Methods of amplifying and sequencing nucleic acids

Field of invention The present invention relates to methods and devices for determining the base sequence of DNA. More specifically, the present invention relates to methods and devices capable of automatically or semi-automatically amplifying and determining the base sequence of a genome.

Background of the invention The development of rapid and sensitive nucleic acid sequencing methods using automated DNA sequencers has revolutionized modern molecular biology. Through the united efforts of a team of machines and engineers, it is now possible to analyze the entire genome of plants, fungi, animals, bacteria and viruses. However, it has not been possible to rapidly and automatically or semi-automatically sequence the genome in a short period of time. There were still technical issues with accurate sample preparation, amplification and sequencing.

One technical problem that interferes with genome sequence analysis has been the inability of researchers to quickly and quickly prepare a variety of nucleic acid samples containing the complete genome.

Another technical problem is the inability to typically amplify the genome to a level compatible with the sensitivity of modern sequencing methods. Modern economically feasible sequencing machines are sensitive, but still require more than a million copies of DNA fragments for sequencing. A recent method of providing large copies for DNA sequencing can amplify the number of individual clones required to economically sequence the entire genome (more than 600,000, 10 million for the human genome). Includes various methods of cloning or in vitro amplification that cannot be done.

Yet another technical problem with the limitation of recent sequencing methods that can be performed is that there is at most one sequencing reaction per hybridization of oligonucleotide primers. Hybridization of sequencing primers is often a rate-determining step that suppresses the output of the DNA sequencer.

In most cases, polymerase chain reaction (PCR; Saiki, RK, et al., Science 1985,230,1350-1354 (Non-Patent Document 1); Mullis, K., et al., Cold Spring Harb.Symp.Quant.Biol.1986,51 Pt 1,263 -273 (Non-Patent Document 2)) Plays an essential role in obtaining DNA sequence information and amplifying small amounts of specific DNA to achieve sufficient concentrations for sequencing. Moreover, scaling recent PCR techniques to meet the increasing demands of genetics in recent years is neither cost effective nor efficient, especially considering the demands for whole genome sequencing.

Efforts to maximize time and cost efficiency have typically been focused on two areas. A decrease in the reaction volume required for amplification and an increase in the number of simultaneous amplifications performed. Miniaturization provides the benefits of reduced sample and reagent utilization, reduced amplification time, and increased power expansion capability.

Conventional thermal cyclers require a relatively long cycle time due to the limitation of thermal mass (Woolley, AT, et al., Anal. Chem. 1996, 68, 4081-4086 (Non-Patent Document 3)). Smaller reaction volumes can circulate more quickly. Continuous flow PCR equipment utilized etched microchannels with a fixed temperature region to reduce the reaction volume to sub-microliter sample levels (Lagally, ET, et al., Analytical Chemistry 2001,73,565-570 (Lagally, ET, et al., Analytical Chemistry 2001,73,565-570). Non-Patent Document 4); Schneegas, I., et al., Lab on a Chip-The Royal Society of Chemistry 2001, 1, 42-49 (Non-Patent Document 5)).

Air-heated glass microcapillaries (Kalinina, O., et al., Nucleic Acids Res. 1997, 25, 1999-2004 (Non-Patent Document 6)) or infrared-heated glass microcapillaries (Oda, R Pet al) ., Anal.Chem.1998,70,4361-4368 (Non-Patent Document 7); Hummer, AFand Landers, JP, Anal.Chem.2000,72,5507-5512 (Non-Patent Document 8)) It was functioning as an efficient container for. A similar reaction volume was achieved using a microfabricated silicon thermal cycler (Burns, MA, et al., Proc. Natl. Acad. Sci. USA 1996,93,5556-5561 (Non-Patent Document 9)).

In many cases, these miniaturizations increase the total PCR reaction time to modified electric heating elements (Kopp, MU, et al., Science 1998, 280, 1046-1048). Chiou, J., Matsudaira, P., Sonin, A. and Ehrlich, D., Anal. Chem. 2001,73,2018-2021 (Non-Patent Document 11)) and hot air cycler (Kalinina, O., et al) ., Nucleic Acids Res. 1997,25,1999-2004 (Non-Patent Document 6)) in less than 30 minutes, and some infrared regulatory reactions (Giordano, BC, et al., Anal.Biochem.2001,291,124) -132 (Non-Patent Document 12)) was reduced to 240 seconds.

Certain techniques have increased, as in the 1536-well system design by Sasaki et al. (Sasaki, N., et al., DNA Res. 1997, 4,387-391 (Non-Patent Document 13)), which maintained the reaction volume below 1 μl. The same amount of processing and miniaturization are used at the same time. As another example, Nagai et al. (Nagai, H., et al., Biosens. Bioelectron. 2001, 16, 1015-1019 (Non-Patent Document 14); Nagai, H., et al., Anal. Chem. 2001). 73,1043-1047 (Non-Patent Document 15)) reported amplification of a single test fragment in 10,000 86 pl reaction pits etched onto a single silicon wafer. Unfortunately, the recovery and utilization of amplicon from these methods is problematic and requires evaporation through a selective permeable membrane.

Despite these significant improvements in reaction volume and cycle time, both of the previous measures provided the large amount of parallel amplification needed to dramatically increase the throughput to the levels required for the analysis of the entire human genome. Not. DNA sequencers are slow to process and continue to be more expensive than desired. In a pure research setting, it is probably acceptable for the sequencer to be slow and expensive. However, if it is desired to use a DNA sequencer in a clinical diagnostic setting, such inefficient sequencing methods are also prohibited for well-funded devices. Large-scale parallel sequencing of thousands of targets amplified by cloning significantly facilitates large-scale whole-genome library analysis without the use of time-consuming sample preparation and expensive and error-prone cloning processes. To do. High-performance solid-phase cloned DNA amplification can be used for many purposes. Therefore, preparing a genome or large template nucleic acid for sequencing, amplifying the nucleic acid template, and sequencing the amplified template nucleic acid without being constrained by one sequencing reaction per hybridization. It is clear that there is a need to do. In addition, there is a need for systems that combine these various techniques with a variety of automated or semi-automatic arranging machines.

<p><nplcit num="1"><text>PCR; Saiki, RK, et al., Science 1985,230,1350-1354</text></nplcit><nplcit num="2"><text>Mullis, K., et al., Cold Spring Harb.Symp.Quant.Biol.1986,51 Pt 1,263-273</text></nplcit><nplcit num="3"><text>Woolley, AT, et al., Anal. Chem. 1996,68,4081-4086</text></nplcit><nplcit num="4"><text>Lagally, ET, et al., Analytical Chemistry 2001,73,565-570</text></nplcit><nplcit num="5"><text>Schneegas, I., et al., Lab on a Chip-The Royal Society of Chemistry 2001,1,42-49</text></nplcit><nplcit num="6"><text>Kalinina, O., et al., Nucleic Acids Res. 1997,25,1999-2004</text></nplcit><nplcit num="7"><text>Oda, RPet al., Anal.Chem.1998,70,4361-4368</text></nplcit><nplcit num="8"><text>Huhmer, AFand Landers, JP, Anal.Chem.2000,72,5507-5512</text></nplcit><nplcit num="9"><text>Burns, MA, et al., Proc.Natl.Acad.Sci.USA 1996,93,5556-5561</text></nplcit><nplcit num="10"><text>Kopp, MU, et al., Science 1998,280,1046-1048</text></nplcit><nplcit num="11"><text>Chiou, J., Matsudaira, P., Sonin, A. and Ehrlich, D., Anal.Chem.2001,73,2018-2021</text></nplcit><nplcit num="12"><text>Giordano, BC, et al., Anal. Biochem. 2001,291,124-132</text></nplcit><nplcit num="13"><text>Sasaki, N., et al., DNA Res. 1997,4,387-391</text></nplcit><nplcit num="14"><text>Nagai, H., et al., Biosens. Bioelectron. 2001,16,1015-1019</text></nplcit><nplcit num="15"><text>Nagai, H., et al., Anal. Chem. 2001,73,1043-1047</text></nplcit></p>

A brief overview of the invention The present invention describes an integrated system that includes (1) nucleic acid sample preparation, (2) nucleic acid amplification, and (3) novel methods and devices for DNA sequencing.

The present invention provides a novel method for preparing a library of multiplex DNA sequences derived from particularly large template DNA or whole (or partial) genomic DNA. Single-strand DNA sequences are prepared from large template DNA or samples of the full or partial DNA genome by single-stranded DNA fragmentation, polishing, adapter ligation, nick repair and isolation. This method involves (a) generating a library of ssDNA templates, (b) attaching the ssDNA template to a solid support, and (c) isolating the solid support to which one ssDNA template is attached. To generate an ssDNA library bound to a solid support.

In the present invention, for example, a plurality of DNA samples are individually encapsulated in microcapsules of an emulsion, the plurality of encapsulated nucleic acid samples are simultaneously amplified, and the amplified plurality of DNAs are used for a subsequent reaction. Also provided is a method of amplifying individual members of a DNA library in a single reaction tube by releasing from the microcapsules. In one embodiment, a single copy of the nucleic acid template species is hybridized to DNA capture beads, suspended in a fully amplified solution and emulsified in a microreactor (typically 100-200 microns in diameter). Then, amplification (eg, PCR) is used to clonally increase the number of copies of the initial template species to more than 1,000,000 copies of a single nucleic acid sequence, preferably 2 to 20 million copies of a single nucleic acid. .. For example, the amplification reaction can be carried out simultaneously using at least 3,000 microreactors per microliter of the reaction mixture, with more than 300,000 micros in a single 100 μl volume test tube (eg, a PCR reaction tube). It can be done using a reactor. The present invention also provides a method of concentrating beads (ie, by removing beads that do not have DNA attached thereto), including a successful DNA amplification event.

The invention also provides a method of sequencing nucleic acids from multiple primers using a single primer hybridization step. Hybridize two or more sequencing primers to the template DNA to be sequenced. All sequencing primers are then protected except one. Sequencing (eg, pyrophosphate sequencing) is performed again by extending the unprotected primer. Elongation is either completed (with additional polymerase and dNTP, if necessary) or stopped (with polymerase and ddNTP). Remove chaining complete and / or stop reagents. Next, sequencing is performed by deprotecting one of the protecting primers and extending the newly deprotected primer. This process continues until all sequencing primers have been deprotected and sequenced. In a preferred embodiment, two primers, one protected and one unprotected, are used to sequence both ends of the double-stranded nucleic acid.

The present invention also provides devices and methods for sequencing nucleic acids using pyrophosphate-based sequencing means. The device includes a charged-coupled device (CCD) camera, a microfluidic chamber, a sample cartridge holder, a pump and a flow valve. The device uses chemiluminescence as the detection method, which has a inherently low background for pyrophosphate sequencing. In a preferred embodiment, the sample cartridge for sequencing is referred to as a "picotiter plate", which is formed from a commercially available fiber optic face plate, etched with acid, and has hundreds of thousands of very high volumes, each well having a volume of 75 pL. Produces small wells. The device includes a novel reagent delivery cuvette adapted for use with the sequences described herein, thereby providing a fluid reagent to a picotita plate and a reagent delivery means communicating with the reagent delivery cuvette. Photons from each well on the picotator plate are guided to a specific pixel on the CCD camera to detect the sequencing reaction.

<figref num="1A">Schematically complete the entire library preparation process, including the steps of template DNA fragmentation (Fig. 1A), end polishing (Fig. 1B), adapter ligation (Fig. 1C), nick repair, chain elongation and gel isolation (Fig. 1D). Shown.</figref><figref num="1B">Schematically complete the entire library preparation process, including the steps of template DNA fragmentation (Fig. 1A), end polishing (Fig. 1B), adapter ligation (Fig. 1C), nick repair, chain elongation and gel isolation (Fig. 1D). Shown.</figref><figref num="1C">Schematically complete the entire library preparation process, including the steps of template DNA fragmentation (Fig. 1A), end polishing (Fig. 1B), adapter ligation (Fig. 1C), nick repair, chain elongation and gel isolation (Fig. 1D). Shown.</figref><figref num="1D">Schematically complete the entire library preparation process, including the steps of template DNA fragmentation (Fig. 1A), end polishing (Fig. 1B), adapter ligation (Fig. 1C), nick repair, chain elongation and gel isolation (Fig. 1D). Shown.</figref><figref num="1E">The steps of amplification and sequencing of the template DNA are schematically shown.</figref><figref num="1F">A representative agarose gel containing a sample preparation of a 180-350 base pair adenovirus DNA library according to the method of the present invention is shown.</figref><figref num="1G">Library preparation, amplification and sequencing are shown schematically in detail.</figref><figref num="2">The universal adapter design of the present invention is schematically shown. Each universal adapter was designed to contain a unique 4bp identification sequence consisting of a 20bp nucleotide sequence for PCR priming, a 20bp nucleotide sequence for sequence priming, and a non-repetitive nucleotide sequence (ie, ACGT, CAGT, etc.) 2 It is produced from two complementary ssDNA oligonucleotides. FIG. 2B shows a typical universal adapter array pair for use in the present invention. Adapter A sense strand: SEQ ID NO: 1; Adapter A antisense strand: SEQ ID NO: 2; Adapter B sense strand: SEQ ID NO: 3; Adapter B antisense strand: SEQ ID NO: 4. FIG. 2C schematically shows a universal adapter design for use in the present invention.</figref><figref num="3">The strand substitution and extension of the nicked double-stranded DNA fragment according to the present invention are shown. Ligase of the universal adapter resulting from the synthetic oligonucleotide is followed by T4 DNA ligase treatment followed by a double-stranded DNA fragment containing two nicked regions (Fig. 3A). Addition of a strand-replacement enzyme (ie, Bst DNA polymerase I) binds the nick (Fig. 3B), replaces the nicked strand, completes the nucleotide elongation of the strand (Fig. 3C), and is nick-free. Generate a double-stranded DNA fragment (Fig. 3D).</figref><figref num="4">It is shown that streptavidin-coated beads are used to isolate single-stranded DNA directly ligated according to the present invention. Following ligation with universal adapters A and B (two different adapters are sometimes referred to as "first" and "second" universal adapters), double-stranded DNA has four possible combinations: AA. Includes adapters in, BB, AB and BA. If universal adapter B contains 5'biotin, a magnetic streptavidin-coated solid support is used to capture and isolate AB, BA and BB populations (population AA is washed away). The BB population is retained on the beads because each end of the double-stranded DNA is attached to the beads and is not released. However, upon washing in the presence of low salt buffer, only populations AB and BA release a single-stranded DNA fragment that is complementary to the bound strand. A single-stranded DNA fragment is isolated from the supernatant and used as a template for subsequent amplification and sequencing. This method is shown below in more detail.</figref><figref num="5">It is a schematic diagram of the structure of the DNA capture bead.</figref><figref num="6A">It is a schematic diagram of one aspect of the bead emulsion amplification process.</figref><figref num="6B">It is a schematic diagram of one aspect of the bead emulsion amplification process.</figref><figref num="7">It is a schematic diagram of the concentration process for removing beads to which DNA is not attached.</figref><figref num="8A">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8B">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8C">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8D">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8E">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8F">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8G">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8H">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8I">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="8J">It is a schematic diagram of the double-stranded sequence determination region by this invention.</figref><figref num="9">The double-stranded sequencing on the pyrosequencing apparatus of the present invention is shown.</figref><figref num="10A">It is an example of a double-stranded sequencing process.</figref><figref num="10B">It is an example of a double-stranded sequencing process.</figref><figref num="10C">It is an example of a double-stranded sequencing process.</figref><figref num="10D">It is an example of a double-stranded sequencing process.</figref><figref num="10E">It is an example of a double-stranded sequencing process.</figref><figref num="10F">It is an example of a double-stranded sequencing process.</figref><figref num="11A">It is a schematic diagram of rolling circle amplification using an anchor primer.</figref><figref num="11B">It is a schematic diagram of rolling circle amplification using an anchor primer.</figref><figref num="11C">It is a schematic diagram of rolling circle amplification using an anchor primer.</figref><figref num="11D">It is a schematic diagram of rolling circle amplification using an anchor primer.</figref><figref num="12">It is a figure of the sequence determination apparatus of this invention.</figref><figref num="13">It is a figure of the reagent delivery / perfusion chamber of this invention.</figref><figref num="14">It is a micrograph of the optical fiber bundle provided with a cavity called PicoTiterPlate of the present invention.</figref><figref num="15">FIG. 3 is a photomicrograph of a beaded picotiter plate with a DNA template immobilized on top and sulfylase and luciferase immobilized on top.</figref><figref num="16">It is a schematic diagram of a reagent flow chamber and FORA (PicoTiter Plate ).</figref><figref num="17">It is a figure of the analyzer of this invention.</figref><figref num="18">It is a schematic diagram of the microparallel sequencing reaction in PicoTiterPlate .</figref><figref num="19">It is a micrograph of a single well reaction.</figref><figref num="20">PicoTiterPlate Filled cartridges are shown. "A" indicates the PicoTiterPlate with the microwell facing into the cartridge, the distance between the open side of the PicoTiterPlate well and the wall of the filling cartridge is 0.3 mm; "B" is silicon sealed. C indicates the inlet port, D indicates the inlet filling pipe, E indicates the outlet port, and F indicates the outlet pipe. The PicoTiterPlate is held in the cartridge by a plastic clamp. The liquid is filled through the inlet filling tube D and enters the space between the open side of the PicoTiter Plate and the wall of the filling cartridge through the inlet C. The area defined by the silicon sealing gasket B is filled and excess liquid exits the cartridge through outlet E and outlet tube F.</figref><figref num="21">It is an enlarged view of the amplification chamber of PicoTiter Plate . "A" indicates an amplification chamber with 6 holding bolts, "B" indicates a closed cell foam insulating pad, "C" indicates a standard glass microscope slide of 25 mm x 75 mm, "D" indicates An "E" indicates a PicoTiter Plate , an "F" indicates an amplification chamber base, and an "G" indicates a second 0.25 mm thick silicon sheet.</figref><figref num="22">It is a schematic diagram of solid phase PicoTiter Plate PCR. Cylindrical structures represent individual PicoTiterPlate wells. Gray spheres indicate beads with primer fixed. Forward "F" (red) and reverse "R" (blue) primers are indicated in the 5'to 3'direction as indicated by the arrows. Synthesized sequences complementary to the forward and reverse primers are shown as dark red (F complement) and dark blue (R complement) bars. The single-stranded template DNA is shown as a solid gray line and the newly synthesized DNA strand is shown as a dashed gray line. Fluorescently labeled hybridization probes are shown as green bars.</figref><figref num="23">Fluorescent probe hybridization to a bead fixation test DNA fragment is shown. Figures 23A (upper left) and 23B (lower right) show the specificity of a mixed population of probes immobilized on control beads and hybridized to fragment B, respectively. Fragment B beads signal Alexa Fluor 647 (red) and Fragment A beads signal Alexa Fluor 488 (green). FIG. 23C (bottom panel) shows probe fluorescence from DNA capture beads after PTPCR. The beads show a homogeneous fragment A and fragment B signal, as well as a mixture of templates shown as varying degrees of yellow.</figref><figref num="24">Representative BioAnalyzer output from analysis of a single-stranded DNA library is shown.</figref><figref num="25">Indicates an insertion site where PCR and sequencing primers are adjacent.</figref><figref num="26">Cleavage products produced by PCR primer mismatches in the cross-hybridization region (CHR) are shown.</figref><figref num="27">The calculation of primer candidates based on the melting temperature is shown.</figref><figref num="28">The assembly for the atomizer used in the method of this invention is shown. The tube cap was placed on top of the atomizer (Fig. 7A) and the cap was secured with the atomizer clamp assembly (Fig. 7B). The bottom of the atomizer was attached to the nitrogen feeder (Fig. 7C) and the entire device was wrapped in parafilm (Fig. 7D).</figref><figref num="29A">Representative results of LabChip analysis of a single-stranded DNA library following spraying and polishing are shown.</figref><figref num="29B">Representative size distribution results for adapter-ligated single-stranded DNA libraries following spraying, polishing and gel purification are shown.</figref><figref num="30">The jig used to hold the tube on the stirring plate underneath the vertical syringe pump is shown. The jig was modified to hold 3 sets of bead emulsion amplification reaction mixture. The syringe was filled with the PCR reaction mixture and beads.</figref><figref num="31">The optimal placement of the syringe in the vertical syringe pump and the orientation of the emulsion tube below the syringe outlet are shown.</figref><figref num="32">The optimum placement of the syringe pump pusher block with respect to the syringe plunger and the optimum orientation of the jig on the stirring plate are shown. Using this configuration, the syringe contents were drained into the agitated emulsion oil.</figref><figref num="33">The beads suspended in the individual microreactors according to the method of the present invention (see arrows) are shown.</figref><figref num="34">The results of the two-sided sequencing showing that the sequences at both ends of the DNA template are determined are shown. SEQ ID NO: 44: atgcacatggttgacacagtggt; SEQ ID NO: 45: atgcacatggttgacacagtgg; SEQ ID NO: 46: atgccaccgacctagtctcaaactt</figref><figref num="35">The encapsulation of beads containing two oligonucleotide sequences for double-stranded sequencing is shown.</figref><figref num="36">Procedures for solution phase PCR and beading-shown are steps in a preferred embodiment of double-ended sequencing.</figref><figref num="37">Emulsion disruption and recovery of amplified template DNA on beads-shown in a preferred embodiment of sequence sequencing.</figref><figref num="38">It is a schematic diagram of a preferable method of double-stranded sequencing.</figref><figref num="39A">The results of sequencing the Staphylococcus aureus genome are shown.</figref><figref num="39B">The results of sequencing the Staphylococcus aureus genome are shown.</figref><figref num="40">The average read length in one experiment including double-ended sequencing is shown.</figref><figref num="41">The number of wells for each genomic range in the double-ended sequencing experiment is shown.</figref><figref num="42">Shown is a typical output and sequence string from a double-ended sequence determination procedure. The sequences are shown in order from top to bottom: SEQ ID NO: 47 ~ SEQ ID NO: 60.</figref>

Detailed description of the invention A novel platform for simultaneously amplifying 300,000 separate PCR reactions (PTPCRs) in a low volume of 39.5 picolitters is described herein. Stored PTPCR products from all reactions can be recovered by a wash step and assayed by real-time PCR for the presence and abundance of a particular template. More relevant herein, these PTPCR products can be detected by transporting them to a solid support and hybridizing with two color fluorescent probes for high volume solid-state cloned DNA amplification and large scale. It is shown to allow parallel sequencing.

The present invention (1) prepares nucleic acids (eg, genomes) in a rapid and efficient manner for sequencing, (2) amplifies nucleic acids in a typical manner, and (3) primer hybridizes only once. The present invention relates to a method and an apparatus for performing genomic sequencing that satisfies the purpose of performing a multiple sequencing reaction using hybridization. The present invention is particularly suitable for genotyping, detecting and diagnosing small samples of nucleic acids in a cost-effective manner. Each of these objectives is listed below.

Definition Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Methods and materials similar to or equivalent to those described herein can be used in the practice of the present invention and examples of suitable methods and materials are described below. For example, a method involving more than 2 steps can be described. In such a method, not all steps are required to achieve the defined objectives, and the present invention envisions the use of separate steps to achieve these separate objectives. All disclosures of publications, patent applications, patents and other references are incorporated herein by reference. Moreover, the materials, methods and examples are for illustration purposes only and are not intended to be limiting.

As used herein, the term "universal adapter" means two complementary and annealed oligonucleotides designed to include a nucleotide sequence for PCR priming and a nucleotide sequence for sequencing priming. Optionally, the universal adapter may further include a unique identification key sequence consisting of non-repeating nucleotide sequences (ie, ACGT, CAGT, etc.). A set of universal adapters contains two unique and distinct double-stranded sequences that can be ligated to the ends of double-stranded DNA. Thus, the same universal adapter or different universal adapters can be ligated to either end of the DNA molecule. A universal adapter can be referred to as a single-stranded universal adapter when it is contained in a large single-stranded DNA molecule or when present as an oligonucleotide.

"Target DNA" means DNA whose sequence is determined by the methods and devices of the invention.

Bonding pair means a pair of molecules that interact by a particular non-covalent interaction that depends on the three-dimensional structure of the molecules involved. Typical pairs of specific binding partners are antigen-antibody, hapten-antibody, hormone-receptor, nucleic acid chain-complementary nucleic acid chain, substrate-enzyme, substrate analog-enzyme, inhibitor-enzyme, carbohydrate- There are lectin, biotin-avidin and virus-cytoplasmic receptors.

As used herein, the term "identifying keyboard layout" means a sequence consisting of at least one of each of the four deoxyribonucleotides (ie, A, C, G, T). The same distinctive sequence can be used for the entire library of DNA fragments. Alternatively, different identification keyboard layouts can be used to track a library of DNA fragments derived from different organisms.

As used herein, the term "plurality of molecules" refers to DNA isolated from the same source, which allows different organisms to be prepared separately by the same method. In one embodiment, multiple DNA samples are derived from large segments of DNA, whole genomic DNA, cDNA, viral DNA, or from reverse transcriptases of viral RNA. This DNA can be derived from any source including mammals (ie, humans, non-human primates, rodents or dogs), plants, birds, reptiles, fish, fungi, bacteria or viruses.

As used herein, the term "library" refers to a subpopulation of small-sized DNA species generated from a single fragmented or whole-genome DNA template.

As used herein, the term "unique" as in "unique PCR priming region" refers to a sequence that is absent or present at very low copy levels in the DNA molecule to be amplified or sequenced.

As used herein, the term "compatible" refers to the end (ie, blunt or sticky end) of double-stranded DNA to which an adapter molecule can be attached.

As used herein, the term "fragmentation" refers to the process of converting large molecules of DNA into smaller pieces of DNA.

The "large template DNA" used herein is more than 25 kb, preferably more than 500 kb, more preferably more than 1 MB, and most preferably 5 MB or more.

As used herein, the term "stringent hybridization condition" refers to a condition in which only complementary sequences hybridize with each other.

The present invention described herein is generally a system and method for processing nucleic acids. Using this system and method, nucleic acids can be processed in a variety of ways that utilize nucleic acid sequencing. Profiling nucleic acid expression (compare nucleic acid expression profiles between two or more states) for such sequencing, to determine the sequence identity of the nucleic acid, or to detect single nucleotide genotypes in nucleic acid fragments. For example, a haplotype test (present in a human subject) for comparison between diseased and normal tissue, or between untreated tissue and tissue treated with drugs, enzymes, radiation or chemical treatments. For genotyping (typically in test tissues from pre-conception embryos / fetuses to detect birth defects) for genes or variants in the genes in each of the two allelic genes For diagnostic comparison of one or more genes with the same gene from a "normal" nuclearized subject, and for genotyping (one or more in the first individual of the species) The gene can be compared to the same gene in other individuals of the same species).

This system has many components. These include (1) a nucleic acid template to be processed, (2) a picotita plate to contain the nucleic acid template, (3) a flow chamber in which a nucleic acid processing reagent is flowed over the nucleic acid template, and a fluid delivery means (nucleic acid processed). Sometimes processing reagents generate light), (4) photocapture means that detect the light generated when processing nucleic acids and convert the captured light into data, and (5) process the data. There are data processing means that produce meaningful information about processed nucleic acids. Each of these components of the system is described in detail below.

1. Nucleic acid template and its preparation Nucleic acid template Nucleic acid templates that can be sequenced according to the present invention, such as nucleic acid libraries, can typically include open cyclic or closed cyclic nucleic acid molecules. A "closed ring" is a covalently closed cyclic nucleic acid molecule, such as a circular DNA or RNA molecule. An "open ring" is a linear single-stranded nucleic acid molecule having a 5'phosphate group and a 3'hydroxyl group.

In one embodiment, the single-stranded nucleic acid comprises at least 100 copies of a particular nucleic acid sequence, each copy covalently attached to each other. In some embodiments, an open ring is formed from a linear double-stranded nucleic acid molecule in situ. The ends of a given open cyclic nucleic acid molecule can be ligated with DNA ligase. The sequences at the 5'and 3'ends of the open cyclic molecule are the two regions of the adjacent nucleotide in the second nucleic acid molecule, eg, the adapter region of the anchor primer (sometimes referred to as the adapter), or the second DNA. It is complementary to two closely adjacent regions in the molecule. That is, the ends of the open cyclic molecule can be ligated with DNA ligase or extended with DNA polymerase in the gap filling reaction. The open ring is described in detail in Lizardi's US Pat. No. 5,854,033, which is incorporated herein by reference in its entirety. For example, after annealing the open ring to the anchor primer, the open ring can be converted to a closed ring in the presence of DNA ligase (eg DNA) or RNA ligase.

If desired, the nucleic acid template can be provided as a padlock probe. A padlock probe is a linear oligonucleotide containing a target complementary sequence located at each end and separated by a linker sequence. The linker can be ligated to the end of a library of nucleic acid sequences, eg, physically sheared or digested with a restriction endonuclease. When hybridized to the target sequence, the 5'and 3'end regions of these linear oligonucleotides are juxtaposed. This juxtaposition allows the two probe segments (if properly hybridized) to be covalently linked by enzymatic ligation (eg, using T4 DNA ligase) and the probes are cyclically closed to a particular target sequence. Convert to a molecule (see, eg, Nilsson, et al., 1994. Science 265: 2085-2088). The resulting probe has specificity and selectivity for gene sequence variants (eg, Lizardi, et al., 1998. Nat. Genet. 19: 225-232; Nilsson, et. Al., 1997. Nat.Genet. 16: 252-255) and the fact that the resulting reaction product remains localized to a particular target sequence, many gene sequences Suitable for simultaneous analysis of. In addition, intramolecular ligation of many different probes is expected to be less sensitive to nonspecific cross-reactivity than multiplex PCR-based methods in which non-homogeneous primer pairs can generate inappropriate amplification products. (See, for example, Landegren and Nilsson, 1997. Ann. Med. 29: 585-590).

One, provided that the nucleic acid sequence contains a region that can be used for annealing to the anchor primer sequence when present in the library, or a region that can be used for annealing to the anchor primer sequence. A starting nucleic acid template library containing either a strand or a double-stranded nucleic acid molecule can be constructed. For example, when used as a template for rolling circle amplification, the region of the double-stranded template needs to be at least temporarily single-stranded to act as a template for extension of anchor primers.

Library templates can include, but are not limited to, multiple elements that include one or more regions that are complementary to anchor primers. For example, a template library may include an insertion sequence consisting of a region complementary to a sequencing primer, a control nucleotide region, and a sequencing template that will be characterized later. As described in more detail below, the control nucleotide region is used to investigate the relationship between the amount of by-products and the number of nucleotides incorporated. As used herein, the term "complementarity" refers to a nucleotide sequence that can hybridize to a particular nucleotide sequence to form a compatible duplex.

In one embodiment, the library template contains (i) two distinct regions complementary to the anchor primer, (ii) one region homologous to the sequencing primer, and (iii) one arbitrary control nucleotide region. (iv) Includes insert sequences of, for example, 30-500, 50-200 or 60-100 nucleotides to be sequenced. The template can, of course, include all two, three or four of these features.

Template nucleic acids can be constructed from any source of nucleic acid, such as any cell, tissue or organism, and can be produced by any method recognized in the art. Suitable methods include, for example, sonicating genomic DNA and digesting it with one or more restriction endonucleases (REs) to generate fragments in the desired length range from an initial population of nucleic acid molecules. There is. Preferably, one or more of the restriction enzymes have different tetrabase identification sequences. Examples of such enzymes include, for example, Sau3Al, MspI and TaqI. Preferably, the enzyme is used in combination with an anchor primer that has a region containing the identification sequence for the corresponding restriction enzyme. In some embodiments, one or both of the adapter regions of the anchor primer comprises an additional sequence flanking the known restriction enzyme identification sequence, whereby the restriction fragment of interest specific to the anchor primer is added to the anchor primer. Allows annealing or capture. In other embodiments, restriction enzymes are used with type IIS restriction enzymes.

Alternatively, a template library can be created by generating a complementary DNA (cDNA) library from RNA, such as messenger RNA (mRNA). If necessary, the cDNA library can be further processed with restriction endonucleases to obtain the 3'end characteristic of a particular RNA, internal fragment, or fragment containing the 3'end of isolated RNA. .. The adapter region in the anchor primer can be complementary to a known or suspected sequence polymorphism in a target sequence that is believed to occur in the template library, eg, a fragment generated by endonuclease digestion.

In one embodiment, an indexing oligonucleotide can be attached to a member of the template library, after which the template nucleic acid can be correlated with the population of nucleic acids from which the template nucleic acid is derived. For example, one or more samples of the starting DNA population can be fragmented separately using any of the previously disclosed methods (eg, restriction digestion, sonication). An indicator oligonucleotide sequence specific for each sample is attached to, eg, ligated, to the ends of the members of the fragmented population. Indicating oligonucleotides can act as regions for cyclization, amplification and optionally sequencing, thereby being used to direct or encode nucleic acids to identify the starting sample from which they are derived. Becomes possible.

Different template libraries made with multiple identifiable directive primers can be mixed for subsequent reactions. By sequencing the members of the library, the sequence corresponding to the indicating oligonucleotide can be identified. Based on this information, the origin of any given fragment can be estimated.

The present invention includes a sample preparation process for obtaining a solid or mobile solid substrate containing multiple anchor primers or adapters covalently attached to a template nucleic acid.

If the template nucleic acid is cyclic, an anchor primer is annealed to the complementary region of the cyclic nucleic acid, then the annealed anchor primer is extended with a polymerase to contain one or more copies of the sequence complementary to the cyclic nucleic acid. By forming the nucleic acid, it is preferred that one or more copies of the covalently bound anchor primer and the target nucleic acid are formed.

Adhesion of anchor primers to a solid or mobile solid substrate can occur before, during, or after elongation of the annealed anchor primers. That is, in one embodiment, one or more anchor primers are attached to a solid or mobile solid substrate, after which the anchor primers are annealed to the target nucleic acid and extended in the presence of the polymerase. Alternatively, in the second embodiment, the anchor primer is first annealed to the target nucleic acid and the 3'OH end of the annealed anchor primer is extended with a polymerase. The extended anchor primer is then attached to a solid or mobile solid substrate. By changing the sequence of the anchor primer, different target nucleic acids existing in the nucleic acid population can be specifically amplified.

Preferred embodiments for the preparation of template nucleic acids for amplification and sequencing reactions are outlined below. The present invention includes a method of preparing sample DNA consisting of seven general steps. (a) Fragment large template DNA or whole-genome DNA samples to produce multiple digested DNA fragments; (b) create compatible ends on multiple digested DNA samples; (c) set of universals Ligate the adapter sequence to the end of the fragmented DNA molecule to create multiple adapter-ligated DNA molecules (each universal adapter sequence is known to contain a common PCR primer sequence, a common sequencing primer sequence and a distinctive tetrabase key sequence. Has a unique base sequence in, and one adapter is attached to biotin); (d) Isolate and isolate multiple ligated DNA fragments; (e) Arbitrary of multiple ligated DNA fragments (F) Nick repair and strand extension of multiple ligated DNA fragments; (g) each of the ligated DNA fragments adheres to a solid support; and (h) unique to each end Isolation of a population containing a single-stranded adapter ligated DNA fragment with an adapter (ie, providing directional).

The following description summarizes the basic steps involved in the methods of the invention. Although these steps are listed in a particular order, as is known to those of skill in the art, the order of these steps can be manipulated to achieve the same result. Such an operation is intended by the present inventors. In addition, some steps can be minimized, as is known to those of skill in the art.

Fragmentation In practicing the methods of the invention, fragmentation of DNA samples can be performed by means known to those of skill in the art. Preferably, fragmentation is performed by enzymatic or mechanical means. The mechanical means is sonication or physical shearing. Enzymatic means can be performed by digestion with a nucleoase (eg, deoxyribonuclease I (DNase I)) or one or more restriction endonucleases. In a preferred embodiment, fragmentation results in an end with an unknown sequence.

In a preferred embodiment, the enzymatic means is DNase I. DNaseI is a multipurpose enzyme that non-specifically cleaves double-stranded DNA (dsDNA) to release 5'phosphorylated di-, tri- and oligonucleotide products. DNaseI is Mn²⁺, Mg²⁺And Ca²⁺Has optimal activity in buffers containing but not containing other salts. The purpose of the DNaseI digestion process is to fragment a large DNA genome into smaller species containing libraries. The cleavage properties of DNase I result in random digestion of template DNA (ie, no sequence bias), with blunt-ended dsDNA fragments predominant when used in the presence of manganese buffer (Melgar, E. and DA Goldthwait). .1968. Deoxyribonucleic acid nucleases.II.The effects of metal on the mechanism of action of deoxyribonuclease IJBiol.Chem.243: 4409). The range of digested products generated after DNase I treatment of the genomic template depends on three factors. i) Amount of enzyme used (units); ii) Digestion temperature (° C); and iii) Incubation time (minutes). The DNase I digestion conditions outlined below were optimized to generate a genomic library in the 50-700 base pair (bp) size range.

In a preferred embodiment, DNase I digests large template DNA or whole genomic DNA for 1-2 minutes to generate a population of polynucleotides. In another preferred embodiment, DNase I digestion is performed at a temperature of 10 ° C to 37 ° C. In yet another preferred embodiment, the digested DNA fragment is in the range of 50 bp to 700 bp in length.

Polishing Mn²⁺Digestion of genomic DNA (gDNA) templates with DNase I in the presence of is produced fragments of DNA that are blunt-ended or have prominent ends that are one or two nucleotides in length. In a preferred embodiment, Pfu DNA polymerase is used to produce an increased number of blunt ends. In other embodiments, less efficient DNA polymerases such as T4 DNA polymerase or Klenow DNA polymerase can be used to make blunt ends. Pfu "polishing" or blunting increases the amount of blunt-ended species that occurs following digestion of the genomic template with DNase I. Using Pfu DNA polymerase to polish the fragments fills the 5'protrusions. In addition, Pfu DNA polymerase does not show DNA extenderase activity, but has 3' 5'exonuclease activity, which removes one and two nucleotide extensions and can be used for adapter ligation. Increased amount of blunt-ended DNA fragments (Costa, GL and MP Weiner. 1994a. Protocols for cloning and analysis of blunt-ended PCR-generated DNA fragments.PCR Methods Appl 3 (5): S95; Costa, GL, A.Grafsky and MPWeiner.1994b.Cloning and analysis of PCR-generated DNA fragments.PCR Methods Appl 3 (6): 338 Costa, GLand MPWeiner.1994c.Polishing with T4 or Pfu Polymerase increases the efficiency of cloning of PCR products. Nucleic Acids Res. 22 (12): 2423).

Adapter ligation When attaching a library of nucleic acids to a solid substrate, preferably the nucleic acid template is annealed to the anchor primer sequence using recognized techniques (eg, Hatch, et al., 1999. Genet. Anal. Biomol. Engineer. 15: 35-40; see Kool's US Pat. No. 5,714,320 and Lizardi's US Pat. No. 5,854,033). Generally, the procedure for annealing an anchor primer to a template nucleic acid sequence is specific, i.e. completely or completely, between one or more adapter regions in the anchor primer sequence and the sequence present in the template library. Suitable as long as close complementarity formation is obtained.

In a preferred embodiment, DNA library fragmentation and blunt termination is followed by the addition of a universal adapter sequence to each DNA fragment. The universal adapter is a set of unique sequences, typically 20 bp in length, optionally followed by a unique distinctive keyboard layout consisting of at least one of each of the four deoxyribonucleotides (ie, A, C, G, T). It is designed to contain a set of unique PCR priming regions, typically 20 bp long, located adjacent to the determined priming region. In a preferred embodiment, the discriminative keyboard layout is 4 bases in length. In another embodiment, the discriminative keyboard layout can be a combination of 1 to 4 bases. In yet another embodiment, each unique universal adapter is 44 bp in length. In a preferred embodiment, the universal adapter is T4 DNA ligase is used to ligate each end of the DNA fragment to add a total of 88 bp of nucleotides to each DNA fragment. Different universal adapters are specifically designed for each DNA library preparation, thus providing a unique identifier for each organism. The size and arrangement of universal adapters can be modified as will be apparent to those skilled in the art.

For example, a market seller (ie, Integrated DNA Technologies, IA or Operon) to prepare two different universal adapters (ie, "first" and "second"). Single-stranded oligonucleotides can be ordered from Technologies, CA). In one embodiment, the universal adapter oligonucleotide sequence is modified during synthesis using two or three phosphorothioate bonds instead of phosphodiester bonds at both the 5'and 3'ends. Unmodified oligonucleotides are subject to rapid denaturation by nucleases, thus limiting their usefulness. A nuclease is an enzyme that catalyzes the hydrolytic cleavage of a polynucleotide chain by cleaving the phosphodiester bond between nucleotide bases. One simple and widely used nuclease resistance chemistry available for use in oligonucleotide applications is phosphorothioate modification. In phosphorothioates, the sulfur atom replaces the non-bridging oxygen in the oligonucleotide backbone, making it resistant to all forms of nuclease digestion (ie, resistant to both endonuclease digestion and exonuclease digestion). Each oligonucleotide is purified by HPLC to ensure that no contamination or pseudo-oligonucleotide sequences occur during the preparation of synthetic oligonucleotides. The universal adapter is designed to allow directional ligation to blunt-ended fragmented DNA. Design each pair of double-stranded universal adapters with PCR priming regions containing non-complementary 5'four-base overhangs that are unable to bind to blunt-ended DNA fragments and prevent mutual ligation at these ends. .. Therefore, between the 3'end of the adapter and the 5'end of the DNA fragment or between the 3'end of the DNA fragment and the 5'of the adapter. Bonding only occurs with the end. Double-stranded universal adapter by using single-stranded oligonucleotides designed primarily with sequences that anneal complementary oligonucleotides and prevent cross-hybridization between two non-complementary oligonucleotides. An array is produced. In one embodiment, the annealing of complementary oligonucleotides forms a 95% universal adapter. In a preferred embodiment, 97% universal adapters are formed from the annealing of complementary oligonucleotides. In a more preferred embodiment, 99% universal adapters are formed from the annealing of complementary oligonucleotides. In the most preferred embodiment, 100% universal adapters are formed from the annealing of complementary oligonucleotides.

One of the two adapters can be attached to the support binding moiety. In a preferred embodiment, 5'biotin is added to the first universal adapter for subsequent isolation of the ssDNA template and to the surface of a solid support saturated with a biotin-binding protein (ie, streptavidin, neutravidin or avidin). Allows non-covalent coupling of universal adapters. Other bindings are well known in the art and can be used in place of biotin-streptavidin (eg, antibody / antigen-epitope, receptor / ligand and oligonucleotide pairing or complementarity). In one embodiment, the solid support is beads, preferably polystyrene beads. In one preferred embodiment, the beads are about 2.8 μm in diameter. As used herein, these beads are referred to as "prep prep beads".

Each universal adapter can be prepared by combining and annealing two ssDNA oligonucleotides, one containing the sense sequence and the other containing the antisense (complementary) sequence. Figure 2 outlines the design of the universal adapter.

Isolation of ligation products Fragmentation of the universal adapter ligation forms fragmented DNA with each terminal adapter, unbound single adapter and adapter dimer. In a preferred embodiment, agarose gel electrophoresis is used as a method for separating and isolating the matched DNA library population from the unbound single adapter and adapter dimer population. In other embodiments, the fragments can be separated by size exclusion chromatography or sucrose precipitation. The procedure for DNase I digestion of DNA typically produces a library population ranging from 50 to 700 bp. In a preferred embodiment, when performing agarose gel electrophoresis in the presence of a DNA marker, the addition of the 88 bp universal adapter set shifts the DNA library population to a larger size, resulting in an electrophoresis profile in the size range of about 130-800 bp. The adapter dimer migrates to 88 bp and the unligated adapter migrates to 44 bp. Therefore, many double-stranded DNA libraries with dimensions ranging from 200 to 800 bp can be physically isolated from agarose gels and purified using standard gel extraction techniques. In one embodiment, gel isolation of the matched ligate DNA library recovers a library population with dimensions ranging from 200 to 400 bp. Other methods of identifying the fragment that ligated the adapter are known to those of skill in the art.

Nick repair Since the DNA oligonucleotide used for the universal adapter is not 5'phosphorylated, there is a gap at the 3'junction of the fragmented DNA after ligase treatment (see Figure 3A). Both of these "gaps" or "nicks" can be filled with a DNA polymerase enzyme that can bind to a DNA fragment with a nick, replace the strand, and extend. DNA polymerases that lack 3' 5'exonuclease activity but exhibit 5' 3'exonuclease activity recognize nicks so that nicks are repaired and non-nick double-stranded DNA is formed. It has the ability to replace strands and extend strands (see Figures 3B and 3C) (Hamilton, SC, JWFarchaus and MCDavis. 2001. DNA polymerases as engines for biotechnology. BioTecchniques 31: 370).

Multiple modifying enzymes, including but not limited to polymerases, ligases and kinases, are utilized for the nick repair process. DNA polymerases that can be used for this purpose include, for example, E. coli DNA pol I, Thermoanaerobacter thermohydrosulfuricus pol I, and bacteriophage φ29. In a preferred embodiment, the strand-substituted enzyme Bacillus stearothermophilus pol I (Bst DNA polymerase I) is used to repair nicked dsDNA, resulting in nickless dsDNA (Fig. 3D). See). In another preferred embodiment, the ligase is T4 and the kinase is a polynucleotide kinase.

Isolation of single-strand DNA After the development of nick-free dsDNA, ssDNA containing both the first and second adapter molecules is isolated (the desired population is shown below with an asterisk; "A" and "B". Corresponds to the first and second adapters). Double-stranded DNA library have the adapter attached with the following structure is. Universal Adapter A-DNA Fragment-Universal Adapter A Universal Adapter B-DNA Fragment-Universal Adapter A^* Universal Adapter A-DNA Fragment-Universal Adapter B^* Universal Adapter B-DNA Fragment-Universal Adapter B

The universal adapter is designed so that only one universal adapter has a 5'biotin moiety. For example, if universal adapter B has a 5'biotin moiety, streptavidin-coated sample prep beads can be used to bind all double-stranded DNA library species to universal adapter B. Genomic library populations containing the two universal adapter A species do not contain the 5'biotin moiety and do not bind to streptavidin-containing sample prep beads and can therefore be washed away. The only species that remain attached to the beads are those with universal adapters A and B, and those with two universal adapter B sequences. DNA species with two universal adapter B sequences (ie, each with a biotin moiety at the 5'end) bind to streptavidin-coated sample prep beads at each end because each strand contained in the duplex is bound. To do. Double-stranded DNA species with universal adapter A and universal adapter B contain a single 5'biotin moiety and therefore bind to streptavidin-coated beads at only one end. The sample prep beads are magnetic, which is why the sample prep beads maintain their bond to the solid support when magnetized. Thus, in the presence of low salt ("melted" or denatured) solutions, only DNA fragments containing a single universal adapter A and a single universal adapter B sequence release complementary unbound strands. This single-stranded DNA population can be collected and quantified by, for example, pyrophosphate-based sequencing, real-time quantitative PCR, agarose gel electrophoresis or capillary gel electrophoresis.

Adhesion of template to beads In one embodiment, the ssDNA library produced by the methods of the invention is quantified to calculate the number of molecules per unit volume. These molecules are annealed into solid supports (beads) containing oligonucleotide capture primers that are complementary to the PCR priming region at the end of the universal adapter of the ssDNA species. The beads are then transferred to the amplification protocol. The single clonal population captured on the DNA beads can then be sequenced. In one embodiment, the solid support is beads, preferably cepharose beads. As used herein, these beads are referred to as "DNA capture beads".

The beads used herein are of any convenient size and can be constructed from any number of known materials. Examples of such materials include inorganic materials, natural polymers, and synthetic polymers. Specific examples of these materials include cellulose, cellulose derivatives, acrylic resins, glass; polystyrene, polystyrene, gelatin, polyvinylpyrrolidone, copolymers of vinyl and acrylamide, divinylbenzene and crosslinked polystyrene (Merrifield Biochemistry). See 1964, 3,1385-1390), polyacrylamide, latex gel, polystyrene dextran, rubber, silicon, plastic, nitrocellulose, cellulose, natural sponge, silica gel, glass, metallic plastic, cellulose, crosslinked dextran (eg, eg. Sephadex ) and agarose gel (Sepharose ), as well as solid support known to those of skill in the art. In one embodiment, the diameter of the DNA capture beads ranges from 20 to 70 μm. In a preferred embodiment, the diameter of the DNA capture beads is in the range of 20-50 μm. In a more preferred embodiment, the diameter of the DNA capture beads is about 30 μm.

In one aspect, the invention comprises (a) preparing a population of ssDNA templates according to the methods disclosed herein, (b) each DNA template so that there is one molecule of DNA per solid support. To attach to a solid support, (c) to amplify a population of single-stranded templates so that amplification produces a clone population of each DNA fragment on each solid support, (d) bead cloning. Includes the steps of arranging the population and includes methods for generating a library of solid supports.

In one embodiment, the solid support is a DNA capture bead. In another embodiment, the DNA is genomic DNA, cDNA, or a reverse transcriptase of viral RNA. DNA can be attached to the solid support by, for example, biotin-streptavidin binding, covalent binding or complementary oligonucleotide hybridization. In one embodiment, each DNA template is ligated into a set of universal adapters. In another embodiment, the universal adapter pair comprises a common PCR primer sequence, a common sequencing primer sequence, and a distinctive key sequence. Single-stranded DNA giving a unique end is isolated and the single-stranded molecule is then attached to a solid support for use in amplification techniques for clonal elongation of the population. DNA can be amplified by PCR.

In another aspect, the invention provides a library of solid supports manufactured by the methods described herein.

Nucleic acid templates prepared by this method (eg, DNA templates) can be used for many molecular biological procedures such as linear elongation, rolling circle amplification, PCR and sequencing. This method can be carried out in the binding reaction, for example, using a high molar ratio of beads to DNA. Capture of single-stranded DNA molecules follows a Poisson distribution, producing a subpopulation of beads with no DNA attached and a subpopulation of beads with two molecules of DNA attached. In a preferred embodiment, there is one bead for each molecule of DNA. In addition, it is possible to include additional components in the adapter that are useful for further manipulation of the isolated library.

2. Nucleic acid template amplification In order to sequence the nucleic acid template according to the method of the invention, the copy number must be amplified in order to generate a sufficient number of copies of the template to generate a detectable signal by photodetecting means. Any suitable nucleic acid amplification means can be used.

Many in vitro nucleic acid amplification techniques have been described. These amplification techniques can be divided into the following methods. (i) Temperature Circulation-Polymerase Chain Reaction (PCR) (see, eg, Saiki, et al., 1995. Science 230: 1350-1354), Ligase Chain Reaction (eg, Barany, 1991.Proc.Natl.Acad). .Sci.USA 88: 189-193; Barringer, et al., 1990.Gene 89: 117-122) and transcription-based amplification (eg, Kwoh, et al., 1989.Proc.Natl.Acad Methods that require .Sci.USA 86: 1173-1177), and (ii) isothermal amplification systems-independent sequence replication (eg, Guatelli, et al., 1990.Proc.Natl.Acad.Sci). .USA 87: 1874-1878), QB Replicase System (see, eg, Lizardi, et al., 1988. BioTechnology 6: 1197-1202), Chain Substitution Amplification (Nucleic Acids) Res.1992 Apr 11; 20 (7): 1691-6); and PNAS 1992 Jan 1; 89 (1): 392-6, and NASBA J Virol Methods.1991 Dec; 35 (3): 273-86. the method of.

In one embodiment, isothermal amplification is used. Isothermal amplification also includes rolling circle amplification (RCA). RCA is described, for example, in Kool's US Pat. No. 5,714,320 and Lizardi's US Pat. No. 5,854,033; Hatch, et al., 1999. Genet. Anal. Biomol. Engineer. 15: 35-40. The result of RCA is a single DNA strand containing a concatemer that extends from the 3'end of the anchor primer (and thus binds to the solid support matrix) and contains multiple copies of the cyclic template annealed to the primer sequence. Typically, RCA can provide copies of 1,000 to 10,000 or more cyclic templates, each in the size range of, for example, about 30 to 500, 50 to 200 or 60 to 100 nucleotides.

The product of RCA amplification after annealing the cyclic nucleic acid molecule to the anchor primer is schematically shown in FIG. 11A. Cyclic template nucleic acid 102 is annealed to anchor primer 104 having free 3'OH attached to surface 106 at its 5'end and available for elongation. Circular template nucleic acid 102 contains two adapter regions 108 and 110 that are complementary to the region of sequence in anchor primer 104. Circular template nucleic acid 102 also includes regions 114 and inserts 112 that are homologous to the sequencing primers used in the sequencing reactions described below.

Upon annealing, the sequences in template nucleic acid 102 can be used to extend free 3'-OH on anchor primer 104. Anchor primer 102 can be extended multiple times along the template, each iteration adding a sequence complementary to the cyclic template nucleic acid to the sequence extended from the anchor primer. Four repetitions or four rolling circle replications are shown in FIG. 11A as extended anchor primer amplification product 114. Extension of the anchor primer results in an amplification product that is covalently or otherwise physically attached to substrate 106. Many in vitro nucleic acid amplification techniques can be utilized to amplify anchor primer sequences. Amplification is typically carried out in the presence of polymerases, such as DNA or RNA-induced DNA polymerases, and 1, 2, 3 or 4 types of nucleotide triphosphates, and optionally, auxiliary binding proteins. Generally, if 3' 5'exonuclease activity is lacking, any polymerase capable of extending the primed 3'-OH group can be used. Suitable polymerases are, for example, Bacillus stearothermophilus, Thermus acquaticus, Pyrococcus furiosis, Thermococcus litoralis, and Thermus thermophilus, Includes Bacterophage T4 and T7, as well as DNA polymerase from the Escherichia coli DNA polymerase I Klenow fragment. Suitable RNA-induced DNA polymerases include, for example, reverse transcriptase from avian myeloid leukemia virus, reverse transcriptase from Molonee murine leukemia virus, and reverse transcriptase from human immunodeficiency virus I.

Further embodiments of the cyclic template and anchor primer are shown in more detail in FIGS. 11B-11D. FIG. 11B shows an annealed open ring linear substrate that can serve as a template for anchor primer extension during ligation. Array<img file="JP2010142233A_D0001.tif" />The template molecule with the 5'-terminal biotin linker and the anchor primer having the sequence 5'-gac ctc aca cga tgg ctg cag ctt-3'(SEQ ID NO: 6) are annealed. Annealing the template brings the 5'and 3'ends of the template molecule close together. The anchor primer 3'OH can be extended using a cyclic template.

The use of cyclic templates and anchor primers to identify single nucleotide polymorphisms is shown in Figure 11C. Array<img file="JP2010142233A_D0002.tif" />Common anchor primers with are shown. Anchor primer is sequence<img file="JP2010142233A_D0003.tif" />Annealed to an SNP probe with. The SNP probe is then sequenced<img file="JP2010142233A_D0004.tif" />It hybridizes to one region of the SNP-containing region of the gene having. By hybridizing the polymorphic nucleic acid sequence to the SNP probe complex, the SNP probe is subsequently ligated and cyclized. SNP probes are designed so that the 5'and 3'ends are annealed into the genomic region and adjacent to the polymorphic site region, as shown in Figure 11C. The cyclized SNP probe can then be extended and sequenced using the methods described herein. Nucleic acids lacking polymorphisms do not hybridize with adjacent 5'and 3'ends of the SNP probe. In this case, the SNP probe cannot be ligated to form the cyclic substrate required for subsequent elongation.

FIG. 11D shows the use of gap oligonucleotides with cyclic template molecules. Array<img file="JP2010142233A_D0005.tif" />Anchor primer with is attached to the surface via a biotin linker. Array<img file="JP2010142233A_D0006.tif" />Annealing a template molecule with an anchor primer results in an anchor primer that is adjacent by a partially single-stranded or gapped region, a double-stranded region. Array<img file="JP2010142233A_D0007.tif" />The gapping molecule with is then annealed to the anchor primer. Ligation of both ends of the gap oligonucleotide to the template molecule forms a cyclic nucleic acid molecule that can act as a template for rolling circle amplification.

RCA can occur when double-stranded molecule replication begins at the origin. Nick then opens one of the strands and extends the free 3'terminal hydroxy moiety produced by Nick by the action of DNA polymerase. The newly synthesized strand eventually replaces the first parent DNA strand. This type of replication is known as rolling circle replication (RCR) because the replication points are thought to "rotate around" the circular template strand and can theoretically continue indefinitely. In addition, the newly synthesized DNA strand covalently binds to the first template, so that the substituted strand has the first genomic sequence (eg, the gene of interest or other sequence) at its 5'end. In RCR, the first genomic sequence is followed by any number of "replication units" that are complementary to the first template sequence, and each replication unit is synthesized by continuing to rotate the first template sequence. Therefore, each subsequent rotation replaces the DNA synthesized in the previous replication cycle.

The use of RCA reactions can generate chains that represent many tandem copies of the complement to the cyclized molecule. For example, RCA was recently used to perform an isothermal cascade amplification reaction of a cyclized padlock probe in vitro to detect a single copy gene in a human genomic DNA sample (Lizardi, et al., 1998. Nat. Genet). See .19: 225-232). In addition, RCA was also used to detect single DNA molecules in solid phase assays, but this technique created difficulties when applied to hybridization in situ (Lizardi, et al., See 1998, Nat. Genet. 19: 225-232).

If desired, RCA can be performed at elevated temperatures, such as temperatures above 37 ° C, 42 ° C, 45 ° C, 50 ° C, 60 ° C or 70 ° C. In addition, the RCA can be run first at a lower temperature, for example room temperature, and then at a higher temperature. High temperature RCA is preferably carried out with a thermostable nucleic acid polymerase and with primers capable of stable and specific annealing at high temperatures.

RCA can also be performed using unnatural oligonucleotides, such as peptide nucleic acids. In addition, RCA can be performed in the presence of co-proteins such as single-stranded binding proteins.

The development of a method for amplifying short DNA molecules immobilized on a solid support called RCA has recently been described in the literature (eg, for example).<img file="JP2010142233A_D0008.tif" />Please refer to). RCA targets specific DNA sequences by hybridization and DNA ligase reactions. The cyclic product is then used as a template in the rolling circle replication reaction.

Other examples of isothermal amplification systems include, for example, (i) self-sustaining sequence replication (see, eg, Guatelli, et al., 1990.Proc.Natl.Acad.Sci.USA 87: 1874-1878), (ii) Qβ replicase system (see, eg, Lizardi, et al., 1988. BioTechnology 6: 1197-1202) and (iii) nucleic acid sequence-based amplification (NASBA ; Kievits, et al., 1991). See .J.Virol.Methods 35: 273-286).

PCR amplification of nucleic acid template In a preferred embodiment, a polymerase chain reaction (PCR) is used to make additional copies of the template nucleic acid. The PCR amplification step can be performed before the nucleic acid template is dispersed on the picotiter plate, or after the nucleic acid template is dispersed on the picotiter plate.

Bead emulsion PCR amplification In a preferred embodiment, a PCR amplification step is performed prior to dispersing the nucleic acid template on the picotator plate.

In a particularly preferred embodiment, a novel amplification system referred to herein as "bead emulsion amplification" is performed by attaching a template nucleic acid (eg, DNA) to be amplified to a solid support, preferably in the form of generally spherical beads. Do. The library of single-stranded template DNA prepared by the sample preparation method of the present invention is an example of one suitable source of starting nucleic acid template library to be attached to beads for use in this amplification method.

The beads are attached to a number of single primer species complementary to the region of the template DNA (ie, primer B in FIG. 6). The template DNA is annealed to the bead binding primer. The beads are suspended in an aqueous reaction mixture and then encapsulated in a water-in-oil emulsion. The emulsion consists of separate aqueous phase droplets about 60-200 μm in diameter surrounded by a thermostable oil phase. Each microdrop preferably contains an amplification reaction solution (ie, a reagent required for nucleic acid amplification). An example of amplification is a PCR reaction mixture (polymerase, salt, dNTP) and a pair of PCR primers (primer A and primer B). See Figure 6A. A subpopulation of microdrop populations also contains DNA beads containing DNA templates. This subpopulation of microdroplets is the basis for amplification. Microdrops not included in this subpopulation do not have template DNA and are not involved in amplification. In one embodiment, the amplification technique is PCR, where the PCR primers have a ratio of 8: 1 or 16: 1 to perform asymmetric PCR (ie, a second primer 1 to a first primer 8 or 16). Exists.

In this overview, the DNA is annealed to the oligonucleotide (primer B) immobilized on the beads. During thermal circulation (Fig. 6B), the bond between the single-stranded DNA template and the fixed B primer on the beads is broken, releasing the template into the surrounding microencapsulated solution. The amplified solution, in this case the PCR solution, contains additional solution phase Primer A and Primer B. The solution phase B primer binds more easily to the complementary b'region of the template because the solution phase primer has a faster binding rate than the stationary primer. In early phase PCR, both A and B chains are equally well amplified (Fig. 6C).

Mid-phase PCR (ie, between 10 and 30 cycles) depletes the B primer, stopping exponential amplification. The reaction then becomes asymmetric amplification, and the amplicon population is dominated by the A chain (Fig. 6D). In late phase PCR (Fig. 6E), after 30-40 cycles, asymmetric amplification increases the concentration of A chain in solution. The excess A chain begins to anneal to the bead-fixed B primer. The thermostable polymerase then uses the A chain as a template to synthesize a fixed bead-bound B chain of amplicon.

In the final phase PCR (Fig. 6F), continuous thermal circulation results in further annealing of the bead binding primers. Solution phase amplification is minimal at this stage, but increases the concentration of immobilized B chains. The emulsion is then broken and the fixed product is denatured (by heat, pH, etc.) to a single strand, thereby removing the complementary A strand. The A primer is annealed to the A'region of the fixed strand and the fixed strand is loaded with the sequencing enzyme and the required auxiliary proteins. The beads are then sequenced using the recognized pyrophosphate techniques (eg, described in US Pat. Nos. 6,274,320, 6,258,568, and 6,210,891, which are incorporated herein by reference). decide.

Temperature design In a preferred embodiment, the DNA template to be amplified by bead emulsion amplification can be a population of DNA, such as a genomic DNA library or a cDNA library. It is preferred that each member of the population has a common nucleic acid sequence at the first end and a common nucleic acid sequence at the second end. This can be achieved, for example, by ligating the first adapter DNA sequence to one end of the DNA population and the second adapter DNA sequence to the second end of the DNA population. Due to the nature of cloning vectors (eg, Bluescript, Stratagene, La Jolla, CA), many DNA and cDNA libraries have a common sequence at the first end of each member DNA and a second at the second end. Fits this description with a common sequence. The DNA template can be of any size that facilitates in vitro amplification, including preferred amplification techniques for PCR and asymmetric PCR. In a preferred embodiment, the DNA template is about 150-750 bp in size, eg, about 250 bp in size.

Binding of nucleic acid template to capture beads In the first step, the single-stranded nucleic acid template to be amplified is attached to the capture beads. The nucleic acid template can be attached to the solid support capture beads in any manner known in the art. There are various methods in the art for attaching DNA to a solid support such as preferred microbeads. According to the present invention, the chemical covalent attachment of DNA to beads can be achieved using standard coupling agents such as water-soluble carbodiimides, where the 5'phosphate groups on the DNA are phosphoami. It is attached to the amine-coated capture beads by a date bond. Another method is to first couple a particular oligonucleotide linker to the beads using similar chemical means, and then use DNA ligase to bind the DNA to the linker on the beads. Other chemical binding means for binding the oligonucleotide to the beads include the use of N-hydroxysuccinamide (NHS) and its derivatives. In such a method, one end of the oligonucleotide contains a reactive group (eg, an amide group) that covalently binds to the solid support, and the other end of the linker can bind to the oligonucleotide to be immobilized. Contains reactive groups. In a preferred embodiment, the oligonucleotide is covalently attached to the DNA capture beads. However, non-covalent bonds such as chelate bonds or antigen-antibody complexes can also be used to attach oligonucleotides to the beads.

Oligonucleotide linkers that specifically hybridize to unique sequences at the ends of DNA fragments, such as overlapping ends from restriction enzyme sites or the "sticky ends" of bacteriophage λ-based cloning vectors, can be used, but with blunt ends. Ligation can also be used advantageously. These methods are described in detail in US Pat. No. 5,674,743. It is preferred that any method used to fix the beads be followed throughout the steps of the method of the invention to bind the fixed oligonucleotide.

In one embodiment, each capture bead is designed to have multiple nucleic acid primers that recognize (ie, are complementary to) a portion of the nucleic acid template, thus hybridizing the nucleic acid template to the capture beads. Since clonal amplification of the template species is desired in the methods described herein, it is preferred that only one unique nucleic acid template be attached to any one capture bead.

The beads used herein are of any convenient size and are made from any number of known materials. Examples of such materials include inorganic materials, natural polymers and synthetic polymers. Specific examples of these materials include cellulose, cellulose derivatives, acrylic resins, glass, silica gel, polystyrene, gelatin, polyvinylpyrrolidone, copolymers of vinyl and acrylamide, polystyrene crosslinked with divinylbenzene, etc. (eg, Merrifield, Biochemistry 1964, (Described in 3,1385-1390), polyacrylamide, latex gel, polystyrene, dextran, rubber, silicon, plastic, nitrocellulose, natural sponge, silica gel, control pore glass, metal, crosslinked dextran (eg, There are Sephadex ), agarose gel (Sepharose ), and solid support known to those skilled in the art. In a preferred embodiment, the capture beads are Sepharose beads with a diameter of about 25-40 μm.

Emulsification Capture beads to which the single-strand template nucleic acid is attached are emulsified as a heat-stable water-in-oil emulsion. Emulsions can be formed according to any suitable method known in the art. One method for making an emulsion is described below, but any method for making an emulsion can be used. These methods are known in the art and include the adjuvant method, the countercurrent method, the cross current method, the rotary drum method, and the membrane method. In addition, the size of the microcapsules can be adjusted by varying the flow rate and rate of ingredients. For example, in the addition of droplets, the size of the droplets and the total time of delivery can be varied. Preferably, the emulsion comprises a bead "microreactor" at a density of about 3,000 beads / μl.

The emulsion is preferably obtained by suspending the template-attached beads in an amplified solution. As used herein, the term "amplified solution" means a sufficient mixture of reagents required to perform amplification of template DNA. An example of an amplified solution, i.e. a PCR amplified solution, is provided in the following examples, but it is believed that this PCR solution can be varied.

In one embodiment, the bead / amplified solution mixture is added dropwise into a rotating mixture of biocompatible oils (eg, light oil, manufactured by Sigma) for emulsification. The oil used can be supplemented with one or more biocompatible emulsion stabilizers. These emulsion stabilizers include Atlox 4912, Span 80, and other recognized and commercially available suitable stabilizers. Preferably, the size of the droplets formed is 5 μm to 500 μm, more preferably about 50 to 300 μm, most preferably 100 to 150 μm.

The size of the microreactor is not limited. The microreactor needs to be large enough to contain sufficient amplification reagents for the required degree of amplification. However, the microreactors need to be small enough to be able to amplify a population of microreactors, each containing a member of a DNA library, with conventional laboratory equipment (eg, PCR heat circulation equipment, test tubes, incubators, etc.). is there.

Due to the limitations mentioned above, the optimum size of the microreactor can be 100-200 μm in diameter. A microreactor of this size allows amplification of a DNA library containing approximately 600,000 members in a suspension of microreactors with a volume of less than 10 ml. For example, if PCR is the amplification method of choice, then 96 tubes of a regular thermal cycler with a capacity of 96 tubes will be filled with 10 ml. In a preferred embodiment, a suspension of 600,000 microreactors is less than 1 ml in volume. Less than 1 ml of suspension can be amplified in about 10 tubes of a conventional PCR thermal cycler. In the most preferred embodiment, the suspension of 600,000 microreactors has a volume of less than 0.5 ml.

amplification Post-encapsulation, transcription-based amplification system<img file="JP2010142233A_D0009.tif" />The template nucleic acid can be amplified by any suitable method of DNA amplification, including. Generals such as "di-oligonucleotide" amplification, isothermal amplification (Walker, GT et al., Proc. Natl. Acad. Sci. (USA) 89: 392-396 (1992)) and rolling circle amplification (outlined at 5,714,320). Other methods of lesser sex can be used in the present invention.

In a preferred embodiment, DNA amplification is performed by PCR. PCR according to the invention can be performed by encapsulating the target nucleic acid bound to the beads with a PCR solution containing all the necessary reagents for PCR. PCR can then be performed by exposing the emulsion to any suitable thermal cycle scheme known in the art. In a preferred embodiment, 30 to 50 cycles, preferably about 40 cycles of amplification are performed. It is desirable, but not necessary, to provide one or more hybridization and extension cycles after the amplification cycle following the amplification procedure. In a preferred embodiment, 10-30 cycles, preferably about 25 cycles of hybridization and extension are performed (eg, as described in the Examples). In general, template DNA is amplified until a copy of template DNA, typically at least 2-50 million, preferably about 10-30 million, per bead is fixed.

Emulsion destruction and bead recovery Following template amplification, the emulsion is "destroyed" (also referred to in the art as "demulsification"). There are many ways to break an emulsion (see, eg, US Pat. No. 5,989,892 and references cited therein), and those skilled in the art can choose the appropriate method. In the present invention, one preferred method of breaking the emulsion is to add additional oil to separate the emulsion into two phases. The oil phase is then removed and a suitable organic solvent (eg, hexane) is added. After mixing, the oil / organic solvent phase is removed. This process can be repeated several times. Finally, the aqueous layer on the beads is removed. The beads are then washed with an organic solvent / annealing buffer mixture (eg, one suitable annealing buffer is described in the Examples) and then washed again in the annealing buffer. Suitable organic solvents include alcohols such as methanol and ethanol.

The amplification template-containing beads can then be resuspended in aqueous solution for use, for example, in sequencing reactions according to known techniques (<img file="JP2010142233A_D0010.tif" />Please refer to). When the beads are used in a pyrophosphate-based sequencing reaction (eg, described in US Pat. Nos. 6,274,320, 6,258,568, and 6,210,891, which are incorporated herein by reference), of the PCR product. It is necessary to remove the second strand and annealing the sequencing primer to the single strand template bound to the beads.

Simply put, the second strand is melted and removed using any number of commonly known methods such as NaOH, low ion (eg, salt) strength or heat treatment. Following this melting step, the beads are pelleted and the supernatant is discarded. The beads are resuspended in annealing buffer, sequencing primers are added, and the beads are annealed into a beaded positive-strand template using a standard annealing cycle.

Purification of beads At this point, the amplified DNA on the beads can be sequenced directly on the beads or in a different reaction vessel. In one embodiment of the invention, DNA is sequenced directly on the beads by transferring the beads to a reaction vessel and subjecting the DNA to a sequencing reaction (eg, pyrophosphate-based sequencing or Sanger sequencing). Alternatively, the beads can be isolated and the DNA removed from each bead and sequenced. In either case, the sequencing step can be performed on each individual bead. However, while this method is commercially viable and technically feasible, it is the least effective. This is because most of the beads are negative beads (beads that do not have attached amplified DNA). Therefore, any of the following processes can be used to remove beads that do not contain the nucleic acid template prior to distribution on the picotita plate.

If the purpose of initial DNA attachment is to minimize beads with two different copies of DNA, then many parts of the beads are "negative" (ie, they do not have an attached amplified nucleic acid template). For useful pyrophosphate-based sequencing, each bead should contain multiple copies of a single species of DNA. This requirement is most closely met by maximizing the total number of beads with a single fragment of DNA bound (before amplification). This goal can be achieved by observing a mathematical model.

In the general case of N DNAs randomly distributed in M beads, the relative bead population containing any number of DNAs depends on the N / M ratio. The proportion of beads containing N DNA R (N) can be calculated using the Poisson distribution. R (N) = exp-(N / M) X (N / M)^N/ N! (In the formula, X is a multiplication sign)

The table below shows the calculated values for the various N / Ms (the ratio of the average DNA fragment to the beads) and N (the number of fragments actually bound to the beads).

<img file="JP2010142233A_D0011.tif" />

In this table, the top column represents the various ratios of N / M. R (0) represents the percentage of beads without DNA, R (1) represents the percentage of beads with one DNA attached (before amplification), and R (N&gt; 1) is greater than 1. Represents the percentage of DNA to which the DNA is attached (before amplification).

The table shows that the maximum percentage of beads containing a single DNA fragment is 0.37 (37%), with a fragment-to-bead ratio of 1. In this mixture, about 63% of the beads do not help in sequencing. They have no DNA or have more than one type of DNA. In addition, adjusting the fragment-to-bead ratio requires complex calculations, and the variability can produce bead batches with a significantly smaller percentage of available beads.

This inefficiency is significant if the amplicon-containing beads (causing the binding of at least one fragment) can be separated from the amplicon-free beads (causing the unbonded beads). Can be improved. Amplicons are defined as any nucleic acid molecule produced by in vitro nucleic acid amplification techniques. Binding is done at a low average fragment-to-bead ratio (N / M &lt;1), minimizing the ratio of beads to which more than 1 DNA is bound. The separation step removes most or all of the beads without DNA, leaving a concentrated population of beads with one species of amplified DNA. These beads can be applied to any sequencing method, such as, for example, pyrophosphate sequencing. Any method of sequencing is more effective because the fraction of the beads with one amplicon (N = 1) is enriched.

As an example, for an average fragment-to-bead ratio of 0.1, 90% of the beads have no amplicon, 9% of the beads have one amplicon, which is useful, and 0.5% of the beads have more than one. Has an amplicon. The enrichment process of the present invention removes 90% of the zero amplicon beads and produces a fraction (N = 1) that can be sequenced. 1-(0.005 / 0.09) = 94% A group of beads remains.

Diluting the fragments into a bead mixture, along with the separation of the beads containing the amplicon, can provide a 2.5-fold enrichment compared to the optimal non-concentration method. 94% / 37% (see table above, N / M = 1) = 2.5. A further advantage of the enrichment procedure of the present invention is that the final proportion of sequenceable beads is relatively insensitive to N / M variability. That is, complex calculations for deriving the optimal N / M ratio can be done with unnecessary or low levels of accuracy. This ultimately makes the procedure more suitable for being performed by less trained personnel or automatically. A further benefit of this procedure is the ability to recycle and reuse zero amplicon beads. Reuse is not required, but this reduces the cost or total volume of reagents and makes the methods of the invention suitable for some purposes, such as mobile sampling, remote robot sampling, etc. Can be. In addition, all the benefits of this procedure (ie, less trained personnel, automation, reagent recycling) reduce the cost of this procedure. This procedure will be described in more detail below.

A concentration procedure can be used to process the amplified beads in the bead emulsion method. Amplification is designed so that each amplified molecule contains the same DNA sequence at its 3'end. The nucleotide sequence can be a dimer, but can be any sequence of 15 or more bases, such as 25, 30, 35 or 40 bases or more. Of course, the longer oligonucleotide terminals are functional, but they are not needed. This DNA sequence can be introduced into the terminal of amplified DNA by those skilled in the art. For example, when PCR is used to amplify DNA, the sequence is part of one member of the PCR primer pair.

The outline of the concentration process is shown in FIG. Here, the amplicon-bound beads mixed with the four empty beads represent a fragment-diluted amplified bead mixture. In step 1, a biotinylated primer complementary to the 3'end of the amplicon is annealed to the amplicon. In step 2, DNA polymerase and four native deoxynucleotide triphosphates (dNTPs) are added to the bead mixture to extend the biotinylated primer. This extension is to enhance the binding between the biotinylated primer and the bead-bound DNA. This step can be omitted if the biotinylated primer-DNA bond is strong (eg, in a highly ionic environment). In step 3, streptavidin-coated beads (referred to herein as "magnetic streptavidin beads") that are susceptible to magnetic field attraction are introduced into the bead mixture. Magnetic beads are commercially available, for example, from Dynal (M290). The streptavidin capture moiety binds to biotin hybridized to the amplicon, whereby the amplicon-bound beads are specifically immobilized on the magnetic streptavidin beads.

In step 5, a magnetic field (generated by a magnet) is applied near the reaction mixture, whereby all "magnetic streptavidin beads / amplicon-bound bead composites" are placed on one side of the tube closest to the magnetic field. It is placed along. It is expected that magnetic beads to which the amplicon binding beads are not attached will also be arranged along the same side. Beads without amplicons remain in solution. The bead mixture is washed and the beads that are not fixed by the magnet (ie, empty beads) are removed and discarded. In step 6, the extended biotinylated primer chain is separated from the amplicon chain by "melting," which is a step that can be achieved, for example, by heating or changing the pH. Heating is at 60 ° C under low salt conditions (ie, a low ionic environment such as 0.1 × SSC). The change in pH can be achieved by the addition of NaOH. The mixture is then washed and the supernatant containing the amplicon-bound beads is recovered, where the unbound magnetic beads are held by a magnetic field. The resulting concentrated beads can be used for DNA sequencing. It is noted that the primers on the DNA capture beads can be the same as the primers in step 2 above. In this case, annealing of the amplicon primer complementary strand (with or without extension) is the source of target capture affinity.

The biotin streptavidin pair can be replaced by a variety of capture target pairs. The two categories are pairs in which the bond is subsequently cleaved and pairs in which the bond is irreversibly bound under practically achievable conditions. Cleavable pairs include thiol-thiol, digoxigenin-anti-digoxigenin, Captavidin if cleavage of the target-capture complex is desired.

As mentioned above, step 2 is optional. If step 2 is omitted, it may not be necessary to separate the magnetic beads from the amplicon-bound beads. The amplicon-bound beads have magnetic beads attached to them and can be used directly for sequencing. If sequencing should be done within the microwells, separation is not necessary if the amplicon-bound bead-magnetic bead complex fits inside the microwells.

The use of magnetic capture beads is convenient, but the capture portion can be bonded to other surfaces. For example, streptavidin can be chemically attached to a surface such as the inner surface of a tube. In this case, the amplified bead mixture can be circulated. Amplicon-bound beads tend to be retained until "thawed", while empty beads pass through. This arrangement can be particularly advantageous for automating the bead preparation process.

Although the aforementioned embodiments are particularly useful, other methods can be considered for separating the beads. For example, the capture beads can be labeled with a fluorescent moiety that makes the target-capture bead complex fluorescent. The target-capture bead complex can be separated by flow cytometry or fluorescent cell sorter. Large capture beads allow separation by filtration or other particle size separation techniques. Both the capture bead and the target bead can form a complex with many other beads, allowing the cross-linked capture-target bead mass to agglomerate. Due to the large size of the agglomerates, the non-aggregated empty beads can be separated by simply washing and removing them. This method is described in more detail, for example, in Bauer, J .; J. Chromatography B, 722 (1999) 55-69 and Brody et al., Applied Physics Lett. 74 (1999) 144-146.

DNA capture beads, each containing multiple copies of a single species of nucleic acid template prepared by the above method, are suitable for distribution on a picotiter plate.

Nucleic acid amplification on a picotita plate In another embodiment, the nucleic acid template is distributed on a picotiter plate prior to amplification and then amplified in situ on the picotiter plate. This method will be described in detail in the examples.

3. Nucleic acid template sequencing Pyrophosphate sequencing is used according to the methods of the invention to sequence nucleic acid templates. This technique is based on the detection of pyrophosphate (Ppi) released during DNA synthesis. See, for example, Hyman, 1988. A new method of sequencing DNA. Anal Biochem. 174: 423-36; Ronaghi, 2001. Pyrosequencing sheds light on DNA sequencing. Genome Res. 11: 3-11.

Visible light is produced in a cascade of enzymatic reactions in proportion to the number of nucleotides incorporated. The cascade begins with a nucleic acid polymerization reaction in which the inorganic Ppi is released and the nucleotides are incorporated by the polymerase. The released Ppi is converted to ATP by ATP sulfylase, which provides energy to luciferase to oxidize luciferin and generate light. Since the added nucleotides are known, the template can be sequenced. Sequencing based on solid phase pyrophosphate utilizes fixed DNA in a trienzyme system (see figure). Natural dATP was replaced with dATPαS to increase the signal-to-noise ratio. Typically, dATPαS is a mixture of two isomers (Sp and Rp); pure 2'-deoxyadenosine-5'-O'-(1-thiotriphosphate) Sp in pyrophosphate-based sequencing. -With isomers, substantially longer reads and up to twice the read length can be obtained.

4. A device for sequencing nucleic acids The present invention typically includes one or more reaction chambers for carrying out sequencing reactions, means for delivering reactants from and to reaction chambers, and means for detecting sequencing reaction events. , Provide an apparatus for sequencing nucleic acids. In another embodiment, the device comprises a reagent delivery cuvette containing a plurality of cavities on a flat surface. In a preferred embodiment, the device is connected to at least one computer for controlling the individual components of the device and for storing and / or analyzing the information obtained from the detection of sequencing reaction events.

The present invention separately localizes the nucleic acid template and the reactants in the sequencing reaction in a defined space and allows the sequencing reaction event to be detected, also referred to herein as the "solid support". One or more reaction chambers arranged on the active substrate material are also provided. That is, the term "reaction chamber" or "analyte reaction chamber" as used herein refers to a localized region on a substrate material that facilitates interaction of reactants, for example in a nucleic acid sequencing reaction. As described in more detail below, the sequencing reactions conceivable by the present invention preferably occur in tandem on many individual nucleic acid samples, and in particular simultaneously derive from genomic and chromosomal nucleic acid templates (eg, DNA). Sequence many of the nucleic acid samples that have been made.

Therefore, the apparatus of the present invention preferably comprises a sufficient number of reaction chambers to carry out such many individual sequencing reactions. In one embodiment, there are at least 10,000 reaction chambers, preferably at least 50,000 reaction chambers, more preferably more than 100,000 reaction chambers, and even more preferably more than 200,000 reaction chambers.

Since the number of co-sequencing reactions is limited by the number of reaction chambers, the throughput can be increased by making plates containing wells of increasing density. The table below shows this progression for the 14 x 43 mm and 30 x 60 mm active regions derived from the 25 x 75 mm and 40 x 75 mm arrays, respectively.

(Table) Development of high-well number array<img file="JP2010142233A_D0012.tif" />

The reaction chamber on the array is typically in the form of cavities or wells in a substrate material having a width and depth into which the reactants can be placed. Typically, the nucleic acid template is distributed in the reaction chamber on one or more solid supports or beads, and the reactants are contained in a medium that facilitates the reaction and flows through the reaction chamber. When formed as cavities or wells, these reaction chambers are preferably (i) the introduction of the required reactants into the reaction chamber, (ii) the reactions that occur within the reaction chamber, and (iii) between the reaction chambers. Sufficient dimensions and order for inhibition of mixing of the reactants. The shape of the wells or cavities is preferably annular or cylindrical, but can be a polyhedron that approaches annular or cylindrical. In one preferred embodiment, the shape of the well or cavity is substantially hexagonal. The cavity has a smooth wall surface. In a further aspect, the cavity has at least one irregular wall surface. The cavity can have a smooth bottom or a concave bottom.

The reaction chambers can be arranged at intervals of 5 μm to 200 μm. The spacing is determined by measuring the center-to-center spacing between the two adjacent reaction chambers. Typically, the reaction chambers can be arranged at intervals of 10 μm to 150 μm, preferably 20 μm to 100 μm, most preferably 40 μm to 60 μm. In one embodiment, the reaction chamber has a dimension width (diameter) of 0.3 μm to 100 μm, more preferably 20 μm to 70 μm, and most preferably about 30 to 50 μm. The depth of the reaction chamber is preferably 10 μm to 100 μm, more preferably 20 μm to 60 μm. Alternatively, the reaction chamber has a depth of 0.25 to 5 times the width of one dimension of the reaction chamber and, in another embodiment, a depth of 0.3 to 1 times the width of one dimension of the reaction chamber. ..

In a preferred embodiment, the array is formed from sliced fiber optic bundles (ie, bundles of fused fiber optic cables) and the reaction chamber is formed by etching one surface of the fiber optic reactor array. Cavities can also be formed in the substrate by etching, molding or micromachining.

Each cavity or reaction chamber is typically 10 μm to 100 μm deep, or at a depth of 0.25 to 5 times the width dimension of the cavity, preferably 0.3 to 1 times the width dimension of the cavity. is there.

In one embodiment, the array described herein typically comprises a flat top surface and a flat bottom surface, which is light guide so that light signals from the reaction chamber can be detected through the bottom flat surface. is there. In these arrays, the distance between the top surface and the bottom surface typically does not exceed 10 cm, preferably no more than 2 cm, usually 0.5 mm to 5 mm, most preferably about 2 mm.

In a particularly preferred embodiment, the solid support is referred to as a picotita plate, the reaction chamber has a center spacing of about 43 μm to 50 μm, a well diameter of 38 μm to 44 μm, and a well volume of 10 to 150 pL, preferably 20 to. It is 90pL, more preferably 40 to 85pL, and most preferably 75pL.

In one embodiment, each cavity or reaction chamber of the array comprises a reagent for analyzing a nucleic acid or protein. Typically, the reaction chamber containing the nucleic acid (though not all reaction chambers in the array need to do so) contains only a single species of nucleic acid (ie, the single strand of interest). A single copy of this type of nucleic acid may be present in a particular reaction chamber, or multiple copies may be present. Generally, the reaction chamber preferably contains at least 100,000 copies of the nucleic acid template sequence, preferably at least 1,000,000 copies, more preferably 2,000,000 to 20,000,000 copies, most preferably 5,000,000 to 15,000,000 copies of nucleic acid. .. Those skilled in the art will appreciate that changes in the number of copies of nucleic acid species in any one reaction chamber affect the number of photons that occur in the pyrosequencing reaction, with more or fewer photons as needed. Understand that it can be routinely adjusted to provide a signal. In one embodiment, PCR, RCA, a ligase chain reaction, other isothermal amplification, or other conventional means of nucleic acid amplification is used to amplify the nucleic acid species to provide the desired number of copies. In one embodiment, the nucleic acid is single strand.

Solid support material Any material can be used as the solid support material as long as the surface allows stable attachment of the primer and detection of the nucleic acid sequence. The solid support material can be flat or hollowed out (eg, using techniques commonly used in the construction of microelectromechanical systems, etching, molding, or otherwise fine in a flat surface. Machined end of optical fiber with microwells or cavities). For example<img file="JP2010142233A_D0013.tif" />Please refer to. In some embodiments, the solid support is optically transparent, such as glass.

Arrays of attachment sites on optically transparent solid supports are described, for example, in US Pat. Nos. 5,143,854, 5,445,934, 5,744,305, and 5,800,992;<img file="JP2010142233A_D0014.tif" />It can be constructed by using a lithography technique generally used in the construction of an electronic integrated circuit as described in the adhesion technique described in 1. Lithography and electron beam lithography are sensitizing solid supports or substrates with binding groups that attach modified biomolecules (eg, proteins or nucleic acids). For example<img file="JP2010142233A_D0015.tif" />Please refer to. Alternatively, an array of sensitized sites can be generated using a thin film technique as described in Zasadzinski et al., Science 263: 1726-1733 (1994).

Substrate materials are preferably made from materials that facilitate the detection of reaction events. For example, in a typical sequencing reaction, the binding of dNTPs to the sample nucleic acid to be sequenced can be monitored by detecting photons generated by enzymatic action on the phosphate released in the sequencing reaction. That is, having a substrate material made of a transparent or light guide material facilitates the detection of photons.

In some embodiments, the solid support can be coupled to a fiber optic bundle used to detect and conduct photoproducts. The total number of optical fibers in the bundle can be varied to match the number of individual reaction chambers in the array utilized in the sequencing reaction. The number of optical fibers incorporated in this bundle is designed to match the resolution of the detector to produce a 1: 1 imaging. The overall dimensions of the bundle are selected to optimize the usable area of the detector while maintaining the desired reagent (flow) properties in the reaction chamber. That is, for a 4096 x 4096 pixel CCD (charge-coupled device) with 15 μm pixels, the fiber bundle is selected to be about 60 mm x 60 mm or have a diameter of about 90 mm. The desired number of fiber optics is first melted into a bundle or fiber optic array, the ends of which are then cut and polished to form a "wafer" of the desired thickness (eg, 1.5 mm). The resulting optical fiber wafer has handling characteristics similar to the flat surface of glass. The individual fibers can be of any size and diameter (eg, 3 μm to 100 μm).

In some embodiments, two fiber optic bundles are used. The first bundle is attached directly to the detector (also referred to herein as a fiber bundle or connector) and the second bundle is used as the reaction chamber substrate (wafer or substrate). In this case, the two are placed in direct contact and optionally an optically coupling fluid is used, whereby the reaction center is imaged on the detector. When using a CCD as a detector, the wafer can be slightly larger to maximize the use of the CCD area, or slightly to fit the typical microscope slide format: 25 mm x 75 mm. It can be made smaller. The diameter of the individual fibers in the bundle is chosen to maximize the likelihood that a single reaction will be imaged on a single pixel in the detector, within the constraints of the art. Examples of diameters are 6-8 μm for fiber bundles and 6-50 μm for wafers, but any diameter in the range of 3-100 μm can be used. Fiber bundles are available on the market from CCD camera manufacturers. For example, wafers can be obtained from Incom, Inc. (Charlton, MA) and can be 0.5-5 mm thick, but are typically cut and polished from a large fusion of optical fibers with a thickness of 2 mm. To. Wafers have handling properties similar to windowpanes or microscope glass slides.

Reaction chambers can be formed in substrates made from fiber optic materials. By treating the ends of the fiber bundles with acid, for example, dents are provided on the surface of the optical fiber to form the optical fiber material. That is, in one embodiment, a cavity is formed from the optical fiber bundle, and preferably, the cavity can be provided by etching one end of the optical fiber bundle. Each surface provided with the cavity forms a reaction chamber. Such an array is referred to herein as a fiber optic reactor array, or FORA. The notch depth ranges from about half the diameter of an individual optical fiber to two to three times the diameter of a fiber. By immersing one side of the optical fiber wafer in an acid bath for various times, cavities can be introduced at the ends of the fibers. The time can vary depending on the total depth of the desired reaction cavity (see, eg, Walt, et al., 1996. Anal. Chem. 70: 1888). The wide channel cavity has a uniform flow velocity dimension of about 14 mm x 43 mm. That is, this approximate size and about 4.82 x 10^-4Cavity / μm²At a density of, the device can have approximately 290,000 cavities through which fluid can enter. Several methods are known in the art for attaching (and desorbing) molecules into the etched cavities at the ends of the fiber optic bundle. For example<img file="JP2010142233A_D0016.tif" />Please refer to. Reactive site patterns can also be created in microwells using photolithography techniques similar to those used in the generation of reaction pad patterns on flat supports.<img file="JP2010142233A_D0017.tif" />Please refer to.

The opposite side (ie, non-etched side) of the fiber optic wafer is typically highly polished to be optically bonded (eg, by immersion oil or other optically binding fluid) to the second fiber optic bundle. Will be done. This second fiber optic bundle can accurately fit the diameter of the optical wafer containing the reaction chamber and act as a conduit for delivering photoproducts to an attached detector such as a CCD imaging system or camera. it can.

In one preferred embodiment, for example, 15% H in aqueous solution.₂O₂/ 15% NH₄OH Volume: Repeatedly washed by volume, then rinsed 6 times with deionized water, then rinsed with 0.5 M EDTA, then rinsed 6 times with deionized water, then 15% H₂O₂/ 15% NH₄The fiber optic wafer is completely cleaned by rinsing with OH and then 6 times with deionized water (half-hour incubation in each wash).

The surface of the fiber optic wafer is preferably coated to facilitate its use in the sequencing reaction. The coated surface is preferably optically transparent, facilitates protein and nucleic acid attachment, and does not adversely affect the activity of the immobilized protein. In addition, this surface preferably minimizes non-specific absorption of macromolecules and enhances the stability of bound macromolecules (eg, attached nucleic acids and proteins).

Suitable materials for coating the array include, for example, plastic (eg, polystyrene). The plastic can preferably be spin coated or sputtered (thickness 0.1 μm). Another material for coating the array is a gold layer, eg, a layer of 24 carat gold with a thickness of 0.1 μm, to which a self-assembling monolayer of long-chain thioalcan is adsorbed. Biotin is then covalently attached to the surface and saturated with a biotin-binding protein (eg, streptavidin or avidin).

The coating material further comprises a system used to attach the anchor primer to the substrate. Arrays can also be coated with organosilane reagents that directly covalently bond proteins via amino, sulfhydryl or carboxyl groups. Additional coating substrates include photoreactive linkers, such as photobiotin.<img file="JP2010142233A_D0018.tif" />

Further coating materials include hydrophilic polymer gels (polyacrylamides, polysaccharides), which preferably polymerize directly on the surface or polymerize covalently bonded polymer chains after polymerization (Hjerten, J. Chromatogr. 347,191 (1985); Novotny, Anal.Chem.62,2478 (1990)), as well as pluronic polymers (triblock polymers, eg PPO-PEO-PPO, also known as F-108) on polystyrene or silicified glass surfaces. There are specifically adsorbed ones (Ho et al., Langmuir 14: 3889-94, 1998) and passively adsorbed layers of biotin-binding proteins. The surface can also be coated with an epoxide that couples the reagent via an amine bond.

In addition, metal chelating groups (eg, nitrilotriacetic acid) that bind one or more functional groups commonly known in the art for the fixation of enzymes and nucleotides, such as 6 × His-labeled proteins and nucleic acids. Any of the above materials can be derived using triacetic acid, iminodiacetic acid, pentadentate chelator).

Surface coatings can be used that increase the number of binding sites available for subsequent treatment, eg, attachment of the enzyme (discussed below), beyond the theoretical binding capacity of the two-dimensional surface.

In a preferred embodiment, the individual optical fibers used to produce the fused optical fiber bundle / wafer are larger in diameter (ie, 6 μm to 12 μm) than those used in the optical imaging system (ie, 3 μm). That is, a single reaction site can be imaged by using a plurality of optically imaging fibers.

In a particularly preferred embodiment, a sample cartridge for nucleic acid template sequencing, called a "picotiter plate," is formed from a commercially available fiber optic faceplate that has been acid etched to obtain a well structure. Each fiber optic nucleus is about 44 microns in diameter, has a coating of 2-3 microns, and each well is formed by acid etching to have a reaction well volume of about 65pL to 85pL, most preferably about 75pL. The use of etched wells on the surface of the fiber optic face plate serves a triple purpose; i) delayed diffusion of light emission from light radiation in different regions of the array, ii) reaction chamber containing amplification template molecules ("test tube"). ) Isolation, and iii) High numerical aperture optical coupling to a highly efficient CCD. Finally, the greater the amount of sequencing template fixed in the well, the more optical signals can be achieved.

Means of delivery An example of a means for delivering a reactant to a reaction chamber is the perfusion chamber of the present invention shown in FIG. The perfusion chamber has a sealed compartment with transparent upper and lower sides. It is designed to allow the solution to flow over the surface of the substrate surface and the rapid exchange of reagents. That is, it is suitable for, for example, performing a pyrophosphate sequencing reaction. The shape and dimensions of the reaction chamber can be adjusted to optimize reagent exchange and include laminar or turbulent bulk flow exchange, diffusible exchange or both.

The perfusion chamber is preferably detached from the imaging system when it is being prepared and placed on the imaging system only when performing sequencing analysis. In one embodiment, a solid support (ie, a DNA chip or glass slide) is held in place by a metal or plastic housing that can be collected or released to replace the solid support. If the underside of the solid support of the perfusion chamber has a reaction chamber array and a conventional optical system focus system is used, a high numerical aperture objective lens is used to image the reaction center array onto the CCD imaging system. Focus.

Thereby, many samples can be analyzed in parallel. Many nucleic acid templates can be analyzed in this way by using the method of the invention to run a solution containing the enzyme and one nucleotide over the surface and then detect the signal generated for each sample. it can. This procedure can then be repeated. Alternatively, different oligonucleotides complementary to the template can be distributed on the surface and subsequently hybridized with the template. Integration of deoxynucleotides or dideoxynucleotides can be monitored for each oligonucleotide with signals made using various oligonucleotides as primers. By combining signals from different regions of the surface, sequence-based analysis can be performed by four cycles of the polymerase reaction with various dideoxynucleotides.

If the support is in the form of an array with cavities, eg, the ends of a picotita plate or another array of microwells, suitable delivery means for reagents are flow and wash, and eg, flow, spray. , Includes electronic spraying, inkjet delivery, stamping, ultrasonic spraying (Sonotek Corp., Milton, NY) and rotation. When spraying is used, it is manufactured by an atomizer or industrial spray nozzle (Spraying Systems, Co., Wheaton, IL) used in thin layer chromatography (TLC) such as CAMAG TLC Sprayer (Camag Scientific Inc., Wilmington, NC). The reagent can be delivered to the picotiter plate in the homogeneous thin layer to be formed. These spraying means atomize the reagents into aerosol spray particles in the size range of 0.3-10 μm.

The continuous reagent delivery step is preferably separated by a washing step using techniques generally known in the art. These washes can be performed using, for example, high flow sprays or the methods described above involving liquid flow on the surface of a picotita plate or microwell array. Washing is after the starting material has reacted with the reagents in each reaction chamber to form a product, but the reagents delivered to any one of the reaction chambers diffuse out of the reaction chamber to any other. It can occur at any time before entering the reaction chamber. In one embodiment, any one reaction chamber is independent of the products formed in any other reaction chamber, but occurs with one or more common reagents.

One embodiment of the complete device is shown in FIG. The device includes an inlet conduit 200 that communicates with a detectable perfusion chamber 226. The inlet conduit 200 allows the sequencing reagent to enter through a plurality of tubes 202 to 212, each communicating with a plurality of sequencing reagent containers 214 to 224.

Reagents are introduced into the perfusion chamber 226 through conduit 200 using either a positive flow pressurization system or a pump. Typically, the reagent flow rate is 0.05 to 50 ml / min (eg, 1 to 50 ml / min) and the volume is from 0.100 ml to continuous flow (for cleaning). The valve is under computer control to circulate nucleotides and wash reagents. Sequencing reagents, such as polymerases, can be premixed with nucleotides or added to the stream. The multi-purpose tube combines a total of six tubes 202-212 into one for supply to the perfusion chamber. That is, multiple reagent delivery ports allow entry into the perfusion chamber. For example, one of the ports can be utilized to contain aqueous sequencing reagents, and the other port can allow these reagents (and any reaction product) to be withdrawn from the perfusion chamber.

In a preferred embodiment, one or more reagents are delivered to a mobile solid support, eg, an array immobilized or attached to a population of beads or microspheres. The beads or microspheres do not have to be spherical and irregularly shaped beads can be used. They are typically constructed from many substrates, such as plastic, glass or ceramic, and the size of the beads is nm ~ mm depending on the width of the reaction chamber. Various chemical bead materials such as methylstyrene, polystyrene, acrylic polymers, latex, paramagnetics, triazole, carbon graphite and titanium dioxide can be used. The structure or chemical material of the beads can be selected to facilitate the attachment of the desired reagent.

In another embodiment, the bioactive agent is first synthesized and then covalently attached to the beads. As will be appreciated by those skilled in the art, this will be done depending on the composition of the bioactivator and beads. Functionalization of the surface of a solid support, such as certain polymers with chemically reactive groups such as thiols, amines, carboxyls, etc., is commonly known in the art.

In a preferred embodiment, the nucleic acid template is delivered to a picotita plate on the beads. Luciferase and sulfylase enzymes, like DNA polymerase, are delivered to each well on the beads as well (see figure). It is noted that one or more of the nucleic acid templates, luciferase and sulfylase can be delivered on the same beads, respectively, on separate beads or together. Thermostable sulfylase was cloned and modified from Bacillus stearothermophilus to allow DNA sequencing at elevated temperatures. We also cloned and modified several luciferase enzymes for solid phase enzyme activity, including P. pennsylvanica and P. pyraris. P. pyraris luciferase is used in a preferred embodiment.

The user can use "blank" beads with surface chemicals that facilitate the attachment of the desired functional groups. Further examples of these surface chemicals for blank beads include amino groups, including aliphatic and aromatic amines, carboxylic acids, aldehydes, amines, chloromethyl groups, hydrazides, hydroxyl groups, sulfonic acid groups and sulfate groups. However, it is not limited to these.

These functional groups can usually be used to add any number of different candidate agents to the beads using known chemicals. For example, a candidate agent containing a carbohydrate can be attached to an amino-functionalized support; the carbohydrate aldehyde is made using standard techniques, and then the aldehyde reacts with the amino groups on the surface. In another embodiment, a sulfhydryl linker can be used. SPDP, maleimide, α-haloacetyl and pyridyl disulfide (eg, 1994 Pierce Chemical Company catalog, technical section on cross, incorporated herein by reference), which can be used to attach cysteine-containing proteinants to the support. There are many sulfhydryl reactive linkers known in the art, such as -linkers, see pages 155-200). Alternatively, the amino group on the candidate agent can be used to attach to the amino group on the surface. For example, a number of stable bifunctional groups, including homobifunctional and heterobifunctional linkers, are well known in the art (Pierce Catalog and See Handbook, pp. 155-200). In a further embodiment, well-known linkers (see Pierce Catalog) can be used to derivatize carboxyl groups (either from the surface or from candidate agents). For example, carbodiimides activate carboxyl groups for attack by good nucleophiles such as amines (Torchilin et al., Critical Rev. Thereapeutic Drug Carrier Systems, 7 (4): 275-308 (1991)). See). The proteinant candidate can also be attached using, for example, other techniques known in the art for attachment of the antibody to the polymer.<img file="JP2010142233A_D0019.tif" />Please refer to. It should be understood that the candidate agent can be attached in a variety of ways, including those listed above. Preferably, the method of attachment should not significantly alter the functionality of the candidate, i.e., the candidate should be able to adhere in a flexible manner that allows interaction with the target.

Specific techniques for immobilizing enzymes on beads are known in the prior art. In one case, NH₂Surface chemical beads are used. Surface activation is achieved with 2.5% glutaraldehyde in phosphate buffered saline (10 mM) at a pH of 6.9 (138 mM NaCl, 2.7 mM KCl). The mixture is stirred in a stirring bed at room temperature for about 2 hours. The beads are then rinsed with ultrapure water + 0.01% Tween 20 (surfactant) -0.02% and again with PBS + 0.01% tween 20 at pH 7.7. Finally, the enzyme is added to the solution after prefiltration, preferably with a 0.45 μm Amicon micropure filter.

A population of mobile solid supports is placed in the reaction chamber. In some embodiments, 5% to 20% of the reaction chamber can have a mobile solid support on which at least one reagent is immobilized, or 20% to 60% of the reaction chamber is at least one. One reagent can have a mobile solid support with the reagent fixed on top, or 50% to 100% of the reaction chamber has a mobile solid support with at least one reagent fixed on top. be able to. Preferably, at least one reaction chamber has a mobile solid support on which at least one reagent is immobilized, which reagent is suitable for use in nucleic acid sequencing reactions.

In some embodiments, the reagent immobilized on the mobile solid support can be a polypeptide having sulfylase activity, a polypeptide having luciferase activity, or a chimeric polypeptide having both sulfylase and luciferase activity. In one embodiment, it can be an ATP sulfylase and luciferase fusion protein. Since the product of the sulfylase reaction is consumed by luciferase, the proximity between these two enzymes can be achieved by covalently binding these two enzymes in the form of a fusion protein. The present invention is useful not only for substrate channeling, but also for the ability to reduce manufacturing costs and potentially double the number of binding sites on streptavidin-coated beads.

In another embodiment, the sulfylase is a thermostable ATP sulfylase. In a preferred embodiment, the thermostable sulfylase is active at temperatures above ambient temperature (at least 50 ° C.). In one embodiment, the ATP sulfylase is obtained from a thermostable bacterium. In a further embodiment, the mobile solid support can have a first reagent and a second reagent immobilized on it, the first reagent being a polypeptide having sulfiferase activity and a second reagent. Is a polypeptide having luciferase activity.

In another embodiment, the reagent immobilized on the mobile solid support can be a nucleic acid; preferably, this nucleic acid is a single strand concatemer. In a preferred embodiment, the nucleic acid can be used for sequencing the nucleic acid, eg, for a pyrosequencing reaction.

The present invention also provides a method of detecting or quantifying ATP activity using a mobile solid support, preferably ATP can be detected or quantified as part of a nucleic acid sequencing reaction.

Figure 15 shows a picotitat plate "carpeted" with a mobile solid support to which nucleic acid or reagent enzymes are attached.

5. Nucleic acid sequencing method Next, sequencing is performed based on pyrophosphate. The sample DNA sequence and extension primers are then subjected to a polymerase reaction in the presence of nucleotide triphosphate, which, if complementary to the base at the target location, incorporates nucleotide triphosphate (PPi). ) Is only released, and nucleotide triphosphates are added to separate aliquots of the sample-primer mixture, or sequentially to the same sample-primer mixture. The release of PPi is then detected to indicate which nucleotides have been incorporated.

In one embodiment, the region of the sequencing product annealates the sequencing primer to the region of the template nucleic acid, then the sequencing primer is a DNA polymerase and a known nucleotide triphosphate, ie dATP, dCTP, dGTP, dTTP. , Or by contact with one analog of these nucleotides. The sequence can be determined by detecting a sequencing reaction by-product, as described below.

Sequencing primers can have any length or base composition as long as they can specifically anneal to the region of the amplified nucleic acid template. No special structure is required for sequencing primers if the region on the amplified template nucleic acid can be specifically primed. Preferably, the sequencing primer is complementary to the region of the template between the sequence to be characterized and the sequence that can hybridize to the anchor primer. Sequencing primers are extended with a DNA polymerase to form the sequence product. Elongation is carried out in the presence of one or more types of nucleotide triphosphates and, if necessary, an auxiliary binding protein.

The incorporation of dNTPs is preferably determined by examining the presence of sequencing by-products. In a preferred embodiment, the nucleotide sequence of the sequencing product is determined by measuring the inorganic pyrophosphate (PPi) released from nucleotide triphosphate (dNTP) when dNMP is incorporated into the extended sequencing primer. .. This sequencing method is called Pyrosequencing technology (PyroSequencing AB, Stockholm, Sweden) and can be performed in solution (liquid phase) or as solid phase technology. Sequencing methods based on PPi generally include, for example, WO9813523A1, Ronaghi, et al., 1996.Anal.Biochem.242: 84-89, Ronaghi, et al., 1998.Science. 281: 363-365 (1998) and US Patent Application No. 2001/0024790. All of these disclosures of PPi sequencing are incorporated herein by reference. See also, for example, US Pat. Nos. 6,210,891 and 6,258,568, each of which is incorporated herein by reference in its entirety.

Pyrophosphoric acid released under these conditions can be detected enzymatically (eg, by generating light in the luciferase-luciferin reaction). Such methods allow nucleotides to be identifiable at a given target location, allowing DNA to be easily and quickly sequenced, while avoiding the need for electrophoresis and the use of potentially dangerous radiolabels. To.

PPi can be detected by many different methods and various enzymatic methods have been previously described (eg, for example).<img file="JP2010142233A_D0020.tif" />Please refer to).

PPi released as a result of the incorporation of dNTPs by the polymerase can be converted to ATP using, for example, ATP sulfylase. This enzyme has been identified to be involved in sulfur metabolism. Sulfur, both reduced and oxidized, is an essential inorganic nutrient for plant and animal growth (eg, Schmidt and Jager, 1992.Ann.Rev.Plant Physiol.Plant Mol.Biol.43: 325-349). Please refer to). In both plants and microorganisms, reduction to sulfide occurs after active uptake of sulfate. Sulfates are much less capable of oxidizing / reducing compared to available cellular reducing agents, and the major steps in assimilation require their activation via an ATP-dependent reaction (eg Leyh, 1993. Crit). See .Rev.Biochem.Mol.Biol.28:515-542). ATP sulfylase (ATP: adenyltransferase sulfate; EC2.7.7.4) is an inorganic sulfate (SO)₄^-2) Catalyze the initial reaction in metabolism (see, eg, Robbins and Lipmann, 1958.J.Biol.Chem.233: 686-690; Hawes and Nicholas, 1973.Biochem.J.133: 541-550). .. In this reaction, SO₄^-2Is activated to obtain adenosine 5'phosphosulfate (APS).

ATP sulfylase is Saccharomyces cerevisiae (see, eg, Hawes and Nicholas, 1973. Biochem. J. 133: 541-550); Penicillium chrysogenum (eg, Renosto, et al., 1990). .J.Biol.Chem.265: 10300-10308); rat liver (see, eg, Yu, et al., 1989.Arch.Biochem.Biophys.269: 165-174); and plants (eg, Shaw). And Anderson, 1972. Biochem.J. 127: 237-247; Ossslund, et al., 1982. Plant Physiol. 70: 39-45)) was highly purified from multiple sources. In addition, the ATP sulfylase gene is found in prokaryotes (eg Leyh, et al., 1992.J.Biol.Chem.267: 10405-10410; Schwedock and Long, 1989.Mol.Plant. Microbe Interaction 2: 181-194; Laue and Nelson, 1994. J. Bacteriol. 176: 3723-3729); Eukaryotes (eg, Cherest, et al., 1987. Mol.Gen.Genet. 210: 307) -313; Mountain and Korch, 1991. Yeast 7: 873-880; Foster, et al., 1994. J.Biol. Chem. 269: 19777-19786); Plants (eg Leustek, et al., 1994) It was cloned from .Plant Physiol. 105: 897-90216) and animals (see, eg, Li, et al., 1995. J. Biol. Chem. 270: 29453-29459). Enzymes are homooligomers or heterodimers depending on the particular source (see, eg, Leyh and Suo, 1992.J. Biol. Chem. 267: 542-545).

In some embodiments, thermostable sulfylase is used. Thermostable sulfylases can be obtained, for example, from Archaeoglobus or Pyrococcus spp. Sequences of thermostable sulfylase can be obtained from database accession number 028606, accession number Q9YCR4, and accession number P56863.

ATP sulfylase has many different uses, eg, bioluminescent detection of ADP at high concentrations of ATP (see, eg, Schultz, et al., 1993. Anal. Biochem. 215: 302-304); Continuous monitoring (see, eg, Nyrbn, 1987.Anal.Biochem.167: 235-238); and DNA sequencing (eg, Ronaghi, et al., 1996.Anal.Biochem.242: 84-89; Ronaghi, It was used in et al., 1998. Science 281: 363-365; see Ronaghi, et al., 1998. Anal. Biochem. 267: 65-71).

Several assays have been developed to detect the previous ATP sulfylase reaction. Colorimetric molybdenum degradation assays are based on phosphate detection (see, eg, Wilson and Bandurski, 1958.J.Biol.Chem.233: 975-981), while continuous spectrophotomolybdenum degradation assays are , Based on the detection of NADH oxidation (eg, Seubert, et al., 1983.Arch.Biochem.Biophys.225: 679-691; Seubert, et al.,1985.Arch.Biochem.Biophys.240: 509-523. Please refer to). The latter assay requires the presence of several detection enzymes. In addition, several radioactivity assays are also described in the literature (see, eg, Daley, et al., 1986. Anal. Biochem. 157: 385-395). For example, one assay³²Released from P-labeled ATP³²Based on the detection of PPi (see, eg, Seubert, et al., 1985. Arch. Biochem. Biophys. 240: 509-523), another assay is³⁵S³⁵S]-Based on incorporation into labeled APS (this assay also requires purified APS kinase as a conjugated enzyme; eg, Seubert, et al., 1983. Arch. Biochem. Biophys. 225: 679-691) And the third reaction is [³⁵S]-From the sign APS³⁵SO₄^-2Depends on the release of (see, eg, Daley, et al., 1986. Anal. Biochem. 157: 385-395).

For the detection of inverse ATP sulfylase reactions, continuous spectrophotometric assays (see, eg, Segel, et al., 1987. Methods Enzymol. 143: 334-349), bioluminescence assays (eg, Balharry and Nicholas, 1971. See Anal.Biochem.40: 1-17),³⁵SO₄^-2Release assay (see, eg, Seubert, et al., 1985. Arch. Biochem. Biophys. 240: 509-523), and³²A PPi integrated assay (see, eg, Osslund, et al., 1982. Plant Physiol. 70: 39-45) has been described above.

ATP produced by ATP sulfylase can be hydrolyzed using an enzymatic reaction to generate light. Luminescent chemical reactions (ie, chemical luminescence) and biological reactions (ie, bioluminescence) are widely used in analytical biochemistry for sensitive measurements of various metabolites. In bioluminescence reactions, the chemical reactions that lead to the emission of light are catalyzed by enzymes. For example, the luciferin-luciferase system allows specific assays for ATP and the bacterial luciferase-oxidoreductase system can be used to monitor NAD (P) H. Both systems have been extended to analyze more substances in combined reactions involving the production or utilization of ATP or NAD (P) H. (See, for example, Kricka, 1991. Chemiluminescent and bioluminescent techniques. Clin. Chem. 37: 1472-1281).

With the development of new reagents, ATP (see, eg, Lundin, 1982. Applications of firefly luciferase In; Luminescent Assays (Raven Press, New York)) or NAD (P) H (eg, Lovgren et al., Continuous monitoring of NADH). -It has become possible to obtain stable luminescence in proportion to the concentration of converting reactions by bacterial luminescence.J.Appl.Biochem.4: 103-111). With such stable luminescent reagents, it is possible to calibrate each individual assay by performing an endpoint assay and adding a known amount of ATP or NAD (P) H.

Suitable enzymes for converting ATP to light include luciferase, such as insect luciferase. Luciferase produces light as the end product of catalysis. The most well-known luciferase is the enzyme of the firefly Photinus pyralis (Coleoptera). Corresponding genes can be found in bacteria (see, eg, Wet, et al., 1985.Proc.Natl.Acad.Sci.USA 80: 7870-7873) and plants (eg, Ow, et al., 1986. Science 234: It was cloned and expressed in insects (see, eg, Jha, et al., 1990.FEBS Lett. 274: 24-26) and mammalian cells (see, eg, 856-859), as well as in insects (see, eg, Jha, et al., 1990.FEBS Lett. 274: 24-26).<img file="JP2010142233A_D0021.tif" />Please refer to). In addition, many luciferase genes from the Jamaican click beetle Pyroplorus plagiophihalamus (Coleoptera) have recently been cloned and partially characterized. (See, for example, Wood, et al., 1989.J.Biolumin.Chemilumin.4: 289-301; Wood, et al., 1989.Science 244: 700-702). Different luciferases can produce light of different wavelengths, which allows simultaneous monitoring of light emission at different wavelengths. Therefore, these features are unique and add a new dimension to the use of current reporter systems.

Firefly luciferase catalyzes bioluminescence in the presence of luciferin, adenosine 5'triphosphate (ATP), magnesium ions and oxygen, resulting in a quantum yield of 0.88 (eg, McElroy and Selinger, 1960. Arch.Biochem. See Biophys. 88: 136-145). Firefly luciferase bioluminescence reaction is about 1 × 10^-13It can be used as an assay to detect ATP at the detection limit of M (see, eg, Leach, 1981.J.Appl.Biochem. 3: 473-517). In addition, due to its overall sensitivity and the convenience of the luciferase-mediated detection system, considerable interest has been shown in the development of firefly luciferase-based biosensors (eg, Green and Kricka, 1984. Talanta 31). : 173-176; Blum, et al., 1989. J.Biolumin.Chenilumin.4: 543-550).

Sequencing primers are exposed to polymerases and known dNTPs using the enzymes described above. Incorporation of dNTP at the 3'end of the primer sequence cleaves dNTP and releases the PPi molecule. The PPi is then converted to ATP using ATP sulfylase. It is preferred that ATP sulfylase is present at a sufficiently high concentration and that PPi conversion proceeds for PPi on a first-order kinetics. In the presence of luciferase, ATP is hydrolyzed to produce photons. The reaction preferably contains a sufficient concentration of luciferase in the reaction mixture, whereby the reaction: ATP ADP + PO.₄^3-+ Photons (light) travel in first-order kinetics with respect to ATP. Photons can be measured using the methods and devices described below. In one embodiment, PPi and sulfylase / luciferase conjugated reactions are used to generate light for detection. In some embodiments, either or both of sulfylase and luciferase are immobilized on one or more mobile solid supports located at each reaction site.

The present invention thus detects the release of PPi during the polymerase reaction to obtain a real-time signal. Sequencing reactions can be continuously monitored in real time. Thus, the present invention allows for a procedure for rapid detection of PPi release. The reaction was expected to occur in less than 2 seconds (Nyren and Lundin, supra). The rate-determining step is the conversion of PPi to ATP by ATP sulfylase, while the luciferase reaction is rapid and expected to occur in less than 0.2 seconds. The rate of integration for polymerase was also estimated by various methods, for example, in the case of Klenow polymerase, it was found that complete integration of a single base occurs in less than 0.5 seconds. That is, the estimated total time for incorporation of one base and detection by this enzymatic assay is approximately 3 seconds. Therefore, it can be seen that a very quick reaction time is possible and real-time detection is possible. The reaction time can be further shortened by using a more thermostable luciferase.

For most applications, it is desirable to use reagents that are free of contaminants such as ATP and PPi. These contaminants can be removed by running the reagent through a precolumn containing resin-bound apyrase and / or pyrophosphatase. Alternatively, apyrase or pyrophosphatase can be used to bind the magnetic beads and remove the contaminating ATP and PPi present in the reagent. In addition, it is desirable to wash away diffusible sequencing reagents, such as non-embedded dNTPs, with wash buffer. Any wash buffer used in pyrophosphate sequencing can be used.

In some embodiments, the concentration of the reactants during the sequencing reaction includes 1 pmol DNA, 3 pmol polymerase, 40 pmol dNTP in 0.2 ml of buffer. See Ronaghi, et al., Anal. Biochem. 242: 84-89 (1996).

Sequencing can be performed using each of the four predetermined nucleotides, if desired. A "complete" cycle usually involves sequentially administering sequencing reagents for each of the nucleotides dATP, dGTP, dCTP and dTTP (or dUTP) in a predetermined order. Rinse non-embedded dNTPs between each nucleotide addition. Alternatively, the non-embedded dNTP is degraded by an apillase (see below). The cycle is repeated as desired until the desired amount of sequence of the sequencing product is obtained. In some embodiments, about 10-100, 10-100, 10-75, 20-50 or about 30 nucleotides of sequence information are obtained by extension of one annealed sequencing primer.

In some embodiments, the nucleotide is modified to include a disulfide derivative of the hapten, such as biotin. Addition of the modified nucleotide to the initial primer annealed to the anchor substrate is i) in the case of modification with biotin, sequentially binding the avidin or streptavidin conjugated moiety bound to the enzyme molecule, ii) excess avidin or Post-polymerization steps including flushing the streptavidin-binding enzyme, iii) flushing the appropriate enzyme substrate under conditions sensitive to enzyme activity, and iv) detecting one or more enzyme substrate reaction products. Is analyzed by. In this embodiment, the addition of a reducing agent removes the hapten. Such methods allow nucleotides to be identified at a given target location, allowing DNA to be sequenced simply and quickly, while avoiding the need for electrophoresis and the use of potentially dangerous radiolabels. Will be done.

A preferred enzyme for detecting haptens is horseradish peroxidase. If desired, wash buffers can be used between the addition of the various reactants here. Apillases can be used to remove unreacted dNTPs used to extend sequencing primers. The wash buffer may optionally contain an apillase.

Examples of haptens, such as biotin, digoxigenin, optical brightener molecules cy3 and cy5, and fluorescein, are integrated into the elongated DNA molecule with varying efficiencies. Hapten attachment can occur via sugar, base, and phosphate moieties on nucleotides. Examples of signal amplification include fluorescence, electrochemical and enzymatic amplification. In a preferred embodiment using enzymatic amplification, enzymes such as alkaline phosphatase (AP), horseradish peroxidase (HRP), β-galactosidase, luciferase can include those of known photogenic substrates. A CCD camera may be included as a means for detecting a light-generating (chemically luminescent) substrate.

In a preferred form, the modified base is added, detection is performed, and either a cleavage or inactivating agent is used to remove or inactivate the hapten binding moiety. For example, if the cleaving linker is a disulfide, the cleaving agent can be a reducing agent such as dithiothreitol (DDT), β-mercaptoethanol and the like. Other aspects of inactivation include heat, low temperature, chemical denaturing agents, surfactants, hydrophobic agents, and self-inactivating inhibitors.

Luciferase can directly hydrolyze dATP with the release of light. This gives a false positive signal. This is because hydrolysis occurs independently of the incorporation of dATP into the extended sequencing primers. To avoid this problem, a dATP analog that integrates into DNA can be used, i.e. it is a substrate for DNA polymerase, but not a substrate for luciferase. One such analog is α-thio-dATP. That is, the use of α-thio-dATP avoids the false photon generation that can occur when dATP is hydrolyzed without being incorporated into the growing nucleic acid strand.

Typically, PPi-based detection is calibrated by measuring the light emitted after adding the control nucleotide to the sequencing reaction mixture immediately after the addition of the sequencing primer. This normalizes the reaction conditions. The sequential incorporation of two or more identical nucleotides is indicated by a corresponding increase in the amount of emitted light. That is, a 2-fold increase in emitted light relative to the control nucleotide indicates that two dNTPs were sequentially incorporated into the extended primers.

If desired, the apillase can be "washed" or "flowed" on the surface of the solid support to facilitate degradation of the residual non-incorporated dNTPs in the sequencing reaction mixture. Apyrase also degrades the ATP produced, thus "suppressing" the light generated by the reaction. Upon treatment with apyrase, the remaining reactants are washed away for subsequent dNTP incubation and photon detection steps. Alternatively, the apillase can be attached to a solid or mobile solid support.

Sequencing both ends In a preferred embodiment, we provide a method of sequencing from both ends of a nucleic acid template. Traditionally, two-ended sequencing of a double-stranded DNA molecule requires at least primer hybridization, one-ended sequencing, second primer hybridization, and other terminal sequencing. To do. Another method is to separate the individual strands of the double-stranded nucleic acid and sequence each strand individually. The present invention provides a third option that is faster and less labor intensive than the first two methods.

The present invention provides a method for sequentially sequencing nucleic acids from a large number of primers. DNA sequencing in this application refers to polymerase-based sequencing in which the sequence is sequenced when nucleotide triphosphate (NTP) is incorporated into the growing strand of the sequencing primer. An example of this type of sequencing is the pyrosequencing detection pyrophosphate method (eg, US Pat. Nos. 6,274,320, 6,258,568 and 6,210,891; the entire of each of which is incorporated herein by reference). ..

In one embodiment, the invention provides a method of sequencing the two ends of a template double-stranded nucleic acid. Double-stranded DNA consists of two single-stranded DNAs referred to herein as the first single-stranded DNA and the second single-stranded DNA. The first primer hybridizes to the first single-stranded DNA and the second primer hybridizes to the second single-stranded DNA. The first primer is unprotected, while the second primer is protected. "Protected" and "protected" are defined in this disclosure as the addition of a chemical group to the reaction site on the primer that prevents the primer from being polymerized by DNA polymerase. In addition, the addition of such chemical protecting groups should be reversible so that the newly deprotected primer can once again act as a sequencing primer after reversal. Nucleic acid sequencing is done in one direction (eg, from one end of the template) by extending the first primer with DNA polymerase using conventional methods such as pyrophosphate sequencing. The second primer is then deprotected and extends the second primer in other directions (eg, from the other end of the template) using conventional methods such as DNA polymerase and pyrophosphate sequencing. The sequence is determined by this. The sequences of the first and second primers are specifically designed to hybridize to the two ends of the double-stranded DNA or anywhere along the template in this method.

In another aspect, the invention provides a method of sequencing nucleic acids from multiple primers. In this method, many sequencing primers are hybridized to the template nucleic acid to be sequenced. All sequencing primers are reversibly protected except one. Protected primers are oligonucleotide primers that cannot be extended with dNTPs and polymerases commonly used in DNA sequencing reactions. A reversibly protected primer is a protecting primer that can be deprotected. All protective primers referred to in the present invention are reversibly protected. After deprotection, the reversibly protected primers can act as normal sequencing primers and participate in normal sequencing reactions.

The present invention provides a method for sequentially sequencing nucleic acids from a large number of primers. This method includes the following steps. First, one or more template nucleic acids to be sequenced are provided. The plurality of sequencing primers are then hybridized to one or more template nucleic acids. The number of sequencing primers can be represented by n, which can be a positive number greater than 1. This number can be, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. In these primers, the number of n-1 can be protected with protecting groups. So, for example, if n is 2, 3, 4, 5, 6, 7, 8, 9, or 10, then n-1 is 1, 2, 3, 4, 5, 6, 7, 8 respectively. Or 9. The remaining primers (eg n primers-(n-1) protective primers = 1 remaining primer) are not protected. Third, the unprotected primer is extended and the template DNA sequence is sequenced by conventional methods such as pyrophosphate sequencing. Fourth, after sequencing the first primer, one of the remaining protective primers is unprotected. Fifth, the unprotected primer is extended and the template DNA sequence is determined by conventional methods such as pyrophosphate sequencing. Optionally, this method can be repeated until sequencing is done on all protective primers.

In another aspect, the invention presents: (a) the step of hybridizing two or more sequencing primers to a nucleic acid (all but one primer is reversibly protected), (b) unprotected. Sequencing one strand of nucleic acid by polymerase extension from the primer, (c) deprotecting one of the reversible protected primers into an unprotected primer, (d) reversibly protected primer Includes a method of sequentially sequencing nucleic acids, comprising repeating steps (b) and (c) until all of the deprotection is used to sequence. In one embodiment, the method involves one additional step between step (b) and step (c), ie, an unprotected primer, a DNA primer, and one or more nucleotide triphosphates or It comprises the step of stopping the elongation of the unprotected primer by contacting it with dideoxynucleotide triphosphate. In yet another embodiment, the method further comprises a further step between step (b) and step (c), i.e., a non-protective primer with DNA polymerase, and ddATP, ddTTP, ddCTP, ddGTP or It comprises the step of stopping the elongation of the unprotected primer by contacting it with dideoxynucleotide triphosphate derived from the combination thereof.

In another aspect, the invention presents (a) a step of hybridizing a first unprotected primer to the first strand of nucleic acid, and (b) a second protected primer to the second strand. Hybridization steps, (c) exposure of the first and second strands to polymerase and extension of the first unprotected primer along the first strand, (d) extension of the first sequencing primer Steps to complete, (e) deprotecting the second sequencing primer, and (f) exposing the first and second strands to the polymerase to hybridize the second sequencing primer to the second strand. Includes methods of sequencing nucleic acids, including the step of extending along. In a preferred embodiment, completion comprises capping or stopping elongation.

In another embodiment, the invention provides a method of sequencing two ends of a template double-stranded nucleic acid containing first and second single-stranded DNA. In this embodiment, the first primer hybridizes to the first single-stranded DNA and the second primer hybridizes to the second single-stranded DNA in the same step. The first primer is unprotected, while the second primer is protected.

Following hybridization, the nucleic acid is sequenced in one direction (eg, from one end of the template) by extending the first primer with DNA polymerase using conventional methods such as pyrophosphate sequencing. In a preferred embodiment, the polymerase lacks 3' 5'exonuclease activity. The second primer is then deprotected and the sequence is extended with DNA polymerase in the other direction (eg, from the other end of the template) using conventional methods such as pyrophosphate sequencing. Determine by doing. As mentioned above, the first and second primer sequences are designed to hybridize to the two ends of the double-stranded DNA or at any position along the template. This technique is particularly useful for sequencing many template DNAs that contain unique sequencing primer hybridization sites at their two ends. For example, many cloning vectors provide unique sequencing primer hybridization sites that flank the insert site to facilitate subsequent sequencing of the cloned sequence (eg, Bluescript, Stratagene, La Jolla, etc.). CA).

One advantage of this method of the invention is that both primers can be hybridized in a single step. The advantages of this method and other methods are particularly useful in parallel sequencing systems where hybridization is more than normal. An example of a parallel sequencing system is disclosed in co-pending U.S. Patent Application No. 10 / 104,280, the entire disclosure of which is incorporated herein by reference.

The oligonucleotide primers of the present invention can be synthesized by conventional techniques, for example, using a commercially available oligonucleotide synthesizer and / or by ligating the subfragments so synthesized together.

In another aspect of the invention, the length of the double-stranded target nucleic acid can be determined. Methods for determining the length of a double-stranded nucleic acid are known in the art. The length can be determined before or after sequencing the nucleic acid. Known methods for determining the length of a nucleic acid molecule include gel electrophoresis, pulsed field gel electrophoresis, mass spectrometry and the like. A blunt-ended double-stranded nucleic acid consists of two single strands of the same length, and determining the length of one strand of nucleic acid is sufficient to determine the length of the corresponding double strand.

The sequencing reaction according to the invention can also determine the length of the template nucleic acid. First, the length can be determined by the complete sequence from one end of the nucleic acid to the other. Second, the sequencing of the two ends overlaps in the middle, which allows the two sequences to be linked. The complete sequence can be determined to indicate the length. For example, if the length of the template is 100 bp, sequencing from one end determines bases 1-75, sequencing from the other end determines bases 25-100; therefore 51 from bases 25 to 75 in the middle. There are multiple base duplications; from this information, a complete sequence from 1 to 100 can be determined, and this complete sequence can indicate a length of 100 bases.

Another method of the present invention relates to a method including the following steps. First, multiple sequencing primers, each with a different sequence, are hybridized to the DNA to be sequenced. The number of sequencing primers can be any value greater than or equal to 2, for example 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. All of these primers are reversibly protected except one. One unprotected primer is extended in the sequencing reaction to sequence. Normally, when a primer is fully extended, the primer cannot be extended and does not affect subsequent sequencing from another primer. If desired, the sequenced primers can be terminated with excess polymerase and dNTPs or with ddNTPs. If a stop step is performed, the stop reagents (dNTP and ddNTP) should be removed after the step. Therefore, one of the reversibly protected primers is unprotected, and sequencing proceeds from the second primer. The steps of deprotecting the primers, sequencing from the deprotected primers, and optionally stopping sequencing from the primers are repeated until all protected primers are unprotected and used for sequencing. ..

Reversibly protected primers should be protected with different chemical groups. By selecting an appropriate method of deprotection, one primer can be deprotected without affecting the protecting groups of the other primer. In a preferred embodiment, the protecting group is PO₄Is. That is, the second primer is PO₄Protected by, deprotection is achieved by T4 polynucleotide kinase (utilizing its 3'-phosphatase activity). In another preferred embodiment, the protection is a thio group or a phosphorothiol group.

The template nucleic acid can be DNA, RNA or peptide nucleic acid (PNA). Although DNA is the preferred template, RNA and PNA can be converted to DNA by known techniques such as random priming PCR, reverse transcription, RT-PCR or a combination of these techniques. In addition, the methods of the invention are useful for sequencing nucleic acids whose sequences are unknown and known. Sequencing a known nucleic acid is useful, for example, to sequence the synthesized DNA or to identify a suspicious pathogen whose nucleic acid sequence is known. The nucleic acid may be a mixture of multiple nucleic acid populations. Sequentially specific sequencing primers (eg, 20 bases, 25 bases, 30 bases, 35 bases, 40 bases, 45 bases, or 50 bases) are a subset of the sequence in a long nucleic acid or an unrelated nucleic acid population It is known that can be used to sequence. That is, for example, the template can be one array of 10 kb or 10 sequences of 1 kb each. In a preferred embodiment, the template DNA is 50 bp to 700 bp in length. DNA can be single-strand or double-stranded.

When the template nucleic acid is single strand, many primers can hybridize to the template nucleic acid as shown below.<img file="JP2010142233A_D0022.tif" />

In this case, the first unprotected primer is preferably the primer that hybridizes at the most 5'end of the template. See Primer 1 in the figure above. In this orientation, extension of primer 1 does not replace primer 2, 3 or 4 (by strand substitution). After sequencing from primer 1, primer 2 can be unprotected and nucleic acid sequencing can begin. Sequencing from primer 2 replaces primer 1 or an extension of primer and does not affect the remaining protected primers (primers 3 and 4). Using this procedure, each primer can be used sequentially, and the sequencing reaction from one primer does not affect the sequencing from the next primer.

One feature of the present invention is the ability to use multiple sequencing primers on one or more nucleic acids, and the ability to sequence from multiple primers using only one hybridization step. In the hybridization step, all sequencing primers (eg, n sequencing primers) can be hybridized to the template nucleic acid at the same time. In conventional sequencing, sequencing from one primer usually requires one hybridization step. One feature of the present invention is that sequencing from n primers (defined above) can be performed by a single hybridization step. This effectively eliminates n-1 hybridization steps.

In a preferred embodiment, the primers do not cross-hybridize or self-hybridize because the sequences of the n primers are so different. Cross-hybridization means that one primer hybridizes to another because of sequence complementarity. One form of cross-hybridization is commonly referred to as a "primer dimer". In the case of primer dimers, the 3'ends of the two primers are complementary and form a structure that, when extended, is approximately the sum of the lengths of the two primers. Self hybridization The emissions, it refers to the situation 5 'primer end 3' primer which is complementary to the terminal. In that case, the primers tend to self-hybridize to form hairpin-like structures.

Primers interact with or specifically associate with template molecules. The terms "interaction" or "association" are used herein to refer to two substances or compounds (eg, primers and templates; chemical moieties and nucleotides) that are well bound to each other (eg, adherence, binding, hybridization, etc.) It is intended that conjugation, annealing, covalent bonding, or other association) can be performed and the assay intended can be performed. The term "specific" or "specifically" as used herein means that the two components selectively bind to each other. The parameters required to achieve a particular interaction can be done by conventional methods, for example using conventional methods of the art.

Protective primers can be modified (eg, derivatized) with chemical moieties designed to give a distinct and unique signal to gain additional susceptibility or to assist in the analysis of the complex mixture. For example, each protective primer can be induced with different natural or synthetic amino acids attached to the oligonucleotide chain via an amide bond at one or more positions along the hybridization portion of the chain. Chemical modifications can, of course, be detected after cleavage from the target nucleic acid or when associated with the target nucleic acid. A large number of different target nucleic acids can be assayed (eg, screened) in a single assay by having each protected target nucleic acid identified in a identifiable manner. Many such assays can be performed quickly and easily. Therefore, such an assay or assay set can be performed with high throughput efficiency as defined herein.

In the method of the present invention, the first primer is extended and the template DNA is sequenced, and then the second primer is deprotected and sequenced. There is no interference between the sequencing reaction of the first primer and the sequencing reaction of the second unprotected primer. This is because the first primer is completely extended or stopped. Since the first primer is fully extended, sequencing from the second primer using conventional methods such as pyrophosphate sequencing is unaffected by the presence of the extended first primer. The present invention also provides a method of reducing possible signal contamination from the first primer. Signal contamination means that the first primer is not completely extended. In this case, the first primer continues to stretch as the next primer is deprotected and stretched. Elongation of both the first and second primers interferes with DNA sequencing.

In a preferred embodiment, the sequencing reaction from one primer (eg, the chain extension reaction) is first stopped or completed before the sequencing reaction begins on the second primer. The DNA strand extension reaction can be stopped by contacting the template DNA with dideoxynucleotide triphosphates (ddNTPs) such as ddATP, ddTTP, ddGTP and ddCTP and DNA polymerase. Following cessation, the dideoxynucleotide triphosphate can be removed by washing the reaction with a ddNTP-free solution. A second method of preventing further elongation of the primer is to add nucleotide triphosphate (dNTPs such as dATP, dTTP, dGTP and dCTP) and DNA polymerase to the reaction solution to any primer that is not fully extended. Is to fully extend. Following full elongation, dNTPs and polymerases are removed before deprotecting the next primer. By completing or stopping one primer before deprotecting the other primer, the signal-to-noise ratio of the sequencing reaction (eg, pyrophosphate sequencing) can be improved.

From the extension of each primer, the sequence is divided into (a) a step of arbitrarily stopping or completing sequencing, (b) a step of deprotecting a new primer, and (c) a step of sequencing from the deprotected primer. It can be repeated until determined. In this method, the hybridization step comprises "n" primers and one unprotected primer. The unprotected primer can be first sequenced and the steps (a), (b), and (c) can be repeated.

In a preferred embodiment, pyrophosphate sequencing is used for all sequencing performed by the methods of the invention.

In another preferred embodiment, both ends sequencing is performed according to the process outlined in FIG. This process can be divided into 6 steps. (1) Preparation of capture beads (Fig. 10A), (2) Drive to bead (DTB) PCR amplification (Fig. 10B), (3) SL reporter system preparation (Fig. 10C), (4) No. 1 Chain sequencing (Fig. 10D), (5) Preparation of second chain (Fig. 10E and 10F), and (6) Analysis of each chain (Fig. 10G). An example of this process is outlined below.

In step 1, N-hydroxysuccinimide (NHS) activated capture beads (eg, Amersham Biosciences, Piscataway, NJ) are attached to both forward and reverse primers. NHS coupling forms a chemically stable amide bond with a ligand containing a primary amino group. The capture beads are also coupled to biotin (Fig. 10A). The beads used herein (ie, solid nucleic acid capture supports) are of any convenient size and are made from any number of known materials. Examples of such materials include inorganic materials, natural polymers and synthetic polymers. Specific examples of these materials include cellulose, cellulose derivatives, acrylic resins, glass; polystyrene, polystyrene, gelatin, polyvinylpyrrolidone, copolymers of vinyl and acrylamide, divinylbenzene and crosslinked polystyrene (Merrifield Biochemistry). See 1964, 3,1385-1390), polyacrylamide, latex gel, polystyrene, dextran, rubber, silicon, plastic, nitrocellulose, cellulose, natural sponge, silica gel, glass, metallic plastic, cellulose, crosslinked dextran (eg , Sephadex ) and agarose gel (Sepharose ), as well as solid support known to those of skill in the art. In one preferred embodiment, the capture beads are cepharose beads having a diameter of about 25-40 μM.

In step 2, the hybridized template DNA is added to the forward and reverse primers, and this DNA is amplified by the PCR amplification method (Fig. 10B). In one embodiment, DNA is amplified by emulsion polymerase chain reaction, drive-to-bead polymerase chain reaction, rolling circle amplification or loop-mediated isothermal amplification. In step 3, streptavidin is added, followed by streptavidin-coupled sulfylase and luciferase (Fig. 10C). The addition of co-enzymes in the sequencing method is disclosed in US Patent Application Nos. 10 / 104,280 and 10 / 127,906, all of which are incorporated herein by reference. In one embodiment, the template DNA has a DNA adapter ligated at both the 5'and 3'ends. In a preferred embodiment, the DNA is coupled to the DNA capture beads by hybridizing one of the DNA adapters to the complementary sequence on the DNA capture beads.

In the first step, the single-stranded nucleic acid template to be amplified is attached to the capture beads. Nucleic acid templates can be attached to capture beads by methods known in the art. There are many methods in the art for attaching DNA to microbeads. Chemical covalent binding of DNA to beads is achieved using standard coupling agents such as water-soluble carbodiimides to bind 5'phosphate on DNA to amine-coated microspheres via phosphoamidate bonds. Can be made to. Another method is to first ligate a particular oligonucleotide linker to the beads by similar chemical means, and then use DNA ligase to bind the DNA to the linker on the beads. Other chemical binding methods may use N-hydroxysuccinamide (NHS) and its derivatives to bind the oligonucleotide to the beads. In such a method, one end of the oligonucleotide contains a reactive group (eg, an amide bond) that forms a covalent bond with the solid support, and the other end of the linker can be attached to the oligonucleotide to be immobilized. It can contain another reactive group. In a preferred embodiment, the oligonucleotide is covalently attached to the DNA capture beads. However, non-covalent bonds such as chelate bonds or antigen-antibody complexes can also be used to attach oligonucleotides to the beads.

Oligonucleotide linkers that specifically hybridize to unique sequences at the ends of DNA fragments, such as overlapping ends from restriction enzyme sites or the "adhesive end" of bacteriophage λ-based cloning vectors, can be used, but with blunt ends. Ligation can also be beneficially used. These methods are described in detail in US Pat. No. 5,674,743, the disclosure of which is incorporated herein by reference. It is preferred to attach the fixed oligonucleotide throughout the steps of the method of the invention, following the method used to fix the beads. In a preferred embodiment, the oligonucleotide is covalently attached to the DNA capture beads. However, non-covalent bonds such as chelate bonds or antigen-antibody complexes can be used to attach oligonucleotides to the beads.

In step 4, the capture beads are deposited on a picotiter plate (PTP) and sequenced by a method known to those of skill in the art (eg, pyrophosphate sequencing) to sequence the first strand of DNA. Determine (Figure 10D). Following sequencing, a mixture of dNTPs and ddNTPs is added to "capp" or stop the sequencing process (Figure 10E). In step 5, the second strand of nucleic acid is prepared by adding an apillase to remove the ddNTP and adding a polynucleotide kinase (PNK) to remove the 3'phosphate group from the blocked primer strand. (Fig. 10F). Polymerase is then added to prime the second strand, followed by sequencing the second strand according to standard methods known to those of skill in the art (Fig. 10G). In step 7, both the first and second strand sequences are analyzed so that the proximity DNA sequence is determined.

Detection means The solid support is optionally combined with conventional optics and fiber optic bundles to be optically coupled to the imaging system 230, including a CCD system. In one embodiment, the perfusion chamber substrate comprises a fiber optic array wafer, whereby light generated near the aqueous interface is directed directly out of the substrate or chamber through the fiber optics. If the CCD system includes a fiber optic connector, imaging can be achieved by placing the perfusion chamber substrate in direct contact with the connector. Alternatively, conventional optical instruments are used to image light directly onto the CCD sensor from outside the fiber optic substrate, for example using a 1-1 magnification high numerical aperture lens system. If the substrate does not provide fiber optic coupling, a lens system can also be used as described above, in which case either the substrate or the perfusion chamber cover is optically transparent. Examples of CCD imaging systems have been described above.

Imaging system 230 is used to collect light from the reactor onto the substrate surface. Light can be imaged on a CCD using, for example, a high-sensitivity low-noise device known in the art. In the case of optical fiber imaging, it is preferred to incorporate the optical fiber directly into the coverslip or, in the case of FORA, to have an optical fiber forming microwells, which are also optical fibers that carry light to the detector.

The imaging system is coupled to a computer controlled and data acquisition system 240. Generally, any commonly available hardware and software package can be used. The computer control and data acquisition system is also coupled to the conduit 200 for controlling the delivery of reagents.

The light generated by the pyrophosphate sequencing reaction is captured by the CCD as long as it passes through a focusing device (eg, an optical lens or optical fiber) and is focused on the CCD element. However, the emitted photons escape equally in all directions. When using flat arrays (eg, DNA chips), collect photons as close as possible to where they occur, eg, in the immediate vicinity of a flat solid support, to maximize subsequent "capture" and quantification. Is preferable. This is achieved either by (i) utilizing an optical immersion oil between the coverslip and a conventional optical lens or fiber optic bundle, or preferably (ii) incorporating the fiber optic directly into the coverslip itself. Will be done. Similarly, when using a thin, optically transparent, flat surface, the fiber optic bundle can be placed on the opposite side of its back surface, eliminating the need to image through the depth of the entire reaction / perfusion chamber.

Photons generated by reaction events, such as luciferase, can be detected in various detectors, such as photomultiplier tubes, CCDs, CMOS, absorbance meters, luminometers, charge injection devices (CIDs) or other solid-state detectors, as well as the present specification. It can be detected and quantified by using the device described in the document. In a preferred embodiment, the quantification of emitted photons is performed by using a CCD camera equipped with a fused optical fiber bundle. In another preferred embodiment, the quantification of emitted photons is performed by using a CCD camera equipped with a microchannel plate enhancer. A back-thinned CCD can be used to increase sensitivity. CCD detectors are described, for example, in Bronks, et al., 1995. Anal. Chem. 65: 2750-2757.

An example of a CCD system is a Spectral Instruments, Inc. (Tucson, AZ) Series 600 4-port camera with 1-1 fiber optic connectors (bundles) with individual fiber diameters of 6-8 μm and a Lockheed-Martin LM485 CCD chip. Is. The system has more than 4096 x 4096 or 16 million pixels and quantum efficiencies in the range of 10% to over 40%. That is, depending on the wavelength, 40% of the photons imaged on the CCD sensor are converted into detectable electrons.

In other embodiments, the fluorescent moiety can be used as a label and reaction events can be detected using a scanning confocal microscope to scan the surface of the array with a laser or other technique, where small. Techniques such as scanning near-field optical microscopy (SNOM) are available that allow optical resolution, which allows the use of "denser" arrays. For example, SNOM can be used to identify individual polynucleotides at distances less than 100 nm, eg, 10 nm × 10 nm. In addition, use a scanning tunneling microscope (Binning et al., Helvetica Physica Acta, 55: 726-735, 1982) and a nuclear microscope (Hanswa et al., Annu Rev Biophys Biomol Struct, 23: 115-139, 1994). Can be done.

Haplotype application Virtually any sequencing application can be achieved using the methods and devices of the present invention. In one embodiment, we contemplate haplotype mapping. Human genetic diversity is an important factor in the variability of a patient's response to a drug. The most accurate means of measuring this diversity is the haplotype, which is the mechanism of polymorphism as seen on the chromosome. Recently, major government agencies and academic genomic researchers in the United States, Canada and Europe have agreed that haplotypes are a powerful tool that can reduce the complexity of genetic information to a practical state. Haplotypes can be used for drug discovery to improve the results of targeting and drug screening studies, and can be used for drug development to improve the design and reliability of clinical trials. Haplotype markers can be used to predict the efficacy and safety of new approved drugs, serve as the basis for new paradigms for personalized drugs, and serve patients through guidance from a database of clinical marker combinations. Fit to the right drug and the right dose.

According to many empirical studies, neighboring SNP alleles are often linked to each other (LD), so that the state of one SNP allele is highly correlated with another close SNP allele. It was shown that there are many things to do. These correlations exist because of the shared history of tightly linked SNPs that are co-transmitted from generation to generation. Therefore, the human sequence diversity pattern (haplotype) represents an ancestral DNA segment. Historical meiosis slowly dissociated alleles from adjacent alleles on ancestral chromosomes, except for tightly linked mutants. The degree of linkage disequilibrium in the founder population with recent disabilities, such as in many studies, especially cystic fibrosis (16), Huntington's disease (11), and twisted bone dysplasia (DTD) (8). It was the subject of many studies in the cloning of simple Mendel's genetic disease. These cloning studies benefit from large chromosomal segments that show LD spread over long distances (often in the megabase range), but until recently, very little empirical data on the LD of the human genome in the global population. Was only obtained.

We noted three recent examples of large-scale LD (and haplotype) studies (eg,).<img file="JP2010142233A_D0023.tif" />Please refer to). We sampled 19 chromosomal regions for their SNP content. For high frequency SNP intervals of 2 to 160 kb, genotypes were first determined in Caucasian samples. In all regions, LD was detectable at a distance of about 60 kb, with large differences between regions, with a short range of 6 kb in one locus and a long range of 155 kb in the other locus. It is not surprising that LD significantly correlated with the estimated local recombination rate. In addition, analysis in the Nigerian sample provided evidence of short LD in this population, but the combination of alleles over short distances was similar to the Caucasian sample. Overall, this study provided evidence that large blocks of LD are common throughout the human genome and that LD mapping across the genome of disease genes is possible.

kit The invention also includes kits for use in methods of the invention that may contain one or more of the following components: (a) hybridize to sample DNA such that the target position is directly adjacent to the 3'end of the primer. Test-specific primers; (b) polymerase; (c) detection enzyme means for confirming PPi release; (d) a substrate for the PPi detection enzyme that can act as a substrate for the polymerase instead of dATP. Deoxynucleotides containing dATP analogs that cannot act as; and (e) any dideoxynucleotide, ddATP can optionally act as a substrate for the polymerase but is a substrate for the PPi detection enzyme. Replaced by a ddATP analog that cannot act as. When the kit is used for initial PCR amplification, it may also contain the following components: (i) A pair of PCR primers, at least one of which has means for immobilizing the primers; (ii) a polymerase that is preferably thermostable, such as Taq1 polymerase; (iii) PCR reaction. Buffer solution for; and (iv) deoxynucleotides. When using enzyme labeling to evaluate PCR, the kit advantageously contains a substrate for the enzyme and other components of the detection system.

One aspect of the invention relates to a method of sequencing nucleic acids. This method involves fragmenting a large template nucleic acid molecule to produce multiple fragmented nucleic acids. The fragmented nucleic acid is then delivered into the aqueous microreactor in a water-in-oil emulsion so that the plurality of aqueous microreactors contain a single copy of the fragmented nucleic acid (single beads are fragmented). It can bind to nucleic acids and the amplification reaction solution contains the reagents needed to perform nucleic acid amplification). In the next step, the fragmented nucleic acid is amplified in the microreactor to form an amplified copy of the nucleic acid, which binds to the beads in the microreactor. The beads are then delivered to an array of at least 10,000 reaction chambers on a flat surface (multiple reaction chambers contain only a single bead). Finally, the sequencing reaction takes place simultaneously on multiple reaction chambers.

Another aspect of the present invention is an array comprising a flat surface with a plurality of cavities on top, each cavity forming an analyzer reaction chamber, each having a center-to-center spacing of 20-100 μm. For arrays where the width of at least one dimension of the cavity is between 20 μm and 70 μm. In addition, there are at least 10,000 reaction chambers in the array. Each reaction chamber may contain at least 100,000 copies of a single species of single-stranded nucleic acid template.

Another aspect of the invention is an array comprising a flat top surface and a flat bottom surface, wherein the flat top surface has at least 10,000 cavities on which each form an analyzer reaction chamber. Since the flat bottom surface is optically conductive, the optical signal from the reaction chamber can be detected through the bottom flat surface, the distance between the top surface and the bottom surface does not exceed 5 mm, the reaction chamber For arrays, each chamber has a center spacing of 20-100 μm and each chamber has a width of at least one dimension of 20 μm-70 μm. The distance between the top surface and the bottom surface does not exceed 2 mm in one embodiment.

Another aspect of the invention relates to array means for performing separate parallel common reactions in an aqueous environment. The array means include a substrate containing at least 10,000 separate reaction chambers containing starting materials capable of reacting with reagents, each reaction chamber containing one or more fluids containing at least one reagent. When delivered in, the diffusion time for the reagent to diffuse out of the well is sized to exceed the time required for the starting material to react with the reagent to form a product.

Another aspect of the invention relates to a method for delivering a bioactive agent to an assay. The method comprises dispersing each mobile solid support with at least one reagent immobilized on top of an array of mobile solid supports, the reagents being used in the nucleic acid sequencing reaction. Suitable for this array includes a flat surface on which multiple reaction chambers are located. The reaction chambers have a center spacing of 20-100 μm and the width of each reaction chamber is 20 μm-70 μm in at least one dimension.

Another aspect of the invention relates to an apparatus for simultaneously monitoring an array of reaction chambers for light indicating that a reaction is taking place at a particular site. The device is (a) an array of reaction chambers formed from a flat substrate containing multiple cavityd surfaces, where each surface with cavities forms a reaction chamber adapted to contain the analyte. (Reaction chambers have a center spacing of 20-100 μm, each reaction chamber has a volume of 10-150 pL, and the array contains more than 10,000 separate reaction chambers); (b) Specific when used Optically sensitive devices arranged such that light from the reaction chamber collides with a specific predetermined area of the optical sensitive device; (c) Means for determining the level of light colliding with each predetermined area. , And (d) include means of recording changes in light levels over time for each of the reaction chambers.

Another aspect of the invention is (a) an array formed from a first bundle of optical fibers having surfaces with multiple cavities at one end (each surface with cavities adapted to include an analyzer. The reaction chambers have a center spacing of 20-100 μm, a width of 20-70 μm, and the array contains more than 10,000 separate reaction chambers); (b) in the reaction chamber. Enzymatic or fluorescent means for generating light in; and (c) light detection means, including light capture means and a second optical fiber bundle for transmitting light to the light detection means (the second optical fiber bundle is Optical contact with the array, whereby the light generated in the individual reaction chambers is captured by a separate fiber or group of separate fibers in a second fiber optic bundle for transmission to the light capture means). With respect to sensors for analysis, including.

Another aspect of the invention relates to means for carrying out separate parallel common reactions in an aqueous environment. The first step involves delivering a fluid containing at least one reagent to the array, the array containing at least 10,000 separate reaction chambers in which each reaction chamber is adapted to contain an analyzer. Containing the substrate, the reaction chamber has a volume of 10-150 pL and contains a starting material capable of reacting with the reagent, each of the reaction chambers where the reagent is delivered from the well when the fluid is delivered to each reaction chamber. The diffusion time that diffuses out is sized to exceed the time required for the starting material to react with the reagent to form a product. The second step is (i) after the starting material reacts with the reagent in each reaction chamber to form a product, but (ii) the reagent delivered to any one of the reaction chambers diffuses out of that reaction chamber. It involves washing the fluid from the array during the period prior to exiting and entering any other reaction chamber.

Another aspect of the invention relates to a method of delivering a nucleic acid sequencing enzyme to an array. The array has a flat surface with multiple cavities on top, each cavity forming an analyzer reaction chamber, with intercenter spacing of 20-100 μm. This method involves an array of mobile solid-state supports on which one or more nucleic acid sequencing enzymes are immobilized, such that multiple reaction chambers contain at least one mobile solid-state support. Includes a step of dispersing on top.

Another aspect of the invention relates to a method of delivering multiple nucleic acid templates to an array. The array has a flat surface on which each cavity forms an analyzer reaction chamber, the reaction chambers having a center spacing of 20-100 μm, and the array having at least 10,000. It has a reaction chamber. The method comprises the step of dispersing a plurality of mobile solid supports on which each mobile solid support has only a single nucleic acid template immobilized on it, and one movable by dispersion. Only the sex solid support is placed in any one reaction chamber.

Another aspect of the invention relates to a method of sequencing nucleic acids. The method comprises providing multiple single-stranded nucleic acid templates arranged in multiple cavities on a flat surface, where each cavity forms an analyzer reaction chamber, the reaction chambers having a center spacing of 20. It is ~ 100 μm and has a flat surface with at least 10,000 reaction chambers. The next step is to anneaate an effective amount of the sequencing primer into the nucleic acid template and extend the sequencing primer with polymerase and a given nucleotide triphosphate to produce a sequencing product and the given nucleotide. When triphosphate is incorporated into the 3'end of a sequencing primer, it involves simultaneously performing a pyrophosphate-based sequencing reaction on all reaction chambers by producing a reaction by-product. The third step involves identifying sequencing reaction by-products and thereby sequencing the nucleic acids in each reaction chamber.

Another aspect of the invention relates to a method of determining the nucleotide sequences of a plurality of nucleotides on an array. The first step comprises providing at least 10,000 DNA templates, each of which is separately located in multiple cavities on a flat surface, where each cavity forms an analyzer reaction chamber. The center spacing is 20-100 μm and the volume is 10-150 pL. The second step involves adding one known nitrogenous base activated nucleotide 5'triphosphate precursor to the reaction mixture in each reaction chamber, where each reaction mixture is a template-dependent nucleotide polymerase. , And a single-stranded polynucleotide template that hybridizes to a complementary oligonucleotide primer strand that is at least one nucleotide residue shorter than the template and forms at least one unpaired nucleotide residue in each template at the 3'end of the primer strand. including. This reaction is carried out under the condition that the activated nucleoside 5'triphosphate precursor can be incorporated into the 3'end of the primer chain, but the nitrogenous base of the activated nucleoside 5'triphosphate precursor is used. It must be complementary to the nitrogenous base of the unpaired nucleotide residue of the template. The third step involves detecting whether the nucleoside 5'triphosphate precursor has been incorporated into the primer chain, and the incorporation of the nucleoside 5'triphosphate precursor involves the unpaired nucleotide residues of the template. It is shown to have a nitrogenous base composition complementary to the composition of the incorporated nucleoside 5'triphosphate precursor. The fourth step involves repeating steps (b) and step (c) sequentially, with each repetition of one type of activated nucleoside 5'triphosphate precursor whose nitrogenous base composition is known. Increase and detect integration. The fifth step involves determining the base sequence of the template's unpaired nucleotide residues in each reaction chamber from the built-in sequence of nucleotide precursors.

Another aspect of the invention relates to a method of identifying a base at a target position in a DNA sequence of template DNA. The first step involves providing at least 10,000 separate DNA templates separately placed in multiple cavities on a flat surface where each cavity forms an analyzer reaction chamber. The center-to-center spacing is 20-100 μm and the DNA is single-stranded before or after being placed in the reaction chamber. The second step involves providing an extension primer that hybridizes to the immobilized single-stranded DNA at a position directly adjacent to the target position. Immobilized single-stranded DNA is subjected to a polymerase reaction in the presence of a given deoxynucleotide or dideoxynucleotide, and when the given deoxynucleotide or dideoxynucleotide is incorporated at the 3'end of a sequencing primer, it is a by-product of the sequencing reaction. Is formed. The fourth step involves identifying sequencing reaction by-products, thereby determining nucleotides that are complementary to the base at the target position within each of the 10,000 DNA templates.

Another aspect of the invention relates to an apparatus for analyzing nucleic acid sequences. This device is (a) a reagent delivery cuvette containing an array containing a flat surface with multiple cavities on top, each cavity forming an analyzer reaction chamber with a center-to-center spacing of 20-100 μm. Reagent delivery cuvette, which has more than 10,000 reaction chambers and contains reagents for use in sequencing reactions, (b) Reagent delivery means communicating with Reagent delivery cuvettes, (c) Reagent delivery chambers. Includes imaging systems that are in operation and (d) data acquisition systems that communicate with imaging systems.

Another aspect of the invention relates to an apparatus for determining the nucleotide sequences of multiple nucleotides on an array. The device is (a) a reagent cuvette containing multiple cavities on a flat surface, each cavity forming an analyzer reaction chamber, with more than 10,000 reaction chambers, each center-to-center spacing of 20. One known under the conditions that a reagent cuvette such as ~ 100 μm and volume 10 ~ 150 pL, (b) activated nucleoside 5'-triphosphate precursor can be incorporated into the 3'-end of the primer chain. Nitrogen-active nucleotide 5'-triphosphate precursors are a means of delivering reagents for simultaneous addition to the reaction mixture in each reaction chamber, where each reaction mixture is a template-dependent nucleotide polymerase and Includes a single-stranded polynucleotide template that hybridizes to a complementary oligonucleotide primer strand that is at least one nucleotide residue shorter than the template and forms at least one unpaired nucleotide residue in each template at the 3'end of the primer strand ( However, the nitrous base of the activated nucleoside 5'-triphosphate precursor is complementary to the nitrous base of the unpaired nucleotide residue of the template) Reagent delivery means, (c) Nucleoside 5'-in each reaction chamber. A detection tool for detecting whether a triphosphate precursor has been incorporated into a primer chain, a nucleoside in which the incorporation of the nucleoside 5'-triphosphate precursor is incorporated with the unpaired nucleotide residue of the template. A detection means that indicates that it has a nitrogenous base composition complementary to the 5'-triphosphate precursor, a means for sequentially repeating steps (d) (b) and (c), each of which is sequentially repeated. However, one type of activated nucleoside 5'with a known nitrogenous base composition

Another aspect of the present invention relates to an apparatus for processing a plurality of analyzers. This device is (a) a flow chamber in which a substrate containing a surface having at least 50,000 cavities on a bundle of optical fibers is arranged, and each surface having cavities is adapted to contain an analyzer. Flow chambers with a center-to-center spacing of 20-100 μm and a diameter of 20-70 μm, (b) processing reagents from one or more reservoirs in the reaction chamber. A fluid means for delivering to the flow chamber and (c) a detection means for simultaneously detecting an array of optical signals from each of the reaction chambers so that the analyzers placed in the are exposed to reagents. Each optical signal of the sequence indicates the interaction between the processing reagent and the analyzer placed in the reaction chamber, and the detection means communicates with the surface provided with the cavity, including the detection means.

Another aspect of the invention relates to a method for sequencing nucleic acids. The first step involves providing multiple single-stranded nucleic acid templates in an array having at least 50,000 separate reaction sites. The second step involves contacting the nucleic acid template with the reagents required to perform a pyrophosphate-based sequencing reaction that couples with luminescence. The third step involves detecting the light emitted from multiple reaction sites on each portion of the optically sensitive device. The fourth step involves converting the light that hits each part of the optically sensitive device into an electrical signal that is distinguishable from signals from all other reaction sites. The fifth step involves determining the sequence of the nucleic acid template from the corresponding electrical signals based on the luminescence for each of the separate reaction sites.

Another aspect of the invention relates to a method of sequencing nucleic acids. The first step involves fragmenting a large template nucleic acid molecule to produce a plurality of fragmented nucleic acids. The second step involves attaching one strand of a plurality of fragmented nucleic acids to the beads individually to produce a single-stranded nucleic acid individually attached to the beads. The third step involves delivering a population of single-stranded fragmented nucleic acids individually attached to the beads to an array of at least 10,000 reaction chambers on a flat surface (multiple wells are single-stranded fragments). Contains only one bead on the fragmented nucleic acid). The fourth step involves simultaneously performing the sequencing reaction on multiple reaction chambers. The sequencing reaction involves (a) annealing an effective amount of the sequencing primer to a single-stranded fragmented nucleic acid template and extending the sequencing primer with a polymerase and a given nucleotide triphosphate to produce a sequencing product. , And if the given nucleotide triphosphate is incorporated at the 3'end of the sequencing primer, the step of producing the sequencing reaction by-product, and (b) identifying the sequencing reaction by-product in multiple reaction chambers. Includes the step of sequencing the nucleic acid by. Alternatively, the sequencing reaction hybridizes two or more sequencing primers, which are (a) primers in which all but one primer is reversibly blocked, into one or more single strands of the nucleic acid molecule. The step of soaking, (b) incorporating at least one base into the nucleic acid molecule by polymerase elongation from the non-blocking primer, (c) preventing further elongation of the non-blocking primer, (d) reversibly blocking. A step of deblocking one of the primers to make it a non-blocking primer, and (e) repeating steps (b) to (d) until at least one reversible blocking primer is deblocked and used for sequencing. Including.

Other materials and methods can be found in the following US patent application 60 / 443,471 pending January 29, 2003 and US patent application 60 / 465,071 filed April 23, 2003. Can be done. All patents, patent applications and references cited in this disclosure are incorporated herein by reference.

<p>Example 1: Sample preparation DNA sample DNA should be of high quality and free of contaminants and salts such as proteins, nucleases, lipids and other chemicals (eg, residual EDTA from preparation). The 260/280 ratio of genomic DNA is preferably 1.8 or higher. If it is desired to sequence the genome of only one organism, the DNA should be examined for quality to ensure that it is free of contaminating DNA. For example, the preparation of human DNA can be examined by PCR to ensure that it is not contaminated with bacterial DNA molecules. Another method of examining contamination is the restriction digestion pattern, and in particular the restriction digestion and subsequent suitable probes known to be specific to the organism (eg, human or mouse), and possible contaminating organisms. By Southern blot using a second probe known to be specific (eg, E. coli). If desired, the DNA should originate from a single clone of the organism (eg, a colony if from a bacterium).</p><p>Step 1: DNase I digestion The purpose of the DNase I digestion process is to fragment large stretches of DNA, such as the entire genome or large parts of the genome, into smaller pieces. This population of small-sized DNA species originating from a single DNA template is called a "library". Deoxyribonuclease I (DNase I) is an endonuclease that cleaves double-stranded template DNA. Due to the cleavage properties of DNase I, template DNA is randomly digested (ie, minimal sequence bias) and blunt-ended double-stranded DNA fragments when used in the presence of manganese buffer (Melgar and Goldthwait 1968). Become superior. Digestion of genomic templates by DNase I depends on three factors. i) Amount of enzyme used (units); ii) Digestion temperature (° C); and iii) Incubation time (minutes). The DNase I digestion conditions outlined below were optimized to obtain DNA libraries in the 50-700 base pair (bp) size range.</p><p> 1. DNA was obtained and adjusted to a concentration of 0.3 mg / ml (10 mM, pH 7-8) in Tris-HCl. A total of 134 μl of DNA (15 μg) was required for this preparation. It is better not to use DNA preparations diluted with a buffer containing EDTA (ie TE, Tris / EDTA). The presence of EDTA is inhibitory to enzymatic digestion with DNase I. If the DNA preparation contains EDTA, DNA is "salted out" from solution and suitable Tris-HCl buffer (10 mM, pH 7-8) or nanopure H.₂It is important to reconstitute with O (pH 7-8). 2. In a 0.2 ml tube, Tris pH 7.5 (1M) 50 μl, MnCl₂A DNase I buffer containing 10 μl of (1M), 1 μl of BSA (100 mg / ml) and 39 μl of water was prepared. 3. In another 0.2 ml tube, 15 μl of DNase I buffer and 1.5 μl of DNase I (1 U / ml) were added. The reaction tube was placed in a thermal cycler set at 15 ° C. 4. 134 μl of DNA (0.3 mg / ml) was added to a DNase I reaction tube placed in a thermal cycler set at 15 ° C. The lid was closed and the sample was incubated for exactly 1 minute. Following incubation, 50 μl of 50 mM EDTA was added to stop enzymatic digestion. 5. Digested DNA was purified using the QiaQuick PCR purification kit. The digestion reaction was then divided into 4 parts and 4 spin columns were used to purify each part (37.5 μl per spin column). Each column was eluted with 30 μl of elution buffer (EB) according to the manufacturer's protocol. Next, the eluates were combined to give a final reaction volume of 120 μl. 6. A 3 μl portion of the digestion reaction was stored for analysis using the BioAnalzyer DNA 1000 Lab Chip.</p><p>Step 2: Pfu polishing Digestion of DNA templates with DNase I produces fragments of DNA that are predominantly blunt-ended, but some fragments have an end that contains a protruding end of one or two nucleotides in length. .. Using Pfu polishing, 5'protrusion filling (ie, "smoothing") increases the amount of blunt-ended species. In addition, Pfu DNA polymerase has 3' 5 exonuclease activity, resulting in the removal of one or two nuclease extensions. Pfu polishing increases the amount of blunt-ended DNA fragments available for adapter ligation (Costa 1994a, 1994b, 1994c). The following Pfu polishing protocol was used.</p><p> 1. In a 0.2 ml tube, add 115 μl of purified DNase I digested DNA fragment, 15 μl of 10 × cloned Pfu buffer, 5 μl of dNTP (10 mM), and 15 μl of cloned Pfu DNA polymerase (2.5 U / μl) in order. did. 2. The polishing reaction components were thoroughly mixed and incubated at 72 ° C for 30 minutes. 3. Following incubation, the reaction tube was removed and placed on ice for 2 minutes. 4. The polishing reaction mixture was then divided into 4 aliquots and purified using a QiaQuickPCR purification column (37.5 μl on each column). Each column was eluted with 30 μl buffer EB according to the manufacturer's protocol. Next, the eluates were combined to give a final reaction volume of 120 μl. 5. 3 μl aliquots of the final polishing reaction were stored for analysis using the BioAnalzyer DNA 1000 Lab Chip.</p><p>Step 3: Litigation of Universal Adapter to Fragmented DNA Library Following fragmentation and polishing of the genomic DNA library, primer sequences are added to the ends of each DNA fragment. These primer sequences are referred to as "universal adapters" and consist of double-stranded oligonucleotides containing specific priming regions that provide both PCR amplification and nucleotide sequencing. The universal adapter is a set of unique sequencing priming regions of 20 base pairs in length, followed by a unique 4-base "key" consisting of one of each deoxyribonucleotide (ie, A, C, G, T). It is designed to contain a set of unique PCR priming regions with a length of 20 base pairs in the vicinity of. Each unique universal adapter (called "universal adapter A" and "universal adapter B") is 44 bp long. Universal adapter is T4 DNA ligase is used to ligate each end of the DNA fragment to add a total of 88 bp of nucleotides to each DNA fragment. Different universal adapters are specifically designed for each genomic DNA library preparation, thus providing a unique confirmation tool for each organism.</p><p> To prepare a pair of universal adapters, single-strand oligonucleotides are designed in-house and manufactured by commercial suppliers. Universal adapter DNA oligonucleotides are designed to have two phosphorothioate linkages at the ends of each oligonucleotide that act to protect against nuclease activity (Samini, TD, B. Jolles, and A. Laigle. 2001, Best minimally modified antisense oligonucleotides according to cell nuclease activity. Antisense Nucleic Acid Drug Dev. 11 (3): 129, all of which is incorporated herein by reference). Each oligonucleotide is purified by HPLC to ensure that it is free of contamination or pseudoDNA oligonucleotide sequences in the final preparation.</p><p> Universal adapters are designed to allow directional ligation into blunt-ended fragmented genomic DNA. For each universal adapter pair, the PCR priming region contains a 5'four-base overhang and a blunt-ended 3'key region. Directivity is achieved when the blunt-ended side of the universal adapter ligates to the blunt-ended DNA fragment and the 5'protrusion of the adapter cannot ligate to the blunt-ended DNA fragment. In addition, 5'biotin is added to Universal Adapter B to allow subsequent isolation of the ssDNA template (step 8). Each universal adapter annealing two single-stranded complementary DNA oligonucleotides (ie, one oligo moiety contains the sense sequence and the second oligo moiety contains the antisense sequence) in a single tube. Is prepared by The following ligation protocol was used.</p><p> 1. In a 0.2 ml tube, nH₂39 μl of O (molecular biology grade water), 25 μl of digested and polished DNA library, 100 μl of 2 × Quick Ligase Reaction buffer, 20 μl of 100: 1 ratio MMP1 (10 pm / μl) adapter set, and 16 μl of Quick Ligase in order. Added. The ligation reaction was mixed well and incubated at room temperature for 20 minutes. 2. Next, the ligation reaction was removed and 10 μl of the ligation reaction was purified for use on the BioAnalyzer. A single spin column from the Qiagen Min-Elute kit was used. The column was eluted with 10 μl EB according to the procedure of the manufacturer protocol. 1 μl of the purified ligation reaction was filled with BioAnalyzer DNA 1000 Lab Chip. This purification step is recommended because the unpurified ligation reaction contains large amounts of PEG and salts that prevent the sample from running properly on the BioAnalyzer. 3. The rest of the ligation reaction (190 μl) was used for gel isolation in step 4.</p><p>Step 3a: Microcon filtration and adapter construction. Total preparation time is about 25 minutes The universal adapter ligation reaction requires a 100-fold excess of adapters. To aid in the removal of these excess adapters, the double-stranded gDNA library is filtered through a Microcon YM-100 filtration device. Double-stranded DNA smaller than 125 bp can be removed using the Microcon YM-100 membrane. Thus, unbound adapters (44 bp) as well as adapter dimers (88 bp) can be removed from the ligated gDNA library population. The following filtration protocol was used.</p><p> 1. 190 μl of the ligation reaction from step 4 was applied into the assembled Microcon YM-100 apparatus. 2. The device was placed in a centrifuge and rotated at 5000 xg for about 6 minutes or until the membrane was almost dry. 3. For cleaning, 200 μl of 1 × TE was added. 4. The sample was rotated at 5000 xg for an additional 9 minutes or until the membrane was almost dry. 5. For recovery, the storage section was inserted into a new vial and rotated at 3,000 xg for 3 minutes. The storage was discarded. The recovered volume was about 10 μl. Next, 80 μl of TE was added.</p><p> Adapters (A and B) were purified by HPLC and modified with phosphorothioate conjugation prior to use. For adapter "A" (10 μM), mix 10 μl of 100 μM adapter A (44 bp, sense) with 10 μl of 100 μM adapter A (40 bp, antisense) and mix 1 x annealing buffer (V)._f= 50 μl) 30 μl was mixed. Primers were annealed on a Sample Prep Labthermal cycler (see below) using the ANNEAL program. For adapter "B" (10 μM), mix 10 μl of 100 μM adapter B (40 bp, sense) with 10 μl of 100 μM adapter B (44 bp, antisense) and mix 1 x annealing buffer (V)._f= 50 μl) 30 μl was mixed. Primers were annealed on the Sample Prep Lab thermal cycler using the ANNEAL program. The adapter set can be stored until it is used at -20 ° C.</p><p> ANNEAL-A program for primer annealing 1. Incubate at 95 ° C for 1 minute 2. Temperature drops to 15 ° C at 0.1 ° C / sec, and 3. Hold at 15 ° C</p><p> No orientation was required for genomic DNA insert fragments and adapters. Fragments could be ligated at any end. Four single-stranded DNA oligonucleotides were incubated in a universal adapter set. Each single-stranded oligonucleotide was synthesized on a 1 μm scale and purified by HPLC. Each single-strand oligonucleotide contained four phosphorothioate bonds at each end.</p><p>Step 4: Gel electrophoresis and extraction of adapted DNA library The universal adapter ligation protocol results in: 1) fragmented DNA with an adapter at either end; 2) unbound single adapter; or 3) formation of an adapter dimer. Agarose gel electrophoresis is used as a method for separating and isolating a matched DNA library population from a single unligated adapter and adapter dimer population. Genomic DNA DNase The procedure of I digestion yields a library population in the range of 50-700 bp (step 1). The addition of the 88bp universal adapter set shifts the population to the larger dimension side, resulting in a mobile profile in the size range of approximately 130-800bp. The adapter dimer moves to 88bp and the unligated adapter moves to 44bp. Therefore, genomic DNA libraries in the size range greater than 200 bp can be physically isolated from agarose gels and purified using standard gel extraction techniques. Gel isolation of the matched DNA library will result in the recovery of library populations in the size range greater than 200 bp (library size range may vary depending on application). The following electrophoresis and extraction protocols were used.</p><p> 1. A 2% agarose gel was prepared. 2. 10 μl of 10 × Ready-Load Dye was added to the remaining 90 μl of the DNA ligation mixture. 3. The dye / ligation reaction mixture was loaded into the gel using 4 adjacent lanes (25 μl per lane). 4. 10 μl of 100 bp ladder (0.1 μg / μl) was charged 2 lanes away from the ligation reaction lane. 5. The gel ran at 100 V for 3 hours. 6. When the gel run was complete, the gel was removed from the gel box and transferred to a flat surface covered with plastic wrap. The DNA band was visualized using handheld long wavelength UV light. Fragments sized 200-400 bp were excised from the agarose gel using a sterile disposable scalpel. Using this technique, libraries of any size range can be isolated. Multiple size ranges can also be isolated. If the library size range is 200-900 bp, several size ranges can be isolated from a single well (ie 200-400 bp and 500-700 bp). 7. DNA embedded in an agarose gel was isolated using the Qiagen MinElute Gel Extraction kit according to the manufacturer's instructions. Simply put, buffer QG was added to cover the agarose in the tube. The agarose was completely dissolved. The color of buffer QG was maintained by adjusting the pH to minimize sample loss according to Qiagen's instructions. Two MinElute spin columns (Qiagen) were used for purification. Large amounts of dissolved agarose require each column to be filled several times. The column was eluted with 10 μl of buffer EB preheated to 55 ° C. The eluate was stored to give 20 μl of gDNA library. 8. 1 μl of each isolated DNA library was analyzed using the BioAnalyzer DNA 1000 LabChip to determine the exact distribution of the DNA library population.</p><p>Step 5: Strand Substitution and Extension of Double-stranded DNA Library with Nick Since the DNA oligonucleotide used for the universal adapter is not phosphorylated, there is a gap at the 3'junction of the fragmented gDNA. These two "gaps" or "nicks" can be filled with standard replacement DNA polymerases. The polymerase recognizes the nick, replaces the nicked strand, and extends the strand so that the nick is repaired and a nick-free double-stranded DNA is formed as a result. The strand replacement enzyme used is a large fragment of BstDNA polymerase.</p><p> 1. In a 0.2 ml tube, gel-extracted DNA library 19 μl, nH₂O 40 μl, 10 × ThermoPol Reacion buffer 8 μl, BSA (1 mg / ml) 8 μl, dNTP (10 mM) 2 μl, and BstI polymerase (8 U / μl) 3 μl were added in that order. 2. The samples were thoroughly mixed, placed in a heat cycler and incubated using the chain replacement incubation program "BST". BST is a nicked double-stranded DNA strand replacement and elongation program. Incubate for 30 minutes at 1.65 ° C; 2. Incubate at 80 ° C for 10 minutes; Incubate for 10 minutes at 3.58 ° C; and Hold at 4.14 ° C 3. 1 μl of Bst-treated DNA library was run using BioAnalyzer DNA 1000 Lab Chip.</p><p>Step 6: Preparation of streptavidin beads Following the generation of nick-free double-stranded genomic DNA, it is necessary to isolate single-stranded genomic DNA containing adjacent universal adapter sequences. This step outlines the binding of biotin-labeled double-stranded DNA to streptavidin beads. The following protocol was used for the preparation of streptavidin beads.</p><p> 1. 100 μl of Dynal M-270 streptavidin beads were washed twice with 200 μl of 1 × Binding Buffer (1M NaCl, 0.5 mM EDTA, 5 mM Tris, pH 7.5) by applying magnetic beads to MPC. 2. The beads were resuspended in 100 μl of 2 × Binding Buffer and 79 μl of the remaining Bst-treated DNA sample (from step 5) and 20 μl of water were added. 3. The bead solution was thoroughly mixed and placed on a tube rotor at room temperature for 20 minutes. The bead mixture was washed twice with 100 μl of 1 × Binding Buffer using MPC, then nH.₂Washed twice with O. Binding &amp; Washing (B &amp; W) Buffer (2 × and 1 ×): 2 × B &amp; W buffer was prepared by mixing 10 mM Tris · HCl (pH 7.5), 1 mM EDTA and 2 M NaCl. The reagents were combined as listed above and mixed thoroughly. The solution can be stored at room temperature for 6 months; 1 x B &amp; W buffer, 2 x B &amp; W buffer nH₂Prepared by mixing 1: 1 with O. The final concentration was half of the above, ie 5 mM Tris HCl (pH 7.5), 0.5 mM EDTA, and 1 M NaCl.</p><p>Step 7: Isolation of a single-stranded DNA library using streptavidin beads Following binding of the double-stranded gDNA library to streptavidin beads, single-stranded gDNA containing universal adapter A and universal adapter B (desirable populations are shown below with an asterisk) from the ligated pool. It is preferable to isolate only. The double-stranded genomic DNA fragment pool has adapters linked in the following possible structures: Universal Adapter A-gDNA Fragment-Universal Adapter A Universal Adapter B-gDNA Fragment-Universal Adapter A^* Universal Adapter A-gDNA Fragment-Universal Adapter B^* Universal Adapter B-gDNA Fragment-Universal Adapter B</p><p> Since only Universal Adapter B has a 5'biotin moiety, magnetic streptavidin-containing beads can be used to bind all gDNA library species with Universal Adapter B. Genomic library populations containing two universal adapter A species (or unligated species) do not bind to streptavidin-containing beads and are removed during the wash procedure. Seeds that remain bound to the beads after washing include seeds with universal adapters A and B, or seeds with two universal adapter B ends.</p><p> Genomic DNA species with two universal adapter B sequences with two biotin molecules can bind to streptavidin-containing beads at both ends. Species with A and B adapters that have only a single biotin molecule can only bind to beads at the "B" end. To isolate the single-stranded population, the bead-bound double-stranded DNA is treated with a solution of sodium hydroxide that acts to break the hydrogen bonds between the complementary DNA strands. If the DNA fragment has biotin at each end (universal adapter B end), both resulting single strands maintain binding to the beads. If the fragment has only a single biotin (universal adapters A and B), the complementary strand is separated from the DNA-bead complex.</p><p> The resulting single-stranded genomic DNA library is collected from the solution phase and quantified, for example, using pyrosequencing or RNA Pico 6000 LabChip (Agilent, Palo Alto, CA). .. The single-strand genomic DNA library is quantified by calculating the number of molecules per unit volume. The single-stranded gDNA molecule is then annealed into 25-30 μm sepharose beads containing DNA capture primer (PCR primer B) (half copy per bead to obtain one valid copy per bead). The template is then amplified using the emulsion polymerase chain reaction protocol. Subsequent sequencing can be performed using known techniques. The following protocol was used for isolation of the single-strand library.</p><p> 1. 250 μl of the melting solution (0.125M NaOH, 0.1M NaCl) was added to the wash beads from step 6 above. 2. The bead solution was thoroughly mixed and the bead mixture was incubated on a tube rotator at room temperature for 10 minutes. 3. Using Dynal MPC (Magnetic Particle Concentrator), pellet beads were carefully removed and the supernatant was removed. The 250 μl supernatant contained a single-stranded DNA library. 4. In a separate tube, 1250 μl of PB (from the QiaQuick purification kit) was added and the solution was neutralized by adding 9 μl of 20% acetic acid. 5. Using Dynal MPC, beads from 250 μl of supernatant containing the single-strand gDNA library were pelleted, the supernatant was carefully removed and transferred to a freshly prepared PB / acetic acid solution. 6. 1500 μl of solution was purified using a single QiaQuick purification rotary column (through the same column, fill the sample twice with 750 μl per filling). The single-strand DNA library was eluted with 50 μl EB.</p><p>Step 8a: Single-strand gDNA quantification using pyrophosphate-based sequencing. Total preparation time is about 1 hour 1. The following reagents were added in order in a 0.2 ml tube. Single-strand gDNA 25 μl NMP2B Sequencing Primer 1 μl<u style="single">Library Annealing Buffer 14 μl</u> 40 μl in total 2. DNA was annealed using the ANNEAL-S program (see Appendix below). 3. Samples were run over a PSQ (pyrophosphate-based sequencing jig) to determine the number of picomoles of the template in each sample (see below). Methods of sequencing can be found in US Pat. No. 6,274,320; US Pat. No. 4,863,849; US Pat. No. 6,210,891 and US Pat. No. 6,258,568, all of which are incorporated herein by reference. Calculated to determine the number of single-strand gDNA template molecules per μl. The remaining 25 μl of the prepared single-stranded gDNA library was used for amplification and subsequent sequencing (approximately 1 × 10).⁶Reaction of).</p><p>Step 8b: Positive-strand RNA quantification using RNA Pico 6000 Lab Chip. Total preparation time is about 30 minutes 1. The mRNA Pico assay option was selected on BioAnalyzer (software version 2.12). 2. RNA Pico 6000 LabChip was prepared on BioAnalyzer according to the manufacturer's guidelines. 3. The RNA Lab Chip ladder (RNA 6000 ladder) was prepared according to the manufacturer's instructions. Briefly, the RNA LabChip ladder in solution was heated at 70 ° C for 2 minutes. The solution is cooled on ice for 5 minutes to allow the ladder to cool rapidly. The solution was centrifuged for a short time to remove the concentrate from the tube wall. The RNA LabChip ladder was stored on ice and used within 1 day. 4. The ssDNA library to be analyzed was run in triads in adjacent lanes using three 1 μl aliquots. Five. BioAnalyzer software was used to calculate the concentration of each ssDNA library lane (see table and Figure 24 below). Using the average of all three lanes, the DNA concentration in the library was calculated using the procedure outlined below. Move the peak integration lower limit line (long dashed line in Figure 24) just in front of the library peak (see below). b. Move the peak integration upper limit line (long dashed line in FIG. 24) immediately behind the library peak. In this way, the peak integration line connecting the lower and upper integration lines followed the background gradient. c. The mouse arrow was used to determine the average size of the peaks at the base (usually close to the peak peak), or the specified peaks selected by the software were used. d. The integrated value was used for the amount of material during the peak. The values obtained for the recovered picograms were converted to the recovered molecules (see table below). The library concentration was then determined (molecules per μl).</p><p> (table)<img file="JP2010142233A_D0024.tif" /></p><p> As shown in the table above, the concentration of Library 1 was calculated to be 1639 pg / μl (row 5) and the average fragment size was 434 nucleotides (row 9). These values were obtained from the Agilent 2100 software as described in steps (a)-(d) above. The average molecular weight (MW) of ribonucleotides is 328.3 g / mol (row 10). Average library fragment MW (1.42 x 10)⁵g / mol, column 11) was calculated by multiplying the mean fragment length (434) by the mean ribonucleotide (328.2). The quantified library (1639 pg / μl) was converted to g / μl (1.64 × 10).^-9g / μl, column 12). Number of molecules per μl (1.15 × 10)^-14Mol / μl, column 14), the number of grams per μl (1.64 × 10)^-9g / μl, column 12) the average molecular weight of the library fragment (1.42 × 10)⁵Calculated by dividing by g / mol, column 11). Finally, the number of molecules per μl (6.93 × 10)⁹Molecules / μl, column 15), number of moles per μl (1.15 × 10)^-14Avogadro's number (6.02 x 10) in mol / μl, column 14)²³Molecule / mol)</p><p> The final library concentration is 1x10⁸Expected to be larger than the numerator / μl. A more important factor for library quality was adapter dimer concentration. In FIG. 24, the height of the library peak was determined to be approximately 10-fold greater than the adapter dimer peak (the first peak after the marker). A good quality library is expected to have a peak height that is at least twice as high as the dimer peak. It should be noted that the RNA Pico 6000 LabChip provides an estimate of single-strand gDNA concentration within 500% accuracy. That is, it was important to perform initial sequencing using template titration to determine the copy number (cpb) per bead of input gDNA. The recommended input DNAs are 2.5cpb, 1cpb, 0.5cpb, and 0.1cpb. This titration was readily investigated using a 4-slot bead filling chamber on 14 × 43 PTP.</p><p>Step 9: Dilution and storage of single-strand gDNA library The single-strand gDNA library was eluted and quantified in buffer EB. To prevent denaturation, the single-strand gDNA library was frozen and stored at -20 ° C in the presence of EDTA. After quantification, the same amount of 10 mM TE was added to the library stock. All subsequent dilutions were done in TE. The yield is shown below. Remaining final volume of ssDNA library after PSQ analysis = 25 μl. Remaining final volume of ssDNA library after LabChip analysis = 47 μl.</p><p> For dilution of the initial stock, the single-strand gDNA library was diluted to 100 million molecules / μl in 1 × Library-Grade elution buffer. An aliquot of the single-strand gDNA library was prepared for general use. To this end, 200,000 molecules / μl was diluted in 1 × library grade elution buffer and 20 μl aliquots were measured. A single-use library aliquot was stored at -20 ° C.</p><p>Step 10: Emulsion polymerase chain reaction If increased cpb numbers were preferred, bead emulsion PCR was performed as described in US Patent Application No. 06 / 476,504, filed June 6, 2003, which is incorporated herein by reference in its entirety.</p><p>Reagent preparation Stop solution (50 mM EDTA) is nH₂A 1.0 ml 50 mM EDTA solution was obtained containing 100 μl of 0.5 M EDTA mixed with 900 μl of O. For 10 mM dNTP, 10 μl of dCTP (100 mM), 10 μl of dATP (100 mM), 10 μl of dGTP (100 mM) and 10 μl of dTTP (100 mM) were mixed with 60 μl of molecular biology grade water. A total of four 100 mM nucleotide stocks were melted on ice. Next, 10 μl of each nucleotide, nH₂Combined with O 60 μl to a final volume of 100 μl, mixed thoroughly. Next, 1 ml was placed in a 1.5 ml microcentrifuge tube. The stock solution could be stored at -20 ° C for 1 year.</p><p> The 10 × annealing buffer contained 200 mM Tris (pH 7.5) and 50 mM magnesium acetate. For this solution, 24.23 g of Tris, 800 ml of nH₂It was added to O and the mixture was adjusted to pH 7.5. To this solution, 10.72 g of magnesium acetate was added and completely dissolved. The solution had a final volume of 1000 ml and could be stored at 4 ° C for 1 month. 10 × TE contained 100 mM Tris HCl (pH 7.5) and 50 mM EDTA. These reagents were added together and mixed well. The solution could be stored at room temperature for 6 months.</p><p>Example 2: Primer design As mentioned above, universal adapters are 1) typically a set of unique PCR priming regions of 20 bp in length (located adjacent to (2)); 2) typically a set of 20 bp in length. Unique sequencing priming region; and 3) optionally followed by a unique distinctive key sequence consisting of at least one of each of the four deoxyribonucleotides (ie, A, C, G, T). Will be done. The likelihood of cross-hybridization between the primer and an unintended region of the genome of interest increases as the genome size increases and the length of the perfect match with the primer decreases. However, this possible interaction with the cross-hybridization region (CHR) is not expected to cause problems for the reasons described below.</p><p> In a preferred embodiment of the invention, a single-strand DNA library is utilized for PCR amplification and subsequent sequencing. Sequencing methods require random digestion of a given genome into 150-500 base pair fragments, followed by two unique duplex primers (consisting of both PCR and sequencing regions) of the fragment. It is ligated to the'and 3'ends (Fig. 25). Melting temperature (T_m), The disclosed process is different from typical PCR amplification in which the site of the genome is selected as the priming site based on the uniqueness of the priming sequence in the genome and its proximity to a particular region or gene of interest. Utilize synthetic priming sites that require careful new primer design.</p><p>Tetramer selection Hensel, M. and DWHolden, Molecular genetic approaches for the study of virulence in both pathogenic fungi and fungi. Microbiology, 1996.142 (Pt5): p. 1049-58; Shoemaker, DD, et al., Quantitative phenotypic analysis of yeast deletion mutants using a highly parallel molecular bar-coding strategy. See Nat Genet. 1996.14 (4): p.450-6) and PCR / Study on LDR (polymerizer chain reaction / ligation detection reaction) hybridization primer (<img file="JP2010142233A_D0025.tif" />Please refer to) Found in published literature on.</p><p> PCR / LDR studies have similar final T_mIt was particularly relevant and focused on the design of the oligonucleotide "Zip Code", which is a 24-base primer consisting of six specifically designed tetramers with.<img file="JP2010142233A_D0026.tif" />Please refer to). Tetramer components were selected based on the following criteria: Each tetramer, unlike the others, excluded tetramers that induce self-pairing or hairpin formation, as well as palindromes (AGCT) or palindromes (TATA). 256 (4⁴Thirty-six of the possible permutations of) met the required requirements and then subjected to the additional restrictions required for acceptable PCR primer design (Table 1).</p><p> (table 1)<img file="JP2010142233A_D0027.tif" /></p><p> This table shows a matrix representing tetramer primer component selection based on the criteria outlined by Gerry et al. 1999.J.Mol.Bio.292: 251-262. Each tetramer was required to differ by at least 2 bases from all other tetramers. Tetramers could not be complementary to palindromes or other tetramers. Thirty-six tetramers were selected (bold underlined) and the italic sequence is the signal palindrome tetramer excluded from consideration.</p><p>Primer design PCR primers were designed to meet specifications common to common primer designs (Rubin, E. and AALevy, A mathematical model and a computerized simulation of PCR using complex templates. Nucleic Acids Res, 1996.24 (18): p. 3538-45; Buck, GA, et al., Design strategies and performance of custom DNA sequencing primers. Biotechniques, 1999.27 (3): see p.528-36), the actual selection is made by the computer program MMP. It was. Primers were limited to a length of 20 bases (5 tetramers) for efficient synthesis of all duplex PCR / sequencing primers. Each primer contains two base GC clamps at the 5'end and a single GC clamp at the 3'end (Table 2), with all primers having similar Ts._mIt had (+/- 2 ° C) (Fig. 27). Hairpins in the primer (internal hairpin stem ΔG&gt; -1.9 kcal / mol) were not allowed. Dimerization was also controlled. A maximum of 3 base dimers was allowed, but it occurred at the last 6 3'bases and the maximum acceptable ΔG for the 3'dimer was -2.0 kcal / mol. In addition, primers whose 3'ends are too similar to others in the group are considered defective, which prevents cross-hybridization between one primer and another inverse complement.</p><p> (Table 2)<img file="JP2010142233A_D0028.tif" /></p><p> Table 2 shows a possible permutation of 36 selected tetramolecules that provide two 5'and one 3'G / C clamps. The inside consists of the remaining four molecules. This results in an 8x19x19x19x9 permutation, or a possible combination of 493,848 pieces. FIG. 27 shows the first pass and the T of allowed primers._mShows selection based on, 493,848 primers, T_mHas decreased to 56,246 candidates at 64 to 66 ° C.</p><p> (Table 3) The probability that a complete sequence will match a primer increases as the matching length requirement decreases and the size of the genome of interest increases.<img file="JP2010142233A_D0029.tif" /></p><p> The possibility of complementary regions occurring in the genome of interest is not important during the primer design process, despite the reported tolerance of PCR for mismatches in the complex sample population. (See, for example, Rubin, E. and AALevy, A mathematical model and a computerized simulation of PCR using complex templates. Nucleic Acids Res, 1996.24 (18): p.3538-45). Very unlikely to find a perfect match for a 20 base primer (4)²⁰) (Table 3), the probability of finding a match with low discontinuity increases significantly with the size of the genome of interest. As a result, the probability of finding at least 10 perfect matches out of 20 bases is 99.35% for the adenovirus genome. The probability of finding an exact match of 16 bases is 97% for sequences in the NCBI database (about 100 times greater than the adenovirus genome). The probability of finding an exact 17-base match for 20 base primers is 99% for the sequence of the human genome (3 billion bases).</p><p> The high probability of primer cross-hybridization to a region of the genome is less problematic than expected due to the random DNA digestion used to generate the template fragments. That is, the effect of the cross-hybridization region (CHR) is quite good. It is unlikely that CHR will successfully compete for a perfect match between the PCR primers in solution and the template. In addition, primers containing a mismatch at the 3'end have a significant competitive disadvantage. Out-compete the PCR primers intended by CHR produces a truncated PCR product that does not have a downstream site for sequencing primers. One of two situations arises if the truncated product can be directed and immobilized on the capture beads. When CHR competes out solution phase primers, the immobilized product lacks the sequencing primer binding site, resulting in an empty picotiter plate (PTP) well. If CHR competes out the bead binding primer, the sequencing primer is still present and only shorter inserts are obtained. None of the results unduly impair the quality of the sequencing. With a large amount of genomic material used in the sample preparation process (currently 25 μg, 5.29 × 10 of the 35 Kb adenovirus genome)¹⁶Oversampling (including copying) can be used to provide fragments lacking complete CHR, resulting in standard PCR amplification of the area in question.</p><p>Example 3: Sample preparation by spraying Preparation of DNA by spraying The purpose of the spraying process is to fragment large DNA stretches, such as the entire genome or most of the genome, to obtain small molecular species that are easy to sequence the DNA. This small-sized collection of DNA species resulting from a single DNA template is called a library. Spraying shears the double-stranded template DNA into 50-900 base pair fragments. The sheared library contains single-stranded ends that have been repaired by a combination of T4 DNA polymerase, E. coli DNA polymerase I (Klenow fragment) and T4 polynucleotide kinase. Both T4 and Klenow DNA polymerase are used to "fill" the 3'recessed ends (5'protrusions) of DNA through their 5'-3'polymerase activity. The single-strand 3'-5'exonuclease activity of T4 and Klenow polymerase removes the 3'protruding end, and the kinase activity of the T4 polynucleotide kinase adds a phosphate group to the 5'hydroxy end.</p><p> The sample was prepared as follows. 1. 15 μg of gDNA (genomic DNA) was obtained and adjusted to a final volume of 100 μl in 10 mM TE (10 mM Tris, 0.1 mM EDTA, pH 7.6, see reagent table at the end of the section). OD of 1.8 or higher_260/280DNA was analyzed for contamination by measuring the ratio. The final gDNA concentration was expected to be about 300 μg / ml. 2. 1600 μl of ice-cold spray buffer (see end of section) was added to gDNA. 3. The reaction mixture was placed in an ice-cooled atomizer (CIS-US, Bedford, MA). 4. 15ml snap cap A cap from the Falcon tube was placed on the top of the atomizer (Fig. 28A). 5. The cap was secured with a clean sprayer clamp assembly consisting of a compatible cover (for the lid of the Falcon tube) and two rubber O-rings (Figure 28B). 6. The bottom of the atomizer was attached to the nitrogen supply and the entire device was wrapped in parafilm (Figures 28C and 28D). 7. While keeping the atomizer upright (as shown in Figure 28D), 50 psi (pounds per cubic inch) of nitrogen was supplied for 5 minutes. The bottom of the atomizer was slammed onto a hard surface every few seconds to push the compressed liquid against the bottom. After 8.5 minutes, nitrogen was stopped. After normalizing the pressure (30 seconds), the nitrogen source was removed from the atomizer. 9. The parafilm was removed and the screw on the top of the atomizer was removed. The sample was removed and transferred to a 1.5 ml microcentrifuge tube. 10. The top of the atomizer was reattached and the atomizer was centrifuged at 500 rpm for 5 minutes. 11. Collected the rest of the sample in the atomizer. The total recovery was about 700 μl. 12. The recovered sample was purified using a QIAquick column (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. Due to its large volume, it was necessary to fill the column several times. Samples were eluted with 30 μl buffer EB (10 mM Tris HCl, pH 8.5, supplied to Qiagen kit) preheated to 55 ° C. 13. Samples were quantified by UV spectroscopy (2 μl in 198 μl of water for 1: 100 dilution).</p><p>Enzymatic polishing The DNA template is sprayed to obtain many DNA fragments with abraded ends. These ends are smoothed and ready to ligate to the adapter fragment using three enzymes: T4 DNA polymerase, polymerase (Klenow fragment) in E. coli and T4 polynucleotide kinase.</p><p> The sample was prepared as follows. 1. The following reagents were added to the 0.2 ml tube in order. Purified spray gDNA fragment 28 μl 5 μl of water 10 × T4 DNA polymerase buffer 5 μl BSA (1 mg / ml) 5 μl dNTP (10mM) 2 μl<u style="single">T4 DNA polymerase (3 units / μl) 5 μl</u> Final volume 50 μl 2. The solution from Step 1 was thoroughly mixed and incubated in an MJ heat cycler (any accurate incubator can be used) at 25 ° C for 10 minutes. 3. Escherichia coli DNA polymerase (Klenow fragment) (5 units / ml) 1.25 μl was added. 4. The reaction mixture was thoroughly mixed and incubated in an MJ heat cycler at 25 ° C for 10 minutes and at 16 ° C for an additional 2 hours. 5. The treated DNA was purified using a QiaQuick column and eluted with 30 μl of buffer EB (10 mM Tris HCl, pH 8.5) preheated to 55 ° C. 6. The following reagents were combined in a 0.2 ml tube. Qiagen Purified Polishing Spray GDNA Fragment 30 μl 5 μl of water 10 × T4 PNK buffer 5 μl ATP (10 mM) 5 μl<u style="single">T4PNK (10 units / ml) 5 μl</u> Final volume 50 μl 7. The solutions were mixed, placed in an MJ heat cycler and incubated at 37 ° C for 30 minutes using the T4PNK program, incubated at 65 ° C for 20 minutes, and then stored at 14 ° C. 8. The sample was purified using a QiaQuick column and eluted in 30 μl of buffer EB preheated to 55 ° C. 9. 2 μl of final polishing reaction was retained for analysis with BioAnalyzer DNA 1000 Lab Chip (see below).</p><p>Adapter ligation The procedure for ligating the adapter was as follows. 1. The following reagents were added to the 0.2 ml tube in order. Molecular biology grade water 20.6 μl Digested and polished gDNA library 28 μl 2 x Quick Ligase reaction buffer 60 μl MMP (200 picomols / μl) universal adapter set 1.8 μl<u style="single">Quick Ligase 9.6 μl </u> 120 μl in total</p><p> The reaction was designed for 5 μg and adjusted depending on the amount of gDNA used.</p><p> 2. The reagents were mixed well and incubated at 25 ° C for 20 minutes. The tubes were placed on ice until the gel was prepared for agarose gel electrophoresis.</p><p>Gel electrophoresis and extraction of adapted gDNA libraries Spraying genomic DNA yields a library population ranging from 50 bp to 900 bp. The addition of the 88bp universal adapter shifts the population towards larger dimensions, resulting in a large size range (approximately 130-980bp) of migration profile. The adapter dimer moves to 88bp and the unligated adapter moves to 44bp. Therefore, genomic DNA libraries isolated in the size range of 250 bp and above can be physically isolated from agarose gels and purified using standard gel extraction techniques. Gel isolation of the matched gDNA library yields a library population with a size range of 250 bp or greater (library size range can vary depending on application). The library size range after adapter ligation is 130-980bp. The procedure is adapted for isolation of any band size range such as 130-200 bp, 200-400 bp, 250-500 bp, 300-600 bp, 500-700 bp, etc. by cutting gels in different regions. It should be noted that it can be made to. Fragments from 250 bp to 500 bp were isolated using the procedure described below.</p><p> 150 ml of agarose gel was prepared to contain 4.5 μl of 2% agarose, 1 × TBE and ethidium bromide (10 mg / ml stock). The ligated DNA was mixed with 10 × Ready Load Dye and packed onto a gel. In addition, 10 μl of 100 bp ladder (0.1 μg / μl) was filled into two lanes away from the ligation reaction adjacent to the sample. The gel was electrophoresed at 100 V for 3 hours. When the gel run was complete, the gel was removed from the gel box, transferred to GelDoc and covered with plastic wrap. The DNA band was visualized using PrepUV light. Library populations were excised from agarose gels with fragment sizes of 250-500 bp using sterile disposable scalpels. This process was performed as quickly as possible to prevent DNA nick formation. Gel slices were placed in a 15 ml falcon tube. The agarose-embedded gDNA library was isolated using the Qiagen MinElute Gel Extraction kit. An aliquot of each isolated gDNA library, BioAnalyzer DNA 1000 Analysis was performed using LabChip to determine the exact distribution of the gDNA library population.</p><p>Strand substitution and extension of the gDNA library and isolation of the single-strand gDNA library using streptavidin beads Strand substitution and extension of the nicked double-stranded gDNA library was performed as described in Example 1, except that the Bst-treated sample was incubated in a heat cycler at 65 ° C for 30 minutes and placed on ice until needed. went. Rinse the streptavidin beads twice with 200 μl of 1 × Binding buffer, nH₂It was prepared as described in Example 1 except that it was washed twice with 200 μl of O and the final wash was performed. The single-strand gDNA library was isolated using streptavidin beads as follows. Water was removed from the wash beads and 250 μl of the melting solution (see below) was added. The bead suspension was thoroughly mixed and incubated on a tube rotator at room temperature for 10 minutes. In a separate tube, 1250 μl of PB (from the QiaQuick purification kit) and 9 μl of 20% acetic acid were mixed. The beads in 250 μl of the thawing solution were pelleted with Dynamic MPC, the supernatant was carefully removed and transferred to a freshly prepared PC / acetic acid solution. DNA from 1500 μl of solution was purified using a single MinElute purified spin column. This was done by filling the sample twice with 750 μl per filling through the sample column. The single-strand gDNA library was eluted with 15 μl buffer EB preheated to 55 ° C.</p><p>Quantification and storage of single-strand gDNA Single-strand gDNA was quantified using RNA Pico 6000 Lab Chip as described in Example 1. In some cases, the single-strand library was quantified by a second assay to confirm that the initial Agilent 2100 quantification was accurate. For this purpose, RiboGreen quantification was performed as described (ssDNA quantification by fluorescence measurement) to confirm the Agilent 2100 quantification. Each analysis was repeated if the estimates differed by more than 3 times. Extensive template vs. beads were used when quantification showed a difference of more than 3-fold between the two procedures.</p><p> Dilution and storage of the single-strand gDNA library was performed as described in Example 1. The yield is shown below. Residual final volume of ssDNA library following LabChip analysis = 12 μl. Residual final volume of ssDNA library following RiboGreen analysis = 9 μl. Final volume of ssDNA library after addition of TE = 18 μl.</p><p> The same volume of TE was added to the single-strand gDNA library stock. Single-strand gDNA library 1 × 10 in buffer TE⁸The numerator / μl was used. The stock was diluted (1/500) to 200,000 molecules / μl in TE, 20 μl of which was prepared as an aliquot.</p><p>Library fragment size distribution after spraying Figure 29A shows typical results of an Agilent 2100 DNA 1000 Lab Chip analysis of 1 μl of material following spraying and polishing. The size range distribution for most of the products was expected to be about 50-900 base pairs. The average dimension (the highest part of the peak) was expected to be about 450 bp. Figure 29B shows typical results of gel purification of library fragments ligated with adapters.</p><p>reagent Unless otherwise stated, the reagents listed in the Examples represent standard reagents on the market. For example, Klenow, T4 DNA polymerase, T4 DNA polymerase buffer, T4 PNK, T4 PNK buffer, Quick T4 DNA ligase, Quick ligation buffer, Bst DNA polymerase (large fragment) and ThermoPol reaction buffer, New England Biolabs ( Obtained from Beverly, MA). The dNTP mixture is obtained from Pierce (Rockford, IL). Agarose, UltraPure TBE, BlueJuice gel-filled buffer and Ready-Load 100bp DNA ladder can be purchased from Invitrogen (Carlsbad, CA). Ethidium bromide and 2-propanol can be purchased from Fisher (Hampton, NH). RNA ladders can be purchased from Ambion (Austin, TX). Other reagents are generally known and / or listed below.</p><p>Melting solution<img file="JP2010142233A_D0030.tif" /></p><p> The melting solution contained 100 mM NaCl and 125 mM NaOH. The listed reagents were combined and mixed well. The solution could be stored at room temperature for 6 months.</p><p>Bound and wash (B &amp; W) buffer (2x and 1x)<img file="JP2010142233A_D0031.tif" /></p><p> The 2 × B &amp; W buffer contained final concentrations of 10 mM Tris-HCl (pH 7.5), 10 mM EDTA, and 2 M NaCl. The listed reagents were combined and mixed well. The solution could be stored at room temperature for 6 months. 1 × B &amp; W buffer is 2 × B &amp; W buffer Pico Pure H₂Prepared by mixing 1: 1 with O. The final concentration was half that of the above, ie 5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, and 1 M NaCl.</p><p> Other buffers contained: 1 × T4 DNA polymerase buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl₂, 1 mM dithiothreitol (pH 7.9, 25 ° C). TE: 10mM Tris, 1mM EDTA.</p><p>Special reagent preparation TE (10mM)<img file="JP2010142233A_D0032.tif" /></p><p> The reagents were mixed and the solution could be stored at room temperature for 6 months.</p><p>Spray buffer<img file="JP2010142233A_D0033.tif" /></p><p> All reagents were added to Stericup (glycerol added last) and mixed well. The solution was labeled and could be stored at room temperature for 6 months.</p><p>ATP (10mM)<img file="JP2010142233A_D0034.tif" /></p><p> The reagents were mixed and the solution could be stored at -20 ° C for 6 months.</p><p>BSA (1 mg / ml)<img file="JP2010142233A_D0035.tif" /></p><p> The reagents were mixed and the solution could be stored at 4 ° C for 6 months.</p><p>Library Annealing Buffer, 10x<img file="JP2010142233A_D0036.tif" /></p><p> The 10 × annealing buffer contained 200 mM Tris (pH 7.5) and 50 mM magnesium acetate. For this buffer, 200 ml of Tris and 500 ml of PicoPure H₂Added to O. Next, 10.72 g of magnesium acetate was added to the solution and completely dissolved. The solution was adjusted to a final volume of 1000 ml. The solution could be stored at 4 ° C for 6 months. To avoid possible contamination of the library, the buffer was divided for one-time or short-term use.</p><p>adapter Adapter "A" (400 μM)<img file="JP2010142233A_D0037.tif" /></p><p> For this solution, 1000 pmol / μl adapter A (44 bp, sense) 10 μl, 1000 pmol / μl adapter A (40 bp, antisense) 10 μl, 10 × library annealing buffer 2.5 μl, and water 2.5 μl (V)._f= 25 μl) and mixed. The adapter was annealed in the Sample Prep Lab thermal cycler using the ANNEAL-A program (see Appendix below). Further details on the adapter design are provided in the appendix.</p><p>Adapter "B" (400 μM)<img file="JP2010142233A_D0038.tif" /></p><p> For this solution, 1000 pmol / μl adapter B (40 bp, sense) 10 μl, 1000 pmol / μl adapter B (44 bp, antisense) 10 μl, 10 × library annealing buffer 2.5 μl, and water 2.5 μl (V)._f= 25 μl) and mixed. The adapter was annealed in the Sample Prep Lab thermal cycler using the ANNEAL-A program (see Appendix below). After annealing, adapter "A" and adapter "B" (V)_f= 25 μl) was combined. The adapter set was stored at -20 ° C until use.</p><p>20% acetic acid<img file="JP2010142233A_D0039.tif" /></p><p> For this solution, glacial acetic acid was added to the water. The solution could be stored at room temperature for 6 months.</p><p>Adapter annealing program ANNEAL-A program for primer annealing: 1. Incubate at 95 ° C for 1 minute; 2. Temperature drops to 15 ° C at a rate of 0.1 ° C / sec; and 3. Hold at 14 ° C.</p><p> T4 Polymerase / Klenow POLISH Program for End Repair: 1. Incubate at 25 ° C for 10 minutes; 2. Incubate for 2 hours at 16 ° C; and 3. Hold at 4 ° C.</p><p> T4 PNK program for end repair 1. Incubate at 37 ° C for 30 minutes; 2. Incubate at 65 ° C for 20 minutes; and 3. Hold at 14 ° C.</p><p> BST program for strand substitution and elongation of double-stranded gDNA with nicks: 1. Incubate at 65 ° C for 30 minutes; and 2. Hold at 14 ° C.</p><p>Step 9: Dilution and storage of single-strand DNA library Single-strand DNA library in EB buffer: final residual volume = 25 μl.</p><p> The initial stock diluent was made as follows. Using Pyrosequencing AB, Uppsala, Sweden results, the single-stranded DNA library was diluted to 100 Mmolecules / μl in 1 × annealing buffer (usually this was a 1:50 dilution). ).</p><p> 200,000 molecules / μl were diluted in 1 × annealing buffer to prepare 30 μl to make an aliquot of a single-stranded DNA library for general use. Store at -20 ° C. The sample was used in emulsion PCR.</p><p>Reagent preparation Stop solution (50 mM EDTA): 0.5 M EDTA 100 μl, nH₂Mix with 900 μl of O to give 1.0 ml of 50 mM EDTA solution.</p><p> 10 mM dNTP solution is dCTP (100 mM) 10 μl, dATP (100 mM) 10 μl, dGTP (100 mM) 10 μl and dTTP (100 mM) 10 μl, molecular biology grade water (nH)₂O) Contains 60 μl. All four 100 mM nucleotide stocks were lysed on ice. 10 μl of each nucleotide, 60 μl of nH₂Combined with O to a final volume of 100 μl, mixed well. The 1 ml aliquot was placed in a 1.5 ml microcentrifuge tube and stored at -20 ° C for less than a year.</p><p> Annealing buffer (10 ×): 10 × Annealing buffer contained 200 mM Tris (pH 7.5) and 50 mM magnesium acetate. For this solution, add 24.23 g of Tris to 800 ml of nH₂It was added to O and adjusted to pH 7.5. To this, 10.72 g of magnesium acetate was added and completely dissolved. The solution had a final volume of 1000 ml. This solution could be stored at 4 ° C for 1 month.</p><p> 10 × TE: 10 × TE contained 100 mM Tris HCl (pH 7.5) and 50 mM EDTA. These reagents were added together and mixed well. The solution could be stored at room temperature for 6 months.</p><p>Example 4: Bead Emulsion PCR The following steps, including capture of template DNA, DNA amplification, and recovery of beads bound to the amplification template, can be performed in a single tube. This emulsion format ensures that the beads are physically separated in this single tube into a 100-200 μm "microreactor" and the various templates are cloned and amplified. Immobilization of the amplification product is achieved by extending the template along the oligonucleotides bound to the DNA capture beads. Typically, the fixed template copy number ranges from 10 to 30 million copies per bead. DNA capture beads to which multiple copies of a single species of nucleic acid template are attached are ready to be distributed on PTP.</p><p> 300,000 75 picolitre wells made on the surface of the PTP provide a large number of parallel, efficient, cost-effective and unique arrays for sequencing short DNA templates. However, this requires a fairly large number (millions of copies) of clone templates in each reaction well. Using the methods of the invention, single-strand genomic templates can be cloned and amplified by performing PCR reactions in standard tubes or microtiter plates. A single copy of the template species is mixed with capture beads, resuspended in complete PCR amplification solution, emulsified into a microreactor (100-200 μm in diameter), and then PCR amplified to produce 10 original template species.⁷It may be amplified twice. This procedure is much simpler and more cost effective than the previous method.</p><p>Binding of nucleic acid template to capture beads This example describes the preparation of a bead population to which one and only nucleic acid template is selectively bound. Successful clonal amplification depends on delivering a controlled number of template species (0.5 to 1) to each bead. When excess template species are delivered, PCR amplification of the mixed template population is performed, resulting in no meaningful sequence data, and when the number of template species is insufficient, wells containing templates for sequencing. The number will decrease. This reduces the coverage of the genome provided by the sequencing step. As a result, it is preferred to repeat the quantification to accurately determine the template concentration and follow the binding protocol outlined below.</p><p>Template quality control The success of the emulsion PCR reaction is related to the quality of the template species. No matter how detailed and careful the amplification steps are, poor template quality compromises successful amplification and generation of meaningful sequence data. To avoid wasting time and money, it is important to check the quality of the template material before starting the emulsion PCR step of this process. Preferably, the library must pass two quality control steps before being used for emulsion PCR. Its concentration and product distribution need to be determined. Ideally, the library is a heterogeneous population of fragments with little or no adapter dimer (eg ~ 90 bases). Amplification with PCR primers also yields product smears in the range of 300 to 500 bp, for example. The absence of amplification products may reflect that the adapter is not properly attached to the template, and the presence of a single band of any size reflects that the template was contaminated. there is a possibility.</p><p>Preparation of PCR solution The main consideration at this stage is to ensure that the scattered amplicon does not contaminate the PCR reaction mixture. Contamination of the PCR reaction solution with residual amplicon is one of the important problems leading to the failure of the sequencing step. Reaction preparations are performed in a clean room UV-treated laminar flow hood using appropriate laboratory techniques to reduce the potential for contamination.</p><p>PCR reaction mixture In 200 μl of the PCR reaction mixture (enough to amplify 600,000 beads), mix the following reagents in a 0.2 ml PCR tube.</p><p> (Table 4)<img file="JP2010142233A_D0040.tif" /></p><p> The tubes were thoroughly vortexed and stored on ice until the beads were annealed on the template.</p><p>DNA capture beads 1. 600,000 DNA capture beads were transferred from the stock tube to a 1.5 ml centrifuge tube. The amount used depends on the bead concentration of the prepared reagents. 2. The beads were precipitated in a benchtop mini-centrifuge and the supernatant was removed. 3. Steps 4-11 were performed in a PCR clean room. 4. The beads were washed with 1 mL of 1X annealing buffer. 5. The trapped beads were precipitated in a microcentrifuge. The tube was rotated 180 ° and centrifuged again. 6. The supernatant was removed from the tube containing the beads, leaving about 10 μl. The beads did not disturb. 7. 1 mL of 1X annealing buffer was added and the mixture was incubated for 1 minute. The beads were then precipitated in the same manner as in step 5. 8. The contents were removed from the tube leaving about 100 μL. 9. The remaining beads and solution were transferred to a PCR tube. 10. Pipette in and out several times with 150 μL of 1X annealing buffer to wash the 1.5 mL tube. This solution was added to a PCR tube containing beads. 11. 11. The beads were precipitated in the same manner as in step 5, and the supernatant was removed leaving 10 μL, being careful not to disturb the bead precipitation. 12. Part of the quantified single-strand template DNA (sstDNA) was removed. The final concentration was 200,000-sst DNA molecules / μl. 13. 3 μl of diluted sstDNA was added to the PCR tube containing the beads. This corresponds to 600,000 copies of sstDNA. 14. The tube was gently vortexed and the contents were mixed. 15. Using program 80 Anneal stored in the EPCR folder of the MJ thermal cycler, sstDNA was annealed into the capture beads in the PCR thermocycler. The following protocol was used. 5 minutes at 65 ° C; Reduced to 60 ° C at 0.1 ° C / sec; Hold at 60 ° C for 1 minute; Reduced to 50 ° C at 0.1 ° C / sec; Hold at 50 ° C for 1 minute; Reduced to 40 ° C at 0.1 ° C / sec; Hold at 40 ° C for 1 minute; · Dropped to 20 ° C at 0.1 ° C / sec; and Hold at 10 ° C until the next stage is ready</p><p> In most cases, the beads were used for amplification immediately after template binding. If the beads were not used immediately, they were stored in template solution at 4 ° C until needed. After storage, the beads were treated as follows.</p><p> 16. As in step 6, the beads were removed from the thermocycler, centrifuged, and the annealing buffer was removed without disturbing the beads. 17. The beads were stored in an ice bucket until emulsification (Example 2). 18. The captured beads had an average of 0.5 to 1 copy of sstDNA per bead and were ready for emulsification.</p><p>Example 5: Emulsification The PCR solutions suitable for use in this step are listed below. For 200 μl of the PCR reaction mixture (sufficient for amplification of 600K beads), the following materials were added to 0.2 ml PCR tubes.</p><p><img file="JP2010142233A_D0041.tif" /></p><p> This example describes a method of making a thermostable water-in-oil emulsion containing approximately 3,000 PCR microreactors per microliter. The following is an outline of the protocol for preparing emulsions.</p><p> 1. 200 μl of PCR solution was added to 600,000 beads (both components were obtained from Example 1). 2. The bead was resuspended by pipetting the solution in and out several times. 3. The PCR-bead mixture was incubated at room temperature for 2 minutes and the beads were equilibrated with the PCR solution. 4. 400 μl of emulsion oil was added to a UV-irradiated 2 ml microcentrifuge tube. 5. A "no amplicon" 1/4 "magnetic stir bar was added to the emulsion oil tube.</p><p> The stirring bar without amplicon was prepared as follows. A large stir bar was used to hold the 1/4 "stir bar. Then the stir bar was: -Wash with DNA-Off (droplets or spray); Rinse with picopure water; -Dry at the edge of the Kimwipe; and UV was irradiated for 5 minutes.</p><p> 6. The magnetic insert of the Dynal MPC-S tube holder was removed. A tube of emulsion oil was placed in the holder. The tube was placed in the center of the stirring plate set at 600 rpm. 7. The tube was thoroughly vortexed and the beads were resuspended. This minimized agglomerated beads. 8. Using a P-200 pipette, add 1 drop of PCR-bead mixture every 2 seconds, allowing each drop to sink to the level of a magnetic stir bar and emulsify before adding the next drop. It was added to the rotating oil one drop at a time. The solution became a uniform milky white liquid with a viscosity similar to mayonnaise. 9. Once all the PCR-bead mixture was added, the centrifuge tube was repelled several times to mix the oil on the surface with the milky emulsion. 10. Stirring was continued for another 5 minutes. 11. Steps 9 and 10 were repeated. 12. The stirring bar was removed from the emulsion by pulling the stirring bar out of the tube using a larger stirring bar. 13. 10 μL of emulsion was removed and placed on a microscope slide. The emulsion was covered with a coverslip and observed at a magnification of 50X (eyepiece 10X, objective lens 5X). A "good" emulsion is one in which a single bead is predominantly contained in a separated droplet (microreactor) of a PCR solution in oil. 14. A suitable emulsion oil mixture containing an emulsion stabilizer was prepared as follows. The components of the emulsion are shown in Table 5.</p><p> (Table 5)<img file="JP2010142233A_D0042.tif" /></p><p> The emulsion oil mixture was prepared by preheating Atlox 4912 to 60 ° C in a water tank. Then 4.5 grams of Span 80 was added to 94.5 grams of mineral oil to prepare a mixture. The warmed Atlox 4912 was then added to the 1 g mixture. The solution was placed in a closed container, shaken and inverted to mix. If there were signs of Atlox hardening or coagulation, the mixture was warmed to 60 ° C and further shaken to correct.</p><p>Example 6: Amplification This example describes the amplification of template DNA in a bead-emulsion mixture. According to the protocol of the present invention, the DNA amplification step of the process takes 3 to 4 hours. After completion of amplification and before beginning the bead isolation process, the emulsion may be left in the thermocycler for up to 12 hours. PCR thermocycling was performed by placing 50 to 100 μl of the emulsion reaction in individual PCR reaction chambers (ie, PCR tubes). PCR was performed as follows.</p><p> 1. Using one pipette tip, 50 to 100 μL of emulsion was transferred to approximately 10 separate PCR tubes or 96-well plates. At this stage, the water-in-oil emulsion is very viscous. 2. The plate was sealed or the PCR tube lid was closed and the container was placed in the MJ thermocycler with or without a 96-well plate adapter. 3. The PCR thermal cycler was run with the following program: 1 cycle (4 minutes at 94 ° C) -Hot start; 40 cycles (30 seconds at 94 ° C, 30 seconds at 58 ° C, 90 seconds at 68 ° C); 25 cycles (30 seconds at 94 ° C, 6 minutes at 58 ° C); and Save at 14 ° C 4. After the PCR reaction was completed, the amplification product was removed to proceed with emulsion destruction and bead recovery.</p><p>Example 7: Emulsion destruction and bead recovery This example describes how to break the emulsion and recover the beads to which the amplification template is attached. Preferably, the emulsion after PCR remains in perfect condition. The lower layer of the emulsion remains a milky white suspension upon visual inspection. If the solution is clear, the emulsion may have partially separated into an aqueous layer and an oil layer, and many of the beads are likely to have a mixture of templates. If the emulsion is broken in one or two tubes, do not mix these samples with the other samples. If the emulsion is broken in all tubes, do not continue this procedure.</p><p> 1. All PCR reactions obtained from the original 600 μl sample were mixed in a single 1.5 ml microcentrifuge tube using a single pipette tip. As mentioned above, the emulsion is very viscous. In some cases, pipetting was repeated several times on each tube. As much material as possible was transferred to a 1.5 ml tube. 2. The remaining emulsion was recovered from each PCR tube by adding 50 μl of Sigma mineral oil to each sample. Using a single pipette tip, each tube was moved in and out several times to resuspend the remaining material. 3. This material was added to a 1.5 ml tube containing most of the emulsifying material. 4. The sample was vortexed for 30 seconds. 5. The sample was centrifuged at 13.2 Krpm for 20 minutes in an Eppendorf tabletop microcentrifuge. 6. The emulsion was separated into two layers with a large white interface. The upper clear oil layer was removed as much as possible. The turbid material was left in the tube. Often, a white layer separated the oil and water layers. Beads were often observed to settle at the bottom of the tube. 7. The aqueous layer above the beads was removed and stored for analysis (gel analysis, Agilent 2100, and Taqman). If the interface of the white material remained above the aqueous layer, 20 μl of the underlying aqueous layer was removed. This was done by penetrating the interface material with a pipette tip and removing the solution from underneath. 8. In the PTP Fabrication and Surface Chemistry Room Fume Hood, 1 ml of hexane was added to the remaining emulsion. 9. The sample was stirred for 1 minute and centrifuged for 1 minute at maximum speed. 10. In the draft of the PTP Production and Surface Chemistry Laboratory, the upper oil / hexane layer was removed and placed in an organic effluent container. 11. 1X annealing buffer in 1 ml of 80% ethanol was added to the remaining aqueous layer, interface, and beads. 12. The sample was vortexed for 1 minute or until the white material was dissolved. 13. The sample was centrifuged at high speed for 1 minute. The tube was rotated 180 degrees and centrifuged for 1 minute. The supernatant was removed without disturbing the bead precipitation. 14. The beads were washed with 1 ml of 1X annealing buffer containing 0.1% Tween 20 and this step was repeated.</p><p>Example 8: Single Strand Removal and Primer Annealing If beads are used in a pyrophosphate-based sequencing reaction, the second strand of the PCR product must be removed and the sequencing primer annealed to the single-stranded template bound to the beads. This embodiment describes a protocol for that purpose.</p><p> 1. The beads were washed with 1 ml of water and centrifuged twice for 1 minute. The tube was rotated 180 degrees between the two centrifuges. After centrifugation, the aqueous layer was removed. 2. The beads were washed with 1 ml of 1 mM EDTA. The tube was centrifuged as in step 1 to remove the aqueous layer. 3. 1 ml of 0.125 M NaOH was added and the sample was incubated for 8 minutes. 4. The sample was lightly vortexed and placed in a microcentrifuge. After 5.6 minutes, the beads were precipitated as in step 1 and as much solution as possible was removed. 6. After 8 minutes of NaOH incubation was completed, 1 ml of 1X annealing buffer was added. 7. The sample was lightly vortexed and the beads were precipitated as in step 1. As much supernatant as possible was removed and an additional 1 ml of 1X annealing buffer was added. 8. The sample was lightly vortexed, the beads were precipitated as in step 1 and 800 μl of 1X annealing buffer was removed. 9. The beads were transferred to a 0.2 ml PCR tube. Ten. The beads were transferred and as much annealing buffer as possible was removed without disturbing the beads. 11. 100 μl of 1X annealing buffer was added. 12.4 μl of 100 μM sequencing primer was added. Immediately prior to annealing, the sample was vortexed. 13. Annealing was performed in the MJ thermal cycler using the "80 Anneal" program. 14. The beads were washed 3 times with 200 μl 1X annealing buffer and resuspended in 100 μl 1X annealing buffer. 15. The beads were counted on the Hausser hemocytometer. Typically, 300,000 to 500,000 beads were recovered (3,000-5,000 beads / μL). 16. The beads were stored at 4 ° C and could be used for sequencing for 1 week.</p><p>Example 9: Any enrichment step The beads containing the amplicon may be concentrated using the following procedure. Concentration is not required, but subsequent molecular biology techniques such as DNA sequencing can be used to make it more efficient.</p><p> To the sepharose beads containing the amplicon obtained in Example 5, 50 μl of 10 μM (total 500 pmol) of biotin sequencing primer was added. The beads were placed in a thermal cycler. Primers were annealed into the DNA on the beads by the thermal cycler annealing program of the example.</p><p> After annealing, the Sepharose beads were washed 3 times with annealing buffer containing 0.1% Tween 20. Beads containing ssDNA fragments annealed to biotin sequencing primers were concentrated by centrifugation and resuspended in 200 μl of BST binding buffer. 10 μl of 50,000 units / ml Bst polymerase was added to the resuspended beads and the container containing the beads was placed on a rotating device for 5 minutes. 2 μl of 10 mM dNTP mixture (ie, 2.5 μl each of 10 mM dATP, dGTP, dCTP and dTTP) was added and the mixture was further incubated at room temperature for 10 minutes. The beads were washed 3 times with annealing buffer containing 0.1% Tween 20 and resuspended in the original volume of annealing buffer.</p><p> 50 μl of Dynal Streptavidin beads (Dynal Biotech Inc., Lake Success, NY; 10 mg / ml M270 or MyOne beads) were washed 3 times with annealing buffer containing 0.1% Tween 20 to the original volume. Resuspended in annealing buffer containing 0.1% Tween 20. Then, the Dynamic bead mixture was added to the resuspended Sepharose beads. The mixture was vortex-stirred and placed on a rotating device at room temperature for 10 minutes.</p><p> The beads were collected at the bottom of the tube by centrifuging at 2300 xg (500 rpm for the Eppendorf Centrifuge 5415D). The beads were resuspended in annealing buffer containing 0.1% Tween 20 of the original volume. The mixture in the test tube was placed in a magnetic separation device (Dynal). The beads were washed 3 times with annealing buffer containing 0.1% Tween 20 and resuspended in the same volume of buffer. Beads without amplicons were removed during the washing step, as previously mentioned. Only Sepharose beads containing suitable DNA fragments were retained.</p><p> Magnetic beads were separated from Sepharose beads by adding 500 μl of 0.125 M NaOH. The mixture was vortex-stirred and the magnetic beads were removed by magnetic separation. The Sepharose beads remaining in the solution were transferred to another tube and washed with 400 μl of 50 mM Tris acetic acid until the pH stabilized at 7.6.</p><p>Example 10: Nucleic acid sequencing using bead emulsion PCR The following experiments were performed to test the effectiveness of bead emulsion PCR. In this protocol, 600,000 Sepharose beads with an average diameter of 25-35 μm (supplied by the manufacturer) were covalently attached to capture primers at a ratio of 30-50 million copies per bead. Beads covalently bound with capture primers were mixed with 1.2 million copies of the single-stranded adenovirus library. The library construct contained sequences complementary to the capture primers on the beads.</p><p> The adenovirus library was annealed into beads using the procedure described in Example 1. The beads were then resuspended in complete PCR solution. The PCR solution and beads were emulsified in twice the volume of rotating emulsion oil using the same procedure as described in Example 2 . The emulsified (encapsulated) beads were amplified by PCR as outlined in Example 3. The emulsion was broken as outlined in Example 4. DNA beads were single-strand and sequenced primers were annealed using the procedure of Example 5.</p><p> Next, using a pyrophosphate sequencer from 454 Life Sciences (New Haven, Connecticut), 70,000 beads were sequenced simultaneously by pyrophosphate sequencing (filed with the present application on June 6, 2003). See US Patent Application No. 60 / 476,592, "Methods for Amplifying and Sequencing Nucleic Acids," in a co-pending application by Lohman et al.). Multiple batches of 70,000 beads were sequenced and the data are shown in Table 6 below.</p><p> (Table 6)<img file="JP2010142233A_D0043.tif" /></p><p> This table shows the results of BLAST analysis comparing the adenovirus sequence with the sequence obtained from the pyrophosphate sequencer. The first column shows the error tolerance used in the BLAST program. The last column shows the true error, as determined by direct comparison with known sequences.</p><p>Beaded emulsion PCR for both-end sequencing Example 11: Template quality control As mentioned above, the success of the emulsion PCR reaction was found to be related to the quality of the single-strand template species. Therefore, the quality of the template material was evaluated by two different quality control measures before starting the emulsion PCR protocol. First, a portion of the single-strand template was analyzed with a 2100 BioAnalyzer (Agilient). RNA Pico Chip was used to confirm that the sample contained a heterogeneous population of fragments about 200-500 bases in size. Second, the library was quantified using the RiboGreen fluorescence assay on a Bio-Tek FL600 plate fluorometer. Samples with a DNA concentration of less than 5 ng / μl were considered to be too low to be used.</p><p>Example 12: Synthesis of DNA capture beads Beads packed in a 1 mL N-hydroxysuccinimide ester (NHS) -activated Sepharose HP affinity column (Amersham Biosciences, Piscataway, NJ) were removed from the column. Beads of size 30-25 μm were selected by continuously passing through 30 μm and 25 μm pore filter mesh sections (Sefar America, Depew, NY, USA). Beads that passed through the first filter but were retained in the second filter were collected and activated as described in the product literature (Amersham Pharmacia Protocol # 71700600AP). Template to amplify<img file="JP2010142233A_D0044.tif" />Two different amine-labeled HEG (hexaethylene glycol) long capture primers were obtained corresponding to the 5'end of the sense and antisense strands of. Primers are designed to capture both strands of the amplification product so that both ends sequencing, i.e., sequencing the first and second strands of the amplification product, is possible. The capture primer was dissolved in 20 mM phosphate buffer pH 8.0 to a final concentration of 1 mM. 3 μl of each primer was bound to the sieved 30-25 μm beads. The beads were then stored in bead storage buffer (50 mM Tris, 0.02% Tween and 0.02% sodium azide, pH 8). Beads were counted using a hemocytometer (Hausser Scientific, Horsham, PA, USA) and stored at 4 ° C until needed.</p><p>Example 13: Preparation and preparation of PCR reaction mixture As with all other single-strand molecule amplification techniques, contamination of the reaction with foreign amplicon or residual amplicon from other experiments can interfere with sequencing. To reduce the potential for contamination, the PCR reaction mixture was prepared in a UV-treated laminar flow hood in a PCR clean room. The following reagents were mixed in a 1.5 ml tube per 600,000 bead emulsion PCR reaction: 225 μl of reaction mixture (1X Platinum HiFi buffer (Invitrogen)), 1 mM dNTP, 2.5 mM DDL:₄ (Invitrogen), 0.1% BSA, 0.01% Tween, 0.003 U / μl Thermal Stability PPi-ase (NEB), 0.125 μM Forward Primer<img file="JP2010142233A_D0045.tif" />And 0.2 U / μl Platinum Hi-Fi Taq polymerase (Invitrogen). 25 μl of the reaction was removed and stored in a 200 μl PCR tube for use as a negative control. Both the reaction and the negative control were stored on ice until needed.</p><p>Example 14: Binding of template species to DNA capture beads Successful cloning DNA amplification for sequencing has been associated with delivering a controlled number of template species to each bead. In the experiments described below, a typical target template concentration was determined to be 0.5 template copy per captured bead. At this concentration, 61% of the beads have no template bound, 30% have one template bound, and 9% have two or more template bounds, according to the Poisson distribution. .. Delivery of excess template species results in the binding and amplification of mixed populations (two or more species) on a single bead, resulting in the loss of meaningful sequence data. However, if the number of species delivered is too small, the number of wells containing the template will be reduced (1 species per bead) and the coverage of sequencing will be reduced. Therefore, the concentration of the single-strand library template was considered to be important.</p><p> Template nucleic acid molecules were annealed to complementary primers on DNA capture beads in a UV-treated laminar flow hood by the following method. 600,000 DNA-capturing beads suspended in bead storage buffer (see Example 9 above) were transferred to a 200 μl PCR tube. The tube was centrifuged in a benchtop mini-centrifuge for 10 seconds, rotated 180 degrees, and then centrifuged for another 10 seconds to form a uniform precipitate. The supernatant was removed and the beads were washed with 200 μl annealing buffer (20 mM Tris, pH 7.5 and 5 mM magnesium acetate). The tube was vortexed for 5 seconds to resuspend the beads and precipitate the beads as described above. The bead supernatant was removed leaving only about 10 μl on the beads, and an additional 200 μl of annealing buffer was added. The beads were further vortexed for 5 seconds and allowed to stand for 1 minute to precipitate as described above. The supernatant was discarded leaving only 10 μl.</p><p> Next, 1.5 μl of the template library of 300,000 molecules / μl was added to the beads. The tube was vortexed for 5 seconds to mix the contents and the beads were annealed with a template by a controlled denaturation / annealing program performed in an MJ thermocycler. According to the program, incubate at 80 ° C for 5 minutes, lower to 70 ° C at 0.1 ° C / sec, incubate at 70 ° C for 1 minute, lower to 60 ° C at 0.1 ° C / sec, at 60 ° C. It was held for 1 minute, lowered to 50 ° C at 0.1 ° C / sec, held at 50 ° C for 1 minute, lowered to 20 ° C at 0.1 ° C / sec, and held at 20 ° C. After the annealing process was complete, the beads were removed from the thermocycler, centrifuged as described above, and the annealing buffer was carefully decanted. An average of 0.5 copies of single-stranded template DNA was attached to each of the captured beads, which was stored on ice until use.</p><p>Example 15: Emulsification The emulsification process produces a thermostable water-in-oil emulsion containing 10,000 separate PCR microreactors per μl. It serves as a substrate for clonal amplification of single molecules, individual molecules in the target library. The reaction solution and DNA capture beads for a single reaction were emulsified as follows. In a UV-treated laminar flow hood, 200 μl of PCR solution (from Example 10) was added to a tube containing 600,000 DNA capture beads (from Example 11). The beads were resuspended by repeated pipetting. The PCR bead mixture was then incubated at room temperature for at least 2 minutes to equilibrate the beads with the PCR solution. Simultaneously, add 450 μl of emulsion oil (4.5% (w: w) Span 80, 1% (w: w) Atlox 4912 (Uniqema, Delaware) in light oil (Sigma)) to a sterile 1/4 inch magnetic stir bar. Dispensed into a flat top 2 ml centrifuge tube (Dot Scientific) containing (Fischer). The Fisher then placed this tube in a custom plastic tube holding jig and set it to 450 RPM. Placed in the center of the Isotemp Digital Stirring Hot Plate (Fisher Scientific).</p><p> The PCR bead solution was vortexed for 15 seconds to resuspend the beads. The solution was then aspirated into a 1 ml disposable plastic syringe (Benton-Dickenson) with a plastic safety syringe needle (Henry Schein). The syringe was placed on a modified syringe pump (Cole-Parmer) with an aluminum base that points the pump vertically instead of horizontally (Figure 30). A tube of emulsion oil was placed on a stirring plate, centered under the plastic syringe needle, allowing the magnetic stirring bar to rotate properly. The syringe pump was set to inject 0.6 ml at 5.5 ml / hr. The PCR bead solution was added drop by drop to the emulsion in oil. Care was taken to prevent the droplets from touching the sides of the tube as they fell into the rotating oil.</p><p> Once the emulsion was formed, care was taken to reduce agitation of the emulsion during both the emulsification process and the post-emulsification dispensing step. It has been found that vortex agitation, fast pipetting, or excessive mixing destroys the emulsion and destroys the individual microreactors. In forming the emulsion, the two solutions became a mayonnaise-like viscous, milky white uniform mixture. The contents of the syringe were added to the rotating oil. The emulsion tube was then removed from the holding jig and gently flicked with the index finger until the residual oil layer at the top of the emulsion disappeared. The tube was returned to the holding jig and stirred with a magnetic stir bar for an additional minute. The stir bar was removed from the emulsion by moving a magnetic recovery tool along the outside of the tube and the stir bar was discarded.</p><p> Using a P100 pipettor, 20 μl of emulsion was removed from the center of the tube and placed on a microscope slide. Larger pipette tips were used to reduce shear. The emulsion was observed at a magnification of 50X and confirmed to be composed primarily of single beads in a microreactor of PCR solution with a diameter of 30-150 microns in oil (Fig. 33). After visual inspection, the emulsion was immediately amplified.</p><p>Example 16: Amplification The emulsion was dispensed into 7-8 separate PCR tubes. Each tube contained approximately 75 μl of emulsion. The tube was sealed and placed in an MJ thermocycler with the 25 μl negative control described above. The following cycle times were used: 1 cycle of 4-minute incubation at 94 ° C (hot start), 30 cycles of incubation at 94 ° C for 30 seconds and 150 seconds at 68 ° C (amplification), and 94 ° C. 40 cycles of incubation at 30 seconds and 360 seconds at 68 ° C (hybridization and elongation). After completion of the PCR program, the tube was removed and the emulsion was destroyed immediately or the reaction was stored at 10 ° C for up to 16 hours until the start of the destruction process.</p><p>Example 17: Emulsion destruction and bead recovery After amplification, emulsion breakdown (separation of oil and aqueous layers) was inspected. The unbroken emulsions were placed in a total of 1.5 ml microcentrifuge tubes and the occasionally seen broken emulsions were discarded. The viscosity of the emulsion sample was so high that a significant amount remained in each PCR tube. The emulsion remaining in the tubes was recovered by adding 75 μl of mineral oil to each PCR tube and pipetting the mixed solution. This mixture was added to a 1.5 ml tube containing most of the emulsifying material. Then, the 1.5 ml tube was vortex-stirred for 30 seconds. The tube was then centrifuged in a benchtop microcentrifuge at 13.2 Krpm (maximum speed) for 20 minutes.</p><p> After centrifugation, the emulsion separated into two layers with a large white interface. The clear oil layer at the top was discarded and the material at the turbid interface was left in the pipe. Within the chemical fume hood, 1 ml of hexane was added to the lower and interfacial layers. The mixture was vortexed for 1 minute and centrifuged at the maximum speed of a benchtop microcentrifuge for 1 minute. The upper oil / hexane layer was removed and discarded. The remaining aqueous layer, interface, and beads were then added with 1 ml of 80% ethanol / 1X annealing buffer. The mixture was vortexed for 1 minute or until the white material at the interface was dissolved. The sample was then centrifuged at the maximum speed of a benchtop microcentrifuge for 1 minute. The tube was rotated 180 degrees and centrifuged for an additional minute. The supernatant was carefully removed without disturbing the bead precipitation.</p><p> The white bead precipitate was washed twice with annealing buffer containing 1 ml 0.1% Tween 20. The wash liquor was discarded and the beads were precipitated for each wash as described above. The precipitate was washed with 1 ml Picopure water. The beads were precipitated by the centrifugation-rotation-centrifugal method used above. The water layer was carefully removed. The beads were then washed with 1 ml of 1 mM EDTA in the same manner as above, except that the beads were lightly vortexed for 2 seconds in an intermediate setting prior to precipitation and removal of the supernatant.</p><p> The amplified DNA immobilized on the capture beads was treated to obtain single-stranded DNA. The second strand was removed by incubation in a basic melting solution. Then 1 ml of melting solution (0.125 M NaOH, 0.2 M NaCl) was added to the beads. The precipitate was resuspended by vortex agitation for 2 seconds in an intermediate setting and the tube was placed on a Thermolyne Lab Quake tube roller for 3 minutes. The beads were then precipitated as described above and the supernatant was carefully removed and discarded. The remaining melting solution was neutralized by adding 1 ml of annealing buffer. The beads were then vortexed for 2 seconds at an intermediate rate. The beads were precipitated as described above and the supernatant was removed. Similarly, washing with annealing buffer was repeated, except that only 800 μl of annealing buffer was removed after centrifugation. The beads and the remaining annealing buffer were transferred to a 0.2 ml PCR tube. The beads were used immediately or stored at 4 ° C for up to 48 hours before proceeding to the concentration process.</p><p>Example 18: Concentration of any beads The bead mass contained beads with amplified and fixed DNA strands, and empty or invalid beads. As mentioned above, 61% of the beads were calculated to have no template DNA during the amplification process. Concentration was used to selectively isolate beads with template DNA and maximize sequencing efficiency. The enrichment process is described in detail below.</p><p> The single chain beads obtained from Example 14 were precipitated by a centrifugal-rotation-centrifugal method and as much supernatant as possible was removed without disturbing the beads. Add 15 μl annealing buffer to the beads, followed by 100 μM biotinylated 40-base concentrated primer.<img file="JP2010142233A_D0046.tif" />Was added in an amount of 2 μl. Primers were complementary to the bound amplification and sequence sites (20 bases long each) at the 3'end of the template immobilized on the beads. The solutions were mixed by vortex agitation for 2 seconds in an intermediate setting and the concentrated primers were annealed to the immobilized DNA strand using a controlled denaturation / annealing program in the MJ thermocycler. The following cycle times and temperatures were used in the program: Incubate at 65 ° C for 30 seconds, decrease to 58 ° C at 0.1 / sec, Incubate at 58 ° C for 90 seconds, and hold at 10 ° C.</p><p> The Dynal MyOne streptavidin beads were gently agitated and resuspended while the primers were annealing. Next, 20 μl of MyOne beads were added to a 1.5 ml microcentrifuge tube containing 1 ml of augmented solution (2 M NaCl, 10 mM Tris-HCl, 1 mM EDTA, pH 7.5). The MyOne bead mixture was vortexed for 5 seconds and the tube was placed in a Dynamic MPC-S magnet. Paramagnetic beads settled on the side of the microcentrifuge tube. The supernatant was carefully removed and discarded without disturbing the MyOne beads. The tube was removed from the magnet and 100 μl of augmentation solution was added. The tube was vortexed for 3 seconds to resuspend the beads and stored on ice until needed.</p><p> When the annealing program was completed, 100 μl of annealing buffer was added to the PCR tube containing the DNA capture beads and concentrated primers. The tube was vortexed for 5 seconds and the contents were transferred to a new 1.5 ml microcentrifuge tube. The PCR tube used for annealing the concentrated primers to the capture beads was washed once with 200 μl annealing buffer, and the wash solution was added to the 1.5 ml tube. The beads were washed 3 times with 1 ml annealing buffer, vortexed for 2 seconds and precipitated as above. The supernatant was carefully removed. After the third wash, the beads were washed twice with 1 ml ice-cooled augmentation solution. The beads were vortexed and precipitated in the same manner as above, and the supernatant was removed. The beads were resuspended in 150 μl ice-cooled augmentation solution and the bead solution was added to the washed MyOne beads.</p><p> The bead mixture was vortexed for 3 seconds and incubated on a LabQuake tube roller for 3 minutes at room temperature. MyOne beads coated with streptavidin were attached to biotinylated concentrated primers annealed to a template immobilized on DNA capture beads. The beads were then centrifuged at 2,000 RPM for 3 minutes and then vortexed with a 2 second pulse until the beads were resuspended. The resuspended beads were allowed to stand on ice for 5 minutes. Then 500 μl of chilled augmentation solution was added to the beads and the tube was placed in a Dynal MPC-S magnet. The beads were allowed to stand for 60 seconds and settled with a magnet. The supernatant containing excess MyOne and invalid DNA capture beads was then carefully removed and discarded.</p><p> The tube was removed from the MPC-S magnet and 1 ml of cooled augmentation solution was added to the beads. The beads were gently flicked and resuspended. It is important not to vortex the beads at this point, as strong mixing can break the bond between MyOne and the DNA capture beads. The beads were returned to the magnet and the supernatant was removed. This wash was repeated 3 more times to ensure that all invalid trapped beads were removed. To remove the annealed concentrated primer and MyOne beads, the DNA capture beads were resuspended in 400 μl of thawing solution, vortexed for 5 seconds and precipitated with a magnet. The supernatant containing the concentrated beads was transferred to another 1.5 ml microcentrifuge tube. An additional 400 μl of thawing solution was added to the tube containing MyOne beads to maximize recovery of the concentrated beads. The beads were vortexed and precipitated in the same manner as described above. The supernatant obtained from the second wash was removed and combined with the first concentrated bead mass. The used MyOne bead tube was discarded.</p><p> A microcentrifuge tube of concentrated DNA capture beads was placed on a Dynal MPC-S magnet to precipitate the remaining Dynal MyOne beads. The concentrated beads of the supernatant were transferred to a second 1.5 ml microcentrifuge tube and centrifuged. The supernatant was removed and the beads were washed 3 times with 1 ml annealing buffer to neutralize the remaining melting solution. After the third wash, 800 μl of supernatant was removed and the remaining beads and solution were transferred to a 0.2 ml PCR tube. The concentrated beads were centrifuged at 2,000 RPM for 3 minutes and the supernatant was decanted. Then 20 μl annealing buffer and two different 100 μM sequencing primers<img file="JP2010142233A_D0047.tif" />Was added in an amount of 3 μl. The tube was vortexed for 5 seconds, placed in an MJ thermocycler and subjected to the following 4-step annealing program: incubation at 65 ° C for 5 minutes, reduction to 50 ° C at 0.1 ° C / sec, 1 at 50 ° C. Minute incubation, down to 40 ° C at 0.1 ° C / sec, hold at 40 ° C for 1 minute, down to 15 ° C at 0.1 ° C / sec, hold at 15 ° C.</p><p> After the annealing program was completed, the beads were removed from the thermal cycler and centrifuged for 10 seconds to precipitate. The tube was rotated 180 degrees and centrifuged for an additional 10 seconds. The supernatant was decanted and discarded, and 200 μl of annealing buffer was added to the tube. The beads were resuspended by vortex stirring for 5 seconds and precipitated in the same manner as described above. The supernatant was removed and the beads were resuspended in 100 μl annealing buffer. At this point, beads were quantified using a Multisizer 3 Coulter Counter (Beckman Coulter). The beads were stored at 4 ° C and were stable for at least a week.</p><p>Example 19: Double-stranded sequencing Two different sequencing primers are used for double-stranded sequencing. Unmodified primer MMP7A and 3'phosphorylated primer MMP2Bp. There are multiple steps in this process. This process is schematically shown in FIG.</p><p> 1. Sequencing the first strand: Sequencing the first strand involves extending the unmodified primer with DNA polymerase by sequentially adding nucleotides during a predetermined number of cycles. 2. Capping: Run a capping buffer containing 25 mM tricine, 5 mM magnesium acetate, 1 mM DTT, 0.4 mg / ml PVP, 0.1 mg / ml BSA, 0.01% Tween, and 2 μM each dideoxynucleotide and 2 μM each deoxynucleotide. Stopped the first strand sequencing. 3. Cleaning: Residual deoxynucleotides by flushing into an apillase buffer containing 25 mM tricine, 5 mM magnesium acetate, 1 mM DTT, 0.4 mg / ml PVP, 0.1 mg / ml BSA, 0.01% Tween and 8.5 units / L of apillase. And dideoxynucleotides were removed. 4. Cleavage: Non-blocking of the second blocking primer by removing phosphate groups from the 3'end of the modified 3'phosphorylating primer by running a cleavage buffer containing 5 units / ml calf intestinal phosphatase. did. Five. Continuation: The second non-blocking primer was activated by adding the polymerase by running 1000 units / ml of DNA polymerase to capture all available primer sites. 6. Sequencing the second strand: Sequencing the second strand with DNA polymerase by sequential addition of nucleotides for a predetermined number of cycles.</p><p> The genomic DNA of Staphylococcus aureus was sequenced using the method described above. The results are shown in Fig. 39. A total of 31,785 readings were obtained based on 15770 readings of the first strand and 16015 readings of the second strand. Of these, a total of 11,799 readings were paired, 8187 readings were unpaired, and a total coverage rate of 38% was obtained.</p><p> The reading length ranged from 60 to 130, with an average of 95 ± 9 bases (Fig. 40). The distribution of genome lengths and the number of wells for each genome length are shown in FIG. A representative sequence from this genome sequencing is shown in FIG.</p><p>Example 20: Template PCR 30 μm NHS Sepharose beads were bound to 1 mM each of the following primers.<img file="JP2010142233A_D0048.tif" /> Drive-to-bead PCR was performed in tubes on an MJ heat cycler by adding 50 μl of washed primer-bound beads to the PCR master mixture in a 1: 1 volume ratio. PCR master mixture 1 x PCR buffer; 1 mM each dNTP; 0.625 μM primer MMP1A; 0.625 μM primer MMP1B; 1 unit / μl 1 μl of HiFiTaq (Invitrogen, San Diego, CA); and It contained 5-10 ng of template DNA (DNA to be sequenced).</p><p> The PCR reaction was performed by programming the MJ heat cycler as follows: Incubation at 94 ° C for 3 minutes; Incubation at 94 ° C for 30 seconds, 58 ° C for 30 seconds, 68 ° C for 30 seconds. 39 cycles; followed by 10 cycles of incubation at 94 ° C for 30 seconds and 58 ° C for 10 minutes; 30 seconds at 94 ° C, 30 seconds at 58 ° C, 30 seconds at 68 ° C; and 10 cycles. Storage at ° C.</p><p>Example 21: Annealing of template DNA preparation and sequencing primers The beads from Example 1 were washed twice with distilled water, once with 1 mM EDTA and incubated with 0.125 M NaOH for 5 minutes. This removed the DNA strands that were not bound to the beads. The beads were then washed once with 50 mM Tris acetate buffer and twice with annealing buffer (200 mM Tris acetic acid, 50 mM Mg acetate, pH 7.5). Next, sequencing primers<img file="JP2010142233A_D0049.tif" />500 picomols were added to the beads. Primers were annealed on an MJ heat cycler according to the following program: Incubate at 60 ° C for 5 minutes; Temperature drop to 50 ° C at a rate of 0.1 ° C per second; Incubate at 50 ° C for 5 minutes; Incubate per second. Temperature drops to 4 ° C at a rate of 0.1 ° C; 5 minutes incubation at 40 ° C; Temperature drops to 10 ° C at a rate of 0.1 ° C per second. Templates were then sequenced by standard pyrophosphate-based sequencing.</p><p>Example 22: Sequencing and Stopping of First Strand The beads were rotated at 3,000 rpm for 10 minutes and placed in a 55 μm picotiter plate (PTP). The PTP was placed on the rig and ran for a predetermined number of cycles in the new sequencing. Sequencing was stopped by capping the first strand. 1 x AB (50 mM Magnesium Acetate, 250 mM Tricin) 100 μl, 1000 Units / ml BST Polymerase, 0.4 mg / ml Single Strand DNA Binding Protein, 1 mM DTT, 0.4 mg / ml PVP (Polyvinylpyrrolidone), 10 μM ddNTPs, and The first strand was capped by adding each 2.5 μM dNTP. The apillase was then run by adding 1 × AB, 0.4 mg / ml PVP, 1 mM DTT, 0.1 mg / ml BSA, 0.125 units / ml apillase to remove excess nucleotides and incubated for 20 minutes.</p><p>Example 23: Preparation of second strand for sequencing The second strand was deblocked by the addition of 1 × AB 100 μl, 0.1 units / ml polynucleotide kinase, 5 mM DTT. The resulting template was sequenced using standard pyrophosphate-based sequencing (eg, described in US Pat. Nos. 6,274,320, 6,258,568 and 6,210,891, which are incorporated herein by reference). .. The results of the sequencing method can be seen in FIG. 10F, where the 174 bp fragment was sequenced at both ends by the pyrophosphate-based sequencing method and the methods described in these examples.</p><p>Example 24: Sequence Analysis of Nucleic Acids on Picotiter Plates A picotiter plate containing the amplified nucleic acid as described in Example 2 is placed in the perfusion chamber. The sulfylase, apillase and luciferase are then delivered to the picotita plate.</p><p> Sequencing primers prepared for DNA synthesis and extended into inserts that appeared to have polymorphisms as shown in FIGS. 11A-11D. The sequencing primer was first extended by sequentially delivering a wash solution, DNA polymerase, and one of dTTP, dGTP, dCTP or α-thiodATP (dATP analog) into the perfusion chamber. Terminally attached sulfylase, luciferase and apillase converted PPi released as part of the sequencing reaction into detectable light. The existing apyrase degrades unreacted dNTPs. Typically, a CCD camera attached to a fiber imaging bundle collects light for 3 seconds (but 1-100 seconds, eg 2-10 seconds is also appropriate), after which additional wash solution is added to the perfusion chamber. To remove excess nucleotides and by-products. The next nucleotide is then added with the polymerase, thereby repeating the cycle.</p><p> During cleaning, the collected light image is sent from the CCD camera to the computer. The luminescence is analyzed by computer and used to determine if the corresponding dNTP was incorporated into the extended sequencing primer. Addition of dNTP and pyrophosphate-based sequencing agents is repeated until a sequence of insert regions containing possible polymorphisms is obtained.</p><p>Example 25: PCR Amplification on Picotiter Plate Picotiter plate preparation: In a further embodiment, the single-stranded library attached to the beads is distributed directly on the picotiter plate and then the nucleic acid template on each bead is amplified (PCR or other known amplification). (Using technology) to generate sufficient copy number templates, which generate detectable signals in the pyrophosphate-based sequencing methods disclosed herein.</p><p>Example 26: Sequence Analysis of Nucleic Acids on PTP The reagents used for sequence analysis and as controls had four nucleotides and made 0.1 μM pyrophosphate (PPi) in substrate solution. Substrate solutions are referred to as a mixture of 300 μM luciferin and 4 μM adenosine 5'phosphosulfate (APS), which are substrates for a cascade of reactions involving PPi, luciferase, and sulfylase. Substrate was made in assay buffer. The concentration of PPi used to test the enzyme and determine the background level of the reagent passing through the chamber was 0.1 μM. The concentrations of nucleotides dTTP, dGTP, and dCTP were 6.5 μM, and the concentration of αdATP was 50 μM. Each of the nucleotides was mixed with the DNA polymerase Klenow at a concentration of 100 U / mL.</p><p> The PTP was placed in the flow chamber of the embodied device and the flow chamber was attached to the face plate of the CCD camera. The PTP was washed by circulating the substrate (3 ml per minute, 2 minutes) through the chamber. The reagent sequences were then circulated through the chamber by a pump connected to an actuator with tubes inserted into different reagents programmed to switch positions. Reagent sequences, flow rates and flow times were determined. The camera was set to a quick shooting mode with an exposure time of 2.5 seconds.</p><p> The signal output from the pad was determined as the average of the number of all pixels in the pad. The number of frames is the equivalent time elapsed during the experiment. Graphical representation of different reagent flows.</p><p>Example 27: Plate-based platform for picolitre-scale PCR reaction Materials and methods Unless otherwise noted, all common laboratory chemicals were purchased from Sigma (Sigma-Aldrich Corporation, St. Louis, MI) or Fisher (Fisher Scientific, Pittsburgh, PA).</p><p> PicoTiter Plates (25 × 75 × 2 mm) was made by anisotropic etching of fiber optic faceplates in a manner similar to that described above (Pantano, P. and Walt, DR, Chemistry of Materials 1996, 8). , 2832-2835). Plates were etched at three different microwell depths of 26, 50, and 76 μm. The center-to-center spacing of the microwells is 50 μm, the well diameters are 39-44 μm (see Figure 14), and the calculated well density is 480 wells / mm.²Met.</p><p> Solid-phase immobilization of oligonucleotide primers: 1 ml NHS activated Sepharose packaging beads from an HP affinity column (Amersham Biosciences, Piscataway, NJ) are removed from the column and activated according to the manufacturer's instructions (Amersham Pharmacia Protocol # 71700600AP). did. 1 mM amine-labeled HEG capture primer in 20 mM phosphate buffer (pH 8.0)<img file="JP2010142233A_D0050.tif" />25 μl was bound to the beads. Beads of 36-25 μm were then selected by sequentially passing through 36 and 25 μm pore filter mesh sections (Sefar America, Depew, NY). DNA capture beads that passed through the first filter but were retained in the second filter were collected in bead storage buffer (50 mM Tris, 0.02% Tween, 0.02% sodium azide, pH 8) and collected on a blood cell calculator (Hausser Scientific). , Horsham, PA) and stored at 4 ° C until needed.</p><p> Generation of test DNA fragments: Amplified test fragments were derived from the commercially available adenovirus serotype 5 vector pAdEasy (Stratagene, La Jolla, CA). Fragments were amplified using dual PCR primers, the 5'end containing a 20 base amplification region and a 20 base 3'section that was complementary to a particular region of the adenovirus genome. Using these primers, two fragments were amplified from positions 12933-13070 and 5659-5767 of the adenovirus genome and labeled Fragment A and Fragment B, respectively.</p><p> The sequences of the forward and reverse primers for Fragment A are shown below. A slash (/) indicates the separation between the two regions of the primer.<img file="JP2010142233A_D0051.tif" />Primers for Fragment B include:<img file="JP2010142233A_D0052.tif" /></p><p> The reaction conditions are 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl.₂, 0.2 mM dNTP, 1 μM each forward and reverse primer, 0.1 U / μl Taq (Promega, Madison, WI) and 50 nanomolar template DNA. Both templates were amplified in a PCR program containing 35 cycles of incubation at 94 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 ° C for 90 seconds. Using PCR primers, the total length of the amplified fragments was 178 bp for fragment A and 148 bp for fragment B.</p><p> To generate a fluorescent probe, a biotinylated double-stranded fluorescent probe was prepared by PCR amplification from the pAdEasy vector as described above. However, the primer sequence was changed to prevent hybridization between the test fragment and the probe primer region. In addition, the reverse primers for both fragments utilized 5'biotin and the subsequent 3x hexaethylene glycol spacer to immobilize the product on the beads prior to elution of the single-stranded probe.</p><p> The sequence for the forward primer for the fluorescent fragment A probe was as follows. A slash (/) indicates the separation between the two regions of the primer.<img file="JP2010142233A_D0053.tif" />The sequence for the reverse primer is<img file="JP2010142233A_D0054.tif" />Met. The primers for fragment B were as follows.<img file="JP2010142233A_D0055.tif" /></p><p> The fluorescent moiety was incorporated via a nucleotide mixture. It contained 0.2 mM dATP / dGTP / dCTP, 0.15 mM TTP and 0.05 mM Alexa Fluor 488-dUTP (Molecular Probes, Eugene, OR) for fragment A. Alternatively, 0.2 mM dATP / dGTP / TTP, 0.15 mM dCTP and 0.05 mM Alexa Fluor 647-dCTP (Molecular Probes, Eugene, OR) were used for amplification of fragment B. Fluorescent products, QIAquick PCR Purification Kit (Qiagen, Valencia, Purified by CA). Biotinylated DNA was subsequently added to 100 μl (approximately 8,100,000) Streptavidin Sepharose High Performance beads (Amersham Biosciences) in 1 × binding wash (5 mM Tris HCl, pH 7.5, 1 M NaCl, 0.5 mM EDTA, 0.05% Tween-20). ) For 2 hours at room temperature. After incubation, the beads were washed 3 times in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and incubated with 250 μl melting solution (0.125N NaOH / 0.1M NaCl) for 2 minutes to single chain from the beads. The probe was released.</p><p> The beads were centrifuged in a benchtop centrifuge for a short period of time to pelletize, and the supernatant was neutralized with 1.9 μl glacial acetic acid in 1.25 ml of buffer PB (Qiagen). The mixture was purified on a QiaQuick column (Qiagen) and the concentration of the purified probe was determined by TaqMan quantification using a BioRad iCycler (BioRad, Hercules, CA).</p><p> Solution phase PTPCR was performed as follows. The PCR reaction mixture was loaded into individual wells of a single 14 mm x 43 mm PicoTiter Plate . To this end, PCR reaction mixture (1 x Platinum HiFi buffer (Invitrogen, Carlsbad, CA), 2.5 mM DDL₄, 0.5% BSA, 1mM dNTP (MBIFermentas, Hanover, MD),<img file="JP2010142233A_D0056.tif" />5 calculated copies of primer, 0.05% Tween-80, 1 U / μl Platinum HiFi Fidelity DNA Polymerase (Invitrogen), 0.003 U / μl thermostable pyrophosphatase (USB, Cleveland, OH), and fragment B template per well ) 500 μl was combined in a 1.5 ml microcentrifuge tube. The tubes were fully vortexed and stored on ice until the PicoTiter Plate filled cartridge was assembled.</p><p> A homemade (in-house) PicoTiterPlate filled cartridge was attached to the PicoTiterPlate using two plastic clips and a silicon cartridge gasket was firmly laid on the PicoTiterPlate surface (see Figure 20). The PCR reaction mixture was drawn into a 1 ml disposable syringe and the mouth of the syringe was inserted into the filling tube of the filling cartridge. The filling cartridge was placed at the end so that the charging port was oriented to the bottom of the cartridge, and the PCR mixture was slowly filled into the chamber. During filling, inspection was performed through the clear back of PicoTiterPlate to ensure bubble-free delivery.</p><p> After filling, the PCR mixture was incubated for 5 minutes, at which point the reaction mixture was withdrawn from the PicoTiter Plate filled cartridge. The PicoTiterPlate was removed from the filling cartridge and immediately placed in the amplification chamber (see Figure 21). The PicoTiterPlate surface was covered with a 0.25 mm thick Silpad A-2000 silicon sheet (The Bergquist Company, Chanhassen, MN). A 25 mm x 75 mm standard glass microscope slide (Fisher) was placed on this top. A closed cell foam insulation pad (Wicks Aircraft Supply, Highland, IL) was placed on the top of the microscope slide. An aluminum lid was attached to the base of the chamber with six 25 mm bolts to seal the amplification chamber.</p><p> Once sealed, the amplification chamber was placed on a Thermal cycler MJ PTC225 Tetrad (MJ Research, Waltham, MA) equipped with a Flat Block Alpha Unit. The amplification program was incubated at 94 ° C for 3 minutes (Hotstart Initiation), followed by 40 cycles of 94 ° C for 12 seconds, 58 ° C for 12 seconds, 68 ° C for 12 seconds, and the final 10 °. Included maintenance at C. After completion of the PCR program, PicoTiterPlate was removed from the amplification chamber and the filled cartridge was reattached. H cartridge chamber using a disposable syringe₂It was filled with 1 ml of O and incubated at room temperature at 10 ° C for 20 minutes.</p><p> After completion of the incubation, the recovered solution was withdrawn from the filled cartridge and transferred to a 1.5 ml microcentrifuge tube. PCR products were quantified using the iCycler RealTime PCR unit (BioRad) and FAM-labeled reporter probes (Epoch Biosciences, Bothell, WA). TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) was combined with 0.3 μM forward and reverse primers, 0.15 μM FAM-labeled probe, and 27 μl of the reaction mixture was added to each well of a 96-well PCR plate.</p><p> Standard curve (1 x 10 per well) using purified fragments⁹~1×10⁴Formed (running in triads) (six standards of molecular range). PCR amplification was performed with the following parameters: 60 cycles of incubation at 94 ° C for 5 minutes (start of hot start), and incubation at 94 ° C for 15 seconds, 68 ° C for 45 seconds, at the final 4 ° C. Maintain. Data were analyzed using iCycler Optical Systems Software Version 2.3 (BioRad) and PCR yields were quantified using iCycler data and Microsoft Excel (Microsoft, Redmond, WA).</p><p> Solid phase PTPCR was performed in the same manner as solution phase PTPCR, except that the PicoTiterPlate wells were filled with DNA capture beads prior to amplification by centrifugation as described below. In addition, after bead deposition was complete, the PCR mixture was filled into microwells. To facilitate retention of trapped beads during the washing process, solid phase experiments utilized a PicoTiter Plate with a depth of 50 μm. PicoTiterPlate was placed in a homemade reticulated glass bead-filled jig. This is the PicoTiterPlate shown in FIG. 20, except that the PicoTiterPlate is sandwiched between a bottom reticulated glass plate and a jig top plate containing inlets and outlets and sealed via a silicon gasket with plastic screws. Similar to a filling jig.</p><p> Template DNA was pre-annealed to DNA-capturing beads as 5 template copies per bead by incubation at 80 ° C for 3 minutes, after which the beads were cooled to room temperature in 15 minutes. The beads were then placed in PicoTiterPlate wells prior to filling with the PCR reaction mixture. A bead-filled buffer (450 μl; 1 × Platinum HiFi PCR buffer (Invitrogen), 0.02% Tween-80) containing 100,000 Sepharose DNA capture beads (approximately 1 bead per 3 PicoTiter Plate wells). The jig was injected with a pipette through one of the inlets. The holes at each inlet were then sealed with an annular adhesive pad (3M VHS, St. Paul, MN). The jig held the PicoTiterPlate with its wells facing up and covered with a bead suspension. This was done with an Allegra 6 centrifuge (Beckman Coulter, Fullerton,) using a Microtiter Rotor. In CA), the mixture was centrifuged at 2000 rpm for 5 minutes at room temperature.</p><p> After centrifugation, PicoTiterPlate was removed from the jig. The PCR reaction mixture was loaded onto a PicoTiter Plate as described for solution phase PCR. However, the solid phase PCR mixture omitted the template as the template was pre-annealed to the DNA capture beads. The solid phase PCR amplification program included an additional hybridization / extension cycle to compensate for the slow reaction rate of the immobilized primers. The program consisted of 40 cycles of incubation at 94 ° C for 3 minutes to start the hot start, and incubation at 94 ° C for 12 seconds, 58 ° C for 12 seconds, 68 ° C for 12 seconds, followed by hybridization. And included 10 cycles of incubation at 94 ° C for 12 seconds, 68 ° C for 10 minutes, and maintenance at the final 10 ° C for elongation.</p><p> Upon completion of the PCR program, PicoTiterPlate was removed from the amplification chamber as described for solution phase PCR and H₂Washed with 1 ml of O. Next, PicoTiterPlate was prepared for hybridization detection of fixed PCR products.</p><p> Hybridization was performed using a fluorescently labeled probe as follows. After PTPCR was completed, strands complementary to the fixed strand were removed. To this end, the entire PicoTiterPlate was incubated in 0.125M NaOH for 8 minutes at room temperature. The solution was neutralized with two 5-minute washes in 50 ml of 20 mM Tris acetic acid (pH 7.5). The PicoTiterPlate was then placed in a custom 800 μl hybridization chamber and the hybridization buffer (3.5 × SSC, 3.0% SDS, 20 × SSC buffer was 3M NaCl, 0.3M Na citrate).₃Was shut off at 65 ° C for 30 minutes. The contents of the chamber were replaced with a new hybridization buffer containing a probe, 20 nM fluorescent fragment A (Alexa-488) and fragment B (Alexa-647). Probes were hybridized to those targets. Incubation was performed at 65 ° C. for 4 hours with shaking at 200 RPM on an orbital oscillator (Barnstead International, Dubuque, IA).</p><p> After hybridization, PicoTiterPlate was washed with 2 x SSC, 0.1% SDS at 37 ° C for 15 minutes, followed by washing in 1 x SSC at 37 ° C for 15 minutes, and finally in 0.2 x SSC. Was washed twice at 37 ° C for 15 minutes. Following post-hybridization washing, PicoTiterPlate was air dried, placed in a FLA-8000 Fluorescent Image Analyzer (Fujifilm Medical Systems USA, Stamford, CT) and scanned at wavelengths 635 nm and 473 nm. The resulting 16-bit tiff image was imported into Genepix 4.0 (Axon Instruments, Union City, CA). Blocks of 100 analytical features were led to the region of interest and 635 and 473 fluorescence intensities were recorded for each feature. The data was then exported to Microsoft Excel for further analysis.</p><p> Control beads were prepared as follows. Biotinylated test templates A and B were prepared from the pAdEasy vector by PCR amplification, purified, immobilized on Streptavidin Sepharose High Performance beads, and strands separated as described in "Preparing Fluorescent Probes". However, the fluorescently labeled dNTP was omitted in the PCR reaction. The pelleted beads were washed 3 times with TE buffer and stored in TE at 4 ° C until deposited on PicoTiterPlate .</p><p>result Solution phase amplification was demonstrated by filling the PicoTiterPlate with a PCR master mixture containing 5 template copies calculated per PicoTiterPlate well. The reactions were performed in duplicate on PicoTiter Plates with wells at depths of 26, 50 and 76 μm. 40 cycles of PTPCR amplification were performed as described in the Materials and Methods section. Incorporating additives prevented the harmful surface effects commonly reported in silica reaction vessels (Kalinina, O., et al., Nucleic Acids Res. 1997, 25, 1999-2004; Wittwer, CTand Garling, DJ, Biotechniques 1991, 10, 76-83; Taylor, TB, et al., Nucleic Acids Res. 1997, 25, 3164-3168).</p><p> The inclusion of 0.5% BSA and 0.05% Tween-80 in the reaction mixture is not only effective in reducing the surface effect, but also facilitates amplification. Reducing the relative concentration of either reagent had a negative effect on amplification. In addition, the polymerase inactivating properties of the silica surface<img file="JP2010142233A_D0057.tif" />Therefore, a high Taq concentration was found to be advantageous. Concentrations above 1 U / μl were optimal for improving amplicon yield.</p><p> Following PTPCR, solutions from each PicoTiterPlate were collected and three samples of each solution were quantified by the TaqMan assay. Standard curve of diluted template (1x10)⁹~10⁴Linear from the molecule, r²The concentration of the amplified product was determined using = 0.995). The number of amplified molecules per well was obtained by dividing the amount of amplification product by the total number of wells (372,380) in the PicoTiter Plate . The amount of amplification per well was calculated by dividing this number by the initial template concentration per well. PTPCR amplification was successful in all of PicoTiterPlate with yields of 2.36 × 10 in 39.5 pl wells.⁶1.28 × 10 in double to 50 pl well⁹Double range (see table below).</p><p><img file="JP2010142233A_D0058.tif" /></p><p> The table shows PicoTiterPlate PCR amplification as determined by the TaqMan assay. The values reflect three measurements obtained from two picotita plates. (N = 6); SD = standard deviation.</p><p> Yield is affected by well volume. Concentration of final product obtained for wells at a depth of 50 μm (1.4 × 10)^-4M) is the concentration obtained for wells at a depth of 76 μm (6.54 × 10).^-5Significantly greater than M) (p-value for ANOVA = 0.023), both concentrations obtained for wells at a depth of 26 μm (4.96 × 10)^-7The magnification is two orders of magnitude larger than M). The yield of microwells at a depth of 50 μm showed the optimal balance between the costs and benefits associated with low volume PCR. In this case, a maximum increase in effective concentration and a low thermal mass of the reagent are obtained, but the surface-to-volume ratio is still sufficiently low to prevent harmful surface effects from significantly reducing amplification efficiency.</p><p> Final concentration of PTPCR product obtained in each of the wells of different depths (4.96 × 10)^-7~1.4×10^-4M) is typically reported as the maximum value that can be achieved before the PCR Plateau effect occurs10^-8The concentration of M was exceeded (Sardelli, A., Amplifications 1993, 9, 1-5). The high effective concentration of primer and template molecules resulting from the low microwell volume increased the overall reaction efficiency and delayed the initiation of the plateau phase until high molar yields were obtained. Alternatively, this effect was caused by the high concentration of Taq used in the PTPCR reaction (Kainz, P., Biochim. Biophys. Acta), as high polymerase concentrations were also shown to be effective in delaying the Plateau effect (Kainz, P., Biochim. Biophys. Acta). 2000, 1494, 23-27; Collins, FS, et al., Science 2003, 300, 286-290). Amplification efficiencies at 40 cycles were 44.3%, 68.9% and 67.5% for wells at depths of 26, 50 and 76 μm, respectively, providing high final concentrations of amplicon. The highest yields were observed in wells at a depth of 50 μm. However, it should be understood that the number of cycles has not been optimized and similar amplification yields can be achieved in much fewer cycles, thereby increasing the effectiveness of PTPCR amplification. ..</p><p> Experimental techniques for clonal solid phase PTPCR, starting with a single valid copy of a single-stranded DNA fragment and ending with a specific bead-fixed DNA amplicon detected by fluorescent probe hybridization, are shown in FIG. 22 and detailed below. Explain to.</p><p> Step 1: Each PicoTiterPlate well is a single-stranded template molecule (single-stranded as shown here, annealed to DNA capture beads or free to move in solution), forward in solution "F". (Red) and reverse R (blue) primers, and R primers attached to DNA capture beads, a PCR reaction mixture consisting of these. Solution phase primers are present in an 8: 1 molar ratio with excess F primer. Arrows indicate 5' 3'DNA orientation.</p><p> Step 2: The initial thermal cycle denatures the DNA template and binds the R primer in solution to the complementary region on the template molecule. The thermostable polymerase begins to extend at the primer site (dashed line), followed by solution phase exponential amplification in the next cycle. Bead-fixing primers are not considered to be the major contributor to amplification at this stage.</p><p> Step 3: Early phase PCR. During initial exponential amplification (1-10 cycles), both F and R primers amplify the template equally, despite the excess of F-primers in solution.</p><p> Step 4: Intermediate phase PCR: Between 10 and 30 cycles, R primer is depleted and exponential amplification is stopped. The reaction then enters the asymmetric amplification phase, where the amplicon population is gradually occupied by the F chain.</p><p> Step 5: Late phase PCR. After 30-40 cycles, asymmetric amplification continues to increase the concentration of F chain in solution. The excess F chain is annealed to the bead-fixed R primer without being captured by the R chain. Thermostable polymerase uses the F chain as a template for synthesizing the fixed R chain of amplicon.</p><p> Step 6: Final phase PCR. The continuous thermal cycle causes further annealing to the bead binding primer. Solution phase amplification is minimal at this stage, but the concentration of the fixed R chain continues to rise.</p><p> Step 7: The non-fixed F chain, which is complementary to the fixed R chain, is removed by alkaline denaturation. The DNA capture beads are now occupied by the positive-strand R strand of the amplicon.</p><p> Step 8: A fluorescently labeled probe (green bar) that is complementary to the R strand is annealed to the fixed strand. A range of homogeneous and heterogeneous fluorescent signals in which a probe specific for a particular strand sequence is labeled with a unique fluorescent probe and depends on the number of distinct templates amplified within a given PicoTiterPlate well. Is obtained.</p><p> First, the specificity of the fluorescently labeled probe is that the biotinylated fragment A or fragment B test DNA fragment is attached to streptavidin sepharose beads and the beads are centrifuged and packed into a 50 μm deep PicoTiterPlate and fluorescently labeled. A mixed population of these probes was confirmed by hybridizing for fragment A and fragment B fragments. No mixed signal or non-specific hybridization was observed; beads with Fragment A product showed a 448 nm signal, while Fragment B beads showed a 635 nm signal (see Figures 23A and 23B). A closer look at Figures 23A and 23B reveals that there are few Fragment A beads in the Fragment B pad and vice versa. If the purity of the signal is indicated by these floating beads, they are either the product of some cross-contamination during the filling process or transferred from one pad to another washed during the subsequent washing process. Most likely.</p><p> As shown in Figure 23C, the fluorescent probe detected successful solid phase PTPCR amplification in both the Fragment A and Fragment B templates. The signal generated by the hybridization probe depends on the relative efficiency of dye incorporation in the probe, the susceptibility of the reaction to unequal amounts of template DNA, and the total and relative amounts of amplification products present on each bead. In addition, the amount of template generated and retained on the DNA capture beads appears to vary from well to well, and the number of capture primers bound to each bead also appears to vary due to the bead size distribution. As a result, the denormalized ratios produced by probe hybridization should appear semi-qualitative rather than quantitative data. Nevertheless, the fluorescence signal produced by the hybridized probe ranges from the homogeneous fragment B signal (red) to the equally homogeneous fragment A signal (green), a heterogeneous mixture of the two signals (yellow degree). ) Is clear as well.</p><p> Due to the probe specificity shown by the controls and the significant number of homogeneous red and green beads on the PicoTiter Plate , non-specific probe hybridization is unlikely to produce a heterogeneous signal. The close proximity of homogeneous beads in either template suggests that heterogeneous beads are unlikely to result from amplicon leaks between wells during amplification (if due to intrawell cross-contamination, either Heterogeneous beads placed between the homogeneous beads of the template, and generally an uneven distribution of homogeneous signals are expected). Rather, the template molecule is dissociated from the first bead before being placed in the microwell and reannealed to a new bead in the PicoTiterPlate packed mixture, or the PCR mixture is applied to the PicoTiterPlate . Sometimes it seems that one bead is washed away and sent to another. Hybridization results, regardless of the cause of the mixed template beads, show that PCR amplification in PicoTiterPlate microwells can deliver sufficient product to the DNA capture beads, allowing hybridization and detection of fluorescent probes. ing.</p><p>Consideration The results in this example show that PCR based on PicoTiterPlate mitigates many factors related to the DNA amplification process, such as high reagent cost, high number of reactions and long reaction times, and "evolves" in PCR technology. It shows that it provides a leap. Microwells on a single PicoTiter Plate can function as separate reaction vessels up to 370,000, even at a low reaction volume of 39.5 picolitters, with high yields (2.3 × 10).⁶~1.2×10⁹Double) Achieve amplification. As a result, processing capacity is increased and the total reagent cost for PTPCR is reduced; the overall reaction volume of PicoTiterPlate with a depth of 26 or 76 μm is 15.3 and 43 μl, respectively. Increasing the dimensions of PicoTiterPlate can further increase the maximum throughput. For example, increasing the PicoTiterPlate dimension to 40mm x 75mm is about 1.4x10.⁶The PicoTiter Plate , which provides separate reaction vessels and has the same perimeter as a commercially available 96-well PCR plate (85.47 mm × 127.81 mm), is 5.24 × 10.⁶It can contain as many wells as individuals.</p><p> Solution-phase PCR amplification is limited in its usefulness if the products cannot be easily and effectively recovered, regardless of the number and volume in which they are performed. Previous studies on parallel PCR (Nagai, H., et al., Anal. Chem. 2001, 73, 1043-1047) requires evaporation of the liquid reaction mixture, leaving a dried amplicon on the walls of the microreactor, which can then be recovered for further processing. The methods disclosed herein include solid phase amplification and avoid the problem of product recovery by immobilizing the PCR product on DNA capture beads. That is, the product of the PicoTiterPlate microwell reaction is not the 370,000 wells containing the solution phase PCR product, but up to 370,000 beads to which the fixed PCR product is bound. These PCR products are suitable for many solid-phase methods of examining nucleic acids, including the potential to support large-scale parallel techniques for sequencing whole genomes containing up to hundreds of millions of bases. The simplicity of the disclosed method dramatically reduces costs for sequencing and other applications that currently require robotics to maintain large-scale cloning and PCR.</p><p> Disclosure of one or more aspects of the invention is shown in the accompanying description. Any method and material similar to or equivalent to that described herein can be used in the practice or testing of the invention, and preferred methods and materials are described herein. Other features, objectives and advantages of the present invention are apparent from the description and claims. In the specification and the accompanying claims, the singular type includes the plural type unless otherwise specified. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Unless otherwise stated, the techniques used or contemplated herein are standard techniques known to those of skill in the art. The embodiments of the embodiments are for illustration purposes only. All patents and publications cited herein are incorporated by reference.</p><p>Example 28: Rig Sequencing Method Step 1: Preparation of pAdEasy PCR DNA beads This procedure was used for 384-well plate PCR of adenovirus clones. Streptavidin-Sepharose beads (12 ml) for binding PCR fragments were prepared by washing once with 2M NaCl solution and resuspending in 288 ml of 2M NaCl. The washed beads were transferred to 15 96-well plates with 200 μl bead suspension / well. The PCR product (25 μl) was transferred to a 384-deep well plate using a Tecan TeMo robot. To attach the DNA to the solid support, 25 μl of bead suspension (15,000 beads) was added and mixed to each well of all 384-deep well plates using a Tecan TeMo robot. The final concentration of NaCl in the binding reaction solution was 1M. The binding reaction was incubated on a shaker at room temperature for 3 hours with shaking. Store the contents of the microtiter plate by turning the 384-well plate upside down on the reservoir, Beckman Centrifugated at 1000 x G in an Allegra benchtop centrifuge. The stored beads were transferred into a 50 ml Falcon tube and centrifuged at 1000 x G to remove the supernatant.</p><p> Approximately one million beads (movable solid support) were washed once with 100 μl of 2M NaCl and then twice with distilled water (100 μl each). The washed beads were incubated in a rotating machine in 300 μl of melting reagents (0.1 M NaCl and 0.125 M NaOH) for 10 minutes to remove non-biotinylated DNA strands. The tube was centrifuged at maximum speed to pellet the beads, the melting solution was removed and discarded. The beads were washed with 100 μl of the melting solution, followed by 3 more times with 1 × annealing buffer. After washing, the beads were suspended again in 25 μl of 1 × annealing buffer.</p><p> Primer P2 (500 picomols) was added to the bead mixture and mixed. The bead mixture in the tube was placed in an automatic incubator (in this case, a PCR heat cycler) with the following temperature profile: incubation at 60 ° C for 5 minutes, temperature drop to 50 ° C at a rate of 0.1 ° C / sec, Incubate at 50 ° C for 5 minutes, temperature drop to 40 ° C at 0.1 ° C / sec, incubation at 40 ° C for 5 minutes, temperature drop to 4 ° C at 0.1 ° C / sec, at 4 ° C Long-term incubation.</p><p> After annealing, the beads were carefully washed and resuspended in 200 μl of Bst DNA polymerase binding solution. Next, 10 μl aliquots (50,000 beads) of the bead suspension were processed for sequencing on the equipment described below.</p><p>Step 2: Preparation of control DNA beads Six control DNA sequences TF2, 7, 9, 10, 12 and 15 were cloned into the pBluescript II KS + vector and plasmid DNA was used with a single biotinylated primer for solid phase fixation of the amplicon. It was used as a template for PCR.</p><p> The following agents were added to a 1.7 ml tube to make a PCR mixture.<img file="JP2010142233A_D0059.tif" /></p><p> 20 μl of plasmid template DNA was added, 50 μl of the mixture was taken and placed in a 0.2 ml PCR tube. The following program was used for the thermal cycle. Incubate for 4 minutes at 94 ° C; 15 seconds at 94 ° C, 30 seconds at 58 ° C, 90 seconds at 68 ° C and 120 seconds at 68 ° C for 39 cycles; maintain at 10 ° C.</p><p> The amplified DNA of each test fragment was purified using the Qiagen MinElute PCR Clean-Up kit according to the manufacturer's instructions. The purity and yield of each of the test fragment DNAs was examined using an Agilent 2100 Bioanalyzer and a DNA500 reagent kit and chip. The biotinylated PCR product was immobilized on Sepharose streptavidin beads at a rate of 10 million DNA copies / beads.</p><p> The beads were washed once with 2M NaCl solution. This was done by adding 100 μl, resuspending the beads in a vortex for a short period of time, centrifuging at maximum speed for 1 minute to pellet the beads and removing the supernatant. This was followed by washing twice with 2M NaCl. The beads were then resuspended in 30 μl of 2M NaCl. The PCR product was added to the beads. The mixture was vortexed to resuspend the beads in solution and then placed in a rack on a titer plate shaker and allowed to stand at room temperature at speed 7 for 1 hour.</p><p> The non-biotinylated second chain was removed by incubating in an overhead rotator at room temperature with an alkaline melting solution (0.1 M NaOH / 0.15 M NaCl) for 10 minutes. Following this, the beads were washed once with 100 μl of the melting solution and 1 × annealing buffer (50 mM Tris-acetic acid, pH 7.5; 5 mM MgCl).₂) Washed 3 times with 100 μl. Sequencing primers were annealed to fixed single-stranded DNA by centrifugation at maximum speed for 1 minute. The supernatant was removed and the beads were resuspended in 25 μl of 1 × annealing buffer. Next, 5 μl of the sequencing primer MMP7A (100 pmol / μl) was added to the bead suspension and the sequencing primer was hybridized using the temperature profile below: Incubate at 60 ° C for 5 minutes, Temperature drops to 50 ° C at a rate of 0.1 ° C / sec, Incubate at 50 ° C for 5 minutes, Temperature drops to 40 ° C at a rate of 0.1 ° C / sec, Incubate at 40 ° C for 5 minutes, Temperature drops to 4 ° C at a rate of 0.1 ° C / sec, and Hold at 4 ° C.</p><p> The beads were washed twice with 100 μl of 1 × annealing buffer and then resuspended with 1 × annealing buffer to a final volume of 200 μl and aliquoted 10 μl in a labeled tube strip in a 4 ° C refrigerator. Stored in.</p><p>Step 3: Sequencing Chemistry Sepharose beads with fixed single-stranded DNA template and annealed sequencing primers on a rotator, 200 μl of Bst polymerase binding solution (25 mM Tricine pH 7.8; 5 mM magnesium acetate; 1 mM DTT; 0.4 mg / ml PVP MW 360,000) Incubated with Amersham Biosciences (2.5 μg / μl ssb stock solution 5 μl per 50,000 beads) and 500 U (50 U / μl 10 μl) of Bst DNA polymerase (NEB) in 30 minutes at room temperature. .. After this, the DNA beads were mixed with SL beads and deposited in the wells of the PicoTiter Plate as follows. Reagents required for sequencing on the 454 instrument included 1) substrate wash solution, 2) apyrase-containing wash solution, 3) 100 nM inorganic pyrophosphate calibration standard, and 4) individual nucleotide triphosphate solution.</p><p> All solutions were prepared in sulfylase-luciferase assay buffer with enzyme substrate (25 mM Tricine pH 7.8; 5 mM magnesium acetate; 0.4 mg / ml PVP MW 360,000; 0.01% Tween 20; 300 μM D-luciferin; 4 μM. APS). The substrate wash solution is the same as the luciferase assay buffer. The apyrase-containing wash solution is based on a luciferase assay buffer, except that no enzyme substrates (APS and D-luciferin) are added, which is based on apyrase (Sigma St. Lous, MO; Pyrosequencing AB, Pyrosequencing, Inc. .Westborough, MA) was contained at a final concentration of 8.5 U / L.</p><p> Sodium pyrophosphate (PP_i) Standard solution was prepared by adding sodium pyrophosphate tetrabasic decahydrate (Sigma St. Louis, MO) to luciferase assay buffer to a final concentration of 100 nM. Nucleotide triphosphates (dCTP, dGTP, TTP; minimal diphosphate grade) (Amersham Biosciences AB, Uppsala, Sweden) were diluted in luciferase assay buffer to a final concentration of 6.5 μM. Deoxyadenosine triphosphate analogs 2'-deoxyadenosine-5'-O- (1-thiotriphosphate), Sp-isomer (Sp-dATP-α-S, Biolog Life Science Institute, Bremen, Germany ) Was diluted in luciferase assay buffer to a final concentration of 50 μM.</p><p>Step 4: Cloning His6-BCCP-Sulfrylase and His6-BCCP-Luciferase Bacillus stearothermophilus (Bst) ATP sulfylase (EC 2.7.7.4) and firefly (Photinus pyralis) luciferase (EC 1.13.12.7) were cloned into the Nhe-I-BamHI digested pRSET-A vector (Invitrogen). BCCP (Biotin Carboxyl Carrier Protein) Gene Code Sequence<img file="JP2010142233A_D0060.tif" />Was used to design PCR primers to amplify fragments corresponding to amino acids 87-165 of the BCCP protein. Forward primer<img file="JP2010142233A_D0061.tif" />And the reverse primer is<img file="JP2010142233A_D0062.tif" />Met. PCR cocktails were prepared as 25 μl each of Mixture 1 and Mixture 2. Mixture 1 contained 75 picomoles of primer, 100 ng of E. coli genomic DNA and 5 μmol of dNTP. Mixture 2 includes 1 unit of Fidelity Expand DNA polymerase (Boehringer Mannheim / Roche Diagnostics Corporation, Indianapolis, IN, Cat.No.1 732 641) and 10 × Fidelity Expand buffer (Boehringer Mannheim / Roche Diagnostics Corporation, Indianapolis, Indianapolis, IN) 5 μl was contained. For PCR hot start, mixture 1 and mixture 2 were separately heated at 96 ° C for 20 seconds and then pooled. The pooled reaction solution was circulated as follows. 10 cycles of incubation at 96 ° C for 3 minutes, 96 ° C for 30 seconds, 55 ° C for 1 minute and 68 ° C for 2 minutes, then at 96 ° C for 30 seconds, 60 ° C for 1 minute. And 20 cycles of 2-minute incubation at 68 ° C, followed by a polishing step of 7-minute incubation at 72 ° C. After PCR, a single 250 bp fragment was obtained. BCCP fragments were digested with Nhe I and BamH I and subcloned into Nhe I-BamH I digestion pRSET-A.</p><p>Step 5: Expression of sulfylase and luciferase Bst ATP sulfylase and P. pyraris luciferase open reading frame containing Pst I / Hind III and Bam H I / Xho I sites (using the first enzyme at the 5'end and the second enzyme at the 3'end), respectively. Amplified by PCR using primers. This resulted in N-terminal fusion of the 6 × His and BCCP regions to ATP sulfylase and luciferase. The enzyme was expressed in E. coli using biotin-supplemented growth medium to induce in vivo biotinogenesis via the BCCP region. The enzyme was purified using a combination of IMAC and size exclusion column chromatography to get closer to homogeneity. Purification was evaluated by electrophoresis on a Protein 200 Plus chip with an Agilent 2100 Bioanalyzer.</p><p>Step 6: Solid phase fixation of luciferase and sulfylase The enzyme was immobilized on Dynamic M-280 streptavidin-coated magnetic microparticles (Dynal, Oslo, Norway) and Bangs microparticles (300 nm) by incubating a 1: 3 mixture of ATP sulfylase and luciferase respectively. Binding is in TAGE buffer (25 mM Tris-acetic acid pH 7.8, 200 mM ammonium acetate, 15% v / v glycerol and 30% v / v ethylene glycerol) with 50 μg of ATP sulfylase and 150 μg of luciferase in Dynal M-280 beads 1 mg. Alternatively, it was performed by mixing with 0.6 mg of Bangs fine particles. The mixture was incubated on a rotator at 4 ° C for 1 hour. After binding, the beads could be stored in enzyme solution at -20 ° C for 3 months. Prior to use, the beads were thoroughly washed in luciferase assay buffer containing 0.1 mg / ml bovine serum albumin (Sigma, St Louis, MO). Fixed enzyme activity, luminometer (Turner, Sunnyvale, It was investigated using California). The washed beads were stored on ice until deposited on PTP slides.</p><p>Step 7: PicoTiterPlate (PTP) PicoTiter Plate (25 × 75 × 2 mm) was produced by anisotropic etching of the optical fiber face plate in the same manner as described in the literature. Plates were etched with three different microwell depths of 26, 50 and 76 mm. The center-to-center spacing of the microwells is 50 μm, the well diameters are 39-44 μm, and the calculated well density is 480 wells / mm.²Met.</p><p>Step 8: PTP filling Sepharose beads with a DNA template and a mixture of Dynal M-280 / Bangs 0.3 μm beads with sulfurylase and luciferase enzymes immobilized were deposited in individual wells of the PicoTiter Plate using a method based on centrifugation. This procedure used a homemade polycarbonate fixture (jig) that included a bottom plate (slide positioning peg), an elastomer sealing gasket, and a top plate with two filling ports. The PTP slide was placed on the bottom plate with the etched side facing up and the top plate with the sealing gasket in place was fastened to the top of the PTP slide. The entire assembly was fastened with four plastic screws to provide a watertight seal. The sealing gasket was designed to form a bead-deposited mask to obtain a single hexagonal area (14 x 43 mm) covering approximately 270,000 PTP wells.</p><p> The beads were deposited to form layers in sequence. PTP was removed from incubation in bead wash buffer. Layer 1, i.e. a mixture of DNA and enzyme beads, was deposited. After centrifugation, the supernatant of layer 1 was aspirated to remove PTP and the Dynal enzyme beads of layer 2 were deposited.</p><p> The bead suspension, 15,000 DNA-containing Sepharose beads in 120 μl of the ssb / Bst pol binding mixture (see above), Dyna-SL in a total volume of 500 μl of luciferase assay buffer containing 0.1 mg / ml bovine serum albumin. And Bangs-SL beads (both 10 mg / ml) prepared by mixing with 270 μl. The bead slurry was vortexed and poured into a bead deposit jig through the pipette mouth. Care was taken to avoid the introduction of air bubbles. The jig / PTP assembly was centrifuged at 2000 rpm for 8 minutes in a Beckman Allegra 6 centrifuge equipped with a 4-position plate swing-out rotor. After centrifugation, the supernatant was carefully removed from the jig chamber using a pipette. A second layer of Dynal-SL beads only was deposited. This layer contained 125 μl of Dynal-SL (10 mg / ml) and 375 μl of bead wash buffer in a 1.5 ml tube (2.5 mg / ml). Dynal beads). The Dynal bead mixture was pipetted into the PTP main active region and centrifuged at 2000 rpm for 8 minutes. The layer 2 mixture was aspirated and the PTP was placed back in bead wash buffer (luciferase assay buffer containing 0.1 mg / ml bovine serum albumin and 8.5 U / L apyrase) until ready to fill the sequencer. ..</p><p>Step 9: Sequencing device The home-made sequencer included three main assemblies. Fluid subsystem, PTP cartridge / flow chamber, and imaging subsystem. The fluid system included a reagent reservoir, a reagent inlet line, a multi-valve manifold, and a peristaltic pump. This allows reagents to be delivered into the flow chamber and one reagent to be delivered at a time with a pre-programmed flow rate and duration. The PTP cartridge / flow chamber was designed to create a space of 300 μm between the top of the PTP (etched side) and the ceiling of the chamber after the PTP was attached. It included means for controlling the temperature of reagents and PTP, as well as a light-tight housing. The polished side of the PTP was exposed on the back side of the PTP cartridge and placed in direct contact with the imaging system. The imaging system included a CCD camera with 1-1 imaging fiber bundles, as well as a cryocooling system for the camera and camera controlled electrical equipment. The camera used was Spectral Instruments (Tucson, It was a AZ) series 600 camera with a Fairchild Imaging LM485 CCD (16 million pixels, 15 μm pixel size). This was directly coupled to an imaging fiber bundle with a 6 μm fiber pitch. The camera was cooled to -70 ° C and operated in frame transfer mode. In this way, the central portion of the CCD was used for imaging and the outer portion of the CCD was used for image storage and retrieval. Reads were made through four ports at each corner of the CCD. The data acquisition speed was set to 1 frame per 30 seconds. The frame transfer shift time was about 0.25 seconds. All camera images were stored in UTIFF 16 format on a computer hard drive (IBM eServer xSeries 335, IBM, White Plains, NY).</p><p>Step 10: Sequencing run condition Cyclic delivery of the sequencing reagent into the PTP wells and washing of the sequencing reaction by-products from the wells were accomplished by pre-programmed manipulation of the fluid system. The program is named reagent (Wash, dATPαS, dCTP, dGTP, dTTP, PP_iWritten in the form of a Microsoft Excel script that identifies the standard), flow rate, and duration of each scripting process. The flow rate was set to 3 ml / min for all reagents and the linear velocity in the flow chamber was approximate. Following the initial cleaning step (5 minutes), PP_iThe standard flow (2 minutes) followed by (Wash-C-Wash-A-Wash-G-Wash-T) for 21 or 42 cycles (each nucleotide flow is 0.5 minutes, the wash step is 2 minutes). Met). After all nucleotide addition and wash cycles, a second PP_iA standard flow (2 minutes) was delivered, followed by a final 5 minute wash step. The total run time was 4 hours. The reagent volumes required to complete this run script are shown below. 300 ml of each wash solution, 50 ml of each nucleotide solution, 20 ml of PP_iStandard solution. All reagents were maintained at room temperature during the run. The flow chamber and flow chamber inlet tube were maintained at 3 ° C, so all reagents entering the flow chamber were at 30 ° C.</p><p>Citations<img file="JP2010142233A_D0063.tif" /></p>