Methods and kits for sense rna synthesis

Cross-reference to related applications This application claims priority to US Patent Application No. 11 / 150,794 filed June 10, 2005, which is incorporated herein by reference in its entirety. Sequence listing The entire computer-readable sequence listing is incorporated herein by reference. Technical field The present invention generally relates to compositions and methods for synthesizing nucleic acid molecules.

Background technology Microarray technology has become a powerful tool for generating and analyzing gene expression profiles. However, microarray expression analysis requires large amounts of RNA, which is often unavailable (see Wang et al., BioTechniques 34: 394-400 (2003)). Several RNA amplification techniques have been developed to overcome this problem. However, these techniques generally suffer from a phenomenon known as amplification bias (see, eg, US Pat. No. 6,582,906). In these cases, the amplified population of RNA molecules does not correspond proportionally to the population of RNA molecules present in the original sample.

For example, in the methods disclosed by Eberwine and colleagues (see, eg, US Pat. Nos. 5,545,522; 5,716,785; 5,891,636; 5,958,688; and 6,291,170), compound oligonucleotides. Is utilized for amplification, where the complex oligonucleotide is provided, including both the T7 promoter and primers. The complex oligonucleotide is used to generate a cDNA copy of the first mRNA transcript, followed by second-strand synthesis, which produces the double-stranded cDNA. RNA amplification is carried out via the promoter portion of the complex oligonucleotide, and transcription proceeds away from the second strand of the cDNA. Since the second strand is used for transcription, the Eberwine method produces amplified RNA that is antisense to the first mRNA sequence.

However, the Eberwine method is due to the incomplete progression of the enzyme utilized (ie, the inability of the enzyme to remain attached to the nucleic acid molecule) and the placement of the RNA polymerase promoter in each step. Introduce a 3'bias all the time (see, eg, U.S. Pat. No. 6,582,906 and U.S. Patent Publication No. US2003 / 0104432). For example, the complex oligonucleotide used to generate the first-strand cDNA places the promoter at the 5'end of the cDNA, which corresponds to the 3'end of the message. This means that RNA polymerase is unable to complete transcription of some templates (probably due to the long poly A tail region or interference due to secondary and tertiary structure in the templates). Combined, it can cause a 3'bias in the amplified antisense RNA population. In addition, if DNA polymerase's synthesis of second-strand cDNA is incomplete, these cDNAs lack a functional promoter, resulting in reduced (or perhaps complete absence) of the presentation of the original RNA molecule in the amplified population. Will result.

As expressly incorporated herein, our co-pending U.S. Patent Application No. 10 / 979,052 sets out a single-stranded promoter template that is inextensible with DNA polymerase, 3'of the cDNA molecule. Disclose a method for adhering to the edge. After enzymatically converting the promoter template to a double-stranded promoter using DNA polymerase, in vitro transcription is initiated by adding RNA polymerase to sense RNA with the same orientation as the original RNA molecule ( sRNA) Produces the synthesis of molecules. The sRNA molecule is reverse transcribed, and the promoter template is reattached to the cDNA molecule of the second cycle, followed by enzymatic conversion to the double-stranded promoter, and then in vitro transcription of the second cycle with RNA polymerase. May perform further cycles of sRNA synthesis.

For sRNA synthesis as disclosed in U.S. Patent Application No. 10 / 979,052, without the need for each cycle of cDNA synthesis after redeposition of the promoter template and subsequent enzymatic conversion to the double-stranded promoter. It would be desirable to provide a method for performing further cycles.

<p>Outline of the invention Applicants are methods and kits for synthesizing sRNA molecules from a variety of nucleic acid templates, including a first RNA polymerase recognition sequence and at least a second different RNA polymerase recognition sequence, extending in DNA polymerase. We have invented the methods and kits that attach an impossible single-stranded promoter template to the 3'end of a first-cycle cDNA molecule. Applicants use these promoter templates to create a complex sequence associated with each cycle of cDNA synthesis after redeposition of the single-stranded promoter template and subsequent enzymatic conversion to the double-stranded promoter. It was discovered that multi-cycle sRNA synthesis is possible without the need to repeat the above steps. Regenerate the double-stranded promoter sequence (s), either during the reverse transcription of the second and subsequent cycles, or by adding a single-stranded oligonucleotide with a promoter sequence complement immediately after the reverse transcription. .. Specific RNA amplification is increased 100-1000-fold over previous methods, without the accompanying increase in the number of non-specific artifacts.</p><p> Thus, one aspect of the invention is a method for synthesizing at least one sRNA molecule: providing at least one single-stranded cDNA molecule with 5'and 3'ends; of said cDNA molecule. Attach an oligodeoxynucleotide tail onto the 3'end; on the oligodeoxynucleotide tail, the first RNA polymerase recognition sequence and at least the second different RNA polymerase on the 3'side of the first recognition sequence. Annealed a single-stranded promoter template containing a recognition sequence, where the single-stranded promoter template is non-extensible with DNA polymerase; the single-stranded RNA promoter template is the first RNA polymerase promoter. , And the oligodeoxynucleotide tail so that it is converted to at least the second RNA polymerase promoter on the 3'side of the first promoter; and the first or second RNA polymerase. -Relevant to the method of initiating RNA transcription using an RNA polymerase that recognizes a promoter, thereby synthesizing at least one sRNA molecule.</p><p> Another aspect of the invention is a method for performing multi-period synthesis of at least one sRNA molecule: providing at least one first-period single-stranded cDNA molecule with 5'and 3'ends. An oligodeoxynucleotide tail is attached to the 3'end of the first cycle cDNA molecule; the first RNA polymerase recognition sequence and the 3'of the first recognition sequence are attached to the oligodeoxynucleotide tail. Annealed a single-stranded promoter template containing at least a second different RNA polymerase recognition sequence on the side, where the single-stranded promoter template is non-extensible with DNA polymerase; the single-stranded promoter template , The first RNA polymerase promoter, and the oligodeoxynucleotide tail extended so that it is converted to at least the second RNA polymerase promoter on the 3'side of the first promoter; RNA polymerase Using an RNA polymerase that recognizes the promoter, initiates the first cycle of RNA transcription to produce at least one first cycle sRNA molecule; from the above first cycle sRNA molecule, at least one Synthesize the second cycle single-stranded cDNA molecule, the second cycle single-stranded cDNA molecule has 5'and 3'ends; as described above so that a second RNA polymerase promoter is formed. Annealing a single-stranded promoter oligonucleotide complementary to a second different RNA polymerase recognition sequence; and using an RNA polymerase that recognizes the second RNA polymerase promoter described above, initiates the second cycle of RNA transcription. The method comprises the steps of producing at least one second cycle sRNA molecule, thereby synthesizing at least one sRNA molecule in multiple cycles.</p><p> Another aspect of the invention is a method for performing multi-period synthesis of at least one sRNA molecule: providing at least one first-period single-stranded cDNA molecule with 5'and 3'ends. An oligodeoxynucleotide tail is attached to the 3'end of the first cycle cDNA molecule; the first RNA polymerase recognition sequence and the 3'of the first recognition sequence are attached to the oligodeoxynucleotide tail. Annealed a single-stranded promoter template containing at least a second different RNA polymerase recognition sequence on the side, where the single-stranded promoter template is non-extensible with DNA polymerase; the single-stranded promoter template , The first RNA polymerase promoter, and the oligodeoxynucleotide tail extended so that it is converted to at least the second RNA polymerase promoter on the 3'side of the first promoter; RNA polymerase that recognizes the promoter of RNA polymerase is used to initiate the first cycle of RNA transcription to produce at least one first cycle sRNA molecule; from the above first cycle sRNA molecule, at least one Synthesize the second cycle single-stranded cDNA molecule, the second cycle single-stranded cDNA molecule has 5'and 3'ends; degrades the first cycle sRNA molecule; said second cycle An excess single-stranded promoter template is annealed at the 3'end of the single-stranded cDNA molecule; the excess promoter template is the first RNA polymerase promoter, and the 3'of the first promoter. Elongate the 3'end of the second cycle cDNA so that it is converted to at least the second RNA polymerase promoter on the side;Then, using an RNA polymerase that recognizes the first or second RNA polymerase promoter, the second cycle of RNA transcription is initiated to produce at least one second cycle sRNA molecule, thereby producing at least one. The method relates to the method comprising the step of synthesizing multiple cycles of one sRNA molecule and producing a large number of sRNA copies.</p><p> In some embodiments, a poly-A tail is added to the resulting sRNA molecule to increase the number and type of downstream assays in which the sRNA molecule can be used. Preferably, the sRNA molecule is reverse transcribed into a cDNA molecule for use in downstream assays.</p><p> Single-stranded cDNA molecules may be provided by contacting RNA molecules with primers in the presence of reverse transcriptase. Such reverse transcription primers include oligo dT primers, random primers, or a combination thereof. In some embodiments, the reverse transcription primer comprises a 5'extension containing a particular nucleotide sequence. In another embodiment, the 3'terminal nucleotide of the reverse transcription primer is a nucleotide or nucleotide analog that is not a substrate for the terminal deoxynucleotide transferase but is extendable by reverse transcriptase. In a preferred embodiment, the reverse transcription primer comprises a 5'extension containing a particular nucleotide sequence, wherein the 3'terminal nucleotide of the reverse transcription primer is a ribonucleotide.</p><p> Another aspect of the invention is a kit for synthesizing at least one sRNA molecule: the first RNA polymerase recognition sequence, and at least the second different RNA on the 3'side of the first recognition sequence. A single-stranded promoter template comprising a polymerase recognition sequence, wherein the single-stranded promoter template is inextensible with DNA polymerase; and instructions for using the promoter template to synthesize sRNA molecules. With respect to the kit, including material.</p><p> Another aspect of the invention is a kit for multi-cycle synthesis of at least one sRNA molecule: the first RNA polymerase recognition sequence, and at least the 3'side of the first recognition sequence. A single-stranded promoter template comprising two different RNA polymerase recognition sequences, wherein the single-stranded promoter template is inextensible with DNA polymerase; one complementary to the second RNA polymerase recognition sequence. With respect to the kit, which comprises a double-stranded promoter oligonucleotide; and instructions for using the promoter template and promoter oligonucleotide to perform multi-cycle synthesis of at least one sRNA molecule.</p><p> In some embodiments, the kit includes reverse transcriptase; an enzyme for attaching an oligodeoxynucleotide tail onto a DNA molecule; an enzyme for converting a promoter template into one or more RNA polymerase promoters; and one or more. Also contains the RNA polymerase of.</p>

Optimal mode for carrying out the invention The present invention relates to methods and kits for the synthesis of sRNA molecules. The terms "sRNA molecule", "RNA molecule", "DNA molecule", "cDNA molecule" and "nucleic acid molecule" each include a single molecule, multiple molecules of a single species, and multiple molecules of different species, respectively. Is intended. The method generally attaches an oligodeoxynucleotide tail onto the 3'end of at least one first cycle single-stranded cDNA molecule; to the oligodeoxynucleotide tail, the first RNA polymerase recognition sequence, And annealed a single-stranded promoter template containing at least the second different RNA polymerase recognition sequence on the 3'side of the first recognition sequence, where the single-stranded promoter template is inextensible with DNA polymerase. The oligodeoxynucleotide so that the single-stranded promoter template is converted to the first RNA polymerase promoter and at least the second RNA polymerase promoter on the 3'side of the first promoter. -Extending the tail; using an RNA polymerase that recognizes the first RNA polymerase promoter, initiates the first cycle of RNA transcription to produce at least one first cycle sRNA molecule; the first Synthesize at least one second-cycle single-stranded cDNA molecule with 5'and 3'ends from periodic sRNA molecules; degrade the first-period sRNA molecule; form a second RNA polymerase promoter Thus, annealed a single-stranded promoter oligonucleotide complementary to a second different RNA polymerase recognition sequence; and using an RNA polymerase that recognizes the second RNA polymerase promoter, the second cycle of RNA transcription Initiating involves producing at least one second cycle sRNA molecule. Such robust linear amplification methods are expected to improve expression analysis involving a small number of cells and reduce the number of artifacts resulting from non-specific amplification (Player et al., Expert Rev. Mol.

The methods of the present invention utilize routine techniques in the field of molecular biology. Basic textbooks that disclose general molecular biology methods include Sambrook et al., Molecular Cloning, A Laboratory Manual (3rd edition, 2001) and Ausubel et al., Current Protocols in Molecular Biology (1994).

Many methods and commercial kits for the synthesis of positive-strand cDNA molecules are well known in the art. For example, Superscript^TMDouble-stranded cDNA synthesis kit (Invitrogen, Carlsbad, CA), Array 50^TM, Array 350^TMAnd Array 900^TMDetection Kit (Genisphere, Hatfield, PA), and CyScribe^TMIncludes post-labeling kit (Amersham, Piscataway, NJ). With reference to Figure 1, RNA molecules from the source of interest (eg, mRNA, hnRNA, rRNA, tRNA, miRNA, snoRNA, non-coding RNA) are used as templates for the reverse transcription reaction (see Figure 1a). I want). RNA may be obtained from any tissue or cell source, including virions, prokaryotes, and eukaryotic sources found in any biological or environmental sample. Preferably, the source is eukaryotic tissue, more preferably mammalian tissue, most preferably human tissue. The methods of the invention use, for example, micromanipulation, fluorescence activated cell fractionation (FACS) and laser microdissection techniques (see Player et al., Expert Rev. Mol. Diagn. 4: 831 (2004)). It is particularly suitable for amplifying RNA from a small number of cells, including single cells, which can be purified from complex cell samples.

Any reverse transcriptase may be used for the initial reverse transcriptase, which is the thermostable RNase H.⁺And RNase H^-Includes reverse transcriptase. Preferably, RNase H^-Use reverse transcriptase.

Primers for first-strand cDNA synthesis may be obtained commercially or synthesized and purified using techniques well known in the art. Primers for positive-strand cDNA synthesis anneal to RNA containing a 3'poly A tail (eg, mRNA), generally about 10 to about 30 nucleotides in length, preferably about 17 to about 24 in length. A range of nucleotides, including single-stranded oligodeoxynucleotides containing an oligo dT tail at the 3'end. If the RNA of interest does not naturally contain a 3'poly A tail (eg miRNA), the poly A polymerase (PAP) may be used to attach the poly A tail to the RNA molecule in the presence of ATP. .. Poly A-tail addition kits are commercially available, and such kits include, for example, the Poly (A) tail addition kit (Ambion, Austin, Texas). For example, bovine intestinal alkaline phosphatase or RNase 3 may be used to enzymatically treat 3'blocked RNA to allow tail addition.

Alternatively, a random primer generally annealed at various positions along the overall length of each of the original mRNA transcripts, generally in the range of about 4 to about 20 nucleotides in length, preferably about 6 to about 9 nucleotides in length. May be used to initiate the reverse transcription reaction. Those skilled in the art will appreciate that the use of random primers can ultimately result in the production of sRNA molecules that better represent the overall length of each of the original mRNA transcripts than those produced with oligo dT primers. You will recognize. In addition, the use of random primers to generate cDNA in the first step of the disclosed method removes RNA that would normally be excluded from amplification, such as degraded RNA or RNA of bacterial origin. It means that it is also possible to produce amplified sRNA molecules using it.

In some embodiments, reverse transcription primers (oligo dT primers, random primers, or both) generally range from about 6 to about 50 nucleotides in length, preferably about 10 to about 20 nucleotides in length. Includes a 5'extension containing a specific nucleotide sequence (see Figure 2a). As shown in FIG. 2e, this 5'specific nucleotide sequence may be used as the starting site for second period cDNA synthesis.

In other embodiments, the 3'terminal nucleotides of the reverse transcription primers (oligodT primers, random primers, or both), like ribonucleotides, are not substrates for the terminal deoxynucleotide transferase, but can be extended by reverse transcriptase. It is a nucleotide or a nucleotide analog. These primers are non-extensible with terminal deoxynucleotidyl transferase (TdT) and will therefore not be tailed and amplified in the steps shown in FIGS. 1c-1f. In a preferred embodiment, the reverse transcription primer comprises a 5'extension containing a particular nucleotide sequence, wherein the 3'terminal nucleotide of the reverse transcription primer is a ribonucleotide.

After first-strand cDNA synthesis, the resulting first-period cDNA molecules are generally purified (see Figure 1b). It is preferable not to degrade RNA prior to cDNA purification, but cDNA purified after RNA degradation works equally well in the methods of the invention. Any method of degrading RNA may be used, such as treatment with NaOH or RNase H (RNase H).⁺It may be supplied in the form of reverse transcriptase or as a separate enzyme). Alternatively, the first period cDNA molecule may be purified from the RNA / cDNA duplex and left intact. There are many methods and kits for purifying DNA molecules, such as MinElute.^TM Includes PCR purification kit (Qiagen, Valencia, CA). If reverse transcription primers in which the 3'terminal nucleotide is a ribonucleotide are used for first-strand cDNA synthesis, DNA purification may be omitted. It is also possible to reduce sample loss and increase amplification yield, which is especially important when manipulating RNA from a small number of cells.

After first cycle cDNA purification, a single-stranded oligodeoxynucleotide tail is attached to the 3'end of the cDNA molecule (see Figure 1b). These oligodeoxynucleotide tails allow amplification of the entire population of nucleic acid molecules, not just specific sequences. The oligodeoxynucleotide tail can be incorporated by any means of attaching deoxynucleotides to DNA. Preferably, in the presence of the appropriate deoxynucleotide, a terminal deoxynucleotidyltransferase, or other suitable enzyme, is used to attach the oligodeoxynucleotide tail to the cDNA. Preferably, the oligodeoxynucleotide tail is a homopolymer tail (ie, poly dA, poly dG, poly dC, or poly dT). Preferably, the oligodeoxynucleotide tail is generally a polydA tail ranging in length from about 3 to 500 nucleotides, preferably from about 20 to about 100 nucleotides in length. Applicants have found that the use of poly dA tails reduces the number of artifacts resulting from non-specific amplification.

After attachment of the single-stranded oligonucleotide tail to the 3'end of the first period cDNA molecule, the single-stranded promoter template is attached to the 3'oligodeoxynucleotide tail (see Figure 1b). This is achieved through complementary base pairing between the 3'oligodeoxynucleotide tail and the complementary set of deoxynucleotides present at the 3'end of the single-stranded promoter template. For example, if the oligonucleotide tail is a poly dA tail, the promoter template will generally have nucleotides at its 3'end, generally greater than about 3-50 nucleotides in length, preferably about 10-30 nucleotides in length. Will contain a range of thymidine bases in the range of. The particular nucleotide sequence of the 3'promoter template sequence does not have to be completely complementary to the particular nucleotide sequence of the 3'oligodeoxynucleotide tail in order for the sequences to be considered complementary to each other. Also, the length of the 3'promoter template sequence does not have to exactly match the length of the 3'oligodeoxynucleotide tail. Those skilled in the art recognize that what is needed is sufficient complementarity between the two sequences so that the promoter template can be annealed to the oligodeoxynucleotide tail at the 3'end of the cDNA molecule. Will do.

The single-stranded promoter template contains the first RNA polymerase recognition sequence at the 5'end and at least the second different RNA polymerase recognition sequence on the 3'side of the first recognition sequence (ie, "tandem." Promoter template "). The term "RNA polymerase recognition sequence" is intended to include both single and double strand nucleotide sequences. In the single-strand form, the nucleotide sequence corresponds to the non-template strand of the double-stranded RNA polymerase promoter. In the double-stranded form, the nucleotide sequence corresponds to both the template and non-template strands of the double-stranded RNA polymerase promoter. Any RNA polymerase recognition sequence may be used as long as it is specifically recognized by RNA polymerase. Preferably, the RNA polymerase recognition sequence used is recognized by a bacteriophage RNA polymerase such as T7, T3, or SP6 RNA polymerase. A typical T7 RNA polymerase recognition sequence is TAATACGACTCACTATAGGG (SEQ ID NO: 1). Typical T3 The RNA polymerase recognition sequence is AATTAACCCTCACTAAAGGG (SEQ ID NO: 2). A typical SP6 RNA polymerase recognition sequence is AATTTAAGGTGACACTATAGAA (SEQ ID NO: 3).

The single-stranded promoter template is also blocked at the 3'end so that it is inextensible with DNA polymerase. As such, the addition of DNA polymerase (Klenow DNA polymerase) and dNTPs extends the single-stranded oligonucleotide tail, and the single-stranded promoter template, the first double-stranded RNA polymerase promoter and at least the first. Converts to two different double-stranded RNA polymerase promoters, but does not catalyze the synthesis of double-stranded cDNA (see Figure 1c). The promoter template may be blocked by any means that makes it inextensible by DNA polymerase, such as by including terminal blocking groups, compounds, or moieties that are attached either during or after synthesis. Preferably, the promoter template is blocked with a 3'amino modifier, 3'deoxy terminator, or 3'dideoxy terminator. Suitable blockers are not limited to any of those described herein and may include any portion that would prevent DNA polymerase from extending the 3'end of the promoter template.

In some embodiments, DNA polymerase is used to convert a single-stranded promoter template to a double-stranded RNA polymerase promoter, but by DNA ligation, a double-stranded RNA polymerase having template and non-template strands. Attach the promoter to the 3'end of the first-cycle cDNA molecule (see PCT / US2004 / 014325 of our co-pending international patent application, which is expressly incorporated herein by reference in its entirety. I want). The double-stranded RNA polymerase promoter has a first RNA polymerase recognition sequence at its 5'end (compared to a non-template strand) and a second different RNA polymerase on the 3'side of the first recognition sequence. Contains a recognition sequence. Promoter attachment is an overhang of the 3'oligodeoxynucleotide tail of the cDNA molecule (eg, poly dA tail), and the 3'end of the non-template strand of the double-stranded RNA polymerase promoter containing a complementary set of nucleotides. Promoted by complementary base pairing between sequences (ie poly dT overhangs). When properly placed, the double-stranded promoter attaches to the cDNA molecule by linking the 5'end of the promoter's template strand to the 3'end of the oligodeoxynucleotide tail. Any DNA ligase may be used in the ligation reaction. Preferably, the DNA ligase is a T4 DNA ligase.

The methods of the invention are preferably carried out in the absence of second-strand cDNA synthesis, but those skilled in the art can use random primers to turn the single-stranded promoter template into a double-stranded RNA polymerase promoter. During the conversion, you will recognize that you may optionally synthesize second-strand cDNA. Random primers will be annealed at various positions along the first strand cDNA and will be extended by DNA polymerase during promoter synthesis. In some cases, various second-strand cDNA fragments may be linked together to form a single second-strand cDNA molecule. These second-strand cDNA molecules can also stabilize the first-strand cDNA during in vitro transcription (ie, remove secondary and tertiary structure), resulting in higher yields of sRNA molecules.

After conversion of the single-stranded promoter template to the double-stranded RNA polymerase promoter, in vitro transcription is initiated by the addition of ribonucleotides and RNA polymerase that recognizes the first promoter (see Figure 1d). .. Methods and kits for performing in vitro transcription are well known in the art, and this includes MEGAscript.^TMTransfer Kit (Ambion) and AmpliScribe^TMIncludes high yield transfer kit (Epicentre Technologies, Madison, Wisconsin).

First, as described above, the resulting first cycle sRNA molecule may be subjected to second cycle synthesis by reverse transcribing the sRNA molecule to the first strand cDNA molecule (see Figure 1e). For example, an sRNA molecule produced from a first-strand cDNA primed to oligo dT (ie, a first-period sRNA molecule) will regenerate a poly-A tail at the 3'end, which becomes a second-period oligo dT. It can also act as a priming site for primed first-strand cDNA synthesis. Furthermore, for first-period sRNA molecules produced from randomly primed first-strand cDNA, a 3'poly A tail was added to the sRNA molecule for oligo dT-primed first-strand cDNA synthesis. Alternatively, random primer-mediated reverse transcription may be performed again to produce second-cycle cDNA. Combinations and mixtures of oligo dT and random primers may also be used for second cycle cDNA synthesis.

If the first reverse transcription primer used in FIG. 2a contains a 5'extension containing a particular nucleotide sequence, then the first period sRNA molecule will contain the defined complementary nucleotide sequence at its 3'end. Let's go. Reverse transcription may be initiated with a second reverse transcription primer that contains a nucleotide sequence that is complementary to this defined nucleotide sequence (ie, "corresponding" to a particular nucleotide sequence of 5'extension). See 2e). Only first cycle sRNA molecules containing the defined nucleotide sequences will be reverse transcribed, resulting in fewer non-specific artifacts. Alternatively, the oligo dT and / or random primers (or other suitable primers) used for the first cycle cDNA synthesis may be used to initiate the second cycle reverse transcription.

RNA is degraded with NaOH or preferably RNase H after the second cycle of cDNA synthesis and prior to purification by the case of the first strand cDNA molecule (see Figure 1f). Similarly, RNase H such as MMLV (Promega, Madison, Wisconsin)⁺Reverse transcriptase may be used.

After RNA degradation, a single-stranded promoter oligonucleotide complementary to a second different RNA polymerase recognition sequence is annealed to a second-period cDNA molecule through complementary base pairing (see Figure 1f). This base pairing forms a second RNA polymerase promoter, from which ribonucleotides and RNA polymerases that recognize the second promoter are added to in the second cycle. Initiate in vitro transcription (ie, the second period sRNA molecule) (see Figure 1g). Further cycles of sRNA synthesis may be performed as described by incorporating additional different RNA polymerase recognition sequences within the promoter template (eg, third cycle sRNA molecules). In addition, non-exponential, linear amplification may be maintained by heat inactivating all enzymes between steps or prior to the addition of RNA polymerase using methods well known to those of skill in the art. Such linear amplification is better suited for a variety of downstream applications such as gene expression studies. Unless otherwise stated, it should be understood that all enzymatic activity is terminated either before the next enzymatic manipulation or before the addition of RNA polymerase.

In some embodiments, RNase, rather than inactivating reverse transcriptase after the second cycle of cDNA synthesis and annealing a single-stranded promoter oligonucleotide complementary to a second different RNA polymerase recognition sequence. H is used to degrade RNA components, and excess single-stranded promoter template binds to the 3'end of the second-cycle cDNA molecule, as well as the still active reverse transcriptase DNA-dependent DNA polymerase. The activity regenerates the first double-stranded promoter (see Figure 3f). Then, by adding an RNA polymerase that recognizes either the first or second promoter, the in of the second cycle In vitro transcription may be initiated (see Figure 3g). Again, reverse transcriptase is generally heat-inactivated just prior to the addition of RNA polymerase to maintain the linearity of amplification. Those skilled in the art will recognize that the single-strand promoter template in this embodiment does not need to contain two RNA polymerase recognition sequences in tandem. Rather, the promoter template is a single RNA polymerase recognition sequence that can be used in place of the tandem promoter template in FIGS. 3c and 3f, which is expressly incorporated herein by the applicants. The co-pending U.S. Patent Application No. 10 / 979,052) may be included to produce templates for first and second cycle sRNA synthesis.

The sRNA molecule produced by the methods of the invention may be used directly for any purpose, typically where mRNA is used, for which purposes are gene expression studies, gene cloning, subtractive hybridization, etc. And other techniques well known to those of skill in the art. Preferably, the sRNA molecule is reverse transcribed into the cDNA molecule using random primers, oligo dT primers, or a combination thereof. The reverse transcription reaction may be carried out directly in the presence of detectable labeled nucleotides, such as fluorescently labeled nucleotides. These nucleotides include Cy3 and Cy5 labeled nucleotides.

Alternatively, the cDNA molecule is indirectly labeled. For example, the reverse transcription reaction may be carried out in the presence of biotinylated or aminoallyl nucleotides (eg aminoallyl UTP) and then coupled to NHS ester labels (eg Cy dye). Preferably 3DNA^TMIndirect labeling of cDNA molecules using dendrimer technology (Genisphere, Hatfield, PA). Each dendritic reagent is expressly incorporated herein by reference in its entirety, Nilsen et al., J. Theor. Biol., 187: 273 (1997); Stears et al., Physiol. Genomics, 3:93 (2000). Also described in various US patents such as US Pat. Nos. 5,175,270; 5,484,904; 5,487,973; 6,072,043; 6,110,687; and 6,117,631.

In addition, the sRNA molecule may be used in the cRNA amplification method to produce a labeled antisense RNA (asRNA) molecule. For example, using the method of Eberwine et al. (E.g., Van Gelder et al., Proc. Natl. Acad. Sci. USA 87: 1663 (1990); The sRNA molecule may be reverse transcribed with T7 promoter primers using 5,545,522; 5,716,785; 5,891,636; 5,958,688; and 6,291,170). After second-strand cDNA synthesis, RNA transcription is initiated using T7 RNA polymerase to produce amplified asRNA molecules. These asRNA molecules may be labeled directly during synthesis by incorporating labeled nucleotides (eg Cy-labeled nucleotides), or, for example biomerized or aminoallyl nucleotides (eg aminoallyl UTPs), followed by NHS ester labeling. It may be labeled indirectly by coupling to (eg, Cy dye).

The labeled single-stranded cDNA and asRNA molecule produced from the sRNA molecule of the present invention are useful as reagents for gene expression research. Labeled cDNA and asRNA molecules may be annealed to nucleic acid microarrays (eg, probes) containing complementary polynucleotides. As used herein, a "microarray" is intended to include any solid support containing a hybridization probe, including slides, chips, membranes, beads, and microtiter plates. Examples of commercially available microarrays include GeneChip® Microarrays (Affymetrix, Santa Clara, CA), CodeLink.^TMMicroarrays (Amersham Biosciences, Piscataway, NJ), Agilent (Palo Alto, Calif.) Oligomicroarrays, and OciChip^TMIncludes microarrays (Ocimum Biosolutions, Indianapolis, Indiana).

The methods and compositions of the present invention can be suitably packaged in the form of kits. Such kits may be used in a variety of research and diagnostic applications. For example, using the methods and kits of the invention, different cells or tissues, different subpopulations of the same cells or tissues, different physiological states of the same cells or tissues, different developmental stages of the same cells or tissues, or different different tissues of the same tissue. It is also possible to facilitate comparative analysis of the expression of one or more genes in a cell population. Such analysis can also reveal statistically significant differences in the level of gene expression, which can then be used to facilitate the diagnosis of diverse disease states, depending on the cells or tissues being analyzed. It is also possible to do.

A great variety of kits may be prepared according to the present invention. For example, the kit contains a first RNA polymerase recognition sequence and at least the second different RNA polymerase recognition sequence on the 3'side of the first recognition sequence, a single-stranded promoter template that cannot be extended by DNA polymerase. ; Also may include instructional material for synthesizing sRNA molecules using promoter templates. For further cycles of sRNA synthesis, the kit may further include a single-stranded promoter oligonucleotide complementary to the second RNA polymerase recognition sequence of the promoter template, as well as appropriate instructional material. Instructions for use typically include, but are not limited to, written or printed material. Any medium capable of preserving these usage instructions and communicating them to the end user is intended by the present invention. These media include, but are not limited to, electronic storage media (eg magnetic disks, tapes, cartridges, chips), optical media (eg CDs). ROM) etc. are included. Such media may include addresses to Internet sites that provide such instructional materials.

The kit of the invention may further include one or more of the following components or reagents: reverse transcriptase; RNase inhibitor; enzyme for attaching oligodeoxynucleotide tails onto DNA molecules (eg, Terminal deoxynucleotidyl transferase); Enzyme for attaching oligoribonucleotide tail on RNA molecule (eg Poly A polymerase); Enzyme for converting promoter template to one or more RNA polymerase promoters (eg Clenou) Enzyme); and one or more RNA polymerases (RNase H)⁺, RNase H^-Or both). In addition, the kit includes buffers, primers (eg, oligo dT primers, random primers), nucleotides, labeled nucleotides, RNase-free water, containers, vials, which are compatible with the synthesis of sRNA molecules according to the methods of the invention. Reaction test tubes and the like may be included. The components and reagents may be provided in a container filled with a suitable storage medium.

Here, specific embodiments according to the methods of the invention will be described in the examples below. The examples are exemplary only and are not intended to limit the rest of the disclosure in any way.

Example Example 1 Positive-strand cDNA synthesis The following RNA / primer mixes were prepared on ice for each RNA sample purified using the RNAqueous® Kit (Ambion): 1-8 μl total RNA (does not exceed 2 ng) 2 μl First Period Oligo dT Sequence Specific RT Primer (50 ng / μl) (5'-TAC AAG GCA ATT TTT TTT TTT TTT TTT V-3', where V = C, G or A deoxyribonucleotide; SEQ ID NO: 4 ) 1 μl First Period Random Sequence Specific RT Primer (2x RNA Mass) (5'-TAC AAG GCA ATT NNN NNN NNN-3, where N = Randomly, A, G, C or T Deoxyribonucleotide; Sequence Number 5) 11 μl with RNase-free water The first cycle RT primer contains a 5'extension containing a specific nucleotide sequence that serves as the binding site for the second cycle RT primer (see Figure 2a). The RNA / primer mixture was heated at 80 ° C. for 10 minutes and immediately cooled on ice for 1-2 minutes. The mixture is then mixed with 9 μl of the master mixture solution and 1xRT buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl).₂), 10 mM dithiothreitol (DTT), 0.5 mM dNTP each, 10U Superase-In^TM(Ambion), and 200U Superscript^TM The final volume was 20 μl containing II reverse transcriptase (Invitrogen). The mixture was briefly centrifuged and incubated at 42 ° C for 2 hours. After simple centrifugation, the reaction was adjusted to 100 μl with 1xTE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).

cDNA purification MinElute according to the manufacturer's protocol^TM The reaction was purified using a PCR purification kit (Qiagen). Briefly, the cDNA reaction was adjusted to 600 μl with PB buffer provided by the manufacturer. Min Elute cDNA reaction^TMIt was applied to the column and microcentrifuged for 1 minute. The flow-through in the collection tube was discarded and the column was washed with 750 μl of PE buffer provided to the manufacturer. The flow-through in the collection tube was discarded and the column was washed with 500 μl of 80% ethanol. The flow-through in the collection tube was discarded and the column was microcentrifuged for 5 minutes with the lid open to dry the resin. The column was placed in a clean 1.5 ml microcentrifuge tube and 10 μl of EB buffer provided by the manufacturer and the column membrane were incubated for 2 minutes at room temperature. First-strand cDNA molecules were eluted by microcentrifuge for 2 minutes.

Positive-strand cDNA tail addition The positive-strand cDNA molecule was heated at 80 ° C. for 10 minutes and immediately cooled on ice for 1-2 minutes. The cDNA molecules in 10 μl are then mixed with 10 μl of master mixture solution to 1x tail addition buffer (10 mM Tris-HCl, pH 7.0, 10 mM MgCl).₂), 0.04 mM dATP, and a 15 U-terminal deoxynucleotidyl transferase (Roche Diagnostics, Indianapolis, Indiana) to a final volume of 20 μl. The mixture was briefly centrifuged and incubated at 37 ° C for 2 minutes. The reaction was stopped by heating at 80 ° C. for 10 minutes and cooled at room temperature for 1-2 minutes.

T7 / T3 promoter synthesis 2 μl T7T3 RNA polymerase promoter template (50 ng / μl) containing 3'amino modifier (5'-TAA TAC GAC TCA CTA TAG GGA GAA ATT AAC CCT CAC TAA AGG GAT TTT TTT TTT TTT T-3'; SEQ ID NO: 6) was added to the oligo dT tail-added cDNA molecule, and the mixture was incubated at 37 ° C. for 10 minutes to annealing the strands. This template is non-extensible with DNA polymerase and contains a T7 RNA polymerase recognition sequence and a T3 RNA polymerase recognition sequence immediately 3'to the T7 sequence. The tail-added cDNA / promoter template mixture is then mixed with 3 μl of the master mixture solution to 1x polymerase buffer (10 mM Tris-HCl, pH 7.0, 10 mM MgCl).₂), 0.4 mM dNTPs each, and 2 U of large DNA polymerase I (Klenow enzyme) (Roche) to a final volume of 25 μl. The mixture was briefly centrifuged and incubated at room temperature for 30 minutes. The reaction was stopped by heating at 65 ° C for 10 minutes and placed on ice.

T7 in vitro transcription Half of the promoter synthesis reaction (12.5 μl) is heated at 37 ° C for 10-15 minutes to reanneal the T7T3 promoter chain, and then mixed with 12.5 μl of the master mixture solution, 1x reaction buffer, each. 7.5 mM rNTP and 2 μl T7 RNA polymerase (MEGAscript)^TMThe final volume was 25 μl containing the transfer kit (Ambion). The mixture was briefly centrifuged and incubated at 37 ° C for 4-16 hours in a thermocycler with a heated lid. Alternatively, the mixture was incubated in a hot block at 37 ° C for 15 minutes and then in a hot air hybridization oven at 37 ° C for 4-16 hours. During this process, it is essential to avoid evaporation and concentration of the reaction.

Reverse transcription of sRNA 25 μl of sRNA was mixed with 1 μl of second period sequence-specific RT primers (500 ng / μl) (5'-TAC AAG GCA ATT-3'; SEQ ID NO: 7) and heated at 80 ° C for 10 minutes. .. The second cycle primer contains the nucleotide sequence corresponding to the specific nucleotide sequence of the 5'extension of the first cycle RT primer (see Figure 2e). The reaction was immediately ice-cooled for 2 minutes, briefly centrifuged and returned to ice. 1 μl dNTP mix (10 mM each) and 1 μl Superscript^TM II reverse transcriptase (200 U / μl) was added and the RT reaction was incubated at 42 ° C for 1 hour. 1 μl of RNase H (2 U / μl) (Invitrogen) was added and the reaction was incubated at 37 ° C for 20 minutes. The reaction was incubated at 65 ° C to stop enzyme activity.

T3 promoter formation 2 μl of the T3 promoter oligonucleotide (50 ng / μl) (5'-GAA ATT AAC CCT CAC TAA AGG G-3'; SEQ ID NO: 8) was added to the second cycle cDNA reaction. The T3 oligonucleotide is complementary to the T3 RNA polymerase recognition sequence of the first T7 T3 RNA polymerase promoter template. The reaction was incubated at 37 ° C for 10 minutes to anneal the chains.

T3 in vitro transcription The promoter synthesis reaction was mixed with 19 μl of the master mixture solution, 1x reaction buffer, 7.5 mM rNTPs each, and 2 μl of T3 RNA polymerase (MEGAscript).^TMThe final volume was 25 μl containing the transfer kit (Ambion). The mixture was briefly centrifuged and incubated at 37 ° C for 4-16 hours in a thermocycler with a heated lid. Alternatively, the mixture was incubated in a hot block at 37 ° C for 15 minutes and then in a hot air hybridization oven at 37 ° C for 4-16 hours. During this process, it is essential to avoid evaporation and concentration of the reaction.

sRNA purification and quantification Second cycle sRNA molecules were purified using the RNeasy kit (Qiagen) according to the manufacturer's protocol for RNA purification. Purified sRNA molecules were eluted twice in 50 μl RNase-free water and quantified by UV spectrophotometry at a wavelength ratio of 260/280 in 0.1xTE buffer, pH 8.0.

Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 25 μg of amplified sRNA was recovered, whereas 0.5-4 μg of non-specific amplification when water alone was used in the reverse transcription reaction instead of RNA. The product was recovered.

Example 2 Each RNA sample was amplified as described in Example 1, except that only oligo dT sequence-specific primers were used for first cycle cDNA synthesis. The following RNA / primer mix was prepared on ice: 1-8 μl total RNA (does not exceed 2 ng) 2 μl First Period Oligo dT Sequence Specific RT Primer (50 ng / μl) (5'-TAC AAG GCA ATT TTT TTT TTT TTT TTT V-3', where V = C, G or A; SEQ ID NO: 4) 11 μl with RNase-free water Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 8-10 μg of amplified sRNA was recovered, whereas 0.5-4 μg of nonspecific when only water was used in the reverse transcription reaction instead of RNA. Amplification product was recovered.

Example 3 Each RNA sample was amplified as described in Example 1, except that only random sequence-specific primers were used for first cycle cDNA synthesis. The following RNA / primer mix was prepared on ice: 1-8 μl total RNA (does not exceed 2 ng) 1 μl First Period Random Sequence Specific RT Primer (2x RNA Mass) (5'-TAC AAG GCA ATT NNN NNN NNN-3, where N = Randomly, A, G, C or T; SEQ ID NO: 5 ) 11 μl with RNase-free water Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 20-25 μg of amplified sRNA was recovered, whereas 0.5-4 μg of nonspecific when only water was used in the reverse transcription reaction instead of RNA. Amplification product was recovered.

Example 4 In the cDNA tail addition step with TdT, dTTP was used in place of dATP, and the corresponding 3'amino-modified T7T3 RNA polymerase promoter template used was 5'-TAA TAC GAC TCA CTA TAG GGA GAA ATT AAC CCT CAC. Each RNA sample was amplified as described in Example 1, except that it was TAA AGG GAA AAA AAA AAA AAA A-3'(SEQ ID NO: 9).

Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 60-70 μg of amplified sRNA was recovered, whereas 2-8 μg nonspecific when only water was used in the reverse transcription reaction instead of RNA. Amplification product was recovered. It is less desirable to have more non-specific amplification products, but certain applications such as subtractive cloning and others well known to those of skill in the art are not negatively affected by non-specific products. , And in fact, it may be easier to carry out because both ends of the product have the same elongation (poly dA).

Example 5 Each RNA sample was amplified as described in Example 1, except that 3'terminal ribonucleotide sequence-specific primers were used in place of the primers consisting exclusively of deoxyribonucleotides for first cycle cDNA synthesis. .. The following RNA / primer mix was prepared on ice: 1-8 μl total RNA (does not exceed 2 ng) 2 μl First Period Oligo dT Sequence Specific RT Primer (50 ng / μl) (5'-TAC AAG GCA ATT TTT TTT TTT TTT TTT V-3', where V = C, G or A ribonucleotide; SEQ ID NO: 10 ) 1 μl 1-period random sequence-specific RT primer (2x in RNA mass) (5'-TAC AAG GCA ATT NNN NNN NNN-3, where the first 8 N = randomly, A, G, C or T deoxyribonucleotide, and last N = randomly, A, G, C or U ribonucleotide; SEQ ID NO: 11) 11 μl with RNase-free water Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average, 20 μg of amplified sRNA was recovered, whereas 0.2-0.5 μg of nonspecific when water alone was used in the reverse transcription reaction instead of RNA. The amplified product was recovered.

Example 6 MinElute^TM Each RNA sample was amplified as described in Example 5, except that first cycle cDNA purification was performed using a YM100 microconcentrator (Millipore, Villa Rica, Mass.) Instead of the PCR purification kit. .. A 100 μl diluted reverse transcriptase was applied to the sample storage vessel. The tube lid was closed tightly and the device was centrifuged at 13,000 xg for 6 minutes. 200 μl of 1xTE buffer, pH 8.0, was added to the sample storage vessel without touching the membrane. The liquid was gently mixed by pipetting up and down 5 times. The lid was closed tightly and the device was centrifuged at 13,000 xg for 6 minutes. The sample storage vessel was separated from the collection tube and the flow-through was discarded. The YM-100 column was placed in the same collection test tube and 200 μl of 1xTE buffer was added to the sample storage vessel without touching the membrane. The liquid was gently mixed by pipetting up and down 5 times. The lid was closed tightly and the device was centrifuged at 13,000 xg for 6 minutes. The sample storage vessel was separated from the collection tube and the flow-through was discarded. The YM-100 column was placed in the same collection test tube and 5 μl of 10 mM Tris, pH 8.0 was added to the sample storage vessel without touching the membrane. The liquid was mixed by gently tapping the sides of the storage container. The sample storage vessel was placed upside down in a new collection tube and all aggregates were centrifuged at 13,000 xg for 3 minutes. The volume of cDNA collected at the bottom of the test tube was about 5 μl, which was diluted to 10 μl with RNase-free water.

Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 40-50 μg of amplified sRNA was recovered, whereas when water alone was used in the reverse transcription reaction instead of RNA, 0.2-0.5 μg of non-RNA was recovered. The specific amplification product was recovered.

Example 7 Each RNA sample was amplified as described in Example 5, except that the cDNA purification step was omitted, thus avoiding further loss of cDNA in the process. Since the terminal ribonucleotide on the 3'end of the reverse transcription primer is enzymatically inextensible with the terminal deoxynucleotidyl transferase, the cDNA purification step may be omitted. Only the 3'end of the newly synthesized cDNA is extended at TdT. The following RNA / primer mix was prepared on ice: 1-3 μl total RNA (does not exceed 2 ng) 2 μl First Period Oligo dT Sequence Specific RT Primer (50 ng / μl) (5'-TAC AAG GCA ATT TTT TTT TTT TTT TTT V-3', where V = C, G or A ribonucleotide; SEQ ID NO: 10 ) 1 μl 1-period random sequence-specific RT primer (2x in RNA mass) (5'-TAC AAG GCA ATT NNN NNN NNN-3, where the first 8 N = randomly, A, G, C or T deoxyribonucleotide, and last N = randomly, A, G, C or U ribonucleotide; SEQ ID NO: 11) RNase water-free to 5 μl The RNA / primer mixture was heated at 80 ° C. for 10 minutes and immediately cooled on ice for 1-2 minutes. The mixture is then mixed with 5.5 μl of the master mixture solution to 1xRT buffer (50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl).₂), 10 mM dithiothreitol (DTT), 0.5 mM dNTP each, 10U Superase-In^TM(Ambion), and 200U Superscript^TM The final volume was 10.5 μl containing II reverse transcriptase (Invitrogen). The mixture was briefly centrifuged and incubated at 42 ° C for 2 hours. It was then tail-added to the positive-strand cDNA molecule and further processed as described in Example 1.

Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 55-60 μg of amplified sRNA was recovered, whereas when water alone was used in the reverse transcription reaction instead of RNA, 0.2-0.5 μg of non-RNA. The specific amplification product was recovered.

Example 8 Each RNA sample as described in Example 7, except that the reverse transcriptase was not heat-inactivated after the second cycle cDNA synthesis and no T3 promoter oligonucleotide was added to the second cycle cDNA reaction. Was amplified. Rather, the excess T7T3 promoter template from the first-cycle promoter synthesis reaction binds to the 3'end of the second-cycle cDNA molecule, and the DNA-dependent DNA polymerase activity of the reverse transcriptase, which is still active, is the T3 sequence. Allows regeneration of the double-stranded T7 promoter adjacent to (see Figure 3f).

After first-cycle sRNA synthesis as described in Example 1, 25 μl of sRNA was added to 1 μl of second-cycle sequence-specific RT primers (500 ng / μl) (5'-TAC AAG GCA ATT-3'; SEQ ID NO: 7). Was mixed with and heated at 80 ° C. for 10 minutes. The reaction was immediately ice-cooled for 2 minutes, briefly centrifuged and returned to ice. 1 μl dNTP mix (10 mM each) and 1 μl Superscript^TM II reverse transcriptase (200 U / μl) was added and the RT reaction was incubated at 42 ° C for 1 hour. 1 μl of RNase H (2 U / μl) (Invitrogen) was added and the reaction was incubated at 37 ° C for 30 minutes. The reaction was incubated at 65 ° C to stop enzyme activity. Then, as described in Example 1, in vitro transcription with T7 polymerase and sRNA purification and quantification were performed.

Replica amplification was performed starting from 1 ng of total RNA or water only (negative control). After amplifying 1 ng of total RNA, on average 90-100 μg of amplified sRNA was recovered, whereas when water alone was used in the reverse transcription reaction instead of RNA, 0.2-0.5 μg of non-RNA was recovered. The specific amplification product was recovered.

Example 9 Design tail addition method 1 for use with most spotted microarrays and with standard labeling methods used in other gene expression assays (eg, qRT-PCR). Affymetrix GeneChip® Microarray, Amersham CodeLink^TMMicroarrays, Agilent oligo microarrays, and OciChip^TMDesign tail addition method 2 for use in downstream T7 amplification / labeling methods, such as those recommended for microarrays.

Poly A tail addition method 1 The desired volume of the purified second cycle sRNA molecule was adjusted to 15.5 μl with nuclease-free water. For each tail addition reaction, 10 mM ATP was diluted 1:50 in 1 mM Tris, pH 8.0 for each 1 μg of sRNA during the reaction. Poly A polymerase (PAP) (2U / μl) in 1xPAP buffer (10 mM Tris-HCl, pH 7.0, 10 mM MgCl)₂) Diluted 1: 5 and placed on ice until use. The sRNA solution was mixed with 9.5 μl of master mixture solution to a final volume of 25 μl containing 1xPAP buffer, 2.5 mM MnCl, 0.2 mM ATP (per 1 μg of sRNA), and 0.4 U poly A polymerase. The mixture was gently mixed, centrifuged and incubated for 15 minutes in a heat block at 37 ° C. The reaction was stopped by adding 3 μl of 0.5 M EDTA. R Easy Min Elute according to the manufacturer's protocol for RNA purification^TMTail-added sRNA molecules were purified using the kit (Qiagen) and eluted in 14 μl RNase-free water. The recovered volume was approximately 12 μl.

Poly A tail addition method 2 Ideally, 250-500 ng of second period sRNA is used for this poly A tail addition method. However, it is not always possible to quantify sRNA from very small sample sizes. Therefore, the table below may be used to determine the amount of purified sRNA to be used in the poly A-tail addition reaction:

<tables num="1"><img file="JP5118025B2_D0001.tif" /></tables>

^*Sufficient amounts of sRNA must be available to confirm concentration via OD 260/280 measurements. The appropriate volume of purified second period sRNA molecules was adjusted to 15.5 μl with nuclease-free water. For each tail addition reaction, 10 mM ATP was diluted 1: 100 in 1 mM Tris, pH 8.0. PAP (2 units per microliter) was diluted 1: 5 in 1xPAP buffer and placed on ice until use. The sRNA solution was mixed with 9.5 μl of master mixture solution to a final volume of 25 μl containing 1xPAP buffer, 2.5 mM MnCl, 0.2 mM ATP (per 1 μg of sRNA), and 0.4 U poly A polymerase. The mixture was gently mixed, centrifuged and incubated for 15 minutes in a heat block at 37 ° C. The reaction was stopped by adding 3 μl of 0.5 M EDTA. R Easy Min Elute according to the manufacturer's protocol for RNA purification^TMTail-added sRNA molecules were purified using the kit (Qiagen) and eluted in 14 μl RNase-free water. The recovered volume was approximately 12 μl.

Example 10 A kit for multicycle sRNA synthesis was assembled with the following components: First period oligo dT sequence-specific RT primer (50 ng / μl); First period random sequence-specific RT primer (250 ng / μl); dNTP mix (10 mM dATP, dCTP, dGTP, dTTP each); Superase-In^TM RNase inhibitor (Ambion); 10mM dATP; 10x reaction buffer (100 mM Tris-HCl, pH 7.0, 100 mM MgCl₂); Terminal deoxynucleotidyl transferase (7.5 U / μl); T7T3 RNA polymerase promoter template (50 ng / μl); Klenow enzyme (2U / μl); rNTP mix (ATP, GTP, CTP, and UTP) (75 mM each); 10x RNA polymerase reaction buffer (Ambion); T7 Enzyme Mix (Ambion); Second period sequence-specific RT primer (500 ng / μl); T3 promoter oligonucleotide (50 ng / μl); and T3 enzyme mix (Ambion).

The components were placed in numbered vials and placed in containers, along with a printed instruction manual for multi-cycle sRNA synthesis using the kit components. All publications cited herein, both patented and non-patented publications, are indicators of the skill level of one of ordinary skill in the art to which the present invention belongs. All of these publications are fully incorporated herein to the same extent as the individual publications are specifically and individually indicated to be incorporated herein.

Although the invention described herein has been described in connection with certain aspects, it is understood that these aspects are merely exemplary of the principles and applications of the invention. Therefore, it is understood that many modifications may be made to the exemplary embodiments and other arrangements may be devised without departing from the spirit and scope of the invention as defined by the claims. It shall be done.

<figref num="1-1">1a to 1g are schematic views showing aspects according to the method of the present invention.</figref><figref num="1-2">1a to 1g are schematic views showing aspects according to the method of the present invention.</figref><figref num="2-1">2a to 2g are schematic views showing a second aspect according to the method of the present invention.</figref><figref num="2-2">2a to 2g are schematic views showing a second aspect according to the method of the present invention.</figref><figref num="3-1">3a to 3g are schematic views showing a third aspect according to the method of the present invention.</figref><figref num="3-2">3a to 3g are schematic views showing a third aspect according to the method of the present invention.</figref>