Modulators of irf5 expression

MODULATORS OF IRF5 EXPRESSION

Cross-Reference to Related Application

The present application claims priority to U.S. Provisional Patent Application No. 62/767,615, filed November 15, 2018, the disclosure of which is incorporated herein by reference in its entirety.

Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0341USLSEQ_ST25.txt created November 5, 2018, which is 324 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

The present embodiments provide methods, compounds, and compositions useful for inhibiting Interferon Regulatory Factor 5 (IRF5; Humirf5) expression, and in certain instances, reducing the amount of IRF5 protein in a cell or animal, which can be useful for treating, preventing, or ameliorating a disease associated with IRF5.

Background

Interferon Regulatory Factor 5 or IRF5 is an important regulator of inflammation and autoimmunity. There is a large body of evidence that links IRF5 risk alleles, which are associated with high expression, to the risk of autoimmune diseases, such as systemic lupus erythematosus, rheumatoid arthritis, systemic sclerosis, inflammatory bowel disease, and multiple sclerosis (Hedi and Abhaham, J. Immunol., 2012, 188: 5348-5356; Kristjansdottir et al., J. Med. Genet. 2008, 45: 362-369; Graham et al., Nature Genet. 2006, 38: 550-555; Graham et al., PNAS, 2007, 104: 6758-6763).

The current standard of medical care for Crohn’s disease and ulcerative colitis, the two major forms of inflammatory bowel disease in humans, involves treatment with anti-inflammatory agents, corticosteroids, immunomodulators, including azathioprine, or its active metabolite 6-mercaptopurine, methotrexate, biologic agents, including tumor necrosis factor antagonist therapies, anti-integrin therapies, and anti-interleukin (IL) 12/23 therapy. It is an object herein to provide compounds and compositions of high efficacy and tolerability for the treatment of diseases disclosed herein.

Summary

Certain embodiments provided herein are compounds and methods for reducing the amount or activity of IRF5 mRNA, and in certain embodiments, reducing the amount of IRF5 protein in a cell or individual. In certain embodiments, the individual has a gastrointestinal disease. In certain embodiments, the individual has an inflammatory bowel disease. In certain embodiments, the disease is Crohn’s disease. In certain embodiments, the disease is inflammatory bowel disease (IBD). In certain embodiments, the disease is ulcerative colitis. In certain embodiments, the disease is systemic lupus erythematosus (SLE). In certain embodiments, the disease is rheumatoid arthritis. In certain embodiments, the disease is primary biliary cirrhosis. In certain embodiments, the disease is systemic sclerosis. In certain embodiments, the disease is Sjogren’s syndrome. In certain embodiments, the disease is multiple sclerosis. In certain embodiments, the disease is scleroderma. In certain embodiments, the disease is interstitial lung disease (SSc-ILD). In certain embodiments, the disease is polycystic kidney disease (PKD). In certain embodiments, the disease is chronic kidney disease (CKD). In certain embodiments, the disease is NASH. In certain embodiments, the disease is liver fibrosis. In certain embodiments, the disease is asthma. In certain embodiments, the disease is severe asthma. Certain compounds provided herein are directed to compounds and compositions that reduce inflammation in an animal.

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting IRF5 expression, which can be useful for treating, preventing, ameliorating, or slowing progression of an inflammatory disease. Certain embodiments provided herein are directed to compounds and compositions that are more potent or have greater therapeutic value than compounds publicly disclosed.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.

Definitions

Unless otherwise indicated, the following terms have the following meanings:

“2’-deoxyfuranosyl sugar moiety” or “2’-deoxyfi1ranosyl sugar” means a furanosyl sugar moiety having two hydrogens at the 2’-position. 2’-deoxyfuranosyl sugar moieties may be unmodified or modified and may be substituted at positions other than the 2’-position or unsubstituted. A β-Ο-2’-deoxyribosyl sugar moiety in the context of an oligonucleotide is an unsubstituted, unmodified 2’-deoxyfi1ranosyl and is found in naturally occurring deoxyribonucleic acids (DNA).

“2’-deoxynucleoside” means a nucleoside comprising 2’-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

“2’-O-methoxyethyl” (also 2’-M0E) refers to a 2’-O(CH2)2־OCH3) in the place of the 2’-OH group of a ribosyl ring. A 2’-O-methoxyethyl modified sugar is a modified sugar.

“2’-M0E nucleoside” (also 2’-O-methoxyethyl nucleoside) means a nucleoside comprising a 2’-M0E modified sugar moiety.

“2’-substituted nucleoside” or “2-modified nucleoside” means a nucleoside comprising a 2’-substituted or 2’-modified sugar moiety. As used herein, “2’-substituted” or “2-modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.

“3’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3’-most nucleotide of a particular compound.

“5’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5’-most nucleotide of a particular compound.

“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.

“About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of PNPLA3”, it is implied that PNPLA3 levels are inhibited within a range of 60% and 80%.

Administration or administering refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

“Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. Hie progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.

“Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

“Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.

“Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

“ Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.

“Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

“cEt” or “constrained ethyl” means a ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH3)-O-2’, and wherein the methyl group of the bridge is in the S configuration.

“cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

“Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2’-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-O-methoxyethyl modifications.

“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.

“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

“Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5methyl cytosine (^mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

“Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

Contiguous in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

“Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2’-0Me modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2’-0Me modified sugar and an unmodified thymine nucleobase are not differently modified.

“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous₌administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

“Dosing regimen” is a combination of doses designed to achieve one or more desired effects.

“Double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.

“Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. Hie effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.

“Efficacy” means the ability to produce a desired effect.

“Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

“Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. Hie internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” “Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).

“Individual” means a human or non-human animal selected for treatment or therapy.

Inhibiting the expression or activity refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

“Intemucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified intemucleoside linkage” means any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Non-phosphate linkages are referred to herein as modified intemucleoside linkages.

“IRF5” means any nucleic acid or protein of IRF5. “IRF5 nucleic acid” means any nucleic acid encoding IRF5. For example, in certain embodiments, an IRF5 nucleic acid includes a DNA sequence encoding IRF5, an RNA sequence transcribed from DNA encoding IRF5 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding IRF5. “IRF5 mRNA” means an mRNA encoding a IRF5 protein. The target may be referred to in either upper or lower case.

“IRF5 specific inhibitor” refers to any agent capable of specifically inhibiting IRF5 RNA and/or IRF5 protein expression or activity at the molecular level. For example, IRF5 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of IRF5 RNA and/or IRF5 protein.

“Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.

“Linked nucleosides” means adjacent nucleosides linked together by an intemucleoside linkage.

“Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linkernucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.

“Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating IRF5 RNA can mean to increase or decrease the level of IRF5 RNA and/or IRF5 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, an IRF5 compound can be a modulator that decreases the amount of IRF5 RNA and/or IRF5 protein in a cell, tissue, organ or organism.

“MOE” means methoxyethyl.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

“Motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.

“Natural” or “naturally occurring” means found in nature.

“Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.

“Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage.

“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

“Oligomeric compound” means a compound comprising a single oligonucleotide and, optionally, one or more additional features, such as a conjugate group or terminal group.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or intemucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or intemucleoside modification.

“Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate intemucleoside linkage is a modified intemucleoside linkage.

“Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

“Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.

“Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.

“Reduce” means to bring down to a smaller extent, size, amount, or number.

“RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequencejiatabases 10 include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

“RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ag02, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

“Segments” are defined as smaller or sub-portions of regions within a nucleic acid.

“Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded” in reference to a compound means the compound has only one oligonucleotide.

“Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is selfcomplementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

“Sites” are defined as unique nucleobase positions within a target nucleic acid.

“Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

“Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid’s expression.

“Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof.

“Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof.

“Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (.S') configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.

“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a β-D-ribosyl moiety, as found in naturally occurring RNA, or a β-Ο-2’deoxyribosyl sugar moiety as found in naturally occurring DNA. As used herein, “modified sugar moiety” or “modified sugar” means a sugar surrogate or a furanosyl sugar moiety other than a β-D-ribosyl or a β-Ο-2'deoxyribosyl. Modified furanosyl sugar moieties may be modified or substituted at a certain position(s) of the sugar moiety, substituted, or unsubstituted, and they may or may not have a stereoconfiguration other than βD-ribosyl. Modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

“Sugar surrogate means a modified sugar moiety that does not comprise a furanosyl or tetrahydrofuranyl ring (is not a “furanosyl sugar moiety”) and that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

“Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone at the same doses.

“Target gene” refers to a gene encoding a target.

“Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.

“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.

“Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5’ target site” refers to the 5’-most nucleotide of a target segment. “3’ target site” refers to the 3’most nucleotide of a target segment.

“Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

“Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting Interferon Regulatory Factor 5 (IRF5) expression.

Certain embodiments provide compounds targeted to an IRF5 nucleic acid. In certain embodiments, the IRF5 nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. U51127.1 (incorporated by reference, disclosed herein as SEQ ID NO: 4); GENBANK Accession No. NT_007933.14 truncated from nucleotides 53761170 to 53774065 (incorporated by reference, disclosed herein as SEQ ID NO: 2); GENBANK Accession No. DC427600.1 (incorporated by reference, disclosed herein as SEQ ID NO: 5); GENBANK Accession No. NM_001098627.3 (incorporated by reference, disclosed herein as SEQ ID NO: 1); GENBANK Accession No. NM_001098629.2 (incorporated by reference, disclosed herein as SEQ ID NO: 3); GENBANK Accession No. NM_001098630.2 (incorporated by reference, disclosed herein as SEQ ID NO: 6); GENBANK Accession No. NM_001242452.2 (incorporated by reference, disclosed herein as SEQ ID NO: 7); GENBANK Accession No. NM_032643.4 (incorporated by reference, disclosed herein as SEQ ID NO: 8); and GENBANK Accession No. NC_000007.14 truncated from nucleotides 128935001 to 128953000 (incorporated by reference, disclosed herein as SEQ ID NO: 9). In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

In certain embodiments, the compound comprises a modified oligonucleotide 16 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or oligomeric compound.

Certain embodiments provide a compound comprising a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded.|In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide 12 to 30 linked nucleosides in length and complementary within nucleobases 4366-4381, 5141-5156, 5140-5160, 5179-5194, 11544-11559, 11542-11596, 11736-11751, 11737-11752, 11720-11790, or 11794-11809 of SEQ ID NO: 2, wherein said modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is doublestranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, compounds target nucleotides 11737-11752 0fanIRF5 nucleic acid. In certain embodiments, compounds target within nucleotides 4366-4381, 5141-5156, 5140-5160, 5179-5194, 1154411559, 11542-11596, 11736-11751, 11737-11752, 11720-11790, or 11794-11809 of an IRF5 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, compounds have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 4366-4381,5141-5156, 5140-5160, 5179-5194, 11544-11559, 11542-11596, 11736-11751, 11737

11752, 11720-11790, or 11794-11809 of an IRF5 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides.

In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion any one of SEQ ID NOs: 168, 228, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294.

In certain embodiments, compounds targeted to IRF5 are ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, and 786548. Out of over 1,320 compounds that were screened as described in the Examples section below, ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, and 786548 emerged as the top lead compounds. In particular, ION 729018 exhibited significant efficacy and tolerability out of over 1,320 compounds.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified intemucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2’-O-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4’-CH(CH3)-O-2’ group, a 4’CH2-O-2’ group, or a 4’-(CH2)2-O-2’group.

In certain embodiments, the modified oligonucleotide comprises at least one modified intemucleoside linkage, such as a phosphorothioate intemucleoside linkage.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides comprises:

a gap segment consisting of linked deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 1270, 1272, and 1294, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence consists of the sequence recited in SEQ ID NO: 228, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides;

a 5’ wing segment consisting of two linked nucleosides; and a 3’ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment, wherein each of the nucleosides in the 5’ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3’ wing segment comprise from 5’ to 3’ direction of a cEt sugar, a 2’-MOE sugar, a cEt sugar, and a 2’-MOE sugar (keke); wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717 and 1340, wherein the modified oligonucleotide comprises a gap segment consisting of nine linked deoxynucleosides;

a 5’ wing segment consisting of two linked nucleosides; and a 3’ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment, wherein each of the nucleosides in the 5’ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3’ wing segment from 5’ to 3’ direction comprise a 2’-MOE sugar, a 2’-MOE sugar, a 2’-MOE sugar, a cEt sugar and a cEt sugar (eeekk); wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 729018 or salt thereof, having the following chemical structure:

<img file="IL283072A_D0001.tif" />

In certain embodiments, a compound comprises or consists of the sodium salt of ION 729018, having the following chemical structure:

<img file="IL283072A_D0002.tif" />

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least

90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding IRF5.

In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to

50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a pharmaceutically acceptable salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are active by virtue of having at least one of an in vitro IC50 of less than 2 μΜ, less than 1.5 μΜ, less than 1 pM, less than 0.9 pM, less than 0.8 pM, less than 0.7 pM, less than 0.6 pM, less than 0.5 pM, less than 0.4 pM, less than 0.3 pM, less than 0.2 pM, less than 0.1 pM, less than 0.05 pM, less than 0.04 pM, less than 0.03 pM, less than 0.02 pM, or less than 0.01 pM.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase in alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, or 2 fold over control animals, or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or any pharmaceutically acceptable salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature, or about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

Certain Indications

Certain embodiments provided herein relate to methods of inhibiting IRF5 expression, which can be useful for treating, preventing, or ameliorating a disease associated with IRF5 in an individual, by administration of a compound that targets IRF5. In certain embodiments, the compound can be a IRF5 specific inhibitor. In certain embodiments, the compound can be an antisense compound, an oligomeric compound, or an oligonucleotide targeted to IRF5.

Examples of diseases associated with IRF5 treatable, preventable, and/or ameliorable with the methods provided herein include inflammatory bowel disease (IBD), ulcerative colitis, Crohn’s disease, systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, and severe asthma. Certain compounds provided herein are directed to compounds and compositions that reduce inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual. Certain compounds provided herein are directed to compounds and compositions that reduce inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual, comprising administering a compound targeted to IRF5 to the individual, thereby reducing or inhibiting reduces inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual.

In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with IRF5 in an individual comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with IRF5. In certain embodiments, the disease is an inflammatory disease. In certain embodiments, the disease is an gastrointestinal disease. In certain embodiments, the gastrointestinal disease is ulcerative colitis or Crohn’s disease. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be singlestranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an animal.

In certain embodiments, a method of treating, preventing, or ameliorating inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an animal comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby treating, preventing, or ameliorating inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, a method of treating, preventing, or ameliorating inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual, comprising administering a compound targeted to IRF5 to the individual, thereby reducing or inhibiting reduces inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, administering the compound improves, preserves, or prevents inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with IRF5.

In certain embodiments, a method of inhibiting expression of IRF5 in an individual having, or at risk of having, a disease associated with IRF5 comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby inhibiting expression of IRF5 in the individual. In certain embodiments, administering the compound inhibits expression of IRF5 in the gastrointestinal tract. In certain embodiments, administering the compound inhibits expression of IRF5 in the liver. In certain embodiments, administering the compound inhibits expression of IRF5 in the lungs. In certain embodiments, administering the compound inhibits expression of IRF5 in the kidneys. In certain embodiments, administering the compound inhibits expression of IRF5 in the joints. In certain embodiments, the disease is an inflammatory disease. In certain embodiments, the disease is a gastrointestinal disease. In certain embodiments, the gastrointestinal disease is ulcerative colitis or Crohn’s disease. In certain embodiments, the individual has, or is at risk of having, inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the individual has, or is at risk of having, inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, the individual has, or is at risk of having, inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ

ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production. In certain embodiments, administering the compound improves, preserves, or prevents inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss.

In certain embodiments, a method of inhibiting expression of IRF5 in a cell comprises contacting the cell with a compound comprising a IRF5 specific inhibitor, thereby inhibiting expression of IRF5 in the cell. In certain embodiments, the cell is a gastrointestinal tract cell. In certain embodiments, the cell is a liver cell. In certain embodiments, the cell is a kidney cell. In certain embodiments, the cell is a lung cell. In certain embodiments, the cell is in the gastrointestinal tract, the lungs, the liver, the kidney, or any other organ. In certain embodiments, the cell is in the gastrointestinal tract of an individual who has, or is at risk of having, inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In certain embodiments, a method of reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual having, or at risk of having, a disease associated with IRF5 comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in the individual. In certain embodiments, a method of reducing or inhibiting inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual having, or at risk of having, a disease associated with IRF5 comprises administering to the individual a compound comprising a IRF5 specific inhibitor, thereby reducing or inhibiting inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in the individual. In certain embodiments, the individual has, or is at risk of having, inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with IRF5.

Certain embodiments are drawn to a compound comprising a IRF5 specific inhibitor for use in treating a disease associated with IRF5. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be singlestranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.

Certain embodiments are drawn to a compound comprising an IRF5 specific inhibitor for use in reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual having, or at risk of having, inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the IRF5 specific inhibitor for use reduces or inhibits inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting ofthe nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any ofthe foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to the use of a compound comprising a IRF5 specific inhibitor for the manufacture or preparation of a medicament for treating a disease associated with IRF5. Certain embodiments are drawn to the use of a compound comprising a IRF5 specific inhibitor for the preparation of a medicament for treating a disease associated with IRF5. In certain embodiments, the disease is an inflammatory disease. In certain embodiments, the disease is a gastrointestinal disease. In certain embodiments, the gastrointestinal disease is ulcerative colitis or Crohn’s disease. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any ofthe foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to the use of a compound comprising a IRF5 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting inflammation, cirrhosis, fibrosis, proteinuria, joint inflammation, autoantibody production, inflammatory cell infiltration, collagen deposits, or inflammatory cytokine production in an individual having, or at risk of having, a disease associated with IRF5. In certain embodiments, the IRF5 specific inhibitor for the manufacture or preparation of the medicament reduces or inhibits inflammation in the gastrointestinal tract, diarrhea, pain, fatigue, abdominal cramping, blood in the stool, intestinal inflammation, disruption of the epithelial barrier of the gastrointestinal tract, dysbiosis, increased bowel frequency, tenesmus or painful spasms of the anal sphincter, constipation, or unintended weight loss in an individual. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. Certain embodiments are drawn to use of a compound comprising a IRF5 specific inhibitor for the preparation of a medicament for treating a disease associated with IRF5. In certain embodiments, the disease is inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis, primary biliary cirrhosis, systemic sclerosis, Sjogren’s syndrome, multiple sclerosis, scleroderma, interstitial lung disease (SSc-ILD), polycystic kidney disease (PKD), chronic kidney disease (CKD), NASH, liver fibrosis, asthma, or severe asthma. In certain embodiments, the compound comprises an antisense compound targeted to IRF5. In certain embodiments, the compound comprises an oligonucleotide targeted to IRF5. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having anucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, a compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 228, 168, 717, 1340, 1270, 1272, and 1294. In certain embodiments, the compound is ION 729018, 728958, 785525, 785674, 785675, 786503, 786524, or 786548. In any of the foregoing embodiments, the compound can be singlestranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to IRF5. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example, a modified oligonucleotide 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 37-1356. In certain embodiments, the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the modified sugar is a bicyclic sugar or a 2’-O-methoxyethyl modified sugar, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing embodiments, the modified oligonucleotide is 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 16 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 37-1356.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 228, 168, 1270, 1272, and 1294, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence consists of the sequence recited in SEQ ID NO: 228, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717, wherein the modified oligonucleotide comprises a gap segment consisting of ten linked deoxynucleosides;

a 5’ wing segment consisting of two linked nucleosides; and a 3’ wing segment consisting of four linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment, wherein each of the nucleosides in the 5’ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3’ wing segment comprise from 5’ to 3’ direction of a cEt sugar, a 2’-MOE sugar, a cEt sugar, and a 2’-MOE sugar (keke); wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 12-30 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 717 and 1340, wherein the modified oligonucleotide comprises a gap segment consisting of nine linked deoxynucleosides;

a 5’ wing segment consisting of two linked nucleosides; and a 3’ wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment, wherein each of the nucleosides in the 5’ wing segment comprises a cEt sugar (kk); wherein the nucleosides of the 3’ wing segment from 5’ to 3’ direction comprise a 2’-MOE sugar, a 2’-MOE sugar, a 2’-MOE sugar, a cEt sugar and a cEt sugar (eeekk); wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 729018 or salt thereof, having the following chemical structure:

<img file="IL283072A_D0003.tif" />

In certain embodiments, a compound comprises or consists of the sodium salt of ION 729018, having the following chemical structure:

<img file="IL283072A_D0004.tif" />

In any of the foregoing methods or uses, the compound can be administered parenterally. For 5 example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a singlestranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 16-30 linked nucleosides in length and the second modified oligonucleotide is 16 -30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 37-1356.

In certain embodiments, antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. Hie first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. Hie oligonucleotide of the second oligomeric compound of such a double-stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. Hie oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.

Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, or 20 to 30 subunits in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits in length, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation). A shortened or truncated compound targeted to a IRF5 nucleic acid may have two subunits deleted from the 5’ end, or alternatively, may have two subunits deleted from the 3’ end of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5’ or 3’ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5’ end (5’ addition), or alternatively, to the 3’ end (3’ addition) of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:73057309; Gautschi etal.J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and singlestranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence-specific RNAi, for example, short interfering RNA (siRNA), doublestranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, posttranscriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence-specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to IRF5 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID NOs: 37-1356 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ

ID NOs: 37-1356 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on IRF5 to which any of SEQ ID NOs: 37-1356 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position of the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’OMe). In certain embodiments, the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. Hie compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to IRF5 described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 37-1356. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on IRF5 to which any of SEQ ID NOs: 37-1356 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. Hie compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19,2000. Incertainembodiments, the compound consists of 16, 17, 18, 19,20,21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNAlike” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

Nucleotide sequences that encode IRF5 include, without limitation, the following: RefSeq or GENBANK Accession No. U51127.1 (incorporated by reference, disclosed herein as SEQ ID NO: 4); GENBANK Accession No. NT_007933.14 truncated from nucleotides 53761170 to 53774065 (incorporated by reference, disclosed herein as SEQ ID NO: 2); GENBANK Accession No. DC427600.1 (incorporated by reference, disclosed herein as SEQ ID NO: 5); GENBANK Accession No. NM_001098627.3 (incorporated by reference, disclosed herein as SEQ ID NO: 1); GENBANK Accession No. NM_001098629.2 (incorporated by reference, disclosed herein as SEQ ID NO: 3); GENBANK Accession No. NM_001098630.2 (incorporated by reference, disclosed herein as SEQ ID NO: 6); GENBANK Accession No. NM_001242452.2 (incorporated by reference, disclosed herein as SEQ ID NO: 7); GENBANK Accession No. NM_032643.4 (incorporated by reference, disclosed herein as SEQ ID NO: 8); and GENBANK Accession No. NC_000007.14 truncated from nucleotides 128935001 to 128953000 (incorporated by reference, disclosed herein as SEQ ID NO: 9).

Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and a IRF5 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a IRF5 nucleic acid.

Complementarity

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and a IRF5 nucleic acid may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a IRF5 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a IRF5 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a IRF5 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer

Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981,2,482 489).

In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to a IRF5 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. “Fully complementary” can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments, selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’-endofthe gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3’-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5 ’ end or 3 ’ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a IRF5 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a IRF5 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

Hie compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.

In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Certain Modified Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage).

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited, to substituents at the 2’, 4’, and/or 5’ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3₌(“MOE”). In certain embodiments, 2’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(R_m)-alkyl, O-alkenyl, S-alkenyl, N(R_m)-alkenyl, O-alkynyl, S-alkynyl,N(R_m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R_m)(Rn) or OCH2C(=O)-N(R_m)(Rn), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2’-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4’-substituent groups suitable for linearly non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5’-substituent groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: 5’-methyl (R or S), 5'-vinyl, and 5’methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.

In certain embodiments, a 2’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2’-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH₂)2SCH₃, O(CH₂)2ON(R_m)(R_n), O(CH2)2O(CH2)2N(CH₃)2, and N-substituted acetamide (OCH2C(=O)-N(R_m)(Rn)), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2’-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH₃)2, O(CH2)2O(CH2)2N(CH₃)2, and OCH₂C(=O)-N(H)CH₃(“NMA”).

In certain embodiments, a 2’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2’-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2’-substituted or 2’-modified sugar moieties are referred to as 2’-substituted nucleosides or 2’-modified nucleosides.

Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH₂-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH₃)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4'CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022,193), 4'C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash etal., U.S. 8,278,425), 4'-CH2־O-N(CH3)-2' (see, e.g., Allerson etal., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'-CH2־C(H)(CH3)-2' (see, e.g., Zhou, etal., J. Org. Chem.,2009, 74, 118134), 4'-CH2-C(=CH2)-2' and analogs thereof (see e.g.״ Seth et al., U.S. 8,278,426), 4’-C(R_aR_b)-N(R)-O-2’, 4’C(RaRb)-O-N(R)-2’, 4'-CH2־O-N(R)-2', and 4'-CH2־N(R)-O-2', wherein each R, Ra, and Rt,is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).

In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rt>)-, -C(Ra)=N-, -C(=NRa)-, -C(=O), -C(=S)-, -O-, -S1(Ra)2-, -S(=O)_X-, and -N(Ra)-;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ!J2, SJ1, N3, COOJ1, acyl (C(=O)H), substituted acyl, CN, sulfonyl (S(=0)2-J1), or sulfoxyl (S(=0)-J1); and each J! and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379;

Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al.,U.S. 7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499, Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133, Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al.,WO 2007/134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the a-L configuration or in the β-D configuration.

<img file="IL283072A_D0005.tif" />

LNA (β-D-configuration) a-Z-LNA (a-Z-configuration) bridge = 4'-CH₂-O-2' bridge - 4'-CH₂-O-2׳ a-L-methyleneoxy (4’-CH2-O-2’) or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfi1r atom and a substitution at the 2'position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“ΊΉΡ”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, CJ. Bioorg. &amp;Med. Chem. 2002,10, 841-854), fluoro HNA:

<img file="IL283072A_D0006.tif" />

F-HNA (“F-HNA”, see e.g., Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; and Swayze et al., U.S. 9,005,906) F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula:

<img file="IL283072A_D0007.tif" />

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q2, q3, q4, q5, q6and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of R! and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ!J2, SJ1, N3, OC(=X)J1, OC(=X)NJ!J2, NJ3C(=X)NJ!J2, and CN, wherein X is O, S or NJ1, and each J!, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q!, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R! and R2 is F. In certain embodiments, R! is F and R2 is H, in certain embodiments, R! is methoxy and R2 is H, and in certain embodiments, R! is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

<img file="IL283072A_D0008.tif" />

N

I »/VW

In certain embodiments, morpholines may be modified, for example, by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as “modifed morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C=C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly, 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-Nbenzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-Nbenzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, sizeexpanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3 diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley &amp; Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991,30,613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler etal., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehleretal., U.S. 5,594,121; Switzeret al., U.S. 5,596,091; Cooketal., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., U.S. 6,166,199; and Matteucci et al., U.S. 6,005,096.

In certain embodiments, compounds targeted to a IRF5 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Modified Internucleoside Linkages

The naturally occuring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

<img file="IL283072A_D0009.tif" />

<img file="IL283072A_D0010.tif" />

<img file="IL283072A_D0011.tif" />

Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

In certain embodiments, compounds targeted to a IRF5 nucleic acid comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorouscontaining and non-phosphorous-containing linkages are well known.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage. The two main classes of intemucleoside linking groups are defined by the presence or absence of aphosphoms atom. Representative phosphoms-containing intemucleoside linkages include, but are not limited to, phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphoms containing intemucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2־N(CH3)-O-CH2), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and Ν,Ν'-dimethylhydrazine (-CH2N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral intemucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.

Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

In certain embodiments, oligonucleotides comprise modified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified intemucleoside linkage motif. In certain embodiments, intemucleoside linkages are arranged in a gapped motif. In such embodiments, the intemucleoside linkages in each of two wing regions are different from the intemucleoside linkages in the gap region. In certain embodiments, the intemucleoside linkages in the wings are phosphodiester and the intemucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped intemucleoside linkage motif may or may not have a gapped nucleoside motif and, if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

In certain embodiments, oligonucleotides comprise a region having an alternating intemucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified intemucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one intemucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate intemucleoside linkages. In certain such embodiments, at least one such block is located at the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3’ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate intemucleoside linkages and the number and position of phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments, it is desirable to decrease the number of phosphorothioate intemucleoside linkages while retaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester intemucleoside linkages while retaining nuclease resistance.

3. Certain Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

a. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap”. Hie three regions of a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides, wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleosides having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2’-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2’modification.

b. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5’-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2thiopyrimidine and a 5-propynepyrimidine.

c. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each intemucleoside linking group is a phosphate intemucleoside linkage (P=O). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal intemucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Λρ motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.

4. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobases independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications). In such circumstances, it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide will be 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameters, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, intemucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a pre-mRNA. In certain embodiments, oligonucleotides are complementary to a sense transcript.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

Compositions and Methods for Formulating Pharmaceutical Compositions

Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

A compound described herein targeted to IRF5 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to IRF5 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

Certain Selected Compounds

Approximately 1,320 newly designed compounds of various lengths, chemistries, and motifs were tested for their effect on human IRF5 mRNA in vitro in several cell types (Examples 1 and 2). Of 1,320 compounds tested for potency at a single dose in vitro, over 110 selected compounds were tested for dose dependent inhibition in THP-1 cells, as well as in KARPAS-229 cells (Example 3).

These oligonucleotides were then tested for tolerability in preclinical rodent models (Examples 4 and 5). Body weights and organ weights, liver function markers (such as alanine transaminase, aspartate transaminase and bilirubin), hematology markers (such as hemoglobin and hematocrit levels, as well as individual blood cell counts), and kidney function markers (such as BUN and creatinine) were measured. Of the over 110 compounds tested by dose response assays, 53 compounds were further screened for tolerability in a a CD-I mouse model. Nineteen oligonucleotides were further screened in the Sprague-Dawley rat model.

Twelve compounds were then selected and tested in a mouse xenograft model, where the mice were inoculated with human non-Hodgkin’s Large Cell Lymphoma (KARPAS-229) cells and treated with the compounds (Example 6). The efficacy and tolerability of the compounds were then tested. Eight compounds were then selected to be tested for efficacy at two separate doses in an IRF5 transgenic mouse model (Example 7).

IDNs 729018, 728958, 785525, 785674, 785675, 786503, 786524, and 786548 were tested for tolerability in cynomolgus monkeys (Example 8). Treatment with the compounds was well tolerated in the monkeys, in particular, treatment with ION 729018. Further analysis was done with these compounds, including measuring for viscosity, evaluation of proinflammatory effects, and dose-dependent inhibition confirmation assays.

Modified oligonucleotides with different chemistry modifications were also designed overlapping the target regions of three compounds, lONs 729018, 786503, and 785675 (Example 13). These newly designed compounds along with the three parent oligonucleotides were tested in a multi-dose assay. Many of the newly designed compounds demonstrated strong efficacy in inhibiting IRF5.

Accordingly, provided herein are compounds with any one or more of the improved properties. In certain embodiments, the compounds as described herein are potent and tolerable.

EXAMPLES

The Examples below describe the screening process to identify lead compounds targeted to IRF5.

ION 728958, 729018, 785525, 785674, 785675, 786503,786524,and 786548 resulted in high potency and tolerability. For instance, ION 729018 exhibited high potency and tolerability.

Non-limiting disclosure and incorporation by reference

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH for the natural 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

Accordingly, nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to, such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “AT^mCGAUCG,” wherein ^mC indicates a cytosine base comprising a methyl group at the 5-position.

Certain compounds described herein (e.g. modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or β, such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Likewise, all tautomeric forms of the compounds provided herein are included unless otherwise indicated. Unless otherwise indicated, oligomeric compounds and modified oligonucleotides described herein are intended to include corresponding salt forms.

Compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ¹H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: ²H or ³H in place of ¹H, ¹³C or ¹⁴C in place of ¹²C, ¹⁵N in place of ¹⁴N, ¹⁷O or ¹⁸O in place of ¹⁶O, and ³³S, ³⁴S, ³⁵S, or ³⁶S in place of³²S.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense inhibition of human IRF5 in THP-1 cells by cEt gapmers

Modified oligonucleotides were designed to target an IRF5 nucleic acid and were tested fortheir effect on IRF5 RNA levels in vitro, !^,he modified oligonucleotides were tested in a series of experiments that had similar culture conditions. Hie results for each experiment are presented in separate tables shown below.

The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. Hie gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2’deoxynucleosides and is flanked by wing segments on the 5 ’ direction and the 3 ’ direction comprising three nucleosides each. Each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a cEt sugar modification. Hie intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5’-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3’-most nucleoside to which the gapmer is targeted in the human gene sequence. Most of the modified oligonucleotide listed in the Tables below are targeted to either human IRF5 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001098627.3) orto human IRF5 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_007933.14 tmncated from nucleotides 53761170 to 53774065). In addition, a small number of modified oligonucleotides are targeted to IRF5 mRNA designated herein as SEQ ID No: 3 (GENBANK Accession No. NM_001098629.1). ‘N/A’ indicates that the modified oligonucleotide does not target that gene sequence with 100% complementarity.

Cultured THP-1 cells at a density of 30,000 cells per well were transfected using electroporation with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and IRF5 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set HTS4167 (forward sequence GCCAAGGAGACAGGGAAATACA, designated herein as SEQ ID NO: 11; reverse sequence GCAGGTTGGCCTTCCACTT; designated herein as SEQ ID NO: 12; probe sequence CGAAGGCGTGGATGAAGCCGATC, designated herein as SEQ ID NO: 13) was used to measure RNA levels. IRF5 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of IRF5 relative to untreated control cells. As used herein, a value of ‘0’ indicates that treatment with the modified oligonucleotide did not inhibit IRF5 mRNA levels. ‘N.D.’ indicates that the % inhibition is not defined for that modified oligonucleotide in that experiment. Activity of that modified oligonucleotide may be defined in a different experiment.

Table 1

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665773</td><td> N/A</td><td> N/A</td><td> 4534</td><td> 4549</td><td> GGTTCATGGCAGAGGG</td><td> 46</td><td> 37</td>

<td> 665775</td><td> N/A</td><td> N/A</td><td> 4545</td><td> 4560</td><td> TGGGATGGACTGGTTC</td><td> 35</td><td> 38</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 70</td><td> 39</td>

<td> 728374</td><td> N/A</td><td> N/A</td><td> 402</td><td> 417</td><td> CCGCCAACCTGCCGGG</td><td> 3</td><td> 40</td>

<td> 728375</td><td> N/A</td><td> N/A</td><td> 404</td><td> 419</td><td> GTCCGCCAACCTGCCG</td><td> 0</td><td> 41</td>

<td> 728376</td><td> N/A</td><td> N/A</td><td> 408</td><td> 423</td><td> GCCGGTCCGCCAACCT</td><td> 12</td><td> 42</td>

<td> 728377</td><td> N/A</td><td> N/A</td><td> 410</td><td> 425</td><td> CCGCCGGTCCGCCAAC</td><td> 0</td><td> 43</td>

<td> 728378</td><td> N/A</td><td> N/A</td><td> 412</td><td> 427</td><td> TCCCGCCGGTCCGCCA</td><td> 7</td><td> 44</td>

<td> 728379</td><td> N/A</td><td> N/A</td><td> 414</td><td> 429</td><td> CCTCCCGCCGGTCCGC</td><td> 7</td><td> 45</td>

<td> 728380</td><td> N/A</td><td> N/A</td><td> 416</td><td> 431</td><td> CGCCTCCCGCCGGTCC</td><td> 18</td><td> 46</td>

<td> 728381</td><td> N/A</td><td> N/A</td><td> 418</td><td> 433</td><td> TGCGCCTCCCGCCGGT</td><td> 9</td><td> 47</td>

<td> 728382</td><td> N/A</td><td> N/A</td><td> 430</td><td> 445</td><td> CTCTGCCCAGGCTGCG</td><td> 17</td><td> 48</td>

<td> 728383</td><td> N/A</td><td> N/A</td><td> 440</td><td> 455</td><td> CCAAGCTGAGCTCTGC</td><td> 29</td><td> 49</td>

<td> 728384</td><td> N/A</td><td> N/A</td><td> 442</td><td> 457</td><td> GACCAAGCTGAGCTCT</td><td> 22</td><td> 50</td>

<td> 728385</td><td> N/A</td><td> N/A</td><td> 445</td><td> 460</td><td> CGGGACCAAGCTGAGC</td><td> 17</td><td> 51</td>

<td> 728386</td><td> N/A</td><td> N/A</td><td> 447</td><td> 462</td><td> GGCGGGACCAAGCTGA</td><td> 0</td><td> 52</td>

<td> 728387</td><td> N/A</td><td> N/A</td><td> 450</td><td> 465</td><td> GGCGGCGGGACCAAGC</td><td> 6</td><td> 53</td>

<td> 728388</td><td> N/A</td><td> N/A</td><td> 459</td><td> 474</td><td> CACCGGCCGGGCGGCG</td><td> 0</td><td> 54</td>

<td> 728389</td><td> N/A</td><td> N/A</td><td> 461</td><td> 476</td><td> AGCACCGGCCGGGCGG</td><td> 0</td><td> 55</td>

<td> 728390</td><td> N/A</td><td> N/A</td><td> 463</td><td> 478</td><td> GGAGCACCGGCCGGGC</td><td> 9</td><td> 56</td>

<td> 728391</td><td> N/A</td><td> N/A</td><td> 466</td><td> 481</td><td> CAGGGAGCACCGGCCG</td><td> 15</td><td> 57</td>

<td> 728392</td><td> N/A</td><td> N/A</td><td> 468</td><td> 483</td><td> GCCAGGGAGCACCGGC</td><td> 0</td><td> 58</td>

<td> 728393</td><td> N/A</td><td> N/A</td><td> 470</td><td> 485</td><td> GCGCCAGGGAGCACCG</td><td> 4</td><td> 59</td>

<td> 728394</td><td> N/A</td><td> N/A</td><td> 472</td><td> 487</td><td> CTGCGCCAGGGAGCAC</td><td> 4</td><td> 60</td>

<td> 728395</td><td> N/A</td><td> N/A</td><td> 474</td><td> 489</td><td> GGCTGCGCCAGGGAGC</td><td> N.D.</td><td> 61</td>

<td> 728396</td><td> N/A</td><td> N/A</td><td> 476</td><td> 491</td><td> GTGGCTGCGCCAGGGA</td><td> 8</td><td> 62</td>

<td> 728397</td><td> N/A</td><td> N/A</td><td> 492</td><td> 507</td><td> TCTGCGGTGCGCCTGC</td><td> 25</td><td> 63</td>

<td> 728398</td><td> N/A</td><td> N/A</td><td> 494</td><td> 509</td><td> TGTCTGCGGTGCGCCT</td><td> 31</td><td> 64</td>

<td> 728401</td><td> 210</td><td> 225</td><td> 4535</td><td> 4550</td><td> TGGTTCATGGCAGAGG</td><td> 50</td><td> 65</td>

<td> 728402</td><td> 211</td><td> 226</td><td> 4536</td><td> 4551</td><td> CTGGTTCATGGCAGAG</td><td> 44</td><td> 66</td>

<td> 728403</td><td> 213</td><td> 228</td><td> 4538</td><td> 4553</td><td> GACTGGTTCATGGCAG</td><td> 25</td><td> 67</td>

<td> 728404</td><td> 214</td><td> 229</td><td> 4539</td><td> 4554</td><td> GGACTGGTTCATGGCA</td><td> 32</td><td> 68</td>

<td> 728405</td><td> 216</td><td> 231</td><td> 4541</td><td> 4556</td><td> ATGGACTGGTTCATGG</td><td> 49</td><td> 69</td>

<td> 728406</td><td> 217</td><td> 232</td><td> 4542</td><td> 4557</td><td> GATGGACTGGTTCATG</td><td> 42</td><td> 70</td>

<td> 728407</td><td> 218</td><td> 233</td><td> 4543</td><td> 4558</td><td> GGATGGACTGGTTCAT</td><td> 47</td><td> 71</td>

<td> 728408</td><td> 219</td><td> 234</td><td> 4544</td><td> 4559</td><td> GGGATGGACTGGTTCA</td><td> 53</td><td> 72</td>

<td> 728409</td><td> 223</td><td> 238</td><td> 4548</td><td> 4563</td><td> CACTGGGATGGACTGG</td><td> 40</td><td> 73</td>

<td> 728410</td><td> 225</td><td> 240</td><td> 4550</td><td> 4565</td><td> GCCACTGGGATGGACT</td><td> 16</td><td> 74</td>

<td> 728411</td><td> 227</td><td> 242</td><td> 4552</td><td> 4567</td><td> GAGCCACTGGGATGGA</td><td> 40</td><td> 75</td>

<td> 728412</td><td> 253</td><td> 268</td><td> 4578</td><td> 4593</td><td> CAGCCGCACGCGGCGG</td><td> 6</td><td> 76</td>

<td> 728413</td><td> 255</td><td> 270</td><td> 4580</td><td> 4595</td><td> TTCAGCCGCACGCGGC</td><td> 44</td><td> 77</td>

<td> 728414</td><td> 257</td><td> 272</td><td> 4582</td><td> 4597</td><td> GCTTCAGCCGCACGCG</td><td> 27</td><td> 78</td>

<td> 728415</td><td> 259</td><td> 274</td><td> 4584</td><td> 4599</td><td> GGGCTTCAGCCGCACG</td><td> 8</td><td> 79</td>

<td> 728416</td><td> 284</td><td> 299</td><td> 4609</td><td> 4624</td><td> AGCTGTTCACCTGGGC</td><td> 5</td><td> 80</td>

<td> 728417</td><td> 286</td><td> 301</td><td> 4611</td><td> 4626</td><td> GCAGCTGTTCACCTGG</td><td> 3</td><td> 81</td>

<td> 728418</td><td> 288</td><td> 303</td><td> 4613</td><td> 4628</td><td> TGGCAGCTGTTCACCT</td><td> 0</td><td> 82</td>

<td> 728419</td><td> 290</td><td> 305</td><td> 4615</td><td> 4630</td><td> ACTGGCAGCTGTTCAC</td><td> 5</td><td> 83</td>

<td> 728420</td><td> 292</td><td> 307</td><td> 4617</td><td> 4632</td><td> GTACTGGCAGCTGTTC</td><td> 0</td><td> 84</td>

<td> 728421</td><td> 294</td><td> 309</td><td> 4619</td><td> 4634</td><td> GGGTACTGGCAGCTGT</td><td> 9</td><td> 85</td>

<td> 728422</td><td> 296</td><td> 311</td><td> 4621</td><td> 4636</td><td> CTGGGTACTGGCAGCT</td><td> 0</td><td> 86</td>

<td> 728423</td><td> 298</td><td> 313</td><td> 4623</td><td> 4638</td><td> CCCTGGGTACTGGCAG</td><td> 24</td><td> 87</td>

<td> 728424</td><td> 300</td><td> 315</td><td> 4625</td><td> 4640</td><td> AGCCCTGGGTACTGGC</td><td> 0</td><td> 88</td>

<td> 728425</td><td> 302</td><td> 317</td><td> 4627</td><td> 4642</td><td> GAAGCCCTGGGTACTG</td><td> 0</td><td> 89</td>

<td> 728426</td><td> 304</td><td> 319</td><td> 4629</td><td> 4644</td><td> TTGAAGCCCTGGGTAC</td><td> 11</td><td> 90</td>

<td> 728427</td><td> 306</td><td> 321</td><td> 4631</td><td> 4646</td><td> CATTGAAGCCCTGGGT</td><td> 13</td><td> 91</td>

<td> 728428</td><td> 308</td><td> 323</td><td> 4633</td><td> 4648</td><td> CCCATTGAAGCCCTGG</td><td> 15</td><td> 92</td>

<td> 728429</td><td> 310</td><td> 325</td><td> 4635</td><td> 4650</td><td> GACCCATTGAAGCCCT</td><td> 14</td><td> 93</td>

<td> 728430</td><td> 312</td><td> 327</td><td> 4637</td><td> 4652</td><td> TTGACCCATTGAAGCC</td><td> 11</td><td> 94</td>

<td> 728431</td><td> 314</td><td> 329</td><td> 4639</td><td> 4654</td><td> CGTTGACCCATTGAAG</td><td> 0</td><td> 95</td>

<td> 728432</td><td> 316</td><td> 331</td><td> 4641</td><td> 4656</td><td> CCCGTTGACCCATTGA</td><td> 25</td><td> 96</td>

<td> 728433</td><td> 318</td><td> 333</td><td> 4643</td><td> 4658</td><td> TCCCCGTTGACCCATT</td><td> 6</td><td> 97</td>

<td> 728434</td><td> 320</td><td> 335</td><td> 4645</td><td> 4660</td><td> TTTCCCCGTTGACCCA</td><td> 20</td><td> 98</td>

<td> 728435</td><td> 322</td><td> 337</td><td> 4647</td><td> 4662</td><td> CTTTTCCCCGTTGACC</td><td> 12</td><td> 99</td>

<td> 728436</td><td> 324</td><td> 339</td><td> 4649</td><td> 4664</td><td> TTCTTTTCCCCGTTGA</td><td> 13</td><td> 100</td>

<td> 728437</td><td> 326</td><td> 341</td><td> 4651</td><td> 4666</td><td> ATTTCTTTTCCCCGTT</td><td> 7</td><td> 101</td>

<td> 728438</td><td> 328</td><td> 343</td><td> 4653</td><td> 4668</td><td> TAATTTCTTTTCCCCG</td><td> 19</td><td> 102</td>

<td> 728439</td><td> 356</td><td> 371</td><td> 4681</td><td> 4696</td><td> TTGTGGCATGCCTCCA</td><td> 25</td><td> 103</td>

<td> 728440</td><td> 358</td><td> 373</td><td> 4683</td><td> 4698</td><td> CCTTGTGGCATGCCTC</td><td> 31</td><td> 104</td>

<td> 728441</td><td> 360</td><td> 375</td><td> 4685</td><td> 4700</td><td> TGCCTTGTGGCATGCC</td><td> 7</td><td> 105</td>

<td> 728442</td><td> 362</td><td> 377</td><td> 4687</td><td> 4702</td><td> CATGCCTTGTGGCATG</td><td> 5</td><td> 106</td>

<td> 728443</td><td> 364</td><td> 379</td><td> 4689</td><td> 4704</td><td> ACCATGCCTTGTGGCA</td><td> 5</td><td> 107</td>

<td> 728444</td><td> 366</td><td> 381</td><td> 4691</td><td> 4706</td><td> GGACCATGCCTTGTGG</td><td> 6</td><td> 108</td>

<td> 728445</td><td> 368</td><td> 383</td><td> 4693</td><td> 4708</td><td> TGGGACCATGCCTTGT</td><td> 10</td><td> 109</td>

<td> 728446</td><td> 371</td><td> 386</td><td> 4696</td><td> 4711</td><td> GGCTGGGACCATGCCT</td><td> 0</td><td> 110</td>

<td> 728447</td><td> 377</td><td> 392</td><td> 4702</td><td> 4717</td><td> CGTCCTGGCTGGGACC</td><td> 2</td><td> 111</td>

<td> 728448</td><td> 380</td><td> 395</td><td> 4705</td><td> 4720</td><td> CTCCGTCCTGGCTGGG</td><td> 18</td><td> 112</td>

Table 2

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665795</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGTCCTGG</td><td> 58</td><td> 113</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 75</td><td> 39</td>

<td> 728449</td><td> 381</td><td> 396</td><td> 4706</td><td> 4721</td><td> TCTCCGTCCTGGCTGG</td><td> 2</td><td> 114</td>

<td> 728450</td><td> 382</td><td> 397</td><td> 4707</td><td> 4722</td><td> ATCTCCGTCCTGGCTG</td><td> 3</td><td> 115</td>

<td> 728451</td><td> 383</td><td> 398</td><td> 4708</td><td> 4723</td><td> TATCTCCGTCCTGGCT</td><td> 0</td><td> 116</td>

<td> 728452</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTCCTGGC</td><td> 11</td><td> 117</td>

<td> 728453</td><td> 386</td><td> 401</td><td> 4711</td><td> 4726</td><td> TGTTATCTCCGTCCTG</td><td> 14</td><td> 118</td>

<td> 728454</td><td> 387</td><td> 402</td><td> 4712</td><td> 4727</td><td> GTGTTATCTCCGTCCT</td><td> 27</td><td> 119</td>

<td> 728455</td><td> 388</td><td> 403</td><td> 4713</td><td> 4728</td><td> GGTGTTATCTCCGTCC</td><td> 18</td><td> 120</td>

<td> 728456</td><td> 389</td><td> 404</td><td> 4714</td><td> 4729</td><td> TGGTGTTATCTCCGTC</td><td> 31</td><td> 121</td>

<td> 728457</td><td> 390</td><td> 405</td><td> 4715</td><td> 4730</td><td> ATGGTGTTATCTCCGT</td><td> 17</td><td> 122</td>

<td> 728458</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTGTTATCTCC</td><td> 50</td><td> 123</td>

<td> 728459</td><td> 394</td><td> 409</td><td> 4719</td><td> 4734</td><td> GAAGATGGTGTTATCT</td><td> 14</td><td> 124</td>

<td> 728460</td><td> 396</td><td> 411</td><td> 4721</td><td> 4736</td><td> TTGAAGATGGTGTTAT</td><td> 15</td><td> 125</td>

<td> 728461</td><td> 398</td><td> 413</td><td> 4723</td><td> 4738</td><td> CCTTGAAGATGGTGTT</td><td> 29</td><td> 126</td>

<td> 728462</td><td> 400</td><td> 415</td><td> N/A</td><td> N/A</td><td> GGCCTTGAAGATGGTG</td><td> 4</td><td> 127</td>

<td> 728492</td><td> 490</td><td> 505</td><td> 8383</td><td> 8398</td><td> CTTGTTAAGGGCACAG</td><td> 26</td><td> 128</td>

<td> 728493</td><td> 491</td><td> 506</td><td> 8384</td><td> 8399</td><td> TCTTGTTAAGGGCACA</td><td> 30</td><td> 129</td>

<td> 728494</td><td> 492</td><td> 507</td><td> 8385</td><td> 8400</td><td> CTCTTGTTAAGGGCAC</td><td> 45</td><td> 130</td>

<td> 728495</td><td> 494</td><td> 509</td><td> 8387</td><td> 8402</td><td> GGCTCTTGTTAAGGGC</td><td> 17</td><td> 131</td>

<td> 728496</td><td> 496</td><td> 511</td><td> 8389</td><td> 8404</td><td> CCGGCTCTTGTTAAGG</td><td> 5</td><td> 132</td>

<td> 728497</td><td> 498</td><td> 513</td><td> 8391</td><td> 8406</td><td> TCCCGGCTCTTGTTAA</td><td> 14</td><td> 133</td>

<td> 728498</td><td> 500</td><td> 515</td><td> 8393</td><td> 8408</td><td> AGTCCCGGCTCTTGTT</td><td> 57</td><td> 134</td>

<td> 728499</td><td> 502</td><td> 517</td><td> 8395</td><td> 8410</td><td> GAAGTCCCGGCTCTTG</td><td> 45</td><td> 135</td>

<td> 728500</td><td> 504</td><td> 519</td><td> 8397</td><td> 8412</td><td> CGGAAGTCCCGGCTCT</td><td> 43</td><td> 136</td>

<td> 728501</td><td> 506</td><td> 521</td><td> 8399</td><td> 8414</td><td> GGCGGAAGTCCCGGCT</td><td> 13</td><td> 137</td>

<td> 728502</td><td> 508</td><td> 523</td><td> 8401</td><td> 8416</td><td> GAGGCGGAAGTCCCGG</td><td> 35</td><td> 138</td>

<td> 728503</td><td> 510</td><td> 525</td><td> 8403</td><td> 8418</td><td> ATGAGGCGGAAGTCCC</td><td> 23</td><td> 139</td>

<td> 728504</td><td> 512</td><td> 527</td><td> 8405</td><td> 8420</td><td> AGATGAGGCGGAAGTC</td><td> 21</td><td> 140</td>

<td> 728505</td><td> 514</td><td> 529</td><td> 8407</td><td> 8422</td><td> GTAGATGAGGCGGAAG</td><td> 29</td><td> 141</td>

<td> 728506</td><td> 538</td><td> 553</td><td> 8431</td><td> 8446</td><td> AGGTGGCATGTCCCGG</td><td> 41</td><td> 142</td>

<td> 728507</td><td> 540</td><td> 555</td><td> 8433</td><td> 8448</td><td> TGAGGTGGCATGTCCC</td><td> 40</td><td> 143</td>

<td> 728508</td><td> 542</td><td> 557</td><td> 8435</td><td> 8450</td><td> GCTGAGGTGGCATGTC</td><td> 33</td><td> 144</td>

<td> 728509</td><td> 544</td><td> 559</td><td> 8437</td><td> 8452</td><td> GGGCTGAGGTGGCATG</td><td> 44</td><td> 145</td>

<td> 728510</td><td> 546</td><td> 561</td><td> 8439</td><td> 8454</td><td> TAGGGCTGAGGTGGCA</td><td> 41</td><td> 146</td>

<td> 728511</td><td> 552</td><td> 567</td><td> 8445</td><td> 8460</td><td> ATCTTGTAGGGCTGAG</td><td> 29</td><td> 147</td>

<td> 728512</td><td> 554</td><td> 569</td><td> 8447</td><td> 8462</td><td> AGATCTTGTAGGGCTG</td><td> 45</td><td> 148</td>

<td> 728513</td><td> 556</td><td> 571</td><td> 8449</td><td> 8464</td><td> GTAGATCTTGTAGGGC</td><td> 36</td><td> 149</td>

<td> 728514</td><td> 572</td><td> 587</td><td> 8465</td><td> 8480</td><td> CATTGGAGCAGACCTC</td><td> 0</td><td> 150</td>

<td> 728515</td><td> 574</td><td> 589</td><td> 8467</td><td> 8482</td><td> GCCATTGGAGCAGACC</td><td> 13</td><td> 151</td>

<td> 728516</td><td> 576</td><td> 591</td><td> 8469</td><td> 8484</td><td> GGGCCATTGGAGCAGA</td><td> 15</td><td> 152</td>

<td> 728517</td><td> 578</td><td> 593</td><td> 8471</td><td> 8486</td><td> CAGGGCCATTGGAGCA</td><td> 15</td><td> 153</td>

<td> 728518</td><td> 580</td><td> 595</td><td> 8473</td><td> 8488</td><td> AGCAGGGCCATTGGAG</td><td> 13</td><td> 154</td>

<td> 728519</td><td> 582</td><td> 597</td><td> 8475</td><td> 8490</td><td> GGAGCAGGGCCATTGG</td><td> 24</td><td> 155</td>

<td> 728520</td><td> 591</td><td> 606</td><td> N/A</td><td> N/A</td><td> GAGTCTGTGGGAGCAG</td><td> 35</td><td> 156</td>

<td> 728521</td><td> 614</td><td> 629</td><td> 8973</td><td> 8988</td><td> AAGAGTAATCCTCAGG</td><td> 22</td><td> 157</td>

<td> 728522</td><td> 616</td><td> 631</td><td> 8975</td><td> 8990</td><td> AAAAGAGTAATCCTCA</td><td> 0</td><td> 158</td>

<td> 728523</td><td> 618</td><td> 633</td><td> 8977</td><td> 8992</td><td> CCAAAAGAGTAATCCT</td><td> 6</td><td> 159</td>

<td> 728524</td><td> 620</td><td> 635</td><td> 8979</td><td> 8994</td><td> CACCAAAAGAGTAATC</td><td> 1</td><td> 160</td>

Table 3

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 75</td><td> 39</td>

<td> 665985</td><td> 1981</td><td> 1996</td><td> 11546</td><td> 11561</td><td> CTCCTATACAGCTAGG</td><td> 49</td><td> 161</td>

<td> 665987</td><td> 1993</td><td> 2008</td><td> 11558</td><td> 11573</td><td> CTTAGGCAATTCCTCC</td><td> 50</td><td> 162</td>

<td> 666005</td><td> 2159</td><td> 2174</td><td> 11724</td><td> 11739</td><td> CTAAGTGCTCACTCAT</td><td> 64</td><td> 163</td>

<td> 666007</td><td> 2183</td><td> 2198</td><td> 11748</td><td> 11763</td><td> AGCCTTGAGCATCTGA</td><td> 63</td><td> 164</td>

<td> 666009</td><td> 2186</td><td> 2201</td><td> 11751</td><td> 11766</td><td> GCCAGCCTTGAGCATC</td><td> 50</td><td> 165</td>

<td> 728956</td><td> 1977</td><td> 1992</td><td> 11542</td><td> 11557</td><td> TATACAGCTAGGCCCC</td><td> 32</td><td> 166</td>

<td> 728957</td><td> 1978</td><td> 1993</td><td> 11543</td><td> 11558</td><td> CTATACAGCTAGGCCC</td><td> 43</td><td> 167</td>

<td> 728958</td><td> 1979</td><td> 1994</td><td> 11544</td><td> 11559</td><td> CCTATACAGCTAGGCC</td><td> 68</td><td> 168</td>

<td> 728959</td><td> 1980</td><td> 1995</td><td> 11545</td><td> 11560</td><td> TCCTATACAGCTAGGC</td><td> 39</td><td> 169</td>

<td> 728960</td><td> 1982</td><td> 1997</td><td> 11547</td><td> 11562</td><td> CCTCCTATACAGCTAG</td><td> 48</td><td> 170</td>

<td> 728961</td><td> 1983</td><td> 1998</td><td> 11548</td><td> 11563</td><td> TCCTCCTATACAGCTA</td><td> 46</td><td> 171</td>

<td> 728962</td><td> 1984</td><td> 1999</td><td> 11549</td><td> 11564</td><td> TTCCTCCTATACAGCT</td><td> 60</td><td> 172</td>

<td> 728963</td><td> 1985</td><td> 2000</td><td> 11550</td><td> 11565</td><td> ATTCCTCCTATACAGC</td><td> 35</td><td> 173</td>

<td> 728964</td><td> 1986</td><td> 2001</td><td> 11551</td><td> 11566</td><td> AATTCCTCCTATACAG</td><td> 28</td><td> 174</td>

<td> 728965</td><td> 1988</td><td> 2003</td><td> 11553</td><td> 11568</td><td> GCAATTCCTCCTATAC</td><td> 61</td><td> 175</td>

<td> 728966</td><td> 1989</td><td> 2004</td><td> 11554</td><td> 11569</td><td> GGCAATTCCTCCTATA</td><td> 60</td><td> 176</td>

<td> 728967</td><td> 1992</td><td> 2007</td><td> 11557</td><td> 11572</td><td> TTAGGCAATTCCTCCT</td><td> 51</td><td> 177</td>

<td> 728968</td><td> 1994</td><td> 2009</td><td> 11559</td><td> 11574</td><td> CCTTAGGCAATTCCTC</td><td> 64</td><td> 178</td>

<td> 728969</td><td> 1995</td><td> 2010</td><td> 11560</td><td> 11575</td><td> CCCTTAGGCAATTCCT</td><td> 68</td><td> 179</td>

<td> 728970</td><td> 1996</td><td> 2011</td><td> 11561</td><td> 11576</td><td> ACCCTTAGGCAATTCC</td><td> 77</td><td> 180</td>

<td> 728971</td><td> 1998</td><td> 2013</td><td> 11563</td><td> 11578</td><td> CCACCCTTAGGCAATT</td><td> 46</td><td> 181</td>

<td> 728972</td><td> 2000</td><td> 2015</td><td> 11565</td><td> 11580</td><td> GGCCACCCTTAGGCAA</td><td> 62</td><td> 182</td>

<td> 728973</td><td> 2003</td><td> 2018</td><td> 11568</td><td> 11583</td><td> GTGGGCCACCCTTAGG</td><td> 58</td><td> 183</td>

<td> 728974</td><td> 2006</td><td> 2021</td><td> 11571</td><td> 11586</td><td> AGAGTGGGCCACCCTT</td><td> 33</td><td> 184</td>

<td> 728975</td><td> 2008</td><td> 2023</td><td> 11573</td><td> 11588</td><td> CAAGAGTGGGCCACCC</td><td> 45</td><td> 185</td>

<td> 728976</td><td> 2010</td><td> 2025</td><td> 11575</td><td> 11590</td><td> CACAAGAGTGGGCCAC</td><td> 37</td><td> 186</td>

<td> 728977</td><td> 2012</td><td> 2027</td><td> 11577</td><td> 11592</td><td> ATCACAAGAGTGGGCC</td><td> 52</td><td> 187</td>

<td> 728978</td><td> 2014</td><td> 2029</td><td> 11579</td><td> 11594</td><td> CAATCACAAGAGTGGG</td><td> 59</td><td> 188</td>

<td> 728979</td><td> 2016</td><td> 2031</td><td> 11581</td><td> 11596</td><td> GGCAATCACAAGAGTG</td><td> 47</td><td> 189</td>

<td> 728980</td><td> 2033</td><td> 2048</td><td> 11598</td><td> 11613</td><td> GTTGCCAGAGGAAATG</td><td> 13</td><td> 190</td>

<td> 728981</td><td> 2035</td><td> 2050</td><td> 11600</td><td> 11615</td><td> TTGTTGCCAGAGGAAA</td><td> 15</td><td> 191</td>

<td> 728982</td><td> 2037</td><td> 2052</td><td> 11602</td><td> 11617</td><td> TTTTGTTGCCAGAGGA</td><td> 19</td><td> 192</td>

<td> 728983</td><td> 2040</td><td> 2055</td><td> 11605</td><td> 11620</td><td> GGCTTTTGTTGCCAGA</td><td> 17</td><td> 193</td>

<td> 728984</td><td> 2047</td><td> 2062</td><td> 11612</td><td> 11627</td><td> ACACTCTGGCTTTTGT</td><td> 11</td><td> 194</td>

<td> 728985</td><td> 2049</td><td> 2064</td><td> 11614</td><td> 11629</td><td> CAACACTCTGGCTTTT</td><td> 0</td><td> 195</td>

<td> 728986</td><td> 2051</td><td> 2066</td><td> 11616</td><td> 11631</td><td> CACAACACTCTGGCTT</td><td> 44</td><td> 196</td>

<td> 728987</td><td> 2059</td><td> 2074</td><td> 11624</td><td> 11639</td><td> ACTTGGCCCACAACAC</td><td> 9</td><td> 197</td>

<td> 728988</td><td> 2061</td><td> 2076</td><td> 11626</td><td> 11641</td><td> GGACTTGGCCCACAAC</td><td> 29</td><td> 198</td>

<td> 728989</td><td> 2086</td><td> 2101</td><td> 11651</td><td> 11666</td><td> CATGCCCTGCAGAGGC</td><td> 44</td><td> 199</td>

<td> 728990</td><td> 2095</td><td> 2110</td><td> 11660</td><td> 11675</td><td> AATCAGGGCCATGCCC</td><td> 0</td><td> 200</td>

<td> 728991</td><td> 2097</td><td> 2112</td><td> 11662</td><td> 11677</td><td> GAAATCAGGGCCATGC</td><td> 9</td><td> 201</td>

<td> 728992</td><td> 2106</td><td> 2121</td><td> 11671</td><td> 11686</td><td> CAAACCAGGGAAATCA</td><td> 26</td><td> 202</td>

<td> 728993</td><td> 2108</td><td> 2123</td><td> 11673</td><td> 11688</td><td> CTCAAACCAGGGAAAT</td><td> 51</td><td> 203</td>

<td> 728994</td><td> 2110</td><td> 2125</td><td> 11675</td><td> 11690</td><td> GTCTCAAACCAGGGAA</td><td> 63</td><td> 204</td>

<td> 728995</td><td> 2112</td><td> 2127</td><td> 11677</td><td> 11692</td><td> GAGTCTCAAACCAGGG</td><td> 61</td><td> 205</td>

<td> 728996</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTCAAACCAG</td><td> 71</td><td> 206</td>

<td> 728997</td><td> 2117</td><td> 2132</td><td> 11682</td><td> 11697</td><td> GAAGTGAGTCTCAAAC</td><td> 58</td><td> 207</td>

<td> 728998</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTGAGTCTCAA</td><td> 68</td><td> 208</td>

<td> 728999</td><td> 2121</td><td> 2136</td><td> 11686</td><td> 11701</td><td> TGAGGAAGTGAGTCTC</td><td> 20</td><td> 209</td>

<td> 729000</td><td> 2141</td><td> 2156</td><td> 11706</td><td> 11721</td><td> TATCTCAGAGGACAGG</td><td> 63</td><td> 210</td>

<td> 729001</td><td> 2143</td><td> 2158</td><td> 11708</td><td> 11723</td><td> ATTATCTCAGAGGACA</td><td> 67</td><td> 211</td>

<td> 729002</td><td> 2145</td><td> 2160</td><td> 11710</td><td> 11725</td><td> ATATTATCTCAGAGGA</td><td> 61</td><td> 212</td>

<td> 729003</td><td> 2148</td><td> 2163</td><td> 11713</td><td> 11728</td><td> CTCATATTATCTCAGA</td><td> 64</td><td> 213</td>

<td> 729004</td><td> 2152</td><td> 2167</td><td> 11717</td><td> 11732</td><td> CTCACTCATATTATCT</td><td> 50</td><td> 214</td>

<td> 729005</td><td> 2154</td><td> 2169</td><td> 11719</td><td> 11734</td><td> TGCTCACTCATATTAT</td><td> 20</td><td> 215</td>

<td> 729006</td><td> 2155</td><td> 2170</td><td> 11720</td><td> 11735</td><td> GTGCTCACTCATATTA</td><td> 53</td><td> 216</td>

<td> 729007</td><td> 2156</td><td> 2171</td><td> 11721</td><td> 11736</td><td> AGTGCTCACTCATATT</td><td> 38</td><td> 217</td>

<td> 729008</td><td> 2157</td><td> 2172</td><td> 11722</td><td> 11737</td><td> AAGTGCTCACTCATAT</td><td> 44</td><td> 218</td>

<td> 729009</td><td> 2158</td><td> 2173</td><td> 11723</td><td> 11738</td><td> TAAGTGCTCACTCATA</td><td> 45</td><td> 219</td>

<td> 729010</td><td> 2160</td><td> 2175</td><td> 11725</td><td> 11740</td><td> CCTAAGTGCTCACTCA</td><td> 63</td><td> 220</td>

<td> 729011</td><td> 2161</td><td> 2176</td><td> 11726</td><td> 11741</td><td> ACCTAAGTGCTCACTC</td><td> 64</td><td> 221</td>

<td> 729012</td><td> 2162</td><td> 2177</td><td> 11727</td><td> 11742</td><td> TACCTAAGTGCTCACT</td><td> 34</td><td> 222</td>

<td> 729013</td><td> 2163</td><td> 2178</td><td> 11728</td><td> 11743</td><td> ATACCTAAGTGCTCAC</td><td> 56</td><td> 223</td>

<td> 729014</td><td> 2164</td><td> 2179</td><td> 11729</td><td> 11744</td><td> GATACCTAAGTGCTCA</td><td> 60</td><td> 224</td>

<td> 729015</td><td> 2166</td><td> 2181</td><td> 11731</td><td> 11746</td><td> ATGATACCTAAGTGCT</td><td> 57</td><td> 225</td>

<td> 729016</td><td> 2168</td><td> 2183</td><td> 11733</td><td> 11748</td><td> ATATGATACCTAAGTG</td><td> 53</td><td> 226</td>

<td> 729017</td><td> 2170</td><td> 2185</td><td> 11735</td><td> 11750</td><td> TGATATGATACCTAAG</td><td> 46</td><td> 227</td>

<td> 729018</td><td> 2172</td><td> 21X7</td><td> Η 737</td><td> iiiii</td><td> TCTGATATGATACCTA</td><td> H</td><td> m</td>

<td> 729019</td><td> 2174</td><td> 2189</td><td> 11739</td><td> 11754</td><td> CATCTGATATGATACC</td><td> 63</td><td> 229</td>

<td> 729020</td><td> 2176</td><td> 2191</td><td> 11741</td><td> 11756</td><td> AGCATCTGATATGATA</td><td> 65</td><td> 230</td>

<td> 729021</td><td> 2178</td><td> 2193</td><td> 11743</td><td> 11758</td><td> TGAGCATCTGATATGA</td><td> 60</td><td> 231</td>

<td> 729022</td><td> 2179</td><td> 2194</td><td> 11744</td><td> 11759</td><td> TTGAGCATCTGATATG</td><td> 37</td><td> 232</td>

<td> 729023</td><td> 2180</td><td> 2195</td><td> 11745</td><td> 11760</td><td> CTTGAGCATCTGATAT</td><td> 36</td><td> 233</td>

<td> 729024</td><td> 2181</td><td> 2196</td><td> 11746</td><td> 11761</td><td> CCTTGAGCATCTGATA</td><td> 56</td><td> 234</td>

<td> 729025</td><td> 2182</td><td> 2197</td><td> 11747</td><td> 11762</td><td> GCCTTGAGCATCTGAT</td><td> 54</td><td> 235</td>

<td> 729026</td><td> 2185</td><td> 2200</td><td> 11750</td><td> 11765</td><td> CCAGCCTTGAGCATCT</td><td> 51</td><td> 236</td>

<td> 729027</td><td> 2187</td><td> 2202</td><td> 11752</td><td> 11767</td><td> TGCCAGCCTTGAGCAT</td><td> 14</td><td> 237</td>

Table 4

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665830</td><td> 680</td><td> 695</td><td> 9499</td><td> 9514</td><td> TGAGGCTCAGGCTTGG</td><td> 65</td><td> 238</td>

<td rowspan="2"> 665840</td><td> 715</td><td> 730</td><td> 9755</td><td> 9770</td><td rowspan="2"> CGGCTGCAGAGTGGGC</td><td rowspan="2"> 43</td><td rowspan="2"> 239</td>

<td> 760</td><td> 775</td><td> 9800</td><td> 9815</td>

<td rowspan="2"> 665842</td><td> 717</td><td> 732</td><td> 9757</td><td> 9772</td><td rowspan="2"> GGCGGCTGCAGAGTGG</td><td rowspan="2"> 43</td><td rowspan="2"> 240</td>

<td> 762</td><td> 777</td><td> 9802</td><td> 9817</td>

<td rowspan="2"> 665843</td><td> 718</td><td> 733</td><td> 9758</td><td> 9773</td><td rowspan="2"> GGGCGGCTGCAGAGTG</td><td rowspan="2"> 53</td><td rowspan="2"> 241</td>

<td> 763</td><td> 778</td><td> 9803</td><td> 9818</td>

<td rowspan="2"> 665845</td><td> 720</td><td> 735</td><td> 9760</td><td> 9775</td><td rowspan="2"> GTGGGCGGCTGCAGAG</td><td rowspan="2"> 43</td><td rowspan="2"> 242</td>

<td> 750</td><td> 765</td><td> 9790</td><td> 9805</td>

<td rowspan="2"> 665846</td><td> 721</td><td> 736</td><td> 9761</td><td> 9776</td><td rowspan="2"> AGTGGGCGGCTGCAGA</td><td rowspan="2"> 28</td><td rowspan="2"> 243</td>

<td> 751</td><td> 766</td><td> 9791</td><td> 9806</td>

<td rowspan="2"> 665847</td><td> 722</td><td> 737</td><td> 9762</td><td> 9777</td><td rowspan="2"> GAGTGGGCGGCTGCAG</td><td rowspan="2"> 24</td><td rowspan="2"> 244</td>

<td> 752</td><td> 767</td><td> 9792</td><td> 9807</td>

<td rowspan="2"> 665848</td><td> 724</td><td> 739</td><td> 9764</td><td> 9779</td><td rowspan="2"> CAGAGTGGGCGGCTGC</td><td rowspan="2"> 40</td><td rowspan="2"> 245</td>

<td> 754</td><td> 769</td><td> 9794</td><td> 9809</td>

<td rowspan="2"> 665853</td><td> 725</td><td> 740</td><td> 9765</td><td> 9780</td><td rowspan="2"> GCAGAGTGGGCGGCTG</td><td rowspan="2"> 11</td><td rowspan="2"> 246</td>

<td> 755</td><td> 770</td><td> 9795</td><td> 9810</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 72</td><td> 39</td>

<td> 728525</td><td> 622</td><td> 637</td><td> 8981</td><td> 8996</td><td> TGCACCAAAAGAGTAA</td><td> 22</td><td> 247</td>

<td> 728526</td><td> 624</td><td> 639</td><td> 8983</td><td> 8998</td><td> CCTGCACCAAAAGAGT</td><td> 31</td><td> 248</td>

<td> 728527</td><td> 626</td><td> 641</td><td> 8985</td><td> 9000</td><td> CTCCTGCACCAAAAGA</td><td> 39</td><td> 249</td>

<td> 728528</td><td> 628</td><td> 643</td><td> 8987</td><td> 9002</td><td> CTCTCCTGCACCAAAA</td><td> 31</td><td> 250</td>

<td> 728529</td><td> 663</td><td> 678</td><td> 9482</td><td> 9497</td><td> AACATCCTCTGCAGCT</td><td> 29</td><td> 251</td>

<td> 728530</td><td> 666</td><td> 681</td><td> 9485</td><td> 9500</td><td> GGCAACATCCTCTGCA</td><td> 36</td><td> 252</td>

<td> 728531</td><td> 668</td><td> 683</td><td> 9487</td><td> 9502</td><td> TTGGCAACATCCTCTG</td><td> 45</td><td> 253</td>

<td> 728532</td><td> 670</td><td> 685</td><td> 9489</td><td> 9504</td><td> GCTTGGCAACATCCTC</td><td> 53</td><td> 254</td>

<td> 728533</td><td> 672</td><td> 687</td><td> 9491</td><td> 9506</td><td> AGGCTTGGCAACATCC</td><td> 66</td><td> 255</td>

<td> 728534</td><td> 675</td><td> 690</td><td> 9494</td><td> 9509</td><td> CTCAGGCTTGGCAACA</td><td> 42</td><td> 256</td>

<td> 728535</td><td> 678</td><td> 693</td><td> 9497</td><td> 9512</td><td> AGGCTCAGGCTTGGCA</td><td> 60</td><td> 257</td>

<td> 728536</td><td> 681</td><td> 696</td><td> 9500</td><td> 9515</td><td> GTGAGGCTCAGGCTTG</td><td> 44</td><td> 258</td>

<td> 728537</td><td> 682</td><td> 697</td><td> 9501</td><td> 9516</td><td> TGTGAGGCTCAGGCTT</td><td> 34</td><td> 259</td>

<td> 728538</td><td> 684</td><td> 699</td><td> N/A</td><td> N/A</td><td> TCTGTGAGGCTCAGGC</td><td> 41</td><td> 260</td>

<td> 728544</td><td> N/A</td><td> N/A</td><td> 9690</td><td> 9705</td><td> CAGACTGCACTGCATC</td><td> 29</td><td> 261</td>

<td> 728545</td><td> N/A</td><td> N/A</td><td> 9692</td><td> 9707</td><td> GCCAGACTGCACTGCA</td><td> 8</td><td> 262</td>

<td> 728546</td><td> N/A</td><td> N/A</td><td> 9694</td><td> 9709</td><td> GGGCCAGACTGCACTG</td><td> 28</td><td> 263</td>

<td> 728547</td><td> N/A</td><td> N/A</td><td> 9711</td><td> 9726</td><td> AATAGGGTGTCATGTG</td><td> 6</td><td> 264</td>

<td> 728548</td><td> N/A</td><td> N/A</td><td> 9713</td><td> 9728</td><td> AGAATAGGGTGTCATG</td><td> 0</td><td> 265</td>

<td> 728549</td><td> N/A</td><td> N/A</td><td> 9715</td><td> 9730</td><td> AAAGAATAGGGTGTCA</td><td> 17</td><td> 266</td>

<td> 728550</td><td> N/A</td><td> N/A</td><td> 9717</td><td> 9732</td><td> GTAAAGAATAGGGTGT</td><td> 14</td><td> 267</td>

<td> 728551</td><td> N/A</td><td> N/A</td><td> 9719</td><td> 9734</td><td> GAGTAAAGAATAGGGT</td><td> 24</td><td> 268</td>

<td> 728552</td><td> N/A</td><td> N/A</td><td> 9721</td><td> 9736</td><td> TTGAGTAAAGAATAGG</td><td> 12</td><td> 269</td>

<td> 728553</td><td> N/A</td><td> N/A</td><td> 9723</td><td> 9738</td><td> CTTTGAGTAAAGAATA</td><td> 8</td><td> 270</td>

<td> 728554</td><td> N/A</td><td> N/A</td><td> 9725</td><td> 9740</td><td> CTCTTTGAGTAAAGAA</td><td> 0</td><td> 271</td>

<td> 728555</td><td> N/A</td><td> N/A</td><td> 9727</td><td> 9742</td><td> TCCTCTTTGAGTAAAG</td><td> 14</td><td> 272</td>

<td> 728556</td><td> N/A</td><td> N/A</td><td> 9729</td><td> 9744</td><td> CATCCTCTTTGAGTAA</td><td> 21</td><td> 273</td>

<td> 728557</td><td> N/A</td><td> N/A</td><td> 9731</td><td> 9746</td><td> GACATCCTCTTTGAGT</td><td> 11</td><td> 274</td>

<td> 728558</td><td> N/A</td><td> N/A</td><td> 9733</td><td> 9748</td><td> TTGACATCCTCTTTGA</td><td> 32</td><td> 275</td>

<td> 728559</td><td> N/A</td><td> N/A</td><td> 9735</td><td> 9750</td><td> ACTTGACATCCTCTTT</td><td> 16</td><td> 276</td>

<td> 728560</td><td> 699</td><td> 714</td><td> 9739</td><td> 9754</td><td> GGCCACTTGACATCCT</td><td> 6</td><td> 277</td>

<td> 728561</td><td> 701</td><td> 716</td><td> 9741</td><td> 9756</td><td> GCGGCCACTTGACATC</td><td> 31</td><td> 278</td>

<td> 728562</td><td> 703</td><td> 718</td><td> 9743</td><td> 9758</td><td> GGGCGGCCACTTGACA</td><td> 13</td><td> 279</td>

<td> 728563</td><td> 705</td><td> 720</td><td> 9745</td><td> 9760</td><td> GTGGGCGGCCACTTGA</td><td> 40</td><td> 280</td>

<td> 728564</td><td> 707</td><td> 722</td><td> 9747</td><td> 9762</td><td> GAGTGGGCGGCCACTT</td><td> 12</td><td> 281</td>

<td> 728565</td><td> 709</td><td> 724</td><td> 9749</td><td> 9764</td><td> CAGAGTGGGCGGCCAC</td><td> 38</td><td> 282</td>

<td> 728566</td><td> 711</td><td> 726</td><td> 9751</td><td> 9766</td><td> TGCAGAGTGGGCGGCC</td><td> 21</td><td> 283</td>

<td> 728567</td><td> 726</td><td> 741</td><td> 9766</td><td> 9781</td><td> CGCAGAGTGGGCGGCT</td><td> 18</td><td> 284</td>

<td> 728568</td><td> 727</td><td> 742</td><td> 9767</td><td> 9782</td><td> CCGCAGAGTGGGCGGC</td><td> 17</td><td> 285</td>

<td> 728569</td><td> 731</td><td> 746</td><td> 9771</td><td> 9786</td><td> GCGGCCGCAGAGTGGG</td><td> 4</td><td> 286</td>

<td> 728570</td><td> 733</td><td> 748</td><td> 9773</td><td> 9788</td><td> AGGCGGCCGCAGAGTG</td><td> 20</td><td> 287</td>

<td> 728571</td><td> 735</td><td> 750</td><td> 9775</td><td> 9790</td><td> GTAGGCGGCCGCAGAG</td><td> 14</td><td> 288</td>

<td> 728572</td><td> 737</td><td> 752</td><td> 9777</td><td> 9792</td><td> GAGTAGGCGGCCGCAG</td><td> 11</td><td> 289</td>

<td> 728573</td><td> 739</td><td> 754</td><td> 9779</td><td> 9794</td><td> CAGAGTAGGCGGCCGC</td><td> 25</td><td> 290</td>

<td> 728574</td><td> 741</td><td> 756</td><td> 9781</td><td> 9796</td><td> TGCAGAGTAGGCGGCC</td><td> 12</td><td> 291</td>

<td> 728575</td><td> 743</td><td> 758</td><td> 9783</td><td> 9798</td><td> GCTGCAGAGTAGGCGG</td><td> 44</td><td> 292</td>

<td> 728576</td><td> 745</td><td> 760</td><td> 9785</td><td> 9800</td><td> CGGCTGCAGAGTAGGC</td><td> 37</td><td> 293</td>

<td> 728577</td><td> 747</td><td> 762</td><td> 9787</td><td> 9802</td><td> GGCGGCTGCAGAGTAG</td><td> 45</td><td> 294</td>

<td> 728578</td><td> 756</td><td> 771</td><td> 9796</td><td> 9811</td><td> TGCAGAGTGGGCGGCT</td><td> 9</td><td> 295</td>

<td> 728579</td><td> 764</td><td> 779</td><td> 9804</td><td> 9819</td><td> CGGGCGGCTGCAGAGT</td><td> 61</td><td> 296</td>

<td> 728580</td><td> 765</td><td> 780</td><td> 9805</td><td> 9820</td><td> ACGGGCGGCTGCAGAG</td><td> 28</td><td> 297</td>

<td> 728581</td><td> 767</td><td> 782</td><td> 9807</td><td> 9822</td><td> CCACGGGCGGCTGCAG</td><td> 17</td><td> 298</td>

<td> 728582</td><td> 768</td><td> 783</td><td> 9808</td><td> 9823</td><td> ACCACGGGCGGCTGCA</td><td> 29</td><td> 299</td>

<td> 728583</td><td> 769</td><td> 784</td><td> 9809</td><td> 9824</td><td> CACCACGGGCGGCTGC</td><td> 26</td><td> 300</td>

<td> 728584</td><td> 771</td><td> 786</td><td> 9811</td><td> 9826</td><td> AGCACCACGGGCGGCT</td><td> 7</td><td> 301</td>

<td> 728585</td><td> 773</td><td> 788</td><td> 9813</td><td> 9828</td><td> CCAGCACCACGGGCGG</td><td> 41</td><td> 302</td>

<td> 728586</td><td> 775</td><td> 790</td><td> 9815</td><td> 9830</td><td> ACCCAGCACCACGGGC</td><td> 19</td><td> 303</td>

<td> 728587</td><td> 777</td><td> 792</td><td> 9817</td><td> 9832</td><td> GGACCCAGCACCACGG</td><td> 41</td><td> 304</td>

<td> 728588</td><td> 830</td><td> 845</td><td> 9870</td><td> 9885</td><td> AGCCAGCAGGGTTGCC</td><td> 26</td><td> 305</td>

<td> 728589</td><td> 832</td><td> 847</td><td> 9872</td><td> 9887</td><td> GAAGCCAGCAGGGTTG</td><td> 16</td><td> 306</td>

<td> 728590</td><td> 834</td><td> 849</td><td> 9874</td><td> 9889</td><td> CTGAAGCCAGCAGGGT</td><td> 26</td><td> 307</td>

<td> 728591</td><td> 845</td><td> 860</td><td> 9885</td><td> 9900</td><td> AGAGAAGCTCCCTGAA</td><td> 8</td><td> 308</td>

<td> 728592</td><td> 849</td><td> 864</td><td> 9889</td><td> 9904</td><td> TCAGAGAGAAGCTCCC</td><td> 3</td><td> 309</td>

Table 5

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 642685</td><td> 1098</td><td> 1113</td><td> 10331</td><td> 10346</td><td> AAGCGCACTTGCTCCA</td><td> 33</td><td> 310</td>

<td> 665862</td><td> 913</td><td> 928</td><td> 9953</td><td> 9968</td><td> GTCTGGCAGGAGCTGT</td><td> 51</td><td> 311</td>

<td> 665878</td><td> 1096</td><td> 1111</td><td> 10329</td><td> 10344</td><td> GCGCACTTGCTCCAGG</td><td> 58</td><td> 312</td>

<td> 665884</td><td> 1181</td><td> 1196</td><td> 10414</td><td> 10429</td><td> GGATGAGCCCGCGGTC</td><td> 56</td><td> 313</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 76</td><td> 39</td>

<td> 728593</td><td> 853</td><td> 868</td><td> 9893</td><td> 9908</td><td> GACCTCAGAGAGAAGC</td><td> 10</td><td> 314</td>

<td> 728594</td><td> 862</td><td> 877</td><td> 9902</td><td> 9917</td><td> AGGCTCCAGGACCTCA</td><td> 7</td><td> 315</td>

<td> 728595</td><td> 902</td><td> 917</td><td> 9942</td><td> 9957</td><td> GCTGTTCGCCTGCAGG</td><td> 59</td><td> 316</td>

<td> 728596</td><td> 904</td><td> 919</td><td> 9944</td><td> 9959</td><td> GAGCTGTTCGCCTGCA</td><td> 14</td><td> 317</td>

<td> 728597</td><td> 906</td><td> 921</td><td> 9946</td><td> 9961</td><td> AGGAGCTGTTCGCCTG</td><td> 4</td><td> 318</td>

<td> 728598</td><td> 908</td><td> 923</td><td> 9948</td><td> 9963</td><td> GCAGGAGCTGTTCGCC</td><td> 44</td><td> 319</td>

<td> 728599</td><td> 909</td><td> 924</td><td> 9949</td><td> 9964</td><td> GGCAGGAGCTGTTCGC</td><td> 30</td><td> 320</td>

<td> 728600</td><td> 910</td><td> 925</td><td> 9950</td><td> 9965</td><td> TGGCAGGAGCTGTTCG</td><td> 15</td><td> 321</td>

<td> 728601</td><td> 911</td><td> 926</td><td> 9951</td><td> 9966</td><td> CTGGCAGGAGCTGTTC</td><td> 34</td><td> 322</td>

<td> 728602</td><td> 912</td><td> 927</td><td> 9952</td><td> 9967</td><td> TCTGGCAGGAGCTGTT</td><td> 33</td><td> 323</td>

<td> 728603</td><td> 914</td><td> 929</td><td> 9954</td><td> 9969</td><td> GGTCTGGCAGGAGCTG</td><td> 49</td><td> 324</td>

<td> 728604</td><td> 915</td><td> 930</td><td> 9955</td><td> 9970</td><td> AGGTCTGGCAGGAGCT</td><td> 60</td><td> 325</td>

<td> 728605</td><td> 916</td><td> 931</td><td> 9956</td><td> 9971</td><td> CAGGTCTGGCAGGAGC</td><td> 53</td><td> 326</td>

<td> 728606</td><td> 918</td><td> 933</td><td> 9958</td><td> 9973</td><td> AGCAGGTCTGGCAGGA</td><td> 35</td><td> 327</td>

<td> 728607</td><td> 922</td><td> 937</td><td> 9962</td><td> 9977</td><td> GATCAGCAGGTCTGGC</td><td> 17</td><td> 328</td>

<td> 728608</td><td> 924</td><td> 939</td><td> 9964</td><td> 9979</td><td> CTGATCAGCAGGTCTG</td><td> 34</td><td> 329</td>

<td> 728609</td><td> 926</td><td> 941</td><td> 9966</td><td> 9981</td><td> GGCTGATCAGCAGGTC</td><td> 38</td><td> 330</td>

<td> 728610</td><td> 945</td><td> 960</td><td> N/A</td><td> N/A</td><td> GTCAGAGGCAGCATGT</td><td> 24</td><td> 331</td>

<td> 728611</td><td> 947</td><td> 962</td><td> N/A</td><td> N/A</td><td> CGGTCAGAGGCAGCAT</td><td> 54</td><td> 332</td>

<td> 728612</td><td> 949</td><td> 964</td><td> N/A</td><td> N/A</td><td> GTCGGTCAGAGGCAGC</td><td> 44</td><td> 333</td>

<td> 728613</td><td> 952</td><td> 967</td><td> N/A</td><td> N/A</td><td> CAGGTCGGTCAGAGGC</td><td> 47</td><td> 334</td>

<td> 728614</td><td> 954</td><td> 969</td><td> N/A</td><td> N/A</td><td> TCCAGGTCGGTCAGAG</td><td> 24</td><td> 335</td>

<td> 728615</td><td> 1001</td><td> 1016</td><td> 10234</td><td> 10249</td><td> TGATGGTGAGGGCCCG</td><td> 18</td><td> 336</td>

<td> 728616</td><td> 1003</td><td> 1018</td><td> 10236</td><td> 10251</td><td> GCTGATGGTGAGGGCC</td><td> 14</td><td> 337</td>

<td> 728617</td><td> 1005</td><td> 1020</td><td> 10238</td><td> 10253</td><td> TTGCTGATGGTGAGGG</td><td> 37</td><td> 338</td>

<td> 728618</td><td> 1024</td><td> 1039</td><td> 10257</td><td> 10272</td><td> GAGCCGGCAGCCATGG</td><td> 13</td><td> 339</td>

<td> 728619</td><td> 1032</td><td> 1047</td><td> 10265</td><td> 10280</td><td> CTGTAGAAGAGCCGGC</td><td> 0</td><td> 340</td>

<td> 728620</td><td> 1034</td><td> 1049</td><td> 10267</td><td> 10282</td><td> GGCTGTAGAAGAGCCG</td><td> 0</td><td> 341</td>

<td> 728621</td><td> 1036</td><td> 1051</td><td> 10269</td><td> 10284</td><td> CTGGCTGTAGAAGAGC</td><td> 21</td><td> 342</td>

<td> 728622</td><td> 1038</td><td> 1053</td><td> 10271</td><td> 10286</td><td> AGCTGGCTGTAGAAGA</td><td> 9</td><td> 343</td>

<td> 728623</td><td> 1040</td><td> 1055</td><td> 10273</td><td> 10288</td><td> CCAGCTGGCTGTAGAA</td><td> 5</td><td> 344</td>

<td> 728624</td><td> 1067</td><td> 1082</td><td> 10300</td><td> 10315</td><td> AGAGTTCCACCTGCTC</td><td> 23</td><td> 345</td>

<td> 728625</td><td> 1069</td><td> 1084</td><td> 10302</td><td> 10317</td><td> GAAGAGTTCCACCTGC</td><td> 14</td><td> 346</td>

<td> 728626</td><td> 1072</td><td> 1087</td><td> 10305</td><td> 10320</td><td> GCCGAAGAGTTCCACC</td><td> 22</td><td> 347</td>

<td> 728627</td><td> 1074</td><td> 1089</td><td> 10307</td><td> 10322</td><td> GGGCCGAAGAGTTCCA</td><td> 13</td><td> 348</td>

<td> 728628</td><td> 1091</td><td> 1106</td><td> 10324</td><td> 10339</td><td> CTTGCTCCAGGCTTAT</td><td> 24</td><td> 349</td>

<td> 728629</td><td> 1093</td><td> 1108</td><td> 10326</td><td> 10341</td><td> CACTTGCTCCAGGCTT</td><td> 46</td><td> 350</td>

<td> 728630</td><td> 1094</td><td> 1109</td><td> 10327</td><td> 10342</td><td> GCACTTGCTCCAGGCT</td><td> 66</td><td> 351</td>

<td> 728631</td><td> 1095</td><td> 1110</td><td> 10328</td><td> 10343</td><td> CGCACTTGCTCCAGGC</td><td> 62</td><td> 352</td>

<td> 728632</td><td> 1097</td><td> 1112</td><td> 10330</td><td> 10345</td><td> AGCGCACTTGCTCCAG</td><td> 55</td><td> 353</td>

<td> 728633</td><td> 1099</td><td> 1114</td><td> 10332</td><td> 10347</td><td> GAAGCGCACTTGCTCC</td><td> 43</td><td> 354</td>

<td> 728634</td><td> 1100</td><td> 1115</td><td> 10333</td><td> 10348</td><td> GGAAGCGCACTTGCTC</td><td> 57</td><td> 355</td>

<td> 728635</td><td> 1101</td><td> 1116</td><td> 10334</td><td> 10349</td><td> GGGAAGCGCACTTGCT</td><td> 59</td><td> 356</td>

<td> 728636</td><td> 1117</td><td> 1132</td><td> 10350</td><td> 10365</td><td> GATGTCCTCAGGGCTG</td><td> 22</td><td> 357</td>

<td> 728637</td><td> 1134</td><td> 1149</td><td> 10367</td><td> 10382</td><td> CGCTGCTTGTCACTGG</td><td> 67</td><td> 358</td>

<td> 728638</td><td> 1161</td><td> 1176</td><td> 10394</td><td> 10409</td><td> ACATCCAGCAGCTGGT</td><td> 0</td><td> 359</td>

<td> 728639</td><td> 1163</td><td> 1178</td><td> 10396</td><td> 10411</td><td> GGACATCCAGCAGCTG</td><td> 8</td><td> 360</td>

<td> 728640</td><td> 1170</td><td> 1185</td><td> 10403</td><td> 10418</td><td> CGGTCCAGGACATCCA</td><td> 32</td><td> 361</td>

<td> 728641</td><td> 1172</td><td> 1187</td><td> 10405</td><td> 10420</td><td> CGCGGTCCAGGACATC</td><td> 47</td><td> 362</td>

<td> 728642</td><td> 1174</td><td> 1189</td><td> 10407</td><td> 10422</td><td> CCCGCGGTCCAGGACA</td><td> 11</td><td> 363</td>

<td> 728643</td><td> 1176</td><td> 1191</td><td> 10409</td><td> 10424</td><td> AGCCCGCGGTCCAGGA</td><td> 20</td><td> 364</td>

<td> 728644</td><td> 1177</td><td> 1192</td><td> 10410</td><td> 10425</td><td> GAGCCCGCGGTCCAGG</td><td> 48</td><td> 365</td>

<td> 728645</td><td> 1179</td><td> 1194</td><td> 10412</td><td> 10427</td><td> ATGAGCCCGCGGTCCA</td><td> 44</td><td> 366</td>

<td> 728646</td><td> 1180</td><td> 1195</td><td> 10413</td><td> 10428</td><td> GATGAGCCCGCGGTCC</td><td> 59</td><td> 367</td>

<td> 728647</td><td> 1182</td><td> 1197</td><td> 10415</td><td> 10430</td><td> AGGATGAGCCCGCGGT</td><td> 49</td><td> 368</td>

<td> 728648</td><td> 1183</td><td> 1198</td><td> 10416</td><td> 10431</td><td> GAGGATGAGCCCGCGG</td><td> 36</td><td> 369</td>

<td> 728649</td><td> 1184</td><td> 1199</td><td> 10417</td><td> 10432</td><td> GGAGGATGAGCCCGCG</td><td> 14</td><td> 370</td>

<td> 728650</td><td> 1185</td><td> 1200</td><td> 10418</td><td> 10433</td><td> TGGAGGATGAGCCCGC</td><td> 27</td><td> 371</td>

<td> 728651</td><td> 1186</td><td> 1201</td><td> 10419</td><td> 10434</td><td> CTGGAGGATGAGCCCG</td><td> 17</td><td> 372</td>

<td> 728652</td><td> 1188</td><td> 1203</td><td> 10421</td><td> 10436</td><td> AGCTGGAGGATGAGCC</td><td> 0</td><td> 373</td>

<td> 728653</td><td> 1190</td><td> 1205</td><td> 10423</td><td> 10438</td><td> GTAGCTGGAGGATGAG</td><td> 13</td><td> 374</td>

<td> 728654</td><td> 1192</td><td> 1207</td><td> 10425</td><td> 10440</td><td> CTGTAGCTGGAGGATG</td><td> 3</td><td> 375</td>

<td> 728655</td><td> 1194</td><td> 1209</td><td> 10427</td><td> 10442</td><td> CCCTGTAGCTGGAGGA</td><td> 4</td><td> 376</td>

<td> 728656</td><td> 1196</td><td> 1211</td><td> 10429</td><td> 10444</td><td> GGCCCTGTAGCTGGAG</td><td> 24</td><td> 377</td>

<td> 728657</td><td> 1198</td><td> 1213</td><td> 10431</td><td> 10446</td><td> CTGGCCCTGTAGCTGG</td><td> 9</td><td> 378</td>

<td> 728658</td><td> 1201</td><td> 1216</td><td> 10434</td><td> 10449</td><td> GTCCTGGCCCTGTAGC</td><td> 25</td><td> 379</td>

<td> 728659</td><td> 1203</td><td> 1218</td><td> 10436</td><td> 10451</td><td> AGGTCCTGGCCCTGTA</td><td> 43</td><td> 380</td>

<td> 728660</td><td> 1205</td><td> 1220</td><td> 10438</td><td> 10453</td><td> AAAGGTCCTGGCCCTG</td><td> 23</td><td> 381</td>

<td> 728661</td><td> 1207</td><td> 1222</td><td> 10440</td><td> 10455</td><td> ATAAAGGTCCTGGCCC</td><td> 10</td><td> 382</td>

<td> 728662</td><td> 1209</td><td> 1224</td><td> 10442</td><td> 10457</td><td> GCATAAAGGTCCTGGC</td><td> 31</td><td> 383</td>

<td> 728663</td><td> 1211</td><td> 1226</td><td> 10444</td><td> 10459</td><td> TGGCATAAAGGTCCTG</td><td> 46</td><td> 384</td>

<td> 728664</td><td> 1213</td><td> 1228</td><td> 10446</td><td> 10461</td><td> GATGGCATAAAGGTCC</td><td> 42</td><td> 385</td>

<td> 728665</td><td> 1215</td><td> 1230</td><td> 10448</td><td> 10463</td><td> CGGATGGCATAAAGGT</td><td> 39</td><td> 386</td>

Table 6

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665892</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACACAGGCGGA</td><td> 68</td><td> 387</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 65</td><td> 39</td>

<td> 665894</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACACAGGCG</td><td> 42</td><td> 388</td>

<td> 665895</td><td> 1242</td><td> 1257</td><td> 10475</td><td> 10490</td><td> CTCCAGAACACCTTGC</td><td> 44</td><td> 389</td>

<td> 665900</td><td> 1272</td><td> 1287</td><td> 10505</td><td> 10520</td><td> CATGAGTCATGGGCTG</td><td> 54</td><td> 390</td>

<td> 665902</td><td> 1301</td><td> 1316</td><td> 10534</td><td> 10549</td><td> TCTTGACCTCCCGCTG</td><td> 37</td><td> 391</td>

<td> 665903</td><td> 1309</td><td> 1324</td><td> 10542</td><td> 10557</td><td> AAGCTTGGTCTTGACC</td><td> 49</td><td> 392</td>

<td> 665908</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCCTTTTGG</td><td> 66</td><td> 393</td>

<td> 728666</td><td> 1217</td><td> 1232</td><td> 10450</td><td> 10465</td><td> GGCGGATGGCATAAAG</td><td> 32</td><td> 394</td>

<td> 728667</td><td> 1223</td><td> 1238</td><td> 10456</td><td> 10471</td><td> GACACAGGCGGATGGC</td><td> 49</td><td> 395</td>

<td> 728668</td><td> 1224</td><td> 1239</td><td> 10457</td><td> 10472</td><td> TGACACAGGCGGATGG</td><td> 27</td><td> 396</td>

<td> 728669</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACAGGCGGAT</td><td> 51</td><td> 397</td>

<td> 728670</td><td> 1230</td><td> 1245</td><td> 10463</td><td> 10478</td><td> TTGCACTGACACAGGC</td><td> 68</td><td> 398</td>

<td> 728671</td><td> 1231</td><td> 1246</td><td> 10464</td><td> 10479</td><td> CTTGCACTGACACAGG</td><td> 42</td><td> 399</td>

<td> 728672</td><td> 1232</td><td> 1247</td><td> 10465</td><td> 10480</td><td> CCTTGCACTGACACAG</td><td> 56</td><td> 400</td>

<td> 728673</td><td> 1233</td><td> 1248</td><td> 10466</td><td> 10481</td><td> ACCTTGCACTGACACA</td><td> 60</td><td> 401</td>

<td> 728674</td><td> 1234</td><td> 1249</td><td> 10467</td><td> 10482</td><td> CACCTTGCACTGACAC</td><td> 57</td><td> 402</td>

<td> 728675</td><td> 1237</td><td> 1252</td><td> 10470</td><td> 10485</td><td> GAACACCTTGCACTGA</td><td> 34</td><td> 403</td>

<td> 728676</td><td> 1238</td><td> 1253</td><td> 10471</td><td> 10486</td><td> AGAACACCTTGCACTG</td><td> 39</td><td> 404</td>

<td> 728677</td><td> 1239</td><td> 1254</td><td> 10472</td><td> 10487</td><td> CAGAACACCTTGCACT</td><td> 25</td><td> 405</td>

<td> 728678</td><td> 1240</td><td> 1255</td><td> 10473</td><td> 10488</td><td> CCAGAACACCTTGCAC</td><td> 30</td><td> 406</td>

<td> 728679</td><td> 1241</td><td> 1256</td><td> 10474</td><td> 10489</td><td> TCCAGAACACCTTGCA</td><td> 39</td><td> 407</td>

<td> 728680</td><td> 1243</td><td> 1258</td><td> 10476</td><td> 10491</td><td> GCTCCAGAACACCTTG</td><td> 39</td><td> 408</td>

<td> 728681</td><td> 1244</td><td> 1259</td><td> 10477</td><td> 10492</td><td> CGCTCCAGAACACCTT</td><td> 59</td><td> 409</td>

<td> 728682</td><td> 1245</td><td> 1260</td><td> 10478</td><td> 10493</td><td> CCGCTCCAGAACACCT</td><td> 37</td><td> 410</td>

<td> 728683</td><td> 1246</td><td> 1261</td><td> 10479</td><td> 10494</td><td> CCCGCTCCAGAACACC</td><td> 41</td><td> 411</td>

<td> 728684</td><td> 1247</td><td> 1262</td><td> 10480</td><td> 10495</td><td> GCCCGCTCCAGAACAC</td><td> 19</td><td> 412</td>

<td> 728685</td><td> 1249</td><td> 1264</td><td> 10482</td><td> 10497</td><td> AGGCCCGCTCCAGAAC</td><td> 24</td><td> 413</td>

<td> 728686</td><td> 1251</td><td> 1266</td><td> 10484</td><td> 10499</td><td> CAAGGCCCGCTCCAGA</td><td> 28</td><td> 414</td>

<td> 728687</td><td> 1253</td><td> 1268</td><td> 10486</td><td> 10501</td><td> CACAAGGCCCGCTCCA</td><td> 16</td><td> 415</td>

<td> 728688</td><td> 1255</td><td> 1270</td><td> 10488</td><td> 10503</td><td> GGCACAAGGCCCGCTC</td><td> 12</td><td> 416</td>

<td> 728689</td><td> 1257</td><td> 1272</td><td> 10490</td><td> 10505</td><td> GAGGCACAAGGCCCGC</td><td> 17</td><td> 417</td>

<td> 728690</td><td> 1259</td><td> 1274</td><td> 10492</td><td> 10507</td><td> CTGAGGCACAAGGCCC</td><td> 13</td><td> 418</td>

<td> 728691</td><td> 1264</td><td> 1279</td><td> 10497</td><td> 10512</td><td> ATGGGCTGAGGCACAA</td><td> 42</td><td> 419</td>

<td> 728692</td><td> 1267</td><td> 1282</td><td> 10500</td><td> 10515</td><td> GTCATGGGCTGAGGCA</td><td> 51</td><td> 420</td>

<td> 728693</td><td> 1268</td><td> 1283</td><td> 10501</td><td> 10516</td><td> AGTCATGGGCTGAGGC</td><td> 52</td><td> 421</td>

<td> 728694</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGGCTGAGG</td><td> 59</td><td> 422</td>

<td> 728695</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGGGCTGAG</td><td> 67</td><td> 423</td>

<td> 728696</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATGGGCTGA</td><td> 75</td><td> 424</td>

<td> 728697</td><td> 1273</td><td> 1288</td><td> 10506</td><td> 10521</td><td> GCATGAGTCATGGGCT</td><td> 23</td><td> 425</td>

<td> 728698</td><td> 1274</td><td> 1289</td><td> 10507</td><td> 10522</td><td> GGCATGAGTCATGGGC</td><td> 47</td><td> 426</td>

<td> 728699</td><td> 1296</td><td> 1311</td><td> 10529</td><td> 10544</td><td> ACCTCCCGCTGGATGG</td><td> 45</td><td> 427</td>

<td> 728700</td><td> 1297</td><td> 1312</td><td> 10530</td><td> 10545</td><td> GACCTCCCGCTGGATG</td><td> 38</td><td> 428</td>

<td> 728701</td><td> 1298</td><td> 1313</td><td> 10531</td><td> 10546</td><td> TGACCTCCCGCTGGAT</td><td> 53</td><td> 429</td>

<td> 728702</td><td> 1299</td><td> 1314</td><td> 10532</td><td> 10547</td><td> TTGACCTCCCGCTGGA</td><td> 38</td><td> 430</td>

<td> 728703</td><td> 1300</td><td> 1315</td><td> 10533</td><td> 10548</td><td> CTTGACCTCCCGCTGG</td><td> 33</td><td> 431</td>

<td> 728704</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCTCCCGCT</td><td> 56</td><td> 432</td>

<td> 728705</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACCTCCCGC</td><td> 71</td><td> 433</td>

<td> 728706</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTGACCTCC</td><td> 73</td><td> 434</td>

<td> 728707</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTTGACCTC</td><td> 79</td><td> 435</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCTTGACCT</td><td> 79</td><td> 436</td>

<td> 728709</td><td> 1310</td><td> 1325</td><td> 10543</td><td> 10558</td><td> AAAGCTTGGTCTTGAC</td><td> 46</td><td> 437</td>

<td> 728710</td><td> 1311</td><td> 1326</td><td> 10544</td><td> 10559</td><td> AAAAGCTTGGTCTTGA</td><td> 29</td><td> 438</td>

<td> 728711</td><td> 1312</td><td> 1327</td><td> 10545</td><td> 10560</td><td> GAAAAGCTTGGTCTTG</td><td> 24</td><td> 439</td>

<td> 728712</td><td> 1313</td><td> 1328</td><td> 10546</td><td> 10561</td><td> TGAAAAGCTTGGTCTT</td><td> 11</td><td> 440</td>

<td> 728713</td><td> 1314</td><td> 1329</td><td> 10547</td><td> 10562</td><td> CTGAAAAGCTTGGTCT</td><td> 13</td><td> 441</td>

<td> 728714</td><td> 1316</td><td> 1331</td><td> 10549</td><td> 10564</td><td> GGCTGAAAAGCTTGGT</td><td> 11</td><td> 442</td>

<td> 728715</td><td> 1318</td><td> 1333</td><td> 10551</td><td> 10566</td><td> CAGGCTGAAAAGCTTG</td><td> 1</td><td> 443</td>

<td> 728716</td><td> 1320</td><td> 1335</td><td> 10553</td><td> 10568</td><td> TCCAGGCTGAAAAGCT</td><td> 5</td><td> 444</td>

<td> 728717</td><td> 1340</td><td> 1355</td><td> N/A</td><td> N/A</td><td> TGAGCTCATTGAGAAA</td><td> 10</td><td> 445</td>

<td> 728718</td><td> 1342</td><td> 1357</td><td> N/A</td><td> N/A</td><td> GATGAGCTCATTGAGA</td><td> 33</td><td> 446</td>

<td> 728719</td><td> 1344</td><td> 1359</td><td> N/A</td><td> N/A</td><td> AGGATGAGCTCATTGA</td><td> 55</td><td> 447</td>

<td> 728720</td><td> 1346</td><td> 1361</td><td> N/A</td><td> N/A</td><td> ACAGGATGAGCTCATT</td><td> 41</td><td> 448</td>

<td> 728721</td><td> 1348</td><td> 1363</td><td> N/A</td><td> N/A</td><td> GAACAGGATGAGCTCA</td><td> 45</td><td> 449</td>

<td> 728722</td><td> 1350</td><td> 1365</td><td> 10671</td><td> 10686</td><td> TGGAACAGGATGAGCT</td><td> 47</td><td> 450</td>

<td> 728723</td><td> 1358</td><td> 1373</td><td> 10679</td><td> 10694</td><td> GGCCCTTTTGGAACAG</td><td> 29</td><td> 451</td>

<td> 728724</td><td> 1359</td><td> 1374</td><td> 10680</td><td> 10695</td><td> TGGCCCTTTTGGAACA</td><td> 34</td><td> 452</td>

<td> 728725</td><td> 1360</td><td> 1375</td><td> 10681</td><td> 10696</td><td> CTGGCCCTTTTGGAAC</td><td> 20</td><td> 453</td>

<td> 728726</td><td> 1361</td><td> 1376</td><td> 10682</td><td> 10697</td><td> TCTGGCCCTTTTGGAA</td><td> 14</td><td> 454</td>

<td> 728727</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCTTTTGGA</td><td> 33</td><td> 455</td>

<td> 728728</td><td> 1364</td><td> 1379</td><td> 10685</td><td> 10700</td><td> TGGTCTGGCCCTTTTG</td><td> 56</td><td> 456</td>

<td> 728729</td><td> 1365</td><td> 1380</td><td> 10686</td><td> 10701</td><td> TTGGTCTGGCCCTTTT</td><td> 54</td><td> 457</td>

<td> 728730</td><td> 1366</td><td> 1381</td><td> 10687</td><td> 10702</td><td> GTTGGTCTGGCCCTTT</td><td> 53</td><td> 458</td>

<td> 728731</td><td> 1367</td><td> 1382</td><td> 10688</td><td> 10703</td><td> TGTTGGTCTGGCCCTT</td><td> 50</td><td> 459</td>

<td> 728732</td><td> 1368</td><td> 1383</td><td> 10689</td><td> 10704</td><td> GTGTTGGTCTGGCCCT</td><td> 47</td><td> 460</td>

<td> 728733</td><td> 1386</td><td> 1401</td><td> 10707</td><td> 10722</td><td> ATCTCGAAGGGTGGTG</td><td> 40</td><td> 461</td>

<td> 728734</td><td> 1389</td><td> 1404</td><td> 10710</td><td> 10725</td><td> AAGATCTCGAAGGGTG</td><td> 52</td><td> 462</td>

<td> 728735</td><td> 1392</td><td> 1407</td><td> 10713</td><td> 10728</td><td> AAGAAGATCTCGAAGG</td><td> 28</td><td> 463</td>

Table 7

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 73</td><td> 39</td>

<td> 665925</td><td> 1506</td><td> 1521</td><td> 11071</td><td> 11086</td><td> GATAGCTCCCCTGAGA</td><td> 29</td><td> 464</td>

<td> 665926</td><td> 1512</td><td> 1527</td><td> 11077</td><td> 11092</td><td> GACCAAGATAGCTCCC</td><td> 50</td><td> 465</td>

<td> 665929</td><td> 1530</td><td> 1545</td><td> 11095</td><td> 11110</td><td> AGCCGGATACTATCAG</td><td> 49</td><td> 466</td>

<td> 665930</td><td> 1536</td><td> 1551</td><td> 11101</td><td> 11116</td><td> ATCTGTAGCCGGATAC</td><td> 39</td><td> 467</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 62</td><td> 468</td>

<td> 728736</td><td> 1394</td><td> 1409</td><td> 10715</td><td> 10730</td><td> AGAAGAAGATCTCGAA</td><td> 13</td><td> 469</td>

<td> 728737</td><td> 1396</td><td> 1411</td><td> 10717</td><td> 10732</td><td> GCAGAAGAAGATCTCG</td><td> 45</td><td> 470</td>

<td> 728738</td><td> 1419</td><td> 1434</td><td> 10740</td><td> 10755</td><td> CGGTCAGGCCATTCTT</td><td> 52</td><td> 471</td>

<td> 728739</td><td> 1421</td><td> 1436</td><td> 10742</td><td> 10757</td><td> TGCGGTCAGGCCATTC</td><td> 68</td><td> 472</td>

<td> 728740</td><td> 1423</td><td> 1438</td><td> 10744</td><td> 10759</td><td> TTTGCGGTCAGGCCAT</td><td> 37</td><td> 473</td>

<td> 728741</td><td> 1426</td><td> 1441</td><td> 10747</td><td> 10762</td><td> GGGTTTGCGGTCAGGC</td><td> 71</td><td> 474</td>

<td> 728742</td><td> 1441</td><td> 1456</td><td> 10762</td><td> 10777</td><td> GAGCTTCTTCTCTCGG</td><td> 22</td><td> 475</td>

<td> 728743</td><td> 1443</td><td> 1458</td><td> 10764</td><td> 10779</td><td> ATGAGCTTCTTCTCTC</td><td> 0</td><td> 476</td>

<td> 728744</td><td> 1445</td><td> 1460</td><td> 10766</td><td> 10781</td><td> TAATGAGCTTCTTCTC</td><td> 14</td><td> 477</td>

<td> 728745</td><td> 1447</td><td> 1462</td><td> 10768</td><td> 10783</td><td> AGTAATGAGCTTCTTC</td><td> 36</td><td> 478</td>

<td> 728746</td><td> 1449</td><td> 1464</td><td> 10770</td><td> 10785</td><td> ACAGTAATGAGCTTCT</td><td> 30</td><td> 479</td>

<td> 728747</td><td> 1451</td><td> 1466</td><td> 10772</td><td> 10787</td><td> GTACAGTAATGAGCTT</td><td> 26</td><td> 480</td>

<td> 728748</td><td> 1453</td><td> 1468</td><td> 10774</td><td> 10789</td><td> CTGTACAGTAATGAGC</td><td> 37</td><td> 481</td>

<td> 728749</td><td> 1455</td><td> 1470</td><td> 10776</td><td> 10791</td><td> ACCTGTACAGTAATGA</td><td> 28</td><td> 482</td>

<td> 728750</td><td> 1457</td><td> 1472</td><td> N/A</td><td> N/A</td><td> CCACCTGTACAGTAAT</td><td> 27</td><td> 483</td>

<td> 728751</td><td> 1459</td><td> 1474</td><td> N/A</td><td> N/A</td><td> CACCACCTGTACAGTA</td><td> 42</td><td> 484</td>

<td> 728752</td><td> 1461</td><td> 1476</td><td> N/A</td><td> N/A</td><td> GGCACCACCTGTACAG</td><td> 27</td><td> 485</td>

<td> 728753</td><td> 1463</td><td> 1478</td><td> N/A</td><td> N/A</td><td> CAGGCACCACCTGTAC</td><td> 53</td><td> 486</td>

<td> 728754</td><td> 1465</td><td> 1480</td><td> N/A</td><td> N/A</td><td> TACAGGCACCACCTGT</td><td> 0</td><td> 487</td>

<td> 728755</td><td> 1467</td><td> 1482</td><td> 11032</td><td> 11047</td><td> GCTACAGGCACCACCT</td><td> 37</td><td> 488</td>

<td> 728756</td><td> 1469</td><td> 1484</td><td> 11034</td><td> 11049</td><td> CTGCTACAGGCACCAC</td><td> 53</td><td> 489</td>

<td> 728757</td><td> 1471</td><td> 1486</td><td> 11036</td><td> 11051</td><td> AGCTGCTACAGGCACC</td><td> 41</td><td> 490</td>

<td> 728758</td><td> 1473</td><td> 1488</td><td> 11038</td><td> 11053</td><td> CGAGCTGCTACAGGCA</td><td> 54</td><td> 491</td>

<td> 728759</td><td> 1475</td><td> 1490</td><td> 11040</td><td> 11055</td><td> GTCGAGCTGCTACAGG</td><td> 63</td><td> 492</td>

<td> 728760</td><td> 1477</td><td> 1492</td><td> 11042</td><td> 11057</td><td> CAGTCGAGCTGCTACA</td><td> 34</td><td> 493</td>

<td> 728761</td><td> 1479</td><td> 1494</td><td> 11044</td><td> 11059</td><td> AGCAGTCGAGCTGCTA</td><td> 3</td><td> 494</td>

<td> 728762</td><td> 1481</td><td> 1496</td><td> 11046</td><td> 11061</td><td> GCAGCAGTCGAGCTGC</td><td> 13</td><td> 495</td>

<td> 728763</td><td> 1483</td><td> 1498</td><td> 11048</td><td> 11063</td><td> CAGCAGCAGTCGAGCT</td><td> 16</td><td> 496</td>

<td> 728764</td><td> 1485</td><td> 1500</td><td> 11050</td><td> 11065</td><td> TCCAGCAGCAGTCGAG</td><td> 23</td><td> 497</td>

<td> 728765</td><td> 1487</td><td> 1502</td><td> 11052</td><td> 11067</td><td> TCTCCAGCAGCAGTCG</td><td> 30</td><td> 498</td>

<td> 728766</td><td> 1489</td><td> 1504</td><td> 11054</td><td> 11069</td><td> CATCTCCAGCAGCAGT</td><td> 31</td><td> 499</td>

<td> 728767</td><td> 1492</td><td> 1507</td><td> 11057</td><td> 11072</td><td> GAACATCTCCAGCAGC</td><td> 47</td><td> 500</td>

<td> 728768</td><td> 1495</td><td> 1510</td><td> 11060</td><td> 11075</td><td> TGAGAACATCTCCAGC</td><td> 33</td><td> 501</td>

<td> 728769</td><td> 1497</td><td> 1512</td><td> 11062</td><td> 11077</td><td> CCTGAGAACATCTCCA</td><td> 60</td><td> 502</td>

<td> 728770</td><td> 1499</td><td> 1514</td><td> 11064</td><td> 11079</td><td> CCCCTGAGAACATCTC</td><td> 43</td><td> 503</td>

<td> 728771</td><td> 1501</td><td> 1516</td><td> 11066</td><td> 11081</td><td> CTCCCCTGAGAACATC</td><td> 42</td><td> 504</td>

<td> 728772</td><td> 1502</td><td> 1517</td><td> 11067</td><td> 11082</td><td> GCTCCCCTGAGAACAT</td><td> 55</td><td> 505</td>

<td> 728773</td><td> 1503</td><td> 1518</td><td> 11068</td><td> 11083</td><td> AGCTCCCCTGAGAACA</td><td> 54</td><td> 506</td>

<td> 728774</td><td> 1504</td><td> 1519</td><td> 11069</td><td> 11084</td><td> TAGCTCCCCTGAGAAC</td><td> 29</td><td> 507</td>

<td> 728775</td><td> 1505</td><td> 1520</td><td> 11070</td><td> 11085</td><td> ATAGCTCCCCTGAGAA</td><td> 15</td><td> 508</td>

<td> 728776</td><td> 1507</td><td> 1522</td><td> 11072</td><td> 11087</td><td> AGATAGCTCCCCTGAG</td><td> 42</td><td> 509</td>

<td> 728777</td><td> 1508</td><td> 1523</td><td> 11073</td><td> 11088</td><td> AAGATAGCTCCCCTGA</td><td> 52</td><td> 510</td>

<td> 728778</td><td> 1509</td><td> 1524</td><td> 11074</td><td> 11089</td><td> CAAGATAGCTCCCCTG</td><td> 64</td><td> 511</td>

<td> 728779</td><td> 1510</td><td> 1525</td><td> 11075</td><td> 11090</td><td> CCAAGATAGCTCCCCT</td><td> 50</td><td> 512</td>

<td> 728780</td><td> 1511</td><td> 1526</td><td> 11076</td><td> 11091</td><td> ACCAAGATAGCTCCCC</td><td> 21</td><td> 513</td>

<td> 728781</td><td> 1513</td><td> 1528</td><td> 11078</td><td> 11093</td><td> TGACCAAGATAGCTCC</td><td> 43</td><td> 514</td>

<td> 728782</td><td> 1514</td><td> 1529</td><td> 11079</td><td> 11094</td><td> CTGACCAAGATAGCTC</td><td> 51</td><td> 515</td>

<td> 728783</td><td> 1515</td><td> 1530</td><td> 11080</td><td> 11095</td><td> GCTGACCAAGATAGCT</td><td> 23</td><td> 516</td>

<td> 728784</td><td> 1516</td><td> 1531</td><td> 11081</td><td> 11096</td><td> AGCTGACCAAGATAGC</td><td> 31</td><td> 517</td>

<td> 728785</td><td> 1517</td><td> 1532</td><td> 11082</td><td> 11097</td><td> CAGCTGACCAAGATAG</td><td> 34</td><td> 518</td>

<td> 728786</td><td> 1519</td><td> 1534</td><td> 11084</td><td> 11099</td><td> ATCAGCTGACCAAGAT</td><td> 28</td><td> 519</td>

<td> 728787</td><td> 1521</td><td> 1536</td><td> 11086</td><td> 11101</td><td> CTATCAGCTGACCAAG</td><td> 48</td><td> 520</td>

<td> 728788</td><td> 1523</td><td> 1538</td><td> 11088</td><td> 11103</td><td> TACTATCAGCTGACCA</td><td> 49</td><td> 521</td>

<td> 728789</td><td> 1525</td><td> 1540</td><td> 11090</td><td> 11105</td><td> GATACTATCAGCTGAC</td><td> 58</td><td> 522</td>

<td> 728790</td><td> 1526</td><td> 1541</td><td> 11091</td><td> 11106</td><td> GGATACTATCAGCTGA</td><td> 51</td><td> 523</td>

<td> 728791</td><td> 1527</td><td> 1542</td><td> 11092</td><td> 11107</td><td> CGGATACTATCAGCTG</td><td> 55</td><td> 524</td>

<td> 728792</td><td> 1528</td><td> 1543</td><td> 11093</td><td> 11108</td><td> CCGGATACTATCAGCT</td><td> 41</td><td> 525</td>

<td> 728793</td><td> 1529</td><td> 1544</td><td> 11094</td><td> 11109</td><td> GCCGGATACTATCAGC</td><td> 68</td><td> 526</td>

<td> 728794</td><td> 1531</td><td> 1546</td><td> 11096</td><td> 11111</td><td> TAGCCGGATACTATCA</td><td> 40</td><td> 527</td>

<td> 728795</td><td> 1532</td><td> 1547</td><td> 11097</td><td> 11112</td><td> GTAGCCGGATACTATC</td><td> 48</td><td> 528</td>

<td> 728796</td><td> 1533</td><td> 1548</td><td> 11098</td><td> 11113</td><td> TGTAGCCGGATACTAT</td><td> 34</td><td> 529</td>

<td> 728797</td><td> 1534</td><td> 1549</td><td> 11099</td><td> 11114</td><td> CTGTAGCCGGATACTA</td><td> 52</td><td> 530</td>

<td> 728798</td><td> 1535</td><td> 1550</td><td> 11100</td><td> 11115</td><td> TCTGTAGCCGGATACT</td><td> 53</td><td> 531</td>

<td> 728799</td><td> 1537</td><td> 1552</td><td> 11102</td><td> 11117</td><td> GATCTGTAGCCGGATA</td><td> 46</td><td> 532</td>

<td> 728800</td><td> 1538</td><td> 1553</td><td> 11103</td><td> 11118</td><td> AGATCTGTAGCCGGAT</td><td> 67</td><td> 533</td>

<td> 728801</td><td> 1543</td><td> 1558</td><td> 11108</td><td> 11123</td><td> GTTTGAGATCTGTAGC</td><td> 55</td><td> 534</td>

<td> 728802</td><td> 1556</td><td> 1571</td><td> 11121</td><td> 11136</td><td> CTTTGAGGTCTGGGTT</td><td> 63</td><td> 535</td>

<td> 728803</td><td> 1557</td><td> 1572</td><td> 11122</td><td> 11137</td><td> TCTTTGAGGTCTGGGT</td><td> 55</td><td> 536</td>

<td> 728804</td><td> 1558</td><td> 1573</td><td> 11123</td><td> 11138</td><td> GTCTTTGAGGTCTGGG</td><td> 61</td><td> 537</td>

<td> 728805</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAGGTCTGG</td><td> 58</td><td> 538</td>

<td> 728806</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGAGGTCTG</td><td> 74</td><td> 539</td>

<td> 728807</td><td> 1562</td><td> 1577</td><td> 11127</td><td> 11142</td><td> TGCGGTCTTTGAGGTC</td><td> 58</td><td> 540</td>

Table 8

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 72</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 62</td><td> 468</td>

<td> 665942</td><td> 1613</td><td> 1628</td><td> 11178</td><td> 11193</td><td> ACCGCTGCTGGGACTG</td><td> 40</td><td> 541</td>

<td> 728808</td><td> 1563</td><td> 1578</td><td> 11128</td><td> 11143</td><td> ATGCGGTCTTTGAGGT</td><td> 37</td><td> 542</td>

<td> 728809</td><td> 1564</td><td> 1579</td><td> 11129</td><td> 11144</td><td> CATGCGGTCTTTGAGG</td><td> 17</td><td> 543</td>

<td> 728810</td><td> 1565</td><td> 1580</td><td> 11130</td><td> 11145</td><td> CCATGCGGTCTTTGAG</td><td> 43</td><td> 544</td>

<td> 728811</td><td> 1566</td><td> 1581</td><td> 11131</td><td> 11146</td><td> ACCATGCGGTCTTTGA</td><td> 26</td><td> 545</td>

<td> 728812</td><td> 1568</td><td> 1583</td><td> 11133</td><td> 11148</td><td> CCACCATGCGGTCTTT</td><td> 9</td><td> 546</td>

<td> 728813</td><td> 1570</td><td> 1585</td><td> 11135</td><td> 11150</td><td> CTCCACCATGCGGTCT</td><td> 22</td><td> 547</td>

<td> 728814</td><td> 1572</td><td> 1587</td><td> 11137</td><td> 11152</td><td> TGCTCCACCATGCGGT</td><td> 23</td><td> 548</td>

<td> 728815</td><td> 1574</td><td> 1589</td><td> 11139</td><td> 11154</td><td> ATTGCTCCACCATGCG</td><td> 0</td><td> 549</td>

<td> 728816</td><td> 1576</td><td> 1591</td><td> 11141</td><td> 11156</td><td> GAATTGCTCCACCATG</td><td> 0</td><td> 550</td>

<td> 728817</td><td> 1578</td><td> 1593</td><td> 11143</td><td> 11158</td><td> TTGAATTGCTCCACCA</td><td> 0</td><td> 551</td>

<td> 728818</td><td> 1580</td><td> 1595</td><td> 11145</td><td> 11160</td><td> CCTTGAATTGCTCCAC</td><td> 0</td><td> 552</td>

<td> 728819</td><td> 1582</td><td> 1597</td><td> 11147</td><td> 11162</td><td> CTCCTTGAATTGCTCC</td><td> 0</td><td> 553</td>

<td> 728820</td><td> 1584</td><td> 1599</td><td> 11149</td><td> 11164</td><td> AGCTCCTTGAATTGCT</td><td> 0</td><td> 554</td>

<td> 728821</td><td> 1586</td><td> 1601</td><td> 11151</td><td> 11166</td><td> GGAGCTCCTTGAATTG</td><td> 0</td><td> 555</td>

<td> 728822</td><td> 1588</td><td> 1603</td><td> 11153</td><td> 11168</td><td> ATGGAGCTCCTTGAAT</td><td> 2</td><td> 556</td>

<td> 728823</td><td> 1590</td><td> 1605</td><td> 11155</td><td> 11170</td><td> TGATGGAGCTCCTTGA</td><td> 0</td><td> 557</td>

<td> 728824</td><td> 1592</td><td> 1607</td><td> 11157</td><td> 11172</td><td> TGTGATGGAGCTCCTT</td><td> 0</td><td> 558</td>

<td> 728825</td><td> 1594</td><td> 1609</td><td> 11159</td><td> 11174</td><td> GATGTGATGGAGCTCC</td><td> 30</td><td> 559</td>

<td> 728826</td><td> 1596</td><td> 1611</td><td> 11161</td><td> 11176</td><td> CAGATGTGATGGAGCT</td><td> 27</td><td> 560</td>

<td> 728827</td><td> 1600</td><td> 1615</td><td> 11165</td><td> 11180</td><td> CTGCCAGATGTGATGG</td><td> 7</td><td> 561</td>

<td> 728828</td><td> 1602</td><td> 1617</td><td> 11167</td><td> 11182</td><td> GACTGCCAGATGTGAT</td><td> 0</td><td> 562</td>

<td> 728829</td><td> 1604</td><td> 1619</td><td> 11169</td><td> 11184</td><td> GGGACTGCCAGATGTG</td><td> 31</td><td> 563</td>

<td> 728830</td><td> 1606</td><td> 1621</td><td> 11171</td><td> 11186</td><td> CTGGGACTGCCAGATG</td><td> 40</td><td> 564</td>

<td> 728831</td><td> 1608</td><td> 1623</td><td> 11173</td><td> 11188</td><td> TGCTGGGACTGCCAGA</td><td> 24</td><td> 565</td>

<td> 728832</td><td> 1609</td><td> 1624</td><td> 11174</td><td> 11189</td><td> CTGCTGGGACTGCCAG</td><td> 19</td><td> 566</td>

<td> 728833</td><td> 1610</td><td> 1625</td><td> 11175</td><td> 11190</td><td> GCTGCTGGGACTGCCA</td><td> 24</td><td> 567</td>

<td> 728834</td><td> 1612</td><td> 1627</td><td> 11177</td><td> 11192</td><td> CCGCTGCTGGGACTGC</td><td> 37</td><td> 568</td>

<td> 728835</td><td> 1614</td><td> 1629</td><td> 11179</td><td> 11194</td><td> AACCGCTGCTGGGACT</td><td> 19</td><td> 569</td>

<td> 728836</td><td> 1616</td><td> 1631</td><td> 11181</td><td> 11196</td><td> GCAACCGCTGCTGGGA</td><td> 38</td><td> 570</td>

<td> 728837</td><td> 1618</td><td> 1633</td><td> 11183</td><td> 11198</td><td> CTGCAACCGCTGCTGG</td><td> 26</td><td> 571</td>

<td> 728838</td><td> 1620</td><td> 1635</td><td> 11185</td><td> 11200</td><td> GGCTGCAACCGCTGCT</td><td> 2</td><td> 572</td>

<td> 728839</td><td> 1624</td><td> 1639</td><td> 11189</td><td> 11204</td><td> CACAGGCTGCAACCGC</td><td> 26</td><td> 573</td>

<td> 728840</td><td> 1626</td><td> 1641</td><td> 11191</td><td> 11206</td><td> GCCACAGGCTGCAACC</td><td> 21</td><td> 574</td>

<td> 728841</td><td> 1628</td><td> 1643</td><td> 11193</td><td> 11208</td><td> GGGCCACAGGCTGCAA</td><td> 37</td><td> 575</td>

<td> 728842</td><td> 1650</td><td> 1665</td><td> 11215</td><td> 11230</td><td> AGGCCTGCTCCAGGAG</td><td> 0</td><td> 576</td>

<td> 728843</td><td> 1654</td><td> 1669</td><td> 11219</td><td> 11234</td><td> ACCAAGGCCTGCTCCA</td><td> 30</td><td> 577</td>

<td> 728844</td><td> 1656</td><td> 1671</td><td> 11221</td><td> 11236</td><td> ACACCAAGGCCTGCTC</td><td> 41</td><td> 578</td>

<td> 728845</td><td> 1659</td><td> 1674</td><td> 11224</td><td> 11239</td><td> CCAACACCAAGGCCTG</td><td> 8</td><td> 579</td>

<td> 728846</td><td> 1661</td><td> 1676</td><td> 11226</td><td> 11241</td><td> GGCCAACACCAAGGCC</td><td> 0</td><td> 580</td>

<td> 728847</td><td> 1663</td><td> 1678</td><td> 11228</td><td> 11243</td><td> CTGGCCAACACCAAGG</td><td> 18</td><td> 581</td>

<td> 728848</td><td> 1666</td><td> 1681</td><td> 11231</td><td> 11246</td><td> CCCCTGGCCAACACCA</td><td> 0</td><td> 582</td>

<td> 728849</td><td> 1668</td><td> 1683</td><td> 11233</td><td> 11248</td><td> GGCCCCTGGCCAACAC</td><td> 0</td><td> 583</td>

<td> 728850</td><td> 1670</td><td> 1685</td><td> 11235</td><td> 11250</td><td> AGGGCCCCTGGCCAAC</td><td> 21</td><td> 584</td>

<td> 728851</td><td> 1676</td><td> 1691</td><td> 11241</td><td> 11256</td><td> TAGGCCAGGGCCCCTG</td><td> 0</td><td> 585</td>

<td> 728852</td><td> 1678</td><td> 1693</td><td> 11243</td><td> 11258</td><td> CATAGGCCAGGGCCCC</td><td> 0</td><td> 586</td>

<td> 728853</td><td> 1680</td><td> 1695</td><td> 11245</td><td> 11260</td><td> TGCATAGGCCAGGGCC</td><td> 0</td><td> 587</td>

<td> 728854</td><td> 1682</td><td> 1697</td><td> 11247</td><td> 11262</td><td> GGTGCATAGGCCAGGG</td><td> 0</td><td> 588</td>

<td> 728855</td><td> 1684</td><td> 1699</td><td> 11249</td><td> 11264</td><td> TGGGTGCATAGGCCAG</td><td> 0</td><td> 589</td>

<td> 728856</td><td> 1687</td><td> 1702</td><td> 11252</td><td> 11267</td><td> AGCTGGGTGCATAGGC</td><td> 0</td><td> 590</td>

<td> 728857</td><td> 1690</td><td> 1705</td><td> 11255</td><td> 11270</td><td> GCCAGCTGGGTGCATA</td><td> 15</td><td> 591</td>

<td> 728858</td><td> 1693</td><td> 1708</td><td> 11258</td><td> 11273</td><td> CATGCCAGCTGGGTGC</td><td> 28</td><td> 592</td>

<td> 728859</td><td> 1695</td><td> 1710</td><td> 11260</td><td> 11275</td><td> TGCATGCCAGCTGGGT</td><td> 32</td><td> 593</td>

<td> 728860</td><td> 1697</td><td> 1712</td><td> 11262</td><td> 11277</td><td> ATTGCATGCCAGCTGG</td><td> 34</td><td> 594</td>

<td> 728861</td><td> 1699</td><td> 1714</td><td> 11264</td><td> 11279</td><td> TTATTGCATGCCAGCT</td><td> 19</td><td> 595</td>

<td> 728862</td><td> 1701</td><td> 1716</td><td> 11266</td><td> 11281</td><td> TGTTATTGCATGCCAG</td><td> 35</td><td> 596</td>

<td> 728863</td><td> 1703</td><td> 1718</td><td> 11268</td><td> 11283</td><td> CTTGTTATTGCATGCC</td><td> 51</td><td> 597</td>

<td> 728864</td><td> 1705</td><td> 1720</td><td> 11270</td><td> 11285</td><td> GCCTTGTTATTGCATG</td><td> 16</td><td> 598</td>

<td> 728865</td><td> 1707</td><td> 1722</td><td> 11272</td><td> 11287</td><td> CAGCCTTGTTATTGCA</td><td> 3</td><td> 599</td>

<td> 728866</td><td> 1709</td><td> 1724</td><td> 11274</td><td> 11289</td><td> TGCAGCCTTGTTATTG</td><td> 0</td><td> 600</td>

<td> 728867</td><td> 1711</td><td> 1726</td><td> 11276</td><td> 11291</td><td> TCTGCAGCCTTGTTAT</td><td> 0</td><td> 601</td>

<td> 728868</td><td> 1713</td><td> 1728</td><td> 11278</td><td> 11293</td><td> CGTCTGCAGCCTTGTT</td><td> 43</td><td> 602</td>

<td> 728869</td><td> 1715</td><td> 1730</td><td> 11280</td><td> 11295</td><td> ACCGTCTGCAGCCTTG</td><td> 51</td><td> 603</td>

<td> 728870</td><td> 1717</td><td> 1732</td><td> 11282</td><td> 11297</td><td> TCACCGTCTGCAGCCT</td><td> 14</td><td> 604</td>

<td> 728871</td><td> 1719</td><td> 1734</td><td> 11284</td><td> 11299</td><td> AGTCACCGTCTGCAGC</td><td> 36</td><td> 605</td>

<td> 728872</td><td> 1721</td><td> 1736</td><td> 11286</td><td> 11301</td><td> CCAGTCACCGTCTGCA</td><td> 57</td><td> 606</td>

<td> 728873</td><td> 1723</td><td> 1738</td><td> 11288</td><td> 11303</td><td> GGCCAGTCACCGTCTG</td><td> 6</td><td> 607</td>

<td> 728874</td><td> 1725</td><td> 1740</td><td> 11290</td><td> 11305</td><td> AGGGCCAGTCACCGTC</td><td> 28</td><td> 608</td>

<td> 728875</td><td> 1727</td><td> 1742</td><td> 11292</td><td> 11307</td><td> CCAGGGCCAGTCACCG</td><td> 30</td><td> 609</td>

<td> 728876</td><td> 1731</td><td> 1746</td><td> 11296</td><td> 11311</td><td> GAAGCCAGGGCCAGTC</td><td> 30</td><td> 610</td>

<td> 728877</td><td> 1742</td><td> 1757</td><td> 11307</td><td> 11322</td><td> CCGCCACCCAGGAAGC</td><td> 30</td><td> 611</td>

<td> 728878</td><td> 1744</td><td> 1759</td><td> 11309</td><td> 11324</td><td> CACCGCCACCCAGGAA</td><td> 9</td><td> 612</td>

<td> 728879</td><td> 1746</td><td> 1761</td><td> 11311</td><td> 11326</td><td> CGCACCGCCACCCAGG</td><td> 46</td><td> 613</td>

<td> 728880</td><td> 1748</td><td> 1763</td><td> 11313</td><td> 11328</td><td> TCCGCACCGCCACCCA</td><td> 29</td><td> 614</td>

<td> 728881</td><td> 1749</td><td> 1764</td><td> 11314</td><td> 11329</td><td> GTCCGCACCGCCACCC</td><td> 30</td><td> 615</td>

<td> 728882</td><td> 1750</td><td> 1765</td><td> 11315</td><td> 11330</td><td> AGTCCGCACCGCCACC</td><td> 27</td><td> 616</td>

<td> 728883</td><td> 1751</td><td> 1766</td><td> 11316</td><td> 11331</td><td> CAGTCCGCACCGCCAC</td><td> 56</td><td> 617</td>

Table 9

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 74</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 60</td><td> 468</td>

<td> 665962</td><td> 1753</td><td> 1768</td><td> 11318</td><td> 11333</td><td> ATCAGTCCGCACCGCC</td><td> 53</td><td> 618</td>

<td> 665964</td><td> 1765</td><td> 1780</td><td> 11330</td><td> 11345</td><td> TCACATCTCCACATCA</td><td> 36</td><td> 619</td>

<td> 665973</td><td> 1903</td><td> 1918</td><td> 11468</td><td> 11483</td><td> AGACCAGAGACAGCCC</td><td> 30</td><td> 620</td>

<td> 665975</td><td> 1911</td><td> 1926</td><td> 11476</td><td> 11491</td><td> GGCTGACCAGACCAGA</td><td> 40</td><td> 621</td>

<td> 665981</td><td> 1951</td><td> 1966</td><td> 11516</td><td> 11531</td><td> GAGTTCTTTCCCTGCT</td><td> 41</td><td> 622</td>

<td> 728884</td><td> 1752</td><td> 1767</td><td> 11317</td><td> 11332</td><td> TCAGTCCGCACCGCCA</td><td> 46</td><td> 623</td>

<td> 728885</td><td> 1754</td><td> 1769</td><td> 11319</td><td> 11334</td><td> CATCAGTCCGCACCGC</td><td> 23</td><td> 624</td>

<td> 728886</td><td> 1755</td><td> 1770</td><td> 11320</td><td> 11335</td><td> ACATCAGTCCGCACCG</td><td> 48</td><td> 625</td>

<td> 728887</td><td> 1756</td><td> 1771</td><td> 11321</td><td> 11336</td><td> CACATCAGTCCGCACC</td><td> 57</td><td> 626</td>

<td> 728888</td><td> 1757</td><td> 1772</td><td> 11322</td><td> 11337</td><td> CCACATCAGTCCGCAC</td><td> 37</td><td> 627</td>

<td> 728889</td><td> 1758</td><td> 1773</td><td> 11323</td><td> 11338</td><td> TCCACATCAGTCCGCA</td><td> 24</td><td> 628</td>

<td> 728890</td><td> 1760</td><td> 1775</td><td> 11325</td><td> 11340</td><td> TCTCCACATCAGTCCG</td><td> 33</td><td> 629</td>

<td> 728891</td><td> 1761</td><td> 1776</td><td> 11326</td><td> 11341</td><td> ATCTCCACATCAGTCC</td><td> 56</td><td> 630</td>

<td> 728892</td><td> 1762</td><td> 1777</td><td> 11327</td><td> 11342</td><td> CATCTCCACATCAGTC</td><td> 37</td><td> 631</td>

<td> 728893</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCACATCAGT</td><td> 56</td><td> 632</td>

<td> 728894</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCACATCAG</td><td> 65</td><td> 633</td>

<td> 728895</td><td> 1766</td><td> 1781</td><td> 11331</td><td> 11346</td><td> GTCACATCTCCACATC</td><td> 47</td><td> 634</td>

<td> 728896</td><td> 1767</td><td> 1782</td><td> 11332</td><td> 11347</td><td> TGTCACATCTCCACAT</td><td> 21</td><td> 635</td>

<td> 728897</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATCTCCACA</td><td> 46</td><td> 636</td>

<td> 728898</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACATCTCCAC</td><td> 73</td><td> 637</td>

<td> 728899</td><td> 1770</td><td> 1785</td><td> 11335</td><td> 11350</td><td> GGCTGTCACATCTCCA</td><td> 64</td><td> 638</td>

<td> 728900</td><td> 1786</td><td> 1801</td><td> 11351</td><td> 11366</td><td> GCCAGGTGCTCATCGG</td><td> 37</td><td> 639</td>

<td> 728901</td><td> 1788</td><td> 1803</td><td> 11353</td><td> 11368</td><td> CAGCCAGGTGCTCATC</td><td> 37</td><td> 640</td>

<td> 728902</td><td> 1790</td><td> 1805</td><td> 11355</td><td> 11370</td><td> GCCAGCCAGGTGCTCA</td><td> 42</td><td> 641</td>

<td> 728903</td><td> 1803</td><td> 1818</td><td> 11368</td><td> 11383</td><td> GTAGGACCCTGCAGCC</td><td> 31</td><td> 642</td>

<td> 728904</td><td> 1805</td><td> 1820</td><td> 11370</td><td> 11385</td><td> AGGTAGGACCCTGCAG</td><td> 6</td><td> 643</td>

<td> 728905</td><td> 1807</td><td> 1822</td><td> 11372</td><td> 11387</td><td> AGAGGTAGGACCCTGC</td><td> 60</td><td> 644</td>

<td> 728906</td><td> 1810</td><td> 1825</td><td> 11375</td><td> 11390</td><td> CCCAGAGGTAGGACCC</td><td> 42</td><td> 645</td>

<td> 728907</td><td> 1812</td><td> 1827</td><td> 11377</td><td> 11392</td><td> AACCCAGAGGTAGGAC</td><td> 32</td><td> 646</td>

<td> 728908</td><td> 1814</td><td> 1829</td><td> 11379</td><td> 11394</td><td> GAAACCCAGAGGTAGG</td><td> 44</td><td> 647</td>

<td> 728909</td><td> 1825</td><td> 1840</td><td> 11390</td><td> 11405</td><td> TCCACTTCCAGGAAAC</td><td> 25</td><td> 648</td>

<td> 728910</td><td> 1833</td><td> 1848</td><td> 11398</td><td> 11413</td><td> GGCCCAAATCCACTTC</td><td> 11</td><td> 649</td>

<td> 728911</td><td> 1835</td><td> 1850</td><td> 11400</td><td> 11415</td><td> TTGGCCCAAATCCACT</td><td> 9</td><td> 650</td>

<td> 728912</td><td> 1837</td><td> 1852</td><td> 11402</td><td> 11417</td><td> TCTTGGCCCAAATCCA</td><td> 22</td><td> 651</td>

<td> 728913</td><td> 1839</td><td> 1854</td><td> 11404</td><td> 11419</td><td> CTTCTTGGCCCAAATC</td><td> 15</td><td> 652</td>

<td> 728914</td><td> 1841</td><td> 1856</td><td> 11406</td><td> 11421</td><td> TCCTTCTTGGCCCAAA</td><td> 31</td><td> 653</td>

<td> 728915</td><td> 1859</td><td> 1874</td><td> 11424</td><td> 11439</td><td> CTCGGGCCTTTCTCCC</td><td> 2</td><td> 654</td>

<td> 728916</td><td> 1861</td><td> 1876</td><td> 11426</td><td> 11441</td><td> GGCTCGGGCCTTTCTC</td><td> 10</td><td> 655</td>

<td> 728917</td><td> 1884</td><td> 1899</td><td> 11449</td><td> 11464</td><td> AGAGAAAGGCCCGGGA</td><td> 0</td><td> 656</td>

<td> 728918</td><td> 1886</td><td> 1901</td><td> 11451</td><td> 11466</td><td> GGAGAGAAAGGCCCGG</td><td> 0</td><td> 657</td>

<td> 728919</td><td> 1898</td><td> 1913</td><td> 11463</td><td> 11478</td><td> AGAGACAGCCCAGGAG</td><td> 13</td><td> 658</td>

<td> 728920</td><td> 1901</td><td> 1916</td><td> 11466</td><td> 11481</td><td> ACCAGAGACAGCCCAG</td><td> 52</td><td> 659</td>

<td> 728921</td><td> 1902</td><td> 1917</td><td> 11467</td><td> 11482</td><td> GACCAGAGACAGCCCA</td><td> 42</td><td> 660</td>

<td> 728922</td><td> 1904</td><td> 1919</td><td> 11469</td><td> 11484</td><td> CAGACCAGAGACAGCC</td><td> 38</td><td> 661</td>

<td> 728923</td><td> 1905</td><td> 1920</td><td> 11470</td><td> 11485</td><td> CCAGACCAGAGACAGC</td><td> 17</td><td> 662</td>

<td> 728924</td><td> 1906</td><td> 1921</td><td> 11471</td><td> 11486</td><td> ACCAGACCAGAGACAG</td><td> 30</td><td> 663</td>

<td> 728925</td><td> 1907</td><td> 1922</td><td> 11472</td><td> 11487</td><td> GACCAGACCAGAGACA</td><td> 14</td><td> 664</td>

<td> 728926</td><td> 1908</td><td> 1923</td><td> 11473</td><td> 11488</td><td> TGACCAGACCAGAGAC</td><td> 7</td><td> 665</td>

<td> 728927</td><td> 1910</td><td> 1925</td><td> 11475</td><td> 11490</td><td> GCTGACCAGACCAGAG</td><td> 26</td><td> 666</td>

<td> 728928</td><td> 1912</td><td> 1927</td><td> 11477</td><td> 11492</td><td> AGGCTGACCAGACCAG</td><td> 14</td><td> 667</td>

<td> 728929</td><td> 1916</td><td> 1931</td><td> 11481</td><td> 11496</td><td> AGCCAGGCTGACCAGA</td><td> 13</td><td> 668</td>

<td> 728930</td><td> 1919</td><td> 1934</td><td> 11484</td><td> 11499</td><td> GAGAGCCAGGCTGACC</td><td> 26</td><td> 669</td>

<td> 728931</td><td> 1923</td><td> 1938</td><td> 11488</td><td> 11503</td><td> TCCCGAGAGCCAGGCT</td><td> 26</td><td> 670</td>

<td> 728932</td><td> 1925</td><td> 1940</td><td> 11490</td><td> 11505</td><td> TTTCCCGAGAGCCAGG</td><td> 26</td><td> 671</td>

<td> 728933</td><td> 1928</td><td> 1943</td><td> 11493</td><td> 11508</td><td> GAATTTCCCGAGAGCC</td><td> 34</td><td> 672</td>

<td> 728934</td><td> 1930</td><td> 1945</td><td> 11495</td><td> 11510</td><td> CTGAATTTCCCGAGAG</td><td> 33</td><td> 673</td>

<td> 728935</td><td> 1932</td><td> 1947</td><td> 11497</td><td> 11512</td><td> GGCTGAATTTCCCGAG</td><td> 39</td><td> 674</td>

<td> 728936</td><td> 1934</td><td> 1949</td><td> 11499</td><td> 11514</td><td> ATGGCTGAATTTCCCG</td><td> 39</td><td> 675</td>

<td> 728937</td><td> 1936</td><td> 1951</td><td> 11501</td><td> 11516</td><td> TCATGGCTGAATTTCC</td><td> 36</td><td> 676</td>

<td> 728938</td><td> 1938</td><td> 1953</td><td> 11503</td><td> 11518</td><td> GCTCATGGCTGAATTT</td><td> 30</td><td> 677</td>

<td> 728939</td><td> 1940</td><td> 1955</td><td> 11505</td><td> 11520</td><td> CTGCTCATGGCTGAAT</td><td> 40</td><td> 678</td>

<td> 728940</td><td> 1942</td><td> 1957</td><td> 11507</td><td> 11522</td><td> CCCTGCTCATGGCTGA</td><td> 51</td><td> 679</td>

<td> 728941</td><td> 1946</td><td> 1961</td><td> 11511</td><td> 11526</td><td> CTTTCCCTGCTCATGG</td><td> 45</td><td> 680</td>

<td> 728942</td><td> 1947</td><td> 1962</td><td> 11512</td><td> 11527</td><td> TCTTTCCCTGCTCATG</td><td> 54</td><td> 681</td>

<td> 728943</td><td> 1948</td><td> 1963</td><td> 11513</td><td> 11528</td><td> TTCTTTCCCTGCTCAT</td><td> 16</td><td> 682</td>

<td> 728944</td><td> 1949</td><td> 1964</td><td> 11514</td><td> 11529</td><td> GTTCTTTCCCTGCTCA</td><td> 56</td><td> 683</td>

<td> 728945</td><td> 1950</td><td> 1965</td><td> 11515</td><td> 11530</td><td> AGTTCTTTCCCTGCTC</td><td> 56</td><td> 684</td>

<td> 728946</td><td> 1952</td><td> 1967</td><td> 11517</td><td> 11532</td><td> AGAGTTCTTTCCCTGC</td><td> 56</td><td> 685</td>

<td> 728947</td><td> 1953</td><td> 1968</td><td> 11518</td><td> 11533</td><td> GAGAGTTCTTTCCCTG</td><td> 54</td><td> 686</td>

<td> 728948</td><td> 1954</td><td> 1969</td><td> 11519</td><td> 11534</td><td> GGAGAGTTCTTTCCCT</td><td> 32</td><td> 687</td>

<td> 728949</td><td> 1955</td><td> 1970</td><td> 11520</td><td> 11535</td><td> GGGAGAGTTCTTTCCC</td><td> 1</td><td> 688</td>

<td> 728950</td><td> 1956</td><td> 1971</td><td> 11521</td><td> 11536</td><td> TGGGAGAGTTCTTTCC</td><td> 24</td><td> 689</td>

<td> 728951</td><td> 1958</td><td> 1973</td><td> 11523</td><td> 11538</td><td> GTTGGGAGAGTTCTTT</td><td> 29</td><td> 690</td>

<td> 728952</td><td> 1970</td><td> 1985</td><td> 11535</td><td> 11550</td><td> CTAGGCCCCAGGGTTG</td><td> 35</td><td> 691</td>

<td> 728953</td><td> 1972</td><td> 1987</td><td> 11537</td><td> 11552</td><td> AGCTAGGCCCCAGGGT</td><td> 23</td><td> 692</td>

<td> 728954</td><td> 1974</td><td> 1989</td><td> 11539</td><td> 11554</td><td> ACAGCTAGGCCCCAGG</td><td> 64</td><td> 693</td>

<td> 728955</td><td> 1976</td><td> 1991</td><td> 11541</td><td> 11556</td><td> ATACAGCTAGGCCCCA</td><td> 14</td><td> 694</td>

Table 10

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 73</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 69</td><td> 468</td>

<td> 666013</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGACTCTCAA</td><td> 65</td><td> 695</td>

<td> 666015</td><td> 2228</td><td> 2243</td><td> 11793</td><td> 11808</td><td> ATTTCTGCTCCAGGTT</td><td> 54</td><td> 696</td>

<td> 729028</td><td> 2190</td><td> 2205</td><td> 11755</td><td> 11770</td><td> AGCTGCCAGCCTTGAG</td><td> 50</td><td> 697</td>

<td> 729029</td><td> 2191</td><td> 2206</td><td> 11756</td><td> 11771</td><td> TAGCTGCCAGCCTTGA</td><td> 57</td><td> 698</td>

<td> 729030</td><td> 2192</td><td> 2207</td><td> 11757</td><td> 11772</td><td> GTAGCTGCCAGCCTTG</td><td> 65</td><td> 699</td>

<td> 729031</td><td> 2194</td><td> 2209</td><td> 11759</td><td> 11774</td><td> GGGTAGCTGCCAGCCT</td><td> 41</td><td> 700</td>

<td> 729032</td><td> 2210</td><td> 2225</td><td> 11775</td><td> 11790</td><td> TGGACTCTCAAGAAGG</td><td> 55</td><td> 701</td>

<td> 729033</td><td> 2211</td><td> 2226</td><td> 11776</td><td> 11791</td><td> TTGGACTCTCAAGAAG</td><td> 37</td><td> 702</td>

<td> 729034</td><td> 2212</td><td> 2227</td><td> 11777</td><td> 11792</td><td> CTTGGACTCTCAAGAA</td><td> 38</td><td> 703</td>

<td> 729035</td><td> 2213</td><td> 2228</td><td> 11778</td><td> 11793</td><td> TCTTGGACTCTCAAGA</td><td> 0</td><td> 704</td>

<td> 729036</td><td> 2214</td><td> 2229</td><td> 11779</td><td> 11794</td><td> TTCTTGGACTCTCAAG</td><td> 55</td><td> 705</td>

<td> 729037</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGACTCTCA</td><td> 80</td><td> 706</td>

<td> 729038</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGGACTCTC</td><td> 85</td><td> 707</td>

<td> 729039</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTGGACTCT</td><td> 74</td><td> 708</td>

<td> 729040</td><td> 2219</td><td> 2234</td><td> 11784</td><td> 11799</td><td> CCAGGTTCTTGGACTC</td><td> 67</td><td> 709</td>

<td> 729041</td><td> 2220</td><td> 2235</td><td> 11785</td><td> 11800</td><td> TCCAGGTTCTTGGACT</td><td> 39</td><td> 710</td>

<td> 729042</td><td> 2222</td><td> 2237</td><td> 11787</td><td> 11802</td><td> GCTCCAGGTTCTTGGA</td><td> 11</td><td> 711</td>

<td> 729043</td><td> 2223</td><td> 2238</td><td> 11788</td><td> 11803</td><td> TGCTCCAGGTTCTTGG</td><td> 44</td><td> 712</td>

<td> 729044</td><td> 2224</td><td> 2239</td><td> 11789</td><td> 11804</td><td> CTGCTCCAGGTTCTTG</td><td> 62</td><td> 713</td>

<td> 729045</td><td> 2225</td><td> 2240</td><td> 11790</td><td> 11805</td><td> TCTGCTCCAGGTTCTT</td><td> 60</td><td> 714</td>

<td> 729046</td><td> 2226</td><td> 2241</td><td> 11791</td><td> 11806</td><td> TTCTGCTCCAGGTTCT</td><td> 54</td><td> 715</td>

<td> 729047</td><td> 2227</td><td> 2242</td><td> 11792</td><td> 11807</td><td> TTTCTGCTCCAGGTTC</td><td> 63</td><td> 716</td>

<td> 729048</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTCCAGGT</td><td> 63</td><td> 717</td>

<td> 729049</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCTCCAGG</td><td> 76</td><td> 718</td>

<td> 729050</td><td> 2231</td><td> 2246</td><td> 11796</td><td> 11811</td><td> ATTATTTCTGCTCCAG</td><td> 76</td><td> 719</td>

<td> 729051</td><td> 2232</td><td> 2247</td><td> 11797</td><td> 11812</td><td> AATTATTTCTGCTCCA</td><td> 58</td><td> 720</td>

<td> 729052</td><td> 2260</td><td> 2275</td><td> 11825</td><td> 11840</td><td> AACATTCATTAATCCA</td><td> 55</td><td> 721</td>

<td> 729053</td><td> 2278</td><td> 2293</td><td> 11843</td><td> 11858</td><td> ACAGCTGAGTCTGTTT</td><td> 26</td><td> 722</td>

<td> 729055</td><td> 2300</td><td> 2315</td><td> 11865</td><td> 11880</td><td> TGGTAGTAGTAAAAGG</td><td> 24</td><td> 723</td>

<td> 729060</td><td> 2310</td><td> 2325</td><td> 11875</td><td> 11890</td><td> TGGGAGCAACTGGTAG</td><td> 33</td><td> 724</td>

<td> 729064</td><td> 2322</td><td> 2337</td><td> 11887</td><td> 11902</td><td> GGTGGAGCAGCATGGG</td><td> 14</td><td> 725</td>

<td> 729067</td><td> 2336</td><td> 2351</td><td> 11901</td><td> 11916</td><td> CCGAAACAGGGCCTGG</td><td> 33</td><td> 726</td>

<td> 729072</td><td> 2346</td><td> 2361</td><td> 11911</td><td> 11926</td><td> CAGTTGGCATCCGAAA</td><td> 8</td><td> 727</td>

<td> 729077</td><td> 2385</td><td> 2400</td><td> 11950</td><td> 11965</td><td> AATGGTCGCAAGCTGG</td><td> 26</td><td> 728</td>

<td> 729082</td><td> 2395</td><td> 2410</td><td> 11960</td><td> 11975</td><td> TCCCAGTGCCAATGGT</td><td> 5</td><td> 729</td>

<td> 729086</td><td> 2417</td><td> 2432</td><td> 11982</td><td> 11997</td><td> CATCAGCCCAGAAGCC</td><td> 12</td><td> 730</td>

<td> 729090</td><td> 2427</td><td> 2442</td><td> 11992</td><td> 12007</td><td> CCAACTGACCCATCAG</td><td> 8</td><td> 731</td>

<td> 729095</td><td> 2437</td><td> 2452</td><td> 12002</td><td> 12017</td><td> TTATGAAGGCCCAACT</td><td> 0</td><td> 732</td>

<td> 729100</td><td> 2447</td><td> 2462</td><td> 12012</td><td> 12027</td><td> AGGTGAGTGTTTATGA</td><td> 33</td><td> 733</td>

<td> 729105</td><td> 2457</td><td> 2472</td><td> 12022</td><td> 12037</td><td> AAAGCCAGCCAGGTGA</td><td> 30</td><td> 734</td>

<td> 729106</td><td> 2486</td><td> 2501</td><td> 12051</td><td> 12066</td><td> TTGCTTCAGCCAGCTT</td><td> 15</td><td> 735</td>

<td> 729110</td><td> 2496</td><td> 2511</td><td> 12061</td><td> 12076</td><td> TTCCACACCCTTGCTT</td><td> 11</td><td> 736</td>

<td> 729112</td><td> 2515</td><td> 2530</td><td> 12080</td><td> 12095</td><td> ACTGTGCACACATTTA</td><td> 53</td><td> 737</td>

<td> 729116</td><td> 2525</td><td> 2540</td><td> 12090</td><td> 12105</td><td> AGTTTTCCAGACTGTG</td><td> 28</td><td> 738</td>

<td> 729120</td><td> 2536</td><td> 2551</td><td> 12101</td><td> 12116</td><td> CTGATTCTGACAGTTT</td><td> 0</td><td> 739</td>

<td> 729123</td><td> 2547</td><td> 2562</td><td> 12112</td><td> 12127</td><td> TTATGGGAAAACTGAT</td><td> 0</td><td> 740</td>

<td> 729125</td><td> 2557</td><td> 2572</td><td> 12122</td><td> 12137</td><td> GCCCACCCTTTTATGG</td><td> 0</td><td> 741</td>

<td> 729129</td><td> 2567</td><td> 2582</td><td> 12132</td><td> 12147</td><td> TGCAATGCTAGCCCAC</td><td> 54</td><td> 742</td>

<td> 729134</td><td> 2577</td><td> 2592</td><td> 12142</td><td> 12157</td><td> CAAATGCAGCTGCAAT</td><td> 27</td><td> 743</td>

<td> 729139</td><td> 2588</td><td> 2603</td><td> 12153</td><td> 12168</td><td> TTGAATGGTCCCAAAT</td><td> 22</td><td> 744</td>

<td> 729144</td><td> 2599</td><td> 2614</td><td> 12164</td><td> 12179</td><td> GAGTGACAGATTTGAA</td><td> 55</td><td> 745</td>

<td> 729146</td><td> 2620</td><td> 2635</td><td> 12185</td><td> 12200</td><td> AGCACAGGAATATACA</td><td> 36</td><td> 746</td>

<td> 729150</td><td> 2637</td><td> 2652</td><td> 12202</td><td> 12217</td><td> GCCCTGATATATTTAA</td><td> 0</td><td> 747</td>

<td> 729155</td><td> 2647</td><td> 2662</td><td> 12212</td><td> 12227</td><td> TACATGCACTGCCCTG</td><td> 31</td><td> 748</td>

<td> 729160</td><td> 2657</td><td> 2672</td><td> 12222</td><td> 12237</td><td> CAGGATGATTTACATG</td><td> 5</td><td> 749</td>

<td> 729164</td><td> 2703</td><td> 2718</td><td> 12268</td><td> 12283</td><td> ACTGTCCCCACCTCGG</td><td> 10</td><td> 750</td>

<td> 729165</td><td> 2720</td><td> 2735</td><td> 12285</td><td> 12300</td><td> ACTAAGAGAACTCACT</td><td> 31</td><td> 751</td>

<td> 729167</td><td> 2747</td><td> 2762</td><td> 12312</td><td> 12327</td><td> GGCTCTTTAACAACCA</td><td> 20</td><td> 752</td>

<td> 729170</td><td> 2761</td><td> 2776</td><td> 12326</td><td> 12341</td><td> GCGGGTAGGTGCCAGG</td><td> 40</td><td> 753</td>

<td> 729175</td><td> 2771</td><td> 2786</td><td> 12336</td><td> 12351</td><td> TGAAGTGAGAGCGGGT</td><td> 45</td><td> 754</td>

<td> 729180</td><td> 2789</td><td> 2804</td><td> 12354</td><td> 12369</td><td> GTGCAGAGATGACACA</td><td> 0</td><td> 755</td>

<td> 729182</td><td> 2800</td><td> 2815</td><td> 12365</td><td> 12380</td><td> TGGGCTGGAGTGTGCA</td><td> 30</td><td> 756</td>

<td> 729185</td><td> 2820</td><td> 2835</td><td> 12385</td><td> 12400</td><td> CAATGGCTGAAGGCAG</td><td> 14</td><td> 757</td>

<td> 729190</td><td> 2876</td><td> 2891</td><td> 12441</td><td> 12456</td><td> GCTGGGCATCAAGATT</td><td> 7</td><td> 758</td>

<td> 729194</td><td> 2885</td><td> 2900</td><td> 12450</td><td> 12465</td><td> GTTCTGATGGCTGGGC</td><td> 50</td><td> 759</td>

<td> 729251</td><td> N/A</td><td> N/A</td><td> 176</td><td> 191</td><td> CTGGAATGGCAAAACT</td><td> 12</td><td> 760</td>

<td> 729252</td><td> N/A</td><td> N/A</td><td> 197</td><td> 212</td><td> GCCACTGGCTCTTTTG</td><td> 0</td><td> 761</td>

<td> 729253</td><td> N/A</td><td> N/A</td><td> 207</td><td> 222</td><td> CCCTAGACTGGCCACT</td><td> 1</td><td> 762</td>

<td> 729254</td><td> N/A</td><td> N/A</td><td> 218</td><td> 233</td><td> ACGGCGCGGTGCCCTA</td><td> 10</td><td> 763</td>

<td> 729255</td><td> N/A</td><td> N/A</td><td> 257</td><td> 272</td><td> AGCCTCGGGCCAGGCC</td><td> 12</td><td> 764</td>

<td> 729256</td><td> N/A</td><td> N/A</td><td> 267</td><td> 282</td><td> ATCCGGGCTGAGCCTC</td><td> 8</td><td> 765</td>

<td> 729257</td><td> N/A</td><td> N/A</td><td> 292</td><td> 307</td><td> CCCCGCACTGACCTGG</td><td> 43</td><td> 766</td>

<td> 729258</td><td> N/A</td><td> N/A</td><td> 302</td><td> 317</td><td> CCACTCCGGGCCCCGC</td><td> 0</td><td> 767</td>

<td> 729259</td><td> N/A</td><td> N/A</td><td> 312</td><td> 327</td><td> CCCCGCGAATCCACTC</td><td> 0</td><td> 768</td>

<td> 729260</td><td> N/A</td><td> N/A</td><td> 364</td><td> 379</td><td> CGCCCCTGGGCAGCTG</td><td> 0</td><td> 769</td>

<td> 729635</td><td> N/A</td><td> N/A</td><td> 228</td><td> 243</td><td> GAGATGCCAGACGGCG</td><td> 0</td><td> 770</td>

<td> 729636</td><td> N/A</td><td> N/A</td><td> 344</td><td> 359</td><td> TGAGCTCCGGGCGCGG</td><td> 5</td><td> 771</td>

Table 11

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 74</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 57</td><td> 468</td>

<td> 729261</td><td> N/A</td><td> N/A</td><td> 502</td><td> 517</td><td> GACCCACCTGTCTGCG</td><td> 7</td><td> 772</td>

<td> 729262</td><td> N/A</td><td> N/A</td><td> 512</td><td> 527</td><td> CGGCGGCCGGGACCCA</td><td> 18</td><td> 773</td>

<td> 729263</td><td> N/A</td><td> N/A</td><td> 532</td><td> 547</td><td> CGGACGCAGAGAGGAG</td><td> 20</td><td> 774</td>

<td> 729264</td><td> N/A</td><td> N/A</td><td> 561</td><td> 576</td><td> CTCCCGCCACCCTCGG</td><td> 9</td><td> 775</td>

<td> 729265</td><td> N/A</td><td> N/A</td><td> 571</td><td> 586</td><td> GCCGGCACCGCTCCCG</td><td> 0</td><td> 776</td>

<td> 729266</td><td> N/A</td><td> N/A</td><td> 594</td><td> 609</td><td> TAGGCCTAGACTTGGG</td><td> 26</td><td> 777</td>

<td> 729267</td><td> N/A</td><td> N/A</td><td> 635</td><td> 650</td><td> TCCCGCCGCCCGCAGG</td><td> 10</td><td> 778</td>

<td> 729268</td><td> N/A</td><td> N/A</td><td> 645</td><td> 660</td><td> CCAGTCTTCATCCCGC</td><td> 33</td><td> 779</td>

<td> 729269</td><td> N/A</td><td> N/A</td><td> 656</td><td> 671</td><td> CCCGCCCTACTCCAGT</td><td> 26</td><td> 780</td>

<td> 729270</td><td> N/A</td><td> N/A</td><td> 686</td><td> 701</td><td> CTCGCTTTCCAGGCGC</td><td> 4</td><td> 781</td>

<td> 729271</td><td> N/A</td><td> N/A</td><td> 696</td><td> 711</td><td> CCCCCCCGAGCTCGCT</td><td> 8</td><td> 782</td>

<td> 729272</td><td> N/A</td><td> N/A</td><td> 706</td><td> 721</td><td> GCTGTAGGCACCCCCC</td><td> 19</td><td> 783</td>

<td> 729273</td><td> N/A</td><td> N/A</td><td> 736</td><td> 751</td><td> TGGAAGTCCCAGGCCG</td><td> 21</td><td> 784</td>

<td> 729274</td><td> N/A</td><td> N/A</td><td> 767</td><td> 782</td><td> CCCCAAACCGATCGGG</td><td> 0</td><td> 785</td>

<td> 729275</td><td> N/A</td><td> N/A</td><td> 801</td><td> 816</td><td> CCGCCTGGGTCACTGG</td><td> 11</td><td> 786</td>

<td> 729276</td><td> N/A</td><td> N/A</td><td> 811</td><td> 826</td><td> GCCCACTCCGCCGCCT</td><td> 0</td><td> 787</td>

<td> 729277</td><td> N/A</td><td> N/A</td><td> 866</td><td> 881</td><td> CTGGGCGATGGCGAGG</td><td> 10</td><td> 788</td>

<td> 729278</td><td> N/A</td><td> N/A</td><td> 876</td><td> 891</td><td> AACCCCCATTCTGGGC</td><td> 6</td><td> 789</td>

<td> 729279</td><td> N/A</td><td> N/A</td><td> 886</td><td> 901</td><td> GGCTCCCGGGAACCCC</td><td> 11</td><td> 790</td>

<td> 729280</td><td> N/A</td><td> N/A</td><td> 911</td><td> 926</td><td> TGTGGTCCAAGCCAGC</td><td> 29</td><td> 791</td>

<td> 729281</td><td> N/A</td><td> N/A</td><td> 931</td><td> 946</td><td> AGGATCGGGCCTCGCT</td><td> 30</td><td> 792</td>

<td> 729282</td><td> N/A</td><td> N/A</td><td> 941</td><td> 956</td><td> ATCGAAAGTAAGGATC</td><td> 17</td><td> 793</td>

<td> 729283</td><td> N/A</td><td> N/A</td><td> 957</td><td> 972</td><td> GAGCAAGGGCGAGTGC</td><td> 29</td><td> 794</td>

<td> 729284</td><td> N/A</td><td> N/A</td><td> 967</td><td> 982</td><td> GGCCCGGTAAGAGCAA</td><td> 6</td><td> 795</td>

<td> 729285</td><td> N/A</td><td> N/A</td><td> 986</td><td> 1001</td><td> TTTCCGAAAGGGTGAG</td><td> 32</td><td> 796</td>

<td> 729286</td><td> N/A</td><td> N/A</td><td> 1028</td><td> 1043</td><td> GCCTGAAGATCCCGGG</td><td> 14</td><td> 797</td>

<td> 729287</td><td> N/A</td><td> N/A</td><td> 1038</td><td> 1053</td><td> CCTGCCATTGGCCTGA</td><td> 14</td><td> 798</td>

<td> 729288</td><td> N/A</td><td> N/A</td><td> 1057</td><td> 1072</td><td> CCCAAACTCTTGCACA</td><td> 25</td><td> 799</td>

<td> 729289</td><td> N/A</td><td> N/A</td><td> 1074</td><td> 1089</td><td> ACCTGACACCATCTTC</td><td> 9</td><td> 800</td>

<td> 729290</td><td> N/A</td><td> N/A</td><td> 1085</td><td> 1100</td><td> ACGCAGCCTCTACCTG</td><td> 0</td><td> 801</td>

<td> 729291</td><td> N/A</td><td> N/A</td><td> 1096</td><td> 1111</td><td> CGAGCCCAGGGACGCA</td><td> 16</td><td> 802</td>

<td> 729292</td><td> N/A</td><td> N/A</td><td> 1107</td><td> 1122</td><td> ATTCCCGGCCGCGAGC</td><td> 19</td><td> 803</td>

<td> 729293</td><td> N/A</td><td> N/A</td><td> 1117</td><td> 1132</td><td> AGAGTCTGCCATTCCC</td><td> 44</td><td> 804</td>

<td> 729294</td><td> N/A</td><td> N/A</td><td> 1157</td><td> 1172</td><td> GAACTATTGCGCCCCA</td><td> 35</td><td> 805</td>

<td> 729295</td><td> N/A</td><td> N/A</td><td> 1167</td><td> 1182</td><td> ACCAGCCCAGGAACTA</td><td> 15</td><td> 806</td>

<td> 729296</td><td> N/A</td><td> N/A</td><td> 1177</td><td> 1192</td><td> ACCTGAGGAAACCAGC</td><td> 15</td><td> 807</td>

<td> 729297</td><td> N/A</td><td> N/A</td><td> 1190</td><td> 1205</td><td> GTTCTGGGACAGGACC</td><td> 19</td><td> 808</td>

<td> 729298</td><td> N/A</td><td> N/A</td><td> 1213</td><td> 1228</td><td> CCTCTTCATTGTTGCC</td><td> 42</td><td> 809</td>

<td> 729299</td><td> N/A</td><td> N/A</td><td> 1244</td><td> 1259</td><td> CATGCTAGCCTCACTT</td><td> 23</td><td> 810</td>

<td> 729300</td><td> N/A</td><td> N/A</td><td> 1268</td><td> 1283</td><td> AACCATCTCCCCACGC</td><td> 21</td><td> 811</td>

<td> 729301</td><td> N/A</td><td> N/A</td><td> 1278</td><td> 1293</td><td> GTCCGGAGACAACCAT</td><td> 13</td><td> 812</td>

<td> 729302</td><td> N/A</td><td> N/A</td><td> 1308</td><td> 1323</td><td> TCCCAGGTACCCGCTC</td><td> 7</td><td> 813</td>

<td> 729303</td><td> N/A</td><td> N/A</td><td> 1330</td><td> 1345</td><td> AGTCCCCCACTCCAGC</td><td> 23</td><td> 814</td>

<td> 729304</td><td> N/A</td><td> N/A</td><td> 1342</td><td> 1357</td><td> CGAGGCTGGGAAAGTC</td><td> 18</td><td> 815</td>

<td> 729305</td><td> N/A</td><td> N/A</td><td> 1370</td><td> 1385</td><td> CCTCGCCCTGCTGTGT</td><td> 18</td><td> 816</td>

<td> 729306</td><td> N/A</td><td> N/A</td><td> 1380</td><td> 1395</td><td> GCACCCCGGTCCTCGC</td><td> 27</td><td> 817</td>

<td> 729307</td><td> N/A</td><td> N/A</td><td> 1557</td><td> 1572</td><td> ATTCTGGGCCCTCGAG</td><td> 3</td><td> 818</td>

<td> 729308</td><td> N/A</td><td> N/A</td><td> 1579</td><td> 1594</td><td> CTGGTTCTGGTCACTT</td><td> 41</td><td> 819</td>

<td> 729309</td><td> N/A</td><td> N/A</td><td> 1591</td><td> 1606</td><td> GCCGAGCCCTCTCTGG</td><td> 13</td><td> 820</td>

<td> 729310</td><td> N/A</td><td> N/A</td><td> 1601</td><td> 1616</td><td> CATCGATACAGCCGAG</td><td> 42</td><td> 821</td>

<td> 729311</td><td> N/A</td><td> N/A</td><td> 1638</td><td> 1653</td><td> CTTGCCAGAGGGCCTC</td><td> 40</td><td> 822</td>

<td> 729312</td><td> N/A</td><td> N/A</td><td> 1676</td><td> 1691</td><td> CCCCATAACTACTGGG</td><td> 20</td><td> 823</td>

<td> 729313</td><td> N/A</td><td> N/A</td><td> 1702</td><td> 1717</td><td> GAACCCCTCAGCCCCA</td><td> 8</td><td> 824</td>

<td> 729314</td><td> N/A</td><td> N/A</td><td> 1712</td><td> 1727</td><td> TTGACTCTTGGAACCC</td><td> 40</td><td> 825</td>

<td> 729315</td><td> N/A</td><td> N/A</td><td> 1722</td><td> 1737</td><td> AGTGCTTCCCTTGACT</td><td> 20</td><td> 826</td>

<td> 729316</td><td> N/A</td><td> N/A</td><td> 1748</td><td> 1763</td><td> CTTTAGATAAAAAGGG</td><td> 12</td><td> 827</td>

<td> 729317</td><td> N/A</td><td> N/A</td><td> 1758</td><td> 1773</td><td> AAAGTAGGGCCTTTAG</td><td> 27</td><td> 828</td>

<td> 729318</td><td> N/A</td><td> N/A</td><td> 1833</td><td> 1848</td><td> GCCCAGAAAGAAGCTT</td><td> 5</td><td> 829</td>

<td> 729319</td><td> N/A</td><td> N/A</td><td> 1867</td><td> 1882</td><td> GGTCCAGACAGGCTGA</td><td> 15</td><td> 830</td>

<td> 729320</td><td> N/A</td><td> N/A</td><td> 1909</td><td> 1924</td><td> CTCCGGGTCAGCTGCC</td><td> 25</td><td> 831</td>

<td> 729321</td><td> N/A</td><td> N/A</td><td> 1919</td><td> 1934</td><td> AATCCCACCCCTCCGG</td><td> 8</td><td> 832</td>

<td> 729322</td><td> N/A</td><td> N/A</td><td> 1942</td><td> 1957</td><td> CCCTGTACAGGCCCTG</td><td> 1</td><td> 833</td>

<td> 729323</td><td> N/A</td><td> N/A</td><td> 1992</td><td> 2007</td><td> ACATGTCTCCTTGCAA</td><td> 6</td><td> 834</td>

<td> 729324</td><td> N/A</td><td> N/A</td><td> 2002</td><td> 2017</td><td> GGTCTGGGTCACATGT</td><td> 33</td><td> 835</td>

<td> 729325</td><td> N/A</td><td> N/A</td><td> 2036</td><td> 2051</td><td> GCCAGACAGCAGGCGC</td><td> 11</td><td> 836</td>

<td> 729326</td><td> N/A</td><td> N/A</td><td> 2047</td><td> 2062</td><td> TAGTAAGAGTGGCCAG</td><td> 16</td><td> 837</td>

<td> 729327</td><td> N/A</td><td> N/A</td><td> 2058</td><td> 2073</td><td> CACAGCAGTCCTAGTA</td><td> 9</td><td> 838</td>

<td> 729328</td><td> N/A</td><td> N/A</td><td> 2068</td><td> 2083</td><td> GAGGAAGTGCCACAGC</td><td> 17</td><td> 839</td>

<td> 729329</td><td> N/A</td><td> N/A</td><td> 2100</td><td> 2115</td><td> TGCAATTCATGGGCAC</td><td> 18</td><td> 840</td>

<td> 729330</td><td> N/A</td><td> N/A</td><td> 2110</td><td> 2125</td><td> ACCCAGGAGCTGCAAT</td><td> 4</td><td> 841</td>

<td> 729331</td><td> N/A</td><td> N/A</td><td> 2129</td><td> 2144</td><td> AGACAGTGCCCCCACC</td><td> 5</td><td> 842</td>

<td> 729332</td><td> N/A</td><td> N/A</td><td> 2170</td><td> 2185</td><td> TAAGCCCACAGCTCAC</td><td> 0</td><td> 843</td>

<td> 729333</td><td> N/A</td><td> N/A</td><td> 2187</td><td> 2202</td><td> GACCTGCTGAGGTGGG</td><td> 15</td><td> 844</td>

<td> 729637</td><td> N/A</td><td> N/A</td><td> 716</td><td> 731</td><td> GGCGCACCCTGCTGTA</td><td> 17</td><td> 845</td>

<td> 729638</td><td> N/A</td><td> N/A</td><td> 1234</td><td> 1249</td><td> TCACTTTTCCTCCACG</td><td> 38</td><td> 846</td>

<td> 729639</td><td> N/A</td><td> N/A</td><td> 1452</td><td> 1467</td><td> GGGCCAGCCCGCGGAG</td><td> 15</td><td> 847</td>

<td> 729640</td><td> N/A</td><td> N/A</td><td> 1611</td><td> 1626</td><td> CAGTTTCCTACATCGA</td><td> 22</td><td> 848</td>

Table 12

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 73</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 63</td><td> 468</td>

<td> 729195</td><td> N/A</td><td> N/A</td><td> 3775</td><td> 3790</td><td> TCGGGTAGCACTTAGG</td><td> 53</td><td> 849</td>

<td> 729334</td><td> N/A</td><td> N/A</td><td> 2204</td><td> 2219</td><td> AGTGGGCAGCCCTAGA</td><td> 12</td><td> 850</td>

<td> 729335</td><td> N/A</td><td> N/A</td><td> 2224</td><td> 2239</td><td> TGTGAGGCAGCGAAGC</td><td> 32</td><td> 851</td>

<td> 729336</td><td> N/A</td><td> N/A</td><td> 2234</td><td> 2249</td><td> CCTACAATTGTGTGAG</td><td> 10</td><td> 852</td>

<td> 729337</td><td> N/A</td><td> N/A</td><td> 2258</td><td> 2273</td><td> GAAATCCAACAGCCTG</td><td> 25</td><td> 853</td>

<td> 729338</td><td> N/A</td><td> N/A</td><td> 2274</td><td> 2289</td><td> AGCCCCGGAAGGTGGG</td><td> 11</td><td> 854</td>

<td> 729339</td><td> N/A</td><td> N/A</td><td> 2284</td><td> 2299</td><td> AATGGACCTGAGCCCC</td><td> 25</td><td> 855</td>

<td> 729340</td><td> N/A</td><td> N/A</td><td> 2304</td><td> 2319</td><td> TGGAGCCCTAGACCTA</td><td> 13</td><td> 856</td>

<td> 729341</td><td> N/A</td><td> N/A</td><td> 2314</td><td> 2329</td><td> GTGAAATGTATGGAGC</td><td> 20</td><td> 857</td>

<td> 729342</td><td> N/A</td><td> N/A</td><td> 2324</td><td> 2339</td><td> GAGTCTCTGGGTGAAA</td><td> 16</td><td> 858</td>

<td> 729343</td><td> N/A</td><td> N/A</td><td> 2334</td><td> 2349</td><td> CCAGGCTCCGGAGTCT</td><td> 0</td><td> 859</td>

<td> 729344</td><td> N/A</td><td> N/A</td><td> 2365</td><td> 2380</td><td> TGGAAGTTCGGTGTCA</td><td> 27</td><td> 860</td>

<td> 729345</td><td> N/A</td><td> N/A</td><td> 2376</td><td> 2391</td><td> GCCCATGACTTTGGAA</td><td> 8</td><td> 861</td>

<td> 729346</td><td> N/A</td><td> N/A</td><td> 2386</td><td> 2401</td><td> CCCAATCAAGGCCCAT</td><td> 16</td><td> 862</td>

<td> 729347</td><td> N/A</td><td> N/A</td><td> 2405</td><td> 2420</td><td> TAGGTCTAATTCAGAC</td><td> 6</td><td> 863</td>

<td> 729348</td><td> N/A</td><td> N/A</td><td> 2415</td><td> 2430</td><td> AGAAAAGGGCTAGGTC</td><td> 0</td><td> 864</td>

<td> 729349</td><td> N/A</td><td> N/A</td><td> 2444</td><td> 2459</td><td> TCCATCCTCCTAGAAG</td><td> 0</td><td> 865</td>

<td> 729350</td><td> N/A</td><td> N/A</td><td> 2454</td><td> 2469</td><td> CCGAACAGCATCCATC</td><td> 3</td><td> 866</td>

<td> 729351</td><td> N/A</td><td> N/A</td><td> 2464</td><td> 2479</td><td> GAGCTCTAACCCGAAC</td><td> 0</td><td> 867</td>

<td> 729352</td><td> N/A</td><td> N/A</td><td> 2507</td><td> 2522</td><td> AGGGACTCAGCCTCAA</td><td> 18</td><td> 868</td>

<td> 729353</td><td> N/A</td><td> N/A</td><td> 2517</td><td> 2532</td><td> ATGCCACAGAAGGGAC</td><td> 15</td><td> 869</td>

<td> 729354</td><td> N/A</td><td> N/A</td><td> 2527</td><td> 2542</td><td> TCTGTCCACCATGCCA</td><td> 6</td><td> 870</td>

<td> 729355</td><td> N/A</td><td> N/A</td><td> 2538</td><td> 2553</td><td> ATGAGCGAGAGTCTGT</td><td> 25</td><td> 871</td>

<td> 729356</td><td> N/A</td><td> N/A</td><td> 2615</td><td> 2630</td><td> GTGTCAGAGGGCCGCG</td><td> 28</td><td> 872</td>

<td> 729357</td><td> N/A</td><td> N/A</td><td> 2625</td><td> 2640</td><td> TCCGACCTCAGTGTCA</td><td> 20</td><td> 873</td>

<td> 729358</td><td> N/A</td><td> N/A</td><td> 2635</td><td> 2650</td><td> AAATGATAACTCCGAC</td><td> 27</td><td> 874</td>

<td> 729359</td><td> N/A</td><td> N/A</td><td> 2658</td><td> 2673</td><td> GTTTAATACAGAGCAA</td><td> 36</td><td> 875</td>

<td> 729360</td><td> N/A</td><td> N/A</td><td> 2668</td><td> 2683</td><td> CAACACGGCTGTTTAA</td><td> 0</td><td> 876</td>

<td> 729361</td><td> N/A</td><td> N/A</td><td> 2695</td><td> 2710</td><td> CTGTCAGTCCAGCAGT</td><td> 29</td><td> 877</td>

<td> 729362</td><td> N/A</td><td> N/A</td><td> 2708</td><td> 2723</td><td> TGCCTGCCCCCTACTG</td><td> 5</td><td> 878</td>

<td> 729363</td><td> N/A</td><td> N/A</td><td> 2755</td><td> 2770</td><td> GAGGCCGTGCAGGCGC</td><td> 23</td><td> 879</td>

<td> 729364</td><td> N/A</td><td> N/A</td><td> 2768</td><td> 2783</td><td> GACCCCCTGGGCTGAG</td><td> 17</td><td> 880</td>

<td> 729365</td><td> N/A</td><td> N/A</td><td> 2778</td><td> 2793</td><td> CTTCCCTAATGACCCC</td><td> 19</td><td> 881</td>

<td> 729366</td><td> N/A</td><td> N/A</td><td> 2799</td><td> 2814</td><td> TCTGCACAGAATCGGG</td><td> 18</td><td> 882</td>

<td> 729367</td><td> N/A</td><td> N/A</td><td> 2823</td><td> 2838</td><td> CAAGGGTGGACAGAGG</td><td> 14</td><td> 883</td>

<td> 729368</td><td> N/A</td><td> N/A</td><td> 2833</td><td> 2848</td><td> TCTGGCCGAGCAAGGG</td><td> 24</td><td> 884</td>

<td> 729369</td><td> N/A</td><td> N/A</td><td> 2843</td><td> 2858</td><td> GGCACACAATTCTGGC</td><td> 3</td><td> 885</td>

<td> 729370</td><td> N/A</td><td> N/A</td><td> 2874</td><td> 2889</td><td> GCCCTAGAATAGAGGG</td><td> 9</td><td> 886</td>

<td> 729371</td><td> N/A</td><td> N/A</td><td> 2884</td><td> 2899</td><td> AGAGGCCTTGGCCCTA</td><td> 5</td><td> 887</td>

<td> 729372</td><td> N/A</td><td> N/A</td><td> 2911</td><td> 2926</td><td> ACCCATAGTTGTATCT</td><td> 13</td><td> 888</td>

<td> 729373</td><td> N/A</td><td> N/A</td><td> 2935</td><td> 2950</td><td> GGTTTATAACATGGGT</td><td> 11</td><td> 889</td>

<td> 729374</td><td> N/A</td><td> N/A</td><td> 2974</td><td> 2989</td><td> GCACCCCAAACTTGCA</td><td> 11</td><td> 890</td>

<td> 729375</td><td> N/A</td><td> N/A</td><td> 2984</td><td> 2999</td><td> GCTGTTCCCCGCACCC</td><td> 17</td><td> 891</td>

<td> 729376</td><td> N/A</td><td> N/A</td><td> 2995</td><td> 3010</td><td> TCCCACCCAGAGCTGT</td><td> 7</td><td> 892</td>

<td> 729377</td><td> N/A</td><td> N/A</td><td> 3016</td><td> 3031</td><td> CCCCAGACCAAATTTC</td><td> 0</td><td> 893</td>

<td> 729378</td><td> N/A</td><td> N/A</td><td> 3026</td><td> 3041</td><td> CGAGTGGGTCCCCCAG</td><td> 17</td><td> 894</td>

<td> 729379</td><td> N/A</td><td> N/A</td><td> 3052</td><td> 3067</td><td> ACTCACTGTGGGCTGA</td><td> 22</td><td> 895</td>

<td> 729380</td><td> N/A</td><td> N/A</td><td> 3080</td><td> 3095</td><td> GGCTAGACCGGGACAA</td><td> 29</td><td> 896</td>

<td> 729381</td><td> N/A</td><td> N/A</td><td> 3090</td><td> 3105</td><td> AAACGAAAGTGGCTAG</td><td> 11</td><td> 897</td>

<td> 729382</td><td> N/A</td><td> N/A</td><td> 3108</td><td> 3123</td><td> TCCACCCGGCCCCAGG</td><td> 3</td><td> 898</td>

<td> 729383</td><td> N/A</td><td> N/A</td><td> 3329</td><td> 3344</td><td> CCCAGTACCTTTTGGG</td><td> 0</td><td> 899</td>

<td> 729384</td><td> N/A</td><td> N/A</td><td> 3339</td><td> 3354</td><td> AAATTCCCTGCCCAGT</td><td> 6</td><td> 900</td>

<td> 729385</td><td> N/A</td><td> N/A</td><td> 3372</td><td> 3387</td><td> TGGCCTTGCAGCATGG</td><td> 27</td><td> 901</td>

<td> 729386</td><td> N/A</td><td> N/A</td><td> 3386</td><td> 3401</td><td> GTCTGGGCCTGCTTTG</td><td> 23</td><td> 902</td>

<td> 729387</td><td> N/A</td><td> N/A</td><td> 3396</td><td> 3411</td><td> AACTCCCTGTGTCTGG</td><td> 18</td><td> 903</td>

<td> 729388</td><td> N/A</td><td> N/A</td><td> 3447</td><td> 3462</td><td> CATCAGAAGTGAATGT</td><td> 8</td><td> 904</td>

<td> 729389</td><td> N/A</td><td> N/A</td><td> 3458</td><td> 3473</td><td> ACAGCACAGCCCATCA</td><td> 14</td><td> 905</td>

<td> 729390</td><td> N/A</td><td> N/A</td><td> 3468</td><td> 3483</td><td> GGGTCATTACACAGCA</td><td> 23</td><td> 906</td>

<td> 729391</td><td> N/A</td><td> N/A</td><td> 3509</td><td> 3524</td><td> GCCCTTCACTTGAGAC</td><td> 13</td><td> 907</td>

<td> 729392</td><td> N/A</td><td> N/A</td><td> 3519</td><td> 3534</td><td> CATGCCCTTGGCCCTT</td><td> 8</td><td> 908</td>

<td> 729393</td><td> N/A</td><td> N/A</td><td> 3530</td><td> 3545</td><td> CTCCCCTTACCCATGC</td><td> 0</td><td> 909</td>

<td> 729394</td><td> N/A</td><td> N/A</td><td> 3556</td><td> 3571</td><td> GTCCTGAGTCCCCTTC</td><td> 0</td><td> 910</td>

<td> 729395</td><td> N/A</td><td> N/A</td><td> 3567</td><td> 3582</td><td> AACTCTCCACAGTCCT</td><td> 10</td><td> 911</td>

<td> 729396</td><td> N/A</td><td> N/A</td><td> 3631</td><td> 3646</td><td> AGGCCAGAGGGACCCT</td><td> 0</td><td> 912</td>

<td> 729397</td><td> N/A</td><td> N/A</td><td> 3648</td><td> 3663</td><td> ACTGCCTCCCTGGAGT</td><td> 0</td><td> 913</td>

<td> 729398</td><td> N/A</td><td> N/A</td><td> 3695</td><td> 3710</td><td> TGCTACCTACCCAGGG</td><td> 2</td><td> 914</td>

<td> 729399</td><td> N/A</td><td> N/A</td><td> 3705</td><td> 3720</td><td> CAGCTCTAACTGCTAC</td><td> 0</td><td> 915</td>

<td> 729400</td><td> N/A</td><td> N/A</td><td> 3729</td><td> 3744</td><td> GAAGGCTACAGGAAAC</td><td> 0</td><td> 916</td>

<td> 729401</td><td> N/A</td><td> N/A</td><td> 3739</td><td> 3754</td><td> AGCCTGTTAGGAAGGC</td><td> 0</td><td> 917</td>

<td> 729402</td><td> N/A</td><td> N/A</td><td> 3749</td><td> 3764</td><td> CGCCTGCCGGAGCCTG</td><td> 18</td><td> 918</td>

<td> 729403</td><td> N/A</td><td> N/A</td><td> 3762</td><td> 3777</td><td> AGGAAGGCCCTAACGC</td><td> 0</td><td> 919</td>

<td> 729641</td><td> N/A</td><td> N/A</td><td> 2214</td><td> 2229</td><td> CGAAGCATCCAGTGGG</td><td> 20</td><td> 920</td>

<td> 729642</td><td> N/A</td><td> N/A</td><td> 2474</td><td> 2489</td><td> AGGTCCACACGAGCTC</td><td> 30</td><td> 921</td>

<td> 729643</td><td> N/A</td><td> N/A</td><td> 2593</td><td> 2608</td><td> CAGGCAGCTTAGGGAG</td><td> 1</td><td> 922</td>

<td> 729644</td><td> N/A</td><td> N/A</td><td> 2945</td><td> 2960</td><td> CATTTAGTGTGGTTTA</td><td> 28</td><td> 923</td>

<td> 729645</td><td> N/A</td><td> N/A</td><td> 3362</td><td> 3377</td><td> GCATGGAGCCTCAGTT</td><td> 33</td><td> 924</td>

<td> 729646</td><td> N/A</td><td> N/A</td><td> 3499</td><td> 3514</td><td> TGAGACCCCTGGGTGG</td><td> 21</td><td> 925</td>

Table 13

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 83</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 59</td><td> 468</td>

<td> 666150</td><td> N/A</td><td> N/A</td><td> 3779</td><td> 3794</td><td> GCATTCGGGTAGCACT</td><td> 46</td><td> 926</td>

<td> 666168</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACTGTGTACC</td><td> 62</td><td> 927</td>

<td> 729196</td><td> N/A</td><td> N/A</td><td> 3776</td><td> 3791</td><td> TTCGGGTAGCACTTAG</td><td> 49</td><td> 928</td>

<td> 729197</td><td> N/A</td><td> N/A</td><td> 3777</td><td> 3792</td><td> ATTCGGGTAGCACTTA</td><td> 36</td><td> 929</td>

<td> 729198</td><td> N/A</td><td> N/A</td><td> 3778</td><td> 3793</td><td> CATTCGGGTAGCACTT</td><td> 33</td><td> 930</td>

<td> 729199</td><td> N/A</td><td> N/A</td><td> 3780</td><td> 3795</td><td> CGCATTCGGGTAGCAC</td><td> 46</td><td> 931</td>

<td> 729200</td><td> N/A</td><td> N/A</td><td> 3781</td><td> 3796</td><td> ACGCATTCGGGTAGCA</td><td> 40</td><td> 932</td>

<td> 729201</td><td> N/A</td><td> N/A</td><td> 3782</td><td> 3797</td><td> CACGCATTCGGGTAGC</td><td> 59</td><td> 933</td>

<td> 729202</td><td> N/A</td><td> N/A</td><td> 3783</td><td> 3798</td><td> ACACGCATTCGGGTAG</td><td> 36</td><td> 934</td>

<td> 729203</td><td> N/A</td><td> N/A</td><td> 3784</td><td> 3799</td><td> GACACGCATTCGGGTA</td><td> 35</td><td> 935</td>

<td> 729204</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTACCCCAT</td><td> 50</td><td> 936</td>

<td> 729205</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGTACCCCA</td><td> 72</td><td> 937</td>

<td> 729206</td><td> N/A</td><td> N/A</td><td> 5284</td><td> 5299</td><td> CACCACTGTGTACCCC</td><td> 71</td><td> 938</td>

<td> 729207</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTGTGTACCC</td><td> 57</td><td> 939</td>

<td> 729208</td><td> N/A</td><td> N/A</td><td> 5287</td><td> 5302</td><td> AATCACCACTGTGTAC</td><td> 20</td><td> 940</td>

<td> 729209</td><td> N/A</td><td> N/A</td><td> 5288</td><td> 5303</td><td> AAATCACCACTGTGTA</td><td> 32</td><td> 941</td>

<td> 729210</td><td> N/A</td><td> N/A</td><td> 5289</td><td> 5304</td><td> CAAATCACCACTGTGT</td><td> 12</td><td> 942</td>

<td> 729211</td><td> N/A</td><td> N/A</td><td> 5290</td><td> 5305</td><td> TCAAATCACCACTGTG</td><td> 44</td><td> 943</td>

<td> 729212</td><td> N/A</td><td> N/A</td><td> 5291</td><td> 5306</td><td> ATCAAATCACCACTGT</td><td> 42</td><td> 944</td>

<td> 729404</td><td> N/A</td><td> N/A</td><td> 3812</td><td> 3827</td><td> CTTGGTCCTCCCCCTT</td><td> 21</td><td> 945</td>

<td> 729405</td><td> N/A</td><td> N/A</td><td> 3822</td><td> 3837</td><td> CATCTAGGTTCTTGGT</td><td> 27</td><td> 946</td>

<td> 729406</td><td> N/A</td><td> N/A</td><td> 3835</td><td> 3850</td><td> CTCTAGGGCCATTCAT</td><td> 19</td><td> 947</td>

<td> 729407</td><td> N/A</td><td> N/A</td><td> 3855</td><td> 3870</td><td> GCACCAAACAGATGTT</td><td> 19</td><td> 948</td>

<td> 729408</td><td> N/A</td><td> N/A</td><td> 3885</td><td> 3900</td><td> ACCAACTCAACCCACC</td><td> 13</td><td> 949</td>

<td> 729409</td><td> N/A</td><td> N/A</td><td> 3895</td><td> 3910</td><td> AATCCCATCAACCAAC</td><td> 15</td><td> 950</td>

<td> 729410</td><td> N/A</td><td> N/A</td><td> 3905</td><td> 3920</td><td> TCTTTAGAGAAATCCC</td><td> 38</td><td> 951</td>

<td> 729411</td><td> N/A</td><td> N/A</td><td> 3943</td><td> 3958</td><td> AAGGACACCTGCCCTC</td><td> 6</td><td> 952</td>

<td> 729412</td><td> N/A</td><td> N/A</td><td> 3954</td><td> 3969</td><td> CTGGAGCTCCCAAGGA</td><td> 17</td><td> 953</td>

<td> 729413</td><td> N/A</td><td> N/A</td><td> 3965</td><td> 3980</td><td> AAGAATCTCATCTGGA</td><td> 4</td><td> 954</td>

<td> 729414</td><td> N/A</td><td> N/A</td><td> 3975</td><td> 3990</td><td> TGCCCTCAACAAGAAT</td><td> 0</td><td> 955</td>

<td> 729415</td><td> N/A</td><td> N/A</td><td> 3995</td><td> 4010</td><td> CTGAGAGTTCCCTCCG</td><td> 22</td><td> 956</td>

<td> 729416</td><td> N/A</td><td> N/A</td><td> 4059</td><td> 4074</td><td> CTCCTGCTCAGTCTAC</td><td> 21</td><td> 957</td>

<td> 729417</td><td> N/A</td><td> N/A</td><td> 4100</td><td> 4115</td><td> CTGGGACAGCGAGCGC</td><td> 47</td><td> 958</td>

<td> 729418</td><td> N/A</td><td> N/A</td><td> 4120</td><td> 4135</td><td> TCTTGTCTCAAGCTGG</td><td> 32</td><td> 959</td>

<td> 729419</td><td> N/A</td><td> N/A</td><td> 4140</td><td> 4155</td><td> TGACACCAAAAGCCCG</td><td> 37</td><td> 960</td>

<td> 729420</td><td> N/A</td><td> N/A</td><td> 4150</td><td> 4165</td><td> AGTGACTGCCTGACAC</td><td> 11</td><td> 961</td>

<td> 729421</td><td> N/A</td><td> N/A</td><td> 4185</td><td> 4200</td><td> GCCCACCCCTTGCTCT</td><td> 11</td><td> 962</td>

<td> 729422</td><td> N/A</td><td> N/A</td><td> 4205</td><td> 4220</td><td> CTACTCACACCACAGG</td><td> 38</td><td> 963</td>

<td> 729423</td><td> N/A</td><td> N/A</td><td> 4215</td><td> 4230</td><td> CCGCCTTCCACTACTC</td><td> 26</td><td> 964</td>

<td> 729424</td><td> N/A</td><td> N/A</td><td> 4225</td><td> 4240</td><td> GGCCAGAGAACCGCCT</td><td> 14</td><td> 965</td>

<td> 729425</td><td> N/A</td><td> N/A</td><td> 4241</td><td> 4256</td><td> CAGCAAGCAGCCCGTT</td><td> 21</td><td> 966</td>

<td> 729426</td><td> N/A</td><td> N/A</td><td> 4251</td><td> 4266</td><td> CTGCTAACAGCAGCAA</td><td> 10</td><td> 967</td>

<td> 729427</td><td> N/A</td><td> N/A</td><td> 4261</td><td> 4276</td><td> CATTCTCCAACTGCTA</td><td> 43</td><td> 968</td>

<td> 729428</td><td> N/A</td><td> N/A</td><td> 4272</td><td> 4287</td><td> GCAGAGGCATCCATTC</td><td> 19</td><td> 969</td>

<td> 729429</td><td> N/A</td><td> N/A</td><td> 4292</td><td> 4307</td><td> CCCCAGGTGCCCTTTA</td><td> 7</td><td> 970</td>

<td> 729430</td><td> N/A</td><td> N/A</td><td> 4304</td><td> 4319</td><td> CTGCGGGCGCGGCCCC</td><td> 22</td><td> 971</td>

<td> 729431</td><td> N/A</td><td> N/A</td><td> 4324</td><td> 4339</td><td> GAGTTACGAGTTAGTG</td><td> 49</td><td> 972</td>

<td> 729432</td><td> N/A</td><td> N/A</td><td> 4357</td><td> 4372</td><td> TCATGGAATTTTGTGT</td><td> 31</td><td> 973</td>

<td> 729433</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGTCATGG</td><td> 64</td><td> 974</td>

<td> 729434</td><td> N/A</td><td> N/A</td><td> 4379</td><td> 4394</td><td> GCATCAGCTTTCTTGT</td><td> 39</td><td> 975</td>

<td> 729435</td><td> N/A</td><td> N/A</td><td> 4401</td><td> 4416</td><td> TAAGGCCAATTCTCTT</td><td> 19</td><td> 976</td>

<td> 729436</td><td> N/A</td><td> N/A</td><td> 4412</td><td> 4427</td><td> ATCTAGGTATTTAAGG</td><td> 19</td><td> 977</td>

<td> 729437</td><td> N/A</td><td> N/A</td><td> 4422</td><td> 4437</td><td> TCTCCAGTCCATCTAG</td><td> 15</td><td> 978</td>

<td> 729438</td><td> N/A</td><td> N/A</td><td> 4432</td><td> 4447</td><td> AAGGATGGTCTCTCCA</td><td> 14</td><td> 979</td>

<td> 729439</td><td> N/A</td><td> N/A</td><td> 4457</td><td> 4472</td><td> CTCAGAGGTCAAGCTA</td><td> 30</td><td> 980</td>

<td> 729440</td><td> N/A</td><td> N/A</td><td> 4484</td><td> 4499</td><td> GGTCTGCAGGTGGATG</td><td> 26</td><td> 981</td>

<td> 729441</td><td> N/A</td><td> N/A</td><td> 4730</td><td> 4745</td><td> GGGCTTACCTTGAAGA</td><td> 20</td><td> 982</td>

<td> 729442</td><td> N/A</td><td> N/A</td><td> 4744</td><td> 4759</td><td> CAACCTCCTCCCCGGG</td><td> 12</td><td> 983</td>

<td> 729443</td><td> N/A</td><td> N/A</td><td> 4754</td><td> 4769</td><td> GAGGTCCAGCCAACCT</td><td> 1</td><td> 984</td>

<td> 729444</td><td> N/A</td><td> N/A</td><td> 4790</td><td> 4805</td><td> TTATGTGCGCTCCTCT</td><td> 26</td><td> 985</td>

<td> 729445</td><td> N/A</td><td> N/A</td><td> 4806</td><td> 4821</td><td> GAGCTGCCTGTGTGCG</td><td> 31</td><td> 986</td>

<td> 729446</td><td> N/A</td><td> N/A</td><td> 4817</td><td> 4832</td><td> CCAGCCTCGAGGAGCT</td><td> 4</td><td> 987</td>

<td> 729447</td><td> N/A</td><td> N/A</td><td> 4853</td><td> 4868</td><td> CCGGCATCAGCAGCAG</td><td> 57</td><td> 988</td>

<td> 729448</td><td> N/A</td><td> N/A</td><td> 4897</td><td> 4912</td><td> AAAGGTGTACCCTGTG</td><td> 36</td><td> 989</td>

<td> 729449</td><td> N/A</td><td> N/A</td><td> 5076</td><td> 5091</td><td> AAGATGTGCCCTAGGC</td><td> 35</td><td> 990</td>

<td> 729450</td><td> N/A</td><td> N/A</td><td> 5087</td><td> 5102</td><td> GCAGGTTAGAAAAGAT</td><td> 16</td><td> 991</td>

<td> 729451</td><td> N/A</td><td> N/A</td><td> 5097</td><td> 5112</td><td> GCTCTAGGGTGCAGGT</td><td> 49</td><td> 992</td>

<td> 729452</td><td> N/A</td><td> N/A</td><td> 5107</td><td> 5122</td><td> TCCCCACGATGCTCTA</td><td> 14</td><td> 993</td>

<td> 729453</td><td> N/A</td><td> N/A</td><td> 5140</td><td> 5155</td><td> CGAGTTATGGGAAGGC</td><td> 66</td><td> 994</td>

<td> 729454</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGAGACGAGCA</td><td> 75</td><td> 995</td>

<td> 729455</td><td> N/A</td><td> N/A</td><td> 5190</td><td> 5205</td><td> AACAAGTCCTCATGAG</td><td> 19</td><td> 996</td>

<td> 729456</td><td> N/A</td><td> N/A</td><td> 5213</td><td> 5228</td><td> TCCTTTAGCATATGCG</td><td> 67</td><td> 997</td>

<td> 729647</td><td> N/A</td><td> N/A</td><td> 3845</td><td> 3860</td><td> GATGTTACCTCTCTAG</td><td> 38</td><td> 998</td>

<td> 729648</td><td> N/A</td><td> N/A</td><td> 4016</td><td> 4031</td><td> AGTTTTCTCACCCTCC</td><td> 49</td><td> 999</td>

<td> 729649</td><td> N/A</td><td> N/A</td><td> 4049</td><td> 4064</td><td> GTCTACACCCCTAGTT</td><td> 24</td><td> 1000</td>

<td> 729650</td><td> N/A</td><td> N/A</td><td> 4195</td><td> 4210</td><td> CACAGGTTAGGCCCAC</td><td> 44</td><td> 1001</td>

<td> 729651</td><td> N/A</td><td> N/A</td><td> 4467</td><td> 4482</td><td> GGACAGGGTACTCAGA</td><td> 26</td><td> 1002</td>

Table 14

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 23</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 46</td><td> 468</td>

<td> 666178</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATATACACA</td><td> 51</td><td> 1003</td>

<td> 666184</td><td> N/A</td><td> N/A</td><td> 6972</td><td> 6987</td><td> TGCCTTTTAATGTTGA</td><td> 36</td><td> 1004</td>

<td> 666187</td><td> N/A</td><td> N/A</td><td> 7176</td><td> 7191</td><td> CTAGACAAATATGCAG</td><td> 29</td><td> 1005</td>

<td> 729213</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATACACAC</td><td> 71</td><td> 1006</td>

<td> 729214</td><td> N/A</td><td> N/A</td><td> 6541</td><td> 6556</td><td> TGCATTCCATATACAC</td><td> 28</td><td> 1007</td>

<td> 729215</td><td> N/A</td><td> N/A</td><td> 6542</td><td> 6557</td><td> TTGCATTCCATATACA</td><td> 27</td><td> 1008</td>

<td> 729216</td><td> N/A</td><td> N/A</td><td> 6543</td><td> 6558</td><td> TTTGCATTCCATATAC</td><td> 3</td><td> 1009</td>

<td> 729217</td><td> N/A</td><td> N/A</td><td> 6544</td><td> 6559</td><td> TTTTGCATTCCATATA</td><td> 19</td><td> 1010</td>

<td> 729218</td><td> N/A</td><td> N/A</td><td> 6545</td><td> 6560</td><td> ATTTTGCATTCCATAT</td><td> 20</td><td> 1011</td>

<td> 729219</td><td> N/A</td><td> N/A</td><td> 6969</td><td> 6984</td><td> CTTTTAATGTTGAATT</td><td> 0</td><td> 1012</td>

<td> 729220</td><td> N/A</td><td> N/A</td><td> 6970</td><td> 6985</td><td> CCTTTTAATGTTGAAT</td><td> 0</td><td> 1013</td>

<td> 729221</td><td> N/A</td><td> N/A</td><td> 6971</td><td> 6986</td><td> GCCTTTTAATGTTGAA</td><td> 50</td><td> 1014</td>

<td> 729222</td><td> N/A</td><td> N/A</td><td> 6973</td><td> 6988</td><td> ATGCCTTTTAATGTTG</td><td> 0</td><td> 1015</td>

<td> 729223</td><td> N/A</td><td> N/A</td><td> 6974</td><td> 6989</td><td> TATGCCTTTTAATGTT</td><td> 10</td><td> 1016</td>

<td> 729224</td><td> N/A</td><td> N/A</td><td> 6975</td><td> 6990</td><td> CTATGCCTTTTAATGT</td><td> 0</td><td> 1017</td>

<td> 729225</td><td> N/A</td><td> N/A</td><td> 6976</td><td> 6991</td><td> TCTATGCCTTTTAATG</td><td> 13</td><td> 1018</td>

<td> 729226</td><td> N/A</td><td> N/A</td><td> 7171</td><td> 7186</td><td> CAAATATGCAGATATC</td><td> 3</td><td> 1019</td>

<td> 729227</td><td> N/A</td><td> N/A</td><td> 7173</td><td> 7188</td><td> GACAAATATGCAGATA</td><td> 0</td><td> 1020</td>

<td> 729228</td><td> N/A</td><td> N/A</td><td> 7174</td><td> 7189</td><td> AGACAAATATGCAGAT</td><td> 1</td><td> 1021</td>

<td> 729229</td><td> N/A</td><td> N/A</td><td> 7175</td><td> 7190</td><td> TAGACAAATATGCAGA</td><td> 27</td><td> 1022</td>

<td> 729230</td><td> N/A</td><td> N/A</td><td> 7177</td><td> 7192</td><td> TCTAGACAAATATGCA</td><td> 18</td><td> 1023</td>

<td> 729231</td><td> N/A</td><td> N/A</td><td> 7178</td><td> 7193</td><td> GTCTAGACAAATATGC</td><td> 0</td><td> 1024</td>

<td> 729232</td><td> N/A</td><td> N/A</td><td> 7179</td><td> 7194</td><td> AGTCTAGACAAATATG</td><td> 12</td><td> 1025</td>

<td> 729233</td><td> N/A</td><td> N/A</td><td> 7180</td><td> 7195</td><td> AAGTCTAGACAAATAT</td><td> 0</td><td> 1026</td>

<td> 729234</td><td> N/A</td><td> N/A</td><td> 7181</td><td> 7196</td><td> TAAGTCTAGACAAATA</td><td> 0</td><td> 1027</td>

<td> 729457</td><td> N/A</td><td> N/A</td><td> 5292</td><td> 5307</td><td> TATCAAATCACCACTG</td><td> 0</td><td> 1028</td>

<td> 729458</td><td> N/A</td><td> N/A</td><td> 5302</td><td> 5317</td><td> TCACTGTGCTTATCAA</td><td> 22</td><td> 1029</td>

<td> 729459</td><td> N/A</td><td> N/A</td><td> 5314</td><td> 5329</td><td> TACCTGATCTGATCAC</td><td> 0</td><td> 1030</td>

<td> 729460</td><td> N/A</td><td> N/A</td><td> 5325</td><td> 5340</td><td> GATATGCTAAGTACCT</td><td> 43</td><td> 1031</td>

<td> 729461</td><td> N/A</td><td> N/A</td><td> 5368</td><td> 5383</td><td> GTTTGTTCCCAACACA</td><td> 34</td><td> 1032</td>

<td> 729462</td><td> N/A</td><td> N/A</td><td> 5393</td><td> 5408</td><td> GTATCTGAATCTTATA</td><td> 22</td><td> 1033</td>

<td> 729463</td><td> N/A</td><td> N/A</td><td> 5403</td><td> 5418</td><td> GATTGATGATGTATCT</td><td> 0</td><td> 1034</td>

<td> 729464</td><td> N/A</td><td> N/A</td><td> 5413</td><td> 5428</td><td> ACAATTGAAAGATTGA</td><td> 0</td><td> 1035</td>

<td> 729465</td><td> N/A</td><td> N/A</td><td> 5464</td><td> 5479</td><td> ATCTGGTCAACAGTGT</td><td> 21</td><td> 1036</td>

<td> 729466</td><td> N/A</td><td> N/A</td><td> 5606</td><td> 5621</td><td> CAAGGAGGTTGAGATG</td><td> 0</td><td> 1037</td>

<td> 729467</td><td> N/A</td><td> N/A</td><td> 5804</td><td> 5819</td><td> GTAGTACATCAATTAA</td><td> 0</td><td> 1038</td>

<td> 729468</td><td> N/A</td><td> N/A</td><td> 5814</td><td> 5829</td><td> ATGTACAGTTGTAGTA</td><td> 0</td><td> 1039</td>

<td> 729469</td><td> N/A</td><td> N/A</td><td> 5868</td><td> 5883</td><td> AACACTAGGCAACAGA</td><td> 0</td><td> 1040</td>

<td> 729470</td><td> N/A</td><td> N/A</td><td> 5878</td><td> 5893</td><td> CCAATGGTGCAACACT</td><td> 0</td><td> 1041</td>

<td> 729471</td><td> N/A</td><td> N/A</td><td> 5888</td><td> 5903</td><td> CCACTGCTCACCAATG</td><td> 0</td><td> 1042</td>

<td> 729472</td><td> N/A</td><td> N/A</td><td> 5910</td><td> 5925</td><td> TGGAGGTTGTGCTATG</td><td> 0</td><td> 1043</td>

<td> 729473</td><td> N/A</td><td> N/A</td><td> 5921</td><td> 5936</td><td> TTGAGCTGAGTTGGAG</td><td> 0</td><td> 1044</td>

<td> 729474</td><td> N/A</td><td> N/A</td><td> 6478</td><td> 6493</td><td> ACATCCTAGCATTAAG</td><td> 0</td><td> 1045</td>

<td> 729475</td><td> N/A</td><td> N/A</td><td> 6495</td><td> 6510</td><td> AAACTATTATGCGAGG</td><td> 55</td><td> 1046</td>

<td> 729476</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGCATTCC</td><td> 64</td><td> 1047</td>

<td> 729477</td><td> N/A</td><td> N/A</td><td> 6559</td><td> 6574</td><td> TTCACTTGATTCCAAT</td><td> 14</td><td> 1048</td>

<td> 729478</td><td> N/A</td><td> N/A</td><td> 6614</td><td> 6629</td><td> AAGGAAAGCTGATCCT</td><td> 0</td><td> 1049</td>

<td> 729479</td><td> N/A</td><td> N/A</td><td> 6624</td><td> 6639</td><td> GTATGTTGGAAAGGAA</td><td> 19</td><td> 1050</td>

<td> 729480</td><td> N/A</td><td> N/A</td><td> 6639</td><td> 6654</td><td> AAAAGTGATGTGGACG</td><td> 23</td><td> 1051</td>

<td> 729481</td><td> N/A</td><td> N/A</td><td> 6666</td><td> 6681</td><td> CATTCCAGTGGAAATT</td><td> 2</td><td> 1052</td>

<td> 729482</td><td> N/A</td><td> N/A</td><td> 6679</td><td> 6694</td><td> AATTGTGCTAAACCAT</td><td> 10</td><td> 1053</td>

<td> 729483</td><td> N/A</td><td> N/A</td><td> 6689</td><td> 6704</td><td> TCAGTGACCAAATTGT</td><td> 30</td><td> 1054</td>

<td> 729484</td><td> N/A</td><td> N/A</td><td> 6710</td><td> 6725</td><td> CAAGTATCTAAAAACC</td><td> 0</td><td> 1055</td>

<td> 729485</td><td> N/A</td><td> N/A</td><td> 6752</td><td> 6767</td><td> CATGACAATGTGGTTT</td><td> 37</td><td> 1056</td>

<td> 729486</td><td> N/A</td><td> N/A</td><td> 6762</td><td> 6777</td><td> AGACAGCCTACATGAC</td><td> 23</td><td> 1057</td>

<td> 729487</td><td> N/A</td><td> N/A</td><td> 6772</td><td> 6787</td><td> GGAAGCATTAAGACAG</td><td> 6</td><td> 1058</td>

<td> 729488</td><td> N/A</td><td> N/A</td><td> 6799</td><td> 6814</td><td> CCCAAAATAATTGAGG</td><td> 0</td><td> 1059</td>

<td> 729489</td><td> N/A</td><td> N/A</td><td> 6810</td><td> 6825</td><td> GGAAATCAACCCCCAA</td><td> 21</td><td> 1060</td>

<td> 729490</td><td> N/A</td><td> N/A</td><td> 6840</td><td> 6855</td><td> TTGCCTTTGACCCAGC</td><td> 34</td><td> 1061</td>

<td> 729491</td><td> N/A</td><td> N/A</td><td> 6887</td><td> 6902</td><td> GCCCAAAAACTAAGAA</td><td> 0</td><td> 1062</td>

<td> 729492</td><td> N/A</td><td> N/A</td><td> 6897</td><td> 6912</td><td> TAAGGATCAAGCCCAA</td><td> 26</td><td> 1063</td>

<td> 729493</td><td> N/A</td><td> N/A</td><td> 6947</td><td> 6962</td><td> CTGTATTACCTATACA</td><td> 0</td><td> 1064</td>

<td> 729494</td><td> N/A</td><td> N/A</td><td> 6958</td><td> 6973</td><td> GAATTTTGTGACTGTA</td><td> 56</td><td> 1065</td>

<td> 729495</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTATGCCTTT</td><td> 53</td><td> 1066</td>

<td> 729496</td><td> N/A</td><td> N/A</td><td> 6998</td><td> 7013</td><td> GAGACTTTTTGCTCTA</td><td> 0</td><td> 1067</td>

<td> 729497</td><td> N/A</td><td> N/A</td><td> 7019</td><td> 7034</td><td> GTGATGAACCAGGGAA</td><td> 44</td><td> 1068</td>

<td> 729498</td><td> N/A</td><td> N/A</td><td> 7045</td><td> 7060</td><td> GGAAAGGCTAGGGAGG</td><td> 1</td><td> 1069</td>

<td> 729499</td><td> N/A</td><td> N/A</td><td> 7059</td><td> 7074</td><td> ACGGCTGCCTCTAGGG</td><td> 9</td><td> 1070</td>

<td> 729500</td><td> N/A</td><td> N/A</td><td> 7128</td><td> 7143</td><td> AGGATAGTTCCATATT</td><td> 15</td><td> 1071</td>

<td> 729501</td><td> N/A</td><td> N/A</td><td> 7145</td><td> 7160</td><td> TATGAAAAGTAGAGGA</td><td> 0</td><td> 1072</td>

<td> 729502</td><td> N/A</td><td> N/A</td><td> 7156</td><td> 7171</td><td> CTAGCATTTCTTATGA</td><td> 2</td><td> 1073</td>

<td> 729503</td><td> N/A</td><td> N/A</td><td> 7184</td><td> 7199</td><td> TATTAAGTCTAGACAA</td><td> 0</td><td> 1074</td>

<td> 729504</td><td> N/A</td><td> N/A</td><td> 7194</td><td> 7209</td><td> CGTCAAGAAGTATTAA</td><td> 0</td><td> 1075</td>

<td> 729505</td><td> N/A</td><td> N/A</td><td> 7208</td><td> 7223</td><td> TGACATGTAGCAATCG</td><td> 28</td><td> 1076</td>

<td> 729652</td><td> N/A</td><td> N/A</td><td> 6458</td><td> 6473</td><td> TTGGAGAGAGCACAGT</td><td> 11</td><td> 1077</td>

<td> 729653</td><td> N/A</td><td> N/A</td><td> 6654</td><td> 6669</td><td> AATTCTACAGTCACGA</td><td> 26</td><td> 1078</td>

<td> 729654</td><td> N/A</td><td> N/A</td><td> 7106</td><td> 7121</td><td> CATGTGCATAAAAATC</td><td> 0</td><td> 1079</td>

Table 15

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 78</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 58</td><td> 468</td>

<td> 666188</td><td> N/A</td><td> N/A</td><td> 7391</td><td> 7406</td><td> AGAAGCATTCACACAA</td><td> 41</td><td> 1080</td>

<td> 729235</td><td> N/A</td><td> N/A</td><td> 7387</td><td> 7402</td><td> GCATTCACACAAAATA</td><td> 52</td><td> 1081</td>

<td> 729236</td><td> N/A</td><td> N/A</td><td> 7388</td><td> 7403</td><td> AGCATTCACACAAAAT</td><td> 54</td><td> 1082</td>

<td> 729237</td><td> N/A</td><td> N/A</td><td> 7389</td><td> 7404</td><td> AAGCATTCACACAAAA</td><td> 27</td><td> 1083</td>

<td> 729238</td><td> N/A</td><td> N/A</td><td> 7390</td><td> 7405</td><td> GAAGCATTCACACAAA</td><td> 39</td><td> 1084</td>

<td> 729239</td><td> N/A</td><td> N/A</td><td> 7392</td><td> 7407</td><td> TAGAAGCATTCACACA</td><td> 41</td><td> 1085</td>

<td> 729240</td><td> N/A</td><td> N/A</td><td> 7393</td><td> 7408</td><td> ATAGAAGCATTCACAC</td><td> 22</td><td> 1086</td>

<td> 729241</td><td> N/A</td><td> N/A</td><td> 7394</td><td> 7409</td><td> CATAGAAGCATTCACA</td><td> 46</td><td> 1087</td>

<td> 729242</td><td> N/A</td><td> N/A</td><td> 7395</td><td> 7410</td><td> TCATAGAAGCATTCAC</td><td> 50</td><td> 1088</td>

<td> 729243</td><td> N/A</td><td> N/A</td><td> 7396</td><td> 7411</td><td> ATCATAGAAGCATTCA</td><td> 59</td><td> 1089</td>

<td> 729506</td><td> N/A</td><td> N/A</td><td> 7218</td><td> 7233</td><td> GTTTATAAGCTGACAT</td><td> 39</td><td> 1090</td>

<td> 729507</td><td> N/A</td><td> N/A</td><td> 7228</td><td> 7243</td><td> GCAGGAAACTGTTTAT</td><td> 55</td><td> 1091</td>

<td> 729508</td><td> N/A</td><td> N/A</td><td> 7253</td><td> 7268</td><td> ACTGGGCAGCACAAAA</td><td> 25</td><td> 1092</td>

<td> 729509</td><td> N/A</td><td> N/A</td><td> 7271</td><td> 7286</td><td> ACCCATTGAATGAAAA</td><td> 23</td><td> 1093</td>

<td> 729510</td><td> N/A</td><td> N/A</td><td> 7281</td><td> 7296</td><td> ATTACGGCCAACCCAT</td><td> 0</td><td> 1094</td>

<td> 729511</td><td> N/A</td><td> N/A</td><td> 7291</td><td> 7306</td><td> GGCTGGTGAAATTACG</td><td> 10</td><td> 1095</td>

<td> 729512</td><td> N/A</td><td> N/A</td><td> 7306</td><td> 7321</td><td> CATCCATCAATGAGGG</td><td> 51</td><td> 1096</td>

<td> 729513</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAACATCCA</td><td> 69</td><td> 1097</td>

<td> 729514</td><td> N/A</td><td> N/A</td><td> 7328</td><td> 7343</td><td> TGACCCAAAATACCCA</td><td> 44</td><td> 1098</td>

<td> 729515</td><td> N/A</td><td> N/A</td><td> 7338</td><td> 7353</td><td> GTGTAAAAGATGACCC</td><td> 37</td><td> 1099</td>

<td> 729516</td><td> N/A</td><td> N/A</td><td> 7349</td><td> 7364</td><td> AGCAGTGCTGTGTGTA</td><td> 48</td><td> 1100</td>

<td> 729517</td><td> N/A</td><td> N/A</td><td> 7372</td><td> 7387</td><td> ATTGCACACACAAAGT</td><td> 10</td><td> 1101</td>

<td> 729518</td><td> N/A</td><td> N/A</td><td> 7397</td><td> 7412</td><td> TATCATAGAAGCATTC</td><td> 24</td><td> 1102</td>

<td> 729519</td><td> N/A</td><td> N/A</td><td> 7426</td><td> 7441</td><td> CTATTTGATTTCTAGG</td><td> 18</td><td> 1103</td>

<td> 729520</td><td> N/A</td><td> N/A</td><td> 7437</td><td> 7452</td><td> TTTTAACCCAGCTATT</td><td> 6</td><td> 1104</td>

<td> 729521</td><td> N/A</td><td> N/A</td><td> 7460</td><td> 7475</td><td> GGTTACCAACATTTCT</td><td> 42</td><td> 1105</td>

<td> 729522</td><td> N/A</td><td> N/A</td><td> 7470</td><td> 7485</td><td> GTGAGGTGAGGGTTAC</td><td> 38</td><td> 1106</td>

<td> 729523</td><td> N/A</td><td> N/A</td><td> 7508</td><td> 7523</td><td> ACACTGGAGCTGTTGG</td><td> 51</td><td> 1107</td>

<td> 729524</td><td> N/A</td><td> N/A</td><td> 7519</td><td> 7534</td><td> ACAGGCTCGAGACACT</td><td> 31</td><td> 1108</td>

<td> 729525</td><td> N/A</td><td> N/A</td><td> 7529</td><td> 7544</td><td> TGCACATAGGACAGGC</td><td> 22</td><td> 1109</td>

<td> 729526</td><td> N/A</td><td> N/A</td><td> 7550</td><td> 7565</td><td> TAAAGCACTCAGAGCT</td><td> 16</td><td> 1110</td>

<td> 729527</td><td> N/A</td><td> N/A</td><td> 7560</td><td> 7575</td><td> TTGATGTCCGTAAAGC</td><td> 53</td><td> 1111</td>

<td> 729528</td><td> N/A</td><td> N/A</td><td> 7876</td><td> 7891</td><td> AGCGAAGACTCAAGGG</td><td> 48</td><td> 1112</td>

<td> 729529</td><td> N/A</td><td> N/A</td><td> 7887</td><td> 7902</td><td> CATGGAGTGGCAGCGA</td><td> 42</td><td> 1113</td>

<td> 729530</td><td> N/A</td><td> N/A</td><td> 7899</td><td> 7914</td><td> AGTTGCCCACCTCATG</td><td> 22</td><td> 1114</td>

<td> 729531</td><td> N/A</td><td> N/A</td><td> 7909</td><td> 7924</td><td> ATCTCCTCACAGTTGC</td><td> 28</td><td> 1115</td>

<td> 729532</td><td> N/A</td><td> N/A</td><td> 7920</td><td> 7935</td><td> CCTTTGTCTTGATCTC</td><td> 48</td><td> 1116</td>

<td> 729533</td><td> N/A</td><td> N/A</td><td> 7936</td><td> 7951</td><td> GCCATGTCACTGCCTC</td><td> 30</td><td> 1117</td>

<td> 729534</td><td> N/A</td><td> N/A</td><td> 7953</td><td> 7968</td><td> CGCCAGCTGTGTGCCA</td><td> 28</td><td> 1118</td>

<td> 729535</td><td> N/A</td><td> N/A</td><td> 7966</td><td> 7981</td><td> TGGAAGTGCCCCCCGC</td><td> 34</td><td> 1119</td>

<td> 729536</td><td> N/A</td><td> N/A</td><td> 7976</td><td> 7991</td><td> GGTTTGAATCTGGAAG</td><td> 31</td><td> 1120</td>

<td> 729537</td><td> N/A</td><td> N/A</td><td> 8000</td><td> 8015</td><td> GGTGAGCACCCTGGAG</td><td> 30</td><td> 1121</td>

<td> 729538</td><td> N/A</td><td> N/A</td><td> 8027</td><td> 8042</td><td> TCTAAGGAGGACAGCG</td><td> 35</td><td> 1122</td>

<td> 729539</td><td> N/A</td><td> N/A</td><td> 8043</td><td> 8058</td><td> GTGAAACAGTGTGATC</td><td> 40</td><td> 1123</td>

<td> 729540</td><td> N/A</td><td> N/A</td><td> 8064</td><td> 8079</td><td> ATAGTCCCTGCTCCTG</td><td> 49</td><td> 1124</td>

<td> 729541</td><td> N/A</td><td> N/A</td><td> 8144</td><td> 8159</td><td> GTGGGAGTCTGCCACA</td><td> 6</td><td> 1125</td>

<td> 729542</td><td> N/A</td><td> N/A</td><td> 8159</td><td> 8174</td><td> GACCTGGTTTGCAGCG</td><td> 34</td><td> 1126</td>

<td> 729543</td><td> N/A</td><td> N/A</td><td> 8171</td><td> 8186</td><td> CGCTGAGCCCCAGACC</td><td> 0</td><td> 1127</td>

<td> 729544</td><td> N/A</td><td> N/A</td><td> 8181</td><td> 8196</td><td> GGCTGAGCCTCGCTGA</td><td> 22</td><td> 1128</td>

<td> 729545</td><td> N/A</td><td> N/A</td><td> 8194</td><td> 8209</td><td> AACTTCGGCTACAGGC</td><td> 39</td><td> 1129</td>

<td> 729546</td><td> N/A</td><td> N/A</td><td> 8213</td><td> 8228</td><td> GACTCTACTGTGTGGG</td><td> 38</td><td> 1130</td>

<td> 729547</td><td> N/A</td><td> N/A</td><td> 8266</td><td> 8281</td><td> CACAGAGAACCTCATC</td><td> 11</td><td> 1131</td>

<td> 729548</td><td> N/A</td><td> N/A</td><td> 8276</td><td> 8291</td><td> AATAGCCGACCACAGA</td><td> 10</td><td> 1132</td>

<td> 729549</td><td> N/A</td><td> N/A</td><td> 8489</td><td> 8504</td><td> GCCTGATACCTGTGGG</td><td> 3</td><td> 1133</td>

<td> 729550</td><td> N/A</td><td> N/A</td><td> 8525</td><td> 8540</td><td> ATTGCACAGCCTCCCA</td><td> 8</td><td> 1134</td>

<td> 729551</td><td> N/A</td><td> N/A</td><td> 8555</td><td> 8570</td><td> ACCCAAGAGCTCATGG</td><td> 6</td><td> 1135</td>

<td> 729552</td><td> N/A</td><td> N/A</td><td> 8569</td><td> 8584</td><td> CTTGGCCTGCCTGCAC</td><td> 10</td><td> 1136</td>

<td> 729553</td><td> N/A</td><td> N/A</td><td> 8598</td><td> 8613</td><td> TTCCTGGACCACTGCC</td><td> 15</td><td> 1137</td>

<td> 729554</td><td> N/A</td><td> N/A</td><td> 8617</td><td> 8632</td><td> GCGGGAGCCCCCGCAT</td><td> 22</td><td> 1138</td>

<td> 729555</td><td> N/A</td><td> N/A</td><td> 8637</td><td> 8652</td><td> GCCCTGGGTGTCATGA</td><td> 17</td><td> 1139</td>

<td> 729556</td><td> N/A</td><td> N/A</td><td> 8648</td><td> 8663</td><td> CACTCCTGGAAGCCCT</td><td> 0</td><td> 1140</td>

<td> 729557</td><td> N/A</td><td> N/A</td><td> 8661</td><td> 8676</td><td> GACCCATCCCAGCCAC</td><td> 7</td><td> 1141</td>

<td> 729558</td><td> N/A</td><td> N/A</td><td> 8671</td><td> 8686</td><td> ATATGCCAGTGACCCA</td><td> 15</td><td> 1142</td>

<td> 729559</td><td> N/A</td><td> N/A</td><td> 8681</td><td> 8696</td><td> GCCATTCCTGATATGC</td><td> 28</td><td> 1143</td>

<td> 729560</td><td> N/A</td><td> N/A</td><td> 8691</td><td> 8706</td><td> TGCACGCCAAGCCATT</td><td> 28</td><td> 1144</td>

<td> 729561</td><td> N/A</td><td> N/A</td><td> 8711</td><td> 8726</td><td> GAAGCACCCAGGTCCC</td><td> 24</td><td> 1145</td>

<td> 729562</td><td> N/A</td><td> N/A</td><td> 8722</td><td> 8737</td><td> ATGGTAAGGAAGAAGC</td><td> 18</td><td> 1146</td>

<td> 729563</td><td> N/A</td><td> N/A</td><td> 8732</td><td> 8747</td><td> AACGAGGGCAATGGTA</td><td> 11</td><td> 1147</td>

<td> 729564</td><td> N/A</td><td> N/A</td><td> 8763</td><td> 8778</td><td> CCATGAGACCTAGGCT</td><td> 3</td><td> 1148</td>

<td> 729565</td><td> N/A</td><td> N/A</td><td> 8773</td><td> 8788</td><td> ACTCCATGGGCCATGA</td><td> 3</td><td> 1149</td>

<td> 729566</td><td> N/A</td><td> N/A</td><td> 8794</td><td> 8809</td><td> GGATTGGGAAAGACCT</td><td> 15</td><td> 1150</td>

<td> 729567</td><td> N/A</td><td> N/A</td><td> 8817</td><td> 8832</td><td> CGAGGTGGAGGGCACA</td><td> 11</td><td> 1151</td>

<td> 729568</td><td> N/A</td><td> N/A</td><td> 8827</td><td> 8842</td><td> CAACACAGGGCGAGGT</td><td> 8</td><td> 1152</td>

<td> 729569</td><td> N/A</td><td> N/A</td><td> 8859</td><td> 8874</td><td> TATGCAGCTTCTGCCT</td><td> 3</td><td> 1153</td>

<td> 729655</td><td> N/A</td><td> N/A</td><td> 7480</td><td> 7495</td><td> TGGCAATTAGGTGAGG</td><td> 48</td><td> 1154</td>

<td> 729656</td><td> N/A</td><td> N/A</td><td> 8101</td><td> 8116</td><td> CAAGCTACATGAAATC</td><td> 11</td><td> 1155</td>

<td> 729657</td><td> N/A</td><td> N/A</td><td> 8627</td><td> 8642</td><td> TCATGACCTAGCGGGA</td><td> 11</td><td> 1156</td>

Table 16

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACACAGGCGG</td><td> 83</td><td> 39</td>

<td> 665933</td><td> 1561</td><td> 1576</td><td> 11126</td><td> 11141</td><td> GCGGTCTTTGAGGTCT</td><td> 64</td><td> 468</td>

<td> 666208</td><td> N/A</td><td> N/A</td><td> 9349</td><td> 9364</td><td> CAGTTTAGCTCAGGCA</td><td> 69</td><td> 1157</td>

<td> 729244</td><td> N/A</td><td> N/A</td><td> 9344</td><td> 9359</td><td> TAGCTCAGGCAAGACC</td><td> 32</td><td> 1158</td>

<td> 729245</td><td> N/A</td><td> N/A</td><td> 9345</td><td> 9360</td><td> TTAGCTCAGGCAAGAC</td><td> 17</td><td> 1159</td>

<td> 729246</td><td> N/A</td><td> N/A</td><td> 9346</td><td> 9361</td><td> TTTAGCTCAGGCAAGA</td><td> 23</td><td> 1160</td>

<td> 729247</td><td> N/A</td><td> N/A</td><td> 9347</td><td> 9362</td><td> GTTTAGCTCAGGCAAG</td><td> 24</td><td> 1161</td>

<td> 729248</td><td> N/A</td><td> N/A</td><td> 9348</td><td> 9363</td><td> AGTTTAGCTCAGGCAA</td><td> 47</td><td> 1162</td>

<td> 729249</td><td> N/A</td><td> N/A</td><td> 9353</td><td> 9368</td><td> GCCTCAGTTTAGCTCA</td><td> 23</td><td> 1163</td>

<td> 729250</td><td> N/A</td><td> N/A</td><td> 9354</td><td> 9369</td><td> AGCCTCAGTTTAGCTC</td><td> 9</td><td> 1164</td>

<td> 729570</td><td> N/A</td><td> N/A</td><td> 8869</td><td> 8884</td><td> CTGTAGCTCCTATGCA</td><td> 14</td><td> 1165</td>

<td> 729571</td><td> N/A</td><td> N/A</td><td> 8895</td><td> 8910</td><td> AGAAGCAAGATCCCCT</td><td> 2</td><td> 1166</td>

<td> 729572</td><td> N/A</td><td> N/A</td><td> 8905</td><td> 8920</td><td> ATGTCGGAGGAGAAGC</td><td> 0</td><td> 1167</td>

<td> 729573</td><td> N/A</td><td> N/A</td><td> 8915</td><td> 8930</td><td> AAAGGAGTCAATGTCG</td><td> 0</td><td> 1168</td>

<td> 729574</td><td> N/A</td><td> N/A</td><td> 8925</td><td> 8940</td><td> GCAGGGCAGTAAAGGA</td><td> 12</td><td> 1169</td>

<td> 729575</td><td> N/A</td><td> N/A</td><td> 8948</td><td> 8963</td><td> GTCTGCACAGCAGGGA</td><td> 24</td><td> 1170</td>

<td> 729576</td><td> N/A</td><td> N/A</td><td> 9021</td><td> 9036</td><td> AACCCACACTCACCTC</td><td> 25</td><td> 1171</td>

<td> 729577</td><td> N/A</td><td> N/A</td><td> 9046</td><td> 9061</td><td> CGTCCAGGGCTCCACC</td><td> 13</td><td> 1172</td>

<td> 729578</td><td> N/A</td><td> N/A</td><td> 9060</td><td> 9075</td><td> GACAGCAGAGAGCTCG</td><td> 9</td><td> 1173</td>

<td> 729579</td><td> N/A</td><td> N/A</td><td> 9082</td><td> 9097</td><td> GCGGAAACCTAAGGCC</td><td> 12</td><td> 1174</td>

<td> 729580</td><td> N/A</td><td> N/A</td><td> 9118</td><td> 9133</td><td> ATTGAGAGGGCCACGG</td><td> 27</td><td> 1175</td>

<td> 729581</td><td> N/A</td><td> N/A</td><td> 9133</td><td> 9148</td><td> GAAACAAGGAGAACTA</td><td> 29</td><td> 1176</td>

<td> 729582</td><td> N/A</td><td> N/A</td><td> 9151</td><td> 9166</td><td> TTCAGAATCCCAGGAG</td><td> 21</td><td> 1177</td>

<td> 729583</td><td> N/A</td><td> N/A</td><td> 9167</td><td> 9182</td><td> GACTGTGCTCCTATCG</td><td> 27</td><td> 1178</td>

<td> 729584</td><td> N/A</td><td> N/A</td><td> 9195</td><td> 9210</td><td> GACAATGCCCTGGGAA</td><td> 55</td><td> 1179</td>

<td> 729585</td><td> N/A</td><td> N/A</td><td> 9205</td><td> 9220</td><td> ACAGGGTAATGACAAT</td><td> 28</td><td> 1180</td>

<td> 729586</td><td> N/A</td><td> N/A</td><td> 9219</td><td> 9234</td><td> CGTGGGTCACACACAC</td><td> 39</td><td> 1181</td>

<td> 729587</td><td> N/A</td><td> N/A</td><td> 9233</td><td> 9248</td><td> AGCCCCAACTGCTGCG</td><td> 25</td><td> 1182</td>

<td> 729588</td><td> N/A</td><td> N/A</td><td> 9249</td><td> 9264</td><td> GGAGTCAGACCTACCA</td><td> 18</td><td> 1183</td>

<td> 729589</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAGGGAGTC</td><td> 73</td><td> 1184</td>

<td> 729590</td><td> N/A</td><td> N/A</td><td> 9285</td><td> 9300</td><td> GCCCTTTGCCTCACTT</td><td> 17</td><td> 1185</td>

<td> 729591</td><td> N/A</td><td> N/A</td><td> 9324</td><td> 9339</td><td> CTCCGGTCCCAGCTCG</td><td> 6</td><td> 1186</td>

<td> 729592</td><td> N/A</td><td> N/A</td><td> 9334</td><td> 9349</td><td> AAGACCCTGCCTCCGG</td><td> 23</td><td> 1187</td>

<td> 729593</td><td> N/A</td><td> N/A</td><td> 9355</td><td> 9370</td><td> TAGCCTCAGTTTAGCT</td><td> 0</td><td> 1188</td>

<td> 729594</td><td> N/A</td><td> N/A</td><td> 9375</td><td> 9390</td><td> GAACTATGAGGCAACT</td><td> 10</td><td> 1189</td>

<td> 729595</td><td> N/A</td><td> N/A</td><td> 9385</td><td> 9400</td><td> TAACAGGCGAGAACTA</td><td> 9</td><td> 1190</td>

<td> 729596</td><td> N/A</td><td> N/A</td><td> 9427</td><td> 9442</td><td> GAAAGGAGGACAGGTT</td><td> 0</td><td> 1191</td>

<td> 729597</td><td> N/A</td><td> N/A</td><td> 9467</td><td> 9482</td><td> TGAAGGGACACCACCA</td><td> 31</td><td> 1192</td>

<td> 729598</td><td> N/A</td><td> N/A</td><td> 9533</td><td> 9548</td><td> TAGACCCCCAACCACC</td><td> 5</td><td> 1193</td>

<td> 729599</td><td> N/A</td><td> N/A</td><td> 9553</td><td> 9568</td><td> CCTATAGCTTCTCTGT</td><td> 51</td><td> 1194</td>

<td> 729600</td><td> N/A</td><td> N/A</td><td> 9567</td><td> 9582</td><td> AGGTACCTATGGTACC</td><td> 9</td><td> 1195</td>

<td> 729601</td><td> N/A</td><td> N/A</td><td> 9578</td><td> 9593</td><td> AGCCCCCTTCCAGGTA</td><td> 28</td><td> 1196</td>

<td> 729602</td><td> N/A</td><td> N/A</td><td> 9590</td><td> 9605</td><td> TAGCCTCCCATCAGCC</td><td> 11</td><td> 1197</td>

<td> 729603</td><td> N/A</td><td> N/A</td><td> 9602</td><td> 9617</td><td> CCTGGGCCACCCTAGC</td><td> 11</td><td> 1198</td>

<td> 729604</td><td> N/A</td><td> N/A</td><td> 9634</td><td> 9649</td><td> CGAACTGCCTCCCAGG</td><td> 7</td><td> 1199</td>

<td> 729605</td><td> N/A</td><td> N/A</td><td> 9645</td><td> 9660</td><td> TGCCACCTCCACGAAC</td><td> 39</td><td> 1200</td>

<td> 729606</td><td> N/A</td><td> N/A</td><td> 9655</td><td> 9670</td><td> CGGCTGTCAGTGCCAC</td><td> 17</td><td> 1201</td>

<td> 729607</td><td> N/A</td><td> N/A</td><td> 9683</td><td> 9698</td><td> CACTGCATCTACAGAG</td><td> 17</td><td> 1202</td>

<td> 729608</td><td> N/A</td><td> N/A</td><td> 9998</td><td> 10013</td><td> CAGCCATGGGTCCTTA</td><td> 18</td><td> 1203</td>

<td> 729609</td><td> N/A</td><td> N/A</td><td> 10009</td><td> 10024</td><td> TTCCCCGTGCCCAGCC</td><td> 0</td><td> 1204</td>

<td> 729610</td><td> N/A</td><td> N/A</td><td> 10025</td><td> 10040</td><td> AATCCCCCAGCACTGC</td><td> 22</td><td> 1205</td>

<td> 729611</td><td> N/A</td><td> N/A</td><td> 10041</td><td> 10056</td><td> TTGCCAATCCTACCCC</td><td> 31</td><td> 1206</td>

<td> 729612</td><td> N/A</td><td> N/A</td><td> 10073</td><td> 10088</td><td> CACCCAAGGGAGTCCA</td><td> 22</td><td> 1207</td>

<td> 729613</td><td> N/A</td><td> N/A</td><td> 10099</td><td> 10114</td><td> AGCCCCATCCGCCCTC</td><td> 3</td><td> 1208</td>

<td> 729614</td><td> N/A</td><td> N/A</td><td> 10157</td><td> 10172</td><td> GGCCCATCCCGTCCTT</td><td> 0</td><td> 1209</td>

<td> 729615</td><td> N/A</td><td> N/A</td><td> 10183</td><td> 10198</td><td> GGTCGGTCACTGTGGG</td><td> 8</td><td> 1210</td>

<td> 729616</td><td> N/A</td><td> N/A</td><td> 10581</td><td> 10596</td><td> CTTTGGGCCCTCACCA</td><td> 0</td><td> 1211</td>

<td> 729617</td><td> N/A</td><td> N/A</td><td> 10591</td><td> 10606</td><td> AGGATCACAGCTTTGG</td><td> 12</td><td> 1212</td>

<td> 729618</td><td> N/A</td><td> N/A</td><td> 10616</td><td> 10631</td><td> ATGCCCTGGGCAAGAG</td><td> 8</td><td> 1213</td>

<td> 729619</td><td> N/A</td><td> N/A</td><td> 10627</td><td> 10642</td><td> AGGCTGGAACCATGCC</td><td> 0</td><td> 1214</td>

<td> 729620</td><td> N/A</td><td> N/A</td><td> 10637</td><td> 10652</td><td> CCCTAGTCAGAGGCTG</td><td> 11</td><td> 1215</td>

<td> 729621</td><td> N/A</td><td> N/A</td><td> 10647</td><td> 10662</td><td> AAATCAAGGTCCCTAG</td><td> 2</td><td> 1216</td>

<td> 729622</td><td> N/A</td><td> N/A</td><td> 10658</td><td> 10673</td><td> GCTCTGCATCAAAATC</td><td> 7</td><td> 1217</td>

<td> 729623</td><td> N/A</td><td> N/A</td><td> 10780</td><td> 10795</td><td> ATGTACCTGTACAGTA</td><td> 14</td><td> 1218</td>

<td> 729624</td><td> N/A</td><td> N/A</td><td> 10800</td><td> 10815</td><td> CCGACTTTGGGATAGG</td><td> 15</td><td> 1219</td>

<td> 729625</td><td> N/A</td><td> N/A</td><td> 10810</td><td> 10825</td><td> CAAGCCAAGGCCGACT</td><td> 36</td><td> 1220</td>

<td> 729626</td><td> N/A</td><td> N/A</td><td> 10820</td><td> 10835</td><td> CCCCAGTTTTCAAGCC</td><td> 13</td><td> 1221</td>

<td> 729627</td><td> N/A</td><td> N/A</td><td> 10833</td><td> 10848</td><td> TAGCCCCAGGATTCCC</td><td> 5</td><td> 1222</td>

<td> 729628</td><td> N/A</td><td> N/A</td><td> 10883</td><td> 10898</td><td> AAGTTCACACTGCTCA</td><td> 38</td><td> 1223</td>

<td> 729629</td><td> N/A</td><td> N/A</td><td> 10914</td><td> 10929</td><td> CGGCTCTGAGCCTTGA</td><td> 0</td><td> 1224</td>

<td> 729630</td><td> N/A</td><td> N/A</td><td> 10933</td><td> 10948</td><td> AGTAATAGACCGCATT</td><td> 21</td><td> 1225</td>

<td> 729631</td><td> N/A</td><td> N/A</td><td> 10952</td><td> 10967</td><td> AGGACAGCCATCAGGG</td><td> 8</td><td> 1226</td>

<td> 729632</td><td> N/A</td><td> N/A</td><td> 10962</td><td> 10977</td><td> GCTGTGCATGAGGACA</td><td> 17</td><td> 1227</td>

<td> 729633</td><td> N/A</td><td> N/A</td><td> 10972</td><td> 10987</td><td> GCCAGATCCAGCTGTG</td><td> 0</td><td> 1228</td>

<td> 729634</td><td> N/A</td><td> N/A</td><td> 11023</td><td> 11038</td><td> ACCACCTGGGAGGCAA</td><td> 16</td><td> 1229</td>

<td> 729658</td><td> N/A</td><td> N/A</td><td> 8885</td><td> 8900</td><td> TCCCCTGAGAGGCTGC</td><td> 20</td><td> 1230</td>

<td> 729659</td><td> N/A</td><td> N/A</td><td> 9543</td><td> 9558</td><td> CTCTGTATACTAGACC</td><td> 64</td><td> 1231</td>

<td> 729660</td><td> N/A</td><td> N/A</td><td> 10134</td><td> 10149</td><td> ACGCCTCCCCATTCTG</td><td> 6</td><td> 1232</td>

<td> 729661</td><td> N/A</td><td> N/A</td><td> 10894</td><td> 10909</td><td> CTCTGGCCGCCAAGTT</td><td> 5</td><td> 1233</td>

Table 17

Inhibition of IRF5 RNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 3

<td> Compound Number</td><td> SEQ ID NO: 3 Start Site</td><td> SEQ ID NO: 3 Stop Site</td><td> Sequence (5' to 3')</td><td> IRF5 (/«Inhibition)</td><td> SEQ ID NO</td>

<td> 728399</td><td> 96</td><td> 111</td><td> TCTGTCTGCGGTGCGC</td><td> 26</td><td> 1234</td>

<td> 728400</td><td> 98</td><td> 113</td><td> GGTCTGTCTGCGGTGC</td><td> 23</td><td> 1235</td>

<td> 728539</td><td> 591</td><td> 606</td><td> GCATCTGTGAGGCTCA</td><td> 21</td><td> 1236</td>

<td> 728540</td><td> 593</td><td> 608</td><td> CTGCATCTGTGAGGCT</td><td> 30</td><td> 1237</td>

<td> 728541</td><td> 595</td><td> 610</td><td> CACTGCATCTGTGAGG</td><td> 8</td><td> 1238</td>

<td> 728542</td><td> 597</td><td> 612</td><td> TGCACTGCATCTGTGA</td><td> 20</td><td> 1239</td>

<td> 728543</td><td> 599</td><td> 614</td><td> ACTGCACTGCATCTGT</td><td> 12</td><td> 1240</td>

Example 2: Antisense inhibition of human IRF5 in KARPAS-229 cells by modified oligonucleotides

In the second stage of the screening, modified oligonucleotides were designed to sites adjacent to the most active leads/sites from the first stage of screening described above. Briefly, active leads from the first phase of the screening were microwalked until previously tested or rejected sites were approximately reached. Several different chemistry modifications were tested, which are specified in the Chemistry Notation column of the tables below, wherein the notation “d” refers to a 2’-deoxyribose sugar, the notation “s” refers to a phosphorothioate intemucleoside linkage, the notation “k” refers to a cEt modified sugar, and the notation “^mC” refers to a 5-methyl cytosine.

Cultured KARPAS-229 cells at a density of 10,000 cells per well were treated using free uptake with 4,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and IRF5 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4524 (forward sequence TTCGAGATCTTCTTCTGCTTTGG, designated herein as SEQ ID NO: 14; reverse sequence GCACCACCTGTACAGTAATGAGCTT; designated herein as SEQ ID NO: 15; probe sequence CCTGACCGCAAACCCCGAGAGAA, designated herein as SEQ ID NO: 16) was used to measure mRNA levels. IRF5 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of IRF5 relative to untreated control cells. As used herein, a value of ‘0’ indicates that treatment with the modified oligonucleotide did not inhibit IRF5 mRNA levels. ‘N/A’ indicates that the modified oligonucleotide does not target that gene sequence with 100% complementarity.

Table 18

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> (% Inhibition)</td><td> SEQ ID NO</td>

<td> 666178</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCksAksTdsTds^mC ds^mC_dsA_dsT_dsA_dsT_dsA ds^dsAks^ksAk</td><td> 21</td><td> 1003</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCTT GACCT</td><td> AksGks^mCksT_dsT_dsG_ds /~י τ τ τ /~י vJdslds Cds 1 ds 1 ds&lt;Jds A_ds^mCks^mCksT_k</td><td> 48</td><td> 436</td>

<td> 728894</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^ksAdsTd«” τ me mr λ m Cdslds Cds CdsAds Cd_SA_dsT_ds^mCksAk_SGk</td><td> 45</td><td> 633</td>

<td> 729213</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> me m ידי ידי λ CksAks 1 ks 1 ds ^ds Cd_SA_dsT_dsA_dsT_dsA_ds^m CdsA_ds^mCksA_ks^mCk</td><td> 28</td><td> 1006</td>

<td> 729476</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> TjZCjZCksAdsAdsT dsTd_ST_dsT_dsGds^mCd_SA τ τ me me ds 1 ds¹ ks ^ks Vk</td><td> 79</td><td> 1047</td>

<td> 785370</td><td> 1762</td><td> 1777</td><td> 11327</td><td> 11342</td><td> CATCTCCACAT CAGTC</td><td> λ יד τ m CksAds 1 ds ^ds 1 ds Cds^mCdsAds^mCdsAdsT ds^mCkSA־_sGk_ST_es^mCk</td><td> 25</td><td> 631</td>

<td> 785371</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td>^mCksAds^mCdsA_dsT_ds^mτ me me a m Cdslds Cds CdsAds CdsAksTeS^mCksAeSGk</td><td> 15</td><td> 633</td>

<td> 785392</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> me m יד יד a CksAds 1 ds 1 ds ^ds Cd_SA_dsT_dsA_dsT_dsA_ds^m p Λ A me '-'ks-^'-es '-׳ks^-es ^k</td><td> 31</td><td> 1006</td>

<td> 785393</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCdsAdsTdsTds^mC ds^mCdSA_dsT_dsA_dsT_dsA ^CesAks^esAk</td><td> 39</td><td> 1003</td>

<td> 785394</td><td> N/A</td><td> N/A</td><td> 6547</td><td> 6562</td><td> CAATTTTGCAT TCCAT</td><td>^mCksAdsAdsTdsTdsTds TdSGds^mCdsA_dsT_dsTks ^mCeS^mCksA־sTk</td><td> 21</td><td> 1241</td>

<td> 785395</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> TksTds’TdsAdsAdsT dsTd_ST_dsT_dsGds^mCd_SA τ τ me me ks¹ es¹ ks Ves Vk</td><td> 37</td><td> 1047</td>

<td> 785425</td><td> 1762</td><td> 1777</td><td> 11327</td><td> 11342</td><td> CATCTCCACAT CAGTC</td><td> a יד me τ m CksAds 1 ds ^ds 1 ds Cds^mCdsAds^mCdsAdsT ks^mCesAksGesTks^mCe</td><td> 32</td><td> 631</td>

<td> 785426</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td>^mCksAds^mCdsA_dsT_ds^mCdslds Cds CdsAds CksAe_STks^mCesAksGe</td><td> 2</td><td> 633</td>

<td> 785447</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> m יד יד a CksAds 1 ds 1 ds ^ds Cd_SA_dsT_dsA_dsT_dsAk_S^m CesAks^esA^Ce</td><td> 7</td><td> 1006</td>

<td> 785448</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCdsAdsTdsTds^mC ds^mCdsAdsTdsAdsTksA ־s^mCkSA_es^mCksA־</td><td> 34</td><td> 1003</td>

<td> 785449</td><td> N/A</td><td> N/A</td><td> 6547</td><td> 6562</td><td> CAATTTTGCAT TCCAT</td><td>^mCksA_dsA_dsT_dsT_dsT_ds T_dsG_ds^mC_dsA_dsTksTe_S mp mp a τ '-'ks '-׳es^'ks a e</td><td> 19</td><td> 1241</td>

<td> 785450</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> Tks^mCds^mCdsA_dsA_dsT _dsT_dsT_dsT_dsG_ds^mCksA_e s 1 ks A es Vks Ve</td><td> 6</td><td> 1047</td>

<td> 785471</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> mp a Δ T ^m '-׳ks^'es '-׳ks^ds a ds mr λ m י־/1מ τ י/ Cdslds Cds CdsAds C_dsA_dsT_es^mCesAksGk</td><td> 26</td><td> 633</td>

<td> 785483</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> nip ATT ^mC ^mV-ks^es A ks A ds ^ds C_dsA_dsT_dsA_dsT_dsA_ds^mCdsAes^mCesAkS^mCk</td><td> 24</td><td> 1006</td>

<td> 785484</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> G_ks^mCeSAksTdsTds^mCd s^mCdsAdsTdsAdsTdsAd s^mCesAcs^mC_ksA_k</td><td> 48</td><td> 1003</td>

<td> 785485</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> Tks^mCes^mCksAdsAdsTd sTdsTdsTdsGds^mCdsA_ds י־/111 τ mp יך A es A es '-'ks Me</td><td> 76</td><td> 1047</td>

<td> 785513</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAdsTds^mCdsT _ds^mCds^mCdsA_ds^mCdsAd sTds^mCksAesGksTe</td><td> 36</td><td> 632</td>

<td> 785514</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^dsAdsTd“ τ י־/1מ mr λ m Cdslds Cds CdsAds C_dsA_dsTks^mCesAksGe</td><td> 23</td><td> 633</td>

<td> 785535</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> mp ATT ^mC ^m'-ks^'ks A ds A ds '-'ds C_dsA_dsT_dsA_dsT_dsA_ds^mCdsAks^esAks^e</td><td> 30</td><td> 1006</td>

<td> 785536</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCksAdsTdsTds^mC ds^mCdsAdsTdsAdsTdsA ds^mCksA־_s'C_ksAe</td><td> 37</td><td> 1003</td>

<td> 785537</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAdsAdsTdsT dsTdsTdsGds^mCdsA_dsT T mp mp A ds A ks '-'es '-'ks-^'-e</td><td> 57</td><td> 1242</td>

<td> 785538</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> Tks^ks^dsAdsAdsT _dsT_dsT_dsT_dsG_ds^mC_dsA τ τ mp mp dsAksAes '-'ks '-'e</td><td> 40</td><td> 1047</td>

<td> 785558</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAdsTds^mCdsT _ds^mCds^mCdsA_ds^mC_dsA־ _sT_es^mCesAesGksTk</td><td> 24</td><td> 632</td>

<td> 785570</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> mp ATT ^mC ^m'-ks^'ks A ds A ds '-'ds C_dsA_dsT_dsA_dsT_dsA_es^mCeSAes^mCeSA_ks^mCk</td><td> 21</td><td> 1006</td>

<td> 785571</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAdsAdsTdsT dsTdsTdsGds^mCdsA_esTe _sT_es^mCeS^mCksAk</td><td> 48</td><td> 1242</td>

<td> 785609</td><td> 1762</td><td> 1777</td><td> 11327</td><td> 11342</td><td> CATCTCCACAT CAGTC</td><td> a τ י־/1מ τ m CksAks 1 ds '-'ds 1 ds C_ds^mCdsAds^mCdsA_dsT ^CesAksGesT^Ck</td><td> 23</td><td> 631</td>

<td> 785610</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> A_ks^mCkSAdsTds^mCdsT ds^mCds^mCdsA_ds^mCdsAk sTeS^mCksAesGksTk</td><td> 15</td><td> 632</td>

<td> 785611</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^dsAdsTd«” /י τ nir mr λ m Cdslds Cds CdsAds CksAe_STks^mCesAk_sGk</td><td> 17</td><td> 633</td>

<td> 785640</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> mr m ידי ידי λ CksAks 1 ds 1 ds '-'ds C_dsA_dsT_dsA_dsT_dsAk_S^m CesAks^mCesAks^mCk</td><td> 17</td><td> 1006</td>

<td> 785641</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCksAdsTdsTds^mC ds^mCdsAdsTdsAdsTksA ־s^mCkSAe_S^mC_ksAk</td><td> 0</td><td> 1003</td>

<td> 785642</td><td> N/A</td><td> N/A</td><td> 6547</td><td> 6562</td><td> CAATTTTGCAT TCCAT</td><td>^mCksAksAdsTdsTdsTds TdsGds^mCdsA_dsTksTe_S^mCks^mCesAksT_k</td><td> 32</td><td> 1241</td>

<td> 785643</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAdsAdsTdsT dsTdSTdsGds^mCdsAk_ST_{e s}T_ks^mCeS^mCkSAk</td><td> 39</td><td> 1242</td>

<td> 785644</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> Tks^ks^dsAdsAdsT dsTd_ST_dsT_dsGds^mCksA_eיך τ me me s^ks^es Vks Vk</td><td> 15</td><td> 1047</td>

<td> 785667</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAdsTds^mCdsT ds^mCds^mCdsAds^mCdsAd sTeS^mCesAesGksTk</td><td> 41</td><td> 632</td>

<td> 785679</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> me ATT ^m '-ks^ks 1 ds¹ ds '-'ds Cd_SA_dsT_dsA_dsT_dsA_ds^mCeSAes^mCeSA_ks^mCk</td><td> 21</td><td> 1006</td>

<td> 785680</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAdsAdsTdsT dsTdsTdsGds^mCdsAdsTe sT_es^mCeS^mCksAk</td><td> 30</td><td> 1242</td>

<td> 785697</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAdsTds^mCdsT ds^mCds^mCdsAds^mC_dsA_dsTksH'CdsAksGdsTk</td><td> 28</td><td> 632</td>

<td> 785709</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> mr m יד יד λ CksAks 1 ds 1 ds '-'ds Cd_SA_dsT_dsA_dsT_dsA_ds^mCksAds^mCksA_ds^mCk</td><td> 25</td><td> 1006</td>

<td> 785710</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAdsAdsTdsT dsTdSTdsGds^mCdSA_dsT τ me me a ks¹ ds '-'ks '-'ds^/'k</td><td> 42</td><td> 1242</td>

<td> 785738</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAdsTds^mCdsT ds^mCds^mCdsAds^mC_dsA_{d s}Tks^mCesAksGesTk</td><td> 16</td><td> 632</td>

<td> 785739</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^dsAdsTds¹ יד me me λ m Cdslds Cds CdsAds CdsAksTeS^mCksAeSGk</td><td> 22</td><td> 633</td>

<td> 785760</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> me m יד יד λ CksAks 1 ds 1 ds '-'ds Cd_SA_dsT_dsA_dsT_dsA_ds^m Ck_SA_es^mCk_SA_es^mCk</td><td> 54</td><td> 1006</td>

<td> 785761</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCksAdsTdsTds^mC ds^mCdSA_dsT_dsA_dsT_dsA ^CesAks^esAk</td><td> 2</td><td> 1003</td>

<td> 785762</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAdsAdsTdsT dsTdsTdsGds^mCdsA_dsT _ksT_es^mCks^mCesAk</td><td> 11</td><td> 1242</td>

<td> 785763</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> TksTksTdsAdsAdsT dsTd_ST_dsT_dsGds^mCd_SA יך יך ks¹ es¹ ks Ves Vk</td><td> 29</td><td> 1047</td>

<td> 785784</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^ksAdsTds¹ Cdslds Cds CdsAds CdSAksTds^mCksAdsGk</td><td> 39</td><td> 633</td>

<td> 785796</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> me ATT ^m '-ks^ks 1 ks¹ ds '-'ds Cd_SA_dsT_dsA_dsT_dsA_ds^mCksAds^mCksAds^mCk</td><td> 40</td><td> 1006</td>

<td> 785797</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> G_ks^mCksAksTdsTds^mC ds^mCdSA_dsT_dsA_dsT_dsA ks^mCdsAks^mCdsAk</td><td> 0</td><td> 1003</td>

<td> 785798</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> TjZCjZCksAdsAdsT dsTd_ST_dsT_dsG_ds^mC_dsA τ τ m/־x m/־x ks 1 ds 1 ks '-'ds '-'k</td><td> 32</td><td> 1047</td>

<td> 785826</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAkSTds^mCdsT ds^mCds^mCdsAds^mC_dsA_{d s}Tks^mCesAksGesTk</td><td> 14</td><td> 632</td>

<td> 785827</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^ksAdsTds¹ Cdslds Cds CdsAds CdsAksTeS^mCksAeSGk</td><td> 43</td><td> 633</td>

<td> 785848</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> me ATT ^m '-ks^'ks 1 ks¹ ds '-'ds Cd_SA_dsT_dsA_dsT_dsA_ds^mCkSAes^mCkSA_es^mCk</td><td> 32</td><td> 1006</td>

<td> 785849</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> G_ks^mCksAksTdsTds^mC ds^mCdSA_dsT_dsA_dsT_dsA ^CesAks^esAk</td><td> 0</td><td> 1003</td>

<td> 785850</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAksAdsTdsT dsTdSTdsGds^mCdsA_dsT _ksT_es^mCks^mCeSAk</td><td> 42</td><td> 1242</td>

<td> 785851</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> Tks^ks^ksAdsAdsT dsTd_ST_dsT_dsGds^mCd_SA τ τ ks¹ es¹ ks *-׳es Me</td><td> 51</td><td> 1047</td>

<td> 785872</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^ksAdsTds¹ Cdslds Cds CdsAds CdsAdsTks^mCesAksGe</td><td> 38</td><td> 633</td>

<td> 785884</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> m י־/1מ ידי ידי Λ CksAks 1 ks 1 ds '-'ds Cd_SA_dsT_dsA_dsT_dsA_ds^m CdsAks’TesAks’Te</td><td> 28</td><td> 1006</td>

<td> 785885</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> G_ks^mCksAksTdsTds^mC ds^mCdSA_dsT_dsA_dsT_dsA ds^mCkSA־s^mCkSAe</td><td> 45</td><td> 1003</td>

<td> 785886</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> Tks^ks^ksAdsAdsT dsTd_ST_dsT_dsG_ds^mC_dsA ds Iks les '-'ks '-׳e</td><td> 14</td><td> 1047</td>

<td> 785914</td><td> 1763</td><td> 1778</td><td> 11328</td><td> 11343</td><td> ACATCTCCAC ATCAGT</td><td> Aks^mCksAkSTds^mCdsT ds^mCds^mCdsAds^mC_dsA_{d s}T_ds^mCksAksGksTe</td><td> 11</td><td> 632</td>

<td> 785915</td><td> 1764</td><td> 1779</td><td> 11329</td><td> 11344</td><td> CACATCTCCAC ATCAG</td><td> “CksAks^ksAdsTd«” p יך mp mp a m '-'ds¹ ds '-'ds '-'ds-^-ds CdsAdsTksH'CksAksGe</td><td> 25</td><td> 633</td>

<td> 785936</td><td> N/A</td><td> N/A</td><td> 6539</td><td> 6554</td><td> CATTCCATATA CACAC</td><td> m/-' m ידי ידי λ CksAks 1 ks 1 ds '-'ds CdsAdsTdsAdsTdsAds¹¹¹ p A mp A mp '-'ds^'ks '-'ks^'ks '-'e</td><td> 39</td><td> 1006</td>

<td> 785937</td><td> N/A</td><td> N/A</td><td> 6540</td><td> 6555</td><td> GCATTCCATAT ACACA</td><td> Gks^mCksAksTdSTds^mC ds^mCdsAdsTdsAdsTdSA ds^lnCksAks^mCksAe</td><td> 25</td><td> 1003</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksA_ksA_dsT_dsT dsTdsTdsGds^mCdsAd_sT dsTksTksTksAe</td><td> 80</td><td> 1242</td>

<td> 785939</td><td> N/A</td><td> N/A</td><td> 6549</td><td> 6564</td><td> TCCAATTTTGC ATTCC</td><td> T^ks^ksAdsAdsT dsTdsTd_sTdsGds^mCdsA mp mp יך יך¹ ds Iks Iks '-'ks '-'e</td><td> 7</td><td> 1047</td>

<td> 786505</td><td> N/A</td><td> N/A</td><td> 6546</td><td> 6561</td><td> AATTTTGCATT CCATA</td><td> AksAksTksTdsTdsTdsG mp ATT ^mp ds '-'ds-^-ds¹ ds¹ ds '-'ds ^mCdsAk_ST_ksA_k</td><td> 41</td><td> 1243</td>

<td> 786506</td><td> N/A</td><td> N/A</td><td> 6547</td><td> 6562</td><td> CAATTTTGCAT TCCAT</td><td> ™CksAksAksTdsTdsTds TdsGds^mCdsAdSTdSTdS ^mCds^mCk_SA_ksTk</td><td> 52</td><td> 1241</td>

<td> 786507</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGCA TTCCA</td><td>^mCks^mCksAksAdSTdsT dsTdsTdsGds^mCdsAdsT T mp mp a ds¹ ds '-'ks '-'ks-^'-k</td><td> 78</td><td> 1242</td>

<td> 786508</td><td> N/A</td><td> N/A</td><td> 6550</td><td> 6565</td><td> TTCCAATTTTG CATTC</td><td> TksTk_S^mCkS^mCdSA_dsA '־/m י~/ יד יד יד יד ds 1 ds 1 ds 1 ds 1 ds^Jds Cd sAd_STksTks^mCk</td><td> 39</td><td> 1244</td>

<td> 786509</td><td> N/A</td><td> N/A</td><td> 6551</td><td> 6566</td><td> ATTCCAATTTT GCATT</td><td> AksTksTks^ds^dsA dsAdsTdsTdsTdsTdsGds ¹CdsAksTksTk</td><td> 21</td><td> 1245</td>

<td> 786510</td><td> N/A</td><td> N/A</td><td> 6553</td><td> 6568</td><td> TGATTCCAATT TTGCA</td><td> Tk_SGksAk_STd_STds^mCds ^mCd_SAd_SAd_STd_STd_STd_ST_dsGks^mCksAk</td><td> 17</td><td> 1246</td>

<td> 786511</td><td> N/A</td><td> N/A</td><td> 6555</td><td> 6570</td><td> CTTGATTCCAA TTTTG</td><td> ™CksTksTksGdsAdsTds Tds^mCds^mCdsAd_SA_dsT dsTdsTksTksGk</td><td> 20</td><td> 1247</td>

<td> 786512</td><td> N/A</td><td> N/A</td><td> 6557</td><td> 6572</td><td> CACTTGATTCC AATTT</td><td>^mCksAkS^mCksTdST_dsG dsAd_sTd_sT_ds^mCds^mCds AdsAdsTksTksTk</td><td> 36</td><td> 1248</td>

Table 19

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665795</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> Gk_STk_STk_SAd_STd_S^mCds τ /~י τ m Ids Cds Cds&lt;Jdslds Cds^mCdsT_ksGk_SGk</td><td> 31</td><td> 113</td>

<td> 728489</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AksAksGksGdsGds Cd _sA_ds^mCdSAdsGdS^mCdS Gds^dsAksGksGk</td><td> 0</td><td> 1249</td>

<td> 728695</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_SGksAksGdsTd_S^mCds Ad_ST_dsGdsGdsGds^mCd sT dsGksAksGk</td><td> 0</td><td> 423</td>

<td> 728696</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTksGksAdsGdsTds ^mCdsAdSTdSGdSGdsGd s^mCdsTkSGk_SAk</td><td> 21</td><td> 424</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCksTd_STdsGds τ τ י־/1מ τ י~/ vJdslds Cds 1 ds 1 ds&lt;Jds Ads^ks^ksTk</td><td> 38</td><td> 436</td>

<td> 785345</td><td> 383</td><td> 398</td><td> 4708</td><td> 4723</td><td> TATCTCCGTCC TGGCT</td><td> TAT τ 1 ks^ds A ds '-'ds A ds V ds Cds&lt;Jds 1 ds Cds C 111/^ τ י~/ י~/ T ds 1 ks'Jes'Jks '-'es^k</td><td> 0</td><td> 116</td>

<td> 785346</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> GksTd_STd_SAd_STd_S^mCds m יך י~/ τ 1 ds '-'ds '-׳ds'-Jds 1 ds Cks^mCesTksGesGk</td><td> 0</td><td> 113</td>

<td> 785350</td><td> 482</td><td> 497</td><td> 8375</td><td> 8390</td><td> GGGCACAGCG CAGGTT</td><td> GksGdsGds^mCdsAds^mCdsA_dsGd_S^mCd_SGd_S^mCdsAksGesGksTesTk</td><td> 37</td><td> 1250</td>

<td> 785351</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AksAdsGdsGdsGds Cd _sAd_S^mCdSAdsGds^mCds Gks^mCesAksGesG_k</td><td> 0</td><td> 1249</td>

<td> 785355</td><td> 1268</td><td> 1283</td><td> 10501</td><td> 10516</td><td> AGTCATGGGC TGAGGC</td><td> Ak_sGdsTds^mCdsAdsTds GdsGdsGds^mCdsT_dsGk _sA־_sGk_SGes^mCk</td><td> 25</td><td> 421</td>

<td> 785356</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> Gk_SAd_SGdsTds^mCdsAd sTdsGdsGdsGds^mCd_STk sGesAksGesGk</td><td> 0</td><td> 422</td>

<td> 785357</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_sGdsAd_sGdsTds^mCds Ad_STdsGdsGdsGds^mCk sT esGksAesGk</td><td> 0</td><td> 423</td>

<td> 785358</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTdsGdsAdsGdsTds ^mCdSAdSTdSGdsGdsGk s^mCesTksGe_SAk</td><td> 0</td><td> 424</td>

<td> 785405</td><td> 482</td><td> 497</td><td> 8375</td><td> 8390</td><td> GGGCACAGCG CAGGTT</td><td> GksGdsGds^mCdsAds^mCdsAdsGds^mCdsGds^mCksAesGksGesTksTe</td><td> 33</td><td> 1250</td>

<td> 785406</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AksAdsGdsGdsGds Cd _sAd_S^mCdsAdsGds^mCks Ges^mC_ksA_esG_ksGe</td><td> 0</td><td> 1249</td>

<td> 785410</td><td> 1268</td><td> 1283</td><td> 10501</td><td> 10516</td><td> AGTCATGGGC TGAGGC</td><td> AksGdsTds^mCdsAdsTds GdsGdsGds^mCdsTksGe sAksGesGks^mCe</td><td> 17</td><td> 421</td>

<td> 785411</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> G_ksAd_SGdsTd_S^mCdsAd sTdSGdsGdsGds^mCksT_esGksAesGksGc</td><td> 0</td><td> 422</td>

<td> 785412</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> T_ksGdsAd_SGdsTd_S^mCds A_dsT_dsGd_SGd_SG_ks^mCe sTlssGesAjisGe</td><td> 0</td><td> 423</td>

<td> 785413</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> A_ksTdsGdsAdsGdsTds ”CdsAdsTdsGdsGksGe «¹CksTesGksA־</td><td> 7</td><td> 424</td>

<td> 785457</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> G_ksTesT_ksAdsTds^mCds m יך י~/ mp mp יך 1 ds '-'ds '-'ds'Jds¹ ds C_ds^mCe_ST_esG_ksG_k</td><td> 13</td><td> 113</td>

<td> 785460</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AjssAesGlisGdsGds Cd _sAd_S^mCdSAdsGds^mCds Gds^esAesGksGk</td><td> 0</td><td> 1249</td>

<td> 785462</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> T_ksGesA_ksGdsTds^mCds AdSTdsGdsGdsGds^mCd sTcsGesAk_sGk</td><td> 12</td><td> 423</td>

<td> 785463</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> A_ksT _CSG ks AdsGdsT ds ¹CdsAdsTdsGdsGdsGd sTesTesGksAk</td><td> 0</td><td> 424</td>

<td> 785489</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> T_ksT_ksAd_STd_S^mCd_STds τ י-/ י־/1מ Cds Cds&lt;Jds 1 ds Cds ''T Γ'' Γ י־/1מ '-'ds 1 ks'Jes'Jks '-׳e</td><td> 0</td><td> 117</td>

<td> 785490</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> G_ksT_ksTdsAd_STds^mCds τ mp mp /~יך י m 1 ds '-^zds '-'ds'Jds¹ ds Cds^ksTesGksGe</td><td> 0</td><td> 113</td>

<td> 785495</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AjssAissGdsGdsGds Cd sAds^mCdsA_dsGds^mCds Gds^ksAesGksGe</td><td> 0</td><td> 1249</td>

<td> 785499</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> G_ksA_ksGdsTd_S^mCdsAd sTdsGdsGdsGds^mCd_STd sGk_sA_esGksGe</td><td> 40</td><td> 422</td>

<td> 785500</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> T_ksG_ksAd_SGdsTd_S^mCds AdsT_dsGdsGdsGds^mCd sTlssGesAicsGe</td><td> 0</td><td> 423</td>

<td> 785501</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> A_ksT_ksGdsA_dsGdsTds ¹¹¹CdsAdsTdsGdsGdsGd sTksTesGksAe</td><td> 0</td><td> 424</td>

<td> 785545</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> T_ksT_ksAdsTds^mCdsTds mp יך י~/ י־/111 mp '-'ds '-'ds'Jds¹ ds '-'es mp י~/ י~/ _T י־/1מ Ves A es'Jes'Jks '-'k</td><td> 0</td><td> 117</td>

<td> 785550</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> G_ksA_ksGdsTds^mCdsAd sTdsGdsGdsGds^mCesT_esGesA_esG_ksG_k</td><td> 5</td><td> 422</td>

<td> 785551</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_SGksAd_SGdsTd_S^mCds Ad_STd_SGd_SGd_SG_es^mCe sTesGesAksGk</td><td> 15</td><td> 423</td>

<td> 785575</td><td> 383</td><td> 398</td><td> 4708</td><td> 4723</td><td> TATCTCCGTCC TGGCT</td><td> י־/במ τ י־/במ tat 1 ksAks 1 ds '-'ds 1 ds ds Cds&lt;Jdslds Cds C τ /~י~/ י mp τ ks¹ es^Jks^Jes Mis^k</td><td> 6</td><td> 116</td>

<td> 785576</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> Tk_sTksAdsTds^mCdsTds '-'ds V^dskJds 1 ds '-'ks Ves A kskJeskJks Vk</td><td> 0</td><td> 117</td>

<td> 785577</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> GksTksTd_SAd_STd_S^mCds τ m י-/ mr י־/1מ τ 1 ds '-'ds V^dskJds 1 ks Ces^mCksT_esGksGk</td><td> 0</td><td> 113</td>

<td> 785583</td><td> 482</td><td> 497</td><td> 8375</td><td> 8390</td><td> GGGCACAGCG CAGGTT</td><td> G_ksGk_SGd_S^mCdSAds^mCdsAd_SGd_S^mCd_SG_ds^mCksAesGksGesTksTk</td><td> 61</td><td> 1250</td>

<td> 785584</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AksAksGdsGdsGds Cd _sAd_S^mCdsAdsGds^mCkS Ges^mCksA_esGksGk</td><td> 0</td><td> 1249</td>

<td> 785590</td><td> 1268</td><td> 1283</td><td> 10501</td><td> 10516</td><td> AGTCATGGGC TGAGGC</td><td> AksGksTds^mCdsAdsTds GdsGdsGds^mCdsTksGe sAksGesGks^mCk</td><td> 17</td><td> 421</td>

<td> 785591</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> Gk_SAksGdsTd_S^mCdsAd sTdsGdsGdsGds^mCksT_{e s}GksA_esGksGk</td><td> 0</td><td> 422</td>

<td> 785592</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> TksGk_SAd_SGdsTd_S^mCds A_dsT_dsGd_SGd_SGk_S^mCe sTksGesAksGk</td><td> 0</td><td> 423</td>

<td> 785593</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTksGdsAdsGdsTds ”CdsAdsTdsGdsGksGe _s^mCksTesGksAk</td><td> 0</td><td> 424</td>

<td> 785654</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> Tk_sTksAdsTds^mCdsTds '-'ds '-׳ds'-Jds¹ ds '-'ds Ves A es'Jes'Jks '-'k</td><td> 5</td><td> 117</td>

<td> 785659</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> Gk_SAksGdsTd_S^mCdsAd sTdsGdsGdsGds^mCdsT_{e s}G_esA_esGksGk</td><td> 30</td><td> 422</td>

<td> 785660</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_SGksAd_SGdsTd_S^mCds A_dsT_dsGd_SGd_SGd_S^mCe sTesGesAksGk</td><td> 16</td><td> 423</td>

<td> 785684</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> Tk_sTksAdsTds^mCdsTds Cds Cds&lt;Jds 1 ds Cds 111/י τ Τ' Τ' ηιτ '-'ks 1 dskJkskJds '-'k</td><td> 14</td><td> 117</td>

<td> 785689</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> Gk_SAksGdsTd_S^mCdsAd sTdsGdsGdsGds^mCd_STk sGdsAksGdsGk</td><td> 31</td><td> 422</td>

<td> 785690</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_SGksAd_SGdsTd_S^mCds Ad_STdsGdsGdsGds^mCk sT dsGksAdsGk</td><td> 12</td><td> 423</td>

<td> 785714</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> Tk_sTksAdsTds^mCdsTds τ τ ηιτ י־/111 י־/111 Cds '-'ds'Jds 1 ds Cds 111/י־ Τ Γ'' Γ'' '-'ks 1 es'Jks'Jes Vk</td><td> 0</td><td> 117</td>

<td> 785715</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> GksTksTd_SAd_STd_S^mCds m יך י~/ י&gt;111 יך 1 ds '-'ds '-'ds'^Jds¹ ds CksTesTksGesGk</td><td> 0</td><td> 113</td>

<td> 785720</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AksAksGdsGdsGds Cd _sAd_S^mCdSAdsGds^mCds G_ks^mC_esA_ksG_esG_k</td><td> 0</td><td> 1249</td>

<td> 785724</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> G_ksA_ksGdsTd_S^mCdsAd sTdsGdsGdsGds^mCd_ST_ksGesAjssGesGli</td><td> 15</td><td> 422</td>

<td> 785725</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> T_ksG_ksAd_SGd_STd_S^mCds AdSTdsGdsGdsGds^mCk sT esG_ksA_esG_k</td><td> 0</td><td> 423</td>

<td> 785726</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> A_ksT_ksGd_SA_dsGd_ST_ds^mCdsAdSTdsGdSGdSGk s^mCesTksGesA_k</td><td> 0</td><td> 424</td>

<td> 785770</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> G_ksT_ksT_ksAdsTds^mCds m יך י~/ י&gt;111 יך 1 ds '-^zds '-'ds'Jds¹ ds CksTdsTksGdsGk</td><td> 27</td><td> 113</td>

<td> 785773</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AjssAissGlssGdsGds Cd _sAd_S^mCdSAdsGds^mCds Gks^dsAksGdsGk</td><td> 12</td><td> 1249</td>

<td> 785775</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> T_ksG_ksA_ksGdsTd_S^mCds AdSTdsGdsGdsGds^mCk sT d_SG_ksA_dsG_k</td><td> 3</td><td> 423</td>

<td> 785776</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTksGksAdsGdsTds ^mCdsAdSTdsGdSGdSGk s^mCdsTksG_dsA_k</td><td> 0</td><td> 424</td>

<td> 785802</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> T_ksT_ksA_ksTd_S^mCd_STds τ י-/ י־/1מ Cds '-'ds'Jds 1 ds Cds ''T Γ'' Γ י־/1מ '-ks 1 eskJkskJes Vk</td><td> 0</td><td> 117</td>

<td> 785803</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> G_ksT_ksT_ksAdsTds^mCds m יך י~/ י&gt;111 τ 1 ds '-'ds '-'ds'Jds¹ ds Cks^esTksGesGk</td><td> 0</td><td> 113</td>

<td> 785808</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AjssAissGlssGdsGds Cd _sAd_S^mCdSAdsGds^mCds G_ks^mC_esA_ksG_esG_k</td><td> 0</td><td> 1249</td>

<td> 785812</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> G_ksA_ksG_ksTd_S^mCdsAd sTdsGdsGdsGds^mCd_ST_ksGesA^GesGit</td><td> 0</td><td> 422</td>

<td> 785813</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> T_ksG_ksA_ksGdsTd_S^mCds AdSTdsGdsGdsGds^mCk sT esG_ksA_esG_k</td><td> 0</td><td> 423</td>

<td> 785814</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTksGksAdsGdsTds ^mCdsAdSTdsGdSGdSGk s^mCesTksGesA_k</td><td> 0</td><td> 424</td>

<td> 785858</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> G_ksT_ksT_ksAdsTds^mCds m יך י~/ י&gt;111 τ 1 ds '-'ds '-'ds'Jds¹ ds Cds^ksTesGksGe</td><td> 0</td><td> 113</td>

<td> 785861</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AjssAissGlssGdsGds Cd _sAd_S^mCdSAdsGds^mCds Gds^ksAesGksGe</td><td> 0</td><td> 1249</td>

<td> 785863</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_SGksAksGdsTd_S^mCds Ad_STdsGdsGdsGds^mCd sTksGesAksGe</td><td> 17</td><td> 423</td>

<td> 785864</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTksGksAdsGdsTds ^mCdsAdsTdsGdsGdsGd s^mCksTesGksAe</td><td> 9</td><td> 424</td>

<td> 785890</td><td> 384</td><td> 399</td><td> 4709</td><td> 4724</td><td> TTATCTCCGTC CTGGC</td><td> TksTksAksTds^mCdsTds τ י-/ י־/1מ Cds Cds&lt;Jdslds Cds י־/1מ י~/ י~/ τ י־/1מ ^ds 1 ksvJksvJks</td><td> 0</td><td> 117</td>

<td> 785891</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> Gk_STk_STk_SAd_STd_S^mCds τ m י-/ י־/1מ τ Ids Cds Cds&lt;Jdslds C_ds^mCksTksGksGe</td><td> 33</td><td> 113</td>

<td> 785896</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> AksAksGksGdsGds Cd _sAd_S^mCdSAdsGds^mCds Gds^mCksAksGksGe</td><td> 3</td><td> 1249</td>

<td> 785900</td><td> 1269</td><td> 1284</td><td> 10502</td><td> 10517</td><td> GAGTCATGGG CTGAGG</td><td> Gk_SAksGksTd_S^mCdsAd sTdsGdsGdsGds^mCd_STd sGksAksGksGe</td><td> 0</td><td> 422</td>

<td> 785901</td><td> 1270</td><td> 1285</td><td> 10503</td><td> 10518</td><td> TGAGTCATGG GCTGAG</td><td> Tk_SGksAksGdsTd_S^mCds Ad_ST_dsGdsGdsGds^mCd sTksGksAksGe</td><td> 11</td><td> 423</td>

<td> 785902</td><td> 1271</td><td> 1286</td><td> 10504</td><td> 10519</td><td> ATGAGTCATG GGCTGA</td><td> AksTksGksAdsGdsTds ^mCdsAdsTdsGdsGdsGd s^mCksTksGksAe</td><td> 20</td><td> 424</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCksAksAdsTdsT dsTdsTdsGds^mCdsAdsT dsTks^mCks^mCksAe</td><td> 71</td><td> 1242</td>

<td> 786473</td><td> 385</td><td> 400</td><td> 4710</td><td> 4725</td><td> GTTATCTCCGT CCTGG</td><td> GksTd_STdsAd_STds^mCds τ m י-/ י־/1מ τ 1 ds ^ds ^dsvJds 1 ks Ces^mCksTesGksGe</td><td> 0</td><td> 113</td>

<td> 786474</td><td> 383</td><td> 398</td><td> 4708</td><td> 4723</td><td> TATCTCCGTCC TGGCT</td><td> י־/במ τ י־/במ TAT 1 ksAds 1 ds ^ds 1 ds mr _r י&gt;111 -ך ds '-׳ds'-Jds 1 ds ^ds יך י־/1מ י~/ י~/ τ ks 1 eskJkskJes '-ks 1 e</td><td> 0</td><td> 116</td>

<td> 786495</td><td> 483</td><td> 498</td><td> 8376</td><td> 8391</td><td> AGGGCACAGC GCAGGT</td><td> AksGksGksGds CdsAd s^mCdsAdsGds^mCdsGds ^mCdsAdsGksGksTk</td><td> 2</td><td> 1251</td>

<td> 786496</td><td> 485</td><td> 500</td><td> 8378</td><td> 8393</td><td> TAAGGGCACA GCGCAG</td><td> TksAksAksGdsGdsGds ^mCdsAds^mCdsAdsGds^mCdsGds^mCksAksGk</td><td> 0</td><td> 1252</td>

<td> 786497</td><td> 486</td><td> 501</td><td> 8379</td><td> 8394</td><td> TTAAGGGCAC AGCGCA</td><td> TksTksAksAdsGdsGds Gds^mCdsAds^mCdsAds Gds^mCdsGks^mCksAk</td><td> 0</td><td> 1253</td>

Table 20

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665892</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACACA GGCGGA</td><td> “CksAksTksTdsGdsAds ^mCdsAds^mCdsA_dsG_dsG_{d s}^mC_dsGksGksA_k</td><td> 1</td><td> 387</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACAC AGGCGG</td><td> ϋ^ΛΤΑ A_ds^mCdsAds^mCdsA_dsG_{d s}G_ds^mCksGksGk</td><td> 14</td><td> 39</td>

<td> 728466</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGk_STk_SG_dsT_dsA_dsT_d s 1 ds 1 ds Cds Cds '-'ds 1 י־/1מ τ י~/ dsCks 1 ks Ck</td><td> 10</td><td> 1254</td>

<td> 728489</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACA GCGCAGG</td><td> AksAksGksG_dsG_ds C_dsA_ds^mCdsAdsGds^mCdsG_{d s}^mC_dsAksGksGk</td><td> 48</td><td> 1249</td>

<td> 728670</td><td> 1230</td><td> 1245</td><td> 10463</td><td> 10478</td><td> TTGCACTGAC ACAGGC</td><td> TksTksGks^mCdsAds^mCds T_dsG_dsA_ds^mCdsAds^mCds A^GATk</td><td> 18</td><td> 398</td>

<td> 728705</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד τ י־/1מ τ י~/ י~/ CksCks 1 ks Cds 1 ds 1 ds '-/mr τ m י־/1מ λ י~/ CdsAds Cds CdsAds C mp mp p mp ds Cds CksCks Ck</td><td> 33</td><td> 433</td>

<td> 728706</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> τ m י~ץ י~ץ יד τ י&gt;111 Cks A ks A ksCdsCds A ds C_dsT_dsT_dsG_dsA_ds^mC_ds^m Cds A ks Cks Ck</td><td> 41</td><td> 434</td>

<td> 728707</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gk_S^mCksTksT_dsG_dsG_ds Am י~/ יד τ י־/1מ τ Ads CdsAdsAdsCdsAds Cds Cks A ks Ck</td><td> 43</td><td> 435</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCk_ST_dsT_dsG_ds יד יד τ י~/ Cds A ds Cds A ds A dsCds A_ds^mCks^mCksT_k</td><td> 14</td><td> 436</td>

<td> 729037</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד τ י־/1מ יד τ י~/ י~/ CksCks A ks A ds Cds A ds A _dsG_dsG_dsA_ds^mCdsTds^mC dsTks^mCksAk</td><td> 68</td><td> 706</td>

<td> 785354</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACAC AGGCGG</td><td> Gks^mCdsAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_{k s}Ges^mCksGesG_k</td><td> 0</td><td> 39</td>

<td> 785359</td><td> 1301</td><td> 1316</td><td> 10534</td><td> 10549</td><td> TCTTGACCTC CCGCTG</td><td> λ m י~/ יד τ י־/במ τ A ks Cds A ds A dsCdsAds p mp ¹־p mp mp m Cds '-'ds 1 ds '-'ds '-'ds CksGesTksTesGk</td><td> 46</td><td> 391</td>

<td> 785360</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד τ τ י~/ י~/ CksCds A ds Cds A ds A ds '-/mr τ m י־/1מ λ י~/ CdsAds Cds Cds A ds C mp mp p mp ks Ces CksCTes Ck</td><td> 37</td><td> 433</td>

<td> 785361</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> m&lt;x τ יד τ m Cks A ds A dsCdsCds A ds C_dsT_dsT_dsG_dsA_ds^mCks^m p יך mp mp CesIks Ces Ck</td><td> 0</td><td> 434</td>

<td> 785362</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCdsTd_STd_SGdsGds A m י~׳/ יד יד ^✓m יד 1 ds '-'ds A ds A ds'-Jds^'ks p mp ¹־p mp Ms '-'ks 1 es M</td><td> 18</td><td> 435</td>

<td> 785363</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGds^mCdsTd_STdsGds י~/ יד יד יד י~/ Mis 1 ds '-'ds 1 ds 1 dsvJks A me me יך -^-es '-'ks Ms¹ k</td><td> 0</td><td> 436</td>

<td> 785409</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACAC AGGCGG</td><td> Gks^mCdsAds^mCdsTdsGds Ads^mCdSAdS^mCdsAk_SGe _sGk_s^mCe_SGksGe</td><td> 0</td><td> 39</td>

<td> 785414</td><td> 1301</td><td> 1316</td><td> 10534</td><td> 10549</td><td> TCTTGACCTC CCGCTG</td><td> r' A m יד יד mp יד 1 ks '-'ds A ds A dsMisAds p me יך me me m '-'ds '-'ds 1 ds '-'ds '-'ks CesGfaTesTksGe</td><td> 40</td><td> 391</td>

<td> 785415</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד יד mp יד p p xJksxJds A ds '-'ds 1 ds A ds P λ mp mp יד mp vJdsAtfs Ms Ms Iks *-׳ me me p mp es Mes MsvJks M</td><td> 35</td><td> 433</td>

<td> 785416</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> m יד p p יד יד mp Ms 1 ds 1 dsvJdsvJds 1 ds C_dsT_dsT_dsG_dsA_ks^mC_es^m p יך mp mp '-'ks 1 es '-'ks M</td><td> 0</td><td> 434</td>

<td> 785417</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCdsTd_STd_SGdsGds P λ in יד יד mp יד 1 ds Ms 1 ds 1 dsvJksAes p mp יך mp Mes Ms^ks M</td><td> 17</td><td> 435</td>

<td> 785418</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGds^mCdsTd_STdsGds P יד יד mp יד p vJds 1 ds Ms 1 ds 1 ksMs A mp mp יך TAks Ms Mes¹ e</td><td> 14</td><td> 436</td>

<td> 785464</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יך יך mp יך p p kJkskJesAks '-'ds¹ds¹ds P λ mp mp יד mp MsAds Ms Ms Ids C mp mp p mp ds Ms MsMes Me</td><td> 33</td><td> 433</td>

<td> 785465</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> mp _{T T} p p _T m Mes 1 es¹ ksMisMis¹ ds C_dsT_dsT_dsG_dsA_ds^mC_ds^m p יך mp mp Ms A es Mes Me</td><td> 36</td><td> 434</td>

<td> 785466</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCesTksT_dsG_dsG_ds P A m יד יד mp יד 1 ds '-'ds A ds A ds^JdsAds p mp יך mp Ms Ms Iks Me</td><td> 46</td><td> 435</td>

<td> 785467</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> AksGes^mCksT_dsT_dsG_ds P יד יד mp יד p Ms Ids MsldsldsMs A mp mp יך -^-es Ms '-'ks¹ k</td><td> 38</td><td> 436</td>

<td> 785498</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksG_ks^mCdsAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_{d s}GksGes^mCksG_e</td><td> 16</td><td> 388</td>

<td> 785502</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> P יד יד mp יד p vJks 1 ks Ms 1 ds 1 dsMis Λ mp mp יד mp m Ads Ms Ms Ids Ms p mp p mp יך '-'ds Mes'Jes '-'ks 1 e</td><td> 65</td><td> 432</td>

<td> 785503</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד יד mp יד p p 'Jks'Jks A ds '-'ds 1 ds A ds P λ mp mp יד mp MsAds Ms Ms Ids C mp mp p mp ds Mes MsvJks M</td><td> 0</td><td> 433</td>

<td> 785504</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> m יד p p יד יד mp Ms 1 ks 1 dsvJdsvJds 1 ds C_dsT_dsT_dsG_dsA_ds^mC_ds^m p יך mp mp '-'ks 1 es '-'ks M</td><td> 39</td><td> 434</td>

<td> 785505</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCk_ST_dsT_dsG_dsG_ds P Am יד יד mp יד Ids MsldsldsMsAds p mp יך mp Mes Ms Iks M</td><td> 9</td><td> 435</td>

<td> 785506</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCdsTd_STdsGds 'r יד יד יד י~/ 'Jds A ds '-'ds A ds A ds'Jds Aks^es^ksTe</td><td> 0</td><td> 436</td>

<td> 785549</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksGks^mCdsAds^mCdsTds GdsAds^mCdsAds^mCesA־ sGesGes^mCkSGk</td><td> 0</td><td> 388</td>

<td> 785552</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> י~/ יד יד יד י~/ vJks 1 ks '-'ds 1 ds 1 dsvJds a mp mp יך mp m /¼ '-'ds '-'ds 1 ds Ves p mp p mp ¹־p Ves '-'es'Jes '-'ks^k</td><td> 34</td><td> 432</td>

<td> 785553</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> m יד 'r' r יד יד mp '-'ks 1 ks A ds'Jds'Jds A ds C_dsT_dsT_dsG_dsA־_s^mC_es^m p יך mp mp Ves A es '-'ks Vk</td><td> 20</td><td> 434</td>

<td> 785554</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCk_STd_STd_SGdsGds ¹יך mp T T f' A ^m 1 ds '-'ds 1 ds 1 ds^Jes-^-es p mp ¹־p mp Ves '-'es^ks Vk</td><td> 19</td><td> 435</td>

<td> 785588</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACAC AGGCGG</td><td> Gk_S^mCksAds^mCdsTdsGds Ads^mCdsAds^mCdsA_ksG_{e s}Gk_s^mCe_SGksGk</td><td> 0</td><td> 39</td>

<td> 785589</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksGks^mCdsAds^mCdsTds GdsAds^mCdsAds^mCksAe _sGksG_es^mCksGk</td><td> 0</td><td> 388</td>

<td> 785594</td><td> 1301</td><td> 1316</td><td> 10534</td><td> 10549</td><td> TCTTGACCTC CCGCTG</td><td> λ m י~/ יד יד יד 1 ks '-'ks 1 ds 1 dsvJdsAtfs p mp ¹־p mp mp m '-'ds '-'ds 1 ds '-'ds '-'ks CesGks^mC_esTksG_k</td><td> 19</td><td> 391</td>

<td> 785595</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> P יד יד mp יד p 'Jks A ks '-'ds A ds A ds'Jds A mp mp יד mp m Ads '-'ds '-'ds 1 ds '-'ks p mp p mp יך Ves '-'ks'Jes Mes Ik</td><td> 26</td><td> 432</td>

<td> 785596</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד יד mp יד p p 'Jks'Jks A ds '-'ds 1 ds A ds P λ mp mp יד mp vJdsAds Cds '-'dsIks mp mp p mp es '-'ks '-'es'Jks Vk</td><td> 44</td><td> 433</td>

<td> 785597</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> m יד p p יד יד mp '-'ks 1 ks 1 dsvJdsvJds 1 ds C_dsT_dsT_dsG_dsA_ks^mC_es^m p יך mp mp '-'ks 1 es '-'ks Vk</td><td> 0</td><td> 434</td>

<td> 785598</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCk_ST_dsT_dsG_dsG_ds P Am יד יד mp יד 1 ds '-'ds 1 ds 1 dsvJksAes p mp יך mp '-'ks '-'es A ks '-'k</td><td> 21</td><td> 435</td>

<td> 785599</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mC_dsT_dsT_dsG_ds P יד יד mp יד p Lids 1 ds '-'ds 1 ds 1 ksvJes A mp mp יך TAks '-'es '-'ks ¹ k</td><td> 0</td><td> 436</td>

<td> 785658</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksG_ks^mCdsAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_{e s}Ge_SGe_S^mC_ksG_k</td><td> 18</td><td> 388</td>

<td> 785661</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> P יד יד mp יד p 'Jks A ks '-'ds A ds A ds'Jds A mp mp יד ^mP m Ads Cds '-'dsIds Cds p mp p mp יך Ves '-'es'Jes Vkslk</td><td> 54</td><td> 432</td>

<td> 785662</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> m יד p p יד יד mp '-'ks 1 ks 1 dsvJdsvJds 1 ds C_dsT_dsT_dsG_dsA_ds^mC_es^m p יך mp mp Ves A es '-'ks Vk</td><td> 11</td><td> 434</td>

<td> 785663</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> G_ks^mC_ksT_dsT_dsG_dsG_ds P Am יד יד mp יד 1 ds '-'ds 1 ds 1 dsvJdsAes p mp יך mp Ves '-'es^ks Vk</td><td> 10</td><td> 435</td>

<td> 785688</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksGk_S^mCdsAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_ksGdsGfaTdsGk</td><td> 0</td><td> 388</td>

<td> 785691</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> /~י τ τ τ /~י vJks 1 ks '-'ds 1 ds 1 dsvJds a mr mr τ m/^ m Ads Cds Cdslds Cds τ י&gt;111 י~/ י&gt;111 '-'ks '-'ds'Jks '-'dsIk</td><td> 46</td><td> 432</td>

<td> 785692</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> τ m י~/ י~/ τ τ י־/111 Cks 1 ks 1 dsvJdsvJds 1 ds CdsTdsTdsGdsAds^ks” '-'ds 1 ks '-'ds '-'k</td><td> 13</td><td> 434</td>

<td> 785693</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> G_ks^mC_ksT_dsT_dsG_dsG_dsτ τ τ ri' a m 1 ds '-'ds 1 ds 1 dsvJdsAks '-'ds '-'ks 1 ds '-'k</td><td> 11</td><td> 435</td>

<td> 785723</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksG_ks^mCdsAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_ksGesGks^mCesG_k</td><td> 0</td><td> 388</td>

<td> 785727</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> /~י τ τ τ 'Jks 1 ks '-'ds 1 ds 1 dsvJds a mp mp יך mp m A*-ds '-'ds '-'ds¹ ds '-'ds p mp p mp ¹״p '-'ks '-'es'Jks '-'es^k</td><td> 40</td><td> 432</td>

<td> 785728</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד ידי τ י~/ י~/ 'Jks'Jks 1 ds '-'ds 1 ds 1 ds /~י a mr mr τ י־/1מ vJdsAds Cds '-'dsIds C mp mp mp ks '-'es '-׳ks'-Jes Me</td><td> 7</td><td> 433</td>

<td> 785729</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> τ m י~/ י~/ יד τ י־/111 '-'ks 1 ks 1 dsvJdsvJds 1 ds CdsTdsTdsGdsAds^ks” p τ mp mp '-'es^ks '-'es Me</td><td> 3</td><td> 434</td>

<td> 785730</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> G_ks^mC_ksT_dsT_dsG_dsG_ds a in י~/ יד יד τ 1 ds '-'ds 1 ds 1 dsvJdsAks p mp יך mp Ves '-'ks 1 es Vk</td><td> 33</td><td> 435</td>

<td> 785731</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> A_ksG_ks^mC_dsT_dsT_dsG_ds י~/ יד τ τ י~/ vids 1 ds '-'ds 1 ds 1 dsvJks A_es^mCks^mCesTk</td><td> 8</td><td> 436</td>

<td> 785777</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד τ τ י~/ י~/ 'Jks'Jks 1 ks '-'ds 1 ds 1 ds '־/m יד a י~/ 'JdsAds Cds '-'ds A ds '-׳ '־/m י~/ '־/m '־/m ks Cds CksVJds Ck</td><td> 4</td><td> 433</td>

<td> 785778</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> τ m י~/ י~/ יד m&lt;x τ '-'ks 1 ks 1 ksvJdsvJds 1 ds CdsTdsTdsGdsAds^ks” p τ mp mp '-'ds^ks '-'ds '-'k</td><td> 19</td><td> 434</td>

<td> 785779</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> G_ks^mC_ksT_ksT_dsG_dsG_ds A m י~/ יד τ τ 1 ds '-'ds 1 ds 1 dsvJdsAks p mp τ mp '-'ds '-'ks¹ ds '-'k</td><td> 30</td><td> 435</td>

<td> 785780</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> A_ksG_ks^mC_ksT_dsT_dsG_ds י~/ יד τ τ י~/ vids 1 ds '-'ds 1 ds 1 dsvJks A_ds^mCks^mCdsT_k</td><td> 12</td><td> 436</td>

<td> 785811</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksG_ks^mCksAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_ksGesGks^mCesG_k</td><td> 0</td><td> 388</td>

<td> 785815</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> י~/ יד τ τ י~/ vJks 1 ks '-'ks 1 ds 1 dsvJds a mp mp τ mp m -^-ds '-'ds '-'ds¹ ds '-'ds p mp p mp יך '-'ks '-'es'Jks '-'es^k</td><td> 23</td><td> 432</td>

<td> 785816</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> יד τ τ י~/ י~/ 'Jks'Jks 1 ks '-'ds 1 ds 1 ds י־/1ז1 τ '־/m י־/1ז1 a י~/ vJdsAds Cds '-'dsIds C mp mp p mp ks Ves '-'ks'Jes Vk</td><td> 29</td><td> 433</td>

<td> 785817</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> י־/1מ t τ u u τ m Cks 1 ks 1 ksvJdsvJds 1 ds CdsTdsTdsGdsAds^ks” p יך mp mp ^eslks Ves Vk</td><td> 1</td><td> 434</td>

<td> 785818</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCksTksTd_SGdsGds τ τ τ /~י Am 1 ds '-'ds 1 ds 1 dsvJdsAks p mp τ mp '-'es '-'ks¹ es ^k</td><td> 0</td><td> 435</td>

<td> 785819</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCksTd_STdsGds /~י τ τ τ /~י vJds 1 ds '-'ds 1 ds 1 dsvJks A_es^mCks^mCeSTk</td><td> 3</td><td> 436</td>

<td> 785865</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> p p τ mp τ יד 'Jks'Jks A ks '-'ds 1 ds A ds P a mp mp τ mp &lt;JdsAds Cds Cdslds C mp mp p mp ds Vks VesvJks '-'e</td><td> 7</td><td> 433</td>

<td> 785866</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> mp τ יד Ο Ο τ m '-'ks 1 ks A ks'Jds'Jds A ds C_dsTd_STd_SGd_SA_ds^mCd_S^m p יך mp mp '-'ks 1 es '-'ks '-׳e</td><td> 15</td><td> 434</td>

<td> 785867</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gk_S^mCksTksTd_SGdsGds τ mp τ יד O A m 1 ds '-'ds A ds A ds'JdsAds p mp יך mp '-'ks '-'es^ks '-׳e</td><td> 35</td><td> 435</td>

<td> 785868</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCksTd_STdsGds p τ mp τ יד p vJdslds Cds 1 ds 1 ds&lt;Jds A mp mp τ -τ'-ks '-'es '-'ks¹ e</td><td> 26</td><td> 436</td>

<td> 785899</td><td> 1229</td><td> 1244</td><td> 10462</td><td> 10477</td><td> TGCACTGACA CAGGCG</td><td> T_ksGks^mCksAdS^mCdsTds GdsAd_S^mCdSAds^mCdSAd _sGk_SG_ks^mC_ksGe</td><td> 0</td><td> 388</td>

<td> 785903</td><td> 1302</td><td> 1317</td><td> 10535</td><td> 10550</td><td> GTCTTGACCT CCCGCT</td><td> p τ mp τ יד o 'Jks A ks '-'ks A ds A ds'Jds A mp mp τ mp m Ads Cds Cdslds Cds p mp p mp τ '-'ds '-'ks'Jks '-'ks 1 e</td><td> 51</td><td> 432</td>

<td> 785904</td><td> 1303</td><td> 1318</td><td> 10536</td><td> 10551</td><td> GGTCTTGACC TCCCGC</td><td> p p τ mp τ יד 'Jks'Jks A ks '-'ds 1 ds A ds P a mp mp τ mp vJdsAds Cds '-'dsIds C mp mp p mp ds '-'ks '-'ks'Jks '-'e</td><td> 22</td><td> 433</td>

<td> 785905</td><td> 1306</td><td> 1321</td><td> 10539</td><td> 10554</td><td> CTTGGTCTTG ACCTCC</td><td> mp τ יד p p τ m '-'ks 1 ks 1 ksvJdsvJds 1 ds C_dsT_dsT_dsG_dsA_ds^mC_ds^m p יך mp mp '-'ks^ks '-'ks '-'e</td><td> 6</td><td> 434</td>

<td> 785906</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCksTksT_dsG_dsG_dsτ mp τ י~/ יד Am Ids Cds 1 ds 1 dsVJdsAds p mp τ mp '-'ks '-'ks^ks '-'e</td><td> 29</td><td> 435</td>

<td> 785907</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCk_ST_dsT_dsG_ds י~/ יד τ '־/τ m י~/ vJdslds Cds 1 ds 1 ds&lt;Jds A mp mp τ -^ks '-'ks '-'ks ¹ e</td><td> 10</td><td> 436</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCksAksAdsTdsTds TdsTdsGds^mCdsA_dsT_dsT _ks^mCkS^mCkSAe</td><td> 30</td><td> 1242</td>

Table 21

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> (% Inhibition)</td><td> SEQ ID NO</td>

<td> 665908</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGk_STk_S^mCdsTdsGds /~י mrx mrx mrx יד יד &lt;Jds Cds Cds Cdsldsl dsTdsTksGksGk</td><td> 16</td><td> 393</td>

<td> 728466</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksTksGdsTdsAdsTd יך mp mp mp יך יך s¹ ds¹ ds '-^zds '-'ds '-'ds¹ mrx יד י~/ dsCks 1 ks Ck</td><td> 50</td><td> 1254</td>

<td> 728670</td><td> 1230</td><td> 1245</td><td> 10463</td><td> 10478</td><td> TTGCACTGAC ACAGGC</td><td> TksTksGks^mCdsAds^mCds TdsGdsAd_S^mCdsA_ds^mCds AdsGksGk_S^mCk</td><td> 8</td><td> 398</td>

<td> 728707</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCksTksTd_SGdsGds λ m י~/ יד יד י־/1מ יד Ids CdsldsldsCdsAds p mp יך mp '-'ds '-'ks^ks '-'k</td><td> 0</td><td> 435</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCksTd_STdsGds e יד יד me יד י~/ &lt;Jdslds Cds 1 ds 1 ds&lt;Jds Ads^ks^ksTk</td><td> 16</td><td> 436</td>

<td> 729037</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד יד יד יד י~/ י~/ 'Jks'Jks 1 ks A ds Cds 1 ds A _dsGd_SGd_SAd_S^mCdSTds^mC dSTks^mCksAk</td><td> 0</td><td> 706</td>

<td> 729038</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SGksGksTd_STds^mCds TdsTdsGdsGd_SAd_S^mCds me יד me יד 1 ds Cks 1 ks Ck</td><td> 0</td><td> 707</td>

<td> 729039</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGksGdsTdsTds^mCdsTdSTd_SGdsGdsAd_S^m יד me יד Cds 1 ks Cks 1 k</td><td> 0</td><td> 708</td>

<td> 785364</td><td> 1361</td><td> 1376</td><td> 10682</td><td> 10697</td><td> TCTGGCCCTT TTGGAA</td><td> יד me TGC' m&lt;x 1 ks Cds 1 dsCdsCds Cds mp mp יד τ τ τ '-'ds '-'ds 1 ds 1 ds 1 ds 1 ks G_esG_ksA_esA_k</td><td> 0</td><td> 454</td>

<td> 785365</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGdsTds^mCdsTdsGds יד יד m&lt;x m&lt;x m&lt;x י~/ &lt;Jds Cds Cds Cdsldsl ksTesTksGesGk</td><td> 0</td><td> 393</td>

<td> 785378</td><td> 2214</td><td> 2229</td><td> 11779</td><td> 11794</td><td> TTCTTGGACT CTCAAG</td><td> יד יד nir יד יד 1 ks A ds Cds 1 ds A ds^dsC a mp יך mp יך m ds-^-ds '-'ds 1 ds '-'ds 1 ks CesAksAesGk</td><td> 0</td><td> 705</td>

<td> 785379</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> יד יד me יד יד י~/ Cks 1 ds A ds Cds 1 ds A dsC _dsG_dsAds^mCdsTds^mCkST es CksAesAk</td><td> 35</td><td> 695</td>

<td> 785380</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד יד me יד יד י~/ י~/ CksCds 1 ds 1 ds Cds 1 ds 1 _dsG_dsG_dsA_ds^mCdsTks^mC esTks^mCesAk</td><td> 9</td><td> 706</td>

<td> 785381</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SG_dsG_dsT_dsT_ds^mCds TdsTdsGdsGdsAds^mCkS mp יך mp יך 1 es '-'ks 1 es Vk</td><td> 34</td><td> 707</td>

<td> 785382</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAdsGdsGdsTdsTds^mCdsT_dsT_dsG_dsG_dsAks^mp יך mp ¹τ¹'-'es^ks '-'es^k</td><td> 0</td><td> 708</td>

<td> 785419</td><td> 1361</td><td> 1376</td><td> 10682</td><td> 10697</td><td> TCTGGCCCTT TTGGAA</td><td> י~/ י~/ τ τ 1 ks '-'ds 1 dsvJdsvJds '-'ds mp mp Τ Τ Τ Τ '-'ds '-'ds 1 ds 1 ds 1 ks 1 es GksGesAksA_e</td><td> 0</td><td> 454</td>

<td> 785420</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> Gk_SG_dsT_ds^mC_dsT_dsG_ds ידי τ י־/1מ י~/ vids '-'ds '-'ds '-'ds 1 ks 1 esTksTesGksGe</td><td> 0</td><td> 393</td>

<td> 785433</td><td> 2214</td><td> 2229</td><td> 11779</td><td> 11794</td><td> TTCTTGGACT CTCAAG</td><td> י~׳/ י~׳/ יד יד mp יד τ 1 ks A ds '-'ds A ds A ds'Jds'J a mp יך mp יך m ds^ds V/ds 1 ds '-'ks 1 es CksAesAksGe</td><td> 0</td><td> 705</td>

<td> 785434</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> P יד יד mp יד p τ 'Jks 1 ds A ds '-'ds A ds A ds'J _dsG_dsA_ds^mCdsTks^mCeST ks CesAksAe</td><td> 0</td><td> 695</td>

<td> 785435</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> p p τ τ mp יד יד 'Jks'Jds 1 ds 1 ds '-'ds 1 ds 1 _dsG_dsG_dsA_ds^mCksTes^mC ksTes^mCksAe</td><td> 0</td><td> 706</td>

<td> 785436</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SG_dsG_dsT_dsT_ds^mC_dsT_dsT_dsG_dsG_dsAks^mCes τ mp יך mp Iks '-'es^ks *-׳e</td><td> 0</td><td> 707</td>

<td> 785437</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAdsGdsGdsTdsTds^mCdsT_dsT_dsG_dsGksA_es^mp τ mp τ '-'ks¹ es '-'ks¹ e</td><td> 0</td><td> 708</td>

<td> 785468</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGesTks^mC_dsT_dsG_dsp mp mp mp τ יד vJds Cds Cds Cdsldsl dsTesTesGksGk</td><td> 13</td><td> 393</td>

<td> 785475</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד יד mp יד p p τ 'Jks'Jes A ks A ds '-'ds A ds A _dsG_dsG_dsA_ds^mC_dsT_ds^mC esTes^mCksAk</td><td> 60</td><td> 706</td>

<td> 785476</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> AksGesGksT_dsT_ds^mCds TdsTdsGdsGdsAds^mCds mp יך mp יך¹ les '-'eslks Vk</td><td> 0</td><td> 707</td>

<td> 785477</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAesGksGdsTdsTds^mCdsT_dsT_dsG_dsG_dsA_ds^mp τ mp τ *-׳es 1 es '-'ks 1 k</td><td> 48</td><td> 708</td>

<td> 785507</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> p τ mp יד p p m vJks 1 ks '-'ds 1 dsvJdsvJds p mp mp Τ Τ T '-'ds '-'ds '-'ds 1 ds 1 ds 1 ds TksGesGksA_e</td><td> 0</td><td> 455</td>

<td> 785508</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGk_ST_ds^mC_dsT_dsG_dsp mp mp mp τ יד vJds Cds Cds Cdsldsl _dsTksTe_SGksGe</td><td> 0</td><td> 393</td>

<td> 785521</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> P יד יד mp יד p τ 'Jks 1 ks A ds '-'ds A ds A ds'J _dsG_dsAds^mCdsTds^mCdsT ks CesAksAe</td><td> 27</td><td> 695</td>

<td> 785522</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> p p τ τ mp יד יד 'Jks'Jks 1 ds 1 ds '-'ds 1 ds 1 _dsG_dsG_dsA_ds^mCdsTds^mC ksTes^mCksA_e</td><td> 51</td><td> 706</td>

<td> 785523</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> AksGksG_dsT_dsT_ds^mC_ds T_dsT_dsG_dsG_dsA_ds^mC_ds mp יך mp יך¹ Iks '-'eslks '-׳e</td><td> 41</td><td> 707</td>

<td> 785524</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGdsGdsTdsTds^mCdsT_dsT_dsG_dsG_dsA_ds^mp יך mp ¹τ¹Vks A es '-ks 1 e</td><td> 28</td><td> 708</td>

<td> 785555</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> τ in י־/1מ τ י~/ vJks 1 ks '-'ds 1 dsvJdsvJds p mp mp Τ _T T *-ds V/ds *-ds 1 ds 1 es 1 es TesGesGksAk</td><td> 0</td><td> 455</td>

<td> 785562</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> י~/ τ τ י־/1מ יד τ י~/ vJks 1 ks 1 ds '-'ds 1 ds 1 dsvJ _dsG_dsA_ds^mCdsTes^mCeST es CesAksAk</td><td> 8</td><td> 695</td>

<td> 785563</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> p p τ יד mp τ יד kJkskJks 1 ds A ds '-'ds A ds A _dsG_dsG_dsA_ds^mCesTes^mC esT_es^mCksAk</td><td> 54</td><td> 706</td>

<td> 785564</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> AksGksG_dsT_dsT_ds^mC_dsT_dsT_dsG_dsG_dsAes^mCesT mp יך mp es '-'es^ks Vk</td><td> 17</td><td> 707</td>

<td> 785600</td><td> 1361</td><td> 1376</td><td> 10682</td><td> 10697</td><td> TCTGGCCCTT TTGGAA</td><td> T mp τ P P mp Iks Cks 1 dsVJdsVJds Cds mp mp τ τ τ τ '-'ds '-'ds 1 ds¹ ds¹ ks¹ es GksGesAksAk</td><td> 0</td><td> 454</td>

<td> 785601</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> p τ mp τ P P m vJks 1 ks '-'ds 1 dsvJdsvJds יד יד יד p mp mp '-'ds '-'ds '-'ds 1 ds 1 ks 1 es TksGesGksAk</td><td> 0</td><td> 455</td>

<td> 785602</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGksT_ds^mC_dsT_dsG_ds p mp mp mp τ יד vids '-'ds '-'ds '-'ds 1 ks 1 esTksTesGksGk</td><td> 0</td><td> 393</td>

<td> 785621</td><td> 2214</td><td> 2229</td><td> 11779</td><td> 11794</td><td> TTCTTGGACT CTCAAG</td><td> τ יד mp τ יד p p 1 ks A ks '-'ds A ds A ds^ds^J a mp יך mp יך m ds^ds V/ds 1 ds '-'ks 1 es CksAesAksGk</td><td> 0</td><td> 705</td>

<td> 785622</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> י~׳/ יד mp τ יד p τ kJks 1 ks A ds '-'ds A ds A ds^J _dsG_dsA_ds^mCdsTks^mCeST ks CesAksAk</td><td> 0</td><td> 695</td>

<td> 785623</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> p p τ τ mp τ יד 'Jks'Jks 1 ds 1 ds '-'ds 1 ds 1 _dsG_dsG_dsA_ds^mCksTes^mC ksTes^mCksAk</td><td> 0</td><td> 706</td>

<td> 785624</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> AksGksG_dsT_dsT_ds^mCds TdsTdsGdsGdsAks^mCes τ mp יך mp 1 ks '-'es A ks '-'k</td><td> 0</td><td> 707</td>

<td> 785625</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGdsGdsTdsTds^mCdsT_dsT_dsG_dsGksAes^mp τ mp τ '-'ks A es '-'ks A k</td><td> 0</td><td> 708</td>

<td> 785664</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> p τ mp τ P P m vJks 1 ks '-'ds 1 dsvJdsvJds p mp mp τ Τ T '-'ds '-'ds '-'ds 1 ds 1 ds 1 es TesGesGksAk</td><td> 0</td><td> 455</td>

<td> 785671</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> י~׳/ יד mp τ יד p τ kJks 1 ks A ds '-'ds A ds A ds^J _dsG_dsA_ds^mC_dsT_ds^mCesT es CesAksAk</td><td> 22</td><td> 695</td>

<td> 785672</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> p p τ τ mp τ יד 'Jks'Jks 1 ds 1 ds '-'ds 1 ds 1 _dsG_dsG_dsA_ds^mCdsTes^mC esTes^mCksAk</td><td> 48</td><td> 706</td>

<td> 785673</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> AksGksG_dsT_dsT_ds^mC_ds T_dsT_dsG_dsG_dA_ds^mCes mp יך mp יך^, les '-'eslks Vk</td><td> 0</td><td> 707</td>

<td> 785694</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> m י~/ י~/ τ י־/1מ τ י~/ vJks 1 ks '-'ds 1 dsvJdsvJds p me me Τ Τ T '-'ds '-'ds '-'ds 1 ds¹ ds¹ ks TdsGksGdsAk</td><td> 0</td><td> 455</td>

<td> 785701</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> י~/ τ τ י־/1מ יד τ י~/ vJks 1 ks 1 ds '-'ds 1 ds 1 dsvJ _dsG_dsAds^mCdsTds^mCkST ds CksAdsAk</td><td> 20</td><td> 695</td>

<td> 785702</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד τ י־/1מ יד τ י~/ י~/ vJksvJks 1 ds 1 ds '-'ds 1 ds 1 dsGdsGdsAdsTdsTksT _dsTks^mC_dsAk</td><td> 29</td><td> 706</td>

<td> 785703</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SGksG_dsT_dsT_ds^mC_ds T_dsT_dsG_dsG_dsAds^mCk_S 1 ds '-'ks 1 ds '-'k</td><td> 36</td><td> 707</td>

<td> 785732</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> /~י τ me τ U U m 'Jks 1 ks '-'ds A ds^JdsNJds p mp mp τ τ τ '-'ds '-'ds '-'ds 1 ds 1 ds 1 ks TesGksGesAk</td><td> 0</td><td> 455</td>

<td> 785733</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> Gk_SGk_ST_ds^mC_dsT_dsG_dsp mp mp mp τ τ 'Jds '-'ds '-'ds '-'ds¹ ds¹ksTesTksGesGk</td><td> 3</td><td> 393</td>

<td> 785746</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> י~/ יד τ י־/1מ יד τ י~/ vJks 1 ks 1 ds '-'ds 1 ds 1 dsvJ _dsG_dsAds^mCdsTds^mCkST mp, A A, es '-׳ks^'es^'k</td><td> 31</td><td> 695</td>

<td> 785747</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד τ י־/1מ יד τ י~/ י~/ vJksvJks 1 ds 1 ds '-'ds 1 ds 1 dsGdsGdsAdsTdsTksT T A esAks '-׳es^'k</td><td> 0</td><td> 706</td>

<td> 785748</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SGksG_dsT_dsT_ds^mC_ds T_dsT_dsG_dsG_dsAds^mCk_S mp יך mp יך 1 es '-'ks 1 es Vk</td><td> 38</td><td> 707</td>

<td> 785749</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGdsGdsTdsTds^mCdsT_dsT_dsG_dsG_dsAks^m יך mp יך^, p '-'es^ks '-'es^k</td><td> 0</td><td> 708</td>

<td> 785781</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> Gk_SGk_STk_S^mCdsTdsGds p mp mp mp τ τ 'Jds '-'ds '-'ds '-'ds¹ ds¹kST_dsTksG_dsGk</td><td> 0</td><td> 393</td>

<td> 785788</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד τ י־/1מ יד τ י~/ י~/ vJksvJks 1 ks 1 ds '-'ds 1 ds 1 dsGdsG_dsA_ds^mCdsTks^mC dSTks^mC_dsA_k</td><td> 28</td><td> 706</td>

<td> 785789</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SGksGksT_dsT_ds^mCds TdsTdsGdsGdsAds^mCkS τ mp τ mp 1 ds '-'ks¹ ds '-'k</td><td> 0</td><td> 707</td>

<td> 785790</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGksGdsTdsTds^mCdST_dsT_dsGdsGdsAks^m'-'ds 1 ks '-'ds 1 k</td><td> 0</td><td> 708</td>

<td> 785820</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> /~י τ me τ U U m 'Jks 1 ks '-'ks A ds^JdsNJds p mp mp τ τ τ '-'ds '-'ds '-'ds 1 ds 1 ds 1 ks TesGksGesAk</td><td> 0</td><td> 455</td>

<td> 785821</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGk_STk_S^mCdsTdsGds p mp mp mp τ τ 'Jds '-'ds '-'ds '-'ds¹ ds¹ksTesTksGesGk</td><td> 2</td><td> 393</td>

<td> 785834</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> י~/ יד τ י־/1מ יד τ י~/ vJks 1 ks 1 ks '-'ds 1 ds 1 dsvJ dsGdsAds^mCdsT_ds^mCksT es CksAesAk</td><td> 0</td><td> 695</td>

<td> 785835</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד יד י־/1מ τ τ י~/ י~/ vJksvJks 1 ks 1 ds '-'ds 1 ds 1 dsGdsGdsA_ds^mCdsTks^mC _esTks^mCesAk</td><td> 25</td><td> 706</td>

<td> 785836</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_sGksGksTd_sTds^mCds TdsTdsGdsGdsAds^mCks τ mp יך mp 1 es '-'ks¹ es Me</td><td> 8</td><td> 707</td>

<td> 785837</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksA_ksGksGdsTdsTds^mCdsTdsTdsGdsGdsAks¹¹¹p יך mp ¹τ¹'-'es^ks '-'es^k</td><td> 0</td><td> 708</td>

<td> 785869</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGk_STk_S^mCdsTdsGds /~י־/111 י ιη/χ ιη/χ τ יד vJds Cds Cds Cdsldsl dsTksTesGksGe</td><td> 17</td><td> 393</td>

<td> 785876</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד יד יד τ י~/ י~/ 'Jks'Jks 1 ks A ds '-'ds A ds A _dsGd_SGd_SAd_S^mCdSTds^mC ksTes^mCksAe</td><td> 48</td><td> 706</td>

<td> 785877</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SGksGksTd_STds^mCds TdsTdsGdsGd_SAd_S^mCds י־/111 p־¹ mp יך¹ Iks '-'es^ks '-׳e</td><td> 0</td><td> 707</td>

<td> 785878</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGksGdsTdsTds^mCdsTdSTd_SGdsGdsAd_S^mp τ mp τ '-'ks¹ es '-'ks¹ e</td><td> 1</td><td> 708</td>

<td> 785908</td><td> 1362</td><td> 1377</td><td> 10683</td><td> 10698</td><td> GTCTGGCCCT TTTGGA</td><td> /~י τ τ in vJks 1 ks '-'ks 1 dsvJdsvJds p mp mp τ τ τ '-'ds '-'ds '-'ds 1 ds 1 ds 1 ds TksGksGksA_e</td><td> 0</td><td> 455</td>

<td> 785909</td><td> 1363</td><td> 1378</td><td> 10684</td><td> 10699</td><td> GGTCTGGCCC TTTTGG</td><td> GksGk_STk_S^mCdsTdsGds /~י־/111 י ιη/χ ιη/χ τ יד vJds Cds Cds Cdsldsl dsTksTksGksGe</td><td> 0</td><td> 393</td>

<td> 785922</td><td> 2215</td><td> 2230</td><td> 11780</td><td> 11795</td><td> GTTCTTGGAC TCTCAA</td><td> 'r יד τ יד τ י~/ 'Jks 1 ks A ks '-'ds A ds A ds'J dsGdsAds^mCdsTds^mCdsT ks CksAksAe</td><td> 37</td><td> 695</td>

<td> 785923</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGGA CTCTCA</td><td> יד יד י־/1מ יד τ י~/ י~/ 'Jks'Jks 1 ks 1 ds '-'ds 1 ds 1 dsGdsGdsAds^mCdsTds^mC ksTks^mCksAe</td><td> 0</td><td> 706</td>

<td> 785924</td><td> 2217</td><td> 2232</td><td> 11782</td><td> 11797</td><td> AGGTTCTTGG ACTCTC</td><td> Ak_SGksGksTd_STds^mCds TdsTdsGdsGdsAds^mCds τ mp τ mp Iks '-'ks^ks '-'e</td><td> 19</td><td> 707</td>

<td> 785925</td><td> 2218</td><td> 2233</td><td> 11783</td><td> 11798</td><td> CAGGTTCTTG GACTCT</td><td>^mCksAksGksGdsTdsTds^mCdsTdSTd_SGdsGdsAd_S^mp τ mp τ '-'ks A ks '-'ks A e</td><td> 0</td><td> 708</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCksAksAdsTdsTds TdsTdSGds^mCdsAdSTd_ST ks^mCks^mCksA_e</td><td> 71</td><td> 1242</td>

Table 22

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> (% Inhibition)</td><td> SEQ ID NO</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> Ak_SGks^mCksTd_STdsGds /~י τ τ τ 'Jds A ds '-'ds A ds A ds'Jds Ads^ks^ksTk</td><td> 12</td><td> 436</td>

<td> 728898</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> vJks '-'ks 1 ksvJds 1 ds '-'ds A_ds^mCdsAdSTdS^mCdSTd_S'-'ds '-'ksAks M</td><td> 33</td><td> 637</td>

<td> 729049</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> TksTksAk_STdsTdsTds^mC T /-י τ m ds 1 dskJds V/ds 1 ds '-'ds CdsAksGksGk</td><td> 55</td><td> 718</td>

<td> 729589</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> '-'ks '-'ks 1 ks 1 ds '-'ds 1 d _sGds^mCd_SAd_SGdsGdsGds AdsGksTksTk</td><td> 0</td><td> 1184</td>

<td> 785372</td><td> 1767</td><td> 1782</td><td> 11332</td><td> 11347</td><td> TGTCACATCT CCACAT</td><td> Tk_SG_dsTd_S^mCdSAds^mCdS Ads Ids '-'ds Ids Ms C ksA_es^mCksAesTk</td><td> 16</td><td> 635</td>

<td> 785373</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> vJks '-'ds 1 dsGis 1 ds '-'ds A_ds^mCdSAdSTds^mCdSTk_S Ms VksAes '-'k</td><td> 17</td><td> 637</td>

<td> 785383</td><td> 2228</td><td> 2243</td><td> 11793</td><td> 11808</td><td> ATTTCTGCTCC AGGTT</td><td> AksTd_STd_STd_S^mCdsTdSG ds '-'ds¹ ds '-'ds '-'ds-Aes GesGksTesTk</td><td> 39</td><td> 696</td>

<td> 785384</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> TksTdsAdsTdsTdsTds^mC T /-י τ m ds 1 dskJds V/ds 1 ds '-'ks CesAfcsGesGk</td><td> 0</td><td> 718</td>

<td> 785400</td><td> N/A</td><td> N/A</td><td> 9257</td><td> 9272</td><td> TTCTGCAGGG AGTCAG</td><td> י~/1מ י~/ τ י~/1מ τ τ 1 ks 1 ds '-'ds 1 dsvJds '-'ds AdsGdsGdsGdsAdsGksT e_S^mC_ksA_esGk</td><td> 4</td><td> 1255</td>

<td> 785401</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> '-'ks '-'ds 1 ds¹ ds '-'ds¹ d sGds CdsAdsGdsGdsGks AesGksTesTk</td><td> 0</td><td> 1184</td>

<td> 785427</td><td> 1767</td><td> 1782</td><td> 11332</td><td> 11347</td><td> TGTCACATCT CCACAT</td><td> Tk_SGd_ST_ds^mCdsAdS^mCdS י&gt;111 יך יך a -^-ds¹ ds '-'ds¹ ds '-'ks '-׳ esAks^mCesAksT_e</td><td> 0</td><td> 635</td>

<td> 785428</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> י~/1מ τ י~/ τ י~/ vJks '-'ds 1 dsMis 1 ds '-'ds a mp a יך mp יך Akds VtfsAvds a ds Mes¹ es Mes MsAks M</td><td> 0</td><td> 637</td>

<td> 785438</td><td> 2228</td><td> 2243</td><td> 11793</td><td> 11808</td><td> ATTTCTGCTCC AGGTT</td><td> AksTd_STd_STd_S^mCdsTd_SG mpv τ mpv mpv a ds '-'ds A ds '-'ds Messes GksGesTksTe</td><td> 13</td><td> 696</td>

<td> 785439</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> TksTdsAdsTdsTdsTds^mC dsAdskJds Mis-l-ks Ms CksAesGksGe</td><td> 0</td><td> 718</td>

<td> 785455</td><td> N/A</td><td> N/A</td><td> 9257</td><td> 9272</td><td> TTCTGCAGGG AGTCAG</td><td> τ τ me τ /~י me 1 ks 1 ds '-'ds 1 dsvJds '-'ds AdsGdsGdsGdsAksGesT ^CesAksGe</td><td> 0</td><td> 1255</td>

<td> 785456</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> me me τ T me τ Cks '-'ds 1 ds 1 ds '-'ds 1 d sGds CdsAdsGdsGksGes AksG_esTks^mC_e</td><td> 0</td><td> 1184</td>

<td> 785472</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> e&gt; me τ /~י τ me vJks Ces 1 ksvJds 1 ds '-'ds A_ds^mCdsAdSTdS^mCdSTd_S me me a me Ves VesAks Vk</td><td> 0</td><td> 637</td>

<td> 785478</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> T_ksT_esA_ksT_dsT_dsT_ds^mC me m יך me י~/ יך ds 1 dsvJds '-'ds 1 ds '-'ds CesAesGksGk</td><td> 56</td><td> 718</td>

<td> 785488</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> יך me יך יך me me '-'ks Ves 1 ks¹ ds '-'ds¹ d _sGds^mCd_SAd_SGdsGdsGds AesGesTksTk</td><td> 14</td><td> 1184</td>

<td> 785515</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksT_ksGdsTds^mCdsAds ^mr δ τ ^mr τ ^mr '-'dsAds¹ ds '-'ds¹ ds '-׳ ds^ksAes^ksAe</td><td> 19</td><td> 636</td>

<td> 785516</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> e&gt; me τ /~י τ vJks '-'ks 1 dsvJds 1 ds '-'ds Ads^mCdsAdsTds^mCdsTds me me a me '-'ks '-׳esAks Ve</td><td> 8</td><td> 637</td>

<td> 785525</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAk_STdsTdsTds^mCdsT dsvJds '-'ds 1 ds '-'ds '-'ds AksGesGksT_e</td><td> 49</td><td> 717</td>

<td> 785526</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> Tk_STk_SA_dsT_dsT_dsT_ds^mC ds 1 dsvJds '-'ds 1 ds '-'ds CksAesGksGe</td><td> 26</td><td> 718</td>

<td> 785543</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> me τ τ ^mc τ e '-'ks 1 ks¹ ds '-'ds¹ ds'-Jds ^mCdsAdSGdsGdsGdsAds GksTes^mCksAe</td><td> 8</td><td> 1256</td>

<td> 785544</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> me τ T τ '-'ks '-'ks 1 ds 1 ds '-'ds 1 d sGds CdsAdsGdsGdsGds Ak_sGe_STks^mCe</td><td> 0</td><td> 1184</td>

<td> 785559</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksT_ksGdsTds^mCdAds V^dsAds 1 ds '-'ds 1 es ־s^mCeSAes^mCksAk</td><td> 11</td><td> 636</td>

<td> 785565</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAk_STdsTdsTds^mCdsT dsvJds '-'ds 1 ds Ves Ves AesGesGksTk</td><td> 43</td><td> 717</td>

<td> 785574</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> τ T τ /~י Cks 1 ks 1 ds '-'ds 1 dsvJds CdsAdsGdsGdsGesAes GesTesTksAk</td><td> 0</td><td> 1256</td>

<td> 785612</td><td> 1767</td><td> 1782</td><td> 11332</td><td> 11347</td><td> TGTCACATCT CCACAT</td><td> T_ksG_ksT_ds^mCdsAds^mCds Ads 1 ds '-'ds 1 ds '-'ks C esAks^mCesAksTk</td><td> 0</td><td> 635</td>

<td> 785613</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksTksGdsTds^mCdAds ^mr δ τ ^mr τ ^mr '-'ds-^-ds¹ ds '-'ds¹ ks '-׳ ־s^mCksA_es^mCkAk</td><td> 0</td><td> 636</td>

<td> 785614</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> vJks '-'ks 1 dsvJds 1 ds '-'ds A_ds^mCdsAdsTds^mCksT_esCks '-'esAks Ck</td><td> 29</td><td> 637</td>

<td> 785626</td><td> 2228</td><td> 2243</td><td> 11793</td><td> 11808</td><td> ATTTCTGCTCC AGGTT</td><td> AksTksTdsTds^mCdsTdsG ds '-'ds¹ ds '-'ds '-׳ks^'es GksGesTksTk</td><td> 6</td><td> 696</td>

<td> 785627</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAk_STdsTdsTds^mCdsT dskJds V/ds 1 ds '-'ks Ves AksGesGksTk</td><td> 0</td><td> 717</td>

<td> 785628</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> Tk_STksAdsTdsTdsTds^mC dsAdskJds V/ds^ks Ves CksAesGksGk</td><td> 0</td><td> 718</td>

<td> 785651</td><td> N/A</td><td> N/A</td><td> 9257</td><td> 9272</td><td> TTCTGCAGGG AGTCAG</td><td> mp י~/ יך mp יך יך 1 ks 1 ks '-'ds¹ dskJds '-'ds AdsGdsGdsGdsAksGesT k_S^mCesAksGk</td><td> 0</td><td> 1255</td>

<td> 785652</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> י~/ ψ י־/!!! mz-A rp rp '-'ks 1 ks 1 ds '-'ds¹ dskJds CdsAdsGdsGdsGksAes Gk_ST_es^mCk_SAk</td><td> 0</td><td> 1256</td>

<td> 785653</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> τ י־/במ τ τ י/111 י־/111 '-'ks '-'ks 1 ds 1 ds '-'ds 1 d sGds CdsAdsGdsGksGes Ak_SGe_STks^mCk</td><td> 0</td><td> 1184</td>

<td> 785668</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksTksGdsTds^mCdsAdS CdsAdslds '-'dsIds C ־s^mCeSAes^mCksAk</td><td> 10</td><td> 636</td>

<td> 785674</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAk_STdsTdsTds^mCdsT dskJds V/ds 1 ds '-'ds Ves AcsGesGksTk</td><td> 44</td><td> 717</td>

<td> 785683</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> mz-A rp rp rp '-'ks 1 ks 1 ds '-'ds¹ dskJds CdsAdsGdsGdsGdsAes GesT_es^mCksA_k</td><td> 0</td><td> 1256</td>

<td> 785698</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksTkSGdSTdS^mCdSA_dsCdsAdslds '-'dsIds C ks^mCdsA_ks^mCdsAk</td><td> 6</td><td> 636</td>

<td> 785704</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> Tk_SAk_STdsTdsTds^mCdsT dskJds '-'ds¹ ds '-'ds '-'ks AdsGksGdsTk</td><td> 27</td><td> 717</td>

<td> 785713</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> י~/ τ י־/במ τ τ י/111 Cks 1 ks 1 ds '-'ds 1 dskJds CdsAdsGdsGdsGdsAks Gd_ST_ks^mC_dsAk</td><td> 0</td><td> 1256</td>

<td> 785740</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksTksGdsTds^mCdsAdS CdsAdslds '-'dsIds C mp a ^mC A ks '-es^'ks '-'es-f'k</td><td> 23</td><td> 636</td>

<td> 785741</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> kJks '-'ks 1 dskJds 1 ds '-'ds A_ds^mCdSAdSTdS^mCdST_ks Ves '-'ks-^-es '-'k</td><td> 5</td><td> 637</td>

<td> 785750</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAk_STd_STd_STd_S^mCdsT dskJds V/ds 1 ds '-'ds '-'ks AesGksGesTk</td><td> 5</td><td> 717</td>

<td> 785751</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> Tk_sTksAdsTdsTdsTds^mC τ /~י mp יך mp m ds¹ dskJds '-'ds¹ ds '-'ks CesAksGesGk</td><td> 9</td><td> 718</td>

<td> 785768</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> '-'ks 1 ks 1 ds '-'ds 1 dskJds CdsAdsGdsGdsGdsAks GesTks^mCesA_k</td><td> 0</td><td> 1256</td>

<td> 785769</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> V'ks '-'ks 1 ds 1 ds '-'ds 1 d sGds CdsAdsGdsGdsGks A_esGksT_es^mCk</td><td> 0</td><td> 1184</td>

<td> 785785</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> יד י~/ τ י־/1מ י~/ vJks '-'ks 1 kskJds 1 ds '-'ds A_ds^mCdsAdsTds^mCdsT_ksmr mr a mr Cds '-'ks-A-ds Ck</td><td> 35</td><td> 637</td>

<td> 785791</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> Tk_STksAksT_dsT_dsT_ds^mC m י&gt;111 יך י~/ יך ds 1 dsvJds '-'ds 1 ds '-'ks C_dsAksG_dsGk</td><td> 57</td><td> 718</td>

<td> 785801</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> יך mp יך יך mr mp '-'ks '-'ks 1 ks¹ ds '-'ds¹ d sGds CdsAdsGdsGdsGks A_dsGksT_ds^mC_k</td><td> 0</td><td> 1184</td>

<td> 785828</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCkSTksGkSTds^mCdsA_ds י־/1מ יד יד Λ י־/1מ CdsAdslds '-'dsIds C ks^esAks^esAk</td><td> 0</td><td> 636</td>

<td> 785829</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> יד י~/ τ י־/1מ י~/ 'Jks Cks 1 ksVJds 1 ds Cds A_ds^mCdsAdsTds^mCdsTks י&gt;111 a י&gt;111 י־/1מ Ves '-׳ks-cYes '-'k</td><td> 0</td><td> 637</td>

<td> 785838</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAksTk_ST_dsT_ds^mC_dsT dsvJds '-'ds 1 ds '-'ds '-'ks AesGksGesTk</td><td> 24</td><td> 717</td>

<td> 785839</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> Tk_sTksAksT_dsT_dsT_ds^mC m י&gt;111 יך י~/ יך ds 1 dsvJds '-'ds 1 ds '-'ks CesAksGesGk</td><td> 23</td><td> 718</td>

<td> 785856</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> mz-A rp rp ψ /י־ '-'ks 1 ks ¹ ks '-'ds ¹ dskJds CdsAdsGdsGdsGdsAks GesTks^mC_esA_k</td><td> 0</td><td> 1256</td>

<td> 785857</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> יך mp יך יך mr mp '-'ks '-'ks 1 ks¹ ds '-'ds¹ d sGds CdsAdsGdsGdsGks AesGksTesTk</td><td> 0</td><td> 1184</td>

<td> 785873</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> י~/ומ יד י~/ τ י־/1מ י~/ 'Jks Cks 1 ksVJds 1 ds Cds A_ds^mCdsAdsTds^mCdsT_ds י־/1מ a י&gt;111 י־/1מ '-'ks '-'eszYks '-׳e</td><td> 3</td><td> 637</td>

<td> 785879</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> Tk_STksAksT_dsT_dsT_ds^mC m י&gt;111 יך י~/ יך ds 1 dsvJds '-'ds 1 ds '-'ds CksAesGksGe</td><td> 43</td><td> 718</td>

<td> 785889</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> יד יד τ י~/111 י־/1מ '-'ks '-'ks 1 ks 1 ds '-'ds 1 d _sG_ds^mC_dsA_dsG_dsG_dsG_ds A_ksG_esT_ks^mC_e</td><td> 1</td><td> 1184</td>

<td> 785916</td><td> 1768</td><td> 1783</td><td> 11333</td><td> 11348</td><td> CTGTCACATC TCCACA</td><td>^mCksTksGksTds^mCdAds י־/1מ יד יד Λ י־/1מ CdsAdslds '-'dsIds C _ds^mCksAks^mCksA_e</td><td> 28</td><td> 636</td>

<td> 785917</td><td> 1769</td><td> 1784</td><td> 11334</td><td> 11349</td><td> GCTGTCACAT CTCCAC</td><td> י~/1ז1 יד 'mr τ r י~/ &lt;Jks '-'ks A ks'Jds A ds '-'ds A_ds^mCdAdSTds^mCdsT_ds י־/1מ a י&gt;111 '-'ks '-'ksAks Ce</td><td> 23</td><td> 637</td>

<td> 785926</td><td> 2229</td><td> 2244</td><td> 11794</td><td> 11809</td><td> TATTTCTGCTC CAGGT</td><td> TksAksTk_ST_dsT_ds^mCdsT /-י mr יך mr mr dskJds '-'ds¹ ds '-'ds '-'ds AksGksGksT _e</td><td> 45</td><td> 717</td>

<td> 785927</td><td> 2230</td><td> 2245</td><td> 11795</td><td> 11810</td><td> TTATTTCTGCT CCAGG</td><td> TksTksAksTdsTdsTds^mC ds 1 dsvJds '-'ds 1 ds '-'ds CksAksGksGe</td><td> 28</td><td> 718</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCkSAksAdsTdsTds TdsTdsGds^mCdsA_dsT_dsT k_s^mCks^mCk_sAe</td><td> 75</td><td> 1242</td>

<td> 785944</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> י~/ τ י־/במ τ τ י־/1מ '-'ks 1 ks 1 ks '-'ds 1 dsvJds ^mCdsAdsGdsGdsGdsAds GkSTks^mCkSA_e</td><td> 0</td><td> 1256</td>

<td> 785945</td><td> N/A</td><td> N/A</td><td> 9259</td><td> 9274</td><td> CCTTCTGCAG GGAGTC</td><td> τ י־/במ ידי τ י־/1מ י־/1מ Cks ^ks 1 ks 1 ds '-'ds 1 d _sG_ds^mC_dsA_dsG_dsG_dsG_dsA_ksGk_ST_ks^mCe</td><td> 0</td><td> 1184</td>

<td> 786513</td><td> N/A</td><td> N/A</td><td> 9250</td><td> 9265</td><td> GGGAGTCAGA CCTACC</td><td> Gk_SGksGksA_dsG_dsT_ds^mCdsAdsGdsAds^mCds^mCd sTdsAks^mCks^mC_k</td><td> 0</td><td> 1257</td>

<td> 786514</td><td> N/A</td><td> N/A</td><td> 9252</td><td> 9267</td><td> CAGGGAGTCA GACCTA</td><td> Ck_SAk_SGksG_dsG_dsA_dsG_dsT_ds^mCdsAdsGdsAds ^mCds^mC_ksT_ksA_k</td><td> 0</td><td> 1258</td>

<td> 786515</td><td> N/A</td><td> N/A</td><td> 9254</td><td> 9269</td><td> TGCAGGGAGT CAGACC</td><td> TksGks^mCksAdsGdsGds GdsAdsGdsTds CdsAds GdsAks^mCks^mCk</td><td> 0</td><td> 1259</td>

<td> 786516</td><td> N/A</td><td> N/A</td><td> 9256</td><td> 9271</td><td> TCTGCAGGGA GTCAGA</td><td> Tks^mCksTksGds^mCdsAds GdsGdsGdsA_dsGdsTds^mCdsAksGksAk</td><td> 0</td><td> 1260</td>

<td> 786517</td><td> N/A</td><td> N/A</td><td> 9257</td><td> 9272</td><td> TTCTGCAGGG AGTCAG</td><td> י־/במ י~/ τ י־/במ יד τ 1 ks 1 ks Mes 1 dsvJds '-'ds AdsGdsGdsGdsAdsGdsT ds CksAksGk</td><td> 0</td><td> 1255</td>

<td> 786518</td><td> N/A</td><td> N/A</td><td> 9258</td><td> 9273</td><td> CTTCTGCAGG GAGTCA</td><td> mz-A rp rp rp '-'ks 1 ks 1 ks '-'ds ¹ dskJds ^mCdsAdsGdsGdsGdSAds GdsTks^mCksAk</td><td> 0</td><td> 1256</td>

<td> 786519</td><td> N/A</td><td> N/A</td><td> 9260</td><td> 9275</td><td> GCCTTCTGCA GGGAGT</td><td> /-י τ τ kJks '-'ks '-'ks 1 ds¹ ds dsTdsGds^mCd_SA_dsGdsGd sGdsAksGksTk</td><td> 0</td><td> 1261</td>

<td> 786520</td><td> N/A</td><td> N/A</td><td> 9261</td><td> 9276</td><td> TGCCTTCTGC AGGGAG</td><td> יד τ י־/במ י~/ T 1 ksvJks '-'ks '-'ds 1 ds 1 ds ^mCdsTdsGds^mCdsA_dsG_dsGdsGksAksGk</td><td> 0</td><td> 1262</td>

<td> 786521</td><td> N/A</td><td> N/A</td><td> 9262</td><td> 9277</td><td> TTGCCTTCTGC AGGGA</td><td> τ י־/1מ י~/ יד τ 1 ks 1 ksvJks '-'ds '-'ds 1 ds Tds^mCdsTdsGds^mCdsAds GdsGksGksAk</td><td> 0</td><td> 1263</td>

<td> 786522</td><td> N/A</td><td> N/A</td><td> 9264</td><td> 9279</td><td> ATTTGCCTTCT GCAGG</td><td> m י־/במ י~/ יד יד יד Λ Aks 1 ks 1 ks 1 dsvJds '-'ds m י~/ τ י־/1מ יד τ י־/ '-'ds Ids Ids '-'ds 1 dsvJds CdsAksGksGk</td><td> 0</td><td> 1264</td>

<td> 786523</td><td> N/A</td><td> N/A</td><td> 9266</td><td> 9281</td><td> TCATTTGCCTT CTGCA</td><td> Tks^mCksAkSTdsTdsTdsG ds '-'ds '-'ds 1 ds 1 ds '-'ds TdsGks^mCksAk</td><td> 6</td><td> 1265</td>

Table 23

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> (% Inhibition)</td><td> SEQ ID NO</td>

<td> 728466</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTT CCCTGTC</td><td> GksGksTksGdsTdsAdsTd יך τ mp mp mp יך s¹ ds¹ ds '-'ds '-'ds '-'ds¹ &lt;־/τ m י~/ dsvJks 1 ks '-'k</td><td> 37</td><td> 1254</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTC TTGACCT</td><td> AksGks^mCksTd_STd_SGds /~י τ m/־&gt; τ τ vids Ids Cds 1 ds 1 ds&lt;Jds A_ds^mCks^mCk_ST_k</td><td> 37</td><td> 436</td>

<td> 728998</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGksAdsAdsGdsT dsGdsAd_SGdsTd_S^mCdsTd s CksAksAk</td><td> 42</td><td> 208</td>

<td> 729018</td><td></td><td> β</td><td> ויי</td><td> 1.1752</td><td> TCTGATATG ATACCTA</td><td></td><td> It</td><td> 111</td>

<td> 729454</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGksAdsGdsTdsG d_SAd_SGdsAds^mCdsGdsAd sGksTksAk</td><td> 56</td><td> 995</td>

<td> 785376</td><td> 2117</td><td> 2132</td><td> 11682</td><td> 11697</td><td> GAAGTGAGT CTCAAAC</td><td> GksAdsAdsGdsTdsGdsA dsGdsTds^mCdsTds^mC_ksA esAksAes Ck</td><td> 44</td><td> 207</td>

<td> 785377</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGdsGdsAdsAdsGdsT dsGd_sAd_sGdsTd_s^mCksT_es“CksAesAk</td><td> 11</td><td> 208</td>

<td> 785387</td><td> N/A</td><td> N/A</td><td> 5168</td><td> 5183</td><td> GAGTGAGA CGAGCAAA</td><td> GksAdsGdsTdsGdsAdsG dsA_ds^mCdsGdsAdsGks^mCesAksAesAk</td><td> 18</td><td> 1266</td>

<td> 785388</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGdsGdsAdsGdsTdsG dsAdsGdsAds CdsGksAe _sGks^mCesA_k</td><td> 37</td><td> 995</td>

<td> 785431</td><td> 2117</td><td> 2132</td><td> 11682</td><td> 11697</td><td> GAAGTGAGT CTCAAAC</td><td> GksAdsAdsGdsTdsGdsA dsGdsT_ds^mCdsTks^mCesA ksAesAks Ce</td><td> 11</td><td> 207</td>

<td> 785432</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGdsGdsAdsAdsGdsT dsGdsAdsGdsTks^mCesTks “CesAksAe</td><td> 23</td><td> 208</td>

<td> 785442</td><td> N/A</td><td> N/A</td><td> 5168</td><td> 5183</td><td> GAGTGAGA CGAGCAAA</td><td> GksAdsGdsTdsGdsAdsG dsA_ds^mCdsGdsAksGes^mCksAesAksAe</td><td> 6</td><td> 1266</td>

<td> 785443</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGdsGdsAdsGdsTdsG dsAdsGdsAds CksGesAk sGes^mCksA_e</td><td> 0</td><td> 995</td>

<td> 785474</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGesGksAdsAdsGdsT dsGdsAdsGdsTds^mCdsTes ^mCesAksAk</td><td> 43</td><td> 208</td>

<td> 785480</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGesGksAdsGdsTdsG dsAdsGdsAds CdsGdsA_esG_es^mCksA_k</td><td> 22</td><td> 995</td>

<td> 785519</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAdsAdsGdsTdsG dsAd_SGdsT_ds^mCdsTds^mC ksAesAksA_e</td><td> 55</td><td> 1267</td>

<td> 785520</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGdsAdsAdsGdsT dsGdsAd_SGdsTd_S^mCdsT_k«”CesAksAe</td><td> 39</td><td> 208</td>

<td> 785529</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAdsGdsTdsGdsA dsGdsAds CdsGdsAdsGk «”CesAksAe</td><td> 33</td><td> 1268</td>

<td> 785530</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGdsAdsGdsTdsG dsAdsGdsAds CdsGdsAk _sGe_S^mCksAe</td><td> 28</td><td> 995</td>

<td> 785561</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAdsAdsGdsTdsG dsAdsGdsT_ds^mCesTes^mC esAesAksAk</td><td> 34</td><td> 1267</td>

<td> 785567</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAdsGdsTdsGdsA dsGdsAds CdsGesAesGe s CesAksAk</td><td> 17</td><td> 1268</td>

<td> 785618</td><td> 2117</td><td> 2132</td><td> 11682</td><td> 11697</td><td> GAAGTGAGT CTCAAAC</td><td> GksAksAdsGdsTdsGdsA dsGdsTds^dsT^CeA A A ^mC ^k</td><td> 27</td><td> 207</td>

<td> 785619</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAdsAdsGdsTdsG dsAdsGdsT_ds^mCksTes^mC ksAesAksAk</td><td> 36</td><td> 1267</td>

<td> 785620</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGdsAdsAdsGdsT dsGdsAdsGdsTks^mCesTks “CesAksAk</td><td> 20</td><td> 208</td>

<td> 785632</td><td> N/A</td><td> N/A</td><td> 5168</td><td> 5183</td><td> GAGTGAGA CGAGCAAA</td><td> GksAksGdsTdsGdsAdsG dsA_ds^mCdsGdsAksGes^mCksAesAksAk</td><td> 17</td><td> 1266</td>

<td> 785633</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAdsGdsTdsGdsA dsGdsAds CdsGksAesGk ^mC A, A, s ^es^ks^k</td><td> 38</td><td> 1268</td>

<td> 785634</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGdsAdsGdsTdsG dsAdsGdsAds CksGesAk _sGes^mCksA_k</td><td> 35</td><td> 995</td>

<td> 785670</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAdsAdsGdsTdsG dsAdsGdsT_ds^mCdsTes^mC esAesAksAk</td><td> 32</td><td> 1267</td>

<td> 785676</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAdsGdsTdsGdsA dsGdsAds CdsGdsAesGe s^mCesAksA_k</td><td> 25</td><td> 1268</td>

<td> 785700</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAdsAdsGdsTdsG dsAdsGdsT_ds^mCdsTks^mC dsAksAdsAk</td><td> 12</td><td> 1267</td>

<td> 785706</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAdsGdsTdsGdsA dsGdsAds CdsGdsAksGd s^mCksAdsA_k</td><td> 16</td><td> 1268</td>

<td> 785744</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAdsAdsGdsTdsG &lt;_teAdsGdsTds^mC_dsT_ks^mC esAksAesAk</td><td> 25</td><td> 1267</td>

<td> 785745</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGdsAdsAdsGdsT dsGdsAd_SGdsTd_S^mCksTes ^mCksAesA_k</td><td> 42</td><td> 208</td>

<td> 785754</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAdsGdsTdsGdsA dsGdsAds CdsGdsAksGe _s^mC_ksA_esAk</td><td> 27</td><td> 1268</td>

<td> 785755</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGdsAdsGdsTdsG dsAdsGdsAds CdsGksAe sGksTesAk</td><td> 36</td><td> 995</td>

<td> 785787</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGksAdsAdsGdsT dsGdsAd_SGdsTd_S^mCksTd s^mCksAdsAk</td><td> 40</td><td> 208</td>

<td> 785793</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGksAdsGdsTdsG dsAdsGdsAds CdsGksAd sGksTdsAk</td><td> 37</td><td> 995</td>

<td> 785832</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAksAdsGdsTdsG dsAdsGdsTds^mCdSTks^mC esAksAesAk</td><td> 45</td><td> 1267</td>

<td> 785833</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGksAdsAdsGdsT dsGdsAdsGdsTds^mCksT_esmp, A A, Cks-^*-es-^*-k</td><td> 24</td><td> 208</td>

<td> 785842</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAksGdsTdsGdsA dsGdsAds CdsGdsAksGe s^mCksAesA_k</td><td> 5</td><td> 1268</td>

<td> 785843</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGksAdsGdsTdsG dsAdsGdsAds CdsGksAe sGks^mCesA_k</td><td> 24</td><td> 995</td>

<td> 785875</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGksAdsAdsGdsT dsGdsAdsGdsT_ds^mCdsTk s^mCesAksA_e</td><td> 21</td><td> 208</td>

<td> 785881</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGksAdsGdsTdsG dsAdsGdsAds CdsGdsAk _sGes^mCksA_e</td><td> 42</td><td> 995</td>

<td> 785920</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAksAdsGdsTdsG dsAdsGdsT_ds^mCdsTds^mC ksAksAksAe</td><td> 49</td><td> 1267</td>

<td> 785921</td><td> 2119</td><td> 2134</td><td> 11684</td><td> 11699</td><td> AGGAAGTG AGTCTCAA</td><td> AksGksGksAdsAdsGdsT dsGdsAdsGdsTds^mCdsTk s^mCksAksA_e</td><td> 47</td><td> 208</td>

<td> 785930</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAksGdsTdsGdsA dsGdsAds CdsGdsAdsGk s^mCksAksA_e</td><td> 33</td><td> 1268</td>

<td> 785931</td><td> N/A</td><td> N/A</td><td> 5170</td><td> 5185</td><td> AGGAGTGA GACGAGCA</td><td> AksGksGksAdsGdsTdsG dsAdsGdsAds CdsGdsAk sGks^mCksA_e</td><td> 37</td><td> 995</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTG CATTCCA</td><td>^mCks^mCksAksAdsTdsTds TdsTdsGds^mCdsAdsTdsT ks^mCks^mCksAe</td><td> 10</td><td> 1242</td>

<td> 786501</td><td> 2118</td><td> 2133</td><td> 11683</td><td> 11698</td><td> GGAAGTGA GTCTCAAA</td><td> GksGksAksAdsGdsTdsG d_SA_dsGd_STd_S^mCd_ST_ds^mC dsAksAksAk</td><td> 51</td><td> 1267</td>

<td> 786502</td><td> 2120</td><td> 2135</td><td> 11685</td><td> 11700</td><td> GAGGAAGT GAGTCTCA</td><td> GksAksGksGdsAdsAdsG d_STd_SGdsAd_SGdsTds^mCd sTks^mCksA_k</td><td> 0</td><td> 1269</td>

<td> 786503</td><td> 2171</td><td> 2186</td><td> 11736</td><td> 11751</td><td> CTGATATGA TACCTAA</td><td>¹¹¹CksTksGksAdsTdsAds TdsGdsAd_ST_dsAd_S^mCds^mCdsTksAksAk</td><td> 59</td><td> 1270</td>

<td> 786504</td><td> 2173</td><td> 2188</td><td> 11738</td><td> 11753</td><td> ATCTGATAT GATACCT</td><td> AksTks^mCksTd_SGdsAd_STdsAdsTdsGdsAdsTdsAd mp mp יך s '-'ks '-'ks 1 k</td><td> 36</td><td> 1271</td>

<td> 786524</td><td> N/A</td><td> N/A</td><td> 5141</td><td> 5156</td><td> ACGAGTTAT GGGAAGG</td><td> Ak_s CksGksAdsGdsTds TdsAdsTdsGdsGdsGdsA dsAksGksGk</td><td> 74</td><td> 1272</td>

<td> 786525</td><td> N/A</td><td> N/A</td><td> 5143</td><td> 5158</td><td> GGACGAGTT ATGGGAA</td><td> GksGksAks CdsGdsAds GdsTd_STd_SAd_STd_SGdsGd sGksAksAk</td><td> 37</td><td> 1273</td>

<td> 786526</td><td> N/A</td><td> N/A</td><td> 5145</td><td> 5160</td><td> TAGGACGA GTTATGGG</td><td> Tk_SAk_SGksGdsAd_S^mCds GdsAd_SGdsTd_STd_SAd_STd sGksGksGk</td><td> 25</td><td> 1274</td>

<td> 786527</td><td> N/A</td><td> N/A</td><td> 5147</td><td> 5162</td><td> AGTAGGAC GAGTTATG</td><td> AksGksTksAdsGdsGdsA ds^mCdsGdsAd_SGd_STd_STd sAk_STk_SGk</td><td> 0</td><td> 1275</td>

<td> 786528</td><td> N/A</td><td> N/A</td><td> 5149</td><td> 5164</td><td> TGAGTAGGA CGAGTTA</td><td> TksGksAksGdsTdsAdsG dsGdsAd_S^mCdsGdsAd_SGd sTksTksAk</td><td> 18</td><td> 1276</td>

<td> 786529</td><td> N/A</td><td> N/A</td><td> 5151</td><td> 5166</td><td> GGTGAGTAG GACGAGT</td><td> GksGksTksGdsAdsGdsT d_SAd_SGdsGdsAds^mCdsGd sAksGksTk</td><td> 48</td><td> 1277</td>

<td> 786530</td><td> N/A</td><td> N/A</td><td> 5153</td><td> 5168</td><td> AGGGTGAGT AGGACGA</td><td> AksGksGksGdsTdsGdsA dsGdsTdsAdsGdsGdsAds “CksGksAk</td><td> 19</td><td> 1278</td>

<td> 786531</td><td> N/A</td><td> N/A</td><td> 5155</td><td> 5170</td><td> AAAGGGTG AGTAGGAC</td><td> AksAksAksGdsGdsGdsT dsGdsAdsGdsTdsAdsGds Gk_SAk_S^mC_k</td><td> 24</td><td> 1279</td>

<td> 786532</td><td> N/A</td><td> N/A</td><td> 5157</td><td> 5172</td><td> GCAAAGGG TGAGTAGG</td><td> Gks CksAksAdsAdsGds GdsGdsTdsGdsAdsGdsT dsAksGksGk</td><td> 24</td><td> 1280</td>

<td> 786533</td><td> N/A</td><td> N/A</td><td> 5159</td><td> 5174</td><td> GAGCAAAG GGTGAGTA</td><td> GksAksGks CdsAdsAds AdsGdsGdsGdsTdsGdsA dsGksTksAk</td><td> 0</td><td> 1281</td>

<td> 786534</td><td> N/A</td><td> N/A</td><td> 5161</td><td> 5176</td><td> ACGAGCAA AGGGTGAG</td><td> A_ks^mCkSGkSAdsGdS^mCd sAdsAdsAdsGdsGdsGds T dsGksAksGk</td><td> 47</td><td> 1282</td>

<td> 786535</td><td> N/A</td><td> N/A</td><td> 5163</td><td> 5178</td><td> AGACGAGC AAAGGGTG</td><td> AksGksAks CdsGdsAds Gds CdsAdsAdsAdsGds GdsGksTksGk</td><td> 35</td><td> 1283</td>

<td> 786536</td><td> N/A</td><td> N/A</td><td> 5164</td><td> 5179</td><td> GAGACGAG CAAAGGGT</td><td> GksAksGksAds CdsGds AdsGds^mCdsAdsAdsAds GdsGksGksTk</td><td> 40</td><td> 1284</td>

<td> 786537</td><td> N/A</td><td> N/A</td><td> 5165</td><td> 5180</td><td> TGAGACGA GCAAAGGG</td><td> Tk_sGksAksGdsAds^mCds GdsA_dsGds CdsAdsAds AdsGksGksGk</td><td> 22</td><td> 1285</td>

<td> 786538</td><td> N/A</td><td> N/A</td><td> 5166</td><td> 5181</td><td> GTGAGACG AGCAAAGG</td><td> GksTksGksAdsGdsAds CdsGdsAd_SGds^mCdsAd_SAdsAksGksGk</td><td> 49</td><td> 1286</td>

<td> 786539</td><td> N/A</td><td> N/A</td><td> 5167</td><td> 5182</td><td> AGTGAGAC GAGCAAAG</td><td> AksGksTksGdsAdsGdsA _ds^mCdSGdSAdsGdS^mCdS AdsAksAksGk</td><td> 16</td><td> 1287</td>

<td> 786540</td><td> N/A</td><td> N/A</td><td> 5168</td><td> 5183</td><td> GAGTGAGA CGAGCAAA</td><td> GksAksGksTdsGdsAdsG dsA_ds^mCdsGdsAdsGds^mCdsAksAksAk</td><td> 27</td><td> 1266</td>

<td> 786541</td><td> N/A</td><td> N/A</td><td> 5169</td><td> 5184</td><td> GGAGTGAG ACGAGCAA</td><td> GksGksAksGdsTdsGdsA dsGdsAd_S^mCdsGdsAd_SGd _s^mCksAksAk</td><td> 37</td><td> 1268</td>

<td> 786542</td><td> N/A</td><td> N/A</td><td> 5171</td><td> 5186</td><td> TAGGAGTGA GACGAGC</td><td> TksAksGksGdsAdsGdsT dsGdsAdsGdsAds CdsGd sAksGksTk</td><td> 1</td><td> 1288</td>

<td> 786543</td><td> N/A</td><td> N/A</td><td> 5172</td><td> 5187</td><td> ATAGGAGTG AGACGAG</td><td> AksTksAksGdsGdsAdsG dsTdsGdsAdsGdsAds^mCd sGksAksGk</td><td> 16</td><td> 1289</td>

<td> 786544</td><td> N/A</td><td> N/A</td><td> 5173</td><td> 5188</td><td> AATAGGAGT GAGACGA</td><td> AksAksTksAdsGdsGdsA dsGdsTdsGdsAdsGdsAds ¹CksGksAk</td><td> 25</td><td> 1290</td>

<td> 786545</td><td> N/A</td><td> N/A</td><td> 5174</td><td> 5189</td><td> TAATAGGAG TGAGACG</td><td> TksAksAksTdsAdsGdsG dsAdsGdsTdsGdsAdsGds Aks^mCksGk</td><td> 12</td><td> 1291</td>

<td> 786546</td><td> N/A</td><td> N/A</td><td> 5175</td><td> 5190</td><td> GTAATAGGA GTGAGAC</td><td> Gk_STk_S Aks Ad_ST ds A_dsG dsGdsAdsGdsTdsGdsAds GksAks^mC_k</td><td> 11</td><td> 1292</td>

<td> 786547</td><td> N/A</td><td> N/A</td><td> 5177</td><td> 5192</td><td> GAGTAATAG GAGTGAG</td><td> Gks AksGksT dsAds AdsT dsAdsGdsGdsAdsGdsTds GksAksGk</td><td> 33</td><td> 1293</td>

<td> 786548</td><td> N/A</td><td> N/A</td><td> 5179</td><td> 5194</td><td> ATGAGTAAT AGGAGTG</td><td> AksTksGksAdsGdsTdsA dsAdsTdsAdsGdsGdsAds GksTksGk</td><td> 56</td><td> 1294</td>

<td> 786549</td><td> N/A</td><td> N/A</td><td> 5181</td><td> 5196</td><td> TCATGAGTA ATAGGAG</td><td> Tks^mCksAk_STd_SGdsAd_SGdsTdsAdsAdsTdsAdsG dsGksAksGk</td><td> 11</td><td> 1295</td>

<td> 786550</td><td> N/A</td><td> N/A</td><td> 5183</td><td> 5198</td><td> CCTCATGAG TAATAGG</td><td> me me יד me λ t Cks Cks 1 ks CdsAtfs 1 dsGdsAdsGdsTdsAdsAds T dsAksGksGk</td><td> 0</td><td> 1296</td>

Table 24

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> % Inhibition</td><td> SEQ ID NO</td>

<td> 665892</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAks^mCksTdsGdsAds ^mCdsAds^mCdsA_dsG_dsG_{d s}^mC_dsGksGksA_k</td><td> 0</td><td> 387</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGACA CAGGCGG</td><td> Gks^mCkSAks^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_{d s}G_ds^mCksGksGk</td><td> 0</td><td> 39</td>

<td> 728466</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGk_STk_SG_dsT_dsA_dsT_d יך me me me יך יך¹ s 1 ds 1 ds '-'ds '-'ds '-'ds 1 p יד mp dsMcs A ks Ck</td><td> 27</td><td> 1254</td>

<td> 728489</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACA GCGCAGG</td><td> AksAksGksG_dsG_ds C_dsA_ds^mCdsAdsGds^mCdsG_{d s}^mC_dsAksGksGk</td><td> 42</td><td> 1249</td>

<td> 728670</td><td> 1230</td><td> 1245</td><td> 10463</td><td> 10478</td><td> TTGCACTGA CACAGGC</td><td> Tk_ST_ksG_ks^mCdsAds^mCds T_dsG_dsA_ds^mCdsAds^mCds AdsGksGksTk</td><td> 21</td><td> 398</td>

<td> 728707</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCTT GACCTC</td><td> Gks^mCksTksT_dsG_dsG_ds p a m יד יד mp יד 1 ds '-'ds A ds A dsMis-Ads p mp יד mp Cds Cks 1 ks M</td><td> 52</td><td> 435</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTC TTGACCT</td><td> Ak_SGks^mCk_ST_dsT_dsG_ds P יד יד mp יד p Cds 1 ds '-'ds A ds A dsCds A_ds^mCks^mCksT_k</td><td> 40</td><td> 436</td>

<td> 728958</td><td> 1979</td><td> 1994</td><td> 11544</td><td> 11559</td><td> CCTATACAG CTAGGCC</td><td>^mCks^mCksTksA_dsT_dsA_ds^mCdsAdsGds^mCdsT_dsA_dsp p mp mp MsMs Cks M</td><td> 0</td><td> 168</td>

<td> 729037</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGG ACTCTCA</td><td> יד יד mp יד יד p p 'Jks'Jks 1 ks 1 ds Ms 1 ds 1 _dsG_dsG_dsA_ds^mCdsTds^mC dsTks^mCksAk</td><td> 68</td><td> 706</td>

<td> 729494</td><td> N/A</td><td> N/A</td><td> 6958</td><td> 6973</td><td> GAATTTTGT GACTGTA</td><td> GksAksAksT_dsT_dsT_dsT_dsG_dsT_dsG_dsA_ds^mC_dsT_dsGksTksAk</td><td> 57</td><td> 1065</td>

<td> 729495</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCksAdsTdsTds ^mCdsT_dsA_dsT_dsG_ds^mC_ds יד יד יד mp Cds 1 ks 1 ks 1 k</td><td> 70</td><td> 1066</td>

<td> 785352</td><td> 1225</td><td> 1240</td><td> 10458</td><td> 10473</td><td> CTGACACAG GCGGATG</td><td>^mCksTdsGdsAds^mCdsA_ds^mCdsAdsGdsGds^mCdsG_ksGesAksTesGk</td><td> 0</td><td> 1297</td>

<td> 785353</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAds^mCdsT_dsG_dsA_ds ^mCdsAds^mCdsA_dsG_dsG_{k s}^mCesGksGesA_k</td><td> 0</td><td> 387</td>

<td> 785396</td><td> N/A</td><td> N/A</td><td> 6979</td><td> 6994</td><td> CATTCTATGC CTTTTA</td><td> יד mp יד יד mp a CksAds 1 ds 1 ds Cds 1 ds A_dsT_dsG_ds^mCds^mCdsTks TesTksTesAk</td><td> 37</td><td> 1298</td>

<td> 785397</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCds^mCdsA_dsT_dsT_ds^mCdsTdsAdsTdsGds^mCks T T T י־/1מ Ves 1 ks 1 es 1 k</td><td> 0</td><td> 1066</td>

<td> 785407</td><td> 1225</td><td> 1240</td><td> 10458</td><td> 10473</td><td> CTGACACAG GCGGATG</td><td> ”CksTdsGdsAdsTdsAds “CdsAdsGdsGds^ksGe _sGksAesT_ksGe</td><td> 0</td><td> 1297</td>

<td> 785408</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAds^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_ksG_{e s}^mC_ksGesG_ksA_e</td><td> 0</td><td> 387</td>

<td> 785451</td><td> N/A</td><td> N/A</td><td> 6979</td><td> 6994</td><td> CATTCTATGC CTTTTA</td><td> mp ATT T '-׳ks^ds 1 ds¹ ds '-'ds¹ ds AdsTdsGds^mCds^mC_ksT_esT_ksTesT_ksA_e</td><td> 13</td><td> 1298</td>

<td> 785452</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCds^mCdsA_dsT_dsT_ds^mCdsTdsAdsTdsGks^mCes T T T י־/1מ '-ks 1 es 1 ks 1 e</td><td> 10</td><td> 1066</td>

<td> 785461</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAes^mCksT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_dsG_{d s}^mCe_SGesG_ksAk</td><td> 0</td><td> 387</td>

<td> 785486</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCeS^mCksA_dsT_dsT_ds^mCdsTdsAdsTdsGds^mCds T T T '-'es 1 es¹ ks¹ k</td><td> 51</td><td> 1066</td>

<td> 785496</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> A_ks^mCksTdsGdsAds^mCds A_ds^mCdsAdsGdsGds^mCd sGksGesA_ksTe</td><td> 0</td><td> 397</td>

<td> 785497</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCkSAkS^mCdsT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_dsG_{d s}^mCk_sGesGk_sA_e</td><td> 0</td><td> 387</td>

<td> 785539</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> '-'ks '-'ks-^-ds A ds A ds _dsT_dsA_dsT_dsG_ds^mCds^mC dsTksTesTksT_e</td><td> 61</td><td> 1299</td>

<td> 785540</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCdsAdsTdsTds ^mCdsT_dsA_dsT_dsG_ds^mC_ds T T T י־/1מ '-ks 1 es 1 ks 1 e</td><td> 51</td><td> 1066</td>

<td> 785548</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> A_ks^mCksTdsGdsAds^mCds A_ds^mCdsAdsGdsGes^mCe sGesGeSA_ksT|_K</td><td> 0</td><td> 397</td>

<td> 785572</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> ^ks V'ksAds 1 ds 1 ds _dsT_dsA_dsT_dsG_ds^mCes^mC esTesTesTksTk</td><td> 17</td><td> 1299</td>

<td> 785585</td><td> 1225</td><td> 1240</td><td> 10458</td><td> 10473</td><td> CTGACACAG GCGGATG</td><td> “CksTksGdsAdsTdsAds ^mC_dsA_dsG_dsG_ds^mCksGe sGksAesTksGk</td><td> 0</td><td> 1297</td>

<td> 785586</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> A_ks^mCkSTdsGdsAds^mCds A_ds^mC_dsA_dsG_dsG_ks^mCe sGksGesAksTk</td><td> 0</td><td> 397</td>

<td> 785587</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAks^mC_dsT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_ksG_e«“CksGesGksAk</td><td> 0</td><td> 387</td>

<td> 785645</td><td> N/A</td><td> N/A</td><td> 6979</td><td> 6994</td><td> CATTCTATGC CTTTTA</td><td> CksA_ks 1 ds 1 ds '-'ds 1 ds A_dsT_dsG_ds^mCds^mCksT_esTksT_esTksAk</td><td> 56</td><td> 1298</td>

<td> 785646</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> mr mr ATT '-'ks '-'ksAtfs 1 ds 1 ds *-׳ dsT_dsA_dsT_dsG_ds^mC_ks^mC esTksTesTksTk</td><td> 3</td><td> 1299</td>

<td> 785647</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCdsAdsTdsTds ^mCdsT_dsAdsT_dsGk_S^mCes mp Τ Τ T '-'ks 1 es¹ ks¹ k</td><td> 0</td><td> 1066</td>

<td> 785657</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> A_ks^mCksTdsGdsAds^mCds A_ds^mCdsAdsGdsGds^mCe sGesGesAksTk</td><td> 0</td><td> 397</td>

<td> 785681</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> mp mp ATT '-'ks '-'ks-^-ds A ds A ds dsT_dsA_dsT_dsG_ds^mC_ds^mC esT_esTesTksTk</td><td> 50</td><td> 1299</td>

<td> 785687</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> A_ks^mCkSTdsGdsAds^mCds A_ds^mCdsAdsGdsGds^mCk sG_dsGk_SA_dsTk</td><td> 6</td><td> 397</td>

<td> 785711</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> m/־' m/־' att '-'ks '-'ksAds 1 ds 1 ds *-׳ dsT_dsA_dsT_dsG_ds^mCds^mC ksTdsTksT_dsTk</td><td> 46</td><td> 1299</td>

<td> 785721</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> A_ks^mCksTdsGdsAds^mCds A_ds^mCdsAdsGdsGds^mCk sGesGksAesTk</td><td> 0</td><td> 397</td>

<td> 785722</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAkS^mCdsT_dsG_dsAds ^mCdsAds^mCdsA_dsG_dsG_{k s}^mC_esGk_SG_esAk</td><td> 0</td><td> 387</td>

<td> 785764</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> mp mp ATT '-'ks '-'ks-^-ds A ds A ds dsT_dsA_dsT_dsG_ds^mC_ds^mC ksT_esTksTesTk</td><td> 62</td><td> 1299</td>

<td> 785765</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCdsA_dsT_dsT_ds^mCdsTdsAdsTdsGds^mCkS mp τ τ τ Ves 1 ks 1 es 1 k</td><td> 40</td><td> 1066</td>

<td> 785774</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAkS^mCksTdsG_dsAds ^mCdsAds^mCdsA_dsG_dsG_{k s}^mC_dsGksG_dsA_k</td><td> 0</td><td> 387</td>

<td> 785799</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCksAdsTdsTds ^mCdsT_dsAdsT_dsG_ds^mCk_Sm/־' τ τ τ '-'ds 1 ks A ds A k</td><td> 11</td><td> 1066</td>

<td> 785809</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> Ak_S^mCksTksGdsAds^mCds A_ds^mCdsAdsGdsGds^mCk sGesGksAesTk</td><td> 0</td><td> 397</td>

<td> 785810</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAkS^mCksTdsG_dsAds ^mCdsAds^mCdsA_dsG_dsG_{k s}^mCesGk_sGesAk</td><td> 0</td><td> 387</td>

<td> 785852</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> mp mp ATT '-'ks '-'ks-^-ks A ds A ds '-׳ dsT_dsA_dsT_dsG_ds^mC_ds^mC ksTesTksTesTk</td><td> 44</td><td> 1299</td>

<td> 785853</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCksAdsTdsTds ^mCdsT_dsA_dsT_dsG_ds^mC_ksmp τ τ τ Ves 1 ks 1 es 1 k</td><td> 15</td><td> 1066</td>

<td> 785862</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAkS^mCksTdsG_dsAds ^mCdsAds^mCdsA_dsG_dsG_{d s}^mCk_sGesGk_sA_e</td><td> 0</td><td> 387</td>

<td> 785887</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCk_SA_dsT_dsT_ds^mCdsTdsAdsTdsGds^mCds mp Τ Τ T Cks 1 es 1 ks 1 e</td><td> 49</td><td> 1066</td>

<td> 785897</td><td> 1226</td><td> 1241</td><td> 10459</td><td> 10474</td><td> ACTGACACA GGCGGAT</td><td> Ak_S^mCksTksGdsAds^mCds A_ds^mCdsAdsGdsGds^mCd sGk_SGk_SAk_ST _e</td><td> 0</td><td> 397</td>

<td> 785898</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACAC AGGCGGA</td><td>^mCksAkS^mCksTdsG_dsA_ds^mCdsAds^mCdsA_dsG_dsG_{d s}^mCk_sGk_sG_ksAe</td><td> 0</td><td> 387</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCkSAksA_dsT_dsT_dsT_dsT_dsG_ds^mC_dsA_dsT_dsT _ks^mCkS^mCkSAe</td><td> 0</td><td> 1242</td>

<td> 785940</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> mp mp ATT Cks Cks-^-ks A ds A ds C _dsT_dsA_dsT_dsG_ds^mCds^mC dsTksTksTksT_e</td><td> 58</td><td> 1299</td>

<td> 785941</td><td> N/A</td><td> N/A</td><td> 6981</td><td> 6996</td><td> ACCATTCTAT GCCTTT</td><td> A_ks^mCks^mCksAdsTdsTds ^mCdsT_dsA_dsT_dsG_ds^mC_dsmp Τ Τ T '-'ks 1 ks 1 ks 1 e</td><td> 59</td><td> 1066</td>

<td> 786551</td><td> N/A</td><td> N/A</td><td> 6979</td><td> 6994</td><td> CATTCTATGC CTTTTA</td><td> me a τ τ m/־' τ CksAks 1 ks 1 ds Cds 1 ds A_dsT_dsG_ds^mCds^mCdsT_dsT_dsTksTksAk</td><td> 24</td><td> 1298</td>

<td> 786552</td><td> N/A</td><td> N/A</td><td> 6980</td><td> 6995</td><td> CCATTCTATG CCTTTT</td><td> m/־' m/־' λ τ τ me Cks CksAks 1 ds 1 ds C _dsT_dsA_dsT_dsG_ds^mCds^mC dsT_dsTksTksTk</td><td> 43</td><td> 1299</td>

<td> 786553</td><td> N/A</td><td> N/A</td><td> 6982</td><td> 6997</td><td> AACCATTCT ATGCCTT</td><td> AksAks^mCks^mC_dsA_dsT_ds m י~/ τ A τ י־/1מ τ Ids Cds A dsAds A dsCds m/־' τ τ Cds Cks 1 ks 1 k</td><td> 33</td><td> 1300</td>

<td> 786554</td><td> N/A</td><td> N/A</td><td> 6983</td><td> 6998</td><td> AAACCATTC TATGCCT</td><td> A_ksA_ksA_ks^mCds^mCdsA_dsT_dsT_ds^mC_dsT_dsA_dsT_ds/~י m/־' m&lt;x τ Cds Cks Cks 1 k</td><td> 0</td><td> 1301</td>

<td> 786555</td><td> N/A</td><td> N/A</td><td> 6984</td><td> 6999</td><td> TAAACCATT CTATGCC</td><td> TksAksAksAds’Tds’Tds A_dsT_dsT_ds^mC_dsT_dsA_dsT '־/m/-' m י~/ dsCks Cks Ck</td><td> 9</td><td> 1302</td>

<td> 786556</td><td> N/A</td><td> N/A</td><td> 6985</td><td> 7000</td><td> CTAAACCAT TCTATGC</td><td> “CksTksAksAdsAdsTds me a τ τ י־/1מ τ CdsAdsldslds CdsAds A_dsTk_SGks^mCk</td><td> 0</td><td> 1303</td>

<td> 786557</td><td> N/A</td><td> N/A</td><td> 6987</td><td> 7002</td><td> CTCTAAACC ATTCTAT</td><td>^mCksTks^mCksTdsA_dsA_dsA_ds^mCds^mCdsA_dsT_dsT_ds^mC_dsTksAk_STk</td><td> 0</td><td> 1304</td>

<td> 786558</td><td> N/A</td><td> N/A</td><td> 6989</td><td> 7004</td><td> TGCTCTAAA CCATTCT</td><td> τ י־/1מ τ י־/1מ י~/ τ 1 ksCks Cks A ds Cds A ds A_dsA_dsA_ds^mCds^mCdsA_d יך mp יך^, יך si ds Iks Cks Ik</td><td> 0</td><td> 1305</td>

<td> 786559</td><td> N/A</td><td> N/A</td><td> 6991</td><td> 7006</td><td> TTTGCTCTAA ACCATT</td><td> τ τ τ τ m A ks A ks A ksCds Cds A ds C_dsT_dsA_dsA_dsA_ds^mC_ds^m C’dsAksTksTk</td><td> 2</td><td> 1306</td>

<td> 786560</td><td> N/A</td><td> N/A</td><td> 6994</td><td> 7009</td><td> CTTTTTGCTC TAAACC</td><td> me τ τ τ τ τ /~י Cks AksAksAdsAdsA dsC _ds^mCdsTds^mCdsT_dsA_dsA _dsA_ks^mCks^mCk</td><td> 0</td><td> 1307</td>

<td> 786561</td><td> N/A</td><td> N/A</td><td> 6997</td><td> 7012</td><td> AGACTTTTTG CTCTAA</td><td> A_ksG_ksA_ks^mC_dsT_dsT_ds τ m י־/1מ י~/ τ τ τ AdsAdsAdsCds Cds A ds C_dsT_ksA_ksA_k</td><td> 0</td><td> 1308</td>

<td> 786587</td><td> N/A</td><td> N/A</td><td> 6948</td><td> 6963</td><td> ACTGTATTA CCTATAC</td><td> Ak_S^mCksTk_SGdsTdsAd_S T T A T 1 ds¹ ds^ds '-'ds '-'ds¹ ds Ad_STk_SAks^mCk</td><td> 22</td><td> 1309</td>

<td> 786588</td><td> N/A</td><td> N/A</td><td> 6949</td><td> 6964</td><td> GACTGTATT ACCTATA</td><td> GksAks^mCksTdsGdsTds AdSTdSTdsAds^mCds^mCds TdSA_ksT_ksAk</td><td> 41</td><td> 1310</td>

<td> 786589</td><td> N/A</td><td> N/A</td><td> 6950</td><td> 6965</td><td> TGACTGTATT ACCTAT</td><td> TksGksAks^mCdsTdsGds TdsAd_STd_ST_dsAds^mCds^mCdsTksAksTk</td><td> 18</td><td> 1311</td>

<td> 786590</td><td> N/A</td><td> N/A</td><td> 6951</td><td> 6966</td><td> GTGACTGTA TTACCTA</td><td> GksTk_SGk_SAd_S^mCdsTds GdsTdsAdSTdSTdSAdS^mCds^mCksTksAk</td><td> 62</td><td> 1312</td>

<td> 786591</td><td> N/A</td><td> N/A</td><td> 6952</td><td> 6967</td><td> TGTGACTGT ATTACCT</td><td> TksGk_STk_SGdsAd_S^mCds TdsGdsTd_SAd_STd_STd_SAd mp mp ¹־p s '-'ks '-'ks 1 k</td><td> 81</td><td> 1313</td>

<td> 786592</td><td> N/A</td><td> N/A</td><td> 6953</td><td> 6968</td><td> TTGTGACTGT ATTACC</td><td> Tk_STk_SGksTd_SGdsAd_S^mCdsTdsGdsTdsAdSTdSTd sAks^mCks^mCk</td><td> 56</td><td> 1314</td>

<td> 786593</td><td> N/A</td><td> N/A</td><td> 6954</td><td> 6969</td><td> TTTGTGACTG TATTAC</td><td> TksTksTksGdsTdsGdsAd _s^mCdsTdsGdsTd_SAd_STds Tk_SA_ks^mCk</td><td> 50</td><td> 1315</td>

<td> 786594</td><td> N/A</td><td> N/A</td><td> 6955</td><td> 6970</td><td> TTTTGTGACT GTATTA</td><td> TksTk_STk_STd_SGdsTdsGds Ads^mCdsTdsGdsTdsAds TksTksAk</td><td> 2</td><td> 1316</td>

<td> 786595</td><td> N/A</td><td> N/A</td><td> 6956</td><td> 6971</td><td> ATTTTGTGAC TGTATT</td><td> AksTk_STk_STd_STd_SGdsTds GdsAds^mCdsTdsGdsTds AksTksTk</td><td> 4</td><td> 1317</td>

<td> 786596</td><td> N/A</td><td> N/A</td><td> 6957</td><td> 6972</td><td> AATTTTGTG ACTGTAT</td><td> AksAksTksTdsTdsTdsGd sTdsGdsAds^mCdsTdsGds TksAksTk</td><td> 0</td><td> 1318</td>

<td> 786597</td><td> N/A</td><td> N/A</td><td> 6959</td><td> 6974</td><td> TGAATTTTGT GACTGT</td><td> TksGksAksAdsTdsTdsTd sTdsGdsTd_SGd_SAd_S^mCds TksGksTk</td><td> 64</td><td> 1319</td>

<td> 786598</td><td> N/A</td><td> N/A</td><td> 6960</td><td> 6975</td><td> TTGAATTTTG TGACTG</td><td> TksTksGksAdsAdsTdsTd sTdsTdsGdsTdsGdsAds™ CksTksGk</td><td> 45</td><td> 1320</td>

<td> 786599</td><td> N/A</td><td> N/A</td><td> 6961</td><td> 6976</td><td> GTTGAATTTT GTGACT</td><td> GksTksTksGdsAdsAdsTd sTdsTdsTdsGdsTdsGdsA mp יך ks '-'ks A k</td><td> 0</td><td> 1321</td>

<td> 786600</td><td> N/A</td><td> N/A</td><td> 6962</td><td> 6977</td><td> TGTTGAATTT TGTGAC</td><td> TksGksTksTdsGdsAdsAd sTdsTd_STd_STd_SGdsTdsGk _sAks^mCk</td><td> 26</td><td> 1322</td>

Table 25

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> % Inhibition</td><td> SEQ ID NO</td>

<td> 728466</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksTksGdsTdsAds τ τ τ mp mp m 1 ds¹ ds¹ ds '-'ds '-'ds τ τ m/־&gt; '-'ds 1 dskJks 1 ks '-'k</td><td> 12</td><td> 1254</td>

<td> 728489</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCACAG CGCAGG</td><td> A_ksAksGk_SG_dsG_ds^mC dsAds^mCdsA_dsG_ds^mCd sGds^mCdsAksGksGk</td><td> 0</td><td> 1249</td>

<td> 728670</td><td> 1230</td><td> 1245</td><td> 10463</td><td> 10478</td><td> TTGCACTGAC ACAGGC</td><td> Tk_STksGks^mCdsAds^mC dsT_dsG_dsA_ds^mCdsAds^mCdsA_dsG_ksG_ks^mCk</td><td> 6</td><td> 398</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTCT TGACCT</td><td> AksGks^mCksTdsTdsGd /~י τ m/־&gt; τ τ /~י s&lt;Jdslds Cds 1 ds 1 ds&lt;Jd sAds^mCks^mCksTk</td><td> 11</td><td> 436</td>

<td> 729513</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td> mp mp mp a a '-'ks '-'ks Mcs-^'ds-^'ds T_dsG_ds^mCdsAdsAds^mCdsA_dsT_ds^mCks^mCk_S Ak</td><td> 12</td><td> 1097</td>

<td> 785349</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGd_STd_SGd_STd_SAd_S Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds p Τ P T mp '-'ks 1 eskJks 1 es '-'k</td><td> 0</td><td> 1254</td>

<td> 785398</td><td> N/A</td><td> N/A</td><td> 7314</td><td> 7329</td><td> CAATGCAACA TCCATC</td><td>^mCksAdsAdsTdsGds^mCdsA_dsA_ds^mC_dsA_dsT_dmp mp a τ mp s V-ks '-'es-^-ks¹ es '-'k</td><td> 0</td><td> 1323</td>

<td> 785399</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCks^mCds^mCdsA_dsA_ds T_dsG_ds^mCdsAdsAds^mCdsA_ksT_es^mCkS^mCeSA k</td><td> 0</td><td> 1097</td>

<td> 785404</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGd_STd_SGd_STd_SAd_S Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ks p τ p τ mp '-'esAkskJes Aks '-׳e</td><td> 0</td><td> 1254</td>

<td> 785453</td><td> N/A</td><td> N/A</td><td> 7314</td><td> 7329</td><td> CAATGCAACA TCCATC</td><td>^mCksA_dsA_dsT_dsG_ds^mCdsAdsAds CdsAdsTk mp mp a ¹־p mp s Ves '-ks^esAks V/e</td><td> 0</td><td> 1323</td>

<td> 785454</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCks^mCds^mCdsA_dsA_ds T_dsG_ds^mC_dsA_dsA_ds^mPAT ^mP ^mP A '-׳ks-^'esAks '-'es '-'ks-*' e</td><td> 0</td><td> 1097</td>

<td> 785459</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGesTksGdsTdsAds τ τ τ mp mp m A ds A ds A ds '-'ds '-'ds p Τ P T ^mP '-'ds A eskJes A ks '-'k</td><td> 5</td><td> 1254</td>

<td> 785487</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCk_S^mCeS^mCksA_dsA_dsT_dsG_ds^mC_dsA_dsA_ds^mPAT ^mP ^mP A '-'ds^'ds¹ es '-'es '-׳ks*' k</td><td> 0</td><td> 1097</td>

<td> 785493</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGdsTdsAdsTds mp mp mp יך יך׳ 1 ds 1 ds '-'ds '-'ds '-'ds Τ p T mp יך 1 dskJks 1 es '-'ks 1 e</td><td> 0</td><td> 1324</td>

<td> 785494</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksT dsGdsT ds Ads Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds P Τ p T mp '-'ds 1 kskJes 1 ks '-׳e</td><td> 21</td><td> 1254</td>

<td> 785541</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCkS^mCkSA_dsA_dsT_dsG_ds^mCdSAdSAds^mCdS A_dsT_ds^mCkS^mCeSA_ksT e</td><td> 0</td><td> 1325</td>

<td> 785542</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCks^mCks^mCdsAdsAds TdsGds^mCdsA_dsAds^mPAT A '-'ds-^-ds¹ ks '-'es '-׳ks⁷' e</td><td> 0</td><td> 1097</td>

<td> 785547</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGdsTdsAdsTds ¹־p יך mp mp mp Ids Ids '-'ds '-'ds Ves Τ Τ' Τ ^mT T 1 eskJes 1 es '-'ks 1 k</td><td> 0</td><td> 1324</td>

<td> 785573</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCksAdsAdsTds Gds^mCdsAdsAds^mCds AesTes^mCes^mCesA_ksT k</td><td> 0</td><td> 1325</td>

<td> 785581</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGdsTdsAdsTds ¹־p יך mp mp mp 1 ds 1 ds '-'ds '-'ds '-'ks Τ Τ' Τ ^mT T 1 eskJks 1 es '-'ks 1 k</td><td> 0</td><td> 1324</td>

<td> 785582</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksT dsGdsT ds Ads Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ks p Τ Τ' T ^mT Ves 1 kskJes 1 ks '-'k</td><td> 0</td><td> 1254</td>

<td> 785648</td><td> N/A</td><td> N/A</td><td> 7314</td><td> 7329</td><td> CAATGCAACA TCCATC</td><td>^mCksAksAdsTdsGds^mCdsAdsAds^mCdsAdSTk mp mp a יך mp s Ves '-'ks-^-es 1 ks Vk</td><td> 0</td><td> 1323</td>

<td> 785649</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCksAdsAdsTds Gds^mCdsAdsAds^mCds AksTes^mCks^mCesAksT k</td><td> 0</td><td> 1325</td>

<td> 785650</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td> mp mp mp a A '-'ks '-'ks '-'ds⁷'ds⁷'ds TdsGds^mCdsAdsA_ds^mCksAesTks^mCes^mCksA k</td><td> 0</td><td> 1097</td>

<td> 785656</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGdsTdsAdsTds ¹־p יך mp mp mp 1 ds 1 ds '-'ds '-'ds '-'ds Τ Τ' T ^mT T 1 eskJes 1 es '-'ks 1 k</td><td> 16</td><td> 1324</td>

<td> 785682</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCksAdsAdsTds Gds^mCdsAdsAds^mCds A_dsTes^mCes^mCesAksT k</td><td> 0</td><td> 1325</td>

<td> 785686</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGdsTdsAdsTds ¹־p יך mp mp mp 1 ds 1 ds '-'ds '-'ds '-'ds τ /~י τ τ 1 kskJds 1 ks '-'ds 1 k</td><td> 0</td><td> 1324</td>

<td> 785712</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCksAdsAdsTds Gds^mCdsAdsAds^mCds AdsTks^mCds^mCksA_dsT k</td><td> 0</td><td> 1325</td>

<td> 785718</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGdsTdsAdsTds יך יך mp mp mp 1 ds¹ ds '-'ds '-'ds '-'ds Τ P T nip יך Iks^Jeslks '-'es^k</td><td> 0</td><td> 1324</td>

<td> 785719</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksT dsGdsT ds Ads Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds Ρ Τ ρ T mp '-'ks¹ es^Jks¹ es '-'k</td><td> 26</td><td> 1254</td>

<td> 785766</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCkS^mCkSA_dsA_dsT_dsG_ds^mCdSAdSAds^mCdS AdsT_ks^mCeS^mCksAe_ST k</td><td> 0</td><td> 1325</td>

<td> 785767</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCks^mCks^mCdsAdsAds TdsGds^mCdsA_dsAds^mPAT A V-ds^ks¹ es '-'ks Ves-cv k</td><td> 0</td><td> 1097</td>

<td> 785772</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksTksGdsTdsAds Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds ^/m ד e יך e '-'ks A ds'Jks 1 ds Me</td><td> 1</td><td> 1254</td>

<td> 785800</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCks^mCks^mCksAdsAds TdsGds^mCdsA_dsAds^mPAT V-ds^ks¹ ds '-'ks '-'ds Ak</td><td> 0</td><td> 1097</td>

<td> 785806</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGksTdsAdsTds יך יך mp mp mp 1 ds 1 ds '-'ds '-'ds '-'ds יך mp יך p יך Iks'Jesiks '-'es^k</td><td> 0</td><td> 1324</td>

<td> 785807</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksTksGdsTdsAds Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds ρ Τ T '-'ks 1 esvJks 1 es '-'k</td><td> 0</td><td> 1254</td>

<td> 785854</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCkSAksA_dsT_dsG_ds^mCdsAdsAds^mCds AdsTks^es^ksAesT k</td><td> 0</td><td> 1325</td>

<td> 785855</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td> mp mp mp a A '-'ks '-'ks '-׳ks^'ds^'ds T_dsG_ds^mCdsAdsAds^mCdsA_ksTe_S^mCks^mCe_SA k</td><td> 0</td><td> 1097</td>

<td> 785860</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksTksGdsTdsAds Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds ρ Τ T '-'ds 1 ks'Jes 1 ks '-׳e</td><td> 0</td><td> 1254</td>

<td> 785888</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td> mp mp mp a A '-'ks '-'ks '-׳ks^'ds^'ds T_dsG_ds^mC_dsA_dsAds^mCdsAdsT^Ces^ksA e</td><td> 0</td><td> 1097</td>

<td> 785894</td><td> 426</td><td> 441</td><td> 8319</td><td> 8334</td><td> GTGTATTTCC CTGTCT</td><td> GksTksGksT_dsA_dsT_dsיך יך mp mp mp 1 ds 1 ds '-'ds '-'ds '-'ds יד '־/m יד י~/ יד 1 dsvJks 1 ks '-'ks 1 e</td><td> 30</td><td> 1324</td>

<td> 785895</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTTC CCTGTC</td><td> GksGksTksGdsTdsAds Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds י־/1מ יד יד '-'ds 1 ksvJks 1 ks '-'e</td><td> 0</td><td> 1254</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCksAksAdsTdsT dsTdSTdsGds^mCdsA_dsT dsTks^mCks^mCksA־</td><td> 61</td><td> 1242</td>

<td> 785942</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCk_SA_ksA_dsT_dsG_ds^mCdsAdsAds^mCds A_dsT_ds^mCks^mCksAksT e</td><td> 16</td><td> 1325</td>

<td> 785943</td><td> N/A</td><td> N/A</td><td> 7316</td><td> 7331</td><td> CCCAATGCAA CATCCA</td><td>^mCks^mCks^mC_ksAdsAds T_dsG_ds^mCdsAdsAds^mCdsA_dsTks^mCks^mCks A_e</td><td> 0</td><td> 1097</td>

<td> 786494</td><td> 428</td><td> 443</td><td> 8321</td><td> 8336</td><td> CGGTGTATTT CCCTGT</td><td>^mCksGksGk_ST_dsG_dsT_d A Τ Τ T ^m s-^-ds 1 ds 1 ds 1 ds '-'ds τ י~/ τ י־/1מ '-'ds '-'ds 1 ksvJks 1 k</td><td> 0</td><td> 1326</td>

<td> 786562</td><td> N/A</td><td> N/A</td><td> 7307</td><td> 7322</td><td> ACATCCATCA ATGAGG</td><td> A_ks^mCkSAksTds^mCds^mCdsAdsTds CdsAdsAd sTdsGdsAksGksGk</td><td> 0</td><td> 1327</td>

<td> 786563</td><td> N/A</td><td> N/A</td><td> 7309</td><td> 7324</td><td> CAACATCCAT CAATGA</td><td> “CksAksAks’TdsAds τ י־/1מ λ τ m Ids Cds CdsAdslds C_dsA_dsA_dsT_ksG_ksA_k</td><td> 0</td><td> 1328</td>

<td> 786564</td><td> N/A</td><td> N/A</td><td> 7311</td><td> 7326</td><td> TGCAACATCC ATCAAT</td><td> TksGksTksAdsAds“ C_dsA_dsT_ds^mCds^mCds A_dsT_ds^mC_dsAk_SAk_STk</td><td> 0</td><td> 1329</td>

<td> 786565</td><td> N/A</td><td> N/A</td><td> 7312</td><td> 7327</td><td> ATGCAACATC CATCAA</td><td> Α^Τ^Ο^ CdsAdsAd s CdsAdslds Cds Cd sAdsTds C^A^Aly</td><td> 0</td><td> 1330</td>

<td> 786566</td><td> N/A</td><td> N/A</td><td> 7313</td><td> 7328</td><td> AATGCAACAT CCATCA</td><td> AksAksTksG_ds C_dsA_{d s}A_ds^mCdsAdsTds^mCds ^mCdsAdsTks^mCkSA_k</td><td> 0</td><td> 1331</td>

<td> 786567</td><td> N/A</td><td> N/A</td><td> 7314</td><td> 7329</td><td> CAATGCAACA TCCATC</td><td>^mCksAksAksTdsGds^mCdsAdsAds CdsAdsTd s Cds CdsAjis 1Ck</td><td> 0</td><td> 1323</td>

<td> 786568</td><td> N/A</td><td> N/A</td><td> 7315</td><td> 7330</td><td> CCAATGCAAC ATCCAT</td><td>^mCks^mCksAksA_dsT_dsG_ds^mCdsAdsAds^mCds A_dsT_ds^mC_ds^mCk_SA_ksT k</td><td> 0</td><td> 1325</td>

<td> 786569</td><td> N/A</td><td> N/A</td><td> 7317</td><td> 7332</td><td> ACCCAATGCA ACATCC</td><td> Aks^mCks^mCks^mC_dsAds AdsTdsGds CdsAdsAd s CdsAds 1 ks Cks Ck</td><td> 33</td><td> 1332</td>

<td> 786570</td><td> N/A</td><td> N/A</td><td> 7318</td><td> 7333</td><td> TACCCAATGC AACATC</td><td> י־/במ י־/1מ Λ יד 1 ksA_ks Cks Cds Cds A_dsA_dsT_dsG_ds^mC_dsA_dsAds^^ksTks^k</td><td> 0</td><td> 1333</td>

<td> 786571</td><td> N/A</td><td> N/A</td><td> 7319</td><td> 7334</td><td> ATACCCAATG CAACAT</td><td> Ak_STk_SA_ks^mCds^mCds^mCdsAdsAdsTdsGds^mCd sA_dsA_ds CksAksTk</td><td> 1</td><td> 1334</td>

Table 26

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> % Inhibition</td><td> SEQ ID NO</td>

<td> 665892</td><td> 1227</td><td> 1242</td><td> 10460</td><td> 10475</td><td> CACTGACA CAGGCGGA</td><td>^mCksAks^mCkST_dsG_dsA _ds^mCdsAds^mCdsA_dsG_dsG_ds^mC_dsGksGksAk</td><td> 0</td><td> 387</td>

<td> 665893</td><td> 1228</td><td> 1243</td><td> 10461</td><td> 10476</td><td> GCACTGAC ACAGGCGG</td><td> ΟΛΑΛΤ₄Ο _dsA_ds^mCdsAds^mCdsA_dsG_dsG_ds^mCksGksGk</td><td> 0</td><td> 39</td>

<td> 666168</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> A_ksT_ks^mCksAds^mCds^mCdsAds^mCdsT_dsG_dsT_dsG_dsT_dsAks^mCks^mCk</td><td> 11</td><td> 927</td>

<td> 728458</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAksT_dsG_dsG_ds T_dsG_dsT_dsT_dsA_dsT_ds^m'-'ds 1 ks '-'ks '-'k</td><td> 0</td><td> 123</td>

<td> 728466</td><td> 427</td><td> 442</td><td> 8320</td><td> 8335</td><td> GGTGTATTT CCCTGTC</td><td> GksGksTksGdsTdsAds Τ Τ T mp mp m 1 ds 1 ds 1 ds '-'ds '-'ds יד י~^ יד י־/ '-'ds A ds'Jks A ks Me</td><td> 37</td><td> 1254</td>

<td> 728489</td><td> 484</td><td> 499</td><td> 8377</td><td> 8392</td><td> AAGGGCAC AGCGCAGG</td><td> AksAksGksG_dsG_ds C_{d s}A_ds^mCdsAdsGds^mCds G_dsⁿ¹C_dsA_ksGksGk</td><td> 2</td><td> 1249</td>

<td> 728670</td><td> 1230</td><td> 1245</td><td> 10463</td><td> 10478</td><td> TTGCACTGA CACAGGC</td><td> Tk_STk_SG_ks^mCdsAds^mC dsT_dsG_dsA_ds^mCdsAds^mCdsA_dsGksGks^mCk</td><td> 0</td><td> 398</td>

<td> 728707</td><td> 1307</td><td> 1322</td><td> 10540</td><td> 10555</td><td> GCTTGGTCT TGACCTC</td><td> Gks^mCksTksTdsGdsGds Tds^mCdsT_dsT_dsG_dsA_ds mp mp ־׳p mp '-'ds '-'ks ¹ ks '-'k</td><td> 0</td><td> 435</td>

<td> 728708</td><td> 1308</td><td> 1323</td><td> 10541</td><td> 10556</td><td> AGCTTGGTC TTGACCT</td><td> Ak_SGks^mCk_ST_dsT_dsG_ds 'r יד יד יד י~/ 'Jds A ds '-'ds A ds A ds'Jds Ads^ks^ksTk</td><td> 41</td><td> 436</td>

<td> 728958</td><td> 1979</td><td> 1994</td><td> 11544</td><td> 11559</td><td> CCTATACA GCTAGGCC</td><td>^mCks^mCksTksAdsTdsA mp a p mp ־׳p ds '-׳ds^'ds'-Jds '-'ds¹ ds AdsG_dsGks^mCk_S^mCk</td><td> 0</td><td> 168</td>

<td> 728996</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGksA_dsG_dsT_ds^mCdsTds^mCdsA_dsA_dsA _ds^mCds^mCksA_ksGk</td><td> 9</td><td> 206</td>

<td> 729037</td><td> 2216</td><td> 2231</td><td> 11781</td><td> 11796</td><td> GGTTCTTGG ACTCTCA</td><td> יד יד יד י~/ י~/ 'Jks'Jks 1 ks 1 ds '-'ds 1 ds T_dsG_dsG_dsA_ds^mCdsTds ^mCdsTks^mCksAk</td><td> 47</td><td> 706</td>

<td> 785347</td><td> 390</td><td> 405</td><td> 4715</td><td> 4730</td><td> ATGGTGTTA TCTCCGT</td><td> AksT_dsG_dsG_dsT_dsG_ds T_dsT_dsA_dsT_ds^mC_dsTks mp mp p יך Ves '-'ks'Jeslk</td><td> 0</td><td> 122</td>

<td> 785348</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> Ak_SG_dsA_dsT_dsG_dsG_dsT_dsG_dsT_dsT_dsA_dsTk_S^mp יך mp mp '-'es^ks Ves '-'k</td><td> 0</td><td> 123</td>

<td> 785374</td><td> 2112</td><td> 2127</td><td> 11677</td><td> 11692</td><td> GAGTCTCA AACCAGGG</td><td> Gk_SAd_SGdsTd_S^mCdsTds ^mCdsAdSAdSAds^mCdS^mCksAesGksGesGk</td><td> 0</td><td> 205</td>

<td> 785375</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTdsGdsAdsGdsTds ^mCdsTdS^mCdSAd_SA_dsA a /~י ks '-'es '-ks^'es'-Jk</td><td> 0</td><td> 206</td>

<td> 785390</td><td> N/A</td><td> N/A</td><td> 5284</td><td> 5299</td><td> CACCACTGT GTACCCC</td><td>^mCkSAds^mCdS^mCd_SA_ds י־/1מ t τ ri' τ Cdslds&lt;Jdslds&lt;Jdslds י־/1מ a -iVks '-'es Vks '-'es Vk</td><td> 0</td><td> 938</td>

<td> 785391</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> A_ksTd_S^mCdSAds^mCdS^mCdsAds^mCdsTdsGdsTds GksTesAks^es^k</td><td> 0</td><td> 927</td>

<td> 785402</td><td> 390</td><td> 405</td><td> 4715</td><td> 4730</td><td> ATGGTGTTA TCTCCGT</td><td> AksTdsGdsGdsTdsGds TdsTdsAdsTds^mCksT_es Vks '-eskJks 1 e</td><td> 0</td><td> 122</td>

<td> 785403</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGdsAdsTdsGdsGds Td_SGdsTdsTdsAk_ST_es^m mp י־/1מ יך י־/ '-ks 1 es Vks Ve</td><td> 0</td><td> 123</td>

<td> 785429</td><td> 2112</td><td> 2127</td><td> 11677</td><td> 11692</td><td> GAGTCTCA AACCAGGG</td><td> Gk_SAd_SGdsTd_S^mCdsTds ^mCdsAdsAdsAds^mCks^mCesAksGesGksGe</td><td> 6</td><td> 205</td>

<td> 785430</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTdsGdsAdsGdsTds ^mCdsTds^mCdsA_dsAksA m_r λ קוון es י—ks '-es^'kskJe</td><td> 0</td><td> 206</td>

<td> 785445</td><td> N/A</td><td> N/A</td><td> 5284</td><td> 5299</td><td> CACCACTGT GTACCCC</td><td> mp a mp mp a '-ks+^ds '-'ds '-ds+'ds י־/1מ t τ ri' τ '-'ds 1 dskJds 1 dskJds 1 ks י־/1מ י־/1מ י־/1מ a -iVes Vks Ves '-'ks '-'e</td><td> 0</td><td> 938</td>

<td> 785446</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> AksTds^mCdsA_ds^mCds^mCdsAds^mCdsTdsGdsTks GesTksAes^mCks^mCe</td><td> 0</td><td> 927</td>

<td> 785458</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGesAksTdsGdsGds TdsGdsTdsTdsAdsTds™ mp mp יך י־/ Ves A es '-'ks '-'k</td><td> 0</td><td> 123</td>

<td> 785473</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTesGksAdsGdsTds” CdsTds^mCdsAdsAdsAd a /~י s V-es '-es^'ks'-Jk</td><td> 22</td><td> 206</td>

<td> 785482</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> AksTes^mCksA_ds^mCds^m CdsAds^mCdsTdsGdsTds 0 T A kJds 1 es^es '-'ks '-'k</td><td> 0</td><td> 927</td>

<td> 785491</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GksAksTdsGdsGdsTds GdsTdsTdsAdsTds^mCds ¹יך mp mp /~י 1 ks Ves '-'ks'Je</td><td> 0</td><td> 1335</td>

<td> 785492</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAdsTdsGdsGds TdsGdsTdsTdsAdsTds¹¹¹ mp mp יך י־/ '-'ks 1 es '-'ks '-'e</td><td> 0</td><td> 123</td>

<td> 785517</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> TksGksAdsGdsTds^mCds Tds^mCdsAdsAdsA_ds^mC ds CksAesGksGe</td><td> 7</td><td> 1336</td>

<td> 785518</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGdsAdsGdsTds ^mCdsTds^mCdsAdsA_dsA ds^mCks^mCesAksGe</td><td> 31</td><td> 206</td>

<td> 785533</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> τ mp a mp mp 1 ks '-ksAds Cds '-'ds Ads^mCdsTdsGd_STd_SGds Τ Δ ^mp ^mp mp 1 ds^ks Ves '-'ks '-׳e</td><td> 0</td><td> 939</td>

<td> 785534</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> A_ksT_ks^mCdsAds^mC_ds^mCdsAds^mCdsTdsGdsTds P Τ' A mp mp kJds 1 ks^es '-'ks '-'e</td><td> 0</td><td> 927</td>

<td> 785546</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GlssAissTdsGdsGdsTds GdsTd_sTd_sAd_sT_es^mCes mp mp p יך^, 1 es Ves '-'ks'Jk</td><td> 0</td><td> 1335</td>

<td> 785560</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> T_ksG_ksAd_SGd_STd_S^mCds Tds^mCdsAd_SAd_SA_es^mC es CcsAesGksGk</td><td> 0</td><td> 1336</td>

<td> 785569</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> τ mp a mp mp 1 ks *-ks^ds '-'ds '-'ds Ads^mCdsTdsGdsTdsGes Τ A ^mp ^mp mp 1 es-^-es Ves '-'ks '-'k</td><td> 0</td><td> 939</td>

<td> 785578</td><td> 390</td><td> 405</td><td> 4715</td><td> 4730</td><td> ATGGTGTTA TCTCCGT</td><td> AjssTissGdsGdsTdsGds TdsTdsAdsTds^mC_ksT_es mp mp p τ '-'ks '-es'Jks 1 k</td><td> 0</td><td> 122</td>

<td> 785579</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GlssAissTdsGdsGdsTds GdsTdsTdsAdsT_ks^mCes יך mp mp־. p. 1 ks '-'es י—kskJk</td><td> 0</td><td> 1335</td>

<td> 785580</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> A_ksG_ksAdsTdsGdsGds TdsGdsTdsTdsA_ksT_es^mp. יך mp. mp. '-'ks A es '-'ks '-'k</td><td> 0</td><td> 123</td>

<td> 785615</td><td> 2112</td><td> 2127</td><td> 11677</td><td> 11692</td><td> GAGTCTCA AACCAGGG</td><td> G_ksA_ksGdsTds^mCdsTds ^mCdsAdsAdsA_ds^mCks^mCcsAksGcsGksGk</td><td> 0</td><td> 205</td>

<td> 785616</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> T_ksG_ksAdsGdsTds^mCds Tds^mCdsAdsAdsA_ks^mC es CksAesGksGk</td><td> 0</td><td> 1336</td>

<td> 785617</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GjssTissGdsAdsGdsTds ^mCdsTds^mCdsAdsAksA es^mCks^mCesAksGk</td><td> 9</td><td> 206</td>

<td> 785637</td><td> N/A</td><td> N/A</td><td> 5284</td><td> 5299</td><td> CACCACTGT GTACCCC</td><td>^mCksAks^mCds^mCdsAds mp τ p τ p τ '-'ds 1 dsvJds 1 dsvJds 1 ks A mp mp mp mp + *-es '-'ks '-'es '-'ks '-'k</td><td> 0</td><td> 938</td>

<td> 785638</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> τ mp a mp mp 1 ks '-'ksAds Cds '-'ds Ads^mCdsTdsGdsTdsG_ks T A 1 es^ks '-'es '-'ks '-'k</td><td> 0</td><td> 939</td>

<td> 785639</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> A_ksT_ks^mCdsAds^mCds^mCdsAds^mCdsTdsGdsT_ksGesTksAes^ks^k</td><td> 0</td><td> 927</td>

<td> 785655</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GksAksTdsGdsGdsTds GdsTdsTdsAdsTds^mCes mp mp p יך^, 1 es Ves '-'ks'Jk</td><td> 0</td><td> 1335</td>

<td> 785669</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> T_ksG_ksAdsGdsTds^mCds Tds^mCdsAdsAdsA_ds^mC es CcsAesGksGk</td><td> 0</td><td> 1336</td>

<td> 785678</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> τ mp a mp mp 1 ks '-'ksAds Cds '-'ds Ads^mCdsTdsGdsTdsGds T A ^mp ^mp mp 1 es^es V/es '-'ks '-'k</td><td> 0</td><td> 939</td>

<td> 785685</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GksAksTdsGdsGdsTds G_dsTd_STd_SAd_ST_ds^mCk_S 1 ds '-'ks V'ds'Jk</td><td> 0</td><td> 1335</td>

<td> 785699</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> TksGksAd_SGdsTd_S^mCds TdS^mCdsAdsAd_SAd_S^mC ks CdsAksGdsGk</td><td> 0</td><td> 1336</td>

<td> 785708</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> 1 ks MsAds Ms Ms Ad_S^mCdsTdsGdsTd_SGds י־/1מ τ A 1 ksAtfs Cks Ms M</td><td> 0</td><td> 939</td>

<td> 785716</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GksAksTdsGdsGdsTds GdsTdsTdsAdsTds^mCks ¹יך mpv mpv p&gt; 1 es Mes vesUk</td><td> 0</td><td> 1335</td>

<td> 785717</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAdsTdsGdsGds TdsGdsTdsTdsAdsTks¹¹¹p^ יך mpv mpv Ms Iks Ms Me</td><td> 0</td><td> 123</td>

<td> 785742</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> TksGksAdsGdsTds^mCds Tds^mCdsAdsAdsA_ds^mC ks CesAksGesGk</td><td> 0</td><td> 1336</td>

<td> 785743</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGdsAdsGdsTds ^mCdsTdS^mCdsAdSA_dsA mp mp^ a p&gt; ks V^es Mes-^-esMe</td><td> 0</td><td> 206</td>

<td> 785758</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> 1 ks MsAds Ms Ms Ads^mCdsTdsGdsTdsGds Τ A 1 ks^es '-'ks Ms '-'k</td><td> 0</td><td> 939</td>

<td> 785759</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> AksTks^mCdsA_ds^mCds^mCdsAds^mCdsTdsGdsTds GksTesAks^mCes^mCk</td><td> 0</td><td> 927</td>

<td> 785771</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAksTdsGdsGds TdsGdsTdsTdsAdsTks¹¹¹Ms Iks Ms M</td><td> 0</td><td> 123</td>

<td> 785786</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGksAdsGdsTds ^mCdsTds^mCdsAdsAdsA ks^mCds^mCksAdsGk</td><td> 0</td><td> 206</td>

<td> 785795</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> AksTks^mCksAds^mCds^mCdsAds^mCdsTdsGdsTds GksTdsAks^mCds^mCk</td><td> 0</td><td> 927</td>

<td> 785804</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GksAksTksGdsGdsTds Gd_ST _dsT dsAdsT ds^mCks τ mp^ mp^ p&gt; 1 es '-'ks ΜΑ</td><td> 0</td><td> 1335</td>

<td> 785805</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAksTdsGdsGds TdsGdsTdsTdsAdsTks¹¹¹p^ יך mp^ mp^ Ms Iks Ms '-'k</td><td> 0</td><td> 123</td>

<td> 785830</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> TksGksAksGdsTd_S^mCds Tds^mCdsAdsAdsA_ds^mC ks CesAksGesGk</td><td> 0</td><td> 1336</td>

<td> 785831</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGksAdsGdsTds ^mCdsTds^mCdsAdSA_dsA ks^mCes^mCksAesGk</td><td> 0</td><td> 206</td>

<td> 785846</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> 1 ks MsAks Ms Ms Ads^mCdsTdsGdsTdsGds Τ A 1 ksA^es '-/ks Ms '-'k</td><td> 0</td><td> 939</td>

<td> 785847</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> A_ksT_ks^mCksAds^mCds^mCdsA_ds^mC_dsT_dsG_dsT_dsGksTesAks^es^k</td><td> 0</td><td> 927</td>

<td> 785859</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAksTdsGdsGds TdsGdsTdsTdsAdsTds¹¹¹p τ mp mp '-'ks¹ es '-'ks *-׳e</td><td> 8</td><td> 123</td>

<td> 785874</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGksAdsGdsTds ^mCdsTds^mCdsA_dsA_dsA _ds^mCks^mCesAksG_e</td><td> 0</td><td> 206</td>

<td> 785883</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> A_ksT_ks^mCksAds^mCds^mCdsAds^mCdsT_dsG_dsT_dsG_dsT_ksA_es^mCk_s^mCe</td><td> 0</td><td> 927</td>

<td> 785892</td><td> 391</td><td> 406</td><td> 4716</td><td> 4731</td><td> GATGGTGTT ATCTCCG</td><td> GksAksTksG_dsG_dsT_dsG_dsT_dsT_dsA_dsT_ds^mC_ds T me m&lt;x /~י 1 ks Cks CksCe</td><td> 0</td><td> 1335</td>

<td> 785893</td><td> 392</td><td> 407</td><td> 4717</td><td> 4732</td><td> AGATGGTG TTATCTCC</td><td> AksGksAksTdsGdsGds TdsGdsTdsTdsAdsTds¹¹¹ p τ mp mp Mes Iks '-'ks '-'e</td><td> 0</td><td> 123</td>

<td> 785918</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> TksGksAksGdsTds^mCds Tds^mCdsAdsAdsA_ds^mC ds CksAksGksGe</td><td> 0</td><td> 1336</td>

<td> 785919</td><td> 2114</td><td> 2129</td><td> 11679</td><td> 11694</td><td> GTGAGTCTC AAACCAG</td><td> GksTksGksAdsGdsTds ^mCdsTds^mCdsAdsA_dsA mp mp a p ds '-'ks '-׳ks^'ks'-Je</td><td> 44</td><td> 206</td>

<td> 785934</td><td> N/A</td><td> N/A</td><td> 5285</td><td> 5300</td><td> TCACCACTG TGTACCC</td><td> τ mp a mp mp 1 ks '-'ks-^-ks '-'ds '-'ds Ads^mCdsTdsGdsTdsGds τ Λ me m/־' m/1 dsAks Cks Cks Ce</td><td> 21</td><td> 939</td>

<td> 785935</td><td> N/A</td><td> N/A</td><td> 5286</td><td> 5301</td><td> ATCACCACT GTGTACC</td><td> AksTks^mCksA_ds^mCds^mCdsAds^mCdsTdsGdsTds GdsTksAks^mCks^mCe</td><td> 19</td><td> 927</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTG CATTCCA</td><td>^mCks^mCksAksAdsTdsT dsTdsTdsGds^mCdsAdsT dsTks^mCks^mCksAe</td><td> 68</td><td> 1242</td>

<td> 786493</td><td> 393</td><td> 408</td><td> 4718</td><td> 4733</td><td> AAGATGGT GTTATCTC</td><td> AksAksGksAdsTdsGds GdsT dsGdsT dsT dsAds τ mp τ mp Ids '-׳kslks '-'k</td><td> 0</td><td> 1337</td>

<td> 786499</td><td> 2113</td><td> 2128</td><td> 11678</td><td> 11693</td><td> TGAGTCTCA AACCAGG</td><td> TksGksAksGdsTds^mCds Tds^mCdsAdsAdsA_ds^mC ds CdsAksGksGk</td><td> 16</td><td> 1336</td>

<td> 786500</td><td> 2115</td><td> 2130</td><td> 11680</td><td> 11695</td><td> AGTGAGTC TCAAACCA</td><td> AksGksTksGdsAdsGds Tds^mCdsTds^mCdsAdsA dsAds^mCks^mCksAk</td><td> 0</td><td> 1338</td>

Table 27

Inhibition of IRF5 mRNA by modified oligonucleotides targeting SEQ ID NO: 1 and 2

<td> Compound Number</td><td> SEQ ID NO: 1 Start Site</td><td> SEQ ID NO: 1 Stop Site</td><td> SEQ ID NO: 2 Start Site</td><td> SEQ ID NO: 2 Stop Site</td><td> Sequence (5' to 3')</td><td> Chemistry Notation</td><td> % Inhibition</td><td> SEQ ID NO</td>

<td> 728806</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> CksvJksvJks 1 ds '-'ds 1 ds TdsTdsGdsAdsGdsGdsTa s '-'ks 1 kskJk</td><td> 32</td><td> 539</td>

<td> 729205</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCks^mCksA_ds^mCdsT dsGdsTdsGdsTdsAds^mCd 111/י־ mr mr a s Cds '-'ks '-'ksAk</td><td> 75</td><td> 937</td>

<td> 729433</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> Tk_STk_SGksTds^mCdsTd_SA dsGdsTdsGdsTds^mCdsAd sTksGksGk</td><td> 60</td><td> 974</td>

<td> 785368</td><td> 1558</td><td> 1573</td><td> 11123</td><td> 11138</td><td> GTCTTTGAGG TCTGGG</td><td> /~י τ m/⁵״ τ τ τ /~י kJks 1 ds '-'ds 1 ds 1 ds 1 dskJ dsAdsGdsGdsT ds^mCksT _es GksGesGk</td><td> 0</td><td> 537</td>

<td> 785369</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> '-'ks'-^rds'-^rds A ds '-'ds A ds TdsTdsGdsAdsGdsGksTe י~/ יך¹ mp s '-'ks 1 eskJk</td><td> 68</td><td> 539</td>

<td> 785385</td><td> N/A</td><td> N/A</td><td> 4365</td><td> 4380</td><td> GTCTAGTGTC ATGGAA</td><td> GksTd_S^mCdsTdsAdSGds TdSGdsTdS^mCdsAdSTks GesGksAesAk</td><td> 42</td><td> 1339</td>

<td> 785386</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksTd_SGdsTd_S^mCdsTdSA dSGdsTdsGdsTds^mCksA_eSTksGesGk</td><td> 44</td><td> 974</td>

<td> 785389</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCd_S^mCdSAds^mCdST dsGdsTdsGdsTdsAds^mCk mp mp mp a s Ves '-'ks '-'es-^-k</td><td> 43</td><td> 937</td>

<td> 785423</td><td> 1558</td><td> 1573</td><td> 11123</td><td> 11138</td><td> GTCTTTGAGG TCTGGG</td><td> /~י τ m/⁵״ τ τ τ kJks 1 ds '-'ds 1 ds 1 ds 1 dskJ dsAdsGdsGdsTks^mCesTks GesGksGe</td><td> 33</td><td> 537</td>

<td> 785424</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> '-'ks'-^rds'-^rds A ds '-'ds A ds TdsTdsGdsAdsGksGesTk י~/ '¹Τ י־/111 s '-'eslks'Je</td><td> 40</td><td> 539</td>

<td> 785440</td><td> N/A</td><td> N/A</td><td> 4365</td><td> 4380</td><td> GTCTAGTGTC ATGGAA</td><td> GksTd_S^mCdsTdsAdSGds TdsGdsTds^mCdsAksTeS GksGesAksAe</td><td> 35</td><td> 1339</td>

<td> 785441</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksTd_SGdsTd_S^mCdsTdSA dsGdsTdsGdsTks^mCesAks TesGksGe</td><td> 8</td><td> 974</td>

<td> 785444</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCd_S^mCdSAds^mCdST dsGdsTdsGdsTdsAks^mCes a י־/111 mp י־/111 '-'ks '-'es '-'ks-^-e</td><td> 40</td><td> 937</td>

<td> 785470</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> τ τ י~/ י~/ י־/111 '-'ks'Jes'Jks 1 ds '-'ds 1 ds TdsTdsGdsAdsGdsGdsTe י~/ יך¹ mp s Ves A kskJk</td><td> 49</td><td> 539</td>

<td> 785479</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksT_esGksTd_S^mCdsTdSA dsGdsTdsGdsTds^mCdsAes TesGksGk</td><td> 55</td><td> 974</td>

<td> 785481</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCeS^mCkSA_ds^mC_dsT dsGdsTdsGdsTdsAds^mCd mp mp mp a s Ves '-'es '-׳ks^'k</td><td> 63</td><td> 937</td>

<td> 785511</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> p p τ mp τ τ τ 'Jks'Jks 1 ds '-'ds 1 ds 1 ds 1 dsGdsAd_SGdsGdsTd_S^mCk sTesGksGe</td><td> 67</td><td> 538</td>

<td> 785512</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> mp p p τ mp τ '-'ks'-^rks'-^rds A ds '-'ds A ds TdsTdsGdsAdsGdsGdsTk mp יך p s '-'eslks'Je</td><td> 43</td><td> 539</td>

<td> 785527</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> TksGksTd_S^mCdsTdSAdS GdsTdsGdsTdS^mCdsAdS TksGesGksAe</td><td> 44</td><td> 1340</td>

<td> 785528</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksTksGdsTds^mCdsTdsA dSGdsTdSGdSTds^mCdSAk _sT_esGksGe</td><td> 38</td><td> 974</td>

<td> 785531</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> mp mp a mp τ P '-'ks '-'ksAtfs '-'ds 1 dsvJ dsTdsGdsTdsA_ds^mCds^mC mp mp a τ ds '-'ks '-'es-^'-ks¹ e</td><td> 19</td><td> 936</td>

<td> 785532</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCkS^mCdSA_ds^mCd_ST dsGdsTdsGdsTdsAds^mCd mp mp mp a s V/ks '-'es '-'ks-^'e</td><td> 66</td><td> 937</td>

<td> 785557</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> p p τ mp τ יד יד 'Jks'Jks A ds '-'ds 1 ds A ds A dsGdsAd_sGdsGesTes^mC_esTesGksGk</td><td> 56</td><td> 538</td>

<td> 785566</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> TksGksTd_S^mCdsTdSAdS GdsTdSGdsTdS^mCesAesT esGesGksAk</td><td> 54</td><td> 1340</td>

<td> 785568</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> mp mp a mp τ P '-'ks '-'ksAds '-'ds 1 dsvJ d_ST_dsGd_STd_SA_ds^mCeS^mC eS^mCeS^mCesAksT_k</td><td> 44</td><td> 936</td>

<td> 785606</td><td> 1558</td><td> 1573</td><td> 11123</td><td> 11138</td><td> GTCTTTGAGG TCTGGG</td><td> p τ mp τ יד יד p vJks 1 ks '-'ds 1 ds 1 ds 1 dsvJ dsAdsGdsGdsTks^mCesTks GesGksGk</td><td> 34</td><td> 537</td>

<td> 785607</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> p p τ mp τ יד יד vJksvJks 1 ds '-'ds 1 ds 1 ds 1 d_SGdsAd_SGdsGksT_es^mCk _sT_esGksGk</td><td> 52</td><td> 538</td>

<td> 785608</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> mp p p τ mp τ CksvJksvJds 1 ds '-'ds 1 ds TdsTdsGdsAdsGksGesTk mp יך p s Ves A ksvJk</td><td> 33</td><td> 539</td>

<td> 785629</td><td> N/A</td><td> N/A</td><td> 4365</td><td> 4380</td><td> GTCTAGTGTC ATGGAA</td><td> Gk_STk_S^mCdsTdsAdSGds TdsGdsTds^mCdsAksTeS GksGesAksAk</td><td> 9</td><td> 1339</td>

<td> 785630</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> TksGksTd_S^mCdsTdSAdS GdSTdsGdsTds^mCksAes TksGesGksAk</td><td> 10</td><td> 1340</td>

<td> 785631</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksTksGdsTds^mCdsTdsA dsGdsTdsGdsTks^mCesAks TesGksGk</td><td> 0</td><td> 974</td>

<td> 785635</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> י~/ יד י־/1מ mr mr λ Lzks LzksAtfs Lzds 1 dskJ dsT_dsG_dsT_dsA_ds^mCks^mC eS^mCks^mCesAksT_k</td><td> 0</td><td> 936</td>

<td> 785636</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mC_ks^mCdsAds^mCdsT _dsG_dsT_dsG_dsT_dsA_ks^mCes me me me a '-'ks '-'es '^׳ks^k</td><td> 15</td><td> 937</td>

<td> 785666</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> ידי ידי יד י־/1מ יד י~/ י~/ LJksvJks 1 ds Lzds 1 ds 1 ds 1 _dsG_dsA_dsG_dsG_dsT_es^mCe sTesGksGk</td><td> 74</td><td> 538</td>

<td> 785675</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> Τ^Ο^Τ^^^Τ^Α^ G_dsT_dsG_dsT_ds^mC_dsA_esT_CsG_CsGksAk</td><td> 60</td><td> 1340</td>

<td> 785677</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> me me a me יד L-ks Lzks-^-ds Lzds A dskJ _dsT_dsG_dsT_dsA_ds^mCds^mC eS^mCeS^mCesA_ksT_k</td><td> 64</td><td> 936</td>

<td> 785696</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> יד יד יד י־/1מ יד י~/ י~/ LJksvJks 1 ds Lzds 1 ds 1 ds 1 _dsG_dsA_dsG_dsG_dsT_ks^mC_{d s}Tk_SG_dsGk</td><td> 56</td><td> 538</td>

<td> 785705</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> Τ^Ο^Τ^^^Τ^Α^ G_dsT_dsG_dsT_ds^mC_dsA_ksT_dsG_ksG_dsA_k</td><td> 40</td><td> 1340</td>

<td> 785707</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> יי׳/ יד י־/1מ me me λ Lzks LzksAds Lzds 1 dskJ _dsT_dsG_dsT_dsA_ds^mC_ds^mC me me a יך ks '-'ds '-'ks-^-ds¹ k</td><td> 54</td><td> 936</td>

<td> 785736</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> יד יד יד יד י~/ י~/ kJkskJks A ds Lzds 1 ds A ds A _dsG_dsA_dsG_dsG_dsT_ks^mC_{e s}Tk_sG_esGk</td><td> 54</td><td> 538</td>

<td> 785737</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> יד יד יי׳/ יי׳/ י&gt;111 L-kskJkskJds A ds Lzds A ds TdsTdsGdsAdsGdsGksTe me ¹־p /~י s Vks A esvJk</td><td> 44</td><td> 539</td>

<td> 785752</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> Τ^Ο^Τ^^^Τ^Α^ G_dsT_dsG_dsT_ds^mC_dsA_ksT_CsGksG_CsAk</td><td> 44</td><td> 1340</td>

<td> 785753</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> Τ^Τ^Ο^Τ^^^Τ^Α _dsG_dsT_dsG_dsT_ds^mCksAes TksGesGk</td><td> 24</td><td> 974</td>

<td> 785756</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> יי׳/ יד י־/1מ me me λ Lzks LzksAds Lzds 1 dskJ _dsT_dsG_dsT_dsA_ds^mC_ds^mC me me a יך ks '-'es '-'ks-^-es¹ k</td><td> 42</td><td> 936</td>

<td> 785757</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mC_ks^mCdsAds^mCdsT _dsG_dsT_dsG_dsT_dsA_ds^mC_kme me me a s V-es '-ks '-es^k</td><td> 17</td><td> 937</td>

<td> 785783</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> יד יד יי׳/ יי׳/ י&gt;111 L-kskJkskJks A ds Lzds A ds TdsTdsGdsAdsGdsGjssTd me יד s Lzks 1 dsvJk</td><td> 57</td><td> 539</td>

<td> 785792</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> Τ^Τ^Ο^Τ^^^Τ^Α (ΐδΟ^Τ^Ο^Τ^ΤίοΑ() sTksG_dsGk</td><td> 36</td><td> 974</td>

<td> 785794</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCks^mCksAds^mCdsT _dsG_dsT_dsG_dsT_dsA_ds^mC_kme me me λ s Cds Lzks LzdsAk</td><td> 40</td><td> 937</td>

<td> 785824</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> /~י~/ י τ τ τ τ vJksvJks 1 ks '-'ds 1 ds 1 ds 1 dsGd_sAd_sGdsGdsTks^mC_esTksGesGk</td><td> 46</td><td> 538</td>

<td> 785825</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> me /~י~/ י τ τ CksvJksvJks 1 ds '-'ds 1 ds TdsTdsGdsAdsGdsGksTe ^me τ e s '-'ks¹ es'Jk</td><td> 56</td><td> 539</td>

<td> 785840</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> Tk_SGksTk_S^mCdsTd_SAds Gd_STdsGdsTd_S^mCdsAks TesGksGesAk</td><td> 57</td><td> 1340</td>

<td> 785841</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksTksGksTd_s^mCdsTdsA dsGdsTdsGdsTds^mCksAes TksGesGk</td><td> 16</td><td> 974</td>

<td> 785844</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> me me a me τ U Cks CksAks Cdslds^J dsTdsGdsTdsA_ds^mCds^mC ks^mCes^mCksAesT_k</td><td> 10</td><td> 936</td>

<td> 785845</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCkS^mCkSA_ds^mC_dsT d_SG_dsTd_SGd_STd_SA_ds^mCk me me me a s Ves '-'ks '-'esAk</td><td> 6</td><td> 937</td>

<td> 785871</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> me /~י τ τ CksvJksvJks 1 ds '-'ds 1 ds TdsTdsGdsAdsGdsGdsTk ^me τ e s '-׳esAks'-Je</td><td> 38</td><td> 539</td>

<td> 785880</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> Tk_STk_SGksTds^mCdsTd_SA dsGdsTdsGdsTds^mCdsAk sTesGksGe</td><td> 39</td><td> 974</td>

<td> 785882</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> A_ks^mCkS^mCkSA_ds^mCd_ST dsGdsTdsGdsTdsAds^mCd me me me a s '-'ks Ves Vks-Ae</td><td> 39</td><td> 937</td>

<td> 785912</td><td> 1559</td><td> 1574</td><td> 11124</td><td> 11139</td><td> GGTCTTTGAG GTCTGG</td><td> /~י~/ י T me τ τ τ 'Jks'Jks A ks '-'ds 1 ds A ds A dsGdsAd_SGdsGdsTd_S^mCk sTksGksGe</td><td> 33</td><td> 538</td>

<td> 785913</td><td> 1560</td><td> 1575</td><td> 11125</td><td> 11140</td><td> CGGTCTTTGA GGTCTG</td><td> me /~י τ τ CksvJksvJks 1 ds '-'ds 1 ds TdsTdsGdsAdsGdsGdsTk י~/ p־¹ s '-'ks 1 ks^Je</td><td> 32</td><td> 539</td>

<td> 785928</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> TksGksTks^mCdsTdsAds GdsTdsGdsTds^mCdsAds TksGksGksA_e</td><td> 39</td><td> 1340</td>

<td> 785929</td><td> N/A</td><td> N/A</td><td> 4367</td><td> 4382</td><td> TTGTCTAGTGT CATGG</td><td> TksTksGksTds^mCdsTdsA dsGdsTdsGdsTds^mCdsAk sTksGksGe</td><td> 20</td><td> 974</td>

<td> 785932</td><td> N/A</td><td> N/A</td><td> 5282</td><td> 5297</td><td> CCACTGTGTA CCCCAT</td><td> '-'ks '-'ksAks Cds 1 dsvJ dsTdsGdsTdsA_ds^mCds^mC ds^mCks^mCksAksTe</td><td> 57</td><td> 936</td>

<td> 785933</td><td> N/A</td><td> N/A</td><td> 5283</td><td> 5298</td><td> ACCACTGTGT ACCCCA</td><td> Aks^mCks^mCksAds^mCdsT dsGdsTdsGdsTdsAds^mCd a s '-'ks '-'ks '-'ks-^-e</td><td> 47</td><td> 937</td>

<td> 785938</td><td> N/A</td><td> N/A</td><td> 6548</td><td> 6563</td><td> CCAATTTTGC ATTCCA</td><td>^mCks^mCksAksAdsTdsTds TdsTdsGds^mCdsAdsTdST ks^mCks^mCksA_e</td><td> 75</td><td> 1242</td>

<td> 786572</td><td> N/A</td><td> N/A</td><td> 4358</td><td> 4373</td><td> GTCATGGAAT TTTGTG</td><td> GksTks^mCksAdsTdsGds GdsAdsAdsTdsTdsTdsTd sGksTksGk</td><td> 54</td><td> 1341</td>

<td> 786573</td><td> N/A</td><td> N/A</td><td> 4360</td><td> 4375</td><td> GTGTCATGGA ATTTTG</td><td> Gk_STk_SGksTd_S^mCdsAds Td_SGdsGdsAd_SAd_STd_STd sTksTk_SGk</td><td> 58</td><td> 1342</td>

<td> 786574</td><td> N/A</td><td> N/A</td><td> 4362</td><td> 4377</td><td> TAGTGTCATG GAATTT</td><td> Tk_SAk_SGksTd_SGd_STds^mCdsAdsTdsGdsGdsAdsA dsTksTksTk</td><td> 38</td><td> 1343</td>

<td> 786575</td><td> N/A</td><td> N/A</td><td> 4363</td><td> 4378</td><td> CTAGTGTCAT GGAATT</td><td> ™CksTksAksGdsTdsGds Tds^mCd_SAd_STd_SGdsGds AdsAksTksH</td><td> 34</td><td> 1344</td>

<td> 786576</td><td> N/A</td><td> N/A</td><td> 4364</td><td> 4379</td><td> TCTAGTGTCAT GGAAT</td><td> Tks^mCksTksAd_SGdsTd_SGdsTds^mCdsAdsTdsGds GdsAksAksTk</td><td> 14</td><td> 1345</td>

<td> 786577</td><td> N/A</td><td> N/A</td><td> 4365</td><td> 4380</td><td> GTCTAGTGTC ATGGAA</td><td> GksTk_S^mCksTdSAdSGds TdsGdsTdS^mCdsAdSTd_SGdsGksAksAk</td><td> 38</td><td> 1339</td>

<td> 786578</td><td> N/A</td><td> N/A</td><td> 4366</td><td> 4381</td><td> TGTCTAGTGTC ATGGA</td><td> Tk_SGksTk_S^mCdsTd_SAds Gd_STdsGdsTd_S^mCdsAds T dsGksGks Ak</td><td> 61</td><td> 1340</td>

<td> 786579</td><td> N/A</td><td> N/A</td><td> 4368</td><td> 4383</td><td> CTTGTCTAGTG TCATG</td><td> m/~1 τ τ /~י τ 111/^ '-'ks 1 ks 1 kskJds 1 ds '-'ds Td_sAd_sGdsTd_sGdsTds^mC_dsA_ksT_ksG_k</td><td> 58</td><td> 1346</td>

<td> 786580</td><td> N/A</td><td> N/A</td><td> 4369</td><td> 4384</td><td> TCTTGTCTAGT GTCAT</td><td> τ m/⁵״ τ τ /~י τ m 1 ks '-'ks 1 ks 1 dskJds 1 ds CdsTd_SAd_SGdsTd_SGdsTd _s^mCk_SAksTk</td><td> 0</td><td> 1347</td>

<td> 786581</td><td> N/A</td><td> N/A</td><td> 4370</td><td> 4385</td><td> TTCTTGTCTAG TGTCA</td><td> יד 'r יד יד יד τ 1 ks A ks '-'ks A ds A ds'Jds A ds^mCdsTdSAdSGdSTdsGd sTks^mCksA_k</td><td> 49</td><td> 1348</td>

<td> 786582</td><td> N/A</td><td> N/A</td><td> 4371</td><td> 4386</td><td> TTTCTTGTCTA GTGTC</td><td> יד יד יד יד יד 1 ks A ks A ks '-'ds A ds A ds'J d_STd_S^mCdsTd_SAd_SGdsTds ^/111 T י~/ kJks 1 ks '-'k</td><td> 53</td><td> 1349</td>

<td> 786583</td><td> N/A</td><td> N/A</td><td> 4372</td><td> 4387</td><td> CTTTCTTGTCT AGTGT</td><td> m/~1 τ τ τ 111/^ τ '-'ks 1 ks 1 ks 1 ds '-'ds 1 ds TdsGdsTd_S^mCdsTd_SAd_SGdsTksGksTk</td><td> 48</td><td> 1350</td>

<td> 786584</td><td> N/A</td><td> N/A</td><td> 4374</td><td> 4389</td><td> AGCTTTCTTGT CTAGT</td><td> m יד יד יד ^/111 י~/ λ A_ksUks '-'ks 1 ds 1 ds 1 ds יד יד י~/ יד יד Cds 1 ds 1 ds&lt;Jds 1 ds Cdsl d_SAk_SGk_STk</td><td> 20</td><td> 1351</td>

<td> 786585</td><td> N/A</td><td> N/A</td><td> 4376</td><td> 4391</td><td> TCAGCTTTCTT GTCTA</td><td> Tks^mCksAksGds^mCdsTds יד י~/ יד יד יד τ Idslds Cds 1 ds 1 ds&lt;Jds 1 ds^mCksTksAk</td><td> 15</td><td> 1352</td>

<td> 786586</td><td> N/A</td><td> N/A</td><td> 4378</td><td> 4393</td><td> CATCAGCTTTC TTGTC</td><td>^mCksAksTks^mCdsAdsGds m/~1 τ τ τ 111/^ τ '-'ds 1 ds 1 ds 1 ds '-'ds 1 ds יד י~/ יד 1 dskJks 1 ks '-'k</td><td> 28</td><td> 1353</td>

Example 3: Dose-dependent inhibition of human IRF5 by cEt gapmers

Modified oligonucleotides described in the studies above exhibiting significant in vitro inhibition of 5 IRF5 RNA were selected and tested at various doses in THP-1 cells, as well as in KARPAS-229 cells. Hie modified oligonucleotides were tested in a series of experiments that had similar culture conditions. Hie results for each experiment are presented in separate tables shown below.

Assay in THP-l cells

Cultured THP-l cells at a density of 30,000 cells per well were transfected using electroporation with modified oligonucleotides diluted to different concentrations as specified in the Tables below. After a treatment period of approximately 24 hours, IRF5 RNA levels were measured as previously described using the human 5 IRF5 primer-probe set HTS4167. IRF5 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent inhibition of IRF5, relative to untreated control cells. The half maximal inhibitory concentration (IC50) of each modified oligonucleotide is also presented. IC50 was calculated using a linear regression on a log/linear plot of the data in excel.

Table 28

Multi-dose assay of modified oligonucleotides in THP-l cells

<td rowspan="2"> Compound No.</td><td colspan="4"> /«Inhibition</td><td rowspan="2"> IC50 (pM)</td>

<td> 185.19 nM</td><td> 555.56 nM</td><td> 1666.67 nM</td><td> 5000.00 nM</td>

<td> 665795</td><td> 36</td><td> 57</td><td> 76</td><td> 85</td><td> 0.4</td>

<td> 665892</td><td> 40</td><td> 59</td><td> 74</td><td> 82</td><td> 0.3</td>

<td> 665893</td><td> 26</td><td> 53</td><td> 74</td><td> 83</td><td> 0.6</td>

<td> 665908</td><td> 19</td><td> 45</td><td> 57</td><td> 73</td><td> 1.1</td>

<td> 665933</td><td> 30</td><td> 38</td><td> 66</td><td> 79</td><td> 0.8</td>

<td> 728408</td><td> 19</td><td> 32</td><td> 55</td><td> 82</td><td> 1.1</td>

<td> 728458</td><td> 29</td><td> 45</td><td> 58</td><td> 80</td><td> 0.8</td>

<td> 728498</td><td> 24</td><td> 31</td><td> 61</td><td> 81</td><td> 1.0</td>

<td> 728670</td><td> 58</td><td> 51</td><td> 70</td><td> 79</td><td> 0.1</td>

<td> 728673</td><td> 25</td><td> 32</td><td> 51</td><td> 84</td><td> 1.1</td>

<td> 728695</td><td> 23</td><td> 54</td><td> 72</td><td> 80</td><td> 0.6</td>

<td> 728696</td><td> 38</td><td> 62</td><td> 73</td><td> 89</td><td> 0.3</td>

<td> 728705</td><td> 39</td><td> 57</td><td> 71</td><td> 82</td><td> 0.4</td>

<td> 728706</td><td> 35</td><td> 55</td><td> 72</td><td> 92</td><td> 0.4</td>

<td> 728707</td><td> 50</td><td> 64</td><td> 74</td><td> 85</td><td> 0.2</td>

<td> 728708</td><td> 53</td><td> 69</td><td> 86</td><td> 88</td><td> 0.1</td>

<td> 728806</td><td> 33</td><td> 47</td><td> 74</td><td> 87</td><td> 0.5</td>

Table 29

Multi-dose assay of modified oligonucleotides in THP-l cells

<td rowspan="2"> Compound No.</td><td colspan="4"> /«Inhibition</td><td rowspan="2"> IC50 (pM)</td>

<td> 185.19 nM</td><td> 555.5556 nM</td><td> 185.19 nM</td><td> 5000.0 nM</td>

<td> 665893</td><td> 25</td><td> 50</td><td> 64</td><td> 81</td><td> 0.7</td>

<td> 665933</td><td> 18</td><td> 30</td><td> 67</td><td> 69</td><td> 1.2</td>

<td> 728739</td><td> 14</td><td> 26</td><td> 55</td><td> 58</td><td> 2.2</td>

<td> 728741</td><td> 13</td><td> 35</td><td> 65</td><td> 82</td><td> 1.0</td>

<td> 728759</td><td> 40</td><td> 49</td><td> 49</td><td> 68</td><td> 0.8</td>

<td> 728778</td><td> 10</td><td> 32</td><td> 46</td><td> 79</td><td> 1.5</td>

<td> 728793</td><td> 10</td><td> 21</td><td> 39</td><td> 68</td><td> 2.4</td>

<td> 728800</td><td> 23</td><td> 39</td><td> 62</td><td> 68</td><td> 1.1</td>

<td> 728802</td><td> 20</td><td> 35</td><td> 34</td><td> 65</td><td> 2.5</td>

<td> 728887</td><td> 8</td><td> 34</td><td> 60</td><td> 72</td><td> 1.4</td>

<td> 728891</td><td> 43</td><td> 23</td><td> 50</td><td> 74</td><td> 1.2</td>

<td> 728893</td><td> 9</td><td> 28</td><td> 45</td><td> 74</td><td> 1.7</td>

<td> 728894</td><td> 20</td><td> 42</td><td> 68</td><td> 85</td><td> 0.8</td>

<td> 728898</td><td> 16</td><td> 41</td><td> 69</td><td> 86</td><td> 0.8</td>

<td> 728899</td><td> 10</td><td> 34</td><td> 65</td><td> 79</td><td> 1.1</td>

<td> 728905</td><td> 21</td><td> 31</td><td> 57</td><td> 77</td><td> 1.2</td>

<td> 728944</td><td> 15</td><td> 21</td><td> 71</td><td> 79</td><td> 1.1</td>

<td> 728954</td><td> 7</td><td> 21</td><td> 60</td><td> 82</td><td> 1.3</td>

<td> 728970</td><td> 30</td><td> 50</td><td> 78</td><td> 85</td><td> 0.5</td>

Table 30

Multi-dose assay of modified oligonucleotides in THP-1 cells

<td rowspan="2"> Compound No.</td><td colspan="4"> /«Inhibition</td><td rowspan="2"> IC50 (hM)</td>

<td> 185.19 nM</td><td> 555.56 nM</td><td> 1666.67 nM</td><td> 5000.00 nM</td>

<td> 665893</td><td> 38</td><td> 59</td><td> 72</td><td> 83</td><td> 0.4</td>

<td> 665933</td><td> 13</td><td> 39</td><td> 52</td><td> 71</td><td> 1.4</td>

<td> 666168</td><td> 29</td><td> 30</td><td> 60</td><td> 82</td><td> 0.9</td>

<td> 728958</td><td> 30</td><td> 43</td><td> 68</td><td> 83</td><td> 0.7</td>

<td> 728969</td><td> 30</td><td> 55</td><td> 81</td><td> 89</td><td> 0.5</td>

<td> 728996</td><td> 36</td><td> 57</td><td> 73</td><td> 84</td><td> 0.4</td>

<td> 728998</td><td> 27</td><td> 56</td><td> 73</td><td> 85</td><td> 0.5</td>

<td></td><td> 0</td><td> H</td><td> 0</td><td> 85</td><td></td>

<td> 729037</td><td> 58</td><td> 64</td><td> 86</td><td> 94</td><td> 0.1</td>

<td> 729038</td><td> 41</td><td> 65</td><td> 89</td><td> 92</td><td> 0.3</td>

<td> 729039</td><td> 40</td><td> 50</td><td> 77</td><td> 90</td><td> 0.39</td>

<td> 729049</td><td> 35</td><td> 57</td><td> 76</td><td> 85</td><td> 0.4</td>

<td> 729050</td><td> 21</td><td> 52</td><td> 75</td><td> 90</td><td> 0.6</td>

<td> 729205</td><td> 23</td><td> 42</td><td> 73</td><td> 84</td><td> 0.7</td>

<td> 729206</td><td> 11</td><td> 40</td><td> 54</td><td> 73</td><td> 1.3</td>

<td> 729433</td><td> 25</td><td> 41</td><td> 65</td><td> 86</td><td> 0.8</td>

<td> 729453</td><td> 16</td><td> 43</td><td> 61</td><td> 80</td><td> 1.0</td>

<td> 729454</td><td> 31</td><td> 40</td><td> 69</td><td> 87</td><td> 0.7</td>

<td> 729456</td><td> 11</td><td> 38</td><td> 63</td><td> 80</td><td> 1.1</td>

Table 31

Multi-dose assay of modified oligonucleotides in THP-1 cells

<td rowspan="2"> Compound No.</td><td colspan="4"> /«Inhibition</td><td rowspan="2"> IC50 (μΜ)</td>

<td> 185.19 nM</td><td> 555.56 nM</td><td> 1666.67 nM</td><td> 5000.00 nM</td>

<td> 665893</td><td> 24</td><td> 53</td><td> 74</td><td> 86</td><td> 0.6</td>

<td> 665933</td><td> 13</td><td> 36</td><td> 58</td><td> 71</td><td> 1.3</td>

<td> 666178</td><td> 29</td><td> 46</td><td> 65</td><td> 82</td><td> 0.7</td>

<td> 666208</td><td> 0</td><td> 24</td><td> 50</td><td> 73</td><td> 1.8</td>

<td> 729201</td><td> 18</td><td> 35</td><td> 49</td><td> 73</td><td> 1.4</td>

<td> 729207</td><td> 12</td><td> 34</td><td> 60</td><td> 84</td><td> 1.1</td>

<td> 729213</td><td> 19</td><td> 47</td><td> 70</td><td> 85</td><td> 0.7</td>