JP2016198110A

Methods and compositions for targeted modification of genome

Abstract

Problem to be solved.To provide a method and a composition for target modification of a genome. Eukaryotic cells, mammalian cells, human cells, or non-human mammalian cells using large targeting vectors (LTVECs) containing the various endogenous or exogenous nucleic acid sequences described herein. Provided are compositions and methods for modifying genomic loci of interest. A further method combines the use of LTVEC with the CRISPR / Cas system. Compositions and methods for producing genetically modified non-human animals, including one or more target gene modifications, in their germline are also provided. [Selection diagram] None

JP2016198110A, drawing sheet 1 — Sheet 1 of 158

Term

9.8 yearsto projected expiry

Projected expiry 27 July 2036, counted from filing; an application has no term until it is granted.

1 claim: 1 independent, 0 dependent

1
本願明細書に記載の発明。

532 paragraphs, as filed

0001Cross-reference of related applications This application is filed on December 11, 2013, US Provisional Patent Application No. 61 / 914,768, US Provisional Patent Application No. 62 / 017,416, filed June 26, 2014, July 25, 2014. US Provisional Patent Application No. 62 / 29,261 filed in, US Provisional Patent Application No. 62 / 052,906 filed on September 19, 2014, US Provisional Patent Application No. 62 filed on October 3, 2014 . Claiming the interests of / 059,527, US Provisional Patent Application No. 62 / 064,384 filed October 15, 2014, each of which is incorporated by reference in its entirety for all purposes.

0002References for sequence listings submitted as text files via EFS WEB The official copy of the sequence listing was created on October 15, 2014 and is a file named 453460SEQLIST.TXT with a size of 27.5 kilobytes, submitted electronically via EFS-Web as an ASCII format sequence listing. It is filed with this specification. The sequence listings contained in this ASCII document are part of this specification and are incorporated herein by reference in their entirety.

0003Rats include, but are not limited to, cardiovascular (eg, hypertension), metabolic (eg, obesity, diabetes), neurological (eg, pain pathology), and various cancers. Although regarded as an important animal model system capable of reproducing pathology, one is their pluripotency after a series of genetic modifications in vitro, eg, one or more continuous electroperforations. Due to the lack of pluripotent rat cells capable of transmitting germline lines that can maintain the gene, yet another is the large genomic DNA sequence in pluripotent rat cells. Due to the lack of efficient targeting techniques that allow introduction or deletion, or replacement of large endogenous genomic DNA sequences with exogenous nucleic acid sequences, the use of rats in modeling human diseases is compared to mice. Is limited.

0004In the art, compositions and methods that enable accurate target changes in the genome of an organism that can open up or expand the current field of target discovery to verify therapeutic agents more quickly and easily. is necessary.

Methods for modifying genomic loci of interest in eukaryotic cells via target gene modification are provided. Such a method is a large targeting vector (LTVEC) containing (a) a eukaryotic cell and (i) a first nucleic acid that is at least 10 kb and is flanked by 5'homologous and 3'homologous arms. , (Ii) a first expression construct containing a first promoter operably linked to a second nucleic acid encoding a Cas protein, (iii) a nucleotide sequence that hybridizes to a target sequence and a trans-activated CRISPR Introducing a second expression construct, which comprises a second promoter operably linked to a third nucleic acid encoding a guide RNA (gRNA), including RNA (tracrRNA), the first and the first. 2 Promoters are active in eukaryotic cells, including introduction and (b) identification of modified eukaryotic cells, including target gene modifications at the genomic locus of interest. In one embodiment, the target gene modification is a genetic modification of two alleles. In one embodiment, the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. In another embodiment the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb. In one embodiment, the eukaryotic cell is a mammalian cell. In one embodiment, the mammalian cell is a fibroblast. In one embodiment, the eukaryotic cell is a pluripotent cell. In one embodiment, the pluripotent cell is a human pluripotent cell. In one embodiment, the human pluripotent cell is a human embryonic stem (ES) cell or a human adult stem cell. In another embodiment, human pluripotent cells are developmentally restricted human progenitor cells. In another embodiment, the human pluripotent cell is a human-induced pluripotent stem (iPS) cell. In one embodiment, the Cas protein is Cas9. In one embodiment, the target sequence is flanked by a protospacer flanking motif (PAM) sequence. In one embodiment, the target sequence is immediately flanked by the protospacer flanking motif (PAM) sequence on the 3'end. In some embodiments, the sum of the 5'and 3'homology arms is from about 10 kb to about 150 kb. In some embodiments, the sum of the 5'and 3'homology arms of LTVEC is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb. , About 100 kb to about 120 kb, or about 120 kb to 150 kb. In this method, the target gene modification is (a) homology of an endogenous nucleic acid sequence or replacement with an orthologous nucleic acid sequence, (b) deletion of an endogenous nucleic acid sequence, and (c) deletion of an endogenous nucleic acid sequence. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ about Deletion of endogenous nucleic acid sequence, insertion of exogenous nucleic acid sequence, (e) about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, ranging from 3 Mb. , About 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, about 150 kb ~ about 200 kb, about 200 kb ~ about 250 kb, about 250 kb ~ about 300 kb, about 300 kb ~ about 350 kb, or about 350 kb ~ about 400 kb Extensive insertion of exogenous nucleic acid sequences, (f) insertion of exogenous nucleic acid sequences containing homologous or orthologous nucleic acid sequences, (g) insertion of chimeric nucleic acid sequences containing human and non-human nucleic acid sequences, (h) site specificity Insertion of conditional allelic genes adjacent to the target recombinase target sequence, (i) insertion of selectable marker or reporter genes operably linked to a third promoter active in pluripotent cells, or (j) them. It is further specified that the combination of. In one embodiment, the genomic locus of interest comprises (i) a 5'target sequence homologous to the 5'homologous arm and (ii) a 3'target sequence homologous to the 3'homologous arm. In some embodiments, the 5'and 3'target sequences are at least 5 kb but less than 3 Mb apart. In some embodiments, the 5'and 3'target sequences are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, At least 60 kb but less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb Less than about 400 kb, at least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb There is less than about 2.5 Mb, or at least about 2.5 Mb but less than about 3 Mb apart. In one embodiment, the genomic locus of interest comprises the interleukin-2 receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2 locus, or both the Rag1 and Rag2 loci. In one embodiment, the first and second expression constructs are on a single nucleic acid molecule. It involves exposing the genome to Cas protein and CRISPR RNA in the presence of a large targeting vector (LTVEC) containing a nucleic acid sequence of at least 10 kb, which is at least after exposure to Cas protein, CRISPR RNA, and LTVEC. Further methods are provided for modifying the genome, which are modified to include a 10 kb nucleic acid sequence. In some such methods, the LTVEC comprises a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. In some such methods, the LTVEC comprises a nucleic acid sequence of at least 100 kb, at least 150 kb, or at least 200 kb. In the presence of a large targeting vector (LTVEC), the genome comprises contacting the Cas protein, CRISPR RNA that hybridizes to the target sequence, and tracrRNA, with an LTVEC of at least 10 kb, a 5'homologous arm and 3 'The genome of interest is such that after contact with the Cas protein, CRISPR RNA, and tracrRNA, where the homology arm contains the adjacent first nucleic acid and in the presence of LTVEC, this genome contains the first nucleic acid. Further methods are provided for modifying the genome, which are modified at the loci. The target sequence can be at or near the genomic locus of interest. In some such methods, the genome is in the eukaryotic cell and the Cas protein, CRISPR RNA, tracrRNA, and LTVEC are introduced into the eukaryotic cell. Some such methods further include identifying modified eukaryotic cells, including target gene modifications at the genomic locus of interest. In some such methods, CRISPR RNA and tracrRNA are introduced together in the form of a single guide RNA (gRNA). In other methods, CRISPR RNA and tracrRNA are introduced separately. In some such methods, (a) Cas protein is introduced into eukaryotic cells in the form of protein, messenger RNA (mRNA) encoding Cas protein, or DNA encoding Cas protein, and (b) CRISPR. RNA is introduced into eukaryotic cells in the form of RNA or DNA encoding CRISPR RNA, and (c) tracrRNA is introduced into eukaryotic cells in the form of RNA or DNA encoding tracrRNA. In some methods, (a) the DNA encoding the Cas protein is in the form of a first expression construct that comprises a first promoter operably linked to a second nucleic acid encoding the Cas protein. b) DNA encoding CRISPR RNA is in the form of a second expression construct containing a second promoter operably linked to a third nucleic acid encoding CRISPR RNA, and (c) encodes tracr RNA. DNA is the form of a third expression construct containing a third promoter operably linked to a fourth nucleic acid encoding tracrRNA, the first, second, and third promoters being eukaryotic cells. Is active in. Optionally, the first, second, and / or third expression constructs are on a single nucleic acid molecule. In some methods, (a) the DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) DNA encoding CRISPR RNA and DNA encoding tracrRNA are second expression constructs containing a second promoter operably linked to a third nucleic acid encoding gRNA containing CRISPR RNA and tracrRNA. In morphology, the first and second promoters are active in eukaryotic cells. Optionally, the first and second expression constructs are on a single nucleic acid molecule. In some methods, Cas protein, CRISPR RNA, and tracrRNA are introduced into eukaryotic cells as a protein-RNA complex. In some methods, the target gene modification simultaneously comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest and the insertion of the first nucleic acid at the genomic locus of interest. In some methods, the deleted endogenous nucleic acid sequence is from about 30 kb to about 110 kb and the inserted first nucleic acid is from about 40 kb to about 140 kb. In some methods, the deleted endogenous nucleic acid sequence is from about 38 kb to about 110 kb and the inserted first nucleic acid is from about 43 kb to about 134 kb. In some methods, the target gene modification is a genetic modification of two alleles. Optionally, genetic modification of the two alleles involves deletion of the endogenous nucleic acid sequence at the genomic locus of interest on the two homologous chromosomes and insertion of the first nucleic acid. In some methods, the modified eukaryotic cells are complex heterozygous at the genomic locus of interest. In some methods, the modified eukaryotic cells are semi-zygous at the genomic locus of interest. Optionally, target gene modification at the genomic locus of interest on one chromosome involves deletion of the endogenous nucleic acid sequence and insertion of the first nucleic acid. Optionally, the target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes, and (2) a first to the genomic locus of interest on the first chromosome. Includes insertion of one nucleic acid and disruption of the genomic locus of interest on the second chromosome. The first chromosome can be one of two homologous chromosomes and the second chromosome can be the other homologous chromosome. In some methods, the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. Optionally, the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb. In some methods, the first nucleic acid is at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, or at least. It is 300 kb. In some methods, the first nucleic acid is about 40 kb to about 140 kb. In some methods, the first nucleic acid is about 43 kb to about 134 kb. In some methods, eukaryotic cells are mammalian cells, fibroblasts, pluripotent cells, non-human pluripotent cells, rodent pluripotent cells, mouse or rat embryonic stem (ES) cells, humans. Pluripotent cells, human embryonic stem (ES) cells, human adult stem cells, developmentally restricted human progenitor cells, or human-induced pluripotent stem (iPS) cells. In some methods, the Cas protein is Cas9. In some methods, the target sequence is immediately flanked by the protospacer flanking motif (PAM) sequence. In some methods, the sum of the LTVEC 5'and 3'homology arms is about 10 kb to about 150 kb. Optionally, the sum of the LTVEC 5'and 3'homology arms is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb ~. It is about 120 kb, or about 120 kb to 150 kb. In some methods, the target gene modification is (a) homology or replacement of the endogenous nucleic acid sequence with an orthologous nucleic acid sequence, (b) deletion of the endogenous nucleic acid sequence, (c) deletion of the endogenous nucleic acid sequence. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb , About 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ About 3 Mb deletion of endogenous nucleic acid sequence, (d) Insertion of exogenous nucleic acid sequence, (e) About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ About 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, about 150 kb ~ about 200 kb, about 200 kb ~ about 250 kb, about 250 kb ~ about 300 kb, about 300 kb ~ about 350 kb, or about 350 kb ~ about Insertion of exogenous nucleic acid sequences ranging from 400 kb, (f) Insertion of exogenous nucleic acid sequences containing homologous or orthologous nucleic acid sequences, (g) Insertion of chimeric nucleic acid sequences containing human and non-human nucleic acid sequences, (h) Insertion of a conditional allelic gene flanked by a site-specific recombinase target sequence, (i) insertion of a selectable marker or reporter gene operably linked to a third promoter active in pluripotent cells, or (j) ) Including their combination. In some methods, the genomic locus of interest comprises (i) a 5'target sequence homologous to the 5'homologous arm and (ii) a 3'target sequence homologous to the 3'homologous arm. .. Optionally, the 5'and 3'target sequences are at least 5 kb but less than 3 Mb apart. Optionally, the 5'and 3'target sequences are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, and at least 60 kb. Is less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb but less than about 400 kb, At least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but about 2.5 Less than Mb, or at least about 2.5 Mb but less than about 3 Mb apart. Optionally, the 5'and 3'target sequences are at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 110 kb, at least 120 kb, at least 130 kb, They are at least 140 kb, at least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at least 190 kb, or at least 200 kb apart. In some methods, the 5'and 3'target sequences are separated by about 30 kb to about 110 kb. In some methods, the 5'and 3'target sequences are separated by about 38 kb to about 110 kb. In some methods, the genomic locus of interest comprises the interleukin-2 receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2 locus, or both the Rag1 and Rag2 loci. In other methods, the genomic locus of interest comprises the Adamts5 locus, the Trpa1 locus, the Fohl1 locus, or the Erbb4 locus. In yet other methods, the genomic locus of interest comprises the Lrp5 locus. In still other methods, the genomic locus of interest comprises the C5 (Hc) locus, the Ror1 locus, or the Dpp4 locus. Further methods for producing F0 generation non-human animals, including target gene modification at the genomic locus of interest, are provided, the method being a major target for (a) forming modified non-human ES cells. Contacting the genome in non-human ES cells with Cas protein, CRISPR RNA, and tracrRNA in the presence of a conversion vector (LTVEC), where the LTVEC is at least 10 kb, 5'homologous arm and 3'homologous. Contacting the sex arm containing the adjacent first nucleic acid, (b) identifying modified non-human ES cells containing the target gene modification at the genomic locus of interest, and (c) modification. The surrogate mother modifies the target gene at the genomic locus of interest, including the introduction of the non-human ES cells into the non-human host embryo and (d) the conception of the non-human host embryo in the surrogate mother. Produces F0 generation non-human animals, including. In some such methods, CRISPR RNA and tracrRNA are introduced together in the form of a single guide RNA (gRNA). In other such methods, CRISPR RNA and tracrRNA are introduced separately. In some such methods, (a) Cas protein is introduced into non-human ES cells in the form of protein, messenger RNA (mRNA) encoding Cas protein, or DNA encoding Cas protein, and (b) CRISPR RNA is introduced into non-human ES cells in the form of RNA or DNA encoding CRISPR RNA, and (c) tracrRNA is introduced into non-human ES cells in the form of RNA or DNA encoding tracrRNA. In some such methods, (a) the DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. Yes, (b) the DNA encoding CRISPR RNA is in the form of a second expression construct containing a second promoter operably linked to a third nucleic acid encoding CRISPR RNA, and (c) tracrRNA. The DNA encoding tracrRNA is in the form of a third expression construct containing a third promoter operably linked to a fourth nucleic acid encoding tracrRNA, the first, second, and third promoters. It is active in non-human ES cells. Optionally, the first, second, and third expression constructs are on a single nucleic acid molecule. In some such methods, (a) the DNA encoding the Cas protein is in the form of a first expression construct containing a first promoter operably linked to a second nucleic acid encoding the Cas protein. Yes, and (b) the DNA encoding the CRISPR RNA and the DNA encoding the tracr RNA are the second including the second promoter operably linked to the third nucleic acid encoding the gRNA containing the CRISPR RNA and the tracr RNA. In the form of an expression construct, the first and second promoters are active in non-human ES cells. Optionally, the first and second expression constructs are on a single nucleic acid molecule. In some such methods, Cas protein, CRISPR RNA, and tracrRNA are introduced into non-human ES cells as a protein-RNA complex. In some such methods, the target gene modification simultaneously comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest and the insertion of the first nucleic acid at the genomic locus of interest. In some such methods, the target gene modification is a genetic modification of two alleles. Optionally, genetic modification of the two alleles involves deletion of the endogenous nucleic acid sequence at the genomic locus of interest on the two homologous chromosomes and insertion of the first nucleic acid. In some such methods, modified non-human ES cells are complex heterozygous at the genomic locus of interest. In some such methods, modified non-human ES cells are semi-zygous at the genomic locus of interest. Optionally, target gene modification at the genomic locus of interest on one chromosome involves deletion of the endogenous nucleic acid sequence and insertion of the first nucleic acid. Optionally, the target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes, and (2) a first to the genomic locus of interest on the first chromosome. Includes insertion of one nucleic acid and disruption of the genomic locus of interest on the second chromosome. The first chromosome can be one of two homologous chromosomes and the second chromosome can be the other homologous chromosome. In some such methods, the Cas protein is Cas9. A method for modifying the genome at a genomic locus of interest in eukaryotic, mouse, or human cells, in the presence of a large targeting vector (LTVEC), the genome of the Cas protein, subject. The LTVEC is at least 10 kb, including contacting with CRISPR RNA and tracrRNA that hybridize to the target sequence at the genomic locus of interest, and 5'homologous to the 5'target sequence at the genomic locus of interest. The sex arm and the 3'homologous arm, which is homologous to the 3'target sequence at the genomic locus of interest, contain the adjacent first nucleic acid, the first nucleic acid being at least 30 kb and / or the 5'target. The sequences and 3'target sequences are separated by at least 30 kb, and after contact with Cas protein, CRISPR RNA, and tracrRNA in the presence of LTVEC, this genome is the first nucleic acid at the genomic locus of interest. Further provided are methods that are modified to include target gene modifications involving insertion. Any of the above methods may further comprise the introduction of Cas protein, CRISPR RNA, tracrRNA, and LTVEC into eukaryotic, mouse, or human cells. Any of the above methods may further comprise identifying modified eukaryotic cells, modified mouse cells, or modified human cells containing the target gene modification at the genomic locus of interest. In some of the above methods, CRISPR RNA and tracrRNA are introduced together in the form of a single transcript. In some of the above methods, CRISPR RNA and tracrRNA are introduced separately. In some of the above methods, (a) Cas protein is introduced into eukaryotic cells, mouse cells, or human cells in the form of protein, messenger RNA (mRNA) encoding Cas protein, or DNA encoding Cas protein. (B) CRISPR RNA is introduced into eukaryotic cells, mouse cells, or human cells in the form of RNA or DNA encoding CRISPR RNA, and (c) tracrRNA is in the form of RNA or DNA encoding tracrRNA. Is introduced into eukaryotic cells, mouse cells, or human cells. In some of the above methods, Cas protein, CRISPR RNA, and tracrRNA are introduced into eukaryotic, mouse, or human cells as a protein-RNA complex. In some of the above methods, (a) the DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. , (B) The DNA encoding CRISPR RNA is in the form of a second expression construct containing a second promoter operably linked to a third nucleic acid encoding CRISPR RNA, and (c) tracrRNA. The encoding DNA is in the form of a third expression construct containing a third promoter operably linked to a fourth nucleic acid encoding tracrRNA, the first, second, and third promoters being true. It is active in nuclear cells, mouse cells, or human cells. In some of the above methods, the first, second, and / or third expression constructs are on a single nucleic acid molecule. In some of the above methods, (a) the DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. And (b) DNA encoding CRISPR RNA and DNA encoding tracrRNA are second promoters operably linked to a third nucleic acid encoding gRNA containing CRISPR RNA and tracrRNA in a single transcript. The first and second promoters are active in eukaryotic cells, mouse cells, or human cells. In some of the above methods, the first and second expression constructs are on a single nucleic acid molecule. In some of the above methods, the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. In some of the above methods, the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb. In some of the above methods, the first nucleic acid is at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, Or at least 300 kb. In some of the above methods, the first nucleic acid is from about 40 kb to about 140 kb. In some of the above methods, the sum of the LTVEC 5'and 3'homology arms is about 10 kb to about 150 kb. In some of the above methods, the sum of the LTVEC 5'and 3'homology arms is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 80 kb. It is 100 kb, about 100 kb to about 120 kb, or about 120 kb to 150 kb. In some of the above methods, the 5'and 3'target sequences are at least 5 kb but less than 3 Mb apart. In some of the above methods, the 5'and 3'target sequences are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, and at least 40 kb but less than 60 kb. At least 60 kb but less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb Is less than about 400 kb, at least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb But less than about 2.5 Mb, or at least about 2.5 Mb but less than about 3 Mb apart. In some of the above methods, the 5'and 3'target sequences are at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 110 kb, at least 110 kb. They are 120 kb, at least 130 kb, at least 140 kb, at least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at least 190 kb, or at least 200 kb apart. In some of the above methods, the 5'and 3'target sequences are separated by about 30 kb to about 110 kb. In some of the above methods, eukaryotic cells are not rat cells. In some of the above methods, eukaryotic cells are pluripotent cells, non-pluripotent cells, mammalian cells, human cells, non-human mammalian cells, rodent cells, mouse cells, hamster cells, non-humans. It is a pluripotent cell, a human pluripotent cell, a rodent pluripotent cell, or a fibroblast. In some of the above methods, eukaryotic cells are primary cells or immortalized cells. In some of the above methods, rodent pluripotent cells are mouse or rat embryonic stem (ES) cells. In some of the above methods, mouse or human cells are primary cells or immortalized cells. In some of the above methods, mouse or human cells are pluripotent cells. In some of the above methods, mouse pluripotent cells are mouse embryonic stem (ES) cells. In some of the above methods, human pluripotent cells are human embryonic stem (ES) cells, human adult stem cells, developmentally restricted human progenitor cells, or human induced pluripotent stem (iPS) cells. .. In some of the above methods, human iPS cells are maintained in medium containing basal medium and supplements, which medium is (a) leukemia inhibitory factor (LIF) polypeptide, (b) glycogen synthase kinase (GSK3). ) Inhibitor, and (c) MEK inhibitor, this medium has an osmol concentration of about 175 mOsm / kg to about 280 mOsm / kg. In some of the above methods, the Cas protein is Cas9. In some of the above methods, the target sequence is immediately flanked by the protospacer flanking motif (PAM) sequence. In some of the above methods, the target gene modification simultaneously comprises the deletion of the endogenous nucleic acid sequence at the genomic locus of interest and the insertion of the first nucleic acid at the genomic locus of interest in a single step. .. In some of the above methods, the deleted endogenous nucleic acid sequence is from about 30 kb to about 110 kb and the inserted first nucleic acid is from about 40 kb to about 140 kb. In some of the above methods, the target gene modification is a genetic modification of two alleles. In some of the above methods, genetic modification of the two alleles involves deletion of the endogenous nucleic acid sequence at the genomic locus of interest on the two homologous chromosomes and insertion of the first nucleic acid. In some of the above methods, modified eukaryotic cells, modified mouse cells, or modified human cells are complex heterozygous at the genomic locus of interest. In some of the above methods, the modified eukaryotic cell, modified mouse cell, or modified human cell is semizygous at the genomic locus of interest. In some of the above methods, target gene modification at the genomic locus of interest on one chromosome involves deletion of the endogenous nucleic acid sequence and insertion of the first nucleic acid. In some of the above methods, the target gene modification is (1) deletion of an endogenous nucleic acid sequence at the genomic locus of interest on the first and second homologous chromosomes, and (2) the first homologous chromosome. Includes insertion of the first nucleic acid into the genomic locus of interest in and disruption of the genomic locus of interest in the second homologous chromosome. In some of the above methods, the target gene modification is (a) substitution of an endogenous nucleic acid sequence with a homologous or orthologous nucleic acid sequence, (b) deletion of an endogenous nucleic acid sequence, (c) deletion of an endogenous nucleic acid sequence. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ About 200kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about Deletion of endogenous nucleic acid sequences ranging from 2.5 Mb to about 3 Mb, (d) Insertion of exogenous nucleic acid sequences, (e) About 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40kb ~ about 60kb, about 60kb ~ about 80kb, about 80kb ~ about 100kb, about 100kb ~ about 150kb, about 150kb ~ about 200kb, about 200kb ~ about 250kb, about 250kb ~ about 300kb, about 300kb ~ about 350kb, or about 350kb Insertion of exogenous nucleic acid sequences ranging from ~ about 400 kb, (f) insertion of exogenous nucleic acid sequences containing homologous or orthologous nucleic acid sequences, (g) insertion of chimeric nucleic acid sequences containing human and non-human nucleic acid sequences, ( h) Insertion of a conditional allelic gene flanked by a site-specific recombinase target sequence, (i) Insertion of a selectable marker or reporter gene operably linked to an active promoter in pluripotent cells, or (j) Including their combination. In some of the above methods, the genomic loci of interest are the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 locus, both Rag1 and Rag2 loci, Adamts5 locus. Includes locus, Trpa1 locus, Fohl1 locus, Erbb4 locus, Lrp5 locus, C5 (Hc) locus, Ror1 locus, or Dpp4 locus. In some of the above methods, the genomic locus of interest comprises extrachromosomal DNA. A method for producing an F0 generation non-human animal or mouse containing a target gene modification at a genomic locus of interest, wherein (a) any of the above methods is used to modify a non-human or mouse ES cell. And (b) identifying modified non-human or mouse ES cells containing the target gene modification at the genomic loci of interest, and (c) introducing the modified non-human or mouse ES cells into the non-human or mouse host embryo. And (d) concealing a non-human or mouse host embryo in the surrogate mother, the surrogate mother produces an F0 generation non-human animal or mouse containing a target gene modification at the genomic locus of interest. , Methods are also provided. For example, the present invention provides: (Item 1) A method for modifying the genome at a genomic locus of interest in mouse or human cells, where the genome is converted to Cas protein, the genomic gene of interest, in the presence of a large targeting vector (LTVEC). Includes contact with CRISPR RNA, which hybridizes to the locus target sequence, and tracrRNA. The LTVEC is at least 10 kb and is homologous to the 5'target sequence of the genomic locus of interest, the 5'homologous arm, and the 3'to the 3'target sequence of the genomic locus of interest. The homology arm contains the adjacent first nucleic acid and contains After contact with the Cas protein, the CRISPR RNA, and the tracrRNA in the presence of the LTVEC, the genome deletes a region of the genomic locus of interest and the genomic locus of interest. Modified to include target gene modifications involving insertion of the first nucleic acid, (i) The region of the genomic locus of interest that has been deleted is at least 30 kb. And / or (ii) The method, wherein the inserted first nucleic acid is at least 30 kb. (Item 2) The method of item 1, wherein the Cas protein, the CRISPR RNA, the tracrRNA, and the LTVEC are introduced into the mouse or human cells. (Item 3) The method of item 1 or 2, further comprising identifying the modified mouse cell or the modified human cell, comprising the target gene modification at the genomic locus of interest. (Item 4) The method of item 2 or 3, wherein the CRISPR RNA and the tracr RNA are introduced together in the form of a single transcript. (Item 5) The method of item 2 or 3, wherein the CRISPR RNA and the tracr RNA are introduced separately. (Item 6) (a) The Cas protein is introduced into the mouse cell or the human cell in the form of a protein, messenger RNA (mRNA) encoding the Cas protein, or DNA encoding the Cas protein. (b) The CRISPR RNA is introduced into the mouse cell or the human cell in the form of RNA or DNA encoding the CRISPR RNA and (c) The method according to any one of items 2 to 5, wherein the tracrRNA is introduced into the mouse cell or the human cell in the form of RNA or DNA encoding the tracrRNA. (Item 7) The method according to item 6, wherein the Cas protein, the CRISPR RNA, and the tracrRNA are introduced into the mouse cell or the human cell as a protein-RNA complex. (Item 8) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA is in the form of a second expression construct comprising a second promoter operably linked to the third nucleic acid encoding the CRISPR RNA. (c) The DNA encoding the tracrRNA is in the form of a third expression construct comprising a third promoter operably linked to the fourth nucleic acid encoding the tracrRNA. The method of item 6, wherein the first, second, and third promoters are active in the mouse or human cells. (Item 9) 8. The method of item 8, wherein the first, second, and / or third expression constructs are on a single nucleic acid molecule. (Item 10) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA and the DNA encoding the tracrRNA were operably linked in a single transcript to a third nucleic acid encoding the CRISPR RNA and the gRNA containing the tracrRNA. In the form of a second expression construct containing a second promoter, The method of item 6, wherein the first and second promoters are active in said mouse cells or said human cells. (Item 11) 10. The method of item 10, wherein the first and second expression constructs are on a single nucleic acid molecule. (Item 12) Item 1 The target gene modification simultaneously comprises the deletion of an endogenous nucleic acid sequence at the target genomic locus and the insertion of the first nucleic acid at the target genomic locus in a single step. The method according to any one of ~ 11. (Item 13) 12. The method of item 12, wherein the deleted endogenous nucleic acid sequence is from about 30 kb to about 110 kb and the inserted first nucleic acid is from about 40 kb to about 140 kb. (Item 14) The method according to any one of items 1 to 13, wherein the target gene modification is a gene modification of two alleles. (Item 15) The method of item 14, wherein the genetic modification of the two alleles comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes and the insertion of the first nucleic acid. (Item 16) The method of item 14, wherein the modified mouse cell or the modified human cell is complex heterozygous at the genomic locus of interest. (Item 17) 14. The method of item 14, wherein the modified mouse cell or the modified human cell is semizygous at the genomic locus of interest. (Item 18) 16. The method of item 16, wherein the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of the first nucleic acid. (Item 19) The target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on the first and second homologous chromosomes, and (2) the subject on the first homologous chromosome. The method of item 16, wherein the method comprises inserting the first nucleic acid into a genomic locus and disrupting the genomic locus of interest on the second homologous chromosome. (Item 20) The method according to any one of items 1 to 19, wherein the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. (Item 21) The method according to any one of items 1 to 20, wherein the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb. (Item 22) The item, wherein the first nucleic acid is at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, or at least 300 kb. The method according to any one of 1 to 21. (Item 23) The method according to any of items 1 to 22, wherein the first nucleic acid is from about 40 kb to about 140 kb. (Item 24) The method according to any one of items 1 to 23, wherein the mouse cell or the human cell is a primary cell or an immortalized cell. (Item 25) The method according to any one of items 1 to 23, wherein the mouse cell or the human cell is a pluripotent cell. (Item 26) 25. The method of item 25, wherein the mouse pluripotent cells are mouse embryonic stem (ES) cells. (Item 27) The human pluripotent cells are human embryonic stem (ES) cells, human adult stem cells, and developmentally restricted (developmentally). Restricted) The method of item 25, wherein is a human progenitor cell or a human induced pluripotent stem (iPS) cell. (Item 28) The human iPS cells were maintained in a medium containing a basal medium and a supplement, and the medium was (a) Leukemia inhibitory factor (LIF) polypeptide, (b) Glycogen synthase kinase (GSK3) inhibitor and (c) Contains MEK inhibitors 27. The method of item 27, wherein the medium has an osmolality of from about 175 mOsm / kg to about 280 mOsm / kg. (Item 29) The method according to any of items 1-28, wherein the Cas protein is Cas9. (Item 30) The method according to any one of items 1-29, wherein the protospacer flanking motif (PAM) sequence is immediately flanked by the target sequence. (Item 31) The method according to any one of items 1 to 30, wherein the sum of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 150 kb. (Item 32) The total of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, and about 100 kb ~. The method according to any of items 1-31, which is about 120 kb, or about 120 kb to 150 kb. (Item 33) The target gene modification (a) Substitution of endogenous nucleic acid sequences by homologous or orthologous nucleic acid sequences, (b) Deletion of endogenous nucleic acid sequence, (c) Deletion of an endogenous nucleic acid sequence About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ about Deletion of endogenous nucleic acid sequence, ranging from 3Mb, (d) Insertion of exogenous nucleic acid sequence, (e) Approximately 5 kb to approximately 10 kb, approximately 10 kb to approximately 20 kb, approximately 20 kb to approximately 40 kb, approximately 40 kb to approximately 60 kb, approximately 60 kb to approximately 80 kb, approximately 80 kb to approximately 100 kb, approximately 100 kb to approximately 150 kb, approximately 150 kb to approximately 200 kb Insertion of exogenous nucleic acid sequences ranging from about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb, (f) Insertion of an exogenous nucleic acid sequence containing a homologous or orthologous nucleic acid sequence, (g) Insertion of chimeric nucleic acid sequences, including human and non-human nucleic acid sequences, (h) Site-specific recombinase target Insertion of conditional alleles with adjacent sequences, (i) Insertion of a selectable marker or reporter gene operably linked to an active promoter in said pluripotent cell, or (j) The method of any of items 1-32, comprising (j) a combination thereof. (Item 34) The method according to any of items 1-33, wherein the 5'target sequence and the 3'target sequence are at least 5 kb but separated by less than 3 Mb. (Item 35) The 5'target sequence and the 3'target sequence are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, and at least 60 kb. Less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb but less than about 400 kb, at least About 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but about 2.5 Mb The method of any of items 1-34, wherein less than, or at least about 2.5 Mb, but less than about 3 Mb apart. (Item 36) The 5'target sequence and the 3'target sequence are at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 110 kb, at least 120 kb, at least 130 kb, at least. 35. The method of item 1-35, wherein the method is 140 kb, at least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at least 190 kb, or at least 200 kb apart. (Item 37) The method according to any of items 1-36, wherein the 5'target sequence and the 3'target sequence are separated by about 30 kb to about 110 kb. (Item 38) The target genomic loci are the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 locus, both Rag1 and Rag2 loci, Adamts5 locus, Trpa1 locus, Folk1. The method according to any of items 1-37, comprising the locus, Erbb4 locus, Lrp5 locus, C5 (Hc) locus, Ror1 locus, or Dpp4 locus. (Item 39) The method according to any one of items 1 to 38, wherein the genomic locus of interest comprises extrachromosomal DNA. (Item 40) A method for producing F0 generation mice containing a target gene modification at a target genomic locus. (a) Hybridize the genome in mouse ES cells to the Cas protein, the target sequence of the genomic locus of interest, in the presence of a large targeting vector (LTVEC) to form modified mouse ES cells. By contacting with CRISPR RNA and tracrRNA, The LTVEC is at least 10 kb and is homologous to the 5'target sequence of the genomic locus of interest, the 5'homologous arm, and the 3'to the 3'target sequence of the genomic locus of interest. The homology arm contains the adjacent first nucleic acid and contains After contact with the Cas protein, the CRISPR RNA, and the tracrRNA in the presence of the LTVEC, the genome is modified to include the gene modification of interest, and the gene modification of interest is said to be said. Includes deletion of a region of the locus of interest and insertion of the first nucleic acid at the genomic locus of interest. (i) The region of the genomic locus of interest that has been deleted is at least 30 kb. And / or (ii) Contacting, where the inserted first nucleic acid is at least 30 k, (b) Identifying the modified ES cell containing the target gene modification at the target genomic locus, and (c) Introducing the modified mouse ES cells into a mouse host embryo and (d) Containing the mouse host embryo in a surrogate mother. The method, wherein the surrogate mother produces the F0 generation mouse comprising the target gene modification at the genomic locus of interest. (Item 41) 40. The method of item 40, wherein the CRISPR RNA and the tracr RNA are introduced together in the form of a single transcript. (Item 42) 40. The method of item 40, wherein the CRISPR RNA and the tracr RNA are introduced separately. (Item 43) (a) The Cas protein is introduced into the mouse ES cell in the form of a protein, messenger RNA (mRNA) encoding the Cas protein, or DNA encoding the Cas protein. (b) The CRISPR RNA is introduced into the mouse ES cells in the form of RNA or DNA encoding the CRISPR RNA and (c) The method according to any one of items 40 to 42, wherein the tracrRNA is introduced into the mouse ES cells in the form of RNA or DNA encoding the tracrRNA. (Item 44) The Cas protein, the CRISPR 43. The method of item 43, wherein RNA and the tracrRNA are introduced into the mouse ES cells as a protein-RNA complex. (Item 45) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA is in the form of a second expression construct comprising a second promoter operably linked to the third nucleic acid encoding the CRISPR RNA. (c) The DNA encoding the tracrRNA is in the form of a third expression construct comprising a third promoter operably linked to the fourth nucleic acid encoding the tracrRNA. 43. The method of item 43, wherein the first, second, and third promoters are active in the mouse ES cells. (Item 46) The method of item 45, wherein the first, second, and third expression constructs are on a single nucleic acid molecule. (Item 47) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA and the DNA encoding the tracrRNA were operably linked in a single transcript to a third nucleic acid encoding the CRISPR RNA and the gRNA containing the tracrRNA. In the form of a second expression construct containing a second promoter, 43. The method of item 43, wherein the first and second promoters are active in the mouse ES cells. (Item 48) 47. The method of item 47, wherein the first and second expression constructs are on a single nucleic acid molecule. (Item 49) Any of items 40-48, wherein the target gene modification simultaneously comprises a deletion of an endogenous nucleic acid sequence at the genomic locus of interest and insertion of the first nucleic acid at the genomic locus of interest. The method according to item 1. (Item 50) The method according to any one of items 40 to 49, wherein the target gene modification is a gene modification of two alleles. (Item 51) The method of item 50, wherein the genetic modification of the two alleles comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes and the insertion of the first nucleic acid. (Item 52) The method of item 50, wherein the modified mouse ES cell is complex heterozygous at the genomic locus of interest. (Item 53) The method of item 50, wherein the modified mouse ES cell is semi-zygous at the genomic locus of interest. (Item 54) 52. The method of item 52, wherein the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of the first nucleic acid. (Item 55) The target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on the first and second homologous chromosomes, and (2) the subject on the first homologous chromosome. 52. The method of item 52, comprising inserting the first nucleic acid into a genomic locus and disrupting the genomic locus of interest on the second homologous chromosome. (Item 56) The method according to any one of items 40 to 55, wherein the Cas protein is Cas9. (Item 57) A method for modifying the genome at a target genomic locus in eukaryotic cells, in the presence of a large targeting vector (LTVEC), the genome is the Cas protein, the target of the target genomic locus. Includes contact with CRISPR RNA, which hybridizes to the sequence, and tracrRNA. The LTVEC is at least 10 kb and is homologous to the 5'target sequence of the genomic locus of interest, the 5'homologous arm, and the 3'to the 3'target sequence of the genomic locus of interest. The homology arm contains the adjacent first nucleic acid and contains The eukaryotic cell is not a rat cell After contact with the Cas protein, the CRISPR RNA, and the tracrRNA in the presence of the LTVEC, the genome deletes a region of the genomic locus of interest and the genomic locus of interest. Modified to include target gene modifications involving insertion of the first nucleic acid, (i) The region of the genomic locus of interest that has been deleted is at least 30 kb. And / or (ii) The method, wherein the inserted first nucleic acid is at least 30 kb. (Item 58) The non-rat eukaryotic cells are pluripotent cells, non-pluripotent cells, mammalian cells, human cells, non-human mammalian cells, rodent cells, mouse cells, hamster cells, or fibroblasts. The method of item 57. (Item 59) 57. The method of item 57, wherein the non-rat eukaryotic cell is a primary cell or an immortalized cell.

0066<figref num="1">Shows rat ESCs that normally separate in a dish and grow as floating small spherical colonies.</figref><figref num="2">It shows various pluripotency markers expressed by rat ESC. A indicates Oct-4 (green), B indicates Sox-2 (red), C indicates DAPI (blue), and D indicates an overlay of pluripotency markers expressed by rESC.</figref><figref num="3">We show that rat ESC expresses light levels of alkaline phosphatase (a pluripotency marker).</figref><figref num="4">The karyotype of the cell line DA.2B, which is 42X, Y, is shown. Because rat ESCs are often tetraploid, karyotyping is performed, so cell lines are pre-selected by counting metaphase chromosomal spreads, with most normal counts. The cell lineage they have was formally karyotyped.</figref><figref num="5A">A photograph showing the analysis of the chromosome number of the ACI.G1 rat ES cell line is provided.</figref><figref num="5B">A photograph showing the analysis of the chromosome number of the ACI.G1 rat ES cell line is provided.</figref><figref num="6A">Photographs showing the analysis of the chromosome number of the DA.2B rat ES cell line are provided.</figref><figref num="6B">Photographs showing the analysis of the chromosome number of the DA.2B rat ES cell line are provided.</figref><figref num="7A">Photographs showing the analysis of the chromosome number of the DA.2C rat ES cell line are provided.</figref><figref num="7B">Photographs showing the analysis of the chromosome number of the DA.2C rat ES cell line are provided.</figref><figref num="8">The enlarged view of the rat ESC of FIG. 1 is shown.</figref><figref num="9">The generation of chimeras by blastocyst injection and transmission of the rat ESC genome through germline is shown. Chimeras were generated by blastocyst injection using the parent ACI.G1 rat ESC. A high percentage of chimeras usually have an albino nose.</figref><figref num="10">Figure 9 shows the asterisk (*The ACI / SD chimera labeled with) indicates an F1 agouti with albino littermates that are male parents.</figref><figref num="11">A schematic diagram of the rat ApoE locus is provided, and the cleavage sites of zinc finger nucleases (ZFN1 and ZFN2) are indicated by gray bars. The genomic regions corresponding to the 5'and 3'homology arms (5 kb and 5.4 kb, respectively) are shown in dark gray boxes. Exon 1 of the ApoE gene is non-coding and is shown as the white box closest to the 5'homologous arm. The three introns of the ApoE gene are indicated by lines. Exons 2 and 3 contain code regions and are shown as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes.</figref><figref num="12">It shows the targeting of the Rosa26 locus in rats with the same spacing and between the Setd5 and Thumpd3 genes, as in mice. Panel A shows the structure of the Rosa26 locus in mice. The mouse Rosa26 transcript consists of two or three exons. Panel B shows the structure of the rat Rosa26 locus, where the rat locus contains a second exon 1 (Ex1b) in addition to an exon homologous to mouse exon 1 (Ex1a). Exons of 3 have not been identified in rats. Panel C shows the target rat Rosa26 allele, each 5 kb homology arm was cloned by PCR using genomic DNA from DA rESC, and the target allele was in the rat Rosa26 intron. Includes a splicing receptor (SA) -lacZ-hUB-neo cassette that replaces the 117 bp deletion.</figref><figref num="13A">A control brain of a 14-week-old wild-type rat stained with X-gal is shown. Control brains showed low levels of background staining for LacZ (back view).</figref><figref num="13B">It shows LacZ expression in the brain of rRosa26 heterozygous rats (14 weeks old). The lacZ reporter was ubiquitously expressed throughout the brain of the rRosa26 heterozygotes.</figref><figref num="13C">A control heart and thymus (insertion view) of a 14-week-old wild-type rat treated with X-gal are shown. Control hearts and thymus showed low levels of background staining for LacZ.</figref><figref num="13D">LacZ expression in control heart and thymus (insertion view) of 14-week-old rRosa26 heterozygous rats is shown. The lacZ reporter was ubiquitously expressed throughout the heart and thymus of the rROSA26 heterozygotes.</figref><figref num="13E">A control lung of a 14-week-old wild-type rat treated with X-gal is shown. Control lungs showed low levels of background staining for LacZ.</figref><figref num="13F">It shows LacZ expression in the lungs of 14-week-old rRosa26 heterozygous rats. The lacZ reporter was ubiquitously expressed throughout the lungs of the rRosa26 heterozygotes.</figref><figref num="13GH">It shows LacZ expression in E12.5 rat embryos. Compared to wild-type control embryos (H) showing low levels of background LacZ staining, rRosa26 heterozygous embryos showed ubiquitous expression of LacZ reporters throughout the embryo.</figref><figref num="13IJ">E14.5 Shows LacZ expression in rat embryos. Compared to wild-type control embryos (J) showing low levels of background LacZ staining, rRosa26 heterozygous rat embryos showed ubiquitous expression of LacZ reporters throughout the embryo.</figref><figref num="14">Shows homologous or non-homologous recombination events occurring in rat ES cells after electroporation of a targeting vector containing a selection cassette (lacZ-neo cassette).</figref><figref num="15">We show the mechanism by which genome-editing endonucleases (eg, ZFNs and TALENs) induce double-strand breaks (DSBs) in target genomic sequences and activate non-homologous end joinings (NHEJs) in ES cells.</figref><figref num="16">We show a gene targeting technique that utilizes ZFN / TALENs to improve the efficiency of homologous recombination of targeting vectors. DSB stands for double-strand break.</figref><figref num="17">The ApoE-ZFN-AB5 chimera produced by chimera production of the ApoE locus and germline transmission of modified rats is shown. Target modification was supported by zinc finger nucleases.</figref><figref num="18">A schematic representation of IL2r-γ targeting events in combination with zinc finger nucleases that target ZFN U and ZFN D is provided. It shows the region of the IL2r-γ locus in rats targeted by ZFN U and ZFN D (SEQ ID NO: 93). The ZFN cleavage site is shown in the figure.</figref><figref num="19">A schematic representation of IL2r-γ targeting events in combination with zinc finger nucleases that target ZFN U and ZFN D or in combination with gRNAs (gRNA1, gRNA2, gRNA3, gRNA4) is provided. It shows the region of the IL2r-γ locus in rats targeted by ZFN U and ZFN D or gRNA1-4, and shows the ZFN cleavage site.</figref><figref num="20">Schematic representations of rat ApoE loci and targeting plasmids are provided. The schematic diagram above shows the genomic structure of the genomic region corresponding to the rat ApoE locus and the 5'and 3'homologous arms (5 kb and 5.4 kb, dark gray boxes, respectively). Exon 1 of the ApoE gene is non-coding and is shown as the white box closest to the 5'homologous arm. The three introns of the ApoE gene are indicated by lines. Exons 2 and 3 contain code regions and are shown as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. The lower panel shows the targeting plasmid. The 5'and 3'homologous arms (5 kb and 5.4 kb, respectively) are indicated by dark gray boxes. The targeting vector contains a reporter gene (lacZ) and a self-deletion cassette adjacent to the loxP site (blank arrow). The self-deletion cassette includes a drug selection cassette containing a mouse Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the neomycin resistance gene.</figref><figref num="21">Self-deletion, including a drug selection cassette containing a zinc finger nuclease and a reporter gene (LacZ), as well as a mouse Prm1 promoter operably linked to the Crei gene, and a human ubiquitin promoter operably linked to the neomycin resistance gene. A schematic diagram for targeting the ApoE locus in rat ES cells using a targeting vector containing a cassette is provided. FIG. 21B shows the homozygous target ApoE locus.</figref><figref num="22">A schematic representation of the rat ApoE locus and large targeting vector (LTVEC) is provided. The upper panel shows the genomic composition of the genomic region corresponding to the rat ApoE locus and the 5'and 3'homologous arms (45 kb and 23 kb, dark gray boxes, respectively). The ApoE exon 1 is non-coded and is shown as the white box closest to the 5'homologous arm. The three introns of the ApoE gene are indicated by lines, and exons 2 and 3 contain coding regions and are indicated as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. The lower panel shows LTVEC for modifying the ApoE locus in rats. The 5'and 3'homology arms (45 kb and 23 kb, respectively) are indicated by dark gray boxes. LTVEC contains a drug selection cassette containing a reporter gene (lacZ), as well as a mouse Prm1 promoter operably linked to the Crei gene, and a human ubiquitin promoter operably linked to the neomycin resistance gene, loxP site (white outline). The arrow) contains the adjacent self-deletion cassette.</figref><figref num="23">A zinc finger nuclease (zinc finger nuclease) that provides a schematic representation of the rat ApoE locus and is used in conjunction with a large targeting vector (LTVEC) to enhance homologous recombination between the targeting vector and the target allogeneic chromosomal region. The cut sites in ZFN1 and ZFN2) are indicated by gray bars.</figref><figref num="24">IL2r in rats disturbed by a 3.2 kb deletion and insertion of a self-deletion cassette containing the reporter gene (eGFP) and the drug selection cassette (hUb-neo) and the Crei gene operably linked to the mouse Prm1 promoter. Shows the -γ locus.</figref><figref num="25">IL2r in rats disturbed by a 3.2 kb deletion and insertion of a self-deletion cassette containing the reporter gene (eGFP) and the Crei gene and drug selection cassette (hUb-Neo) operably linked to the mouse Prm1 promoter. -Provides another diagram of the γ locus.</figref><figref num="26">A schematic diagram of a rat Rag2 locus and a large targeting vector (LTVEC) for modifying the rat Rag2 locus is provided. The upper panel shows the genomic composition of the allogeneic genomic region corresponding to the rat Rag2 locus and the 5'and 3'homologous arms (48 kb and 84 kb, dark gray boxes, respectively). Rag2 contains a single exon shown with a dotted gray shade. The lower panel is LTVEC. The 5'and 3'homology arms (48 kb and 84 kb, respectively) are indicated by dark gray boxes. LTVEC contains a drug selection cassette containing a reporter gene (lacZ), as well as a rat Prm1 promoter operably linked to the Crei gene, and a human ubiquitin promoter operably linked to the neomycin resistance gene, loxP site (white outline). The arrow) contains the adjacent self-deletion cassette.</figref><figref num="27">Provides genomic structure of rat Rag1 / Rag2 locus and genomic region deleted by either Rag2 targeting (Rag2 deletion) or Rag2 / Rag1 double targeting (Rag2 / Rag1 deletion) To do.</figref><figref num="28">A schematic representation of the rat Rag2 and Rag1 loci and the large targeting vector (LTVEC) used to modify the loci is provided. The upper panel shows the genomic composition of the allogeneic genomic regions corresponding to the Rag1 and Rag2 loci and the 5'and 3'homologous arms (48 kb and 15 kb, dark gray boxes, respectively). Rag2 and Rag1 each contain a single exon, shown with a dotted gray shade. The lower panel is LTVEC. The 5'and 3'homology arms (48 kb and 15 kb, respectively) are indicated by dark gray boxes. LTVEC contains a drug selection cassette containing a reporter gene (lacZ), as well as a rat Prm1 promoter operably linked to the Crei gene, and a human ubiquitin promoter operably linked to the neomycin resistance gene, loxP site (white outline). The arrow) contains the adjacent self-deletion cassette.</figref><figref num="29-1">GFP expression in peripheral blood mononuclear cells (PBMC) from II2rg- / y chimeric rats (panels A to C) and wild DA rats (panels D to F) and T-cell markers CD3 (panels A and D), B- Flow cytometric analysis of cell markers B220 (panels B and E) and NK cell markers CD161a (panels C and F) is shown. Double positive cells are shown in quadrant R8. FIG. 29 shows that II2rg- / y PBMC does not express mature lymphocyte markers.</figref><figref num="29-2">GFP expression in peripheral blood mononuclear cells (PBMC) from II2rg- / y chimeric rats (panels A to C) and wild DA rats (panels D to F) and T-cell markers CD3 (panels A and D), B- Flow cytometric analysis of cell markers B220 (panels B and E) and NK cell markers CD161a (panels C and F) is shown. Double positive cells are shown in quadrant R8. FIG. 29 shows that II2rg- / y PBMC does not express mature lymphocyte markers.</figref><figref num="30">It is shown that GFP-positive lymphocytes were detected in the peripheral blood of two of the three II2rg-/ y chimeras.</figref><figref num="31">A schematic representation of the rat Il2rg locus and the targeting plasmid in fully humanized rat Il2rg locus is provided. The upper panel shows the genomic composition of the allogeneic genomic region corresponding to the rat Il2rg locus and the 5'and 3'homologous arms (4.3 kb and 4.0 kb, gray boxes, respectively). The lower panel is the targeting plasmid. The 5'and 3'homologous arms (4.3 kb and 4.0 kb, respectively) are indicated by gray boxes. The targeting plasmid contains a deletion cassette flanked by loxP sites (blank arrows), including a drug selection cassette containing the human IL-2rg genomic region and the human ubiquitin promoter operably linked to the neomycin resistance gene.</figref><figref num="32">To provide a schematic diagram of the rat Il2rg locus and the targeting plasmid in the extracellular domain humanization of the rat Il2rg locus. The upper panel shows the genomic composition of the allogeneic genomic region corresponding to the rat Il2rg locus and the 5'and 3'homologous arms (4.3 kb and 4.0 kb, gray boxes, respectively). The lower panel is the targeting plasmid. The 5'and 3'homologous arms (4.3 kb and 4.0 kb, respectively) are indicated by gray boxes. The targeting plasmid includes a human extracellular domain of the IL-2Rg genomic region, as well as a drug selection cassette containing a rat Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the neomycin resistance gene. Contains self-deletion cassettes adjacent to the loxP site (blank arrow).</figref><figref num="33">Human extracellular domain of IL-2rg fused to the rest of human IL-2rg protein (SEQ ID NO: 20, NP_000197.1), rat IL-2rg protein (SEQ ID NO: 21, NP_543165.1), and rat IL-2rg protein. Provided is a sequence alignment of the chimeric IL-2rg protein (SEQ ID NO: 22) containing. The connections between human IL-2rg and rat IL-2rg are shown by vertical lines.</figref><figref num="34">A CRISPR / Cas9-supported humanization of the mouse Lrp5 gene is provided, with LTVEC shown in the upper panel and the mouse Lrp5 locus in the lower panel. The humanized region is the extracellular domain. Arrows indicate target sites in each gRNA (gA, gB, gB2, gC, gD, gE2, gE, gF) and ZFN (a ~ d).</figref><figref num="35A">The percentages of targeting efficiencies of LTVEC targeting genes with increased deletion size (Fig. 35A) and LTVEC with increased insertion size of human genes (Fig. 35B) are shown. LTVEC was used alone (gray square or triangle) or in combination with ZFN (black square or triangle).</figref><figref num="35B">The percentages of targeting efficiencies of LTVEC targeting genes with increased deletion size (Fig. 35A) and LTVEC with increased insertion size of human genes (Fig. 35B) are shown. LTVEC was used alone (gray square or triangle) or in combination with ZFN (black square or triangle).</figref><figref num="36">A schematic representation of CRISPR / Cas9-supported humanization of the entire coding region of the mouse Trpa1 gene is provided, with LTVEC shown in the upper panel and mouse Trpa1 locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gA2, gB, gC, gD, gE2, gE, gF).</figref><figref num="37">A CRISPR / Cas9-supported humanization of the extracellular domain of the mouse Fohl1 gene (exon 2 to stop codon) is provided, with LTVEC shown in the upper panel and the mouse Fohl1 locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gA2, gB, gC, gD, gE, gE2, gF).</figref><figref num="38">A schematic representation of CRISPR / Cas9-supported humanization of the region from exon 2 to the stop codon of the mouse C5 (Hc) gene is provided, with LTVEC shown in the upper panel and mouse C5 (Hc) locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gB, gB2, gC, gD, gE2, gE, gF).</figref><figref num="39">A schematic representation of CRISPR / Cas9-supported humanization of the entire coding region of the mouse Adamts5 gene is provided, with LTVEC shown in the upper panel and mouse Adamts5 locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gA2, gB, gC, gD, gE2, gE, gF).</figref><figref num="40">A schematic representation of CRISPR / Cas9-supported humanization of exons 4-15 of the mouse Erbb4 gene is provided, with LTVEC shown in the upper panel and mouse Erbb4 locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gB, gB2, gC, gD, gE2, gE, gF).</figref><figref num="41">A schematic diagram of CRISPR / Cas9-supported humanization of exons 2-7 of the mouse Ror1 gene is provided, with LTVEC shown in the upper panel and mouse Ror1 locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gB, gC, gD, gE, gF).</figref><figref num="42">A schematic diagram of CRISPR / Cas9-supported humanization of the exon 2 to stop codon region of the mouse Dpp4 gene is provided, with LTVEC shown in the upper panel and mouse Dpp4 locus in the lower panel. Arrows indicate target sites in each gRNA (gA, gB, gB2, gC, gD, gE2, gE, gF).</figref><figref num="43-1">The brain of a 12-week-old female rat stained with X-gal is shown. Figures 43A-C show brains from wild-type rats, and Figures 43D-F show ApoE.+/-Shows the brain from a rat. 43A and D show the rear view, FIGS. 43B and E show the ventral view, and FIGS. 43C and F show the enlarged view.</figref><figref num="43-2">The brain of a 12-week-old female rat stained with X-gal is shown. Figures 43A-C show brains from wild-type rats, and Figures 43D-F show ApoE.+/-Shows the brain from a rat. 43A and D show the rear view, FIGS. 43B and E show the ventral view, and FIGS. 43C and F show the enlarged view.</figref><figref num="44">The corresponding enlarged views (B and D) of the heart (A and C) and blood vessels of a 12-week-old female rat stained with X-gal are shown. Figures 44A and B show the heart and blood vessels from wild-type rats, respectively, and Figures 44C and D show ApoE, respectively.+/-Shows heart and blood vessels from rats. Staining was present in the atrium of the heart and some blood vessels (eg, vena cava).</figref><figref num="45">The liver of a 12-week-old female rat stained with X-gal is shown. Figures 45A and B show livers from wild-type rats, and Figures 45C and D show ApoE.+/-Shows liver from rat. 45B and D are enlarged views of the liver.</figref><figref num="46">Detection of cholesterol, LDL, HDL, and triglyceride levels in rats targeting homozygous ApoE, rats targeting heterozygous ApoE, and wild-type rats at 6, 9, 12, and 15 weeks ( Figures 46A to D) are shown, respectively.</figref><figref num="47">A schematic diagram of a large targeting vector (LTVEC) targeting the rat ApoE locus (upper panel) and the rat ApoE locus (lower panel) is shown. The upper panel shows the genomic composition of the genomic region corresponding to the rat ApoE locus and the 5'and 3'homologous arms (45 kb and 23 kb, dark gray boxes, respectively). The ApoE exon 1 is non-coded and is shown as the white box closest to the 5'homologous arm. The three introns of the ApoE gene are indicated by lines, and exons 2 and 3 contain coding regions and are indicated as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. ApoE The target sites in gRNA2 (SEQ ID NO: 87) and gRNA3 (SEQ ID NO: 88) are shown. The lower panel shows LTVEC for modifying the ApoE locus in rats. The 5'and 3'homology arms (45 kb and 23 kb, respectively) are indicated by dark gray boxes. LTVEC contains a drug selection cassette containing a reporter gene (lacZ), as well as a mouse Prm1 promoter operably linked to the Crei gene, and a human ubiquitin promoter operably linked to the neomycin resistance gene, loxP site (white outline). The arrow) contains the adjacent self-deletion cassette.</figref><figref num="48">A schematic diagram of a large targeting vector (LTVEC) targeting the rat Rag2 locus (upper panel) and the rat Rag2 locus (lower panel) is shown. The upper panel shows the genomic composition of the allogeneic genomic region corresponding to the rat Rag2 locus and the 5'and 3'homologous arms (48 kb and 84 kb, dark gray boxes, respectively). Rag2 contains a single exon shown with a dotted gray shade. The target sites in Rag2 gRNA1 (SEQ ID NO: 89) and gRNA4 (SEQ ID NO: 90) are shown. The lower panel is LTVEC. The 5'and 3'homology arms (48 kb and 84 kb, respectively) are indicated by dark gray boxes. LTVEC contains a drug selection cassette containing a reporter gene (lacZ), as well as a rat Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the hygromycin resistance gene. The arrow) contains the adjacent self-deletion cassette.</figref><figref num="49">A schematic diagram of a targeting plasmid for humanization of the extracellular domain of the rat Il2rg locus (upper panel) and the rat Il2rg locus (lower panel) is shown. The upper panel shows the genomic composition of the allogeneic genomic region corresponding to the rat Il2rg locus and the 5'and 3'homologous arms (4.3 kb and 4.0 kb, gray boxes, respectively). The target sites in Il2rg gRNA2 (SEQ ID NO: 91) and gRNA4 (SEQ ID NO: 92) are shown. The lower panel is the targeting plasmid. The 5'and 3'homologous arms (4.3 kb and 4.0 kb, respectively) are indicated by gray boxes. The targeting plasmid includes a human extracellular domain of the IL-2Rg genomic region, as well as a drug selection cassette containing a rat Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the neomycin resistance gene. Contains self-deletion cassettes adjacent to the loxP site (blank arrow).</figref><figref num="50">FIG. 3 shows a schematic representation of rat Rag2 and Rag1 loci and a large targeting vector (LTVEC) used to modify loci in rat ES cells (clone Il2rg-CG12) targeted by Il2rg. The upper panel shows the genomic composition of the allogeneic genomic regions corresponding to the Rag1 and Rag2 loci and the 5'and 3'homologous arms (48 kb and 15 kb, gray boxes, respectively). Rag2 and Rag1 each contain a single exon indicated by an unshaded arrow. The lower panel is LTVEC. The 5'and 3'homology arms (48 kb and 15 kb, respectively) are indicated by gray boxes. LTVEC contains a reporter gene (eGFP) and a puromycin resistance gene that have been isolated by an internal ribosome entry site (IRES) and operatively linked to the actin promoter. LTVEC is self-deficient with adjacent loxP sites (blank arrows), including a drug selection cassette containing a rat Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the neomycin resistance gene. Includes more lost cassettes.</figref><figref num="51">The schematic diagram of the substitution of a part of the human ADAM6 locus by the nucleic acid containing the mouse Adam6a locus and the mouse Adam6b locus using LTVEC and guide RNA in human iPS cells is shown. The target site of the guide RNA is indicated by an arrow.</figref><figref num="52">It shows the morphology shown by human iPS cells cultured in 2i medium for 8 days. FIG. 52B shows the morphology shown by human iPS cells cultured in 2i medium for 12 days.</figref><figref num="53">The morphology of human iPS cells cultured for 6 days in mTeSR -hLIF medium or low osmolality VG2i medium is shown. Figures 53A and 53B show the morphology of human iPS cells cultured for 6 days in mTeSR -hLIF medium (Figure 3A) or VG2i medium (Figure 53B). Figures 53C and 53D show the morphology of human iPS cells cultured in neonatal human foreskin fibroblast (NuFF) feeder cells in mTeSR -hLIF medium (Figure 53C) or VG2i medium (Figure 53D) for 6 days. ..</figref><figref num="54">Reprogrammed human iPS cells cultured in VG2i medium stained with alkaline phosphatase are shown. Figures 54B and 54C show reprogrammed human iPS cells cultured in VG2i medium immunostained for NANOG expression.</figref><figref num="55">The enzyme dissociation and subculture of reprogrammed human iPS cells cultured in VG2i medium are shown. FIG. 55A shows reprogrammed human iPS cells cultured in VG2i medium prior to enzyme dissociation by trypsin in the absence of a ROCK inhibitor. FIG. 55B shows human iPS cells cultured in VG2i medium for 1 day after subculture. FIG. 55C shows human iPS cells cultured in VG2i medium for 4 days after subculture.</figref>

0067Rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters via bacterial homologous recombination (BHR) in prokaryotes Compositions and methods for modifying the genomic locus of interest are provided. Rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents using a large targeting vector (LTVEC) in combination with the genomic locus of interest, eg, endonuclease. Compositions and methods for genetically modifying genomic loci of interest in non-rat mammals, mice are also provided. Compositions and methods for producing genetically modified non-human animals, such as rats, mice, rodents, or non-rat rodents, comprising one or more target gene modifications are also provided. It is also possible to maintain pluripotency after continuous genetic modification in isolated human and non-human pluripotent or pluripotent stem cells, especially in vitro, and target subsequent generations throughout the germline. Rat embryonic stem cells capable of transmitting genetic modification are also provided.

0068Glossary As used herein, the term "embryonic stem cell" or "ES cell" is an embryo-derived omnipotent or pluripotent cell that can contribute to any tissue of the developing embryo upon introduction into the embryo. including. As used herein, the term "pluripotent cell" includes undifferentiated cells capable of developing into more than one differentiated cell type. The term "non-pluripotent cell" includes cells that are not pluripotent cells.

0069As used herein, the term "homologous nucleic acid" includes nucleic acid sequences that are identical or substantially similar to known reference sequences. In one embodiment, the term "homologous nucleic acid" is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% of a known reference sequence. It is used to characterize sequences with amino acid sequences that are at least 98%, at least 99%, or even 100% identical.

0070As used herein, the term "orthologous nucleic acid" includes a nucleic acid sequence from one species that is functionally equivalent to a known reference sequence in another species.

0071The term "large targeting vector" or "LTVEC" as used herein is larger than that commonly used by other approaches aimed at targeting homologous genes in eukaryotic cells. Includes a large targeting vector in eukaryotic cells derived from a fragment of cloned genomic DNA. Examples of LTVEC include, but are not limited to, bacterial homologous chromosomes (BACs) and yeast artificial chromosomes (YACs).

0072As used herein, the term "allelic modification" (MOA) includes modification of the exact DNA sequence of one allele of a gene (s) or chromosomal translocation (s) in the genome. .. Examples of "allelic modifications (MOA)" described herein are small deletions, substitutions, or insertions of single nucleotides, or genes of interest (s) or chromosomal translocations (s). ), As well as any and all possible modifications between these two limits, but not limited to these.

0073As used herein, the term "recombination site" includes nucleotide sequences that are recognized by site-specific recombinases and can serve as substrates for recombination events.

0074For "continuous" genetic modification, cells (eg, eukaryotic cells, non-rat eukaryotic cells, mammalian cells, human cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent) Pluripotent cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, Includes two or more independent modifications to mouse cells, hamster cells, fibroblasts, or Chinese hamster ovary (CHO) cells). The first modification can be achieved by electroporation or any other method well known in the art. The second modification is then made to the same cellular genome with a suitable second nucleic acid construct. The second modification can be achieved by a second electroporation method, or any other method well known in the art. In various embodiments, after the first and second genetic modification of the same cell, the third, fourth, fifth, sixth, etc. continuous genetic modification (one followed by another) is, for example, It can be achieved using continuous electroporation or any other suitable (continuous) method well known in the art.

0075As used herein, the term "site-specific recombinase" refers to recombination between "recombination sites" where two recombination sites are physically separated within a single nucleic acid molecule or on separate nucleic acid molecules. Contains a group of enzymes that can be promoted. Examples of "site-specific recombinases" include, but are not limited to, Cre, Flp, and Dre recombinases.

0076With respect to nucleic acid sequences, the term "germline" includes nucleic acid sequences that can be passaged to offspring.

0077The expression "heavy chain" or "immunoglobulin heavy chain" includes an immunoglobulin heavy chain sequence that includes an immunoglobulin heavy chain constant region sequence from any organism. Unless otherwise stated, a heavy chain variable domain comprises three heavy chain CDRs and four FR regions. Heavy chain fragments include CDRs, CDRs, and FRs, and combinations thereof. A common heavy chain follows the variable domain (from N-terminus to C-terminus) and then C.H1 domain, hinge, CH2 domains and CHHas 3 domains. Functional fragments of heavy chains specifically recognize epitopes (eg, K in the range of micromoles, nanomoles, or picomoles).DCan be expressed and secreted from cells, and contains fragments containing at least one CDR. The heavy chain variable domain is a V present in the germlineH, DH, And JHV derived from the segment repertoireH, DH, And JHIt is encoded by a variable region nucleotide sequence that generally contains a segment. The placement, location, and terminology of V, D, and J heavy chain segments for various organisms can be found in the IMGT database accessible via the Internet at the URL "imgt.org" on the World Wide Web (www). Can be found.

0078The expression "light chain" includes immunoglobulin light chain sequences from any organism, including human kappa (κ) and lambda (λ) light chains and VpreB, as well as alternative light chains, unless otherwise stated. .. Unless otherwise stated, a light chain variable domain generally includes three light chain CDRs and four framework (FR) regions. In general, a fully long light chain contains a variable domain containing FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 and a light chain constant region amino acid sequence from the amino terminus to the carboxyl terminus. The light chain variable domain is derived from the repertoire of light chain V and J gene segments present in germline.LAnd light chain JLIt is encoded by a light chain variable region nucleotide sequence that generally contains a gene segment. The placement, location, and terminology of light chain V and J gene segments for various organisms can be found in the IMGT database accessible via the Internet at the URL "imgt.org" on the World Wide Web (www). Can be done. Light chains include, for example, those that do not selectively bind to either the first epitope or the second epitope that they are selectively bound by the epitope binding protein in which they appear. Light chains also include those that bind and recognize one or more eptops that are selectively bound by the epitope-binding proteins in which they appear, or those that assist heavy chains in binding and recognizing.

0079The expression "operably linked" includes a relationship in which the operably linked components function in their intended manner. In one example, the nucleic acid sequence encoding the protein can be operably linked to a regulatory sequence (eg, promoter, enhancer, silencer sequence, etc.) so as to retain proper transcriptional regulation. In one example, the nucleic acid sequence of the immunoglobulin variable region (or V (D) J segment) is the nucleic acid sequence of the immunoglobulin constant region so as to allow proper recombination between the sequences into the immunoglobulin heavy or light chain sequence. Can be operably connected to.

00801. Target locus containing nucleic acid Various methods and compositions are provided that allow the integration of at least one inserted nucleic acid at the target locus. As used herein, a "genome locus of interest" includes any segment or region of DNA within the genome in which the inserted nucleic acid is desired to be integrated. The terms "target genomic locus" and "target genomic locus" can be used interchangeably. The genomic locus of interest can be native to the cell or can include heterologous or exogenous segments of DNA integrated into the cell's genome. Such heterologous or extrinsic segments of DNA can include transgenes, expression cassettes, polynucleotides encoding selectable markers, or heterologous or extrinsic regions of genomic DNA. The term "locus" is defined herein as a segment of DNA within genomic DNA. The genetic modifications described herein include one or more deletions from the locus of interest, addition of the locus of interest, substitution of the locus of interest, and / or any combination thereof. Can be included. The locus of interest may include a coding region or a non-coding regulation region.

0081Genomic loci of interest further include any component of the targeted integration system, including, for example, recognition sites, selectable markers, pre-integrated insertion nucleic acids, polynucleotides encoding nucleases, promoters, and the like. It can be. Alternatively, the genomic locus of interest is a cell such as a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a human artificial chromosome, or any other genetically engineered genomic region contained in a suitable host cell. Can be located within the intrachromosomal DNA. In various embodiments, the target loci are prokaryotes, eukaryotes, non-rat eukaryotes, yeasts, bacteria, non-human mammals, non-human cells, rodents, non-rat rodents, humans, rats. , Mice, hamsters, rabbits, pigs, cows, deer, sheep, goats, chickens, cats, dogs, ferrets, primates (eg, marmosets, red-haired monkeys), domestic mammals, or agricultural mammals, or targeted It may contain natural, heterologous, or exogenous nucleic acid sequences from any other organism, or a combination thereof. In some embodiments, the genomic locus of interest comprises a nucleic acid sequence from human, mouse, or a combination thereof.

0082In certain embodiments, the target loci are, for example, eukaryotic cells, non-rat eukaryotic cells, mammalian cells, human cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells. Pluripotent cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, It is from mouse cells, hamster cells, fibroblasts, or CHO cells.

0083In certain embodiments, the genomic locus of interest comprises the target locus of a "rat nucleic acid". Such regions include nucleic acids from rats that integrate into the cell's genome. Non-limiting examples of target loci include genomic loci encoding proteins expressed in B cells, genomic loci expressing polypeptides in immature B cells, and genomes expressing polypeptides in mature B cells. These include loci, immunoglobulin (Ig) loci, or, for example, the T cell receptor locus, including the T cell receptor alpha locus. Further examples of target genomic loci include Fcer1a locus, Tlr4 locus, Plrl locus, Notch4 locus, Accn2 locus, Adamts5 locus, Trpa1 locus, Fohl1 locus, Lrp5 locus, eg IL2 receptor. Included are the IL2 receptor locus, including the gamma (Il2rg) locus, the ApoE locus, the Rag1 locus, the Rag2 locus, the Rag1 / Rag2 locus, and the Erbb4 locus. Any such target locus can be from a rat or from a eukaryotic cell, a non-rat eukaryotic cell, a mammalian cell, a human cell, or a non-human mammalian cell.

0084In one embodiment, the target locus encodes a mammalian immunoglobulin heavy chain variable region amino acid sequence. In one embodiment, the target locus encodes a rat immunoglobulin heavy chain variable region amino acid sequence. In one embodiment, the target locus comprises a genomic DNA sequence comprising a non-rearranged rat, mouse, or human immunoglobulin heavy chain variable region nucleic acid sequence operably linked to a nucleic acid sequence in the immunoglobulin heavy chain constant region. .. In one embodiment, the nucleic acid sequence of the immunoglobulin heavy chain constant region is the nucleic acid sequence of the rat, mouse, or human immunoglobulin heavy chain constant region selected from CH1, hinge, CH2, CH3, and combinations thereof. In one embodiment, the nucleic acid sequence of the heavy chain constant region comprises CH1-hinge-CH2-CH3. In one embodiment, the target locus comprises a rearranged rat, mouse, or human immunoglobulin heavy chain variable region nucleic acid sequence operably linked to the nucleic acid sequence of the immunoglobulin heavy chain constant region. In one embodiment, the nucleic acid sequence of the immunoglobulin heavy chain constant region is the nucleic acid sequence of the rat, mouse, or human immunoglobulin heavy chain constant region selected from CH1, hinge, CH2, CH3, and combinations thereof. In one embodiment, the nucleic acid sequence of the heavy chain constant region comprises CH1-hinge-CH2-CH3.

0085In one embodiment, the target locus comprises a genomic DNA sequence encoding a mammalian immunoglobulin light chain variable region amino acid sequence. In one embodiment, the genomic DNA sequence comprises a mammalian λ and / or κ light chain variable region nucleic acid sequence that is not rearranged.

0086In one embodiment, the genomic DNA sequence comprises a mammalian λ and / or κ light chain variable region nucleic acid sequence to be rearranged. In one embodiment, the non-rearranged λ or κ light chain variable region nucleic acid sequence is a mammalian immunoglobulin light chain constant region nucleic acid selected from the λ light chain constant region nucleic acid sequence and the κ light chain constant region nucleic acid sequence. Operatively linked to the sequence. In one embodiment, the nucleic acid sequence of the mammalian immunoglobulin light chain constant region is the nucleic acid sequence of the rat immunoglobulin light chain constant region. In one embodiment, the nucleic acid sequence of the mammalian immunoglobulin light chain constant region is the nucleic acid sequence of the mouse immunoglobulin light chain constant region. In one embodiment, the nucleic acid sequence of the mammalian light chain constant region is the nucleic acid sequence of the human immunoglobulin light chain constant region.

0087The ApoE locus, interleukin-2 receptor gamma (Il2rg) locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus used herein are each of these genes or gene recombination. Includes each region of the genome in which the locus is located (ie, a mammalian genome, a human genome, or a non-human mammalian genome). ApoE locus, interleukin-2 receptor gamma (Il2rg) locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus (ie, mammalian, human, or non-human mammalian ApoE locus) , Interleukin-2 receptor gamma locus, Rag2 locus, Rag1 locus, and / or a combination of Rag2 / Rag1 loci), any one of the desired modifications to a given locus. Can include changes in. Non-limiting examples of modifications to a given locus (ie, a mammalian, human, or non-human mammalian locus) are discussed in more detail herein.

0088For example, in certain embodiments, the ApoE locus, the interleukin-2 receptor gamma (Il2rg) locus, the Rag2 locus, the Rag1 locus and / or the Rag2 / Rag1 locus (ie, mammalian, human, or non-mammalian, human, or non-locus). Human mammalian ApoE locus, mammalian, human, or non-human mammalian interleukin-2 receptor gamma locus, mammalian, human, or non-human mammalian Rag2 locus, and / or Rag2 / Rag1 One or more of the loci) modified to reduce the activity and / or level of the encoded ApoE protein or interleukin-2 receptor gamma protein or Rag1 protein or Rag2 protein or Rag1 and Rag2 protein combination Will be done. In other embodiments, there is no activity of ApoE protein, interleukin-2 receptor gamma protein, Rag1 protein, or Rag2 protein, or a combination of Rag1 and Rag2 proteins.

0089By "reducing" is intended any reduction in the level or activity of the gene and / or protein encoded at the locus of interest. For example, reduced activity is (1) a statistically significant reduction in overall level or activity of a given protein (ie, ApoE, interleukin-2 receptor gamma, Rag2, Rag2, or a combination of Rag1 and Rag2). Can include, for example, 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60% when compared to a suitable control. Includes reduced levels or activity of 70%, 80%, 90%, 100%, 120%, or more. Methods of assaying for reduced concentrations and / or activity of any of ApoE, interleukin-2 receptor gamma, Rag1, and Rag2 are well known in the art.

0090In other embodiments, the ApoE locus of mammals, humans, or non-human mammals, the interleukin-2 receptor gamma locus of mammals, humans, or non-human mammals, mammals, humans, or non-humans. One or more of the mammalian Rag2 locus, the mammalian, human, or non-human mammalian Rag1 locus, and / or the mammalian, human, or non-human mammalian Rag2 / Rag1 locus is coded. Includes modifications that increase the activity and / or levels of the ApoE polypeptide, interleukin-2 receptor gamma polypeptide, Rag2 polypeptide, Rag1 polypeptide, or both Rag1 and Rag2 polypeptides. By "increasing" is intended any increase in the level or activity of the gene / polypeptide encoded at the locus of interest. For example, an increase in activity is either (1) a statistically significant increase in activity or overall level of a given protein (ie, ApoE, interleukin-2 receptor gamma, Rag1, Rag2, or Rag1 and Rag2). This can include, for example, 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 when compared to a suitable control. Includes increased levels or activity of%, 80%, 90%, 100%, 120%, or more. Methods of assaying for increased concentrations and / or activity of any of the ApoE, Rag1, Rag2, and interleukin-2 receptor gamma proteins are well known in the art.

0091ApoE locus in mammals, humans, or non-human mammals, interleukin-2 receptor gamma locus in mammals, humans, or non-human mammals, Rag2 locus in mammals, humans, or non-human mammals , Mammalian, human, or non-human mammalian Rag1 locus, and / or genetic modification to the Mammalian, human, or non-human mammalian Rag2 / Rag1 locus is an endogenous nucleic acid sequence at the genomic locus. May include deletions, insertion of exogenous nucleic acids at genomic loci, or combinations thereof. Deletions and / or insertions can occur anywhere within a given locus discussed elsewhere herein.

0092Further embodiments provided herein include another of the ApoE locus, the interleukin-2 receptor gamma (Il2rg) locus, the Rag2 locus, the Rag1 locus, and / or a portion of the Rag2 / Rag1 locus. ApoE locus, interleukin-2 receptor gamma locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus replaced by the corresponding homologous or orthologous moieties of the organism, mammals, Includes modifications of the ApoE locus, interleukin-2 receptor gamma locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus in human or non-human mammals.

0093In still other embodiments, of the ApoE locus, interleukin-2 receptor gamma locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus of mammalian, human, or non-human mammals. One or more modifications of the ApoE locus, the interleukin-2 receptor gamma (Il2rg) locus, the Rag2 locus, the Rag1 locus, and / or a portion of the Rag2 / Rag1 locus, over its entire length. At least 80%, 85%, 90%, 91% of the ApoE locus, interleukin-2 receptor gamma locus, Rag2 locus, Rag1 locus, and / or part of the Rag2 / Rag1 locus to be replaced by , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% through replacement with shared insert polynucleotides.

0094Corresponding regions of a given inserted polynucleotide and / or deleted locus are coding regions, introns, exons, untranslated regions, regulatory regions, promoters, or enhancers, or any combination thereof, or any combination thereof. Can be part. In addition, the region of a given inserted polynucleotide and / or, for example, a deletion locus, is, for example, 10-100 nucleotides long, 100-500 nucleotides long, 500-1 kb nucleotides long, 1 kb-1.5 kb nucleotides long, 1.5 kb-. Any desired nucleotide length, including 2 kb to 2 kb, 2 kb to 2.5 kb, 2.5 kb to 3 kb, 3 kb to 5 kb, 5 kb to 8 kb, 8 kb to 10 kb, and even longer. It can be of length. In another example, the size of the insert or replacement is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb. 100kb ~ about 150kb, about 150kb ~ about 200kb, about 200kb ~ about 250kb, about 250kb ~ about 300kb, about 300kb ~ about 350kb, about 350kb ~ about 400kb, about 400kb ~ about 800kb, about 800kb ~ 1Mb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, about 2.5Mb ~ about 2.8Mb, about 2. It is 8Mb ~ about 3Mb. In other embodiments, the region of a given inserted polynucleotide and / or deleted locus is at least 100, 200, 300, 400, 500, 600, 700, 800, or 900 nucleotides, or at least 1 kb, 2 kb, 3kb, 4kb, 5kb, 6kb, 7kb, 8kb, 9kb, 10kb, 11kb, 12kb, 13kb, 14kb, 15kb, 16kb, or more. In other embodiments, the region of a given inserted polynucleotide and / or deleted locus is at least 10 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, At least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, or at least 300 kb, or more.

0095Given insert polynucleotides are, for example, rodents, non-rat rodents, rats, mice, hamsters, mammals, non-human mammals, eukaryotes, non-rat eukaryotes, humans, agricultural animals, Or it can be from any organism, including livestock.

0096As discussed in more detail herein, various methods include, for example, the ApoE locus, the interleukin-2 receptor gamma (Il2rg) locus, the Rag2 locus, the Rag1 locus, and / or Rag2 / Rag1. Provided to result in targeted modification of any locus of interest, including targeted modification at the locus. Genes containing deletions, insertions, substitutions, and / or any combination thereof at the interleukin-2 receptor gamma locus, ApoE locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus Genetically modified non-human animals, genetically modified non-human mammals, genetically modified non-rat eukaryotes, genetically modified non-pluripotent cells, or genetically modified Pluripotent cells (eg, pluripotent cells, non-human pluripotent cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human progenitor cells, or human iPS cells) Further provided. Such genetic alterations, including those that result in the absence, decrease, increase, or regulation of target locus activity, can also be transmitted through germline. In certain embodiments, the genetic modification results in a knockout of the desired target locus. Such non-human animals find use in various experimental systems, for example, as discussed elsewhere herein.

0097For example, ApoE (apolipoprotein E) knockouts include, but are not limited to, plaque formation, transcriptional alterations (total transcriptome shotgun sequencing (RNA-Seq)), and exvivo function, to study endothelial function. ApoE is an important transport molecule and can transport lipids such as cholesterol through the bloodstream. ApoE is also used in the nervous system, for example, to remove β-amyloid from the brain. It can also function. Modifications in ApoE have been associated with a variety of conditions, including, for example, atherosclerosis, dyslipidemia, and Alzheimer's disease. ApoE knockout animals remove lipoproteins from their blood. It exhibits hypofunction and develops atherosclerosis. Therefore, ApoE knockout animals, for example, have endothelial function, plaque formation, transcriptional alterations (RNA-Seq), dyslipidemia, atherosclerosis, and Alzheimer's disease. Provides a model for studying conditions and / or processes such as. Assays for measuring ApoE activity are well known in the art. For example, reduction of ApoE activity can be achieved by such as ELISA or immunoblotting. Immunological assays can be measured by assaying for reduced ApoE levels in blood samples obtained from subjects. In addition, the large size of rats facilitates all of these assays and improves data quality. ..

0098RAG1 (recombination activating gene 1) and RAG2 (recombination activating gene 2) are part of a multi-subunit complex with VDJ recombination activity and rearrange the immunoglobulin and T cell receptor genes in lymphocytes. And an enzyme that plays an important role in recombination. RAG1 and RAG2 induce double-stranded DNA cleavage to facilitate recombination and conjugation of segments of the T cell receptor and B cell receptor (ie, immunoglobulin) genes. Knockout of RAG1 and / or RAG2 results in loss of B cells and T cells, leading to severe immune deficiency. RAG1 and / or RAG2 knockout animals are used, for example, in studies of xenografts (ie, human cell xenografts in rats), cancer, vaccine development, autoimmune diseases, infectious diseases, and graft-versus-host disease (GVHD). Find use of. Various assays for measuring RAG1 and / or RAG2 activity are well known in the art, including, for example, measuring recombination efficiency in a subject or assaying for the presence or absence of B cells and / or T cells. ..

0099The IL-2 receptor (IL-2R) is expressed on the surface of certain immune cells and binds to the cytokine interleukin-2 (IL-2). IL-2R is an endogenous membrane containing at least three separate subunit chains containing the alpha chain (IL-2Ra, CD25), beta chain (IL-2Rb, CD122), and gamma chain (IL2-Rg, CD132). It is a protein. The IL-2 receptor gamma (also referred to as IL2r-γ or IL2Rg) chain can include, for example, various receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. It is a common gamma chain shared by various cytokine receptors. IL-2Rg is an extracellular domain on the extracellular surface of cells that contributes to ligand binding, a transmembrane domain, and an intracellular domain that can interact with various molecules to induce intracellular signal conversion pathways. ,including. The Il2rg gene is found on the X-chromosome in mammals, and certain mutations in the gamma chain in humans can cause human X-linked severe combined immunodeficiency (XSCID) characterized by severe T cell deficiency. .. In addition, the extracellular domain of the gamma chain can escape from the transmembrane receptor and be released as a soluble gamma chain receptor. Soluble gamma chain receptors can be detected in the blood of a subject and can function to regulate cytokine signaling.

0100In some embodiments, the non-human IL-2Rg chain is replaced with a human IL2-Rg chain such that the genetically modified animal expresses the complete human IL-2Rg chain. In another example, it may be useful to replace only the extracellular domain of the non-human IL-2Rg chain with the extracellular domain of the human IL-2Rg chain. In such cases, the resulting humanized IL-2Rg chain expressed in non-humans contains the human extracellular domain and the rest of the molecule is from a natural organism.

0101Full-length humanization of IL-2Rg is useful because non-human mammals carrying this modified locus produce human IL-2Rg. This enables the detection of human IL-2Rg in non-human mammals having antibodies specific for human IL-2Rg. An IL-2Rg polypeptide that binds to the human ligand of IL2-Rg by extracellular humanization (ie, replacing the extracellular domain of non-human mammalian IL-2Rg with the extracellular domain of human IL-2Rg). As a result, the extracellular humanized form of IL-2Rg will also interact with non-human mammalian signaling mechanisms, as the cytoplasmic domain is still of non-human mammalian origin.

01022. Modification of target locus A. Targeting vector and inserted nucleic acid i. Inserted nucleic acid As used herein, the "inserted nucleic acid" includes a segment of DNA that is desired to be integrated at the target locus. In one embodiment, the inserted nucleic acid comprises one or more polynucleotides of interest. In other embodiments, the inserted nucleic acid may comprise one or more expression cassettes. A given expression cassette may include a polynucleotide of interest, a polynucleotide encoding a selectable marker and / or a reporter gene, along with various regulatory components that affect expression. Non-limiting examples of polynucleotides of interest, selectable markers, and reporter genes that can be contained within the inserted nucleic acid are discussed in detail elsewhere herein.

0103In certain embodiments, the inserted nucleic acid may include nucleic acid from a rat, which may include a segment of genomic DNA, a cDNA, a regulatory region, or any portion or combination thereof. In other embodiments, the inserted nucleic acid is eukaryote, non-rat eukaryote, mammal, human, non-human mammal, rodent, non-rat rodent, human, rat, mouse, hamster, rabbit, From pigs, cows, deer, sheep, goats, chickens, cats, dogs, ferrets, primates (eg, marmosets, red-haired monkeys), domestic mammals, or agricultural mammals, or any other organism of interest. May contain nucleic acids. As outlined herein in more detail, the inserted nucleic acids used in various methods and compositions can result in "humanization" of the target locus of interest.

0104In one embodiment, the inserted nucleic acid comprises at least one exon knock-in allele of the endogenous gene. In one embodiment, the inserted nucleic acid comprises a knock-in allele of the entire endogenous gene (ie, "gene exchange knock-in").

0105In one embodiment, the inserted nucleic acid comprises a regulator, including, for example, a promoter, enhancer, or transcriptional repressor binding factor.

0106In a further embodiment, the inserted nucleic acid comprises a conditional allele. In one embodiment, the conditional allele is a multifunctional allele described in US Pat. No. 6,2011 / 0104799, which is incorporated by reference in its entirety. In certain embodiments, this conditional allele is the nucleotide of interest for (a) a sense-oriented trigger sequence for transcription of the target gene, and a sense or antisense-oriented drug selection cassette, (b) antisense-oriented. Utilize conditional (COIN, exon split introns and invertable gene trap-like modules) by sequence (NSI) and inversion modules, see, eg, US Pat. No. 6,2011 / 0104799, which is incorporated by reference in its entirety. (I), and (c) recombination upon exposure to the first recombinase, (i) lacking the trigger sequence and DSC, and (ii) containing NSI in sense orientation and COIN in antisense orientation. Includes recombinant units, which form the allele.

0107The inserted nucleic acids are about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 150 kb, and about 150 kb to about 150 kb. It ranges from 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb.

0108In one embodiment, the inserted nucleic acid is, for example, eukaryotic cells, non-rat eukaryotic cells, mammalian cells, human cells ranging from about 1 kb to about 200 kb, about 2 kb to about 20 kb, or about 0.5 kb to about 3 Mb. , Or a deletion of a non-human mammalian cell genomic DNA sequence. In one embodiment, the degree of deletion of the genomic DNA sequence is greater than the overall length of the 5'homologous arm and the 3'homologous arm. In one embodiment, the degree of deletion of the genomic DNA sequence is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb. , About 100 kb ~ about 150 kb, about 150 kb ~ about 200 kb, about 20 kb ~ about 30 kb, about 30 kb ~ about 40 kb, about 40 kb ~ about 50 kb, about 50 kb ~ about 60 kb, about 60 kb ~ about 70 kb, about 70 kb ~ about 80 kb, about 80kb ~ about 90kb, about 90kb ~ about 100kb, about 100kb ~ about 110kb, about 110kb ~ about 120kb, about 120kb ~ about 130kb, about 130kb ~ about 140kb, about 140kb ~ about 150kb, about 150kb ~ about 160kb, about 160kb ~ About 170 kb, about 170 kb ~ about 180 kb, about 180 kb ~ about 190 kb, about 190 kb ~ about 200 kb, about 200 kb ~ about 250 kb, about 250 kb ~ about 300 kb, about 300 kb ~ about 350 kb, about 350 kb ~ about 400 kb, about 400 kb ~ about 800 kb , About 800kb ~ 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, about 2.5Mb ~ about 2.8Mb, about 2.8Mb ~ about 3Mb, about 200kb ~ about 300kb, about 300kb It ranges from ~ 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ about 3Mb.

0109In one embodiment, the inserted nucleic acid comprises the insertion of a eukaryotic cell, non-rat eukaryotic cell, mammalian, human, or non-human mammalian nucleic acid sequence or a homologous or substitution by an orthologous human nucleic acid sequence thereof. In one embodiment, the inserted nucleic acid comprises the insertion of a DNA sequence or the homology of a DNA sequence or the substitution by an orthologous human nucleic acid sequence at an endogenous locus containing the corresponding DNA sequence.

0110In one embodiment, the genetic modification is the addition of a nucleic acid sequence. In one embodiment, the added nucleotide sequence ranges from 5 kb to 200 kb.

0111In one embodiment, the inserted nucleic acid comprises a genetic modification in the coding sequence. In one embodiment, the genetic modification comprises a deletion mutant of the coding sequence. In one embodiment, the genetic modification comprises the fusion of two endogenous coding sequences. In one embodiment, the inserted nucleic acid comprises eukaryotic cells, non-rat eukaryotic cells, mammals, humans, or non-human mammals, insertion of nucleic acid sequences or substitution by homologues or orthologous human nucleic acid sequences thereof. In one embodiment, the inserted nucleic acid comprises the insertion of a rat DNA sequence or the homology of a rat DNA sequence or the substitution by an orthologous human nucleic acid sequence at an endogenous rat locus containing the corresponding rat DNA sequence.

0112In one embodiment, the genetic modification comprises a deletion of a non-protein coding sequence, but does not include a deletion of a protein coding sequence. In one embodiment, a deletion of a non-protein coding sequence comprises a deletion of a regulatory element. In one embodiment, the genetic modification comprises a promoter deletion. In one embodiment, genetic modification comprises the addition of a promoter or regulatory element. In one embodiment, the genetic modification comprises the substitution of a promoter or regulatory element.

0113In one embodiment, the nucleic acid sequence of the targeting vector comprises a polynucleotide that, when integrated into the genome, causes a genetic modification of the ApoE locus region of a mammalian, human, or non-human mammal, at the ApoE locus. Genetic modification results in decreased ApoE activity, increased ApoE activity, or regulation of ApoE activity. In one embodiment, an ApoE knockout (a "null allele") is made.

0114In one embodiment, the nucleic acid sequence of the targeting vector is interleukin-when integration into the genome results in a genetic modification of the region of the interleukin-2 receptor locus in mammalian, human cells, or non-human mammals. Genetic modification at the 2 receptor loci may include polynucleotides that reduce interleukin-2 receptor activity. In one embodiment, an interleukin-2 receptor knockout (null allele) is made.

0115In a further embodiment, the inserted nucleic acid is a mammalian, human cell, or non-human mammalian ApoE locus, interleukin-2 receptor gamma locus and / or Rag2 locus, and / or Rag1 locus, and /. Or part of the Rag2 / Rag1 locus, the ApoE locus from another organism, the interleukin-2 receptor gamma locus, the Rag2 locus, the Rag1 locus, and / or the corresponding homology of the Rag2 / Rag1 locus or It results in replacement by the orthologous portion.

0116In yet another embodiment, the inserted nucleic acid is at the ApoE locus, the interleukin-2 receptor gamma locus, the Rag2 locus, the Rag1 locus, and / or the Rag2 / Rag1 locus that it replaces over its entire length. Includes polynucleotides that share at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a portion.

0117A given insertion polynucleotide and the corresponding region of a mammalian, human cell, or non-human mammalian locus to be substituted can be a coding region, an intron, an exon, an untranslated region, a regulatory region, a promoter, or an enhancer, or It can be any combination of them. In addition, the region of a given inserted polynucleotide and / or deletion locus in a mammalian, human cell, or non-human mammalian is, for example, 10-100 nucleotides in length, 100-500 nucleotides in length, 500-1 kb nucleotides in length. , 1 kb ~ 1.5 kb long, 1.5 kb ~ 2 kb long, 2 kb ~ 2.5 kb long, 2.5 kb ~ 3 kb long, 3 kb ~ 5 kb long, 5 kb ~ 8 kb long, 8 kb ~ 10 kb long, or more Can also be of any desired length, including long nucleotide lengths. In other examples, the size of the insert or replacement is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb. 100kb ~ about 150kb, about 150kb ~ about 200kb, about 200kb ~ about 250kb, about 250kb ~ about 300kb, about 300kb ~ about 350kb, about 350kb ~ about 400kb, about 400kb ~ about 800kb, about 800kb ~ 1Mb, about 1Mb ~ about It is 1.5Mb, about 1.5Mb to about 2Mb, about 2Mb to about 2.5Mb, about 2.5Mb to about 2.8Mb, and about 2.8Mb to about 3Mb. In other embodiments, the region of a given insertion polynucleotide and / or deletion locus of a mammalian, human cell, or non-human mammal is at least 100, 200, 300, 400, 500, 600, 700, 800 or 900 nucleotides, or at least 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 16 kb, or more.

0118In one embodiment, the promoter is a constitutively active promoter.

0119In one embodiment, the promoter is an inductive promoter. In one embodiment, the inductive promoter is a chemically regulated promoter. In one embodiment, the chemically regulated promoter is an alcohol regulated promoter. In one embodiment, the alcohol-regulated promoter is an alcohol dehydrogenase (alcA) gene promoter. In one embodiment, the chemically regulated promoter is a tetracycline regulated promoter. In one embodiment, the tetracycline regulated promoter is a tetracycline responsive promoter. In one embodiment, the tetracycline-regulated promoter is a tetracycline operator sequence (tetO). In one embodiment, the tetracycline-regulated promoter is a tet-on promoter. In one embodiment, the tetracycline-regulated promoter is a tet-Off promoter. In one embodiment, the chemically regulated promoter is a steroid-regulated promoter. In one embodiment, the steroid-regulated promoter is a rat glucocorticoid receptor promoter. In one embodiment, the steroid-regulated promoter is an estrogen receptor promoter. In one embodiment, the steroid-regulated promoter is an ecdysone receptor promoter. In one embodiment, the chemically regulated promoter is a metal regulated promoter. In one embodiment, the metal regulation promoter is a metalloprotein promoter. In one embodiment, the inductive promoter is a physically regulated promoter. In one embodiment, the physically regulated promoter is a temperature regulated promoter. In one embodiment, the temperature controlled promoter is a heat shock promoter. In one embodiment, the physically regulated promoter is a light regulated promoter. In one embodiment, the light control promoter is a light induction promoter. In one embodiment, the light control promoter is a light inhibitory promoter.

0120In one embodiment, the promoter is a tissue-specific promoter. In one embodiment, the promoter is a neuron-specific promoter. In one embodiment, the promoter is a glial-specific promoter. In one embodiment, the promoter is a muscle cell-specific promoter. In one embodiment, the promoter is a cardiac cell-specific promoter. In one embodiment, the promoter is a renal cell specific promoter. In one embodiment, the promoter is an osteoocyte-specific promoter. In one embodiment, the promoter is an endothelial cell-specific promoter. In one embodiment, the promoter is an immune cell-specific promoter. In one embodiment, the immune cell promoter is a B cell promoter. In one embodiment, the immune cell promoter is a T cell promoter.

0121In one embodiment, the promoter is a developmentally regulated promoter. In one embodiment, a developmentally regulated promoter is active only during developmental embryogenesis. In one embodiment, the developmentally regulated promoter is active only in mature cells.

0122In certain embodiments, promoters may be selected based on cell type. Therefore, various promoters include eukaryotic cells, non-rat eukaryotic cells, mammalian cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, human pluripotent cells. , Human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, mouse cells, hamster cells, fibroblasts , Or find use in CHO cells.

0123In some embodiments, the inserted nucleic acid comprises a nucleic acid flanking the site-specific recombination target sequence. Such site-specific recombinant target sequences may be flanked by the entire insertion nucleic acid, but any region or individual polynucleotide of interest within the insertion nucleic acid may also be such site. Be recognized. The site-specific recombinase can be introduced into the cell by any means, including introducing the recombinase polypeptide into the cell, introducing a polynucleotide encoding the site-specific recombinase into the host cell, and the like. The polynucleotide encoding the site-specific recombinase can be located within the inserted nucleic acid or within a separate polynucleotide. Site-specific promoters include promoters that are active in cells, including, for example, inducible promoters, promoters that are endogenous to cells, promoters that are heterologous to cells, cell-specific promoters, tissue-specific promoters, or developmental stage-specific promoters. Can be operably connected to. In the inserted nucleic acid, site-specific recombinant target sequences in which the inserted nucleic acid or any polynucleotide of interest may be laterally located include loxP, lox511, lox2272, lox66, lox71, loxM2, lox5171, FRT, FRT11, FRT71, attp. , Att, FRT, rox, and combinations thereof.

0124In some embodiments, the site-specific recombination site is flanked by a polynucleotide encoding a selectable marker and / or reporter gene contained within the inserted nucleic acid. In such an example, after integration of the inserted nucleic acid at the target locus, the sequences between site-specific recombination sites can be removed.

0125In one embodiment, the inserted nucleic acid comprises a polynucleotide encoding a selectable marker. The selectable marker may be included in the selectable cassette. As such a selectable marker, neomycin phosphotransferase (neo)r), Hygromycin B phosphotransferase (hyg)r), Puromycin-N-acetyltransferase (puro)r), Blasticidin S deaminase (bsr)r), Xanthine / guanine phosphoribosyl transferase (gpt), or herpes simplex virus thymidine kinase (HSV-k), or a combination thereof, but is not limited to these. In one embodiment, the polynucleotide encoding the selection marker is a cell, rat cell, pluripotent rat cell, ES rat cell, eukaryotic cell, non-rat eukaryotic cell, pluripotent cell, non-pluripotent cell, Non-human pluripotent cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, mammalian cells, non-human mammalian cells, human cells, rodents It is operably linked to an active promoter in similar cells, non-rat rodent cells, mouse cells, hamster cells, fibroblasts, or CHO cells. When the polynucleotide of interest is continuously tiling at the target locus, the selectable marker may include a recombination site for the nuclease agent, as outlined above. In one embodiment, the polynucleotide encoding the selectable marker is flanked by a site-specific recombination target sequence.

0126The inserted nucleic acid may further contain a reporter gene operably linked to the promoter, which is LacZ, mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet, A group consisting of high-sensitivity yellow fluorescent protein (eYFP), emerald, high-sensitivity green fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP), azure, T-sapphire, luciferase, alkaline phosphatase, and / or a combination thereof. Encode reporter proteins selected from or containing them. Such a reporter gene can be operably linked to an active promoter in the cell. Such promoters can be inducible promoters, promoters that are endogenous to the reporter gene or cell, promoters that are heterologous to the reporter gene or cell, cell-specific promoters, tissue-specific promoters, or developmental stage-specific promoters.

0127In one embodiment, the insertion of nucleic acid is the nervous system, skeletal system, digestive system, circulatory system, muscular system, respiratory system, cardiovascular system, lymphatic system, endocrine system, urinary system, genital system, or a combination thereof. Can include mammalian nucleic acids containing genomic loci encoding proteins expressed in. In one embodiment, the mammalian nucleic acid comprises a genomic locus encoding a protein expressed in bone marrow or bone marrow-derived cells. In one embodiment, the nucleic acid comprises a genomic locus encoding a protein expressed in spleen cells.

0128In one embodiment, the mammalian nucleic acid is the nervous system, skeletal system, digestive system, circulatory system, muscular system, respiratory system, cardiovascular system, lymphatic system, endocrine system, urinary system, genital system, or theirs. Includes genomic loci encoding proteins expressed in combination. In one embodiment, the mammalian nucleic acid comprises a genomic locus encoding a protein expressed in bone marrow or bone marrow-derived cells. In one embodiment, the nucleic acid comprises a genomic locus encoding a protein expressed in spleen cells. In one embodiment, the genomic locus is a mouse genomic DNA sequence, a rat genomic DNA sequence, a eukaryotic genomic DNA sequence, a non-rat eukaryotic genomic DNA sequence, a mammalian genomic DNA sequence, a human genomic DNA sequence, or a non-human DNA. Includes sequence mammals, or combinations thereof. In one embodiment, the genomic locus comprises a rat and human genomic DNA sequence in any order. In one embodiment, the genomic locus comprises mouse and human genomic DNA sequences in any order. In one embodiment, the genomic locus comprises mouse and rat genomic DNA sequences in any order. In one embodiment, the genomic locus comprises rat, mouse, and human genomic DNA sequences in any order.

0129In one embodiment, the genomic loci are mouse genomic DNA sequence, rat genomic DNA sequence, hamster genomic DNA sequence, human genomic DNA sequence, eukaryotic genomic DNA sequence, non-rat eukaryotic genomic DNA sequence, mammalian genomic DNA sequence. , Or non-human DNA sequences, mammals, or combinations thereof. In one embodiment, the genomic locus comprises a rat and human genomic DNA sequence in any order. In one embodiment, the genomic locus comprises mouse and human genomic DNA sequences in any order. In one embodiment, the genomic locus comprises mouse and rat genomic DNA sequences in any order. In one embodiment, the genomic locus comprises rat, mouse, and human genomic DNA sequences in any order.

0130In one embodiment, the genetic modification comprises at least one human disease allele of the human gene. In one embodiment, the human disease is a neurological disease. In one embodiment, the human disease is a cardiovascular disease. In one embodiment, the human disease is a renal disease. In one embodiment, the human disease is a muscle disease. In one embodiment, the human disease is a blood disease. In one embodiment, the human disease is cancer. In one embodiment, the human disease is an immune system disease.

0131In one embodiment, the human disease allele is a dominant allele. In one embodiment, the human disease allele is a recessive allele. In one embodiment, the human disease allele comprises a single nucleotide polymorphism (SNP) allele.

0132In one embodiment, genetic modification produces a mutant form of a protein that has altered binding properties, altered localization, altered expression, and / or altered expression patterns.

0133In one embodiment, the inserted nucleic acid comprises a selection cassette. In one embodiment, the selection cassette comprises a nucleic acid sequence encoding a selectable marker, which is operably linked to an active promoter in rat ES cells. In one embodiment, the selectable marker is selected from or comprises a hygromycin resistance gene or a neomycin resistance gene.

0134In one embodiment, the nucleic acid comprises a genomic locus encoding a protein expressed on B cells. In one embodiment, the nucleic acid comprises a genomic locus encoding a protein expressed in immature B cells. In one embodiment, the nucleic acid comprises a genomic locus encoding a protein expressed in mature B cells.

0135In one embodiment, the inserted nucleic acid comprises a regulatory element. In one embodiment, the adjusting element is a promoter. In one embodiment, the regulatory element is an enhancer. In one embodiment, the regulatory element is a transcriptional repressor binding element.

0136In one embodiment, the genetic modification comprises a deletion of a non-protein coding sequence, but does not include a deletion of a protein coding sequence. In one embodiment, a deletion of a non-protein coding sequence comprises a deletion of a regulatory element. In one embodiment, the genetic modification comprises a deletion of a regulatory element. In one embodiment, genetic modification comprises the addition of a promoter or regulatory element. In one embodiment, the genetic modification comprises the substitution of a promoter or regulatory element.

0137ii. Expression cassette Any one or any of the genomic integration systems of interest provided herein (ie, nuclease agents, recognition sites, inserted nucleic acids, polynucleotides of interest, targeting vectors, selection markers, and other components). Polynucleotides or nucleic acid molecules, including the various components used in any combination thereof), are provided herein.

0138The terms "polynucleotide", "polynucleotide sequence", "nucleic acid sequence", and "nucleic acid fragment" are used interchangeably herein. These terms include nucleotide sequences and the like. The polynucleotide may optionally be a polymer of single- or double-stranded RNA or DNA containing synthetic, unnatural, or modified nucleotide bases. A polynucleotide in the form of a DNA polymer may consist of one or more segments of cDNA, genomic DNA, synthetic DNA, or a mixture thereof. Polynucleotides can include deoxyribonucleotides, which include both natural and synthetic analogs, as well as any combination thereof. The polynucleotides provided herein also include, but are not limited to, all forms of the sequence, including, but not limited to, single-stranded, double-stranded, hairpin, stem-and-loop structures, and the like.

0139Further provided are recombinant polynucleotides containing various components of the genomic integration system of interest. The terms "recombinant polynucleotide" and "recombinant DNA construct" are used interchangeably herein. Recombinant constructs include artificial or heterogeneous combinations of nucleic acid sequences such as regulatory and coding sequences that are not found together in nature. In other embodiments, the recombinant construct also comprises regulatory and coding sequences from different origins, or regulatory and coding sequences that are derived from the same origin but are arranged in a manner different from that found in nature. Good. Such constructs may be used by themselves or in combination with vectors. When using a vector, the choice of vector depends on the method used to transform the host cell, as is well known to those of skill in the art. For example, a plasmid vector can be used. Also provided are the genetic elements required to successfully transform, select and proliferate a host cell containing any of the isolated nucleic acid fragments provided herein. Screening may be accomplished, among other things, by Southern analysis of DNA, Northern analysis of mRNA expression, Western analysis of protein expression, or phenotypic analysis.

0140In certain embodiments, one or more of the components of the genomic integration system of interest described herein are prokaryotic cells, eukaryotic cells, non-rat eukaryotic cells, bacteria, yeast cells, or mammals. Provided in an expression cassette for expression in cells, or other organisms or cell types of interest. The cassette can include 5'and 3'regulatory sequences operably linked to the polynucleotides provided herein. "Operatively linked" includes a relationship in which the operably linked components function in their intended manner. For example, an operable link (ie, promoter) between a polynucleotide of interest and a regulatory sequence is a functional link that allows expression of the polynucleotide of interest. The operably connected elements may be continuous or discontinuous. When used to refer to the binding of two protein coding regions, operably linked means that the coding regions are in the same reading frame. In another example, the nucleic acid sequence encoding the protein can be operably linked to a regulatory sequence (eg, promoter, enhancer, silencer sequence, etc.) so as to retain proper transcriptional regulation. In one example, the nucleic acid sequence of the immunoglobulin variable region (or V (D) J segment) is the nucleic acid sequence of the immunoglobulin constant region so as to allow proper recombination between the sequences into the immunoglobulin heavy or light chain sequence. Can be operably connected to.

0141The cassette may further contain at least one additional polynucleotide of interest to be co-introduced into the organism. Alternatively, additional polynucleotides of interest may be provided on multiple expression cassettes. Expression cassettes are provided that have multiple restriction sites and / or recombination sites for insertion of recombinant polynucleotides under transcriptional regulation of the regulatory region. The expression cassette may further contain a selectable marker gene.

0142Expression cassettes are functional for transcription, transcription and translation initiation regions (ie, promoters) in the 5'to 3'direction, recombinant polynucleotides provided herein, and mammalian cells or host cells of interest. Transcription and translation termination regions (ie, termination regions) can be included. The regulatory regions (ie, promoters, transcriptional regulatory regions, and translation termination regions) and / or the polynucleotides provided herein can be natural / similar to or to host cells. Alternatively, the regulatory regions and / or the polynucleotides provided herein can be heterologous to or from the host cell. For example, if the promoters operably linked to a heterologous polynucleotide are from a different species than the species from which the polynucleotide was derived, or if they are from the same / similar species, one or both of them Substantially modified from the archetypal and / or genomic loci, or the promoter is not a natural promoter for operably linked polynucleotides. Alternatively, the regulatory regions and / or the polynucleotides provided herein can be fully synthesized.

0143This termination region can be natural, including a transcription initiation region, can be natural, including an operably linked recombinant polynucleotide, can be natural, including a host cell, or a promoter, recombinant polynucleotide. , Host cells, or any combination thereof, may come from a different origin (ie, foreign or heterologous).

0144When preparing the expression cassette, various DNA fragments may be manipulated to provide the DNA sequence in the proper orientation. For this purpose, an adapter or linker may be used to ligate the DNA fragments, or other operations may be performed to provide a convenient restriction site, remove excess DNA, remove the restriction site, etc. It may be included. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, revisions, such as transversion and transversion may be performed.

0145Many promoters can be used in the expression cassettes provided herein. This promoter can be selected based on the desired result. It is recognized that the use of different promoters in expression cassettes can enhance different uses to regulate the timing, location, and / or level of expression of the polynucleotide of interest. Such expression constructs are also optionally regulated in promoter regulatory regions (eg, inducible, constitutive, environmentally, or developmentally regulated, or cell or tissue-specific / selective expression. Can also include), transcription initiation sites, ribosome binding sites, RNA processing signals, transcription termination sites, and / or polyadenylation signals.

0146Expression cassettes containing polynucleotides provided herein can also contain selectable marker genes for selection of transformed cells. Selectable marker genes are utilized for selection of transformed cells or tissues.

0147If desired, the sequences used in the methods and compositions (ie, polynucleotides of interest, nucleases, etc.) can be optimized for increased expression in cells. That is, the genes are, for example, mammalian preferred codons, human preferred codons, rodent preferred codons, non-rat rodent preferred codons, mouse preferred codons, rat preferred codons, hamster preferred codons, etc. for improved expression. Can be synthesized using codons preferred in a given cell of interest, including.

0148Selectable markers can be used in the various methods and compositions provided herein. Various selectable markers can be used in the methods and compositions disclosed herein. Such selectable markers can confer resistance to antibiotics such as G418, hygromycin, blastsidedin, neomycin, or puromycin. As such a selectable marker, neomycin phosphotransferase (neo)r), Hygromycin B phosphotransferase (hyg)r), Puromycin-N-acetyltransferase (puro)r), And Blasticidin S deaminase (bsr)r). In yet another embodiment, the selectable marker is operably linked to an induction promoter and expression of the selectable marker is toxic to the cell. Non-limiting examples of such selectable markers include xanthine / guanine phosphoribosyl transferase (gpt), hypoxanthine-guanine phosphoribosyl transferase (HGPRT), or herpes simplex virus thymidine kinase (HSV-TK). The polynucleotide encoding the selectable marker is operably linked to an active promoter in the cell.

0149iii. Targeting vector The targeting vector contains the inserted nucleic acid as the target gene for rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammal, human, rodent, non-rat rodent, mouse, or hamster nucleic acid. Used to introduce to. The targeting vector comprises an insert nucleic acid and further comprises 5'and 3'homology arms flanking the insert nucleic acid. The homology arm adjacent to the inserted nucleic acid targets the nucleic acid of rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, mouse, or hamster. Corresponds to the region within the locus. For convenience of reference, the corresponding homologous genomic region within the target genomic locus is referred to herein as the "target site." For example, the targeting vector may contain a first insertion nucleic acid flanked by first and second homology arms complementary to the first and second target sites. Thus, the targeting vector thereby produces rats, eukaryotes, non-rat eukaryotes, mammals, through complementary recombination events that occur between the homologous arm and complementary target sites within the cell's genome. Insertion of non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid into the target locus Helps integrate the nucleic acid.

0150In one embodiment, the target locus of nucleic acid of a rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, mouse, or hamster is 5 Includes a first nucleic acid sequence complementary to the'homologous arm and a second nucleic acid sequence complementary to the'3' homologous arm. In one embodiment, the first and second nucleic acid sequences are separated by at least 5 kb. In another embodiment, the first and second nucleic acid sequences are at least 5 kb but less than 200 kb apart. In one embodiment, the first and second nucleic acid sequences are separated by at least 10 kb. In one embodiment, the first and second nucleic acid sequences are at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 110 kb, at least 120 kb, at least 130 kb. , At least 140 kb, at least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at least 190 kb, or at least 200 kb apart. In a further embodiment, the first and second nucleic acid sequences are at least 5 kb but less than 10 kb, at least 5 kb but less than 3 Mb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, and at least 40 kb. Less than 60 kb, at least 60 kb but less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, At least about 300 kb but less than about 400 kb, at least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 1 Mb but about 1.5 Mb Less than, at least about 2Mb, but 2.

0151The homologous arms of the targeting vector are, for example, at least 5-10 kb, 5-15 kb, 10-20 kb, 20-30 kb, 30-40 kb, 40-50 kb, 50-60 kb, 60-70 kb, 70-80 kb, 80- 90kb, 90 ~ 100kb, 100 ~ 110kb, 110 ~ 120kb, 120 ~ 130kb, 130 ~ 140kb, 140 ~ 150kb, 150 ~ 160kb, 160 ~ 170kb, 170 ~ 180kb, 180 ~ 190kb, 190 ~ 200kb length or longer It can be from any length sufficient to promote a homologous recombination event with a corresponding target site, including. Larger targeting vectors can use targeting arms of larger length, as outlined in more detail below. In certain embodiments, the sum of the 5'homologous arm and the 3'homologous arm is at least 10 kb, or the sum of the 5'homologous arm and the 3'homologous arm is at least about 16 kb to about 100 kb or It is about 30 kb to about 100 kb. In other embodiments, the total magnitude of the LTVEC 5'and 3'homology arms is about 10 kb to about 150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb, about 20 kb to about 150 kb, about 20kb ~ about 100kb, about 20kb ~ about 75kb, about 30kb ~ about 150kb, about 30kb ~ about 100kb, about 30kb ~ about 75kb, about 40kb ~ about 150kb, about 40kb ~ about 100kb, about 40kb ~ about 75kb, about 50kb ~ About 150 kb, about 50 kb ~ about 100 kb, or about 50 kb ~ about 75 kb, about 10 kb ~ about 30 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about It is 120 kb, or about 120 kb to about 150 kb. In one embodiment, the size of the deletion is equal to or similar to the total size of the LTVEC 5'and 3'homology arms.

0152In one embodiment, the genomic locus of interest comprises (i) a 5'target sequence homologous to the 5'homologous arm and (ii) a 3'target sequence homologous to the 3'homologous arm. In one embodiment, the 5'and 3'target sequences are at least 5 kb but less than 3 Mb apart. In a further embodiment, the 5'and 3'target sequences are at least 5 kb but less than 10 kb, at least 5 kb but less than 3 Mb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least. 40 kb but less than 60 kb, at least 60 kb but less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb At least about 300 kb but less than about 400 kb, at least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 1 Mb but about 1.5 Less than Mb, at least about 2Mb but less than 2.5Mb, or at least about 2.5Mb but less than about 3Mb, or at least about 2Mb but less than about 3Mb apart.

0153When a nuclease agent is used, the homologous genomic region corresponding to the 5'and 3'homologous arm of the targeting vector is between the homologous genomic region and the homologous arm upon nick or double-strand breaks at the recognition site. "Placed in close proximity" to the nuclease target site to facilitate the occurrence of homologous recombination events. For example, nuclease target sites can be located anywhere between homologous genomic regions corresponding to the 5'and 3'homology arms. In certain embodiments, the recognition site is immediately flanked by at least one or both of the homologous genomic regions.

0154As used herein, the homology arm and the target site (ie, the homologous genomic region) are sufficient to "complement" each other or to allow the two regions to act as substrates for homologous recombination reactions. They are "complementary" to each other when they share a level of sequence identity. "Complementarity" means a DNA sequence that is identical to, or shares sequence identity with, a corresponding or "complementary" sequence. The sequence identity between a given target site and the corresponding homology arm found on the targeting vector can be any degree of sequence identity that allows homologous recombination to occur. For example, the amount of sequence identity shared by the homology arm of the targeting vector (or fragment thereof) and the target site (or fragment thereof) is at least 50%, 55% for this sequence to undergo homologous recombination. , 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 It can be%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In addition, the complementary region of complementarity between the homology arm and the complementary target site can be of any length sufficient to promote homologous recombination at the amputated recognition site. For example, a given homology arm and / or complementary target site is such that the homology arm has sufficient complementarity to perform homologous recombination at the corresponding target site within the cell's genome (eg,). At least 5-10 kb, 5-15 kb, 10-20 kb, 20-30 kb, 30-40 kb, 40-50 kb, 50-60 kb, as described elsewhere in the specification of the LTVEC vector. 60 ~ 70kb, 70 ~ 80kb, 80-90kb, 90 ~ 100kb, 100 ~ 110kb, 110 ~ 120kb, 120 ~ 130kb, 130 ~ 140kb, 140 ~ 150kb, 150 ~ 160kb, 160 ~ 170kb, 170 ~ 180kb, 180 ~ 190kb, 190 ~ 200kb, 200kb ~ 3 It can contain complementary regions of homology that are 00 kb long or greater. For convenience of reference, homology arms are referred to herein as 5'and 3'homology arms. This term refers to the relative position of the homology arm with respect to the inserted nucleic acid in the targeting vector.

0155Therefore, the homology arm of the targeting vector is designed to be complementary to the target site having the target locus. Thus, homologous arms can be complementary to loci naturally occurring in the cell, or they can include heterologous or exogenous regions of transgenes, expression cassettes, or genomic DNA. It can be complementary to regions of heterologous or exogenous segments of DNA integrated into the cell's genome, including but not limited to these. Alternatively, the homology arm of the targeting vector can be complementary to a region of a human artificial chromosome, or any other genetically engineered genomic region contained in a suitable host cell. Furthermore, the homology arm of the targeting vector can be complementary to or derived from a region of the BAC library, cosmid library, or P1 phage library. Therefore, in certain embodiments, the homology arm of the targeting vector is a rat, eukaryotic, non-rat eukaryote that is naturally occurring, heterologous, or exogenous in a given cell. Complementary to the genomic loci of mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters. In a further embodiment, the homologous arm is untargetable using conventional methods, or only inaccurately or significantly inefficiently, in the absence of nuclease-induced nicks or double-strand breaks. Complementary to the genomic loci of rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters that can be targeted Is. In one embodiment, the homology arm is derived from synthetic DNA.

0156In yet another embodiment, the 5'and 3'homology arms are complementary to the same genome as the target genome. In one embodiment, the homology arm is from the relevant genome, eg, the targeting genome is the rat genome of the first strain and the targeting arm is from the rat genome of the second strain. The first strain and the second strain are different. In other embodiments, the homology arm is from the genome of the same animal or from the genome of the same strain, eg, the target genome is the rat genome of the first strain. The targeting arm is from the rat genome from the same rat or from the same strain.

0157Targeting vectors (such as large targeting vectors) can also include selectable cassettes or reporter genes, as discussed elsewhere herein. The selection cassette can contain a nucleic acid sequence encoding a selectable marker, the nucleic acid sequence being operably linked to a promoter. Promoters can be active in prokaryotic cells of interest and / or eukaryotic cells of interest. Such promoters can be inducible promoters, promoters that are endogenous to the reporter gene or cell, promoters that are heterologous to the reporter gene or cell, cell-specific promoters, tissue-specific promoters, or developmental stage-specific promoters. In one embodiment, the selectable marker is neomycin phosphotransferase (neo).r), Hygromycin B phosphotransferase (hyg)r), Puromycin-N-acetyltransferase (puro)r), Blasticidin S deaminase (bsr)r), Xanthine / guanine phosphoribosyl transferase (gpt), and herpes simplex virus thymidine kinase (HSV-k), and / or combinations thereof. Selectable markers for the targeting vector can be flanked by 5'and 3'homology arms, or can be found with either 5'or 3'homology arms.

0158In one embodiment, the targeting vector (such as a large targeting vector) comprises a reporter gene operably linked to a promoter, which reporter gene is LacZ, mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed. , MOrange, mKO, mCitrine, Venus, YPet, Sensitive Yellow Fluorescent Protein (EYFP), Emerald, Sensitive Green Fluorescent Protein (EGFP), CyPet, Cyan Fluorescent Protein (CFP), Azure, T-Sapphire, Luciferase, Alkaline Selected from or include phosphatases and / or combinations thereof. Such a reporter gene can be operably linked to an active promoter in the cell. Such promoters can be inducible promoters, promoters that are endogenous to the report gene or cell, promoters that are heterologous to the reporter gene or cell, cell-specific promoters, tissue-specific promoters, or developmental stage-specific promoters.

0159In one embodiment, the combined use of a targeting vector (eg, including a large targeting vector) with a nuclease agent results in an increase in targeting efficiency as compared to the use of the targeting vector alone. In one embodiment, when the targeting vector is used in combination with a nuclease agent, the targeting efficiency of the targeting vector is at least 2-fold, at least 3-fold, as compared to when the targeting vector is used alone. , Or at least a 4-fold increase.

0160When using a targeting vector, the design of the vector can be made to allow the insertion of a given sequence, which is about 5 kb to about 200 kb, as described herein. In one embodiment, the insertion is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 60 kb, about 60 kb to about 70 kb, About 80 kb ~ about 90 kb, about 90 kb ~ about 100 kb, about 100 kb ~ about 110 kb, about 110 kb ~ about 120 kb, about 120 kb ~ about 130 kb, about 130 kb ~ about 140 kb, about 140 kb ~ about 150 kb, about 150 kb ~ about 160 kb, about 160 kb ~ 170 kb, about 170 kb ~ about 180 kb, about 180 kb ~ about 190 kb, or about 190 kb ~ about 200 kb, about 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ It is about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb.

0161When using a targeting vector, the design of the vector can be made to allow substitution of a given sequence, which is about 5 kb to about 200 kb or about 5 kb to about 3.0 Mb, as described herein. .. In one embodiment, the substitutions are about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 60 kb, about 60 kb to about 70 kb, About 80kb ~ about 90kb, about 90kb ~ about 100kb, about 100kb ~ about 110kb, about 110kb ~ about 120kb, about 120kb ~ about 130kb, about 130kb ~ about 140kb, about 140kb ~ about 150kb, about 150kb ~ about 160kb, about 160kb ~ 170 kb, about 170 kb ~ about 180 kb, about 180 kb ~ about 190 kb, about 190 kb ~ about 200 kb, about 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80kb, about 80kb ~ about 100kb, about 100kb ~ about 150kb, or about 150kb ~ about 200kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5 Mb, about 1.5Mb to about 2Mb, about 2Mb to about 2.5Mb, or about 2.5Mb to about 3Mb.

0162In one embodiment, the targeting vector comprises a site-specific recombinase gene. In one embodiment, the site-specific recombinase gene encodes a Cre recombinase. In one embodiment, the Cre recombinase gene is Crei and the two exons encoding Cre recombinase are separated by introns to prevent their expression in prokaryotic cells.

0163In one embodiment, the Cre recombinase gene further provides a nuclear localization signal to promote the localization of Cre (or any recombinase or nuclease agent) to the nucleus (eg, this gene is the NL-Cre gene). Including. In certain embodiments, the Cre recombinase gene further comprises a nuclear localization signal and an intron (eg, NL-Crei).

0164In various embodiments, suitable promoters for the expression of nuclease agents, including the Cre or Crei recombinases discussed above, are selected from Prm1, Blimp1, Gata6, Gata4, Igf2, Lhx2, Lhx5, and / or Pax3. Or include them. In certain embodiments, the promoter is a Gata 6 or Gata 4 promoter. The various promoters are from any organism, including, for example, rodents such as mice or rats, non-rat rodents, eukaryotes, non-rat eukaryotes, non-human mammals, mammals, humans, or hamsters. Can be In another particular embodiment, the promoter is a Prm1 promoter. In another particular embodiment, the promoter is a rat Prm1 promoter. In another particular embodiment, the promoter is a mouse Prm1 promoter. In another particular embodiment, the promoter is the Blimp1 promoter or a fragment thereof, such as a 1 kb or 2 kb fragment of the Blimp1 promoter. See, for example, U.S. Pat. No. 8,697,851 and U.S. Application Publication No. 2013-0312129, both of which are incorporated herein by reference in their entirety.

0165iv. Large targeting vector The term "large targeting vector" or "LTVEC" as used herein is a nucleic acid larger than that commonly used by other approaches aimed at performing homologous recombination targeting in cells. Homology containing an inserted nucleic acid containing a nucleic acid sequence that corresponds to and / or is derived from a sequence and that is larger than that commonly used by other approaches aimed at performing homologous recombination targeting in cells. Includes a large targeting vector, including a sex arm. For example, LTVEC allows modification of large loci that cannot be accommodated by conventional plasmid-based targeting vectors due to their size limits. In certain embodiments, the LTVEC homology arm and / or inserted nucleic acid comprises the genomic sequence of eukaryotic or non-rat eukaryotic cells. The size of the LTVEC is too large to screen for targeted events by conventional assays such as Southern blotting and long range (eg 1 kb-5 kb) PCR. Examples of LTVECs include, but are not limited to, bacterial artificial chromosomes (BACs), human artificial chromosomes, or yeast artificial chromosomes (YACs). Non-limiting examples of LTVEC and methods for making them are described, for example, in US Pat. Nos. 6,586,251, 6,596,541, 7,105,348, and WO 2002/036789 (PCT / US01 / 45375). , U.S. Patent Publication No. 2013/0137101, each of which is incorporated herein by reference.

0166LTVEC is about 20kb ~ about 400kb, about 20kb ~ about 30kb, about 30kb ~ 40kb, about 40kb ~ about 50kb, about 50kb ~ about 75kb, about 75kb ~ about 100kb, about 100kb ~ 125kb, about 125kb ~ about 150kb, about 150kb ~ about 175kb, about 175kb ~ about 200kb, about 200kb ~ about 225kb, about 225kb ~ about 250kb, about 250kb ~ about 275kb, about 275kb ~ about 300kb, about 200kb ~ about 300kb, about 300kb ~ about 350kb, about 350kb ~ It can be from any length, including but not limited to about 400 kb, or about 350 kb to about 550 kb. In one embodiment, the LTVEC is about 100 kb.

0167In some embodiments, the LTVEC is at least 10 kb, at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, or at least 200 kb. is there.

0168In some embodiments, the LTVEC comprises a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, or at least 200 kb.

0169In one embodiment, the LTVEC is about 5 kb to about 200 kb, about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 0.5 kb to about 30 kb, about 0.5 kb to about 40 kb, about 30 kb to about 30 kb. 150kb, about 0.5kb ~ about 150kb, about 30kb ~ about 40kb, about 40kb ~ about 50kb, about 60kb ~ about 70kb, about 80kb ~ about 90kb, about 90kb ~ about 100kb, about 100kb ~ about 110kb, about 120kb ~ about 130kb , About 130kb ~ about 140kb, about 140kb ~ about 150kb, about 150kb ~ about 160kb, about 160kb ~ about 170kb, about 170kb ~ about 180kb, about 180kb ~ about 190kb, or about 190kb ~ about 200kb, about 5kb ~ about 10kb, About 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, about 150 kb ~ about 200 kb, about 200 kb ~ about 250 kb, about 250 kb Includes inserted nucleic acids ranging from about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb.

0170In one embodiment, the LTVEC comprises a nucleic acid sequence of at least 100 kb, at least 150 kb, or at least 200 kb.

0171When using LTVEC, the vector design can be adapted to allow substitution of a given sequence, which is about 5 kb to about 200 kb or about 5 kb to about 3 Mb, as described herein. In one embodiment, the substitutions are about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb to about 60 kb, about 60 kb to about 70 kb, About 80kb ~ about 90kb, about 90kb ~ about 100kb, about 100kb ~ about 110kb, about 110kb ~ about 120kb, about 120kb ~ about 130kb, about 130kb ~ about 140kb, about 140kb ~ about 150kb, about 150kb ~ about 160kb, about 160kb ~ 170 kb, about 170 kb ~ about 180 kb, about 180 kb ~ about 190 kb, about 190 kb ~ about 200 kb, about 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80kb, about 80kb ~ about 100kb, about 100kb ~ about 150kb, or about 150kb ~ about 200kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5 Mb, about 1.5Mb to about 2Mb, about 2Mb to about 2.5Mb, or about 2.5Mb to about 3Mb.

0172In one embodiment, the LTVEC homology arm is derived from the BAC library, cosmid library, or P1 phage library. In other embodiments, the homology arm is derived from the target genomic locus of the cell, and in some cases, the target genomic locus designed to be targeted by LTVEC is targeted using conventional methods. It is impossible. In yet another embodiment, the homology arm is derived from synthetic DNA.

0173In one embodiment, the sum of the 5'homologous arm and the 3'homologous arm in LTVEC is at least 10 kb. In other embodiments, the sum of the 5'homology arm and the 3'homology arm in LTVEC is about 10 kb to about 30 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb ~. It is about 100 kb, about 100 kb to about 120 kb, about 120 kb to about 140 kb, about 140 kb to about 160 kb, about 160 kb to about 180 kb, and about 180 kb to about 200 kb. In one embodiment, the sum of the LTVEC 5'and 3'homology arms is from about 30 kb to about 100 kb. In other embodiments, the total magnitude of the LTVEC 5'and 3'homology arms is about 10 kb to about 150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb, about 20 kb to about 150 kb, about 20kb ~ about 100kb, about 20kb ~ about 75kb, about 30kb ~ about 150kb, about 30kb ~ about 100kb, about 30kb ~ about 75kb, about 40kb ~ about 150kb, about 40kb ~ about 100kb, about 40kb ~ about 75kb, about 50kb ~ About 150 kb, about 50 kb ~ about 100 kb, or about 50 kb ~ about 75 kb, about 10 kb ~ about 30 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ It is 120 kb, or about 120 kb to about 150 kb. In one embodiment, the size of the deletion is equal to or similar to the total size of the LTVEC 5'and 3'homology arms.

0174In other embodiments, the 5'homology arm ranges from about 5 kb to about 100 kb. In one embodiment, the 3'homology arm ranges from about 5 kb to about 100 kb. In other embodiments, the sum of the 5'and 3'homology arms is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, about 50 kb. ~ About 60 kb, about 60 kb ~ about 70 kb, about 70 kb ~ about 80 kb, about 80 kb ~ about 90 kb, about 90 kb ~ about 100 kb, about 100 kb ~ about 110 kb, about 110 kb ~ about 120 kb, about 120 kb ~ about 130 kb, about 130 kb ~ about 140kb, about 140kb ~ about 150kb, about 150kb ~ about 160kb, about 160kb ~ about 170kb, about 170kb ~ about 180kb, about 180kb ~ about 190kb, about 190kb ~ about 200kb, or about 30kb ~ about 100kb, about 10kb ~ about 30kb , About 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 120 kb, or about 120 kb to about 150 kb.

0175In one embodiment, the LTVEC comprises an inserted nucleic acid in which the LTVEC homology arm is homologous or orthologous to a rat nucleic acid sequence flanking. In one embodiment, the inserted nucleic acid sequence is from a species other than rat. In one embodiment, the inserted nucleic acid sequence is from eukaryote. In one embodiment, the inserted nucleic acid that is homologous or orthologous to the rat nucleic acid sequence is a mammalian nucleic acid. In one embodiment, the inserted nucleic acid that is homologous or orthologous to the rat nucleic acid sequence is a non-human mammalian nucleic acid. In one embodiment, the mammalian nucleic acid is a mouse nucleic acid. In one embodiment, the mammalian nucleic acid is a human nucleic acid. In one embodiment, the mammalian nucleic acid is a hamster nucleic acid. In one embodiment, the inserted nucleic acid is genomic DNA. In one embodiment, the insertion is 5 kb to 200 kb, as described above.

0176In one embodiment, the LTVEC comprises a selectable cassette or reporter gene. The various forms of selectable cassette and reporter genes that can be used are discussed in detail elsewhere herein. As described elsewhere herein, LTVEC also includes pluripotent or non-pluripotent rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, and rodents. In dentate, non-rat rodent, mouse, or hamster cells, targeting vectors and rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rats It can also be used in the methods provided herein in combination with nucleases that promote homologous recombination between rodent, mouse, or hamster nucleic acid target loci.

0177In one embodiment, the large targeting vector (LTVEC) comprises a site-specific recombinase gene. In one embodiment, the site-specific recombinase gene encodes a Cre recombinase. In one embodiment, the Cre recombinase gene is Crei and the two exons encoding Cre recombinase are separated by introns to prevent their expression in prokaryotic cells. In one embodiment, the Cre recombinase gene further provides a nuclear localization signal to promote the localization of Cre (or any recombinase or nuclease agent) to the nucleus (eg, this gene is the NL-Cre gene). Including. In certain embodiments, the Cre recombinase gene further comprises a nuclear localization signal and an intron (eg, NL-Crei).

0178In various embodiments, suitable promoters for the expression of nuclease agents, including the Cre or Crei recombinases discussed above, are selected from Prm1, Blimp1, Gata6, Gata4, Igf2, Lhx2, Lhx5, and / or Pax3. Or include them. In certain embodiments, the promoter is a Gata 6 or Gata 4 promoter. The various promoters are from any organism, including, for example, rodents such as mice or rats, non-rat rodents, eukaryotes, non-rat eukaryotes, non-human mammals, mammals, humans, or hamsters. Can be In another particular embodiment, the promoter is a Prm1 promoter. In another particular embodiment, the promoter is a rat Prm1 promoter. In another particular embodiment, the promoter is a mouse Prm1 promoter. In another particular embodiment, the promoter is the Blimp1 promoter or a fragment thereof, such as a 1 kb or 2 kb fragment of the Blimp1 promoter. See, for example, U.S. Pat. No. 8,697,851 and U.S. Application Publication No. 2013-0312129, both of which are incorporated herein by reference in their entirety.

0179In one embodiment, the LTVEC is a rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, as discussed in detail elsewhere herein. Deletions, additions, substitutions, or combinations of regions at the ApoE, Il2rg, Rag2, Rag1, and / or Rag2 / Rag1 loci in non-rat mammals, mice, or hamsters. Contains insertable nucleic acids that can result. In certain embodiments, genetic modification of the ApoE locus results in a decrease, increase, or regulation of ApoE activity, IL-2Rg activity, Rag2 activity, Rag1 activity, and / or Rag2 and Rag1 activity. In one embodiment, ApoE knockouts, Il2rg knockouts, Rag2 knockouts, Rag1 knockouts, Rag2 / Rag1 knockouts are made. As discussed below, nuclease agents can be used with any of the LTVEC targeting systems that target any genomic locus of interest.

0180In another embodiment, the genome is exposed to Cas protein and CRISPR RNA in the presence of a large targeting vector (LTVEC) containing a nucleic acid sequence of at least 10 kb. In such cases, after exposure to Cas protein, CRISPR RNA, and LTVEC, the genome is modified to contain at least 10 kb of nucleic acid sequence. In certain embodiments, the LTVEC comprises a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, or at least 200 kb.

0181v. Recognizing sites of nucleases and nucleases As outlined in detail above, nuclease agents can be used in prokaryotic cells or in pluripotent or non-pluripotent rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents. It can be utilized in the methods and compositions disclosed herein to aid in the modification of target loci, both intracellularly in dentate, non-rat mammals, mice, or hamsters. Such nucleases can promote homologous recombination between the targeting vector and the target locus. In one embodiment, the nuclease agent comprises an endonuclease agent.

0182As used herein, the term "recognition site for a nuclease agent" includes DNA sequences in which nicks or double-strand breaks are induced by the nuclease agent. The recognition site of the nuclease agent can be endogenous (or naturally occurring) to the cell, or the recognition site can be exogenous to the cell. In certain embodiments, the recognition site is exogenous to the cell and therefore does not naturally occur in the cell's genome. In yet a further embodiment, the recognition site is extrinsic to the cell and the polynucleotide of interest that should be located at the target genomic locus. In a further embodiment, the exogenous or endogenous recognition site is present only once in the genome of the host cell. In certain embodiments, endogenous or natural sites that occur only once in the genome are identified. Such sites can then be used to design nucleases that result in nicks or double-strand breaks at the endogenous recognition site.

0183The length of the recognition site can vary, eg, at least 4, 6, 8, 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, It can include recognition sites with nucleotide lengths of 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or greater. In one embodiment, each monomer of the nuclease agent recognizes a recognition site of at least 9 nucleotides. In other embodiments, the recognition sites are about 9 to about 12 nucleotides in length, about 12 to about 15 nucleotides in length, about 15 to about 18 nucleotides in length, or about 18 to about 21 nucleotides in length, and such partial. Any combination of ranges (eg, 9-18 nucleotides). The recognition site can be a palindrome, i.e., a sequence on one strand reads the same sequence in the opposite direction on the complementary strand. It is recognized that a given nuclease agent can bind to and cleave the binding site, or the nuclease agent can bind to a sequence different from the recognition site. In addition, the term recognition site includes both nuclease drug binding sites and nick / cleavage sites, regardless of whether the nick / cleavage site is within or outside the nuclease drug binding site. In another variant, cleavage with a nuclease agent can occur at nucleotide sequence sites immediately opposite each other, resulting in blunt-ended cleavage, or in other cases, cleavage is a 5'overhang or a 3'overhang. Can be arranged alternately to produce a single-stranded overhang, also referred to as the "adhesive end", which can be any of the above.

0184Any nuclease agent that induces nicks or double-strand breaks to the desired recognition site can be used in the methods and compositions disclosed herein. Naturally occurring or native nuclease agents can be used as long as the nuclease agent induces nicks or double-strand breaks at the desired recognition site. Alternatively, a modified or genetically engineered nuclease agent can be used. A "genetically engineered nuclease agent" is genetically engineered (modified or derived) from its natural form to specifically recognize and induce nicks or double-strand breaks at the desired recognition site. ) Includes nuclease. Thus, genetically engineered nucleases can be derived from naturally occurring, naturally occurring nucleases, or can be artificially produced or synthesized. Modifications of the nuclease agent can be only one amino acid in the protein cleaving agent or one nucleotide in the nucleic acid cleaving agent. In some embodiments, the genetically engineered nuclease induces a nick or double-strand break at the recognition site, which recognition site is not a sequence unrecognized by a native (non-genetically modified or unmodified) nuclease agent. It was. The occurrence of a nick or double-strand break at a recognition site or other DNA may be referred to herein as "cutting" or "cleaving" the recognition site or other DNA.

0185Active variants and fragments of the exemplified recognition sites are also provided. Such active variants are at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, for a given recognition site. It may contain 96%, 97%, 98%, 99%, or more sequence identity, and this active variant retains biological activity and is therefore recognized by the nuclease agent in a sequence-specific manner. Can be cut. Assays for measuring double-stranded cleavage of a recognition site by a nuclease agent are well known in the art and generally measure the ability of a nuclease to cleave a recognition site.

0186The recognition site of the nuclease agent can be located at or near the target locus. The recognition site can be located within the coding region or regulatory region of the gene, which affects the expression of the gene. Thus, recognition sites for nucleases can be located in introns, exons, promoters, enhancers, regulatory regions, or any non-protein coding region.

0187In one embodiment, the nuclease agent is a transcriptional activation-like effector nuclease (TALEN). TAL effector nucleases are a set of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the prokaryotic or eukaryotic genome. TAL effector nucleases are made, for example, by fusing the catalytic domain of an endonuclease, such as FokI, with a natural or genetically engineered transcriptional activation-like (TAL) effector, or a functional portion thereof. The unique modular TAL effector's DNA-binding domain allows the design of proteins with potentially arbitrary given DNA recognition specificity. Thus, the DNA-binding domain of TAL effector nucleases can be genetically engineered to recognize specific DNA target sites and therefore be used to make double-strand breaks at the desired target sequence. WO 2010/079430, Morbitzer et al. (2010) PNAS 10.1073 / pnas.1013133107, Scholze & Boch (2010) Virulence 1: 428-432, Christian et al. Genetics (2010) 186: 757-761, Li et al. (2010) Nuc. Acids Res. (2010) doi: 10.1093 / nar / gkq704, and Miller et al. ( 2011) Please refer to Nature Biotechnology 29: 143-148, all of which are incorporated herein by reference.

0188Examples of suitable TAL nucleases and methods for preparing suitable TAL nucleases are, for example, US Patent Publication Nos. 2011/0239315 A1, 2011/0269234 A1, 2011/0145940 A1, No. 2003/0232410 A1, 2005/0208489 A1, 2005/0026157 A1, 2005/0064474 A1, 2006/0188987 A1, and 2006/0063231 A1 (see each) (Incorporated herein by). In various embodiments, for example, a TAL effector nuclease that is cleaved at or near the target nucleic acid sequence of the genomic locus of interest is genetically engineered and the target nucleic acid sequence is the sequence or sequence thereof modified by the targeting vector. It is in the vicinity. Suitable TAL nucleases for use in the various methods and compositions provided herein are specifically in the target nucleic acid sequence modified by the targeting vector, as described herein. Includes those designed to join in the vicinity.

0189In one embodiment, each monomer of TALEN comprises 12-25 TAL repeats, and each TAL repeat binds to a 1 bp lower site. In one embodiment, the nuclease agent is a chimeric protein comprising a TAL repeat-based DNA binding domain operably linked to an independent nuclease. In one embodiment, the independent nuclease is the FokI endonuclease. In one embodiment, the nuclease agent comprises a first TAL repeat-based DNA binding domain and a second TAL repeat-based DNA binding domain, each of the first and second TAL repeat-based DNA binding domains. Operatively linked to the FokI nuclease, the first and second TAL repeat-based DNA binding domains are two contiguous target DNAs in each strand of the target DNA sequence separated by cleavage sites of about 6 bp to about 40 bp. Recognizing the sequence, the FokI nuclease dimerizes and creates a double-strand break at the target sequence.

0190In one embodiment, the nuclease agent comprises a first TAL repeat-based DNA binding domain and a second TAL repeat-based DNA binding domain, each of the first and second TAL repeat-based DNA binding domains. Operatively linked to the FokI nuclease, the first and second TAL repeat-based DNA binding domains are two contiguous target DNAs in each strand of the target DNA sequence separated by cleavage sites of about 5 bp to about 6 bp. Recognizing the sequence, the FokI nuclease dimerizes to create a double-strand break.

0191The nuclease agents used in the various methods and compositions disclosed herein can further include zinc finger nucleases (ZFNs). In one embodiment, each monomer of ZFN comprises three or more zinc finger-based DNA-binding domains, and each zinc finger-based DNA-binding domain binds to a lower site of 3 bp. In another embodiment, ZFN is a chimeric protein comprising a zinc finger-based DNA binding domain operably linked to an independent nuclease. In one embodiment, the independent nuclease is the FokI endonuclease. In one embodiment, the nuclease agent comprises a first ZFN and a second ZFN, each of the first ZFN and the second ZFN being operably linked to a FokI nuclease, the first and second ZFNs. Recognizes two consecutive target DNA sequences in each strand of the target DNA sequence separated by a cleavage site of about 6 bp to about 40 bp or a cleavage site of about 5 bp to about 6 bp, and the FokI nuclease is quantified. Make a double-strand break. For example, US Pat. Nos. US20060246567, US20080182332, US20020081614, US20030021776, International Publication WO / 2002/057308A2, US Patent US20130123484, US20100291048, and International Publication WO / Please refer to 2011/017293A2, each of which is incorporated herein by reference.

0192In one embodiment of the methods provided herein, the nuclease agent is fused to (a) a chimeric protein containing a zinc finger-based DNA binding domain that is fused to a FokI endonuclease, or (b) a FokI endonuclease. Contains chimeric proteins containing transcriptional activation-like effector nucleases (TALENs).

0193In yet another embodiment, the nuclease agent is a meganuclease. Meganucleases are classified into four families based on conserved sequence motifs, and these families are the LAGLIDADG (SEQ ID NO: 16), GIY-YIG, HNH, and His-Cys box families. These motifs are involved in the regulation of metal ions and hydrolysis of phosphodiester bonds. HEases are noteworthy because they tolerate some sequence polymorphisms in their long recognition sites and in their DNA substrates. The domains, structures, and functions of meganucleases are known, such as Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38: 199-248, Lucas et al., (2001) Nucleic Acids Res 29: 960-9, Jurica and Stoddard, (1999) Cell Mol Life Sci 55: 1304-26, Stoddard, (2006) Q Rev Biophys 38: 49-95, and Moure et al., (2002) Nat Struct Biol 9: 764. In some examples, naturally occurring variants and / or meganucleases of genetically engineered derivatives are used. Methods for modifying kinetics, cofactor interactions, expression, optimal conditions, and / or recognition site specificity, and screening for activity are known, eg, Epinat et al., (2003) Nucleic Acids Res. 31: 2952-62, Chevalier et al., (2002) Mol Cell 10: 895-905, Gimble et al., (2003) Mol Biol 334: 993-1008, Seligman et al., (2002) Nucleic Acids Res 30 : 3870-9, Sussman et al., (2004) J Mol Biol 342: 31-41, Rosen et al., (2006) Nucleic Acids Res 34: 4791-800, Chames et al., (2005) Nucleic Acids Res 33: e178, Smith et al., (2006) Nucleic Acids Res 34: e149, Gruen et al., (2002) Nucleic Acids Res 30: e29, Chen and Zhao, (2005) ) See Nucleic Acids Res 33: e154, WO2005105989, WO2003078619, WO2006097854, WO2006097853, WO2006097784, and WO2004031346.

0194I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I- CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I- HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I- SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIPPI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI- Any meganuclease, including, but not limited to, TliII, or any active variant or fragment thereof, can be used herein.

0195In one embodiment, the meganuclease recognizes a 12-40 base pair double-stranded DNA sequence. In one embodiment, the meganuclease recognizes one perfectly matched target sequence in the genome. In one embodiment, the meganuclease is a homing nuclease. In one embodiment, the homing nuclease is a homing nuclease of the LAGLIDADG (SEQ ID NO: 16) family. In one embodiment, the LAGLIDADG (SEQ ID NO: 16) family of homing nucleases is selected from I-SceI, I-CreI, and I-Dmol.

0196The nuclease agent may further include restriction endonucleases, including type I, type II, type III, and type IV endonucleases. Type I and type III restriction endonucleases recognize specific recognition sites, but generally cleave at variable positions from nuclease binding sites, which can be hundreds of base pairs away from the cleavage site (recognition site). In type II systems, limiting activity is independent of any methylase activity, and cleavage generally occurs at specific sites within or near the binding site. Most type II enzymes cleave the parindrome sequence, whereas type IIa enzymes recognize non-parindrome recognition sites and cleave outside the recognition site, and type IIb enzymes both outside the recognition site. The sequence is cleaved twice at the site, and the type IIs enzyme recognizes the asymmetric recognition site and cleaves on one side at a limited distance of about 1-20 nucleotides from the recognition site. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and are classified, for example, in the REBASE database (rebase.neb.com web page, Roberts et al., (2003) Nucleic Acids Res). 31: 418-20), Roberts et al., (2003) Nucleic Acids Res 31: 1805-12, and Belfort et al., (2002) in Mobile DNA II, pp.761-783, Eds. Craigie et al. , (ASM Press, Washington, DC).

0197The nuclease agent used in various methods and compositions can also include the CRISPR / Cas system. Such systems can, for example, use Cas9 nucleases that are codon-optimized for the desired cell type to be expressed. Such a system can also use guide RNAs (gRNAs) that contain two separate molecules. Two exemplary molecular gRNAs are a crRNA-like (CRISPR RNA or targeter-RNA or crRNA or crRNA repeat) molecule and a corresponding tracrRNA-like (trans-acting CRISPR) molecule. Includes "RNA" or "activator RNA" or "tracrRNA" or "skeleton") molecules. The crRNA contains both the DNA-targeted segment of the gRNA (single strand) and the contiguous nucleotides that form one of the double strands of the double-stranded RNA (dsRNA) of the gRNA's protein-binding segment. The corresponding tracrRNA (activator RNA) contains a series of nucleotides that form the other double strand of dsRNA in the protein binding segment of the gRNA. Thus, a series of nucleotides in a crRNA is complementary to a series of nucleotides in a tracrRNA and hybridizes with it to form a double strand of dsRNA in the protein binding domain of the gRNA. Therefore, each crRNA can be said to have a corresponding tracrRNA. crRNA also provides a single-stranded DNA targeting segment. Thus, gRNAs include sequences that hybridize to target sequences and tracrRNAs. Therefore, crRNAs and tracrRNAs (as corresponding pairs) hybridize to form gRNAs. When used for intracellular modification, the exact sequence and / or length of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule is used.

0198Naturally occurring genes encoding the three elements (Cas9, tracrRNA, and crRNA) are generally organized into operons (s). Naturally occurring CRISPR RNA, depending on the Cas9 system and organism, may contain two overlapping sequences (DRs) of 21-46 nucleotides in length adjacent targeting segments of 21-72 nucleotides in length (eg, international). See Publication No. WO 2014/131833). For S. pyogenes, the DR is 36 nucleotides in length and the targeting segment is 30 nucleotides in length. The DR located at 3'is complementary to and hybridizes to the corresponding tracrRNA, which also binds to the Cas9 protein.

0199Alternatively, the system further utilizes a fused crRNA-tracrRNA construct (ie, a single transcript) that functions with codon-optimized Cas9. This single RNA is often referred to as a guide RNA or gRNA. Within the gRNA, the crRNA moiety is identified as the "target sequence" at a given recognition site, and the tracrRNA is often referred to as the "skeleton." Briefly, a short DNA fragment containing the target sequence is inserted into the guide RNA expression plasmid. The gRNA expression plasmid is suitable, which is active in the target sequence (about 20 nucleotides in some embodiments), the morphology of the tracrRNA sequence (skeleton), as well as in cells and is a necessary element for proper processing in eukaryotic cells. Includes promoter. Many of the systems rely on custom complementary oligos that are annealed to form double-stranded DNA and then cloned into a gRNA expression plasmid. Then, the gRNA expression cassette and the Cas9 expression cassette are introduced into the cells. For example, Mali P et al. (2013) Science 2013 Feb 15; 339 (6121): 823-6, Jinek M et al.Science 2012 Aug 17; 337 (6096): 816-21, Hwang WY et al.Nat Biotechnol 2013 Mar; 31 (3): 227-9, Jiang See W et al. Nat Biotechnol 2013 Mar; 31 (3): 233-9, and Cong L et al. Science 2013 Feb 15; 339 (6121): 819-23, each of which is a book by reference. Incorporated into the specification. Also, for example, International Publication No. WO / 2013/176772A1, No. WO / 2014/065596A1, No. WO / 2014/089290A1, No. WO / 2014/093622A2, No. WO / 2014/099750A2, And WO / 2013142578A1 as well, each of which is incorporated herein by reference.

0200In some embodiments, the Cas9 nuclease can be provided in the form of a protein. In some embodiments, the Cas9 protein can be provided in the form of a complex with a gRNA. In other embodiments, the Cas9 nuclease may be provided in the form of a nucleic acid encoding a protein. The nucleic acid encoding the Cas9 nuclease can be RNA (eg, messenger RNA (mRNA)) or DNA.

0201In some embodiments, the gRNA can be provided in the form of RNA. In other embodiments, the gRNA can be provided in the form of DNA encoding the RNA. In some embodiments, the gRNA may be provided in the form of separate crRNA and tracrRNA molecules, respectively, or separate DNA molecules encoding crRNA and tracrRNA.

0202In one embodiment, a method for modifying a genomic locus of interest in a cell is to: (a) Clustered Regularly Interspaced Short Palindromic. A first expression construct containing a first promoter operably linked to a first nucleic acid sequence encoding a Repeats (CRISPR) -related (Cas) protein, (b) a genomic target linked to a guide RNA (gRNA). Containing the introduction of a second expression construct containing a second promoter operably linked to the sequence, the genomic target sequence is flanked by a protospacer flanking motif. Optionally, the genomic target sequence is flanked by a protospacer flanking motif (PAM) sequence on the 3'end. In one embodiment, the cells are eukaryotic cells, non-rat eukaryotic cells, mammalian cells, human cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, Human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, mouse cells, hamsters Includes cells, fibroblasts, or CHO cells.

0203In one embodiment, the genomic target sequence is GNNNNNNNNNNNNNNNNNNNNGG (GN).1-20GG; contains the nucleotide sequence of SEQ ID NO: 1). In one embodiment, the genomic target sequence comprises SEQ ID NO: 23 and N is 1-20 nucleotides in length. In another embodiment, the genomic target sequence comprises 14-20 nucleotides in length of SEQ ID NO: 1.

0204In one embodiment, the gRNA comprises a third nucleic acid sequence encoding a clustered regular interspersed short palindrome repeat (CRISPR) RNA (crRNA) and a transactivated CRISPR RNA (tracrRNA). In certain embodiments, the Cas protein is Cas9.

0205In some embodiments, the gRNA is a chimeric RNA of (a) nucleic acid sequence 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 2), or (b) nucleic acid sequence 5'-GUUUUAGAGCUAGAAAUAGCAA Contains chimeric RNA.

0206In another embodiment, the crRNA comprises 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3'(SEQ ID NO: 4), 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG (SEQ ID NO: 5), or 5'-GAGUCCGAGCAGAAGAAGAAGUUUUA-3' (SEQ ID NO: 6).

0207In yet another embodiment, the tracrRNA comprises 5'-AAGGCUAGUCCG-3'(SEQ ID NO: 7) or 5'-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 8).

0208In one embodiment, the Cas protein is a type I Cas protein. In one embodiment, the Cas protein is a type II Cas protein. In one embodiment, the type II Cas protein is Cas9. In one embodiment, the first nucleic acid sequence encodes a human codon-optimized Cas protein.

0209In certain embodiments, the Cas protein is a "nickase" that can produce a single-strand break (ie, "nick") at the target site without breaking both strands of double-stranded DNA (dsDNA). is there. For example, Cas9 contains two nuclease domains involved in the cleavage of the contralateral DNA strand (RuvC-like nuclease domain and HNH-like nuclease domain). Mutations in any of these domains can produce nickase. Examples of mutations that make nickase can be found, for example, in WO / 2013/176772A1 and WO / 2013/142578A1, each of which is incorporated herein by reference.

0210In certain embodiments, two separate Cas proteins (eg, nickase) specific for the target site on each strand of dsDNA complement the overhang sequence in different nucleic acids, or in different regions of the same nucleic acid. Overhang sequence can be formed. The overhang end formed by contacting the nucleic acid with two nickases specific for the target site on both strands of dsDNA can be a 5'or 3'overhang end. For example, the first nickase can form a single strand break on the first strand of dsDNA, while the second nickase can form a single strand break on the second strand of dsDNA to form an overhang sequence. It can form a single-strand break. The target site of each nickase forming a single-strand break can be selected such that the overhang end sequences formed are complementary to the overhang end sequences on different nucleic acid molecules. Complementary overhang ends of two different nucleic acid molecules can be annealed by the methods disclosed herein. In some embodiments, the target site for nickase on the first strand is different from the target site for nickase on the second strand.

0211In one embodiment, the first nucleic acid comprises a mutant that disrupts at least one amino acid residue of the nuclease active site in the Cas protein, and the mutant Cas protein cleaves only one strand of the target DNA region. The resulting mutant reduces non-homologous recombination in the target DNA region.

0212In one embodiment, the first nucleic acid encoding the Cas protein further comprises a nuclear localization signal (NLS). In one embodiment, the nuclear localization signal is the SV40 nuclear localization signal.

0213In one embodiment, the second promoter that drives the expression of genomic target sequences and guide RNAs (gRNAs) is the RNA polymerase III promoter. In one embodiment, the RNA polymerase III promoter is a human U6 promoter. In one embodiment, the RNA polymerase III promoter is a rat U6 polymerase III promoter. In one embodiment, the RNA polymerase III promoter is a mouse U6 polymerase III promoter.

0214In one embodiment, the nucleic acid sequences encoding crRNA and tracrRNA are linked via a synthetic loop, and upon expression, the crRNA and tracrRNA form a double strand of crRNA: tracrRNA.

0215The CRISPR / Cas system described above includes eukaryotic cells, non-rat eukaryotic cells, mammalian cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, human pluripotency. Sex cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, mouse cells, hamster cells, fibers It can be used in combination with large targeting vectors, along with either blast cells or CHO cell cell types.

0216In one embodiment, the first expression construct and the second expression construct are expressed from the same plasmid.

0217In one embodiment, the first and second expression constructs are introduced with LTVEC. In one embodiment, the first and second expression constructs are introduced separately from the LTVEC over a period of time.

0218In one embodiment, the method comprises introducing multiple second constructs and multiple LTVECs for multiple editing of the different target loci described herein.

0219Active variants and fragments of nuclease agents (ie, genetically engineered nuclease agents) are also provided. Such active variants are at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% of natural nucleases. , 97%, 98%, 99%, or more sequence identity, the active variant retains the ability to cleave at the desired recognition site and therefore induces nick or double-strand breaks. Retain activity. For example, any of the nuclease agents described herein are modified from the native endonuclease sequence to recognize and induce nicks or double-strand breaks at recognition sites not recognized by the native nuclease agent. Can be designed. Therefore, in some embodiments, the genetically engineered nuclease has the specificity of inducing a nick or double-strand break at a recognition site that is different from the recognition site of the corresponding natural nuclease agent. Assays for activity that induces nick or double-strand breaks are known and generally measure the overall activity and specificity of endonucleases on DNA substrates, including recognition sites.

0220The nuclease agent may be introduced into cells by any means well known in the art. The polypeptide encoding the nuclease agent may be introduced directly into the cell. Alternatively, a polypeptide encoding a nuclease agent can be introduced into the cell. When a polypeptide encoding a nuclease agent is introduced into a cell, the nuclease agent can be expressed transiently, conditionally, or structurally within the cell. Therefore, the polypeptide encoding the nuclease agent can be contained in an expression cassette and operably linked to a conditional promoter, induction promoter, structural promoter, or tissue-specific promoter. Such promoters of interest are discussed in more detail elsewhere herein. Alternatively, the nuclease agent is introduced into the cell as an mRNA encoding or containing the nuclease agent.

0221In one embodiment, crRNA and tracrRNA are expressed as separate RNA transcripts.

0222In certain embodiments, the polynucleotide encoding the nuclease agent is stably integrated into the cell's genome and operably linked to a promoter that is active in the cell. In other embodiments, the polynucleotide encoding the nuclease agent is present in the same targeting vector containing the insertion nucleic acid, while in other examples the polynucleotide encoding the nuclease agent is the target containing the insertion nucleic acid. It is present in a vector or plasmid that is separate from the conversion vector.

0223When a nuclease agent is provided to a cell through the introduction of a polynucleotide encoding a nuclease agent, such polynucleotides encoding the nuclease agent are of interest compared to the naturally occurring polynucleotide sequence encoding the nuclease agent. Can be modified to replace codons that have a higher frequency of use in the cells. For example, polynucleotides encoding nucleases are bacterial cells, yeast cells, human cells, non-human cells, non-rat eukaryotic cells, mammalian cells, rodents compared to naturally occurring polynucleotide sequences. Codons with higher frequency of use in a given prokaryotic or eukaryotic cell of interest, including cells, non-rat rodent cells, mouse cells, rat cells, hamster cells, or any other host cell of interest. Can be modified to replace.

0224In one embodiment, the endonuclease agent is introduced with LTVEC. In one embodiment, the endonuclease agent is introduced separately from LTVEC over a period of time. In one embodiment, the endonuclease agent is introduced prior to the introduction of LTVEC. In one embodiment, the endonuclease agent is a rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, mouse, or Introduced into hamster ES cells.

0225In one embodiment, the endonuclease agent is an expression construct comprising a nucleic acid sequence encoding an endonuclease, which nucleic acid sequence is operably linked to a promoter. In one embodiment, the promoter is a constitutively active promoter. In one embodiment, the promoter is an inductive promoter. In one embodiment, the promoter is a pluripotent or non-pluripotent rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, mouse. , Or active in hamster cells. In one embodiment, the endonuclease agent is an mRNA encoding an endonuclease.

0226B. Methods for incorporating the polynucleotide of interest into the target locus Methods for modifying the target locus of interest are provided. In one embodiment, pluripotent or non-pluripotent rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamster cells. In, the target locus is the target of genetic modification. Such methods include (a) pluripotent or non-pluripotent rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice. , Or to hamster cells, 5'rat, eukaryotic, non-rat eukaryotic, mammal, non-human mammal, human, rodent, non-rat rodent, mouse, or hamster homology arm and 3 'Targeting containing inserted nucleic acids with flanking homologous arms of rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters Introducing vectors and (b) genetically modified pluripotent or non-pluripotent rats, eukaryotes, non-rat eukaryotes, mammals, non-humans, including target gene modifications at target loci Target gene modifications can be transmitted through the germline, including identifying mammalian, human, rodent, non-rat rodent, mouse, or hamster cells. In certain embodiments, the sum of the 5'homology arm and the 3'homology arm is at least 10 kb and / or a large targeting vector is used.

0227In other embodiments, the total magnitude of the LTVEC 5'and 3'homology arms is about 10 kb to about 150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb, about 20 kb to about 150 kb, about 20kb ~ about 100kb, about 20kb ~ about 75kb, about 30kb ~ about 150kb, about 30kb ~ about 100kb, about 30kb ~ about 75kb, about 40kb ~ about 150kb, about 40kb ~ about 100kb, about 40kb ~ about 75kb, about 50kb ~ About 150 kb, about 50 kb ~ about 100 kb, or about 50 kb ~ about 75 kb, about 10 kb ~ about 30 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about It is 120 kb, or about 120 kb to about 150 kb. In one embodiment, the size of the deletion is equal to or similar to the total size of the LTVEC 5'and 3'homology arms.

0228A pluripotent cell, eg, a rat cell, can be an embryonic stem cell, eg, a rat embryonic stem cell. In certain embodiments, (a) rat ES cells are derived from DA or ACI strains, or (b) rat ES cells contain Oct-4, Sox-2, alkaline phosphatase, or a combination thereof. It is characterized by the expression of pluripotency markers. In another example, the rat embryonic stem cells used are the rat ES cells described in U.S. Patent Application No. 14 / 185,103, filed February 20, 2014, which is incorporated herein by reference in its entirety. including.

0229Any pluripotent or non-pluripotent cell can be used in the methods provided herein. For example, pluripotent or non-pluripotent cells can be derived from eukaryotes, non-rat eukaryotes, non-human mammals, mammals, rodents, non-rat rodents, rats, mice, humans, or hamsters. Can be a cell of.

0230As described elsewhere herein, the inserted nucleic acid can be any nucleic acid sequence. In a non-limiting embodiment, (a) the inserted nucleic acid is an endogenous rat, eukaryotic, non-rat eukaryotic, mammalian, human, rodent, non-rat rode according to the nucleic acid sequence of a homologous or orthologous mammal. Containing the substitution of the nucleic acid sequence of a tooth, mouse, or hamster, (b) the inserted nucleic acid is an endogenous rat, eukaryotic, non-rat eukaryotic, mammalian, human, rodent, non-rat rodent. , Mouse, or hamster containing a deletion of the nucleic acid sequence, (c) the inserted nucleic acid is endogenous rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-human. It contains a deletion of the nucleic acid sequence of a rat rodent, mouse, or hamster, and this deletion ranges from 5 kb to 200 kb or 5 kb to 3 Mb (as discussed in detail elsewhere herein). ), (D) The inserted nucleic acid is an exogenous nucleic acid sequence (for example, about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 80 kb. Includes exogenous nucleic acid sequences ranging from 100 kb, about 100 kb to about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb) The inserted nucleic acid comprises an exogenous nucleic acid sequence containing a homologous or orthologous nucleic acid sequence, and is a homologous or orthologous nucleic acid sequence of (f) (a), wherein the nucleic acid sequence is a human nucleic acid sequence. , (G) The inserted nucleic acid is a chimeric nucleic acid sequence containing the homologous or orthologous nucleic acid sequence of (a) and the nucleic acid sequence contains human and rat nucleic acid sequences, and (h) the inserted nucleic acid is the exogenous nucleic acid of (e). Containing the sequence, the inserted nucleic acid ranges from about 5 kb to about 200 kb, (i) the inserted nucleic acid contains a conditional allelic gene adjacent to the site-specific recombinase target sequence, and (j) the inserted nucleic acid is a promoter. Containing an operably linked reporter gene, the (k) inserted nucleic acid is a rodent heavy chain constant region.HGene segment, one or more unrearranged human immunoglobulin heavy chains D Gene segment, one or more unrearranged human immunoglobulin heavy chains JHContaining a gene segment, (l) the inserted nucleic acid comprises a rearranged nucleic acid sequence operably linked to the nucleic acid sequence of the rodent heavy chain constant region, and (m) the inserted nucleic acid is one or more. Human immunoglobulin V not rearrangedκOr VλGene segment and one or more non-rearranged human immunoglobulin JκOr JλIt contains gene segments, which are operably linked to the nucleic acid sequence of the mammalian immunoglobulin λ or κ light chain constant region, and (n) the inserted nucleic acid is the mammalian immunoglobulin λ or κ light chain constant. Containing a rearranged human immunoglobulin λ or κ light chain variable region nucleic acid sequence operably linked to the nucleic acid sequence of the region, the heavy chain constant region of mammals (o) (k) and / or (l). Nucleic acid sequences include rat constant region nucleic acid sequences, human constant region nucleic acid sequences, or combinations thereof, or mammalian immunoglobulins λ or κ of (p) (m) and / or (n). Nucleic acid in the chain constant region includes a nucleic acid sequence in the rat constant region, a nucleic acid sequence in the human constant region, or a combination thereof.

0231In one embodiment, the inserted nucleic acid is VH1-2, VH1-3, VH1-8, VH1-18, VH1-24, VH1-45, VH1-46, VH1-58, VH1-69, VH2-5, VH2-26, VH2-70, VH3-7, VH3-9, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-30-3, VH3-30-5, VH3-33, VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-72, VH3-73, VH3-74, VH4-4, VH4-28, VH4-30-1, VH4-30-2, VH4-30-4, VH4-31, VH4-34, VH4-39, VH4-59, VH4-61, VH5-51, VH6-1 and VH7-4-1, VHOne or more functional human Vs containing 7-81, or a combination thereofHContains gene segments.

0232In one embodiment, the inserted nucleic acids are D1-1, D1-7, D1-14, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3. -9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6 , D6-13, D6-19, D6-25, D7-27, or a combination thereof, containing one or more functional human D gene segments.

0233In one embodiment, the inserted nucleic acid is JH1, JH2, JH3, JH4, JH5, JH6, or one or more functional Js containing a combination thereofHContains gene segments. In one embodiment, the inserted nucleic acids are Vκ4-1, Vκ5-2, Vκ7-3, Vκ2-4, Vκ1-5, Vκ1-6, Vκ3-7, Vκ1-8, Vκ1-9, Vκ2-10, Vκ3. -11, Vκ1-12, Vκ1-13, Vκ2-14, Vκ3-15, Vκ1-16, Vκ1-17, Vκ2-18, Vκ2-19, Vκ3-20, Vκ6-21, Vκ1-22, Vκ1-23 , Vκ2-24, Vκ3-25, Vκ2-26, Vκ1-27, Vκ2-28, Vκ2-29, Vκ2-30, Vκ3-31, Vκ1-32, Vκ1-33, Vκ3-34, Vκ1-35, Vκ2 Includes one or more human Vκ gene segments containing -36, Vκ1-37, Vκ2-38, Vκ1-39, Vκ2-40, or a combination thereof.

0234In one embodiment, the inserted nucleic acids are Vλ3-1, Vλ4-3, Vλ2-8, Vλ3-9, Vλ3-10, Vλ2-11, Vλ3-12, Vλ2-14, Vλ3-16, Vλ2-18, Vλ3. Includes one or more human Vλ gene segments containing -19, Vλ3-21, Vλ3-22, Vλ2-23, Vλ3-25, Vλ3-27 or a combination thereof.

0235In one embodiment, the inserted nucleic acid comprises one or more human Jκ gene segments comprising Jκ1, Jκ2, Jκ3, Jκ4, Jκ5, or a combination thereof.

0236In certain embodiments, pluripotent or non-pluripotent rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters. Upon modification of the target locus in the cell, the genetic modification can be transmitted through the germline.

0237In one embodiment, when the inserted nucleic acid sequence is integrated into the genome, rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, mouse, Alternatively, it contains a polynucleotide that causes a genetic modification in the region of the ApoE locus of a hamster, and the genetic modification at the ApoE locus results in a decrease in ApoE activity, an increase in ApoE activity, or a regulation of ApoE activity. In one embodiment, an ApoE knockout is made.

0238In one embodiment, when the inserted nucleic acid sequence is integrated into the genome, rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, Or it contains a polynucleotide that causes a genetic modification of the region of the interleukin-2 receptor gamma locus in a hamster, and the genetic modification at the interleukin-2 receptor gamma locus reduces interleukin-2 receptor activity, inter It results in increased leukin-2 receptor gamma activity or regulation of interleukin-2 receptor activity. In one embodiment, an interleukin-2 receptor knockout is made.

0239In yet another embodiment, when the inserted nucleic acid sequence is integrated into the genome, rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, Rag1 locus of mouse or hamster, rat, eukaryote, non-rat eukaryote, non-human mammal, mammal, human, rodent, non-rat rodent, mouse, or hamster Rag2 locus, And / or genetic modification of the Rag2 / Rag1 locus region of rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters Contains polynucleotides that give rise to rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice, or hamsters Rag1, Rag2, and / Alternatively, genetic modification at the Rag2 / Rag1 locus may result in decreased Rag1, Rag2, or Rag1 and Rag2 protein activity, increased Rag1, Rag2, or Rag1 and Rag2 protein activity, or increased Rag1, Rag2, or Rag1 and Rag2 protein activity. Brings adjustment. In one embodiment, a Rag1, Rag2, or Rag2 / Rag1 knockout is made.

0240In a further embodiment, the inserted nucleic acid is a rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster ApoE locus. Interleukin-2 receptor gamma, an ApoE locus from another organism, part of the Interleukin-2 receptor gamma locus and / or Rag2 locus, and / or Rag1 and / or Rag2 / Rag1 locus. It results in substitution by the corresponding ausologas locus at the locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus.

0241In yet another embodiment, the inserted nucleic acid is at the ApoE locus, the interleukin-2 receptor gamma locus, the Rag2 locus, the Rag1 locus, and / or the Rag2 / Rag1 locus that it replaces over its entire length. Includes polynucleotides that share at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a portion.

0242Substituted gene loci of a given inserted polynucleotide and rat, eukaryote, non-rat eukaryote, mammal, non-human mammal, human, rodent, non-rat rodent, mouse, or hamster Corresponding regions of can be code regions, introns, exons, untranslated regions, regulatory regions, promoters, or enhancers, or any combination thereof. In addition, replacement of a given insertion polynucleotide and / or rat, eukaryotic, non-rat eukaryotic, mammalian, human, non-human mammalian, rodent, non-rat rodent, mouse, or hamster The region of the loci to be formed is, for example, 10 to 100 nucleotides in length, 100 to 500 nucleotides in length, 500 to 1 kb nucleotides in length, 1 kb to 1.5 kb nucleotides in length, 1.5 kb to 2 kb nucleotides in length, 2 kb to 2.5 kb nucleotides in length, 2.5. It can be of any desired length, including kb to 3 kb nucleotide length, 3 kb to 5 kb nucleotide length, 5 kb to 8 kb nucleotide length, 8 kb to 10 kb nucleotide length, or longer. In other examples, the size of the insert or replacement is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb. 100kb ~ about 150kb, about 150kb ~ about 200kb, about 200kb ~ about 250kb, about 250kb ~ about 300kb, about 300kb ~ about 350kb, about 350kb ~ about 400kb, about 400kb ~ about 800kb, about 800kb ~ 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, about 2.5Mb ~ about 2.8Mb, about 2. It is 8Mb ~ about 3Mb. In other embodiments, a given insertion polynucleotide and / or rat, eukaryote, non-rat eukaryote, non-human mammal, mammal, human, rodent, non-rat rodent, mouse, Alternatively, the region of the locus to be substituted in the hamster is at least 100, 200, 300, 400, 500, 600, 700, 800, or 900 nucleotides or at least 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9kb, 10kb, 11kb, 12kb, 13kb, 14kb, 15kb, 16kb, or more.

0243i. Methods for modifying target loci of nucleic acids via bacterial homologous recombination (BHR) Methods and compositions for modifying target loci of nucleic acids in eukaryotes, non-rat eukaryotes, mammals, humans, or non-human mammals via bacterial homologous recombination (BHR) in prokaryotes. Is provided. Such methods involve bacterial homologous recombination in prokaryotic cells to genetically modify the target loci of nucleic acids in eukaryotes, non-rat eukaryotes, mammals, humans, or non-human mammals. Utilize to find use in making targeting vectors. Targeting vectors such as those containing a genetically modified target locus include eukaryotic cells such as eukaryotic cells, non-rat eukaryotic cells, mammalian cells, human cells, non-human mammalian cells, pluripotency. Cells, non-pluripotent cells, non-human pluripotent cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells Can be introduced into non-rat rodent cells, rat cells, mouse cells, hamster cells, fibroblasts, or CHO cells. "Homologous recombination" involves exchanging DNA fragments between two DNA molecules at intersections within a homologous region. Thus, "bacterial homologous recombination" or "BHR" includes homologous recombination that occurs in bacteria.

0244Through bacterial homologous recombination (BHR), eukaryotic cells, non-rat eukaryotic cells, mammalian cells, human cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent Sex cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human precursor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, mice Methods for modifying the target loci of nucleic acids from cells, hamster cells, fibroblasts, or CHO cells are provided. These methods involve introducing into a prokaryotic cell a targeting vector containing an inserted nucleic acid flanked by a 5'homologous arm and a 3'homologous arm, the prokaryotic cell containing the target locus of the nucleic acid and targeting. BHR-mediated recombinases can be expressed at the locus. Such targeting vectors may include any of the larger targeting vectors described herein.

0245In one embodiment, the method comprises an inserted nucleic acid in which the prokaryotic cell is adjacent to (i) a first construct comprising a nucleic acid having the DNA sequence of interest, (ii) a 5'homologous arm and a 3'homologous arm. Includes introduction into a second targeted construct, including (iii) a third construct encoding a recombinase that mediates bacterial homologous recombination. In one embodiment, the first, second, and third constructs are separately introduced into prokaryotic cells over a period of time. In one embodiment, the prokaryotic cell comprises a nucleic acid encoding a recombinase and the method does not require the introduction of a third construct. In one embodiment, the recombinase is expressed under the control of an inducible promoter.

0246In one embodiment, the first construct containing the nucleic acid is derived from a bacterial artificial chromosome (BAC) or a yeast artificial chromosome (YAC). Prokaryotic cells containing the inserted nucleic acid can be selected at the target genomic locus. The method can be repeated continuously, as disclosed herein, to allow the introduction of multiple inserted nucleic acids at the target locus in prokaryotic cells. Once the target nucleic acid locus is "constructed" within the prokaryotic cell, the targeting vector containing the modified target loci is isolated from the prokaryotic cell and eukaryotic, non-rat eukaryotic, and mammalian cells. , Human cells, non-human mammalian cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, human pluripotent cells ,, human ES cells, human adult stem cells, developmentally restricted humans It can be introduced into a target genomic locus in progenitor cells, human iPS cells, human cells, rodent cells, non-rat rodent cells, rat cells, mouse cells, hamster cells, fibroblasts, or CHO cells.

0247Preferred rat cells for receiving the targeting vector are described in US Application No. 14 / 185,703 filed February 20, 2014, the contents of which are outlined herein. These rat cells are pluripotent rat cells capable of maintaining their pluripotency after modification of one or more target genes in vitro and can transmit the target gene modification through germline. ..

0248For example, electroporated pluripotent cells are densely plated for selection of drug resistant cells containing targeting vectors. The drug selection process removes most of the plated cells (about 99%), leaving individual colonies, each of which is a clone derived from a single cell. Of the remaining cells, most cells (approximately 80-100%), embedded in a random arrangement in the genome including Mareta targeting vector (containing a drug selection cassette). Therefore, colonies are individually selected and genetically determined to identify ES cells that carry the targeting vector with the correct genomic arrangement (eg, using modifications of the allelic assay described below).

0249Modifications of the high-throughput quantitative assay, the allele (MOA) assay, can be used for genetic determination. Such an assay allows large-scale screening of modified alleles (including multiple) on the parent chromosome after genetic modification. MOA assays can be performed via a variety of analytical techniques, including but not limited to quantitative PCR, such as real-time PCR (qPCR). For example, real-time PCR includes a first primer set that recognizes a target locus and a second primer set that recognizes a non-targeted reference locus. In addition, the primer set includes a fluorescent probe that recognizes the amplified sequence. In one embodiment, the quantitative assay is performed via Invader Probes®. In one embodiment, the quantitative assay is performed via an MMP assay®. In one embodiment, the quantitative assay is TaqMan® Molecular. It is done via Beacon. In one embodiment, the quantitative assay is performed via Eclipse probe technology (see, eg, US Patent Application No. US2005 / 0144655, which is incorporated herein by reference in its entirety. ).

0250Selected pluripotent cells (ie, non-human pluripotent cells, non-human ES cells) containing the target gene modification are then introduced into a host embryo, eg, a premorula or blastoblast embryo. It can be transplanted into the womb of a surrogate mother to produce a primordial non-human animal (F0 animal). The wound initiator can then be bred, for example, with wild-type animals to produce F1 offspring that are heterozygous for genetic modification. Mating of heterozygous F1 animals can produce homozygous offspring for genetic modification. Mating of heterozygous F1 animals can produce homozygous offspring for genetic modification. In some embodiments, various genetic modifications of the target loci described herein are performed using the large targeting vector (LTVEC) described in detail elsewhere herein. obtain. For example, LTVEC can be obtained from bacterial artificial chromosome (BAC) DNA using VELOCIGENE® gene recombination technology (eg, US Pat. No. 6,586,251 and Valenzuela, D Mat al. (2003), High-throughput. Please refer to engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotechnology 21 (6): 652-659, which is incorporated herein by reference in its entirety).

0251The use of bacterial homologous recombination (BHR) to generate large targeting vectors (LTVECs) adapts large genomic DNA fragments to target alterations in pluripotent or non-pluripotent cells at endogenous loci. Avoid the limitations of the plasmid with low efficiency resulting in introduction. One or more target gene modifications can be made during the production of LTVEC. An exemplary LTVEC produced in a prokaryotic cell is a genome with one or more genetically modified or extrinsic nucleic acids (eg, rat nucleic acid homologs or orthologs) flanked by homologous arms and complementary to a particular genomic region. It may contain an inserted nucleic acid having a sequence.

0252Also provided are host prokaryotic cells containing the various targeting vectors described herein. Examples of such prokaryotic cells include, but are not limited to, bacteria such as Escherichia coli. In one embodiment, the host prokaryotic cell comprises a targeting vector containing an insert nucleic acid flanked by a 5'homologous arm and a 3'homologous arm, the insert nucleic acid ranging from about 5 kb to about 200 kb.

0253The host prokaryotic cell may further comprise a nucleic acid encoding a recombinase polypeptide, or the nucleic acid encoding the recombinase polypeptide is operably linked to an induction promoter.

0254Various methods and compositions using LTVEC as described herein in combination with prokaryotic cells are further provided to generate the target gene modification. Such compositions and methods are discussed elsewhere herein.

0255Modifying the nucleic acid's target locus via bacterial homologous recombination (BHR), including introducing into prokaryotic cells a targeting vector containing an inserted nucleic acid with adjacent 5'homologous and 3'homologous arms. Prokaryotic cells contain nucleic acids corresponding to the 5'and 3'homology arms, and the prokaryotic cells can express BHR-mediated recombinases at the target locus. Such targeting vectors may include any of the larger targeting vectors described herein. Such methods can use LTVEC, which is discussed in detail herein, and further use the CRISPR / Cas system, as discussed elsewhere herein.

0256In one embodiment, the CRISPR / Cas system can be controlled by a promoter that is active in prokaryotic cells such as E. coli.

0257ii. Methods for modifying the target locus of interest in pluripotent or non-pluripotent cells A method for modifying a target locus of interest in pluripotent or non-pluripotent cells via target gene modification, in which (a) pluripotent or non-pluripotent cells, 5'. Introducing a targeting vector containing an inserted nucleic acid in which the homology arm and the 3'homology arm are flanking, the total of the 5'homologity arm and the 3'homologity arm is at least 10 kb. And (b) identifying genetically modified pluripotent or non-pluripotent cells containing the target gene modification at the target locus of interest is further provided. In one embodiment, the sum of the 5'homologous arm and the 3'homologous arm is at least about 16 kb to about 30 kb. In certain embodiments, the target genetic modification can be transmitted through germline. Such targeting vectors may include any of the larger targeting vectors described herein.

0258Various cells can also be used in the methods provided herein for modifying the target locus of interest. In certain embodiments, the cells are eukaryotic cells, non-rat eukaryotic cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, human pluripotent cells, human ES cells, human adults. Stem cells, developmentally restricted human precursor cells, human inducible pluripotent cells (iPS) cells, mammalian cells, human cells, fibroblasts, rodent cells, non-rat rodent cells, mouse cells, Hamster cells, or CHO cells.

0259In one aspect, it is a method for modifying a genomic locus of interest in a pluripotent cell via target gene modification, and (a) the pluripotency after at least one target gene modification of the genome. To provide pluripotent cells that are capable of maintenance and capable of transmitting targeted alterations to the F1 generation germline, and (b) transfer large targeting vectors (LTVECs) to pluripotent cells. Introducing, LTVEC contains an inserted nucleic acid flanked by a 5'homologous arm and a 3'homologous arm, and a 5'homologous arm and a 3'homologous arm contain a genomic DNA fragment. Methods are provided that include (c) identifying genetically modified pluripotent cells that contain a target gene modification.

0260Various methods can be used to identify cells that carry the inserted nucleic acid integrated at the target locus of interest. Insertion of the inserted nucleic acid at the target locus of interest results in "allelic modification". The term "allelic modification" and methods for detecting modified alleles are discussed in more detail elsewhere herein.

0261In one aspect, a method for modifying a genomic locus of interest in a non-pluripotent or pluripotent cell via an endonuclease-mediated gene targeting method is provided, the method of which is (a). To provide isolated non-pluripotent cells or isolated pluripotent cells capable of transmitting a genetically modified genome to the F1 generation germline, and (b) non-pluripotency. By introducing an endonuclease agent into a sex cell or pluripotent cell, the endonuclease agent creates a nick or double-strand break at the target DNA sequence located at the genomic locus of interest and is non-pluripotent. In sex cells or pluripotent cells, nick or double-strand breaks in the target DNA sequence are (i) nick or double-strand breaks, non-homologous end binding (NHEJ) -mediated DNA repair, NHEJ-mediated DNA. Repair induces DNA repair, or (ii) homologous recombination-mediated DNA repair that results in the recovery of wild-type nucleic acid sequences, producing mutant allelic genes containing insertions or deletions of the nucleic acid sequence in the target DNA sequence. Introducing and (c) identifying the modified genomic loci of interest.

0262In one embodiment, it is a method for modifying a genomic locus of interest in an isolated embryonic stem cell (ES) via a nuclease agent, wherein (a) the target gene modification is applied to the F1 generation germ cell lineage. Providing isolated ES cells that can be transmitted, and (b) a large targeting vector containing an inserted nucleic acid in which the ES cells are flanked by (i) 5'homologous arms and 3'homologous arms ( LTVEC), a large targeting vector (LTVEC), which is a nucleic acid sequence whose insertion is at least 5 kb, and (ii) an endonuclease agent, located at the genomic locus of interest by the endonuclease agent. Making a nick or double-strand break on the target DNA sequence, introducing an endonuclease agent in which the target sequence is absent in the inserted nucleic acid, and (c) identifying the target gene modification in embryonic stem (ES) cells. And, including, methods are provided.

0263In one aspect, a method for modifying a genomic locus of interest in a non-pluripotent or pluripotent cell via RNA-guided genomic genetic manipulation is provided, the method of which: To provide non-pluripotent or pluripotent cells capable of transmitting a genetically modified genome to the F1 generation germline, and (b) non-pluripotent or pluripotent cells. A first expression construct, comprising a first promoter operably linked to a first nucleic acid sequence encoding a (i) clustered regular interspersed short parindrome repeat (CRISPR) -related (Cas) protein in a cell, (ii) Introducing a second expression construct containing a second promoter operably linked to a genomic target sequence linked to a guide RNA (gRNA), the genomic target sequence containing a protospacer flanking motif. (PAM) Sequences are adjacent. Optionally, the genomic target sequence is flanked by a protospacer flanking motif (PAM) sequence on the 3'end. In one embodiment, the Cas protein and CRISPR RNA and / or tracrRNA are not naturally present together (eg, Cas protein and CRISPR). RNA does not exist naturally together). In one embodiment, the genomic target sequence is GNNNNNNNNNNNNNNNNNNNNGG (GN).1-20GG; contains the nucleotide sequence of SEQ ID NO: 1). In one embodiment, the genomic target sequence comprises SEQ ID NO: 1 and N is 14-20 nucleotides in length. In one embodiment, the gRNA is a third nucleic acid sequence encoding a clustered regular interspersed short palindrome repeat (CRISPR) RNA (crRNA) and a transactivated CRISPR. Contains a fourth nucleic acid sequence encoding RNA (tracrRNA). In one embodiment, upon expression, the Cas protein forms a CRISPR-Cas complex containing crRNA and tracrRNA, and the CRISPR-Cas complex is nicked or doubled at the target DNA sequence located at the genomic locus of interest. Making a strand break, a nick or double-strand break at the target DNA sequence in a non-pluripotent or pluripotent cell is (i) a non-nick or double-strand break formed by the CRISPR-Cas complex. Homologous end binding (NHEJ) -mediated DNA repair, in which NHEJ produces mutational allelic genes involving insertions or deletions of nucleic acid sequences in target DNA sequences, DNA repair, or (ii) wild-type nucleic acid sequences. It involves inducing homologous recombination-mediated DNA repair that results in recovery and (c) identifying the modified genomic locus of interest.

0264In one aspect, a method for modifying a genomic locus of interest in a non-pluripotent or pluripotent cell via RNA-guided genomic genetic manipulation is provided, the method of which is a germ cell. Encodes (i) clustered regular interspersed short parindrome repeat (CRISPR) -related (Cas) or Cas proteins into non-pluripotent or pluripotent cells capable of transmitting the modified genome through the lineage. Nucleic acids and (ii) gRNA or including the introduction of gRNA or DNA encoding the gRNA, the genomic target sequence comprises a nucleotide sequence in which the gRNA hybridizes to the genomic target sequence and a trans-activated CRISPR RNA (tracrRNA). Adjacent protospacer motif (PAM) sequences are adjacent.

0265In some embodiments, the Cas protein can be introduced into non-pluripotent or pluripotent cells as an isolated protein. In some embodiments, the Cas protein may further comprise a cell permeable domain that promotes cellular uptake of the protein. In other embodiments, the Cas protein can be introduced into cells as a messenger RNA (mRNA) molecule that encodes the Cas protein. In other embodiments, the Cas protein can be introduced into the cell as a DNA molecule encoding the Cas protein. For example, the DNA molecule encoding the Cas protein can be operably linked to a promoter that is provided in the construct and can be expressed in non-pluripotent or pluripotent cells. In certain embodiments, the nucleic acid encoding the Cas protein is codon-optimized for expression in non-pluripotent or pluripotent cells.

0266In some embodiments, the gRNA can be introduced into a non-pluripotent or pluripotent cell as an RNA molecule. For example, gRNA molecules can be transcribed in vitro. In other embodiments, the gRNA can be introduced into a non-pluripotent or pluripotent cell as a DNA molecule encoding the gRNA. For example, a DNA molecule encoding a gRNA can be operably linked to a promoter that is present in the construct and capable of expressing the gRNA in a non-pluripotent or pluripotent cell. In other embodiments, the gRNA can be chemically synthesized.

0267In some embodiments, the gRNA can be introduced into a non-pluripotent or pluripotent cell as a fused crRNA-tracrRNA molecule (ie, a single transcript). In other embodiments, the gRNA can be introduced into non-pluripotent or pluripotent cells as separate crRNA and tracrRNA molecules (ie, separate transcripts). In other embodiments, the gRNA can be introduced into a non-pluripotent or pluripotent cell as separate DNA molecules encoding crRNA and tracrRNA, respectively. For example, separate DNA molecules encoding crRNA and tracrRNA can be operably linked to promoters that are present in separate constructs and can be expressed in non-pluripotent or pluripotent cells. In any of the above embodiments, any combination of constructs may be present in separate nucleic acid molecules or together in a single nucleic acid molecule.

0268In some embodiments, the Cas protein and gRNA can be introduced simultaneously or sequentially into non-pluripotent or pluripotent cells. Similarly, gRNA crRNAs and tracrRNAs can be introduced simultaneously or sequentially into non-pluripotent or pluripotent cells. The Cas protein (or coding nucleic acid) to gRNA (or coding DNA) ratio and / or the crRNA to tracrRNA ratio can be approximately stoichiometric so that they can form an RNA-protein complex. ..

0269In certain embodiments, the Cas protein can be introduced into non-pluripotent or pluripotent cells in the form of a gRNA-containing complex.

0270In one embodiment, pluripotent cells are induced pluripotent stem cells (iPS). In one embodiment, pluripotent cells are developmentally restricted progenitor cells.

0271In various embodiments, the presence of nicks or double-strand breaks at the recognition site within the selectable marker increases the efficiency and / or frequency of recombination between the targeting vector (such as LTVEC) and the target locus of interest. Let me. In one embodiment, this recombination is a homologous recombination. In another embodiment, this recombination is a non-homologous end binding insertion. In various embodiments, the targeting efficiency of a targeting vector at a target genomic locus (such as LTVEC) in the presence of nicks or double-strand breaks is in the absence of nicks or double-strand breaks (eg, the same targeting). At least about 2 times higher, at least about 2 times higher than the corresponding target site at the genomic locus of interest using the vector and the same homology arm, but without additional nucleases to make nicks or double-strand breaks) 3 times higher, at least about 4 times higher.

0272In one embodiment, the target gene modification at the target locus is two alleles. By "2 alleles" is meant that both alleles of the gene contain a target gene modification. Target gene modifications can be the same or different for each allele. For example, a two allele modification can result in the same modification made to the corresponding allele on the corresponding homologous chromosome, or can result in a different modification made to the corresponding allele on the corresponding homologous chromosome. Therefore, a biallelic modification is, for example, homozygous for a specific modification at the genomic locus of interest (ie, specific modification at both alleles) and complex heterozygosity at the genomic locus of interest. Gender (eg, specific modification in one allele and inactivation or disruption of the other allele), or semi-zygous at the genomic locus of interest (eg, specific modification in one allele) And can result in the deletion of the other allele). In certain embodiments, the combined use of a targeting vector (including, for example, LTVEC) with a nuclease agent of the two alleles of the genomic locus of interest in the cell compared to the use of the targeting vector alone. It results in modification of the target gene. When the targeting vector is used in combination with a nuclease agent, the targeting efficiency of the two alleles is at least 2-fold, at least 3-fold, at least 4-fold or more than when the targeting vector alone is used. More than that. In a further embodiment, the targeting efficiencies of the two alleles are at least 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%. , Or 5%, or more.

0273Target gene modification of two alleles at the target locus can result in homozygous, genetically modified cells. "Homozygous" means that both alleles at the target locus (ie, alleles on both homologous chromosomes) have been modified in the same way. In certain embodiments, the combined use of targeting vectors with nuclease agents (including, for example, LTVEC) results in homozygous target gene modification of the two alleles of the genomic locus of interest in the cell. .. In one embodiment, genetic modification of two allelic genes is a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes (ie, a pair of first and second homologous chromosomes), as well as two. Includes insertion of an inserted nucleic acid at a genomic locus of interest on a homologous chromosome (ie, a pair of first and second homologous chromosomes). In some embodiments, the inserted nucleic acid replaces the endogenous nucleic acid sequence at the genomic locus of interest on both homologous chromosomes. In one embodiment, the inserted nucleic acid is homologous or orthologous to the deleted endogenous nucleic acid sequence.

0274In one embodiment, target gene modification at the target locus results in semi-zygous, genetically modified cells. "Semi-zygous" means that there is only one allele at the target locus (ie, the allele on one of the two homologous chromosomes), or only one allele can be expressed. It means that it is functional. In other embodiments, the target gene modification more generally results in complex heterozygotes. Complex heterozygosity modifies both alleles at the target locus (ie, alleles on both homologous chromosomes), but they are inserted in different ways (eg, inserted in one allele and the other allele). Includes situations that are altered by gene inactivation or disruption). In certain embodiments, the combined use of targeting vectors with nuclease agents (including, for example, LTVEC) results in semi-zygous target gene modification of the genomic locus of interest in cells. In certain embodiments, the combined use of a targeting vector with a nuclease agent (including, for example, LTVEC) results in a target gene modification that forms complex heterozygotes at the genomic locus of interest in the cell. In one embodiment, the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of an inserted nucleic acid. In other embodiments, the target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes, and (2) a genomic locus of interest on the first chromosome. Insertion into Insertion Includes insertion of nucleic acid and disruption of the genomic locus of interest on the second chromosome. The first chromosome can be the first homologous chromosome of the two homologous chromosomes, and the second chromosome can be the second homologous chromosome of the two homologous chromosomes. In other embodiments, targeted modifications include (1) deletion of an endogenous nucleic acid sequence at the genomic locus of interest on the first homologous chromosome and insertion of the inserted nucleic acid at the genomic locus of interest, as well as ( 2) No. Includes disruption of the genomic locus of interest in 2 homologous chromosomes. Disruption of the endogenous nucleic acid sequence is of interest, for example, when double-stranded breaks are repaired by heterologous end-binding (NHEJ) -mediated DNA repair at the genomic locus of interest formed by a nuclease agent. Mutant alligators containing insertions or deletions of nucleic acid sequences at genomic loci can result in disruption of the genomic locus of interest. Examples of disruption include alterations in regulatory elements (eg, promoters or enhancers), missense mutations, cleavage mutations, null mutations, or a small number (eg, resulting in frameshift mutations) at the genomic locus of interest. Includes insertion or deletion of nucleotides. Another example of disturbance is a nonsense mutation. Disturbance can result in inactivation (ie, loss of function) or loss of alleles.

0275Homozygous and semi-zygous target gene modifications were intended when genetically modified cells containing these mutations were used to produce the genetically modified animals discussed below. Less because the process for producing genetically modified animals that are non-heterozygous (ie, homozygous or semi-zygous) to the target gene modification is more efficient and requires less reproductive steps. It is advantageous because it does not take time. Target gene modifications that result in complex heterozygosity or semi-zygotes (eg, insertion in one allele and inactivation, disruption, or loss of the other allele) can be advantageous for the same reason.

0276Various cell types can also be used in any of the various methods described above herein to modify genomic loci via nuclease agents. In certain embodiments, the cells are eukaryotic cells, non-rat eukaryotic cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, human pluripotent cells, human ES cells, human adults. Stem cells, developmentally restricted human precursor cells, human inducible pluripotent cells (iPS) cells, mammalian cells, human cells, fibroblasts, rodent cells, non-rat rodent cells, mouse cells, Hamster cells, or CHO cells.

0277Compositions comprising genetically modified non-human animals having a target gene modification at the interleukin-2 receptor gamma or ApoE locus are provided. The various methods and compositions provided herein allow these modified loci to be transmitted through germline.

0278In certain embodiments, genetically modified non-human animals or genetically modified pluripotent or non-pluripotent cells have a target gene modification at the interleukin-2 gamma receptor locus or Alternatively, the interleukin-2 gamma receptor genomic locus or ApoE locus contains at least a portion of the interleukin-2 gamma receptor locus or the ApoE gene, including a genomic locus having a target gene modification at the ApoE locus. A genetically modified genomic gene containing a deletion of at least a portion of the locus, (ii) insertion of a heterologous nucleic acid sequence into the ApoE locus or the interleukin-2 gamma receptor locus, or (iii) a combination thereof. The locus can be transmitted through the germline.

0279Further provided are methods that allow the production of such genetically modified non-human animals and such genetically modified pluripotent cells. Such methods include methods for modifying the ApoE genomic locus or the interleukin-2 gamma receptor locus in pluripotent cells via target gene modification. The method involves (a) introducing into pluripotent cells a targeting vector containing an inserted nucleic acid with a 5'homologous arm at the ApoE locus and a 3'homologous arm adjacent to the ApoE locus, and (b). ) The target gene modification can be transmitted through the germline, including identifying genetically modified pluripotent cells containing the target gene modification at the ApoE genomic locus of interest.

0280Further methods are as follows: (a) Inserted nucleic acids in pluripotent cells with a 5'homologous arm at the interleukin-2 receptor gamma locus and a 3'homologous arm adjacent to the interleukin-2 receptor gamma locus. Target gene modification, including introduction of a targeting vector containing the gene, and (b) identification of genetically modified pluripotent cells containing the target gene modification at the interleukin-2 receptor gamma locus. Can be transmitted through the germline.

0281iii. Method of integrating multiple polynucleotides of interest at the target locus The various methods and compositions provided herein allow for targeted integration of multiple polynucleotides of interest by a given target locus. The various methods described above are continuously repeated to allow targeted integration of any number of inserted nucleic acids into a given target locus. Therefore, the various methods are at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14 to the target locus. , 15, 16, 17, 18, 19, 20, or more insert nucleic acid insertions. In certain embodiments, such continuous tying methods include eukaryotic cells such as non-rat eukaryotic cells, mammalian cells (ie, human, non-human, rodent, non-rat rodent, mouse, etc. Allows the reconstruction of large-scale genomic regions from monkeys, rats, hamsters, domestic mammals, or agricultural animals) to target loci. In such an example, the transfer and reconstruction of a genomic region that includes both coding and non-coding regions is a variant of copy number found within the coding, non-coding, and natural genomic regions, at least in part. By preserving in, it allows the complexity of a given area to be preserved. Therefore, various methods can be used, for example, in any eukaryotic cell, any non-rat eukaryotic cell, any mammalian cell, or in a target animal, in particular in a prokaryotic host cell or non-pluripotency. Provided are methods of generating "heterologous" or "exogenous" genomic regions within cells, pluripotent cells, or ES cells. In one non-limiting example, it produces a "humanized" genomic region within a non-human animal (ie, within a rat). A method for generating a genomic region in any cell is provided herein. In certain embodiments, the cells are eukaryotic cells, non-rat eukaryotic cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, human pluripotent cells, human ES cells, human adults. Stem cells, developmentally restricted human precursor cells, human inducible pluripotent cells (iPS) cells, mammalian cells, human cells, fibroblasts, rodent cells, non-rat rodent cells, mouse cells

02823. Humanized genomic locus Various methods and compositions comprising humanized genomic loci are provided herein. As used herein, the "humanized" genomic locus means a region of the non-human genome that contains at least one human nucleic acid sequence. The humanized genomic locus can include a region of DNA from any organism having the human DNA sequence inserted therein. In certain embodiments, the organism is eukaryote, non-rat eukaryote, non-human mammal, mammal, human, rodent, non-rat rodent, rat, mouse, or hamster. For example, a "humanized rat locus" includes a region of rat DNA having a human DNA sequence inserted therein.

0283The human DNA sequence can be a naturally occurring human DNA sequence or can be modified from its natural form. In certain embodiments, human DNA is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 relative to the native human sequence. % Share array identity. If the human sequence is not a native human sequence, it has at least greater sequence identity to the native human sequence than that of an orthologous non-human sequence. Furthermore, the human DNA sequence can include cDNA, a region of human genomic DNA, a non-coding regulatory region, or any portion of the coding, genome, or regulatory region of human DNA. A human DNA sequence inserted at a non-human locus may contain any of the inserted polynucleotides, as described elsewhere herein. In certain embodiments, the human DNA sequence is orthologous to a non-human target locus, whereas in another example, the human DNA sequence is homologous to a non-human target locus.

0284In one embodiment, the target gene modification is the insertion of an endogenous nucleic acid sequence or the replacement of an endogenous nucleic acid sequence with a homologous or orthologous human nucleic acid sequence. In one embodiment, the target gene modification comprises inserting an endogenous nucleic acid sequence or substituting an endogenous nucleic acid sequence with a human nucleic acid sequence that is homologous or orthologous at an endogenous locus containing the corresponding non-human nucleic acid sequence.

0285A method for making a humanized locus comprises introducing a human nucleic acid sequence into a target locus containing a nucleic acid. In one embodiment, a method of making a humanized non-human animal is provided. Such methods are: (a) modifying the genome of a non-human pluripotent cell or non-pluripotent cell with a targeting vector containing an insert nucleic acid containing a human nucleic acid sequence to form a donor cell. And (b) the introduction of donor cells into the host embryo and (c) the conception of the host embryo in the surrogate mother, which the surrogate mother produces progeny containing the human nucleic acid sequence. In certain embodiments, the humanized locus can be transmitted through germline. In a further embodiment, the targeting vector comprises a large targeting vector (LTVEC) and an inserted nucleic acid having a human nucleic acid sequence of at least 5 kb.

0286In other methods, humanized genomic loci are made by modifying the target locus of a nucleic acid via bacterial homologous recombination (BHR). The method involves introducing into a prokaryotic cell a targeting vector containing an inserted nucleic acid adjacent to a 5'homologous arm and a 3'homologous arm, the inserted nucleic acid containing a human nucleic acid sequence, and the prokaryotic cell containing the nucleic acid. It contains and is capable of expressing BHR-mediated recombinases at the target locus.

0287The humanized genomic locus may include (a) insertion of a homologous or orthologous human nucleic acid sequence, (b) substitution of an endogenous nucleic acid sequence with a homologous or orthologous human nucleic acid sequence, or (c) a combination thereof. In certain embodiments, the humanized genomic locus can be transmitted through germline. In yet another embodiment, the orthologous human sequence replaces the corresponding sequence found at a non-human locus.

0288Any human nucleic acid sequence can be used in the methods and compositions provided herein. Non-limiting examples of human nucleic acid sequences that can be used in methods and compositions are discussed in detail elsewhere herein.

0289The human nucleic acid sequence for insertion into the locus of interest can be of any size. In one embodiment, the human nucleic acid sequence is about 500 nucleotides to about 200 kb, about 500 nucleotides to about 5 kb, about 5 kb to about 200 kb, about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 30 kb. ~ About 40 kb, about 40 kb ~ about 50 kb, about 60 kb ~ about 70 kb, about 80 kb ~ about 90 kb, about 90 kb ~ about 100 kb, about 100 kb ~ about 110 kb, about 120 kb ~ about 130 kb, about 130 kb ~ about 140 kb, about 140 kb ~ about It can be 150 kb, about 150 kb to about 160 kb, about 160 kb to about 170 kb, about 170 kb to about 180 kb, about 180 kb to about 190 kb, or about 190 kb to about 200 kb. In certain embodiments, the human nucleic acid sequence is at least 5 kb.

0290In one embodiment, one or more unrearranged human immunoglobulin heavy chains V in which a homologous or orthologous human nucleic acid sequence is operably linked to (a) a nucleic acid sequence in a mammalian heavy chain constant region.HGene segment, one or more unrearranged human immunoglobulin heavy chains D gene segment, and one or more unrearranged human immunoglobulin heavy chains JHGene segment, (b) Nucleic acid sequence of the rearranged human immunoglobulin heavy chain variable region operably linked to the nucleic acid sequence of the mammalian heavy chain constant region, (c) Mammalian immunoglobulin λ or κ One or more unrearranged human immunoglobulins operably linked to the nucleic acid sequence of the light chain constant regionκOr VλGene segment and one or more non-rearranged human immunoglobulin JκOr JλContains the genetic segment, or (d) the nucleic acid sequence of the rearranged human immunoglobulin λ or κ light chain variable region operably linked to the nucleic acid sequence of the mammalian immunoglobulin λ or κ light chain constant region. , Genome loci are provided.

0291In another embodiment, (a) the nucleic acid sequence of the immunoglobulin heavy chain constant region of a mammal is a nucleic acid sequence of a constant region, a nucleic acid sequence of a human constant region, or a combination thereof, or (b) a mammal. The nucleic acid sequence of the immunoglobulin λ or κ light chain light chain constant region of is provided as a genomic locus, which is the nucleic acid sequence of the rat constant region, the nucleic acid sequence of the human constant region, or a combination thereof.

0292In certain embodiments, genomic loci are provided in which the nucleic acid sequence of the immunoglobulin heavy chain constant region is selected from or contains CH1, hinges, CH2, CH3, and / or combinations thereof.

0293In one embodiment, the genomic locus is VH1-2, VH1-3, VH1-8, VH1-18, VH1-24, VH1-45, VH1-46, VH1-58, VH1-69, VH2-5, VH2-26, VH2-70, VH3-7, VH3-9, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-30-3, VH3-30-5, VH3-33, VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-72, VH3-73, VH3-74, VH4-4, VH4-28, VH4-30-1, VH4-30-2, VH4-30-4, VH4-31, VH4-34, VH4-39, VH4-59, VH4-61, VH5-51, VH6-1 and VH7-4-1, VHOne or more functional human Vs containing 7-81, or a combination thereofHContains gene segments.

0294In one embodiment, the genomic loci are D1-1, D1-7, D1-14, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6- Includes one or more functional human D gene segments containing 6, D6-13, D6-19, D6-25, D7-27, or a combination thereof.

0295In one embodiment, the genomic locus is JH1, JH2, JH3, JH4, JH5, JHOne or more functional Js containing 6, and / or combinations thereofHContains gene segments. In one embodiment, the inserted nucleic acids are Vκ4-1, Vκ5-2, Vκ7-3, Vκ2-4, Vκ1-5, Vκ1-6, Vκ3-7, Vκ1-8, Vκ1-9, Vκ2-10, Vκ3. -11, Vκ1-12, Vκ1-13, Vκ2-14, Vκ3-15, Vκ1-16, Vκ1-17, Vκ2-18, Vκ2-19, Vκ3-20, Vκ6-21, Vκ1-22, Vκ1-23 , Vκ2-24, Vκ3-25, Vκ2-26, Vκ1-27, Vκ2-28, Vκ2-29, Vκ2-30, Vκ3-31, Vκ1-32, Vκ1-33, Vκ3-34, Vκ1-35, Vκ2 Includes one or more human Vκ gene segments containing -36, Vκ1-37, Vκ2-38, Vκ1-39, Vκ2-40, or a combination thereof.

0296In one embodiment, the genomic loci are Vλ3-1, Vλ4-3, Vλ2-8, Vλ3-9, Vλ3-10, Vλ2-11, Vλ3-12, Vλ2-14, Vλ3-16, Vλ2-18, Includes one or more human Vλ gene segments containing Vλ3-19, Vλ3-21, Vλ3-22, Vλ2-23, Vλ3-25, Vλ3-27, or a combination thereof.

0297In one embodiment, the genomic locus comprises one or more human Jκ gene segments comprising Jκ1, Jκ2, Jκ3, Jκ4, Jκ5, or a combination thereof.

0298In yet another embodiment, a genomic locus comprising a humanized genomic locus comprising a human interleukin-2 receptor (IL2R) nucleic acid sequence or a variant or fragment thereof is provided. In certain embodiments, the IL2R nucleic acid sequence comprises an interleukin-2 receptor alpha, an interleukin-2 receptor beta, or an interleukin-2 receptor gamma nucleic acid sequence or a variant or fragment thereof.

0299In a further embodiment, the genomic locus is a non-human ApoE locus, an interleukin-2 receptor gamma locus, a Rag2 locus, a Rag1 locus, and / or a corresponding homologous or orthologous portion of the Rag2 / Rag1 locus. Includes a humanized genomic locus that comprises a portion of the human ApoE locus, the human interleukin-2 receptor gamma locus, the human Rag2 locus, the human Rag1 locus, and / or the human Rag2 / Rag1 locus to be substituted. In one embodiment, the non-human extracellular domain of IL-2Rg is replaced with the extracellular domain of human IL-2Rg, the rest of which is of non-human origin.

0300In another embodiment, a genetically modified non-human animal comprising a humanized genomic locus is provided. Such genetically modified non-human animals include (a) insertion of homologous or orthologous human nucleic acid sequences, (b) substitution of nucleic acid sequences by homologous or orthologous human nucleic acid sequences at endogenous genomic loci, Or (c) including combinations thereof, the humanized genomic locus can be transmitted through the germline.

0301Also provided herein are genetically modified animals (including non-human animals containing any of the various humanized genomic loci described above).

03024. Target polynucleotide Any polynucleotide of interest is included in a variety of inserted nucleic acids so that it can be integrated at the target locus. The methods disclosed herein include at least one, two, three, four, five, six, or more polynucleotides of interest that integrate into a targeted genomic locus. provide.

0303When integrated at the target genomic locus, the polynucleotide of interest in the inserted nucleic acid can introduce one or more genetic modifications into the cell. Genetic modifications can include deletion of endogenous nucleic acid sequences and / or addition of exogenous or heterologous or orthologous polynucleotides to target genomic loci. In one embodiment, the genetic modification comprises the replacement of an endogenous nucleic acid sequence with an exogenous polynucleotide of interest at the target genomic locus. Therefore, the methods provided herein are knockouts, deletions, insertions, substitutions (knock-ins), point mutations, domain swaps, exon swaps, intron swaps, regulatory sequence swaps, gene swaps, or combinations thereof. Allows the generation of genetic modifications, including. Such modifications can occur during the integration of the first, second, third, fourth, fifth, sixth, seventh, or any subsequent insertion nucleic acid into the target genomic locus.

0304The polynucleotide of interest that is integrated at the and / or target locus in the inserted nucleic acid can contain a sequence that is naturally present in the cell into which it is introduced, and the polynucleotide of interest is into the cell into which it is introduced. The polynucleotide of interest can be heterologous and the polynucleotide of interest can be exogenous to the cell into which it is introduced, and the polynucleotide of interest can be orthologous to the cell into which it is introduced, or the polynucleotide of interest can be , Can be from a different species than the cell that introduces it. As used herein, "naturally occurring" with respect to a sequence inserted at a target locus is naturally occurring in a cell having the target locus or derived from the target locus (ie, in a rat). It is a naturally occurring sequence in the cells. As used herein, "heterologous" with respect to a sequence is derived from an alien species, or if derived from the same species, with its natural form at the composition and / or genomic locus by intentional human intervention. Includes sequences that are substantially different or modified. As used herein, "exogenous" with respect to a sequence is a sequence derived from an alien species. The polynucleotides of interest include, but are not limited to, non-humans, rodents, non-rat rodents, hamsters, mice, rats, humans, monkeys, agricultural mammals, or non-agricultural mammals. , Can be from any organism of interest. The polynucleotide of interest may further comprise a coding region, a non-coding region, a regulatory region, or genomic DNA. Therefore, any of the first, second, third, fourth, fifth, sixth, seventh, and / or subsequent inserted nucleic acids can contain such a sequence.

0305In one embodiment, the polynucleotides of interest that are integrated at the and / or target loci within the inserted nucleic acid are mouse nucleic acid sequences, human nucleic acids, non-human nucleic acids, eukaryotic nucleic acids, non-rat eukaryotic nucleic acids, non-humans. It is naturally present in mammalian nucleic acids, mammalian nucleic acids, rodent nucleic acids, non-rat rodent nucleic acids, rat nucleic acids, hamster nucleic acids, monkey nucleic acids, agricultural mammalian nucleic acids, or non-agricultural mammalian nucleic acids. In yet another embodiment, the polynucleotide of interest to be integrated at the target locus is a fragment of genomic nucleic acid. In one embodiment, genomic nucleic acids include mouse genomic nucleic acids, human genomic nucleic acids, non-human nucleic acids, eukaryotic nucleic acids, non-rat eukaryotic nucleic acids, non-human mammalian nucleic acids, mammalian nucleic acids, rodent nucleic acids, non-rat rodents. Dental nucleic acid, rat nucleic acid, hamster nucleic acid, monkey nucleic acid, agricultural mammalian nucleic acid, or non-agricultural mammalian nucleic acid, or a combination thereof.

0306In one embodiment, the polynucleotide of interest can range from about 500 nucleotides to about 200 kb, as described above. The target polynucleotides are about 500 nucleotides to about 5 kb, about 5 kb to about 200 kb, about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 30 kb, about 30 kb to about 40 kb, about 40 kb to about 50 kb, About 60 kb ~ about 70 kb, about 80 kb ~ about 90 kb, about 90 kb ~ about 100 kb, about 100 kb ~ about 110 kb, about 120 kb ~ about 130 kb, about 130 kb ~ about 140 kb, about 140 kb ~ about 150 kb, about 150 kb ~ about 160 kb, about 160 kb ~ 170 kb, about 170 kb ~ about 180 kb, about 180 kb ~ about 190 kb, or about 190 kb ~ about 200 kb, about 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ From about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. obtain.

0307The polynucleotide of interest inserted at the and / or target genomic locus in the inserted nucleic acid can encode a polypeptide, encode a miRNA, or, for example, a regulatory sequence, promoter sequence, enhancer. It can include deletions of any regulatory or non-coding region of interest, including sequences, transcriptional repressor binding sequences, or non-protein coding sequences, but does not include deletions of protein coding sequences. In addition, the polynucleotides of interest inserted at the and / or target genomic loci in the inserted nucleic acid are the nervous system, skeletal system, digestive system, circulatory system, muscular system, respiratory system, cardiovascular system, lymphatic system. , Endocrine system, urinary system, genital system, or a combination thereof can encode a protein. In one embodiment, the polynucleotide of interest inserted in the inserted nucleic acid and / or at the target genomic locus encodes a protein expressed in bone marrow or bone marrow-derived cells. In one embodiment, the polynucleotide of interest inserted in the inserted nucleic acid and / or at the target locus encodes a protein expressed in pancreatic cells. In yet another embodiment, the polynucleotide of interest inserted in the inserted nucleic acid and / or at the target locus encodes a protein expressed on B cells and encodes a protein expressed on immature B cells. Or encode a protein expressed in mature B cells.

0308The polynucleotide of interest within the insertion polynucleotide can include the ApoE locus, the Il2rg locus, the Rag1 locus, the Rag2 locus, and / or a portion of the Rag2 / Rag1 locus. Such parts of these given loci are discussed elsewhere herein, as are various homology and orthologous regions from any organism of interest that may be used.

0309In one embodiment, the polynucleotide of interest inserted in the inserted nucleic acid and / or at the target locus comprises a genomic nucleic acid sequence encoding the amino acid sequence of the immunoglobulin heavy chain variable region. The expressions "heavy chain" or "immunoglobulin heavy chain" are described elsewhere herein.

0310In one embodiment, the polynucleotide of interest inserted at the and / or target locus within the inserted nucleic acid comprises a genomic nucleic acid sequence encoding the amino acid sequence of the human immunoglobulin heavy chain variable region.

0311In one embodiment, the genomic nucleic acid sequence is one or more unrearranged human immunoglobulin heavy chains V.HGene segment, one or more unrearranged human immunoglobulin heavy chains D gene segment, and one or more unrearranged human immunoglobulin heavy chains JHIt contains gene segments that are operably linked to nucleic acid sequences in the mammalian heavy chain constant region. In one embodiment, the genomic nucleic acid sequence comprises a rearranged human immunoglobulin heavy chain variable region nucleic acid sequence operably linked to a mammalian heavy chain constant region nucleic acid sequence. In one embodiment, the genomic nucleic acid sequence is one or more unrearranged human immunoglobulin V.κOr VλGene segment and one or more non-rearranged human immunoglobulin JκOr JλIt contains gene segments that are operably linked to the nucleic acid sequences of the mammalian immunoglobulin λ or κ light chain light chain constant region. In one embodiment, the genomic nucleic acid sequence is a rearranged human immunoglobulin λ or κ light chain variable region nucleic acid sequence operably linked to a mammalian immunoglobulin λ or κ light chain constant region nucleic acid sequence. including. In one embodiment, the nucleic acid sequence of the heavy chain constant region comprises a nucleic acid sequence of the rat constant region, a nucleic acid sequence of the human constant region, or a combination thereof. In one embodiment, the nucleic acid of the immunoglobulin λ or κ light chain constant region comprises a nucleic acid sequence of the rat constant region, a nucleic acid sequence of the human constant region, or a combination thereof.

0312In one embodiment, the nucleic acid sequence of the immunoglobulin heavy chain constant region is selected from or comprises CH1, hinge, CH2, CH3, and / or combinations thereof. In one embodiment, the nucleic acid sequence of the heavy chain constant region comprises CH1-hinge-CH2-CH3.

0313In one embodiment, the polynucleotide of interest to be integrated at the and / or target locus within the inserted nucleic acid comprises a genomic nucleic acid sequence encoding the amino acid sequence of the immunoglobulin light chain variable region. The expression "light chain" includes immunoglobulin light chain sequences from any organism and is described elsewhere herein.

0314In one embodiment, the polynucleotide of interest incorporated at the and / or target locus within the inserted nucleic acid comprises a genomic nucleic acid sequence encoding the amino acid sequence of the human immunoglobulin light chain variable region.

0315In one embodiment, the genomic nucleic acid sequence is one or more unrearranged human immunoglobulin V.κOr VλGene segment and one or more non-rearranged human immunoglobulin JκOr JλIt contains gene segments that are operably linked to the nucleic acid sequences of the rodent immunoglobulin λ or κ light chain light chain constant region. In one embodiment, the genomic nucleic acid sequence is a rearranged human immunoglobulin λ or κ light chain variable region nucleic acid sequence operably linked to a nucleic acid sequence of a rodent immunoglobulin λ or κ light chain light chain constant region. including. In one embodiment, the nucleic acid sequence of the light chain constant region comprises a nucleic acid sequence of the rat constant region, a nucleic acid sequence of the human constant region, or a combination thereof. In one embodiment, the nucleic acid of the immunoglobulin λ or κ light chain constant region comprises a nucleic acid sequence of the rat constant region, a nucleic acid sequence of the human constant region, or a combination thereof.

0316The polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid can encode a ligand for an extracellular protein or receptor. In certain embodiments, the encoded ligand is a cytokine. Cytokines of interest include chemokines selected from or containing CCL, CXCL, CX3CL, and / or XCL. This cytokine can also include tumor necrosis factor (TNF). In yet another embodiment, the cytokine is interleukin (IL). In one embodiment, the interleukin is IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL- 23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, And / or selected from or include IL-36. In one embodiment, the interleukin is IL-2. In certain embodiments, such polynucleotides of interest that have been integrated in and / or at the target genomic locus within the inserted nucleic acid are from humans and, in more specific embodiments, include the human genomic sequence. be able to.

0317The polynucleotide of interest integrated at the and / or target genomic locus within the inserted nucleic acid can encode apolipoprotein E (ApoE).

0318The polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid can encode a cytoplasmic or membrane protein. In one embodiment, the membrane protein is a receptor such as a cytokine receptor, an interleukin receptor, an interleukin 2 receptor-alpha, an interleukin-2 receptor beta, an interleukin-2 receptor gamma, or a receptor. It is a body tyrosine kinase. In another example, the polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid can include an orthologous or homologous region of the target locus.

0319The polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid can include a polynucleotide encoding at least one region of the T cell receptor, including the T cell receptor alpha. In a particular method, each of the inserted nucleic acids is integrated at the target locus so that at the end of continuous integration, part or all of the genomic T cell receptor locus is integrated (ie, the T cell receptor locus). , T cell receptor alpha locus) contains the genomic region. Such inserted nucleic acids can include at least one or more of the variable or binding segments of the T cell receptor locus (ie, the T cell receptor alpha locus). In yet another embodiment, the polynucleotide of interest encoding the region of the T cell receptor is, for example, eukaryote, non-rat eukaryote, mammal, non-human mammal, rodent, non-rat rode. It can be a polynucleotide encoding a mutant protein from a tooth, mouse, rat, human, monkey, hamster, agricultural mammal, or domestic mammal.

0320In other embodiments, the polynucleotide of interest integrated at the target locus encodes a nuclear protein. In one embodiment, the nuclear protein is a nuclear receptor. In certain embodiments, such polynucleotides of interest integrated at and / or target loci within the inserted nucleic acid are from humans and, in more specific embodiments, include the human genome sequence. Can be done.

0321The polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid can include a genetic modification in the coding sequence. Such genetic modifications include, but are not limited to, deletion mutations in the coding sequence or fusion of the two coding sequences.

0322The polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid can include, for example, a polynucleotide encoding a mutated protein, including a human mutated protein. In one embodiment, the mutant protein is characterized by altered binding properties, altered localization, altered expression, and / or altered expression patterns. In one embodiment, the polynucleotides of interest integrated at the and / or target loci in the inserted nucleic acid are, for example, alleles of neurological disease, alleles of cardiovascular disease, alleles of renal disease, muscle disease. Includes at least one disease allele, including alleles of blood disease, alleles of carcinogenic genes, or alleles of immune system diseases. In such an example, the disease allele can be a dominant allele, or the disease allele is a recessive allele. In addition, the disease allele can include single nucleotide polymorphism (SNP) alleles. The polynucleotides of interest that encode the mutant protein are eukaryotes, non-rat eukaryotes, mammals, non-human mammals, rodents, non-rat rodents, mice, rats, humans, monkeys, hamsters. , Agricultural mammals, or livestock mammals, but not limited to these, can be a polynucleotide encoding a mutated protein from any organism.

0323In one embodiment, genetic modification produces a mutant form of a protein with altered binding properties, altered localization, altered expression, and / or altered expression patterns.

0324In one embodiment, genetic modification results in deletion, addition, substitution, or a combination of regions of the ApoE locus, eg, rat ApoE locus, and genetic modification at the ApoE locus reduces ApoE activity. Let me. In one embodiment, an ApoE knockout is made.

0325In one embodiment, genetic modification results in the deletion, addition, substitution, or combination thereof of a region of the Rag1 locus, eg, rat Rag1 locus, and genetic modification at the Rag1 locus reduces Rag1 activity. .. In one embodiment, a Rag1 knockout is made. In one embodiment, genetic modification results in the deletion, addition, substitution, or combination thereof of a region of the Rag2 locus, eg, rat Rag2 locus, and genetic modification at the Rag2 locus reduces Rag2 activity. .. In one embodiment, a Rag2 knockout is made. In one embodiment, genetic modification results in the deletion, addition, substitution, or combination of regions of the Rag1 / Rag2 locus, eg, rat Rag1 / Rag2 locus, and genetic modification at the Rag1 / Rag2 locus. , Decreases Rag1 activity and reduces Rag2 activity. In one embodiment, a Rag1 / Rag2 knockout is made.

0326In one embodiment, genetic modification results in the deletion, addition, substitution, or combination thereof of regions of the interleukin-2 receptor gamma locus, eg, rat interleukin-2 receptor gamma locus, interleukin. Genetic modification at the -2 receptor gamma locus reduces interleukin-2 receptor gamma. In one embodiment, an interleukin-2 receptor gamma knockout is made.

0327As discussed elsewhere herein, additional embodiments provided herein include the ApoE locus, the interleukin-2 receptor gamma locus, the Rag2 locus, the Rag1 locus, and / or. Contains one or more of the Rag2 / Rag1 loci, eg, the rat ApoE locus, the rat interleukin-2 receptor gamma locus, the Rag2 locus, the Rag1 locus, and / or the Rag2 / Rag1 locus. , Rat ApoE locus, interleukin-2 receptor gamma locus, Rag2 locus, Rag1 locus, and / or part of the Rag2 / Rag1 locus, ApoE locus from another organism, interleukin-2 It is modified through substitutions by the corresponding orthologous moieties of the receptor gamma locus, Rag2 locus, Rag1 locus, and / or Rag2 / Rag1 locus.

0328In one embodiment, it causes multiple genetic modifications. In one embodiment, genetic modification results in the deletion, addition, substitution, or combination thereof of regions of the interleukin-2 receptor gamma locus, eg, rat interleukin-2 receptor gamma locus, interleukin. Genetic modification at the -2 receptor gamma locus lowers the interleukin-2 receptor gamma, and the second genetic modification results in deletions, additions, substitutions, or combinations thereof in the region of the rat Rag2 locus. As a result, genetic modification at the Rag2 locus reduces Rag2 activity. In one embodiment, an interleukin-2 receptor gamma / Rag2 knockout is made. Such rats have a SCID phenotype.

0329In one embodiment, the mammalian nucleic acid is the nervous system, skeletal system, digestive system, circulatory system, muscular system, respiratory system, cardiovascular system, lymphatic system, endocrine system, urinary system, genital system, or theirs. Includes genomic loci encoding proteins expressed in combination. In one embodiment, the mammalian nucleic acid comprises a genomic locus encoding a protein expressed in bone marrow or bone marrow-derived cells. In one embodiment, the nucleic acid comprises a genomic locus encoding a protein expressed in spleen cells. In one embodiment, the genomic locus comprises a mouse genomic DNA sequence, a rat genomic DNA sequence, a human genomic DNA sequence, or a combination thereof. In one embodiment, the genomic locus comprises a rat and human genomic DNA sequence in any order. In one embodiment, the genomic locus comprises mouse and human genomic DNA sequences in any order. In one embodiment, the genomic locus comprises mouse and rat genomic DNA sequences in any order. In one embodiment, the genomic locus comprises rat, mouse, and human genomic DNA sequences in any order.

0330In one embodiment, the inserted nucleic acid comprises a genetic modification in the coding sequence of the gene. In one embodiment, the genetic modification comprises a deletion mutant of the coding sequence. In one embodiment, the genetic modification comprises the fusion of two endogenous coding sequences.

0331In one embodiment, the genetic modification comprises a deletion of a non-protein coding sequence, but does not include a deletion of a protein coding sequence. In one embodiment, a deletion of a non-protein coding sequence comprises a deletion of a regulatory element. In one embodiment, the genetic modification comprises the addition of a promoter. In one embodiment, the genetic modification comprises the substitution of a promoter or regulatory element. In one embodiment, the regulatory element is an enhancer. In one embodiment, the regulatory element is a transcriptional repressor binding element.

0332In one embodiment, the genetic modification comprises the substitution of a human nucleic acid sequence encoding a mutated human protein. In one embodiment, the genetic modification comprises at least one human disease allele of the human gene. In one embodiment, the human disease is a neurological disease. In one embodiment, the human disease is a cardiovascular disease. In one embodiment, the human disease is a renal disease. In one embodiment, the human disease is a muscle disease. In one embodiment, the human disease is a blood disease. In one embodiment, the human disease is cancer. In one embodiment, the human disease is an immune system disease. In one embodiment, the human disease allele is a dominant allele. In one embodiment, the human disease allele is a recessive allele. In one embodiment, the human disease allele comprises a single nucleotide polymorphism (SNP) allele.

0333The polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid may also include, for example, a regulatory sequence containing a promoter sequence, enhancer sequence, or transcriptional repressor binding sequence. In certain embodiments, the polynucleotide of interest integrated at the and / or target locus within the inserted nucleic acid comprises a polynucleotide having a deletion of a non-protein coding sequence, but comprising a deletion of a protein coding sequence. Absent. In one embodiment, a deletion of a non-protein coding sequence comprises a deletion of a regulatory sequence. In another embodiment, the deletion of the regulatory element comprises a deletion of the promoter sequence. In one embodiment, the deletion of the regulatory element comprises a deletion of the enhancer sequence. Such target polynucleotides include eukaryotes, non-rat eukaryotes, mammals, non-human mammals, rodents, non-rat rodents, mice, rats, humans, monkeys, and agricultural mammals. , Or livestock mammals, but not limited to these, can be polynucleotides encoding mutant proteins from any organism.

03345. Method of sequence introduction and generation of transgenic animals As outlined above, methods and compositions that allow targeted integration of one or more polynucleotides of interest into a target locus are provided herein. Such systems use a variety of components, and for convenience of reference, the term "targeted integration system" as used herein generally refers to integration events (ie, in a non-limiting example, various nuclease agents. , Recognition site, inserted DNA polynucleotide, targeting vector, target genomic locus, and / or the polynucleotide of interest).

0335The methods provided herein include introducing into a cell one or more polynucleotides or polypeptide constructs containing various elements of a genomic integration system of interest. "Introducing" means presenting a sequence (polypeptide or polynucleotide) to a cell in such a way that the sequence accesses the interior of the cell. The methods provided herein do not depend on a particular method for introducing any component of the genomic integration system of interest into the cell, but the polynucleotide only accesses the interior of at least one cell. It is a thing. Methods for introducing polynucleotides into various cell types are well known in the art, including stable transfection methods, transient transfection methods, and virus-mediated methods. , Not limited to these.

0336Any cell from any organism can be used in the methods provided herein. In certain embodiments, the cells are from eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, rats, mice, or hamsters. .. In certain embodiments, the cells are eukaryotic cells, non-rat eukaryotic cells, pluripotent cells, non-pluripotent cells, non-human pluripotent cells, non-human mammalian cells, human pluripotent cells, humans. ES cells, human adult stem cells, developmentally restricted human precursor cells, human-induced pluripotent cells (iPS) cells, mammalian cells, human cells, fibroblasts, rodent cells, non-rat rodent cells , Rat cells, mouse cells, hamster cells, or CHO cells.

0337In some embodiments, the cells used in this method and composition have DNA constructs that are stably integrated into their genome. "Stable integration" or "stable introduction" means the introduction of a polynucleotide into a cell in which the nucleotide sequence is integrated into the cell's genome and can be inherited by its progeny. Any protocol can be used for stable integration of various components of DNA constructs or genomic integration systems of interest.

0338Transfection protocols and protocols for introducing polypeptides or polynucleotide sequences into cells can vary. Non-limiting transfection methods, including chemical transfection methods, include liposomes, nanoparticles, calcium phosphate (Graham et al. (1973). Virology 52 (2): 456-67, Bacchetti et al. (1977) Proc. Natl Acad Sci USA 74 (4): 1590-4, and Kriegler, M (1991) .Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company.pp.96-97), Dendrimer, or DEAE-Dextran or Includes the use of cationic polymers such as polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and optical transfection. For particle-based transfection, gene guns and magnetic transfection (magnet assisted) Includes the use of transfection) (Bertram, J. (2006) Current Pharmaceutical Biotechnology 7,277-28). Various methods can also be used for transfection.

0339In one embodiment, the introduction of one or more of the polynucleotides into one or more cells is mediated by electroperforation, intracytoplasmic injection, viral infection, adenovirus, lentivirus, retrovirus, transfection, lipid-mediated transfection. Or mediated by Nucleofection .

0340In one embodiment, introduction into one or more cells of a polynucleotide further comprises introducing an expression construct containing the nucleic acid sequence of interest operably linked to a promoter. In one embodiment, the promoter is a constitutively active promoter. In one embodiment, the promoter is an inductive promoter. In one embodiment, the promoter is active on stem cells, such as embryonic stem cells.

0341In one embodiment, the expression construct is introduced with LTVEC. In one embodiment, the expression construct is introduced separately from LTVEC over a period of time.

0342In one embodiment, the introduction of one or more polynucleotides into a cell can occur multiple times over a period of time. In one embodiment, the introduction of one or more polynucleotides into a cell is at least 2 times over a period of time, at least 3 times over a period of time, at least 4 times over a period of time, at least 5 times over a period of time, and at least over a period of time. 6 times, at least 7 times over a period, at least 8 times over a period, at least 9 times over a period, at least 10 times over a period, at least 11 times, at least 12 times over a period, at least 13 times over a period Performed at least 14 times over a period, at least 15 times over a period, at least 16 times over a period, at least 17 times over a period, at least 18 times over a period, at least 19 times over a period, or at least 20 times over a period ..

0343In one embodiment, the nuclease agent is simultaneously introduced into the cell with a targeting vector or a large targeting vector (LTVEC). Alternatively, the nuclease agent is introduced separately from the targeting vector or LTVEC over a period of time. In one embodiment, the nuclease agent is introduced prior to the introduction of the targeting vector or LTVEC, while in other embodiments the nuclease agent is introduced after the introduction of the targeting vector or LTVEC.

0344In one embodiment, the screening step comprises a quantitative assay to assess alteration of the allele of the parent chromosome (MOA). In one embodiment, the quantitative assay is performed via quantitative PCR. In one embodiment, the quantitative PCR is real-time PCR (qPCR). In one embodiment, real-time PCR comprises a first primer set that recognizes a target locus and a second primer set that recognizes a non-targeted reference locus. In one embodiment, the primer set comprises a fluorescent probe that recognizes the amplified sequence. In one embodiment, the quantitative assay is performed via fluorescence-mediated in situ hybridization (FISH). In one embodiment, the quantitative assay is performed via comparative genomic hybridization. In one embodiment, the quantitative assay is performed via isothermal DNA amplification. In one embodiment, the quantitative assay is performed via isothermal DNA amplification. In one embodiment, the quantitative assay is performed via quantitative hybridization to an immobilized probe (s). In one embodiment, the quantitative assay is performed via Invader Probes®. In one embodiment, the quantitative assay is performed via an MMP assay®. In one embodiment, the quantitative assay is performed via TaqMan® Molecular Beacon. In one embodiment, the quantitative assay is performed via Eclipse probe technology (see, eg, US Patent Application No. US2005 / 0144655, which is incorporated herein by reference in its entirety. ).

0345A method for producing humanized non-human animals, in which (a) the genome of pluripotent cells is modified with a targeting vector containing an insertion nucleic acid containing a human nucleic acid sequence to form donor cells. A method that involves (b) introducing donor cells into a host embryo and (c) conceiving a host embryo in a surrogate mother, the surrogate mother producing progeny containing the human nucleic acid sequence. Further provided. In one embodiment, donor cells are introduced into a host embryo that is in the blast or pre-morula stage (ie, 4-cell or 8-cell stage). In addition, step (a) can also be performed with a large targeting vector (LTVEC) and / or a human nucleic acid sequence of at least 5 kb length. In yet other embodiments, the genetic modification can be transmitted through germline.

0346Genetically modified non-human animals can be produced using the various methods disclosed herein. Such methods include (1) incorporating one or more target polynucleotides at the target loci of pluripotent cells at the target genomic loci using the methods disclosed herein. Generating genetically modified pluripotent cells containing the inserted nucleic acid and (2) genetically modified pluripotent cells having one or more target polynucleotides at the target genomic locus. Selection, (3) introduction of genetically modified pluripotent cells into the host genome, and (4) transplantation of the host embryo containing the genetically modified pluripotent cells into the surrogate mother. Including that. Progeny are produced from genetically modified pluripotent cells. In one embodiment, donor cells are introduced into a host embryo that is in the blast or pre-morula stage (ie, 4-cell or 8-cell stage). Progeny that can be transmitted through the germline are produced. This pluripotent cell can be an ES cell, as discussed elsewhere herein.

0347Nuclear transfer techniques can also be used to generate genetically modified non-human animals. Briefly, the methods for nuclear migration include (1) enucleating the egg mother cell, (2) isolating the donor cell or nucleus to be combined with the denuclearized egg mother cell, and (3). ) The step of inserting this cell or nucleus into an enucleated egg mother cell to form a reconstituted cell, and (4) the step of transplanting this reconstituted cell into the uterus of an animal to form an embryo. And (5) the step of developing an embryo. In such a method, oocytes are generally recovered from dead animals, but they may also be isolated from the oviducts and / or ovaries of live animals. Oocytes can be matured in a variety of media well known to those of skill in the art prior to enucleation. Enucleation of oocytes can be performed in many ways well known to those of skill in the art. Insertion of donor cells or nuclei into enucleated oocytes to form reconstituted cells is usually by microinjection of the donor cells under the zona pellucida before fusion. Fusion can be induced by application of DC electrical pulses to the contact / fusion surface (electrofusion), exposure of cells to fusion-promoting chemicals such as polyethylene glycol, or by an inactivating virus such as Sendai virus. The reconstituted cells are typically activated by electrical and / or non-electrical means before, during, and / or after fusion of the nuclear donor and recipient oocytes. Activation methods include electrical pulses, chemically induced shock, sperm invasion, increased levels of divalent cations in oocytes, and phosphorylation of cellular proteins (such as by kinase inhibitors) in oocytes. Includes reduction. Activated reconstituted cells or embryos are typically cultured in a medium well known to those of skill in the art and then transplanted into the animal's uterus. For example, US Patent Publication No. US20080092249, International Publication No. WO / 1999/005266A2, US Patent Publication No. US20040177390, International Publication No. WO / 2008/017234A1, and US Patent No. 7.

0348In one embodiment, a method for producing genetically modified non-human animals, in which endonuclease-mediated gene targeting is used to modify the genomic loci of interest in pluripotent cells to provide a subject. Introducing modifications at the genomic loci to form modified pluripotent cells and maintaining the modified pluripotent cells under conditions sufficient to maintain pluripotency. , Includes the use of modified pluripotent cells as donor cells in the host embryo and the conception of a host embryo containing the modified pluripotent cells in the surrogate mother, wherein the surrogate mother conceives the host embryo. And a method is provided in which genetically modified offspring are born.

0349In one embodiment, this target sequence is located in an intron. In one embodiment, this target sequence is located in an exon. In one embodiment, this target sequence is located in the promoter. In one embodiment, the target sequence is located in the promoter control region. In one embodiment, the target sequence is located in the enhancer region.

0350In one embodiment, the introduction step is performed multiple times over a period of time with multiple endonucleases that recognize different target sequences. In one embodiment, the step is at least twice over a period of time with multiple endonucleases that recognize different target sequences, and at least three times over a period of time using multiple endonucleases that recognize different target sequences. Multiple endonucleases that recognize different target sequences at least 4 times over a period of time, and multiple endonucleases that recognize different target sequences at least 5 times over a period of time. A period of time using multiple endonucleases that recognize different target sequences at least 6 times over a period of time and at least 7 times over a period of time using multiple endonucleases that recognize different target sequences. Different target sequences at least 8 times over a period of at least 9 times using multiple endonucleases that recognize different target sequences, and at least 10 times over a period of time using multiple endonucleases that recognize different target sequences. Multiple endonucleases that recognize different target sequences at least 11 times over a period of time, and multiple endonucleases that recognize different target sequences at least 12 times over a period of time. Using multiple endonucleases that recognize different target sequences at least 13 times over a period of time, at least 14 times over a period of time, using multiple endonucleases that recognize different target sequences, at least 15 times over a period of time. Recognize different target sequences at least 16 times over a period of time using multiple endonucleases that recognize different target sequences, and at least 17 times over a period of time using multiple endonucleases that recognize different target sequences. With multiple endonucleases, for a period of time

0351In one embodiment, the introduction step is mediated by electroporation, intracytoplasmic injection, adenovirus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or by Nucleofection .

0352In one embodiment, the method further comprises introducing an exogenous nucleic acid into a genetically modified pluripotent cell. In one embodiment, the exogenous nucleic acid is a trans gene. In one embodiment, the exogenous nucleic acid is introduced at an endogenous locus. In one embodiment, the exogenous nucleic acid is introduced ectopically (eg, at a locus different from its endogenous locus).

0353In one aspect, a method for producing genetically modified non-human animals that uses RNA-guided genomic genetic manipulation to modify a genomic locus of interest in pluripotent cells. Introduce modifications at the genomic loci of interest to form modified pluripotent cells and maintain the modified pluripotent cells under conditions sufficient to maintain pluripotency. The surrogate mother is the host of the host embryo, including the use of modified pluripotent cells as donor cells in the host embryo and the conception of the host embryo containing the modified pluripotent cells in the surrogate mother. A method is provided in which an embryo is conceived and a genetically modified offspring is born.

0354In one embodiment, the method has a targeting rate ranging from about 2% to about 80%.

0355In one embodiment, the method comprises co-introducing multiple second expression constructs containing different genomic target sequences for multiple editing of different genomic loci. In one embodiment, the method comprises introducing multiple second expression constructs containing different genomic target sequences for multiple editing of different genomic loci over a period of time.

0356In one embodiment, the introduction step is performed multiple times over a period of time. In one embodiment, the introduction step (b) is performed at least twice over a period of time, at least 3 times over a period of time, at least 4 times over a period of time, at least 5 times over a period of time, at least 6 times over a period of time, over a period of time. At least 7 times, at least 8 times over a period, at least 9 times over a period, at least 10 times over a period, at least 11 times, at least 12 times over a period, at least 13 times over a period, at least 14 times over a period It is performed at least 15 times over a period of time, at least 16 times over a period of time, at least 17 times over a period of time, at least 18 times over a period of time, at least 19 times over a period of time, or at least 20 times over a period of time.

0357In one embodiment, the first expression construct and the second expression construct are expressed from the same plasmid.

0358In one embodiment, the introduction step is mediated by electroporation, intracytoplasmic injection, adenovirus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or by Nucleofection .

0359In one embodiment, the method further comprises introducing an exogenous nucleic acid into a pluripotent cell containing a mutation allele.

0360In one embodiment, the exogenous nucleic acid is a trans gene. In one embodiment, the exogenous nucleic acid is introduced at an endogenous locus. In one embodiment, the exogenous nucleic acid is placed ectopically (eg, at a locus different from its endogenous locus).

0361In one embodiment, the method further comprises introducing an exogenous nucleic acid into a genetically modified pluripotent cell. In one embodiment, the exogenous nucleic acid is a trans gene. In one embodiment, the exogenous nucleic acid is introduced at an endogenous locus. In one embodiment, the exogenous nucleic acid is introduced ectopically (eg, at a locus different from its endogenous locus).

0362In one embodiment, a method for producing humanized non-human animals, in which the genome of a pluripotent cell is modified using LTVEC containing an insertion containing a human sequence of at least 5 kb, and pluripotency as a donor cell. Provided are methods of using sex cells, introducing donor cells into a host embryo, and gestating the host embryo in a surrogate mother, the surrogate mother giving birth to offspring, including humanization. ..

0363Other methods described herein for producing genetically modified non-human animals, including one or more genetic modifications in its germline, (a) described herein. Modifying the target locus contained in the prokaryotic cell by using various methods described in the following, (b) selecting the modified prokaryotic cell containing the genetic modification at the target locus, and (c) modifying it. Isolating a genetically modified targeting vector from the genome of a proto-nuclear cell, and (d) introducing the genetically modified targeting vector into a pluripotent cell to target the genomic locus. To generate genetically modified pluripotent cells containing the inserted nucleic acid in, (e) select genetically modified pluripotent cells, and (f) gene in the pre-mulberry embryonic stage. Introducing a genetically modified pluripotent cell into a host genome and (g) transplanting a host embryo containing the genetically modified pluripotent cell into a surrogate mother to genetically modify the pluripotency Methods are provided, including the generation of F0 generations derived from capable cells. In such a method, the targeting vector can include a large targeting vector. The pluripotent cell can be an ES cell. In a further method, isolation step (c) further comprises linearizing (c1) a genetically modified targeting vector (ie, genetically modified LTVEC). In yet another embodiment, the introduction step (d) further comprises (d1) introducing the nuclease agent described herein into pluripotent cells. In one embodiment, selection steps (b) and / or (e) are performed by applying the selectable agents described herein to prokaryotic or pluripotent cells. In one embodiment, selection steps (b) and / or (e) are performed via modification of the allele (MOA) assay described herein.

0364Additional methods for modifying target loci of mammalian cells via bacterial homologous recombination (BHR) in prokaryotic cells are provided, and these methods include (a) a prokaryote containing a target locus containing a nucleic acid. Donating cells and (b) introducing into prokaryotic cells a targeting vector containing an inserted nucleic acid flanked by 5'homologous and 3'homologous arms, the inserted nucleic acid in the mammalian region. Prokaryotic cells mediate BHR, including including (eg, including DNA insertion from humans), introduction, and (c) selection of target prokaryotic cells containing the inserted nucleic acid at the target locus. Recombinase can be expressed. Step (a1) may include providing a prokaryotic cell containing a target locus containing a nucleic acid containing a first polynucleotide containing a first recognition site for a first nuclease agent, step (b1). Can further include expressing in prokaryotic cells a nuclease agent that produces a nick or double-strand break at or near the first recognition site. Steps (a)-(c) can be repeated continuously, as disclosed herein, to allow the introduction of multiple inserted nucleic acids at the target locus in prokaryotic cells. Once the targeted genomic locus is "constructed" using the prokaryotic cell, the targeting vector containing the modified target locus is isolated from the prokaryotic cell and within the pluripotent cell the target genomic locus. Can be introduced in. A pluripotent cell (ie, an ES cell) containing a modified genomic locus can then be made into a genetically modified non-human animal.

0365In some embodiments, various genetic modifications of the target genomic loci described herein are made using LTVEC derived from bacterial artificial chromosome (BAC) DNA using VELOCIGENE® genetic recombination technology. It can be performed by a series of homologous recombination reactions (BHR) in bacterial cells (eg, US Pat. No. 6,586,251 and Valenzuela, DM et al. (2003), High-throughput engineering of the mouse genome coupled with high-resolution expression analysis). , Nature Biotechnology 21 (6): 652-659, which is incorporated herein by reference in its entirety).

0366In some embodiments, target ES cells containing the various genetic modifications described herein are used as insertion ES cells from the corresponding organism via the VELOCI Mouse® method. For example, it is introduced into pre-morula embryos such as 8-cell stage mouse embryos (eg, US Pat. Nos. 7,576,259, 7,659,442, 7,294,754, and US Patent Application No. 2008-0078000). Please refer to A1, all of which are incorporated herein by reference in their entirety). Embryos containing genetically modified ES cells are incubated to the blastogenic stage and then transplanted into surrogate mothers to produce F0. Animals carrying a genetically modified genomic locus can be identified via modification of the allele (MOA) assay described herein. Non-human animals derived from the obtained F0 generation genetically modified ES cells are crossed with wild-type non-human animals to obtain F1 generation offspring. After genetic determination with specific primers and / or probes, F1 non-human animals that are heterozygous for the genetically modified genomic locus are crossed with each other and genetically modified genomic loci. Produces animals that are homozygous to. Alternatively, F0 female non-human animals and F0 male non-human animals having genetic modification, respectively, can be mated to obtain F1 non-human animals that are homozygous to the genetic modification.

0367In one aspect, a genetically modified rat genome is provided, comprising, for example, a targeted modification of an endogenous nucleic acid sequence having a homologous or orthologous nucleic acid sequence from another organism.

0368In one embodiment, the homologous or orthologous nucleic acid sequence is about 5 kb to about 200 kb in length. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 5 kb to about 10 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 10 kb to about 20 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 20 kb to about 30 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 30 kb to about 40 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 40 kb to about 50 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 50 kb to about 60 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 60 kb to about 70 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 70 kb to about 80 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 80 kb to about 90 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 90 kb to about 100 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 100 kb to about 110 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 110 kb to about 120 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 120 kb to about 130 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 140 kb to about 150 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 150 kb to about 160 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 160 kb to about 170 kb. Bu. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 170 kb to about 180 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 180 kb to about 190 kb. In one embodiment, homologous or orthologous non-rat nucleic acid sequences range from about 190 kb to about 200 kb. The various polynucleotides of interest that can be used for the inserted nucleic acid are described elsewhere herein.

0369Additional methods for target genome modification of non-human animals are provided. Such methods are as follows: (a) The genomic locus of interest in non-human pluripotent cells according to any of the various methods provided herein for modifying the genomic locus of interest. And thereby producing genetically modified non-human pluripotent cells containing targeted genome modification, and (b) the modified non-human pluripotent cells of step (a) as a non-human host. Introducing into an embryo and (c) conceiving a non-human host embryo containing a modified pluripotent cell in the surrogate mother can include this surrogate mother producing F0 progeny containing the targeted genomic modification. Produced and targeted genomic modifications can be transmitted through germline.

0370In some embodiments, the target genomic modification is a deletion of an endogenous nucleic acid sequence at the genomic locus of interest and an insertion of an exogenous nucleic acid at the genomic locus of interest (ie, deletion in a single step). And insertion) at the same time. In some embodiments, the target genomic modification comprises the genetic modification of two alleles. 2 Allele genetic modifications include deletion of endogenous nucleic acid sequences and insertion of exogenous nucleic acids at the genomic loci of interest on two homologous chromosomes (ie, a pair of first and second chromosomes). Can be done.

0371In other embodiments, the target genomic modification forms a modified pluripotent cell that is complex heterozygous at the genomic locus of interest. In other embodiments, the target genomic modification forms a modified pluripotent cell that is semi-zygous at the genomic locus of interest. In some embodiments, the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of an exogenous nucleic acid. For example, target gene modifications include (1) deletion of an endogenous nucleic acid sequence at the target genomic locus on two homologous chromosomes, and (2) exogenous to the target genomic locus on the first chromosome. It can include insertion of nucleic acid and disruption of the genomic locus of interest on the second chromosome. The first chromosome can be the first homologous chromosome of the two homologous chromosomes, and the second chromosome can be the second homologous chromosome of the two homologous chromosomes.

03726. Cells The various methods and compositions described herein use a system for targeting genomic loci in cells. In one embodiment, the cell is a pluripotent cell. In one embodiment, the cell is a non-pluripotent cell. In one embodiment, the pluripotent cell is a non-human pluripotent cell. In one embodiment, the non-human pluripotent cell is a mammalian pluripotent cell. In one embodiment, the pluripotent cell is a human-induced pluripotent stem (iPS) cell.

0373In other embodiments, the cells are eukaryotic cells, non-rat eukaryotic cells, human pluripotent cells, human ES cells, human adult stem cells, developmentally restricted human progenitor cells, non-human mammalian cells, Mammalian cells, human cells, fibroblasts, rodent cells, non-rat rodent cells, rat cells, mouse cells, hamster cells, or CHO cells.

0374In one embodiment, the eukaryotic cell is a primary cell. Primary cells include cells or cell cultures that are isolated directly from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortalized. They were previously not subcultured in tissue culture or were previously subcultured in tissue culture but cannot be subcultured indefinitely in tissue culture, any from an organism, organ, or tissue. Contains cells. Such cells can be isolated by conventional techniques, such as hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratin-producing cells, melanin cells, monospheres, mononuclear cells, Includes adipocytes, preadipocytes, neurons, glial cells, hepatocytes, skeletal myoblasts, and smooth muscle cells. In some embodiments, the primary cells are derived from connective tissue, muscle tissue, nervous system tissue, or epithelial tissue.

0375In another embodiment, the eukaryotic cell is an immortalized cell. Immortalized cells usually do not proliferate indefinitely, but include cells from multicellular organisms that, by mutation or alteration, can avoid normal cell senescence and instead continue to divide. Such mutations or changes can occur naturally or can be deliberately induced. Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human fetal kidney cells (eg, HEK293 cells), and mouse fetal fibroblasts (eg, 3T3 cells). Many types of immortalized cells are well known in the art.

0376In some embodiments, the immortalized cell is derived from a cancer cell. In another embodiment, primary or immortalized cells are those commonly used to culture or express recombinant genes or proteins.

0377In other embodiments, pluripotent cells are capable of maintaining their pluripotency after modification of at least one target gene in their genome and can transmit the target modification to the F1 generation germline. it can.

0378In one embodiment, the pluripotent cell is a non-human fertilized egg in the unicellular phase. In one embodiment, the non-human fertilized egg is a fertilized mammalian egg. In one embodiment, the fertilized mammalian egg is a fertilized rodent egg in the unicellular stage. In one embodiment, the fertilized mammalian egg is a fertilized rat or mouse in the unicellular stage.

0379The various cells used in the methods and compositions disclosed herein can also include prokaryotic cells such as bacterial cells, including E. coli. In certain embodiments, the prokaryotic cell is a recombinant competent strain of Escherichia coli. In one embodiment, the prokaryotic cell comprises a nucleic acid encoding a recombinase, but in another example, the prokaryotic cell does not contain a nucleic acid encoding a recombinase, and the nucleic acid encoding the recombinase is introduced into the prokaryotic cell. In one embodiment, the nucleic acid encoding the recombinase comprises DNA or mRNA. In some embodiments, the nucleic acid encoding the recombinase is pABG. In one embodiment, the recombinase is expressed under the control of an inducible promoter. In one embodiment, the expression of recombinase is regulated by arabinose.

0380A. Low osmolal medium for producing and maintaining human-induced pluripotent stem cells Cell culture media are provided for use in the methods and compositions of the present invention. In one embodiment, this medium is suitable for creating a population of human iPS cells. In another embodiment, this medium is suitable for maintaining human iPS cells in culture. In some embodiments, human iPS cells are naive or naive-like.

0381The media provided herein include at least one basal medium, a supplement, a leukemia inhibitory factor (LIF) polypeptide, a glycogen synthase kinase 3 (GSK3) inhibitor, and a MEK inhibitor.

0382The medium of the present invention is a medium having a low osmolality. In one example, the osmolality is about 175-280 mOsm / kg. In a further example, the osmolal concentration of the medium is about 180-270 mOsm / kg, about 200-250 mOsm / kg, about 220-240 mOsm / kg, or about 225-235 mOsm. In certain embodiments, the osmolal concentration of the medium is approximately 233 mOsm / kg.

0383The basal medium provided in the present invention is a low osmolality basal medium to which supplements are added. The basal medium of the present invention is commercially available in various forms as Dalveco Modified Eagle's Medium (DMEM) (eg, Invitrogen DMEM, Catalog No. 11971-025) and KO-DMEM (Invitrogen Catalog No. 10829-018). It differs from the basal medium typically used to maintain human iPS cells in culture, which contains low-salt DMEM.

0384The basal medium provided herein is a medium with a low osmolality, but exhibits features not limited to a low osmolality. For example, the DMEM preparations shown in Table A can be made to be suitable for the purposes of the present invention by varying the concentrations of sodium chloride and / or sodium bicarbonate provided herein, Table A. It results in different osmolal concentrations compared to standard DMEM basal medium or low salt DMEM basal medium (KO-DMEM) shown in.

0385<tables num="1A-1"><img id="000002" he="204" wi="150" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="1A-2"><img id="000003" he="67" wi="152" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>

0386The basal medium of the present invention may contain salts of alkali metals such as sodium chloride (NaCl) and halides. An exemplary concentration of NaCl in the basal medium comprises 50 ± 5 mM or about 3 mg / mL.

0387In another embodiment, the basal medium indicates the concentration of carbonate. The carbonate can be a sodium salt. In such an example, this sodium salt can be sodium bicarbonate. In certain embodiments, sodium bicarbonate is present in the basal medium at a concentration of about 26 ± 5 mM or about 2.2 mg / mL.

0388In yet another embodiment, the basal medium is a basal medium with a low osmolality. The osmolal concentration of the basal medium can be in the range of about 175 to 280 mOsm / kg, about 180 to 250 mOsm / kg, about 190 to 225 mOsm / kg, or about 195 to 205 mOsm / kg. An exemplary osmolal concentration of basal medium can be 200, 214, 216, or 218 mOsm / kg. In a particular example, the osmolal concentration of basal medium is 200 mOsm / kg. The osmolal concentration is the concentration of CO that cells have different concentrations.2Can be determined when cultured in. In some examples, the cells are 3% CO2Or 5% CO2Incubate in.

0389In a preferred embodiment, the basal medium contains NaCl at a concentration of 3.0 mg / mL, sodium bicarbonate at a concentration of about 2.2 mg / mL, and has an osmolality of 200 mOsm / kg.

0390The supplements formulated in the basal medium of the invention are suitable for producing, maintaining, or enriching the population of human iPS cells disclosed herein. Such supplements are referred to herein as "supplements" or "+ supplements". The term "supplement" or the expression "+ supplement" includes one or more additional elements added to the components of the basal medium listed in Table A. For example, supplements include F-12® medium (Gibco), N2® supplement (Gibco; 100-fold solution), NEUROBASAL® medium (Gibco), B-27®. ) Supplement (Gibco; 50x solution), L-glutamine, glucose, 2-mercaptoethanol, leukemia inhibitory factor (LIF) polypeptide, glycogen synthase kinase 3 inhibitor, MEK inhibitor, or any combination thereof It can be mentioned, but is not limited to these.

0391In certain embodiments, the LIF polypeptide is a human LIF (hLIF) polypeptide. In some examples, the hLIF polypeptide is about 1-1000 units / mL, about 20-800 units / mL, about 50-500 units / mL, about 75-250 units / mL, or about 100 units / mL. Used in concentration.

0392In another particular embodiment, the GSK3 inhibitor comprises CHIR99021. In some examples, CHIR99021 is used at concentrations of about 0.1-10 μM, about 1-5 μM, about 2-4 μM, or about 3 μM.

0393In another particular embodiment, the MEK inhibitor comprises PD0325901. In some examples, PD0325901 is used at concentrations of about 0.1-5 μM, about 0.2-1 μM, about 0.3-0.7 μM, or about 0.5 μM.

0394The exemplary medium is about 24.75% (v / v) of the low osmolal basal medium described herein, about 24.75% (v / v) of the F-12 medium, about 0.5% (v / v). ) N2 supplement, about 49% (v / v) NEUROBASAL medium, about 1% (v / v) B-27 supplement, about 2 mM L-glutamine, about 0.1 mM 2-mercaptoethanol, about Includes 100 units / mL hLIF, approximately 3 μM CHIR99021, and approximately 0.5 μM PD0325901.

0395In another particular embodiment, the medium may or may not contain basic fibroblast growth factor (bFGF, also known as FGF2 or FGF-β). Preferably, the medium of the present invention does not contain bFGF.

0396B. Human-induced pluripotent stem cells Methods and compositions for making populations of human iPS cells are provided herein. Further provided are methods and compositions for maintaining human iPS cells in culture. Human iPS cells produced or maintained in culture are also provided.

0397The term "pluripotent cell" or "pluripotent stem cell" includes undifferentiated cells capable of developing into more than one differentiated cell type. Such pluripotent cells can be, for example, mammalian embryonic stem (ES cell) cells or mammalian induced pluripotent stem cells (iPS cells). Examples of pluripotent cells include human iPS cells.

0398The term "embryonic stem cell" or "ES cell" means an embryo-derived pluripotent or pluripotent cell derived from the inner cell mass of a blastocyst that can be maintained in an in vitro culture under suitable conditions. ES cells can differentiate into cells of any of the three vertebrate germ layers, eg, endoderm, ectoderm, or mesoderm. ES cells are also characterized by their ability to reproduce indefinitely under suitable in vitro culture conditions. See, for example, Thomson et al. (Science (1998) Vol.282 (5391), pp.1145-1147).

0399The term "induced pluripotent stem cell" or "iPS cell" includes pluripotent stem cells that can be directly derived from differentiated mature cells. Human iPS cells include, for example, Oct3 / 4, Sox family transcription factors (eg, Sox1, Sox2, Sox3, Sox15), Myc family transcription factors (eg, c-Myc, l-Myc, n-Myc), Kruppel-like family. Specific sets of reprogramming factors in non-pluripotent cells that may contain (KLF) transcription factors (eg, KLF1, KLF2, KLF4, KLF5) and / or related transcription factors such as NANOG, LIN28, and / or Glis1. Can be produced by introducing. Human iPS cells can also be produced, for example, by the use of miRNAs, small molecules that mimic the actions of transcription factors, or sequence indicators. Human iPS cells are characterized by their ability to differentiate into cells of any of the three vertebrate germ layers, eg, endoderm, ectoderm, or mesoderm. Human iPS cells are also characterized by their ability to reproduce indefinitely under suitable in vitro culture conditions. For example, Takahashi and See Yamanaka (Cell (2006) Vol.126 (4), pp.663-676).

0400The terms "naive" and "prime" identify different pluripotent states of human iPS cells. The term "naive-like" identifies cells that exhibit a state of pluripotency that is characteristic of one or more of the naive pluripotent cells. Naive-like human iPS cells can also be referred to as "naive-like" human iPS cells. In some embodiments, naive-like human iPS cells exhibit one or more morphological features of naive human iPS cells, such as morphology characterized by small dome-shaped colonies. In some embodiments, naive-like human iPS cells exhibit one or more of the pluripotency markers described herein. In some embodiments, the naive or naive-like human iPS cells are naive human iPS cells. In other embodiments, the naive or naive-like human iPS cells are naive-like iPS cells.

0401Naive and prime iPS cells have been described in the art. See, for example, Nichols and Smith (Cell Stem Cell (2009) Vol.4 (6), pp.487-492). Naive human iPS cells exhibit a pluripotent state similar to that of ES cells in the inner cell mass of the embryo before implantation. Such naive cells are not prime for phylogenetic specificity and involvement. Female naive iPS cells are characterized by two active X chromosomes. In culture, the self-renewal of naive human iPS cells depends on leukemia inhibitory factor (LIF) and other inhibitors. Cultured naive human iPS cells exhibit a clonal morphology characterized by a round dome-shaped colony and a lack of apical polarity. Cultured naive cells may further exhibit one or more pluripotency markers as described elsewhere herein. Under suitable conditions, the doubling time of naive human iPS cells in culture can be 16-24 hours.

0402Prime human iPS cells exhibit a pluripotent state similar to that of post-implantation blastoderm cells. Such cells are prime for phylogenetic specificity and involvement. Female prime iPS cells are characterized by one active X chromosome and one inactive X chromosome. In culture, the self-renewal of prime human iPS cells depends on fibroblast growth factor (FGF) and activin. Cultured prime human iPS cells exhibit a clonal morphology characterized by an epithelial monolayer and exhibit low apical polarity. Under suitable conditions, the doubling time of prime human iPS cells in culture can be 24 hours or more.

0403In one embodiment, human iPS cells can be derived from non-pluripotent cells transformed to exhibit a pluripotent state. Such transformed cells include, for example, cells that have been transformed to express a reprogramming gene that induces pluripotency. The pluripotency state can include, for example, expression of one or more of the pluripotency markers described herein. Such cells (such as human foreskin fibroblasts) can be transformed to express the reprogramming gene or any additional gene of interest by any means known in the art. See, for example, Takahashi and Yamanaka (Cell (2006) Vol.126 (4), pp.663-676). For example, they are one or more plasmids, lentviral vectors. Vector) , or can be introduced into cells using a retroviral vector. In some cases, these vectors can be integrated into the genome and removed after reprogramming is complete. In certain embodiments, non-pluripotent cells are transformed with a reprogramming gene that includes Oct4, Sox2, Klf4, Myc, or any combination thereof. In some examples, transformed cells include prime human iPS cells.

0404In some embodiments, human iPS cells cultured in the low osmolality medium described herein exhibit one or more phenotypes, gene expression profiles, or naive state marker characteristics. In one example, human iPS cells exhibit one or more pluripotent markers whose expression indicates a naive state. Such pluripotency markers include alkaline phosphatase, NANOG, 5T4, ABCG2, activin RIB / ALK-4, activin RIIB, E-cadherin, Cbx2, CD9, CD30 / TNFSF8, CD117 / c-kit, CDX2, CHD1, Cripto, DNMT3B, DPPA2, DPPA4, DPPA5 / ESG1, EpCAM / TROP1, ERR beta / NR3B2, ESGP, F-box protein 15 / FBXO15, FGF-4, FGF-5, FoxD3, GBX2, GCNF / NR6A1, GDF-3 , Gi24 / VISTA / B7-H5, Integrin Alpha 6 / CD49f, Integrin Alpha 6 Beta 1, Integrin Alpha 6 Beta 4, Integrin Beta 1 / CD29, KLF4, KLF5, L1TD1, Lefty, Lefty-1, Lefty-A, LIN -28A, LIN-28B, LIN-41, cMaf, cMyc, Oct-3 / 4, Oct-4A, Podocalixin, Rex-1 / ZFP42, Smad2, Smad2 / 3, SOX2, SSEA-1, SSEA-3, SSEA May include -4, STAT3, Stella / Dppa3, SUZ12, TBX2, TBX3, TBX5, TERT, TEX19, TEX19.1, THAP11, TRA-1-60 (R), TROP-2, UTF1, and / or ZIC3 it can. In certain examples, the pluripotency markers expressed are alkaline phosphatase, NANOG, or both.

0405In another embodiment, human iPS cells cultured in the low osmolality medium described herein exhibit morphological features that exhibit a naive state. The exemplary morphology is characterized by cells with small dome-shaped colonies in culture.

0406In another embodiment, human iPS cells cultured in the low osmolality medium described herein are mechanically or enzymatically dissociated into a suspension of single cells, passaged and / or passaged. Can be subcultured. In one example, enzymatic dissociation can be performed with trypsin. When cultured in the low osmolal medium of the present invention, human iPS cells can provide greater transformation efficiency due to the enhanced dissociation of single cells into suspensions. Dissociation of human iPS cells can be performed mechanically or with trypsin using other types of medium commonly used to maintain human iPS cells in culture (eg, mTeSR medium or 2i medium). It must be done with less potent enzymes such as collagenase. As a result, cells are not dissociated very efficiently or completely. In contrast, trypsin can be used to dissociate cells using the low osmolality medium of the invention, with enhanced dissociation resulting in increased transformation efficiency. Moreover, unlike other types of media commonly used to maintain human iPS cells in culture (eg, mTeSR medium or 2i medium), the low osmolality medium of the invention (preferably). Enzyme dissociation of human iPS cells cultured in medium with low osmolality without bFGF) is performed in the absence of one or more inhibitors normally required for passage of such cells. It can be done. An exemplary inhibitor that can be excluded is a Rho-related protein kinase (ROCK) inhibitor. ROCK inhibitors are usually required when substituting human iPS cells to inhibit activation of the pro-apoptotic pathway.

0407In a further embodiment, subcultured human iPS cells cultured in the low osmolality medium described herein can maintain a naive or naive-like state after enzyme dissociation and subculture. In some examples, subcultured human iPS cells may continue to exhibit the morphology characterized by small dome-shaped colonies. Subcultured human iPS cells may also continue to express those described herein or pluripotent markers.

0408C. Methods for creating and maintaining populations of human-induced pluripotent stem cells Methods and compositions for producing human iPS cells in in vitro cultures are provided. Further provided are methods and compositions for maintaining human iPS cells in in vitro cultures.

0409The term "manufacturing" refers to changes in cell phenotype, gene expression, or both, such that the cell exhibits a naive or naive-like state, i.e., one or more characteristics of naive human iPS cells. Includes culturing non-pluripotent cells transformed to express one or more of the reprogramming factors described herein under conditions suitable for inducing. Naive or naive-like conditions can be expressed in response to specific culture conditions, eg, culture in the low osmolality medium described herein. In some examples, the proportion of cells representing a naive or naive-like state is at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% of the cells in culture. , And up to 100%.

0410In one embodiment, the method increases in vitro cultures in a naive or naive-like population of human iPS cells. In such embodiments, naive or naive-like human iPS cells can be preferentially propagated in culture over cells that do not represent a naive or naive-like state. In another embodiment, naive or naive-like human iPS cells are selected from cultures, enzymatically dissociated, and subcultured to produce a enriched population of naive or naive-like human iPS cells. Can be.

0411In one embodiment, non-pluripotent cells transformed to represent a pluripotent state are at least 1 day, 2 days, 5 days, 7 days, 10 days, 14 days, 21 days, or 28 days. The cultures provided herein suitable for inducing the expression of naive or naive-like states during the period of, or for any period sufficient to induce naive or naive-like expression in the culture. In vitro cultured in an object. Transformed cells can be cultured in the medium of the invention for at least 1 week, 2 weeks, 3 weeks, or 4 weeks. Occasionally, transformed cells are cultured for 1-4 weeks. The expression of a naive or naive-like state can be determined by observing the expression of morphological or pluripotent markers, the characteristics of a naive or naive-like state described elsewhere herein. ..

0412In one embodiment, non-pluripotent cells transformed to express a pluripotent state are cultured in a medium of low osmolality of the invention until they develop the characteristics of a naive or naive-like state. To. The cells can then be cultured in the medium of the invention to maintain a naive or naive-like state. In another embodiment, the non-pluripotent cells transformed to express the pluripotent state are first in a high osmolality medium prior to culturing in the low osmolality medium of the invention. Is cultured in. Such high osmolality media may exhibit higher osmolality than the low osmolality media of the invention and may contain bFGF. Some high osmolal media contain one or more of bovine serum albumin, bFGF, transforming growth factor β (TGFβ), lithium chloride, pipecolic acid, and gamma-aminobutyric acid (GABA). Examples of media with high osmolality include mTeSR medium (Stemcell Technologies).

0413In some embodiments, non-pluripotent cells transformed to express a pluripotent state first begin to exhibit the characteristics of a naive or naive-like state, and the cells have a low osmolal concentration of the invention. Can be mediumd in high osmolal medium containing bFGF until cultured in medium. In one example, cells are at least 1 day, 2 days, 5 days, 10 days, 30 days, 60 days, or 90 days, 1 week, 2 weeks, 4 weeks, 8 weeks, or 12 weeks, or 1 It can be cultured in a medium with high osmolality containing bFGF for a period of days to 3 months. An exemplary period of culture in a medium with high osmolality containing bFGF is 2 months.

0414In other embodiments, non-pluripotent cells transformed to express a pluripotent state first begin to exhibit morphology characterized by three-dimensional cell clumps, where the cells are low in the invention. It can be cultured in a high osmolality medium containing bFGF until it is cultured in an osmolality medium. In such embodiments, cells exhibiting a three-dimensional mass are selected, dissociated (eg, with trypsin) and transferred to a new culture in the low osmolality medium described herein. Can be done.

0415The terms "maintain", "maintain", and "maintain" include the maintenance of at least one or more of the characteristics or phenotypes of human iPS cells described herein. Such features may include maintaining the pluripotency, cell morphology, gene expression profile, and / or other functional features of naive cells. The terms "maintain", "maintain", and "maintain" can also include cell proliferation and / or an increase in the number of cultured naive cells. These terms include culture conditions that prevent cells from transforming into a prime or non-pluripotent state. These terms allow cells to retain pluripotency and / or naive, but further include culture conditions in which cells divide and may or may not continue to increase in number.

0416In one embodiment, human iPS cells are cultured in vitro in the medium provided herein, which is suitable for maintaining such cells in a naive or naive-like state. In certain examples, human iPS cells were cultured for 1, 2, 5, 7, 10, 14, 21, or 28 days, or for a period of about 2, about 3, about 4, or more. As long as the cells are maintained in a naive or naive-like state, they can be cultured in a suitable medium. Cells can be cultured for at least 1, 2, 3, or 4 weeks. Occasionally, cells are cultured for 1-4 weeks. Human iPS cells can be maintained, for example, for any period sufficient for cell proliferation, genetic modification of cells, and / or subculture of cells in the medium.

0417In another embodiment, human iPS cells or non-pluripotent cells transformed to express a pluripotent state can be cultured on a substrate or feeder cell layer suitable for in vitro culture. In certain examples, cells are cultured on MATRIGEL (BD Biosciences). In another example, cells are cultured on feeder cells of neonatal human foreskin fibroblasts (NuFF). In another example, cells are cultured on GELTREX (Life Technologies).

0418In a further embodiment, the doubling time of human iPS cells cultured in the low osmolality medium of the invention is compared to prime human iPS cells or non-pluripotent cells transformed to express pluripotent states. To be reduced. In certain examples, the doubling time of human iPS cells of the invention is 16-24 hours.

04197. Sequence identity The methods and compositions provided herein are various different elements of the genomic integration system of interest (ie, nuclease agent, recognition site, inserted nucleic acid, polynucleotide of interest, targeting vector, selectable marker, and Other elements) are used. It is recognized throughout this description that some elements of the genomic integration system of interest may have active variants and fragments. Such elements include, for example, a nuclease agent (ie, a genetically engineered nuclease agent), a recognition site for the nuclease agent, a polynucleotide of interest, a target site, and a corresponding homology arm of the targeting vector. Biological activity in each of these elements is described elsewhere herein.

0420As used herein, the terms "sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences are the same when aligned for maximum matching in a particular comparison window. Refers to the residues in the two sequences. When a percentage of sequence identity is used with respect to a protein, non-identical residue positions are often replaced with other amino acid residues in which the amino acid residue has similar chemical properties (eg, charged or hydrophobic). Therefore, it is recognized that it depends on the conserved amino acid substitution, which does not change the functional properties of the molecule. If the sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitutions. Sequences that differ due to such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically, this relates to scoring conservative permutations as partial inconsistencies rather than complete inconsistencies, thereby increasing percentage sequence identity. So, for example, if the same amino acid is given a score of 1 and the non-conservative substitution is given a score of zero, the conservative substitution is given a score between zero and one. Conservation and replacement scoring is calculated, for example, as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).

0421As used herein, "percentage of sequence identity" means a value determined by comparing two optimally aligned sequences in a comparison window, the polynucleotide sequence within that comparison window. The portion of may contain additions or deletions (ie, gaps) as compared to reference sequences (without additions and deletions) for optimal alignment of the two sequences. The percentage determines the number of positions where the same nucleobase or amino acid residue is found in either sequence, determines the number of matching positions, divides the number of matching positions by the total number of positions in the comparison window, and the result is Calculated by multiplying by 100 to get the percentage of sequence identity.

0422Unless otherwise stated, sequence identity / similarity values provided herein are values obtained using GAP Version 10 with the following parameters, or any equivalent program thereof. Refers to: 50 GAP weights and 3 length weights, as well as nucleotide sequence identity percentages (%) and similarity percentages (%) using the nwsgapdna.cmp scoring matrix, 8 GAP weights and 2 lengths. Weight, as well as amino acid sequence identity percentage (%) and similarity percentage (%) using the BLOSUM62 scoring matrix. The "equivalent program" is the same nucleotide or amino acid residue match and the same sequence identity compared to the corresponding alignment generated by GAP Version 10 for any two sequences in question. Means any sequence comparison program that produces alignments with proportions.

0423Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Any method and material similar to or equivalent to that described herein can be used in the practice or testing of the present invention, but preferred methods and materials are described below. All publications referred to herein are incorporated herein by reference to disclose and describe the methods and / or materials by which the publications are cited in the context thereof.

0424As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural references unless the context clearly indicates otherwise. All technical and scientific terms used herein have the same meaning.

0425The publications discussed herein are provided solely for their disclosure prior to the filing date of this application. It is not to be construed herein as an approval that the present invention is not entitled to precede such publications for reasons of prior invention. In addition, the dates of publications provided may differ from the actual publication dates, which may need to be confirmed independently.

0426The present invention may be practiced in other particular embodiments without departing from its spirit or essential features, and thus references are attached, not by description above, to indicate the scope of the invention. Should be within the scope of the claims.

0427Non-limiting embodiments include:

04281. A method for target modification of a genomic locus of interest in pluripotent rat cells, in which (a) pluripotent rat cells are flanked by 5'rat homology arms and 3'rat homology arms. Introducing a large targeting vector (LTVEC) containing the inserted nucleic acid to be introduced, wherein the sum of the 5'and 3'homologous arms is at least 10 kb but less than 150 kb. b) Identifying genetically modified pluripotent rat cells containing the target gene modification at the genomic locus of interest, including the transmission of the target gene modification through the germline. The method that can be done.

04292. The method according to embodiment 1, wherein the target gene modification is a two allele.

04303. The method according to embodiment 1 or 2, wherein the pluripotent rat cell is a rat embryonic stem (ES) cell.

04314. The method according to embodiment 1, 2 or 3, wherein the pluripotent rat cell is derived from a DA strain or an ACI strain.

04325. The pluripotent rat cells contain Dnmt3L, Eras, Err-beta, Fbxo15, Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15, Sox2, Utf1 or a combination thereof. The method according to any one of embodiments 1 to 4, characterized by expression of at least one pluripotency marker.

04336. The pluripotent rat cells (a) Lack of expression of one or more pluripotency markers, including c-Myc, Ecat1, and / or Rexo1, (b) Lack of expression of mesoderm markers, including Brachyury and / or Bmpr2, (c) Gata6 , Sox17, and / or lack of expression of one or more endoderm markers, including Sox7, or (d) lack of expression of one or more neural markers, including Nestin and / or Pax6. The method according to any one of embodiments 1 to 4, characterized by.

04347. The total of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 30 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb. The method according to any one of embodiments 1 to 6, wherein the method is 100 kb to about 120 kb, or about 120 kb to 150 kb.

04358. The method according to any one of embodiments 1-6, wherein the total of the 5'and 3'homology arms of the LTVEC is from about 16 kb to about 150 kb.

04369. The target gene modification is (a) replacement of an endogenous rat nucleic acid sequence with a homologous or orthologous nucleic acid sequence, (b) deletion of an endogenous rat nucleic acid sequence, and (c) deletion of an endogenous rat nucleic acid sequence. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb , About 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb Deletion of endogenous rat nucleic acid sequences ranging from ~ about 3 Mb, (d) about 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, Extrinsic nucleic acids ranging from about 80 kb to about 100 kb, about 100 kb to about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. Sequences, (e) exogenous nucleic acid sequences containing homologous or orthologous nucleic acid sequences, (f) chimeric nucleic acid sequences containing human and rat nucleic acid sequences, (g) conditional allelic genes flanked by site-specific recombinase target sequences, or ( h) The method according to any one of embodiments 1-8, comprising a reporter gene operably linked to an active promoter in rat cells.

043710. The genomic locus of interest is (i) a first nucleic acid sequence homologous to the 5'rat homology arm, and (ii) a second nucleic acid sequence homologous to the 3'rat homology arm. The method according to any one of embodiments 1 to 9, wherein the method comprises.

043811. The method of embodiment 10, wherein the first and second nucleic acid sequences are at least 5 kb, but separated by less than 3 Mb.

043912. The first and second nucleic acid sequences are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb. Is less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb but less than about 400 kb, At least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but about 2.5 The method of embodiment 10, wherein the method is less than Mb, or at least about 2.5 Mb but less than about 3 Mb apart.

044013. Introduction step (a) introduces a second nucleic acid encoding a nuclease agent that promotes homologous recombination between the targeted construct and the genomic locus of interest in the pluripotent rat cell. The method according to any one of embodiments 1 to 12, further comprising the above.

044114. The nuclease agent contains (a) a chimeric protein containing a zinc finger-based DNA-binding domain that is fused to a FokI endonuclease, or (b) a transcriptional activation-like effector nuclease (TALEN) that is fused to a FokI endonuclease. 13. The method of embodiment 13, comprising a chimeric protein comprising.

044215. Introductory step (a) operably ligates the pluripotent rat cell to (i) a first nucleic acid sequence encoding a clustered regular interspersed short parindrome repeat (CRISPR) -related (Cas) protein. Introduce a first expression construct containing the first promoter, (ii) a second expression construct containing a second promoter operably linked to a genomic target sequence linked to a guide RNA (gRNA). The method according to any one of embodiments 1 to 12, further comprising the above, wherein the genomic target sequence is immediately flanked by a promoter flanking motif (PAM) sequence on the 3'end.

044316. The method of embodiment 15, wherein the genomic locus of interest comprises the nucleotide sequence of SEQ ID NO: 1.

044417. The gRNA according to embodiment 15 or 16, wherein the gRNA comprises a third nucleic acid sequence encoding a clustered regular interspersed short palindrome repeat (CRISPR) RNA (crRNA) and a transactivated CRISPR RNA (tracrRNA). The method of.

044518. The method according to embodiment 15, 16 or 17, wherein the Cas protein is Cas9.

044619. In embodiments 15, 16, 17, or 18, the gRNA comprises (a) the chimeric RNA of the nucleic acid sequence of SEQ ID NO: 2, or (b) the chimeric RNA of the nucleic acid sequence of SEQ ID NO: 3. The method described.

044720. The method of embodiment 17, wherein the crRNA comprises SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

044821. The method of embodiment 17, wherein the tracrRNA comprises SEQ ID NO: 7 or SEQ ID NO: 8.

044922. Modified rat genomic loci, (i) insertion of homologous or orthologous human nucleic acid sequences, (ii) substitution of endogenous rat nucleic acid sequences with homologous or orthologous human nucleic acid sequences, or (iii) them. A modified rat genomic locus that contains a combination of and can be transmitted through the germline.

045023. The modified rat genomic locus according to embodiment 22, wherein the size of the insertion or substitution is from about 5 kb to about 400 kb.

045124. The size of the insertion or substitution is about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb ~. The rat genomic locus according to embodiment 22, which is about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb.

045225. A method for producing humanized rats that has been genetically modified to target the genomic locus of interest in pluripotent rat cells using (a) a targeted construct containing human nucleic acids. Forming pluripotent rat cells, (b) introducing the genetically modified pluripotent rat cells into a host rat embryo, and (c) conceiving the host rat embryo in a surrogate mother. And, the surrogate mother is (i) inserting a human nucleic acid sequence, (ii) substituting a rat nucleic acid sequence at a genomic locus of interest with a homologous or orthologous human nucleic acid sequence, (iii) humans and rats. A chimeric nucleic acid sequence containing a nucleic acid sequence, or (iv) a combination thereof, produces rat progeny containing a modified genomic locus, and the modified genomic locus can be transmitted through the germline. ,Method.

045326. The targeting construct is a large targeting vector (LTVEC), wherein the sum of the 5'and 3'homology arms of the LTVEC is at least 10 kb but less than 150 kb, as described in embodiment 25. The method of.

045427. The sum of the 5'and 3'homology arms of the targeted construct is about 10 kb to about 30 kb, about 20 kb to 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, or about 80 kb to about 100 kb. The method according to embodiment 26, wherein the method is about 100 kb to about 120 kb, or about 120 kb to 150 kb.

045528. The method of embodiment 25, 26, or 27, wherein the human nucleic acid sequence is at least 5 kb but less than 400 kb.

045629. The human nucleic acid sequence is at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb but less than 80 kb, at least about. 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, at least 150 kb but less than 200 kb, at least 200 kb but less than 250 kb, at least 250 kb but less than 300 kb, at least 300 kb but less than 350 kb, or at least 350 kb 25, 26, or 27, wherein the method is, but less than 400 kb.

045730. The method according to any one of embodiments 25-29, wherein the pluripotent rat cell is a rat embryonic stem (ES) cell.

045831. The method according to any one of embodiments 25-30, wherein the pluripotent rat cell is derived from a DA strain or an ACI strain.

045932. The pluripotent rat cells contain Dnmt3L, Eras, Err-beta, Fbxo15, Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15, Sox2, Utf1 or a combination thereof. The method according to any one of embodiments 25-31, characterized by expression of at least one pluripotency marker.

046033. One pluripotent rat cell containing (a) lack of expression of one or more pluripotency markers, including c-Myc, Ecat1, and / or Rexo1, and (b) Brachyury and / or Bmpr2. Lack of expression of the above mesoderm markers, (c) lack of expression of one or more endoderm markers including Gata6, Sox17, and / or Sox7, or (d) one or more including Nestin and / or Pax6 The method according to any one of embodiments 25-31, characterized by one or more of the characteristics of lack of expression of a neural marker.

046134. Modified rats containing the humanized genomic locus, the humanized genomic locus being (i) inserted into a homologous or orthologous human nucleic acid sequence, (ii) endogenous by the homologous or orthologous human nucleic acid sequence. Substitution of rat nucleic acid sequences at sex genomic loci, (iii) chimeric nucleic acid sequences containing human and rat nucleic acid sequences, or (iv) combinations thereof, the humanized genomic locus being transmitted through the germline. A modified rat that can be.

046235. A rat or rat cell containing a target gene modification at the genomic locus of the rat or rat cell, the genomic locus being the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 gene. The locus, or Rag2 / Rag1 locus, the target gene modification is (a) deletion of an endogenous rat nucleic acid sequence at the genomic locus, (b) a homologous nucleic acid, including human and rat nucleic acid sequences. The rat or rat, comprising the insertion of a nucleic acid, or chimeric nucleic acid, or (c) a combination thereof, the target gene modification can be transmitted through the germline of the rat or rat propagated from the rat cell. cell.

046336. (a) the deletion of the endogenous rat nucleic acid at the genomic locus is at least about 10 kb, or (b) the deletion of the endogenous rat nucleic acid at the genomic locus. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ about 3Mb and (c) the insertion of the exogenous nucleic acid sequence at the genomic locus is at least about 5 kb, or (d) the insertion of the exogenous nucleic acid sequence at the genomic locus is About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, about 150 kb ~ about 200 kb, about 200 kb The rat or rat cell according to embodiment 35, which is ~ about 250 kb, about 250 kb ~ about 300 kb, about 300 kb ~ about 350 kb, or about 350 kb ~ about 400 kb.

046437. (a) Does the target gene modification at the interleukin-2 receptor gamma locus result in diminished or absent interleukin-2 receptor gamma protein activity? (B) The ApoE locus Whether the target gene modification results in a decrease or absence of ApoE protein activity, (c) the target gene modification at the Rag1 locus results in a decrease or absence of Rag1 protein activity, or (d) at the Rag2 locus. The target gene modification of the above results in a decrease or absence of Rag2 protein activity, or (e) the modification of the target gene at the Rag2 / Rag1 locus results in a decrease or absence of Rag2 protein activity and Rag1 activity. The rat or rat cell according to form 35 or 36.

046538. The target gene modification of the interleukin-2 receptor gamma locus is (a) deletion of the entire rat interleukin-2 receptor gamma coding region or a part thereof, (b) human interleukin-2 acceptance. Substitution of the whole rat interleukin-2 receptor gamma coding region or a part thereof by the body gamma coding region or a part thereof, (c) the rat interleukin-2 by the extracellular domain of the human interleukin-2 receptor gamma. The rat or rat cell according to embodiment 35, 36, or 37, comprising substitution of the receptor gamma coding region, or (d) deletion of at least 3 kb of the interleukin-2 receptor gamma locus.

046639. The target gene modification of the ApoE locus is (a) a deletion of all or part of the ApoE coding region, or (b) a deletion of at least 1.8 kb of the ApoE locus containing the ApoE coding region. The rat or rat cell according to any one of embodiments 35 to 37, comprising:

046740. The target gene modification at the Rag2 locus comprises (a) a deletion of the entire Rag2 coding region or a portion thereof, and (b) a deletion of at least 5.7 kb of the Rag2 locus containing the Rag2 coding region. , The rat or rat cell according to any one of embodiments 35-37.

046841. The target gene modification of the Rag2 / Rag1 locus is (a) a deletion of the entire Rag2 coding region or a part thereof and a deletion of the whole Rag1 coding region or a part thereof, or (b) the deletion of the Rag2 coding. The rat or rat cell according to any one of embodiments 35-37, comprising a deletion of at least 16 kb of the Rag2 / Rag1 locus comprising the region.

046942. The target gene modification is an expression cassette containing a selection marker at the interleukin-2 receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2 locus, or the Rag2 / Rag1 locus. The rat or rat cell according to any one of embodiments 35-41, comprising insertion.

047043. Any one of Embodiment 42, wherein the expression cassette comprises an lacZ gene operably linked to the endogenous promoter at the genomic locus and a human ubiquitin promoter operably linked to a selectable marker. The rat or rat cell according to one.

047144. The target gene modification at the interleukin-2 receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2 locus, or the Rag2 / Rag1 locus causes the insertion of a self-deletion selection cassette. The rat or rat cell according to any one of embodiments 35-43, comprising.

047245. The self-deletion selection cassette contains a selectable marker gene operably linked to an active promoter in the rat cell and a recombinant gene operably linked to a male germ cell specific promoter. The rat or rat cell according to embodiment 44, wherein the deletion cassette is flanked by a recombinant recognition site recognized by the recombinase.

047346. (a) The male germ cell-specific promoter is a protamine-1 promoter, or (b) the recombinase gene encodes Cre and the recombinant recognition site is a loxP site, as described in embodiment 45. The rat or rat cell of.

047447. The insertion of the exogenous nucleic acid sequence at the genomic locus is operably linked to an endogenous interleukin-2 receptor gamma promoter, an endogenous ApoE promoter, an endogenous Rag1 promoter, or an endogenous Rag2 promoter. The rat or rat cell according to any one of embodiments 35-46, comprising the reporter nucleic acid.

047548. The reporter nucleic acid is β-galactosidase, mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet, high-sensitivity yellow fluorescent protein (EYFP), emerald, high-sensitivity green fluorescent protein. The rat or rat according to embodiment 47, which encodes a reporter comprising protein (EGFP), CyPet, cyan fluorescent protein (CFP), azure, T-sapphire, luciferase, alkaline phosphatase, and / or a combination thereof. cell.

047649. The rat cell according to any one of embodiments 35-48, wherein the rat cell is a pluripotent rat cell or a rat embryonic stem (ES) cell.

047750. Whether the pluripotent rat cell or rat embryonic stem (ES) cell is derived from (a) DA strain or ACI strain, or (b) Dnmt3L, Eras, Err-beta, Fbxo15, Fgf4, Gdf3, Klf4 , Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15, Sox2, Utf1, or a combination thereof, characterized by the expression of at least one pluripotency marker, or (c) (i) c-Myc , Ecat1, and / or lack of expression of one or more pluripotency markers, including Rexo1, (ii) lack of expression of mesodermal markers, including Brachyury and / or Bmpr2, (iii) Gata6, Sox17, and / or Characterized by one or more of the characteristics of lack of expression of one or more endoderm markers, including Sox7, or (iv) lack of expression of one or more neural markers, including Nestin and / or Pax6. The rat cell according to embodiment 49.

047851. A method for modifying the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 locus, or target genomic locus at the Rag2 / Rag1 locus in pluripotent rat cells. (A) Introducing into the pluripotent rat cell a targeting vector containing an inserted nucleic acid flanked by 5'and 3'rat homologous arms homologous to the target genomic locus, and ( b) Identifying genetically modified pluripotent rat cells containing the target gene modification at the target genomic locus, the target gene modification of a rat propagated from the pluripotent rat cell. The method, which can be transmitted through the germline.

047952. The targeting vector according to embodiment 51, wherein the targeting vector is a large targeting vector (LTVEC) and the sum of the 5'and 3'rat homology arms is at least about 10 kb but less than about 150 kb. The method.

048053. Introduction of the targeting vector into the pluripotent rat cell is (i) deletion of the endogenous rat nucleic acid sequence at the target genomic locus, (ii) exogenous nucleic acid at the target genomic locus. The method according to embodiment 51 or 52, which results in the insertion of sequences, or (iii) a combination thereof.

048154. (a) the deletion of the endogenous rat nucleic acid at the genomic locus is at least about 10 kb, or (b) the deletion of the endogenous rat nucleic acid at the genomic locus. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ about It is 3Mb and (c) the insertion of the exogenous nucleic acid sequence at the genomic locus is at least about 5 kb, or (d) the insertion of the exogenous nucleic acid sequence at the genomic locus is. About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, about 150 kb ~ about 200 kb, about 200 kb The method of embodiment 53, wherein the method is ~ about 250 kb, about 250 kb ~ about 300 kb, about 300 kb ~ about 350 kb, or about 350 kb ~ about 400 kb.

048255. (a) Does the target gene modification at the interleukin-2 receptor gamma locus result in diminished or absent interleukin-2 receptor gamma protein activity? (B) The ApoE locus Whether the target gene modification results in a decrease or absence of ApoE protein activity, (c) the target gene modification at the Rag1 locus results in a decrease or absence of Rag1 protein activity, or (d) at the Rag2 locus. The modification of the target gene results in a decrease or absence of Rag2 protein activity, or (e) the modification of the target gene at the Rag2 / Rag1 locus results in a decrease or absence of Rag2 protein activity and i Rag1 protein activity. , The method according to any one of embodiments 51 to 54.

048356. The target gene modification of the interleukin-2 receptor gamma locus is (a) deletion of the whole rat interleukin-2 receptor gamma coding region or a part thereof, (b) human interleukin-2. Substitution of the entire rat interleukin-2 receptor gamma coding region or a portion thereof by the receptor gamma coding region or a part thereof, (c) the rat interleukin by the extracellular domain of the human interleukin-2 receptor gamma. Embodiment 51 ~, comprising substitution of the -2 receptor gamma coding region, or (d) deletion of at least 3 kb of the interleukin-2 receptor gamma locus containing the interleukin-2 receptor gamma coding region. The method according to any one of 54.

048457. The target gene modification of the ApoE locus is (a) a deletion of the entire ApoE coding region or a part thereof, and (b) a deletion of at least 1.8 kb of the ApoE locus containing the ApoE coding region. The method according to any one of embodiments 51-55, comprising.

048558. The target gene modification at the Rag2 locus is (a) a deletion of the entire Rag2 coding region or a portion thereof, or (b) a deletion of at least 5.7 kb of the Rag2 locus containing the Rag2 coding region. The method according to any one of embodiments 51 to 55, comprising:

048659. The target gene modification at the Rag1 / Rag2 locus is (a) a deletion of the entire Rag2 coding region or part thereof and a deletion of the entire Rag1 coding region or part thereof, or (b) the deletion of the Rag2 And the method according to any one of embodiments 51-55, comprising deleting at least 16 kb of the Rag2 / Rag1 locus comprising the Rag1 coding region.

048760. The method of any one of embodiments 51-59, wherein the inserted nucleic acid comprises an expression cassette containing a polynucleotide encoding a selectable marker.

048861. The expression cassette according to embodiment 60, wherein the expression cassette comprises a lacZ gene operably linked to an endogenous promoter at the genomic locus and a human ubiquitin promoter operably linked to a selectable marker gene. Method.

048962. The method according to any one of embodiments 51-60, wherein the inserted nucleic acid comprises a self-deletion selection cassette.

049063. The self-deletion selection cassette encodes a selectable marker gene operably linked to an active promoter in the rat pluripotent cell and a recombinase operably linked to a male germ cell-specific promoter. The method of embodiment 62, wherein the self-deletion selection cassette comprises a polynucleotide and is flanked by a recombinant recognition site recognized by the recombinase.

049164. (a) The male germ cell-specific promoter is a protamine-1 promoter, or (b) the recombinase gene encodes Cre and the recombinant recognition site is a loxP site, as described in embodiment 63. The method of.

049265. The insertion of the exogenous nucleic acid sequence at the genomic locus is operably linked to an endogenous interleukin-2 receptor gamma promoter, an endogenous ApoE promoter, an endogenous Rag1 promoter, or an endogenous Rag2 promoter. The method according to embodiment 53, which comprises a reporter nucleic acid.

049366. The reporter nucleic acid sequence is β-galactosidase, mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet, sensitive yellow fluorescent protein (EYFP), emerald, sensitive green. 25. The method of embodiment 65, which encodes a reporter comprising fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP), azure, T-sapphire, luciferase, alkaline phosphatase, or a combination thereof.

049467. The method according to any one of embodiments 51-66, wherein the pluripotent rat cell is a rat embryonic stem (ES) cell.

049568. The pluripotent rat cells are derived from (a) DA or ACI strains, or (b) expression of pluripotency markers containing Oct-4, Sox-2, alkaline phosphatase, or a combination thereof. Mesoderm characterized by (i) lack of expression of one or more pluripotency markers, including (c) (i) c-Myc, Ecat1, and / or Rexo1, (ii) Brachyury and / or Bmpr2 Lack of marker expression, (iii) lack of expression of one or more endoderm markers, including Gata6, Sox17, and / or Sox7, or (iv) expression of one or more neural markers, including Nestin and / or Pax6. The method according to any one of embodiments 51-67, characterized by one of the characteristics of the lack of.

049669. The specific step further comprises identifying the target gene modification at the target genomic locus, and the specific step uses a quantitative assay to assess the modification of the allele (MOA) at the target genomic locus. , The method according to any one of embodiments 51 to 68.

049770. Introduction step (a) is to introduce a second nucleic acid encoding a nuclease agent that promotes homologous recombination between the targeting vector and the target genomic locus in the pluripotent rat cell. The method according to any one of embodiments 51 to 69, further comprising.

049871. The method of embodiment 70, wherein the nuclease agent comprises a chimeric protein comprising a zinc finger-based DNA binding domain fused to a FokI endonuclease.

049972. The method according to embodiment 71, wherein the method results in genetic modification of two alleles at the target genomic locus.

050073. Introduction step (a) operably links to the pluripotent rat cell to (i) a first nucleic acid sequence encoding a clustered regular interspersed short parindrome repeat (CRISPR) -related (Cas) protein. Introduce a first expression construct containing the first promoter, (ii) a second expression construct containing a second promoter operably linked to a genomic target sequence linked to a guide RNA (gRNA). The method according to any one of embodiments 51 to 70, wherein the genomic target sequence is immediately flanked by a promoter flanking motif (PAM) sequence on the 3'end.

050174. The method of embodiment 73, wherein the genomic locus of interest comprises the nucleotide sequence of SEQ ID NO: 1.

050275. The gRNA according to embodiment 73 or 74, wherein the gRNA comprises a third nucleic acid sequence encoding a clustered regular interspersed short palindrome repeat (CRISPR) RNA (crRNA) and a transactivated CRISPR RNA (tracrRNA). The method of.

050376. The method according to embodiment 73, wherein the Cas protein is Cas9.

050477. The gRNA according to embodiment 73, 74, or 75, wherein the gRNA comprises (a) the chimeric RNA of the nucleic acid sequence of SEQ ID NO: 2 or (b) the chimeric RNA of the nucleic acid sequence of SEQ ID NO: 3. The method.

050578. The method of embodiment 75, wherein the crRNA comprises SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

050679. The method of embodiment 75, wherein the tracrRNA comprises SEQ ID NO: 7 or SEQ ID NO: 8.

050780. In embodiments 35-50, comprising target gene modification at the interleukin-2 receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2 locus, and / or the Rag2 / Rag1 locus. The rat or rat cell according to any one.

050881. The rat or rat cell according to embodiment 80, which comprises a target gene modification at the interleukin-2 receptor gamma locus and / or the Rag2 / Rag1 locus.

0509Further non-limiting embodiments include:

05101. A method for modifying a genomic locus of interest in a eukaryotic cell, which is (a) to the eukaryotic cell, (i) at least 10 kb, 5'homologous arm and 3'homologous arm. A large targeting vector (LTVEC) containing an adjacent first nucleic acid, (ii) a first expression construct containing a first promoter operably linked to a second nucleic acid encoding a Cas protein, (iii) A second promoter operably linked to a third nucleic acid encoding a guide RNA (gRNA) containing a nucleotide sequence that hybridizes to the target sequence and a trans-activated CRISPR RNA (tracrRNA). Introducing the expression construct of 2, wherein the first and second promoters are active in eukaryotic cells, including (b) target gene modification at the genomic locus of interest. , The method comprising identifying a modified eukaryotic cell.

05112. The method according to embodiment 1, wherein the target gene modification is a gene modification of two alleles.

05123. The method according to embodiment 1, wherein the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb.

05134. The method according to embodiment 1, wherein the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb.

05145. The method according to embodiment 1, wherein the eukaryotic cell is a mammalian cell.

05156. The method according to embodiment 5, wherein the mammalian cell is a fibroblast.

05167. The method according to embodiment 1, wherein the eukaryotic cell is a pluripotent cell.

05178. The method according to embodiment 7, wherein the pluripotent cell is a human pluripotent cell.

05189. The method according to embodiment 8, wherein the human pluripotent cell is a human embryonic stem (ES) cell or a human adult stem cell.

051910. The method according to embodiment 8, wherein the human pluripotent cell is a developmentally restricted human progenitor cell.

052011. The method according to embodiment 8, wherein the human pluripotent cell is a human-induced pluripotent stem (iPS) cell.

052112. The method according to embodiment 1, wherein the Cas protein is Cas9.

052213. The method according to embodiment 1, wherein the target sequence is immediately flanked by a protospacer flanking motif (PAM) sequence on the 3'end.

052314. The method according to embodiment 1, wherein the sum of the 5'and 3'homology arms is from about 10 kb to about 150 kb.

052415. The total of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb. The method according to embodiment 1, wherein the method is 100 kb to about 120 kb, or about 120 kb to 150 kb.

052516. The target gene modification is (a) substitution of an endogenous nucleic acid sequence by a homologous or orthologous nucleic acid sequence, (b) deletion of an endogenous nucleic acid sequence, and (c) deletion of an endogenous nucleic acid sequence. 5kb ~ about 10kb, about 10kb ~ about 20kb, about 20kb ~ about 40kb, about 40kb ~ about 60kb, about 60kb ~ about 80kb, about 80kb ~ about 100kb, about 100kb ~ about 150kb, or about 150kb ~ about 200kb, about 200kb ~ About 300kb, About 300kb ~ About 400kb, About 400kb ~ About 500kb, About 500kb ~ About 1Mb, About 1Mb ~ About 1.5Mb, About 1.5Mb ~ About 2Mb, About 2Mb ~ About 2.5Mb, or About 2.5Mb ~ About 3Mb Endogenous nucleic acid sequence deletion, (d) exogenous nucleic acid sequence insertion, (e) about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, Range of about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. (F) Insertion of exogenous nucleic acid sequences including homologous or orthologous nucleic acid sequences, (g) Insertion of chimeric nucleic acid sequences including human and non-human nucleic acid sequences, (h) Site-specific Conditional allelic insertions flanked by recombinase target sequences, (i) insertion of selectable marker or reporter genes operably linked to a third promoter active in pluripotent cells, or (j) their The method according to embodiment 1, comprising a combination.

052617. The genomic locus of interest comprises (i) a 5'target sequence homologous to the 5'homologous arm and (ii) a 3'target sequence homologous to the 3'homologous arm. The method according to the first embodiment.

052718. The method of embodiment 17, wherein the 5'and 3'target sequences are at least 5 kb but less than 3 Mb apart.

052819. The 5'target sequence and the 3'target sequence are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb. Less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb but less than about 400 kb At least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but about The method of embodiment 17, wherein the method is less than 2.5 Mb, or at least about 2.5 Mb but less than about 3 Mb apart.

052920. The genomic locus of interest comprises the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 locus, or both the Rag1 locus and the Rag2 locus. The method according to the first embodiment.

053021. The method of embodiment 1, wherein the first and second expression constructs are on a single nucleic acid molecule.

053122. A method for modifying a genome, which comprises exposing the genome to Cas protein and CRISPR RNA in the presence of a large targeting vector (LTVEC) containing a nucleic acid sequence of at least 10 kb. The method, wherein after exposure to the CRISPR RNA, and the LTVEC, the genome is modified to contain a nucleic acid sequence of at least 10 kb.

053223. The method of embodiment 22, wherein the LTVEC comprises a nucleic acid sequence of at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb.

053324. The method of embodiment 22, wherein the LTVEC comprises a nucleic acid sequence of at least 100 kb, at least 150 kb, or at least 200 kb.

053425. A method for modifying a genome, which comprises contacting the genome with Cas protein, a CRISPR RNA that hybridizes to a target sequence, and tracrRNA in the presence of a large targeting vector (LTVEC). After contact with the Cas protein, CRISPR RNA, and tracrRNA in the presence of the LTVEC, where the LTVEC is at least 10 kb and the 5'homologous arm and the 3'homologous arm contain the adjacent first nucleic acid. The method, wherein the genome is modified at the genomic locus of interest to include the first nucleic acid.

053526. The method of embodiment 25, wherein the genome is in a eukaryotic cell and the Cas protein, the CRISPR RNA, the tracrRNA, and the LTVEC are introduced into the eukaryotic cell.

053627. The method of embodiment 26, further comprising identifying a modified eukaryotic cell comprising a target gene modification at the genomic locus of interest.

053728. The method of embodiment 26 or 27, wherein the CRISPR RNA and the tracrRNA are introduced together in the form of a single guide RNA (gRNA).

053829. The method of embodiment 26 or 27, wherein the CRISPR RNA and the tracrRNA are introduced separately.

053930. (a) The Cas protein is introduced into the eukaryotic cell in the form of a protein, a messenger RNA (mRNA) encoding the Cas protein, or a DNA encoding the Cas protein, and (b) the CRISPR RNA , Introduced into the eukaryotic cell in the form of RNA or DNA encoding the CRISPR RNA, and (c) the tracrRNA is introduced into the eukaryotic cell in the form of RNA or DNA encoding the tracrRNA. The method according to any one of forms 26 to 29.

054031. The method of embodiment 30, wherein the Cas protein, the CRISPR RNA, and the tracrRNA are introduced into the eukaryotic cell as a protein-RNA complex.

054132. (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein, (b). ) The DNA encoding the CRISPR RNA is in the form of a second expression construct comprising a second promoter operably linked to a third nucleic acid encoding the CRISPR RNA, and (c) the tracrRNA. The DNA encoding the tracrRNA is in the form of a third expression construct comprising a third promoter operably linked to the fourth nucleic acid encoding the tracrRNA, the first, second, and third. The method of embodiment 30, wherein the promoter is active in the eukaryotic cells.

054233. The method of embodiment 32, wherein the first, second, and / or third expression constructs are on a single nucleic acid molecule.

054334. (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein, and ( b) The DNA encoding the CRISPR RNA and the DNA encoding the tracrRNA comprises a second promoter operably linked to the CRISPR RNA and a third nucleic acid encoding the gRNA containing the tracrRNA. 30. The method of embodiment 30, wherein the first and second promoters are in the form of a second expression construct and are active in the eukaryotic cells.

054435. The method of embodiment 34, wherein the first and second expression constructs are on a single nucleic acid molecule.

054536. Embodiment 27 ~, wherein the target gene modification simultaneously comprises a deletion of an endogenous nucleic acid sequence at the genomic locus of interest and insertion of the first nucleic acid at the genomic locus of interest. The method according to any one of 35.

054637. The method according to any one of embodiments 27-36, wherein the target gene modification is a genetic modification of two alleles.

054738. The said in embodiment 37, wherein the genetic modification of the two alleles comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes and the insertion of the first nucleic acid. Method.

054839. The method according to any one of embodiments 27-36, wherein the modified eukaryotic cell is semizygous at the genomic locus of interest.

054940. The method of embodiment 39, wherein the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of the first nucleic acid.

055041. The target gene modification results in (1) deletion of an endogenous nucleic acid sequence at the target genomic locus on two homologous chromosomes, and (2) to the target genomic locus on the first chromosome. 39. The method of embodiment 39, comprising inserting the first nucleic acid and disrupting the genomic locus of interest on the second chromosome.

055142. The said in any one of embodiments 25-41, wherein the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. Method.

055243. The method according to any one of embodiments 25-42, wherein the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb.

055344. The first nucleic acid is at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, or at least 300 kb. , The method according to any one of embodiments 25 to 43.

055445. The method according to any one of embodiments 26-44, wherein the eukaryotic cell is a mammalian cell.

055546. The method of embodiment 45, wherein the mammalian cell is a fibroblast.

055647. The method according to any one of embodiments 26-43, wherein the eukaryotic cell is a pluripotent cell.

055748. The method of embodiment 47, wherein the pluripotent cell is a non-human pluripotent cell.

055849. The method of embodiment 48, wherein the non-human pluripotent cell is a rodent pluripotent cell.

055950. The method of embodiment 49, wherein the rodent pluripotent cells are mouse or rat embryonic stem (ES) cells.

056051. The method of embodiment 47, wherein the pluripotent cell is a human pluripotent cell.

056152. The method of embodiment 51, wherein the human pluripotent cell is a human embryonic stem (ES) cell or a human adult stem cell.

056253. The method of embodiment 51, wherein the human pluripotent cell is a developmentally restricted human progenitor cell.

056354. The method of embodiment 51, wherein the human pluripotent cell is a human-induced pluripotent stem (iPS) cell.

056455. The method according to any one of embodiments 25-54, wherein the Cas protein is Cas9.

056556. The method according to any one of embodiments 25-55, wherein the target sequence is immediately flanked by a protospacer flanking motif (PAM) sequence.

056657. The method according to any one of embodiments 25-56, wherein the total of the 5'and 3'homology arms of the LTVEC is from about 10 kb to about 150 kb.

056758. The total of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb. The method according to any one of embodiments 25-57, wherein the method is 100 kb to about 120 kb, or about 120 kb to 150 kb.

056859. The target gene modification is (a) homology of an endogenous nucleic acid sequence or replacement with an orthologous nucleic acid sequence, (b) deletion of an endogenous nucleic acid sequence, and (c) deletion of an endogenous nucleic acid sequence. 5kb ~ about 10kb, about 10kb ~ about 20kb, about 20kb ~ about 40kb, about 40kb ~ about 60kb, about 60kb ~ about 80kb, about 80kb ~ about 100kb, about 100kb ~ about 150kb, or about 150kb ~ about 200kb, about 200kb ~ About 300kb, About 300kb ~ About 400kb, About 400kb ~ About 500kb, About 500kb ~ About 1Mb, About 1Mb ~ About 1.5Mb, About 1.5Mb ~ About 2Mb, About 2Mb ~ About 2.5Mb, or About 2.5Mb ~ About 3Mb Endogenous nucleic acid sequence deletion, (d) exogenous nucleic acid sequence insertion, (e) about 5 kb to about 10 kb, about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, Range of about 60 kb to about 80 kb, about 80 kb to about 100 kb, about 100 kb to about 150 kb, about 150 kb to about 200 kb, about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb. (F) Insertion of exogenous nucleic acid sequences including homologous or orthologous nucleic acid sequences, (g) Insertion of chimeric nucleic acid sequences including human and non-human nucleic acid sequences, (h) Site-specific Conditional allelic insertions flanked by recombinase target sequences, (i) insertion of selectable marker or reporter genes operably linked to a third promoter active in pluripotent cells, or (j) their The method according to any one of embodiments 27-58, comprising a combination.

056960. The genomic locus of interest comprises (i) a 5'target sequence homologous to the 5'homologous arm and (ii) a 3'target sequence homologous to the 3'homologous arm. The method according to any one of embodiments 25 to 59.

057061. The method of embodiment 60, wherein the 5'and 3'target sequences are at least 5 kb but less than 3 Mb apart.

057162. The 5'target sequence and the 3'target sequence are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb. Less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb but less than about 400 kb At least about 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but about The method of embodiment 60, wherein it is less than 2.5 Mb, or at least about 2.5 Mb but less than about 3 Mb apart.

057263. The 5'target sequence and the 3'target sequence are at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 110 kb, at least 120 kb, at least 130 kb. The method of embodiment 60, wherein the method is separated by at least 140 kb, at least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at least 190 kb, or at least 200 kb.

057364. The genomic locus of interest comprises the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 locus, or both the Rag1 locus and the Rag2 locus. The method according to any one of forms 25 to 63.

057465. The method according to any one of embodiments 25-63, wherein the genomic locus of interest comprises the Adamts5 locus, the Trpa1 locus, the Fohl1 locus, or the Erbb4 locus.

057566. The method according to any one of embodiments 25-63, wherein the genomic locus of interest comprises the Lrp5 locus.

057667. A method for producing F0 generation non-human animals containing a target gene modification at the genomic locus of interest, (a) a large targeting vector for forming modified non-human ES cells. By contacting the genome in non-human ES cells with Cas protein, CRISPR RNA, and tracrRNA in the presence of (LTVEC), the LTVEC is at least 10 kb, 5'homologous arm and 3'homologous. Contacting, with the sex arm containing the adjacent first nucleic acid, and (b) identifying the modified non-human ES cell, including the target gene modification at the genomic locus of interest, ( c) Introducing the modified non-human ES cells into a non-human host embryo and (d) conceiving the non-human host embryo in a surrogate mother, wherein the surrogate mother is the genome of interest. The method of producing an F0 generation non-human animal comprising a target gene modification at a locus.

057768. The method of embodiment 67, wherein the CRISPR RNA and the tracrRNA are introduced together in the form of a single guide RNA (gRNA).

057869. The method of embodiment 67, wherein the CRISPR RNA and the tracrRNA are introduced separately.

057970. (a) The Cas protein is introduced into a non-human ES cell in the form of a protein, a messenger RNA (mRNA) encoding the Cas protein, or a DNA encoding the Cas protein, and (b) the CRISPR RNA , Introduced into the non-human ES cell in the form of RNA or DNA encoding the CRISPR RNA, and (c) the tracrRNA is introduced into the non-human ES cell in the form of RNA or DNA encoding the tracrRNA. The method according to any one of forms 67 to 69.

058071. The method of embodiment 70, wherein the Cas protein, the CRISPR RNA, and the tracrRNA are introduced into the non-human ES cell as a protein-RNA complex.

058172. (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein, (b). ) The DNA encoding the CRISPR RNA is in the form of a second expression construct comprising a second promoter operably linked to the third nucleic acid encoding the CRISPR RNA, and (c) the tracrRNA. The DNA encoding the tracrRNA is in the form of a third expression construct comprising a third promoter operably linked to the fourth nucleic acid encoding the tracrRNA, the first, second, and third. The method of embodiment 70, wherein the promoter is active in the non-human ES cells.

058273. The method of embodiment 72, wherein the first, second, and third expression constructs are on a single nucleic acid molecule.

058374. (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein, and ( b) The DNA encoding the CRISPR RNA and the DNA encoding the tracrRNA comprises a second promoter operably linked to the CRISPR RNA and a third nucleic acid encoding the gRNA containing the tracrRNA. The method of embodiment 70, wherein the first and second promoters are in the form of a second expression construct and are active in the non-human ES cells.

058475. The method of embodiment 74, wherein the first and second expression constructs are on a single nucleic acid molecule.

058576. The target gene modification simultaneously comprises a deletion of an endogenous nucleic acid sequence at the genomic locus of interest and insertion of the first nucleic acid at the genomic locus of interest. The method according to any one of 75.

058677. The method according to any one of embodiments 67-76, wherein the target gene modification is a genetic modification of two alleles.

058778. The said embodiment 77, wherein the genetic modification of the two alleles comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes and the insertion of the first nucleic acid. Method.

058879. The method according to any one of embodiments 67-76, wherein the modified non-human ES cell is semizygous at the genomic locus of interest.

058980. The method of embodiment 79, wherein the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of the first nucleic acid.

059081. The target gene modification is (1) deletion of an endogenous nucleic acid sequence at the target genomic locus on two homologous chromosomes, and (2) the first to the target genomic locus on the first chromosome. The method of embodiment 79, comprising inserting one nucleic acid and disrupting a genomic locus of interest on the second chromosome.

059182. The method according to any one of embodiments 67-81, wherein the Cas protein is Cas9.

The following examples are provided to provide those skilled in the art with complete disclosure and description of how the invention is practiced and used, and are not intended to limit the scope of what the inventor considers to be their invention. It is not intended to state that the following experiments are all or the only experiments performed. Efforts are being made to ensure accuracy with respect to the numbers used (eg, quantity, temperature, etc.), but some experimental errors and deviations should be considered. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is temperature in degrees Celsius, and pressure is atmospheric pressure or near atmospheric pressure.Example 1. Rat ES cell origin and characterization 1.1. characterization of rat ES cells As shown in FIG. 1, rat ESCs grow as small spherical colonies, usually separate and float in the dish (enlarged view, FIG. 8). Rat ESCs express pluripotency markers, including Oct-4 (Fig. 2A) and Sox2 (Fig. 2B), and express high levels of alkaline phosphatase (Fig. 3). Karyotype 42X, Y of cell line DA.2B (Fig. 4). Rat ESCs are often tetraploid, and therefore cell lines are pre-selected by counting metaphase chromosomal spreads, and cell lines with most normal counts formally nucleate. Type analyzed. ACI blastocysts were harvested from commercially available overovulatory females. DA blastocysts were cultured from commercially available frozen 8-cell embryos. The zona pellucida was removed by acidic tie load and blastocysts were plated on MEFs sorted during mitosis. By-products were collected and expanded using standard methods. All blastocysts were plated, cultured and expanded using 2i medium (Li et al. (2008) Germline competent embryonic stem cells derived from rat blastocysts, Cell 135: 1299-1310, by reference. The whole is incorporated herein).<tables num="1"><img id="000004" he="104" wi="155" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>1.2 .: Rat generation Chimeric rats were generated by blastocyst injection and transmission of the rat ESC genome. Figure 9 shows the chimera produced by blastocyst injection using the parent ACI.G1 rat ESC. Figure 9 shows the asterisk (*The F1 agouti having albino litters whose male parent is the ACI / SD chimera labeled with) is shown in FIG.Germline transmission of parent rat ESC. Three positive ploidy rat ESC cell lines were evaluated for pluripotency by microinjection into albino SD blastocysts. Chimeras were identified by agouti coat color, which indicates rat ESC contribution (see Figure 10). For each cell line, the majority of chimeras transmitted the rESC genome to F1 offspring (Table 2).<tables num="2-1"><img id="000005" he="43" wi="149" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="2-2"><img id="000006" he="38" wi="148" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>1.3 .: Induction of rat embryonic stem cells Overovulation protocol, rat Day 0: Injection of pregnant female serum: intraperitoneal, 20 U (0.4 ml). Day 1: No activity Day 2: (46 hours later): Injection with hCG, IP, 50U (1ml). --Single female mating settings. Day 3: Confirm vaginal plug. The female vaginal opening was closed. This is the 0.5th day. Day 6 (e3.5): Females were slaughtered and embryos washed. ES cell-derived protocol (excessive ovulation) Day 0: 1) CO2Killed the female. 2) The anterior abdomen was disinfected with 70% ethanol, and the abdominal body wall was opened using scissors to expose the internal organs. 3) The fallopian tubes and uterine horns were separated and placed in a tissue culture dish containing warm N2B27 medium. Rinse as much blood as possible and transfer to a new dish containing N2B27. 4) Using a 1 ml syringe and a 27 g blunt needle, the medium was flushed through the uterine horn and oviduct to extrude the blastocysts into the medium. 5) Collect blastocysts using a mouse pipette and transfer to an embryo culture dish containing KSOM + 2i (1 μM PD0325901, 3 μM CHIR99021). KSOM is a culture medium produced by Millipore. The catalog number is MR-106-D. 6) 7.5% CO at 37 °2Incubated overnight. ES cell induction protocol (frozen embryo) Day 0: 1) Frozen 8-cell embryos (commercially available) were thawed in M2 medium. Incubate at room temperature for 10 minutes. 2) Transferred to KSOM + 2i and cultured overnight. ES cell induction protocol (same for both) First day: 1) The hollowed-out embryos were transferred to 2i medium and cultured overnight. 2) Continued culture of non-hollow embryos in KSOM + 2i the 2nd day: 1) All remaining embryos were transferred to 2i medium (whether hollow or not). 2) The cells were cultured overnight, and the early embryos were continuously cultured in 2i medium. Third day: 1) Embryos were transferred by acidic tie load for 30 to 60 seconds to remove the zona pellucida. 2) Embryos were washed 3 times in 2i medium to remove acidic tie load. 3) Each embryo was attached to a separate well of a 96-well feeder plate (wells contained mouse fetal fibroblasts (containing a monolayer of MEF) that were inactivated during mitosis). 4) Incubated overnight in 2i medium. Day 4-5: 1) Embryos plated in the presence of by-products (amorphous undifferentiated cell mass) were observed. By-products are ready for migration when the size of the plated embryo almost doubles. 2) Each day: Remove the used medium with a micropipette and replace with new 2i medium. 3) Moved by-products to the new feeder well: The used medium was removed and the wells were gently washed with PBS. b. PBS was removed, 30 μl of 0.05% trypsin was added and incubated for 10 minutes. c. The reaction of trypsin was stopped by adding 30 μl of 2i + 10% FBS. d. Cells were gently dissociated with a micropipetta and the entire contents of the wells were transferred to new wells in a 24-well feeder plate. This was Succession 1 (P1). e. Incubated overnight in 2i medium. Days 5-8: (Timing depends on how quickly each cell line expands) 1) The medium (2i medium) was changed daily and observed in the presence of colonies with ESC morphology. 2) When colonies appeared, they were continuously cultured until the colonies expanded to about 50% confluent. 3) As before, the colonies were trypsinized, passaged, and 1 well per cell lineage was plated on the feeder in a 6-well dish. This was Succession 2 (P2). Continued: 1) The supply was continued up to about 50% confluent, and each cell line was observed. 2) The cells were trypsinized as before. 3) Trypsin treatment was stopped by 2i + 10% FBS, and cells were pelleted by centrifugation (5', 1200 rpm in a Beckman-Coulter desktop centrifuge). 4) The supernatant was aspirated and the cells were gently resuspended in 400 μl of frozen medium (70% 2i, 20% FBS, 10% DMSO). 5) The cells were dispensed into two vials and frozen at -80 °. This was Succession 3 (P3). 6) The vial was transferred to a liquid nitrogen storage container for long-term storage. 2i medium was prepared as shown in Table 3.<tables num="3-1"><img id="000007" he="27" wi="154" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="3-2"><img id="000008" he="110" wi="153" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Ingredients: Equine chorionic gonadotropin (PMSG) Human pregnancy urinary fibrous gonadotropin (HCG) Female rat (5-12 weeks old) Male rats (12 weeks to 8 months old), 1 per cage Syringe / needle Animal room with lights from 6:00 to 18:00 procedure: Day 1: 8: 00 ~ 10: 00AM Inject 20IU PMSG (0.4 ml) into the abdominal cavity of a female Discard unused PMSG. Day 3: 8: 00 ~ 10: 00 AM (48 hours after PMSG injection) Inject 50 IU HCG (1 ml) into the abdominal cavity of a female Place one female per male in the mating cage. Discard unused HCG. Day 4: 8: 00 ~ 10: 00 AM (24 hours after HCG injection) Check the female vaginal plug. Hormone supplier PMSG: Sigma # G-4877 (1000IU). Resuspended in PBS at the final [] of 50 IU / ml. Store at -20 ° in 1 ml aliquot. HCG: Sigma # CG-5 (5000 IU). Resuspended in PBS at the final [] of 50 IU / ml. Store at -20 ° in 1 ml aliquot.1.4 .: Karyotyping of rat embryonic stem cell lines The rat ES cell lines prepared herein are karyotyped and the results are summarized in Tables 4-7.<tables num="4"><img id="000009" he="92" wi="140" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="5-1"><img id="000010" he="30" wi="139" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="5-2"><img id="000011" he="45" wi="140" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="6"><img id="000012" he="70" wi="140" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="7"><img id="000013" he="93" wi="159" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>1.5 .: Electroporation of vector into rat embryonic stem cells 1. Rat ES cells were passaged for 24-48 hours prior to electroporation. 2. The medium was replaced with RVG2i + ROCKi (10 μM Y-27632) 24 hours before electroporation. 3. The medium was changed 30 minutes before trypsin treatment. 4. Electroporated DNA was aliquoted. 5. The DNA was warmed at room temperature for more than 10 minutes. The DNA was heated at 62 ° C for 6.5 minutes. Place the DNA on ice. 7. Trypsinized cells: Floating colonies were collected. The plate was washed to recover as much airborne material as possible. b. Pelleted colonies: 3 minutes at 750 rpm c. Wash the pellet once with 5-10 ml PBS and re-rotate / pellet d. The supernatant was aspirated and 500λ trypsin, 0.05% + 1% chicken serum was added. i. Did not pool more than one 10 cm plate colony per tube. If there are too many colonies packed in the bottom of the tube during trypsinization, they will aggregate and lose most of the cells. e. 3 minutes at 37 °. The colonies were pipetted several times to minimize agglomeration. f. Steps were repeated 1-2 times: 4 minutes at 37 ° The trypsin reaction was stopped by g.500λ RVG2i + 10% FBS. 8. Cell pelleted: 1200 rpm for 5 minutes Cells were resuspended in 9.10 ml PBS. Two 20λ aliquots were counted to determine total cell count. 10. Pelleted cells (5 min / 1200 rpm), total cell count and total resuspend volume were calculated to achieve accurate cell concentration (target count / 75 μl EP buffer). 11. Resuspend in the smallest volume of EP buffer, measure the total volume, and adjust the target volume with EP buffer. Electroporation buffers are sold by Millipore. The catalog number is ES-003-D. See Valenzuela et al. (2003) Nature Biotechnology 21: 652-659, which is incorporated herein by reference. Add 12.75λ cells to 50λ DNA and transfer 125λ cells / DNA solution to one well of BTX48-well cuvette. Empty wells in the same column were filled with 125λ EP buffer. 13. Pulsed cuvette once in BTX electroporator: a. Setting: 400V; Ω; 100μF (setting can vary) 14. Place the cuvette on ice for 15 minutes to recover. Cells were removed in 15.5 ml RVG 2i + 10 μM ROCKi. Added to a 15 cm plate containing 16.20 ml RVG 2i + 10 μM ROCKi. The plate has twice the neoR MEF (or other MEF depending on the project). neoR Selectable markers are neomycin phospho from Beck et al. (1982) Gene, 19: 327-36 or US Pat. No. 7,205,148 or 6,596,541, each of which is incorporated herein by reference. It is a transferase (neo) gene. Incubated at 17.37 °. After 48 hours, selection begins. The ROCK inhibitor used was Y-27632.1.6: Selection of target gene modification in rat embryonic stem cells 1. Cells were passaged for 24-48 hours prior to electroporation. 2. Twenty-four hours before electroporation, the medium was replaced with RVG2i + ROCKi (10 μM Y-27632). 3. The medium was changed 30 minutes before trypsin treatment. 4. Electroporated DNA was aliquoted. 5. The DNA was warmed at room temperature for more than 10 minutes. The DNA was heated at 62 ° C for 6.5 minutes. Place the DNA on ice. 7. Cells were trypsinized: Floating colonies were collected. The plate was washed to recover as much airborne material as possible. b. Colonies pelleted: 750 rpm for 3 minutes c. Wash the pellet once with 5-10 ml PBS and re-rotate / pellet d. The supernatant was aspirated and 500λ trypsin, 0.05% + 1% chicken serum was added. i. Did not pool more than one 10 cm plate colony per tube. If there are too many colonies packed in the bottom of the tube during trypsinization, they will aggregate and lose most of the cells. e. 3 minutes at 37 °. The colonies were pipetted several times to minimize agglomeration. f. Repeated 1-2 times: 4 minutes at 37 ° The trypsin reaction was stopped by g.500λ RVG2i + 10% FBS. 8. Pillette cells: 5 minutes at 1200 rpm Cells were resuspended in 9.10 ml PBS. Two 20λ aliquots were counted to determine total cell count. 10. Pelleted cells (5 min / 1200 rpm), total cell count and total resuspend volume were calculated to achieve accurate cell concentration (target count / 75 μl EP buffer). 11. Resuspended in the smallest volume of EP buffer, the total volume was measured and the target volume was adjusted with EP buffer. Add 12.75λ cells to 50λ DNA and transfer 125λ cells / DNA solution to one well of BTX 48-well cuvette. Empty wells in the same column were filled with 125λ EP buffer. 13. Pulsed cuvette once in BTX electroporator: Setting: 400V; 100μF (setting can vary) 14. Place the cuvette on ice for 15 minutes to recover. Cells were removed in 15.5 ml RVG 2i + 10 μM ROCKi. Added to a 15 cm plate containing 16.20 ml RVG 2i + 10 μM ROCKi. The plate had twice the neoR MEF (or other MEF depending on the project). Incubated at 17.37 °. After 48 hours, selection began. 18. G418's selection protocol was: Day 2: Cells were incubated in 75 μg / ml 2i medium + G418. b. Day 3: Cells were incubated in 2i medium without G418. c. Day 4: Cells were incubated in 75 μg / ml 2i medium + G418. d. Day 5: Cells were incubated in 2i medium without G418. e. Day 6: Cells were incubated in 75 μg / ml 2i medium + G418. f. Day 7: Cells were incubated in 2i medium without G418. g. Day 8: Cells were incubated in 75 μg / ml 2i medium + G418. h. Day 9: Cells were incubated in 2i medium without G418. i. Day 10: Cells were incubated in 75 μg / ml 2i medium + G418. j. Day 11: Cells were incubated in 2i medium without G418. k. Day 12: Colonies were picked and expanded for screening. Each colony was dissociated in 0.05% trypsin + 1% chicken serum for 10 minutes and then plated in one well of a 96-well feeder plate. Colonies were expanded in 19.2i medium for 3 days. 20. 1: 1 cloning clones into the new 96-well feeder well. The clones were expanded in 21.2i medium for 3 days. 22. For each clone, colonies were dissociated into trypsin. Two-thirds of each clone was frozen, stored at -80 ° and the remaining one-third was plated on a laminin plate (a 96-well plate coated with 10 μg / ml laminin). 23. If the laminin plate was confluent, it was transferred to a screening laboratory for clonal genotypes.1.7. Molecular signature of rat embryonic stem cells The genes listed in Table 8 were expressed in rat ES cells at 20-fold lower levels than the corresponding genes in mouse ES cells. The genes listed in Table 9 were expressed at 20-fold higher levels in rat ES cells than the corresponding genes in mouse ES cells. The microarray data in Tables 8 and 9 were prepared as follows. Rat ES cells (ACI.G2 and DA.2B) and mouse ES cells (F1H4) were cultured in 2i medium for 3 passages to confluence. F1H4 cells were cultured on gelatin-coated plates in the absence of feeders. F1H4 mouse ES cells are 129S6 / SvEvTac and C57BL / 6NTac heterozygous embryos (eg, US Pat. No. 7,294,754 and Poueymirou, WT, Auerbach, W., Frendewey, D., Hickey, JF, Escaravage, JM, Esau, Please refer to L., Dore, AT, Stevens, S., Adams, NC, Dominguez, MG, Gale, NW, Yancopoulos, GD, DeChiara, TM, Valenzuela, DM (2007), which is the whole by reference. It was derived from (incorporated herein). The following protocol was used for sample preparation: 1.5 mL Eppendorf tubes were labeled with sample ID. Cells grown on the plate were rinsed in phosphate buffered saline (PBS) at 37 ° C. PBS was removed and 300 ul of Trizol® was added. Cells in Trizol® (Life Technology) were stripped using a scraper. Lysinated cells in Trizol® were collected in a 1.5 mL Eppendorf tube. For cells grown on suspension, cells were rinsed in PBS at 37 ° C and collected in 1.5 mL tubes. The cells were centrifuged, PBS was removed, and 300 ul of Trizol® was added to the cells. The cell membrane was breached by pipette operation. 10 ~ 105Samples with cells were classified for FACS and the volume was concentrated to less than 100 uL. Four volumes of RNA lysis buffer were added and mixed by pipette operation. For the sample, 320 uL of RNA lysis buffer was added to the 80 uL sample. The sample was stored at -20 ° C. Expression levels of mouse and rat genes were measured using RNA-Seq. Sequencing readings by Tophat were mapped to mouse and rat reference genomes and RPKMs (fragments per kilobase of exons per million mapped fragments) were calculated for mouse and rat genes. Homologous genes based on the gene symbol were selected, and then t-test was used to compare the expression levels of each gene between mice and rats. miR-32 was expressed in rat ESCs at the top 10 but not in mouse ES cells. There are no comparative data from miR-632, but based on their level of expression compared to other genes expressed in rat ESC and their known function in embryonic development, miR-632 was used in rat ES cells. Selected as a marker in. Table 8. The listed genes were expressed in rat ES cells at 20-fold lower levels than the corresponding genes in mouse ES cells.<tables num="8-1"><img id="000014" he="235" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-2"><img id="000015" he="241" wi="146" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-3"><img id="000016" he="240" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-4"><img id="000017" he="242" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-5"><img id="000018" he="245" wi="148" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-6"><img id="000019" he="242" wi="148" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-7"><img id="000020" he="244" wi="145" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-8"><img id="000021" he="244" wi="144" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-9"><img id="000022" he="241" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-10"><img id="000023" he="244" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-11"><img id="000024" he="241" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="8-12"><img id="000025" he="72" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Table 9. The listed genes were expressed at 20-fold higher levels in rat ES cells than the corresponding genes in mouse ES cells.<tables num="9-1"><img id="000026" he="150" wi="146" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="9-2"><img id="000027" he="240" wi="146" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="9-3"><img id="000028" he="241" wi="146" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="9-4"><img id="000029" he="242" wi="146" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="9-5"><img id="000030" he="244" wi="145" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="9-6"><img id="000031" he="228" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Table 10. A subset of the genes from Table 9 expressed at 20-fold higher levels in rat ES cells than the corresponding genes in mouse ES cells.<tables num="10"><img id="000032" he="141" wi="162" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Additional molecular signatures using pluripotency markers / genes in rat ES cells have also been developed. Table 11 provides a list of genes from RNA profiling data and their expression ranks. mRNA was isolated from rat ES cells and the expression levels of various markers were compared against each other. The term "rank" means the relative expression level of an individual gene, the higher the rank (1 is the highest), the higher the expression. For example, an Oct4 rank of 13 out of all of the assayed genes means that it was expressed higher than all but 12 genes. The background of this experiment was any expression value below 30, and the 6107 gene had an expression value of 30 or more. Table 11. Rat ES cell molecular signatures with various pluripotency, mesoderm, endoderm, nerve, and trophic ectoderm markers / genes<tables num="11-1"><img id="000033" he="36" wi="152" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="11-2"><img id="000034" he="239" wi="152" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="11-3"><img id="000035" he="132" wi="152" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>Example 2: Inactivation of genomic loci in rats 2.1: Inactivation of endogenous genomic loci with endonuclease agent To introduce a mutation allele at an endogenous rat genomic locus, the rat ES cells described herein are electroperforated with an expression vector (or mRNA) expressing ZFN1 and 2 (or TALEN1 and 2). Will be done. These proteins bind to their target sequences on opposite strands, which are about 6 bp to about 40 bp apart. Double-strand breaks have formed within the target locus and cells are attempting to repair by non-homologous end joining (NHEJ). NHEJ often results in the formation of deletions and often disrupts gene function (most often by causing frameshift mutations). Since no drug selection is made to identify positive clones containing the mutation allele, electroporated cells are plated at low density. Colonies were screened and assayed at the target site to see if mutations occurred (eg, using a modification of the allele (MOA) assay described above). Selected ES cells containing the mutation allele are then introduced into host rat embryos, such as pre-morula or blastopathic rat embryos, and transplanted into the uterus of the surrogate mother to generate primordial rats (F0 rats). ) Is prepared. Primordial rats are then bred with wild-type rats to produce F1 offspring that are heterozygous for the mutation allele. Mating of heterozygous F1 rats can produce homozygous offspring to the mutant allele.2.2 .: Targeting rat ESC in inactivation of rat apolipoprotein E (ApoE) gene using zinc finger nucleases Zinc finger nucleases use sequence-specific modular DNA-binding domains to direct endonuclease activity to unique target sequences in the genome. ZFNs are genetically engineered as a pair of monomers. Each monomer contains a non-specific cleavage domain from a FokI endonuclease fused to three or more zinc finger DNA binding domains. Each zinc finger binds to a 3 bp subsite and specificity is achieved by the combined target micron of both monomers. ZFNs cause double-strand breaks (DSBs) in DNA, and mutations (insertions or deletions) often occur during non-homologous end joining (NHEJ). In Figure 15, genome editing endonucleases such as ZFNs and TALENs introduce double-strand breaks in target genomic sequences and activate NHEJ in cells. DSBs also stimulate homologous orientation repair (HDR) by homologous recombination when ZFNs are given to the donor sequence. Such ZFNs have been used in combination with the various methods and compositions described herein to improve targeting efficiency. The rat apolipoprotein E (ApoE) locus is targeted as described in Examples 3.2 (a) (i), except that expression vectors expressing ZFN1 and 2 are also introduced into rat ES cells. did. See Figure 11, which provides a schematic of ApoE targeting events in combination with rTZFN1P and rTZFN2P. Targeting efficiencies were determined and the results are shown in Table 12 as discussed below in Example 5. Specific primers and probes were used to genotype to screen for heterozygous targeting, homozygous targeting, and "mixed" doubles (eg, composite heterozygous targeting). Surprisingly, the targeting efficiency increased 8-10 times.<tables num="12"><img id="000036" he="69" wi="157" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> The plasmid targeting vector was constructed using a self-deletion drug selection cassette and the lacZ gene as a reporter gene (for a description of the homologous and non-homologous recombination events that can occur during electroporation of the targeting vector containing the selection cassette. See Figure 14). Good targeting efficiency was achieved and a high percentage of chimeras were produced. Zinc finger nucleases (ZFNs) were also tested in combination with targeting vectors to test their effect in improving targeting efficiency (ZFNs or ZFNs to improve the efficiency of homologous recombination of targeting vectors). See Figure 16 for an explanation of gene targeting techniques using TALENs). The targeting vector was co-expressed with the expression vector for two ZFN pairs that cleave the ApoE locus. Rat ESC clones were electroporated with both targeting vectors and a set of ZFNs showed 8-10 fold higher targeting efficiency than those of rat ESC clones electroporated with the targeting vector alone. In addition, about 2% of clones detected homozygous targeting of the two alleles. A high percentage of chimeras were obtained from two of these target clones. Using standard techniques, ApoE-targeted (ZFN-supported) rat ESC clones were microinjected into SD blastocysts and then transferred to pseudopregnant SD-receptive females. Identify chimeras by coat color (ApoE-ZFN-AB5 chimeras (ie, ApoE)-/-Chimeras), see Figure 17), male F0 chimeras were bred with SD females. Germline F1 offspring were genotyped in the presence of the targeted ApoE allele (Table 13). A high percentage of chimeras were obtained from two of these target clones.<tables num="13"><img id="000037" he="35" wi="155" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> ApoE knockout rats provide a means for testing various types of disorders and diseases. In humans, apolipoproteins are found in chylomicrons, HDL, LDL, and VLDL. APOE is essential for the normal catabolism of triglyceride-rich lipoprotein components. APOE deficiency risks, for example, familial hypercholesterolemia, dyslipidemia, beta-lipoproteinemia, familial abnormal beta-lipoproteinemia, type III hyperlipoproteinemia (HLP III), coronary artery disease It results in many medical conditions, including. One isotype (ApoE4) is also associated with late-onset and idiopathic Alzheimer's disease and, in some cases, MS. In mice, ApoE transports cholesterol, as found in HDL and in humans. ApoE-deficient mice (two independent KOs) had five times normal plasma cholesterol and developed a foam cell-rich precipitate in the proximal aorta at 3 months of age (comparable to human syndrome). ApoE knockouts in rats provide an animal model for studying endothelial function, including, but not limited to, plaque formation, transcriptional alteration (RNA-Seq), and exvivo function. In addition, large size rats can facilitate all of these assays and potentially improve the quality of RNA-Seq data.2.3. Inactivation of rat interleukin-2 receptor gamma (IL2r-γ) locus using zinc finger nuclease Except for introducing rat interleukin-2 receptor gamma (IL2r-γ or Il2rg) loci to rat ES cells with expression vectors expressing ZFN U (upstream ZFN) and ZFN D (downstream ZFN). , Targeted as described in Example 3.3 (a). FIG. 18 provides a schematic representation of IL2r-γ targeting events in combination with ZFN U and ZFN D. The sequence of the IL2r-γ locus to which these zinc fingers bind in SEQ ID NO: 93 is shown in FIG. Targeting efficiencies were determined and the results are shown in Table 14, as discussed in Example 3.3 (a) below. Briefly, homozygous target clones were confirmed by PCR. For ZFN1 pair, 173 of 192 mutant clones were screened (90%), and for ZFN2 pair, 162 of 192 clones were screened (84%).<tables num="14"><img id="000038" he="41" wi="150" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Using standard techniques, IL2r-γ-targeted (ZFN-supported) rat ESC clones were microinjected into SD blastocysts and then transferred to pseudopregnant SD-receptive females. Chimeras were identified by coat color and male F0 chimeras were bred with SD females. Germline F1 offspring were genotyped in the presence of the targeted IL2r-γ allele.2.4 .: Inactivation of rat interleukin-2 receptor gamma (IL2r-γ) using CRISPR / Cas9 The rat IL2r-γ locus was targeted as described in Example 3.3 (a), except that the CRISPR / Cas9 system was also introduced into rat ES cells to aid in targeting efficiency. did. SBI: System Biosciences Cas9 expression was driven by the CAG, EF1a, PGK, or CMV promoter using the Cas9 "Smart Nuclease" integrated vector. The custom gRNA was ligated into the vector and expressed by the H1 promoter. We designed four gRNAs for Il2rg. The IL2r-γ locus of rats targeted by gRNAs1-4 is shown in FIG. Specific primers and probes were used to genotype to screen for targeting (eg, heterozygous targeting, homozygous targeting, and complex heterozygous targeting). Table 15 shows the results of targeting when various guide RNAs are used. Strong and weak refer to the strength of screening-based evidence that a colony has a targeted modification.<tables num="15-1"><img id="000039" he="52" wi="150" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="15-2"><img id="000040" he="47" wi="149" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>2.5 .: Inactivation of mouse hypoxanthine-phosphoribosyl transferase (Hprt) gene using CRISPR / Cas9 The mouse Hprt locus was targeted in mouse ES cells using LTVEC alone or in combination with CRISPR / Cas9. The complete Hprt coding sequence of 32.9 kb was targeted for deletion and replacement of the pCAGG-Puro puromycin resistance selection cassette, which also expressed eGFP. The deletion endpoints were start and stop codons. The guide RNA sequence used was 5'-GACCCGCAGUCCCAGCGUCG-3'(SEQ ID NO: 84), which targeted exon 1 in the mouse Hprt gene. The predicted target site cleavage position was 22 base pairs from the 5'end of the deletion. The actual cleavage efficiency of Cas9 / gRNA observed in ES cells was 93%. A summary is shown in Table 16. The use of CRISPR / Cas9, which supports the targeting of the full 32.9 kb Hprt locus, resulted in five-fold more target enhancement than the use of LTVEC alone.<tables num="16"><img id="000041" he="61" wi="153" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>Example 3: Targeted modification of rat genomic locus 3.1: Targeting rat ESC: Rat Rosa26 locus The Rosa26 locus in rats has the same spacing and is between the Setd5 and Thumpd3 genes, as in mice. The rat Rosa26 locus (Fig. 12, panel B) is different from the mouse Rosa26 locus (Fig. 12, panel A). The mouse Rosa26 transcript consists of two or three exons. The rat locus contains a second exon 1 (Ex1b) in addition to an exon homologous to mouse exon 1 (Ex1a). The third exon has not been identified in rats. Targeting of the rat Rosa26 allele is shown in Figure 12C, where each 5 kb homology arm was cloned by PCR using genomic DNA from DA rat ESC. Target alleles include the SA (splicing receptor) -lacZ-hUb-neo cassette that replaces the 117 bp deletion in rat Rosa26 introns. The targeting efficiency at the Rosa26 locus in rats was determined (Table 17). Using standard techniques, the linearized vector was electroporated into DA or ACI rat ESC and the transformed colonies were cultured in 2i medium + G418. Individual colonies were selected and screened using an allelic loss (LOA) assay (Valenzuela, D. et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21: 652-660, which is incorporated herein by reference in its entirety).<tables num="17"><img id="000042" he="42" wi="154" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Chimera production and germline transmission using rat ESC clones targeting Rosa26. Using standard techniques, reconfirmed Rosa26-targeted rat ESC clones were microinjected into SD blastocysts and then transferred to pseudopregnant SD-receptive females. Chimeras were identified by coat color and male F0 chimeras were bred with SD females. The presence of the targeted Rosa26 allele genotyped the germline (Aguchi) F1 offspring, and 9 of the 22 Aguchi offspring were genotyped as heterozygotes at the Rosa26 locus ( Table 18).<tables num="18"><img id="000043" he="75" wi="148" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> To confirm that the genetically modified allele at the Rosa26 locus was transmitted through germline, lacZ expression was confirmed by X-gal staining in rats targeting heterozygous Rosa26. .. X-gal staining of the brain, heart and thymus, and lungs from rats targeting 14-week-old heterozygous Rosa26 showed lacZ expression (FIGS. 13B, D, and F, respectively), while Age-matched wild-type controls showed low levels of background X-gal staining (FIGS. 13A, C, and E, respectively). X-gal staining in rat embryos targeting E12.5 and E14.5 heterozygous Rosa26 showed ubiquitous expression of lacZ (FIGS. 13G and I, respectively), while control rat embryos Low levels of background X-gal staining were shown (FIGS. 13H and J, respectively).3.2. (a) (i): Targeting the rat apolipoprotein E (ApoE) locus ApoE function was disrupted by targeting the rat apolipoprotein E (ApoE) locus. Targeting of the ApoE locus was performed using a targeting vector containing a lacZ-hUb-neo cassette flanked by 5'and 3'homologous arms homologous to the ApoE locus. Figure 20 shows a gene in which the rat ApoE locus was disrupted by a 1.8 kb deletion and insertion of a lacZ-hUb-neo cassette containing an additional self-deletion cassette containing the Crei gene driven by the protamine promoter. Shows the ApoE locus of a specifically modified rat. The conditions for electroporation were as follows: 6ug DNA, 2.05 × 106Plated on neoR MEF, twice as rich as 15 cm in cells, 400V, 200uF: 342V, 593usec; 2i + 10uM ROCKi. The targeting efficiency at the ApoE locus was determined and is shown in Table 19. Using standard techniques, the linearized vector was electroporated into DA.2B rat ESCs from the DA strain and the transformed colonies were cultured. Individual colonies were selected and screened using the Allele Loss (LOA) assay.<tables num="19"><img id="000044" he="53" wi="136" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Chimera production and germline transmission were performed using rat ESC clones targeting ApoE. Using standard techniques, ApoE-targeted rat ESC clones were microinjected into SD blastocysts and then transferred to pseudopregnant SD-receptive females. Chimeras were identified by coat color and male F0 chimeras were bred with SD females. Germline transmission was achieved. F1 offspring were genotyped in the presence of the targeted ApoE allele (Table 20).<tables num="20"><img id="000045" he="36" wi="143" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> LacZ expression driven by the endogenous ApoE promoter is 12-week-old ApoE+/-It was confirmed by X-gal staining in the brain, blood vessels, and liver in female rats (Figs. 43-45, respectively). Figures 43-45 show the expression pattern of lacZ, which reflects the expression pattern of endogenous ApoE. Age-matched wild-type controls showed low levels of background X-gal staining. The phenotype of ApoE-deficient rats was further tested. A longitudinal blood biochemical test study was performed and cholesterol, LDL, HDL, and triglyceride levels were measured at 3-week intervals. Figures 46A-D show serum cholesterol, LDL, HDL, and triglyceride levels in 6-, 9-, 12-, and 15-week-old homozygous targets, heterozygous targets, and wild-type rats. .. Eye bleeding occurred in an age-matched cohort of 2 wild-type rats, 7 heterozygous rats, and 8 homozygous rats. No significant difference was found between males and females. Homozygous ApoE-deficient rats showed elevated cholesterol and LDL levels as well as decreased HDL levels. ApoE-/-Unlike mice, no significant increase in triglycerides was observed in ApoE-deficient rats. Further phenotypic analysis performed included histology / exvivo imaging of aortic plaque formation, in vivo imaging of aortic plaque formation, and transcriptional alterations of the aortic endothelium (total transcriptome shotgun sequencing (RNA-Seq)). Including. The timing of these assays depends on the time record of plaque formation. Plaque is a 24-week ApoE-/-It is detectable in the mouse. Further targeted data on ApoE are also provided in Table 22.3.2. (a) (ii). Targeting of ApoE using a targeting vector in rats FIG. 20 provides a schematic diagram of the rat ApoE locus and targeting plasmid. The schematic diagram above in FIG. 20 shows the genomic structure of the genomic region corresponding to the rat ApoE locus and the 5'and 3'homologous arms (5 kb and 5.4 kb, dark gray boxes, respectively). The ApoE exon 1 is non-coded and is shown as the white box closest to the 5'homologous arm. The three introns of ApoE are indicated by lines, and exons 2 and 3 contain coding regions and are indicated as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. The schematic diagram below FIG. 20 is a targeting vector. The 5'and 3'homologous arms (5 kb and 5.4 kb, respectively) are indicated by dark gray boxes. The targeting vector contains a reporter gene (lacZ) and a self-deletion cassette adjacent to the loxP site (blank arrow). The self-deletion cassette contains a drug selection cassette containing the Crei gene operably linked to the mouse Prm1 promoter and the neomycin resistance gene operably linked to the human ubiquitin promoter. The Crei gene contains two exons encoding Cre recombinase, which are separated by introns (Crei) to prevent their expression in prokaryotic cells. See, for example, US Pat. No. 8,697,851 and US Patent Publication No. 2013-0312129, which describe self-deletion cassettes in detail and are incorporated herein by reference in their entirety. By using the Prm1 promoter, the self-deletion cassette can be specifically deleted in F0 rat male germ cells. The targeting vector was electroporated into rat ES cells obtained in Example 1 and plated on a neomycin resistant MEF that was twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. As shown in Table 44, 384 colonies were screened to obtain 23 target clones. The targeting efficiency was 5.99%. Three clones were injected into the blastocysts described herein in Example 1. Three chimera-producing clones were obtained and targeted modifications were transmitted to one of the clones through germline.3.2. (a) (iii). Targeting ApoE in rats with a targeting vector combined with a zinc finger nuclease The targeting vector used in Example 3.2 (a) (ii) was used in combination with a zinc finger nuclease to target the rat ApoE locus. Table 21 provides a summary of the genomic composition of the rat ApoE locus. The arrangements shown in Table 21 were obtained from Rat Genome Reference Sequence Construction 5.0 (ENSMBL). ApoE is on chromosome 1 of the (-) strand. Table 21. Summary of rat ApoE locus and zinc finger nuclease binding and cleavage site arrangements<tables num="21-1"><img id="000046" he="128" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="21-2"><img id="000047" he="47" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> FIG. 11 provides a schematic diagram of the rat ApoE locus and shows the cleavage sites at ZFN1 and ZFN2 with gray bars. The cleavage site for ZFN1 is in exon 3 and the cleavage site for ZNF2 is in intron 3. The exact locations of both ZFN sites are shown in Table 21. The genomic regions corresponding to the 5'and 3'homology arms (5 kb and 5.4 kb, respectively) are shown in dark gray boxes. The ApoE exon 1 is non-coded and is shown as the white box closest to the 5'homologous arm. The three introns of the ApoE gene are indicated by lines, and exons 2 and 3 contain coding regions and are indicated as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. The targeting vector used is the same as in Example 3.2 (a) (ii) and is shown in FIG. 20 and FIG. 21A is a rat using the zinc finger nuclease and the targeting vector shown in FIG. A schematic diagram for targeting the ApoE locus in ES cells is provided. Two expression plasmids were introduced into the ZFN, one for each half of the ZFN pair. A 20 ug plasmid was used for ZFN1 and a 20 ug plasmid was used for ZFN2. ZFNs were purchased from Sigma. The expression of each ZFN was driven by the CMV promoter. The targeting vector was electroporated into rat ES cells obtained in Example 1 and plated on neoR MEF, which was twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. As shown in Tables 22 and 44, 384 colonies were screened to obtain 290 target clones. The targeting efficiency was 75.52%. Two clones were injected into the blastocysts described herein in Example 1. Two chimera-producing clones were obtained and targeted modification was transmitted to one of the clones through germline. In addition, ZFN1 and ZFN2 were used to generate clones targeting eight two alleles with an efficiency of 2.08%.<tables num="22-1"><img id="000048" he="30" wi="153" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="22-2"><img id="000049" he="42" wi="154" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>3.2. (b) (i): Target modification of rat apolipoprotein E (ApoE) locus using large targeting vector (LTC) Using a large targeting vector (LTVEC) containing a lacZ-mouse Prm1-Crei cassette with a 5'homologous arm adjacent to the approximately 45 kb ApoE locus and a 3'homologous arm adjacent to the approximately 23 kb ApoE locus. The ApoE locus is labeled. FIG. 22 shows a rat ApoE locus in which the ApoE locus was disturbed by a 1.83 kb deletion and insertion of a self-deletion cassette containing the lacZ gene as well as the mPrm1-Crei and hUb-neo selection cassettes. This vector can be introduced into rat ES cells using the method used in Examples 3.2 (a) (i).Examples 3.2. (B) (ii). Targeting the ApoE locus in rats using a large targeting vector (LTVEC) FIG. 22 provides a schematic of the rat ApoE locus and large targeting vector (LTVEC). The schematic diagram above in FIG. 22 shows the genomic composition of the genomic region corresponding to the rat ApoE locus and the 5'and 3'homologous arms (45 kb and 23 kb, dark gray boxes, respectively). The ApoE exon 1 is non-coded and is shown as the white box closest to the 5'homologous arm. The three introns of ApoE are indicated by lines, and exons 2 and 3 contain coding regions and are indicated as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. The schematic diagram below FIG. 22 is the LTVEC. The 5'and 3'homology arms (45 kb and 23 kb, respectively) are indicated by dark gray boxes. The targeting vector contains a loxP site (white) containing a reporter gene (lacZ) and a drug selection cassette containing a Crei gene operably linked to the mouse Prm1 promoter and a neomycin resistance gene operably linked to the human ubiquitin promoter. The pull-out arrow) contains the adjacent self-deletion cassette. Crei contains two exons encoding Cre recombinase, which are separated by introns (Crei) to prevent their expression in prokaryotic cells. See, for example, US Pat. No. 8,697,851 and US Patent Publication No. 2013-0312129, which describe self-deletion cassettes in detail and are incorporated herein by reference in their entirety. By using the mouse Prm1 promoter, the self-deletion cassette can be specifically deleted in F0 rat male germ cells. LTVECs were electroporated into rat ES cells obtained in Example 1 and plated on neoR MEFs twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. As shown in Table 44, 288 colonies were screened to obtain 8 target clones. The targeting efficiency was 2.78%. Three clones were injected into the host embryo at the blastulatory stage as described herein in Example 2 to produce chimeric rats (F0). In addition, clones targeting one biallele were generated, provided that the efficiency was 0.35% biallele.3.2. (b) (iii). Targeting ApoE in rats with a large targeting vector (LTVEC) combined with zinc finger nucleases The LTVEC used in Example 3.2. (B) (ii) was used in combination with a zinc finger nuclease to target the rat ApoE locus. Table 21 provides a summary of the genomic composition of the rat ApoE locus, and the locations shown were obtained from rat genome reference sequence construction 5.0 (ENSMBL). FIG. 23 provides a schematic diagram of the rat ApoE locus, with gray bars showing cleavage sites at ZFN1 and ZFN2. The cleavage site for ZFN1 is in t exon 3, and the cleavage site for ZNF2 is in intron 3 . The exact locations of both ZFN sites are shown in Table 21. The 5'and 3'homology arms (45 kb and 23 kb, respectively) are indicated by dark gray boxes. Exons 1 in the ApoE gene are non-coding and are shown as the white box closest to the 5'homologous arm. The three introns of the ApoE gene are indicated by lines. Exons 2 and 3 contain code regions and are shown as dotted gray boxes. Exons 4 include both coded and non-coded sequences shown in dotted gray shaded and white boxes. The LTVEC used is that of Example 3.2 (b) (ii) and is the same as that shown in FIG. Two expression plasmids were introduced into the ZFN, one for each half of the ZFN pair. A 20 ug plasmid was used for ZFN 1 and a 20 ug plasmid was used for ZFN 2. ZFNs were purchased from Sigma. The expression of each ZFN was driven by the CMV promoter. The targeting vector was electroporated into rat ES cells obtained in Example 1 and plated on neoR MEF, which was twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. As shown in Table 44, 288 colonies were screened to obtain 16 target clones. The targeting efficiency was 5.56%. One clone was injected into the blastocysts described herein in Example 2. In addition, ZFN1 and ZFN2 produced clones targeting one two alleles with an efficiency of 0.35%.3.2. Targeting ApoE in rats with a large targeting vector (LTVEC) combining CRISPR / Cas9 (b) (iv). The LTVEC used in Example 3.2. (B) (ii) was used in combination with CRISPR / Cas9 to target the ApoE locus in rats. Table 23 shows the results of experiments using ApoE LTVEC alone to target the rat ApoE locus or in combination with the CRISPR / Cas9 nuclease to target the rat ApoE locus. The comparison is shown. In each experiment, electroporated pluripotent cells were densely plated and subjected to drug selection to find drug-resistant colonies. Drug-resistant colonies were selected and screened for targeted alterations using the modifications of the allele (MOA) assay described herein. Specifically, 4x106Cells were electroporated with 2 ug of ApoE LT VEC at a voltage of 400 V, a capacitance of 100 uF, and a resistance of 0. In the latter experiment, 6 ug of Cas9 expression plasmid and 3 ug of ApoE gRNA2 or 3 ug of ApoE gRNA3 were also electroporated. Selection was made using 75 ug / mL G418. ApoE gRNA2 has the sequence of GCAGGCCCTGAACCGCTTCTTGG (SEQ ID NO: 87) and targets the starting portion of 3'rat ApoE exon 3 in region 67 bp. ApoE gRNA3 has the sequence CCTGCGCTGGGTGCAGACGCTTT (SEQ ID NO: 88) and targets the starting portion of 97 bp 3'rat ApoE exon 3 (see Figure 47). As shown in Table 23, targeting efficiency increased (43% to 53% or 47%) when either Cas9, or gRNA, was introduced into cells with ApoE LTVEC. Allele targeting was observed in 5 colonies targeting ApoE LTVEC in combination with ApoE gRNA 2 or 3, whereas 2 allele targeting was ApoE. It was not observed with LTVEC alone.<tables num="23"><img id="000050" he="85" wi="159" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>3.3 (a): Targeting of rat interleukin-2 receptor gamma (IL2r-γ) locus The IL2r-γ function was disrupted by targeting the rat interleukin-2 receptor gamma (IL2r-γ or Il2rg) locus. IL2r-γ plays an important role in signal transduction by IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, and mutations in IL2r-γ are T, B, And associated with significant defects in NK cell growth. Targeting the IL2r-γ locus was performed using a targeting vector containing an eGFP-hUb-neo cassette with adjacent 5'and 3'homologous arms homologous to the IL2r-γ locus shown in FIG. I was broken. FIG. 25 shows the genomic structure of the rat IL2r-γ locus disrupted by a 3.2 kb deletion. The target IL2r-γ locus also contains a self-deletion containing a drug selection cassette containing the eGFP gene and the hUb promoter operably linked to the mouse protamine 1 promoter and the Crei and neomycin resistance genes. It consisted of a cassette. The targeting efficiency at the IL2r-γ locus was determined and is shown in Table 24. Using standard techniques, the linearized vector was electroporated into DA.2B rat ESCs and transformed colonies were cultured. Individual colonies were selected and screened using the Allele Loss (LOA) assay.<tables num="24"><img id="000051" he="58" wi="153" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Chimera production and germline transmission were performed using rat ESC clones targeting IL2r-γ-. Using standard techniques, rat ESC clones targeting IL2r-γ- were microinjected into SD blastocysts and then transferred to pseudopregnant SD-receptive females. Chimeras were identified by coat color and male F0 chimeras were bred with SD females. Germline F1 offspring were genotyped in the presence of the targeted IL2r-γ allele (Table 25). In another microinjection experiment with clone Il2rg-CG12, germline transmission was also confirmed by coat color and genotype.<tables num="25"><img id="000052" he="46" wi="145" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Il2rg-/ YChimera No. 3 phenotype was further tested. Peripheral blood mononuclear cells (PBMC) were stained with antibodies that recognize several lymphoid antigens. GFP-positive PBMCs were detected in Chimera 2 as shown in FIG. In addition, GFP + cells were negative for the T cell marker CD3 (FIG. 29A) and most were negative for the B cell marker B220 and the NK cell marker CD161a (FIGS. 29B and C, respectively). PBMCs from wild-type rats were used as a negative control for GFP expression. See Figures 29D ~ F. The double-positive small population is consistent with the published Il2rg knockout phenotype in mice. These data are obtained from chimeric rats containing IL2 receptor gamma-positive cells, which can complicate phenotypic analysis. Flow cytometric analysis can also be performed on cell populations from the bone marrow and spleen to show a corresponding decrease in the number of lymphocytes. See Mashimo et al. (2010) PLoS One 5 (1): e8870.3.3 (b): Target modification of rat interleukin-2 receptor gamma (IL2r-γ) locus The rat interleukin-2 receptor gamma (IL2r-γ) locus was targeted to disrupt IL2r-γ function in rats. FIG. 25 shows the genomic structure of the rat Il2rg locus (upper panel of FIG. 25) and the targeting vector introduced into the locus (lower panel of FIG. 25). eGFP was selected as a reporter so that the immune phenotype of genetically modified rats could be tested using FACS. A self-deletion cassette (hUb-Neo, Prm1-Cre) was used to delete the specific Cre gene in the drug selection cassette and male germ cells of F0 rats. In addition, the targeting vector was designed to delete the entire coding region (approximately 3.2 kb) of the rat Il2rg gene. The size of the deletion in rat ESC was confirmed by PCR using primers specific for the rat Il2rg locus. A high percentage of chimeras were obtained upon microinjection of the target clones into the host embryo during the blastulation stage. These chimeras were set up for mating. To determine if targeting worked as expected, peripheral blood from the chimera was collected prior to mating and the phenotype of immune cells in the peripheral blood was analyzed via FACS. As shown in FIG. 30, GFP-positive cells were detected in the peripheral blood of two of the three tested chimeras, with chimeric rats having less than 1% T cells, less than 1% B cells, and 1 Contains less than% NK cells, which are positive for GFP (ie, Il2rg KO cells) (FIGS. 29A-C).3.4 (a) (i). Targeting the Rag2 locus in rats with a large targeting vector (LTVEC) Table 26 provides a summary of the genomic composition of the rat Rag2 locus, and the locations shown were obtained from rat genome reference sequence construction 5.0 (ENSMBL). Rag2 is on chromosome 3 of the (+) strand.<tables num="26-1"><img id="000053" he="65" wi="150" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="26-2"><img id="000054" he="32" wi="151" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> FIG. 26 provides a schematic of the rat Rag2 locus and the large targeting vector (LTVEC). LTVEC is 140 kb and targets the rat Rag2 locus at about 5.7 kb for deletion. The schematic diagram above in FIG. 26 shows the genomic composition of the rat ApoE locus and the genomic regions corresponding to the 5'and 3'homologous arms (48 kb and 84 kb, dark gray boxes, respectively). Rag2 contains a single exon shown with a dotted gray shade. The schematic diagram below FIG. 26 is the LTVEC. The 5'and 3'homology arms (48 kb and 84 kb, respectively) are indicated by dark gray boxes. LTVEC contains a reporter gene (lacZ) and a self-deletion cassette adjacent to the loxP site (blank arrow). The self-deletion cassette includes a drug selection cassette containing a mouse Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the neomycin resistance gene. Another variant of LTVEC was created in which the neomycin resistance gene was replaced with a hygromycin resistance gene that allowed retargeting of rat ES cells targeting Il2rg. Crei contains two exons encoding Cre recombinase, which are separated by introns (Crei) to prevent their expression in prokaryotic cells. See, for example, US Pat. No. 8,697,851 and US Patent Publication No. 2013-0312129, which describe self-deletion cassettes in detail and are incorporated herein by reference in their entirety. By using the mouse Prm1 promoter, the self-deletion cassette can be specifically deleted in F0 rat male germ cells. LTVECs were electroporated into rat ES cells obtained in Example 1 and plated on neoR MEFs twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured and maintained as described in Example 1. Colonies were screened to obtain targeted clones as described elsewhere herein. The target clone is then injected into the host embryo as described elsewhere herein to produce F0 rats.3.4 (a) (ii). Targeting the Rag2 locus in rats with a large targeting vector (LTVEC) and CRISPR / Cas9 Table 27 shows variants of Rag2 LTVEC with the hygromycin resistance gene (see Figure 48) used alone to target the rat Rag2 locus or in combination with the CRISPR / Cas9 nuclease. Here is a comparison of the results of experiments targeting the rat Rag2 locus. In each experiment, electroporated pluripotent cells were densely plated and subjected to drug selection to find drug-resistant colonies. Drug-resistant colonies were selected and screened for targeted alterations using the modifications of the allele (MOA) assay described herein. Specifically, 4x106Cells were electroporated with 2 ug of Rag2 LT VEC at a voltage of 400 V, a capacitance of 100 uF, and a resistance of 0. In the latter experiment, 6 ug of Cas9 expression plasmid and 3 ug of Rag2 gRNA1 or 3 ug of Rag2 gRNA4 were also electroporated. Selection was made using 75 ug / mL G418. Rag2 gRNA1 has the sequence CCAGCTACTTGCTCGTACAA (SEQ ID NO: 89) and targets the 3'rat Rag2 start codon (ATG) in region 219 bp. Rag2 gRNA4 has the sequence CCCCTCAGATTCACGTGCGT (SEQ ID NO: 90) and targets 3'in the region 12 bp of the rat Rag2 stop codon (TAG) (see Figure 48). As shown in Table 27, when either Cas9, or gRNA, was introduced into cells with Rag2 LTVEC, targeting efficiency was increased (0% to 10% or 38%). Targeting of two alleles was observed in one colony.<tables num="27"><img id="000055" he="76" wi="160" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>3.4. (b) (i): Targeting of Rag1 and Rag2 loci in rats FIG. 27 provides the genomic structure of the rat Rag1 / Rag2 locus. The CDS indicates the code sequence, and the gray box represents the exon. Rag2 is on a "plus" strand with a transcription to the right. Rag1 is on a "minus" strand with a left transfer. Mbp = million base pairs Table 28 provides a summary of the genomic composition of the rat Rag2 and Rag1 loci, and the locations shown were obtained from Rat Genome Reference Sequence Construction 5.0 (ENSMBL). Rag1 is on chromosome 3 of the (-) strand.<tables num="28-1"><img id="000056" he="37" wi="142" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="28-2"><img id="000057" he="41" wi="144" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> FIG. 28 provides a schematic representation of the rat Rag2 and Rag1 loci as well as the large targeting vector (LTVEC). LTVEC is about 70 kb and targets the rat genomic locus of about 16.6 kb, including the Rag1 and Rag2 loci, for deletions. The schematic diagram above in FIG. 28 shows the genomic composition of the genomic regions (48 kb and 15 kb, dark gray boxes, respectively) corresponding to the Rag1 and Rag2 loci and the 5'and 3'homologous arms. Rag2 and Rag1 each contain a single exon, shown with a dotted gray shade. The schematic diagram below FIG. 28 is the LTVEC. The 5'and 3'homology arms (48 kb and 15 kb, respectively) are indicated by dark gray boxes. LTVEC contains a reporter gene (lacZ) and a self-deletion cassette adjacent to the loxP site (blank arrow). Self-deletion cassettes include drug selection cassettes containing a rat Prm1 promoter operably linked to the Crei gene and a human ubiquitin promoter operably linked to the neomycin resistance gene. Another variant of LTVEC was created in which the neomycin resistance gene was replaced with a hygromycin resistance gene that allowed retargeting of rat ES cells targeting Il2rg. Crei contains two exons encoding Cre recombinase, which are separated by introns (Crei) to prevent their expression in prokaryotic cells. See, for example, US Pat. No. 8,697,851 and US Patent Publication No. 2013-0312129, which describe self-deletion cassettes in detail and are incorporated herein by reference in their entirety. By using a rat Prm1 promoter that specifically drives Crei expression in male germ cells, the self-deletion cassette can be deleted in F0 rat male germ cells. LTVECs were electroporated into rat ES cells obtained in Example 1 and plated on neoR MEFs twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured and maintained as described in Example 1. Colonies were screened to obtain targeted clones as described elsewhere herein. The target clone is then injected into the host embryo as described elsewhere herein to produce F0 rats.3.4. (b) (ii): Retargeting of Rag1 and Rag2 loci in rat ES cells for which the Il2rg locus has already been targeted LTVEC, as seen in FIG. 50, was prepared to target the Rag1 and Rag2 loci for deletion. The total length of LTVEC was 72 kb. LTVEC was electroporated into rat ES cells that had already been targeted due to a deletion of the Il2rg locus as seen in Example 3.3. Specifically, rat ES cells were from clone Il2rg-CG12, and germline transmission was confirmed in Example 3.3 (a). Transformed rat ES cells were cultured and maintained as described in Example 1. Double-targeted clones were screened to obtain targeted clones, as described elsewhere herein. Il2rg-CG12 cells were retargeted with an efficiency of 85% and Il2rg mutations were still present in the targeted clones. Electroporation was performed and antibiotic selection was performed using 1.5 ug / ml puromycin as described elsewhere herein. The target clone will then be injected into the host embryo as described elsewhere herein to produce F0 rats. Retargeting is advantageous because it is faster than crossbreeding rats targeting Rag1 / Rag2 by rats targeting Il2rg.Example 4. Humanization 4.1. Humanization of rat genome locus The rat ES cells described herein can be used to maintain their pluripotency after one or more electroporations in vitro and can transmit target gene modifications to successive generations. The rat genome locus can be humanized. In addition, one or more target genes to avoid plasmid limitations and to overcome the low efficiency of introducing target gene modifications to endogenous loci in rat ES cells when adapting large genomic DNA fragments. Modifications are made in bacteria, such as E. coli, by utilizing bacterial homologous recombination (BHR) and using a large targeting vector (LTVEC). The LTVECs described herein include, for example, a large fragment of an endogenous rat genomic sequence with one or more modifications, or an exogenous nucleic acid flanked by rat homology arms that are complementary to a particular genomic region. Includes (eg, homologous or orthologous human nucleic acids).4.2. Humanization of rat immunoglobulin locus Humanization of an endogenous rat immunoglobulin heavy chain locus is associated with one or more endogenous rat immunoglobulin heavy chain nucleic acid sequences (eg, one or more endogenous V).HGene segment, one or more human D gene segments, and one or more human JHA targeting vector, eg, (i) one or more unrearranged human variable region nucleic acid sequences (eg, one or more human Vs), with the gene segment removed and at the modified immunoglobulin locus.HGene segment, one or more human D gene segments, and one or more human JHGene segment), or one or more rearranged human variable region nucleic acid sequences (eg, one or more human rearranged VDJ gene segments), (ii) selection cassette (eg, neomycin flanked by loxP sites) Resistance genes), as well as (iii) 5'and 3'rat homology arms, are carried out by introducing a large targeting vector (LTVEC). Briefly, one or more endogenous rat immunoglobulin heavy chain variable region gene segments (ie, one or more Vs) in rat BAC clones.HGene segment, one or more human D gene segments, and one or more human JHThe gene segment) is removed or the rat homology arm is inactivated by targeting an endogenous rat immunoglobulin heavy chain locus with an adjacent selection cassette. More specifically, the targeting vector is a target rat genomic sequence (eg, one or more rat Vs).HGene segment, one or more human D gene segments, and one or more human JH5'and 3'rat homology arms complementary to the upstream and downstream rat genomic DNA sequences containing the gene segment are configured to contain adjacent selection cassettes (eg, neomycin resistance genes adjacent to the loxP site). .. Bacterial cells containing a large rat genomic DNA fragment containing the rat immunoglobulin heavy chain locus are then selected and operably linked to a transiently induced promoter in a plasmid encoding a recombinase (eg, eg). Introduced with pABG). The targeting vector constructed above is then introduced into recombinant competent bacterial cells. After electroporation, bacterial cells are treated with an inducing factor (eg, arabinoside) in the BAC clone to initiate homologous recombination between the targeting vector and the target rat genomic sequence. Transformed cells are densely plated and subjected to drug selection to find drug-resistant colonies. Drug-resistant colonies are selected and screened for targeted alteration. A high-throughput quantitative assay to facilitate the identification of target gene modifications, i.e., an allele (MOA) assay that allows large-scale screening of alleles (including multiple) on the parent chromosome after gene modification. Modifications are used. MOA assays can be performed via a variety of analytical techniques, including but not limited to quantitative PCR, such as real-time PCR (qPCR). For example, real-time PCR includes a first primer set that recognizes a target locus and a second primer set that recognizes a non-targeted reference locus. In addition, the primer set can include a fluorescent probe that recognizes the amplified sequence. Alternatively, quantitative assays include fluorescence-mediated in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization to immobilized probes, Invader Probes®, MMP. Assay®, TaqMan® Molecular Beacon and Eclipse probe techniques can be performed via a variety of analytical techniques, including but not limited to these techniques. (See, for example, US Patent Application No. US2005 / 0144655, which is incorporated herein by reference in its entirety). The modified rat BAC clone, ie, one or more endogenous heavy chain variable region gene segments (V)H, D, and / or JHBacterial cells containing BAC clones containing a rat genomic DNA sequence lacking or inactivating a gene segment) are (i) one or more unrearranged human variable region nucleic acid sequences (eg, one or more). Human V not rearrangedHGene segment, one or more human D gene segments, and one or more human JHGene segment), or electroporation with a large targeting vector (LTVEC) containing one or more rearranged human variable region nucleic acid sequences (eg, one or more rearranged human VDJ gene segments). Initiation of homologous recombination and selection of positive clones in bacterial cells is performed as described above. The nucleic acid sequence of the unrearranged or rearranged human immunoglobulin heavy chain variable region can act on the nucleic acid sequence of the endogenous rat immunoglobulin heavy chain constant region when targeted at the endogenous immunoglobulin heavy chain locus. Is connected to. Alternatively, the endogenous rat heavy chain constant region locus can be inactivated, for example, by deleting one or more rat heavy chain constant region gene segments (CHs) from the endogenous heavy chain constant region locus. It can be replaced with the nucleic acid sequence of the human heavy chain constant region. Similarly, humanization of an endogenous rat immunoglobulin κ or λ light chain gene can result in one or more endogenous rat immunoglobulin κ and / or λ light chain variable region nucleic acid sequences (eg, one or more endogenous rat V).κGene segment and one or more endogenous rats JκThe gene segment) is removed and the targeting vector, eg, (i) one or more unrearranged human immunoglobulin light chain variable region nucleic acid sequences (eg, one or more human Vs).κGene segment and one or more human JκGene segment), or one or more rearranged human variable region nucleic acid sequences (eg, one or more human rearranged Vs)κ-JκUsing a large targeting vector (LTVEC), which comprises a gene segment), (ii) a selective cassette (eg, a neomycin resistance gene flanked by loxP sites), and (iii) 5'and 3'rat homology arms. It is done by targeting the modified immunoglobulin light chain locus. The nucleic acid sequence of the non-rearranged or rearranged human immunoglobulin light chain variable region can act on the nucleic acid sequence of the endogenous rat immunoglobulin light chain constant region when targeted at the endogenous immunoglobulin light chain locus. Is connected to. LTVECs so produced in bacterial cells include, for example, an inserted nucleic acid containing a humanized rat immunoglobulin heavy chain or light chain locus and one or more endogenous rat heavy chain or light chain variable region gene segments. Is replaced with one or more human heavy or light chain variable region gene segments and rat homologous arms (eg, ranging from 5 kb to 150 kb) complementary to a particular genomic target sequence. The LTVEC containing the genetic modification described above is then linearized and electroporated into rat ES cells. Electroporated rat ES cells are densely plated to select drug-resistant ES cells containing the targeting vector. The drug selection process removes most of the plated cells (about 99%), leaving individual colonies, each of which is a clone derived from a single cell. Of the remaining cells, most cells (about 80-100%) contain a targeting vector that is randomly aligned in the genome. Therefore, colonies are selected and genetically determined to identify rat ES cells containing the targeting vector with the correct genomic arrangement (eg, using modifications of the allele (MOA) assay described above). To increase the efficiency of target gene modification, rat ES cells are electroporated with an expression vector (or mRNA) that expresses ZFN1 and 2 (or TALEN1 and 2) together with LTVEC. The homology arm of the targeting vector is outside the ZFN target site, so the targeting vector is not cleaved by the ZFN. Double-strand breaks produced by ZFNs stimulate homologous orientation repair (HDR) or otherwise occupy a very low rate of repair that normally occurs in mammalian cells (non-homologous end binding, with NHEJ). Compared to). Alternatively, an expression vector containing a type II CRISPR-related nuclease (eg, Cas9), a guide RNA, including CRISPR-RNA (cr-RNA) and trans-activated CRISPR RNA (tracrRNA), as described herein. It can be introduced into bacterial cells together with LTVEC to increase the efficiency of homologous recombination at the target genomic locus. Electroporated cells are densely plated and subjected to drug selection to find drug-resistant colonies. Drug-resistant colonies are selected and screened for targeted alterations using the modifications of the allele (MOA) assay described herein. After these steps, an improvement in targeting efficiency can be achieved. For example, the amount of improvement can be small (eg, 10% to 15% improvement) or large (eg, 10% to 80% improvement). Selected rat ES cells containing the target gene modification are then introduced into a host rat embryo, eg, a premorula or blastoplasmic rat embryo, and transplanted into the uterus of the surrogate mother to create a primordial rat (F0). Rat) is made. The founding rats are then bred with wild-type rats to produce F1 offspring that are heterozygous for genetic modification. Mating of heterozygous F1 rats can produce homozygous offspring to genetic modification.4.3 (a). Replacement of rat IL2rg with human IL2 receptor gamma Table 29 provides a summary of the genomic composition of the rat interleukin-2 receptor gamma locus, and the locations shown were obtained from rat genome reference sequence construction 5.0 (ENSMBL). Il2rg is on chromosome X of the (-) strand.<tables num="29"><img id="000058" he="189" wi="142" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> The schematic below FIG. 25 is a targeting vector with a 3.2 kb deletion of Il2rg. The targeting vector contains a reporter gene (eGFP) operably linked to an endogenous promoter and a self-deletion cassette flanked by loxP sites (blank arrows). The self-deletion cassette contains a drug selection cassette containing the Crei gene operably linked to the mouse Prm1 promoter and the neomycin resistance gene operably linked to the human ubiquitin promoter. The Crei gene contains two exons encoding Cre recombinase, which are separated by introns (Crei) to prevent their expression in prokaryotic cells. See, for example, US Pat. No. 8,697,851 and US Patent Publication No. 2013-0312129, which describe self-deletion cassettes in detail and are incorporated herein by reference in their entirety. By using the mouse Prm1 promoter, the Cre expression cassette and drug selection cassette can be specifically deleted in F0 rat male germ cells. The targeting vector was electroporated into rat ES cells obtained in Example 1 and plated on a neomycin resistant MEF that was twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. The plasmid targeting vector was configured to replace the full-length rat interleukin 2 receptor gamma coding region with the full-length human interleukin 2 receptor gamma coding region, as shown in FIG. The targeting vector was electroporated into rat ES cells obtained in Example 1 and plated on a neomycin resistant MEF that was twice as concentrated as 15 cm in 2i + 10uM ROCKi. Specifically, 4x106Cells were electroporated with 2 ug of Il2rg full-length humanized vector at a voltage of 400 V, a capacitance of 100 uF, and a resistance of 0. Selection was made using 75 ug / mL G418. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. As shown in Table 44, 168 colonies were screened to obtain 6 target clones. The targeting efficiency was 3.57%. One clone was injected into the blastocysts described herein in Example 1 to give one clone to produce a chimera. The clones were injected into the blastocysts described herein in Example 1. A clone was obtained that produced an F0 chimeric rat. Using standard techniques, blastocysts were transferred to pseudopregnant receptive females to obtain chimeric F0 rats. Obtain F0 rats that transmit target modifications through germline.4.3 (b) (i). Substitution of rat IL2rg extracellular domain by human IL2rg extracellular domain Full-length humanization of the IL2 receptor gamma is useful because rats with this modified locus produce human IL-2rg, thereby detecting human Il2rg in rats with antibodies specific for human Il2rg. To enable. Extracellular humanization (ie, replacing the extracellular domain of rat IL-2rg with the extracellular domain of human IL-2rg) results in an IL-2rg polypeptide that binds to the human ligand of IL2-Rg. Since the cytoplasmic domain is still rat, the extracellular humanized form of IL-2rg will also interact with rat signaling mechanisms. FIG. 33 shows the human IL-2rg protein (SEQ ID NO: 20, NP_000197.1), the rat IL-2rg region (SEQ ID NO: 21, NP_543165.1), and the human extracellular domain fused to the rest of the rat IL-2rg protein. Provided is a sequence alignment of the chimeric IL-2rg protein (SEQ ID NO: 22) containing. The connection between human IL-2rg and rat IL-2rg is shown by a vertical line. Table 30 provides a summary of the genomic composition of the rat interleukin-2 receptor gamma locus, and the locations shown were obtained from Construction 5.0 of the rat genome reference sequence (ENSMBL). Il2rg is on chromosome X of the (-) strand. The location of the extracellular domain of Il2rg is further described.<tables num="30"><img id="000059" he="154" wi="159" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> The plasmid targeting vector was configured to replace the rat extracellular domain of the interleukin-2 receptor gamma coding region with the human extracellular domain, as shown in FIG. The targeting vector was electroporated into rat ES cells obtained in Example 1 and plated on a neomycin resistant MEF that was twice as concentrated as 15 cm in 2i + 10uM ROCKi. Transformed rat ES cells were cultured, selected and maintained as described in Example 1. As shown in Table 44, 192 colonies were screened to obtain 13 target clones. The targeting efficiency was 6.77%. Two clones were injected into the blastocysts described herein in Example 1 to give two clones producing chimeras. A clone was obtained that produced F0 rats. Obtain F0 rats that transmit target modifications through germline.4.3 (b) (ii). Substitution of rat IL2rg extracellular domain by human IL2rg extracellular domain using plasmid combined with CRISPR / Cas9 Table 31 shows a variant of the humanized vector of the extracellular domain of Il2rg shown in FIG. 32 used alone to target the rat Rag2 locus or in combination with the CRISPR / Cas9 nuclease. A comparison of the results of experiments targeting the rat Rag2 locus is shown. In each experiment, electroporated pluripotent cells were densely plated and subjected to drug selection to find drug-resistant colonies. Drug-resistant colonies were selected and screened for targeted alterations using the modifications of the allele (MOA) assay described herein. Specifically, 4x106Cells were electroporated with a humanized vector of 2 ug of Il2rg extracellular domain at a voltage of 400 V, a capacitance of 100 uF, and a resistance of 0. In the latter experiment, 6 ug of Cas9 expression plasmid and 3 ug of Il 2 rg gRNA2 or 3 ug of Il 2 rg gRNA 4 were also electroporated. Selection was made using 75 ug / mL G418. Il2rg gRNA2 has the sequence of GAAGCTCTTTCTATACAATCTGG (SEQ ID NO: 91) and targets 3'rat Il2rg exon 1 in region 190 bp. Il2rg gRNA4 has the sequence CCCCCGAAAGGAGGAGCCCTAGG (SEQ ID NO: 92) and targets the 5'rat Il2rg stop codon (TGA) in the region 80 bp (see Figure 49).<tables num="31"><img id="000060" he="64" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>4.4 (a). CRISPR / Cas9 endonuclease-enhanced targeting of large non-human animal gene deletions with concomitant human gene substitutions Newly developed drugs for human pathologies, such as fully human antibodies, are often highly specific for their targets in human cells and tissues and do not recognize homologous targets in rodents. This high level of selectivity makes it impossible to test the efficacy and mechanism of drug action in rodents prior to preemptive use of the drug in humans. A very effective solution to this problem is to generate genetically modified mice or rats that replace rodent homologues with the human gene encoding the drug target. One method for producing such humanized alleles in rodents is to first delete the rodent gene in embryonic stem (ES) cells and then in a second gene modification event. The exact insertion of a human gene at the locus of loss. ES cells are then injected into the rodent embryo and transplanted into the uterus of the rodent surrogate mother, which then gives birth to a genetically modified offspring that carry the humanized allele. A more effective method of humanizing gene modification is to use a large targeting vector (LTVEC) that simultaneously induces deletion of the rodent gene and its replacement with a human control. By using the VELOCIGENE® gene recombination method, such single-step humanization occurs when rodent gene deletions and human gene insertions are less than about 20 kilobase pairs (kb). In addition, it can be achieved with relatively high efficiency. Larger single-step humanizations that cause deletions and substitutions greater than 100 kb are possible by genetic recombination methods such as LTVEC and VELOCIGENE® gene recombination methods, but occasionally face very large alterations. Rather than reducing the targeting efficiency, success may require screening or hundreds of thousands of ES cell clones to find one with the desired genetic modification. To improve the efficiency of large humanization, we have developed a method for combining LTVEC gene targeting with Cas9 endonucleases (CRISPR / Cas9) guided by clustered, regular, scattered short palindromic repeat RNAs. The CRISPR / Cas9 nuclease binds to CRISPR RNA, which induces Cas9 to cleave at a specific DNA sequence by the Watson-Crick base pair between the guide RNA and one strand of the target DNA. It is a ribonucleoprotein enzyme consisting of DNA endonucleases. The simplicity of the targeting mechanism makes it easy to design CRISPR / Cas9 endonucleases that induce double-strand breaks at almost any genomic locus. Double-strand breaks are mutated and often induce genomic repair of cells by the non-homologous end joining (NHEJ) pathway, which results in deletions or insertions at the site of double-strand breaks. An alternative mechanism for repairing double-strand breaks is that endogenous or exogenous fragments of DNA that share sequence identity or similarity with a break site seamlessly break at the cut ends by the action of cell homologous recombination mechanisms. It is a homologous orientation type repair (HDR) that repairs. HDR can result in a complete repair that restores the original sequence at the site of cleavage, or is used to induce designed modifications such as deletion, insertion, or substitution of the sequence at the site of double-strand breaks. obtain. CRISPR / Cas9 nucleases can greatly increase the proportion of genetically engineered HDR events by inducing accurate double-strand breaks at the site of the intended genetic modification. Three nucleic acid molecules in rodent ES cells to result in the exact single-step deletion of all or part of the rodent gene and simultaneous substitution with all or part of its human homolog: (1). LTVEC, (2) plasmid or mRNA encoding Cas9 endonuclease, and (3) CRISPR A single guide RNA (sgRNA) or a plasmid encoding the sgRNA itself was introduced by electroporation. LTVEC is a human gene that encodes a gene product (protein or RNA) flanked by a homologous arm of rodent DNA designed to induce an HR event that deletes the rodent gene and inserts the human gene. Included all or part of. Humanized LTVEC also had a drug selection cassette that induces the expression of enzymes that develop resistance to antibiotics (eg, G418) (eg, neomycin phosphotransferase). ES cells that utilized LTVEC and integrated it into their genome were able to grow and form colonies on Petri dishes in growth medium containing antibiotics. Most of the LTVEC-containing drug-resistant colonies also contained the CRISPR / Cas9 component, at least temporarily, because they introduced a nuclear molecule that encodes CRISPR / Cas9 more than 500-1,000 times more than the LTVEC molecule. Drug-resistant colonies are selected and screened by allelic loss-of-allele methods (Valenzuela, D. et. al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21: 652-660, Frendewey, D. et al. (2010) The loss-of-allele assay for ES cell screening and mouse genotyping, Methods Enzymol. 476: 295-307, which are incorporated herein by reference in their entirety) have identified clones with the exact target humanization allele. In one particular experiment, LTVEC was designed to result in a 68 kb deletion of the mouse Lrp5 (low density lipoprotein receptor-related protein 5) gene and a co-substitution with a 91 kb fragment of the homologous human LRP5 gene (Fig. 34). ). LTVEC is a 91 kb of human LRP5 gene flanked by homologous arms containing 7 kb and 33 kb genomic DNA from a portion of the mouse Lrp5 locus flanking the 68 kb sequence of the mouse Lrp5 gene targeted for deletion. Included fragments. In another experiment, Lrp5 humanized LTVEC was subjected to Cas9-encoding plasmid and sgRNA (gA, gB, gB2) designed to form double-strand breaks within the region of the mouse Lrp5 gene targeted for deletion. , GC, gD, gE2, gE, gF) in combination with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human LRP5 gene. Table 32 shows the results of humanization of the Lrp5 gene supported by CRISPR / Cas9. We found that when LTVEC was introduced into ES cells alone, 1.0% of the drug-resistant clones screened had a heterozygous humanized allele of the single allele that was accurately targeted. In contrast, LTVEC was used in 7 of 8 tested sgRNAs (sgRNA-5'A, sgRNA-5'B, sgRNA-5'B2, sgRNA-C, sgRNA-D, sgRNA-3'E2, And sgRNA-3'F; the sequence provided in Table 33), combined with the Cas9 endonuclease derived by Cas9 endonuclease, heterozygousness of the single allelic gene to be accurately targeted with an efficiency ranging from 2.1 to 7.3%. It resulted in a mutation, which showed a 2- to 9-fold enhancement of single-step humanized gene targeting compared to unsupported LTVEC. In addition to targeting single alleles, for Cas9-induced cleavage by sgRNA-5'B2, homozygous humanization of the two alleles was detected with a frequency of 1%. Homozygous Lrp5 humanized ES cells are VELOCI mouse® genetic engineering (Poueymirou, WT et al. (2007) F0 generation mice fully derived from gene-targeted embryonic stem cells allowing immediate phenotypic analyzes, Nature Biotech. 25 : 91-99, which is incorporated herein by reference in its entirety), can be directly converted to fully ES cell-derived mice ready for phenotypic and efficacy studies.<tables num="32-1"><img id="000061" he="216" wi="162" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="32-2"><img id="000062" he="31" wi="157" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="33"><img id="000063" he="115" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Enhanced targeting of large Lrp5 humanizations with CRISPR / Cas9 endonucleases is significant compared to comparable experiments performed with zinc finger nucleases (ZFNs). We obtained four ZFNs designed to form double-strand breaks at sites within the region of the mouse Lrp5 gene that targeted the deletion (Figure 34). One ZFN targets a deletion of the sequence near the 5'end (a), one targets the deletion of the central sequence (b), and two lacks the sequence near the 3'end. Targeted loss (c, d). In a separate experiment, Lrp5 humanized LTVECs were administered to one of four ZFNs (a to d) designed to form double-strand breaks within the region of the mouse Lrp5 gene targeted for deletion. Combined with the plasmid to encode. All of the ZFNs were active and were able to induce NHEJ mutations in the Lrp5 gene (data not shown), but when combined with LTVEC, HDR-mediated gene targeting compared to LTVEC alone. It was judged that neither was enhanced. The enhanced targeting efficiency of large Lrp5 humanizations with CRISPR / Cas9 endonucleases is also significant compared to a series of ZFN-supported humanization experiments. In these experiments, a series of ZFN-supported humanizations were performed, with mouse target gene deletions and human gene insertions generally increasing in size (Table 34, Figure 35). FIG. 35A shows the percentage of targeting efficiency of LTVEC targeting genes with increased deletion size. LTVEC was used alone (gray square) or in combination with ZFN (black square). FIG. 35B shows the percentage of LTVEC targeting efficiency due to increased size human gene insertion. In addition, LTVECs were used alone (gray triangles) or in combination with ZFNs (black triangles). As shown in Table 34 and FIG. 35, the ability of ZFN-mediated DNA cleavage to enhance the targeting efficiency of LTVEC is greater when the mouse target gene deletion size is greater than 24.7 kb, and the human gene. Disappeared when the size of the insertion was greater than 22.2 kb (Table 34, Figure 35A). In contrast, CRISPR / Cas9 was able to enhance the Lrp5 gene's LPVEC targeting efficiency, which included a 68.3 kb mouse gene deletion and a 91.0 kb human gene insertion (Table 32). , Figure 34). This indicates that the CRISPR / Cas9 endonuclease can enhance the targeting efficiency of LTVEC in situations where other nucleases (eg, zinc finger nucleases) cannot enhance.<tables num="34"><img id="000064" he="159" wi="162" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>nd = not decided na = Not applicable () = Lower targeting efficiency with ZFN than without ZFN Comparative experiments were performed on humanization of other mouse genes. In one experiment, LTVEC was designed to result in a 45 kb deletion of the mouse Trpa1 (transient receptor latent cation channel subfamily A member 1) gene and a co-substitution with a 55 kb fragment of the homologous human TTrpa1 gene. (Fig. 36). LTVEC is a 55 kb of human TRPA1 gene flanked by homologous arms containing 41 kb and 58 kb genomic DNA from a portion of the mouse Trpa1 locus flanking the 45 kb sequence of the mouse Trpa1 gene targeted for deletion. Included fragments. In a separate experiment, Trpa1 humanized LTVEC was subjected to Cas9-encoding plasmid and eight sgRNAs (gA, gA2) designed to form double-strand breaks within the region of the mouse Trpa1 gene targeted for deletion. , GB, gC, gD, gE, gE2, and gF) were combined with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human TRPA1 gene. Table 35 shows the results of humanization of the Trpa1 gene supported by CRISPR / Cas9. We found that when LTVEC was introduced into ES cells alone, 1.0% of the drug-resistant clones screened had the heterozygous humanized allele of the single allele that was accurately targeted. In contrast, by combining LTVEC with Cas9 endonucleases derived by 6 of the 8 tested sgRNAs (A, A2, B, C, D, and F; sequences provided in Table 43). Heterozygous mutations of single alleles or complex heterozygotes or homozygous mutations of two alleles were produced, with efficiencies ranging from 1.0 to 3.1%. For Cas9-induced cleavage by gRNA A and gRNA F, complex heterozygous mutations were detected with a frequency of 1.0%.<tables num="35-1"><img id="000065" he="107" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="35-2"><img id="000066" he="86" wi="156" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> In another experiment, LTVEC was designed to result in a 55 kb deletion of the mouse Folk1 (glutamate carboxypeptidase 2) gene and a co-substitution with a 61 kb fragment of the homologous human FOLH1 gene (Fig. 37). LTVEC is a 61 kb of human FOLH1 gene flanked by homologous arms containing 22 kb and 46 kb genomic DNA from a portion of the mouse Fohl1 locus flanking the 55 kb sequence of the mouse Fohl1 gene targeted for deletion. Included fragments. In another experiment, Folh1 humanized LTVEC was subjected to a plasmid encoding Cas9 and six sgRNAs (gA, gA2) designed to form double-strand breaks within the region of the mouse Folh1 gene targeted for deletion. , GC, gD, gE, and gE2) were combined with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human FOLH1 gene. Table 36 shows the results of humanization of the Folh1 gene supported by CRISPR / Cas9. We found that none of the 96 screened drug-resistant clones had the heterozygous humanized allele of the single allele to accurately target when LTVEC was introduced into ES cells alone. In contrast, LTVEC was 1.0-3.1% by combining with Cas9 endonucleases derived by 3 of the 6 tested sgRNAs (A, D, and E2; sequences provided in Table 43). Heterozygous mutations of single alleles that are accurately targeted with a range of efficiencies have occurred.<tables num="36-1"><img id="000067" he="47" wi="160" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="36-2"><img id="000068" he="99" wi="157" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> In another experiment, LTVEC was designed to result in a 76 kb deletion of the mouse gene and a 97 kb fragment of the homologous human C5 gene at complement component 5 (C5 or Hc) (Fig. 38). LTVEC has a homology arm containing 34.1 kb and 31.2 kb genomic DNA derived from a portion of the mouse C5 (Hc) locus flanking the 76 kb sequence of the mouse C5 (Hc) gene targeted for deletion. It contained a 97 kb fragment of the adjacent human C5 gene. In another experiment, C5 (Hc) humanized LTVEC was designed to form double-strand breaks within the Cas9-encoding plasmid and region of the mouse C5 (Hc) gene targeted for deletion 6 Combined with a second plasmid encoding one of the two sgRNAs (gA, gB, gC, gD, gE, and gE2). The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human C5 gene. Table 37 shows the results of humanization of the C5 (Hc) gene supported by CRISPR / Cas9. We found that when LTVEC was introduced into ES cells alone, 1.0% of the drug-resistant clones screened had the heterozygous humanized allele of the single allele that was accurately targeted. In contrast, by combining LTVEC with Cas9 endonucleases derived from all six tested sgRNAs (A, B, C, D, E, and E2; sequences provided in Table 43), 4.2 ~ Heterozygous mutations of single alleles or complex heterozygous or homozygous mutations of two alleles were produced with an efficiency ranging from 16.7%. For Cas9-induced cleavage by gRNA A and E, complex heterozygous mutations were detected at a frequency of 5.2% and 4.2%, respectively.<tables num="37-1"><img id="000069" he="25" wi="159" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="37-2"><img id="000070" he="117" wi="159" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> In another experiment, LTVEC was designed to result in a 38 kb deletion of the mouse Adamts5 (disintegrin and metalloprotease with thrombospondin motif 5) gene and a co-substitution with a 43 kb fragment of the homologous human ADAMTS5 gene ( Figure 39). LTVEC is a 43 kb of human ADAMTS5 gene flanked by homologous arms containing 22 kb and 46 kb genomic DNA from a portion of the mouse Adamts5 locus flanking the 38 kb sequence of the mouse Adamts5 gene targeted for deletion. Included fragments. In a separate experiment, Adamts5 humanized LTVEC was subjected to a plasmid encoding Cas9 and eight sgRNAs (gA, gA2) designed to form double-strand breaks within the region of the mouse Adamts5 gene targeted for deletion. , GB, gC, gD, gE, gE2, and gF) were combined with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human ADAMTS5 gene. Table 38 shows the results of humanization of the Adamts5 gene supported by CRISPR / Cas9. We found that none of the 96 screened drug-resistant clones had the heterozygous humanized allele of the single allele to accurately target when LTVEC was introduced into ES cells alone. In contrast, LTVEC is accurately targeted with 1.0% efficiency by combining LTVEC with Cas9 endonucleases derived by two of the eight tested sgRNAs (B and F; sequences provided in Table 43). A heterozygous mutation of the single allele or a complex heterozygous mutation of the two alleles occurred. For Cas9-induced cleavage by gRNA E2, complex heterozygous mutations were detected with a frequency of 1.0%. Table 38. CRISPR / Cas9-supported screening results for Adamts5 gene for humanization<tables num="38"><img id="000071" he="177" wi="147" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> In another experiment, LTVEC was designed to result in a 102 kb deletion of the mouse Erbb4 (receptor tyrosine-protein kinase erbB-4) gene and a co-substitution with a 127 kb fragment of the homologous human Erbb4 gene (Fig. 40). .. LTVEC is a 127 kb of human ERBB4 gene flanked by homologous arms containing 48 kb and 26 kb genomic DNA from a portion of the mouse Erbb4 locus flanking the 102 kb sequence of the mouse Erbb4 gene targeted for deletion. Included fragments. In a separate experiment, Erbb4 humanized LTVEC was subjected to Cas9-encoding plasmid and eight sgRNAs (gA, gB) designed to form double-strand breaks within the region of the mouse Erbb4 gene targeted for deletion. , GB2, gC, gD, gE, gE2, and gF) were combined with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human ERBB4 gene. Table 39 shows the results of humanization of the Erbb4 gene supported by CRISPR / Cas9. We found that none of the 96 screened drug-resistant clones had the heterozygous humanized allele of the single allele to accurately target when LTVEC was introduced into ES cells alone. In contrast, LTVEC is accurately targeted with 1.0% efficiency by combining with Cas9 endonucleases derived by one of eight tested sgRNAs (D; sequences provided in Table 43). Heterozygous mutations of single alleles or complex heterozygous mutations of two alleles occurred. For Cas9-induced cleavage by gRNA D, complex heterozygous mutations were detected with a frequency of 1%.<tables num="39-1"><img id="000072" he="182" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="39-2"><img id="000073" he="12" wi="157" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> In another experiment, LTVEC was designed to result in a 110 kb deletion of the mouse Ror1 (tyrosine-protein kinase transmembrane receptor ROR1) gene and a co-substitution with a 134 kb fragment of the homologous human ROR1 gene (Fig. 41). .. LTVEC is a human ROR1 gene flanked by homologous arms containing 41.8 kb and 96.4 kb genomic DNA derived from a portion of the mouse Ror1 locus flanking the 110 kb sequence of the mouse Ror1 gene targeted for deletion. Contains a 134 kb fragment. In a separate experiment, Ror1 humanized LTVEC was subjected to Cas9-encoding plasmid and six sgRNAs (gA, gB) designed to form double-strand breaks within the region of the mouse Ror1 gene targeted for deletion. , GC, gD, gE, and gF) in combination with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human ROR1 gene. Table 40 shows the results of humanization of the Ror1 gene supported by CRISPR / Cas9. We found that none of the 96 screened drug-resistant clones had the heterozygous humanized allele of the single allele to accurately target when LTVEC was introduced into ES cells alone. In contrast, LTVEC is accurately targeted with 1.0% efficiency by combining LTVEC with Cas9 endonucleases derived by two of the six tested sgRNAs (D and F; sequences provided in Table 43). A heterozygous mutation of the single allele or a complex heterozygous mutation of the two alleles occurred. For Cas9-induced cleavage by gRNA F, complex heterozygous mutations were also detected with a frequency of 1%.<tables num="40-1"><img id="000074" he="116" wi="160" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="40-2"><img id="000075" he="43" wi="156" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> In another experiment, LTVEC was designed to result in a 79 kb deletion of the mouse Dpp4 (dipeptidyl peptidase 4) gene and a co-substitution with an 82 kb fragment of the homologous human DPP4 gene (Fig. 42). LTVEC is a human DPP4 flanked by 5'and 3'homologous arms containing 46 kb genomic DNA from a portion of the mouse Dpp4 locus flanking the 79 kb sequence of the mouse Dpp4 gene targeted for deletion, respectively. It contained an 82 kb fragment of the gene. In a separate experiment, Dpp4 humanized LTVEC was subjected to a plasmid encoding Cas9 and eight sgRNAs (gA, gB) designed to form double-strand breaks within the region of the mouse Dpp4 gene targeted for deletion. , GB2, gC, gD, gE, gE2, and gF) were combined with a second plasmid encoding one of them. The sgRNA was designed to avoid recognition of any sequence at the insertion site of the human DPP4 gene. Table 41 shows the results of humanization of the Dpp4 gene supported by CRISPR / Cas9. We found that when LTVEC was introduced into ES cells alone, 2.1% of the drug-resistant clones screened had the heterozygous humanized allele of the single allele that was accurately targeted. In contrast, LTVEC was induced by Cas9 derived from any one of eight tested sgRNAs (A, B, B2, C, D, E, E2, and F; sequences provided in Table 43). Combination with endonucleases resulted in heterozygous mutations of the single allele that were accurately targeted with efficiencies ranging from 2.1 to 7.3%.<tables num="41-1"><img id="000076" he="92" wi="163" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="41-2"><img id="000077" he="99" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Table 42 provides a table summarizing the results of CRISPR / Cas9-supported humanization of various mouse genes. The first row shows the target locus. The second row shows the magnitude of the deletion of the endogenous mouse locus (Del) and the magnitude of the insertion of the corresponding human locus (Ins). The remaining rows are for each state with a heterozygous mutation of the single allele, a complex heterozygous mutation of the two alleles, or a homozygous mutation of the two alleles that are exactly targeted. Shows many colonies (out of 96). "No gRNA" represents LTVEC alone, while the other rows represent LTVEC + corresponding gRNAs (indicated by their relative positions within the deletion locus).<tables num="42-1"><img id="000078" he="93" wi="156" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="42-2"><img id="000079" he="38" wi="156" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="43-1"><img id="000080" he="202" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="43-2"><img id="000081" he="244" wi="160" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="43-3"><img id="000082" he="141" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>Example 5. Summary of Target Modification of Rat Genome Locus Table 44. Summary of rats targeted with various vector types and nucleases discussed in Examples 3 and 4.<tables num="44-1"><img id="000083" he="242" wi="154" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="44-2"><img id="000084" he="242" wi="161" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="44-3"><img id="000085" he="241" wi="88" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Table 45 summarizes the targeting of rat ES cells with either plasmid or LTVEC in combination with CRISPR / Cas9. The two gRNAs were tested separately for their respective target loci: Rag2, ApoE, and Il2rg. CRISPR / Cas9 cleavage efficiency exceeded 20% at all three loci. Increased targeting efficiency and increased targeting of the two alleles were observed when CRISPR / Cas9 was used in combination with the targeting plasmid and LTVEC.<tables num="45-1"><img id="000086" he="223" wi="38" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="45-2"><img id="000087" he="223" wi="26" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> Table 46 provides a summary of germline transmission data for targeted alterations of the rat genomic locus. Germline transmission was confirmed in ApoE-targeted rats and Il2rg-targeted rats. Rat ES cells were XY (male) and targeted heterozygotes. Therefore, if the targeted ES cells contribute to the germline, about 50% of the ES cell-derived semen will carry the mutation allele and produce heterozygous F1 offspring.<tables num="46"><img id="000088" he="243" wi="34" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables>Example 6. Preparation, maintenance, and targeting of human-induced pluripotent stem cells 6.1. Preparation of human iPS cells This example illustrates the production of human iPS cells from non-pluripotent human cells. Piggy BaC (System Biosciences) Vector (PB-600A_CAGGS Bst XI (0.64 μg / μL)) containing genes encoding four reprogramming factors (hOct4, hSox2, hKLF-4, hMYC) operably linked to the CM7 promoter And PB-200 (0.99 μg / μL) were introduced into neonatal human capsule fibroblasts using the RED and BLUE GeneIn Transfection Reagent (Global Stem). Transfect cells were fed into NuFF1 feeders in E7 medium. Incubation on cells allowed uptake of vector and expression of reprogramming factors. E7 medium was DMEM / F-12, LVDS.3, L-ascorbic acid, insulin, transferrin, selenium, and FGF-2. Puromycin selection was initiated 10 days after transfection with 2 μg / mL puromycin in E7 medium. On day 21, select colonies, DMEM / F-12, LVDS3, L-ascorbic acid, insulin, transferrin, selenium, FGF-2, TGF-β1, glutathione, L-glutamine, prescribed lipids, thiamine, trace elements B and C, β-mercaptoethanol, bovine serum albumin, pipecoric acid, chloride The cells were cultured in mTeSR medium containing lithium and GABA. On days 29-57, cells were propagated and passaged in mTeSR medium until approximately 50% confluence was reached in 6-well plates. On days 65-73, reproduction and passage were continued using mTeSR medium and Gentle Cell Dissociation Reagent (Stem Cell Technologies). On day 76, the medium was replaced with low osmolal VG2i medium for further reproduction, passage, and maintenance of cells containing naive or naive-like hiPSC.6.2. Targeting LTVEC in human iPS cells This example illustrates the use of LTVEC targeting in human iPS cells. As shown in FIG. 51, human iPS cells propagated in VG2i medium were subjected to nucleic acid molecules: (1) LTVEC (0.67 μg), (2) plasmid encoding Cas9 endonuclease (5 μg), and (3) CRISPR. A plasmid (10 μg) encoding a single guide RNA (gRNA) was introduced by electroporation. Cas9 and gRNA were excluded from one set of samples. Specifically, 3x106Cells were electroporated with a voltage of 700 V, a capacitance of 25 uF, and a resistance of 400 ohms. LTVEC contains 16.7 kb of mouse Adam6a and Adam6b genes flanked by homology arms containing 34 kb and 105 kb genomic DNA from a genomic region flanking the 4.1 kb sequence of the human ADAM6 locus targeted for deletion. Containing the nucleic acid of. LTVEC also had a drug selection cassette that induces the expression of enzymes that develop resistance to the antibiotic (hygromycin). The human ADAM6 gRNA used had the sequence: GTATAGCCCTGTTACACATT (SEQ ID NO: 94). Cells that took up LTVEC and integrated it into their genome were able to grow and form colonies on tissue culture dishes coated with GELTREX in growth medium containing antibiotics. Most of the LTVEC-containing drug-resistant colonies also contained the CRISPR / Cas9 component, at least temporarily, because they introduced a nuclear molecule encoding CRISPR / Cas9, which is 500 to 1,000 times more than the LTVEC molecule. Drug-resistant colonies were selected and screened by allelic loss methods (Valenzuela et al. (2003) Nat. Biotech. 21: 652-660, Frendewey et al. (2010) Methods Enzymol. 476: 295-307, These have identified clones with the exact target allele) (which are incorporated herein by reference in their entirety). Table 47 shows the results of LTVEC targeting supported by CRISPR / Cas9 at the ADAM6 locus.<tables num="47"><img id="000089" he="25" wi="158" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> When LTVEC was introduced into human iPS cells alone, a targeting efficiency of 3.1% was observed. In contrast, LTVEC combined with Cas9 induced by ADAM6 gRNA resulted in a targeting efficiency of 7.3%.6.3. Effect of low osmolality medium on human iPS cell morphology This example illustrates the effects of salt concentration, ionic strength, and / or osmolality on the pluripotent state of human iPS cells in culture. Human iPS cells were cultured on MATRIGEL or GELTREX substrates in the media listed in Table 48 or mTeSR -hLIF medium.<tables num="48-1"><img id="000090" he="108" wi="127" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables><tables num="48-2"><img id="000091" he="11" wi="128" file="JP2016198110A_D0001.tif" img-format="tif" img-content="drawing" /></tables> If the basal medium used was DMEM, this medium was referred to as 2i medium. When the basal medium used was VG-DMEM, this low osmolal medium was referred to as VG2i medium. The osmolality of VG2i medium (233mOsm / kg) is lower than the osmolality of conventional 2i medium (261mOsm / kg). As shown in FIG. 52, human iPS cells cultured on MATRIGEL in 2i medium for 8 days (FIG. 52A) or 12 days (FIG. 52B) were primed with iPS cell morphological characteristics, particularly We showed growth and the appearance of hypopolarity in the epithelial monolayer. mTeSR-hLIF and VG2i media were further evaluated for their effects on human iPS cell morphology and pluripotent state. In this test, human iPS cells were cultured in MATRIGEL or NuFF feeder cells in mTeSR -hLIF medium (FIGS. 53A and 53C) or VG2i medium (FIGS. 53B and 53D) for 6 days. When cultured in MATRIGEL or NuFF feeder cells in mTeSR -hLIF medium, human iPS cells are morphologically characterized by a prime pluripotent state, especially growth and apical low polarity in the epithelial monolayer. Showed the appearance. Some cells cultured in mTeSR -hLIF medium began to exhibit morphology characterized by three-dimensional clamping. In contrast, when cultured in MATRIGEL or NuFF feeder cells in VG2i medium, human iPS cells show morphological features of the naive pluripotent state, especially growth and apex in round dome-shaped colonies. It showed a lack of polarity. 6.4. Effect of low osmolality medium on expression of pluripotent markers in human iPS cells This example illustrates the effect of salt concentration, ionic strength, and / or osmolality on the expression of pluripotent markers in human iPS cells reprogrammed from the prime state to the naive state. Twenty-four days after culturing on MATRIGEL substrate in VG2i medium, reprogrammed naive human iPS cells were stained for alkaline phosphatase or NANOG expression. Reprogrammed cells were observed to be strongly expressed in both alkaline phosphatase (Fig. 54A) and NANOG (Fig. 54B and 54C), indicating a state of naive pluripotency.6.5. Effect of low osmolality medium on enzyme dissociation and subculture of human iPS cells In this example, human iPS cells reprogrammed into a naive state using low osmolal VG2i medium were enzymatically dissociated with trypsin to create a single cell suspension (Fig. 55A). The cell suspension was subcultured on a new GELTREX coated plate for subculture in VG2i medium. It was observed after 1 day (Fig. 55B) and 4 days (Fig. 55C) that the subcultured cells continued to show the morphological characteristics of the cells in a naive pluripotency state. In particular, the cells grew as round dome-shaped colonies and showed no apical polarity. It was noteworthy that enzymatic dissociation could take place in the absence of ROCK inhibitors, which are generally required to prevent activation of the pro-apoptotic pathway. This suggests that the pro-apoptotic pathway is not as strongly activated as the enzyme dissociation and subculture period in naive human iPS cells cultured under the conditions specified herein. All publications and patent applications referred to in this application represent the level of one of ordinary skill in the art to which the present invention belongs. All publications and patent applications are incorporated herein by reference to the same extent as if each individual publication or patent application is specifically and individually indicated to be incorporated by reference. It may be used in combination with any other, unless otherwise specified in the context of any embodiment, aspect, step, or property of the invention. References to ranges include any integer within the range, any partial range within the range. References to multiple ranges include composite numbers in such ranges. For example, the present invention provides the following items in a preferred embodiment. (Item 1) A method for modifying the genome at a genomic locus of interest in mouse or human cells, where the genome is converted to the Cas protein, the genomic locus of interest, in the presence of a large targeting vector (LTVEC). Includes contact with CRISPR RNA and tracrRNA that hybridize to the target sequence of The LTVEC is at least 10 kb and is homologous to the 5'target sequence of the target genomic locus, the 5'homologous arm, and the 3'to the 3'target sequence of the target genomic locus. The homology arm comprises an adjacent first nucleic acid, the first nucleic acid being at least 30 kb and / or the 5'target sequence and the 3'target sequence being at least 30 kb apart. After contact with the Cas protein, the CRISPR RNA, and the tracrRNA in the presence of the LTVEC, the genome comprises a target gene modification comprising the insertion of the first nucleic acid at the genomic locus of interest. The method as described above. (Item 2) The method of item 1, wherein the Cas protein, the CRISPR RNA, the tracrRNA, and the LTVEC are introduced into the mouse or human cells. (Item 3) The method of item 1 or 2, further comprising identifying the modified mouse cell or the modified human cell, comprising the target gene modification at the genomic locus of interest. (Item 4) The method of item 2 or 3, wherein the CRISPR RNA and the tracr RNA are introduced together in the form of a single transcript. (Item 5) The method of item 2 or 3, wherein the CRISPR RNA and the tracr RNA are introduced separately. (Item 6) (a) The Cas protein is introduced into the mouse cell or the human cell in the form of a protein, messenger RNA (mRNA) encoding the Cas protein, or DNA encoding the Cas protein. (b) The CRISPR RNA is introduced into the mouse cell or the human cell in the form of RNA or DNA encoding the CRISPR RNA and (c) The method according to any one of items 2 to 5, wherein the tracrRNA is introduced into the mouse cell or the human cell in the form of RNA or DNA encoding the tracrRNA. (Item 7) The method according to item 6, wherein the Cas protein, the CRISPR RNA, and the tracrRNA are introduced into the mouse cell or the human cell as a protein-RNA complex. (Item 8) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA is in the form of a second expression construct comprising a second promoter operably linked to the third nucleic acid encoding the CRISPR RNA. (c) The DNA encoding the tracrRNA is in the form of a third expression construct comprising a third promoter operably linked to the fourth nucleic acid encoding the tracrRNA. The method of item 6, wherein the first, second, and third promoters are active in the mouse or human cells. (Item 9) 8. The method of item 8, wherein the first, second, and / or third expression constructs are on a single nucleic acid molecule. (Item 10) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA and the DNA encoding the tracr RNA were operably linked to a third nucleic acid encoding the CRISPR RNA and the gRNA containing the tracr RNA in a single transcript. In the form of a second expression construct, including a second promoter, The method of item 6, wherein the first and second promoters are active in said mouse cells or said human cells. (Item 11) 10. The method of item 10, wherein the first and second expression constructs are on a single nucleic acid molecule. (Item 12) Item 1 The target gene modification simultaneously comprises the deletion of an endogenous nucleic acid sequence at the target genomic locus and the insertion of the first nucleic acid at the target genomic locus in a single step. The method according to any one of ~ 11. (Item 13) 12. The method of item 12, wherein the deleted endogenous nucleic acid sequence is from about 30 kb to about 110 kb and the inserted first nucleic acid is from about 40 kb to about 140 kb. (Item 14) The method according to any one of items 1 to 13, wherein the target gene modification is a gene modification of two alleles. (Item 15) The method of item 14, wherein the genetic modification of the two alleles comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes and the insertion of the first nucleic acid. (Item 16) The method of item 14, wherein the modified mouse cell or the modified human cell is complex heterozygous at the genomic locus of interest. (Item 17) 14. The method of item 14, wherein the modified mouse cell or the modified human cell is semizygous at the genomic locus of interest. (Item 18) 16. The method of item 16, wherein the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of the first nucleic acid. (Item 19) The target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on the first and second homologous chromosomes, and (2) the subject on the first homologous chromosome. The method of item 16, wherein the method comprises inserting the first nucleic acid into a genomic locus and disrupting the genomic locus of interest on the second homologous chromosome. (Item 20) The method according to any one of items 1 to 19, wherein the LTVEC is at least 15 kb, at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, or at least 90 kb. (Item 21) The method according to any one of items 1 to 20, wherein the LTVEC is at least 100 kb, at least 150 kb, or at least 200 kb. (Item 22) The item, wherein the first nucleic acid is at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 150 kb, at least 200 kb, at least 250 kb, or at least 300 kb. The method according to any one of 1 to 21. (Item 23) The method according to any of items 1 to 22, wherein the first nucleic acid is from about 40 kb to about 140 kb. (Item 24) The method according to any one of items 1 to 23, wherein the mouse cell or the human cell is a primary cell or an immortalized cell. (Item 25) The method according to any one of items 1 to 23, wherein the mouse cell or the human cell is a pluripotent cell. (Item 26) 25. The method of item 25, wherein the mouse pluripotent cells are mouse embryonic stem (ES) cells. (Item 27) The human pluripotent cells are human embryonic stem (ES) cells, human adult stem cells, and developmentally restricted (developmentally). Restricted) The method of item 25, wherein is a human progenitor cell or a human induced pluripotent stem (iPS) cell. (Item 28) The human iPS cells were maintained in a medium containing a basal medium and a supplement, and the medium was (a) Leukemia inhibitory factor (LIF) polypeptide, (b) Glycogen synthase kinase (GSK3) inhibitor and (c) Contains MEK inhibitors 27. The method of item 27, wherein the medium has an osmolality of from about 175 mOsm / kg to about 280 mOsm / kg. (Item 29) The method according to any of items 1-28, wherein the Cas protein is Cas9. (Item 30) The method according to any one of items 1-29, wherein the protospacer flanking motif (PAM) sequence is immediately flanked by the target sequence. (Item 31) The method according to any one of items 1 to 30, wherein the sum of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 150 kb. (Item 32) The total of the 5'and 3'homology arms of the LTVEC is about 10 kb to about 20 kb, about 20 kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, and about 100 kb ~. The method according to any of items 1-31, which is about 120 kb, or about 120 kb to 150 kb. (Item 33) The target gene modification (a) Substitution of endogenous nucleic acid sequences by homologous or orthologous nucleic acid sequences, (b) Deletion of endogenous nucleic acid sequence, (c) Deletion of an endogenous nucleic acid sequence About 5 kb ~ about 10 kb, about 10 kb ~ about 20 kb, about 20 kb ~ about 40 kb, about 40 kb ~ about 60 kb, about 60 kb ~ about 80 kb, about 80 kb ~ about 100 kb, about 100 kb ~ about 150 kb, or about 150 kb ~ about 200 kb, about 200kb ~ about 300kb, about 300kb ~ about 400kb, about 400kb ~ about 500kb, about 500kb ~ about 1Mb, about 1Mb ~ about 1.5Mb, about 1.5Mb ~ about 2Mb, about 2Mb ~ about 2.5Mb, or about 2.5Mb ~ about Deletion of endogenous nucleic acid sequence, ranging from 3Mb, (d) Insertion of exogenous nucleic acid sequence, (e) Approximately 5 kb to approximately 10 kb, approximately 10 kb to approximately 20 kb, approximately 20 kb to approximately 40 kb, approximately 40 kb to approximately 60 kb, approximately 60 kb to approximately 80 kb, approximately 80 kb to approximately 100 kb, approximately 100 kb to approximately 150 kb, approximately 150 kb to approximately 200 kb Insertion of exogenous nucleic acid sequences ranging from about 200 kb to about 250 kb, about 250 kb to about 300 kb, about 300 kb to about 350 kb, or about 350 kb to about 400 kb, (f) Insertion of an exogenous nucleic acid sequence containing a homologous or orthologous nucleic acid sequence, (g) Insertion of chimeric nucleic acid sequences, including human and non-human nucleic acid sequences, (h) Insertion of a conditional allele adjacent to a site-specific recombinase target sequence, (i) Insertion of a selectable marker or reporter gene operably linked to an active promoter in said pluripotent cell, or (j) The method of any of items 1-32, comprising (j) a combination thereof. (Item 34) The method according to any of items 1-33, wherein the 5'target sequence and the 3'target sequence are at least 5 kb but separated by less than 3 Mb. (Item 35) The 5'target sequence and the 3'target sequence are at least 5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but less than 40 kb, at least 40 kb but less than 60 kb, and at least 60 kb. Less than 80 kb, at least about 80 kb but less than 100 kb, at least 100 kb but less than 150 kb, or at least 150 kb but less than 200 kb, at least about 200 kb but less than about 300 kb, at least about 300 kb but less than about 400 kb, at least About 400 kb but less than about 500 kb, at least about 500 kb but less than about 1 Mb, at least about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but less than about 2 Mb, at least about 2 Mb but about 2.5 Mb The method of any of items 1-34, wherein less than, or at least about 2.5 Mb, but less than about 3 Mb apart. (Item 36) The 5'target sequence and the 3'target sequence are at least 20 kb, at least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at least 110 kb, at least 120 kb, at least 130 kb, at least. 35. The method of item 1-35, wherein the method is 140 kb, at least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at least 190 kb, or at least 200 kb apart. (Item 37) The method according to any of items 1-36, wherein the 5'target sequence and the 3'target sequence are separated by about 30 kb to about 110 kb. (Item 38) The target genomic loci are the interleukin-2 receptor gamma locus, ApoE locus, Rag1 locus, Rag2 locus, both Rag1 and Rag2 loci, Adamts5 locus, Trpa1 locus, Folk1. The method according to any of items 1-37, comprising the locus, Erbb4 locus, Lrp5 locus, C5 (Hc) locus, Ror1 locus, or Dpp4 locus. (Item 39) The method according to any one of items 1 to 38, wherein the genomic locus of interest comprises extrachromosomal DNA. (Item 40) A method for producing F0 generation mice containing a target gene modification at a target genomic locus. (a) Hybridize the genome in mouse ES cells to the Cas protein, the target sequence of the genomic locus of interest, in the presence of a large targeting vector (LTVEC) to form modified mouse ES cells. By contacting with CRISPR RNA and tracrRNA, The LTVEC is at least 10 kb and is homologous to the 5'target sequence of the genomic locus of interest, the 5'homologous arm, and the 3'to the 3'target sequence of the genomic locus of interest. The homology arm comprises the adjacent first nucleic acid, the first nucleic acid is at least 30 kb and / or the 5'target sequence and the 3'target sequence are at least 30 kb apart from each other. , (b) Identifying the modified mouse ES cell containing the target gene modification at the target genomic locus, and (c) Introducing the modified mouse ES cells into a mouse host embryo and (d) Containing the mouse host embryo in a surrogate mother. The method, wherein the surrogate mother produces the F0 generation mouse comprising the target gene modification at the genomic locus of interest. (Item 41) 40. The method of item 40, wherein the CRISPR RNA and the tracr RNA are introduced together in the form of a single transcript. (Item 42) 40. The method of item 40, wherein the CRISPR RNA and the tracr RNA are introduced separately. (Item 43) (a) The Cas protein is introduced into the mouse ES cell in the form of a protein, messenger RNA (mRNA) encoding the Cas protein, or DNA encoding the Cas protein. (b) The CRISPR RNA is introduced into the mouse ES cells in the form of RNA or DNA encoding the CRISPR RNA and (c) The method according to any one of items 40 to 42, wherein the tracrRNA is introduced into the mouse ES cells in the form of RNA or DNA encoding the tracrRNA. (Item 44) 43. The method of item 43, wherein the Cas protein, the CRISPR RNA, and the tracrRNA are introduced into the mouse ES cells as a protein-RNA complex. (Item 45) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA is the CRISPR It is in the form of a second expression construct containing a second promoter operably linked to a third nucleic acid encoding RNA, and (c) The DNA encoding the tracrRNA is in the form of a third expression construct comprising a third promoter operably linked to the fourth nucleic acid encoding the tracrRNA. 43. The method of item 43, wherein the first, second, and third promoters are active in the mouse ES cells. (Item 46) The method of item 45, wherein the first, second, and third expression constructs are on a single nucleic acid molecule. (Item 47) (a) The DNA encoding the Cas protein is in the form of a first expression construct comprising a first promoter operably linked to a second nucleic acid encoding the Cas protein. (b) The DNA encoding the CRISPR RNA and the DNA encoding the tracr RNA were operably linked to a third nucleic acid encoding the CRISPR RNA and the gRNA containing the tracr RNA in a single transcript. In the form of a second expression construct, including a second promoter, 43. The method of item 43, wherein the first and second promoters are active in the mouse ES cells. (Item 48) 47. The method of item 47, wherein the first and second expression constructs are on a single nucleic acid molecule. (Item 49) Any of items 40-48, wherein the target gene modification simultaneously comprises a deletion of an endogenous nucleic acid sequence at the genomic locus of interest and insertion of the first nucleic acid at the genomic locus of interest. The method according to item 1. (Item 50) The method according to any one of items 40 to 49, wherein the target gene modification is a gene modification of two alleles. (Item 51) The method of item 50, wherein the genetic modification of the two alleles comprises the deletion of an endogenous nucleic acid sequence at the genomic locus of interest on two homologous chromosomes and the insertion of the first nucleic acid. (Item 52) The method of item 50, wherein the modified mouse ES cell is complex heterozygous at the genomic locus of interest. (Item 53) The method of item 50, wherein the modified mouse ES cell is semi-zygous at the genomic locus of interest. (Item 54) 52. The method of item 52, wherein the target gene modification at the genomic locus of interest on one chromosome comprises the deletion of an endogenous nucleic acid sequence and the insertion of the first nucleic acid. (Item 55) The target gene modification is (1) a deletion of an endogenous nucleic acid sequence at the genomic locus of interest on the first and second homologous chromosomes, and (2) the subject on the first homologous chromosome. 52. The method of item 52, comprising inserting the first nucleic acid into a genomic locus and disrupting the genomic locus of interest on the second homologous chromosome. (Item 56) The method according to any one of items 40 to 55, wherein the Cas protein is Cas9. (Item 57) A method for modifying the genome at a genomic locus of interest in eukaryotic cells, in the presence of a large targeting vector (LTVEC), the genome is the Cas protein, the target of the genomic locus of interest. Includes contact with CRISPR RNA, which hybridizes to the sequence, and tracrRNA. The LTVEC is at least 10 kb and is homologous to the 5'target sequence of the target genomic locus, the 5'homologous arm, and the 3'to the 3'target sequence of the target genomic locus. The homology arm comprises an adjacent first nucleic acid, the first nucleic acid being at least 30 kb and / or the 5'target sequence and the 3'target sequence being at least 30 kb apart. The eukaryotic cell is not a rat cell After contact with the Cas protein, the CRISPR RNA, and the tracrRNA in the presence of the LTVEC, the genome undergoes target gene modification involving the insertion of the first nucleic acid at the genomic locus of interest. Said method modified to include. (Item 58) The non-rat eukaryotic cells are pluripotent cells, non-pluripotent cells, mammalian cells, human cells, non-human mammalian cells, rodent cells, mouse cells, hamster cells, or fibroblasts. The method of item 57. (Item 59) 57. The method of item 57, wherein the non-rat eukaryotic cell is a primary cell or an immortalized cell.

Every citation, both ways

Citations
Document	Relation	Office	Category	Cited during	Relevant claims
JP2020507327A	Cited by	Japan	–	Search report	–
US11530388B2	Cited by	United States of America	–	Applicant	–
WO2013163394A1	Cites	World Intellectual Property Organization (WIPO)	Y	Search report	1-58
JP6174811B2	Cites	Japan	EX	Search report	55
JP6174811B2	Cites	Japan	EX	Search report	55
CELL STEM CELL, vol. 12, JPN6018047988, 4 April 2013 (2013-04-04), pages 393 - 394, ISSN: 0003934671	Non-patent	–	–	Search report	–
CELL STEM CELLS, vol. 13, JPN6018047991, 5 December 2013 (2013-12-05), pages 653 - 658, ISSN: 0003934672	Non-patent	–	–	Search report	–
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 441, JPN6016044568, 6 November 2013 (2013-11-06), pages 815 - 819, ISSN: 0003934673	Non-patent	–	–	Search report	–
CELL, vol. 153, JPN6016044569, 9 May 2013 (2013-05-09), pages 910 - 918, ISSN: 0003934674	Non-patent	–	–	Search report	–
SCIENCE, vol. 339, JPN6016044570, 15 February 2013 (2013-02-15), pages 823 - 826, ISSN: 0003934675	Non-patent	–	–	Search report	–
SCIENCE, vol. 339, JPN6016044571, 15 February 2013 (2013-02-15), pages 819 - 823, ISSN: 0003934676	Non-patent	–	–	Search report	–
TRENDS IN BIOTECHNOLOGY, vol. 31, JPN6018047994, July 2013 (2013-07-01), pages 397 - 405, ISSN: 0003934677	Non-patent	–	–	Search report	–

163 members in 27 offices

This recordMember, by publication datePriority claim17 more offices are in the list below

Priority claims12

Priority claims
Document	Office	Kind	Date
61914768	United States of America	–	2013-12-11
201361914768	United States of America	P	2013-12-11
62017416	United States of America	–	2014-06-26
201462017416	United States of America	P	2014-06-26
62029261	United States of America	–	2014-07-25
201462029261	United States of America	P	2014-07-25
62052906	United States of America	–	2014-09-19
201462052906	United States of America	P	2014-09-19
62059527	United States of America	–	2014-10-03
201462059527	United States of America	P	2014-10-03
62064384	United States of America	–	2014-10-15
201462064384	United States of America	P	2014-10-15

Members163

Family members, oldest first
Document	Office	Kind
US2014309487A1	United States of America	A1	2014-10-16
US2014310828A1	United States of America	A1	2014-10-16
CA2908697A1	Canada	A1	2014-10-23
WO2014172489A2	World Intellectual Property Organization (WIPO)	A2	2014-10-23
WO2014172489A3	World Intellectual Property Organization (WIPO)	A3	2014-12-11
US2015159174A1	United States of America	A1	2015-06-11
US2015159175A1	United States of America	A1	2015-06-11
CA2933433A1	Canada	A1	2015-06-18
WO2015088643A1	World Intellectual Property Organization (WIPO)	A1	2015-06-18
SG11201508028QA	Singapore	A	2015-10-29
AU2014253942A1	Australia	A1	2015-11-12
KR20150141987A	Republic of Korea	A	2015-12-21
US9228208B2	United States of America	B2	2016-01-05
CN105308184A	China	A	2016-02-03
EP2986729A2	European Patent Office (EPO)	A2	2016-02-24
US2016060657A1	United States of America	A1	2016-03-03
CA2963315A1	Canada	A1	2016-04-21
US2016108369A1	United States of America	A1	2016-04-21
WO2016061374A1	World Intellectual Property Organization (WIPO)	A1	2016-04-21
JP2016515401A	Japan	A	2016-05-30
IL245674A0	Israel	A0	2016-06-30
IL245674D0	Israel	D0	2016-06-30
AU2014360811A1	Australia	A1	2016-07-28
MX2015014487A	Mexico	A	2016-07-28
HK1214625A1	Hong Kong, China	A1	2016-07-29
KR20160095150A	Republic of Korea	A	2016-08-10
CN105980568A	China	A	2016-09-28
EP2986729A4	European Patent Office (EPO)	A4	2016-10-19
EP3080279A1	European Patent Office (EPO)	A1	2016-10-19
JP2016198110AThis record	Japan	A	2016-12-01
JP2016539655A	Japan	A	2016-12-22
US9546384B2	United States of America	B2	2017-01-17
US2017067078A1	United States of America	A1	2017-03-09
AU2015332451A1	Australia	A1	2017-04-20
SG10201700961TA	Singapore	A	2017-04-27
SG11201702309RA	Singapore	A	2017-04-27
AU2014360811B2	Australia	B2	2017-05-18
RU2015148637A	Russian Federation	A	2017-05-22
KR20170070136A	Republic of Korea	A	2017-06-21
IL251576A0	Israel	A0	2017-06-29
IL251576D0	Israel	D0	2017-06-29
US2017204430A1	United States of America	A1	2017-07-20
CN107002042A	China	A	2017-08-01
JP6174811B2	Japan	B2	2017-08-02
MX2016007654A	Mexico	A	2017-08-15
EP3207124A1	European Patent Office (EPO)	A1	2017-08-23
AU2017210669A1	Australia	A1	2017-08-24
KR101773782B1	Republic of Korea	B1	2017-09-01
KR20170102056A	Republic of Korea	A	2017-09-06
BR112016013400A2	Brazil	A2	2017-09-26
BR112015026197A2	Brazil	A2	2017-10-10
JP2017536811A	Japan	A	2017-12-14
BR112017007770A2	Brazil	A2	2018-01-16
RU2016126989A	Russian Federation	A	2018-01-23
MX2017004890A	Mexico	A	2018-02-12
EP2986729B1	European Patent Office (EPO)	B1	2018-09-19
EP3080279B1	European Patent Office (EPO)	B1	2018-09-26
JP6411463B2	Japan	B2	2018-10-24
LT2986729T	Lithuania	T	2018-10-25
LT3080279T	Lithuania	T	2018-10-25
DK2986729T3	Denmark	T3	2018-10-29
DK3080279T3	Denmark	T3	2018-11-05
RU2017116678A	Russian Federation	A	2018-11-22
SG10201808935WA	Singapore	A	2018-11-29
PT2986729T	Portugal	T	2018-11-30
PT3080279T	Portugal	T	2018-12-17
RU2676708C2	Russian Federation	C2	2019-01-10
HRP20181632T1	Croatia	T1	2019-01-11
SMT201800653T1	San Marino	T1	2019-01-11
SMT201800671T1	San Marino	T1	2019-01-11
AU2017210669B2	Australia	B2	2019-01-17
HRP20181648T1	Croatia	T1	2019-01-25
SI3080279T1	Slovenia	T1	2019-01-31
ES2699578T3	Spain	T3	2019-02-11
ES2700596T3	Spain	T3	2019-02-18
US10208317B2	United States of America	B2	2019-02-19
SI2986729T1	Slovenia	T1	2019-02-28
EP3456831A1	European Patent Office (EPO)	A1	2019-03-20
EP3460063A1	European Patent Office (EPO)	A1	2019-03-27
HUE040575T2	Hungary	T2	2019-03-28
PL3080279T3	Poland	T3	2019-03-29
RS58159B1	Serbia	B1	2019-03-29
RS58255B1	Serbia	B1	2019-03-29
AU2019202160A1	Australia	A1	2019-04-18
US2019112619A1	United States of America	A1	2019-04-18
RU2685914C1	Russian Federation	C1	2019-04-23
PL2986729T3	Poland	T3	2019-04-30
RU2019111616A	Russian Federation	A	2019-05-06
JP6517755B2	Japan	B2	2019-05-22
RU2017116678A3	Russian Federation	A3	2019-05-22
HUE041331T2	Hungary	T2	2019-05-28
EP3207124B1	European Patent Office (EPO)	B1	2019-06-26
JP2019110925A	Japan	A	2019-07-11
DK3207124T3	Denmark	T3	2019-08-12
US10385359B2	United States of America	B2	2019-08-20
PT3207124T	Portugal	T	2019-08-27
US10428310B2	United States of America	B2	2019-10-01
US2019323032A1	United States of America	A1	2019-10-24
EP3561052A1	European Patent Office (EPO)	A1	2019-10-30
MX369747B	Mexico	B	2019-11-20

Showing 100 of 163

12 legal events, as the office reported them to INPADOC

Over the term

Point at a mark for the event

Events

Legal events, newest first
	Event	Code
2025-04-07	Receipt of annual feesJAPANESE INTERMEDIATE CODE: R250R250	R250
2024-04-04	Receipt of annual feesJAPANESE INTERMEDIATE CODE: R250R250	R250
2023-03-29	Receipt of annual feesJAPANESE INTERMEDIATE CODE: R250R250	R250
2022-03-31	Receipt of annual feesJAPANESE INTERMEDIATE CODE: R250R250	R250
2019-04-26	Certificate of patent or registration of utility modelJAPANESE INTERMEDIATE CODE: R150R150	R150
2019-04-25	First payment of annual fees (during grant procedure)JAPANESE INTERMEDIATE CODE: A61A61	A61
2019-03-19	Written decision to grant a patent or to grant a registration (utility model)JAPANESE INTERMEDIATE CODE: A01A01	A01
2019-03-14	Decision of grant or rejection writtenTRDD	TRDD
2019-03-04	Request for written amendment filedJAPANESE INTERMEDIATE CODE: A523A521	A521
2018-12-05	Notification of reasons for refusalJAPANESE INTERMEDIATE CODE: A131A131	A131
2017-10-11	Written submission of copy of amendment under article 19 pctJAPANESE INTERMEDIATE CODE: A524A524	A524
2017-10-11	Written request for application examinationJAPANESE INTERMEDIATE CODE: A621A621	A621