Internal controls for isothermal nucleic acid amplification reactions.

Description: TECHNICAL FIELD [Detailed description of the invention]

【0001】

[Industrial application field]

The present invention relates to constant temperature in vitro nucleic acid amplification methods, and specifically to methods for assessing the amplification activity of a sample or for quantifying the amount of target sequence present in a sample.

【0002】

[Conventional technology]

In vitro nucleic acid amplification technology has provided a powerful tool for the detection and analysis of small amounts of nucleic acids. The ultimate sensitivity of such methods has led to attempts to develop diagnostics for infectious and genetic disorders. Nucleic acid amplification techniques can be classified according to the temperature requirements of the method. Polymerase Chain Reaction Method (PCR; RK Saiki et al., 1985, Science 230,1350-1354), Rigestein Reaction (LCR; DYWu et al., 1989, Genomics 4,560-569; K. Barringer) Et al., 1990, Gene 89,117-122; Barany, 1991, Proc.Natl.Acad.Sci.USA 88,189-193) and transcription-based amplification (DYKwoh et al., 1989, Proc.Natl.Acad. .Sci.USA 86,1173-1177) requires temperature circulation. In contrast, Chain Substitution Amplification (SDA; Walker (GT Walker) et al., 1992, Proc. Natl. Acad. Sci. USA 89, 392-396; Walker et al., 1992, Nuc.Acids.Res.20,1691-1696), Self-retaining sequence replication (3SR; JCGuatelli et al., 1990, Proc.Natl.Acad.Sci. Methods such as USA 87,1874-1878) and the Qβ replicase system (PMLizardi et al., 1988, BioTechnology 6,1197-1202) are constant temperature reactions. In addition, WO 90/10064 and WO 91/03573 describe the use of the replication origin of bacteriophage, Phy 29, for homeothermic replication of nucleic acids.

【0003】

Usually, these nucleic acid amplification techniques have been used to obtain qualitative results in diagnostic assays. However, there is great interest in the development of quantitative nucleic acid amplification methods and methods for measuring the amplification activity (ie, efficiency) of a sample. These possibilities should provide improved reliability and accuracy in nucleic acid-based amplification diagnostic assays.

【0004】

In many cases, nucleic acid amplification is a logarithmic step, making it difficult to quantify the absolute amount of a specific target by co-amplification of the internal control sequence. For this reason, small differences in amplification efficiency between control and target sequences can result in large differences in amplification product yields and false quantitative comparisons. Co-amplification of the internal control sequence was used in PCR to quantify the amount of target sequence present in the sample. For years, the accuracy of this method has been recognized to depend on the possibility of selecting an internal control sequence that exhibits the same amplification efficiency as the target sequence. First, co-amplification techniques used target and control sequences amplified by different PCR primer pairs, making it difficult to balance amplification efficiency with reduced accuracy of the method. For example, J. Chelly et al. ((1988), Nature 333,858-860 reported co-amplification of aldolase A receptor mRNA and dystrophin mRNA in human tissues. Although the absolute amount of dystrophin mRNA could not be measured directly, this method evaluated the relative amount by comparing the aldolase A amplification product with the dystrophin amplification product. Assessment of the amount of dystrophin-targeted mRNA as a percentage of total mRNA was obtained using published calculations for assessing aldolase A mRNA. Therefore, these authors used an internal control sequence that was not associated with the target sequence, and the two sequences were co-amplified with different primer pairs. Moreover, the amplification products of the control sequence and the amplification sequence were of different sizes.

【0005】

Improvements in PCR internal controls have been reported by selecting internal control sequences that can be amplified using the same primers as the target sequence. See, for example, WO 93/02215 and WO 92/11273. In certain studies, it was recommended that the target and control sequences be of different lengths to facilitate identification on the gel (KDEisenach et al., 1991, Amer.Rev.Resp.Dis.144,1160- 1163; Wang et al., 1989, Proc.Natl.Acad.Sci.USA86,9717-9721; International Patent Application International Publication No. 91/02817). G. Gilliland et al. (1989, J.Cell.Biochem.13, Suppl.E., 270; (1990) Proc.Natl.Acad.Sci.USA 87,2725-2729) describes a competitive PCR reaction in which the internal control sequence is approximately the same size as the target and replication is initiated with the same primers. Gililand et al. Teach that the target and internal sequences should be associated with reducing the number of variables, but describe the length of the amplified sequence as one of the variables that significantly affects amplification efficiency. It is known that the rate of PCR is relatively unaffected by the length of the target.

【0006】

The literature relating to the internal control of the PCR reaction states that the variable should be controlled to ensure equal amplification efficiency between the target and control sequences. In part, these are primer pair lengths and nucleotide sequences, polymerases, dNTPs, MgCl₂, Concentration of template nucleic acid and primer, rate of primer dimer formation, nucleic acid denaturation temperature, and concentration and length of template nucleic acid. Please refer to the above international publication number 91/02817. Although the importance of amplification efficiency and the balance of the variables contained has been evaluated in PCR, factors influencing the rate of amplification in a homeothermic system, such as SDA (and thus selection of the appropriate control sequence), affect PCR. Expected to be different from what you do.

【0007】

Significantly different features in PCR consist of three steps consisting of the following single amplification cycle: (1) thermal denaturation of double-stranded nucleic acids, (2) hybridization of primers to the now single-stranded target, And (3) the hybridized primers are extended and synthesized to form the same copy of the double-stranded target modified in step (1). In PCR, these steps are synchronized so that one of the steps can occur at any given time. Once one step is complete, the next can only begin after changing the reaction temperature. Therefore, one complete cycle requires several temperature changes. That is, PCR amplification proceeds so that all target molecules go through the same process at the same time in a coherent phase. The efficiency with which a given target is amplified depends directly on the combined efficiency of the three constituent steps.

【0008】

When two or more target sequences are amplified by PCR, the amplification efficiency of each sequence is also a result of the efficiency of the constituent steps. Therefore, for two unequal sequences amplified with equal efficiency in PCR, each constituent step ends only simultaneously for the two sequences at the end of the time allotted for that step. The given reaction (ie, primer extension synthesis) need not occur at the same rate for both targets. It is only required that the reactions occur in the same range before the entire reaction moves to the next step of the cycle (eg, metamorphism). That is, the kinetics of the two targets may be slightly different in any given step, providing sufficient time to slowly complete the reaction before the next reaction step begins. As a result, in PCR, all amplification efficiencies for the two targets are the same, even if the basic molecular processing rates (ie, the rates of the steps that make up the cycle) differ by simply adjusting the temperature cycle. be able to. The amplification properties of the two target sequences need not be finely balanced with respect to the equal range of resulting amplification.

【0009】

In a homeothermic system, such as SDA, the amplified phase (coherent) There is no case of progressing in phase). Amplification of each target molecule occurs at a given point in time through a consistent series of reactions in such a system, but different individual target molecules are in different phases of the amplification cycle. In such a continuous amplification system, it is not possible to catch up with the delayed reaction involving the second target sequence by delaying the reaction process for one target sequence. Instead, the imbalance in the basal rate of reaction for the two target sequences, no matter how slow, directly changes the amplification efficiency. As mentioned earlier, even small differences in amplification efficiency can result in large differences in product yields in logarithmic amplification systems such as PCR and SDA. A slight reaction rate imbalance is therefore enormous in a homeothermic amplification system, such as SDA, but a similar imbalance in PCR is effectively negated by the choice of proper temperature circulation. For these reasons, the selection of control sequences with properly balanced amplification efficiencies is more decisive and more difficult in homeothermic systems than in systems performed in different reaction steps. For example, the efficiency of SDA decreases as the length of the target or control sequence increases above about 60 nucleotides. In contrast, PCR targets with different lengths of hundreds of nucleotides can be amplified with similar efficiency. The low amplification temperature of the SDA and other homeothermic amplification reactions increases the degree of secondary structure of the primers and target sequences, which in turn affects the amplification reaction rate.

【0010】

European Patent No. 0525882 describes a method for quantifying a target nucleic acid in a Nucleic Acid Sequence Based Amplification (NASBA) reaction by competitive amplification of a target nucleic acid and a mutant sequence. This method is performed with a fixed amount of sample and a dilution series of mutant sequences. The analysis is performed by measuring the amount of added mutant sequence that reduces the signal from the target sequence by 50%, a value of 50% indicating that the mutant sequence and the target sequence are present in equal amounts. To produce accurate quantification, the amplification reaction described in European Patent No. 0525882 is the logarithm of the reaction until at least one reagent is completely consumed, i.e., where limited reagent competition can occur. Phase (post-exponential) Must continue until phase). In addition, the calculation is accurate only if there are two reactions between the reagent and the amplification of the target and the amplification of the mutant sequence. The results are therefore unreliable if a third reaction, such as background amplification, occurs. In essence, all amplification reactions involve some background amplification, and the quantification method of EPO 0525882 is accurate only for high levels of target sequences. At low target levels, competition for background amplification reactions significantly impairs computational accuracy. The method of European Patent No. 0525882 is also sensitive to changes in the amount of mutant sequence and target sequence between tubes, as it depends on the amplification of various dilutions of the mutant sequence by the target sequence. Small differences in the amount of target sequences or slight inaccuracies in dilutions of mutant sequences between tubes are logarithmically amplified in the next amplification reaction and reflected in the quantification calculations. In contrast, the methods of the invention do not need to compete the control sequence with the target sequence for reagents, nor do they need to direct the reaction to the backlog phase. Both the logarithmic and posterior logarithmic phases of the amplification reaction are accurate. The target / control ratio in the methods of the invention is therefore unaffected by the background amplification reaction that may occur and remains the same regardless of the extent of the background reaction. Therefore, results are also obtained early in the amplification reaction, and variability is reduced by the use of a single target / control co-amplification reaction rather than a series of reactions.

【0011】

Applicants first provide several methods for reducing pre-amplification target levels from the amount of amplification products produced in a homeothermic nucleic acid amplification reaction that is essentially independent of background interference. .. These methods, along with the usefulness of demonstrating that each amplification reaction makes it possible to detect the minimum number of target molecules identified by having sufficient amplification activity, are the initial target amounts present. It is also useful for quantifying. These methods were made possible by the applicants' discovery of reaction variables that must be controlled to balance the amplification rates of the control sequence and the target sequence in the homeothermic amplification reaction. Like other amplification methods, the logarithm of SDA and other homeothermic reactions causes large changes in the target copy number caused by making small changes in amplification rate. Amplification rates and efficiencies are known to be sensitive to the detection of various parameters in the experiment, such as temperature, ionic strength and the presence of non-target DNA. As a result, slight changes in these (and other) parameters can result in dramatically different yields of amplified targets from nominally the same sample. This sample-to-sample change makes it extremely difficult to quantify the initial target level, and false diagnostic results, if the low amplification activity leads to the false result that the target was not present in the sample. Can bring.

【0012】

[Problems to be Solved by the Invention]

All reaction parameters that contribute to the variability of amplification rates in homeothermic reactions, however, are unknown. Moreover, the balance between control and amplification rates of such variables is more decisive and more difficult in homeothermic amplification methods, but it causes a slight imbalance in their continuity as in PCR. It does not give you the opportunity to make adjustments (see above). As a result, if slight differences in kinetics make the initial target level quantification extremely inaccurate, and low amplification activity leads to the false result that the target was not present in the sample, it will lead to false results. sell.

【0013】

The present invention provides the use of internal oligonucleotide standards in constant temperature nucleic acid amplification reactions for (1) measuring amplification reaction efficiencies and (2) quantifying pre-amplification target levels. Since the internal control sequence is amplified in the same reaction mixture as the target sequence, the ionic strength, level and temperature of the non-target nucleic acid are constant. In order to balance the amplification rates of the target and control sequences in the homeothermic amplification reaction, the target and control sequences should be substantially the same length and have substantially the same G + C content. is there. Other than the G + C content, these sequences need not be closely related at the nucleotide level. This provides an internal control sequence with metamorphic properties similar to the target sequence. Furthermore, it was found that the internal control sequence should be selected to have minimal secondary structure at amplification temperature.

【0014】

[Means for solving problems]

The present invention relates to the use of oligonucleotides as internal standards or controls in constant temperature nucleic acid amplification reactions to (1) measure amplification reaction efficiencies and (2) quantify pre-amplification target levels. Internal control oligonucleotides also provide a means of identifying "false negative" results, where the absence of amplified control sequences in a sample that is also negative for amplified target sequences is more than the absence of target sequences. Rather, it suggests a failure of the amplification reaction. The target copy number produced in a given amplification reaction depends on the amount of targets present prior to amplification and the total efficiency and rate of the amplification reaction itself. The methods of the invention provide a means of assessing the amplification activity of individual reaction mixtures independently of the presence or absence of target molecules in the sample. A known amount of internal control oligonucleotide is added to each mixture and this molecule is amplified with the target sequence, if any. By selecting this internal control sequence, the amplification rate under the reaction conditions of the standard set is approximated to the amplification rate of the target sequence. In this method, the ratio of the control concentration to the target concentration remains constant throughout the total amplification reaction. The amount of initially present target sequence is then calculated from the ratio of target to control levels after amplification and the known amount of added control sequence.

【0015】

In terms of reliability, control and target amplification rates should be as identical as possible. This is preferably achieved in the homeothermic amplification reaction by selecting a control sequence that can be amplified with the same primers used to amplify the target sequence. The use of a single set of primers reduces the level of non-specific background amplification reactions that may be encountered when multiple primer sets are used in a single amplification reaction. To achieve the same amplification rate, it is preferred to select the control sequence so that it has minimal secondary structure (and thus minimal folding) and the same length as the target sequence. Furthermore, it is preferred to distinguish the two molecules by hybridization with an oligonucleotide probe by sufficiently differentiating the internal region of the control sequence (between the primer binding sites) from the target sequence. It is preferred that the target and control sequences, however, have roughly equal G + C content to have similar hybridization and denaturation properties.

【0016】

Internal control oligonucleotides may be chemically synthesized, amplified from the cloned sequence, or isolated by other means known in the art. Conveniently, it is preferred to synthesize the oligonucleotide using any known synthetic method of the defined nucleic acid sequence. For example, C. Caruthers et al., 1982, Cold Spring Harbor Symp.Quant.Biol.47,411-418; Adams et al., 1983, J.Am.Chem.Soc.105,601; Froehler et al., 1986. , Nuc.Acids Res.14,5399; Narang et al., 1979, Methods Enz.68,90; Ogilvie et al., 1988, PNAS See 85,5764. Following the production of an internal control sequence for the selected target sequence according to the above parameters, a known amount of control sequence is added to a constant temperature nucleic acid amplification reaction, such as SDA, 3SR or Qβ replicase amplification. SDA is preferred for use with the internal controls described above. The amount of control sequence added to the reaction depends on the length of time for amplification and the estimated rate of reaction. The dynamic range of the control sequence for a given amount of target sequence is extremely wide (eg, at least 100,000 molecules or more control sequence for amplification of the 50 Mycobacterium tuberculosis (Mtb) genome). To ensure that the exact detectable amount of amplified control sequence is calculated in a given amplification reaction, prepare a dilution of the reaction mixture containing a range of control concentrations, and Gililand for competing PCR. Operate in parallel in a manner similar to the method described in (Gilliland) et al. (1989 and 1990, supra). Alternatively, if the expected degree of amplification is estimated, a control sequence is added to a single dose, a single reaction.

【0017】

After amplification, the levels of target and control sequences generated are measured by any method known in the art for detecting a particular nucleic acid sequence. For example, the amplification product is detected by hybridization to a detectable labeled oligonucleotide, where one probe specifically hybridizes to the control sequence and the other probe specifically to the target sequence. Hybridize. If the target-specific probe and the control-specific probe hybridize to the amplification product as well, the labels should be identified separately to facilitate the distinction between the respective amounts of control and target. Otherwise, separate aliquots of the amplification reaction are hybridized separately to the same labeled target-specific and control-specific probes. The detectable label is, for example, in the form of a label-inducing nucleotide, which is bound after synthesis or incorporated into the probe during synthesis. Such labels are known in the art and include labels that can be detected directly or indirectly. Directly detectable labels generate signals without the need for further chemical reactions and include fluorescent dyes, radiolabels and dyes. Indirectly detectable labels require additional chemical reactions or the addition of reagents that produce detectable signals. For example, they include enzymes such as horseradish peroxidase and alkaline phosphatase, biotin detected by binding to ligands such as labeled bound avidin, and chemiluminescent molecules. The probe may hybridize to the respective amplification product in solution, gel, or solid support. After hybridization, a signal with the associated label is generated and detected and separately quantified using the method appropriate for the selected label and hybridization protocol. The amount of signal detected for each amplification product reflects the abundance.

【0018】

One preferred method for the detection of target and control amplification products is by polymerase extension synthesis of primers that specifically hybridize to the target or control sequence. As described above, the primer is preferably labeled with a radioisotope and the primer label is incorporated into the extension reaction product. This method is described in detail in Walker et al. (1992) Nuc. Acids Res. And PNAS (above).

【0019】

Another preferred method for detecting amplified targets and control sequences is a chemiluminescent method for detecting the amplification product using a biotinylated obtained oligodeoxynucleotide probe and an enzyme binding detection oligodeoxynucleotide probe. After hybridizing these two probes to different sites of the amplified target sequence, the complex is obtained on a streptavidin-coated microtiter plate, and chemiluminescence occurs and is read on a luminescence meter. This detection method can be performed in less than 2 hours and is sensitive enough to detect the same amount as a single pre-amplified target sequence.

【0020】

When quantifying the initial level of the target sequence using the method of the invention, the post-amplification level of the target and control is measured by signaling and the level of target-specific / control-specific signal (R). It is calculated. It is found that this ratio (R: target signal / control signal) changes linearly with respect to the target / control initial concentration (ie, pre-amplification) ratio. This linear relationship was shown to be maintained over a range of 100,000 times the initial target / control ratio. As a rule, the concentration of the target present at time 0 is by comparing the target signal ratio R to the post-amplification control with the above R on the standard plot to the level of early Mycobacterium tubercrosis (Mtb). Be measured.

【0021】

When measuring sample efficiency using the methods of the invention, the amount of control sequence added to the reaction mixture is usually chosen to correspond to the minimum number of target molecular weights that should be detected in a positive sample. .. In this method, the control sequence acts as a control for the amplification reaction itself, and the detectable amplification of the control sequence present in an amount at the lowest threshold of reaction sensitivity serves to confirm a negative result for the target sequence. The inability to detect amplification of the control sequence warns the user of the fact that the sample is not really negative, but only negative due to the failure of the amplification reaction.

【0022】

A particularly preferred control oligonucleotide sequence (SEQ ID NO: 1) used in the amplification reaction for the detection of Mycobacterium tuberculosis (Mtb) is 5'-ACTGAGATCCCCTAGCGACGATGTCTGAGGCAACTAGCAAAGCTGGTCGAGTACGCC-3'. This oligonucleotide is compatible with a control-target mixture containing the Mtb target sequence from positions 972 to 1023 of the IS6110 insertion sequence (SEQ ID NO: 2): 5'ACTGAGATCCCCTATCCGTATGGTGGATAACGTCTTTCAGGTCGAGTACGCC-3'.

【0023】

[Example]

Example 1 Co-amplification of the internal control sequence and the Mtb target sequence was carried out by SDA means under the conditions described in Walker et al. (1992) with the following modifications. Each 50 μl reaction mixture contained 30,000 copies of a single-stranded control sequence molecule (SEQ ID NO: 1) and DNA of genomic Mtb present at concentrations ranging from 0 to 300,000 copies per reaction. Each reaction mixture was 50 mM potassium phosphate (pH 7.4), 6 mM magnesium chloride, 0.1 mg bovine serum albumin, 12% glycerol (v / v), 250 ng human placenta DNA (Sigma Chemical, St. Louis, MO). ), 150 units HincII (New England Biolabs, Beverly, MA) and 2.5 units exo^-It also included Clenault DNA polymerase (United States Biochemical, Cleveland, OH). The reactants are S described by Walkers et al.₁, S₂, B₁And B₂Also included oligodeoxynucleotide primers (500 nM S₁And S₂, 50nM B₁And B₂)。

【0024】

HincII and exo^-All amplification reaction components other than Clenault were mixed and the mixture was heated at 95 ° C. for 2 minutes to denature the double-stranded target DNA. After cooling to 39 ° C (3-5 minutes), Hinc II and exo^-Creno polymerase was added and the mixture was kept at 39 ° C for 2 hours and amplification was completed by heating at 95 ° C for 2 minutes. After cooling, described by Walkers et al.³²A 3.8 μl aliquot of each reaction was analyzed for the presence of either the amplified target molecule or the control molecule using the P-primer extension synthesis method. Target detection has been described by Walkers et al.³²A P-labeled probe was used. For the detection of control sequences, the following probes were used: 5'-³²P-GCTTTGCTAGTTGCC-3'(SEQ ID NO: 3). The components of primer extension synthesis are separated by polyacrylamide gel electrophoresis, and the band corresponding to the extension synthesis band specific to the target or control is excised from the gel.³²Attenuation of P radioactivity was quantified by liquid scintillation counting.

【0025】

Figure 1 shows the radioactivity measured from each band plotted against the Mtb genome copy number present in the pre-amplification mixture (counts / minute). This plot is wide (10)⁵It shows effective co-amplification of target and control sequences over the initial Mtb level in the double) range. In addition, the target signal / control signal ratio is linear with respect to the entire range of Mtb levels before amplification. Pre-amplification levels of Mtb DNA present in the sample include (i) adding a known amount of control molecule to the sample prior to amplification, (ii) co-amplifying the target and control sequence by SDA means, and (iii) targeting. The ratio after amplification of the target-specific / control-specific signal level by measuring the control-specific signal level and using a standard curve such as (iv) Ratio (R) to the plot of the Mtb genome in Figure 1. Measured by assessing the target level before amplification from.

【0026】

Example 2 Clinical samples of sputum from patients who were positive or negative for Mtb in culture were treated as follows. An equal volume of liquid reagent (potassium hydroxide / N-acetylcysteine) was added to the sputum sample. The mixture was simply mixed by swirl stirring and centrifuged at 4,000 xg for 15 minutes. Decant the supernatant and apply the precipitate twice, 25 mM KPO₄, PH 7.6. Precipitates from these wash products were autoclaved in 500 μl in the same buffer. Autoclaved samples were analyzed in a total of 50 μl standard SDA reactions using 25 μl clinical samples. The reaction contained 10,000 molecules of synthetic internal control sequence (SEQ ID NO: 1). After amplification at 37 ° C for 2 hours, the reaction was stopped by heating to 95 ° C for 2 minutes and separated for independent detection of product from IS6110 (Mtb) and internal control amplification.

【0027】

Amplified products were detected in chemiluminescence analysis. The oligonucleotide acquisition probe was synthesized using a DNA synthesizer (Model 380B, Applied Biosystems, Foster City, CA) BIOTIN-ON phosphoramidite (Clontech, Palo Alto, CA). The acquisition probe (SEQ ID NO: 4) for the control sequence was 5'-GCTTTGCTAGTTGCC-3' and the acquisition probe for the Mtb IS6110 target sequence number (SEQ ID NO: 6) was 5'-CCTGAAAGACGTTAT-3'. Oligonucleotides were subjected to reverse phase high performance liquid chromatography (HPLC) (Brownlee Lab Aquapore RP300 column 220 x 4.6 mm, C8 column, 7 particles, 300 Å pore size) 14-44 in buffer A using a UV monitor at 254 nm. Purification was performed using a gradient of% buffer B for 1 hour (buffer B: 0.1 M triethylamine-acetate, pH 7 and 50% acetonitrile; buffer A: 0.1 M triethylamine-acetate, pH 7) at a flow rate of 1 ml / min.

【0028】

Probes for oligonucleotide detection were synthesized using a model 380 BDNA synthesizer and a 3'-amino-modified C3 column (Glen Research, Sterling, VA). This then produced an oligonucleotide with a 3'amino terminus for binding to alkaline phosphatase. The detection probe (SEQ ID NO: 5) for the control sequence is 5'-TCAGACATCGTCGCT-al.₂-AP-3'(al₂Is an amino bond 2). The detection probe (SEQ ID NO: 7) for the IS6110 target SEQ ID NO: was 5'-CCACCATACGGATAGT-am-AP-3'(am is amino-modified). Calf intestinal alkaline phosphatase (AP) (EIA grade, Boehringer Mannheim, Indianapolis, ID) is then dialyzed against 50 mM potassium phosphate (pH 7.5) at 4 ° C overnight to remove aggregates. Centrifuged. 40 μl of 50 mM succinimidyl-4- (p-maleimidephenyl) butyrate (SMPB) (Pierce, Rockford, WI) in which 4 ml of 10 mg / ml AP was dissolved in N, N'-dimethylformamide (DMF) (Aldrich, Milwaukee, WI). It was mixed with IL) and reacted in the dark at room temperature for 30 minutes. Induced AP and excess SMPB on NAP-25 column (Pharmacia) and 50 mM potassium phosphate (pH 7.5) (degassed N₂Separated using a purge). Absorption of NAP-25 column fractions was read at 260 nm and 280 nm, and void volume peaks were preserved. The concentration of induced alkaline phosphatase is 0m75ml / μmole^-1It was measured by absorption at 280 nm using the extinction coefficient of. The resulting derivatized AP was placed on ice for less than 2 hours before binding to the derivatized oligodeoxynucleotide.

【0029】

50 nmole oligodeoxynucleotides diluted with 13.4 μl 1M potassium phosphate (pH 7.2) and 26.8 μl diluted with DMF 26.8 μl 50 mM n-succinimidyl-3- (2-pyridyldithio) propionate (SPDP) (Pierce, Rockford) , IL) and mixed. The mixture was incubated in the dark for 1 hour at room temperature. Dithiothreitol (DTT) was diluted with 50 mM potassium phosphate (pH 7.5) to a concentration of 1 M and added to oligodeoxynucleotide / DMF to a final concentration of 0.1 M and incubated for 15 minutes at room temperature. Excess DTT and SPDP were separated from the derivatized oligodeoxynucleotides, which were eluted with 50 mM potassium phosphate (pH 7.5) using a NAP-25 column (degassing and N).₂Purge with). This derivatized oligodeoxynucleotide eluted the void volume as judged by absorption at 160 nm and 180 nm. The reduced oligodeoxynucleotides were reacted with the derivatized AP within 10 minutes to avoid oxidation. Derived oligodeoxynucleotides and derivatized APs were incubated overnight at room temperature for 1-4 hours and then at 4 ° C. This solution was quenched using 1/100 times the volume of 50 mM beta-mercaptoethanol in 50 mM potassium phosphate (pH 7.5). The crude conjugate was concentrated to about 2 ml with 20 mM Tris (pH 7.5) using CENTRIPREP30 (Amicon) according to the manufacturer's instructions. The crude conjugate was purified by HPLC using a DEAE-5PW column (7.5 mm x 7.5 cm) and a gradient of 0-66% buffer B in buffer A at a flow rate of 1 ml / min (buffer B: 20 mM Tris). , 1MNaCl (pH 7.5); Buffer A: 20 mM Tris (pH 7.5)). Absorption was monitored at 254 nm. A₂₆₀And A₂₈₀Absorption in A was measured using a spectrophotometer.₂₆₀/ A₂₈₀Collected the = 1 fractions. The protein concentration of the bound oligodeoxynucleotide was measured (BCA Protein Assay Kit, Pierce, Rockford, IL).

【0030】

The activity of the oligodeoxynucleotide probe for detecting alkaline phosphatase (AP) was measured as follows. Bounds, 50 mM Tris-HCl, 100 mM NaCl, 1 mM MgCl₂Diluted to 5 μg / ml in 1 mg / ml BSA (pH 7.5). Substrate, 4-nitrophenyl phosphate (pNPP), concentration 5 mM, 1M diethanolamine, 1 mM MgCl₂Prepared in (pH 9.8). AP activity was analyzed at 25 ° C as follows. The conjugate (5 μl) was pipette into 2 ml of substrate solution and changes in absorption were monitored at 405 nm. The initial rate is calculated from the linear region, and the reaction rate is the extinction coefficient of the product p-nitrophenol at 18500 M at 405 nm.^-1cm^-1Calculated using as equal to. The specific activity of the oligodeoxynucleotide for AP detection was calculated at μmole / min / mg. The AP detection probe was diluted to 2 μM in 20 mM Tris (pH 7.5), 1 M NaCl, 50 μg / ml sonicated salmon sperm DNA, 0.05% sodium azide and then stored at 4 ° C. The 20 mM Tris (pH 7.5), 1 M NaCl buffer was autoclaved prior to the addition of other ingredients.

【0031】

Coated microtiter plates for obtaining the target / probe complex were prepared as follows. Biotinylated bovine serum albumin (Biotin * BSA) (Pierce, Rockford, IL) diluted to 5 μg / ml in 0.3 M glycine (pH 9.6) (prepared using autoclaved water), and MICROLITEI plate (prepared using autoclaved water). Pipette into each well (200 μl / well) of Dynatech, Chantilly, VA). Plates were incubated overnight at 4 ° C and FTA hemagglutination buffers (Becton Dickinson Microbiology) prepared using autoclaved water. Washed twice using Systems) (pH 7.2) (375 μl / wash). Streptavidin (50 μg / ml) (BRL, Bethesda, MD) in hemagglutination buffer was added to biotin * BSA-coated microtiter wells (100 μl / well). Plates were covered and incubated for 1 hour at 37 ° C. Unbound streptavidin was discarded by inversion and manual agitation. Blocking buffer (300 μl / well) (hemoglutination buffer (pH 7.2), 0.05% w / v bovine serum albumin) was then added. Plates were covered and incubated for 30 minutes at 37 ° C. The blocking buffer was discarded by inversion and manual agitation. Plates were washed twice with hemagglutination buffer (375 μl / well) and 2% Washed once with hemagglutination buffer containing w / v trehalose (375 μl / well) (Fluka, Ronkonkoma, NY). The plate is tapped vigorously to dry by hand, and dried under vacuum at 0.5 Torr at 25 ° C for about 4 hours, sealed with a desiccant-containing mylar pouch, and before use, Stored overnight at room temperature. After that, the plate was stored at 2-8 ° C.

【0032】

The SDA reactant (50 μl) in a microcentrifuge was mixed with 5 μl of 1 mg / ml carrier DNA (cut by sonication) (salmon sperm, Sigma, St. Louis, MO). The sample was heated at 95 ° C for 5 minutes to deflate the DNA and cooled at room temperature for 5 minutes. 45 μl hybridization mixture (0.5 M sodium phosphate (pH 7.0), 0.1% w / v bovine serum albumin (Sigma, St. Louis, MO)), 2 pmole biotinylated oligodeoxynucleotide probe, and 0.5-1 pmole AP A detection oligodeoxynucleotide probe was added to each sample to bring the final volume to 100 μl. The samples were incubated for 5 minutes at 37 ° C to hybridize the DNA. Individual samples were added to each microtiter plate well, covered and incubated for 30 minutes at 37 ° C. 3 stringency washes (300 μl / well) (10 mM sodium phosphate (pH 7.0), 0.1% w / v bovine serum albumin, 0.05% v / v NONIDET 40) was carried out at room temperature. Each wash was removed by leaving it in a microtiter well for 1 minute. LUMIPHOS 530 (100 μl) (Lumigen, Inc., Detroit, MI) substrate was added, and the plates were covered and incubated for 30 minutes at 37 ° C. Emissions were read in Relative Light Units (RLU) on a microtiter plate luminometer (Labsystems, Research Triangle Park, NC) at 37 ° C with a 2 second / well integration time.

【0033】

A in Figure 2 shows the RLU results for six separate clinically negative samples for both Mtb (TB) and internal control amplification products. The dashed line on the RLU TB axis shows the RLU from the standard curve in the absence of the Mtb target sequence. This value (less than 50 RLU) should be expected for the sample to be negative. The dashed line on the RLU control axis indicates the value of the internal control sequence in the absence of inhibition of the amplification product. Only one of the negative samples (N1) shows no inhibition of amplification of the internal control sequence. The corresponding TB signal from this sample is less than or equal to 0 from the standard curve, suggesting that this sample is truly negative for Mtb. Each of the remaining samples (particularly N2, N4, N5 and N6) shows inhibition of internal controls and low TB values. In the absence of an internal control, these samples may be mistakenly considered negative for the DNA probe set niyoriTB. That is, this internal control sequence avoids a false negative. Since about 95% of clinical samples are negative for Tb, the value of this internal control to force the user to discard the true negative is significant.

【0034】

B in Figure 2 shows the results for a series of positive clinical samples. Each sample shows some inhibition of internal control amplification. However, even the TB signal for samples with low RLU (1600 RLU, P1) was above zero (about 50 RLU), which quickly confirms that these samples are positive.

【0035】

FIG. 3 shows that the use of the sample TB / control signal ratios in A and B of FIG. 2 compensates or corrects the consequences of amplification inhibition. Samples with a high TB / control ratio are truly positive, and samples with a low ratio are truly negative. A suitable minimum ratio for positivity is measured from the standard curve resulting from amplifying a series of known amounts of target sequences (even if they do not contain target sequences) with a fixed amount of control sequences. This standard curve is also used to quantify the amount of target sequence initially present in the sample.

【0036】

Example 3 Internal control sequences were co-amplified with various levels of Mtb genomic DNA. Samples of generated Mtb DNA, 0, 5, 10, 25 or 50 genomic copies were co-amplified by SDA reaction with 25,000 copies of synthetic internal control sequence (SEQ ID NO: 1). Following SDA, product detection was performed in two ways by chemiluminescence as described above. In Figure 4, the Mtb signal is indicated by a bar and the internal control for the corresponding reaction is indicated by a black circle. The special tube showed slightly higher or lower internal control levels, but the overall flow was significantly constant regardless of the initial ratio of control sequence to target sequence.

【0037】

[Sequence list]

SEQ ID NO: 1 Array length: 57 Sequence type: Nucleic acid Number of chains: Single chain Topology: Linear Array ACTGAGATCC CCTAGCGACG ATGTCTGAGG CAACTAGCAA AGCTGGTCGA GTACGCC 57 SEQ ID NO: 2 Array length: 52 Sequence type: Nucleic acid Number of chains: Double chain Topology: Linear Sequence type: genomic DNA origin Organism name: Mycobacterium tuberculosis Array ACTGAGATCC CCTATCCGTA TGGTGGATAA CGTCTTTCAG GTCGAGTACG CC 52 SEQ ID NO: 3 Array length: 15 Sequence type: Nucleic acid Number of chains: Single chain Topology: Linear Array GCTTTGCTAG TTGCC 15 SEQ ID NO: 4 Array length: 15 Sequence type: Nucleic acid Number of chains: Single chain Topology: Linear Array features Feature symbol: misc feature Location: 1 Other information: Standard name = 5'biotin label : Symbol = 5'-BBB- Array GCTTTGCTAG TTGCC 15 SEQ ID NO: 5 Array length: 15 Sequence type: Nucleic acid Number of chains: Single chain Topology: Linear Array features Feature symbol: misc feature Location: 15 Other information: Standard name = 3'amino binding to alkaline phosphatase : Symbol = 5'-BBB- Array TCAGACATCG TCGCT 15 SEQ ID NO: 6 Array length: 15 Sequence type: Nucleic acid Number of chains: Single chain Topology: Linear Array features Feature symbol: misc feature Location: 1 Other information: Standard name = 5'biotin label : Symbol = 5'-BBB- Array CCTGAAAGAC GTTAT 15 SEQ ID NO: 7 Array length: 16 Sequence type: Nucleic acid Number of chains: Single chain Topology: Linear Array features Feature symbol: misc feature Location: 15 Other information: Standard name = 3'amino binding to alkaline phosphatase : Symbol = 5'-BBB- Array CCACCATACG GATAGT 16 [0038]

[Simple explanation of drawings]

【0039】

[Figure 1]

FIG. 1 shows the co-amplification of the internal control sequence of Mycobacterium tuberculosis and the IS6110 sequence fragment.

【0040】

[Figure 2]

FIG. 2 shows the advantages of including an internal control sequence as a control in homeothermic nucleic acid amplification of clinical samples to detect amplification inhibition and to identify "wrong negatives". A shows the analysis of samples that were clinically negative by culture. B shows the analysis of samples that were clinically positive in culture.

【0041】

[Fig. 3]

Figure 3 shows the use of target / control sequence ratios to correct the inhibition of amplification in clinical samples and aids in accurate interpretation of the results.

【0042】

[Fig. 4]

FIG. 4 shows the concordance of amplification of a fixed amount of control sequence in the presence of varying amounts of target sequence.