Polycomb-associated non-coding rnas

Federal-sponsored research or development The present invention was made with government support under grant number RO1-GM-090278 awarded by the National Institutes of Health. Government has specific rights to the invention.

Related Applications This application is filed in US Provisional Patent Application Nos. 61 / 412,862, filed November 12, 2010, and filed December 20, 2010, respectively, which are incorporated herein by reference in their entirety. Claims the priority of 61 / 425,174 and 61 / 512,754 filed on 28 July 2011.

The present invention relates to long non-coding RNAs (lncRNAs) that regulate gene expression, and methods of regulating gene expression using or using inhibitory nucleic acids that bind to them.

Transcriptome analysis suggests that only 1-2% of the mammalian genome encodes proteins, but 70-90% have transcriptional activity (Carninci et al., 2005; Kapranov et al., 2007; Mercer et al., 2009). From 100 nt to over 100 kb, these transcripts are largely unknown in function, may originate within or between genes, are conserved, and may be developmentally regulated. (Kapranov et al., 2007; Guttman et al., 2009). Recent findings indicate that a subset of these transcripts play a decisive role in epigenetic regulation. For example, the gene at the human HOX-D locus is trans-regulated by HOTAIR RNA produced by the unlinked HOX-C locus (Rinn et al., 2007), during X-chromosome inactivation. Tsix, RepA and Xist RNAs target chromatin modifiers in cis to regulate chromosome-wide silencing (Zhao et al., 2008). Interestingly, all four RNAs bind to and regulate polycomb repressor complex 2 (PRC2), a complex that catalyzes the trimethylation of histone H3-lysine 27 (H3-K27me3) (Schwartz and Pirrotta). , 2008). These findings support the idea that long non-coding RNAs are ideal for targeting chromatin modifiers at specific alleles or unique positions in the genome (Lee, 2009) (Lee, 2010). ..

RNA-mediated recruitment is particularly attractive for polycomb proteins. Although first identified in Drosophila as a homeotic regulator, polycomb proteins are conserved from flies to mammals and control many aspects of development (Ringrose and Paro, 2004; Boyer et al., 2006; Lee et al). ., 2006; Schuettengruber et al., 2007; Pietersen and van Lohuizen, 2008; Schwartz and Pirrotta, 2008). Mammalian PRC2 contains four core subunits, Eed, Suz12, RbAp48 and catalytic Ezh2. In humans, abnormal PRC2 expression is associated with cancer and disease (Sparmann and van Lohuizen, 2006; Bernardi and Pandolfi, 2007; Miremadi et al., 2007; Rajasekhar and Begemann, 2007; Simon and Lange, 2008). Despite increasing awareness of the role of polycombs in health, little is known about their in vivo regulation. In flies, polycomb complexes contain sequence-specific DNA binding factors such as Zeste, Pipsqueak (PSQ) or Pho that help bind to polycomb response elements (PREs) (Ringrose and Paro, 2004; Schwartz and Pirrotta). , 2008). Mammalian polycomb complexes, on the other hand, are not believed to contain such subunits. Thus, PRE-like elements (Sing et al., 2009; Woo et al., 2010) and Jarid2 may promote binding, but the mechanism of recruitment to thousands of genomic positions remains poorly understood. (Li et al .; Pasini et al .; Peng et al., 2009; Shen et al., 2009). Interestingly, some PRC2 subunits have a potential RNA-binding motif (Denisenko et al., 1998; Bernstein and Allis, 2005; Bernstein et al., 2006b), ie, for X-inactivation, Tsix / The hypothetical functional interaction between RepA / Xist RNA and PRC2 (Zhao et al., 2008) and the HOX regulation may be supported by HOTAIR and PRC2 (Rinn et al., 2007). Have. Recent studies have also identified several short RNAs of 50-200 nt as potential regulators of PRC2 (Kanhere et al., 2010). RNA may also be involved in the regulation of polycomb repressor complex 1 (PRC1) (Yap et al., 2010).

Despite its ubiquity, the structure and function of many long non-coding RNAs remains largely unanalyzed. Recent studies suggest that some long-chain non-coding RNAs function as epigenetic regulators / RNA cofactors in chromatin remodeling and tumor suppression. Knockdown methods using siRNA and shRNA have become an essential element in the functional analysis of microRNA (miRNA) and messenger RNA (mRNA) (4-6) localized in the cytoplasm. Some have been reported to be less consistently effective for nuclear-localized long non-coding RNAs (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)).

<p> A genome-wide pool of over 9,000 RNAs with which Polycomb repressor complex 2 (PRC2) interacts in embryonic stem cells using a method referred to herein as "RNA immunoprecipitation (RIP) -sequencing". In the book, it is called "PRC2 transcriptome"). Transcriptomes include antisense transcripts, intergenic transcripts and promoter-related transcripts, as well as a number of unannotated RNAs. Numerous transcripts occur within the imprint region, oncogene and tumor suppressor loci and stem cell-related bivalent domains. Some provide evidence of direct RNA / protein interactions via the Ezh2 subunit. Evidence that inhibitory oligonucleotides that specifically bind to RNA that interacts with these PRC2s can successfully increase gene expression in a variety of separate, independent cases, presumably by inhibiting PRC2-related inhibition. Is provided. Gtl2 RNA was identified as a PRC2 cofactor that points PRC2 to alternating imprinted Dlk1 coding genes. Thus, Polycomb proteins interact with a family of RNAs throughout the genome, some of which can be used as biological markers and therapeutic targets for human disease.</p>

<p> In one embodiment, the invention provides a method of preparing multiple effective cDNAs that are complementary to a pool of cell nuclear ribonucleic acid (nRNA). The method is to provide a sample containing a cellular nuclear ribonucleic acid, eg, a sample containing a nuclear lysate, eg, an nRNA that binds to a nuclear protein; it is known to bind to a cellular nuclear ribonucleic acid. , Or an agent that specifically binds to a suspected nuclear protein, eg, an antibody and a sample, are brought into contact with each other under conditions sufficient to form a complex between the agent and the protein; Isolating the complex; synthesizing DNA that is complementary to nRNA to provide the first population of cDNA; performing PCR amplification with strand-specific primers as needed; length Purifying the first population of cDNA to obtain a population of purified cDNA that is at least about 20 nucleotides (nt), eg, at least 25, 50, 75, 100, 150, 200 or 250 nt in length. Determining at least a portion or substantially all of the purified cDNA population; aligning and retaining only those aligned with respect to the reference genome; for example, (1) Candidate transcripts It has a minimum read density in units of reads (RPKM) per kilobase per million reads (eg, above the desired threshold), and (2) candidate transcripts are suitable control libraries (eg, IgG pull-down live). Select a reliable cDNA sequence based on two criteria: enriched in a wild-type library compared to a rally or protein-null pull-down library; thereby preparing multiple cDNAs. Including.</p><p> Ezh2 (Zhao et al., Science. 2008 Oct 31; 322 (5902): 750-6; Khalil et. al., Proc Natl Acad Sci US A. 2009 Jul 14; 106 (28): 11667-72. Epub 2009 Jul 1); G9a (Nagano et al., Science. 2008 Dec 12; 322 (5908): 1717-20 Epub 2008 Nov 6); and Cbx7 (Yap et al., Mol Cell. 2010 Jun 11; 38 (5): 662-74.).</p><p> In some embodiments, the invention includes a method of preparing multiple validated cDNAs that are complementary to a pool of cell nuclear ribonucleic acid (nRNA). The method is to provide a sample containing cytonuclear ribonucleic acid, such as a sample containing nuclear lysates, eg, a sample containing nRNA that binds to a nuclear protein; known to bind to cellular nuclear ribonucleic acid. Factors that specifically bind to or suspected nuclear proteins, such as Ezh2, G9a or Cbx7, such as antibodies and samples, such as nRNAs that remain bound to the protein. Contacting and the protein under conditions sufficient to form a complex; isolating the complex; synthesizing DNA that is complementary to nRNA to provide the first population of cDNA. That; if desired, perform PCR amplification of the cDNA with strand-specific primers; at least about 20 nucleotides (nt) in length, eg, at least 25, 50, 100, 150 or 200 nt in length. Purifying the first population of cDNA to obtain a population of purified cDNA; sequencing at least part or substantially all of the population of purified cDNA; reliable sequences as reference genomes Compare and select sequences that have a high degree of identity to the sequence of the reference genome, eg, at least 95%, 98% or 99% identity, or less than 10, 5, 2 or 1 mismatch. That; and (i) have reads per kilobase per million reads (RPKM) above the desired threshold, and (ii) make from control libraries (protein-null libraries or parallel IgG pull-downs). To select the cDNA to be enriched as compared to the library to be); thereby including preparing a library of cDNA.</p><p> In some embodiments, the method is used to prepare a library corresponding to the transcriptome associated with the protein of interest. In some embodiments, the agent is an antibody and isolating the complex comprises immunoprecipitating the complex. In some embodiments, cDNA is synthesized using a strand-specific adapter. In some embodiments, the method further comprises sequencing substantially all of the cDNA. In another aspect, the invention features a library of cDNAs that is complementary to a pool of cell nuclear ribonucleic acids (nRNAs) prepared by the methods of claims 1-4. In some embodiments, each of the cDNAs is linked to individually addressable beads or regions on a substrate (eg, a microarray).</p><p> In another embodiment, the invention features an RNA that binds to Polycomb repressor complex 2 (PRC2), eg, an inhibitory nucleic acid that specifically binds to or is complementary to SEQ ID NOs: 1-193,049. .. Without being bound by the theory of the invention, these inhibitory nucleic acids can interfere with the binding and function of PRC2 by interfering with the recruitment of PRC2 to specific chromosomal loci. For example, the data herein indicate that a single dose of an inhibitory nucleic acid designed to specifically bind a lncRNA can stably transfer not only the lncRNA but also PRC2, which binds to the lncRNA, from the bound chromatin. Show that you can. After the move, the fully complementary PRC2 does not recover for up to 24 hours. The data provided herein also show that the putative lncRNA binding site of PRC2 does not show a conserved primary sequence motif and simply does not disrupt the interaction of PRC2 with other lncRNAs in general. Allows the design of specific inhibitory nucleic acids that interfere with the interaction of PRC2 with a single lncRNA. In addition, the data provided herein also indicate that lncRNAs can recruit PRC2 in a cis manner and suppress gene expression at or near specific chromosomal loci to which the lncRNAs are transcribed, thus , Supporting the design of inhibitory nucleic acids that inhibit the function of PRC2 and increase the expression of specific target genes.</p><p> In some embodiments, a "gene targeted by a PRC2-binding RNA" (eg, an intersecting gene as described in Tables 1-8 below, or an intersecting gene or a gene whose expression is regulated by a PRC2-binding RNA. Inhibitor nucleic acids are provided for use in methods that regulate the expression of the near-by gene). The terms "PRC2-binding RNA" or "PRC2-binding RNA" are used interchangeably with "PRC2-related RNA" and "PRC2-interacting RNA" to directly or indirectly bind lncRNA, RNA transcription to the PRC2 complex. Refers to an object or region thereof (eg, peaks as described below). Such binding can be determined by immunoprecipitation using antibodies to components of the PRC2 complex, such as Ezh2. SEQ ID NOs: 1 to 193,049 are RNA sequences of mice containing moieties that have been experimentally determined to bind PRC2 using the RIP-sequencing methods described herein, or RNA sequences of these mice. Represents the human RNA sequence corresponding to.</p><p> Such methods of regulating gene expression can be performed in vitro, ex vivo or in vivo. Table 8 shows the genes targeted by the PRC2-binding RNA; the sequence number of the PRC2-binding RNA is shown in the same row as the gene name. In some embodiments, inhibitory nucleic acids are provided for use in methods of treating a disease, eg, the class of disease described in Table 9. Treatment involves regulating (either up or down) the expression of the gene targeted by the PRC2-binding RNA, preferably upregulating gene expression. The inhibitory nucleic acid can be formulated as a sterile composition for parenteral administration. Throughout this description, any reference to the use of a compound is understood to take into account the use of that compound in the preparation of pharmaceutical compositions or pharmaceuticals used in the treatment of diseases. Thus, as one non-limiting example, this aspect of the invention is such an inhibitory nucleic acid in the preparation of pharmaceuticals for use in the treatment of diseases, including increasing the expression of a gene targeted by PRC2-binding RNA. Including using.</p><p> Diseases, disorders or conditions that can be treated according to the present invention include cardiovascular disorders, metabolic disorders, inflammatory disorders, bone disorders, neurological or neurodegenerative disorders, lung disorders, liver disorders, renal disorders, genitourinary disorders. , Bone disorders, cancer and / or protein deficiency disorders. Examples of disease categories are shown in Table 9.</p><p> In a related embodiment, the invention is a method of preparing an inhibitory nucleic acid that regulates gene expression, the RNA sequence identified as binding to PRC2, optionally Tables 1-8 or SEQ ID NOs: 1-193,049. It features the method comprising synthesizing an inhibitory nucleic acid between 5 and 40 bases in length that specifically binds to, or is complementary to, any RNA of. This aspect of the invention further comprises identifying the RNA sequence that binds to PRC2 via the RIP-sequencing method described herein, if desired.</p><p> In a further aspect of the invention, a method of preparing an inhibitory nucleic acid that specifically binds to RNA that binds to Polycomb repressor complex 2 (PRC2) is provided, the method of which is an RNA sequence that binds to PRC2, optionally a table. A step of designing and / or synthesizing a single-stranded inhibitory nucleic acid, optionally, between 5-40 bases of length that specifically binds to any RNA of 1-8 or SEQ ID NOs: 1-193,049. Including. In some embodiments, the method further comprises identifying RNA that binds to PRC2 prior to synthesizing the inhibitory nucleic acid. In some embodiments, RNA has been identified by methods involving identifying RNA that binds to PRC2.</p><p> In some embodiments, the inhibitory nucleic acid is at least 80% complementary to a contiguous sequence between 5-40 bases in said RNA sequence that binds to PRC2. In some embodiments, the designed and / or synthesized sequence of the inhibitory nucleic acid is based on the RNA sequence that binds to PRC2 or a portion thereof, the portion having a length of 5-40 consecutive base pairs. Has In some embodiments, the designed and / or synthesized sequence of the inhibitory nucleic acid is a nucleic acid sequence that is complementary or partially complementary to said RNA sequence that binds to PRC2. Based on this, some of the above have a length of 5-40 consecutive base pairs.</p><p> The designed and / or synthesized inhibitory nucleic acid is at least 80% complementary (optionally) to the portion of the RNA sequence to which it binds or targets, or is intended to bind or target. , At least 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary). In some embodiments, it may contain 1, 2 or 3 base mismatches as compared to each part of the target RNA sequence or its complement. In some embodiments, it can have up to 3 mismatches for 15 bases, or up to 2 mismatches for 10 bases.</p><p> The portion of the inhibitory nucleic acid or RNA sequence that binds to PRC2 is at least one of 8-40 or 10-50 or 5-50 bases in length, eg, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 , 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases. If the inhibitory nucleic acid is based on an RNA sequence that binds to PRC2, a nucleic acid sequence that is complementary to the RNA sequence that binds to PRC2, or part of such a sequence, it may be information about that sequence, eg, public. It may be based on sequence information available in record or electronic form, which may include sequence information contained in scientific publications or sequence databases available.</p><p> If the design and / or synthesis involves the design and / or synthesis of a sequence that is complementary to the nucleic acid described by such sequence information, those skilled in the art may, for example, use common knowledge in the art. Complementarity sequences can be easily determined through an understanding of the Watson / Crick base pairing rules that form part. In the methods described above, RNA that binds to PRC2 can, or can be obtained, or has been identified, or has been obtained by methods that include identifying RNA that binds to PRC2.</p><p> Such a method involves the following steps: providing a sample containing cytonuclear ribonucleic acid, contacting the sample with an agonist that specifically binds to PRC2 or its subunits, in the sample the agonist and protein. It may include allowing a complex to form between them, partitioning the complex, and synthesizing nucleic acids that are complementary to the nucleic acids present in the complex. If necessary, the method further amplifies the synthesized nucleic acid, and / or purifies the nucleic acid (or the amplified nucleic acid), and / or sequences the nucleic acid so obtained. And / or the steps of selecting / analyzing the nucleic acid so obtained to identify transcripts that interact with the probable PRC2 (or subsystem thereof) may be included.</p><p> In one embodiment, the method comprises the Rip-sequencing method described herein. According to the above, in some embodiments, the RNA that binds to PRC2 may be known to bind PRC2, eg, the sequence of the RNA and / or its ability to bind PRC2. Information about is publicly available in recorded or electronic form that allows the design and / or synthesis of inhibitory nucleic acids based on that information. Therefore, RNA that binds to PRC2 can be selected from known sequence information and used to provide information about the design and / or synthesis of inhibitory nucleic acids. In other embodiments, RNA that binds to PRC2 can be identified as binding to PRC2 as part of a design and / or synthetic method. In a preferred embodiment, the design and / or synthesis of the inhibitory nucleic acid involves the production of the nucleic acid from a starting material by techniques known to those of skill in the art, wherein the synthesis may bind to Polycomb repressor complex 2. Obtained based on the sequence of the RNA (or part thereof) selected as known.</p><p> The method of designing and / or synthesizing an inhibitory nucleic acid is the step of identifying and / or selecting the RNA sequence that binds to PRC2; the step of identifying and / or selecting part of the RNA sequence that binds to PRC2: The step of designing a nucleic acid sequence that has the desired degree of sequence identity or complementarity to an RNA sequence that binds to PRC2 or a portion thereof; the step of synthesizing a nucleic acid into the designed sequence; It may include one or more steps of forming a pharmaceutical composition or pharmaceutical by mixing with an acceptable diluent, carrier or excipient.</p><p> Inhibitor nucleic acids so designed and / or synthesized can be useful in methods of regulating gene expression as described herein. Thus, the method of preparing an inhibitory nucleic acid can be a method for use in the manufacture of pharmaceutical compositions or pharmaceuticals for use in the treatment of disease, where optionally RNA binding to PRC2 is targeted. The treatment involves regulating the expression of the gene. In yet another aspect, the invention is incorporated herein by reference into Tables 1, 2, 3, 6 and / or 7, or Table 8, or not herein, but in its entirety. Isolated containing the sequence referenced in Appendix I of US Provisional Patent Application No. 61 / 425,174 filed December 20, 2014, or a fragment thereof containing at least 20 nt, eg, as shown in Appendix I. Provide nucleic acid. In some embodiments, the isolated nucleic acid is synthetic.</p><p> In a further aspect, the invention provides a method of reducing the expression of an oncogene in a cell. In some embodiments, the method comprises at least about 90%, 91, to the long non-coding RNA or PRC2 binding fragment thereof referenced in Table 6, or lncRNA or PRC2 binding fragment thereof referenced in Table 6. Includes contacting cells with nucleic acid sequences that are%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous. A PRC2 binding fragment of a mouse lncRNA or an ortholog lncRNA containing a human lncRNA that retains the ability of the lncRNA to bind to PRC2 is believed. In some embodiments, the oncogene is c-myc. In some embodiments, the long non-coding RNA is Pvt1.</p><p> In yet another aspect, the invention features a method of increasing the expression of a tumor suppressor in a mammal, eg, a human, in need thereof. Methods include inhibitory nucleic acids that specifically bind or complement lncRNAs that interact with human PRC2 corresponding to the tumor suppressor gene loci in Table 7, or human lncRNAs corresponding to the imprint gene in Table 1. , And / or human lncRNAs corresponding to the growth suppressor genes in Table 2, or at least 90%, or at least 90%, (eg, 91) over at least 15 (eg, at least 20, 21, 25, 30, 100) nucleobases thereof. %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) Identical related naturally occurring lncRNAs that increase tumor suppressor expression Includes administration to nucleic acids in effective amounts. Therefore, one method of determining the human ortholog lncRNA that corresponds to the mouse lncRNA is at least 15 nucleobases (or at least 20, 21, 25, 30, 40, 50, 60, 70, 80, 80, in the mouse sequence. To identify a corresponding human sequence that is at least 90% identical to 90 or 100).</p><p> In an additional aspect, the invention is an inhibitory nucleic acid that specifically binds or is complementary to a lncRNA that interacts with human PRC2 corresponding to the tumor suppressor locus in Table 7, or the imprint gene in Table 1. The human lncRNA corresponding to and / or the human lncRNA corresponding to the growth inhibitory gene in Table 2 or at least 15 (eg, at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof are orthologs. Or at least 90% (eg, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of the associated naturally occurring lncRNA that is identical. Provided are methods of suppressing or inhibiting tumor growth in said mammals, eg, humans with cancer, comprising administering to the mammal in an amount effective to suppress or inhibit tumor growth.</p><p> In another embodiment, the invention comprises an inhibitory nucleic acid that specifically binds to or is complementary to a human lncRNA corresponding to the tumor suppressor gene locus in Table 7, or a human lncRNA corresponding to the imprint gene in Table 1. And / or human lncRNA corresponding to the growth suppressor gene in Table 2, or at least 90% of the nucleobases thereof, or at least 15 (eg, at least 20, 21, 25, 30, 50, 70, 100) (eg, at least 20, 21, 25, 30, 50, 70, 100). For example, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) the same associated naturally occurring lncRNA in therapeutically effective amounts. It features a method of treating a human with said mammal, eg, cancer, comprising administering to the mammal in.</p><p> In some or any embodiment, the inhibitory nucleic acid is an oligomeric base compound or oligonucleotide mimetic that hybridizes with at least a portion of the target nucleic acid and regulates its function. In some or any embodiment, the inhibitory nucleic acid is single-stranded or double-stranded. Various exemplary inhibitory nucleic acids are known and described in the art. In some examples, inhibitory nucleic acids are antisense oligonucleotides, locked nucleic acid (LNA) molecules, peptide nucleic acid (PNA) molecules, ribozymes, siRNAs, antago miRs, external guide sequence (EGS) oligonucleotides, microRNAs (miRNAs). ), Small interfering RNA (stRNA), or single or double-stranded RNA interference (RNAi) compounds. Since the term "LNA molecule" refers to a molecule that contains at least one LNA modification, an LNA molecule can have one or more locked nucleotides (three-dimensionally constrained) and one or more unlocked nucleotides. Is understood. It is also understood that the term "LNA" includes nucleotides containing constrained sugars that retain the desired properties of high binding affinity for complementary RNA, nuclease resistance, lack of immune stimulation, and rapid kinetics. Will be done. Examples of constrained sugars are listed below. Similarly, it is understood that the term "PNA molecule" comprises at least one PNA modification and such molecule may contain unmodified nucleotides or nucleoside linkages.</p><p> In some or any embodiment, the inhibitory nucleic acid comprises modification of at least one nucleotide and / or nucleoside (eg, with a modified base, or modified sugar moiety), modified internucleoside binding and / Or include combinations thereof. Thus, the inhibitory nucleic acid can include modified nucleosides and bindings, as well as natural nucleosides and bindings. Examples of such chimeric inhibitory nucleic acids, including hybrids or gapmers, are described below.</p><p> In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising a modified sugar moiety and / or a modified nucleoside bond and / or a modified nucleotide and / or a combination thereof. In some embodiments, the modified nucleoside bond is alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl. Includes at least one of the esters or combinations thereof. In some embodiments, the modified sugar moiety is a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, or a bicyclic sugar moiety. Contains sugar portion. Other examples of modifications include locked nucleic acids (LNA), peptide nucleic acids (PNA), arabinonucleic acids (ANA) (optionally with 2'-F modifications), 2'-fluoro-D-arabinonic acids (FANA), Phosphoramidate morpholino oligomers (PMOs), ethylene-crosslinked nucleic acids (ENA) (optionally with 2'-O, 4'-C-ethylene bridges), and bicyclic nucleic acids (BNAs). Yet other examples are described below and / or are known in the art.</p><p> In some embodiments, the inhibitory nucleic acid is 5-40 bases in length (eg, 12-30, 12-28, 12-25). The inhibitory nucleic acid may be 10-50 or 5-50 bases in length. For example, inhibitory nucleic acids are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 It can be any one of the bases. In some embodiments, the inhibitory nucleic acid is double-stranded and comprises an overhang (optionally 2-6 bases in length) at one end or both ends. In other embodiments, the inhibitory nucleic acid is double-stranded and blunt-ended. In some embodiments, the inhibitory nucleic acid has a sequence that is at least 80% or 90% complementary to at least 5, 10, 15, 20, 25 or 30 bases or up to 30 or 40 bases of the target RNA. Includes, consists of, or contains a sequence having up to 3 mismatches (eg, up to 1 or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases of the target RNA.</p><p> Thus, the inhibitory nucleic acid is at least 80% complementary to at least 10 contiguous bases in the target RNA, or at least 80% to at least 15 or 15-30 or 15-40 contiguous bases in the target RNA. Complementary, or at least 80% complementary to at least 20 or 20-30 or 20-40 contiguous bases of the target RNA, or at least 25, or 25-30 or 25-40 of the target RNA At least 80% complementary to contiguous bases, or at least 80% complementary to at least 30 or 30-40 contiguous bases in the target RNA, or to at least 40 contiguous bases in the target RNA It can contain, or can consist of, a base sequence that is at least 80% complementary. In addition, the inhibitory nucleic acid is at least 90% complementary to at least 10 contiguous bases in the target RNA, or at least 90% to at least 15 or 15-30 or 15-40 contiguous bases in the target RNA. Complementary, or at least 90% complementary to at least 20 or 20-30 or 20-40 contiguous bases of the target RNA, or at least 25, or 25-30 or 25-40 of the target RNA At least 90% complementary to contiguous bases, or at least 90% complementary to at least 30 or 30-40 contiguous bases in the target RNA, or to at least 40 contiguous bases in the target RNA It can contain, or can consist of, a base sequence that is at least 90% complementary. Similarly, an inhibitory nucleic acid can contain, or can consist of, a base sequence that is fully complementary to at least 5, 10 or 15 contiguous bases in the target RNA.</p><p> Complementarity can also be referred to in terms of the number of mismatches in the pairing of complementary bases, as mentioned above. Thus, an inhibitory nucleic acid has up to 3 mismatches across 10 contiguous bases of the target RNA, or up to 3 mismatches across 15 contiguous bases of the target RNA, or up to 3 across 20 contiguous bases of the target RNA. It can contain, or can consist of, a base sequence that has a mismatch, or has up to 3 mismatches across 25 contiguous bases of the target RNA, or has up to 3 mismatches across 30 contiguous bases of the target RNA. Similarly, an inhibitory nucleic acid has up to 2 mismatches across 10 contiguous bases of the target RNA, or up to 2 mismatches across 15 contiguous bases of the target RNA, or up to 2 across 20 contiguous bases of the target RNA. It can contain, or can consist of, a base sequence that has a mismatch, or has up to 2 mismatches across 25 contiguous bases of the target RNA, or has up to 2 mismatches across 30 contiguous bases of the target RNA. Similarly, an inhibitory nucleic acid can contain or consist of a base sequence having a mismatch of 1 across 10, 15, 20, 25 or 30 contiguous bases of the target RNA.</p><p> Thus, in some embodiments, the inhibitory nucleic acid is at least 5-40 bases of the target lncRNA (optionally one of 10, 15, 20, 25 or 30 bases, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, At least 80% of a sequence of 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or one of 50 bases) Approximately 5-40, or 10-50 in length, containing a base sequence that is complementary to (optionally at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). Or it contains or consists of 5 to 50 base sequences. Thus, in some embodiments, the inhibitory nucleic acid is 80% identical (optionally) to a sequence of bases of an antisense nucleic acid of the same length that is completely complementary in sequence to the target lncRNA. At least 5-40 or 5-50 or 10-50 bases (optionally 10, 15, 20) with at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity. , One of 25 or 30 bases or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 , Or one of 50 bases), or may consist of it. In some embodiments, the sequence of the inhibitory nucleic acid is 10, 15, 20, 25 or 30 bases of the target lncRNA (optionally 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 1, 2 or 3 in complementary base pairing compared to the target lncRNA sequence (one of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30)</p><p> In some or any embodiment, the inhibitory nucleic acid has a length of 5-40 or 10-50 bases (eg, 12-30, 12-28, 12-25, 5-25 or 10-25). Bases), including base sequences having up to 3 mismatches in complementary base pairing over 15 bases, or up to 2 mismatches over 10 bases.</p><p> In some embodiments, the cell is a cancer cell, eg, a tumor cell, in vitro or in vivo, eg, in a subject. In other embodiments, cells are in vitro contacted with inhibitory nucleic acids, PRC2-binding lncRNAs, or fragments thereof to increase pluripotency, enhance differentiation, or certain cell types of stem cells, such as nerves. Neurons, dopaminergic neurons, muscles, skin, heart, kidneys, liver, lungs, neuroendocrine, retinal, retinal pigment epithelium, pancreatic α and β cells, hematopoietic cells, cartilage cells, bone cells and / or blood cells ( For example, it is a stem cell that induces differentiation into T cells, B cells, macrophages, erythrocytes, platelets, etc.).</p><p> In some embodiments, the gene is Nkx2-1 (also known as Titf1). In some embodiments, the long non-coding (antisense) RNA against Nkx2-1 is the mouse number at approximately 57,636,100 to 57,638,650 base pairs, perhaps overlapping with the Nkx2-1 promoter containing AK14300; or NR_003367.1. It is on 12 chromosomes. In humans, similar antisense transcripts are present at the human NKX2-1 locus (human gene BX161496; Chr14: human genome assembly version GRCh37 / hg19 with bp36,988,521-36,991,722, if not consistent). ). Nkx2-1 is both a tumor suppressor and an oncogene. At an early stage, Nkx2-1 is required to form a tumor, later its expression is lost, and that loss correlates with a poor prognosis. Therefore, lncRNAs that target Nkx2-1 have at least two uses. That is, the lncRNA can be administered to itself block the formation of cancer, or later reduce its expression and increase the expression of NKX2-1. In humans, NKX2-1 is often amplified and mutated in lung adenocarcinoma and is directly associated with lung tumorigenesis. It is described as a proto-oncogene in the early stages of cancer development, but at the same time its loss of expression is ultimately associated with a poor prognosis. Thus, in some embodiments, a promoter-related antisense transcript is administered to a subject, eg, a subject of cancer, eg, lung adenocarcinoma, and / or introduced into tumor cells, thereby amplifying NKX2. Decreases NKX2-1 expression in patients who express -1. Alternatively, in subjects with a poor prognosis that have lost NKX2-1 expression (eg, cancer, eg, lung adenocarcinoma), anti-introducing inhibitory RNAs such as LNA molecules to interact with PRC2. It antagonizes the sense transcript and resumes expression of the NKX2-1 gene.</p><p> In an additional aspect, the invention provides a method of increasing the pluripotency of stem cells. The method is at least about 90%, 91%, 92%, 93%, for long non-coding RNAs or their PRC2 binding fragments as shown in Table 3, lncRNA sequences or their PRC2 binding fragments as shown in Table 3. Includes contacting cells with nucleic acid sequences that are 94%, 95%, 96%, 97%, 98%, or 99% homologous. PRC2 binding fragments of mouse lncRNA, or ortholog lncRNA containing human lncRNA, are contemplated by the methods described above.</p><p> In a further aspect, the invention features a method of enhancing stem cell differentiation, which method specifically binds to or is complementary to a long non-coding RNA as shown in Tables 3 and 4. Includes contacting cells with an inhibitory nucleic acid that is. In some embodiments, the stem cells are embryonic stem cells. In some embodiments, the stem cells are iPS cells or adult stem cells.</p><p> In additional embodiments, the present invention relates to lncRNAs (at least 5, 10, 15, 20, 25 or 30 bases, or up to 30 or 40) of Table 1, 2, 6 or 7 or 8 for parenteral administration. An inhibitory nucleic acid that specifically binds to or is at least 90% complementary to a base), or at least 15 (eg, at least 20, 21, 25, 30) of lncRNAs in Tables 1, 2, 6 or 7 or 8 , 100) At least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to nucleobases Related naturally occurring Provided is a sterile composition containing lncRNA. In some embodiments, the inhibitory nucleic acids are antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, microRNAs (miRNAs), small molecule single-stranded RNAs (stRNAs), and singles. It is selected from the group consisting of strand or double strand RNA interference (RNAi) compounds. In some embodiments, the RNAi compound consists of small interfering RNA (siRNA), or small hairpin RNA (shRNA), small RNA-inducing gene activation (RNAa), and small activated RNA (saRNA). Selected from the group.</p><p> In some embodiments, the antisense oligonucleotide is selected from the group consisting of antisense RNA, antisense DNA, chimeric antisense oligonucleotides and antisense oligonucleotides.</p><p> In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising a modified sugar moiety, a modified nucleoside bond, a modified nucleotide and / or a combination thereof. In some embodiments, the modified nucleoside bond is an alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester. Or include at least one of their combinations. In some embodiments, the modified sugar moiety is a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, or a bicyclic sugar moiety. Contains sugar portion. Other examples of modifications include locked nucleic acids (LNA), peptide nucleic acids (PNA), arabinonucleic acids (ANA) (optionally with 2'-F modifications), 2'-fluoro-D-arabinonic acids (FANA), Phosphoramidate morpholino oligomers (PMOs), ethylene-crosslinked nucleic acids (ENA) (optionally with 2'-O, 4'-C-ethylene bridges), and bicyclic nucleic acids (BNAs). Yet other examples are described below and / or are known in the art.</p><p> Any PRC2 binding fragment of the RNA shown in the sequence listing summarized below is also considered. In some embodiments, the fragment can recruit PRC2 and enhance PRC2 activity, thereby suppressing gene expression, while in other cases, the fragment masks the lncRNA binding site on PRC2 to increase PRC2 activity. Can interfere with. In particular, the invention uses the following RNA fragments to describe the diseases, disorders, or conditions listed in any of the categories shown in Table 9 (either in the "reverse" or "same" column). Alternatively, it is characterized by regulating the expression of any of the genes shown in Tables 1-8 for use in treating associations.</p><p> In addition, inhibitory nucleic acids that specifically bind to any of the RNAs set forth in SEQ ID NOs: 1-193,049, summarized below, are also considered. In particular, the invention treats a disease, disorder, condition or association listed in any of the categories shown in Table 9 (either in the "reverse chain" column or the "same chain" column in Table 8). It features the use of these inhibitory nucleic acids to upregulate the expression of any of the genes shown in Tables 1-8 for use in; upregulation of a series of genes grouped together in any category. Is also being considered. Evidence is also provided herein that such inhibitory nucleic acids increased the expression of the mRNA corresponding to that gene by about 50% (ie, 150% or 1.5 times normal) or about 2 to about 5 times. To. In some embodiments, it is believed that expression can be increased to a range of about 15-fold, 20-fold, 30-fold, 40-fold, 50-fold or 100-fold, or between any of the numbers described above. .. Other experiments have shown that enhanced mRNA expression correlates with enhanced protein expression. A summary of the sequences in the sequence listing is shown below.</p><p><chemistry num="1-1"><img file="JP6577611B2_D0001.tif" /></chemistry><chemistry num="1-2"><img file="JP6577611B2_D0002.tif" /></chemistry></p><p> SEQ ID NO: Refers to an RNA that associates with (binds) to PRC2 (ie, the RNA to which the inhibitory nucleic acid is directed). (a) Reference genes listed in the table, (b) Prc2-binding transcripts or peaks (ie, smaller regions of RNA that bind to PRC2) that target (regulate expression of) these genes, and ( c) Each of the PRC2-binding transcripts or inhibitory nucleic acids that specifically bind to or complement to the peak is in one of these categories represented by the numbers in Table 9 below. Can be conveniently grouped.</p><p> Diseases are classified as category numbers 11, 14, 15, 17, 21, 24, 26, 42, 44, 49, 58, 69, 82, 103, 119, 120, 126, 143, 163, 167, 172, 177, 182. , 183, 184, 187, 191, 196, 200, 203, 204, 212, 300-323, or 400-643.</p><p> Other functional groups are category numbers 10, 12, 13, 16, 18, 19, 20, 22, 23, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 121, 122, 123, 124, 125, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 164, 165, 166, 168, 169, 170, 171, 173, 174, 175, 176, 178, 179, 180, 181, 185, 186, 188, 189, 190, 192, 193, 194, 195, 197, 198, 199, 201, 202, 205, 206, 207, 208, 209, 210, Pointed to by 211, 213, 214, 215, 216, 217, or 218.</p><p>Category No. Name 10 Actin cell skeletal organization 11 Acute myeloid leukemia 12 Adhesive junction 13 Fat cytokine signaling pathway 14 Age 15 Alzheimer's disease 16 Amino sugar and nucleotide sugar metabolism 17 Muscle atrophic lateral sclerosis (ALS) 18 Angiogenesis 19 Apoptosis 20 Metabolism of arginine and proline 21 Arrhythmic right ventricular cardiomyopathy (ARVC) 22 Axon induction 23 B cell receptor signaling pathway 24 Basal cell carcinoma (also applicable to category 644) 25 Basal transcription factor 26 Bladder cancer (also applicable to category 644) 27 Blood coagulation 28 Vascular development 29 Bone development 30 Calcium signaling pathway</p><p>31 Myocardial contraction 32 Cationic channel activity 33 Cell adhesion 34 Cell cycle 35 Cell cycle 36 Cell motility 37 Signal transduction linked to cell surface receptors 38 Cell response to stress 39 Channel activity 40 Chemokine signaling Route 41 Cholesterol metabolic process 42 Chronic myeloid leukemia 43 Citrate cycle (TCA cycle) 44 Colon-rectal cancer 45 Complement and coagulation cascade 46 Cythal activity 47 Cell skeletal protein binding 48 Cellular sol 49 Dilated cardiomyopathy 50 DNA binding 51 DNA repair 52 DNA replication 53 DNA replication 54 Drug metabolism 55 Fetal morphogenesis 56 Endocytosis 57 Endocytosis 58 Endocytosis 58 Endocytosis 59 vesicles</p><p>60 ErbB signaling pathway 61 Extracellular region 62 Eye development 63 Fatty metabolism 64 Fructose and mannose metabolism 65 G protein binding receptor protein signaling pathway 66 Spawn generation 67 Gap conjugation 68 Gene silencing by miRNA 69 Glymatoma 70 Glucose metabolism 71 Glycosylation / glycosylation 72 Gorgi apparatus 73 Growth factor activity 74 GTP-degrading enzyme regulator activity 75 Cardiac development 76 Hedgehog signaling pathway 77 Hematopoietic cell lineage 78 Hematopoiesis 79 Hematopoiesis Development of system or lymphoid organs 80 Histone modification 81 Huntington's disease 82 Hypertrophic cardiomyopathy (HCM) 83 Immune response 84 Immune system development 85 Inflammatory response 86 Insulin signaling pathway 87 Intracellular signaling cascade 88 Ion channel activity 89 Ion transport</p><p>90 Jak / STAT signaling pathway 91 Learning or memory 92 Leukocyte activation 93 Leukocyte transendothelial migration 94 Extremity development 95 Motor organ behavior 96 Long-term strengthening 97 Lung development 98 Lysosome 99 Lysosome 100 MAPK Signal transduction pathway 101 MAPKKK cascade 102 Melanin formation 103 Lysosome 104 Mismatch repair 105 Lysosome 106 Mitochondrial organization 107 mTOR signaling pathway 108 Muscle tissue development 109 Non-coding RNA metabolism 110 Neuron development 111 Neurotrophic factor Signal transduction pathway 112 Non-small cell lung cancer (also applicable to category 644) 113 Notch signaling pathway 114 Nucleus body 115 Lysosomal lysosomal division 116 Oxidation reduction 117 Oxidative phosphorylation 118 p53 Signal transduction pathway 119 Pancreatic cancer (Also applicable to category 644) 120 Parkinson's disease</p><p>121 pathways in cancer (also applicable to category 644) 122 phosphatase activity 123 phosphoprotein phosphatase activity 124 positive regulation of cellular biosynthesis 125 PPAR signaling pathway 126 prostate cancer (also applicable to category 644) 127 proteasome 128 protein amino acids Dephosphorylation 129 Protein folding 130 Protein kinase activity 131 Protein serine / threonine kinase activity 132 Purine metabolism 133 Pyrimidine metabolism 134 Ras Protein signaling 135 Regulation of actin cell skeleton 136 Regulation of self-eating action 137 Regulation of cell death (category) 644 also applicable) 138 regulation of cell proliferation (also applicable to category 644) 139 regulation of cell size 140 regulation of protein ubiquitination 141 regulation of Ras protein signaling 142 regulation of transcription 143 renal cell carcinoma (category 644) 145 Response to hypoxia 145 Response to steroid hormone stimulation 146 Response to virus 147 Ribosome 148 RNA degradation 149 RNA processing 150 RNA splicing via transesterification</p><p>151 Secretion 152 Skeletal system development 153 Skeletal system morphology 154 Small cell lung cancer (also applicable to category 644) 155 Low-molecular-weight GTP-degrading enzyme regulator activity 156 Sperm formation 157 Sphingolipid metabolism 158 Spliceosome 159 Spliceosome 160 Stem cell differentiation 161 Steroid biosynthesis 162 Synapse 163 Systemic erythematosus 164 T cell activation 165 T cell receptor signaling pathway 166 TGF-β signaling pathway 167 Thyroid cancer (class 644) 168 Tall-like receptor signaling pathway 169 Transcription activator activity 170 Transcription factor activity 171 Translation 172 Type II diabetes 173 Ubiquitin-mediated proteolysis 174 Vascular smooth muscle contraction 175 Vascular system development 176 VEGF signaling pathway 177 Viral myocarditis 178 Wnt signaling pathway 179 Amino acid biosynthesis 180 ank repeats</p><p>181 Bromodomain 182 Myocardium 183 Cataracts 184 Charcoal-Marie Tooth Disease 185 Cytokines 186 Cytokine Receptors 187 Hearing 188 Disease Mutations 189 egf-like Domains 190 Endomes 191 Glycoproteins 193 Glycoproteins 194 Growth Factor Bindings 195 Growth Factor Receptors Body 196 Fish scale 197 Immunoglobulin domain 198 Ion channel 199 Leucine-rich repeat 200 Cerebral leukoplasia 201 Methylation 202 Methyltransferase 203 Neurodegeneration 204 Neurology 205 Nuclear 206 Obesity 207 Protein phosphatase 208 Protein phosphatase inhibitor 209 Cancer gene (cancer source) Contains genes) (also applicable to category 644) 210 secreted</p><p>211 Serine / threonine-specific protein kinase 212 Systemic erythematosus 213 Transmembrane 214 Transmembrane protein 215 Tumor suppressor (also applicable to category 644) 216 Tyrosine protein kinase 217 ubl Concatenation pathway 218 wd Repeated 300 Downward regulation in bladder cancer (category 644) Also applicable)</p><p>301 Downward regulation in leukemia (also applicable to category 644) 302 Downward adjustment in brain tumor (also applicable to category 644) 303 Downward adjustment in cancer (also applicable to category 644) 304 Downward adjustment in cervical cancer (also applicable to category 644) 305 Downward regulation in colon cancer (also applicable to category 644) 306 Downward adjustment in esophageal cancer (also applicable to category 644) 307 Downward adjustment in gastric cancer (also applicable to category 644) 308 Downward adjustment in head and neck cancer (also applicable to category 644) 309 Downward regulation in kidney cancer (also applicable to category 644) 310 Downward adjustment in liver cancer (also applicable to category 644) 311 Downward adjustment in lung cancer (also applicable to category 644) 312 Downward adjustment in lymphoma (also applicable to category 644) 313 Downward regulation in melanoma (also applicable to category 644) 314 Downward adjustment in multiple myeloma (also applicable to category 644) 315 Downward adjustment in ovarian cancer (also applicable to category 644) 316 Downward adjustment in pancreatic cancer (corresponding to category 644) 317 Downward regulation in prostate cancer (also applicable to category 644) 318 Downward adjustment in sarcoma (also applicable to category 644) 319 Downward regulation in non-melanoma skin cancer (also applicable to category 644) 320 Downward adjustment in uterine cancer in category 644 (also applicable to category 644) 321 Downward adjustment in mesothelioma (also applicable to category 644) 322 Adrenal gland Downward regulation in cancer (also applicable to category 644) 323 Downward adjustment in parathyroid cancer (also applicable to category 644)</p><p>400 Up-regulation in clear cell sarcoma of the kidney (also applicable to category 644) 401 Up-regulation in acute lung injury 402 Up-regulation in acute giant nuclear blastocytic leukemia (also applicable to category 644) 403 Up-regulation in acute myeloid leukemia (also applicable to category 644) 404 Up-regulation in acute pancreatitis of unknown details 405 Up-regulation in esophageal adenocarcinoma (also applicable to category 644) 406 Up-regulation in lung adenocarcinoma (also applicable to category 644) 407 In adenomas of the small intestine Up-regulation (also applicable to category 644) 408 Up-regulation in adenovirus infection 409 Up-regulation in AIDS with encephalitis 410 Up-regulation in alcohol intoxication 411 Up-regulation in Alexander's disease 412 Up-regulation in α-1 antitrypsin deficiency 413 Alzheimer Up-regulation in disease 414 Up-regulation in anaplastic oligodendroglioma (also applicable to category 644) 415 Up-regulation in Androgen insensitivity syndrome 416 Up-regulation in stellate astrocytoma (also applicable to category 644) 417 In muscle atrophy Upregulation 418 Upregulation in autoimmune hepatitis 419 Up-regulation in bacterial infection 420 Up-regulation in Barrett's esophagus 421 Up-regulation in in-situ cancer of the small intestine (also applicable to category 644e) 422 Up-regulation in cardiomyopathy 423 Up-regulation in chronic granulomatous disease 424 In chronic lymphocytic leukemia Up-regulation 425 Up-regulation in chronic obstructive airway disease 426 Up-regulation in chronic articulated juvenile rheumatoid arthritis 427 Up-regulation in liver cirrhosis 428 Up-regulation in cocaine dependence 429 Up-regulation in complex rodents 430 Up-regulation in Crohn's disease</p><p>431 Up-regulation in decompensated heart failure 432 Up-regulation in dehydration 433 Up-regulation in dilated cardiomyopathy 434 Up-regulation in dilated cardiomyopathy secondary to viral cardiomyopathy 435 Up-regulation in epidermal proliferation 436 In Escherichia coli infection of the central nervous system Up-regulation 437 Up-regulation in essential plateletemia 438 Up-regulation in exhaustion due to excessive exertion 439 Up-regulation in familial hypophosphatemic bone disease 440 Up-regulation in fracture 441 Up-regulation in femoral fracture 442 General deficiency Up-regulation in bloody myocardial dysfunction 443 Up-regulation in glioblastoma (also applicable to category 644) 444 Up-regulation in Haman-Rich syndrome 445 Up-regulation in gastrointestinal infection with helicobacter pylori 446 Up-regulation in hepatitis C 447 HIV infection Up-regulation in 448 Up-regulation in Huntington's disease 449 Up-regulation in hypercholesterolemia 450 Up-regulation in hypertrophy</p><p>451 Up-regulation in idiopathic thrombocytopenic purpura 452 Up-regulation in infection with enteritis Ersina 453 Up-regulation in infertility due to asthenia 454 Up-regulation in heart injury 455 ISM-Up-regulation in in-situ melanoma of the skin 456 Up-regulation in Laver's melanoma 457 Up-regulation in liver cancer (also applicable to category 644) 458 Up-regulation in macular degeneration 459 Up-regulation in malignant lymphoma (also applicable to category 644) 460 Up-regulation in cervical malignancies (category) 644 Applicable to) 461 Up-regulation in duodenal malignancies (also applicable to category 644) 462 Up-regulation in prostate malignancies (also applicable to category 644) 463 Up-regulation in gastric malignancies (also applicable to category 644) 464 Up-regulation in testicular malignancies (also applicable to category 644) 465 Up-regulation in colon malignancies (also applicable to category 644) 466 Up-regulation in multiple benign pigmented mother's spots 467 Up-regulation in diabetic neuropathy 468 Up-regulation in non-insulin-dependent diabetes 469 Up-regulation in nutritional deficiency 470 Up-regulation in obstructive sleep apnea 471 Up-regulation in oligodendroglioma (also applicable to category 644) 472 Up-regulation in papillary thyroid cancer (also applicable to category 644) 473 Up-regulation in Parkinson's disease 474 Pig nephropathy Upward adjustment in 475 Upregulation in anterior neoplasia 476 Upregulation in primary cardiomyopathy 477 Upregulation in primary open-angle glaucoma 478 Upregulation in primary pulmonary hypoplasia 479 Upregulation in Pseudomonas infection 480 Upregulation in pulmonary emphysema 481 Pulmonary hypertension Upward regulation in illness</p><p>482 Up-regulation in renal disorders associated with type II diabetes 483 Up-regulation in renal injury 484 Up-regulation in retinal pigment degeneration 485 Up-regulation in rheumatoid arthritis 486 Up-regulation in spinous cell carcinoma (also applicable to category 644) 487 Lung Up-regulation in spinous cell carcinoma (also applicable to category 644) 488 Up-regulation in epilepsy 489 Up-regulation in systemic infection 490 Up-regulation in thrombocytopenia 491 Up-regulation in thoracic adenocarcinoma (also applicable to category 644) 492 Up-regulation in transitional cell carcinoma (also applicable to category 644) 493 Up-regulation in in-situ transitional cell carcinoma (also applicable to category 644) 494 Up-regulation in ulcerative colitis 495 Up-regulation in uterine myoma 496 Respiratory-related Up-regulation in lung injury 497 Up-regulation in ventricular hypertrophy 498 Up-regulation in ventricular hypertrophy ([left]) 499 Up-regulation in vitamin A deficiency 500 Down-regulation in clear cell sarcoma of the kidney (also applicable to category 644) 501 Acute lung injury Down-regulation in 502 Down-regulation in acute giant blastoid leukemia (also applicable to category 644) 503 Downward regulation in acute myeloid leukemia (also applicable to category 644) 504 Downward adjustment in unspecified acute pancreatitis 505 Downward adjustment in esophageal adenocarcinoma (also applicable to category 644) 506 Downward regulation in lung adenocarcinoma (class 644) 507 Downward regulation in adenocarcinoma of the small intestine (also applicable to category 644) 508 Downward regulation in adenovirus infection 509 Downward regulation in AIDS with encephalitis 510 Downward regulation in alcohol poisoning</p><p>511 Downward regulation in Alexander's disease 512 Downward regulation in α-1 antitrypsin deficiency 513 Downward regulation in Alzheimer's disease 514 Downward regulation in anaplastic hypoplasia astrocytoma 515 Downward regulation in Androgen insensitivity syndrome 516 Downward regulation in stellate cell tumor (Applicable to category 644) 517 Anaplasia in muscle atrophy 518 Anaplasia in autoimmune hepatitis 519 Anaplasia in bacterial infection 520 Anaplasia in Barrett's esophagus 521 Anaplasia in in-situ cancer of the small intestine (also in category 644) 522 Downward adjustment in cardiomyopathy 523 Downward adjustment in chronic astrocytoma disease 524 Downward adjustment in chronic lymphocytic leukemia 525 Downward adjustment in chronic obstructive airway disease 526 Downward adjustment in chronic articulated juvenile rheumatoid arthritis 527 Downward in liver cirrhosis Regulatory 528 Downward regulation in cocaine addiction 529 Downward regulation in complex rodent 530 Downward regulation in Crohn's disease 531 Downward regulation in decompensated heart failure 532 Downward regulation in dehydration 533 Downward regulation in dilated cardiomyopathy 534 Downward regulation in dilated cardiomyopathy secondary to viral myocarditis 535 Downward regulation in epidermal proliferation 536 Downward regulation in central nervous system Escherichia coli infection 537 Downward regulation in essential thrombocythemia 538 Downward regulation in exhaustion due to excessive exertion 539 Family Downward adjustment in hypophosphatemic bone disease 540 Downward adjustment in fractures</p><p>541 Downward regulation in femoral fracture 542 Downward adjustment in pan-ischemic myocardial dysfunction 543 Downward regulation in glioblastoma (also applicable to category 644) 544 Downward adjustment in Haman-Rich syndrome 545 Downward in gastrointestinal infection with Helicobacter pylori Regulatory 546 Downward regulation in hepatitis C 547 Downward regulation in HIV infection 548 Downward regulation in Huntington's disease 549 Downward regulation in hypercholesterolemia 550 Downward regulation in hypertrophy 551 Downward regulation in idiopathic thrombocytopenic purpura 552 In infection with enteritis Ersina Downward regulation 553 Downward adjustment in infertility due to asthenia 554 Downward adjustment in heart injury 555 ISM-Downward adjustment in in-situ melanoma of the skin (also applicable to category 644) 556 Downward adjustment in Laver's melanosis 557 Downward in liver cancer Regulatory (also applicable to category 644) 558 Downward regulation in leukoplakia 559 Downward regulation in malignant lymphoma (also applicable to category 644) 560 Downward regulation in cervical malignant tumor (also applicable to category 644) 561 Downward regulation in duodenal malignancies (also applicable to category 644) 562 Downward adjustment in prostate malignancies (also applicable to category 644) 563 Downward adjustment in gastric malignancies (also applicable to category 644) 564 In testicular malignancies Downward regulation (also applicable to category 644) 565 Downward adjustment in malignant tumors of the colon (also applicable to category 644) 566 Downward adjustment in multiple benign pigment cell mother's spots 567 Downward adjustment in diabetic neuropathy 568 Non-insulin-dependent diabetes Downward adjustment in 569 Downward adjustment in nutritional deficiency 570 Downward adjustment in obstructive sleep apnea</p><p>571 Downward adjustment in oligodendroglioma 572 Downward adjustment in papillary thyroid cancer 573 Downward adjustment in Parkinson's disease 574 Downward adjustment in porcine nephropathy 575 Downward adjustment in preeclampsia 576 Downward adjustment in primary myocardial disease 577 Primary open-angle glaucoma 578 Downward regulation in primary pulmonary hypoplasia 579 Downward regulation in Pseudomonas infection 580 Downward regulation in pulmonary emphysema 581 Downward regulation in pulmonary hypertension 582 Downward regulation in renal disorders associated with type II diabetes 583 Downward regulation in renal injury 584 Retina Downward regulation in pigment degeneration 585 Downward regulation in rheumatoid arthritis 586 Downward regulation in spinous cell carcinoma (also applicable to category 644) 587 Downward regulation in lung spinous cell carcinoma (also applicable to category 644) 588 In epilepsy Down-regulation 589 Down-regulation in systemic infection 590 Down-regulation in thrombocytopenia 591 Down-regulation in thyroid cancer (also applicable to category 644) 592 Down-regulation in transitional cell carcinoma (also applicable to category 644) 593 In-situ transitional cell carcinoma down-regulated (also applicable to category 644) 594 Ulcerative colitis down-regulated 595 Uterine fibroid down-regulated 596 Ventilator-related lung injury down-regulated 597 Ventricular hypertrophy down-regulated 598 Ventricular Downward regulation in hypertrophy ([left]) 599 Downward regulation in vitamin A deficiency 600 Associated with bone disease</p><p>601 Related to cancer diseases (also applicable to category 644) 602 Related to cardiovascular diseases 603 Related to connective tissue disorders 604 Related to skin diseases 605 Related to developmental disorders 606 Related to ear, nose, and throat diseases 607 Related to endocrine diseases 608 Related to gastrointestinal diseases 609 Related to blood diseases 610 Related to immune diseases 611 Related to metabolic diseases 612 Related to multiple diseases 613 Related to muscle diseases 614 For neurological diseases Related 615 Related to nutritional diseases 616 Related to ophthalmic diseases 617 Related to other diseases 618 Related to mental diseases 619 Related to kidney diseases 620 Related to respiratory diseases 621 Related to skeletal diseases 622 Bone diseases 623 Decreased in cancer disease (also applicable to category 644) 624 Decreased in cardiovascular disease 625 Decreased in connective tissue disorder disease 626 Decreased in skin disease 627 Decreased in developmental disorders 628 Ear, nose, throat Decreased by disease 629 Decreased by endocrine disease 630 Decreased by gastrointestinal disease</p><p>631 Decreased in blood disorders 632 Decreased in immune disorders 633 Decreased in metabolic disorders 634 Decreased in multiple diseases 635 Decreased in muscle disorders 636 Decreased in neurological disorders 637 Decreased in nutritional disorders 638 Decreased in ophthalmic diseases 639 Decreased by other diseases 640 Decreased by mental illness 641 Decreased by kidney disease 642 Decreased by respiratory illness 643 Decreased by skeletal disease 644 Involved in cancer</p><p> Thus, in various embodiments, the present invention regulates the expression of a group of reference genes that fall within one or more of the categories shown in the table and is shown in Table 9 (indicating diseases associated with each reference gene). It features an inhibitory nucleic acid that specifically binds to any of the RNA sequences of any of Tables 1-8 for treating the corresponding disease, disorder or condition in any one or more of the categories.</p><p> In another embodiment, the invention also presents SEQ ID NOs: 124437-19716 or 190934-191086 or 191087 (human peak), shown in Table 8 in either the "reverse chain" column or the "same chain" column. Alternatively, an inhibitory nucleic acid that specifically binds to or is complementary to any of the RNA sequences of SEQ ID NOs: 21583 to 124436 or 190717 to 190933 or 191088 (mouse peak) is also characterized. In some embodiments, the inhibitory nucleic acid is used in a method that regulates the expression of a gene targeted by the PRC2-binding RNA (eg, the intersecting gene or near-by gene shown in Tables 1-8 below). Provided. Such methods can be performed in vitro, ex vivo or in vivo. In some embodiments, inhibitory nucleic acids are provided for use, for example, in methods of treating diseases as described in Table 9 below. Treatment involves regulating (either up or down) the expression of the gene targeted by the PRC2-binding RNA, preferably upregulating gene expression. In some embodiments, the inhibitory nucleic acid is formulated as a sterile composition for parenteral administration. The reference genes targeted by these RNA sequences are shown in Table 8 and are grouped according to categories 1-643 in Table 9. Thus, in one embodiment, the invention is an inhibition that specifically binds to or is complementary to any group of RNA sequences, transcripts or peaks in any one of categories 1-643. The group of sex nucleic acids is described. In particular, the present invention relates to any of the categories shown in Table 9 (eg, category numbers 11, 14, 15, 17, 21, 24, 26, 42, 44, 49, 58, 69, 82, 103, 119, One of 120, 126, 143, 163, 167, 172, 177, 182, 183, 184, 187, 191, 196, 200, 203, 204, 212, 300 ~ 323, and / or 400 ~ 643 Diseases described in (above)</p><p> As a non-limiting example, category 45 (complement and coagulation cascade) includes TFPI, F2, F2R, CD46, PROS1, SERPINE1, A2M, C1S, C3AR1, BDKRB1, C1R, SERPING1, BDKRB2, F5, C8G, THBD, Criteria selected from the group consisting of and / or PLAU (gene IDs 7035, 2147, 2149, 4179, 5627, 5054, 2, 716, 719, 623, 715, 710, 624, 2153, 733, 7056, and 5328, respectively). Contains genes. Then TFPI, F2, F2R, CD46, PROS1, SERPINE1, A2M, C1S, C3AR1, BDKRB1, C1R, SERPING1, BDKRB2, F5, C8G, THBD, and / or PLAU, respectively, in the applicable columns of Table 8. Targeted by PRC2-binding RNA with the indicated SEQ ID NO:. For example, the TFPI SEQ ID NOs include 13245 [F], 155228 [F], 155229 [F], 155230 [F], 155231 [F], 155232 [F], 155233 [F], 155234 [F] according to Table 8. ], 155235 [F], 155236 [F], 155237 [F], 155238 [F], 155239 [F], 155240 [F], 155241 [F], 155242 [F], 155243 [F], 155244 [F] ], 155245 [F], 155246 [F], 155247 [F], 155248 [F], 155249 [F], 155250 [F], 155251 [F], 155252 [F], 155255 [F], 155256 [F] ], 13245 [66912], 155237 [-806], 879 [F], 68709 [F], 68710 [F], 68711 [F], 68712 [F], 68713 [F], 68714 [F], 68715 [ F], 68716 [F], 68717 [F], 68718 [F], 68719 [F], 68720 [F], 68721 [F], 68722 [F], 68723 [F], 68724 [ F], 68725 [F], 68726 [F], 68727 [F], 68728 [F], 68729 [F], 68730 [F], 68731 [F], 68732 [F], 68733 [F], 68734 [ F], 68735 [F], 68736 [F], 68737 [F], 68738 [F], 68739 [F], 68740 [F], 68741 [F], 68742 [F], 68743 [F], 68744 [ Includes F], 68745 [F], 68746 [F], 68747 [F], 68748 [F], 68749 [F], and / or 68713 [-245]. Target reference genes TFPI, F2, F2R, CD46, PROS1, SERPINE1, A2M, C1S, C3AR1, BDKRB1, C1R, SERPING1, BDKRB2, F5, C8G, THBD, and / or PLAU listed in Table 8 The group of inhibitory nucleic acids selected from the group consisting of inhibitory nucleic acids that specifically bind to or are complementary to any one of the SEQ ID NOs is Category 45 (Complement and Coagulation Cascade). Intended for use in any of the compositions and methods described herein, including, but not limited to, the use in treating the disease, but the treatment includes the reference genes TFPI, F2, F2R, Regulation of any of CD46, PROS1, SERPINE1, A2M, C1S, C3AR1, BDKRB1, C1R, SERPING1, BDKRB2, F5, C8G, THBD, and / or PLAU is involved. Similarly, inhibitory nucleic acids that specifically bind to or are complementary to a gene in category 643 ("decreased in skeletal disease") include, but are limited to, use in treating skeletal disease. Not intended for use in any of the compositions and methods described herein. Inhibitor nucleic acids that specifically bind to or complement a gene in a category that is also part of category 644 (included in cancer) include, but are limited to, use in treating cancer.</p><p> In various embodiments, the invention further corresponds to chromosomal coordinates in the vicinity of each other, eg, in the range of 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kb or 2 kb of each other, preferably (i). It is characterized by an inhibitory nucleic acid that binds to an RNA sequence between one or more peaks associated with the same reference gene in Table 9 or (ii) the same UCSC transcript in Table 9. For example, the present invention relates to any of the RNA transcripts of SEQ ID NOs: 1-21582 or 191089-193049, about 2000, about 1750, about 1500 or about 1250 nucleotides in length, or preferably about 1000, about 750 in length. It features an inhibitory nucleic acid that specifically binds to or is complementary to a fragment of about 500, about 400, about 300 nucleotides, or about 200, about 150, or about 100 in length, in which the RNA is characterized. Fragments are either SEQ ID NOs: 124437-19716 or 190934-191086 or 191087 (human peak) or SEQ ID NOs: 21583-124436 or 190717-190933 or 191088 (mouse peak), or are not attached herein. Includes stretching of at least 5 contiguous nucleotides within any inverse complementary sequence of any of the cDNA sequences in Appendix I of US Provisional Patent Application No. 61 / 425,174, which is incorporated herein by reference in its entirety. In an exemplary embodiment, the RNA fragment is either SEQ ID NO: 124437-19716 or 190934-191086 or 191087 (human peak) or SEQ ID NO: 21583-124436 or 190717-190933 or 191088 (mouse peak), or US Provisional Patent Application No. 61/425, filed December 20, 2010,</p><p> In some or any embodiment, the inhibitory nucleic acid is, for example, about 5-40 bases, or 10-50 bases, or 5-50 bases in length. In some embodiments, the inhibitory nucleic acid is, for example, at least 5, 10, 15, 20, 25 or 30 bases, or 30 or 40 bases of the target RNA (ie, any of SEQ ID NOs: 1-193,049). Contains or consists of sequences that are at least 80% or 90% complementary to, or up to 3 mismatches (eg, up to 1 or up to 2) over 10, 15, 20, 25, or 30 bases of the target RNA. Includes a base sequence with a mismatch).</p><p> Thus, as mentioned above, the inhibitory nucleic acid is at least 80% complementary to at least 10 or 10-30 or 10-40 contiguous bases of the target RNA, or at least 15 of the target RNA. Alternatively, it is at least 80% complementary to 15-30 or 15-40 contiguous bases, or at least 80% complementary to at least 20, 20-30, or 20-40 contiguous bases in the target RNA. Or at least 80% complementary to at least 25, or 25 to 30, or 25 to 40 contiguous bases in the target RNA, or to at least 30, or 30 to 40 contiguous bases in the target RNA. It can contain, or can consist of, a base sequence that is at least 80% complementary, or at least 80% complementary to at least 40 contiguous bases in the target RNA. In addition, the inhibitory nucleic acid is at least 90% complementary to at least 5, or 5-30, or 5-40 contiguous bases of the target RNA, or at least 10, 10-30, or 10 of the target RNA. At least 90% complementary to ~ 40 contiguous bases, or at least 15 or 15-30 or at least 90% complementary to 15-40 contiguous bases of target RNA, or of target RNA At least 90% complementary to at least 20, or 20 to 30, or 20 to 40 contiguous bases, or at least 90 to at least 25, or 25 to 30, or 25 to 40 contiguous bases in the target RNA. % Complementary, or at least 90% complementary to at least 30 or 30-40 contiguous bases in the target RNA, or at least 90% complementary to at least 40 contiguous bases in the target RNA It can contain, or can consist of, a base sequence. Similarly, the inhibitory nucleic acid may contain a sequence that is completely complementary to at least 5, 10, or 15 contiguous bases in the target RNA. Can or can consist of it. It is understood that some additional non-complementary bases may be included. It is understood that inhibitory nucleic acids containing such sequences of the described bases may also contain other non-complementary bases. For example, an inhibitory nucleic acid can be 20 bases in total length, but can contain a 15-base moiety that is completely complementary to the 15 bases of the target RNA. Similarly, an inhibitory nucleic acid can be 20 bases in total length, but can contain a 15-base moiety that is at least 80% complementary to the 15 bases of the target RNA.</p><p> Complementarity can also be referred to in terms of the number of mismatches in the base pairing of complementarity, as mentioned above. Thus, an inhibitory nucleic acid can have up to 3 mismatches across 10 contiguous bases in the target RNA, or up to 3 mismatches across 15 contiguous bases in the target RNA, or up to 3 mismatches across 20 contiguous bases in the target RNA, or the target. It can contain, or can consist of, a base sequence with up to 3 mismatches across 25 contiguous bases of RNA, or up to 3 mismatches across 30 contiguous bases of a target RNA. Similarly, an inhibitory nucleic acid has up to 2 mismatches across 10 contiguous bases in the target RNA, or up to 2 mismatches across 15 contiguous bases in the target RNA, or up to 2 mismatches across 20 contiguous bases in the target RNA, or It can contain, or can consist of, a base sequence with up to 2 mismatches across 25 contiguous bases of the target RNA, or up to 2 mismatches across 30 contiguous bases of the target RNA. Similarly, an inhibitory nucleic acid can include, or can consist of, a base sequence with one mismatch across 10, 15, 20, 25, or 30 consecutive bases of the target RNA.</p><p> Inhibitory in some or any embodiment of the inhibitory nucleic acid described herein (eg, in summary, detailed description, or examples of embodiments) or methods of designing or synthesizing it. Nucleic acids are optionally (a) made and actually disclosed (ie, specific chemicals, single-stranded or double-stranded, specific modifications and specific base sequences), specified by the following SEQ ID NOs: 1 or more of the inhibitory nucleic acids of; and / or (b) 1 or more base sequences of the inhibitory nucleic acids of (a); and / or specific RNAs of the same RNA as 1 or more of the inhibitory nucleic acids of (c) (a) A group of inhibitory nucleic acids that specifically bind to or are complementary to a moiety (stretch of contiguous bases) can be excluded, as disclosed in one or more of the following publications:</p><p>Target HOT AIR RNA (Rinn et al., 2007), Tsix, RepA or Xist RNA ((Zhao et al., 2008) SEQ ID NOs: 194206 to 194210], or (Sarma et al., 2010) [SEQ ID NOs: 194217 to 194226] or (Zhao et al., 2010) [SEQ ID NOs: 194227 to 194228] or (Prasanath et al., 2005) [SEQ ID NO: 194213 to 194216] or (Shamovsky et al., 2006) [SEQ ID NO: 194212] or (Mariner et al., 2008) [SEQ ID NO: 194211] or (Sunwoo et al., 2008) or (Bernard et al., 2010) [SEQ ID NO: 194229] As; or 50-200 nt targeting short-stranded RNA identified as a PRC2 regulator (Kanhere et al., 2010); or (Kuwabara et al., US Patent Application Publication No. 2005/0226848) [SEQ ID NO: 194230-194231] or (Li Et al., US Patent Application Publication No. 2010/0210707) [SEQ ID NO: 194232 to 194267] or (Corey et al., 7,709,456) [SEQ ID NO: 194268 to 194285] or (Mattick et al., International Publication No. WO2009 / 124341) or (Corey et al.) , US Patent Application Publication No. 2010/0273863) [SEQ ID NO: 194286 to 194305], or (Wahlstedt et al., US Patent Application Publication No. 2009/0258925) [SEQ ID NO: 193140 to 193206], or BACE: US Patent Application Publication No. 2009/0258925 [SEQ ID NO: 193140 ~ 193206]; ApoA1: US Patent Application Publication No. 2010/0105760 / European Patent No. 235283 [SEQ ID NO: 193207 ~ 193379], P73, p53, PTEN, International Publication No. WO2010 / 065787A2 / European Patent No. 2370582 [SEQ ID NO: 193380 ~ 193425]; SIRT1: International Publication No. WO 2010/065662A2 / European Patent No. 09831068 [SEQ ID NO: 193426 ~ 193472]; VEGF:WO 2010/065671A2 / European Patent No. 2370581 [SEQ ID NO: 193473-193483]; EPO: International Publication No. WO2010 / 065792A2 / European Patent No. 09831152 [SEQ ID NO: 193484 ~ 193492]; BDNF: International Publication No. WO2010 / 093904 [SEQ ID NO: 193493 ~ 193503], DLK1: International Publication No. WO2010/107740 [SEQ ID NO: 193504 ~ 193510]; NRF2 / NFE2L2: International Publication No. WO2010 / 107733 [SEQ ID NO: 193511 ~ 193518];</p><p>International Publication No. WO / 2011/085066 [SEQ ID NO: 194083 ~ 194115]; MBTPS1: International Publication No. WO / 2011/084455 [SEQ ID NO: 194116 ~ 194119]; SHBG: International Publication No. WO / 2011/085347 [SEQ ID NO: 194120 ~ 194133]; IRF8: International Publication No. WO / 2011/082409 [SEQ ID NO: 194134 ~ 194137]; UCP2: International Publication No. WO / 2011/079263 [SEQ ID NO: 194138 ~ 194148]; HGF: International Publication No. WO / 2011/079261 [SEQ ID NO: 194149 ~ 194156]; GH: International Publication No. WO / 2011/038205 [SEQ ID NO: 194157 ~ 194161]; IQGAP: International Publication No. WO / 2011/031482 [SEQ ID NO: 194162 ~ 194166]; NRF1: International Publication No. WO / 2011/090740 [SEQ ID NO: 194167 ~ 194172]; P63: International Publication No. WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAse H1: International Publication No. WO / 2011/091390 [ SEQ ID NO: 194177 ~ 194184]; ALOX12B: International Publication No. WO / 2011/097582 [SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NOs: 194194 to 194198]; FGF21: WO / 2011/127337 [SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). .. In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions: International Publication No. WO / 2011/084455 [SEQ ID NO: 194116 ~ 194119]; SHBG: International Publication No. WO / 2011/085347 [SEQ ID NO: 194120 ~ 194133]; IRF8: International Publication No. WO / 2011/082409 [SEQ ID NO: 194134 ~ 194137]; UCP2: International Publication No. WO / 2011/079263 [SEQ ID NO: 194138 ~ 194148]; HGF: International Publication No. WO / 2011/079261 [SEQ ID NO: 194149 ~ 194156]; GH: International Publication No. WO / 2011/038205 [SEQ ID NO: 194157 ~ 194161]; IQGAP: International Publication No. WO / 2011/031482 [SEQ ID NO: 194162 ~ 194166]; NRF1: International Publication No. WO / 2011/090740 [SEQ ID NO: 194167 ~ 194172]; P63: International Publication No. WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAse H1: International Publication No. WO / 2011/091390 [SEQ ID NO: 194177 ~ 194184]; ALOX12B: International Publication No. WO / 2011/097582 [ SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NO: 194194 ~ 194198]; FGF21: International Publication No. As WO / 2011/127337 [SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions: International Publication No. WO / 2011/084455 [SEQ ID NO: 194116 ~ 194119]; SHBG: International Publication No. WO / 2011/085347 [SEQ ID NO: 194120 ~ 194133]; IRF8: International Publication No. WO / 2011/082409 [SEQ ID NO: 194134 ~ 194137]; UCP2: International Publication No. WO / 2011/079263 [SEQ ID NO: 194138 ~ 194148]; HGF: International Publication No. WO / 2011/079261 [SEQ ID NO: 194149 ~ 194156]; GH: International Publication No. WO / 2011/038205 [SEQ ID NO: 194157 ~ 194161]; IQGAP: International Publication No. WO / 2011/031482 [SEQ ID NO: 194162 ~ 194166]; NRF1: International Publication No. WO / 2011/090740 [SEQ ID NO: 194167 ~ 194172]; P63: International Publication No. WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAse H1: International Publication No. WO / 2011/091390 [SEQ ID NO: 194177 ~ 194184]; ALOX12B: International Publication No. WO / 2011/097582 [ SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NO: 194194 ~ 194198]; FGF21: International Publication No. As WO / 2011/127337 [SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions: International Publication No. WO / 2011/079263 [SEQ ID NO: 194138 ~ 194148]; HGF: International Publication No. WO / 2011/079261 [SEQ ID NO: 194149 ~ 194156]; GH: International Publication No. WO / 2011/038205 [SEQ ID NO: 194157 ~ 194161]; IQGAP: International Publication No. WO / 2011/031482 [SEQ ID NO: 194162 ~ 194166]; NRF1: International Publication No. WO / 2011/090740 [SEQ ID NO: 194167 ~ 194172]; P63: International Publication No. WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAseH1: International Publication No. WO / 2011/091390 [SEQ ID NO: 194177 ~ 194184]; ALOX12B: International Publication No. WO / 2011/097582 [SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NO: 194194 ~ 194198]; FGF21: International Publication No. WO / 2011/127337 [ As SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions: International Publication No. WO / 2011/079263 [SEQ ID NO: 194138 ~ 194148]; HGF: International Publication No. WO / 2011/079261 [SEQ ID NO: 194149 ~ 194156]; GH: International Publication No. WO / 2011/038205 [SEQ ID NO: 194157 ~ 194161]; IQGAP: International Publication No. WO / 2011/031482 [SEQ ID NO: 194162 ~ 194166]; NRF1: International Publication No. WO / 2011/090740 [SEQ ID NO: 194167 ~ 194172]; P63: International Publication No. WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAseH1: International Publication No. WO / 2011/091390 [SEQ ID NO: 194177 ~ 194184]; ALOX12B: International Publication No. WO / 2011/097582 [SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NO: 194194 ~ 194198]; FGF21: International Publication No. WO / 2011/127337 [ As SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions: WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAseH1: WO / 2011/091390 [SEQ ID NO: 194177 ~ 194184]; ALOX12B: WO / 2011/097582 [SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NO: 194194 ~ 194198]; FGF21: International Publication No. WO / As 2011/127337 [SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions: WO / 2011/090741 [SEQ ID NO: 194173 ~ 194176]; RNAseH1: WO / 2011/091390 [SEQ ID NO: 194177 ~ 194184]; ALOX12B: WO / 2011/097582 [SEQ ID NO: 194185 ~ 194189]; PYCR1: International Publication No. WO / 2011/103528 [SEQ ID NO: 194190 ~ 194193]; CSF3: International Publication No. WO / 2011/123745 [SEQ ID NO: 194194 ~ 194198]; FGF21: International Publication No. WO / As 2011/127337 [SEQ ID NOs: 194199 to 194205] (the above are incorporated herein by reference in their entirety). In some or any embodiment, optionally excluded from the invention is an inhibitory nucleic acid that specifically binds to or is complementary to one or more of the following regions:</p><p>Nucleotides 1-932 of SEQ ID NO: 193208; nucleotides 1-1675 of SEQ ID NO: 193386; nucleotides 1-518 of SEQ ID NO: 193387; nucleotides 1-759 of SEQ ID NO: 193388; nucleotides 1-25892 of SEQ ID NO: 193389; nucleotides of SEQ ID NO: 193390 1 to 279; nucleotides 1 to 1982 of SEQ ID NO: 193391; nucleotides 1 to 789 of SEQ ID NO: 193392; nucleotides 1 to 467 of SEQ ID NO: 193393; nucleotides 1 to 1028 of SEQ ID NO: 193427; nucleotides 1 to 429 of SEQ ID NO: 193428; Nucleotides 1 to 156 of SEQ ID NO: 193429; nucleotides 1 to 593 of SEQ ID NO: 193430; nucleotides 1 to 643 of SEQ ID NO: 193475; nucleotides 1 to 513 of SEQ ID NO: 193476; nucleotides 1 to 156 of SEQ ID NO: 193486; ~ 3175; nucleotides 1 to 1347 of SEQ ID NO: 193506; nucleotides 1 to 5808 of SEQ ID NO: 193513; nucleotides 1 to 237 of SEQ ID NO: 193520; nucleotides 1 to 1246 of SEQ ID NO: 193521; 1 to 400; nucleotides 1 to 619 of SEQ ID NO: 193554; nucleotides 1 to 813 of SEQ ID NO: 193555; nucleotides 1 to 993 of SEQ ID NO: 193560; nucleotides 1 to 401 of SEQ ID NO: 193560; Baselets 1 to 418 of SEQ ID NO: 193562; Baselets 1 to 378 of SEQ ID NO: 193576; Baselets 1 to 294 of SEQ ID NO: 193577; Baselets 1 to 686 of SEQ ID NO: 193578; Baselets 1 to 480 of SEQ ID NO: 193579; Nucleotides 1 to 501; nucleotides 1 to 1299 of SEQ ID NO: 193613; nucleotides 1 to 918 of SEQ ID NO: 193614;Nucleotides 1 to 1550 of SEQ ID NO: 193615; Nucleotides 1 to 329 of SEQ ID NO: 193616; Nucleotides 1 to 1826 of SEQ ID NO: 193617; Nucleotides 1 to 536 of SEQ ID NO: 193618; Nucleotides 1 to 551 of SEQ ID NO: 193619; 672; Nucleotides 1 to 616 of SEQ ID NO: 193621; Nucleotides 1 to 471 of SEQ ID NO: 193622; Nucleotides 1 to 707 of SEQ ID NO: 193623; Nucleotides 1 to 741 of SEQ ID NO: 193624; Nucleotides 1 to 346 of SEQ ID NO: 193625; Nucleotides 1 to 867; Nucleotides 1 to 563 of SEQ ID NO: 193627; Nucleotides 1 to 970 of SEQ ID NO: 193892; Nucleotides 1 to 1117 of SEQ ID NO: 193893; Nucleotides 1 to 297 of SEQ ID NO: 193894; Nucleotides 1 to 497 of SEQ ID NO: 193907; Nucleotides 1 to 1267 of SEQ ID NO: 193923; Nucleotides 1 to 586 of SEQ ID NO: 193924;</p><p>SEQ ID NO: 193925 nucleotides 1 to 741; nucleotides 1 to 251 of SEQ ID NO: 193926; nucleotides 1 to 681 of SEQ ID NO: 193927; nucleotides 1 to 580 of SEQ ID NO: 193928; 387; nucleotides 1 to 561 of SEQ ID NO: 193970; nucleotides 1 to 335 of SEQ ID NO: 193971; nucleotides 1 to 613 of SEQ ID NO: 193972; nucleotides 1 to 177 of SEQ ID NO: 193973; nucleotides 1 to 285 of SEQ ID NO: 193974; 1 to 3814; nucleotides 1 to 633 of SEQ ID NO: 194002; nucleotides 1 to 497 of SEQ ID NO: 194003; nucleotides 1 to 545 of SEQ ID NO: 194004; nucleotides 1 to 413 of SEQ ID NO: 194306; Vessels 1 to 334 of SEQ ID NO: 194308; Vessels 1 to 582 of SEQ ID NO: 194309; Vessels 1 to 416 of SEQ ID NO: 194310; Substances 1 to 3591 of SEQ ID NO: 194311; Substances 1 to 875 of SEQ ID NO: 194312; Nucleotides 1 to 194; nucleotides 1 to 2074 of SEQ ID NO: 194314; nucleotides 1 to 1237 of SEQ ID NO: 194315; nucleotides 1 to 4050 of SEQ ID NO: 194316; nucleotides 1 to 1334 of SEQ ID NO: 194317; nucleotides 1 to 1235 of SEQ ID NO: 194318; Baselets 1 to 17,964 of SEQ ID NO: 194319;</p><p>Nucleotides 1 to 50,003 of SEQ ID NO: 194320; nucleotides 1 to 486 of SEQ ID NO: 194321; nucleotides 1 to 494 of SEQ ID NO: 194322; nucleotides 1 to 1992 of SEQ ID NO: 194323; nucleotides 1 to 1767 of SEQ ID NO: 194324; 1 to 1240; nucleotides 1 to 3016 of SEQ ID NO: 194326; nucleotides 1 to 1609 of SEQ ID NO: 194327; nucleotides 1 to 312 of SEQ ID NO: 194328; nucleotides 1 to 243 of SEQ ID NO: 194329; nucleotides 1 to 802 of SEQ ID NO: 194330; Nucleotides 1 to 514 of SEQ ID NO: 194331; nucleotides 1 to 936 of SEQ ID NO: 194332; nucleotides 1 to 1075 of SEQ ID NO: 194333; nucleotides 1 to 823 of SEQ ID NO: 194334; nucleotides 1 to 979 of SEQ ID NO: 194335; ~ 979; nucleotides 1 to 288 of SEQ ID NO: 194337; nucleotides 1 to 437 of SEQ ID NO: 194338; nucleotides 1 to 278 of SEQ ID NO: 194339; nucleotides 1 to 436 of SEQ ID NO: 194340; nucleotides 1 to 1140 of SEQ ID NO: 194341; 194342 nucleotides 1 to 2082; SEQ ID NO: 194343 nucleotides 1 to 380; SEQ ID NOs: 194344 nucleotides 1 to 742;</p><p> In some or any embodiment, one or more of the mouse RNA sequences in Table 3 can be excluded. In some or any embodiment, one or more of the human RNA sequences in Table 3 can be excluded. In some or any embodiment, one or more of the mouse RNA sequences in Table 4 can be excluded. In some or any embodiment, one or more of the human RNA sequences in Table 4 can be excluded. In some or any embodiment, one or more of the mouse RNA sequences in Table 5 can be excluded. In some or any embodiment, one or more of the human RNA sequences in Table 5 can be excluded.</p><p> In some or any embodiment of the inhibitory nucleic acids described herein or the methods for designing or synthesizing them, the inhibitory nucleic acids upregulate gene expression and have the same strand as the reference gene encoding the protein. It can specifically bind to, or specifically hybridize with, a PRC2-binding RNA transcribed from, or it can be complementary to it. Inhibitor nucleic acids originate within the intron, exon, intron / exon junction, 5'UTR, 3'UTR, translation initiation region, or translation termination region of the sense strand encoding the protein of the reference gene (refGene). Can bind to regions of PRC2-binding RNA that overlap or overlap.</p><p> In some or any embodiment of the inhibitory nucleic acids described herein or the methods for designing or synthesizing them, the inhibitory nucleic acids upregulate gene expression and compare to the reference gene encoding the protein. It can specifically bind to, or specifically hybridize with, a PRC2-binding RNA transcribed from the contralateral strand (antisense strand), or it can be complementary to it.</p><p> The inhibitory nucleic acids described herein can include, for example, modified sugar moieties, modified nucleoside linkages, modified nucleotides and / or combinations thereof. In addition, the inhibitory nucleic acid can exhibit one or more of the following properties, i.e., it does not induce substantial cleavage or degradation of the target RNA; it does not cause substantially complete cleavage or degradation of the target RNA; Does not activate the pathway of RNA-degrading enzyme H; does not activate RISC; does not recruit any Argonaute family proteins; does not cleave by dicers; does not intervene in selective splicing; is not immunostimulatory; is nuclease resistant; Has improved cell uptake compared to unmodified oligonucleotides; is not toxic to cells or mammals; may have improved endosome exits; PRC2, preferably Ezh2, but optionally Suz12, Eed Interferes with lncRNA interactions with RbAp46 / 48 subunits or accessory molecules such as, for example, Jarid2; reduces methylation of H3-lysine 27 and / or upregulates gene expression.</p><p> In some or any embodiment of the inhibitory nucleic acids described herein or the methods for designing or synthesizing them, the inhibitory nucleic acids are optional, U.S. Patent Application Publication No. 2005/0226848 of Kuwabara et al. Li et al. U.S. Patent Application Publication No. 2010/0210707 or Corey et al. U.S. Pat. No. 7,709,456 or Mattick et al. International Publication No. WO2009 / 124341, which binds the DNA of the promoter region, or Corey et al. Those that bind DNA in the 3'UTR region as described in US Patent Application Publication No. 2010/0273863 may be excluded.</p><p> Inhibitor nucleic acids designed to interact with RNA to regulate gene expression are those designed to bind target DNA (eg, complementary to the underlying genomic DNA sequence into which RNA is transcribed. It is a subset of the base sequence that is distinguished from (target).</p><p> Also described herein is the use of locked nucleic acid (LNA) molecules to target nuclear long noncoding RNAs, which are subclasses of RNA that do not adhere well to traditional knockdown methods (Jepsen et. al., Oligonucleotides, 14, 130-146 (2004); Khalil et al., PNAS 106 (28) 11675-11680 (2009)). As described herein, LNA molecules can be used to rapidly remove lncRNAs from cognate binding sequences (ie, cognate binding partners), such as chromosomes or PRC2. Thus, in one embodiment, the invention provides a locked nucleic acid (LNA) that is complementary to or specifically binds to a long non-coding RNA (lncRNA).</p><p> In another aspect, the invention features a method of dissociating a long non-coding RNA (lncRNA) from its cognate binding partner (eg, breaking the binding or reducing the binding affinity). Methods include contacting lncRNA with a locked nucleic acid (LNA) that is complementary to or specifically binds to lncRNA. In some embodiments, lncRNAs are high molecular weight non-coding RNAs (li non-coding RNAs), promoter-related short RNAs (PASRs), endogenous antisense RNAs, or chromatin modifiers such as polycombs. An RNA that binds to a complex, eg, a polycomb repressor complex 2.</p><p> In some embodiments, the lncRNA is localized to the nucleus. In some embodiments, the LNA molecule is complementary to a region of lncRNA that contains a known RNA localization motif. In some embodiments, the LNA molecule comprises at least one unlocked molecule. Such an LNA molecule can have one or more locked nucleotides and one or more unlocked nucleotides. The term "LNA" includes nucleotides containing constrained sugars that retain the desired properties of high affinity for complementary RNA, nuclease resistance, lack of immune stimulation, and fast kinetics. Examples of constrained sugars are listed below.</p><p> Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Although methods and materials are described herein for use in the present invention; other suitable methods and materials known in the art can also be used. The materials, methods and examples are for illustration purposes only and are not intended to be limiting. All publications, patent applications, patents, sequences, database registrations and other references referred to herein are incorporated herein by reference in their entirety. In the event of inconsistency, this specification, including the definitions, will prevail. Other features and advantages of the present invention will become apparent from the following detailed description, drawings and claims.</p><p> References to Sequence Listings Presented on Compact Discs This application includes compact discs containing sequence listings. Sequence Listing compact Di as follows identified in risk.<chemistry num="2"><img file="JP6577611B2_D0003.tif" /></chemistry> The entire sequence listing is incorporated herein by reference.</p>

Description of the drawing<figref num="1A">FIGS. 1A-1K show one embodiment of RNA immunoprecipitation (RIP) -sequencing methods and pilot library analysis as described herein. FIG. 1A is a typical RIP-sequencing schematic.</figref><figref num="1B-F">Figure 1B shows the results of Western blot analysis of Ezh2 protein in wild-type (WT) ES cells and Ezh2- / -ES cells (right panel) and Coomassie staining (left panel) showing that they were loaded at equal doses. It is a pair of images. FIG. 1C is an image showing the results of a preparation agarose gel for size selection of RNA immunoprecipitated products. Figure 1D shows an equivalent number of cells (row 2), reads after sorting using the criteria shown in Figure 7 (row 3), and separate reads after removing duplicate and repeat sequences (row 4). ) Is a table showing the statistics of the pilot library of the WT library and the control library. Figure 1E is a table showing the library's correlation coefficient (CC) for display in a pair comparison with the original WT library. FIG. 1F is a line graph showing the cumulative frequency of corresponding WT reads for elements with the indicated copy number in the genome.</figref>

<figref num="1G">Figure 1G is a pie chart showing the relative frequencies of the various iterations in the WT library. Elements that were repeated more than 10 times per genome accounted for less than 20% of all reads. Simple repeats accounted for 85.714%, and LINE, SINE, LTR, low complexity repeats and satellites were 4.881%, 4.130%, 2.636%, 2.487% and 0.002% (not shown in the graph), respectively. Equivalent.</figref><figref num="1H-I">FIG. 1H is a graph showing the alignment of separate WT pilot reads to the mouse X chromosome. The number of reads per 100 kb window for both unique elements and repetitive sequences is plotted from centromere (CEN) to distal telomere (TELO). Windows on a 100 kilobase pair do not overlap and are continuous. The leads were normalized so that the leads corresponding to the "n" points were counted as 1 / n leads at each position. Chr: Chromosome, dark gray: forward strand, light gray: reverse strand. FIG. 1I is a graph showing a magnified view of the X-chromosome inactivation center that describes the pilot WT read. These reads are missing in the Ezh2-/-library. Leads with a frequency of 3 or less are shown. *: Non-coding RNA.</figref><figref num="1J">Figure 1J shows a pair of graphs. The graph above shows the alignment of separate WT pilot reeds to mouse chromosome 12. The number of reads per 100 kb window for both unique elements and repetitive sequences is plotted from centromere (CEN) to distal telomere (TELO). Windows on a 100 kilobase pair do not overlap and are continuous. The leads were normalized so that the leads corresponding to the "n" points were counted as 1 / n leads at each position. Chr: Chromosome, dark gray: forward strand, light gray: reverse strand. The graph below shows an expanded version of the imprint domain that describes the pilot WT leads. These reads are missing in the Ezh2-/-library. Leads with a frequency of 3 or less are shown. *: Non-coding RNA.</figref>

<figref num="1K-M">Figure 1K shows a pair of graphs. The graph on the left shows the alignment of separate WT pilot leads to mouse chromosome 12. The number of reads per 100 kb window for both unique elements and repetitive sequences is plotted from centromere (CEN) to distal telomere (TELO). Windows on a 100 kilobase pair do not overlap and are continuous. The leads were normalized so that the leads corresponding to the "n" points were counted as 1 / n leads at each position. Chr: Chromosome, dark gray: forward strand, light gray: reverse strand. The graph on the right shows an expanded version of the imprint domain that describes the pilot WT leads. These reads are missing in the Ezh2-/-library. Leads with a frequency of 3 or less are shown. *: Non-coding RNA. FIG. 1L is a table showing the number of reads (with a frequency of 3 or more) in each genetic category. The parentheses indicate the percentage of separate reads belonging to each category (for example, 50.7% of reads corresponding to non-coding RNA). FIG. 1M is a table showing the number of transfer units in which a read was hit with a frequency of 3 or more times. The total number of transcripts for each category is shown in column 2. The parentheses indicate the percentage representation of each category in the PRC2 transcriptome (for example, 13.7% for a known Suz12 domain in the PRC2 transcriptome).</figref>

<figref num="2A">Figures 2A-2D show data related to larger sequencing to capture the PRC2 transcriptome. FIG. 2A is a scatter plot showing 39,003 transcripts from the UCSC linked transcriptome database by their RPKM values in the wild-type library (x-axis) and null library (y-axis). UCSC transcripts that are neither represented in the WT library nor in the null library are plotted at (0,0). Smoothing was performed by smoothScatter, which is a function of statistical software R. Dark shades correspond to higher gene densities at a given point on the graph. The 3: 1WT / null enrichment line and the x = 0.4 threshold are shown as gray dotted lines. In the pool labeled "PRC2 Transcriptome", transcripts that meet the criteria of 3: 1 or higher RPKM enrichment and 0.4 or higher WT RPKM are considered strongly positive and are shown in red. Transcripts below the cutoff value are considered background and are shown in orange. Tsix is on the outside (arrow) of the figure with the indicated (x, y) coordinates.</figref><figref num="2B">Figure 2B is a table showing the characteristics of the PRC2 transcriptome. The number in parentheses indicates the total number of genes in each category (eg, 325 of the 793 tumor suppressor genes are found in the PRC2 transcriptome).</figref><figref num="2C">Figure 2C is a graph showing the results of a higher resolution analysis of the X-chromosome inactivation center. Separate reads were smoothed by sliding a 200 bp window on the x-axis and plotting their representation on the y-axis.</figref><figref num="2D">Figure 2D is a graph showing the results of metagene analysis. Separate reads from the PRC2 transcriptome are plotted as a function of distance from the transcription start site (TSS).</figref>

<figref num="2E-F">Figure 2E is a pair of graphs showing the frequency of all reads plotted as a function of distance from TSS for the WT (left) and Ezh2-/-(right) libraries. The x-axis shows the promoter regions of all genes obtained from the UCSC refGene database and has base pair (bp) coordinates for TSS. The lead of the forward chain is shown in blue and the reverse chain is shown in red. Arrows indicate enrichment near TSS. Figure 2F is a set of three graphs showing separate reads (with duplicate sequences removed) plotted as a function of distance from TSS for WT, Ezh2-/-samples and IgG samples. Arrows indicate enrichment near TSS.</figref>

<figref num="3A">Figures 3A-B are read density plots for Nesp / Gnas (A) imprint clusters and Dlk1 / Gtl2 (B) imprint clusters. Separate reads were smoothed by sliding a 200 bp or 2 kb window on the x-axis and plotting their representation on the y-axis. *, Non-coding RNA. Chr: Chromosome, dark gray: forward strand, light gray: reverse strand. These reads are missing in the Ezh2-/-library.</figref><figref num="3B">Same as above</figref>

<figref num="4A">Figure 4 shows confirmation by undenatured RNA immunoprecipitation / qRT-PCR and UV-crosslinked RNA immunoprecipitation. FIG. 4A is a set of nine bar graphs showing the results of qRT-PCR to compare anti-Ezh2 antibody pull-down and IgG pull-down. The experiment was performed by repeating 3 sets 2-3 times. Error bar = 1 standard deviation (SD). P was calculated using Student's two-sided t-test. Asterisk: Undetectable level.</figref><figref num="4B">FIG. 4B is an eight-bar graph showing the results of qRT-PCR after RNA immunoprecipitation with undenatured anti-Ezh2 antibody in wild-type ES cells and null ES cells, respectively, normalized to the values for RNA immunoprecipitation with IgG. It is a set. The numbers for Xist, Gtl2-as and Foxn2-as were off the graph. The experiment was performed by repeating 3 sets 2 to 4 times. 1SD is shown. Student's association P is calculated using the two-group two-sided t-test. Asterisk: Undetectable RNA level.</figref><figref num="4C-E">FIG. 4C is a set of seven bar graphs showing the results of confirmation of undenatured RNA immunoprecipitation by UV-crosslinked RNA immunoprecipitation. Each experiment was performed by repeating 3 sets 2-4 times, normalized to IgG pull-down, and compared to Ezh2-/-control experiments using t-test (P). 1SD is shown. FIG. 4E is an image showing the results of undenatured RNA immunoprecipitation with ribonuclease pretreatment followed by qRT-PCR quantification.</figref><figref num="4D">FIG. 4D is an image showing the results of Northern blot analysis for the indicated RNA species.</figref>

<figref num="5A-B">Figures 5A-F show the results of biochemical analysis showing the direct interaction between RNA and PRC2. FIG. 5A is an image showing a Coomassie-stained gel of human PRC2 and subunits. The various mobilities reflect the Flag-tag and untagged types of each protein. FIG. 5B is a schematic diagram showing WT and mutant (Mut) types of RepA (SEQ ID NOs: 193118 and 193119) and Hes1 (SEQ ID NOs: 193120 and 193121) as double stem-loop structures.</figref><figref num="5C">FIG. 5C is an image showing the results of RNA EMSA using a purified PRC2 complex and a terminal-labeled probe. Negative controls: RNA sequences from Xist other than RepA, DsI and DsII. The double shift indicates the presence of multiple PRC2 subcomplexes.</figref><figref num="5D">FIG. 5D is an image showing the results of RNA EMSA using the purified PRC2 subunit. Multiple lanes were run on the same gel, but one lane was cut out between each panel and was cut off in the image.</figref><figref num="5E">FIG. 5E is an image showing the results of titration of a 1-25 fmol Hes1-as RNA probe to 0.1-1.0 mg EZH2.</figref><figref num="5F">Figure 5F is a set of four images showing the results of an RNA pull-down assay using an RNA probe labeled equimolarly loaded with purified PRC2. 25% of the immunoprecipitated fraction, 10% of the transit fraction and 10% of the input RNA are shown.</figref>

<figref num="6A">Figures 6A-E show that Gtl2 controls Dlk1 by targeting PRC2. FIG. 6A is a map of the location of primer pairs used in Dlk1-Gtl2 and shRNA and RNA immunoprecipitation and chromatin immunoprecipitation (ChIP). Dotted lines indicate that the transcript can be further elongated.</figref><figref num="6B-E">Figure 6B is a set of three bar graphs showing the qRT-PCR of RNA levels of Gtl2, Dlk1 and Gtl2-as after Gtl2 knockdown (KD) (left bar in each graph) or scrambled KD (right bar). is there. A pool of knockdown cells is used. RNA levels are normalized to Gapdh levels and compared to levels in the scrambled knockdown control (Scr). The experiment was performed by repeating 3 sets twice. 1SD is shown. P is calculated between Gtl2 KD and Scr KD using Student's two-sided t-test. Figure 6C is a pair of bar graphs showing the results of qChIP for PRC2 binding in KD cells. ChIP was performed using an anti-Ezh2 antibody (top) and an anti-K27 trimethylated histone H3 antibody (bottom) using normal rabbit IgG as a control. qPCR levels are expressed as a percentage of input DNA. DMR, methylation variable region. ICR, imprint control area. 1SD is shown. Gtl2 KD and Scr P is calculated between KD using Student's two-sided t-test. FIG. 6D is a bar graph showing qRT-PCR of Ezh2 mRNA levels in Gtl2-KD and Scr-KD clones. FIG. 6E is a bar graph showing qRT-PCR of Dlk1 expression relative to Gtl2 expression in Ezh2-/-cells and WT cells. 1SD is shown.</figref>

<figref num="7A-C">Figures 7A-C show RIP-sequencing and bioinformatics analysis on test and control samples. FIG. 7A is a flow chart illustrating RIP-sequencing and bioinformatics analysis in test and control samples. Figure 7B shows that treatment of RNA immunoprecipitated products with ribonuclease A (10 ug / mL) and ribonuclease V1 (0.001 U / mL) disrupts products in the range of 200-2,000 nucleotides (boxed). This image shows that the substance pulled down was RNA. Bands in the range of less than 200 nucleotides are PCR primer dimers. Figure 7C shows the results of the metagene analysis, ie, the number of separate reads plotted as a function of the distance from the TSS for the WT pilot sample (plotted on the same scale), the Ezh2-/-pilot sample and the IgG pilot sample. It is a set of three graphs shown.</figref>

<figref num="8A">Figures 8A-C show chromosomal ideograms for wild-type transcriptomes plotted with duplicate sequences removed. Alignment for all mouse genomes of pilot reads after demultiplexing duplicate sequences in the wild-type transcriptome is shown. The number of reads per 100 kb window for both unique elements and repetitive sequences is plotted as a function of distance (in bp) from centromere (CEN) to distal telomere (TELO). Windows on a 100 kilobase pair do not overlap and are continuous. To normalize the leads so that the leads corresponding to the "n" points are counted as one-nth leads at each position, and to illustrate the significantly reduced complexity of the control library compared to immunoprecipitated samples. Further normalized to. Chr: Chromosome. Dark gray: forward chain, light gray: reverse chain.</figref><figref num="8B">Same as above</figref><figref num="8C">Same as above</figref>

<figref num="9A">Figures 9A-C show chromosomal ideograms for the Ezh2-/-control library plotted with duplicate sequences removed. The analysis was performed as explained in the legend of FIG. Note that the graph is plotted on the same scale as the graph for the wild-type library.</figref><figref num="9B">Same as above</figref><figref num="9C">Same as above</figref><figref num="10A">Figures 10A-C show chromosomal ideograms for IgG control libraries plotted with duplicate sequences removed. The analysis was performed as explained in the legend of FIG. Note that the graph is plotted on the same scale as the graph for the wild-type library.</figref><figref num="10B">Same as above</figref><figref num="10C">Same as above</figref><figref num="11A">Figures 11A-C show chromosomal ideograms for wild-type technical repeats plotted with duplicate sequences removed. The analysis was performed as explained in the legend of FIG. Note that the graph is plotted on the same scale as the graph for the wild-type library.</figref><figref num="11B">Same as above</figref><figref num="11C">Same as above</figref>

<figref num="12A">Figures 12A-C Figures 11A-C show chromosomal ideograms for wild-type biological repeats plotted with duplicate sequences removed. The analysis was performed as explained in the legend of FIG. Note that the graph is plotted on the same scale as the graph for the wild-type library.</figref><figref num="12B">Same as above</figref><figref num="12C">Same as above</figref><figref num="13">FIG. 13 represents a plot showing the region around the c-Myc oncogene (bar).</figref><figref num="14">FIG. 14 represents a plot showing the region around the Nkx2-1 gene (also known as Titf1).</figref>

<figref num="15A">Figures 15A-C show that LNA molecules targeting Xist repeat C abolish the localization of Xist RNA on the inactive X chromosome (Xi). Figure 15A is an alignment of 14 tandem mouse repeat Cs (SEQ ID NOs: 193122 to 193135). Conserved nucleotides are indicated by an asterisk. The region targeted by the LNA molecule is indicated by a line.</figref><figref num="15B-C">FIG. 15B is a pair of graphs showing the quantification of the FISH results of Xist RNA at the time of display of LNA molecules after nucleofection. Results for LNA-C1 have been shown, but LNA-C2 yields similar results. FIG. 15C shows the alignment of the mouse and human repeat C region (left) (SEQ ID NOs: 193136 to 193139) targeted by the LNA molecule.</figref>

<figref num="16">FIG. 16 shows that elimination of Xist RNA is accompanied by loss of localization of PRC2, and recovery of Xist RNA occurs first in the vicinity of Xist. The bar graph shows the results of Xist-level real-time qRT-PCR analysis normalized to Gapdh's RNA.</figref><figref num="17A-B">Figures 17A-C show that a wide range of domains around repeat C are required for Xist localization. Figure 17A is a schematic map of the Xist exon / intron structure and the location of the LNA molecule used. FIG. 17B is a bar graph showing the results of Xist-level qRT-PCR normalized to the amount of Gapdh.</figref><figref num="17C">FIG. 17C is an image of a Western blot using the Ezh2 antibody. Actin is used as a loading control.</figref>

<figref num="18A-B">Figures 18A-D show that the recovery of Ezh2 after nucleofection of the LNA molecule is uniform along Xi but slow. FIG. 18A is a schematic diagram of the genes on the X chromosome. FIG. 18B is a bar graph showing ChIP analysis of Ezh2 on genes on the X chromosome.</figref><figref num="18C">FIG. 18C is a pair of bar graphs showing ChIP analysis of Ezh2 after nucleofection of LNA molecules. Asterisk: Student's t-test P &lt;0.05.</figref><figref num="18D">Figure 18D is a bar graph showing ChIP analysis of Ezh2 enrichment at the En1 promoter on autosomal chromosomes.</figref>

Table 1: Imprint area hit by the PRC2 transcriptome An intersection with the imprinted gene coordinates of the PRC2 transcriptome (available online at geneimprint.com). The mouse imprint genes (ie, intersecting genes or near-by genes) targeted by the PRC2-binding transcript are shown in column 1. Column 1 also indicates the chromosomal strand of the mouse imprint gene (the "+" sign indicates that the gene is transcribed from the top or plus strand, and the "-" sign indicates that the PRC2-binding transcript is from the bottom or minus strand. Indicates that it will be transcribed). "+" Indicates whether the PRC2 binding transcript is transcribed from the top strand (plus strand hit) or from the bottom strand (minus strand hit), as well as the chromosomal and nucleotide coordinates in mm9 of the PRC2 binding transcript. A sign or "-" sign is shown in column 2. Column 3 shows the sequence number of the mouse PRC2-binding transcript (ie, the nucleotide sequence transcribed from the mouse chromosomal coordinates and strands of row 2 that is converted to RNA by replacing T with U). Column 4 is the Mouse Genome Database (MGD) in the Mouse Genome Informatics of Jackson Laboratory in Bar Harbor, Maine, Worldwide Webb (www.informatics.jax.). The names of the human genes corresponding to the mouse imprint genes in column 1 obtained from org) are shown. A mouse-to-human LiftOver of mouse chromosomal coordinates in column 2 was performed in the UCSC Genome Browser as described herein to create the orthologous human chromosomal coordinates that appear in column 5. 50% storage was used for LiftOver analysis. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 6 shows the sequence number of the expected human PRC2-binding transcript (ie, the human chromosomal coordinates of column 5 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). When the PRC2 interacting transcript is transcribed from the opposite strand as compared to the imprint reference gene in column 1, it means that the PRC2 interacting RNA is complementary or oriented to the reference imprint gene. Means that it is an antisense strand ("reverse strand"). Note that the PRC2-binding transcript is not necessarily the reference imprint gene itself, but a separate transcript that overlaps in position.

Table 2: PRC2 transcriptome 9,788 transcripts that bind to PRC2 are shown in mouse ES cells. A concatenated UCSC transcriptome was used to map the reads in the WT library. The UCSC transcripts on which the reads were hit are shown in column 1 ("MTR" is the name of the linked gene). Column 2 shows the chromosomal strand of the UCSC transcript (the "+" sign indicates the top or plus strand, and the "-" sign indicates the bottom or minus strand). "+" Indicates whether the PRC2 binding transcript is transcribed from the top strand (plus strand hit) or from the bottom strand (minus strand hit), as well as the chromosomal and nucleotide coordinates in mm9 of the PRC2 binding transcript. A sign or "-" sign is shown in column 3. 0. An RPKM value of 4 or greater was considered a "hit". Column 4 shows the sequence number of the mouse PRC2-binding transcript (ie, the mouse chromosomal coordinates of column 3 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). A mouse-to-human LiftOver of mouse chromosomal coordinates in column 3 was performed in the UCSC Genome Browser as described herein to create the orthologous human chromosomal coordinates that appear in column 5. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 6 shows the sequence number of the expected human PRC2-binding transcript (ie, the human chromosomal coordinates of column 5 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). 50% storage was used for LiftOver analysis. Read alignments have been reported based on the chromosomal strands on which the reads match, regardless of the orientation of the duplicate gene. A single hit on the opposite strand of the reference transcript means that the PRC2-binding RNA is complementary to the reference transcript or is an antisense strand ("reverse strand") in the direction. The mouse PRC2-binding transcript in column 2 shows in column 7 which overlapping refGenes (ie, intersecting genes or near-by genes) are targeted, regardless of orientation.

Table 3: PRC2 interaction transcripts associated with the bivalent domain The bivalent domain of ES cells in the PRC2 transcriptome The intersection with domain). For this analysis, the mm8 coordinates of Mikkelsen et al. (2007) were converted to mm9. Column 1 shows overlapping refGenes (ie, intersecting genes or near-by genes) targeted by the PRC2-binding transcript of column 2, regardless of strand orientation. The chromosomal coordinates of the PRC2-binding transcript (mm9), as well as the "+" sign or "-" indicating whether the PRC2-binding transcript is transcribed from the top strand (plus strand) or from the bottom strand (minus strand). The sign is shown in column 2. Column 3 shows the sequence number of the mouse PRC2-binding RNA (ie, the mouse chromosomal coordinates of column 2 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). A mouse-to-human LiftOver of mouse chromosomal coordinates in column 2 (50% conservation was used for LiftOver analysis) was performed in the UCSC Genome Browser as described herein and is an orthologous gas appearing in column 4. Human chromosome coordinates were created. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 5 shows the expected human PRC2-binding RNA SEQ ID NO: (ie, the human chromosomal coordinates in column 3 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U).

Table 4: PRC2 interaction transcripts associated with the PRC2 binding site The intersection of the PRC2 transcriptome and the known Suz12 binding site in ES cells. The mm8 coordinates of Boyer et al. (2006) were converted to mm9. Column 1 shows overlapping refGenes (ie, intersecting genes or near-by genes) targeted by the PRC2-binding transcript of column 2, regardless of strand orientation. The chromosomal coordinates of the PRC2-binding transcript, as well as the "+" or "-" sign indicating whether the PRC2-binding transcript is transcribed from the top strand (plus strand) or from the bottom strand (minus strand) Shown in 2. Column 3 shows the sequence number of the mouse PRC2-binding transcript (ie, the mouse chromosomal coordinates of column 2 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). A mouse-to-human LiftOver of mouse chromosomal coordinates in column 2 (50% conservation was used for LiftOver analysis) was performed in the UCSC Genome Browser as described herein and is an orthologous gas appearing in column 4. Human chromosome coordinates were created. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 5 shows the sequence number of the expected corresponding human PRC2-binding transcript (ie, the nucleotide sequence transcribed from the human chromosomal coordinates and chromosomal strands of column 4, which is converted to RNA by replacing T with U. ).

Table 5: Long non-coding RNA (lincRNA) domains crossing the PRC2 transcriptome Mouse long non-coding RNA (lincRNA) domains in the PRC2 transcriptome (Guttman et al.,, The intersection with 2009). Since there is no direct Lift Over from mm6 to mm9, the coordinates were converted from mm6 to mm8 and then to mm9. Hits can occur for either strand of the long non-coding RNA (lincRNA) domain. The chromosomal coordinates of the PRC2-binding transcript, as well as the "+" or "-" sign indicating whether the PRC2-binding transcript is transcribed from the top strand (plus strand) or from the bottom strand (minus strand) Shown in 1. Column 2 shows the sequence number of the mouse PRC2-binding RNA (ie, the mouse chromosomal coordinates of column 1 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). A mouse-to-human LiftOver of mouse chromosomal coordinates in column 1 (50% conservation was used for LiftOver analysis) was performed in the UCSC Genome Browser as described herein and is an orthologous gas appearing in column 3. Human chromosome coordinates were created. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 4 shows the sequence number of the expected corresponding human PRC2-binding transcript (ie, the nucleotide sequence transcribed from the human chromosomal coordinates and chromosomal strands of column 3, which is converted to RNA by replacing T with U. ). The overlapping refGenes (ie, intersecting genes or near-by genes) targeted by the mouse PRC2-binding transcript in column 1 are shown in column 5.

Table 6: Hits to the PRC2 transcriptome within the oncogene locus Known cancer loci of the PRC2 transcriptome The intersection with (available online at cbio.mskcc.org/CancerGenes). For this analysis, first merge the cognate and cochromosomal coordinates with the gene of that name in refGene, then refGene the same name of the oncogene without regard to the use of uppercase letters. By intersecting with the name of the gene inside, the human oncogene locus was mapped to mouse coordinates. Column 1 shows the name of the mouse gene corresponding to the human oncogene in column 6 targeted by the PRC2-binding transcript. Mouse Genome Database (MGD) (www.informatics.jax.) In Mouse Genome Informatics at Jackson Laboratory in Bar Harbor, Maine. Obtained the names of the corresponding mouse and human genes from org). Column 1 also indicates the chromosomal strand of the mouse oncogene (the "+" sign indicates that the gene is transcribed from the top or plus strand, and the "-" sign indicates that the gene is transcribed from the bottom or minus strand. Shows). Chromosome and nucleotide coordinates in mm9 of the PRC2-binding transcript, as well as a "+" sign or a "+" sign indicating whether the PRC2-binding transcript is transcribed from the top or bottom strand (minus strand) A "-" sign is shown in column 2. Column 3 shows the sequence number of the mouse PRC2-binding transcript (ie, the mouse chromosomal coordinates of column 2 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). A mouse-to-human LiftOver of mouse chromosomal coordinates in column 2 (50% conservation was used for LiftOver analysis) was performed in the UCSC Genome Browser as described herein and is an orthologous gas appearing in column 4. Human chromosome coordinates were created. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 5 shows the sequence number of the expected corresponding human PRC2-binding transcript (ie, the nucleotide sequence transcribed from the human chromosomal coordinates and chromosomal strands of column 4, which is converted to RNA by replacing T with U. ). Column 6 shows the human refGene name (ie, intersecting gene or near-by gene) of each mouse oncogene targeted by the mouse PRC2-binding transcript of column 2. When the PRC2 binding transcript is on the opposite strand to the refGene, it means that the PRC2 interacting RNA is complementary to the reference oncogene or is an antisense strand ("reverse strand") in the direction. doing. Note that the PRC2 interaction transcript does not necessarily have to be the refGene itself, but a separate transcript that overlaps the refGene in terms of position. With oncogenes

Table 7: Hits to the PRC2 transcriptome within the tumor suppressor locus Known tumor suppressor loci of the PRC2 transcriptome The intersection with (available online at cbio.mskcc.org/CancerGenes). For this analysis, the human tumor suppressor locus was mapped to mouse coordinates in the same way as the oncogenes in Table 6. The table is structured as described in the legend in Table 6. Column 1 shows the mouse tumor suppressor genes corresponding to the human tumor suppressor genes in column 6 targeted by the PRC2-binding transcript. Mouse Genome Database (MGD) (www.informatics.jax.) In Mouse Genome Informatics at Jackson Laboratory in Bar Harbor, Maine. Obtained the names of the corresponding mouse and human genes from org). Column 1 also indicates the chromosomal strand of the mouse tumor suppressor gene (the "+" sign indicates that the gene is transcribed from the top or plus strand, and the "-" sign indicates that the gene is transcribed from the bottom or minus strand. Indicates that). Chromosome and nucleotide coordinates in mm9 of the PRC2-binding transcript, as well as a "+" sign or a "+" sign indicating whether the PRC2-binding transcript is transcribed from the top or bottom strand (minus strand) A "-" sign is shown in column 2. Column 3 shows the sequence number of the mouse PRC2-binding RNA (ie, the mouse chromosomal coordinates of column 2 and the nucleotide sequence transcribed from the chromosomal strand that is converted to RNA by replacing T with U). A mouse-to-human LiftOver of mouse chromosomal coordinates in column 2 (50% conservation was used for LiftOver analysis) was performed in the UCSC Genome Browser as described herein and is an orthologous gas appearing in column 4. Human chromosome coordinates were created. Further human chromosomal coordinates were created by mapping highly conserved or homologous regions from the mouse genome to the human genome. Column 5 shows the sequence number of the expected corresponding human PRC2-binding transcript (ie, the nucleotide sequence transcribed from the human chromosomal coordinates and chromosomal strands of column 4, which is converted to RNA by replacing T with U. ). Column 6 shows the human refGene name (ie, intersecting gene or near-by gene) of each tumor suppressor gene targeted by the mouse PRC2-binding transcript of column 2.

Table 8: Intersection of the PRC2 transcriptome with the target gene of the peak created by superimposing the reads in Appendix I Sequence reads in Appendix I (obtained by sequencing cDNA according to Examples 1-2) represent regions protected from endogenous nucleases during RNA immunoprecipitation and therefore RNA that binds to PRC2. Represents the area of. As mentioned above, Appendix I appears in US Patent Provisional Application No. 61 / 425,174 filed December 20, 2010 and is not attached herein, but is incorporated herein by reference in its entirety. These sequence reads in Appendix I, enriched 3: 1 with WT and null and showing a minimum RPKM value of 0.4, are superposed to give a longer sequence of sequences referred to herein as "peaks". The area is created. The corresponding nucleotide sequence of the mouse peak (converted to RNA by substituting T for U) appears in the Sequence Listing as SEQ ID NO: 21583-124436, or SEQ ID NO: 190717-190933 or SEQ ID NO: 191088. Mouse chromosomal coordinates of these mouse peaks and mouse-to-human LiftOver of chromosomal chains were performed in the UCSC Genome Browser as described herein to generate orthologous human chromosomal coordinates. The corresponding human peak RNA sequences (ie, the nucleotide sequences of human chromosomal coordinates and chromosomal chains that are converted to RNA by substituting T for U) are listed in the sequence listing as SEQ ID NOs: 124437-19716 or SEQ ID NOs: 190934-191086 or Appears as SEQ ID NO: 191087.

To identify genes targeted by PRC2-binding RNA (ie, intersecting genes or near-by genes), known genes from NCBI's refGene database and their peaks in humans and the human PRC2 transcriptome (ie) That is, the human sequences of the PRC2-linked transcripts listed in Tables 1-7) were intersected. Similarly, to identify genes targeted by PRC2-binding RNA (ie, intersecting genes or near-by genes), known genes from NCBI's refGene database and peaks in mice in Tables 1-7. Intersect mouse PRC2 transcriptome.

Columns 1 and 2 show all of (a) human PRC2-binding transcripts, (b) human peak sequences within PRC2-binding RNA, (c) mouse PRC2-binding transcripts, and (d) mouse peak sequences within PRC2-binding RNA. It shows the SEQ ID NOs of the sequences, but they target the NCBI gene shown in column 3 (ie, the intersecting gene or the near-by gene). Column 3 is the name of the NCBI gene and the only NCBI gene ID number (National Center for Biotechnology Information; Chapter 19, Entrez Gene: Gene Directory, www.ncbi.nlm.nih.gov/gene/) Is shown. Human gene names appear in all capital letters, but mouse gene names appear in capital letters only in the first letter.

Column 1 shows the SEQ ID NOs of "same-strand" PRC2-binding RNA transcribed from the same strand as the reference NCBI gene (eg, if the NCBI gene is transcribed from the minus strand of the chromosome, then the PRC2-binding RNA is also from the minus strand. Will be transcribed). Column 2 shows the SEQ ID NOs of "reverse strand" PRC2-binding RNA transcribed from the strand opposite the reference NCBI gene or from the antisense strand. SEQ ID NOs: 1 to 21582, or SEQ ID NOs: 191089 to 192972, represent transcripts, while SEQ ID NOs: 21583 to 191088 represent peaks.

In columns 1 and 2, the degree of overlap between (a) transcript or peak coordinates and (b) NCBI gene coordinates appears in square brackets. Positive numbers represent the number of nucleotides that overlap between the two, and negative numbers represent the size of the gap between the two (ie, the number of nucleotides that are separated between the two). For peaks, the "F" in square brackets indicates that the peak coordinates completely overlap the gene coordinates. For transcripts, the "F" in square brackets indicates that the transcript coordinates completely overlap the genetic coordinates, or vice versa.

Table 9: PRC2-binding RNA categories, genes targeted by RNA, and usage in the treatment of disease Column 1 shows the name and unique gene ID of the NCBI gene. Column 2 is a functional group of genes and a class of diseases, disorders or diseases that are related to these genes and can be treated by regulating their expression. Column 3 is a description of genes derived from NCBI.

Appendix I of US Patent Provisional Application No. 61 / 425,174, filed December 20, 2010, which is incorporated herein by reference in its entirety, is a table of complete RIP-sequencing datasets, the data of which. Shows all the leads in the set. Appendix I is not attached herein. The sequence reads in Appendix I are derived directly from the Illumina GA-II Genome Analyzer and are in the direction of the inverse complementary strand of the PRC2-binding transcript. Appendix I shows a selected subset of all bioinformatics selections after adapter / primer dimer, mitochondrial RNA, rRNA, homopolyma, reads with uncertain nucleotides, and shortened reads (less than 15 nucleotides) have been removed. is there.

Detailed Description The RNA immunoprecipitation (RIP) -sequencing techniques described herein directly or indirectly capture a genome-wide pool of long-stranded transcripts (&gt; 200 nt) that bind to the PRC2 complex. Used. The PRC2 transcriptome described herein is from approximately 10,000 RNA in mouse ES cells, which probably occupy 5-25% of the mouse expressed sequence, depending on the actual size of the entire mouse transcriptome. Become. Transcriptome properties are medically important, including dozens of imprint loci, hundreds of oncogenes and tumor suppressor loci and numerous stem cell-related domains that can be used as biomarkers and therapeutic targets in the future. Identifying the target class. Many, if not all, mouse PRC2-transcriptions have direct counterparts to the human epigenome.

As demonstrated herein, at least a subset of RNA interacts with Polycomb proteins in vivo, and in many cases the interacting subunit is Ezh2. Recent studies have shown that Suz12 also interacts with RNA (Kanhere et al., 2010). The difference between bacterial and baculovirus-produced subunits is that they produce post-transcriptional modifications that have the effect of binding properties. However, a large number of subunits of PRC2 can be regulated by RNA (particularly Ezh2 and Suz12, both having a nucleic acid binding motif), thereby binding between PRC2 subunits, PRC2 binding affinity of chromatin and /. Alternatively, the Ezh2 catalytic rate can be adjusted. This scenario amplifies the number of possible mechanisms by the RNA that controls the polycomb. This study suggests thousands of RNA cofactors for decoy Ezh2 used for RIP-sequencing, especially as part of the PRC2 complex. To the best of our knowledge, Ezh2 is only present in polycomb complexes as a biochemical purification using labeled Ezh2, identifying only polycomb-related polypeptides (Li et al., 2010). Knocking out other subunits of PRC2 results in rapid degradation of Ezh2 (Pasini et al., 2004; Montgomery et al., 2005; Schoeftner et al., 2006).

Both cis and trans mechanisms can be used by the RNA of the PRC2 transcriptome. Although it was assumed that HOTAIR acted trans (Rinn et al., 2007; Gupta et al.), Many antisense transcripts of the transcriptome, such as Tsix, were duplicated or bound in cis. It has been suggested that it may function by directing PRC2 to the coding locus. Here, an example of Gtl2, which is a binding RNA that binds to and targets PRC2 at the Dlk1 locus that directs H3K27 trimethylation in cis, is given.

With the evidence provided herein, RNA cofactors are a common feature of Polycomb regulation, and the inhibitory nucleic acids described herein targeting RNA in the PRC2 transcriptome are likely to inhibit PRC2-related inhibition. It has been demonstrated that gene expression can be successfully regulated upwards. Genes can be regulated in cis either in the orientation of the antisense strand or in the same strand orientation, and when extending more than 1 kb from the arrangement of PRC2-binding RNA. Regulation by RNA does not have to be specific for Polycomb proteins. RIP-sequencing techniques can be used to identify RNA cofactors for other chromatin modifiers, with different cell types having individual transcriptomes consistent with their developmental profile. Chromatin modifiers such as PRC2 play a central role in maintaining stem cell pluripotency, and in cancer, the genome-wide profile of regulatory RNAs will be a valuable aid in seeking diagnosis and treatment of the disease.

RIP-Sequencing, Methods for Generating Long Non-coding RNAs In the present specification, a method for producing a library of lncRNAs will be described. RNA that binds to the Ezh2 portion of the PRC2 complex has been identified using such methods, but contact with other PRC2 subunits or related proteins has not been ruled out. It will be appreciated that in some embodiments, such methods include the steps shown in FIG. 1A and can be replaced by those of ordinary skill in the art.

In some embodiments, the method obtains a sample comprising cell nuclear ribonucleic acid ("nRNA"), eg, a sample containing a nuclear lysate, eg, an nRNA that binds to a nuclear protein, and a sample and material, eg, Includes contact with an antibody that is known to bind to cellular nuclear ribonucleic acid or that specifically binds to a suspected nuclear protein. Ezh2 (Zhao et al., Science. 2008 Oct 31; 322 (5902): 750-6; Khalil et al. , Proc Natl Acad Sci US A. 2009 Jul 14; 106 (28): 11667-72. Epub 2009 Jul 1), G9a (Nagano et al., Science. 2008 Dec 12; 322 (5908): 1717-20. Epub 2008 Nov 6) and Cbx 7 (Yap et al., Mol Cell. 2010 Jun 11; 38 (5): 662-74).

In some embodiments, the method is applied under conditions sufficient to form a complex between the substance and the protein, including some or all of the following: isolation of the complex, to the cDNA. Complementary DNA is synthesized to obtain an initial population of cDNA, PCR amplification using strand-specific primers if necessary, purification of the initial population of cDNA, and cDNA of at least 20 nucleotides (nt) in length. Purified populations are obtained and high-throughput sequencing of the purified cDNA populations is performed. Homopolymer reads are screened and reads that align with the mitochondrial genome and ribosomal RNA are excluded from all of the following analyzes. Homopolymers that retain reads that align to the reference genome with a mismatch of 1 or less and that align to the mitochondrial genome and ribosomal RNA are excluded. The probable PRC2 interacting transcripts are then divided into two criteria: (1) the candidate transcript has the minimum read amount in terms of RPKM (number of reads per kilobase per million reads), and / Or (2) candidate transcripts are increased in wild-type libraries relative to suitable control libraries (eg, proteins-null libraries or libraries made from concurrent IgG pulldowns). Classify based on.

Generally, to construct a RIP-sequencing library, cell nuclei are prepared, treated with deoxyribonucleases, controlled IgG reactions are performed in parallel, and incubated with antibodies directed against chromatin-related factors of interest. The RNA protein complex is then immunoprecipitated using agarose beads, magnetic beads or any other platform in solution or on a solid matrix (eg, column, microfluidic device). Extract RNA using standard techniques. To capture all RNA (not just poly-A RNA) and store strand information, use asymmetric primers to generate cDNA from the RNA template, in this case the first adapter to make the first-strand cDNA (in this case). Adapter 1) contains a random multimer sequence (eg, random hexamer) at the 3'end. Reverse transcriptase is used to make fast strands. A separate second adapter (adapter 2) is used to make the second strand. An example is: Superscript When using II, a non-template CCC 3'overhang can be added and then used to hybridize to a second adapter containing a GGG annealing to the non-template CCC overhang at the 3'end. It can be replaced with other methods of making second strands. The cDNA was then synthesized by PCR using primer pairs specific for adapter 1 and adapter 2 and the products were sequenced by standard methods of high-throughput sequencing. Desired size prior to sequencing, after separation by gel electrophoresis (eg, on a NuSieve agarose gel or acrylamide gel) or other purification method, such as purification on a microfluidic device or standard biochemical column. A size selection step (if desired) can be incorporated to excise RNA or cDNA.

lncRNA and lncRNA libraries The present invention includes a library of individual lncRNAs described herein as well as lncRNAs produced by the methods described herein. In some embodiments, the library is present in solution or lyophilized. In some embodiments, the library is attached to a substrate. For example, in this case, each member of the library is attached to an individual addressable member, eg, an individual region or bead on an array (eg, a microarray). An RNA transcript that is non-coding but interacts with PRC2 is a protein-encoding base if it is a separate transcript that overlaps a protein-encoding reference gene (eg, a gene whose expression is regulated by cis) at the appropriate location. Can contain sequences.

In one embodiment, the lncRNA is a fragment comprising the full length of the lncRNA sequence shown herein, eg, at least 20 nt thereof (eg, at least 25, 30, 35, 40, 50, 50). At least about 85% or more homologous to 60, 70, 80, 90 or 100 nt, eg at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50% or more of full-length lncRNA. Or it contains a nucleotide sequence that is identical. In some embodiments, the nucleotide sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 to the lncRNA sequence shown herein. % Or 100% homologous or identical. In some embodiments, the nucleotide sequence is at least about 85% homologous or identical to the lncRNA sequence described herein, eg, at least about 90%, 91%, 92%, 93%, 94%, 95%. , 96%, 97%, 98%, 99% or 100% homologous or identical, but in more conserved regions such as fragments or repeat A, sequence identity outside the region is low.

Mouse-to-human Lift Over analysis and analysis at the UCSC Genome Browser at synteny positions show the presence of transcripts similar to the human genome. This method and Lift Over strands are generally referred to as Kent et al., Proc. Nat'l Acad. It is described in Sci., 100 (20) 11484-11489 (2003). Considering the geographic and sequence similarity between mouse and human transcripts, a similar number of PRC2-interacting transcripts appear to occur in human systems. For example, the Pvt1 transcripts described below are well conserved in humans. Human PVT1 also occurs near the MYC gene and has a similar expression profile. Human PVT1 is often disrupted in plasmacytoma and can also be disrupted in Burkitt lymphoma. Mouse Gtl2 and Xist are also well conserved in humans (GTL2 / MEG3 and XIST). Therefore, the data suggest that many, if not all, mouse PRC2-transcriptions have a direct counterpart in the human epigenome. Other such direct counterparts are referred to herein as "orthologous".

lncRNAs are not highly conserved at the level of total nucleotide identity but can be functionally conserved. For example, mouse Xist uses a sliding 21 bp window to show overall sequence identity with only 76% or only 60% overall nucleotide identity with human XIST. However, within a particular functional domain, such as Repeat A, the degree of conservation can be greater than 70% between different mammalian species. An important motif of repeat A is the secondary structure formed by repetition. Therefore, lncRNAs that interact with PRC2 may be similarly low in overall conservation, but are nevertheless conserved in secondary structure within a particular domain of RNA, thereby being functional with respect to PRC2 recruitment. Indicates preservation.

Calculations of homology and sequence identity between sequences (these terms are used interchangeably herein) are performed as follows. To determine the percentage of identity between the two nucleic acid sequences, the sequences are aligned for optimal comparison (eg, gaps are introduced into one or both of the first and second amino acids, or of optimal alignment. Nucleic acid sequences and non-homologous sequences can be ignored for comparison). The length of the reference sequence aligned for comparison is at least 80% of the length of the reference sequence and, in some embodiments, at least 90% or 100%. Each nucleotide at the corresponding amino acid position or nucleotide position is then compared. If the position of the first sequence is occupied by the same nucleotides as the corresponding position of the second sequence, then the molecule at that position is identical (the "identity" of the nucleic acids used herein is: Equal to the "homology" of nucleic acids). The percentage of identity between the two sequences is shared by each sequence, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. It is a function of the number of the same position.

For the purposes of the present invention, a blossom 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4 and a frameshift gap penalty of 5 is used to compare sequences and determine the percentage of identity between two sequences. Can be achieved. There are several possible uses of lncRNA described herein in the PRC2 transcriptome: expression of polycomb target genes using the RNA itself or the antago miR and small molecules designed for them ( Can be adjusted either upwards or downwards).

In various related embodiments, including those relating to the targeting of long-chain ncRNAs by LNA molecules, long-chain ncRNAs are longer than 60 nt, eg, longer than 100 nt, eg, longer than 200 nt, and 100 nt in length. It does not have a positive chain open reading frame longer than amino acids, has been identified as lncRNA by experimental evidence, and has known (small) functional RNA classes (ribosomal RNA, transfer RNA and small nuclei / nuclei). Endogenous cellular RNAs that are distinct from, but are not limited to, body RNAs, siRNAs, piRNAs and miRNAs can be included. For example, Lipovich et al., "MacroRNA underdogs in a microRNA world: Evolutionary, regulatory, and biomedical significance of mammalian long non-protein-coding RNA" Biochimica et Biophysica Acta (2010) doi: 10.1016 / j.bbagrm.2010.10.001 ; Ponting et al., Cell 136 (4): 629-641 (2009), Jia et al., RNA 16 (8) (2010) 1478-1487, Dinger et al., Nucleic Acids Res. 37 1685 (2009) D122 -See D126 (Database Issue) and the references cited in them. lncRNA is also called long RNA, macromolecular RNA, macroRNA, intergenic RNA and non-coding transcripts.

The methods described herein can be used to target nuclear localized lncRNAs. As a known class of lncRNA, large molecule intergenic non-coding RNAs (lincRNAs, eg Guttman et al., Nature. 2009 Mar 12; 458 (7235): 223-7. Epub 2009 Feb 1 (this is in mammals). More than 1000 examples of highly conserved non-coding RNAs have been described); and Khalil et al., PNAS 106 (28) 11675-11680 (2009)), promoter-related short RNAs (PASR). , For example, Seila et al., Science. 2008 Dec 19; 322 (5909): 1849-51. Epub 2008 Dec 4; Kanhere et al., Molecular Cell 38, 675-688, (2010)), Endogenous antisense RNA (eg, Numata et al., BMC Genomics. 10: 392 (2009); Okada et al., Hum Mol Genet. 17 (11): 1631-40 (2008); Numata et al., Gene 392 (1-2): 134-141 (2007); and Rossok and Sioud, Nat Biotechnol. 22 (1): 104-8 (2004)) and RNA that binds chromatin modifiers such as PRC2 and LSD1 (eg, Tsai et al., Science. 2010 Aug 6; 329) (5992): 689-93. Epub 2010 Jul 8; and Zhao et al., Science. 2008 Oct 31; 322 (5902): 750-6).

Examples of lncRNAs include XIST, TSIX, MALAT1, RNCR2 and HOTAIR. More than 17,000 long-chain human ncRNA sequences can be found in the NCode Long ncRNA database on the Invitrogen website. Additional long-chain ncRNAs are available, for example, in published bibliographic manuals, the Mouse Function Annotation (FANTOM3) project, the Human Full-Length cDNA Annotation Collaborative Research (H-Invitational) project, mouse and human cDNA and EST databases using computer pipelines. Antisense ncRNA by Zhang et al., Nucl. Acids Res. 35 (suppl 1): D156-D161 (2006); Engstrom et al., PLoS Genet. 2: e47 (2006)), snoRNA-LBME-db Human snoRNA and scaRNA derived from certain RNAz (Washi etl et al. 2005), non-coding RNA search (Torarinsson, et al. It can be identified using 2006) and EvoFold (Pedersen et al. 2006).

Methods of Regulation of Gene Expression To regulate gene expression in cells for gene therapy or epigenetic therapy, such as cancer cells, stem cells or other normal cell types, lncRNAs and lengths described herein are at least 20 nt of its fragments, as well as suppressive nucleic acids and small molecules that target them (eg, complementary to them) can be used. The cells may be in vitro (including ex vivo) or in vivo (eg, in a subject having cancer, eg tumor).

The methods described herein can be used to regulate the expression of oncogenes and cells, such as tumor suppressors in cancer cells. For example, to reduce the expression of oncogenes in cells, the method regulates the oncogenes listed in Table 6, the imprint genes in Table 1 and / or other growth-promoting genes in Table 2, long-chain non-coding. It involves introducing RNA and its PRC2 binding fragment into cells.

As another example, to increase the expression of tumor suppressor factors in cells, the method involves long non-coding RNAs targeting tumor suppressor factors listed in Table 7, imprinted genes in Table 1 and / or Table 2. Introduces into cells a suppressor nucleic acid or small molecule that specifically binds or complements other growth suppressor genes (eg, subjects with cancer, eg Nkx2-1 or Titf-1 in patients with lung adenocarcinoma). Including that. In some embodiments, the method comprises introducing into cells a suppressive nucleic acid that specifically binds or complements a long non-coding RNA targeting the imprint gene listed in Table 1. Nucleic acids that bind "specifically" primarily bind to the target lncRNA or associated lncRNA and inhibit the regulatory function of the lncRNA, but not the function of other non-target RNAs. Thus, the specificity of a nucleic acid interaction refers to its function (eg, inhibition of PRC2-related inhibition of gene expression) rather than its ability to hybridize. Inhibitory nucleic acids can bind non-specifically to other parts of the genome or other mRNAs without interfering with the binding of other regulatory proteins and without causing degradation of non-specifically bound RNA. Therefore, this non-specific binding does not significantly affect the function of other non-target RNAs and does not cause severe adverse effects.

Using these methods, a composition containing a lncRNA (eg, a lncRNA that inhibits a cancer-promoting cancer gene or an imprint gene) (eg, as described herein) or a PRC2-binding fragment thereof and / or a long chain thereof. By administering to a subject an inhibitory nucleic acid that binds to a non-coding RNA (eg, an inhibitory nucleic acid that binds to a tumor suppressor or cancer suppressor imprint gene and / or lncRNA that inhibits other growth suppressor genes in Table 2). , Can treat the nucleic acid of interest. Table 9 shows examples of genes involved in cancer and classification of cancer. Examples of cell proliferation disorders and / or cell differentiation disorders are cancers such as carcinomas, sarcomas, metastatic disorders or hematopoietic neoplastic disorders such as leukemia. Metastatic tumors can arise from a myriad of primary tumor types, including but not limited to those originating from the prostate, colon, lung, breast and liver.

As used herein, treatment means "preventive action" which means reducing or preventing (or reducing the risk of) the onset of disease signs or symptoms of a patient at risk of disease. Includes "therapeutic treatment" which means reducing the signs or symptoms of the disease in a patient diagnosed with the disease, slowing the progression of the disease and reducing the severity of the disease. With respect to cancer, treatment inhibits tumor cell proliferation, increases tumor cell death or lethality, inhibits the rate of tumor cell proliferation or metastasis, reduces tumor size, reduces tumor number, metastases. Includes reducing numbers and increasing 1-year or 5-year survival.

As used herein, the terms "cancer," "hyperproliferation," and "neoplasm" are cells with abnormal conditions or symptoms characterized by the ability to grow autonomously, i.e., a rapid proliferation of cells. Point to. Overgrowth and neoplastic disease states can be classified as pathological, i.e. characterizing or constituting the disease state, or non-pathological, i.e. deviations from normal, but not associated with the disease state. obtain. The term is meant to include all types of cancer growth or oncogene processes, metastatic or malignant transformed cells, tissues or organs, regardless of histopathological type or non-invasive stage. .. "Pathological overgrowth" cells occur in disease states characterized by malignant tumor growth. Examples of non-pathological hyperproliferative cells include proliferation of cells associated with wound repair.

The term "cancer" or "neoplasm" includes malignant tumors of various organ systems, such as those affecting the lungs (eg, small cell cancer, non-small cell cancer, squamous cell carcinoma, adenocarcinoma), breast cancer, thyroid cancer. , Lymphoid, gastrointestinal cancer, urogenital tract cancer, kidney cancer, bladder cancer, liver cancer (eg, hepatocellular carcinoma), pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, uterine cancer, prostate cancer, brain tumor And adenocarcinoma, including malignant tumors, such as most colon cancers, rectal cancers, renal cell cancers, prostate cancers and / or testicular tumors, non-small cell cancers of the lungs, cancers of the small intestines and esophageal cancers.

The term "cancer" is recognized in the art and is malignant of epithelial or endocrine tissues, including respiratory, gastrointestinal, urogenital, testicular, breast, prostate, endocrine and melanoma. Refers to a tumor. In some embodiments, the disease is kidney cancer or melanoma. Examples of cancers are those formed from tissues of the cervix, lungs, prostate, breast, head and neck, colon and ovaries. The term includes cancerous sarcomas and includes, for example, malignant tumors consisting of cancerous and sarcomatous tissues. "Adenocarcinoma" refers to the formation of recognizable glandular structures by cancer or tumor cells derived from glandular tissue.

The term "sarcoma" is recognized in the art and refers to a malignant tumor derived from the mesenchyme. A further example of proliferative disorders is hematopoietic neoplastic disorders. As used herein, the term "hematopoietic neoplastic disorder" includes hyperplastic / neoplastic cells derived from hematopoietic cells, including diseases arising from, for example, bone marrow, lymphocytes or erythrocyte lineages or precursor cells thereof. .. Preferably, the disease results from poorly differentiated acute leukemia, such as erythroblastic leukemia and acute megakaryoblastic leukemia. Further examples of myelogenous disorders include, but are not limited to, acute promyelocytic leukemia (APML), acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML) (Vaickus, L. (1991). ) Crit Rev. in Oncol./Hemotol. (Outlined at 11: 267-97), lymphocytic malignancies include acute lymphoblastic leukemia (ALL), including B-cell ALL and T-cell ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (pre-lymphocytic leukemia) It includes, but is not limited to, PLL), hair cell leukemia (HLL) and Waldenstrem macroglobulinemia (WM). Further forms of malignant lymphoma include non-Hodgkin's lymphoma and its variants, peripheral T-cell lymphoma, adult T-cell leukemia / adult T-cell lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocytic leukemia (LGF), Includes, but is not limited to, Hodgkin's disease and Reedsternberg's disease.

In some embodiments, specific cancers that can be treated using the methods described herein are listed, for example, in Table 6 or 9, and the breast, lung, prostate, central nervous system (eg, glioma). ), Cancer of the salivary gland, prostate, ovary and leukemia (eg, ALL, CML or AML), but not limited to them. The association between these genes and specific cancers is known in the art, eg Futreal et al., Nat Rev Cancer. 2004; 4; 177-83 (incorporated herein by reference, eg, Table). 1); and COSMIC (Somatic Hypermutation Catalog in Cancer) database and website, Bamford et al., Br J Cancer. 2004; 91; 355-8, and Forbes et al. , Curr Protoc Hum Genet. See 2008; Chapter 10; Unit 10.11 and the COSMIC database, eg v.50 (November 30, 2010). For example, a reference to any particular type of cancer in Table 6 or 9 is understood to mean that patients with other types of cancer, i.e. general cancers, can be treated.

In addition, the methods described herein are specific differentiation pathways to regulate (eg, enhance or reduce) stem cell pluripotency and to produce endoderm, mesoderm, ectoderm and developmental derivatives. Can be used to direct stem cells downwards. To increase, maintain or enhance pluripotency, the method comprises introducing into cells a suppressive nucleic acid that specifically binds or complements the long non-coding RNAs listed in Table 3. To reduce the pluripotency of stem cells or enhance their differentiation, the method comprises introducing the long non-coding RNAs listed in Table 3 into the cells. Stem cells useful in the methods described herein are adult stem cells (eg, adult stem cells obtained from a subject, eg, the inner ear, bone marrow, mesenchymal, skin, fat, liver, muscle or blood of the subject being treated); placenta. Or embryonic stem cells or stem cells obtained from the umbilical cord; primordial cells (eg, primordial cells from the inner ear, bone marrow, mesenchymal, skin, fat, liver, muscle or blood); and induced pluripotent stem cells (eg, iPS cells) )including.

In some embodiments, the methods described herein are complementary to the composition, eg, the lncRNA described herein, in Tables 1, 2, 3, 6 or 7 or Table 8. It involves administering a bactericidal composition containing a sex nucleic acid. The inhibitory nucleic acids used to carry out the methods described herein may be antisense RNAs or small interfering RNAs, including but not limited to shRNAs or siRNAs. In some embodiments, the inhibitory nucleic acid is a modified nucleic acid polymer (eg, a locked nucleic acid (LNA) molecule).

Inhibitory nucleic acids have been used as therapeutic components in the treatment of disease states in animals, including humans. Inhibitory nucleic acids can be a useful therapeutic modality that can be configured to be useful in treatment methods for the treatment of cells, tissues and animals, especially humans. As a therapeutic agent, animals suspected of having cancer, preferably humans, are treated by administering lncRNA or inhibitory nucleic acids in accordance with the present invention. For example, in a non-limiting example, the method comprises administering a therapeutically effective amount of lncRNA or inhibitory nucleic acid described herein to an animal in need of treatment.

Suppressive Nucleic Acids Suppressive nucleic acids useful in this method and composition are single-stranded or double-stranded RNA interference (RNAi) such as antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, siRNA compounds. ) Compounds, molecules containing modified bases, locked nucleic acid molecules (LNA molecules), antago miRs, peptide nucleic acid molecules (PNA molecules) and other oligomeric compounds that hybridize to and regulate their function at least part of the target nucleic acid. Includes oligonucleotide mimics. In some embodiments, the inhibitory nucleic acid is antisense RNA, antisense DNA, chimeric antisense oligonucleotide, antisense oligonucleotide containing a modification system, interfering RNA (RNAi), short interfering RNA (siRNA); micro Interfering RNA (miRNA); Small Single Strand RNA (stRNA); or Short Hairpin RNA (shRNA); Small RNA Inducible Gene Activation (RNAa); Small Activated RNA (saRNA) or a combination thereof .. See, for example, International Publication No. WO 2010040112.

In some embodiments, the inhibitory nucleic acid is 10-50, 13-50 or 13-30 nucleotides in length. If you are a person skilled in the art, this is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31. , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length or any range of antisense. It will be appreciated to embody an oligonucleotide with a (complementarity) moiety. It is understood that non-complementary bases can be included in such inhibitory nucleic acids, for example, an inhibitory nucleic acid with a length of 30 nucleotides can have some of the 15 bases that are complementary to the target RNA. To. In some embodiments, the oligonucleotide is 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds of the invention are 12 or 13-30 nucleotides in length. For those skilled in the art, this is an anti, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. It will be appreciated that it embodies inhibitory nucleic acids with a sense (complementarity) moiety.

Preferably, the inhibitory nucleic acid comprises one or more modifications comprising modified sugar moieties and / or modified nucleoside linkages and / or modified nucleotides and / or combinations thereof. Not all positions of a given oligonucleotide need to be uniformly modified, and in fact two or more modifications described herein can be applied within a single-stranded oligonucleotide or a single nucleoside within an oligonucleotide. Can be incorporated.

In some embodiments, the inhibitory nucleic acid is a chimeric oligonucleotide that contains two or more chemically distinct regions, each consisting of at least one nucleotide. These oligonucleotides typically include at least one region of the modified nucleotide that imparts one or more beneficial properties (eg, increased nuclease resistance, increased uptake into cells, increased binding affinity of the target). Contains regions that are substrates for enzymes capable of cleaving RNA: DNA or RNA: RNA hybrids. The chimeric inhibitory nucleic acid of the present invention can be formed as a complex structure of two or more oligonucleotides, modified oligonucleotides, the above oligonucleosides and / or oligonucleotide mimetics. Such compounds are also referred to in the art as hybrids or gunpers. Representative U.S. patents that teach the preparation of such hybrid structures are incorporated herein by reference, U.S. Pat. Nos. 5013830, 5149797, 5220007, 5256775, and 5256775. It includes, but is not limited to, No. 5366878, No. 5403711, No. 5491133, No. 5565350, No. 5623565, No. 5652355, No. 5652356 and No. 5700922.

In some embodiments, the inhibitory nucleic acid is at least one nucleotide modified at the 2'position of the sugar, most preferably 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-. Includes fluoro-modified nucleotides. In another preferred embodiment, the RNA modification is a 2'-fluoro, 2'-amino and 2'O-methyl modification on the ribose of pyrimidine, a non-basic residue or inverted base at the 3'end of the RNA. Including. Such modifications are routinely incorporated into oligonucleotides, which have a higher Tm (ie, higher target binding affinity) than 2'-deoxy oligonucleotides for a given target. It is shown.

Many nucleotides and nucleoside modifications make the oligonucleotides into which they are incorporated more resistant to nuclease digestion compared to native oligonucleotides, and these modified oligonucleotides are longer intact than unmodified oligonucleotides. It has been shown to remain. Specific examples of modified oligonucleotides include modified scaffolds, such as phosphorothioates, phosphotriesters, methylphosphonic acids, short-chain alkyl or cycloalkyl intersaccharide bonds or short-chain heteroatom or heterocyclic sugar bonds. Most preferred are oligonucleotides with a phosphorothioate skeleton and those with a heteroatomic skeleton, particularly known as CH2-NH-O-CH2, CH, ~ N (CH3) ~ O ~ CH2 (methylene (methylimino) or MMI skeletons). ), CH2--O--N (CH3) -CH2, CH2-N (CH3) -N (CH3) -CH2 and ON (CH3) -CH2-CH2 skeletons, where natural phospho The diester skeleton is represented as OP--O-CH); the amide skeleton (De Mesmaeker et al. Ace. Chem. Res. 1995, 28: 366-374); Morphorino skeleton structure (see Summerton and Weller, US Pat. No. 5,034,506); Peptide nucleic acid (PNA) skeleton (where the phosphodiester skeleton of the oligonucleotide is polyamide Replaced by the skeleton, nucleotides bind directly or indirectly to the aza-nitrogen atom of the polyamide skeleton, Nielsen et al., Science 1991, 254, See 1497). Phosphorus-containing bonds include phosphorothioates with normal 3'-5'bonds, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyls and other alkyls including 3'alkylene phosphonates and chiralphosphonates. Phosphonate, phosphinate, phosphoramidate including 3'-aminophosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkyl phosphate triester, and borano Phosphonates, these 2'-5'binding analogs, and adjacent pairs of nucleoside units bind to 3'-5'to 5'-3'or 2'-5'to 5'-2', reversed. Includes, but is not limited to, those having polarity. U.S. Pat. Nos. 3687808, 4469863, 4476301, 5023243, 5177196, 5188897, 5264423, 5276019, 5278302, 5286717. , 5321131, 5399676, 5405939, 5453496, 5455233, 5466677, 5476925, 5519126, 5536821, 5541306 , 5550111, 5563253, 5571799, 5587361 and 5652050.

Morpholine oligomeric compounds include Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41 (14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and 1991. It is described in US Pat. No. 5,034,506 issued on June 23, 2014. In some embodiments, the morpholino-based oligomeric compounds are phosphorodiamidate morpholino oligomers (PMOs) (eg, their disclosures are incorporated herein by reference in their entirety, Iverson, Curr. Opin. Mol. Ther. ., 3: 235-238, 2001; and Wang et al., J. Gene Med., 12: 354-364, 2010).

Cyclohexenyl nucleic acid oligonucleotide mimetics are Wang et al., J. Am. Chem. Soc., 2000, 122, It is described in 8595-8602. The phosphorus atom-free modified oligonucleotide skeleton is formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatom or heterocyclic nucleoside bonds. Has a skeleton. These are morpholino bonds (partially formed from the sugar moiety of nucleoside), siloxane skeletons, sulfides, sulfoxides and sulfone skeletons, form acetyl and thioform acetyl skeletons, methyleneform acetyl and thioform acetyl skeletons, alkene-containing skeletons, sulfamines. Includes acid skeletons, methyleneimino and methylenehydrazino skeletons, sulfonate and sulfonamide skeletons, amide skeletons and others with mixed N, O, S and CH2 component moieties. U.S. Pat. Nos. 5034506, 5166315, 5185444, 5214134, 5216141, 5235033, 5264562, 5264564, respectively, which are incorporated herein by reference. No. 5,405938, No. 5434257, No. 5466677, No. 5470967, No. 5489677, No. 5541307, No. 5561225, No. 5596086, No. 5602240, No. 5610289 See No. 5602240, No. 5680466, No. 5610289, No. 5618704, No. 5623070, No. 5663312, No. 5633360, No. 5677437 and No. 5677439. ..

Modified oligonucleotides are also known to include arabinonucleotides or modified arabinonucleotide residue systems or oligonucleotides composed of them. Arabinonucleosides are stereoisomers of ribonucleosides and differ only in the 3'structure of the sugar ring. In some embodiments, the 2'-arabino modifier is 2'-F arabino. In some embodiments, the modified oligonucleotide is a 2'-fluoro-D-arabinonucleic acid (FANA) (eg, these disclosures are incorporated herein by reference in their entirety, Lon et al., Biochem. ., 41: 3457-3467, 2002 and Min et al., Bioorg. Med. Chem. Lett., 12: 2651-2654, 2002.). Similar modifications can be made to other positions of the sugar, especially to the 3'- or 2'-5'binding oligonucleotides of the sugar at the 3'-terminal nucleoside and to the 5'-position of the 5'-terminal nucleotide.

PCT WO99 / 67378 discloses arabinonucleic acid (ANA) oligomers and analogs thereof that enhance sequence-specific inhibition of gene expression through association with complementary messenger RNA. Other preferred modifications include ethylene bridged nucleic acids (ENA) (eg, their disclosures are incorporated herein by reference in their entirety, WO 2005/042777, Morita et al., Nucleic Acid Res. ., Suppl 1: 241-242, 2001; Surono et al., Hum. Gene Ther., 15: 749-757, 2004; Koizumi, Curr. Opin. Mol. Ther., 8: 144-149, 2006 and Horie et al., Nucleic Acids Symp. Ser (Oxf), 49: 171-172, 2005). Preferred ENAs include, but are not limited to, 2'-O, 4'-C-ethylene-bridged nucleic acids.

Examples of LNAs are described in WO / 2008/043753 and include compounds of the formula:<chemistry num="3"><img file="JP6577611B2_D0004.tif" /></chemistry>In the equation, X and Y are independently -O-, -S-, -N (H)-, N (R)-, -CH2- or -CH- (if part of a double bond). , -CH2-O-, -CH2-S-, -CH2-N (H)-, -CH2-N (R)-, -CH2-CH2- or -CH2-CH- (as part of a double bond (If any), selected from the group consisting of -CH = CH-, R selected from hydrogen and C1-4 alkyl, Z and Z * independently selected from internucleoside bonds, end groups or protecting groups, B Consists of natural or unnatural nucleotide base moieties, and asymmetric groups can be found in either orientation.

Preferably, the LNA used in the oligomers of the invention comprises at least one LNA unit in any of the following formulas.<chemistry num="4"><img file="JP6577611B2_D0005.tif" /></chemistry>In the formula, Y is -O-, -S-, -NH- or N (RH), Z and Z * are independently selected from nucleoside linkages, terminal groups or protecting groups, and B is natural or non-natural or non-natural. Constituting a natural nucleotide base moiety, RH is selected from hydrogen and C1-4 alkyl.

Preferably, the locked nucleic acid (LNA) used in oligomeric compounds such as antisense oligonucleotides of the present invention is a locked nucleic acid (LNA) unit in any of the formulas shown in Scheme 2 of PCT application DK2006 / 000512. Contains at least one nucleotide.

Preferably, the LNAs used in the oligomers of the invention are -0-P (O) 2-O-, -OP (O, S) -O-, -0-P (S) 2-O-,-. SP (O) 2-O-, -SP (O, S) -O-, -SP (S) 2-O-, -0-P (O) 2-S-, -OP (O, S)- S-, -SP (O) 2-S-, -O-PO (RH) -O-, O-PO (OCH3) -O-, -O-PO (NRH) -O-, -O-PO ( OCH2CH2S-R) -O-, -O-PO (BH3) -O-, -O-PO (NHRH) -O-, -OP (O) 2-NRH-, -NRH-P (O) 2-O Includes internucleoside bonds selected from-, -NRH-CO-O-, in which RH is selected from hydrogen and C1-4 alkyl.

A particularly preferred LNA unit is shown in Scheme 2.<chemistry num="5"><img file="JP6577611B2_D0006.tif" /></chemistry> Scheme 2

The term "thio-LNA" comprises a locked nucleotide in which at least one of the above general formulas X or Y is selected from S or -CH2-S-. Thio-LNA can be both β-D and α-L-three structures. The term "amino-LNA" means that at least one of X or Y in the above general formula is -N (H)-, N (R)-, CH2-N (H)-and -CH2-N (R). )-Contains locked nucleotides selected from-in the formula, R is selected from hydrogen and C1-4 alkyl. Amino-LNA can be both β-D and α-L-three structures. The term "oxy-LNA" comprises a locked nucleotide in which at least one of X or Y in the above general formula represents -O- or -CH2-O-. Oxy-LNA can be both β-D and α-L-three structures.

The term "ena-LNA" includes locked nucleotides in which Y in the above general formula is -CH2-O- (in the formula, the oxygen atom of -CH2-O- is at the 2'position with respect to base B. Join). The LNA is further described in detail below. One or more substituted sugar moieties can include, for example, one of the following in the 2'position: OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O (CH2) nCH3, O (CH2) nNH2 or O ( CH2) nCH3, in the formula, n is 1 to about 10, Ci to C10 lower alkyl, alkoxyalkyl, substituted lower alkyl, alkaline or aralkyl, Cl, Br, CN, CF3, OCF3, O-, S- or N-alkyl, O-, S- or N-alkoxy, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkalyl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, Reporter groups, alkoxylators, groups that improve the pharmacodynamic properties of oligonucleotides or groups that improve the pharmacodynamic properties of oligonucleotides and other substituents with similar properties. Preferred modifications are 2'-methoxyethoxy [2'-0-CH2CH2OCH3 (also known as 2'-O- (2-methoxyethyl))] (Martin et al, HeIv. Chim. Includes Acta, 1995, 78, 486). Other preferred modifications include 2'-methoxy (2'-0-CH3), 2'-propoxy (2'-OCH2CH2CH3) and 2'-fluoro (2'-F). Similar modifications can be made at other positions of the oligonucleotide, especially at the 3'position of the sugar on the 3'end nucleotide and the 5'position of the 5'end nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl instead of the pentoflanosyl group.

Inhibitory nucleic acids may also contain additional or alternative nucleobase (often referred to simply as "bases" in the art) modifications or substitutions. The "unmodified" or "natural" nucleobases used herein include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases are nucleobases found only rarely or temporarily in natural nucleic acids, such as hypoxanthin, 6-methyladenine, 5-Me pyrimidines, especially 5-methylcytosine (5-methyl-2'deoxy). Also called citidine, often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, isositosine, pseudoisositosine and synthetic nucleobases such as , 2-Amino Adenine, 2- (Methylamino) Adenine, 2- (Imidazolylalkyl) Adenine, 2- (Aminoalkylamino) Adenine or Other Heterosubstituted Alky Adenines, 2-Thiouracil, 2-Thiothymin, 5-Bromouracil , 5-Hydroxymethyluracil, 5-propynyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 6-aminopurine, 2-aminopurine, 2-chloro-6-aminopurine and 2, Contains 6-diaminopurine or other diaminopurines. See, for example, Kornberg, "DNA Replication," WH Freeman &amp; Co., San Francisco, 1980, pp75-77; and Gebeyehu, G., et al. Nucl. Acids Res., 15:4513 (1987). It can also include "universal" bases known in the art, such as inosine. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 &lt;0&gt; C (Sanghvi, in Crooke,

Not all given oligonucleotides need to be uniformly modified at position, and in effect two or more of the modifications described herein are in a single oligonucleotide, or within a single nucleoside within an oligonucleotide. Can even be incorporated into. In some embodiments, the nucleotide unit, the sugar-nucleoside bond, is both, i.e. the skeleton is replaced by a novel group. Base units are maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound, which is an oligonucleotide mimic that has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide is replaced with an amide-containing backbone, eg, an aminoethylglycine backbone. The nucleobase is retained and directly or indirectly binds to the aza-nitrogen atom of the amide moiety of the backbone. Representative US patents teaching the preparation of PNA compounds include, but are not limited to, US Pat. Nos. 5539082, 5714331 and 5791262, each of which is incorporated herein by reference. In addition, teachings of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.

Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art as simply "bases") modifications or substitutions. The "unmodified" or "natural" nucleobases used herein are the purine bases adenine (A), guanine (G), the pyrimidine bases thymine (T), cytosine (C) and uracil (U). including. Modified nucleobases are 6- of other synthetic and naturally occurring nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthin, hypoxanthin, 2-aminoadenine, adenine and guanine. Methyl and other alkyl derivatives, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and citocin, 6-azouracil, cytosine And timine, 5-uracil (psoid uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-halo. Bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanin and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine Including.

In addition, nucleobases are those disclosed in US Pat. No. 3687808, "The Concise Encyclopedia of Polymer Science And Engineering", pages 858-859, Kroschwitz, ed. John Wiley &amp; Sons, 1990, Englisch et al., Angewandle Chemie, International Edition, 1991, 30, page 613 and Sanghvi, Chapter 15, Antisense Research and Applications, "pages. Includes those disclosed by 289- 302, Crooke, and Lebleu, eds., CRC Press, 1993. Certain of these nucleobases are particularly of the binding affinity of the oligomeric compounds of the invention. Useful for augmentation. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, 2-aminopropyladenine, 5-propynyluracil and 5-propynylcitosine. 5-Methylcytosine substitutions have been shown to increase the double-stranded stability of the nucleic acid by 0.6-1.2 &lt;0&gt; C (Sanghvi, et al.,, eds, "Antisense Research and Applications," CRC Press, Boca Raton, 1993, pp. 276-278), now, and more specifically, preferred base substitutions when combined with a 2'-O-methoxyethyl sugar modification. It is a thing. The modified nucleobases are incorporated herein by reference in U.S. Pat. Nos. 3687808 and 4845205, 5130302, 5134066, 5175273, 5376066, 5432272. No. 5457187, No. 5459255, No. 5484908, No. 5502177, No. 5525711, No. 5552540, No. 5587469, No. 5596901, No. 5614617, No. 5750692. No. and No. 5689141.

In some embodiments, inhibitory nucleic acids chemically bind to one or more moieties or complexes that enhance oligonucleotide activity, cell distribution, or cell uptake. For example, one or more inhibitory nucleic acids of the same or different types can be complexed with each other, or inhibitory nucleic acids are complexed with targeted moieties with enhanced specificity of cell or tissue types. Can be embodied.

Such parts are lipid parts such as cholesterol parts (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556) and cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al, Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993. , 75, 49- 54), Phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphate (Manoharan et al., Tetrahedron Lett) ., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamines or polyethylene glycol chains (Mancharan et al., Nucleosides &amp; Nucleotides, 1995, 14, 969-973) or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995) , 36, 3651-3654), palmitic acid moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or octadecylamine or hexylamino-carbonyl-t-oxycholesterol moiety (Crooke et al. , J. Pharmacol. Exp. Ther., 1996, 277, 923-937), but not limited to them. In addition, U.S. Pat. Nos. 4828979, 4948882, 5218105, 5525465, 5541313, 5545730, 5552538, and 5552538, each incorporated herein by reference. No. 5578717, No. 5580731, No. 5580731, No. 5591584, No. 5109124, No. 5118802, No. 5138045, No. 5414077, No. 5486603, No. 5512439, No. No. 5578718, No. 5608046, No. 4587044, No. 4605735, No. 4667025, No. 4762779, No. 4789737, No. 4824941, No. 4835263, No. 4876335, No. No. 4904582, No. 4958013, No. 5082830, No. 5112963, No. 5214136, No. 5082830, No. 5112963, No. 5214136, No. 5245022, No. 5254469, No. No. 5258506, No. 5262536, No. 5272250, No. 5292873, No. 5317098, No. 5371241, No. 5391723, No. 5416203, No. 5451463, No. 5510475, No. No. 5512667, No. 5514785, No. 5565552, No. 5567810, No. 5574142, No. 5558481, No. 5587371, No. 5595726, No. 5597696, No. 5599923, No. See No. 5599928 and No. 5689491.

These moieties or complexes can include linking groups that covalently bond with functional groups such as primary or secondary hydroxyl groups. The binding groups of the present invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers and groups that enhance the pharmacodynamic properties of oligomers. Typical binding groups include cholesterol, lipids, phospholipids, biotin, phenazine, iodide, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin and dyes. In the context of the present invention, groups that enhance pharmacodynamic properties include groups that improve uptake of target nucleic acids, enhance resistance to degradation, and / or enhance sequence-specific hybridization. In the context of the present invention, groups that enhance pharmacokinetic properties include groups that improve the uptake, distribution, metabolism or excretion of compounds of the invention. Representative binding groups are disclosed in International Patent Application No. PCT / US92 / 09196 and US Pat. No. 6,287,860, filed October 23, 1992, which are incorporated herein by reference.

It includes, but is not limited to, 2-di-O-hexadecyl-rac-glycero-3-H-phosphate, polyamines or polyethylene glycol chains or adamantane acetate, palmicyl moieties or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties. For example, U.S. Pat. Nos. 4828979, 4948882, 5218105, 5525465, 5541313, 5545730, 5552538, 5578717, 5580731, 5580731, 5580731, 5591584, 5109124, 5118802, 5138045, 5414077, 5486603, 5512439, 5578718, 5608046, 568046 4587044, 4605735, 4667025, 4762779, 4789737, 4824941, 4835263, 4876335, 4904582, 4958013, 4958013 5082830, 5112963, 5214136, 5082830, 5112963, 5214136, 5245022, 5254469, 5258506, 5262536, 5262536 5272250, 5292873, 5317098, 5317241, 5391723, 5416203, 5451463, 5510475, 5512667, 5514785, 5514785 See 5565552, 5567810, 5574142, 5558481, 5587371, 5595726, 5597696, 5599923, 5599928 and 5689491. ..

The inhibitory nucleic acids useful in this method are sufficiently complementary to the target lncRNA, eg, hybridize well to obtain the desired effect and have sufficient biological sensory specificity. "Complementary" is paired via base stacking and specific hydrogen bonding between two sequences containing naturally or non-naturally occurring (eg, modified as described above) bases (nucleosides) or analogs thereof. Refers to the ability to do. For example, if a base at one position of an inhibitory nucleic acid can hydrogen bond to a base at the corresponding position in the lncRNA, the bases are considered complementary to each other at that position. No need for 100% complementarity. As mentioned above, inhibitory nucleic acids can include universal bases or inert non-basic spacers that do not contribute positively or negatively to hydrogen bonds. Base pairing can include both normative Watson-Crick base pairing and non-Watson-Crick base pairing (eg, wobble base pairing and Hoogsteen base pairing). For complementary base pairing, adenosine-type base (A) is complementary to thymidine-type base (T) or uracil-type base (U), and cytosine-type base (C) is complementary to guanosine-type base (G). It is understood that universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize to any A, C, U or T and are considered to be complementary. Nichols et al., Nature, 1994; 369: 492-493 and Loakes et al., Nucleic Acids Res., 1994; 22: 4039-4043. Inosine (I) is also considered to be a universal base in the art and is considered to be complementary to any A, C, U or T. See Watkins and Santa Lucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.

In some embodiments, the location of the target lncRNA to which the inhibitory nucleic acid hybridizes is defined as the target region to which the protein binding partner binds. These regions can be identified by summarizing the data submitted in Appendix I and identifying the enhanced regions in the dataset, and these regions are likely to contain protein binding sequences. The identification of such a region, called the peak, is described in Example 8 below. Routine methods can be used to design inhibitory nucleic acids that bind to this sequence with sufficient specificity. In some embodiments, the method uses bioinformatics methods known in the art to identify secondary structures, such as regions of one or more stem-loop structures or pseudo-knots, and inhibitory nucleic acids. It involves selecting these regions to be targeted using.

Specific sequences of specific exemplary target segments are described herein, but those skilled in the art will serve to help illustrate and describe specific embodiments within the scope of the invention. You will recognize that you are doing it. Further target segments can be readily identified by one of ordinary skill in the art in view of the present disclosure. A target segment with a length of 5 to 500 nucleotides, including an extension of at least 5 contiguous nucleotides within the protein binding region, or immediately adjacent to it, is considered well suited for the target. The target segment can contain a sequence containing at least 5 contiguous nucleotides from one 5'end of the protein binding region (the remaining nucleotides are initiated just upstream of the 5'end of the binding segment and the inhibitory nucleic acid is about. Continuously extend the same RNA that lasts until it contains 5 to about 100 nucleotides). Similarly, a preferred target segment is represented by an RNA sequence containing at least 5 contiguous nucleotides from the 3'end of one of the preferred target segments as described below (the remaining nucleotides are just downstream of the 3'end of the target segment. The same lncRNA that begins with and continues until the inhibitory nucleic acid contains about 5 to about 100 nucleotides is continuously extended). Those skilled in the art using the sequences listed herein will be able to identify more preferred protein binding regions to target with complementary inhibitory nucleic acids without undue experimentation.

In the context of the present disclosure, hybridization means base stacking and hydrogen bonding, which can be Watson-click, Hoogsteen or inverse Hoogsteen hydrogen bonds between complementary nucleosides or nucleotide bases. For example, adenine and thymine are complementary nucleobases that are paired through the formation of hydrogen bonds. As used in the art, complementary refers to the ability to pair exactly between two nucleotides. For example, if a nucleotide at a particular position in an oligonucleotide can hydrogen bond to a nucleotide at the same position in the lncRNA molecule, the inhibitory nucleic acid and lncRNA are considered complementary to each other at that position. Inhibitory nucleic acids and lncRNAs are complementary to each other if the corresponding positions of each molecule occupy a sufficient number by nucleotides that can hydrogen bond to each other via a base. Therefore, "specifically hybridize" and "complementary" are meant to indicate a sufficient degree of complementarity or exact pairing, such as stable specific binding between inhibitory nucleic acids and lncRNA targets. The term used. For example, if a base at a position in an inhibitory nucleic acid can hydrogen bond with a base at the corresponding lncRNA position, the bases are considered to be complementary to each other at that position. No need for 100% complementarity.

It is understood in the art that the complementary nucleic acid sequence does not have to be 100% complementary to that of the target nucleic acid to which it specifically hybridizes. Complementary nucleic acid sequences of interest in this method are such that binding of a sequence to a target lncRNA molecule interferes with the normal functioning of the target lncRNA, resulting in loss of activity (eg, PRC2-related inhibition is inhibited, resulting in inhibition. , Gene expression is upregulated) and conditions where non-specific binding avoidance is desired, eg, in vivo assays or therapeutic procedures and in vitro assays. If the assay is performed under appropriate stringency conditions under the physiological conditions of the case, it will be sufficiently complementary to avoid non-specific binding of the sequence to the non-target lncRNA sequence. For example, stringent salt concentrations are typically less than about 750 mM NaCl and 75 mM trisodium citrate, preferably about 500 mM NaCl and 50 mM less than trisodium citrate and more preferably about 250 mM. It will be less than NaCl and 25 mM trisodium citrate. Hybridization of low stringents can be obtained in the absence of organic solvents such as formamide, while hybridization of high stringents is in the presence of at least about 35% formamide and more preferably about 50% formamide. Obtainable. Stringent temperature conditions will typically include at least 30 ° C, more preferably at least about 37 ° C and most preferably at least about 42 ° C. Various additional parameters such as hybridization time, detergent concentration, eg sodium dodecyl sulfate (SDS) and carrier DNA selection or exclusion are known to those of skill in the art. Different stringent levels are achieved by combining these various conditions as needed. In a preferred embodiment, hybridization occurs at 30 ° C with 750 mM NaCl, 75 mM trisodium citrate and 1% SDS. In a more preferred embodiment, hybridization is 500 mM at 37 ° C. Occurs in NaCl, 50 mM trisodium citrate and 1% SDS, 35% formamide and 100 μg / ml denatured salmon sperm DNA (ssDNA). In the most preferred embodiment, hybridization occurs at 42 ° C with 250 mM NaCl, 25 mM trisodium citrate and 1% SDS, 50% formamide and 200 μg / ml ssDNA. Variations useful for these conditions will be readily apparent to those of skill in the art.

In most applications, the washing steps following hybridization will also vary in degree of stringent. Wash stringent conditions can be defined by salt concentration and temperature. As mentioned above, the degree of wash stringent can be increased by decreasing salt concentration or by increasing temperature. For example, the stringent salt concentration of the washing step is preferably less than about 30 mM NaCl and 3 mM trisodium citrate, most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. The stringent temperature conditions of the washing step usually include at least about 25 ° C, more preferably at least 42 ° C and even more preferably at least about 68 ° C. In a preferred embodiment, the washing step occurs at 25 ° C with 30 mM NaCl, 3 mM trisodium citrate and 0.1% SDS. In a more preferred embodiment, the wash step occurs at 42 ° C with 15 mM NaCl, 1.5 mM trisodium citrate and 0.1% SDS. In a more preferred embodiment, the cleaning step is 15 mM at 68 ° C. It occurs with NaCl, 1.5 mM trisodium citrate and 0.1% SDS. Further variations in these conditions will be readily apparent to those skilled in the art. Hybridization techniques are known to those of skill in the art, such as Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72: 3961, 1975); Ausubel et al. .. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Described in Harbor Laboratory Press, New York.

In general, inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to the target region within the target nucleic acid, eg, 90%, 95% or 100% sequence complementarity to the target region within the lncRNA. Has. For example, 18 of the 20 nucleobases of an antisense oligonucleotide are complementary, and therefore antisense compounds that will specifically hybridize to the target region represent 90% complementarity. The% complementarity of inhibitory nucleic acids with regions of target nucleic acids can be routinely determined using a basic local alignment search tool (BLAST program) (Altschul et al., J. Mol. Biol). ., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The antisense and other compounds of the invention that hybridize to lncRNA are identified through routine experiments. In general, inhibitory nucleic acids need to either retain the specificity of the target, i.e., do not directly bind to transcripts other than the target of interest, or have no direct significant effect on their expression levels. is there.

Target-specific effects with corresponding target-specific functional biological effects are possible even when inhibitory nucleic acids exhibit non-specific binding to many non-target RNAs. For example, a short-chain 8-base long-chain inhibitory nucleic acid that is completely complementary to lncRNA can have multiple 100% matches for hundreds of sequences in the genome, but nonetheless, target-specific effects. For example, upregulation of a particular target gene can occur through inhibition of PRC2 activity. Eight-base inhibitory nucleic acids have been reported to prevent exon skipping with a high degree of specificity and reduced off-target effects. See Singh et al., RNA Biol., 2009; 6 (3): 341-350. Eight-base inhibitory nucleic acids have been reported to interfere with miRNA activity without significant off-target effects. See Obad et al., Nature Genetics, 2011; 43: 371-378.

For further disclosure of inhibitory nucleic acids, see U.S. Pat. No. 2010/0317718 (Antisense Oligo); U.S. Pat. No. 2010/0249052 (Double-stranded Ribonucleic Acid (dsRNA)); U.S. Pat. No. 2009/0181914 and U.S.A. Patent No. 2010/0234451 (LNA molecule); US Pat. No. 2007/0191294 (siRNA analog); US Pat. No. 2008/0249039 (modified siRNA); and WO 2010/129746 and WO 2010/129746. See 2010/040112 (suppressive nucleic acid).

Antisense In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide. Antisense oligonucleotides are designed to block the expression of DNA or RNA targets by binding to the target and arresting expression, typically at the level of transcription, translation or splicing. The antisense oligonucleotide of the present invention is a complementary nucleic acid sequence designed to hybridize to lncRNA in vitro under stringent conditions and is expected to inhibit the activity of PRC2 in vivo. Thus, oligonucleotides are selected that are sufficiently complementary to the target, i.e., well hybridized, have sufficient biological and functional specificity, and provide the desired effect.

Modified Bases Containing Locked Nucleic Acids (LNAs) In some embodiments, inhibitory nucleic acids used in the methods described herein comprise one or more modified bonds or bases. Modified bases include phosphorothioates, methylphosphonates, peptide nucleic acids or locked nucleic acids (LNAs). Preferably, the modified nucleotide is part of a locked nucleic acid molecule containing [α] -L-LNA. The LNA contains a ribonucleic acid analog, where the ribose ring is a methylene bridge between 2'oxygen and 4'carbon, ie an oligonucleotide containing at least one LNA monomer, ie one 2'. It is "locked" by -O, 4'-C-methylene-β-D-ribofuranosyl nucleotides. LNA bases form standard Watson-click base pairs, but locked conformation increases the rate and stability of base pairing reactions (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). LNA also has an increased affinity for RNA base pairs when compared to DNA. These properties provide antisense oligos that target fluorescence in situ hybridization (FISH) and comparative genomic hybridization as probes, miRNA knockdown tools, and mRNA or other RNAs, such as lncRNAs described herein. As a nucleotide, LNA is particularly useful.

Modified base / LNA molecules are 10-30 in each chain, eg 12-24, eg 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, It can contain molecules containing 26, 27, 28, 29 or 30 nucleotides, where one of the strands is substantially identical to the target region of the lncRNA, eg at least 80% (or more, eg 85%, 90). %, 95% or 100%) are identical and have, for example, 3, 2, 1 or 0 mismatched nucleotides. Modified base / LNA molecules can be chemically synthesized using methods known in the art.

Modified base / LNA molecules can be designed using any method known in the art, and many algorithms are known and commercially available (eg, on the internet, eg exiqon.com). At). For example, You et al., Nuc. Acids. Res. 34: e60 (2006); McTigue et al., Biochemistry 43: 5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34: See e142 (2006). For example, a "gene walk" method similar to that used to design antisense oligos can be used to optimize the inhibitory activity of modified base / LNA molecules, eg, over the length of the target lncRNA. After preparing a series of oligonucleotides, 10-30 nucleotides, the activity can be tested. Optionally, a gap of, for example, 5-10 nucleotides or more can be left between the LNAs to reduce the number of synthetic and test oligonucleotides. The amount of GC is preferably about 30 to 60%. General guidelines for designing modified base / LNA molecules are known in the art, for example, the LNA sequence binds very closely to other LNA sequences, resulting in significant complementarity within the LNA molecule. It is preferable to avoid. Adjacent placement of 3 or more G or C or 4 or more LNA residues should be avoided when possible (eg, not possible with very short (eg about 9-10 nt) oligonucleotides). Is. In some embodiments, the LNA is xyllo-LNA.

In some embodiments, the modified base / LNA molecule can be designed to target a specific region of the lncRNA. For example, a specific functional region, such as a region containing a known RNA localization motif (ie, a region complementary to the target nucleic acid on which lncRNA acts) or a region containing a known protein binding region, such as a polycomb (eg, H3K27 methylase). Polycomb suppression complex 2 (PRC2) consisting of EZH2, SUZ12 and EED) or LSD1 / CoREST / REST complex binding region (eg Tsai et al., Science. 2010 Aug 6; 329 (5992): 689-93. Epub 2010 Jul 8; and Zhao et al., Science. 2008 Oct 31; 322 (5902): 750-6) can be targeted. Sarma et al., "Locked nucleic acids (LNAs) reveal sequence requirements and kinetics of Xist RNA localization to the X chromosome." PNAS, pre-print publication, December 6, 2010, doi: 10.1073 / pnas.1009785107. Alternatively, or in addition, target highly conserved regions that are identified by aligning sequences from different species, such as primates (eg, humans) and rodents (eg, mice). It is possible to search for a region having a high degree of identity. Identity% Basic Local Alignment Search Tool (BLAST Program) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) can be used to make routine decisions, for example using default parameters.

For more information on LNA molecules, see US Pat. Nos. 6268490, 6734291, 6770748, 6794499, 7034133, 7053207, 7060809, 7084125 and more. No. 7572582 and U.S. Patent Grant Nos. 20100267018, 20100261175 and 20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 ( 1998); Jepsen et al., Oligonucleotides 14: 130-146 (2004); Kauppinen et al., Drug Disc. Today 2 (3): 287-290 (2005); and Ponting et al., Cell 136 (4) See: 629-641 (2009) and the references cited therein.

In a related aspect, the present disclosure describes the ability of LNA molecules to remove cell-nucleus long-stranded ncRNAs with fast cis action (eg, RNAs from chromosomes from 2, 5, 10 seconds to 60 minutes described herein). / PRC2 dissociation), a property that allows modification and testing of the function of long-stranded ncRNAs in previously impossible ways. 17kb Xist as a model Using RNA, we have shown that LNA molecules designed to specifically target transcripts lead to very rapid elimination of RNA from the inactive X chromosome. Interestingly, RNA was removed, but transcript stability was unaffected. By targeting different Xist regions, it is possible to identify localized domains and show that Polycomb repression complex 2 (PRC2) is eliminated with Xist. Therefore, PRC2 depends on RNA both for its initial targeting of chromatin and for its stable association with it. Time-lapse analysis of RNA relocalization suggests that Xist and PRC2 expand along X at the same time but do not reach saturation levels in 24 hours, providing an opportunity to reprogram chromatin if necessary. To do.

It is noteworthy that targeting a small region within 17 kb RNA can have such a dramatic effect. Its rapid effect suggests that the Xist RNA-protein complex can be immobilized on the inactive X chromosome (Xi) chromatin via repeat C. Alternatively, binding of the LNA molecule to repeat C can alter the RNA structure and interfere with the remote fixed domain. RNA elimination occurs with rapid kinetics, while the recovery period is extended. Full haze-like Xists are restored within 8 hours, but full PRC2 complements are not restored for up to 24 hours. This means that while X-chromosome inactivation (XCI) expands, the synthesis of said RNA is not a rate-determining step, but rather the rate-determining step is the recruitment of related silencing proteins such as PRC2. The rapid elimination and slow recovery dynamics of Xist provided a great opportunity to investigate Xist expansion patterns relative to the PRC2 pattern. Time-lapse analysis during the recovery phase is Xist It shows that RNA first binds most strongly near the Xist locus, but at the same time spreads to the rest of the Xi chromosome. Similarly, PRC2 is recruited synchronously throughout the X chromosome. Interestingly, neither Xist levels nor PRC2 levels reach saturation immediately, as Xist coating is not completed by 8 hours and PRC2 binding does not peak until 24 hours. Taken together, this analysis means that the establishment of chromosome-wide silencing may be relatively slow.

As shown herein, LNA molecules can be used as a valuable tool that can manipulate long-stranded nuclear ncRNAs and assist in their analysis. The advantages provided by the LNA molecule-based system are relatively low cost, easy delivery, and rapid action. While other inhibitory nucleic acids may be effective after longer chain times, LNA molecules are more rapid, eg, relatively early onset of activity, complete after a recovery period after synthesis of new lncRNA. It is reversible and exhibits effects that occur without causing substantial or substantially complete RNA cleavage or RNA degradation. One or more of these design properties can be the desired properties of the inhibitory nucleic acids of the invention. In addition, the LNA molecule allows for systematic targeting of domains within longer chain nuclear transcripts. Although PNA-based systems were described earlier, their effects on the Xi chromosome appeared only after 24 hours (13). LNA technology enables high-throughput screens for the functional analysis of long non-coding RNAs and also provides new tools for manipulating chromatin conditions in vivo for therapeutic applications.

In various related embodiments, the methods described herein use LNA molecules to target lncRNAs in many applications, such as as a search tool for probing the function of specific lncRNAs in vitro or in vivo. Including doing. The methods are to select one or more desired RNAs, to design one or more LNA molecules that target lncRNAs, to provide the designed LNA molecules, and to administer the LNA molecules to cells or animals. Including doing. The method can optionally include selecting a region of lncRNA and designing one or more LNA molecules that target that region of lncRNA.

Aberrant imprint gene expression has been shown to be involved in several diseases such as long QT syndrome, Beckwith-Wiedemann syndrome, Prader-Willi syndrome and Angelman syndrome and behavioral disorders and carcinogenesis (eg). Falls et al., Am. J. Pathol. 154: 635-647 (1999); Lalande, Annu Rev Genet 30: 173-195 (1996); Hall Annu Rev Med. 48: 35-44 (1997) thing). LNA molecules can be made to treat such imprinted diseases. As an example, long QT syndrome can be caused by the K + gated calcium channel encoded by Kcnq1. This gene is regulated by its antisense counterpart, the long non-coding RNA Kcnq1ot1 (Pandey et al., Mol Cell. 2008 Oct 24; 32 (2): 232-46). Disease occurs when Kcnq1ot1 is abnormally expressed. An LNA molecule that downregulates Kcnq1ot1 can be created to restore Kcnq1 expression. As another example, the LNA molecule can inhibit the lncRNA cofactor of the polycomb complex chromatin modifier and reverse the imprint deficiency.

From a commercial and clinical point of view, a time point of about 1 to 24 hours may define an opportunity for epigenetic reprogramming. The advantage of the LNA system is that it acts quickly, has a limited half-life, and is therefore reversible by the degradation of LNA, and at the same time it can perform epigenetic manipulations in the meantime. To provide an individual time frame that can be done. By targeting cell nuclear long-chain ncRNAs, in culture or in vivo by temporarily eliminating regulatory RNAs and binding proteins long enough to change the underlying locus for therapeutic purposes. LNA molecules or similar polymers such as xyllo-LNA can be utilized to manipulate the chromatin state of cells in the cell. In particular, LNA molecules or similar polymers that specifically bind or complement the PRC2-binding lncRNA can gene-specifically prevent the recruitment of PRC2 to specific chromosomal loci.

The LNA molecule can also be administered in vivo to treat other human diseases such as, but not limited to, cancer, neuropathy, infection, inflammation and myotonic dystrophy. For example, LNA branches can be delivered to tumor cells to down-regulate the biological activity of growth-promoting or carcinogenic long-chain cell nuclear ncRNAs (eg, metastasis-related lncRNAs, often in cancer. Upregulated Gtl2 or MALAT1 (Luo et al., Hepatology. 44 (4): 1012-24 (2006)). Inhibitory lncRNAs that downregulate tumor suppressors are also targeted by LNA molecules to promote reexpression. For example, the expression of the INK4b / ARF / INK4a tumor suppressor locus is regulated by proteins in the polycomb group, including PRC1 and PRC2, and is suppressed by the antisense non-coding RNA ANRIL (Yap et al. , Mol Cell. 2010 Jun 11; 38 (5): 662-74). ANRIL can be targeted by LNA molecules to promote reexpression of INK4b / ARF / INK4a tumor suppressors. Some lncRNAs can be positive regulators of oncogenes. Such "activated lncRNAs" have recently been described (eg, Jpx (Tian et al., Cell. 143 (3): 390-403 (2010)) and others (Orom et al., Cell. 143 (1). ): 46-58 (2010)). Therefore, LNA molecules can be directed to these activated lncRNAs to down-regulate cancer genes, and down-regulatory lncRNAs that regulate inflammatory or immune responses. LNA molecules can also be delivered to inflammatory cells for regulation (see, eg, LincRNA-Cox2, Guttman et al., Nature. 458 (7235): 223-7. Epub 2009 Feb 1 (2009)).

In yet other related embodiments, lncRNAs described herein are used to generate animal or cellular models of symptoms associated with altered gene expression (eg, as a result of changes in epigenetic properties). The target LNA molecule can be used. For example, changes in the X chromosome were often found in female genital cancers, first found about half a century ago. Approximately 70% of breast cancers lack the "bar body" that is a cytological feature of the inactive X chromosome (Xi) and instead carry two or more active X chromosomes (Xa). The additional X chromosome is also a risk factor in men, as XXY men (Klinefelter's syndrome) have a 20-50-fold increased risk of breast cancer on a BRCA1 background. The X chromosome is also known to carry many oncogenes. Excess Xa correlates with poor prognosis and is present as one of the most common cytological abnormalities in genital cancers, as well as in both sexes, leukemias, lymphomas and germ cell tumors. For example, Liao et al., Cancer Invest 21, 641-58 (2003); Spatz et al., Nat Rev Cancer 4, 617-29 (2004); Barr et al., Proc Can Cancer Conf 2, 3-16 (1957); Borah et al., J Surg Oncol 13, 1-7 (1980) ); Camargo and Wang, Hum Genet 55, 81-5 (1980); Dutrillaux et al., Int J Cancer 38, 475-9 (1986); Ghosh and ShahCancer Genet Cytogenet 4, 269-74 (1981); Ghosh and Shah, Med Hypotheses 7, 1099-104 (1981); Ghosh et al., Acta Cytol 27, 202-3 (1983); Huang et al., Mol Cancer Ther 1, 769-76 (2002); Kawakami et al. , Lancet 363, 40-2 (2004); Kawakami et al., J Urol 169, 1546-52 (2003); Kawakami et al., Oncogene 23, 6163-9 (2004); Moore and Barr, Br J Cancer 9, 246-52 (1955); Moore and Barr , Br J Cancer 11, 384-90 (1957); Moore et al., J Exp Zool 135, 101-25 (1957); Rosen et al., Ann Clin Lab Sci 7, 491-9 (1977); Sirchia et al., Cancer Res 65, 2139-46 (2005); Tavares, Lancet 268, 948-9 (1955); Tavares, Medico (Porto) 12, 97-100 (1961); Tavares, Acta Cytol 6, 90-4 (1962); See Wang et al., Cancer Genet Cytogenet 46, 271-80 (1990); and Ganesan et al., Cold Spring Harb Symp Quant Biol 70, 93-7 (2005).

Approximately 60% of children with acute lymphoblastic leukemia (ALL) also show an excess of the X chromosome. In chronic neutrophil leukemia, an increase in the X chromosome may be the only obvious abnormality and is associated with the progression of blast crisis (eg, Heinonen and Mahlamaki, Cancer Genet Cytogenet 87, 123-6 (1996)). ); See Heinonen et al., Med Pediatr Oncol 32, 360-5 (1999); and Yamamoto et al., Cancer Genet Cytogenet 134, 84-7 (2002)). These observations are only correlated so far, but in summary, suggest that the X chromosome can contribute to carcinogenesis. Therefore, Xist can be a tumor suppressor. Preliminary data obtained after removing Xist in specific strains of male and female mice show that increased B cell proliferation occurs in a subset of mice (not in controls, n = 9). Although not bound by theory, one possible mechanism is that the lack of Xist in the cell leads to reactivation of the X chromosome or doubling of the Xa chromosome, resulting in an intracellular XaXa state. The resulting increased expression of oncogenes on the X chromosome induces a precancerous state and an accumulation of additional epigenetic / genetic changes (eg, genome-wide changes that later lead to cancer). Therefore, Xist can be a tumor suppressor.

By using XIST-LNA, eg, the XIST LNA described herein, to remove XIST in cells or tissues and in a developmentally specific manner, certain cancers (eg, known in the art). It is possible to create an animal model of the above-mentioned cancers that are associated with changes in the X chromosome. The methods described herein can also be useful, for example, in creating animal or cell models of other symptoms associated with the expression of abnormal imprinted genes as described above.

In various related embodiments, the results described herein utilize, for example, LNA molecules targeting long-stranded ncRNAs to temporarily disrupt chromatin to reprogram chromatin status in vitro. It is demonstrating. Since the LNA molecule stably eliminates RNA for several hours and chromatin is not reconstituted for several hours thereafter, the LNA molecule is in a specific locus in vitro due to, for example, reprogramming of hiPS and hESC prior to stem cell therapy. Create a great opportunity to manipulate the epigenetic state of. For example, Gtl2 regulates DLK1 expression, which regulates iPS cell pluripotency. Low Gtl2 and high DLK1 correlate with increased pluripotency and stability of human iPS cells. Therefore, LNA molecules that target Gtl2 can be used to inhibit iPS cell differentiation and increase pluripotency and stability. See also U.S. Pat. No. 61/41286, which is incorporated herein by reference in its entirety.

Antago miR In some embodiments, the inhibitory nucleic acid is Antago miR. Antago miR is a chemically modified antisense oligonucleotide that can target lncRNA. For example, the antago miR used in the methods described herein can contain a nucleotide sequence that is sufficiently complementary to hybridize to a lncRNA target sequence of about 12-25 nucleotides, preferably about 15-23 nucleotides. ..

In some embodiments, the antago miR comprises, for example, a cholesterol moiety at the 3'end. In some embodiments, antago miR has various modifications for pharmacological properties such as ribonuclease protection and improved tissue and cell uptake. For example, in addition to the antisense oligo modifications described above, antago miR can have one or more complete or partial 2'-O-methylation of the sugar and / or phosphorothioate backbone. Phosphorothioate modification provides protection against ribonuclease or other nuclease activity, and its lipophilicity contributes to enhanced tissue uptake. In some embodiments, the antago miR can include six phosphorothioate skeletal modifications, two phosphorothioates located at the 5'end and four located at the 3'end, but other patterns of phosphorothioate modification also. Usually used and valid. For example, Krutzfeldt et al., Nature 438, 685-689 (2005); Czech, N Engl J Med 2006; 354: 1194-1195 (2006); Robertson et al., Silence. 1:10 (2010); Marquez and McCaffrey, Hum Gene Ther. 19 (1): 27-38 (2008); van Rooij et al., Circ Res. 103 (9): 919- See 928 (2008); and Liu et al., Int. J. Mol. Sci. 9: 978-999 (2008). Krutzfeld et al. (2005) described a chemically engineered oligonucleotide named "AntagomiR", which has been reported to be an efficient and specific silencer for mouse endogenous miRNAs.

In general, the design of Antago miR avoids degradation of the target RNA due to the modified sugar present in the molecule. The presence of a contiguous string of unmodified sugars supports ribonuclease H recruitment and enzymatic activity. Thus, typically, the Antago miR design contains bases that contain modified sugars (eg, LNA) at the ends or are interspersed with natural ribose or deoxyribose nucleobases.

The antago miR useful in the present invention can also be modified with the length or number of nucleotides that make the antago miR. In some embodiments, the antago miR must retain target specificity, i.e., it must not bind directly to transcripts other than the target of interest, or has a direct significant effect on its expression level. Do not exert. In some embodiments, antago miR may exhibit non-specific binding that does not produce significant and undesired biological effects, eg, antago miR is associated with expression levels of non-target transcripts or regulatory proteins or regulatory RNAs. Does not affect the association of.

Interfering RNA containing siRNA / shRNA In some embodiments, inhibitory nucleic acid sequences that are complementary to lncRNA can be interfering RNAs that include, but are not limited to, small interfering RNAs ("siRNA") or small hairpin RNAs ("shRNA"). it can. Methods of constructing interfering RNA are well known in the art. For example, interfering RNA can be assembled from two separate oligonucleotides, one strand being the sense strand and the other antisense strand, and the antisense and sense strands are self-complementary (ie, each). The strand contains a nucleotide sequence that is complementary to the nucleotide sequence of one strand, so that the antisense and sense strands form a double or double strand structure), the antisense strand is the target nucleic acid molecule or one of them. It contains a nucleotide sequence that is complementary to the nucleotide sequence of the part, and the sense chain contains a nucleotide sequence corresponding to the target nucleic acid sequence or a part thereof. Alternatively, the interfering RNA is assembled from a single oligonucleotide and the self-complementary sense and antisense regions are linked using nucleic acid or non-nucleic acid linkers. The interfering RNA can be a polynucleotide having a double, asymmetric double, hairpin or asymmetric hairpin secondary structure and can have sense and antisense regions that are self-complementary, in which case the antisense region , Containing a nucleotide sequence that is complementary to a separate target nucleic acid molecule or a nucleotide sequence thereof, and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Interference may be a circular single-stranded polynucleotide having two or more loop structures, a stem cell containing a self-complementary sense and antisense region, in which case the antisense region is the target nucleic acid molecule. Or contains a nucleotide sequence that is complementary to a portion of the nucleotide sequence thereof, the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and the cyclic polynucleotide is processed either in vivo or in vitro. , Can mediate RNA interference

In some embodiments, the region encoding the interfering RNA encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such RNA molecules form a "hairpin" structure when expressed as desired and are referred to herein as "shRNA". The loop region is generally about 2 to about 10 nucleotides in length. In some embodiments, the loop region is about 6 to about 9 nucleotides in length. In some embodiments, the sense and antisense regions are about 15 to about 20 nucleotides in length. After post-transcriptional processing, small-molecular-weight hairpin RNA is converted to siRNA by a cleavage event mediated by the enzyme Dicer, a member of the ribonuclease III family. SiRNAs can then inhibit the expression of genes that share homology. For more information, see Brummelkamp et al., Science 296: 550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20: 497-500, (2002); Paddison et al. Genes &amp; Dev. 16: 948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui , Proc. Natl. Acad. Sd. USA, 99 (6), 5515-5520, (2002); see Yu et al. Proc NatlAcadSci USA 99: 6047-6052, (2002).

The target RNA cleavage reaction induced by siRNA is highly sequence-specific. In general, siRNAs containing the same nucleotide sequence as part of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required for the practice of the present invention. Therefore, the present invention has the advantage of being able to tolerate the sequence diversity that can be expected due to genetic mutations, interstrain polymorphisms or evolutionary diversification. For example, siRNAs with insertions, deletions and single point mutations to the target sequence have also been shown to be effective in inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions may be effective for inhibition. In general, siRNAs must retain their specificity for the target, i.e., they must not bind directly to transcripts other than the target of interest, or have a direct significant effect on their expression levels.

Ribozyme In some embodiments, the inhibitory nucleic acid is a ribozyme. Trans-cleaving enzymatic nucleic acid molecules can also be used and are expected to be effective as therapeutic agents for human diseases (Usman &amp; McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995. J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific lncRNA targets within the background of cellular RNA. It is assumed that such a cleavage event cannot function lncRNA.

In general, enzymatic nucleic acids with RNA cleaving activity act by first binding to the target RNA. Such binding occurs via the target binding portion of the enzymatic nucleic acid, which is held in close proximity to the enzymatic portion of the molecule that acts to cleave the target RNA. Thus, enzymatic nucleic acids first recognize the target RNA via complementary base pairing, then bind to it, and when it binds to the correct site, it acts enzymatically to cleave the target RNA. Strategic cleavage of such target RNA disrupts its ability to direct the synthesis of the encoded protein. Enzymatic nucleic acid can bind to its RNA target and cleave it, then be released from that RNA, search for another target, repeatedly bind to and cleave its new target.

Various reactions such as cleavage and ligation of phosphodiester and amide bonds using several techniques (Orgel, 1979, Proc. R. Soc. London, B 205, 435), including in vitro selection (evolution) methods. (Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al, 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261: 1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al, 1995, FASEB J., 9 , 1183; Breaker, 1996, Curr. Op. Biotech., 1, 442). The development of optimal ribozymes for catalytic activity has contributed significantly to any method of using RNA-cleaving ribozymes to control gene expression. For example, a hammerhead ribozyme functions at a catalytic rate (kcat) of about 1 / min in the presence of a saturated (10MM) concentration of Mg2 + cofactor. Artificial "RNA ligase" ribozymes have been shown to catalyze the corresponding self-modifying reaction at a rate of about 100 / min. In addition, certain modified hammerhead ribozymes with substrate-binding arms made of DNA are known to catalyze RNA cleavage at multiple turnover rates close to 100 / min.

Preparation and Use of Suppressive Nucleic Acids Nucleic acid sequences used to carry out the methods described herein are from a variety of sources, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof. It can be isolated, genetically engineered, amplified, and / or expressed / produced by recombinant techniques. If desired, the nucleic acid sequence of the invention can be inserted into a delivery vector and expressed from the transcriptional units within that vector. The recombinant vector can be a DNA plasmid or a viral vector. The production of vector constructs is described, for example, in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and "RNA Viruses: A Practical Approach" (Alan J. They include standard techniques for PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification and DNA sequencing, as described in Cann, Ed., Oxford University Press, (2000). It can be achieved using any suitable genetic manipulation technique well known in the art, not limited to.

Preferably, the inhibitory nucleic acids of the invention are chemically synthesized. Nucleic acid sequences used to carry out the present invention are described, for example, in Adams (1983) J. Am. Chem. Soc. 105: 661; Belousov (1997) Nucleic Acids Res. 25: 3440-3444; Frenkel (1995) Free. Radic. Biol. Med. 19: 373-380; Blommers (1994) Biochemistry 33: 7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) ) Tetra. Lett. 22: 1859; US Pat. No. 4,458,066; WO / 2008/043753 and WO / 2008/049085 and the known chemistry described therein and the references cited therein. It can be synthesized in vitro by a synthetic technique.

The nucleic acid sequence of the present invention can be stabilized against nucleic acid degradation by incorporating modifications such as nucleotide modifications. For example, the nucleic acid sequences of the invention contain phosphothioates at least at the 5'or 3'end of the nucleotide sequence at least in primary, secondary or tertiary internucleotide linkages. As another example, the nucleic acid sequence is a 2'-modified nucleotide, eg, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-). O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'- O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) or 2'-O--N-methylacetamide (2'-O--NMA) can be included. As another example, the nucleic acid sequence can contain at least one 2'-O-methyl-modified nucleotide, and in some embodiments, all nucleotides contain 2'-O-methyl-modified. In some embodiments, the nucleic acid comprises a nucleic acid analog that is "locked", i.e., the ribose ring is "locked" by a methylene bridge that attaches 2'-O and 4'-C atoms (eg,). See Kaupinnen et al., Drug Disc. Today 2 (3): 287-290 (2005); Koshkin et al., J. Am. Chem. Soc., 120 (50): 13252-13253 (1998). ). See U.S. Pat. No. 20100004320, U.S. Pat. No. 20090298916, and U.S. Pat. No. 20090143326 for further modifications.

Any of the modified chemical or inhibitory nucleic acid forms described herein can be combined with each other to include 1, 2, 3, 4, 5, or more different types of modifications within the same molecule.

Nucleic acid manipulation methods used to carry out the present invention include, for example, subcloning, labeled probes (eg, random primers labeled using cleno polymerase, nick translation, amplification), sequencing, hybridization and the like. , Scientific and patent literature, eg Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al., Eds. (John Wiley &amp; Sons) , Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. See Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, NY (1993).

Pharmaceutical Compositions The methods described herein can include administration of pharmaceutical compositions and formulations that contain inhibitory nucleic acid sequences designed to target lncRNAs. In some embodiments, the composition is formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered by topical, topical, oral or topical administration, eg, aerosol or transdermal. The pharmaceutical composition can be formulated by any method and is administered in various unit dosage forms depending on the symptomatology or disease and the degree of illness, the general medical condition of each patient, the preferred administration method obtained, and the like. Can be done. The details of pharmaceutical formulation and administration techniques are well documented in the scientific and patent literature, see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

The inhibitory nucleic acid can be administered alone or as a component of a pharmaceutical preparation (composition). The compounds can be formulated for administration in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants such as sodium lauryl sulfate and magnesium stearate and colorants, mold release agents, coatings, sweeteners, fragrances and fragrances, preservatives and antioxidants may also be included in the composition. it can.

The formulations of the compositions of the present invention include those suitable for intradermal, inhalation, oral / nasal, topical, extraintestinal, rectal and / or intravaginal administration. The formulation may be conveniently provided in the form of a unit dosage form and can be prepared by any method known in the pharmaceutical art. The amount of active ingredient (eg, the nucleic acid sequence of the invention) that can be combined with the carrier material to produce a single dosage form depends on the particular mode of administration, such as the host being treated, intradermal administration or inhalation. different. The amount of active ingredient that can be combined with the carrier material to produce a single dosage form is generally the amount of compound that provides a therapeutic effect, such as an antigen-specific T cell response or a humoral response.

The pharmaceutical preparation of the present invention can be prepared according to any method known in the field of manufacturing a pharmaceutical product. Such agents can contain sweeteners, flavors, colorants and preservatives. The formulation can be mixed with a non-toxic, pharmaceutically acceptable excipient suitable for manufacture. The formulation can contain one or more diluents, emulsifiers, preservatives, buffers, excipients, etc., liquids, powders, emulsions, frozen powders, sprays, creams, lotions, release-release formulations, tablets, It may be provided in the form of pills, gels, patches, implants and the like.

Pharmaceutical formulations for oral administration can be formulated at appropriate and appropriate doses using pharmaceutically acceptable carriers well known in the art. Such carriers are formulated into unit dosage forms such as tablets, pills, powders, dragees, capsules, liquids, troches, gels, syrups, slurries, suspensions, etc. that are suitable for patient intake. Make it possible. If desired, after the addition of the appropriate other compounds, optionally the resulting mixture is ground and the mixture of granules is processed to obtain a tablet or sugar-coated pill core to make a pharmaceutical formulation for oral use. It can be formulated as a solid excipient. Suitable solid excipients are carbohydrates or protein fillers, such as sugars such as lactose, sucrose, mannitol or sorbitol, starches from corn, wheat, rice, potatoes or other plants, methylcellulose, hydroxypropylmethylcellulose or Includes cellulose such as sodium carboxymethyl cellulose and gums such as Arabic gum and tragacant gum and proteins such as gelatin and collagen. Cross-linked polyvinylpyrrolidone, agar, alginic acid or a salt thereof, for example, a disintegrant or solubilizer such as sodium alginate can be added. Extruded capsules can contain fillers or binders such as lactose or starch, lubricants such as talc or magnesium stearate and, optionally, active agents mixed with stabilizers. In flexible capsules, the active agent can be dissolved or suspended in a suitable liquid, such as fatty oils, liquid paraffin or polyethylene glycol solutions, with or without stabilizers.

The aqueous suspension can contain, for example, an activator (eg, the nucleic acid sequence of the invention) mixed with an excipient suitable for producing an aqueous suspension for aqueous intradermal injection. Such excipients include suspending agents such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, sodium alginate, polyvinylpyrrolidone, tragacant gum and arabic gum, and natural phosphatides (eg, ethylene), alkylene oxides and fatty acids. Condensation products (eg, polyoxyethylene stearate), condensation products of ethylene oxide and long-chain aliphatic alcohols (eg, heptadecaethyleneoxycetanol), condensation products of ethylene oxide and fatty acids and partial esters derived from hexitol (eg, eg). Includes dispersants or wetting agents such as polyoxyethylene sorbitol monooleate) or condensation products of ethylene oxide and fatty acids and partial esters derived from hexitol anhydride (eg, polyoxyethylene sorbitan monooleate). Aqueous suspensions include one or more preservatives, such as ethyl or n-propyl p-hydroxybenzoic acid, one or more colorants, one or more flavors and one or more sweeteners, such as sucrose. It can also contain aspartame or saccharin. The formulation can be adjusted for molar osmolality.

In some embodiments, oil-based pharmaceuticals are used for administration of the nucleic acid sequences of the invention. An oil-based suspension can be formulated by suspending the activator in a vegetable oil such as peanut oil, olive oil, sesame oil or coconut oil, or a mineral oil such as liquid paraffin or a mixture thereof. For example, U.S. Pat. No. 5,716,928, which describes the use of essential oils or essential oil components to improve the bioavailability of orally administered hydrophobic pharmaceutical compounds and reduce inter-individual and intra-individual diversity. See (see also US Pat. No. 5,858,401). The oil suspension can contain thickeners such as beeswax, hard paraffin or cetyl alcohol. A sweetening agent such as glycerol, sorbitol or sucrose can be added to provide an easy-to-drink oral preparation. These preparations can be preserved by adding an antioxidant such as ascorbic acid. See Minto (1997) J. Pharmacol. Exp. Ther. 281: 93-102 for an example of an injectable oil vehicle.

The pharmaceutical product may be in the form of an oil-in-water emulsion. The oil phase may be the above vegetable oil or mineral oil or a mixture thereof. Suitable emulsifiers are naturally occurring gums such as acacia gum and tragacant gum, naturally occurring phosphatides such as soybean lectin, fatty acids and esters or partial esters derived from hexitol anhydrides such as sorbitan monooleates and their partial esters and ethylene oxide. Condensation products such as polyoxyethylene sorbitan monooleate are included. The emulsion can also contain sweeteners and flavors, such as in the formulation of syrups and elixirs. Such a formulation can also contain a mucilage, a preservative or a colorant. In alternative embodiments, these injectable oil-in-water emulsions of the invention include paraffin oil, sorbitan monooleate, ethoxylated sorbitan monooleate and / or ethoxylated sorbitan trioleate.

Pharmaceutical compounds can also be administered by intranasal, intraocular and intravaginal routes, including suppositories, blows, powders and aerosol formulations. (See, for example, Rohatagi (1995) J. Clin. Pharmacol. 35: 1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75: 107-111 for examples of steroid inhalers). The suppository preparation is prepared by mixing the drug with a suitable non-irritating excipient that melts in the body and releases the drug because it is solid at normal temperature but liquid at body temperature. Can be done. Such materials are cocoa butter and polyethylene glycol.

In some embodiments, pharmaceutical compounds formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders and aerosols can be transdermally delivered by topical route. it can. In some embodiments, the pharmaceutical compound can also be delivered into the body as microspheres for sustained release. For example, it can be administered via intradermal injection of a drug that slowly releases microspheres subcutaneously, see Rao (1995) J. Biomater Sci. Polym. Ed. 7: 623-645, biodegradable and See, for example, Gao (1995) Pharm. Res. 12: 857-863 (1995) as an injectable gel formulation, or, for example, Eyles (1997) J. Pharm. Pharmacol. 49: as a microsphere for oral administration. See 669-674.

In some embodiments, the pharmaceutical compound can be administered extraintestinally, for example by intravenous (IV) administration or administration into the lumen of a body cavity or organ. These formulations can include a solution of the activator dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be used are water and Ringer's solution, isotonic sodium chloride. In addition, sterile non-volatile oil can be used as a solvent or suspension medium. For this purpose, any non-volatile non-volatile oil can be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids such as oleic acid can also be used in the formulation of injectable solutions. These solutions are sterile and generally free of unwanted substances. These formulations can be sterilized by conventional known sterilization techniques. The formulation contains pharmaceutically acceptable auxiliary substances required for appropriate physiological conditions, such as pH regulators and buffers, toxicity regulators, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate. Etc. can be contained. The concentration of the activator of these formulations can vary widely and will be selected primarily based on fluid volume, viscosity, body weight, etc., according to the particular mode of administration selected and the needs of the patient. For IV administration, the formulation may be a sterile injectable formulation, such as a sterile injectable aqueous solution or an oily suspension. The suspension can be formulated with these suitable dispersants or wetting and suspending agents. The sterile injectable formulation may be a non-toxic extraintestinal tolerable diluent or solvent suspension, such as a 1,3-butanediol solution. Administration can be by bolus or continuous infusion (eg, introduced into a blood vessel for a specific period of time with virtually no interruption).

In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. A stable lyophilized preparation containing an inhibitory nucleic acid can be prepared by lyophilizing a solution containing the preparation and bulking agent of the present invention, for example, mannitol, trehalose, raffinose and sucrose or a mixture thereof. Methods for preparing stable lyophilized formulations are solutions of about 2.5 mg / mL protein, about 15 mg / mL sucrose, about 19 mg / mL NaCl and sodium citrate buffer having a pH of greater than or equal to 5.5 but less than 6.5. Includes lyophilization. See, for example, US Pat. No. 20040028670. The compositions and formulations can be delivered by using liposomes. By using liposomes, in vivo for delivery of activators, especially if the liposome surface carries a ligand specific to the target cell or is otherwise preferably directed to a particular organ. You can focus. For example, U.S. Pat. Nos. 6063400, 6007839; Al-Muhammed (1996) J. Microencapsul. See 13: 293-306; Chonn (1995) Curr. Opin. Biotechnol. 6: 698-708; Ostro (1989) Am. J. Hosp. Pharm. 46: 1576-1587. As used in the present invention, the term "liposome" means a vesicle consisting of amphipathic lipids arranged in two or more layers. Liposomes are monolayer or multilayer vesicles with a membrane formed from an aqueous interior containing a lipophilic material and the composition to be delivered. Cationic liposomes are positively charged liposomes and are thought to interact with negatively charged DNA molecules to form stable complexes. Liposomes that are pH sensitive or negatively charged are thought to capture DNA rather than form a complex with DNA. Both cationic and non-cationic liposomes have been used to deliver DNA to cells.

Liposomes can also include "sterically stable" liposomes, ie, liposomes containing one or more special lipids. When incorporated into liposomes, these special lipids result in liposomes with enhanced circulating lifespan compared to liposomes lacking such special lipids. As an example of a sterically stable liposome, a portion of the vehicle-forming lipid portion of the liposome contains one or more glycolipids or is derivatized with one or more hydrophilic polymers such as polyethylene glycol (PEG) moieties. It is a thing. Liposomes and their use are further described in US Pat. No. 6,287,860.

The formulations of the present invention can be administered for prophylactic and / or therapeutic treatment. In some embodiments, for therapeutic use, the composition requires a reduction in triglyceride concentration, or is at risk of a disorder described herein, or has a disorder described herein. To be administered in an amount sufficient to cure, alleviate or partially stop the clinical signs of the disorder or its complications, which may be referred to as a therapeutically effective dose. For example, in some embodiments, the pharmaceutical composition of the invention is administered in an amount sufficient to reduce the serum concentration of the triglyceride of interest.

A sufficient amount of pharmaceutical composition to achieve this is a therapeutically effective dose. The effective dosing regimen and amount for this use, ie, the method of administration, depends on a variety of factors including the stage of the disease or condition, the severity of the disease or condition, the general condition of the patient's health, the patient's physical condition, age, etc. will do. The mode of administration is also taken into account when calculating the method of administration of the patient.

The dosing regimen also takes into account pharmacokinetic parameters well known in the art, such as activator absorption rate, bioavailability, metabolism, clearance (eg, Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol). 58: 611-617; Groning (1996) Pharmazie 51: 337-341; Fotherby (1996) Contraception 54: 59-69; Johnson (1995) J. Pharm. Sci. 84: 1144-1146; Rohatagi (1995) Pharmazie 50: 610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24: 103-108; see Remington: The Science and Practice of Pharmacy, 21st ed., 2005). State-of-the-art technology allows clinicians to determine the method of administration, activator and disease or condition of each individual patient. Using the guidelines provided for similar compositions used as pharmaceuticals as guidance, the dosing regimen, i.e. the schedule and dose level of dosing administered to carry out the methods of the invention, is accurate and appropriate. You can decide that there is.

Single or multiple doses of the pharmaceutical product may vary, for example, to the dose and frequency required and tolerated by the patient, the degree and amount of therapeutic effect produced after each dose (eg, tumor size or growth). Can be done accordingly. The formulation should provide an amount of activator sufficient to effectively treat, prevent or alleviate the condition, disease or condition.

In an alternative embodiment, the pharmaceutical formulation for oral administration has a daily dose of about 1-100 mg / kg body weight / day or more. In contrast to oral administration, low doses can be used by injecting into the bloodstream, into body cavities, or into the lumen of organs. Significantly higher doses can be used when administered topically or orally or by powder, spray or inhalation. Practical methods of preparing extraintestinal or non-intestinal-administrable formulations are well known or obvious to those of skill in the art and publications such as Remington: The Science and Practice of Pharmacy, 21st ed., 2005. It is described in more detail by.

Various studies have reported successful administration of mammals using complementary nucleic acid sequences. For example, Esau C., et al., (2006) Cell Metabolism, 3 (2): 87-98 used intraperitoneal administration of 12.5 to 75 mg / kg of miR-122 antisense oligonucleotide twice weekly for 4 weeks. We reported the administration of normal mice. Mice appeared healthy and normal at the end of the procedure, with no weight loss or reduced food intake. Plasma transaminase concentrations were in the normal range (AST3 / 445, ALT3 / 435) at all doses except the 75 mg / kg dose of miR-122ASO, indicating a very slight increase in ALT and AST concentrations. The result was that 50 mg / kg was an effective, non-toxic dose. Kruetzfeldt J., et al., (2005) Nature 438, Another study with 685-689 injected antago miR to silence mouse miR-122 using a total dose of 80, 160 or 240 mg / kg body weight. The miR-122 signal was completely abolished at the highest dose. In yet another study, we succeeded in applying a locked nucleic acid molecule ("LNA molecule") to primates to silence miR-122. Elmen J., et al., (2008) Nature 452, 896-899 show that effective silencing of miR-122 was achieved in primates with three doses of 10 mg / kg LNA anti-miR and LNA in test animals. It has been reported to result in a persistent and reversible reduction in total plasma cholesterol without any signs of associated toxicity or histopathological changes.

In some embodiments, the methods described herein can include co-administration with other agents or pharmaceuticals, such as compositions for providing cholesterol homeostasis. For example, inhibitory nucleic acids can be co-administered with agents for treating or reducing the risk of the disorders described herein.

<p> The present invention will be further described in the following examples, but they do not limit the scope of the invention described in the claims. Materials and Methods The following materials and methods were used in Examples 1-7 shown below.</p><p> RNA Immunoprecipitation-Sequencing RNA immunoprecipitation using 107 wild-type 16.7 ES cells (Lee and Lu, 1999) and Ezh2-/-ES cells (Shen et al., 2008) (Zhao et al., 2008) ) Was performed. To construct an RNA immunoprecipitation-sequencing library, cell nuclei are isolated, karyolysis is prepared, treated with 400 U / ml DNAse, and anti-Ezh2 antibody (Active Motif) or control IgG (Cell Signaling). Incubated with Technology). The RNA-protein complex was immunoprecipitated using Protein A agarose beads and RNA was extracted using Trizol (Invitrogen). Template switching was used to build the library to protect the chain information (Cloonan et al.,, 2008). 20-150 ng of RNA and adapter 1 (5'-CTTTCCCTACACGACGCTCTTCCGATCTNNNNNN-3'; SEQ ID NO: 193050) were used for fast-strand cDNA synthesis using the Superscript II reverse transcription kit (Invitrogen). Superscript II adds non-template CCC3'overhangs, which were used to hybridize to the adapter 2-GGG template switch primer (5'-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGGG-3'; SEQ ID NO: 193051). For first-strand cDNA synthesis, samples were incubated with Adapter 1 at 20 ° C for 10 minutes, followed by 37 ° C for 10 minutes, and 42 ° C for 45 minutes. A modified template switch primer was then added and each tube was incubated at 42 ° C for 30 minutes, followed by 75 ° C for 15 minutes. The resulting cDNA was amplified with forward illuminator primers (5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'; SEQ ID NO: 193052) and reverse illuminator primers (5'-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3'; SEQ ID NO: 193053). PCR was performed with Phusion polymerase (BioRad) as follows: 20-24 cycles of 98 ° C for 30 seconds, [98 ° C for 10 seconds, 65 ° C for 30 seconds, 72 ° C for 30 seconds]: And at 72 ° C for 5 minutes. PCR products were loaded on 3% NuSieve gels for size selection and 200-1,200 bp products were cut out and extracted with the QIAEX II agarose gel extraction kit (Qiagen). Samples without reverse transcription generally produced no products. DNA concentration was quantified by PicoGreen. The Sequencing Core Facility of the Molecular Biology Department at Massachusetts General Hospital (MGH) sequenced 5-10 ml of 2-20 nM cDNA samples with Illumina GAII.</p><p> Bioinformatics Analysis A complete RNA immunoprecipitation-sequencing dataset is accessible via GEO in series GSE17064. Except for the case described later, all the analyzes were performed using my own C ++ program. Image processing and base calling were performed using the Illumina pipeline. Cross-matching detected 3'adapter sequences, matched 5 bases, homopolymer reads were screened, and reads matching the mitochondrial genome and ribosomal RNA were excluded from all subsequent analysis. Next, shortQueryLookup (Batzoglou et al., The remaining sequence was aligned to the mm9 mouse reference genome using 2002). Alignments with an error of 1 or less were retained. Since library construction and sequencing generate sequences from the reverse strands of PRC2-binding RNA, in all further analyzes we treated each read as if it were inversely complementary. To determine the correlation coefficient between the original anti-Ezh2 RNA immunoprecipitation-sequencing library with its technical and biological repeats, and also with RNA immunoprecipitation-sequencing of Ezh2-/-control cell lines. In addition, we compared the number of reads per gene between the two samples, and for each pair we calculated the Pearson correlation between the number of reads mapped to each refGene. That is, for each sample, we created a vector for the count of reads mapped to each refGene, and calculated the Pearson correlation between the vectors of all pairs.</p><p> Position of repetitive sequences in mm9 (Repeat Masker) at UCSC Genome Browser database (Kent et al., The human genome browser at UCSC. Genome Res. 2002 Jun; 12 (6): 996-1006; Fujita et al., "The UCSC" Genome Browser database: update 2011. "Nucleic Acids Res. 2010 Obtained from Oct 18). By intersecting the coordinates of the RepeatMasker data with the coordinates of the read alignment, we obtained an overlap with these repeats of the PRC2 transcriptome read. The UCSC transcriptome was used as a general reference (hgdownload.cse.ucsc.edu/goldenPath/mm9/database/transcriptome.txt.gz Available online at). To obtain a set of non-overlapping separate transcription regions, we sorted the UCSC transcriptome transcripts by start coordinates and merged the overlapping transcripts on the same strand (linkage UCSC transcriptome). Tome: 39,003 transcripts total). Next, to determine the number of UCSC transcripts present in the PRC2 transcriptome, we intersected the read alignment coordinates with the coordinates of the merged UCSC transcripts. Hits to the transcript were converted to RPKM units, in which case the read count was 1 / (n × K × M), n was the number of alignments in the genome, and K was the transcript divided by 1,000. Length, and M is the depth of sequencing containing only the reads corresponding to mm9 divided by 1,000,000 (Mortazavi et al.,, 2008). This normalization takes into account comparisons between transcripts of different lengths and samples of different sequencing depths. To create the promoter map, the promoter region was defined as -10,000 to +2000 bases for TSS (obtained from the refGene catalog, UCSC Genome Browser). With the exception of relaxing the 10 alignment limit, we plotted the read counts that overlap the promoter region. For the alignment of the chromosomes in Figures 1H and 7-12, the number of reads was calculated for all non-overlapping, continuous 100 kb windows on each chromosome. The leads were normalized so that the leads corresponding to n points were counted as 1 / n leads at each position. I plotted the graph using my own script written in R. To prepare Tables 3-7, a list of all transcripts enriched was found by comparing the RPKM scores at each strand for all transcripts in the WT and Ezh2-/-samples. .. Next, those coordinates were intersected with the coordinates of the feature of interest. The coordinates of features not found in the NCBI37 / mm9 mouse assembly were converted to those coordinates using UCSC's LiftOver utility (the liftOver utility effectively maps one genome to another and between successive assemblies of the same species. Allows rapid identification of regions of interest in or between two distinct species, available online at genome.ucsc.edu/cgi-bin/hgLiftOver). Only the features whose coordinates were convertible are shown.</p><p> RNA Immunoprecipitation / qRT-PCR Validate using 5 μl rabbit anti-mouse Ezh2 antibody (Active Motif) or normal rabbit IgG (Millipore) as described (Zhao et al., 2008). RNA immunoprecipitation was performed. RNA immunoprecipitation was followed by quantitative strand-specific RT-PCR using the ICYCLER IQ real-time detection system (BioRad). The gene-specific PCR primer pairs are:</p><p>Malat-1: Forward primer 5'-GCCTTTTGTCACCTCACT-3'; SEQ ID NO: 193054 Reverse primer 5'-CAAACTCACTGCAAGGTCTC-3'; SEQ ID NO: 193055 Malat1-as: Forward primer 5'-TACTGGGTCTGGATTCTCTG-3'; SEQ ID NO: 193056 Reverse primer 5' -CAGTTCCGTGGTCTTTAGTG-3'; SEQ ID NO: 193057 Foxn2-as: Forward primer 5'-GGCTATGCTCATGCTGTAAC; SEQ ID NO: 193058 Reverse primer 5'-GTTACTGGCATCTTTCTCACA-3'; SEQ ID NO: 193059Ly6e-as: Forward primer 5'-CCACACCGAGATTGAGATTG 193060 Reverse primer 5'-GCCAGGAGAAAGACCATTAC-3'; SEQ ID NO: 193061Bgn-as: Forward primer 5'-TGTGAACCCTTTCCTGGA-3'; SEQ ID NO: 193062 Reverse primer 5'-CTTCACAGGTCTCTAGCCA-3'; SEQ ID NO: 193063Gtl2: Forward primer 5'-CGAGGACTTCACGCACAAC -3'; SEQ ID NO: 193064 Reverse primer 5'-TTACAGTTGGAGGGTCCTGG -3'; SEQ ID NO: 193065</p><p>Gtl2-as: Forward Primer 5'-CACCCTGAACATCCAACA-3'; SEQ ID NO: 193066 Reverse Primer 5'-CATCTGCTTTTCCTACCTGG-3'; SEQ ID NO: 193067Hapa1-upstream: Forward Primer 5'-GGTCCAAAATCGGCAGT-3'; SEQ ID NO: 193068 Reverse Primer 5' -GTCCTCAAATCCCTACCAGA-3'; SEQ ID NO: 193069Htr6-downstream: Forward primer 5'-ACACGGTCGTGAAGCTAGGTA-3'; SEQ ID NO: 193070 Reverse primer 5'-CAGTTGGAGTAGGCCATTCCC-3'; SEQ ID NO: 193071 Nespas / TR019501: Forward primer 5'-AGATGAGTCCAGGTGCTT-3' SEQ ID NO: 193072 Reverse primer 5'-CAAGTCCAGAGTAGCCAAC-3'; SEQ ID NO: 193073</p><p> Xist-Forward3F5 and Xist-Reverse2R primers have been described (Zhao et al., 2008). For strand-specific cDNA synthesis, reverse primers were used, qPCR was performed using SYBR green (BioRad), and threshold intersections (Ct) were recorded. Each value was normalized to input RNA levels.</p><p> Northern Blot Analysis 5 μg of poly (A +) RNA was isolated from 16.7 ES cells, separated on a formaldehyde-containing 0.8% agarose gel, blotted on Hybrid-XL (GE Healthcare), and used with Ultrahyb (Ambion) 42. Hybridized to the probe at ° C. Probes were made using the STRIP-EZ PCR kit (Ambion), but they were Malat1-AS-F, 5'-TGGGCTATTTTTCCTTACTGG-3'; SEQ ID NO: 193074 Malat1-AS-R, 5'-GAGTCCCTTTGCTGTGCTG-3'; SEQ ID NO: 193075 (Gtl2) Meg3-F, 5'-GCGATAAAGGAAGACACATGC-3'; SEQ ID NO: 193076Meg3-R, 5'-CCACTCCTTACTGGCTGCTC-3'; SEQ ID NO: 193077Meg3 ds-F3, 5'-ATGAAGTCCATGGTGACAGAC-3'; ds-R2, 5'-ACGCTCTCGCATACACAATG-3'; SEQ ID NO: 193079Rtl1-F, 5'-GTTGGGGATGAAGATGTCGT-3'; SEQ ID NO: 193080Rtl1-R, 5'-GAGGCACAAGGGAAAATGAC-3'; SEQ ID NO: 193081 Nespas ds-F, 5'- TGGACTTGCTACCCAAAAAGG-3'; SEQ ID NO: 193082 Nespas ds-R, 5'-CGATGTTGCCCAGTTATCAG-3'; SEQ ID NO: 193083Bgn-AS-F, 5'-CAACTGACCTCATAAGCAGCAC-3'; SEQ ID NO: 193084Bgn-AS-R, 5'-AGGCTGCTTTCTGCTTCA-3 It was amplified from genomic DNA using SEQ ID NO: 193085Htr6 up-F, 5'-ATACTGAAGTGCCCGGAGTG-3'; SEQ ID NO: 193086Htr6 up-R, 5'-CAGGGGACAGACATCAGTGAG-3'; SEQ ID NO: 193087.</p><p> UV cross-linked RNA immunoprecipitation As described, with the exception of not trimming transcripts in RNA-protein complexes by ribonuclease treatment prior to RNA isolation to protect full-length RNA for RT-PCR. To (Ule et al., 2005) UV cross-linking IP was performed. Mouse ES cells were irradiated with UV of 254 nm, 400 mJ / cm2 (using Stratagene's STRATALINKER), and RSB-TRITON buffer (10 mM Tris hydrochloric acid, 100 mM NaCl, 2.5 mM MgCl2, 35 μg / mL digitonin, 0.5) was subjected to ultrasonic crushing treatment. Cell nuclei were lysed in% Triton X-100). Karyolysis was preclarified using salmon sperm DNA / protein agarose beads at 4 ° C for 1 hour and incubated overnight with antibody. The RNA / antibody complex was then precipitated using the protein ADYNABEADS (Invitrogen), first with low intensity buffer (1 x PBS [150 mM NaCl], 0.1% SDS, 0.5% deoxycholic acid, 0.5% NP-40). ), Then twice with high-intensity high-salt buffer (5 x PBS [750 mM NaCl], 0.1% SDS, 0.5% deoxycholic acid, 0.5% NP-40), and with protease K. Processed. RNA was extracted using trizol (Invitrogen) and RT-qPCR was performed as described above.</p><p> Expression and purification of human PRC2 components N-terminal FLAG-tagged EZH2 and SUZ12 in pFastBac1 were expressed in Sf9 cells for expression of the human PRC2 subunit (Francis et al., 2001). For expression of the entire PRC2 complex, FLAG-tagged EZH2 co-expressed with untagged SUZ12, EED and RBAP48. Extracted by 4 freeze-thaw cycles in BC300 buffer (20 mM HEPES (pH 7.9), 300 mM KCl, 0.2 mM EDTA, 10% glycerol, 1 mM DTT, 0.2 mM PMSF, and complete protease inhibitor (Roche)) The product was made, bound to M2 beads for 4 hours, washed with BC2000 and then eluted in BC300 with 0.4 mg / ml flag peptide. EZH2 and PRC2 were adjusted to 100 mM KCl and loaded onto a HiTrap heparin FF 1 ml column and eluted using a concentration gradient of 100-1000 mM KCl. Peak fractions were concentrated using an Amicon Ultra 10 kDa MWCO concentrator (Millipore) and loaded onto a BC300 equilibrated Superose 6 column. The peak fraction was collected and concentrated. For SUZ12, the flag-eluting fraction was concentrated and BC300 equilibrated with Superdex. Loaded 200 columns.</p><p> Electrophoretic Mobility Shift Assay (EMSA) RNA-EMSA was performed as previously described (Zhao et al., 2008). A 30 nucleotide Hes-1 probe (approximately 270 bp downstream from TSS in the antisense direction) was used for gel shift. RNA probes were radiolabeled with [γ-33p] ATP using T4 polynucleotide kinase (Ambion). Purified PRC2 protein (1 μg) was incubated with a labeled probe at 4 ° C for 1 hour. The RNA-protein complex was separated on a 4% non-denatured polyacrylamide gel in 0.5 × TBE at 250 V at 4 ° C for 1 hour. The gel was dried and exposed to Kodak's BioMax film.</p><p> RNA pull-down assay We incorporated the T7 promoter sequence into the forward primers for PCR products of RepA, Xist exon 1 and shortened Gtl2. The full-length Gtl2 was cloned to pYX-ASC, and the Xist E1 was cloned to pEF1 / V5 / HisB (Invitrogen). Specific primer sequences, RepA-F: TAATACGACTCACTATAGGGAGAcccatcggggccacggatacctgtgtgtcc; SEQ ID NO 193088RepA-R: taataggtgaggtttcaatgatttacatcg; SEQ ID NO 193089Truncated-Gtl2-F: TAATACGACTCACTATAGGGAGATTCTGAGACACTGACCATGTGCCCAGTGCACC; SEQ ID NO 193090Truncated-Gtl2-R: CGTCGTGGGTGGAGTCCTCGCGCTGGGCTTCC; SEQ ID NO 193091Xist E1-F: atgctctgtgtcctctatcaga; SEQ ID NO: 193092 Xist E1-R: gaagtcagtatggagggggt; SEQ ID NO: 193093.</p><p> RNA was then transcribed using Mega Script T7 (Ambion), purified using trizol, and slowly cooled to promote secondary structure formation. For the pull-down assay, 5 pmol RNA supplemented with 3 μg Flag-PRC2 or Flag-GFP and 20 U RNAsin was incubated on ice for 30 minutes. 10 μl of flag beads were added and incubated on a rotator at 4 ° C for 1 hour. The beads were washed 3 times with 200 μl buffer containing 150 mM KCl, 25 mM Tris (pH 7.4), 5 mM EDTA, 0.5 mM DTT, 0.5% NP40 and 1 mM PMSF. The RNA-protein complex was eluted from the flag beads by adding 35 μl of 0.2 M glycine (pH 2.5). The eluate was neutralized by adding a tenth volume of 1M tris (pH 8.0) and analyzed by gel electrophoresis.</p><p> Knockdown analysis and qRT-PCR shRNA oligos were cloned into MISSION pLKO.1-puro (Sigma-Aldrich) vectors and transfected into wild-type mouse ES cells with lipofectamine 2000 (Invitrogen). Cells were harvested 10 days after puromycin sorting and qRT-PCR was performed to confirm RNA knockdown. The corresponding scrambled sequence (MISSION non-target shRNA) was used as the control (Scr). ShRNA Oligo for Gtl2: (Top Chain) 5'-CCG GGC AAG TGA GAG GAC ACA TAG GCT CGA GCC TAT GTG TCC TCT CAC TTG CTT TTT G -3'; SEQ ID NO: 193094, (Bottom Chain) 5'-AAT TCA AAA AGC AAG TGA GAG GAC ACA TAG GCT CGA GCC TAT GTG TCC TCT CAC TTG C -3'; SEQ ID NO: 1930995. Gtl2 RNA and Gtl2-as The qPCR primers for RNA are as described above. Primers for Dlk1 RNA: (Forward) 5'-ACG GGA AAT TCT GCG AAA TA -3'; SEQ ID NO: 193096 (Reverse) 5'-CTT TCC AGA GAA CCC AGG TG -3'; SEQ ID NO: 193097. Another Gtl2 shRNA was purchased from Open Biosystems (V2MM_97929). Ezh2 levels after knockdown using this shRNA were tested by qPCR (Zhao et al., 2008). After testing multiple clones, we concluded that Gtl2 can be knocked down in early passage clones (50-70%), but knockdown clones are difficult to locate in long-term cultures.</p><p> DNA ChIP and real-time PCR as described (Zhao et al., 2008) ChIP was executed. 5 μl of anti-Ezh2 antibody (Active Motif 39103), normal rabbit IgG (Upstate 12-370) and anti-K27 trimethylated histone H3 antibody (Upstate) were used for each IP. Use prGtl2F / prGtl2R for Gtl2-proximal DMR, DMR-F / DMR-R for Gtl2-distal DMR, prDlk1F / prDlk1R for Dlk1 promoter, and prGAPDH-F / prGAPDH for Gapdh promoter. Real-time PCR of ChIP DNA was performed using -R. The primer sequence is as follows. proximal-DMR, 5'- CATTACCACAGGGACCCCATTTT; SEQ ID NO: 193098proximal-DMR, 5'- GATACGGGGAATTTGGCATTGTT; SEQ ID NO: 193099prDlk1F, 5'- CTGTCTGCATTTGACGGTGAAC; SEQ ID NO: 193100prDlk1R, 5'- CTCCTCTCGCAGGTACCACAGT; SEQ ID NO: 193101distal-DMR-F, 5'-GCCGTAAAGATGACCACA; SEQ ID NO: 193102distal-DMR-R, 5'-GGAGAAACCCCTAAGCTGTA; SEQ ID NO: 193103prGAPDH-F, 5'-AGCATCCCTAGACCCGTACAGT; SEQ ID NO: 193105prActin-F, 5'- GCA GGC CTA GTA ACC GAG ACA; SEQ ID NO: 193106prActin-R, 5'- AGT TTT GGC GAT GGG TGC T; SEQ ID NO: 193107</p><p> The following materials and methods were used in Examples 10-15 shown below. LNA Nucleofection 2 x 106 SV40T transformed MEF cells were resuspended in 100 μl of Mef nucleofector solution (Lonza). Cy3-labeled LNA molecules were added to a final concentration of 2 μM. Cells were transfected using the T-20 program. 2 ml of medium was added to the cells and 100 μl of this suspension was plated on 10-well slides gelatin coded at each time point. The LNA sequence was designed using Exiqon software (available at exiqon.com). Modified LNA bases were strategically introduced to maximize target affinity (Tm) while minimizing self-hybridization scores. The LNA molecular sequence (from 5'to 3') was as follows. LNA-Scr, GTGTAACACGTCTATACGCCCA; SEQ ID NO: 193108LNA-C1, CACTGCATTTTAGCA; SEQ ID NO: 193109LNA-C2, AAGTCAGTATGGAG; SEQ ID NO: 193110LNA-B, AGGGGCTGGGGCTGG; SEQ ID NO: 193111LNA-E, ATAGACACACAAAAGCA; 4978, GCTAAATGCACACAGGG; SEQ ID NO: 193114LNA-5205, CAGTGCAGAGGTTTTT; SEQ ID NO: 193115LNA-726, TGCAATAACTCACAAAACCA; SEQ ID NO: 193116LNA-3', ACCCACCCATCCACCCACCC; SEQ ID NO: 193117</p><p> Total RNA was extracted after nucleofection using real-time PCR trizol (Invitrogen). A reverse transcription reaction was performed using the Superscript II kit, and real-time PCR was performed on the cDNA sample using icycler SYBR Green Chemistry (Biorad). Cells were fixed in 1% formaldehyde solution at various time points after ChIP nucleofection. Fixation was stopped by adding glycine up to 0.125 M, and ChIP was performed as previously described (28), and quantification was performed by qPCR.</p><p> Antibodies Antibodies to various epitopes were purchased as follows. H3K27me3, Active Motif 39535. Ezh2, Active Motif 39639 and BD Pharmingen 612666. For immunostaining, the H3K27me3 antibody was used at a 1: 100 dilution and the Ezh2 antibody (BD Pharmingen) was used at a 1: 500 dilution. The Alexa-Fluor secondary antibody was purchased from Invitrogen. For Western blot, Ezh2 antibody (BD Pharmingen) was used at a 1: 2000 dilution. Actin antibody (Sigma A2066) was used at a 1: 5000 dilution.</p><p> DNA FISH, RNA FISH and immunostained cells were cultured on gelatin-coated glass slides or cytospinned. RNA FISH, DNA FISH, continuous RNA-DNA FISH, immunostaining and immuno-FISH were performed as described (24). Xist RNA FISH was performed using a nick-translated pSx9-3 probe or Xist revolving probe cocktail. PSx9-3 was used as a probe for Xist DNA FISH. Colchicine was added to the cells for 1 hour for a metaphase chromosomal spread. Cells were trypsinized and resuspended in 3 ml 0.056 M KCl at room temperature for 30 minutes, centrifuged and resuspended in methanol: acetic acid (3: 1) fixative. After changing the fixation solution several times, the cells were dropped onto a cooled slide glass and treated with RNA FISH or DNA FISH.</p><p> Example 1. Collection of PRC2 transcriptome by RNA immunoprecipitation-sequencing Prior to, RepA, Xist and Tsix were identified as PRC2 interacting RNAs by unmodified RNA immunoprecipitation (RNA immunoprecipitation) (Zhao et al. , 2008). Here we combine undenatured RNA immunoprecipitation (Zhao et al., 2008) with RNA sequencing (Cloonan et al., 2008) (this method is referred to herein as "RNA immunoprecipitation-sequencing". Developed a method for collecting a genome-wide pool bound to PRC2 (see exemplary Figure 1A). Nuclear RNA immunoprecipitated by anti-Ezh2 antibody was isolated from mouse ES cells (Lee and Lu, 1999) and Ezh2-/-control (Shen et al., 2008) (Fig. 1B) using a strand-specific adapter. cDNA was made and 200-1,200 nucleotides of cDNA was purified and subjected to Illumina sequencing (Fig. 1C).</p><p> In a pilot experiment, we performed RNA immunoprecipitation on 107 ES cells and included several control RNA immunoprecipitation in the experiment to assess the specificity of the anti-Ezh2 pulldown. In the wild-type pull-down and its technical and biological repeats, the anti-Ezh2 antibody precipitated 70-170 ng of RNA from 107 ES cells and produced a smear of cDNA greater than 200 nucleotides (Fig. 1C, Figure 7A). Treatment with ribonuclease removed products of this range size (Fig. 7B), and samples without reverse transcription produced no products. These facts suggest that the immunoprecipitated material was actually RNA. There was about 10-fold less RNA present when Ezh2-/-pull-down (about 14 ng) and when wild-type cells were immunoprecipitated by IgG (about 24 ng). A 500-fold enrichment relative to the mock RNA immunoprecipitation control (without cells) was also observed. For size ranges greater than 200 nucleotides, control RNA immunoprecipitation (null cells, IgG pulldowns, mock) was even less RNA, and these samples were exclusively adapter and primer dimers. We computationally removed adapter / primer dimers, rRNA, mitochondrial RNA, reads with less than 18 nucleotides or undetermined nucleotides, and homopolymer chains greater than 15 bases (Fig. 7). Control RNA immunoprecipitation had significantly lower reads from comparable numbers of cells (Fig. 7D). In the wild-type library, 23.188-1.2 million leads remained after sorting. In contrast, controls left only 4,888-73,691 reads (Figure 1D, columns 2 and 3). The overwhelming majority of transcripts in controls were suspicious (adapter / primer dimers, homopolymers, etc.). Therefore, wild-type RNA immunoprecipitation showed significant RNA enrichment and higher RNA complexity compared to control RNA immunoprecipitation.</p><p> Approximately half of all reeds in the wild-type library appeared more than three times. Even after removing duplicate sequences to avoid potential PCR anthropogenic products, the wild-type library contained 301,427 separate reads (98,704, respectively, for technical and biological iterations). And 87,128), while the control sample produced only 1,050 (IgG) and 17,424 (null) (Fig. 1D). The wild-type libraries are very similar to each other, with a correlation coefficient (CC) of 0.71 to 0.90 for the Ezh2-/-control and IgG control, respectively, compared to 0.27 to 0.01 when compared. Was (Fig. 1E). Reads corresponding to more than 10 copies per genome accounted for less than 20% of all wild-type reads (Figure 1F), with simple repeats being the most common, accounting for 85.714%, while LINE, SINE and LTR It was relatively underestimated (Fig. 1G). Since most reads have alignments of 10 or less, we will focus on analyzing these reads from now on (cutoffs of 10 or less carry genes with low copy number genomic duplication).</p><p> We then investigated their distribution on the genome by plotting separate reads as a function of chromosomal location (Figures 8-12). Alignment showed that PRC2-binding RNA is present on all chromosomes in the wild-type library. Alignment for IgG controls and Ezh2-/-controls showed few reads, showing sporadic reads. Therefore, our RNA immunoprecipitation-sequencing provided a specific and reproducible profile for the PRC2 transcriptome. A large number of wild-type reads hit the X chromosome (Fig. 1H), and our positive controls, namely Tsix RNA, RepA RNA, and Xist RNA, each appear dozens of times, expanding the X-chromosome inactivation center. Shown by objects (Fig. 1I). The hypersensitivity of our RNA immunoprecipitation-sequencing detection was suggested by the indications of RepA and Xist, which are expressed in total less than 10 copies per ES cell (Zhao et al.,, 2008). On the other hand, there were no hits in other non-coding RNAs of the X-chromosome inactivation center. Therefore, RNA immunoprecipitation-sequencing techniques were sensitive and specific.</p><p> Example 2. PRC2 Transcriptome To obtain saturated inclusion, we expanded the sequencing to obtain 31.9 million reads for the original wild-type sample and 36.4 million reads for its biological repeats. .. After removing and sorting duplicate sequences as shown in Figure 7A, 1,030,708 and 852,635 separate reads with less than 10 alignments remained for each library. All analyzes were then performed using these reads in combination with pilot wild-type leads (hereafter referred to as the WT library) and the Ezh2-/-library as controls for subsequent analysis. To determine the threshold for calling a transcript a member of the "PRC2 transcriptome", we argue that a genuine PRC2 interacting transcript would have a higher read density than the background. Based on the principle, (i) between the WT library and the null library because (i) the number of separate reads per transcript and, if true positive, would be enriched with WT. The strategy was designed based on the relative expression of. We have "reads per kilobase per million reads" (RPKM) (Mortazavi et al., As a way to normalize gene length and sequencing depth. 2008) was used to calculate the genetic expression, then all 39,003 transcripts in the UCSC ligated transcriptome by their WT RPKM values (x-axis) and their null RPKM values (y-axis). Mapped to a scatter plot (Figure 2A). Transcripts with 0 or near 0 expression in both libraries occupied the majority of the data points [blue haze at (0, 0)]. Transcripts with a non-zero x-value and a zero y-value show a population that appears only in the WT pull-down (Figure 2A, y = 0 line).</p><p> We confirmed the minimum density by using the control transcript as a calibration point. Xist / RepA contained an RPKM of 4.19, which means 126 separate leads per million. The Tsix score was 10.35, and the Bsn-pasr (about 300 nucleotide Bsn promoter-related transcript (Kanhere et al., 2010)) scored 0.95. The imprint antisense transcript Kcnq1ot1 is claimed to interact with PRC2, but it is not known if it interacts directly (Pandey et al., 2008). The score for Kcnq1ot1 was 1.17. For negative controls, we used transcripts that would not be deductively present in the WT library. For example, Hotair is expressed late in development only in tail tissue (Rinn et al., 2007). It scored 0.25, which means only one expression per million. Two other promoter-related RNAs, Hey1-pasr and Pax3-pasr (Kanhere et al.,, 2010) was less than 200 nucleotides and was omitted from our size selection program. Their scores were 0.28 and 0.11, respectively, suggesting a distinct lead of well less than 1 per million. MRNAs encoding proteins localized in the cytoplasm that are not expected to be PRC2 interacting also showed low RPKM [Insl6: 0.27, Ccdc8: 0.22]. We consider these low expressions as the background. Based on the calibration points, we set the minimum RPKM to x = 0.40, which is between the values of the positive and negative controls.</p><p> To determine the appropriate enrichment threshold, we investigated the WT / null RPKM ratio for the same calibrator. The Xist / RepA score was 4.18 / 0, which means hundreds to thousands of representations in the WT library, but no representations in the null library . The Tsix score was 10.35 / 3.27, the Bsn-pasr score was 0.95 / 0, and the Kcnq1ot1 score was 1.17 / 0. Negative control scores were low, but Pax3-pasr scored 0.11 / 0.26, Hey1-pasr scored 0.28 / 0, Hotair scored 0.25 / 0, and Insl6 scored. Was 0.27 / 3.09, and the score for Ccdc8 was 0.22 / 5.04. Based on this, we set the enrichment cutoff to 3: 1. A combination of criteria for transcript inclusion [RPKM (WT) = 0.4, RPKM (WT) / RPKM (null) = 3.0] directly between WT and null libraries using a set of established controls. Based on the comparison, it is expected to eliminate false positives and deduct background.</p><p> Based on these criteria, we estimated the PRC2 transcriptome to be 9,788 RNA (Table 2). Approximately 4,446 transcripts in the ligated UCSC transcriptome (39,003 transcriptome) were included in our PRC2 transcriptome (Fig. 2B). Another 3,106 UCSC transcript was hit, but only on the reverse strand, indicating the presence of previously unannotated 3,106 antisense RNA. Approximately 1,118 UCSC transcripts were hit in both directions, implying the presence of 2,236 additional distinct transcripts. 19% of the leads did not hit the UCSC database. These "orphan leads" suggest that the transcriptome may contain other novel transcripts. Therefore, 9,788 represents the lower limit of the actual PRC2 transcriptome in ES cells. Since the total mouse transcriptome is thought to be around 40,000 to 200,000, the PRC2 transcriptome contains 5-25% of the total mouse transcript, depending on the actual size of the total transcriptome.</p><p> Example 3. Epigenetic characteristics We investigated specific epigenetic characteristics (Fig. 2B, Table I, 3-7). Interestingly, a region consistent with the Ezh2 footprint candidate (Zhao et al., 2008), the RepA region within Xist and the 3'end of Tsix appeared multiple times (Fig. 2C). In the metagene analysis, we determined the relationship of the transcript to the transcription initiation site (TSS) by plotting the number of reads as a function of distance (Fig. 2D). In the forward strand, enrichment was observed at -2.0 to +0.001 kb. In the reverse chain, a peak was observed at -0.5 to +0.1 kb. Concentration occurred across the background (null, IgG control) (Fig. 7C). Presence of short transcripts at the promoter (Kapranov et al., 2007; Core et al., 2008; Seila et al., 2008; Taft et al., 2009), preferential occupancy of PRC2 near the promoter (Boyer) et al., 2006; Lee et al., 2006; Schwartz et al., 2006; Considering Ku et al., 2008) and the identification of several TSS-related RNAs that bind to PRC2 (Kanhere et al., 2010), the association with TSS is significant.</p><p> Next, we found that how much of the PRC2 transcriptome is in ES cells with the PRC2 binding site (Boyer et al., 2006; Lee et al., 2006) and the bivalent domain (Bernstein et al., 2006a; Mikkelsen et al., 2007; We asked if we had fellowship with Ku et al., 2008). Notably, there were at least one RNA hit in 562 (21%) of the 2,704 bivalent domains and 330 (18%) of the 1,800 Suz12 binding sites. However (Fig. 2B, Tables 3 and 4), this suggests that RNA may be involved in the recruitment or retention of polycomb complexes at the binding site and in a subset of control stem cell fate. Sites that do not intersect with our transcriptome may recruit PRC2 using other mechanisms. We also have a group of intergenic non-coding RNAs called "long non-coding RNAs (lincRNAs)" (Guttman et al., The degree of overlap with 2009) was calculated. Intersecting 2,127 mouse long non-coding RNAs (lincRNAs) with our 9,788 transcripts revealed 216 duplications (Figure 2B, Table 5), which are long. We show that intergeneric non-coding RNA (lincRNA) accounts for about 2% of the PRC2 transcriptome. Of the human long non-coding RNAs (lincRNAs), 260 may bind to PRC2 (Khalil et al., 2009). To ask if 260 human long non-coding RNAs (lincRNAs) overlap with 216 mouse long non-coding RNAs (lincRNAs) in our PRC2 transcriptome, we lift Over (genome). We mapped synteny coordinates in mice by .ucsc.edu / cgi-bin / hgLiftOver (available on the World Wide Web), but found no recognizable homology between the two subsets. Therefore, our transcriptome represents a large and separate set of PRC2 interacting RNAs.</p><p> Since misregulation of polycomb proteins is often associated with cancer, we intersected PRC2 interacting RNA with oncogene and tumor suppressor loci (Sparmann and van Lohuizen, 2006; Bernardi and Pandolfi, 2007; Miremadi et. al., 2007; Rajasekhar and Begemann, 2007; Simon and Lange, 2008). Interestingly, of the 441 and 793 tumor suppressor genes (available on the Worldwide Web at cbio.mskcc.org/CancerGenes), 182 (41%) and 325 (41%), respectively. There is at least one PRC2 interacting transcript in either direction (Fig. 2B, Tables 6 and 7), suggesting that RNA plays a role in misregulation of polycomb recruitment in cancer. Notable examples include c-Myc, Brca1, Klf4 and Dnmt1. After all, genomic imprinting must be cis-controlled, like X-chromosome inactivation. Imprint genes are regulated by the cis-acting "imprint control region" (ICR), which regulates parent-specific expression (Edwards and Ferguson-Smith, 2007; Thorvaldsen and Bartolomei, 2007). Interestingly, although ICRs are generally associated with long-chain transcripts (Williamson et al., 2006; Pandey et al., 2008; Wan and Bartolomei, 2008), many of which were found during the PRC2 transcriptome (Fig. 2B, Table 2). They include H19, Gtl2, Kcnq1ot1 and Nespas. Although there were multiple hits in Nespas RNA / TR019501 (Fig. 3A), antisense RNA from the major ICR is thought to regulate Nesp / Gnas clusters (Coombes et al., 2003; Williamson et al., 2006). ). Also, although there were repeated hits on Gtl2 (Fig. 3B), its sitting position is thought to control the imprinting of Dlk1 along with the antisense relatives of anti-Rtl1 and Gtl2 (here referred to as Gtl2-as). (Edwards et al., 2008). Hits within ICR-related long-strand transcripts suggest that RNA can regulate imprinted clusters by targeting PRC2.</p><p> Example 4. Verification of RNA-PRC2 interaction We then examined RNA-protein interactions by several approaches. First, we performed RNA immunoprecipitation-qPCR and found that candidate RNA was significantly enriched in anti-Ezh2 pull-down compared to IgG pull-down (Fig. 4A). Strong positive pull-downs were observed for imprinted Gtl2 and its antisense relatives Gtl2-as / Rtl1 and Nespas / TR019501. Hspa1-as (antisense against Hsp70), Malat-1-as (antisense against Malat-1), Bgn-as (antisense against Bgn), Ly6e-as (antisense against lymphocyte antigen 6 complex locus E) A number of previously unknown antisense transcripts or RNAs associated with disease-related loci, including RNA located upstream of the Foxn2-as (antisense against Foxn2) and Htr6 serotonin receptors, are also enriched. It was. Second, we compared the amount of RNA pulled down by the anti-Ezh2 antibody between WT ES cells and Ezh2- / -ES cells (Fig. 4B). In all cases, RNA was significantly more enriched with WT. In contrast, the negative control Malat-1 sense transcript showed no enrichment. Third, we use UV cross-linking-RNA immunoprecipitation (Ule et.), Another method of testing RNA-protein interactions in vivo, based on the ability of UV to cross-link RNA to proteins close to 0 angstrom. al., 2005) was performed. This method better detects direct RNA-protein interactions, and RNA alone, as cross-linking occurs only in a short range and the complex is isolated using ultrasonic disruption and high salinity washing. Reunion anthropogenic products during separation can be avoided. Concentration of candidate RNA was also observed using this method (Fig. 4C). Taken together, these data support the specificity of RNA immunoprecipitation-sequencing and suggest a direct interaction between RNA and Ezh2.</p><p> Nearly half of the transcripts identified by RNA immunoprecipitation-sequencing were previously unannotated (Figure 2B). To verify their presence, we performed a Northern analysis and found a separate transcript in ES cells (Fig. 4D). To confirm the properties of the nucleic acids precipitated by the anti-Ezh2 antibody, we pretreated the nuclear extract with ribonucleases with different substrate specificities. RNA pull-down disappeared after digestion with single-strand-specific ribonuclease (ribonuclease I) and double-strand-specific ribonuclease (ribonuclease V1), but ribonuclease H (which degrades RNA strands in RNA: DNA hybrids) and deoxyribonuclease Digestion with I had no effect (Fig. 4E). Therefore, RNA in the complex with PRC2 has single-stranded and double-stranded characteristics.</p><p> Example 5. Direct binding of RNA to PRC2 We then perform in vitro biochemical analysis using the purified recombinant human PRC2 subunits EED, EZH2, SUZ12 and RBAP48 to directly bind RNA to PRC2. I dealt with the question of whether or not (Fig. 5A). The newly identified antisense RNA of Hes1 (Transcription factor of Notch signaling pathway (Axelson, 2004)) is also a motif found in RepA (Zhao et al.,, 2008) Includes a double stem-loop structure (Fig. 5B). In the RNA electrophoresis mobility shift assay (EMSA), both the 28-nucleotide RepA probe and the 30-nucleotide Hes1-as probe were shifted by PRC2, but RNA (DsI, DsII) from other regions of Xist was shifted. I didn't. Mutations in the stem-loop structure reduced PRC2 binding. To determine which subunit of PRC2 binds to Hes1-as, we performed an EMSA with specific subunits (Figures 5A, D, E). EZH2 strongly shifted wild-type Hes1-as RNA, but not mutant Hes1-as RNA. On the other hand, neither SUZ12 nor EED shifted Hes1-as. When whole PRC2 was used, RNA-protein shifts were always more discrete, suggesting that other subunits interact-stabilize. These results indicate that Hes1-as RNA interacts directly and specifically with PRC2, and that Ezh2 is an RNA-binding subunit.</p><p> We also investigated Gtl2 RNA. Since Gtl2 is 1.7-4.3 kb, which is too large to be tested by EMSA, we performed an RNA pull-down assay (Fig. 5F). We transcribed Gtl2, shortened form (1.0 kb from the 5'end), RepA and Xist exon 1 (negative control) in vitro, and equimolar amounts in a pull-down assay using Flag-PRC2 or Flag-GFP protein. Each RNA was tested. Both full-length and shortened Gtl2 RNA were consistently enriched in the PRC2 pull-down. RepARNA was also enriched, but Xist exon 1 was not. These results indicate that Gtl2RNA, perhaps 1.0 kb proximal to it, binds directly and specifically to PRC2.</p><p> Example 6. Gtl2-PRC2 interaction regulates gene expression in Dlk1-Gtl2 To investigate whether RNA immunoprecipitation-sequencing was successful in discovering new functions, we called Callipyge in sheep. Focuses on Gtl2-PRC2 interaction in Dlk1-Gtl2, an imprint locus associated with growth dysregulation in mice, and cancer in humans (Edwards et al., 2008; Takahashi et al., 2009) I guessed it. Gtl2 expressed from maternal chromosomes is associated with ICR (Fig. 6A) and is claimed to regulate Dlk1 expressed from paternal chromosomes (Lin et al., 2003; Takahashi et al., 2009), the mechanism of action is currently unknown. To determine if the Gtl2 transcript itself regulates Dlk1, we knocked down Gtl2 in ES cells and observed a 2-fold increased expression of Dlk1, which is because Dlk1 expresses a monoallele. It fits the idea that the expression of the biallele was changed from (Fig. 6B). Gtl2-as was also upregulated. These experiments show that Gtl2 functions as RNA because shRNA targets RNA for degradation after transcription.</p><p> To address the question of whether RNA functions by attracting PRC2 to Dlk1, we performed quantitative chromatin immunoprecipitation (ChIP) using anti-Ezh2 and anti-K27 trimethylated histone H3 antibodies. In fact, when Gtl2 RNA was knocked down, we detected a 2-fold reduction in recruitment of Ezh2 to the Dlk1 promoter and a similar reduction in histone H3-K27 trimethylation in the cis region (Fig. 6C). ), Which is consistent with increased expression of Dlk1 (Fig. 6B). We also noticed a decrease in Ezh2 recruitment and histone H3-K27 trimethylation in the methylation variable region (DMR) of the ICR proximal to Gtl2, but with less effect in the distal DMR (Figure 6C). I found out. Because the distal DMR is genetically upstream of Gtl2 (Lin et al., 2003; Takahashi et al., 2009), we did not anticipate regulation by Gtl2. Gapdh and actin controls showed no significant reduction after Gtl2 knockdown, and reduced recruitment of Ezh2 to Dlk1 was not the result of a generally reduced Ezh2 level in Gtl2 knockdown cells (Fig. 6D). .. These data show that Gtl2 actually works by attracting PRC2 to Dlk1. Further support, the disappearance of Ezh2 resulted in an approximately 3-fold increase in Dlk1 expression relative to Gtl2 levels (Fig. 6E), resulting in a phenotype similar to that of Gtl2 knockdown. Considering the direct Gtl2-PRC2 interaction (Fig. 5) and the disappearance of Ezh2 / histone H3-K27 trimethylation in Dlk1 when Gtl2 is knocked down (Fig. 6), the Gtl2-PRC2 interaction is cis. We conclude that Dlk1 is regulated by targeting PRC2 to Dlk1.</p><p> Example 7. Regulation of oncogenes and tumor suppressor genes by long non-coding RNA As described earlier herein, the application of the RNA immunoprecipitation-sequencing method created a genome-wide pool of long non-coding RNA transcripts that bind to the PRC2 transcriptome. The genomic distribution of the identified transcripts was investigated by plotting separate reads as a function of chromosomal location. As a result, long non-coding (lnc) RNAs that regulate both oncogenes and tumor suppressor genes have been identified. FIG. 13 illustrates a plot showing the area around the c-Myc oncogene (red bar). An enlarged view of the reeds around the c-Myc oncogene shows an impressive peak of PRC2 binding (tall red peak at chromosomal coordinates 61,870,000). Further analysis revealed that this lncRNA is Pvt1 (GenBank accession number Z12002.1 (mouse), or NR_003367.1 (human)). Pvt1 is known in the art to be disrupted in some cases of Burkitt lymphoma, as well as in plasmacytoma (eg, by translocation from another chromosome). Therefore, Pvt1 may act by targeting PRC2 to c-Myc to suppress its expression. Therefore, exogenous administration of Pvt1 or fragments thereof could relieve the dysfunctional phenotype of Pvt1 that causes various cancers.</p><p> Figure 14 shows the Nkx2-1 gene (also known as Titf1; Genbank accession numbers NM_001079668.2 (human mRNA) and NM_001146198.1 (mouse mRNA); genomic sequences NC_000014.8 (human), NT_026437.12, NC_000078). A plot showing the area around (.5 (mouse) or NC_000078.5 (mouse)) is illustrated. In humans, NKX2-1 is often amplified or mutated in lung adenocarcinoma and is directly associated with lung cancer formation. It is described as a proto-oncogene that promotes early cancer development, but at the same time, loss of its expression is ultimately associated with a poor prognosis. Therefore, regulation of NKX2-1 is of particular interest, as the regulatory element may be used to regulate NKX2-1 expression in patients. The circled region of the plot represents the position of PRC2 that binds to the antisense lncRNA within the mouse (also known as Titf1) Nkx2-1 gene. Based on the pattern and density of hits, the antisense RNA appears to contain the mouse genome assembly version NCBI37 / mm9 (which appears to contain the Nkx2-1 promoter and AK14300) at 57,636,100-57,638,250 bp intervals on mouse chromosome 12 (sequence). It is in number 191088). The RNA species at the 5'end of Nkx2-1 is a promoter-related antisense transcript that overlaps the Nkx2-1 promoter and is within the divalent domain. As mentioned earlier, mouse and human RNA is well conserved even for long non-coding RNAs (eg, PVT1, XIST, GTL2). Mouse-to-human LiftOver analysis and UCSC Genome Browser analysis of synteny positions revealed that the human NKX2-1 / TITF1 locus (human gene BX161496; human genome assembly version GRCh37 / hg19, chromosome 14: 36,988,521-36, The presence of similar non-coding antisense promoter-related transcripts is indicated for 991,722 bp (which may overlap even if it does not match SEQ ID NO: 191087). Similarities in gene structure and the presence of upstream RNA sequences are evident in the UCSC Genome Browser. These points suggest that the control of human sitting can be similar to that in mice.</p><p> The level of this antisense transcript can be regulated to affect the expression of NKX2-1. Promoter-binding antisense transcripts are administered to subjects with amplified NKX2-1 expression, such as patients with lung adenocarcinoma, and / or to tumor cells to reduce NKX2-1 expression. be introduced. Alternatively, in patients with a poor prognosis in which NKX2-1 expression has disappeared, an inhibitory RNA such as an LNA molecule that specifically binds to a region within the NKX2-1 antisense lncRNA is introduced, which is PRC2 interacting antisense transcription. It antagonizes the substance and resumes expression of the NKX2-1 gene.</p><p> Example 8. Identification of PRC2 Binding Peaks from Appendix I In some or any embodiment, the region of RNA to which a protein binding partner (eg, PRC2) binds is designed to hybridize the inhibitory nucleic acid. It is one of the representative positions on its target lncRNA. For example, these regions can be identified by reviewing the data in Appendix I and identifying the regions that are enriched in the dataset. These regions may contain PRC2 binding sequences.</p><p> The sequence reads in Appendix I are derived directly from the Illumina GA-II Genome Analyzer and are in the direction of the inverse complementary strand of the PRC2-binding transcript. Appendix I shows a selected subset of all bioinformatics selections after adapter / prime dimer, mitochondrial RNA, rRNA, homopolyma, reads with uncertain nucleotides, and shortened reads (less than 15 nucleotides) have been removed. is there. They may represent the regions best protected from endogenous nucleases during the RNA immunoprecipitation described in Example 1 above and the subsequent RNA purification step (RNA immunoprecipitation-sequencing method). Therefore, it represents a candidate region of RNA that binds to PRC2 or a binding protein or complex. Reads were extracted from Appendix I for transcripts enriched 3: 1 between WT and null [RPKM (WT) / RPKM (null) = 3.0] and having a minimum RPKM value of 0.4. .. We then use continuous pile-ups (peaks) of the read to identify regions of the PRC2-binding transcript and consider them as candidate contact regions for PRC2 within RNA.</p><p> The sequence reads in Appendix I were used to create sequence coverage for the reference genome using the Arachne Aligner Short Query Lookup from Broad Institute, which created a dictionary of k-mer (K = 12) for the reference genome. And based on the execution of a local Smith-Waterman alignment for the candidate position of the read based on the position of the matching k-mar in the genome. The aligner performs multiple placements. The best alignment can have at most one error, and alignments that differ by up to one from the number of errors in the best alignment are also acceptable. Comprehensiveness is normalized by dividing by the number of positions in which the read aligns (for example, if a read aligns in four locations, 0.25 is added to each of the four bases).</p><p> The following methodology was used to obtain the target peak. Wild-type inclusion of transcriptome is enriched at least 3 times that of Ezh2-/-transcriptome, and base-level mouse (mm9) inclusion of regions with a minimum RPKM inclusion of at least 0.4. The degree file serves as a starting point. Its comprehensiveness is strand-specific. The peak values and their positions are then determined in a 100 bp long non-overlapping continuous window. The peak position is then corrected for peaks that are at the edge of the window and are determined to be on the side of the larger peak. Those peaks are moved to the tip of the larger peak. The overlapping peak positions are then removed. The peak position in the flat area is moved to the center of the flat area. Next, the Gauss kernel with σ = 5.0<maths num="1"><img file="JP6577611B2_D0007.tif" /></maths>The degree of inclusion is smoothed using. The peak width is then determined by peaking the most proximal position so that the smoothed coverage is less than one-third of the maximum coverage. By placing a boundary between them at the midpoint between the peaks, adjacent peaks that overlap each other are separated.</p><p> The peak is then output to the table with the sum of position, width, maximum amplitude, and unsmoothed coverage below the peak width. The corresponding nucleotide sequence of the mouse peak at mm9 (converted to RNA by substituting T for U) appears in the sequence listing as SEQ ID NOs: 21583-124436 or SEQ ID NOs: 190717-190933. Mouse chromosomal coordinates of these mouse peaks and mouse-to-human LiftOver of chromosomal chains were performed in the UCSC Genome Browser as described herein to generate orthologous human chromosomal coordinates. This process and the Lift Over chain are generally described in Kent et al., Proc. Nat'l Acad. Sci., 100 (20) 11484-11489 (2003). When the mouse coordinates (mm9) of each mouse peak are converted to the corresponding human (hg19) coordinates, whenever a match occurs, the mapping percentages of 50, 65, 75 and 95 are essentially the same position and length. The result was brought about. As a result, we used 50% mapping parameters.</p><p> The corresponding human peak RNA sequences (ie, the nucleotide sequences of human chromosomal coordinates and chromosomal chains that are converted to RNA by substituting T for U) appear in the sequence listing as SEQ ID NOs: 124437-19716 or SEQ ID NOs: 190934-191086, respectively. .. These human peaks and the human PRC2 transcriptome (ie, the PRC2-binding transcripts referred to in Tables 1-7) to identify genes targeted by PRC2-binding RNA (ie, intersecting genes or near-by genes). Human sequence) was intersected with a known gene from the NCBI database.</p><p> Table 8 shows a note of mouse and human peaks and the names of genes near or intersect with each peak. The only NCBI gene ID associated with the human gene (listed first) or mouse gene (listed second) is shown in parentheses adjacent to the gene name. The degree of overlap between peak and gene coordinates is shown in square brackets. Positive numbers represent the number of nucleotides that overlap between the two, and negative numbers represent the size gap between the two (ie, the number of nucleotides that are separated between the two). For peaks, the "F" in square brackets indicates that the peak coordinates completely overlap the gene coordinates. For peaks, the "F" in square brackets indicates that the transcript coordinates completely overlap the gene coordinates, or vice versa. The RNA transcript or peak is "antisense" to the reference gene in the "reverse strand" column, while the RNA transcript or peak is in the same "sense" orientation as the reference gene in the "same strand" column.</p><p> Bioinformatics analysis shows that the average peak is about 40-60 bases, which is a good size for the initial design of the inhibitory nucleic acid. Over 100,000 peaks were identified in the mouse transcriptome of Table 2. Each of these peaks corresponds to an overlapping piece of inverse complementary read from Appendix I and is therefore fully represented by the inverse complementary read in Appendix I. Peaks can be found at any position within the coding gene, either in the sense or antisense direction. Peaks can also be found in the promoter / 5'UTR region, introns, internal exons and 3'UTRs. Analysis strongly suggests that the PRC2 interacting transcript is not a protein-encoding mRNA, but a separate transcript or a transcript that overlaps the mRNA sequence. Many are novel RNAs that have not been described so far.</p><p> Routine methods can be used to design an inhibitory nucleic acid that binds to a target location or fragment with sufficient specificity or is sufficiently complementary to the target RNA to produce the desired effect. it can. In some embodiments, the method comprises a bioinformatics method known in the art for identifying a region of secondary structure, eg, one, two, or more stem-loop structures or pseudoknots. Includes use and selection of regions for targeting with inhibitory nucleic acids. Further target fragments with a length of 5 to 500 nucleotides, or about 5 to about 100 nucleotides, containing or immediately adjacent to at least 5 contiguous nucleotides within the peak are also considered suitable for targeting.</p><p> Example 9. In vitro effect of inhibitory oligonucleotide on increased expression of mRNA A.ApoE Designed to target lncRNA as shown in Table 8 to increase expression of ApoE. did. Oligonucleotides are less than 16 bases in length and contain unmodified DNA and multiple locked nucleic acid modified bases, all linked by thiophosphate ester bonds. Transfection and data analysis were performed as briefly described below. RNA was collected from Hep3B cells using the Promega SV96 total RNA isolation system, omitting the deoxyribonuclease step. In another pilot experiment, 50 ng of RNA was determined to be a sufficient template for the reverse transcriptase reaction. RNA collected from Hep3B cells was normalized and 50 ng of RNA was fed into each reverse transcription reaction. For a small number of samples that were very diluted to reach this limit, the maximum input was added. Next, the quantitative PCR evaluation was completed.</p><p> As outlined above, quantitative PCR was used to determine baseline level ApoE mRNA expression. Baseline levels were also determined for the mRNAs of various constitutively expressed housekeeping genes. A "control" housekeeping gene with approximately the same level of baseline expression as ApoE mRNA was selected for comparison with ApoE. Hep3B cells were sown in each well of a 24-well plate at a density of 25,000 cells per 500 μL and transfected with lipofectamine and inhibitory oligonucleotides. The control well contained only lipofectamine. 48 hours after transfection, approximately 200 μL of cell culture supernatant was stored for ELISA at -80 ° C. Forty-eight hours after transfection, RNA was collected from Hep3B cells and quantitative PCR was performed as outlined above. ApoE by each inhibitory oligonucleotide by normalizing the mRNA level in the presence of the inhibitory oligonucleotide against the mRNA level in the presence of a control (lipofectamine only) The induction rate of mRNA expression was determined. This was compared side by side with elevated mRNA expression in the "control" housekeeping gene.</p><p> A total of 26 oligonucleotides tested were complementary to SEQ ID NO: 15050 in Table 2. Of these 26 oligonucleotides, 7 oligonucleotides increased apoE expression in human Hep3B cells, as indicated by increased ApoE mRNA levels compared to the "control" housekeeping gene. The above method was repeated using human proximal tubular epithelial cells (RPTEC). Of the 26 oligonucleotides complementary to SEQ ID NO: 15050 in Table 2, 5 oligonucleotides increased ApoE mRNA levels in kidney cells compared to the "control" housekeeping gene. Levels increased about 1.5 to about 5-fold relative to baseline expression. In addition, of the 11 oligonucleotides complementary to the peaks in Table 8 associated with apoE, 3 oligonucleotides increased apoE expression. Inhibitory oligonucleotides of only 8 nucleotides in length have been shown to increase gene expression.</p><p> B. Nkx2-1 Experiments with inhibitory oligonucleotides designed to target lncRNAs as shown in Table 8 to increase Nkx2-1 expression as described in Example 9A above. Was repeated. A total of 13 oligonucleotides tested were complementary to SEQ ID NO: 17040 in Table 2. Of these 13 oligonucleotides, 3 oligonucleotides increased Nkx2-1 expression, as indicated by increased Nkx2-1 mRNA expression compared to baseline, whereas the "control" housekeeping gene was Nkx2. It could not be associated with -1 due to the low level of original expression. In addition, of the 9 oligonucleotides complementary to the peaks in Table 8 associated with Nkx2-1, 3 oligonucleotides increased Nkx2-1 expression.</p><p> C. Brca1 Experiments were repeated for inhibitory oligonucleotides designed to target lncRNAs as shown in Table 8 to increase the expression of Brca1 as described in Example 9A above. A total of 30 oligonucleotides tested were complementary to SEQ ID NOs: 192,309 and SEQ ID NOs: 192,965 in Table 2. Of these 30 oligonucleotides, 5 oligonucleotides increased Brca1 expression. Of these 30 oligonucleotides, 13 were also complementary to the peaks in Table 8 associated with Brca1. Of the 13 oligonucleotides complementary to these peaks, 2 oligonucleotides increased Brca1 expression. Levels increased about 2-3-fold relative to baseline expression.</p><p> D. Smad7 For inhibitory oligonucleotides designed to target lncRNAs as shown in Table 8 to increase Smad7 expression, experiments as described in Example 9A above, with the following exceptions: Was repeated. The kidney cell line RPTEC was used instead of HepB3. A total of 28 oligonucleotides tested were complementary to SEQ ID NO: 18602 in Table 2. Of these 28 oligonucleotides, 4 oligonucleotides increased Smad7 expression. In addition, of the 28 oligonucleotides complementary to the peaks in Table 8 associated with Smad7, 4 oligonucleotides increased Smad7 expression.</p><p> E. SirT6 Experiments were repeated for inhibitory oligonucleotides designed to target lncRNAs as shown in Table 8 to increase SirT6 expression, as described in Example 9A above. A total of 25 oligonucleotides tested were complementary to SEQ ID NOs: 192,182 in Table 2. Of these 25 oligonucleotides, 3 oligonucleotides increased SirT6 expression. A total of 2 oligonucleotides tested were complementary to SEQ ID NOs: 130,694 in Table 2. Of these two oligonucleotides, one oligonucleotide increased SirT6 expression. A total of 2 oligonucleotides tested were complementary to SEQ ID NOs: 130,695 in Table 2. Neither of these two oligonucleotides increased SirT6 expression. Levels increased 2- to 6-fold relative to baseline expression. In addition, of the 6 oligonucleotides complementary to the peaks in Table 8 associated with SirT6, 1 oligonucleotide increased SirT6 expression.</p><p> F. Serpinf1 Experiments were repeated for inhibitory oligonucleotides designed to target lncRNAs as shown in Table 8 to increase the expression of Serpinf1 as described in Example 9A above. A total of 38 oligonucleotides tested were complementary to SEQ ID NO: 16698 and SEQ ID NO: 16699 in Table 2. Of these 38 oligonucleotides, 3 oligonucleotides increased Serpin F1 expression. Levels increased 1.2 to 2-fold relative to baseline expression. In addition, of the 32 oligonucleotides complementary to the Serpinf1 related peaks in Table 8, 3 oligonucleotides increased SerpinF1 expression.</p><p> Example 10. An LNA molecule targeting Xist repeat C rapidly eliminates Xist RNA from the Xi chromosome Geneious (Drummond et al.,, (2010) Geneious v5.1, available on the internet at geneious.com) was used to align repeat C and synthesize LNA molecules for two regions with a high degree of repeat-to-repeat storage (Figure 15A). ). The first LNA molecule was conservative for all 14 repeats (LNA-C1), and the second LNA molecule was conservative for 13 of the 14 repeats (LNA-C2) (Fig. 15A). .. LNA molecules were separately nucleofected into transformed mouse embryonic fibroblasts (MEFs) and the cells were adhered onto a slide class and 0 minutes after nucleofection (immediately after nucleofection). Cells were fixed in situ at various time points during the 8 hours. Xist RNA fluorescence in situ hybridization (FISH) was performed using an Xist-specific probe to investigate its effect on RNA. (MEF cells are tetraploid for transformation. Each tetraploid cell has two Xa chromosomes and two Xi chromosomes). In controls transfected with the scrambled LNA molecule (LNA-Scr), strong Xist haze was found in 80-90% of cells at all time points (Fig. 15C). Interestingly, the introduction of either LNA-C1 or LNA-C2 resulted in the rapid loss of Xist RNA from the Xi chromosome (Fig. 15B; LNA-C1 is shown; LNA-C1 and LNA-C2). The result is similar for.). Even at 0 (cells fixed between seconds and minutes immediately after LNA introduction), about 10% of the nuclei were unraveled Xist It showed clusters of RNA, which appeared to be vaguely diffused (Fig. 15C, lightest gray bar) (n = 149). The percentage of nuclei with a full Xist haze continued to decline during the first hour and reached a minimum at 60 minutes (21%, n = 190). These findings indicate that the LNA molecule was introduced and immediately disrupted the binding of Xist to chromatin. However, pinpoints of Xist RNA typical of neoplastic transcripts found in undifferentiated embryonic stem (ES) cells were visible in 3 hours (Fig. 15C, darkest gray bar) (at 1 hour). At 18%, n = 190; 3 hours, 36%, n = 123), the disappearance of Xist from the Xi chromosome was transient. Complete recovery of Xist haze was not seen until 8-24 hours after nucleofection (81% at 8 hours, n = 117).</p><p> The next experiment addressed the question of whether LNA molecules have similar effects in mouse ES cells, an established in vitro model that repeats XCI again as cells differentiate in culture. In the undifferentiated state, wild-type female ES cells express low levels of Xist RNA, which is recognized as a pinpoint signal by RNA FISH. By day 6 of induction of differentiation, in about 40% of cells, usually Xist There will be RNA expression. When ES cells were nucleofected with LNA-C1 on day 6, Xist elimination occurred rapidly, culminating in 1 hour and recovering by 8 hours. Therefore, the LNA molecule was effective in ES cells as well as somatic cells. These results were sharply contracted with the results obtained from MEFs nucleofected with siRNA or shRNA for the same Xist region. Neither siRNA nor shRNA resulted in Xist loss at 1, 3 or 24 hours, and only at 48 hours there was a partial reduction in Xist haze (83% at 1 hour, n = 84; 80% in 24 hours, n = 106). Therefore, LNA molecules can be used to efficiently target long-stranded cell nuclear non-coding RNAs such as Xist with very fast kinetics, much faster than the action of siRNA or shRNA in multiple cell types. ..</p><p> To test the specificity of the LNA molecule, 293 human cells were nucleofected with the repeat C LNA molecule. Sequence comparison between mouse and human Xist / XIST shows that the region targeted by LNA-C1 is conserved at 10 nucleotides out of 15 nucleotides, and that LNA-C2 is conserved at 10 nucleotides out of 14 nucleotides. Was clarified (Fig. 15C). XIST RNA following nucleofection of scrambled LNA molecule in human cells FISH showed two normal XIST haze in almost all cells (92%, n = 108). Similarly, nucleofection with either LNA-C1 or LNAC-2 did not change the XIST haze (LNA-C1, 89%, n = 126; LNA-C2, 85%, n = 139). ). Therefore, mouse repeat C LNA molecules do not affect the localization of human XISTs, suggesting that they function species-specifically. To determine if human repeat C can eliminate human XIST, we nucleofect 293 cells with an LNA molecule complementary to human repeat C, but observe the disappearance of XIST haze. There was no (91% at 1 hour, n = 103; 87% at 3 hours, n = 95, and 92% at 8 hours, n = 85). This finding indicates that repeat C may play a role in humans, but that another human component functions in RNA localization. Mouse repeat C is present 14 times, while human repeat is present only once (8, 9).</p><p> Example 11. Xist RNA is eliminated without destabilizing the transcript. Several mechanisms could explain the disappearance of Xist. The LNA molecules could be annealed to the complementarity regions and targeted to Xist for degradation. Alternatively, hybridization to the LNA molecule could eliminate Xist RNA from the Xi chromosome without affecting the stability of the transcript. To distinguish between these possibilities, qRT-PCR was used to quantify Xist levels relative to Gadph levels (controls) at various time points. At one hour, when the Xist haze was no longer visible, the Xist level was comparable to that seen in scrambled controls (Figure 16). Even at 3 and 8 hours, Xist levels did not change much. These results indicate that Xist elimination occurs without completely degrading RNA. Therefore, LNA molecules function by interfering with Xist's interaction with chromatin rather than altering RNA stability.</p><p> The rapid elimination and slow dynamics of Xist recovery provided an opportunity to investigate unanswered questions about the mechanism of Xist localization. To question whether the reappearance of Xist on the Xi chromosome is due to the relocalization of the eliminated Xist molecule or the coating of newly synthesized RNA, we have actinomycin D, an inhibitor of RNA polymerase II ( Time course analysis was performed in the presence of Act D). Previous studies have shown that the half-life of Xist in cells is about 4-6 hours (14-16). 0-8 hours of cell processing with ActD during this time frame Xist It was logically thought that it interfered with the new synthesis of RNA and therefore the reappearance of the Xist haze meant the relocalization of the excluded RNA to the Xi chromosome. The LNA molecule was introduced into the cell and then left to the cell to recover in medium containing ActD. In the scrambled control, Xist haze was clearly observed at all times when ActD was not used. With ActD, Xist haze was apparent at 1 and 3 hours, but disappeared by 8 hours. This is consistent with a half-life of 4-6 hours. LNA-C1 or LNA-C2-treated samples were left to recover without ActD, Xist pinpoints were noted in 3 hours, and Xist haze was restored by 8 hours. However, with ActD, the Xist haze was never restored, either in whole or in part. Therefore, the recovery of Xist after LNA molecule-mediated elimination from the Xi chromosome is by novel RNA synthesis, not by relocalization of the eliminated transcripts.</p><p> Example 12. Xist RNA first localizes near the X-chromosome inactivation center Taking advantage of rapid elimination and slow recovery, does Xist spread in small increments or localize on the Xi chromosome at once? I asked the long-standing question of whether it exists. One hypothesis is that the coating begins near the Xist locus and progresses towards both ends of the chromosome via a booster element localized at X (17). Alternatively, coating can occur at once through multiple X-chain seeding points that will promote local diffusion. Xist localization on metaphase chromosomes was analyzed over a 3-8 hour recovery period. In cells treated with scrambled LNA molecules, all Xist RNA-covered metaphase chromosomes showed a band pattern similar to the heterogeneous pattern described in previous studies (18-20). In contrast, LNA-C1-treated cells resulted in an intermediate pattern. At 1 hour, there were no metaphase chromosomes showing Xist RNA coverage (0%, n = 41). Xist as a pinpoint in interphase cells At 3 hours when RNA was visible, the main pattern was a combination of one bright band in the middle of the metaphase chromosome and a few very faint bands somewhere on the X chromosome ( 52%, n = 46). The results suggested that Xist RNA initially binds locally. Xist RNA FISH was performed on non-denatured cell nuclei to determine if a high intensity RNA band was localized to the Xist region, followed by denaturation and hybridization to the Xist probe. In fact, the localized RNA band at the 3-hour stage co-existed with the Xist region. At 5 hours, moderate coating and strength could be seen (68%, n = 38). At 8 hours, the chromosome-wide painting pattern typical of control cells was the predominant pattern (78%, n = 38). In the control, no intermediate pattern was observed at any time. These findings indicate that, within the temporal and spatial resolutions of FISH technology, Xist RNA initially binds nearby but at the same time appears to spread to the rest of the Xi chromosome.</p><p> Example 13. Elimination of Xist RNA involves loss of localization of PRC2 The pattern of polycomb repressor complex 2 (PRC2) that binds to the Xi chromosome is the trimethylation of histone H3 at lysine 27 (H3K27me3). ) Is catalyzed, so it is particularly interesting. Since deletion of Xist in ES cells makes it impossible to recruit PRC2 during cell differentiation, and conditional deletion of Xist in MEF cells results in the loss of PRC2 on the Xi chromosome (21-24). Several studies have shown that PRC2 is Xist-dependently localized on the Xi chromosome. However, the dynamics of PRC2 being recruited to the X chromosome and disappearing from the X chromosome are unknown. Xist Since RNA recruits PRC2 directly (12), we asked whether elimination of LNA molecule-mediated Xist would result in immediate elimination of PRC2 by immunostaining Ezh2 with MEF after delivery of the LNA molecule. Treatment with the repeat C LNA molecule rapidly eliminated Ezh2. There was an almost perfect match between the disappearance of Xist and PRC2. At 1 and 3 hours, Ezh2 focus was never observed in Xist-depleted nuclei, and conversely, Xist haze-restored nuclei were always observed. The loss of Ezh2 on the Xi chromosome was due to the turnover of the Ezh2 protein (see Western analysis below). However, within the 1-8 hour time frame, the transient elimination of PRC2 does not lead to the apparent disappearance of H3K27me3. Therefore, the localization of PRC2 to the Xi chromosome is absolutely dependent on Xist RNA for both initial targeting and stable binding after XCI is established, but when Xist and PRC2 are eliminated, H3K27me3 Mark is stable for a short period of time.</p><p> With this in mind, we asked if LNA would affect gene silencing. RNA FISH was performed on either Pgk1 or Hprt, the two X-linked genes that receive Xist and XCI, at 3 hours when Xist elimination was maximized. In control nucleofect (LNA-Scr) cells, Xist haze was observed from the Xi chromosome and nascent Pgk1 or nascent Hprt transcripts were observed from the Xa chromosome. Two focal points of the Pgk1 transcript were still seen in 79% (n = 39) of controls and 80% (n = 36) of LNA-C1-treated cells, and 84% (n = 44) of controls and LNA- Nucleofection at LNA-C1 and LNA-4978 did not alter the expression pattern, as 79% (n = 35) of C1-treated cells had two focuses on Hprt RNA. The four focus of the Pgk1 or Hprt transcript was never seen. Therefore, consistent with retention of H3K27me3, silencing was not disturbed by transient disappearance of Xist and PRC2.</p><p> Example 14. A wide domain around repeat C is required for Xist localization The next experiment examined other conservative repeats within Xist. Since repeat A has already been shown to be essential for PRC2 targeting, we can focus our experiments on repeats B, E and F, and target either repeat individually or in combination. We found that the localization of Xist was unaffected (Fig. 17A). Unique to Xist, including LNA-726 (between repeats A and F), LNA-4978 and LNA-5205 (between repeats C and D) and LNA-3'(distal end of Xist) (Figure 17A). Conservative areas were also tested. With the exception of LNA-4978, which corresponds to a 15-nucleotide element located 280 bp downstream of repeat C, nothing affected the localization of Xist. LNA-4978 produced similar effects to LNA-C1 / C2, except for its slower kinetics. At 1 hour, Xist haze was still visible, but appeared vaguely diffused (78%, n = 125). At 3 hours, the number of haze was minimal (25%, n = 158). At 8 hours, Xist was recognized as a small pinpoint (39%, n = 123). Recovery was not complete until 24 hours. For repeat C LNA molecules, Xist loss is not due to RNA turnover, as determined by qRT-PCR (Fig. 17B), and does not affect H3K27me3 or at Ezh2 protein levels. Ezh2 is eliminated without changing (Fig. 17C). Therefore, the localization of Xist to chromatin involves a large region that includes both repeat C and the unique region directly beneath the repeat.</p><p> LNA-4978 and LNA-C1 were nucleofected separately or together in the MEF to determine if the two motifs would work together. As expected, treatment with LNA-C1 alone resulted in the disappearance of Xist RNA by 1 hour, and recovery began at 3 hours, with treatment with LNA-4978 at 3 and 8 hours, respectively. It showed disappearance and recovery at the time point. Treatment with both LNA molecules expanded the window of Xist disappearance. Loss of Xist RNA and Ezh2 was observed by 1 hour (as in the case of LNA-C1 only), and recovery did not begin until 8 hours (as in the case of LNA-4978 only). Therefore, the effects of the LNA molecule were additive rather than synergistic, as no effect was enhanced other than by expanding the time window of Xist disappearance.</p><p> Example 15. Recovery of Ezh2 after LNA molecule nucleofection is slow but uniform along the Xi chromosome Finally, Xist during the recovery phase We asked if retargeting of Ezh2 to the Xi chromosome would follow immediately after the wiggle relocalization of RNA. Since PRC2 generally binds in the vicinity of the promoter (25, 26), the localization of Ezh2 in the promoter of the gene on the X chromosome was analyzed by quantitative chromatin immunoprecipitation (qChIP) (Fig. 18A). Female cells have two X chromosomes, and the Ezh2 epitope pulled down by the antibody can theoretically be derived from the Xa or Xi chromosomes, but most Ezh2 and H3K27me3 are said to be bound to the Xi chromosome. There is evidence to show that (21-24). In fact, Ezh2 was enriched by the promoters of genes that undergo silencing on the Xi chromosome (eg, Xmr, Pgk1), but not by the promoters of genes that escape XCI (eg, Jarid1c) (Fig. 18B). MEF cells were then nucleofected with LNA-C1 and qChIP was performed with anti-Ezh2 antibody between 1 and 24 hours. At 1 hour, Ezh2 levels dropped dramatically to background levels in all targeted gene promoters tested (Fig. 18C), which was the disappearance of promoter-binding Ezh2 shortly after elimination of Xist on the Xi chromosome. Indicates that At 3 and 8 hours, Ezh2 levels gradually and uniformly increased across all genes, and by 8 hours many genes appeared to have reached saturation. In promoters with the highest levels of Ezh2 at 0 hours (Fig. 18B), Ezh2 levels did not fully recover until 24 hours (Fig. 18C). Therefore, the origin of ChIP pull-downs was expected to be predominantly the Xi chromosome, if not almost exclusively. In contrast, Ezh2 levels in the known autosomal PRC2 target, the En1 control (27), did not change significantly (Fig. 18D). Therefore, Ezh2 levels increase and decrease with similar kinetics throughout the Xi chromosome. Xist between 1 hour and 8 hours</p><p> References 1. Kapranov P, Willingham AT, &amp; Gingeras TR (2007) Genome-wide transcription and the implications for genomic organization. Nat Rev Genet 8 (6): 413-423.2. Mercer TR, Dinger ME, &amp; Mattick JS (2009) ) Long non-coding RNAs: insights into functions. Nat Rev Genet 10 (3): 155-159.3. Krutzfeldt J, et al. (2005) Silencing of microRNAs in vivo with'antagomirs'. Nature 438 (7068): 685- 689.4. Orom UA, Kauppinen S, &amp; Lund AH (2006) LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene 372: 137-141.5. Morris KV (2008) RNA-mediated transcriptional gene silencing in human cells. Curr Top Microbiol Immunol 320 : 211-224.6. Petersen M &amp; Wengel J (2003) LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 21 (2): 74-81.7. Penny GD, Kay GF, Sheardown SA, Rastan S, &amp; Brockdorff N ( 1996) Requirement for Xist in X chromosome inactivation. Nature 379 (6561): 131-137.8. Brockdorff N, et al. (1992) The product of the mouse Xist gene is a 15 kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell 71 (3) : 515-526.9. Brown CJ, et al. (1992) The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell 71 (3): 527-542.10 .. Clemson CM, McNeil JA, Willard HF, &amp; Lawrence JB (1996) XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear / chromasome structure. J Cell Biol 132 (3): 259-275.11. Wutz A, Rasmussen TP, &amp; Jaenisch R (2002) Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat Genet 30 (2): 167-174.12. Zhao J, Sun BK, Erwin JA, Song JJ, &amp; Lee JT (2008) Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 322 (5902): 750-756.</p><p>13. Beletskii A, Hong YK, Pehrson J, Egholm M, &amp; Strauss WM (2001) PNA interference mapping demonstrates functional domains in the noncoding RNA Xist. Proc Natl Acad Sci USA 98 (16): 9215-9220.14. Sheardown SA, et al. (1997) Stabilization of Xist RNA mediates initiation of X chromosome inactivation. Cell 91 (1): 99-107.15. Sun BK, Deaton AM, &amp; Lee JT (2006) A transient heterochromatic state in Xist preempts X inactivation choice without RNA stabilization. Mol Cell 21 (5): 617-628.16. Panning B, Dausman J, &amp; Jaenisch R (1997) X chromosome inactivation is mediated by Xist RNA stabilization. Cell 90 (5): 907-916.17. Gartler SM &amp; Riggs AD (1983) Mammalian X-chromosome inactivation. Annu Rev Genet 17 : 155-190.18. Duthie SM, et al. (1999) Xist RNA exhibits a banded localization on the inactive X chromosome and is excluded from autosomal material in cis. Hum Mol Genet 8 (2): 195-204.19. Chadwick BP &amp; Willard HF (2004) Multiple spatially distinct types of facultative heterochromatin on the human inactive X chromosome. Proc Natl Acad Sci USA 101 (50): 17450-17455.20. Clemson CM, Hall LL, Byron M, McNeil J, &amp; Lawrence JB (2006) The X chromosome is organized into a gene-rich outer rim and an internal core containing silenced nongenic sequences. Proc Natl Acad Sci USA 103 (20): 7688-7693.21. Plath K, et al. (2003) Role of histone H3 lysine 27 methylation in X in activation. Science 300 (5616): 131-135.22. Kohlmaier A, et al. (2004) A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol 2 (7): E171.23. Silva J, et al. ( 2003) Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell 4 (4): 481-495.24. Zhang LF, Huynh KD, &amp; Lee JT (2007) Perinucleolar targeting of the inactive X during S phase: evidence for a role in the maintenance of silencing. Cell 129 (4): 693-706.</p><p>25. Boyer LA, et al. (2006) Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441 (7091): 349-353.26. Ku M, et al. (2008) Genomewide analysis of PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 4 (10): e1000242.27. Bracken AP, Dietrich N, Pasini D, Hansen KH, &amp; Helin K (2006) Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions. Genes Dev 20 (9): 1123-1136.28. Blais A, et al. (2005) An initial blueprint for myogenic differentiation. Genes Dev 19 (5): 553-569. Axelson, H. (2004). The Notch signaling cascade in neuroblastoma: role of the basic helix-loop-helix proteins HASH-1 and HES-1. Cancer Lett 204, 171-178 Batzoglou, S., Jaffe, DB, Stanley, K., Butler, J., Gnerre, S., Mauceli, E., Berger, B., Mesirov, JP, and Lander, ES (2002). ARACHNE: a whole-genome shotgun assembler. Genome Res 12, 177-189 Bernardi, R., and Pandolfi, PP (2007). Structure, dynamics and functions of promyelocytic leukemia nuclear bodies. Nat Rev Mol Cell Biol 8, 1006-1016 Bernstein, BE, Mikkelsen, TS, Xie, X., Kamal, M., Huebert, DJ, Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., et al. (2006a). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326 Bernstein, E., and Allis, CD (2005). RNA meets chromatin. Genes Dev 19, 1635-1655 Bernstein, E., Duncan, EM, Masui, O., Gil, J., Heard, E., and Allis, CD (2006b). Mouse polycomb proteins bind differentially to methylated histone H3 and RNA Mol Cell Biol 26, 2560-2569 Boyer, LA, Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, LA, Lee, TI, Levine, SS, Wernig, M. , Tajonar, A., Ray, MK, et al. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349-353 Carninci, P., Kasukawa, T., Katayama, S., Gough, J., Frith, MC, Maeda, N., Oyama, R., Ravasi, T., Lenhard, B., Wells, C., et al. (2005). The transcriptional landscape of the mammalian genome. Science 309, 1559-1563</p><p> Cloonan, N., Forrest, AR, Kolle, G., Gardiner, BB, Faulkner, GJ, Brown, MK, Taylor, DF, Steptoe, AL, Wani, S., Bethel, G., et al. (2008) . Stem cell transcriptome profiling via massive-scale mRNA sequencing. Nat Methods 5, 613-619 Coombes, C., Arnaud, P., Gordon, E., Dean, W., Coar, EA, Williamson, CM, Feil, R ., Peters, J., and Kelsey, G. (2003). Epigenetic properties and identification of an imprint mark in the Nesp-Gnasxl domain of the mouse Gnas imprinted locus. Mol Cell Biol 23, 5475-5488 Core, LJ, Waterfall, JJ, and Lis, JT (2008). Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322, 1845-1848 Denisenko, O., Shnyreva, M., Suzuki, H., and Bomsztyk, K. (1998). Point mutations in the WD40 domain of Eed block its interaction with Ezh2. Mol Cell Biol 18, 5634-5642 Edwards, CA, and Ferguson-Smith, AC ( 2007). Mechanisms regulating imprinted genes in clusters. Curr Opin Cell Biol 19, 281-289 Edwards, CA, Mungall, AJ, Matthews, L., Ryder, E., Gray, DJ, Pask, AJ, Shaw, G., Graves, JA, Rogers, J., Dunham , I., et al. (2008). The evolution of the DLK1-DIO3 imprinted domain in mammals. PLoS Biol 6, e135 Francis, NJ, Saurin, AJ, Shao, Z., and Kingston, RE (2001). Reconstitution of a functional core polycomb repressive complex. Mol Cell 8, 545-556 Gupta, RA, Shah, N., Wang, KC, Kim, J., Horlings, HM, Wong, DJ, Tsai, MC, Hung, T., Argani, P., Rinn, JL , et al. (2010). Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 464, 1071-1076 Guttman, M., Amit, I., Garber, M., French, C., Lin, MF, Feldser, D., Huarte, M., Zuk, O., Carey, BW, Cassady, JP, et al. (2009). Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature Kanhere, A., Viiri, K., Araujo, CC, Rasaiyaah, J., Bouwman, RD, Whyte, WA, Pereira, CF, Brookes, E., Walker, K., Bell, GW, et al. ( 2010). Short RNAs Are Transcribed from Repressed Polycomb Target Genes and Interact with Polycomb Repressive Complex-2. Mol Cell 38, 675-688</p><p> Kapranov, P., Cheng, J., Dike, S., Nix, DA, Duttagupta, R., Willingham, AT, Stadler, PF, Hertel, J., Hackermuller, J., Hofacker, IL, et al. ( 2007). RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316, 1484-1488 Khalil, AM, Guttman, M., Huarte, M., Garber, M., Raj, A., Rivea Morales, D., Thomas, K., Presser, A., Bernstein, BE, van Oudenaarden, A., et al. (2009). Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci USA Ku, M., Koche, RP, Rheinbay, E., Mendenhall, EM, Endoh, M., Mikkelsen, TS, Presser , A., Nusbaum, C., Xie, X., Chi, AS, et al. (2008). Genomewide analysis of PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 4, e1000242 Lee, JT (2009) .. Lessons from X-chromosome inactivation: long ncRNA as guides and tethers to the epigenome. Genes Dev 23, 1831-1842 Lee, JT (2010). The X as model for RNA's niche in epigenomic regulation. Cold Spring Harb Perspect Biol 2, a003749 Lee, JT, and Lu, N. (1999). Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell 99, 47-57 Lee, TI, Jenner, RG, Boyer, LA, Guenther, MG, Levine, SS, Kumar , RM, Chevalier, B., Johnstone, SE, Cole, MF, Isono, K., et al. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301-313 Li, G., Margueron, R., Ku, M., Chambon, P., Bernstein, BE, and Reinberg, D. Jarid2 and PRC2 , partners in regulating gene expression. Genes Dev 24, 368-380 Li, G., Margueron, R., Ku, M., Chambon, P., Bernstein, BE, and Reinberg, D. (2010). Jarid2 and PRC2 , partners in regulating gene expression. Genes Dev 24, 368-380 Lin, SP, Youngson, N., Takada, S., Seitz, H., Reik, W., Paulsen, M., Cavaille, J., and Ferguson-Smith, AC (2003) Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome 12. Nat Genet 35, 97-102 Mercer, TR, Dinger, ME, and Mattick, JS (2009). Long non-coding RNAs: insights into functions. Nat Rev Genet 10, 155-159</p><p> Mikkelsen, TS, Ku, M., Jaffe, DB, Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, TK, Koche, RP, et al. ( 2007). Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553-560 Miremadi, A., Oestergaard, MZ, Pharoah, PD, and Caldas, C. (2007). Cancer genetics of epigenetic genes. Hum Mol Genet 16 Spec No 1, R28-49 Montgomery, ND, Yee, D., Chen, A., Kalantry, S., Chamberlain, SJ, Otte, AP, and Magnuson, T. (2005). The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Curr Biol 15, 942-947 Mortazavi, A., Williams, BA, McCue, K., Schaeffer, L., and Wold, B. (2008) ). Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5, 621-628 Pandey, RR, Mondal, T., Mohammad, F., Enroth, S., Redrup, L., Komorowski, J., Nagano, T., Mancini-Dinardo, D., and Kanduri, C. (2008). Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Mol Cell 32, 232-246 Pasini, D., Bracken, AP, Jensen, MR, Lazzerini Denchi, E., and Helin, K. (2004) Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity. EMBO J 23, 4061-4071 Pasini, D., Cloos, PA, Walfridsson, J., Olsson, L., Bukowski, JP, Johansen, JV, Bak, M., Tommerup, N., Rappsilber, J., and Helin, K. JARID2 regulates binding of the Polycomb repressive complex 2 to target genes in ES cells. Nature 464, 306-310 Peng, JC, Valouev, A., Swigut, T., Zhang, J., Zhao, Y., Sidow, A. , and Wysocka, J. (2009). Jarid2 / Jumonji Coordinates Control of PRC2 Enzymatic Activity and Target Gene Occupancy in Pluripotent Cells. Cell 139, 1290-1302 Pietersen, AM, and van Lohuizen, M. (2008). Stem cell regulation by polycomb repressors: postponing commitment. Curr Opin Cell Biol 20, 201-207 Rajasekhar, VK, and Begemann, M. (2007). Concise review: roles of polycomb group proteins in development and disease: a stem cell perspective. Stem Cells 25, 2498-2510 Ringrose, L ., and Paro, R. (2004). Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu Rev Genet 38, 413-443</p><p> Rinn, JL, Kertesz, M., Wang, JK, Squazzo, SL, Xu, X., Brugmann, SA, Goodnough, LH, Helms, JA, Farnham, PJ, Segal, E., et al. (2007). Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129, 1311-1323 Schoeftner, S., Sengupta, AK, Kubicek, S., Mechtler, K., Spahn, L., Koseki, H. , Jenuwein, T., and Wutz, A. (2006). Recruitment of PRC1 function at the initiation of X inactivation independent of PRC2 and silencing. Embo J 25, 3110-3122 Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., and Cavalli, G. (2007). Genome regulation by polycomb and trithorax proteins. Cell 128, 735-745 Schwartz, YB, Kahn, TG, Nix, DA, Li, XY, Bourgon, R., Biggin, M., and Pirrotta, V. (2006). Genome-wide analysis of Polycomb targets in Drosophila melanogaster. Nat Genet 38, 700-705 Schwartz, YB, and Pirrotta, V. (2008). Polycomb complexes and epigenetic states. Curr Opin Cell Biol 20, 266-273 Seila, AC, Calabrese, JM, Levine, SS, Yeo, GW, Rahl, PB, Flynn, RA, Young, RA, and Sharp, PA (2008). Divergent transcription from active promoters . Science 322, 1849-1851 Shen, X., Liu, Y., Hsu, YJ, Fujiwara, Y., Kim, J., Mao, X., Yuan, GC, and Orkin, SH (2008). EZH1 mediates methylation on histone H3 lysine 27 and complements EZH2 in maintaining promoter cell identity and executing pluripotency. Mol Cell 32, 491-502 Shen, X., Woojin, K., Fujiwara, Y., Simon, MD, Liu, Y., Mysliwiec, MR, Yuan, GC, Lee, Y., and Orkin, SH (2009) ). Jumonji Modulates Polycomb Activity and Self-Renewal versus Differentiation of Stem Cells. Cell 139, 1303-1314 Simon, JA, and Lange, CA (2008). Roles of the EZH2 histone methyltransferase in cancer epigenetics. Mutat Res 647, 21- 29 Sing, A., Pannell, D., Karaiskakis, A., Sturgeon, K., Djabali, M., Ellis, J., Lipshitz, HD, and Cordes, SP (2009). A vertebrate Polycomb response element governs segmentation of the posterior hindbrain. Cell 138, 885-897 Sparmann, A., and van Lohuizen, M. (2006). Polycomb silencers control cell fate, development and cancer. Nat Rev Cancer 6, 846- 856</p><p> Taft, RJ, Glazov, EA, Cloonan, N., Simons, C., Stephen, S., Faulkner, GJ, Lassmann, T., Forrest, AR, Grimmond, SM, Schroder, K., et al. (2009) ). Tiny RNAs associated with transcription start sites in animals. Nat Genet 41, 572-578 Takahashi, N., Okamoto, A., Kobayashi, R., Shirai, M., Obata, Y., Ogawa, H., Sotomaru , Y., and Kono, T. (2009). Deletion of Gtl2, imprinted non-coding RNA, with its differentially methylated region induces lethal parent-origin-dependent defects in mice. Hum Mol Genet 18, 1879-1888 Thorvaldsen, JL, and Bartolomei, MS (2007). SnapShot: imprinted gene clusters. Cell 130, 958 Ule, J., Jensen, K., Mele, A., and Darnell, RB ( 2005). CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods 37, 376-386 Wan, LB, and Bartolomei, MS (2008). Regulation of imprinting in clusters: noncoding RNAs versus insulators. Adv Genet 61, 207-223 Williamson, CM, Turner, MD, Ball, ST, Nottingham, WT, Glenister, P., Fray, M., Tymowska-Lalanne, Z., Plagge, A., Powles-Glover, N ., Kelsey, G., et al. (2006). Identification of an imprinting control region affecting the expression of all transcripts in the Gnas cluster. Nat Genet 38, 350-355 Woo, CJ, Kharchenko, PV, Daheron, L. , Park, PJ, and Kingston, RE (2010). A region of the human HOXD cluster that confers Polycomb-group responsiveness. Cell 140, 99-110 Yap, KL, Li, S., Munoz-Cabello, AM, Raguz, S., Zeng, L., Mujtaba, S., Gil, J., Walsh, MJ, and Zhou, MM ( 2010). Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol Cell 38, 662-674 Zhao, J., Sun, BK, Erwin, JA, Song, JJ, and Lee, JT (2008). Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 322, 750-756</p><p> Prasanth et al., Cell, 123: 249-263, 2005 Khalil et al., Proc. Natl. Acad. Sci. USA, 106: 11667-1672, 2009 Bernard et al., EMBO J, 29: 3082-3093, 2010 Mariner et al., Molec. Cell, 29: 499-509, 2008 Shamovsky et al., Nature, 440: 556-560, 2006 Sunwoo et al., Genome Res., 19: 347-359, 2009 Kanhere et al ., Molec. Cell, 38: 675-388, 2010 Sarma et al., Proc. Natl. Acad. Sci., USA 107: 22196-22201, 2010</p><p> Examples of Embodiments Examples of embodiments described herein include, but are not limited to: 1. A method of preparing multiple effective cDNAs complementary to a pool of cell nuclear ribonucleic acid (nRNA), in which a sample containing cellular nuclear ribonucleic acid (nRNA), for example, a nuclear lysate containing nRNA that binds to nuclear protein. A cell nucleus of Ezh2, G9a or Cbx7, for example, under conditions sufficient to form a complex between the sample and the substance, eg, nRNA remains bound to the protein. Contact with an antibody that specifically binds to a nuclear protein known or suspected to bind to sex ribonucleic acid, isolate the complex, synthesize DNA complementary to nRNA, and provide an early population of cDNA. And optionally, PCR amplification of the cDNA using strand-specific primers and purification of the initial population of cDNA, eg, at least 25, 50, 100, 150 or 200 nt in length, at least about 20 in length. Obtained a purified population of cDNA, which is a nucleotide (nt). Sequencing at least some or substantially all of the purified cDNA population, comparing the reliable sequence with the reference genome, and having high identity to the sequence of the reference genome, eg, at least 95%, 98 Select sequences that have% or 99% identity or have less than 10, 5, 2 or 1 mismatches: (i) Reads per kilobase per kilobase (RPKM) per million reads above the desired threshold and (ii) Select these cDNAs that are increasing when compared to a control library (eg, a protein-null library or a library made from a parallel IgG pull-down), thereby a library of cDNAs. Methods involving the preparation of.</p><p> 2. The method of embodiment 1, wherein the substance is an antibody and isolating the complex comprises immunoprecipitating the complex. 3. The method of embodiment 1, wherein the cDNA is synthesized using a strand-specific adapter. 4. The method of embodiment 1, further comprising sequencing substantially all of the cDNAs. 5. A library of cDNA complementary to a pool of cell nuclear ribonucleic acid (nRNA) prepared by the methods of embodiments 1-4. 6. The library of embodiment 5, where each of the cDNAs binds to a region on individually treatable beads or substrate. 7. Isolated nucleic acid containing the sequences referenced in Tables 1, 2, 3, 6 and / or 7 or fragments containing at least 20 nt thereof.</p><p> 8. Approximately 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, on cells and their long non-coding RNAs or their PRC2 binding fragments or lncRNA sequences referenced in Table 6. A method of reducing the expression of a cancer gene in a cell, comprising contacting a nucleic acid sequence that is 98%, 99% or 100% homologous or its PRC2-binding fragment referred to in Table 6. 9. The method of embodiment 8, wherein the oncogene is c-myc. 10. The method of embodiment 9, wherein the long non-coding RNA is Pvt1. 11. Suppressive nucleic acids that specifically bind to human lncRNAs corresponding to the tumor suppressor gene loci in Table 7 or human lncRNAs corresponding to the imprint genes in Table 1 and / or growth suppressor genes in Table 2 to mammals. Corresponding to human lncRNA or orthologous, or at least 15 (eg, at least 20, 21, 25, 30, 100) of which at least 90% (eg, 91%, 92%, 93%, 94%) of a mammalian base. , 95%, 96%, 97%, 98%, 99% or 100%) Tumors, including administration of the same associated naturally occurring lncRNA in an amount effective to increase tumor suppressor expression. A method of increasing suppressor expression in a mammal, eg, a human, in need thereof.</p><p> 12. Suppressive nucleic acids that specifically bind to human lncRNAs corresponding to the tumor suppressor gene loci in Table 7 or human lncRNAs corresponding to the imprint genes in Table 1 and / or growth suppressor genes in Table 2 in mammals. Corresponding to human lncRNA or orthologous gas, or at least 90% (eg, 91%, 92%, 93) of its at least 15 (eg, at least 20, 21, 25, 30, 50, 70, 100) nucleobases. %, 94%, 95%, 96%, 97%, 98%, 99% or 100%) Administer the same associated naturally occurring lncRNA in an amount effective to suppress or inhibit tumor growth. A method of inhibiting or suppressing tumor growth in a mammalian animal, eg, a human, having cancer. 13. Inhibitor nucleic acids that specifically bind to human lncRNAs corresponding to the tumor suppressor loci in Table 7 or human lncRNAs corresponding to the imprint genes in Table 1 and / or growth inhibitory genes in Table 2 to mammals. Corresponding to human lncRNA or orthologous gas, or at least 90% (eg, 91%, 92%, 93) of its at least 15 (eg, at least 20, 21, 25, 30, 50, 70, 100) nucleobases. %, 94%, 95%, 96%, 97%, 98%, 99% or 100%) Mammals with cancer, including the administration of the same associated naturally occurring lncRNA in therapeutically effective amounts. For example, how to treat humans.</p><p> 14. The method of any of embodiments 11-13, wherein the inhibitory nucleic acid is single-stranded or double-stranded. 15. The method of any of embodiments 11-14, wherein the inhibitory nucleic acid is an antisense oligonucleotide, LNA, PNA, ribozyme or siRNA. 16. The method of any of embodiments 11-15, wherein the inhibitory nucleic acid is 5-40 bases (eg, 12-30, 12-28, 12-25) long. 17. The method of embodiment 14, wherein the inhibitory nucleic acid is double-stranded and comprises an overhang (possibly 2-6 bases in length) at one or both ends. 18. Inhibitory nucleic acids contain at least 80% or 90% complementary base sequences (eg, at least 5, 10, 15, 20, 25 or 30 bases or up to 30 or 40), or 10, 15, 20, 25 Alternatively, the method of any of embodiments 1-17, comprising a base sequence having up to 3 mismatches (eg, up to 1 or up to 2 mismatches) for 30 bases.</p><p> 19. The method of embodiments 8-18, wherein the cells are in vitro or in vivo, eg, cancer cells of interest, eg tumor cells. 20. The method of embodiments 8-19, wherein the gene is Nkx2-1. 21. Human genome assembly version NCBI37 / mm9 (SEQ ID NO: 191088) bp57636100 to 57638250 mouse chromosome 12 or human genome assembly version GRCh37 / hg19 (SEQ ID NO: 191087) bp36988521 to 36991722 human chromosome 14 The method of embodiment 20 at the NKX2-1 locus. 22. At least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% of cells and their PRC2 binding fragments or lncRNA sequences referenced in long noncoding RNA or Table 3. A method of enhancing stem cell diversity, including contacting a nucleic acid sequence that is 98% or 99% homologous or its PRC2 binding fragment referred to in Table 3. 23. Methods of enhancing stem cell differentiation, including contacting cells with inhibitory nucleic acids that specifically bind to the long non-coding RNAs referenced in Table 3. 24. The method of embodiment 22 or 23, wherein the stem cells are embryonic stem cells.</p><p> 25. The method of embodiment 22 or 23, wherein the stem cells are iPS cells. 26. For extraintestinal administration, specifically bind or at least bind to lncRNAs in Tables 1, 2, 6 or 7 (at least 5, 10, 15, 20, 25 or 30 bases or up to 30 or 40 bases). At least 90%, 91%, 92%, at least 15 (eg, at least 20, 21, 25, 30, 100) nucleobases of inhibitory nucleic acids or lncRNAs of Table 1, 2, 6 or 7 that are 90% complementary. Sterilized compositions containing related naturally occurring lncRNAs that are 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical. 27. Inhibitory nucleic acids include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, microRNAs (miRNAs), small molecule single-stranded RNAs (stRNAs) and single- or double-stranded RNA interference. The composition of embodiment 26, selected from the group consisting of (RNAi) compounds. 28. RNAi compounds selected from the group consisting of short interfering RNA (siRNA) or short hairpin RNA (shRNA), small RNA-induced gene activation (RNAa) and small activated RNA (saRNA), performed. The composition of form 26.</p><p> 29. The composition of embodiment 26, wherein the antisense oligonucleotide is selected from the group consisting of antisense RNA, antisense DNA, chimeric antisense oligonucleotides and antisense oligonucleotides. 30. The composition of any of embodiments 26-29, wherein the inhibitory nucleic acid comprises one or more modifications comprising modified sugar moieties, modified nucleoside linkages, modified nucleotides and / or combinations thereof. 31. Modified nucleoside bonds are at least of alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamic acid, carboxymethyl ester or a combination thereof. The composition of embodiment 30, comprising one. 32. The composition of embodiment 30, wherein the modified sugar moiety comprises a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety or a bicyclic sugar moiety. ..</p><p> Still other examples of embodiments include, but are not limited to: 1A. A locked nucleic acid (LNA) molecule that is complementary to and specifically binds to long non-coding RNA (lncRNA). For these embodiments, lncRNAs include endogenous cell RNAs of 60 nt or greater in length, such as 100 nt or greater, eg, 200 nt or greater, without a plus-strand open reading frame of 100 amino acids or greater, and are experimental. Evidence identifies it as a lncRNA and distinguishes it from known (smaller) functional RNA classes, including but not limited to ribosomes, transcription factors and micronucleus / nuclear body RNAs, siRNAs, piRNAs and miRNAs. For example, Lipovich et al., "MacroRNA underdogs in a microRNA world: Evolutionary, regulatory, and biomedical significance of mammalian long non-protein-coding RNA "Biochimica et Biophysica Acta (2010) doi: 10.1016 / j.bbagrm.2010.10.001; Ponting et al., Cell 136 (4): 629-641 (2009), Jia et al., RNA 16 (8) (2010) 1478-1487, Dinger et al., Nucleic Acids Res. 37 1685 (2009) D122-D126 (database issue); and cited therein. LncRNAs are also referred to as long-chain RNAs, large RNAs, macroRNAs, intergenic RNAs and non-coding transcripts.</p><p> 2A.lncRNA binds to large molecules, intergenic non-coding RNAs (lincRNAs), promoter-related short RNAs (PASRs), endogenous antisense RNAs or chromatin modifiers such as polycomb complexes, such as polycomb repressor complex 2. The molecule of embodiment 1A. The molecule of embodiment 1A, where the 3A.lncRNA is localized in the nucleus. 4A. The molecule of embodiment 1A, wherein the LNA molecule is complementary to a region of lncRNA that contains a known RNA localization motif. 5A. The method of embodiment 1A, wherein the LNA comprises at least one non-locked nucleotide.</p><p> 6A. A method of dissociating a long non-coding RNA (lncRNA) from its cognate binding sequence, which involves contacting lncRNA with a locked nucleic acid (LNA) molecule that is complementary to lncRNA and specifically binds. 7A. A method of reducing the binding of long non-coding RNA (lncRNA) to a cognate binding sequence, including contacting lncRNA with a locked nucleic acid (LNA) molecule that is complementary to lncRNA and specifically binds. .. 8A. The method of embodiment 6A or 7A, wherein lncRNA is a large molecule, an intergenic non-coding RNA (lincRNA), a promoter-associated short RNA (PASR), an endogenous antisense RNA or an RNA that binds to a chromatin modifier.</p><p> 9A. The method of embodiment 6A or 7A, in which lncRNA is localized to the nucleus. 10A. The method of embodiment 6A or 7A, wherein the LNA molecule is complementary to a region of lncRNA that contains a known RNA localization motif. 11A. The method of embodiment 6A or 7A, wherein the LNA comprises at least one non-locked nucleotide.</p><p> Still other examples of embodiments include, but are not limited to: 1B. RNA known to bind to Polycomb Inhibitor Complex 2 (PRC2) for use in the treatment of disease, optionally RNA of SEQ ID NO: 17040 or RNA of any of Tables 1-8 or SEQ ID NO: 1 ~ An inhibitory nucleic acid that specifically binds to or is complementary to any RNA of 193049, the treatment involving regulating the expression of inheritance targeted by the RNA, 5-40 bases in length. An inhibitory nucleic acid that is formulated as a sterile composition. 2B. Inhibitory nucleic acid with a length of 5-40 bases, optionally single strand that specifically binds to the RNA sequence that binds to PRC2, optionally RNA of SEQ ID NO: 17040 or RNA of any of Tables 1-8 or Specific binding or complementation to RNA known to bind to Polycomb repression complex 2 (PRC2), including the step of designing and / or synthesizing any RNA of SEQ ID NOs: 1-13049. The process of preparing a target inhibitory nucleic acid.</p><p> 3B. The process of embodiment 2B, which comprises further identifying the RNA that binds to PRC2 before designing and / or synthesizing the inhibitory nucleic acid. The process of embodiment 2B, wherein 4B. RNA has been identified by a method comprising identifying RNA that binds to PRC2. 5B. Of Embodiment 2B, the sequence of inhibitory nucleic acids designed and / or synthesized is based on the RNA sequence that binds to PRC2 or a portion thereof, in part having a length of 15-100 consecutive base pairs. process. 6B. Designed and / or synthesized inhibitory nucleic acid sequences are partly 5-40 based on nucleic acid sequences that are complementary or partially complementary to the RNA sequence that binds to PRC2. The process of embodiment 2B having a length of continuous base pairs.</p><p> 7B. Inhibitory nucleic acids are used in the manufacture of pharmaceutical compositions or pharmaceuticals used in the treatment of diseases, optionally comprising regulating the expression of genes targeted by RNA that binds to PRC2. The process of any one of embodiments 2B-6B. 8B. Sterilization containing inhibitory nucleic acids that specifically bind to or complement the RNA sequence of any one of SEQ ID NOs: 1 to 193049 and can regulate the expression of genes targeted by RNA. Composition. 9B. Inhibitory nucleic acids specifically bind to or complement the RNA sequence of any one of SEQ ID NOs: 1-13049, and treatment involves regulating the expression of a gene targeted by the RNA. , Inhibitory nucleic acids for use in the treatment of diseases. 10B. In order to regulate the expression of a gene targeted by RNA, an inhibitory nucleic acid that specifically binds to or complements the RNA sequence of any one of SEQ ID NOs: 1 to 193049 in mammals. A method of regulating gene expression, including administration in an effective amount.</p><p> 11B. The inhibitory nucleic acid specifically binds or is complementary to the mouse RNA sequence of any one of the mouse RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 1-12603, and the treatment is by RNA. Suppressive nucleic acids for use in the treatment of diseases, including regulating the expression of targeted genes. 12B. The inhibitory nucleic acid specifically binds to or is complementary to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 1-12603. Yes, human RNA sequences can be obtained by (a) mapping highly conserved regions from the mouse to the human genome or by mapping synteny positions from the mouse to the human genome, eg, by mouse-to-human LiftOver analysis, or (b). At least 90% identical to at least 15 bases (or at least 20, 21, 25, 30 or 100 bases) to the mouse RNA sequence, and treatment involves regulating the expression of genes targeted by the RNA. , Suppressive nucleic acid for use in the treatment of diseases. 13B. The inhibitory nucleic acid of embodiment 12B, wherein the human RNA sequence is any one of the human RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 12604-21582 or 191089-193049. 14B. An inhibitory nucleic acid that specifically binds or complements a mouse RNA sequence of any one of the mouse RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 1-12603, to mammalian animals. A method of regulating gene expression, comprising administering an effective amount to regulate the expression of the gene targeted by.</p><p> 15B. Mammalian animals are specifically bound to or complementary to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 1-12603. A method of regulating gene expression, comprising administering an inhibitory nucleic acid in an amount effective to regulate the expression of a gene targeted by RNA, wherein the human RNA sequence is (a) from a mouse. It can be obtained by mapping highly conserved regions to the human genome or by mapping synteny positions from the mouse to the human genome, such as mouse-to-human LiftOver analysis, or (b) at least 15 bases (or) to the mouse RNA sequence. A method that is at least 90% identical to at least 20, 21, 25, 30 or 100 bases). 16B. The method of embodiment 15B, wherein the human RNA sequence is any one of the human RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 12604-21582 or 191089-193049.</p><p> 17B. Human RNA sequence of any of the human peaks set forth in, for example, SEQ ID NOs: 124437-19716 or 190934-191086 or 191087, or mouse RNA sequence of any of the mouse peaks set forth in, for example, SEQ ID NOs: 21583-124436 or 190717-190933 or 191088. A sterile composition comprising an inhibitory nucleic acid that specifically binds to or is complementary to and is capable of regulating the expression of a gene targeted by RNA. 18B. Human RNA sequence of any of the human peaks set forth in, for example, SEQ ID NO: 124437-19716 or 190934-191086 or 191087 or mouse RNA sequence of any of the mouse peaks set forth in, for example, SEQ ID NO: 21583-124436 or 190717-190933 or 191088. Suppressive nucleic acids for use in the treatment of diseases, including specifically binding to or complementary to, and the treatment regulating the expression of a gene targeted by RNA.</p><p> 19B. Mammalian animals, eg, either the mouse RNA sequence of any of the human peaks set forth in SEQ ID NO: 124437-19716 or 190934-191086 or 191087 or the mouse peak set forth in eg, SEQ ID NO: 21583-124436 or 190717-190933 or 191088 Regulatory expression of a gene, including administration of an inhibitory nucleic acid that specifically binds to or is complementary to the mouse RNA sequence of the RNA in an amount effective to regulate the expression of the gene targeted by the RNA. how to. 20B. Specific binding or complementary to any fragment of the RNA of SEQ ID NO: 1-21582 or 191089-193049, optionally used in the treatment of disease, fragments of approximately 2000, 1750, 1500, An inhibitory nucleic acid having a length of about 1250, 1000, 750, 500, 400, 300, 200 or about 100 bases (or any range of any of these numbers) and a length of about 5-50 bases. , RNA fragments in any range of human peaks set forth in, for example, SEQ ID NOs: 124437-19716 or 190934-191086 or 191087, or in any range of mouse peaks set in, for example, SEQ ID NOs: 21583-124436 or 190717-190933 or 191088. Inhibitory nucleic acids that overlap and include at least 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 consecutive base extensions, and that treatment regulates the expression of genes targeted by RNA. ..</p><p> 21B. A method of regulating gene expression, comprising administering to a mammal an inhibitory nucleic acid of embodiment 20B in an amount effective to regulate the expression of the gene targeted by RNA. 22B. Regulation upregulates gene expression, optionally the gene targeted by RNA is selected from the group of genes listed in Table 8, and the RNA sequence is the sequence of RNA targeting the gene shown in Table 8. The inhibitory nucleic acid, method, composition or method of any of the preceding embodiments selected from the numbers. 23B. Inhibitions that specifically bind to or are complementary to the mouse RNA sequence of any one of the mouse RNAs set forth in Tables 1, 2, 6 or 7, eg, SEQ ID NOs: 1-9846 or 12053-12603. A sterile composition comprising sex nucleic acids. 24B. Specific binding to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Tables 1, 2, 6 or 7, eg, SEQ ID NOs: 1-9846 or 12053-12603, Or a sterile composition comprising an inhibitory nucleic acid that is complementary.</p><p> 25 B. (a) Human RNA sequences can be obtained by mapping highly conserved regions from the mouse to the human genome or by mapping synteny positions from the mouse to the human genome, such as mouse-to-human LiftOver analysis, or (b). The sterile composition of embodiment 24B, wherein the human RNA sequence is at least 90% identical to at least 15 bases (or at least 20, 21, 25, 30 or 100 bases) relative to the mouse RNA sequence. 26B. The human RNA sequence is any one of Tables 1, 2, 6 or 7, eg, one of the human RNAs set forth in SEQ ID NOs: 12604-19236 or 21195-21582 or 191089-192885 or 192980-193049. Sterile composition of form 24B. 27B. A sterile composition of any of the preceding embodiments for extraintestinal administration. 28B. A sterile composition of any of the preceding embodiments, wherein the inhibitory nucleic acid is capable of upregulating the expression of a gene targeted by RNA.</p><p> 29B. Compositions for use in methods that increase the expression of tumor suppressors, for use in methods that inhibit or suppress tumor growth, or in methods that treat cancer, Table 1 Or a tumor suppressor that comprises an inhibitory nucleic acid that specifically binds to or is complementary to any one of the mouse RNA sequences of 7, eg, SEQ ID NOs: 1-49 or 12268-12603. A composition for use in a manner that increases the expression of, for use in a manner that inhibits or suppresses tumor growth, or in a manner that treats cancer. 30B. Compositions for use in methods that increase the expression of tumor suppressors, for use in methods that inhibit or suppress tumor growth, or in methods that treat cancer, Table 1 Or 7, an inhibitory nucleic acid that specifically binds to or is complementary to an orthologous human RNA sequence in any one of the mouse RNA sequences set forth in, eg, SEQ ID NOs: 1-49 or 12268-12603. Composition containing. 31B. Inhibition in mammals that specifically binds to or is complementary to the mouse RNA sequence of any one of the mouse RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 1-49 or 12268-12603. A method of increasing the expression of a tumor suppressor, comprising administering the sex nucleic acid in an amount effective to increase the expression of the tumor suppressor, in a mammal in need thereof.</p><p> 32B. Mammalians specifically bind to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 1-49 or 12268-12603. Increasing the expression of tumor suppressors, including administering complementary suppressive nucleic acids in an amount effective to increase the expression of the tumor suppressors, is performed in mammals in need thereof. Method. 33B. Inhibitions that specifically bind to or complement the mouse RNA sequence of any one of the mouse RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 1-49 or 12268-12603, to mammals. A method of inhibiting or suppressing tumor growth in a mammal in need thereof, comprising administering sex nucleic acid in an amount effective to suppress or inhibit tumor growth.</p><p> 34B. Mammalians specifically bind to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 1-49 or 12268-12603. Or it is necessary to inhibit or suppress mammalian tumor growth, including administering a complementary inhibitory nucleic acid in an amount effective to suppress or inhibit tumor growth. How to do it in mammals. 35B. Inhibitions that specifically bind to or complement the mouse RNA sequence of any one of the mouse RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 1-49 or 12268-12603, to mammals. A method of treating a mammal having cancer, comprising administering sex nucleic acid in a therapeutically effective amount.</p><p> 36B. Mammalians specifically bind to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 1-49 or 12268-12603. Alternatively, a method of treating a mammal having cancer, comprising administering a complementary inhibitory nucleic acid in a therapeutically effective amount. 37 B. (a) Human RNA sequences can be obtained by mapping highly conserved regions from the mouse to the human genome or by mapping synteny positions from the mouse to the human genome, such as mouse-to-human LiftOver analysis, or (b). The composition or method of any of embodiments 29B-36B, wherein the human RNA sequence is at least 90% identical to at least 15 bases (or at least 20, 21, 25, 30 or 100 bases) relative to the mouse RNA sequence. .. 38B. Embodiment 29B-36B, wherein the human RNA sequence is any one of the human RNAs set forth in Table 1 or 7, eg, SEQ ID NOs: 12604 to 12632 or 21338 to 21582 or 192874 to 192885 or 193007 to 193049. Any of the compositions or methods of. 39B. Contacting cells with an inhibitory nucleic acid that specifically binds to or is complementary to the mouse RNA sequence of any one of the mouse RNAs set forth in Table 3, eg, SEQ ID NOs: 9837-10960. A method of enhancing the differentiation of stem cells, optionally embryonic stem cells and optionally iPS cells, including.</p><p> 40B. Inhibition that specifically binds to or is complementary to the human RNA sequence corresponding to the mouse RNA sequence of any one of the mouse RNAs set forth in Table 3, eg, SEQ ID NOs: 9837-10960, with the 40B. A method of enhancing the differentiation of stem cells, optionally embryonic stem cells and optionally iPS cells, comprising contacting nucleic acids. 41 B. (a) Human RNA sequences can be obtained by mapping highly conserved regions from the mouse to the human genome or by mapping synteny positions from the mouse to the human genome, such as mouse-to-human LiftOver analysis, or (b). The method of embodiment 40B, wherein the human RNA sequence is at least 90% identical to at least 15 bases (or at least 20, 21, 25, 30 or 100 bases) relative to the mouse RNA sequence. 42B. The method of embodiment 40B, wherein the corresponding human RNA sequence is any one of the human RNAs set forth in Table 3, eg, SEQ ID NOs: 19237-20324 or 192886-192906. 43B. Optional stem cells of a particular cell type, optionally nerves, neurons, dopaminergic neurons, muscles, skin, heart, kidneys, liver, lungs, neuroendocrine, retina, retinal pigment epithelium, pancreatic α or β cells, The method of any of embodiments 39B-42B performed in Exvivo for differentiation into hematopoietic cells, chondrocytes, bone cells, blood cells, T cells, B cells, macrophages, erythrocytes or platelets. 44B. Inhibitory nucleic acids, processes, compositions of any of the preceding embodiments, wherein the inhibitory nucleic acid is 5-40 bases in length (optionally 12-30, 12-28 or 12-25 bases in length). A thing or method.</p><p> 45B. The inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid is 10-50 bases long. 46B. Inhibitory nucleic acids are, for example, at least 5-30, 10-30, 15-30, 20-30, 25-30 or 5-40, 10-40, 15-40, 20-40, 25-40 or 30. An inhibitory nucleic acid, process, composition or method of any of the preceding embodiments comprising a base sequence that is at least 80% or 90% complementary (including fully complementary) to an RNA sequence of ~ 40 bases. Complementarity is understood to be determined for contiguous bases, for example 5-30 contiguous bases. 47B. The inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid comprises a base sequence that is at least 90% complementary to an RNA sequence of at least 10 bases. 48B. An inhibitory nucleic acid comprising a base sequence having up to 3 mismatches (eg, up to 1 or up to 2 mismatches) in complementary base pairing to an RNA sequence of 10, 15, 20, 25 or 30 bases. An inhibitory nucleic acid, process, composition or method of any of the embodiments. 49B. The inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid comprises a base sequence that is at least 80% complementary to an RNA sequence of at least 10 bases.</p><p> 50B. The inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid comprises a base sequence having a maximum of 3 mismatches to an RNA sequence of 15 bases. 51B. An inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid is single strand. 52B. An inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid is double-stranded. 53B. An inhibitory nucleic acid, process, composition or of any of the preceding embodiments, wherein the inhibitory nucleic acid comprises one or more modifications comprising a modified sugar moiety, a modified nucleoside bond, a modified nucleotide and / or a combination thereof. Method. 54B. The inhibitory nucleic acid, process, composition or method of any of the preceding embodiments, wherein the inhibitory nucleic acid is an antisense oligonucleotide, LNA molecule, PNA molecule, ribozyme or siRNA. 55B. An inhibitory nucleic acid, process, of any of the preceding embodiments, wherein the inhibitory nucleic acid is double-stranded and comprises an overhang (possibly 2-6 bases in length) at one or both ends. Composition or method.</p><p> 56B. Inhibitory nucleic acids include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, microRNAs (miRNAs), small molecule single-stranded RNAs (stRNAs) and single- or double-stranded RNAs. An inhibitory nucleic acid, process, composition or method of any of the preceding embodiments selected from the group consisting of interfering (RNAi) compounds. 57B. RNAi compounds are selected from the group consisting of short interfering RNA (siRNA) or short hairpin RNA (shRNA), small RNA-induced gene activation (RNAa) and small activated RNA (saRNA). A suppressive nucleic acid, process, composition or method of form 56B. 58B. Inhibitory nucleic acid, process, composition or method of embodiment 54B or 56B, wherein the antisense oligonucleotide is selected from the group consisting of antisense RNA, antisense DNA, chimeric antisense oligonucleotides and antisense oligonucleotides. .. 59B. Modified nucleoside bonds are among alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamic acids, carboxymethyl esters or combinations thereof. The inhibitory nucleic acid, process, composition or method of embodiment 53B, comprising at least one.</p><p> 60B. Inhibitory of Embodiment 53B, wherein the modified sugar moiety comprises a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety or a bicyclic sugar moiety. Nucleic acid, process, composition or method. 61B. The inhibitory nucleic acid, process, composition or method of embodiment 53B comprising a 2'-OMe, 2'-F, LNA, PNA, FANA, ENA or morpholino modification. 62B. Isolated mouse RNA sequence from Tables 1-7, eg, any one of the mouse RNAs set forth in SEQ ID NOs: 1-12603, or a fragment thereof, at least 20 bases long that retains PRC2 binding activity. Sterilized composition containing nucleic acid. 63B. In a human RNA sequence of any one of the human RNAs set forth in Tables 1-7, eg, SEQ ID NOs: 12604-21582 or 191089-193049, or a fragment thereof having a length of at least 20 bases that retains PRC2 binding activity. A sterile composition comprising an isolated nucleic acid. 64B. The nucleobase sequence of any one of the mouse RNAs of Table 6, eg, SEQ ID NOs: 12053-12267, or optionally any one of SEQ ID NOs: 21195-21337 or 192980-193066. An RNA for use in a method of reducing the expression of an oncogene containing a corresponding human RNA sequence or a fragment thereof having a length of at least 20 bases that retains PRC2-binding activity. 65B. Cells and any of the mouse RNA sequences of Table 6, eg, any one of the mouse RNAs set forth in SEQ ID NOs: 12053-12267, or optionally SEQ ID NOs: 21195-21337 or 192980-193066 (see Table 6). A method of reducing the expression of a cancer gene in a cell, comprising contacting a corresponding human RNA sequence having any one nucleobase sequence or a fragment thereof having a length of at least 20 bases retaining PRC2-binding activity.</p><p> 66B. Any one of the mouse RNA sequences of Table 3, eg, any of the mouse RNAs set forth in SEQ ID NOs: 9837-10960, or optionally SEQ ID NOs: 19237-20324 or 192886192906 (see Table 3). Enhances pluripotency of stem cells, optionally embryonic stem cells, and optionally iPS cells, containing a corresponding human RNA sequence with one nucleobase sequence or a fragment thereof with a length of at least 20 bases that retains PRC2 binding activity. RNA for use in the method. 67B. Cells and any of the mouse RNA sequences of Table 3, eg, any one of the mouse RNAs set forth in SEQ ID NOs: 9837-10960, or optionally SEQ ID NOs: 19237-20324 or 192886192906 (see Table 3). Stem cells, optionally embryonic stem cells, and optionally iPS cells, comprising contacting a corresponding human RNA sequence having any one nucleobase sequence or a fragment thereof having a length of at least 20 bases retaining PRC2-binding activity. How to enhance your versatility.</p><p> 68B. An LNA molecule that is complementary and specifically binds to lncRNA that binds to chromatin modifiers. 69B. The LNA molecule of embodiment 68B, wherein the chromatin modifier is Polycomb repressor complex 2. 70B. Binding of long non-coding RNAs (lncRNAs) to cognate binding sequences such as PRC2 or chromosomes, including contacting lncRNAs with lncRNAs that are complementary and specifically bind to locked nucleic acid (LNA) molecules. How to reduce. 71B. Large molecules, intergenic non-coding RNAs (lincRNAs), promoter-related short RNAs (PASRs), endogenous antisense RNAs or chromatin modifiers, such as RNAs that bind to polycomb complexes, such as polycomb repressor complex 2. An LNA molecule that is complementary to and specifically binds to lncRNA.</p><p> Although the present invention has been described in conjunction with its detailed description, the above description is for illustration purposes and does not limit the scope of the invention, the scope of which is limited by the appended claims. Is understood. Other aspects, advantages and modifications are within the scope of the following claims.</p><p><tables num="1"><img file="JP6577611B2_D0008.tif" /></tables></p><p><tables num="2"><img file="JP6577611B2_D0009.tif" /></tables></p><p><tables num="3"><img file="JP6577611B2_D0010.tif" /></tables></p><p><tables num="4"><img file="JP6577611B2_D0011.tif" /></tables></p><p><tables num="5"><img file="JP6577611B2_D0012.tif" /></tables></p><p><tables num="6"><img file="JP6577611B2_D0013.tif" /></tables></p><p><tables num="7"><img file="JP6577611B2_D0014.tif" /></tables></p><p><tables num="8"><img file="JP6577611B2_D0015.tif" /></tables></p><p><tables num="9"><img file="JP6577611B2_D0016.tif" /></tables></p><p><tables num="10"><img file="JP6577611B2_D0017.tif" /></tables></p><p><tables num="11"><img file="JP6577611B2_D0018.tif" /></tables></p><p><tables num="12"><img file="JP6577611B2_D0019.tif" /></tables></p><p><tables num="13"><img file="JP6577611B2_D0020.tif" /></tables></p><p><tables num="14"><img file="JP6577611B2_D0021.tif" /></tables></p><p><tables num="15"><img file="JP6577611B2_D0022.tif" /></tables></p><p><tables num="16"><img file="JP6577611B2_D0023.tif" /></tables></p><p><tables num="17"><img file="JP6577611B2_D0024.tif" /></tables></p><p><tables num="18"><img file="JP6577611B2_D0025.tif" /></tables></p><p><tables num="19"><img file="JP6577611B2_D0026.tif" /></tables></p><p><tables num="20"><img file="JP6577611B2_D0027.tif" /></tables></p><p><tables num="21"><img file="JP6577611B2_D0028.tif" /></tables></p><p><tables num="22"><img file="JP6577611B2_D0029.tif" /></tables></p><p><tables num="23"><img file="JP6577611B2_D0030.tif" /></tables></p><p><tables num="24"><img file="JP6577611B2_D0031.tif" /></tables></p><p><tables num="25"><img file="JP6577611B2_D0032.tif" /></tables></p><p><tables num="26"><img file="JP6577611B2_D0033.tif" /></tables></p><p><tables num="27"><img file="JP6577611B2_D0034.tif" /></tables></p><p><tables num="28"><img file="JP6577611B2_D0035.tif" /></tables></p><p><tables num="29"><img file="JP6577611B2_D0036.tif" /></tables></p><p><tables num="30"><img file="JP6577611B2_D0037.tif" /></tables></p><p><tables num="31"><img file="JP6577611B2_D0038.tif" /></tables></p><p><tables num="32"><img file="JP6577611B2_D0039.tif" /></tables></p><p><tables num="33"><img file="JP6577611B2_D0040.tif" /></tables></p><p><tables num="34"><img file="JP6577611B2_D0041.tif" /></tables></p><p><tables num="35"><img file="JP6577611B2_D0042.tif" /></tables></p><p><tables num="36"><img file="JP6577611B2_D0043.tif" /></tables></p><p><tables num="37"><img file="JP6577611B2_D0044.tif" /></tables></p><p><tables num="38"><img file="JP6577611B2_D0045.tif" /></tables></p><p><tables num="39"><img file="JP6577611B2_D0046.tif" /></tables></p><p><tables num="40"><img file="JP6577611B2_D0047.tif" /></tables></p><p><tables num="41"><img file="JP6577611B2_D0048.tif" /></tables></p><p><tables num="42"><img file="JP6577611B2_D0049.tif" /></tables></p><p><tables num="43"><img file="JP6577611B2_D0050.tif" /></tables></p><p><tables num="44"><img file="JP6577611B2_D0051.tif" /></tables></p><p><tables num="45"><img file="JP6577611B2_D0052.tif" /></tables></p><p><tables num="46"><img file="JP6577611B2_D0053.tif" /></tables></p><p><tables num="47"><img file="JP6577611B2_D0054.tif" /></tables></p><p><tables num="48"><img file="JP6577611B2_D0055.tif" /></tables></p><p><tables num="49"><img file="JP6577611B2_D0056.tif" /></tables></p><p><tables num="50"><img file="JP6577611B2_D0057.tif" /></tables></p><p><tables num="51"><img file="JP6577611B2_D0058.tif" /></tables></p><p><tables num="52"><img file="JP6577611B2_D0059.tif" /></tables></p><p><tables num="53"><img file="JP6577611B2_D0060.tif" /></tables></p><p><tables num="54"><img file="JP6577611B2_D0061.tif" /></tables></p><p><tables num="55"><img file="JP6577611B2_D0062.tif" /></tables></p><p><tables num="56"><img file="JP6577611B2_D0063.tif" /></tables></p><p><tables num="57"><img file="JP6577611B2_D0064.tif" /></tables></p><p><tables num="58"><img file="JP6577611B2_D0065.tif" /></tables></p><p><tables num="59"><img file="JP6577611B2_D0066.tif" /></tables></p><p><tables num="60"><img file="JP6577611B2_D0067.tif" /></tables></p><p><tables num="61"><img file="JP6577611B2_D0068.tif" /></tables></p><p><tables num="62"><img file="JP6577611B2_D0069.tif" /></tables></p><p><tables num="63"><img file="JP6577611B2_D0070.tif" /></tables></p><p><tables num="64"><img file="JP6577611B2_D0071.tif" /></tables></p><p><tables num="65"><img file="JP6577611B2_D0072.tif" /></tables></p><p><tables num="66"><img file="JP6577611B2_D0073.tif" /></tables></p><p><tables num="67"><img file="JP6577611B2_D0074.tif" /></tables></p><p><tables num="68"><img file="JP6577611B2_D0075.tif" /></tables></p><p><tables num="69"><img file="JP6577611B2_D0076.tif" /></tables></p><p><tables num="70"><img file="JP6577611B2_D0077.tif" /></tables></p><p><tables num="71"><img file="JP6577611B2_D0078.tif" /></tables></p><p><tables num="72"><img file="JP6577611B2_D0079.tif" /></tables></p><p><tables num="73"><img file="JP6577611B2_D0080.tif" /></tables></p><p><tables num="74"><img file="JP6577611B2_D0081.tif" /></tables></p><p><tables num="75"><img file="JP6577611B2_D0082.tif" /></tables></p><p><tables num="76"><img file="JP6577611B2_D0083.tif" /></tables></p><p><tables num="77"><img file="JP6577611B2_D0084.tif" /></tables></p><p><tables num="78"><img file="JP6577611B2_D0085.tif" /></tables></p><p><tables num="79"><img file="JP6577611B2_D0086.tif" /></tables></p><p><tables num="80"><img file="JP6577611B2_D0087.tif" /></tables></p><p><tables num="81"><img file="JP6577611B2_D0088.tif" /></tables></p><p><tables num="82"><img file="JP6577611B2_D0089.tif" /></tables></p><p><tables num="83"><img file="JP6577611B2_D0090.tif" /></tables></p><p><tables num="84"><img file="JP6577611B2_D0091.tif" /></tables></p><p><tables num="85"><img file="JP6577611B2_D0092.tif" /></tables></p><p><tables num="86"><img file="JP6577611B2_D0093.tif" /></tables></p><p><tables num="87"><img file="JP6577611B2_D0094.tif" /></tables></p><p><tables num="88"><img file="JP6577611B2_D0095.tif" /></tables></p><p><tables num="89"><img file="JP6577611B2_D0096.tif" /></tables></p><p><tables num="90"><img file="JP6577611B2_D0097.tif" /></tables></p><p><tables num="91"><img file="JP6577611B2_D0098.tif" /></tables></p><p><tables num="92"><img file="JP6577611B2_D0099.tif" /></tables></p><p><tables num="93"><img file="JP6577611B2_D0100.tif" /></tables></p><p><tables num="94"><img file="JP6577611B2_D0101.tif" /></tables></p><p><tables num="95"><img file="JP6577611B2_D0102.tif" /></tables></p><p><tables num="96"><img file="JP6577611B2_D0103.tif" /></tables></p><p><tables num="97"><img file="JP6577611B2_D0104.tif" /></tables></p><p><tables num="98"><img file="JP6577611B2_D0105.tif" /></tables></p><p><tables num="99"><img file="JP6577611B2_D0106.tif" /></tables></p><p><tables num="100"><img file="JP6577611B2_D0107.tif" /></tables></p><p><tables num="101"><img file="JP6577611B2_D0108.tif" /></tables></p><p><tables num="102"><img file="JP6577611B2_D0109.tif" /></tables></p><p><tables num="103"><img file="JP6577611B2_D0110.tif" /></tables></p><p><tables num="104"><img file="JP6577611B2_D0111.tif" /></tables></p><p><tables num="105"><img file="JP6577611B2_D0112.tif" /></tables></p><p><tables num="106"><img file="JP6577611B2_D0113.tif" /></tables></p><p><tables num="107"><img file="JP6577611B2_D0114.tif" /></tables></p><p><tables num="108"><img file="JP6577611B2_D0115.tif" /></tables></p><p><tables num="109"><img file="JP6577611B2_D0116.tif" /></tables></p><p><tables num="110"><img file="JP6577611B2_D0117.tif" /></tables></p><p><tables num="111"><img file="JP6577611B2_D0118.tif" /></tables></p><p><tables num="112"><img file="JP6577611B2_D0119.tif" /></tables></p><p><tables num="113"><img file="JP6577611B2_D0120.tif" /></tables></p><p><tables num="114"><img file="JP6577611B2_D0121.tif" /></tables></p><p><tables num="115"><img file="JP6577611B2_D0122.tif" /></tables></p><p><tables num="116"><img file="JP6577611B2_D0123.tif" /></tables></p><p><tables num="117"><img file="JP6577611B2_D0124.tif" /></tables></p><p><tables num="118"><img file="JP6577611B2_D0125.tif" /></tables></p><p><tables num="119"><img file="JP6577611B2_D0126.tif" /></tables></p><p><tables num="120"><img file="JP6577611B2_D0127.tif" /></tables></p><p><tables num="121"><img file="JP6577611B2_D0128.tif" /></tables></p><p><tables num="122"><img file="JP6577611B2_D0129.tif" /></tables></p><p><tables num="123"><img file="JP6577611B2_D0130.tif" /></tables></p><p><tables num="124"><img file="JP6577611B2_D0131.tif" /></tables></p><p><tables num="125"><img file="JP6577611B2_D0132.tif" /></tables></p><p><tables num="126"><img file="JP6577611B2_D0133.tif" /></tables></p><p><tables num="127"><img file="JP6577611B2_D0134.tif" /></tables></p><p><tables num="128"><img file="JP6577611B2_D0135.tif" /></tables></p><p><tables num="129"><img file="JP6577611B2_D0136.tif" /></tables></p><p><tables num="130"><img file="JP6577611B2_D0137.tif" /></tables></p><p><tables num="131"><img file="JP6577611B2_D0138.tif" /></tables></p><p><tables num="132"><img file="JP6577611B2_D0139.tif" /></tables></p><p><tables num="133"><img file="JP6577611B2_D0140.tif" /></tables></p><p><tables num="134"><img file="JP6577611B2_D0141.tif" /></tables></p><p><tables num="135"><img file="JP6577611B2_D0142.tif" /></tables></p><p><tables num="136"><img file="JP6577611B2_D0143.tif" /></tables></p><p><tables num="137"><img file="JP6577611B2_D0144.tif" /></tables></p><p><tables num="138"><img file="JP6577611B2_D0145.tif" /></tables></p><p><tables num="139"><img file="JP6577611B2_D0146.tif" /></tables></p><p><tables num="140"><img file="JP6577611B2_D0147.tif" /></tables></p><p><tables num="141"><img file="JP6577611B2_D0148.tif" /></tables></p><p><tables num="142"><img file="JP6577611B2_D0149.tif" /></tables></p><p><tables num="143"><img file="JP6577611B2_D0150.tif" /></tables></p><p><tables num="144"><img file="JP6577611B2_D0151.tif" /></tables></p><p><tables num="145"><img file="JP6577611B2_D0152.tif" /></tables></p><p><tables num="146"><img file="JP6577611B2_D0153.tif" /></tables></p><p><tables num="147"><img file="JP6577611B2_D0154.tif" /></tables></p><p><tables num="148"><img file="JP6577611B2_D0155.tif" /></tables></p><p><tables num="149"><img file="JP6577611B2_D0156.tif" /></tables></p><p><tables num="150"><img file="JP6577611B2_D0157.tif" /></tables></p><p><tables num="151"><img file="JP6577611B2_D0158.tif" /></tables></p><p><tables num="152"><img file="JP6577611B2_D0159.tif" /></tables></p><p><tables num="153"><img file="JP6577611B2_D0160.tif" /></tables></p><p><tables num="154"><img file="JP6577611B2_D0161.tif" /></tables></p><p><tables num="155"><img file="JP6577611B2_D0162.tif" /></tables></p><p><tables num="156"><img file="JP6577611B2_D0163.tif" /></tables></p><p><tables num="157"><img file="JP6577611B2_D0164.tif" /></tables></p><p><tables num="158"><img file="JP6577611B2_D0165.tif" /></tables></p><p><tables num="159"><img file="JP6577611B2_D0166.tif" /></tables></p><p><tables num="160"><img file="JP6577611B2_D0167.tif" /></tables></p><p><tables num="161"><img file="JP6577611B2_D0168.tif" /></tables></p><p><tables num="162"><img file="JP6577611B2_D0169.tif" /></tables></p><p><tables num="163"><img file="JP6577611B2_D0170.tif" /></tables></p><p><tables num="164"><img file="JP6577611B2_D0171.tif" /></tables></p><p><tables num="165"><img file="JP6577611B2_D0172.tif" /></tables></p><p><tables num="166"><img file="JP6577611B2_D0173.tif" /></tables></p><p><tables num="167"><img file="JP6577611B2_D0174.tif" /></tables></p><p><tables num="168"><img file="JP6577611B2_D0175.tif" /></tables></p><p><tables num="169"><img file="JP6577611B2_D0176.tif" /></tables></p><p><tables num="170"><img file="JP6577611B2_D0177.tif" /></tables></p><p><tables num="171"><img file="JP6577611B2_D0178.tif" /></tables></p><p><tables num="172"><img file="JP6577611B2_D0179.tif" /></tables></p><p><tables num="173"><img file="JP6577611B2_D0180.tif" /></tables></p><p><tables num="174"><img file="JP6577611B2_D0181.tif" /></tables></p><p><tables num="175"><img file="JP6577611B2_D0182.tif" /></tables></p><p><tables num="176"><img file="JP6577611B2_D0183.tif" /></tables></p><p><tables num="177"><img file="JP6577611B2_D0184.tif" /></tables></p><p><tables num="178"><img file="JP6577611B2_D0185.tif" /></tables></p><p><tables num="179"><img file="JP6577611B2_D0186.tif" /></tables></p><p><tables num="180"><img file="JP6577611B2_D0187.tif" /></tables></p><p><tables num="181"><img file="JP6577611B2_D0188.tif" /></tables></p><p><tables num="182"><img file="JP6577611B2_D0189.tif" /></tables></p><p><tables num="183"><img file="JP6577611B2_D0190.tif" /></tables></p><p><tables num="184"><img file="JP6577611B2_D0191.tif" /></tables></p><p><tables num="185"><img file="JP6577611B2_D0192.tif" /></tables></p><p><tables num="186"><img file="JP6577611B2_D0193.tif" /></tables></p><p><tables num="187"><img file="JP6577611B2_D0194.tif" /></tables></p><p><tables num="188"><img file="JP6577611B2_D0195.tif" /></tables></p><p><tables num="189"><img file="JP6577611B2_D0196.tif" /></tables></p><p><tables num="190"><img file="JP6577611B2_D0197.tif" /></tables></p><p><tables num="191"><img file="JP6577611B2_D0198.tif" /></tables></p><p><tables num="192"><img file="JP6577611B2_D0199.tif" /></tables></p><p><tables num="193"><img file="JP6577611B2_D0200.tif" /></tables></p><p><tables num="194"><img file="JP6577611B2_D0201.tif" /></tables></p><p><tables num="195"><img file="JP6577611B2_D0202.tif" /></tables></p><p><tables num="196"><img file="JP6577611B2_D0203.tif" /></tables></p><p><tables num="197"><img file="JP6577611B2_D0204.tif" /></tables></p><p><tables num="198"><img file="JP6577611B2_D0205.tif" /></tables></p><p><tables num="199"><img file="JP6577611B2_D0206.tif" /></tables></p><p><tables num="200"><img file="JP6577611B2_D0207.tif" /></tables></p><p><tables num="201"><img file="JP6577611B2_D0208.tif" /></tables></p><p><tables num="202"><img file="JP6577611B2_D0209.tif" /></tables></p><p><tables num="203"><img file="JP6577611B2_D0210.tif" /></tables></p><p><tables num="204"><img file="JP6577611B2_D0211.tif" /></tables></p><p><tables num="205"><img file="JP6577611B2_D0212.tif" /></tables></p><p><tables num="206"><img file="JP6577611B2_D0213.tif" /></tables></p><p><tables num="207"><img file="JP6577611B2_D0214.tif" /></tables></p><p><tables num="208"><img file="JP6577611B2_D0215.tif" /></tables></p><p><tables num="209"><img file="JP6577611B2_D0216.tif" /></tables></p><p><tables num="210"><img file="JP6577611B2_D0217.tif" /></tables></p><p><tables num="211"><img file="JP6577611B2_D0218.tif" /></tables></p><p><tables num="212"><img file="JP6577611B2_D0219.tif" /></tables></p><p><tables num="213"><img file="JP6577611B2_D0220.tif" /></tables></p><p><tables num="214"><img file="JP6577611B2_D0221.tif" /></tables></p><p><tables num="215"><img file="JP6577611B2_D0222.tif" /></tables></p><p><tables num="216"><img file="JP6577611B2_D0223.tif" /></tables></p><p><tables num="217"><img file="JP6577611B2_D0224.tif" /></tables></p><p><tables num="218"><img file="JP6577611B2_D0225.tif" /></tables></p><p><tables num="219"><img file="JP6577611B2_D0226.tif" /></tables></p><p><tables num="220"><img file="JP6577611B2_D0227.tif" /></tables></p><p><tables num="221"><img file="JP6577611B2_D0228.tif" /></tables></p><p><tables num="222"><img file="JP6577611B2_D0229.tif" /></tables></p><p><tables num="223"><img file="JP6577611B2_D0230.tif" /></tables></p><p><tables num="224"><img file="JP6577611B2_D0231.tif" /></tables></p><p><tables num="225"><img file="JP6577611B2_D0232.tif" /></tables></p><p><tables num="226"><img file="JP6577611B2_D0233.tif" /></tables></p><p><tables num="227"><img file="JP6577611B2_D0234.tif" /></tables></p><p><tables num="228"><img file="JP6577611B2_D0235.tif" /></tables></p><p><tables num="229"><img file="JP6577611B2_D0236.tif" /></tables></p><p><tables num="230"><img file="JP6577611B2_D0237.tif" /></tables></p><p><tables num="231"><img file="JP6577611B2_D0238.tif" /></tables></p><p><tables num="232"><img file="JP6577611B2_D0239.tif" /></tables></p><p><tables num="233"><img file="JP6577611B2_D0240.tif" /></tables></p><p><tables num="234"><img file="JP6577611B2_D0241.tif" /></tables></p><p><tables num="235"><img file="JP6577611B2_D0242.tif" /></tables></p><p><tables num="236"><img file="JP6577611B2_D0243.tif" /></tables></p><p><tables num="237"><img file="JP6577611B2_D0244.tif" /></tables></p><p><tables num="238"><img file="JP6577611B2_D0245.tif" /></tables></p><p><tables num="239"><img file="JP6577611B2_D0246.tif" /></tables></p><p><tables num="240"><img file="JP6577611B2_D0247.tif" /></tables></p><p><tables num="241"><img file="JP6577611B2_D0248.tif" /></tables></p><p><tables num="242"><img file="JP6577611B2_D0249.tif" /></tables></p><p><tables num="243"><img file="JP6577611B2_D0250.tif" /></tables></p><p><tables num="244"><img file="JP6577611B2_D0251.tif" /></tables></p><p><tables num="245"><img file="JP6577611B2_D0252.tif" /></tables></p><p><tables num="246"><img file="JP6577611B2_D0253.tif" /></tables></p><p><tables num="247"><img file="JP6577611B2_D0254.tif" /></tables></p><p><tables num="248"><img file="JP6577611B2_D0255.tif" /></tables></p><p><tables num="249"><img file="JP6577611B2_D0256.tif" /></tables></p><p><tables num="250"><img file="JP6577611B2_D0257.tif" /></tables></p><p><tables num="251"><img file="JP6577611B2_D0258.tif" /></tables></p><p><tables num="252"><img file="JP6577611B2_D0259.tif" /></tables></p><p><tables num="253"><img file="JP6577611B2_D0260.tif" /></tables></p><p><tables num="254"><img file="JP6577611B2_D0261.tif" /></tables></p><p><tables num="255"><img file="JP6577611B2_D0262.tif" /></tables></p><p><tables num="256"><img file="JP6577611B2_D0263.tif" /></tables></p><p><tables num="257"><img file="JP6577611B2_D0264.tif" /></tables></p><p><tables num="258"><img file="JP6577611B2_D0265.tif" /></tables></p><p><tables num="259"><img file="JP6577611B2_D0266.tif" /></tables></p><p><tables num="260"><img file="JP6577611B2_D0267.tif" /></tables></p><p><tables num="261"><img file="JP6577611B2_D0268.tif" /></tables></p><p><tables num="262"><img file="JP6577611B2_D0269.tif" /></tables></p><p><tables num="263"><img file="JP6577611B2_D0270.tif" /></tables></p><p><tables num="264"><img file="JP6577611B2_D0271.tif" /></tables></p><p><tables num="265"><img file="JP6577611B2_D0272.tif" /></tables></p><p><tables num="266"><img file="JP6577611B2_D0273.tif" /></tables></p><p><tables num="267"><img file="JP6577611B2_D0274.tif" /></tables></p><p><tables num="268"><img file="JP6577611B2_D0275.tif" /></tables></p><p><tables num="269"><img file="JP6577611B2_D0276.tif" /></tables></p><p><tables num="270"><img file="JP6577611B2_D0277.tif" /></tables></p><p><tables num="271"><img file="JP6577611B2_D0278.tif" /></tables></p><p><tables num="272"><img file="JP6577611B2_D0279.tif" /></tables></p><p><tables num="273"><img file="JP6577611B2_D0280.tif" /></tables></p><p><tables num="274"><img file="JP6577611B2_D0281.tif" /></tables></p><p><tables num="275"><img file="JP6577611B2_D0282.tif" /></tables></p><p><tables num="276"><img file="JP6577611B2_D0283.tif" /></tables></p><p><tables num="277"><img file="JP6577611B2_D0284.tif" /></tables></p><p><tables num="278"><img file="JP6577611B2_D0285.tif" /></tables></p><p><tables num="279"><img file="JP6577611B2_D0286.tif" /></tables></p><p><tables num="280"><img file="JP6577611B2_D0287.tif" /></tables></p><p><tables num="281"><img file="JP6577611B2_D0288.tif" /></tables></p><p><tables num="282"><img file="JP6577611B2_D0289.tif" /></tables></p><p><tables num="283"><img file="JP6577611B2_D0290.tif" /></tables></p><p><tables num="284"><img file="JP6577611B2_D0291.tif" /></tables></p><p><tables num="285"><img file="JP6577611B2_D0292.tif" /></tables></p><p><tables num="286"><img file="JP6577611B2_D0293.tif" /></tables></p><p><tables num="287"><img file="JP6577611B2_D0294.tif" /></tables></p><p><tables num="288"><img file="JP6577611B2_D0295.tif" /></tables></p><p><tables num="289"><img file="JP6577611B2_D0296.tif" /></tables></p><p><tables num="290"><img file="JP6577611B2_D0297.tif" /></tables></p><p><tables num="291"><img file="JP6577611B2_D0298.tif" /></tables></p><p><tables num="292"><img file="JP6577611B2_D0299.tif" /></tables></p><p><tables num="293"><img file="JP6577611B2_D0300.tif" /></tables></p><p><tables num="294"><img file="JP6577611B2_D0301.tif" /></tables></p><p><tables num="295"><img file="JP6577611B2_D0302.tif" /></tables></p><p><tables num="296"><img file="JP6577611B2_D0303.tif" /></tables></p><p><tables num="297"><img file="JP6577611B2_D0304.tif" /></tables></p><p><tables num="298"><img file="JP6577611B2_D0305.tif" /></tables></p><p><tables num="299"><img file="JP6577611B2_D0306.tif" /></tables></p><p><tables num="300"><img file="JP6577611B2_D0307.tif" /></tables></p><p><tables num="301"><img file="JP6577611B2_D0308.tif" /></tables></p><p><tables num="302"><img file="JP6577611B2_D0309.tif" /></tables></p><p><tables num="303"><img file="JP6577611B2_D0310.tif" /></tables></p><p><tables num="304"><img file="JP6577611B2_D0311.tif" /></tables></p><p><tables num="305"><img file="JP6577611B2_D0312.tif" /></tables></p><p><tables num="306"><img file="JP6577611B2_D0313.tif" /></tables></p><p><tables num="307"><img file="JP6577611B2_D0314.tif" /></tables></p><p><tables num="308"><img file="JP6577611B2_D0315.tif" /></tables></p><p><tables num="309"><img file="JP6577611B2_D0316.tif" /></tables></p><p><tables num="310"><img file="JP6577611B2_D0317.tif" /></tables></p><p><tables num="311"><img file="JP6577611B2_D0318.tif" /></tables></p><p><tables num="312"><img file="JP6577611B2_D0319.tif" /></tables></p><p><tables num="313"><img file="JP6577611B2_D0320.tif" /></tables></p><p><tables num="314"><img file="JP6577611B2_D0321.tif" /></tables></p><p><tables num="315"><img file="JP6577611B2_D0322.tif" /></tables></p><p><tables num="316"><img file="JP6577611B2_D0323.tif" /></tables></p><p><tables num="317"><img file="JP6577611B2_D0324.tif" /></tables></p><p><tables num="318"><img file="JP6577611B2_D0325.tif" /></tables></p><p><tables num="319"><img file="JP6577611B2_D0326.tif" /></tables></p><p><tables num="320"><img file="JP6577611B2_D0327.tif" /></tables></p><p><tables num="321"><img file="JP6577611B2_D0328.tif" /></tables></p><p><tables num="322"><img file="JP6577611B2_D0329.tif" /></tables></p><p><tables num="323"><img file="JP6577611B2_D0330.tif" /></tables></p><p><tables num="324"><img file="JP6577611B2_D0331.tif" /></tables></p><p><tables num="325"><img file="JP6577611B2_D0332.tif" /></tables></p><p><tables num="326"><img file="JP6577611B2_D0333.tif" /></tables></p><p><tables num="327"><img file="JP6577611B2_D0334.tif" /></tables></p><p><tables num="328"><img file="JP6577611B2_D0335.tif" /></tables></p><p><tables num="329"><img file="JP6577611B2_D0336.tif" /></tables></p><p><tables num="330"><img file="JP6577611B2_D0337.tif" /></tables></p><p><tables num="331"><img file="JP6577611B2_D0338.tif" /></tables></p><p><tables num="332"><img file="JP6577611B2_D0339.tif" /></tables></p><p><tables num="333"><img file="JP6577611B2_D0340.tif" /></tables></p><p><tables num="334"><img file="JP6577611B2_D0341.tif" /></tables></p><p><tables num="335"><img file="JP6577611B2_D0342.tif" /></tables></p><p><tables num="336"><img file="JP6577611B2_D0343.tif" /></tables></p><p><tables num="337"><img file="JP6577611B2_D0344.tif" /></tables></p><p><tables num="338"><img file="JP6577611B2_D0345.tif" /></tables></p><p><tables num="339"><img file="JP6577611B2_D0346.tif" /></tables></p><p><tables num="340"><img file="JP6577611B2_D0347.tif" /></tables></p><p><tables num="341"><img file="JP6577611B2_D0348.tif" /></tables></p><p><tables num="342"><img file="JP6577611B2_D0349.tif" /></tables></p><p><tables num="343"><img file="JP6577611B2_D0350.tif" /></tables></p><p><tables num="344"><img file="JP6577611B2_D0351.tif" /></tables></p><p><tables num="345"><img file="JP6577611B2_D0352.tif" /></tables></p><p><tables num="346"><img file="JP6577611B2_D0353.tif" /></tables></p><p><tables num="347"><img file="JP6577611B2_D0354.tif" /></tables></p><p><tables num="348"><img file="JP6577611B2_D0355.tif" /></tables></p><p><tables num="349"><img file="JP6577611B2_D0356.tif" /></tables></p><p><tables num="350"><img file="JP6577611B2_D0357.tif" /></tables></p><p><tables num="351"><img file="JP6577611B2_D0358.tif" /></tables></p><p><tables num="352"><img file="JP6577611B2_D0359.tif" /></tables></p><p><tables num="353"><img file="JP6577611B2_D0360.tif" /></tables></p><p><tables num="354"><img file="JP6577611B2_D0361.tif" /></tables></p><p><tables num="355"><img file="JP6577611B2_D0362.tif" /></tables></p><p><tables num="356"><img file="JP6577611B2_D0363.tif" /></tables></p><p><tables num="357"><img file="JP6577611B2_D0364.tif" /></tables></p><p><tables num="358"><img file="JP6577611B2_D0365.tif" /></tables></p><p><tables num="359"><img file="JP6577611B2_D0366.tif" /></tables></p><p><tables num="360"><img file="JP6577611B2_D0367.tif" /></tables></p><p><tables num="361"><img file="JP6577611B2_D0368.tif" /></tables></p><p><tables num="362"><img file="JP6577611B2_D0369.tif" /></tables></p><p><tables num="363"><img file="JP6577611B2_D0370.tif" /></tables></p><p><tables num="364"><img file="JP6577611B2_D0371.tif" /></tables></p><p><tables num="365"><img file="JP6577611B2_D0372.tif" /></tables></p><p><tables num="366"><img file="JP6577611B2_D0373.tif" /></tables></p><p><tables num="367"><img file="JP6577611B2_D0374.tif" /></tables></p><p><tables num="368"><img file="JP6577611B2_D0375.tif" /></tables></p><p><tables num="369"><img file="JP6577611B2_D0376.tif" /></tables></p><p><tables num="370"><img file="JP6577611B2_D0377.tif" /></tables></p><p><tables num="371"><img file="JP6577611B2_D0378.tif" /></tables></p><p><tables num="372"><img file="JP6577611B2_D0379.tif" /></tables></p><p><tables num="373"><img file="JP6577611B2_D0380.tif" /></tables></p><p><tables num="374"><img file="JP6577611B2_D0381.tif" /></tables></p><p><tables num="375"><img file="JP6577611B2_D0382.tif" /></tables></p><p><tables num="376"><img file="JP6577611B2_D0383.tif" /></tables></p><p><tables num="377"><img file="JP6577611B2_D0384.tif" /></tables></p><p><tables num="378"><img file="JP6577611B2_D0385.tif" /></tables></p><p><tables num="379"><img file="JP6577611B2_D0386.tif" /></tables></p><p><tables num="380"><img file="JP6577611B2_D0387.tif" /></tables></p><p><tables num="381"><img file="JP6577611B2_D0388.tif" /></tables></p><p><tables num="382"><img file="JP6577611B2_D0389.tif" /></tables></p><p><tables num="383"><img file="JP6577611B2_D0390.tif" /></tables></p><p><tables num="384"><img file="JP6577611B2_D0391.tif" /></tables></p><p><tables num="385"><img file="JP6577611B2_D0392.tif" /></tables></p><p><tables num="386"><img file="JP6577611B2_D0393.tif" /></tables></p><p><tables num="387"><img file="JP6577611B2_D0394.tif" /></tables></p><p><tables num="388"><img file="JP6577611B2_D0395.tif" /></tables></p><p><tables num="389"><img file="JP6577611B2_D0396.tif" /></tables></p><p><tables num="390"><img file="JP6577611B2_D0397.tif" /></tables></p><p><tables num="391"><img file="JP6577611B2_D0398.tif" /></tables></p><p><tables num="392"><img file="JP6577611B2_D0399.tif" /></tables></p><p><tables num="393"><img file="JP6577611B2_D0400.tif" /></tables></p><p><tables num="394"><img file="JP6577611B2_D0401.tif" /></tables></p><p><tables num="395"><img file="JP6577611B2_D0402.tif" /></tables></p><p><tables num="396"><img file="JP6577611B2_D0403.tif" /></tables></p><p><tables num="397"><img file="JP6577611B2_D0404.tif" /></tables></p><p><tables num="398"><img file="JP6577611B2_D0405.tif" /></tables></p><p><tables num="399"><img file="JP6577611B2_D0406.tif" /></tables></p><p><tables num="400"><img file="JP6577611B2_D0407.tif" /></tables></p><p><tables num="401"><img file="JP6577611B2_D0408.tif" /></tables></p><p><tables num="402"><img file="JP6577611B2_D0409.tif" /></tables></p><p><tables num="403"><img file="JP6577611B2_D0410.tif" /></tables></p><p><tables num="404"><img file="JP6577611B2_D0411.tif" /></tables></p><p><tables num="405"><img file="JP6577611B2_D0412.tif" /></tables></p><p><tables num="406"><img file="JP6577611B2_D0413.tif" /></tables></p><p><tables num="407"><img file="JP6577611B2_D0414.tif" /></tables></p><p><tables num="408"><img file="JP6577611B2_D0415.tif" /></tables></p><p><tables num="409"><img file="JP6577611B2_D0416.tif" /></tables></p><p><tables num="410"><img file="JP6577611B2_D0417.tif" /></tables></p><p><tables num="411"><img file="JP6577611B2_D0418.tif" /></tables></p><p><tables num="412"><img file="JP6577611B2_D0419.tif" /></tables></p><p><tables num="413"><img file="JP6577611B2_D0420.tif" /></tables></p><p><tables num="414"><img file="JP6577611B2_D0421.tif" /></tables></p><p><tables num="415"><img file="JP6577611B2_D0422.tif" /></tables></p><p><tables num="416"><img file="JP6577611B2_D0423.tif" /></tables></p><p><tables num="417"><img file="JP6577611B2_D0424.tif" /></tables></p><p><tables num="418"><img file="JP6577611B2_D0425.tif" /></tables></p><p><tables num="419"><img file="JP6577611B2_D0426.tif" /></tables></p><p><tables num="420"><img file="JP6577611B2_D0427.tif" /></tables></p><p><tables num="421"><img file="JP6577611B2_D0428.tif" /></tables></p><p><tables num="422"><img file="JP6577611B2_D0429.tif" /></tables></p><p><tables num="423"><img file="JP6577611B2_D0430.tif" /></tables></p><p><tables num="424"><img file="JP6577611B2_D0431.tif" /></tables></p><p><tables num="425"><img file="JP6577611B2_D0432.tif" /></tables></p><p><tables num="426"><img file="JP6577611B2_D0433.tif" /></tables></p><p><tables num="427"><img file="JP6577611B2_D0434.tif" /></tables></p><p><tables num="428"><img file="JP6577611B2_D0435.tif" /></tables></p><p><tables num="429"><img file="JP6577611B2_D0436.tif" /></tables></p><p><tables num="430"><img file="JP6577611B2_D0437.tif" /></tables></p><p><tables num="431"><img file="JP6577611B2_D0438.tif" /></tables></p><p><tables num="432"><img file="JP6577611B2_D0439.tif" /></tables></p><p><tables num="433"><img file="JP6577611B2_D0440.tif" /></tables></p><p><tables num="434"><img file="JP6577611B2_D0441.tif" /></tables></p><p><tables num="435"><img file="JP6577611B2_D0442.tif" /></tables></p><p><tables num="436"><img file="JP6577611B2_D0443.tif" /></tables></p><p><tables num="437"><img file="JP6577611B2_D0444.tif" /></tables></p><p><tables num="438"><img file="JP6577611B2_D0445.tif" /></tables></p><p><tables num="439"><img file="JP6577611B2_D0446.tif" /></tables></p><p><tables num="440"><img file="JP6577611B2_D0447.tif" /></tables></p><p><tables num="441"><img file="JP6577611B2_D0448.tif" /></tables></p><p><tables num="442"><img file="JP6577611B2_D0449.tif" /></tables></p><p><tables num="443"><img file="JP6577611B2_D0450.tif" /></tables></p><p><tables num="444"><img file="JP6577611B2_D0451.tif" /></tables></p><p><tables num="445"><img file="JP6577611B2_D0452.tif" /></tables></p><p><tables num="446"><img file="JP6577611B2_D0453.tif" /></tables></p><p><tables num="447"><img file="JP6577611B2_D0454.tif" /></tables></p><p><tables num="448"><img file="JP6577611B2_D0455.tif" /></tables></p><p><tables num="449"><img file="JP6577611B2_D0456.tif" /></tables></p><p><tables num="450"><img file="JP6577611B2_D0457.tif" /></tables></p><p><tables num="451"><img file="JP6577611B2_D0458.tif" /></tables></p><p><tables num="452"><img file="JP6577611B2_D0459.tif" /></tables></p><p><tables num="453"><img file="JP6577611B2_D0460.tif" /></tables></p><p><tables num="454"><img file="JP6577611B2_D0461.tif" /></tables></p><p><tables num="455"><img file="JP6577611B2_D0462.tif" /></tables></p><p><tables num="456"><img file="JP6577611B2_D0463.tif" /></tables></p><p><tables num="457"><img file="JP6577611B2_D0464.tif" /></tables></p><p><tables num="458"><img file="JP6577611B2_D0465.tif" /></tables></p><p><tables num="459"><img file="JP6577611B2_D0466.tif" /></tables></p><p><tables num="460"><img file="JP6577611B2_D0467.tif" /></tables></p><p><tables num="461"><img file="JP6577611B2_D0468.tif" /></tables></p><p><tables num="462"><img file="JP6577611B2_D0469.tif" /></tables></p><p><tables num="463"><img file="JP6577611B2_D0470.tif" /></tables></p><p><tables num="464"><img file="JP6577611B2_D0471.tif" /></tables></p><p><tables num="465"><img file="JP6577611B2_D0472.tif" /></tables></p><p><tables num="466"><img file="JP6577611B2_D0473.tif" /></tables></p><p><tables num="467"><img file="JP6577611B2_D0474.tif" /></tables></p><p><tables num="468"><img file="JP6577611B2_D0475.tif" /></tables></p><p><tables num="469"><img file="JP6577611B2_D0476.tif" /></tables></p><p><tables num="470"><img file="JP6577611B2_D0477.tif" /></tables></p><p><tables num="471"><img file="JP6577611B2_D0478.tif" /></tables></p><p><tables num="472"><img file="JP6577611B2_D0479.tif" /></tables></p><p><tables num="473"><img file="JP6577611B2_D0480.tif" /></tables></p><p><tables num="474"><img file="JP6577611B2_D0481.tif" /></tables></p><p><tables num="475"><img file="JP6577611B2_D0482.tif" /></tables></p><p><tables num="476"><img file="JP6577611B2_D0483.tif" /></tables></p><p><tables num="477"><img file="JP6577611B2_D0484.tif" /></tables></p><p><tables num="478"><img file="JP6577611B2_D0485.tif" /></tables></p><p><tables num="479"><img file="JP6577611B2_D0486.tif" /></tables></p><p><tables num="480"><img file="JP6577611B2_D0487.tif" /></tables></p><p><tables num="481"><img file="JP6577611B2_D0488.tif" /></tables></p><p><tables num="482"><img file="JP6577611B2_D0489.tif" /></tables></p><p><tables num="483"><img file="JP6577611B2_D0490.tif" /></tables></p><p><tables num="484"><img file="JP6577611B2_D0491.tif" /></tables></p><p><tables num="485"><img file="JP6577611B2_D0492.tif" /></tables></p><p><tables num="486"><img file="JP6577611B2_D0493.tif" /></tables></p><p><tables num="487"><img file="JP6577611B2_D0494.tif" /></tables></p><p><tables num="488"><img file="JP6577611B2_D0495.tif" /></tables></p><p><tables num="489"><img file="JP6577611B2_D0496.tif" /></tables></p><p><tables num="490"><img file="JP6577611B2_D0497.tif" /></tables></p><p><tables num="491"><img file="JP6577611B2_D0498.tif" /></tables></p><p><tables num="492"><img file="JP6577611B2_D0499.tif" /></tables></p><p><tables num="493"><img file="JP6577611B2_D0500.tif" /></tables></p><p><tables num="494"><img file="JP6577611B2_D0501.tif" /></tables></p><p><tables num="495"><img file="JP6577611B2_D0502.tif" /></tables></p><p><tables num="496"><img file="JP6577611B2_D0503.tif" /></tables></p><p><tables num="497"><img file="JP6577611B2_D0504.tif" /></tables></p><p><tables num="498"><img file="JP6577611B2_D0505.tif" /></tables></p><p><tables num="499"><img file="JP6577611B2_D0506.tif" /></tables></p><p><tables num="500"><img file="JP6577611B2_D0507.tif" /></tables></p><p><tables num="501"><img file="JP6577611B2_D0508.tif" /></tables></p><p><tables num="502"><img file="JP6577611B2_D0509.tif" /></tables></p><p><tables num="503"><img file="JP6577611B2_D0510.tif" /></tables></p><p><tables num="504"><img file="JP6577611B2_D0511.tif" /></tables></p><p><tables num="505"><img file="JP6577611B2_D0512.tif" /></tables></p><p><tables num="506"><img file="JP6577611B2_D0513.tif" /></tables></p><p><tables num="507"><img file="JP6577611B2_D0514.tif" /></tables></p><p><tables num="508"><img file="JP6577611B2_D0515.tif" /></tables></p><p><tables num="509"><img file="JP6577611B2_D0516.tif" /></tables></p><p><tables num="510"><img file="JP6577611B2_D0517.tif" /></tables></p><p><tables num="511"><img file="JP6577611B2_D0518.tif" /></tables></p><p><tables num="512"><img file="JP6577611B2_D0519.tif" /></tables></p><p><tables num="513"><img file="JP6577611B2_D0520.tif" /></tables></p><p><tables num="514"><img file="JP6577611B2_D0521.tif" /></tables></p><p><tables num="515"><img file="JP6577611B2_D0522.tif" /></tables></p><p><tables num="516"><img file="JP6577611B2_D0523.tif" /></tables></p><p><tables num="517"><img file="JP6577611B2_D0524.tif" /></tables></p><p><tables num="518"><img file="JP6577611B2_D0525.tif" /></tables></p><p><tables num="519"><img file="JP6577611B2_D0526.tif" /></tables></p><p><tables num="520"><img file="JP6577611B2_D0527.tif" /></tables></p><p><tables num="521"><img file="JP6577611B2_D0528.tif" /></tables></p><p><tables num="522"><img file="JP6577611B2_D0529.tif" /></tables></p><p><tables num="523"><img file="JP6577611B2_D0530.tif" /></tables></p><p><tables num="524"><img file="JP6577611B2_D0531.tif" /></tables></p><p><tables num="525"><img file="JP6577611B2_D0532.tif" /></tables></p><p><tables num="526"><img file="JP6577611B2_D0533.tif" /></tables></p><p><tables num="527"><img file="JP6577611B2_D0534.tif" /></tables></p><p><tables num="528"><img file="JP6577611B2_D0535.tif" /></tables></p><p><tables num="529"><img file="JP6577611B2_D0536.tif" /></tables></p><p><tables num="530"><img file="JP6577611B2_D0537.tif" /></tables></p><p><tables num="531"><img file="JP6577611B2_D0538.tif" /></tables></p><p><tables num="532"><img file="JP6577611B2_D0539.tif" /></tables></p><p><tables num="533"><img file="JP6577611B2_D0540.tif" /></tables></p><p><tables num="534"><img file="JP6577611B2_D0541.tif" /></tables></p><p><tables num="535"><img file="JP6577611B2_D0542.tif" /></tables></p><p><tables num="536"><img file="JP6577611B2_D0543.tif" /></tables></p><p><tables num="537"><img file="JP6577611B2_D0544.tif" /></tables></p><p><tables num="538"><img file="JP6577611B2_D0545.tif" /></tables></p><p><tables num="539"><img file="JP6577611B2_D0546.tif" /></tables></p><p><tables num="540"><img file="JP6577611B2_D0547.tif" /></tables></p><p><tables num="541"><img file="JP6577611B2_D0548.tif" /></tables></p><p><tables num="542"><img file="JP6577611B2_D0549.tif" /></tables></p><p><tables num="543"><img file="JP6577611B2_D0550.tif" /></tables></p><p><tables num="544"><img file="JP6577611B2_D0551.tif" /></tables></p><p><tables num="545"><img file="JP6577611B2_D0552.tif" /></tables></p><p><tables num="546"><img file="JP6577611B2_D0553.tif" /></tables></p><p><tables num="547"><img file="JP6577611B2_D0554.tif" /></tables></p><p><tables num="548"><img file="JP6577611B2_D0555.tif" /></tables></p><p><tables num="549"><img file="JP6577611B2_D0556.tif" /></tables></p><p><tables num="550"><img file="JP6577611B2_D0557.tif" /></tables></p><p><tables num="551"><img file="JP6577611B2_D0558.tif" /></tables></p><p><tables num="552"><img file="JP6577611B2_D0559.tif" /></tables></p><p><tables num="553"><img file="JP6577611B2_D0560.tif" /></tables></p><p><tables num="554"><img file="JP6577611B2_D0561.tif" /></tables></p><p><tables num="555"><img file="JP6577611B2_D0562.tif" /></tables></p><p><tables num="556"><img file="JP6577611B2_D0563.tif" /></tables></p><p><tables num="557"><img file="JP6577611B2_D0564.tif" /></tables></p><p><tables num="558"><img file="JP6577611B2_D0565.tif" /></tables></p><p><tables num="559"><img file="JP6577611B2_D0566.tif" /></tables></p><p><tables num="560"><img file="JP6577611B2_D0567.tif" /></tables></p><p><tables num="561"><img file="JP6577611B2_D0568.tif" /></tables></p><p><tables num="562"><img file="JP6577611B2_D0569.tif" /></tables></p><p><tables num="563"><img file="JP6577611B2_D0570.tif" /></tables></p><p><tables num="564"><img file="JP6577611B2_D0571.tif" /></tables></p><p><tables num="565"><img file="JP6577611B2_D0572.tif" /></tables></p><p><tables num="566"><img file="JP6577611B2_D0573.tif" /></tables></p><p><tables num="567"><img file="JP6577611B2_D0574.tif" /></tables></p><p><tables num="568"><img file="JP6577611B2_D0575.tif" /></tables></p><p><tables num="569"><img file="JP6577611B2_D0576.tif" /></tables></p><p><tables num="570"><img file="JP6577611B2_D0577.tif" /></tables></p><p><tables num="571"><img file="JP6577611B2_D0578.tif" /></tables></p><p><tables num="572"><img file="JP6577611B2_D0579.tif" /></tables></p><p><tables num="573"><img file="JP6577611B2_D0580.tif" /></tables></p><p><tables num="574"><img file="JP6577611B2_D0581.tif" /></tables></p><p><tables num="575"><img file="JP6577611B2_D0582.tif" /></tables></p><p><tables num="576"><img file="JP6577611B2_D0583.tif" /></tables></p><p><tables num="577"><img file="JP6577611B2_D0584.tif" /></tables></p><p><tables num="578"><img file="JP6577611B2_D0585.tif" /></tables></p><p><tables num="579"><img file="JP6577611B2_D0586.tif" /></tables></p><p><tables num="580"><img file="JP6577611B2_D0587.tif" /></tables></p><p><tables num="581"><img file="JP6577611B2_D0588.tif" /></tables></p><p><tables num="582"><img file="JP6577611B2_D0589.tif" /></tables></p><p><tables num="583"><img file="JP6577611B2_D0590.tif" /></tables></p><p><tables num="584"><img file="JP6577611B2_D0591.tif" /></tables></p><p><tables num="585"><img file="JP6577611B2_D0592.tif" /></tables></p><p><tables num="586"><img file="JP6577611B2_D0593.tif" /></tables></p><p><tables num="587"><img file="JP6577611B2_D0594.tif" /></tables></p><p><tables num="588"><img file="JP6577611B2_D0595.tif" /></tables></p><p><tables num="589"><img file="JP6577611B2_D0596.tif" /></tables></p><p><tables num="590"><img file="JP6577611B2_D0597.tif" /></tables></p><p><tables num="591"><img file="JP6577611B2_D0598.tif" /></tables></p><p><tables num="592"><img file="JP6577611B2_D0599.tif" /></tables></p><p><tables num="593"><img file="JP6577611B2_D0600.tif" /></tables></p><p><tables num="594"><img file="JP6577611B2_D0601.tif" /></tables></p><p><tables num="595"><img file="JP6577611B2_D0602.tif" /></tables></p><p><tables num="596"><img file="JP6577611B2_D0603.tif" /></tables></p><p><tables num="597"><img file="JP6577611B2_D0604.tif" /></tables></p><p><tables num="598"><img file="JP6577611B2_D0605.tif" /></tables></p><p><tables num="599"><img file="JP6577611B2_D0606.tif" /></tables></p><p><tables num="600"><img file="JP6577611B2_D0607.tif" /></tables></p><p><tables num="601"><img file="JP6577611B2_D0608.tif" /></tables></p><p><tables num="602"><img file="JP6577611B2_D0609.tif" /></tables></p><p><tables num="603"><img file="JP6577611B2_D0610.tif" /></tables></p><p><tables num="604"><img file="JP6577611B2_D0611.tif" /></tables></p><p><tables num="605"><img file="JP6577611B2_D0612.tif" /></tables></p><p><tables num="606"><img file="JP6577611B2_D0613.tif" /></tables></p><p><tables num="607"><img file="JP6577611B2_D0614.tif" /></tables></p><p><tables num="608"><img file="JP6577611B2_D0615.tif" /></tables></p><p><tables num="609"><img file="JP6577611B2_D0616.tif" /></tables></p><p><tables num="610"><img file="JP6577611B2_D0617.tif" /></tables></p><p><tables num="611"><img file="JP6577611B2_D0618.tif" /></tables></p><p><tables num="612"><img file="JP6577611B2_D0619.tif" /></tables></p><p><tables num="613"><img file="JP6577611B2_D0620.tif" /></tables></p><p><tables num="614"><img file="JP6577611B2_D0621.tif" /></tables></p><p><tables num="615"><img file="JP6577611B2_D0622.tif" /></tables></p><p><tables num="616"><img file="JP6577611B2_D0623.tif" /></tables></p><p><tables num="617"><img file="JP6577611B2_D0624.tif" /></tables></p><p><tables num="618"><img file="JP6577611B2_D0625.tif" /></tables></p><p><tables num="619"><img file="JP6577611B2_D0626.tif" /></tables></p><p><tables num="620"><img file="JP6577611B2_D0627.tif" /></tables></p><p><tables num="621"><img file="JP6577611B2_D0628.tif" /></tables></p><p><tables num="622"><img file="JP6577611B2_D0629.tif" /></tables></p><p><tables num="623"><img file="JP6577611B2_D0630.tif" /></tables></p><p><tables num="624"><img file="JP6577611B2_D0631.tif" /></tables></p><p><tables num="625"><img file="JP6577611B2_D0632.tif" /></tables></p><p><tables num="626"><img file="JP6577611B2_D0633.tif" /></tables></p><p><tables num="627"><img file="JP6577611B2_D0634.tif" /></tables></p><p><tables num="628"><img file="JP6577611B2_D0635.tif" /></tables></p><p><tables num="629"><img file="JP6577611B2_D0636.tif" /></tables></p><p><tables num="630"><img file="JP6577611B2_D0637.tif" /></tables></p><p><tables num="631"><img file="JP6577611B2_D0638.tif" /></tables></p><p><tables num="632"><img file="JP6577611B2_D0639.tif" /></tables></p><p><tables num="633"><img file="JP6577611B2_D0640.tif" /></tables></p><p><tables num="634"><img file="JP6577611B2_D0641.tif" /></tables></p><p><tables num="635"><img file="JP6577611B2_D0642.tif" /></tables></p><p><tables num="636"><img file="JP6577611B2_D0643.tif" /></tables></p><p><tables num="637"><img file="JP6577611B2_D0644.tif" /></tables></p><p><tables num="638"><img file="JP6577611B2_D0645.tif" /></tables></p><p><tables num="639"><img file="JP6577611B2_D0646.tif" /></tables></p><p><tables num="640"><img file="JP6577611B2_D0647.tif" /></tables></p><p><tables num="641"><img file="JP6577611B2_D0648.tif" /></tables></p><p><tables num="642"><img file="JP6577611B2_D0649.tif" /></tables></p><p><tables num="643"><img file="JP6577611B2_D0650.tif" /></tables></p><p><tables num="644"><img file="JP6577611B2_D0651.tif" /></tables></p><p><tables num="645"><img file="JP6577611B2_D0652.tif" /></tables></p><p><tables num="646"><img file="JP6577611B2_D0653.tif" /></tables></p><p><tables num="647"><img file="JP6577611B2_D0654.tif" /></tables></p><p><tables num="648"><img file="JP6577611B2_D0655.tif" /></tables></p><p><tables num="649"><img file="JP6577611B2_D0656.tif" /></tables></p><p><tables num="650"><img file="JP6577611B2_D0657.tif" /></tables></p><p><tables num="651"><img file="JP6577611B2_D0658.tif" /></tables></p><p><tables num="652"><img file="JP6577611B2_D0659.tif" /></tables></p><p><tables num="653"><img file="JP6577611B2_D0660.tif" /></tables></p><p><tables num="654"><img file="JP6577611B2_D0661.tif" /></tables></p><p><tables num="655"><img file="JP6577611B2_D0662.tif" /></tables></p><p><tables num="656"><img file="JP6577611B2_D0663.tif" /></tables></p><p><tables num="657"><img file="JP6577611B2_D0664.tif" /></tables></p><p><tables num="658"><img file="JP6577611B2_D0665.tif" /></tables></p><p><tables num="659"><img file="JP6577611B2_D0666.tif" /></tables></p><p><tables num="660"><img file="JP6577611B2_D0667.tif" /></tables></p><p><tables num="661"><img file="JP6577611B2_D0668.tif" /></tables></p><p><tables num="662"><img file="JP6577611B2_D0669.tif" /></tables></p><p><tables num="663"><img file="JP6577611B2_D0670.tif" /></tables></p><p><tables num="664"><img file="JP6577611B2_D0671.tif" /></tables></p><p><tables num="665"><img file="JP6577611B2_D0672.tif" /></tables></p><p><tables num="666"><img file="JP6577611B2_D0673.tif" /></tables></p><p><tables num="667"><img file="JP6577611B2_D0674.tif" /></tables></p><p><tables num="668"><img file="JP6577611B2_D0675.tif" /></tables></p><p><tables num="669"><img file="JP6577611B2_D0676.tif" /></tables></p><p><tables num="670"><img file="JP6577611B2_D0677.tif" /></tables></p><p><tables num="671"><img file="JP6577611B2_D0678.tif" /></tables></p><p><tables num="672"><img file="JP6577611B2_D0679.tif" /></tables></p><p><tables num="673"><img file="JP6577611B2_D0680.tif" /></tables></p><p><tables num="674"><img file="JP6577611B2_D0681.tif" /></tables></p><p><tables num="675"><img file="JP6577611B2_D0682.tif" /></tables></p><p><tables num="676"><img file="JP6577611B2_D0683.tif" /></tables></p><p><tables num="677"><img file="JP6577611B2_D0684.tif" /></tables></p><p><tables num="678"><img file="JP6577611B2_D0685.tif" /></tables></p><p><tables num="679"><img file="JP6577611B2_D0686.tif" /></tables></p><p><tables num="680"><img file="JP6577611B2_D0687.tif" /></tables></p><p><tables num="681"><img file="JP6577611B2_D0688.tif" /></tables></p><p><tables num="682"><img file="JP6577611B2_D0689.tif" /></tables></p><p><tables num="683"><img file="JP6577611B2_D0690.tif" /></tables></p><p><tables num="684"><img file="JP6577611B2_D0691.tif" /></tables></p><p><tables num="685"><img file="JP6577611B2_D0692.tif" /></tables></p><p><tables num="686"><img file="JP6577611B2_D0693.tif" /></tables></p><p><tables num="687"><img file="JP6577611B2_D0694.tif" /></tables></p><p><tables num="688"><img file="JP6577611B2_D0695.tif" /></tables></p><p><tables num="689"><img file="JP6577611B2_D0696.tif" /></tables></p><p><tables num="690"><img file="JP6577611B2_D0697.tif" /></tables></p><p><tables num="691"><img file="JP6577611B2_D0698.tif" /></tables></p><p><tables num="692"><img file="JP6577611B2_D0699.tif" /></tables></p><p><tables num="693"><img file="JP6577611B2_D0700.tif" /></tables></p><p><tables num="694"><img file="JP6577611B2_D0701.tif" /></tables></p><p><tables num="695"><img file="JP6577611B2_D0702.tif" /></tables></p><p><tables num="696"><img file="JP6577611B2_D0703.tif" /></tables></p><p><tables num="697"><img file="JP6577611B2_D0704.tif" /></tables></p><p><tables num="698"><img file="JP6577611B2_D0705.tif" /></tables></p><p><tables num="699"><img file="JP6577611B2_D0706.tif" /></tables></p><p><tables num="700"><img file="JP6577611B2_D0707.tif" /></tables></p><p><tables num="701"><img file="JP6577611B2_D0708.tif" /></tables></p><p><tables num="702"><img file="JP6577611B2_D0709.tif" /></tables></p><p><tables num="703"><img file="JP6577611B2_D0710.tif" /></tables></p><p><tables num="704"><img file="JP6577611B2_D0711.tif" /></tables></p><p><tables num="705"><img file="JP6577611B2_D0712.tif" /></tables></p><p><tables num="706"><img file="JP6577611B2_D0713.tif" /></tables></p><p><tables num="707"><img file="JP6577611B2_D0714.tif" /></tables></p><p><tables num="708"><img file="JP6577611B2_D0715.tif" /></tables></p><p><tables num="709"><img file="JP6577611B2_D0716.tif" /></tables></p><p><tables num="710"><img file="JP6577611B2_D0717.tif" /></tables></p><p><tables num="711"><img file="JP6577611B2_D0718.tif" /></tables></p><p><tables num="712"><img file="JP6577611B2_D0719.tif" /></tables></p><p><tables num="713"><img file="JP6577611B2_D0720.tif" /></tables></p><p><tables num="714"><img file="JP6577611B2_D0721.tif" /></tables></p><p><tables num="715"><img file="JP6577611B2_D0722.tif" /></tables></p><p><tables num="716"><img file="JP6577611B2_D0723.tif" /></tables></p><p><tables num="717"><img file="JP6577611B2_D0724.tif" /></tables></p><p><tables num="718"><img file="JP6577611B2_D0725.tif" /></tables></p><p><tables num="719"><img file="JP6577611B2_D0726.tif" /></tables></p><p><tables num="720"><img file="JP6577611B2_D0727.tif" /></tables></p><p><tables num="721"><img file="JP6577611B2_D0728.tif" /></tables></p><p><tables num="722"><img file="JP6577611B2_D0729.tif" /></tables></p><p><tables num="723"><img file="JP6577611B2_D0730.tif" /></tables></p><p><tables num="724"><img file="JP6577611B2_D0731.tif" /></tables></p><p><tables num="725"><img file="JP6577611B2_D0732.tif" /></tables></p><p><tables num="726"><img file="JP6577611B2_D0733.tif" /></tables></p><p><tables num="727"><img file="JP6577611B2_D0734.tif" /></tables></p><p><tables num="728"><img file="JP6577611B2_D0735.tif" /></tables></p><p><tables num="729"><img file="JP6577611B2_D0736.tif" /></tables></p><p><tables num="730"><img file="JP6577611B2_D0737.tif" /></tables></p><p><tables num="731"><img file="JP6577611B2_D0738.tif" /></tables></p><p><tables num="732"><img file="JP6577611B2_D0739.tif" /></tables></p><p><tables num="733"><img file="JP6577611B2_D0740.tif" /></tables></p><p><tables num="734"><img file="JP6577611B2_D0741.tif" /></tables></p><p><tables num="735"><img file="JP6577611B2_D0742.tif" /></tables></p><p><tables num="736"><img file="JP6577611B2_D0743.tif" /></tables></p><p><tables num="737"><img file="JP6577611B2_D0744.tif" /></tables></p><p><tables num="738"><img file="JP6577611B2_D0745.tif" /></tables></p><p><tables num="739"><img file="JP6577611B2_D0746.tif" /></tables></p><p><tables num="740"><img file="JP6577611B2_D0747.tif" /></tables></p><p><tables num="741"><img file="JP6577611B2_D0748.tif" /></tables></p><p><tables num="742"><img file="JP6577611B2_D0749.tif" /></tables></p><p><tables num="743"><img file="JP6577611B2_D0750.tif" /></tables></p><p><tables num="744"><img file="JP6577611B2_D0751.tif" /></tables></p><p><tables num="745"><img file="JP6577611B2_D0752.tif" /></tables></p><p><tables num="746"><img file="JP6577611B2_D0753.tif" /></tables></p><p><tables num="747"><img file="JP6577611B2_D0754.tif" /></tables></p><p><tables num="748"><img file="JP6577611B2_D0755.tif" /></tables></p><p><tables num="749"><img file="JP6577611B2_D0756.tif" /></tables></p><p><tables num="750"><img file="JP6577611B2_D0757.tif" /></tables></p><p><tables num="751"><img file="JP6577611B2_D0758.tif" /></tables></p><p><tables num="752"><img file="JP6577611B2_D0759.tif" /></tables></p><p><tables num="753"><img file="JP6577611B2_D0760.tif" /></tables></p><p><tables num="754"><img file="JP6577611B2_D0761.tif" /></tables></p><p><tables num="755"><img file="JP6577611B2_D0762.tif" /></tables></p><p><tables num="756"><img file="JP6577611B2_D0763.tif" /></tables></p><p><tables num="757"><img file="JP6577611B2_D0764.tif" /></tables></p><p><tables num="758"><img file="JP6577611B2_D0765.tif" /></tables></p><p><tables num="759"><img file="JP6577611B2_D0766.tif" /></tables></p><p><tables num="760"><img file="JP6577611B2_D0767.tif" /></tables></p><p><tables num="761"><img file="JP6577611B2_D0768.tif" /></tables></p><p><tables num="762"><img file="JP6577611B2_D0769.tif" /></tables></p><p><tables num="763"><img file="JP6577611B2_D0770.tif" /></tables></p><p><tables num="764"><img file="JP6577611B2_D0771.tif" /></tables></p><p><tables num="765"><img file="JP6577611B2_D0772.tif" /></tables></p><p><tables num="766"><img file="JP6577611B2_D0773.tif" /></tables></p><p><tables num="767"><img file="JP6577611B2_D0774.tif" /></tables></p><p><tables num="768"><img file="JP6577611B2_D0775.tif" /></tables></p><p><tables num="769"><img file="JP6577611B2_D0776.tif" /></tables></p><p><tables num="770"><img file="JP6577611B2_D0777.tif" /></tables></p><p><tables num="771"><img file="JP6577611B2_D0778.tif" /></tables></p><p><tables num="772"><img file="JP6577611B2_D0779.tif" /></tables></p><p><tables num="773"><img file="JP6577611B2_D0780.tif" /></tables></p><p><tables num="774"><img file="JP6577611B2_D0781.tif" /></tables></p><p><tables num="775"><img file="JP6577611B2_D0782.tif" /></tables></p><p><tables num="776"><img file="JP6577611B2_D0783.tif" /></tables></p><p><tables num="777"><img file="JP6577611B2_D0784.tif" /></tables></p><p><tables num="778"><img file="JP6577611B2_D0785.tif" /></tables></p><p><tables num="779"><img file="JP6577611B2_D0786.tif" /></tables></p><p><tables num="780"><img file="JP6577611B2_D0787.tif" /></tables></p><p><tables num="781"><img file="JP6577611B2_D0788.tif" /></tables></p><p><tables num="782"><img file="JP6577611B2_D0789.tif" /></tables></p><p><tables num="783"><img file="JP6577611B2_D0790.tif" /></tables></p><p><tables num="784"><img file="JP6577611B2_D0791.tif" /></tables></p><p><tables num="785"><img file="JP6577611B2_D0792.tif" /></tables></p><p><tables num="786"><img file="JP6577611B2_D0793.tif" /></tables></p><p><tables num="787"><img file="JP6577611B2_D0794.tif" /></tables></p><p><tables num="788"><img file="JP6577611B2_D0795.tif" /></tables></p><p><tables num="789"><img file="JP6577611B2_D0796.tif" /></tables></p><p><tables num="790"><img file="JP6577611B2_D0797.tif" /></tables></p><p><tables num="791"><img file="JP6577611B2_D0798.tif" /></tables></p><p><tables num="792"><img file="JP6577611B2_D0799.tif" /></tables></p><p><tables num="793"><img file="JP6577611B2_D0800.tif" /></tables></p><p><tables num="794"><img file="JP6577611B2_D0801.tif" /></tables></p><p><tables num="795"><img file="JP6577611B2_D0802.tif" /></tables></p><p><tables num="796"><img file="JP6577611B2_D0803.tif" /></tables></p><p><tables num="797"><img file="JP6577611B2_D0804.tif" /></tables></p><p><tables num="798"><img file="JP6577611B2_D0805.tif" /></tables></p><p><tables num="799"><img file="JP6577611B2_D0806.tif" /></tables></p><p><tables num="800"><img file="JP6577611B2_D0807.tif" /></tables></p><p><tables num="801"><img file="JP6577611B2_D0808.tif" /></tables></p><p><tables num="802"><img file="JP6577611B2_D0809.tif" /></tables></p><p><tables num="803"><img file="JP6577611B2_D0810.tif" /></tables></p><p><tables num="804"><img file="JP6577611B2_D0811.tif" /></tables></p><p><tables num="805"><img file="JP6577611B2_D0812.tif" /></tables></p><p><tables num="806"><img file="JP6577611B2_D0813.tif" /></tables></p><p><tables num="807"><img file="JP6577611B2_D0814.tif" /></tables></p><p><tables num="808"><img file="JP6577611B2_D0815.tif" /></tables></p><p><tables num="809"><img file="JP6577611B2_D0816.tif" /></tables></p><p><tables num="810"><img file="JP6577611B2_D0817.tif" /></tables></p><p><tables num="811"><img file="JP6577611B2_D0818.tif" /></tables></p><p><tables num="812"><img file="JP6577611B2_D0819.tif" /></tables></p><p><tables num="813"><img file="JP6577611B2_D0820.tif" /></tables></p><p><tables num="814"><img file="JP6577611B2_D0821.tif" /></tables></p><p><tables num="815"><img file="JP6577611B2_D0822.tif" /></tables></p><p><tables num="816"><img file="JP6577611B2_D0823.tif" /></tables></p><p><tables num="817"><img file="JP6577611B2_D0824.tif" /></tables></p><p><tables num="818"><img file="JP6577611B2_D0825.tif" /></tables></p><p><tables num="819"><img file="JP6577611B2_D0826.tif" /></tables></p><p><tables num="820"><img file="JP6577611B2_D0827.tif" /></tables></p><p><tables num="821"><img file="JP6577611B2_D0828.tif" /></tables></p><p><tables num="822"><img file="JP6577611B2_D0829.tif" /></tables></p><p><tables num="823"><img file="JP6577611B2_D0830.tif" /></tables></p><p><tables num="824"><img file="JP6577611B2_D0831.tif" /></tables></p><p><tables num="825"><img file="JP6577611B2_D0832.tif" /></tables></p><p><tables num="826"><img file="JP6577611B2_D0833.tif" /></tables></p><p><tables num="827"><img file="JP6577611B2_D0834.tif" /></tables></p><p><tables num="828"><img file="JP6577611B2_D0835.tif" /></tables></p><p><tables num="829"><img file="JP6577611B2_D0836.tif" /></tables></p><p><tables num="830"><img file="JP6577611B2_D0837.tif" /></tables></p><p><tables num="831"><img file="JP6577611B2_D0838.tif" /></tables></p><p><tables num="832"><img file="JP6577611B2_D0839.tif" /></tables></p><p><tables num="833"><img file="JP6577611B2_D0840.tif" /></tables></p><p><tables num="834"><img file="JP6577611B2_D0841.tif" /></tables></p><p><tables num="835"><img file="JP6577611B2_D0842.tif" /></tables></p><p><tables num="836"><img file="JP6577611B2_D0843.tif" /></tables></p><p><tables num="837"><img file="JP6577611B2_D0844.tif" /></tables></p><p><tables num="838"><img file="JP6577611B2_D0845.tif" /></tables></p><p><tables num="839"><img file="JP6577611B2_D0846.tif" /></tables></p><p><tables num="840"><img file="JP6577611B2_D0847.tif" /></tables></p><p><tables num="841"><img file="JP6577611B2_D0848.tif" /></tables></p><p><tables num="842"><img file="JP6577611B2_D0849.tif" /></tables></p><p><tables num="843"><img file="JP6577611B2_D0850.tif" /></tables></p><p><tables num="844"><img file="JP6577611B2_D0851.tif" /></tables></p><p><tables num="845"><img file="JP6577611B2_D0852.tif" /></tables></p><p><tables num="846"><img file="JP6577611B2_D0853.tif" /></tables></p><p><tables num="847"><img file="JP6577611B2_D0854.tif" /></tables></p><p><tables num="848"><img file="JP6577611B2_D0855.tif" /></tables></p><p><tables num="849"><img file="JP6577611B2_D0856.tif" /></tables></p><p><tables num="850"><img file="JP6577611B2_D0857.tif" /></tables></p><p><tables num="851"><img file="JP6577611B2_D0858.tif" /></tables></p><p><tables num="852"><img file="JP6577611B2_D0859.tif" /></tables></p><p><tables num="853"><img file="JP6577611B2_D0860.tif" /></tables></p><p><tables num="854"><img file="JP6577611B2_D0861.tif" /></tables></p><p><tables num="855"><img file="JP6577611B2_D0862.tif" /></tables></p><p><tables num="856"><img file="JP6577611B2_D0863.tif" /></tables></p><p><tables num="857"><img file="JP6577611B2_D0864.tif" /></tables></p><p><tables num="858"><img file="JP6577611B2_D0865.tif" /></tables></p><p><tables num="859"><img file="JP6577611B2_D0866.tif" /></tables></p><p><tables num="860"><img file="JP6577611B2_D0867.tif" /></tables></p><p><tables num="861"><img file="JP6577611B2_D0868.tif" /></tables></p><p><tables num="862"><img file="JP6577611B2_D0869.tif" /></tables></p><p><tables num="863"><img file="JP6577611B2_D0870.tif" /></tables></p><p><tables num="864"><img file="JP6577611B2_D0871.tif" /></tables></p><p><tables num="865"><img file="JP6577611B2_D0872.tif" /></tables></p><p><tables num="866"><img file="JP6577611B2_D0873.tif" /></tables></p><p><tables num="867"><img file="JP6577611B2_D0874.tif" /></tables></p><p><tables num="868"><img file="JP6577611B2_D0875.tif" /></tables></p><p><tables num="869"><img file="JP6577611B2_D0876.tif" /></tables></p><p><tables num="870"><img file="JP6577611B2_D0877.tif" /></tables></p><p><tables num="871"><img file="JP6577611B2_D0878.tif" /></tables></p><p><tables num="872"><img file="JP6577611B2_D0879.tif" /></tables></p><p><tables num="873"><img file="JP6577611B2_D0880.tif" /></tables></p><p><tables num="874"><img file="JP6577611B2_D0881.tif" /></tables></p><p><tables num="875"><img file="JP6577611B2_D0882.tif" /></tables></p><p><tables num="876"><img file="JP6577611B2_D0883.tif" /></tables></p><p><tables num="877"><img file="JP6577611B2_D0884.tif" /></tables></p><p><tables num="878"><img file="JP6577611B2_D0885.tif" /></tables></p><p><tables num="879"><img file="JP6577611B2_D0886.tif" /></tables></p><p><tables num="880"><img file="JP6577611B2_D0887.tif" /></tables></p><p><tables num="881"><img file="JP6577611B2_D0888.tif" /></tables></p><p><tables num="882"><img file="JP6577611B2_D0889.tif" /></tables></p><p><tables num="883"><img file="JP6577611B2_D0890.tif" /></tables></p><p><tables num="884"><img file="JP6577611B2_D0891.tif" /></tables></p><p><tables num="885"><img file="JP6577611B2_D0892.tif" /></tables></p><p><tables num="886"><img file="JP6577611B2_D0893.tif" /></tables></p><p><tables num="887"><img file="JP6577611B2_D0894.tif" /></tables></p><p><tables num="888"><img file="JP6577611B2_D0895.tif" /></tables></p><p><tables num="889"><img file="JP6577611B2_D0896.tif" /></tables></p><p><tables num="890"><img file="JP6577611B2_D0897.tif" /></tables></p><p><tables num="891"><img file="JP6577611B2_D0898.tif" /></tables></p><p><tables num="892"><img file="JP6577611B2_D0899.tif" /></tables></p><p><tables num="893"><img file="JP6577611B2_D0900.tif" /></tables></p><p><tables num="894"><img file="JP6577611B2_D0901.tif" /></tables></p><p><tables num="895"><img file="JP6577611B2_D0902.tif" /></tables></p><p><tables num="896"><img file="JP6577611B2_D0903.tif" /></tables></p><p><tables num="897"><img file="JP6577611B2_D0904.tif" /></tables></p><p><tables num="898"><img file="JP6577611B2_D0905.tif" /></tables></p><p><tables num="899"><img file="JP6577611B2_D0906.tif" /></tables></p><p><tables num="900"><img file="JP6577611B2_D0907.tif" /></tables></p><p><tables num="901"><img file="JP6577611B2_D0908.tif" /></tables></p><p><tables num="902"><img file="JP6577611B2_D0909.tif" /></tables></p><p><tables num="903"><img file="JP6577611B2_D0910.tif" /></tables></p><p><tables num="904"><img file="JP6577611B2_D0911.tif" /></tables></p><p><tables num="905"><img file="JP6577611B2_D0912.tif" /></tables></p><p><tables num="906"><img file="JP6577611B2_D0913.tif" /></tables></p><p><tables num="907"><img file="JP6577611B2_D0914.tif" /></tables></p><p><tables num="908"><img file="JP6577611B2_D0915.tif" /></tables></p><p><tables num="909"><img file="JP6577611B2_D0916.tif" /></tables></p><p><tables num="910"><img file="JP6577611B2_D0917.tif" /></tables></p><p><tables num="911"><img file="JP6577611B2_D0918.tif" /></tables></p><p><tables num="912"><img file="JP6577611B2_D0919.tif" /></tables></p><p><tables num="913"><img file="JP6577611B2_D0920.tif" /></tables></p><p><tables num="914"><img file="JP6577611B2_D0921.tif" /></tables></p><p><tables num="915"><img file="JP6577611B2_D0922.tif" /></tables></p><p><tables num="916"><img file="JP6577611B2_D0923.tif" /></tables></p><p><tables num="917"><img file="JP6577611B2_D0924.tif" /></tables></p><p><tables num="918"><img file="JP6577611B2_D0925.tif" /></tables></p><p><tables num="919"><img file="JP6577611B2_D0926.tif" /></tables></p><p><tables num="920"><img file="JP6577611B2_D0927.tif" /></tables></p><p><tables num="921"><img file="JP6577611B2_D0928.tif" /></tables></p><p><tables num="922"><img file="JP6577611B2_D0929.tif" /></tables></p><p><tables num="923"><img file="JP6577611B2_D0930.tif" /></tables></p><p><tables num="924"><img file="JP6577611B2_D0931.tif" /></tables></p><p><tables num="925"><img file="JP6577611B2_D0932.tif" /></tables></p><p><tables num="926"><img file="JP6577611B2_D0933.tif" /></tables></p><p><tables num="927"><img file="JP6577611B2_D0934.tif" /></tables></p><p><tables num="928"><img file="JP6577611B2_D0935.tif" /></tables></p><p><tables num="929"><img file="JP6577611B2_D0936.tif" /></tables></p><p><tables num="930"><img file="JP6577611B2_D0937.tif" /></tables></p><p><tables num="931"><img file="JP6577611B2_D0938.tif" /></tables></p><p><tables num="932"><img file="JP6577611B2_D0939.tif" /></tables></p><p><tables num="933"><img file="JP6577611B2_D0940.tif" /></tables></p><p><tables num="934"><img file="JP6577611B2_D0941.tif" /></tables></p><p><tables num="935"><img file="JP6577611B2_D0942.tif" /></tables></p><p><tables num="936"><img file="JP6577611B2_D0943.tif" /></tables></p><p><tables num="937"><img file="JP6577611B2_D0944.tif" /></tables></p><p><tables num="938"><img file="JP6577611B2_D0945.tif" /></tables></p><p><tables num="939"><img file="JP6577611B2_D0946.tif" /></tables></p><p><tables num="940"><img file="JP6577611B2_D0947.tif" /></tables></p><p><tables num="941"><img file="JP6577611B2_D0948.tif" /></tables></p><p><tables num="942"><img file="JP6577611B2_D0949.tif" /></tables></p><p><tables num="943"><img file="JP6577611B2_D0950.tif" /></tables></p><p><tables num="944"><img file="JP6577611B2_D0951.tif" /></tables></p><p><tables num="945"><img file="JP6577611B2_D0952.tif" /></tables></p><p><tables num="946"><img file="JP6577611B2_D0953.tif" /></tables></p><p><tables num="947"><img file="JP6577611B2_D0954.tif" /></tables></p><p><tables num="948"><img file="JP6577611B2_D0955.tif" /></tables></p><p><tables num="949"><img file="JP6577611B2_D0956.tif" /></tables></p><p><tables num="950"><img file="JP6577611B2_D0957.tif" /></tables></p><p><tables num="951"><img file="JP6577611B2_D0958.tif" /></tables></p><p><tables num="952"><img file="JP6577611B2_D0959.tif" /></tables></p><p><tables num="953"><img file="JP6577611B2_D0960.tif" /></tables></p><p><tables num="954"><img file="JP6577611B2_D0961.tif" /></tables></p><p><tables num="955"><img file="JP6577611B2_D0962.tif" /></tables></p><p><tables num="956"><img file="JP6577611B2_D0963.tif" /></tables></p><p><tables num="957"><img file="JP6577611B2_D0964.tif" /></tables></p><p><tables num="958"><img file="JP6577611B2_D0965.tif" /></tables></p><p><tables num="959"><img file="JP6577611B2_D0966.tif" /></tables></p><p><tables num="960"><img file="JP6577611B2_D0967.tif" /></tables></p><p><tables num="961"><img file="JP6577611B2_D0968.tif" /></tables></p><p><tables num="962"><img file="JP6577611B2_D0969.tif" /></tables></p><p><tables num="963"><img file="JP6577611B2_D0970.tif" /></tables></p><p><tables num="964"><img file="JP6577611B2_D0971.tif" /></tables></p><p><tables num="965"><img file="JP6577611B2_D0972.tif" /></tables></p><p><tables num="966"><img file="JP6577611B2_D0973.tif" /></tables></p><p><tables num="967"><img file="JP6577611B2_D0974.tif" /></tables></p><p><tables num="968"><img file="JP6577611B2_D0975.tif" /></tables></p><p><tables num="969"><img file="JP6577611B2_D0976.tif" /></tables></p><p><tables num="970"><img file="JP6577611B2_D0977.tif" /></tables></p><p><tables num="971"><img file="JP6577611B2_D0978.tif" /></tables></p><p><tables num="972"><img file="JP6577611B2_D0979.tif" /></tables></p><p><tables num="973"><img file="JP6577611B2_D0980.tif" /></tables></p><p><tables num="974"><img file="JP6577611B2_D0981.tif" /></tables></p><p><tables num="975"><img file="JP6577611B2_D0982.tif" /></tables></p><p><tables num="976"><img file="JP6577611B2_D0983.tif" /></tables></p><p><tables num="977"><img file="JP6577611B2_D0984.tif" /></tables></p><p><tables num="978"><img file="JP6577611B2_D0985.tif" /></tables></p><p><tables num="979"><img file="JP6577611B2_D0986.tif" /></tables></p><p><tables num="980"><img file="JP6577611B2_D0987.tif" /></tables></p><p><tables num="981"><img file="JP6577611B2_D0988.tif" /></tables></p><p><tables num="982"><img file="JP6577611B2_D0989.tif" /></tables></p><p><tables num="983"><img file="JP6577611B2_D0990.tif" /></tables></p><p><tables num="984"><img file="JP6577611B2_D0991.tif" /></tables></p><p><tables num="985"><img file="JP6577611B2_D0992.tif" /></tables></p><p><tables num="986"><img file="JP6577611B2_D0993.tif" /></tables></p><p><tables num="987"><img file="JP6577611B2_D0994.tif" /></tables></p><p><tables num="988"><img file="JP6577611B2_D0995.tif" /></tables></p><p><tables num="989"><img file="JP6577611B2_D0996.tif" /></tables></p><p><tables num="990"><img file="JP6577611B2_D0997.tif" /></tables></p><p><tables num="991"><img file="JP6577611B2_D0998.tif" /></tables></p><p><tables num="992"><img file="JP6577611B2_D0999.tif" /></tables></p><p><tables num="993"><img file="JP6577611B2_D1000.tif" /></tables></p><p><tables num="994"><img file="JP6577611B2_D1001.tif" /></tables></p><p><tables num="995"><img file="JP6577611B2_D1002.tif" /></tables></p><p><tables num="996"><img file="JP6577611B2_D1003.tif" /></tables></p><p><tables num="997"><img file="JP6577611B2_D1004.tif" /></tables></p><p><tables num="998"><img file="JP6577611B2_D1005.tif" /></tables></p><p><tables num="999"><img file="JP6577611B2_D1006.tif" /></tables></p><p><tables num="1000"><img file="JP6577611B2_D1007.tif" /></tables></p><p><tables num="1001"><img file="JP6577611B2_D1008.tif" /></tables></p><p><tables num="1002"><img file="JP6577611B2_D1009.tif" /></tables></p><p><tables num="1003"><img file="JP6577611B2_D1010.tif" /></tables></p><p><tables num="1004"><img file="JP6577611B2_D1011.tif" /></tables></p><p><tables num="1005"><img file="JP6577611B2_D1012.tif" /></tables></p><p><tables num="1006"><img file="JP6577611B2_D1013.tif" /></tables></p><p><tables num="1007"><img file="JP6577611B2_D1014.tif" /></tables></p><p><tables num="1008"><img file="JP6577611B2_D1015.tif" /></tables></p><p><tables num="1009"><img file="JP6577611B2_D1016.tif" /></tables></p><p><tables num="1010"><img file="JP6577611B2_D1017.tif" /></tables></p><p><tables num="1011"><img file="JP6577611B2_D1018.tif" /></tables></p><p><tables num="1012"><img file="JP6577611B2_D1019.tif" /></tables></p><p><tables num="1013"><img file="JP6577611B2_D1020.tif" /></tables></p><p><tables num="1014"><img file="JP6577611B2_D1021.tif" /></tables></p><p><tables num="1015"><img file="JP6577611B2_D1022.tif" /></tables></p><p><tables num="1016"><img file="JP6577611B2_D1023.tif" /></tables></p><p><tables num="1017"><img file="JP6577611B2_D1024.tif" /></tables></p><p><tables num="1018"><img file="JP6577611B2_D1025.tif" /></tables></p><p><tables num="1019"><img file="JP6577611B2_D1026.tif" /></tables></p><p><tables num="1020"><img file="JP6577611B2_D1027.tif" /></tables></p><p><tables num="1021"><img file="JP6577611B2_D1028.tif" /></tables></p><p><tables num="1022"><img file="JP6577611B2_D1029.tif" /></tables></p><p><tables num="1023"><img file="JP6577611B2_D1030.tif" /></tables></p><p><tables num="1024"><img file="JP6577611B2_D1031.tif" /></tables></p><p><tables num="1025"><img file="JP6577611B2_D1032.tif" /></tables></p><p><tables num="1026"><img file="JP6577611B2_D1033.tif" /></tables></p><p><tables num="1027"><img file="JP6577611B2_D1034.tif" /></tables></p><p><tables num="1028"><img file="JP6577611B2_D1035.tif" /></tables></p><p><tables num="1029"><img file="JP6577611B2_D1036.tif" /></tables></p><p><tables num="1030"><img file="JP6577611B2_D1037.tif" /></tables></p><p><tables num="1031"><img file="JP6577611B2_D1038.tif" /></tables></p><p><tables num="1032"><img file="JP6577611B2_D1039.tif" /></tables></p><p><tables num="1033"><img file="JP6577611B2_D1040.tif" /></tables></p><p><tables num="1034"><img file="JP6577611B2_D1041.tif" /></tables></p><p><tables num="1035"><img file="JP6577611B2_D1042.tif" /></tables></p><p><tables num="1036"><img file="JP6577611B2_D1043.tif" /></tables></p><p><tables num="1037"><img file="JP6577611B2_D1044.tif" /></tables></p><p><tables num="1038"><img file="JP6577611B2_D1045.tif" /></tables></p><p><tables num="1039"><img file="JP6577611B2_D1046.tif" /></tables></p><p><tables num="1040"><img file="JP6577611B2_D1047.tif" /></tables></p><p><tables num="1041"><img file="JP6577611B2_D1048.tif" /></tables></p><p><tables num="1042"><img file="JP6577611B2_D1049.tif" /></tables></p><p><tables num="1043"><img file="JP6577611B2_D1050.tif" /></tables></p><p><tables num="1044"><img file="JP6577611B2_D1051.tif" /></tables></p><p><tables num="1045"><img file="JP6577611B2_D1052.tif" /></tables></p><p><tables num="1046"><img file="JP6577611B2_D1053.tif" /></tables></p><p><tables num="1047"><img file="JP6577611B2_D1054.tif" /></tables></p><p><tables num="1048"><img file="JP6577611B2_D1055.tif" /></tables></p><p><tables num="1049"><img file="JP6577611B2_D1056.tif" /></tables></p><p><tables num="1050"><img file="JP6577611B2_D1057.tif" /></tables></p><p><tables num="1051"><img file="JP6577611B2_D1058.tif" /></tables></p><p><tables num="1052"><img file="JP6577611B2_D1059.tif" /></tables></p><p><tables num="1053"><img file="JP6577611B2_D1060.tif" /></tables></p><p><tables num="1054"><img file="JP6577611B2_D1061.tif" /></tables></p><p><tables num="1055"><img file="JP6577611B2_D1062.tif" /></tables></p><p><tables num="1056"><img file="JP6577611B2_D1063.tif" /></tables></p><p><tables num="1057"><img file="JP6577611B2_D1064.tif" /></tables></p><p><tables num="1058"><img file="JP6577611B2_D1065.tif" /></tables></p><p><tables num="1059"><img file="JP6577611B2_D1066.tif" /></tables></p><p><tables num="1060"><img file="JP6577611B2_D1067.tif" /></tables></p><p><tables num="1061"><img file="JP6577611B2_D1068.tif" /></tables></p><p><tables num="1062"><img file="JP6577611B2_D1069.tif" /></tables></p><p><tables num="1063"><img file="JP6577611B2_D1070.tif" /></tables></p><p><tables num="1064"><img file="JP6577611B2_D1071.tif" /></tables></p><p><tables num="1065"><img file="JP6577611B2_D1072.tif" /></tables></p><p><tables num="1066"><img file="JP6577611B2_D1073.tif" /></tables></p><p><tables num="1067"><img file="JP6577611B2_D1074.tif" /></tables></p><p><tables num="1068"><img file="JP6577611B2_D1075.tif" /></tables></p><p><tables num="1069"><img file="JP6577611B2_D1076.tif" /></tables></p><p><tables num="1070"><img file="JP6577611B2_D1077.tif" /></tables></p><p><tables num="1071"><img file="JP6577611B2_D1078.tif" /></tables></p><p><tables num="1072"><img file="JP6577611B2_D1079.tif" /></tables></p><p><tables num="1073"><img file="JP6577611B2_D1080.tif" /></tables></p><p><tables num="1074"><img file="JP6577611B2_D1081.tif" /></tables></p><p><tables num="1075"><img file="JP6577611B2_D1082.tif" /></tables></p><p><tables num="1076"><img file="JP6577611B2_D1083.tif" /></tables></p><p><tables num="1077"><img file="JP6577611B2_D1084.tif" /></tables></p><p><tables num="1078"><img file="JP6577611B2_D1085.tif" /></tables></p><p><tables num="1079"><img file="JP6577611B2_D1086.tif" /></tables></p><p><tables num="1080"><img file="JP6577611B2_D1087.tif" /></tables></p><p><tables num="1081"><img file="JP6577611B2_D1088.tif" /></tables></p><p><tables num="1082"><img file="JP6577611B2_D1089.tif" /></tables></p><p><tables num="1083"><img file="JP6577611B2_D1090.tif" /></tables></p><p><tables num="1084"><img file="JP6577611B2_D1091.tif" /></tables></p><p><tables num="1085"><img file="JP6577611B2_D1092.tif" /></tables></p><p><tables num="1086"><img file="JP6577611B2_D1093.tif" /></tables></p><p><tables num="1087"><img file="JP6577611B2_D1094.tif" /></tables></p><p><tables num="1088"><img file="JP6577611B2_D1095.tif" /></tables></p><p><tables num="1089"><img file="JP6577611B2_D1096.tif" /></tables></p><p><tables num="1090"><img file="JP6577611B2_D1097.tif" /></tables></p><p><tables num="1091"><img file="JP6577611B2_D1098.tif" /></tables></p><p><tables num="1092"><img file="JP6577611B2_D1099.tif" /></tables></p><p><tables num="1093"><img file="JP6577611B2_D1100.tif" /></tables></p><p><tables num="1094"><img file="JP6577611B2_D1101.tif" /></tables></p><p><tables num="1095"><img file="JP6577611B2_D1102.tif" /></tables></p><p><tables num="1096"><img file="JP6577611B2_D1103.tif" /></tables></p><p><tables num="1097"><img file="JP6577611B2_D1104.tif" /></tables></p><p><tables num="1098"><img file="JP6577611B2_D1105.tif" /></tables></p><p><tables num="1099"><img file="JP6577611B2_D1106.tif" /></tables></p><p><tables num="1100"><img file="JP6577611B2_D1107.tif" /></tables></p><p><tables num="1101"><img file="JP6577611B2_D1108.tif" /></tables></p><p><tables num="1102"><img file="JP6577611B2_D1109.tif" /></tables></p><p><tables num="1103"><img file="JP6577611B2_D1110.tif" /></tables></p><p><tables num="1104"><img file="JP6577611B2_D1111.tif" /></tables></p><p><tables num="1105"><img file="JP6577611B2_D1112.tif" /></tables></p><p><tables num="1106"><img file="JP6577611B2_D1113.tif" /></tables></p><p><tables num="1107"><img file="JP6577611B2_D1114.tif" /></tables></p><p><tables num="1108"><img file="JP6577611B2_D1115.tif" /></tables></p><p><tables num="1109"><img file="JP6577611B2_D1116.tif" /></tables></p><p><tables num="1110"><img file="JP6577611B2_D1117.tif" /></tables></p><p><tables num="1111"><img file="JP6577611B2_D1118.tif" /></tables></p><p><tables num="1112"><img file="JP6577611B2_D1119.tif" /></tables></p><p><tables num="1113"><img file="JP6577611B2_D1120.tif" /></tables></p><p><tables num="1114"><img file="JP6577611B2_D1121.tif" /></tables></p><p><tables num="1115"><img file="JP6577611B2_D1122.tif" /></tables></p><p><tables num="1116"><img file="JP6577611B2_D1123.tif" /></tables></p><p><tables num="1117"><img file="JP6577611B2_D1124.tif" /></tables></p><p><tables num="1118"><img file="JP6577611B2_D1125.tif" /></tables></p><p><tables num="1119"><img file="JP6577611B2_D1126.tif" /></tables></p><p><tables num="1120"><img file="JP6577611B2_D1127.tif" /></tables></p><p><tables num="1121"><img file="JP6577611B2_D1128.tif" /></tables></p><p><tables num="1122"><img file="JP6577611B2_D1129.tif" /></tables></p><p><tables num="1123"><img file="JP6577611B2_D1130.tif" /></tables></p><p><tables num="1124"><img file="JP6577611B2_D1131.tif" /></tables></p><p><tables num="1125"><img file="JP6577611B2_D1132.tif" /></tables></p><p><tables num="1126"><img file="JP6577611B2_D1133.tif" /></tables></p><p><tables num="1127"><img file="JP6577611B2_D1134.tif" /></tables></p><p><tables num="1128"><img file="JP6577611B2_D1135.tif" /></tables></p><p><tables num="1129"><img file="JP6577611B2_D1136.tif" /></tables></p><p><tables num="1130"><img file="JP6577611B2_D1137.tif" /></tables></p><p><tables num="1131"><img file="JP6577611B2_D1138.tif" /></tables></p><p><tables num="1132"><img file="JP6577611B2_D1139.tif" /></tables></p><p><tables num="1133"><img file="JP6577611B2_D1140.tif" /></tables></p><p><tables num="1134"><img file="JP6577611B2_D1141.tif" /></tables></p><p><tables num="1135"><img file="JP6577611B2_D1142.tif" /></tables></p><p><tables num="1136"><img file="JP6577611B2_D1143.tif" /></tables></p><p><tables num="1137"><img file="JP6577611B2_D1144.tif" /></tables></p><p><tables num="1138"><img file="JP6577611B2_D1145.tif" /></tables></p><p><tables num="1139"><img file="JP6577611B2_D1146.tif" /></tables></p><p><tables num="1140"><img file="JP6577611B2_D1147.tif" /></tables></p><p><tables num="1141"><img file="JP6577611B2_D1148.tif" /></tables></p><p><tables num="1142"><img file="JP6577611B2_D1149.tif" /></tables></p><p><tables num="1143"><img file="JP6577611B2_D1150.tif" /></tables></p><p><tables num="1144"><img file="JP6577611B2_D1151.tif" /></tables></p><p><tables num="1145"><img file="JP6577611B2_D1152.tif" /></tables></p><p><tables num="1146"><img file="JP6577611B2_D1153.tif" /></tables></p><p><tables num="1147"><img file="JP6577611B2_D1154.tif" /></tables></p><p><tables num="1148"><img file="JP6577611B2_D1155.tif" /></tables></p><p><tables num="1149"><img file="JP6577611B2_D1156.tif" /></tables></p><p><tables num="1150"><img file="JP6577611B2_D1157.tif" /></tables></p><p><tables num="1151"><img file="JP6577611B2_D1158.tif" /></tables></p><p><tables num="1152"><img file="JP6577611B2_D1159.tif" /></tables></p><p><tables num="1153"><img file="JP6577611B2_D1160.tif" /></tables></p><p><tables num="1154"><img file="JP6577611B2_D1161.tif" /></tables></p><p><tables num="1155"><img file="JP6577611B2_D1162.tif" /></tables></p><p><tables num="1156"><img file="JP6577611B2_D1163.tif" /></tables></p><p><tables num="1157"><img file="JP6577611B2_D1164.tif" /></tables></p><p><tables num="1158"><img file="JP6577611B2_D1165.tif" /></tables></p><p><tables num="1159"><img file="JP6577611B2_D1166.tif" /></tables></p><p><tables num="1160"><img file="JP6577611B2_D1167.tif" /></tables></p><p><tables num="1161"><img file="JP6577611B2_D1168.tif" /></tables></p><p><tables num="1162"><img file="JP6577611B2_D1169.tif" /></tables></p><p><tables num="1163"><img file="JP6577611B2_D1170.tif" /></tables></p><p><tables num="1164"><img file="JP6577611B2_D1171.tif" /></tables></p><p><tables num="1165"><img file="JP6577611B2_D1172.tif" /></tables></p><p><tables num="1166"><img file="JP6577611B2_D1173.tif" /></tables></p><p><tables num="1167"><img file="JP6577611B2_D1174.tif" /></tables></p><p><tables num="1168"><img file="JP6577611B2_D1175.tif" /></tables></p><p><tables num="1169"><img file="JP6577611B2_D1176.tif" /></tables></p><p><tables num="1170"><img file="JP6577611B2_D1177.tif" /></tables></p><p><tables num="1171"><img file="JP6577611B2_D1178.tif" /></tables></p><p><tables num="1172"><img file="JP6577611B2_D1179.tif" /></tables></p><p><tables num="1173"><img file="JP6577611B2_D1180.tif" /></tables></p><p><tables num="1174"><img file="JP6577611B2_D1181.tif" /></tables></p><p><tables num="1175"><img file="JP6577611B2_D1182.tif" /></tables></p><p><tables num="1176"><img file="JP6577611B2_D1183.tif" /></tables></p><p><tables num="1177"><img file="JP6577611B2_D1184.tif" /></tables></p><p><tables num="1178"><img file="JP6577611B2_D1185.tif" /></tables></p><p><tables num="1179"><img file="JP6577611B2_D1186.tif" /></tables></p><p><tables num="1180"><img file="JP6577611B2_D1187.tif" /></tables></p><p><tables num="1181"><img file="JP6577611B2_D1188.tif" /></tables></p><p><tables num="1182"><img file="JP6577611B2_D1189.tif" /></tables></p><p><tables num="1183"><img file="JP6577611B2_D1190.tif" /></tables></p><p><tables num="1184"><img file="JP6577611B2_D1191.tif" /></tables></p><p><tables num="1185"><img file="JP6577611B2_D1192.tif" /></tables></p><p><tables num="1186"><img file="JP6577611B2_D1193.tif" /></tables></p><p><tables num="1187"><img file="JP6577611B2_D1194.tif" /></tables></p><p><tables num="1188"><img file="JP6577611B2_D1195.tif" /></tables></p><p><tables num="1189"><img file="JP6577611B2_D1196.tif" /></tables></p><p><tables num="1190"><img file="JP6577611B2_D1197.tif" /></tables></p><p><tables num="1191"><img file="JP6577611B2_D1198.tif" /></tables></p><p><tables num="1192"><img file="JP6577611B2_D1199.tif" /></tables></p><p><tables num="1193"><img file="JP6577611B2_D1200.tif" /></tables></p><p><tables num="1194"><img file="JP6577611B2_D1201.tif" /></tables></p><p><tables num="1195"><img file="JP6577611B2_D1202.tif" /></tables></p><p><tables num="1196"><img file="JP6577611B2_D1203.tif" /></tables></p><p><tables num="1197"><img file="JP6577611B2_D1204.tif" /></tables></p><p><tables num="1198"><img file="JP6577611B2_D1205.tif" /></tables></p><p><tables num="1199"><img file="JP6577611B2_D1206.tif" /></tables></p><p><tables num="1200"><img file="JP6577611B2_D1207.tif" /></tables></p><p><tables num="1201"><img file="JP6577611B2_D1208.tif" /></tables></p><p><tables num="1202"><img file="JP6577611B2_D1209.tif" /></tables></p><p><tables num="1203"><img file="JP6577611B2_D1210.tif" /></tables></p><p><tables num="1204"><img file="JP6577611B2_D1211.tif" /></tables></p><p><tables num="1205"><img file="JP6577611B2_D1212.tif" /></tables></p><p><tables num="1206"><img file="JP6577611B2_D1213.tif" /></tables></p><p><tables num="1207"><img file="JP6577611B2_D1214.tif" /></tables></p><p><tables num="1208"><img file="JP6577611B2_D1215.tif" /></tables></p><p><tables num="1209"><img file="JP6577611B2_D1216.tif" /></tables></p><p><tables num="1210"><img file="JP6577611B2_D1217.tif" /></tables></p><p><tables num="1211"><img file="JP6577611B2_D1218.tif" /></tables></p><p><tables num="1212"><img file="JP6577611B2_D1219.tif" /></tables></p><p><tables num="1213"><img file="JP6577611B2_D1220.tif" /></tables></p><p><tables num="1214"><img file="JP6577611B2_D1221.tif" /></tables></p><p><tables num="1215"><img file="JP6577611B2_D1222.tif" /></tables></p><p><tables num="1216"><img file="JP6577611B2_D1223.tif" /></tables></p><p><tables num="1217"><img file="JP6577611B2_D1224.tif" /></tables></p><p><tables num="1218"><img file="JP6577611B2_D1225.tif" /></tables></p><p><tables num="1219"><img file="JP6577611B2_D1226.tif" /></tables></p><p><tables num="1220"><img file="JP6577611B2_D1227.tif" /></tables></p><p><tables num="1221"><img file="JP6577611B2_D1228.tif" /></tables></p><p><tables num="1222"><img file="JP6577611B2_D1229.tif" /></tables></p><p><tables num="1223"><img file="JP6577611B2_D1230.tif" /></tables></p><p><tables num="1224"><img file="JP6577611B2_D1231.tif" /></tables></p><p><tables num="1225"><img file="JP6577611B2_D1232.tif" /></tables></p><p><tables num="1226"><img file="JP6577611B2_D1233.tif" /></tables></p><p><tables num="1227"><img file="JP6577611B2_D1234.tif" /></tables></p><p><tables num="1228"><img file="JP6577611B2_D1235.tif" /></tables></p><p><tables num="1229"><img file="JP6577611B2_D1236.tif" /></tables></p><p><tables num="1230"><img file="JP6577611B2_D1237.tif" /></tables></p><p><tables num="1231"><img file="JP6577611B2_D1238.tif" /></tables></p><p><tables num="1232"><img file="JP6577611B2_D1239.tif" /></tables></p><p><tables num="1233"><img file="JP6577611B2_D1240.tif" /></tables></p><p><tables num="1234"><img file="JP6577611B2_D1241.tif" /></tables></p><p><tables num="1235"><img file="JP6577611B2_D1242.tif" /></tables></p><p><tables num="1236"><img file="JP6577611B2_D1243.tif" /></tables></p><p><tables num="1237"><img file="JP6577611B2_D1244.tif" /></tables></p><p><tables num="1238"><img file="JP6577611B2_D1245.tif" /></tables></p><p><tables num="1239"><img file="JP6577611B2_D1246.tif" /></tables></p><p><tables num="1240"><img file="JP6577611B2_D1247.tif" /></tables></p><p><tables num="1241"><img file="JP6577611B2_D1248.tif" /></tables></p><p><tables num="1242"><img file="JP6577611B2_D1249.tif" /></tables></p><p><tables num="1243"><img file="JP6577611B2_D1250.tif" /></tables></p><p><tables num="1244"><img file="JP6577611B2_D1251.tif" /></tables></p><p><tables num="1245"><img file="JP6577611B2_D1252.tif" /></tables></p><p><tables num="1246"><img file="JP6577611B2_D1253.tif" /></tables></p><p><tables num="1247"><img file="JP6577611B2_D1254.tif" /></tables></p><p><tables num="1248"><img file="JP6577611B2_D1255.tif" /></tables></p><p><tables num="1249"><img file="JP6577611B2_D1256.tif" /></tables></p><p><tables num="1250"><img file="JP6577611B2_D1257.tif" /></tables></p><p><tables num="1251"><img file="JP6577611B2_D1258.tif" /></tables></p><p><tables num="1252"><img file="JP6577611B2_D1259.tif" /></tables></p><p><tables num="1253"><img file="JP6577611B2_D1260.tif" /></tables></p><p><tables num="1254"><img file="JP6577611B2_D1261.tif" /></tables></p><p><tables num="1255"><img file="JP6577611B2_D1262.tif" /></tables></p><p><tables num="1256"><img file="JP6577611B2_D1263.tif" /></tables></p><p><tables num="1257"><img file="JP6577611B2_D1264.tif" /></tables></p><p><tables num="1258"><img file="JP6577611B2_D1265.tif" /></tables></p><p><tables num="1259"><img file="JP6577611B2_D1266.tif" /></tables></p><p><tables num="1260"><img file="JP6577611B2_D1267.tif" /></tables></p><p><tables num="1261"><img file="JP6577611B2_D1268.tif" /></tables></p><p><tables num="1262"><img file="JP6577611B2_D1269.tif" /></tables></p><p><tables num="1263"><img file="JP6577611B2_D1270.tif" /></tables></p><p><tables num="1264"><img file="JP6577611B2_D1271.tif" /></tables></p><p><tables num="1265"><img file="JP6577611B2_D1272.tif" /></tables></p><p><tables num="1266"><img file="JP6577611B2_D1273.tif" /></tables></p><p><tables num="1267"><img file="JP6577611B2_D1274.tif" /></tables></p><p><tables num="1268"><img file="JP6577611B2_D1275.tif" /></tables></p><p><tables num="1269"><img file="JP6577611B2_D1276.tif" /></tables></p><p><tables num="1270"><img file="JP6577611B2_D1277.tif" /></tables></p><p><tables num="1271"><img file="JP6577611B2_D1278.tif" /></tables></p><p><tables num="1272"><img file="JP6577611B2_D1279.tif" /></tables></p><p><tables num="1273"><img file="JP6577611B2_D1280.tif" /></tables></p><p><tables num="1274"><img file="JP6577611B2_D1281.tif" /></tables></p><p><tables num="1275"><img file="JP6577611B2_D1282.tif" /></tables></p><p><tables num="1276"><img file="JP6577611B2_D1283.tif" /></tables></p><p><tables num="1277"><img file="JP6577611B2_D1284.tif" /></tables></p><p><tables num="1278"><img file="JP6577611B2_D1285.tif" /></tables></p><p><tables num="1279"><img file="JP6577611B2_D1286.tif" /></tables></p><p><tables num="1280"><img file="JP6577611B2_D1287.tif" /></tables></p><p><tables num="1281"><img file="JP6577611B2_D1288.tif" /></tables></p><p><tables num="1282"><img file="JP6577611B2_D1289.tif" /></tables></p><p><tables num="1283"><img file="JP6577611B2_D1290.tif" /></tables></p><p><tables num="1284"><img file="JP6577611B2_D1291.tif" /></tables></p><p><tables num="1285"><img file="JP6577611B2_D1292.tif" /></tables></p><p><tables num="1286"><img file="JP6577611B2_D1293.tif" /></tables></p><p><tables num="1287"><img file="JP6577611B2_D1294.tif" /></tables></p><p><tables num="1288"><img file="JP6577611B2_D1295.tif" /></tables></p><p><tables num="1289"><img file="JP6577611B2_D1296.tif" /></tables></p><p><tables num="1290"><img file="JP6577611B2_D1297.tif" /></tables></p><p><tables num="1291"><img file="JP6577611B2_D1298.tif" /></tables></p><p><tables num="1292"><img file="JP6577611B2_D1299.tif" /></tables></p><p><tables num="1293"><img file="JP6577611B2_D1300.tif" /></tables></p><p><tables num="1294"><img file="JP6577611B2_D1301.tif" /></tables></p><p><tables num="1295"><img file="JP6577611B2_D1302.tif" /></tables></p><p><tables num="1296"><img file="JP6577611B2_D1303.tif" /></tables></p><p><tables num="1297"><img file="JP6577611B2_D1304.tif" /></tables></p><p><tables num="1298"><img file="JP6577611B2_D1305.tif" /></tables></p><p><tables num="1299"><img file="JP6577611B2_D1306.tif" /></tables></p><p><tables num="1300"><img file="JP6577611B2_D1307.tif" /></tables></p><p><tables num="1301"><img file="JP6577611B2_D1308.tif" /></tables></p><p><tables num="1302"><img file="JP6577611B2_D1309.tif" /></tables></p><p><tables num="1303"><img file="JP6577611B2_D1310.tif" /></tables></p><p><tables num="1304"><img file="JP6577611B2_D1311.tif" /></tables></p><p><tables num="1305"><img file="JP6577611B2_D1312.tif" /></tables></p><p><tables num="1306"><img file="JP6577611B2_D1313.tif" /></tables></p><p><tables num="1307"><img file="JP6577611B2_D1314.tif" /></tables></p><p><tables num="1308"><img file="JP6577611B2_D1315.tif" /></tables></p><p><tables num="1309"><img file="JP6577611B2_D1316.tif" /></tables></p><p><tables num="1310"><img file="JP6577611B2_D1317.tif" /></tables></p><p><tables num="1311"><img file="JP6577611B2_D1318.tif" /></tables></p><p><tables num="1312"><img file="JP6577611B2_D1319.tif" /></tables></p><p><tables num="1313"><img file="JP6577611B2_D1320.tif" /></tables></p><p><tables num="1314"><img file="JP6577611B2_D1321.tif" /></tables></p><p><tables num="1315"><img file="JP6577611B2_D1322.tif" /></tables></p><p><tables num="1316"><img file="JP6577611B2_D1323.tif" /></tables></p><p><tables num="1317"><img file="JP6577611B2_D1324.tif" /></tables></p><p><tables num="1318"><img file="JP6577611B2_D1325.tif" /></tables></p><p><tables num="1319"><img file="JP6577611B2_D1326.tif" /></tables></p><p><tables num="1320"><img file="JP6577611B2_D1327.tif" /></tables></p><p><tables num="1321"><img file="JP6577611B2_D1328.tif" /></tables></p><p><tables num="1322"><img file="JP6577611B2_D1329.tif" /></tables></p><p><tables num="1323"><img file="JP6577611B2_D1330.tif" /></tables></p><p><tables num="1324"><img file="JP6577611B2_D1331.tif" /></tables></p><p><tables num="1325"><img file="JP6577611B2_D1332.tif" /></tables></p><p><tables num="1326"><img file="JP6577611B2_D1333.tif" /></tables></p><p><tables num="1327"><img file="JP6577611B2_D1334.tif" /></tables></p><p><tables num="1328"><img file="JP6577611B2_D1335.tif" /></tables></p><p><tables num="1329"><img file="JP6577611B2_D1336.tif" /></tables></p><p><tables num="1330"><img file="JP6577611B2_D1337.tif" /></tables></p><p><tables num="1331"><img file="JP6577611B2_D1338.tif" /></tables></p><p><tables num="1332"><img file="JP6577611B2_D1339.tif" /></tables></p><p><tables num="1333"><img file="JP6577611B2_D1340.tif" /></tables></p><p><tables num="1334"><img file="JP6577611B2_D1341.tif" /></tables></p><p><tables num="1335"><img file="JP6577611B2_D1342.tif" /></tables></p><p><tables num="1336"><img file="JP6577611B2_D1343.tif" /></tables></p><p><tables num="1337"><img file="JP6577611B2_D1344.tif" /></tables></p><p><tables num="1338"><img file="JP6577611B2_D1345.tif" /></tables></p><p><tables num="1339"><img file="JP6577611B2_D1346.tif" /></tables></p><p><tables num="1340"><img file="JP6577611B2_D1347.tif" /></tables></p><p><tables num="1341"><img file="JP6577611B2_D1348.tif" /></tables></p><p><tables num="1342"><img file="JP6577611B2_D1349.tif" /></tables></p><p><tables num="1343"><img file="JP6577611B2_D1350.tif" /></tables></p><p><tables num="1344"><img file="JP6577611B2_D1351.tif" /></tables></p><p><tables num="1345"><img file="JP6577611B2_D1352.tif" /></tables></p><p><tables num="1346"><img file="JP6577611B2_D1353.tif" /></tables></p><p><tables num="1347"><img file="JP6577611B2_D1354.tif" /></tables></p><p><tables num="1348"><img file="JP6577611B2_D1355.tif" /></tables></p><p><tables num="1349"><img file="JP6577611B2_D1356.tif" /></tables></p><p><tables num="1350"><img file="JP6577611B2_D1357.tif" /></tables></p><p><tables num="1351"><img file="JP6577611B2_D1358.tif" /></tables></p><p><tables num="1352"><img file="JP6577611B2_D1359.tif" /></tables></p><p><tables num="1353"><img file="JP6577611B2_D1360.tif" /></tables></p><p><tables num="1354"><img file="JP6577611B2_D1361.tif" /></tables></p><p><tables num="1355"><img file="JP6577611B2_D1362.tif" /></tables></p><p><tables num="1356"><img file="JP6577611B2_D1363.tif" /></tables></p><p><tables num="1357"><img file="JP6577611B2_D1364.tif" /></tables></p><p><tables num="1358"><img file="JP6577611B2_D1365.tif" /></tables></p><p><tables num="1359"><img file="JP6577611B2_D1366.tif" /></tables></p><p><tables num="1360"><img file="JP6577611B2_D1367.tif" /></tables></p><p><tables num="1361"><img file="JP6577611B2_D1368.tif" /></tables></p><p><tables num="1362"><img file="JP6577611B2_D1369.tif" /></tables></p><p><tables num="1363"><img file="JP6577611B2_D1370.tif" /></tables></p><p><tables num="1364"><img file="JP6577611B2_D1371.tif" /></tables></p><p><tables num="1365"><img file="JP6577611B2_D1372.tif" /></tables></p><p><tables num="1366"><img file="JP6577611B2_D1373.tif" /></tables></p><p><tables num="1367"><img file="JP6577611B2_D1374.tif" /></tables></p><p><tables num="1368"><img file="JP6577611B2_D1375.tif" /></tables></p><p><tables num="1369"><img file="JP6577611B2_D1376.tif" /></tables></p><p><tables num="1370"><img file="JP6577611B2_D1377.tif" /></tables></p><p><tables num="1371"><img file="JP6577611B2_D1378.tif" /></tables></p><p><tables num="1372"><img file="JP6577611B2_D1379.tif" /></tables></p><p><tables num="1373"><img file="JP6577611B2_D1380.tif" /></tables></p><p><tables num="1374"><img file="JP6577611B2_D1381.tif" /></tables></p><p><tables num="1375"><img file="JP6577611B2_D1382.tif" /></tables></p><p><tables num="1376"><img file="JP6577611B2_D1383.tif" /></tables></p><p><tables num="1377"><img file="JP6577611B2_D1384.tif" /></tables></p><p><tables num="1378"><img file="JP6577611B2_D1385.tif" /></tables></p><p><tables num="1379"><img file="JP6577611B2_D1386.tif" /></tables></p><p><tables num="1380"><img file="JP6577611B2_D1387.tif" /></tables></p><p><tables num="1381"><img file="JP6577611B2_D1388.tif" /></tables></p><p><tables num="1382"><img file="JP6577611B2_D1389.tif" /></tables></p><p><tables num="1383"><img file="JP6577611B2_D1390.tif" /></tables></p><p><tables num="1384"><img file="JP6577611B2_D1391.tif" /></tables></p><p><tables num="1385"><img file="JP6577611B2_D1392.tif" /></tables></p><p><tables num="1386"><img file="JP6577611B2_D1393.tif" /></tables></p><p><tables num="1387"><img file="JP6577611B2_D1394.tif" /></tables></p><p><tables num="1388"><img file="JP6577611B2_D1395.tif" /></tables></p><p><tables num="1389"><img file="JP6577611B2_D1396.tif" /></tables></p><p><tables num="1390"><img file="JP6577611B2_D1397.tif" /></tables></p><p><tables num="1391"><img file="JP6577611B2_D1398.tif" /></tables></p><p><tables num="1392"><img file="JP6577611B2_D1399.tif" /></tables></p><p><tables num="1393"><img file="JP6577611B2_D1400.tif" /></tables></p><p><tables num="1394"><img file="JP6577611B2_D1401.tif" /></tables></p><p><tables num="1395"><img file="JP6577611B2_D1402.tif" /></tables></p><p><tables num="1396"><img file="JP6577611B2_D1403.tif" /></tables></p><p><tables num="1397"><img file="JP6577611B2_D1404.tif" /></tables></p><p><tables num="1398"><img file="JP6577611B2_D1405.tif" /></tables></p><p><tables num="1399"><img file="JP6577611B2_D1406.tif" /></tables></p><p><tables num="1400"><img file="JP6577611B2_D1407.tif" /></tables></p><p><tables num="1401"><img file="JP6577611B2_D1408.tif" /></tables></p><p><tables num="1402"><img file="JP6577611B2_D1409.tif" /></tables></p><p><tables num="1403"><img file="JP6577611B2_D1410.tif" /></tables></p><p><tables num="1404"><img file="JP6577611B2_D1411.tif" /></tables></p><p><tables num="1405"><img file="JP6577611B2_D1412.tif" /></tables></p><p><tables num="1406"><img file="JP6577611B2_D1413.tif" /></tables></p><p><tables num="1407"><img file="JP6577611B2_D1414.tif" /></tables></p><p><tables num="1408"><img file="JP6577611B2_D1415.tif" /></tables></p><p><tables num="1409"><img file="JP6577611B2_D1416.tif" /></tables></p><p><tables num="1410"><img file="JP6577611B2_D1417.tif" /></tables></p><p><tables num="1411"><img file="JP6577611B2_D1418.tif" /></tables></p><p><tables num="1412"><img file="JP6577611B2_D1419.tif" /></tables></p><p><tables num="1413"><img file="JP6577611B2_D1420.tif" /></tables></p><p><tables num="1414"><img file="JP6577611B2_D1421.tif" /></tables></p><p><tables num="1415"><img file="JP6577611B2_D1422.tif" /></tables></p><p><tables num="1416"><img file="JP6577611B2_D1423.tif" /></tables></p><p><tables num="1417"><img file="JP6577611B2_D1424.tif" /></tables></p><p><tables num="1418"><img file="JP6577611B2_D1425.tif" /></tables></p><p><tables num="1419"><img file="JP6577611B2_D1426.tif" /></tables></p><p><tables num="1420"><img file="JP6577611B2_D1427.tif" /></tables></p><p><tables num="1421"><img file="JP6577611B2_D1428.tif" /></tables></p><p><tables num="1422"><img file="JP6577611B2_D1429.tif" /></tables></p><p><tables num="1423"><img file="JP6577611B2_D1430.tif" /></tables></p><p><tables num="1424"><img file="JP6577611B2_D1431.tif" /></tables></p><p><tables num="1425"><img file="JP6577611B2_D1432.tif" /></tables></p><p><tables num="1426"><img file="JP6577611B2_D1433.tif" /></tables></p><p><tables num="1427"><img file="JP6577611B2_D1434.tif" /></tables></p><p><tables num="1428"><img file="JP6577611B2_D1435.tif" /></tables></p><p><tables num="1429"><img file="JP6577611B2_D1436.tif" /></tables></p><p><tables num="1430"><img file="JP6577611B2_D1437.tif" /></tables></p><p><tables num="1431"><img file="JP6577611B2_D1438.tif" /></tables></p><p><tables num="1432"><img file="JP6577611B2_D1439.tif" /></tables></p><p><tables num="1433"><img file="JP6577611B2_D1440.tif" /></tables></p><p><tables num="1434"><img file="JP6577611B2_D1441.tif" /></tables></p><p><tables num="1435"><img file="JP6577611B2_D1442.tif" /></tables></p><p><tables num="1436"><img file="JP6577611B2_D1443.tif" /></tables></p><p><tables num="1437"><img file="JP6577611B2_D1444.tif" /></tables></p><p><tables num="1438"><img file="JP6577611B2_D1445.tif" /></tables></p><p><tables num="1439"><img file="JP6577611B2_D1446.tif" /></tables></p><p><tables num="1440"><img file="JP6577611B2_D1447.tif" /></tables></p><p><tables num="1441"><img file="JP6577611B2_D1448.tif" /></tables></p><p><tables num="1442"><img file="JP6577611B2_D1449.tif" /></tables></p><p><tables num="1443"><img file="JP6577611B2_D1450.tif" /></tables></p><p><tables num="1444"><img file="JP6577611B2_D1451.tif" /></tables></p><p><tables num="1445"><img file="JP6577611B2_D1452.tif" /></tables></p><p><tables num="1446"><img file="JP6577611B2_D1453.tif" /></tables></p><p><tables num="1447"><img file="JP6577611B2_D1454.tif" /></tables></p><p><tables num="1448"><img file="JP6577611B2_D1455.tif" /></tables></p><p><tables num="1449"><img file="JP6577611B2_D1456.tif" /></tables></p><p><tables num="1450"><img file="JP6577611B2_D1457.tif" /></tables></p><p><tables num="1451"><img file="JP6577611B2_D1458.tif" /></tables></p><p><tables num="1452"><img file="JP6577611B2_D1459.tif" /></tables></p><p><tables num="1453"><img file="JP6577611B2_D1460.tif" /></tables></p><p><tables num="1454"><img file="JP6577611B2_D1461.tif" /></tables></p><p><tables num="1455"><img file="JP6577611B2_D1462.tif" /></tables></p><p><tables num="1456"><img file="JP6577611B2_D1463.tif" /></tables></p><p><tables num="1457"><img file="JP6577611B2_D1464.tif" /></tables></p><p><tables num="1458"><img file="JP6577611B2_D1465.tif" /></tables></p><p><tables num="1459"><img file="JP6577611B2_D1466.tif" /></tables></p><p><tables num="1460"><img file="JP6577611B2_D1467.tif" /></tables></p><p><tables num="1461"><img file="JP6577611B2_D1468.tif" /></tables></p><p><tables num="1462"><img file="JP6577611B2_D1469.tif" /></tables></p><p><tables num="1463"><img file="JP6577611B2_D1470.tif" /></tables></p><p><tables num="1464"><img file="JP6577611B2_D1471.tif" /></tables></p><p><tables num="1465"><img file="JP6577611B2_D1472.tif" /></tables></p><p><tables num="1466"><img file="JP6577611B2_D1473.tif" /></tables></p><p><tables num="1467"><img file="JP6577611B2_D1474.tif" /></tables></p><p><tables num="1468"><img file="JP6577611B2_D1475.tif" /></tables></p><p><tables num="1469"><img file="JP6577611B2_D1476.tif" /></tables></p><p><tables num="1470"><img file="JP6577611B2_D1477.tif" /></tables></p><p><tables num="1471"><img file="JP6577611B2_D1478.tif" /></tables></p><p><tables num="1472"><img file="JP6577611B2_D1479.tif" /></tables></p><p><tables num="1473"><img file="JP6577611B2_D1480.tif" /></tables></p><p><tables num="1474"><img file="JP6577611B2_D1481.tif" /></tables></p><p><tables num="1475"><img file="JP6577611B2_D1482.tif" /></tables></p><p><tables num="1476"><img file="JP6577611B2_D1483.tif" /></tables></p><p><tables num="1477"><img file="JP6577611B2_D1484.tif" /></tables></p><p><tables num="1478"><img file="JP6577611B2_D1485.tif" /></tables></p><p><tables num="1479"><img file="JP6577611B2_D1486.tif" /></tables></p><p><tables num="1480"><img file="JP6577611B2_D1487.tif" /></tables></p><p><tables num="1481"><img file="JP6577611B2_D1488.tif" /></tables></p><p><tables num="1482"><img file="JP6577611B2_D1489.tif" /></tables></p><p><tables num="1483"><img file="JP6577611B2_D1490.tif" /></tables></p><p><tables num="1484"><img file="JP6577611B2_D1491.tif" /></tables></p><p><tables num="1485"><img file="JP6577611B2_D1492.tif" /></tables></p><p><tables num="1486"><img file="JP6577611B2_D1493.tif" /></tables></p><p><tables num="1487"><img file="JP6577611B2_D1494.tif" /></tables></p><p><tables num="1488"><img file="JP6577611B2_D1495.tif" /></tables></p><p><tables num="1489"><img file="JP6577611B2_D1496.tif" /></tables></p><p><tables num="1490"><img file="JP6577611B2_D1497.tif" /></tables></p><p><tables num="1491"><img file="JP6577611B2_D1498.tif" /></tables></p><p><tables num="1492"><img file="JP6577611B2_D1499.tif" /></tables></p><p><tables num="1493"><img file="JP6577611B2_D1500.tif" /></tables></p><p><tables num="1494"><img file="JP6577611B2_D1501.tif" /></tables></p><p><tables num="1495"><img file="JP6577611B2_D1502.tif" /></tables></p><p><tables num="1496"><img file="JP6577611B2_D1503.tif" /></tables></p><p><tables num="1497"><img file="JP6577611B2_D1504.tif" /></tables></p><p><tables num="1498"><img file="JP6577611B2_D1505.tif" /></tables></p><p><tables num="1499"><img file="JP6577611B2_D1506.tif" /></tables></p><p><tables num="1500"><img file="JP6577611B2_D1507.tif" /></tables></p><p><tables num="1501"><img file="JP6577611B2_D1508.tif" /></tables></p><p><tables num="1502"><img file="JP6577611B2_D1509.tif" /></tables></p><p><tables num="1503"><img file="JP6577611B2_D1510.tif" /></tables></p><p><tables num="1504"><img file="JP6577611B2_D1511.tif" /></tables></p><p><tables num="1505"><img file="JP6577611B2_D1512.tif" /></tables></p><p><tables num="1506"><img file="JP6577611B2_D1513.tif" /></tables></p><p><tables num="1507"><img file="JP6577611B2_D1514.tif" /></tables></p><p><tables num="1508"><img file="JP6577611B2_D1515.tif" /></tables></p><p><tables num="1509"><img file="JP6577611B2_D1516.tif" /></tables></p><p><tables num="1510"><img file="JP6577611B2_D1517.tif" /></tables></p><p><tables num="1511"><img file="JP6577611B2_D1518.tif" /></tables></p><p><tables num="1512"><img file="JP6577611B2_D1519.tif" /></tables></p><p><tables num="1513"><img file="JP6577611B2_D1520.tif" /></tables></p><p><tables num="1514"><img file="JP6577611B2_D1521.tif" /></tables></p><p><tables num="1515"><img file="JP6577611B2_D1522.tif" /></tables></p><p><tables num="1516"><img file="JP6577611B2_D1523.tif" /></tables></p><p><tables num="1517"><img file="JP6577611B2_D1524.tif" /></tables></p><p><tables num="1518"><img file="JP6577611B2_D1525.tif" /></tables></p><p><tables num="1519"><img file="JP6577611B2_D1526.tif" /></tables></p><p><tables num="1520"><img file="JP6577611B2_D1527.tif" /></tables></p><p><tables num="1521"><img file="JP6577611B2_D1528.tif" /></tables></p><p><tables num="1522"><img file="JP6577611B2_D1529.tif" /></tables></p><p><tables num="1523"><img file="JP6577611B2_D1530.tif" /></tables></p><p><tables num="1524"><img file="JP6577611B2_D1531.tif" /></tables></p><p><tables num="1525"><img file="JP6577611B2_D1532.tif" /></tables></p><p><tables num="1526"><img file="JP6577611B2_D1533.tif" /></tables></p><p><tables num="1527"><img file="JP6577611B2_D1534.tif" /></tables></p><p><tables num="1528"><img file="JP6577611B2_D1535.tif" /></tables></p><p><tables num="1529"><img file="JP6577611B2_D1536.tif" /></tables></p><p><tables num="1530"><img file="JP6577611B2_D1537.tif" /></tables></p><p><tables num="1531"><img file="JP6577611B2_D1538.tif" /></tables></p><p><tables num="1532"><img file="JP6577611B2_D1539.tif" /></tables></p><p><tables num="1533"><img file="JP6577611B2_D1540.tif" /></tables></p><p><tables num="1534"><img file="JP6577611B2_D1541.tif" /></tables></p><p><tables num="1535"><img file="JP6577611B2_D1542.tif" /></tables></p><p><tables num="1536"><img file="JP6577611B2_D1543.tif" /></tables></p><p><tables num="1537"><img file="JP6577611B2_D1544.tif" /></tables></p><p><tables num="1538"><img file="JP6577611B2_D1545.tif" /></tables></p><p><tables num="1539"><img file="JP6577611B2_D1546.tif" /></tables></p><p><tables num="1540"><img file="JP6577611B2_D1547.tif" /></tables></p><p><tables num="1541"><img file="JP6577611B2_D1548.tif" /></tables></p><p><tables num="1542"><img file="JP6577611B2_D1549.tif" /></tables></p><p><tables num="1543"><img file="JP6577611B2_D1550.tif" /></tables></p><p><tables num="1544"><img file="JP6577611B2_D1551.tif" /></tables></p><p><tables num="1545"><img file="JP6577611B2_D1552.tif" /></tables></p><p><tables num="1546"><img file="JP6577611B2_D1553.tif" /></tables></p><p><tables num="1547"><img file="JP6577611B2_D1554.tif" /></tables></p><p><tables num="1548"><img file="JP6577611B2_D1555.tif" /></tables></p><p><tables num="1549"><img file="JP6577611B2_D1556.tif" /></tables></p><p><tables num="1550"><img file="JP6577611B2_D1557.tif" /></tables></p><p><tables num="1551"><img file="JP6577611B2_D1558.tif" /></tables></p><p><tables num="1552"><img file="JP6577611B2_D1559.tif" /></tables></p><p><tables num="1553"><img file="JP6577611B2_D1560.tif" /></tables></p><p><tables num="1554"><img file="JP6577611B2_D1561.tif" /></tables></p><p><tables num="1555"><img file="JP6577611B2_D1562.tif" /></tables></p><p><tables num="1556"><img file="JP6577611B2_D1563.tif" /></tables></p><p><tables num="1557"><img file="JP6577611B2_D1564.tif" /></tables></p><p><tables num="1558"><img file="JP6577611B2_D1565.tif" /></tables></p><p><tables num="1559"><img file="JP6577611B2_D1566.tif" /></tables></p><p><tables num="1560"><img file="JP6577611B2_D1567.tif" /></tables></p><p><tables num="1561"><img file="JP6577611B2_D1568.tif" /></tables></p><p><tables num="1562"><img file="JP6577611B2_D1569.tif" /></tables></p><p><tables num="1563"><img file="JP6577611B2_D1570.tif" /></tables></p><p><tables num="1564"><img file="JP6577611B2_D1571.tif" /></tables></p><p><tables num="1565"><img file="JP6577611B2_D1572.tif" /></tables></p><p><tables num="1566"><img file="JP6577611B2_D1573.tif" /></tables></p><p><tables num="1567"><img file="JP6577611B2_D1574.tif" /></tables></p><p><tables num="1568"><img file="JP6577611B2_D1575.tif" /></tables></p><p><tables num="1569"><img file="JP6577611B2_D1576.tif" /></tables></p><p><tables num="1570"><img file="JP6577611B2_D1577.tif" /></tables></p><p><tables num="1571"><img file="JP6577611B2_D1578.tif" /></tables></p><p><tables num="1572"><img file="JP6577611B2_D1579.tif" /></tables></p><p><tables num="1573"><img file="JP6577611B2_D1580.tif" /></tables></p><p><tables num="1574"><img file="JP6577611B2_D1581.tif" /></tables></p><p><tables num="1575"><img file="JP6577611B2_D1582.tif" /></tables></p><p><tables num="1576"><img file="JP6577611B2_D1583.tif" /></tables></p><p><tables num="1577"><img file="JP6577611B2_D1584.tif" /></tables></p><p><tables num="1578"><img file="JP6577611B2_D1585.tif" /></tables></p><p><tables num="1579"><img file="JP6577611B2_D1586.tif" /></tables></p><p><tables num="1580"><img file="JP6577611B2_D1587.tif" /></tables></p><p><tables num="1581"><img file="JP6577611B2_D1588.tif" /></tables></p><p><tables num="1582"><img file="JP6577611B2_D1589.tif" /></tables></p><p><tables num="1583"><img file="JP6577611B2_D1590.tif" /></tables></p><p><tables num="1584"><img file="JP6577611B2_D1591.tif" /></tables></p><p><tables num="1585"><img file="JP6577611B2_D1592.tif" /></tables></p><p><tables num="1586"><img file="JP6577611B2_D1593.tif" /></tables></p><p><tables num="1587"><img file="JP6577611B2_D1594.tif" /></tables></p><p><tables num="1588"><img file="JP6577611B2_D1595.tif" /></tables></p><p><tables num="1589"><img file="JP6577611B2_D1596.tif" /></tables></p><p><tables num="1590"><img file="JP6577611B2_D1597.tif" /></tables></p><p><tables num="1591"><img file="JP6577611B2_D1598.tif" /></tables></p><p><tables num="1592"><img file="JP6577611B2_D1599.tif" /></tables></p><p><tables num="1593"><img file="JP6577611B2_D1600.tif" /></tables></p><p><tables num="1594"><img file="JP6577611B2_D1601.tif" /></tables></p><p><tables num="1595"><img file="JP6577611B2_D1602.tif" /></tables></p><p><tables num="1596"><img file="JP6577611B2_D1603.tif" /></tables></p><p><tables num="1597"><img file="JP6577611B2_D1604.tif" /></tables></p><p><tables num="1598"><img file="JP6577611B2_D1605.tif" /></tables></p><p><tables num="1599"><img file="JP6577611B2_D1606.tif" /></tables></p><p><tables num="1600"><img file="JP6577611B2_D1607.tif" /></tables></p><p><tables num="1601"><img file="JP6577611B2_D1608.tif" /></tables></p><p><tables num="1602"><img file="JP6577611B2_D1609.tif" /></tables></p><p><tables num="1603"><img file="JP6577611B2_D1610.tif" /></tables></p><p><tables num="1604"><img file="JP6577611B2_D1611.tif" /></tables></p><p><tables num="1605"><img file="JP6577611B2_D1612.tif" /></tables></p><p><tables num="1606"><img file="JP6577611B2_D1613.tif" /></tables></p><p><tables num="1607"><img file="JP6577611B2_D1614.tif" /></tables></p><p><tables num="1608"><img file="JP6577611B2_D1615.tif" /></tables></p><p><tables num="1609"><img file="JP6577611B2_D1616.tif" /></tables></p><p><tables num="1610"><img file="JP6577611B2_D1617.tif" /></tables></p><p><tables num="1611"><img file="JP6577611B2_D1618.tif" /></tables></p><p><tables num="1612"><img file="JP6577611B2_D1619.tif" /></tables></p><p><tables num="1613"><img file="JP6577611B2_D1620.tif" /></tables></p><p><tables num="1614"><img file="JP6577611B2_D1621.tif" /></tables></p><p><tables num="1615"><img file="JP6577611B2_D1622.tif" /></tables></p><p><tables num="1616"><img file="JP6577611B2_D1623.tif" /></tables></p><p><tables num="1617"><img file="JP6577611B2_D1624.tif" /></tables></p><p><tables num="1618"><img file="JP6577611B2_D1625.tif" /></tables></p><p><tables num="1619"><img file="JP6577611B2_D1626.tif" /></tables></p><p><tables num="1620"><img file="JP6577611B2_D1627.tif" /></tables></p><p><tables num="1621"><img file="JP6577611B2_D1628.tif" /></tables></p><p><tables num="1622"><img file="JP6577611B2_D1629.tif" /></tables></p><p><tables num="1623"><img file="JP6577611B2_D1630.tif" /></tables></p><p><tables num="1624"><img file="JP6577611B2_D1631.tif" /></tables></p><p><tables num="1625"><img file="JP6577611B2_D1632.tif" /></tables></p><p><tables num="1626"><img file="JP6577611B2_D1633.tif" /></tables></p><p><tables num="1627"><img file="JP6577611B2_D1634.tif" /></tables></p><p><tables num="1628"><img file="JP6577611B2_D1635.tif" /></tables></p><p><tables num="1629"><img file="JP6577611B2_D1636.tif" /></tables></p><p><tables num="1630"><img file="JP6577611B2_D1637.tif" /></tables></p><p><tables num="1631"><img file="JP6577611B2_D1638.tif" /></tables></p><p><tables num="1632"><img file="JP6577611B2_D1639.tif" /></tables></p><p><tables num="1633"><img file="JP6577611B2_D1640.tif" /></tables></p><p><tables num="1634"><img file="JP6577611B2_D1641.tif" /></tables></p><p><tables num="1635"><img file="JP6577611B2_D1642.tif" /></tables></p><p><tables num="1636"><img file="JP6577611B2_D1643.tif" /></tables></p><p><tables num="1637"><img file="JP6577611B2_D1644.tif" /></tables></p><p><tables num="1638"><img file="JP6577611B2_D1645.tif" /></tables></p><p><tables num="1639"><img file="JP6577611B2_D1646.tif" /></tables></p><p><tables num="1640"><img file="JP6577611B2_D1647.tif" /></tables></p><p><tables num="1641"><img file="JP6577611B2_D1648.tif" /></tables></p><p><tables num="1642"><img file="JP6577611B2_D1649.tif" /></tables></p><p><tables num="1643"><img file="JP6577611B2_D1650.tif" /></tables></p><p><tables num="1644"><img file="JP6577611B2_D1651.tif" /></tables></p><p><tables num="1645"><img file="JP6577611B2_D1652.tif" /></tables></p><p><tables num="1646"><img file="JP6577611B2_D1653.tif" /></tables></p><p><tables num="1647"><img file="JP6577611B2_D1654.tif" /></tables></p><p><tables num="1648"><img file="JP6577611B2_D1655.tif" /></tables></p><p><tables num="1649"><img file="JP6577611B2_D1656.tif" /></tables></p><p><tables num="1650"><img file="JP6577611B2_D1657.tif" /></tables></p><p><tables num="1651"><img file="JP6577611B2_D1658.tif" /></tables></p><p><tables num="1652"><img file="JP6577611B2_D1659.tif" /></tables></p><p><tables num="1653"><img file="JP6577611B2_D1660.tif" /></tables></p><p><tables num="1654"><img file="JP6577611B2_D1661.tif" /></tables></p><p><tables num="1655"><img file="JP6577611B2_D1662.tif" /></tables></p><p><tables num="1656"><img file="JP6577611B2_D1663.tif" /></tables></p><p><tables num="1657"><img file="JP6577611B2_D1664.tif" /></tables></p><p><tables num="1658"><img file="JP6577611B2_D1665.tif" /></tables></p><p><tables num="1659"><img file="JP6577611B2_D1666.tif" /></tables></p><p><tables num="1660"><img file="JP6577611B2_D1667.tif" /></tables></p><p><tables num="1661"><img file="JP6577611B2_D1668.tif" /></tables></p><p><tables num="1662"><img file="JP6577611B2_D1669.tif" /></tables></p><p><tables num="1663"><img file="JP6577611B2_D1670.tif" /></tables></p><p><tables num="1664"><img file="JP6577611B2_D1671.tif" /></tables></p><p><tables num="1665"><img file="JP6577611B2_D1672.tif" /></tables></p><p><tables num="1666"><img file="JP6577611B2_D1673.tif" /></tables></p><p><tables num="1667"><img file="JP6577611B2_D1674.tif" /></tables></p><p><tables num="1668"><img file="JP6577611B2_D1675.tif" /></tables></p><p><tables num="1669"><img file="JP6577611B2_D1676.tif" /></tables></p><p><tables num="1670"><img file="JP6577611B2_D1677.tif" /></tables></p><p><tables num="1671"><img file="JP6577611B2_D1678.tif" /></tables></p><p><tables num="1672"><img file="JP6577611B2_D1679.tif" /></tables></p><p><tables num="1673"><img file="JP6577611B2_D1680.tif" /></tables></p><p><tables num="1674"><img file="JP6577611B2_D1681.tif" /></tables></p><p><tables num="1675"><img file="JP6577611B2_D1682.tif" /></tables></p><p><tables num="1676"><img file="JP6577611B2_D1683.tif" /></tables></p><p><tables num="1677"><img file="JP6577611B2_D1684.tif" /></tables></p><p><tables num="1678"><img file="JP6577611B2_D1685.tif" /></tables></p><p><tables num="1679"><img file="JP6577611B2_D1686.tif" /></tables></p><p><tables num="1680"><img file="JP6577611B2_D1687.tif" /></tables></p><p><tables num="1681"><img file="JP6577611B2_D1688.tif" /></tables></p><p><tables num="1682"><img file="JP6577611B2_D1689.tif" /></tables></p><p><tables num="1683"><img file="JP6577611B2_D1690.tif" /></tables></p><p><tables num="1684"><img file="JP6577611B2_D1691.tif" /></tables></p><p><tables num="1685"><img file="JP6577611B2_D1692.tif" /></tables></p><p><tables num="1686"><img file="JP6577611B2_D1693.tif" /></tables></p><p><tables num="1687"><img file="JP6577611B2_D1694.tif" /></tables></p><p><tables num="1688"><img file="JP6577611B2_D1695.tif" /></tables></p><p><tables num="1689"><img file="JP6577611B2_D1696.tif" /></tables></p><p><tables num="1690"><img file="JP6577611B2_D1697.tif" /></tables></p><p><tables num="1691"><img file="JP6577611B2_D1698.tif" /></tables></p><p><tables num="1692"><img file="JP6577611B2_D1699.tif" /></tables></p><p><tables num="1693"><img file="JP6577611B2_D1700.tif" /></tables></p><p><tables num="1694"><img file="JP6577611B2_D1701.tif" /></tables></p><p><tables num="1695"><img file="JP6577611B2_D1702.tif" /></tables></p><p><tables num="1696"><img file="JP6577611B2_D1703.tif" /></tables></p><p><tables num="1697"><img file="JP6577611B2_D1704.tif" /></tables></p><p><tables num="1698"><img file="JP6577611B2_D1705.tif" /></tables></p><p><tables num="1699"><img file="JP6577611B2_D1706.tif" /></tables></p><p><tables num="1700"><img file="JP6577611B2_D1707.tif" /></tables></p><p><tables num="1701"><img file="JP6577611B2_D1708.tif" /></tables></p><p><tables num="1702"><img file="JP6577611B2_D1709.tif" /></tables></p><p><tables num="1703"><img file="JP6577611B2_D1710.tif" /></tables></p><p><tables num="1704"><img file="JP6577611B2_D1711.tif" /></tables></p><p><tables num="1705"><img file="JP6577611B2_D1712.tif" /></tables></p><p><tables num="1706"><img file="JP6577611B2_D1713.tif" /></tables></p><p><tables num="1707"><img file="JP6577611B2_D1714.tif" /></tables></p><p><tables num="1708"><img file="JP6577611B2_D1715.tif" /></tables></p><p><tables num="1709"><img file="JP6577611B2_D1716.tif" /></tables></p><p><tables num="1710"><img file="JP6577611B2_D1717.tif" /></tables></p><p><tables num="1711"><img file="JP6577611B2_D1718.tif" /></tables></p><p><tables num="1712"><img file="JP6577611B2_D1719.tif" /></tables></p><p><tables num="1713"><img file="JP6577611B2_D1720.tif" /></tables></p><p><tables num="1714"><img file="JP6577611B2_D1721.tif" /></tables></p><p><tables num="1715"><img file="JP6577611B2_D1722.tif" /></tables></p><p><tables num="1716"><img file="JP6577611B2_D1723.tif" /></tables></p><p><tables num="1717"><img file="JP6577611B2_D1724.tif" /></tables></p><p><tables num="1718"><img file="JP6577611B2_D1725.tif" /></tables></p><p><tables num="1719"><img file="JP6577611B2_D1726.tif" /></tables></p><p><tables num="1720"><img file="JP6577611B2_D1727.tif" /></tables></p><p><tables num="1721"><img file="JP6577611B2_D1728.tif" /></tables></p><p><tables num="1722"><img file="JP6577611B2_D1729.tif" /></tables></p><p><tables num="1723"><img file="JP6577611B2_D1730.tif" /></tables></p><p><tables num="1724"><img file="JP6577611B2_D1731.tif" /></tables></p><p><tables num="1725"><img file="JP6577611B2_D1732.tif" /></tables></p><p><tables num="1726"><img file="JP6577611B2_D1733.tif" /></tables></p><p><tables num="1727"><img file="JP6577611B2_D1734.tif" /></tables></p><p><tables num="1728"><img file="JP6577611B2_D1735.tif" /></tables></p><p><tables num="1729"><img file="JP6577611B2_D1736.tif" /></tables></p><p><tables num="1730"><img file="JP6577611B2_D1737.tif" /></tables></p><p><tables num="1731"><img file="JP6577611B2_D1738.tif" /></tables></p><p><tables num="1732"><img file="JP6577611B2_D1739.tif" /></tables></p><p><tables num="1733"><img file="JP6577611B2_D1740.tif" /></tables></p><p><tables num="1734"><img file="JP6577611B2_D1741.tif" /></tables></p><p><tables num="1735"><img file="JP6577611B2_D1742.tif" /></tables></p><p><tables num="1736"><img file="JP6577611B2_D1743.tif" /></tables></p><p><tables num="1737"><img file="JP6577611B2_D1744.tif" /></tables></p><p><tables num="1738"><img file="JP6577611B2_D1745.tif" /></tables></p><p><tables num="1739"><img file="JP6577611B2_D1746.tif" /></tables></p><p><tables num="1740"><img file="JP6577611B2_D1747.tif" /></tables></p><p><tables num="1741"><img file="JP6577611B2_D1748.tif" /></tables></p><p><tables num="1742"><img file="JP6577611B2_D1749.tif" /></tables></p><p><tables num="1743"><img file="JP6577611B2_D1750.tif" /></tables></p><p><tables num="1744"><img file="JP6577611B2_D1751.tif" /></tables></p><p><tables num="1745"><img file="JP6577611B2_D1752.tif" /></tables></p><p><tables num="1746"><img file="JP6577611B2_D1753.tif" /></tables></p><p><tables num="1747"><img file="JP6577611B2_D1754.tif" /></tables></p><p><tables num="1748"><img file="JP6577611B2_D1755.tif" /></tables></p><p><tables num="1749"><img file="JP6577611B2_D1756.tif" /></tables></p><p><tables num="1750"><img file="JP6577611B2_D1757.tif" /></tables></p><p><tables num="1751"><img file="JP6577611B2_D1758.tif" /></tables></p><p><tables num="1752"><img file="JP6577611B2_D1759.tif" /></tables></p><p><tables num="1753"><img file="JP6577611B2_D1760.tif" /></tables></p><p><tables num="1754"><img file="JP6577611B2_D1761.tif" /></tables></p><p><tables num="1755"><img file="JP6577611B2_D1762.tif" /></tables></p><p><tables num="1756"><img file="JP6577611B2_D1763.tif" /></tables></p><p><tables num="1757"><img file="JP6577611B2_D1764.tif" /></tables></p><p><tables num="1758"><img file="JP6577611B2_D1765.tif" /></tables></p><p><tables num="1759"><img file="JP6577611B2_D1766.tif" /></tables></p><p><tables num="1760"><img file="JP6577611B2_D1767.tif" /></tables></p><p><tables num="1761"><img file="JP6577611B2_D1768.tif" /></tables></p><p><tables num="1762"><img file="JP6577611B2_D1769.tif" /></tables></p><p><tables num="1763"><img file="JP6577611B2_D1770.tif" /></tables></p><p><tables num="1764"><img file="JP6577611B2_D1771.tif" /></tables></p><p><tables num="1765"><img file="JP6577611B2_D1772.tif" /></tables></p><p><tables num="1766"><img file="JP6577611B2_D1773.tif" /></tables></p><p><tables num="1767"><img file="JP6577611B2_D1774.tif" /></tables></p><p><tables num="1768"><img file="JP6577611B2_D1775.tif" /></tables></p><p><tables num="1769"><img file="JP6577611B2_D1776.tif" /></tables></p><p><tables num="1770"><img file="JP6577611B2_D1777.tif" /></tables></p><p><tables num="1771"><img file="JP6577611B2_D1778.tif" /></tables></p><p><tables num="1772"><img file="JP6577611B2_D1779.tif" /></tables></p><p><tables num="1773"><img file="JP6577611B2_D1780.tif" /></tables></p><p><tables num="1774"><img file="JP6577611B2_D1781.tif" /></tables></p><p><tables num="1775"><img file="JP6577611B2_D1782.tif" /></tables></p><p><tables num="1776"><img file="JP6577611B2_D1783.tif" /></tables></p><p><tables num="1777"><img file="JP6577611B2_D1784.tif" /></tables></p><p><tables num="1778"><img file="JP6577611B2_D1785.tif" /></tables></p><p><tables num="1779"><img file="JP6577611B2_D1786.tif" /></tables></p><p><tables num="1780"><img file="JP6577611B2_D1787.tif" /></tables></p><p><tables num="1781"><img file="JP6577611B2_D1788.tif" /></tables></p><p><tables num="1782"><img file="JP6577611B2_D1789.tif" /></tables></p><p><tables num="1783"><img file="JP6577611B2_D1790.tif" /></tables></p><p><tables num="1784"><img file="JP6577611B2_D1791.tif" /></tables></p><p><tables num="1785"><img file="JP6577611B2_D1792.tif" /></tables></p><p><tables num="1786"><img file="JP6577611B2_D1793.tif" /></tables></p><p><tables num="1787"><img file="JP6577611B2_D1794.tif" /></tables></p><p><tables num="1788"><img file="JP6577611B2_D1795.tif" /></tables></p><p><tables num="1789"><img file="JP6577611B2_D1796.tif" /></tables></p><p><tables num="1790"><img file="JP6577611B2_D1797.tif" /></tables></p><p><tables num="1791"><img file="JP6577611B2_D1798.tif" /></tables></p><p><tables num="1792"><img file="JP6577611B2_D1799.tif" /></tables></p><p><tables num="1793"><img file="JP6577611B2_D1800.tif" /></tables></p><p><tables num="1794"><img file="JP6577611B2_D1801.tif" /></tables></p><p><tables num="1795"><img file="JP6577611B2_D1802.tif" /></tables></p><p><tables num="1796"><img file="JP6577611B2_D1803.tif" /></tables></p><p><tables num="1797"><img file="JP6577611B2_D1804.tif" /></tables></p><p><tables num="1798"><img file="JP6577611B2_D1805.tif" /></tables></p><p><tables num="1799"><img file="JP6577611B2_D1806.tif" /></tables></p><p><tables num="1800"><img file="JP6577611B2_D1807.tif" /></tables></p><p><tables num="1801"><img file="JP6577611B2_D1808.tif" /></tables></p><p><tables num="1802"><img file="JP6577611B2_D1809.tif" /></tables></p><p><tables num="1803"><img file="JP6577611B2_D1810.tif" /></tables></p><p><tables num="1804"><img file="JP6577611B2_D1811.tif" /></tables></p><p><tables num="1805"><img file="JP6577611B2_D1812.tif" /></tables></p><p><tables num="1806"><img file="JP6577611B2_D1813.tif" /></tables></p><p><tables num="1807"><img file="JP6577611B2_D1814.tif" /></tables></p><p><tables num="1808"><img file="JP6577611B2_D1815.tif" /></tables></p><p><tables num="1809"><img file="JP6577611B2_D1816.tif" /></tables></p><p><tables num="1810"><img file="JP6577611B2_D1817.tif" /></tables></p><p><tables num="1811"><img file="JP6577611B2_D1818.tif" /></tables></p><p><tables num="1812"><img file="JP6577611B2_D1819.tif" /></tables></p><p><tables num="1813"><img file="JP6577611B2_D1820.tif" /></tables></p><p><tables num="1814"><img file="JP6577611B2_D1821.tif" /></tables></p><p><tables num="1815"><img file="JP6577611B2_D1822.tif" /></tables></p><p><tables num="1816"><img file="JP6577611B2_D1823.tif" /></tables></p><p><tables num="1817"><img file="JP6577611B2_D1824.tif" /></tables></p><p><tables num="1818"><img file="JP6577611B2_D1825.tif" /></tables></p><p><tables num="1819"><img file="JP6577611B2_D1826.tif" /></tables></p><p><tables num="1820"><img file="JP6577611B2_D1827.tif" /></tables></p><p><tables num="1821"><img file="JP6577611B2_D1828.tif" /></tables></p><p><tables num="1822"><img file="JP6577611B2_D1829.tif" /></tables></p><p><tables num="1823"><img file="JP6577611B2_D1830.tif" /></tables></p><p><tables num="1824"><img file="JP6577611B2_D1831.tif" /></tables></p><p><tables num="1825"><img file="JP6577611B2_D1832.tif" /></tables></p><p><tables num="1826"><img file="JP6577611B2_D1833.tif" /></tables></p><p><tables num="1827"><img file="JP6577611B2_D1834.tif" /></tables></p><p><tables num="1828"><img file="JP6577611B2_D1835.tif" /></tables></p><p><tables num="1829"><img file="JP6577611B2_D1836.tif" /></tables></p><p><tables num="1830"><img file="JP6577611B2_D1837.tif" /></tables></p><p><tables num="1831"><img file="JP6577611B2_D1838.tif" /></tables></p><p><tables num="1832"><img file="JP6577611B2_D1839.tif" /></tables></p><p><tables num="1833"><img file="JP6577611B2_D1840.tif" /></tables></p><p><tables num="1834"><img file="JP6577611B2_D1841.tif" /></tables></p><p><tables num="1835"><img file="JP6577611B2_D1842.tif" /></tables></p><p><tables num="1836"><img file="JP6577611B2_D1843.tif" /></tables></p><p><tables num="1837"><img file="JP6577611B2_D1844.tif" /></tables></p><p><tables num="1838"><img file="JP6577611B2_D1845.tif" /></tables></p><p><tables num="1839"><img file="JP6577611B2_D1846.tif" /></tables></p><p><tables num="1840"><img file="JP6577611B2_D1847.tif" /></tables></p><p><tables num="1841"><img file="JP6577611B2_D1848.tif" /></tables></p><p><tables num="1842"><img file="JP6577611B2_D1849.tif" /></tables></p><p><tables num="1843"><img file="JP6577611B2_D1850.tif" /></tables></p><p><tables num="1844"><img file="JP6577611B2_D1851.tif" /></tables></p><p><tables num="1845"><img file="JP6577611B2_D1852.tif" /></tables></p><p><tables num="1846"><img file="JP6577611B2_D1853.tif" /></tables></p><p><tables num="1847"><img file="JP6577611B2_D1854.tif" /></tables></p><p><tables num="1848"><img file="JP6577611B2_D1855.tif" /></tables></p><p><tables num="1849"><img file="JP6577611B2_D1856.tif" /></tables></p><p><tables num="1850"><img file="JP6577611B2_D1857.tif" /></tables></p><p><tables num="1851"><img file="JP6577611B2_D1858.tif" /></tables></p><p><tables num="1852"><img file="JP6577611B2_D1859.tif" /></tables></p><p><tables num="1853"><img file="JP6577611B2_D1860.tif" /></tables></p><p><tables num="1854"><img file="JP6577611B2_D1861.tif" /></tables></p><p><tables num="1855"><img file="JP6577611B2_D1862.tif" /></tables></p><p><tables num="1856"><img file="JP6577611B2_D1863.tif" /></tables></p><p><tables num="1857"><img file="JP6577611B2_D1864.tif" /></tables></p><p><tables num="1858"><img file="JP6577611B2_D1865.tif" /></tables></p><p><tables num="1859"><img file="JP6577611B2_D1866.tif" /></tables></p><p><tables num="1860"><img file="JP6577611B2_D1867.tif" /></tables></p><p><tables num="1861"><img file="JP6577611B2_D1868.tif" /></tables></p><p><tables num="1862"><img file="JP6577611B2_D1869.tif" /></tables></p><p><tables num="1863"><img file="JP6577611B2_D1870.tif" /></tables></p><p><tables num="1864"><img file="JP6577611B2_D1871.tif" /></tables></p><p><tables num="1865"><img file="JP6577611B2_D1872.tif" /></tables></p><p><tables num="1866"><img file="JP6577611B2_D1873.tif" /></tables></p><p><tables num="1867"><img file="JP6577611B2_D1874.tif" /></tables></p><p><tables num="1868"><img file="JP6577611B2_D1875.tif" /></tables></p><p><tables num="1869"><img file="JP6577611B2_D1876.tif" /></tables></p><p><tables num="1870"><img file="JP6577611B2_D1877.tif" /></tables></p><p><tables num="1871"><img file="JP6577611B2_D1878.tif" /></tables></p><p><tables num="1872"><img file="JP6577611B2_D1879.tif" /></tables></p><p><tables num="1873"><img file="JP6577611B2_D1880.tif" /></tables></p><p><tables num="1874"><img file="JP6577611B2_D1881.tif" /></tables></p><p><tables num="1875"><img file="JP6577611B2_D1882.tif" /></tables></p><p><tables num="1876"><img file="JP6577611B2_D1883.tif" /></tables></p><p><tables num="1877"><img file="JP6577611B2_D1884.tif" /></tables></p><p><tables num="1878"><img file="JP6577611B2_D1885.tif" /></tables></p><p><tables num="1879"><img file="JP6577611B2_D1886.tif" /></tables></p><p><tables num="1880"><img file="JP6577611B2_D1887.tif" /></tables></p><p><tables num="1881"><img file="JP6577611B2_D1888.tif" /></tables></p><p><tables num="1882"><img file="JP6577611B2_D1889.tif" /></tables></p><p><tables num="1883"><img file="JP6577611B2_D1890.tif" /></tables></p><p><tables num="1884"><img file="JP6577611B2_D1891.tif" /></tables></p><p><tables num="1885"><img file="JP6577611B2_D1892.tif" /></tables></p><p><tables num="1886"><img file="JP6577611B2_D1893.tif" /></tables></p><p><tables num="1887"><img file="JP6577611B2_D1894.tif" /></tables></p><p><tables num="1888"><img file="JP6577611B2_D1895.tif" /></tables></p><p><tables num="1889"><img file="JP6577611B2_D1896.tif" /></tables></p><p><tables num="1890"><img file="JP6577611B2_D1897.tif" /></tables></p><p><tables num="1891"><img file="JP6577611B2_D1898.tif" /></tables></p><p><tables num="1892"><img file="JP6577611B2_D1899.tif" /></tables></p><p><tables num="1893"><img file="JP6577611B2_D1900.tif" /></tables></p><p><tables num="1894"><img file="JP6577611B2_D1901.tif" /></tables></p><p><tables num="1895"><img file="JP6577611B2_D1902.tif" /></tables></p><p><tables num="1896"><img file="JP6577611B2_D1903.tif" /></tables></p><p><tables num="1897"><img file="JP6577611B2_D1904.tif" /></tables></p><p><tables num="1898"><img file="JP6577611B2_D1905.tif" /></tables></p><p><tables num="1899"><img file="JP6577611B2_D1906.tif" /></tables></p><p><tables num="1900"><img file="JP6577611B2_D1907.tif" /></tables></p><p><tables num="1901"><img file="JP6577611B2_D1908.tif" /></tables></p><p><tables num="1902"><img file="JP6577611B2_D1909.tif" /></tables></p><p><tables num="1903"><img file="JP6577611B2_D1910.tif" /></tables></p><p><tables num="1904"><img file="JP6577611B2_D1911.tif" /></tables></p><p><tables num="1905"><img file="JP6577611B2_D1912.tif" /></tables></p><p><tables num="1906"><img file="JP6577611B2_D1913.tif" /></tables></p><p><tables num="1907"><img file="JP6577611B2_D1914.tif" /></tables></p><p><tables num="1908"><img file="JP6577611B2_D1915.tif" /></tables></p><p><tables num="1909"><img file="JP6577611B2_D1916.tif" /></tables></p><p><tables num="1910"><img file="JP6577611B2_D1917.tif" /></tables></p><p><tables num="1911"><img file="JP6577611B2_D1918.tif" /></tables></p><p><tables num="1912"><img file="JP6577611B2_D1919.tif" /></tables></p><p><tables num="1913"><img file="JP6577611B2_D1920.tif" /></tables></p><p><tables num="1914"><img file="JP6577611B2_D1921.tif" /></tables></p><p><tables num="1915"><img file="JP6577611B2_D1922.tif" /></tables></p><p><tables num="1916"><img file="JP6577611B2_D1923.tif" /></tables></p><p><tables num="1917"><img file="JP6577611B2_D1924.tif" /></tables></p><p><tables num="1918"><img file="JP6577611B2_D1925.tif" /></tables></p><p><tables num="1919"><img file="JP6577611B2_D1926.tif" /></tables></p><p><tables num="1920"><img file="JP6577611B2_D1927.tif" /></tables></p><p><tables num="1921"><img file="JP6577611B2_D1928.tif" /></tables></p><p><tables num="1922"><img file="JP6577611B2_D1929.tif" /></tables></p><p><tables num="1923"><img file="JP6577611B2_D1930.tif" /></tables></p><p><tables num="1924"><img file="JP6577611B2_D1931.tif" /></tables></p><p><tables num="1925"><img file="JP6577611B2_D1932.tif" /></tables></p><p><tables num="1926"><img file="JP6577611B2_D1933.tif" /></tables></p><p><tables num="1927"><img file="JP6577611B2_D1934.tif" /></tables></p><p><tables num="1928"><img file="JP6577611B2_D1935.tif" /></tables></p><p><tables num="1929"><img file="JP6577611B2_D1936.tif" /></tables></p><p><tables num="1930"><img file="JP6577611B2_D1937.tif" /></tables></p><p><tables num="1931"><img file="JP6577611B2_D1938.tif" /></tables></p><p><tables num="1932"><img file="JP6577611B2_D1939.tif" /></tables></p><p><tables num="1933"><img file="JP6577611B2_D1940.tif" /></tables></p><p><tables num="1934"><img file="JP6577611B2_D1941.tif" /></tables></p><p><tables num="1935"><img file="JP6577611B2_D1942.tif" /></tables></p><p><tables num="1936"><img file="JP6577611B2_D1943.tif" /></tables></p><p><tables num="1937"><img file="JP6577611B2_D1944.tif" /></tables></p><p><tables num="1938"><img file="JP6577611B2_D1945.tif" /></tables></p><p><tables num="1939"><img file="JP6577611B2_D1946.tif" /></tables></p><p><tables num="1940"><img file="JP6577611B2_D1947.tif" /></tables></p><p><tables num="1941"><img file="JP6577611B2_D1948.tif" /></tables></p><p><tables num="1942"><img file="JP6577611B2_D1949.tif" /></tables></p><p><tables num="1943"><img file="JP6577611B2_D1950.tif" /></tables></p><p><tables num="1944"><img file="JP6577611B2_D1951.tif" /></tables></p><p><tables num="1945"><img file="JP6577611B2_D1952.tif" /></tables></p><p><tables num="1946"><img file="JP6577611B2_D1953.tif" /></tables></p><p><tables num="1947"><img file="JP6577611B2_D1954.tif" /></tables></p><p><tables num="1948"><img file="JP6577611B2_D1955.tif" /></tables></p><p><tables num="1949"><img file="JP6577611B2_D1956.tif" /></tables></p><p><tables num="1950"><img file="JP6577611B2_D1957.tif" /></tables></p><p><tables num="1951"><img file="JP6577611B2_D1958.tif" /></tables></p><p><tables num="1952"><img file="JP6577611B2_D1959.tif" /></tables></p><p><tables num="1953"><img file="JP6577611B2_D1960.tif" /></tables></p><p><tables num="1954"><img file="JP6577611B2_D1961.tif" /></tables></p><p><tables num="1955"><img file="JP6577611B2_D1962.tif" /></tables></p><p><tables num="1956"><img file="JP6577611B2_D1963.tif" /></tables></p><p><tables num="1957"><img file="JP6577611B2_D1964.tif" /></tables></p><p><tables num="1958"><img file="JP6577611B2_D1965.tif" /></tables></p><p><tables num="1959"><img file="JP6577611B2_D1966.tif" /></tables></p><p><tables num="1960"><img file="JP6577611B2_D1967.tif" /></tables></p><p><tables num="1961"><img file="JP6577611B2_D1968.tif" /></tables></p><p><tables num="1962"><img file="JP6577611B2_D1969.tif" /></tables></p><p><tables num="1963"><img file="JP6577611B2_D1970.tif" /></tables></p><p><tables num="1964"><img file="JP6577611B2_D1971.tif" /></tables></p><p><tables num="1965"><img file="JP6577611B2_D1972.tif" /></tables></p><p><tables num="1966"><img file="JP6577611B2_D1973.tif" /></tables></p><p><tables num="1967"><img file="JP6577611B2_D1974.tif" /></tables></p><p><tables num="1968"><img file="JP6577611B2_D1975.tif" /></tables></p><p><tables num="1969"><img file="JP6577611B2_D1976.tif" /></tables></p><p><tables num="1970"><img file="JP6577611B2_D1977.tif" /></tables></p><p><tables num="1971"><img file="JP6577611B2_D1978.tif" /></tables></p><p><tables num="1972"><img file="JP6577611B2_D1979.tif" /></tables></p><p><tables num="1973"><img file="JP6577611B2_D1980.tif" /></tables></p><p><tables num="1974"><img file="JP6577611B2_D1981.tif" /></tables></p><p><tables num="1975"><img file="JP6577611B2_D1982.tif" /></tables></p><p><tables num="1976"><img file="JP6577611B2_D1983.tif" /></tables></p><p><tables num="1977"><img file="JP6577611B2_D1984.tif" /></tables></p><p><tables num="1978"><img file="JP6577611B2_D1985.tif" /></tables></p><p><tables num="1979"><img file="JP6577611B2_D1986.tif" /></tables></p><p><tables num="1980"><img file="JP6577611B2_D1987.tif" /></tables></p><p><tables num="1981"><img file="JP6577611B2_D1988.tif" /></tables></p><p><tables num="1982"><img file="JP6577611B2_D1989.tif" /></tables></p><p><tables num="1983"><img file="JP6577611B2_D1990.tif" /></tables></p><p><tables num="1984"><img file="JP6577611B2_D1991.tif" /></tables></p><p><tables num="1985"><img file="JP6577611B2_D1992.tif" /></tables></p><p><tables num="1986"><img file="JP6577611B2_D1993.tif" /></tables></p><p><tables num="1987"><img file="JP6577611B2_D1994.tif" /></tables></p><p><tables num="1988"><img file="JP6577611B2_D1995.tif" /></tables></p><p><tables num="1989"><img file="JP6577611B2_D1996.tif" /></tables></p><p><tables num="1990"><img file="JP6577611B2_D1997.tif" /></tables></p><p><tables num="1991"><img file="JP6577611B2_D1998.tif" /></tables></p><p><tables num="1992"><img file="JP6577611B2_D1999.tif" /></tables></p><p><tables num="1993"><img file="JP6577611B2_D2000.tif" /></tables></p><p><tables num="1994"><img file="JP6577611B2_D2001.tif" /></tables></p><p><tables num="1995"><img file="JP6577611B2_D2002.tif" /></tables></p><p><tables num="1996"><img file="JP6577611B2_D2003.tif" /></tables></p><p><tables num="1997"><img file="JP6577611B2_D2004.tif" /></tables></p><p><tables num="1998"><img file="JP6577611B2_D2005.tif" /></tables></p><p><tables num="1999"><img file="JP6577611B2_D2006.tif" /></tables></p><p><tables num="2000"><img file="JP6577611B2_D2007.tif" /></tables></p><p><tables num="2001"><img file="JP6577611B2_D2008.tif" /></tables></p><p><tables num="2002"><img file="JP6577611B2_D2009.tif" /></tables></p><p><tables num="2003"><img file="JP6577611B2_D2010.tif" /></tables></p><p><tables num="2004"><img file="JP6577611B2_D2011.tif" /></tables></p><p><tables num="2005"><img file="JP6577611B2_D2012.tif" /></tables></p><p><tables num="2006"><img file="JP6577611B2_D2013.tif" /></tables></p><p><tables num="2007"><img file="JP6577611B2_D2014.tif" /></tables></p><p><tables num="2008"><img file="JP6577611B2_D2015.tif" /></tables></p><p><tables num="2009"><img file="JP6577611B2_D2016.tif" /></tables></p><p><tables num="2010"><img file="JP6577611B2_D2017.tif" /></tables></p><p><tables num="2011"><img file="JP6577611B2_D2018.tif" /></tables></p><p><tables num="2012"><img file="JP6577611B2_D2019.tif" /></tables></p><p><tables num="2013"><img file="JP6577611B2_D2020.tif" /></tables></p><p><tables num="2014"><img file="JP6577611B2_D2021.tif" /></tables></p><p><tables num="2015"><img file="JP6577611B2_D2022.tif" /></tables></p><p><tables num="2016"><img file="JP6577611B2_D2023.tif" /></tables></p><p><tables num="2017"><img file="JP6577611B2_D2024.tif" /></tables></p><p><tables num="2018"><img file="JP6577611B2_D2025.tif" /></tables></p><p><tables num="2019"><img file="JP6577611B2_D2026.tif" /></tables></p><p><tables num="2020"><img file="JP6577611B2_D2027.tif" /></tables></p><p><tables num="2021"><img file="JP6577611B2_D2028.tif" /></tables></p><p><tables num="2022"><img file="JP6577611B2_D2029.tif" /></tables></p><p><tables num="2023"><img file="JP6577611B2_D2030.tif" /></tables></p><p><tables num="2024"><img file="JP6577611B2_D2031.tif" /></tables></p><p><tables num="2025"><img file="JP6577611B2_D2032.tif" /></tables></p><p><tables num="2026"><img file="JP6577611B2_D2033.tif" /></tables></p><p><tables num="2027"><img file="JP6577611B2_D2034.tif" /></tables></p><p><tables num="2028"><img file="JP6577611B2_D2035.tif" /></tables></p><p><tables num="2029"><img file="JP6577611B2_D2036.tif" /></tables></p><p><tables num="2030"><img file="JP6577611B2_D2037.tif" /></tables></p><p><tables num="2031"><img file="JP6577611B2_D2038.tif" /></tables></p><p><tables num="2032"><img file="JP6577611B2_D2039.tif" /></tables></p><p><tables num="2033"><img file="JP6577611B2_D2040.tif" /></tables></p><p><tables num="2034"><img file="JP6577611B2_D2041.tif" /></tables></p><p><tables num="2035"><img file="JP6577611B2_D2042.tif" /></tables></p><p><tables num="2036"><img file="JP6577611B2_D2043.tif" /></tables></p><p><tables num="2037"><img file="JP6577611B2_D2044.tif" /></tables></p><p><tables num="2038"><img file="JP6577611B2_D2045.tif" /></tables></p><p><tables num="2039"><img file="JP6577611B2_D2046.tif" /></tables></p><p><tables num="2040"><img file="JP6577611B2_D2047.tif" /></tables></p><p><tables num="2041"><img file="JP6577611B2_D2048.tif" /></tables></p><p><tables num="2042"><img file="JP6577611B2_D2049.tif" /></tables></p><p><tables num="2043"><img file="JP6577611B2_D2050.tif" /></tables></p><p><tables num="2044"><img file="JP6577611B2_D2051.tif" /></tables></p><p><tables num="2045"><img file="JP6577611B2_D2052.tif" /></tables></p><p><tables num="2046"><img file="JP6577611B2_D2053.tif" /></tables></p><p><tables num="2047"><img file="JP6577611B2_D2054.tif" /></tables></p><p><tables num="2048"><img file="JP6577611B2_D2055.tif" /></tables></p><p><tables num="2049"><img file="JP6577611B2_D2056.tif" /></tables></p><p><tables num="2050"><img file="JP6577611B2_D2057.tif" /></tables></p><p><tables num="2051"><img file="JP6577611B2_D2058.tif" /></tables></p><p><tables num="2052"><img file="JP6577611B2_D2059.tif" /></tables></p><p><tables num="2053"><img file="JP6577611B2_D2060.tif" /></tables></p><p><tables num="2054"><img file="JP6577611B2_D2061.tif" /></tables></p><p><tables num="2055"><img file="JP6577611B2_D2062.tif" /></tables></p><p><tables num="2056"><img file="JP6577611B2_D2063.tif" /></tables></p><p><tables num="2057"><img file="JP6577611B2_D2064.tif" /></tables></p><p><tables num="2058"><img file="JP6577611B2_D2065.tif" /></tables></p><p><tables num="2059"><img file="JP6577611B2_D2066.tif" /></tables></p><p><tables num="2060"><img file="JP6577611B2_D2067.tif" /></tables></p><p><tables num="2061"><img file="JP6577611B2_D2068.tif" /></tables></p><p><tables num="2062"><img file="JP6577611B2_D2069.tif" /></tables></p><p><tables num="2063"><img file="JP6577611B2_D2070.tif" /></tables></p><p><tables num="2064"><img file="JP6577611B2_D2071.tif" /></tables></p><p><tables num="2065"><img file="JP6577611B2_D2072.tif" /></tables></p><p><tables num="2066"><img file="JP6577611B2_D2073.tif" /></tables></p><p><tables num="2067"><img file="JP6577611B2_D2074.tif" /></tables></p><p><tables num="2068"><img file="JP6577611B2_D2075.tif" /></tables></p><p><tables num="2069"><img file="JP6577611B2_D2076.tif" /></tables></p><p><tables num="2070"><img file="JP6577611B2_D2077.tif" /></tables></p><p><tables num="2071"><img file="JP6577611B2_D2078.tif" /></tables></p><p><tables num="2072"><img file="JP6577611B2_D2079.tif" /></tables></p><p><tables num="2073"><img file="JP6577611B2_D2080.tif" /></tables></p><p><tables num="2074"><img file="JP6577611B2_D2081.tif" /></tables></p><p><tables num="2075"><img file="JP6577611B2_D2082.tif" /></tables></p><p><tables num="2076"><img file="JP6577611B2_D2083.tif" /></tables></p><p><tables num="2077"><img file="JP6577611B2_D2084.tif" /></tables></p><p><tables num="2078"><img file="JP6577611B2_D2085.tif" /></tables></p><p><tables num="2079"><img file="JP6577611B2_D2086.tif" /></tables></p><p><tables num="2080"><img file="JP6577611B2_D2087.tif" /></tables></p><p><tables num="2081"><img file="JP6577611B2_D2088.tif" /></tables></p><p><tables num="2082"><img file="JP6577611B2_D2089.tif" /></tables></p><p><tables num="2083"><img file="JP6577611B2_D2090.tif" /></tables></p><p><tables num="2084"><img file="JP6577611B2_D2091.tif" /></tables></p><p><tables num="2085"><img file="JP6577611B2_D2092.tif" /></tables></p><p><tables num="2086"><img file="JP6577611B2_D2093.tif" /></tables></p><p><tables num="2087"><img file="JP6577611B2_D2094.tif" /></tables></p><p><tables num="2088"><img file="JP6577611B2_D2095.tif" /></tables></p><p><tables num="2089"><img file="JP6577611B2_D2096.tif" /></tables></p><p><tables num="2090"><img file="JP6577611B2_D2097.tif" /></tables></p><p><tables num="2091"><img file="JP6577611B2_D2098.tif" /></tables></p><p><tables num="2092"><img file="JP6577611B2_D2099.tif" /></tables></p><p><tables num="2093"><img file="JP6577611B2_D2100.tif" /></tables></p><p><tables num="2094"><img file="JP6577611B2_D2101.tif" /></tables></p><p><tables num="2095"><img file="JP6577611B2_D2102.tif" /></tables></p><p><tables num="2096"><img file="JP6577611B2_D2103.tif" /></tables></p><p><tables num="2097"><img file="JP6577611B2_D2104.tif" /></tables></p><p><tables num="2098"><img file="JP6577611B2_D2105.tif" /></tables></p><p><tables num="2099"><img file="JP6577611B2_D2106.tif" /></tables></p><p><tables num="2100"><img file="JP6577611B2_D2107.tif" /></tables></p><p><tables num="2101"><img file="JP6577611B2_D2108.tif" /></tables></p><p><tables num="2102"><img file="JP6577611B2_D2109.tif" /></tables></p><p><tables num="2103"><img file="JP6577611B2_D2110.tif" /></tables></p><p><tables num="2104"><img file="JP6577611B2_D2111.tif" /></tables></p><p><tables num="2105"><img file="JP6577611B2_D2112.tif" /></tables></p><p><tables num="2106"><img file="JP6577611B2_D2113.tif" /></tables></p><p><tables num="2107"><img file="JP6577611B2_D2114.tif" /></tables></p><p><tables num="2108"><img file="JP6577611B2_D2115.tif" /></tables></p><p><tables num="2109"><img file="JP6577611B2_D2116.tif" /></tables></p><p><tables num="2110"><img file="JP6577611B2_D2117.tif" /></tables></p><p><tables num="2111"><img file="JP6577611B2_D2118.tif" /></tables></p><p><tables num="2112"><img file="JP6577611B2_D2119.tif" /></tables></p><p><tables num="2113"><img file="JP6577611B2_D2120.tif" /></tables></p><p><tables num="2114"><img file="JP6577611B2_D2121.tif" /></tables></p><p><tables num="2115"><img file="JP6577611B2_D2122.tif" /></tables></p><p><tables num="2116"><img file="JP6577611B2_D2123.tif" /></tables></p><p><tables num="2117"><img file="JP6577611B2_D2124.tif" /></tables></p><p><tables num="2118"><img file="JP6577611B2_D2125.tif" /></tables></p><p><tables num="2119"><img file="JP6577611B2_D2126.tif" /></tables></p><p><tables num="2120"><img file="JP6577611B2_D2127.tif" /></tables></p><p><tables num="2121"><img file="JP6577611B2_D2128.tif" /></tables></p><p><tables num="2122"><img file="JP6577611B2_D2129.tif" /></tables></p><p><tables num="2123"><img file="JP6577611B2_D2130.tif" /></tables></p><p><tables num="2124"><img file="JP6577611B2_D2131.tif" /></tables></p><p><tables num="2125"><img file="JP6577611B2_D2132.tif" /></tables></p><p><tables num="2126"><img file="JP6577611B2_D2133.tif" /></tables></p><p><tables num="2127"><img file="JP6577611B2_D2134.tif" /></tables></p><p><tables num="2128"><img file="JP6577611B2_D2135.tif" /></tables></p><p><tables num="2129"><img file="JP6577611B2_D2136.tif" /></tables></p><p><tables num="2130"><img file="JP6577611B2_D2137.tif" /></tables></p><p><tables num="2131"><img file="JP6577611B2_D2138.tif" /></tables></p><p><tables num="2132"><img file="JP6577611B2_D2139.tif" /></tables></p><p><tables num="2133"><img file="JP6577611B2_D2140.tif" /></tables></p><p><tables num="2134"><img file="JP6577611B2_D2141.tif" /></tables></p><p><tables num="2135"><img file="JP6577611B2_D2142.tif" /></tables></p><p><tables num="2136"><img file="JP6577611B2_D2143.tif" /></tables></p><p><tables num="2137"><img file="JP6577611B2_D2144.tif" /></tables></p><p><tables num="2138"><img file="JP6577611B2_D2145.tif" /></tables></p><p><tables num="2139"><img file="JP6577611B2_D2146.tif" /></tables></p><p><tables num="2140"><img file="JP6577611B2_D2147.tif" /></tables></p><p><tables num="2141"><img file="JP6577611B2_D2148.tif" /></tables></p><p><tables num="2142"><img file="JP6577611B2_D2149.tif" /></tables></p><p><tables num="2143"><img file="JP6577611B2_D2150.tif" /></tables></p><p><tables num="2144"><img file="JP6577611B2_D2151.tif" /></tables></p><p><tables num="2145"><img file="JP6577611B2_D2152.tif" /></tables></p><p><tables num="2146"><img file="JP6577611B2_D2153.tif" /></tables></p><p><tables num="2147"><img file="JP6577611B2_D2154.tif" /></tables></p><p><tables num="2148"><img file="JP6577611B2_D2155.tif" /></tables></p><p><tables num="2149"><img file="JP6577611B2_D2156.tif" /></tables></p><p><tables num="2150"><img file="JP6577611B2_D2157.tif" /></tables></p><p><tables num="2151"><img file="JP6577611B2_D2158.tif" /></tables></p><p><tables num="2152"><img file="JP6577611B2_D2159.tif" /></tables></p><p><tables num="2153"><img file="JP6577611B2_D2160.tif" /></tables></p><p><tables num="2154"><img file="JP6577611B2_D2161.tif" /></tables></p><p><tables num="2155"><img file="JP6577611B2_D2162.tif" /></tables></p><p><tables num="2156"><img file="JP6577611B2_D2163.tif" /></tables></p><p><tables num="2157"><img file="JP6577611B2_D2164.tif" /></tables></p><p><tables num="2158"><img file="JP6577611B2_D2165.tif" /></tables></p><p><tables num="2159"><img file="JP6577611B2_D2166.tif" /></tables></p><p><tables num="2160"><img file="JP6577611B2_D2167.tif" /></tables></p><p><tables num="2161"><img file="JP6577611B2_D2168.tif" /></tables></p><p><tables num="2162"><img file="JP6577611B2_D2169.tif" /></tables></p><p><tables num="2163"><img file="JP6577611B2_D2170.tif" /></tables></p><p><tables num="2164"><img file="JP6577611B2_D2171.tif" /></tables></p><p><tables num="2165"><img file="JP6577611B2_D2172.tif" /></tables></p><p><tables num="2166"><img file="JP6577611B2_D2173.tif" /></tables></p><p><tables num="2167"><img file="JP6577611B2_D2174.tif" /></tables></p><p><tables num="2168"><img file="JP6577611B2_D2175.tif" /></tables></p><p><tables num="2169"><img file="JP6577611B2_D2176.tif" /></tables></p><p><tables num="2170"><img file="JP6577611B2_D2177.tif" /></tables></p><p><tables num="2171"><img file="JP6577611B2_D2178.tif" /></tables></p><p><tables num="2172"><img file="JP6577611B2_D2179.tif" /></tables></p><p><tables num="2173"><img file="JP6577611B2_D2180.tif" /></tables></p><p><tables num="2174"><img file="JP6577611B2_D2181.tif" /></tables></p><p><tables num="2175"><img file="JP6577611B2_D2182.tif" /></tables></p><p><tables num="2176"><img file="JP6577611B2_D2183.tif" /></tables></p><p><tables num="2177"><img file="JP6577611B2_D2184.tif" /></tables></p><p><tables num="2178"><img file="JP6577611B2_D2185.tif" /></tables></p><p><tables num="2179"><img file="JP6577611B2_D2186.tif" /></tables></p><p><tables num="2180"><img file="JP6577611B2_D2187.tif" /></tables></p><p><tables num="2181"><img file="JP6577611B2_D2188.tif" /></tables></p><p><tables num="2182"><img file="JP6577611B2_D2189.tif" /></tables></p><p><tables num="2183"><img file="JP6577611B2_D2190.tif" /></tables></p><p><tables num="2184"><img file="JP6577611B2_D2191.tif" /></tables></p><p><tables num="2185"><img file="JP6577611B2_D2192.tif" /></tables></p><p><tables num="2186"><img file="JP6577611B2_D2193.tif" /></tables></p><p><tables num="2187"><img file="JP6577611B2_D2194.tif" /></tables></p><p><tables num="2188"><img file="JP6577611B2_D2195.tif" /></tables></p><p><tables num="2189"><img file="JP6577611B2_D2196.tif" /></tables></p><p><tables num="2190"><img file="JP6577611B2_D2197.tif" /></tables></p><p><tables num="2191"><img file="JP6577611B2_D2198.tif" /></tables></p><p><tables num="2192"><img file="JP6577611B2_D2199.tif" /></tables></p><p><tables num="2193"><img file="JP6577611B2_D2200.tif" /></tables></p><p><tables num="2194"><img file="JP6577611B2_D2201.tif" /></tables></p><p><tables num="2195"><img file="JP6577611B2_D2202.tif" /></tables></p><p><tables num="2196"><img file="JP6577611B2_D2203.tif" /></tables></p><p><tables num="2197"><img file="JP6577611B2_D2204.tif" /></tables></p><p><tables num="2198"><img file="JP6577611B2_D2205.tif" /></tables></p><p><tables num="2199"><img file="JP6577611B2_D2206.tif" /></tables></p><p><tables num="2200"><img file="JP6577611B2_D2207.tif" /></tables></p><p><tables num="2201"><img file="JP6577611B2_D2208.tif" /></tables></p><p><tables num="2202"><img file="JP6577611B2_D2209.tif" /></tables></p><p><tables num="2203"><img file="JP6577611B2_D2210.tif" /></tables></p><p><tables num="2204"><img file="JP6577611B2_D2211.tif" /></tables></p><p><tables num="2205"><img file="JP6577611B2_D2212.tif" /></tables></p><p><tables num="2206"><img file="JP6577611B2_D2213.tif" /></tables></p><p><tables num="2207"><img file="JP6577611B2_D2214.tif" /></tables></p><p><tables num="2208"><img file="JP6577611B2_D2215.tif" /></tables></p><p><tables num="2209"><img file="JP6577611B2_D2216.tif" /></tables></p><p><tables num="2210"><img file="JP6577611B2_D2217.tif" /></tables></p><p><tables num="2211"><img file="JP6577611B2_D2218.tif" /></tables></p><p><tables num="2212"><img file="JP6577611B2_D2219.tif" /></tables></p><p><tables num="2213"><img file="JP6577611B2_D2220.tif" /></tables></p><p><tables num="2214"><img file="JP6577611B2_D2221.tif" /></tables></p><p><tables num="2215"><img file="JP6577611B2_D2222.tif" /></tables></p><p><tables num="2216"><img file="JP6577611B2_D2223.tif" /></tables></p><p><tables num="2217"><img file="JP6577611B2_D2224.tif" /></tables></p><p><tables num="2218"><img file="JP6577611B2_D2225.tif" /></tables></p><p><tables num="2219"><img file="JP6577611B2_D2226.tif" /></tables></p><p><tables num="2220"><img file="JP6577611B2_D2227.tif" /></tables></p><p><tables num="2221"><img file="JP6577611B2_D2228.tif" /></tables></p><p><tables num="2222"><img file="JP6577611B2_D2229.tif" /></tables></p><p><tables num="2223"><img file="JP6577611B2_D2230.tif" /></tables></p><p><tables num="2224"><img file="JP6577611B2_D2231.tif" /></tables></p><p><tables num="2225"><img file="JP6577611B2_D2232.tif" /></tables></p><p><tables num="2226"><img file="JP6577611B2_D2233.tif" /></tables></p><p><tables num="2227"><img file="JP6577611B2_D2234.tif" /></tables></p><p><tables num="2228"><img file="JP6577611B2_D2235.tif" /></tables></p><p><tables num="2229"><img file="JP6577611B2_D2236.tif" /></tables></p><p><tables num="2230"><img file="JP6577611B2_D2237.tif" /></tables></p><p><tables num="2231"><img file="JP6577611B2_D2238.tif" /></tables></p><p><tables num="2232"><img file="JP6577611B2_D2239.tif" /></tables></p><p><tables num="2233"><img file="JP6577611B2_D2240.tif" /></tables></p><p><tables num="2234"><img file="JP6577611B2_D2241.tif" /></tables></p><p><tables num="2235"><img file="JP6577611B2_D2242.tif" /></tables></p><p><tables num="2236"><img file="JP6577611B2_D2243.tif" /></tables></p><p><tables num="2237"><img file="JP6577611B2_D2244.tif" /></tables></p><p><tables num="2238"><img file="JP6577611B2_D2245.tif" /></tables></p><p><tables num="2239"><img file="JP6577611B2_D2246.tif" /></tables></p><p><tables num="2240"><img file="JP6577611B2_D2247.tif" /></tables></p><p><tables num="2241"><img file="JP6577611B2_D2248.tif" /></tables></p><p><tables num="2242"><img file="JP6577611B2_D2249.tif" /></tables></p><p><tables num="2243"><img file="JP6577611B2_D2250.tif" /></tables></p><p><tables num="2244"><img file="JP6577611B2_D2251.tif" /></tables></p><p><tables num="2245"><img file="JP6577611B2_D2252.tif" /></tables></p><p><tables num="2246"><img file="JP6577611B2_D2253.tif" /></tables></p><p><tables num="2247"><img file="JP6577611B2_D2254.tif" /></tables></p><p><tables num="2248"><img file="JP6577611B2_D2255.tif" /></tables></p><p><tables num="2249"><img file="JP6577611B2_D2256.tif" /></tables></p><p><tables num="2250"><img file="JP6577611B2_D2257.tif" /></tables></p><p><tables num="2251"><img file="JP6577611B2_D2258.tif" /></tables></p><p><tables num="2252"><img file="JP6577611B2_D2259.tif" /></tables></p><p><tables num="2253"><img file="JP6577611B2_D2260.tif" /></tables></p><p><tables num="2254"><img file="JP6577611B2_D2261.tif" /></tables></p><p><tables num="2255"><img file="JP6577611B2_D2262.tif" /></tables></p><p><tables num="2256"><img file="JP6577611B2_D2263.tif" /></tables></p><p><tables num="2257"><img file="JP6577611B2_D2264.tif" /></tables></p><p><tables num="2258"><img file="JP6577611B2_D2265.tif" /></tables></p><p><tables num="2259"><img file="JP6577611B2_D2266.tif" /></tables></p><p><tables num="2260"><img file="JP6577611B2_D2267.tif" /></tables></p><p><tables num="2261"><img file="JP6577611B2_D2268.tif" /></tables></p><p><tables num="2262"><img file="JP6577611B2_D2269.tif" /></tables></p><p><tables num="2263"><img file="JP6577611B2_D2270.tif" /></tables></p><p><tables num="2264"><img file="JP6577611B2_D2271.tif" /></tables></p><p><tables num="2265"><img file="JP6577611B2_D2272.tif" /></tables></p><p><tables num="2266"><img file="JP6577611B2_D2273.tif" /></tables></p><p><tables num="2267"><img file="JP6577611B2_D2274.tif" /></tables></p><p><tables num="2268"><img file="JP6577611B2_D2275.tif" /></tables></p><p><tables num="2269"><img file="JP6577611B2_D2276.tif" /></tables></p><p><tables num="2270"><img file="JP6577611B2_D2277.tif" /></tables></p><p><tables num="2271"><img file="JP6577611B2_D2278.tif" /></tables></p><p><tables num="2272"><img file="JP6577611B2_D2279.tif" /></tables></p><p><tables num="2273"><img file="JP6577611B2_D2280.tif" /></tables></p><p><tables num="2274"><img file="JP6577611B2_D2281.tif" /></tables></p><p><tables num="2275"><img file="JP6577611B2_D2282.tif" /></tables></p><p><tables num="2276"><img file="JP6577611B2_D2283.tif" /></tables></p><p><tables num="2277"><img file="JP6577611B2_D2284.tif" /></tables></p><p><tables num="2278"><img file="JP6577611B2_D2285.tif" /></tables></p><p><tables num="2279"><img file="JP6577611B2_D2286.tif" /></tables></p><p><tables num="2280"><img file="JP6577611B2_D2287.tif" /></tables></p><p><tables num="2281"><img file="JP6577611B2_D2288.tif" /></tables></p><p><tables num="2282"><img file="JP6577611B2_D2289.tif" /></tables></p><p><tables num="2283"><img file="JP6577611B2_D2290.tif" /></tables></p><p><tables num="2284"><img file="JP6577611B2_D2291.tif" /></tables></p><p><tables num="2285"><img file="JP6577611B2_D2292.tif" /></tables></p><p><tables num="2286"><img file="JP6577611B2_D2293.tif" /></tables></p><p><tables num="2287"><img file="JP6577611B2_D2294.tif" /></tables></p><p><tables num="2288"><img file="JP6577611B2_D2295.tif" /></tables></p><p><tables num="2289"><img file="JP6577611B2_D2296.tif" /></tables></p><p><tables num="2290"><img file="JP6577611B2_D2297.tif" /></tables></p><p><tables num="2291"><img file="JP6577611B2_D2298.tif" /></tables></p><p><tables num="2292"><img file="JP6577611B2_D2299.tif" /></tables></p><p><tables num="2293"><img file="JP6577611B2_D2300.tif" /></tables></p><p><tables num="2294"><img file="JP6577611B2_D2301.tif" /></tables></p><p><tables num="2295"><img file="JP6577611B2_D2302.tif" /></tables></p><p><tables num="2296"><img file="JP6577611B2_D2303.tif" /></tables></p><p><tables num="2297"><img file="JP6577611B2_D2304.tif" /></tables></p><p><tables num="2298"><img file="JP6577611B2_D2305.tif" /></tables></p><p><tables num="2299"><img file="JP6577611B2_D2306.tif" /></tables></p><p><tables num="2300"><img file="JP6577611B2_D2307.tif" /></tables></p><p><tables num="2301"><img file="JP6577611B2_D2308.tif" /></tables></p><p><tables num="2302"><img file="JP6577611B2_D2309.tif" /></tables></p><p><tables num="2303"><img file="JP6577611B2_D2310.tif" /></tables></p><p><tables num="2304"><img file="JP6577611B2_D2311.tif" /></tables></p><p><tables num="2305"><img file="JP6577611B2_D2312.tif" /></tables></p><p><tables num="2306"><img file="JP6577611B2_D2313.tif" /></tables></p><p><tables num="2307"><img file="JP6577611B2_D2314.tif" /></tables></p><p><tables num="2308"><img file="JP6577611B2_D2315.tif" /></tables></p><p><tables num="2309"><img file="JP6577611B2_D2316.tif" /></tables></p><p><tables num="2310"><img file="JP6577611B2_D2317.tif" /></tables></p><p><tables num="2311"><img file="JP6577611B2_D2318.tif" /></tables></p><p><tables num="2312"><img file="JP6577611B2_D2319.tif" /></tables></p><p><tables num="2313"><img file="JP6577611B2_D2320.tif" /></tables></p><p><tables num="2314"><img file="JP6577611B2_D2321.tif" /></tables></p><p><tables num="2315"><img file="JP6577611B2_D2322.tif" /></tables></p><p><tables num="2316"><img file="JP6577611B2_D2323.tif" /></tables></p><p><tables num="2317"><img file="JP6577611B2_D2324.tif" /></tables></p><p><tables num="2318"><img file="JP6577611B2_D2325.tif" /></tables></p><p><tables num="2319"><img file="JP6577611B2_D2326.tif" /></tables></p><p><tables num="2320"><img file="JP6577611B2_D2327.tif" /></tables></p><p><tables num="2321"><img file="JP6577611B2_D2328.tif" /></tables></p><p><tables num="2322"><img file="JP6577611B2_D2329.tif" /></tables></p><p><tables num="2323"><img file="JP6577611B2_D2330.tif" /></tables></p><p><tables num="2324"><img file="JP6577611B2_D2331.tif" /></tables></p><p><tables num="2325"><img file="JP6577611B2_D2332.tif" /></tables></p><p><tables num="2326"><img file="JP6577611B2_D2333.tif" /></tables></p><p><tables num="2327"><img file="JP6577611B2_D2334.tif" /></tables></p><p><tables num="2328"><img file="JP6577611B2_D2335.tif" /></tables></p><p><tables num="2329"><img file="JP6577611B2_D2336.tif" /></tables></p><p><tables num="2330"><img file="JP6577611B2_D2337.tif" /></tables></p><p><tables num="2331"><img file="JP6577611B2_D2338.tif" /></tables></p><p><tables num="2332"><img file="JP6577611B2_D2339.tif" /></tables></p><p><tables num="2333"><img file="JP6577611B2_D2340.tif" /></tables></p><p><tables num="2334"><img file="JP6577611B2_D2341.tif" /></tables></p><p><tables num="2335"><img file="JP6577611B2_D2342.tif" /></tables></p><p><tables num="2336"><img file="JP6577611B2_D2343.tif" /></tables></p><p><tables num="2337"><img file="JP6577611B2_D2344.tif" /></tables></p><p><tables num="2338"><img file="JP6577611B2_D2345.tif" /></tables></p><p><tables num="2339"><img file="JP6577611B2_D2346.tif" /></tables></p><p><tables num="2340"><img file="JP6577611B2_D2347.tif" /></tables></p><p><tables num="2341"><img file="JP6577611B2_D2348.tif" /></tables></p><p><tables num="2342"><img file="JP6577611B2_D2349.tif" /></tables></p><p><tables num="2343"><img file="JP6577611B2_D2350.tif" /></tables></p><p><tables num="2344"><img file="JP6577611B2_D2351.tif" /></tables></p><p><tables num="2345"><img file="JP6577611B2_D2352.tif" /></tables></p><p><tables num="2346"><img file="JP6577611B2_D2353.tif" /></tables></p><p><tables num="2347"><img file="JP6577611B2_D2354.tif" /></tables></p><p><tables num="2348"><img file="JP6577611B2_D2355.tif" /></tables></p><p><tables num="2349"><img file="JP6577611B2_D2356.tif" /></tables></p><p><tables num="2350"><img file="JP6577611B2_D2357.tif" /></tables></p><p><tables num="2351"><img file="JP6577611B2_D2358.tif" /></tables></p><p><tables num="2352"><img file="JP6577611B2_D2359.tif" /></tables></p><p><tables num="2353"><img file="JP6577611B2_D2360.tif" /></tables></p><p><tables num="2354"><img file="JP6577611B2_D2361.tif" /></tables></p><p><tables num="2355"><img file="JP6577611B2_D2362.tif" /></tables></p><p><tables num="2356"><img file="JP6577611B2_D2363.tif" /></tables></p><p><tables num="2357"><img file="JP6577611B2_D2364.tif" /></tables></p><p><tables num="2358"><img file="JP6577611B2_D2365.tif" /></tables></p><p><tables num="2359"><img file="JP6577611B2_D2366.tif" /></tables></p><p><tables num="2360"><img file="JP6577611B2_D2367.tif" /></tables></p><p><tables num="2361"><img file="JP6577611B2_D2368.tif" /></tables></p><p><tables num="2362"><img file="JP6577611B2_D2369.tif" /></tables></p><p><tables num="2363"><img file="JP6577611B2_D2370.tif" /></tables></p><p><tables num="2364"><img file="JP6577611B2_D2371.tif" /></tables></p><p><tables num="2365"><img file="JP6577611B2_D2372.tif" /></tables></p><p><tables num="2366"><img file="JP6577611B2_D2373.tif" /></tables></p><p><tables num="2367"><img file="JP6577611B2_D2374.tif" /></tables></p><p><tables num="2368"><img file="JP6577611B2_D2375.tif" /></tables></p><p><tables num="2369"><img file="JP6577611B2_D2376.tif" /></tables></p><p><tables num="2370"><img file="JP6577611B2_D2377.tif" /></tables></p><p><tables num="2371"><img file="JP6577611B2_D2378.tif" /></tables></p><p><tables num="2372"><img file="JP6577611B2_D2379.tif" /></tables></p><p><tables num="2373"><img file="JP6577611B2_D2380.tif" /></tables></p><p><tables num="2374"><img file="JP6577611B2_D2381.tif" /></tables></p><p><tables num="2375"><img file="JP6577611B2_D2382.tif" /></tables></p><p><tables num="2376"><img file="JP6577611B2_D2383.tif" /></tables></p><p><tables num="2377"><img file="JP6577611B2_D2384.tif" /></tables></p><p><tables num="2378"><img file="JP6577611B2_D2385.tif" /></tables></p><p><tables num="2379"><img file="JP6577611B2_D2386.tif" /></tables></p><p><tables num="2380"><img file="JP6577611B2_D2387.tif" /></tables></p><p><tables num="2381"><img file="JP6577611B2_D2388.tif" /></tables></p><p><tables num="2382"><img file="JP6577611B2_D2389.tif" /></tables></p><p><tables num="2383"><img file="JP6577611B2_D2390.tif" /></tables></p><p><tables num="2384"><img file="JP6577611B2_D2391.tif" /></tables></p><p><tables num="2385"><img file="JP6577611B2_D2392.tif" /></tables></p><p><tables num="2386"><img file="JP6577611B2_D2393.tif" /></tables></p><p><tables num="2387"><img file="JP6577611B2_D2394.tif" /></tables></p><p><tables num="2388"><img file="JP6577611B2_D2395.tif" /></tables></p><p><tables num="2389"><img file="JP6577611B2_D2396.tif" /></tables></p><p><tables num="2390"><img file="JP6577611B2_D2397.tif" /></tables></p><p><tables num="2391"><img file="JP6577611B2_D2398.tif" /></tables></p><p><tables num="2392"><img file="JP6577611B2_D2399.tif" /></tables></p><p><tables num="2393"><img file="JP6577611B2_D2400.tif" /></tables></p><p><tables num="2394"><img file="JP6577611B2_D2401.tif" /></tables></p><p><tables num="2395"><img file="JP6577611B2_D2402.tif" /></tables></p><p><tables num="2396"><img file="JP6577611B2_D2403.tif" /></tables></p><p><tables num="2397"><img file="JP6577611B2_D2404.tif" /></tables></p><p><tables num="2398"><img file="JP6577611B2_D2405.tif" /></tables></p><p><tables num="2399"><img file="JP6577611B2_D2406.tif" /></tables></p><p><tables num="2400"><img file="JP6577611B2_D2407.tif" /></tables></p><p><tables num="2401"><img file="JP6577611B2_D2408.tif" /></tables></p><p><tables num="2402"><img file="JP6577611B2_D2409.tif" /></tables></p><p><tables num="2403"><img file="JP6577611B2_D2410.tif" /></tables></p><p><tables num="2404"><img file="JP6577611B2_D2411.tif" /></tables></p><p><tables num="2405"><img file="JP6577611B2_D2412.tif" /></tables></p><p><tables num="2406"><img file="JP6577611B2_D2413.tif" /></tables></p><p><tables num="2407"><img file="JP6577611B2_D2414.tif" /></tables></p><p><tables num="2408"><img file="JP6577611B2_D2415.tif" /></tables></p><p><tables num="2409"><img file="JP6577611B2_D2416.tif" /></tables></p><p><tables num="2410"><img file="JP6577611B2_D2417.tif" /></tables></p><p><tables num="2411"><img file="JP6577611B2_D2418.tif" /></tables></p><p><tables num="2412"><img file="JP6577611B2_D2419.tif" /></tables></p><p><tables num="2413"><img file="JP6577611B2_D2420.tif" /></tables></p><p><tables num="2414"><img file="JP6577611B2_D2421.tif" /></tables></p><p><tables num="2415"><img file="JP6577611B2_D2422.tif" /></tables></p><p><tables num="2416"><img file="JP6577611B2_D2423.tif" /></tables></p><p><tables num="2417"><img file="JP6577611B2_D2424.tif" /></tables></p><p><tables num="2418"><img file="JP6577611B2_D2425.tif" /></tables></p><p><tables num="2419"><img file="JP6577611B2_D2426.tif" /></tables></p><p><tables num="2420"><img file="JP6577611B2_D2427.tif" /></tables></p><p><tables num="2421"><img file="JP6577611B2_D2428.tif" /></tables></p><p><tables num="2422"><img file="JP6577611B2_D2429.tif" /></tables></p><p><tables num="2423"><img file="JP6577611B2_D2430.tif" /></tables></p><p><tables num="2424"><img file="JP6577611B2_D2431.tif" /></tables></p><p><tables num="2425"><img file="JP6577611B2_D2432.tif" /></tables></p><p><tables num="2426"><img file="JP6577611B2_D2433.tif" /></tables></p><p><tables num="2427"><img file="JP6577611B2_D2434.tif" /></tables></p><p><tables num="2428"><img file="JP6577611B2_D2435.tif" /></tables></p><p><tables num="2429"><img file="JP6577611B2_D2436.tif" /></tables></p><p><tables num="2430"><img file="JP6577611B2_D2437.tif" /></tables></p><p><tables num="2431"><img file="JP6577611B2_D2438.tif" /></tables></p><p><tables num="2432"><img file="JP6577611B2_D2439.tif" /></tables></p><p><tables num="2433"><img file="JP6577611B2_D2440.tif" /></tables></p><p><tables num="2434"><img file="JP6577611B2_D2441.tif" /></tables></p><p><tables num="2435"><img file="JP6577611B2_D2442.tif" /></tables></p><p><tables num="2436"><img file="JP6577611B2_D2443.tif" /></tables></p><p><tables num="2437"><img file="JP6577611B2_D2444.tif" /></tables></p><p><tables num="2438"><img file="JP6577611B2_D2445.tif" /></tables></p><p><tables num="2439"><img file="JP6577611B2_D2446.tif" /></tables></p><p><tables num="2440"><img file="JP6577611B2_D2447.tif" /></tables></p><p><tables num="2441"><img file="JP6577611B2_D2448.tif" /></tables></p><p><tables num="2442"><img file="JP6577611B2_D2449.tif" /></tables></p><p><tables num="2443"><img file="JP6577611B2_D2450.tif" /></tables></p><p><tables num="2444"><img file="JP6577611B2_D2451.tif" /></tables></p><p><tables num="2445"><img file="JP6577611B2_D2452.tif" /></tables></p><p><tables num="2446"><img file="JP6577611B2_D2453.tif" /></tables></p><p><tables num="2447"><img file="JP6577611B2_D2454.tif" /></tables></p><p><tables num="2448"><img file="JP6577611B2_D2455.tif" /></tables></p><p><tables num="2449"><img file="JP6577611B2_D2456.tif" /></tables></p><p><tables num="2450"><img file="JP6577611B2_D2457.tif" /></tables></p><p><tables num="2451"><img file="JP6577611B2_D2458.tif" /></tables></p><p><tables num="2452"><img file="JP6577611B2_D2459.tif" /></tables></p><p><tables num="2453"><img file="JP6577611B2_D2460.tif" /></tables></p><p><tables num="2454"><img file="JP6577611B2_D2461.tif" /></tables></p><p><tables num="2455"><img file="JP6577611B2_D2462.tif" /></tables></p><p><tables num="2456"><img file="JP6577611B2_D2463.tif" /></tables></p><p><tables num="2457"><img file="JP6577611B2_D2464.tif" /></tables></p><p><tables num="2458"><img file="JP6577611B2_D2465.tif" /></tables></p><p><tables num="2459"><img file="JP6577611B2_D2466.tif" /></tables></p><p><tables num="2460"><img file="JP6577611B2_D2467.tif" /></tables></p><p><tables num="2461"><img file="JP6577611B2_D2468.tif" /></tables></p><p><tables num="2462"><img file="JP6577611B2_D2469.tif" /></tables></p><p><tables num="2463"><img file="JP6577611B2_D2470.tif" /></tables></p><p><tables num="2464"><img file="JP6577611B2_D2471.tif" /></tables></p><p><tables num="2465"><img file="JP6577611B2_D2472.tif" /></tables></p><p><tables num="2466"><img file="JP6577611B2_D2473.tif" /></tables></p><p><tables num="2467"><img file="JP6577611B2_D2474.tif" /></tables></p><p><tables num="2468"><img file="JP6577611B2_D2475.tif" /></tables></p><p><tables num="2469"><img file="JP6577611B2_D2476.tif" /></tables></p><p><tables num="2470"><img file="JP6577611B2_D2477.tif" /></tables></p><p><tables num="2471"><img file="JP6577611B2_D2478.tif" /></tables></p><p><tables num="2472"><img file="JP6577611B2_D2479.tif" /></tables></p><p><tables num="2473"><img file="JP6577611B2_D2480.tif" /></tables></p><p><tables num="2474"><img file="JP6577611B2_D2481.tif" /></tables></p><p><tables num="2475"><img file="JP6577611B2_D2482.tif" /></tables></p><p><tables num="2476"><img file="JP6577611B2_D2483.tif" /></tables></p><p><tables num="2477"><img file="JP6577611B2_D2484.tif" /></tables></p><p><tables num="2478"><img file="JP6577611B2_D2485.tif" /></tables></p><p><tables num="2479"><img file="JP6577611B2_D2486.tif" /></tables></p><p><tables num="2480"><img file="JP6577611B2_D2487.tif" /></tables></p><p><tables num="2481"><img file="JP6577611B2_D2488.tif" /></tables></p><p><tables num="2482"><img file="JP6577611B2_D2489.tif" /></tables></p><p><tables num="2483"><img file="JP6577611B2_D2490.tif" /></tables></p><p><tables num="2484"><img file="JP6577611B2_D2491.tif" /></tables></p><p><tables num="2485"><img file="JP6577611B2_D2492.tif" /></tables></p><p><tables num="2486"><img file="JP6577611B2_D2493.tif" /></tables></p><p><tables num="2487"><img file="JP6577611B2_D2494.tif" /></tables></p><p><tables num="2488"><img file="JP6577611B2_D2495.tif" /></tables></p><p><tables num="2489"><img file="JP6577611B2_D2496.tif" /></tables></p><p><tables num="2490"><img file="JP6577611B2_D2497.tif" /></tables></p><p><tables num="2491"><img file="JP6577611B2_D2498.tif" /></tables></p><p><tables num="2492"><img file="JP6577611B2_D2499.tif" /></tables></p><p><tables num="2493"><img file="JP6577611B2_D2500.tif" /></tables></p><p><tables num="2494"><img file="JP6577611B2_D2501.tif" /></tables></p><p><tables num="2495"><img file="JP6577611B2_D2502.tif" /></tables></p><p><tables num="2496"><img file="JP6577611B2_D2503.tif" /></tables></p><p><tables num="2497"><img file="JP6577611B2_D2504.tif" /></tables></p><p><tables num="2498"><img file="JP6577611B2_D2505.tif" /></tables></p><p><tables num="2499"><img file="JP6577611B2_D2506.tif" /></tables></p><p><tables num="2500"><img file="JP6577611B2_D2507.tif" /></tables></p><p><tables num="2501"><img file="JP6577611B2_D2508.tif" /></tables></p><p><tables num="2502"><img file="JP6577611B2_D2509.tif" /></tables></p><p><tables num="2503"><img file="JP6577611B2_D2510.tif" /></tables></p><p><tables num="2504"><img file="JP6577611B2_D2511.tif" /></tables></p><p><tables num="2505"><img file="JP6577611B2_D2512.tif" /></tables></p><p><tables num="2506"><img file="JP6577611B2_D2513.tif" /></tables></p><p><tables num="2507"><img file="JP6577611B2_D2514.tif" /></tables></p><p><tables num="2508"><img file="JP6577611B2_D2515.tif" /></tables></p><p><tables num="2509"><img file="JP6577611B2_D2516.tif" /></tables></p><p><tables num="2510"><img file="JP6577611B2_D2517.tif" /></tables></p><p><tables num="2511"><img file="JP6577611B2_D2518.tif" /></tables></p><p><tables num="2512"><img file="JP6577611B2_D2519.tif" /></tables></p><p><tables num="2513"><img file="JP6577611B2_D2520.tif" /></tables></p><p><tables num="2514"><img file="JP6577611B2_D2521.tif" /></tables></p><p><tables num="2515"><img file="JP6577611B2_D2522.tif" /></tables></p><p><tables num="2516"><img file="JP6577611B2_D2523.tif" /></tables></p><p><tables num="2517"><img file="JP6577611B2_D2524.tif" /></tables></p><p><tables num="2518"><img file="JP6577611B2_D2525.tif" /></tables></p><p><tables num="2519"><img file="JP6577611B2_D2526.tif" /></tables></p><p><tables num="2520"><img file="JP6577611B2_D2527.tif" /></tables></p><p><tables num="2521"><img file="JP6577611B2_D2528.tif" /></tables></p><p><tables num="2522"><img file="JP6577611B2_D2529.tif" /></tables></p><p><tables num="2523"><img file="JP6577611B2_D2530.tif" /></tables></p><p><tables num="2524"><img file="JP6577611B2_D2531.tif" /></tables></p><p><tables num="2525"><img file="JP6577611B2_D2532.tif" /></tables></p><p><tables num="2526"><img file="JP6577611B2_D2533.tif" /></tables></p><p><tables num="2527"><img file="JP6577611B2_D2534.tif" /></tables></p><p><tables num="2528"><img file="JP6577611B2_D2535.tif" /></tables></p><p><tables num="2529"><img file="JP6577611B2_D2536.tif" /></tables></p><p><tables num="2530"><img file="JP6577611B2_D2537.tif" /></tables></p><p><tables num="2531"><img file="JP6577611B2_D2538.tif" /></tables></p><p><tables num="2532"><img file="JP6577611B2_D2539.tif" /></tables></p><p><tables num="2533"><img file="JP6577611B2_D2540.tif" /></tables></p><p><tables num="2534"><img file="JP6577611B2_D2541.tif" /></tables></p><p><tables num="2535"><img file="JP6577611B2_D2542.tif" /></tables></p><p><tables num="2536"><img file="JP6577611B2_D2543.tif" /></tables></p><p><tables num="2537"><img file="JP6577611B2_D2544.tif" /></tables></p><p><tables num="2538"><img file="JP6577611B2_D2545.tif" /></tables></p><p><tables num="2539"><img file="JP6577611B2_D2546.tif" /></tables></p><p><tables num="2540"><img file="JP6577611B2_D2547.tif" /></tables></p><p><tables num="2541"><img file="JP6577611B2_D2548.tif" /></tables></p><p><tables num="2542"><img file="JP6577611B2_D2549.tif" /></tables></p><p><tables num="2543"><img file="JP6577611B2_D2550.tif" /></tables></p><p><tables num="2544"><img file="JP6577611B2_D2551.tif" /></tables></p><p><tables num="2545"><img file="JP6577611B2_D2552.tif" /></tables></p><p><tables num="2546"><img file="JP6577611B2_D2553.tif" /></tables></p><p><tables num="2547"><img file="JP6577611B2_D2554.tif" /></tables></p><p><tables num="2548"><img file="JP6577611B2_D2555.tif" /></tables></p><p><tables num="2549"><img file="JP6577611B2_D2556.tif" /></tables></p><p><tables num="2550"><img file="JP6577611B2_D2557.tif" /></tables></p><p><tables num="2551"><img file="JP6577611B2_D2558.tif" /></tables></p><p><tables num="2552"><img file="JP6577611B2_D2559.tif" /></tables></p><p><tables num="2553"><img file="JP6577611B2_D2560.tif" /></tables></p><p><tables num="2554"><img file="JP6577611B2_D2561.tif" /></tables></p><p><tables num="2555"><img file="JP6577611B2_D2562.tif" /></tables></p><p><tables num="2556"><img file="JP6577611B2_D2563.tif" /></tables></p><p><tables num="2557"><img file="JP6577611B2_D2564.tif" /></tables></p><p><tables num="2558"><img file="JP6577611B2_D2565.tif" /></tables></p><p><tables num="2559"><img file="JP6577611B2_D2566.tif" /></tables></p><p><tables num="2560"><img file="JP6577611B2_D2567.tif" /></tables></p><p><tables num="2561"><img file="JP6577611B2_D2568.tif" /></tables></p><p><tables num="2562"><img file="JP6577611B2_D2569.tif" /></tables></p><p><tables num="2563"><img file="JP6577611B2_D2570.tif" /></tables></p><p><tables num="2564"><img file="JP6577611B2_D2571.tif" /></tables></p><p><tables num="2565"><img file="JP6577611B2_D2572.tif" /></tables></p><p><tables num="2566"><img file="JP6577611B2_D2573.tif" /></tables></p><p><tables num="2567"><img file="JP6577611B2_D2574.tif" /></tables></p><p><tables num="2568"><img file="JP6577611B2_D2575.tif" /></tables></p><p><tables num="2569"><img file="JP6577611B2_D2576.tif" /></tables></p><p><tables num="2570"><img file="JP6577611B2_D2577.tif" /></tables></p><p><tables num="2571"><img file="JP6577611B2_D2578.tif" /></tables></p><p><tables num="2572"><img file="JP6577611B2_D2579.tif" /></tables></p><p><tables num="2573"><img file="JP6577611B2_D2580.tif" /></tables></p><p><tables num="2574"><img file="JP6577611B2_D2581.tif" /></tables></p><p><tables num="2575"><img file="JP6577611B2_D2582.tif" /></tables></p><p><tables num="2576"><img file="JP6577611B2_D2583.tif" /></tables></p><p><tables num="2577"><img file="JP6577611B2_D2584.tif" /></tables></p><p><tables num="2578"><img file="JP6577611B2_D2585.tif" /></tables></p><p><tables num="2579"><img file="JP6577611B2_D2586.tif" /></tables></p><p><tables num="2580"><img file="JP6577611B2_D2587.tif" /></tables></p><p><tables num="2581"><img file="JP6577611B2_D2588.tif" /></tables></p><p><tables num="2582"><img file="JP6577611B2_D2589.tif" /></tables></p><p><tables num="2583"><img file="JP6577611B2_D2590.tif" /></tables></p><p><tables num="2584"><img file="JP6577611B2_D2591.tif" /></tables></p><p><tables num="2585"><img file="JP6577611B2_D2592.tif" /></tables></p><p><tables num="2586"><img file="JP6577611B2_D2593.tif" /></tables></p><p><tables num="2587"><img file="JP6577611B2_D2594.tif" /></tables></p><p><tables num="2588"><img file="JP6577611B2_D2595.tif" /></tables></p><p><tables num="2589"><img file="JP6577611B2_D2596.tif" /></tables></p><p><tables num="2590"><img file="JP6577611B2_D2597.tif" /></tables></p><p><tables num="2591"><img file="JP6577611B2_D2598.tif" /></tables></p><p><tables num="2592"><img file="JP6577611B2_D2599.tif" /></tables></p><p><tables num="2593"><img file="JP6577611B2_D2600.tif" /></tables></p><p><tables num="2594"><img file="JP6577611B2_D2601.tif" /></tables></p><p><tables num="2595"><img file="JP6577611B2_D2602.tif" /></tables></p><p><tables num="2596"><img file="JP6577611B2_D2603.tif" /></tables></p><p><tables num="2597"><img file="JP6577611B2_D2604.tif" /></tables></p><p><tables num="2598"><img file="JP6577611B2_D2605.tif" /></tables></p><p><tables num="2599"><img file="JP6577611B2_D2606.tif" /></tables></p><p><tables num="2600"><img file="JP6577611B2_D2607.tif" /></tables></p><p><tables num="2601"><img file="JP6577611B2_D2608.tif" /></tables></p><p><tables num="2602"><img file="JP6577611B2_D2609.tif" /></tables></p><p><tables num="2603"><img file="JP6577611B2_D2610.tif" /></tables></p><p><tables num="2604"><img file="JP6577611B2_D2611.tif" /></tables></p><p><tables num="2605"><img file="JP6577611B2_D2612.tif" /></tables></p><p><tables num="2606"><img file="JP6577611B2_D2613.tif" /></tables></p><p><tables num="2607"><img file="JP6577611B2_D2614.tif" /></tables></p><p><tables num="2608"><img file="JP6577611B2_D2615.tif" /></tables></p><p><tables num="2609"><img file="JP6577611B2_D2616.tif" /></tables></p><p><tables num="2610"><img file="JP6577611B2_D2617.tif" /></tables></p><p><tables num="2611"><img file="JP6577611B2_D2618.tif" /></tables></p><p><tables num="2612"><img file="JP6577611B2_D2619.tif" /></tables></p><p><tables num="2613"><img file="JP6577611B2_D2620.tif" /></tables></p><p><tables num="2614"><img file="JP6577611B2_D2621.tif" /></tables></p><p><tables num="2615"><img file="JP6577611B2_D2622.tif" /></tables></p><p><tables num="2616"><img file="JP6577611B2_D2623.tif" /></tables></p><p><tables num="2617"><img file="JP6577611B2_D2624.tif" /></tables></p><p><tables num="2618"><img file="JP6577611B2_D2625.tif" /></tables></p><p><tables num="2619"><img file="JP6577611B2_D2626.tif" /></tables></p><p><tables num="2620"><img file="JP6577611B2_D2627.tif" /></tables></p><p><tables num="2621"><img file="JP6577611B2_D2628.tif" /></tables></p><p><tables num="2622"><img file="JP6577611B2_D2629.tif" /></tables></p><p><tables num="2623"><img file="JP6577611B2_D2630.tif" /></tables></p><p><tables num="2624"><img file="JP6577611B2_D2631.tif" /></tables></p><p><tables num="2625"><img file="JP6577611B2_D2632.tif" /></tables></p><p><tables num="2626"><img file="JP6577611B2_D2633.tif" /></tables></p><p><tables num="2627"><img file="JP6577611B2_D2634.tif" /></tables></p><p><tables num="2628"><img file="JP6577611B2_D2635.tif" /></tables></p><p><tables num="2629"><img file="JP6577611B2_D2636.tif" /></tables></p><p><tables num="2630"><img file="JP6577611B2_D2637.tif" /></tables></p><p><tables num="2631"><img file="JP6577611B2_D2638.tif" /></tables></p><p><tables num="2632"><img file="JP6577611B2_D2639.tif" /></tables></p><p><tables num="2633"><img file="JP6577611B2_D2640.tif" /></tables></p><p><tables num="2634"><img file="JP6577611B2_D2641.tif" /></tables></p><p><tables num="2635"><img file="JP6577611B2_D2642.tif" /></tables></p><p><tables num="2636"><img file="JP6577611B2_D2643.tif" /></tables></p><p><tables num="2637"><img file="JP6577611B2_D2644.tif" /></tables></p><p><tables num="2638"><img file="JP6577611B2_D2645.tif" /></tables></p><p><tables num="2639"><img file="JP6577611B2_D2646.tif" /></tables></p><p><tables num="2640"><img file="JP6577611B2_D2647.tif" /></tables></p><p><tables num="2641"><img file="JP6577611B2_D2648.tif" /></tables></p><p><tables num="2642"><img file="JP6577611B2_D2649.tif" /></tables></p><p><tables num="2643"><img file="JP6577611B2_D2650.tif" /></tables></p><p><tables num="2644"><img file="JP6577611B2_D2651.tif" /></tables></p><p><tables num="2645"><img file="JP6577611B2_D2652.tif" /></tables></p><p><tables num="2646"><img file="JP6577611B2_D2653.tif" /></tables></p><p><tables num="2647"><img file="JP6577611B2_D2654.tif" /></tables></p><p><tables num="2648"><img file="JP6577611B2_D2655.tif" /></tables></p><p><tables num="2649"><img file="JP6577611B2_D2656.tif" /></tables></p><p><tables num="2650"><img file="JP6577611B2_D2657.tif" /></tables></p><p><tables num="2651"><img file="JP6577611B2_D2658.tif" /></tables></p><p><tables num="2652"><img file="JP6577611B2_D2659.tif" /></tables></p><p><tables num="2653"><img file="JP6577611B2_D2660.tif" /></tables></p><p><tables num="2654"><img file="JP6577611B2_D2661.tif" /></tables></p><p><tables num="2655"><img file="JP6577611B2_D2662.tif" /></tables></p><p><tables num="2656"><img file="JP6577611B2_D2663.tif" /></tables></p><p><tables num="2657"><img file="JP6577611B2_D2664.tif" /></tables></p><p><tables num="2658"><img file="JP6577611B2_D2665.tif" /></tables></p><p><tables num="2659"><img file="JP6577611B2_D2666.tif" /></tables></p><p><tables num="2660"><img file="JP6577611B2_D2667.tif" /></tables></p><p><tables num="2661"><img file="JP6577611B2_D2668.tif" /></tables></p><p><tables num="2662"><img file="JP6577611B2_D2669.tif" /></tables></p><p><tables num="2663"><img file="JP6577611B2_D2670.tif" /></tables></p><p><tables num="2664"><img file="JP6577611B2_D2671.tif" /></tables></p><p><tables num="2665"><img file="JP6577611B2_D2672.tif" /></tables></p><p><tables num="2666"><img file="JP6577611B2_D2673.tif" /></tables></p><p><tables num="2667"><img file="JP6577611B2_D2674.tif" /></tables></p><p><tables num="2668"><img file="JP6577611B2_D2675.tif" /></tables></p><p><tables num="2669"><img file="JP6577611B2_D2676.tif" /></tables></p><p><tables num="2670"><img file="JP6577611B2_D2677.tif" /></tables></p><p><tables num="2671"><img file="JP6577611B2_D2678.tif" /></tables></p><p><tables num="2672"><img file="JP6577611B2_D2679.tif" /></tables></p><p><tables num="2673"><img file="JP6577611B2_D2680.tif" /></tables></p><p><tables num="2674"><img file="JP6577611B2_D2681.tif" /></tables></p><p><tables num="2675"><img file="JP6577611B2_D2682.tif" /></tables></p><p><tables num="2676"><img file="JP6577611B2_D2683.tif" /></tables></p><p><tables num="2677"><img file="JP6577611B2_D2684.tif" /></tables></p><p><tables num="2678"><img file="JP6577611B2_D2685.tif" /></tables></p><p><tables num="2679"><img file="JP6577611B2_D2686.tif" /></tables></p><p><tables num="2680"><img file="JP6577611B2_D2687.tif" /></tables></p><p><tables num="2681"><img file="JP6577611B2_D2688.tif" /></tables></p><p><tables num="2682"><img file="JP6577611B2_D2689.tif" /></tables></p><p><tables num="2683"><img file="JP6577611B2_D2690.tif" /></tables></p><p><tables num="2684"><img file="JP6577611B2_D2691.tif" /></tables></p><p><tables num="2685"><img file="JP6577611B2_D2692.tif" /></tables></p><p><tables num="2686"><img file="JP6577611B2_D2693.tif" /></tables></p><p><tables num="2687"><img file="JP6577611B2_D2694.tif" /></tables></p><p><tables num="2688"><img file="JP6577611B2_D2695.tif" /></tables></p><p><tables num="2689"><img file="JP6577611B2_D2696.tif" /></tables></p><p><tables num="2690"><img file="JP6577611B2_D2697.tif" /></tables></p><p><tables num="2691"><img file="JP6577611B2_D2698.tif" /></tables></p><p><tables num="2692"><img file="JP6577611B2_D2699.tif" /></tables></p><p><tables num="2693"><img file="JP6577611B2_D2700.tif" /></tables></p><p><tables num="2694"><img file="JP6577611B2_D2701.tif" /></tables></p><p><tables num="2695"><img file="JP6577611B2_D2702.tif" /></tables></p><p><tables num="2696"><img file="JP6577611B2_D2703.tif" /></tables></p><p><tables num="2697"><img file="JP6577611B2_D2704.tif" /></tables></p><p><tables num="2698"><img file="JP6577611B2_D2705.tif" /></tables></p><p><tables num="2699"><img file="JP6577611B2_D2706.tif" /></tables></p><p><tables num="2700"><img file="JP6577611B2_D2707.tif" /></tables></p><p><tables num="2701"><img file="JP6577611B2_D2708.tif" /></tables></p><p><tables num="2702"><img file="JP6577611B2_D2709.tif" /></tables></p><p><tables num="2703"><img file="JP6577611B2_D2710.tif" /></tables></p><p><tables num="2704"><img file="JP6577611B2_D2711.tif" /></tables></p><p><tables num="2705"><img file="JP6577611B2_D2712.tif" /></tables></p><p><tables num="2706"><img file="JP6577611B2_D2713.tif" /></tables></p><p><tables num="2707"><img file="JP6577611B2_D2714.tif" /></tables></p><p><tables num="2708"><img file="JP6577611B2_D2715.tif" /></tables></p><p><tables num="2709"><img file="JP6577611B2_D2716.tif" /></tables></p><p><tables num="2710"><img file="JP6577611B2_D2717.tif" /></tables></p><p><tables num="2711"><img file="JP6577611B2_D2718.tif" /></tables></p><p><tables num="2712"><img file="JP6577611B2_D2719.tif" /></tables></p><p><tables num="2713"><img file="JP6577611B2_D2720.tif" /></tables></p><p><tables num="2714"><img file="JP6577611B2_D2721.tif" /></tables></p><p><tables num="2715"><img file="JP6577611B2_D2722.tif" /></tables></p><p><tables num="2716"><img file="JP6577611B2_D2723.tif" /></tables></p><p><tables num="2717"><img file="JP6577611B2_D2724.tif" /></tables></p><p><tables num="2718"><img file="JP6577611B2_D2725.tif" /></tables></p><p><tables num="2719"><img file="JP6577611B2_D2726.tif" /></tables></p><p><tables num="2720"><img file="JP6577611B2_D2727.tif" /></tables></p><p><tables num="2721"><img file="JP6577611B2_D2728.tif" /></tables></p><p><tables num="2722"><img file="JP6577611B2_D2729.tif" /></tables></p><p><tables num="2723"><img file="JP6577611B2_D2730.tif" /></tables></p><p><tables num="2724"><img file="JP6577611B2_D2731.tif" /></tables></p><p><tables num="2725"><img file="JP6577611B2_D2732.tif" /></tables></p><p><tables num="2726"><img file="JP6577611B2_D2733.tif" /></tables></p><p><tables num="2727"><img file="JP6577611B2_D2734.tif" /></tables></p><p><tables num="2728"><img file="JP6577611B2_D2735.tif" /></tables></p><p><tables num="2729"><img file="JP6577611B2_D2736.tif" /></tables></p><p><tables num="2730"><img file="JP6577611B2_D2737.tif" /></tables></p><p><tables num="2731"><img file="JP6577611B2_D2738.tif" /></tables></p><p><tables num="2732"><img file="JP6577611B2_D2739.tif" /></tables></p><p><tables num="2733"><img file="JP6577611B2_D2740.tif" /></tables></p><p><tables num="2734"><img file="JP6577611B2_D2741.tif" /></tables></p><p><tables num="2735"><img file="JP6577611B2_D2742.tif" /></tables></p><p><tables num="2736"><img file="JP6577611B2_D2743.tif" /></tables></p><p><tables num="2737"><img file="JP6577611B2_D2744.tif" /></tables></p><p><tables num="2738"><img file="JP6577611B2_D2745.tif" /></tables></p><p><tables num="2739"><img file="JP6577611B2_D2746.tif" /></tables></p><p><tables num="2740"><img file="JP6577611B2_D2747.tif" /></tables></p><p><tables num="2741"><img file="JP6577611B2_D2748.tif" /></tables></p><p><tables num="2742"><img file="JP6577611B2_D2749.tif" /></tables></p><p><tables num="2743"><img file="JP6577611B2_D2750.tif" /></tables></p><p><tables num="2744"><img file="JP6577611B2_D2751.tif" /></tables></p><p><tables num="2745"><img file="JP6577611B2_D2752.tif" /></tables></p><p><tables num="2746"><img file="JP6577611B2_D2753.tif" /></tables></p><p><tables num="2747"><img file="JP6577611B2_D2754.tif" /></tables></p><p><tables num="2748"><img file="JP6577611B2_D2755.tif" /></tables></p><p><tables num="2749"><img file="JP6577611B2_D2756.tif" /></tables></p><p><tables num="2750"><img file="JP6577611B2_D2757.tif" /></tables></p><p><tables num="2751"><img file="JP6577611B2_D2758.tif" /></tables></p><p><tables num="2752"><img file="JP6577611B2_D2759.tif" /></tables></p><p><tables num="2753"><img file="JP6577611B2_D2760.tif" /></tables></p><p><tables num="2754"><img file="JP6577611B2_D2761.tif" /></tables></p><p><tables num="2755"><img file="JP6577611B2_D2762.tif" /></tables></p><p><tables num="2756"><img file="JP6577611B2_D2763.tif" /></tables></p><p><tables num="2757"><img file="JP6577611B2_D2764.tif" /></tables></p><p><tables num="2758"><img file="JP6577611B2_D2765.tif" /></tables></p><p><tables num="2759"><img file="JP6577611B2_D2766.tif" /></tables></p><p><tables num="2760"><img file="JP6577611B2_D2767.tif" /></tables></p><p><tables num="2761"><img file="JP6577611B2_D2768.tif" /></tables></p><p><tables num="2762"><img file="JP6577611B2_D2769.tif" /></tables></p><p><tables num="2763"><img file="JP6577611B2_D2770.tif" /></tables></p><p><tables num="2764"><img file="JP6577611B2_D2771.tif" /></tables></p><p><tables num="2765"><img file="JP6577611B2_D2772.tif" /></tables></p><p><tables num="2766"><img file="JP6577611B2_D2773.tif" /></tables></p><p><tables num="2767"><img file="JP6577611B2_D2774.tif" /></tables></p><p><tables num="2768"><img file="JP6577611B2_D2775.tif" /></tables></p><p><tables num="2769"><img file="JP6577611B2_D2776.tif" /></tables></p><p><tables num="2770"><img file="JP6577611B2_D2777.tif" /></tables></p><p><tables num="2771"><img file="JP6577611B2_D2778.tif" /></tables></p><p><tables num="2772"><img file="JP6577611B2_D2779.tif" /></tables></p><p><tables num="2773"><img file="JP6577611B2_D2780.tif" /></tables></p><p><tables num="2774"><img file="JP6577611B2_D2781.tif" /></tables></p><p><tables num="2775"><img file="JP6577611B2_D2782.tif" /></tables></p><p><tables num="2776"><img file="JP6577611B2_D2783.tif" /></tables></p><p><tables num="2777"><img file="JP6577611B2_D2784.tif" /></tables></p><p><tables num="2778"><img file="JP6577611B2_D2785.tif" /></tables></p><p><tables num="2779"><img file="JP6577611B2_D2786.tif" /></tables></p><p><tables num="2780"><img file="JP6577611B2_D2787.tif" /></tables></p><p><tables num="2781"><img file="JP6577611B2_D2788.tif" /></tables></p><p><tables num="2782"><img file="JP6577611B2_D2789.tif" /></tables></p><p><tables num="2783"><img file="JP6577611B2_D2790.tif" /></tables></p><p><tables num="2784"><img file="JP6577611B2_D2791.tif" /></tables></p><p><tables num="2785"><img file="JP6577611B2_D2792.tif" /></tables></p><p><tables num="2786"><img file="JP6577611B2_D2793.tif" /></tables></p><p><tables num="2787"><img file="JP6577611B2_D2794.tif" /></tables></p><p><tables num="2788"><img file="JP6577611B2_D2795.tif" /></tables></p><p><tables num="2789"><img file="JP6577611B2_D2796.tif" /></tables></p><p><tables num="2790"><img file="JP6577611B2_D2797.tif" /></tables></p><p><tables num="2791"><img file="JP6577611B2_D2798.tif" /></tables></p><p><tables num="2792"><img file="JP6577611B2_D2799.tif" /></tables></p><p><tables num="2793"><img file="JP6577611B2_D2800.tif" /></tables></p><p><tables num="2794"><img file="JP6577611B2_D2801.tif" /></tables></p><p><tables num="2795"><img file="JP6577611B2_D2802.tif" /></tables></p><p><tables num="2796"><img file="JP6577611B2_D2803.tif" /></tables></p><p><tables num="2797"><img file="JP6577611B2_D2804.tif" /></tables></p><p><tables num="2798"><img file="JP6577611B2_D2805.tif" /></tables></p><p><tables num="2799"><img file="JP6577611B2_D2806.tif" /></tables></p><p><tables num="2800"><img file="JP6577611B2_D2807.tif" /></tables></p><p><tables num="2801"><img file="JP6577611B2_D2808.tif" /></tables></p><p><tables num="2802"><img file="JP6577611B2_D2809.tif" /></tables></p><p><tables num="2803"><img file="JP6577611B2_D2810.tif" /></tables></p><p><tables num="2804"><img file="JP6577611B2_D2811.tif" /></tables></p><p><tables num="2805"><img file="JP6577611B2_D2812.tif" /></tables></p><p><tables num="2806"><img file="JP6577611B2_D2813.tif" /></tables></p><p><tables num="2807"><img file="JP6577611B2_D2814.tif" /></tables></p><p><tables num="2808"><img file="JP6577611B2_D2815.tif" /></tables></p><p><tables num="2809"><img file="JP6577611B2_D2816.tif" /></tables></p><p><tables num="2810"><img file="JP6577611B2_D2817.tif" /></tables></p><p><tables num="2811"><img file="JP6577611B2_D2818.tif" /></tables></p><p><tables num="2812"><img file="JP6577611B2_D2819.tif" /></tables></p><p><tables num="2813"><img file="JP6577611B2_D2820.tif" /></tables></p><p><tables num="2814"><img file="JP6577611B2_D2821.tif" /></tables></p><p><tables num="2815"><img file="JP6577611B2_D2822.tif" /></tables></p><p><tables num="2816"><img file="JP6577611B2_D2823.tif" /></tables></p><p><tables num="2817"><img file="JP6577611B2_D2824.tif" /></tables></p><p><tables num="2818"><img file="JP6577611B2_D2825.tif" /></tables></p><p><tables num="2819"><img file="JP6577611B2_D2826.tif" /></tables></p><p><tables num="2820"><img file="JP6577611B2_D2827.tif" /></tables></p><p><tables num="2821"><img file="JP6577611B2_D2828.tif" /></tables></p><p><tables num="2822"><img file="JP6577611B2_D2829.tif" /></tables></p><p><tables num="2823"><img file="JP6577611B2_D2830.tif" /></tables></p><p><tables num="2824"><img file="JP6577611B2_D2831.tif" /></tables></p><p><tables num="2825"><img file="JP6577611B2_D2832.tif" /></tables></p><p><tables num="2826"><img file="JP6577611B2_D2833.tif" /></tables></p><p><tables num="2827"><img file="JP6577611B2_D2834.tif" /></tables></p><p><tables num="2828"><img file="JP6577611B2_D2835.tif" /></tables></p><p><tables num="2829"><img file="JP6577611B2_D2836.tif" /></tables></p><p><tables num="2830"><img file="JP6577611B2_D2837.tif" /></tables></p><p><tables num="2831"><img file="JP6577611B2_D2838.tif" /></tables></p><p><tables num="2832"><img file="JP6577611B2_D2839.tif" /></tables></p><p><tables num="2833"><img file="JP6577611B2_D2840.tif" /></tables></p><p><tables num="2834"><img file="JP6577611B2_D2841.tif" /></tables></p><p><tables num="2835"><img file="JP6577611B2_D2842.tif" /></tables></p><p><tables num="2836"><img file="JP6577611B2_D2843.tif" /></tables></p><p><tables num="2837"><img file="JP6577611B2_D2844.tif" /></tables></p><p><tables num="2838"><img file="JP6577611B2_D2845.tif" /></tables></p><p><tables num="2839"><img file="JP6577611B2_D2846.tif" /></tables></p><p><tables num="2840"><img file="JP6577611B2_D2847.tif" /></tables></p><p><tables num="2841"><img file="JP6577611B2_D2848.tif" /></tables></p><p><tables num="2842"><img file="JP6577611B2_D2849.tif" /></tables></p><p><tables num="2843"><img file="JP6577611B2_D2850.tif" /></tables></p><p><tables num="2844"><img file="JP6577611B2_D2851.tif" /></tables></p><p><tables num="2845"><img file="JP6577611B2_D2852.tif" /></tables></p><p><tables num="2846"><img file="JP6577611B2_D2853.tif" /></tables></p><p><tables num="2847"><img file="JP6577611B2_D2854.tif" /></tables></p><p><tables num="2848"><img file="JP6577611B2_D2855.tif" /></tables></p><p><tables num="2849"><img file="JP6577611B2_D2856.tif" /></tables></p><p><tables num="2850"><img file="JP6577611B2_D2857.tif" /></tables></p><p><tables num="2851"><img file="JP6577611B2_D2858.tif" /></tables></p><p><tables num="2852"><img file="JP6577611B2_D2859.tif" /></tables></p><p><tables num="2853"><img file="JP6577611B2_D2860.tif" /></tables></p><p><tables num="2854"><img file="JP6577611B2_D2861.tif" /></tables></p><p><tables num="2855"><img file="JP6577611B2_D2862.tif" /></tables></p><p><tables num="2856"><img file="JP6577611B2_D2863.tif" /></tables></p><p><tables num="2857"><img file="JP6577611B2_D2864.tif" /></tables></p><p><tables num="2858"><img file="JP6577611B2_D2865.tif" /></tables></p><p><tables num="2859"><img file="JP6577611B2_D2866.tif" /></tables></p><p><tables num="2860"><img file="JP6577611B2_D2867.tif" /></tables></p><p><tables num="2861"><img file="JP6577611B2_D2868.tif" /></tables></p><p><tables num="2862"><img file="JP6577611B2_D2869.tif" /></tables></p>