Two-step hybridization and capture of a polynucleotide

<u style="single">Technical field of invention</u>The present invention relates to a method for capturing polynucleotides that may be present in a sample on a solid support. The present invention is particularly useful for separating the target polynucleotide from other components in the sample, and is preferably used as part of a diagnostic method for detecting the presence of the target polynucleotide in the sample. ..<u style="single">Background of the invention</u>The target polynucleotide is a polynucleotide present in the sample that can be purified from one or more sample components and / or its presence can be detected using different techniques. Is. Such techniques are typically performed as part of a diagnostic method that detects the presence of a target polynucleotide indicating the presence of an infectious pathogen or pathogenic condition. The presence of the target polynucleotide base sequence region present in the target polynucleotide may be detected by various methods such as those using a nucleic acid probe that hybridizes to the target sequence. The probe may be designed to detect different target sequences, such as those characteristic of microbial, viral, human genes, plant or animal genes, and / or pathogenic conditions. Techniques for purifying target polynucleotides are often used in diagnostic methods, including capturing the target polynucleotide on a solid support. The solid support retains the target polynucleotide during one or more washing steps of the target polynucleotide purification process. Ranki et al., US Pat. No. 4,486,539 describes a hybridization sandwich technique for capturing and detecting the presence of a target polynucleotide. The technique includes the capture of a target polynucleotide by a probe bound to a solid support and the hybridization of a detection probe to the captured target polynucleotide. Detection probes that do not hybridize to the target polynucleotide are easily flushed from the solid support. Therefore, the remaining label is bound to the target polynucleotide that was originally present in the sample. Stabinsky et al., US Pat. No. 4,751,177 describes a method using a mediating polynucleotide that hybridizes to both a target polynucleotide and a polynucleotide immobilized on a solid support. The mediating polynucleotide joins the target polynucleotide to a solid support to produce a binding target. The labeled probe may hybridize to the binding target and the unbound labeled probe may be flushed from the solid support. Englehardt et al., US Pat. Nos. 4,894,324 and 5,288,609 describe methods for detecting target polynucleotides. The method utilizes two single-stranded polynucleotide moieties complementary to the same or opposite strands as the target and causes the formation of a double hybrid with the target polynucleotide. In one embodiment, the dual hybrid may be captured on the support. Cape et al., EP Patent Publication No. 0 370 694 describes methods and kits for nucleic acid detection using solid phase capture means. The method uses oligonucleotide primers labeled with a specific binding partner to immobilize the primers and primer extension products. The label forms a complex specifically with its receptor bound to a solid support.<u style="single">Outline of the invention</u>A method of capturing a target polynucleotide present in a sample according to one aspect of the invention: a mixture comprising a target polynucleotide, a capture probe, and a fixed probe is composed of a capture probe and a target polynucleotide. Capture probe: Convenient for formation of target hybridization complex, and fixed probe composed of fixed probe and capture probe: Incubation under the first hybridization condition, which is not convenient for formation of capture probe hybridization complex. The mixture is then incubated under a second hybridization condition that is convenient for the formation of a fixed probe: capture probe hybridization complex, whereby the fixation consisting of a fixed probe, a captured probe and a target polynucleotide. Probe: Capture The method is disclosed, which comprises the step of capturing the target polynucleotide in the target hybridization complex. In one embodiment, the first incubation step is the capture probe: T of the target hybridization complex._mLower and fixed probe: T of capture probe hybridization complex_mHigher temperatures are used, and the second incubation step is the T of the fixed probe: capture probe hybridization complex._mUse a lower temperature. Preferably, the second incubation step is achieved by lowering the temperature of the first hybridization condition by at least about 10 ° C, or at least about 20 ° C. In one embodiment, the first incubation step uses a temperature of about 60 ° C, and the second incubation step uses a temperature of about 40 ° C or lower. The method may also include the step of purifying the fixed probe: capture probe: target hybridization complex. Another aspect of the method involves detecting the target polynucleotide in a fixed probe: capture probe: target hybridization complex by hybridizing the labeled probe to the target polynucleotide and detecting the labeled probe. included. The method may also include the step of amplifying the target polynucleotide, preferably by transcription-related amplification, to produce an amplified nucleic acid. When an amplification step is involved, the method also involves detecting the amplified nucleic acid, preferably hybridizing the labeled probe to the amplified nucleic acid that is complementary to the target polynucleotide, and detecting the labeled probe. Including, said steps may also be included. The method may also include a step of removing unhybridized labeled probes during the detection step. In a preferred embodiment, both incubation steps use a fixed probe that includes a capture probe binding region of at least a 5 nucleotide base recognition group and a capture probe that contains a fixed probe binding region of at least a 5 nucleotide base recognition group. Included, however, the capture probe binding region is complementary to the fixed probe binding region. Preferably, the capture probe binding region is: To a first backbone containing at least one sugar-phosphodiester bond, or at least one peptide nucleic acid group, at least one phosphorothioate bond, or a combination thereof, and (b) a first skeleton. Containing at least 10 nucleotide base recognizing groups to be linked, where each nucleotide recognizing group is capable of hydrogen bonding with adenine, guanine, cytosine, timine, uracil or inosin; and fixed probe binding regions: (a). ) A second skeleton containing at least one sugar-phosphodiester bond, or at least one peptide nucleic acid group, at least one phosphorothioate bond, or a combination thereof, and (b) nucleotide base recognition linked to the first skeleton. It contains at least 10 nucleotide base recognition groups linked to a second skeleton capable of hydrogen bonding to the group. In one embodiment of the method, the capture probe binding region consists of a homopolymer containing at least 10 nucleotides, and the fixed probe binding region is a homopolymer containing at least 25 nucleotides, of which at least 10 nucleotides are capture probes. It consists of the homopolymer that is complementary to the 10 nucleotides of the binding region. Preferably, the capture probe binding region comprises about 14 contiguous A or T bases, and the fixed probe binding region comprises a complementary sequence of about 30 bases. In a preferred embodiment, the incubation step uses a mixture of fixed and capture probes, where each probe comprises a deoxynucleotide, ribonucleotide, 2'-methoxy-substituted nucleotide, 2'-halo-substituted nucleotide component, or a combination thereof. .. (a) A second backbone containing at least one sugar-phosphate diester bond, or at least one peptide nucleic acid group, at least one phosphorothioate bond, or a combination thereof, and (b) a nucleotide linked to the first backbone. It contains at least 10 nucleotide base recognizing groups linked to a second backbone capable of hydrogen bonding to the base recognizing group. In one embodiment of the method, the capture probe binding region consists of a homopolymer containing at least 10 nucleotides, and the fixed probe binding region is a homopolymer containing at least 25 nucleotides, of which at least 10 nucleotides are capture probes. It consists of the homopolymer that is complementary to the 10 nucleotides of the binding region. Preferably, the capture probe binding region comprises about 14 contiguous A or T bases, and the fixed probe binding region comprises a complementary sequence of about 30 bases. In a preferred embodiment, the incubation step uses a mixture of fixed and capture probes, where each probe comprises a deoxynucleotide, ribonucleotide, 2'-methoxy-substituted nucleotide, 2'-halo-substituted nucleotide component, or a combination thereof. .. (a) A second backbone containing at least one sugar-phosphate diester bond, or at least one peptide nucleic acid group, at least one phosphorothioate bond, or a combination thereof, and (b) a nucleotide linked to the first backbone. It contains at least 10 nucleotide base recognizing groups linked to a second backbone capable of hydrogen bonding to the base recognizing group. In one embodiment of the method, the capture probe binding region consists of a homopolymer containing at least 10 nucleotides, and the fixed probe binding region is a homopolymer containing at least 25 nucleotides, of which at least 10 nucleotides are capture probes. It consists of the homopolymer that is complementary to the 10 nucleotides of the binding region. Preferably, the capture probe binding region comprises about 14 contiguous A or T bases, and the fixed probe binding region comprises a complementary sequence of about 30 bases. In a preferred embodiment, the incubation step uses a mixture of fixed and capture probes, where each probe comprises a deoxynucleotide, ribonucleotide, 2'-methoxy-substituted nucleotide, 2'-halo-substituted nucleotide component, or a combination thereof. .. Another aspect of the invention is a method of determining the presence of a target polynucleotide in a sample. The method: provides a capture probe capable of hybridizing to a target polynucleotide present in the sample; hybridization of the capture probe to the target polynucleotide with a sample suspected of containing the target polynucleotide. Mix at the first incubation temperature to help, thereby producing a capture probe: target polynucleotide complex; providing a fixed probe capable of hybridizing with the capture probe; capture probe: target polynucleotide complex and fixation. The probe is incubated at a second incubation temperature that aids in hybridization of the fixed probe and the captured probe, thereby producing a captured target polynucleotide, including the fixed probe: capture probe: target polynucleotide complex; captured. Purify the target polynucleotide, thereby producing a purified target polynucleotide; amplify the purified target polynucleotide, thereby producing an amplified nucleic acid; and detect the amplified nucleic acid to detect the presence of the target polynucleotide in the sample. Including the decision stage. In one embodiment of the method, the detection step comprises hybridizing the labeled probe to an amplified nucleic acid complementary to the target polynucleotide or a portion thereof and detecting the labeled probe.<u style="single">Brief description of the figure</u>Figures 1A and 1B show targets labeled "(c)" using a fixed probe labeled "(a)" and a capture probe labeled "(b)" attached to solid support 10. Schematically illustrates the use of two different hybridization conditions to capture a polynucleotide. In FIG. 1A, the first hybridization condition allows hybridization of the capture probe (b) and the target polynucleotide (c) to form the capture probe: target polynucleotide complex 15, but the capture probe (b). And does not allow hybridization of the fixed probe (a). In FIG. 1B, the second hybridization condition allows hybridization of the capture probe (b) and the fixation probe (a) to form the fixation probe: capture probe: target polynucleotide complex 20. FIG. 2 illustrates steps A through F of a method involving amplification of a captured target polynucleotide sequence (step (A)) using transcription-related amplification (steps (B) to (F)). In FIG. 2, step (A), the fixed probe (a), capture probe (b), and target polynucleotide sequence (c) bound to the solid support 10 are shown as shown in FIG. The promoter sequence recognized by RNA polymerase is indicated by "P"; "(-)" indicates the 5'end of the nucleic acid, and "(+)" indicates the 3'end of the complementary nucleic acid; and the dash. "(---)" indicates nucleic acid polymerization. 3A, 3B and 3C show the fixed probe (a), capture probe (b), attached to the solid support 10 for detecting the presence of the target polynucleotide (c), as shown in FIG. And the use of two different hybridization conditions with the labeled probe labeled "(d)" is illustrated. In FIG. 3A, the first hybridization condition allows the formation of a capture probe: target polynucleotide: labeled probe complex 30. In FIG. 3B, the second hybridization condition allows the formation of a fixed probe: capture probe: target polynucleotide: labeled probe complex 40, leaving the unbound labeled probe 50. In FIG. 3C, the unbound labeled probe has been washed away, leaving the purified fixed probe: capture probe: target polynucleotide: labeled probe complex 40. Figure 4 shows T₁₄An example of a solid support 10 with a bound fixed probe consisting of an array is illustrated; the upper probe (with "(a)" on the right) is T.₁₄A with complementary fixed probe₁₄Capture probe containing sequence (3'A₁₄Hybridized to TTTGTCAGTAACCTTGATTCATCAAG5'(SEQ ID NO: 1) (indicated as ":" between bases), fixed probe: in capture probe complex; central probe ("(b)" adjacent to right side ) Contains a fixed probe hybridizing to a capture probe hybridizing to a target sequence (5'CAGTCATTGGAACTAAGTAGTTC3' (SEQ ID NO: 2)) in a larger sequence (indicated by the terminal "NNNNNN" sequence). , Fixed probe: Capture probe: in the target polynucleotide complex; and the lower probe (adjacent to "(c)" on the right) is a non-hybridized fixed T₁₄It is a probe.<u style="single">Detailed description of the invention</u>The present invention features a method of capturing a target polynucleotide on a solid support using a capture probe and two different hybridization conditions. Different hybridization conditions are used to regulate the order of hybridization in a sample containing a target polynucleotide mixed with a capture probe and a fixed probe. Hybridization condition means that one single-stranded nucleic acid is hydrogen-bonded to a second single-stranded nucleic acid to produce a hybridization complex (sometimes referred to herein as a complex). Means the cumulative environment used for the reaction. Cumulative environments include, for example, the concentration and components of aqueous or organic solutions containing single-stranded nucleic acids (eg, salts, chelating and non-competitive inhibitor nucleic acids), and the temperature of the reaction mixture. Other factors that may contribute to the cumulative environment include, for example, the length of time that hydrogen bonds occur, the physical shape of the chamber that holds the reactants, and the use of mixing or stirring during hybridization. Is included. All of these environmental conditions are well known in the art (eg Sambrook et al., Molecular Cloning, A Laboratory Manual 2).^nd ed. (See Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). In the present invention, the first hybridization condition facilitates hybridization of the capture probe to the target polynucleotide, while essentially interfering with the hybridization of the capture probe and the fixed probe, and the second hybridization condition. It then facilitates hybridization of the capture probe and the fixation probe. The fixed probe provides a means for connecting the capture probe to the fixed support. A fixed probe is a base sequence recognition molecule linked to a solid support, facilitating the separation of bound target polynucleotides from unbound components. Any known solid support may be used, such as matrix and free particles in solution. For example, the solid support may be nitrocellulose, nylon, glass, polyacrylic acid, mixed polymers, polystyrene, silane polypropylene, and preferably magnetically attractable particles. A particularly preferred support is a magnetic sphere, which is monodisperse (ie, uniform in size at about ± 5%), thereby providing constant results and particularly useful for use in automated assays. The fixed probe is directly or indirectly linked to the solid support by stable binding or interaction during the first and second hybridization conditions used in the present invention. Direct linking occurs when the fixed probe molecule is linked to a solid support in the absence of intermediate groups. For example, direct linking may be via covalent, chelating, or ionic interactions. Indirect ligation occurs when the fixed probe is ligated to a solid support by one or more linkers. "Linker" means a means of binding at least two different molecules into a stable complex, and includes one or more components of a binding partner set. Members of the combined partner set are capable of recognizing and combining with each other. Binding partner sets include, for example, receptors and ligands, enzymes and substrates, enzymes and cofactors, enzymes and coenzymes, antibodies and antigens, sugars and lectins, biotins and streptavidins, ligands and chelating agents, nucleic acids and histidines, substantially. It may be a nucleotide base recognition molecule complementary to, and a complementary homopolymeric nucleic acid or a homopolymer portion of the polymerized nucleic acid. The components of a bond partner set are the areas of members involved in the bond. The method of the present invention has many different aspects. In one, the linker connects directly to the solid support and then to the fixed probe through the components of the binding pair set. In other embodiments, there is more than one linker, the first linker is directly linked to the solid support, and at least one second linker is linked to the fixed probe through the components of the binding pair set. Additional linkers may be used to link the first and second linkers. A "base sequence recognition molecule" is a polymer containing a nucleotide base recognition group, which is bound together by a skeleton. Nucleotide base recognition groups provide sequence information for hybridizing with complementary molecules. Individual nucleotide base recognizing groups are capable of hydrogen bonding with adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U) or derivatives thereof. The backbone of the base sequence recognition molecule provides nucleotide base recognition groups in the correct orientation and spacing, especially for hydrogen bonding during hybridization to nucleobases. The base sequence recognition molecule may be, for example, RNA, DNA, peptide nucleic acid, or a derivative thereof. The capture probe provides a means for stable ligation of the target polynucleotide and the fixed probe. The capture probe contains one or more sequence recognition portions: a target polynucleotide binding region and a fixed probe binding region. These two binding regions may be present on one or more base sequence recognition molecules, but are preferably contained in a single base sequence recognition molecule containing two binding regions. In other embodiments, the capture probe comprises a target polynucleotide binding region and a fixed probe binding region that are present on two different nucleotide sequence recognition molecules that are linked together by one or more linkers. For example, the fixed probe binding region may be on the first sequence recognition molecule, the target polynucleotide binding region may be on the second sequence recognition molecule, and two different molecules. Is linked by a linker, which is a base sequence recognition molecule that hybridizes to the first and second base sequence recognition molecules. The present invention includes a method of capturing a target polynucleotide present in a sample. First, a mixture containing a sample, a capture probe and a fixed probe is produced, and then incubated under the first hybridization conditions to form a capture probe: labeled complex composed of the capture probe hybridized to the target polynucleotide. To do. The first hybridization condition is the capture probe: T of the target complex._mLower and fixed probe: T of capture probe hybrid_mUse a higher temperature. Preferably, under the first hybridization condition, at least less than 50% of the capture probe is in the fixed probe: capture probe complex. More preferably, under the first hybridization conditions, less than 25%, even more preferably less than 10%, and most preferably less than 1% of the capture probe is in the fixed probe: capture probe complex. Then, using the second hybridization condition, a fixed probe: capture probe: target polynucleotide complex composed of a fixed probe hybridized with a capture probe hybridized with the target polynucleotide is formed. The temperature of the second hybridization condition is the T of the fixed probe: capture probe hybridization complex._mLower and therefore suitable for the formation of fixed probe: capture probe complexes. Preferably, the fixed probe is in excess compared to the capture probe. "T_m"" Refers to the melting temperature at which 50% of the hybridization complex formed between two nucleotide sequence recognition molecules denatures. T_mAt lower temperatures, hybridization complex formation is assisted, while T_mAt higher temperatures, complex formation is not assisted. T of a hybridization complex containing a capture probe or a fixed probe_mWith respect to, complex formed through hybridization with one or more linkers that may be present. If a linker is present, the T of the hybridization complex_mReflects the overall stability of the complex, as easily calculated by those skilled in the art. For example, in a capture probe composed of three oligonucleotides, the first T that hybridizes the first oligonucleotide to the second oligonucleotide._m, And a second T in which the second oligonucleotide hybridizes to the third oligonucleotide._mThere is. These first and second T_mThe lower one determines the stability of the capture probe and whether the three oligonucleotides that make up the capture probe continue to hybridize under specific hybridization conditions. Capture probe: The target polynucleotide hybridization complex, like the other complexes described herein, may contain additional groups in addition to the components shown. These additional groups include, for example, labeled probes that hybridize to the target polynucleotide, or target-hybridized oligonucleotides that are useful for amplifying the target polynucleotide. There may also be additional groups that do not affect the functioning of the present invention. Labeled probes are nucleotide sequence recognition molecules that contain detectable groups. The detectable group may be, for example, a fluorescent moiety, a chemically emitting moiety, a radioactive isotope, biotin, avidin, an enzyme or enzyme substrate, or a reactive group. The method of the present invention may further include a purification step. "Purification" means removing one or more components of a sample before purification from one or more other components of the sample. Sample components include nucleic acids, and may also contain components such as proteins, carbohydrates, lipids and labeled probes. Preferably, the purification step removes at least about 70%, more preferably at least about 90%, and even more preferably at least about 95% of the non-target nucleic acid present in the sample. The methods of the invention may also include capturing, followed by amplification of the purified target polynucleotide (referred to herein as the "captured target") to produce an amplified nucleic acid. Targeted nucleic acid amplification uses a nucleic acid polymerase to produce multiple copies of the total target polynucleotide or fragment thereof, or a nucleic acid complementary to the total target polynucleotide or fragment thereof. Suitable amplification techniques well known in the art include, for example, transcription-related amplification, polymerase chain reaction (PCR), replicase-mediated amplification, and ligase chain reaction (LCR). Amplification of "a fragment thereof" refers to the production of an amplified nucleic acid containing less than a full-length target polynucleotide or complement thereof. Such fragments may also be produced by amplifying a portion of the target polynucleotide, for example, by using an amplified oligonucleotide that hybridizes to the inner portion of the target polynucleotide and initiates polymerization from there. Good. Preferably, the amplified fragment comprises a detectable target sequence. The presence of the amplified nucleic acid may be detected using a different well-known technique, such as hybridizing a labeled probe to the amplified nucleic acid. Other techniques well known in the art for detecting nucleic acids include, for example, gel filtration, gel electrophoresis, and high performance liquid chromatography (HPLC). A labeled probe may be used to detect the presence of a purified capture label. Preferably, a purification step is used to remove the unbound probe from the bound labeled probe hybridized to the captured target polynucleotide. The purification step may be used at the same time as the purification of the captured target polynucleotide. Alternatively, the labeled probe may be added to the purification capture target polynucleotide and the unbound labeled probe may be removed in the subsequent purification step. With respect to sample or hybridization reaction components (eg, unbound labeled probes, etc.), "removal" means that at least 70% of the undesired components are separated from the retained components. More preferably at least 90% of the undesired components, and even more preferably at least 95%, are removed. The components may be removed using standard treatments, such as by using a cleaning treatment. The presence of the captured target polynucleotide may be detected using a homogeneous detectable label that may be located on the capture probe or on another detection probe. "Homogeneous detectable label" refers to a label capable of detecting its presence in a homogeneous manner based on whether the label is on a molecule hybridized to a target polynucleotide. Therefore, a homogeneous detectable label can be detected without physically removing the hybridized form from the non-hybridized form of the label. Homogeneous detectable labels are already described in the examples of Arnold et al., U.S. Pat. No. 5,283,174; Woodhead et al., U.S. Pat. No. 5,656,207; and Nelson et al., U.S. Pat. No. 5,658,737. The stationary probe may include one or more repeat base sequences that are complementary to one or more repeat base sequences of the capture probe. These complementary repeats are preferably sequences of at least 5 bases in length and serve as binding regions (ie, the capture probe binding region of the fixed probe and the fixed probe binding region of the capture probe). Complementary repeats of fixed and captured probes facilitate hybridization between the two probes. A "repeated" sequence is a sequence of regularly repeating base sequences, such as polyadenylation (A)._n), Polytimine (T_n), Polycitosine (C_n), And polyguanine (G)_n) Nucleic acid homopolymers, etc. Repeated sequences also have AT repeats ([AT]_n), Etc., a nucleic acid mixed polymer is also included. Preferably, the repetitive sequence of the capture probe is longer than the complementary repetitive sequence of the fixed probe. The length of the complementary repeats of the two probes is the fixed probe: T of the capture probe complex._mTo decide. The longer the repetitive sequence of the capture probe, the easier it is to bind the fixed probe to the repetitive sequence. This is because the added length provides a distance from the secondary structure of the target polynucleotide that would otherwise interfere with hybridization to the fixed probe. Preferably, the repetitive base sequence of the fixed probe is at least about 10 bases in length, even more preferably about 14 bases; and the repetitive base sequence of the complementary capture probe is at least about 10 bases in length, more preferably. Is at least about 14 bases, even more preferably at least about 25 bases in length, and most preferably about 30 bases in length. The method of the invention is used to determine if the target polynucleotide is present in the sample. The method comprises a target capture step involving two hybridizations, a purification step, an amplification step if desired, and a detection step. In the presence of the target polynucleotide, in the first hybridization, a capture probe: target polynucleotide complex is produced, and in the second hybridization, the fixed probe hybridizes with the capture probe. Thus, in the presence of the target polynucleotide, the target capture step results in the formation of a fixed probe: capture probe: target complex that includes a fixed probe, a captured probe, and the target polynucleotide. In the absence of the target polynucleotide, this fixed probe: capture probe: target complex is not formed, and only the fixed probe: capture probe complex of the second hybridization is formed. The complex formed during the target capture step is purified to produce a purified target polynucleotide for the sample containing the target polynucleotide. Purified target polynucleotides may be amplified and subsequently detected, or purified target polynucleotides may be detected without an amplification step. Preferably, the presence of a purified capture target polynucleotide or amplified nucleic acid is detected using a labeled probe. More preferably, the labeled probe hybridizes to the target polynucleotide and has a T above the temperature of the first hybridization condition._mLabeled probe with: forms a target polynucleotide complex. Detection of labeled probes in the complex indicates the presence of the target polynucleotide in the sample. When any amplification step is included in the method, it amplifies the purified target polynucleotide to produce an amplified nucleic acid, which is then labeled as described above using a labeled probe, or any known variety of nucleic acids detected. Detection by technique (eg, visualization with an intercalating agent). Detection of amplified nucleic acid indicates that the target polynucleotide was initially present in the sample. Rather than binding the capture probe to a solid support to maximize the concentration of the free capture probe during hybridization of the capture probe to the target polynucleotide and to take advantage of the preferred liquid phase hybridization kinetics known to those of skill in the art. It is useful to put it in a solution. That is, solution phase hybridization generally occurs 100 times faster than solid phase hybridization using the same complementary binding sequence. It is also desirable to add a fixed probe prior to hybridization of the capture probe to the target polynucleotide to minimize the number of reagent additions and separations and the complexity of the chemical reaction. These aspects of the invention are of particular importance for automated assays. In a method of the invention that captures a target polynucleotide on a solid support using a capture probe and two different hybridization conditions, the solid support, including the fixed probe, the capture probe, and the target nucleic acid hybridize both. It may be present in the condition. The target nucleic acid captured from the other component may be purified by washing away the other components present using conditions that retain the capture target. Then capture probe: T of the fixed probe complex_mPurified target polynucleotides may be eluted from the solid support under suitable conditions, such as by incubating at a higher temperature. These methods are particularly useful as part of a diagnostic assay that amplifies the target polynucleotide and produces larger amounts of free amplified nucleic acid in solution. Amplified nucleic acids in solution may be detected using well-known techniques such as nucleic acid hybridization. An automated diagnostic assay using the methods of the invention, eg: (1) a sample suspected of having a target polynucleotide is added to a vessel containing a target-specific capture probe and a fixed probe linked to a solid support. (2) By performing two-step hybridization and incubating under the first hybridization condition, and then lowering the temperature to that of the second hybridization condition, the target polynucleotide is placed on the solid support. Captured; (3) sample components that are not bound to the solid support are removed, for example by using a washing step; (4) oligonucleotides used in nucleic acid amplification of all or part of the target, amplification. A solution containing a suitable solution component, and a probe that hybridizes to the amplified nucleic acid and contains a homogeneous detectable label, is added to the solid support; (5) to produce the amplified nucleic acid; and (6) the sample. This may be done by detecting the amplified nucleic acid, such as by processing and producing a signal from a label hybridized to the amplified nucleic acid. Detection of the signal indicates the presence of the target polynucleotide in the sample. Based on the disclosure provided herein, different modifications of the above plan may be made. FIGS. 1-3 provide schematic illustrations of the use of the invention to capture the target polynucleotide, optionally amplify the polynucleotide target, and detect the presence of the polynucleotide target. Although FIGS. 1 to 3 illustrate preferred embodiments, those skilled in the art may also use other modifications and equivalents to carry out the described inventions based on the description provided herein. You will recognize that. FIG. 4 shows an example of the types of complexes that can be attached to a solid support via a fixed probe that is a homopolymer. Figures 1A and 1B illustrate the capture of target polynucleotides. At the start of the assay, the fixed probe (a) is attached to the fixed support particle 10, and the capture probe (b) and target polynucleotide (c) are free in solution. Referring to FIG. 1A, under the first hybridization condition, the capture probe: target polynucleotide complex 15 is formed in solution, but the capture probe (b) is substantially bound to the fixed probe (a). Absent. The reaction is then incubated under second hybridization conditions, as shown in FIG. 1B. In the second hybridization condition, the capture probe (b) hybridizes to the fixed probe (a), thereby capturing the target polynucleotide (c) in the fixed probe: capture probe: target nucleic acid complex 20. .. Preferably, the second hybridization condition occurs in the same solution by lowering the temperature from the first hybridization condition. Specific examples of complexes capable of binding to a solid support via a fixed probe are illustrated in FIG. FIG. 2 illustrates yet one embodiment comprising amplification of the target polynucleotide sequence (c) using transcription-related amplification. The 5'and 3'ends of the nucleic acid are indicated by (-) and (+) on the right side of the figure, next to the row representing the nucleic acid, respectively; using this notation, they are indicated as "(-)". The strands indicate the antisense strand, and the strands marked "(+)" indicate the sense strand. A dash (---) with an arrow ( or ) at the end indicates nucleic acid polymerization of the complementary strand of nucleic acid. In FIG. 2, step (A) is a captured target poly as described in FIG. 1B, which hybridizes to an oligonucleotide containing the promoter sequence "P" and forms the nucleic acid hybridization complex 22. Nucleotide (c) is illustrated. Complementary DNA is synthesized using a polymerase such as reverse transcriptase (indicated by ---). In step (B), the (-) strand hybridizes to primer 24 and uses reverse transcriptase to polymerize (indicated by ---) to form the DNA duplex 23 containing the duplex promoter P. .. In step (B), complex 23 is shown free in solution, but does not need to be separated from solid support 10. Creation of (-) strands capable of hybridizing with Primer 24 may be accomplished using different techniques well known in the art, such as by using a denaturing step or RNase H activity. Preferably, if the target is an RNA polynucleotide, use RNase H activity. FIG. 2, steps (C) to (E) exemplify the production of amplified nucleic acid from the product of step (B). Multiple sense RNA transcripts are produced using RNA polymerases such as T7 RNA polymerase (step (C)), to which primer 24 can bind due to primer extension (step (D)). The dash in step (D) illustrates primer extension. Primer 24, sometimes referred to as the promoter primer, may be added prior to initiation of amplification. During steps (C) to (F), the (-) strand is made available for hybridization to promoter primer 24. Figure 2, steps (D) through (F) exemplify the use of promoter primers to form a double-stranded promoter, which is recognized by RNA polymerase and used to produce additional RNA transcripts. The transcript produced may be used for other amplification cycles (indicated by the left arrow in Figure 2, connecting steps (F) and (C)). The amplification steps are described in more detail below "Transfer-related amplification". Figures 3A-3C illustrate the capture and detection of the target polynucleotide (c) using the labeled probe (d). At the start of the assay, the reagent mixture contains a fixed probe (a) bound to the solid particle 10, a capture probe (b), a target polynucleotide (c), and a labeled probe (d) free in solution. As shown in FIG. 3A, under the first hybridization conditions, a capture probe: target polynucleotide: labeled probe hybridization complex 30 is formed in solution. The capture probe (b) shown in FIG. 3A consists of a linker 31 linked to a first nucleotide sequence recognition polynucleotide 33 and a second nucleotide sequence recognition polynucleotide 35. The first sequence recognition polynucleotide 33 comprises the target polynucleotide binding region 32, and the second sequence recognition polynucleotide 35 comprises the fixed probe binding region 34. As shown in FIG. 3B, under the second hybridization condition, the capture probe: target polynucleotide: labeled probe hybridization complex 30 hybridizes to the fixed probe (a), whereby the fixed probe: capture probe. : Target polynucleotide: Produces labeled probe complex 40 (ie, binding labeled probe). This complex 40 is formed when the fixed probe (a) hybridizes with the fixed probe binding region 34. The second hybridization condition may be achieved by lowering the temperature of the first hybridization condition. With reference to FIG. 3C, a wash step may be used to remove the unbound labeled probe (unpresented) from the bound labeled probe (d) present in the complex 40 bound to the solid support 10. Detection of the binding labeled probe (d) indicates that the target polynucleotide was initially present in the sample. Figure 4 shows T₁₄An example of a solid support 10 to which a fixed probe shown as a sequence is attached is illustrated. The upper fixed probe (marked (a) on the right) is T₁₄The probe is 3'A₁₄Complementary A of capture probe shown as TTTGTCAGTAACCTTGATTCATCAAG5'(SEQ ID NO: 1)₁₄It hybridizes to the sequence (indicated as an interbase ":") and is shown in the fixed probe: capture probe complex. The central fixed probe (marked (b) on the right) hybridizes the components of the fixed probe: capture probe complex to the complementary target sequence shown as 5'CAGTCATTGGAACTAAGTAGTTC3' (SEQ ID NO: 2). Fixed probe: Capture probe: Shown in the target polynucleotide complex, including with the 5'region of the capture probe. The exemplified target sequence is an internal sequence as indicated by the terminal "NNNNNN" sequence. The bottom fixed probe (marked (c) on the right) is not hybridized.<u style="single">Nucleotide sequence recognition molecule</u>The base sequence recognition molecule contains sequence information that allows hybridization to a fully complementary nucleic acid under appropriate reaction conditions. "Sufficiently complementary" is a contiguous nucleobase sequence that can hybridize to a base sequence recognition molecule (eg, another contiguous nucleobase sequence) by hydrogen bonding between complementary bases. Means the nucleic acid base sequence. Complementary base sequences may be complementary at each position of the base sequence recognition molecule using standard base pairing (eg, G: C, A: T or A: U pairing). Alternatively, the complementary sequence may contain one or more residues (including non-basic "nucleotides") that are not complementary using standard hydrogen bonds, but the entire complementary sequence may contain. Under appropriate hybridization conditions, it is possible to specifically hybridize with a nucleotide sequence recognition molecule. Appropriate hybridization conditions are well known to those of skill in the art and can be easily predicted based on the sequence composition or can be empirically determined using conventional testing (conventional tests). For example, Sambrook et al., Molecular Cloning, A Laboratory Manual 2^nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) §§1.90-1.91,7.37-7.57,9.47-9.51 and 11.47-11.57, especially §§9.50-9.51,11.12-11.13,11.45-11.47 , 11.55-11.57). These sequence recognition molecules may contain additional groups that do not provide sequence information. The additional group, if present, does not interfere with the hybridization of the sequence recognition molecule to a fully complementary nucleic acid under the reaction conditions. The base sequence recognition molecule contains a nucleotide base recognition group linked together by a skeleton. Nucleotide base recognizing groups can hydrogen bond to nucleotide nitrogenous bases present in nucleic acids. The skeleton provides the proper conformation and spacing, allowing the group to hydrogen bond to the nucleotides of the nucleic acid. The default nucleotide base recognizing group may be complementary to a particular nucleotide (eg, A, G, C, T, and U) and is therefore capable of hydrogen bonding to the nucleotide present in the nucleic acid. You may. Nucleotide base recognizing groups may also be capable of hydrogen bonding with different nucleotides. For example, when inosine is a nucleotide base recognizing group, it can hydrogen bond with U, A, or C. Preferred nucleotide base recognizing groups are nitrogenous purine or pyrimidine bases, or derivatives thereof, capable of hydrogen bonding to any of A, G, C, T, U or inosine (I). Examples of base recognizing groups include A, G, C, T, U or I, and derivatives thereof. An example of a derivative is N⁴-Methyldeoxyguanosine, deaza-or aza-purine and deaza- or aza-pyrimidine used in place of natural purine and pyrimidine bases, pyrimidine bases with substituents at the 5 or 6 position, and at the 2, 6 or 8 position Included are modified purine or pyrimidine bases, such as purine bases with modified or replaced substituents. These derivatives and their synthesis are well known in the art (see Cook, PCT International Publication No. WO 93/13121). Further examples are 2-amino-6-methylaminopurine, O⁶-Methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, O⁴-Alkyl-pyrimidines, and others known to the art. The backbone of the nucleotide sequence recognition molecule may be composed of different groups or bonds known in the art. Preferably, the scaffold comprises one or more sugar-phosphate diester bonds, one or more peptide nucleic acid scaffold groups, one or more phosphorothioate bonds, or a combination thereof. Structure I exemplifies a sugar-phosphodiester type skeletal group, and the sugar group is a pentoflanosyl group. Glycosyls are linked together by phosphodiester bonds or other suitable bonds.<img file="JP4222635B2_D0001.tif" />With reference to structure I, X represents the group that connects the two sugars. An example of X is -P (O)₃-, -NHP (O)₃-, -OCOO-, -OCH₂CONH-, -OCH₂Includes COO- and -OCONH-. As with the other examples provided herein, other equivalents well known in the art may also be used, based on the disclosure provided. Y₁And Y₂Is an independently selected group. Y₁And Y₂Examples are H, OH, alkoxy, halogen, and C containing up to 4 carbon atoms.₁-C₄Includes alkyl. Preferably Y₁And Y₂Independently, H, OH, F or OCH₃Is one of. base₁(Base₁) And bases₂(Base₂) Is an independently selected nucleotide base recognition group. Preferably the base₁And bases₂Are independently A, G, C, T, U or inosine (I). R₁And R₂Are independently selected groups, additional sugar-phosphodiester type groups, peptide nucleic acids, and non-basic "nucleotides" (including phosphodiester skeletons, but lacking nucleotide base recognizing groups). Represents a group that may contain moieties that do not provide sequence information, such as polymers such as polyethylene glycols, polysaccharides, polypeptides, peptides and other non-nucleotide bonds. Other types of non-nucleotide linkers are well known (see Arnold et al., US Pat. No. 5,585,481). Derivatives of structure I, which may be components of nucleotide sequence recognition molecules, are well known in the art, such as molecules having different types of sugars in their skeletons. For example, a base sequence recognition molecule may have a cyclobutyl moiety linked by a binding moiety, where the cyclobutyl moiety has a heterocyclic base attached to it (eg, Cook et al., PCT International Publication No. WO 94 / See issue 19023). Other types of skeletons of nucleotide sequence recognition molecules are peptide-type bonds, such as those present in peptide nucleic acids. "Peptide nucleic acids" are as previously described (Hyrup and Nielsen, 1996, Bioorg. &amp; Med.Chem.4: 5-23; Hydig-Hielsen et al., PCT International Publication No. WO 95/32305), DNA analogs in which the deoxyribose phosphate backbone was replaced by a pseudopeptide backbone. Point to. Preferably, the peptide nucleic acid is composed of N- (2-aminoethyl) glycine units, as exemplified in Structure II, where R.₁, R₂And bases₁Is similar to that described in Structural Type I Compounds.<img file="JP4222635B2_D0002.tif" />Base sequence recognition molecules may be produced using known methods such as standard organic synthesis methods for producing oligonucleotides and modified oligonucleotides (eg, Eckstein, F., Oligonucleotides and Analogues, a Practical Approach, Chapters1- 5,1991; Caruthers et al., Meth. In Enzymol., Vol.154, p.287,1987; Bhatt, US Pat. No. 5,252,723; Klem et al., PCT International Announcement WO 92/07864; Cook et al., PCT International Announcement WO 93/13121; Miller et al., PCT International Announcement WO 94/15619; McGee et al., PCT International Announcement WO 94/02051; Cook et al., PCT International Announcement WO 94/19023; Hyrup et al., Bioorg .Med.Chem.4: 5-23, 1996; and Hydig-Hielsen et al., PCT International Announcement WO 95/32305; Ordoukhanian et al., Nuc.Acids Res.25 (19): 3783-3786, 1997; Myer et al., Bioconjug.Chem.7 (4): 401-412,1996; Shultz et al., Nuc.Acids Res.24 (15): 2966-2973,1996; Woo et al., Nuc. Acids Res. 24 (13): 2470-2475, 1996; Agris et al., Biochimie 77: 125-134, 1995; Berressem et al., Nuc. Acids Res. 23 (17): 3465-3472, 1995; Seela et al., Nuc.Acids Res.23 (13): 2499-2505, 1995; Vinayak et al., Nuc.Acids Symp.Ser.33: 123-125,1995; Limbach et al., Nuc.Acids Res.22 (12): 2183-2196,1994; Gryaznov et al., Nuc.Acids Res.20 (8): 1879-1882,1992; Kawana et al., Nuc.Acids Symp.Ser.25: 93-94,1991; Pfleiderer et al., Nuc.Acids Symp.Ser.24: 29-32,1991; Wagner et al., Nuc.Acids Res.19 (21): 5965-5971,1991; Marquez et al., Nuc.Acids Symp.Ser.22: 35-36,1990; Lin Et al., Nuc.Acids Res.17 (24): 10373-10383,1989; Farrance et al., Anal.Biochem.179 (1): 60-65,1989; Gildea et al., Nuc.Acids Res.17 (6): 2261 -2281,1989; Yeung et al., Nuc.Acids Res.16 (10): 4539-4554,1988; Pon et al., Nuc.Acids Res.13 (18): 6447-6465,1985; .12 (19): 7435-7453,1984; see Schinazi et al., J. Med. Chem. 21 (11): 1141-1146, 1978). Preferred nucleotide sequence recognition molecules are independent: (i) a skeleton containing at least one sugar-phosphate diester type group, at least one peptide nucleic acid group, at least one phosphorothioate group, or a combination thereof, and (ii) skeleton. Includes an independently selected nucleotide base recognizing group capable of hydrogen bonding to A, G, C, T, U or I linked to. The nucleotide sequence recognition molecule may include selected components, which are deoxynucleotides, ribonucleotides, 2'-methoxy-substituted ribonucleotides, or 2'-halo-substituted ribonucleotides. Preferably, one or more of the mentioned components are at least about 70%, more preferably at least about 80%, even more preferably at least about 90%, and most preferably about 100% of the sequence recognition molecules. To configure.<u style="single">Fixation to solid support</u>Sequence recognition molecules may be linked to different types of supports by various known means to form fixed probes. Covalent attachment of oligonucleotides synthesized using standard chemical techniques to solid supports has already been described (Lund et al., Nuc. Acids Res. 16: 10861-10880, 1988; European Patent Application Publication No. 0444120. issue). A particularly preferred solid support is magnetically attractable particles, which are separated because they can be attracted to the reaction vessel position and retained in place while the unbound solution components are washed away. Useful for the stage. Magnetically attractable particles may be produced using standard techniques or may be obtained from available commercial sources.<u style="single">T</u>_{<u style="single">m</u>}<u style="single">And hybridization conditions</u>The method of the present invention changes the hybridization conditions to regulate the timing of formation of a capture probe: target complex and a fixed probe: capture probe complex. The ability of two sequence recognition molecules to hybridize depends on the structure and the surrounding reaction environment. The reaction environment includes the composition and temperature of the solution containing two or more recognition molecules. Using a particular assay composition, the hybridization complex has a T of the assay temperature complex._mWhen higher, it is not stable. Solution factors well known in the art, such as salt concentration and the presence of denaturants, are the T of the given complex._mMay affect. The two nucleotide sequence recognition molecules that make up the hybridization complex are suitable for use in the present invention, based on the description provided herein and well-known techniques in the art._mIt may be constructed to have properties (eg Sambrook et al., Molecular Cloning, A Laboratory Manual 2).^nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) §§1.90-1.91,7.37-7.57,9.47-9.51 and 11.47-11.57, especially §§9.50-9.51,11.12-11.13,11.45-11.47 , 11.55-11.57). Hybridization complex stability is influenced by the length and degree of complementarity between the two sequence recognition molecules, the nucleotide sequence recognition group, and the backbone of the sequence recognition molecule. For example, the T of a complex formed between two nucleotide sequence recognition molecules._mCan be lowered by constructing the molecules so that they have less than 100% complementary internal regions of each other. This may be achieved by mismatching, or by including linker components such as non-nucleotide linkers and non-basic "nucleotides". Linker components may be placed in the opposite position of the base in the opposite strand, or chain or al "bulge (bulge)" out, thereby may reduce complex stability. The type of nucleotide base recognizing group present on the opposite strand will also affect the stability of the probe hybridization complex. For example, G: C pair formation is stronger than A: T pair formation because hydrogen bonds in G: C pairs are increased compared to A: T pairs. The skeletal components of the nucleotide sequence recognition molecule may be adjusted in different ways to affect the stability of the hybridization complex. Preferred skeletons are peptide bonds, such as those present in peptide nucleic acids, and sugar-phosphate diester-type bonds, such as those present in ribonucleic acids and deoxyribonucleic acids, or derivatives thereof. Peptide nucleic acids generally form a more stable complex with RNA than the corresponding DNA sequence. More preferably, the backbone is composed of glycosyl-phosphodiester type bonds, in which both the sugar group and the bond attached to the group can affect complex stability. For example, the effect of sugar may be shown with a 2'-methoxy-substituted RNA group, where the hybridization complex formed between the 2'-methoxy-substituted RNA and the complementary 2'OH RNA corresponds. It is generally more stable than the DNA: RNA complex. 2'-fluorosubstituted RNA has essentially the same kind of effect on complex stability as 2'-methoxy substituted RNA. Bonds linking two glycosyl groups can affect hybridization complex stability by affecting the overall charge or charge density, or by affecting the conformation between the two molecular components. is there. Three-dimensional interactions due to bulging bonds result in "bulging" that reduces complex stability. Binding to a charged group (eg, phosphorothioate) or a neutral (eg, methylphosphonate) group can affect complex stability. T_mMay be predicted using standard calculations and measured using routine testing techniques well known in the art. Such methods are described, for example, by Sambrook et al., Molecular Cloning, A Laboratory Manual 2.^nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) §§1.90-1.91,7.37-7.57,9.47-9.51 and 11.47-11.57, especially §§9.50-9.51,11.12-11.13,11.45-11.47 , 11.55-11.57, and Hogan et al., US Pat. No. 5,547,842. In the first hybridization solution of the preferred embodiment of the present invention, the capture probe: T of the target polynucleotide complex._mIs a fixed probe: T of the capture probe complex_mMore preferably at least about 5 ° C, more preferably at least about 10 ° C, even more preferably at least about 20 ° C, and most preferably at least about 25 ° C, higher.<u style="single">Changes in hybridization conditions</u>A preferred method of changing hybridization conditions is by changing the temperature of the hybridization solution containing the assay composition. Temperature changes can be easily achieved without the addition of reagents to the solution, and are therefore more suitable for automation. The automated assay is a preferred embodiment of the present invention. Preferably, the second hybridization condition sets the first hybridization condition at least about 10 ° C, more preferably at least about 15 ° C, even more preferably at least about 20 ° C, and most preferably at least about. Achieved by lowering by 25 ° C. However, the second hybridization condition was achieved using any known method of reducing the stringency of the hybridization condition, such as by increasing the ionic strength of the solution or by diluting the solution with a denaturant. You may.<u style="single">amplification</u>Amplification increases the copy number of the target polynucleotide. The amplification conditions are suitable for nucleic acid polymerization, and by using at least one nucleic acid polymerase, a nucleic acid chain complementary to the nucleic acid template is produced. Amplification conditions include one or more enzymes, amplified oligonucleotides, nucleoside triphosphate substrates, buffers, and incubation at the appropriate temperature. Specific conditions are well known in the art and depend on the type of nucleic acid amplification used.<u style="single">enzyme</u>Nucleic acid polymerases suitable for performing nucleic acid amplification methods are readily commercially available or can be isolated and purified. Such polymerases include, for example, Escherichia coli DNA polymerase I, Bacillus stearothermophilus DNA polymerase I, B. caldotenex DNA polymerase I, T4 DNA polymerase and Taq polymerase. Includes DNA-dependent DNA polymerase. Other suitable enzymes are DNA-dependent RNA polymerases, such as, for example, T7 RNA polymerase, T3 RNA polymerase, and SP6 RNA polymerase. Suitable enzymes also include RNA-dependent DNA polymerases, such as, for example, trimyeloblastosis virus (AMV) reverse transcriptase and Molonee murine leukemia virus (MMLV) reverse transcriptase. Amplification may also be achieved using a replicase (eg, Qβ replicase), ligase (eg, E. coli DNA ligase and T4 DNA ligase) or a combination of enzymes.<u style="single">Amplified oligonucleotide</u>An "amplified oligonucleotide" is an oligonucleotide that hybridizes to a target nucleic acid or complement thereof and participates in an amplification reaction. Examples of amplified oligonucleotides include primers and promoter primers. The choice of amplified oligonucleotide depends on the amplification method used and the nucleic acid being amplified. Certain amplified oligonucleotides may be readily designed and synthesized by one of ordinary skill in the art, depending on the desired target nucleic acid sequence and the amplification method selected by the practitioner of the invention. Examples of commonly used amplified oligonucleotides include those that are similar or complementary to the nucleotide sequence and may optionally contain nucleic acid sequence regions that are not complementary to the target nucleic acid, if desired. For example, the amplified oligonucleotide may contain a promoter sequence recognized by RNA polymerase or a base sequence recognized by a replicase. Similar amplified oligonucleotides include regions that are capable of hybridizing to nucleic acids that are perfectly complementary to the region of the target nucleic acid (eg, cDNA when the target nucleic acid is RNA). Similar oligonucleotides may hybridize to complementary nucleic acids at positions near the 3'end of the complementary target sequence. Similar oligonucleotides may also include one or more modifications, such as non-complementary regions such as the promoter sequence region and / or modifications that inhibit nucleic acid polymerase activity. Preferably, the similar oligonucleotide is at least about 10 contiguous bases, and more preferably at least about 12 contiguous bases, said base complementary to the nucleic acid that is completely complementary to the region of the target nucleic acid. Including. Consecutive bases are preferably at least about 80%, more preferably at least about 90%, and most preferably about 100% complementary to the region of the target nucleic acid sequence. Similar oligonucleotides are preferably about 12-60 nucleotide bases in length and may optionally contain modified nucleotide bases. Amplified oligonucleotides complementary to the template have regions capable of hybridizing to the target nucleic acid at the 3'end of the target sequence. Oligonucleotides complementary to the template may include non-complementary regions, such as the 5'end promoter region. Preferably, the target-complementary oligonucleotide comprises at least about 10 contiguous bases, more preferably at least about 12 contiguous bases, which are complementary to the region of the target nucleic acid sequence. Consecutive bases are preferably at least about 80%, more preferably at least about 90%, and most preferably about 100% complementary to the region of the target sequence. Oligonucleotides complementary to the template are preferably about 12-60 bases in length and may include modified nucleotides. A "primer" is an optionally modified oligonucleotide that can hybridize to a template and can be efficiently extended in known polymerization reactions at the 3'end. Refers to an oligonucleotide having. The 5'region of the primer does not have to be complementary to the target nucleic acid. If the non-complementary region at the 5'end contains a promoter sequence, it is referred to as a "promoter primer". Primers or promoter primers may be similar or complementary to the target nucleic acid.<u style="single">Transcription-related amplification</u>Transcription-related amplification uses RNA polymerase to produce multiple RNA transcripts from nucleic acid templates. Transcription-related amplification generally uses RNA polymerase, DNA polymerase, deoxyribonucleoside triphosphate, ribonucleoside triphosphate, and promoter template complementary oligonucleotides. Often similar oligonucleotides are also used. Different variations of transcription-related amplification are well known in the art. Examples of different variations using different reaction conditions and different numbers and types of amplified oligonucleotides are Burg et al., U.S. Pat. No. 5,437,990; Kachan et al., U.S. Pat. Nos. 5,399,491 and 5,554,516; Kachan et al., PCT International Publication No. WO 93/22461; Gingeras et al., PCT International Publication No. WO 88/01302; Gingeras et al., PCT International Publication No. WO 88/10315, Malek et al., US Pat. No. 5,130,238; Urdea et al., US Pat. No. 4,868,105 and No. 5,124,246; McDonough et al., PCT International Announcement No. WO 94/03472; and Ryder et al., PCT International Announcement WO 95/03430, detailed. Briefly, in general, transcription-related amplification uses promoter-template complementary oligonucleotides, which are recognized by RNA polymerase to form double strands (in Figure 2A, " Includes a 3'sequence region capable of hybridizing to the template nucleic acid at the 3'position of the target sequence (shown as P') and (as shown in FIG. 2A). Promoter template After hybridization of complementary oligonucleotides and templates, a double-stranded promoter is formed upstream of the template. Double-stranded promoters are formed by primer extension of polymerase-mediated promoter template complementary oligonucleotides to produce target complementary strands (see Figure 2A) and then similar oligonucleotides (eg, FIG. 2B). Hybridization of primers 24) and primer extension of similar oligonucleotides may be performed (see Figure 2B). Other known techniques are suitable, such as those involving primer extension of the target nucleic acid to form the double-stranded promoter. Transcription-related amplification proceeds by binding an enzyme with RNA polymerase activity to the promoter region and synthesizing a single-stranded RNA transcript in the 5'to 3'direction (see Figure 2C). Multiple RNA transcripts (eg, about 100 to 3,000) may be produced by transcription-related amplification using a single template (eg, by repeating FIGS. 2C-2F). In a preferred embodiment of the invention, a transcription-related amplification method using RNase H activity is used for target amplification. This produces large amounts of single-stranded amplified nucleic acid under essentially constant reaction conditions. More preferably, RNase H activity is supplied by reverse transcriptase.<u style="single">Other amplification methods</u>Other well-known amplification methods may be used in the amplification steps of the methods of the invention, including replicase-mediated amplification, polymerase chain reaction (PCR), and ligase chain reaction (LCR). Replicase-mediated amplification uses self-replicating RNA molecules and replicases such as QB replicases (see, eg, Kramer et al., US Pat. No. 4,786,600; PCT International Publication No. WO 90/14439). PCR amplification is well known, and DNA polymerase, primers and thermal cycles are used to synthesize multiple copies of two complementary strands of DNA or RNA (eg, Mullis et al., US Pat. No. 4,683,195, 4,683,202). No. 4,800,159; see Methods in Enzymology, 1987, Vol.155: 335-350). The LCR uses at least four separate oligonucleotides to amplify the target and its complementary strands by using multiple cycles of hybridization, ligation, and denaturation (see European Patent Application Publication No. 0 320 308). I want).<u style="single">Detection of target polynucleotide</u>The presence of the target polynucleotide may be detected using a different technique that uses a detection probe and / or detects the amplified nucleic acid. Preferably, the target polynucleotide is detected using a target polynucleotide or an amplification product of the target polynucleotide, particularly a labeled probe that hybridizes to an amplification nucleic acid complementary to the target polynucleotide. Labeled probes may contain different types of labels, and different techniques may be used to detect the labels. For example, well-known probe labels include radioisotopes, fluorescent moieties, chemiluminescent moieties, and catalytic groups (eg, enzymes that cause color changes and participate in reactions). Examples of the production and / or use of such labeled probes are Sambrook et al., Molecular Cloning, A Laboratory Manual 2^nded. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989), Chapter 10; Nelson et al., U.S. Pat. No. 5,658,737; Woodhead et al., U.S. Pat. No. 5,656,207; Hogan et al., U.S. Pat. No. 5,547,842; Arnold. Et al., US Pat. No. 5,283,174; Kourilsky et al., US Pat. No. 4,581,333; and Becker et al., European Patent Application Publication No. 0 747 706. The labeled probe may hybridize to the target polynucleotide, amplified nucleic acid, or intermediate molecule that hybridizes directly or indirectly to the target polynucleotide or amplified nucleic acid. Indirect hybridization may be achieved by using a plurality of intermediate molecules that hybridize together. Amplified nucleic acids may be detected using labeled probes or using other well-known methods of detecting nucleic acids. For example, the amplified nucleic acid may be labeled during amplification with a labeled precursor or after amplification with a fluorescent insert (eg, ethidium bromide). Well-known methods such as gel filtration, gel electrophoresis, and HPLC may be used to detect labeled amplified nucleic acids. The following examples illustrate some preferred embodiments of the invention, but one of ordinary skill in the art will recognize that the methods of the invention may be performed equivalently with other reagents and reaction conditions. .. Example 1: T by varying the complementary length_mAdjustment of Hybridization complex T_mOne way to adjust is to change the complementary length between the two nucleic acids that make up the complex. In this example, T due to complementary length differences in the complex._mIllustrate the changes in. Hybrids were formed between the first and second oligonucleotide chains. The first chain is 40 deoxythymidine (dT)₄₀) Homopolymer, and the second chain is a different sized deoxyadenosine (dA)_n) Was a homopolymer. These oligonucleotides were synthesized using standard nucleic acid synthesis methods. 20 μl of 2X hybridization buffer (200 mM lithium succinate (pH 5.1-5.2), 17% lithium lauryl sulfate (LLS), 3 mM ethylenediaminetetraacetic acid (EDTA)), and 3 mM ethylene glycol N in both chains (350 pmol each). , N, N', N'-tetraacetic acid (EGTA)) were mixed in a volume of 40 μl and heated at 55 ° C for 30 minutes. Each complex was then diluted to 300 μl with 1X hybridization buffer (ie, half the concentration of 2X hybridization buffer). By detecting a hyperchromatic shift in this solution, T_mWas measured. Briefly, the absorbance at 260 nm was measured during increasing changes in the temperature of the reaction mixture, and a shift in the absorbance of the solution was detected over that temperature range. T_mIs the temperature at the midpoint of the absorbance shift. Table 1 shows dA_nThe length is dA₁₀From dA₄₀The results of the hybridization complex vary over the range of.<img file="JP4222635B2_D0003.tif" />As can be seen from these results, as the complementary length increases, the T of the complex_mAlso increased. Longer hybridization complexes (eg dA₃₀: dT₄₀) Is compared because of the potentially many types of hybridization complexes present in the mixture due to offset pairing (eg, 30-mer, 29-mer, 28-mer, etc.). Tends to have a broader absorbance shift. Combinations of homopolymers that give rise to shorter hybridization complexes (eg, dA capable of forming up to 15-mer complexes)₁₅: dT₄₀) Is T, which is lower than about 60 ° C_mHad. Fixed poly dT bound to magnetic beads in solution₁₄Or dT₃₀100 μg probe³²P-labeled dA₃₀This property was further investigated by incubation with a capture probe of 2.5 pmol. The reaction is placed in hybridization buffer (3 mM EDTA, 3 mM EGTA, 17% LLS, 190 mM succinic acid, 250 mM lithium hydroxide, pH 5.1 ± 0.1) at 60 ° C or room temperature (about 25 ° C) for 30 minutes. Incubation was repeated 5 times for each hybridization condition. At room temperature, dT₁₄And dT₃₀Labeled dA that hybridizes to the probe₃₀The average percentage of probes is 90% and 88%, respectively, and at 60 ° C, dT₁₄And dT₃₀Labeled dA that hybridizes to the probe₃₀The average percentage of probes was 61% and 1%, respectively. These hybridization properties were utilized in a two-step hybridization assay in which fixed probes were present in hybridization conditions at two different temperatures, as shown in the following examples. Example 2: Two-step hybridization This example illustrates a two-step hybridization method that uses two hybridization temperatures to achieve target polynucleotide capture. In one assay condition, the capture probe, target polynucleotide and fixed probe co-existed in the mixture through both hybridization conditions. In other assays, in the first hybridization condition, the capture probe hybridized to the target polynucleotide before adding a fixed probe. The coexisting mixture of the first assay is beneficial because it requires fewer reagent addition steps, but by adding a separate fixed probe, it is more than that seen in two-step hybridization performed in the coexisting mixture state. In general, a signal that was about twice as high was produced. Capture probe oligonucleotides and acridinium ester (AE) -labeled target polynucleotides were synthesized and detected using standard techniques. These techniques are described by Sambrook et al., Molecular Cloning, A Laboratory Manual 2^nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Chapter 10; Nelson et al., U.S. Pat. No. 5,658,737; Woodhead et al., U.S. Pat. No. 5,656,207; Hogan et al., U.S. Pat. No. 5,547,842; and Known to the art, as described in US Pat. No. 5,283,174, Arnold et al. First, in a 1X hybridization buffer (see Example 1) containing or not containing 100 μg of a poly T-fixed probe bound to Seradyn magnetic beads, a capture probe (1.25 pmol) and an AE-labeled target polynucleotide. Incubation was performed at 60 ° C. for 30 minutes, and then the temperature was changed to room temperature for 30 minutes. For samples incubated at 60 ° C. without a fixed probe bound to the beads, this component (in 50 μl of 1X hybridization buffer) was added at the start of the second incubation. Both samples were kept at the same volume by adding 50 μl of 1X hybridization buffer to the assay already containing the fixed probe. The fixed probe is a dT attached to a solid support that is a magnetic bead.₁₄Or dT₃₀It was a homopolymer of. The capture probe has a base sequence complementary to the sequence in the target polynucleotide (Neisseria gonorrhoeae 16S rRNA sequence) and dA.₁₅Or dA₃₀It was a polynucleotide having a poly A tail of. The target sequence was AE-labeled Neisseria gonorrhoeae 16S rRNA. Using this combination, the target sequence is hybridized to the target complementary sequence of the capture probe during the first hybridization at 60 ° C, and the dA region of the capture probe is fixed during the second hybridization at room temperature. By hybridization with the dT region, a fixed probe: capture probe: target polynucleotide complex was formed. A magnetic field is applied to attract the beads containing the fixed probe to the location of the reaction vessel, and then the binding buffer (50 mM lithium succinate, 100 mM LiCl, 1.5% LLS, 1.5 mM EDTA, 1.5 mM EGTA, pH 5.2). The captured AE-labeled target polynucleotide was purified by washing twice with. The captured target polynucleotide was detected by resuspending the beads and measuring the chemiluminescence produced by the AE label. Chemiluminescence was substantially previously described (Arnold et al., Clinical Chemistry). 35: 1588-1594 (1989); detected as relative light units (RLUs) using techniques such as Nelson et al., US Pat. No. 5,658,737). The RLU results shown in Table 2 are the average values of the samples tested in triplicate.<img file="JP4222635B2_D0004.tif" />The results in Table 2 validate the target polynucleotide using a two-step hybridization with a capture probe and a fixed probe present in the reaction mixture during both hybridizations or added prior to the second hybridization. Indicates that it is possible to capture. Therefore, the method is capable of achieving target capture when less reagent addition steps are required because all reagents are present in coexistence during both hybridizations. The results in Table 2 also show relatively short complementary sequences (dT).₁₄And dA₁₅) Indicates that it was effective in target capture in the fixed probe: capture probe: target polynucleotide complex. With a 14-mer fixed probe, substantially the same signal was produced whether the fixed probe was added during the second hybridization or was present during both hybridizations. dT₃₀: dA₁₅Compared to the combination of dT₁₄: dA₃₀Shorter fixed probe homopolymers appeared to be more useful than shorter capture probe homopolymers, as evidenced by the higher signal yielded in this combination. Example 3: Two-step hybridization using an amplified target sequence This example shows that it is possible to detect a human Mycobacterium tuberculosis target polynucleotide present in a clinical sample by using the two-step hybridization method of the present invention. The assay also includes other Mycobacterium species (ie, Mycobacterium bovis (M. bovis), M. bovis monkeys (M. simiae) and M. africanum, often collectively human tubercle bacilli complex. Although it was possible to detect (referred to as the body), it will be described herein for human M. tuberculosis for clarity. The basic protocol includes the following steps: Clinical samples (eg, sputum, bronchoalveolar lavage or bronchial lavage sediment 500 μl), containing the same volume of lysis buffer (4% (w / v) LLS, 2.2M LiCl, 250 mM A lysate of the sample was prepared by addition to HEPES buffer, pH 7.5), and the organisms in the lysate were killed by heat (15 minutes at 95 ° C). If M. tuberculosis is present in the clinical sample, target polynucleotides from M. tuberculosis (eg, rRNA sequences) will be present in the lysate. Aliquots (250 μl) of the lysate were mixed with the same volume of solution containing a capture probe specific for the M. tuberculosis target sequence and a fixed probe bound to a solid support. The capture probe is a 5'15 base sequence complementary to the rRNA sequence of M. tuberculosis, internal T.₃, And 3'dA₄₀It was a 58-base oligonucleotide, including the tail. The fixed probe used a carbodiimide chemistry on a solid support of magnetic particles (0.7-1.05 μmuons, Seradyn, Indianapolis, Indiana) (essentially Lund et al., Nuc. Acids Res. 16: 10861-10880,1988). Combined poly dT (as previously described in)₁₄It was an array. In this assay, 5 pmol of capture probe and 50 μg of fixed probe particles were used for each reaction. The mixture was subsequently incubated at two different temperatures (60 ° C for 20 minutes and 25 ° C for 15 minutes). At the first temperature, the T of the hybridization complex_mWas greater than 60 ° C, so a sequence complementary to M. tuberculosis in the capture probe hybridized to the target sequence, and at a second temperature, the T of the dA: dT complex._mWas lower than about 50 ° C, so the homopolymeric fixed probe hybridized to the complementary homopolymer region of the capture probe. After both incubations, magnetic beads were separated from the solution using a magnetic field substantially as described in Example 2. When M. tuberculosis was present in the sample, these magnetic beads were bound to a hybridization complex consisting of a fixed probe: a capture probe: a target polynucleotide. If human M. tuberculosis was not present in the sample, the beads were bound to a hybridization complex consisting of a fixed probe and a capture probe. The beads were washed twice with 1 ml of wash buffer for each wash by resuspending the beads in buffer and then repeating the magnetic separation step. Substantially, the washed beads were then resuspended in 75 μl of nucleic acid amplification reagent solution for transcription-related amplification using the methods described in US Pat. Nos. 5,399,491 and 5,554,516. Primers specific for bead and M. tuberculosis target polynucleotides 15 pmol each, covered with a layer of inert oil (200 μl) to prevent evaporation, reaction mixture (40 mM) Trizma base, pH7.5, 17.5 mM KCl, 20 mM MgCl₂Incubated in 5% polyvinylpyrrolidone (PVP), 1 mM dNTPs, 4 mM rNTPs) at 60 ° C for 10-15 minutes, and then at 41.5-42 ° C for 5 minutes. Reverse transcriptase (about 750 units and about 2,000 units of T7 RNA polymerase in 25 μl) was added per reaction, mixed, and target polynucleotide amplification was continued at 41.5-42 ° C for 2 hours. Detected as chemiluminescent and relative light units substantially as previously described (US Pat. No. 5,658,737, column 25, lines 27-46; Nelson et al., 1996, Biochem. 35: 8429-8438, 8432). An amplified human M. tuberculosis target sequence was detected using an AE-labeled probe represented by (RLU). For each assay, all except a negative control consisting of the same reagent, except that the sample is replaced with the same volume of negative sputum, and that the sample contains extracted total cell human M. tuberculosis RNA (containing approximately 2000 copies of rRNA). Included positive controls consisting of the same reagents. Samples were doubly tested for each assay (RLU No. 1 and RLU No. 2 in Table 3). Table 3 shows the results of this assay for 15 clinical samples that were independently determined to be positive for the presence of M. tuberculosis (based on standard clinical smear analysis and / or BACTEC culture results).<img file="JP4222635B2_D0005.tif" />As can be seen from the results shown in Table 3, samples that were positive for M. tuberculosis based on at least one clinical assay result were tested positive in a two-step hybridization assay compared to a negative control. Was done. Positive results were based on samples with RLU readings that were at least about 10 times greater than the negative controls. For most samples, positive results were based on RLU readings that were at least about 100 times greater than the negative controls. In general, the chemiluminescence indicating the presence of a human M. tuberculosis target polynucleotide in a sample is about 1,000 times greater than that detected in the negative control, and is essentially equal to or greater than that of the positive control. was. Example 4: Two-step hybridization assay to detect different levels of N. gonorrhoeae target This example shows that it is possible to detect only 5 fg of target polynucleotides indicating bacterial infection using the two-step hybridization method of the present invention. The target polynucleotide was a gonococcal-specific rRNA sequence (Hogan et al., US Pat. No. 5,541,308; Nelson et al., 1996, Biochem. 35: 8429-8438). In addition, when samples were stored at 0-4 ° C for 3 days and assayed on days 1, 2, and 3, the results were reproducible with little variation. The amount of N. gonorrhoeae assayed, 5fg and 50fg, corresponds to the rRNA present in 1 and 10 cells, respectively. The basic protocol used includes the following steps: For each assay sample, 20 μl of an aqueous solution of 0fg (negative control), 5fg or 50fg of gonococcal target polynucleotide in 400 μl of water was added to the synthetic urine control (KOVATROL).^TMHycor Biomedical, Inc) 400 μl and sequence complementary to gonococcal target polypeptide and dT₃dA₃₀It was mixed with 200 μl of target capture buffer (TCB; 2.2 M LiCl, 250 mM HEPES buffer, pH 7.5) containing the capture oligonucleotide (6.25 nM) having the sequence. Fixed dT bound to magnetic particles that serve as a solid support₁₄The probe was added to 100 μg / ml and the mixture was subsequently incubated at two different temperatures (60 ° C for 20 minutes and 25 ° C for 15 minutes). At the first temperature, the capture probe: T of the target polynucleotide complex_mBecause is greater than 60 ° C, the capture probe and target polynucleotide hybridize, and at a second temperature, the T of the dA: dT complex._mThe poly dA portion of the fixed probe and the capture probe hybridized because the temperature was lower than about 52 ° C. After incubation, magnetic beads were separated from the solution using a magnetic field substantially as described in Example 2. In the sample containing the gonococcal target polynucleotide, the magnetic beads were bound to the fixed probe: capture probe: target polynucleotide complex, while in the negative control sample, the beads were bound to the fixed probe: capture probe. The beads were then washed twice, and the washed beads were resuspended in 75 μl of nucleic acid amplification reagent, and with primers specific for the gonococcal target polynucleotide, substantially as described in Example 3. , Substantially amplified as described in Example 3. After amplification, the amplified target sequence was detected with an AE-labeled probe detected using a chemiluminescence assay, as described in Example 3, and the signal was expressed in relative light units (RLU). .. Background RLUs of negative and positive controls were measured in the same manner with the same reagents for each day's assay. The assay results are shown in Table 4, including the RLU results for each experimental sample and the average of the 2 positive controls and 10 negative controls obtained each day. The background (mean of the two samples) values were 6.81 x 10 for days 1, 2, and 3, respectively.², 1.18 x 10³And 6.61 x 10² It was RLU.<img file="JP4222635B2_D0006.tif" />The results shown in Table 4 show that the two-step hybridization assay was able to detect only 5 fg of gonococcal target polynucleotides with reproducibility, and the target polynucleotide-free samples tested under the same conditions. It is shown to produce significantly higher chemical luminescence than those produced. In addition, when samples were stored and retested using the method over a 3-day lapse, reproducible results were obtained over the entire period. The results also showed that the reproducibility between the samples was good over 3 days. Example 5: Two-step hybridization assay to detect bacteria in clinical urine samples This example shows that it is possible to detect a target indicating a bacterial infection using a clinical urine sample using the two-step hybridization method of the present invention. The target polynucleotide is Chlamydia It was a sequence specific to trachomatis). Samples were independently tested for trachoma chlamydia using a PCR-based assay, and the results obtained by the two-step hybridization method were compared to those obtained by the PCR-based assay. Urine samples were doubly tested using the step hybridization method, in which the samples were placed in a random order for classification (positive or negative) based on PCR-based assay results. Briefly, the two-step hybridization assay protocol was as follows: Each reaction tube has a sequence complementary to the trachoma chlamydia target polynucleotide and dT₃dA₃₀Contains 200 μl of TCB (defined in Example 4) containing 6.25 pmol of capture oligonucleotide with sequence, wherein 800 μl of prepared urine sample (400 μl of urine plus TM buffer (100 mM (NH))₄)₂SO₄, 50 mM Hepes, pH7.5, 8% LLS) 400 μl) or control 800 μl (negative control is KOVATROL)^TM400 μl plus TM buffer 400 μl; positive control is KOVATROL^TMIn addition to 400 μl, 400 μl of TM buffer containing 5 fg of trachoma chlamydia total cellular RNA (ie, rRNA target polynucleotide) was added. The tubes were sealed, mixed and incubated at 60 ° C for 30 minutes and then at 40 ° C for 30 minutes. The test tube was then placed in a magnetic field, and the magnetic beads were separated from the solution with a fixation probe, and the fixation components were washed twice, substantially as described in Example 2. At 60 ° C, capture probe: T of target polynucleotide complex_mThe capture probe and trachoma chlamydia target polynucleotide hybridize because is greater than 60 ° C, and at a second temperature, the T of the dA: dT complex._mIs lower than about 52 ° C, so the poly A portion of the fixed poly dT probe and capture probe hybridized. Using a primer specific for the trachoma chlamydia target sequence and a reagent for transcription-related amplification contained in a volume of 75 μl, the target polynucleotide was substantially as described in Example 3 except that the amplification was 1 hour. Amplified. An AE-labeled probe specific for the trachoma chlamydia target sequence is added (in 100 μl), mixed, and the mixture is incubated at 60 ° C for 20 minutes, after which 300 μl of the selective reagent is added, mixed, incubated, and Detected as RLU (see Example 3). Table 5 shows a two-step hybridization assay (RLU is the average of double tests on 30 urine samples, and the average of 5 positive and 5 negative controls) and PCR-based tests (detection of trachoma chlamydia nucleic acids). (Positive or negative) results are shown.<img file="JP4222635B2_D0007.tif" />As can be seen from the results in Table 5, for all assayed samples, the two-step hybridization method provided positive results for samples that were independently tested positive using PCR-based assays. , And all samples tested negative using the PCR-based assay were also negative when assayed by the two-step hybridization method. Relatively high (10³For negative samples with a negative signal (Samples 2, 8 and 22), the dual assay always contained one "0" RLU signal and one relatively high background signal. Therefore, it is possible to use a two-step hybridization assay to detect bacteria present in clinical urine samples and provide positive or negative results comparable to those obtained in the PCR assay. Example 6: Two-step hybridization assay to detect multiple bacterial targets in a sample This example shows that the two-step hybridization method of the present invention can be used to detect multiple targets showing bacterial infection by different species in a single sample. The target polynucleotide was a sequence specific for N. gonorrhoeae and Trachoma chlamydia, and the assay was performed substantially as described in Examples 3-6. Contaminants (1% to 10% v / v blood) were also added to these samples. The assay was performed substantially as described in Example 3-6 and the sample was normal urine (free of bacterial contamination) and contained no target polynucleotide (negative control); Tracoma chlamydia target polynucleotide 5 fg. Contains; contains 5fg of gonococcal target polynucleotide; or contains a mixture of 5fg of gonococcal target polynucleotide and 5fg of gonococcal target polynucleotide. For each set of samples, assay tubes further contained 0%, 1%, 5% or 10% v / v blood. Simultaneous detection of two target sequences using a chemiluminescent probe is substantially as described in Nelson et al. (1996, Biochem. 35: 8429-8438, 8432) and is specific for trachoma chlamydia target polynucleotides. Ortho-F-AE labeled probes and 2-Me-AE labeled probes specific for gonococcal target polynucleotides were used. For continuous hybridization steps, substantially as described in Example 5 herein, except that urine samples are prepared and some samples contain blood contaminants as described above. Incubation was performed at 60 ° C for 30 minutes and then at 40 ° C for 30 minutes. Fixed probes in the hybridization complex are purified using magnetic fields and wash steps and are specific for trachoma chlamydia target polynucleotides and gonococcal target polynucleotides, as described in Examples 4 and 5 above. Purified target sequences were amplified using a transcription-related amplification method containing various primers. A detection reagent was added, and chemiluminescence was simultaneously detected from the trachoma chlamydia-specific labeled probe and the gonococcus-specific labeled probe. For each type of sample assayed, four iterations were assayed and the RLU results (mean values for each type of sample) are shown in Table 6. In Table 6, the signal detected for a trachoma chlamydia-specific labeled probe (RLU) is indicated as "CT" and the signal detected for a gonococcal-specific labeled probe is indicated as "NG".<img file="JP4222635B2_D0008.tif" />The results shown in Table 6 show that it is possible to simultaneously detect two targets in a single sample using a two-step hybridization assay. Negative controls showed essentially negligible signals compared to samples containing trachoma chlamydia alone, gonococci alone, or combined targets. Detection of neither target was impeded by up to 10% v / v blood contamination, and both targets in a single sample were detected even with up to 10% v / v blood contamination. Although some aspects of the invention have been described herein, it is possible to create various modifications to a particular probe without departing from the spirit and scope of the invention as defined by the following claims. Good.<img file="JP4222635B2_D0009.tif" /><img file="JP4222635B2_D0010.tif" />