System and methods for nucleic acid sequencing of single molecules by polymerase synthesis

(Cross-reference to related applications) This application is based on US Provisional Patent Application No. 60 / 112,078 filed on December 14, 1998, and No. 60 / 115,496 filed on January 11, 1999 (these disclosures are for all purposes). To claim priority in their entirety (incorporated herein by reference).

(Statement of rights to inventions made under federal-sponsored research and development) [Not applicable] (Field of invention) The present invention relates to improved methods for sequencing and genotyping nucleic acids in a single molecule arrangement. This method involves the detection of a single molecule of the fluorescently labeled pyrophosphate [PPi] moiety released from nucleotide triphosphate [NTP] when the polymerase extension product is made.

(Background of invention) Previous non-electrophoretic sequencing and gene determination methods did not utilize continuous detection of PPi release from integrated nucleotides. In the prior art of PPi sequencing (www.pyrosepuencing.com), each nucleotide (adenosine 5'-phosphate "A", cytidine 5'-phosphate "C", guanosine 5'-phosphate, uridine 5'phosphorus The acid "U" and thymidine 5'-phosphate "T") were added separately to the reaction mixture containing the nucleic acid target and the polymerase. The current nucleotide is removed before the next nucleotide is added. Nucleotide uptake is achieved by the release of PPi from NTP and is detected by a secondary assay for PPi. Since the PPi portion of NTP is not labeled, a secondary assay is required. Only one nucleotide can be tested per cycle; if all four NTPs are present at the same time, the polymerization reaction will continue uncontrolled and no sequence information will be available. The read length is limited by the loss of synchronization between the target nucleic acid molecules in the sample.

Other non-electrophoretic methods (eg, stepwise ligation and cleavage of the probe on a DNA fragment bound to microbeads) require synchronization of the DNA molecule, which is necessarily attenuated in each cycle. And.

This method solves these problems and has advantages over other sequencing methods. If all four nucleotides are added at the same time, stepwise addition of nucleotides is unnecessary. When the polymerase continuously incorporates all four nucleotides into the extending nucleic acid [NA] strand, sequence information is generated contiguously. Since single molecules are observed separately, there is no loss of synchronization. Single molecule analysis also allows the use of NA fragments taken directly from the organism. It is no longer necessary to prepare NA for sequencing using this method using cloning or amplification steps, but NAs thus prepared can still be sequenced. In addition, there is the possibility of simultaneously sequencing and genotyping many different nucleic acids on a single surface.

<p> (Gist of the invention) The present invention provides methods for genotyping or sequencing a target nucleic acid [NA], including the following steps: i. Immobilization of a nucleic acid polymerase or target nucleic acid on a solid support in a single molecule arrangement. ii. Steps of contacting a solid support with a solution containing: (a) the target nucleic acid if this polymerase is immobilized, or the polymerase if this target nucleic acid is immobilized; (b) sequence Primer nucleic acids that complement the region of the target nucleic acid downstream of the region to be determined; (c) Each type of base is an NTP that is differentially labeled with a phosphate moiety, where these labels are polymerase extended. NPT; iii. A step of continuously extending a primer and incorporating the NTP into a polymerase to make a complement to the target nucleic acid, which provides a unique signal that can be selectively detected upon incorporation of the NTP into the product. ; And iv. The step of determining primer extension and genotyping or sequencing the target nucleic acid by detecting a unique signal from the labeled NTP. This method may use solutions containing at least two different NTP types.</p><p> If the γ-phosphate is excised from the nucleoside, it is preferred that this NTP be labeled on the γ-phosphate with a fluorescent label that emits differential fluorescence. The immobilized moiety may further include an array of positions each carrying a single molecule of polymerase or target nucleic acid. This immobilized moiety can be a polymerase located as an array of individual single molecules on a solid support. For genotyping, this target nucleic acid can be a single nucleotide polymorphism. In such an environment, it is only necessary to add a solution with a single type of NTP. With respect to sequencing, the determination comprises a continuous determination of different NTP types and provides a sequence of target nucleic acids. In a preferred embodiment, the dNTP is labeled with a fluorophore on the γ phosphate and quenching moieties. In another preferred embodiment, the solution in contact with the solid support flows past the immobilized polymerase or target NA. This polymerase can be a DNA-dependent or RNA-dependent DNA polymerase or a DNA-dependent RNA polymerase. This NTP can be ribonucleotide triphosphate [rNTP] or deoxynucleotide triphosphate [dNTP], depending on the target nucleic acid and the polymerase used.</p><p> The invention further includes a system for genotyping or sequencing a target NA, including: i. A solid support with a surface carrying an immobilized nucleic acid polymerase or immobilized target NA in a single molecule arrangement; ii. Solutions for contacting surfaces containing: (a) Target NA if the polymerase is immobilized, or polymerase if the target NA is immobilized; (b) Where this polymerase is There are added primers that require the use of primer nucleic acids and complement the region of the target NA downstream of the sequenced region; (c) each type of NTP base is differentially labeled with a phosphate moiety. And this label provides a unique signal that is selectively detected upon incorporation of NTP into the polymerase extension product. This system embraces the same embodiments identified above with respect to the method. If the system contains a flowing solution, the force due to this flow can be generated mechanically or electroosmotically using electrodes.</p><p> The present invention further provides a solid support with a surface, the surface having a nucleic acid polymerase array attached to the surface, the members of which array consists of individual molecules of polymerase. Members of this array are provided as needed to define their location, and comparison information between sites can be generated and recorded by an optical reader. The solid support can have a DNA-dependent DNA polymerase, or a DNA-dependent RNA polymerase, or an RNA-dependent DNA polymerase (reverse transcriptase) that is bound to it. Preferably, this immobilized moiety is in a single molecule arrangement.<u style="single">The present invention also provides the following items.</u><u style="single"> (Item 1) A method for genotyping or sequencing a target nucleic acid.</u><u style="single">Step below:</u><u style="single"> i. Immobilization of nucleic acid polymerase or target nucleic acid on a solid support in a single molecule arrangement;</u><u style="single"> ii. The step of bringing the solid support into contact with the solution, the solution is:</u><u style="single"> (a) If the polymerase is immobilized, the target nucleic acid, or if the target nucleic acid is immobilized, the polymerase;</u><u style="single"> (b) Primer nucleic acid complementing the region of the target nucleic acid downstream of the region sequenced;</u><u style="single"> (c) Each type of base is nucleotide triphosphate [NPT], which is differentially labeled on the phosphate moiety, which is selective upon incorporation of NTP into the extension product of the polymerase. Nucleotide triphosphate [NPT], which provides a unique signal that can be detected in</u><u style="single">Process including;</u><u style="single"> iii. The step of continuously extending the primer to the polymerase and incorporating NTP to make a complement to the target nucleic acid; and</u><u style="single"> iv. The step of determining the extension of the primer by detecting the unique signal from the labeled NTP and genotyping or sequencing the target nucleic acid.</u><u style="single">Including, methods.</u><u style="single"> (Item 2) The method of item 1, wherein the solution comprises at least two different types of dNTPs.</u><u style="single"> (Item 3) The method according to item 1, wherein the dNTP is labeled on the γ-phosphate with a fluorescent label that emits fluorescent light differentially when the γ-phosphate is excised from the nucleotide.</u><u style="single"> (Item 4) The method of item 1, wherein the surface of the solid support comprises an array of positions each carrying a single molecule of polymerase or target DNA.</u><u style="single"> (Item 5) The method of item 1, wherein the polymerase is immobilized on a solid support as an array of individual single molecules.</u><u style="single"> (Item 6) The method according to item 1, wherein the target DNA is a single nucleotide polymorphism.</u><u style="single"> (Item 7) The method according to item 6, wherein the above solution contains a single dNTP.</u><u style="single"> (Item 8) The method according to item 1, wherein the detection is a continuous detection of different types of dNTPs to provide a sequence of target DNA.</u><u style="single"> (Item 9) The method according to item 1, wherein the NTP is labeled with a fluorophore on the γ phosphate and quenching moiety.</u><u style="single"> (Item 10) The method according to item 1, wherein the detector is an optical reader.</u><u style="single"> (Item 11) The method according to item 1, wherein the solution in contact with the solid support flows through the immobilized polymerase or target DNA.</u><u style="single"> (Item 12) The method according to item 1, wherein the target nucleic acid is a deoxynucleotide acid, the polymerase is either a DNA-dependent DNA polymerase or an RNA-dependent DNA polymerase, and the NTP is a dNTP.</u><u style="single"> (Item 13) The method according to item 1, wherein the target nucleic acid is double-stranded DNA, the polymerase is RNA polymerase, and the NTP is rNTP.</u><u style="single"> (Item 14) A system for genotyping or sequencing a target nucleic acid, which is as follows:</u><u style="single"> i. Solid support with immobilized nucleic acid polymerase or surface carrying the target nucleic acid in a single molecule arrangement;</u><u style="single"> ii. A solution for contacting the surface, the following:</u><u style="single"> (a) If the polymerase is immobilized, the target nucleic acid, or if the target nucleic acid is immobilized, the polymerase;</u><u style="single"> (b) A molar excess of nucleotide triphosphate [NTP], each type of NTP base is differentially labeled on the phosphate moiety, where the labeling is in the polymerase extension product. A solution containing a molar excess of nucleotide triphosphate [NTP] that provides a unique signal that can be selectively detected upon uptake of NTP.</u><u style="single">The system.</u><u style="single"> (Item 15) The system according to item 14, wherein the polymerase is a DNA-dependent DNA polymerase, the target nucleic acid is DNA, and the NTP is dNTP, and the system is sequenced. A system further comprising a primer nucleic acid that is complementary to the region of the target nucleic acid downstream of the region.</u><u style="single"> (Item 16) The system according to item 14, wherein the surface carries an immobilized DNA-dependent DNA polymerase.</u><u style="single"> (Item 17) The system according to item 14, wherein the solution comprises at least two different types of dNTPs.</u><u style="single"> (Item 18) The system of item 14, wherein the surface of the solid support comprises an array of positions each carrying a single molecule polymerase or target nucleic acid.</u><u style="single"> (Item 19) The system of item 14, wherein the surface of the solid support comprises an array of positions each carrying a single molecule polymerase.</u><u style="single"> (Item 20) The system according to item 14, wherein when γ-phosphate is excised from the above-mentioned nucleotide, the above-mentioned NTP is labeled with the γ-phosphate using a fluorescent label that emits fluorescent light in a differential manner.</u><u style="single"> 21. The system of item 14, wherein the target nucleic acid is DNA, wherein the DNA has a single nucleotide polymorphism derived from wild-type DNA.</u><u style="single"> (Item 22) The system according to item 14, wherein the solution comprises a single dNTP.</u><u style="single"> (Item 23) The system according to item 14, wherein the polymerase is an RNA-dependent DNA polymerase, the target nucleic acid is RNA, and the NTP is dNTP.</u><u style="single"> (Item 24) The system according to item 14, wherein the polymerase is a DNA-dependent RNA polymerase, the target nucleic acid is double-stranded DNA, and the NTP is rNTP.</u><u style="single"> (Item 25) The system according to item 14, further comprising an optical reader.</u><u style="single"> (Item 26) The solid according to item 14, wherein the system further comprises an electrode, which is sufficient to bring the flow of the solution into contact with the immobilized polymerase or target nucleic acid. A system that is arranged to provide a voltage gradient across a support.</u><u style="single"> (Item 27) A solid support having a surface, wherein the solid support has a surface, wherein the surface has a nucleic acid polymerase array attached thereto, wherein members of the array are present. A solid support consisting of individual molecules of polymerase.</u><u style="single"> (Item 28) The solid support according to item 25, wherein the members of the above array are addressed.</u><u style="single"> (Item 29) The solid support according to item 25, wherein the polymerase is a DNA-dependent DNA polymerase.</u><u style="single"> (Item 30) The solid support according to item 25, wherein the polymerase is a DNA-dependent RNA polymerase.</u></p>

<figref num="1">Figure 1 shows the chemical structure of the quenching moiety connected to uracil via a linker.</figref><figref num="2">FIG. 2 describes a dye linked to a γ phosphate of a nucleotide that also has a quenching moiety.</figref><figref num="3-1">FIG. 3 outlines a synthetic pathway for producing nucleotides that have a fluorophore on the γ phosphate and a quenching moiety on the base.</figref><figref num="3-2">FIG. 3 outlines a synthetic pathway for producing nucleotides that have a fluorophore on the γ phosphate and a quenching moiety on the base.</figref><figref num="4">FIG. 4 is an overview of the system for polymerase synthesis sequencing of target nucleic acids.</figref><figref num="5">FIG. 5 is a schematic representation of how DNA polymerase is immobilized on a solid support and the target nucleic acid is DNA.</figref><figref num="6">FIG. 6 is a schematic representation of how RNA polymerase is immobilized on a solid support and the target nucleic acid is double-stranded DNA.</figref>

(Definition) "Addressable" in the context of an array refers to members of the array that are located within individual and defined areas.

"Array" refers to a solid support having more than one site or position with either the target nucleic acid or the nucleic acid polymerase that binds to the solid support.

"Complementing the region of the target nucleic acid downstream of the region to be sequenced" in the context of sequencing or genotyping refers to the fact that the primer is extended in the 3'direction by the polymerase. Therefore, the primer that binds to the partial sequence (downstream) of target 3'with respect to the target sequence determined as the 3'end of the primer is extended.

"Genotyping" is the determination of the allele content of the target DNA, not necessarily the content of the entire DNA sequence. This is a subset of sequencing. For example, identification of a single nucleotide polymorphism by determining a single nucleotide difference between two known allelic forms is a form of sequencing that does not require all the target DNA to be sequenced.

"Immobilization" refers to the binding of a target nucleic acid or polymerase to a solid support by a method that prevents the release of the target nucleic acid or polymerase in the reaction solution. The method can be covalent or ionic or hydrophobic.

"Optical reader" refers to a device capable of detecting and recording light emitted from a labeled dNTP.

"Sequencing" refers to the determination of the order and position of bases in a nucleic acid.

"Single molecule arrangement" refers to an array of molecules on a solid support presented as individual molecules in which the members of the array are located within defined positions. This member can be the same or different.

Nucleotide The "base type" in the context of triphosphate [NTP] refers to a nucleotide that can be recognized as a substrate for a polymerase. Typical bases include adenine bases, cytosine bases, guanine bases, uracil bases, or thymidine bases, where this type is a subpopulation of nucleotides having bases within a population of NTPs carrying different bases. To say. Other rare (rarer) bases or analogs can be replaced with xanthine or hypoxanthine or methylated cytosine and the like.

(Detailed explanation) (1. Introduction) The present invention provides novel means for genotyping and sequencing nucleic acids. The method described herein uses individual fluorescent NTP molecules identified at one time as RNA-dependent or DNA-dependent polymerases that incorporate their respective NTPs into the extension product. To do. This NTP transports two adducts: a fluorescent dye added to the γ phosphate and a fluorescent quencher added to either a base or sugar or dye. When the quencher is added to a base or sugar, the NTP is hydrolyzed as it is incorporated into the extension product, and the free pyrophosphate dye moiety becomes fluorescent. This currently non-quenching free dye becomes fluorescent, and this development is imaged at a video rate under a microscope.

The flowing stream wipes the dye from the parent molecule. All four NTPs exist at the same time. If the polymerase continues to move along the target nucleic acid, this nucleotide sequence is read from the order of the dyes released.

(2. Source of target nucleic acid) The target nucleic acid is not important and can come from a variety of standard sources. The source can be mRNA, ribosomal RNA, genomic DNA or cDNA. If this target is from a biological source, there are various known procedures for extracting nucleic acids, and optionally to concentrations convenient for genotyping or sequencing operations. Amplified. Nucleic acid can be obtained from any living cell of human, animal or plant. Humans, pathogens and viruses are particularly interesting sources.

Nucleic acid amplification methods are also known. Preferably, this amplification is carried out by the polymerase chain reaction (PCR) (US Pat. Nos. 4,683,202, 4,683,195, and 4,889,818; Gyllenstein et al., 1998, Proc. Natl. Acad. Sci. USA 85: 7652-7656; Ochman et al., 1988, Genetics 120: 621-623; Loh et al., 1989, Science 243: 217-220; Innis et al., 1990, PCR Protocols, Academic Press, Inc., San Diego, Calif). Other amplification methods known in the art can be used, including but not limited to: ligase chain reaction with Q-β replicase (see EP320,308), or Kricka et al., 1995, Molecular. The methods listed in Probing, Blotting, and Sequencing, Chapter 1, and Table IX, Academic Press, New York.

(3. Immobilization) Single molecule arrays used in the present invention include supports, bioreactive or bioadhesive layers, and bioresistant layers. The support can be glass, silica, plastic or any other conventional non-reactive material, which does not produce significant noise or background due to the fluorescence detection method. This bioadhesive layer is powered by ion adsorbents such as gold, nickel or copper (Montemagno and Bachand (1999) Constructing nanomechanical devices powered by biomolecular motors. Nanotechnology. 10: 225-231))), protein-absorbing plastics (eg, polystyrene (US Pat. No. 5,858,801)), or covalent reactants (eg, thiol groups). In order to do so, the electron-sensitive polymer coated on the support (eg, polymethylmethacrylate (PMMA)) can be etched with an electron beam in any desired pattern, followed by the sensitizing polymer. It is developed to remove. The pores in the polymer are then coated with a metal (eg, nickel), and the polymer is removed with a solvent, leaving a pattern of metal posts on the substrate. This electron beam lithography The method provides a very high degree of spatial decomposition, and the small build size required to immobilize just one molecule at each point in the patterned array. Produce a highly degradable patterned array. The second means for this is an interatomic force microscope. The third means is X-ray lithography.

The biologic can be attached to the bioadhesive pattern by supplying a polyhistidine tag on the biologic that binds to the metallic bioadsorption pattern. Other conventional means for attachment use homologous bifunctional cross-linking agents and homologous bifunctional cross-linking reagents. Homological bifunctional reagents have two identical functional groups, while heterologous bifunctional reagents contain two dissimilar functional groups for linking biologics to bioadhesives. Huge amounts of heterologous bifunctional cross-linking agents contain primary amine-reactive groups and thiol-reactive groups. Covalent cross-linking agents are disulfide (SS), glycol (-CH (OH) -CH (OH)-), azo (-N = N-), sulfone (S = (O).₂It is selected from reagents that can form -), ester (-C (= O) -O-), or amide (-C (= O) -N-) crosslinks.

The bioresistant layer can be placed or placed on the bioadsorptive layer either before or after the binding of the biologic to the bioadhesive layer. This bioresistant layer is any substance that does not bind to biologics. Examples include polysorbate 20 (polyethene sorbitan monolauric acid) and polyethylene oxide containing bovine serum albumin, gelatin, lysozyme, octoxinol, block copolymers, and surfactants (US Pat. No. 5,858,801). The deposition of this layer is carried out by conventional means including spraying, dipping and vapor deposition (metal).

(4. NTP labeling) (A. γ phosphate fluorescence group binding) The methods of the invention relate to the detection and identification of individual fluorescing dNTP molecules as the polymerase incorporates the dNTP molecules into a single nucleic acid molecule. In certain aspects, the fluorescent dye is attached to the γ phosphate and the quencher is attached to the nucleobase. Thus, the present invention provides a nucleotide triphosphate (NTP) probe, including: NTP with a γ phosphate having a fluorophore moiety attached to the NTP; to interfere with fluorescence of the fluorophore moiety. Quenching portion sufficiently proximal to the fluorophore portion; where the fluorophore portion is at least about 5 times greater if the γ phosphate is bound to the NTP and is quenched when this γ phosphate is dissociated from the NTP. Quenching effect, preferably at least 10 times the quenching effect.

In a preferred aspect, the NTP probe is a dNTP probe having a fluorescent dye attached to the γ-phosphate moiety and a quencher attached to a nucleobase. Suitable nucleobases include, but are not limited to: adenine, guanine, cytosine, uracil, thymine, deazaadenine and deazaguanosine. Quenched dNTPs are non-fluorescent when γ-phosphate is attached to NTP and then become fluorescent when γ-phosphate is not attached to NTP.

(B. Fluorescent quenching) In single molecule detection, a high quenching effect is advantageous as it reduces the fluorescent background, thus allowing the use of higher nucleotide concentrations. There are several quenching mechanisms (see, eg, GG Guilbault, Practical Fluorescence, Marcel Dekker, New York, 1973). In certain cases, quenching depends on the overlapping spectrum between the fluorophore and the quencher and functions over a long range (fluorescence resonance energy transfer, FRET). In other cases, the fluorophore and quencher interact between molecular orbitals and require contact between the fluorophore and the quencher (eg, an electron transfer mechanism). In yet other cases, ground-state complex quenching can occur. All such quenching mechanisms are within the scope of the present invention.

In certain aspects, the fluorophore moiety is a fluorescent organic dye derivatized for attachment to γ-phosphate, either directly or via a linker. Preferably, the quencher moiety is also an organic dye, which may or may not be fluorescent, depending on the particular embodiment of the invention. For example, in one embodiment of the invention, the fluorophore and quencher are both fluorescent. In one embodiment, a fluorescence energy transfer mechanism can be used, where the first fluorescence group (eg, fluorescein) is excited and the luminescence is read by the second fluorescence group (eg, rhodamine). In these systems, dequenching is achieved by hydrolysis of the fluorophore attached to the γ-phosphate.

In another embodiment, the fluorophore and quencher function by an electron transfer mechanism. In this aspect, the non-fluorescent quencher (eg, DABCYL or dinitrophenyl (see Figure 1)) absorbs energy from the excited phosphor group but does not emit luminescent energy. These quenchers can be referred to as chromogen molecules.

There is a lot of practical guidance available in the literature to provide a complete table of fluorescent and chromophore molecules and their associated optical properties (eg, Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop ed., Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescence Probes and Research Chemicals (Molecular Probes, Eugene, 1992) Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New See York, 1949), etc.). In addition, there is extensive guidance in the literature on derivatized fluorophore and quencher molecules for covalent attachment via common reactive groups that can be added to nucleotides, as illustrated by the references below. Yes: Haugland et al. (Ibid.), Ullman et al., U.S. Pat. No. 3,996,345; Khanna et al., U.S. Pat. No. 4,351,760.

Suitable donors and acceptors operating on the principle of Fluorescent Energy Transfer (FET) include, but are not limited to: 4-acetamide-4'-isothiocyanate stylben-2,2'disulfonic acid; aclysine. And derivatives: aclysine, aclysine isothiocyanate; 5- (2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS); 4-amino-N- [3-vinylsulfonyl) phenyl] naphthalimide-3,5 di Sulfonate; N- (4-amino-1-naphthyl) maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumarins and derivatives: coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin120), 7-amino-4-tri Fluoromethylcoumarin (Coumarin 151); Cyanine pigment; Cyanine; 4', 6-diaminidid-2-phenylindole (DAPI); 5', 5''-dibromopyrogalol-sulfonaphthalein (Bromopyrogallol) Red); 7-diethylamino-3- (4'-isothiocianatophenyl) -4-methylcoumarin; diethylenetriamine 6acetic acid; 4,4'-diisothiocyanatodihydrostilben-2,2'-disulfonic acid; 4, 4'-Diisothiociana tostilben-2,2'-disulfonic acid; 5- [dimethylamino] naphthalene-1-sulfonyl chloride (DNS, dancil chloride); 4-dimethylaminophenylazophenyl-4'-isothiocianate (DABITC); Eosin and Derivatives: Eosin, Eosin Isothiocianate, Erytrosin and Derivatives: Elytrosin B, Erytrosin, Isothiocyanate; Etidium; Fluorescein and Derivatives: 5-carboxyfluorescein (FAM), 5- (4,6-dichlorotriazine- 2-Il) Aminofluorescein (DTAF), 2', 7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate, QFITC, (XRITC); fluorescein; IR144; IR1446 Malachite Green isothiocyanate; 4-methylumbelliferone orthocresolphthalein; nitrotyrosine; pararosaniline; phenol red; B-phycoerythrin; o-phthaldaldehyde; pyrene and derivatives: pyrene, pyrene butyrate, succiniminidyl 1-pyrene; butyrate Quantum dot; Reactive Red 4 (Cibacron^TM Brilliant Red 3B-A) Rhodamine and Derivatives: 6-Rhodamine-X-Rhodamine (ROX), 6-Rhodamine (R6G), Lissamine Rhodamine Bsulfonyl Chloride Rhodamine B, Rhodamine 123, Rhodamine X Isothiocyanate, Sulfolodamine B, Sulforhodamine 101, Sulfolodamine 101 sulfonyl chloride derivatives (Texas Red); N, N, N', N'-tetramethyl-6-carboxyrhodamine (TAMRA); Tetramethylrhodamine; Tetramethylrhodamine isothiocyanate (TRITC) ); Rhodamine; rosolic acid; terbium chelate derivative; Cy3; Cy5; Cy5.5; Cy7; IRD700; IRD800; La Jolla Blue;

Preferred fluorophore-quenching pairs include, but are not limited to, xanthene dyes, including fluorescein, and rhodamine dyes. Many suitable forms of these compounds are widely marketed with substituents on these phenyl moieties, which are the binding sites or for attachment to γ-phosphate or nucleobases. It can be used as a functional group. Another group of fluorescent compounds is naphthylamine, which has an amino group at the α or β position. The following are included in such naphthylamine compounds: 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-toluidinyl-6-naphthalene sulfonate. Other pigments include: 3-phenyl-7-isocyanate coumarin, acridine (eg 9-isothiocyanatoacridine and acridine orange; N- (p- (2-benzoxazolyl) phenyl) maleimide; benzoxa Isocyanate, coumarin, pyrene, etc.

Preferably, the fluorophore / quencher pair is selected from fluorescein dyes and rhodamine dyes. Appropriate binding methodologies for attachment to these dyes and nucleotides are described in many references. (Khanna et al. (Supra); Marshall, Histochemical J., 7: 299-303 (1995); Menchen et al., U.S. Pat. No. 5,188,934; Menchen et al., European Patent Application No. 87310256.0; and Bergot et al. See Pat. No. 5,366,860).

In a preferred embodiment, the quencher 4- (4'-dimethylaminophenylazo) benzoic acid (DABCYL) is used. The quencher DABCYL (see Figure 1) typically uses a fluorescent probe to detect DNA hybridization (molecular beacon) or protease activity. DABCYL excites between 475 nm and 805 nm and quenches fluorescein from a wide variety of dyes with measurement efficacy in the 90-99.9% range (S. Tyagi et al., Nat. Biotechnol. 16, 49 (S. Tyagi et al., Nat. Biotechnol. 16, 49). 1998); and GT Wang et al., Tetrahedron Lett. 31, 6493 (1990)). Although not bound by any particular theory, the quenching mechanism of DABCYL is believed to be preferably involved in electron transfer rather than fluorescence resonance energy transfer. Because it is wavelength independent. In equally preferred embodiments, the quencher dinitrophenyl (DNP) or trinitrophenyl (TNP) is used.

Quenching effectiveness as measured in any particular experiment depends on: the purity of the dye-quenching pair (where the contaminating free dye or the cleaved molecule fluoresces); the electrons between the dye and the quencher. Bonding and physical distance (closer is better than usual); and dye excited state lifetime (the longer the time, the greater the opportunity for electron transfer).

In certain embodiments, certain visible and near IR dyes are known to be sufficiently fluorescent and photostable to detect as a single molecule. In this aspect, the visible dye BODIPY R6G (525/545) and the larger dye LI-COR near-infrared dye IRD-38 (780/810) were detected using single molecule sensitivity. Obtained and used to carry out the present invention.

There are many linking moieties and methodologies for attaching fluorophore or photochromic moieties to nucleotides, as illustrated by the references below: Eckstein, Oligonucleotides and Analogues: A Practical Approach (IRL Press,). Oxford, 1991); Zuckerman et al., Nucleic Acids Research, 15: 5305-5321 (1987) (3'thiol group on oligonucleotide); Sharma et al., Nucleic Acids Research, 19:30 19 (1991) (3'sulfhydryl group) Aminolink available from Giusti et al., PCR Methods and Applications, 2: 223-227 (1993) and Fung et al., US Pat. No. 4,757,141 (Applied Biosystems, Foster City, Calif.)^TMII-mediated 5'phosphoamino group) Stabinsky, US Pat. No. 4,739,044 (3'aminoalkylphosphoryl group); Agrawal et al., Tetrahedron Letters, 31: 1543-1546 (1990) (adhesion via phosphoramidate bond); Sproat et al. , Nucleic Acids Research, 15:4837 (1987) (5'mercapto group); Nelson et al., Nucleic Acids Research, 17: 7187-7194 (1989) (3'amino group), etc.

With reference to FIG. 2, preferred linkers to some bases of the various dNTP structures of the present invention are shown. In addition, DABCYL is a wavelength-independent fluorescein quencher with quenching effectiveness in the range required by the method. Better quenching allows for higher dNTP concentrations and faster turnover. In certain aspects, the quencher is linked to the same nucleobase site typically used to add the dye (see Figure 1). If the polymerase advances along the DNA, the quencher remains at all integrated bases. In certain aspects, the quencher is covalently attached to dNTPs using the C5 linker shown in FIG. In certain embodiments, the quencher moiety is attached to the fluorophore moiety via a linker. In certain other embodiments, the quencher can be attached to the sugar of dNTP.

In general, nucleoside labeling can be achieved using any number of known nucleotide labeling techniques using known binding, binding groups, and related complementary functional groups. The quencher moiety and the binding to the nucleoside should be compatible with the relevant polymerase and should not quench the fluorophore moiety fluorescein.

Preferably, the quencher is covalently attached to the 5 carbons of the pyrimidine base and the 7 carbons of the 7-deazapurine base. Several suitable nucleotide labeling procedures that can be used in the present invention have been reported (eg, Gibson et al., Nucleic Acids Research, 15: 6455-6467 (1987); Gebeyehu et al., Nucleic Acids Research, 15: 4513-4535. (1987); Haralambidis et al., Nucleic Acids Research, 15: 4856-4876 (1987); Nelson et al., Nucleosides and Nucleotides, 5 (3) 233-241 (1986); Bergstrom et al., JACS, 111, 374-375 (1989). ); US Pat. Nos. 4,855,225, 5,231,191 and 5,449,767, each of which is incorporated herein by reference). Preferably, the bond is an acetylenic amido bond or an alkenic. The amido) bond, the bond between the photochromic agent and the nucleotide base, is that the dye-activated N-hydroxysuccinimide (NHS) ester reacts with the alkynylamino derivatized base or alkenylamino derivatized base of the nucleotide. Formed by. More preferably, the resulting bond is shown in FIG.

The synthesis of alkynylamino derivatized nucleosides is taught by Hobbs et al., European Patent Application No. 87305844.0, and Hobbs et al., J. Org. Chem. 54: 3420 (1989), which is incorporated herein by reference. To. As taught in these, alkynylamino derivatized nucleotides are formed by substituting the appropriate halodeoxynucleosides (usually 5-iodopyrimidines and 7-iodo-deazapurine deoxynucleosides and Cu in flasks). In (I), argon is flushed to remove air, dry DMF is added, and then alkynylamine, triethylamine and Pd (0) are added). The reaction mixture can be stirred for several hours or until thin layer chromatography shows consumption of the halodeoxynucleoside.

As taught in US Pat. No. 5,047,519 issued September 19, 1991 to Hobbs et al., The alkynyl aminolinker has the following structure:

<chemistry num="1"><img file="JP2010142250A_D0001.tif" /></chemistry>Have and here R¹Is a diradical portion of 1 to 20 atoms that is substituted or unsubstituted, Nuc is a purine base or pyrimidine base, and is a linear R.¹Is alkylene C₁-C₂₀And optionally contain a double bond, triple bond, aryl group or heteroatom such as N, O or S in the chain. Heteroatoms can be part of functional groups such as ethers, thioethers, esters, amines or amides. Preferably R¹Is a linear alkylene C₁-C₂₀Is; most preferably R¹Is CH₂Is. R¹The above substituent is C₁-C₆It may contain an alkyl group, an aryl group, an ester group, an ether group, an amine group, an amide group or a chloro group. R²And R³Are independently H, alkyl, C₁-C₄, Or a protecting group (eg, acyl, alkoxycarbonyl, fluorophore, quencher or sulfonyl). Preferably R²Is H and R³Is a quencher. The alkynyl aminolinker is preferably attached at the 5-position of the pyrimidine nucleotide and the 7-position of the purine nucleotide.

In a preferred embodiment, the quencher-sulfoNHS derivative (eg, DABCYL-sulfoNHS) uses DABCYL and under nitrogen atmosphere, DABCYL with N-hydroxysulfosuccinimide and N, N'-dicyclohexylcarbodiimide. Prepared by reaction (see Figure 1). The DABCYL-sulfoNHS derivative reacts with aminoallyl-dNTP (eg, aminoallyl-dNTP) to produce DABCYL-dNTP. DABCYL-dUTP and cystamine dihydrochloride can be used to generate DABCYL-dUTP-thiol derivatives. Thus, NTPs with γ-phosphate attached to the fluorophore are produced, for example, by reacting DABCYL-dUTP-thiol with BODIPY TR-iodoacetamide (commercially available from Molecular Probes D-6011) and DABCYL-dNTP. -Can generate BODIPY TR.

(C. Quenching effect) The present invention provides an NTP molecule having a γ-phosphate for a fluorescent group moiety attached thereto. The fluorophore portion exhibits quenching with at least about 5 times the quenching effect when γ-phosphate is attached to NTP, and does not quench when γ-phosphate dissociates from NTP, that is, fluorescence. Preferably, the fluorophore moiety exhibits quenching with at least about 3 times the quenching effect to about 100 times the quenching effect. In a more preferred embodiment, the fluorophore moiety exhibits quenching with at least about 100 times the quenching effect to about 1000 times the quenching effect.

The quenching effect of the NTP of the present invention is an easily determined idiomatic parameter. As will be apparent to those skilled in the art, the quenching effect can be measured on a fluorometer with laser excitation light, if desired. Similar to the early discussion of the Stern-Volmer equation, the quenching effect is:

<chemistry num="2"><img file="JP2010142250A_D0002.tif" /></chemistry>Equal to, where F₀Is the non-quenched NTP fluorescence and F is the quenched fluorescence. Non-quenched measurements F because there is no reliable way to eliminate all fluorescence in the quenched NTP sample.₀Can be done in another sample containing the dye alone, and the quenching measurement F can be made at the same concentration as the quenching dNTP.

The compounds of the present invention have at least three times the quenching effect. Complete fluorescent dye is 1 F₀Dyes that have a value, while quenching to 90%, have an F value of 0.100. Compounds that are quenched to 90% have a quenching effect of 0.9 or are quenched 10 times. Thus, for the compounds of the invention, F is characterized as: 0.670 F 0.999, i.e., the compound has a quenching effect between about 3 and about 1000 times. Preferably, the quenching effect of the compounds of the present invention is at least about 5 to about 1000 times, and more preferably, the quenching effect is at least about 10 to 1000 times.

In the present invention, detection of pyrophosphate depends on the generation of a fluorescent signal by quenching or stimulation of a fluorescent dye that has been quenched in response to pyrophosphate. Efficient quenching presents a lower background and increases the signal-to-noise ratio in pyrophosphate quenching. Incomplete quenching results in a low level of fluorescent background from each dye molecule. Further background fluorescence is contributed by some of the dye molecules that are sufficiently fluorescent, for example, for accidental (ie, pyrophosphate-independent) quenching due to broken bonds that bind the dye to the quenching moiety. To. Therefore, background fluorescence has two components: low-level fluorescence from all dye molecules (referred to herein as "dispersed fluorescence background") and full-intensity fluorescence from some molecules (referred to herein as "dispersed fluorescence background"). In the present specification, it is referred to as "localized fluorescence background").

When multiple labeling schemes are used, wavelengths that approximate the average maximum absorption of the various candidate labels can be used. Alternatively, multiple excitations can be performed, each excitation using a wavelength corresponding to the maximum absorption of a particular label. Table I lists various types of fluorophore and examples of their corresponding maximum absorption.

<tables num="I"><img file="JP2010142250A_D0003.tif" /></tables> (5. Various reaction reagents) The polymerase selected for use in the present invention is not important. Preferred polymerases can be tolerant of both labeling on nucleobases and on γ-phosphate. Polymerases should have at least 99% guarantee (integration accuracy) and at least 20 nucleotides evolution (the number of nucleotides integrated before the enzyme dissociates from DNA), preferably with greater evolution. .. Examples include T7 DNA polymerase, T5 DNA polymerase, HIV reverse transcriptase, E. coli DNA polI, T4 DNA polymerase, T7 RNA polymerase, Taq DNA polymerase and E. coli RNA polymerase. Endonuclease-deficient versions of these polymerases are preferred.

Primers (DNA polymerases) or promoters (RNA polymerases) are made synthetically using conventional nucleic acid synthesis techniques. The complementary strands of the probe are modeled on an automated DNA synthesizer (eg, Applied Biosystems, Inc. (Foster City, Calif)) using standard chemistry, eg, phosphoramidite chemistry (eg, disclosed in the references below). Or simply synthesized with 394 DNA / RNA Synthesizer): Beaucage and Iyer, Tetrahedron, 48: 2223-2311 (1992); Molko et al., US Pat. No. 4,980,460; Koster et al., US Pat. No. 4,725,677; Caruthers et al., US Pat. Nos. 4,415,732; 4,458,066; and 4,973,679, etc. Alternative chemistries (eg, producing non-natural backbone groups (eg, phosphorothioates, phosphoramidates, etc.)) can also be utilized provided that the resulting oligonucleotide is compatible with polymerase. These are Operon It can be purchased commercially from various companies that specialize in oligonucleotide orders, such as Inc. (Alameda, California).

Primers combined with polymerase can be used to sequence the target DNA. The primer length is selected to provide hybridization with the complementary template DNA. Primers are generally at least 10 bp long and are usually between at least 10 bp and 30 bp long. Primer lengths are designed to hybridize to known internal sites on the target DNA of interest. Alternatively, the primer can bind to a synthetic oligonucleotide adapter linked to the end of the target DNA by ligase. Similar to when a promoter is used, the primer can be inside the target DNA or can be ligated to the end as an adapter.

(6. Reaction conditions) The reaction mixture for sequencing includes a water-soluble buffer medium, which is optimized for a particular polymerase. Generally, the buffer solution contains a raw material for monovalent ions, a raw material for divalent cations, and a buffering agent. Any convenient source of monovalent ions (eg Kcl, K-acetic acid, NH₄-Acetic acid, K-glutamic acid, NH₄Cl, ammonium sulphate, etc.) can be utilized, where the amount of monovalent ion raw material present in the buffer is typically about 500-20,000, usually about 1000-10,000, and more commonly. Is present in sufficient quantity to provide conductivity in the range of about 3,000 to 6,000 micromhos.

The divalent cation can be magnesium, manganese enzyme (managanese), zinc and the like, and the cation is typically magnesium. MgCl₂, Any convenient raw material for magnesium cations, including Mg acetic acid and the like, can be used. The amount of Mg ions present in the buffer can be in the range of 0.5-20 mM, preferably in the range of about 1-12 mM, more preferably 2-10 mM, and ideally about 5 mM. Is.

Typical buffering agents or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS, etc., where the amount of this buffering agent is typically about 5 to 150 mM. The range, typically in the range of about 10-100 mM, and more usually in the range of about 20-50 mM, where in certain preferred embodiments, the buffering agent has a pH in the range of about 6.0-9.5 ( Here, most preferred is present in an amount sufficient to provide (pH 7.6) at 25 ° C. Other agents that may be present in the buffer medium include chelating agents such as EDTA, EGTA and the like.

(7. Sample storage) The solid support is optionally housed in a flow chamber with inlets and outlets that allow regeneration of the reactants flowing through the immobilized portion. The flow chamber can be made of plastic or glass and should be either open or transparent in the plane displayed by a microscope or optical reader. Electroosmotic flow requires a charge fixed on a solid support and a voltage gradient (current) that passes between two electrodes located at the opposite ends of the solid support. The flow chamber can be divided into multiple channels for different orders. An example of a microflow chamber already exists. For example, Fu et al. (Nat. Biotechnol. (1999) 17: 1109) describe a microfabricated fluorescent cell analyzer with 3 μm × 4 μm channels that utilize electroosmotic flow for sorting. ..

(8. Detection of fluorescent group) The present invention requires imaging of one molecule in solution. There are various known methods to achieve this goal. A general overview describing this technique is available. An overview includes Bache et al., 1996, Single molecule optical detection, imaging, and spectroscopy, Weinheim: VCM, and Plakhotnik et al., Single-molecule spectroscopy, Ann.Rev.Phys.Chem.48:181-212. In general, these methods include the detection of laser activated fluorescence using a microscope equipped with a camera. This is sometimes referred to as a high-efficiency photon detection system. Nie et al., 1994, Probing individual molecules with confocal fluorescence microscopy, Science 266: 1018-1019. Detection of one molecule is in the field of view with statistical reasons where only one molecule is considered to be present (homogeneous assay) or in the field of view where only one actual attachment point is present (heterogeneous assay). Includes limiting its detection. The single molecule fluorescence detection of the present invention can be performed using an optical setup, which includes a near-field scanning microscope, a far-field confocal microscope, and wide-field epi-illumination. Examples include wide-field epi-illumination and total internal reflection fluorescence (TIRF) microscopy. For two-dimensional imaging fluorescence detection, the microscope is typically a total internal reflection microscope. Vale et al., 1996, Direct observation of single kinesin molecules moving along microtubules, Nature 380: 451, Xu and Yeung 1997, Direct Mesurement of Single-Molecule Diffusion and Photodecomposition in Free Solution, Science 275: 1106-1109.

Suitable photon detectors include, but are not limited to, photodiodes and sensitized CCD cameras. In a preferred embodiment, a sensitized charge-coupled device (ICCD) camera is used. The use of ICCD cameras to image individual fluorochrome molecules in a fluid near the surface of a glass slide is advantageous for several reasons. By using the ICCD optical setup, it is possible to obtain a series of images (videos) of the fluorophore. In certain aspects, each of the NTPs of the invention has a unique fluorophore that binds to itself, and a four-color device with four cameras and four excitation lasers can be used. Therefore, it is possible to sequence DNA using this optical setup. In addition, many different DNA molecules spread on microscope slides can be imaged and sequenced at the same time. In addition, by using image analysis algorithms, one dye pathway is traced, and these are "accidentally dequenched" with fixed background fluorescence and moving from the original upstream to the field of view. It is possible to distinguish it from pigments.

In certain aspects, the preferred geometry for single molecule ICCD detection is a total internal reflection fluorescence (TIRF) microscope. In TIRF, the laser beam is totally reflected at the glass-water interface. The optical field of view does not end sharply at this reflection interface, but its intensity decreases exponentially with distance. A thin "evanscent" optical field of view at this interface provides a low background and allows the detection of a single molecule with a signal-to-noise ratio of 12: 1 at visible wavelengths (M. See Tokunaga et al., Biochem and Biophys. Res. Com. 235,47 (1997) and P. Ambrose, Cytometry, 36, 244 (1999)).

The transmission of the field of view beyond the glass depends on the wavelength and the angle of incidence of the laser beam. Deeper transmission is obtained by longer wavelengths and by smaller angles with respect to normal surfaces within critical angle limits. In a typical assay, fluorophore is detected within about 200 μm from the surface, which corresponds to a contour length of about 600 base pairs of DNA. Preferably, prismatic TIRF geometry is used for single molecule imaging as described by Xu and Yeung (see XH.N.Xu et al., Science, 281, 1650 (1998)).

Single molecule detection can be achieved using flow cytometry, where flow samples are passed through a focused laser with a spatial filter used to define small volumes. U.S. Pat. No. 4,979,824 describes a device for this purpose. U.S. Pat. No. 4,793,705 details and claims a detection system for identifying individual molecules in a particle's flow train in a flow cell. The '705 patent further describes how to place multiple lasers, filters and detectors to detect different fluorescent nucleic acid base-specific labels. U.S. Pat. No. 4,962,037 also uses nucleases to cleave bases to obtain DNA and RNA sequences, as described herein, rather than synthesizing using polymerases. A method for detecting an ordered train of labeled nucleotides is described. Single-molecule detection by laser-induced fluorescence technique by Ishikawa et al. (1994) It is described in with a position-sensitive photon-counting apparatus, Jan.J.Apple.Phys.33: 1571-1576. Ishikawa describes a representative device including a photon counting camera system connected to a fluorescence microscope. Lee et al. (1994) Laser-induced fluorescence detection of a single molecule in a capillary, Anal.Chem., 66: 4142-4129 describes a device for detecting one molecule in a quartz capillary tube. The choice of laser depends on the label and the required light quality. Diodes, helium neon, argon ions, argon-krypton mixed ions, and Nd: YAG lasers are useful in the present invention.

The present invention can be thought of as a system of components designed to detect the synthesis of nucleic acids such that PPi is released. FIG. 4 provides a schematic of this system, which is described in detail in Example 2. FIG. 5 illustrates a typical arrangement of polymerase (14) immobilized on the surface of a solid support (15) with target DNA (13) extended by uptake of γ-labeled dTNP (17). More specifically, the target DNA hybridizes to a primer, which becomes an extender produced by the bound DNA-dependent DNA polymerase.

FIG. 6 illustrates a continuous sequence reading of a double-stranded DNA molecule (18) using a double-stranded DNA-dependent RAN polymerase (19) immobilized on a solid support (15), where The elongation product is transcribed from the labeled rNTP (21) as new RNA (20). More specifically, the double-stranded DNA template binds to RNA polymerase by sequence recognition of the polymerase promoter sequence. This sequence is read as DNA travel by the enzyme that produces the nascent RNA. After RNA and DNA are released, the enzyme is prepared to read the sequence of the next DNA molecule to pass through.

These schemes ensure that the active site remains in the bright field where it disappears on the surface, resulting in irradiation of any dye emitted by the quenched dNTP. It is convenient to bind the polymerase rather than the target nucleic acid molecule (template). This is because one fixed enzyme provides a continuous sequence reading process that reads the sequences of many different DNA molecules.

All publications and patents cited herein are herein as each of the individual publications or patent specification is specifically and individually indicated to be incorporated by reference. It is used as a reference.

Although the invention described above has been described in some detail by way of example and examples for the purpose of clarifying understanding, certain changes and modifications do not deviate from the ideas or scope of the appended claims. What can be done for the present invention is readily apparent to those skilled in the art with reference to the teachings of the present invention.

<p> The following examples are provided for illustration purposes only and are not for limitation. One of ordinary skill in the art will readily recognize various non-essential parameters that can be modified or modified to obtain essentially similar results.</p><p> (Example 1. Polymerase array) This example shows how to fabricate an array of nickel nanodots and attach a polymerase to each dot. Required equipment includes spinner (PWM202 E-beam resist spinner, Headway Research Inc.), evaporator (SC4500 thermal e-gun evaporator, CVC Products Inc.) and scanning electron microscope (Nabity pattern generator). Includes Leo982, Leo Electron Microscopy Inc.).</p><p> A 25 mm diameter microscope cover glass on a spinner is cleaned by alternately spraying acetone and isopropyl alcohol (IPA) and spinning the final IPA film until dry. The cover glass in the spinner is coated with 0.5 ml PMMA (poly (polymethylmethyl acrylate), MW496 kDa, in chlorobenzene), fired on a hot plate at 170 ° C for 10 minutes, and 0.5 mm PMMA. Coat with (MW950kDa, 2% in methyl isobutyl ketone [MIBK]) and re-fire. The conductive layer is applied to the PMMA film in CVC SC4500 by evaporating 100 Å of gold. Using an electron microscope, using a pattern generator on Leo982 as embodied by CAD diagrams (Design CAD, 50 nm spot, 10 μ center-to-center, 200 × 200 dot array) Then, the array pattern is etched on the PMMA film.</p><p> The gold layer is removed by placing the exposed cover glass on Gold Etch (15-17% sodium iodide) for 7 seconds, followed by rinsing with IPA and water. Tantalum (50 Å) and nickel (100 Å) are deposited on the cover glass in the CVC SC4500. PMMA in a 1: 1 mixture of acetone and methylene chloride is removed for 10-15 minutes, followed by sonication for a few seconds and rinsing with IPA and water.</p><p> Just before use, polyhistidine tagged Klenow DNA polymerase exo^-TOPO cloning vector and in a 10 ml 15 nM solution of phosphate buffered saline (PBS; Harlow E., Lane D.1988, Antibodies A Laboratory Manual. Cold Spring Harbor Laboratory ISBN 0-87969-14-2). (Prepared using ProBond Resin, Invitrogen Inc.,) is attached to the cover glass, and after 20 minutes, the cover glass is washed with PBS and used immediately.</p><p> (Example 2. Dichroic single molecule imaging microscope) The microscope described in FIG. 4 is used to detect a single molecular event on the surface of the cover glass obtained in Example 1. The microscope is adapted to a multicolor mixed gas laser (1) that emits light at a tunable wavelength. This laser beam is first passed through a laser line filter (10) to pass undesired wavelengths. The unfocused output is passed through a fused silica right angle prism (2) placed directly under the cover glass (3). Sample (4) Molecules are placed in a buffer solution on a cover glass.</p><p> The laser beam entering the prism is refracted at an angle that exceeds the critical angle between the fused silica and the buffer solution. The light is therefore completely reflected within the prism, creating a total internal reflection (TIR) vanishing region (9) in the buffer. The region of interest is imaged using a microscope (6) with an objective lens (5) immersed directly in buffer. Fluorescent radiation at the microscope output passes through a multi-wavelength viewer (7), which spatially separates images at different wavelengths. This makes it possible to distinguish between events that occur at different wavelengths.</p><p> The image is projected onto an array of sensitized CCD (ICCD) cameras (8), digitized from it, and stored in storage (11). The image analysis algorithm (12) is executed on the image stored in the storage device. These algorithms can distinguish background-derived signals, track molecules, and perform other signal processing functions. Storage and signal processing can be performed offline on a specialized digital signal processing (DSP) chip controlled by a computer or microprocessor.</p><p> (Example 3. Synthesis of double-labeled nucleotides) (Example 3 Synthesis of DABCYL-dUTP-BODIPY TR (Fig. 3)).</p><p> (a. Preparation of DABCYL-sulfoNHS) DABCYL (108 mg, 0.4 mmol; Aldrich 25,019-8 methyl red) in a mixture of dry N, N-dimethylformamide (10 mL; Aldrich 22,705-6) and dry pyridine (96 mg, 1.2 mmol; Aldrich 27,097-0). Dissolved in. N-Hydroxysulfosuccinimide (260 mg, 1.2 mmol; Pierce 24510) and N, N'-dicyclohexylcarbodiimide (250 mg, 1.2 mmol; Pierce 20320) were added and the mixture was added at 50 ° C. for 2 hours under nitrogen atmosphere. Stirred. The reaction was monitored by TLC (MKC18F reverse phase; Whatman 4803-110; developed in 0.1 M triethylammonium acetate, pH 7, 80% acetonitrile). After diluting with ether, the supernatant was decanted and the product was washed with ether on a filter, dried and stored dry at -20 ° C.</p><p> (b. Synthesis of DABCYL-dUTP) Aminoallyl-dUTP (10 mg, 20 μmol; Sigma A0410) was mixed with DABCYL-sulfoNHS (30 mg, 30 μmol; derived from Step A) in 3 mL of 0.1 M sodium carbonate pH 8.3. The mixture was incubated in a dark room for 4 hours at room temperature, and the reaction was monitored by TLC (similar to step A). The DABCYL-dUTP product was purified by reverse phase HPLC using a 20 minute linear gradient of 0% -100% buffer B mixed with buffer A (buffer A is 0.1 M in water). Triethylammonium acetate, pH 7, 4% acetonitrile; buffer B is similar to buffer A with 80% acetonitrile).</p><p> (c.DABCYL-dUTP thiol) DABCYL-dUTP (9 mg, 12 μmol; from step B) was dissolved in 1 mL of 0.1 M MES pH 5.7 (Sigma M 3023) and the pH was adjusted to 5.75. Sistamine dihydrochloride (10 mg, 44 μmol; Sigma C8707) was dissolved in 2.5 mL of 0.1 M MES pH 5.7 and the pH was adjusted to 5.75. EDC (9 mg, 47 μmol; Pierce 22980) was dissolved in 0.5 mL of 0.1 M MES pH 5.7 and immediately added to the DABCYL-dUTP solution. After 10 minutes, a cystamine solution was added and the pH was maintained between 5.5 and 5.8 while the reaction proceeded at room temperature. After 2 hours, the pH was adjusted to 7.0 and the sample was stored at -20 ° C. The product was purified by reverse phase HPLC as in step B.</p><p> (Synthesis of d.DABCYL-dUTP-BODIPY TR) DABCYL-dUTP-thiol (2.5 mg, 3 μmol; derived from Step C) was dissolved in 5.4 mL of 5 mM TCEP (Pirece 20490), 30 mM sodium phosphate adjusted to pH 7.5. BODIPY TR-iodoacetamide (5 mg, 7.4 μmol; Molecular Probes D-6011) was dissolved in 2.6 mL N, N-dimethylformamide and added to DABCYL-dUTP-thiol solution. After allowing to stand at room temperature in a dark room for 5 hours, the product was purified by reverse phase HPLC as in step B.</p><p> (e. Determination of disappearance efficiency) The disappearance efficiency of DABCYL-dUTP-BODIPY TR was determined as follows. First, the fluorescence of the sample containing the dye BODIPY TR is measured. Second, a sample containing the same concentration of nucleotide triphosphate with γ-phosphate with attached fluorophore moiety (ie, DABCYL-dUTP-BODIPY TR) is measured. Then disappearance efficiency (this is F₀-F / F₀Equal to, where F₀Is the fluorescence of BODIPY TR alone, and F is the fluorescence of DABCYL-dUTP-BODIPY TR). The fluorescence elimination efficiency of DABCYL-dUTP-BODIPY TR is at least 5 times higher than that of BODIPY TR alone.</p><p> (Example 3 B. Rho-d UTP-BODIPY TR and Rho-d CT Synthesis of P-BODIPY TR) (A. Synthesis of Rho-d UTP) Aminoallyl-dUTP (20 μmol; Sigma A0410) was mixed with 5-carboxyrhodamine 6G, succinimidyl ester (30 μmol, Molecular Probes C-6127) in 3 ml of 0.1 M sodium carbonate pH 8.3, 20% DMF. .. The mixture was incubated at room temperature in a dark room and the reaction was monitored by TLC (MKC18F reversed phase; Whatman 4803-110; developed in 0.1 M triethylammonium acetate, pH 7, 80% acetonitrile). The Rho-dUTP product was purified by reverse phase HPLC using a 20 minute linear gradient of 0% -100% buffer B mixed with buffer A (buffer A is 0.1 M in water). Triethylammonium acetate, pH 7, 4% acetonitrile; buffer B is similar to buffer A with 80% acetonitrile).</p><p> (b. Synthesis of Rho-dUTP-thiol) Rho-dUTP (12 μmol; from step a) was dissolved in 1 ml of 0.1 M MES pH 5.7 (Sigma M 3023) and the pH was adjusted to 5.75. Sistamine dihydrochloride (44 μmol; Sigma C8707) was dissolved in 2.5 ml of 0.1 M MES pH 5.7 and the pH was adjusted to 5.75. EDC (47 μmol; Pierce 22980) was dissolved in 0.5 ml of 0.1 M MES pH 5.7 and immediately added to the Rho-d UTP solution. After 10 minutes, this cystamine solution was added and the pH was maintained between 5.5 and 5.8 while the reaction proceeded at room temperature. After 2 hours, the pH was adjusted to 7.0 and the sample was stored at -20 ° C. The product was purified by reverse phase HPLC as described in step a.</p><p> (C. Synthesis of Rho-dUTP-BODIPY TR) Rho-dUTP-thiol (3 μmol; from step b) was dissolved in 5.4 ml of 5 mM TCEP (Pierce 20490), 30 mM sodium phosphate adjusted to pH 7.5. BODIPY TR-iodoacetamide (7.4 μmol; Molecular Probes D-6011) was dissolved in 2.6 ml of N, N-dimethylformamide and added to the Rho-dUTP-thiol solution. After allowing to stand at room temperature for 5 hours in a dark room, the product was purified by reverse phase HPLC as in step a.</p><p> (Synthesis of d.Rho-dUTP-BODIPY TR) Labeled dCTP was made essentially as described for dUTP, except that dUTP was replaced with aminoallyl-dCTP. Aminoallyl-dCTP was synthesized according to US Pat. No. 5,476,928, except that dCTP was used in place of dUTP.</p><p> (Example 4. Genotyping) This example illustrates a sequence-based genotyping assay for a single DNA molecule. The target is a (Δ) F508 deletion of a cystic fibrosis transmembrane conduction regulatory gene (Welsh MJ et al., 1993. J. Cell Science 106S: 235-239). Genomic DNA is isolated from the whole blood of CFTR homozygous individuals (Wizard Genomic DNA Purification Kit Cat.No.A1120, Promega Inc.). The 54 nucleotide segment of the CFTR gene is amplified by PCR using primers 5'CACCATTAAAAGAAAATATCAT (Primer 1 SEQ ID NO: 1) and 5'-biotinyl-CTGTATCTATATTCATCATAG (Primer 2 SEQ ID NO: 2).</p><p> Custom primers are obtained from commercial sources (eg, Operon Technologies, Alameda, CA). Primer 1 hybridizes to the CFTR sequence flanking the (Δ) F508 deletion; the first 3'nucleotide to Primer 1 is cytosine within the normal allele or thymine within the deletion mutant (below). See Table 2; from Vaughan P, McCarthy T.1998 Nuc Acids Res 26: 810-815). Amplification conditions were 200 ng of genomic DNA, 0.2 mM dATP, dCTP, dGTP, and dUTP, 0.2 μM primers, 2.0 mM MgCl2, 1 unit of Taq DNA polymerase, 50 mM KCl, 10 mM in a final volume of 50 μl. Tris-HCl (pH 9, 25 ° C), 0.1% Triton X-100 (94 ° C 30 seconds, 52 ° C 30 seconds, 72 ° C 15 seconds 30 cycles; depending on the specific characteristics of the thermal cycler device used , Mg concentration and cycling parameters may need to be optimized).</p><p> Purify the PCR product on streptavidin-coated magnetic beads (DYNAPURE Dye Terminator Removal kit (Dynal AS)) and replace genomic DNA with 2 μl of purified amplification product, and single-stranded DNA complementary to Primer 1. Reamplify for 15 cycles under the same conditions as above, except to exclude primer 1 to overproduce the product. The dNTP is removed from the amplification product (template primer) using the magnetic beads described above.</p><p> 10 μl reaction mixture (30 nM template primer, 100 nM primer 1, 1 nM Rho-dCTP-BTR (Example 3), 10 mM Tris-HCl (pH 7.5), 5 mM MgCl₂, 7.5 mM dithiothreitol) is placed on a polymerase array on a two-color, single-molecule image processing microscope from Example 2 to obtain a series of images for 20 minutes. Similarly, analyze the second sample, which is identical to the first sample, except that the Rho-dCTP-BTR of the first sample is replaced by Rho-dUTP-BTR (Example 3). Analyze the image set for the uptake event exhibited by the separation of the two bound dyes from each other. The number of events observed using dCTP (Sample 1) and dUTP (Sample 2) is compared to determine whether the test CFTR gene is a normal or deleted allele.</p><p><tables num="2"><img file="JP2010142250A_D0004.tif" /></tables>The primers are underlined (primer 1 on the left and primer 2 on the right). The three deleted base pairs are shown in bold in the normal sequence.</p><p> (Example 5. Sequence determination) Sequencing is accomplished for genotyping (Example 4) and involves reading more than one nucleotide downstream of the primer.</p><p> (a) BODIPY TR-dUTP-Rhodamine synthesis) To make BODIPY TR-dUTP, replace the rhodamine of Example 3a with BODIPY TR-X STP ester (Molecular Probes B-10003) according to the procedure of Example 3a. Derivativeize a BODIPY TR-dUTP with a thiol, as in Example 3b, and bind tetramethylrhodamine-5-iodoacetamide dihydroiodide (Moleclar Probes T-6006) to that thiol as in Example 3c. Let me.</p><p> (b) Sequencing) The same normal allelic DNA template is used as prepared in Example 4. 10 μl of reaction mixture (30 nM template-primer, 100 nM primer 1, 1 nM BODIPY TR-dUTP-Rho (Example 5a), 1 nM Rho-d CTP-BODIPY TR (Example 3d), 10 mM Tris-HCl (pH 7) .5), 5 mM MgCl₂, 7.5 mM dithiothreitol) is placed on a polymerase array on a two-color, one-molecule image processing microscope of Example 2 and an image series is acquired. Incorporation of dUTP is observed by the separation of the two dyes with the release of rhodamine. Incorporation of dCTP is detected by the separation of the same two dyes, but with the release of rhodamine instead of BODIPY.<maths num="1"><img file="JP2010142250A_D0005.tif" /></maths></p>