Method for linking sequences of interest

Description

Technical Field of The invention [0001] The present invention relates to a multiplex molecular amplification procedure capable of linking nucleotide sequences of interest in connection with the amplification, in particular polymerase chain reaction (multiplex PCR). The method is used for the generation of cognate pair libraríes.

Background of The invention [0002] Antigen binding proteins involved in the immune response are present in mammals as large polydonal repertoires representing a broad diversity of binding specificities. This diversity is generated by rearrangement of gene sequences encoding variable regions of these binding proteins. Such variable region binding proteins include soluble and membrane-bound forms of the B cell receptor (also known as immunoglobulins or antibodies) and the membrane-bound T cell receptors (TcR). With respectto immunoglobulins, their affinity is enhancedsubsequentto recognition ofan antigen by a B cell antigen receptor, through a process termed affinity maturation which involves cycles of somatic hypermutation of these variable genes.

[0003] Notably, immunoglobulins or fragments thereof, such as Fab fragments, Fv fragments and single chain Fv (scFv) molecules have been subject to cloning and recombinant expression. However, all other variable region binding proteins can in principle also be doned and expressed using the same concepts as for antibodies.

[0004] Known approaches for isolating antibodies with a desired binding specificity most often involves generation of hybridomas from immunized hosts followed by screening for spedfic clones or involves the generation of combinatoríal expression libraries in E. coli composed of immunoglobulin variable domains, which are subsequently enriched using techniques such as, for example, phage display.

[0005] The main restriction in the use of the hybridoma technology for making therapeutic antibodies is the absence of a human lymphoma suitable as fusion partners for human B lymphocytes. Heterohybridomas (i.e., fusion of human B cells with mouse lymphomas) are notoriously unstable and thus rarely lead to suitable cell lines for production purposes. Human B cells immortalized through infection wíth Epstein-Barr virus exhibit similar challenges of instability. The lack ofrobustcellularmethodologyformakinghumanantibodiesfortherapycanbecompensatedwith morerecentadvantages in molecular biology.

[0006] The use of combinatorial libraries and phage display allows for generation of large repertoires of antibody clones with a potential diversity in excess of 10¹⁰. From this repertoire selection for binding to a specific target can be performed thereby generating a sub-library. This sub-library can be used to generate either polydonal or monodonal antibodies. The variable region encoding sequences (for example immunoglobulin heavy chain variable region and light chain variable region encoding sequences) which constitute the library can be am plified from lymphocytes, plasma cells, hybridomas or any other immunoglobulin expressing population of cells. Current technologies for generating combinatorial libraries involve separate isolation of the variable region encoding sequences from a population of cells. Thus, the original pairing of for example immunoglobulin heavy chain variable regian and light chain variable region encoding sequenceswillbelost. Rather.inacombinatoriallibrarysaidsequencesarerandomly paired andtheoriginalcombinations of these variable sequences will only occur by chance. Thus, in order to isolate variable region encoding sequences responsible for a desired binding specificity, a considerable amount of screening is necessary. This is typically performed in combination with methods for enrichment of dones exhibiting a desired specificity, such as ribosome display or phage display. Even then, the diversity achieved might not be sufficiently large to isolate variable region encoding sequence pairs giving rise to binding proteins of similar high affinity as those found in the original cells. Further, the enrichment procedures normally used to screen combinatorial libraries introduce a strong bias e.g. for polypeptides of particular low toxicity in E. co/i, efficient folding, slow off-rates, or other system dependent parameters, that reduce the diversity of the library even further. In addition, dones derived from such combinatonal libraries will be more prone to produce binding proteins with cross-reactivity against self-antigens because they as pairs, in contrast to original pairs (hereafter called cognate pairs), never have been through in vivo negative selection against self-antigens, such as it is the case for B and T lymphocyte receptors during particular stages of their development. Therefore, the doning of original pairs of variable region encoding sequences is a desirable approach. Moreover, the frequency of dones exhibiting a desired binding specificity is expeded to be considerably higher within a library of cognate pairs, than in a conventional combi-natoria! library, particularly if the starting material cells are derived from a donor with high frequency of cells encoding specific binding pairs e.g. immune or immunized donors. It follows that the size of a cognate pair library will not need to be as large as a combinatorial library: a cognate pair library size of 10⁴ to 10⁵ dones or even as small as 10² to 10³clones derived from a donor with a relevant ongoing immune response might very well suffice in order to obtain binding proteins representing a broad diversity of desired binding specificities.

[0007] In order to generate cognate pair líbraries the linkage of the variable region encoding sequences derived from the same cell is required. At present, two different approaches which can achieve cognate pairing of variable region encoding sequences have been described.

[0008] ln-cell PCR is an approach where a population of cells is fixed and permeabilized, followed by in-cell linkage of heavy chain variable region and light chain variable region encoding sequences from immunoglobulins. This linkage can be performed either by overlap-extension RT-PCR (WO 93/03151) or by recombination (Chapal, N. et al. 1997 BioTechniques 23,518-524). The ampl ification process as described in these publications is a three or four step process consisting of i) reverse transcription utilizing constant region primers generating immunoglobulin cDNA, ii) PCR arnpli-fication of the heavy and light chain variable region encoding sequences utilizing primer sets containing either overlapextension desígn or recombination sites, iii) linkage by recombination, ifthis approach is chosen, iv) nested PCR of the products generating restriction sites for doning. Since the cells are permeabilized there is a considerable risk that amplification products might leak out of the cells, thereby i ntroduci ng scrambling of the heavy chain variable region and light chain variable region encoding sequences, resu Iting in the loss of cognate pairing. Therefore, the procedure includes washing steps after each reaction which makes the process laborious and reduces the efficiency of the reactions.

[0009] More generally, the in-cell PCR Is notoriously inefficient, resulting in low sensitivity. Accordingly, the in-cell PCR linkage technique has neverfound widespread usage, and the original study has in fact never been reliably repeated in a way which can be used to verify that the linkage actually occurs within the cell. This, however, is absolutely crucial to avoid scrambling of the heavy chain variable region and light chain variable region encoding sequences and thereby disrupting the cognate pairs.

[0010] A different in-cell approach is described in WO 01/92291. This approach is based on RNA trans-splicing, and achieves joining of V_H and V_L encoding mRNA within the cell. This approach requires the presence of a DNA construct driving the trans-splicing within the cells.

[0011] Single-cell PCR is a different approach to achieve cognate pairing of heavy chain variable region and light chain variable region encoding sequences (see, for example, Coronella, J.A. et al. 2000 Nucleic Acids Res. 28, E85; Wang,X.,etal.2000 J. Immunol. Methods 20,217-225). Inthese publicationsapopulationofimmunoglobulinexpressing cells are distributed by diluting to a density of one cell per reaction, thereby eli minating scrambling of heavy chain variable region and light chain variable region encoding sequences during the cloning process. Basically, the process described is a three to four step procedure consisting of i) reverse transcription utilizing oligo-dT-, random hexamer- or constant region primers generating cDNA, ii) fractionating the cDNA product into several tubes and performing PCR amplification on the individual variable chain encoding sequences (in separate tubes) with primer sets containing restriction sites for cloning, iii) nested PCR of the products generating restriction sites for cloning (optionally) and iv) linking the heavy chain variable region and light chain variable region encoding sequences from the separate tubes by cloning them into an appropriate vector, which in itself is a multi-step process.

[0012] In humans there are two types of light chains: lambda (λ) and kappa (k). This means that with the cDNA generated from every single cell at least three separate PCR reactions must be performed followed by analysis and cloning of the appropriate fragments into a single vector to achieve the cognate pairing. Thus, the single-cell PCR approach as described requires a large number of manipulations to generate a library of cognate pairs. Although, a cognate pair library does not need to be as large as a combinatorial library in order to obtain binding proteins representing a broad diversity of binding specificities it would still be a laborious task to generate a library of for example 10⁴ to 10⁵clones by the described single-cell PCR approach. Further, the large number of manipulations highly increases the risk of contamination and human error.

[0013] In order to obtain high affinity binding proteins corresponding to the affinities normally observed during an immune response, cognate pairing of the variable region sequences in association with their amplification is highly advantageous. To generate a library of large diversity it is necessary to have a cloning technique that can be fitted to a high-throughput format and where the risk of contamination and scrambling is minimal.

[0014] A reduction of the number of cloning steps allowing the generation of combinatorial libraries to be fitted to a high-throughput format, is likewise desired.

[0015] WO 92/15678 appears to describe a method of linking a plurality of non-contiguous nucleotide sequences if interest, by a multiplex molecular amplification procedure using a template from a population of isogenic cells.

[0016] WO 01/89563 appears to disclose a technology for generating recombinant polyclonal antibody libraries that enables the creation and perpetuation of standardized mixtures of polyclonal whole antibod ies specific for a multiantigen. [0017] Sharon J et al„ (Combinatorial Chemistry and high throughput screening, Hilversum, NL; June 2000, Vol 3; 185-196) appears to disclose the use of a recombinant or purified polyclonal antibody capable of reacting with or binding to an allergen for the manufacture of a pharmaceutical composition for the prophylaxis or treatment of allergy, for the prophylactic or therapeutic induction of tolerance to the allergen, or for the modulation of the immune system.

Disclosure of Contribution [0018] The present invention provides an efficient method of linking two or more nucleotide sequences of interest,

e.g. variable region encoding sequences, utilizing a multiplex molecular amplification procedure, such as multiplex overlap-extension RT-PCR or multiplex RT-PCR followed by linkage by ligation or recombination. The method is applicable on a single cell, thereby enabling cloning of cognate pairs in a high-throughput format.

Description of the Figures [0019] FIGURE 1 is a diagram illustrating the different types of overlap-extension tails. The bold line corresponds to a gene-specific part of the primer and the regular line corresponds to the overlapping tail. The vertical bars illustrate complementary regions. The primers facilitate the linkage of two nucleotide sequences of interest. FIGURE1 (I) illustrates two varieties of the type I overlap-extension tails where only the extension tails overlap, either completely or partially; FIGURE 1 (II) illustrates the type II overlap-extension tails where some of the 5’-nucleotides of the first primer extension tail are complementary to the gene-specific part of the neighboring primer; FIGURE 1 (III) illustrates the type III overlapextension tails where the entire overlap-extension tails are complementary to the gene-specific region of the neighboring primer.

[0020] FIGURE 2 is a diagram showing a schematic overview of a multiplex overlap-extension primer mix applicable in the linkage of immunoglobulin variable region encoding sequences. The cDNA encoding the light chain (LC) and the heavy chain variable region (V_H) to be linked are illustrated as tubes with indication of their sense strand 5' and 3'ends as well as the expected size of the amplified product. The multiplex overlap-extension primer sets used to amplify the encoding sequence are illustrated by the arrows. The bended arrow tails with dashed 5' overhangs illustrate the cloning tails. The overlap-extension tails are in bold. The restriction sites present in the tails are named in connection with the tail. The total numberof primers in the multiplexoverlap-extension primer mix is sixteen, distributed on the outer primers comprising one C_K and one C_H1 primer and the overlap extension primers comprising six V_L and eight V_H primers. The C_H1 prlmer anneal at the 5' end of the heavy chain constant domain 1. The product resulting from the multiplex overlapextension RT-PCR is expected to be approximately 1070 bp constituting the entire kappa light chain composed of the constant region, joining gene and variable gene (C_K + J_L + V_L) and the heavy chain variable region, composed of the variable gene, diversíty segment and joining gene (V_H + D + J_H). 5' and 3' indicates the direction of the open reading frame. Only a small portion of the C_H1 region encoding sequence is amplified by this multiplex overlap-extension primer mix, because the annealing position of the C_H1 primer is close to the heavy chain J-region.

[0021] FIGURE 3 is a series of diagrams illustrating the different linking direction of the products that can be obtained depending on which primers are equipped with the linkage tail. Solid black illustrates the overlap region. 5' and 3' indicates the direction of the open reading frame. FIGURE 3A is a diagram illustrating a head-to-head orientation of the products. FIGURE 3B is a dlagram illustrating a tail-to-tail orientation. FIGURE 3C is a diagram illustrating a head-to-tail orientation with the light chain encoding sequence first. FIGURE 3D is a diagram illustrating a head-to-tail orientation with the heavy chain encoding sequence first.

[0022] FIGURE 4 is a schematic diagram of the immunoglobulin expression vector pLL113, where the encoding sequences are in a head-to-tail orientation. The vector comprises the following elements: bla = promoter allowing expression of the ampicillin resistance gene. Amp = gene encoding for ampicillin resistance. pUC ori = pUC origin of replication. AdMLP= Adenovirus major late promoter. Human lgG1 = Sequence encoding for immunoglobulin isotype G1 heavy chain. hGH pA = Human growth hormone poly A signal sequence. bGH polyA= Bovine Growth Hormone poly A sequence. Human kappa LC = Sequence encoding immunoglobulin kappa light chain. FRT = A Flp recognition target site. Hygromycin = gene encoding hygromycin resistance. SV40 poly A = Simian virus 40 poly A signal sequence.

[0023] FIGURE 5A is an electrophoretic gel showing the results from a two-step multiplex overlap-extension RT-PCR followed by a semi-nested PCR. The amplification products are derived from cDNA isolated from single CHO Flp-ln pLL113 cells, Lanes 1-12 are sample lanes and the arrows indicate correct nested multiplex-overlap-extension RT-PCR products of 1076 bp; M1 is a 100 bp ladder. W is water used as negative control template. C is a positive cDNA control template derived from cell-line HB-8501. In a separate panel the same lanes W, C and the 10Obp ladder have been depicted with less contrast in order to resolve the individual DNA fragments. FIGURE 5B is a sketch of the gel shown in Figure 5A, illustrating the relevant fragments from the gel.

[0024] FIGURE 6 is a series of photographs and a graphical representation of electrophoretic gels showing the results from a single-step multiplex overlap-extension RT-PCR reaction without additional PCR amplification. In each panel, M1 is a 100 bp ladder and M2 is a 500 bp ladder. FIGURE 6A is an electrophoretic gel showing the amplification products derived from lysate corresponding to 100,10,1 orO cells. The arrow indicates the overlap-extension product. FIGURE 6B is a sketch of the gel in Figure 6A. FIGURE 6C is an electrophoretic gel verifying the presence of overlap-extension product in the 100 and 1 cell lanes in Figure 6A. FIGURE 6D is an electrophoretic gel showing restriction enzyme cleavage with Nhel and Ncol, respectively, of the overlap-extension product from the 1 cell lane in Figure 6C.

[0025] FIGURE 7 is an electrophoretic gel showing the results from a single-step multiplex overlap-extension RT-PCR followed by a semi-nested PCR amplification. M1 is a 100 bp ladder and M2 is a 500 bp ladder. Results from multiplex overlap-extension primer mixtures containing either C_H1, C_H2, C_H3, C_H4 or C_H5 as the outer primer in the multiplex overlap-extension RT-PCR reaction. The reactions were performed on cell lysates corresponding to 100,10,1 or 0 cells. The size of the overlap-extension product is indicated with an arrow.

[0026] FIGURE 8 is an electrophoretic gel showing the results from a single-step multiplex overlap-extension RT-PCR followed by a semi-nested PCR amplification using enriched human B lymphocytes as template. M1 is a 100 bp ladder, Lane 5 and 6 show bands of the size expected forthe overlap-extension product.

[0027] FIGURE 9A is a schematic diagram of the mammalian expression vectors (Em465/01P582/Em465/01P581) used for generation of lgG1-lambda expressing cell lines, where the encoding sequences are in a head-to-head orientation. The vectors comprise the following elements: Amp = gene encoding for ampicillin resistance. pUC ori = pUC origin of replication. AdMLP= Adenovirus major late promoter. EFP=Elongation factor promoter. AP leader= alkaline phosphatase leader sequence. VH= heavy chain variable region encoding sequence. lgG1 HC = Sequence encoding for immunoglobulin isotype G1 heavy chain constant region. rBG polyA =Rabbit beta-globin poly A signal sequence. bGH polyA= Bovine Growth Hormone poly A sequence. IgK leader= sequence encoding for murine kappa leader. IgL (1b or 1c) = Sequence encoding immunoglobulin lambda light chain family 1 b or 1c. FRT = A Flp recognition target site. Hygromycin = gene encoding hygromycin resistance. SV40 poly A = Símían virus 40poly A signal sequence. FIGURES 9B and 9C are ethidium bromide stained agarose gels loaded with PCR products isolated form cell line CHO Flp-ln/Em464/01P581 and CHO Flp-ln/Em464/01P582, respectively. Lanes 1 to 4 correspond to total RNA template concentrations of 50 pg, 5 pg, 0.5 pgorO pg usedforthe multiplex overlap-extension RT-PCR reaction. M isa 100 bp ladder (New England Biolabs, New England, USA). The arrows indicate the overlap-extension PCR product.

[0028] FIGURE 10 is a flow chart showing the steps applied in order to generate a cognate antibody expression library from whicd polyclonal or monoclonal antibodies can be expressed.

[0029] FIGURE 11 is a schematic diagram of JSK301, an E. coli vector used to generate a library of Fab vectors by inserting the overlap-extension fragments comprising the cognate variable region encoding sequences into the vector at the indicated Notl/ Xhol restriction sites. The vector comprises the following elements: Amp and Amp pro =ampicillin resistance gene and its promoter. pUC19 Ori=orig in of replication. Human CH1=sequence encoding human immunoglobulin gamma 1 heavy chain domain 1. Stuffer=an irrelevantsequence insert which is cutout upon insertion oftheoverlap-extension fragments. tac P and lac Z = bacterial promoters which can be excised at the Nhel and Ascl restriction sites. [0030] FIGURE 12 is a schematic diagram íllustrating the generation of a library of cognate Fab expression vectors. Step I illustrates the insertion of cognate pairs of variable region encoding sequences (νΗ,-VL, to VHx-VLx) into E. coli vector JSK301 by Xhol-Notl digestion. Step II illustrates the insertion of a bacterial promoter and leader cassette (pe/B leader-P tac-promoter driving the expression of VHx and P lac promoter- pelB leader driving the expression of VLx) by Ascl-Nhel digestion.

[0031] FIGURE 13 illustrate the linkage of α-, 13- and ^subunits constituting a G-protein, utilizing sing le-step multiplex overlap-extension RT-PCR followed by an additional PCR amplification. The sizes of the individual coding regions are given as well as the size of the linked product. Restriction sites introduced by the primer tails during amplification are indicated for the final product.

[0032] FtGURE 14 shows dot plots of an analytic FACS staining of (A) PBMC purified from donor blood; (B) the magnetically sorted non-labelled CD19 negative cell fraction and (C) magnetically sorted CD19+ cellsfraction. Ascatter plot, a CD19/CD38 plot, and a CD38/CD45 plot is shown for each fraction.

[0033] FIGURE 15 shows the CD19+ fraction from Figure 9 C, which had been stored in liquid nitrogen, thawed and stained with anti-CD19, anti-CD38 and anti-CD45. Dot plots corresponding to Figure 9C are shown.

[0034] FIGURE 16 shows gates used for sorting on the CD19+ cell fraction. A scatter gate and a fluorescence gate based on CD38 and CD45 were used for isolating the CD38high (CD38hi), CD45intermediate (CD45in) cells.

[0035] FIGURE 17 is an electrophoretic gel showing the successful multiplex overlap-extension RT-PCR reaction on donorTT03 (rowA, well 1-12 from eight 96 well plates). Thesamples havebeen applied tothe agarosegel in tworows (A and B) with 48 samples in each. The expected size of the overlap-extension fragment was approximately 1070bp. The putative overlap-extension fragments are marked with arrows.

[0036] FIGURE 18 shows ELISA analysis of periplasmic extracts from plate G060. The ELISA plate was coated with goat(gt)-anti-human Kappa, and captured Fab fragments were detected with a HRP-conjugated gt-anti-human Fab-specific antibody.

[0037] FIGURE 19 shows ELISA analysis of periplasmic extracts fram plate G060. The ELISA plate was coated with 10 fxg/ml Ovalbumin (Sigma A-5503), and captured Fab fragments were detected with a HRP-conjugated gt-anti-human Fab-specific antibody.

[0038] FIGURE 20 shows ELISA analysis of periplasmic extracts from plate G060. The ELISA plate was coated with T etanus Toxoid, and captured Fab fragments were detected with a H RP-conjugated gt-anti-human Fab-specific antibody. [0039] FIGURE 21 shows a one step competition ELISA analysis of periplasmic extracts from plate G060. The ELISA plate was coated with Tetanus Toxoid (TT), and soluble TT was added to each well at 10^-7 M in order to compete for the binding of Fab fragments from the bacterial supernatants, to immobilized TT. Captured Fab fragments were detected with a HRP-conjugated gt-anti-human Fab-specific antibody.

[0040] FIGURE 22 shows alignment of variable heavy chain protein sequences from TT antigen-binding clones from plate G060. The degree of sequence homology was represented by different shadings; 100%, 80% and 60% were depicted with black, grey and light grey, respectively. CDR1 is located at alignment position 34 to 41. CDR2 is located at alignment position 55 to 73. CDR3 is located atalignment position 107 to 127. Premature stop codons were denoted by an asterisk. The alignment is divided into 8 separate Figures (a-h) distributed in two rows from left to right with Figure 22a to d in the top row and Figure 22e to h in the bottom row.

[0041] FIGURE 23 shows alignment of variable light chain protein sequence fram TT antigen-binding clones from plate G060. The degree of sequence homology was represented by different shadings; 100%, 80% and 60% were depicted with black, grey and light grey, respectively. CDR1 is located at alignment position 26 to 42. CDR2 ís located at alignment position 58 to 64. CDR3 is located at alignment position 97 to 106. Premature stop codons were denoted by an asterisk. The alignment is divided into 8 separate Figures (a-h) distributed ln two rows from leftto right with Figure 23a to d in the top row and Figure 23e to h in the bottom row.

[0042] FIGURE 24 shows a competition ELISA assay for determination of apparent afflnities of selected clones from plate G060. Soluble TT dilutions in concentrations from 100 nM to 25 pM (four-fold dilutions) were added to the Fab fragments, thereby competing out the binding of the Fab-fragments to immobilized TT. The extents of the reactions are given as the ratio of the observed binding at a given soluble TT concentration to the binding found when no soluble TT was added to the reactions.

[0043] FIGURE 25 shows a double phylogenetic dot matrix plot showing the intra- and intergenetic relationship between antíbody heavy and light chain variable domain sequences. Phylogenetic threes of V_H and V_L sequences are paired in a dot matrix in order to indicate actual pairing of particular V genes. A) TT binding clones obtained from a combinatorial library using phage display. Β) TT binding clones obtained from a library of cognate pairs using the present invention.

Description of The invention [0044] The present invention sets out to provide an amplification and linkage process of two or more non-contiguous nucleotide sequences of interest which enables the cloning of such sequences to be fitted to a high-throughput format. This is basically achieved by reducing the number of steps necessary to amplify and link sequences to be cloned.

[0045] One aspect of The invention is a method of linking a plurality of non-contiguous nucleotide sequences comprising amplifying, in a multiplex molecular amplification procedure, nucleotide sequences of interest using a template derived from an isolated single cell and effecting a subsequent linkage of the amplified sequences. The linkage results in a nucleic acid segment comprising nucleotide sequenœs of interest associated with each other in a cognate manner.

[0046] In one embodiment of the present invention this multiplex molecular ampl ification procedure is a multiplex PCR amplification, preferably preceded by a reverse transcription step. In a preferred embodiment reverse transcription, amplification and linkage are performed in a single step, using multiplex overlap-extension RT-PCR or alternatively in two steps using multiplex RT-PCR followed by linkage by ligation or recombination.

[0047] The invention relates to the generation of libraries of cognate pairs comprising linked variable region encoding sequences, in particular heavy chain variable region and light chain encoding sequences or T cell receptor (TcR) alpha chain encoding sequences and beta chain encoding sequences. The process involves obtaining a lymphocyte-containing cell fraction from at least one suitable donor and optionally enriching for a particular lymphocyte population from this fraction, for example B lymphocytes or T lymphocytes, depending on whether variable region encoding sequences from immunoglobulins orTcRs are desired. The lymphocyte-containing cell fraction orthe enriched cell fraction is distributed into an array of vessels, obtaining one cell in each vessel. The array ofsingle cells are subjected to a reverse transcription (RT) step or an alternative cDNA generating procedure, using the nucleic acids derived from the population of single cells as template. The RT step is followed by multiplex molecularamplification procedure and linkage of pairs of variable region encoding sequences generated from each cell according to one of the methods of the present invention.

[0048] The cloning techniques disclosed in the present invention omit laborious and inefficient cloning approaches and addítíonally reduces the rísk of contamination and loss of diversity during multiple cloning steps.

[0049] The invention enables libraries of cognate pairs produced by the multiplex molecular amplification and linkage process. The initial library of cognate pairs (parent library) generated by the method of the present invention can be subjected to screening, thereby generating a sub-l ibrary of cognate pairs encoding target-specific binding protein variable domains or full-length binding proteins.

[0050] The libraries and sub-libraries enabled by the present invention can be used in the expression of recombinant monoclonal or polyclonal proteins, where the original binding affinities and specificities present in the donor are preserved.

Definitions [0051] The term "cognate pair" describes an original pair of non-contiguous nucleic acids of interest that are contained within or derived from a single cell. In preferred embodiments, a cognate pair comprises two variable region encoding sequences which together encode for a binding protein variable domain and which gene sequences are derived from the same cell. Thus, when expressed eitheras a complete binding protein or as a stablefragmentthereof, they preserve the binding affinity and s pecificity of the binding protein orig inally expressed from this cell. A cognate pair can for example be comprised of an antibody variable heavy chain encoding sequence associated with a variable light chain encoding sequence from the same cell, or a T cell receptor α chain encoding sequence associated with a β chain encoding sequence from the same cell. A library of cognate pairs is a collection of such cognate pairs.

[0052] The term "hot-start polymerase" describes polymerases that are inactive or have very low activity at temperatures used for reverse transcription. Such polymerases need to be activated by high temperatures (90 to 95“C) to become functional. This is for example an advantage in single-step RT-PCR procedures, since this prohibits interference of the polymerase with the reverse transcriptase reaction.

[0053] The term "isogenic population of cells" describes a population of genetically identical cells. In particular, an isogenic population of cells derived by clonal expansion of an isolated single cell is of interest in the present invention. [0054] The term "isolated single cell’ describes a cell that has been physically separated from a population of cells corresponding to "a single cell in a single vessel". When distributing a population of cells individually among a plurality of vessels, a population of isolated single cells is obtained. As specified in the section entitled "Template sources"Vhe proportion of vessels with a single cell is not necessarily a 100% in order to call it a population of single cells.

[0055] Terms derived from "link" or "linkage" in relation to amplification describes the association of the amplified nucleic acid sequences encoding the nucleíc acid sequences of interest into a single segment. In relation to cognate pairs a segment comprises nucleic acid sequences encoding a variable domain, e.g. an antibody heavy chain variable region associated with an antibody light chain variable region encoding sequence, derived from the same cell. The linkage can either be achieved simultaneously with the amplification or as an immediate step following the amplification. There are no requirements to the form or fun ctionality of the segment, it may be linear, circular, single stranded or double stranded. Nor is the linkage necessarily permanent, one of the nucleicacid sequences of interest may be isolated from the segment if desired, one of the variable region encoding sequence may for example be isolated from a cognate pair segment. However, as long as the original variable regions constituting the cognate pair are not scrambled with other variable regions, they are still considered a cognate pair, although not linked together into a single segment. The linkage is preferably a nucleotide phosphodiester linkage. However, linkage can also be obtained by different chemical cross linking procedures.

[0056] The term "multiplex molecular amplification" describes the simultaneous amplification of two or more target sequences in the same reaction. Suitable amplífication methods include the polymerase chain reaction (PCR) (U.S. 4,683,202), ligase chain reaction (LCR), (Wu and Wallace, 1989, Genomics 4,560-9), strand displacement amplification (SDA) technique (Walkeretal., 1992, Nucl. Acids Res. 20,1691-6), self-sustained sequence replication (Guatelli etal.,

1990, Proc. Nat. Acad. Sci. U.S.A., 87,1874-8) and nucleic acid based sequence amplification (NASBA) (Compton J„

1991, Nature 350, 91-2). The latter two amplification methods involve isothermal reactions based on isothermal tran-scription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA).

[0057] The term "multiplex PCR'' describes a variant of PCR in which two or more target sequences are amplified simultaneously, by including more than one set of primers in the same reaction, e.g. one primer set adapted for amplification of the heavy chain variable region and one primer set adapted for amplification of the kappa chain variable region in the same PCR reaction. Additionally a primer set adapted for amplification of the lambda chain variable region may be combined with these primer sets.

[0058] The term "multiplex RT-PCR'' describes a multi plex PCR reaction, which is preceded by a reverse transcription (RT) step. The multiplex RT-PCR, can either be performed as a two-step process with a separate RT step priorto the multiplex PCR, or as a single-step process where all components for both RT and multiplex PCR are combined in a singletube.

[0059] The terms "multiplex overlap-extension PCR" and "multiplex overlap-extension RT-PCR" implies that the multiplex PCR or multiplex RT-PCR is performed utilizing a multiplex overlap-extension primer mix to amplify the target sequences, thereby enabling simultaneous amplification and linkage of the target sequences.

[0060] The term "a plurality of vessels” describes any object (or collection of objects) which enables the physical separation of a single cell from a population of cells. This may be tubes, multiwell plates (e.g. 96-well, 384-well, microtitter plates or other multiwell plates), arrays, microarrays, microchips, gels, or a gel matrix. Preferably the object is applicable for PCR amplification.

[0061] The term "polyclonal protein" or "polyclonality" as used herein, refers to a protein composition comprising different, but homologous protein molecules, preferably selected from the immunoglobulin superfamily. Thus, each protein molecule is homologous to the other molecules of the composition, but also contains one or more stretches of variable polypeptide sequence, which is/are characterized by differences in the amino acid sequence between the individual members of the polyclonal protein. Known examples of such polyclonal proteins include antibody or immunoglobulin molecules, T cell receptors and B cell receptors. A polydonal protein may consist of a defined subset of protein molecules, which has been defined by a common feature such as the shared binding activity towards a desired target, e.g. a polyclonal antibody exhibiting binding specificity towards a desired target antigen.

[0062] The term "a population of genetically diverse cells" as used herein, refers to a cell population where the i ndividual cells in the population differ among each otheron the genomic level. Such a population of genetically diverse cell is for example a population of cells derived from a donor, or a fraction of such cells, e.g. a B lymphocyte or a T lymphocyte containing cell fraction.

[0063] The term "primer set" is used interchangeably with the term "primer pair" and describes two or more primers which together are capable of priming the amplification of a nucleotide sequence of interest (i.e., one member of a cognatepaiij.Apnmersetofthepresentinvention mightbe designedtoprimeafamilyofnucleotidesequences containing varlable region encoding sequences. Examples of different families are antibody kappa light chains, lambda light chains, heavy chain variable regions, and α, β, γ, or δ T cell receptor variable regions. A primer set for the amplification of a family of nucleotide sequences containing variable region encoding sequences often constitutes a plurality of primers where several primers can be degenerate primers.

[0064] The term "sequence identity" is expressed as a percentage which indicates the degree of identity between to nucleic acid sequences over the length of the shortest of the two sequences. It can be calculated as (N_ref- N_dif)xl00/N_ref, wherein N_re( is the number of residues in the shorter of the sequences, and wherein N_dif is the total number of nonidentical residues in an N_ref long optimally aligned match between the two sequences. Hence, the DNA sequence AGTCAGTC will have a sequence identity of 75% with the sequence TAATCAATCGG (Nd if=2 and Nref=8) (underlining shows the optimal alignment, and bold indicates the two non-identical residues out of 8).

[0065] The terms "randomly" or ”random” with respect to linkage refers to linkage of nucleotide sequences which are notderivedfrom the samecell butarelinkedtransverselyamongapopulationofgeneticallydiversecells. Ifthe nucleotide sequences of interest are variable region encoding sequences, this will result in a combinatorial library of linked sequences. If, on the other hand, the nucleotide sequences of interest encode for a non-diverse heteromeric protein the randomly linked sequences will appear similar to sequences linked from a single cell.

[0066] The term ''template derived from an isolated single cell," with regard to reverse transcription, relates to the nucleic acids within such an isolated cell. The nucleic acids can for example be in the form of RNA, mRNA, DNA or genomic DNA. The nucleic acids can either be isolated from the cell or still be with the remaining contents of the cell, where the cell is in an intact form or a lysed form.

The Amplification and Linkage Process [0067] Onefeatureofthepresentinventionreducesthenumberoftubesnecessarytoamplifythenucleotidesequences of interest, utilizing a variant of PCR in which two or more target sequences are amplified simultaneously in the same tube, by including more than one set of primers, for example all the primers necessary to amplify variable region encoding sequences, ir> the same reaction. Generally this approach is known as multiplex polymerase chain reaction (multiplex PCR).

[0068] Multiplex PCR amplification and multiplex PCR preceded by reverse transcription (multiplex RT-PCR) are well known techniques within the diagnostic field, for example in the analysis of mutations, deletions and polymorphísms of DNA, for quantitative assays of mRNA levels and for identification of viruses, bacteria and parasites (reviewed in Mark-oulatos, P. et al. 2002. J. Clin. Lab. Anal. 16,47-51). However, thereare only very few examples where immunoglobulin light chain variable region encoding sequences has been amplified in the same vessel as immunoglobulin heavy chain variable region encoding sequences using a multiplex primer mix composed of more than four primers constituting a V_Kand/or ν_λ primer set together with a V_H primer set (Chapal, N. et al. 1997. BioTechniques 23, 518-524.; Liu, A.H. et al.

1992. Proc. Natí. Acad. Sci. U.S.A. 89,7610-7614; Embleton, M.J. et al. 1992. Nucleic Acids Res. 20, 3831-3837). The reason for this, might be that primer sets adapted for the amplification of sequences encoding the variable domains of antigen binding proteins generally are constituted of a plurality of degenerate primers in order to capture the diversity of these variable region encoding sequences. Thus, the complexity of the PCR reaction is highly increased when performing multiplex PCR amplification on variable region encoding sequences.

[0069] A further feature of the present invention is that two or more target sequences amplified by multiplex PCR are linked in close proximity to the amplification process. In particular cognate pairs of variable region encoding sequences are linked by this process.

[0070] One embodiment of the present invention exploits that a multiplex primer mix can be designed to work in an overlap-extension PCR procedure, resulting in a simultaneous amplification and linkage of nucleotide sequences of interest. This multiplex overlap-extension PCR technique serves to reduce the number of reactions necessary to isolate and link nucleotide sequences of interest, in particular cognate pairs of linked variable regions.

[0071] Other embodiments of the present invention apply linkage by Iigation or by recombination as an alternative to linkage by multiplex overlap-extension PCR. In these procedures, the linkage is not performed simultaneously with the multiplex PCR amp lifi cation, but as an immediate step following the amplification. However, linkage can still be performed in the same tube as the multiplex PCR was performed in.

[0072] In order to perform multiplex overlap-extension PCR, the presence of two or more primer sets (a multiplex primer mix), where at least one primer of each set is equipped with an overlap-extension tail is needed. The overlapextension tails enable the linkage of the products generated by each of the primer sets during amplification. Such a primer mix is called a multiplex overlap-extension primer mix. The multiplex overlap-extension PCR, differ from conventional overlap-extension PCR in that the sequences to be linked are generated simultaneously in the same tube, thereby providing immediate linkage of the target sequences during amplification, without any intermediate purification. Further, conventional overlap-extension PCR requires a separate linking PCR reaction either with an outer primer set or a nested primer set in order to generate the linked product (Horton, R.M. et al. 1989. Gene 77, 61-68). Such an additional amplification step ís optional in the multiplex overlap-extension PCR of the present invention.

[0073] A further feature of the present invention is a reverse transcription (RT) step preceding the multiplex PCR or multiplex overlap-extension PCR amplification, utilizing a template derived from an isolated single cell or a population of isogenic cells.

[0074] A feature of the present invention is the use of nucleotide sequences derived from an isolated single cell as template forthe multiplex PCR amplífication. Preferably, RNA from a single cell is reverse transcribed into cDNA prior to the multiplex PCR. For the amplification of some nucleic acid sequences of interest genomic DNA may be used as an alternative to mRNA. By using isolated single cells as template source, it is possible to avoid scrambling of nucleotide sequences encoding a heteromeric protein of interest, with nucleotide sequences derived from different cells within a population of cells. This is of importance if one wishes to obtain the original composition of the sequences of interest. Especially for the generation of a cognate pair of variable region encoding sequences, is the use of an isolated single cell as template source an important feature.

[0075] Multiplex overlap-extension PCR is a rarely used technology. WO 99/16904 discloses the linkage of exons from a genomic sequence in a single reaction, thereby generating cDNA without utilizing reverse transcription. The process as described, utilized one primer set (constituted of two primers) per exon to be linked, thereby composing a muftíplex overlap-extenslon primer mix. Each individual primer set was capable of overlapping with the adjacent primer set by complementary overlap-extension tails. The cDNA was generated from a template of genomic DNA by performlng an overlap-extension PCR reaction utilizing the m ultiplex overlap-extension primer mix followed by a nested PCR, which was described as a necessary step.

[0076] The generation of cDNA from the exons of genomic DNA as described in WO 99/16904 is a different field than the cloning of sequences encoding for heteromeric proteins. First of all, heteromeric proteins are generally expressed from different genes, whereas the exon linkage as described in WO 99/16904 relates to the linkage of exons from a single gene. Add itionally, the present invention facilitates the generation of libraries of linked nudeic acid sequences of interest, in particular combinatorial libraries and libraries of cognate pairs of variable regions; a completely different situation than linking a series of exons from a single gene, resulting in a single non-variable cDNA. Further, the present invention utilizes nucleic acids derived from single cells, preferably in the form of RNA that does not need to be isolated from the remaining cell contents before it can be utilized as template.

[0077] There are few publications, where multiplex overlap-extension RT-PCR has been described ín relation to linkage of variable region encoding sequences.

[0078] The most simpleform of multiplexoverlap-extension RT-PCR wasdescribed for the isolation of a scFvencoding sequence from a hybridoma cell line (Thirion, S. et al. 1996. Eur. J. Cancer Prev. 5, 507-511 and Mullinax, R.L et al. 1992. BioTechniques 12, 864-869). The methods described by Thirion and Mullinax utilized reverse transcription of mRNA with oligo-dT primers on total RNA extracted from the hybridoma cell line followed by a separate linkage step. The linkage step was performed with a total of four primers, constítuting two primer pairs for amplification of heavy chain variable region and light chain variable region encoding sequences, respectively. The V_L forward primer and the V_H or C_H reverse primer contained complementary overlap-extension tails, thereby enabling simultaneous amplification and linkage of the heavy chain variable region and light chain variable region encoding sequences. These methods dld not use a nested PCR to increase the sensitivity of the linkage method.

[0079] The other example of multiplex overlap-extension RT-PCR in relation to línkage of variable region encoding sequences was described in the previously mentioned WO 93/03151, providing a method of cloning heavy chain variable region and light chain variable region encoding sequences originating from the same cell without having to isolate single cells prior to the cloning. The method described in WO 93/03151 required washing between the RT step and the multiplex overlap-extension PCR step. Further, one of the specific aims brought about by WO 93/03151, was to solvethe problem of having to isolate single cells in order to obtain cognate pairs of variable region encoding sequences.

[0080] None ofthese known multiplex overlap-extension RT-PCRtechniques were developed to function on template derived from an isolated single celI. Neither were any of the methods able to perform as single-step RT-PCR reactions. [0081] One embodiment of the present invention encompasses the linkage of a plurality of non-contiguous nucleotide sequences of interest. The method comprises amplifying, in a multiplex PCR or multiplex RT-PCR amplification proce-dure, nucleotide sequences of interest using a template derived from an isolated single cell or a population of isogenic cells and effecting linkage of the amplified nucleotide sequences of interest. Further, the method comprises an optional step of performing an additional amplification of the linked products.

[0082] A further embodiment of the present invention encompasses a method of producing a library of cognate pairs comprising linked variable region encoding sequences. The method comprises providing a lymphocyte-containing cell fraction from a donor, which is optionally enriched for a particular lymphocyte population from said cell fraction. Further, a population of isolated single cells is obtained by distributing cells from the lymphocyte-containing cell fraction, or the enriched cell fraction, individually among a plurality of vessels. Multiplex molecular amplification (multiplex RT-PCR amplification) of the variable region encoding sequences contained in the population of isolated single cells is performed and linkage of pairs of variable region encoding sequences, wherein an individual pair is derived from a single cell, within the population of isolated single cell, ís effected. Further, the technique comprises two optional steps: in the first step the individual isolated single cell in the population of single cells is expanded to a population of isogenic cells prior to performing multiplex RT-PCR amplification. Thereby obtaining a plurality of vessels with a diverse population of isogenic cells (one population of isogenic cells in one vessel). The second optional step encompasses performing an additional amplification of the linked variable region encoding sequences.

[0083] In preferred embodiments of the present invention, an Individual member of said library of cognate pairs comprised of an immunoglobulin light chain variable region encoding sequence is associated with an immunoglobulin heavy chain variable region encoding sequence, originating from the same cell or of sequences encoding a T cell receptor binding domain, constituted of an alpha chain variable region associated with a beta chain variable region or a gamma chain variable region associated with a delta chain variable region, where the associated variable regions originate from the same cell.

[0084] The multiplex RT-PCR amplification of the present invention can be performed either as a two-step process, where reverse transcription (RT) is preformed separate from the multiplex PCR amplification (or altemative multiplex molecular ampl ification), or as a sing le-step process, where the RT and multiplex PCR amplification steps are performed with the same primers in one tube.

[0085] The reverse transcription (RT) is performed with an enzyme containing reverse transcriptase activity resulting in the generation of cDNA from total RNA, mRNAortarget specific RNAfrom an isolated single cell. Primers which can be utilized for the reverse transcription are for example oligo-dT primers, random hexamers, random decamers, other random primers, or primers that are specific for the nucleotide sequences of interest.

[0086] The two-step multiplex RT-PCR amplification procedure, allows for the cDNA generated in the RT step, to be distributed to more than one vessel permitting for the storage of a template fraction before proceeding with the amplification. Additionally, the d istrib utio n of cDNA to more than one tube, allows for the performance of more than one multi plex PCR amplification of nucleic acid derived from the same template. Although, this results in an increased number of separate reactions, it opens for the possibility to decrease the complexity of the multiplex primer mix if this should be desired. This two-step approach can for example be applied to amplify and link heavy chain variable region and kappa light chain variable region encoding sequences in one tube and heavy chain variable region and lambda light chain variable region encoding sequences in a different tube utilizing the same template. A síngle cell usually only expresses one of the light chains. However, it will often be easier to perform the reactions simultaneously instead of awaiting the result of one of the reactions before performing the other. Further, the ampliflcation of both kappa and lambda serves as an internal negative control, since it would be expected that only kappa or lambda ampiify from a single cell.

[0087] In the single-step multiplex RT-PCR procedure, reverse transcription and multiplex PCR amplification is carried out in the same vessel. All the components necessary to perform both the reverse transcription and the multiplex PCR in a single step are initially added into the vessels and the reaction is performed. Generally, there is no need to add additional components once the reaction has been started. The advantage of si ngle-step multiplex RT-PCR amplification is that it reduces the number of steps necessary to generate the linked nucleotide sequences of the present invention even further. This is particular useful when performing multiplex RT-PCR on an array of single cells, where the same reaction needs to be carried out in a plurality of vessels. Single-step multiplex RT-PCR is performed by utilizing the reverse primers present in the multiplex primer mix needed for the multiplex PCR a mplification as primers for the reverse transcription as well. Generally, the composition needed for the single-step multiplex RT-PCR comprises a nucleic acid template, an enzyme with reverse transcriptase activity, an enzyme with DNA polymerase activity, deoxynucleoside triphosphate mix (dNTP mix comprising dATP, dCTP, dGTP and dTTP) and a multiplex primer mix. The nucleic acid template is preferably total RNA or mRNA derived from an isolated síngle cell either ín a purified form, as a lysate of the cell or still within the intact cell. Generally, the exact composition of the reaction mixture requires some optimization for each multiplex primer mixture to be used with the present invention. Thís applies both for the two-step and the singlestep multiplex RT-PCR procedures.

[0088] In alternative embodiments of the present invention it may be appropriate to use genomic DNA instead of RNA as template. In such cases the reverse transcription step is omitted, and the remaining steps of The invention are performed as described throughout the application.

[0089] For some single-step multiplex RT-PCR reactions it may be an advantage to add add itional components during the reaction. For example, addition of the polymerase following the RT step. Other components could for example be a dNTP mixture or a multiplex primer mix possibly with a different primer composition. This can then be considered as a one-tube multíplex RT-PCR, which generally has the same advantages as the single-step multiplex RT-PCR, since it also limits the number of tubes necessary to obtain the desired linked products.

[0090] The nucleotide sequences of interest, amplified by the multiplex RT-PCR, can be linked to one another by several methods, such as multiplex overlap-extension RT-PCR, I igation or recombination, using different multiplex primer mixes. Preferably the multiplex RT-PCR amplification and linkage process is a single step or a two step process. However, the linkage process may also be performed as a multi step process, using for example a stuffer fragment to link the nudeic acid sequences of interest, either with PCR, ligation or recombination. Such a stuffer fragment may contain cis-elements, promoter elements or a relevant coding sequence or recognition sequence. In a preferred embodiment the linkage process is performed in the same vessel as the multiplex RT-PCR amplification.

[0091] In one embodiment of the present invention the linkage of a plurality of non-contiguous nucleotide sequences of i nterest is performed in association with the multiplex PCR amplification, utilizing a multi plex overlap-extension primer mix. This results in the combined amplification and linkage of the target sequences. Generally, the composition needed for the multiplex overlap-extension PCR comprises, a nucleic acid template, an enzyme with DNA polymerase activity, deoxynucleosidetriphospate mix (dNTP mixcomprising dATP, dCTP, dGTP and dTTP) and a m ultiplex overlap-extension primer mix.

[0092] In a particular embodiment of the present invention, the linkage of a plurality of non-contiguous nudeotide sequences of interest is performed by multiplex overlap-extension RT-PCR using a template derived from an isolated single cell or a population of isogenic cells. Further, the method comprises an optional step of performing an additional molecular amplification of linked products. Preferably, the multiplex overlap-extension RT-PCR is performed as a single-step/one-tube reaction.

[0093] A multiplex overlap-extension primer mix of the present invention comprises at least two primer sets capable of priming the amplification and línkage of at least two variable region encoding sequences, for example, amplification and linkage of sequences from immunoglobulin heavy chain variable region families with kappa or lambda light chain variable region families, or amplification and linkage of sequences from T cell receptor families a, β, γ, or δ.

[0094] ln another embodiment of the present invention the plurality of nudeotide sequences of interest, amplified by multiplex RT-PCR, are linked by ligation. To achieve this, the multiplex primer mix used for the multiplex RT-PCR, is designed such that the amplified target sequences can be deaved with appropriate restriction enzymes, and covalent linkage by DNA ligation can be performed (the primer design is described in the section "Primer Mixtures and Desigrí'). Following multiplex RT-PCR amplification with such a multiplex primer mix, the restriction enzymes needed to form compatible ends of the target sequences, are added to the mixture together with the ligase. No purification of the PCR products is needed prior to this step, although purification may be performed. The reaction temperature for the combined restriction cleavage and ligation is approximately between 0 and 40°C. However, if the polymerase from the multiplex PCR reaction is still present in the mixture, an incubation temperature below room temperature is preferred, most preferred are temperatures between 4 and 16°C.

[0095] In yet another embodiment of the present invention, the pl urality of nucleotide sequences of interest, amplífied by multiplex RT-PCR, are linked by recombination, In this approach, the target sequences amplified can be joined using identical recombination sites. Linkage is then performed by adding the recombinases facilitating recombination. Some suitable recombinase systems are Flp recombinase with a variety of FRT sites, Cre recombinase with a variety of lox sites, integrase <PC31 which carries out recombination between the attP site and the attB site, the β-recombinase-six system as well as the Gin-gix system. Linkage by recombination has been exemplified for two nudeotide sequences (V_H linked with V_L) (Chapal, N. et al. 1997 BioTechniques 23, 518-524), hereby incorporated by reference.

[0096] In a preferred embodiment of the present invention, the nudeotide sequences of interest comprise variable region encoding sequences and the linkage generates a cognate pair of variable region encoding sequences. Such a cognate pair may comprise one or more constant region encoding sequences in addition to the variable regions.

[0097] ln an even more preferred embodiment of the present invention, the nudeotide sequences of interest comprise immunoglobulin variable region encoding sequences and the linkage generates a cognate pair of light chain variable region and heavy chain variable region encoding sequences. Such a cognate pair may comprise one or more constant region encoding sequences in addition to the variable regions. Further, such a cognate pair may be isolated from template derived from cells of the B-lymphocyte lineage enriched from a lymphocyte-containing cell fraction, such as whole blood, mononudear cells or white blood cells.

[0098] In a just as preferred embodiment of the present invention, the nudeotide sequences of interest comprise TcR variable region encoding sequences and the linkage generates a cognate pair of α chain variable region and β chain variable region encoding sequences orychain variable region and δ chain variable region encoding sequences. Such a cognate pair may comprise one or more constant region encoding sequences in addition to the variable regions. Further, such a cognate pair may be isolated from template derived from cells of the T-lymphocyte lineage enriched from a lymphocyte-containing cell fraction, such as whole blood, mononudear cells or white blood cells.

[0099] An efficient way to increase the specificity, sensitivity, and yield of the multiplex RT-PCR-linkage process, is by performing an addítional molecular amplification of the linked nucleotide sequences obtained from the multiplex RT-PCR followed by linkage by ligation or recombination or linkage using the multiplex overlap-extension RT-PCR. This additional amplification is preferably performed with PCR amplification, utilizing a primer mix adapted for amplifying the linked nucleic acid sequences of interest. The primer mix utilized may be the outer primers of the multiplex primer mix or multiplex overlap-extension primer mix, meaning the primers which anneal to the outermost 5’ end and 3’ end of the sense strand of the linked variable region encoding sequences, thereby enabling the amplification of the entire linked product The outer primers can also be described as the primers of the multiplex overlap-extension primer mixture that do not contain overlap extension tails. Alternatively, a nested or semi-nested primer set can be used for the additional amplification of the linked nucleotide sequences. Such a nested PCR especially serves to increase the specificity of the method as well as to increase the amount of linked product. For the present invention, semi-nested PCR (as described in the section entitled Primer Mixtures and Design) is considered to function as well as the nested PCR. Thus, it is desired although not necessary for the present invention to perform an additional PCR ampl ification of the linked products from the multiplex overlap-extension RT-PCR or of the products linked by ligation or recombination, preferably using nested PCR or semi-nested PCR.

[0100] The additional amplification can either be performed directly using a fraction or the entire multiplex overlap-extensionRT-PCRreactionproductorligation productorrecombination product, orafraction ofanyoneofthese products or using partially purified linked productsfrom any one of these reactíons, eg. by performing an agarosegel electrophoresis of the linked products, and excising thefragment Gorresponding to the expected size of the linked variable region encoding sequences. For products linked by multiplex overlap-extension RT-PCR, the additional amplification is preferably performed directly on a fraction from the multiplex overlap-extension RT-PCR reaction, since this would assist linkage of the indMdual target sequences that were not linked in the first reaction.

Sequences of interest [0101] The nucleotide sequences of interest of the present invention can be selected from sequences that encode different subunits or domains, whích when expressed, forms a protein or part of a protein. Such proteins that are composed of at least two non-identical subunits are known as heteromeric proteins. Heteromeric proteins are common in all kinds of species. Some of the classes to which such proteins belong are for example enzymes, inhibitors, structural proteins, toxins, channel proteins, G-proteins, receptor proteins, immunoglobulin superfamily proteins, transportation proteins etc. The nucleotide sequences encoding such heteromeric proteins are non-contiguous, meaning for example that they originate from different genes, or different mRNA molecules. However, non-contiguous as used in the present invention may also mean nucleotide sequences encoding domains of the same protein, where the domains are separated by nucleotide sequences which are not of interest.

[0102] In one embodiment of the present invention the nucleotide sequencess of interest contain variable region encoding sequences from the immunoglobulin superfamily, such as immunoglobulins (antibodies), B cell receptors and T cell receptors (TcR's). Especially variable region encoding sequences from immunoglobulins are of interest. Such variable region encoding sequences comprise full-length antibodies as well a$ Fab’s, Fv's, scFv’s and combinations of fragments ofthe variable region encoding sequences, e.g. complementarity determining regions (CDR’s), joining genes or V-genes or combinations of these. Generally the present invention can be applied with any combinations of variable region encoding sequences and fragments thereof. The present application exemplifies the linkage of the entire light chain with the variable domain of the heavy chain. However, the present invention also allowforthe linkage of only the variable domains of the heavy and light chains generating Fv or scFv encoding sequences, orthe linkage of the entire light chain with the heavy chain variable region + constant region domain C_H1 + parts of the hinge region, generating Fab, Fab’ or F(ab)₂. Further, it is possible to add any region of the heavy chain constant region domains to the variable heavy chain, thereby generating truncated antibody encoding sequences or full-length antibody encoding sequences. [0103] In a further embodiment of the present invention variable region encoding sequences comprise one type of immunoglobulin light chain (kappa or lambda) encoding sequence and one immunoglobulin heavy chain variable region encoding sequence.

[0104] Variable region encoding sequences derived from T cell receptors (TcR's) are also of interest. Such TcR encoding sequences comprise encoding sequences for full-length alpha and beta chains or gamma and delta chains as well as soluble TcR’s or only the variable domains of these chains or single chain fusion proteíns thereof (e.g. single chain αβ or single chain γδ).

Template sources [0105] One feature of the present invention is the ability to link nucleotide sequences derived from an isolated single cell which have not been separated into single vessels. The cells utilized in the present invention can for example be bacteria, yeast, fungi, insect cells, plant cells or mammalian cells or fractions of such cells. Blood cells derived from mammals are one example of a fraction of cells that can be utilized in the present invention.

[0106] Afeature of the present invention is the use of isolated single cells as template source, since scrambling of the nucleic acid sequences of interest, in particular variable region encoding sequences is avoided. This is of importance if one wishes to obtaln an original pair of forexample variable region encoding sequences.

[0107] Another preferred feature of the present invention, is obtaining a single cell from a cell fraction comprising lymphocytes, such as B lymphocytes, T lymphocytes, plasma cells and/or various developmental stages of these cell lineages. Other populations of cells that express binding proteins from the immunoglobulin superfamily might also be used to obtain single cells. Cell linessuch as hybridoma cells, cell lines ofB lymphocyte or T lymphocyte lineage orvirus immortalized cell lines or donor derived cells participating in the immune response are also applicable in the present invention. Donor derived lymphocyte-containing cell fractions may be obtained from natural tissue or fluid which is rich in such cells, e.g. blood, bone marrow, lymph nodes, spleen tissue, tonsil tissue or from infiltrations in and around tumors or inflammatQry tissue infiltrations. Suitable cell donors for the present invention can be selected from vertebrates that all contain an acquired immune system. Donors can either be naive or hyperimmune with respect to a desired target. For the isolation of antigen binding proteins with binding specifícities toward a desired target, hyperimmune donors are preferred. Such hyperimmune donors can either be donors immiinized with the target, or fragments of the target, or it can be convalescent patients, or ποη-healthy indmduals which are running a natural immune response towards tha target e.g. autoimmune patients, cancer patients, patients with infectious diseases e.g. HIV patients, Hepetitis A, B or C patients, SARS patients etc., or patients with chronic diseases.

[0108] When utilizing recombinant proteins for treatment, it is preferable that they are derived from sequences that have species identity with the individual to be treated (e.g. human sequences for treatment of humans). Firstiy, because recombinant proteins derived from a foreign sequence (i.e. non-human) will be recognized by the immune system leading to an immune response implicating polyclonal anti-protein antibodies. These anti-protein antibodies can blockthe drug action by occupying the active site, they wil I accelerate drug clearance and they could potentia lly ind uce adverse reactions such as hypersensitivity reactions upon repeated exposure.

[0109] Immunogenícity may however, also be seen in cases where the recombinant protein is derived from a sequence that have species identity, Such immunogenicity can for example be induced by post-translational modifications that might differ from those seen in vlvo. Combinatorial líbraries of variable region encoding sequences might also give rise to immunogenicity, since they consist of random pairs of variable region encoding sequences created in vitro. The rules that govern formation of antibody heavy and light chain encoding sequence pairs (or T cell receptors) in vivo are not completely understood. Hence, it follows that some of the in vitro formed pairs could be recognized as foreign by the immune system, even though both sequences constituting the pair are perfectly human. Binding proteins obtained from cognate libraries do on the other hand not create said abnormal combinations and they are consequently of lesser potential immunogenicity than binding proteins from combinatorial libraries. This does not mean that products from combinatorial libraries are unsuitable for treatment, they just require a larger degree of monitoring with respect to the above mentioned side effects.

[0110] For use in the present invention, cell donors should preferably be of the same species as the species to be treated with the products obtainable from the linked nucleotide sequences of the present invention. Preferably, a cell donor is a domestic animal, a pet, a human ora transgenicanimal. Transgenic animals carrying human immunoglobulin loci are described in U.S. Patent No. 6,111,166 and Kuroiwa, Y. et al. Nature Biotechnology; 2002; 20: 889-893. Such transgenic animals are capable of producing human immunoglobulins. Thiis, fully human antibodies against a specific target can be raised by usual immunization techniques of such transgenic animals. This allows for generation of libraries encoding for binding proteins with specificities towards more difficult targets such as human antigens to which no or limited natural human antibody response exist. Such transgenic animals can likewise be developed to produce human T cell receptors.

[0111] In a further embodiment of the present invention, the lymphocyte-contaíning cell fraction is constituted ofwhole blood, bone marrow, mononuclear cells, or white blood cells obtained from a donor. Mononuclear cells can be isolated from blood, bone marrow, lymph nodes, spleen, infiltrations around cancer cells and inflammatory infiltrations. Mononuclear cells can be isolated by density centrifugation techniques, e.g. Ficoll gradients. If the mononuclear cells are isolated from samples composed of tissue, the tissue is disintegrated before the gradient centrifugation is performed. Disintegration can be performed, for example, by mechanical methods such as grinding, electroporation and/or by chemical methods such as enzymatic treatments. The isolation of white blood cells can be performed directly from donors using leukopheresis. Raw preparations of for example bone marrow or tissue, which contain lymphocytes, can also be used in the present invention. Such preparations will need to be disintegrated, for example as described above, in order to facilitate single cell distribution.

[0112] A further feature of the present invention is enrichment of the lymphocyte-containing cell fraction e.g. whole blood, mononuclear cells, white blood cells or bone marrow, with respectto a partícular lymphocyte population, such as cellsfrom the B lymphocyte orTlymphocytelineage. Enrichmentof B lymphocytes can forexample be performed, using magnetic bead cell sorting or fluorescence activated cell sorting (FACS) taking advantage of lineage-specific cell surface marker proteins such as CD19 or other B cell lineage-specific markers. Enrichment of T lymphocytes can for example be performed, utilizlng a cell surface marker such as CD3 or other T cell lineage-specific markers.

[0113] A preferred feature of the present invention is to sort the enriched B lymphocytes further in order to acquire plasma cells, before distributing the cells individually among a plurality of vessels. Isolation of plasma cells is generally performed by FACS sorting, utílízíng surface markers such as CD38 possibly in combiriation with CD45. Other plasma cell-specific surface markers or combinations thereof can be utilized as well, for example CD138, CD20, CD21, CD40, CD9, HLA-DR or CD62L, the exact choice of marker depends on the plasma cell source, e.g. tonsils, blood or bone marrow. Plasma cells can also be obtained from a non-enriched lymphocyte-containing cell population obtained from any of these sources. The plasma cells isolated from blood are sometimes called early plasma cells or plasmablasts. In the present invention these cells are also termed plasma cells although they are CD19 positive in contrast to plasma cells residing in the bone marrow, Plasma cells are desired for the isolation of cognate pairs of immunoglobulin encoding sequences because a higher frequency of these cells produces antigen-specific antibodies that reflect the acquired immunify toward the desired antigen and mostofthe cells have undergone somatic hypermutation and therefore encode for hígh-affinity antibodies. Further, the mRNA levelsin plasma cellsare elevated compared tothe remaining B lymphocyte population, thus the reverse transcription procedure is more efficient when using single plasma cells. As an alternative to plasma cell isolation, memory B cells may be isolated from a lymphocyte containing cell fraction utilizing a cell surface marker such as CD22.

[0114] An alternative feature of the present invention, is selecting the enriched B lymphocytes for antigen specificity before distributing the cells among a plurality of vessels. Isolation of antigen-specific B lymphocytes is performed by contacting the enriched B lymphocytes with the desired antigen or antigens enabling binding of antigen to surface exposed immunoglobuh'n, followed by isolation of binders. This can be done, for example, by coating magnetic beads with the desired antigen or antigens followed by magnetic bead cell sorting, by FACS, by coating a column with the antigens followed by affinity chromatography, by filter screening assays or other methods known in the art. Plasma cells as well as B lymphocytes, non-enriched mononuclear cells, white blood cells, whole blood, bone marrow or tissue preparations can be subjected to isolation with respect to antigen specificity if this is desired.

[0115] Another feature of the present invention, is to sort enriched T lymphocytes (e.g. CD3 positive cells) using surface markers CD45R0 and/or CD27 to obtain a fraction of memory T cells. T lymphocytes can also be selected for MHC-antigen specificity using MHC-peptide complexes (e.g. Callan, M.F. et al. 1998. J. Exp. Med. 187, 1395-1402; Novak, E.J. etal. 1999. J. Clin. Invest 104, R63-R67).

[0116] A further feature ofthe present invention is immortalization of any ofthe isolated cell fractions described in the above (e.g. B lymphocytes, plasma cells, memory cells or T ly mphocytes). ImmortalizatÍQn may for example be performed with Epstein-Barr virus (Traggiai, E., et al„ 2004. Nat Med 10, 871-875) prior to cell distribution. Alternatively, isolated single cells may be immortalized and expanded priorto reverse transcription. Traggiai et al., Nat Med. 2004 Aug;10(8): 871-5.

[0117] A further feature of the present invention, is the distribution of a population of desired cells (e.g. hybridoma cells, cell lines of B lymphocyte orT lymphocyte lineage, whole blood cells, bone marrow cells, mononuclear cells, white blood cells, B lymphocytes, plasma cells, antigen-specific B lymphocytes, memory B cells, T lymphocytes, antigen/MHC-specific T lymphocytes, or memory T cells) individually, into a plurality of vessels, in order to obtain a population of isolated single cells. This isolation of single cells refers to the physical separation of cells from a population of cells in such a way that a single vessel contains a single cell, or a micro array, chip or gelmatrix is loaded in a manner that produce single cells. The cells may be distributed directly into multitudes of vessels such as arrays of single vessels by limiting dilution. The single vessels utilized in the present invention are preferably those applicable in PCR (e.g. PCR tubes and 96 well or 384 well PCR plates or larger arrays of vessels). However other vessels may also be used. When d istributing single cells into a large number of single vessels (e.g. 384 well plates), a population of single cells is obtained. Such a d istri b ution may be performed, for example, by dispensing a volume into a single vessel that on average encompasses a cell concentration of one, 0.5 or 0.3 cell, thereby obtaining vessels that on average contain a single cell or less. Since distribution of cells by limiting dilution is a statistical event, a fraction of the vessels will be empty, a major fraction will contain a single cell, and a minor fraction will contain two or more cells. Where two or more cells are present in a vessel some scrambling of the variable region encoding sequences may occur among the cells present in the vessel. However, since it is a minor event it will not affect the overall utility of the present invention. Additionally, combinations of variable region encoding sequences which do not posses the desired binding affinity and specificity will most likely not be selected and hence eliminated during a screening process. Therefore, minor events of scrambling will not significantly affect the final library of the present invention.

[0118] There are alternatives to cell distribution by limiting dilution using, for example, cell sorters such as FACS machines or robots that can be programmed to accurately dispense single cells into single vessels. These alternatives are preferable, since they are less laborious and are more effícient in uníformly obtaíning a dístribution of single cells into single vessels.

[0119] The enrichment, sorting and ísolation procedures described in the above, are performed such that the majority of the cells are kept intact. Rupture of cells during enrichment and sorting might result in scrambling of the variable region encoding sequences. However, this is not expected to be a problem since the frequency of rupture is expected to be low. Washing and possible RNAse treatment of the cells prior to distribution into single vessels will remove any RNA that has leaked during the process.

[0120] Further, when considering the above descriptions of how to distribute cells in order to obtain a population of single cells in a population of single vessels, it is not to be interpreted as an absolutely required feature that every vessel must contain a single cell. Rather, it indicates that a majority of the vessels contain single cells, e.g. the number of vessels with two or more cells is below 25% of the total amount of cells distributed, or even better it is below 10%.

[0121] A further feature of the present invention is the performance of a reverse transcription using template derived from cells distributed individually among a plurality of vessels.

[0122] For the purpose of reverse transcription (RT), in accordance with the present invention, the nudeic adds within a single cell that is to serve as template source for the RT, are considered to be derived from a single cell although they have not necessarily been separated from the remaining contents of that single cell.

[0123] When the final distribution of the single cells to their single vessels has been performed, the single cells may be expanded in order to obtain a population of isogenic cells prior to reverse transcription. This process yields more mRNA to be used as template, which might be important if a rare target is to be amplified and linked. However, the cells shojldremaingeneticallyidenticalwithrespecttothetargetgenediiringtheexpansion.Theisolatedcellsorthepopulation of isogenic cells can either be kept intact or lysed, as long as the template for the reverse transcription is not degraded. Preferentially, the cells are lysed in order to ease the following reverse transcription and PCR amplification.

[0124] In a different embodiment of the present invention, the disdosed multiplex overlap-extension RT-PCR method or multiplex RT-PCR followed by linkage by ligation or recombination may also be utilized on template derived from a genetically diverse population of cells which have not been separated into single vessels, but all remain together as a pool of cells. This method may be used for the generation of combinatorial libraries. Such an approach will not require the distribution of single cells. However, the cells which may be used in this approach are the same as those described forthe single cell approach, forexamplea population (pool) of sorted B lymphocytes orT lymphocytes. When performing the single-step multiplex overlap-extension RT-PCR or single-step multiplex RT-PCR followed by linkage by ligatíon or recombination on such a population of cells, it is preferable to lyse the cells prior to the reaction and if desired total RNA or mRNA may be isolated from the lysate.

[0125] The sensitivity of the single-step multiplex overlap-extension RT-PCR of the present invention enables the use of a very low amount of template. As shown in Example 2 and 3, single-step multiplex overlap-extension RT-PCR may be carried out on an amount of template corresponding to the lysate of a single cell.

Primer Mixtures and Design [01126] The primer mixtures of the present invention comprise at least four primers that form primer sets two by two, which are capable of amplifying at least two different target sequences of interest. Mixtures of two or more of such primer sets constitute a multiplex primermix. Preferably, a multiplex mix comprise at least 3,4,5,6,7, 8, 9,10,11,12,13,14, 15,16,17,18,19or 20, 30,40,50,60,70,80, 90 100,110,120,130,140 or 150 primersets (primerpairs). In particular for the amplification of variable region encoding sequences, may an individual primer set within the multiplex primer mix constitute several more than two primers. Preferably, an individual primer set comprise at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280 or 300 primers. Preferably the total number of primers in a multiplex primer mix is at least 5, 6, 7, 8, 9, 1C, 11,12,13,14,15,20,25, 30, 35,45, 50,60, 70,80, 90,100,125,150 or 200 and atthe most 225,250,275, 300, 325, 350, 375 or 400 primers.

[0127] All the primers of the present invention comprise a gene-specific region, and preferably all primers are additionally equipped with a primer tail at the 5' end of the primer, i.e. 5' non-coding sequences which are fused to the 3’ end of the gene-spedfic primer part. Such a primer tail is approximately from 6 to 50 nudeotides long, but it may also be longer if desired. Upon amplification the primer tails are added to the target sequences.

[0128] Primer tails of the present invention are for example, doning tails and linkage tails such as, tails adapted for linkage by ligation, tails adapted for linkage by recombination or overlap-extension tails.

[0129] Cloning tails may be from 6 to 20 nudeotides long or longer and comprise restriction sites and/or recombination sites, which are useful for the insertion of the linked product into an appropriate vector.

[0130] To enable linkage by ligation, the primer sets of the multiplex primer mix are designed such that one part (forward or reverse primer(s)) of the first primer set is equipped with a linkage-taiI containing a restriction site that upon cleavage will be compatible with a restriction site located in the linkage tail of one part of the second primer set. For linkage of more than two target sequences, the second part of the second primer set is equipped with a restriction site that upon deavage will be compatible with a restriction site located in one part of the third primer set. This second restriction site located in the second primer set should be non-compatible with that of the first primer set. A considerable number of target sequences can be linked by designing primer sets this way. Restriction sites with a low frequency or no occurrence, in the target sequences should be chosen. Further, it is preferable that compatible restriction sites are not identical, such that the site of ligation becomes cleavage-resistant for the particular restriction enzymes used. This will drive the reaction towards linkage of targetsequence one with target sequence two, since linkage between identical target sequences will be cleavable by the restríction enzymes. Suitable pairs of restrictíon sites are for example, Spel with Xbal (alternatively Nhel or Avrll can substitute one or both of these), Ncol with BspHI, EcoRI with Mfel or Pstl with Nsil. For linkage, Spel can for example be located in target sequence one, Xbal can be located in target sequence two, Ncol can be located at the other end of target sequence two and BspHI in target sequence three and so forth. To simplify the process further, it is an advantage if the restriction enzymes function in the same buffer.

[0131] To enable linkage by recombination the primer sets of the multiplex primer mix can for example be designed as exemplified in the article by Chapal (1997 BioTechniques 23, 518-524), which is hereby incorporated by reference. [0132] T o enable the linkage of the nucleotide sequences of interest in the same step as the multiplex PCR amplification, tails adapted for overlap-extension PCR are added to at least one primer of each primer set of the multiplex primer mix, thereby generating a multiplex overlap-extension primer mixture.

[0133] The overlap-extension tails are typically longer, ranging from 8 to 75 nudeotides in length and may contain restriction sites or recombination sites which allow for subsequent insertion of regulatory elements such as promoters, ribosomal binding sites, termination sequences, or linker sequences such as in a scFv. The overlap-extension tail may also contain a stop codon if that is desired. Generally there are three types of overlap-extension tails, as illustrated in Figure 1, In type I the overlap-extension tails of two primer sets solely overlap with each other. Not necessarily all of the nudeotides of two overlap-extension tails are complementary to each other. In one aspect of the present invention the complementary nudeotides represent between 60 to 85% of the overlap-extension tail. In type II overlap-extension tails, 4 to 6 of the 5’ nucleotides are complementary to the gene-specific region of the adjacent target sequence. In type III overlap-extension tails, the entire overlap is complementary to the adjacent target sequence. The type I and II overlapextension tails are preferred when regulatory elements and the like are later to be inserted between the linked target sequences. Type II overlap-extension tails are preferred if the target sequences are to be linked by a defined linker as seen with scFv. T ype III overlap-extension tails are preferred if the target sequences are to be linked in-frame to each other. [0134] Design of overlap-extension tails is dependent on sequence features such as length, relative GC content (GC%), presence of restriction sites, palindromes, melting temperature, the gene-spedfic part to which they are coupled etc. The length of the overlap-extensíon tails should be between 8 and 75 nucleotides long, preferably they arefrom 15 to 40 nucleotides long. Even more preferred they are from 22 to 28 nudeotides long. The use of very long overlapextension tails (50 to 75 nudeotides) could favor the linkage of the products produced by each primer set. However, the proportion between the length of the overlap-extension tail and the gene-spedfic region probably will need to be adjusted when using very long overlap-extension tails. The GC% preference is dependent on the length of the overlap-extension tail. Since shorter tails have a shorter area where they are complementary they need a higher GC% to strengthen the interaction than longer tails. Other prindplesof primerdesign should likewise beobserved, e.g. primerdimerization and hairpin formation should be minimized. Neither shall they engage in false priming. Further, it is known that Taq DNA polymerase often adds an adenosine (A) at the 3' end of the newly synthesized DNA strand, and this can be accommo-datedforinoverlap-extensiontail designby enablingoverlap-extensiontailstoaccommodate 3' non-templateAaddition. [0135] The choice of primers that carry the linkage tail, e.g. the overlap-extension tail, tail adapted for linkage by ligation or tail adapted for linkage by recombination, defines the order and direction of Iinkage of the target sequences. It is not essential to The invention whether it is the forward primer(s) or reverse primer(s) of a primer set or possibly both forward and reverse primers that are equipped with the linkage tail. However, some consideration should be given to this anyway since the order and direction of the target sequences in the final product might be of relevance e.g. for the insertion of regulatory elements such as promoters and termination sequences or for the in-frame linkage of the individual target sequences.

[0136] For the linkage of two nudeotide sequences of interest the linkage tail may be added either to the reverse primer(s) or forward primer(s) of each prímer set used for the PCR amplification of each target sequence. The present invention exemplifies addition of overlap-extension tails and tails adapted for linkage by ligation, to the V_H and V_L forward primers of each set (e.g. Figure 2 and example 9, respectively). This results in a linking direction of the products that is 5’ to 5’ (head-to-head and bi-directional). However, linkage tails might as well be added to the reverse prlmer(s) of each set (e.g. C_K and/or Ο_λ, in the first set and C_H or J_H in the second set). This results in a linking direction of the product that is 3’ to 3’ (tail-to-taiI and bi-directional). A third option Is adding the linkage tails to the reverse primer(s) of the first primer set (e.g. C_K and/or C\ primers) and the forward primer(s) of the second primer set (e.g, V_H primer(s)) or visa versa. This results in a 3’ to 5’ orientation (head-to-tail and uni-directional). Figure 3 illustrates the possible directions that can be generated depending on which primer of each primer set that is equipped with the linkage tail.

[0137] When linking more than two nudeotide sequences of interest some of the primer sets need to have linkage tails on both the forward and reverse primers, such that one tail is complementary to a tail of the preceding primer set and the other tail is complementary to one of the primers of the subsequent primer set. This principle holds for all the primer sets that amplify target sequences that are to be linked between two other target sequences.

[0138] The design of the gene-specific primer part generally should observe known primer design rules such as minimizing primer dimerization, hairpin formation and non-specific annealing. Further, multiple G or C nucleotides as the 3’ bases are to be avoided when possible. The melting temperature (Tm) of the gene-specific regions in a primer set should preferably be equal to each other plus/minus 5“C. In the present invention Tm values between 45°C and 75°C are desirable and Tm values of about 60°C are optimal for most applications. Advantageously, the initial primer design can be aided by computer programs developed for this task. However, primer designs generally need laboratory testing and routine optimization. This may be done, for example, by analyzlng size, restriction fragment length polymorphism (RFLP) and sequencing of the amplification products obtained using the primer sets. The use of degenerate positions within primers is a useful approach when amplifying sequences with variable regions or when searching for new family members belonging to a specified class of proteins. The numbers of degenerate positions may also require optimization.

[0139] The present invention encompasses improved primer sets that can be used together in a highly multiplexed format. The primer set described by de Haard (de Haard, H.J, et al. 1999. J. Biol. Chem. 274,18218-18230) were used as starting point, and was modified by trimming the 3’ ends of the primers to reduce non-specific interactions and adding overlap-extension tails or tails adapted for linkage by ligation.

[0140] One feature of the present invention, are primer mixes composed of at least two primer sets that are able to prime amplification and promote linkage of at least two nucleotide sequences of interest. The primer mixes of the present invention are capable of priming the amplification of at least two subunits or domains from heteromeric proteins, e.g. belonging to the class of enzymes, inhibitors, structural proteins, toxins, channel proteins, G-proteins, receptor proteins, immunoglobulin superfamily proteins, transportation proteins etc.

[0141] A further feature of the present inventíon is a multiplex overlap-extension primer mix comprising primer sets wherein at least one primer set member of each primer set comprises an overlap-extension tail capable of hybridizing to the overlap-extension tail of a primer set member of a second primer set.

[0142] The overlap-extension tails enables the immediate linkage of the nucleotides of interest during the multiplex overlap-extension PCR amplification by equipping each individual product arising from the primer sets with a tail that is complementary to an adjoining product. This however does not mean that the linkage necessarily occur during this first PCR amplification. Depending on the reaction setup, the majority of the actual linkage may be performed during an additional amplification with the outer primers of the first PCR amplification (multiptex PCR amplification), [0143] A further feature of the present invention, is a primerset designed to amplify a famlly of nudeotide sequences containingvariableregionencodingsequences. Examplesofsuchfamiliesarekappa lightchains (e.g. VKI-VI in humans), lambda light chains (e.g. VL1-10 in humans) and variable heavy chains (e.g. VH1-7 in humans and VH1-15 in mice) frcm immunoglobulins, and α, β, yor δ TcR variable regions. A primer set for the amplification of a family of nucleotide sequences containing variable region encoding sequences often comprise a plurality of primers where several primers can be degenerate primers. Amplification of families of immunoglobulin light chain variable region encoding sequences is for example performed using a primer set comprised of a plurality of primers complementary to the 5’ end of the variable region of the kappa chain (V_Llc primer(s)) or the kappa leader sequence (V_Lt._L primer(s)) and/or the lambda chain (V_LX primer(s)) or the lambda leader sequence (V_LXL primer(s)) (forward primers) together with constant region kappa (C_K primer(s)) and/or lambda primers (C\ primer(s)) (reverse primers) or a plurality of such primers. Alternatively, light chain joining region primers (J_Lk. and/ or primer(s)) may be used as reverse primers instead of the constant region primers. Alternatively, forward primers anneal in the UTR region preceding the leader sequence of the variable light chain. Equally, families of immunoglobulin heavy chain variable region encoding sequences can be amplified with one primer set utilizing various primer combinations. For example, a plurality of primers complementary to the 5’ end of the heavy chain varíable region (V_H primer(s)) or the leader sequence of this region (V_HL primer(s)) (forward primers) together with a plurality of heavy chain joining region primers (J_H primer(s)) or heavy chain constant region primer(s) (reverse primers). The C_H primer may ba isotype-specific and in principle any C_H primer can be utilized (e.g. C_H1, C_H2, C_H3, or C_H4), also one that would result In a full-length heavy chain. Alternatively, forward primers anneal in the UTR region preceding the leader sequence of the variable heavy chain.

[0144] The use of forward primers annealing in the leader sequence instead of the 5’ end of the variable region is particular useful if cross-hybridization is observed for the variable region primers. Since mutations due to cross-hybridization will be eliminated from the final protein because leader sequences are cleaved off during protein processing within the cell. Example 9 describes the design of antibody variable heavy chain and kappa light chain leader primers. The aspect that the site of priming is located in the 3' end of the leader encoding sequence (C-terminal) is an advantage over previous antibody leader primers, since this allows for shuttling of the amplified sequences between bacterial and eukaryotic expression vectors in a way that allow functional leader sequences in both system. The design system described in Example 9 can easily be applied to antibody lambda light chains, TcR α, β, γ or δ chains as well.

[0145] One feature of the present invention are primers which anneal in the 3’ end of the leader encoding sequence preceding a variable region encoding sequence, and their use for amplification of variable region encoding sequences.

[0146] A preferred feature of the present invention is the application of primers with at least 90% sequence identity (preferably at least 95% identity) with the gene-specific region of SEQ ID NO 86 to 92, which correspond to primers annealing in the C-terminal of heavy chain leader encoding sequences (V_HL primers). The gene-specific sequence of these SEQ ID NO’s correspondto base number 18 to the 3' end ofthe sequences (see also table 11).

[0147] Another preferred feature of the present invention is the application of primers with at least 90% sequence identity (preferably at least 95% identity) with the gene-specific region of SEQ ID NO 93 to 98, which correspond to primers annealing in the C-terminal of kappa light chain leader encoding sequences (V_LkL primers). The gene-specific sequence of these SEQ ID NO’s correspond to base number 25 to the 3’ end of the sequences (see also table 11).

[0148] In one embodiment of the present invention, the multiplex overlap-extension primer mix utilized forthe multiplex overlap-extension PCR and possibly for the reverse transcription step as well comprises a) at least one C_L or J_L primer complementary to the sense strand of an immunoglobulin light chain region encoding sequence; b) at least one V_L 5’ primer or V_L leader primer complementary to the antisense strand of an immunoglobulin light chain variable region encoding sequence and capable of forming a primer set with the primer(s) in a); c) at least one C_H or J_H primer complementary to the sense strand of an immunoglobulin constant heavy chain domain encoding sequence or the heavy chain joining region and d) at least one V_H 5' primer or V_H leader primer complementary to the antisense strand of an immunoglobulin heavy chain variable region encoding sequence, and capable of forming a primer set with the primer (s) in c).

[0149] Primer sets of the present invention can for example be V_Llí + C_K, V_u+ C_/? V_Lk + J_Lk, V_lz + J_LX, V_LkL + C_K, V_LXL^{+ <}-^:λ, VLkl ⁺ Jl>c’ Vlxl ⁺ 4λ> ^{+ +} CH. V_hl^{+ j}h ^{or v}hl ⁺ orcombinations of these, capable of amplifyíng a variable region encoding target sequence.

[0150] In a further embodiment are the C_L (J_L) primer(s) and V_L (V_LL) primer(s) adapted for amplifying sequences comprising kappa light chain variable regions or lambda light chain variable regions.

[0151] In a preferred embodiment of the present invention the are the C_L (J_L) primer(s) and V_L (V_LL) primer(s) adapted for amplifying both kappa and lambda light chain variable region encoding sequences.

[0152] In an even more preferred embodiment of the present invention, are the forward primers for light chain amplification V_LL primers with at least 90% sequence identity (preferably at least 95% identity) with the gene-specific region of SEQ ID 93 to 98, and the forward primers for heavy chain amplification are V_HL primers with at least 90% identity (preferably at least 95%) with the gene-specific region of SEQ ID 86 to 92.

[0153] In a further embodiment of the present invention, carries the immunoglobulin V_L/ V_LL and V_HA/_HL primers linkage tails, preferably in the form of complementary overlap-extension tails. This generates variable region encoding sequences that are linked in a head-to-head fashion. Forthe linkage of variable region encoding sequences in a head-to-tail fashion, either the C_L/J_L and V_H/V_HL primers contain linkage tails or the V_LA/_LL and C_H/ J_H primers contain linkage tails, preferably in the form of complementary overlap-extension tails. For the linkage of variable region encoding sequences in a tai l-to-tai I fashion, the C_L/J_L and C_H/J_H primers contain linkage tails, preferably in the form of complementary overlap-extension tails (Figure 3).

[0154] Preferentially, the multiplex primer mixes, including multiplex overlap-extension primer mixes, of the present invention comprise two primer sets. Thus, a multiplex primer mix comprises at least four different primers. In a further aspect of the present invention a multiplex primer mix comprises more than four different primers. A multiplex primer mix of the present invention is used for the amplification of target sequences in a single vessel. For example are kappa, lambda and heavy chain variable regions all amplified in the same vessel. One multiplex primer mix of the present invention was comprised of 16 different degenerate primers distributed as follows: eight V_H primers, one C_H1 primer, six V_Lk primers, and one C_K primer (Figure 2). Another set was comprised of 19 degenerate primers distributed as follows: eight V_H primers, four J_H primers, six V_LKprimers, and one C_Kprimer. A third set was comprised of 22 degenerate primers distributed as follows: eight V_H primers, one C_H1 primer, eleven V_LX primers, and two Ο_λ primers. A fourth set was comprised of 27 degenerate primers distributed as follows: eight V_H primers, one C_H1 primer, six V_Lk primers, one C_K primer, eleven V_LX primers, and two C_K primers.

[0155] The present invention also encompasses primers for an additional PCR amplification of the linked products obtained by multiplex RT-PCR followed by linkage by ligation or recombination or by multiplex overlap-extension RT-PCR. This additional PCR amplification can be performed using a primer mix adapted for amplifying the linked target sequences. Such a primer mix may comprise the outer primers of the m ultiplex primer mix or multiplex overlap-extension primer mix, meaning the primers that anneals to the outermost 5' end and 3’ end of the sense strand of the linked nucleotide sequences, thereby enabling the amplification oftheentire linked product. One example of primers that can be utilized as outer in the present invention are the C_K/J_K and/or Οχ/Jj. primers forming a primer set with the J_H or C_Kprimers. This process generally serves to increase the amount of linked product obtained from the multiplex RT-PCR followed by linkage by ligation or recombination or from the multiplex overlap-extension RT-PCR.

[0156] Alternatively, a primer set which is nested compared to the outer primers used in the primary multiplex RT-PCR or multiplex overlap-extension RT-PCR reaction can be used for the additional amplification of the linked nucleotide sequences. In the present invention such a primer set is termed a nested primer set. The design of nested primers :83 η» ’ XS ”” ^u“^a “·“ «™_ΙϊρΒ, o«^L_si„ _r;«r.

’ amounl of línkeð praduel, dd _ηΜ,_{ω PCR} 2 ™)^ptex ovefíap-exlension RT-PCR In additon io increase 0» overíap-extension RT-PCR Whnnin™ ^θ⁵ °^!ncrease overaf í specífícíty, especíally of the muítipíex

Performing the additionai amniificafinn i _h^{P lOus|}7 ^{are Suiíabl}® fof combination withanestedprimersetwhen exíension p ime7nZÍ £ J " T Τθ⁵ ‘"θ ^{primers of lhe} * «plex overiap-[0157] ln₀"boX_ntXr±^^^^ additional amplification of the linked mmunoalobLZv^T^⁶ °^{f and J}* ^{prírTlers ls used as nestecl primers íor the}fftrfeQi ti , i flð£nobulin variabte reciion encodínö ssnnAnnöc from the fír^LwírimermXuZ^{compnsecf of a reverse} (ortorward) outer primer(s) íhe annealing position of the forward ínr rpwre ^ap'^{eXtensiOn pr,mer mix and a second} n®sted primer that prime 3’ to exíension primer mix The use Of such a orimpr θ <7 θ^{Γ Ρ}™^ΘΓ^ ^{of tfle fifsí multiplex} mix/multiplex overlap-nested PCR Semi-nesXSrS ? ** θ" ^additi°^{nal PCR amplification is} Senerally known as a semi-e.9. for the varia^ mentanty determining reqions íCPRs) F _)rth ^P ’ ^{because such a primer would} have to anneaí in the comple«« 'zs “:"~^w ™ - »«*««« ««p ~ «> »< addtoal «ηρΙΜο, “*”^la?"^l9^w sdquence tept iniacl during the compared ío the ouier orimpr/d h f "L ^{6 S per!si used for th}® additional amplification is only slíghtly modified

PCR reaction) Th«±_nrl ^{reaCtiOn(the multiplex RT}'^{PCR or} ™!tiplex ovedap-extension RTpnmyarX^^^ used in the additional amolifirat· ^{Π C}°™^{9 tail miðfl! be added t0 t,1e} nested CL primer(s). The forward primer(s) used In the primary reaction Thp n'^P/ θ ^{Y neSted compared !o lhe} œnstant heavy chain-specific outer primer(s) nested CL pnmer(s) toqether with thP rT ιΤι °^{f prímer}& '^{n íhe} Ρ™θΎ reaction and the slightly modified increase in specificiív that ré rnmna «m Γ*^Ρ* θ^{neStód íorward} P^rimer(s) in the additional amplification resuíts in an [0160] lna preferedembodinJntnfth ° r ^{acfllevable with a nested PCR usin}9 ^a completeíy nested primerset. CLPnmeríslXZXÍ ^nt'^nvention’^thenestedPCRfeperfor_med_WithJ_Hprím_er(_S)and_mcdified

Ptarw «íde «w.« ^3M “ ^Cl

Optimization of Multiplex Overtap-extension PCR can be optimize^onípvprai¹⁰ ™^{ltiplex overla}P-^extension PCR step of both the iwo-step and the single-step procedure CoX? μΪ’STí ^,OreXSmPle' ^He^^aríU' °· ^eta'· ¹"⁷· «oTechniU 23, 504-511;

RT-PCR althouah th_P rafin ηοΛ ³ '^³'^16,47'⁵^· ^Generally tbesameoptimizaíionparametersapplyformultiplex although the rafto between outer and inner primers is |_{ess importan) fcr such a} r_eaction.

a· Primer Concentration preferabiv^TÍXpHh!n^tího°ⁿ °^{? PnTOrS carryin}ð ^íhe °^v®^daP-extönsion tail (forexample the V_H and V_L primers) is primersj æncentraiion of the outer primers without overlap-ertension íail (for example J_H and kappa hiaher^tarð^etseí>^uencesarnplifieswitha lower efficiencythantheothers, for example, asa resultof a of thp nrim⁰’ L ®^{possi te to} the amplífication efficacy. This may be done öy using a higher concentration θ'"*³'⁰"*^{Í0Wefficiency}'^or =on Jratio'ofXther primer set plification pffi'ripnrvth ^{Sfor Ρδ3ν}^ ^{cha,n vadable re}9^,ons tend p flave a hígher GC% and hence lower am-fhe V_H primís ^{9 P}“"^{tS uS}'‘® ^{Vl pr,mrs at 3 !ower} concentration than ímiíkrfptam^^eL^{Wllen USÍn3 a lar0e numberof}P^{rimers tf}ie total primerccnceatration might be an issue. The upper as2.4u.M «íurh r ' ^{μΜί031 OÍ,}9°^nuc,eotide^c°ncentraíio», °ⁿersysterisit rnayhoweverbe ashigb

Drimpre ifthc /ⁿH^Upí?^er.^{lmiíofíotalo,i9}°^{nuc!eobdecor,cen(ra{}ion infl«e«esthe maximal concentration of individual fO 65 τΓ ' , ! ^Pr'^mer "^irata"¹⁵¹⁰⁰ «likeíy to ca^ poor pCR _seí1Si_tlvity.

ðxtensionPcaucHr °₍^l'^3orillcleoMeP^{rimers have}also beenfoJrtf tobe irportant f_orihe multiplex overlap-n PCR HPLC-purified oligonudeotides, have produced the best *sufe.

b. PCR Cycling Conditions:

[0166] Preferentially the cycling conditions are as follows:

Denaturation: 10-30 s 94°C

Annealing: 30-60 s 50-70°C Approximately5°CbelowTmofprimers.

Extension: IminxEPL 65-72°C EPL is Expected Product Length in kb.

Cycle number: 30-80

Final extension: 10min 65-72°C [0167] Forthe single-step multiplex overlap-extension RT-PCR the following steps were built into the cycling program prior to the amplification cycling outlined above:

Reverse transcription: 30 min 42-60°C These conditions are also used where separate reverse transcription is performed.

Polymerase activation: 10-15 min 95°C Hot-start polymerases are favorable in single-step RTPCR Activation according to manufacturer.

[0168] It is possible to optimize on all these parameters. Especially the annealing temperature is important. Thus, initially all the individual primer sets that are to constitute the final primer mix should be tested separately in order to identify optimal annealing temperature and time, as well as elongation and denaturing times. This will give a good idea about the window within which these parameters can be optimized forthe multiplex overlap-extension primer mix.

[0169] Problems with poor PCR sensitivity, for example due to low primer concentration or template concentration can be overcome by using a high number of thermal cycles. A high number of thermal circles constitute between 35 and 80 cycles, preferably around 40 cycles.

[0170] Further, longer extension times can improve the multiplex overlap-extension PCR process. Long extension times constitute 1.5 - 4 min x EPL compared to the normal 1 min extension.

c. Use of Adjuvants [0171] Multiplex PCR reactions can be significantly improved by using a PCR additive, such as DMSO, glycerol, formamide, or betaine, which relax DNA, thus making template denaturation easier.

d. dNTP and MgCI₂ [0172] Deoxynudeoside triphosphate (dNTP) quality and concentration is important for the multiplex overlap-extension PCR. The best dNTP concentration is between 200 and 400 μΜ of each dNTP (dATP, dCTP, dGTP and dTTP), above which the amplification ís rapidly inhibited. Lower dNTP concentrations (100 μΜ of each dNTP) suffice to achieve PCR amplification. dNTP stocks are sensitive to thawing/freezing cydes. After three to five such cydes, multiplex PCR often do not work well. To avoid such problems, small aliquots of dNTP can be made and kept frozen at -20°C [0173] Optimization of Mg²⁺ concentration is critical since most DNA polymerases are magnesium-dependent enzymes. In addition to the DNA polymerase, the template DNA primers and dNTP’s bind Mg²·*·. Therefore, the optimal Mg²⁺ concentration will depend on the dNTP concentration, template DNA, and sample buffer composition. If primers and/or template DNA buffers contain chelators such as EDTA or EGTA, the apparent Mg²⁺ optimum may be altered. Excessive Mg²⁺ concentration stabilizes the DNA double strand and prevents complete denaturation of DNA, which reduces yield. Excessive Mg²⁺ can also stabilize spurious annealing of primer to incorrect template sites, thereby decreasing spedficity. On the other hand, an inadequate Mg²⁺ concentration reduces the amount of product.

[0174] A good balance between dNTP and MgCI₂ is approximately 200 to 400 μΜ dNTP (of each) to 1.5 to 3 mM MgCI₂.

e. PCR Buffár Concentration [0175] Generally KCI based buffers suffice for multiplex overlap-extension PCR; however, buffers based on other components such as (NH₄)₂SO₄, MgSO₄, Tris-HCI, or combinations thereof may also be optimized to fuiiction with the multiplex overlap-extension PCR. Primer pairs involved in the amplification of longer products work better at lower salt concentrations (e.g. 20 to 50 mM KCI), whereas primer pairs involved in the amplifícation of short products work better at higher salt concentrations (e.g. 80 to 100 mM KCI). Raising the buffer concentration to 2X instead of 1X may improve <tie effícíency of the multiplex reaction.

E DNA Polymerase

Dolvmpracac if ^r?^S^ⁿ’^{Invention is exa}mplified with Taq polymerase. Alíernatively, other types of heat-resistant DNA or with q- ta rz ^{C Ud}'ⁿ?’ ^f°^{r example}’^Pfu· ^Phasion, Pwo, Tgo, Tth, Vent, Deep-vent may be used, Polymerases without exonucease activify may either be used alone or In combination with each other.

Vectors and Libraries segment como nudeotide sequences of inferesí according to the present invention produces a nucleotide of interest are θ .^{,inketl nuc,eotide} sequences of interest. Further, Íibraríes of such linked nucleic acid sequences sequences ^Γ° ^{methods of the} P^resent invention, in particular líbraries of variable region encoding interest or ^{preSení mvent}'^on ® the insertíon of a segmení containing linked nucleotide sequences of suitable vector ° rh° ^{nuCleoticfe se}Q^1Jerices of ínterest, generated by a mettiod of the present invention, into seauencps Th^S ?·¹ ,^rar'^{es may Pe} w^binatorial libraries or libraries of cognate pairs of variabíe region encoding desianed to m ^ncöon.^s'^tes ðenerated by the outer primers, nested primers or semi-nested primers are preferably also be insert d ° ^{appmpriate resíriction} sites of the vector of choice. The linked nucteic acid sequences of interest can with 9 ο,ιιμη ^{6 10} ° ^{vecíors py} recombínafíon, if one of the semi-nested, nested primers orouter primers were equipped roí 791 BasΛΤ^{b,natiOn Site and the} of Choice contains one as well.

of the multiol * ³rt ργρ ^{,imitaíions !o ÍPe ve}btors that can be used as carrlers of the products generated by one cation and e θ* ' · '^,inka?^{e me}^^{ods ttle} present inventton. Vectors of choice may be those suitable for ampiifi-' cells Such r ^Sl°ⁿ '^{n CellS} '^ncludinð’ '^{or exa}mple, bacteria, yeast, other fungi, insectcells, plantcells, or mammaíian

Droducf inspftaa⁰^ ^{USed to facilitate} further cloning steps, shuttling between vector systems, display of the

Γ01801 cio · ‘ⁿ°a ^{β VecíOr}' ^exP^ressíon °f the inserted product and/or integrate into the genome of a host ceil.

anniiPd in Η.-™^{9 3Π} ,^{shuttle vectQrs} are preferably bacferíal vectors. However, the other types of vectors may also be applied m cloning and shuttle procedures.

or(1 fiLmpnfnN^ ?^{eCt0rs can for example de} phage vectors or phagemid vectors originating from the class of fd, M13, a bindinn nmfa^{S er}'^oppað^es· ^vectors are capabfe of facilitating the display of a protein including, for example, displav on °^{Γ a ra}®^{ment tflereo}^ ^or> the surface of a filamentous bacteriophage. Display vectors suitable for v&rtnre nr » ^omes· NA, yeast cells or mammalian cells are also known ín the art, These comprise for example viral f0182? F ^enCOd'^{n9 f}°^{r Ch}’^{meríC PmteinS}· protein to be ^^S'°^{n VaCÍOrS exis}* ?^{0Γ a}'^{!i men}lioned species and the one to be chosen completely depend on the eíther bv randa ^PreaSe '^{Some ex}P^ression vectors are additionally capable of integrating into the genome of a host cell mav hp ηρ n Ti? ^e9ration’^{or by sí}te-specific integration, utilizing appropriate recombination sites. Expression vectors seoupnra/Lnahi ^{0 pr}°^{vitie add,íl0na}l encoding sequences that, when the linked product is inserted in-frame to these acoronriatp h_n θιι ® ®^{xpression of a ,ar}9^er protain, e.g. a fulMength monoclonal antibody, when introduced into an disDlav nn thp ^S T '^S 'ⁿ'^{frame ,nserf,}°n may also facilitate the expression of chimeric proteins that facilitate the sennpnrpp nf intl ° ³ ^^arnen'^0Íls Pacteriophage or cell. In a bacteriophage display system, the linked nucleotide CF et ai 1001 p^{6S be insertec) ln}’^Pame to a sequence encoding a coat protein such as pfll or pVlíl (Barbas, 4363-4366) ^ACad' ^^1, ^^{SA 88}· ⁷⁹⁷ð’⁷982; Kang, A.S. et al. 1991. Proc. Natl. Acad. Sci. USA 88, is comnrísp^Hf ^em*³⁰^^rnen*Present invention, the indíviduai segments of íínked nucteotide sequences of interest reninn on/' a ^lmmunoð^lo^^ul’ⁿ hesvy chairi váriabJe region encoding sequence associated with a light chain variable pornriinn λ ^sec,uence' ^PreferaWy. these linked sequences are inserted into a vector that contains sequences variahio rpnin θ'" ^m^^{e immun}°9^,obulin constant fomains. The insertion is engineered such that the linked heavy chain pnrnrtin/i cnn °^Γ?'^{9Μ variap|}® ægi'·’^{11 en}coding sequences are inserted in-frame to the constant region DressinnvprtnrnrT' ^an ’^{nsertion can} fof^example generate a Fab expression vector, a full-length antíbody ex-exDressien vprtnr«^{Π axpression vec>íOr e}ncodití a fragment of a full-length antibody. Preferentially such a vector is an chain pncodinn ^{Ul 9} θ °^{Γ screenin}ð (^e-9- E ^C0^'· Phagemíd, or mammalian vectors) and the constaní region heavy ΙαΑ2 loD nr inP ^Ch°^{Sen from immuno}9l°bulin Classes lgG1,1gG2, lgG3, lgG4, IgM, lgA1, r-ham ^·θ^Γ6 Y ^er‘^at3'^!in9^tlle expressi·'^{11 of a} Fab or full-length recombinant antibody. In addition to the constant ^{sec,uences ve}®tor iW ðlso contain a constant light chain encoding sequence chosen froæ ulin variablp γρπιλ θ^ΡΡ3 ^^ains'^{This is a}PP^roP'^{aíe wfien (fle} íínked nucíeotíde sequences only encode the immunogtob-u»n vanabie region encoding sequences (Fv’sis comírised °^{f tbe PrcSe,t} ’^nvent,on·^the individtial segments of ihe linked nudeotide sequences a c <n variable regíofencoding sequence associated with a P chain variable region encoding sequence ora ychain variable region encoding sequence associated with a δ chain variable region encoding sequence. Preferably, these linked sequences are inserted into a vector that contains sequences encoding one or more TcR constant domains. The insertion is engineered such that the inserted linked variable region encoding sequences are inframe to the corresponding TcR constant region encoding sequences. In a further embodiment, such a vector is a chimeric expression vector comprising sequences that encode a leucine zipper in-frame to the TcR constant regions. It hasbeenshownthatsuch constructsincreasestabilityofsolubleTcR’s(Willcox, B.E.etal. 1999. ProteinSci 8,24182423). [0185] Libraries of cognate pairs prepared according to the present invention may be íntroduced ínto vectors by two different approaches. In the first approach, the single cognate pairs are inserted individually into a suitable vector. This library of vectors may then either be kept separate or be pooled. In the second approach, all the cognate pairs are pooled priortovectorinsertion, followed by in-mass insertion intosuitable vectorsgenerating a pooled libraryofvectors (illustrated in Figure 12). Such a library of vectors comprises a large diversity of pairs of variable region encoding sequences.

[0186] Thspresentinventionenablesalibraryofcognatepairsoflinkedvariableregionencodingsequences. Preferably the individual cognate pairs of the library comprise an immunoglobulin light chain variable region encoding sequence associated with a heavy chain variable region encoding sequence.

[0187] Anothersuch library of cognate pairs comprise linked TcR region encoding sequences, whereeach individual TcR region encoding sequences comprise an alpha chain vadable region encoding sequence associated with a beta chain variable region encoding sequence and/or a TcR gamma chain variable region encoding sequence associated with a delta chain variable region encoding sequence.

[0188] Also enabled is a sub-library of cognate pairs of linked variable region encoding sequences which encode for desired binding specificities directed against a particular target. Preferably these cognate pairs comprise linked immunoglobulin light chain variable region and heavy chain variable region encoding sequences, TcR alpha chain variable region and beta chain variable region encoding sequences and/or TcR gamma chain variable region and delta chain variable region encoding sequences.

[0189] This sub-library may be a sub-library selected from a parent library of cognate pairs of variable region encoding sequences as described throughout The invention.

[0190] The present invention also enables a library or sub-library encoding forcognate pairs offull-length immunoglobulins selected from human immunoglobulin classes lgA1, lgA2, IgD, IgE, lgG1, lgG2, lgG3, lgG4, or IgM, and also enables a library or sub-library encoding for soluble and stable cognate pairs of TcRs.

[0191 ] A feature obtained by the present invention is the diversity of said libraries, which are comprised of at least 5, 10,20, 50,100, 1000,10⁴,10⁵ or 10⁶ different cognate pairs.

[0192] Said libraries of cognate pairs of linked variable region encoding sequences are obtainable by a method comprising the steps described herein. This library is also termed the parent library.

Screening and Selection [0193] The parent library of pairs of linked variable region encoding sequences isolated from a donor, utilizing one of the methods of the present invention, is expected to represent a diversity of binding proteins of which some will be irrelevant i.e. not bindíng to a desired target. Therefore, the present invention encompasses enrichment and screening, for a sub-library encoding a subset of diversities of binding specíficities directed against a particular target.

[0194] For libraries of cognate pairs the diversity of the library is expected to represent the diversity present in the donor material, with only a minor number of randomly linked variable regions. Thus, an enrichment step may not be necessary prior to the screening for target-specific binding affinities in a library composed of cognate pairs.

[0195] In a further embodiment of the present invention, the method of generating a library of pairs of linked variable region encoding sequences, further comprises creating a sub-library by selecting a subset of pairs of linked variable region sequences that encode binding proteins with a desired target specificity. Such a selection of linked variable region encoding sequences, is also termed a library of target-specific cognate pairs.

[0196] In a preferred embodiment of the present invention, is the library of target-specific cognate pairs of variable region encodíng sequences transferred to a mammalian expression vector.

[0197] Immunological assays are generally suitable forthe selection of target-specific immunoglobulin variable region encoding sequences. Such assays are well know in the art and constitute for example ELISPOTS, ELISA, membrane assays (e.g. Western blots), arrays on filters, or FACS. The assays can either be performed in a direct manner, utilizing the Polypeptides produced from the immunoglobulin variable region encoding sequences. Alternatively, the immunoassays can be performed in combination with or following enrichment methods such as phage display, ribosome display, bacterial surface display, yeast dísplay, eukaryotic virus display, RNA display or covalent display (reviewed in FitzGerald, K., 2000. Drug Discov. Today 5,253-258). As illustrated in Figure 10, both cognafe Fab expression libraries and cognate full-length antibody expression libraries can be subjected to screening, thereby generating a sub-library of positive clones. Such screening assays and enrichment procedures are also suitable for Fv or scFv fragments or combinatorial libraries of linked variable regions.

[0198] In a preferred embodiment of the present invention, the selection of a sub-library of target-specific cognate pairs of variable region encoding sequences is performed by using a high-throughput screening assay. High-throughput screening assays could be, but are not restricted to, ELISA assays performed with semi-automated or fully automated equipment. It could also be a membrane assays in which bacteria are robotically picked and gridded onto an appropriate membrane on top of agar plates generating arrays of colonies expressing antigen-binding molecules. The molecules are secreted through the membrane onto a second underlying antigen-coated membrane which can be developed separately and used to identlfy clones that secrete antigen binding molecules towards the desired target (de Wíldt, R.M., et al. 2000. Nat. Biotechnol. 18, 989-994).

[0199] When a sub-library of cognate pairs or combinatorial pairs of antigen-binding clones has been selected by an appropriate technology it is possible to perform an additional analysis by DNA sequencing of the linked immunoglobulin light chain variable region and heavy chain variable region encoding sequences. First of all such a DNA sequencing will provide information about the library diversity such as germline origin, family distribution and maturation within the CDR regions. Such an analysis will enable the selection of clones which represent a broad diversity, and leaving out repeated clones. Secondly, DNA sequencing will reveal mutations introduced during the isolation process.

[0200] When analyzing variable region encoding sequences there are three types of mutations to consider when assessing whether a mutation is acceptable: i) The most frequent type of mutations result from intra-family cross-priming, where V gene primers prime to the wrong subset within one particular V gene family. The changes introduced are mainly substitutions of naturally occurring codons at one particular position. Due to the high degree of sequence homology within a V gene family these changes usually can be regarded as conservative and acceptable changes; ii) Less frequent mutations are induced by inter-family cross-priming (e.g., a VH3 family primer primes a VH1 family encoding sequence) and induces more sig nificant structural changes, sometimes with no natural counterpart. Such changes could potentially affect the immunogenicity of the variable region by creating new epitopes. Such changes can easily be identified and subsequently repaired using standard molecular biological techniques or the clones can be excluded from the library; iii) Errors created by the Taq DNA polymerase are most easily identified in the constant region encoding sequences and can easily be eliminated. However, Taq induced mutations will of course also be present in the variable region encoding sequences where they are indistinguishable from the naturally occurring somatic mutations, which are also the result of random mutations in the variable region encoding sequences. Considering that the mutations are non-systematic and only affect particular pairs in distinct ways, it appears reasonable to disregard such changes.

[0201] Further the sequence analysis can be used to identify the degree of scrambling in a cognate pair library, as illustrated in table 20 for VH group H4.

[0202] As described in Example 9 the presence of the mutations described in i) and ii) can be circumvented in the expression library, when utilizlng primers that anneal in the leader sequence of the variable region encoding sequences ínstead of primers that anneal in the 5’ region of the variable regions.

[0203] In a further embodiment of the present invention, the sub-library of target-specific and possibly sequence analysed pairs of linked immunoglobulin light chain variable region and heavy chain variable region encoding sequences are transferred to a mammallan expression vector. Such a transfer can be performed into any of the vectors described in the previous section, enabling the expression of a full-length recombinant antibody. If the screening is performed with a mammalian cognate full-length antibody expression library such a transfer may not be needed.

[0204] In another embodiment of the present invention, the parent library is generated from a lymphocyte-containing cell fraction which is enriched for T lymphocytes. The pairs of linked variable region encoding sequences constituting the parent library, may be selected for encoding a subset of pairs of linked variable region sequences, composed of alpha and beta and/or gamma and delta chains that encode binding proteins with a desired target specificity, generating a sub-library of cognate pairs or combinatorial pairs. Antigen-specific T cell receptors can subsequently be identified from a pool of transfected cells using standard methodology such as staining with tetrameric MHC-peptide complexes (e.g„ Callan, M.F. et al. 1998. J. Exp. Med. 187,1395-1402; Novak, E.J. et al. 1999. J. Clin. Invest 104, R63-R67), by measuring cellular responses in the form of IL-2 release or by more sophisticated means such as yeast or retraviral display techniques.

Host cells and Expression [0205] The libraries can be transferred to vectors suitable for expression and production of proteins encoded from the linked nucleic acid sequences of interest, in particular variable region containing binding proteins or fragments thereof. Such vectors are described in the Vectors and Librariessection, and provide for the expression offorexample full-length antibod ies, Fab fragments, Fv fragments, scFv, membrane bound or soluble T cRs or T cR fragments of a species of choice. [0206] One feature of the present invention is the introduction into a host cell of a library or a sub-library of vectors of cognate pairs of linked variable region encoding sequences or a single clone encoding a cognate pair of linked variable region encoding sequences, for amplification and/or expression. Host cells can be chosen from bacteria, yeast, other fungi, insect cells, plant cells, or mammalian cells. For expression purposes mammalian cells, such as Chinese hamster ovary (CHO) cells, COS cells, BHK cells, myeloma cells (e.g., Sp2/0 cells, NSO), NIH 3T3, fibroblast or immortalized human cells such as HeLa cells, HEK 293 cells, or PER.C6 are preferred.

[0207] The introduction of vectors into host cells may be accomplished by a number of transformation or transfection methods known to those skilled in the art, including calcium phosphate precipitation, electroporation, microinjection, liposome fusion, RBC ghost fusion, protoplast fusion, viral infection and the like. The production of monoclonal full-length antibodies, Fab fragments, Fv fragments and scFv fragments is well known.

[0208] The production of recombinant polyclonal antibodies to be used for treatment is a quite new area. A recombinant polyclonal manufacturing technology has been described in PCT application WO 2004/061104. In brief, this technology involves the generation of a collection of cells, suitable as a manufacturing cell line. The following description of the technique is made for a library of cognate pairs, it is however just as applicable for a combinatorial library. The individual cells in the collection of cells are capable of expressing a distinct member of the recombinant polyclonal binding protein for example from a library of cognate pairs. In order to ensure that the individual cells express a single cognate pair and not several cognate pairs of the polyclonal binding protein, the nucleic acid sequences encoding the cognate pairs are introduced into a single site-specif ic site in the genome of each individual cell. This is an important feature of the collection of cells, since this prevent scrambling of the heavy and light chains expressed from each cell, but also because it generates cells that are virtually identical to one another, except for the small differences in the variable regions of the individual cognate pairs. This trait will enable an unbiased growth of the collection of cells over the period of time necessary for the production. To ensure single site-specific integration, a host cell line with only one integralion site should be used, these are commercially available e.g. Invitrogen’s CHO Flp-ln cells containing a single FRT site. Appropriate vectors for this cell line contain a corresponding FRT site and are introduced into the genome using the Flp recombinase. There are several other known recombinases e.g. Cre, beta-recombinase, Gín, Pin, PinB, PinD, R/RS, lambda integrase, or phage ΦΟ31 integrase that can be used in combination with their corresponding recombination sites. Further, appropriate vectors contain a selection marker that enables the selection of site-specific integrants.

[0209] The generation of a polyclonal manufacturing cell line and the production of a recombinant polyclonal protein from such a cell line can be obtained by several different transfection and manufacturing strategies.

[0210] One way, is to use a library of vectors mixed together into a single composition, for the transfection of a host cell line with a single integration site per cell. This method is termed bulk transfection or transfection in bulk. Generally, the vector and host cell design previously described will ensure that a polyclonal cell line capable of unbiased growth will be obtained upon appropriate selection. A frozen stock of the polyclonal cell line will be generated before initiation of the recombinant polyclonal protein manufacturing.

[0211] Another way, is to use a library of vectors split into fractions, containing approximately 5 to 50 individual vectors ofthe library in a composition.fortransfection. Preferably, a fraction ofthe library constitutes 10 to 20 individual vectors. Each composition is then transfected into an aliquot of host cells. This method is termed semi-bulk transfection. The number of aliquots transfected will depend on the size of the library and the number of individual vectors in each fraction. If the library for example constitutes 100 distinct cognate pairs, which are split into fractions containing 20 distinct members in a composition, 5 aliquots of host cells would need to be transfected with a library composition constituting a distinct fraction of the original library. The aliquots of host cells are selected for site-specific integration. Preferably, the distinct aliquots are selected separately. However, they can also be pooled before selection. The aliquots can be analyzed for their clonal diversity and only those with sufficient diversity will be used to generate a polyclonal cognate pair library stock. To obtain the desíred polyclonal cell line for manufacturing, the aliquots can be mixed before generating the freezing stock, immediately after they have been retrieved from the stock or after a short proliferation and adaptation time. Optionally, the aliquots of cells are kept separate throughout production, and the polyclonal protein composition is assembled by combining the products of each aliquot rather than the aliquots of cells before production.

[0212] A third way, is a high throughput method in which host cells are transfected separately using the individual vectors constituting the library of cognate pairs. This method is termed individual transfection. The indi vid ually transfected host cells are preferably selected for site specific integration separately. The individual cell clones generated upon selection may be analyzed with respect to proliferation time and preferably, those with similar growth rates are used to generate a polyclonal cognate paír library stock. The individual cell clones can be mixed to obtain the desired polyclonal cell line before generating the stock, immediately after they have been retrieved from the stock, or after a short proliferation and adaptation time. This approach may eliminate any possible residual sequence bias during transfection, integration and selection. Alternatively the individually transfected host cellsare mixed before selection is performed, this will enable control of sequence bias due to transfection.

[0213] A shared feature in the manufacturing strategies outlined in the above is that all the individual cognate pairs constituting the recombinant polyclonal protein can be produced in one, or a limited number of bioreactors. The only difference is the stage at which one chooses to generate the collection of cells that constitutes the po lyclona I manufacturing cell llne.

[0214] The invention also enables a population of host ceils comprising a cognate library or sub-library of linked pairs of variable region encoding sequences and also a population of host cells comprising a library obtained from a population of isolated single cells constituting lymphocytes, utilizing the multiplex RT-PCR amplification followed by linkage by ligation or recombination or the multiplex overlap-extension RT-PCR technology of the present invention, to link the cognate pairs.

[0215] Also enabled is a population of host cells comprising a combinatorial library or sub-library of linked pairs of variable region encoding sequences.

[0216] A population of host cells enabled by the present invention, wíll encompass a diverse populatíon of cells corresponding to the diversity of the library the cells have been transformed/transfected with. Preferably, each cell of the population of cells only constitutes one cognate pairof the entire library of cognate pairs, and no individual member of the líbrary of cognate pairs exceeds more than 50%, more preferred 25%, or most preferred 10%, of the total number of individual members expressed from the population of host cells.

[0217] The population of host cells is typically mammalian cells.

[0218] A population of host ceils as described in the above can be utilized for the expression of a recombinant polyclonal binding protein, since ind ividual cells of the population constitute variable region encoding sequences of different diversity. [0219] The invention also enables a recombinant polyclonal protein expressed from a population of host cells comprising a library of vectors encoding diverse cognate pairs of linked variable region encoding sequences, where such a library is obtainable by the method of the present invention. T ypically, such a recombinant polyclonal protein is comprised of at least 2, 5,10, 20, 50,100,1000,10⁴,10⁵ or 10⁶ proteins composed of different cognate pairs.

[0220] The invention further enables a recombinant polydonal immunoglobulin expressed from a population of host cells comprising a library of vectors encoding diverse cognate pairs of heavy chain variable region and light chain variable region encoding sequences and also a recombinant polyclonal T cR expressed from a population of host cells comprising a library of vectors encoding diverse cognate pairs of TcR alpha chain variable region linked with beta chain variable region encoding sequences and/or TcR gamma chain variable region linked with delta chain variable region encoding sequences.

[0221] The invention also enables a host cell suitableforproduction ofa monoclonal protein. In particular a monodonal antibody comprised of a cognate pair of a light chain variable region with a heavy chain variable region or a monodonal TcR comprised of a cognate pair of an alpha variable region with a beta variable region or a delta variable region with a gamma variable region. Preferably such a monoclonal production cell line is not a hybridoma cell line.

[0222] Such a monodonal antibody or TcR can be generated by adding the following steps to the method of linking a plurality of non-contiguous nudeotide sequences of interest a) inserting said linked nudeic acid sequences into a vector, b) introdudng said vector into a host cell; c) cultivating said host cells under conditions suitable for expression; andd)obtainingtheproteinproductexpressedfromthevectorinsertedintosaid hostcell.Preferably.thevectorintroduced into the host cell encodes an individual cognate pair of variable region encoding sequences.

Appiications of The invention [0223] One of the major applications of the present invention is the linkage of cognate pairs of variable region encoding sequences, especially immunoglobulin heavy and light chain variable region encoding sequences or TcR alpha and betachainorgamma anddelta chainvariableregionencodingsequences, byahigh-throughpiitmethodforthegeneration of libraries of cognate pairs. In addition to the generation of cognate pair libraries, the multiplex RT-PCR followed by linkage by ligation or recombination orthe multiplexoverlap-extension RT-PCR techniques of the present invention may be utilized in the generation of combinatorial libraries by performing the technique on a population of genetically diverse cells, cell lysates from such a population of cells, or on RNA purified from such a population of cells. The libraries, sub-libraries, or single dones from one of these libraries facilitate the expression of polydonal or monoclonal proteins. Espedally monodonal or polydonal antibodies may be obtained from the libraries of the present invention.

[0224] The use of recombinant monoclonal antibodies in diagnostics, treatment, and prophylaxis is well known. Recombinant monodonal and polydonal antibodies generated by the present invention will have the same applications as antibody productsgenerated by existing technologies. In particular, a pharmaceutical composition comprising a polyclonal recombinant immunoglobulin as active ingredient, combined with at least one pharmaceutically acceptable excipient, can be produced by means of the present invention. More preferred are pharmaceutical compositíons where the polydonal recombinant immunoglobulin is comprised of cognate pairs of variable region encoding sequences. Such pharmaceutical compositions of polydonal recombinant immunoglobulins can be used as medicaments. The polyclonal recombinant immunoglobulin of the composítion can be specific for or reactive against a predetermined disease target, and the composition can thus be used for the treatment, amelioration or prevention of diseases such as cancer, infections, inflammatory diseases, allergy, asthma and other respiratory diseases, autoimmune diseases, immunological malfunc-tions, cardiovascular diseases, diseases in the central nervous system, metabolic and endocrine diseases, transplant rejection, or undesired pregnancy, in a mammal such as a human, a domestic animal, or a pet.

[0225] The present invention has a further application which cannot be obtained with conventional monodonal combinatorial antibody techniques. In situations where protective antígens are either poorly characterized or completely unknown, such as in emerging infectious diseases, it is impossible to screen for a monoclonal antibody that will provide protection against the disease.

[0226] However, with the present invention it will be possible to obtain antibody-expressing cells directly from donors with an established protective antibody response, e.g. convalescent patients, and use the starting material from these individuals to generate a library of cognate pairs of immunoglobulin heavy and light chain variable region encoding sequences.

[0227] In situations where for example the virus is known, but the protective antigens are unknown, it will be possible to generate a sub-library of cognate antibody gene pairs with broad reactivity towards antigenic structures on the virus, If a recombinant polyclonal antibody is produced from such a sub-library, it will likely contain protective antibodies.

[0228] In situations where antigens are completely unknown, a recombinant polyclonal antibody generated from a cognate pair library from e.g. convalescent patients can be used in the same way as hyperimmune immunoglobulins are being used today. The reason for this is the cognate pairing which ensures that the recombinant polyclonal antibody produced closely resemble the antibody immune response of the convalescent patient.

[0229] Another application of the techniques for linking cognate palrs of variable regions, described in the present invention, is for diagnostic and analytical purposes. When administering a medicament to a patient, the possibility of an immune response directed towards the medicament always exists. This immunogenecity can be assessed by conventional techniques, such as medicament-specific binding assays with serum or plasma derived from the individ ual treated with the medicament. Alternatively, the methods of the present invention can be used to mirror the patients’ immune response shortly after administration of the medicament, by isolating cognate pairs of variable heavy chain and light chain encoding sequences. Antibodies expressed from such a library can then be screened for reactivity towards the medicament or components of the medicament. This method is particular useful if the presence of the medicament in plasma or serum would interfere with the conventional method. Such medicaments are for example antibodies. With conventional methods, identification of an anti-medicament immune response (e.g. an anti-idiotypic, anti-framework or anti-Fc immune response) in relation to treatment with an antibody cannot be performed until the antibody used for treatment has been cleared completely from the blood. With the present invention sequences encoding such antimedicament antibodies can be isolated and analyzed from the individual treated with the medicament within a couple of weeks. Thus, it would be an altemative method for assessing whether drugs in general and in particular antibodybased drugs are immunogenic.

[0230] A further application of the present invention is in the validation and comparison ofvaccines and immunization programmes. This is particular useful during vaccine development, since it will be possible to assess and compare the sequence diversity of antibody responses generated in response to novel candidate vaccines, in addition to the current comparisons of antibody binding affinities and serum titer. Further, the present invention can be used to analyze, monítor and compare antibody responses in surveillance of vaccine efficacy in populations.

[0231] The present invention also finds applications outside the field of variable region containing binding proteins. It is merely a matter of optimization for one skilled in the art to adapt the technique disclosed in the present invention to link two or more transcribed nucleotide sequences encoding a heteromeric protein other that a binding protein. Such a linkage of sequences encoding for domains or subunits from a heteromeric protein may be an advantage in the isolation of these protein encoding sequences since it would reduce the number of steps considerably. Further, it is possible to isolate for example splice variants, mutations ornewfamily members of such proteins by using only one multiplex primer mix/multiplex overlap-extension primer mix.

[0232] The linkage of sequences which encode distant domains of a single protein is also a possibility. Such a technique would ease the research in relation to the importance of certain domaíns in a multidomain protein, sínce it would ease the deletion of intermediate domains.

[0233] The generation of chimeric or coupled proteins is also an area where the present invention may be applied. Even if the proteins to be linked are of different origin, e.g. a chimera between a human and a mouse protein, the present invention may be utilized by mixing the cells prior to reverse transcription. Such a cell mixture may constitute either a population of cells from each species or a síngle cell from each species.

Examples

Example 1: Two-step Multiplex Overlap-extension RT-PCR [0234] In this example, reverse transcription (RT) was performed using a template derived from an isolated single cell and the cDNA produced was used as template for more than one multiplex overlap-extension PCR.

a. Cells [0235] An lgG1-kappa expressing Chinese hamster ovary (CHO) cell line was generated using the Flp-ln technology (Invitrogen, Carlsbad, CA, USA).

[0236] An IgG-kappa mammalian expressing plasmid vector pLL 113 (Figure 4) was constructed based on the Flp-ln expression vector, pcDNA5/FRT. CHO-Flp-ln cells were co-transfected, using Lipofectamin2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, with pLL 113 containing the antibody encoding genes and pOG44 conferring transient expression of the Flp recombinase. Transformants were selected and verified for production of IgG-kappa by immiinoassays. TheselectedcelllinewasnamedCHO Flp-ln pLL113, and maintained in Ham’sF-12medium, supplemented with 2 mM L-glutamine, 10% FCS and 900 Hygromycin B (maintenance media).

[0237] CHO Flp-ln pLL113 cells were harvested using trypsin and washed 3x in maintenance media. After the final wash the cells were re-suspended in the original volume of maintenance media. The cell concentration was determined using a Casy-1 System (Scharfe System GmbH, Reutlingen, Germany) and diluted in maintenance media to a concentration of 1 cell/5 μ,Ι.

b. Reverse transcription [0238] CHO Flp-ln pLL113 cell suspension, on average containing one cell, was dispensed into single wells of a 96-well PCR plate (Thermo-Fast 96, skirted AB-0800, ABgene, Epsom, Surrey, UK).

[0239] The cDNA was synthesized from the distributed cells by utilizing the reverse transcriptase (RT) step in the Qiagen One-Step RT-PCR protocol (Qiagen OneStep RT-PCR Kit, Cat# 210210, Hilden, Germany).

[0240] Each well contained the following reagents in a total volume of 20 μ,Ι;

x One Step RT-PCR buffer, dNTP’s in a final concentration of 1 mM of each, pmol Oligo poly-dT (18),

U RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2111), μΙ One Step RT-PCR enzyme mix, and μΙ CHO Flp-ln pLL113 cell suspension.

[0241] The RT reaction was performed by incubating the reaction mixes at 55°Cfor30 min. Subsequentlythe reverse transcriptase was ínactivated by incubatíng the reactíon mixture at 94°C for 10 min.

c. Multlplex Overlap-extension PCR [0242] A fraction of the cDNA products generated in step b) was used as template for multiplex overlap-extension PCR. The reactions were performed in 96-well plates.

[0243] Each well contained, in a total volume of 40 μΙ, the following reagents:

x One Step RT-PCR buffer, dNTP’s in a final concentration of 500 μΜ of each,

Multiplex overlap-extension primer mix in the concentrations as indicated in Table 1,

U RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2111), μΙ One Step RT-PCR enzyme mix, and μΙ cDNA template (derived from a single cell (step b)).

[0244] The muItiplex overlap-extension primer mix used comprised the primers shown in table 1.

Table 1 <img file="IS2583B_D0001.tif" />

<img file="IS2583B_D0002.tif" />

(continued) <img file="IS2583B_D0003.tif" /> [0245] The reactions were performed with a 96-well MWG Primus HT thermocycler (MWG Biotech AG, Ebersberg, Germany) with the following cycling conditions:

Denature 30 sec 95°Cλ

Anneal 30 sec 50°C l 50 cycles

Extend 5 min 72^qCJ

Final extension 10 min72°C

d. Ncsted PCR [0246] Nested PCR was performed using the multiplex overlap-extension products as template. The reactions were performed in 96-well plates.

[0247] Each well contained, in a total volume of 50 μΙ, the following reagents:

x BioTaq buffer, dNTP’s in a final concentration of 400 μΜ of each, mM MgCI₂,

Nested PCR primer mix,

1.25 U BIOTAQ DNA Polymerase (Cat. No BIO-21040, Bioline, UK), and μΙ Mulliplex overlap-extension PCR product (step c).

[0248] The primers used are shown in table 2.

Table 2 <img file="IS2583B_D0004.tif" /> [0249] The reactions were performed with a 96-well MWG Primus HT thermocycler (MWG Biotech AG, Ebersberg, Germany) with the following cycling conditions:

<img file="IS2583B_D0005.tif" />

<img file="IS2583B_D0006.tif" />

Denature 30 sec 95°C'

Anneal 30 sec 50°C » 25 cycles

Extend 90 sec 72°C*

Final extension 10 min72°C [0250] The nested PCR products were analyzed by 1% agarose gel electrophoresis using ethidium bromide for detection (Figure 5). The expected size of the overlap-extension product was 1076 bp. Such a product can be observed in lanes 1, 5, 6, 7, 8 and 12 indicated by the arrows (Figure 5A). In the experiment shown, the negative control is contaminated and a similar contamination is also present in the samples. Figure 5B illustrates the fragments of Figure 5A, which are relevant to the present experiment.

[0251] The present experiment illustrates one way to perform two-step multiplex overlap-extension PCR, utilizing template derived from a single cell. Further, it was shown that it is possible to perform approximately twenty multiplex overlap-extensíon PCR’s using cDNA generated from an isolated single cell.

Example 2: Single-step Multiplex Overlap-extension RT-PCR [0252] ln this example reverse transcription and multiplex overlap-extension PCR was performed in a single step using template from lysed cells, in concentrations corresponding to 100,10, or 1 cells.

a. Cells [0253] The human hybridoma cell line HB-8501 producing an anti-tetanus lgG1-kappa antibody was acquired from American Type Culture Collection and cultured in Iscove’s Modified Dulbecco’s Medium (Vitacell, Kiev, Ukraine, cat. No 30-2005) containing 10% fetal bovine serum. Before multiplex overlap-extension RT-PCR was performed, the cells were harvested, counted and frozen at -80°C in culture medium in a concentration of 200 cells/μΙ.

b. Single-step Multiplex Overlap-extension RT-PCR [0254] The Qiagen One-Step RT-PCR kit (Qiagen cat. No 210212, Hilden, Germany) was used for the multiplex overlap-extension RT-PCR essentially according to the manufacturer’s recommendation. Before addition to the PCR tubes cell lysates were thawed and diluted in H₂O to yield a lysate concentration corresponding to 100,10, and 1 cells per 5 μΙ.

[0255] Each PCR tube contained the following reagents in a total volume of 50 μΙ:

x One-Step RT-PCR buffer, dNTP's in a final concentration of 400 μΜ of each,

Multiplex overlap-extension primer mix in the concentrations as indicated in table 3, μΙ One-step RT-PCR enzyme mix,

U RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2515), and μΙ diluted cell lysate [0256] The multiplex overlap-extension primer mix used comprised the primers shown in table 3.

Table 3 <img file="IS2583B_D0007.tif" /> [0257] The reactions were performed using the following cycling conditions:

Reverse transcription: 30 min 55°C

Polymerase activation: 15min 95°C inactivating reverse transcriptase and activating Taq polymerase.

[0258] PCR reaction:

Denature 30 sec 94°C '

Anneal 30 sec 44°C „ 50 cycles

Extend 3 min 72°C

Final extension 10 min 72^QC [0259] Ten microliters of the reaction products were analyzed by 1.5 % agarose gel electrophoresis using ethidium bromide for detection (Figure 6A).

[0260] Expected size of the fragments (the exact size depends upon the lengths of the variable regions):

V_H: 410 bp

LC: 680 bp

Overlap-extension fragment: 1070 bp [0261] Discrete DNA fragments with mobilities corresponding to the heavy chain variable region (V_H) and the light chain variable and constant region (LC) lengths are seen for all dilutions of cell lysate. A less intense fragment with mobility corresponding to the putative overlap-extension fragmant is seen in lysates from 100 and 10 cells. The overlapextension fragment of the one cell lysate sample, is difficult to recognize, although it can be seen on the original gel (see

<img file="IS2583B_D0008.tif" />

arrow in photo shown in Figure 6A and sketch shown in Figure 6B).

c. Identification of the Overlap-extension Fragment [0262] From an experiment reproduced as the one described above the presence of the overlap-extension band was verified. Regions in the agarose gel around 1070 bp from a lane corresponding to 1 cell and from a lane corresponding to 100 cells were excised and the DNA purified using Qiaex II (Qiagen cat. No 20051, Hilden, Germany) and eluted in 20 μΙ of water.

[0263] One microliterof the eluate was subjected to PCR (Biotaq kit, Bioline, UK cat. No BIO-21040) according to the manufacturers instructions with primers flanking the putative overlap-extension fragment (J_H primers corresponding to SEQID NO 32 to 35 and C_Lk primer corresponding to SEQID NO: 17, each primer at a concentration of 0.5 μΜ). Cycling parameters were:

Denature 30 sec 95°C '

Anneal 30sec 55°C ^k 30cycles

Extend 1 min 72°C &gt;

[0264] Ten microliters of each reaction product was analyzed by 1% agarose gel electrophoresis using ethidium bromide for detection. Several fragments can be seen including, both from 1 and 100 cells, a fragment with mobility of the expected overlap-extension fragment (arrow in Figure 6C). The 1 kb fragment from the gel lane corresponding to one cell was cut out of the gel and purified using Qiaex II as described above. The purified fragment was digested with the restriction enzymes Nhel and Ncol (separately) and the reaction products were analyzed by 1% agarose gel electrophoresis using ethidium bromide for detection (Figure 6D). These restriction sites are present in the averlap between VH and LC and the expected sizes after digestion are approximately 410 and 680 bp long, respectively (Figure 2). The Nhel digestion was partial since a large fraction is still present atthe original size.

Example 3: Combined Single-step Multiplex Overlap-extension RT-PCR and Nested PCR [0265] In this example, reverse transcription and multiplex overlap-extension PCR reactions were performed in a singlestepfollowed byasemi-nested PCRamplification.usingtemplatefrom lysed cells, inconcentrationscorresponding to 100,10 or 1 cells.

a. Single-step Multiplex Overlap-extension RT- PCR [0266] Multiplex overlap-extension RT-PCR using HB-8501 cell lysate was performed as described in Example 2 utilizing a m ultiplex overlap-extension primer mix comprising the primers shown in table 4,

Table 4 <img file="IS2583B_D0009.tif" />

<img file="IS2583B_D0010.tif" />

(continued) <img file="IS2583B_D0011.tif" /> [0267] It should however be noted that for each multiplex overlap-extension primer mix only one of the C_H1.₅ primers were used, resulting in five different multiplex overlap-extension primer mixes.

[0268] Remaining parameters were as described for the multiplex overlap-extension RT-PCR reaction in Example 2, only with a change in annealing temperature to 50°C. A reaction was performed for each heavy chain constant region reverse primer (C_H1, C_H2, C_H3, C_H4, C_H5 corresponding to SEQ ID NOs: 49 to 53, respectively) utilizing lysates corresponding to 100, 10, 1 and 0 cells.

b. Semi-nested PCR [0269] One microliter of the multiplex overlap-extensian RT-PCR reaction product was subjected to semi-nested PCR (Biotaq kit, Bioline, UK cat. No BIO-21040), essentially as proposed by the manufacturer. The total volume of the reactions were 50 μΙ. The primers used are shown in table 5.

Table 5 <img file="IS2583B_D0012.tif" /> [0270] Cycling conditions were as follows:

3Öze-C.Ί

Anneal 30sec 50°C r 25cycles

Extend 1.5 min72°Cj

Fínal extensíon 5min72°C [0271] Ten microliters of each reaction was analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for detection (Figure 7).

[0272] The putative overlap-extension fragment from the semi-nested PCR corresponding to lysate from one cell and where the C_H4 primer was used in the first reaction (see arrow in Figure 7), was excised from the agarose gel, purified using a Qiaex II kit (Qiagen cat. No. 20051, Hilden, Germany) and inserted into pCR2.1-TOPO using an Invitrogen TOPO TA cloning kit (Invitrogen cat, No 45-0641, Carlsbad, CA, USA). Inserts of eight clones were sequenced and seven of these appeared to consist of a heavy chain variable region linked to a light chain variable and constant region, by the expected overlap region.

<img file="IS2583B_D0013.tif" />

<img file="IS2583B_D0014.tif" />

[0273] In summary, the sensitivity of the combined multiplex overlap-extension RT-PCR. and the semi-nested PCR reaction was very satisfactory, with 4 out of 5 constant region primers capable of amplifying significant amounts of overlap-extension products fram lysate corresponding to a single cell.

Example4:Combined Single-stepMultiplexOverlap-extensionRT-PCRandNested PCRUsingEnrichedHuman B Lymphocytes as Template Source [0274] In this example, reverse transcription and multiplex overlap-extension PCR reactions were performed in a single step followed by a semi-nested a mplification PCR, using isolated single human B lymphocytes as template source.

a. B-cell isolation [0275] A human male donor was immunized with Tetanus toxoid. A blood sample of 120 ml was collected from the donor 6 days post immunization and peripheral blood mononuclear cells (PBMC’s) were isolated using Lymphoprep (Axis-Shield, Oslo Norway, prod. No 1001967) according to the manufacturer's instructions. The CD19-positive cell population was enriched utilizing magnetic bead cell sorting. The PBMC’s were stained with FITC-conjugated anti-CP19 antibody (Becton Dickinson, NJ, USA, cat. No 345776). Magnetic bead cell sorting using anti-FITC-conjugated magnetic microbeads and column purífication was performed according to manufactures instructions (Miltenyi Biotec, Gladbach, Germany, cat. No 130-042-401). The cells were diluted to a concentration of 200 cells per ml in PBS containing 2 nM EDTA and 0.5% BSA. Five microliters of the diluted cells was distributed to PCR tubes obtaining approximately a single cell pr. tube. The tubes were stored at -80’C until use.

b. Multiplex Overlap-extension RT- PCR and Semi-nested PCR [0276] Conditions for multiplex overlap-extension RT-PCR and semi-nested PCR were as described in Example 3. However, the reactions were only performed with the multiplex overlap-extension primer mix constituting primer C_H3corresponding to SEQ ID NO: 51. Sixteen samples from the combined multiplex overlap-extension RT-PCR and seminested PCR reactions were analyzed by subjecting 10 μΙ from each semi-nested PCR reaction to 1% agarose gel electrophoresis using ethidium bromide for detection (Figure 8).

[0277] As can be seen in Figure 8, 2 out of 16 lanes (lanes 5 and 6) contained fragments of the expected mobility (around 1 kb). Further, lane 2 contained a less intense fragment at the expected mobility. The 1 kb fragments of lane 5 and 6 were excised from the agarose gel, purified using a Qiaex II kit (Qiagen cat. No 20051) and inserted into pCR2.1-TOPO using the Invitrogen TOPO TA cloning kit (Invitrogen cat. No 45-0641, Carlsbad, CA, USA). Two clones from each isolated fragment had inserts ofthecorrectsize. Restriction enzyme digestion (Ncol and Nhel, separately) showed fragments of the expected sizes (410 and 680 bp) indicating a correct linkage between the heavy chain variable region and the light chain variable and constant region encoding sequences.

[0278] The two clones originating from the fragment in lane 5 were sequenced and shown to be identical, indicating that the linked V_H and LC were cognate pairs.

Example 5: Combined Single-step Multiplex Overlap-extensian RT-PCR and Nested PCR Using Vj-specific Primers [0279] In this example, reverse transcription and multiplex overlap-extension PCR reactions were performed in a single step using V^-specific primers, followed by a semi nested PCR reaction. Total RNA purified from two different cell lines expressing lambda gene families 1b and 1e in combination with the same heavy chain variable region were used as templates.

a. Cells [0280] Two lgG1-lambda expressing Chinese hamster ovary (CHO) cell lines were generated using the Flp-ln technology (Invitrogen, Carlsbad, CA, USA).

[0281] IgGI-lamda mammalian expressing vectors pEm465/01P581 and pEm465/01P582 (Figure 9A) representing two lambda gene families were constructed based on the Flp-ln expression vector, pcDNA5/FRT. CHO-Flp-ln cells were co-transfected, using Fugene 6 (Roche, Mannheiin, Germany) according to the manufacturer's instructions, with the above mentioned plasmids containing the antíbody encoding genes and pOG44 conferring transient expression of the Flp recombinase. Transformants were selected for insertions. The selected cell lines were named CHO Flp-ln/Em464/01P581 &amp; CHO Flp-ln/Em464/01P582, and maintained in Ham’s F-12 medium, supplemented with 2mM L-glutamine, 10% FCS and 900 μg/ml Hygromycin B (maintenance media).

[0282] The cell lines were harvested using trypsin and washed 3x in maintenance media. Approximately 10⁷ cells were used for Total RNA purification using Nucleo Spin L kit (Macherey- Nagel, Duren, Germany) according to the manufacturer's description. The final RNA concentrations were determined by OD₂₆₀ measurements.

b. Single-step Multiplex Overlap-extension RT-PCR [0283] Multiplex overlap-extension RT-PCR using 50 pg, 5 pg, or 0.5 pg total RNA as template was essentially performed as described in Example 3 utilizing a multiplex overlap-extension primer mix comprising the primers shown in Table 6 and the cycling conditions specified below.

Reverse transcription: 30min 55°C

Polymerase activation: 15min 95°C inactivatingreversetranscriptaseandactivatingTaqpolymerase.

PCR reaction:

Denature 30 sec 95°C '

Anneal 30sec 50°C ► 35cycles

Extend 5 min 72°C _

Final extension 10 min 72°C <img file="IS2583B_D0015.tif" />

<img file="IS2583B_D0016.tif" />

c. Semi-nested PCR [0284] One microliter of the mult iplex overlap-extension RT-PCR reaction product was subjected to semi-nested PCR (Biotaq kit, Bioline, UK cat. No BIO-21040), essentially as proposed by the manufacturer. The total volumes of the reactions were 20 μΙ. The primers used are shown in table 7.

Table 7 <img file="IS2583B_D0017.tif" /> [0285] Cyding conditions were as follows:

Denature 30 sec 95°C '

Anneal 30 sec 50°C - 25 cycles

Extend 1.5 min 72°C

Final extension 5 min 72°C [0286] Ten microliters of the nested praduds were analyzed by 1.5% agarose gel electrophoresis usíng ethidíum bramide for detection (Figures 9B and 9C). The arrows indicate overlap-extension products with the expected migration properties of approximately 1 kb.

[0287] The present experiment illustrates that the lambda multiplex overlap-extension primer mix shown in Table 6 is applicable in single-step multiplex overlap-extension RT-PCR independentonthetemplateused. Further, specific overlap-extension PCR products were produced at 0.5 pg total RNA. This sensitivity suggest that cognate linked heavy chain variable region and light chain variable region encoding sequences can be amplified from a single cell.

Example 6: Generation of a Sub-library of Tetanus-specific Cognate Pairs of Antibody Encoding Sequences [0288] In the present example the steps outlined in the flow chart ill ustrated in Figure 10, are exemplified using Tetanus Toxoid (TT) as target antigen.

a. Donors [0289] Donors which previously have been immunized with the Tetanus vaccine are boosted with Tetanus vacdne (Statens Serum Institut, Denmark). Six days post the Tetanus vaccine boost a blood sample of approximately 200 ml is drawn from the donors into a tube containing anticoagulant.

[0290] It is required that the donors generally are healthy with no silent or chronic infections. They should not suffer from autoimmune diseases or receive any immunosuppressive medication, and they should not have had any vaccinations within the last 3 months. Also, at the time of the TT-vacdne boost, the donors must not have had any serious infections within the last month.

b. Preparation of Peripheral Blood Mononuclear Cells (PBMC) [0291] PBMC are isolated from the blood samples using Lymphoprep (Axis- Shield PoC AS, Norway, prod. No 1001967) according to the manufactures recommendations. Briefly, the blood is diluted 1:1 in PBS and this suspension is layered over Lymphoprep in a 2:1 ratio. Vials are centrifuged for 20 min, 25°C at 800g and the white inter phase band is collected.

<img file="IS2583B_D0018.tif" />

Cells are washed in PBS containing 2 mM EDTA.

c. Enrichment of B cells [0292] The B-cell lineage (CD19+ cells) of the PBMC's is enriched by magnetic bead cell sorting using the following procedure.

[0293] The isolated PBMC are stained with anti-CD 19-FITC (Becton Dickenson, NJ, USA, cat. No 345776). All steps are performed at4°C in the dark. Staining is performed with 10 μΙ anti-CD19-FITC pr. 1x10® cells in a volume of 100 μΙ per 1x10® cells using M-buffer (PBS, pH 7.2, 0.5% BSA, 2 mM EDTA). This will stain the B-cell lineage of the PBMCs. Cells are incubated for 20 min followed by two washing steps with M-buffer. The anti-CD19-FITC stained cells are magnetically labeled with anti-FITC conjugated microbeads, using 10 μΙ of anti-FITC magnetic beads (Miltenyi Biotec, Gladbach, Germany, cat. No 130-042-401) per 1x10® cells in a volume of 100 μΙ M-buffer per 1x10® cells. Incubation is performed for 15 min followed by a single washing step with M-buffer. The cells are resuspended in degassed M-buffer. [0294] A MACS LS column (Miltenyi Biotec, Gladbach, Germany, cat. No 130-042-401) is pretreated with degassed M-buffer according to the manufactures prescriptions. The suspension of cells stained with anti-CD19-FITC and labeled with anti-FITC-magnetic beads are applied to the column and allowed to run through. Stained and labeled cells (CD 19+) will be retained in the magnetic field surrounding the column while unstained cells (CD 19-) will pass through the column. The column is washed with degassed M-buffer. The magnetic field is removed and the CD19+ cells are collected.

d. Sorting of plasma cells [0295] The eluate from the MACS column is centrifuged and resuspended in FACS buffer (PBS, pH 7.2,2% BSA) in a concentration of 1x10® cells/60 μΙ FACS buffer. Anti-CD19-FITC (Becton Dickenson, NJ, USA, cat. No 345776) (10 μΙ/10® cells), anti-CD38-PE (Becton Dickenson, NJ, USA, cat. No 555460) (10 μΙ/10® cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, cat. No 345809) (20 μ.Ι/10⁶ cells) are added. Incubationis performed at4°Cfor20min inthedark, followed by two times washing and resuspension in FACS buffer.

The cells are sorted by fluorescence activated cell sorting (FACS) usíng the followíng gating parameíers:

1. Forward scatter and side scatter in order to retain lymphocytes and monocytes including plasma blasters and plasma cells and to avoid dead cells and cells with very high side scatter which may be aggregates or granulocytes.

2. Cells that are CD19 positive and express increased levels of CD38 (CD38^hi). This is basically only a gate on CD38 since the PBMCs have been enriched on a MACS column for CD19 expression, but this will disclose any contaminants.

3. CD45 positive cells. All lymphocytes express CD45. However, plasma cells down regulate their CD45 expression compared to earlier lymphocyte differentiation stages. Therefore a discrete population of cells corresponding to plasma cells can be obtained when gating on CD45.

[0296] FACS sorted cells are collected as single cells directly in single wells of 96 well plates containing 5μΙ PBS buffer supplemented with 5 U RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2515) perwell. At this point the cells may be frozen for later RT-PCR orthe cells may proceed immediately for RT-PCR.

e. Linkage of Cognate Pairs of Immunoglobulin Variable Region Encoding Sequences [0297] The multiplex overlap-extension RT-PCR technology is applied to the single cells, thereby achieving cognate linkage of transcribed anti-T etanus Toxoid heavy chain variable region and light chain variable region encoding sequences.

e-1. Single-step Multiplex Overlap-extension RT-PCR [0298] The Qiagen One-Step RT-PCR kit (Qiagen cat. No 210212, Hilden, Germany) is used for the multiplex overlapextension RT-PCR essentially according to the manufacturer’s recommendation. Frozen 96-well plates containing a single cell per well are removed from the freezer and when the wells are free of ice crystals 15 μΙ RT-PCR reaction mixture is added immediately to each sample (single cell).

[0299] The RT-PCR reaction mixture contains, in a total volume of 20 μΙ, the following reagents:

x One-Step RT-PCR buffer, dNTP's in a final concentration of 400 μΜ of each,

Multiplex overlap-extension primer mix in the concentrations as indicated in table 8,

0.8 μΙ One-step RT-PCR enzyme mix, and

U RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2515).

[0300] The composition of the muItiplex overlap-extension primer mix is shown in tabíe 8.

Table 8 <img file="IS2583B_D0019.tif" /> [0301] Cycling conditions are as follows:

Reverse transcription: 30min55°C

Polymerase activation: 15min 95°C inactivates reverse transcriptase and activates Taq polymerase.

[0302] PCR reaction:

Denature 30 sec 94°CΊ

Anneal 30sec 52°C &gt;- 35cyclcs

Extend 5 min72°C

Final extension lOmin72°C e-2. Additional Amplification [0303] One microliter of the multiplex overlap-extension RT-PCR reaction product, from each sample, is subjected to semi-nested PCR (Biotaq kit, Bioline, UK cat. No BIO-21040), essentially as proposed by the manufacturer utilizing 96 well plates. The total volume of each reaction is 50 μΙ, containing a final concentration of 1x Biotaq buffer, 200 μΜ dNTP's (of each), 2 mM MgCI₂,1.25 U Bio Taq polymerase and the primers shown in Table 9.

[0304] Cycling conditions are as follows:

<img file="IS2583B_D0020.tif" />

Denature 30 sec 95°C ”

Anneal 30 sec 55°C _k 30 cycles

Extend 1.5 min 72°C

Final extension 5 min 72°C

Table 9 <img file="IS2583B_D0021.tif" /> [0305] Ten microliters of a limited set of samples are analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for visualization, in order to verify that the multiplex overlap-extension RT-PCR has been successful.

[0306] Expected size of the fragments (the exact size depends upon the lengths of the variable regions):

V_H:-410bp LC: - 680 bp

Overlap-extension fragment: - 1070 bp [0307] Two microliters from all the samples, run in the 96 well plates, originating from the same donor, are combined in a single tube. The pooled samples are digested with Xhol and Notl. The digested overlap-extension fragments are purified by preparative 1% agarose gel electrophoresis; the overlap-extension fragments are excised from the agarose gel and purified using a Qiaex II kit (Qiagen cat. No 20051, Hilden, Germany). It is not necessary to pool the cognate pairs at this stage if this is not desired. In thatcase each individual reaction wíll be subjected to restriction cleavage and the products are cloned individually into the vector described below.

f. Cognate Fab Expression Library [0308] A library of Fab vectors is generated by inserting the pool of Xhol/Notl digested overlap-extension fragments into E. coli vector JSK301 (Figure 11) by ligation. E. coli (TOP10) is transformed by electroporation with the library of Fab vectors and the transformants are selected on 2xYT agar containing 100pg/ml carbenicill in. Plasmid DNA is prepared from colonies directly off the agar plates. The plasmid preparation is derived from a minimum number of colonies per donor, corresponding to 3x the total number of single plasma cells originally sorted, in order to maintain diversity. An Fab expression library is generated by inserting a prokaryotic promoter and leader cassette derived from phh3 (Den, W. et al. 1999. J. Immunol. Methods 222,45-57) into the resulti ng plasmid preparation by digesting the plasmid preparation with Ascl and Nhel and subsequent ligation. The library generation process is outlined in Figure 12. E. coli (TG1) is transformed by electroporation with the resulting Fab expression library and the transformants are selected on 2xYT agar containing 100pg/ml carbenicillin. The individual donors are kept separate during the described procedure in Den etal, J Immunol Methods. 1999 Jan 1 ;222(1-2):45-57. They can, however, be combined at any stage where this might be desired

g. Screening of Clones [0309] Fab expressing clones are screened for TT antigen-binding by antigen-specific ELISA assays.

<img file="IS2583B_D0022.tif" />

g-1. Master Plate Generation and Fab Expression [0310] Individual selected colonies of the TG1 cells, each harbouring a cognate Fab expression vector from the library generated in step (f) are picked into single wells of 96 well plates containing 2 x YT/100 ^g/mL Amp/1 % glucose. The colonies are grown overnight at 37°C with gentle shaking. These plates are referred to as master plates, which are stored at -80°C upon addition of glycerol to a final concentration of 15%.

[0311] Before the master plates are stored, they are used for inoculation of one or more 384 well plates containing 2 x YT/100 μg/mL Amp 0.1 % glucose using a 96 pin replicator. The plates are sealed and shaken for 2 - 3 h at 37°C. [0312] Fab expression is induced by adding an equal volume of 2 x YT/100 pg/mL Amp/0.2 mM IPTG, obtaining a final IPTG concentration of 0.1 mM. The plates are sealed and shaken overnight at 30°C. The following day, the Fab containing supernatants are analyzed for TT antigen-binding specificity by ELISA.

g-2. ELISA Analysis [0313] Three hundred and eighty four (384) well ELISA plates (Nunc, Roskilde, Denmark, cat. No 265196) are coated overnight at 4°C with tetanus toxoid (TT) antigen, diluted to a flnal concentration of 1 μg/mL in PBS in a volume of 25 μΙ per well. Excess binding sites of the wells are blocked for 1 h at RT by adding 2 % M-PBS-T (2 % skim milk powder in PBS, 0.05 % Tween 20). The wells are washed 2 times with PBS-T (PBS, 0.05 % Tween 20).

[0314] The Fab containing bacterial supernatants from g-1. are diluted 1:2 in 2 % M-PBS-T, and transferred to the ELISA wells in duplicate. Incubation is performed for 1 h at RT. The wells are washed 4 times with PBS-T. Goat-anti-human Fab/HRP (Sigma, St. Louis, MO, USA, cat. No A0293) 1:10.000 dilution in 2 % M-PBS-T is added to the wells. Incubation is performed for 1 h at RT. The wells are washed 4 times with PBS-T. TMB Plus (KemEnTec, Copenhagen, Denmark, cat. No 4390L) substrate is added and incubation is performed for 5-15 minutes. The reactions are stopped by adding an equal volume of 1 M H₂SO₄. The extents of the reactions are read at 450 nm in an ELISA reader (Mu Itiscan Ascent, Labsystems, Franklin, USA).

[0315] The original bacterial clones corresponding to TT antigen-binding clones are subsequently retrieved from the original master plates. Plasmid DNA is prepared from the isolated antigen positive Fab clones, generating a cognate Fab expression sub-library of TT antigen-binding clones.

[0316] The clones may also be analyzed by an anti-light chain ELISA assay, ín order to get a correlation between the number of antigen-binding clones and the number of Fab expressing clones. Further, such an analysis provides information of kappa and lambda light chain representation in the clones.

h. Cognate Antibody Expression Library [0317] In order to facilitate the expression of full-length human antibodies the cognate variable regions from the bacterial Fab expression vector must be transferred to a mammalian expression vector containing the constant domains from one of the human immunoglobulin isotypes. Such a transfer can either be performed clone by clone or in mass. Below it is described how to perform the mass transfer.

[0318] The mass transfer is performed in two steps. First, the plasmid preparations of the individually isolated antigenbinding Fab clones are pooled. The prokaryotic promoter and leader containing cassette is exchanged with a mammalian promoterand leadercassetteconsistingofhumanalkaline phosphataseleadersequence(AP Leader), humanelongation factor 1-alpha promoter (EFP), adenovirus major late promoter (AdMLP), IgK leader sequence by digesting the pooled Fab expression sub-library with Ascl and Nhel followed by insertion of a mammalian promoter and leader cassette by a subsequent ligation. E. coli (TOP10) is transformed by electroporation with the resulting promoter exchanged Fab expression library and the transformants are selected on 2xYT agar containing 100μg/ml carbenicillin. Plasmid DNA is prepared from colonies directly off the agar plates. The plasmid preparation Is derived from a minimum number of colonies per donor, corresponding to approximately 3x the total number of clones in the original library, in order to maintain diversity.

[0319] Second, the cognate variable regions from the promoter exchanged Fab expression vector are isolated by digesting the plasmid preparation with Xhol and Notl. The isolated fragment is inserted by ligation into a mammalian expression vector resulting in a cognate antibody expression library. The vector used is essentially the same as in Figure 9A, except that IgL in this case corresponds to the kappa light chain encoding sequence. The mammalian expression vector used above is based on the site-specific Flp-ln system (Invitrogen Corporation, Carlsbad, CA, USA, Cat No K6010-01). E. coli (TOP10) is transformed by electroporation with the resulting cognate antibody expression library and the transformants are selected on 2xYT agar containing 100μg/ml carbenicillin. Plasmid DNA is prepared from colonies directly off the agar plates. The plasmid preparation is again derived from a minimum number of colonies per donor, corresponding to approximately 3x the total number of clones in the oríginal library, in order to maintain diversity. The resulting plasmid preparation of the cognate antibody expression library can be used to transfect a mammalian host cell, e.g. the CHO cells from Invitrogen's Flp-ln system (Invitrogen Corporation, Carlsbad, CA, USA, Cat No K6010-01) in order to generate a stable mammalian expression cell lines by Flp recombinase-mediated integration. Such a cell line can be used in the production of recombinant polyclonal antibodies.

Example 7: Screening by High Density Membrane Assay [0320] The Fab expressing clones from Example 6 f are screened by a high density membrane assay.

a. Master Plate Generation [0321] Master plates are generated as described in step (g-1) of Example 6.

b. PVDF Membrane Preparation [0322] PVDF membranes (Amersham, Uppsala, Sweden, cat. NoRPN2020F) are coated according to the manufacturer’s instructions overnight at 4°C with TT antigen diluted to a final concentration of 1 pbg/ml in PBS. Excess binding sites on the membranes are blocked for 1 h in 2 % M-PBS (2 % skim milk powder in PBS). The membranes are rinsed 3 times in PBS. The membranes are soaked in 2 x YT for a few minutes.

c. Clone Consolidation [0323] Consolidation of clones into 384 well plates is performed by transferring clones from the master plates into one or more 384 well plates containing 20 μΙ 2 x YT/well, using a 96 pin replicator.

[0324] Using a 384 pin replicator the bacteria are transferred to one or more nylon membranes in duplicate (Amersham, Uppsala, Sweden, cat. No RPN2020B) placed on 2 x YT/Carb/1 % glucose agar plates. The plates are incubated 4 - 6 h at 37’C.

d. Fab Induction [0325] The PVDF membranes prepared in step b, are placed on a 2 x YT/Carb/0,1 mM IPTG agar plates. The nylon membranes with the growing bacterial colonies are placed on top of the PVDF membranes (one nylon membrane per PVDF membrane) on the IPTG-containing agar plate. The IPTG-containing agar plate is incubated at 30°C overnight to facilitate IPTG induced Fab expression from the colonies. The Fab molecules diffuse through the nylon membrane onto the PVDF membrane, where TT-antigen binding Fab's will be retained on the membrane.

e. Detection [0326] The nylon membranes are removed and the PVDF membranes are washed 2x5 minutes with PBS-T (PBS, 0.05 % Tween 20). The membranes are incubated for 30 minutes with 2 % M-PBS. The PVDF membranes are washed 2x5 minutes with PBS-T, followed by incubation for 1 h with goat-anti-human IgG/HRP (Sigma, St. Louis, MO, USA, cat. No A0293), 1:10.000 diluted in 2 % M-PBS.The PVDF membranes are washed 3 x 5 minutes with PBS-T. Finally, the PVDF membranes are incubated for 5 minutes with SuperSignal West Femto chemiluminiscent substrate (Pierce, Rockford, II, USA, cat. No 34095) according to the manufactures instructions. Excess substrate is removed and the PVDF membranes are placed under a CCD camera for detection of the chemiluminescent signal generated at positions on the PVDF membrane where a Fab fragment binds the TT-antigen.

[0327] Positive TT-antigen binding clones will appear as dots on the image. The original bacterial clone is subsequently retrieved from the original master plates. Plasmid DNA is prepared from the isolated antigen positive Fab clones, generating a cognate Fab expression sub-library of TT-antigen binding clones.

f. Correlation Between Antigen Binding Clones and Fab Expressing Clones [0328] The nylon membranes removed in step e. are placed on a second series of PVDF membranes coated with anti-light chain antibody or anti-Fab antibody according to the procedure in step b. Step d. and e. are then repeated.

[0329] Fab positive clones will then appearasdots on the image and a correlation between the numberofTT-antigen binding clones and the number of Fab expressing clones can be made.

Example 8: lllustrative Example Describing the Isolation of Sequences Encoding a Heteromeric Protein [0330] The present example illustrates how a trimeric guanine nucleotide binding protein (G-protein) can be isolated in a single step utilizing the multiplex overlap-extension RT-PCR technique of the present invention. The family of G-protein subunits is large, alone in humans there are approximately 16 different alpha subunits, 5 beta subunits and 12 gamma subunits. For the present example subunit GaS (GenBank accession No X04408), subunit Gp1 (GenBank accession No AF501822) and subunit Gy1 (GenBank accession No BC029367) were chosen. The linkage procedure is illustrated in Figure 13, where step 1 is the multipiex overlap-extension RT-PCR step and step 2 is the additional amplification of the linked product.

a. Cells [0331] A population of human liver cells is obtained from surgical discharge samples. The liver cells are disintegrated and lysed, total RNA is isolated from the lysate using RNA L kit (Macherey - Nagel, Diiren, Germany, cat, No 740 962.20) according to the manufactures instructions.

b. Multiplex Overlap-extension RT-PCR [0332] The Qiagen One-Step RT-PCR kit (Qiagen cat. No 210212, Hilden, Germany) is used forthe multiplex overlapextension RT-PCR essentially according to the manufacturer’s recommendation.

[0333] Each PCR tube contains, in a total volume of 50 μΙ, the following reagents:

x One Step RT-PCR buffer, dNTP’s in a final concentration of 400 μΜ of each,

Multiplex overlap-extension primermix in the concentrations as indicated in table 10, μΙ One step RT-PCR enzyme mix,

U/μΙ RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2515), and ng total RNA.

[0334] The multiplex overlap-extension primer mix used comprises the primers shown in table 10.

Table 10 <img file="IS2583B_D0023.tif" /> [0335] The cycling conditions used are:

Reverse transcription: 30 min 42°C

Polymerase activation: 15 min 95°C inactivating reverse transcriptase and activating Taq polymerase.

[0336] PCR reaction:

<img file="IS2583B_D0024.tif" />

Denature 30 sec94°C

Anneal 30 sec 49°C 45 cycles

Extend 3 min72°C

Final extension 10 min72

c. Amplification PCR [0337] One microIiter of the multiplex overlap-extension RT-PCR reaction product is subjected to an additional PCR amplification step (Biotaq kit, Bioline, UK cat. No BIO-21040) essentially as proposed by the manufacturer. The primers used are a1 and γ2 as shown in table 10 corresponding to SEQID NO 80 and 85. The total volume of the reaction is 50 μΙ. [0338] Cycling conditions are as follows:

Denature 30 sec95°C

Anneal 30 sec 53°C 25 cycles

Extend 3 min72°C

Final extension lOmin72°C [0339] Five microliters of the reaction product is analyzed by 1 % agarose gel electrophoresis using ethidium bromide for detection. The size of the product is expected to be 2215 bp. However, additional unlinked fragments of the subunits might be present. The expected sizes of these fragments are Ga: 1228 bp, Gp: 1064 bp and Gy. 262 bp.

d. Cloning [0340] The remaining reaction product is subjected to 1 % agarose gel electrophoresis using ethidium bromide for detection and the overlap-extension fragment of 2215 bp is excised from the agarose gel, purified using a Qiaex II kit (Qiagen, Hilden, Germany, cat. No 20051) and inserted into pCR2.1-TOPO using Invitrogen’s TOPO TA cloning kit (Invitrogen cat. No 45-0641, Carlsbad, CA, USA).

[0341] Furthermore, promoter sequences or ribosome bindíng sites might be inserted upstream of each subunit encoding sequence in order to facilitate their expression from the vector. The restriction sites present in the overlapextension sequences are applicable for such insertion.

e. General Considerations [0342] The linkage of sequences encoding subunits constituting a heteromeric protein, as described above, can be performed for most heteromeric proteins where the sequence of the individual subunits is known. Moreover, when utilizing a multiplex overlap-extension primer mixture capable of amplifying several members of a particular family, e.g. all the G-protein α-, β-, and γ-subunits, it is possible to identify and link any combination of subunits from a cell type without first having to analyze which family members are expressed by what cell type. For example, the above example can be performed utilizing template derived from isolated single liver cells employing a multi piex overlap-extension primer mix capable of amplifying and linking all 16 Gasubunits with the 5 Gp subunitsand 12 Gysubunits, thereby identifying which combination of subunits are expressed in each cell and simultaneously isolating the encoding sequences responsible for that combination of subunits. In addition, the use of degenerate primers might even serve to identify new members of a particular family.

[0343] When linking subunits of a heteromeric protein using the multiplex overlap-extension RT-PCRtechnique ofthe present invention, the overall size of the linked product should be considered, since there are limits to the number of base pairs a DNA polymerase can amplify. The Deep Vent polymerase from New England Biolabs, MA, USA is one DNA polymerase capable of generating very long primer extensions, of up to 14,000 bp in length. Theoretically, 14,000 bp can encode a protein with an average weight of 510 kDa. Thus, it should be possible to isolate encoding sequences for very large heteromeric proteins utilizing the method of the present invention. The extension capability could possibly be increased even further by utilizing mixtures of DNA polymerases.

<img file="IS2583B_D0025.tif" />

<img file="IS2583B_D0026.tif" />

Example 9: Design of leader primers:

[0344] In this example, a multiplex set of primers in which the site of priming is kept in the sequence encoding the leader region of the human antibody heavy chain and kappa light chain families was designed.

[0345] When using primers annealing to the N-terminal encoding sequences of the variable region families, some degree of cross-hybridization may be observed. Primers of one particular gene family sequence can hybridize to the cDNA of another gene family, which in many cases cause creation of novel sequences. Proteins produced fram such sequences are potentially immunogenic when used in treatment. Generally, these novel sequences can be corrected by PCR, or eliminated from the library.

[0346] An alternative solution, is to position the site of priming in the sequence encoding the leader peptide region of the antibody variable region. Hybrid sequences, generated as a result of cross-priming, will be eliminated during intracellular processing ofthe antibody, in which the peptide leader containing the potential immunogenicsequences will be cleaved off, and hence will not be present in the secreted antibody product. Previous sets of leader primers for antibody cloning, have been located in the 5’ end of the leader encoding sequence, allowing for direct eukaryotic expression (Campbell M.J. et al. 1992 Mol Immunol. 29, 193-203). Unfortunately, eukaryotic leader peptides are poorty suited for prokaryotic processing.

[0347] The ease by which nudeic acid sequences are manipulated in bacteria makes it attractive to develop cloning systems in which sequence sh uttling between bacterial vectors and vectors for other host organisms is possible. There-fore, a multiplex primer set, in which the site of priming is kept at a position in the leader region encoding sequence, that allowforfunctionalexpressionofantibodiesorantibodyfragmentsinbotheukaryoticand prokaryoticexpressionsystems, was designed in the present example.

[0348] The sequence requirement for signal peptídase cleavage at the C-termínal regíon ofany leader peptíde seems very similar for prokaryote and eukaryote systems (Nielsen H. et al. 1997 Protein Eng. 10,1-6.). Further, it follows that mutations in the C-terminal region of the leader peptide is likely to have little effect on the conformation of the N-terminal region and vice versa. Thus, it is expected that C-terminal sequences could be transferable among species without loss of function.

[0349] The basic concept of the primer design in the present example, was to place the site of priming at the last six codons of the C-terminal region of the leader peptide. The remaining part of the leader encoding sequence, up-stream of the site of priming (approximately 50 nucleotides) should be supplied by the appropriate expression vector matching the host species. For example, vectors suitable for expression in gram negative bacteria can be designed with a partial or full-length PelB leader sequence. For expression of antibodies in eukaryotes, a vector with a partial native antibody heavy chain leader encoding sequence and a partial variable kappa chain leader encoding sequence will be suitable. Regardless of expression system, the last six amino acids of the leader, will originate from the endogenous antibody leader encoding sequence contained in the nucleic acid segment inserted into the vector.

[0350] The following primer sequences were designed for use in the multiplex overlap-extension RT-PCR (table 11). However, the overlapping tails (lowercase letters) can easily be redesigned to function in the linkage by ligation or recombination procedures.

Table 11 <img file="IS2583B_D0027.tif" />

<img file="IS2583B_D0028.tif" />

(continued) <img file="IS2583B_D0029.tif" /> [0351J It should be noted that the restrictíon sites in this primer design were s lightly modified compared to the primers described in the previous examples. Thus, the overiap sequence between the heavy chain and light chain variable region encoding sequences comprised a Notl and a Nhel restriction site, and in the constant kappa primer (C_Lk), the previous Notl site has been exchanged with an Ascl site. The later modification should of course be observed when designing the primers for the additional PCR amplification. Further, the Notl site in the cloning vector, shown in Figure 11, should be changed to a Ascl site, and the Ascl site in the promoter unit should be changed to a Notl site.

[0352] The functionality with respect to leader cleavage has been tested in silico using SignalP provided by CBS at the Danish Technical University.

[0353] The chimeric leader peptides tested for the variable heavy chain, were encoded by nucleic acid sequences composed of a truncated PelB sequence, a C-terminal Notl site (SEQ ID NO 100: ATG AAA TAT CTT CTA CCA ACA GCG GCA GCT GGA TTA TTG GCG GCC GCC), and in association with the Notl site the gene specific part of one of SEQ ID NO 86 to 92, encoding the six C-terminal amino acids from native V_HL family members. All seven sequences showed signal peptide cleavage in gram negative bacteria, using the SignalP program.

[0354] The chimeric leader peptides tested for the variable light chain, were encoded by nucleic acid sequences composed of a truncated PelB sequence, a C-terminal Nhel site (SEQ ID NO 101: ATG AAA TAT TTG CTA CCA ACA GCG GCA GCT GGA TTA TTG TTA CTA GCG), and in association with the Nhel site the gene specific part of one of SEQ ID NO 93 to 98, encoding the six C-terminal amino acids from native V_LkL family members. All six sequences showed signal peptide cleavage in gram negative bacteria, using the SignalP program.

[0355] The sequences of SEQ ID NO 100 and 101 are suitable for the construction of a bacterial expression vector similar to the one illustrated in Figure 11, in that the Ascl site illustrated in figure 11 is substituted with SEQ ID NO 100 and theNhelsite issubstituted withSEQ ID NO 101. Further, the Notl site illustrated infigure 11 needsto be substituted for a Ascl site.

[0356] The mammalian expression vector (Figure 9) can likewise be re-designed to enable expression in mammalian cells following transfer of the variable region encoding segments from the bacterial vector just described.

Example 10: One tube multiplex RT-PCR and linkage by ligation [0357] The present example illustrates how a cognate pair comprising linked heavy chain variable region and light chain variable region encoding sequences can be generated in a single tube reaction using ligation instead of overlapextension PCR, to obtain linkage.

a. multiplex RT-PCR [0358] An in-house producad cell line expressing Fab molecules with specificity towards T etanus Toxoid are distri buted by limiting dilution to obtain a single cell in a single PCR tube.

[0359] In addition to the single cell, each PCR tube contains the following reagents in a total volume of 20 μΙ:

x Phusion HF buffer dNTP’s in a final concentration of 200μΜ each

Multiplex primer mix in the concentrations as indicated in table 12

0.8 U Phusion polymerase (FinnZymes Cat. No F-530-L) μΙ Sensiscript reverse transcriptase (Qiagen Cat. No 205213

U Rnase inhibitor

<img file="IS2583B_D0030.tif" />

Table 12 <img file="IS2583B_D0031.tif" /> [0360] The cycling conditions are:

Reverse transcriptíon 30 min 37°C

Denature 30 sec98°C

Denature 10 sec98°C

Anneal 30 sec 55°C 40 cycles

Extend 30 sec72°C

Final extension 5min 72°C

b. linkage by ligation [0361] To perform the linkage by ligation, restriction enzymes and ligase are added directly to the multiplex RT-PCR reaction products. Alternatively, the multiplex RT-PCR can be purified prior to this addition in order to free the mixture from the polymerase.

[0362] The following reagents are added to each tube in a total volume of 40 μΙ:

x NEBII buffer mM ATP

U Xbal (New England Biolabs Cat. No R0145L)

U Spel (New England Biolabs Cat. No R0133S)

100 μg/ml BSA

400U T4 DNA ligase (New England Biolabs Cat. No M0202S) [0363] The reaction is incubated at 16°C over night.

<img file="IS2583B_D0032.tif" />

<img file="IS2583B_D0033.tif" />

[0364] The linked heavy chain and light chain variable region encoding sequences are purified from the reaction by gel electrophoresis and excision of the band of approximately 1000bp.

[0365] In an alternatively version of this method, the multiplex RT-PCR reaction is performed with a C_H primer instead of the J_H primers in the multiplex primer set. This primer may either be equipped with a cloning tail that allows in-frame insertion of the heavy chain variable region into an expression vector, or a semi nested PCR may be performed with the primers of table 5.

Example 11: Generation of a recombinant polyclonal immunoglobulin with specificity towards Tetanus Toxoid [0366] In the present example results from a single donor (TT03) immunized with Tetanus Toxoid (TT) is used to illustrate the steps outlined in the flow chart in Figure 10.

a. Donors [0367] Eight Donors which previously have been immunized with the Tetanus vaccine were boosted with Tetanus vaccine (Statens Serum Institut, Denmark). The donors were assigned with numbers TT01 to TT08. Six days after the Tetanus vaccine boost a blood sample of approximately 200 ml was drawn from the donors into a tube containing anticoagulant.

[0368] The donors were healthy without chronic infections, autoimmune disease, or immunosuppressive medication, and they had not had any vaccinations within the last 3 months.

a-1. Monitoring Donor Quality [0369] Pre-bleedings of the donors were taken at the time of immunization. Fourteen days later additional bleedings were taken to determine the serum titer. All donors responded with an increase in the TT-titer. An ELISPOT assay was also set up to measure the frequency of TT-specific plasma cells. Different cell fractions can be used for the ELISPOT,

e.g. the major bleedfrom day 6, the PBMC fraction, the magneticsortedfraction, orthe FACS sorted fraction. ELISPOT can be used to evaluate the donor material and to identify the best responders, which then may proceed through the sorting step and multiplex overlap-extension RT-PCR. For donor TT03 an ELISPOT was performed using the CD19+ cell fraction (see section c). The ELISPOT assay was performed as described by Lakew (Lakew, M. et al. 1997. J. Immunol. Methods 203, 193-198) with minor modifications. The frequency of TT specific plasma cells in the PBMC fraction was calculated to 0.021 %

b. Preparation of Peripheral Blood Mononuclear Cells (PBMC) [0370] PBMC's were isolated from the blood sample using Lymphoprep (Axis-Shield PoC AS, Norway, prod. No 1001967) accordingtothemanufacturesrecommendations. Briefly, the bloodwasdiluted 1:1 in PBSandthis suspension was layered over Lymphoprep in a 2:1 ratio. Vials were centdfuged for 20 min, 25°C at 800g and the white inter phase band was collected. Cells were washed in PBS containing 2 mM EDTA.

[0371] From the 200 m| full blood drawn from donor TT03 approximately 2x10® PBMC’s were obtained.

c. Enrichment of B cells [0372] The B-cell lineage (CD19+ cells) of the PBMC’s was enriched by magnetic bead cell sorting using the following procedure.

[0373] The isolated PBMC’s were stained with anti-CD 19-FITC (Becton Dickenson, NJ, USA, cat. No 345776). All steps were performed at 4°C in the dark. Staining was performed with 10 μΙ anti-CD19-FITC pr. 1x10® cells in a volume of 100 μΙ per 1x10® cells using M-buffer (PBS, pH 7.2, 0.5% BSA, 2 mM EDTA). This will stain the B-cell lineage of the PBMC's. Cells were incubated for 20 min followed by two washing steps with M-buffer. The anti-CD19-FITC stained cells were magnetically labeled with anti-FITC-conjugated microbeads, using 10 μΙ of anti-FITC magnetic beads (M iltenyi Biotec, Gladbach, Germany, cat. No 130-042-401) per 1x10® cells in a volume of 100 μΙ M-buffer per 1x10® cells. Incubation was performed for 15 min followed by a single washing step with M-buffer. The cells were resuspended in degassed M-buffer.

[0374] A MACS LS column (Miltenyi Biotec, Gladbach, Germany, cat. No 130-042-401) was pretreated with degassed M-buffer according to the manufacturers descriptions. The suspension of cells stained with anti-CD 19-FITC and labeled with anti-FITC-magnetic beads were applied to the column and allowed to run through. Stained and labeled cells (CD 19+) were retained in the magnetic field surrounding the column while unstained cells (CD 19+) passed through the column. The column was washed with degassed M-buffer. The magnetic field was removed and the CD 19+ cells were collected.

[0375] An analytic staining of the starting material (PBMC), the unlabelled fraction and the CD 19 labelled fraction from TT03, using anti-CD 19-FITC, anti-CD38-PE, and anti-CD45-PerCP was performed (Figure 14). This shows that the Magnetic cell sorting results in two distinct fractions compared to the PBMC fraction. The CD19 negative cells shown in panel B and the CD19 positive cells shown in panel C. Ofthe PBMC fraction 11 %ofthecells wereCD19+, theextent of CD19 positive cell purification was 99.5% of R1 (the scatter gate in Figure 14C) for TT03.

[0376] As seen in Figure 14C, the anti-CD38/anti-CD45 plot showed a distinct population of CD38hi, CD45in cells (R2) corresponding to 1.1 % of R1. This population contained the plasma cells and was collected during the later sorting step. This indicated that in the PBMC fraction 0.12% of the cells corresponded to plasma cells.

[0377] The CD19 positive cell fraction was frozen in FCS (Invítrogen, Cat. No. 16000-044) +10% DMSO (Sigma, Cat. No. D2650) for later sorting. An analysis like the one seen in Figure 14 was made on the MACS purified cells that had been frozen to make sure that the cells were intact (Figure 15). The staining patterns seen in Figure 15 were the same as seen in Figure 14C although a slightly broader staining intensity were observed. The cells that were collected by sorting is the subset of R1 and R2. This corresponds to approx. 1.1 % of the MACS purified cells.

d. Sorting of plasma cells [0378] The frozen eluate from the MACS column was thawed, centrifuged and resuspended in FACS buffer (PBS, pH 7.2, 2% BSA) in a concentration of 1 χ10⁶ cells/60 μΙ FACS buffer. Anti-CD19-FITC (Becton Dickenson, NJ, USA, cat. No 345776) (10 μΙ/10⁶ cells), anti-CD38-PE (Becton Dickenson, NJ, USA, cat. No 555460) (10 μΙ/10⁶ cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, cat. No 345809) (20 μΙ/10⁶ cells) were added, and the mixture was incubated at 4°C for 20 min in the dark, followed by two times washing and resuspension in FACS buffer.

[0379] The cells were sorted by fluorescence activated cell sorting (FACS) using the following gating parameters:

1. Forward scatter and side scatter in order to retain lymphocytes and monocytes induding plasma blasters and plasma cells and to avoid dead cells and cells with very high side scatter which may be aggregates or granulocytes.

2. Cells that are CD19 positive and express increased levels of CD38 (CD38hi) This is basically only a gate on CD38 since the PBMC’ s have been enriched on a MACS column for CD19 expression, but this will disclose any contaminants.

3. CD45 intermediate positive cells. All lymphocytes express CD45. However, plasma cells down regulate their CD45 expression compared to earlier lymphocyte differentiation stages. Therefore, a discrete population of cells corresponding to plasma cells can be obtained when gating on CD45.

[0380] FACS sorted cells from donor TT03 were collected as the subset of the two gates P2 and P1 (Figure 16A and 16B, respectively). Thecells wereCD38hi (FL2-A), CD45in (FL3-A) andCD 19+, thelatterduetotheMACS purification. Briefly, the cells were collected in bulk, counted and diluted in RPMI (Invitrogen, Cat No. 21875-034) containing 10% FCS (Invitrogen Cat. No. 16000-044), 100 units/ml Penidllin-streptomycin (Invitrogen, cat. No. 15140-122), 2mM L-glutamine (cat No. 25030-024). Cells were then dispensed into fifty 96 well PCR plates (ABgene, cat. No. AB-0800) with one cell per well in 5 μΙ medium, The plates were sealed and frozen immediately, and stored for later RT-PCR analysis.

e. Linkage of Cognate Pairs of Immunoglobulin Variable Region Encodlng Sequences [0381] The multiplex overlap-extension RT-PCR technology was applied to the single cells obtained from donor TT03, thereby achieving cognate linkage of transcribed anti-Tetanus Toxoid heavy chain variable region and light chain variable region encoding sequences.

e-1. Single-step Multiplex Overlap-extension RT-PCR [0382] The Qiagen One-Step RT-PCR kit (Qiagen cat. No 210212, Hilden, Germany) was used for the multiplex overlap-extensionRT-PCRessentiallyaccordingtothemanufacturer’srecommendation. Fifty frozen 96-well PCR plates containing approximately a single cell per well were removed from the freezer and when the wells were free of ice crystals, 15 μΙ RT-PCR reaction mixture was added immediately to each well.

[0383] The RT-PCR reaction mixture contained, in a total volume of 20 μΙ, the following reagents:

x One Step RT-PCR buffer dNTP's in a final concentration of 400 μΜ of each

Multiplex overlap-extension primer mix in the concentrations as indicated in table 13

0.8 μΙ One-step RT-PCR enzyme mix

U RNase inhibitor (RNasin, Promega, Madison USA, cat. No N2515) [0384] The composition of the multiplex overlap-extension primer mix is shown in table 13.

Table 13 <img file="IS2583B_D0034.tif" /> [0385] Cycling conditions were as follows:

Reverse transcription: 30 min 55°C

Polymerase activation: 15min 95°C inactivatesreversetranscriptaseandactivatesTaqpolymerase.

PCR reaction:

Denature 30 sec 94°CΊ

Anneal 30 sec 52°C &gt; 35 cycles

Extend 5 min 72°CJ

Final extension lOmin72°C e-2. Additional Amplification [0386] One microliter of the multiplex overlap-extension RT-PCR reaction product, from each sample, was subjected to semi-nested PCR (Biotaq kit, Bioline, UK cat. No BIO-21040), essentially as proposed by the manufacturer utilizing 96 well PCR plates (ABgene, cat. No. AB-0800). The total volume of each reaction was 50 μΙ, containing a final concentration of 1x Biotaq buffer, 200 μΜ dNTP's (of each), 2 mM MgCI₂, 1.25 U Bio Taq polymerase and the primers shown in table 14.

<img file="IS2583B_D0035.tif" />

Table 14 <img file="IS2583B_D0036.tif" /> [0387] Cycling conditions were as follows:

Denature 30 sec 95°CΊ

Anneal 30 sec 55°C &gt; 30 cycles

Extend 1.5 min 72°CJ

Final extension 5 min72°C [0388] Ten microliters of samples from row A, well 1-12 from each plate were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for visualization, in order to verify that the multiplex overlap-extension RT-PCR was successful. The expected size of the overlap-extension fragment was approximately 1070bp (the exact size depends upon the lengths of the variable regions). Figure 17 shows samples from eight 96 well plates. The average number of successful overlap-extensíon RT-PCR fragments from fífty 96 well plates, was estimated to eight per plate. Thus, the total number of successful overlap-extension RT-PCR fragments were estimated to approximately 400.

[0389] Ten microliters from all the performed reactions, run in the 96 well plates, originating from the same donor, were consolidated in a single tube. An aliquot con sisting of200 μΙ of the pooled PCR products were subsequently purified using QIAquick PCR purification kitaccordingtothemanufactures procedure (Qiagen cat. No. 28106, Hilden, Germany) using 60 microliters buffer EB for elution. The purified pool of overlap PCR products was digested with Xhol and Notl and subsequently purified by preparative 1% agarose gel electrophoresis; the overlap-extension fragments are excised from the agarose gel and purified using a Qiaex II kit (Qiagen cat. No 20051, Hilden, Germany).

f. Cognate Fab Expression Library [0390] A Fab expression library was generated by a two-step ligation procedure. Initially the pool of digested overlapextension fragments described above was ligated into the Xhol/Notl digested E. coli vector JSK301 (Figure 11). The I igation reaction was subsequently transformed into electrocompetent E. coli cells (XL1 -Blue electroporation competent, Stratagen, cat. No. 200228, La Jolla, USA), according to manufactures instructions. The transformed E. coli cells were plated onto 2xYT agar containing 100μg/ml carbenicillin. Biomass corresponding to approximately 10¹ °-10¹¹ cells originating from a number of independent colonies that exceeded at least 5 times the total number of overlap PCR products was used as starting material for plasmid preparation using Qiagen Plasmld preparation Maxi kit (Qiagen cat. No. 12163, Hilden, Germany). To enable Fab expression of thecloned cognate linked VH and VL encoding sequences, a prokaryotic promoter and leader cassette was inserted in a second ligation step. The used bi-directional promoter fragment (SEQ ID NO 321) was extracted from the parental JSK301 by Ascl/Nhel digestion. The purified pool of plasmids was likewise digested with Ascl /Nhel restriction endonucleases and gel purified as previously described. The purified fragments were subsequently ligated and transformed into electrocompetent E. coli cells (TG1, Stratagene, cat. No. 200123, La Jolla, USA) and plated on 2xYT agarcontaining 100pg/mlcarbenicillin,and 1%glycose.The Fabexpressionlibrarygeneration process is outlined in Figure 12.

g. Screening of Clones [0391] Fab expressing clones were screened for TT antigen-binding by antigen-specific ELISA assays.

<img file="IS2583B_D0037.tif" />

g-1. Master Plate Generation and Fab Expression [0392] Individual selected coloniesoftheTGI cells, each harbouringacognate Fab expression vectorfrom thelibrary generated as described in section (f) were picked into single wells of 96 well plates containing 2 x YT/100 p,g/ml Carb/ 1 % glucose. The plates were incubated overnight at 37°C with gentle shaking. Four 96 well plates were consolidated into the wells of one 384 well plate, containing 2 x YT/100 μg/ml Carb/1 % glucose, using 96 pin replicators. The 384 well plates were incubated overday at 37°C. These plates are referred to as master plates, and they were stored at -80°C after addition of glycerol to a final concentration of 15%.

[0393] The masterplates were used for inoculation of 384 Deep Well plates containing 2 x YT/100 p,g/ml Carb 0.1 % glucose using a 96 pin replicator. The plates were sealed and incubated for 2 - 3 h at 37°C with shaking.

[0394] Fab expression was induced by adding an equal volume of 2 x YT/100 μg/ml Carb/0.2 mM IPTG, obtaining a final IPTG concentration of 0.1 mM. The plates were sealed and incubated overnight at 30°C with shaking. The following day, the Fab-containing supernatants were analyzed forTT antigen-binding specificity by ELISA.

g-2. ELISA Analysis [0395] Three hundred and eighty four (384) well ELISA plates (Corning Inc., Corning, NY, USA, cat. No 3700) were coated overnight at 4°C with Tetanus Toxoid (TT) antigen, diluted to a final concentration of 1 μg/ml in PBS in a volume of 25 μΙ per well. Excess binding sites of the wells were blocked for 1 h at room temperature (RT) by adding 2 % M-PBS-T (2 % skim milk powder in PBS, 0.05 % Tween 20). The wells were washed 2 times with PBS-T (PBS, 0.05 % Tween 20), [0396] The Fab-containing bacterial supernatants from section (g-1) were diluted 1:2 in 2 % M-PBS-T, and transferred to the ELISA wells in duplicate. Incubation was performed for 1 h at RT. The wells were washed 4 times with PBS-T. Goat-anti-human Fab/HRP (Sigma, St. Louis, MO, USA, cat. No A0293) 1:10.000 dilution in 2 % M-PBS-T was added to the wells. Incubation was performed for 1 h at RT. The wells were washed 4 times with PBS-T. TMB Plus (KemEnTec, Copenhagen, Denmark, cat. No 4390L) substrate was added and Incubation was performed for 5-15 minutes. The reactions were stopped by adding an equal volume of 1 M H₂SO₄, and analyzed using a spectrophotometer at 450 nm (Multiscan Ascent, Labsystems, Franklin, USA).

[0397] The original bacterial clones corresponding to TT antigen-binding dones may subsequently be retrieved from the original master plates. Plasmid DNA can be prepared from the isolated antigen positive Fab clones, generating a cognate Fab expression sub-library of TT antigen-binding clones.

[0398] A subset ofthe dones were further analyzed by an anti-kappa ELISA assay, in order to get a correlation between the number of antigen-binding dones and the number of Fab expressing dones. The anti-kappa assay was generally performed as the TT-assay, except that the wells were coated with a 1:1000 dilution of goat anti-human kappa antibody (Caltag, California, USA, Cat. No H16000), using a carbonate buffer, pH 9.6.

g-3. Screening results [0399] Clones from four 384 well plates were screened for reactivity with anti-kappa Ab and TT using ELISA assays according to the procedure described in g-2. The results obtained results are summarized in the tables 15 through 19. The anti-kappa ELISA results inform about the expression of Fab fragments in a given done, the TT ELISA results inform about the fundionality of the Fab fragments.

Table 15 ELISA screening, anti-kappa coat (1440 clones in total) <img file="IS2583B_D0038.tif" /> [0400] Of 1440 single dones analyzed, 482 clones or 34 % exhibited anti-Kappa reactivity at a level exceeding 2 x background reactivity. 395 clones or 27 % of the dones showed reactivity above 3 x background, etc.

<img file="IS2583B_D0039.tif" />

[0401] The same clones were analyzed for TT-antigen reactivity by ELISA, and results are given in table 16 below:

Table 16 ELISA screening, TT coat (1440 clones in total) <img file="IS2583B_D0040.tif" /> [0402] From this table it is seen that 9.0 % clones showed reactivity with TT at 2 x background (defined as the signal obtained by the reacti vity of a Fab fragment with a irrelevant specifi city). 104 clones reacted at 3 x backgroiind (7,2 %) etc. [0403] Of the Fab-positive clones (482 clones in total), approximately 27 % of the clones (130/482) exhibited reactivity with TT at the 2x background level. This level does not change significantly at the other background levels.

[0404] Six 384 well plates were screened for clones with TT reactivity. The number of clones giving rise to reactivity with the antigen are shown in the table 17. Anti-kappa ELISA was not carríed out wíth these plates.

Table 17 ELISA screening, TT coat (2160 clones in total) <img file="IS2583B_D0041.tif" /> [0405] The percentage of TT positive clones in plates G054 - G059 was comparable to what was found in plates G050 -G053 (table 16).

[0406] The results from all the clones screened against TT (table 16 and 17) are summarized in table 18.

Table 18 All clones screened, TT reactive clones <img file="IS2583B_D0042.tif" /> [0407] In summary, a total of 339 clones showed reactivity with TT at least at 2x background levels (table 18). This corresponds to 9.4 % of all clones screened.

[0408] All positive clones exhibiting reactivity with TT at 2x background was inoculated into 96 well plates as privously described, from the master plate. The next day, the bacteria was collected by centrifugation at 4000 rpm for 15 minutes, and the pellet was resuspended ín 0,8 mM EDTA, 0,4 x PBS, 0,8 M NaCI, and incubated on ice for 15 minutes. The periplasmic extract was collected by centrifugation, and the reactivity of the dones was further analyzed. Here we show results from one such plate (G060) for reactivity with anti-Kappa (Figure 18), Ovalbumin (unrelated antigen) (Figure 19),

<img file="IS2583B_D0043.tif" />

<img file="IS2583B_D0044.tif" />

<img file="IS2583B_D0045.tif" />

TT (Figure 20), and a one-step competitive assay using 10'⁷ M concentration of TT-antigen in solution (Figure 21). These ELISA assays were performed on the same periplasmic extract, at the same dilution.

[0409] Mostof the clones expressed Fab fragments (90/96) (Figure 13), and no clones reacted with Ovalbumin (Figure 19). The reactivity with immobilized TT was reduced orcompletely inhibited by TT in solution (Figure 21), indicating that the clones react specifically with TT. The reactivity of the clones in plate G060 is summarized in table 19.

Table 19 Summary of G060 plate (96 clones in total) <img file="IS2583B_D0046.tif" />

h. Diversity analysis and clone approval [0410] Plasmid isolated from 47 clones (from plate G060) from the cognate TT antigen-binding Fab expression sublibrary were subjected to sequence analysis. The variable heavy chain encoding sequences were sequenced using primer LSN-HCP: AGGAAACAGGAGATATACAT (SEQID NO131), annealing to the P íac promoter, and the light chain encoding sequences were sequenced using primer LSN-LCP: TCGCCAAGGAGACAGTCATA (SEQ ID NO132), annealing to the P lac promoter. The sequence data was analysed using the Vector NTI software (Informax, Frederick, MD, USA). The resulting sequence data of the heavy chain was trimmed to one base pair 5’ of the upstream Ascl restriction site and immediately 3’ of the downstream Xhol restriction site. The light chain sequence data was trimmed to the second 5' base pair of the upstream Nhel restriction site and 3’ of the last codon "AAA" encoding the variable chain C-terminal lysine. The trimming was performed in order to facilitate further analysis such as translation of each DNA sequence.

[0411] The variable heavy and light chain encoding sequences were analyzed for germline gene usage by comparlng the sequences to the V-base germline variable region sequence database (MRC Centre for Protein Engineering, Cam-bridge, UK). The closest related germline allele was thus determined for each sequence showing a V-gene repertoire originating from 12 different variable heavy chain germline alleles belonging to VH-family VH1 through VH5 and 8 different variable kappa light chain germline alleles belonging to VKI, VKIII and VKIV (Table 20).

[0412] Furthermore, the variable gene sequences were translated into protein sequences which were aligned using the AlignX software (Informax, Frederick, MD, USA) as depicted in Figure 22 and Figure 23. Based on the protein sequence alignments, the variable chain sequences could be categorized into groups according to V(D)J rearrangement events, designated with H for the variable heavy chain sequence and L for the variable kappa chain sequence followed byauniquenumber. Ineachrearrangementgroup.thesequenceswerecategorizedaccordingtothe maturationgenotype (M-type in table 20) within the CDR1,2 and 3 regions, represented by a lower case letter in alphabetical order. Seven of the clones had premature stop codons, Whereof 6 clones were an amber mutation (TAG) (clone IDs g060:b12, d08, f06, c12, f03, c04) and 1 clone was an opal mutation (TGA) (clone ID g060: h12). These codons were most likely suppressed by E. coli resulting in functional Fab fragments. Four of these clones were members of groups containing similar clones making them redundant. Additional clones would have to be analyzed in order to replace the remaining 3 clones with premature stop codons as they were single members of their groups. Alternatively, the sequences could be corrected by standard molecular biology techniques such as PCR, replacing the stop codon with an appropriate codon. [0413] The 47 analyzed V-region sequences could be divided into 20 unique V(D)J rearrangement groups (designated "groups" in table 20) both for the variable heavy and variable kappa gene. Four of the rearrangement groups could further be divided into 1 to 4 maturation types (a through d), resulting in 27 unique antibody encoding sequences (Table12).Generally, specificheavychain rearrangementgroupscombinewith specificlightchainrearrangementgroups (e.g. H1 with L1, H12 with L24 and so forth). Further, the maturation type match among pairs of variable heavy chain and the variable light encoding sequences (e.g. H4c match with L13c). Such stringency in paring among rearrangement groups and maturation types indicating cognate paring of the variabla region encoding sequences.

[0414] However, heavy chain rearrangement group H4 is an exception. H4 pairs with two different light chains L28 and L13. L13 was unique to H4, comprising maturation types a, b and cthat matches with L13 maturations types. L28, on the other hand, was also found paired with the single member in heavy chain group H2. Two out of seven H4a heavy chain sequences pair with heavy chain L13a and five out of seven H4a heavy chain sequences pair with L28a. In summary, these observations suggested a multiplex overlap-extension RT-PCR event where two TT-specific antibody producing plasma cells, with the genotype combinations H2-L28 and H4a-L13a, were present in a single well. Rare scrambling events of the light chain and heavy chain gene pairing, such as for H2 and H4a with L28, was expected as

<img file="IS2583B_D0047.tif" />

the experiment was based on limiting dilution of plasma cells.

[0415] The sequence identity among individual cognate pairs of the variable heavy chain and variable light chain encoding sequences from the same group and maturation type is at least 90 % and preferably at least 95 %. Take for example g060g03 and g060a01 from group H1 maturation type a. Clone g060g03 correspond to nucl. SEQID pair 168: 215, where the variable heavy chain encoding sequence correspond to SEQ ID NO 168 and the variable light chain encoding sequences correspond SEQID NO 215. Clone g060a01 correspond to nucl. SEQID pair 133:180. When SEQ ID NO 168 is alignedwith SEQID NO 133 (the variable heavy chains) 4/369 bases are notidentical andforthe variable lights chains (SEQ ID NOs 215 and 180) 8/327 bases are not identical, this correspond to a sequence identity of 98.3 % between these two cognate pairs (g060g03 and g060a01). However, when looking at sequence identity among different groups it is not expected that the sequence identity will be high, since it is a polyclonal sub-library and diversity is desired. In this particular example the lowest identity among the cognate pairs is approximately 40 % (e.g. g060b11 and g060h 11 have a sequence identity of 39.5%).

[0416] One embodiment of the present inventíon ís a sub-library of cognate pairs of ímmunoglobulin heavy chain variable region and light chain variable region encoding sequences, where the immunoglobulins obtainable from said library are capable of reacting with or binding to Tetanus Toxin.

[0417] A further embodiment of the present invention is such a sub-library of cognate pairs of immunoglobulin heavy chain variable region and light chain variable region encoding sequences, comprising individual cognate pairs with at least 90 % sequence identity with one individual SEQ ID pair, selected from the group consisting of SEQ ID pairs 135: 182,168:215,146:193,151:198,173:220,152:199,164:211,148:195,137:184,169:216,138:185,143:190,161:208, 166:213,157:204,139:186,134:181,150:197,156:203,158:205,170:217,178:225,141:188 or 144:191.

Table 20

<img file="IS2583B_D0048.tif" />

<img file="IS2583B_D0049.tif" />

<img file="IS2583B_D0050.tif" />

i. Apparent affinities [0418] A competition assay was set up in order to determine the apparent affinity or IC₅₀ of selected clones from plate G060.

[0419] Briefly, Fab fragments were expressed in 50 ml cultures asfollows: 50 ml 2 x YT/100 μg/ml Carb/ 0.1 % glucose was added 0.5 ml overnight culture, and shaken for approximately 2 h at 37°C. IPTG was added to a final concentration of 0,1 mM, and shaking was continued ovemight at 30°C. The next day, the bacteria were collected by centrifugation at 4000 rpm for 15 minutes, and the pellet was resuspended in 1 ml 0.8 mM EDTA, 0.4 x PBS, 0.8 M NaCI, and incubated on ice for 15 minutes. The periplasmic extract was collected by centrifugation, and stored at -20°C.

[0420] The competition assay was peiíormed as follows: the periplasmic extracts in appropriate dilutions estimated by titration were added to a series of tubes. As a positive control the phage display derived Fab fragment mp584, derived from the human hybridoma cell line HB8501 expressing an anti-TT antibody was used. Soluble TT was added to the first tube at 100 nM concentration, and subsequently diluted at four-fold steps in the following tubes, making a total of seven dilutions of TT (from 100 nM to 25 pM). The reactions were incubated for approximately 45 minutes at room temperature. The samples were transferred to ELISA plates coated with TT at 1 μg/ml, and blocked as previously described. The plates were incubated for 1 h at room temperature, followed by 4x wash with PBS-T, goat-anti-human Fab/HRPwas addedat a 1:10.000 dilution, and incubated for 1 h. TMB Plus substrate (KemEnTech, Denmark, cat. No. 4390A) was added, incubation was performed for approximately 10 minutes, and the reactions were stopped wlth 1 M H₂SO₄. The plates were read at 450 nm. The data are plotted in Figure 24.

[0421] The apparent affinities of the analyzed clones are given in the table 21:

Table 21 <img file="IS2583B_D0051.tif" /> [0422] As seen in table 21, the Fab fragments have apparent affinities in the lower nano-molar or upper pico-molar range. Furthermore, all cognate paired Fab fragments exhibit a higher apparent affinity than that of the phage display derived Fab fragment.

j. Summary [0423] ln donor TT03 the frequency of TT specific plasma cells in the peripheral blood monocyte cell fraction was calculated to 0.022%. Appraximately 400 cognate pairs were generated from TT03. 3600 clones from the cells transformed with the cognate pair library were screened using ELISA, of these 339 clones showed TT reactivity in the ELISA screening. 47 of these clones have been analysed with respect to their clonal diversity. Of these 47 clones, 27 proved to resemble unique non-scrambled variable region encoding sequences. Three of these clones contained a premature stop codon that will need correction before transfer to a mammalian expression vector. The transfer to mammalian expression vectors was described in example 1 section h. The apparent affinities were measured on selected clones, ranging from the lower nano-molar to upper pico-molar range.

k. Prospects [0424] The TetanusToxin isoneof the mosttoxicsubstances known with a lethal dose of a few nanogram. The toxin

<img file="IS2583B_D0052.tif" />

is produced by Clostridium tetani, a soil bacteria also present in the digestive tract of up to 25% of humans. The tetanus immunization program has effectively abolished the disease in the western world, although 100-200 cases are still observed in the major western countries annually, with a case-fatality ratio of 50%. In the developing world the number of cases is s ig nifican tly greater. Bacterial growth in contaminated penetrating wounds may lead to toxin release, ultimately leading to rigidity, spasms, respiratory arrest and death.

[0425] Hyperimmune immunoglobulin products isolated from human blood donors with a high titer of antibody response against T etanus T oxoid may be used to prevent tetanus or if Instituted early to treat established tetanus, also in conjunction with active immunization. However, due to shortage of human product, equine hyperimmune anti-Tetanus Toxoid is used in the developing world. Recombinant monoclonal or polyclonal antibodies against Tetanus Toxoid have potential to substitute hyperimmune globulin products fortherapeutic and/or prophylactic use. Recombinant monoclonal antibodies originating from the conventional hybridoma technology has been described to be efíective against TT (Chin, J. et al. 2003. Biologicals 31, 45-53). Interestlngly, a synergistic effect was observed when mixing two monoclonal antibodies. Thus, a recombinant polyclonal anti-Tetanus Toxoid antibody capable of reacting with or binding to TetanusToxin could potentially be very effective in treatment or prophylaxis protection of patients at risk of developing tetanus.

[0426] One embodiment of the present invention ís a recombinant polyclonal immunoglobulin or fragments thereof capable of reacting with or binding to Tetanus Toxin.

[0427] Apreferredembodimentofthe presentinventionis arecombinantpolyclonal immunoglobulin capableofreacting with or binding to Tetanus Toxin comprised of cognate pairs of immunoglobulin heavy chain variable region and light chain variable region.

[0428] Afurther embodimentof the present invention is a recombinant polyclonal immunoglobulin capable of reacting with or binding to Tetanus Toxin obtained by the method according to the present invention.

[0429] Afurther embodiment of the present invention is a recombinant polyclonal immunoglobulin capable of reacting with or binding to TetanusToxin comprising individual cognate pairs of immunoglobulin heavy chain variable region and light chain varíable region with at least 90 % sequence identity with one Individual SEQ ID pair, selected among SEQ ID pairs 229:276, 262:309, 240:287, 245:292, 267:314, 246:293, 258:305, 242:289, 231:278, 263:310, 232:279, 237: 284,255:302,260:307,251:298,233:280,228:275,244:291,250:297,252:299,264:311,272:319,235:282 or 238:285. [0430] Another embodiment of The invention, is a pharmaceutical composition comprising a recombinant polyclonal antibody capable of reacting with or binding to Tetanus Toxin as actíve ingredíent intended for the treatment or prevention of a tetanus. Preferably, the recombinant polycíonal antibody is combined with a pharmaceutically acceptable excipient. [0431] A further embodiment of the present invention is the use of a recombinant polyclonal immiinoglobulin capable of reacting with or binding to Tetanus Toxin as a medicament for the treatment or prophylactic protection of a patient at risk of developing tetanus.

[0432] An additional embodiment is a method of preventing or treating a patient at risk of developing tetanus by administering to a patient in need thereof a composition comprising a recombinant polyclonal antibody capable of reacting with or binding to Tetanus Toxin.

Example 12: Comparing results obtained from two donors [0433] In the following example results obtained from donor TT08 are compared with the results obtained from donor TT03 in Example 11. The results are summarized in table 22.

Table 22 <img file="IS2583B_D0053.tif" />

<img file="IS2583B_D0054.tif" />

(continued) <img file="IS2583B_D0055.tif" /> [0434] This clearly illustrated that libraries of similar quality could be isolated from two different donors immunized with TT.

[0435] The reason for the higher number of unique cognate pairs in the library obtained from donor TT08 is most likely due to the larger number of sequences analyzed.

Example 13: Comparing the library of cognate pairs from Example 11 with a combinatorial phage display library generated from the same donor [0436] In the present example a combinatorial phage display library was prepared from the same donor previously used toprepare the library of cognate pairs, inorderto compare library diversity, affinity and specificity between libraries of cognate pairs and combinatorial libraries.

a. Combinatorial phage library construction [0437] A phage display library was generated from the CD 19⁺ fraction of cells from donor TT03 (identical to the cell fraction obtained in Example 11c).

[0438] Total RNA was prepared from app. 5x10® CD19⁺ cells using NucleoSpin RNA L kit (Machery-Nagel cat. no. 740 962.20). cDNA was subsequently synthesized in an oligo(dT)-primed reaction using ThermoScript reverse transcriptase (Invitrogen cat. no. 11146-016).

[0439] The V_H and Kappa chains were PCR amplified using HotMasterTaq DNA polymerase (Eppendorf cat. no. 0032 002.692) and primers essentiallyas described bydeHaardetal. (J. Biol.Chem.274,18218-18230:1999), only modífíed with respect to restriction enzyme recognition sequences in the 5'-end.

[0440] The combinatorial phage display library was generated by successive insertion of Kappa and V_H PCR products into Em351 phage display vector (modified from phh3described in Den,W. etal. 1999 J. Immunol. Methods 222,45-57). [0441] The final library was electroporated into TG1 E.coli strain (Stratagene). The size of the combinatorial library contained 3x10® independent clones with a high insert frequency.

b. Panning of the combinatorial library [0442] Fab displaying phage particles were prepared according to standard procedures (e.g. Antibody Engineering, A Practical Approach 1996, ed. McCafferty, Hoogenboom and Chiswell).

[0443] Panning was performed on tetanus toxoid (TT; SSI batch no. 89-2) diluted to 1 μg/mL in PBS, and immobilized in MaxiSorp ímmunotubes (Nunc cat. no. 444202). Following a one hour incubation period and several washing steps, bound phage particles were eluted using 100 mM TEA (Triethylamine).

[0444] The phage particle eluate was neutralized, and used to infect exponentially growing TG1 cells, from which Fab displayi ng phage particles enriched for TT specificity were obtained. A second round of panning using the eluted phages was performed following the general procedure outlined above.

[0445] In parallel, three panning rounds were performed on the C-fragment of the tetanus toxin molecule (Sigma cat. no. T3694), following the procedure outlined above.

[0446] Single colonies were screened for binding to tetanus toxoid and the C-fragment from the unselected library, and after each panning round, from both sets of panning described above.

c. Comparing specificity and affinity of combinatorial phage particle clones and cognate pair clones [0447] Single colonies were picked from the unselected library and after each round of panning (on intact tetanus toxoid (TT) and the tetanus toxoid C-fragment, respectively). Fab displaying phage particles were analyzed for reactivity by ELISA assays. The number of Fab-positive clones exh ibiting TT and/or C-fragment reacti vity of at least 2 x background reactivity and at least 4 x background reactivity are given in table 23 to 25 below. All the results are shown as number

<img file="IS2583B_D0056.tif" />

of specific clones/number of Fab positive clones.

Table 23: Clones selected on TT and analyzed by TT-specific ELISA <img file="IS2583B_D0057.tif" />

Table 24: Clones selected on TT and analyzed by C-fragment-specific ELISA <img file="IS2583B_D0058.tif" />

Table 25: Clones selected on C-fragment, analyzed by C-fragment-specific ELISA <img file="IS2583B_D0059.tif" /> [0448] Panning of the phage display library against TT revealed an increasing number of TT specific clones when increasing the number of panning rounds, and only a few clones were identified in the unselected library. No clones were found to be reactive with the teatanus toxoid C-fragment from the unselected library or after two rounds of panning of the library against TT. To obtain Fab fragments with C-fragment specificity from the combinatorial phage display library, this library had to be panned against the C-fragment specifically.

[0449] For comparison, thirteen TT-specific clones from Example 11 were subjected to C-fragment-specific ELISA, of these seven showed reactivity above 2 x background. Thus, Fab fragments with specificity towards the tetanus toxin C-fragment could be expressed from a library of cognate pairs obtained from a TT-immunized individual.

[0450] This clearly illustrates the disadvantage of using panning to identify clones with specificity towards a particular antigen. If important antigen fragments or epitopes are unknown, they may be discharged during panning, thereby resulting in a less efficient product in the end.

[0451] Further, apparent affinities of the combinatorial clones were measured as described in the assay of Example 11 i. Ten of the combinatorial clones obtained after two rounds of panning on TT were analyzed, revealing apparent binding affinities between 1 and 15 nM.

[0452] For comparison four of the nine clones analyzed from the library of cognate pairs (table 21), showed affinities in the pico-molar range.

[0453] This indicates that the pairing of variable regions as originally selected for by the donors immune system, in combination with the somatic hyper-mutations the pairs have been subjected to as a pair, potentially results in higher apparent binding affinities than random combinations of such variable regions.

d. Comparíng sequences of TT specific combinatorlal phage particle clones and cognate pair clones [0454] The large amount of sequence data generated from the two libraries precludes direct comparisons of raw sequences. In order to vísualize the dífference between V_H and V_L sequence paírs in the phage dísplay library an in the library of cognate pairs, phylogenetic threes were generated for the V_H and V_L sequences, and pairs were illustrated in a dot matrix. The pairing of phylogenetic information in a dot matrix (Figure 25) revealed very different distribution profiles of V_H and V_L sequence pairs in the two libraries. The scattered appearance of the V_H and V_L sequence pairs in the phage display library (Figure 25A) indicated Iittle phylogenetic relation between V_H and V_L genes in agreement with the random paring of the V genes in this library. In contrast, V_H and V_L sequence pairs from the library of cognate pairs

<img file="IS2583B_D0060.tif" />

<img file="IS2583B_D0061.tif" />

<img file="IS2583B_D0062.tif" />

(Figure 25B) show a clustered appearance indicating co-evolution of V genes as expected for cognate pairs. Also, the genetic diversity is much greater for the V-genes in the library of cognate pairs compared to the V-genes from the combinatorial library, indicating that the method of isolating cognate paired V-genes is less biased.

Example 14; Combined Single-step Multiplex Overlap-extension RT-PCR and Nested PCR Using T-cells as Template Source [0455] In this example, it is described how a single-step multiplex overlap-extension RT-PCR can be performed on T lymphocytes derived from a human donor.

a. Obtaining a lymphocyte containing cell fraction [0456] A blood sample is obtained from human donors who have been subjected to the desired antigen, for example by immunization, natural infection, malignancy, through an autoimmune reaction, orother diseases. The peripheral blood mononuclear cells (PBMC’s) are isolated using Lymphoprep (Axis-Shield, Oslo Norway, prod. No 1001967) according to the manufacturer’s instructions.

[0457] In the present example antigen-specific T cells are generated by further stimulation of the PBMC fraction. However, the multiplex overlap-extension RT-PCR can also be performed directly on single cells from the PBMC fraction or on a cell fraction enriched for T cells (e.g. by FACS-sorting for CD3-positive cells).

b. Generating antigen-specific T cells [0458] The PBMC cell fraction is re-suspended in an appropriate culture medium containing relevant cytokines such as IL2. Further, the desired antigen is added to the culture, where it will be presented to the T lymphocytes by antigen presenting cells (APC) present in the PBMC fraction. Aíternatively, APC feeder cells treated in beforehand such that they are presenting the desired antigen may be added to the PBMC fraction. Such APC feeder cells can be APC exposed to the desired antigen in the form of for example peptide, protein or other molecular form, or microbially infected APC or cells transfected to express and present the antigen, or APC co-cultured with other antigenic cells, e.g. such as cancer cell in the form of primary tissue or cell lines. Many different types of APC feeder cell are known from the literature, including transformed cell lines, B cell lines, dendritic cells, etc.

[0459] The PBMC fraction is cultivated for approximately 3 to 5 weeks, during which fresh antigen presenting cells are added together with cytokines, e.g. on a weekly basis. This results in T lymphocyte proliferation, activation and maturation. At the end of the cultivation period the cell culture will be dominated by antigen-specific T cells. Whether these cells are CD4+ or CD8+ depends on the disease, the antigen, the APC cells, and the cytokine mixtures used during the stimulation period.

[0460] The antigen specificity can for example be tested with a CTL assay, proliferation assays and MHC tetramers loaded with the desired antigen (Altman, J.D., et al. 1996. Science 274, 94-96).

[0461] The antigen-specific T cells are distributed to PCR tubes, either by limiting dilution or using a FACS in order to obtain a single cell pr. vessel. The vessel can be stored at -80°C until use.

b. Single-step Multiplex Overlap-extension RT-PCR [0462] The Qiagen One-Step RT-PCR kit (Qiagen cat. No 210212, Hilden, Germany) is used for the multiplex overlapextension RT-PCRessentially according tothe manufacturer’s recommendation. Before addition of PCR reaction mixture to the PCR tubes, the cells are thawed.

[0463] PCR reaction mixtures and cycling conditions are initially set up as described in Example 11 e-1. However, a certain amount of optimization may be expected for a new set of primers.

[0464] The multiplex overlap-extension primer mix used comprise the primers shown in table 26.

Table 26 <img file="IS2583B_D0063.tif" />

<img file="IS2583B_D0064.tif" />

(continued) <img file="IS2583B_D0065.tif" />

c. Semi-Nested PCR [0465] Semi-nested PCR ís likewise proposed to be performed as described in Example 11 e-2, and some optimization may be expected.

[0466] The primers used are shown in table 27.

Table 27 <img file="IS2583B_D0066.tif" /> [0467] In order to verify that the multiplex overlap-extension RT-PCR is successful a proportion of the samples from the semi-nested PCR reactions are analyzed by subjecting 10 μΙ from each semi-nested PCR reaction to 1% agarose gel electrophoresis using ethidium bromide for detection. The expected síze of the overlap-extension fragment is ap-proximately 850bp (the exact size depends upon the lengths of the variable regions).

[0468] Appraximately ten microliters from all the performed reactions originating from the same donor, are consolidated in a single tube. An aliquot of the pooled PCR products is subsequently purified using QIAquick PCR purification kit according to the manufactures procedure (Qiagen cat. No. 28106, Hilden, Germany, The purified pool of overlap PCR products can be digested with appropriate restriction enzymes and subsequently purified and inserted into a suitable vector.

[0469] In the present experíment constant region primers (SEQ ID NO 376 and 377) used in the semi-nested PCR are designed for sub-cloning of semi-nested PCR product into a suitable vector. The design of the Οβ primer relies on changing a SER to Met at pos. 21 in the β chain constant region peptide, whereby a NsiJ site can be introduced into the

<img file="IS2583B_D0067.tif" />

<img file="IS2583B_D0068.tif" />

nucleic acid sequence:

Nsil tcc cac -&gt; atg cat

SER HIS MET HIS [0470] This transition should be relative safe since SER 21 is exposed on the β chain constant region in a loop structure at the membrane proximal end of the domain. This relative conservative change is therefore not likely to disturb the overall domain structure.

[0471] The design of the Cot primer relies on changing nucleotides corresponding to pos. 15-17 in the ot chain constant region peptide, whereby a Sacl site can be introduced into the nucleic acid sequence:

Sacl aaa tcc agt -&gt; aag agc tct

LYS SER SER LYS SER SER [0472] Suitable vectors will therefore contain the remaining parts of the constant regions of the TcR α and β chains and will contain appropriate modification in terms of restriction sites. These changes can be performed using standard PCR and sub-cloning techniques.

e. Additional Considerations [0473] The large amountof variable region primers may potentially interact in an inhibitory mannerduring the multiplex overlap-extension PCR amplification. To avoid this, variable region primers may be divided into sub-sets and used separately in proper combinations.

Other Embodiments [0474] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, itwill be readily apparentto those of ordinary skill in theart in light ofthe teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

SEQUENCE LISTING [0475] &lt;110&gt; Symphogen A/S &lt;120&gt; METHOD FOR LINKING SEQUENCES OF INTEREST &lt;130&gt; 15881PCT00 &lt;160&gt; 377 &lt;170&gt; Patent In version 3.3 &lt;210&gt; 1 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 1 agcctatact attgattagg cgcgcccagr tgcagctggt gcart 45 &lt;210&gt;2 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400 2 agcctatact attgattagg cgcgccsagg tccagctggt rcagt 45 &lt;210 3 &lt;211&gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 3 agcctatact attgattagg cgcgcccagr tcaccttgaa ggagt 45 &lt;210 4 &lt;211 &gt;44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 4 agcctatact attgattagg cgcgccsagg tgcagctggt ggag 44 &lt;210 5 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 5 agcctatact attgattagg cgcgcccagg tgcagctaca gcagt 45 &lt;210 6 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 6 agcctatact attgattagg cgcgcccags tgcagctgca ggagt 45 &lt;210&gt;7 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 7 agcctatact attgattagg cgcgccgarg tgcagctggt gcagt 45 &lt;210&gt;8 &lt;211 &gt;46 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt;8 agcctatact attgattagg cgcgcccagg tacagctgca gcagtc 46 &lt;210&gt;9 &lt;211 &gt;20 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 9 gacsgatggg cccttggtgg 20 &lt;210&gt; 10 &lt;211&gt; 47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 10 cgcctaatca atagtatagg ctagccgaca tccagwtgac ccagtct 47 &lt;210&gt; 11 &lt;211&gt; 47 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 11 cgcctaatca atagtatagg ctagccgatg ttgtgatgac tcagtct 47 &lt;210 12 &lt;211&gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400 12 cgcctaatca atagtatagg ctagccgaaa ttgtgwtgac rcagtct 47 &lt;210&gt; 13 &lt;211&gt; 47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400&gt; 13 cgcctaatca atagtatagg ctagccgata ttgtgatgac ccacact 47 &lt;210&gt; 14 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 14 cgcctaatca atagtatagg ctagccgaaa cgacactcac gcagt 45 &lt;210&gt; 15 &lt;211 &gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400&gt; 15 cgcctaatca atagtatagg ctagccgaaa ttgtgctgac tcagtct 47 &lt;210&gt; 16 &lt;211 &gt;38 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 16 atatatatgc ggccgcttat taacactctc ccctgttg 38 &lt;210&gt; 17 &lt;211 &gt;26 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt;17 atattctcga gacggtgacc agggtg 26 &lt;210&gt;18 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 18 atattctcga gacggtgacc attgt 25 &lt;210&gt; 19 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400 19 atattctcga gacggtgacc agggttc 27 &lt;210&gt; 20 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400 20 atattctcga gacggtgacc gtggt 25 &lt;210&gt; 21 &lt;211&gt; 51 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 21 accgcctcca ccggcggccg cttattaaca ctctcccctg ttgaagctct t 51 &lt;210&gt; 22 &lt;211&gt; 43 &lt;212* DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; primer sequence &lt;400&gt; 22 gctagcatta ttattaccat ggcccagrtg cagctggtgc art 43 &lt;210 23 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400 23 gctagcatta ttattaccat ggccsaggtc cagctggtrc agt 43 &lt;210&gt; 24 &lt;211 &gt;43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 24 gctagcatta ttattaccat ggcccagrtc accttgaagg agt 43 &lt;210&gt; 25 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400 25 gctagcatta ttattaccat ggccsaggtg cagctggtgg ag 42 &lt;210 26 &lt;211 &gt;36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 26 tattggcgcg ccatggccsa ggtgcagctg gtggag 36 &lt;210&gt; 27 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 27 gctagcatta ttattaccat ggcccaggtg cagctacagc agt 43 &lt;210 28 &lt;211 &gt;43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 28 gctagcatta ttattaccat ggcccagstg cagctgcagg agt 43 &lt;210&gt; 29 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 29 gctagcatta ttattaccat ggccgargtg cagctggtgc agt 43 &lt;210 30 &lt;211 &gt;44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400&gt; 30 gctagcatta ttattaccat ggcccaggta cagctgcagc agtc 44 &lt;210 31 &lt;211&gt; 26 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 31 atattctcga gacggtgacc agggtg 26 &lt;210&gt; 32 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 32 atattctcga gacggtgacc attgtcc 27 &lt;210&gt; 33 &lt;211&gt; 27 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 33 atattctcga gacggtgacc agggttc 27 &lt;210 34 &lt;211 &gt;27 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 34 atattctcga gacggtgacc gtggtcc 27 &lt;210 35 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400 35 ccatggtaat aataatgcta gccgacatcc agwtgaccca gtct 44 &lt;210 36 &lt;211 &gt;44 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400 36 ccatggtaat aataatgcta gccgatgttg tgatgactca gtct 44 &lt;210 37 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 37 ccatggtaat aataatgcta gccgaaattg tgwtgacrca gtct 44 &lt;210&gt; 38 &lt;211&gt; 44 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400 38 ccatggtaat aataatgcta gccgatattg tgatgaccca cact 44 &lt;210&gt; 39 &lt;211 &gt;42 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220 &lt;223&gt; Primer sequence &lt;400&gt; 39 ccatggtaat aataatgcta gccgaaacga cactcacgca gt 42 &lt;210 40 &lt;211 &gt;44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Primer sequence &lt;400&gt; 40 ccatggtaat aataatgcta gccgaaattg tgctgactca gtct 44 &lt;210 41 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 41 tattggcgcg ccatggccca grtgcagctg gtgcart 37 &lt;210&gt; 42 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 42 tattggcgcg ccatggccsa ggtccagctg gtrcagt 37 &lt;210&gt; 43 &lt;211&gt; 37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 43 tattggcgcg ccatggccca grtcaccttg aaggagt 37 &lt;210&gt; 44 &lt;211&gt; 36 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt; 44 tattggcgcg ccatggccsa ggtgcagctg gtggag 36 &lt;210&gt; 45 &lt;211&gt; 36 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400 45 tattggcgcg ccatggccca ggtgcagcta cagcag 36 &lt;210&gt;46 &lt;211 &gt;37 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt; 46 tattggcgcg ccatggccca gstgcagctg caggagt 37 &lt;210 47 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 47 tattggcgcg ccatggccga rgtgcagctg gtgcagt 37 &lt;210&gt; 48 &lt;211 &gt;38 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 48 tattggcgcg ccatggccca ggtacagctg cagcagtc 38 &lt;210&gt; 49 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 49 aagtagtcct tgaccaggca gcc 23 &lt;210&gt; 50 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 50 tgagttccac gacaccgtca 20 &lt;210 51 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 51 agaggtgctc ttggaggagg 20 &lt;210&gt; 52 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 52 agttttgtca caagatttgg g 21 &lt;210&gt; 53 &lt;211 &gt;23 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 53 gttgcagatg taggtctggg tgc 23 &lt;210&gt; 54 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 54 gccatggcgc gccaatagct agccgacatc cagwtgaccc agtct 45 &lt;210&gt; 55 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 55 gccatggcgc gccaatagct agccgatgtt gtgatgactc agtct 45 &lt;210&gt; 56 &lt;211&gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 56 gccatggcgc gccaatagct agccgaaatt gtgwtgacrc agtct 45 &lt;210&gt; 57 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 57 gccatggcgc gccaatagct agccgatatt gtgatgaccc acact 45 &lt;210&gt; 58 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 58 gccatggcgc gccaatagct agccgaaacg acactcacgc agt 43 &lt;210&gt; 59 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 59 gccatggcgc gccaatagct agccgaaatt gtgctgactc agtct 45 &lt;210&gt; 60 &lt;211 &gt;40 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 60 atatatatgc ggccgcttat taacactctc ccctgttgaa 40 &lt;210&gt; 61 &lt;211&gt; 30 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 61 ggaggcgctc gagacggtga ccagggtgcc 30 &lt;210&gt; 62 &lt;211 &gt;30 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 62 ggaggcgctc gagacggtga ccattgtccc 30 &lt;210&gt; 63 &lt;211 &gt;30 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 63 ggaggcgctc gagacggtga ccagggttcc 30 &lt;210&gt;64 &lt;211 &gt;30 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 64 ggaggcgctc gagacggtga ccgtggtccc 30 &lt;210&gt; 65 &lt;211 &gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 65 cgcctaatca atagtatagg ctagcccagt ctgtgctgac tcagcca 47 &lt;210&gt;66 &lt;211 &gt;45 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt; 66 cgcctaatca atagtatagg ctagcccagt ctgtgytgac gcagc 45 &lt;210&gt; 67 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 67 cgcctaatca atagtatagg ctagcccagt ctgtcgtgac gcagc 45 &lt;210&gt; 68 &lt;211 &gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 68 cgcctaatca atagtatagg ctagcccart ctgccctgac tcagcct 47 &lt;210&gt; 69 &lt;211 &gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 69 cgcctaatca atagtatagg ctagcctcct atgwgctgac tcagcca 47 &lt;210&gt; 70 &lt;211 &gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 70 cgcctaatca atagtatagg ctagcctctt ctgagctgac tcaggac 47 &lt;210&gt; 71 &lt;211 &gt;47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 71 cgcctaatca atagtatagg ctagcccacg ttatactgac tcaaccg 47 &lt;210&gt; 72 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 72 cgcctaatca atagtatagg ctagcccagg ctgtgctgac tcagc 45 &lt;210&gt; 73 &lt;211 &gt;49 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 73 cgcctaatca atagtatagg ctagccaatt ttatgctgac tcagcccca 49 &lt;210 74 &lt;210 46 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 74 cgcctaatca atagtatagg ctagcccagr ctgtggtgac ycagga 46 &lt;210&gt; 75 &lt;210 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 75 cgcctaatca atagtatagg ctagcccwgc ctgtgctgac tcagc 45 &lt;210&gt; 76 &lt;210 31 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 76 gccgcttatt atgaacattc tgtaggggcc a 31 &lt;210&gt; 77 &lt;210 31 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 77 gccgcttatt aagagcattc tgcaggggcc a 31 &lt;210&gt; 78 &lt;210 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 78 atatatatgc ggccgcttat tatgaacatt ctgtaggggc cactg 45 &lt;210 79 &lt;21045 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt; 79 atatatatgc ggccgcttat taagagcatt ctgcaggggc cactg 45 &lt;210&gt; 80 &lt;21036 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 80 atatatatgc ggccgcttaa tgggctgcct cgggaa 36 &lt;210&gt; 81 &lt;210 47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 81 gccatggcgc gccaatagct agccttagag cagctcgtac tgacgaa 47 &lt;210&gt; 82 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 82 tattggcgcg ccatggccat gagtgagctt gaccagttac g 41 &lt;210&gt; 83 &lt;211&gt; 47 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 83 ggtacctaat aataatcgat cgcttagttc cagatcttga ggaagct 47 &lt;210&gt; 84 &lt;211 &gt;48 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 84 cgatcgatta ttattaggta ccccatgcca gtaatcaata ttgaggac 48 &lt;210&gt; 85 &lt;211 &gt;38 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 85 ggaggcgctc gagttatgaa atcacacagc ctcctttg 38 &lt;210&gt; 86 &lt;211&gt; 34 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;221&gt; misc_feature &lt;222&gt; (18)..(34) &lt;223&gt; gene-specific region &lt;400 86 tattcccagc ggccgccgcc acaggtgccc actc 34 &lt;210&gt; 87 &lt;211 &gt;34 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;221 &gt; miscfeature &lt;222&gt; (18)..(34) &lt;223&gt; gene-specific region &lt;400&gt; 87 tattcccagc ggccgcccct tcmtgggtct tgtc 34 &lt;210&gt; 88 &lt;211 &gt;35 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;221 &gt; miscfeature &lt;222&gt; (18)..(35) &lt;223&gt; gene-specific region &lt;400&gt; 88 tattcccagc ggccgcctta raaggtgtcc agtgt 35 &lt;210&gt; 89 &lt;210 32 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;220 miscjeature &lt;222&gt; (18)..(32) &lt;223&gt; gene-specific region &lt;400&gt; 89 tattcccagc ggccgccccc agatgggtcc tg 32 &lt;210&gt; 90 &lt;210 34 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;220 misc_feature &lt;222&gt; (18)..(34) &lt;223&gt; gene-specific region &lt;400&gt; 90 tattcccagc ggccgccctc caaggagtct gttc 34 &lt;210&gt; 91 &lt;210 35 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;220 misc_feature &lt;222&gt; (18)..(35) &lt;223&gt; gene-specific region &lt;400&gt; 91 tattcccagc ggccgcccca tggggtgtcc tgtca 35 &lt;400&gt; 101 atgaaatatt tgctaccaac agcggcagct ggattattgt tactagcg 48 &lt;210&gt; 102 &lt;211=» 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 102 tgttgttcta gatgaaggcg cgcccagrtg cagctggtgc art 43 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 103 tgttgttcta gatgaaggcg cgccsaggtc cagctggtrc agt 43 &lt;210&gt; 104 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 104 tgttgttcta gatgaaggcg cgcccagrtc accttgaagg agt 43 &lt;210&gt; 105 &lt;211 &gt;42 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt;105 tgttgttcta gatgaaggcg cgccsaggtg cagctggtgg ag 42 &lt;210&gt; 106 &lt;211 &gt;43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 106 tgttgttcta gatgaaggcg cgcccaggtg cagctacagc agt 43 &lt;210&gt; 107 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 107 tgttgttcta gatgaaggcg cgcccagstg cagctgcagg agt 43 &lt;210&gt; 108 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 108 tgttgttcta gatgaaggcg cgccgargtg cagctggtgc agt 43 &lt;210&gt; 109 &lt;211 &gt;44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 109 tgttgttcta gatgaaggcg cgcccaggta cagctgcagc agtc 44 &lt;210&gt; 110 &lt;211&gt; 45 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt;110 aacaacacta gtgataggct agccgacatc cagwtgaccc agtct 45 &lt;210&gt;111 &lt;211 &gt;45 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt; 111 aacaacacta gtgataggct agccgatgtt gtgatgactc agtct 45 &lt;210&gt; 112 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 112 aacaacacta gtgataggct agccgaaatt gtgwtgacrc agtct 45 &lt;210&gt; 113 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 113 aacaacacta gtgataggct agccgatatt gtgatgaccc acact 45 &lt;210&gt; 114 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 114 aacaacacta gtgataggct agccgaaacg acactcacgc agt 43 &lt;210&gt;115 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 115 aacaacacta gtgataggct agccgaaatt gtgctgactc agtct 45 &lt;210&gt; 116 &lt;211 &gt;36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 116 tattcccatg gcgcgcccag rtgcagctgg tgcart 36 &lt;210&gt;117 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 117 tattcccatg gcgcgccsag gtccagctgg trcagt 36 &lt;210&gt;118 &lt;210 36 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400&gt; 118 tattcccatg gcgcgcccag rtcaccttga aggagt 36 &lt;210&gt; 119 &lt;210 35 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 119 tattcccatg gcgcgccsag gtgcagctgg tggag 35 &lt;210&gt; 120 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 120 tattcccatg gcgcgcccag gtgcagctac agcagt 36 &lt;210&gt; 121 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 121 tattcccatg gcgcgcccag stgcagctgc aggagt 36 &lt;210 122 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 122 tattcccatg gcgcgccgar gtgcagctgg tgcagt 36 &lt;210&gt; 123 &lt;210 37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 123 tattcccatg gcgcgcccag gtacagctgc agcagtc 37 &lt;210&gt; 124 &lt;211&gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 124 ggcgcgccat gggaatagct agccgacatc cagwtgaccc agtct 45 &lt;210&gt; 125 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artiflcial &lt;400&gt; 125 ggcgcgccat gggaatagct agccgatgtt gtgatgactc agtct 45 &lt;210&gt; 126 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt;126 ggcgcgccat gggaatagct agccgaaatt gtgwtgacrc agtct 45 &lt;210&gt; 127 &lt;211 &gt;45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 127 ggcgcgccat gggaatagct agccgatatt gtgatgaccc acact 45 &lt;210 128 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 128 ggcgcgccat gggaatagct agccgaaacg acactcacgc agt 43 &lt;210&gt; 129 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 129 ggcgcgccat gggaatagct agccgaaatt gtgctgactc agtct 45 &lt;210&gt; 130 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt;130 atatatatgc ggccgcttaa cactctcccc tgttgaa 37 &lt;210&gt; 131 &lt;211 &gt;20 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Vector Sequence &lt;400&gt; 131 aggaaacagg agatatacat 20 &lt;210&gt; 132 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Vector sequence &lt;400&gt; 132 tcgccaagga gacagtcata 20 &lt;210&gt; 133 &lt;211&gt;369 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 133 gggcgcgccc aggtgcagct ggtgcaatct ggacctgaag tgaagaagcc tggggcctca60 gtgagggtct cctgcaaggc ctctggttac tcctttaaga actatggtat ccactgggtg120 cgacaggccc ctggacaggg gcttgagtgg atggggtgga tcagcgctga caatggtgac180 acaaccactg cactgaacct ccggggcaga gtctccatga ccacagacae atccacaaac240 acagtctaca tggaggtgaa gagcctaaga tctgacgaca cggccatata tttctgtgcg300 cgagattttt atagtgggag ttaccggtcc tttgactgct ggggccaggg caccctggtc360 accgtctcg369 &lt;210 134 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 134 gggcgcgccc aggtgcagct acagcagtct gggggaggcc tggtcaagcc tggggggtcc 60 ctgagactct cctgtgcagc ctctggattc accttcagta gctatagcat gaactgggtc120 cgccaggctc cagggaaggg gctggagtgg gtctcatcca ttagtagtag tagtagttac180 atatactacg cagactcagt gaagggccga ttcaccatct ccagagacaa cgccaagaac240 tcactgtatc tgcaaatgaa cagcctgaga gccgaggaca cggctgtgta ttactgtgcg300 agacgccctg gttgggctgc tactcgggcg gcgggtgctt ttgatatctg gggccaaggg 360 acaatggtca ccgtctcg378 &lt;210&gt; 135 &lt;210 357 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 135 gggcgcgccc aggtgcagct ggtgcaatct ggacctgaac tgaagaagcc tggggcctca60 gtgaggatct cctgcaaggc ctctgagaaa tgtgatatcc actgggtgcg acaggcccct120 ggacaggggc ttgagtggat gggatggatc agcgctgacg atggtgggac aaccactgcg180 ctgaacctcc ggggcagagt ctccatgacc acagacagag ccacaaacac agtatacatg240 gaactgaaga gcctaagatc tgacgacacg gccatttatt tctgtgcgcg agatttttat300 agtgggactt accggtcctt tgactactgg ggccagggaa ccctggtcac cgtctcg357 &lt;210&gt; 136 &lt;210 396 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 136 gggcgcgcca aggtgcagct ggtggagtct gggggaggcg tggtccagcc tgggacgtcc60 ctcagactct cctgtgtagt ctctggattc accttcagaa cctatggtat gaactgggtc120 cgccaggctc caggcaaggg gctggagtgg ctggcatttc tatcatctga tgggagcgat180 gaattctacg cggactccgt gaagggccga ttcaccgtct ccagggacaa ttccaagagc240 actctctttc tgaaaatgaa cagtctgaga cctgatgaca cggctgtcta ttactgtgcg300 agggatcgtg gggcccaaat tacacttttt ggagcccctc ttataaggcc ttcgtccttt360 gactcctggg gccagggcac cctggtcacc gtctcg396 &lt;210&gt; 137 &lt;210 362 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 137 gggcgcgccc aggtgcagct gcaggagtct ggacctgagg tgaagaagcc tggggcctca60 gtgaaggtgt cctgcaaggc ttctggctac acgtttaaca gttatggaat cgcctgggtg120 cgacaggtcc ctggacaagg gcttgagtgg atgggatgga tcagccctta cagtggtcac180 acaaactatg cagagaaggt ccagggcaga gtcaccatga ccacagacac cgccacgagc240 acagcctgca tggagctgac gagcctgaga tctgacgaca cggccgttta tttctgtgcg300 agagactaca gtagtccgta ccactttgac tactggggcc agggcacctg gtcaccgtct360 cg362 &lt;210&gt; 138 &lt;211 &gt;366 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 138 gggcgcgccc agatcacctt gaaggagtct ggtcctacgc tggtgaaacc cacacagacc60 ctcacgctga cctgcacctt gtctgggttc tcactctaca ctactggagt gggtgtgggc120 tggatccgtc agcccccagg aaaggccctg gagtggctgg cacgcattta ttgggatgat180 gatgagcgct acaacccgtc tctgaagagc aggctcacca tcaccaagga cgcctccaaa240 aaccaggtgg tccttaaaat gaccaacatg gaccctgtgg acacagccac atattactgt300 gcccggacca tgggcgtcgt tcttccattt gactactggg gccagggaac cctggtcacc360 gtctcg366 &lt;210&gt; 139 &lt;211&gt; 351 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 139 gggcgcgcca aggtgcagct ggtggagtct gggggaggcc tggtcaagcc gggggggtcc60 ctgagactct cctgtgtagt ttctgggttc cccctcaata gatacaccat gaactgggtc120 cgccaggctc cagggaaggg gctggagtgg ctctcgtcca ttagtagtac tagttcttac180 atatactacg cagactcagt gaagggccga ttcaccatct ccagagacaa cgccaagaat240 tctctgtttc tgcagatgaa cagcctgaga gccgacgaca cggctctcta tttctgtgcg300 agtggcaata ctcatgacta ctggggccag ggaaccctgg tcaccgtctc g351 &lt;210&gt; 140 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 140 gggcgcgccc aggtgcagct ggtgcagtct ggggctgagg tgaagaagct tgggacgtca60 gtgagggtct cctgcaagac tcctggaggc tatgttttca gctgggtgcg acaggcccct120 ggacaagggc ctgagtggat gggagggatc atcaccaact ttgggacaac aaactacgca180 cggaagttcc ágggcagaat cacggttacc gcggacaaat ccacgaacac agtgtacatg240 gatttgagca acctggcatc tgaggacacg gccgtgtatt actgtgcgag agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cgatatttct ttgactcctg gggccagggc 360 accctggtca ccgtctcg378 &lt;210&gt; 141 &lt;211&gt; 396 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 141 gggcgcgccc aggtgcagct tcaggagtct gggggaggcg tggtccagcc tgggacgtcc60 ctcagactct cctgtgtagt ctctggattc accttcagaa cctatggtat gaactgggtc120 cgccaggctc caggcaaggt gctggagtgg ctggcatttg tatcatctga tgggagcgat180 gaattctacg cggactccgt gaagggccga ttcaccgtct ccagggacaa ttccaagagc240 actctctttc tgaaaatgaa cagtctgaga gctgatgaca cggctgtcta ttactgtgcg300 agagatcgtg gggcccaaat tacacttttt ggagcccctc ttataaggcc ttcgtccttt360 gactcctggg gccagggaac cctggtcacc gtctcg396 &lt;210142 &lt;211&gt; 378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 142 gggcgcgccg aggtgcagct ggtggagtct ggggctgagg tgaagaagcc tgggacctca60 gtgagggtct cctgcaagac ttctggaggc tatgttttca gctgggtgcg acaggcccct120 ggacaagggc ctgagtggat gggagggatc atcaccagct ttgggacaac aagctacgca180 cagaagttcc agggcagagt cacgattacc gcggacaaag ccacgaacac agtgtacatg240 gatttgagcg acctgacatc tgaggacacg gccatatatt actgtgcgaa agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cgctatttct ttgactcctg gggccagggc360 accctggtca ccgtctcg378 &lt;210 143 &lt;211&gt; 366 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400 143 gggcgcgccc aggtgcagct gcaggagtct ggtcctacgc tggtgaaacc cacacagacc60 ctcacgctga cctgctcgtt ctctggtttc tcactcggca ctactggagt caatgtgggc120 tggatccgtc agcccccggg aaaggccctg gagtggcttg cactcatttc ttgggatggt180 ggtaagcact acagcccatc tctgaactcc aggatcaccc tcactaagga cgcctccaga240 gagcaggtgg tggtccctac aatgaccaac atggaccctg cggacacagg cagatattat300 tgtgcacgta tagtggggac tcacggcttt gactactggg gccagggaac cctggtcacc360 gtctcg366 &lt;210&gt; 144 &lt;211&gt; 393 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 144 gggcgcgcca aggtgcagct ggtggagtct ggagctgagg tgaagaagcc tggggccaca60 gtcagggtct cctgtaaggc ttctggttac aggtttaacg actattgtat cagctgggtg120 cgacaggccc ctggacaagg gcttgagtgg atggggtgga tcaacggtaa caatgctgac1Β0 acattctatg caccgaagct ccagggcaga gtcaccatga gcacagacac atccacgagc240 acagcctaca tggagctgag gaacttgaga tcggacgaca cggccgttta tttctgtgcg300 cgagatcgag gacgtattac tctttttggc gaagttattt taagggcggg atggttcgac360 tcctggggcc agggcaccct ggtcaccgtc tcg393 &lt;210&gt; 145 &lt;210 372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 145 gggcgcgccc aggtgcagct ggtgcagtct gggggaggcc tggtcaagcc gggggggtcc60 ctgagactct cctgtgcagc ctctggattc tcctttagta ataataacat gaattgggtc120 cgccagactc caggaaaggg actggagtgg gtcgcatcta ttagttttgg aagtcattac180 atatcctacg cagactcagt gaagggccga ttcaccatct ccagagacaa cgccaggaat240 gcagtttatc tgcagatgaa cagcctgaga gtcgaggaca cggctgtcta ttactgcacg300 agatgcaggg gcggaactcg tacctattat tacatggacg tctggggcaa aggcaccctg 360 gtcaccgtct cg372 &lt;210&gt; 146 &lt;210 372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 146 gggcgcgcca aggtgcagct ggtggagtct gggggaggcc tggtcaagcc aggggggtcc60 ctgagactct cctgtgcagc ctctggatcc tcctttagta ataataacat gaattgggtc120 cgccagactc caggaaaggg actggagtgg gtcgcatcca ttagttttgg aagtcattac180 atatcctacg cagactcagt gaagggccga ttcaccatct ccagagacaa cgccaggaat240 gcagtttatc tgcagatgaa cagcctgaga gtcgaggaca cggctgtcta ttactgcacg300 agatgcaggg gcggaactcg tacctattat tacatggacg tctggggcaa aggcaccctg 360 gtcaccgtct cg372 &lt;210&gt; 147 &lt;211 &gt;390 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 147 gggcgcgccc agatgcagct ggtgcaatct ggggctgagg tgaagaagcc tgggtcctcg60 gtgaaggtct cctgccagtc ttctggaggc ccccccaaaa gttatactct cagctgggtg120 cggcaggccc ctggacaagg ccctgagtgg atgggcggaa tcattctaat ctttggccca180 ccaaactacg cccagaagtt ccaggacaga ctcacgatca ccgcggacaa gtccaccaac240 acagtctaca tggagttaag tagcctgaga tctgatgaca cggccatgta ctactgtgtg300 acagcccccg acgacactgg cactatatta gctcgtcaca accgttacta ctttgactcc360 tggggccagg gcaccctggt caccgtctcg390 &lt;210&gt; 148 &lt;211&gt; 390 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 148 gggcgcgcca aggtgcagct ggtgcagtct ggagcagagg tgaagaagcc cggggagtct60 ctgaaaatct cctgtcaggc ttctggatac ggctttaccg tctactggat cggctgggtg120 cgccagccgc ccgggaaagg cctggagtgg ctgggtatca tctatcctgg tgactctgat180 accagataca atccgtcctt ccaaggccag gtcaccatct cagccgacaa gtccgtcagc240 accacctacc tgcagtggag cagcctgaag gcctcggaca ccgccattta ctactgtgcg300 agacatctgg actcatacga tgttttcact ggttataatt tggggggcta catggacgtc 360 tggggcaagg gaaccctggt caccgtctcg390 &lt;210&gt; 149 &lt;211&gt; 351 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 149 gggcgcgcca aagtgtagct ggtgcagtct gggggaggcc tggtcaagcc tggggggtcc60 ctgagactct cctgtgtagt ctctggattc cccctcaata gatacatcat gaactgggtc120 cgccagactc cagggaaggg gctggagtgg ctctcgtcca ttagtagtac cagttcttac180 atatactacg cagactcagc gaagggccga ttcaccatct ccagagacaa cgccaagaat240 tctctgtttc tgcagatgaa cagcctgaga gccgaggaca caggtctcta ttactgtgcg300 agtggcaata ctcatgacta ttggggccag ggcaccctgg tcaccgtctc g351 &lt;210&gt; 150 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 150 gggcgcgccc agatgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggacctca60 gtgagggtct cctgcaagac ttctggaggc tatgttttca gctgggtgcg acaggcccct120 ggacaagggc ctgagtggat gggagggatc atcaccaact ttgggacaac aaactacgca180 cagaagttcc agggcagagt cacgattacc gcggacaaat ccacgaacac agtgtatatg240 gatttgagca acctgacatc tgaggacacg gccgtgtatt actgtgcgag agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cggtatttct ttgactcctg gggccagggc 360 accctggtca ccgtctcg378 &lt;210&gt; 151 &lt;211&gt; 372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 151 gggcgcgcca aggtgcagct ggtggagtct ggggctgagg tgaagaagcc tgggtcctcg60 gtgaaggtct cctgcaaggc ctctggaggc agcttcagca cctatgctat cacctgggtg120 cgccaggccc ctggacaggg gcttgaatgg atgggaggga tcatccctat ctttgcttca180 agagactacg cacagaagtt tcagggcaga gtcacagtca ccgcggacga atccacgagg240 acagtgtaca tggagctgag cagcctgaga tctgacgaca cggccgtgta ttactgtgca 300 agagtgctgg gaggtacaag gctctactac gctctgaacg tctggggcca agggacaatg 360 gtcaccgtct cg 372 &lt;210&gt; 152 &lt;210 372 &lt;212&gt; DNA &lt;213&gt; Homo, Sapiens &lt;400&gt; 152 gggcgcgcca aggtgcagct ggtggagtct ggggctgagg tgaagaagcc tgggtcctcg60 gtgaaggtct cctgcaagac atctggaggc agtttcagca catactctat cacctgggtg120 cgccaggccc ctggacaggg gcttgagtgg atgggaggga tcaaccctat cttcgctaca180 agagactacg cacagaagtt ccagggcaga gtcacgatca ccgcggacga atccacgagg240 acagtctaca tggagttgag gaacttgaga tctgaggaca cggccgtgta ttattgtgca300 agagtgttcg gaggaacaag actctactac gccctgaacg tctggggcca aggcaccctg 360 gtcaccgtct cg372 &lt;210&gt; 153 &lt;210 378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 153 gggcgcgccg aagtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggacgtca60 gtgagggtct cctgcaagac tcctggaggc tatgttttca gctgggtgcg acaggcccct120 ggacaagggc ctgagtggat gggagggatc atcaccaact ttgggacaac aaactacgca180 cggaagttcc agggcagaat cacggttacc gcggacaaat ccacgaacac agtgtacatg240 gatttgagca acctggcatc tgaggacacg gccgtgtatt actgtgcgag agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cgatatttct ttgactcctg gggccagggc 360 accctggtca ccgtctcg378 &lt;210&gt; 154 &lt;210 372 &lt;212&gt; DNA &lt;213&gt; Hoitio Sapiens &lt;400&gt; 154 gggcgcgcca aggtgcagct ggtggagtct gggggaggcc tggtcaagcc gggggggtcc60 ctgagactct cctgtgcagc ctctggattc tcctttagta ataataacat gaattgggtc120 cgccagaccc caggaaaggg actggagtgg gtcgcatcca ttagttttgg aagtcattac180 atatcctacg cagactcagt gaagggccga ttcaccatct ccagagacaa cgccaggaat240 gcagtttatc tgcagatgaa cagcctgaga gtcgaggaca cggctgtcta ttactgcacg300 agatgcaggg gcggaactcg tacctattat tacatggacg tctggggcaa agggacaatg360 gtcaccgtct cg372 &lt;210&gt; 155 &lt;211 &gt;390 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 155 gggcgcgcca aggtgcagct ggtgcagtct ggagcagagg tgaagaagcc cggggagtct60 ctgaaaatct cctgtcaggc ttctggatac ggctttaccg tctactggat cggctgggtg120 cgccagccgc ccgggaaagg cctggagtgg ctgggtatca tctatcctgg tgactctgat180 accagataca atccgtcctt ccaaggccag gtcaccatct cagccgacaa gtccgtcagc240 accacctacc tgcagtggag cagcctgaag gcctcggaca ccgccattta ctactgtgcg300 agacatctgg actcatacga tgttttcact ggttataatt tggggggctá catggacgtc360 tggggcaagg gaaccctggt caccgtctcg390 &lt;210&gt; 156 &lt;211&gt; 378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 156 gggcgcgccc aggtgcagct ggtggagtct ggggctgaag tgaagaagcc tgggtcctca60 gtgaaggtct cctgcaagtc ttctggaggc tatgttttca gctgggtgcg acaggcccct120 gggcaaggac tagagtggat gggagggatc atctccaact ttcgcacggc agagtacgca180 cggaagttcc agggtagagt caccatgacc gcggacacat ccacgaacac aatctacatg240 gagctgacca gcctgacatc tgaagacacg gccgtatatt tctgtgtgag cgccccccga300 gacacgtcga ctatagcagc tcgttttaat cgatacttct ttgacacctg gggccagggc 360 accctggtca ccgtctcg378 &lt;210 157 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt;157 gggcgcgccc aggtgcagct acagcagtcg gggggaggcg tggtccagcc tgggaggtcc 60 ctgagactct cctgtgctgc ctctggattc gccttcagag actatgccat gcactgggtc120 cgccaggccc caggcaaggg gctggagtgg atgggagtta tctcatttaa tggagatcag180 atattttacg cagactccat gaagggccgc ttcaccatct ccagagagaa ctccaagaac240 acgc-tgcatc tgcgcatgaa cagcctgaga cctgaggaca cggctgtcta ttactgtgcg300 agagcccgac ttcttttttg tagcggtggt aggtgcgaca tggactcttg gggccaggga 360 accctggtca ccgtctcg373 &lt;210&gt; 158 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400 158 gggcgcgcca aagtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggacctca60 gtgagggtct cctgcaagac ttctggaggc tatgttttca gttgggtgcg acaggcccct120 ggacacgggc ctgaatggat gggagggatc atcaccaact ttgggacagc aacctacgca180 cagaagttcc agggcagagt ctcgattacc gcggacacat ccacgaacac attttacatg240 gatttgaaca atctgaaatc tgacgacacg gccgtttatt actgtgcgag cgccccccga300 gacacgtcga ctatagcggc tcggtttaat cggtacttct ttgacttctg gggcccgggc 360 accctggtca ccgtctcg378 &lt;210* 159 &lt;211*348 &lt;212* DNA &lt;213* Homo Sapíens &lt;400* 159 gggcgcgcct aggtgcagct ggtgcagtct gggggaggct tggtaaaacc tggggggtcc60 cttagactct cctgtgcagc ctctggattc actttcagta acgcctggat gagctgggtc120 cgccaggctc cagggaaggg gctggagtgg gttggccatg ttaaaagcat gactgatggt180 gggacaacag actacgctgc acccgtgaaa ggcagattca ccatctcaag agatgattca240 gaaaacacgc tgtatctgca aatgaacagc ctgaagaccg acgacacagc cgtgtattac300 tgtaccactc atgactactg gggccagggc accctggtca ccgtctcg348 &lt;210* 160 &lt;211*378 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 160 gggcgcgcca aagtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggacgtca60 gtgagggtct cctgcaagac tcctggaggc tatgttttca gctgggtgcg acaggcccct120 ggacaagggc ctgagtggat gggagggatc atcaccaact ttgggacaac aaactacgca180 cggaagttcc agggcagaat cacggttacc gcggacaaat ccacgaacac agtgtacatg240 gatttgagca acctggcatc tgaggacacg gccgtgtatt actgtgcgag agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cgatatttct ttgactcctg gggccagggc 360 accctggtca ccgtctcg3^8 &lt;210&gt; 161 &lt;211 &gt;393 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 161 gggcgcgccc aggtgcagct ggtggagtct ggggctgaga tgaagaagcc tgggtcctcg60 gtgaaggtct cctgccaggc ctctggaggc accttcagca actatggcat caattgggtg120 cgacacgccc ctggacaagg gcttgagtgg atgggaggaa tcgtccctat ctatggtcca180 ccgaagtacg cacagaagtt ccagggcaga gtcacgatta ctgcggacac gtccacgagc240 acagcctaca tggagctgag cagcctgagc tctgatgaca cggccgtgta ttactgtgcg300 cgactttccc ggactgtgtt tggctcgggg acttatcgtc cgggctacta ctacatggac360 gtctggggca tagggaccac ggtcaccgtc tcg393 &lt;210&gt; 162 &lt;211 &gt;372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 162 gggcgcgcct aggtgcagct acagcagtct gggggaggcc tggtcaagcc gggggggtcc60 ctgagactct cctgtgcagc ctctggattc tcctttagta ataataacat gaattgggtc120 cgccagactc caggaaaggg actggagtgg gtcgcatcca ttagttttgg aagtcattac180 atatcctacg cagactcagt gaagggccga ttcaccatct ccagagacaa cgccaggaat240 gcagtttatc tgcagatgaa cagcctgaga gtcgaggaca cggctgtcta ttactgcacg300 agatgcaggg gcggaactcg tacctattat tacatggacg tctggggcaa aggcaccctg 360 gtcaccgtct cg372 &lt;210&gt;163 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt;163 gggcgcgcca^- aggtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggacctca60 gtgagggtct cctgcaagac ttctggaggc tatgttttca gctgggtgcg acaggcccct120 ggacaagggc ctgagtggat gggagggatc atcaccaact ttgggacaac aaactacgca180 cagaagttcc agggcagagt cacgattacc gcggacaaat ccacgaacac agtgtacatg240 gatttgagca acctgacatc tgaggacacg gccgtgtatt actgtgcgag agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cggtatttct ttgactcctg gggccagggc 360 accctggtca ccgtctcg378 &lt;210&gt; 164 &lt;211 &gt;372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 164 gggcgcgccg aagtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggtcctcg60 gtgaaggtct cctgcaagac tgaaggaggc accttcagca cctatgttat cagttggatg120 cgacaggccc ctggacaagg gcttgagtgg atgggaggga tcgtccccat ctttaacaca180 ccaaactacg ctcagaaatt ccagggcaga gtcacaatta ccgcggacag atccacgagc240 acagcctaca tggagctgag gagcctggga tctgaggaca cggccgtcta ttactgtgcg300 agggtagtgg gaggtacaag gtcctactac gctttgggct tctggggcca ggggaccacg360 gtcaccgtct cg372 &lt;210&gt; 165 &lt;211 &gt;366 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 165 gggcgcgccc aggtcacctt gaaggagtct ggtcctacgc tggtgaaacc cacacagacc60 ctcacgctga cctgcacgtt ctctggtttc tcactcggca ctactggagt caatgtgggc120 tggatccgtc agcccccagg aaaggccctg gagtggcttg cactcatttc ttggggtggt180 ggtaagcact acagcccatc tctgaactcc aggatcaccc tcactaagga cgcctccaga240 gagcaggtgg tggtccttac aatggccaac atggaccctg tggacacagg cagatattat300 tgtgcacgta tagtggggac tcacggcttt gactactggg gccagggcac cctggtcacc360 gtctcg366 &lt;210* 166 &lt;211*372 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 166 gggcgcgccg aggtccagct ggtgcagtct gggggaggtg tggtgcggcc tggggggtcc60 ctgagactct cgtgtgcagg ctctggattc acctttgatg aatacgctat gagctgggtc120 cgccaagctc cagggaaggg gctggagtgg gtcgctttta ttaattggaa tggtgatagc130 acatattatg cagactctgt gaagggccga ttcaccgtct ccagaaccaa cgccaagaac240 tccctgtatc tgcaaatgaa cagtctgaga gccgaggaca cggccttcta ttactgtgcg300 agagaccccc gcactaaact ggggatgtcc tattttgact attggggcca gggcaccctg 360 gtcaccgtct cg372 &lt;210*167 &lt;211*390 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 167 gggcgcgccg aagtgcagct ggtgcagtct ggagcagagg tgaagaagcc cggggagtct60 ctgaaaatct cctgtcaggc ttctggatac ggctttaccg tctactggat cggctgggtg120 cgccagctgc ccgggaaagg cctggagtgg ctgggtatca tctatcctgg tgactctgat180 accagataca atccgtcctt ccaaggccag gtcaccatct cagccgacaa gtccgtcagc240 accacctacc tgcagtggag cagcctgaag gcctcggaca ccgccattta ctactgtgcg300 agacatctgg actcatacga tgttttcact ggttataatt tggggggcta catggacgtc 360 tggggcaagg ggacaatggt caccgtctcg390 &lt;210*168 &lt;211*369 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 168 gggcgcgccg aggtgcagct ggtgcagtct ggacctgaag tgaagaagcc tggggcctca60 gtgagggtct cctgcaaggc ctctggttac tcccttaaga actatggtat ccactgggtg120 cgacaggccc ctggacaggg gcttgagtgg atggggtgga tcagcgctga caatggtgac180 acaaccactg cactgaacct ccggggcaga gtctccatga ccacagacac atccacaaac240 acagtctaca tggaggtgaa gagcctaaga tctgacgaca cggccatata tttctgtgcg300 cgagattttt atagtgggag ttaccggtcc tttgactact ggggccaggg caccctggtc360 accgtctcg369 &lt;210&gt; 169 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 169 gggcgcgccg aagtgcagct ggtgcagtcg ggcccaggac tggtgaagcc ttcggagacc60 ctgtccctca catgcgctgt ctctggtgcc tccgtcagcg gtggtgatta ctactggagc120 tggatccggc agcccccagg gaaggcactg gagtggattg ggtatatcta ttacataggg180 agcaccaact acaatccctc tctcaagagt cgactctccc tatcagtaga cacggccaag240 agccagttct ccctgaagtt gagctctgtg accgctgcgg acacggccat ttatttctgt300 gcgagagcac gtcggacgta tagtggctac gactccgcct ttgactactg gggccaggga 360 accctggtca ccgtctcg378 &lt;210&gt; 170 &lt;211 &gt;372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 170 gggcgcgccc aggtgcagct gcagcagtcg ggcccaggac tggtgaagcc ctcggagacc60 ctgcccctca cctgcactgt ctctggtggc tccttcagta cctactactg gagctggatc120 cggcagtccc cagagaaggg actggagtgg attggatata tccaaaacag tgtgaacacc180 aactacaacc cctccctcaa gagtcgtgtc atcatttcag tggacacgtc caacaaccag240 ttctccctga agctgaggtc tgtgaccgct gcggacacgg ccgtatatta ctgtgcgaga300 gtaagcggct ggggcccaag gggaggcatc tactttgact actggggcca gggaaccctg 360 gtcaccgtct cg372 &lt;210&gt; 171 &lt;211 &gt;378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 171 gggcgcgcca aggtgcagct ggtgcagtct ggggctgaag tgaagaagcc tgggtcctca60 gtgaaggtct cctgcaagtc ttctggaggc tatgttttca gctgggtgcg acaggcccct120 gggcaaggac tagagtggat gggagggatc atctccaact ttcacacggc agagtacgca180 cagaagttcc agggtagagt caccatgacc gcggacacat ccacgaacac aatctacatg240 gagctgacca gcctgacatc tgaagacacg gccgtatatt tctgcgtgag cgccccccga 300 gacacgtcga ctatagcagc tcgttttaat cgatacttct ttgacacctg gggccagggc 360 accctggtca ccgtctcg378 &lt;210&gt; 172 &lt;211&gt; 378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 172 gggcgcgccg aggtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggacgtca60 gtgagggtct cccgcaagac tcctggaggc tatgttttca gctgggtgcg acaggcccca120 ggacaagggc ctgagtggat gggagggatc atcaccaact ttgggacaac aaactacgca180 cggaagttcc agggcagaat cacggttacc gcggacaaat ccacgaacac agtgtacatg240 gatttgagca acctggcatc tgaggacacg gccgtgtatt actgtgcgag agccccccga300 ggcacgtcga ctatagcagc tcgttttaat cgatatttct ttgactcctg gagccagggc 360 accctggtca ccgtctcg378 &lt;210* 173 &lt;211*372 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 173 gggcgcgccg aggtgcagct ggtggagtct ggggctgagg tgaagaagcc tgggtcctcg60 gtgaaggtct cctgcaaggc ctctggaggc agcttcagca cctatatttt cacctgggtg120 cgccaggccc ctggacaggg gcttgagtgg atgggaggga tcaatcctat ctttgctaca180 agagactacc caaagaagtt ccagggcaga gtcacgatca ccgcggacga atccacgagg240 actgtctata tggagttgag cagcctcaca tctgaggaca cggccgtcta ttactgtgca300 agagtgttgg gaggtacaag gctctactac gctctgaacg tctggggcca agggaccacg 360 gtcaccgtct cg372 &lt;210* 174 &lt;211*372 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 174 gggcgcgccg aagtgcagct ggtgcagtct gggggaggtg tggtgcggcc tggggggtcc 60 ctgagactct cgtgtgcagg ctctggattc acctttgatg aatacgccat gagctgggtc 120 cgccaagctc cagggaaggg gctgaagtgg gtcgctttta ttaattggaa tggtgatagc180 acatattatg cagactctgt gaagggccga ttcaccgtct ccagatccaa cgccaagaac240 tccctgtatc tgcaaatgaa cagtctgaga gccgaggaca cggccttcta ttgctgtgcg300 agagaccccc gcactaaact ggggatgtcc tattttgact attggggcca gggcaccctg360 gtcaccgtct cg372 &lt;210&gt; 175 &lt;211 &gt;372 &lt;212&gt;DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 175 gggcgcgccg aggtgcagct ggtgcagtct ggggctgagg tgaagaagcc tgggtcctcg60 gtgaaggtct cctgcaaggc ctctggaggc agcttcagca cctatgctat cacctgggtg120 cgccaggccc ctggacaggg gcttgaatgg atgggaggga tcatccctat ctttgcttca180 agagactacg cacagaagtt tcagggcaga gtcacaatca ccgcggacga atccacgagg240 acagtgtaca tggagccgag gagcctgaga tctgaagaca cggccgtgta ttactgtgca300 agagtgctgg gaggtacaag gctctactac gctctgaacg tctggggcca aggcaccctg 360 gtcaccgtct cg372 &lt;210&gt; 176 &lt;211&gt; 378 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 176 gggcgcgccg aggtgcagct ggtgcagtcg ggcccaggac tggtgaagcc ttcggagacc60 ctgtccctca catgcgctgt ctctggtgcc tccgtcagcg gtggtgatta ctactggagc120 tggatccggc agcccccagg gaaggcactg gagtggattg ggtatatcta ttacataggg180 agcaccaact acaatccctc tctcaagagt cgactctccc tatcagtaga cacggccaag240 agccagttct ccctgaagtt gagctctgtg accgctgcgg acacggccac ttatttctgt300 gcgagagcac gtcggacgta tagtggctac gactccgcct ttgactactg gggccaggga 360 accctggtca ccgtctcg378 &lt;210&gt;177 &lt;211 &gt;372 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 177 gggcgcgccg aggtgcagct ggtggagtct ggggctgagg tgaagaagcc tgggtcctcg 60 gtgaaggtct cctgcaaggc ctctggaggc agcttcagca cctatgctat cacctgggtg120 cgccaggccc ctggacaggg gcttgaatgg atgggaggga tcatccctat ctttgcttca180 agagactacg cacagaagtt tcagggcaga gtcacaatca ccgcggacga atccacgagg240 acagtgtaca tggagctgag cagcctgaga tctgacgaca cggccgtgta ttactgtgca300 agagtgctgg gaggtacaag gctctactac gctctgaacg tctggggcca agggaccacg 360 gtcaccgtct cg372 &lt;210&gt; 178 &lt;211 &gt;369 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 178 gggcgcgccc aggtcacctt gaaggagtct ggtcctacag tggtgaaacc cacacagacc60 ctcacgctga cctgtagcct ctctgggttc gcactcggca ctaccggagt ggctgtgggc120 tggatccgtc agcccccagg aaaggccctg gaatggcttg gactcatcga ttggaatgat180 gataggcgct acagaccctc tctgaagacc agactcacca tcacccagga catgtccagg240 aaccaggtgg tccttagact gaccaacttg gacccactgg acacaggcac atatttttgt300 gcacgttcag tagtgccggc gactagggcc tttgacttct ggggccaggg caccctggtc360 accgtctcg369 &lt;210&gt; 179 &lt;211&gt; 366 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 179 gggcgcgccc aggtcacctt gaaggagtct ggtcctacgc tggtgaaacc cacacagacc60 ctcacgctga cctgcacctt gtctgggttc tcactctaca ctactggagt gggtgtgggc120 tggatccgtc agcccccagg aaaggccctg gagtgactgg cacgcattta ttgggatgat100 gatgagcgct acaacccgtc tctgaagagc aggctcacca tcaccaagga cgcctccaaa240 aaccaggtgg tccttaaaat gaccaacatg gaccctgtgg acacagccac atattactgt300 gcccggacca tgggcgtcgt tcttccattt gactactggg gccagggaac cctggtcacc360 gtctcg366 &lt;210&gt; 180 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 180 ctagccgaaa ttgtgctgac tcagtctcca tcctccctgt ctgcatctct aggagacaga60 gtcaccatca cttgccgggc aagtcagcac attagcaatt atttaaattg gtatcagcag120 aaacctggga aagcccctaa actcctgatc tgtgctgcat ccagtttgca aagtggggtc180 ccatcaaggt tcactggcag tggatctggg gcagattaca ccctcaccat cagcagtctg240 caacctgaag attttgcaac ttactactgt caacagagtt acagtacctc gtggacgttc 300 ggccaaggga ccacggtgga aatcaaa327 &lt;210* 181 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 181 ctagccgaaa ttgtgttgac acagtctcca tcctccctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc gagtcagggc attagcaatt atttagcctg gtatcagcag120 aaaccaggga aagttcctaa gctcctgatc tatgctgcat ccactttgca atcaggggtc180 ccatctcggt tcagtggcag tggatctggg acagatttca ctctcaccat cagcagcctg240 cagcctgaag atgttgcaac ttattactgt caaaagtata acagtgcccc gtacactttt 300 ggccagggga ccaagctgga gatcaaa327 &lt;210* 182 &lt;211*327 &lt;212* DNA &lt;213&gt; Homo Sapiens &lt;400 182 ctagccgatg ttgtgatgac tcagtctcca tcctccctgt ctgcatctct aggagacaga60 gtcagcatca cttgccgggc aagtcaacat attagcaatt atataaattg gtatcagcag120 aaacctggga aagcccctaa actcctgatc tatgctgctt ccactttgca aagtggggtc130 ccatcaaggt tcactggcag tggatctggg gcagattaca ctctcaccat caccagtctg240 caacctgaag attttgcaac ttactactgt caacagagtt acggtacctc gtggacgttc300 ggccaaggga ccacggtgga aatcaaa327 &lt;210&gt; 183 &lt;211&gt; 327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 183 ctagccgatg ttgtgatgac tcagtctcca tcctccctgt ctgcatctgt gggagacaga60 gtcaccatca cttgccaggc gagtcaagac attaccaact atttaaattg gtatcagcag120 aaaccaggga aagcccctaa gctcctgatc tacgatgcat ccaatttgca accaggggtc180 ccatcaaggt tcagtggaag tggatctgtg acagatttta ctttcaccat cagcagcctg240 cggcctgaag atattgcaac atattactgt caacagtatg atggtccagt gcttactttc 300 ggcggaggga ccaaggtaga gatcaaa327 &lt;210=» 184 &lt;211&gt; 327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 184 ctagccgatg ttgtgatgac tcagtctcca tcctccctgt ctgcatctgt aggagacaga60 gtcaccatct cttgccgggc aagtcagccc attagcacct atttaaattg gtatcagcag120 aaaccaggga aagcccctaa gatcctgatc tttggtgcat ctcgtttgca aagtggtgtc180 ccatcaaggt tcagcggcag tggatctggg acagatttca gtctcaccat caccagtctc240 caacctgaag attttgcaac ttacatctgt caacaaagca agagtccccc gtacaatttt 300 ggccggggga ccaagctgga gatcaaa327 &lt;210&gt;185 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400 185 ctagccgaaa ttgtgttgac acagtctcct tccaccctgt ctgcatctgt aggcgacaga60 gtcaccatca cttgccgggc cagtcagagt attggtagct ggttggcctg gtatcaacag120 aaaccaggga aagcccctaa actcctgatc tataaggcgt ctactttaca aagtgagacc180 ccttcaaggt tccgcggcag tggatctggg accgaattca ctctcaccat cagcagcctg240 cagcctgatg attttgcaac ttactactgc caacagttta atagtttttc tccgtggacg 300 ttcggccaag ggaccaaggt ggaattcaaa330 &lt;210186 &lt;211 &gt;327 &lt;212&gt; DNA &lt;213&gt; Homo Saplens &lt;400&gt; 186 ctagccgatg ttgtgatgac tcagtctcca tcgtccctgt ctgcatctgt tggtgacaga 60 gtcaccatca cttgccgggc aagtcagagc attaacatta atttaaattg gtttcagcag120 aaacccggga aagcccctaa cctactgatc tattctgcat ccactttgca aactggggtc180 ccctcaaggt tcagtggaag tggatctggg acagagttca ctctcaccat cagcagtcta240 caacctgaag attttgcaac ttactactgt caacagattt acagtcatgt taggacgttc300 • ggccaaggga ccaaggtgga gatcaaa 327 &lt;210&gt; 187 &lt;211 &gt;345 &lt;212&gt;DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 187 ctagccgatg ttgtgatgac tcagtctcca gactccctgg ctgtgtctct gggcgagagg60 gccaccatca actgcaagtc cagccagagt cttttgtaca gctccaacaa taagaattac120 ttagcttggt accagcagaa accaggacag cctcctaagt tgctcattta ctgggcatct180 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcact240 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat300 agtactcctc cgatgttcgg ccaagggacc aaggtggaaa tcaaa345 &lt;210&gt; 188 &lt;211* 327 &lt;212* DNA &lt;213&gt; Homo Sapiens &lt;400*188 ctagccgaaa ttgtgttgac acagtctcca tcctccctgt ctgcatctgt gggagacaga60 atcaccatca cttgccaggc gagtcaagac attaccaact atttaaattg gtatcagcag120 aaaccaggga aagcccctaa gctcctgatc tacgatgcat ccaatttgca accaggggtc180 ccatcaaggt tcagtggaag tagatctggg acagatttta ctttcaccat cagcagcctg240 cggcctgaag atattgcaac atattactgt caacagtatg atggtccagt gcttactttc 300 ggcggaggga ccaaggtaga gatcaaa327 &lt;210*189 &lt;211 &gt; 345 &lt;212* DNA &lt;213&gt; Homo Sapiens &lt;400* 189 ctagccgaaa ttgtgttgac acagtctcca gactccctgg ctgtgtctct gggcgagagg60 gccaccatca actgcaagtc cagccagagt cttttataca gctccaacaa taagaactac120 ttagcttggt accagcagaa accaggacag cctcctaagt tgctcattta ctgggcatct180 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcacc240 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat300 agtactcctc cgatgttcgg ccaagggacc aaggtggaaa tcaaa345 &lt;210&gt;190 &lt;211*330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 190 ctagccgaaa ttgtgttgac acagtctcca tccttcctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc cagtcagggc attgggaatt ttttagcctg gtatcagcaa120 aaaccaggga aagcccctaa gctcctaatc tctggtgcat ccactttgca aagttgggtc180 qcatcaaggt tcagcggccg tggatctggg accgaattca ccctcacaat cagcagcctg240 cagcctgaag attttgcaac ttattactgt caacagctta atcgttaccc tccatacact300 tttggccagg ggaccaagct ggagatcaaa330 &lt;210&gt; 191 &lt;211 &gt;327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 191 ctagccgaaa ttgtgatgac gcagtctcca tcctccctgt ctgcatctgt gggagacaga60 gtcaccatca cttgccaggc gagtcaggac attagcaaat atttaaattg gtatcagcag120 aaaccaggga gagcccctaa actcctgatc tacgaagcat ccaatttgga gacaggggtc180 ccaccaaggt tcagtggaag tggatctggg acacatttta ctttcaccat caccggcctg240 cagcctgaag atattgcaac atattactgt caacagtgtg atagtctgcc tccggtcttt 300 ggccagggga ccaagctgga agtcaaa327 &lt;210&gt; 192 &lt;211&gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 192 ctagccgaaa ttgtgctgac tcagtctcca ggcaccctgg ctttgtctcc aggtgataga60 gccaccctct cctgcggggc cagtcagagc gtgttcggcg acttcttagc ctggtaccaa120 cacaagcctg gccaggctcc caggctcctc atctatggtg cttccaccag ggccactggc180 atcccagaca ggttcagtgg cagtggagct gggacagact tcactctcac catcagcaga240 ctggagcctg aggattttgc agtttatttc tgtcagtagt atggtgactc agtgttcacg 300 ttcggccaag ggaccaagtt gggaatcaaa 330 &lt;210&gt; 193 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 193 ctagccgaaa ttgtgatgac acagtctcca ggcaccctgg ctttgtctcc aggtgataga60 gccaccctct cctgcggggc cagtcagagc gtgttcggcg acttcttagc ctggtaccaa120 cacaagcctg gccaggctcc caggctcctc atctatggtg cttccaccag ggccactggc180 atcccagaca ggttcagtgg cagtggagct gggacagact tcactctcac catcagcaga240 ctggagcctg aggattttgc agtttatttc tgtcagcagt atggtgactc agtgttcacg300 ttcggccaag ggaccaagtt ggaaatcaaa330 &lt;210&gt; 194 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 194 ctagccgaaa ttgtgttgac acagtctcca ggcaccctgt ctttgtctcc agggcaaaga60 gccaccctct cctgcagggc cagtcagagt gttaacagag actacctagc ctggtaccag120 cagaaacctg gctaggctcc caggctcctc atctatggtg catccagcag ggccactggc180 atcccagaca ggttcagtgg cagtgggtct ggaacagact tcactctcac catcagcaga240 ctggagcgag acgattttgc agtgtatttc tgtcaccagt atggtagctc acctaacact 300 tttggccagg ggaccaagct ggagatcaaa330 &lt;210&gt;195 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt;195 ctagccgaaa cgacactcac gcagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgcagggc cagtcagagc gttagcacca actacttagc ctggtaccga120 cagaaacctg gccaggctcc caggctcctc atccatggtg catccagccg ggccactggc180 atcccagaca ggttcagtgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtatttc tgtcagcagt atggtagctc acctcagacg 300 ttcggccaag ggaccaggtt ggaaatcaaa330 &lt;210&gt; 196 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 196 ctagccgaaa ttgtgctgac tcagtctcca tcctccctgt ctgcatctgt tggtgacaga60 gtcaccacca cttgccggac aagtcagagc attttcatta atttaaattg gtttcagcag120 aaacccggga aagcccctaa actcctgatc tattctgcat ccactttgca aactggggtc180 ccctcaaggt tcagtggcag tggatctggg acagagttca ctctcaccat cagcagtcta240 caacctgaag attttgcaac ttactactgt caacagattt acagtcaggt taggacgttc 300 ggccaaggga ccaaggtgga gatcaaa327 &lt;210* 197 &lt;211*330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 197 ctagccgaca tccagatgac ccagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgcagggc cagtcagagt gttaacagcg acaacttagc ctggtaccag120 cagaaacctg gccaggctcc caggctcctc atgtctggtg caaccagtag ggccactgac180 gtcccagaca ggttcagtgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtattac tgtcaccagt atggtagctc agataacact 300 tttggccagg ggaccaagct ggagatcaaa330 &lt;210* 198 &lt;211*330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400&gt; 198 ctagccgatg ttgtgatgac tcagtttcct tcctctctgt ctgcatctgt gggagacaga60 gtcaccatca cttgccgggc gagtcagggc attagcaatt ttttagcctg gtatcagcag120 aaaccaggga aagttcctga gctccttatc tatggtgcat ccactttgca atcaggggtc180 ccatctcggt tcagtggcag tggatctggg gcagagttca cactcaccat caacagcctg240 cagcctgaag atgttgcgac ttattactgt caaaagtatg acagtggcct gagattcact 300 ttcggccctg ggaccaaagt ggatatcaaa330 &lt;210&gt; 199 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 199 ctagccgatg ttgtgatgac tcagtctcct tcctctctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc gagtcagggc attagcaatt ttttagcctg gcatcagcag120 aaaccagggc aagttcctaa actcctgatc tatggtgcat ccactttgca atcaggggtc180 ccatctcgct tcagtggcag tggatctggc acagatttca ctctcaccat caacggcctg240 cagcctgaag atgttgcaac ttattactgt caaaagtatg acagtggcct gatattcact 300 ttcggccctg ggaccagagt ggagatcaaa330 &lt;210&gt; 200 &lt;211&gt; 345 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 200 ctagccgatg ttgtgatgac tcagtctcca gactccctgg ctgtgtctct gggcgagagg60 gccaccatca actgcaagtc cagccagagt cttttataca gctccaacaa taagaactac120 ttagcttggt accagcagaa accaggacag cctcctaagt tgctcattta ctgggcatct180 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcact240 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat300 agtactcctc cgatgctcgg ccaagggacc aaggtggaaa tcaaa345 &lt;210&gt; 201 &lt;211&gt; 330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 201 ctagccgatg ttgtgatgac ttagtctcca ggcaccctgg ctttgtctcc aggtgataga60 gccaccctct cctgcggggc cagtcagagc gtgttcggcg acttcttagc ctggtaccaa120 cacaagcctg gccaggctcc caggctcctc atctatgttg cttccaccag ggccactggc180 atcccagaca ggttcagtgg cagtggagct gggacagact tcactctcac catcagcaga240 ctggagcctg aggattttgc agtttatttc tgtcagcagt atggtgactc agtgttcacg 300 ttcggccaag ggaccaagtt ggaaatcaga330 &lt;210» 202 &lt;211 &gt;330 &lt;212&gt;DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 202 ctagccgaaa cgacactcac gcagtctcca ggcaccctgt ctttgtctcc aggggaaaga 60 gccaccctct cctgcagggc cagtcagagc gttagcacca actacttagc ctggtaccga120 cagaaacctg gccaggctcc caggctcctc atccatggtg catccagccg ggccactggc1ΘΌatcccagaca ggttcagtgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtatttc tgtcagcagt atggtagctc acctcagacg300 ttcggccaag ggaccaggtt ggaaatcaaa330 &lt;210&gt; 203 &lt;211&gt; 330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 203 ctagccgaaa ttgtgctgac tcagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgcagggc cagtcggagt gtaaacagca acaacttagc ctggtatcag120 cagaaacctg accaggctcc caggctcctc atgtatggtg catccagtag ggccactggc180 atcccagaca ggttcactgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtattac tgtcatcagt atggtgcctc agataacact 300 tttggccagg ggaccaagct ggagatcaag330 &lt;210* 204 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 204 ctagccgaaa ttgtgatgac acagtctcca tccttcctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc cagtcaggac attatcactt atttagcctg gtatcaacaa120 aaaccaggga aagcccctga ggtcctgatc tttggtgcgt ccactttgca aagtggggtc180 ccatcaagat tcagcggcag tggatctggg accgaattca ctctcactat ctccagcctg240 cagcctgaag attttgcaac ttattactgt caacagatta ttcgttaccc tcgcactttc 300 ggccaaggga ccagggtgga aatcaaa327 &lt;210*205 &lt;211*330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 205 ctagccgatg ttgtgatgac tcagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgccgggc cagtcagagt gttaacagca acaacttagc ctggtaccag120 cagaaacctg gccaggctcc caggctcctc gtctctggtg caaccaatag ggccactgac180 atcccagaca ggttcagtgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtattac tgtcaccagt atggtagctc agagaacact 300 tttggccagg ggaccaagct ggagatcaga330 &lt;210* 206 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 206 ctagccgaaa ttgtgatgac gcagtctcca cccttcctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc cagtcagggc ttaagcactt atttagcctg gtatcaggta120 aaaccaggga aagcccctaa gctcctgatc tatgctgcat ccactttgca aagtggggtc180 ccatcaaggt tcagcggcag tggatctggg acagaattca ctctcacaat caacagcctg240 cagcctgaag attttgcaac ttattactgt caacaacttg atacttaccc tctcactctc 300 ggcggaggga ccaaggtgga gatcaaa327 &lt;210&gt; 207 &lt;211 &gt;345 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 207 ctagccgaaa ttgtgttgac acagtctcca gactccctgg ctgtgtctct gggcgagagg60 gccaccatca actgcaagtc cagccagagt cttttataca gctccaacaa taagaactac120 ttagcttggt accagcagaa accaggacag cctcctaagt tgctcattta ctgggcatct180 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcact240 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat300 agtactcctc cgatgttcgg ccaagggacc aaggtggaaa tcaaa345 &lt;210&gt; 208 &lt;211 &gt;345 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 208 ctagccgaca tccagatgac ccagtctcca gactccctgg ctgtgtctct gggcgagagg 60 gccaccatca actgcaagtc cagccagagt cttttataca gctccaacaa taagaactac120 ttagcttggt accagcagaa accaggacag cctcctaagt tgctcattta ctgggcatct180 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcact240 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat300 agtactcctc cgatgttcgg ccaagggacc agggtggaaa tcaaa345 &lt;210&gt; 209 &lt;211 &gt;330 &lt;212&gt;DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 209 ctagccgaaa ttgtgatgac acagtctcca ggcaccctgg ctttgtctcc aggtgataga60 gccaccctct cctgcggggc cagtcagagc gtgttcggcg acttcttagc ctggtaccaa120 cacaagcctg gccaggctcc caggcccctc atctatggtg cttccaccag ggccactggc180 atcccagaca ggttcagtgg cagtggagct gggacagact tcactctcac catcagcaga240 ctggagcctg aggattttgc agtttatttc tgtcagcagt atggtgactc agtgttcacg 300 ttcggccaag ggaccaagtt ggaaatcaaa330 &lt;210&gt; 210 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 210 ctagccgatg ttgtgatgac tcagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgcagggc cagtcagagt gttaacagcg acaacttagc ctggtaccag120 cagaaacctg gccaggctcc caggctcctc atgtctggtg caaccagtag ggccactgac180 atcccagaca ggttcagtgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtattac tgtcaccagt atggtagctc agataacact300 tttggccagg ggaccaagct ggagatcaaa330 &lt;210&gt; 211 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 211 ctagccgaca tccagttgac ccagtctcca tcctccctgt ctgcatctgt tggagacagc60 gtcaccatca cttgccgggc gagtcagggc attagcaatt ttttagcctg gtatcagaag120 aaaccgggaa aagttcctag gctcctgatc tatggtgcat ccactttgca atcaggggtc180 ccatctcggt tcagtggcag tggatctggg accgatttca ctctcaccat cagcagcctg 240 cagcctgaag atgttgcgac ttattactgt caggagtata gcaatgccct gatattcact 300 ttcggccctg ggaccaaagt tcatatcaaa 330 &lt;210*212 &lt;211*330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400*212 ctagccgaaa ttgtgatgac acagtctcca tccttcctgt ctgcgtctgt aggagacaga60 gtcaccatca cttgccgggc cagtcagggc attgggaatt ttttagcctg gtatcagcaa120 aaaccaggga aagcccctaa gctcctgatc tctggtgcat ccactttgca aagttgggtc180 ccatcaaggt tcagcggccg tggatctggg accgaattca ctctcacaat cagcagcctg240 cagcctgaag attttgcaac ttattactgt caacagctta atcgttaccc tccatacact 300 tttggccagg ggaccaagct ggagatcaaa330 &lt;210*213 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400*213 ctagccgaaa ttgtgatgac acagtctcca tcctccctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc aagtcagacc attagcaacc atttaaattg gtatcagcag120 aaaccaggga gagcccctaa gctcctgatc tatgttgggt ccagtctgca aagtggggtc180 ccatcaaggt tcagtggcag tggatctggg acagatttca ctctcaccat cagtggtctg240 caacctgaag attttgcaac ttactactgt caacagagtt acagtccctc gtacactttt300 ggccagggga ccaaggtgga gatcaaa327 &lt;210*214 &lt;211*330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400*214 ctagccgaca tccagttgac ccagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgcagggc cagtcagagc gttagcacca actacttagc ctggtaccga120 cagaaacctg gccaggctcc caggctcctc atccatggtg catccagccg ggccactggc180 atcccagaca ggttcagtgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtatttc tgtcagcagt atggtagctc acctcagacg300 ttcggccaag ggaccaggtt ggaaatcaaa330 &lt;210&gt; 215 &lt;211&gt; 327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 215 ctagccgatg ttgtgatgac tcagtctcca tcctccctgt ctgcatctct aggagacaga60 gtcaccatca cttgccgggc aagtcagcat attagcaatt atttaaattg gtatcagcag120 aaacctggga aagcccctaa actcctgatc tatgctgcat ccagtttgca aagtggggtc180 ccatcaaggt tcactggcag tggatctggg gcagattaca ctctcaccat cagcagtctg240 caacctgaag attttgcaac ttactactgt caacagagtt acagcacctc gtggacgttc 300 ggccaaggga ccacggtggg aatcaaa327 &lt;210&gt; 216 &lt;211 &gt;327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 216 ctagccgatg ttgtgatgac tcagtctcca tcctccctgt ctgcatctgt aggagacaga60 gtcagcatca cttgccgggc aagtcggagc gttaagacct atttaaattg gtatcagcag120 aaaccaggga aagcccctaa gctcctggtc tatggttcgt ccagtttgga aagtggggtc180 ccatcaagat tcagtggcag tggatctggg acagatttca ctctcaccat cagcagtctg240 caacctgagg attttgcaac ttactactgt caacagagtt tcggtacccc ctacactttt 300 ggccagggga ccaagctgga caccaaa327 &lt;210&gt; 217 &lt;211*327 &lt;212* DNA &lt;213* Homo Sapiens &lt;400*217 ctagccgaca tccagatgac ccagtctcca tcctccctgt ctgcatctgt aagtgacaga60 gtcaccatta cttgccgggc aagtcagagc attaacaagt tcttaaactg gtatcagcag120 aaaccaggga aagcccctca gctcctcatc tatgctgcaa ccaatttgca gagtggggtc180 ccatcaaggt tcagtggcag tggatctggg acagacttca ctctcaccat cagcagtctg240 caaactgaag attttgccac ttactactgt caacagagtt acgatatgcc tcggacgttc 300 ggccaaggga ccaaggtgga gatcaaa327 &lt;210*218 &lt;211*330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400*218 ctagccgaaa ttgtgctgac tcagtctcca ggcaccctgt ctttgtctcc aggggaaaga60 gccaccctct cctgcagggc cagtcggagt gtatacagca acaacttagc ctggtatcag120 cagaaacctg accaggctcc caggctcctc atgtatggtg catccagtag ggccactggc180 atcccagaca ggttcactgg cagtgggtct gggacagact tcactctcac catcagcaga240 ctggagcctg aagattttgc agtgtattac tgtcatcagt atggtgcctc agataacact 300 tttggccagg ggaccaagct ggagatcaag330 &lt;210*219 &lt;211*345 &lt;212* DNA &lt;213* Homo Sapiens &lt;400*219 ctagccgaca tccagatgac ccagtctcca gactccctgg ctgtgtctct gggcgagaag60 gccaccatca actgcaagtc cagccagagt cttttataca gctccaacaa taagaactac120 ttagcttggt accagcagaa accaggacag cctcctaagt tgctcattta ctgggcatct180 acccgggaat ccggggtccc tgaccgattc agtggcagcg ggtctgggac agatttcact240 ctcaccatca gcagcctgca ggctgaagat gtggcagttt attactgtca gcaatattat300 agtactcctc cgatgttcgg ccaagggacc aaggtggaaa tcaaa345 &lt;210&gt; 220 &lt;211» 330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 220 ctagccgaaa ttgtgatgac gcagtctcct tcctctctgt ctgcatctgt aggagacaga60 gtcaccatct cttgccgggc gagtcagggc attagcaatt ttttagcctg gtttcagcag120 aaaccaggtc aagttcctaa gctcctgatc tatgttgcat ccactttgca atcaggggtc180 ccatctcggt tcagtggcag tggatctggg acagatttca gtctcaccat caacggcctg240 cagcctgagg atgttgcaac ttattactgt caaaggtatg acagtggcct gatattcact 300 ttcggccctg ggaccaaagt ggagatcaaa330 &lt;210&gt; 221 &lt;211 &gt;327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 221 ctagccgaca tccagatgac ccagtctcca tcctccctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc aagtcagacc attagcaacc atttaaattg gtatcagcag.120 aaaccaggga gagcccctaa gctcctgatc tatgttgggt ccagtctgcg aagtggggtc180 ccatcaaggt tcagtggcag tggatctggg acagatttca ctctcaccat cagtggtctg240 caacctgaag attttgcaac ttactactgt caacagagtt acagtccctc gtacactttt 300 ggccagggga ccaaggtgga gatcaaa327 &lt;210&gt; 222 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 222 ctagccgaaa ttgtgttgac acagtctcct tcctctctgt ctgcatctgt gggagacaga60 gtcaccatca cttgccgggc gagtcagggc attagcaatt ttttagcctg gtatcagcag120 aaaccaggga aagttcctga gctccttatc tatggcgcat ccactttgca atcgggggtc180 ccatctcggt tcagtggcag tggatctggg acagatttca ctctcaccat caacagcctg240 cagcctgaag atgttgcaac ttattactgt caaaagtatg acagtggcct gagattcact 300 ttcggccctg gggccaaagt ggatatcaaa330 &lt;210&gt; 223 &lt;211 &gt;327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 223 ctagccgatg ttgtgatgac tcagtctcca tcctccctgt ctgcatctgt aggagacaga60 gtcagcatca cttgccgggc aagtcggagc gttaagacct atttaaattg gtatcagcag120 aaaccaggga aagcocctaa gctcctggtc tatggttcgt ccagtttgga aagtggggtc180 ccatcaagat tcagtggcag tggatctggg acagatttca ctctcaccat cagcagtctg240 caacctgagg attttgcaac ttactgctgt caacagagtt tcggtacccc ctacactttt 300 ggccagggga ccaagctgga catcaaa327 &lt;210&gt; 224 &lt;211 &gt;330 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400&gt; 224 ctagccgaca tccagttgac ccagtctcct tcctctctgt ctgcatctgt gggagacaga60 gtcaccatca cttgccgggc gagtcagggc attagcaatt ttttagcctg gtatcagcag120 aaaccaggga aagttcctga gctccttatc tatggtgcat ccaccttgca atcaggggtc180 ccatctcggt tcagtggcag tggatctggg acagagttca ctctcaccat caacagcctg240 cagcctgaag atgttgcgac ttattactgt caaaagtatg atagtggcct gagattcact300 ttcggccctg ggaccaaagt ggatatcaaa330 &lt;210&gt; 225 &lt;211&gt; 327 &lt;212&gt; DNA &lt;213&gt; Homo Sapiens &lt;400* 225 ctagccgaca tccagatgac ccagtcttct tccaccctgt ctgcatctgt aggagacaga60 gtcaccatca cttgccgggc cagtcagaat attaatatct ggttggcctg gtatcagcag120 aaagcaggga aagcccccaa actcctgatc tataaggcgt ctactttaga aaggggggtc180 ccctcaaggt tcagcggcag tggatctggg acagagttca ctctcaccat caccggcctg240 cgccctgacg atttcggaag ttattattgc caacactatg atggtaattc actaacgttc 300 ggccaaggga ccagggtgga tatccaa327 &lt;210&gt; 226 &lt;211&gt;330 &lt;212* DNA &lt;213* Homo Sapiens &lt;400* 226 ctagccgaca tccagttgac ccagtctcct tccaccctgt ctgcatctgt aggcgacaga60 gtcaccatca cttgccgggc cagtcagagt attggtagct ggttggcctg gtatcaacag120 aaaccaggga aagcccctaa actcctgatc tataaggcgt ctactttaca aagtgagacc180 ccttcaaggt tccgcggcag tggatctggg accgaattca ctctcaccat cagcagcctg240 cagcctgatg attttgcaac ttactactgc caacagttta atagtttttc tccgtggacg 300 ttcggccaag ggaccaaggc ggaattcaaa330 &lt;210*227 &lt;211* 123 &lt;212* PRT &lt;213* homo sapiens &lt;400* 227

Gly Arg Ala Gln Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys 15 1015

Pro Gly Ala Ser Val Arg Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe 20 2530

Lys Asn Tyr Gly Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Trp Ile Ser Ala Asp Asn Gly Asp Thr Thr Thr Ala 50 5560

Leu Asn Leu Arg Gly Arg Val Ser Met Thr Thr Asp Thr Ser ThrAsn

70 7580

Thr Val Tyr Met Glu Val Lys Ser Leu Arg Ser Asp Asp Thr AlaIle

9095

Tyr Phe Cys Ala Arg Asp Phe Tyr Ser Gly Ser Tyr Arg Ser Phe Asp 100 105110

Cys Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 228 &lt;211&gt; 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 228

Gly Arg Ala Gln Val Gln Leu Gln Gln Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 ' 2530

Ser Ser Tyr Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Tyr Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala LysAsn

70 7580

Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Arg Pro Gly Trp Ala Ala Thr Axg Ala Ala Gly 100 105110

Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser

115 120125 &lt;210&gt;229 &lt;211&gt; 119 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 229

Gly Arg Ala Gln Val Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 15 1015

Pro Gly Ala Ser Val Arg Ile Ser Cys Lys Ala Ser Glu Lys Cys Asp 20 2530

Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly 35 4045

Trp Ile Ser Ala Asp Asp Gly Gly Thr Thr Thr Ala Leu Asn Leu Arg 50 5560

Gly Arg Val Ser Met Thr Thr Asp Arg Ala Thr Asn Thr Val TyrMet

70 7580

Glu Leu Lys Ser Leu Arg Ser Asp Asp Thr Ala Ile Tyr Phe CysAla

9095

Axg Asp Phe Tyr Ser Gly Thr Tyr Arg Ser Phe Asp Tyr Trp Gly Gln 100 105110

Gly Thr Leu Val Thr Val Ser

115 &lt;210&gt; 230 &lt;211* 132 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 230

Gly Arg Ala Lys Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln 15 10 15

Pro Gly Thr Ser Leu Arg Leu Ser Cys Val Val Ser Gly Phe Thr Phe 20 2530

Arg Thr Tyr Gly Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Glu Trp Leu Ala Phe Leu Ser Ser Asp Gly Ser Asp Glu Phe Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser LysSex

70 7580

Thr Leu Phe Leu Lys Met Asn Ser Leu Arg Pro Asp Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Asp Arg Gly Ala Gln Ile Thr Leu Phe Gly Ala 100 105110

Pro Leu Ile Arg Pro Ser Ser Phe Asp Ser Trp Gly Gln Gly Thr Leu 115 120125

Val Thr Val Ser

130 &lt;210&gt; 231 &lt;211&gt; 121 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 231

Gly Arg Ala Gln Val Gln Leu Gln Glu Ser Gly Pro Glu Val Lys Lys 15 1015

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe

2530

Asn Ser Tyr Gly Ile Ala Trp Val Arg Gln Val Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Trp Ile Ser Pro Tyr Ser Gly His Thr Asn Tyr Ala 50 5560

Glu Lys Val Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ala ThrSer

70 7580

Thr Ala Cys Met Glu Leu Thr Ser Leu Arg Ser Asp Asp Thr AlaVal

9095

Tyr Phe Cys Ala Arg Asp Tyr Ser Ser Pro Tyr His Phe Asp TyxTrp

100 105110

Gly Gln Gly Thr Trp Ser Pro Ser Arg

115120 &lt;210&gt; 232 &lt;211&gt; 122 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 232

Gly Arg Ala Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys 15 1015

Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Leu Ser Gly Phe Ser Leu 20 2530

Tyr Thr Thr Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 4045

Ala Leu Glu Trp Leu Ala Arg Ile Tyx Trp Asp Asp Asp GLu Arg Tyr 50 5560

Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile Thr Lys Asp Ala SerLys

70 7580

Asn Gln Val Val Leu Lys Met Thr Asn Met Asp Pro Val Asp ThrAla

9095

Thr Tyr Tyr Cys Ala Arg Thr Met Gly Val Val Leu Pro Phe Asp Tyr 100 105110

Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 233 &lt;211&gt;117 &lt;212* PRT &lt;213* homosapiens &lt;400* 233

Gly Arg Ala Lys Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Val Val Ser Gly Phe Pro Leu 20 2530

Asn Arg Tyr Thr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Glu Trp Leu Ser Ser Ile Ser Ser Thr Ser Ser Tyr Ile Tyr Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala LysAsn

70 7580

Ser Leu Phe Leu Gln Met Asn Ser Leu Arg Ala Asp Asp Thr AlaLeu

9095

Tyr Phe Cys Ala Ser Gly Asn Thr His Asp Tyr Trp Gly Gln Gly Thr 100 105110

Leu Val Thr Val Ser

115 &lt;210&gt; 234 &lt;211&gt; 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400* 234

Gly Arg Ala Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Leu Gly Thr Ser Val Arg Val Ser Cys Lys Thr Pro Gly Gly Tyr Val

2530

Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro Glu Trp Met Gly 35 40 45'

Gly Ile Ile Thr Asn Phe Gly Thr Thr Asn Tyx Ala Arg Lys Phe Gln 50 5560

Gly Arg Ile Thr Val Thr Ala Asp Lys Ser Thr Asn Thr Val Tyr Met 65 70 7580

Asp Leu Ser Asn Leu Ala Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala

9095

Arg Ala Pro Arg Gly Thr Ser Thr Ile 'Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser 115 120125 &lt;210&gt; 235 &lt;211* 132 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 235

Gly Arg Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln 15 1015

Pro Gly Thr Ser Leu Arg Leu Ser Cys Val Val Ser Gly Phe Thr Phe 20 2530

Arg Thr Tyr Gly Met Asn Trp Val Arg Gln Ala Pro Gly Lys Val Leu 35 4045

Glu Trp Leu Ala Phe Val Ser Ser Asp Gly Ser Asp Glu Phe Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser LysSer

70 7580

Thr Leu Phe Leu Lys Met Asn Ser Leu Arg Ala Asp Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Asp Arg Gly Ala Gln Ile Thr Leu Phe Gly Ala 100 105110

Pro Leu Ile Arg Pro Ser Ser Phe Asp Ser Trp Gly Gln Gly Thr Leu 115 120125

Val Thr Val Ser

130 &lt;210&gt; 236 &lt;211* 126 &lt;212* PRT &lt;213* homo sapiens &lt;400* 236

Gly Arg Ala Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Thr Ser Val Arg Val Ser Cys Lys Thr Ser Gly Gly Tyr Val 20 2530

Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro Glu Trp Met Gly 35 4045

Gly Ile Ile Thr Ser Phe Gly Thr Thr Ser Tyr Ala Gln Lys Phe Gln 50 5560

Gly Arg Val Thr Ile Thr Ala Asp Lys Ala Thr Asn Thr Val TyrMet

70 7580

Asp Leu Ser Asp Leu Thr Ser Glu Asp Thr Ala Ile Tyr Tyr CysAla

9095

Lys Ala Pro Arg Gly Thr Ser Thr Ile Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115 120125 &lt;210&gt; 237 &lt;211&gt; 122 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 237

Gly Arg Ala Gln Val Gln Leu Gln Glu Ser Gly Pro Thr Leu Val Lys 15 1015

Pro Thr Gln Thr Leu Thr Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu 20 2530

Gly Thr Thr Gly Val Asn Val Gly Trp Ile Axg Gln Pro Pro Gly Lys 35 4045

Ala Leu Glu Trp Leu Ala Leu Ile Ser Trp Asp Gly Gly Lys His Tyr 50 5560

Ser Pro Ser Leu Asn Ser Arg Ile Thr Leu Thr Lys Asp Ala Ser Arg 65 70 7580

Glu Gln Val Val Val Pro Thr Met Thr Asn Met Asp Pro Ala Asp Thr 85 9095

Gly Arg Tyr Tyr Cys Ala Arg Ile Val Gly Thr His Gly Phe Asp Tyr 100 105110

Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 238 &lt;211&gt; 131 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 238

Gly Arg Ala Lys Val Gln Leu Val Glu Sex Gly Ala Glu Val Lys Lys 15 1015

Pxo Gly Ala Thx Val Axg Val Sex Cys Lys Ala Ser Gly Tyx Axg Phe 20 2530

Asn Asp Tyx Cys Ile Ser Txp Val Axg Gln Ala Pxo Gly Gln Gly Leu 35 4045

Glu Txp Met Gly Txp Ile Asn Gly Aan Asn Ala Asp Thx Phe Tyx Ala 50 5560

Pxo Lys Leu Gln Gly Axg Val Thx Met Ser Thx Asp Thx Sex ThxSer

70 7580

Thr Ala Tyx Met Glu Leu Arg Asn Leu Axg Ser Asp Asp Thr AlaVal

9095

Tyr Phe Cya Ala Axg Asp Arg Gly Axg Ile Thr Leu Phe Gly Glu Val 100 105110

Ile Leu Arg Ala Gly Trp Phe Asp Sex Txp Gly Gln Gly Thx Leu Val 115 120125

Thr Val Ser

130 &lt;210&gt; 239 &lt;211&gt; 124 &lt;212* PRT &lt;213* homo sapiens &lt;400* 239

Gly Arg Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe 20 2530

Ser Asn Asn Asn Met Asn Trp Val Arg Gln Thr Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Ala Ser Ile Ser Phe Gly Ser His Tyr Ile Ser Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala ArgAsn

70 7580

Ala Val Tyr Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Thr Arg Cys Arg Gly Gly Thr Arg Thr Tyr Tyr Tyr Met 100 105110

Asp Val Trp Gly Lys Gly Thr Leu Val Thr Val Ser 115120 &lt;210&gt; 240 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 240

Gly Arg Ala Lys Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ser Phe 20 2530

Ser Asn Asn Asn Met Asn Trp Val Arg Gln Thr Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Ala Ser Ile Ser Phe Gly Ser His Tyx Ile Ser Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Arg Asn 65 70 7580

Ala Val Tyr Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr Ala Val 85 9095

Tyr Tyr Cys Thr Arg Cys Arg Gly Gly Thr Arg Thr Tyr Tyr Tyr Met 100 105110

Asp Val Trp Gly Lys Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 241 &lt;211&gt; 130 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 241

Gly Arg Ala Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Gln Ser Ser Gly Gly Pro Pro 20 2530

Lys Ser Tyr Thr Leu Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro 35 4045

Glu Trp Met Gly Gly Ile Ile Leu Ile Phe Gly Pro Pro Asn Tyr Ala 50 5560

Gln Lys Phe Gln Asp Arg Leu Thr Ile Thr Ala Asp Lys Ser ThrAsn

70 7580

Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr AlaMet

9095

Tyr Tyr Cys Val Thr Ala Pro Asp Asp Thr Gly Thr Ile Leu Ala Arg 100 105110

His Asn Arg Tyr Tyr Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr 115 120125

Val Ser

130 &lt;210&gt; 242 &lt;211&gt; 130 &lt;212&gt; PRT &lt;213* homo sapiens &lt;400* 242

Gly Arg Ala Lys Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Glu Ser Leu Lys Ile Ser Cys Gln Ala Ser Gly Tyr Gly Phe 20 2530

Thr Val Tyr Trp Ile Gly Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 35 4045

Glu Trp Leu Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Asn 50 5560

Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser ValSer

70 7580

Thr Thr Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr AlaIle

9095

Tyr Tyr Cys Ala Arg His Leu Asp Ser Tyr Asp Val Phe Thr Gly Tyr 100 105110

Asn Leu Gly Gly Tyr Met Asp Val Trp Gly Lys Gly Thr Leu Val Thr 115 120125

Val Ser

130 &lt;210*243 &lt;211*117 &lt;212* PRT &lt;213* homo sapiens &lt;220* &lt;221* MISC_FEATURE &lt;222* (6)..(6) &lt;223* Xaa corresponds to a stop codon &lt;400* 243

Gly Arg Ala Lys Val Xaa Leu Val Gln Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Val Val Ser Gly Phe Pro Leu 20 2530

Asn Arg Tyr Ile Met Asn Trp Val Arg Gln Thr Pro Gly Lys Gly Leu 35 4045

Glu Trp Leu Ser Ser Ile Ser Ser Thr Ser Ser Tyr Ile Tyr Tyr Ala 50 5560

Asp Ser Ala Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala LysAsn

70 7580

Ser Leu Phe Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr GlyLeu

9095

Tyr Tyr Cys Ala Ser Gly Asn Thr His Asp Tyr Trp Gly Gln Gly Thr 100 105110

Leu Val Thr Val Ser

115 &lt;210&gt; 244 &lt;211&gt;126 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 244

Gly Arg Ala Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Thr Ser Val Arg Val Ser Cya Lys Thr Ser Gly Gly Tyr Val 20 2530

Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro Glu Trp Met Gly 35 4045

Gly Ile Ile Thr Asn Phe Gly Thr Ihr Asn Tyr Ala Gln Lys Phe Gln 50 5560

Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Asn Thr Val TyrMet

70 7580

Asp Leu Ser Asn Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr CysAla

9095

Arg Ala Pro Arg Gly Thr Ser Thr Ile Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser 115 120125 &lt;210&gt; 245 &lt;211* 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 245

Gly Arg Ala Lys Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Ser Phe 20 2530

Ser Thr Tyr Ala Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Ala Ser Arg Asp Tyr Ala 50 5560

Gln Lys Phe Gln Gly Arg Val Thr Val Thr Ala Asp Glu Ser ThrArg

70 75Θ0

Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Val Leu Gly Gly Thr Arg Leu Tyr Tyr Ala Leu 100 105110

Asn Val Trp Gly Gln Gly Thr Met Val Thr Val Ser

115120 &lt;210&gt; 246 &lt;211&gt; 124 &lt;212* PRT &lt;213&gt; homo sapiens &lt;400* 246

Gly Arg Ala Lys Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys 15 10 15

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Thr Ser Gly Gly Ser Phe 20 25 30

Ser Thr Tyr Ser Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Asn Pro Ile Phe Ala Thr Arg Asp Tyr Ala 50 5560

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser ThrAxg

70 7580

Thr Val Tyr Met Glu Leu Arg Asn Leu Arg Ser Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Val Phe Gly Gly Thr Arg Leu Tyr Tyr Ala Leu 100 105110

Asn Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 247 &lt;211&gt; 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 247

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Thr Ser Val Arg Val Ser Cys Lys Thr Pro Gly Gly Tyr Val 20 2530

Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro Glu Trp Met Gly 35 4045

Gly Ile Ile Thr Asn Phe Gly Thr Thr Asn Tyr Ala Arg Lys Phe Gln 50 5560

Gly Arg Ile Thr Val Thr Ala Asp Lys Ser Thr Asn Thr Val TyrMet

70 7580

Asp Leu Ser Asn Leu Ala Ser Glu Aap Thr Ala Val Tyr Tyr CysAla

9095

Arg Ala Pro Arg Gly Thr Ser Thr Ile Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Aap Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser 115 120125 &lt;210&gt;248 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 248

Gly Axg Ala Lys Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe 20 2530

Ser Asn Asn Asn Met Asn Trp Val Arg Gln Thr Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Ala Ser Ile Ser Phe Gly Ser His Tyr Ile Ser Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala ArgAsn

70 7580

Ala Val Tyr Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Thr Axg Cys Arg Gly Gly Thr Arg Thr Tyr Tyr Tyr Met 100 105110

Asp Val Trp Gly Lys Gly Thr Met Val Thr Val Ser

115120 &lt;210&gt; 249 &lt;211&gt; 130 &lt;212* PRT &lt;213&gt; homo sapiens &lt;400* 249

Gly Arg Ala Lys Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Glu Ser Leu Lys Ile Ser Cys Gln Ala Ser Gly Tyr Gly Phe 20 2530

Ihr Val Tyr Trp Ile Gly Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 35 4045

Glu Trp Leu Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Asn 50 5560

Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser ValSer

70 .7580

Thr Thr Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr AlaIle

9095

Tyr Tyr Cys Ala Arg His Leu Asp Ser Tyr Asp Val Phe Thr Gly Tyr 100 105110

Asn Leu Gly Gly Tyr Met Asp Val Trp Gly Lys Gly Thr Leu Val Thr 115 120125

Val Ser

130 &lt;210&gt; 250 &lt;211&gt; 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 250

Gly Arg Ala Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ser Ser GLy Gly Tyr Val 20 2530

Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly 35 4045

Gly Ile Ile Ser Asn Phe Arg Thr Ala Glu Tyr Ala Arg Lys Phe Gln 50 5560

Gly Arg Val Thr Met Thr Ala Asp Thr Ser Thr Asn Thr Ile TyrMet

70 7580

Glu Leu Thr Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Phe CysVal

9095

Ser Ala Pro Arg Aap Thr Ser Thr Ile Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Asp Thr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 115 120125 &lt;210&gt; 251 &lt;211&gt;126 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 251

Gly Arg Ala Gln Val Gln Leu Gln Gln Ser Gly Gly Gly Val Val Gln 15 1015

Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe 20 2530

Arg Asp Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Glu Trp Met Gly Val Ile Ser Phe Asn Gly Asp Gln Ile Phe Tyr Ala 50 5560

Asp Ser Met Lys Gly Arg Phe Thr Ile Ser Arg Glu Asn Ser LysAsn

70 7580

Thr beu His Leu Arg Met Asn Ser Leu Arg Pro Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Ala Arg Leu Leu Phe Cys Ser Gly Gly Arg Cys 100 105110

Asp Met Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115 120125 &lt;210*252 &lt;211*126 &lt;212* PRT &lt;213* homosapiens &lt;400* 252

Gly Arg Ala Lys Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 10 15

Pro Gly Thr Ser Val Arg Val Ser Cys Lys Thr Ser Gly Gly Tyr Val 20 25 30

Phe Ser Trp Val Axg Gln Ala Pro Gly His Gly Pro Glu Trp Met Gly 35 4045

Gly Ile Ile Thr Asn Phe Gly Thr Ala Thr Tyr Ala Gln Lys Phe Gln 50 5560

Gly Arg Val Ser Ile Thr Ala Asp Thr Ser Thr Asn Thr Phe TyrMet

70 7580

Asp Leu Asn Asn Leu Lys Ser Asp Asp Thr Ala Val Tyr Tyr CysAla

9095

Sex Ala Pro Arg Asp Thr Ser Thr Ile Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Asp Phe Trp Gly Pro Gly Thr Leu Val Thr Val Ser 115 120125 &lt;210&gt; 253 &lt;211&gt; 116 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;220&gt;

&lt;221 &gt; MISC.FEATURE &lt;222&gt; (4)..(4) &lt;223&gt; Xaa corresponds to a stop codon &lt;400&gt; 253

Gly Arg Ala Xaa Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 2530

Ser Asn Ala Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Gly His Val Lys Ser Met Thr Asp Gly Gly Thr Thr Asp 50 5560

Tyr Ala Ala Pro Val Lya Gly Arg Phe Thr Ile Ser Arg Asp AspSer

70 7580

Glu Asn Thr Leu Tyr Leu Gln Met Aan Ser Leu Lya Thr Aap AspThr

9095

Ala Val Tyr Tyr Cys Thr Thr His Asp Tyr Trp Gly Gln Gly Thr Leu 100 105110

Val Thr Val Ser

115 &lt;210&gt; 254 &lt;211&gt; 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 254

Gly Arg Ala Lys Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Thx Sex Val Arg Val Ser Cys Lys Thx Pxo Gly Gly Tyr Val 20 2530

Phe Ser Txp Val Axg Gln Ala Pxo Gly Gln Gly Pxo Glu Trp Met Gly 35 4045

Gly Ile Ile Thr Asn Phe Gly Thr Thr Asn Tyx Ala Arg Lys Phe Gln 50 5560

Gly Axg Ile Thr Val Thr Ala Asp Lys Ser Thr Asn Thr Val TyrMet

70 7580

Asp Leu Sex Asn Leu Ala Sex Glu Asp Thr Ala Val Tyr Tyr CysAla

9095

Axg Ala Pxo Axg Gly Thx Ser Thx Ile Ala Ala Axg Phe Asn Arg Tyx 100 105110

Phe Phe Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Sex

115 120125 &lt;210&gt; 255 &lt;211&gt; 131 &lt;212=&gt; PRT &lt;213* homo sapiens &lt;400* 255

Gly Axg Ala Gln Val Gln Leu Val Glu Sex Gly Ala Glu Met Lys Lys 15 10 15

Pro Gly Ser Ser Val Lys Val Set Cys Gln Ala Ser Gly Gly Thr Phe 20 2530

Ser Asn Tyr Gly Ile Asn Trp Val Arg His Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Val Pro Ile Tyr Gly Pro Pro Lys Tyr Ala 50 5560

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Thr Ser ThrSer

70 7580

Thr Ala Tyr Met Glu Leu Ser Ser Leu Ser Ser Asp Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Leu Ser Arg Thr Val Phe Gly Ser Gly Thr Tyr 100 105110

Arg Pro Gly Tyr Tyr Tyr Met Asp Val Trp Gly Ile Gly Thr Thr Val 115 120125

Thr Val Ser

130 &lt;210&gt; 256 &lt;211&gt; 124 &lt;212» PRT &lt;213&gt; homo sapiens &lt;220&gt;

&lt;221» MISC_FEATURE &lt;222&gt; (4).. (4) &lt;223» Xaa corresponds to a stop codon &lt;400&gt; 256

Gly Arg Ala Xaa Val Gln Leu Gln Gln Ser Gly Gly Gly Leu Val Lys 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe 20 2530

Ser Asn Asn Asn Met Asn Trp Val Arg Gln Thr Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Ala Ser Ile Ser Phe Gly Ser Hia Tyr Ile Ser Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala ArgAsn

70 7580

Ala Val Tyr Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Thr Arg Cys Arg Gly Gly Thr Arg Thr Tyr Tyr Tyr Met 100 105110

Asp Val Trp Gly Lys Gly Thr Leu Val Thr Val Ser 115120 &lt;210&gt; 257 &lt;211&gt;126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 257

Gly Axg Ala Lys Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Thr Ser Val Arg Val Ser Cys Lys Thr Ser Gly Gly Tyr Val 20 2530

Phe Sex Trp Val Arg Gln Ala Pro Gly Gln Gly Pxo Glu Txp Met Gly

4045

Gly Ile Ile Thr Asn Phe Gly Thx Thx Asn Tyx Ala Gln Lys Phe Gln 50 5560

Gly Axg Val Thr Ile Thr Ala Asp Lys Ser Thr Asn Thx Val TyxMet

70 7580

Asp Leu Sex Asn Leu Thx Sex Glu Asp Thr Ala Val Tyr Tyx CysAla

9095

Arg Ala Pro Arg Gly Thr Ser Thr Ile Ala Ala Axg Phe Asn Axg Tyr 100 105110

Phe Phe Asp Sex Txp Gly Gln Gly Thx Leu Val Thr Val Sex

115 120125 &lt;210&gt; 258 &lt;211&gt; 124 &lt;212* PRT &lt;213&gt; homo sapiens &lt;400&gt; 258

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Thr Glu Gly Gly Thr Phe 20 2530

Ser Thr Tyr Val Ile Ser Trp Met Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Val Pro Ile Phe Asn Thr Pro Asn Tyr Ala 50 5560

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Arg Ser ThrSer

70 7580

Thr Ala Tyr Met Glu Leu Arg Ser Leu Gly Ser Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Val Val Gly Gly Thr Arg Ser Tyr Tyr Ala Leu 100 105110

Gly Phe Trp Gly Gln Gly Thr Thr Val Thr Val Ser

115120 &lt;210&gt; 259 &lt;211&gt;122 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 259

Gly Arg Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys 15 1015

Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu 20 2530

Gly Thr Thr Gly Val Asn Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 4045

Ala Leu Glu Trp Leu Ala Leu Ile Ser Trp Gly Gly Gly Lys His Tyr 50 5560

Ser Pro Ser Leu Asn Ser Arg Ile Thr Leu Thr Lys Asp Ala Ser Arg

70 7580

Glu Gln Val Val Val Leu Thr Met Ala Asn Met Asp Pro Val AspThr

9095

Gly Arg Tyr Tyr Cys Ala Arg Ile Val Gly Thr His Gly Phe Asp Tyr 100 105110

Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 260 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 260

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Arg 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe 20 2530

Asp Glu Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Glu Trp Val Ala Phe Ile Asn. Trp Asn Gly Asp Ser Thr Tyr Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Thr Asn Ala LysAsn

70 7580

Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr AlaPhe

9095

Tyr Tyr Cys Ala Arg Asp Pro Arg Thr Lys Leu Gly Met Ser Tyr Phe 100 105110

Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210» 261 &lt;211&gt; 130 &lt;212» PRT &lt;213* homo sapiens &lt;400&gt; 261

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Glu Ser Leu Lys Ile Ser Cys Gln Ala Ser Gly Tyr Gly Phe 20 2530

Thr Val Tyr Trp Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu 35 4045

Glu Trp Leu Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Asn 50 5560

Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser ValSer

70 7580

Thr Thr Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr AlaIle

9095

Tyr Tyr Cys Ala Arg His Leu Asp Ser Tyr Asp Val Phe Thr Gly Tyr 100 105110

Asn Leu Gly Gly Tyr Met Asp Val Trp Gly Lys Gly Thr Met Val Thr 115 120125

Val Ser

130 &lt;210&gt; 262 &lt;211*123 &lt;212* PRT &lt;213* homo sapiens &lt;400&gt; 262

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys 15 1015

Pro Gly Ala Ser Val Arg Val Ser Cys Lys Ala Ser Gly Tyr Ser Leu 20 2530

Lys Asn Tyr Gly Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Trp Ile Ser Ala Asp Asn Gly Asp Thr Thr Thr Ala 50 5560

Leu Asn Leu Arg Gly Axg Val Ser Met Thr Thr Asp Thr Ser ThrAsn

70 7580

Thr Val Tyr Met Glu Val Lys Ser Leu Arg Ser Asp Asp Thr AlaIle

9095

Tyr Phe Cys Ala Arg Asp Phe Tyr Ser Gly Ser Tyr Arg Ser Phe Asp 100 105110

Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210» 263 &lt;211» 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 263

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Pro Gly Leu Val Lys 15 1015

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Ala Ser Val 20 2530

Ser Gly Gly Asp Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lya 35 4045

Ala Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ile Gly Ser Thr Aan Tyr 50 5560

Asn Pro Ser Leu Lys Ser Arg Leu Ser Leu Ser Val Asp Thr AlaLya

70 7580

Ser Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp ThrAla

9095

Ile Tyr Phe Cys Ala Arg Ala Arg Arg Thr Tyr Ser Gly Tyr Asp Ser 100 105110

Ala Phe Aap Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115 120125 &lt;210&gt; 264 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 264

Gly Arg Ala Gln Val Gln Leu Gln Gln Ser Gly Pxo Gly Leu Val Lys 15 1015

Pro Ser Glu Thr Leu Pro Leu Thx Cys Thr Val Sex Gly Gly Ser Phe 20 2530

Ser Thr Tyx Tyr Trp Ser Txp Ile Arg Gln Ser Pro Glu Lys Gly Leu 35 4045

Glu Txp Ile Gly Tyx Ile Gln Asn Ser Val Asn Thr Asn Tyr Asn Pxo 50 5560

Ser Leu Lys Ser Arg Val Ile Ile Ser Val Asp Thr Ser Asn AsnGln

70 7580

Phe Ser Leu Lys Leu Axg Ser Val Thx Ala Ala Asp Thr Ala ValTyx

9095

Tyx Cys Ala Axg Val Sex Gly Txp Gly Pro Arg Gly Gly Ile Tyx Phe 100 105110

Asp Tyr Trp Gly Gln Gly Thx Leu Val Thx Val Ser

115120 &lt;210*265 &lt;211*126 &lt;212* PRT &lt;213* homo sapiens &lt;400* 265

Gly Arg Ala Lys Val Gln Leu Val Gln Sex GLy Ala Glu Val Lys Lys 15 1015

Pro Gly Sex Ser Val Lys Val Sex Cys Lys Ser Sex Gly Gly Tyx Val

2530

Phe Sex Trp Val Axg Gln Ala Pxo Gly Gln Gly Leu Glu Trp Met Gly 35 4045

Gly Ile Ile Sex Asn Phe His Thx Ala Glu Tyr Ala Gln Lys Phe Gln 50 5560

Gly Arg Val Thr Met Thx Ala Asp Thr Ser Thr Asn Thr Ile Tyr Met

70 7580

Glu Leu Thr Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Phe CysVal

9095

Ser Ala Pro Arg Asp Thr Ser Thr Ile Ala Ala Arg Phe Asn Axg Tyr 100 105110

Phe Phe Asp Thr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115 120125 &lt;210» 266 &lt;211&gt;126 &lt;212&gt;PRT &lt;213* homo sapiens &lt;400&gt; 266

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Thr Ser Val Arg Val Ser Arg Lys Thr Pro Gly Gly Tyr Val 20 2530

Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro Glu Trp Met Gly 35 4045

Gly Ile Ile Thr Asn Phe Gly Thr Thr Asn Tyr Ala Arg Lys Phe Gln 50 5560

Gly Arg Ile Thr Val Thr Ala Asp Lys Ser Thr Asn Thr Val TyrMet

70 7580

Asp Leu Ser Asn Leu Ala Ser Glu Asp Thr Ala Val Tyr Tyr CysAla

9095

Arg Ala Pro Arg Gly Thr Ser Thr Ile Ala Ala Arg Phe Asn Arg Tyr 100 105110

Phe Phe Asp Ser Trp Ser Gln Gly Thr Leu Val Thr Val Ser

115 120125 &lt;210 267 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 267

Gly Arg Ala Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Ser Phe 20 2530

Ser Thr Tyr Ile Phe Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Asn Pro Ile Phe Ala Thr Arg Asp Tyr Pro 50 5560

Lys Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser ThrArg

70 7580

Thr Val Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Val Leu Gly Gly Thr Arg Leu Tyr Tyr Ala Leu 100 105110

Asn Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser

115120 &lt;210&gt; 268 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 268

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Arg 15 1015

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe 20 2530

Asp Glu Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 4045

Lys Trp Val Ala Phe Ile Asn Trp Asn Gly Asp Ser Thr Tyr Tyr Ala 50 5560

Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Ser Asn Ala Lys Asn 65 70 7580

Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Phe 85 9095

Tyr Cys Cys Ala Arg Asp Pro Arg Thr Lys Leu Gly Met Ser Tyr Phe 100 105110

Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 115120 &lt;210*269 &lt;211* 124 &lt;212* PRT &lt;213* homo sapiens &lt;400* 269

Gly Arg Ala Glú Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Ser Phe 20 2530

Ser Thr Tyr Ala Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Ala Ser Arg Asp Tyr Ala 50 5560

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser ThrArg

70 7580

Thr Val Tyr Met Glu Pro Arg Ser Leu Arg Ser Glu Asp Thr AlaVal

9095

Tyr Tyr Cys Ala Arg Val Leu Gly Gly Thr Arg Leu Tyr Tyr Ala Leu 100 105110

Asn Val Trp Gly GLn Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 270 &lt;211&gt; 126 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 270

Gly Arg Ala Glu Val Gln Leu Val Gln Ser Gly Pro Gly Leu Val Lys 15 1015

Pro Ser Glu Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Ala Ser Val 20 2530

Ser Gly Gly Asp Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys 35 4045

Ala Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ile Gly Ser Thr Asn Tyr 50 5560

Asn Pro Ser Leu Lys Ser Arg Leu Ser Leu Ser Val Asp Thr AlaLys

70 7580

Ser Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp ThrAla

9095

Thr Tyr Phe Cys Ala Arg Ala Arg Arg Thr Tyr Ser Gly Tyr Asp Ser 100 105110

Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115 120125 &lt;210&gt; 271 &lt;211&gt; 124 &lt;212&gt; PRT &lt;213* homo sapiens &lt;400* 271

Gly Arg Ala Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys 15 1015

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Ser Phe 20 2530

Ser Thr Tyr Ala Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 4045

Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Ala Ser Arg Asp Tyr Ala 50 5560

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Arg 65 70 7580

Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val 85 9095

Tyr Tyr Cys Ala Arg Val Leu Gly Gly Thr Arg Leu Tyr Tyr Ala Leu 100 105110

Asn Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser

115120 &lt;210&gt; 272 &lt;211&gt; 123 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 272

Gly Arg Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Val Val Lys 15 1015

Pro Thr Gln Thr Leu Thr Leu Thr Cys Ser Leu Ser Gly Phe Ala Leu 20 2530

Gly Thr Thr Gly Val Ala Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 4045

Ala Leu Glu Trp Leu Gly Leu Ile Asp Trp Asn Asp Asp Arg Arg Tyr 50 5560

Arg Pro Ser Leu Lys Thr Arg Leu Thr Ile Thr Gln Asp Met SerArg

70 7580

Asn Gln Val Val Leu Arg Leu Thr Asn Leu Asp Pro Leu Asp ThrGly

9095

Thr Tyr Phe Cys Ala Arg Ser Val Val Pro Ala Thr Arg Ala Phe Asp 100 105110

Phe Trp Gly Gln Gly Thr Leu Val Thr Val Ser

115120 &lt;210&gt; 273 &lt;211&gt; 122 &lt;212&gt; PRT &lt;213* homo sapiens &lt;220&gt;

&lt;221&gt; MISC_FEATURE &lt;222&gt; (52)..(52) &lt;223&gt; Xaa corresponds to a stop codon &lt;400&gt; 273

Gly Arg Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys 15 1015

Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Leu Ser Gly Phe Ser Leu 20 2530

Tyr Thr Thr Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 4045

Ala Leu Glu Xaa Leu Ala Arg Ile Tyr Trp Asp Asp Asp Glu Arg Tyr 50 5560

Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile Thr Lys Asp Ala SerLys

70 7580

Asn Gln Val Val Leu Lys Met Thr Asn Met Asp Pro Val Asp ThrAla

9095

Thr Tyr Tyr Cys Ala Arg Thr Met Gly Val Val Leu Pro Phe Asp Tyr 100 105110

Trp Gly Gln Gly Thr Leu Val Thr Val Ser 115120 &lt;210*274 &lt;211*109 &lt;212* PRT &lt;213* homo sapiens &lt;400* 274

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Leu Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln His Ile Ser 20 2530

Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Cys Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Thr Gly Sex Gly Sex Gly Ala Asp Tyr Thr Leu Thr Ile Ser Ser Leu

70 7580

Gln Pxo Glu Asp Phe Ala Thx Tyx Tyr Cys Gln Gln Ser Tyr SexThr

9095

Sex Txp Thr Phe Gly Gln Gly Thr Thr Val Glu Ile Lys

100105 &lt;210&gt; 275 &lt;211&gt; 109 &lt;212» PRT &lt;213&gt; homo sapiens &lt;400&gt; 275

Leu Ala Glu Ile Val Leu Thr Gln Sex Pro Ser Sex Leu Ser Ala Sex 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Sex 20 2530

Asn Tyr Leu Ala Txp Tyx Gln Gln Lys Pro Gly Lys Val Pxo Lys Leu 35 4045

Leu Ile Tyr Ala Ala Ser Thr Leu Gln Sex Gly Val Pro Sex Axg Phe 50 5560

Sex Gly Ser Gly Sex Gly Thr Asp Phe Thx Leu Thr Ile Ser SerLeu

70 7580

Gln Pxo Glu Asp Val Ala Thx Tyr Tyr Cys Gln Lys Tyx Asn SexAla

9095

Pro Tyx Thx Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100105 &lt;210&gt; 276 &lt;211&gt;109 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 276

Leu Ala Asp Val Val Met Thr Gln Sex Pro Ser Ser Leu Ser Ala Ser 15 1015

Leu Gly Asp Axg Val Sex Ile Thr Cys Arg Ala Ser Gln His Ile Sex 20 2530

Asn Tyr Ile Asn Txp Tyx Gln Gln Lya Pro Gly Lys Ala Pra Lys Leu 35 4045

Leu Ile Tyr Ala Aia Ser Thr Leu Gln Sex Gly Val Pro Sex Arg Phe 50 5560

Thx Gly Sex Gly Sex Gly Ala Asp Tyx Thx Leu Thr Ile Thr SexLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cya Gln Gln Sex Tyx GlyThx

9095

Ser Trp Thx Phe Gly Gln Gly Thr Thx Val Glu Ile Lys

100105 &lt;210&gt; 277 &lt;211&gt; 109 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 277

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Thr 20 2530

Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Asp Ala Ser Asn Leu Gln Pro Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Val Thr Asp Phe Thr Phe Thr Ile Ser SerLeu

70 7580

Arg Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp GlyPro

9095

Val Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100105 &lt;210*278 &lt;211* 109 &lt;212* PRT &lt;213* homo sapiens &lt;400* 278

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thx Ile Ser Cys Arg Ala Ser Gln Pro Ile Ser 20 2530

Thr Tyx Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ile 35 4045

Leu Ile Phe Gly Ala Ser Arg Leu Gln Sex Gly Val Pro Ser Axg Phe 50 5560

Ser Gly Sex Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile Thx SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thx Tyr Ile Cys Gln Gln Ser Lys SerPro

9095

Pro Tyr Asn Phe Gly Axg Gly Thr Lys Leu Glu Ile Lys 100105 &lt;210&gt; 279 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213» homo sapiens &lt;400&gt; 279

Leu Ala Glu Ile Val Leu Ihr Gln Ser Pro Ser Thx Leu Sex Ala Ser 15 1015

Val Gly Asp Axg Val Thx Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly 20 2530

Ser Trp Leu Ala Txp Tyx Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Lys Ala Ser Thr Leu Gln Ser Glu Thr Pro Ser Arg Phe 50 5560

Arg Gly Sex Gly Sex Gly Thr Glu Phe Thx Leu Thr Ile Sex Ser Leu 65 70 7580

Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Phe

90 95

Ser Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Phe Lys

100 105 110 &lt;210&gt; 280 &lt;211&gt; 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 280

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asn

2530

Ile Asn Leu Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu

4045

Leu Ile Tyr Ser Ala Ser Thr Leu Gln Thr Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Sex Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ile Tyr SerHis

9095

Val Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100105 &lt;210&gt; 281 &lt;211&gt;. 115 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 281

Leu Ala Asp Val Val Met Thr Gln Ser Pxo Asp Ser Leu Ala Val Sex 15 1015

Leu Gly Glu Axg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu 20 2530

Tyr Sex Sex Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 35 4045

Gly Gln Pxo Pxo Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser 50 5560

Gly Val Pro Asp Arg Phe Ser Gly Sex Gly Sex Gly Thx Asp PheThx

70 7580

Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr TyrCys

9095

Gln Gln Tyr Tyr Ser Thx Pro Pro Met Phe Gly Gln Gly Thx Lys Val 100 105110

Glu Ile Lys

115 &lt;210&gt; 282 &lt;211&gt; 109 &lt;212* PRT &lt;213* homo sapiens &lt;400&gt; 282

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Ile Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Thr 20 2530

Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Asp Ala Ser Asn Leu Gln Pro Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Axg Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser SerLeu

70 7580

Arg Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp GlyPro

9095

Val Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100105 &lt;210&gt; 283 &lt;211&gt;115 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400* 283

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser 15 1015

Leu Gly Glu Axg Ala Thr Ile Asn Cys Lys Sex Ser Gln Ser Leu Leu 20 2530

Tyx Sex Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pxo 35 4045

Gly Gln Pro Pro Lys Leu Leu Ile Tyx Txp Ala Ser Thr Arg Glu Ser 50 5560

Gly Val Pro Asp Arg Phe Sex Gly Ser Gly Sex Gly Thx Asp PheThr

70 7580

Leu Thx Ile Ser Sex Leu Gln Ala Glu Asp Val Ala Val Tyx TyrCys

9095

Gln Gln Tyr Tyr Ser Thx Pxo Pxo Met Phe Gly Gln Gly Thr Lys Val 100 105110

Glu Ile Lys

115 &lt;210&gt; 284 &lt;211* 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 284

Leu Ala Glu Ile Val Leu Thr Gln Sex Pxo Ser Phe Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thx Cys Arg Ala Ser Gln Gly Ile Gly 20 2530

Asn Phe Leu Ala Txp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu IIe Ser Gly Ala Ser Thr Leu Gln Ser Trp Val Pxo Ser Axg Phe 50 5560

Ser Gly Arg Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Sex Ser Leu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn ArgTyr ’ 9095

Pro Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210&gt; 285 &lt;211=» 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 285

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser 20 2530

Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Arg Ala Pro Lys Leu 35 4045

Leu Ile Tyr Glu Ala Ser Asn Leu Glu Thr Gly Val Pro Pro Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr His Phe Thr Phe Thr Ile Thr GlyLeu

70 7580

Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Cys Asp SerLeu

9095

Pro Pro Val Phe Gly Gln Gly Thr Lys Leu Glu Val Lys

100105 &lt;210&gt; 286 &lt;211&gt; 110 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;220&gt;

&lt;221&gt; MISC_FEATURE &lt;222&gt; (93)..(93) &lt;223&gt; Xaa corresponds to a stop codon &lt;400 286

L&gt;eu Ala Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ala Leu Ser 15 1015

Pro Gly Asp Arg Ala Thr Leu Ser Cys Gly Ala Ser Gln Ser Val Phe 20 2530

Gly Asp Phe Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Arg 35 4045

Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ala Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Xaa Tyr GlyAsp

9095

Ser Val Phe Thr Phe Gly Gln Gly Thr Lys Leu Gly Ile Lys

100 105110 &lt;210&gt; 287 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 287

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Gly Thr Leu Ala Leu Ser 15 1015

Pro Gly Asp Arg Ala Thr Leu Ser Cys Gly Ala Ser Gln Ser Val Phe 20 2530

Gly Asp Phe Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Arg 35 4045

Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ala Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr GlyAsp

9095

Ser Val Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105110 &lt;210&gt; 288 &lt;211*110 &lt;212* PRT &lt;213* homo sapiens &lt;220* &lt;221* MISC_FEATURE &lt;222* (45)..(45) &lt;223* Xaa corresponds to a stop codon &lt;400* 288

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015

Pro Gly Gln Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asn 20 2530

Arg Asp Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Xaa Ala Pro Arg 35 4045

Leu Leu lle Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Arg Asp Asp Phe Ala Val Tyr Phe Cys His Gln Tyr GlySer

9095

Ser Pro Asn Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210&gt; 289 &lt;211» 110 &lt;212&gt; PRT &lt;213» homo sapiens &lt;400&gt; 289

Leu Ala Glu Thr Thr Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 10 15

Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser 20 25 30

Thr Αδη Tyr Leu Ala Trp Tyr Axg Gln Lys Pro Gly Gln Ala Pro Arg

40 45.

Leu Leu Ile His Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro AspArg

5560

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr GlySer

9095

Ser Pro Gln Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys

100 105110 &lt;210&gt; 290 &lt;211&gt; 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 290

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Thr Thr Cys Arg Thr Ser Gln Ser Ile Phe 20 2530

Ile Asn Leu Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Ser Ala Ser Thr Leu Gln Thr Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ile Tyr SerGln

9095

Val Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100105 &lt;210&gt; 291 &lt;211&gt;110 &lt;212* PRT &lt;213* homo sapiens &lt;400* 291

Leu Ala Asp Ile Gln Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015

Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asn 20 2530

Ser Asp Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg 35 4045

Leu Leu Met Ser Gly Ala Thr Ser Arg Ala Thr Asp Val Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys His Gln Tyr GlySer

9095

Ser Asp Asn Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210&gt; 292 &lt;211* 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400* 292

Leu Ala Asp Val Val Met Thr Gln Phe Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cya Arg Ala Ser Gln Gly Ile Ser 20 2530

Asn Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Val Pro Glu Leu 35 4045

L&gt;eu Ile Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Ala Glu Phe Thr Leu Thr ile Asn SerLeu

70 7580

Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Lys Tyr Asp SerGly

9095

Leu Arg Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105110 &lt;210 293 &lt;211&gt;110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400 293

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser 20 2530

Asn Phe Leu Ala Trp His Gln Gln Lys Pro Gly Gln Val Pro Lys Leu 35 4045

Leu Ile Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn GlyLeu

70 7580

Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Lys Tyr Asp SerGly

9095

Leu Ile Phe Thr Phe Gly Pro Gly Thr Arg Val Glu Ile Lys

100 105110 &lt;210&gt; 294 &lt;211&gt; 115 &lt;212* PRT &lt;213&gt; homo sapiens &lt;400&gt; 294

Leu Ala Asp Val Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser 15 1015

Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu 20 2530

Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 35 4045

Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser 50 5560

Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp PheThr

70 7580

Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr. TyrCys

9095

Gln Gln Tyr Tyr Ser Thr Pro Pro Met Leu Gly Gln Gly Thr Lys Val 100 105110

Glu Ile Lys'

115 &lt;210&gt; 295 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;220&gt;

&lt;221 &gt; MISC_FEATURE &lt;222&gt; (8)..(8) &lt;223&gt; Xaa corresponds to a stop codon &lt;400&gt; 295

Leu Ala Asp Val Val Met Thr Xaa Sex Pro Gly Thr Leu Ala Leu Ser 15 1015

Pro Gly Asp Arg Ala Thr Leu Ser Cys Gly Ala Ser Gln Ser Val Phe 20 2530

Gly Asp Phe Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Arg 35 4045

Leu Leu Ile Tyr Val Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ala Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr Gly Asp

9095

Ser Val Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Arg

100 105110 &lt;210&gt; 296 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 296

Leu Ala Glu Thr Thr Leu Thr Gln Ser Pxo Gly Thr Leu Ser Leu Sex 15 1015

Pro Gly Glu Axg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser 20 2530

Thr Asn Tyx Leu Ala Trp Tyr Arg Gln Lys Pxo Gly Gln Ala Pro Arg 35 4045

Leu Leu Ile His Gly Ala Sex Ser Axg Ala Thr Gly Ile Pxo Asp Arg 50 5560

Phe Ser Gly Ser Gly Sex Gly Thr Asp Phe Thr Leu Thr Ile SerAxg

70 7590

Leu Glu Pro Glu Asp Phe Ala Val Tyx Phe Cys Gln Gln Tyr GlySer

9095

Ser Pro Gln Thx Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys

100 105110 &lt;210*297 &lt;211*110 &lt;212* PRT &lt;213* homo sapiens &lt;400* 297

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015

Pro Gly Glu Arg Ala Thx Leu Ser Cys Arg Ala Ser Arg Ser Val Asn 20 2530

Ser Asn Aan Leu Ala Trp Tyr Gln Gln Lys Pro Asp Gln Ala Pro Arg 35 4045

Leu Leu Met Tyr Gly Ala Sex Ser Arg Ala Thx Gly Ile Pro Asp Axg 50 5560

Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys His Gln Tyr GlyAla

9095

Ser Asp Asn Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210&gt; 298 &lt;211&gt; 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;4Q0&gt; 298

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ile 20 2530

Thr Tyx Leu Ala Txp Tyr Gln Gln Lys Pxo Gly Lys Ala Pro Glu Val 35 4045

Leu Ile Phe Gly Ala Sex Thx Leu Gln Sex Gly Val Pxo Ser Arg Phe 50 5560

Sex Gly Sex Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser SexLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ile Ile ArgTyr

9095

Pro Arg Thx Phe Gly Gln Gly Thr Axg Val Glu Ile Lys

100105 &lt;210&gt; 299 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 299

Leu Ala Asp Val Val Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015 pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser ValAsn

25 .30

Ser Asn Asn I.eu Ala Trp Tyr GLn Gln Lys Pro Gly Gln Ala ProArg

4045

Leu Leu Val Ser Gly Ala Thr Asn Axg Ala Thr Asp Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr IIe SerArg

70 75BO

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys His Gln Tyr GlySer

9095

Ser Glu Asn Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Arg

100 105110 &lt;210&gt; 300 &lt;211&gt;109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 300

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Pro Phe Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Leu Ser 20 2530

Thr Tyr Leu Ala Trp Tyr Gln Val Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Asn SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asp ThrTyr

9095

Pro Leu Thr Leu Gly Gly Gly Thr Lys Val Glu Ile Lys

100105 &lt;210*301 &lt;211*115 &lt;212* PRT &lt;213* homo sapiens &lt;400* 301

Leu Ala Glu Ile Val I&gt;eu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser 15 1015

Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu 20 2530

Tyr Ser Sex Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 35 4045

Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg GLu Ser 50 5560

Gly Val Pro Asp Axg Phe Ser Gly Ser Gly Ser Gly Thr Asp PheThr

70 7500

Leu Thx Ile Ser Sex Leu Gln Ala Glu Asp Val Ala Val Tyx TyxCys

9095

Gln Gln Tyx Tyx Ser Thx Pro Pxo Met Phe Gly Gln Gly Thx Lys Val 100 105110

Glu Ile Lys

115 &lt;210&gt; 302 &lt;211&gt;115 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 302

Leu Ala Asp lle Gln Met Thr GLn Ser Pro Asp Ser Leu Ala Val Ser 15 1015

Leu Gly Glu Axg Ala Thr Ile Aan Cys Lys Sex Ser Gln Sex Leu Leu 20 2530

Tyx Sex Ser Asn Aan Lys Aan Tyr Leu Ala Trp Tyx Gln Gln Lys Pxo 35 4045

Gly Gln Pro Pro Lya Leu Leu Ile Tyr Trp Ala Ser Thr Axg Glu Sex 50 5560

Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

70 7580

Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr TyrCys

9095

Gln Gln Tyr Tyr Ser Thr Pro Pro Met Phe Gly Gln Gly Thr Arg Val 100 105110

Glu Ile Lys

115 &lt;210&gt; 303 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 303

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Gly Thr Leu Ala Leu Ser 15 1015

Pro Gly Asp Arg Ala Thr Leu Ser Cys Gly Ala Ser Gln Ser Val Phe 20 2530

Gly Asp Phe Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Arg 35 4045

Pro Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ala Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg

70 7580

Leu Glu Pro Glu Asp Phe ALa Val Tyr Phe Cys Gln Gln Tyr Gly Asp

9095

Ser Val Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210&gt; 304 &lt;211&gt;110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 304

Leu Ala Asp Val Val Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015

Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asn 20 2530

Ser Asp Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg 35 4045

Leu Leu Met Ser Gly Ala Thr Ser Arg Ala Thr Asp Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys His Gln Tyr GlySer

9095

Ser Asp Asn Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210* 305 &lt;211*110 &lt;212* PRT &lt;213* homo sapiens &lt;400* 305

Leu Ala Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Ser Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser 20 2530

Asn Phe Leu Ala Trp Tyr Gln Lys Lys Pro Gly Lys Val Pro Arg Leu 35 4045

Leu Ile Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser SerLeu

70 7580

Gln Pro Glu Asp Val Ala Thr Tyr Tyr cys Gln Glu Tyr Ser AsnAla • 85 9095

Leu Ile Phe Thr Phe Gly Pro Gly Thr Lys Val His Ile Lys

100 105 110 &lt;210&gt; 306 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 306

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Gly

2530

Asn Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Ser Gly Ala Ser Thr Leu Gln Ser Trp Val Pro Ser Arg Phe 50 5560

Ser Gly Arg Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn ArgTyr

9095

Pro Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105110 &lt;210&gt; 307 &lt;211&gt; 109 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 307

Leu Ala Glu Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015 val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Ser 20 2530

Asn His Leu Asn Trp Tyr Gln Gln Lys Pro Gly Arg Ala Pro Lys Leu 35 4045

Leu Ile Tyr Val Gly Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser GlyLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys GLn Gln Ser Tyr SerPro

9095

Ser Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100105 &lt;210&gt; 308 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 308

Leu Ala Asp Ile Gln Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015

Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser 20 2530

Thr Asn Tyr Leu Ala Txp Tyr Axg Gln Lys Pro Gly Gln Ala Pro Arg 35 4045

Leu Leu Ile His Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile SerArg

70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr GlySer

9095

Ser Pro Gln Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys

100 105110 &lt;210&gt; 309 &lt;211* 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 309

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 10 15

Leu Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln His Ile Ser 20 2530

Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Thr Gly Ser Gly Ser Gly Ala Asp Tyr Thr Leu Thr Ile Ser SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr SerThr

9095

Ser Trp Thr Phe Gly Gln Gly Thr Thr Val Gly Ile Lys

100105 &lt;210&gt; 310 &lt;211&gt; 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt;310

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Ser Ile Thr Cys Arg Ala Ser Arg Ser Val Lys 20 2530

Thr Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Val Tyr Gly Ser Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser SerLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Phe GlyThr

9095

Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Asp Thr Lys

100105 &lt;210 311 &lt;211&gt;109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 311

Leu Ala Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser

1015

Val Ser Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asn 20 2530

Lys Phe Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Leu 35 4045

Leu Ile Tyr Ala Ala Thr Asn Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr IleSer SerLeu

70 7580

Gln Thr Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr AspMet

9095

Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100105 &lt;210*312 &lt;211*110 &lt;212* PRT &lt;213* homo sapiens &lt;400*312

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser 15 1015

Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Arg Ser Val Tyr 20 2530

Ser Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Asp GLn Ala Pro Arg 35 4045

Leu Leu Met Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg 50 5560

Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg 65 70 7580

Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys His Gln Tyr Gly Ala 65 90 95

Ser Asp Asn Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys . 100 105. 110 &lt;210 313 &lt;210115 &lt;212&gt;PRT &lt;213&gt; homo sapiens &lt;400&gt; 313

Leu Ala Asp Ile Gln Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser 15 1015

Leu Gly Glu Lys Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu 20 2530

Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 35 4045

Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser 50 5560

Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp PheThr

70 7580

Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr TyrCys

9095

Gln Gln Tyr Tyr Ser Thr Pro Pro Met Phe Gly Gln Gly Thr Lys Val 100 105110

Glu Ile Lys

115 &lt;210&gt; 314 &lt;210110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 314

Leu Ala Glu Ile Val Met Thr Gln Sex Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Gly Ile Ser 20 2530

Asn Phe Leu Ala Trp Phe Gln Gln Lys Pro Gly Gln Val Pro Lys Leu 35 4045

Leu Ile Tyr Val Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile Asn GlyLeu

70 75Θ0

Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asp SerGly

9095

Leu Ile Phe Thr Phe Gly Pro Gly Thr Lys Val Glu Ile Lys

100 105110 &lt;210&gt; 315 &lt;211&gt; 109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt;315

Leu Ala Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Axg Val Thr Ile Thr Cys Arg Ala Ser Gln Thx Ile Ser 20 2530

Asn His Leu Asn Txp Tyx Gln Gln Lys Pro Gly Arg Ala Pxo Lys Leu 35 4045

Leu He Tyr Val Gly Sex Ser Leu Arg Ser Gly Val Pxo Sex Axg Phe 50 5560

Ser Gly Ser Gly Sex Gly Thx Asp Phe Thr Leu Thr Ile Ser GlyLeu

70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Sex Tyx SerPxo

9095

Ser Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100105 &lt;210*316 &lt;211*110 &lt;212* PRT &lt;213* homo sapiens &lt;400*316

Leu Ala Glu Ile Val Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser

5 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly IleSer

2530

Asn Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Val Pro Glu Leu 35 4045

Leu Ile Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn SerLeu

70 7580

Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Lys Tyr Asp SerGly

9095

Leu Arg Phe Thr Phe Gly Pro Gly Ala Lys Val Asp Ile Lys

100 105110 &lt;210&gt; 317 &lt;211&gt;109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 317

Leu Ala Asp Val Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Ser Ile Thr Cys Arg Ala Set Arg Ser Val Lys 20 2530

Thr Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 4045

Leu Val Tyr Gly Ser Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu 65 70 7580

Gln Pro Glu Asp Phe Ala Thr Tyr Cys Cys Gln Gln Ser Phe Gly Thr

90 95

Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Asp Ile Lys

100 105 &lt;210&gt; 318 &lt;211&gt; 110 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt; 318

Leu Ala Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser

2530

Asn Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Val Pro Glu Leu

4045

Leu Ile Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Glu Phe Thir Leu Thr Ile Asn SerLeu

70 7580

Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Lys Tyr Asp SerGly

9095

Leu Arg Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys

100 105110 &lt;210&gt; 319 &lt;211&gt;109 &lt;212&gt; PRT &lt;213&gt; homo sapiens &lt;400&gt;319

Leu Ala Asp Ile Gln Met Thr Gln Ser Ser Ser Thr Leu Ser Ala Ser 15 1015

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asn 20 2530

Ile Trp Leu Ala Trp Tyr Gln Gln Lys Ala Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Lys Ala Ser Thr Leu Glu Arg Gly Val Pro Ser Arg Phe 50 5560

Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Thr GlyLeu

70 7580

Arg Pro Asp Asp Phe Gly Ser Tyr Tyr Cys Gln His Tyr Asp GlyAsn

9095

Ser Leu Thr Phe Gly Gln Gly Thr Arg Val Asp Ile Gln 100105 &lt;210*320 &lt;211* 110 &lt;212* PRT &lt;213* homo sapiens &lt;400* 320

Leu Ala Asp Ile Gln Leu Thr Gln Ser Pro Ser Thx Leu Ser Ala Sex 15 1015

Val Gly Asp Arg Val Thr Ile Thx Cys Arg Ala Sex Gln Sex Ile Gly

2530

Ser Trp Leu Ala Trp Tyx Gln Gln Lys Pxo Gly Lys Ala Pro Lys Leu 35 4045

Leu Ile Tyr Lys Ala Ser Thr Leu Gln Ser Glu Thx Pro Ser Axg Phe 50 5560

Axg Gly Sex Gly Sex Gly Thx Glu Phe Thr Leu Thx Ile Ser SerLeu

70 7580

Gln Pro Asp Asp Phe Ala Thx Tyx Tyx Cys Gln Gln Phe Asn SerPhe

9095

Ser Pro Txp Thr Phe Gly Gln Gly Thx Lys Ala Glu Phe Lys

100 105110 &lt;210&gt; 321 &lt;210 402 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Vector sequence &lt;400&gt; 321 gctagcgctg gttgggcagc gagtaataac aatccagcgg ctgccgtagg caataggtat60 ttcattatga ctgtctcctt ggcgactagc tagtttagaa ttaattcgtg aaattgttat120 ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc180 taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagatctta 240.

ctccccatcc ccctgttgac aattaatcat cggctcgtat gatgtgtgga attgtgagcg300 gataacaatt tcacacagga aacaggagat atacatatga aatacctgct gccgaccgct360 gctgctggtc tgctgctcct cgctgcccag ccggggcgcg cc402 &lt;210&gt; 322 &lt;210 37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 322 tattggcgcg ccatggccgc ccagtctgtg acccagc 37 &lt;210&gt; 323 &lt;211&gt; 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 323 tattggcgcg ccatggccgc ccagaagata actcaa 36 &lt;210&gt; 324 &lt;211&gt; 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 324 tattggcgcg ccatggccga tgctaagacc acccag 36 &lt;210&gt; 325 &lt;211&gt; 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 325 tattggcgcg ccatggccgc ccagacagtc actcag 36 &lt;210&gt; 326 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 326 tattggcgcg ccatggccaa acaggaggtg acacaga 37 &lt;210&gt; 327 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 327 tattggcgcg ccatggccgg agactcggtt acccaga 37 &lt;210&gt; 328 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 328 tattggcgcg ccatggccgg agattcagtg acccaga 37 &lt;210 329 &lt;211 &gt;37 &lt;212&gt;DNA &lt;213&gt; Artificial &lt;400 329 tattggcgcg ccatggccag caattcagtc aagcaga 37 &lt;210* 330 &lt;211* 36 &lt;212* DNA &lt;213* Artificial &lt;400* 330 tattggcgcg ccatggccgg acaaaacatt gaccag 36 &lt;210*331 &lt;211*37 &lt;212* DNA &lt;213* Artificial &lt;400* 331 tattggcgcg ccatggccaa aaatgaagtg gagcaga 37 &lt;210* 332 &lt;211*37 &lt;212* DNA &lt;213* Artificial &lt;400* 332 tattggcgcg ccatggccga agaccaggtg acgcaga 37 &lt;210* 333 &lt;211*37 &lt;212* DNA &lt;213* Artificial &lt;400* 333 tattggcgcg ccatggccgg aatacaagtg gagcaga 37 &lt;210* 334 &lt;211*37 &lt;212* DNA &lt;213* Artificial &lt;400* 334 tattggcgcg ccatggccct acatacactg gagcaga 37 &lt;210* 335 &lt;211*37 &lt;212* DNA &lt;213* Artificial &lt;400* 335 tattggcgcg ccatggccga agacaaggtg gtacaaa 37 &lt;210* 336 &lt;211*37 &lt;212* DNA &lt;213* Artificial &lt;400* 336 tattggcgcg ccatggccga aaaccaggtg gagcaca 37 &lt;210* 337 &lt;211*36 &lt;212&gt; DNA &lt;213* Artificial &lt;400&gt; 337 tattggcgcg ccatggccca ggagaatgtg gagcag 36 &lt;210* 338 &lt;211 &gt;36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 338 tattggcgcg ccatggccgg agagagtgtg gggctg 36 &lt;210&gt; 339 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 339 tattggcgcg ccatggccgg agaggatgtg gagcaga 37 &lt;210&gt; 340 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 340 tattggcgcg ccatggccag ccaaaagata gaacaga 37 &lt;210&gt; 341 &lt;211&gt; 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt;341 tattggcgcg ccatggccag tcaacaggga gaagag 36 &lt;210&gt;342 &lt;211 &gt;36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 342 tattggcgcg ccatggccca acaaccagtg cagagt 36 &lt;210* 343 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 343 tattggcgcg ccatggccag ccaagaactg gagcaga 37 &lt;210&gt;344 &lt;211 &gt;37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400 344 tattggcgcg ccatggccgg tcaacagctg aatcaga 37 &lt;210&gt; 345 &lt;210 37 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 345 tattggcgcg ccatggccac ccagctgctg gagcaga 37 &lt;210&gt; 346 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 346 tattggcgcg ccatggccca gcagcaggtg aaacaa 36 &lt;210&gt; 347 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 347 tattggcgcg ccatggccat actgaacgtg gaacaa 36 &lt;210&gt; 348 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 348 tattggcgcg ccatggccga ccagcaagtt aagcaa 36 &lt;210&gt; 349 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 349 tattggcgcg ccatggccgg acaacaggta atgcaa 36 &lt;210 350 &lt;210 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 350 tattggcgcg ccatggccaa ggaccaagtg tttcag 36 &lt;210&gt; 351 &lt;21021 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 351 taggcagaca gacttgtcac 121 &lt;210&gt; 352 &lt;211 &gt;43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 352 gccatggcgc gccaatagct agccggtgaa gaagtcgccc aga 43 &lt;210&gt; 353 &lt;211» 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 353 gccatggcgc gccaatagct agccgatgcc atggtcatcc aga 43 &lt;210&gt; 354 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 354 gccatggcgc gccaatagct agccgaagcc caagtgaccc aga 43 &lt;210&gt; 355 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 355 gccatggcgc gccaatagct agcccatgcc aaagtcacac aga 43 &lt;210 356 &lt;211 &gt;43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 356 gccatggcgc gccaatagct agccgacaca gccgtttccc aga 43 &lt;210 357 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 357 gccatggcgc gccaatagct agccgaaacg ggagttacgc aga 43 &lt;210 358 &lt;211 &gt;43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 358 gccatggcgc gccaatagct agccgaacct gaagtcaccc aga 43 &lt;210&gt; 359 &lt;211 &gt;43 &lt;212* DNA &lt;213* Artificial &lt;400* 359 gccatggcgc gccaatagct agccgaagct gacatctacc aga 43 &lt;210* 360 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 360 gccatggcgc gccaatagct agccatatct ggagtctccc aca 43 &lt;210*361 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400*361 gccatggcgc gccaatagct agccgatgct ggaatcaccc aga 43 &lt;210*362 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 362 gccatggcgc gccaatagct agccaatgct ggtgtcactc aga 43 &lt;210* 363 &lt;211*42 &lt;212* DNA &lt;213* Artificial &lt;400* 363 gccatggcgc gccaatagct agccagtgct gtcgtctctc aa 42 &lt;210* 364 &lt;211*42 &lt;212* DNA &lt;213* Artificial &lt;400* 364 gccatggcgc gccaatagct agccgacgct ggagtcacac aa 42 &lt;210* 365 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 365 gccatggcgc gccaatagct agccgatggt ggaatcactc agt 43 &lt;210* 366 &lt;211*42 &lt;212* DNA &lt;213* Artificial &lt;400* 366 gccatggcgc gccaatagct agccactgct gggatcaccc ag 42 &lt;210* 367 &lt;211* 43 &lt;212&gt; DNA &lt;213* Artificial &lt;400* 367 gccatggcgc gccaatagct agccgaagct ggagttgccc agt 43 &lt;210* 368 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 368 gccatggcgc gccaatagct agccgaagct ggagtggttc agt 43 &lt;210* 369 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 369 gccatggcgc gccaatagct agccgaagct ggagttactc agt 43 &lt;210* 370 &lt;211*42 &lt;212* DNA &lt;213* Artificial &lt;400* 370 gccatggcgc gccaatagct agccgatgct gtagttacac aa 42 &lt;210* 371 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 371 gccatggcgc gccaatagct agccgatgct ggagttatcc agt 43 &lt;210* 372 &lt;211*42 &lt;212* DNA &lt;213* Artificial &lt;400* 372 gccatggcgc gccaatagct agccggtgct ggagtctccc ag 42 &lt;210* 373 &lt;211*43 &lt;212* DNA &lt;213* Artificial &lt;400* 373 gccatggcgc gccaatagct agccgatgct gatgttaccc aga 43 &lt;210&gt; 374 &lt;211» 43 &lt;212» DNA &lt;213» Artificial &lt;400&gt; 374 gccatggcgc gccaatagct agcctctcag actattcatc aat 43 &lt;210» 375 &lt;211» 21 &lt;212» DNA &lt;213&gt; Artificial &lt;400&gt; 375 caggcacacc agtgtggcct t 21 &lt;210» 376 &lt;211» 36 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;400&gt; 376 caccttagag ctcttagagt ctctcagctg gtacac 36 &lt;210» 377 &lt;211» 33 &lt;212&gt; DNA &lt;213» Artificial &lt;400&gt; 377 gacattatgc atgatctctg cttctgatgg ctc 33