to Aoa) 18 consecutive Mmoah No. 8 Leader Hh (succession acid exponent) 19 consecutive Biofilms RIP 16) Anti-CD 19scFv ^ acid exponent) 20 consecutive stretched No. 8 Hinge Hh (succession acid exponent) 21 consecutive Mmoah No. CD8 / membrane ( succession acid exponent) 22 consecutive Biofilms number: Hh1-4 (succession acid exponent) 23 consecutive Mmoah No. 16) CD3zeta ^ acid exponent) 24 consecutive Mmoah No. 1 Asyjaah eating 0 y 0 cauterizing and evaluations after 1 Rabaa ten days of the first leak, the start of the patient to feel a shiver will ' & quot; Ur E0 a iu) of milk 0 jolt 'for a second. To extend the 1.1 the following five 5 days Ma- and Aongaa Drbhh lane A; Ad to 39.2 m (02.5 a degree Fihri-Fa) 'War: IVIM 6 Id 6 thd 122- i Arsalaad.; Hadaszle 0 J 0 & lt's ;; & amp; And Ysadaob.tm-Ssqlarmhysamfayyadm 22 DAP and 12 distemper b). 6 Z Z Adharak 0 burden 6-0.1 r Does d & lt; 05 HTH 0.6 for 5:00 of 00 your responsibilities; a gu 0 Gul 4.7 Bjm 5 for Dspo (1:50 in 0 and for each No, 0 (Avdi ace 2.4 to 4.7 Dd [8 Uh; for Y5.arml ^]) introduction 6 Z to Oct 0 T. Dam, Saz 1130 Edh p y (Ay p, 98 to 192). for Onlkl, having Ahalo d; p 0.0 p only Cree 6 Pugh x 2.60 including p d 0 SSH (229.8 Mvelol (Killi (only j pitched for 0 & lt; 0. a 5 for d -sdr 1 4'88 Pro .od p. I). Dekel Amartihs but I was four Bs 0 or Alaloh Ouadstoysadz; for Yakyasfison 24 Yqoteads 6 Z Amesn in Ggon 3 Yum; Ohi a; Ad o'clock in additional behind '4 • m 6 Z to Aaouat gradually. and, all of the 0 E 1 for in Z House: all automated. .άμ Z in 1528 after the soils of August 1 CART19, | Ed benefits 0 for i ask Looney 1 km 23 'no m z for each z CLL in A'a bones (Akkl 2 production). Ayh August 6 Wei Ouada 15 Z 15 (d 46.ΧΥ), s 5 to 1 test 1 FISH not 0 August NL ΤΡ55 in the 198 Z 200 Z 0 Shs; Ohz; age of 1 to within 1 to Yeh in impressively Averlo thousands, z r Assad Aailli cm having CLL Z was 5 Escherichia p Kl is a 1 & gt;) B% 0 n s's 'vinegar CD5.CD1.-CD19.CD23. the cells gate Easyway 0) 0 h · additional termination Lalai name: must be analyzed in 22,031 after infusion purity of ill 0 F d (d 12 d). -123- ΜΑ 34813Β1 Dam 3 6 Azm z see Bh CART19, remained marginal Shs z M 'h L termination of Atd 0 for 0 and stressed Oaher survey CT 1 was the one who Araa d 0 3 0 g Adad reason S CART19 | Tarar Adma (bereavement 2nd Ed.) It showed rack 4 Laa mother at least one additional Ladd absence of Double Z CLL Boa 0 Plan refers Akkl & lt; P August nuclear (46'ΧΥ) 'Ed 5 4 Yale Bartend cellular PSC 1 1 Aqar 1 cr sa Β Alhbkzlk. Water S for 10 months on persons.
Ratio picturesque 19 RT, Carr 0 for 0 x 1 0 Hlaya At A- 0 categories-A 0 A severe. 'To raise Mackie Adte ;; (b' Guide 9 2 4) p Ilaz August 0 of fidget Alo (m D'ldrjh 3 Amoosolo 0 previously recognized · RNAi Land 0 n z Alao 0 A and Ia Assad Easyway 5 I y 0 of Ubah and shame newcomer milk 0 Gaoih g 'to the extent of 2 or 3 start 0 n s Sa z least 10 Cioo d Alag. Tm's 0 El I equ Chaos-y p equ ''; 0 p counting 0 strand of Khalaa 0 isoforms 140 Khel Q y Shell toss light of 'd. is 3 Ibom 22 ZZ' Lash 10 Z & lt ; spirit but Adlaq d Midh 1 o ^ z oo;. Ad shortages and 780 b r touched over the cube (class 2 or 3 fry s Almufolo) '^ Ni a g 15 1 Vhat one of the deadliest one for Aztqala of 1 ° 1 & lt; Ed August' 98.000 to 000. Miss over cubic) from 1 to 19 on the right one to throw 26'krjh 1 or 2 x 0 for fishhook, C timer "lattes 0.1090 to & gt; 1630 Z 0 6 u d) are additional 17 -d Orom of 3. .. .... Indicator 1 T. and land .lokhry Elynhoman 0 for treating August which one cell but Dr. Leah 0 Jul class 1 and 2 in the enzyme Abu Sawa 0 / Antaral and cream Vosga & quot; alkaline Lear 'in the development of B and Ή & quot; : 0 2 Z 1 b d first Tmrab and 1 bee black one-day 33, Iek Land 1 Study 1 Krt 1 and Z 20 -124- -124-ΜΑ 34813Β1 and Ash 0 prolific and lived, and muscle pain, headaches, and fatigue. Been corrected hypogammaglobulinemia Z Grade 2 using "Sribat globulin immunoprecipitation in Acherb0-transmitting serum and Shakaatzkhaa one of the bones accompanied Alassaph clinical patient increase late in AD 6 Yat Avetoknat Alakhabiyh 5 (1 for bereaved 3a Getty A! 3 Ed) for 0 p form Snuyat Anzvruzs Azzveron-Tma-Smat - CXCLIOj CXCL9, and Adhirkosh -6 Dreamcast high 160 times the initial cloud levels. Each 1-Z 1 for projects in intraday levels swords symptoms Alacletakh, Y M'ouh from 17 to Jul 23 after the first leak of cell CART19. 10 was one Nharl floating Z Rthanat Nkhoza bones Altzllah to Avinat showed evidence of AAC 0 scorch 1 Absorbent (1 for bereaved 13 s. The increases Mlhokhlh in Anrveruzmn, CXCL9J, Azoolakan -6, and acceptor Adhirlven -2 soluble, compared with the initial value on day 1 Las crepe trotting τ; Arthat values in Edom 23 after the first cM 0 Yep 0 to Jaih CART19. Taza 0 Zt Aazaa 0 six in Cons Nhaa bones 0 the disposal of blood Mrtan cells from the marrow Orthopedic 15 Ouammeltdzhrmfayalmsloviia'vam '1 Kusa and Pat has not changed acceptor antigen Alkhemara cells Τ repel real-time PCR DNA vacancy future generator Anti antibody Khaybari 19 CAR19) CD) must be in Orom 1 after the first leak (Fig. 14a). Mlahnlh has expanded to more p s 00 if wy object in one neighborhood by day 21 after the 'leak. At the top levels. 0 der Mahlaya CART 20 Wu in one blood more than 20% of lymphocytes in the blood circulation; coincided Mhoiat Tip these with 0 Hdolt for symptoms of structuralism, exostotic decomposition of the tumor (Figure 12 bear), and elevations in paints 125- ΜΑ 34813Β1 1 between serum (Fig. 3a Z AAC & quot ;. 0 Bz_m, 0 ,. f w 0.0 «a m. ', Desertification Ed Wyatt Figure 3). CART19 cells yielded monitoring in the forcing of decreasing values by a factor 10
<img img-format="tif" img-content="drawing" file="MA-34813-B1D01271.tif" id="idf0004" />
5 Shqubl generator UaJl * 4 Ka Ri T cells not- L
<img img-format="tif" img-content="drawing" file="MA-34813-B1D01272.tif" id="idf0005" />
<img img-format="tif" img-content="drawing" file="MA-34813-B1D01273.tif" id="idf0006" />
Tkhadd supports 0 o n squadron in August aye been Ebhab August 3 0 d Shahuls but additional 7 T. Ge Movhh). No 0 blood repel B cells b after Adloj 1 Akkl Hagee Aleylaa 1 CART19 Resume Almgsho and Aslhor 1 O D 1 to Talmb 1 of the current phase of the other crisis decomposition of the tumor and full response three weeks after the treatment a-M T cells Resume modified Almnmto genetically Ahadav 19 CD Z through A solid Ba-M -ger Agheirosh slow anti CD19 for bands associated with the Aral exciting CD137J CD3-zeta (Jajal 4) 0 existed genetically modified cells and high levels in the bone marrow for a period of 6 months to 1 to less after Altmrab. It turned out to generate immune Alamtahabh own cells 19 CD in the bone marrow by 1 to launch intraday evidence and eradicate leukemia, which coincides 0 p penetration Nroh cells ml antigen Alkhemara cells T. is not transmitting the evolution of the decomposition of the tumor syndrome after treatment 20 -126- -126-ΜΑ 34813Β1
Baeksgaard et al., 2003, Cancer Chemother Pharacol, 51: 187-5) immune cell in advance. (92 autologous antibody to target specific tumor generators is Z T genotype Alskm in cells Sadelain et al., 2009, Curr Opin Immunol, 21: 215.) Alamehratejaat impurity cancer y 23). Significant pain : So migration described in the application Jena et al., 2010, Blood , 116: 1035-44 5 z identify the goals of the tumor in a manner T current is enabling the future of antigen Alkhemara cells so that they can build a & quot; receptor - antigen Alkhemara without storing & quot; Of Awam, HLA Gther constrained by and have a range of Oasah range of Alonjh attributes. The Amthaddam expression Agheirosh tankers in the treatment Alrtan, and & lt; is an approach that has characterized b 0 biting advantages over slow HIV - derived. (June et al., 2009 , Nat Rev Immunol, 9: 704-16) 10 using the term Agheirosh feedback Kath Astahabat tankers Resume tumor, and did not, T in Altharm b for the future of the former antigen Alkhemara cells Kershaw et al ,, 2006, Clin Cancer Res, 12:) multiplication of the modified cells in Cache neighborhood continue. (6106-15; Till et al. , 2008, Blood , 112: 2261-71; Pule et al ,, 2008, Nat Med, 14: 1264-70 and his colleagues the preliminary results of the clinical experience of the target antigen receptor dragged Brentjens and found Astha, data CD28 tumor Almrbth range Armal exciting CD19 chimerism Alatahedvh 15 y; and 0 p Zlat, (Brentjens et al., 2010 , Mol Ther, 18: 666-8 advanced) CLL transition in the two disappeared receptor antigen chimerism quickly from one Korh bloody 0 is excruciating to August Das has been sent to the mystery; guardian stage Ezh 1 1 Stahabh T Alankhvavy of the future of the antigen Alkhemara cell anti-tumor and Adhhh clinically. each T already 20, K - 1 v 1 to Jrah Almrbh from 05/01/10 w accept antigen Alkhemara cells modified T LMO several more times Ashe Q doses costumed in the previous Aldarat cells -127.
Kershaw et al ") in August Odi T p 0 d food-Barre or 0 for any Φ seven Falt 2006, Clin Cancer Res, 12: 6106-15; Brentjens et al., 2010, Mol Ther, 18: 666-8; Morgan 2010, .1 ...), without F, M5lTher, 18: 843-51; J0h | ne, 5i.020 50d. 114: 535-46 Khayh state theory & lt; G | Goza that Addloj not d 0 chat Z 0 and K less my mother and marrow mother in the land p Meh Loa CART19 o 'o b Fla.da 4, Q eating Anne Akels 0 n' Nklaya August 5 Lalai 0 stretch in Hddlo- ΙΒΒ 1 Ara JL.,; m not the blood of U 0 easy Hven Alth 0 for Seche Sass let 0's, but s Aadil CART 19 o up Addd ace Z Fv BBC Weber against Adam, I barely CART 19 1 rejection of the cells one I sprayed Rsdaa in mg 0 of CD19 Vry 0 of August the & lt; An.vizlabelaaszn 1 m FA 0 Ri -Ur bitter and without r Ba-Ye Zhleral specific, PO darker Z 0 fled 0 paralyze Z Alozl & lt; a Z AG 6 Yeh Okhgh Boisla thousands of cells 8 first snitch start in the T to Akhla.a in only 6 Declaration Baev for Hubble and 6 d father Eddh fled re- · fu, attend j P T 0 d 0 d tumor merry 0 CD 19 Z Artem p that, T & quot; Zs'a Tz 0 H 0 Alfd Labrie | a Wasp 0 but Loew 0 0 Ta Seve Z Atr'r 0 vinegar 0 o B 5 (Ahaar 0 Phil Z Khala-a in Arai B and 0, which Zd -to 0 i Qahdote & lt ; Comair resulted in Ed T 1 CKD any 0 Ri Azla.a 0 n nay Oia mother I 6 days z persons d any 'no B in Alarb 0 six Adla.a Dalla D'rd tumors Ed 8' and Taku 5 Z Land a 7 night UU, WjU BP is me ' (M.'2.08 ' ";, Al Rev Med, z-range Z 0 for scam (50-237: 9; b 20 for Khaya RIP 1 Sen B1 Tedam not 9 Web promises breathtaking 0 Vidiad ue S' did not -128- -128-ΜΑ 34813Β1 anti-T cell sacrifice then Amakozt this topic one to occur in a sober; ZZ Taatmr have cells
Aash in the neighborhood. B to H 0 stillness machines b d treatments ΤΡ53 with clubfoot CLL exposed patients who have had one crepe Kaha 1 Aghulam Hdo. (Doluier et al., 1995, Blood, 85; 1580-9) standard
Gribben et al.,) Advanced CLL 5 1 for 1 for the sole Khvez cases 1 to Skov & lt; glance 1 to prolong his Ady 2011) '0 p deletion 0 Wilt; dew August 1 fell, Biol Blood Marrow Transplant, 17; Suppl: S63-S70 -almatj-versus-Tatar tumor large proportion of the order 1 z because Artaga, GS Taker'r 1 distress Almzs-Tel CLL any lichen Mmttiya b - L disease breadwinner, and 1 one who 0 have been as severe in 1 Ghalib A; Doanh one of the largest
Gribben et al & quot; 2011, Biol Blood Marrow Transplant, 17: Suppl: S63-S70; Sorror et a!.,) Rates T 2008). 1 to indicate Bamat provided in Wadley 1 to request that the cells, Blood, 111; 446-5210 autologous .orathia can overcome this limitation raises Forever 1 Yeh delayed syndrome decomposition of the tumor and the secretion Alsaq 1 n 1 to Akusa one of the Shatt al medicine 0 of Rla in the object one neighborhood and Alzhat 1 emerged as one FD fled 0 because the blood & lt; To Za'v T antibody to Haimari cell shower 1 Kjarb Mosola in S. Wadley Baldu- .CART19 the transponder key and nailed cells D'tah termination 1 Study Lori 'I 15 Ouay Vaelah this 1 1 to treat and provide support for Conscious 0 of Amom 0 him to the cells and 1 other goals) Henslhgz Del 0 born less Ashe 1 sprayer) CD19 for Astahed 1 P Bztaqqat Ir 0 the active signal. Ashe Z 1 Klaj which 0 Dst heh R newcomer nest 0 0 marked by one of the modified Rada potency of 0.1 to Akakh in Alcaeln R 'has 0 T Mstakec MOQ 1 antibody 1 Khemara the exception-of CLL is only 0 evil Toh 1 ml to continuously control the tumor. Z n 0 1, because a; Doanh Massapf b 0 colostrum for this Waddle. Dunn both 0 No 1 SAT-tumor 0 CART 19 CART 19 20 advanced also leaks Olam p. 05 C.I9 less; b T Turn 1 Study 1 cells Φ included this one for Aktthavat -129- ΜΑ 34813Β1 ^ each patent Atiraa, and a patent application, and Manoucr deniable in the current demand then merge one to detect Kahy d t; '& quot; p
<img img-format="tif" img-content="drawing" file="MA-34813-B1D01311.tif" id="idf0007" />
. Was detected from the other 1 GS current with reference to the private Nmang, it is clear that in the glory. Faihmaatm Zj r c p p 1 1 worker know my brother and Awar calibration him by experienced in Atjal without going out on Balamkanossabzj'lod 5.0 c Zhlaqumajal Walles' - elements Almrih protection Mufsod them Altgbr Alnmang Almtkorq da collection and Alsoralga.rh 9 No -130- -130-ΜΑ 34813Β1
SEQUENCE LISTING
& Lt; 110 & gt; The Trustees of the University of Pennsylvania June, Carl H Pôrter, David L Kalos, Michael Levine, Bruce L
& Lt; 120 & gt; USE OF CHIMERIC ANTIGEN RECEPTOR-MODIFIED T CELLS TO TREAT CANOBR & lt; 130 & gt; 46483-6001-00-W0.601218 & lt; 150 & gt; 61 / 421,470 & lt; 151 ^ 2010-12-09 & lt; 150 & gt; 61 / 502,649 & lt; 151 & gt; 2010-06-29 & lt; 16017
& Lt; 170 & gt; Patentln version 3.5 & lt; 210 & gt; 1 & lt; 211 & gt; 22174 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ (Chemically Synthesized & lt; 400 & gt; 1 gcgcgctcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 60 cttaat.c ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc 120 accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgggacgc gccctgtagc 180 ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 240 40 gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt 300 ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac 360 ctcgarôSca aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag 420 acggtttttc gcccffigac gttggagtcc acgttcttta atagtggact cttgttccaa 480 actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg 540 50 atrtcggcct attggttaaa aaatgagctg alttaacaaa aatttaacgc gaattrtaac 600 -131- -131-ΜΑ 34813Β1 aaaatattaa cgcttacaat ttaggtggca cmcgggg aaatgtgcgc ggaaccccta 660 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat 720 5 aaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgccc 780 ttattccctt ttttgcggca ttttgccttc ctgfflftgc tcacccagaa acgctggtga 840 aagtaaiâga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca 900 acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt 960 ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg 1020 15 gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 1080 atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata 1140 acact ^ gc caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttm 1200 tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag 1260 ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca 1320 25 aactattaac tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 1380 aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc Igglllallg 1440 atggtaagcc ctcccgtatc glagttatct acacgacggg gagtcaggca actatggatg 1560 aacgaaatag acagatcgct gagataggtg cctcactgat taagc.attgg taactgtcag 1620 35 accaagttta clcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 1680 tctaggtgaa gatccl gataatctca tgaccaaaat cccttaacgt gagttttcgt 1740 tccactâ.c gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cc-c 1800 tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 1860 cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac 1920 45 caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac 1980 cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt 2040 -132- -132-ΜΑ 34813Β1 gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat 2160 acctecagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt 2220 atccg ^ aag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg 2280 cctggtatct ttatagtcct gtcgggttc gccacctctg acttgagcgt cgatmigt 2340 gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt 2400 10 tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc. cctgattctg 2460 tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg 2520 agcgc.ga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc 2580 ccgcgcgttg gccgattcat taatgcagct ggcacgacag gmcccgac tggaaagcgg 2640 gcagtgagcg caacgcaatt aatgtgagtt agctcactca ttaggcaccc caggctttac 2700 20 acmatgct tccggctcgt atgttgtgtg gaattgtgag cggataacaa tttcacacag 2760 gaaacagcta tgaccatgat tacgccaagc gcgcaattaa ccctcactaa agggaacaaa 2820 agctg ^ ct gcaagcttaa tgtagtctta tgcaatactc ttglagtctt gcaacatggt 2880 aacgatgagt tagcaacatg ccttacaagg agagaaaaag caccgtgcat gccgattggt 2940 ggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggat 3000 30 tggacgaacc actgaattgc cgcattgcag agatattgta tttaagtgcc tagctcgata 3060 cataaacggg tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg 3120 gaaccâfctg cttaagcctc aataaagctt gccttgagtg cttcaagtag tgtgtgcccg 3180 tctgttgtgt gactctggta actagagatc cctcagaccc ttttagtcag tgtggaaaat 3240 ctctagcagt ggcgcccgaa cagggacttg aaagcgaaag ggaaaccaga ggagctctct 3300 40 cgacgcagga ctcggcttgc tgaagcgcgc acggcaagag gcgaggggcg gcgactggtg 3360 agtacgccaa aaattttgac tagcggaggc tagaaggaga gagatgggtg cgagagcgtc 3420 aagaaaaaat ataaattaaa acatatagta tgggcaagca gggagctaga acgattcgca 3540 gttaatcctg gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa 3600 50 ccatcccttc agacaggatc agagaactt agatcattat ataatacagt agcaccctc 3660 -133- -133-ΜΑ 34813Β1 tattgtgtgc atcaaaggat agagaiaaaa gacaccaagg aagctttaga caagatagag 3720 gaagagcaaa acaaaagtaa gaccaccgca cagcaagcgg ccgctgatct tcagacctgg 3780 5 tgaaccatta ggagtagcac ccaccaaggc aaagagaaga gtggtgcaga gagaaaaaag 3900 agcag0a ataggagctt tgttccttgg gttcttggga gcagcaggaa gcactatggg 3960 gcagaacaat ttgctgaggg ctattgaggc gcaacagcat ctgttgcaac tcacagtctg 4080 5; gctcctgggg atttggggtt gctctggaaa actcatttgc accactgctg tgccttggaa 4200 tgctag. agtaataaat ctctggaaca gatttggaat cacacgacct ggatggagtg 4260 ggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaa 4320 ccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaa 4380 25 ttggtttaac ataacaaatt ggctgtggta tataaaatta ttcataatga tagtaggagg 4440 cttggtaggt ttaagaatag tttttgctgt actttctata gtgaatagag ttaggcaggg 4500 atattc.a ttatcgtttc agacccacct cccaaccccg aggggacccg acaggcccga 4560 aggaatagaa gaagaag ^ g gagagagaga cagagacaga tccattcgat tagtgaacgg 4620 atctcgacgg tatcgattag actgtagccc aggaatatgg cagctagatt gtacacattt 4680 35 agaaggaaaa gttatcttgg tagcagttca tgtagccagt ggatatatag aagcagaagt 4740 aattccagca gagacagggc aagaaacagc atacttcctc ttaaaattag caggaagatg 4800: ;; incandescent aca ^ acata 4860 1 ::: ::::::: Aaeq; E Gigi: loyal: 45 Jjaj termination gg ggctgaacat cttaagacag cagtacaaat ggcagtattc atccacaatt ttaaaagaaa 5040 acaaa0aa gaattacaaa aacaaattac aaaaattcaa aattttcggg tttattacag 5160 -134- -134-ΜΑ 34813Β1 ggacagcaga gatccagttt ggctgcattg atcacgtgag gctccggtgc ccgtcagtgg 5220 gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg caattgaacc 5280 ggtgcâaga gaaggtggcg cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc 5340 ctttttcccg agggtggggg agaaccgtat ataagtgcag tagtcgccgt gaacgttctt 5400 tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 5460 10 ggcctcttta cgggttatgg cccttgcgtg ccttgaatta cttccacctg gctgcagtac 5520 taagg.cc cttcgcctcg tgcttgagtt gaggcctggc ctgggcgctg gggccgccgc 5640 taaaaWtt gatgacctgc tgcgacgctt tttttctggc agatagtct tgtaaatgcg 5760 20 ggccaagatc tgcacactgg tatttcggtt tttggggccg cgggcggcga cggggcccgt 5820 gcglcccagc gcacatgttc ggcgaggcgg ggcctgcgag cgcggccacc gagaatcgga 5880 cggg.gt ctcaagctgg ccggcctgct ctggtgcctg gcctcgcgcc gccggtatc 5940 ccgcttcccg gccctgctgc agggagctca aaatggagga cgcggcgctc gggagagcgg 6060 30 gcgggtgagt cacccacaca aaggaaaagg gcctttc.cgt cctcagccgt cgcttcatgt 6120 gactccactg agtaccgggc gccgtccagg cacctcgatt agttctcgag cttttggagt 6180 acgtc ^ fitt taggttgggg ggaggggttt tatgcgatgg agtttcccca cactgagtgg 6240 gtggagactg aagttaggcc agcttggcac ttgatgtaat tctccttgga atttgccctt 6300 tttgagtttg gatcttggtt cattctcaag cctcagacag tggttcaaag tttttttctt 6360 40 ccatttcagg tgtcgtgatc tagaggatcc atggccttac cagtgaccgc cttgctcctg 6420 ccgctggcct tgctgctcca cgccgccagg ccggacatcc agatgacaca gactacatcc 6480 tccct ^ g cctctctggg agacagagtc accatcagtt gcagggcaag tcaggacatt 6540 agtaaatatt taaattggta tcagcagaaa ccagatggaa ctgttaaact cctgatctac 6600 catacatcaa gattacactc aggagtccca tcaaggttca gtggcagtgg gtctggaaca 6660 50 gattattctc tcaccattag caacctggag caagaagata ttgccactta ctttigccaa 6720 -135- -135-ΜΑ 34813Β1 ggacctggcc tggiggcgcc ctcacagagc ctgtccgtca catgcactgt ctcaggggtc 6900 tcattacccg actatggtgt aagctggatt cgccagcctc cacgaaaggg tctggagtgg 6960 ctggg.aa tatggggtag tgaaaccaca tactataatt cagctctcaa atccagactg 7020 accatcatca aggacaactc caagagccaa gttttcttaa aaatgaacag tctgcaaact 7080 gatgacacag ccatttacta ctgtgccaaa cattattact acggtggtag ctatgctatg 7140 15 gactactggg gccaaggaac ctcagtcacc gtctcctcaa ccacgacgcc agcgccgcga 7200 ccaccaacac cggcgcccac catcgcgtcg cagcccctgt ccctgcgccc agaggcgtgc 7260 cggcc.gg cggggggcgc agtgcacacg agggggctgg acttcgcctg tgatatctac 7320 atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 7380 tactgcaaac ggggcagaaa gaaactcctg tatatattca aacaaccatt tatgagacca 7440 25 gtacaaacta ctcaagagga agatggctgt agctgccgat ttccagaaga agaagaagga 7500 ggatgtgaac tgagagtgaa gttcagcagg agcgcagacg cccccgcgta caagcagggc 7560 cagaa.gc tctataacga gctcaatcta ggacgaagag aggagtacga tgttttggac 7620 aagagacgtg gccgggaccc tgagatgggg ggaagccga gaaggaagaa ccctcaggaa 7680 ggcctgtaca atgaactgca gaaagataag atggcggagg cctacagtga gattgggatg 7740 35 aaaggcgagc gccggagggg caaggggcac gatggccttt accagggtct cagtacagcc 7800 accaaggaca cctacgacgc ccttcacatg caggccctgc cccctcgcta agtcgacaat 7860 caacctètgg attacaaaat ttgtgaaaga ttgactggta ttcttaacta tgttgctcct 7920 tttacgctat gtggatacgc tgctttaatg cctttgtatc atgctattgc ttcccglatg 7980 gctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtgg 8040 45 cccgttgtca ggcaacgtgg cgtggtgtgc actgtgtttg ctgacgcaac ccccactggt 8100 tggggcattg ccaccacctg tcagctcctt tccgggactt tcgctttccc cctccctatt 8160 gccaclgg aactcatcgc cgcctgcctt gcccgctgct ggacaggggc tcggctgttg 8220 -136- -136-ΜΑ 34813Β1 ggcactgaca attccgtggt gtt ^ cgggg aagctgacgt cctttccatg gctgctcgcc 8280 tgtgttgcca cctggattct gcgcgggacg tccttctgct acgtcccttc ggccctcat 8340 ccagcggacc ttccttcccg cggcctgctg ccggctctgc ggcctcttcc gcgtcttcgc 8400 cttcgccctc agacgagtcg gatctccctt tgggccgcct ccccgcctgg aattcgagct 8460 cggtaccttt aagaccaatg acttacaagg cagctgtaga tcttagccac tttttaaaag 8520 10 aaaagggggg actggaaggg ctaattcact cccaacgaag acaagalctg ctttttgctt 8580 gtactgggtc tcetggtta gaccagatct gagcclggga gctctctggc taactaggga 8640 acccadt | ct taagcctcaa taaagcttgc cttgagtgct tcaagtagtg tgtgcccgtc 8700 tgttgtgtga ctctggtaac tagagatccc tcagaccctt ttagtcagtg tggaaaatct 8760 ctagcagtag tagttcatgt catcttatta ttcagtattt ataacttgca aagaaatgaa 8820 20 latcagagag tgagaggaac ttgtttattg cagcttataa tggttacaaa taaagcaata 8880 gcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtcca 8940 aactcia tgtatcttat catgtctggc tctagctatc ccgcccctaa ctccgcccat 9000 cccgccccta actccgccca gttccgccca ttctccgccc catggctgac taattttttt 9060 tatttatgca gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg 9120 30 cttttttgga ggcctaggga cgtacccaat tcgccctata gtgagtcgta ttac 9174 2 & lt; 210 & gt; 28 Gela 211 & gt;
& Lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ (Chemically Synthesized & lt; 400 & gt; 2 atgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacat 60 gccttaddag gagagaaaaa gcaccgtgca tgccgattgg tggaagtaag gtggtacgat 120 cgtgccttat taggaaggca acagacgggt ctgacatgga ttggacgaac cactgaattg 180 ccgcattgcagagatattgtatttaagtgcctagctcgatacataaac 228 50 -137- -137-ΜΑ 34813Β1
& Lt; 210 & gt; 3 & lt; 211 & gt; 98 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 3
gggtctfctfct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60 ctgcttaagc ctcaataaag cttgccttga gtgcttca 98 & lt; 210 ^ 51 & lt; 211 & gt; 85 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; 20 & lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 4 agtagtgtgt gcccgtctgt tgtgtgactc tggtaactag agatccctca gacccmta 60 25 gtcagtgtgg aaaatctcta gcagt 85
& Lt; 210 & gt; 5 & lt; 2111377 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ £ hemically Synthesized & lt; 400 & gt; 5 cgaacaggga cttgaaagcg aaagggaaac cagaggagct ctctcgacgc aggactcggc 60 ttgctg. gcgcacggca agaggcgagg ggcggcgact ggtgagtacg ccaaaaattt 120 tgactagcgg aggctagaag gagagagatg ggtgcgagag cgtcagtatt aagcggggga 180 45 c gg ggg ggt gg ggggg g taaaacatat agtatgggca agcagggagc tagaacgatt cgcagttaat cctggcctg 300 tagaacatc agaaggctgt agacaaatac tgggacagct acaaccatcc cttcagacag 360 gatca ^ ga acttagatca ttatataata cagtagcaac cctctattgt gtgcatcaaa 420 -138- ΜΑ 34813Β1 ggatagagat aaaagacacc aaggaagctt tagacaagat agaggaagag caaaacaaaa 480 gtaagaccac cgcacagcaa gcggccgctg atcttcagac ctggaggagg agatatgagg 540 gacaa5gga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta 600 gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga 660 gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg 720 10 ctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctg 780 agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc 840 caggcâ ^ aa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg 900 ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat 960 aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac 1020 20 aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat 1080 gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca 1140 aattggSfgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga 1200 atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg 1260 tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat agaagaagaa 1320 30
ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg acggtat 1377 & lt; 210 & gt; 6 & lt; 211 ^ 547 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ 0emically Synthesized & lt; 400 & gt; 6 tagactgtag cccaggaata tggcagctag attgtacaca nragaagga aaagttatct 60 tggta ^ Sgt tcatgtagcc agtggatata tagaagcaga agtaattcca gcagagacag 120 ggcaagaaac agcatacttc ctcttaaaat tagcaggaag atggccagta aaaacagtac 180 atacagacaa tggcagcaat ttcaccagta ctacagttaa ggccgcctgt tggtgggcgg 240 50 300 ggatcaagca ggaatttggc attccctaca atccccaaag tcaaggagta atagaatcta -139- -139-ΜΑ 34813Β1 tgaataaaga attaaagaaa attataggac aggtaagaga tcaggctgaa catcttaaga 360 cagcagtacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggt 420 5
acagtgcagg ggaaagaata gtagacataa tagcaacaga catacaaact aaagaattac 480 aaaaacaaat tacaaaaatt caaaattttc gggtttatta cagggacagc agagatccag 540 tttggcflO 547 & lt; 210 & gt; 7 & lt; 211 & gt; 1178 & lt; 212 & gt; lfA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized 20 & lt; 400 & gt; 7 g 5 Jahjah gg g ggtg ggg ^ gg g gggg atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180 tagtcgccgt gaacgttctt Wcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240 tgtgtggfic ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300 cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360 agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420 35 ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480 tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540 aagat.ct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600 cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660 cgcggccacc gagaatcgga cgggggta ^ ctcaagctgg ccggcctgct ctggtgcctg 720 45 gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780 ttgcgtgagc ggaaagatgg ccgcttcc.cg gccctgctgc agggagctca aaatggagga 840 cgcggfigctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900 -140- ΜΑ 34813Β1 cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960 agtttc & amp; ca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080 tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140 tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178 10
& Lt; 210 & gt; 8 & lt; 211 & gt; 1459 & lt; 212 & gt; DNA & lt; 213 ^ Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 2® atggccttac ca ^ gaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggacatcc agatgacaca gactacatcc tccctgtctg cctctctggg agacagagtc 120 accat ^ tt gcagggcaag tcaggacatt agtaaatatt taaattggta tcagcagaaa 180 ccagatggaa ctgttaaact cctgatctac catacatcaa gattacactc agga ^ ccca 240 tcaaggttca gtggcagtgg gtctggaaca gattattctc tcaccattag caacctggag 300: : Fill the: AA :: I; & amp; :::::: Ctgtccgtca catgcactgt ctcaggggtc tcattacccg actatggtgt aagctggatt 540 cgccagcctc cacgaaaggg tctggagtgg ctgggagtaa tatggggtag tgaaaccaca 600 40 tactataatt cagctctcaa atccagactg accatcatca aggacaactc caagagccaa 660 gttttcttaa aaatgaacag tctgcaaact gatgacacag ccatttacta ctgtgccaaa 720 catta «46t acggtggtag ctatgctatg gactactggg gccaaggaac ctcagtcacc 780 gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840 cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900 50 960 agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg -141- -141-ΜΑ 34813Β1 gtccttctcc tgtcactggt tatcaccctt iactgcaaac ggggcagaaa gaaactcctg 1020 tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080 5 agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140 agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200 a ^ ag ^^ cg ^^^ ac 1260 gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440 caggccctgc cccctcgct 1459 20
& Lt; 210 & gt; 9 & lt; 211 & gt; 591 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 9 atcaa5fct ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc 60 cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta 120 tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat gaggagttgt 180 35 ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca acccccactg 240 gttggggcat tgccaccacc tgtcagctcc Wccgggac tttcgctttc cccctcccta 300 ttgccadggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt 360 tgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcg 420 cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca 480 45 atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt ccgcgtcttc 540 gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcct g 591 50 & lt; 210 & gt; 10 ΜΑ 34813Β1 -142-
& Lt; 211 & gt; 98 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 11 & lt; 223 & gt; Chemically Synthezied & lt; 400 & gt; 10
<img img-format="tif" img-content="drawing" file="MA-34813-B1D01441.tif" id="idf0008" />
ctgcttaagc ctcaataaag cttgccttga gtgcttca agggaaccca 60 98
& Lt; 210 & gt; 11 & lt; 211 & gt; 15Β4 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223dremically Synthesized & lt; 400 & gt; 11 agtagtgtgt gcccgtctgt tgtgtgactc tggtaactag agatccctca gacccraa 60 84: aaaatctcta gcag
& Lt; 210 & gt; 12 & lt; 211 & gt; 486 & lt; 212 ^ ffRT & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 12
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 40
His Ala Ala Arg Pro Asp lie Gin Met Thr Gin Thr Thr Ser Ser Leu 20 25 30
Ser Ala Ser Leu Gly Asp Arg Val Thr lie Ser Cys Arg Ala Ser Gin 35 40 45
Asp IlSffier Lys Tyr Leu Asn Trp Tyr Gin Gin Lys Pro Asp Gly Thr 50 55 60 -143-
Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro 65 70 75 80
Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile 85 90 95 10
Ser Asn Leu Glu Gin Glu Asp Ile Ala Thr Tyr Phe Cys Gin Gin Gly 100 105 110
Asn Thi Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr 115 120 125
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu 13Œ0 135 140
Val Lys Leu Gin Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gin Ser 145 150 155 160 25
Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly 165 170 175 30
Val Ser Trp Ile Arg Gin Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly 180 185 190
Val IiaTrp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser 195 200 205
Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gin Val Phe Leu Lys 21010 215 220
Met Asn Ser Leu Gin Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys 225 230 235 240 45
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gin Gly 245 250 255 50
Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro -144- ΜΑ 34813Β1 260 265 270
Thr Pro Ala Pro Thr Ile Ala Ser Gin Pro Leu Ser Leu Arg Pro Glu 255 280 285
Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp 290 295 300 10
Phe Ala Cys Asp lie Tyr lie Trp Ala Pro Leu Ala Gly Thr Cys Gly 305 310 315 320 15
Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg 325 330 335
Lys LgOLeu Leu Tyr Ile Phe Lys Gin Pro Phe Met Arg Pro Val Gin 340 345 350
Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu 325 360 365
Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala 370 375 380 30
Pro Ala Tyr Lys Gin Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu 385 390 395 400 35
Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp 405 410 415
Pro GftOMet Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu 420 425 430
Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie 445 440 445
Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr 450 455 460 50 -145- -145-ΜΑ 34813Β1
Gin Gly Leu Ser Thr Ala Thi Lys Asp Thr Tyr Asp Ala Leu His Met 465 470 475 480
Gin Afe Leu Pro Pro Arg 485
& Lt; 210 & gt; 13 & lt; 211) 4053 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ Chemically Synthesized & lt; 400 & gt; 13 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccg 20 63 & lt; 210 & gt; 14 & lt; 211 & gt; 726 & lt; 212 & gt; 2 »ΝΑ & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized 30 & lt; 400 & gt; 14 gacatccaga tgacacagac tacatcctcc ctgtctgcct ctctgggaga cagagtcacc 60 atcagttgca gggcaagtca ggacattagt aaatatttaa attggtatca gcagaaacca 120 35 gatggaactg ttaaactcct gatctaccat acatcaagat tacactcagg agtcccatca 180 aggttcagtg gcagtgggtc tggaacagat tattctctca ccattagcaa cctggagcaa 240 gaaga ^ g ^ cac ^ a ^ h ^ g ^ cacag ggiaa ^ a ^ gc tt ^ cgtacac gtt ^ ggaggg ^ 00 458gg g ggg gg gg ggggg gg g tccgtcacat gcactgtctc aggggtctca ttacccgact atggtgtaag ctggattcgc 480 cagcctccac gaagggtct ggagtggctg ggagtaatat ggggtagtga aaccacatac 540 tatattSSg ctctcaaatc cagactgacc atcatcaagg acaactcca gagccaagtt 600 -146- ΜΑ 34813Β1
ttcttaaaaa tgaacagtct gcaaactgat gacacagcca tttactactg tgccaaacat 660 tattactacg gtggtagcta tgctatggac tactggggcc aaggaacctc agtcaccgtc 720 tcctca5 726 & lt; 210 & gt; 15 & lt; 211 & gt; 135 & lt; 212 ^ © NA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 15 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 20 gacttcgcct gtgat 135 16 & lt; 210 & gt; 2 No 2 & lt; 211 & gt;
& Lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ © hemically Synthesized & lt; 400 & gt; 16 atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60 72 accctt0t gc & lt; 210 & gt; 17 & lt; 211 & gt; 126 & lt; 212 ^ © ΝΑ & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 17 60 aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt 50 gaactg 126 120 -147- -147-ΜΑ 34813Β1
& Lt; 210 & gt; 18 & lt; 211 & gt; 336 & lt; 2123 DNA & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized 10 & lt; 400 & gt; 18 agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 60 tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 15 cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180 cggaggêgca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300 tacgacgccc ttcacatgca ggccctgccc cctcgc 336 9 No 2 & lt; 210 & gt;
& Lt; 211 & gt; 21 & lt; 212 & gt; PRT & lt; 213 & gt; Artificial Sequence & lt; 22030 & lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 19
Met A3â Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15
His Ala Ala Arg Pro 4.0
& Lt; 210 & gt; 20 & lt; 211 & gt; 242 & lt; 2123 IT & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized 50 & lt; 400 & gt; 20 -148- -148-ΜΑ 34813Β1
Asp Ile Gin Met Thr Gin Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15
Asp Aig Val Thr Ile Ser Cys Arg Ala Ser Gin Asp Ile Ser Lys Tyr 20 25 30
Leu i Trp Tyr Gin Gin Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45
Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 15 55 60
Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gin 65 70 75 80 20
Glu Asp Ile Ala Thr Tyr Phe Cys Gin Gin Gly Asn Thr Leu Pro Tyr 85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Gly Gly Gly Ser 100 105 110
Gly GlOGly Gly Ser Gly Gly Gly Gly Ser Glu Val Lys Leu Gin Glu 115 120 125
Ser Gly Pro Gly Leu Val Ala Pro Ser Gin Ser Leu Ser Val Thr Cys 13®5 135 140
Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg 145 150 155 160 40
Gin Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser 165 170 175
Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile 180 185 190
Lys ASf) Asn Ser Lys Ser Gin Val Phe Leu Lys Met Asn Ser Leu Gin 195 200 205 -149- -149-ΜΑ 34813Β1
Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly 210 215 220
Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gin Gly Thr Ser Val Thr Val 225 230 235 240 10
Ser Ser
& Lt; 210221 & lt; 211 & gt; 47 & lt; 212 & gt; PRT & lt; 213 & gt; Artificial Sequence & lt; 22020 & lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 21
Thr TSfiThr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr lie Ala 1 5 10 15
Ser Gin Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 3.0 25 30
Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp lie Tyr 45 40 5 A 3 22 & lt; 210 & gt;
& Lt; 211 & gt; 22 & lt; 212 & gt; PRT & lt; 2132 ^ rtificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400222 lie Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu 1 5 10 15 50
Val lie Thr Leu Tyr Cys -150- -150-ΜΑ 34813Β1 20
& Lt; 210 & gt; 23 & lt; 211 ^ 42 & lt; 212 & gt; PRT & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 ^ (Chemically Synthesized & lt; 400 & gt; 23
Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gin Pro Phe Met 1 155 10 15
Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 20
Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 35 40
& Lt; 210 & gt; 24 & lt; 211 & gt; 112 & lt; 212 & gt; PRT & lt; 213 & gt; Artificial Sequence 30 & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 2435
Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gin Gly 1 5 10 15
Gin Α4Α Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30
Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 315 40 45
Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys 50 55 60 50 -151- ΜΑ 34813Β1
Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80
Arg Aig Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala 85 90 95
Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 1000 105 110 & lt; 210 & gt; 25 & lt; 211 & gt; 22 & lt; 212 & gt; 1ΙΑ & lt; 213 & gt; Artificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized 20 & lt; 400 & gt; 25 22 gaaagctgac tgcccctatt tg
& Lt; 210 & gt; 226 & lt; 211 & gt; 22 & lt; 212 & gt; DNA & lt; 213 & gt; Artificial Sequence & lt; 220 ^ 0 & lt; 223 & gt; Chemically Synthesized & lt; 400 & gt; 26 gg 35 c gg & lt; 210 & gt; 27 & lt; 211 & gt; 15
& Lt; 212 & gt; DNA & lt; 213 ^^ rtificial Sequence & lt; 220 & gt; & Lt; 223 & gt; Chemically Synthesized & lt; 400: 427 ctccccagtc tcttt 15
27 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27
157 members in 45 offices
Priority claims5
| Document | Office | Kind | Date |
|---|---|---|---|
| 61421470 | United States of America | – | |
| 42147010 | United States of America | P | |
| 61502649 | United States of America | – | |
| 201161502649 | United States of America | P | |
| 2011064191 | United States of America | W |
Members157
| Document | Office | Kind | |
|---|---|---|---|
| CA2820681A1 | Canada | A1 | |
| WO2012079000A1 | World Intellectual Property Organization (WIPO) | A1 | |
| WO2012079000A4 | World Intellectual Property Organization (WIPO) | A4 | |
| AP2013006918A0 | African Regional Intellectual Property Organization (ARIPO) | A0 | |
| AU2011338200A1 | Australia | A1 | |
| PH12013501201A1 | Philippines | A1 | |
| SG190997A1 | Singapore | A1 | |
| MX2013006570A | Mexico | A | |
| CR20130269A | Costa Rica | A | |
| CU20130079A7 | Cuba | A7 | |
| EP2649086A1 | European Patent Office (EPO) | A1 | |
| ECSP13012739A | Ecuador | A | |
| US2013287748A1 | United States of America | A1 | |
| US2013288368A1 | United States of America | A1 | |
| KR20130124521A | Republic of Korea | A | |
| US2013309258A1 | United States of America | A1 | |
| CO6801633A2 | Colombia | A2 | |
| EA201390847A1 | Eurasian Patent Organization (EAPO) | A1 | |
| CN103492406A | China | A | |
| MA34813B1This record | Morocco | B1 | |
| NI201300051A | Nicaragua | A | |
| CL2013001645A1 | Chile | A1 | |
| PE20140178A1 | Peru | A1 | |
| DOP2013000128A | Dominican Republic | A | |
| JP2014507118A | Japan | A | |
| US2014106449A1 | United States of America | A1 | |
| GT201300150A | Guatemala | A | |
| ZA201304470B | South Africa | B | |
| TN2013000246A1 | Tunisia | A1 | |
| US8906682B2 | United States of America | B2 | |
| US8911993B2 | United States of America | B2 | |
| US2014370017A1 | United States of America | A1 | |
| US8916381B1 | United States of America | B1 | |
| EP2649086A4 | European Patent Office (EPO) | A4 | |
| US2015050729A1 | United States of America | A1 | |
| US8975071B1 | United States of America | B1 | |
| NZ612512A | New Zealand | A | |
| US2015093822A1 | United States of America | A1 | |
| US2015099299A1 | United States of America | A1 | |
| US2015118202A1 | United States of America | A1 | |
| US9101584B2 | United States of America | B2 | |
| US9102760B2 | United States of America | B2 | |
| US9102761B2 | United States of America | B2 | |
| SG10201510092QA | Singapore | A | |
| US9328156B2 | United States of America | B2 | |
| US2016130355A1 | United States of America | A1 | |
| US2016159907A1 | United States of America | A1 | |
| JP5947311B2 | Japan | B2 | |
| US2016194404A1 | United States of America | A1 | |
| US2016208012A1 | United States of America | A1 | |
| JP2016174607A | Japan | A | |
| US9464140B2 | United States of America | B2 | |
| US9481728B2 | United States of America | B2 | |
| US9499629B2 | United States of America | B2 | |
| US9518123B2 | United States of America | B2 | |
| CN106220739A | China | A | |
| US9540445B2 | United States of America | B2 | |
| AU2011338200B2 | Australia | B2 | |
| MX347078B | Mexico | B | |
| AU2017203087A1 | Australia | A1 | |
| EA027153B1 | Eurasian Patent Organization (EAPO) | B1 | |
| EP2649086B1 | European Patent Office (EPO) | B1 | |
| EP3214091A1 | European Patent Office (EPO) | A1 | |
| DK2649086T3 | Denmark | T3 | |
| EA201790175A1 | Eurasian Patent Organization (EAPO) | A1 | |
| US2017283775A1 | United States of America | A1 | |
| PT2649086T | Portugal | T | |
| AU2017225161A1 | Australia | A1 | |
| LT2649086T | Lithuania | T | |
| ES2641870T3 | Spain | T3 | |
| HRP20171577T1 | Croatia | T1 | |
| BR112013014265A2 | Brazil | A2 | |
| RS56453B1 | Serbia | B1 | |
| SI2649086T1 | Slovenia | T1 | |
| CN107699585A | China | A | |
| JP2018029594A | Japan | A | |
| JP2018029595A | Japan | A | |
| JP6293194B2 | Japan | B2 | |
| PL2649086T3 | Poland | T3 | |
| EP3305798A1 | European Patent Office (EPO) | A1 | |
| CN108103085A | China | A | |
| CY1119760T1 | Cyprus | T1 | |
| HUE036872T2 | Hungary | T2 | |
| US2018258391A1 | United States of America | A1 | |
| EP3214091B1 | European Patent Office (EPO) | B1 | |
| CA2820681C | Canada | C | |
| LT3214091T | Lithuania | T | |
| DK3214091T3 | Denmark | T3 | |
| PT3214091T | Portugal | T | |
| TR2018020015T4 | Türkiye | T4 | |
| TR201820015T4 | Türkiye | T4 | |
| NO2019006I1 | Norway | I1 | |
| NO2019007I1 | Norway | I1 | |
| ES2700966T3 | Spain | T3 | |
| NL300967I1 | Netherlands (Kingdom of the) | I1 | |
| LUC00104I1 | Luxembourg | I1 | |
| RS58100B1 | Serbia | B1 | |
| SI3214091T1 | Slovenia | T1 | |
| HRP20182202T1 | Croatia | T1 | |
| LTPA2019502I1 | Lithuania | I1 |
Numbers
- Publication
- 34813
- Application
- 36089
Titles2
- French
- UTILISATION DE LYMPHOCYTES T MODIFIES PAR UN RECEPTEUR CHIMERIQUE D'ANTIGENES CHIMERIQUE POUR TRAITER LE CANCER
- English
- USE OF MODIFIED T CELLS RECEIVER CHIMERIQUE CHIMERIQUE ANTIGEN FOR TREATMENT OF CANCER
Classification
- CPC, 54
- C07K14/7051
- C12N5/0636
- C12N15/86
- A61K39/39
- C07K14/70503
- C07K14/70507
- C07K14/70521
- C07K14/70578
- C07K16/2803
- C07K16/3061
- C12N2740/15043
- C07K2319/03
- C07K2319/02
- C07K2319/00
- C07K2317/76
- C07K2317/622
- C07K2319/33
- C07K2319/30
- C07K2319/74
- A61K2239/38
- A61K2239/31
- A61K2239/48
- A61K40/11
- A61K40/31
- A61K40/4211
- A61P35/02
- A61K39/39558
- C12N2501/515
- C12N2510/00
- A61K38/177
- A61K38/1774
- A61P35/00
- A61P37/02
- A61P37/04
- A61P43/00
- C07K14/70517
- A61K2039/505
- C07K16/2896
- C07K2317/80
- C12N15/85
- C07K14/70596
- A61K48/005
- A61K2039/585
- C07K14/525
- C12N7/00
- C12N2740/15034
- A61K45/06
- C07K16/30
- A61K2039/5256
- C07K2317/53
- C12N2740/15071
- C07K14/075
- C12N15/861
- C12N2501/51
- IPC, 2
- C07H21 04
- A61K39 00