Organism-associated substance microarray and detecting method using it

[0001] [Technical field to which the invention belongs] The present invention relates to a bio-related substance microarray composed of fiber array flakes holding a gel containing a bio-related substance and a dye, and a detection method using the same. The microarray can be used for clinical tests, food tests, and the like. [0002] [Conventional technology] In recent years, genome projects in various organisms have been promoted, and many genes including human genes and their base sequences are being rapidly clarified. The function of the sequenced gene can be investigated by various methods. As one of the promising methods, gene expression analysis using the revealed base sequence information is known. For example, methods using various nucleic acid: nucleic acid-to-nucleic acid hybridization reactions and various PCR reactions, such as Northern hybridization, have been developed, and the relationship between various genes and their biological function expression is investigated by the method. Can be done. Although these methods limit the number of genes that can be applied, many are used to perform a comprehensive and systematic analysis of a very large number of genes at the single individual level, as is being revealed through today's genome projects. A new analytical method or methodology called the DNA microarray method (DNA chip method), which enables batch expression analysis of genes, has been developed. [0003] The present inventors have previously developed a novel microarray (Japanese Patent Laid-Open Nos. 2000-270877, 2000-270878, 2000-270879). In these inventions, a nucleic acid-immobilized gel-holding fiber array that holds a nucleic acid-immobilized gel on the surface or a gap of a fiber is prepared, and a slice is obtained by cutting the array in a direction intersecting the fiber axis of the array. It is a thing. This slice is used as a nucleic acid-immobilized two-dimensional high-density array, that is, a DNA microarray. [0004] [Problems to be Solved by the Invention] However, since the fiber array flakes are microarrays using a transparent gel, even if the gel falls off, shrinks, deforms, etc. during the manufacturing process of the microarray or the inspection using the microarray, it is visually visible. It was not easy to detect. Further, in the method of detecting the hybrid formation of the capture probe and the sample, after the capture probe forms a hybrid with the fluorescence-labeled sample, the amount of fluorescence is detected by a fluorescence measuring device such as a fluorescence laser scanner or a fluorescence microscope. Is a general method, but in a sample with low fluorescence labeling intensity or a microarray with low arrangement accuracy, it is difficult to accurately recognize the fluorescence corresponding to each compartment position classified by the fiber, and the fluorescence intensity is easy. Moreover, it was difficult to detect it accurately. Further, there is a problem that the intensity unevenness of the excitation light in the irradiation area of the fluorescence detection device and the fluorescence intensity unevenness due to the configuration of the optical system occur, and the detection of the hybrid formation cannot be accurately performed. [0005] INDUSTRIAL APPLICABILITY The present invention is a bio-related substance-immobilized gel with improved visibility, which can easily detect gel shedding during the manufacturing process, and can easily detect foam adhesion, gel deformation, and shedding during hybridization operations. An object of the present invention is to provide a holding fiber array piece. At the same time, to provide a bio-related substance-immobilized gel-holding fiber array thin section capable of accurately recognizing the fluorescence corresponding to each compartment position classified by the fiber and easily and accurately detecting the fluorescence intensity. With the goal. [0006] [Means for solving problems] As a result of diligent studies to solve the above problems, the present inventors have immobilized a dye, for example, a fluorescent dye, in advance on a gel arranged in each section divided by fibers, thereby producing and hybridization. We have found that the filling, deformation, falling state, etc. of gel at time can be easily detected using a fluorescence microscope, and have reached the present invention. In addition, in the detection method for detecting the hybrid formation of a bio-related substance and a sample immobilized on a microarray, each compartment position (coordinates) divided by fibers can be accurately recognized, and each compartment position (coordinates) can be accurately recognized. ), It was found that the fluorescence intensity corresponding to) can be detected accurately. Furthermore, in the detection method for detecting the hybrid formation of a bio-related substance and a sample immobilized on a microarray, the fluorescence intensity spot caused by a fluorescence detection device, for example, a light source can be easily detected and corrected, so that the hybrid formation can be performed. We have found that the detection of the above can be performed quantitatively, and have reached the present invention. [0007] That is, the present invention is [1] a bio-related substance obtained by cutting a fiber array formed by converging a plurality of fibers in which a gel containing a bio-related substance and a dye is held in a direction intersecting the fiber axis. It is a microarray. Examples of the biological substance include nucleic acids, and examples of the immobilized dye include those having a fluorescence wavelength of 350 nm to 500 nm. Examples of such fluorescent dyes include fluorescein derivatives and coumarin derivatives. Moreover, as a gel, a gel made of a water-soluble monomer can be mentioned. An example of such a monomer is an acrylamide monomer. Examples of the fiber include hollow fiber, porous fiber, and porous hollow fiber. Furthermore, the present invention is a method for detecting hybrid production of a capture probe and a sample held in each compartment of the biorelated substance microarray, which comprises the following steps. (1) Light having a wavelength that can be excited by a dye immobilized on a gel in advance is exposed to a microarray to detect fluorescence emitted from the dye. (2) Acquire the position information of each section divided by the fibers constituting the microarray. (3) The captured probe and sample hybrid are detected using the obtained position information. [3] A method for detecting hybrid production of a capture probe and a fluorescently labeled sample held in each section of the biorelated substance microarray, which comprises the following steps. (1) Light of a first wavelength that can be excited by a dye immobilized on a gel in advance is exposed to a microarray to detect fluorescence emitted from the dye. (2) Obtain information on the fluorescence intensity and / or intensity distribution in the first step. (3) Hybridization reaction between the capture probe and the fluorescently labeled sample is performed, and the hybrid formation is detected by the light of the second wavelength in which the fluorescently labeled sample can be excited. (4) The obtained fluorescence intensity is corrected by the information of the fluorescence intensity and / or the intensity distribution obtained in the second step. [4] The biological substance to inspection method of a microarray fraud and mitigating risk light of immobilized dye excitable wavelength to the gel, and exposed to the microarray, by detecting the fluorescence emitted, each compartment of the microarray It is a method for inspecting a bio-related substance microarray, which is characterized by evaluating the shape of the gel. [0008] BEST MODE FOR CARRYING OUT THE INVENTION Examples of the bio-related substance to be immobilized on the gel include nucleic acids such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), and oxypeptide nucleic acid (OPNA), proteins, and polysaccharides. .. These may be commercially available products or those obtained from living cells or the like. For example, when nucleic acid is used as a biological substance, the preparation of DNA or RNA from living cells can be carried out by a known method. For example, the method of Blin et al. (Nucleic Acids Res.3.2303 (1976)) is used for DNA extraction, and the method of Favaloro et al. (Methods. Enzymol. 65.718 (1980)) is used for RNA extraction. it can. Furthermore, chained or circular plasmid DNA or chromosomal DNA can also be used. As the DNA, a restriction enzyme, a chemically cleaved DNA fragment, a DNA synthesized by an enzyme or the like in vitro, a chemically synthesized oligonucleotide, or the like can also be used. [0009] The gel that can be used in the present invention is not particularly limited, and is, for example, acrylamide, N, N-dimethylacrylamide, N-isopropylacrylamide, N-acryloylaminoethoxyethanol, N-acryloylaminopropanol, N-methylolacrylamide, N. -At least one monomer selected from vinylpyrrolidone, hydroxyethyl methacrylate, (meth) acrylic acid, allyldextrin, etc., and polyfunctional singles such as methylenebis (meth) acrylamide, polyethylene glycol di (meth) acrylate, etc. A gel obtained by copolymerizing the quanta in an aqueous medium can be used. In addition, a gel such as agarose, alginic acid, dextran, polyvinyl alcohol, polyethylene glycol, or a gel obtained by cross-linking these can be used. [0010] In the present invention, the bio-related substance may be immobilized on the gel as it is, or a derivative obtained by chemically modifying the bio-related substance or a bio-related substance modified as necessary may be immobilized. For immobilization of the bio-related substance on the gel, a method of physically enclosing the bio-related substance in the gel or a direct bond to the gel component may be used, and the bio-related substance is once polymerized, inorganic particles, etc. The carrier may be covalently or non-covalently attached to the carrier and immobilized on the gel. [0011] For example, in order to directly bind a nucleic acid as a bio-related substance to a gel component, a vinyl group is introduced into the terminal group of the nucleic acid (see WO98 / 39351) and copolymerized with a gel component such as acrylamide. It can be done by. When the vinyl group is introduced into the terminal group of the nucleic acid via the glycidyl group, the nucleic acid needs to be modified in advance, but the modification is not particularly limited as long as it reacts with the glycidyl group. For example, one having an amino group introduced therein can be used. [0012] Regarding the method of introducing an amino group, for example, in the case of deoxyribonucleic acid (DNA), the binding site between the amino group and the single-stranded DNA is the 5'end, 3'end, in the chain, the phosphodiester site or the base site. However, it is preferable to bind at the 5'end or 3'end of the DNA. The single-stranded DNA derivative can be prepared according to the methods described in JP-A-3-74239, US Pat. No. 4,667,025, US Pat. No. 4,789,737 and the like. In addition to the above method, for example, using a commercially available amino group introduction reagent such as Aminolink II (manufactured by PE Biosystems Japan), Amino Modifiers (manufactured by Clontech), or phosphorus at the 5'end of DNA. It can be prepared according to a well-known method for introducing an aliphatic hydrocarbon chain having an amino group into an acid (Nucleic Acids Res., 11 (18), 6513- (1983)). [0013] The dyes that can be used in the present invention are mainly classified into natural dyes and synthetic dyes. Typical examples of natural pigments include flavone derivatives, chalcone derivatives, anthraquinone derivatives, indigo derivatives and the like. Typical examples of synthetic dyes include azo dyes, anthraquinone dyes, indigoid dyes, diphenylmethane dyes, triphenyl dyes, xanthene dyes, acrydin dyes and the like. In particular, some of the above dyes have fluorescence. The type of fluorescent dye that can be used in the present invention is not particularly limited as long as it is a dye that emits fluorescence, and for example, rhodamine, Texas Red, Fluorescein, fluorescein isothiocyanate (FITC), Oregon Green, Pacific Blue, etc. Examples thereof include R-Phycoerythrin, Rhodol Green, Coumarin derivatives, and Amino Methyl Coumarin. [0014] Examples of the dye immobilization method used in the present invention include a method of immobilizing the dye on a gel as it is, a derivative obtained by chemically modifying the dye, and a method of immobilizing a modified dye as needed. Immobilization of the dye on the gel may utilize a method of physically enclosing the dye in the gel or direct binding to the gel constituents. Further, the dye may be once bound to a carrier such as polymer particles or inorganic particles by covalent bond or non-covalent bond, and the carrier may be immobilized on the gel. [0015] To directly bond the dye to the gel component, for example, a method of copolymerizing with a gel component such as acrylamide using Fluorecein Dimethacrylate or 1-Pyrenylmethyl Methacrylate manufactured by Polyscience, or a dye derivative having an amino group is glycidyl. A method in which a polymerizable vinyl group is introduced by reacting with methacrylate (GMA) and copolymerized with a gel component such as acrylamide, or a method in which an anionic monomer is introduced into a gel to ionic bond a cationic dye. And so on. [0016] According to the present invention, when a sample using a fluorescent label is subjected to hybridization and a fluorescent dye having a specific wavelength is immobilized on the gel in advance when detecting the hybrid, the visibility of the gel is imparted. It is possible to provide a biorelated substance microarray containing a gel having a high degree of transparency. The fluorescent label of the sample is not easily affected by the autofluorescence of the members constituting the microarray (in the present invention, the support for fixing the bio-related substance which is the capture probe, that is, gel, fiber, adhesive, etc.) 500. Since it is preferable to use fluorescence having a long wavelength of nm or more, the fluorescence wavelength of the fluorescent dye immobilized on the gel in advance is preferably a short wavelength of 350 nm to 500 nm in the visible light range. Preferred examples of the fluorescent dye to be immobilized on the gel in advance are fluorescein derivatives such as Fluorescein and fluorescein isothiocyanate (FITC), and coumarin derivatives such as Amino Methyl Coumarin. In the present invention, the amount of the dye to be immobilized is not particularly limited and can be arbitrarily adjusted. Usually, it is 100 fmol to 10 atmol for each fiber fragment constituting each section of the microarray. The amount of dye to be immobilized is determined independently of the amount of biorelated material to be immobilized and need not be equal to or proportional to the amount of biorelated material, but in all fiber fragments contained in the array. The amount is preferably equal. In particular, for the purpose of correcting the light intensity distribution based on the optical system of the detection device, it is necessary that each fiber fragment contains an equal amount of dye. [0017] Examples of fibers that can be used in the present invention include synthetic fibers, semi-synthetic fibers, regenerated fibers, chemical fibers such as inorganic fibers, and natural fibers. Typical examples of synthetic fibers include various polyamide fibers such as nylon 6, nylon 66 and aromatic polyamide, various polyester fibers such as polyethylene terephthalate, polybutylene terephthalate, polylactic acid and polyglycolic acid, and polyacrylonitrile. Various acrylic fibers, various polyolefin fibers such as polyethylene and polypropylene, various polyvinyl alcohol fibers, various vinylidene chloride fibers, polyvinyl chloride fibers, various polyurethane fibers, phenol fibers, polyhushes Examples thereof include fluorine-based fibers made of vinylidene conjugation, polytetrafluoroethylene, and various polyalkylene paraoxybenzoate-based fibers. Further, optical fibers other than those for clothing, for example, which are mainly made of a transparent amorphous polymer such as polymethylmethacrylate or polystyrene, can also be used. Typical examples of semi-synthetic fibers include various cellulosic derivative fibers made from cellulose diacetate, cellulose triacetate, chitin, chitosan and the like, and various protein-based fibers called promixes. Typical examples of the regenerated fiber include various cellulosic regenerated fibers (rayon, cupra, polynosic, etc.) by the viscose method, the copper-ammonia method, or the organic solvent method. Typical examples of inorganic fibers include glass fibers and carbon fibers. Typical examples of natural fibers include plant fibers such as cotton, flax, ramie, and yellow hemp, animal fibers such as wool and silk, and mineral fibers such as asbestos. [0018] The structure of the fiber used in the present invention is not particularly defined in its form, and may be a monofilament or a multifilament. Further, a spun yarn obtained by spinning short fibers may be used. When multifilaments or spun yarn fibers are used, it is also possible to use voids between single fibers for holding the bio-related substance-immobilized gel. Further, the fiber used in the present invention may have a porous structure. The cross-sectional shape may be not only a circular cross-section but also a deformed cross-section such as a flat cross-section or a hollow cross-section. In particular, from the viewpoint of uniformly immobilizing the gel, it is preferably hollow. [0019] In order to allow the fiber to retain the gel, the fiber is immersed in a liquid containing a monomer such as acrylamide, which is a gel component, a polyfunctional monomer, a polymerization initiator, a dye, and a bio-related substance component, and the fiber is polymerized and gelled. Just do it. At this time, as described above, it is preferable that the dye and / or the bio-related substance is bound to a carrier such as a monomer such as acrylamide, which is a gel component, polymer particles, or inorganic particles. In addition to the method of copolymerizing in the presence of the polyfunctional monomer, gelation may be carried out by copolymerizing in the absence of the polyfunctional monomer and then using a cross-linking agent. In addition, a method of heating and dissolving agarose or the like on which a biological substance is immobilized, immersing the fiber, and forming a cooling gel can be mentioned. [0020] When the fibers are hollow fibers and porous hollow fibers, instead of immersing the fibers in a liquid containing each of the above-mentioned components, the liquid is injected or sucked into the hollow portion and / or the porous portion of these fibers. After filling, it may be gelled. The procedure for holding the gel in the hollow fiber, the hollow portion of the porous hollow fiber, and / or the porous portion may be before or after forming the fiber array described later. [0021] [0021] The bio-related substance and the dye-immobilized gel-holding fiber prepared as described above can be brought into close contact with each other after convergence to form a bio-related substance and the dye-immobilized gel-holding fiber array. At this time, by arranging the fibers regularly and adhering them with a resin adhesive or the like, for example, the fiber array in which the fibers are arranged in an orderly and regular manner in the vertical and horizontal directions can be obtained. [0022] The flakes of the present invention can be obtained by cutting the above-mentioned bio-related substance and dye-immobilized gel-retaining fiber array in a direction intersecting the fiber axis, preferably in a direction perpendicular to the fiber axis. Examples of the cutting method at this time include a method of cutting out flakes from the array using a microtome. The thickness of the flakes can be adjusted arbitrarily, but is usually 1 to 5,000 μm, preferably 10 to 2,000 μm. By observing the flakes thus obtained, for example, with a fluorescence microscope, the shape of the gel such as deformation and shedding can be easily observed. [0023] These flakes can be used for detecting a specific bio-related substance in a sample by reacting the bio-related substance immobilized on the gel with a sample to form a hybrid. In a broad sense, the capture probe referred to here refers to a bio-related substance immobilized on a gel that can specifically bind to a bio-related substance on the sample sample side such as a protein or a low molecular weight compound present in the sample. When the bio-related substance immobilized on the gel is nucleic acid, the flakes are reacted with the sample to hybridize to form a hybrid between the capture probe and the nucleic acid present in the complementary sample, and this hybrid is formed. By detecting the above, the nucleic acid in the sample having the target base sequence can be detected. [0024] For the detection of the hybrid, a known means capable of specifically recognizing the hybrid can be used. For example, a labeled substance such as a fluorescent substance, a luminescent substance, or a radioisotope can be allowed to act on a biological substance in a sample to detect the labeled substance. The type of the labeled body, the method of introducing the labeled body, and the like are not limited in any way, and various conventionally known means can be used. [0025] In the hybrid detection step, first, the gel-immobilized dye is exposed to a microarray with light of a first wavelength that can excite the gel-immobilized dye, and the gel-immobilized dye is held in a compartment partitioned by each fiber. It is possible to detect the fluorescence emitted from the section and obtain the position information (coordinates) of the section. Based on the obtained position information, the compartments divided by each fiber are represented by, for example, XY coordinates on the XY plane of the array. Using the obtained position information, the detection of the hybrid can be detected for each position of the section divided by each fiber. For example, when the label is a fluorescent dye, the fluorescent dye can be excited and the microarray is exposed to light different from the first wavelength, and the fluorescence hybridized with the bio-related substance immobilized on each fiber fragment. Detect labeled specimens. At this time, the position (coordinates) of the section can be specified by the position information, and the hybrid amount of the position can be detected. In addition, the intensity distribution of the fluorescence intensity on the microarray can be detected in advance, and the hybrid amount of the positions of each fiber fragment can be quantified by using the above-mentioned position information. The method is particularly effective when the fluorescence intensity of the labeled substance is low and the fluorescence intensity is accurately detected, and is also effective when the arrangement accuracy of the microarray is low. [0026] Further, in the hybrid detection step using the microarray of the present invention, when the sample is fluorescently labeled, the microarray is exposed with light of the first wavelength capable of exciting the dye immobilized on the gel, and each of them is exposed. Information on the intensity distribution of excitation light on the microarray and the distribution of fluorescence detection efficiency due to the detection device by detecting the fluorescence emitted from the dye immobilized on the gel held in the compartments separated by fibers. , Information such as time change of excitation light intensity can be obtained. After obtaining the above information, the microarray is exposed to a second wavelength capable of exciting the fluorescent dye labeled with the sample, and the fluorescence of the sample hybridized with the bio-related substance immobilized on each compartment is detected. By making corrections based on the above information, fluorescence detection can be performed accurately. For example, when a xenon lamp or the like is used as the excitation light source, the excitation light intensity is distributed when the front surface of the microarray is irradiated with the excitation light. Therefore, the fluorescence intensity at the position of a certain fiber fragment when excited at the first wavelength is S1 (X).₁, Y₁), The fluorescence intensity at the same position when excited at the second wavelength is S2 (X)₁, Y₁), Then, by taking the ratio of S1 and S2, it is possible to obtain the corrected hybrid fluorescence intensity in which the distribution unevenness of the fluorescence intensity is corrected. Similarly, the time change of the excitation light can be corrected. [0027] The microarray of the present invention is obtained by cutting a fiber array containing a bundle of fibers holding a gel on which a biorelated substance and a dye are immobilized in a direction crossing the fiber axis. In particular, when the fiber is a hollow fiber, it is preferable to hold the gel in the hollow portion of the fiber because a large number of trapping probes can be held. However, there is a risk that the fibers or gel will fall off when the fiber bundles are cut to obtain flakes. Therefore, it is necessary to check whether the microarray is complete. In that case, if the gel is dyed with a dye, the shape of the gel, that is, the gel is dropped or missing, etc., by irradiating the flakes with light having a wavelength that excites the dye and detecting the fluorescence emitted from the dye. Can be easily investigated. In the above description, the hybrid formation in the present invention has been described by using nucleic acid as an example and complementary binding of its base pairs. However, when the biorelated substance is a substance other than nucleic acid, for example, a protein exhibiting an antigen-antibody reaction, the microarray using the antibody as a capture probe specifically binds to the antigen. Such a bond also means the hybrid formation of the present invention, and in the present invention, a hydrophobic bond other than a hydrogen bond, a complex formation, a bond due to an electrostatic interaction, and the like are defined as a hybrid. [0028] [Example] The present invention will be described in more detail with reference to the following examples. However, the technical scope of the present invention is not limited by these examples. [0029] Reference example 1 (a) Preparation of oligonucleotide capture probe having a methacrylate group The oligonucleotides (capture probe A and capture probe B) shown below were synthesized. Capture probe A: GCGATCGAAACCTTGCTGTACGAGCGAGGGCTC (SEQ ID NO: 1) Capture probe B: GATGAGGTGGAGGTCAGGGTTTGGGACAGCAG (SEQ ID NO: 2) Oligonucleotide synthesis is performed by PE Biosystems' automatic synthesizer DNA / RNA Performed using a synthesizer (model394) and in the final step of DNA synthesis, NH at the 5'end of each oligonucleotide using Aminolink II (brand name) (Applied Biosystems).₂(CH₂)₆-Introduced to prepare an aminized capture probe. These were used after being deprotected and purified by a general method. 5 μl of the obtained capture probe A or B (500 nmol / ml) and 0.5 μl of glycidyl methacrylate (GMA) are mixed and reacted at 70 ° C. for 2 hours to prepare an oligonucleotide capture probe having a methacrylate group, and 190 μl of water is added. In addition, a solution of capture probes (GMA modified capture probe A and GMA modified capture probe B) having a methacrylate group of 100 nmol / ml was obtained. [0030] b) Preparation of sample nucleic acid model As a model of the sample nucleic acid, the oligonucleotide synthesized in (a) (capture probe A, Oligonucleotides (C, D) complementary to a part of the sequence of capture probe B) were synthesized. Oligonucleotide C: GAGCCCTCGCTCGTACAGCAAGGTTTCG (SEQ ID NO: 3) Oligonucleotide D: CTGCTGTCCCAAACCCTGACCTCCACC (SEQ ID NO: 4) Oligonucleotide synthesis was carried out in the same manner as in (a), and a model of a fluorescently labeled sample nucleic acid was prepared by introducing Cy3 at the 5'end of oligonucleotide C and Cy5 at the 5'end of oligonucleotide D. These were used after being deprotected and purified by a general method. [0031] (c) Preparation of fiber array Five polyethylene porous hollow fiber membranes MHF200TL (manufactured by Mitsubishi Rayon Co., Ltd., outer diameter 290 μm, inner diameter 200 μm) were arranged on a Teflon plate in close contact with each other without overlapping, and both ends were fixed. A polyurethane resin adhesive (Nippon Polyurethane Industry Co., Ltd. Coronate 4403, Nippon Polyurethane 4223) was thinly applied to this, and hollow fibers were adhered. After the polyurethane resin was sufficiently hardened, it was peeled off from the Teflon plate to obtain a sheet-like material in which porous hollow fibers were arranged in a row. Five of these sheet-like materials were laminated and adhered with the above adhesive to obtain a porous hollow fiber array in which a total of 25 hollow fibers were regularly arranged in a square manner, 5 in each of the vertical and horizontal directions. [0032] Example 1 (1) Synthesis of fluorescently labeled oligonucleotide In the same manner as in Reference Example (a), an oligonucleotide having the sequence of GCAT in which fluorescein isothiocyanate (FITC) was introduced at the 5'end was synthesized. [0033] (2) Preparation of fluorescent dye having a methacrylate group 50 μl of the oligonucleotide (500 nmol / ml) having FITC at the 5'end obtained in (1), 5 μl of glycidyl methacrylate and 5 μl of dimethylformamide (DMF) were mixed and reacted at 70 ° C. for 2 hours to obtain a methacrylate group. And 190 μl of water was added to obtain a solution of a fluorescent dye (GMA-modified FITC) having a methacrylate group of 100 nmol / ml. [0034] (3) Preparation of bio-related substance-immobilized gel-retaining fiber array [0035] &lt;Preparation of monomer solution and polymerization initiator solution&gt; A monomer solution and an initiator solution were prepared by mixing at the following mass ratios. a) Monomer liquid Acrylamide 0.76 parts by mass Methylenebisacrylamide 0.04 parts by mass water 4.2 parts by mass b) Initiator solution 2,2'-Azobis (2-amidinopropane) dihydrochloride 0.01 parts by mass Water 4.99 parts by mass [0036] &lt;Preparation of polymerization solution&gt; The volume ratios of the above-mentioned monomer solution a), initiator solution b), GMA-modified capture probe A or GMA-modified capture probe B prepared in Reference Example 1 (a), and GMA-modified FITC prepared in (2) are shown in Table 1. To prepare the polymerization solutions 1 to 3 by mixing with. The obtained polymer solution was filled in the hollow portion of the hollow fiber in a predetermined row of the hollow fiber array obtained in Reference Example (c), transferred to a closed glass container whose inside was saturated with water vapor, and 4 at 80 ° C. The polymerization reaction was carried out by leaving it for a while. [0037] [table 1]<img file="JP4036611B2_D0001.tif" />[0038] (4) Observation of the filling state of slices and gels A thin section of 500 μm was cut out from the array obtained in (3) using a microtome. When these flakes were observed with a fluorescence microscope (Nikon fluorescence microscope E400) using a FITC filter (excitation wavelength range 465 to 495 nm, fluorescence wavelength range 515 to 555 nm), the gel filling state could be easily observed. [0039] (5) Hybridization The flakes obtained in (4) were placed in a hybridization bag, a hybridization solution having the following composition was poured, and prehybridization was performed at 45 ° C. for 30 minutes. [0040] &lt;Hybridization solution composition&gt; 5xSSC (0.75 mol / l sodium chloride, 0.075 mol / l sodium citrate, Ph7.0) 5% Blocking Reagent (Roche Diagnostics Co., Ltd.) 0.1% N-Lauroyl sarcosin sodium 0.02% SDS (sodium lauryl sulfate) 50% formamide [0041] Subsequently, the model of the fluorescently labeled sample nucleic acid prepared in Reference Example (b) was added to a concentration of 50 pmol / ml, and hybridization was performed at 45 ° C. for 15 hours. After hybridization was completed, the nucleic acid-immobilized flakes were transferred to 50 ml of 0.1 x SSC, 0.1% SDS solution that had been kept warm in advance, and washed 3 times at 45 ° C for 20 minutes with shaking. [0042] (6) Detection When the chip after hybridization obtained in (5) was observed with a filter for CY3 (excitation wavelength peak region 535 nm, half width 50 nm, fluorescence wavelength peak 610 nm, half width 75 nm), it was hindered by the fluorescence of GMA-modified FITC. An image was obtained in which only the array row number 2 fluoresces. Next, as in (4), observation was performed using a FITC filter with a fluorescence microscope, and it was confirmed that the gel was filled in all the hollow threads even for the column numbers in which fluorescence was not observed with the CY3 filter. .. Similarly, when observed with a filter for CY5 (excitation wavelength peak region 620 nm, half width 60 nm, fluorescence wavelength peak 700 nm, half width 75 nm), only the sequence number 4 fluoresces without being hindered by the fluorescence of GMA-modified FITC. The resulting image was obtained. From the above results, it can be seen that oligonucleotide C is specifically hybridized only in the cross section in which the capture probe A is immobilized, and oligonucleotide D is specifically hybridized only in the cross section in which the capture probe B is immobilized. It was confirmed that the gel did not fall off or deformed during the hybridization operation. [0043] Example 2 Flakes of the fiber array were obtained under the same conditions except that the GMA-modified FITC in Example 1 was replaced with Fluorescein Dimethacrylate manufactured by Polysciences, Inc. When the flakes were observed with a fluorescence microscope, the gel filling state could be easily observed. In addition, hybridization was carried out in the same manner as in Example 1, and it was confirmed that the fluorescence of Fluorescein did not interfere with the detection of fluorescence of CY3 and CY5, and that the gel did not fall off or deform during the hybridization operation. .. [0044] Example 3 (1) Acquisition of position information of compartments divided by fibers and measurement of fluorescence intensity distribution of immobilized dye The hybridization reaction was completed in the same manner as in Examples 1 (1) to (5). Next, a CCD camera was connected to the fluorescence microscope described in Example 1, and a fluorescence image was taken using a FITC filter. The captured image was saved in 16-bit TIFF format. The obtained image was processed using image processing software, and the position of each fiber fragment on the microarray was measured. Subsequently, the fluorescence intensity of the immobilized fluorescent dye was quantified at the position on each fiber fragment. The obtained fluorescence intensity included a distribution due to the intensity distribution of the excitation light, the fluorescence intensity distribution caused by the optical system of the microscope, and the like, and the center was high and the peripheral portion was low. [0045] (2) Hybrid detection In the same manner as in (1), the fluorescence intensity was measured using a CY3 filter. Next, the fluorescence intensity of the fluorescently labeled sample present in each fiber fragment was quantified using the position of each fiber fragment obtained in (1) on the microarray. [0046] (3) Hybrid strength correction A corrected hybrid intensity distribution could be obtained by dividing the fluorescence intensity of the fluorescently labeled sample obtained in (2) by the fluorescence intensity of each fiber fragment obtained in (1). [0047] Comparative example 1 The flakes were obtained in the same manner as in Example 1 without using GMA-modified FITC. When hybridization was performed in the same manner as in Example 1 and the flakes were observed under a microscope using a filter for CY3, an image in which only sequence number 2 fluoresces was obtained, but other than sequence number 2. It was difficult to observe the filling state such as the lack of gel in the row, and it was not possible to easily determine whether the row that did not generate fluorescence did not form a hybrid or the gel was missing. [0048] [Effect of the invention] According to the present invention, the filling state of the gel existing in the microarray can be easily confirmed. As a result, the efficiency of the inspection work of the microarray is significantly improved. Furthermore, since the gel filling state can be easily confirmed after hybridization, it can be easily determined whether the hybrid is not formed or the gel is missing. Further, according to the present invention, it is possible to easily and accurately detect the fluorescence intensity even in a sample having a low fluorescence intensity or an array having a low arrangement accuracy. Furthermore, the intensity unevenness of the excitation light in the irradiation area of the fluorescence detection device and the fluorescence intensity unevenness due to the configuration of the optical system can be easily corrected, and the hybrid formation can be accurately detected. [0049] [Sequence list]<img file="JP4036611B2_D0002.tif" /><img file="JP4036611B2_D0003.tif" />[0050] [Free text of sequence listing] SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA