Antibodies binding preferentially human csf1r extracellular domain 4 and their use

ANTIBODIES BINDING PREFERENTIALLY HUMAN CSF1R EXTRACELLULAR DOMAIN 4 AND THEIR USE

The present invention relates to antibodies against human CSF-IR (anti-CSF־lR antibodies), methods for their production, pharmaceutical compositions containing said antibodies, and uses thereof.

Background of the Invention

The human CSF-l receptor (CSF-IR; colony stimulating factor 1 receptor; synonyms: M-CSF receptor; Macrophage colony-stimulating factor 1 receptor, Fms proto-oncogene, c-fins, SEQ ID NO: 62) is known since 1986 (Coussens, L., et al., Nature 320 (1986) 277-280). CSF-lRis a growth factor and encoded by the c-fins proto-oncogcnc (reviewed e.g. in Roth, P., and Stanley, E.R., Curr. Top. Microbiol. Immunol. 181 (1992) 141-67).

CSF-IR is the receptor for CSF-l (colony stimulating factor 1, also called M-CSF, macrophage colony-stimulating factor) and mediates the biological effects of this cytokine (Sherr, C.J., et al., Cell 41 (1985) 665-676). The cloning of the colony stimulating factor-1 receptor (CSF-IR) (also called c-fms) was described for the first time in Roussel, M.F., et al., Nature 325 (1987) 549-552. In that publication, it was shown that CSF-IR had transforming potential dependent on changes in the Cterminal tail of the protein including the loss of the inhibitory tyrosine 969 phosphorylation which binds Cbl and thereby regulates receptor down regulation (Lee, P.S., et al., Embo J. 18 (1999) 3616-3628). Recently a second ligand for CSF-IR termed interleukin-34 (IL-34) was identified (Lin, H., et al, Science 320 (2008) 807-811).

The cytokine CSF-l (colony stimulating factor 1, also called M-CSF, macrophage) is found extracellularly as a disulfide-linked homodimer (Stanley, E.R. et al., Journal of Cellular Biochemistry 21 (1983) 151-159; Stanley, E.R. et al., Stem Cells 12 Suppl. 1 (1995) 15-24).

The main biological effects of CSF-IR signaling are the differentiation, proliferation, migration, and survival of hematopoietic precursor cells to the macrophage lineage (including osteoclast). Activation ofCSF-lR is mediated by its ligands, CSF-l (M-CSF) and IL-34. Binding of CSF-l (M-CSF) to CSF-IR induces the formation of homodimers and activation of the kinase by tyrosine phosphorylation (Li, W. ct al, EMBO Journal. 10 (1991) 277-288; Stanley, E.R., et al. Mol. Reprod. Dev. 46 (1997) 4-10).

The biologically active homodimcr CSF-1 binds to the CSF-1R within the subdomains DI to D3 of the extracellular domain of the CSF-1 receptor (CSF-1 RECD). The CSF-1R-ECD comprises five immunoglobulin-like subdomains (designated DI to D5). The subdomains D4 to D5 of the extracellular domain (CSFlR-ECD)are not involved in the CSF-1 binding. (Wang, Z., et al Molecular and Cellular Biology 13 (1993) 5348-5359). The subdomain D4 is involved in dimerization (Yeung, Y-G., ct al Molecular & Cellular Proteomics 2 (2003) 11431155; Pixley, F. J., et al., Trends Cell Biol 14 (2004) 628-638).

Further signaling is mediated by the p85 subunit of PI3K and Grb2 connecting to the P13K/AKT and Ras/MAPK pathways, respectively. These two important signaling pathways can regulate proliferation, survival and apoptosis. Other signaling molecules that bind the phosphorylated intracellular domain of CSF-1 R include STAT1, STAT3, PLCy, and Cbl (Bourette, R.P. and Rohrschncider, L.R., Growth Factors 17 (2000) 155-166).

CSF-1R signaling has a physiological role in immune responses, in bone remodeling and in the reproductive system. The knockout animals for either CSF-1 (Pollard, J.W., Mol. Reprod. Dev. 46 (1997) 54-61) or CSF-1 R (Dai, X.M., et al., Blood 99 (2002) 111-120) have been shown to have osteopetrotic, hematopoietic, tissue macrophage, and reproductive phenotypes consistent with a role for CSF-1R in the respective cell types.

Sherr, C.J., et al., Blood 73 (1989) 1786-1793 relates to some antibodies against CSF-IRthat inhibit the CSF-1 activity (see Sherr, C.J. et al., Blood 73 (1989) 1786-1793). Ashmun, R.A., et al., Blood 73 (1989) 827-837 relates to CSF-1R antibodies. Lenda, D., etal., Journal of Immunology 170 (2003) 3254-3262 relates to reduced macrophage recruitment, proliferation, and activation in CSF deficient mice results in decreased tubular apoptosis during renal inflammation. Kitaura, H., et al., Journal of Dental Research 87 (2008) 396-400 refers to an anti-CSF-1 antibody which inhibits orthodontic tooth movement. WO 2001/030381 mentions CSF-1 activity inhibitors including antisense nucleotides and antibodies while disclosing only CSF-1 antisense nucleotides. WO 2004/045532 relates to metastases and bone loss prevention and treatment of metastatic cancer by a CSF-1 antagonist disclosing as antagonist anti-CSF antibodies only. WO 2005/046657 relates to the treatment of inflammatory bowel disease by anti-CSF antibodies. US 2002/0141994 relates to inhibitors of colony stimulating factors. WO 2006/096489 relates to the treatment of rheumatoid arthritis by anti-CSF-1antibodies. WO 2009/026303 and WO 2009/112245 relate to certain anti-CSF-1 R antibodies binding to CSF-1R within the first three subdomains (DI to D3) of the Extracellular Domain (CSF-1R-ECD).

Summary of the Invention

The invention comprises an antibody binding to human CSF-1R, characterized in that the antibody binds to human CSF-1R fragment dclD4 (SEQ ID NO: 65) and to human CSF-1R Extracellular Domain (SEQ ID NO: 64) with a ratio of 1:50 or lower.

The invention further comprises an antibody according to the invention characterized in that

a) the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain is SEQ ID NO:15 and the light chain variable domain is SEQ ID NO: 16;

c) the heavy chain variable domain is SEQ ID NO:75 and the light chain variable domain is SEQ ID NO:76;

d) the heavy chain variable domain is SEQ ID NO:83 and the light chain variable domain is SEQ ID NO:84;

or a humanized version thereof.

The invention further comprises an antibody according to the invention characterized in that

a) the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain is SEQ ID NOHS and the light chain variable domain is SEQ ID NO:16;

or a humanized version thereof.

In one embodiment the antibody according to the invention is characterized in that

a) the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO:24, or

b) the heavy chain variable domain is SEQ ID NO:31 and the light chain variable domain is SEQ ID NO :32, or

c) the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO :40, or

d) the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48, or

e) the heavy chain variable domain is SEQ ID NO:55 and the light chain variable domain is SEQ ID NO:56.

The invention further comprises an antibody according to the invention, characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 15 1, a CDR2 region of SEQ ID NO: 2, and a CDR1 region of SEQ ID NO:3, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 4, a CDR2 region of SEQ ID NO:5, and a CDRI region of SEQ ID NO:6, or

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID 20 NO: 9, a CDR2 region of SEQ ID NO: 10, and a CDRI region of SEQ ID

NO: 11, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:12, a CDR2 region of SEQ ID NO: 13, and a CDRI region of SEQ ID NO: 14, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25 17, a CDR2 region of SEQ ID NO: 18, and a CDRI region of SEQ ID

NO: 19, and the light chain variable domain comprises a CDRI region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDRI region of SEQ IDNO:22, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID 30 NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDRI region of SEQ ID

NO: 27, and the light chain variable domain comprises a CDR3 region of

־5־

SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of

SEQ ID NO: 30, or

e) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID

NO: 35, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38, or

f) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID

NO:43, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ ID NO:46, or

g) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDR1 region of SEQ ID

NO: 51, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:52, a CDR2 region of SEQ ID NO: 53, and a CDR1 region of SEQ ID NO: 54; or

h) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:69, a CDR2 region of SEQ ID NO: 70, and a CDR1 region of SEQ ID

NO:71, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO: 72, a CDR2 region of SEQ ID NO:73, and a CDR1 region of SEQ ID NO:74, or

i) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 77, a CDR2 region of SEQ ID NO: 78, and a CDR1 region of SEQ ID

NO: 79, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:80, a CDR2 region of SEQ ID NO: 81, and a CDR1 region of SEQ ID NO: 82.

Preferably the antibody according to the invention is of human IgGl subclass or of human IgG4 subclass.

A further embodiment of the invention is a pharmaceutical composition comprising an antibody according to the invention.

The invention further comprises the use an of an antibody according to the invention for the manufacture of a medicament for treatment of a CSF-1R mediated disease.

The invention further comprises the use an of an antibody according to the invention for the manufacture of a medicament for treatment of cancer.

The invention further comprises the use an of an antibody according to the invention for the manufacture of a medicament for treatment of bone loss.

The invention further comprises the use an of an antibody according to the invention for the manufacture of a medicament for treatment of metastasis.

The invention further comprises the use an of an antibody according to the invention for the manufacture of a medicament for treatment of inflammatory diseases.

The invention further comprises an antibody according to the invention for treatment of a CSF-1 R mediated disease.

The invention further comprises an antibody according to the invention for treatment of cancer.

The invention further comprises an antibody according to the invention for treatment of bone loss.

The invention further comprises an antibody according to the invention for treatment of metastasis.

The invention further comprises an antibody according to the invention for treatment of inflammatory diseases.

A further embodiment of the invention is a nucleic acid encoding an antibody according to the invention characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 1, a CDR2 region of SEQ ID NO: 2, and a CDR1 region of SEQ ID NO:3, and the light chain variable domain comprises a CDR3 region of SEQ ID

NO: 4, a CDR2 region of SEQ ID NO:5, and a CDR1 region of SEQ ID

NO:6, or,

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 9, a CDR2 region of SEQ ID NO: 10, and a CDR1 region of SEQ ID NO: 11, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 12, a CDR2 region of SEQ ID NO: 13, and a CDR1 region of SEQ ID NO: 14, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDR1 region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO; 20, a CDR2 region of SEQ ID NO:21, and a CDR1 region of SEQ IDNO:22, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDR1 region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of SEQ ID NO: 30, or

e) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38, or

f) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ 1DNO:46, or

g) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDR1 region of SEQ ID NO: 51, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:52, a CDR2 region of SEQ ID NO: 53, and a CDR1 region of

SEQ ID NO: 54, or

h) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:69, a CDR2 region of SEQ ID NO: 70, and a CDR1 region of SEQ ID NO:71, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 72, a CDR2 region of SEQ ID NO:73, and a CDR1 region of SEQ 1DNO:74, or

i) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 77, a CDR2 region of SEQ ID NO: 78, and a CDR1 region of SEQ ID NO: 79, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:80, a CDR2 region of SEQ ID NO: 81, and a CDR1 region of SEQ ID NO: 82.

A further embodiment of the invention is a nucleic acid encoding an antibody according to the invention characterized in that

a) the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain is SEQ ID NO: 15 and the light chain variable domain is SEQ ID NO: 16;

c) the heavy chain variable domain is SEQ ID NO:75 and the light chain variable domain is SEQ ID NO:76;

d) the heavy chain variable domain is SEQ ID NO:83 and the light chain variable domain is SEQ ID NO:84;

or a humanized version thereof.

A further embodiment of the invention is a nucleic acid encoding an antibody according to the invention characterized in that

a) the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO:24, or

b) the heavy chain variable domain is SEQ ID NO:31 and the light chain variable domain is SEQ ID NO:32, or

c) the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO:40, or

d) the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48, or

e) the heavy chain variable domain is SEQ ID NO:55 and the light chain variable domain is SEQ ID NO:56.

The invention further provides expression vectors containing nucleic acid according to the invention capable of expressing said nucleic acid in a prokaryotic or eukaryotic host cell, and host cells containing such vectors for the recombinant production of an antibody according to the invention.

The invention further comprises a prokaryotic or eukaryotic host cell comprising a vector according to the invention.

The invention further comprises a method for the production of a recombinant human or humanized antibody according to the invention, characterized by expressing a nucleic acid according to the invention in a prokaryotic or eukaryotic host cell and recovering said antibody from said cell or the cell culture supernatant. The invention further comprises the antibody obtained by such a recombinant method.

Antibodies according to the invention show benefits for patients in need of a CSF-IR targeting therapy. The antibodies according to the invention show efficient antiproliferative activity against Ligand-indcpcndcnt and ligand-dependant proliferation and arc therefore especially useful in the treatment of cancer and metastasis.

The invention further provides a method for treating a patient suffering from cancer, comprising administering to a patient diagnosed as having such a disease (and therefore being in need of such a therapy) an effective amount of an antibody according to the invention. The antibody is administered preferably in a pharmaceutical composition.

A further embodiment of the invention is a method for the treatment of a patient suffering from cancer characterized by administering to the patient an antibody according to the invention.

Surprisingly it has been found that, using a human CSF-1R fragment delD4 in which the D4 subdomain of human CSF-1R-ECD was deleted (SEQ ID NO:65), the new anti-CSF-lR antibodies according to the invention could be selected. These antibodies show valuable properties like excellent ligand-dependant cell growth inhibition and at the same time ligand independent cell growth inhibition of NIH 3T3 cell, rctrovirally infected with either an expression vector for full-length wildtypc CSF-1R (SEQ ID NO:62) or mutant CSF-1R L301S Y969F (SEQ ID NO:63) whereby mutant CSF-1R recombinant cells are able to form spheroids independent of the CSF-1 ligand. Furthermore the antibodies according to the invention inhibit (both) human and cynomolgous macrophage differentiation, as they inhibit survival of human and cynomolgous monocytes.

Detailed Description of the Invention

The invention comprises an antibody binding to human CSF-1R, characterized in that the antibody binds to human CSF-1 R fragment delD4 (comprising the extracellular subdomains DI -D3 and D5) (SEQ ID NO: 65) and to human CSF-1R Extracellular Domain (CSF-1R-ECD) (comprising the extracellular subdomains DI -D5) (SEQ ID NO: 64) with a ratio of 1:50 or lower.

The invention further comprises an antibody according to the invention characterized in comprising as heavy chain variable domain CDR3 region a CDR3 region of SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO:23, SEQ ID NO:31, SEQ ID NO:39, SEQ ID NO:47 or SEQ ID NO:55.

The invention further comprises an antibody according to the invention characterized in that

a) the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain is SEQ ID NO: 15 and the light chain variable domain is SEQ ID NO: 16;

or a humanized version thereof.

The invention further comprises an antibody according to the invention characterized in that

a) the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain variable domain is SEQ ID NO: 16;

c) the heavy chain variable domain variable domain is SEQ ID NO:76;

d) the heavy chain variable domain variable domain is SEQ ID NO:84;

is SEQ ID NO: 15 and the light chain is SEQ ID NO:75 and the light chain is SEQ ID NO:83 and the light chain or a humanized version thereof.

The invention further comprises an antibody according to the invention characterized in that the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8, or a humanized version thereof.

In one embodiment the antibody according to the invention is characterized in that

a) the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO :24, or

b) the heavy chain variable domain is SEQ ID NO:31 and the light chain variable domain is SEQ ID NO :32, or

c) the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO:40, or

d) the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48, or

e) the heavy chain variable domain is SEQ ID NO:55 and the light chain variable domain is SEQ ID NO:56.

In one embodiment the antibody according to the invention is characterized in that

a) the heavy chain variable domain is variable domain is SEQ ID NO :24, or b) the heavy chain variable domain is variable domain is SEQ ID NO:32, or c) the heavy chain variable domain is variable domain is SEQ ID NO:40, or d) the heavy chain variable domain is variable domain is SEQ ID NO:48.

SEQ ID NO:23 and the light chain

SEQ ID NO:31 and the light chain

SEQ ID NO:39 and the light chain

SEQ ID NO:47 and the light chain

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO:24, or

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain is SEQ ID NO:31 and the Light chain variable domain is SEQ ID NO:32.

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO:40.

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48.

The invention further comprises an antibody according to the invention characterized in that the heavy chain variable domain is SEQ ID NO: 15 and the light chain variable domain is SEQ ID NO: 16, or a humanized version thereof.

The invention further comprises an antibody according to the invention characterized tn that the heavy chain variable domain is SEQ ID NO:75 and the light chain variable domain is SEQ ID NO:76;

or a humanized version thereof.

The invention further comprises an antibody according to the invention characterized in that the heavy chain variable domain is SEQ ID NO:83 and the light chain variable domain is SEQ ID NO :84;

or a humanized version thereof.

The invention further comprises an antibody according to the invention, characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:1, a CDR2 region of SEQ ID NO: 2, and a CDR1 region of SEQ ID NO:3, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 4, a CDR2 region of SEQ ID NO:5, and a CDR1 region of SEQ ID NO:6, or,

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 9, a CDR2 region of SEQ ID NO: 10, and a CDR1 region of SEQ ID NO: 11, and the light chain variable domain comprises a CDR3 region of SEQ 1DNO:12, a CDR2 region of SEQ ID NO: 13, and a CDR1 region of SEQ ID NO: 14, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDR1 region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDR1 region of SEQ IDNO:22, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDR1 region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of SEQ ID NO: 30, or

e) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38, or

f) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO;41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of

SEQ ID NO:46, or

g) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDRI region of SEQ ID NO: 51, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:52, a CDR2 region of SEQ ID NO: 53, and a CDRI region of SEQ ID NO: 54.

The invention further comprises an antibody according to the invention, characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:1, a CDR2 region of SEQ ID NO: 2, and a CDRI region of SEQ ID NO:3, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 4, a CDR2 region of SEQ ID NO:5, and a CDRI region of SEQ ID NO:6, or,

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 9, a CDR2 region of SEQ ID NO: 10, and a CDRI region of SEQ ID NO: 11, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:12, a CDR2 region of SEQ ID NO: 13, and a CDRI region of SEQ ID NO: 14, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDRI region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDRI region of SEQ ID NO:22, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDRI region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ IDNO:28, a CDR2 region of SEQ ID NO: 29, and a CDRI region of SEQ ID NO: 30, or

e) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDRI region of SEQ ID ו NO: 35, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of

SEQ ID NO; 38, or

f) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ ID NO:46,

g) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDR1 region of SEQ ID NO: 51, and the light chain variable domain comprises a CDR3 region of SEQ ID NO;52, a CDR2 region of SEQ ID NO: 53, and a CDR1 region of SEQ ID NO: 54;

h) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:69, a CDR2 region of SEQ ID NO: 70, and a CDR1 region of SEQ ID NO:71, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 72, a CDR2 region of SEQ ID NO:73, and a CDR1 region of SEQ ID NO:74, or

i) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 77, a CDR2 region of SEQ ID NO: 78, and a CDR1 region of SEQ ID NO: 79, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:80, a CDR2 region of SEQ ID NO: 81, and a CDR1 region of SEQ ID NO: 82.

In one embodiment the antibody according to the invention is characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:69, a CDR2 region of SEQ ID NO: 70, and a CDR1 region of SEQ ID NO:71, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 72, a CDR2 region of SEQ ID NO:73, and a CDR1 region of SEQ ID NO:74, or

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 77, a CDR2 region of SEQ ID NO: 78, and a CDR1 region of SEQ ID

NO; 79, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:80, a CDR2 region of SEQ ID NO: 81, and a CDR1 region of

SEQ ID NO. 82.

In one embodiment the antibody according to the invention is characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO; 17, a CDR2 region of SEQ ID NO: 18, and a CDR1 region of SEQ ID NO; 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDR1 region of SEQ IDNO:22, or

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDR1 region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of SEQ ID NO: 30, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO; 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ ID NO:46, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDR1 region of SEQ ID NO: 51, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:52, a CDR2 region of SEQ ID NO: 53, and a CDR1 region of SEQ ID NO: 54.

In one embodiment the antibody according to the invention is characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:

17, a CDR2 region of SEQ ID NO: 18, and a CDRI region of SEQ ID

NO: 19, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDRI region of

SEQ ID NO:22, or

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDRI region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDRI region of SEQ ID NO: 30, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDRI region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDRI region of SEQ ID NO: 38, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDRI region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDRI region of SEQ 1DNO:46.

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDRI region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDRI region of SEQ IDNO:22.

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDRI region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of

SEQ ID NO: 30.

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38.

In one embodiment the antibody according to the invention is characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ1DNO:46.

In one embodiment the antibody binding to human CSF-1R, characterized in that the antibody binds to human CSF-1R fragment delD4 (SEQ ID NO: 65) and to human CSF-1R-ECD (SEQ ID NO: 64) with a ratio of 1:50 or lower, is further characterized in not binding to human CSF-1 R fragment D1-D3 (SEQ ID NO: 66).

The term antibody encompasses the various forms of antibodies including but not being limited to whole antibodies, antibody fragments, human antibodies, humanized antibodies, chimeric antibodies, T cell epitope depleted antibodies, and further genetically engineered antibodies as long as the characteristic properties according to the invention are retained. “Antibody fragments” comprise a portion of a full length antibody, preferably the variable domain thereof, or at least the antigen binding site thereof. Examples of antibody fragments include diabodies, single-chain antibody molecules, and multispecific antibodies formed from antibody fragments. scFv antibodies are, e.g., described in Houston, J.S., Methods in Enzymol. 203 (1991) 46-88). In addition, antibody fragments comprise single chain polypeptides having the characteristics of a Vh domain binding to CSF-1R, namely being able to assemble together with a VL domain, or of a VL domain Φ

binding to CSF-1R, namely being able to assemble together with a V!! domain to a functional antigen binding site and thereby providing the property.

The terms monoclonal antibody or monoclonal antibody composition as used herein refer to a preparation of antibody molecules of a single amino acid composition.

The term chimeric antibody refers to a monoclonal antibody comprising a variable region, i.e., binding region, from mouse and at least a portion of a constant region derived from a different source or species, usually prepared by recombinant DNA techniques. Chimeric antibodies comprising a mouse variable region and a human constant region arc especially preferred. Such rat/human chimeric antibodies are the product of expressed immunoglobulin genes comprising DNA segments encoding rat immunoglobulin variable regions and DNA segments encoding human immunoglobulin constant regions. Other forms of chimeric antibodies encompassed by the present invention arc those in which the class or subclass has been modified or changed from that of the original antibody. Such chimeric antibodies are also referred to as class-switched antibodies. Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques now well known in the art. See, e.g., Morrison, S.L., et al., Proc. Natl. Acad Sci. USA 81 (1984) 6851-6855; US 5,202,238 and US 5,204,244.

The term humanized antibody refers to antibodies in which the framework or complementarity determining regions (CDR) have been modified to comprise the CDR of an immunoglobulin of different specificity as compared to that of the parent immunoglobulin. In a preferred embodiment, a murine CDR is grafted into the framework region of a human antibody to prepare the humanized antibody. See e.g. Ricchmann, L.} et al., Nature 332 (1988) 323-327; and Neuberger, M.S., et al., Nature 314 (1985) 268-270. Optionally the framework region can be modified by further mutations. Also the CDRs can be modified by one or more mutations to generate antibodies according to the invention e.g. by mutagenesis based upon molecular modeling as described by Ricchmann, L., ct al., Nature 332 (1988) 323־ 327 and Queen, C״ ct al., Proc. Natl. Acad. Sci. USA 86 (1989) 10029-10033, or others. Particularly preferred CDRs correspond to those representing sequences recognizing the antigens noted above for chimeric antibodies. A “humanized version of an antibody according to the invention” (which is e.g. of mouse origin) refers to an antibody, which is based on the mouse antibody sequences in which the Vh and Vl are humanized by standard techniques (including CDR grafting and optionally subsequent mutagenesis of certain amino acids in the framework region and the CDRs ). Preferably such humanized version is chimcrizcd with a human constant region (see e.g. Sequences SEQ ID NO:57-61).

Other forms of humanized antibodies encompassed by the present invention are those in which the constant region has been additionally modified or changed from that of the original antibody to generate the properties according to the invention, especially in regard to Clq binding and/or Fc receptor (FcR) binding.

In the following examples the terms “Mab” or “muMab” refer to murine monoclonal antibodies such as Mab 2F11 or Mab 2E10, whereas the term “hMab” refers to humanized monoclonal versions of such murine antibodies such as hMab 2F11-cll, hMab 2F1 l-d8, hMab 2F1 l-e7, hMab 2F1 l-fl2, etc.

The term human antibody, as used herein, is intended to include antibodies having variable and constant regions derived from human germ line immunoglobulin sequences. Human antibodies are well-known in the state of the art (van Dijk, M.A., and van de Winkel, J.G., Curr. Opin. Chcm. Biol. 5 (2001) 368-374). Human antibodies can also be produced in transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire or a selection of human antibodies in the absence of endogenous immunoglobulin production. Transfer of the human germ-line immunoglobulin gene array in such germ-line mutant mice will result in the production of human antibodies upon antigen challenge (sec, e.g., Jakobovits, A., ct al., Proc. Natl. Acad. Sci. USA 90 (1993) 2551-2555; Jakobovits, A., ct al., Nature 362 (1993) 255-258; Brueggemann, M., et al., Year Immunol. 7 (1993) 33-40). Human antibodies can also be produced in phage display libraries (Hoogenboom, H.R., and Winter, G.J. Mol. Biol. 227 (1992) 381-388; Marks, J.D., et al., J. Mol. Biol. 222 (1991) 581597). The techniques of Cole, et al., and Boemer, et al., are also available for the preparation of human monoclonal antibodies (Cole, S.P.C., ct al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); and Boemer, P., ct al., J. Immunol. 147 (1991) 86-95). As already mentioned for chimeric and humanized antibodies according to the invention the term “human antibody” as used herein Φ

- וגalso comprises such antibodies which are modified in the constant region !ס

generate the properties according to the invention, especially in regard to Clq binding and/or FcR binding, e.g. by “class switching” i.e. change or mutation of Fc parts (e.g. from IgGl to IgG4 and/or lgGl/IgG4 mutation).

The term recombinant human antibody, as used herein, is intended to include all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from a host cell such as a NS0 or CHO cell or from an animal (e.g. a mouse) that is transgenic for human immunoglobulin genes or antibodies expressed using a recombinant expression vector transfected into a host cell. Such recombinant human antibodies have variable and constant regions in a rearranged form. The recombinant human antibodies according to the invention have been subjected to in vivo somatic hypermutation. Thus, the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germ line VH and VL sequences, may not naturally exist within the human antibody germ line repertoire in vivo.

The antibodies according to the invention include, in addition, such antibodies having conservative sequence modifications”, nucleotide and amino acid sequence modifications which do not affect or alter the above-mentioned characteristics of the antibody according to the invention. Modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCRmediated mutagenesis. Conservative amino acid substitutions include ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isolcucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in a human anti-CSF-lR antibody can be preferably replaced with another amino acid residue from the same side chain family.

Amino acid substitutions can be performed by mutagenesis based upon molecular modeling as described by Riechmann, L., et al., Nature 332 (1988) 323-327 and

Queen, C., ct al., Proc. Natl. Acad. Sci. USA 86 (1989) 10029-10033.

The human CSF-1R (CSF-1 receptor; synonyms: M-CSF receptor; Macrophage colony-stimulating factor 1 receptor, Fms proto-oncogene, c-frns, SEQ ID NO: 22)) is known since 1986 (Coussens, L., ct al., Nature 320 (1986) 277-280). CSF-1 R is a growth factor and encoded by the c-fms proto-oncogene (reviewed e.g. in Roth, P. and Stanley, E.R., Curr. Top. Microbiol. Immunol. 181 (1992) 141-67).

CSF-1 R is the receptor for CSF-1 (macrophage colony stimulating factor, also called M-CSF) and IL-34 and mediates the biological effects of these cytokines (Sherr, C.J., et al., Cell 4] (1985) 665-676 (Lin, et al., Science 320 (2008) 807811). The cloning of the colony stimulating factor-1 receptor (also called c-ftns) was described for the first time in Roussel, M.F., et al., Nature 325 (1987) 549-552. In that publication, it was shown that CSF-1 R had transforming potential dependent on changes in the C-terminal tail of the protein including the loss of the inhibitory tyrosine 969 phosphorylation which binds Cbl and thereby regulates receptor down regulation (Lee, P.S., et al., Embo J. 18 (1999) 3616-3628).

CSF-1 R is a single chain, transmembrane receptor tyrosine kinase (RTK) and a member of the family of immunoglobulin (1g) motif containing RTKs characterized by 5 repeated Ig-like subdomains D1-D5 in the extracellular domain (ECD) of the receptor (Wang, Z., ct al Molecular and Cellular Biology 13 (1993) 5348-5359). The human CSF-1R Extracellular Domain (CSF-1R-ECD) (SEQ ID NO: 64) comprises all five extracellular Ig-like subdomains DI -D5. The human CSF-1 R fragment delD4 (SEQ ID NO: 65) comprises the extracellular Ig-like subdomains D1-D3 and D5, but is missing the D4 subdomain. The human CSF-1 R fragment D1-D3 (SEQ ID NO: 66) comprises the respective subdomains D1-D3. The sequences are listed without the signal peptide MGSGPGVLLL LLVATAWHGQ G (SEQ ID NO: 67).

The intracellular protein tyrosine kinase domain is interrupted by a unique insert domain that is also present in the other related RTK class III family members that include the platelet derived growth factor receptors (PDGFR), stem cell growth factor receptor (c-K.it) and fins-like cytokine receptor (FLT3). In spite of the ־ 23 structural homology among this family of growth factor receptors, they have distinct tissue-specific functions.

CSF-1R is mainly expressed on cells of the monocytic lineage and in the female reproductive tract and placenta. In addition expression of CSF-1R has been reported in Langerhans cells in skin, a subset of smooth muscle cells (Inaba, T., et al., J. Biol. Chern. 267 (1992) 5693-5699), B cells (Baker, A.H., et al., Oncogene 8 (1993) 371-378) and microglia (Sawada, M., et al., Brain Res. 509 (1990) 119124). Cells with mutant human CSF-1R ((SEQ ID NO: 23) are known to proliferate independently of ligand stimulation.

As used herein, binding to human CSF-1R” or specifically binding to human CSF-1R” refers to an antibody specifically binding to the human CSF-1R antigen with a binding affinity of KD-valuc of 1.0 χ 10'8 mol/1 or lower at 35°C, in one embodiment of a KD-value of 1.0 xlO'9 moFl or lower at 35°C. The binding affinity is determined with a standard binding assay at 35°C, such as surface plasmon resonance technique (BlAcore®, GE-Healthcare Uppsala, Sweden) A method for determining the KD-value of the binding affinity is described in Example 9. Thus an “antibody binding to human CSF-1R” as used herein refers to an antibody specifically binding to the human CSF-1R antigen with a binding affinity of KD 1.0 χ 10*8 mol/1 or lower (preferably 1.0 χ I0'8 mol/1 - 1.0 χ 1012־ mol/l) at 35°C, preferably of a KD 1.0 xlO'9 mol/1 or lower at 35°C (preferably 1.0 χ 1 O'9 mol/1 - 1.0 χ 1 O’12 mol/1).

The “binding to human CSF-1R fragment delD4 (SEQ ID NO: 65) and to human CSF-1R Extracellular Domain (SEQ ID NO: 64)” as used herein is measured by a Surface Plasmon Resonance assay (Biacore assay) as described in Example 4. The human CSF-1R fragment delD4 (SEQ ID NO: 65) or human CSF-1R Extracellular Domain (SEQ ID NO: 64), respectively, are captured to the surface (each to a separate surface) and the test antibodies were added (each in a separate measurement) and the respective binding signals (Response Units (RU)) were determined. Reference signals (blank surface) were subtracted. If signals of nonbinding test antibodies were slightly below 0 the values were set as 0. Then the ratio of the respective binding signals (binding signal (RU) to human CSF-1R fragment delD4 /binding signal (RU) to human CSF-1R Extracellular Domain (CSF-1R-ECD)) is determined. The antibodies according to the invention have a ratio of the binding signals (RU(delD4) / RU(CSF-IR-ECD) of 1:50 or lower, preferably of 1:100 or lower (the lower included end is 0 ( e.g. if the RU is 0, then the ratio is 0:50 or 0:100)).

This means that such anti-CSF-IR antibodies according to the invention do not bind to the human CSF-1R fragment delD4 (like the anti-CCR5 antibody m<CCR5>PzO3.1C5 (deposited as DSM ACC 2683 on 18.08.2004 at DSMZ) and have binding signals for binding to the human CSF-1R fragment delD4 in the range of the anti-CCR5 antibody m<CCR5>PzO3.1C5, which are below 20 RU (Response Units), preferably below 10 RU in a Surface Plasmon Resonance (BIAcore) assay as shown in Example 4.

The term “binding to human CSF-1R fragment D1-D3” refers to a binding affinity determination by a Surface Plasmon Resonance assay (Biacore assay). The test antibody is captured to the surface and the human CSF-1R fragment D1-D3 (SEQ ID NO: 66) was added and the respective binding affinities were determined. The term “not binding to human CSF-1R fragment D1-D3” denotes that in such an assay the detected signal was in the area of no more than 1.2 fold of background signal and therefore no significant binding could be detected and no binding affinity could be determined (see Example 10).

One embodiment of the invention is a screening method for selecting antibodies according to the invention comprising the following steps;

a) determining the binding signal (Response Units (RU)) of anti-CSF-IR antibodies to human CSF-IR fragment delD4 (SEQ ID NO: 65) and to human CSF-1R Extracellular Domain (CSF-1R-ECD) (SEQ ID NO: 64) by a Surface Plasmon Resonance assay (Biacore assay).

b) selecting antibodies with ratio of the binding signals (human CSF-IR fragment delD4/ human CSF-IR Extracellular Domain (CSF-1R-ECD)) of 50:1 or lower.

In one embodiment the determination is performed at 25°C.

In one embodiment the screening method comprises as further steps the measuring of the binding of anti-CSF-IR antibodies to human CSF-IR fragment D1-D3 (SEQ

ID NO: 66) (D1-D3) and the selecting of antibodies which show no binding to said fragment.

The term “epitope” denotes a protein determinant of human CSF-1R capable of specifically binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually epitopes have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. Preferably an antibody according to the invention binds specifically to native and to denatured CSF-1R.

The “variable domain” (variable domain of a light chain (Vl), variable domain of a heavy chain (V!!)) as used herein denotes each of the pair of light and heavy chain domains which are involved directly in binding the antibody to the antigen. The variable light and heavy chain domains have the same general structure and each domain comprises four framework (FR) regions whose sequences are widely conserved, connected by three “hypcrvariable regions” (or complementary determining regions, CDRs). The framework regions adopt a β-sheet conformation and the CDRs may form loops connecting the β-sheet structure. The CDRs in each chain are held in their three-dimensional structure by the framework regions and form together with the CDRs from the other chain the antigen binding site. The antibody’s heavy and light chain CDR3 regions play a particularly important role in the binding spccificity/affinity of the antibodies according to the invention and therefore provide a further object of the invention.

The term “antigen-binding portion of an antibody” when used herein refer to the amino acid residues of an antibody which are responsible for antigen-binding. The antigen-binding portion of an antibody comprises amino acid residues from the “complementary determining regions” or “CDRs”. “Framework” or “FR” regions are those variable domain regions other than the hypcrvariable region residues as herein defined. Therefore, the light and heavy chain variable domains of an antibody comprise from N- to C-terminus the domains FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. Especially, CDR3 of the heavy chain is the region which contributes most to antigen binding and defines the antibody’s properties. CDR and FR regions arc determined according to the standard defmition of Rabat et al.,

Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service,

National Institutes of Health, Bethesda, MD (1991) and/or those residues from a “hypervariable loop”.

The terms “nucleic acid” or “nucleic acid molecule”, as used herein, are intended to include DNA molecules and RNA molecules. A nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded DNA.

The term amino acid” as used within this application denotes the group of naturally occurring carboxy a-amino acids comprising alanine (three letter code: ala, one letter code: A), arginine (arg, R), asparagine (asn, N), aspartic acid (asp, D), cysteine (cys, C), glutamine (gin, Q), glutamic acid (glu, E), glycine (gly, G), histidine (his, H), isoleucine (ilc, I), leucine (leu, L), lysine (lys, K), methionine (met, M), phenylalanine (phe, F), proline (pro, P), serine (ser, S), threonine (thr, T), tryptophan (trp, W), tyrosine (tyr, Y), and valine (val, V),

In one embodiment the antibodies according to the invention inhibit CSF-1 binding to CSF-1R. In one embodiment with an IC50 of 200 ng/ml or lower, in one embodiment with an IC50 of 50 ng/ml or lower. The IC50 of inhibition of CSF-1 binding to CSF-1 R can be determined as shown in Example 2.

In one embodiment the antibodies according to the invention inhibit CSF-1induced CSF-1R phosphorylation (in NIH3T3-CSF-1R recombinant cells).

In one embodiment with an IC50 of 800 ng/ml or lower, in one embodiment with an IC50 of 600 ng/ml or lower, in one embodiment with an 1C50 of 250 ng/ml or lower. The 1C50 of CSF-I-induced CSF-1R phosphorylation can be determined as shown in Example 3.

In one embodiment the antibodies according to the invention inhibit the growth of recombinant N1H3T3 cells expressing human CSF-1R (SEQ ID No: 62). In one embodiment with an IC50 of 10 pg/ml or lower, in one embodiment with an IC50 of 5 pg/ml or lower, in one embodiment with an IC50 of 2 pg/ml or lower. In one embodiment with an 1C30 of 10 pg/ml or lower, in one embodiment with an IC30 of 5 pg/ml or lower, in one embodiment with an IC30 of 2 pg/ml or lower. The IC50 value, the IC30 value or the % growth inhibition is determined as shown in Example 5.

In one embodiment the antibodies according to the invention inhibit the growth of recombinant NIH3T3 cells expressing human mutant CSF-1R L301S Y969F (SEQ ID No: 63). In one embodiment with an IC50 of 15 pg/ml or lower, in one embodiment with an IC50 of 10 pg/ml or lower. In one embodiment with an 1C30 of 10 pg/ml or lower, in one embodiment with an IC50 of 5 pg/ml ng/ml or lower; in one embodiment with an IC50 of 2 pg/ml or lower. The IC50 value, the IC30 value or the % growth inhibition is determined as shown in Example 5.

In one embodiment the antibodies according to the invention inhibit the growth of BeWo tumor cells (ATCC CCL-98) by 65 % or more (at an antibody concentration of lOpg/ml; and as compared to the absence of antibody). The % growth inhibition is determined as shown in Example 8. E.g. Mab 2F11 shows a growth inhibition of BeWo tumor cells of 70 %.

In one embodiment the antibodies according to the invention inhibit (both) human and cynomolgous macrophage differentiation ( which is indicated by the inhibition of the survival of human and cynomolgous monocytes as shown in Examples 7 and 8). In one embodiment the antibodies according to the invention inhibit the survival of human monocytes with an IC50 of 0.15 pg/ml or lower, in on embodiment with an IC50 of 0.10 pg/ml or lower. The inhibition of the survival of human monocytes is determined as shown in Example 7. In one embodiment the antibodies according to the invention inhibit the survival of cynomolgous monocytes by 80 % or more, in one embodiment by 90 % or more (at an antibody concentration of 5 pg/ml ;and as compared to the absence of antibody). The inhibition of the survival of human monocytes is determined as shown in Example 8.

A further embodiment of the invention is a method for the production of an antibody against CSF-1 R characterized in that the sequence of a nucleic acid encoding the heavy chain of a human IgG 1 class antibody binding to human CSF-1 R according to the invention said modified nucleic acid and the nucleic acid encoding the light chain of said antibody are inserted into an expression vector, said vector is inserted in a eukaryotic host cell, the encoded protein is expressed and recovered from the host cell or the supernatant.

The antibodies according to the invention are preferably produced by recombinant means. Therefore the antibody is preferably an isolated monoclonal antibody. Such recombinant methods are widely known in the state of the art and comprise protein expression in prokaryotic and eukaryotic cells with subsequent isolation of the antibody polypeptide and usually purification to a pharmaceutically acceptable purity. For the protein expression, nucleic acids encoding light and heavy chains or fragments thereof are inserted into expression vectors by standard methods. Expression is performed in appropriate prokaryotic or eukaryotic host cells like CHO cells, NSO cells, SP2/0 cells, HEK293 cells, COS cells, yeast, or E.coli cells, and the antibody is recovered from the cells (supernatant or cells after lysis).

Recombinant production of antibodies is well-known in the state of the art and described, for example, in the review articles of Makrides, S.C., Protein Expr. Purif. 17 (1999) 183-202; Geisse, S., et al., Protein Expr. Purif. 8 (1996) 271-282; Kaufman, R.J., Mol. Biotechnol. 16 (2000) 151-161; Werner, R.G., Drug Res. 48 (1998) 870-880.

The antibodies may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form. Purification is performed in order to eliminate other cellular components or other contaminants, e.g. other cellular nucleic acids or proteins, by standard techniques, including alkaline/SDS treatment, CsCI banding, column chromatography, agarose gel electrophoresis, and others well known in the art. See Ausubel, F., et al., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York (1987).

Expression in NSO cells is described by, e.g., Barnes, L.M., et aL, Cytotcchnology 32 (2000) 109-123; and Barnes, L.M., et al., Biotech. Bioeng. 73 (2001) 261-270. Transient expression is described by, e.g., Durocher, Y., et al., Nucl. Acids. Res. 30 (2002) E9. Cloning of variable domains is described by Orlandi, R., et al.&amp;#1470; Proc. Natl. Acad. Sci. USA 86 (1989) 3833-3837; Carter, P., et al., Proc. Natl. Acad. Sci. USA 89 (1992) 4285-4289; and Norderhaug, L., et al., J. Immunol. Methods 204 (1997) 77-87. A preferred transient expression system (HEK 293) is described by Schlaeger, E.-L, and Christensen, K., in Cytotcchnology 30 (1999) 71-83 and by Schlaegcr, E.-J., in J. Immunol. Methods 194 (1996) 191-199.

The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, enhancers and polyadenylation signals.

&amp;#1470;

Nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, operably linked means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers arc used in accordance with conventional practice.

The monoclonal antibodies arc suitably separated from the culture medium by conventional immunoglobulin purification procedures such as, for example, protein A-Scpharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography. DNA and RNA encoding the monoclonal antibodies are readily isolated and sequenced using conventional procedures. The hybridoma cells can serve as a source of such DNA and RNA. Once isolated, the DNA may be inserted into expression vectors, which are then transfected into host cells such as HEK 293 cells, CHO cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of recombinant monoclonal antibodies in the host cells.

As used herein, the expressions “cell”, “cell line”, and “cell culture” are used interchangeably and all such designations include progeny. Thus, the words “transformants” and “transformed cells” include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological activity as screened for in the originally transformed cell are included.

The “Fc part” of an antibody is not involved directly in binding of an antibody to an antigen, but exhibit various effector functions. A “Fc part of an antibody” is a term well known to the skilled artisan and defined on the basis of papain cleavage of antibodies. Depending on the amino acid sequence of the constant region of their heavy chains, antibodies or immunoglobulins arc divided in the classes: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g. IgGl, lgG2, lgG3, and lgG4, IgAl, and lgA2. According to the heavy chain constant regions the different classes of immunoglobulins are called a, δ, ε, γ, and μ, respectively. The Fc part of an antibody is directly involved in ADCC (antibody-dependent cell-mediated cytotoxicity) and CDC (complement-dependent cytotoxicity) based on complement activation, Clq binding and Fc receptor binding. Complement activation (CDC) is initiated by binding of complement factor Clq to the Fc part of most IgG antibody subclasses. While the influence of an antibody on the complement system is dependent on certain conditions, binding to Clq is caused by defined binding sites in the Fc part. Such binding sites are known in the state of the art and described e.g. by Boackle, R.J., et al., Nature 282 (1979) 742-743, Lukas, T.J., et al., J. Immunol. 127 (1981) 2555-2560, Brunhouse, R., and Cebra, J.J., Mol. Immunol. 16 (1979) 907-917, Burton, D.R., ct al., Nature 288 (1980) 338-344, Thommesen, J.E., ct al., Mol. Immunol. 37 (2000) 995-1004, Idusogie, E.E., et al., J. Immunol.164 (2000) 4178-4184, Hezareh, M., et al., J. Virology 75 (2001) 12161-12168, Morgan, A., ct al., Immunology 86 (1995) 319324, EP 0307434. Such binding sites are e.g. L234, L235, D270, N297, E318, K320, K322, P331 and P329 (numbering according to EU index of Kabat, E.A., see below). Antibodies of subclass IgGl, IgG2 and IgG3 usually show complement activation and Clq and C3 binding, whereas IgG4 do not activate the complement system and do not bind Clq and C3.

In one embodiment the antibody according to the invention comprises a Fc part derived from human origin and preferably all other parts of the human constant regions. As used herein the term “Fc part derived from human origin” denotes a Fc part which is either a Fc part of a human antibody of the subclass IgG I, IgG2, IgG3 or IgG4, preferably a Fc part from human IgGl subclass, a mutated Fc part from human IgGl subclass (preferably with a mutation on L234A + L235A), a Fc part from human IgG4 subclass or a mutated Fc part from human IgG4 subclass (preferably with a mutation on S228P). Mostly preferred are the human heavy chain constant regions of SEQ ID NO: 58 (human IgG 1 subclass), SEQ ID NO: 59 (human IgGl subclass with mutations L234A and L235A) , SEQ ID NO: 60 human IgG4 subclass), or SEQ ID NO: 61 (human IgG4 subclass with mutation S228P).

Preferably the antibody according to the invention is of human IgG 1 subclass or of human IgG4 subclass. In one embodiment the antibody according to the invention is of human IgG 1 subclass. In one embodiment the antibody according to the invention is of human IgG4 subclass.

In one embodiment the antibody according to the invention is characterized in that the constant chains are of human origin. Such constant chains arc well known in the state of the art and e.g. described by Kabat, E.A., (see e.g. Johnson, G. and Wu, T.T., Nucleic Acids Res. 28 (2000) 214218&amp;#1470;). For example, a useful human heavy chain constant region comprises an amino acid sequence of SEQ ID NO: 58. For example, a useful human light chain constant region comprises an amino acid sequence of a kappa-light chain constant region of SEQ ID NO: 57.

Another aspect of the invention is an antibody binding to human CSF-1 R, characterized in that

a) the heavy chain variable domain is SEQ ID NO;7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain is SEQ ID NO: 15 and the light chain variable domain is SEQ ID NO: 16;

or a humanized version thereof.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

a) the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8,

b) the heavy chain variable domain is SEQ ID NO: 15 and the light chain variable domain is SEQ ID NO:16;

c) the heavy chain variable domain is SEQ ID NO:75 and the light chain variable domain is SEQ ID NO:76;

d) the heavy chain variable domain is SEQ ID NO:83 and the light chain variable domain is SEQ ID NO:84;

or a humanized version thereof.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that *

the heavy chain variable domain is SEQ ID NO:7 and the light chain variable domain is SEQ ID NO:8, or a humanized version thereof.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

a) the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO :24, or

b) the heavy chain variable domain is SEQ ID NO:31 and the light chain variable domain is SEQ ID NO:32, or

c) the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO:40, or

d) the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48, or

e) the heavy chain variable domain is SEQ ID NO;55 and the light chain variable domain is SEQ ID NO:56.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

a) the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO :24, or

b) the heavy chain variable domain is SEQ ID NO:3 1 and the light chain variable domain is SEQ ID NO :32, or

c) the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO:40, or

d) the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain is SEQ ID NO:23 and the light chain variable domain is SEQ ID NO:24, or

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

&amp;#1470; 33 &amp;#1470;

the heavy chain variable domain is SEQ ID NO:31 and the light chain variable domain is SEQ ID NO:32.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain is SEQ ID NO:39 and the light chain variable domain is SEQ ID NO:40.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain is SEQ ID NO:47 and the light chain variable domain is SEQ ID NO:48.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain is SEQ ID NO:15 and the light chain variable domain is SEQ ID NO: 16, or a humanized version thereof.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain is SEQ ID NO:75 and the light chain variable domain is SEQ ID NO;76;

or a humanized version thereof.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain is SEQ ID NO:83 and the light chain variable domain is SEQ ID NO:84;

or a humanized version thereof.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

WO 2011/07(1024

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID

NO;1, a CDR2 region of SEQ ID NO: 2, and a CDR1 region of SEQ ID

NO:3, and the light chain variable domain comprises a CDR3 region of SEQ

ID NO: 4, a CDR2 region of SEQ ID NO:5, and a CDR1 region of SEQ ID

NO:6, or,

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 9, a CDR2 region of SEQ ID NO: 10, and a CDR1 region of SEQ ID NO: 11, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 12, a CDR2 region of SEQ ID NO: 13, and a CDR1 region of SEQ ID NO: 14, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDR1 region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDR1 region of SEQ ID NO :22, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDR1 region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of SEQ ID NO: 30, or

e) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38, or

f) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ ID NO:46,

g) the heavy chain variable domain comprises a CDR3 region of SEQ ID

NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDRI region of SEQ ID

NO: 51, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO:52, a CDR2 region of SEQ ID NO: 53, and a CDRI region of

SEQ ID NO: 54;

h) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:69, a CDR2 region of SEQ ID NO: 70, and a CDRI region of SEQ ID NO:71, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 72, a CDR2 region of SEQ ID NO:73, and a CDRI region of SEQ ID NO:74, or

i) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 77, a CDR2 region of SEQ ID NO: 78, and a CDRI region of SEQ ID NO: 79, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:80, a CDR2 region of SEQ ID NO: 81, and a CDRI region of SEQ ID NO: 82.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDRI region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDRI region of SEQ ID NO:22, or

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDRI region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDRI region of SEQ ID NO: 30, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDRI region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of

&amp;#1470;

SEQ ID NO:36&amp;#1470; a CDR2 region of SEQ ID NO: 37, and a CDR1 region of

SEQ ID NO: 38, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of SEQ ID NO:46, or

e) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 49, a CDR2 region of SEQ ID NO: 50, and a CDR1 region of SEQ ID NO: 51, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:52, a CDR2 region of SEQ ID NO: 53, and a CDR1 region of SEQ ID NO: 54.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that

a) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDR1 region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDR1 region of SEQ ID NO:22, or

b) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDR1 region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of SEQ ID NO: 30, or

c) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ IDNO:36, a CDR2 region of SEQ ID NO: 37, and a CDR1 region of SEQ ID NO: 38, or

d) the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and aCDRl region of SEQ ID &amp;#9632;

NO:43, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of

SEQ IDNO:46.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 17, a CDR2 region of SEQ ID NO: 18, and a CDR1 region of SEQ ID NO: 19, and the light chain variable domain comprises a CDR3 region of SEQ ID NO: 20, a CDR2 region of SEQ ID NO:21, and a CDR1 region of SEQ IDNO:22.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 25, a CDR2 region of SEQ ID NO: 26, and a CDR1 region of SEQ ID NO: 27, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:28, a CDR2 region of SEQ ID NO: 29, and a CDR1 region of SEQ ID NO: 30.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO: 33, a CDR2 region of SEQ ID NO: 34, and a CDR1 region of SEQ ID NO: 35, and the light chain variable domain comprises a CDR3 region of SEQ ID NO:36, a CDR2 region of SEQ ID NO: 37, and a CDR 1 region of SEQ ID NO: 38.

Another aspect of the invention is an antibody binding to human CSF-1R, characterized in that the heavy chain variable domain comprises a CDR3 region of SEQ ID NO:41, a CDR2 region of SEQ ID NO: 42, and a CDR1 region of SEQ ID NO:43, and the light chain variable domain comprises a CDR3 region of

SEQ ID NO: 44, a CDR2 region of SEQ ID NO:45, and a CDR1 region of

SEQ IDNO:46.

The invention comprises a method for the treatment of a patient in need of therapy, characterized by administering to the patient a therapeutically effective amount of an antibody according to the invention.

The invention comprises the use of an antibody according to the invention for therapy.

One preferred embodiment of the invention are the CSF-1R antibodies ofthe present invention for use in the treatment of “CSF-1 R mediated diseases” or the CSF-1 R antibodies of the present invention for use for the manufacture of a medicament in the treatment of “CSF-1R mediated diseases”, which can be described as follows:

There are 3 distinct mechanisms by which CSF-1 R signaling is likely involved in tumor growth and metastasis. The first is that expression of CSF-ligand and receptor has been found in tumor cells originating in the female reproductive system (breast, ovarian, endometrium, cervical) (Scholl, S.M., et al., J. Natl. Cancer Inst. 86 (1994) 120-126; Kacinski, B.M., Mol. Rcprod. Dev. 46 (1997) 7174; Ngan, H.Y., et al., Eur. J. Cancer 35 (1999) 1546-1550; Kirma, N., et al., Cancer Res 67 (2007) 1918-1926) and the expression has been associated with breast cancer xenograft growth as well as poor prognosis in breast cancer patients. Two point mutations were seen in CSF-1R in about 10-20% of acute myelocytic leukemia, chronic myelocytic leukemia and myelodysplasia patients tested in one study, and one of the mutations was found to disrupt receptor turnover (Ridge, S.A., et al., Proc. Natl. Acad. Sci USA 87 (1990) 1377-1380). However the incidence of the mutations could not be confirmed in later studies (Abu-Duhier, F.M., et al., Br. J. Haematol. 120 (2003) 464-470). Mutations were also found in some cases of hepatocellular cancer (Yang, D.H., et al., Hepatobiliary Pancreat. Dis. Int. 3 (2004) 86-89) and idiopathic myelofibrosis (Abu-Duhier, F.M., et al., Br. J. Haematol. 120 (2003) 464-470). Recently, in the GDM-1 cell line derived from a patient with myelomonoblastic leukemia the Y571 D mutation in CSF-1 R was identified (Chase, A., ct al., Leukemia 23 (2009) 358-364).

Pigmented villonodular synovitis (PVNS) and Tenosynovial Giant cell tumors (TGCT) can occur as a result of a translocation that fuses the M-CSF gene to a collagen gene COL6A3 and results in overexpression of M-CSF (West, R.B., et al., Proc. Natl. Acad. Sci. USA 103 (2006) 690-695). A landscape effect is proposed to be responsible for the resulting tumor mass that consists of monocytic cells attracted by cells that express M-CSF. TGCTs are smaller tumors that can be relatively easily removed from fingers where they mostly occur. PVNS is more aggressive as it can recur in large joints and is not as easily controlled surgically.

The second mechanism is based on blocking signaling through M-CSF/CSF-1R at metastatic sites in bone &amp;#1470;which induces osteoclastogenesis, bone resorption and osteolytic bone lesions. Breast, multiple myeloma and lung cancers are examples of cancers that have been found to metastasize to the bone and cause osteolytic bone disease resulting in skeletal complications. M-CSF released by tumor cells and stroma induces the differentiation of hematopoietic myeloid monocyte progenitors to mature osteoclasts in collaboration with the receptor activator of nuclear factor kappa-B ligand-RANKL. During this process, M-CSF acts as a permissive factor by giving the survival signal to osteoclasts (Tanaka, S., et al., J. Clin. Invest. 91 (1993) 257-263). Inhibition of CSF-1R activity during osteoclast differentiation and maturation with a anti-CSF-1 R antibody is likely to prevent unbalanced activity of osteoclasts that cause osteolytic disease and the associated skeletal related events in metastatic disease. Whereas breast, lung cancer and multiple myeloma typically result in osteolytic lesions, metastasis to the bone in prostate cancer initially has an osteoblastic appearance in which increased bone forming activity results in 'woven bone' which is different from typical lamellar structure of normal bone. During disease progression bone lesions display a significant osteolytic component as well as high serum levels of bone resorption and suggests that anti-resorptive therapy may be useful. Bisphosphonates have been shown to inhibit the formation of osteolytic lesions and reduced the number of skeletalrelated events only in men with hormone-refractory metastatic prostate cancer but at this point their effect on osteoblastic lesions is controversial and bisphosphonates have not been beneficial in preventing bone metastasis or hormone responsive prostate cancer to date. The effect of anti-resorptive agents in mixed ostcolytic/osteoblastic prostate cancer is still being studied in the clinic (Choueiri, M.B., et al,, Cancer Metastasis Rev. 25 (2006) 601-609; Vessella, R.L. and Corey, E, Clin. Cancer Res. 12 (20 Pt 2) (2006) 6285s-6290s).

The third mechanism is based on the recent observation that tumor associated macrophages (TAM) found in solid tumors of the breast, prostate, ovarian and cervical cancers correlated with poor prognosis (Bingle, L., et al., J. Pathol. 196 (2002) 254-265; Pollard, J.W., Nat. Rev. Cancer 4 (2004) 71-78). Macrophages are recruited to the tumor by M-CSF and other chcmokincs. The macrophages can then contribute to tumor progression through the secretion of angiogenic factors, proteases and other growth factors and cytokines and may be blocked by inhibition of CSF-IR signaling. Recently it was shown by Zins ct al (Zins, K., et al., Cancer Res. 67 (2007) 1038-1045) that expression of siRNA of Tumor necrosis factor alpha (TNF alpha), M-CSF or the combination of both would reduce tumor growth in a mouse xenograft model between 34% and 50% after intratumoral injection of the respective siRNA. SiRNA targeting the TNF alpha secreted by the human SW620 cells reduced mouse M-CSF levels and led to reduction of macrophages in the tumor. In addition treatment of MCF7 tumor xenografts with an antigen binding fragment directed against M-CSF did result in 40% tumor growth inhibition, reversed the resistance to chemotherapeutics and improved survival of the mice when given in combination with chcmothcrapcutics (Paulus, P., ct al., Cancer Res. 66 (2006) 4349-4356).

TAMs arc only one example of an emerging link between chronic inflammation and cancer. There is additional evidence for a link between inflammation and cancer as many chronic diseases arc associated with an increased risk of cancer, cancers arise at sites of chronic inflammation, chemical mediators of inflammation are found in many cancers; deletion of the cellular or chemical mediators of inflammation inhibits development of experimental cancers and long-term use of anti-inflammatory agents reduce the risk of some cancers. A link to cancer exists for a number of inflammatory conditions among- those H.pylori induced gastritis for gastric cancer, Schistosomiasis for bladder cancer, HHVX for Kaposi's sarcoma, endometriosis for ovarian cancer and prostatitis for prostate cancer (Balkwill, F., et al., Cancer Cell 211-217 (2005) &amp;#1512;). Macrophages are key cells in chronic inflammation and respond differentially to their microenvironment. There are two types of macrophages that are considered extremes in a continuum of functional states: Ml macrophages are involved in Type 1 reactions. These reactions involve the activation by microbial products and consequent killing of pathogenic microorganisms that result in reactive oxygen intermediates. On the other end of the extreme are M2 macrophages involved in Type 2 reactions that promote cell proliferation, tune inflammation and adaptive immunity and promote tissue remodeling, angiogenesis and repair (Mantovani, A., et al., Trends Immunol. 25 (2004) 677-686). Chronic inflammation resulting in established neoplasia is usually associated with M2 macrophages. A pivotal cytokine that mediates inflammatory reactions is TNF alpha that true to its name can stimulate anti-tumor immunity and hemorrhagic necrosis at high doses but has also recently been found to be expressed by tumor cells and acting as a tumor promoter (Zins, K., et al., Cancer Res. 67 (2007) 1038-1045; Balkwill, F&amp;#1524; Cancer Metastasis Rev. 25 (2006) 409-416). The specific role of macrophages with respect to the tumor still needs to be better understood including the potential spatial and temporal dependence on their function and the relevance to specific tumor types.

Thus one embodiment of the invention are the CSF-1 R antibodies of the present invention for use in the treatment of cancer. The term “cancer” as used herein may be, for example, lung cancer, non small cell lung (NSCL) cancer, bronchioloalviolar cell lung cancer, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, gastric cancer, colon cancer, breast cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, prostate cancer, cancer of the bladder, cancer of the kidney or ureter, renal cell carcinoma, carcinoma of the renal pelvis, mesothelioma, hepatocellular cancer, biliary cancer, neoplasms of the central nervous system (CNS), spinal axis tumors, brain stem glioma, glioblastoma multiforme, astrocytomas, schwanomas, ependymonas, . medulloblastomas, meningiomas, squamous cell carcinomas, pituitary adenoma, lymphoma, lymphocytic leukemia, including refractory versions of any of the above cancers, or a combination of one or more of the above cancers. Preferably such cancer is a breast cancer, ovarian cancer , cervical cancer, lung cancer or prostate cancer. Preferably such cancers are further characterized by CSF-1 or CSF-1R expression or overexpression. One further embodiment the invention are the CSF-1 R antibodies of the present invention for use in the simultaneous treatment of primary tumors and new metastases.

Thus another embodiment of the invention are the CSF-1 R antibodies of the present invention for use in the treatment of periodontitis, histiocytosis X, osteoporosis, Paget's disease of bone (PDB), bone loss due to cancer therapy, pcriprosthetic osteolysis, glucocorticoid-induced osteoporosis, rheumatoid arthritis, psiratic arthritis, osteoarthritis, inflammatory arthriditics, and inflammation.

Rabello, D., ct al., Biochem. Biophys. Res. Commun. 347 (2006) 791-796 has demonstrated that SNPs in the CSF1 gene exhibited a positive association with aggressive periodontitis: an inflammatory disease of the periodontal tissues that causes tooth loss due to resorption of the alveolar bone.

Histiocytosis X (also called Langerhans cell histiocytosis, LCH) is a proliferative disease of Langerhans dendritic cells that appear to differentiate into osteoclasts in bone and extra osseous LCH lesions. Langerhans cells are derived from circulating monocytes. Increased levels of M-CSF that have been measured in sera and lesions where found to correlate with disease severity (da Costa, C.E., et al,, J. Exp. Med. 201 (2005) 687-693). The disease occurs primarily in a pediatric patient population and has to be treated with chemotherapy when the disease becomes systemic or is recurrent.

The pathophysiology of osteoporosis is mediated by loss of bone forming osteoblasts and increased osteoclast dependent bone resorption. Supporting data has been described by Ccnci et al showing that an anti-M-CSF antibody injection preserves bone density and inhibits bone resorption in ovariectomized mice (Cenci, S., et al., J. Clin. Invest. 105 (2000) 1279-1287). Recently a potential link between postmenopausal bone loss due to estrogen deficiency was identified and found that the presence of TNF alpha producing T-cell affected bone metabolism (Roggia, C., et al., Minerva Med. 95 (2004) 125-132). A possible mechanism could be the induction of M-CSF by TNF alpha in vivo. An important role for M-CSF in TNFalpha-induced osteoclastogenesis was confirmed by the effect of an antibody directed against M-CSF that blocked the TNF alpha induced osteolysis in mice and thereby making inhibitors of CSF-1 R signaling potential targets for inflammatory arthritis (Kitaura, H., ct al., J. Clin. Invest. 115 (2005) 3418-3427).

Paget's disease of bone (PDB) is the second most common bone metabolism disorder after osteoporosis in which focal abnormalities of increased bone turnover lead to complications such as bone pain, deformity, pathological fractures and deafness. Mutations in four genes have been identified that regulate normal osteoclast function and predispose individuals to PDB and related disorders: insertion mutations in TNFRSF11 A, which encodes receptor activator of nuclear factor (NF) kappaB (RANK)-a critical regulator of osteoclast function, inactivating mutations of TNFRSF1 IB which encodes osteoprotcgcrin (a decoy receptor for RANK ligand), mutations of the sequestosome 1 gene (SQSTM1), which encodes an important scaffold protein in the NFkappaB pathway and mutations in the valosin-containing protein (VCP) gene. This gene encodes VCP, which has a role in targeting the inhibitor of NFkappaB for degradation by the proteasome (Daroszewska, A. and Ralston, S.H., Nat. Clin. Pract. Rheumatol. 2 (2006) 270277). Targeted CSF-1 R inhibitors provide an opportunity to block the deregulation of the RANKL signaling indirectly and add an additional treatment option to the currently used bisphosphonates.

Cancer therapy induced bone loss especially in breast and prostate cancer patients is an additional indication where a targeted CSF-1 R inhibitor could prevent bone loss (Lester, J.E., et al., Br. J. Cancer 94 (2006) 30-35). With the improved prognosis for early breast cancer the long-term consequences of the adjuvant therapies become more important as some of the therapies including chemotherapy, irradiation, aromatase inhibitors and ovary ablation affect bone metabolism by decreasing the bone mineral density, resulting in increased risk for osteoporosis and associated fractures (Lester, J.E., ct al., Br. J. Cancer 94 (2006) 30-35). The equivalent to adjuvant aromatase inhibitor therapy in breast cancer is androgen ablation therapy in prostate cancer which leads to loss of bone mineral density and significantly increases the risk of osteoporosis-related fractures (Stoch, S.A., et al., J. Clin. Endocrinol. Metab. 86 (2001)2787-2791).

Targeted inhibition of CSF-1R signaling is likely to be beneficial in other indications as well when targeted cell types include osteoclasts and macrophages e.g. treatment of specific complications in response to joint replacement as a consequence of rheumatoid arthritis. Implant failure due to periprosthetic bone loss and consequent loosing of prostheses is a major complication of joint replacement and requires repeated surgery with high socioeconomic burdens for the individual patient and the health-care system. To date, there is no approved drug therapy to prevent or inhibit periprosthetic osteolysis (Drees, P., et al., Nat. Clin. Pract. Rheumatol. 3 (2007) 165-171).

Glucocorticoid-induced osteoporosis (G1OP) is another indication in which a CSF1R inhibitor could prevent bone loss after longterm glucocorticocosteroid use that is given as a result of various conditions among those chronic obstructive pulmonary disease, asthma and rheumatoid arthritis (Guzman-Clark, J.R., et al., Arthritis Rheum. 57 (2007) 140-146; Feldstein, A.C., et al., Ostcoporos. Int, 16 (2005) 2168-2174).

Rheumatoid arthritis, psioratic arthritis and inflammatory arthridities are in itself potential indications for CSF-1 R signaling inhibitors in that they consist of a macrophage component and to a varying degree bone destruction (Ritchlin, C.T., et al., J. Clin. Invest. Ill (2003) 821-831). Osteoarthritis and rheumatoid arthritis are inflammatory autoimmune disease caused by the accumulation of macrophages in the connective tissue and infiltration of macrophages into the synovial fluid, which is at least partially mediated by M-CSF. Campbell, 1., K., et al., J. Lcukoc. Biol. 68 (2000) 144-150, demonstrated that M-CSF is produced by human-joint tissue cells (chondrocytes, synovial fibroblasts) in vitro and is found in synovial fluid of patients with rheumatoid arthritis, suggesting that it contributes to the synovial tissue proliferation and macrophage infiltration which is associated with the pathogenesis of the disease. Inhibition of CSF-1 R signaling is likely to control the number of macrophages in the joint and alleviate the pain from the associated bone destruction. In order to minimize adverse affects and to further understand the impact ofthe CSF-1 R signaling in these indications, one method is to specifically inhibit CSF-1 R without targeting a myriad other kinases, such as Raf kinase.

Recent literature reports correlate increased circulating M-CSF with poor prognosis and atherosclerotic progression in chronic coronary artery disease (Saitoh, T., et al., J. Am. Coll. Cardiol. 35 (2000) 655-665; Ikonomidis, 1., et al., Eur. Heart. J. 26 (2005) p. 1618-1624); M-CSF influences the atherosclerotic process by aiding the formation of foam cells (macrophages with ingested oxidized LDL) that express CSF-1R and represent the initial plaque (Murayama, T., et al., Circulation 99 (1999) 1740-1746).

Expression and signaling of M-CSF and CSF-1R is found in activated microglia. Microglia, which arc resident macrophages of the central nervous system, can be activated by various insults, including infection and traumatic injury. M-CSF is considered a key regulator of inflammatory responses in the brain and M-CSF levels increase in HIV-1, encephalitis, Alzheimer's disease (AD) and brain tumors. Microgliosis as a consequence of autocrine signaling by M-CSF/CSF-1R results in induction of inflammatory cytokines and nitric oxides being released as demonstrated by e.g. using an experimental neuronal damage model (Hao, A.J., et al., Neuroscience 112 (2002) 889900&amp;#1470;; Murphy, G.M., Jr,, et al., J. Biol. Chern. 273 (1998) 20967-20971). Microglia that have increased expression of CSF-1R are found to surround plaques in AD and in the amyloid precursor protein V717F transgenic mouse model of AD (Murphy, G.M., Jr., et al., Am. J. Pathol. 157 (2000) 895-904). On the other hand op/op mice with fewer microglia in the brain resulted in fibri lar deposition of A-beta and neuronal loss compared to normal control suggesting that microglia do have a neuroprotective function in the development of AD lacking in the op/op mice (Kaku, M., et al., Brain Res. Brain Res. Protoc. 12 (2003) 104-108).

Expression and signaling of M-CSF and CSF-1R is associated with inflammatory bowel disease (1BD) (WO 2005/046657). The term inflammatory bowel disease refers to serious, chronic disorders of the intestinal tract characterized by chronic inflammation at various sites in the gastrointestinal tract, and specifically includes ulcerative colitis (UC) and Crohn's disease.

The invention comprises an antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for the treatment of cancer.

The invention comprises an antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for the treatment of bone loss.

The invention comprises an antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for the prevention or treatment of metastasis.

The invention comprises an antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for treatment of inflammatory diseases.

The invention comprises the use of an antibody characterized in comprising the antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for the treatment of cancer or alternatively for the manufacture of a medicament for the treatment of cancer.

The invention comprises the use of an antibody characterized in comprising the antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for the treatment of bone loss or alternatively for the manufacture of a medicament for the treatment of bone loss.

The invention comprises the use of an antibody characterized in comprising the antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for the prevention or treatment of metastasis or alternatively for the manufacture of a medicament for the prevention or treatment of metastasis.

The invention comprises the use of an antibody characterized in comprising the antibody binding to human CSF-1R being characterized by the above mentioned epitope binding properties or alternatively by the above mentioned amino acid sequences and amino acid sequence fragments for treatment of inflammatory diseases or alternatively for the manufacture of a medicament for the treatment of inflammatory diseases.

A further embodiment of the invention is a method for the production of an antibody against CSF-1R characterized in that the sequence of a nucleic acid encoding the heavy chain of a human IgG 1 class antibody binding to human CSF-1R according to the invention said modified nucleic acid and the nucleic acid encoding the light chain of said antibody arc inserted into an expression vector, &amp;#1470; 47 said vector is inserted in a eukaryotic host cell, the encoded protein is expressed and recovered from the host cell or the supernatant.

The antibodies according to the invention are preferably produced by recombinant means. Such methods are widely known in the state of the art and comprise protein expression in prokaryotic and eukaryotic cells with subsequent isolation of the antibody polypeptide and usually purification to a pharmaceutically acceptable purity. For the protein expression nucleic acids encoding light and heavy chains or fragments thereof are inserted into expression vectors by standard methods. Expression is performed in appropriate prokaryotic or eukaryotic host cells, such as CHO cells, NSO cells, SP2/0 cells, HEK293 cells, COS cells, yeast, or E. coli cells, and the antibody is recovered from the cells (from the supernatant or after cells lysis).

Recombinant production of antibodies is well-known in the state of the art and described, for example, in the review articles of Makrides, S.C., Protein Expr. Purif. 17 (1999) 183-202; Geisse, S., et al., Protein Expr. Purif. 8 (1996) 271-282; Kaufman, R.J., Mol. Biotechnol. 16 (2000) 151-161; Werner, R.G., Drug Res. 48 (1998) 870-880.

The antibodies may be present in whole cells, in a cell lysate, or in a partially purified, or substantially pure form. Purification is performed in order to eliminate other cellular components or other contaminants, e.g. other cellular nucleic acids or proteins, by standard techniques, including alkaline/SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, and others well known in the art. See Ausubel, F., etal., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York (1987).

Expression in NSO cells is described by, e.g., Barnes, L.M., et al,, Cytotechnology 32 (2000) 109-123; Barnes, L.M., ct a[., Biotech. Biocng. 73 (2001) 261-270. Transient expression is described by, e.g., Durocher, Y., et al., Nucl. Acids. Res. 30 (2002) E9. Cloning of variable domains is described by Orlandi, R., et al., Proc. Natl. Acad. Sci. USA 86 (1989) 3833-3837; Carter, P., et al., Proc. Natl. Acad. Sci. USA 89 (1992) 4285-4289; Norderhaug, L., etal., J. Immunol. Methods 204 (1997) 77-87. A preferred transient expression system (HEK 293) is described by Schlaeger, E.-J. and Christensen, K., in Cytotechnology 30 (1999) 71-83, and by Schlaeger, E.-J., in J. Immunol. Methods 194(1996) 191-199.

Nucleic acid molecules encoding amino acid sequence variants of anti-CSF-lR antibody are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucicotidc-mcdiatcd (or sitc-dircctcd) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of humanized anti-CSF-lR antibody.

The heavy and light chain variable domains according to the invention are combined with sequences of promoter, translation initiation, constant region, 3' untranslated region, polyadenylation, and transcription termination to form expression vector constructs. The heavy and light chain expression constructs can be combined into a single vector, co&amp;#1470;transfccted, serially transfected, or separately transfected into host cells which arc then fused to form a single host cell expressing both chains.

In another aspect, the present invention provides a composition, e.g. a pharmaceutical composition, containing one or a combination of monoclonal antibodies, or the antigen-binding portion thereof, of the present invention, formulated together with a pharmaceutically acceptable carrier.

As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption/resorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for injection or infusion.

A composition of the present invention can be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. In addition to water, the carrier can be, for example, an isotonic buffered saline solution.

&amp;#1470; 49 Regardless of the route of administration selected, the compounds of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.

Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient (effective amount). The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

The invention comprises the use of the antibodies according to the invention for the treatment of a patient suffering from cancer, especially from colon, lung or pancreas cancer.

The invention comprises also a method for the treatment of a patient suffering from such disease.

The invention further provides a method for the manufacture of a pharmaceutical composition comprising an effective amount of an antibody according to the invention together with a pharmaceutically acceptable carrier and the use of the antibody according to the invention for such a method.

The invention further provides the use of an antibody according to the invention in an effective amount for the manufacture of a pharmaceutical agent, preferably together with a pharmaceutically acceptable carrier, for the treatment of a patient suffering from cancer.

The invention also provides the use of an antibody according to the invention in an effective amount for the manufacture of a pharmaceutical agent, preferably together with a pharmaceutically acceptable carrier, for the treatment of a patient suffering from cancer.

The following examples, sequence listing and figures are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit of the invention.

Description of the Sequences

SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID

NO: 1

NO: 2

NO: 3

NO: 4

NO: 5

NO; 6

NO: 7

NO: 8

NO: 9

NO: 10

NO: 11

NO: 12

NO: 13

NO: 14

NO: 15

NO: 16

NO: 17

NO: 18

NO: 19

NO: 20

NO: 21

NO: 22

NO: 23

NO: 24 heavy chain CDR3, Mab 2F11 heavy chain CDR2, Mab 2F11 heavy chain CDR1, Mab 2F11 light chain CDR3, Mab2Fll light chain CDR2, Mab 2F11 light chain CDR1, Mab2Fll heavy chain variable domain, Mab 2F11 light chain variable domain, Mab 2F11 heavy chain CDR3, Mab 2E10 heavy chain CDR2, Mab 2E10 heavy chain CDR1, Mab 2E10 light chain CDR3, Mab 2E10 light chain CDR2, Mab 2E10 light chain CDR1, Mab2E10 heavy chain variable domain, Mab 2E10 light chain variable domain, Mab 2E10 heavy chain CDR3, hMab 2F11-cl 1 heavy chain CDR2, hMab 2F11-cl 1 heavy chain CDR1, hMab 2F11-cll light chain CDR3, hMab 2FU-cl 1 light chain CDR2, hMab 2F11-cl 1 light chain CD RI, hMab 2F11-cl 1 heavy chain variable domain, hMab 2F11-cl 1 light chain variable domain, hMab 2F11-cll

<td> SEQ ID NO: 25</td><td> heavy chain CDR3, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 26</td><td> heavy chain CDR2, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 27</td><td> heavy chain CDR1, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 28</td><td> light chain CDR3, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 29</td><td> light chain CDR2, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 30</td><td> light chain CDR1, hMab 2F1l-d8</td>

<td> SEQ ID NO: 31</td><td> heavy chain variable domain, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 32</td><td> light chain variable domain, hMab 2F1 l-d8</td>

<td> SEQ ID NO: 33</td><td> heavy chain CDR3, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 34</td><td> heavy chain CDR2, hMab 2F1 l־e7</td>

<td> SEQ ID NO: 35</td><td> heavy chain CDR1, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 36</td><td> light chain CDR3, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 37</td><td> light chain CDR2, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 38</td><td> light chain CDR1, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 39</td><td> heavy chain variable domain, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 40</td><td> light chain variable domain, hMab 2F1 l-e7</td>

<td> SEQ ID NO: 41</td><td> heavy chain CDR3, hMab 2F11-fl 2</td>

<td> SEQ ID NO: 42</td><td> heavy chain CDR2, hMab 2F1J-fl 2</td>

<td> SEQ ID NO: 43</td><td> heavy chain CDR1, hMab 2F11-fl 2</td>

<td> SEQ ID NO: 44</td><td> light chain CDR3, hMab 2F1 l-fl2</td>

<td> SEQ ID NO: 45</td><td> light chain CDR2, hMab 2F11-Π2</td>

<td> SEQ ID NO: 46</td><td> light chain CDR1, hMab 2F1 l-fl2</td>

<td> SEQ ID NO: 47</td><td> heavy chain variable domain, hMab 2F11-Ω2</td>

<td> SEQ ID NO: 48</td><td> light chain variable domain, hMab 2F11-Π2</td>

<td> SEQ ID NO: 49</td><td> heavy chain CDR3, hMab 2F11-gl</td>

<td> SEQ ID NO: 50</td><td> heavy chain CDR2, hMab 2F11-gl</td>

<td> SEQ ID NO: 51</td><td> heavy chain CDR1, hMab 2FI 1-gl</td>

<td> SEQ ID NO: 52</td><td> light chain CDR3, hMab 2F11-gl</td>

<td> SEQ ID NO. 53</td><td> light chain CDR2, hMab 2F11-gl</td>

<td> SEQ ID NO: 54</td><td> light chain CDR1, hMab 2F11-gl</td>

<td> SEQ ID NO: 55</td><td> heavy chain variable domain, hMab 2F11-gl</td>

<td> SEQ ID NO: 56</td><td> light chain variable domain, hMab 2F11-gl</td>

<td> SEQ ID NO: 57</td><td> human kappa light chain constant region</td>

<td> SEQ ID NO: 58</td><td> human heavy chain constant region derived from IgGl</td>

SEQ ID NO; 59

SEQ ID NO: 60

SEQ ID NO: 61

SEQ ID NO: 62

SEQ ID NO: 63

SEQ ID NO: 64

SEQ ID NO: 65

SEQ ID NO: 66

SEQ ID NO: 67

SEQ ID NO: 68

SEQ ID NO: 69

SEQ ID NO: 70

SEQ ID NO: 71

SEQ ID NO: 72

SEQ ID NO; 73

SEQ1DNO:74

SEQ ID NO: 75

SEQ ID NO: 76

SEQ 1DNO:77

SEQ ID NO: 78

SEQ ID NO: 79

SEQ ID NO: 80

SEQ ID NO: 81

SEQ ID NO: 82

SEQ ID NO: 83

SEQ ID NO: 84 human heavy chain constant region derived from IgG 1 mutated on L234A and L235A human heavy chain constant region derived from IgG4 human heavy chain constant region derived from IgG4 mutated on S228P human wildtype CSF* 1R (wt CSF-1R) human mutant CSF-1R L301S Y969F human CSF-1R Extracellular Domain human CSF-1R fragment dclD4 human CSF-1R fragment D1-D3 signal peptide

Primer heavy chain CDR3, Mab 1G10 heavy chain CDR2, Mab 1G10 heavy chain CDR1, Mab 1G10 light chain CDR3, Mab 1G10 light chain CDR2, Mab 1G10 light chain CDR1, Mab 1G10 heavy chain variable domain, Mab 1G10 light chain variable domain, Mab 1G10 heavy chain CDR3, Mab 2H7 heavy chain CDR2, Mab 2H7 heavy chain CDR1, Mab 2H7 light chain CDR3, Mab 2H7 light chain CDR2, Mab 2H7 light chain CDR1, Mab 2H7 heavy chain variable domain, Mab 2H7 light chain variable domain, Mab 2H7

The following examples, sequence listing and figures are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit of the invention.

Description of the Figures

Figure 1 Growth inhibition of BeWo tumor cells in 3D culture under treatment with different anti-CSF-lR monoclonal antibodies at a concentration of I0gg/ml.

X axis: viability normalized mean relative light units (RLU) corresponding to the ATP-content of the cells (CellTitcrGlo assay).

Y axis: tested probes: Minimal Medium (0.5% FBS), mouse IgG 1 (mlgGl, lOpg/ml), mouse lgG2a (m!gG2a 10gg/ml), CSF-1 only, Mab 2F11, Mab 2E10, Mab2H7, MablGlO and SC 2-4A5.

Highest inhibition of CSF-1 induced growth was observed ,with the anti-CSF-JR antibodies according to the invention.

Figure 2a Biacore sensogram of binding of different anti-CSF-lR antibodies to immobilized human CSF-1 R fragment delD4 15 (comprising the extracellular subdomains DI -D3 and D5) (SEQ

ID NO: 65) (y-axis: binding signal in Response Units (RU), baseline = 0 RU, x-axis: time in seconds (s)): While the antibodies Mab 3291 and sc 2-4A5 clearly show binding to this delD4 fragment, the antibodies according to the invention e.g.

Mab 2F11, and Mab 2E10, did not bind to the CSF-1 R fragment dclD4. The control anti-CCR5 antibody m<CCR5>Pz03.1C5 did also not bind to the CSF-1 R fragment dclD4.

Figure 2b Biacore sensogram of binding of different anti-CSF-lR antibodies to immobilized human CSF-1 R Extracellular Domain (CSF-1 R-ECD) (comprising the extracellular subdomains DI D5) (SEQ ID NO: 64) (y-axis: binding signal in Response Units (RU), baseline = 0 RU, x-axis: time in seconds (s)):: All anti-CSF-1R antibodies show binding to CSF-1 R-ECD. The control anti-CCR5 antibody m<CCR5>PzO3.1C5 did not bind to the CSF-1 R-ECD.

Figure 2c Biacore sensogram of binding of different anti-CSF-lR antibodies to immobilized human CSF-1 R fragment delD4 (comprising the extracellular subdomains DI -D3 and D5) (SEQ ID NO: 65) (y-axis: binding signal in Response Units (RU), 35 baseline = 0 RU, x-axis: time in seconds (s)): Mab 1G10, Mab

<td></td><td> - 2H7 and humanized hMab 2Fll-e7 did not bind to the CSF-1R fragment delD4. The control anti-CCR5 antibody m&lt;CCR5&gt;PzO3.1C5 did also not bind to the CSF-1R fragment delD4.</td>

<td> Figure 2d</td><td> Biacorc scnsogram of binding of different anti-CSF-lR antibodies to immobilized human CSF-1R Extracellular Domain (CSF-1R-ECD) (comprising the extracellular subdomains DI D5) (SEQ ID NO: 64) (y-axis: binding signal in Response Units (RU), baseline = 0 RU, x-axis: time in seconds (s)): All anti-CSF1R antibodies Mab 1G10, Mab 2H7 and humanized hMab 2F11e7 showed binding to CSF-1R-ECD. The control anti-CCR5 antibody m&lt;CCR5&gt;PzO3.1C5 did not bind to the CSF-1 R-ECD.</td>

<td> Figure 2e</td><td> Biacore sensogram of binding of different anti-CSF-1R antibodies to immobilized human CSF-1R fragment delD4 (comprising the extracellular subdomains D1 -D3 and D5) (SEQ ID NO; 65) (y-axis: binding signal in Response Units (RU), baseline = 0 RU, x-axis: time in seconds (s)): All anti-CSF-lR antibodies 1.2.SM, CX11G6, ab 10676 and MAB3291 show binding to to the CSF-1R fragment delD4. The control anti-CCR5 antibody m&lt;CCR5&gt;PzO3.1C5 did also not bind to the CSF-1R fragment delD4.</td>

<td> Figure 2f</td><td> Biacorc sensogram of binding of different anti-CSF-1R antibodies to immobilized human CSF-1R Extracellular Domain (CSF-1 R-ECD) (comprising the extracellular subdomains DI D5) (SEQ ID NO: 64) (y-axis: binding signal in Response Units (RU), baseline = 0 RU, x-axis: time in seconds (s)):: All anti-CSF-lR antibodies 1.2.SM, CXIIG6, abl0676 and MAB3291 show binding to CSF-1 R-ECD. The control antiCCR5 antibody m&lt;CCR5&gt;Pz03.1C5 did not bind to the CSF-1 RECD.</td>

<td> Figure 3a-d</td><td> CSF-1 levels in Cynomolgus monkey after application of different dosages of anti-CSF-lR antibody according to the invention</td>

Figure 4 In vivo efficacy - tumor growth inhibition of anti-CSF-lR antibodies according to th invention in breast cancer BT20 xenograft

Examnle 1

Generation of a hybridoma cell line producing anti-CSF-lR antibodies

Immunization procedure of NMRI mice

NMR] mice were immunized with an expression vector pDisplay™ (Invitrogen, USA) encoding the extracellular domain of huCSF-lR by utilizing electroporation. Every mouse was 4 times immunized with lOOgg DNA. When scrum titers of antihuCSF-lR were found to be sufficient, mice were additionally boosted once with 50gg of a 1:1 mixture huCSF-lR ECD/huCSF-lR ECDhuFc chimera in 200 μ&amp;#912; PBS intravenously (i.v.) 4 and 3 days before fusion.

Antigen specific ELISA

Anti-CSF-lR titers in sera of immunized mice were determined by antigen specific ELISA.

0.3 gg/ml huCSF-lR-huFc chimera (soluble extracellular domain) was captured on a streptavidin plate (MaxiSorb; MicroCoat, DE, Cat.No. 11974998/MC1099) with 0.1 mg/mi biotinylated anti Fey (Jackson ImmunoResearch., Cat.No. 109098&amp;#1470;066&amp;#1470;) and horse radish peroxidase (HRP)&amp;#1470;conjugated F(ab’)2 anti mouse IgG (GE Healthcare, UK, Cat.N0.NA9310V) diluted 1/800 in PBS/0.05% Tween20/0.5% BSA was added. Sera from all taps were diluted 1/40 in PBS/0.05% Twcen20/0.5% BSA and serially diluted up to 1/1638400. Diluted sera were added to the wells. Pre-tap scrum was used as negative control. A dilution scries of mouse anti-human CSF-1R Mab3291 (R&amp;D Systems, UK) from 500 ng/ml to 0,25 ng/ml was used as positive control. All components were incubated together for 1,5 hours, Wells were washed 6 times with PBST (PBS/0.2% Tween20) and assays were developed with freshly prepared ABTS® solution (1 mg/ml) (ABI'S: 2,2’-azino bis (3-ethylbenzthiazoline sulfonic acid) for 10 minutes at RT. Absorbance was measured at 405 nm.

Hybridoma generation

The mouse lymphocytes can be isolated and fused with a mouse myeloma cell line using PEG based standard protocols to generate hybridomas. The resulting hybridomas arc then screened for the production of antigen-specific antibodies. For example, single cell suspensions of splenic derived lymphocytes from immunized mice are fused to Ag8 non-secreting mouse myeloma cells P3X63Ag8.653 (ATCC, CRL-1580) with 50% PEG. Cells arc plated at approximately 104 in flat bottom 96 well micro titer plate, followed by about two weeks incubation in selective medium. Individual wells are then screened by ELISA for human anti-CSF-lR monoclonal IgM and IgG antibodies. Once extensive hybridoma growth occurs, the antibody secreting hybridomas are replated, screened again, and if still positive for human IgG, anti-CSF-lR monoclonal antibodies, can be subcloned by FACS. The stable subclones are then cultured in vitro to produce antibody in tissue culture medium for characterization. Antibodies according to the invention could be selected using the determination of the binding of anti-CSF-1 R antibodies to human CSF-1R fragment delD4 and to human CSF-1R Extracellular Domain (CSF-1R-ECD) as described in Example 4, as well as the determination of growth inhibition of N1H3T3 cells transfected with wildtype CSF-1R (ligand dependent signalling) or mutant CSF-1R L301S Y969F (ligand independent signalling) under treatment with anti-CSF-lR monoclonal antibodies as described in Example 5.

Culture of hybridomas

Generated muMAb hybridomas were cultured in RPMl 1640 (PAN - Catalogue No. (Cat. No.) PO4-17500) supplemented with 2 mM L-glutamine (GIBCO - Cat. No.35050-038), 1 mM Na-Pyruvat (GIBCO - Cat. No. 11360-039), lx NEAA (GIBCO - Cat. No. 11140-035), 10% FCS (PAA - Cat. N0.A15-649), lx Pen Strep (Roche - Cat. No. 1074440), lx Nutridoma CS (Roche - Cat. No. 1363743), 50 μΜ Mercaptoethanol (GIBCO - Cat. No.31350-010) and 50 U/ml IL 6 mouse (Roche Cat. No. I 444 581) at 37°C and 5% CO2. Some of the resulting mouse antibodies have been humanized (e.g. Mab 2F11) and been expressed recombinantly.

Example 2

Inhibition of CSF-1 binding to CSF-1 R (ELISA)

By setting-up this assay to first allow for anti-CSF-lR antibody binding to the CSF-1 R -ECD followed by detection of ligand not bound to the receptor bothligand displacing antibodies and dimerization inhibitor anti-CSF-lR antibodies can be tested. The test was performed on 384 well microtiter plates (MicroCoat, DE, Cat.No. 464718) at RT. After each incubation step plates were washed 3 times with PBST.

At the beginning, plates were coated with 0.5 mg/ml goat F(ab’)2 biotinylated anti Fey (Jackson Immuno Research., Cat.No. 109 170) for 1 hour (h).

Thereafter the wells were blocked with PBS supplemented with 0.2% Tween®-20 and 2% BSA (Roche Diagnostics GmbH, DE) for 0.5 h. 75 ng/ml of huCSF-lRhuFc chimera (which forms the dimeric soluble extracellular domain of huCSF-lR) was immobilized to plate for 1 h. Then dilutions of purified antibodies in PBS/0.05% Twccn20/0.5% BSA were incubated for J h. After adding a mixture of 3 ng/ml CSF-1 (Biomol, DE, Cat.No.60530), 50ng/ml biotinylated anti CSF-1 clone BAF216 (R&amp;D Systems,UK) and 1:5000 diluted streptavidin HRP (Roche Diagnostics GmbH, DE, Cat.No. 11089153001) for 1 h the plates were washed 6 times with PBST. Anti CSF-1R SC 2-4A5 (Santa Cruz Biotechnology, US), which inhibits the ligand- receptor interaction, was used as positive control. Plates were developed with freshly prepared BM blue® POD substrate solution (BM blue®: 3,3'-5,5'-Tetramethylbenzidinc, Roche Diagnostics GmbH, DE, Cat.No. 11484281001) for 30 minutes at RT. Absorbance was measured at 370 nm.A decrease of absorbance is found, if the anti-CSF-lR antibody causes a release of CSF-1 from the dimeric complex. All anti-CSF-lR antibodies showed significant inhibition ofthe CSF-1 interaction with CSF-1R (seeTable 1). Anti CSF-1R SC 24A5 (Santa Cruz Biotechnology, US see also Sherr, C.J. et al., Blood 73 (1989) 1786-1793), which inhibits the ligand- receptor interaction, was used as reference control.

PC17EP2010/069090

- »&amp;#1510;Table !:

Calculated 1C50 values for the inhibition of the CSF-1/CSF-1R interaction

<td> CSF-1R Mab</td><td> IC50 CSF-1 /CSF-1R Inhibition | ng/ml]</td>

<td> Mab 2FI1</td><td> 19.3</td>

<td> Mab 2E10</td><td> 20. 6</td>

<td> Mab 2H7</td><td> 18.2</td>

<td> Mab 1G10</td><td> 11.8</td>

<td> SC-2-4A5</td><td> 35.2</td>

Example 3

Inhibition of CSF-l-induced CSF-1 R phosphorylation in NIH3T3-CSF-1R recombinant cells

4.5xlOJ N1H 3T3 cells, retrovirally infected with an expression vector for fulllength CSF-1R, were cultured in DMEM (PAA Cat. No.El5-011), 2mM Lglutamine (Sigma, Cat.N0.G7513, 2mM Sodium pyruvate , lx nonessential aminoacids, 10% FKS (PAA, Cat.No.Al5-649) and 100pg/ml PenStrep (Sigma, Cat.N0. P4333 [10mg/ml]) until they reached confluency. Thereafter cells were washed with scrum-free DMEM media (PAA Cat.No.E 15-01 1) supplemented with sodium selenite [5ng/ml] (Sigma, Cat.No. S9133), transferrin [10pg/ml] (Sigma, Cat.No. T8158), BSA [400gg/ml] (Roche Diagnostics GmbH, Cat.No. 10735078), 4mM L&amp;#1470;glutamine (Sigma, Cat.N0.G7513), 2mM sodium pyruvate (Gibco, Cat.No. 11360), lx nonesscntial aminoacids (Gibco, Cat: 11140-035), 2-mercaptocthanol [0,05mM] (Merck, Cat.No. M7522), 1 00gg/ml and PenStrep (Sigma, Cat. No. P4333) and incubated in 30 μΙ of the same medium for 16 hours to allow for receptor up-regulation. 10 μ&amp;#912; of diluted anti-CSR-lR antibodies were added to the cells for 1.5 h. Then cells were stimulated with 10 μ&amp;#912; of 100 ng/ml huM-CSF-l (Biomol Cat.No.60530) for 5 min. After the incubation, supernatant was removed, cells were washed twice with 80 μ&amp;#912; of ice-cold PBS and 50 μ&amp;#912; of freshly prepared ice-cold lysis buffer (1 50mM NaCl/ 20mM Tris pH 7.5/1 mM EDTA/ ImM EGTA/ 1% Triton X-100 /1 protease inhibitor tablet (Roche Diagnostics GmbH Cat.No.1 836 170) per 10 ml buffcr/10gl/ml phosphatase inhibitor cocktail 1 (Sigma Cat.No. P-2850, lOOx Stock)/ ΙΟμΙ/ml protease inhibitor 1 (Sigma Cat.No.P-5726, lOOx Stock) /ΙΟμΙ/ml 1 M NaF ) was added. After 30 minutes on ice the plates were shaken vigourously on a plateshaker for 3 minutes and then centrifuged 10 minutes at 2200 rpm (Heraeus Megafuge 10).

The presence of phosphorylated and total CSF-1 receptor in the cell lysate was analyzed with Elisa. For detection of the phosphorylated receptor the kit from R&amp;D Systems (Cat. No. DYC3268-2) was used according to the instructions of the supplier. For detection of total CSF-1 R 10 μ 1 of the lysate was immobilized on plate by use of the capture antibody contained in the kit. Thereafter 1:750 diluted biotinylated anti CSF-1 R antibody BAF329 (R&amp;D Systems) and 1:1000 diluted streptavidin-HRP conjugate was added. After 60 minutes plates were developed with freshly prepared ABTS® solution and the absorbance was detected. Data were calculated as %’ of positive control without antibody and the ratio value phospho/total receptor expressed. The negative control was defined without addition ofM-CSF-1. Anti CSF-1 R SC 2-4A5 (SantaCruz Biotechnology, US, see also Sherr, CJ. et al., Blood 73 (1989) 1786-1793), which inhibits the ligandreceptor interaction, was used as reference control.

Table 2:

Calculated 1C50 values for the inhibition of CSF-1 receptor phosphorylation.

<td> CSF-lRMab</td><td> IC50 CSF-1 R Phosphorylation (ng/mlj</td>

<td> Mab2Fll</td><td> 219.4</td>

<td> Mab 2E10</td><td> 752.0</td>

<td> Mab 2H7</td><td> 703.4</td>

<td> Mab 1G10</td><td> 56.6</td>

<td> SC-2-4A5</td><td> 1006.6</td>

Examnle 4

Determination of the binding of anti-CSF-lR antibodies to human CSF-1R fragment delD4 and to human CSF-1R Extracellular Domain (CSF-1R-ECD)

Preparation of human CSF-1R Extracellular Domain (CSF-1R-ECD) (comprising the extracellular subdomains DI -D5, hCSF-lR-ECD) of SEQ ID NO: 64:

pCMV-preS-Fc-hCSF-lR-ECD (7836bp) encodes the complete ECD of human CSF-1R (SEQ ID NO: 64) C-terminally fused to a PreScission protease cleavage site, followed by aal 00-330 of human IgGl and a 6xHis-Tag, under the control of

CMV promoter. The natural signal peptide has been varied by insertion of amino acids G and S after the first M, in order to create a BamHl restriction site.

Preparation of human CSF-1R fragment delD4 (comprising the extracellular subdomains DI -D3 and D5, hCSF-lR-delD4) of SEQ ID NO: 65:

hCSFlR-delD4-Vl&amp;#1470;PreSc-hFc-His was cloned from pCMV-preS-Fc-hCSF-lRECD by means of the Stratagcne QuikChange XL site-directed mutagenesis protocol, using delD4-for with sequence CACCTCCATGTTCTTCCGGTACCCCCCAGAGGTAAG (SEQ ID NO: 68) as the forward primer and dclD4-rcv with the reverse complement sequence as the reverse primer. A protocol variation published in BioTechniques 26 (1999) 680 was used to extend both primers in separate reactions in three cycles proceeding the regular Stratagene protocol:

Two separate 50 μ&amp;#912; reaction mixtures were set up according to the manufacturer’s manual, each containing 10 ng plasmid pCMV-prcS-Fc-hCSFIR-ECD as the template and 10 pM of one of the primers delD4-for or delD4-rev, and 0,5 μ&amp;#912; Pfu DNA polymerase as provided with the kit. Three PCR cycles 95 °C 30 sec / 55 C 60 sec / 68 °C 8 min were run, then 25 μ&amp;#912; each of both reaction mixtures were combined in a new tube and 0,5 μ&amp;#912; fresh Pfu DNA polymerase were added. The regular PCR protocol with 18 temperature cycles as specified by Stratagene in the kit manual was carried out, followed by 2 hrs final digestion with the Dpnl restriction enzyme provided with the kit. Clones bearing the deletion were detected by digestion with Cel II and Not 1 and verified by sequencing.

Protein was prepared by transient transfection in the Hek293 FreeStylc suspension cell system (Invitrogen) according to the manufacturer’s specifications. After 1 week 500 ml supernatant was filtered and loaded onto a 1ml HiTrap MabSelect Xtra (GE healthcare) protein A column (0,2 ml /min). The colomn was washed first with PBS, then with 50 mM Tris/ 150 mM NaCl/ 1 mM EDTA/ pH 7,3. 75 μ&amp;#912; PreScission Protease (GE #27-084301&amp;#1470;) diluted in 375 μ&amp;#912; of the same buffer were loaded onto the column and the closed column was incubated over night at 4 °C with rolling. The column was mounted on top of a 1 ml GSTrap FF column (GE helthcare) and the desired protein was eluted (0,2 ml/min, 0,2 ml fractions). Pooled

PC T/EP2010/069090 fractions were concentrated from 1,8 ml to 0,4 ml by centrifugal ultrafiltration via a

3k Nanoscp and chromatographed over an S200 HR SEC in PBS (0,5 ml/min).

Human CSF-1 R fragment delD4 was obtained in two fractions as a dimeric molecule (pool), V-l ,5 ml; c= 0,30 mg/ml; apparent mass on SDS page 83 kDa, reduced 62 kDa) and as the monomer (pool 2, V=l,4 ml; c - 0,25 mg/ml apparent mass on SDS page 62 kDa). The dimeric form was used for all experiments.

Determination of the binding of anti-CSF-lR antibodies to human CSF-1R fragment delD4 and to human CSF-1R Extracellular Domain (CSF-1R-ECD) (binding signals as Response Units (RU):

Instrument: Biacore T100 (GE Healthcare)

Software: T100 Control, Version 2.0.1

T100 Evaluation, Version 2.0.2

Assayformat Chip: CM5

Temperature: 25°C

CSF-1 R fragments were immobilized via amine coupling. To compare the binding of different anti-CSF-lR antibodies according to the invention one concentration of the test antibody was injected. Anti CSF-1 R Mab3291 (R&D-Systems) and SC 2&#1470; 4A5 (Santa Cruz Biotechnology, US- see also Sherr, C.J. et al., Blood 73 (1989) 1786-1793), was used as reference control, anti-CCR5 m<CCR5>Pz03.1C5 (deposited as DSM ACC 2683 on 18.08.2004 at DSMZ) as negative control, all under the same conditions as the anti-CSF-lR antibodies according to the invention.

Amine coupling of CSF-1 R fragments

Standard amine coupling according to the manufacturer’s instructions: running buffer: PBS-T (Roche: 11 666 789 + 0.05% Twecn20: 11 332 465), activation by mixture of EDC/NHS, injection of human CSF-1 R fragment delD4 (comprising the extracellular subdomains DI -D3 and D5) (SEQ ID NO: 65) and human CSF-1 R Extracellular Domain (CSF-1 R-ECD) (comprising the extracellular subdomains DI -D5) (SEQ ID NO: 64) for 600 seconds at flow rate ΙΟμΙ/min; diluted in coupling buffer NaAc, pH 5.0, c = 10 pg/mL; finally remaining activated carboxyl groups were blocked by injection of 1 M Ethanolamin.

&#1470;62Binding of <CSF1&#1470;R> Mab 2F11, Mab 2E10, Mab 3291 and sc2-4A5 and other anti-CSF-lR antibodies to human CSF-1R fragment delD4 and human CSF&#1470;

1R Extracellular Domain (CSF-1R-ECD) at 25°C

Running buffer: PBS-T (Roche: 11 666 789 + 0.05% Tween20: 11 332 465)

Analyte sample:

Binding was measured at a flow rate of 30 pL/min by one injection of the analyte with concentration c = 10 nM. (for Mab 1G10, Mab 2H7 and humanized hMab 2F1 l&amp;#1470;e7 in second experiment) Each injection was 700 seconds long, followed by a dissociation phase of 180 seconds. Final regeneration was performed after each 10 cycle using 50 mM NaOH, contact time 60 seconds, flow rate 30 pL/min.

Signals were measured by a report point 10 seconds after end of injection. Reference signals (signals from a blank reference flow cell (treated with EDC/NHS and ethanolamine, only) were subtracted to give the binding signals (as RU). If binding signals of nonbinding antibodies were slightly below 0 (Mab 2F11 =-3; 15 Mab 2E10 = -2; Mab 1G10 = - 6, Mab 2H7 =-9; and humanized hMab 2F1 l-c7 = 7) the values were set as 0.

Table 3a:

Binding of <CSF-1R> MAbs to human CSF-1R fragment delD4 and CSF-1RECD and ratio at 25°C, measured by SPR

<td></td><td> Binding to dclD4 LKU]</td><td> Binding to_CSF1R-ECD IKUI</td><td> Ratio of binding of anti-CSFIR antibodies to CSF1R fragment delD4 / to CS F-1R-ECD</td>

<td> Mab 3291</td><td> 1015</td><td> 627</td><td> 1015/627= 1.61</td>

<td> sc24־A5</td><td> 374</td><td> 249</td><td> 374/249= 1.50</td>

<td> Mab2FIl</td><td> 0</td><td> 176</td><td> 0/176 = 0</td>

<td> hMab2Fll-e7</td><td> 0</td><td> 237</td><td> 0/237= 0</td>

<td> Mab 2E10</td><td> 0</td><td> 120</td><td> 0/120 = 0</td>

<td> Mab 1G10</td><td> 0</td><td> 2708</td><td> 0/2708 = 0</td>

<td> Mab 2H7</td><td> 0</td><td> 147</td><td> 0/147 = 0</td>

<td> m&lt;CCR5&gt;Pz03.1C5</td><td> 2</td><td> 5</td><td> -</td>

Mab 2F11 and Mab 2E10 showed binding to the human CSF-1R Extracellular

Domain (CSF-1 R-ECD) (see Fig. 2b); however no binding was detected to CSF-1R fragment delD4. (sec Fig. 2a).

Sc2-4A5 and MAB3291 showed binding to CSF-1R-ECD and to del D4 (see Fig. 2b and 2a).

Thus the ratio of binding of anti-CSFIR antibodies Mab 2F11 and Mab 2E10 to CSF1R fragment delD4 / to CSF-1R-ECD was clearly below 1:50 (= 0.02), while the binding ratio 0fMAB3291 and Sc24&#1470;A5 were 1.61 and 1.50, respectively and were highly above 1:50 (= 0.02). Negative control antibody m<CCR5>Pz03.1C5 did not show any binding (as expected).

Mab IG10, Mab 2H7 and humanized hMab 2F1 l&amp;#1470;e7 showed binding to the human CSF-1R Extracellular Domain (CSF-1R-ECD) (see Fig. 2d); however no binding was detected to CSF-1R fragment de!D4. (see Fig. 2c). Thus the ratio of binding of anti-CSFIR antibodies Mab 1G10, Mab 2H7 and humanized hMab 2Fll-e7 to CSF1R fragment dclD4 1 to CSF-1 R-ECD was clearly below 1:50 (= 0.02).

In a further experiment anti-CSF-lR antibodies 1.2.SM (ligand displacing CSF-1R antibody described in WO2009026303), CX1IG6 (ligand displacing CSF-1 R antibody described in WO 2009/112245), the goat polyclonal anti-CSF-lR antibody abl0676 (abeam) were investigated. Anti-CSF-lR antibody Mab3291 (R&D-Systcms) was used as reference control. Anti-CCR5 m<CCR5>Pz03.1C5 (deposited as DSM ACC 2683 on 18.08.2004 at DSMZ) was used as negative control.

Table 3b:

Binding of <CSF-1R> MAbs to human CSF-1R fragment delD4 and CSF-1RECD and ratio at 25°C, measured by SPR

<td></td><td> Binding to delD4 [RUI</td><td> Binding to_CSF1 R-ECD BUI</td><td> Ratio of binding of anti-CSFIR antibodies to CSF1R fragment delD4 / to CSF-1 R-ECD</td>

<td> MAB3291</td><td> 1790</td><td> 1222</td><td> 1790/1222= 1.47</td>

<td> 1.2.SM</td><td> 469</td><td> 704</td><td> 469/704 = 0.67</td>

<td> CXIIG6</td><td> 1983</td><td> 1356</td><td> 1983/1356= 1.46</td>

<td> ab10676</td><td> 787</td><td> 547</td><td> 787/547- 1.44</td>

<td> m&lt;CCR5&gt;PzO3.1C5</td><td> 0</td><td> 0</td><td> -</td>

1.2.SM, CX11G6, ab 10676 and MAB3291 showed binding to CSF-1 R-ECD and to del D4 (see Fig. 2f and 2c).

The binding ratio of 1.2.SM, CX11G6, abl0676 and MAB3291 was highly above 1:50 (= 0.02). Negative control antibody m<CCR5>Pz03.1C5 did not show any binding (as expected).

Example 5

Growth inhibition of NIH3T3-CSF-1R recombinant cells in 3D culture under treatment with anti-CSF-lR monoclonal antibodies (CellTiterGlo-assay)

NIH 3T3 cells, rctrovirally infected with cither an expression vector for full-length wildtype CSF-1R (SEQ ID NO: 62) or mutant CSF-1R L301S Y969F (SEQ ID NO: 63), were cultured in DMEM high glucose media (PAA, Pasching, Austria) supplemented with 2mM L-glutamine, 2mM sodium pyruvate and non-essential amino acids and 10% fetal bovine serum (Sigma, Taufkirchen, Germany) on polyHEMA (poly(2-hydroxycthylmethacrylate)) (Polyscicnces, Warrington, PA, USA)) coated dishes to prevent adherence to the plastic surface. Cells are seeded in medium replacing serum with 5ng/ml sodium selenite, lOmg/ml transferrin, 400gg/ml BSA and 0.05 mM 2-mercaptoethanoL When treated with lOOng/ml huCSF-1 (Biomol, Hamburg, Germany) wtCSF-lR ( expressing cells form dense spheroids that grow three dimensionally, a property that is called anchorage independence. These spheroids resemble closely the three dimensional architecture and organization of solid tumors in situ. Mutant CSF-1R recombinant cells are able to form spheroids independent of the CSF-1 ligand. Spheroid cultures were incubated for 3 days in the presence of different concentrations of antibody in order to determine an IC50 (concentration with 50 percent inhibition of cell viability). The CclITitcrGlo assay was used to detect cell viability by measuring the ATPcontent of the cells.

Table 5a:

<td> CSF-IRMab</td><td> wtCSF-lR IC50 [pg/ml|</td><td> Mutant CSF-1R IC50 [pg/ml]</td>

<td> Mab2Fll</td><td> 1.1</td><td> 8.0</td>

<td> Mab2E10</td><td> 0.49</td><td> 4.9</td>

<td> Mab 2H7</td><td> 0.31</td><td> 5.3</td>

<td> Mab 1G10</td><td> 0.29</td><td> 14.2</td>

<td> SC 2-4A5</td><td> 10.0</td><td> 10.0</td>

Reference control Mab R&amp;D-Systems 3291 did not show inhibition of mutant CSF-1R recombinant cell proliferation.

In a further experiment the anti-CSF-lR antibody according to the invention hMab 2Fll-e7 and the anti-CSF-lR antibodies 1.2.SM (ligand displacing CSF-1R antibody described in WO2009026303), CXIIG6 (ligand displacing CSF-1R antibody described in WO 2009/112245), the goat polyclonal anti-CSF-lR antibody ab 10676 (abeam), and SC 2-4A5 (Santa Cruz Biotechnology, US- sec also ShciT, C.J. et al., Blood 73 (1989) 1786-1793) were investigated.

Spheroid cultures were incubated for 3 days in the presence of different concentrations of antibody in order to determine an IC30 (concentration with 30 percent inhibition of cell viability). Maximum concentration was 20 pg/ml The CellTiterGlo assay was used to detect cell viability by measuring the ATP-content of the cells.

Table 5b:

<td> CSF-IRMab</td><td> wtCSF-lR IC30 [gg/ml]</td><td> Mutant CSF-1 R IC30 Igg/ml]</td>

<td> hMab 2F11-67</td><td> 4.91</td><td> 0.54</td>

<td> 1.2.SM</td><td> 1.19</td><td> &gt;20 pg/ml (-19% inhibition at 20 pg/ml = 19% stimulation)</td>

<td> CX11G6</td><td> &gt;20 rtg/ml (21% inhibition at 20 pg/mi)</td><td> &gt; 20 pg/ml (-36% inhibition at 20 pg/ml = 36% stimulation)</td>

<td> ab10676</td><td> 14.15</td><td> &gt; 20 gg/ml (0% inhibition at 20 gg/ml)</td>

<td> SC 2-4A5</td><td> 16.62</td><td> 2.56</td>

Example 6

Growth inhibition of BeWo tumor cells in 3D culture under treatment with anti-CSF-1 R monoclonal antibodies (CellTiterGlo-assay)

BeWo choriocarcinoma cells (ATCC CCL-98) were cultured in F12K media (Sigma, Steinheim, Germany) supplemented with 10% FBS (Sigma) and 2mM L-glutamine. 5xl04 cells/well were seeded in 96-well poly-HEMA (poly(2-hydroxycthylmethacrylate)) coated plates containing F12K medium supplemented with 0.5 % FBS and 5% BSA. Concomitantly, 200 ng/ml huCSF-1 and lOgg/ml of different anti-CSF-1 R monoclonal antibodies were added and incubated for 6 days. The CcllTiterGlo assay was used to detect cell viability by measuring the ATP-content of the cells in relative light units (RLU). When BeWo spheroid cultures were treated with different anti-CSF-1 R antibodies (10 pg/ml) inhibition of CSF-1 induced growth was observed. To calculate antibody-mediated inhibition the mean RLU value of unstimulated BeWo cells was subtracted from all samples. Mean RLU value of CSF-1 stimulated cells was set arbitrarily to 100%. Mean RLU values of cells stimulated with CSF-1 and treated with anti-CSF-1 R antibodies were calculated in % of CSF-1 stimulated RLUs. The Table 6 shows the calculated data of growth inhibition of BeWo tumor cells in 3D culture under treatment with anti-CSF-1 R monoclonal antibodies; Fig.la and b depicts normalized mean RLU values.

Table 6:

<td> CSF-1 R Mab</td><td>⁰/״inhibition 10gg/ml antibody concentration</td>

<td> CSF-1 only</td><td> 0</td>

<td> Mab 2F11</td><td> 70</td>

<td> Mab2E10</td><td> 102</td>

<td> Mab 2H7</td><td> 103</td>

<td> Mab 1G10</td><td> 99</td>

<td> SC 2-4A5</td><td> 39</td>

Examole 7

Inhibition of human macrophage differentiation under treatment with anti-

CSF-1R monoclonal antibodies (CellTiterGlo-assay)

Human monocytes were isolated from peripheral blood using the RosettcScp1M Human Monocyte Enrichment Cocktail (StemCell Tech, - Cat. No. 15028). Enriched monocyte populations were seeded into 96 well microtiterplates (2.5xl04 cells/wcll) in 100 μ&amp;#912; RPM1 1640 (Gibco - Cat. No.31870) supplemented with 10% 10 FCS (GIBCO - Cat. No.011-090014M), 4 mM L-glutamine (GIBCO - Cat.

No.25030) and lx PenStrep (Roche Cat. No.l 074 440) at 37°C and 5% CO2 in a humidified atmosphere. When 150 ng/ml huCSF-1 was added to the medium, a clear differentiation into adherent macrophages could be observed. This differentiation could be inhibited by addition of anti-CSF-lR antibodies. 15 Furthermore, the monocyte survival is affected and could be analyzed by

CellTiterGlo (CTG) analysis. From the concentration dependent inhibition of the survival of monocytes by antibody treatment, an IC50 was calculated (see Tabic 7).

Table 7:

<td> CSF-IR Mab</td><td> IC50 [ pg/ml|</td>

<td> Mab2Fl 1</td><td> 0.08</td>

<td> Mab 2E10</td><td> 0.06</td>

<td> Mab 2H7</td><td> 0.03</td>

<td> Mab 1G10</td><td> 0.06</td>

<td> SC 2-4A5</td><td> 0.36</td>

In a separate test series humanized versions of Mab 2 Fl 1, e.g. hMab 2F11-cl 1, hMab 2Fll-d8, hMab 2Fll-e7, hMab 2Fll-fl2, showed IC50 values of 0.07 pg/ml (hMab 2Fll-cll), 0.07 gg/ml (hMab 2FH-d8), 0.04 pg/ml (hMab 2F11-67) and 0.09 μ grin I (hMab 2FI l-fl2).

Esamplg 8

Inhibition of cynomolgous macrophage differentiation under treatment with anti-CSF-IR monoclonal antibodies (CellTiterGlo-assay)

Cynomolgous monocytes were isolated from peripheral blood using the CD 14 MicroBeads non-human primate kit (Miltenyi Biotec - Cat.No. 130-091097&amp;#1470;) according to the manufacturers description. Enriched monocyte populations were seeded into 96 well microtiterplates (l-3xl04 cells/well) in 100 μ&amp;#912; RPM1 1640 (Gibco - Cat. No.31870) supplemented with 10% FCS (G1BCO - Cat. No.011&amp;#1470; 090014M), 4 mM L-glutamine (GIBCO - Cat. No.25030) and lx PenStrcp (Roche Cat. No.l 074 440) at 37°C and 5% CO2 in a humidified atmosphere. When 150 ng/ml huCSF-1 was added to the medium, a clear differentiation into adherent macrophages could be observed. This differentiation could be inhibited by addition of anti-CSF-IR antibodies. Furthermore, the monocyte survival is affected and could be analyzed by CcllTitcrGIo (CTG) analysis. The viability was analyzed at a concentration of 5 pg/ml antibody treatment (see Table 8).

Table 8:

<td> CSF-IRMab</td><td> % survival</td><td> % inhibition (of survival) = (100% - %survival)</td>

<td> Mab 2F11</td><td> 4 *</td><td> 96</td>

<td> Mab2E10</td><td> ןy **</td><td> 83</td>

<td> Mab 2H7</td><td> 8</td><td> 92</td>

<td> Mab 1G10</td><td> 2</td><td> 98</td>

<td> SC 2-4A5</td><td> 31</td><td> 69</td>

* mean of four experiments (3 expts, using the murine, 1 expt, using the chimeric mAb) * * mean of two experiments using the murine mAb only

Example 9

Determination of the binding affinity of anti-CSF-lR antibodies to human CSF-1R

Instrument: B1ACORE®A100

Chip: CM5 (Biacorc BR 68)

Coupling: amine coupling

Buffer: PBS (Biacore BR 72), pH 7.4, 35°C

For affinity measurements 36 μg/ml anti mouse Fey antibodies (from goat, Jackson Immuno Reasearch JIRI 15 071) have been coupled to the chip surface for capturing the antibodies against CSF-1R. Human CSF-1R Extracellular Domain (CSF-1R-ECD) (comprising the extracellular subdomains DI -D5) (SEQ ID NO: 64) (R&amp;D-Systems 329-MR or subcloned pCMV-presS-HisAvitag-hCSF-lRECD) was added in various concentrations in solution. Association was measured by an CSF-lR-injection of 1.5 minutes at 35 °C; dissociation was measured by washing the chip surface with buffer for 10 minutes at 35 °C. For calculation of kinetic parameters the Langmuir 1:1 model was used.

Table 9:

Affinity data measured by SPR

<td> CSF-1 R Mab</td><td> K_D (״M)</td><td> k_tt (1/Ms)</td><td> ka (1/s)</td><td> 11/2 (min)</td>

<td> Mab 2F11</td><td> 0.29</td><td> E77E⁺⁰⁵</td><td> 5.18E^^S</td><td> 223</td>

<td> Mab 2E10</td><td> 0.2</td><td> 1.52E^+U:!</td><td> 2.97E^</td><td> 389</td>

<td> Mab 2H7</td><td> 0.21</td><td> 1.47E^+US</td><td> 3.12£^</td><td> 370</td>

<td> Mab IG10</td><td> 0.36</td><td> E75E^+U&gt;</td><td> 6.28E^</td><td> 184</td>

In a separate biacore binding assay using the CSF-1R ECD (data not shown) some competition ofthe antibodies Mab 2F11 and Mab 2E10 with the antibody Ab SC2-4A5 was shown. However Mab 2F11/Mab 2E10 do not bind to the human CSFIR fragment delD4, whereas Ab SC. 4A5 binds to this de!D4 fragment (see Example 4 and Fig 2a). Thus the binding region of Mab 2F11/Mab 2E10 is clearly distinct from the binding region of Ab SC 4A5, but probably located in a vicinity area. In such competition assay both antibodies Mab 2F11 and Mab 2E10 did not compete with Mab3291 from R&amp;D-Systcms (data not shown).

Example 10

Determination of the binding of anti-CSF-lR antibodies to human CSF-1R fragment D1-D3

Instrument: Biacore T100 (GE Healthcare)

Software: T100 Control, Version 1.1.11

B3000 Evaluation, Version 4.01 Scrubber, Version 2.0a

Assayformat Chip:CM5-Chip

Antibodies against CSF-1 R were captured via amine coupled capture molecules. Using the single cycle kinetics five increasing concentrations of human CSF-1R fragment D1-D3 (SEQ ID NO: 66) were injected. Human CSF-1R fragment D1-D3 was subcloncd into pCMV-presS-HisAvitag expression vector.

Anti CSF-1 R SC 2-4A5 (Santa Cruz Biotechnology, US; Shcrr. C.J. ct al. Blood 73 (1989) 1786-1793) which inhibits the ligand-receptor interaction, and Mab 3291 (R&amp;D-Systems) were used as reference controls.

Capture molecules: Anti mouse Fey antibodies (from goat, Jackson Immuno

Reasearch JIRI 15 071) for antibodies according to the invention and the

R&amp;D-Systems control Mab 3291 and Anti rat Fey antibodies (from goat, Jackson

Immuno Reasearch JIRI 12 071) for the reference control anti CSF-IR SC 24A5.

Amine coupling of capture molecules

Standard amine coupling according to the manufacturer’s instructions: running buffer: HBS-N buffer, activation by mixture of EDC/NHS, aim for ligand density of 2000 RU; the capturc-Abs were diluted in coupling buffer NaAc, pH 4.5, c = 10 pg/mL; finally remaining activated carboxyl groups were blocked by injection of 1 M Ethano lamin.

Kinetic characterization of human CSF-IR fragments D1-D3 binding to MAbs <CSF-1R> at 37°C

Running buffer: PBS (Biacore BR 72)

Capturing of Mabs <CSF-1R> on flow cells 2 to 4: Flow 20 pL/min, contact time 90 seconds, c(Abs<CSF-1 R>) = 50 nM, diluted with running buffer + 1 mg/mL BSA;

Analyte sample:

Single Cycle Kinetics was measured at a Bow rate of 30 pL/min by five consecutive injections of the analyte with concentrations, c = 7.8 , 31.25, 125 500 and 2000 nM, without regeneration. Each injection was 30 seconds long and followed by a dissociation phase of 120 Seconds for the first four injections, and finally 1200 seconds for the highest concentration (Hast injection).

Final regeneration was performed after each cycle using 10 mM Glycin pH 1.5 (Biacore BR 54), contact time 60 seconds, flow rate 30 pL/min.

Kinetic parameters were calculated by using the usual double referencing (control reference: binding of analyte to capture molecule; Flow Cell: subdomain CSF-IR concentration “0” as Blank) and calculation with model ‘titration kinetics 1:1 binding with draft’.

&amp;#1470; 72 Table 10:

Affinity data for binding of human CSF-1 R fragment D1-D3 measured by

SPR

<td> CSF-1R Mab</td><td> Sub domain</td><td> Kd (nM)</td><td> k_a(l/Ms)</td><td> ka (1/s)</td><td> ti/2 (min)</td>

<td> Mab 2F11</td><td> D1-D3</td><td> no binding</td><td></td><td></td><td></td>

<td> Mab 2E10</td><td> D1-D3</td><td> no binding</td><td></td><td></td><td></td>

<td> Mab 2H7</td><td> D1-D3</td><td> not determined</td><td></td><td></td><td></td>

<td> Mab 1G10</td><td> D1-D3</td><td> no binding</td><td></td><td></td><td></td>

<td> SC-2-4A5</td><td> D1-D3</td><td> no binding</td><td></td><td></td><td></td>

<td> R&amp;D-Systcms 3291</td><td> D1-D3</td><td> 5.4</td><td> 2.2E⁺⁵</td><td> 1.2E³־</td><td> 9.6</td>

The antibodies Mab 2F11, Mab 2E10 and Mab 1G10 showed no binding to human CSF-1 R fragment D1-D3

Also reference control-Ab SC 4A5 did not bind to human CSF-1 R fragment DID3.

The reference control Mab R&amp;D-Systems 3291 showed binding to the human CSF1R frag ment D1-D3.

Example 11

CSF-1 level increase during CSF-1R inhibition in Cynomolgus monkey

Serum CSF-1 levels provide a pharmacodynamic marker of CSF-1 R neutralizing activity of anti-human CSF-1 R dimerization inhibitor hMab 2FlI-e7. One male and one female cynomolgus monkey per dosage group (1 and 10 mg/kg) were intravenously administered anti-CSFIR antibody hMab 2FI l-e7. Blood samples for analysis of CSF-1 levels were collected 1 week before treatment (pre-dose), 2, 24, 48, 72, 96, 168 hours post-dose and weekly for two additional weeks. CSF-1 levels were determined using a commercially available ELISA kit (Quantikine® human M-CSF) according to the manufacturer’s instructions (R&amp;D Systems, UK.). Monkey CSF-1 level were determined by comparison with CSF-1 standard curve samples provided in the kit.

Administration of hMab 2F1 l-c7 induced a dramatic increase in CSF-1 by ~ 1000fold, which depending on the dose administered lasted for 48 hr (1 mg/kg) or 15 days (lOmg/kg). Hence, a dimerization inhibitor for CSF-1 R offers the advantage to not directly compete with the dramatically upregulatcd ligand for binding to the receptor in contrast to a ligand displacing antibody.

Example 12

In vivo efficacy - tumor growth inhibition of anti-CSF-lR antibodies in breast cancer BT20 xenograft tumor cells in SCID beige mice

The human breast cancer cell line BT-20 expresses human CSF-1 R but lacks CSF-1 expression (Sapi, E. et al Cancer Res 59 (1999) 5578-5585). Since the mouse derived CSF-1 fails to activate human CSF-1R on the tumor cells recombinant human CSF-1 (Biomol, Hamburg, Germany) was supplemented via osmotic minipumps (ALZET, Cupertino, CA) providing a continuous CSF-1 infusion rate 0f2gg/day (Martin, T.A., Carcinogenesis 24 (2003) 1317-1323).

To directly compare the efficacy of an antibody interfering with dimerization of CSF-1 R with a ligand displacing CSF-1 R antibody we tested the chimeric antiCSF-1 R Mab 2F11 (antibody interfering with dimerization of CSF-1R) and 1.2.SM (ligand displacing CSF-IR antibody described in WO2009026303) in the BT-20 xenograft model.

SCID beige mice (Charles River, Sulzfeld, Germany) were subcutaneously coinjected with lx 107 cells BT-20 cells (ATCC HTB-19) and 100μ1 of Matrigel . Treatment of animals started at day of randomization at a mean tumor volume of 100 mm3. Mice arc treated once weekly i.p. with the respective antibodies (see figure 4) in 20mM Histidine, 140 mM NaCl pH 6.0 buffer. The tumor dimensions are measured by caliper beginning on the staging day and subsequently 2 times per week during the whole treatment period. Tumor volume is calculated according to NCI protocol (Tumor weight = l/2ab2, where “a” and “b” are the long and the short diameters of the tumor, respectively).

Tumor growth analysis is shown in Figure 4. Inhibition of human CSF-1 R on tumor cells with the chimeric anti-CSF-lR Mab 2FI1 was statistically more efficacious in mediating tumor growth inhibition than anti-CSF-lR antibody 1.2.SM (CSF-IR antibody described in WO2009026303).

Case 26143_sequence listing.txt SEQUENCE LISTING

<td> &lt;110&gt;</td><td> F. Hoffmann-La Roche AG</td>

<td> &lt;120&gt;</td><td> Antibodies against human CSF-1R and uses thereof</td>

<td> &lt;130&gt;</td><td> 26143 WO</td>

<td> &lt;150&gt; &lt;151&gt;</td><td> EPO9O1531O 2009-12-10</td>

<td> &lt;150&gt; &lt;151&gt;</td><td> EP10173407 2010-08-19</td>

<td> &lt;160&gt;</td><td> 84</td>

<td rowspan="2"> &lt;170&gt; &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt; &lt;400&gt; Asp Gin 1</td><td colspan="2"> Patentin version 1 8 PRT Mus musculus 1</td><td colspan="2"> 3.5</td>

<td> 1 Arg Leu Tyr 5</td><td> Phe</td><td> ASP</td><td> Val</td>

<td colspan="2"> &lt;210&gt; 2 &lt;211&gt; 16 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 2 val lie Trp Thr Asp</td><td> Gly</td><td> Gly</td><td> Thr Asn Tyr Asn Ser Pro Phe Met Ser</td>

<td colspan="2"> 1 5 &lt;210&gt; 3 &lt;211&gt; 5 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 3 Thr Tyr Asp lie Ser 1 5 &lt;210&gt; 4 &lt;211&gt; 8 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 4 Gly Gin ser Phe Ser 1 5 &lt;210&gt; 5 &lt;211&gt; 7 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 5 Gly Ala Ser Asn Arg</td><td> Tyr Tyr</td><td> Pro Thr</td><td> 10 15 Thr</td>

case

5

26143_sequence listing.txt < 210> 6 < 211> 11 < 212> PRT < 213> Mus musculus < 400> 6

Lys Ala Ser Glu Asp Vai Asn Thr

5

Tyr val Ser 10 <210> 7 <211> 116 < 212> PRT < 213> Mus musculus < 400> 7

Gin Vai Gin Leu Lys Glu Ser Gly 1 5

Pro Gly Leu Val Ala Pro Ser Gin

15

Ser Leu Ser lie Thr Cys Thr val 20

Ser Gly Phe ser Leu Thr Thr Tyr 25 30

Asp lie Ser Trp lie Arg Gin Ser

40

Pro Gly Lys Gly Leu Glu Trp Leu 45

Gly val lie Trp Thr Asp Gly Gly

55

Thr Asn Tyr Asn Ser Pro Phe Met 60

Ser Arg Leu ser lie Arg Lys Asp 65 70

Asn Ser Lys ser Gin Val Phe Leu 75 80

Lys Met Asn Arg Leu Gin Thr Asp 85

Asp Thr Ala lie Tyr Tyr Cys Val

95

Arg Asp Gin Arg Leu Tyr Phe Asp val Trp Gly Ala Gly Thr Thr val

105 110

Thr Val Ser Ser < 210> 8 < 211> 106 < 212> PRT < 213> Mus musculus <400> 8

Asn lie Val Met Thr Gin Ser Pro

5

Lys Ser Met ser Met ser val Gly

15

Glu Arg val Thr Leu Asn cys Lys 20

Ala Ser Glu Asp val Asn Thr Tyr 25 30

Val Ser Trp Tyr Gin Gin Gin Pro

40

Glu Gin Ser Pro Lys Leu Leu lie

<img file="IL219595A_D0001.tif" />

Case 26143_sequence listing.txt

Tyr Gly Ala Ser Asn Arg Tyr Thr

55

Gly Val Pro Asp Arg Phe Thr Gly 60

Gly Gly Ser. Thr Thr Asp Phe Thr 65 70

Leu Thr lie Ser Ser val Gin Ala

80

Glu Asp Leu Ala Asp Tyr Phe Cys 85

Gly Gin Ser Phe Ser Tyr Pro Thr

95

Phe Gly Thr Gly Thr Lys Leu Glu lie Lys 105 < 210> 9 < 211> 7 < J212> PRT < 213> Mus musculus < 400> 9

Asp Pro Arg Leu Tyr Phe Asp

5 <210> 10 <211> 16 < 212> PRT < 213> Mus musculus < 400> 10

Val lie Trp Thr Gly Gly Gly Thr Asn 1 5

Tyr Asn Ser Gly 10

Phe Met ser <210> 11 < 211> 5 < 212> PRT < 213> Mus musculus < 400> 11

Ser Phe Asp lie ser 1 5 < 210> 12 < 211> 8 < 212> PRT < 213> Mus musculus < 400> 12

Gly Gin Thr Phe ser Tyr Pro Thr

5 <210> 13 <211> 7 <212> PRT <213> Mus musculus <400> 13

Gly Ala Ser Asn Arg Tyr Thr

<img file="IL219595A_D0002.tif" />

Case

5

26143_sequence listing.txt <210> 14 <211> 11 < 212> PRT < 213> Mus musculus < 400> 14

Lys Ala Ser Glu Asp val val Thr

5 <210> 15 <211> 116 < 212> PRT < 213> Mus musculus < 400> 15

Gin Val Gin Leu Lys Glu Ser Gly 1 5

Tyr val Ser

Pro Gly Leu val Ala Pro Ser Lys

15

Ser Leu ser lie Thr Cys Thr val 20 ser Gly ser ser Leu Asp Ser Phe

30

Asp lie Ser Trp lie Arg Gin Ser

40

Pro Gly Lys Gly Leu Glu Trp Leu 45

Gly val lie Trp Thr Gly Gly Gly 50 55

Thr Asn Tyr Asn Ser Gly Phe Met 60

Ser Arg Leu Arg lie Thr Lys Asp 65 70

Asn Ser Lys Ser Gin val Leu Leu

80

Lys Met Asn Ser Leu Gin Ser Asp 85

Asp Thr Ala lie Tyr Tyr cys val

95

Arg Asp Pro Arg Leu Tyr Phe Asp 100 val Trp Gly Ala Gly Thr Thr val

105 110

Thr val Ser Ser < 210> 16 < 211> 106 < 212> PRT < 213> Mus musculus < 400> 16

Asn lie Val Met Thr Gin Ser Pro 1 5

Lys ser Met Ser Met ser val Gly

15

Glu Arg val Thr Leu Ser Cys Lys 20 val Ser Trp Tyr Gin Gin Lys Pro

40

Ala Ser Glu Asp val val Thr Tyr

30

Asp Gin ser Pro Lys Leu Leu lie case 26143_sequence 1isting.txt

<img file="IL219595A_D0003.tif" />

<td> Tyr</td><td> Gly 50</td><td> Ala</td><td> Ser</td><td> Asn</td><td> Arg</td><td> Tyr 55</td><td> Thr</td><td> Gly</td><td> Vai</td><td> Pro</td><td> Asp 60</td><td> Arg</td><td> Phe</td><td> Thr</td><td> Gly</td>

<td> ser 65</td><td> Gly</td><td> Ser</td><td> Al a</td><td> Thr</td><td> Asp 70</td><td> Phe</td><td> Thr</td><td> Leu</td><td> Thr</td><td> lie 75</td><td> Ser</td><td> Ser</td><td> val</td><td> G1 n</td><td> Ala 80</td>

<td> G1 u</td><td> Asp</td><td> Leu</td><td> Ala</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> cys</td><td> Gly</td><td> Gin</td><td> Thr</td><td> Phe</td><td> Ser</td><td> Tyr</td><td> Pro</td><td> Thr</td>

90 95

Phe Gly Thr Gly Thr Lys Leu Glu lie Lys

100 105 < 210> 17 < 211> 8 < 212> PRT < 213> Artificial <220>

< 223> heavy chain CDR3, hMab 2F11-C11 < 400> 17

Asp Gin Arg Leu Tyr Phe Asp Vai 1 5 <210> 18 <211> 16 < 212> PRT < 213> Artificial <220>

< 223> heavy chain CDR2, hMab 2F11-C11 < 400> 18

Vai lie Trp Thr Asp Gly Gly Thr Asn Tyr Asn Ser Pro Phe Met Ser 15 10 15 < 210> 19 < 211> 5 < 212> PRT < 213> Artificial <220>

< 223> heavy chain CDR1, hMab 2F11-C11 < 400> 19

Thr Tyr Asp lie Ser 1 5 < 210> 20 < 211> 8 < 212> PRT < 213> Artificial <220>

< 223> light chain CDR3, hMab 2F11-C11 <400> 20

Case 26143_sequence list&amp;#1470;!ng.txt

Gly Gin Ser Phe Ser Tyr Pro Thr 1 5 <210> 21 < 211> 7 < 212> PRT < 213> Artificial <22O>

<223> light chain CDR2, hMab 2F11-C11 <400> 21

Gly Ala Ser Asn Arg Tyr Thr 1 5 <210> 22 <211> 11 <212> PRT <213> Artificial <220>

<223> light chain CDR1, hMab 2F11-C11 <400> 22

Arg Ala Ser Glu Asp Val Asn Thr Tyr val Ser 1 5 10 <210> 23 <211> 116 <212> PRT <213> Artificial <22O>

<223> heavy chain variable domain, hMab 2F11-C11 <400> 23

Gin val Gin Leu val Gin Ser Gly 1 5

Ala Glu Val Lys Lys Pro Gly Ser

15

Ser Val Lys val Ser Cys Lys Ala 20

Ser Gly Phe Ser Leu Thr Thr Tyr 25 30

Asp lie Ser Trp lie Arg Gin Ala

40

Pro Gly Gin Gly Leu Glu Trp Met 45

Gly val lie Trp Thr Asp Gly Gly

55

Thr Asn Tyr Asn Ser Pro Phe Met 60

Ser Arg val Thr lie Thr Lys Asp 65 70

Glu Ser Thr Ser Thr Ala Tyr Met 75 80

Glu Leu Ser Ser Leu Arg Ser Glu 85

Asp Thr Ala val Tyr Tyr cys val

95

Arg Asp Gin Arg Leu Tyr Phe Asp 100

Val Trp Gly Gin Gly Thr Thr Val

105 110

Thr Val Ser Ser

Case 26143_sequence listing.txt <210> 24 <211> 106 <212> PRT <213> Artificial <22O>

<223> light chain variable domain, hMab 2F11-C11 <400> 24

Asp lie Gin Met Thr Gin Ser Pro 1 5

Ser Ser Leu Ser Ala Ser val Gly

15

Asp Arg val Thr lie Thr Cys Arg

Ala Ser Glu Asp Val Asn Thr Tyr 25 30 val Ser Trp Tyr Gin Gin Lys Pro 35 40

Gly Lys Ala Pro Lys Leu Leu lie 45

Tyr Gly Ala Ser Asn Arg Tyr Thr

55

Gly val Pro ser Arg Phe Ser Gly 60

Ser Gly Ser Gly Thr Asp Phe Thr 65 70

Leu Thr lie Ser Ser Leu Gin Pro 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys 85

Gly Gin ser Phe Ser Tyr Pro Thr 90 95

Phe Gly Gin Gly Thr Lys Leu Glu lie Lys 105 < 210> 25 < 211> 8 < 212> PRT < 213> Arti fi ci al <22O>

< 223> heavy chain CDR3, hMab 2Fll-d8 < 400> 25

Asp Gin Arg Leu Tyr Phe Asp val 1 5

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 26 16 PRT Artifi ci al</td>

<td> &lt;22O&gt; &lt;223&gt;</td><td> heavy chain CDR2, hMab 2Fll-d8</td>

<td> &lt;400&gt;</td><td> 26</td>

val lie Trp Thr Asp Gly Gly Ala Asn Tyr Ala Gin Lys Phe Gin Gly 15 10 15 case 26143_sequence listing.txt < 210> 27 < 211> 5 < 212> PRT < 213> Artificial <220>

< 223> heavy chain CDR1, hMab 2Fll-d8 <400> 27

Thr Tyr Asp lie Ser 1 5 < 210> 28 < 211> 8 < 212> PRT < 213> Artificial <220>

< 223> light chain CDR3, hMab 2Fll-d8 < 400> . 28

Gly Gin Ser Phe Ser Tyr Pro Thr 1 5 <210> 29 < 211> 7 < 212> PRT < 213> Artificial <220>

<223> light chain CDR2, hMab 2Fll-d8 <400> 29

Gly Ala Ser Asn Arg Tyr Thr 1 5

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 30 11 PRT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> light chain CDR1, hMab 2Fll-d8</td>

<td> &lt;400&gt;</td><td> 30</td>

<td> Lys Ala 1</td><td> Ser Glu Asp 5</td><td> Val Asn</td><td> Thr Tyr</td><td> val 10</td><td> Ser</td><td></td>

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 31 116 PRT Artifi ci al</td><td></td><td></td><td></td><td></td><td></td>

<td> &lt;220&gt; &lt;223&gt;</td><td> heavy chain</td><td> variable</td><td> domai n,</td><td> hMat</td><td> 1 2Fll-d8</td><td></td>

<td> &lt;400&gt;</td><td> 31</td><td></td><td></td><td></td><td></td><td></td>

<td> Gin Vai 1</td><td> Gin Leu val 5</td><td> Gin Ser</td><td> Gly Ala</td><td> Glu 10</td><td> val Lys Lys</td><td> pro Gly Ser 15</td>

<img file="IL219595A_D0004.tif" />

Case 26143_sequence listing.txt

Ser Val Lys val Ser Cys Lys Ala Ser Gly Phe Ser Leu Thr Thr Tyr 20 25 30

Asp lie ser Trp val 35

Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met 40 45

Gly val lie Trp Thr Asp Gly Gly

55

Ala Asn Tyr Ala Gin Lys Phe Gin 60

Gly Arg val Thr lie Thr Ala Asp 65 70

Glu Ser Thr Ser Thr Ala Tyr Met 75 80

Glu Leu Ser Ser Leu Arg Ser Glu 85

Asp Thr Ala val Tyr Tyr Cys Ala

95

Arg Asp Gin Arg Leu Tyr Phe Asp val Trp Gly Gin Gly Thr Thr Val

105 110

Thr val Ser Ser < 210> 32 < 211> 106 < 212> PRT < 213> Artificial <220>

< 223> light chain variable domain, hMab 2Fll-d8 <400> 32

Asp lie Gin Met Thr Gin Ser Pro 1 5

Ser Ser Leu Ser Ala Ser val Gly

15

Asp Arg Val Thr lie Thr cys Lys 20

Ala Ser Glu Asp val Asn Thr Tyr 25 30 val ser Trp Tyr Gin Gin Lys Pro

40

Gly Lys Ala Pro Lys Leu Leu lie 45

Tyr Gly Ala Ser Asn Arg Tyr Thr

55

Gly val Pro Ser Arg Phe Ser Gly 60

Ser Gly ser Gly Thr Asp Phe Thr 65 70

Leu Thr lie Ser ser Leu Gin Pro 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys 85

Phe Gly Gin Gly Thr Lys Leu Glu lie Lys 105 <210> 33 <211> 8 <212> PRT <213> Artificial

Gly Gin ser Phe Ser Tyr Pro Thr

95

Case 26143_sequence 1 &#1493;sting.txt <220>

<223> heavy chain CDR3, hMab 2Fll-e7 <400> 33

Asp Gin Arg Leu Tyr Phe Asp Vai

5 <210> 34 <211> 16 < 212> PRT < 213> Artificial <22O>

< 223> heavy chain CDR2, hMab 2Fll-e7 < 400> 34

Vai lie Trp Thr Asp Gly Gly Thr Asn Tyr Ala Gin Lys Leu Gin Gly 15 1015

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 35 5 PRT Arti ficial</td>

<td> &lt;22O&gt; &lt;223&gt;</td><td> heavy chain CDRI, hMab 2Fll-e7</td>

<td> &lt;400&gt;</td><td> 35</td>

Ser Tyr Asp lie Ser 15

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 36 8 PRT Arti fici al</td>

<td> &lt;22O&gt; &lt;223&gt;</td><td> light chain cdr3, hMab 2Fll-e7</td>

<td> &lt;400&gt;</td><td> 36</td>

Gin Gin ser Phe Ser Tyr Pro Thr 15

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 37 7 PRT Arti fi ci al</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> light chain CDR2, hMab 2Fll-e7</td>

<td> &lt;400&gt;</td><td> 37</td>

Ala Ala Ser Asn Arg Tyr Thr 15 <210> 38 <211> 11 <212> PRT <213> Artificial

<img file="IL219595A_D0005.tif" />

case 26143_sequence listing.txt <220>

<223> light chain CDR1, hMab 2Fll-e7 <400> 38

Arg Ala Ser Glu Asp Val Asn Thr Tyr val Ser 1 5 10 <210> 39 <211> 116 < 212> PRT < 213> Artificial <220>

< 223> heavy chain variable domain, hMab 2Fll-e7 < 400> 39

Gin Val Gin Leu Val Gin Ser Gly Ala Glu val Lys Lys Pro Gly Ala 15 1015

Ser val Lys val Ser cys Lys Ala Ser Gly Tyr Thr Phe Thr ser Tyr 20 2530

Asp lie Ser Trp Val Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met 35 4045

Gly val lie Trp Thr Asp Gly Gly Thr Asn Tyr Ala Gin Lys Leu Gin 50 5560

Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr Met 65 70 7580

Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala val Tyr Tyr Cys Ala 85 9095

Arg Asp Gin Arg Leu Tyr Phe Asp Val Trp Gly Gin Gly Thr Thr val

100 105110

Thr Val Ser Ser <210> 40 < 211> 106 < 212> PRT < 213> Artificial <220>

<223> light chain variable domain, hMab 2Fll-e7 <400> 40

Asp lie Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser val Gly 15 10 15

Asp Arg Val Thr lie Thr Cys Arg Ala Ser Glu Asp val Asn Thr Tyr 20 25 30

Case 26143_sequence 1isting.txt val Ser Trp Tyr Gin Gin Lys Pro Gly Lys Ala Pro Lys Leu Leu 11e 35 40 45

Tyr Ala Ala Ser Asn Arg Tyr Thr

55

Ser Gly Ser Gly Thr Asp Phe Thr 65 70

Glu Asp Phe Ala Thr Tyr Tyr Cys 85

Gly Val Pro Ser Arg Phe Ser Gly 60

Leu Thr lie Ser Ser Leu Gin Pro 75 80

Gin Gin Ser Phe Ser Tyr Pro Thr 90 95

Phe Gly Gin Gly Thr Lys Leu Glu lie Lys

100 105 <210> 41 <211> 8 <212> PRT <213> Artificial <220>

<223> heavy chain CDR3, hMab 2Fll-fl2 <400> 41

Asp Gin Arg Leu Tyr Phe Asp Val 1 5 <210> 42 <211> 16 <212> PRT <213> Artificial <220>

<223> heavy chain CDR2, hMab 2Fll-fl2 <400> 42 val lie Trp Thr Asp Gly Gly Thr Asn Tyr Asn Ser Pro Phe Met Ser

10 15

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 43 5 PRT Artifi ci al</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> heavy chain CDR1, hMab 2Fll-fl2</td>

<td> &lt;400&gt;</td><td> 43</td>

Thr Tyr Asp lie Ser 1 5 <210> 44 <211> 8 <212> PRT <213> Artificial <220>

<223> light chain CDR3, hMab 2Fll-fl2 <400> 44 case 26143_sequence listing.txt

Gly Gin Ser Phe Ser Tyr Pro Thr 1 5 < 210> 45 < 211> 7 < 212> PRT < 213> Artificial <220>

< 223> light chain CDR2, hMab 2Fll-fl2 < 400> 45

Gly Ala Ser Ser Leu Gin Ser 1 5 < 210> 46 < 211> 11 < 212> PRT < 213> Artificial <220>

<223> light chain CDR1, hMab 2Fll-fl2 <400> 46

Arg Ala Ser Glu Asp Vai Asn Thr Tyr Vai Ser 1 5 10 <210> 47 <211> 116 <212> PRT <213> Artificial <22O>

<223> heavy chain variable domain, hMab 2Fll-fl2

<td colspan="7"> &lt;400&gt; 47</td><td colspan="2" rowspan="2"> Gly Ala</td><td colspan="2" rowspan="2"> Glu Val 10</td><td rowspan="2"> Lys</td><td rowspan="2"> Lys</td><td colspan="2" rowspan="2"> Pro Gly 15</td><td rowspan="2"> Ser</td>

<td colspan="2"> Gin Vai 1</td><td> Gin</td><td> Leu</td><td> Val 5</td><td> G1 n</td><td> Ser</td>

<td> Ser</td><td> val</td><td> Lys</td><td> val 20</td><td> Ser</td><td> Cys</td><td> Lys</td><td> Ala</td><td> Ser 25</td><td> Gly</td><td> Phe</td><td> Ser</td><td> Leu</td><td> Thr 30</td><td> Thr</td><td> Tyr</td>

<td> Asp</td><td> lie</td><td> Ser 35</td><td> Trp</td><td> val</td><td> Arg</td><td> Gin</td><td> Ala 40</td><td> Pro</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Leu 45</td><td> Glu</td><td> Trp</td><td> Met</td>

<td> Gly</td><td> val 50</td><td> lie</td><td> Trp</td><td> Thr</td><td> ASp</td><td> Gly 55</td><td> Gly</td><td> Thr</td><td> Asn</td><td> Tyr</td><td> Asn 60</td><td> ser</td><td> Pro</td><td> Phe</td><td> Met</td>

<td> Ser 65</td><td> Arg</td><td> val</td><td> Thr</td><td> lie</td><td> Thr 70</td><td> Lys</td><td> Asp</td><td> Glu</td><td> Ser</td><td> Thr 75</td><td> Ser</td><td> Thr</td><td> Ala</td><td> Tyr</td><td> Met 80</td>

<td> G1 u</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Leu 85</td><td> Arg</td><td> Ser</td><td> Glu</td><td> Asp</td><td> Thr 90</td><td> Ala</td><td> val</td><td> Tyr</td><td> Tyr</td><td> cys 95</td><td> val</td>

<td> Arg</td><td> ASp</td><td> Gin</td><td> Arg 100</td><td> Leu</td><td> Tyr</td><td> Phe</td><td> Asp</td><td> val 105</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Thr 110</td><td> Thr</td><td> Val</td>

<img file="IL219595A_D0006.tif" />

Case 26143_sequence listing.txt

Thr val ser Ser <210> 48 <211> 106 <212> PRT <213> Artificial <223> light chain variable domain, hMab 2Fll-fl2 <400> 48

Asp lie Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 15 1015

&amp;#1494;

Asp Arg Val Thr lie Thr Cys Arg Ala Ser Glu Asp val Asn Thr Tyr 20 2530

Val ser Trp Tyr Gin Gin Lys Pro Gly Lys Ala Pro Lys Leu Leu lie 35 4045

Tvr Gly Ala ser Ser Leu Gin Ser Gly val Pro Ser Arg Phe Ser Gly 50 5560

Ser Gly ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu Gin Pro 65 70 7580

Glu Asp Phe Ala Thr Tyr Tyr Cys Gly Gin ser Phe Ser Tyr Pro Thr 85 9095

Phe Gly Gin Gly Thr Lys Leu Glu lie Lys

100105 < 210> 49 < 211> 8 < 212> PRT < 213> Artificial

4220>

<223> heavy chain CDR3, hMab 2Fll-gl <400> 49

Asp Gin Arg Leu Tyr Phe Asp val 1 5 <210> 50 <211> 16 < 212> PRT < 213> Artificial <22O>

< 223> heavy chain CDR2, hMab 2Fll-gl <400> 50 val lie Trp Thr Asp Gly Gly Thr Asn Tyr Asn ser Pro Leu Lys Ser

10 15

Case 26143_sequence 11 sting.txt

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 51 5 PRT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> heavy chain CDRI, hMab 2Fll-gl</td>

<td> &lt;400&gt;</td><td> 51</td>

Thr Tyr Asp lie Ser 15

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 52 8 PRT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> light chain CDR3, hMab 2Fll-gl</td>

<td> &lt;400&gt;</td><td> 52</td>

Gly Gin Ser Phe Ser Tyr Pro Thr

<td> 1</td><td> 5</td>

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 53 7 PRT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> light chain CDR2, hMab 2Fll-gl</td>

<td> &lt;400&gt;</td><td> 53</td>

Gly Ala Ser Ser Arg Ala Thr 15

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 54 11 PRT Artifi ci al</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> light chain CDRI, hMab 2Fll-gl</td>

<td> &lt;400&gt;</td><td> 54</td>

Arg Ala Ser Glu Asp val Asn Thr Tyr Leu Ala 1 510

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td> 55 116 PRT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td> heavy chain variable domain, hMab 2Fll-gl</td>

<td> &lt;400&gt;</td><td> 55</td>

Gin val Gin Leu Gin Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu

<td> 1</td><td> 5 10 15</td>

Ser 65

Lys

Arg

Thr &amp;#906; &amp;#1512; sti ng. txt

Case 26143_sequence

Thr

Asp

Gly

<td> Leu</td><td> ser</td><td> Leu Thr cys 20</td><td> Thr val</td><td> Ser 25</td><td> Gly</td><td> phe Ser</td><td> Leu</td><td> Thr 30</td><td> Thr</td>

<td> lie</td><td> Ser 35</td><td> Trp lie Arg</td><td> Gin Pro 40</td><td> Pro</td><td> Gly</td><td> Lys Gly</td><td> Leu 45</td><td> Glu</td><td> Trp</td>

<td> val 50</td><td> lie</td><td> Trp Thr Asp</td><td> Gly Gly 55</td><td> Thr</td><td> Asn</td><td> Tyr Asn 60</td><td> Ser</td><td> Pro</td><td> Leu</td>

<td> Arg</td><td> val</td><td> Thr lie Ser</td><td> val Asp</td><td> Thr</td><td> ser</td><td> Lys Asn</td><td> Gin</td><td> phe</td><td> Ser</td>

Tyr

He

Lys

Leu 80

Leu

Ser ser

Val 85

Thr

Ala

Ala

Asp

Thr 90

Ala val

Tyr

Tyr cys 95

Ala

Asp

Gin

Arg 100

Leu

Tyr

Phe

Asp val

Trp

Gly

G1 n

Gly

Thr

Thr

Val

Val

Ser 115

Ser <210> 56 <211> 106 <212> PRT <213> Artificial <22O>

<223> light chain variable domain, hMab 2Fll-gl <400> 56

Glu lie val Leu Thr Gin Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 15 1015

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Glu Asp val Asn Thr Tyr 20 2530

Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu lie 35 4045

Tyr Gly Ala Ser Ser Arg Ala Thr Gly lie Pro Asp Arg Phe Ser Gly 50 5560

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Arg Leu Glu Pro 65 70 7580

Glu Asp Phe Ala val Tyr Tyr Cys Gly Gin Ser Phe Ser Tyr Pro Thr 85 9095

Phe Gly Gin

Gly Thr Lys Leu Glu lie Lys

100105 <210> 57 <211> 107

Case <212> PRT <213> Homo sapiens <400> 57

Arg Thr Val Ala Ala Pro Ser Val 1 5

26143_sequence listing.txt

Phe lie Phe Pro Pro Ser Asp Glu

15

Gin Leu Lys Ser Gly Thr Ala Ser 20 val val Cys Leu Leu Asn Asn Phe 25 30

Tyr Pro Arg Glu Ala Lys val Gin 35 40

Trp Lys Val Asp Asn Ala Leu Gin 45

Ser Gly Asn Ser Gin Glu ser Val

55

Thr Glu Gin Asp Ser Lys Asp Ser 60

Thr Tyr Ser Leu Ser ser Thr Leu 65 70

Thr Leu Ser Lys Ala Asp Tyr Glu

80

Lys His Lys Val Tyr Ala Cys Glu 85 val Thr His Gin Gly Leu Ser ser

95

Pro val Thr Lys Ser Phe Asn Arg

Gly Glu cys 105 <210> 58 <211> 330 <212> PRT <213> Homo sapiens <400> 58

<td> Ala 1</td><td> Ser</td><td> Thr</td><td> Lys</td><td> Gly 5</td><td> Pro</td><td> Ser</td><td> val</td><td> Phe</td><td> Pro 10</td><td> Leu</td><td> Ala</td><td> Pro</td><td> ser</td><td> Ser 15</td><td> Lys</td>

<td> ser</td><td> Thr</td><td> Ser</td><td> Gly 20</td><td> Gly</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu 25</td><td> Gly</td><td> Cys</td><td> Leu</td><td> val</td><td> Lys 30</td><td> Asp</td><td> Tyr</td>

<td> Phe</td><td> pro</td><td> Glu 35</td><td> Pro</td><td> val</td><td> Thr</td><td> val</td><td> Ser 40</td><td> Trp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala 45</td><td> Leu</td><td> Thr</td><td> ser</td>

<td> Gly</td><td> val 50</td><td> Hi s</td><td> Thr</td><td> Phe</td><td> Pro</td><td> Ala 55</td><td> val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser 60</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td>

<td> Leu 65</td><td> Ser</td><td> Ser</td><td> val</td><td> val</td><td> Thr 70</td><td> val</td><td> pro</td><td> Ser</td><td> Ser</td><td> ser 75</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Gin</td><td> Thr 80</td>

<td> Tyr</td><td> lie</td><td> Cys</td><td> Asn</td><td> val 85</td><td> Asn</td><td> Hi s</td><td> Lys</td><td> Pro</td><td> Ser 90</td><td> Asn</td><td> Thr</td><td> Lys</td><td> val</td><td> Asp 95</td><td> Lys</td>

<td> Lys</td><td> val</td><td> Glu</td><td> pro 100</td><td> Lys</td><td> ser</td><td> cys</td><td> Asp</td><td> Lys 105</td><td> Thr</td><td> His</td><td> Thr</td><td> Cys</td><td> Pro 110</td><td> Pro</td><td> cys</td>

<td> pro</td><td> Ala</td><td> Pro 115</td><td> Glu</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Gly 120</td><td> Pro</td><td> Ser</td><td> val</td><td> Phe</td><td> Leu 125</td><td> Phe</td><td> Pro</td><td> Pro</td>

Case 26143_sequence listing.txt

<td> Lys</td><td> Pro 130</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met 135</td><td> lie</td><td> ser</td><td> Arg</td><td> Thr</td><td> Pro 140</td><td> Glu</td><td> val</td><td> Thr</td><td> cys</td>

<td> val 145</td><td> val</td><td> val</td><td> Asp</td><td> Val</td><td> ser 150</td><td> Hi s</td><td> Glu</td><td> Asp</td><td> Pro</td><td> Glu 155</td><td> Val</td><td> Lys</td><td> phe</td><td> Asn</td><td> Trp 160</td>

<td> Tyr</td><td> val</td><td> Asp</td><td> Gly</td><td> Val 165</td><td> Glu</td><td> val</td><td> Hi s</td><td> Asn</td><td> Ala 170</td><td> Lys</td><td> Thr</td><td> Lys</td><td> pro</td><td> Arg 175</td><td> Glu</td>

<td> Glu</td><td> Gin</td><td> Tyr</td><td> Asn 180</td><td> ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> Val 185</td><td> val</td><td> Ser</td><td> val</td><td> Leu</td><td> Thr 190</td><td> val</td><td> Leu</td>

<td> Hi s</td><td> G1 n</td><td> Asp 195</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys 200</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys 205</td><td> Val</td><td> Ser</td><td> Asn</td>

<td> Lys</td><td> Ala 210</td><td> Leu</td><td> Pro</td><td> Ala</td><td> Pro</td><td> lie 215</td><td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> Ser 220</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td>

<td> Gin 225</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin 230</td><td> Val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro 235</td><td> Pro</td><td> Ser</td><td> Arg</td><td> Asp</td><td> Glu 240</td>

<td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin 245</td><td> Val</td><td> ser</td><td> Leu</td><td> Thr</td><td> cys 250</td><td> Leu</td><td> val</td><td> Lys</td><td> Gly</td><td> Phe 255</td><td> Tyr</td>

<td> Pro</td><td> Ser</td><td> Asp</td><td> lie 260</td><td> Ala</td><td> val</td><td> Glu</td><td> Trp</td><td> G1 u 265</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro 270</td><td> Glu</td><td> Asn</td>

<td> Α5Π</td><td> Tyr</td><td> Lys 275</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td><td> val 280</td><td> Leu</td><td> Asp</td><td> Ser</td><td> ASp</td><td> Gly 285</td><td> Ser</td><td> phe</td><td> phe</td>

<td> Leu</td><td> Tyr 290</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td><td> val 295</td><td> Asp</td><td> Lys</td><td> Ser</td><td> Arg</td><td> Trp 300</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td>

<td> val 305</td><td> Phe</td><td> ser</td><td> cys</td><td> Ser</td><td> val 310</td><td> Met</td><td> His</td><td> Glu</td><td> Ala</td><td> Leu 315</td><td> Hi s</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr 320</td>

<td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser 325</td><td> Leu</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys 330</td><td></td><td></td><td></td><td></td><td></td><td></td>

<210> 59 <211> 330 <212> PRT <213> Artificial <220>

<223>

human heavy chain constant region derived from igGl mutated on L234A and L235A <400> 59

Ala Ser Thr Lys Gly.Pro Ser val phe Pro Leu Ala Pro Ser Ser Lys 15 10 15

Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu val Lys Asp Tyr • -92Case 26143_sequence listing.txt

25 30

Phe Pro Glu Pro Val Thr val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45

<td> Gly</td><td> val 50</td><td> Hi s</td><td> Thr</td><td> phe</td><td> pro</td><td> Ala 55</td><td> val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser 60</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td>

<td> Leu 65</td><td> Ser</td><td> Ser</td><td> val</td><td> val</td><td> Thr 70</td><td> val</td><td> Pro</td><td> ser</td><td> Ser</td><td> ser 75</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Gin</td><td> Thr 80</td>

<td> Tyr</td><td> He</td><td> Cys</td><td> Asn</td><td> val 85</td><td> Asn</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser 90</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asp 95</td><td> Lys</td>

<td> Lys</td><td> val</td><td> Glu</td><td> Pro 100</td><td> Lys</td><td> Ser</td><td> Cys</td><td> Asp</td><td> Lys 105</td><td> Thr</td><td> Hi s</td><td> Thr</td><td> Cys</td><td> Pro 110</td><td> Pro</td><td> Cys</td>

<td> Pro</td><td> Ala</td><td> pro 115</td><td> Glu</td><td> Ala</td><td> Ala</td><td> Gly</td><td> Gly 120</td><td> pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu 125</td><td> Phe</td><td> Pro</td><td> Pro</td>

<td> Lys</td><td> Pro 130</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met 135</td><td> lie</td><td> ser</td><td> Arg</td><td> Thr</td><td> pro 140</td><td> Glu</td><td> val</td><td> Thr</td><td> Cys</td>

<td> val 145</td><td> val</td><td> Val</td><td> Asp</td><td> val</td><td> Ser 150</td><td> Hi s</td><td> Glu</td><td> Asp</td><td> Pro</td><td> G1 u 155</td><td> Val</td><td> Lys</td><td> Phe</td><td> Asn</td><td> Trp 160</td>

<td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> val 165</td><td> Glu</td><td> val</td><td> Hi s</td><td> Asn</td><td> Ala 170</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg 175</td><td> Glu</td>

<td> Glu</td><td> Gin</td><td> Tyr</td><td> Asn 180</td><td> Ser</td><td> Thr</td><td> Tyr</td><td> Arg</td><td> val 185</td><td> val</td><td> Ser</td><td> val</td><td> Leu</td><td> Thr 190</td><td> val</td><td> Leu</td>

<td> Hi s</td><td> Gin</td><td> Asp 195</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td> Lys 200</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> cys</td><td> Lys 205</td><td> Val</td><td> ser</td><td> Asn</td>

<td> Lys</td><td> Ala 210</td><td> Leu</td><td> Pro</td><td> Al a</td><td> Pro</td><td> lie 215</td><td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> ser 220</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td>

<td> Gin 225</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin 230</td><td> val</td><td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro 235</td><td> pro</td><td> Ser</td><td> Arg</td><td> Asp</td><td> Glu 240</td>

<td> Leu</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin 245</td><td> val</td><td> Ser</td><td> Leu</td><td> Thr</td><td> cys 250</td><td> Leu</td><td> val</td><td> Lys</td><td> Gly</td><td> Phe 255</td><td> Tyr</td>

<td> Pro</td><td> Ser</td><td> ASp</td><td> lie 260</td><td> Ala</td><td> Val</td><td> Glu</td><td> Trp</td><td> Glu 265</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro 270</td><td> Glu</td><td> Asn</td>

<td> Asn</td><td> Tyr</td><td> Lys 275</td><td> Thr</td><td> Thr</td><td> Pro</td><td> pro</td><td> val 280</td><td> Leu</td><td> Asp</td><td> ser</td><td> Asp</td><td> Gly 285</td><td> ser</td><td> Phe</td><td> Phe</td>

<td> Leu</td><td> Tyr 290</td><td> Ser</td><td> Lys</td><td> Leu</td><td> Thr</td><td> val 295</td><td> ASp</td><td> Lys</td><td> ser</td><td> Arg</td><td> Trp 300</td><td> Gin</td><td> Gin</td><td> Gly</td><td> Asn</td>

Case 26143_sequence 11sting.txt

Vai Phe Ser Cys Ser Vai Met His Glu Ala Leu His Asn His Tyr Thr 305 310 315 320

Gin Lys ser Leu ser Leu Ser Pro Gly Lys 325 330 <210> 60 <211> 327 <212> PRT <213> Homo sapiens <400> 60

<td> Ala 1</td><td> Ser</td><td> Thr</td><td> Lys</td><td> Gly 5</td><td> Pro</td><td> ser</td><td> val</td><td> Phe</td><td> Pro 10</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser 15</td><td> Arg</td>

<td> Ser</td><td> Thr</td><td> Ser</td><td> Glu 20</td><td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu 25</td><td> Gly</td><td> cys</td><td> Leu</td><td> val</td><td> Lys 30</td><td> Asp</td><td> Tyr</td>

<td> Phe</td><td> Pro</td><td> Glu 35</td><td> Pro</td><td> val</td><td> Thr</td><td> Val</td><td> Ser 40</td><td> Trp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala 45</td><td> Leu</td><td> Thr</td><td> Ser</td>

<td> Gly</td><td> Val 50</td><td> Hi s</td><td> Thr</td><td> Phe</td><td> Pro</td><td> Al a 55</td><td> val</td><td> Leu</td><td> Gin</td><td> ser</td><td> Ser 60</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td>

<td> Leu 65</td><td> Ser</td><td> Ser</td><td> va!</td><td> Val</td><td> Thr 70</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser 75</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr 80</td>

<td> Tyr</td><td> Thr</td><td> cys</td><td> Asn</td><td> val 85</td><td> ASp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser 90</td><td> Asn</td><td> Thr</td><td> Lys</td><td> val</td><td> Asp 95</td><td> Lys</td>

<td> Arg</td><td> val</td><td> Glu</td><td> Ser 100</td><td> Lys</td><td> Tyr</td><td> Gly</td><td> Pro</td><td> Pro 105</td><td> Cys</td><td> Pro</td><td> Ser</td><td> Cys</td><td> Pro 110</td><td> Ala</td><td> Pro</td>

<td> Glu</td><td> Phe</td><td> Leu 115</td><td> Gly</td><td> Gly</td><td> Pro</td><td> Ser</td><td> val 120</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro 125</td><td> Lys</td><td> Pro</td><td> Lys</td>

<td> Asp</td><td> Thr 130</td><td> Leu</td><td> Met</td><td> lie</td><td> Ser</td><td> Arg 135</td><td> Thr</td><td> pro</td><td> Glu</td><td> Val</td><td> Thr 140</td><td> Cys</td><td> val</td><td> Val</td><td> val</td>

<td> Asp 145</td><td> val</td><td> Ser</td><td> Gin</td><td> Glu</td><td> Asp 150</td><td> Pro</td><td> Glu</td><td> val</td><td> Gin</td><td> Phe 155</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> val</td><td> Asp 160</td>

<td> Gly</td><td> val</td><td> Glu</td><td> Val</td><td> Hi s 165</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys 170</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin 175</td><td> Phe</td>

<td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr 180</td><td> Arg</td><td> val</td><td> val</td><td> Ser</td><td> Val 185</td><td> Leu</td><td> Thr</td><td> val</td><td> Leu</td><td> His 190</td><td> Gin</td><td> ASp</td>

<td> Trp</td><td> Leu</td><td> Asn 195</td><td> Gly</td><td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys 200</td><td> cys</td><td> Lys</td><td> val</td><td> ser</td><td> Asn 205</td><td> Lys</td><td> Gly</td><td> Leu</td>

Pro Ser Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg

210 215 220 φ -94Case 26143_sequence listing.txt

Glu Pro Gin Vai Tyr Thr Leu Pro

225 230

Pro ser Gin Glu Glu Met Thr Lys

235 240

Asn Gin Vai ser Leu Thr Cys Leu val Lys Gly Phe Tyr Pro Ser Asp

250 255 lie Ala val Glu Trp Glu Ser Asn 260

Gly Gin Pro Glu Asn Asn Tyr Lys 265 270

Thr Thr Pro Pro val Leu Asp Ser

275 280

Asp Gly ser Phe Phe Leu Tyr Ser

Arg Leu Thr Val Asp Lys Ser Arg

290 295

Trp Gin Glu Gly Asn val Phe Ser 300

Cys ser val Met His Glu Ala Leu 305 310

His Asn His Tyr Thr Gin Lys Ser

315 320

Leu Ser Leu Ser Leu Gly Lys <210> 61 <211> 327 <212> PRT <213> Artificial <220>

<223>

human heavy chain constant region derived from igG4 mutated onS228P <400> 61

Ala Ser Thr Lys Gly Pro ser val 1 5

Phe Pro Leu Ala Pro Cys Ser Arg

15

Ser Thr ser Glu Ser Thr Ala Ala 20

Phe Pro Glu Pro Val Thr val Ser 35 40

Leu Gly Cys Leu Val Lys Asp Tyr 25 30

Trp Asn Ser Gly Ala Leu Thr ser 45

Gly val His Thr Phe Pro Ala val

55

Leu Gin Ser Ser Gly Leu Tyr ser 60

Leu Ser ser val val Thr val Pro 65 70 ser Ser Ser Leu Gly Thr Lys Thr

80

Tyr Thr Cys Asn val Asp His Lys 85

Arg val Glu Ser Lys Tyr Gly Pro 100 pro ser Asn Thr Lys val Asp Lys

95 pro Cys Pro Pro Cys Pro Ala Pro

105 110

Glu Phe Leu Gly Gly Pro Ser val

Phe Leu Phe Pro Pro Lys Pro Lys

<td rowspan="2"></td><td rowspan="2"> 115</td><td colspan="2"> Case 26143_sequence listing.txt</td>

<td> 120</td><td> 125</td>

<td> Asp</td><td> Thr Leu Met lie</td><td> Ser Arg Thr Pro Glu Val</td><td> Thr cys val Val Val</td>

<td></td><td> 130</td><td> 135</td><td> 140</td>

<td> Asp</td><td> val Ser Gin Glu</td><td> Asp Pro Glu Val Gin Phe</td><td> Asn Trp Tyr val Asp</td>

<td> 145</td><td></td><td> 150 155</td><td> 160</td>

<td> Gly</td><td> Val Glu val His</td><td> Asn Ala Lys Thr Lys Pro</td><td> Arg Glu Glu Gin Phe</td>

<td></td><td> 165</td><td> 170</td><td> 175</td>

<td> Asn</td><td> Ser Thr Tyr Arg</td><td> Val Val Ser val Leu Thr</td><td> val Leu His Gin Asp</td>

<td></td><td> 180</td><td> 185</td><td> 190</td>

<td> Trp</td><td> Leu Asn Gly Lys</td><td> Glu Tyr Lys Cys Lys val</td><td> Ser Asn Lys Gly Leu</td>

<td></td><td> 195</td><td> 200</td><td> 205</td>

<td> Pro</td><td> Ser ser lie Glu</td><td> Lys Thr lie Ser Lys Ala</td><td> Lys Gly Gin Pro Arg</td>

<td></td><td> 210</td><td> 215</td><td> 220</td>

<td> Glu</td><td> Pro Gin Val Tyr</td><td> Thr Leu Pro Pro Ser Gin</td><td> Glu Glu Met Thr Lys</td>

<td> 225</td><td></td><td> 230 235’</td><td> 240</td>

<td> Asn</td><td> Gin Val Ser Leu</td><td> Thr Cys Leu val Lys Gly</td><td> Phe Tyr Pro Ser Asp</td>

<td></td><td> 245</td><td> 250</td><td> 255</td>

<td> lie</td><td> Ala Val Glu Trp</td><td> Glu Ser Asn Gly Gin Pro</td><td> Glu Asn Asn Tyr Lys</td>

<td></td><td> 260</td><td> 265</td><td> 270</td>

<td> Thr</td><td> Thr Pro Pro val</td><td> Leu Asp Ser Asp Gly Ser</td><td> Phe Phe Leu Tyr Ser</td>

<td></td><td> 275</td><td> 280</td><td> 285</td>

<td> Arg</td><td> Leu Thr val Asp</td><td> Lys Ser Arg Trp Gin Glu</td><td> Gly Asn Val Phe Ser</td>

<td></td><td> 290</td><td> 295</td><td> 300</td>

<td> cys</td><td> Ser val Met His</td><td> Glu Ala Leu His Asn His</td><td> Tyr Thr Gin Lys Ser</td>

<td> 305</td><td></td><td> 310 315</td><td> 320</td>

<td> Leu</td><td> ser Leu ser Leu</td><td> Gly Lys</td><td></td>

<td></td><td> 325</td><td></td><td></td>

<210> 62 <211> 972 <212> PRT <213> Homo sapiens <400> 62

Met Gly Pro Gly Val 1 5

Leu Leu Leu Leu Leu val Ala Thr Ala Trp Hi 5

15

Gly Gin Gly lie Pro Vai lie Glu Pro Ser val Pro Glu Leu val val 20 25 30

<td> Lys</td><td> Pro</td><td> Gly 35</td><td> Ala</td><td> Thr</td><td> val</td><td> 1 Thr</td><td> case Leu 40 .</td><td colspan="4"> 26143_sequence Arg cys Val Gly</td><td colspan="2"> listing. Asn Gly 45</td><td> txt Ser</td><td> Val</td>

<td> Glu</td><td> Trp 50</td><td> Asp</td><td> Gly</td><td> pro</td><td> Pro</td><td> ser 55</td><td> pro</td><td> His</td><td> Trp</td><td> Thr</td><td> Leu 60</td><td> Tyr</td><td> Ser</td><td> Asp</td><td> Gly</td>

<td> Ser 65</td><td> Ser</td><td> Ser</td><td> lie</td><td> Leu</td><td> ser 70</td><td> Thr</td><td> Asn</td><td> Asn</td><td> Ala</td><td> Thr 75</td><td> Phe</td><td> Gin</td><td> Asn</td><td> Thr</td><td> Gly 80</td>

<td> Thr</td><td> Tyr</td><td> Arg</td><td> cys</td><td> Thr 85</td><td> Glu</td><td> Pro</td><td> Gly</td><td> Asp</td><td> Pro 90</td><td> Leu</td><td> Gly</td><td> Gly</td><td> Ser</td><td> Ala 95</td><td> Ala</td>

<td> lie</td><td> Hi s</td><td> Leu</td><td> Tyr 100</td><td> Val</td><td> Lys</td><td> Asp</td><td> Pro</td><td> Ala 105</td><td> Arg</td><td> Pro</td><td> Trp</td><td> Asn</td><td> Val 110</td><td> Leu</td><td> Ala</td>

<td> Gin</td><td> Glu</td><td> val 115</td><td> val</td><td> val</td><td> phe</td><td> Glu</td><td> Asp 120</td><td> Gin</td><td> Asp</td><td> Al a</td><td> Leu</td><td> Leu 125</td><td> Pro</td><td> cys</td><td> Leu</td>

<td> Leu</td><td> Thr 130</td><td> Asp</td><td> Pro</td><td> val</td><td> Leu</td><td> Glu 135</td><td> Ala</td><td> Gly</td><td> Val</td><td> Ser</td><td> Leu 140</td><td> val</td><td> Arg</td><td> val</td><td> Arg</td>

<td> Gly 145</td><td> Arg</td><td> Pro</td><td> Leu</td><td> Met</td><td> Arg 150</td><td> Hi s</td><td> Thr</td><td> Asn</td><td> Tyr</td><td> Ser 155</td><td> Phe</td><td> Ser</td><td> Pro</td><td> Trp</td><td> His 160</td>

<td> Gly</td><td> Phe</td><td> Thr</td><td> He</td><td> Hi s 165</td><td> Arg</td><td> Ala</td><td> Lys</td><td> phe</td><td> He 170</td><td> Gin</td><td> Ser</td><td> Gin</td><td> Asp</td><td> Tyr 175</td><td> Gin</td>

<td> cys</td><td> Ser</td><td> Ala</td><td> Leu 180</td><td> Met</td><td> Gly</td><td> Gly</td><td> Arg</td><td> Lys 185</td><td> Val</td><td> Met</td><td> Ser</td><td> lie</td><td> Ser 190</td><td> lie</td><td> Arg</td>

<td> Leu</td><td> Lys</td><td> val 195</td><td> Gin</td><td> Lys</td><td> val</td><td> lie</td><td> Pro 200</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Ala</td><td> Leu 205</td><td> Thr</td><td> Leu</td><td> val</td>

<td> Pro</td><td> Ala 210</td><td> Glu</td><td> Leu</td><td> val</td><td> Arg</td><td> lie 215</td><td> Arg</td><td> Gly</td><td> G1 u</td><td> Ala</td><td> Al a 220</td><td> Gin</td><td> lie</td><td> val</td><td> Cys</td>

<td> Ser 225</td><td> Ala</td><td> ser</td><td> Ser</td><td> val</td><td> Asp 230</td><td> val</td><td> Asn</td><td> Phe</td><td> ASp</td><td> Val 235</td><td> Phe</td><td> Leu</td><td> Gin</td><td> Hi s</td><td> Asn 240</td>

<td> Asn</td><td> Thr</td><td> Lys</td><td> Leu</td><td> Ala 245</td><td> lie</td><td> Pro</td><td> Gin</td><td> Gin</td><td> ser 250</td><td> Asp</td><td> Phe</td><td> Hi s</td><td> Asn</td><td> Asn 255</td><td> Arg</td>

<td> Tyr</td><td> Gin</td><td> Lys</td><td> val 260</td><td> Leu</td><td> Thr</td><td> Leu</td><td> Asn</td><td> Leu 265</td><td> Asp</td><td> Gin</td><td> val</td><td> Asp</td><td> Phe 270</td><td> Gin</td><td> His</td>

<td> Ala</td><td> Gly</td><td> Asn 275</td><td> Tyr</td><td> Ser</td><td> cys</td><td> Val</td><td> Ala 280</td><td> Ser</td><td> Asn</td><td> val</td><td> Gin</td><td> Gly 285</td><td> Lys</td><td> Hi s</td><td> Ser</td>

<td> Thr</td><td> ser 290</td><td> Met</td><td> Phe</td><td> Phe</td><td> Arg</td><td> val 295</td><td> Val</td><td> Glu</td><td> Ser</td><td> Ala</td><td> Tyr 300</td><td> Leu</td><td> Asn</td><td> Leu</td><td> Ser</td>

<td> Ser 305</td><td> Glu</td><td> Gin</td><td> Asn</td><td> Leu</td><td> lie 310</td><td> Gin</td><td> Glu</td><td> val</td><td> Thr</td><td> val 315</td><td> Gly</td><td> Glu</td><td> Gly</td><td> Leu</td><td> Asn 320</td>

φ

Case 26143_sequence listing.txt

<td> Leu</td><td> Lys</td><td> Val</td><td> Met</td><td> Val 325</td><td> Glu</td><td> Ala</td><td> Tyr</td><td> Pro</td><td> Gly 330</td><td> Leu</td><td> Gin</td><td> Gly</td><td> Phe</td><td> Asn 335</td><td> Trp</td>

<td> Thr</td><td> Tyr</td><td> Leu</td><td> Gly 340</td><td> Pro</td><td> Phe</td><td> Ser</td><td> Asp</td><td> Hi s 345</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Pro</td><td> Lys 350</td><td> Leu</td><td> Ala</td>

<td> Asn</td><td> Al a</td><td> Thr 355</td><td> Thr</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Tyr 360</td><td> Arg</td><td> His</td><td> Thr</td><td> Phe</td><td> Thr 365</td><td> Leu</td><td> Ser</td><td> Leu</td>

<td> Pro</td><td> Arg 370</td><td> Leu</td><td> Lys</td><td> Pro</td><td> ser</td><td> Glu 375</td><td> Ala</td><td> Gly</td><td> Arg</td><td> Tyr</td><td> ser 380</td><td> phe</td><td> Leu</td><td> Ala</td><td> Arg</td>

<td> Asn 385</td><td> Pro</td><td> Gly</td><td> Gly</td><td> Trp</td><td> Arg 390</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Phe</td><td> G1 u 395</td><td> Leu</td><td> Thr</td><td> Leu</td><td> Arg</td><td> Tyr 400</td>

<td> Pro</td><td> Pro</td><td> Glu</td><td> val</td><td> Ser 405</td><td> val</td><td> lie</td><td> Trp</td><td> Thr</td><td> Phe 410</td><td> lie</td><td> Asn</td><td> Gly</td><td> Ser</td><td> Gly 415</td><td> Thr</td>

<td> Leu</td><td> Leu</td><td> cys</td><td> Ala 420</td><td> Ala</td><td> Ser</td><td> Gly</td><td> Tyr</td><td> Pro 425</td><td> G1 n</td><td> Pro</td><td> Asn</td><td> val</td><td> Thr 430</td><td> Trp</td><td> Leu</td>

<td> Gin</td><td> Cys</td><td> ser 435</td><td> Gly</td><td> Hi s</td><td> Thr</td><td> Asp</td><td> Arg 440</td><td> Cys</td><td> ASp</td><td> Glu</td><td> Al a</td><td> Gin 445</td><td> Val</td><td> Leu</td><td> Gin</td>

<td> val</td><td> Trp 450</td><td> ASP</td><td> ASp</td><td> pro</td><td> Tyr</td><td> pro 455</td><td> Glu</td><td> val</td><td> Leu</td><td> Ser</td><td> G1 ח 460</td><td> Glu</td><td> Pro</td><td> Phe</td><td> Hi s</td>

<td> Lys 465</td><td> val</td><td> Thr</td><td> val</td><td> Gin</td><td> Ser 470</td><td> Leu</td><td> Leu</td><td> Thr</td><td> Val</td><td> G1 u 475</td><td> Thr</td><td> Leu</td><td> Glu</td><td> His</td><td> Asn 480</td>

<td> Gin</td><td> Thr</td><td> Tyr</td><td> Glu</td><td> cys 485</td><td> Arg</td><td> Ala</td><td> His</td><td> Asn</td><td> Ser 490</td><td> val</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Ser 495</td><td> Trp</td>

<td> Ala</td><td> Phe</td><td> lie</td><td> Pro 500</td><td> lie</td><td> Ser</td><td> Ala</td><td> Gly</td><td> Al a 505</td><td> Hi s</td><td> Thr</td><td> Hi s</td><td> Pro</td><td> Pro 510</td><td> Asp</td><td> Glu</td>

<td> Phe</td><td> Leu</td><td> Phe 515</td><td> Thr</td><td> pro</td><td> val</td><td> Val</td><td> val 520</td><td> Ala</td><td> Cys</td><td> Met</td><td> Ser</td><td> lie 525</td><td> Met</td><td> Ala</td><td> Leu</td>

<td> Leu</td><td> Leu 530</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu 535</td><td> Leu</td><td> Leu</td><td> Tyr</td><td> Lys</td><td> Tyr 540</td><td> Lys</td><td> Gin</td><td> Lys</td><td> pro</td>

<td> Lys 545</td><td> Tyr</td><td> Gin</td><td> val</td><td> Arg</td><td> Trp 550</td><td> Lys</td><td> lie</td><td> lie</td><td> Glu</td><td> ser 555</td><td> Tyr</td><td> Glu</td><td> Gly</td><td> Asn</td><td> Ser 560</td>

<td> Tyr</td><td> Thr</td><td> phe</td><td> lie</td><td> Asp 565</td><td> Pro</td><td> Thr</td><td> Gin</td><td> Leu</td><td> Pro 570</td><td> Tyr</td><td> Asn</td><td> Glu</td><td> Lys</td><td> Trp 575</td><td> G1 u</td>

<td> Phe</td><td> Pro</td><td> Arg</td><td> Asn 580</td><td> Asn</td><td> Leu</td><td> Gin</td><td> Phe</td><td> Gly 585</td><td> Lys</td><td> Thr</td><td> Leu</td><td> Gly</td><td> Ala 590</td><td> Gly</td><td> Ala</td>

<img file="IL219595A_D0007.tif" />

<td colspan="3" rowspan="2"> Phe Gly Lys</td><td rowspan="3"> Val</td><td rowspan="3"> val</td><td rowspan="3"> Glu</td><td colspan="10"> Case 26143_sequence list!ng.txt</td>

<td rowspan="2"> Ala</td><td rowspan="2"> Thr 600</td><td rowspan="2"> Ala</td><td rowspan="2"> Phe</td><td rowspan="2"> Gly</td><td rowspan="2"> Leu</td><td rowspan="2"> Gly 605</td><td rowspan="2"> Lys</td><td rowspan="2"> Glu</td><td rowspan="2"> Asp</td>

<td colspan="2"></td><td> 595</td>

<td> Al a</td><td> val</td><td> Leu</td><td> Lys</td><td> val</td><td> Ala</td><td> Val</td><td> Lys</td><td> Met</td><td> Leu</td><td> Lys</td><td> ser</td><td> Thr</td><td> Ala</td><td> Hi s</td><td> Ala</td>

<td></td><td> 610</td><td></td><td></td><td></td><td></td><td> 615</td><td></td><td></td><td></td><td></td><td> 620</td><td></td><td></td><td></td><td></td>

<td> Asp</td><td> Glu</td><td> Lys</td><td> Glu</td><td> Ala</td><td> Leu</td><td> Met</td><td> Ser</td><td> Glu</td><td> Leu</td><td> Lys</td><td> lie</td><td> Met</td><td> Ser</td><td> Hi s</td><td> Leu</td>

<td> 625</td><td></td><td></td><td></td><td></td><td> 630</td><td></td><td></td><td></td><td></td><td> 635</td><td></td><td></td><td></td><td></td><td> 640</td>

<td> Gly</td><td> Gin</td><td> Hi s</td><td> Glu</td><td> Asn</td><td> lie</td><td> val</td><td> Asn</td><td> Leu</td><td> Leu</td><td> Gly</td><td> Ala</td><td> cys</td><td> Thr</td><td> Hi s</td><td> Gly</td>

<td></td><td></td><td></td><td></td><td> 645</td><td></td><td></td><td></td><td></td><td> 650</td><td></td><td></td><td></td><td></td><td> 655</td><td></td>

<td> Gly</td><td> Pro</td><td> Val</td><td> Leu</td><td> val</td><td> lie</td><td> Thr</td><td> Glu</td><td> Tyr</td><td> Cys</td><td> Cys</td><td> Tyr</td><td> Gly</td><td> Asp</td><td> Leu</td><td> Leu</td>

<td></td><td></td><td></td><td> 660</td><td></td><td></td><td></td><td></td><td> 665</td><td></td><td></td><td></td><td></td><td> 670</td><td></td><td></td>

<td> Asn</td><td> Phe</td><td> Leu</td><td> Arg</td><td> Arg</td><td> Lys</td><td> Ala</td><td> Glu</td><td> Ala</td><td> Met</td><td> Leu</td><td> Gly</td><td> Pro</td><td> Ser</td><td> Leu</td><td> ser</td>

<td></td><td></td><td> 675</td><td></td><td></td><td></td><td></td><td> 680</td><td></td><td></td><td></td><td></td><td> 685</td><td></td><td></td><td></td>

<td> Pro</td><td> Gly</td><td> Gin</td><td> Asp</td><td> Pro</td><td> Glu</td><td colspan="2"> Gly Gly</td><td> val</td><td> Asp</td><td> Tyr</td><td> Lys</td><td> Asn</td><td> lie</td><td> Hi s</td><td> Leu</td>

<td></td><td> 690</td><td></td><td></td><td></td><td></td><td> 695</td><td></td><td></td><td></td><td></td><td> 700</td><td></td><td></td><td></td><td></td>

<td> Glu</td><td> Lys</td><td> Lys</td><td> Tyr</td><td> val</td><td> Arg</td><td> Arg</td><td> Asp</td><td> Ser</td><td> Gly</td><td> Phe</td><td> Ser</td><td> Ser</td><td> Gin</td><td> Gly</td><td> val</td>

<td> 705</td><td></td><td></td><td></td><td></td><td> 710</td><td></td><td></td><td></td><td></td><td> 715</td><td></td><td></td><td></td><td></td><td> 720</td>

<td> Asp</td><td> Thr</td><td> Tyr</td><td> Val</td><td> Glu</td><td> Met</td><td> Arg</td><td> Pro</td><td> val</td><td> ser</td><td> Thr</td><td> Ser</td><td> ser</td><td> Asn</td><td> ASp</td><td> Ser</td>

<td></td><td></td><td></td><td></td><td> 725</td><td></td><td></td><td></td><td></td><td> 730</td><td></td><td></td><td></td><td></td><td> 735</td><td></td>

<td> Phe</td><td> ser</td><td> Glu</td><td> Gin</td><td> ASp</td><td> Leu</td><td> Asp</td><td> Lys</td><td> G1U</td><td> Asp</td><td> Gly</td><td> Arg</td><td> Pro</td><td> Leu</td><td> Glu</td><td> Leu</td>

<td></td><td></td><td></td><td> 740</td><td></td><td></td><td></td><td></td><td> 745</td><td></td><td></td><td></td><td></td><td> 750</td><td></td><td></td>

<td> Arg</td><td> Asp</td><td> Leu</td><td> Leu</td><td> Hi s</td><td> Phe</td><td> Ser</td><td> Ser</td><td> Gin</td><td> val</td><td> Ala</td><td> Gin</td><td> Gly</td><td> Met</td><td> Ala</td><td> Phe</td>

<td></td><td></td><td> 755</td><td></td><td></td><td></td><td></td><td> 760</td><td></td><td></td><td></td><td></td><td> 765</td><td></td><td></td><td></td>

<td> Leu</td><td> Al a</td><td> Ser</td><td> Lys</td><td> Asn</td><td> Cys</td><td> lie</td><td> His</td><td> Arg</td><td> Asp</td><td> Val</td><td> Ala</td><td> Ala</td><td> Arg</td><td> Asn</td><td> val</td>

<td></td><td> 770</td><td></td><td></td><td></td><td></td><td> 775</td><td></td><td></td><td></td><td></td><td> 780</td><td></td><td></td><td></td><td></td>

<td> Leu</td><td> Leu</td><td> Thr</td><td> Asn</td><td> Gly</td><td> His</td><td> val</td><td> Ala</td><td> Lys</td><td> lie</td><td> Gly</td><td> Asp</td><td> Phe</td><td> Gly</td><td> Leu</td><td> Ala</td>

<td> 785</td><td></td><td></td><td></td><td></td><td> 790</td><td></td><td></td><td></td><td></td><td> 795</td><td></td><td></td><td></td><td></td><td> 800</td>

<td> Arg</td><td> Asp</td><td> lie</td><td> Met</td><td> Asn</td><td> Asp</td><td> Ser</td><td> Asn</td><td> Tyr</td><td> lie</td><td> val</td><td> Lys</td><td> Gly</td><td> Asn</td><td> Ala</td><td> Arg</td>

<td></td><td></td><td></td><td></td><td> 805</td><td></td><td></td><td></td><td></td><td> 810</td><td></td><td></td><td></td><td></td><td> 815</td><td></td>

<td> Leu</td><td> Pro</td><td> val</td><td> Lys</td><td> Trp</td><td> Met</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Ser</td><td> lie</td><td> Phe</td><td> Asp</td><td> cys</td><td> val</td><td> Tyr</td>

<td></td><td></td><td></td><td> 820</td><td></td><td></td><td></td><td></td><td> 82 5</td><td></td><td></td><td></td><td></td><td> 830</td><td></td><td></td>

<td> Thr</td><td> Val</td><td> Gin</td><td> Ser</td><td> Asp</td><td> val</td><td> Trp</td><td> Ser</td><td> Tyr</td><td> Gly</td><td> lie</td><td> Leu</td><td> Leu</td><td> Trp</td><td> Glu</td><td> 11 e</td>

<td></td><td></td><td> 835</td><td></td><td></td><td></td><td></td><td> 840</td><td></td><td></td><td></td><td></td><td> 845</td><td></td><td></td><td></td>

<td> Phe</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Leu</td><td> Asn</td><td> pro</td><td> Tyr</td><td> Pro</td><td> Gly</td><td> lie</td><td> Leu</td><td> val</td><td> Asn</td><td> Ser</td><td> Lys</td>

<td></td><td> 850</td><td></td><td></td><td></td><td></td><td> 855</td><td></td><td></td><td></td><td></td><td> 860</td><td></td><td></td><td></td><td></td>

<td> Phe</td><td> Tyr</td><td> Lys</td><td> Leu</td><td> Val</td><td> Lys</td><td> ASp</td><td> G1 y</td><td> Tyr</td><td> Gin</td><td> Met</td><td> Ala</td><td> Gin</td><td> Pro</td><td> Ala</td><td> phe</td>

<td> 865</td><td></td><td></td><td></td><td></td><td> 870</td><td></td><td></td><td></td><td></td><td> 875</td><td></td><td></td><td></td><td></td><td> 880</td>

case 26143_sequence listing.txt

<td> Ala</td><td> Pro</td><td> Lys</td><td> Asn</td><td> He 885</td><td> Tyr</td><td> Ser</td><td> lie</td><td> Met</td><td> Gin 890</td><td> Ala</td><td> cys</td><td> T rp</td><td> Ala</td><td> Leu 895</td><td> Glu</td>

<td> Pro</td><td> Thr</td><td> Hi s</td><td> Arg 900</td><td> Pro</td><td> Thr</td><td> Phe</td><td> Gin</td><td> Gin 905</td><td> lie</td><td> cys</td><td> Ser</td><td> Phe</td><td> Leu 910</td><td> Gin</td><td> Glu</td>

<td> Gin</td><td> Ala</td><td> Gin 915</td><td> Glu</td><td> Asp</td><td> Arg</td><td> Arg</td><td> Glu 920</td><td> Arg</td><td> Asp</td><td> Tyr</td><td> Thr</td><td> Asn 925</td><td> Leu</td><td> pro</td><td> Ser</td>

<td> Ser</td><td> Ser 930</td><td> Arg</td><td> ser</td><td> Gly</td><td> Gly</td><td> ser 935</td><td> Gly</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Ser 940</td><td> Glu</td><td> Leu</td><td> Glu</td><td> Glu</td>

<td> Glu 945</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Glu</td><td> Hi s 950</td><td> Leu</td><td> Thr</td><td> cys</td><td> cys</td><td> Glu 955</td><td> Gin</td><td> Gly</td><td> Asp</td><td> lie</td><td> Ala 960</td>

<td> Gl n</td><td> Pro</td><td> Leu</td><td> Leu</td><td> Gin</td><td> Pro</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Gl n</td><td> Phe</td><td> cys</td><td></td><td></td><td></td><td></td>

965 970 <210> 63 <211> 972 <212> PRT <213> Artificial <220>

<223> mutant CSF-1R L301S Y969F <400> 63

Met Gly Pro Gly 1 val Leu Leu Leu 5

Leu Leu val Ala

Thr Ala Trp His 15

Gly Gin Gly lie 20

Pro val lie Glu

Pro Ser Val Pro 25

Glu Leu val val

Lys Pro Gly Ala 35

Thr Val Thr Leu

Arg Cys Val Gly

Asn Gly Ser val 45

Glu Trp Asp Gly 50

Pro Pro Ser Pro 55

His Trp Thr Leu 60

Tyr Ser Asp Gly

Ser ser ser lie 65

Leu Ser Thr Asn 70

Asn Ala Thr Phe 75

Gin Asn Thr Gly 80

Thr Tyr Arg Cys

Thr Glu Pro Gly 85

Asp Pro Leu Gly 90

Gly Ser Ala Ala 95 lie Hi s Leu Tyr val Lys Asp Pro

Ala Arg Pro Trp 105

Asn val Leu Ala

Gin Glu val val val Phe Glu Asp

Gin Asp Ala Leu

Leu Pro Cys Leu 125

Leu Thr Asp Pro val Leu Glu Ala

Gly Val Ser Leu val Arg val Arg φ

Case 26143_sequence list!ng.txt

Gly 145

Arg

Pro

Leu

Met

Arg 150

Hi S

Thr

Asn

Tyr

Ser

5

Phe

Ser

Pro

Trp

Hi s 160

Gly phe

Thr lie

Hi s 165

Arg

Ala

Lys

Phe lie

Gin

Ser

G1 n

Asp

Tyr 175

Gin

Cys

Ser

Al a

Leu 180

Met

Gly

Gly

Arg

Lys 185 val

Met

Ser lie

Ser lie

Arg

Leu

Lys

Val

Gin

Lys val lie

Pro

Gly

Pro

Pro

Ala

Leu

Thr

Leu val

Pro

Al a 210

Glu

Leu val

Arg lie

Arg

Gly

Glu

Al a

Ala

Gin lie val cys

Ser

Al a

Ser

Ser val

Asp 230 val

Asn

Phe

Asp val 235

Phe

Leu

Gin

His

Asn

Asn

Thr

Lys

Leu

Ala lie

Pro

Gin

Gin

Ser

Asp

Phe

His

Asn

Asn

Arg

Tyr

Gin

Lys val 260

Leu

Thr

Leu

Asn

Leu

Asp

Gin val

Asp

Phe

Gin

Hi s

Ala

Gly

Asn

Tyr

Ser cys val

Ala

Ser

Asn val

Gin

Gly 285

Lys

Hi s

Ser

Thr

Ser

Met

Phe

Phe

Arg val 295 val

Glu

Ser

Ala

Tyr 300

Ser

Asn

Leu

Ser

Ser

Glu

Gin

Asn

Leu lie

Gin

Glu

Val

Thr

Val

Gly

Glu

Gly

Leu

Asn 320

Leu

Lys val

Met val 325

Glu

Ala

Tyr pro

Gly 330

Leu

G1 n

Gly

Phe

Asn

Trp

Thr

Tyr

Leu

Gly pro

Phe

Ser

Asp

His

Gin pro

Glu

Pro

Lys 350

Leu

Ala

Asn

Al a

Thr

Thr

Lys

Asp

Thr

Tyr 360

Arg

Hi s

Thr

Phe

Thr

Leu

Ser

Leu

Pro

Arg 370

Leu

Lys

Pro

Ser

Glu

Ala

Gly

Arg

Tyr

Ser

Phe

Leu

Ala

Arg

Asn

Pro

Gly

Gly

Trp

Arg 390

Ala

Leu

Thr

Phe

Glu

Leu

Thr

Leu

Arg

Tyr 400

Pro

Pro

Glu

Val

Ser val lie

Trp

Thr

Phe lie

Asn

Gly

Ser

Gly 415

Thr

<td> Leu</td><td> Leu</td><td> cys</td><td> Ala 420</td><td> Ala</td><td> Ser</td><td> Case Gly Tyr</td><td> 26143_sequence listing.txt Pro Gin Pro Asn Val Thr Trp 425 430</td><td> Leu</td>

<td> Gin</td><td> cys</td><td> Ser 435</td><td> Gly</td><td> Hi s</td><td> Thr</td><td> Asp Arg 440</td><td> Cys Asp Glu Ala Gin val Leu 445</td><td> Gin</td>

<td> Vai</td><td> Trp 450</td><td> Asp</td><td> Asp</td><td> Pro</td><td> Tyr</td><td> Pro Glu 455</td><td> val Leu Ser Gin Glu Pro Phe 460</td><td> Hi s</td>

<td> Lys 465</td><td> Vai</td><td> Thr</td><td> Vai</td><td> Gin</td><td> Ser 470</td><td> Leu Leu</td><td> Thr val Glu Thr Leu Glu His 475</td><td> Asn 480</td>

<td> Gin</td><td> Thr</td><td> Tyr</td><td> Gl u</td><td> cys 485</td><td> Arg</td><td> Ala His</td><td> Asn Ser Val Gly Ser Gly Ser 490 495</td><td> Trp</td>

<td> Ala</td><td> phe</td><td> lie</td><td> Pro 500</td><td> lie</td><td> Ser</td><td> Ala Gly</td><td> Ala His Thr His Pro Pro Asp 505 510</td><td> Gl u</td>

<td> Phe</td><td> Leu</td><td> Phe 515</td><td> Thr</td><td> pro</td><td> val</td><td> Val Val 520</td><td> Ala Cys Met Ser lie Met Ala 525</td><td> Leu</td>

<td> Leu</td><td> Leu 530</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu</td><td> Leu Leu 535</td><td> Leu Tyr Lys Tyr Lys Gin Lys 540</td><td> Pro</td>

<td> Lys 545</td><td> Tyr</td><td> Gin</td><td> val</td><td> Arg</td><td> Trp 550</td><td> Lys lie</td><td> lie Glu Ser Tyr Glu Gly Asn 555</td><td> Ser 560</td>

<td> Tyr</td><td> Thr</td><td> Phe</td><td> lie</td><td> Asp 565</td><td> Pro</td><td> Thr Gin</td><td> Leu Pro Tyr Asn Glu Lys Trp 570 575</td><td> Glu</td>

<td> Phe</td><td> Pro</td><td> Arg</td><td> Asn 580</td><td> Asn</td><td> Leu</td><td> Gin Phe</td><td> Gly Lys Thr Leu Gly Ala Gly 585 590</td><td> Ala</td>

<td> Phe</td><td> Gly</td><td> Lys 595</td><td> Val</td><td> val</td><td> Glu</td><td> Ala Thr 600</td><td> Ala Phe Gly Leu Gly Lys Glu 605</td><td> Asp</td>

<td> Yla</td><td> Vai 610</td><td> Leu</td><td> Lys</td><td> val</td><td> Al a</td><td> Val Lys 615</td><td> Met Leu Lys Ser Thr Ala His 620</td><td> Ala</td>

<td> Asp 625</td><td> Glu</td><td> Lys</td><td> Glu</td><td> Ala</td><td> Leu 630</td><td> Met Ser</td><td> Glu Leu Lys lie Met Ser His 635</td><td> Leu 640</td>

<td> Gly</td><td> Gin</td><td> His</td><td> Glu</td><td> Asn 645</td><td> He</td><td> Val Asn</td><td> Leu Leu Gly Ala Cys Thr His 650 655</td><td> Gly</td>

<td> Gly</td><td> Pro</td><td> val</td><td> Leu 660</td><td> val</td><td> He</td><td> Thr Glu</td><td> Tyr Cys Cys Tyr Gly Asp Leu 665 670</td><td> Leu</td>

<td> Asn</td><td> Phe</td><td> Leu 675</td><td> Arg</td><td> Arg</td><td> Lys</td><td> Ala Glu 680</td><td> Ala Met Leu Gly Pro Ser Leu 685</td><td> Ser</td>

<td> Pro</td><td> Gly 690</td><td> Gin</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Gly Gly 695</td><td> Val Asp Tyr Lys Asn lie His 700</td><td> Leu</td>

Case 26143_sequence listing.txt

<td> Glu 705</td><td> Lys</td><td> Lys</td><td> Tyr</td><td> Val</td><td> Arg 710</td><td> Arg</td><td> Asp</td><td> ser</td><td> Gly</td><td> Phe 715</td><td> Ser</td><td> Ser</td><td> Gin</td><td> Gly</td><td> val 720</td>

<td> Asp</td><td> Thr</td><td> Tyr</td><td> val</td><td> Glu 725</td><td> Met</td><td> Arg</td><td> Pro</td><td> val</td><td> Ser 730</td><td> Thr</td><td> Ser</td><td> Ser</td><td> Asn</td><td> Asp 735</td><td> ser</td>

<td> Phe</td><td> Ser</td><td> Glu</td><td> Gin 740</td><td> Asp</td><td> Leu</td><td> Asp</td><td> Lys</td><td> Glu 745</td><td> Asp</td><td> Gly</td><td> Arg</td><td> Pro</td><td> Leu 750</td><td> Glu</td><td> Leu</td>

<td> Arg</td><td> Asp</td><td> Leu 755</td><td> Leu</td><td> His</td><td> Phe</td><td> Ser</td><td> ser 760</td><td> Gin</td><td> val</td><td> Ala</td><td> G1 n</td><td> Gly 765</td><td> Met</td><td> Ala</td><td> Phe</td>

<td> Leu</td><td> Ala 770</td><td> ser</td><td> Lys</td><td> Asn</td><td> Cys</td><td> lie 775</td><td> Hi s</td><td> Arg</td><td> Asp</td><td> Val</td><td> Al a 780</td><td> Al a</td><td> Arg</td><td> Asn</td><td> val</td>

<td> Leu 785</td><td> Leu</td><td> Thr</td><td> Asn</td><td> Gly</td><td> Hi s 790</td><td> val</td><td> Ala</td><td> Lys</td><td> lie</td><td> Gly 795</td><td> Asp</td><td> Phe</td><td> Gly</td><td> Leu</td><td> Ala 800</td>

<td> Arg</td><td> Asp</td><td> lie</td><td> Met</td><td> Asn 805</td><td> Asp</td><td> Ser</td><td> Asn</td><td> Tyr</td><td> lie 810</td><td> Val</td><td> Lys</td><td> G1 y</td><td> Asn</td><td> Ala 815</td><td> Arg</td>

<td> Leu</td><td> pro</td><td> val</td><td> Lys 820</td><td> Trp</td><td> Met</td><td> Al a</td><td> Pro</td><td> Glu 825</td><td> Ser</td><td> lie</td><td> Phe</td><td> Asp</td><td> cys 830</td><td> val</td><td> Tyr</td>

<td> Thr</td><td> Val</td><td> Gin 835</td><td> Ser</td><td> Asp</td><td> val</td><td> Trp</td><td> Ser 840</td><td> Tyr</td><td> Gly</td><td> lie</td><td> Leu</td><td> Leu 845</td><td> Trp</td><td> Glu</td><td> He</td>

<td> Phe</td><td> Ser 850</td><td> Leu</td><td> Gly</td><td> Leu</td><td> Asn</td><td> Pro 855</td><td> Tyr</td><td> Pro</td><td> Gly</td><td> lie</td><td> Leu 860</td><td> val</td><td> Asn</td><td> Ser</td><td> Lys</td>

<td> Phe 865</td><td> Tyr</td><td> Lys</td><td> Leu</td><td> Val</td><td> Lys 870</td><td> ASp</td><td> Gly</td><td> Tyr</td><td> Gin</td><td> Met 875</td><td> Ala</td><td> Gin</td><td> Pro</td><td> Ala</td><td> Phe 880</td>

<td> Ala</td><td> Pro</td><td> Lys</td><td> Asn</td><td> lie 885</td><td> Tyr</td><td> ser</td><td> lie</td><td> Met</td><td> Gin 890</td><td> Al a</td><td> Cys</td><td> Trp</td><td> Ala</td><td> Leu 895</td><td> Glu</td>

<td> Pro</td><td> Thr</td><td> His</td><td> Arg 900</td><td> Pro</td><td> Thr</td><td> Phe</td><td> Gin</td><td> Gin 905</td><td> lie</td><td> Cys</td><td> Ser</td><td> Phe</td><td> Leu 910</td><td> Gin</td><td> Glu</td>

<td> Gin</td><td> Ala</td><td> Gin 915</td><td> Glu</td><td> Asp</td><td> Arg</td><td> Arg</td><td> Glu 920</td><td> Arg</td><td> Asp</td><td> Tyr</td><td> Thr</td><td> Asn 925</td><td> Leu</td><td> Pro</td><td> Ser</td>

<td> Ser</td><td> Ser 930</td><td> Arg</td><td> Ser</td><td> Gly</td><td> Gly</td><td> ser 935</td><td> Gly</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Ser 940</td><td> Glu</td><td> Leu</td><td> Glu</td><td> Glu</td>

<td> Glu 945</td><td> Ser</td><td> Ser</td><td> ser</td><td> Glu</td><td> Hi s 950</td><td> Leu</td><td> Thr</td><td> cys</td><td> cys</td><td> Glu 955</td><td> Gin</td><td> Gly</td><td> Asp</td><td> lie</td><td> Ala 960</td>

Gin Pro Leu Leu Gin Pro Asn Asn Phe Gin Phe Cys

965 970

<img file="IL219595A_D0008.tif" />

case 26143_sequence listing.txt <210>

<211>

<212>

<213>

493 PRT Artificial <220>

<223>

human CSF-1R

Extracellular Domain <400>

<td> lie Pro 1</td><td> val</td><td> lie</td><td> Glu 5</td><td> Pro</td><td> ser val</td><td> pro Glu 10</td><td> Leu val</td><td> Val</td><td> Lys</td><td> Pro 15</td><td> Gly</td>

<td> Ala Thr</td><td> val</td><td> Thr 20</td><td> Leu</td><td> Arg</td><td> cys Val</td><td> Gly Asn 25</td><td> Gly ser</td><td> val</td><td> Glu 30</td><td> Trp</td><td> Asp</td>

<td> Gly Pro</td><td> Pro 35</td><td> ser</td><td> Pro</td><td> Hi s</td><td> Trp Thr 40</td><td> Leu Tyr</td><td> Ser Asp</td><td> Gly 45</td><td> ser</td><td> Ser</td><td> ser</td>

<td> lie Leu 50</td><td> Ser</td><td> Thr</td><td> Asn</td><td> Asn</td><td> Ala Thr 55</td><td> Phe Gin</td><td> Asn Thr 60</td><td> Gly</td><td> Thr</td><td> Tyr</td><td> Arg</td>

<td> Cys Thr 65</td><td> Glu</td><td> Pro</td><td> Gly</td><td> Asp 70</td><td> pro Leu</td><td> Gly Gly</td><td> Ser Ala 75</td><td> Ala</td><td> lie</td><td> His</td><td> Leu 80</td>

<td> Tyr val</td><td> Lys</td><td> Asp</td><td> Pro 85</td><td> Ala</td><td> Arg Pro</td><td> Trp Asn 90</td><td> Val Leu</td><td> Ala</td><td> Gin</td><td> Glu 95</td><td> val</td>

<td> Vai val</td><td> Phe</td><td> Glu 100</td><td> Asp</td><td> Gin</td><td> Asp Ala</td><td> Leu Leu 105</td><td> pro cys</td><td> Leu</td><td> Leu 110</td><td> Thr</td><td> Asp</td>

<td> Pro val</td><td> Leu 115</td><td> Glu</td><td> Ala</td><td> Gly</td><td> val Ser 120</td><td> Leu val</td><td> Arg Val</td><td> Arg 125</td><td> Gly</td><td> Arg</td><td> Pro</td>

<td> Leu Met 130</td><td> Arg</td><td> His</td><td> Thr</td><td> Asn</td><td> Tyr Ser 135</td><td> Phe Ser</td><td> pro Trp 140</td><td> Hi s</td><td> Gly</td><td> Phe</td><td> Thr</td>

<td> lie His 145</td><td> Arg</td><td> Ala</td><td> Lys</td><td> Phe 150</td><td> lie Gin</td><td> Ser Gin</td><td> Asp Tyr 155</td><td> Gin</td><td> Cys</td><td> Ser</td><td> Ala 160</td>

<td> Leu Met</td><td> Gly</td><td> Gly</td><td> Arg 165</td><td> Lys</td><td> Val Met</td><td> Ser lie 170</td><td> Ser lie</td><td> Arg</td><td> Leu</td><td> Lys 175</td><td> val</td>

<td> Glח Lys</td><td> val</td><td> lie 180</td><td> Pro</td><td> Gly</td><td> pro Pro</td><td> Ala Leu 185</td><td> Thr Leu</td><td> val</td><td> pro 190</td><td> Al a</td><td> Glu</td>

<td> Leu val</td><td> Arg 195</td><td> lie</td><td> Arg</td><td> Gly</td><td> Glu Ala 200</td><td> Ala Gin</td><td> lie val</td><td> Cys 205</td><td> ser</td><td> Ala</td><td> Ser</td>

<td> Ser Val 210</td><td> Asp</td><td> val</td><td> Asn</td><td> Phe</td><td> Asp val 215</td><td> Phe Leu</td><td> Gin His 220</td><td> Asn</td><td> Asn</td><td> Thr</td><td> Lys</td>

Leu

Ala lie

Pro

Gin

Gin 230

Ser

Asp

Phe

Hi s

Asn

Asn

Arg

Tyr

Gin

Lys 240 val

Leu

Thr

Leu

Asn

Leu

Asp

Case 26143_sequence

Gin

Val

Asp 250

Phe

G1 η

&amp;#906; &amp;#1512; sting.txt

Hi s

Ala

Gly 255

Asn

Tyr

Ser

Cys val

Ala

Ser

Asn

Val

Gin

Gly

Lys

His ser

Thr 270

Ser

Met

Phe

Phe

Arg val val

Glu

Ser

Ala

Tyr

Leu

Asn

Leu

Ser

Ser

Glu

G1 n

Asn

Leu 290 lie

Gin

Glu val

Thr val

Gly

Glu

Gly

Leu

Asn

Leu

Lys val

Met

Val

Glu

Ala

Tyr

Pro

Gly

Leu

Gin

Gly

Phe

Asn

Trp

Thr

Tyr

Leu

Gly

Pro

Phe

Ser

Asp 325

His

Gin

Pro

Glu

Pro 330

Lys

Leu

Ala

Asn

Ala

Thr

Thr

Lys

Asp

Thr

Tyr

Arg

His

Thr

Phe

Thr

Leu

Ser

Leu

Pro

Arg

Leu

Lys

Pro

Ser

Glu

Ala

Gly

Arg

Tyr 360 ser

Phe

Leu

Ala

Arg 365

Asn

Pro

Gly

Gly

Trp 370

Arg

Ala

Leu

Thr

Phe

Glu

Leu

Thr

Leu

Arg 380

Tyr

Pro

Pro

Glu val

Ser val lie

Trp

Thr

Phe lie

Asn

Gly

Ser

Gly

Thr

Leu

Leu cys 400

Al a

Ala

Ser

Gly

Tyr 405

Pro

Gin

Pro

Asn

Val

Thr

Trp

Leu

Gin

Cys 415 ser

Gly

His

Thr

Asp 420

Arg

Cys

Asp

Glu

Ala

Gin

Val

Leu

Gin val

Trp

Asp

Asp

Pro

Tyr 435

Pro

Glu val

Leu

Ser

Gin

G1 u

Pro

Phe

His

Lys

Val

Thr val

Gin

Ser

Leu

Leu

Thr val 455

Glu

Thr

Leu

Glu

His 460

Asn

Gin

Thr

Tyr

Glu cys

Arg

Ala

Hi s

Asn

Ser

Val

Gly ser

Gly 475

Ser

Trp

Ala

Phe lie

Pro lie

Ser

Ala

Gly 485

Ala

His

Thr

Hi s

Pro pro

Asp

Glu <210> 65 <211> 388 <212> PRT <213> Artificial <22O>

<img file="IL219595A_D0009.tif" />

case 26143_sequence list!ng.txt <223> human CSF-IR fragment delD4 <400> 65

<td> lie 1</td><td> Pro Val</td><td> lie Glu 5</td><td> Pro Ser</td><td> val</td><td> Pro Glu 10</td><td> Leu</td><td> Val</td><td> val</td><td> Lys</td><td> Pro 15</td><td> Gly</td>

<td> Ala</td><td> Thr val</td><td> Thr Leu 20</td><td> Arg Cys</td><td> Val</td><td> Gly Asn 25</td><td> Gly</td><td> Ser</td><td> val</td><td> Glu 30</td><td> Trp</td><td> Asp</td>

<td> Gly</td><td> Pro Pro 35</td><td> Ser Pro</td><td> His Trp</td><td> Thr 40</td><td> Leu Tyr</td><td> ser</td><td> Asp</td><td> Gly 45</td><td> Ser</td><td> Ser</td><td> ser</td>

<td> lie</td><td> Leu Ser 50</td><td> Thr Asn</td><td> Asn Ala 55</td><td> Thr</td><td> Phe Gin</td><td> Asn</td><td> Thr 60</td><td> Gly</td><td> Thr</td><td> Tyr</td><td> Arg</td>

<td> cys 65</td><td> Thr Glu</td><td> Pro Gly</td><td> Asp Pro 70</td><td> Leu</td><td> Gly Gly</td><td> ser 75</td><td> Al a</td><td> Ala</td><td> lie</td><td> Hi s</td><td> Leu 80</td>

<td> Tyr</td><td> Val Lys</td><td> Asp Pro 85</td><td> Ala Arg</td><td> Pro</td><td> Trp Asn 90</td><td> val</td><td> Leu</td><td> Ala</td><td> Gin</td><td> Glu 95</td><td> val</td>

<td> Va1</td><td> val Phe</td><td> Glu Asp 100</td><td> Gin Asp</td><td> Ala</td><td> Leu Leu 105</td><td> Pro</td><td> Cys</td><td> Leu</td><td> Leu 110</td><td> Thr</td><td> Asp</td>

<td> Pro</td><td> val Leu 115</td><td> Glu Ala</td><td> Gly val</td><td> Ser 120</td><td> Leu val</td><td> Arg</td><td> val</td><td> Arg 125</td><td> Gly</td><td> Arg</td><td> Pro</td>

<td> Leu</td><td> Met Arg 130</td><td> His Thr</td><td> Asn Tyr 135</td><td> Ser</td><td> Phe ser</td><td> Pro</td><td> Trp 140</td><td> His</td><td> Gly</td><td> Phe</td><td> Thr</td>

<td> lie 145</td><td> His Arg</td><td> Ala Lys</td><td> Phe lie 150</td><td> רו G1</td><td> Ser Gin</td><td> Asp 155</td><td> Tyr</td><td> Gin</td><td> cys</td><td> Ser</td><td> Ala 160</td>

<td> Leu</td><td> Met Gly</td><td> Gly Arg 165</td><td> Lys val</td><td> Met</td><td> ser lie 170</td><td> Ser</td><td> lie</td><td> Arg</td><td> Leu</td><td> Lys 175</td><td> val</td>

<td> Gin</td><td> Lys val</td><td> lie Pro 180</td><td> Gly Pro</td><td> Pro</td><td> Ala Leu 185</td><td> Thr</td><td> Leu</td><td> val</td><td> Pro 190</td><td> Ala</td><td> Glu</td>

<td> Leu</td><td> Val Arg 195</td><td> lie Arg</td><td> Gly Glu</td><td> Ala 200</td><td> Ala Gin</td><td> lie</td><td> Val</td><td> Cys 205</td><td> ser</td><td> Ala</td><td> Ser</td>

<td> Ser</td><td> Val Asp 210</td><td> val Asn</td><td> phe Asp 215</td><td> Val</td><td> Phe Leu</td><td> Gin</td><td> Hi s 220</td><td> Asn</td><td> Asn</td><td> Thr</td><td> Lys</td>

<td> Leu 225</td><td> Ala lie</td><td> Pro Gin</td><td> Gin Ser 230</td><td> Asp</td><td> Phe His</td><td> Asn 235</td><td> Asn</td><td> Arg</td><td> Tyr</td><td> Gin</td><td> Lys 240</td>

<td> val</td><td> Leu Thr</td><td> Leu Asn 245</td><td> Leu Asp</td><td> Gin</td><td> val Asp 250</td><td> Phe</td><td> Gin</td><td> Hi s</td><td> Al a</td><td> Gly 255</td><td> Asn</td>

<td> Tyr</td><td> Ser cys</td><td> val Ala 260</td><td> Ser Asn</td><td> Val</td><td> Gin Gly 265</td><td> Lys</td><td> His</td><td> Ser</td><td> Thr 270</td><td> ser</td><td> Met</td>

<img file="IL219595A_D0010.tif" />

Case 26143_sequence listing.txt

Phe Phe Arg Tyr Pro Pro Glu Val ser Val

275 280 lie Trp Thr Phe lie Asn 285

Gly ser Gly Thr Leu Leu Cys Ala

290 295

Ala Ser Gly Tyr Pro Gin Pro Asn 300 val Thr Trp Leu Gin Cys Ser Gly

305 310

His Thr Asp Arg Cys Asp Glu Ala

315 320

Gin Val Leu Gin val Trp Asp Asp

Pro Tyr Pro Glu Val Leu Ser Gin

330 335

Glu Pro Phe His Lys val Thr val 340

Gin ser Leu Leu Thr Val Glu Thr

345 350

Leu Glu His Asn Gin Thr Tyr Glu

355 360 cys Arg Ala His Asn Ser Val Gly

Ser Gly

Ser Trp Ala Phe lie Pro lie Ser Ala Gly Ala His Thr His

375 380

Pro Pro Asp Glu 385 <210> 66 <211> 292 <212> PRT <213> Artificial <22O>

<223> human CSF-1R fragment D1-D3 <400> 66 lie Pro val lie Glu Pro Ser val 1 5

Pro Glu Leu Val val Lys Pro Gly

15

Ala Thr val Thr Leu Arg Cys val 20

Gly Asn Gly Ser val Glu Trp Asp 25 30

Gly Pro Pro Ser Pro His Trp Thr

40

Leu Tyr ser Asp Gly ser ser Ser 45 lie Leu Ser Thr Asn Asn Ala Thr

55

Phe Gin Asn Thr Gly Thr Tyr Arg 60

Cys Thr Glu Pro Gly Asp pro Leu 65 70

Tyr val Lys Asp Pro Ala Arg Pro 85

Trp Asn val Leu Ala Gin Glu Val

95

Val val Phe Glu Asp Gin Asp Ala

Leu Leu Pro cys Leu Leu Thr Asp

105 110

Gly Gly Ser Ala Ala lie His Leu

80

<img file="IL219595A_D0011.tif" />

Case

26143_sequence &amp;#906;&amp;#1493; sting.txt

Pro

Leu

Leu

Gin

Leu

Ser val

Tyr

Phe

Asn

Leu 225 lie

<td> val</td><td> Leu 115</td><td> Glu</td><td> Ala</td><td> Gly</td><td> val</td><td> Ser 120</td><td> Leu</td><td> Val</td><td> Arg</td><td> val</td><td> Arg 125</td><td> Gly</td><td> Arg</td>

<td> Met 130</td><td> Arg</td><td> Hi s</td><td> Thr</td><td> Asn</td><td> Tyr 135</td><td> Ser</td><td> Phe</td><td> Ser</td><td> Pro</td><td> Trp 140</td><td> Hi s</td><td> Gly</td><td> phe</td>

<td> His</td><td> Arg</td><td> Ala</td><td> Lys</td><td> Phe 150</td><td> lie</td><td> Gin</td><td> Ser</td><td> Gin</td><td> Asp 155</td><td> Tyr</td><td> Gin</td><td> Cys</td><td> Ser</td>

<td> Met</td><td> Gly</td><td> Gly</td><td> Arg 165</td><td> Lys</td><td> Val</td><td> Met</td><td> ser</td><td> lie 170</td><td> Ser</td><td> lie</td><td> Arg</td><td> Leu</td><td> Lys 175</td>

<td> Lys</td><td> Val</td><td> He 180</td><td> Pro</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Ala 185</td><td> Leu</td><td> Thr</td><td> Leu</td><td> Val</td><td> Pro 190</td><td> Ala</td>

<td> val</td><td> Arg 195</td><td> lie</td><td> Arg</td><td> Gly</td><td> Glu</td><td> Ala 200</td><td> Ala</td><td> Gin</td><td> lie</td><td> val</td><td> Cys 205</td><td> ser</td><td> Ala</td>

<td> val 210</td><td> ASp</td><td> val</td><td> Asn</td><td> phe</td><td> Asp 215</td><td> val</td><td> Phe</td><td> Leu</td><td> Gin</td><td> His 220</td><td> Asn</td><td> Asn</td><td> Thr</td>

<td> Ala</td><td> lie</td><td> Pro</td><td> Gin</td><td> Gin 230</td><td> Ser</td><td> Asp</td><td> Phe</td><td> His</td><td> Asn 235</td><td> Asn</td><td> Arg</td><td> Tyr</td><td> Gin</td>

<td> Leu</td><td> Thr</td><td> Leu</td><td> Asn 245</td><td> Leu</td><td> Asp</td><td> G1 n</td><td> Val</td><td> Asp 250</td><td> Phe</td><td> G1 n</td><td> Hi s</td><td> Ala</td><td> Gly 255</td>

<td> Ser</td><td> cys</td><td> val 260</td><td> Ala</td><td> ser</td><td> Asn</td><td> Val</td><td> Gin 265</td><td> Gly</td><td> Lys</td><td> His</td><td> ser</td><td> Thr 270</td><td> ser</td>

<td> Phe</td><td> Arg 275</td><td> val</td><td> Val</td><td> G1 u</td><td> Ser</td><td> Ala 280</td><td> Tyr</td><td> Leu</td><td> Asn</td><td> Leu</td><td> Ser 285</td><td> Ser</td><td> G1U</td>

<td> Leu</td><td> lie</td><td> Gin</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

Pro

Thr

Val

Glu ser

Lys

Asn

Met

Gin

Al a 160

Lys 240 <210>

<211>

<212>

<213>

PRT

Arti fici al <220>

<223>

signal peptide <400>

Met Gly 1

Ser

Gly

Pro Gly 5

Val

Leu

Leu

Leu 10

Leu

Leu val

Ala

Thr 15

Ala

Trp His

Gly

Gin 20

Gly <210> 68 <211> 36

Case 26143_sequence listing.txt <212> DNA <213> Artificial <220>

<223> Primer <400> 68 cacctccatg ttcttccggt accccccaga ggtaag 36 <210> 69 <211> 8 <212> PRT <213> Mus musculus <400> 69

Asp Leu Arg Leu Tyr Phe Asp val 1 5 <210> 70 <211> 16 <212> PRT <213> Mus musculus <400> 70 val lie Trp ser Gly Gly Gly Thr Asn Tyr Asn Ser Pro Phe Met Ser

10 15

<td rowspan="2"> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt; &lt;400&gt; Gly Phe 1</td><td colspan="3"> 71 10 PRT Mus musculus 71</td>

<td> ! Ser Leu Thr Ser Tyr 5</td><td> Asp lie</td><td> Ser 10</td>

<td colspan="2"> &lt;210&gt; 72 &lt;211&gt; 8 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 72 Gly Gin Ser Phe Thr Tyr Pro</td><td> Thr</td><td></td>

<td colspan="2"> 1 5 &lt;210&gt; 73 &lt;211&gt; 7 &lt;212&gt; PRT &lt;213&gt; Mus musculus &lt;400&gt; 73 Gly Ser Ser Asn Arg Tyr Thr</td><td></td><td></td>

5 <210> 74 <211> 11 <212> PRT <213> Mus musculus <400> 74

Case 26143&amp;#1524;sequence 11sting.txt

Lys Ala ser Glu Asp val Gly Thr Tyr val Ser 1 5 10 < 210> 75 < 211> 116 < 212> PRT < 213> Mus musculus < 400> 75

Ara val Gin Leu Lys Glu Ser Gly Pro Gly Leu val Ala Pro Ser Gin 15 1015

Ser Leu Ser lie Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Ser Tyr 20 2530

Asp lie ser Trp lie Arg Gin Ser Pro Gly Lys Gly Leu Glu Trp Leu 35 4045

Gly val lie Trp ser Gly Gly Gly Thr Asn Tyr Asn Ser Pro Phe Met 50 5560 ser Arq Leu Arg lie Ser Lys Asp Asp Ser Arg Ser Gin val Phe Leu 65 70 7580

Lys val Asn Arg Leu Gin Thr Asp Asp Thr Ala lie Tyr Tyr cys Val 85 9095

Arq Asp Leu Arq Leu Tyr Phe Asp Val Trp Gly Ala Gly Thr Thr val 100 105110

Thr val ser ser < 210> 76 < 211> 106 < 212> PRT < 213> Mus musculus < 400> 76

Lys lie val Met Thr Gin Ser Pro 1 5

Lys Ser Met Ser Val Ser val Gly

15

Glu Arg val Ser Leu Ser Cys Lys 20

Ala Ser Glu Asp Val Gly Thr Tyr 25 30 val Ser Trp Tyr Gin Gin Lys Pro

40

Glu Gin Ser Pro Lys Leu Leu lie 45

Tyr Gly ser Ser Asn Arg Tyr Thr

55

Gly val Pro Asp Arg Phe Thr Gly 60 ser Gly ser Ala Thr Asp Phe Thr 65 70

Leu Thr tie Ser Ser val Gin Ala

80

<img file="IL219595A_D0012.tif" />

Case 26143_sequence listing.txt

Glu Asp Leu Ala Asp Tyr Ser cys 85

Gly Gin Ser Phe Thr Tyr Pro Thr

95

Phe Gly Thr Gly Thr Lys Leu Glu lie Lys 105 < 210> 77 < 211> 8 < 212> PRT < 213> Mus musculus < 400> 77

Asp Pro Arg Leu Tyr Phe Asp val 1 5 <210> 78 <211> 16 < 212> PRT < 213> Mus musculus < 400> 78 val lie Trp Thr Gly Gly Gly Thr

5

Asn Tyr Asn ser Gly Phe Met Ser

15 <210> 79 <211> 10 < 212> PRT < 213> Mus musculus < 400> 79

Gly Ser ser Leu Asp Ser Phe Asp 1 5 lie Ser <210> 80 < 211> 8 < 212> PRT < 213> Mus musculus < 400> 80

Gly Gin Thr Phe Ser Tyr Pro Thr 1 5 <210> 81 < 211> 7 < 212> PRT < 213> Mus musculus <400> 81

Gly Ala Ser Asn Arg Tyr Thr

5 <210> 82 <211> 11 <212> PRT <213> Mus musculus

Case <400> 82

Lys Ala Ser Glu Asp val val Thr 1 5

26143_sequence listing.txt

Tyr Val Ser <210> 83 < 211> 116 < 212> PRT < 213> Mus musculus <400> 83

Gin val Gin Leu Lys Glu Ser Gly 1 5

Pro Gly Leu Val Ala Pro Ser Lys

15

Ser Leu Ser lie Thr Cys Thr val 20

Ser Gly Ser Ser Leu Asp Ser Phe 25 30

Asp lie Ser Trp lie Arg Gin Pro

40

Pro Gly Lys Gly Leu Glu Trp Leu 45

Gly Val lie Trp Thr Gly Gly Gly

55

Thr Asn Tyr Asn Ser Gly Phe Met 60

Ser Arg Leu Arg lie Ser Lys Asp 65 70

Asn Ser Lys Ser Gin val Phe Leu

80

Lys Met Ser Ser Leu Gin Ser Asp 85

Asp Thr Ala lie Tyr Tyr Cys val

95

Arg Asp Pro Arg Leu Tyr Phe Asp 100 val Trp Gly Ala Gly Thr Thr val

105 110

Thr val Ser ser <210> 84 <211> 106 <212> PRT <213> Mus musculus <400> 84

Asn lie Val Met Thr Gin ser Pro 1 5

Lys Ser Met Ser Met Ser val Gly

15

Glu Arg val Thr Leu Ser Cys Lys 20

Ala Ser Glu Asp Val val Thr Tyr 25 30 val Ser Trp Tyr Gin Gin Lys Pro

40

Tyr Gly Ala Ser Asn Arg Tyr Thr

55

Gly val Pro Asp Arg Phe Thr Gly 60

Glu Gin Ser Pro Lys Leu Leu lie

Leu Thr lie ser Ser lie Gin Ala

80

Ser Gly Ser Ala Thr Asp Phe Thr

70

<img file="IL219595A_D0013.tif" />

Case 26143_sequence listing.txt

<td> Glu</td><td> Asp Leu Ala</td><td> Asp Tyr Tyr cys Gly 85</td><td> Gin Thr Phe Ser Tyr Pro Thr 90 95</td>

<td> Phe</td><td> Gly Thr Gly 100</td><td> Thr Lys Leu Glu lie 105</td><td> Lys</td>